summaryrefslogtreecommitdiff
path: root/spec/ruby/shared/process
diff options
context:
space:
mode:
Diffstat (limited to 'spec/ruby/shared/process')
-rw-r--r--spec/ruby/shared/process/abort.rb12
-rw-r--r--spec/ruby/shared/process/exit.rb22
-rw-r--r--spec/ruby/shared/process/fork.rb43
3 files changed, 40 insertions, 37 deletions
diff --git a/spec/ruby/shared/process/abort.rb b/spec/ruby/shared/process/abort.rb
index 935637e1c2..19f9f1e6a5 100644
--- a/spec/ruby/shared/process/abort.rb
+++ b/spec/ruby/shared/process/abort.rb
@@ -8,29 +8,29 @@ describe :process_abort, shared: true do
end
it "raises a SystemExit exception" do
- -> { @object.abort }.should raise_error(SystemExit)
+ -> { @object.abort }.should.raise(SystemExit)
end
it "sets the exception message to the given message" do
- -> { @object.abort "message" }.should raise_error { |e| e.message.should == "message" }
+ -> { @object.abort "message" }.should.raise { |e| e.message.should == "message" }
end
it "sets the exception status code of 1" do
- -> { @object.abort }.should raise_error { |e| e.status.should == 1 }
+ -> { @object.abort }.should.raise { |e| e.status.should == 1 }
end
it "prints the specified message to STDERR" do
- -> { @object.abort "a message" }.should raise_error(SystemExit)
+ -> { @object.abort "a message" }.should.raise(SystemExit)
$stderr.should =~ /a message/
end
it "coerces the argument with #to_str" do
str = mock('to_str')
str.should_receive(:to_str).any_number_of_times.and_return("message")
- -> { @object.abort str }.should raise_error(SystemExit, "message")
+ -> { @object.abort str }.should.raise(SystemExit, "message")
end
it "raises TypeError when given a non-String object" do
- -> { @object.abort 123 }.should raise_error(TypeError)
+ -> { @object.abort 123 }.should.raise(TypeError)
end
end
diff --git a/spec/ruby/shared/process/exit.rb b/spec/ruby/shared/process/exit.rb
index 1e073614a3..cacf2f8774 100644
--- a/spec/ruby/shared/process/exit.rb
+++ b/spec/ruby/shared/process/exit.rb
@@ -1,13 +1,13 @@
describe :process_exit, shared: true do
it "raises a SystemExit with status 0" do
- -> { @object.exit }.should raise_error(SystemExit) { |e|
+ -> { @object.exit }.should.raise(SystemExit) { |e|
e.status.should == 0
}
end
it "raises a SystemExit with the specified status" do
[-2**16, -2**8, -8, -1, 0, 1 , 8, 2**8, 2**16].each do |value|
- -> { @object.exit(value) }.should raise_error(SystemExit) { |e|
+ -> { @object.exit(value) }.should.raise(SystemExit) { |e|
e.status.should == value
}
end
@@ -15,14 +15,14 @@ describe :process_exit, shared: true do
it "raises a SystemExit with the specified boolean status" do
{ true => 0, false => 1 }.each do |value, status|
- -> { @object.exit(value) }.should raise_error(SystemExit) { |e|
+ -> { @object.exit(value) }.should.raise(SystemExit) { |e|
e.status.should == status
}
end
end
it "raises a SystemExit with message 'exit'" do
- -> { @object.exit }.should raise_error(SystemExit) { |e|
+ -> { @object.exit }.should.raise(SystemExit) { |e|
e.message.should == "exit"
}
end
@@ -30,24 +30,24 @@ describe :process_exit, shared: true do
it "tries to convert the passed argument to an Integer using #to_int" do
obj = mock('5')
obj.should_receive(:to_int).and_return(5)
- -> { @object.exit(obj) }.should raise_error(SystemExit) { |e|
+ -> { @object.exit(obj) }.should.raise(SystemExit) { |e|
e.status.should == 5
}
end
it "converts the passed Float argument to an Integer" do
{ -2.2 => -2, -0.1 => 0, 5.5 => 5, 827.999 => 827 }.each do |value, status|
- -> { @object.exit(value) }.should raise_error(SystemExit) { |e|
+ -> { @object.exit(value) }.should.raise(SystemExit) { |e|
e.status.should == status
}
end
end
it "raises TypeError if can't convert the argument to an Integer" do
- -> { @object.exit(Object.new) }.should raise_error(TypeError)
- -> { @object.exit('0') }.should raise_error(TypeError)
- -> { @object.exit([0]) }.should raise_error(TypeError)
- -> { @object.exit(nil) }.should raise_error(TypeError)
+ -> { @object.exit(Object.new) }.should.raise(TypeError)
+ -> { @object.exit('0') }.should.raise(TypeError)
+ -> { @object.exit([0]) }.should.raise(TypeError)
+ -> { @object.exit(nil) }.should.raise(TypeError)
end
it "raises the SystemExit in the main thread if it reaches the top-level handler of another thread" do
@@ -75,7 +75,7 @@ describe :process_exit, shared: true do
ScratchPad.recorded.should == [:in_thread, :in_main]
# the thread also keeps the exception as its value
- -> { t.value }.should raise_error(SystemExit)
+ -> { t.value }.should.raise(SystemExit)
end
end
diff --git a/spec/ruby/shared/process/fork.rb b/spec/ruby/shared/process/fork.rb
index 11e18d7b1c..6c7ea75980 100644
--- a/spec/ruby/shared/process/fork.rb
+++ b/spec/ruby/shared/process/fork.rb
@@ -1,18 +1,18 @@
describe :process_fork, shared: true do
- platform_is :windows do
+ guard_not -> { Process.respond_to?(:fork) } do
it "returns false from #respond_to?" do
# Workaround for Kernel::Method being public and losing the "non-respond_to? magic"
mod = @object.class.name == "KernelSpecs::Method" ? Object.new : @object
- mod.respond_to?(:fork).should be_false
- mod.respond_to?(:fork, true).should be_false
+ mod.respond_to?(:fork).should == false
+ mod.respond_to?(:fork, true).should == false
end
it "raises a NotImplementedError when called" do
- -> { @object.fork }.should raise_error(NotImplementedError)
+ -> { @object.fork }.should.raise(NotImplementedError)
end
end
- platform_is_not :windows do
+ guard -> { Process.respond_to?(:fork) } do
before :each do
@file = tmp('i_exist')
rm_r @file
@@ -23,31 +23,31 @@ describe :process_fork, shared: true do
end
it "returns status zero" do
- pid = Process.fork { exit! 0 }
+ pid = @object.fork { exit! 0 }
_, result = Process.wait2(pid)
result.exitstatus.should == 0
end
it "returns status zero" do
- pid = Process.fork { exit 0 }
+ pid = @object.fork { exit 0 }
_, result = Process.wait2(pid)
result.exitstatus.should == 0
end
it "returns status zero" do
- pid = Process.fork {}
+ pid = @object.fork {}
_, result = Process.wait2(pid)
result.exitstatus.should == 0
end
it "returns status non-zero" do
- pid = Process.fork { exit! 42 }
+ pid = @object.fork { exit! 42 }
_, result = Process.wait2(pid)
result.exitstatus.should == 42
end
it "returns status non-zero" do
- pid = Process.fork { exit 42 }
+ pid = @object.fork { exit 42 }
_, result = Process.wait2(pid)
result.exitstatus.should == 42
end
@@ -74,16 +74,19 @@ describe :process_fork, shared: true do
it "marks threads from the parent as killed" do
t = Thread.new { sleep }
- pid = @object.fork {
- touch(@file) do |f|
- f.write Thread.current.alive?
- f.write t.alive?
- end
- Process.exit!
- }
- Process.waitpid(pid)
- t.kill
- t.join
+ begin
+ pid = @object.fork {
+ touch(@file) do |f|
+ f.write Thread.current.alive?
+ f.write t.alive?
+ end
+ Process.exit!
+ }
+ Process.waitpid(pid)
+ ensure
+ t.kill
+ t.join
+ end
File.read(@file).should == "truefalse"
end
end
class='graph'>
-rw-r--r--ChangeLog4920
-rw-r--r--GPL39
-rw-r--r--KNOWNBUGS.rb17
-rw-r--r--LEGAL1123
-rw-r--r--Makefile.in381
-rw-r--r--NEWS150
-rw-r--r--NEWS.md820
-rw-r--r--README140
-rw-r--r--README.EXT1467
-rw-r--r--README.EXT.ja1568
-rw-r--r--README.ja185
-rw-r--r--README.ja.md182
-rw-r--r--README.md91
-rw-r--r--ToDo124
-rw-r--r--aclocal.m40
-rw-r--r--addr2line.c3070
-rw-r--r--addr2line.h11
-rw-r--r--array.c8821
-rw-r--r--array.rb69
-rw-r--r--ast.c773
-rw-r--r--ast.rb276
-rwxr-xr-xautogen.sh17
-rwxr-xr-xbasictest/runner.rb33
-rwxr-xr-xbasictest/test.rb2367
-rw-r--r--bcc32/Makefile.sub617
-rw-r--r--bcc32/README.bcc32130
-rwxr-xr-xbcc32/configure.bat163
-rwxr-xr-xbcc32/mkexports.rb26
-rw-r--r--bcc32/setup.mak179
-rw-r--r--benchmark/README.md74
-rw-r--r--benchmark/app_answer.rb (renamed from benchmark/bm_app_answer.rb)0
-rw-r--r--benchmark/app_aobench.rb297
-rw-r--r--benchmark/app_erb.yml23
-rw-r--r--benchmark/app_factorial.rb11
-rw-r--r--benchmark/app_fib.rb (renamed from benchmark/bm_app_fib.rb)0
-rw-r--r--benchmark/app_lc_fizzbuzz.rb52
-rw-r--r--benchmark/app_mandelbrot.rb23
-rw-r--r--benchmark/app_pentomino.rb130
-rw-r--r--benchmark/app_raise.rb8
-rw-r--r--benchmark/app_strconcat.rb5
-rw-r--r--benchmark/app_tak.rb (renamed from benchmark/bm_app_tak.rb)0
-rw-r--r--benchmark/app_tarai.rb (renamed from benchmark/bm_app_tarai.rb)0
-rw-r--r--benchmark/app_uri.rb (renamed from benchmark/bm_app_uri.rb)0
-rw-r--r--benchmark/array_flatten.yml19
-rw-r--r--benchmark/array_intersection.yml14
-rw-r--r--benchmark/array_max_float.yml30
-rw-r--r--benchmark/array_max_int.yml31
-rw-r--r--benchmark/array_max_str.yml30
-rw-r--r--benchmark/array_min.yml31
-rw-r--r--benchmark/array_sample.yml4
-rw-r--r--benchmark/array_sample_100k_10.rb2
-rw-r--r--benchmark/array_sample_100k_11.rb2
-rw-r--r--benchmark/array_sample_100k__100.rb2
-rw-r--r--benchmark/array_sample_100k__1k.rb2
-rw-r--r--benchmark/array_sample_100k__6k.rb2
-rw-r--r--benchmark/array_sample_100k___10k.rb2
-rw-r--r--benchmark/array_sample_100k___50k.rb2
-rw-r--r--benchmark/array_shift.rb14
-rw-r--r--benchmark/array_small_and.rb17
-rw-r--r--benchmark/array_small_diff.rb17
-rw-r--r--benchmark/array_small_or.rb17
-rw-r--r--benchmark/array_sort_block.rb2
-rw-r--r--benchmark/array_sort_float.rb2
-rw-r--r--benchmark/array_sort_int.yml15
-rw-r--r--benchmark/array_values_at_int.rb2
-rw-r--r--benchmark/array_values_at_range.rb2
-rw-r--r--benchmark/attr_accessor.yml29
-rw-r--r--benchmark/bighash.rb1
-rw-r--r--benchmark/bm_app_erb.rb26
-rw-r--r--benchmark/bm_app_factorial.rb11
-rw-r--r--benchmark/bm_app_mandelbrot.rb23
-rw-r--r--benchmark/bm_app_pentomino.rb259
-rw-r--r--benchmark/bm_app_raise.rb8
-rw-r--r--benchmark/bm_app_strconcat.rb5
-rw-r--r--benchmark/bm_io_file_create.rb13
-rw-r--r--benchmark/bm_io_file_read.rb15
-rw-r--r--benchmark/bm_io_file_write.rb14
-rw-r--r--benchmark/bm_loop_whileloop.rb4
-rw-r--r--benchmark/bm_loop_whileloop2.rb4
-rw-r--r--benchmark/bm_so_ackermann.rb19
-rw-r--r--benchmark/bm_so_array.rb23
-rw-r--r--benchmark/bm_so_binary_trees.rb57
-rw-r--r--benchmark/bm_so_concatenate.rb18
-rw-r--r--benchmark/bm_so_count_words.rb19
-rw-r--r--benchmark/bm_so_exception.rb61
-rw-r--r--benchmark/bm_so_fannkuch.rb45
-rw-r--r--benchmark/bm_so_fasta.rb81
-rw-r--r--benchmark/bm_so_k_nucleotide.rb48
-rw-r--r--benchmark/bm_so_lists.rb47
-rw-r--r--benchmark/bm_so_matrix.rb48
-rw-r--r--benchmark/bm_so_meteor_contest.rb564
-rw-r--r--benchmark/bm_so_nbody.rb148
-rw-r--r--benchmark/bm_so_nested_loop.rb24
-rw-r--r--benchmark/bm_so_nsieve_bits.rb42
-rw-r--r--benchmark/bm_so_object.rb56
-rw-r--r--benchmark/bm_so_pidigits.rb92
-rw-r--r--benchmark/bm_so_random.rb20
-rw-r--r--benchmark/bm_so_reverse_complement.rb30
-rw-r--r--benchmark/bm_so_sieve.rb24
-rw-r--r--benchmark/bm_vm1_block.rb10
-rw-r--r--benchmark/bm_vm1_const.rb8
-rw-r--r--benchmark/bm_vm1_ensure.rb11
-rw-r--r--benchmark/bm_vm1_ivar.rb8
-rw-r--r--benchmark/bm_vm1_ivar_set.rb6
-rw-r--r--benchmark/bm_vm1_length.rb9
-rw-r--r--benchmark/bm_vm1_neq.rb8
-rw-r--r--benchmark/bm_vm1_not.rb7
-rw-r--r--benchmark/bm_vm1_rescue.rb7
-rw-r--r--benchmark/bm_vm1_simplereturn.rb9
-rw-r--r--benchmark/bm_vm1_swap.rb8
-rw-r--r--benchmark/bm_vm2_array.rb5
-rw-r--r--benchmark/bm_vm2_case.rb14
-rw-r--r--benchmark/bm_vm2_eval.rb6
-rw-r--r--benchmark/bm_vm2_method.rb9
-rw-r--r--benchmark/bm_vm2_mutex.rb9
-rw-r--r--benchmark/bm_vm2_poly_method.rb20
-rw-r--r--benchmark/bm_vm2_poly_method_ov.rb20
-rw-r--r--benchmark/bm_vm2_proc.rb14
-rw-r--r--benchmark/bm_vm2_regexp.rb6
-rw-r--r--benchmark/bm_vm2_send.rb12
-rw-r--r--benchmark/bm_vm2_super.rb20
-rw-r--r--benchmark/bm_vm2_unif1.rb8
-rw-r--r--benchmark/bm_vm2_zsuper.rb20
-rwxr-xr-xbenchmark/bm_vm3_gc.rb7
-rw-r--r--benchmark/bm_vm3_thread_create_join.rb6
-rw-r--r--benchmark/bm_vm3_thread_mutex.rb18
-rw-r--r--benchmark/bmx_temp.rb9
-rw-r--r--benchmark/buffer_each.yml27
-rw-r--r--benchmark/buffer_get.yml25
-rw-r--r--benchmark/cgi_escape_html.yml31
-rw-r--r--benchmark/complex_float_add.yml7
-rw-r--r--benchmark/complex_float_div.yml7
-rw-r--r--benchmark/complex_float_mul.yml7
-rw-r--r--benchmark/complex_float_new.yml7
-rw-r--r--benchmark/complex_float_power.yml7
-rw-r--r--benchmark/complex_float_sub.yml7
-rw-r--r--benchmark/constant_invalidation.rb22
-rw-r--r--benchmark/dir_empty_p.rb5
-rw-r--r--benchmark/driver.rb251
-rw-r--r--benchmark/enum_lazy_flat_map.yml16
-rw-r--r--benchmark/enum_lazy_grep_v_100.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_20.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_50.rb4
-rw-r--r--benchmark/enum_lazy_uniq_100.rb4
-rw-r--r--benchmark/enum_lazy_uniq_20.rb4
-rw-r--r--benchmark/enum_lazy_uniq_50.rb4
-rw-r--r--benchmark/enum_lazy_zip.yml22
-rw-r--r--benchmark/enum_minmax.yml25
-rw-r--r--benchmark/enum_sort.yml15
-rw-r--r--benchmark/enum_tally.yml4
-rw-r--r--benchmark/erb_escape_html.yml31
-rw-r--r--benchmark/erb_render.yml24
-rw-r--r--benchmark/fiber_chain.yml36
-rw-r--r--benchmark/fiber_locals.yml8
-rw-r--r--benchmark/file_chmod.rb9
-rw-r--r--benchmark/file_rename.rb11
-rw-r--r--benchmark/float_methods.yml14
-rw-r--r--benchmark/float_neg_posi.yml8
-rw-r--r--benchmark/float_to_s.yml7
-rw-r--r--benchmark/gc/aobench.rb1
-rw-r--r--benchmark/gc/binary_trees.rb1
-rw-r--r--benchmark/gc/gcbench.rb57
-rw-r--r--benchmark/gc/hash1.rb11
-rw-r--r--benchmark/gc/hash2.rb7
-rw-r--r--benchmark/gc/null.rb1
-rw-r--r--benchmark/gc/pentomino.rb1
-rw-r--r--benchmark/gc/rdoc.rb13
-rw-r--r--benchmark/gc/redblack.rb366
-rw-r--r--benchmark/gc/ring.rb29
-rw-r--r--benchmark/hash_aref_array.rb5
-rw-r--r--benchmark/hash_aref_dsym.rb4
-rw-r--r--benchmark/hash_aref_dsym_long.rb21
-rw-r--r--benchmark/hash_aref_fix.rb4
-rw-r--r--benchmark/hash_aref_flo.rb4
-rw-r--r--benchmark/hash_aref_miss.rb5
-rw-r--r--benchmark/hash_aref_str.rb4
-rw-r--r--benchmark/hash_aref_sym.rb9
-rw-r--r--benchmark/hash_aref_sym_long.rb13
-rw-r--r--benchmark/hash_defaults.yml6
-rw-r--r--benchmark/hash_dup.yml8
-rw-r--r--benchmark/hash_first.yml11
-rw-r--r--benchmark/hash_flatten.rb9
-rw-r--r--benchmark/hash_ident_flo.rb4
-rw-r--r--benchmark/hash_ident_num.rb4
-rw-r--r--benchmark/hash_ident_obj.rb4
-rw-r--r--benchmark/hash_ident_str.rb4
-rw-r--r--benchmark/hash_ident_sym.rb4
-rw-r--r--benchmark/hash_keys.rb9
-rw-r--r--benchmark/hash_literal_small2.rb3
-rw-r--r--benchmark/hash_literal_small4.rb3
-rw-r--r--benchmark/hash_literal_small8.rb3
-rw-r--r--benchmark/hash_long.rb4
-rw-r--r--benchmark/hash_shift.rb10
-rw-r--r--benchmark/hash_shift_u16.rb10
-rw-r--r--benchmark/hash_shift_u24.rb10
-rw-r--r--benchmark/hash_shift_u32.rb10
-rw-r--r--benchmark/hash_small2.rb1
-rw-r--r--benchmark/hash_small4.rb1
-rw-r--r--benchmark/hash_small8.rb1
-rw-r--r--benchmark/hash_to_proc.rb9
-rw-r--r--benchmark/hash_values.rb9
-rw-r--r--benchmark/int_quo.rb1
-rw-r--r--benchmark/io_copy_stream_write.rb24
-rw-r--r--benchmark/io_copy_stream_write_socket.rb35
-rw-r--r--benchmark/io_file_create.rb13
-rw-r--r--benchmark/io_file_read.rb15
-rw-r--r--benchmark/io_file_write.rb14
-rw-r--r--benchmark/io_nonblock_noex.rb22
-rw-r--r--benchmark/io_nonblock_noex2.rb21
-rw-r--r--benchmark/io_pipe_rw.rb13
-rw-r--r--benchmark/io_select.rb9
-rw-r--r--benchmark/io_select2.rb22
-rw-r--r--benchmark/io_select3.rb21
-rw-r--r--benchmark/io_write.rb22
-rw-r--r--benchmark/irb_color.yml13
-rw-r--r--benchmark/irb_exec.yml10
-rw-r--r--benchmark/iseq_load_from_binary.yml25
-rw-r--r--benchmark/ivar_extend.yml23
-rw-r--r--benchmark/kernel_clone.yml6
-rw-r--r--benchmark/kernel_float.yml5
-rw-r--r--benchmark/kernel_tap.yml6
-rw-r--r--benchmark/kernel_then.yml6
-rw-r--r--benchmark/keyword_arguments.yml13
-rw-r--r--benchmark/lib/benchmark_driver/output/driver.rb36
-rw-r--r--benchmark/lib/benchmark_driver/runner/cstime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/cutime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/mjit.rb34
-rw-r--r--benchmark/lib/benchmark_driver/runner/peak.rb151
-rw-r--r--benchmark/lib/benchmark_driver/runner/ractor.rb122
-rw-r--r--benchmark/lib/benchmark_driver/runner/size.rb25
-rw-r--r--benchmark/lib/benchmark_driver/runner/stime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/total.rb137
-rw-r--r--benchmark/lib/benchmark_driver/runner/utime.rb22
-rw-r--r--benchmark/lib/load.rb18
-rw-r--r--benchmark/loop_for.rb (renamed from benchmark/bm_loop_for.rb)0
-rw-r--r--benchmark/loop_generator.rb (renamed from benchmark/bm_loop_generator.rb)0
-rw-r--r--benchmark/loop_times.rb (renamed from benchmark/bm_loop_times.rb)0
-rw-r--r--benchmark/loop_whileloop.rb4
-rw-r--r--benchmark/loop_whileloop2.rb4
-rw-r--r--benchmark/make_fasta_output.rb19
-rw-r--r--benchmark/marshal_dump_flo.rb2
-rw-r--r--benchmark/marshal_dump_load_geniv.rb10
-rw-r--r--benchmark/marshal_dump_load_integer.yml22
-rw-r--r--benchmark/marshal_dump_load_time.rb1
-rw-r--r--benchmark/masgn.yml53
-rw-r--r--benchmark/match_gt4.rb1
-rw-r--r--benchmark/match_small.rb1
-rw-r--r--benchmark/method_bind_call.yml16
-rw-r--r--benchmark/mjit_exivar.yml18
-rw-r--r--benchmark/mjit_integer.yml32
-rw-r--r--benchmark/mjit_kernel.yml20
-rw-r--r--benchmark/mjit_leave.yml8
-rw-r--r--benchmark/mjit_opt_cc_insns.yml27
-rw-r--r--benchmark/mjit_struct_aref.yml10
-rw-r--r--benchmark/module_eqq.yml27
-rw-r--r--benchmark/nil_p.yml9
-rw-r--r--benchmark/nilclass.yml6
-rw-r--r--benchmark/num_zero_p.yml8
-rw-r--r--benchmark/numeric_methods.yml29
-rw-r--r--benchmark/object_allocate.yml21
-rw-r--r--benchmark/objspace_dump_all.yml13
-rw-r--r--benchmark/other-lang/eval.rb4
-rw-r--r--benchmark/other-lang/fact.py2
-rw-r--r--benchmark/other-lang/fact.rb4
-rw-r--r--benchmark/other-lang/loop.rb4
-rw-r--r--benchmark/pm_array.yml19
-rw-r--r--benchmark/prepare_so_count_words.rb15
-rw-r--r--benchmark/prepare_so_k_nucleotide.rb2
-rw-r--r--benchmark/prepare_so_reverse_complement.rb2
-rw-r--r--benchmark/ractor_const.yml4
-rw-r--r--benchmark/ractor_float_to_s.yml8
-rw-r--r--benchmark/range_last.yml4
-rw-r--r--benchmark/range_min.yml2
-rw-r--r--benchmark/realpath.yml30
-rw-r--r--benchmark/report.rb79
-rw-r--r--benchmark/require.yml32
-rw-r--r--benchmark/require_thread.yml40
-rw-r--r--benchmark/run.rb127
-rw-r--r--benchmark/runc.rb27
-rw-r--r--benchmark/securerandom.rb5
-rw-r--r--benchmark/so_ackermann.rb19
-rw-r--r--benchmark/so_array.rb23
-rw-r--r--benchmark/so_binary_trees.rb62
-rw-r--r--benchmark/so_concatenate.rb18
-rw-r--r--benchmark/so_count_words.yml65
-rw-r--r--benchmark/so_exception.rb61
-rw-r--r--benchmark/so_fannkuch.rb45
-rw-r--r--benchmark/so_fasta.rb81
-rw-r--r--benchmark/so_k_nucleotide.yml155
-rw-r--r--benchmark/so_lists.rb47
-rw-r--r--benchmark/so_mandelbrot.rb (renamed from benchmark/bm_so_mandelbrot.rb)0
-rw-r--r--benchmark/so_matrix.rb48
-rw-r--r--benchmark/so_meteor_contest.rb563
-rw-r--r--benchmark/so_nbody.rb148
-rw-r--r--benchmark/so_nested_loop.rb24
-rw-r--r--benchmark/so_nsieve.rb (renamed from benchmark/bm_so_nsieve.rb)0
-rw-r--r--benchmark/so_nsieve_bits.rb43
-rw-r--r--benchmark/so_object.rb56
-rw-r--r--benchmark/so_partial_sums.rb (renamed from benchmark/bm_so_partial_sums.rb)0
-rw-r--r--benchmark/so_pidigits.rb92
-rw-r--r--benchmark/so_random.rb20
-rw-r--r--benchmark/so_reverse_complement.yml137
-rw-r--r--benchmark/so_sieve.rb24
-rw-r--r--benchmark/so_spectralnorm.rb (renamed from benchmark/bm_so_spectralnorm.rb)0
-rw-r--r--benchmark/string_capitalize.yml10
-rw-r--r--benchmark/string_casecmp.yml26
-rw-r--r--benchmark/string_casecmp_p.yml26
-rw-r--r--benchmark/string_concat.yml45
-rw-r--r--benchmark/string_downcase.yml18
-rw-r--r--benchmark/string_index.rb3
-rw-r--r--benchmark/string_scan_re.rb2
-rw-r--r--benchmark/string_scan_str.rb2
-rw-r--r--benchmark/string_slice.yml11
-rw-r--r--benchmark/string_split.yml22
-rw-r--r--benchmark/string_swapcase.yml18
-rw-r--r--benchmark/string_upcase.yml18
-rw-r--r--benchmark/time_at.yml7
-rw-r--r--benchmark/time_new.yml4
-rw-r--r--benchmark/time_now.yml3
-rw-r--r--benchmark/time_parse.yml10
-rw-r--r--benchmark/time_strptime.yml13
-rw-r--r--benchmark/time_subsec.rb2
-rw-r--r--benchmark/vm_array.yml4
-rw-r--r--benchmark/vm_attr_ivar.yml14
-rw-r--r--benchmark/vm_attr_ivar_set.yml14
-rw-r--r--benchmark/vm_backtrace.rb22
-rw-r--r--benchmark/vm_bigarray.yml105
-rw-r--r--benchmark/vm_bighash.yml4
-rw-r--r--benchmark/vm_block.yml9
-rw-r--r--benchmark/vm_block_handler.yml27
-rw-r--r--benchmark/vm_blockparam.yml7
-rw-r--r--benchmark/vm_blockparam_call.yml8
-rw-r--r--benchmark/vm_blockparam_pass.yml12
-rw-r--r--benchmark/vm_blockparam_yield.yml8
-rw-r--r--benchmark/vm_case.yml13
-rw-r--r--benchmark/vm_case_classes.yml9
-rw-r--r--benchmark/vm_case_lit.yml23
-rw-r--r--benchmark/vm_clearmethodcache.rb8
-rw-r--r--benchmark/vm_const.yml13
-rw-r--r--benchmark/vm_cvar.yml20
-rw-r--r--benchmark/vm_defined_method.yml8
-rw-r--r--benchmark/vm_dstr.yml6
-rw-r--r--benchmark/vm_dstr_ary.rb6
-rw-r--r--benchmark/vm_dstr_bool.rb7
-rw-r--r--benchmark/vm_dstr_class_module.rb10
-rw-r--r--benchmark/vm_dstr_digit.rb7
-rw-r--r--benchmark/vm_dstr_int.rb5
-rw-r--r--benchmark/vm_dstr_nil.rb6
-rw-r--r--benchmark/vm_dstr_obj.rb6
-rw-r--r--benchmark/vm_dstr_obj_def.rb8
-rw-r--r--benchmark/vm_dstr_str.rb6
-rw-r--r--benchmark/vm_dstr_sym.rb6
-rw-r--r--benchmark/vm_ensure.yml14
-rw-r--r--benchmark/vm_eval.yml4
-rw-r--r--benchmark/vm_fiber_allocate.yml8
-rw-r--r--benchmark/vm_fiber_count.yml10
-rw-r--r--benchmark/vm_fiber_reuse.yml14
-rw-r--r--benchmark/vm_fiber_reuse_gc.yml12
-rw-r--r--benchmark/vm_fiber_switch.yml9
-rw-r--r--benchmark/vm_float_simple.yml8
-rw-r--r--benchmark/vm_freezeobj.yml6
-rw-r--r--benchmark/vm_freezestring.yml10
-rw-r--r--benchmark/vm_gc.rb6
-rw-r--r--benchmark/vm_gc_old_full.rb4
-rw-r--r--benchmark/vm_gc_old_immediate.rb4
-rw-r--r--benchmark/vm_gc_old_lazy.rb4
-rw-r--r--benchmark/vm_gc_short_lived.yml9
-rw-r--r--benchmark/vm_gc_short_with_complex_long.yml25
-rw-r--r--benchmark/vm_gc_short_with_long.yml13
-rw-r--r--benchmark/vm_gc_short_with_symbol.yml13
-rw-r--r--benchmark/vm_gc_wb_ary.yml12
-rw-r--r--benchmark/vm_gc_wb_ary_promoted.yml15
-rw-r--r--benchmark/vm_gc_wb_obj.yml15
-rw-r--r--benchmark/vm_gc_wb_obj_promoted.yml17
-rw-r--r--benchmark/vm_iclass_super.yml20
-rw-r--r--benchmark/vm_ivar.yml6
-rw-r--r--benchmark/vm_ivar_embedded_obj_init.yml14
-rw-r--r--benchmark/vm_ivar_extended_obj_init.yml16
-rw-r--r--benchmark/vm_ivar_generic_get.yml17
-rw-r--r--benchmark/vm_ivar_generic_set.yml14
-rw-r--r--benchmark/vm_ivar_get.yml37
-rw-r--r--benchmark/vm_ivar_get_unintialized.yml12
-rw-r--r--benchmark/vm_ivar_lazy_set.yml12
-rw-r--r--benchmark/vm_ivar_of_class.yml12
-rw-r--r--benchmark/vm_ivar_of_class_set.yml11
-rw-r--r--benchmark/vm_ivar_set.yml5
-rw-r--r--benchmark/vm_ivar_set_on_instance.yml35
-rw-r--r--benchmark/vm_ivar_set_subclass.yml20
-rw-r--r--benchmark/vm_length.yml8
-rw-r--r--benchmark/vm_lvar_cond_set.yml8
-rw-r--r--benchmark/vm_lvar_init.yml21
-rw-r--r--benchmark/vm_lvar_set.yml4
-rw-r--r--benchmark/vm_method.yml8
-rw-r--r--benchmark/vm_method_missing.yml11
-rw-r--r--benchmark/vm_method_with_block.yml8
-rw-r--r--benchmark/vm_module_ann_const_set.yml4
-rw-r--r--benchmark/vm_module_const_set.yml8
-rw-r--r--benchmark/vm_mutex.yml8
-rw-r--r--benchmark/vm_neq.yml7
-rw-r--r--benchmark/vm_newlambda.yml4
-rw-r--r--benchmark/vm_not.yml6
-rw-r--r--benchmark/vm_poly_method.yml24
-rw-r--r--benchmark/vm_poly_method_ov.yml24
-rw-r--r--benchmark/vm_poly_same_method.yml25
-rw-r--r--benchmark/vm_poly_singleton.yml18
-rw-r--r--benchmark/vm_proc.yml12
-rw-r--r--benchmark/vm_raise1.yml16
-rw-r--r--benchmark/vm_raise2.yml16
-rw-r--r--benchmark/vm_regexp.yml8
-rw-r--r--benchmark/vm_rescue.yml6
-rw-r--r--benchmark/vm_send.yml14
-rw-r--r--benchmark/vm_send_cfunc.yml3
-rw-r--r--benchmark/vm_simplereturn.yml7
-rw-r--r--benchmark/vm_string_literal.yml4
-rw-r--r--benchmark/vm_struct_big_aref_hi.yml7
-rw-r--r--benchmark/vm_struct_big_aref_lo.yml7
-rw-r--r--benchmark/vm_struct_big_aset.yml11
-rw-r--r--benchmark/vm_struct_big_href_hi.yml7
-rw-r--r--benchmark/vm_struct_big_href_lo.yml7
-rw-r--r--benchmark/vm_struct_big_hset.yml11
-rw-r--r--benchmark/vm_struct_small_aref.yml7
-rw-r--r--benchmark/vm_struct_small_aset.yml11
-rw-r--r--benchmark/vm_struct_small_href.yml7
-rw-r--r--benchmark/vm_struct_small_hset.yml7
-rw-r--r--benchmark/vm_super.yml17
-rw-r--r--benchmark/vm_swap.yml7
-rw-r--r--benchmark/vm_symbol_block_pass.rb13
-rw-r--r--benchmark/vm_thread_alive_check.yml8
-rw-r--r--benchmark/vm_thread_close.rb6
-rw-r--r--benchmark/vm_thread_condvar1.rb28
-rw-r--r--benchmark/vm_thread_condvar2.rb35
-rw-r--r--benchmark/vm_thread_create_join.rb6
-rw-r--r--benchmark/vm_thread_mutex1.rb21
-rw-r--r--benchmark/vm_thread_mutex2.rb21
-rw-r--r--benchmark/vm_thread_mutex3.rb20
-rw-r--r--benchmark/vm_thread_pass.rb15
-rw-r--r--benchmark/vm_thread_pass_flood.rb10
-rw-r--r--benchmark/vm_thread_pipe.rb17
-rw-r--r--benchmark/vm_thread_queue.rb18
-rw-r--r--benchmark/vm_thread_sized_queue.rb20
-rw-r--r--benchmark/vm_thread_sized_queue2.rb23
-rw-r--r--benchmark/vm_thread_sized_queue3.rb22
-rw-r--r--benchmark/vm_thread_sized_queue4.rb26
-rw-r--r--benchmark/vm_thread_sleep.yml4
-rw-r--r--benchmark/vm_unif1.yml7
-rw-r--r--benchmark/vm_yield.yml13
-rw-r--r--benchmark/vm_zsuper.yml18
-rw-r--r--benchmark/wc.input.base25
-rw-r--r--bignum.c8683
-rwxr-xr-xbin/erb155
-rwxr-xr-xbin/gem19
-rwxr-xr-xbin/irb20
-rwxr-xr-xbin/rake31
-rwxr-xr-xbin/rdoc35
-rwxr-xr-xbin/ri5
-rwxr-xr-xbin/testrb15
-rw-r--r--bootstraptest/pending.rb24
-rwxr-xr-xbootstraptest/runner.rb795
-rw-r--r--bootstraptest/test_attr.rb16
-rw-r--r--bootstraptest/test_autoload.rb82
-rw-r--r--bootstraptest/test_block.rb72
-rw-r--r--bootstraptest/test_class.rb10
-rw-r--r--bootstraptest/test_constant_cache.rb187
-rw-r--r--bootstraptest/test_env.rb12
-rw-r--r--bootstraptest/test_eval.rb81
-rw-r--r--bootstraptest/test_exception.rb32
-rw-r--r--bootstraptest/test_fiber.rb39
-rw-r--r--bootstraptest/test_flow.rb78
-rw-r--r--bootstraptest/test_fork.rb42
-rw-r--r--bootstraptest/test_insns.rb440
-rw-r--r--bootstraptest/test_io.rb25
-rw-r--r--bootstraptest/test_jump.rb38
-rw-r--r--bootstraptest/test_literal.rb70
-rw-r--r--bootstraptest/test_literal_suffix.rb54
-rw-r--r--bootstraptest/test_method.rb168
-rw-r--r--bootstraptest/test_objectspace.rb21
-rw-r--r--bootstraptest/test_proc.rb105
-rw-r--r--bootstraptest/test_ractor.rb1628
-rw-r--r--bootstraptest/test_string.rb3
-rw-r--r--bootstraptest/test_syntax.rb26
-rw-r--r--bootstraptest/test_thread.rb176
-rw-r--r--bootstraptest/test_yjit.rb3522
-rw-r--r--bootstraptest/test_yjit_30k_ifelse.rb241023
-rw-r--r--bootstraptest/test_yjit_30k_methods.rb121018
-rw-r--r--bootstraptest/test_yjit_rust_port.rb422
-rw-r--r--builtin.c69
-rw-r--r--builtin.h121
-rw-r--r--ccan/build_assert/build_assert.h40
-rw-r--r--ccan/check_type/check_type.h63
-rw-r--r--ccan/container_of/container_of.h142
-rw-r--r--ccan/licenses/BSD-MIT17
-rw-r--r--ccan/licenses/CC028
-rw-r--r--ccan/list/list.h789
-rw-r--r--ccan/str/str.h17
-rw-r--r--class.c2514
-rw-r--r--common.mk18338
-rw-r--r--compar.c223
-rw-r--r--compile.c16120
-rw-r--r--complex.c2378
-rw-r--r--configure.ac4567
-rw-r--r--configure.in2923
-rw-r--r--constant.h39
-rw-r--r--cont.c3624
-rw-r--r--coroutine/amd64/Context.S46
-rw-r--r--coroutine/amd64/Context.h85
-rw-r--r--coroutine/arm32/Context.S33
-rw-r--r--coroutine/arm32/Context.h59
-rw-r--r--coroutine/arm64/Context.S73
-rw-r--r--coroutine/arm64/Context.h83
-rw-r--r--coroutine/asyncify/Context.c10
-rw-r--r--coroutine/asyncify/Context.h89
-rw-r--r--coroutine/emscripten/Context.c8
-rw-r--r--coroutine/emscripten/Context.h77
-rw-r--r--coroutine/ppc/Context.S90
-rw-r--r--coroutine/ppc/Context.h58
-rw-r--r--coroutine/ppc64/Context.S89
-rw-r--r--coroutine/ppc64/Context.h57
-rw-r--r--coroutine/ppc64le/Context.S75
-rw-r--r--coroutine/ppc64le/Context.h57
-rw-r--r--coroutine/pthread/Context.c272
-rw-r--r--coroutine/pthread/Context.h63
-rw-r--r--coroutine/riscv64/Context.S87
-rw-r--r--coroutine/riscv64/Context.h46
-rw-r--r--coroutine/ucontext/Context.c23
-rw-r--r--coroutine/ucontext/Context.h79
-rw-r--r--coroutine/universal/Context.S16
-rw-r--r--coroutine/universal/Context.h21
-rw-r--r--coroutine/win32/Context.S47
-rw-r--r--coroutine/win32/Context.asm55
-rw-r--r--coroutine/win32/Context.h65
-rw-r--r--coroutine/win64/Context.S77
-rw-r--r--coroutine/win64/Context.asm79
-rw-r--r--coroutine/win64/Context.h75
-rw-r--r--coroutine/x86/Context.S42
-rw-r--r--coroutine/x86/Context.h61
-rw-r--r--coverage/README17
-rw-r--r--cygwin/GNUmakefile.in81
-rw-r--r--darray.h179
-rw-r--r--debug.c605
-rw-r--r--debug.h41
-rw-r--r--debug_counter.c152
-rw-r--r--debug_counter.h434
-rw-r--r--defs/gmake.mk482
-rw-r--r--defs/id.def219
-rw-r--r--defs/keywords8
-rw-r--r--defs/known_errors.def248
-rw-r--r--defs/lex.c.src8
-rw-r--r--defs/opt_insn_unif.def2
-rw-r--r--defs/opt_operand.def51
-rw-r--r--defs/separated_version.mk38
-rw-r--r--defs/universal.mk5
-rw-r--r--dir.c3314
-rw-r--r--dir.rb314
-rw-r--r--dln.c1540
-rw-r--r--dln.h41
-rw-r--r--dln_find.c340
-rw-r--r--dmydln.c3
-rw-r--r--dmyenc.c10
-rw-r--r--dmyencoding.c2
-rw-r--r--dmyversion.c2
-rw-r--r--doc/.document9
-rw-r--r--doc/ChangeLog-0.06_to_0.521147
-rw-r--r--doc/ChangeLog-0.50_to_0.60462
-rw-r--r--doc/ChangeLog-0.60_to_1.13955
-rw-r--r--doc/ChangeLog-1.8.0162
-rw-r--r--doc/ChangeLog-1.9.312219
-rw-r--r--doc/ChangeLog-2.0.024015
-rw-r--r--doc/ChangeLog-2.1.018060
-rw-r--r--doc/ChangeLog-2.2.012157
-rw-r--r--doc/ChangeLog-2.3.012188
-rw-r--r--doc/ChangeLog-2.4.09492
-rw-r--r--doc/ChangeLog-YARV246
-rw-r--r--doc/NEWS-1.8.7648
-rw-r--r--doc/NEWS-1.9.1422
-rw-r--r--doc/NEWS-1.9.2498
-rw-r--r--doc/NEWS/NEWS-1.8.7669
-rw-r--r--doc/NEWS/NEWS-1.9.1429
-rw-r--r--doc/NEWS/NEWS-1.9.2509
-rw-r--r--doc/NEWS/NEWS-1.9.3341
-rw-r--r--doc/NEWS/NEWS-2.0.0529
-rw-r--r--doc/NEWS/NEWS-2.1.0376
-rw-r--r--doc/NEWS/NEWS-2.2.0359
-rw-r--r--doc/NEWS/NEWS-2.3.0384
-rw-r--r--doc/NEWS/NEWS-2.4.0399
-rw-r--r--doc/NEWS/NEWS-2.5.0565
-rw-r--r--doc/NEWS/NEWS-2.6.0662
-rw-r--r--doc/NEWS/NEWS-2.7.0845
-rw-r--r--doc/NEWS/NEWS-3.0.0.md829
-rw-r--r--doc/NEWS/NEWS-3.1.0.md660
-rw-r--r--doc/bsearch.rdoc120
-rw-r--r--doc/bug_triaging.rdoc79
-rw-r--r--doc/case_mapping.rdoc116
-rw-r--r--doc/character_selectors.rdoc97
-rw-r--r--doc/command_injection.rdoc29
-rw-r--r--doc/contributing.md12
-rw-r--r--doc/contributing/building_ruby.md172
-rw-r--r--doc/contributing/documentation_guide.md435
-rw-r--r--doc/contributing/making_changes_to_ruby.md28
-rw-r--r--doc/contributing/making_changes_to_stdlibs.md49
-rw-r--r--doc/contributing/reporting_issues.md91
-rw-r--r--doc/contributing/testing_ruby.md138
-rw-r--r--doc/csv/arguments/io.rdoc5
-rw-r--r--doc/csv/options/common/col_sep.rdoc63
-rw-r--r--doc/csv/options/common/quote_char.rdoc42
-rw-r--r--doc/csv/options/common/row_sep.rdoc100
-rw-r--r--doc/csv/options/generating/force_quotes.rdoc17
-rw-r--r--doc/csv/options/generating/quote_empty.rdoc12
-rw-r--r--doc/csv/options/generating/write_converters.rdoc33
-rw-r--r--doc/csv/options/generating/write_empty_value.rdoc15
-rw-r--r--doc/csv/options/generating/write_headers.rdoc29
-rw-r--r--doc/csv/options/generating/write_nil_value.rdoc14
-rw-r--r--doc/csv/options/parsing/converters.rdoc46
-rw-r--r--doc/csv/options/parsing/empty_value.rdoc13
-rw-r--r--doc/csv/options/parsing/field_size_limit.rdoc39
-rw-r--r--doc/csv/options/parsing/header_converters.rdoc43
-rw-r--r--doc/csv/options/parsing/headers.rdoc63
-rw-r--r--doc/csv/options/parsing/liberal_parsing.rdoc19
-rw-r--r--doc/csv/options/parsing/nil_value.rdoc12
-rw-r--r--doc/csv/options/parsing/return_headers.rdoc22
-rw-r--r--doc/csv/options/parsing/skip_blanks.rdoc31
-rw-r--r--doc/csv/options/parsing/skip_lines.rdoc37
-rw-r--r--doc/csv/options/parsing/strip.rdoc15
-rw-r--r--doc/csv/options/parsing/unconverted_fields.rdoc27
-rw-r--r--doc/csv/recipes/filtering.rdoc156
-rw-r--r--doc/csv/recipes/generating.rdoc244
-rw-r--r--doc/csv/recipes/parsing.rdoc543
-rw-r--r--doc/csv/recipes/recipes.rdoc6
-rw-r--r--doc/date/calendars.rdoc62
-rw-r--r--doc/dig_methods.rdoc82
-rw-r--r--doc/dtrace_probes.rdoc184
-rw-r--r--doc/encodings.rdoc479
-rw-r--r--doc/etc.rd75
-rw-r--r--doc/etc.rd.ja75
-rw-r--r--doc/examples/files.rdoc26
-rw-r--r--doc/extension.ja.rdoc1869
-rw-r--r--doc/extension.rdoc2221
-rw-r--r--doc/fiber.md232
-rw-r--r--doc/format_specifications.rdoc348
-rw-r--r--doc/forwardable.rd83
-rw-r--r--doc/forwardable.rd.ja46
-rw-r--r--doc/globals.rdoc69
-rw-r--r--doc/implicit_conversion.rdoc221
-rw-r--r--doc/irb/irb-tools.rd.ja116
-rw-r--r--doc/irb/irb.rd391
-rw-r--r--doc/irb/irb.rd.ja411
-rw-r--r--doc/keywords.rdoc162
-rw-r--r--doc/maintainers.rdoc424
-rw-r--r--doc/marshal.rdoc313
-rw-r--r--doc/matchdata/begin.rdoc30
-rw-r--r--doc/matchdata/end.rdoc30
-rw-r--r--doc/matchdata/offset.rdoc31
-rw-r--r--doc/math/math.rdoc117
-rw-r--r--doc/memory_view.md167
-rw-r--r--doc/mjit/mjit.md39
-rw-r--r--doc/net-http/examples.rdoc31
-rw-r--r--doc/net-http/included_getters.rdoc3
-rw-r--r--doc/optparse/.document1
-rw-r--r--doc/optparse/argument_converters.rdoc380
-rw-r--r--doc/optparse/creates_option.rdoc7
-rw-r--r--doc/optparse/option_params.rdoc509
-rw-r--r--doc/optparse/ruby/argument_keywords.rb6
-rw-r--r--doc/optparse/ruby/argument_strings.rb6
-rw-r--r--doc/optparse/ruby/argv.rb2
-rw-r--r--doc/optparse/ruby/array.rb6
-rw-r--r--doc/optparse/ruby/basic.rb17
-rw-r--r--doc/optparse/ruby/block.rb9
-rw-r--r--doc/optparse/ruby/collected_options.rb8
-rw-r--r--doc/optparse/ruby/custom_converter.rb9
-rw-r--r--doc/optparse/ruby/date.rb6
-rw-r--r--doc/optparse/ruby/datetime.rb6
-rw-r--r--doc/optparse/ruby/decimal_integer.rb7
-rw-r--r--doc/optparse/ruby/decimal_numeric.rb7
-rw-r--r--doc/optparse/ruby/default_values.rb8
-rw-r--r--doc/optparse/ruby/descriptions.rb15
-rw-r--r--doc/optparse/ruby/explicit_array_values.rb9
-rw-r--r--doc/optparse/ruby/explicit_hash_values.rb9
-rw-r--r--doc/optparse/ruby/false_class.rb6
-rw-r--r--doc/optparse/ruby/float.rb6
-rw-r--r--doc/optparse/ruby/help.rb18
-rw-r--r--doc/optparse/ruby/help_banner.rb7
-rw-r--r--doc/optparse/ruby/help_format.rb25
-rw-r--r--doc/optparse/ruby/help_program_name.rb7
-rw-r--r--doc/optparse/ruby/integer.rb6
-rw-r--r--doc/optparse/ruby/long_names.rb9
-rw-r--r--doc/optparse/ruby/long_optional.rb6
-rw-r--r--doc/optparse/ruby/long_required.rb6
-rw-r--r--doc/optparse/ruby/long_simple.rb9
-rw-r--r--doc/optparse/ruby/long_with_negation.rb6
-rw-r--r--doc/optparse/ruby/match_converter.rb9
-rw-r--r--doc/optparse/ruby/matched_values.rb6
-rw-r--r--doc/optparse/ruby/method.rb11
-rw-r--r--doc/optparse/ruby/missing_options.rb12
-rw-r--r--doc/optparse/ruby/mixed_names.rb12
-rw-r--r--doc/optparse/ruby/name_abbrev.rb9
-rw-r--r--doc/optparse/ruby/no_abbreviation.rb10
-rw-r--r--doc/optparse/ruby/numeric.rb6
-rw-r--r--doc/optparse/ruby/object.rb6
-rw-r--r--doc/optparse/ruby/octal_integer.rb7
-rw-r--r--doc/optparse/ruby/optional_argument.rb9
-rw-r--r--doc/optparse/ruby/parse.rb13
-rw-r--r--doc/optparse/ruby/parse_bang.rb13
-rw-r--r--doc/optparse/ruby/proc.rb13
-rw-r--r--doc/optparse/ruby/regexp.rb6
-rw-r--r--doc/optparse/ruby/required_argument.rb9
-rw-r--r--doc/optparse/ruby/shellwords.rb6
-rw-r--r--doc/optparse/ruby/short_names.rb9
-rw-r--r--doc/optparse/ruby/short_optional.rb6
-rw-r--r--doc/optparse/ruby/short_range.rb6
-rw-r--r--doc/optparse/ruby/short_required.rb6
-rw-r--r--doc/optparse/ruby/short_simple.rb9
-rw-r--r--doc/optparse/ruby/string.rb6
-rw-r--r--doc/optparse/ruby/terminator.rb6
-rw-r--r--doc/optparse/ruby/time.rb6
-rw-r--r--doc/optparse/ruby/true_class.rb6
-rw-r--r--doc/optparse/ruby/uri.rb6
-rw-r--r--doc/optparse/tutorial.rdoc835
-rw-r--r--doc/packed_data.rdoc590
-rw-r--r--doc/pty/README84
-rw-r--r--doc/pty/README.expect22
-rw-r--r--doc/pty/README.expect.ja28
-rw-r--r--doc/pty/README.ja88
-rw-r--r--doc/ractor.md952
-rw-r--r--doc/rake/CHANGES440
-rw-r--r--doc/rake/README196
-rw-r--r--doc/rake/command_line_usage.rdoc102
-rw-r--r--doc/rake/example/Rakefile138
-rw-r--r--doc/rake/example/Rakefile235
-rw-r--r--doc/rake/example/a.c6
-rw-r--r--doc/rake/example/b.c6
-rw-r--r--doc/rake/example/main.c11
-rw-r--r--doc/rake/glossary.rdoc51
-rw-r--r--doc/rake/jamis.rb591
-rw-r--r--doc/rake/proto_rake.rdoc127
-rw-r--r--doc/rake/rakefile.rdoc534
-rw-r--r--doc/rake/rational.rdoc151
-rw-r--r--doc/rake/release_notes/rake-0.8.7.rdoc55
-rw-r--r--doc/rdoc/markup_reference.rb1257
-rw-r--r--doc/re.rdoc582
-rw-r--r--doc/regexp.rdoc801
-rw-r--r--doc/rubygems/ChangeLog5689
-rw-r--r--doc/rubygems/History.txt852
-rw-r--r--doc/rubygems/LICENSE.txt53
-rw-r--r--doc/rubygems/README41
-rw-r--r--doc/security.rdoc139
-rw-r--r--doc/shell.rd347
-rw-r--r--doc/shell.rd.ja335
-rw-r--r--doc/signals.rdoc106
-rw-r--r--doc/standard_library.rdoc118
-rw-r--r--doc/strftime_formatting.rdoc527
-rw-r--r--doc/string/b.rdoc14
-rw-r--r--doc/string/bytes.rdoc6
-rw-r--r--doc/string/bytesize.rdoc11
-rw-r--r--doc/string/center.rdoc16
-rw-r--r--doc/string/chars.rdoc5
-rw-r--r--doc/string/chomp.rdoc29
-rw-r--r--doc/string/chop.rdoc16
-rw-r--r--doc/string/codepoints.rdoc6
-rw-r--r--doc/string/delete_prefix.rdoc8
-rw-r--r--doc/string/delete_suffix.rdoc8
-rw-r--r--doc/string/each_byte.rdoc17
-rw-r--r--doc/string/each_char.rdoc17
-rw-r--r--doc/string/each_codepoint.rdoc18
-rw-r--r--doc/string/each_grapheme_cluster.rdoc12
-rw-r--r--doc/string/each_line.rdoc60
-rw-r--r--doc/string/end_with_p.rdoc11
-rw-r--r--doc/string/force_encoding.rdoc20
-rw-r--r--doc/string/grapheme_clusters.rdoc6
-rw-r--r--doc/string/index.rdoc38
-rw-r--r--doc/string/length.rdoc13
-rw-r--r--doc/string/ljust.rdoc16
-rw-r--r--doc/string/new.rdoc51
-rw-r--r--doc/string/ord.rdoc6
-rw-r--r--doc/string/partition.rdoc24
-rw-r--r--doc/string/rjust.rdoc16
-rw-r--r--doc/string/rpartition.rdoc24
-rw-r--r--doc/string/scrub.rdoc25
-rw-r--r--doc/string/split.rdoc86
-rw-r--r--doc/string/start_with_p.rdoc18
-rw-r--r--doc/string/sum.rdoc11
-rw-r--r--doc/symbol/casecmp.rdoc27
-rw-r--r--doc/symbol/casecmp_p.rdoc26
-rw-r--r--doc/syntax.rdoc39
-rw-r--r--doc/syntax/assignment.rdoc483
-rw-r--r--doc/syntax/calling_methods.rdoc429
-rw-r--r--doc/syntax/comments.rdoc253
-rw-r--r--doc/syntax/control_expressions.rdoc571
-rw-r--r--doc/syntax/exceptions.rdoc102
-rw-r--r--doc/syntax/literals.rdoc534
-rw-r--r--doc/syntax/methods.rdoc652
-rw-r--r--doc/syntax/miscellaneous.rdoc136
-rw-r--r--doc/syntax/modules_and_classes.rdoc376
-rw-r--r--doc/syntax/pattern_matching.rdoc540
-rw-r--r--doc/syntax/precedence.rdoc64
-rw-r--r--doc/syntax/refinements.rdoc284
-rw-r--r--doc/timezones.rdoc108
-rw-r--r--doc/transcode.rdoc52
-rw-r--r--doc/yarvarch.en (renamed from template/yarvarch.en)0
-rw-r--r--doc/yarvarch.ja454
-rw-r--r--doc/yjit/yjit.md417
-rw-r--r--doc/yjit/yjit_hacking.md75
-rw-r--r--enc/Makefile.in28
-rw-r--r--enc/ascii.c17
-rw-r--r--enc/big5.c27
-rw-r--r--enc/cesu_8.c469
-rw-r--r--enc/cp949.c13
-rw-r--r--enc/depend10809
-rw-r--r--enc/ebcdic.h11
-rw-r--r--enc/emacs_mule.c12
-rw-r--r--enc/encdb.c15
-rw-r--r--enc/encinit.c.erb38
-rw-r--r--enc/euc_jp.c337
-rw-r--r--enc/euc_kr.c34
-rw-r--r--enc/euc_tw.c13
-rw-r--r--enc/gb18030.c14
-rw-r--r--enc/gb2312.c4
-rw-r--r--enc/gbk.c11
-rw-r--r--enc/iso_2022_jp.h9
-rw-r--r--enc/iso_8859.h1
-rw-r--r--enc/iso_8859_1.c71
-rw-r--r--enc/iso_8859_10.c66
-rw-r--r--enc/iso_8859_11.c7
-rw-r--r--enc/iso_8859_13.c82
-rw-r--r--enc/iso_8859_14.c75
-rw-r--r--enc/iso_8859_15.c72
-rw-r--r--enc/iso_8859_16.c74
-rw-r--r--enc/iso_8859_2.c69
-rw-r--r--enc/iso_8859_3.c75
-rw-r--r--enc/iso_8859_4.c65
-rw-r--r--enc/iso_8859_5.c41
-rw-r--r--enc/iso_8859_6.c7
-rw-r--r--enc/iso_8859_7.c73
-rw-r--r--enc/iso_8859_8.c7
-rw-r--r--enc/iso_8859_9.c87
-rw-r--r--enc/jis/props.h.blt217
-rw-r--r--enc/jis/props.kwd52
-rw-r--r--enc/jis/props.src52
-rw-r--r--enc/koi8_r.c10
-rw-r--r--enc/koi8_u.c9
-rwxr-xr-xenc/make_encmake.rb113
-rw-r--r--enc/mktable.c1184
-rw-r--r--enc/prelude.rb6
-rw-r--r--enc/shift_jis.c360
-rw-r--r--enc/shift_jis.h546
-rw-r--r--enc/trans/GB/GB12345%UCS.src61
-rw-r--r--enc/trans/GB/GB2312%UCS.src75
-rw-r--r--enc/trans/GB/UCS%GB12345.src61
-rw-r--r--enc/trans/GB/UCS%GB2312.src75
-rw-r--r--enc/trans/JIS/JISX0201-KANA%UCS.src51
-rw-r--r--enc/trans/JIS/JISX0208@1990%UCS.src54
-rw-r--r--enc/trans/JIS/JISX0212%UCS.src64
-rw-r--r--enc/trans/JIS/JISX0213-1%UCS@BMP.src1926
-rw-r--r--enc/trans/JIS/JISX0213-1%UCS@SIP.src60
-rw-r--r--enc/trans/JIS/JISX0213-2%UCS@BMP.src2193
-rw-r--r--enc/trans/JIS/JISX0213-2%UCS@SIP.src311
-rw-r--r--enc/trans/JIS/UCS%JISX0201-KANA.src52
-rw-r--r--enc/trans/JIS/UCS%JISX0208@1990.src53
-rw-r--r--enc/trans/JIS/UCS%JISX0212.src63
-rw-r--r--enc/trans/JIS/UCS@BMP%JISX0213-1.src1922
-rw-r--r--enc/trans/JIS/UCS@BMP%JISX0213-2.src2189
-rw-r--r--enc/trans/JIS/UCS@SIP%JISX0213-1.src56
-rw-r--r--enc/trans/JIS/UCS@SIP%JISX0213-2.src307
-rw-r--r--enc/trans/big5.trans3
-rw-r--r--enc/trans/cesu_8.trans85
-rw-r--r--enc/trans/chinese.trans3
-rw-r--r--enc/trans/ebcdic.trans278
-rw-r--r--enc/trans/emoji.trans3
-rw-r--r--enc/trans/emoji_iso2022_kddi.trans5
-rw-r--r--enc/trans/emoji_sjis_docomo.trans3
-rw-r--r--enc/trans/emoji_sjis_kddi.trans3
-rw-r--r--enc/trans/emoji_sjis_softbank.trans3
-rw-r--r--enc/trans/escape.trans10
-rw-r--r--enc/trans/euckr-tbl.rb2
-rw-r--r--enc/trans/gb18030.trans11
-rw-r--r--enc/trans/gbk.trans3
-rw-r--r--enc/trans/ibm720-tbl.rb122
-rw-r--r--enc/trans/ibm737-tbl.rb130
-rw-r--r--enc/trans/iso-8859-16-tbl.rb98
-rw-r--r--enc/trans/iso2022.trans3
-rw-r--r--enc/trans/japanese.trans3
-rw-r--r--enc/trans/japanese_euc.trans15
-rw-r--r--enc/trans/japanese_sjis.trans3
-rw-r--r--enc/trans/korean.trans3
-rw-r--r--enc/trans/newline.trans30
-rw-r--r--enc/trans/single_byte.trans15
-rw-r--r--enc/trans/transdb.c2
-rw-r--r--enc/trans/utf8_mac-tbl.rb23655
-rw-r--r--enc/trans/utf8_mac.trans160
-rw-r--r--enc/trans/utf_16_32.trans3
-rw-r--r--enc/trans/windows-1255-tbl.rb3
-rw-r--r--enc/unicode.c2431
-rw-r--r--enc/unicode/15.0.0/casefold.h7629
-rw-r--r--enc/unicode/15.0.0/name2ctype.h45690
-rw-r--r--enc/unicode/name2ctype.h23866
-rw-r--r--enc/unicode/name2ctype.h.blt23866
-rw-r--r--enc/unicode/name2ctype.kwd22543
-rw-r--r--enc/unicode/name2ctype.src22543
-rw-r--r--enc/us_ascii.c18
-rw-r--r--enc/utf_16_32.h7
-rw-r--r--enc/utf_16be.c21
-rw-r--r--enc/utf_16le.c24
-rw-r--r--enc/utf_32be.c37
-rw-r--r--enc/utf_32le.c36
-rw-r--r--enc/utf_7.h2
-rw-r--r--enc/utf_8.c68
-rw-r--r--enc/windows_1250.c271
-rw-r--r--enc/windows_1251.c57
-rw-r--r--enc/windows_1252.c260
-rw-r--r--enc/windows_1253.c297
-rw-r--r--enc/windows_1254.c302
-rw-r--r--enc/windows_1257.c304
-rw-r--r--enc/windows_31j.c81
-rw-r--r--enc/x_emoji.h4
-rw-r--r--encindex.h70
-rw-r--r--encoding.c1556
-rw-r--r--enum.c4614
-rw-r--r--enumerator.c4182
-rw-r--r--error.c2922
-rw-r--r--eval.c2138
-rw-r--r--eval_error.c667
-rw-r--r--eval_intern.h344
-rw-r--r--eval_jump.c102
-rw-r--r--ext/-test-/RUBY_ALIGNOF/c.c15
-rw-r--r--ext/-test-/RUBY_ALIGNOF/cpp.cpp9
-rw-r--r--ext/-test-/RUBY_ALIGNOF/depend162
-rw-r--r--ext/-test-/RUBY_ALIGNOF/extconf.rb6
-rw-r--r--ext/-test-/abi/abi.c11
-rw-r--r--ext/-test-/abi/extconf.rb4
-rw-r--r--ext/-test-/add_suffix/bug.c22
-rw-r--r--ext/-test-/add_suffix/depend1
-rw-r--r--ext/-test-/add_suffix/extconf.rb4
-rw-r--r--ext/-test-/arith_seq/beg_len_step/beg_len_step.c19
-rw-r--r--ext/-test-/arith_seq/beg_len_step/depend161
-rw-r--r--ext/-test-/arith_seq/beg_len_step/extconf.rb2
-rw-r--r--ext/-test-/arith_seq/extract/depend161
-rw-r--r--ext/-test-/arith_seq/extract/extconf.rb2
-rw-r--r--ext/-test-/arith_seq/extract/extract.c27
-rw-r--r--ext/-test-/array/concat/depend162
-rw-r--r--ext/-test-/array/concat/extconf.rb2
-rw-r--r--ext/-test-/array/concat/to_ary_concat.c38
-rw-r--r--ext/-test-/array/resize/depend161
-rw-r--r--ext/-test-/array/resize/extconf.rb1
-rw-r--r--ext/-test-/array/resize/resize.c6
-rw-r--r--ext/-test-/auto_ext.rb11
-rw-r--r--ext/-test-/bignum/big2str.c53
-rw-r--r--ext/-test-/bignum/bigzero.c26
-rw-r--r--ext/-test-/bignum/depend1122
-rw-r--r--ext/-test-/bignum/div.c35
-rw-r--r--ext/-test-/bignum/extconf.rb3
-rw-r--r--ext/-test-/bignum/init.c11
-rw-r--r--ext/-test-/bignum/intpack.c87
-rw-r--r--ext/-test-/bignum/mul.c65
-rw-r--r--ext/-test-/bignum/str2big.c38
-rw-r--r--ext/-test-/bug-14834/bug-14384.c39
-rw-r--r--ext/-test-/bug-14834/depend162
-rw-r--r--ext/-test-/bug-14834/extconf.rb2
-rw-r--r--ext/-test-/bug-3571/bug.c6
-rw-r--r--ext/-test-/bug-3571/depend162
-rw-r--r--ext/-test-/bug-3571/extconf.rb3
-rw-r--r--ext/-test-/bug-3662/bug.c16
-rw-r--r--ext/-test-/bug-3662/extconf.rb1
-rw-r--r--ext/-test-/bug-5832/bug.c14
-rw-r--r--ext/-test-/bug-5832/depend162
-rw-r--r--ext/-test-/bug-5832/extconf.rb2
-rw-r--r--ext/-test-/bug_reporter/bug_reporter.c24
-rw-r--r--ext/-test-/bug_reporter/depend162
-rw-r--r--ext/-test-/bug_reporter/extconf.rb2
-rw-r--r--ext/-test-/class/class2name.c14
-rw-r--r--ext/-test-/class/depend321
-rw-r--r--ext/-test-/class/extconf.rb3
-rw-r--r--ext/-test-/class/init.c11
-rw-r--r--ext/-test-/cxxanyargs/cxxanyargs.cpp961
-rw-r--r--ext/-test-/cxxanyargs/depend13
-rw-r--r--ext/-test-/cxxanyargs/extconf.rb46
-rw-r--r--ext/-test-/cxxanyargs/failure.cpp13
-rw-r--r--ext/-test-/cxxanyargs/failurem1.cpp13
-rw-r--r--ext/-test-/debug/depend482
-rw-r--r--ext/-test-/debug/extconf.rb3
-rw-r--r--ext/-test-/debug/init.c11
-rw-r--r--ext/-test-/debug/inspector.c32
-rw-r--r--ext/-test-/debug/profile_frames.c44
-rw-r--r--ext/-test-/dln/empty/depend162
-rw-r--r--ext/-test-/dln/empty/empty.c6
-rw-r--r--ext/-test-/dln/empty/extconf.rb2
-rw-r--r--ext/-test-/econv/append.c15
-rw-r--r--ext/-test-/econv/extconf.rb3
-rw-r--r--ext/-test-/econv/init.c11
-rw-r--r--ext/-test-/enumerator_kw/depend162
-rw-r--r--ext/-test-/enumerator_kw/enumerator_kw.c22
-rw-r--r--ext/-test-/enumerator_kw/extconf.rb1
-rw-r--r--ext/-test-/eval/eval.c13
-rw-r--r--ext/-test-/eval/extconf.rb2
-rw-r--r--ext/-test-/exception/dataerror.c31
-rw-r--r--ext/-test-/exception/depend653
-rw-r--r--ext/-test-/exception/enc_raise.c15
-rw-r--r--ext/-test-/exception/ensured.c39
-rw-r--r--ext/-test-/exception/extconf.rb3
-rw-r--r--ext/-test-/exception/init.c11
-rw-r--r--ext/-test-/fatal/depend162
-rw-r--r--ext/-test-/fatal/extconf.rb2
-rw-r--r--ext/-test-/fatal/rb_fatal.c20
-rw-r--r--ext/-test-/file/depend506
-rw-r--r--ext/-test-/file/extconf.rb18
-rw-r--r--ext/-test-/file/fs.c111
-rw-r--r--ext/-test-/file/init.c11
-rw-r--r--ext/-test-/file/stat.c27
-rw-r--r--ext/-test-/float/depend326
-rw-r--r--ext/-test-/float/extconf.rb3
-rw-r--r--ext/-test-/float/init.c11
-rw-r--r--ext/-test-/float/nextafter.c36
-rw-r--r--ext/-test-/funcall/depend162
-rw-r--r--ext/-test-/funcall/extconf.rb3
-rw-r--r--ext/-test-/funcall/funcall.c72
-rw-r--r--ext/-test-/gvl/call_without_gvl/call_without_gvl.c78
-rw-r--r--ext/-test-/gvl/call_without_gvl/depend162
-rw-r--r--ext/-test-/gvl/call_without_gvl/extconf.rb2
-rw-r--r--ext/-test-/hash/delete.c16
-rw-r--r--ext/-test-/hash/depend322
-rw-r--r--ext/-test-/hash/extconf.rb3
-rw-r--r--ext/-test-/hash/init.c11
-rw-r--r--ext/-test-/integer/core_ext.c36
-rw-r--r--ext/-test-/integer/depend490
-rw-r--r--ext/-test-/integer/extconf.rb3
-rw-r--r--ext/-test-/integer/init.c11
-rw-r--r--ext/-test-/integer/my_integer.c16
-rw-r--r--ext/-test-/iseq_load/depend162
-rw-r--r--ext/-test-/iseq_load/extconf.rb2
-rw-r--r--ext/-test-/iseq_load/iseq_load.c21
-rw-r--r--ext/-test-/iter/break.c25
-rw-r--r--ext/-test-/iter/depend482
-rw-r--r--ext/-test-/iter/extconf.rb3
-rw-r--r--ext/-test-/iter/init.c11
-rw-r--r--ext/-test-/iter/yield.c16
-rw-r--r--ext/-test-/load/dot.dot/depend162
-rw-r--r--ext/-test-/load/dot.dot/dot.dot.c2
-rw-r--r--ext/-test-/load/dot.dot/extconf.rb3
-rw-r--r--ext/-test-/load/protect/depend162
-rw-r--r--ext/-test-/load/protect/extconf.rb1
-rw-r--r--ext/-test-/load/protect/protect.c19
-rw-r--r--ext/-test-/marshal/compat/depend162
-rw-r--r--ext/-test-/marshal/compat/extconf.rb2
-rw-r--r--ext/-test-/marshal/compat/usrcompat.c32
-rw-r--r--ext/-test-/marshal/internal_ivar/depend162
-rw-r--r--ext/-test-/marshal/internal_ivar/extconf.rb2
-rw-r--r--ext/-test-/marshal/internal_ivar/internal_ivar.c45
-rw-r--r--ext/-test-/marshal/usr/depend162
-rw-r--r--ext/-test-/marshal/usr/extconf.rb2
-rw-r--r--ext/-test-/marshal/usr/usrmarshal.c50
-rw-r--r--ext/-test-/memory_status/depend162
-rw-r--r--ext/-test-/memory_status/extconf.rb12
-rw-r--r--ext/-test-/memory_status/memory_status.c80
-rw-r--r--ext/-test-/memory_view/depend163
-rw-r--r--ext/-test-/memory_view/extconf.rb5
-rw-r--r--ext/-test-/memory_view/memory_view.c450
-rw-r--r--ext/-test-/method/arity.c22
-rw-r--r--ext/-test-/method/depend322
-rw-r--r--ext/-test-/method/extconf.rb3
-rw-r--r--ext/-test-/method/init.c11
-rw-r--r--ext/-test-/notimplement/bug.c18
-rw-r--r--ext/-test-/notimplement/depend162
-rw-r--r--ext/-test-/notimplement/extconf.rb2
-rw-r--r--ext/-test-/num2int/depend162
-rw-r--r--ext/-test-/num2int/extconf.rb2
-rw-r--r--ext/-test-/num2int/num2int.c136
-rw-r--r--ext/-test-/path_to_class/depend162
-rw-r--r--ext/-test-/path_to_class/extconf.rb7
-rw-r--r--ext/-test-/path_to_class/path_to_class.c15
-rw-r--r--ext/-test-/popen_deadlock/depend163
-rw-r--r--ext/-test-/popen_deadlock/extconf.rb6
-rw-r--r--ext/-test-/popen_deadlock/infinite_loop_dlsym.c50
-rw-r--r--ext/-test-/postponed_job/depend163
-rw-r--r--ext/-test-/postponed_job/extconf.rb2
-rw-r--r--ext/-test-/postponed_job/postponed_job.c100
-rw-r--r--ext/-test-/printf/depend174
-rw-r--r--ext/-test-/printf/extconf.rb2
-rw-r--r--ext/-test-/printf/printf.c109
-rw-r--r--ext/-test-/proc/depend482
-rw-r--r--ext/-test-/proc/extconf.rb3
-rw-r--r--ext/-test-/proc/init.c11
-rw-r--r--ext/-test-/proc/receiver.c21
-rw-r--r--ext/-test-/proc/super.c27
-rw-r--r--ext/-test-/random/bad_version.c135
-rw-r--r--ext/-test-/random/depend482
-rw-r--r--ext/-test-/random/extconf.rb3
-rw-r--r--ext/-test-/random/init.c11
-rw-r--r--ext/-test-/random/loop.c111
-rw-r--r--ext/-test-/rational/depend179
-rw-r--r--ext/-test-/rational/extconf.rb8
-rw-r--r--ext/-test-/rational/rat.c48
-rw-r--r--ext/-test-/rb_call_super_kw/depend162
-rw-r--r--ext/-test-/rb_call_super_kw/extconf.rb1
-rw-r--r--ext/-test-/rb_call_super_kw/rb_call_super_kw.c15
-rw-r--r--ext/-test-/recursion/depend162
-rw-r--r--ext/-test-/recursion/extconf.rb3
-rw-r--r--ext/-test-/recursion/recursion.c28
-rw-r--r--ext/-test-/regexp/depend323
-rw-r--r--ext/-test-/regexp/extconf.rb3
-rw-r--r--ext/-test-/regexp/init.c11
-rw-r--r--ext/-test-/regexp/parse_depth_limit.c23
-rw-r--r--ext/-test-/scan_args/depend162
-rw-r--r--ext/-test-/scan_args/extconf.rb1
-rw-r--r--ext/-test-/scan_args/scan_args.c305
-rw-r--r--ext/-test-/st/foreach/depend162
-rw-r--r--ext/-test-/st/foreach/extconf.rb2
-rw-r--r--ext/-test-/st/foreach/foreach.c175
-rw-r--r--ext/-test-/st/numhash/depend162
-rw-r--r--ext/-test-/st/numhash/extconf.rb2
-rw-r--r--ext/-test-/st/numhash/numhash.c137
-rw-r--r--ext/-test-/st/update/depend162
-rw-r--r--ext/-test-/st/update/extconf.rb2
-rw-r--r--ext/-test-/st/update/update.c34
-rw-r--r--ext/-test-/string/capacity.c18
-rw-r--r--ext/-test-/string/coderange.c47
-rw-r--r--ext/-test-/string/cstr.c156
-rw-r--r--ext/-test-/string/depend2675
-rw-r--r--ext/-test-/string/ellipsize.c13
-rw-r--r--ext/-test-/string/enc_associate.c22
-rw-r--r--ext/-test-/string/enc_str_buf_cat.c28
-rw-r--r--ext/-test-/string/extconf.rb9
-rw-r--r--ext/-test-/string/fstring.c30
-rw-r--r--ext/-test-/string/init.c10
-rw-r--r--ext/-test-/string/modify.c22
-rw-r--r--ext/-test-/string/new.c21
-rw-r--r--ext/-test-/string/nofree.c13
-rw-r--r--ext/-test-/string/normalize.c17
-rw-r--r--ext/-test-/string/qsort.c61
-rw-r--r--ext/-test-/string/rb_interned_str.c14
-rw-r--r--ext/-test-/string/rb_str_dup.c35
-rw-r--r--ext/-test-/string/set_len.c12
-rw-r--r--ext/-test-/struct/depend642
-rw-r--r--ext/-test-/struct/duplicate.c24
-rw-r--r--ext/-test-/struct/extconf.rb3
-rw-r--r--ext/-test-/struct/init.c11
-rw-r--r--ext/-test-/struct/len.c13
-rw-r--r--ext/-test-/struct/member.c18
-rw-r--r--ext/-test-/symbol/depend322
-rw-r--r--ext/-test-/symbol/extconf.rb4
-rw-r--r--ext/-test-/symbol/init.c39
-rw-r--r--ext/-test-/symbol/type.c78
-rw-r--r--ext/-test-/thread/instrumentation/depend164
-rw-r--r--ext/-test-/thread/instrumentation/extconf.rb2
-rw-r--r--ext/-test-/thread/instrumentation/instrumentation.c141
-rw-r--r--ext/-test-/thread_fd/depend161
-rw-r--r--ext/-test-/thread_fd/extconf.rb2
-rw-r--r--ext/-test-/thread_fd/thread_fd.c30
-rw-r--r--ext/-test-/time/depend487
-rw-r--r--ext/-test-/time/extconf.rb3
-rw-r--r--ext/-test-/time/init.c11
-rw-r--r--ext/-test-/time/leap_second.c15
-rw-r--r--ext/-test-/time/new.c34
-rw-r--r--ext/-test-/tracepoint/depend322
-rw-r--r--ext/-test-/tracepoint/extconf.rb2
-rw-r--r--ext/-test-/tracepoint/gc_hook.c85
-rw-r--r--ext/-test-/tracepoint/tracepoint.c96
-rw-r--r--ext/-test-/typeddata/depend162
-rw-r--r--ext/-test-/typeddata/extconf.rb2
-rw-r--r--ext/-test-/typeddata/typeddata.c44
-rw-r--r--ext/-test-/vm/at_exit.c44
-rw-r--r--ext/-test-/vm/depend162
-rw-r--r--ext/-test-/vm/extconf.rb1
-rw-r--r--ext/-test-/wait/depend174
-rw-r--r--ext/-test-/wait/extconf.rb2
-rw-r--r--ext/-test-/wait/wait.c39
-rw-r--r--ext/-test-/win32/console/attribute.c69
-rw-r--r--ext/-test-/win32/console/depend1
-rw-r--r--ext/-test-/win32/console/extconf.rb5
-rw-r--r--ext/-test-/win32/console/init.c11
-rw-r--r--ext/-test-/win32/dln/depend9
-rw-r--r--ext/-test-/win32/dln/dlntest.c17
-rw-r--r--ext/-test-/win32/dln/extconf.rb33
-rw-r--r--ext/-test-/win32/dln/libdlntest.c4
-rw-r--r--ext/-test-/win32/dln/libdlntest.def2
-rw-r--r--ext/-test-/win32/fd_setsize/depend1
-rw-r--r--ext/-test-/win32/fd_setsize/extconf.rb4
-rw-r--r--ext/-test-/win32/fd_setsize/fd_setsize.c55
-rw-r--r--ext/.document69
-rw-r--r--ext/Setup24
-rw-r--r--ext/Setup.atheos7
-rw-r--r--ext/Setup.emx33
-rw-r--r--ext/Setup.nt8
-rw-r--r--ext/bigdecimal/README60
-rw-r--r--ext/bigdecimal/bigdecimal.c7328
-rw-r--r--ext/bigdecimal/bigdecimal.gemspec38
-rw-r--r--ext/bigdecimal/bigdecimal.h221
-rw-r--r--ext/bigdecimal/bigdecimal_en.html792
-rw-r--r--ext/bigdecimal/bigdecimal_ja.html799
-rw-r--r--ext/bigdecimal/bits.h141
-rw-r--r--ext/bigdecimal/depend331
-rw-r--r--ext/bigdecimal/extconf.rb83
-rw-r--r--ext/bigdecimal/feature.h68
-rw-r--r--ext/bigdecimal/lib/bigdecimal.rb1
-rw-r--r--ext/bigdecimal/lib/bigdecimal/jacobian.rb23
-rw-r--r--ext/bigdecimal/lib/bigdecimal/ludcmp.rb1
-rw-r--r--ext/bigdecimal/lib/bigdecimal/math.rb163
-rw-r--r--ext/bigdecimal/lib/bigdecimal/newton.rb6
-rw-r--r--ext/bigdecimal/lib/bigdecimal/util.rb182
-rw-r--r--ext/bigdecimal/missing.c27
-rw-r--r--ext/bigdecimal/missing.h196
-rw-r--r--ext/bigdecimal/missing/dtoa.c3462
-rw-r--r--ext/bigdecimal/sample/linear.rb27
-rw-r--r--ext/bigdecimal/sample/nlsolve.rb24
-rw-r--r--ext/bigdecimal/sample/pi.rb1
-rw-r--r--ext/bigdecimal/static_assert.h54
-rw-r--r--ext/cgi/escape/depend174
-rw-r--r--ext/cgi/escape/escape.c466
-rw-r--r--ext/cgi/escape/extconf.rb3
-rw-r--r--ext/continuation/continuation.c5
-rw-r--r--ext/continuation/depend161
-rw-r--r--ext/continuation/extconf.rb1
-rw-r--r--ext/coverage/coverage.c591
-rw-r--r--ext/coverage/depend195
-rw-r--r--ext/coverage/extconf.rb2
-rw-r--r--ext/coverage/lib/coverage.rb14
-rw-r--r--ext/curses/curses.c2231
-rw-r--r--ext/curses/depend1
-rw-r--r--ext/curses/extconf.rb36
-rw-r--r--ext/curses/hello.rb30
-rw-r--r--ext/curses/mouse.rb53
-rw-r--r--ext/curses/rain.rb76
-rw-r--r--ext/curses/view.rb91
-rw-r--r--ext/curses/view2.rb149
-rw-r--r--ext/date/date.gemspec34
-rw-r--r--ext/date/date_core.c10088
-rw-r--r--ext/date/date_parse.c3083
-rw-r--r--ext/date/date_strftime.c638
-rw-r--r--ext/date/date_strptime.c700
-rw-r--r--ext/date/date_tmx.h56
-rw-r--r--ext/date/depend688
-rw-r--r--ext/date/extconf.rb12
-rw-r--r--ext/date/lib/date.rb70
-rw-r--r--ext/date/prereq.mk19
-rw-r--r--ext/date/update-abbr52
-rw-r--r--ext/date/zonetab.h1562
-rw-r--r--ext/date/zonetab.list327
-rw-r--r--ext/dbm/dbm.c1025
-rw-r--r--ext/dbm/depend1
-rw-r--r--ext/dbm/extconf.rb57
-rw-r--r--ext/digest/bubblebabble/bubblebabble.c41
-rw-r--r--ext/digest/bubblebabble/depend166
-rw-r--r--ext/digest/bubblebabble/extconf.rb4
-rw-r--r--ext/digest/depend165
-rw-r--r--ext/digest/digest.c244
-rw-r--r--ext/digest/digest.gemspec44
-rw-r--r--ext/digest/digest.h46
-rw-r--r--ext/digest/digest_conf.rb17
-rw-r--r--ext/digest/extconf.rb3
-rw-r--r--ext/digest/lib/digest.rb71
-rw-r--r--ext/digest/lib/digest/hmac.rb281
-rw-r--r--ext/digest/lib/digest/loader.rb3
-rw-r--r--ext/digest/lib/digest/version.rb5
-rw-r--r--ext/digest/md5/depend337
-rw-r--r--ext/digest/md5/extconf.rb16
-rw-r--r--ext/digest/md5/md5.c14
-rw-r--r--ext/digest/md5/md5.h6
-rw-r--r--ext/digest/md5/md5cc.h19
-rw-r--r--ext/digest/md5/md5init.c39
-rw-r--r--ext/digest/md5/md5ossl.c9
-rw-r--r--ext/digest/md5/md5ossl.h13
-rw-r--r--ext/digest/rmd160/depend336
-rw-r--r--ext/digest/rmd160/extconf.rb17
-rw-r--r--ext/digest/rmd160/rmd160.c16
-rw-r--r--ext/digest/rmd160/rmd160.h6
-rw-r--r--ext/digest/rmd160/rmd160init.c39
-rw-r--r--ext/digest/rmd160/rmd160ossl.c8
-rw-r--r--ext/digest/rmd160/rmd160ossl.h19
-rw-r--r--ext/digest/sha1/depend337
-rw-r--r--ext/digest/sha1/extconf.rb15
-rw-r--r--ext/digest/sha1/sha1.c6
-rw-r--r--ext/digest/sha1/sha1.h6
-rw-r--r--ext/digest/sha1/sha1cc.h14
-rw-r--r--ext/digest/sha1/sha1init.c41
-rw-r--r--ext/digest/sha1/sha1ossl.c10
-rw-r--r--ext/digest/sha1/sha1ossl.h20
-rw-r--r--ext/digest/sha2/depend336
-rw-r--r--ext/digest/sha2/extconf.rb21
-rw-r--r--ext/digest/sha2/lib/sha2.rb88
-rw-r--r--ext/digest/sha2/lib/sha2/loader.rb3
-rw-r--r--ext/digest/sha2/sha2.c67
-rw-r--r--ext/digest/sha2/sha2.h30
-rw-r--r--ext/digest/sha2/sha2cc.h31
-rw-r--r--ext/digest/sha2/sha2init.c19
-rw-r--r--ext/digest/sha2/sha2ossl.c11
-rw-r--r--ext/digest/sha2/sha2ossl.h17
-rw-r--r--ext/dl/callback/depend15
-rw-r--r--ext/dl/callback/extconf.rb14
-rw-r--r--ext/dl/callback/mkcallback.rb246
-rw-r--r--ext/dl/cfunc.c632
-rw-r--r--ext/dl/cptr.c650
-rw-r--r--ext/dl/depend7
-rw-r--r--ext/dl/dl.c165
-rw-r--r--ext/dl/dl.h224
-rw-r--r--ext/dl/extconf.rb29
-rw-r--r--ext/dl/handle.c377
-rw-r--r--ext/dl/lib/dl.rb12
-rw-r--r--ext/dl/lib/dl/callback.rb96
-rw-r--r--ext/dl/lib/dl/cparser.rb109
-rw-r--r--ext/dl/lib/dl/func.rb187
-rw-r--r--ext/dl/lib/dl/import.rb238
-rw-r--r--ext/dl/lib/dl/pack.rb128
-rw-r--r--ext/dl/lib/dl/stack.rb116
-rw-r--r--ext/dl/lib/dl/struct.rb212
-rw-r--r--ext/dl/lib/dl/types.rb40
-rw-r--r--ext/dl/lib/dl/value.rb112
-rw-r--r--ext/dl/win32/extconf.rb3
-rw-r--r--ext/dl/win32/lib/Win32API.rb30
-rw-r--r--ext/dl/win32/lib/win32/registry.rb845
-rw-r--r--ext/dl/win32/lib/win32/resolv.rb379
-rw-r--r--ext/dl/win32/lib/win32/sspi.rb330
-rw-r--r--ext/erb/escape/escape.c95
-rw-r--r--ext/erb/escape/extconf.rb7
-rw-r--r--ext/etc/depend182
-rw-r--r--ext/etc/etc.c925
-rw-r--r--ext/etc/etc.gemspec43
-rw-r--r--ext/etc/extconf.rb75
-rw-r--r--ext/etc/mkconstants.rb340
-rwxr-xr-xext/extmk.rb644
-rw-r--r--ext/fcntl/depend163
-rw-r--r--ext/fcntl/extconf.rb1
-rw-r--r--ext/fcntl/fcntl.c221
-rw-r--r--ext/fcntl/fcntl.gemspec21
-rw-r--r--ext/fiber/extconf.rb3
-rw-r--r--ext/fiber/fiber.c8
-rw-r--r--ext/fiddle/closure.c323
-rw-r--r--ext/fiddle/closure.h2
-rw-r--r--ext/fiddle/conversions.c264
-rw-r--r--ext/fiddle/conversions.h26
-rw-r--r--ext/fiddle/depend1396
-rw-r--r--ext/fiddle/extconf.rb245
-rw-r--r--ext/fiddle/fiddle.c677
-rw-r--r--ext/fiddle/fiddle.gemspec59
-rw-r--r--ext/fiddle/fiddle.h198
-rw-r--r--ext/fiddle/function.c467
-rw-r--r--ext/fiddle/function.h2
-rw-r--r--ext/fiddle/handle.c586
-rw-r--r--ext/fiddle/lib/fiddle.rb84
-rw-r--r--ext/fiddle/lib/fiddle/closure.rb57
-rw-r--r--ext/fiddle/lib/fiddle/cparser.rb264
-rw-r--r--ext/fiddle/lib/fiddle/function.rb24
-rw-r--r--ext/fiddle/lib/fiddle/import.rb320
-rw-r--r--ext/fiddle/lib/fiddle/pack.rb137
-rw-r--r--ext/fiddle/lib/fiddle/struct.rb539
-rw-r--r--ext/fiddle/lib/fiddle/types.rb73
-rw-r--r--ext/fiddle/lib/fiddle/value.rb122
-rw-r--r--ext/fiddle/lib/fiddle/version.rb3
-rw-r--r--ext/fiddle/memory_view.c321
-rw-r--r--ext/fiddle/pinned.c123
-rw-r--r--ext/fiddle/pointer.c853
-rw-r--r--ext/fiddle/win32/fficonfig.h29
-rw-r--r--ext/fiddle/win32/libffi-3.2.1-mswin.patch191
-rwxr-xr-xext/fiddle/win32/libffi-config.rb48
-rw-r--r--ext/fiddle/win32/libffi.mk.tmpl96
-rw-r--r--ext/gdbm/README1
-rw-r--r--ext/gdbm/depend1
-rw-r--r--ext/gdbm/extconf.rb7
-rw-r--r--ext/gdbm/gdbm.c1255
-rw-r--r--ext/iconv/charset_alias.rb104
-rw-r--r--ext/iconv/depend2
-rw-r--r--ext/iconv/extconf.rb54
-rw-r--r--ext/iconv/iconv.c1256
-rw-r--r--ext/iconv/mkwrapper.rb53
-rwxr-xr-xext/io/console/buildgem.sh5
-rw-r--r--ext/io/console/console.c1375
-rw-r--r--ext/io/console/depend197
-rw-r--r--ext/io/console/extconf.rb34
-rw-r--r--ext/io/console/io-console.gemspec41
-rw-r--r--ext/io/console/lib/console/size.rb23
-rw-r--r--ext/io/console/win32_vk.chksum1
-rw-r--r--ext/io/console/win32_vk.inc1391
-rw-r--r--ext/io/console/win32_vk.list166
-rw-r--r--ext/io/nonblock/depend175
-rw-r--r--ext/io/nonblock/extconf.rb1
-rw-r--r--ext/io/nonblock/io-nonblock.gemspec25
-rw-r--r--ext/io/nonblock/nonblock.c113
-rw-r--r--ext/io/wait/depend176
-rw-r--r--ext/io/wait/extconf.rb32
-rw-r--r--ext/io/wait/io-wait.gemspec38
-rw-r--r--ext/io/wait/wait.c370
-rw-r--r--ext/json/VERSION1
-rw-r--r--ext/json/depend2
-rw-r--r--ext/json/extconf.rb2
-rw-r--r--ext/json/fbuffer/fbuffer.h187
-rw-r--r--ext/json/generator/depend183
-rw-r--r--ext/json/generator/extconf.rb8
-rw-r--r--ext/json/generator/generator.c660
-rw-r--r--ext/json/generator/generator.h118
-rw-r--r--ext/json/json.gemspec67
-rw-r--r--ext/json/lib/json.rb573
-rw-r--r--ext/json/lib/json/add/bigdecimal.rb29
-rw-r--r--ext/json/lib/json/add/complex.rb28
-rw-r--r--ext/json/lib/json/add/core.rb156
-rw-r--r--ext/json/lib/json/add/date.rb34
-rw-r--r--ext/json/lib/json/add/date_time.rb50
-rw-r--r--ext/json/lib/json/add/exception.rb31
-rw-r--r--ext/json/lib/json/add/ostruct.rb31
-rw-r--r--ext/json/lib/json/add/range.rb29
-rw-r--r--ext/json/lib/json/add/rational.rb27
-rw-r--r--ext/json/lib/json/add/regexp.rb30
-rw-r--r--ext/json/lib/json/add/set.rb29
-rw-r--r--ext/json/lib/json/add/struct.rb30
-rw-r--r--ext/json/lib/json/add/symbol.rb25
-rw-r--r--ext/json/lib/json/add/time.rb38
-rw-r--r--ext/json/lib/json/common.rb589
-rw-r--r--ext/json/lib/json/ext.rb2
-rw-r--r--ext/json/lib/json/generic_object.rb71
-rw-r--r--ext/json/lib/json/version.rb3
-rw-r--r--ext/json/parser/depend181
-rw-r--r--ext/json/parser/extconf.rb31
-rw-r--r--ext/json/parser/parser.c4730
-rw-r--r--ext/json/parser/parser.h59
-rw-r--r--ext/json/parser/parser.rl620
-rw-r--r--ext/json/parser/prereq.mk5
-rw-r--r--ext/mathn/complex/complex.c7
-rw-r--r--ext/mathn/complex/extconf.rb3
-rw-r--r--ext/mathn/rational/extconf.rb3
-rw-r--r--ext/mathn/rational/rational.c7
-rw-r--r--ext/monitor/depend161
-rw-r--r--ext/monitor/extconf.rb2
-rw-r--r--ext/monitor/lib/monitor.rb284
-rw-r--r--ext/monitor/monitor.c225
-rw-r--r--ext/nkf/depend183
-rw-r--r--ext/nkf/extconf.rb1
-rw-r--r--ext/nkf/lib/kconv.rb1
-rw-r--r--ext/nkf/nkf-utf8/config.h2
-rw-r--r--ext/nkf/nkf-utf8/nkf.c816
-rw-r--r--ext/nkf/nkf-utf8/nkf.h29
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.c5888
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.h15
-rw-r--r--ext/nkf/nkf.c121
-rw-r--r--ext/nkf/nkf.gemspec24
-rw-r--r--ext/objspace/depend582
-rw-r--r--ext/objspace/extconf.rb2
-rw-r--r--ext/objspace/lib/objspace.rb142
-rw-r--r--ext/objspace/lib/objspace/trace.rb45
-rw-r--r--ext/objspace/object_tracing.c586
-rw-r--r--ext/objspace/objspace.c1214
-rw-r--r--ext/objspace/objspace.h20
-rw-r--r--ext/objspace/objspace_dump.c833
-rw-r--r--ext/openssl/History.md676
-rw-r--r--ext/openssl/depend6215
-rw-r--r--ext/openssl/extconf.rb251
-rw-r--r--ext/openssl/lib/openssl.rb37
-rw-r--r--ext/openssl/lib/openssl/bn.rb49
-rw-r--r--ext/openssl/lib/openssl/buffering.rb362
-rw-r--r--ext/openssl/lib/openssl/cipher.rb70
-rw-r--r--ext/openssl/lib/openssl/config.rb316
-rw-r--r--ext/openssl/lib/openssl/digest.rb102
-rw-r--r--ext/openssl/lib/openssl/hmac.rb78
-rw-r--r--ext/openssl/lib/openssl/marshal.rb30
-rw-r--r--ext/openssl/lib/openssl/pkcs5.rb22
-rw-r--r--ext/openssl/lib/openssl/pkey.rb471
-rw-r--r--ext/openssl/lib/openssl/ssl-internal.rb177
-rw-r--r--ext/openssl/lib/openssl/ssl.rb548
-rw-r--r--ext/openssl/lib/openssl/version.rb5
-rw-r--r--ext/openssl/lib/openssl/x509-internal.rb152
-rw-r--r--ext/openssl/lib/openssl/x509.rb382
-rw-r--r--ext/openssl/openssl.gemspec21
-rw-r--r--ext/openssl/openssl_missing.c338
-rw-r--r--ext/openssl/openssl_missing.h254
-rw-r--r--ext/openssl/ossl.c995
-rw-r--r--ext/openssl/ossl.h194
-rw-r--r--ext/openssl/ossl_asn1.c1634
-rw-r--r--ext/openssl/ossl_asn1.h15
-rw-r--r--ext/openssl/ossl_bio.c74
-rw-r--r--ext/openssl/ossl_bio.h9
-rw-r--r--ext/openssl/ossl_bn.c982
-rw-r--r--ext/openssl/ossl_bn.h11
-rw-r--r--ext/openssl/ossl_cipher.c756
-rw-r--r--ext/openssl/ossl_cipher.h6
-rw-r--r--ext/openssl/ossl_config.c462
-rw-r--r--ext/openssl/ossl_config.h16
-rw-r--r--ext/openssl/ossl_digest.c262
-rw-r--r--ext/openssl/ossl_digest.h6
-rw-r--r--ext/openssl/ossl_engine.c383
-rw-r--r--ext/openssl/ossl_engine.h3
-rw-r--r--ext/openssl/ossl_hmac.c292
-rw-r--r--ext/openssl/ossl_hmac.h3
-rw-r--r--ext/openssl/ossl_kdf.c311
-rw-r--r--ext/openssl/ossl_kdf.h6
-rw-r--r--ext/openssl/ossl_ns_spki.c218
-rw-r--r--ext/openssl/ossl_ns_spki.h4
-rw-r--r--ext/openssl/ossl_ocsp.c1587
-rw-r--r--ext/openssl/ossl_ocsp.h11
-rw-r--r--ext/openssl/ossl_pkcs12.c159
-rw-r--r--ext/openssl/ossl_pkcs12.h4
-rw-r--r--ext/openssl/ossl_pkcs5.c101
-rw-r--r--ext/openssl/ossl_pkcs5.h6
-rw-r--r--ext/openssl/ossl_pkcs7.c296
-rw-r--r--ext/openssl/ossl_pkcs7.h20
-rw-r--r--ext/openssl/ossl_pkey.c1584
-rw-r--r--ext/openssl/ossl_pkey.h183
-rw-r--r--ext/openssl/ossl_pkey_dh.c604
-rw-r--r--ext/openssl/ossl_pkey_dsa.c526
-rw-r--r--ext/openssl/ossl_pkey_ec.c1610
-rw-r--r--ext/openssl/ossl_pkey_rsa.c781
-rw-r--r--ext/openssl/ossl_rand.c142
-rw-r--r--ext/openssl/ossl_rand.h4
-rw-r--r--ext/openssl/ossl_ssl.c2678
-rw-r--r--ext/openssl/ossl_ssl.h24
-rw-r--r--ext/openssl/ossl_ssl_session.c295
-rw-r--r--ext/openssl/ossl_ts.c1539
-rw-r--r--ext/openssl/ossl_ts.h16
-rw-r--r--ext/openssl/ossl_version.h16
-rw-r--r--ext/openssl/ossl_x509.c180
-rw-r--r--ext/openssl/ossl_x509.h29
-rw-r--r--ext/openssl/ossl_x509attr.c181
-rw-r--r--ext/openssl/ossl_x509cert.c494
-rw-r--r--ext/openssl/ossl_x509crl.c210
-rw-r--r--ext/openssl/ossl_x509ext.c225
-rw-r--r--ext/openssl/ossl_x509name.c357
-rw-r--r--ext/openssl/ossl_x509req.c180
-rw-r--r--ext/openssl/ossl_x509revoked.c133
-rw-r--r--ext/openssl/ossl_x509store.c752
-rw-r--r--ext/openssl/ruby_missing.h41
-rw-r--r--ext/pathname/depend174
-rw-r--r--ext/pathname/extconf.rb2
-rw-r--r--ext/pathname/lib/pathname.rb245
-rw-r--r--ext/pathname/pathname.c863
-rw-r--r--ext/pathname/pathname.gemspec25
-rw-r--r--ext/psych/.gitignore1
-rw-r--r--ext/psych/depend901
-rw-r--r--ext/psych/emitter.c517
-rw-r--r--ext/psych/emitter.h8
-rw-r--r--ext/psych/extconf.rb53
-rw-r--r--ext/psych/lib/psych.rb673
-rw-r--r--ext/psych/lib/psych/class_loader.rb104
-rw-r--r--ext/psych/lib/psych/coder.rb1
-rw-r--r--ext/psych/lib/psych/core_ext.rb28
-rw-r--r--ext/psych/lib/psych/deprecated.rb82
-rw-r--r--ext/psych/lib/psych/exception.rb28
-rw-r--r--ext/psych/lib/psych/handler.rb38
-rw-r--r--ext/psych/lib/psych/handlers/document_stream.rb23
-rw-r--r--ext/psych/lib/psych/handlers/recorder.rb40
-rw-r--r--ext/psych/lib/psych/json.rb6
-rw-r--r--ext/psych/lib/psych/json/ruby_events.rb20
-rw-r--r--ext/psych/lib/psych/json/stream.rb35
-rw-r--r--ext/psych/lib/psych/json/tree_builder.rb27
-rw-r--r--ext/psych/lib/psych/json/yaml_events.rb30
-rw-r--r--ext/psych/lib/psych/nodes.rb17
-rw-r--r--ext/psych/lib/psych/nodes/alias.rb3
-rw-r--r--ext/psych/lib/psych/nodes/document.rb3
-rw-r--r--ext/psych/lib/psych/nodes/mapping.rb3
-rw-r--r--ext/psych/lib/psych/nodes/node.rb41
-rw-r--r--ext/psych/lib/psych/nodes/scalar.rb5
-rw-r--r--ext/psych/lib/psych/nodes/sequence.rb5
-rw-r--r--ext/psych/lib/psych/nodes/stream.rb3
-rw-r--r--ext/psych/lib/psych/omap.rb1
-rw-r--r--ext/psych/lib/psych/parser.rb18
-rw-r--r--ext/psych/lib/psych/scalar_scanner.rb127
-rw-r--r--ext/psych/lib/psych/set.rb1
-rw-r--r--ext/psych/lib/psych/stream.rb21
-rw-r--r--ext/psych/lib/psych/streaming.rb28
-rw-r--r--ext/psych/lib/psych/syntax_error.rb22
-rw-r--r--ext/psych/lib/psych/tree_builder.rb55
-rw-r--r--ext/psych/lib/psych/versions.rb10
-rw-r--r--ext/psych/lib/psych/visitors.rb12
-rw-r--r--ext/psych/lib/psych/visitors/depth_first.rb27
-rw-r--r--ext/psych/lib/psych/visitors/emitter.rb16
-rw-r--r--ext/psych/lib/psych/visitors/json_tree.rb28
-rw-r--r--ext/psych/lib/psych/visitors/to_ruby.rb369
-rw-r--r--ext/psych/lib/psych/visitors/visitor.rb21
-rw-r--r--ext/psych/lib/psych/visitors/yaml_tree.rb417
-rw-r--r--ext/psych/lib/psych/y.rb10
-rw-r--r--ext/psych/parser.c372
-rw-r--r--ext/psych/parser.h6
-rw-r--r--ext/psych/psych.c11
-rw-r--r--ext/psych/psych.gemspec66
-rw-r--r--ext/psych/psych.h11
-rw-r--r--ext/psych/psych_emitter.c555
-rw-r--r--ext/psych/psych_emitter.h8
-rw-r--r--ext/psych/psych_parser.c565
-rw-r--r--ext/psych/psych_parser.h6
-rw-r--r--ext/psych/psych_to_ruby.c39
-rw-r--r--ext/psych/psych_to_ruby.h (renamed from ext/psych/to_ruby.h)0
-rw-r--r--ext/psych/psych_yaml_tree.c12
-rw-r--r--ext/psych/psych_yaml_tree.h (renamed from ext/psych/yaml_tree.h)0
-rw-r--r--ext/psych/to_ruby.c41
-rw-r--r--ext/psych/yaml_tree.c24
-rw-r--r--ext/pty/depend187
-rw-r--r--ext/pty/extconf.rb12
-rw-r--r--ext/pty/lib/expect.rb46
-rw-r--r--ext/pty/pty.c623
-rw-r--r--ext/racc/cparse/README3
-rw-r--r--ext/racc/cparse/cparse.c156
-rw-r--r--ext/racc/cparse/depend163
-rw-r--r--ext/racc/cparse/extconf.rb8
-rw-r--r--ext/rbconfig/sizeof/depend335
-rw-r--r--ext/rbconfig/sizeof/extconf.rb36
-rw-r--r--ext/readline/.gitignore1
-rw-r--r--ext/readline/README.ja401
-rw-r--r--ext/readline/depend176
-rw-r--r--ext/readline/depend-gem4
-rw-r--r--ext/readline/extconf.rb126
-rw-r--r--ext/readline/readline-ext.gemspec22
-rw-r--r--ext/readline/readline.c1283
-rw-r--r--ext/ripper/README2
-rw-r--r--ext/ripper/depend249
-rw-r--r--ext/ripper/eventids2.c537
-rw-r--r--ext/ripper/extconf.rb15
-rw-r--r--ext/ripper/lib/ripper.rb70
-rw-r--r--ext/ripper/lib/ripper/core.rb32
-rw-r--r--ext/ripper/lib/ripper/filter.rb32
-rw-r--r--ext/ripper/lib/ripper/lexer.rb267
-rw-r--r--ext/ripper/lib/ripper/sexp.rb164
-rw-r--r--ext/ripper/tools/dsl.rb88
-rw-r--r--[-rwxr-xr-x]ext/ripper/tools/generate-param-macros.rb1
-rw-r--r--[-rwxr-xr-x]ext/ripper/tools/generate.rb57
-rw-r--r--[-rwxr-xr-x]ext/ripper/tools/preproc.rb56
-rw-r--r--[-rwxr-xr-x]ext/ripper/tools/strip.rb8
-rw-r--r--ext/rubyvm/depend2
-rw-r--r--ext/rubyvm/extconf.rb1
-rw-r--r--ext/rubyvm/lib/forwardable/impl.rb16
-rw-r--r--ext/sdbm/_sdbm.c929
-rw-r--r--ext/sdbm/depend2
-rw-r--r--ext/sdbm/extconf.rb4
-rw-r--r--ext/sdbm/init.c713
-rw-r--r--ext/sdbm/sdbm.h86
-rw-r--r--ext/socket/.document23
-rw-r--r--ext/socket/addrinfo.h36
-rw-r--r--ext/socket/ancdata.c656
-rw-r--r--ext/socket/basicsocket.c317
-rw-r--r--ext/socket/constants.c11
-rw-r--r--ext/socket/depend2909
-rw-r--r--ext/socket/extconf.rb747
-rw-r--r--ext/socket/getaddrinfo.c915
-rw-r--r--ext/socket/getnameinfo.c260
-rw-r--r--ext/socket/ifaddr.c478
-rw-r--r--ext/socket/init.c760
-rw-r--r--ext/socket/ipsocket.c275
-rw-r--r--ext/socket/lib/socket.rb773
-rw-r--r--ext/socket/mkconstants.rb921
-rw-r--r--ext/socket/option.c691
-rw-r--r--ext/socket/raddrinfo.c1082
-rw-r--r--ext/socket/rubysocket.h370
-rw-r--r--ext/socket/socket.c1457
-rw-r--r--ext/socket/sockport.h86
-rw-r--r--ext/socket/sockssocket.c40
-rw-r--r--ext/socket/tcpserver.c119
-rw-r--r--ext/socket/tcpsocket.c72
-rw-r--r--ext/socket/udpsocket.c228
-rw-r--r--ext/socket/unixserver.c89
-rw-r--r--ext/socket/unixsocket.c275
-rw-r--r--ext/stringio/README18
-rw-r--r--ext/stringio/README.md10
-rw-r--r--ext/stringio/depend178
-rw-r--r--ext/stringio/extconf.rb2
-rw-r--r--ext/stringio/stringio.c1246
-rw-r--r--ext/stringio/stringio.gemspec38
-rw-r--r--ext/strscan/depend178
-rw-r--r--ext/strscan/extconf.rb9
-rw-r--r--ext/strscan/strscan.c718
-rw-r--r--ext/strscan/strscan.gemspec41
-rw-r--r--ext/syck/bytecode.c1165
-rw-r--r--ext/syck/depend12
-rw-r--r--ext/syck/emitter.c1247
-rw-r--r--ext/syck/extconf.rb5
-rw-r--r--ext/syck/gram.c1894
-rw-r--r--ext/syck/gram.h79
-rw-r--r--ext/syck/handler.c173
-rw-r--r--ext/syck/implicit.c2990
-rw-r--r--ext/syck/lib/syck.rb447
-rw-r--r--ext/syck/lib/syck/baseemitter.rb242
-rw-r--r--ext/syck/lib/syck/basenode.rb222
-rw-r--r--ext/syck/lib/syck/constants.rb45
-rw-r--r--ext/syck/lib/syck/encoding.rb35
-rw-r--r--ext/syck/lib/syck/error.rb34
-rw-r--r--ext/syck/lib/syck/loader.rb14
-rw-r--r--ext/syck/lib/syck/rubytypes.rb464
-rw-r--r--ext/syck/lib/syck/stream.rb41
-rw-r--r--ext/syck/lib/syck/stringio.rb85
-rw-r--r--ext/syck/lib/syck/syck.rb16
-rw-r--r--ext/syck/lib/syck/tag.rb95
-rw-r--r--ext/syck/lib/syck/types.rb192
-rw-r--r--ext/syck/lib/syck/yamlnode.rb54
-rw-r--r--ext/syck/lib/syck/ypath.rb54
-rw-r--r--ext/syck/lib/yaml/syck.rb14
-rw-r--r--ext/syck/node.c407
-rw-r--r--ext/syck/rubyext.c2326
-rw-r--r--ext/syck/syck.c524
-rw-r--r--ext/syck/syck.h453
-rw-r--r--ext/syck/token.c2724
-rw-r--r--ext/syck/yaml2byte.c259
-rw-r--r--ext/syck/yamlbyte.h171
-rw-r--r--ext/syslog/depend164
-rw-r--r--ext/syslog/extconf.rb3
-rw-r--r--ext/syslog/lib/syslog/logger.rb209
-rw-r--r--ext/syslog/syslog.c385
-rw-r--r--ext/syslog/syslog.gemspec23
-rw-r--r--ext/syslog/syslog.txt4
-rw-r--r--ext/tk/ChangeLog.tkextlib949
-rw-r--r--ext/tk/MANUAL_tcltklib.eng473
-rw-r--r--ext/tk/MANUAL_tcltklib.eucj584
-rw-r--r--ext/tk/README.1st19
-rw-r--r--ext/tk/README.ActiveTcl62
-rw-r--r--ext/tk/README.fork34
-rw-r--r--ext/tk/README.macosx-aqua67
-rw-r--r--ext/tk/README.tcltklib127
-rw-r--r--ext/tk/config_list.in37
-rw-r--r--ext/tk/depend2
-rw-r--r--ext/tk/extconf.rb1583
-rw-r--r--ext/tk/lib/README30
-rw-r--r--ext/tk/lib/multi-tk.rb3754
-rw-r--r--ext/tk/lib/remote-tk.rb530
-rw-r--r--ext/tk/lib/tcltk.rb367
-rw-r--r--ext/tk/lib/tk.rb5729
-rw-r--r--ext/tk/lib/tk/after.rb6
-rw-r--r--ext/tk/lib/tk/autoload.rb760
-rw-r--r--ext/tk/lib/tk/bgerror.rb29
-rw-r--r--ext/tk/lib/tk/bindtag.rb138
-rw-r--r--ext/tk/lib/tk/busy.rb118
-rw-r--r--ext/tk/lib/tk/button.rb31
-rw-r--r--ext/tk/lib/tk/canvas.rb816
-rw-r--r--ext/tk/lib/tk/canvastag.rb459
-rw-r--r--ext/tk/lib/tk/checkbutton.rb32
-rw-r--r--ext/tk/lib/tk/clipboard.rb75
-rw-r--r--ext/tk/lib/tk/clock.rb71
-rw-r--r--ext/tk/lib/tk/composite.rb484
-rw-r--r--ext/tk/lib/tk/console.rb52
-rw-r--r--ext/tk/lib/tk/dialog.rb326
-rw-r--r--ext/tk/lib/tk/encodedstr.rb187
-rw-r--r--ext/tk/lib/tk/entry.rb120
-rw-r--r--ext/tk/lib/tk/event.rb562
-rw-r--r--ext/tk/lib/tk/font.rb2351
-rw-r--r--ext/tk/lib/tk/fontchooser.rb176
-rw-r--r--ext/tk/lib/tk/frame.rb132
-rw-r--r--ext/tk/lib/tk/grid.rb279
-rw-r--r--ext/tk/lib/tk/image.rb275
-rw-r--r--ext/tk/lib/tk/itemconfig.rb1222
-rw-r--r--ext/tk/lib/tk/itemfont.rb327
-rw-r--r--ext/tk/lib/tk/kinput.rb71
-rw-r--r--ext/tk/lib/tk/label.rb22
-rw-r--r--ext/tk/lib/tk/labelframe.rb31
-rw-r--r--ext/tk/lib/tk/listbox.rb284
-rw-r--r--ext/tk/lib/tk/macpkg.rb80
-rw-r--r--ext/tk/lib/tk/menu.rb718
-rw-r--r--ext/tk/lib/tk/menubar.rb137
-rw-r--r--ext/tk/lib/tk/menuspec.rb456
-rw-r--r--ext/tk/lib/tk/message.rb24
-rw-r--r--ext/tk/lib/tk/mngfocus.rb33
-rw-r--r--ext/tk/lib/tk/msgcat.rb296
-rw-r--r--ext/tk/lib/tk/namespace.rb551
-rw-r--r--ext/tk/lib/tk/optiondb.rb377
-rw-r--r--ext/tk/lib/tk/optionobj.rb212
-rw-r--r--ext/tk/lib/tk/pack.rb107
-rw-r--r--ext/tk/lib/tk/package.rb143
-rw-r--r--ext/tk/lib/tk/palette.rb55
-rw-r--r--ext/tk/lib/tk/panedwindow.rb260
-rw-r--r--ext/tk/lib/tk/place.rb128
-rw-r--r--ext/tk/lib/tk/radiobutton.rb73
-rw-r--r--ext/tk/lib/tk/root.rb95
-rw-r--r--ext/tk/lib/tk/scale.rb112
-rw-r--r--ext/tk/lib/tk/scrollable.rb82
-rw-r--r--ext/tk/lib/tk/scrollbar.rb183
-rw-r--r--ext/tk/lib/tk/scrollbox.rb39
-rw-r--r--ext/tk/lib/tk/selection.rb86
-rw-r--r--ext/tk/lib/tk/spinbox.rb144
-rw-r--r--ext/tk/lib/tk/tagfont.rb43
-rw-r--r--ext/tk/lib/tk/text.rb1604
-rw-r--r--ext/tk/lib/tk/textimage.rb88
-rw-r--r--ext/tk/lib/tk/textmark.rb204
-rw-r--r--ext/tk/lib/tk/texttag.rb321
-rw-r--r--ext/tk/lib/tk/textwindow.rb154
-rw-r--r--ext/tk/lib/tk/timer.rb669
-rw-r--r--ext/tk/lib/tk/toplevel.rb264
-rw-r--r--ext/tk/lib/tk/ttk_selector.rb98
-rw-r--r--ext/tk/lib/tk/txtwin_abst.rb39
-rw-r--r--ext/tk/lib/tk/validation.rb397
-rw-r--r--ext/tk/lib/tk/variable.rb1799
-rw-r--r--ext/tk/lib/tk/virtevent.rb139
-rw-r--r--ext/tk/lib/tk/winfo.rb392
-rw-r--r--ext/tk/lib/tk/winpkg.rb156
-rw-r--r--ext/tk/lib/tk/wm.rb552
-rw-r--r--ext/tk/lib/tk/xim.rb122
-rw-r--r--ext/tk/lib/tkafter.rb4
-rw-r--r--ext/tk/lib/tkbgerror.rb4
-rw-r--r--ext/tk/lib/tkcanvas.rb4
-rw-r--r--ext/tk/lib/tkclass.rb47
-rw-r--r--ext/tk/lib/tkconsole.rb4
-rw-r--r--ext/tk/lib/tkdialog.rb4
-rw-r--r--ext/tk/lib/tkentry.rb4
-rw-r--r--ext/tk/lib/tkextlib/ICONS.rb13
-rw-r--r--ext/tk/lib/tkextlib/ICONS/icons.rb129
-rw-r--r--ext/tk/lib/tkextlib/ICONS/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/SUPPORT_STATUS198
-rw-r--r--ext/tk/lib/tkextlib/blt.rb189
-rw-r--r--ext/tk/lib/tkextlib/blt/barchart.rb79
-rw-r--r--ext/tk/lib/tkextlib/blt/bitmap.rb112
-rw-r--r--ext/tk/lib/tkextlib/blt/busy.rb83
-rw-r--r--ext/tk/lib/tkextlib/blt/component.rb2218
-rw-r--r--ext/tk/lib/tkextlib/blt/container.rb28
-rw-r--r--ext/tk/lib/tkextlib/blt/cutbuffer.rb23
-rw-r--r--ext/tk/lib/tkextlib/blt/dragdrop.rb269
-rw-r--r--ext/tk/lib/tkextlib/blt/eps.rb32
-rw-r--r--ext/tk/lib/tkextlib/blt/graph.rb67
-rw-r--r--ext/tk/lib/tkextlib/blt/htext.rb112
-rw-r--r--ext/tk/lib/tkextlib/blt/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/blt/spline.rb23
-rw-r--r--ext/tk/lib/tkextlib/blt/stripchart.rb74
-rw-r--r--ext/tk/lib/tkextlib/blt/table.rb412
-rw-r--r--ext/tk/lib/tkextlib/blt/tabnotebook.rb110
-rw-r--r--ext/tk/lib/tkextlib/blt/tabset.rb504
-rw-r--r--ext/tk/lib/tkextlib/blt/ted.rb68
-rw-r--r--ext/tk/lib/tkextlib/blt/tile.rb25
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/button.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/checkbutton.rb17
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/frame.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/label.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/radiobutton.rb17
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/scrollbar.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/toplevel.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tree.rb1058
-rw-r--r--ext/tk/lib/tkextlib/blt/treeview.rb1287
-rw-r--r--ext/tk/lib/tkextlib/blt/unix_dnd.rb141
-rw-r--r--ext/tk/lib/tkextlib/blt/vector.rb256
-rw-r--r--ext/tk/lib/tkextlib/blt/watch.rb175
-rw-r--r--ext/tk/lib/tkextlib/blt/win_printer.rb61
-rw-r--r--ext/tk/lib/tkextlib/blt/winop.rb107
-rw-r--r--ext/tk/lib/tkextlib/bwidget.rb153
-rw-r--r--ext/tk/lib/tkextlib/bwidget/arrowbutton.rb21
-rw-r--r--ext/tk/lib/tkextlib/bwidget/bitmap.rb21
-rw-r--r--ext/tk/lib/tkextlib/bwidget/button.rb31
-rw-r--r--ext/tk/lib/tkextlib/bwidget/buttonbox.rb90
-rw-r--r--ext/tk/lib/tkextlib/bwidget/combobox.rb62
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dialog.rb194
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dragsite.rb31
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dropsite.rb39
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dynamichelp.rb63
-rw-r--r--ext/tk/lib/tkextlib/bwidget/entry.rb43
-rw-r--r--ext/tk/lib/tkextlib/bwidget/label.rb41
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelentry.rb80
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelframe.rb52
-rw-r--r--ext/tk/lib/tkextlib/bwidget/listbox.rb361
-rw-r--r--ext/tk/lib/tkextlib/bwidget/mainframe.rb132
-rw-r--r--ext/tk/lib/tkextlib/bwidget/messagedlg.rb192
-rw-r--r--ext/tk/lib/tkextlib/bwidget/notebook.rb166
-rw-r--r--ext/tk/lib/tkextlib/bwidget/pagesmanager.rb73
-rw-r--r--ext/tk/lib/tkextlib/bwidget/panedwindow.rb42
-rw-r--r--ext/tk/lib/tkextlib/bwidget/panelframe.rb67
-rw-r--r--ext/tk/lib/tkextlib/bwidget/passwddlg.rb44
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressbar.rb20
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressdlg.rb58
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollableframe.rb40
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrolledwindow.rb48
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollview.rb25
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectcolor.rb73
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectfont.rb91
-rw-r--r--ext/tk/lib/tkextlib/bwidget/separator.rb20
-rw-r--r--ext/tk/lib/tkextlib/bwidget/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/bwidget/spinbox.rb98
-rw-r--r--ext/tk/lib/tkextlib/bwidget/statusbar.rb62
-rw-r--r--ext/tk/lib/tkextlib/bwidget/titleframe.rb33
-rw-r--r--ext/tk/lib/tkextlib/bwidget/tree.rb500
-rw-r--r--ext/tk/lib/tkextlib/bwidget/widget.rb129
-rw-r--r--ext/tk/lib/tkextlib/itcl.rb13
-rw-r--r--ext/tk/lib/tkextlib/itcl/incr_tcl.rb178
-rw-r--r--ext/tk/lib/tkextlib/itcl/setup.rb13
-rw-r--r--ext/tk/lib/tkextlib/itk.rb13
-rw-r--r--ext/tk/lib/tkextlib/itk/incr_tk.rb446
-rw-r--r--ext/tk/lib/tkextlib/itk/setup.rb13
-rw-r--r--ext/tk/lib/tkextlib/iwidgets.rb94
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/buttonbox.rb121
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/calendar.rb125
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintbox.rb53
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintdialog.rb38
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/checkbox.rb130
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/combobox.rb104
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dateentry.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/datefield.rb58
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialog.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialogshell.rb121
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/disjointlistbox.rb50
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/entryfield.rb185
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extbutton.rb40
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectionbox.rb46
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectiondialog.rb33
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/feedback.rb35
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectionbox.rb46
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectiondialog.rb33
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/finddialog.rb42
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hierarchy.rb365
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hyperhelp.rb50
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledframe.rb39
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledwidget.rb45
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/mainwindow.rb67
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/menubar.rb212
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagebox.rb93
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagedialog.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/notebook.rb175
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/optionmenu.rb92
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/panedwindow.rb134
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/promptdialog.rb131
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/pushbutton.rb35
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/radiobox.rb121
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scopedobject.rb24
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledcanvas.rb353
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledframe.rb59
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledhtml.rb58
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledlistbox.rb207
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledtext.rb568
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledwidget.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectionbox.rb102
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectiondialog.rb92
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/shell.rb38
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spindate.rb48
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinint.rb30
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinner.rb169
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spintime.rb48
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabnotebook.rb181
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabset.rb145
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timeentry.rb25
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timefield.rb58
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/toolbar.rb112
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/watch.rb56
-rwxr-xr-xext/tk/lib/tkextlib/pkg_checker.rb184
-rw-r--r--ext/tk/lib/tkextlib/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tcllib.rb105
-rw-r--r--ext/tk/lib/tkextlib/tcllib/README135
-rw-r--r--ext/tk/lib/tkextlib/tcllib/autoscroll.rb158
-rw-r--r--ext/tk/lib/tkextlib/tcllib/calendar.rb55
-rw-r--r--ext/tk/lib/tkextlib/tcllib/canvas_sqmap.rb36
-rw-r--r--ext/tk/lib/tkextlib/tcllib/canvas_zoom.rb21
-rw-r--r--ext/tk/lib/tkextlib/tcllib/chatwidget.rb151
-rw-r--r--ext/tk/lib/tkextlib/tcllib/crosshair.rb117
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ctext.rb160
-rw-r--r--ext/tk/lib/tkextlib/tcllib/cursor.rb97
-rw-r--r--ext/tk/lib/tkextlib/tcllib/dateentry.rb62
-rw-r--r--ext/tk/lib/tkextlib/tcllib/datefield.rb57
-rw-r--r--ext/tk/lib/tkextlib/tcllib/diagrams.rb224
-rw-r--r--ext/tk/lib/tkextlib/tcllib/dialog.rb84
-rw-r--r--ext/tk/lib/tkextlib/tcllib/getstring.rb134
-rw-r--r--ext/tk/lib/tkextlib/tcllib/history.rb73
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ico.rb146
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ip_entry.rb75
-rw-r--r--ext/tk/lib/tkextlib/tcllib/khim.rb68
-rw-r--r--ext/tk/lib/tkextlib/tcllib/menuentry.rb47
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ntext.rb146
-rw-r--r--ext/tk/lib/tkextlib/tcllib/panelframe.rb78
-rw-r--r--ext/tk/lib/tkextlib/tcllib/plotchart.rb1404
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ruler.rb65
-rw-r--r--ext/tk/lib/tkextlib/tcllib/screenruler.rb68
-rw-r--r--ext/tk/lib/tkextlib/tcllib/scrolledwindow.rb57
-rw-r--r--ext/tk/lib/tkextlib/tcllib/scrollwin.rb61
-rw-r--r--ext/tk/lib/tkextlib/tcllib/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tcllib/statusbar.rb79
-rw-r--r--ext/tk/lib/tkextlib/tcllib/style.rb61
-rw-r--r--ext/tk/lib/tkextlib/tcllib/superframe.rb51
-rw-r--r--ext/tk/lib/tkextlib/tcllib/swaplist.rb150
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist.rb28
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist_core.rb1072
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist_tile.rb43
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tkpiechart.rb314
-rw-r--r--ext/tk/lib/tkextlib/tcllib/toolbar.rb175
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tooltip.rb104
-rw-r--r--ext/tk/lib/tkextlib/tcllib/widget.rb82
-rw-r--r--ext/tk/lib/tkextlib/tclx.rb13
-rw-r--r--ext/tk/lib/tkextlib/tclx/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tclx/tclx.rb74
-rw-r--r--ext/tk/lib/tkextlib/tile.rb449
-rw-r--r--ext/tk/lib/tkextlib/tile/dialog.rb102
-rw-r--r--ext/tk/lib/tkextlib/tile/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tile/sizegrip.rb32
-rw-r--r--ext/tk/lib/tkextlib/tile/style.rb336
-rw-r--r--ext/tk/lib/tkextlib/tile/tbutton.rb34
-rw-r--r--ext/tk/lib/tkextlib/tile/tcheckbutton.rb38
-rw-r--r--ext/tk/lib/tkextlib/tile/tcombobox.rb55
-rw-r--r--ext/tk/lib/tkextlib/tile/tentry.rb49
-rw-r--r--ext/tk/lib/tkextlib/tile/tframe.rb34
-rw-r--r--ext/tk/lib/tkextlib/tile/tlabel.rb34
-rw-r--r--ext/tk/lib/tkextlib/tile/tlabelframe.rb38
-rw-r--r--ext/tk/lib/tkextlib/tile/tmenubutton.rb38
-rw-r--r--ext/tk/lib/tkextlib/tile/tnotebook.rb147
-rw-r--r--ext/tk/lib/tkextlib/tile/tpaned.rb245
-rw-r--r--ext/tk/lib/tkextlib/tile/tprogressbar.rb57
-rw-r--r--ext/tk/lib/tkextlib/tile/tradiobutton.rb38
-rw-r--r--ext/tk/lib/tkextlib/tile/treeview.rb1306
-rw-r--r--ext/tk/lib/tkextlib/tile/tscale.rb56
-rw-r--r--ext/tk/lib/tkextlib/tile/tscrollbar.rb63
-rw-r--r--ext/tk/lib/tkextlib/tile/tseparator.rb34
-rw-r--r--ext/tk/lib/tkextlib/tile/tspinbox.rb107
-rw-r--r--ext/tk/lib/tkextlib/tile/tsquare.rb30
-rw-r--r--ext/tk/lib/tkextlib/tkDND.rb18
-rw-r--r--ext/tk/lib/tkextlib/tkDND/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkDND/shape.rb125
-rw-r--r--ext/tk/lib/tkextlib/tkDND/tkdnd.rb182
-rw-r--r--ext/tk/lib/tkextlib/tkHTML.rb13
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/htmlwidget.rb453
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkimg.rb36
-rw-r--r--ext/tk/lib/tkextlib/tkimg/README26
-rw-r--r--ext/tk/lib/tkextlib/tkimg/bmp.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/gif.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ico.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/jpeg.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/pcx.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/pixmap.rb44
-rw-r--r--ext/tk/lib/tkextlib/tkimg/png.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ppm.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ps.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkimg/sgi.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/sun.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/tga.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/tiff.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/window.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/xbm.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/xpm.rb33
-rw-r--r--ext/tk/lib/tkextlib/tktable.rb14
-rw-r--r--ext/tk/lib/tkextlib/tktable/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tktable/tktable.rb966
-rw-r--r--ext/tk/lib/tkextlib/tktrans.rb14
-rw-r--r--ext/tk/lib/tkextlib/tktrans/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tktrans/tktrans.rb64
-rw-r--r--ext/tk/lib/tkextlib/treectrl.rb13
-rw-r--r--ext/tk/lib/tkextlib/treectrl/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/treectrl/tktreectrl.rb2522
-rw-r--r--ext/tk/lib/tkextlib/trofs.rb13
-rw-r--r--ext/tk/lib/tkextlib/trofs/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/trofs/trofs.rb51
-rw-r--r--ext/tk/lib/tkextlib/version.rb6
-rw-r--r--ext/tk/lib/tkextlib/vu.rb48
-rw-r--r--ext/tk/lib/tkextlib/vu/bargraph.rb61
-rw-r--r--ext/tk/lib/tkextlib/vu/charts.rb53
-rw-r--r--ext/tk/lib/tkextlib/vu/dial.rb102
-rw-r--r--ext/tk/lib/tkextlib/vu/pie.rb286
-rw-r--r--ext/tk/lib/tkextlib/vu/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/vu/spinbox.rb22
-rw-r--r--ext/tk/lib/tkextlib/winico.rb14
-rw-r--r--ext/tk/lib/tkextlib/winico/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/winico/winico.rb224
-rw-r--r--ext/tk/lib/tkfont.rb4
-rw-r--r--ext/tk/lib/tkmacpkg.rb4
-rw-r--r--ext/tk/lib/tkmenubar.rb4
-rw-r--r--ext/tk/lib/tkmngfocus.rb4
-rw-r--r--ext/tk/lib/tkpalette.rb4
-rw-r--r--ext/tk/lib/tkscrollbox.rb4
-rw-r--r--ext/tk/lib/tktext.rb4
-rw-r--r--ext/tk/lib/tkvirtevent.rb4
-rw-r--r--ext/tk/lib/tkwinpkg.rb4
-rw-r--r--ext/tk/old-README.tcltklib.eucj159
-rw-r--r--ext/tk/old-extconf.rb440
-rw-r--r--ext/tk/sample/24hr_clock.rb286
-rw-r--r--ext/tk/sample/binding_sample.rb87
-rw-r--r--ext/tk/sample/bindtag_sample.rb127
-rw-r--r--ext/tk/sample/binstr_usage.rb45
-rw-r--r--ext/tk/sample/btn_with_frame.rb20
-rw-r--r--ext/tk/sample/cd_timer.rb81
-rw-r--r--ext/tk/sample/cmd_res_test.rb17
-rw-r--r--ext/tk/sample/cmd_resource5
-rw-r--r--ext/tk/sample/demos-en/ChangeLog64
-rw-r--r--ext/tk/sample/demos-en/ChangeLog.prev9
-rw-r--r--ext/tk/sample/demos-en/README138
-rw-r--r--ext/tk/sample/demos-en/README.1st18
-rw-r--r--ext/tk/sample/demos-en/README.tkencoding29
-rw-r--r--ext/tk/sample/demos-en/anilabel.rb174
-rw-r--r--ext/tk/sample/demos-en/aniwave.rb118
-rw-r--r--ext/tk/sample/demos-en/arrow.rb249
-rw-r--r--ext/tk/sample/demos-en/bind.rb127
-rw-r--r--ext/tk/sample/demos-en/bitmap.rb75
-rw-r--r--ext/tk/sample/demos-en/browse163
-rw-r--r--ext/tk/sample/demos-en/browse282
-rw-r--r--ext/tk/sample/demos-en/button.rb84
-rw-r--r--ext/tk/sample/demos-en/check.rb72
-rw-r--r--ext/tk/sample/demos-en/check2.rb109
-rw-r--r--ext/tk/sample/demos-en/clrpick.rb87
-rw-r--r--ext/tk/sample/demos-en/colors.rb158
-rw-r--r--ext/tk/sample/demos-en/combo.rb96
-rw-r--r--ext/tk/sample/demos-en/cscroll.rb136
-rw-r--r--ext/tk/sample/demos-en/ctext.rb207
-rw-r--r--ext/tk/sample/demos-en/dialog1.rb38
-rw-r--r--ext/tk/sample/demos-en/dialog2.rb41
-rw-r--r--ext/tk/sample/demos-en/doc.org/README7
-rw-r--r--ext/tk/sample/demos-en/doc.org/README.JP14
-rw-r--r--ext/tk/sample/demos-en/doc.org/README.tk8046
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms39
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms.tk8039
-rw-r--r--ext/tk/sample/demos-en/entry1.rb58
-rw-r--r--ext/tk/sample/demos-en/entry2.rb93
-rw-r--r--ext/tk/sample/demos-en/entry3.rb220
-rw-r--r--ext/tk/sample/demos-en/filebox.rb102
-rw-r--r--ext/tk/sample/demos-en/floor.rb1723
-rw-r--r--ext/tk/sample/demos-en/floor2.rb1722
-rw-r--r--ext/tk/sample/demos-en/form.rb64
-rw-r--r--ext/tk/sample/demos-en/goldberg.rb2006
-rw-r--r--ext/tk/sample/demos-en/hello14
-rw-r--r--ext/tk/sample/demos-en/hscale.rb75
-rw-r--r--ext/tk/sample/demos-en/icon.rb105
-rw-r--r--ext/tk/sample/demos-en/image1.rb65
-rw-r--r--ext/tk/sample/demos-en/image2.rb107
-rw-r--r--ext/tk/sample/demos-en/image3.rb125
-rw-r--r--ext/tk/sample/demos-en/items.rb381
-rw-r--r--ext/tk/sample/demos-en/ixset333
-rw-r--r--ext/tk/sample/demos-en/ixset2367
-rw-r--r--ext/tk/sample/demos-en/knightstour.rb271
-rw-r--r--ext/tk/sample/demos-en/label.rb72
-rw-r--r--ext/tk/sample/demos-en/labelframe.rb95
-rw-r--r--ext/tk/sample/demos-en/mclist.rb117
-rw-r--r--ext/tk/sample/demos-en/menu.rb196
-rw-r--r--ext/tk/sample/demos-en/menu84.rb215
-rw-r--r--ext/tk/sample/demos-en/menubu.rb237
-rw-r--r--ext/tk/sample/demos-en/msgbox.rb90
-rw-r--r--ext/tk/sample/demos-en/msgbox2.rb91
-rw-r--r--ext/tk/sample/demos-en/paned1.rb47
-rw-r--r--ext/tk/sample/demos-en/paned2.rb94
-rw-r--r--ext/tk/sample/demos-en/pendulum.rb240
-rw-r--r--ext/tk/sample/demos-en/plot.rb124
-rw-r--r--ext/tk/sample/demos-en/puzzle.rb134
-rw-r--r--ext/tk/sample/demos-en/radio.rb86
-rw-r--r--ext/tk/sample/demos-en/radio2.rb109
-rw-r--r--ext/tk/sample/demos-en/radio3.rb117
-rw-r--r--ext/tk/sample/demos-en/rmt268
-rw-r--r--ext/tk/sample/demos-en/rolodex320
-rw-r--r--ext/tk/sample/demos-en/ruler.rb205
-rw-r--r--ext/tk/sample/demos-en/sayings.rb106
-rw-r--r--ext/tk/sample/demos-en/search.rb187
-rw-r--r--ext/tk/sample/demos-en/spin.rb65
-rw-r--r--ext/tk/sample/demos-en/square81
-rw-r--r--ext/tk/sample/demos-en/states.rb80
-rw-r--r--ext/tk/sample/demos-en/style.rb231
-rw-r--r--ext/tk/sample/demos-en/tcolor526
-rw-r--r--ext/tk/sample/demos-en/text.rb128
-rw-r--r--ext/tk/sample/demos-en/textpeer.rb76
-rw-r--r--ext/tk/sample/demos-en/timer136
-rw-r--r--ext/tk/sample/demos-en/tkencoding.rb42
-rw-r--r--ext/tk/sample/demos-en/toolbar.rb130
-rw-r--r--ext/tk/sample/demos-en/tree.rb119
-rw-r--r--ext/tk/sample/demos-en/ttkbut.rb139
-rw-r--r--ext/tk/sample/demos-en/ttkmenu.rb85
-rw-r--r--ext/tk/sample/demos-en/ttknote.rb89
-rw-r--r--ext/tk/sample/demos-en/ttkpane.rb213
-rw-r--r--ext/tk/sample/demos-en/ttkprogress.rb66
-rw-r--r--ext/tk/sample/demos-en/twind.rb291
-rw-r--r--ext/tk/sample/demos-en/twind2.rb384
-rw-r--r--ext/tk/sample/demos-en/unicodeout.rb114
-rw-r--r--ext/tk/sample/demos-en/vscale.rb79
-rw-r--r--ext/tk/sample/demos-en/widget1087
-rw-r--r--ext/tk/sample/demos-jp/README54
-rw-r--r--ext/tk/sample/demos-jp/README.1st20
-rw-r--r--ext/tk/sample/demos-jp/anilabel.rb177
-rw-r--r--ext/tk/sample/demos-jp/aniwave.rb120
-rw-r--r--ext/tk/sample/demos-jp/arrow.rb247
-rw-r--r--ext/tk/sample/demos-jp/bind.rb125
-rw-r--r--ext/tk/sample/demos-jp/bitmap.rb74
-rw-r--r--ext/tk/sample/demos-jp/browse163
-rw-r--r--ext/tk/sample/demos-jp/browse282
-rw-r--r--ext/tk/sample/demos-jp/button.rb83
-rw-r--r--ext/tk/sample/demos-jp/check.rb70
-rw-r--r--ext/tk/sample/demos-jp/check2.rb110
-rw-r--r--ext/tk/sample/demos-jp/clrpick.rb84
-rw-r--r--ext/tk/sample/demos-jp/colors.rb155
-rw-r--r--ext/tk/sample/demos-jp/combo.rb98
-rw-r--r--ext/tk/sample/demos-jp/cscroll.rb134
-rw-r--r--ext/tk/sample/demos-jp/ctext.rb204
-rw-r--r--ext/tk/sample/demos-jp/dialog1.rb39
-rw-r--r--ext/tk/sample/demos-jp/dialog2.rb43
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README7
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README.JP14
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README.tk8046
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms39
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms.tk8039
-rw-r--r--ext/tk/sample/demos-jp/entry1.rb60
-rw-r--r--ext/tk/sample/demos-jp/entry2.rb91
-rw-r--r--ext/tk/sample/demos-jp/entry3.rb225
-rw-r--r--ext/tk/sample/demos-jp/filebox.rb102
-rw-r--r--ext/tk/sample/demos-jp/floor.rb1721
-rw-r--r--ext/tk/sample/demos-jp/floor2.rb1719
-rw-r--r--ext/tk/sample/demos-jp/form.rb66
-rw-r--r--ext/tk/sample/demos-jp/goldberg.rb2011
-rw-r--r--ext/tk/sample/demos-jp/hello10
-rw-r--r--ext/tk/sample/demos-jp/hscale.rb78
-rw-r--r--ext/tk/sample/demos-jp/icon.rb103
-rw-r--r--ext/tk/sample/demos-jp/image1.rb64
-rw-r--r--ext/tk/sample/demos-jp/image2.rb106
-rw-r--r--ext/tk/sample/demos-jp/image3.rb127
-rw-r--r--ext/tk/sample/demos-jp/items.rb379
-rw-r--r--ext/tk/sample/demos-jp/ixset333
-rw-r--r--ext/tk/sample/demos-jp/ixset2369
-rw-r--r--ext/tk/sample/demos-jp/knightstour.rb273
-rw-r--r--ext/tk/sample/demos-jp/label.rb69
-rw-r--r--ext/tk/sample/demos-jp/labelframe.rb102
-rw-r--r--ext/tk/sample/demos-jp/mclist.rb121
-rw-r--r--ext/tk/sample/demos-jp/menu.rb201
-rw-r--r--ext/tk/sample/demos-jp/menu84.rb213
-rw-r--r--ext/tk/sample/demos-jp/menu8x.rb233
-rw-r--r--ext/tk/sample/demos-jp/menubu.rb238
-rw-r--r--ext/tk/sample/demos-jp/msgbox.rb89
-rw-r--r--ext/tk/sample/demos-jp/msgbox2.rb90
-rw-r--r--ext/tk/sample/demos-jp/paned1.rb52
-rw-r--r--ext/tk/sample/demos-jp/paned2.rb100
-rw-r--r--ext/tk/sample/demos-jp/pendulum.rb242
-rw-r--r--ext/tk/sample/demos-jp/plot.rb126
-rw-r--r--ext/tk/sample/demos-jp/puzzle.rb131
-rw-r--r--ext/tk/sample/demos-jp/radio.rb84
-rw-r--r--ext/tk/sample/demos-jp/radio2.rb112
-rw-r--r--ext/tk/sample/demos-jp/radio3.rb119
-rw-r--r--ext/tk/sample/demos-jp/rmt268
-rw-r--r--ext/tk/sample/demos-jp/rolodex320
-rw-r--r--ext/tk/sample/demos-jp/rolodex-j300
-rw-r--r--ext/tk/sample/demos-jp/ruler.rb203
-rw-r--r--ext/tk/sample/demos-jp/sayings.rb103
-rw-r--r--ext/tk/sample/demos-jp/search.rb184
-rw-r--r--ext/tk/sample/demos-jp/spin.rb71
-rw-r--r--ext/tk/sample/demos-jp/square81
-rw-r--r--ext/tk/sample/demos-jp/states.rb74
-rw-r--r--ext/tk/sample/demos-jp/style.rb270
-rw-r--r--ext/tk/sample/demos-jp/tcolor534
-rw-r--r--ext/tk/sample/demos-jp/text.rb120
-rw-r--r--ext/tk/sample/demos-jp/textpeer.rb82
-rw-r--r--ext/tk/sample/demos-jp/timer136
-rw-r--r--ext/tk/sample/demos-jp/toolbar.rb136
-rw-r--r--ext/tk/sample/demos-jp/tree.rb120
-rw-r--r--ext/tk/sample/demos-jp/ttkbut.rb145
-rw-r--r--ext/tk/sample/demos-jp/ttkmenu.rb91
-rw-r--r--ext/tk/sample/demos-jp/ttknote.rb97
-rw-r--r--ext/tk/sample/demos-jp/ttkpane.rb216
-rw-r--r--ext/tk/sample/demos-jp/ttkprogress.rb71
-rw-r--r--ext/tk/sample/demos-jp/twind.rb292
-rw-r--r--ext/tk/sample/demos-jp/twind2.rb384
-rw-r--r--ext/tk/sample/demos-jp/unicodeout.rb119
-rw-r--r--ext/tk/sample/demos-jp/vscale.rb80
-rw-r--r--ext/tk/sample/demos-jp/widget1122
-rw-r--r--ext/tk/sample/editable_listbox.rb148
-rw-r--r--ext/tk/sample/encstr_usage.rb30
-rw-r--r--ext/tk/sample/figmemo_sample.rb456
-rw-r--r--ext/tk/sample/images/earth.gifbin51712 -> 0 bytes-rw-r--r--ext/tk/sample/images/earthris.gifbin6343 -> 0 bytes-rw-r--r--ext/tk/sample/images/face.xbm173
-rw-r--r--ext/tk/sample/images/flagdown.xbm27
-rw-r--r--ext/tk/sample/images/flagup.xbm27
-rw-r--r--ext/tk/sample/images/gray25.xbm6
-rw-r--r--ext/tk/sample/images/grey.256
-rw-r--r--ext/tk/sample/images/grey.56
-rw-r--r--ext/tk/sample/images/letters.xbm27
-rw-r--r--ext/tk/sample/images/noletter.xbm27
-rw-r--r--ext/tk/sample/images/pattern.xbm6
-rw-r--r--ext/tk/sample/images/tcllogo.gifbin2341 -> 0 bytes-rw-r--r--ext/tk/sample/images/teapot.ppm31
-rw-r--r--ext/tk/sample/irbtk.rb30
-rw-r--r--ext/tk/sample/irbtkw.rbw156
-rw-r--r--ext/tk/sample/iso2022-kr.txt2
-rw-r--r--ext/tk/sample/menubar1.rb51
-rw-r--r--ext/tk/sample/menubar2.rb56
-rw-r--r--ext/tk/sample/menubar3.rb72
-rw-r--r--ext/tk/sample/msgs_rb/README3
-rw-r--r--ext/tk/sample/msgs_rb/cs.msg84
-rw-r--r--ext/tk/sample/msgs_rb/de.msg88
-rw-r--r--ext/tk/sample/msgs_rb/el.msg98
-rw-r--r--ext/tk/sample/msgs_rb/en.msg83
-rw-r--r--ext/tk/sample/msgs_rb/en_gb.msg7
-rw-r--r--ext/tk/sample/msgs_rb/eo.msg87
-rw-r--r--ext/tk/sample/msgs_rb/es.msg84
-rw-r--r--ext/tk/sample/msgs_rb/fr.msg84
-rw-r--r--ext/tk/sample/msgs_rb/it.msg84
-rw-r--r--ext/tk/sample/msgs_rb/ja.msg13
-rw-r--r--ext/tk/sample/msgs_rb/nl.msg123
-rw-r--r--ext/tk/sample/msgs_rb/pl.msg87
-rw-r--r--ext/tk/sample/msgs_rb/ru.msg87
-rw-r--r--ext/tk/sample/msgs_rb2/README5
-rw-r--r--ext/tk/sample/msgs_rb2/de.msg88
-rw-r--r--ext/tk/sample/msgs_rb2/ja.msg85
-rw-r--r--ext/tk/sample/msgs_tk/README4
-rw-r--r--ext/tk/sample/msgs_tk/cs.msg84
-rw-r--r--ext/tk/sample/msgs_tk/de.msg88
-rw-r--r--ext/tk/sample/msgs_tk/el.msg103
-rw-r--r--ext/tk/sample/msgs_tk/en.msg83
-rw-r--r--ext/tk/sample/msgs_tk/en_gb.msg7
-rw-r--r--ext/tk/sample/msgs_tk/eo.msg87
-rw-r--r--ext/tk/sample/msgs_tk/es.msg84
-rw-r--r--ext/tk/sample/msgs_tk/fr.msg84
-rw-r--r--ext/tk/sample/msgs_tk/it.msg84
-rw-r--r--ext/tk/sample/msgs_tk/ja.msg13
-rw-r--r--ext/tk/sample/msgs_tk/license.terms39
-rw-r--r--ext/tk/sample/msgs_tk/nl.msg123
-rw-r--r--ext/tk/sample/msgs_tk/pl.msg87
-rw-r--r--ext/tk/sample/msgs_tk/ru.msg87
-rw-r--r--ext/tk/sample/multi-ip_sample.rb103
-rw-r--r--ext/tk/sample/multi-ip_sample2.rb29
-rw-r--r--ext/tk/sample/optobj_sample.rb67
-rw-r--r--ext/tk/sample/propagate.rb30
-rw-r--r--ext/tk/sample/remote-ip_sample.rb33
-rw-r--r--ext/tk/sample/remote-ip_sample2.rb56
-rw-r--r--ext/tk/sample/resource.en13
-rw-r--r--ext/tk/sample/resource.ja13
-rw-r--r--ext/tk/sample/safe-tk.rb134
-rw-r--r--ext/tk/sample/scrollframe.rb247
-rw-r--r--ext/tk/sample/tcltklib/batsu.gifbin538 -> 0 bytes-rw-r--r--ext/tk/sample/tcltklib/lines0.tcl42
-rw-r--r--ext/tk/sample/tcltklib/lines1.rb50
-rw-r--r--ext/tk/sample/tcltklib/lines2.rb54
-rw-r--r--ext/tk/sample/tcltklib/lines3.rb54
-rw-r--r--ext/tk/sample/tcltklib/lines4.rb54
-rw-r--r--ext/tk/sample/tcltklib/maru.gifbin481 -> 0 bytes-rw-r--r--ext/tk/sample/tcltklib/safeTk.rb22
-rw-r--r--ext/tk/sample/tcltklib/sample0.rb39
-rw-r--r--ext/tk/sample/tcltklib/sample1.rb634
-rw-r--r--ext/tk/sample/tcltklib/sample2.rb451
-rw-r--r--ext/tk/sample/tkalignbox.rb235
-rw-r--r--ext/tk/sample/tkballoonhelp.rb220
-rw-r--r--ext/tk/sample/tkbiff.rb155
-rw-r--r--ext/tk/sample/tkbrowse.rb79
-rw-r--r--ext/tk/sample/tkcombobox.rb497
-rw-r--r--ext/tk/sample/tkdialog.rb61
-rw-r--r--ext/tk/sample/tkextlib/ICONS/Orig_LICENSE.txt61
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons195
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons-sample.kde658
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons.kde195
-rw-r--r--ext/tk/sample/tkextlib/ICONS/viewIcons.rb329
-rw-r--r--ext/tk/sample/tkextlib/blt/barchart5.rb101
-rw-r--r--ext/tk/sample/tkextlib/blt/calendar.rb117
-rw-r--r--ext/tk/sample/tkextlib/blt/graph6.rb2222
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7.rb40
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7a.rb63
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7b.rb41
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7c.rb45
-rw-r--r--ext/tk/sample/tkextlib/blt/images/buckskin.gifbin7561 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/chalk.gifbin4378 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/qv100.t.gifbin2694 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/rain.gifbin3785 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/sample.gifbin186103 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/pareto.rb90
-rw-r--r--ext/tk/sample/tkextlib/blt/plot1.rb9
-rw-r--r--ext/tk/sample/tkextlib/blt/plot1b.rb10
-rw-r--r--ext/tk/sample/tkextlib/blt/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/blt/scripts/stipples.rb156
-rw-r--r--ext/tk/sample/tkextlib/blt/winop1.rb40
-rw-r--r--ext/tk/sample/tkextlib/blt/winop2.rb28
-rw-r--r--ext/tk/sample/tkextlib/bwidget/Orig_LICENSE.txt53
-rw-r--r--ext/tk/sample/tkextlib/bwidget/basic.rb198
-rw-r--r--ext/tk/sample/tkextlib/bwidget/bwidget.xbm46
-rw-r--r--ext/tk/sample/tkextlib/bwidget/demo.rb243
-rw-r--r--ext/tk/sample/tkextlib/bwidget/dnd.rb46
-rw-r--r--ext/tk/sample/tkextlib/bwidget/manager.rb150
-rw-r--r--ext/tk/sample/tkextlib/bwidget/select.rb82
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tmpldlg.rb221
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tree.rb289
-rw-r--r--ext/tk/sample/tkextlib/bwidget/x1.xbm2258
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/Orig_LICENSE.txt42
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/box.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/clear.gifbin279 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/close.gifbin249 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/copy.gifbin269 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/cut.gifbin179 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/exit.gifbin396 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/find.gifbin386 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/help.gifbin591 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/line.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/mag.gifbin183 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/new.gifbin212 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/open.gifbin258 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/oval.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/paste.gifbin376 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/points.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/poly.gifbin141 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/print.gifbin263 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/ruler.gifbin174 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/save.gifbin270 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/select.gifbin124 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/text.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/buttonbox.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/calendar.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/canvasprintbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/canvasprintdialog.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/checkbox.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/combobox.rb32
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dateentry.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/datefield.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dialog.rb20
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dialogshell.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/disjointlistbox.rb16
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-1.rb39
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-2.rb44
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-3.rb40
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extbutton.rb20
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extfileselectionbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extfileselectiondialog.rb29
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/feedback.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/fileselectionbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/fileselectiondialog.rb28
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/finddialog.rb15
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/hierarchy.rb25
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/hyperhelp.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/labeledframe.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/labeledwidget.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/mainwindow.rb64
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar.rb124
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar2.rb44
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox1.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox2.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagedialog.rb44
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook2.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/optionmenu.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow2.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/promptdialog.rb17
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/pushbutton.rb9
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/radiobox.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledcanvas.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledframe.rb18
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledhtml.rb15
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledlistbox.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledtext.rb11
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectionbox.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectiondialog.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/shell.rb17
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spindate.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinint.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinner.rb33
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spintime.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook.rb26
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook2.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabset.rb34
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/timeentry.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/timefield.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/toolbar.rb152
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/watch.rb18
-rw-r--r--ext/tk/sample/tkextlib/tcllib/Orig_LICENSE.txt46
-rw-r--r--ext/tk/sample/tkextlib/tcllib/datefield.rb29
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos1.rb158
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos2.rb71
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos3.rb83
-rw-r--r--ext/tk/sample/tkextlib/tcllib/xyplot.rb17
-rw-r--r--ext/tk/sample/tkextlib/tile/Orig_LICENSE.txt30
-rw-r--r--ext/tk/sample/tkextlib/tile/demo.rb983
-rw-r--r--ext/tk/sample/tkextlib/tile/iconlib.tcl110
-rw-r--r--ext/tk/sample/tkextlib/tile/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/tile/repeater.tcl117
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue.tcl149
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowdown-h.gifbin315 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowdown-p.gifbin312 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowdown.gifbin313 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowleft-h.gifbin329 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowleft-p.gifbin327 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowleft.gifbin323 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowright-h.gifbin330 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowright-p.gifbin327 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowright.gifbin324 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowup-h.gifbin309 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowup-p.gifbin313 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowup.gifbin314 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-h.gifbin696 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-n.gifbin770 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-n.xcfbin1942 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-p.gifbin769 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-hc.gifbin254 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-hu.gifbin234 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-nc.gifbin249 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-nu.gifbin229 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-hc.gifbin1098 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-hu.gifbin626 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-nc.gifbin389 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-nu.gifbin401 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-thumb-p.gifbin343 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-thumb.gifbin316 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-vthumb-p.gifbin333 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-vthumb.gifbin308 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/slider-p.gifbin182 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/slider.gifbin182 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/vslider-p.gifbin183 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/vslider.gifbin283 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/pkgIndex.tcl6
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik.tcl194
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowdown-n.gifbin273 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowdown-p.gifbin258 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowleft-n.gifbin292 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowleft-p.gifbin272 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowright-n.gifbin274 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowright-p.gifbin258 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowup-n.gifbin286 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowup-p.gifbin271 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-d.gifbin1266 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-h.gifbin896 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-n.gifbin881 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-p.gifbin625 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-s.gifbin859 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/check-c.gifbin434 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/check-u.gifbin423 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/hsb-n.gifbin401 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/hsb-p.gifbin395 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/hslider-n.gifbin592 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-a.gifbin1116 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-arrow-n.gifbin61 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-d.gifbin1057 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-n.gifbin1095 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/radio-c.gifbin695 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/radio-u.gifbin686 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tab-n.gifbin383 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tab-p.gifbin878 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tbar-a.gifbin907 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tbar-n.gifbin238 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tbar-p.gifbin927 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/vsb-n.gifbin405 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/vsb-p.gifbin399 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/vslider-n.gifbin587 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/pkgIndex.tcl15
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc.rb226
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc.tcl163
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/button-h.gifbin522 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/button-n.gifbin554 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/button-p.gifbin548 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-hc.gifbin281 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-hu.gifbin273 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-nc.gifbin303 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-nu.gifbin294 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-hc.gifbin652 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-hu.gifbin644 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-nc.gifbin632 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-nu.gifbin621 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/pkgIndex.tcl15
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/pkgIndex.tcl16
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik.tcl125
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowdown-n.gifbin362 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowdown-p.gifbin250 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowleft-n.gifbin378 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowleft-p.gifbin267 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowright-n.gifbin379 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowright-p.gifbin266 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowup-n.gifbin363 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowup-p.gifbin251 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/button-h.gifbin439 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/button-n.gifbin443 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/button-p.gifbin302 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-hc.gifbin169 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-hu.gifbin170 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-nc.gifbin235 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-nu.gifbin226 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-pc.gifbin169 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/hsb-n.gifbin269 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/hslider-n.gifbin342 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-hc.gifbin178 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-hu.gifbin179 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-nc.gifbin236 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-nu.gifbin178 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-pc.gifbin178 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/vsb-n.gifbin366 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/vslider-n.gifbin336 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/toolbutton.tcl152
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/Orig_COPYRIGHT.txt12
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/README12
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/hv.rb313
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image1bin8995 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image10bin3095 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image11bin1425 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image12bin2468 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image13bin4073 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image14bin53 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image2bin42 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image3bin3473 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image4bin1988 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image5bin973 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image6bin2184 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image7bin2022 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image8bin1186 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image9bin139 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/index.html115
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image1bin1966 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image10bin255 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image11bin590 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image12bin254 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image13bin493 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image14bin195 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image15bin68 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image16bin157 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image17bin81 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image18bin545 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image19bin53 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image2bin49 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image20bin533 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image21bin564 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image22bin81 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image23bin539 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image24bin151 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image25bin453 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image26bin520 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image27bin565 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image28bin416 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image29bin121 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image3bin10835 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image30bin663 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image31bin78 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image32bin556 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image33bin598 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image34bin496 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image35bin724 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image36bin404 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image37bin124 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image38bin8330 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image39bin369 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image4bin268 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image5bin492 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image6bin246 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image7bin551 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image8bin497 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image9bin492 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/index.html433
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image1bin113 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image10bin5088 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image11bin4485 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image12bin3579 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image13bin5119 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image14bin3603 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image2bin74 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image3bin681 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image4bin3056 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image5bin2297 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image6bin79 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image7bin1613 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image8bin864 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image9bin2379 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/index.html2787
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image1bin42 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image2bin14343 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image3bin17750 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image4bin61 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image5bin201 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image6bin214 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image7bin149 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image8bin203 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image9bin1504 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/index.html768
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/ss.rb436
-rw-r--r--ext/tk/sample/tkextlib/tkimg/demo.rb1478
-rw-r--r--ext/tk/sample/tkextlib/tkimg/license_terms_of_Img_extension41
-rw-r--r--ext/tk/sample/tkextlib/tkimg/readme.txt3
-rw-r--r--ext/tk/sample/tkextlib/tktable/Orig_LICENSE.txt52
-rw-r--r--ext/tk/sample/tkextlib/tktable/basic.rb60
-rw-r--r--ext/tk/sample/tkextlib/tktable/buttons.rb76
-rw-r--r--ext/tk/sample/tkextlib/tktable/command.rb89
-rw-r--r--ext/tk/sample/tkextlib/tktable/debug.rb101
-rw-r--r--ext/tk/sample/tkextlib/tktable/dynarows.rb99
-rw-r--r--ext/tk/sample/tkextlib/tktable/maxsize.rb67
-rw-r--r--ext/tk/sample/tkextlib/tktable/spreadsheet.rb137
-rw-r--r--ext/tk/sample/tkextlib/tktable/tcllogo.gifbin2341 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tktable/valid.rb88
-rw-r--r--ext/tk/sample/tkextlib/treectrl/bitmaps.rb76
-rw-r--r--ext/tk/sample/tkextlib/treectrl/demo.rb1305
-rw-r--r--ext/tk/sample/tkextlib/treectrl/explorer.rb430
-rw-r--r--ext/tk/sample/tkextlib/treectrl/help.rb404
-rw-r--r--ext/tk/sample/tkextlib/treectrl/imovie.rb130
-rw-r--r--ext/tk/sample/tkextlib/treectrl/layout.rb159
-rw-r--r--ext/tk/sample/tkextlib/treectrl/mailwasher.rb269
-rw-r--r--ext/tk/sample/tkextlib/treectrl/outlook-folders.rb124
-rw-r--r--ext/tk/sample/tkextlib/treectrl/outlook-newgroup.rb448
-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-dll.gifbin437 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-exe.gifbin368 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-file.gifbin466 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-folder.gifbin459 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-txt.gifbin392 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/checked.gifbin78 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/file.gifbin279 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/folder-closed.gifbin111 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/folder-open.gifbin120 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/help-book-closed.gifbin115 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/help-book-open.gifbin128 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/help-page.gifbin132 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-01.gifbin5406 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-02.gifbin5912 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-03.gifbin4696 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-04.gifbin5783 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-05.gifbin3238 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-06.gifbin3509 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-07.gifbin2091 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-check-off.gifbin70 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-check-on.gifbin76 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-print.gifbin124 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-radio-off.gifbin68 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-radio-on.gifbin71 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-search.gifbin114 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-security.gifbin108 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/mac-collapse.gifbin275 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/mac-expand.gifbin277 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-arrow.gifbin73 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-clip.gifbin73 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-deleted.gifbin138 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-draft.gifbin134 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-folder.gifbin133 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-group.gifbin144 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-inbox.gifbin133 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-local.gifbin146 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-main.gifbin174 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-outbox.gifbin136 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-read-2.gifbin343 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-read.gifbin304 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-sent.gifbin132 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-server.gifbin163 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-unread.gifbin303 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-watch.gifbin98 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/sky.gifbin6454 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-dll.gifbin311 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-exe.gifbin115 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-file.gifbin338 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-folder.gifbin307 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-txt.gifbin302 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/unchecked.gifbin72 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/random.rb508
-rw-r--r--ext/tk/sample/tkextlib/treectrl/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/treectrl/www-options.rb303
-rw-r--r--ext/tk/sample/tkextlib/vu/Orig_LICENSE.txt51
-rw-r--r--ext/tk/sample/tkextlib/vu/README.txt50
-rw-r--r--ext/tk/sample/tkextlib/vu/canvItems.rb90
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker.rb82
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker2.rb101
-rw-r--r--ext/tk/sample/tkextlib/vu/dial_demo.rb113
-rw-r--r--ext/tk/sample/tkextlib/vu/m128_000.xbm174
-rw-r--r--ext/tk/sample/tkextlib/vu/oscilloscope.rb68
-rw-r--r--ext/tk/sample/tkextlib/vu/pie.rb56
-rw-r--r--ext/tk/sample/tkextlib/vu/vu_demo.rb67
-rw-r--r--ext/tk/sample/tkfrom.rb132
-rw-r--r--ext/tk/sample/tkhello.rb10
-rw-r--r--ext/tk/sample/tkline.rb47
-rw-r--r--ext/tk/sample/tkmenubutton.rb135
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb.rb102
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb2.rb102
-rw-r--r--ext/tk/sample/tkmsgcat-load_tk.rb118
-rw-r--r--ext/tk/sample/tkmulticolumnlist.rb743
-rw-r--r--ext/tk/sample/tkmultilistbox.rb654
-rw-r--r--ext/tk/sample/tkmultilistframe.rb940
-rw-r--r--ext/tk/sample/tkoptdb-safeTk.rb73
-rw-r--r--ext/tk/sample/tkoptdb.rb106
-rw-r--r--ext/tk/sample/tkrttimer.rb77
-rw-r--r--ext/tk/sample/tksleep_sample.rb29
-rw-r--r--ext/tk/sample/tktextframe.rb281
-rw-r--r--ext/tk/sample/tktextio.rb1060
-rw-r--r--ext/tk/sample/tktimer.rb50
-rw-r--r--ext/tk/sample/tktimer2.rb47
-rw-r--r--ext/tk/sample/tktimer3.rb59
-rw-r--r--ext/tk/sample/tktree.rb103
-rw-r--r--ext/tk/sample/tktree.tcl305
-rw-r--r--ext/tk/sample/ttk_wrapper.rb154
-rw-r--r--ext/tk/stubs.c594
-rw-r--r--ext/tk/stubs.h33
-rw-r--r--ext/tk/tcltklib.c11070
-rw-r--r--ext/tk/tkutil/depend1
-rw-r--r--ext/tk/tkutil/extconf.rb18
-rw-r--r--ext/tk/tkutil/tkutil.c1861
-rw-r--r--ext/win32/depend2
-rw-r--r--ext/win32/extconf.rb4
-rw-r--r--ext/win32/lib/win32/registry.rb910
-rw-r--r--ext/win32/lib/win32/resolv.rb135
-rw-r--r--ext/win32/lib/win32/sspi.rb338
-rw-r--r--ext/win32/resolv/depend17
-rw-r--r--ext/win32/resolv/extconf.rb3
-rw-r--r--ext/win32/resolv/resolv.c65
-rw-r--r--ext/win32ole/depend13
-rw-r--r--ext/win32ole/extconf.rb25
-rw-r--r--ext/win32ole/lib/win32ole.rb45
-rw-r--r--ext/win32ole/lib/win32ole/property.rb1
-rw-r--r--ext/win32ole/sample/excel1.rb10
-rw-r--r--ext/win32ole/sample/excel2.rb13
-rw-r--r--ext/win32ole/sample/excel3.rb10
-rw-r--r--ext/win32ole/sample/ie.rb3
-rw-r--r--ext/win32ole/sample/ieconst.rb1
-rw-r--r--ext/win32ole/sample/ienavi.rb7
-rw-r--r--ext/win32ole/sample/ienavi2.rb1
-rw-r--r--ext/win32ole/sample/oledirs.rb1
-rw-r--r--ext/win32ole/sample/olegen.rb9
-rw-r--r--ext/win32ole/sample/xml.rb13
-rw-r--r--ext/win32ole/win32ole.c6786
-rw-r--r--ext/win32ole/win32ole.gemspec22
-rw-r--r--ext/win32ole/win32ole.h155
-rw-r--r--ext/win32ole/win32ole_error.c87
-rw-r--r--ext/win32ole/win32ole_error.h9
-rw-r--r--ext/win32ole/win32ole_event.c1278
-rw-r--r--ext/win32ole/win32ole_event.h6
-rw-r--r--ext/win32ole/win32ole_method.c953
-rw-r--r--ext/win32ole/win32ole_method.h16
-rw-r--r--ext/win32ole/win32ole_param.c439
-rw-r--r--ext/win32ole/win32ole_param.h8
-rw-r--r--ext/win32ole/win32ole_record.c607
-rw-r--r--ext/win32ole/win32ole_record.h10
-rw-r--r--ext/win32ole/win32ole_type.c918
-rw-r--r--ext/win32ole/win32ole_type.h8
-rw-r--r--ext/win32ole/win32ole_typelib.c847
-rw-r--r--ext/win32ole/win32ole_typelib.h11
-rw-r--r--ext/win32ole/win32ole_variable.c384
-rw-r--r--ext/win32ole/win32ole_variable.h8
-rw-r--r--ext/win32ole/win32ole_variant.c736
-rw-r--r--ext/win32ole/win32ole_variant.h9
-rw-r--r--ext/win32ole/win32ole_variant_m.c151
-rw-r--r--ext/win32ole/win32ole_variant_m.h7
-rw-r--r--ext/zlib/.gitignore1
-rw-r--r--ext/zlib/depend176
-rw-r--r--ext/zlib/extconf.rb99
-rw-r--r--ext/zlib/zlib.c2193
-rw-r--r--ext/zlib/zlib.gemspec31
-rw-r--r--file.c5726
-rw-r--r--gc.c16000
-rw-r--r--gc.h89
-rw-r--r--gc.rb296
-rw-r--r--gem_prelude.rb27
-rw-r--r--gems/bundled_gems16
-rw-r--r--gems/lib/core_assertions.rb1
-rw-r--r--gems/lib/envutil.rb1
-rw-r--r--gems/lib/rake/extensiontask.rb12
-rw-r--r--golf_prelude.rb52
-rw-r--r--goruby.c50
-rw-r--r--hash.c7556
-rw-r--r--hrtime.h227
-rw-r--r--ia64.s42
-rw-r--r--id.c51
-rw-r--r--id_table.c326
-rw-r--r--id_table.h39
-rw-r--r--include/ruby.h32
-rw-r--r--include/ruby/assert.h234
-rw-r--r--include/ruby/atomic.h890
-rw-r--r--include/ruby/backward.h25
-rw-r--r--include/ruby/backward/2/assume.h56
-rw-r--r--include/ruby/backward/2/attributes.h165
-rw-r--r--include/ruby/backward/2/bool.h36
-rw-r--r--include/ruby/backward/2/gcc_version_since.h37
-rw-r--r--include/ruby/backward/2/inttypes.h131
-rw-r--r--include/ruby/backward/2/limits.h99
-rw-r--r--include/ruby/backward/2/long_long.h73
-rw-r--r--include/ruby/backward/2/r_cast.h32
-rw-r--r--include/ruby/backward/2/rmodule.h36
-rw-r--r--include/ruby/backward/2/stdalign.h30
-rw-r--r--include/ruby/backward/2/stdarg.h69
-rw-r--r--include/ruby/backward/cxxanyargs.hpp700
-rw-r--r--include/ruby/backward/rubyio.h6
-rw-r--r--include/ruby/backward/rubysig.h48
-rw-r--r--include/ruby/backward/st.h6
-rw-r--r--include/ruby/backward/util.h6
-rw-r--r--include/ruby/debug.h667
-rw-r--r--include/ruby/defines.h376
-rw-r--r--include/ruby/encoding.h358
-rw-r--r--include/ruby/fiber/scheduler.h374
-rw-r--r--include/ruby/intern.h936
-rw-r--r--include/ruby/internal/abi.h58
-rw-r--r--include/ruby/internal/anyargs.h376
-rw-r--r--include/ruby/internal/arithmetic.h39
-rw-r--r--include/ruby/internal/arithmetic/char.h81
-rw-r--r--include/ruby/internal/arithmetic/double.h72
-rw-r--r--include/ruby/internal/arithmetic/fixnum.h60
-rw-r--r--include/ruby/internal/arithmetic/gid_t.h41
-rw-r--r--include/ruby/internal/arithmetic/int.h264
-rw-r--r--include/ruby/internal/arithmetic/intptr_t.h74
-rw-r--r--include/ruby/internal/arithmetic/long.h356
-rw-r--r--include/ruby/internal/arithmetic/long_long.h135
-rw-r--r--include/ruby/internal/arithmetic/mode_t.h41
-rw-r--r--include/ruby/internal/arithmetic/off_t.h62
-rw-r--r--include/ruby/internal/arithmetic/pid_t.h41
-rw-r--r--include/ruby/internal/arithmetic/short.h113
-rw-r--r--include/ruby/internal/arithmetic/size_t.h66
-rw-r--r--include/ruby/internal/arithmetic/st_data_t.h75
-rw-r--r--include/ruby/internal/arithmetic/uid_t.h41
-rw-r--r--include/ruby/internal/assume.h87
-rw-r--r--include/ruby/internal/attr/alloc_size.h32
-rw-r--r--include/ruby/internal/attr/artificial.h46
-rw-r--r--include/ruby/internal/attr/cold.h37
-rw-r--r--include/ruby/internal/attr/const.h46
-rw-r--r--include/ruby/internal/attr/constexpr.h84
-rw-r--r--include/ruby/internal/attr/deprecated.h75
-rw-r--r--include/ruby/internal/attr/diagnose_if.h42
-rw-r--r--include/ruby/internal/attr/enum_extensibility.h32
-rw-r--r--include/ruby/internal/attr/error.h32
-rw-r--r--include/ruby/internal/attr/flag_enum.h33
-rw-r--r--include/ruby/internal/attr/forceinline.h40
-rw-r--r--include/ruby/internal/attr/format.h38
-rw-r--r--include/ruby/internal/attr/maybe_unused.h38
-rw-r--r--include/ruby/internal/attr/noalias.h69
-rw-r--r--include/ruby/internal/attr/nodiscard.h45
-rw-r--r--include/ruby/internal/attr/noexcept.h91
-rw-r--r--include/ruby/internal/attr/noinline.h35
-rw-r--r--include/ruby/internal/attr/nonnull.h34
-rw-r--r--include/ruby/internal/attr/noreturn.h48
-rw-r--r--include/ruby/internal/attr/pure.h43
-rw-r--r--include/ruby/internal/attr/restrict.h44
-rw-r--r--include/ruby/internal/attr/returns_nonnull.h37
-rw-r--r--include/ruby/internal/attr/warning.h32
-rw-r--r--include/ruby/internal/attr/weakref.h32
-rw-r--r--include/ruby/internal/cast.h50
-rw-r--r--include/ruby/internal/compiler_is.h45
-rw-r--r--include/ruby/internal/compiler_is/apple.h40
-rw-r--r--include/ruby/internal/compiler_is/clang.h37
-rw-r--r--include/ruby/internal/compiler_is/gcc.h45
-rw-r--r--include/ruby/internal/compiler_is/intel.h40
-rw-r--r--include/ruby/internal/compiler_is/msvc.h56
-rw-r--r--include/ruby/internal/compiler_is/sunpro.h54
-rw-r--r--include/ruby/internal/compiler_since.h61
-rw-r--r--include/ruby/internal/config.h155
-rw-r--r--include/ruby/internal/constant_p.h38
-rw-r--r--include/ruby/internal/core.h35
-rw-r--r--include/ruby/internal/core/rarray.h585
-rw-r--r--include/ruby/internal/core/rbasic.h158
-rw-r--r--include/ruby/internal/core/rbignum.h80
-rw-r--r--include/ruby/internal/core/rclass.h93
-rw-r--r--include/ruby/internal/core/rdata.h386
-rw-r--r--include/ruby/internal/core/rfile.h51
-rw-r--r--include/ruby/internal/core/rhash.h144
-rw-r--r--include/ruby/internal/core/rmatch.h146
-rw-r--r--include/ruby/internal/core/robject.h176
-rw-r--r--include/ruby/internal/core/rregexp.h168
-rw-r--r--include/ruby/internal/core/rstring.h578
-rw-r--r--include/ruby/internal/core/rstruct.h121
-rw-r--r--include/ruby/internal/core/rtypeddata.h604
-rw-r--r--include/ruby/internal/ctype.h545
-rw-r--r--include/ruby/internal/dllexport.h112
-rw-r--r--include/ruby/internal/dosish.h89
-rw-r--r--include/ruby/internal/encoding/coderange.h202
-rw-r--r--include/ruby/internal/encoding/ctype.h258
-rw-r--r--include/ruby/internal/encoding/encoding.h1060
-rw-r--r--include/ruby/internal/encoding/pathname.h184
-rw-r--r--include/ruby/internal/encoding/re.h46
-rw-r--r--include/ruby/internal/encoding/sprintf.h78
-rw-r--r--include/ruby/internal/encoding/string.h346
-rw-r--r--include/ruby/internal/encoding/symbol.h100
-rw-r--r--include/ruby/internal/encoding/transcode.h562
-rw-r--r--include/ruby/internal/error.h582
-rw-r--r--include/ruby/internal/eval.h400
-rw-r--r--include/ruby/internal/event.h154
-rw-r--r--include/ruby/internal/fl_type.h948
-rw-r--r--include/ruby/internal/gc.h57
-rw-r--r--include/ruby/internal/glob.h113
-rw-r--r--include/ruby/internal/globals.h209
-rw-r--r--include/ruby/internal/has/attribute.h163
-rw-r--r--include/ruby/internal/has/builtin.h117
-rw-r--r--include/ruby/internal/has/c_attribute.h38
-rw-r--r--include/ruby/internal/has/cpp_attribute.h86
-rw-r--r--include/ruby/internal/has/declspec_attribute.h47
-rw-r--r--include/ruby/internal/has/extension.h33
-rw-r--r--include/ruby/internal/has/feature.h31
-rw-r--r--include/ruby/internal/has/warning.h31
-rw-r--r--include/ruby/internal/intern/array.h657
-rw-r--r--include/ruby/internal/intern/bignum.h846
-rw-r--r--include/ruby/internal/intern/class.h394
-rw-r--r--include/ruby/internal/intern/compar.h62
-rw-r--r--include/ruby/internal/intern/complex.h253
-rw-r--r--include/ruby/internal/intern/cont.h282
-rw-r--r--include/ruby/internal/intern/dir.h42
-rw-r--r--include/ruby/internal/intern/enum.h73
-rw-r--r--include/ruby/internal/intern/enumerator.h259
-rw-r--r--include/ruby/internal/intern/error.h287
-rw-r--r--include/ruby/internal/intern/eval.h222
-rw-r--r--include/ruby/internal/intern/file.h213
-rw-r--r--include/ruby/internal/intern/gc.h392
-rw-r--r--include/ruby/internal/intern/hash.h320
-rw-r--r--include/ruby/internal/intern/io.h661
-rw-r--r--include/ruby/internal/intern/load.h218
-rw-r--r--include/ruby/internal/intern/marshal.h112
-rw-r--r--include/ruby/internal/intern/numeric.h208
-rw-r--r--include/ruby/internal/intern/object.h501
-rw-r--r--include/ruby/internal/intern/parse.h194
-rw-r--r--include/ruby/internal/intern/proc.h353
-rw-r--r--include/ruby/internal/intern/process.h273
-rw-r--r--include/ruby/internal/intern/random.h116
-rw-r--r--include/ruby/internal/intern/range.h89
-rw-r--r--include/ruby/internal/intern/rational.h172
-rw-r--r--include/ruby/internal/intern/re.h249
-rw-r--r--include/ruby/internal/intern/ruby.h77
-rw-r--r--include/ruby/internal/intern/select.h86
-rw-r--r--include/ruby/internal/intern/select/largesize.h214
-rw-r--r--include/ruby/internal/intern/select/posix.h144
-rw-r--r--include/ruby/internal/intern/select/win32.h259
-rw-r--r--include/ruby/internal/intern/signal.h152
-rw-r--r--include/ruby/internal/intern/sprintf.h159
-rw-r--r--include/ruby/internal/intern/string.h1757
-rw-r--r--include/ruby/internal/intern/struct.h203
-rw-r--r--include/ruby/internal/intern/thread.h492
-rw-r--r--include/ruby/internal/intern/time.h161
-rw-r--r--include/ruby/internal/intern/variable.h628
-rw-r--r--include/ruby/internal/intern/vm.h431
-rw-r--r--include/ruby/internal/interpreter.h304
-rw-r--r--include/ruby/internal/iterator.h513
-rw-r--r--include/ruby/internal/memory.h666
-rw-r--r--include/ruby/internal/method.h205
-rw-r--r--include/ruby/internal/module.h177
-rw-r--r--include/ruby/internal/newobj.h195
-rw-r--r--include/ruby/internal/rgengc.h443
-rw-r--r--include/ruby/internal/scan_args.h534
-rw-r--r--include/ruby/internal/special_consts.h362
-rw-r--r--include/ruby/internal/static_assert.h77
-rw-r--r--include/ruby/internal/stdalign.h135
-rw-r--r--include/ruby/internal/stdbool.h51
-rw-r--r--include/ruby/internal/symbol.h332
-rw-r--r--include/ruby/internal/value.h133
-rw-r--r--include/ruby/internal/value_type.h449
-rw-r--r--include/ruby/internal/variable.h337
-rw-r--r--include/ruby/internal/warning_push.h124
-rw-r--r--include/ruby/internal/xmalloc.h392
-rw-r--r--include/ruby/io.h1059
-rw-r--r--include/ruby/io/buffer.h92
-rw-r--r--include/ruby/memory_view.h325
-rw-r--r--include/ruby/missing.h277
-rw-r--r--include/ruby/onigmo.h952
-rw-r--r--include/ruby/oniguruma.h807
-rw-r--r--include/ruby/ractor.h264
-rw-r--r--include/ruby/random.h359
-rw-r--r--include/ruby/re.h202
-rw-r--r--include/ruby/regex.h29
-rw-r--r--include/ruby/ruby.h1701
-rw-r--r--include/ruby/st.h198
-rw-r--r--include/ruby/subst.h10
-rw-r--r--include/ruby/thread.h235
-rw-r--r--include/ruby/thread_native.h205
-rw-r--r--include/ruby/util.h295
-rw-r--r--include/ruby/version.h167
-rw-r--r--include/ruby/vm.h66
-rw-r--r--include/ruby/win32.h489
-rw-r--r--inits.c59
-rw-r--r--insns.def2362
-rw-r--r--internal.h113
-rw-r--r--internal/array.h163
-rw-r--r--internal/basic_operators.h64
-rw-r--r--internal/bignum.h246
-rw-r--r--internal/bits.h565
-rw-r--r--internal/class.h187
-rw-r--r--internal/cmdlineopt.h61
-rw-r--r--internal/compar.h29
-rw-r--r--internal/compile.h35
-rw-r--r--internal/compilers.h107
-rw-r--r--internal/complex.h29
-rw-r--r--internal/cont.h32
-rw-r--r--internal/dir.h16
-rw-r--r--internal/enc.h19
-rw-r--r--internal/encoding.h32
-rw-r--r--internal/enum.h18
-rw-r--r--internal/enumerator.h21
-rw-r--r--internal/error.h191
-rw-r--r--internal/eval.h33
-rw-r--r--internal/file.h38
-rw-r--r--internal/fixnum.h184
-rw-r--r--internal/gc.h192
-rw-r--r--internal/hash.h243
-rw-r--r--internal/imemo.h242
-rw-r--r--internal/inits.h50
-rw-r--r--internal/io.h38
-rw-r--r--internal/load.h18
-rw-r--r--internal/loadpath.h16
-rw-r--r--internal/math.h23
-rw-r--r--internal/missing.h18
-rw-r--r--internal/numeric.h275
-rw-r--r--internal/object.h61
-rw-r--r--internal/parse.h25
-rw-r--r--internal/proc.h32
-rw-r--r--internal/process.h137
-rw-r--r--internal/ractor.h6
-rw-r--r--internal/random.h16
-rw-r--r--internal/range.h40
-rw-r--r--internal/rational.h72
-rw-r--r--internal/re.h30
-rw-r--r--internal/sanitizers.h190
-rw-r--r--internal/serial.h23
-rw-r--r--internal/signal.h21
-rw-r--r--internal/static_assert.h16
-rw-r--r--internal/string.h147
-rw-r--r--internal/struct.h153
-rw-r--r--internal/symbol.h42
-rw-r--r--internal/thread.h56
-rw-r--r--internal/time.h34
-rw-r--r--internal/transcode.h20
-rw-r--r--internal/util.h27
-rw-r--r--internal/variable.h90
-rw-r--r--internal/vm.h134
-rw-r--r--internal/warnings.h16
-rw-r--r--io.c13608
-rw-r--r--io.rb123
-rw-r--r--io_buffer.c3507
-rw-r--r--iseq.c4400
-rw-r--r--iseq.h349
-rw-r--r--kernel.rb178
-rw-r--r--lex.c.blt218
-rw-r--r--lib/.document107
-rw-r--r--lib/English.gemspec22
-rw-r--r--lib/English.rb99
-rw-r--r--lib/README93
-rw-r--r--lib/abbrev.gemspec22
-rw-r--r--lib/abbrev.rb135
-rw-r--r--lib/base64.gemspec20
-rw-r--r--lib/base64.rb31
-rw-r--r--lib/benchmark.rb371
-rw-r--r--lib/benchmark/benchmark.gemspec29
-rw-r--r--lib/benchmark/version.rb4
-rw-r--r--lib/bundler.rb662
-rw-r--r--lib/bundler/.document1
-rw-r--r--lib/bundler/build_metadata.rb43
-rw-r--r--lib/bundler/bundler.gemspec43
-rw-r--r--lib/bundler/capistrano.rb22
-rw-r--r--lib/bundler/cli.rb894
-rw-r--r--lib/bundler/cli/add.rb47
-rw-r--r--lib/bundler/cli/binstubs.rb57
-rw-r--r--lib/bundler/cli/cache.rb43
-rw-r--r--lib/bundler/cli/check.rb40
-rw-r--r--lib/bundler/cli/clean.rb25
-rw-r--r--lib/bundler/cli/common.rb130
-rw-r--r--lib/bundler/cli/config.rb203
-rw-r--r--lib/bundler/cli/console.rb43
-rw-r--r--lib/bundler/cli/doctor.rb157
-rw-r--r--lib/bundler/cli/exec.rb88
-rw-r--r--lib/bundler/cli/fund.rb36
-rw-r--r--lib/bundler/cli/gem.rb465
-rw-r--r--lib/bundler/cli/info.rb94
-rw-r--r--lib/bundler/cli/init.rb51
-rw-r--r--lib/bundler/cli/inject.rb60
-rw-r--r--lib/bundler/cli/install.rb189
-rw-r--r--lib/bundler/cli/issue.rb41
-rw-r--r--lib/bundler/cli/list.rb66
-rw-r--r--lib/bundler/cli/lock.rb70
-rw-r--r--lib/bundler/cli/open.rb31
-rw-r--r--lib/bundler/cli/outdated.rb297
-rw-r--r--lib/bundler/cli/platform.rb48
-rw-r--r--lib/bundler/cli/plugin.rb41
-rw-r--r--lib/bundler/cli/pristine.rb52
-rw-r--r--lib/bundler/cli/remove.rb17
-rw-r--r--lib/bundler/cli/show.rb75
-rw-r--r--lib/bundler/cli/update.rb122
-rw-r--r--lib/bundler/cli/viz.rb31
-rw-r--r--lib/bundler/compact_index_client.rb119
-rw-r--r--lib/bundler/compact_index_client/cache.rb101
-rw-r--r--lib/bundler/compact_index_client/gem_parser.rb28
-rw-r--r--lib/bundler/compact_index_client/updater.rb117
-rw-r--r--lib/bundler/constants.rb7
-rw-r--r--lib/bundler/current_ruby.rb108
-rw-r--r--lib/bundler/definition.rb961
-rw-r--r--lib/bundler/dependency.rb97
-rw-r--r--lib/bundler/deployment.rb69
-rw-r--r--lib/bundler/deprecate.rb44
-rw-r--r--lib/bundler/digest.rb71
-rw-r--r--lib/bundler/dsl.rb583
-rw-r--r--lib/bundler/endpoint_specification.rb143
-rw-r--r--lib/bundler/env.rb150
-rw-r--r--lib/bundler/environment_preserver.rb86
-rw-r--r--lib/bundler/errors.rb175
-rw-r--r--lib/bundler/feature_flag.rb53
-rw-r--r--lib/bundler/fetcher.rb320
-rw-r--r--lib/bundler/fetcher/base.rb50
-rw-r--r--lib/bundler/fetcher/compact_index.rb133
-rw-r--r--lib/bundler/fetcher/dependency.rb78
-rw-r--r--lib/bundler/fetcher/downloader.rb89
-rw-r--r--lib/bundler/fetcher/index.rb25
-rw-r--r--lib/bundler/force_platform.rb18
-rw-r--r--lib/bundler/friendly_errors.rb126
-rw-r--r--lib/bundler/gem_helper.rb237
-rw-r--r--lib/bundler/gem_helpers.rb117
-rw-r--r--lib/bundler/gem_tasks.rb7
-rw-r--r--lib/bundler/gem_version_promoter.rb145
-rw-r--r--lib/bundler/graph.rb152
-rw-r--r--lib/bundler/index.rb175
-rw-r--r--lib/bundler/injector.rb287
-rw-r--r--lib/bundler/inline.rb73
-rw-r--r--lib/bundler/installer.rb267
-rw-r--r--lib/bundler/installer/gem_installer.rb84
-rw-r--r--lib/bundler/installer/parallel_installer.rb220
-rw-r--r--lib/bundler/installer/standalone.rb103
-rw-r--r--lib/bundler/lazy_specification.rb159
-rw-r--r--lib/bundler/lockfile_generator.rb95
-rw-r--r--lib/bundler/lockfile_parser.rb225
-rw-r--r--lib/bundler/man/.document1
-rw-r--r--lib/bundler/man/bundle-add.182
-rw-r--r--lib/bundler/man/bundle-add.1.ronn58
-rw-r--r--lib/bundler/man/bundle-binstubs.142
-rw-r--r--lib/bundler/man/bundle-binstubs.1.ronn41
-rw-r--r--lib/bundler/man/bundle-cache.161
-rw-r--r--lib/bundler/man/bundle-cache.1.ronn79
-rw-r--r--lib/bundler/man/bundle-check.131
-rw-r--r--lib/bundler/man/bundle-check.1.ronn26
-rw-r--r--lib/bundler/man/bundle-clean.124
-rw-r--r--lib/bundler/man/bundle-clean.1.ronn18
-rw-r--r--lib/bundler/man/bundle-config.1512
-rw-r--r--lib/bundler/man/bundle-config.1.ronn405
-rw-r--r--lib/bundler/man/bundle-console.153
-rw-r--r--lib/bundler/man/bundle-console.1.ronn44
-rw-r--r--lib/bundler/man/bundle-doctor.144
-rw-r--r--lib/bundler/man/bundle-doctor.1.ronn33
-rw-r--r--lib/bundler/man/bundle-exec.1165
-rw-r--r--lib/bundler/man/bundle-exec.1.ronn152
-rw-r--r--lib/bundler/man/bundle-gem.1105
-rw-r--r--lib/bundler/man/bundle-gem.1.ronn117
-rw-r--r--lib/bundler/man/bundle-help.113
-rw-r--r--lib/bundler/man/bundle-help.1.ronn12
-rw-r--r--lib/bundler/man/bundle-info.120
-rw-r--r--lib/bundler/man/bundle-info.1.ronn17
-rw-r--r--lib/bundler/man/bundle-init.129
-rw-r--r--lib/bundler/man/bundle-init.1.ronn31
-rw-r--r--lib/bundler/man/bundle-inject.136
-rw-r--r--lib/bundler/man/bundle-inject.1.ronn24
-rw-r--r--lib/bundler/man/bundle-install.1313
-rw-r--r--lib/bundler/man/bundle-install.1.ronn382
-rw-r--r--lib/bundler/man/bundle-list.150
-rw-r--r--lib/bundler/man/bundle-list.1.ronn33
-rw-r--r--lib/bundler/man/bundle-lock.184
-rw-r--r--lib/bundler/man/bundle-lock.1.ronn94
-rw-r--r--lib/bundler/man/bundle-open.152
-rw-r--r--lib/bundler/man/bundle-open.1.ronn27
-rw-r--r--lib/bundler/man/bundle-outdated.1152
-rw-r--r--lib/bundler/man/bundle-outdated.1.ronn105
-rw-r--r--lib/bundler/man/bundle-platform.171
-rw-r--r--lib/bundler/man/bundle-platform.1.ronn49
-rw-r--r--lib/bundler/man/bundle-plugin.181
-rw-r--r--lib/bundler/man/bundle-plugin.1.ronn59
-rw-r--r--lib/bundler/man/bundle-pristine.134
-rw-r--r--lib/bundler/man/bundle-pristine.1.ronn34
-rw-r--r--lib/bundler/man/bundle-remove.131
-rw-r--r--lib/bundler/man/bundle-remove.1.ronn23
-rw-r--r--lib/bundler/man/bundle-show.123
-rw-r--r--lib/bundler/man/bundle-show.1.ronn21
-rw-r--r--lib/bundler/man/bundle-update.1394
-rw-r--r--lib/bundler/man/bundle-update.1.ronn351
-rw-r--r--lib/bundler/man/bundle-version.135
-rw-r--r--lib/bundler/man/bundle-version.1.ronn24
-rw-r--r--lib/bundler/man/bundle-viz.142
-rw-r--r--lib/bundler/man/bundle-viz.1.ronn32
-rw-r--r--lib/bundler/man/bundle.1141
-rw-r--r--lib/bundler/man/bundle.1.ronn116
-rw-r--r--lib/bundler/man/gemfile.5736
-rw-r--r--lib/bundler/man/gemfile.5.ronn543
-rw-r--r--lib/bundler/man/index.txt29
-rw-r--r--lib/bundler/match_metadata.rb13
-rw-r--r--lib/bundler/match_platform.rb23
-rw-r--r--lib/bundler/match_remote_metadata.rb29
-rw-r--r--lib/bundler/mirror.rb221
-rw-r--r--lib/bundler/plugin.rb352
-rw-r--r--lib/bundler/plugin/api.rb81
-rw-r--r--lib/bundler/plugin/api/source.rb320
-rw-r--r--lib/bundler/plugin/dsl.rb53
-rw-r--r--lib/bundler/plugin/events.rb61
-rw-r--r--lib/bundler/plugin/index.rb185
-rw-r--r--lib/bundler/plugin/installer.rb112
-rw-r--r--lib/bundler/plugin/installer/git.rb34
-rw-r--r--lib/bundler/plugin/installer/rubygems.rb19
-rw-r--r--lib/bundler/plugin/source_list.rb31
-rw-r--r--lib/bundler/process_lock.rb24
-rw-r--r--lib/bundler/remote_specification.rb117
-rw-r--r--lib/bundler/resolver.rb427
-rw-r--r--lib/bundler/resolver/base.rb107
-rw-r--r--lib/bundler/resolver/candidate.rb94
-rw-r--r--lib/bundler/resolver/incompatibility.rb15
-rw-r--r--lib/bundler/resolver/package.rb72
-rw-r--r--lib/bundler/resolver/root.rb25
-rw-r--r--lib/bundler/resolver/spec_group.rb82
-rw-r--r--lib/bundler/retry.rb66
-rw-r--r--lib/bundler/ruby_dsl.rb24
-rw-r--r--lib/bundler/ruby_version.rb124
-rw-r--r--lib/bundler/rubygems_ext.rb355
-rw-r--r--lib/bundler/rubygems_gem_installer.rb172
-rw-r--r--lib/bundler/rubygems_integration.rb562
-rw-r--r--lib/bundler/runtime.rb307
-rw-r--r--lib/bundler/safe_marshal.rb31
-rw-r--r--lib/bundler/self_manager.rb168
-rw-r--r--lib/bundler/settings.rb507
-rw-r--r--lib/bundler/settings/validator.rb102
-rw-r--r--lib/bundler/setup.rb30
-rw-r--r--lib/bundler/shared_helpers.rb343
-rw-r--r--lib/bundler/similarity_detector.rb63
-rw-r--r--lib/bundler/source.rb114
-rw-r--r--lib/bundler/source/gemspec.rb18
-rw-r--r--lib/bundler/source/git.rb379
-rw-r--r--lib/bundler/source/git/git_proxy.rb426
-rw-r--r--lib/bundler/source/metadata.rb62
-rw-r--r--lib/bundler/source/path.rb260
-rw-r--r--lib/bundler/source/path/installer.rb53
-rw-r--r--lib/bundler/source/rubygems.rb512
-rw-r--r--lib/bundler/source/rubygems/remote.rb68
-rw-r--r--lib/bundler/source/rubygems_aggregate.rb68
-rw-r--r--lib/bundler/source_list.rb227
-rw-r--r--lib/bundler/source_map.rb71
-rw-r--r--lib/bundler/spec_set.rb216
-rw-r--r--lib/bundler/stub_specification.rb116
-rw-r--r--lib/bundler/templates/.document1
-rw-r--r--lib/bundler/templates/Executable27
-rw-r--r--lib/bundler/templates/Executable.bundler109
-rw-r--r--lib/bundler/templates/Executable.standalone14
-rw-r--r--lib/bundler/templates/Gemfile5
-rw-r--r--lib/bundler/templates/newgem/CHANGELOG.md.tt5
-rw-r--r--lib/bundler/templates/newgem/CODE_OF_CONDUCT.md.tt84
-rw-r--r--lib/bundler/templates/newgem/Cargo.toml.tt7
-rw-r--r--lib/bundler/templates/newgem/Gemfile.tt26
-rw-r--r--lib/bundler/templates/newgem/LICENSE.txt.tt21
-rw-r--r--lib/bundler/templates/newgem/README.md.tt45
-rw-r--r--lib/bundler/templates/newgem/Rakefile.tt67
-rw-r--r--lib/bundler/templates/newgem/bin/console.tt11
-rw-r--r--lib/bundler/templates/newgem/bin/setup.tt8
-rw-r--r--lib/bundler/templates/newgem/circleci/config.yml.tt25
-rw-r--r--lib/bundler/templates/newgem/exe/newgem.tt3
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/Cargo.toml.tt15
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/extconf-c.rb.tt10
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/extconf-rust.rb.tt6
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/newgem.c.tt9
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/newgem.h.tt6
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/src/lib.rs.tt12
-rw-r--r--lib/bundler/templates/newgem/github/workflows/main.yml.tt37
-rw-r--r--lib/bundler/templates/newgem/gitignore.tt23
-rw-r--r--lib/bundler/templates/newgem/gitlab-ci.yml.tt18
-rw-r--r--lib/bundler/templates/newgem/lib/newgem.rb.tt15
-rw-r--r--lib/bundler/templates/newgem/lib/newgem/version.rb.tt9
-rw-r--r--lib/bundler/templates/newgem/newgem.gemspec.tt51
-rw-r--r--lib/bundler/templates/newgem/rspec.tt3
-rw-r--r--lib/bundler/templates/newgem/rubocop.yml.tt13
-rw-r--r--lib/bundler/templates/newgem/sig/newgem.rbs.tt8
-rw-r--r--lib/bundler/templates/newgem/spec/newgem_spec.rb.tt11
-rw-r--r--lib/bundler/templates/newgem/spec/spec_helper.rb.tt15
-rw-r--r--lib/bundler/templates/newgem/standard.yml.tt3
-rw-r--r--lib/bundler/templates/newgem/test/minitest/test_helper.rb.tt6
-rw-r--r--lib/bundler/templates/newgem/test/minitest/test_newgem.rb.tt13
-rw-r--r--lib/bundler/templates/newgem/test/test-unit/newgem_test.rb.tt15
-rw-r--r--lib/bundler/templates/newgem/test/test-unit/test_helper.rb.tt6
-rw-r--r--lib/bundler/ui.rb9
-rw-r--r--lib/bundler/ui/rg_proxy.rb19
-rw-r--r--lib/bundler/ui/shell.rb165
-rw-r--r--lib/bundler/ui/silent.rb85
-rw-r--r--lib/bundler/uri_credentials_filter.rb43
-rw-r--r--lib/bundler/uri_normalizer.rb23
-rw-r--r--lib/bundler/vendor/.document1
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool.rb128
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/timed_stack.rb174
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/version.rb3
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/wrapper.rb56
-rw-r--r--lib/bundler/vendor/fileutils/lib/fileutils.rb2706
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent.rb1073
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/connection.rb40
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/pool.rb53
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/timed_stack_multi.rb79
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub.rb31
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/assignment.rb20
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/basic_package_source.rb189
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/failure_writer.rb182
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/incompatibility.rb150
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/package.rb43
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/partial_solution.rb121
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/rubygems.rb45
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/solve_failure.rb19
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/static_package_source.rb60
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/term.rb105
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version.rb3
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version_constraint.rb129
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version_range.rb411
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version_solver.rb248
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version_union.rb178
-rw-r--r--lib/bundler/vendor/thor/lib/thor.rb516
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions.rb340
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/create_file.rb104
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/create_link.rb61
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/directory.rb108
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/empty_directory.rb143
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/file_manipulation.rb375
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/inject_into_file.rb119
-rw-r--r--lib/bundler/vendor/thor/lib/thor/base.rb699
-rw-r--r--lib/bundler/vendor/thor/lib/thor/command.rb142
-rw-r--r--lib/bundler/vendor/thor/lib/thor/core_ext/hash_with_indifferent_access.rb103
-rw-r--r--lib/bundler/vendor/thor/lib/thor/error.rb115
-rw-r--r--lib/bundler/vendor/thor/lib/thor/group.rb281
-rw-r--r--lib/bundler/vendor/thor/lib/thor/invocation.rb178
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor.rb17
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor/basic.rb37
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor/readline.rb88
-rw-r--r--lib/bundler/vendor/thor/lib/thor/nested_context.rb29
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser.rb4
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/argument.rb70
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/arguments.rb179
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/option.rb159
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/options.rb255
-rw-r--r--lib/bundler/vendor/thor/lib/thor/rake_compat.rb72
-rw-r--r--lib/bundler/vendor/thor/lib/thor/runner.rb325
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell.rb81
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/basic.rb512
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/color.rb157
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/html.rb126
-rw-r--r--lib/bundler/vendor/thor/lib/thor/util.rb284
-rw-r--r--lib/bundler/vendor/thor/lib/thor/version.rb3
-rw-r--r--lib/bundler/vendor/tsort/lib/tsort.rb452
-rw-r--r--lib/bundler/vendor/uri/lib/uri.rb104
-rw-r--r--lib/bundler/vendor/uri/lib/uri/common.rb729
-rw-r--r--lib/bundler/vendor/uri/lib/uri/file.rb100
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ftp.rb267
-rw-r--r--lib/bundler/vendor/uri/lib/uri/generic.rb1587
-rw-r--r--lib/bundler/vendor/uri/lib/uri/http.rb125
-rw-r--r--lib/bundler/vendor/uri/lib/uri/https.rb23
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ldap.rb261
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ldaps.rb22
-rw-r--r--lib/bundler/vendor/uri/lib/uri/mailto.rb293
-rw-r--r--lib/bundler/vendor/uri/lib/uri/rfc2396_parser.rb539
-rw-r--r--lib/bundler/vendor/uri/lib/uri/rfc3986_parser.rb119
-rw-r--r--lib/bundler/vendor/uri/lib/uri/version.rb6
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ws.rb83
-rw-r--r--lib/bundler/vendor/uri/lib/uri/wss.rb23
-rw-r--r--lib/bundler/vendored_fileutils.rb4
-rw-r--r--lib/bundler/vendored_persistent.rb15
-rw-r--r--lib/bundler/vendored_pub_grub.rb4
-rw-r--r--lib/bundler/vendored_thor.rb8
-rw-r--r--lib/bundler/vendored_tsort.rb4
-rw-r--r--lib/bundler/vendored_uri.rb4
-rw-r--r--lib/bundler/version.rb13
-rw-r--r--lib/bundler/vlad.rb17
-rw-r--r--lib/bundler/worker.rb117
-rw-r--r--lib/bundler/yaml_serializer.rb89
-rw-r--r--lib/cgi.rb100
-rw-r--r--lib/cgi/.document1
-rw-r--r--lib/cgi/cgi.gemspec42
-rw-r--r--lib/cgi/cookie.rb240
-rw-r--r--lib/cgi/core.rb511
-rw-r--r--lib/cgi/html.rb328
-rw-r--r--lib/cgi/session.rb133
-rw-r--r--lib/cgi/session/pstore.rb33
-rw-r--r--lib/cgi/util.rb200
-rw-r--r--lib/cmath.rb254
-rw-r--r--lib/complex.rb28
-rw-r--r--lib/csv.rb4346
-rw-r--r--lib/csv/core_ext/array.rb9
-rw-r--r--lib/csv/core_ext/string.rb9
-rw-r--r--lib/csv/csv.gemspec64
-rw-r--r--lib/csv/delete_suffix.rb18
-rw-r--r--lib/csv/fields_converter.rb89
-rw-r--r--lib/csv/input_record_separator.rb18
-rw-r--r--lib/csv/match_p.rb20
-rw-r--r--lib/csv/parser.rb1289
-rw-r--r--lib/csv/row.rb757
-rw-r--r--lib/csv/table.rb1055
-rw-r--r--lib/csv/version.rb6
-rw-r--r--lib/csv/writer.rb210
-rw-r--r--lib/date.rb1848
-rw-r--r--lib/date/delta.rb431
-rw-r--r--lib/date/delta/parser.rb302
-rw-r--r--lib/date/delta/parser.ry85
-rw-r--r--lib/date/format.rb1311
-rw-r--r--lib/debug.rb907
-rw-r--r--lib/delegate.rb417
-rw-r--r--lib/delegate/delegate.gemspec29
-rw-r--r--lib/did_you_mean.rb155
-rw-r--r--lib/did_you_mean/core_ext/name_error.rb57
-rw-r--r--lib/did_you_mean/did_you_mean.gemspec27
-rw-r--r--lib/did_you_mean/experimental.rb2
-rw-r--r--lib/did_you_mean/formatter.rb44
-rw-r--r--lib/did_you_mean/formatters/plain_formatter.rb4
-rw-r--r--lib/did_you_mean/formatters/verbose_formatter.rb10
-rw-r--r--lib/did_you_mean/jaro_winkler.rb87
-rw-r--r--lib/did_you_mean/levenshtein.rb57
-rw-r--r--lib/did_you_mean/spell_checker.rb46
-rw-r--r--lib/did_you_mean/spell_checkers/key_error_checker.rb20
-rw-r--r--lib/did_you_mean/spell_checkers/method_name_checker.rb79
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers.rb20
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers/class_name_checker.rb49
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers/variable_name_checker.rb85
-rw-r--r--lib/did_you_mean/spell_checkers/null_checker.rb6
-rw-r--r--lib/did_you_mean/spell_checkers/pattern_key_name_checker.rb20
-rw-r--r--lib/did_you_mean/spell_checkers/require_path_checker.rb39
-rw-r--r--lib/did_you_mean/tree_spell_checker.rb109
-rw-r--r--lib/did_you_mean/verbose.rb2
-rw-r--r--lib/did_you_mean/version.rb3
-rw-r--r--lib/drb.rb1
-rw-r--r--lib/drb/acl.rb177
-rw-r--r--lib/drb/drb.gemspec43
-rw-r--r--lib/drb/drb.rb740
-rw-r--r--lib/drb/eq.rb3
-rw-r--r--lib/drb/extserv.rb37
-rw-r--r--lib/drb/extservm.rb39
-rw-r--r--lib/drb/gw.rb45
-rw-r--r--lib/drb/invokemethod.rb9
-rw-r--r--lib/drb/observer.rb6
-rw-r--r--lib/drb/ssl.rb330
-rw-r--r--lib/drb/timeridconv.rb112
-rw-r--r--lib/drb/unix.rb60
-rw-r--r--lib/drb/version.rb3
-rw-r--r--lib/drb/weakidconv.rb59
-rw-r--r--lib/e2mmap.rb172
-rw-r--r--lib/erb.gemspec38
-rw-r--r--lib/erb.rb650
-rw-r--r--lib/erb/compiler.rb471
-rw-r--r--lib/erb/def_method.rb46
-rw-r--r--lib/erb/util.rb62
-rw-r--r--lib/erb/version.rb5
-rw-r--r--lib/error_highlight.rb2
-rw-r--r--lib/error_highlight/base.rb514
-rw-r--r--lib/error_highlight/core_ext.rb47
-rw-r--r--lib/error_highlight/error_highlight.gemspec27
-rw-r--r--lib/error_highlight/formatter.rb23
-rw-r--r--lib/error_highlight/version.rb3
-rw-r--r--lib/fileutils.gemspec31
-rw-r--r--lib/fileutils.rb2457
-rw-r--r--lib/find.gemspec24
-rw-r--r--lib/find.rb53
-rw-r--r--lib/forwardable.rb315
-rw-r--r--lib/forwardable/forwardable.gemspec26
-rw-r--r--lib/forwardable/impl.rb17
-rw-r--r--lib/getoptlong.rb805
-rw-r--r--lib/getoptlong/getoptlong.gemspec30
-rw-r--r--lib/gserver.rb253
-rw-r--r--lib/ipaddr.gemspec36
-rw-r--r--lib/ipaddr.rb763
-rw-r--r--lib/irb.rb1033
-rw-r--r--lib/irb/.document1
-rw-r--r--lib/irb/cmd/backtrace.rb21
-rw-r--r--lib/irb/cmd/break.rb21
-rw-r--r--lib/irb/cmd/catch.rb21
-rw-r--r--lib/irb/cmd/chws.rb26
-rw-r--r--lib/irb/cmd/continue.rb17
-rw-r--r--lib/irb/cmd/debug.rb136
-rw-r--r--lib/irb/cmd/delete.rb17
-rw-r--r--lib/irb/cmd/edit.rb61
-rw-r--r--lib/irb/cmd/finish.rb17
-rw-r--r--lib/irb/cmd/fork.rb42
-rw-r--r--lib/irb/cmd/help.rb40
-rw-r--r--lib/irb/cmd/info.rb21
-rw-r--r--lib/irb/cmd/irb_info.rb37
-rw-r--r--lib/irb/cmd/load.rb88
-rw-r--r--lib/irb/cmd/ls.rb116
-rw-r--r--lib/irb/cmd/measure.rb48
-rw-r--r--lib/irb/cmd/next.rb17
-rw-r--r--lib/irb/cmd/nop.rb49
-rw-r--r--lib/irb/cmd/pushws.rb35
-rw-r--r--lib/irb/cmd/show_cmds.rb39
-rw-r--r--lib/irb/cmd/show_source.rb112
-rw-r--r--lib/irb/cmd/step.rb17
-rw-r--r--lib/irb/cmd/subirb.rb53
-rw-r--r--lib/irb/cmd/whereami.rb25
-rw-r--r--lib/irb/color.rb266
-rw-r--r--lib/irb/color_printer.rb50
-rw-r--r--lib/irb/completion.rb613
-rw-r--r--lib/irb/context.rb525
-rw-r--r--lib/irb/easter-egg.rb138
-rw-r--r--lib/irb/ext/change-ws.rb46
-rw-r--r--lib/irb/ext/history.rb120
-rw-r--r--lib/irb/ext/loader.rb166
-rw-r--r--lib/irb/ext/math-mode.rb36
-rw-r--r--lib/irb/ext/multi-irb.rb234
-rw-r--r--lib/irb/ext/save-history.rb115
-rw-r--r--lib/irb/ext/tracer.rb54
-rw-r--r--lib/irb/ext/use-loader.rb47
-rw-r--r--lib/irb/ext/workspaces.rb41
-rw-r--r--lib/irb/extend-command.rb439
-rw-r--r--lib/irb/frame.rb40
-rw-r--r--lib/irb/help.rb23
-rw-r--r--lib/irb/init.rb423
-rw-r--r--lib/irb/input-method.rb423
-rw-r--r--lib/irb/inspector.rb151
-rw-r--r--lib/irb/irb.gemspec40
-rw-r--r--lib/irb/lc/error.rb67
-rw-r--r--lib/irb/lc/help-message89
-rw-r--r--lib/irb/lc/ja/encoding_aliases.rb5
-rw-r--r--lib/irb/lc/ja/error.rb68
-rw-r--r--lib/irb/lc/ja/help-message48
-rw-r--r--lib/irb/locale.rb91
-rw-r--r--lib/irb/magic-file.rb6
-rw-r--r--lib/irb/notifier.rb194
-rw-r--r--lib/irb/output-method.rb59
-rw-r--r--lib/irb/ruby-lex.rb1801
-rw-r--r--lib/irb/ruby-token.rb265
-rw-r--r--lib/irb/ruby_logo.aa37
-rw-r--r--lib/irb/slex.rb282
-rw-r--r--lib/irb/src_encoding.rb7
-rw-r--r--lib/irb/version.rb8
-rw-r--r--lib/irb/workspace.rb202
-rw-r--r--lib/irb/ws-for-case-2.rb1
-rw-r--r--lib/irb/xmp.rb119
-rw-r--r--lib/logger.rb1121
-rw-r--r--lib/logger/errors.rb9
-rw-r--r--lib/logger/formatter.rb36
-rw-r--r--lib/logger/log_device.rb207
-rw-r--r--lib/logger/logger.gemspec26
-rw-r--r--lib/logger/period.rb47
-rw-r--r--lib/logger/severity.rb19
-rw-r--r--lib/logger/version.rb5
-rw-r--r--lib/mathn.rb210
-rw-r--r--lib/matrix.rb1536
-rw-r--r--lib/minitest/autorun.rb11
-rw-r--r--lib/minitest/benchmark.rb366
-rw-r--r--lib/minitest/mock.rb67
-rw-r--r--lib/minitest/pride.rb41
-rw-r--r--lib/minitest/spec.rb328
-rw-r--r--lib/minitest/unit.rb929
-rw-r--r--lib/mkmf.rb4330
-rw-r--r--lib/monitor.rb277
-rw-r--r--lib/mutex_m.gemspec27
-rw-r--r--lib/mutex_m.rb83
-rw-r--r--lib/net/.document8
-rw-r--r--lib/net/ftp.rb985
-rw-r--r--lib/net/http.rb3943
-rw-r--r--lib/net/http/backward.rb40
-rw-r--r--lib/net/http/exceptions.rb34
-rw-r--r--lib/net/http/generic_request.rb414
-rw-r--r--lib/net/http/header.rb981
-rw-r--r--lib/net/http/net-http.gemspec39
-rw-r--r--lib/net/http/proxy_delta.rb17
-rw-r--r--lib/net/http/request.rb88
-rw-r--r--lib/net/http/requests.rb425
-rw-r--r--lib/net/http/response.rb738
-rw-r--r--lib/net/http/responses.rb1174
-rw-r--r--lib/net/http/status.rb84
-rw-r--r--lib/net/https.rb5
-rw-r--r--lib/net/imap.rb3665
-rw-r--r--lib/net/net-protocol.gemspec33
-rw-r--r--lib/net/pop.rb1000
-rw-r--r--lib/net/protocol.rb240
-rw-r--r--lib/net/smtp.rb1032
-rw-r--r--lib/net/telnet.rb763
-rw-r--r--lib/observer.rb110
-rw-r--r--lib/observer/observer.gemspec32
-rw-r--r--lib/open-uri.gemspec25
-rw-r--r--lib/open-uri.rb372
-rw-r--r--lib/open3.rb211
-rw-r--r--lib/open3/open3.gemspec33
-rw-r--r--lib/open3/version.rb3
-rw-r--r--lib/optionparser.rb2
-rw-r--r--lib/optparse.rb877
-rw-r--r--lib/optparse/ac.rb54
-rw-r--r--lib/optparse/date.rb3
-rw-r--r--lib/optparse/kwargs.rb22
-rw-r--r--lib/optparse/optparse.gemspec30
-rw-r--r--lib/optparse/shellwords.rb3
-rw-r--r--lib/optparse/time.rb3
-rw-r--r--lib/optparse/uri.rb3
-rw-r--r--lib/optparse/version.rb3
-rw-r--r--lib/ostruct.rb478
-rw-r--r--lib/ostruct/ostruct.gemspec27
-rw-r--r--lib/pp.gemspec27
-rw-r--r--lib/pp.rb335
-rw-r--r--lib/prettyprint.gemspec22
-rw-r--r--lib/prettyprint.rb247
-rw-r--r--lib/prime.rb495
-rw-r--r--lib/profile.rb10
-rw-r--r--lib/profiler.rb59
-rw-r--r--lib/pstore.rb721
-rw-r--r--lib/pstore/pstore.gemspec32
-rw-r--r--lib/racc.rb6
-rw-r--r--lib/racc/compat.rb33
-rw-r--r--lib/racc/debugflags.rb60
-rw-r--r--lib/racc/exception.rb16
-rw-r--r--lib/racc/grammar.rb1118
-rw-r--r--lib/racc/grammarfileparser.rb561
-rw-r--r--lib/racc/info.rb17
-rw-r--r--lib/racc/iset.rb92
-rw-r--r--lib/racc/logfilegenerator.rb212
-rw-r--r--lib/racc/parser-text.rb637
-rw-r--r--lib/racc/parser.rb303
-rw-r--r--lib/racc/parserfilegenerator.rb468
-rw-r--r--lib/racc/racc.gemspec58
-rw-r--r--lib/racc/sourcetext.rb35
-rw-r--r--lib/racc/state.rb972
-rw-r--r--lib/racc/statetransitiontable.rb311
-rw-r--r--lib/racc/static.rb5
-rw-r--r--lib/rake.rb2485
-rw-r--r--lib/rake/classic_namespace.rb8
-rw-r--r--lib/rake/clean.rb31
-rw-r--r--lib/rake/contrib/compositepublisher.rb20
-rw-r--r--lib/rake/contrib/ftptools.rb150
-rw-r--r--lib/rake/contrib/publisher.rb73
-rw-r--r--lib/rake/contrib/rubyforgepublisher.rb16
-rw-r--r--lib/rake/contrib/sshpublisher.rb45
-rw-r--r--lib/rake/gempackagetask.rb95
-rw-r--r--lib/rake/loaders/makefile.rb38
-rw-r--r--lib/rake/packagetask.rb182
-rw-r--r--lib/rake/rake_test_loader.rb5
-rw-r--r--lib/rake/rdoctask.rb4
-rw-r--r--lib/rake/runtest.rb21
-rw-r--r--lib/rake/tasklib.rb21
-rw-r--r--lib/rake/testtask.rb150
-rw-r--r--lib/rake/win32.rb46
-rw-r--r--lib/random/formatter.rb245
-rw-r--r--lib/rational.rb23
-rw-r--r--lib/rbconfig/datadir.rb13
-rw-r--r--lib/rbconfig/obsolete.rb5
-rw-r--r--lib/rdoc.rb191
-rw-r--r--lib/rdoc/.document2
-rw-r--r--lib/rdoc/alias.rb3
-rw-r--r--lib/rdoc/anon_class.rb5
-rw-r--r--lib/rdoc/any_method.rb277
-rw-r--r--lib/rdoc/attr.rb90
-rw-r--r--lib/rdoc/class_module.rb514
-rw-r--r--lib/rdoc/code_object.rb236
-rw-r--r--lib/rdoc/code_objects.rb26
-rw-r--r--lib/rdoc/comment.rb250
-rw-r--r--lib/rdoc/constant.rb119
-rw-r--r--lib/rdoc/context.rb564
-rw-r--r--lib/rdoc/context/section.rb234
-rw-r--r--lib/rdoc/cross_reference.rb226
-rw-r--r--lib/rdoc/encoding.rb111
-rw-r--r--lib/rdoc/erb_partial.rb19
-rw-r--r--lib/rdoc/erbio.rb11
-rw-r--r--lib/rdoc/extend.rb10
-rw-r--r--lib/rdoc/generator.rb37
-rw-r--r--lib/rdoc/generator/darkfish.rb591
-rw-r--r--lib/rdoc/generator/json_index.rb300
-rw-r--r--lib/rdoc/generator/markup.rb103
-rw-r--r--lib/rdoc/generator/pot.rb98
-rw-r--r--lib/rdoc/generator/pot/message_extractor.rb68
-rw-r--r--lib/rdoc/generator/pot/po.rb84
-rw-r--r--lib/rdoc/generator/pot/po_entry.rb141
-rw-r--r--lib/rdoc/generator/ri.rb70
-rw-r--r--lib/rdoc/generator/template/darkfish/_footer.rhtml5
-rw-r--r--lib/rdoc/generator/template/darkfish/_head.rhtml20
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_VCS_info.rhtml19
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_classes.rhtml33
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_extends.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_in_files.rhtml9
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_includes.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_installed.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_methods.rhtml12
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_navigation.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_pages.rhtml32
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_parent.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_search.rhtml14
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_sections.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_table_of_contents.rhtml39
-rw-r--r--lib/rdoc/generator/template/darkfish/class.rhtml174
-rw-r--r--lib/rdoc/generator/template/darkfish/classpage.rhtml296
-rw-r--r--lib/rdoc/generator/template/darkfish/css/fonts.css167
-rw-r--r--lib/rdoc/generator/template/darkfish/css/rdoc.css662
-rw-r--r--lib/rdoc/generator/template/darkfish/filepage.rhtml124
-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-Light.ttfbin0 -> 94668 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-LightItalic.ttfbin0 -> 94196 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-Regular.ttfbin0 -> 96184 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-RegularItalic.ttfbin0 -> 95316 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Bold.ttfbin0 -> 138268 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Regular.ttfbin0 -> 138680 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/add.pngbin0 -> 733 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/arrow_up.pngbin0 -> 372 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/delete.pngbin0 -> 715 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/tag_blue.pngbin0 -> 1880 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/transparent.pngbin0 -> 97 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/index.rhtml78
-rw-r--r--lib/rdoc/generator/template/darkfish/js/darkfish.js134
-rw-r--r--lib/rdoc/generator/template/darkfish/js/jquery.js32
-rw-r--r--lib/rdoc/generator/template/darkfish/js/quicksearch.js114
-rw-r--r--lib/rdoc/generator/template/darkfish/js/search.js110
-rw-r--r--lib/rdoc/generator/template/darkfish/js/thickbox-compressed.js10
-rw-r--r--lib/rdoc/generator/template/darkfish/page.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/rdoc.css706
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_not_found.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_root.rhtml62
-rw-r--r--lib/rdoc/generator/template/darkfish/table_of_contents.rhtml58
-rw-r--r--lib/rdoc/generator/template/json_index/.document1
-rw-r--r--lib/rdoc/generator/template/json_index/js/navigation.js105
-rw-r--r--lib/rdoc/generator/template/json_index/js/searcher.js229
-rw-r--r--lib/rdoc/ghost_method.rb3
-rw-r--r--lib/rdoc/i18n.rb10
-rw-r--r--lib/rdoc/i18n/locale.rb102
-rw-r--r--lib/rdoc/i18n/text.rb126
-rw-r--r--lib/rdoc/include.rb100
-rw-r--r--lib/rdoc/known_classes.rb16
-rw-r--r--lib/rdoc/markdown.rb16783
-rw-r--r--lib/rdoc/markdown/entities.rb2132
-rw-r--r--lib/rdoc/markdown/literals.rb455
-rw-r--r--lib/rdoc/markup.rb632
-rw-r--r--lib/rdoc/markup/attr_changer.rb23
-rw-r--r--lib/rdoc/markup/attr_span.rb36
-rw-r--r--lib/rdoc/markup/attribute_manager.rb201
-rw-r--r--lib/rdoc/markup/attributes.rb71
-rw-r--r--lib/rdoc/markup/blank_line.rb1
-rw-r--r--lib/rdoc/markup/block_quote.rb15
-rw-r--r--lib/rdoc/markup/document.rb105
-rw-r--r--lib/rdoc/markup/formatter.rb163
-rw-r--r--lib/rdoc/markup/formatter_test_case.rb689
-rw-r--r--lib/rdoc/markup/hard_break.rb32
-rw-r--r--lib/rdoc/markup/heading.rb63
-rw-r--r--lib/rdoc/markup/include.rb43
-rw-r--r--lib/rdoc/markup/indented_paragraph.rb48
-rw-r--r--lib/rdoc/markup/inline.rb137
-rw-r--r--lib/rdoc/markup/list.rb29
-rw-r--r--lib/rdoc/markup/list_item.rb22
-rw-r--r--lib/rdoc/markup/paragraph.rb15
-rw-r--r--lib/rdoc/markup/parser.rb274
-rw-r--r--lib/rdoc/markup/pre_process.rb223
-rw-r--r--lib/rdoc/markup/raw.rb11
-rw-r--r--lib/rdoc/markup/regexp_handling.rb41
-rw-r--r--lib/rdoc/markup/rule.rb1
-rw-r--r--lib/rdoc/markup/table.rb47
-rw-r--r--lib/rdoc/markup/text_formatter_test_case.rb116
-rw-r--r--lib/rdoc/markup/to_ansi.rb24
-rw-r--r--lib/rdoc/markup/to_bs.rb13
-rw-r--r--lib/rdoc/markup/to_html.rb383
-rw-r--r--lib/rdoc/markup/to_html_crossref.rb277
-rw-r--r--lib/rdoc/markup/to_html_snippet.rb285
-rw-r--r--lib/rdoc/markup/to_joined_paragraph.rb47
-rw-r--r--lib/rdoc/markup/to_label.rb75
-rw-r--r--lib/rdoc/markup/to_markdown.rb192
-rw-r--r--lib/rdoc/markup/to_rdoc.rb123
-rw-r--r--lib/rdoc/markup/to_table_of_contents.rb89
-rw-r--r--lib/rdoc/markup/to_test.rb6
-rw-r--r--lib/rdoc/markup/to_tt_only.rb121
-rw-r--r--lib/rdoc/markup/verbatim.rb39
-rw-r--r--lib/rdoc/meta_method.rb3
-rw-r--r--lib/rdoc/method_attr.rb108
-rw-r--r--lib/rdoc/mixin.rb121
-rw-r--r--lib/rdoc/normal_class.rb51
-rw-r--r--lib/rdoc/normal_module.rb31
-rw-r--r--lib/rdoc/options.rb736
-rw-r--r--lib/rdoc/parser.rb268
-rw-r--r--lib/rdoc/parser/c.rb950
-rw-r--r--lib/rdoc/parser/changelog.rb335
-rw-r--r--lib/rdoc/parser/markdown.rb24
-rw-r--r--lib/rdoc/parser/rd.rb23
-rw-r--r--lib/rdoc/parser/ripper_state_lex.rb590
-rw-r--r--lib/rdoc/parser/ruby.rb2163
-rw-r--r--lib/rdoc/parser/ruby_tools.rb77
-rw-r--r--lib/rdoc/parser/simple.rb34
-rw-r--r--lib/rdoc/parser/text.rb12
-rw-r--r--lib/rdoc/rd.rb99
-rw-r--r--lib/rdoc/rd/block_parser.rb1060
-rw-r--r--lib/rdoc/rd/inline.rb72
-rw-r--r--lib/rdoc/rd/inline_parser.rb1208
-rw-r--r--lib/rdoc/rdoc.gemspec233
-rw-r--r--lib/rdoc/rdoc.rb313
-rw-r--r--lib/rdoc/require.rb3
-rw-r--r--lib/rdoc/ri.rb10
-rw-r--r--lib/rdoc/ri/driver.rb979
-rw-r--r--lib/rdoc/ri/formatter.rb1
-rw-r--r--lib/rdoc/ri/paths.rb139
-rw-r--r--lib/rdoc/ri/store.rb264
-rw-r--r--lib/rdoc/ri/task.rb71
-rw-r--r--lib/rdoc/ruby_lex.rb1291
-rw-r--r--lib/rdoc/ruby_token.rb416
-rw-r--r--lib/rdoc/rubygems_hook.rb248
-rw-r--r--lib/rdoc/servlet.rb451
-rw-r--r--lib/rdoc/single_class.rb21
-rw-r--r--lib/rdoc/stats.rb373
-rw-r--r--lib/rdoc/stats/normal.rb31
-rw-r--r--lib/rdoc/stats/quiet.rb1
-rw-r--r--lib/rdoc/stats/verbose.rb1
-rw-r--r--lib/rdoc/store.rb986
-rw-r--r--lib/rdoc/task.rb132
-rw-r--r--lib/rdoc/text.rb205
-rw-r--r--lib/rdoc/token_stream.rb77
-rw-r--r--lib/rdoc/tom_doc.rb263
-rw-r--r--lib/rdoc/top_level.rb372
-rw-r--r--lib/rdoc/version.rb10
-rw-r--r--lib/readline.gemspec33
-rw-r--r--lib/readline.rb7
-rw-r--r--lib/reline.rb600
-rw-r--r--lib/reline/ansi.rb350
-rw-r--r--lib/reline/config.rb401
-rw-r--r--lib/reline/general_io.rb109
-rw-r--r--lib/reline/history.rb76
-rw-r--r--lib/reline/key_actor.rb7
-rw-r--r--lib/reline/key_actor/base.rb19
-rw-r--r--lib/reline/key_actor/emacs.rb517
-rw-r--r--lib/reline/key_actor/vi_command.rb518
-rw-r--r--lib/reline/key_actor/vi_insert.rb517
-rw-r--r--lib/reline/key_stroke.rb105
-rw-r--r--lib/reline/kill_ring.rb125
-rw-r--r--lib/reline/line_editor.rb3357
-rw-r--r--lib/reline/reline.gemspec25
-rw-r--r--lib/reline/terminfo.rb174
-rw-r--r--lib/reline/unicode.rb665
-rw-r--r--lib/reline/unicode/east_asian_width.rb1164
-rw-r--r--lib/reline/version.rb3
-rw-r--r--lib/reline/windows.rb497
-rw-r--r--lib/resolv-replace.gemspec22
-rw-r--r--lib/resolv-replace.rb4
-rw-r--r--lib/resolv.gemspec22
-rw-r--r--lib/resolv.rb811
-rw-r--r--lib/rexml/attlistdecl.rb62
-rw-r--r--lib/rexml/attribute.rb188
-rw-r--r--lib/rexml/cdata.rb67
-rw-r--r--lib/rexml/child.rb96
-rw-r--r--lib/rexml/comment.rb80
-rw-r--r--lib/rexml/doctype.rb269
-rw-r--r--lib/rexml/document.rb234
-rw-r--r--lib/rexml/dtd/attlistdecl.rb10
-rw-r--r--lib/rexml/dtd/dtd.rb51
-rw-r--r--lib/rexml/dtd/elementdecl.rb17
-rw-r--r--lib/rexml/dtd/entitydecl.rb56
-rw-r--r--lib/rexml/dtd/notationdecl.rb39
-rw-r--r--lib/rexml/element.rb1245
-rw-r--r--lib/rexml/encoding.rb66
-rw-r--r--lib/rexml/entity.rb166
-rw-r--r--lib/rexml/formatters/default.rb111
-rw-r--r--lib/rexml/formatters/pretty.rb141
-rw-r--r--lib/rexml/formatters/transitive.rb57
-rw-r--r--lib/rexml/functions.rb387
-rw-r--r--lib/rexml/instruction.rb70
-rw-r--r--lib/rexml/light/node.rb195
-rw-r--r--lib/rexml/namespace.rb47
-rw-r--r--lib/rexml/node.rb75
-rw-r--r--lib/rexml/output.rb24
-rw-r--r--lib/rexml/parent.rb167
-rw-r--r--lib/rexml/parseexception.rb51
-rw-r--r--lib/rexml/parsers/baseparser.rb521
-rw-r--r--lib/rexml/parsers/lightparser.rb58
-rw-r--r--lib/rexml/parsers/pullparser.rb196
-rw-r--r--lib/rexml/parsers/sax2parser.rb247
-rw-r--r--lib/rexml/parsers/streamparser.rb46
-rw-r--r--lib/rexml/parsers/treeparser.rb100
-rw-r--r--lib/rexml/parsers/ultralightparser.rb56
-rw-r--r--lib/rexml/parsers/xpathparser.rb696
-rw-r--r--lib/rexml/quickpath.rb263
-rw-r--r--lib/rexml/rexml.rb31
-rw-r--r--lib/rexml/sax2listener.rb97
-rw-r--r--lib/rexml/source.rb269
-rw-r--r--lib/rexml/streamlistener.rb92
-rw-r--r--lib/rexml/syncenumerator.rb32
-rw-r--r--lib/rexml/text.rb404
-rw-r--r--lib/rexml/undefinednamespaceexception.rb8
-rw-r--r--lib/rexml/validation/relaxng.rb559
-rw-r--r--lib/rexml/validation/validation.rb155
-rw-r--r--lib/rexml/validation/validationexception.rb9
-rw-r--r--lib/rexml/xmldecl.rb130
-rw-r--r--lib/rexml/xmltokens.rb18
-rw-r--r--lib/rexml/xpath.rb77
-rw-r--r--lib/rexml/xpath_parser.rb793
-rw-r--r--lib/rinda/.document3
-rw-r--r--lib/rinda/rinda.gemspec28
-rw-r--r--lib/rinda/rinda.rb52
-rw-r--r--lib/rinda/ring.rb353
-rw-r--r--lib/rinda/tuplespace.rb15
-rw-r--r--lib/rss.rb19
-rw-r--r--lib/rss/0.9.rb428
-rw-r--r--lib/rss/1.0.rb452
-rw-r--r--lib/rss/2.0.rb111
-rw-r--r--lib/rss/atom.rb748
-rw-r--r--lib/rss/content.rb31
-rw-r--r--lib/rss/content/1.0.rb9
-rw-r--r--lib/rss/content/2.0.rb11
-rw-r--r--lib/rss/converter.rb170
-rw-r--r--lib/rss/dublincore.rb161
-rw-r--r--lib/rss/dublincore/1.0.rb12
-rw-r--r--lib/rss/dublincore/2.0.rb12
-rw-r--r--lib/rss/dublincore/atom.rb16
-rw-r--r--lib/rss/image.rb193
-rw-r--r--lib/rss/itunes.rb410
-rw-r--r--lib/rss/maker.rb54
-rw-r--r--lib/rss/maker/0.9.rb508
-rw-r--r--lib/rss/maker/1.0.rb435
-rw-r--r--lib/rss/maker/2.0.rb223
-rw-r--r--lib/rss/maker/atom.rb172
-rw-r--r--lib/rss/maker/base.rb944
-rw-r--r--lib/rss/maker/content.rb21
-rw-r--r--lib/rss/maker/dublincore.rb121
-rw-r--r--lib/rss/maker/entry.rb163
-rw-r--r--lib/rss/maker/feed.rb426
-rw-r--r--lib/rss/maker/image.rb111
-rw-r--r--lib/rss/maker/itunes.rb242
-rw-r--r--lib/rss/maker/slash.rb33
-rw-r--r--lib/rss/maker/syndication.rb18
-rw-r--r--lib/rss/maker/taxonomy.rb118
-rw-r--r--lib/rss/maker/trackback.rb61
-rw-r--r--lib/rss/parser.rb568
-rw-r--r--lib/rss/rexmlparser.rb54
-rw-r--r--lib/rss/rss.rb1312
-rw-r--r--lib/rss/slash.rb49
-rw-r--r--lib/rss/syndication.rb67
-rw-r--r--lib/rss/taxonomy.rb145
-rw-r--r--lib/rss/trackback.rb288
-rw-r--r--lib/rss/utils.rb111
-rw-r--r--lib/rss/xml-stylesheet.rb105
-rw-r--r--lib/rss/xml.rb71
-rw-r--r--lib/rss/xmlparser.rb93
-rw-r--r--lib/rss/xmlscanner.rb121
-rw-r--r--lib/ruby2_keywords.gemspec23
-rw-r--r--lib/ruby_vm/mjit/c_pointer.rb329
-rw-r--r--lib/ruby_vm/mjit/c_type.rb91
-rw-r--r--lib/ruby_vm/mjit/compiler.rb952
-rw-r--r--lib/ruby_vm/mjit/hooks.rb32
-rw-r--r--lib/rubygems.rb1458
-rw-r--r--lib/rubygems/available_set.rb165
-rw-r--r--lib/rubygems/basic_specification.rb346
-rw-r--r--lib/rubygems/builder.rb108
-rw-r--r--lib/rubygems/bundler_version_finder.rb77
-rw-r--r--lib/rubygems/command.rb306
-rw-r--r--lib/rubygems/command_manager.rb241
-rw-r--r--lib/rubygems/commands/build_command.rb149
-rw-r--r--lib/rubygems/commands/cert_command.rb396
-rw-r--r--lib/rubygems/commands/check_command.rb122
-rw-r--r--lib/rubygems/commands/cleanup_command.rb206
-rw-r--r--lib/rubygems/commands/contents_command.rb183
-rw-r--r--lib/rubygems/commands/dependency_command.rb224
-rw-r--r--lib/rubygems/commands/environment_command.rb194
-rw-r--r--lib/rubygems/commands/exec_command.rb249
-rw-r--r--lib/rubygems/commands/fetch_command.rb83
-rw-r--r--lib/rubygems/commands/generate_index_command.rb94
-rw-r--r--lib/rubygems/commands/help_command.rb340
-rw-r--r--lib/rubygems/commands/info_command.rb38
-rw-r--r--lib/rubygems/commands/install_command.rb223
-rw-r--r--lib/rubygems/commands/list_command.rb43
-rw-r--r--lib/rubygems/commands/lock_command.rb29
-rw-r--r--lib/rubygems/commands/mirror_command.rb26
-rw-r--r--lib/rubygems/commands/open_command.rb85
-rw-r--r--lib/rubygems/commands/outdated_command.rb38
-rw-r--r--lib/rubygems/commands/owner_command.rb95
-rw-r--r--lib/rubygems/commands/pristine_command.rb216
-rw-r--r--lib/rubygems/commands/push_command.rb98
-rw-r--r--lib/rubygems/commands/query_command.rb278
-rw-r--r--lib/rubygems/commands/rdoc_command.rb90
-rw-r--r--lib/rubygems/commands/search_command.rb44
-rw-r--r--lib/rubygems/commands/server_command.rb102
-rw-r--r--lib/rubygems/commands/setup_command.rb639
-rw-r--r--lib/rubygems/commands/signin_command.rb34
-rw-r--r--lib/rubygems/commands/signout_command.rb32
-rw-r--r--lib/rubygems/commands/sources_command.rb247
-rw-r--r--lib/rubygems/commands/specification_command.rb128
-rw-r--r--lib/rubygems/commands/stale_command.rb25
-rw-r--r--lib/rubygems/commands/uninstall_command.rb188
-rw-r--r--lib/rubygems/commands/unpack_command.rb140
-rw-r--r--lib/rubygems/commands/update_command.rb368
-rw-r--r--lib/rubygems/commands/which_command.rb64
-rw-r--r--lib/rubygems/commands/yank_command.rb99
-rw-r--r--lib/rubygems/compatibility.rb42
-rw-r--r--lib/rubygems/config_file.rb432
-rw-r--r--lib/rubygems/core_ext/kernel_gem.rb70
-rw-r--r--lib/rubygems/core_ext/kernel_require.rb169
-rw-r--r--lib/rubygems/core_ext/kernel_warn.rb50
-rw-r--r--lib/rubygems/core_ext/tcpsocket_init.rb54
-rw-r--r--lib/rubygems/custom_require.rb48
-rw-r--r--lib/rubygems/defaults.rb265
-rw-r--r--lib/rubygems/dependency.rb241
-rw-r--r--lib/rubygems/dependency_installer.rb443
-rw-r--r--lib/rubygems/dependency_list.rb118
-rw-r--r--lib/rubygems/deprecate.rb165
-rw-r--r--lib/rubygems/doc_manager.rb246
-rw-r--r--lib/rubygems/doctor.rb132
-rw-r--r--lib/rubygems/errors.rb195
-rw-r--r--lib/rubygems/exceptions.rb232
-rw-r--r--lib/rubygems/ext.rb20
-rw-r--r--lib/rubygems/ext/build_error.rb9
-rw-r--r--lib/rubygems/ext/builder.rb241
-rw-r--r--lib/rubygems/ext/cargo_builder.rb360
-rw-r--r--lib/rubygems/ext/cargo_builder/link_flag_converter.rb27
-rw-r--r--lib/rubygems/ext/cmake_builder.rb16
-rw-r--r--lib/rubygems/ext/configure_builder.rb22
-rw-r--r--lib/rubygems/ext/ext_conf_builder.rb73
-rw-r--r--lib/rubygems/ext/rake_builder.rb39
-rw-r--r--lib/rubygems/format.rb85
-rw-r--r--lib/rubygems/gem_openssl.rb98
-rw-r--r--lib/rubygems/gem_path_searcher.rb108
-rw-r--r--lib/rubygems/gem_runner.rb78
-rw-r--r--lib/rubygems/gemcutter_utilities.rb371
-rw-r--r--lib/rubygems/gemcutter_utilities/webauthn_listener.rb105
-rw-r--r--lib/rubygems/gemcutter_utilities/webauthn_listener/response.rb163
-rw-r--r--lib/rubygems/gemcutter_utilities/webauthn_poller.rb78
-rw-r--r--lib/rubygems/indexer.rb469
-rw-r--r--lib/rubygems/install_default_message.rb13
-rw-r--r--lib/rubygems/install_message.rb13
-rw-r--r--lib/rubygems/install_update_options.rb200
-rw-r--r--lib/rubygems/installer.rb989
-rw-r--r--lib/rubygems/installer_uninstaller_utils.rb29
-rw-r--r--lib/rubygems/local_remote_options.rb61
-rw-r--r--lib/rubygems/mock_gem_ui.rb86
-rw-r--r--lib/rubygems/name_tuple.rb121
-rw-r--r--lib/rubygems/old_format.rb159
-rw-r--r--lib/rubygems/openssl.rb7
-rw-r--r--lib/rubygems/optparse.rb3
-rw-r--r--lib/rubygems/optparse/.document1
-rw-r--r--lib/rubygems/optparse/lib/optionparser.rb2
-rw-r--r--lib/rubygems/optparse/lib/optparse.rb2308
-rw-r--r--lib/rubygems/optparse/lib/optparse/ac.rb54
-rw-r--r--lib/rubygems/optparse/lib/optparse/date.rb18
-rw-r--r--lib/rubygems/optparse/lib/optparse/kwargs.rb22
-rw-r--r--lib/rubygems/optparse/lib/optparse/shellwords.rb7
-rw-r--r--lib/rubygems/optparse/lib/optparse/time.rb11
-rw-r--r--lib/rubygems/optparse/lib/optparse/uri.rb7
-rw-r--r--lib/rubygems/optparse/lib/optparse/version.rb71
-rw-r--r--lib/rubygems/package.rb763
-rw-r--r--lib/rubygems/package/digest_io.rb63
-rw-r--r--lib/rubygems/package/f_sync_dir.rb29
-rw-r--r--lib/rubygems/package/file_source.rb32
-rw-r--r--lib/rubygems/package/io_source.rb48
-rw-r--r--lib/rubygems/package/old.rb169
-rw-r--r--lib/rubygems/package/source.rb4
-rw-r--r--lib/rubygems/package/tar_header.rb210
-rw-r--r--lib/rubygems/package/tar_input.rb228
-rw-r--r--lib/rubygems/package/tar_output.rb152
-rw-r--r--lib/rubygems/package/tar_reader.rb59
-rw-r--r--lib/rubygems/package/tar_reader/entry.rb133
-rw-r--r--lib/rubygems/package/tar_writer.rb160
-rw-r--r--lib/rubygems/package_task.rb39
-rw-r--r--lib/rubygems/path_support.rb86
-rw-r--r--lib/rubygems/platform.rb215
-rw-r--r--lib/rubygems/psych_tree.rb33
-rw-r--r--lib/rubygems/query_utils.rb351
-rw-r--r--lib/rubygems/rdoc.rb13
-rw-r--r--lib/rubygems/remote_fetcher.rb446
-rw-r--r--lib/rubygems/request.rb295
-rw-r--r--lib/rubygems/request/connection_pools.rb95
-rw-r--r--lib/rubygems/request/http_pool.rb47
-rw-r--r--lib/rubygems/request/https_pool.rb10
-rw-r--r--lib/rubygems/request_set.rb467
-rw-r--r--lib/rubygems/request_set/gem_dependency_api.rb844
-rw-r--r--lib/rubygems/request_set/lockfile.rb240
-rw-r--r--lib/rubygems/request_set/lockfile/parser.rb344
-rw-r--r--lib/rubygems/request_set/lockfile/tokenizer.rb114
-rw-r--r--lib/rubygems/require_paths_builder.rb24
-rw-r--r--lib/rubygems/requirement.rb249
-rw-r--r--lib/rubygems/resolver.rb348
-rw-r--r--lib/rubygems/resolver/activation_request.rb163
-rw-r--r--lib/rubygems/resolver/api_set.rb133
-rw-r--r--lib/rubygems/resolver/api_set/gem_parser.rb20
-rw-r--r--lib/rubygems/resolver/api_specification.rb105
-rw-r--r--lib/rubygems/resolver/best_set.rb77
-rw-r--r--lib/rubygems/resolver/composed_set.rb65
-rw-r--r--lib/rubygems/resolver/conflict.rb154
-rw-r--r--lib/rubygems/resolver/current_set.rb12
-rw-r--r--lib/rubygems/resolver/dependency_request.rb119
-rw-r--r--lib/rubygems/resolver/git_set.rb121
-rw-r--r--lib/rubygems/resolver/git_specification.rb57
-rw-r--r--lib/rubygems/resolver/index_set.rb79
-rw-r--r--lib/rubygems/resolver/index_specification.rb101
-rw-r--r--lib/rubygems/resolver/installed_specification.rb57
-rw-r--r--lib/rubygems/resolver/installer_set.rb272
-rw-r--r--lib/rubygems/resolver/local_specification.rb40
-rw-r--r--lib/rubygems/resolver/lock_set.rb81
-rw-r--r--lib/rubygems/resolver/lock_specification.rb86
-rw-r--r--lib/rubygems/resolver/molinillo.rb3
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo.rb11
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/resolution_state.rb57
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/specification_provider.rb88
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph.rb255
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/action.rb36
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_edge_no_circular.rb66
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_vertex.rb62
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/delete_edge.rb63
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/detach_vertex_named.rb61
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/log.rb126
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/set_payload.rb46
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/tag.rb36
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/vertex.rb164
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/errors.rb149
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/gem_metadata.rb6
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/specification_provider.rb112
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/ui.rb67
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolution.rb839
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolver.rb46
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/state.rb58
-rw-r--r--lib/rubygems/resolver/requirement_list.rb82
-rw-r--r--lib/rubygems/resolver/set.rb55
-rw-r--r--lib/rubygems/resolver/source_set.rb47
-rw-r--r--lib/rubygems/resolver/spec_specification.rb69
-rw-r--r--lib/rubygems/resolver/specification.rb126
-rw-r--r--lib/rubygems/resolver/stats.rb46
-rw-r--r--lib/rubygems/resolver/vendor_set.rb86
-rw-r--r--lib/rubygems/resolver/vendor_specification.rb23
-rw-r--r--lib/rubygems/s3_uri_signer.rb177
-rw-r--r--lib/rubygems/safe_yaml.rb59
-rw-r--r--lib/rubygems/security.rb910
-rw-r--r--lib/rubygems/security/policies.rb116
-rw-r--r--lib/rubygems/security/policy.rb292
-rw-r--r--lib/rubygems/security/signer.rb204
-rw-r--r--lib/rubygems/security/trust_dir.rb119
-rw-r--r--lib/rubygems/security_option.rb43
-rw-r--r--lib/rubygems/server.rb838
-rw-r--r--lib/rubygems/shellwords.rb3
-rw-r--r--lib/rubygems/source.rb241
-rw-r--r--lib/rubygems/source/git.rb241
-rw-r--r--lib/rubygems/source/installed.rb39
-rw-r--r--lib/rubygems/source/local.rb132
-rw-r--r--lib/rubygems/source/lock.rb51
-rw-r--r--lib/rubygems/source/specific_file.rb72
-rw-r--r--lib/rubygems/source/vendor.rb26
-rw-r--r--lib/rubygems/source_index.rb359
-rw-r--r--lib/rubygems/source_list.rb146
-rw-r--r--lib/rubygems/spec_fetcher.rb349
-rw-r--r--lib/rubygems/specification.rb3097
-rw-r--r--lib/rubygems/specification_policy.rb507
-rw-r--r--lib/rubygems/ssl_certs/.document1
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/GlobalSignRootCA.pem21
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/GlobalSignRootCA_R3.pem21
-rw-r--r--lib/rubygems/stub_specification.rb211
-rw-r--r--lib/rubygems/test_utilities.rb153
-rw-r--r--lib/rubygems/text.rb85
-rw-r--r--lib/rubygems/tsort.rb3
-rw-r--r--lib/rubygems/tsort/.document1
-rw-r--r--lib/rubygems/tsort/lib/tsort.rb452
-rw-r--r--lib/rubygems/uninstaller.rb387
-rw-r--r--lib/rubygems/unknown_command_spell_checker.rb21
-rw-r--r--lib/rubygems/update_suggestion.rb69
-rw-r--r--lib/rubygems/uri.rb126
-rw-r--r--lib/rubygems/uri_formatter.rb47
-rw-r--r--lib/rubygems/user_interaction.rb429
-rw-r--r--lib/rubygems/util.rb116
-rw-r--r--lib/rubygems/util/licenses.rb545
-rw-r--r--lib/rubygems/util/list.rb38
-rw-r--r--lib/rubygems/validator.rb133
-rw-r--r--lib/rubygems/version.rb228
-rw-r--r--lib/rubygems/version_option.rb44
-rw-r--r--lib/scanf.rb721
-rw-r--r--lib/securerandom.gemspec22
-rw-r--r--lib/securerandom.rb298
-rw-r--r--[-rwxr-xr-x]lib/set.rb1559
-rw-r--r--lib/set/set.gemspec23
-rw-r--r--lib/set/sorted_set.rb6
-rw-r--r--lib/shell.rb300
-rw-r--r--lib/shell/builtin-command.rb160
-rw-r--r--lib/shell/command-processor.rb593
-rw-r--r--lib/shell/error.rb25
-rw-r--r--lib/shell/filter.rb109
-rw-r--r--lib/shell/process-controller.rb319
-rw-r--r--lib/shell/system-command.rb159
-rw-r--r--lib/shell/version.rb15
-rw-r--r--lib/shellwords.gemspec22
-rw-r--r--lib/shellwords.rb176
-rw-r--r--lib/singleton.rb330
-rw-r--r--lib/singleton/singleton.gemspec30
-rw-r--r--lib/sync.rb306
-rw-r--r--lib/syntax_suggest.rb3
-rw-r--r--lib/syntax_suggest/api.rb201
-rw-r--r--lib/syntax_suggest/around_block_scan.rb232
-rw-r--r--lib/syntax_suggest/block_expand.rb165
-rw-r--r--lib/syntax_suggest/capture/before_after_keyword_ends.rb85
-rw-r--r--lib/syntax_suggest/capture/falling_indent_lines.rb71
-rw-r--r--lib/syntax_suggest/capture_code_context.rb245
-rw-r--r--lib/syntax_suggest/clean_document.rb306
-rw-r--r--lib/syntax_suggest/cli.rb130
-rw-r--r--lib/syntax_suggest/code_block.rb100
-rw-r--r--lib/syntax_suggest/code_frontier.rb178
-rw-r--r--lib/syntax_suggest/code_line.rb237
-rw-r--r--lib/syntax_suggest/code_search.rb139
-rw-r--r--lib/syntax_suggest/core_ext.rb114
-rw-r--r--lib/syntax_suggest/display_code_with_line_numbers.rb70
-rw-r--r--lib/syntax_suggest/display_invalid_blocks.rb83
-rw-r--r--lib/syntax_suggest/explain_syntax.rb103
-rw-r--r--lib/syntax_suggest/left_right_lex_count.rb168
-rw-r--r--lib/syntax_suggest/lex_all.rb55
-rw-r--r--lib/syntax_suggest/lex_value.rb70
-rw-r--r--lib/syntax_suggest/parse_blocks_from_indent_line.rb60
-rw-r--r--lib/syntax_suggest/pathname_from_message.rb59
-rw-r--r--lib/syntax_suggest/priority_engulf_queue.rb63
-rw-r--r--lib/syntax_suggest/priority_queue.rb105
-rw-r--r--lib/syntax_suggest/ripper_errors.rb36
-rw-r--r--lib/syntax_suggest/scan_history.rb134
-rw-r--r--lib/syntax_suggest/syntax_suggest.gemspec32
-rw-r--r--lib/syntax_suggest/unvisited_lines.rb36
-rw-r--r--lib/syntax_suggest/version.rb5
-rw-r--r--lib/tempfile.gemspec22
-rw-r--r--lib/tempfile.rb363
-rw-r--r--lib/test/unit.rb219
-rw-r--r--lib/test/unit/assertions.rb161
-rw-r--r--lib/test/unit/testcase.rb15
-rw-r--r--lib/thread.rb361
-rw-r--r--lib/thwait.rb143
-rw-r--r--lib/time.gemspec24
-rw-r--r--lib/time.rb537
-rw-r--r--lib/timeout.rb241
-rw-r--r--lib/timeout/timeout.gemspec30
-rw-r--r--lib/tmpdir.gemspec26
-rw-r--r--lib/tmpdir.rb119
-rw-r--r--lib/tracer.rb195
-rw-r--r--lib/tsort.gemspec22
-rw-r--r--lib/tsort.rb250
-rw-r--r--lib/ubygems.rb10
-rw-r--r--lib/un.gemspec24
-rw-r--r--lib/un.rb223
-rw-r--r--lib/unicode_normalize/normalize.rb175
-rw-r--r--lib/unicode_normalize/tables.rb9259
-rw-r--r--lib/uri.rb111
-rw-r--r--lib/uri/.document7
-rw-r--r--lib/uri/common.rb1036
-rw-r--r--lib/uri/file.rb100
-rw-r--r--lib/uri/ftp.rb108
-rw-r--r--lib/uri/generic.rb964
-rw-r--r--lib/uri/http.rb97
-rw-r--r--lib/uri/https.rb11
-rw-r--r--lib/uri/ldap.rb83
-rw-r--r--lib/uri/ldaps.rb14
-rw-r--r--lib/uri/mailto.rb193
-rw-r--r--lib/uri/rfc2396_parser.rb539
-rw-r--r--lib/uri/rfc3986_parser.rb119
-rw-r--r--lib/uri/uri.gemspec31
-rw-r--r--lib/uri/version.rb6
-rw-r--r--lib/uri/ws.rb83
-rw-r--r--lib/uri/wss.rb23
-rw-r--r--lib/weakref.rb100
-rw-r--r--lib/weakref/weakref.gemspec34
-rw-r--r--lib/webrick.rb29
-rw-r--r--lib/webrick/accesslog.rb82
-rw-r--r--lib/webrick/cgi.rb260
-rw-r--r--lib/webrick/compat.rb15
-rw-r--r--lib/webrick/config.rb121
-rw-r--r--lib/webrick/cookie.rb110
-rw-r--r--lib/webrick/htmlutils.rb25
-rw-r--r--lib/webrick/httpauth.rb45
-rw-r--r--lib/webrick/httpauth/authenticator.rb79
-rw-r--r--lib/webrick/httpauth/basicauth.rb65
-rw-r--r--lib/webrick/httpauth/digestauth.rb393
-rw-r--r--lib/webrick/httpauth/htdigest.rb91
-rw-r--r--lib/webrick/httpauth/htgroup.rb61
-rw-r--r--lib/webrick/httpauth/htpasswd.rb83
-rw-r--r--lib/webrick/httpauth/userdb.rb29
-rw-r--r--lib/webrick/httpproxy.rb288
-rw-r--r--lib/webrick/httprequest.rb414
-rw-r--r--lib/webrick/httpresponse.rb326
-rw-r--r--lib/webrick/https.rb63
-rw-r--r--lib/webrick/httpserver.rb217
-rw-r--r--lib/webrick/httpservlet.rb22
-rw-r--r--lib/webrick/httpservlet/abstract.rb70
-rw-r--r--lib/webrick/httpservlet/cgi_runner.rb46
-rw-r--r--lib/webrick/httpservlet/cgihandler.rb108
-rw-r--r--lib/webrick/httpservlet/erbhandler.rb54
-rw-r--r--lib/webrick/httpservlet/filehandler.rb439
-rw-r--r--lib/webrick/httpservlet/prochandler.rb33
-rw-r--r--lib/webrick/httpstatus.rb132
-rw-r--r--lib/webrick/httputils.rb392
-rw-r--r--lib/webrick/httpversion.rb49
-rw-r--r--lib/webrick/log.rb88
-rw-r--r--lib/webrick/server.rb210
-rw-r--r--lib/webrick/ssl.rb127
-rw-r--r--lib/webrick/utils.rb175
-rw-r--r--lib/webrick/version.rb13
-rw-r--r--lib/xmlrpc/.document1
-rw-r--r--lib/xmlrpc/README.rdoc300
-rw-r--r--lib/xmlrpc/README.txt31
-rw-r--r--lib/xmlrpc/base64.rb81
-rw-r--r--lib/xmlrpc/client.rb625
-rw-r--r--lib/xmlrpc/config.rb40
-rw-r--r--lib/xmlrpc/create.rb290
-rw-r--r--lib/xmlrpc/datetime.rb142
-rw-r--r--lib/xmlrpc/httpserver.rb178
-rw-r--r--lib/xmlrpc/marshal.rb76
-rw-r--r--lib/xmlrpc/parser.rb813
-rw-r--r--lib/xmlrpc/server.rb778
-rw-r--r--lib/xmlrpc/utils.rb165
-rw-r--r--lib/yaml.rb100
-rw-r--r--lib/yaml/dbm.rb189
-rw-r--r--lib/yaml/store.rb61
-rw-r--r--lib/yaml/yaml.gemspec23
-rwxr-xr-xlibexec/bundle38
-rwxr-xr-xlibexec/bundler4
-rwxr-xr-xlibexec/erb164
-rwxr-xr-xlibexec/irb11
-rwxr-xr-xlibexec/racc320
-rwxr-xr-xlibexec/rdoc43
-rwxr-xr-xlibexec/ri12
-rwxr-xr-xlibexec/syntax_suggest7
-rw-r--r--load.c1621
-rw-r--r--loadpath.c91
-rw-r--r--localeinit.c138
-rw-r--r--main.c36
-rw-r--r--man/erb.133
-rw-r--r--man/goruby.112
-rw-r--r--man/index.txt25
-rw-r--r--man/irb.1139
-rw-r--r--man/rake.1169
-rw-r--r--man/ri.1247
-rw-r--r--man/ruby.1287
-rw-r--r--marshal.c2555
-rw-r--r--marshal.rb40
-rw-r--r--math.c1024
-rw-r--r--memory_view.c872
-rw-r--r--method.h273
-rw-r--r--mini_builtin.c97
-rw-r--r--miniinit.c51
-rw-r--r--misc/README18
-rwxr-xr-xmisc/expand_tabs.rb208
-rw-r--r--misc/inf-ruby.el416
-rwxr-xr-xmisc/lldb_cruby.py748
-rw-r--r--misc/lldb_disasm.py250
-rw-r--r--misc/lldb_rb/commands/command_template.py30
-rw-r--r--misc/lldb_rb/commands/heap_page_command.py26
-rw-r--r--misc/lldb_rb/commands/rclass_ext_command.py14
-rw-r--r--misc/lldb_rb/constants.py4
-rw-r--r--misc/lldb_rb/rb_base_command.py69
-rw-r--r--misc/lldb_yjit.py47
-rw-r--r--misc/rb_optparse.bash5
-rw-r--r--[-rwxr-xr-x]misc/rb_optparse.zsh15
-rw-r--r--misc/rdoc-mode.el83
-rw-r--r--misc/ruby-electric.el200
-rw-r--r--misc/ruby-mode.el1427
-rw-r--r--misc/ruby-style.el20
-rw-r--r--misc/rubydb2x.el104
-rw-r--r--misc/rubydb3x.el115
-rw-r--r--misc/test_lldb_cruby.rb40
-rw-r--r--missing/alloca.c10
-rw-r--r--missing/crt_externs.h8
-rw-r--r--missing/crypt.c624
-rw-r--r--missing/crypt.h247
-rw-r--r--missing/des_tables.c1616
-rw-r--r--missing/dtoa.c3470
-rw-r--r--missing/dup2.c60
-rw-r--r--missing/erf.c15
-rw-r--r--missing/explicit_bzero.c94
-rw-r--r--missing/file.h5
-rw-r--r--missing/fileblocks.c1
-rw-r--r--missing/finite.c9
-rw-r--r--missing/flock.c20
-rw-r--r--missing/isinf.c69
-rw-r--r--missing/isnan.c17
-rw-r--r--missing/langinfo.c6
-rw-r--r--missing/lgamma_r.c13
-rw-r--r--missing/memcmp.c3
-rw-r--r--missing/mt19937.c158
-rw-r--r--missing/nan.c28
-rw-r--r--missing/nextafter.c77
-rw-r--r--missing/os2.c138
-rw-r--r--missing/procstat_vm.c85
-rw-r--r--missing/setproctitle.c175
-rw-r--r--missing/signbit.c19
-rw-r--r--missing/strerror.c2
-rw-r--r--missing/strlcat.c86
-rw-r--r--missing/strlcpy.c77
-rw-r--r--missing/strtol.c27
-rw-r--r--missing/tgamma.c44
-rw-r--r--missing/x86_64-chkstk.S (renamed from missing/x86_64-chkstk.s)0
-rw-r--r--mjit.c1998
-rw-r--r--mjit.h145
-rw-r--r--mjit.rb37
-rw-r--r--mjit_c.c43
-rw-r--r--mjit_c.h97
-rw-r--r--mjit_c.rb807
-rw-r--r--nilclass.rb25
-rw-r--r--node.c1990
-rw-r--r--node.h610
-rw-r--r--numeric.c6625
-rw-r--r--numeric.rb405
-rw-r--r--object.c3948
-rw-r--r--pack.c3346
-rw-r--r--pack.rb31
-rw-r--r--parse.y16315
-rw-r--r--prelude.rb50
-rw-r--r--probes.d223
-rw-r--r--probes_helper.h44
-rw-r--r--proc.c3897
-rw-r--r--process.c7704
-rw-r--r--ractor.c3327
-rw-r--r--ractor.rb842
-rw-r--r--ractor_core.h342
-rw-r--r--random.c2210
-rw-r--r--range.c2472
-rw-r--r--rational.c2765
-rw-r--r--re.c3598
-rw-r--r--regcomp.c1356
-rw-r--r--regenc.c201
-rw-r--r--regenc.h173
-rw-r--r--regerror.c118
-rw-r--r--regexec.c3150
-rw-r--r--regint.h564
-rw-r--r--regparse.c2487
-rw-r--r--regparse.h84
-rw-r--r--regsyntax.c93
-rw-r--r--ruby-runner.c98
-rw-r--r--ruby.c3384
-rw-r--r--ruby_assert.h14
-rw-r--r--ruby_atomic.h23
-rw-r--r--rubystub.c61
-rw-r--r--safe.c135
-rw-r--r--sample/README4
-rw-r--r--sample/benchmark.rb19
-rw-r--r--sample/biorhythm.rb31
-rw-r--r--sample/cal.rb10
-rw-r--r--sample/cbreak.rb8
-rw-r--r--sample/cgi-session-pstore.rb11
-rw-r--r--sample/coverage.rb6
-rw-r--r--sample/delegate.rb31
-rw-r--r--sample/dir.rb2
-rw-r--r--sample/drb/README.ja.rdoc59
-rw-r--r--sample/drb/README.rd56
-rw-r--r--sample/drb/README.rd.ja59
-rw-r--r--sample/drb/README.rdoc56
-rw-r--r--sample/drb/acl.rb15
-rw-r--r--sample/drb/darray.rb2
-rw-r--r--sample/drb/darrayc.rb4
-rw-r--r--sample/drb/dbiff.rb24
-rw-r--r--sample/drb/dchatc.rb4
-rw-r--r--sample/drb/dchats.rb25
-rw-r--r--sample/drb/dhasen.rb7
-rw-r--r--sample/drb/dhasenc.rb8
-rw-r--r--sample/drb/dlogc.rb2
-rw-r--r--sample/drb/dlogd.rb9
-rw-r--r--sample/drb/dqin.rb2
-rw-r--r--sample/drb/dqout.rb2
-rw-r--r--sample/drb/dqueue.rb5
-rw-r--r--sample/drb/drbc.rb2
-rw-r--r--sample/drb/drbch.rb2
-rw-r--r--sample/drb/drbm.rb6
-rw-r--r--sample/drb/drbmc.rb2
-rw-r--r--sample/drb/drbs-acl.rb6
-rw-r--r--sample/drb/drbs.rb4
-rw-r--r--sample/drb/extserv_test.rb12
-rw-r--r--sample/drb/gw_cu.rb2
-rw-r--r--sample/drb/holderc.rb2
-rw-r--r--sample/drb/holders.rb6
-rw-r--r--sample/drb/http0.rb64
-rw-r--r--sample/drb/http0serv.rb125
-rw-r--r--sample/drb/name.rb22
-rw-r--r--sample/drb/namec.rb2
-rw-r--r--sample/drb/old_tuplespace.rb84
-rw-r--r--sample/drb/ring_echo.rb3
-rw-r--r--sample/drb/ring_place.rb6
-rw-r--r--sample/drb/simpletuple.rb16
-rw-r--r--sample/drb/speedc.rb2
-rw-r--r--sample/drb/speeds.rb4
-rw-r--r--sample/dualstack-fetch.rb2
-rw-r--r--sample/dualstack-httpd.rb33
-rw-r--r--sample/export.rb2
-rw-r--r--sample/exyacc.rb26
-rw-r--r--sample/fact.rb4
-rw-r--r--sample/fib.awk8
-rw-r--r--sample/fib.pl4
-rw-r--r--sample/fib.py2
-rw-r--r--sample/fib.scm4
-rw-r--r--sample/freq.rb12
-rw-r--r--sample/from.rb42
-rw-r--r--sample/fullpath.rb2
-rw-r--r--sample/getoptlong/abbrev.rb9
-rw-r--r--sample/getoptlong/aliases.rb8
-rw-r--r--sample/getoptlong/argv.rb12
-rw-r--r--sample/getoptlong/each.rb12
-rw-r--r--sample/getoptlong/fibonacci.rb62
-rw-r--r--sample/getoptlong/permute.rb12
-rw-r--r--sample/getoptlong/require_order.rb13
-rw-r--r--sample/getoptlong/return_in_order.rb13
-rw-r--r--sample/getoptlong/simple.rb7
-rw-r--r--sample/getoptlong/types.rb10
-rw-r--r--sample/iseq_loader.rb243
-rw-r--r--sample/list.rb6
-rw-r--r--sample/list2.rb2
-rw-r--r--sample/list3.rb4
-rw-r--r--sample/logger/app.rb2
-rwxr-xr-x[-rw-r--r--]sample/mine.rb48
-rw-r--r--sample/mkproto.rb22
-rw-r--r--sample/mpart.rb44
-rw-r--r--sample/net-imap.rb167
-rw-r--r--sample/observ.rb11
-rw-r--r--sample/occur.pl8
-rw-r--r--sample/occur.rb4
-rw-r--r--sample/occur2.rb13
-rw-r--r--sample/open3.rb12
-rw-r--r--sample/openssl/c_rehash.rb41
-rw-r--r--sample/openssl/cert2text.rb7
-rw-r--r--sample/openssl/certstore.rb61
-rw-r--r--sample/openssl/cipher.rb4
-rw-r--r--sample/openssl/crlstore.rb32
-rw-r--r--sample/openssl/echo_cli.rb2
-rw-r--r--sample/openssl/echo_svr.rb8
-rw-r--r--sample/openssl/gen_csr.rb14
-rw-r--r--sample/openssl/smime_read.rb11
-rw-r--r--sample/openssl/smime_write.rb15
-rwxr-xr-xsample/optparse/opttest.rb70
-rw-r--r--sample/philos.rb3
-rw-r--r--sample/pstore.rb19
-rw-r--r--sample/pty/expect_sample.rb16
-rw-r--r--sample/pty/script.rb2
-rw-r--r--sample/pty/shl.rb47
-rw-r--r--sample/rcs.awk54
-rw-r--r--sample/rinda-ring.rb22
-rw-r--r--sample/ripper/ruby2html.rb6
-rwxr-xr-xsample/rss/blend.rb79
-rwxr-xr-xsample/rss/convert.rb69
-rwxr-xr-xsample/rss/list_description.rb91
-rwxr-xr-xsample/rss/re_read.rb64
-rwxr-xr-xsample/rss/rss_recent.rb85
-rw-r--r--sample/simple-bench.rb140
-rw-r--r--sample/svr.rb2
-rw-r--r--sample/tempfile.rb8
-rw-r--r--sample/test.rb2268
-rw-r--r--sample/testunit/adder.rb13
-rw-r--r--sample/testunit/subtracter.rb12
-rw-r--r--sample/testunit/tc_adder.rb18
-rw-r--r--sample/testunit/tc_subtracter.rb18
-rw-r--r--sample/testunit/ts_examples.rb7
-rw-r--r--sample/timeout.rb18
-rw-r--r--sample/trick2013/README.md15
-rw-r--r--sample/trick2013/kinaba/authors.markdown3
-rw-r--r--sample/trick2013/kinaba/entry.rb1
-rw-r--r--sample/trick2013/kinaba/remarks.markdown37
-rw-r--r--sample/trick2013/mame/authors.markdown3
-rw-r--r--sample/trick2013/mame/entry.rb97
-rw-r--r--sample/trick2013/mame/remarks.markdown47
-rw-r--r--sample/trick2013/shinh/authors.markdown2
-rw-r--r--sample/trick2013/shinh/entry.rb10
-rw-r--r--sample/trick2013/shinh/remarks.markdown4
-rw-r--r--sample/trick2013/yhara/authors.markdown3
-rw-r--r--sample/trick2013/yhara/entry.rb28
-rw-r--r--sample/trick2013/yhara/remarks.en.markdown23
-rw-r--r--sample/trick2013/yhara/remarks.markdown24
-rw-r--r--sample/trick2015/README.md16
-rw-r--r--sample/trick2015/eregon/authors.markdown3
-rw-r--r--sample/trick2015/eregon/entry.rb16
-rw-r--r--sample/trick2015/eregon/remarks.markdown70
-rw-r--r--sample/trick2015/kinaba/authors.markdown4
-rw-r--r--sample/trick2015/kinaba/entry.rb150
-rw-r--r--sample/trick2015/kinaba/remarks.markdown85
-rw-r--r--sample/trick2015/ksk_1/authors.markdown3
-rw-r--r--sample/trick2015/ksk_1/entry.rb1
-rw-r--r--sample/trick2015/ksk_1/remarks.markdown120
-rw-r--r--sample/trick2015/ksk_2/abnormal.cnf6
-rw-r--r--sample/trick2015/ksk_2/authors.markdown3
-rw-r--r--sample/trick2015/ksk_2/entry.rb1
-rw-r--r--sample/trick2015/ksk_2/quinn.cnf21
-rw-r--r--sample/trick2015/ksk_2/remarks.markdown204
-rw-r--r--sample/trick2015/ksk_2/sample.cnf9
-rw-r--r--sample/trick2015/ksk_2/uf20-01.cnf99
-rw-r--r--sample/trick2015/ksk_2/unsat.cnf11
-rw-r--r--sample/trick2015/monae/authors.markdown1
-rw-r--r--sample/trick2015/monae/entry.rb26
-rw-r--r--sample/trick2015/monae/remarks.markdown25
-rw-r--r--sample/trick2018/01-kinaba/authors.markdown3
-rw-r--r--sample/trick2018/01-kinaba/entry.rb8
-rw-r--r--sample/trick2018/01-kinaba/remarks.markdown55
-rw-r--r--sample/trick2018/02-mame/authors.markdown3
-rw-r--r--sample/trick2018/02-mame/entry.rb15
-rw-r--r--sample/trick2018/02-mame/remarks.markdown16
-rw-r--r--sample/trick2018/03-tompng/Gemfile2
-rw-r--r--sample/trick2018/03-tompng/Gemfile.lock13
-rw-r--r--sample/trick2018/03-tompng/authors.markdown3
-rw-r--r--sample/trick2018/03-tompng/entry.rb31
-rw-r--r--sample/trick2018/03-tompng/output.txt44
-rw-r--r--sample/trick2018/03-tompng/remarks.markdown19
-rw-r--r--sample/trick2018/03-tompng/trick.pngbin0 -> 5661 bytes-rw-r--r--sample/trick2018/04-colin/authors.markdown3
-rw-r--r--sample/trick2018/04-colin/entry.rb2
-rw-r--r--sample/trick2018/04-colin/remarks.markdown62
-rw-r--r--sample/trick2018/05-tompng/authors.markdown3
-rw-r--r--sample/trick2018/05-tompng/entry.rb41
-rw-r--r--sample/trick2018/05-tompng/preview_of_output.pngbin0 -> 66800 bytes-rw-r--r--sample/trick2018/05-tompng/remarks.markdown31
-rw-r--r--sample/trick2018/README.md16
-rw-r--r--sample/trick2022/01-tompng/Gemfile2
-rw-r--r--sample/trick2022/01-tompng/Gemfile.lock13
-rw-r--r--sample/trick2022/01-tompng/authors.markdown3
-rw-r--r--sample/trick2022/01-tompng/entry.rb40
-rw-r--r--sample/trick2022/01-tompng/remarks.markdown51
-rw-r--r--sample/trick2022/02-tompng/authors.markdown3
-rw-r--r--sample/trick2022/02-tompng/entry.rb32
-rw-r--r--sample/trick2022/02-tompng/remarks.markdown32
-rw-r--r--sample/trick2022/03-mame/authors.markdown3
-rw-r--r--sample/trick2022/03-mame/entry.rb27
-rw-r--r--sample/trick2022/03-mame/remarks.markdown96
-rw-r--r--sample/trick2022/03-mame/test.txt13
-rw-r--r--sample/trick2022/README.md14
-rw-r--r--sample/trojan.rb4
-rw-r--r--sample/uumerge.rb2
-rw-r--r--sample/weakref.rb9
-rw-r--r--sample/webrick/demo-app.rb66
-rw-r--r--sample/webrick/demo-multipart.cgi12
-rw-r--r--sample/webrick/demo-servlet.rb6
-rw-r--r--sample/webrick/demo-urlencoded.cgi12
-rw-r--r--sample/webrick/hello.cgi11
-rw-r--r--sample/webrick/hello.rb8
-rw-r--r--sample/webrick/httpd.rb23
-rw-r--r--sample/webrick/httpproxy.rb26
-rw-r--r--sample/webrick/httpsd.rb33
-rw-r--r--scheduler.c679
-rw-r--r--shape.c825
-rw-r--r--shape.h232
-rw-r--r--signal.c1468
-rw-r--r--siphash.c490
-rw-r--r--siphash.h48
-rw-r--r--sparc.c40
-rw-r--r--spec/README30
-rw-r--r--spec/README.md160
-rw-r--r--spec/bundler/bundler/build_metadata_spec.rb49
-rw-r--r--spec/bundler/bundler/bundler_spec.rb378
-rw-r--r--spec/bundler/bundler/cli_spec.rb262
-rw-r--r--spec/bundler/bundler/compact_index_client/updater_spec.rb59
-rw-r--r--spec/bundler/bundler/definition_spec.rb292
-rw-r--r--spec/bundler/bundler/dependency_spec.rb157
-rw-r--r--spec/bundler/bundler/digest_spec.rb24
-rw-r--r--spec/bundler/bundler/dsl_spec.rb308
-rw-r--r--spec/bundler/bundler/endpoint_specification_spec.rb83
-rw-r--r--spec/bundler/bundler/env_spec.rb236
-rw-r--r--spec/bundler/bundler/environment_preserver_spec.rb79
-rw-r--r--spec/bundler/bundler/fetcher/base_spec.rb76
-rw-r--r--spec/bundler/bundler/fetcher/compact_index_spec.rb109
-rw-r--r--spec/bundler/bundler/fetcher/dependency_spec.rb283
-rw-r--r--spec/bundler/bundler/fetcher/downloader_spec.rb255
-rw-r--r--spec/bundler/bundler/fetcher/index_spec.rb82
-rw-r--r--spec/bundler/bundler/fetcher_spec.rb192
-rw-r--r--spec/bundler/bundler/friendly_errors_spec.rb234
-rw-r--r--spec/bundler/bundler/gem_helper_spec.rb451
-rw-r--r--spec/bundler/bundler/gem_version_promoter_spec.rb163
-rw-r--r--spec/bundler/bundler/index_spec.rb36
-rw-r--r--spec/bundler/bundler/installer/gem_installer_spec.rb50
-rw-r--r--spec/bundler/bundler/installer/parallel_installer_spec.rb46
-rw-r--r--spec/bundler/bundler/installer/spec_installation_spec.rb66
-rw-r--r--spec/bundler/bundler/lockfile_parser_spec.rb153
-rw-r--r--spec/bundler/bundler/mirror_spec.rb331
-rw-r--r--spec/bundler/bundler/plugin/api/source_spec.rb88
-rw-r--r--spec/bundler/bundler/plugin/api_spec.rb83
-rw-r--r--spec/bundler/bundler/plugin/dsl_spec.rb38
-rw-r--r--spec/bundler/bundler/plugin/events_spec.rb22
-rw-r--r--spec/bundler/bundler/plugin/index_spec.rb204
-rw-r--r--spec/bundler/bundler/plugin/installer_spec.rb131
-rw-r--r--spec/bundler/bundler/plugin/source_list_spec.rb25
-rw-r--r--spec/bundler/bundler/plugin_spec.rb337
-rw-r--r--spec/bundler/bundler/remote_specification_spec.rb187
-rw-r--r--spec/bundler/bundler/resolver/candidate_spec.rb21
-rw-r--r--spec/bundler/bundler/retry_spec.rb81
-rw-r--r--spec/bundler/bundler/ruby_dsl_spec.rb120
-rw-r--r--spec/bundler/bundler/ruby_version_spec.rb500
-rw-r--r--spec/bundler/bundler/rubygems_integration_spec.rb104
-rw-r--r--spec/bundler/bundler/settings/validator_spec.rb111
-rw-r--r--spec/bundler/bundler/settings_spec.rb337
-rw-r--r--spec/bundler/bundler/shared_helpers_spec.rb506
-rw-r--r--spec/bundler/bundler/source/git/git_proxy_spec.rb150
-rw-r--r--spec/bundler/bundler/source/git_spec.rb73
-rw-r--r--spec/bundler/bundler/source/path_spec.rb31
-rw-r--r--spec/bundler/bundler/source/rubygems/remote_spec.rb172
-rw-r--r--spec/bundler/bundler/source/rubygems_spec.rb47
-rw-r--r--spec/bundler/bundler/source_list_spec.rb459
-rw-r--r--spec/bundler/bundler/source_spec.rb174
-rw-r--r--spec/bundler/bundler/spec_set_spec.rb77
-rw-r--r--spec/bundler/bundler/stub_specification_spec.rb47
-rw-r--r--spec/bundler/bundler/ui/shell_spec.rb60
-rw-r--r--spec/bundler/bundler/ui_spec.rb41
-rw-r--r--spec/bundler/bundler/uri_credentials_filter_spec.rb127
-rw-r--r--spec/bundler/bundler/worker_spec.rb69
-rw-r--r--spec/bundler/bundler/yaml_serializer_spec.rb194
-rw-r--r--spec/bundler/cache/cache_path_spec.rb32
-rw-r--r--spec/bundler/cache/gems_spec.rb327
-rw-r--r--spec/bundler/cache/git_spec.rb276
-rw-r--r--spec/bundler/cache/path_spec.rb169
-rw-r--r--spec/bundler/cache/platform_spec.rb49
-rw-r--r--spec/bundler/commands/add_spec.rb305
-rw-r--r--spec/bundler/commands/binstubs_spec.rb556
-rw-r--r--spec/bundler/commands/cache_spec.rb428
-rw-r--r--spec/bundler/commands/check_spec.rb554
-rw-r--r--spec/bundler/commands/clean_spec.rb916
-rw-r--r--spec/bundler/commands/config_spec.rb580
-rw-r--r--spec/bundler/commands/console_spec.rb141
-rw-r--r--spec/bundler/commands/doctor_spec.rb146
-rw-r--r--spec/bundler/commands/exec_spec.rb1254
-rw-r--r--spec/bundler/commands/fund_spec.rb82
-rw-r--r--spec/bundler/commands/help_spec.rb90
-rw-r--r--spec/bundler/commands/info_spec.rb249
-rw-r--r--spec/bundler/commands/init_spec.rb207
-rw-r--r--spec/bundler/commands/inject_spec.rb117
-rw-r--r--spec/bundler/commands/install_spec.rb1106
-rw-r--r--spec/bundler/commands/issue_spec.rb16
-rw-r--r--spec/bundler/commands/licenses_spec.rb37
-rw-r--r--spec/bundler/commands/list_spec.rb195
-rw-r--r--spec/bundler/commands/lock_spec.rb1273
-rw-r--r--spec/bundler/commands/newgem_spec.rb1662
-rw-r--r--spec/bundler/commands/open_spec.rb176
-rw-r--r--spec/bundler/commands/outdated_spec.rb1368
-rw-r--r--spec/bundler/commands/platform_spec.rb1307
-rw-r--r--spec/bundler/commands/post_bundle_message_spec.rb205
-rw-r--r--spec/bundler/commands/pristine_spec.rb221
-rw-r--r--spec/bundler/commands/remove_spec.rb732
-rw-r--r--spec/bundler/commands/show_spec.rb224
-rw-r--r--spec/bundler/commands/update_spec.rb1715
-rw-r--r--spec/bundler/commands/version_spec.rb47
-rw-r--r--spec/bundler/commands/viz_spec.rb144
-rw-r--r--spec/bundler/install/allow_offline_install_spec.rb99
-rw-r--r--spec/bundler/install/binstubs_spec.rb49
-rw-r--r--spec/bundler/install/bundler_spec.rb268
-rw-r--r--spec/bundler/install/deploy_spec.rb550
-rw-r--r--spec/bundler/install/failure_spec.rb51
-rw-r--r--spec/bundler/install/gemfile/eval_gemfile_spec.rb122
-rw-r--r--spec/bundler/install/gemfile/force_ruby_platform_spec.rb118
-rw-r--r--spec/bundler/install/gemfile/gemspec_spec.rb697
-rw-r--r--spec/bundler/install/gemfile/git_spec.rb1630
-rw-r--r--spec/bundler/install/gemfile/groups_spec.rb403
-rw-r--r--spec/bundler/install/gemfile/install_if_spec.rb44
-rw-r--r--spec/bundler/install/gemfile/lockfile_spec.rb48
-rw-r--r--spec/bundler/install/gemfile/path_spec.rb984
-rw-r--r--spec/bundler/install/gemfile/platform_spec.rb618
-rw-r--r--spec/bundler/install/gemfile/ruby_spec.rb123
-rw-r--r--spec/bundler/install/gemfile/sources_spec.rb1672
-rw-r--r--spec/bundler/install/gemfile/specific_platform_spec.rb971
-rw-r--r--spec/bundler/install/gemfile_spec.rb118
-rw-r--r--spec/bundler/install/gems/compact_index_spec.rb954
-rw-r--r--spec/bundler/install/gems/dependency_api_spec.rb759
-rw-r--r--spec/bundler/install/gems/env_spec.rb107
-rw-r--r--spec/bundler/install/gems/flex_spec.rb370
-rw-r--r--spec/bundler/install/gems/fund_spec.rb164
-rw-r--r--spec/bundler/install/gems/mirror_spec.rb39
-rw-r--r--spec/bundler/install/gems/native_extensions_spec.rb188
-rw-r--r--spec/bundler/install/gems/post_install_spec.rb150
-rw-r--r--spec/bundler/install/gems/resolving_spec.rb600
-rw-r--r--spec/bundler/install/gems/standalone_spec.rb515
-rw-r--r--spec/bundler/install/gems/win32_spec.rb25
-rw-r--r--spec/bundler/install/gemspecs_spec.rb161
-rw-r--r--spec/bundler/install/git_spec.rb174
-rw-r--r--spec/bundler/install/global_cache_spec.rb254
-rw-r--r--spec/bundler/install/path_spec.rb226
-rw-r--r--spec/bundler/install/prereleases_spec.rb54
-rw-r--r--spec/bundler/install/process_lock_spec.rb57
-rw-r--r--spec/bundler/install/redownload_spec.rb91
-rw-r--r--spec/bundler/install/security_policy_spec.rb72
-rw-r--r--spec/bundler/install/yanked_spec.rb233
-rw-r--r--spec/bundler/lock/git_spec.rb162
-rw-r--r--spec/bundler/lock/lockfile_spec.rb1608
-rw-r--r--spec/bundler/other/cli_dispatch_spec.rb20
-rw-r--r--spec/bundler/other/ext_spec.rb65
-rw-r--r--spec/bundler/other/major_deprecation_spec.rb649
-rw-r--r--spec/bundler/plugins/command_spec.rb78
-rw-r--r--spec/bundler/plugins/hook_spec.rb109
-rw-r--r--spec/bundler/plugins/install_spec.rb381
-rw-r--r--spec/bundler/plugins/list_spec.rb60
-rw-r--r--spec/bundler/plugins/source/example_spec.rb452
-rw-r--r--spec/bundler/plugins/source_spec.rb111
-rw-r--r--spec/bundler/plugins/uninstall_spec.rb49
-rw-r--r--spec/bundler/quality_es_spec.rb61
-rw-r--r--spec/bundler/quality_spec.rb245
-rw-r--r--spec/bundler/realworld/dependency_api_spec.rb46
-rw-r--r--spec/bundler/realworld/double_check_spec.rb40
-rw-r--r--spec/bundler/realworld/edgecases_spec.rb516
-rw-r--r--spec/bundler/realworld/ffi_spec.rb57
-rw-r--r--spec/bundler/realworld/fixtures/warbler/.gitignore1
-rw-r--r--spec/bundler/realworld/fixtures/warbler/Gemfile7
-rw-r--r--spec/bundler/realworld/fixtures/warbler/Gemfile.lock30
-rw-r--r--spec/bundler/realworld/fixtures/warbler/bin/warbler-example.rb3
-rw-r--r--spec/bundler/realworld/fixtures/warbler/demo/demo.gemspec10
-rw-r--r--spec/bundler/realworld/gemfile_source_header_spec.rb53
-rw-r--r--spec/bundler/realworld/git_spec.rb11
-rw-r--r--spec/bundler/realworld/mirror_probe_spec.rb131
-rw-r--r--spec/bundler/realworld/parallel_spec.rb66
-rw-r--r--spec/bundler/realworld/slow_perf_spec.rb33
-rw-r--r--spec/bundler/resolver/basic_spec.rb350
-rw-r--r--spec/bundler/resolver/platform_spec.rb427
-rw-r--r--spec/bundler/runtime/executable_spec.rb169
-rw-r--r--spec/bundler/runtime/gem_tasks_spec.rb106
-rw-r--r--spec/bundler/runtime/inline_spec.rb626
-rw-r--r--spec/bundler/runtime/load_spec.rb113
-rw-r--r--spec/bundler/runtime/platform_spec.rb464
-rw-r--r--spec/bundler/runtime/require_spec.rb465
-rw-r--r--spec/bundler/runtime/self_management_spec.rb126
-rw-r--r--spec/bundler/runtime/setup_spec.rb1557
-rw-r--r--spec/bundler/runtime/with_unbundled_env_spec.rb302
-rw-r--r--spec/bundler/spec_helper.rb119
-rw-r--r--spec/bundler/support/artifice/compact_index.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_api_missing.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/compact_index_checksum_mismatch.rb16
-rw-r--r--spec/bundler/support/artifice/compact_index_concurrent_download.rb32
-rw-r--r--spec/bundler/support/artifice/compact_index_creds_diff_host.rb39
-rw-r--r--spec/bundler/support/artifice/compact_index_extra.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_api.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_api_missing.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_missing.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_forbidden.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_host_redirect.rb21
-rw-r--r--spec/bundler/support/artifice/compact_index_no_gem.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_partial_update.rb38
-rw-r--r--spec/bundler/support/artifice/compact_index_partial_update_no_etag_not_incremental.rb40
-rw-r--r--spec/bundler/support/artifice/compact_index_precompiled_before.rb25
-rw-r--r--spec/bundler/support/artifice/compact_index_range_not_satisfiable.rb34
-rw-r--r--spec/bundler/support/artifice/compact_index_rate_limited.rb48
-rw-r--r--spec/bundler/support/artifice/compact_index_redirects.rb21
-rw-r--r--spec/bundler/support/artifice/compact_index_strict_basic_authentication.rb20
-rw-r--r--spec/bundler/support/artifice/compact_index_wrong_dependencies.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_wrong_gem_checksum.rb20
-rw-r--r--spec/bundler/support/artifice/endpoint.rb6
-rw-r--r--spec/bundler/support/artifice/endpoint_500.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_api_forbidden.rb13
-rw-r--r--spec/bundler/support/artifice/endpoint_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/endpoint_creds_diff_host.rb39
-rw-r--r--spec/bundler/support/artifice/endpoint_extra.rb33
-rw-r--r--spec/bundler/support/artifice/endpoint_extra_api.rb34
-rw-r--r--spec/bundler/support/artifice/endpoint_extra_missing.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_fallback.rb19
-rw-r--r--spec/bundler/support/artifice/endpoint_host_redirect.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_marshal_fail.rb6
-rw-r--r--spec/bundler/support/artifice/endpoint_marshal_fail_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/endpoint_mirror_source.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_redirect.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_strict_basic_authentication.rb20
-rw-r--r--spec/bundler/support/artifice/endpoint_timeout.rb15
-rw-r--r--spec/bundler/support/artifice/fail.rb29
-rw-r--r--spec/bundler/support/artifice/helpers/artifice.rb30
-rw-r--r--spec/bundler/support/artifice/helpers/compact_index.rb118
-rw-r--r--spec/bundler/support/artifice/helpers/compact_index_extra.rb33
-rw-r--r--spec/bundler/support/artifice/helpers/compact_index_extra_api.rb48
-rw-r--r--spec/bundler/support/artifice/helpers/endpoint.rb112
-rw-r--r--spec/bundler/support/artifice/helpers/endpoint_extra.rb29
-rw-r--r--spec/bundler/support/artifice/helpers/endpoint_fallback.rb15
-rw-r--r--spec/bundler/support/artifice/helpers/endpoint_marshal_fail.rb9
-rw-r--r--spec/bundler/support/artifice/helpers/rack_request.rb100
-rw-r--r--spec/bundler/support/artifice/used_cassettes.txt20908
-rw-r--r--spec/bundler/support/artifice/vcr.rb152
-rw-r--r--spec/bundler/support/artifice/windows.rb45
-rw-r--r--spec/bundler/support/build_metadata.rb49
-rw-r--r--spec/bundler/support/builders.rb677
-rw-r--r--spec/bundler/support/bundle.rb10
-rw-r--r--spec/bundler/support/command_execution.rb33
-rw-r--r--spec/bundler/support/filters.rb38
-rw-r--r--spec/bundler/support/hax.rb53
-rw-r--r--spec/bundler/support/helpers.rb597
-rw-r--r--spec/bundler/support/indexes.rb419
-rw-r--r--spec/bundler/support/matchers.rb237
-rw-r--r--spec/bundler/support/path.rb311
-rw-r--r--spec/bundler/support/permissions.rb12
-rw-r--r--spec/bundler/support/platforms.rb106
-rw-r--r--spec/bundler/support/rubygems_ext.rb177
-rw-r--r--spec/bundler/support/rubygems_version_manager.rb120
-rw-r--r--spec/bundler/support/silent_logger.rb10
-rw-r--r--spec/bundler/support/switch_rubygems.rb4
-rw-r--r--spec/bundler/support/the_bundle.rb35
-rw-r--r--spec/bundler/update/gemfile_spec.rb47
-rw-r--r--spec/bundler/update/gems/fund_spec.rb50
-rw-r--r--spec/bundler/update/gems/post_install_spec.rb76
-rw-r--r--spec/bundler/update/git_spec.rb336
-rw-r--r--spec/bundler/update/path_spec.rb19
-rw-r--r--spec/bundler/update/redownload_spec.rb34
-rw-r--r--spec/default.mspec74
-rw-r--r--spec/mspec/.rspec1
-rw-r--r--spec/mspec/Gemfile4
-rw-r--r--spec/mspec/Gemfile.lock26
-rw-r--r--spec/mspec/LICENSE22
-rw-r--r--spec/mspec/README.md84
-rw-r--r--spec/mspec/Rakefile6
-rwxr-xr-xspec/mspec/bin/mkspec7
-rwxr-xr-xspec/mspec/bin/mkspec.bat1
-rwxr-xr-xspec/mspec/bin/mspec7
-rwxr-xr-xspec/mspec/bin/mspec-ci7
-rwxr-xr-xspec/mspec/bin/mspec-ci.bat1
-rwxr-xr-xspec/mspec/bin/mspec-run7
-rwxr-xr-xspec/mspec/bin/mspec-run.bat1
-rwxr-xr-xspec/mspec/bin/mspec-tag7
-rwxr-xr-xspec/mspec/bin/mspec-tag.bat1
-rwxr-xr-xspec/mspec/bin/mspec.bat1
-rw-r--r--spec/mspec/lib/mspec.rb8
-rwxr-xr-xspec/mspec/lib/mspec/commands/mkspec.rb145
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-ci.rb79
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-run.rb87
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-tag.rb133
-rwxr-xr-xspec/mspec/lib/mspec/commands/mspec.rb120
-rw-r--r--spec/mspec/lib/mspec/expectations.rb2
-rw-r--r--spec/mspec/lib/mspec/expectations/expectations.rb39
-rw-r--r--spec/mspec/lib/mspec/expectations/should.rb41
-rw-r--r--spec/mspec/lib/mspec/guards.rb11
-rw-r--r--spec/mspec/lib/mspec/guards/block_device.rb16
-rw-r--r--spec/mspec/lib/mspec/guards/bug.rb29
-rw-r--r--spec/mspec/lib/mspec/guards/conflict.rb23
-rw-r--r--spec/mspec/lib/mspec/guards/endian.rb25
-rw-r--r--spec/mspec/lib/mspec/guards/feature.rb45
-rw-r--r--spec/mspec/lib/mspec/guards/guard.rb141
-rw-r--r--spec/mspec/lib/mspec/guards/platform.rb104
-rw-r--r--spec/mspec/lib/mspec/guards/quarantine.rb11
-rw-r--r--spec/mspec/lib/mspec/guards/superuser.rb25
-rw-r--r--spec/mspec/lib/mspec/guards/support.rb14
-rw-r--r--spec/mspec/lib/mspec/guards/version.rb72
-rw-r--r--spec/mspec/lib/mspec/helpers.rb13
-rw-r--r--spec/mspec/lib/mspec/helpers/argf.rb35
-rw-r--r--spec/mspec/lib/mspec/helpers/argv.rb44
-rw-r--r--spec/mspec/lib/mspec/helpers/datetime.rb48
-rw-r--r--spec/mspec/lib/mspec/helpers/fixture.rb24
-rw-r--r--spec/mspec/lib/mspec/helpers/flunk.rb3
-rw-r--r--spec/mspec/lib/mspec/helpers/fs.rb64
-rw-r--r--spec/mspec/lib/mspec/helpers/io.rb87
-rw-r--r--spec/mspec/lib/mspec/helpers/mock_to_path.rb6
-rw-r--r--spec/mspec/lib/mspec/helpers/numeric.rb80
-rw-r--r--spec/mspec/lib/mspec/helpers/ruby_exe.rb189
-rw-r--r--spec/mspec/lib/mspec/helpers/scratch.rb21
-rw-r--r--spec/mspec/lib/mspec/helpers/tmp.rb48
-rw-r--r--spec/mspec/lib/mspec/helpers/warning.rb21
-rw-r--r--spec/mspec/lib/mspec/matchers.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/base.rb79
-rw-r--r--spec/mspec/lib/mspec/matchers/be_an_instance_of.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/be_ancestor_of.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/be_close.rb29
-rw-r--r--spec/mspec/lib/mspec/matchers/be_computed_by.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/be_empty.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_false.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_kind_of.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/be_nan.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_nil.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_true.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_true_or_false.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/block_caller.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/complain.rb71
-rw-r--r--spec/mspec/lib/mspec/matchers/eql.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/equal.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/equal_element.rb78
-rw-r--r--spec/mspec/lib/mspec/matchers/have_class_variable.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_constant.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_instance_variable.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_private_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_private_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_protected_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_public_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_singleton_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/include.rb31
-rw-r--r--spec/mspec/lib/mspec/matchers/include_any_of.rb29
-rw-r--r--spec/mspec/lib/mspec/matchers/infinity.rb28
-rw-r--r--spec/mspec/lib/mspec/matchers/match_yaml.rb50
-rw-r--r--spec/mspec/lib/mspec/matchers/method.rb10
-rw-r--r--spec/mspec/lib/mspec/matchers/output.rb67
-rw-r--r--spec/mspec/lib/mspec/matchers/output_to_fd.rb71
-rw-r--r--spec/mspec/lib/mspec/matchers/raise_error.rb93
-rw-r--r--spec/mspec/lib/mspec/matchers/respond_to.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/signed_zero.rb28
-rw-r--r--spec/mspec/lib/mspec/matchers/skip.rb5
-rw-r--r--spec/mspec/lib/mspec/matchers/variable.rb24
-rw-r--r--spec/mspec/lib/mspec/mocks.rb3
-rw-r--r--spec/mspec/lib/mspec/mocks/mock.rb212
-rw-r--r--spec/mspec/lib/mspec/mocks/object.rb28
-rw-r--r--spec/mspec/lib/mspec/mocks/proxy.rb186
-rw-r--r--spec/mspec/lib/mspec/runner.rb12
-rw-r--r--spec/mspec/lib/mspec/runner/actions.rb6
-rw-r--r--spec/mspec/lib/mspec/runner/actions/constants_leak_checker.rb84
-rw-r--r--spec/mspec/lib/mspec/runner/actions/filter.rb40
-rw-r--r--spec/mspec/lib/mspec/runner/actions/leakchecker.rb319
-rw-r--r--spec/mspec/lib/mspec/runner/actions/profile.rb60
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tag.rb133
-rw-r--r--spec/mspec/lib/mspec/runner/actions/taglist.rb56
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tagpurge.rb56
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tally.rb133
-rw-r--r--spec/mspec/lib/mspec/runner/actions/timeout.rb93
-rw-r--r--spec/mspec/lib/mspec/runner/actions/timer.rb22
-rw-r--r--spec/mspec/lib/mspec/runner/context.rb237
-rw-r--r--spec/mspec/lib/mspec/runner/evaluate.rb54
-rw-r--r--spec/mspec/lib/mspec/runner/example.rb34
-rw-r--r--spec/mspec/lib/mspec/runner/exception.rb54
-rw-r--r--spec/mspec/lib/mspec/runner/filters.rb4
-rw-r--r--spec/mspec/lib/mspec/runner/filters/match.rb18
-rw-r--r--spec/mspec/lib/mspec/runner/filters/profile.rb54
-rw-r--r--spec/mspec/lib/mspec/runner/filters/regexp.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/filters/tag.rb29
-rw-r--r--spec/mspec/lib/mspec/runner/formatters.rb13
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/base.rb144
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/describe.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/dotted.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/file.rb24
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/html.rb81
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/junit.rb87
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/method.rb95
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/multi.rb47
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/profile.rb18
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/specdoc.rb41
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/spinner.rb111
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/stats.rb57
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/summary.rb4
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/unit.rb20
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/yaml.rb38
-rw-r--r--spec/mspec/lib/mspec/runner/mspec.rb422
-rw-r--r--spec/mspec/lib/mspec/runner/object.rb26
-rw-r--r--spec/mspec/lib/mspec/runner/parallel.rb98
-rw-r--r--spec/mspec/lib/mspec/runner/shared.rb14
-rw-r--r--spec/mspec/lib/mspec/runner/tag.rb38
-rw-r--r--spec/mspec/lib/mspec/utils/deprecate.rb6
-rw-r--r--spec/mspec/lib/mspec/utils/format.rb24
-rw-r--r--spec/mspec/lib/mspec/utils/name_map.rb126
-rw-r--r--spec/mspec/lib/mspec/utils/options.rb504
-rw-r--r--spec/mspec/lib/mspec/utils/script.rb299
-rw-r--r--spec/mspec/lib/mspec/utils/version.rb52
-rw-r--r--spec/mspec/lib/mspec/utils/warnings.rb53
-rw-r--r--spec/mspec/lib/mspec/version.rb5
-rw-r--r--spec/mspec/spec/commands/fixtures/four.txt0
-rw-r--r--spec/mspec/spec/commands/fixtures/level2/three_spec.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/one_spec.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/three.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/two_spec.rb1
-rw-r--r--spec/mspec/spec/commands/mkspec_spec.rb363
-rw-r--r--spec/mspec/spec/commands/mspec_ci_spec.rb150
-rw-r--r--spec/mspec/spec/commands/mspec_run_spec.rb173
-rw-r--r--spec/mspec/spec/commands/mspec_spec.rb207
-rw-r--r--spec/mspec/spec/commands/mspec_tag_spec.rb414
-rw-r--r--spec/mspec/spec/expectations/expectations_spec.rb29
-rw-r--r--spec/mspec/spec/expectations/should_spec.rb61
-rw-r--r--spec/mspec/spec/fixtures/a_spec.rb15
-rw-r--r--spec/mspec/spec/fixtures/b_spec.rb7
-rw-r--r--spec/mspec/spec/fixtures/chatty_spec.rb8
-rw-r--r--spec/mspec/spec/fixtures/config.mspec8
-rw-r--r--spec/mspec/spec/fixtures/die_spec.rb7
-rwxr-xr-xspec/mspec/spec/fixtures/my_ruby4
-rw-r--r--spec/mspec/spec/fixtures/object_methods_spec.rb8
-rw-r--r--spec/mspec/spec/fixtures/print_interpreter_spec.rb4
-rw-r--r--spec/mspec/spec/fixtures/should.rb75
-rw-r--r--spec/mspec/spec/fixtures/tagging_spec.rb16
-rw-r--r--spec/mspec/spec/guards/block_device_spec.rb46
-rw-r--r--spec/mspec/spec/guards/bug_spec.rb151
-rw-r--r--spec/mspec/spec/guards/conflict_spec.rb53
-rw-r--r--spec/mspec/spec/guards/endian_spec.rb55
-rw-r--r--spec/mspec/spec/guards/feature_spec.rb120
-rw-r--r--spec/mspec/spec/guards/guard_spec.rb421
-rw-r--r--spec/mspec/spec/guards/platform_spec.rb337
-rw-r--r--spec/mspec/spec/guards/quarantine_spec.rb35
-rw-r--r--spec/mspec/spec/guards/superuser_spec.rb35
-rw-r--r--spec/mspec/spec/guards/support_spec.rb54
-rw-r--r--spec/mspec/spec/guards/user_spec.rb20
-rw-r--r--spec/mspec/spec/guards/version_spec.rb112
-rw-r--r--spec/mspec/spec/helpers/argf_spec.rb37
-rw-r--r--spec/mspec/spec/helpers/argv_spec.rb27
-rw-r--r--spec/mspec/spec/helpers/datetime_spec.rb44
-rw-r--r--spec/mspec/spec/helpers/fixture_spec.rb25
-rw-r--r--spec/mspec/spec/helpers/flunk_spec.rb20
-rw-r--r--spec/mspec/spec/helpers/fs_spec.rb195
-rw-r--r--spec/mspec/spec/helpers/io_spec.rb136
-rw-r--r--spec/mspec/spec/helpers/mock_to_path_spec.rb23
-rw-r--r--spec/mspec/spec/helpers/numeric_spec.rb31
-rw-r--r--spec/mspec/spec/helpers/ruby_exe_spec.rb256
-rw-r--r--spec/mspec/spec/helpers/scratch_spec.rb24
-rw-r--r--spec/mspec/spec/helpers/suppress_warning_spec.rb19
-rw-r--r--spec/mspec/spec/helpers/tmp_spec.rb27
-rw-r--r--spec/mspec/spec/integration/interpreter_spec.rb18
-rw-r--r--spec/mspec/spec/integration/object_methods_spec.rb18
-rw-r--r--spec/mspec/spec/integration/run_spec.rb71
-rw-r--r--spec/mspec/spec/integration/tag_spec.rb59
-rw-r--r--spec/mspec/spec/matchers/base_spec.rb228
-rw-r--r--spec/mspec/spec/matchers/be_an_instance_of_spec.rb50
-rw-r--r--spec/mspec/spec/matchers/be_ancestor_of_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_close_spec.rb48
-rw-r--r--spec/mspec/spec/matchers/be_computed_by_spec.rb42
-rw-r--r--spec/mspec/spec/matchers/be_empty_spec.rb26
-rw-r--r--spec/mspec/spec/matchers/be_false_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_kind_of_spec.rb31
-rw-r--r--spec/mspec/spec/matchers/be_nan_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_nil_spec.rb27
-rw-r--r--spec/mspec/spec/matchers/be_true_or_false_spec.rb19
-rw-r--r--spec/mspec/spec/matchers/be_true_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/block_caller_spec.rb13
-rw-r--r--spec/mspec/spec/matchers/complain_spec.rb102
-rw-r--r--spec/mspec/spec/matchers/eql_spec.rb33
-rw-r--r--spec/mspec/spec/matchers/equal_element_spec.rb75
-rw-r--r--spec/mspec/spec/matchers/equal_spec.rb32
-rw-r--r--spec/mspec/spec/matchers/have_class_variable_spec.rb49
-rw-r--r--spec/mspec/spec/matchers/have_constant_spec.rb37
-rw-r--r--spec/mspec/spec/matchers/have_instance_method_spec.rb53
-rw-r--r--spec/mspec/spec/matchers/have_instance_variable_spec.rb50
-rw-r--r--spec/mspec/spec/matchers/have_method_spec.rb55
-rw-r--r--spec/mspec/spec/matchers/have_private_instance_method_spec.rb57
-rw-r--r--spec/mspec/spec/matchers/have_private_method_spec.rb44
-rw-r--r--spec/mspec/spec/matchers/have_protected_instance_method_spec.rb57
-rw-r--r--spec/mspec/spec/matchers/have_public_instance_method_spec.rb53
-rw-r--r--spec/mspec/spec/matchers/have_singleton_method_spec.rb45
-rw-r--r--spec/mspec/spec/matchers/include_any_of_spec.rb42
-rw-r--r--spec/mspec/spec/matchers/include_spec.rb37
-rw-r--r--spec/mspec/spec/matchers/infinity_spec.rb34
-rw-r--r--spec/mspec/spec/matchers/match_yaml_spec.rb39
-rw-r--r--spec/mspec/spec/matchers/output_spec.rb84
-rw-r--r--spec/mspec/spec/matchers/output_to_fd_spec.rb44
-rw-r--r--spec/mspec/spec/matchers/raise_error_spec.rb183
-rw-r--r--spec/mspec/spec/matchers/respond_to_spec.rb33
-rw-r--r--spec/mspec/spec/matchers/signed_zero_spec.rb32
-rw-r--r--spec/mspec/spec/mocks/mock_spec.rb530
-rw-r--r--spec/mspec/spec/mocks/proxy_spec.rb405
-rw-r--r--spec/mspec/spec/runner/actions/filter_spec.rb84
-rw-r--r--spec/mspec/spec/runner/actions/tag_spec.rb313
-rw-r--r--spec/mspec/spec/runner/actions/taglist_spec.rb152
-rw-r--r--spec/mspec/spec/runner/actions/tagpurge_spec.rb154
-rw-r--r--spec/mspec/spec/runner/actions/tally_spec.rb355
-rw-r--r--spec/mspec/spec/runner/actions/timer_spec.rb44
-rw-r--r--spec/mspec/spec/runner/context_spec.rb1028
-rw-r--r--spec/mspec/spec/runner/example_spec.rb117
-rw-r--r--spec/mspec/spec/runner/exception_spec.rb146
-rw-r--r--spec/mspec/spec/runner/filters/a.yaml4
-rw-r--r--spec/mspec/spec/runner/filters/b.yaml11
-rw-r--r--spec/mspec/spec/runner/filters/match_spec.rb34
-rw-r--r--spec/mspec/spec/runner/filters/profile_spec.rb117
-rw-r--r--spec/mspec/spec/runner/filters/regexp_spec.rb31
-rw-r--r--spec/mspec/spec/runner/filters/tag_spec.rb92
-rw-r--r--spec/mspec/spec/runner/formatters/describe_spec.rb67
-rw-r--r--spec/mspec/spec/runner/formatters/dotted_spec.rb284
-rw-r--r--spec/mspec/spec/runner/formatters/file_spec.rb84
-rw-r--r--spec/mspec/spec/runner/formatters/html_spec.rb220
-rw-r--r--spec/mspec/spec/runner/formatters/junit_spec.rb159
-rw-r--r--spec/mspec/spec/runner/formatters/method_spec.rb177
-rw-r--r--spec/mspec/spec/runner/formatters/multi_spec.rb68
-rw-r--r--spec/mspec/spec/runner/formatters/specdoc_spec.rb106
-rw-r--r--spec/mspec/spec/runner/formatters/spinner_spec.rb83
-rw-r--r--spec/mspec/spec/runner/formatters/summary_spec.rb26
-rw-r--r--spec/mspec/spec/runner/formatters/unit_spec.rb73
-rw-r--r--spec/mspec/spec/runner/formatters/yaml_spec.rb134
-rw-r--r--spec/mspec/spec/runner/mspec_spec.rb597
-rw-r--r--spec/mspec/spec/runner/shared_spec.rb90
-rw-r--r--spec/mspec/spec/runner/tag_spec.rb123
-rw-r--r--spec/mspec/spec/runner/tags.txt4
-rw-r--r--spec/mspec/spec/spec_helper.rb68
-rw-r--r--spec/mspec/spec/utils/deprecate_spec.rb17
-rw-r--r--spec/mspec/spec/utils/name_map_spec.rb175
-rw-r--r--spec/mspec/spec/utils/options_spec.rb1302
-rw-r--r--spec/mspec/spec/utils/script_spec.rb470
-rw-r--r--spec/mspec/spec/utils/version_spec.rb45
-rwxr-xr-xspec/mspec/tool/find.rb10
-rwxr-xr-xspec/mspec/tool/pull-latest-mspec-spec26
-rw-r--r--spec/mspec/tool/remove_old_guards.rb70
-rw-r--r--spec/mspec/tool/sync/.gitignore4
-rw-r--r--spec/mspec/tool/sync/sync-rubyspec.rb254
-rwxr-xr-xspec/mspec/tool/tag_from_output.rb63
-rwxr-xr-xspec/mspec/tool/wrap_with_guard.rb28
-rw-r--r--spec/ruby/.gitignore5
-rw-r--r--spec/ruby/.mspec.constants234
-rw-r--r--spec/ruby/.rubocop.yml185
-rw-r--r--spec/ruby/.rubocop_todo.yml137
-rw-r--r--spec/ruby/CONTRIBUTING.md295
-rw-r--r--spec/ruby/LICENSE22
-rw-r--r--spec/ruby/README.md157
-rw-r--r--spec/ruby/TODO8
-rw-r--r--spec/ruby/command_line/backtrace_limit_spec.rb48
-rw-r--r--spec/ruby/command_line/dash_a_spec.rb19
-rw-r--r--spec/ruby/command_line/dash_c_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_d_spec.rb22
-rw-r--r--spec/ruby/command_line/dash_e_spec.rb41
-rw-r--r--spec/ruby/command_line/dash_encoding_spec.rb36
-rw-r--r--spec/ruby/command_line/dash_external_encoding_spec.rb15
-rw-r--r--spec/ruby/command_line/dash_internal_encoding_spec.rb15
-rw-r--r--spec/ruby/command_line/dash_l_spec.rb31
-rw-r--r--spec/ruby/command_line/dash_n_spec.rb36
-rw-r--r--spec/ruby/command_line/dash_p_spec.rb19
-rw-r--r--spec/ruby/command_line/dash_r_spec.rb28
-rw-r--r--spec/ruby/command_line/dash_s_spec.rb52
-rw-r--r--spec/ruby/command_line/dash_upper_c_spec.rb6
-rw-r--r--spec/ruby/command_line/dash_upper_e_spec.rb37
-rw-r--r--spec/ruby/command_line/dash_upper_f_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_upper_i_spec.rb51
-rw-r--r--spec/ruby/command_line/dash_upper_k_spec.rb65
-rw-r--r--spec/ruby/command_line/dash_upper_s_spec.rb29
-rw-r--r--spec/ruby/command_line/dash_upper_u_spec.rb45
-rw-r--r--spec/ruby/command_line/dash_upper_w_spec.rb44
-rw-r--r--spec/ruby/command_line/dash_upper_x_spec.rb6
-rw-r--r--spec/ruby/command_line/dash_v_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_w_spec.rb10
-rw-r--r--spec/ruby/command_line/dash_x_spec.rb21
-rw-r--r--spec/ruby/command_line/error_message_spec.rb11
-rw-r--r--spec/ruby/command_line/feature_spec.rb71
-rw-r--r--spec/ruby/command_line/fixtures/backtrace.rb35
-rw-r--r--spec/ruby/command_line/fixtures/bad_syntax.rb1
-rw-r--r--spec/ruby/command_line/fixtures/bin/bad_embedded_ruby.txt3
-rw-r--r--spec/ruby/command_line/fixtures/bin/dash_s_fail1
-rw-r--r--spec/ruby/command_line/fixtures/bin/embedded_ruby.txt3
-rw-r--r--spec/ruby/command_line/fixtures/bin/hybrid_launcher.sh4
-rwxr-xr-xspec/ruby/command_line/fixtures/bin/launcher.rb2
-rw-r--r--spec/ruby/command_line/fixtures/change_directory_script.rb1
-rw-r--r--spec/ruby/command_line/fixtures/conditional_range.txt5
-rw-r--r--spec/ruby/command_line/fixtures/dash_s_script.rb12
-rw-r--r--spec/ruby/command_line/fixtures/debug.rb10
-rw-r--r--spec/ruby/command_line/fixtures/debug_info.rb11
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_across_files.rb3
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_across_files_diff_enc.rb3
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_one_literal.rb2
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_required.rb1
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_required_diff_enc.rbbin0 -> 121 bytes-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_two_literals.rb1
-rw-r--r--spec/ruby/command_line/fixtures/full_names.txt3
-rw-r--r--spec/ruby/command_line/fixtures/loadpath.rb1
-rw-r--r--spec/ruby/command_line/fixtures/names.txt3
-rw-r--r--spec/ruby/command_line/fixtures/passwd_file.txt3
-rw-r--r--spec/ruby/command_line/fixtures/require.rb1
-rw-r--r--spec/ruby/command_line/fixtures/rubyopt.rb1
-rw-r--r--spec/ruby/command_line/fixtures/test_file.rb1
-rw-r--r--spec/ruby/command_line/fixtures/verbose.rb1
-rw-r--r--spec/ruby/command_line/frozen_strings_spec.rb29
-rw-r--r--spec/ruby/command_line/rubylib_spec.rb69
-rw-r--r--spec/ruby/command_line/rubyopt_spec.rb185
-rw-r--r--spec/ruby/command_line/shared/change_directory.rb21
-rw-r--r--spec/ruby/command_line/shared/verbose.rb9
-rw-r--r--spec/ruby/command_line/syntax_error_spec.rb13
-rw-r--r--spec/ruby/core/argf/argf_spec.rb11
-rw-r--r--spec/ruby/core/argf/argv_spec.rb19
-rw-r--r--spec/ruby/core/argf/binmode_spec.rb43
-rw-r--r--spec/ruby/core/argf/bytes_spec.rb16
-rw-r--r--spec/ruby/core/argf/chars_spec.rb16
-rw-r--r--spec/ruby/core/argf/close_spec.rb35
-rw-r--r--spec/ruby/core/argf/closed_spec.rb18
-rw-r--r--spec/ruby/core/argf/codepoints_spec.rb16
-rw-r--r--spec/ruby/core/argf/each_byte_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_char_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_codepoint_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_line_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_spec.rb6
-rw-r--r--spec/ruby/core/argf/eof_spec.rb10
-rw-r--r--spec/ruby/core/argf/file_spec.rb21
-rw-r--r--spec/ruby/core/argf/filename_spec.rb6
-rw-r--r--spec/ruby/core/argf/fileno_spec.rb6
-rw-r--r--spec/ruby/core/argf/fixtures/bin_file.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/file1.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/file2.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/filename.rb3
-rw-r--r--spec/ruby/core/argf/fixtures/lineno.rb5
-rw-r--r--spec/ruby/core/argf/fixtures/rewind.rb5
-rw-r--r--spec/ruby/core/argf/fixtures/stdin.txt2
-rw-r--r--spec/ruby/core/argf/getc_spec.rb20
-rw-r--r--spec/ruby/core/argf/gets_spec.rb49
-rw-r--r--spec/ruby/core/argf/lineno_spec.rb30
-rw-r--r--spec/ruby/core/argf/lines_spec.rb16
-rw-r--r--spec/ruby/core/argf/path_spec.rb6
-rw-r--r--spec/ruby/core/argf/pos_spec.rb38
-rw-r--r--spec/ruby/core/argf/read_nonblock_spec.rb80
-rw-r--r--spec/ruby/core/argf/read_spec.rb85
-rw-r--r--spec/ruby/core/argf/readchar_spec.rb19
-rw-r--r--spec/ruby/core/argf/readline_spec.rb23
-rw-r--r--spec/ruby/core/argf/readlines_spec.rb6
-rw-r--r--spec/ruby/core/argf/readpartial_spec.rb75
-rw-r--r--spec/ruby/core/argf/rewind_spec.rb39
-rw-r--r--spec/ruby/core/argf/seek_spec.rb63
-rw-r--r--spec/ruby/core/argf/set_encoding_spec.rb41
-rw-r--r--spec/ruby/core/argf/shared/each_byte.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_char.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_codepoint.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_line.rb62
-rw-r--r--spec/ruby/core/argf/shared/eof.rb24
-rw-r--r--spec/ruby/core/argf/shared/filename.rb28
-rw-r--r--spec/ruby/core/argf/shared/fileno.rb24
-rw-r--r--spec/ruby/core/argf/shared/getc.rb17
-rw-r--r--spec/ruby/core/argf/shared/gets.rb99
-rw-r--r--spec/ruby/core/argf/shared/pos.rb31
-rw-r--r--spec/ruby/core/argf/shared/read.rb58
-rw-r--r--spec/ruby/core/argf/shared/readlines.rb22
-rw-r--r--spec/ruby/core/argf/skip_spec.rb42
-rw-r--r--spec/ruby/core/argf/tell_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_a_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_i_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_io_spec.rb23
-rw-r--r--spec/ruby/core/argf/to_s_spec.rb14
-rw-r--r--spec/ruby/core/array/allocate_spec.rb19
-rw-r--r--spec/ruby/core/array/any_spec.rb37
-rw-r--r--spec/ruby/core/array/append_spec.rb40
-rw-r--r--spec/ruby/core/array/array_spec.rb7
-rw-r--r--spec/ruby/core/array/assoc_spec.rb40
-rw-r--r--spec/ruby/core/array/at_spec.rb56
-rw-r--r--spec/ruby/core/array/bsearch_index_spec.rb85
-rw-r--r--spec/ruby/core/array/bsearch_spec.rb84
-rw-r--r--spec/ruby/core/array/clear_spec.rb32
-rw-r--r--spec/ruby/core/array/clone_spec.rb31
-rw-r--r--spec/ruby/core/array/collect_spec.rb11
-rw-r--r--spec/ruby/core/array/combination_spec.rb74
-rw-r--r--spec/ruby/core/array/compact_spec.rb51
-rw-r--r--spec/ruby/core/array/comparison_spec.rb97
-rw-r--r--spec/ruby/core/array/concat_spec.rb74
-rw-r--r--spec/ruby/core/array/constructor_spec.rb24
-rw-r--r--spec/ruby/core/array/count_spec.rb15
-rw-r--r--spec/ruby/core/array/cycle_spec.rb101
-rw-r--r--spec/ruby/core/array/deconstruct_spec.rb9
-rw-r--r--spec/ruby/core/array/delete_at_spec.rb41
-rw-r--r--spec/ruby/core/array/delete_if_spec.rb52
-rw-r--r--spec/ruby/core/array/delete_spec.rb46
-rw-r--r--spec/ruby/core/array/difference_spec.rb22
-rw-r--r--spec/ruby/core/array/dig_spec.rb52
-rw-r--r--spec/ruby/core/array/drop_spec.rb64
-rw-r--r--spec/ruby/core/array/drop_while_spec.rb28
-rw-r--r--spec/ruby/core/array/dup_spec.rb31
-rw-r--r--spec/ruby/core/array/each_index_spec.rb42
-rw-r--r--spec/ruby/core/array/each_spec.rb77
-rw-r--r--spec/ruby/core/array/element_reference_spec.rb50
-rw-r--r--spec/ruby/core/array/element_set_spec.rb537
-rw-r--r--spec/ruby/core/array/empty_spec.rb10
-rw-r--r--spec/ruby/core/array/eql_spec.rb19
-rw-r--r--spec/ruby/core/array/equal_value_spec.rb51
-rw-r--r--spec/ruby/core/array/fetch_spec.rb55
-rw-r--r--spec/ruby/core/array/fill_spec.rb336
-rw-r--r--spec/ruby/core/array/filter_spec.rb14
-rw-r--r--spec/ruby/core/array/find_index_spec.rb6
-rw-r--r--spec/ruby/core/array/first_spec.rb93
-rw-r--r--spec/ruby/core/array/fixtures/classes.rb584
-rw-r--r--spec/ruby/core/array/fixtures/encoded_strings.rb69
-rw-r--r--spec/ruby/core/array/flatten_spec.rb278
-rw-r--r--spec/ruby/core/array/frozen_spec.rb16
-rw-r--r--spec/ruby/core/array/hash_spec.rb83
-rw-r--r--spec/ruby/core/array/include_spec.rb33
-rw-r--r--spec/ruby/core/array/index_spec.rb6
-rw-r--r--spec/ruby/core/array/initialize_spec.rb156
-rw-r--r--spec/ruby/core/array/insert_spec.rb78
-rw-r--r--spec/ruby/core/array/inspect_spec.rb7
-rw-r--r--spec/ruby/core/array/intersect_spec.rb17
-rw-r--r--spec/ruby/core/array/intersection_spec.rb19
-rw-r--r--spec/ruby/core/array/join_spec.rb50
-rw-r--r--spec/ruby/core/array/keep_if_spec.rb11
-rw-r--r--spec/ruby/core/array/last_spec.rb87
-rw-r--r--spec/ruby/core/array/length_spec.rb7
-rw-r--r--spec/ruby/core/array/map_spec.rb11
-rw-r--r--spec/ruby/core/array/max_spec.rb116
-rw-r--r--spec/ruby/core/array/min_spec.rb121
-rw-r--r--spec/ruby/core/array/minmax_spec.rb14
-rw-r--r--spec/ruby/core/array/minus_spec.rb7
-rw-r--r--spec/ruby/core/array/multiply_spec.rb104
-rw-r--r--spec/ruby/core/array/new_spec.rb122
-rw-r--r--spec/ruby/core/array/pack/a_spec.rb73
-rw-r--r--spec/ruby/core/array/pack/at_spec.rb30
-rw-r--r--spec/ruby/core/array/pack/b_spec.rb113
-rw-r--r--spec/ruby/core/array/pack/buffer_spec.rb50
-rw-r--r--spec/ruby/core/array/pack/c_spec.rb85
-rw-r--r--spec/ruby/core/array/pack/comment_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/d_spec.rb39
-rw-r--r--spec/ruby/core/array/pack/e_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/empty_spec.rb11
-rw-r--r--spec/ruby/core/array/pack/f_spec.rb39
-rw-r--r--spec/ruby/core/array/pack/g_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/h_spec.rb205
-rw-r--r--spec/ruby/core/array/pack/i_spec.rb133
-rw-r--r--spec/ruby/core/array/pack/j_spec.rb217
-rw-r--r--spec/ruby/core/array/pack/l_spec.rb221
-rw-r--r--spec/ruby/core/array/pack/m_spec.rb317
-rw-r--r--spec/ruby/core/array/pack/n_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/p_spec.rb38
-rw-r--r--spec/ruby/core/array/pack/percent_spec.rb7
-rw-r--r--spec/ruby/core/array/pack/q_spec.rb61
-rw-r--r--spec/ruby/core/array/pack/s_spec.rb133
-rw-r--r--spec/ruby/core/array/pack/shared/basic.rb97
-rw-r--r--spec/ruby/core/array/pack/shared/encodings.rb16
-rw-r--r--spec/ruby/core/array/pack/shared/float.rb287
-rw-r--r--spec/ruby/core/array/pack/shared/integer.rb441
-rw-r--r--spec/ruby/core/array/pack/shared/numeric_basic.rb50
-rw-r--r--spec/ruby/core/array/pack/shared/string.rb48
-rw-r--r--spec/ruby/core/array/pack/shared/taint.rb2
-rw-r--r--spec/ruby/core/array/pack/shared/unicode.rb104
-rw-r--r--spec/ruby/core/array/pack/u_spec.rb140
-rw-r--r--spec/ruby/core/array/pack/v_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/w_spec.rb52
-rw-r--r--spec/ruby/core/array/pack/x_spec.rb65
-rw-r--r--spec/ruby/core/array/pack/z_spec.rb44
-rw-r--r--spec/ruby/core/array/partition_spec.rb43
-rw-r--r--spec/ruby/core/array/permutation_spec.rb138
-rw-r--r--spec/ruby/core/array/plus_spec.rb43
-rw-r--r--spec/ruby/core/array/pop_spec.rb124
-rw-r--r--spec/ruby/core/array/prepend_spec.rb7
-rw-r--r--spec/ruby/core/array/product_spec.rb68
-rw-r--r--spec/ruby/core/array/push_spec.rb7
-rw-r--r--spec/ruby/core/array/rassoc_spec.rb38
-rw-r--r--spec/ruby/core/array/reject_spec.rb143
-rw-r--r--spec/ruby/core/array/repeated_combination_spec.rb84
-rw-r--r--spec/ruby/core/array/repeated_permutation_spec.rb94
-rw-r--r--spec/ruby/core/array/replace_spec.rb7
-rw-r--r--spec/ruby/core/array/reverse_each_spec.rb43
-rw-r--r--spec/ruby/core/array/reverse_spec.rb42
-rw-r--r--spec/ruby/core/array/rindex_spec.rb80
-rw-r--r--spec/ruby/core/array/rotate_spec.rb129
-rw-r--r--spec/ruby/core/array/sample_spec.rb144
-rw-r--r--spec/ruby/core/array/select_spec.rb14
-rw-r--r--spec/ruby/core/array/shared/clone.rb20
-rw-r--r--spec/ruby/core/array/shared/collect.rb109
-rw-r--r--spec/ruby/core/array/shared/delete_if.rb13
-rw-r--r--spec/ruby/core/array/shared/difference.rb78
-rw-r--r--spec/ruby/core/array/shared/enumeratorize.rb5
-rw-r--r--spec/ruby/core/array/shared/eql.rb92
-rw-r--r--spec/ruby/core/array/shared/index.rb37
-rw-r--r--spec/ruby/core/array/shared/inspect.rb107
-rw-r--r--spec/ruby/core/array/shared/intersection.rb84
-rw-r--r--spec/ruby/core/array/shared/join.rb112
-rw-r--r--spec/ruby/core/array/shared/keep_if.rb60
-rw-r--r--spec/ruby/core/array/shared/length.rb11
-rw-r--r--spec/ruby/core/array/shared/push.rb33
-rw-r--r--spec/ruby/core/array/shared/replace.rb60
-rw-r--r--spec/ruby/core/array/shared/select.rb32
-rw-r--r--spec/ruby/core/array/shared/slice.rb889
-rw-r--r--spec/ruby/core/array/shared/union.rb79
-rw-r--r--spec/ruby/core/array/shared/unshift.rb64
-rw-r--r--spec/ruby/core/array/shift_spec.rb120
-rw-r--r--spec/ruby/core/array/shuffle_spec.rb96
-rw-r--r--spec/ruby/core/array/size_spec.rb7
-rw-r--r--spec/ruby/core/array/slice_spec.rb246
-rw-r--r--spec/ruby/core/array/sort_by_spec.rb52
-rw-r--r--spec/ruby/core/array/sort_spec.rb252
-rw-r--r--spec/ruby/core/array/sum_spec.rb71
-rw-r--r--spec/ruby/core/array/take_spec.rb40
-rw-r--r--spec/ruby/core/array/take_while_spec.rb28
-rw-r--r--spec/ruby/core/array/to_a_spec.rb24
-rw-r--r--spec/ruby/core/array/to_ary_spec.rb20
-rw-r--r--spec/ruby/core/array/to_h_spec.rb79
-rw-r--r--spec/ruby/core/array/to_s_spec.rb8
-rw-r--r--spec/ruby/core/array/transpose_spec.rb53
-rw-r--r--spec/ruby/core/array/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/array/union_spec.rb25
-rw-r--r--spec/ruby/core/array/uniq_spec.rb217
-rw-r--r--spec/ruby/core/array/unshift_spec.rb7
-rw-r--r--spec/ruby/core/array/values_at_spec.rb74
-rw-r--r--spec/ruby/core/array/zip_spec.rb71
-rw-r--r--spec/ruby/core/basicobject/__id__spec.rb6
-rw-r--r--spec/ruby/core/basicobject/__send___spec.rb10
-rw-r--r--spec/ruby/core/basicobject/basicobject_spec.rb91
-rw-r--r--spec/ruby/core/basicobject/equal_spec.rb52
-rw-r--r--spec/ruby/core/basicobject/equal_value_spec.rb10
-rw-r--r--spec/ruby/core/basicobject/fixtures/classes.rb33
-rw-r--r--spec/ruby/core/basicobject/fixtures/common.rb9
-rw-r--r--spec/ruby/core/basicobject/fixtures/remove_method_missing.rb9
-rw-r--r--spec/ruby/core/basicobject/fixtures/singleton_method.rb10
-rw-r--r--spec/ruby/core/basicobject/initialize_spec.rb13
-rw-r--r--spec/ruby/core/basicobject/instance_eval_spec.rb248
-rw-r--r--spec/ruby/core/basicobject/instance_exec_spec.rb107
-rw-r--r--spec/ruby/core/basicobject/method_missing_spec.rb39
-rw-r--r--spec/ruby/core/basicobject/not_equal_spec.rb53
-rw-r--r--spec/ruby/core/basicobject/not_spec.rb11
-rw-r--r--spec/ruby/core/basicobject/singleton_method_added_spec.rb145
-rw-r--r--spec/ruby/core/basicobject/singleton_method_removed_spec.rb24
-rw-r--r--spec/ruby/core/basicobject/singleton_method_undefined_spec.rb24
-rw-r--r--spec/ruby/core/binding/clone_spec.rb7
-rw-r--r--spec/ruby/core/binding/dup_spec.rb7
-rw-r--r--spec/ruby/core/binding/eval_spec.rb152
-rw-r--r--spec/ruby/core/binding/fixtures/classes.rb66
-rw-r--r--spec/ruby/core/binding/fixtures/irb.rb3
-rw-r--r--spec/ruby/core/binding/fixtures/irbrc1
-rw-r--r--spec/ruby/core/binding/fixtures/location.rb6
-rw-r--r--spec/ruby/core/binding/irb_spec.rb16
-rw-r--r--spec/ruby/core/binding/local_variable_defined_spec.rb46
-rw-r--r--spec/ruby/core/binding/local_variable_get_spec.rb56
-rw-r--r--spec/ruby/core/binding/local_variable_set_spec.rb71
-rw-r--r--spec/ruby/core/binding/local_variables_spec.rb35
-rw-r--r--spec/ruby/core/binding/receiver_spec.rb11
-rw-r--r--spec/ruby/core/binding/shared/clone.rb34
-rw-r--r--spec/ruby/core/binding/source_location_spec.rb9
-rw-r--r--spec/ruby/core/builtin_constants/builtin_constants_spec.rb49
-rw-r--r--spec/ruby/core/class/allocate_spec.rb41
-rw-r--r--spec/ruby/core/class/attached_object_spec.rb31
-rw-r--r--spec/ruby/core/class/dup_spec.rb64
-rw-r--r--spec/ruby/core/class/fixtures/classes.rb47
-rw-r--r--spec/ruby/core/class/inherited_spec.rb101
-rw-r--r--spec/ruby/core/class/initialize_spec.rb34
-rw-r--r--spec/ruby/core/class/new_spec.rb155
-rw-r--r--spec/ruby/core/class/subclasses_spec.rb60
-rw-r--r--spec/ruby/core/class/superclass_spec.rb27
-rw-r--r--spec/ruby/core/comparable/between_spec.rb25
-rw-r--r--spec/ruby/core/comparable/clamp_spec.rb78
-rw-r--r--spec/ruby/core/comparable/equal_value_spec.rb114
-rw-r--r--spec/ruby/core/comparable/fixtures/classes.rb36
-rw-r--r--spec/ruby/core/comparable/gt_spec.rb43
-rw-r--r--spec/ruby/core/comparable/gte_spec.rb47
-rw-r--r--spec/ruby/core/comparable/lt_spec.rb49
-rw-r--r--spec/ruby/core/comparable/lte_spec.rb46
-rw-r--r--spec/ruby/core/complex/abs2_spec.rb9
-rw-r--r--spec/ruby/core/complex/abs_spec.rb6
-rw-r--r--spec/ruby/core/complex/angle_spec.rb6
-rw-r--r--spec/ruby/core/complex/arg_spec.rb6
-rw-r--r--spec/ruby/core/complex/coerce_spec.rb70
-rw-r--r--spec/ruby/core/complex/comparison_spec.rb25
-rw-r--r--spec/ruby/core/complex/conj_spec.rb6
-rw-r--r--spec/ruby/core/complex/conjugate_spec.rb6
-rw-r--r--spec/ruby/core/complex/constants_spec.rb7
-rw-r--r--spec/ruby/core/complex/denominator_spec.rb13
-rw-r--r--spec/ruby/core/complex/divide_spec.rb6
-rw-r--r--spec/ruby/core/complex/eql_spec.rb31
-rw-r--r--spec/ruby/core/complex/equal_value_spec.rb93
-rw-r--r--spec/ruby/core/complex/exponent_spec.rb61
-rw-r--r--spec/ruby/core/complex/fdiv_spec.rb129
-rw-r--r--spec/ruby/core/complex/finite_spec.rb32
-rw-r--r--spec/ruby/core/complex/hash_spec.rb16
-rw-r--r--spec/ruby/core/complex/imag_spec.rb6
-rw-r--r--spec/ruby/core/complex/imaginary_spec.rb6
-rw-r--r--spec/ruby/core/complex/infinite_spec.rb32
-rw-r--r--spec/ruby/core/complex/inspect_spec.rb16
-rw-r--r--spec/ruby/core/complex/integer_spec.rb11
-rw-r--r--spec/ruby/core/complex/magnitude_spec.rb6
-rw-r--r--spec/ruby/core/complex/marshal_dump_spec.rb11
-rw-r--r--spec/ruby/core/complex/minus_spec.rb45
-rw-r--r--spec/ruby/core/complex/multiply_spec.rb49
-rw-r--r--spec/ruby/core/complex/negative_spec.rb13
-rw-r--r--spec/ruby/core/complex/numerator_spec.rb19
-rw-r--r--spec/ruby/core/complex/phase_spec.rb6
-rw-r--r--spec/ruby/core/complex/plus_spec.rb45
-rw-r--r--spec/ruby/core/complex/polar_spec.rb43
-rw-r--r--spec/ruby/core/complex/positive_spec.rb13
-rw-r--r--spec/ruby/core/complex/quo_spec.rb6
-rw-r--r--spec/ruby/core/complex/rationalize_spec.rb31
-rw-r--r--spec/ruby/core/complex/real_spec.rb28
-rw-r--r--spec/ruby/core/complex/rect_spec.rb10
-rw-r--r--spec/ruby/core/complex/rectangular_spec.rb10
-rw-r--r--spec/ruby/core/complex/shared/abs.rb10
-rw-r--r--spec/ruby/core/complex/shared/arg.rb9
-rw-r--r--spec/ruby/core/complex/shared/conjugate.rb8
-rw-r--r--spec/ruby/core/complex/shared/divide.rb82
-rw-r--r--spec/ruby/core/complex/shared/image.rb8
-rw-r--r--spec/ruby/core/complex/shared/rect.rb94
-rw-r--r--spec/ruby/core/complex/to_c_spec.rb12
-rw-r--r--spec/ruby/core/complex/to_f_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_i_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_r_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_s_spec.rb44
-rw-r--r--spec/ruby/core/complex/uminus_spec.rb11
-rw-r--r--spec/ruby/core/conditionvariable/broadcast_spec.rb40
-rw-r--r--spec/ruby/core/conditionvariable/marshal_dump_spec.rb9
-rw-r--r--spec/ruby/core/conditionvariable/signal_spec.rb77
-rw-r--r--spec/ruby/core/conditionvariable/wait_spec.rb175
-rw-r--r--spec/ruby/core/data/constants_spec.rb35
-rw-r--r--spec/ruby/core/dir/chdir_spec.rb124
-rw-r--r--spec/ruby/core/dir/children_spec.rb134
-rw-r--r--spec/ruby/core/dir/chroot_spec.rb47
-rw-r--r--spec/ruby/core/dir/close_spec.rb19
-rw-r--r--spec/ruby/core/dir/delete_spec.rb15
-rw-r--r--spec/ruby/core/dir/dir_spec.rb7
-rw-r--r--spec/ruby/core/dir/each_child_spec.rb106
-rw-r--r--spec/ruby/core/dir/each_spec.rb64
-rw-r--r--spec/ruby/core/dir/element_reference_spec.rb33
-rw-r--r--spec/ruby/core/dir/empty_spec.rb31
-rw-r--r--spec/ruby/core/dir/entries_spec.rb70
-rw-r--r--spec/ruby/core/dir/exist_spec.rb15
-rw-r--r--spec/ruby/core/dir/fileno_spec.rb37
-rw-r--r--spec/ruby/core/dir/fixtures/common.rb204
-rw-r--r--spec/ruby/core/dir/foreach_spec.rb68
-rw-r--r--spec/ruby/core/dir/getwd_spec.rb15
-rw-r--r--spec/ruby/core/dir/glob_spec.rb253
-rw-r--r--spec/ruby/core/dir/home_spec.rb88
-rw-r--r--spec/ruby/core/dir/initialize_spec.rb23
-rw-r--r--spec/ruby/core/dir/inspect_spec.rb24
-rw-r--r--spec/ruby/core/dir/mkdir_spec.rb107
-rw-r--r--spec/ruby/core/dir/open_spec.rb15
-rw-r--r--spec/ruby/core/dir/path_spec.rb15
-rw-r--r--spec/ruby/core/dir/pos_spec.rb40
-rw-r--r--spec/ruby/core/dir/pwd_spec.rb39
-rw-r--r--spec/ruby/core/dir/read_spec.rb76
-rw-r--r--spec/ruby/core/dir/rewind_spec.rb36
-rw-r--r--spec/ruby/core/dir/rmdir_spec.rb15
-rw-r--r--spec/ruby/core/dir/seek_spec.rb19
-rw-r--r--spec/ruby/core/dir/shared/chroot.rb44
-rw-r--r--spec/ruby/core/dir/shared/closed.rb9
-rw-r--r--spec/ruby/core/dir/shared/delete.rb63
-rw-r--r--spec/ruby/core/dir/shared/exist.rb56
-rw-r--r--spec/ruby/core/dir/shared/glob.rb484
-rw-r--r--spec/ruby/core/dir/shared/open.rb73
-rw-r--r--spec/ruby/core/dir/shared/path.rb30
-rw-r--r--spec/ruby/core/dir/shared/pos.rb51
-rw-r--r--spec/ruby/core/dir/shared/pwd.rb45
-rw-r--r--spec/ruby/core/dir/tell_spec.rb18
-rw-r--r--spec/ruby/core/dir/to_path_spec.rb15
-rw-r--r--spec/ruby/core/dir/unlink_spec.rb15
-rw-r--r--spec/ruby/core/encoding/_dump_spec.rb5
-rw-r--r--spec/ruby/core/encoding/_load_spec.rb5
-rw-r--r--spec/ruby/core/encoding/aliases_spec.rb43
-rw-r--r--spec/ruby/core/encoding/ascii_compatible_spec.rb11
-rw-r--r--spec/ruby/core/encoding/compatible_spec.rb379
-rw-r--r--spec/ruby/core/encoding/converter/asciicompat_encoding_spec.rb37
-rw-r--r--spec/ruby/core/encoding/converter/constants_spec.rb131
-rw-r--r--spec/ruby/core/encoding/converter/convert_spec.rb45
-rw-r--r--spec/ruby/core/encoding/converter/convpath_spec.rb24
-rw-r--r--spec/ruby/core/encoding/converter/destination_encoding_spec.rb11
-rw-r--r--spec/ruby/core/encoding/converter/finish_spec.rb36
-rw-r--r--spec/ruby/core/encoding/converter/insert_output_spec.rb5
-rw-r--r--spec/ruby/core/encoding/converter/inspect_spec.rb13
-rw-r--r--spec/ruby/core/encoding/converter/last_error_spec.rb91
-rw-r--r--spec/ruby/core/encoding/converter/new_spec.rb119
-rw-r--r--spec/ruby/core/encoding/converter/primitive_convert_spec.rb211
-rw-r--r--spec/ruby/core/encoding/converter/primitive_errinfo_spec.rb68
-rw-r--r--spec/ruby/core/encoding/converter/putback_spec.rb56
-rw-r--r--spec/ruby/core/encoding/converter/replacement_spec.rb72
-rw-r--r--spec/ruby/core/encoding/converter/search_convpath_spec.rb30
-rw-r--r--spec/ruby/core/encoding/converter/source_encoding_spec.rb11
-rw-r--r--spec/ruby/core/encoding/default_external_spec.rb71
-rw-r--r--spec/ruby/core/encoding/default_internal_spec.rb74
-rw-r--r--spec/ruby/core/encoding/dummy_spec.rb14
-rw-r--r--spec/ruby/core/encoding/find_spec.rb82
-rw-r--r--spec/ruby/core/encoding/fixtures/classes.rb49
-rw-r--r--spec/ruby/core/encoding/inspect_spec.rb19
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_name_spec.rb18
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_spec.rb18
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/error_bytes_spec.rb30
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/incomplete_input_spec.rb28
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/readagain_bytes_spec.rb30
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_name_spec.rb28
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_spec.rb33
-rw-r--r--spec/ruby/core/encoding/list_spec.rb49
-rw-r--r--spec/ruby/core/encoding/locale_charmap_spec.rb56
-rw-r--r--spec/ruby/core/encoding/name_list_spec.rb23
-rw-r--r--spec/ruby/core/encoding/name_spec.rb5
-rw-r--r--spec/ruby/core/encoding/names_spec.rb35
-rw-r--r--spec/ruby/core/encoding/replicate_spec.rb75
-rw-r--r--spec/ruby/core/encoding/shared/name.rb15
-rw-r--r--spec/ruby/core/encoding/to_s_spec.rb5
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_name_spec.rb15
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_spec.rb15
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/error_char_spec.rb27
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_name_spec.rb28
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_spec.rb29
-rw-r--r--spec/ruby/core/enumerable/all_spec.rb181
-rw-r--r--spec/ruby/core/enumerable/any_spec.rb194
-rw-r--r--spec/ruby/core/enumerable/chain_spec.rb23
-rw-r--r--spec/ruby/core/enumerable/chunk_spec.rb72
-rw-r--r--spec/ruby/core/enumerable/chunk_while_spec.rb42
-rw-r--r--spec/ruby/core/enumerable/collect_concat_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/collect_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/compact_spec.rb11
-rw-r--r--spec/ruby/core/enumerable/count_spec.rb59
-rw-r--r--spec/ruby/core/enumerable/cycle_spec.rb104
-rw-r--r--spec/ruby/core/enumerable/detect_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/drop_spec.rb43
-rw-r--r--spec/ruby/core/enumerable/drop_while_spec.rb50
-rw-r--r--spec/ruby/core/enumerable/each_cons_spec.rb105
-rw-r--r--spec/ruby/core/enumerable/each_entry_spec.rb41
-rw-r--r--spec/ruby/core/enumerable/each_slice_spec.rb107
-rw-r--r--spec/ruby/core/enumerable/each_with_index_spec.rb53
-rw-r--r--spec/ruby/core/enumerable/each_with_object_spec.rb41
-rw-r--r--spec/ruby/core/enumerable/entries_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/filter_map_spec.rb24
-rw-r--r--spec/ruby/core/enumerable/filter_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/find_all_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/find_index_spec.rb89
-rw-r--r--spec/ruby/core/enumerable/find_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/first_spec.rb28
-rw-r--r--spec/ruby/core/enumerable/fixtures/classes.rb345
-rw-r--r--spec/ruby/core/enumerable/flat_map_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/grep_spec.rb102
-rw-r--r--spec/ruby/core/enumerable/grep_v_spec.rb91
-rw-r--r--spec/ruby/core/enumerable/group_by_spec.rb37
-rw-r--r--spec/ruby/core/enumerable/include_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/inject_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/lazy_spec.rb10
-rw-r--r--spec/ruby/core/enumerable/map_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/max_by_spec.rb81
-rw-r--r--spec/ruby/core/enumerable/max_spec.rb119
-rw-r--r--spec/ruby/core/enumerable/member_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/min_by_spec.rb81
-rw-r--r--spec/ruby/core/enumerable/min_spec.rb123
-rw-r--r--spec/ruby/core/enumerable/minmax_by_spec.rb44
-rw-r--r--spec/ruby/core/enumerable/minmax_spec.rb20
-rw-r--r--spec/ruby/core/enumerable/none_spec.rb147
-rw-r--r--spec/ruby/core/enumerable/one_spec.rb149
-rw-r--r--spec/ruby/core/enumerable/partition_spec.rb20
-rw-r--r--spec/ruby/core/enumerable/reduce_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/reject_spec.rb25
-rw-r--r--spec/ruby/core/enumerable/reverse_each_spec.rb26
-rw-r--r--spec/ruby/core/enumerable/select_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/shared/collect.rb107
-rw-r--r--spec/ruby/core/enumerable/shared/collect_concat.rb54
-rw-r--r--spec/ruby/core/enumerable/shared/entries.rb16
-rw-r--r--spec/ruby/core/enumerable/shared/enumerable_enumeratorized.rb33
-rw-r--r--spec/ruby/core/enumerable/shared/enumeratorized.rb42
-rw-r--r--spec/ruby/core/enumerable/shared/find.rb77
-rw-r--r--spec/ruby/core/enumerable/shared/find_all.rb31
-rw-r--r--spec/ruby/core/enumerable/shared/include.rb34
-rw-r--r--spec/ruby/core/enumerable/shared/inject.rb77
-rw-r--r--spec/ruby/core/enumerable/shared/take.rb63
-rw-r--r--spec/ruby/core/enumerable/slice_after_spec.rb61
-rw-r--r--spec/ruby/core/enumerable/slice_before_spec.rb64
-rw-r--r--spec/ruby/core/enumerable/slice_when_spec.rb54
-rw-r--r--spec/ruby/core/enumerable/sort_by_spec.rb43
-rw-r--r--spec/ruby/core/enumerable/sort_spec.rb54
-rw-r--r--spec/ruby/core/enumerable/sum_spec.rb50
-rw-r--r--spec/ruby/core/enumerable/take_spec.rb13
-rw-r--r--spec/ruby/core/enumerable/take_while_spec.rb51
-rw-r--r--spec/ruby/core/enumerable/tally_spec.rb80
-rw-r--r--spec/ruby/core/enumerable/to_a_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/to_h_spec.rb88
-rw-r--r--spec/ruby/core/enumerable/uniq_spec.rb78
-rw-r--r--spec/ruby/core/enumerable/zip_spec.rb46
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/begin_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/each_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/end_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/eq_spec.rb18
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/exclude_end_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/first_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/hash_spec.rb20
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/inspect_spec.rb20
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/last_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/new_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/size_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/step_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/chain/each_spec.rb15
-rw-r--r--spec/ruby/core/enumerator/chain/initialize_spec.rb31
-rw-r--r--spec/ruby/core/enumerator/chain/inspect_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/chain/rewind_spec.rb51
-rw-r--r--spec/ruby/core/enumerator/chain/size_spec.rb22
-rw-r--r--spec/ruby/core/enumerator/each_spec.rb89
-rw-r--r--spec/ruby/core/enumerator/each_with_index_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/each_with_object_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/enum_for_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/enumerator_spec.rb7
-rw-r--r--spec/ruby/core/enumerator/feed_spec.rb52
-rw-r--r--spec/ruby/core/enumerator/first_spec.rb7
-rw-r--r--spec/ruby/core/enumerator/fixtures/common.rb9
-rw-r--r--spec/ruby/core/enumerator/generator/each_spec.rb40
-rw-r--r--spec/ruby/core/enumerator/generator/initialize_spec.rb26
-rw-r--r--spec/ruby/core/enumerator/initialize_spec.rb65
-rw-r--r--spec/ruby/core/enumerator/inspect_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/lazy/chunk_spec.rb67
-rw-r--r--spec/ruby/core/enumerator/lazy/chunk_while_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/lazy/collect_concat_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/collect_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/compact_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/lazy/drop_spec.rb58
-rw-r--r--spec/ruby/core/enumerator/lazy/drop_while_spec.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/eager_spec.rb27
-rw-r--r--spec/ruby/core/enumerator/lazy/enum_for_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/filter_map_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/lazy/filter_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/lazy/find_all_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/fixtures/classes.rb54
-rw-r--r--spec/ruby/core/enumerator/lazy/flat_map_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/lazy/force_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/lazy/grep_spec.rb121
-rw-r--r--spec/ruby/core/enumerator/lazy/grep_v_spec.rb123
-rw-r--r--spec/ruby/core/enumerator/lazy/initialize_spec.rb63
-rw-r--r--spec/ruby/core/enumerator/lazy/lazy_spec.rb32
-rw-r--r--spec/ruby/core/enumerator/lazy/map_spec.rb12
-rw-r--r--spec/ruby/core/enumerator/lazy/reject_spec.rb78
-rw-r--r--spec/ruby/core/enumerator/lazy/select_spec.rb47
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/collect.rb62
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/collect_concat.rb78
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/select.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/to_enum.rb55
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_after_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_before_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_when_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/lazy/take_spec.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/take_while_spec.rb60
-rw-r--r--spec/ruby/core/enumerator/lazy/to_enum_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/uniq_spec.rb74
-rw-r--r--spec/ruby/core/enumerator/lazy/with_index_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/lazy/zip_spec.rb86
-rw-r--r--spec/ruby/core/enumerator/new_spec.rb119
-rw-r--r--spec/ruby/core/enumerator/next_spec.rb38
-rw-r--r--spec/ruby/core/enumerator/next_values_spec.rb55
-rw-r--r--spec/ruby/core/enumerator/peek_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/peek_values_spec.rb57
-rw-r--r--spec/ruby/core/enumerator/plus_spec.rb33
-rw-r--r--spec/ruby/core/enumerator/produce_spec.rb34
-rw-r--r--spec/ruby/core/enumerator/rewind_spec.rb70
-rw-r--r--spec/ruby/core/enumerator/size_spec.rb26
-rw-r--r--spec/ruby/core/enumerator/to_enum_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/with_index_spec.rb72
-rw-r--r--spec/ruby/core/enumerator/with_object_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/yielder/append_spec.rb35
-rw-r--r--spec/ruby/core/enumerator/yielder/initialize_spec.rb18
-rw-r--r--spec/ruby/core/enumerator/yielder/to_proc_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/yielder/yield_spec.rb33
-rw-r--r--spec/ruby/core/env/assoc_spec.rb31
-rw-r--r--spec/ruby/core/env/clear_spec.rb20
-rw-r--r--spec/ruby/core/env/delete_if_spec.rb54
-rw-r--r--spec/ruby/core/env/delete_spec.rb49
-rw-r--r--spec/ruby/core/env/each_key_spec.rb34
-rw-r--r--spec/ruby/core/env/each_pair_spec.rb6
-rw-r--r--spec/ruby/core/env/each_spec.rb6
-rw-r--r--spec/ruby/core/env/each_value_spec.rb34
-rw-r--r--spec/ruby/core/env/element_reference_spec.rb76
-rw-r--r--spec/ruby/core/env/element_set_spec.rb6
-rw-r--r--spec/ruby/core/env/empty_spec.rb23
-rw-r--r--spec/ruby/core/env/except_spec.rb36
-rw-r--r--spec/ruby/core/env/fetch_spec.rb63
-rw-r--r--spec/ruby/core/env/filter_spec.rb13
-rw-r--r--spec/ruby/core/env/fixtures/common.rb9
-rw-r--r--spec/ruby/core/env/has_key_spec.rb6
-rw-r--r--spec/ruby/core/env/has_value_spec.rb6
-rw-r--r--spec/ruby/core/env/include_spec.rb6
-rw-r--r--spec/ruby/core/env/index_spec.rb14
-rw-r--r--spec/ruby/core/env/indexes_spec.rb1
-rw-r--r--spec/ruby/core/env/indices_spec.rb1
-rw-r--r--spec/ruby/core/env/inspect_spec.rb11
-rw-r--r--spec/ruby/core/env/invert_spec.rb16
-rw-r--r--spec/ruby/core/env/keep_if_spec.rb54
-rw-r--r--spec/ruby/core/env/key_spec.rb11
-rw-r--r--spec/ruby/core/env/keys_spec.rb14
-rw-r--r--spec/ruby/core/env/length_spec.rb6
-rw-r--r--spec/ruby/core/env/member_spec.rb6
-rw-r--r--spec/ruby/core/env/merge_spec.rb6
-rw-r--r--spec/ruby/core/env/rassoc_spec.rb42
-rw-r--r--spec/ruby/core/env/rehash_spec.rb7
-rw-r--r--spec/ruby/core/env/reject_spec.rb101
-rw-r--r--spec/ruby/core/env/replace_spec.rb51
-rw-r--r--spec/ruby/core/env/select_spec.rb13
-rw-r--r--spec/ruby/core/env/shared/each.rb65
-rw-r--r--spec/ruby/core/env/shared/include.rb23
-rw-r--r--spec/ruby/core/env/shared/key.rb31
-rw-r--r--spec/ruby/core/env/shared/length.rb13
-rw-r--r--spec/ruby/core/env/shared/select.rb61
-rw-r--r--spec/ruby/core/env/shared/store.rb60
-rw-r--r--spec/ruby/core/env/shared/to_hash.rb33
-rw-r--r--spec/ruby/core/env/shared/update.rb106
-rw-r--r--spec/ruby/core/env/shared/value.rb22
-rw-r--r--spec/ruby/core/env/shift_spec.rb47
-rw-r--r--spec/ruby/core/env/size_spec.rb6
-rw-r--r--spec/ruby/core/env/slice_spec.rb27
-rw-r--r--spec/ruby/core/env/spec_helper.rb26
-rw-r--r--spec/ruby/core/env/store_spec.rb6
-rw-r--r--spec/ruby/core/env/to_a_spec.rb18
-rw-r--r--spec/ruby/core/env/to_h_spec.rb58
-rw-r--r--spec/ruby/core/env/to_hash_spec.rb6
-rw-r--r--spec/ruby/core/env/to_s_spec.rb7
-rw-r--r--spec/ruby/core/env/update_spec.rb6
-rw-r--r--spec/ruby/core/env/value_spec.rb6
-rw-r--r--spec/ruby/core/env/values_at_spec.rb38
-rw-r--r--spec/ruby/core/env/values_spec.rb14
-rw-r--r--spec/ruby/core/exception/backtrace_locations_spec.rb39
-rw-r--r--spec/ruby/core/exception/backtrace_spec.rb93
-rw-r--r--spec/ruby/core/exception/case_compare_spec.rb39
-rw-r--r--spec/ruby/core/exception/cause_spec.rb56
-rw-r--r--spec/ruby/core/exception/dup_spec.rb74
-rw-r--r--spec/ruby/core/exception/equal_value_spec.rb68
-rw-r--r--spec/ruby/core/exception/errno_spec.rb67
-rw-r--r--spec/ruby/core/exception/exception_spec.rb69
-rw-r--r--spec/ruby/core/exception/exit_value_spec.rb13
-rw-r--r--spec/ruby/core/exception/fixtures/common.rb95
-rw-r--r--spec/ruby/core/exception/frozen_error_spec.rb22
-rw-r--r--spec/ruby/core/exception/full_message_spec.rb106
-rw-r--r--spec/ruby/core/exception/hierarchy_spec.rb62
-rw-r--r--spec/ruby/core/exception/inspect_spec.rb24
-rw-r--r--spec/ruby/core/exception/interrupt_spec.rb60
-rw-r--r--spec/ruby/core/exception/io_error_spec.rb45
-rw-r--r--spec/ruby/core/exception/key_error_spec.rb19
-rw-r--r--spec/ruby/core/exception/load_error_spec.rb21
-rw-r--r--spec/ruby/core/exception/message_spec.rb27
-rw-r--r--spec/ruby/core/exception/name_error_spec.rb28
-rw-r--r--spec/ruby/core/exception/name_spec.rb43
-rw-r--r--spec/ruby/core/exception/new_spec.rb7
-rw-r--r--spec/ruby/core/exception/no_method_error_spec.rb136
-rw-r--r--spec/ruby/core/exception/reason_spec.rb13
-rw-r--r--spec/ruby/core/exception/receiver_spec.rb58
-rw-r--r--spec/ruby/core/exception/result_spec.rb21
-rw-r--r--spec/ruby/core/exception/set_backtrace_spec.rb56
-rw-r--r--spec/ruby/core/exception/shared/new.rb18
-rw-r--r--spec/ruby/core/exception/signal_exception_spec.rb123
-rw-r--r--spec/ruby/core/exception/signm_spec.rb9
-rw-r--r--spec/ruby/core/exception/signo_spec.rb9
-rw-r--r--spec/ruby/core/exception/standard_error_spec.rb23
-rw-r--r--spec/ruby/core/exception/status_spec.rb9
-rw-r--r--spec/ruby/core/exception/success_spec.rb15
-rw-r--r--spec/ruby/core/exception/system_call_error_spec.rb143
-rw-r--r--spec/ruby/core/exception/system_exit_spec.rb59
-rw-r--r--spec/ruby/core/exception/to_s_spec.rb37
-rw-r--r--spec/ruby/core/exception/top_level_spec.rb45
-rw-r--r--spec/ruby/core/exception/uncaught_throw_error_spec.rb12
-rw-r--r--spec/ruby/core/false/and_spec.rb11
-rw-r--r--spec/ruby/core/false/case_compare_spec.rb14
-rw-r--r--spec/ruby/core/false/dup_spec.rb7
-rw-r--r--spec/ruby/core/false/falseclass_spec.rb15
-rw-r--r--spec/ruby/core/false/inspect_spec.rb7
-rw-r--r--spec/ruby/core/false/or_spec.rb11
-rw-r--r--spec/ruby/core/false/to_s_spec.rb15
-rw-r--r--spec/ruby/core/false/xor_spec.rb11
-rw-r--r--spec/ruby/core/fiber/blocking_spec.rb79
-rw-r--r--spec/ruby/core/fiber/fixtures/classes.rb12
-rw-r--r--spec/ruby/core/fiber/new_spec.rb39
-rw-r--r--spec/ruby/core/fiber/raise_spec.rb119
-rw-r--r--spec/ruby/core/fiber/resume_spec.rb79
-rw-r--r--spec/ruby/core/fiber/shared/blocking.rb41
-rw-r--r--spec/ruby/core/fiber/storage_spec.rb117
-rw-r--r--spec/ruby/core/fiber/yield_spec.rb49
-rw-r--r--spec/ruby/core/file/absolute_path_spec.rb94
-rw-r--r--spec/ruby/core/file/atime_spec.rb57
-rw-r--r--spec/ruby/core/file/basename_spec.rb183
-rw-r--r--spec/ruby/core/file/birthtime_spec.rb60
-rw-r--r--spec/ruby/core/file/blockdev_spec.rb6
-rw-r--r--spec/ruby/core/file/chardev_spec.rb6
-rw-r--r--spec/ruby/core/file/chmod_spec.rb185
-rw-r--r--spec/ruby/core/file/chown_spec.rb144
-rw-r--r--spec/ruby/core/file/constants/constants_spec.rb31
-rw-r--r--spec/ruby/core/file/constants_spec.rb141
-rw-r--r--spec/ruby/core/file/ctime_spec.rb51
-rw-r--r--spec/ruby/core/file/delete_spec.rb6
-rw-r--r--spec/ruby/core/file/directory_spec.rb10
-rw-r--r--spec/ruby/core/file/dirname_spec.rb124
-rw-r--r--spec/ruby/core/file/empty_spec.rb13
-rw-r--r--spec/ruby/core/file/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/executable_spec.rb7
-rw-r--r--spec/ruby/core/file/exist_spec.rb6
-rw-r--r--spec/ruby/core/file/expand_path_spec.rb265
-rw-r--r--spec/ruby/core/file/extname_spec.rb76
-rw-r--r--spec/ruby/core/file/file_spec.rb16
-rw-r--r--spec/ruby/core/file/fixtures/common.rb22
-rw-r--r--spec/ruby/core/file/fixtures/do_not_remove1
-rw-r--r--spec/ruby/core/file/fixtures/file_types.rb66
-rw-r--r--spec/ruby/core/file/flock_spec.rb106
-rw-r--r--spec/ruby/core/file/fnmatch_spec.rb10
-rw-r--r--spec/ruby/core/file/ftype_spec.rb82
-rw-r--r--spec/ruby/core/file/grpowned_spec.rb10
-rw-r--r--spec/ruby/core/file/identical_spec.rb6
-rw-r--r--spec/ruby/core/file/initialize_spec.rb19
-rw-r--r--spec/ruby/core/file/inspect_spec.rb17
-rw-r--r--spec/ruby/core/file/join_spec.rb148
-rw-r--r--spec/ruby/core/file/lchmod_spec.rb32
-rw-r--r--spec/ruby/core/file/lchown_spec.rb59
-rw-r--r--spec/ruby/core/file/link_spec.rb39
-rw-r--r--spec/ruby/core/file/lstat_spec.rb33
-rw-r--r--spec/ruby/core/file/lutime_spec.rb38
-rw-r--r--spec/ruby/core/file/mkfifo_spec.rb51
-rw-r--r--spec/ruby/core/file/mtime_spec.rb53
-rw-r--r--spec/ruby/core/file/new_spec.rb162
-rw-r--r--spec/ruby/core/file/null_spec.rb15
-rw-r--r--spec/ruby/core/file/open_spec.rb704
-rw-r--r--spec/ruby/core/file/owned_spec.rb35
-rw-r--r--spec/ruby/core/file/path_spec.rb40
-rw-r--r--spec/ruby/core/file/pipe_spec.rb32
-rw-r--r--spec/ruby/core/file/printf_spec.rb18
-rw-r--r--spec/ruby/core/file/read_spec.rb6
-rw-r--r--spec/ruby/core/file/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/readable_spec.rb7
-rw-r--r--spec/ruby/core/file/readlink_spec.rb86
-rw-r--r--spec/ruby/core/file/realdirpath_spec.rb104
-rw-r--r--spec/ruby/core/file/realpath_spec.rb94
-rw-r--r--spec/ruby/core/file/rename_spec.rb37
-rw-r--r--spec/ruby/core/file/reopen_spec.rb32
-rw-r--r--spec/ruby/core/file/setgid_spec.rb36
-rw-r--r--spec/ruby/core/file/setuid_spec.rb38
-rw-r--r--spec/ruby/core/file/shared/fnmatch.rb249
-rw-r--r--spec/ruby/core/file/shared/open.rb12
-rw-r--r--spec/ruby/core/file/shared/path.rb94
-rw-r--r--spec/ruby/core/file/shared/read.rb15
-rw-r--r--spec/ruby/core/file/shared/stat.rb32
-rw-r--r--spec/ruby/core/file/shared/unlink.rb61
-rw-r--r--spec/ruby/core/file/size_spec.rb119
-rw-r--r--spec/ruby/core/file/socket_spec.rb42
-rw-r--r--spec/ruby/core/file/split_spec.rb64
-rw-r--r--spec/ruby/core/file/stat/atime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/birthtime_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/blksize_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/blockdev_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/blocks_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/chardev_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/comparison_spec.rb66
-rw-r--r--spec/ruby/core/file/stat/ctime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/dev_major_spec.rb23
-rw-r--r--spec/ruby/core/file/stat/dev_minor_spec.rb23
-rw-r--r--spec/ruby/core/file/stat/dev_spec.rb15
-rw-r--r--spec/ruby/core/file/stat/directory_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/executable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/file_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/fixtures/classes.rb5
-rw-r--r--spec/ruby/core/file/stat/ftype_spec.rb64
-rw-r--r--spec/ruby/core/file/stat/gid_spec.rb19
-rw-r--r--spec/ruby/core/file/stat/grpowned_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/ino_spec.rb28
-rw-r--r--spec/ruby/core/file/stat/inspect_spec.rb26
-rw-r--r--spec/ruby/core/file/stat/mode_spec.rb19
-rw-r--r--spec/ruby/core/file/stat/mtime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/new_spec.rb32
-rw-r--r--spec/ruby/core/file/stat/nlink_spec.rb21
-rw-r--r--spec/ruby/core/file/stat/owned_spec.rb33
-rw-r--r--spec/ruby/core/file/stat/pipe_spec.rb32
-rw-r--r--spec/ruby/core/file/stat/rdev_major_spec.rb31
-rw-r--r--spec/ruby/core/file/stat/rdev_minor_spec.rb31
-rw-r--r--spec/ruby/core/file/stat/rdev_spec.rb15
-rw-r--r--spec/ruby/core/file/stat/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/readable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/setgid_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/setuid_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/size_spec.rb21
-rw-r--r--spec/ruby/core/file/stat/socket_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/sticky_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/symlink_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/uid_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/world_readable_spec.rb11
-rw-r--r--spec/ruby/core/file/stat/world_writable_spec.rb11
-rw-r--r--spec/ruby/core/file/stat/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/writable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/zero_spec.rb7
-rw-r--r--spec/ruby/core/file/stat_spec.rb55
-rw-r--r--spec/ruby/core/file/sticky_spec.rb50
-rw-r--r--spec/ruby/core/file/symlink_spec.rb57
-rw-r--r--spec/ruby/core/file/to_path_spec.rb6
-rw-r--r--spec/ruby/core/file/truncate_spec.rb177
-rw-r--r--spec/ruby/core/file/umask_spec.rb57
-rw-r--r--spec/ruby/core/file/unlink_spec.rb6
-rw-r--r--spec/ruby/core/file/utime_spec.rb102
-rw-r--r--spec/ruby/core/file/world_readable_spec.rb12
-rw-r--r--spec/ruby/core/file/world_writable_spec.rb12
-rw-r--r--spec/ruby/core/file/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/writable_spec.rb7
-rw-r--r--spec/ruby/core/file/zero_spec.rb13
-rw-r--r--spec/ruby/core/filetest/blockdev_spec.rb6
-rw-r--r--spec/ruby/core/filetest/chardev_spec.rb6
-rw-r--r--spec/ruby/core/filetest/directory_spec.rb10
-rw-r--r--spec/ruby/core/filetest/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/executable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/exist_spec.rb6
-rw-r--r--spec/ruby/core/filetest/file_spec.rb10
-rw-r--r--spec/ruby/core/filetest/grpowned_spec.rb10
-rw-r--r--spec/ruby/core/filetest/identical_spec.rb6
-rw-r--r--spec/ruby/core/filetest/owned_spec.rb6
-rw-r--r--spec/ruby/core/filetest/pipe_spec.rb6
-rw-r--r--spec/ruby/core/filetest/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/readable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/setgid_spec.rb6
-rw-r--r--spec/ruby/core/filetest/setuid_spec.rb6
-rw-r--r--spec/ruby/core/filetest/size_spec.rb34
-rw-r--r--spec/ruby/core/filetest/socket_spec.rb6
-rw-r--r--spec/ruby/core/filetest/sticky_spec.rb7
-rw-r--r--spec/ruby/core/filetest/symlink_spec.rb10
-rw-r--r--spec/ruby/core/filetest/world_readable_spec.rb5
-rw-r--r--spec/ruby/core/filetest/world_writable_spec.rb5
-rw-r--r--spec/ruby/core/filetest/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/writable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/zero_spec.rb13
-rw-r--r--spec/ruby/core/float/abs_spec.rb6
-rw-r--r--spec/ruby/core/float/angle_spec.rb6
-rw-r--r--spec/ruby/core/float/arg_spec.rb6
-rw-r--r--spec/ruby/core/float/case_compare_spec.rb6
-rw-r--r--spec/ruby/core/float/ceil_spec.rb21
-rw-r--r--spec/ruby/core/float/coerce_spec.rb18
-rw-r--r--spec/ruby/core/float/comparison_spec.rb113
-rw-r--r--spec/ruby/core/float/constants_spec.rb55
-rw-r--r--spec/ruby/core/float/denominator_spec.rb29
-rw-r--r--spec/ruby/core/float/divide_spec.rb43
-rw-r--r--spec/ruby/core/float/divmod_spec.rb43
-rw-r--r--spec/ruby/core/float/dup_spec.rb8
-rw-r--r--spec/ruby/core/float/eql_spec.rb16
-rw-r--r--spec/ruby/core/float/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/float/exponent_spec.rb15
-rw-r--r--spec/ruby/core/float/fdiv_spec.rb6
-rw-r--r--spec/ruby/core/float/finite_spec.rb19
-rw-r--r--spec/ruby/core/float/fixtures/classes.rb4
-rw-r--r--spec/ruby/core/float/fixtures/coerce.rb15
-rw-r--r--spec/ruby/core/float/float_spec.rb19
-rw-r--r--spec/ruby/core/float/floor_spec.rb21
-rw-r--r--spec/ruby/core/float/gt_spec.rb38
-rw-r--r--spec/ruby/core/float/gte_spec.rb38
-rw-r--r--spec/ruby/core/float/hash_spec.rb11
-rw-r--r--spec/ruby/core/float/infinite_spec.rb19
-rw-r--r--spec/ruby/core/float/inspect_spec.rb6
-rw-r--r--spec/ruby/core/float/lt_spec.rb38
-rw-r--r--spec/ruby/core/float/lte_spec.rb39
-rw-r--r--spec/ruby/core/float/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/float/minus_spec.rb12
-rw-r--r--spec/ruby/core/float/modulo_spec.rb10
-rw-r--r--spec/ruby/core/float/multiply_spec.rb17
-rw-r--r--spec/ruby/core/float/nan_spec.rb9
-rw-r--r--spec/ruby/core/float/negative_spec.rb33
-rw-r--r--spec/ruby/core/float/next_float_spec.rb49
-rw-r--r--spec/ruby/core/float/numerator_spec.rb39
-rw-r--r--spec/ruby/core/float/phase_spec.rb6
-rw-r--r--spec/ruby/core/float/plus_spec.rb12
-rw-r--r--spec/ruby/core/float/positive_spec.rb33
-rw-r--r--spec/ruby/core/float/prev_float_spec.rb49
-rw-r--r--spec/ruby/core/float/quo_spec.rb6
-rw-r--r--spec/ruby/core/float/rationalize_spec.rb43
-rw-r--r--spec/ruby/core/float/round_spec.rb194
-rw-r--r--spec/ruby/core/float/shared/abs.rb21
-rw-r--r--spec/ruby/core/float/shared/arg.rb36
-rw-r--r--spec/ruby/core/float/shared/arithmetic_exception_in_coerce.rb11
-rw-r--r--spec/ruby/core/float/shared/comparison_exception_in_coerce.rb11
-rw-r--r--spec/ruby/core/float/shared/equal.rb38
-rw-r--r--spec/ruby/core/float/shared/modulo.rb48
-rw-r--r--spec/ruby/core/float/shared/quo.rb59
-rw-r--r--spec/ruby/core/float/shared/to_i.rb14
-rw-r--r--spec/ruby/core/float/shared/to_s.rb308
-rw-r--r--spec/ruby/core/float/to_f_spec.rb9
-rw-r--r--spec/ruby/core/float/to_i_spec.rb6
-rw-r--r--spec/ruby/core/float/to_int_spec.rb6
-rw-r--r--spec/ruby/core/float/to_r_spec.rb5
-rw-r--r--spec/ruby/core/float/to_s_spec.rb6
-rw-r--r--spec/ruby/core/float/truncate_spec.rb14
-rw-r--r--spec/ruby/core/float/uminus_spec.rb28
-rw-r--r--spec/ruby/core/float/uplus_spec.rb9
-rw-r--r--spec/ruby/core/float/zero_spec.rb9
-rw-r--r--spec/ruby/core/gc/auto_compact_spec.rb26
-rw-r--r--spec/ruby/core/gc/count_spec.rb17
-rw-r--r--spec/ruby/core/gc/disable_spec.rb18
-rw-r--r--spec/ruby/core/gc/enable_spec.rb13
-rw-r--r--spec/ruby/core/gc/garbage_collect_spec.rb15
-rw-r--r--spec/ruby/core/gc/measure_total_time_spec.rb19
-rw-r--r--spec/ruby/core/gc/profiler/clear_spec.rb5
-rw-r--r--spec/ruby/core/gc/profiler/disable_spec.rb16
-rw-r--r--spec/ruby/core/gc/profiler/enable_spec.rb17
-rw-r--r--spec/ruby/core/gc/profiler/enabled_spec.rb21
-rw-r--r--spec/ruby/core/gc/profiler/report_spec.rb5
-rw-r--r--spec/ruby/core/gc/profiler/result_spec.rb7
-rw-r--r--spec/ruby/core/gc/profiler/total_time_spec.rb7
-rw-r--r--spec/ruby/core/gc/start_spec.rb12
-rw-r--r--spec/ruby/core/gc/stat_spec.rb62
-rw-r--r--spec/ruby/core/gc/stress_spec.rb27
-rw-r--r--spec/ruby/core/gc/total_time_spec.rb15
-rw-r--r--spec/ruby/core/hash/allocate_spec.rb15
-rw-r--r--spec/ruby/core/hash/any_spec.rb30
-rw-r--r--spec/ruby/core/hash/assoc_spec.rb50
-rw-r--r--spec/ruby/core/hash/clear_spec.rb32
-rw-r--r--spec/ruby/core/hash/clone_spec.rb12
-rw-r--r--spec/ruby/core/hash/compact_spec.rb59
-rw-r--r--spec/ruby/core/hash/compare_by_identity_spec.rb138
-rw-r--r--spec/ruby/core/hash/constructor_spec.rb110
-rw-r--r--spec/ruby/core/hash/deconstruct_keys_spec.rb23
-rw-r--r--spec/ruby/core/hash/default_proc_spec.rb80
-rw-r--r--spec/ruby/core/hash/default_spec.rb46
-rw-r--r--spec/ruby/core/hash/delete_if_spec.rb44
-rw-r--r--spec/ruby/core/hash/delete_spec.rb44
-rw-r--r--spec/ruby/core/hash/dig_spec.rb66
-rw-r--r--spec/ruby/core/hash/each_key_spec.rb23
-rw-r--r--spec/ruby/core/hash/each_pair_spec.rb11
-rw-r--r--spec/ruby/core/hash/each_spec.rb11
-rw-r--r--spec/ruby/core/hash/each_value_spec.rb23
-rw-r--r--spec/ruby/core/hash/element_reference_spec.rb134
-rw-r--r--spec/ruby/core/hash/element_set_spec.rb7
-rw-r--r--spec/ruby/core/hash/empty_spec.rb15
-rw-r--r--spec/ruby/core/hash/eql_spec.rb9
-rw-r--r--spec/ruby/core/hash/equal_value_spec.rb18
-rw-r--r--spec/ruby/core/hash/except_spec.rb34
-rw-r--r--spec/ruby/core/hash/fetch_spec.rb44
-rw-r--r--spec/ruby/core/hash/fetch_values_spec.rb35
-rw-r--r--spec/ruby/core/hash/filter_spec.rb10
-rw-r--r--spec/ruby/core/hash/fixtures/classes.rb75
-rw-r--r--spec/ruby/core/hash/fixtures/name.rb30
-rw-r--r--spec/ruby/core/hash/flatten_spec.rb62
-rw-r--r--spec/ruby/core/hash/gt_spec.rb42
-rw-r--r--spec/ruby/core/hash/gte_spec.rb42
-rw-r--r--spec/ruby/core/hash/has_key_spec.rb7
-rw-r--r--spec/ruby/core/hash/has_value_spec.rb7
-rw-r--r--spec/ruby/core/hash/hash_spec.rb53
-rw-r--r--spec/ruby/core/hash/include_spec.rb7
-rw-r--r--spec/ruby/core/hash/index_spec.rb9
-rw-r--r--spec/ruby/core/hash/initialize_spec.rb61
-rw-r--r--spec/ruby/core/hash/inspect_spec.rb7
-rw-r--r--spec/ruby/core/hash/invert_spec.rb27
-rw-r--r--spec/ruby/core/hash/keep_if_spec.rb37
-rw-r--r--spec/ruby/core/hash/key_spec.rb12
-rw-r--r--spec/ruby/core/hash/keys_spec.rb23
-rw-r--r--spec/ruby/core/hash/length_spec.rb7
-rw-r--r--spec/ruby/core/hash/lt_spec.rb42
-rw-r--r--spec/ruby/core/hash/lte_spec.rb42
-rw-r--r--spec/ruby/core/hash/member_spec.rb7
-rw-r--r--spec/ruby/core/hash/merge_spec.rb100
-rw-r--r--spec/ruby/core/hash/new_spec.rb36
-rw-r--r--spec/ruby/core/hash/rassoc_spec.rb42
-rw-r--r--spec/ruby/core/hash/rehash_spec.rb84
-rw-r--r--spec/ruby/core/hash/reject_spec.rb95
-rw-r--r--spec/ruby/core/hash/replace_spec.rb7
-rw-r--r--spec/ruby/core/hash/ruby2_keywords_hash_spec.rb59
-rw-r--r--spec/ruby/core/hash/select_spec.rb10
-rw-r--r--spec/ruby/core/hash/shared/comparison.rb15
-rw-r--r--spec/ruby/core/hash/shared/each.rb124
-rw-r--r--spec/ruby/core/hash/shared/eql.rb204
-rw-r--r--spec/ruby/core/hash/shared/equal.rb90
-rw-r--r--spec/ruby/core/hash/shared/greater_than.rb23
-rw-r--r--spec/ruby/core/hash/shared/index.rb37
-rw-r--r--spec/ruby/core/hash/shared/iteration.rb19
-rw-r--r--spec/ruby/core/hash/shared/key.rb38
-rw-r--r--spec/ruby/core/hash/shared/length.rb12
-rw-r--r--spec/ruby/core/hash/shared/less_than.rb23
-rw-r--r--spec/ruby/core/hash/shared/replace.rb51
-rw-r--r--spec/ruby/core/hash/shared/select.rb91
-rw-r--r--spec/ruby/core/hash/shared/store.rb115
-rw-r--r--spec/ruby/core/hash/shared/to_s.rb89
-rw-r--r--spec/ruby/core/hash/shared/update.rb76
-rw-r--r--spec/ruby/core/hash/shared/value.rb14
-rw-r--r--spec/ruby/core/hash/shared/values_at.rb9
-rw-r--r--spec/ruby/core/hash/shift_spec.rb101
-rw-r--r--spec/ruby/core/hash/size_spec.rb7
-rw-r--r--spec/ruby/core/hash/slice_spec.rb53
-rw-r--r--spec/ruby/core/hash/sort_spec.rb17
-rw-r--r--spec/ruby/core/hash/store_spec.rb7
-rw-r--r--spec/ruby/core/hash/to_a_spec.rb39
-rw-r--r--spec/ruby/core/hash/to_h_spec.rb72
-rw-r--r--spec/ruby/core/hash/to_hash_spec.rb14
-rw-r--r--spec/ruby/core/hash/to_proc_spec.rb99
-rw-r--r--spec/ruby/core/hash/to_s_spec.rb7
-rw-r--r--spec/ruby/core/hash/transform_keys_spec.rb147
-rw-r--r--spec/ruby/core/hash/transform_values_spec.rb97
-rw-r--r--spec/ruby/core/hash/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/hash/update_spec.rb7
-rw-r--r--spec/ruby/core/hash/value_spec.rb7
-rw-r--r--spec/ruby/core/hash/values_at_spec.rb7
-rw-r--r--spec/ruby/core/hash/values_spec.rb10
-rw-r--r--spec/ruby/core/integer/abs_spec.rb6
-rw-r--r--spec/ruby/core/integer/allbits_spec.rb37
-rw-r--r--spec/ruby/core/integer/anybits_spec.rb36
-rw-r--r--spec/ruby/core/integer/bit_and_spec.rb97
-rw-r--r--spec/ruby/core/integer/bit_length_spec.rb76
-rw-r--r--spec/ruby/core/integer/bit_or_spec.rb89
-rw-r--r--spec/ruby/core/integer/bit_xor_spec.rb93
-rw-r--r--spec/ruby/core/integer/case_compare_spec.rb6
-rw-r--r--spec/ruby/core/integer/ceil_spec.rb19
-rw-r--r--spec/ruby/core/integer/chr_spec.rb257
-rw-r--r--spec/ruby/core/integer/coerce_spec.rb104
-rw-r--r--spec/ruby/core/integer/comparison_spec.rb177
-rw-r--r--spec/ruby/core/integer/complement_spec.rb20
-rw-r--r--spec/ruby/core/integer/constants_spec.rb41
-rw-r--r--spec/ruby/core/integer/denominator_spec.rb20
-rw-r--r--spec/ruby/core/integer/digits_spec.rb41
-rw-r--r--spec/ruby/core/integer/div_spec.rb146
-rw-r--r--spec/ruby/core/integer/divide_spec.rb89
-rw-r--r--spec/ruby/core/integer/divmod_spec.rb117
-rw-r--r--spec/ruby/core/integer/downto_spec.rb69
-rw-r--r--spec/ruby/core/integer/dup_spec.rb13
-rw-r--r--spec/ruby/core/integer/element_reference_spec.rb188
-rw-r--r--spec/ruby/core/integer/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/integer/even_spec.rb40
-rw-r--r--spec/ruby/core/integer/exponent_spec.rb7
-rw-r--r--spec/ruby/core/integer/fdiv_spec.rb100
-rw-r--r--spec/ruby/core/integer/fixtures/classes.rb4
-rw-r--r--spec/ruby/core/integer/floor_spec.rb19
-rw-r--r--spec/ruby/core/integer/gcd_spec.rb69
-rw-r--r--spec/ruby/core/integer/gcdlcm_spec.rb53
-rw-r--r--spec/ruby/core/integer/gt_spec.rb43
-rw-r--r--spec/ruby/core/integer/gte_spec.rb43
-rw-r--r--spec/ruby/core/integer/integer_spec.rb20
-rw-r--r--spec/ruby/core/integer/lcm_spec.rb58
-rw-r--r--spec/ruby/core/integer/left_shift_spec.rb211
-rw-r--r--spec/ruby/core/integer/lt_spec.rb45
-rw-r--r--spec/ruby/core/integer/lte_spec.rb53
-rw-r--r--spec/ruby/core/integer/magnitude_spec.rb6
-rw-r--r--spec/ruby/core/integer/minus_spec.rb43
-rw-r--r--spec/ruby/core/integer/modulo_spec.rb10
-rw-r--r--spec/ruby/core/integer/multiply_spec.rb45
-rw-r--r--spec/ruby/core/integer/next_spec.rb6
-rw-r--r--spec/ruby/core/integer/nobits_spec.rb36
-rw-r--r--spec/ruby/core/integer/numerator_spec.rb18
-rw-r--r--spec/ruby/core/integer/odd_spec.rb38
-rw-r--r--spec/ruby/core/integer/ord_spec.rb17
-rw-r--r--spec/ruby/core/integer/plus_spec.rb58
-rw-r--r--spec/ruby/core/integer/pow_spec.rb51
-rw-r--r--spec/ruby/core/integer/pred_spec.rb11
-rw-r--r--spec/ruby/core/integer/rationalize_spec.rb39
-rw-r--r--spec/ruby/core/integer/remainder_spec.rb51
-rw-r--r--spec/ruby/core/integer/right_shift_spec.rb233
-rw-r--r--spec/ruby/core/integer/round_spec.rb83
-rw-r--r--spec/ruby/core/integer/shared/abs.rb18
-rw-r--r--spec/ruby/core/integer/shared/arithmetic_coerce.rb31
-rw-r--r--spec/ruby/core/integer/shared/comparison_coerce.rb11
-rw-r--r--spec/ruby/core/integer/shared/equal.rb58
-rw-r--r--spec/ruby/core/integer/shared/exponent.rb126
-rw-r--r--spec/ruby/core/integer/shared/integer_rounding.rb19
-rw-r--r--spec/ruby/core/integer/shared/modulo.rb74
-rw-r--r--spec/ruby/core/integer/shared/next.rb25
-rw-r--r--spec/ruby/core/integer/shared/to_i.rb8
-rw-r--r--spec/ruby/core/integer/size_spec.rb34
-rw-r--r--spec/ruby/core/integer/sqrt_spec.rb31
-rw-r--r--spec/ruby/core/integer/succ_spec.rb6
-rw-r--r--spec/ruby/core/integer/times_spec.rb79
-rw-r--r--spec/ruby/core/integer/to_f_spec.rb23
-rw-r--r--spec/ruby/core/integer/to_i_spec.rb6
-rw-r--r--spec/ruby/core/integer/to_int_spec.rb6
-rw-r--r--spec/ruby/core/integer/to_r_spec.rb26
-rw-r--r--spec/ruby/core/integer/to_s_spec.rb95
-rw-r--r--spec/ruby/core/integer/truncate_spec.rb19
-rw-r--r--spec/ruby/core/integer/try_convert_spec.rb40
-rw-r--r--spec/ruby/core/integer/uminus_spec.rb30
-rw-r--r--spec/ruby/core/integer/upto_spec.rb69
-rw-r--r--spec/ruby/core/integer/zero_spec.rb21
-rw-r--r--spec/ruby/core/io/advise_spec.rb86
-rw-r--r--spec/ruby/core/io/binmode_spec.rb64
-rw-r--r--spec/ruby/core/io/binread_spec.rb47
-rw-r--r--spec/ruby/core/io/binwrite_spec.rb6
-rw-r--r--spec/ruby/core/io/bytes_spec.rb47
-rw-r--r--spec/ruby/core/io/chars_spec.rb30
-rw-r--r--spec/ruby/core/io/close_on_exec_spec.rb76
-rw-r--r--spec/ruby/core/io/close_read_spec.rb60
-rw-r--r--spec/ruby/core/io/close_spec.rb118
-rw-r--r--spec/ruby/core/io/close_write_spec.rb64
-rw-r--r--spec/ruby/core/io/closed_spec.rb20
-rw-r--r--spec/ruby/core/io/codepoints_spec.rb38
-rw-r--r--spec/ruby/core/io/constants_spec.rb19
-rw-r--r--spec/ruby/core/io/copy_stream_spec.rb322
-rw-r--r--spec/ruby/core/io/dup_spec.rb106
-rw-r--r--spec/ruby/core/io/each_byte_spec.rb57
-rw-r--r--spec/ruby/core/io/each_char_spec.rb12
-rw-r--r--spec/ruby/core/io/each_codepoint_spec.rb43
-rw-r--r--spec/ruby/core/io/each_line_spec.rb11
-rw-r--r--spec/ruby/core/io/each_spec.rb11
-rw-r--r--spec/ruby/core/io/eof_spec.rb107
-rw-r--r--spec/ruby/core/io/external_encoding_spec.rb225
-rw-r--r--spec/ruby/core/io/fcntl_spec.rb8
-rw-r--r--spec/ruby/core/io/fdatasync_spec.rb5
-rw-r--r--spec/ruby/core/io/fileno_spec.rb12
-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-16BE.txtbin0 -> 20 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-16LE.txtbin0 -> 20 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-32BE.txtbin0 -> 40 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-32LE.txtbin0 -> 40 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-8.txt1
-rw-r--r--spec/ruby/core/io/fixtures/classes.rb218
-rw-r--r--spec/ruby/core/io/fixtures/copy_in_out.rb2
-rw-r--r--spec/ruby/core/io/fixtures/copy_stream.txt6
-rw-r--r--spec/ruby/core/io/fixtures/empty.txt0
-rw-r--r--spec/ruby/core/io/fixtures/incomplete.txt1
-rw-r--r--spec/ruby/core/io/fixtures/lines.txt9
-rw-r--r--spec/ruby/core/io/fixtures/no_bom_UTF-8.txt1
-rw-r--r--spec/ruby/core/io/fixtures/numbered_lines.txt5
-rw-r--r--spec/ruby/core/io/fixtures/one_byte.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_binary.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_euc_jp.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_text.txt1
-rw-r--r--spec/ruby/core/io/fixtures/reopen_stdout.rb3
-rw-r--r--spec/ruby/core/io/flush_spec.rb37
-rw-r--r--spec/ruby/core/io/for_fd_spec.rb10
-rw-r--r--spec/ruby/core/io/foreach_spec.rb81
-rw-r--r--spec/ruby/core/io/fsync_spec.rb24
-rw-r--r--spec/ruby/core/io/getbyte_spec.rb42
-rw-r--r--spec/ruby/core/io/getc_spec.rb42
-rw-r--r--spec/ruby/core/io/gets_spec.rb315
-rw-r--r--spec/ruby/core/io/initialize_spec.rb49
-rw-r--r--spec/ruby/core/io/inspect_spec.rb23
-rw-r--r--spec/ruby/core/io/internal_encoding_spec.rb147
-rw-r--r--spec/ruby/core/io/io_spec.rb11
-rw-r--r--spec/ruby/core/io/ioctl_spec.rb32
-rw-r--r--spec/ruby/core/io/isatty_spec.rb6
-rw-r--r--spec/ruby/core/io/lineno_spec.rb136
-rw-r--r--spec/ruby/core/io/lines_spec.rb46
-rw-r--r--spec/ruby/core/io/new_spec.rb12
-rw-r--r--spec/ruby/core/io/nonblock_spec.rb70
-rw-r--r--spec/ruby/core/io/open_spec.rb86
-rw-r--r--spec/ruby/core/io/output_spec.rb27
-rw-r--r--spec/ruby/core/io/path_spec.rb14
-rw-r--r--spec/ruby/core/io/pid_spec.rb35
-rw-r--r--spec/ruby/core/io/pipe_spec.rb225
-rw-r--r--spec/ruby/core/io/popen_spec.rb271
-rw-r--r--spec/ruby/core/io/pos_spec.rb11
-rw-r--r--spec/ruby/core/io/pread_spec.rb50
-rw-r--r--spec/ruby/core/io/print_spec.rb66
-rw-r--r--spec/ruby/core/io/printf_spec.rb32
-rw-r--r--spec/ruby/core/io/putc_spec.rb11
-rw-r--r--spec/ruby/core/io/puts_spec.rb139
-rw-r--r--spec/ruby/core/io/pwrite_spec.rb43
-rw-r--r--spec/ruby/core/io/read_nonblock_spec.rb148
-rw-r--r--spec/ruby/core/io/read_spec.rb627
-rw-r--r--spec/ruby/core/io/readbyte_spec.rb24
-rw-r--r--spec/ruby/core/io/readchar_spec.rb110
-rw-r--r--spec/ruby/core/io/readline_spec.rb86
-rw-r--r--spec/ruby/core/io/readlines_spec.rb236
-rw-r--r--spec/ruby/core/io/readpartial_spec.rb111
-rw-r--r--spec/ruby/core/io/reopen_spec.rb313
-rw-r--r--spec/ruby/core/io/rewind_spec.rb53
-rw-r--r--spec/ruby/core/io/seek_spec.rb79
-rw-r--r--spec/ruby/core/io/select_spec.rb120
-rw-r--r--spec/ruby/core/io/set_encoding_by_bom_spec.rb262
-rw-r--r--spec/ruby/core/io/set_encoding_spec.rb238
-rw-r--r--spec/ruby/core/io/shared/binwrite.rb78
-rw-r--r--spec/ruby/core/io/shared/chars.rb73
-rw-r--r--spec/ruby/core/io/shared/codepoints.rb54
-rw-r--r--spec/ruby/core/io/shared/each.rb267
-rw-r--r--spec/ruby/core/io/shared/gets_ascii.rb19
-rw-r--r--spec/ruby/core/io/shared/new.rb404
-rw-r--r--spec/ruby/core/io/shared/pos.rb78
-rw-r--r--spec/ruby/core/io/shared/readlines.rb263
-rw-r--r--spec/ruby/core/io/shared/tty.rb24
-rw-r--r--spec/ruby/core/io/shared/write.rb99
-rw-r--r--spec/ruby/core/io/stat_spec.rb24
-rw-r--r--spec/ruby/core/io/sync_spec.rb64
-rw-r--r--spec/ruby/core/io/sysopen_spec.rb50
-rw-r--r--spec/ruby/core/io/sysread_spec.rb132
-rw-r--r--spec/ruby/core/io/sysseek_spec.rb49
-rw-r--r--spec/ruby/core/io/syswrite_spec.rb81
-rw-r--r--spec/ruby/core/io/tell_spec.rb7
-rw-r--r--spec/ruby/core/io/to_i_spec.rb12
-rw-r--r--spec/ruby/core/io/to_io_spec.rb21
-rw-r--r--spec/ruby/core/io/try_convert_spec.rb49
-rw-r--r--spec/ruby/core/io/tty_spec.rb6
-rw-r--r--spec/ruby/core/io/ungetbyte_spec.rb54
-rw-r--r--spec/ruby/core/io/ungetc_spec.rb148
-rw-r--r--spec/ruby/core/io/write_nonblock_spec.rb95
-rw-r--r--spec/ruby/core/io/write_spec.rb204
-rw-r--r--spec/ruby/core/kernel/Array_spec.rb97
-rw-r--r--spec/ruby/core/kernel/Complex_spec.rb272
-rw-r--r--spec/ruby/core/kernel/Float_spec.rb345
-rw-r--r--spec/ruby/core/kernel/Hash_spec.rb63
-rw-r--r--spec/ruby/core/kernel/Integer_spec.rb801
-rw-r--r--spec/ruby/core/kernel/Rational_spec.rb6
-rw-r--r--spec/ruby/core/kernel/String_spec.rb106
-rw-r--r--spec/ruby/core/kernel/__callee___spec.rb48
-rw-r--r--spec/ruby/core/kernel/__dir___spec.rb37
-rw-r--r--spec/ruby/core/kernel/__method___spec.rb40
-rw-r--r--spec/ruby/core/kernel/abort_spec.rb15
-rw-r--r--spec/ruby/core/kernel/at_exit_spec.rb70
-rw-r--r--spec/ruby/core/kernel/autoload_spec.rb175
-rw-r--r--spec/ruby/core/kernel/backtick_spec.rb84
-rw-r--r--spec/ruby/core/kernel/binding_spec.rb51
-rw-r--r--spec/ruby/core/kernel/block_given_spec.rb38
-rw-r--r--spec/ruby/core/kernel/caller_locations_spec.rb84
-rw-r--r--spec/ruby/core/kernel/caller_spec.rb70
-rw-r--r--spec/ruby/core/kernel/case_compare_spec.rb135
-rw-r--r--spec/ruby/core/kernel/catch_spec.rb127
-rw-r--r--spec/ruby/core/kernel/chomp_spec.rb65
-rw-r--r--spec/ruby/core/kernel/chop_spec.rb53
-rw-r--r--spec/ruby/core/kernel/class_spec.rb26
-rw-r--r--spec/ruby/core/kernel/clone_spec.rb209
-rw-r--r--spec/ruby/core/kernel/comparison_spec.rb31
-rw-r--r--spec/ruby/core/kernel/define_singleton_method_spec.rb114
-rw-r--r--spec/ruby/core/kernel/display_spec.rb6
-rw-r--r--spec/ruby/core/kernel/dup_spec.rb67
-rw-r--r--spec/ruby/core/kernel/enum_for_spec.rb5
-rw-r--r--spec/ruby/core/kernel/eql_spec.rb10
-rw-r--r--spec/ruby/core/kernel/equal_value_spec.rb15
-rw-r--r--spec/ruby/core/kernel/eval_spec.rb439
-rw-r--r--spec/ruby/core/kernel/exec_spec.rb18
-rw-r--r--spec/ruby/core/kernel/exit_spec.rb27
-rw-r--r--spec/ruby/core/kernel/extend_spec.rb79
-rw-r--r--spec/ruby/core/kernel/fail_spec.rb42
-rw-r--r--spec/ruby/core/kernel/fixtures/Complex.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/__callee__.rb34
-rw-r--r--spec/ruby/core/kernel/fixtures/__dir__.rb2
-rw-r--r--spec/ruby/core/kernel/fixtures/__method__.rb34
-rw-r--r--spec/ruby/core/kernel/fixtures/at_exit.rb3
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_b.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_d.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_from_included_module.rb9
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_from_included_module2.rb9
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_frozen.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller_at_exit.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller_locations.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/chomp.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chomp_f.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chop.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chop_f.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/classes.rb504
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_locals.rb6
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_return_with_lambda.rb12
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_return_without_lambda.rb14
-rw-r--r--spec/ruby/core/kernel/fixtures/singleton_methods.rb13
-rw-r--r--spec/ruby/core/kernel/fixtures/test.rb362
-rw-r--r--spec/ruby/core/kernel/fixtures/warn_core_method.rb14
-rw-r--r--spec/ruby/core/kernel/fixtures/warn_require.rb1
-rw-r--r--spec/ruby/core/kernel/fixtures/warn_require_caller.rb2
-rw-r--r--spec/ruby/core/kernel/fork_spec.rb15
-rw-r--r--spec/ruby/core/kernel/format_spec.rb15
-rw-r--r--spec/ruby/core/kernel/freeze_spec.rb91
-rw-r--r--spec/ruby/core/kernel/frozen_spec.rb76
-rw-r--r--spec/ruby/core/kernel/gets_spec.rb17
-rw-r--r--spec/ruby/core/kernel/global_variables_spec.rb26
-rw-r--r--spec/ruby/core/kernel/gsub_spec.rb96
-rw-r--r--spec/ruby/core/kernel/initialize_clone_spec.rb28
-rw-r--r--spec/ruby/core/kernel/initialize_copy_spec.rb29
-rw-r--r--spec/ruby/core/kernel/initialize_dup_spec.rb20
-rw-r--r--spec/ruby/core/kernel/inspect_spec.rb31
-rw-r--r--spec/ruby/core/kernel/instance_of_spec.rb40
-rw-r--r--spec/ruby/core/kernel/instance_variable_defined_spec.rb41
-rw-r--r--spec/ruby/core/kernel/instance_variable_get_spec.rb111
-rw-r--r--spec/ruby/core/kernel/instance_variable_set_spec.rb105
-rw-r--r--spec/ruby/core/kernel/instance_variables_spec.rb40
-rw-r--r--spec/ruby/core/kernel/is_a_spec.rb6
-rw-r--r--spec/ruby/core/kernel/iterator_spec.rb14
-rw-r--r--spec/ruby/core/kernel/itself_spec.rb9
-rw-r--r--spec/ruby/core/kernel/kind_of_spec.rb6
-rw-r--r--spec/ruby/core/kernel/lambda_spec.rb150
-rw-r--r--spec/ruby/core/kernel/load_spec.rb40
-rw-r--r--spec/ruby/core/kernel/local_variables_spec.rb48
-rw-r--r--spec/ruby/core/kernel/loop_spec.rb79
-rw-r--r--spec/ruby/core/kernel/match_spec.rb30
-rw-r--r--spec/ruby/core/kernel/method_spec.rb61
-rw-r--r--spec/ruby/core/kernel/methods_spec.rb101
-rw-r--r--spec/ruby/core/kernel/nil_spec.rb12
-rw-r--r--spec/ruby/core/kernel/not_match_spec.rb21
-rw-r--r--spec/ruby/core/kernel/object_id_spec.rb6
-rw-r--r--spec/ruby/core/kernel/open_spec.rb167
-rw-r--r--spec/ruby/core/kernel/p_spec.rb85
-rw-r--r--spec/ruby/core/kernel/pp_spec.rb9
-rw-r--r--spec/ruby/core/kernel/print_spec.rb24
-rw-r--r--spec/ruby/core/kernel/printf_spec.rb63
-rw-r--r--spec/ruby/core/kernel/private_methods_spec.rb69
-rw-r--r--spec/ruby/core/kernel/proc_spec.rb58
-rw-r--r--spec/ruby/core/kernel/protected_methods_spec.rb69
-rw-r--r--spec/ruby/core/kernel/public_method_spec.rb32
-rw-r--r--spec/ruby/core/kernel/public_methods_spec.rb76
-rw-r--r--spec/ruby/core/kernel/public_send_spec.rb116
-rw-r--r--spec/ruby/core/kernel/putc_spec.rb39
-rw-r--r--spec/ruby/core/kernel/puts_spec.rb29
-rw-r--r--spec/ruby/core/kernel/raise_spec.rb57
-rw-r--r--spec/ruby/core/kernel/rand_spec.rb197
-rw-r--r--spec/ruby/core/kernel/readline_spec.rb12
-rw-r--r--spec/ruby/core/kernel/readlines_spec.rb12
-rw-r--r--spec/ruby/core/kernel/remove_instance_variable_spec.rb72
-rw-r--r--spec/ruby/core/kernel/require_relative_spec.rb437
-rw-r--r--spec/ruby/core/kernel/require_spec.rb34
-rw-r--r--spec/ruby/core/kernel/respond_to_missing_spec.rb100
-rw-r--r--spec/ruby/core/kernel/respond_to_spec.rb72
-rw-r--r--spec/ruby/core/kernel/select_spec.rb18
-rw-r--r--spec/ruby/core/kernel/send_spec.rb68
-rw-r--r--spec/ruby/core/kernel/set_trace_func_spec.rb12
-rw-r--r--spec/ruby/core/kernel/shared/dup_clone.rb91
-rw-r--r--spec/ruby/core/kernel/shared/kind_of.rb55
-rw-r--r--spec/ruby/core/kernel/shared/lambda.rb11
-rw-r--r--spec/ruby/core/kernel/shared/load.rb207
-rw-r--r--spec/ruby/core/kernel/shared/method.rb56
-rw-r--r--spec/ruby/core/kernel/shared/require.rb808
-rw-r--r--spec/ruby/core/kernel/shared/sprintf.rb993
-rw-r--r--spec/ruby/core/kernel/shared/sprintf_encoding.rb67
-rw-r--r--spec/ruby/core/kernel/shared/then.rb20
-rw-r--r--spec/ruby/core/kernel/singleton_class_spec.rb29
-rw-r--r--spec/ruby/core/kernel/singleton_method_spec.rb41
-rw-r--r--spec/ruby/core/kernel/singleton_methods_spec.rb192
-rw-r--r--spec/ruby/core/kernel/sleep_spec.rb62
-rw-r--r--spec/ruby/core/kernel/spawn_spec.rb25
-rw-r--r--spec/ruby/core/kernel/sprintf_spec.rb24
-rw-r--r--spec/ruby/core/kernel/srand_spec.rb73
-rw-r--r--spec/ruby/core/kernel/sub_spec.rb26
-rw-r--r--spec/ruby/core/kernel/syscall_spec.rb12
-rw-r--r--spec/ruby/core/kernel/system_spec.rb115
-rw-r--r--spec/ruby/core/kernel/taint_spec.rb19
-rw-r--r--spec/ruby/core/kernel/tainted_spec.rb21
-rw-r--r--spec/ruby/core/kernel/tap_spec.rb13
-rw-r--r--spec/ruby/core/kernel/test_spec.rb109
-rw-r--r--spec/ruby/core/kernel/then_spec.rb6
-rw-r--r--spec/ruby/core/kernel/throw_spec.rb80
-rw-r--r--spec/ruby/core/kernel/to_enum_spec.rb5
-rw-r--r--spec/ruby/core/kernel/to_s_spec.rb8
-rw-r--r--spec/ruby/core/kernel/trace_var_spec.rb54
-rw-r--r--spec/ruby/core/kernel/trap_spec.rb9
-rw-r--r--spec/ruby/core/kernel/trust_spec.rb20
-rw-r--r--spec/ruby/core/kernel/untaint_spec.rb20
-rw-r--r--spec/ruby/core/kernel/untrace_var_spec.rb12
-rw-r--r--spec/ruby/core/kernel/untrust_spec.rb19
-rw-r--r--spec/ruby/core/kernel/untrusted_spec.rb20
-rw-r--r--spec/ruby/core/kernel/warn_spec.rb309
-rw-r--r--spec/ruby/core/kernel/yield_self_spec.rb6
-rw-r--r--spec/ruby/core/main/define_method_spec.rb28
-rw-r--r--spec/ruby/core/main/fixtures/classes.rb26
-rw-r--r--spec/ruby/core/main/fixtures/string_refinement.rb7
-rw-r--r--spec/ruby/core/main/fixtures/string_refinement_user.rb11
-rw-r--r--spec/ruby/core/main/fixtures/using.rb1
-rw-r--r--spec/ruby/core/main/fixtures/using_in_main.rb5
-rw-r--r--spec/ruby/core/main/fixtures/using_in_method.rb5
-rw-r--r--spec/ruby/core/main/fixtures/wrapped_include.rb1
-rw-r--r--spec/ruby/core/main/include_spec.rb16
-rw-r--r--spec/ruby/core/main/private_spec.rb52
-rw-r--r--spec/ruby/core/main/public_spec.rb53
-rw-r--r--spec/ruby/core/main/ruby2_keywords_spec.rb9
-rw-r--r--spec/ruby/core/main/to_s_spec.rb7
-rw-r--r--spec/ruby/core/main/using_spec.rb152
-rw-r--r--spec/ruby/core/marshal/dump_spec.rb650
-rw-r--r--spec/ruby/core/marshal/fixtures/classes.rb4
-rw-r--r--spec/ruby/core/marshal/fixtures/marshal_data.rb420
-rw-r--r--spec/ruby/core/marshal/fixtures/random.dumpbin0 -> 2520 bytes-rw-r--r--spec/ruby/core/marshal/float_spec.rb77
-rw-r--r--spec/ruby/core/marshal/load_spec.rb6
-rw-r--r--spec/ruby/core/marshal/major_version_spec.rb7
-rw-r--r--spec/ruby/core/marshal/minor_version_spec.rb7
-rw-r--r--spec/ruby/core/marshal/restore_spec.rb6
-rw-r--r--spec/ruby/core/marshal/shared/load.rb987
-rw-r--r--spec/ruby/core/matchdata/allocate_spec.rb8
-rw-r--r--spec/ruby/core/matchdata/begin_spec.rb104
-rw-r--r--spec/ruby/core/matchdata/captures_spec.rb15
-rw-r--r--spec/ruby/core/matchdata/dup_spec.rb14
-rw-r--r--spec/ruby/core/matchdata/element_reference_spec.rb116
-rw-r--r--spec/ruby/core/matchdata/end_spec.rb104
-rw-r--r--spec/ruby/core/matchdata/eql_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/fixtures/classes.rb3
-rw-r--r--spec/ruby/core/matchdata/hash_spec.rb5
-rw-r--r--spec/ruby/core/matchdata/inspect_spec.rb23
-rw-r--r--spec/ruby/core/matchdata/length_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/match_length_spec.rb34
-rw-r--r--spec/ruby/core/matchdata/match_spec.rb34
-rw-r--r--spec/ruby/core/matchdata/named_captures_spec.rb15
-rw-r--r--spec/ruby/core/matchdata/names_spec.rb33
-rw-r--r--spec/ruby/core/matchdata/offset_spec.rb30
-rw-r--r--spec/ruby/core/matchdata/post_match_spec.rb26
-rw-r--r--spec/ruby/core/matchdata/pre_match_spec.rb26
-rw-r--r--spec/ruby/core/matchdata/regexp_spec.rb24
-rw-r--r--spec/ruby/core/matchdata/shared/eql.rb26
-rw-r--r--spec/ruby/core/matchdata/shared/length.rb5
-rw-r--r--spec/ruby/core/matchdata/size_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/string_spec.rb25
-rw-r--r--spec/ruby/core/matchdata/to_a_spec.rb15
-rw-r--r--spec/ruby/core/matchdata/to_s_spec.rb15
-rw-r--r--spec/ruby/core/matchdata/values_at_spec.rb76
-rw-r--r--spec/ruby/core/math/acos_spec.rb56
-rw-r--r--spec/ruby/core/math/acosh_spec.rb41
-rw-r--r--spec/ruby/core/math/asin_spec.rb48
-rw-r--r--spec/ruby/core/math/asinh_spec.rb42
-rw-r--r--spec/ruby/core/math/atan2_spec.rb54
-rw-r--r--spec/ruby/core/math/atan_spec.rb40
-rw-r--r--spec/ruby/core/math/atanh_spec.rb14
-rw-r--r--spec/ruby/core/math/cbrt_spec.rb27
-rw-r--r--spec/ruby/core/math/constants_spec.rb22
-rw-r--r--spec/ruby/core/math/cos_spec.rb42
-rw-r--r--spec/ruby/core/math/cosh_spec.rb37
-rw-r--r--spec/ruby/core/math/erf_spec.rb44
-rw-r--r--spec/ruby/core/math/erfc_spec.rb43
-rw-r--r--spec/ruby/core/math/exp_spec.rb37
-rw-r--r--spec/ruby/core/math/fixtures/classes.rb28
-rw-r--r--spec/ruby/core/math/frexp_spec.rb37
-rw-r--r--spec/ruby/core/math/gamma_spec.rb69
-rw-r--r--spec/ruby/core/math/hypot_spec.rb41
-rw-r--r--spec/ruby/core/math/ldexp_spec.rb60
-rw-r--r--spec/ruby/core/math/lgamma_spec.rb54
-rw-r--r--spec/ruby/core/math/log10_spec.rb43
-rw-r--r--spec/ruby/core/math/log2_spec.rb41
-rw-r--r--spec/ruby/core/math/log_spec.rb57
-rw-r--r--spec/ruby/core/math/sin_spec.rb39
-rw-r--r--spec/ruby/core/math/sinh_spec.rb37
-rw-r--r--spec/ruby/core/math/sqrt_spec.rb40
-rw-r--r--spec/ruby/core/math/tan_spec.rb42
-rw-r--r--spec/ruby/core/math/tanh_spec.rb39
-rw-r--r--spec/ruby/core/method/arity_spec.rb222
-rw-r--r--spec/ruby/core/method/call_spec.rb7
-rw-r--r--spec/ruby/core/method/case_compare_spec.rb7
-rw-r--r--spec/ruby/core/method/clone_spec.rb14
-rw-r--r--spec/ruby/core/method/compose_spec.rb100
-rw-r--r--spec/ruby/core/method/curry_spec.rb36
-rw-r--r--spec/ruby/core/method/element_reference_spec.rb7
-rw-r--r--spec/ruby/core/method/eql_spec.rb6
-rw-r--r--spec/ruby/core/method/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/method/fixtures/classes.rb246
-rw-r--r--spec/ruby/core/method/hash_spec.rb15
-rw-r--r--spec/ruby/core/method/inspect_spec.rb6
-rw-r--r--spec/ruby/core/method/name_spec.rb22
-rw-r--r--spec/ruby/core/method/original_name_spec.rb22
-rw-r--r--spec/ruby/core/method/owner_spec.rb32
-rw-r--r--spec/ruby/core/method/parameters_spec.rb270
-rw-r--r--spec/ruby/core/method/private_spec.rb21
-rw-r--r--spec/ruby/core/method/protected_spec.rb21
-rw-r--r--spec/ruby/core/method/public_spec.rb21
-rw-r--r--spec/ruby/core/method/receiver_spec.rb22
-rw-r--r--spec/ruby/core/method/shared/call.rb51
-rw-r--r--spec/ruby/core/method/shared/eql.rb94
-rw-r--r--spec/ruby/core/method/shared/to_s.rb85
-rw-r--r--spec/ruby/core/method/source_location_spec.rb113
-rw-r--r--spec/ruby/core/method/super_method_spec.rb66
-rw-r--r--spec/ruby/core/method/to_proc_spec.rb104
-rw-r--r--spec/ruby/core/method/to_s_spec.rb6
-rw-r--r--spec/ruby/core/method/unbind_spec.rb54
-rw-r--r--spec/ruby/core/module/alias_method_spec.rb173
-rw-r--r--spec/ruby/core/module/ancestors_spec.rb70
-rw-r--r--spec/ruby/core/module/append_features_spec.rb61
-rw-r--r--spec/ruby/core/module/attr_accessor_spec.rb119
-rw-r--r--spec/ruby/core/module/attr_reader_spec.rb80
-rw-r--r--spec/ruby/core/module/attr_spec.rb168
-rw-r--r--spec/ruby/core/module/attr_writer_spec.rb90
-rw-r--r--spec/ruby/core/module/autoload_spec.rb1012
-rw-r--r--spec/ruby/core/module/case_compare_spec.rb31
-rw-r--r--spec/ruby/core/module/class_eval_spec.rb7
-rw-r--r--spec/ruby/core/module/class_exec_spec.rb7
-rw-r--r--spec/ruby/core/module/class_variable_defined_spec.rb72
-rw-r--r--spec/ruby/core/module/class_variable_get_spec.rb76
-rw-r--r--spec/ruby/core/module/class_variable_set_spec.rb62
-rw-r--r--spec/ruby/core/module/class_variables_spec.rb34
-rw-r--r--spec/ruby/core/module/comparison_spec.rb36
-rw-r--r--spec/ruby/core/module/const_added_spec.rb125
-rw-r--r--spec/ruby/core/module/const_defined_spec.rb154
-rw-r--r--spec/ruby/core/module/const_get_spec.rb251
-rw-r--r--spec/ruby/core/module/const_missing_spec.rb36
-rw-r--r--spec/ruby/core/module/const_set_spec.rb142
-rw-r--r--spec/ruby/core/module/const_source_location_spec.rb225
-rw-r--r--spec/ruby/core/module/constants_spec.rb97
-rw-r--r--spec/ruby/core/module/define_method_spec.rb805
-rw-r--r--spec/ruby/core/module/define_singleton_method_spec.rb15
-rw-r--r--spec/ruby/core/module/deprecate_constant_spec.rb61
-rw-r--r--spec/ruby/core/module/eql_spec.rb7
-rw-r--r--spec/ruby/core/module/equal_spec.rb7
-rw-r--r--spec/ruby/core/module/equal_value_spec.rb7
-rw-r--r--spec/ruby/core/module/extend_object_spec.rb56
-rw-r--r--spec/ruby/core/module/extended_spec.rb44
-rw-r--r--spec/ruby/core/module/fixtures/autoload.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_abc.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_c.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_callback.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_concur.rb9
-rw-r--r--spec/ruby/core/module/fixtures/autoload_d.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_autoload.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_require.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_require_current_file.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_e.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_empty.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_ex1.rb16
-rw-r--r--spec/ruby/core/module/fixtures/autoload_exception.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_f.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_g.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_h.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_i.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_j.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_k.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_lm.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_location.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_nested.rb8
-rw-r--r--spec/ruby/core/module/fixtures/autoload_never_set.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_o.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_overridden.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_r.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_raise.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_required_directly.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_required_directly_nested.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_required_directly_no_constant.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_s.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_self_during_require.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_subclass.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_t.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_v.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_w.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_w2.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_x.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_z.rb5
-rw-r--r--spec/ruby/core/module/fixtures/classes.rb627
-rw-r--r--spec/ruby/core/module/fixtures/constant_unicode.rb5
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload.rb6
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_a.rb2
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_b.rb2
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_c.rb3
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_d.rb4
-rw-r--r--spec/ruby/core/module/fixtures/module.rb4
-rw-r--r--spec/ruby/core/module/fixtures/multi/foo.rb6
-rw-r--r--spec/ruby/core/module/fixtures/multi/foo/bar_baz.rb11
-rw-r--r--spec/ruby/core/module/fixtures/name.rb10
-rw-r--r--spec/ruby/core/module/fixtures/path1/load_path.rb9
-rw-r--r--spec/ruby/core/module/fixtures/path2/load_path.rb1
-rw-r--r--spec/ruby/core/module/fixtures/refine.rb25
-rw-r--r--spec/ruby/core/module/fixtures/repeated_concurrent_autoload.rb8
-rw-r--r--spec/ruby/core/module/freeze_spec.rb6
-rw-r--r--spec/ruby/core/module/gt_spec.rb36
-rw-r--r--spec/ruby/core/module/gte_spec.rb33
-rw-r--r--spec/ruby/core/module/include_spec.rb577
-rw-r--r--spec/ruby/core/module/included_modules_spec.rb14
-rw-r--r--spec/ruby/core/module/included_spec.rb44
-rw-r--r--spec/ruby/core/module/initialize_copy_spec.rb18
-rw-r--r--spec/ruby/core/module/initialize_spec.rb18
-rw-r--r--spec/ruby/core/module/instance_method_spec.rb111
-rw-r--r--spec/ruby/core/module/instance_methods_spec.rb61
-rw-r--r--spec/ruby/core/module/lt_spec.rb36
-rw-r--r--spec/ruby/core/module/lte_spec.rb33
-rw-r--r--spec/ruby/core/module/method_added_spec.rb83
-rw-r--r--spec/ruby/core/module/method_defined_spec.rb98
-rw-r--r--spec/ruby/core/module/method_removed_spec.rb33
-rw-r--r--spec/ruby/core/module/method_undefined_spec.rb33
-rw-r--r--spec/ruby/core/module/module_eval_spec.rb7
-rw-r--r--spec/ruby/core/module/module_exec_spec.rb7
-rw-r--r--spec/ruby/core/module/module_function_spec.rb285
-rw-r--r--spec/ruby/core/module/name_spec.rb130
-rw-r--r--spec/ruby/core/module/nesting_spec.rb31
-rw-r--r--spec/ruby/core/module/new_spec.rb31
-rw-r--r--spec/ruby/core/module/prepend_features_spec.rb64
-rw-r--r--spec/ruby/core/module/prepend_spec.rb761
-rw-r--r--spec/ruby/core/module/prepended_spec.rb25
-rw-r--r--spec/ruby/core/module/private_class_method_spec.rb93
-rw-r--r--spec/ruby/core/module/private_constant_spec.rb32
-rw-r--r--spec/ruby/core/module/private_instance_methods_spec.rb54
-rw-r--r--spec/ruby/core/module/private_method_defined_spec.rb120
-rw-r--r--spec/ruby/core/module/private_spec.rb107
-rw-r--r--spec/ruby/core/module/protected_instance_methods_spec.rb57
-rw-r--r--spec/ruby/core/module/protected_method_defined_spec.rb120
-rw-r--r--spec/ruby/core/module/protected_spec.rb69
-rw-r--r--spec/ruby/core/module/public_class_method_spec.rb96
-rw-r--r--spec/ruby/core/module/public_constant_spec.rb38
-rw-r--r--spec/ruby/core/module/public_instance_method_spec.rb65
-rw-r--r--spec/ruby/core/module/public_instance_methods_spec.rb61
-rw-r--r--spec/ruby/core/module/public_method_defined_spec.rb72
-rw-r--r--spec/ruby/core/module/public_spec.rb57
-rw-r--r--spec/ruby/core/module/refine_spec.rb1051
-rw-r--r--spec/ruby/core/module/remove_class_variable_spec.rb44
-rw-r--r--spec/ruby/core/module/remove_const_spec.rb105
-rw-r--r--spec/ruby/core/module/remove_method_spec.rb131
-rw-r--r--spec/ruby/core/module/ruby2_keywords_spec.rb319
-rw-r--r--spec/ruby/core/module/shared/class_eval.rb168
-rw-r--r--spec/ruby/core/module/shared/class_exec.rb29
-rw-r--r--spec/ruby/core/module/shared/equal_value.rb14
-rw-r--r--spec/ruby/core/module/shared/set_visibility.rb186
-rw-r--r--spec/ruby/core/module/singleton_class_spec.rb27
-rw-r--r--spec/ruby/core/module/to_s_spec.rb68
-rw-r--r--spec/ruby/core/module/undef_method_spec.rb181
-rw-r--r--spec/ruby/core/module/using_spec.rb377
-rw-r--r--spec/ruby/core/mutex/lock_spec.rb34
-rw-r--r--spec/ruby/core/mutex/locked_spec.rb36
-rw-r--r--spec/ruby/core/mutex/owned_spec.rb55
-rw-r--r--spec/ruby/core/mutex/sleep_spec.rb103
-rw-r--r--spec/ruby/core/mutex/synchronize_spec.rb66
-rw-r--r--spec/ruby/core/mutex/try_lock_spec.rb32
-rw-r--r--spec/ruby/core/mutex/unlock_spec.rb38
-rw-r--r--spec/ruby/core/nil/and_spec.rb11
-rw-r--r--spec/ruby/core/nil/case_compare_spec.rb13
-rw-r--r--spec/ruby/core/nil/dup_spec.rb7
-rw-r--r--spec/ruby/core/nil/inspect_spec.rb7
-rw-r--r--spec/ruby/core/nil/match_spec.rb21
-rw-r--r--spec/ruby/core/nil/nil_spec.rb7
-rw-r--r--spec/ruby/core/nil/nilclass_spec.rb15
-rw-r--r--spec/ruby/core/nil/or_spec.rb11
-rw-r--r--spec/ruby/core/nil/rationalize_spec.rb16
-rw-r--r--spec/ruby/core/nil/to_a_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_c_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_f_spec.rb11
-rw-r--r--spec/ruby/core/nil/to_h_spec.rb8
-rw-r--r--spec/ruby/core/nil/to_i_spec.rb11
-rw-r--r--spec/ruby/core/nil/to_r_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_s_spec.rb15
-rw-r--r--spec/ruby/core/nil/xor_spec.rb11
-rw-r--r--spec/ruby/core/numeric/abs2_spec.rb34
-rw-r--r--spec/ruby/core/numeric/abs_spec.rb6
-rw-r--r--spec/ruby/core/numeric/angle_spec.rb6
-rw-r--r--spec/ruby/core/numeric/arg_spec.rb6
-rw-r--r--spec/ruby/core/numeric/ceil_spec.rb15
-rw-r--r--spec/ruby/core/numeric/clone_spec.rb32
-rw-r--r--spec/ruby/core/numeric/coerce_spec.rb59
-rw-r--r--spec/ruby/core/numeric/comparison_spec.rb48
-rw-r--r--spec/ruby/core/numeric/conj_spec.rb6
-rw-r--r--spec/ruby/core/numeric/conjugate_spec.rb6
-rw-r--r--spec/ruby/core/numeric/denominator_spec.rb24
-rw-r--r--spec/ruby/core/numeric/div_spec.rb22
-rw-r--r--spec/ruby/core/numeric/divmod_spec.rb15
-rw-r--r--spec/ruby/core/numeric/dup_spec.rb16
-rw-r--r--spec/ruby/core/numeric/eql_spec.rb22
-rw-r--r--spec/ruby/core/numeric/fdiv_spec.rb32
-rw-r--r--spec/ruby/core/numeric/finite_spec.rb8
-rw-r--r--spec/ruby/core/numeric/fixtures/classes.rb17
-rw-r--r--spec/ruby/core/numeric/floor_spec.rb14
-rw-r--r--spec/ruby/core/numeric/i_spec.rb15
-rw-r--r--spec/ruby/core/numeric/imag_spec.rb6
-rw-r--r--spec/ruby/core/numeric/imaginary_spec.rb6
-rw-r--r--spec/ruby/core/numeric/infinite_spec.rb8
-rw-r--r--spec/ruby/core/numeric/integer_spec.rb8
-rw-r--r--spec/ruby/core/numeric/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/numeric/modulo_spec.rb24
-rw-r--r--spec/ruby/core/numeric/negative_spec.rb41
-rw-r--r--spec/ruby/core/numeric/nonzero_spec.rb18
-rw-r--r--spec/ruby/core/numeric/numerator_spec.rb33
-rw-r--r--spec/ruby/core/numeric/numeric_spec.rb7
-rw-r--r--spec/ruby/core/numeric/phase_spec.rb6
-rw-r--r--spec/ruby/core/numeric/polar_spec.rb50
-rw-r--r--spec/ruby/core/numeric/positive_spec.rb41
-rw-r--r--spec/ruby/core/numeric/quo_spec.rb64
-rw-r--r--spec/ruby/core/numeric/real_spec.rb37
-rw-r--r--spec/ruby/core/numeric/rect_spec.rb6
-rw-r--r--spec/ruby/core/numeric/rectangular_spec.rb6
-rw-r--r--spec/ruby/core/numeric/remainder_spec.rb67
-rw-r--r--spec/ruby/core/numeric/round_spec.rb14
-rw-r--r--spec/ruby/core/numeric/shared/abs.rb19
-rw-r--r--spec/ruby/core/numeric/shared/arg.rb38
-rw-r--r--spec/ruby/core/numeric/shared/conj.rb20
-rw-r--r--spec/ruby/core/numeric/shared/imag.rb26
-rw-r--r--spec/ruby/core/numeric/shared/quo.rb7
-rw-r--r--spec/ruby/core/numeric/shared/rect.rb48
-rw-r--r--spec/ruby/core/numeric/shared/step.rb416
-rw-r--r--spec/ruby/core/numeric/singleton_method_added_spec.rb41
-rw-r--r--spec/ruby/core/numeric/step_spec.rb198
-rw-r--r--spec/ruby/core/numeric/to_c_spec.rb45
-rw-r--r--spec/ruby/core/numeric/to_int_spec.rb10
-rw-r--r--spec/ruby/core/numeric/truncate_spec.rb14
-rw-r--r--spec/ruby/core/numeric/uminus_spec.rb31
-rw-r--r--spec/ruby/core/numeric/uplus_spec.rb9
-rw-r--r--spec/ruby/core/numeric/zero_spec.rb18
-rw-r--r--spec/ruby/core/objectspace/_id2ref_spec.rb52
-rw-r--r--spec/ruby/core/objectspace/add_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/call_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/count_objects_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/define_finalizer_spec.rb194
-rw-r--r--spec/ruby/core/objectspace/each_object_spec.rb213
-rw-r--r--spec/ruby/core/objectspace/finalizers_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/fixtures/classes.rb64
-rw-r--r--spec/ruby/core/objectspace/garbage_collect_spec.rb22
-rw-r--r--spec/ruby/core/objectspace/remove_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/undefine_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/weakmap/each_key_spec.rb11
-rw-r--r--spec/ruby/core/objectspace/weakmap/each_pair_spec.rb11
-rw-r--r--spec/ruby/core/objectspace/weakmap/each_spec.rb11
-rw-r--r--spec/ruby/core/objectspace/weakmap/each_value_spec.rb11
-rw-r--r--spec/ruby/core/objectspace/weakmap/element_reference_spec.rb24
-rw-r--r--spec/ruby/core/objectspace/weakmap/element_set_spec.rb38
-rw-r--r--spec/ruby/core/objectspace/weakmap/include_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/inspect_spec.rb25
-rw-r--r--spec/ruby/core/objectspace/weakmap/key_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/keys_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/length_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/member_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/each.rb10
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/include.rb30
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/members.rb14
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/size.rb14
-rw-r--r--spec/ruby/core/objectspace/weakmap/size_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/values_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap_spec.rb12
-rw-r--r--spec/ruby/core/proc/allocate_spec.rb9
-rw-r--r--spec/ruby/core/proc/arity_spec.rb640
-rw-r--r--spec/ruby/core/proc/binding_spec.rb21
-rw-r--r--spec/ruby/core/proc/block_pass_spec.rb21
-rw-r--r--spec/ruby/core/proc/call_spec.rb16
-rw-r--r--spec/ruby/core/proc/case_compare_spec.rb16
-rw-r--r--spec/ruby/core/proc/clone_spec.rb6
-rw-r--r--spec/ruby/core/proc/compose_spec.rb162
-rw-r--r--spec/ruby/core/proc/curry_spec.rb180
-rw-r--r--spec/ruby/core/proc/dup_spec.rb6
-rw-r--r--spec/ruby/core/proc/element_reference_spec.rb27
-rw-r--r--spec/ruby/core/proc/eql_spec.rb12
-rw-r--r--spec/ruby/core/proc/equal_value_spec.rb12
-rw-r--r--spec/ruby/core/proc/fixtures/common.rb51
-rw-r--r--spec/ruby/core/proc/fixtures/proc_aref.rb9
-rw-r--r--spec/ruby/core/proc/fixtures/proc_aref_frozen.rb10
-rw-r--r--spec/ruby/core/proc/fixtures/source_location.rb55
-rw-r--r--spec/ruby/core/proc/hash_spec.rb17
-rw-r--r--spec/ruby/core/proc/inspect_spec.rb6
-rw-r--r--spec/ruby/core/proc/lambda_spec.rb60
-rw-r--r--spec/ruby/core/proc/new_spec.rb201
-rw-r--r--spec/ruby/core/proc/parameters_spec.rb118
-rw-r--r--spec/ruby/core/proc/ruby2_keywords_spec.rb78
-rw-r--r--spec/ruby/core/proc/shared/call.rb99
-rw-r--r--spec/ruby/core/proc/shared/call_arguments.rb29
-rw-r--r--spec/ruby/core/proc/shared/compose.rb22
-rw-r--r--spec/ruby/core/proc/shared/dup.rb10
-rw-r--r--spec/ruby/core/proc/shared/equal.rb100
-rw-r--r--spec/ruby/core/proc/shared/to_s.rb60
-rw-r--r--spec/ruby/core/proc/source_location_spec.rb86
-rw-r--r--spec/ruby/core/proc/to_proc_spec.rb9
-rw-r--r--spec/ruby/core/proc/to_s_spec.rb6
-rw-r--r--spec/ruby/core/proc/yield_spec.rb16
-rw-r--r--spec/ruby/core/process/_fork_spec.rb24
-rw-r--r--spec/ruby/core/process/abort_spec.rb6
-rw-r--r--spec/ruby/core/process/clock_getres_spec.rb33
-rw-r--r--spec/ruby/core/process/clock_gettime_spec.rb152
-rw-r--r--spec/ruby/core/process/constants_spec.rb86
-rw-r--r--spec/ruby/core/process/daemon_spec.rb115
-rw-r--r--spec/ruby/core/process/detach_spec.rb75
-rw-r--r--spec/ruby/core/process/egid_spec.rb58
-rw-r--r--spec/ruby/core/process/euid_spec.rb56
-rw-r--r--spec/ruby/core/process/exec_spec.rb241
-rw-r--r--spec/ruby/core/process/exit_spec.rb10
-rw-r--r--spec/ruby/core/process/fixtures/clocks.rb18
-rw-r--r--spec/ruby/core/process/fixtures/common.rb88
-rw-r--r--spec/ruby/core/process/fixtures/daemon.rb111
-rw-r--r--spec/ruby/core/process/fixtures/in.txt1
-rw-r--r--spec/ruby/core/process/fixtures/kill.rb45
-rw-r--r--spec/ruby/core/process/fixtures/map_fd.rb9
-rw-r--r--spec/ruby/core/process/fixtures/setpriority.rb12
-rw-r--r--spec/ruby/core/process/fork_spec.rb6
-rw-r--r--spec/ruby/core/process/getpgid_spec.rb17
-rw-r--r--spec/ruby/core/process/getpgrp_spec.rb7
-rw-r--r--spec/ruby/core/process/getpriority_spec.rb23
-rw-r--r--spec/ruby/core/process/getrlimit_spec.rb100
-rw-r--r--spec/ruby/core/process/gid/change_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/eid_spec.rb9
-rw-r--r--spec/ruby/core/process/gid/grant_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/re_exchange_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/re_exchangeable_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/rid_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/sid_available_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/switch_spec.rb5
-rw-r--r--spec/ruby/core/process/gid_spec.rb22
-rw-r--r--spec/ruby/core/process/groups_spec.rb67
-rw-r--r--spec/ruby/core/process/initgroups_spec.rb22
-rw-r--r--spec/ruby/core/process/kill_spec.rb132
-rw-r--r--spec/ruby/core/process/last_status_spec.rb18
-rw-r--r--spec/ruby/core/process/maxgroups_spec.rb19
-rw-r--r--spec/ruby/core/process/pid_spec.rb9
-rw-r--r--spec/ruby/core/process/ppid_spec.rb9
-rw-r--r--spec/ruby/core/process/set_proctitle_spec.rb23
-rw-r--r--spec/ruby/core/process/setpgid_spec.rb29
-rw-r--r--spec/ruby/core/process/setpgrp_spec.rb37
-rw-r--r--spec/ruby/core/process/setpriority_spec.rb60
-rw-r--r--spec/ruby/core/process/setrlimit_spec.rb241
-rw-r--r--spec/ruby/core/process/setsid_spec.rb16
-rw-r--r--spec/ruby/core/process/spawn_spec.rb756
-rw-r--r--spec/ruby/core/process/status/bit_and_spec.rb5
-rw-r--r--spec/ruby/core/process/status/coredump_spec.rb5
-rw-r--r--spec/ruby/core/process/status/equal_value_spec.rb15
-rw-r--r--spec/ruby/core/process/status/exited_spec.rb32
-rw-r--r--spec/ruby/core/process/status/exitstatus_spec.rb25
-rw-r--r--spec/ruby/core/process/status/inspect_spec.rb5
-rw-r--r--spec/ruby/core/process/status/pid_spec.rb15
-rw-r--r--spec/ruby/core/process/status/right_shift_spec.rb5
-rw-r--r--spec/ruby/core/process/status/signaled_spec.rb31
-rw-r--r--spec/ruby/core/process/status/stopped_spec.rb5
-rw-r--r--spec/ruby/core/process/status/stopsig_spec.rb5
-rw-r--r--spec/ruby/core/process/status/success_spec.rb41
-rw-r--r--spec/ruby/core/process/status/termsig_spec.rb43
-rw-r--r--spec/ruby/core/process/status/to_i_spec.rb13
-rw-r--r--spec/ruby/core/process/status/to_int_spec.rb5
-rw-r--r--spec/ruby/core/process/status/to_s_spec.rb5
-rw-r--r--spec/ruby/core/process/status/wait_spec.rb102
-rw-r--r--spec/ruby/core/process/sys/getegid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/geteuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/getgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/getuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/issetugid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setegid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/seteuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setregid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setresgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setresuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setreuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setrgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setruid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setuid_spec.rb5
-rw-r--r--spec/ruby/core/process/times_spec.rb39
-rw-r--r--spec/ruby/core/process/uid/change_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/eid_spec.rb9
-rw-r--r--spec/ruby/core/process/uid/grant_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/re_exchange_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/re_exchangeable_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/rid_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/sid_available_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/switch_spec.rb5
-rw-r--r--spec/ruby/core/process/uid_spec.rb57
-rw-r--r--spec/ruby/core/process/wait2_spec.rb45
-rw-r--r--spec/ruby/core/process/wait_spec.rb91
-rw-r--r--spec/ruby/core/process/waitall_spec.rb48
-rw-r--r--spec/ruby/core/process/waitpid2_spec.rb5
-rw-r--r--spec/ruby/core/process/waitpid_spec.rb13
-rw-r--r--spec/ruby/core/queue/append_spec.rb6
-rw-r--r--spec/ruby/core/queue/clear_spec.rb6
-rw-r--r--spec/ruby/core/queue/close_spec.rb6
-rw-r--r--spec/ruby/core/queue/closed_spec.rb6
-rw-r--r--spec/ruby/core/queue/deq_spec.rb6
-rw-r--r--spec/ruby/core/queue/empty_spec.rb6
-rw-r--r--spec/ruby/core/queue/enq_spec.rb6
-rw-r--r--spec/ruby/core/queue/initialize_spec.rb49
-rw-r--r--spec/ruby/core/queue/length_spec.rb6
-rw-r--r--spec/ruby/core/queue/num_waiting_spec.rb6
-rw-r--r--spec/ruby/core/queue/pop_spec.rb6
-rw-r--r--spec/ruby/core/queue/push_spec.rb6
-rw-r--r--spec/ruby/core/queue/shift_spec.rb6
-rw-r--r--spec/ruby/core/queue/size_spec.rb6
-rw-r--r--spec/ruby/core/random/bytes_spec.rb30
-rw-r--r--spec/ruby/core/random/default_spec.rb45
-rw-r--r--spec/ruby/core/random/equal_value_spec.rb37
-rw-r--r--spec/ruby/core/random/fixtures/classes.rb15
-rw-r--r--spec/ruby/core/random/new_seed_spec.rb24
-rw-r--r--spec/ruby/core/random/new_spec.rb37
-rw-r--r--spec/ruby/core/random/rand_spec.rb224
-rw-r--r--spec/ruby/core/random/random_number_spec.rb8
-rw-r--r--spec/ruby/core/random/seed_spec.rb29
-rw-r--r--spec/ruby/core/random/shared/bytes.rb17
-rw-r--r--spec/ruby/core/random/shared/rand.rb9
-rw-r--r--spec/ruby/core/random/srand_spec.rb39
-rw-r--r--spec/ruby/core/random/urandom_spec.rb25
-rw-r--r--spec/ruby/core/range/begin_spec.rb6
-rw-r--r--spec/ruby/core/range/bsearch_spec.rb436
-rw-r--r--spec/ruby/core/range/case_compare_spec.rb19
-rw-r--r--spec/ruby/core/range/clone_spec.rb26
-rw-r--r--spec/ruby/core/range/count_spec.rb12
-rw-r--r--spec/ruby/core/range/cover_spec.rb10
-rw-r--r--spec/ruby/core/range/dup_spec.rb23
-rw-r--r--spec/ruby/core/range/each_spec.rb114
-rw-r--r--spec/ruby/core/range/end_spec.rb6
-rw-r--r--spec/ruby/core/range/eql_spec.rb10
-rw-r--r--spec/ruby/core/range/equal_value_spec.rb18
-rw-r--r--spec/ruby/core/range/exclude_end_spec.rb19
-rw-r--r--spec/ruby/core/range/first_spec.rb53
-rw-r--r--spec/ruby/core/range/fixtures/classes.rb90
-rw-r--r--spec/ruby/core/range/frozen_spec.rb27
-rw-r--r--spec/ruby/core/range/hash_spec.rb24
-rw-r--r--spec/ruby/core/range/include_spec.rb10
-rw-r--r--spec/ruby/core/range/initialize_spec.rb50
-rw-r--r--spec/ruby/core/range/inspect_spec.rb29
-rw-r--r--spec/ruby/core/range/last_spec.rb59
-rw-r--r--spec/ruby/core/range/max_spec.rb103
-rw-r--r--spec/ruby/core/range/member_spec.rb10
-rw-r--r--spec/ruby/core/range/min_spec.rb88
-rw-r--r--spec/ruby/core/range/minmax_spec.rb132
-rw-r--r--spec/ruby/core/range/new_spec.rb79
-rw-r--r--spec/ruby/core/range/percent_spec.rb16
-rw-r--r--spec/ruby/core/range/range_spec.rb7
-rw-r--r--spec/ruby/core/range/shared/begin.rb10
-rw-r--r--spec/ruby/core/range/shared/cover.rb193
-rw-r--r--spec/ruby/core/range/shared/cover_and_include.rb76
-rw-r--r--spec/ruby/core/range/shared/end.rb10
-rw-r--r--spec/ruby/core/range/shared/equal_value.rb51
-rw-r--r--spec/ruby/core/range/shared/include.rb91
-rw-r--r--spec/ruby/core/range/size_spec.rb65
-rw-r--r--spec/ruby/core/range/step_spec.rb514
-rw-r--r--spec/ruby/core/range/to_a_spec.rb39
-rw-r--r--spec/ruby/core/range/to_s_spec.rb23
-rw-r--r--spec/ruby/core/rational/abs_spec.rb5
-rw-r--r--spec/ruby/core/rational/ceil_spec.rb5
-rw-r--r--spec/ruby/core/rational/coerce_spec.rb5
-rw-r--r--spec/ruby/core/rational/comparison_spec.rb22
-rw-r--r--spec/ruby/core/rational/denominator_spec.rb5
-rw-r--r--spec/ruby/core/rational/div_spec.rb17
-rw-r--r--spec/ruby/core/rational/divide_spec.rb19
-rw-r--r--spec/ruby/core/rational/divmod_spec.rb13
-rw-r--r--spec/ruby/core/rational/equal_value_spec.rb17
-rw-r--r--spec/ruby/core/rational/exponent_spec.rb5
-rw-r--r--spec/ruby/core/rational/fdiv_spec.rb5
-rw-r--r--spec/ruby/core/rational/floor_spec.rb5
-rw-r--r--spec/ruby/core/rational/hash_spec.rb5
-rw-r--r--spec/ruby/core/rational/inspect_spec.rb5
-rw-r--r--spec/ruby/core/rational/integer_spec.rb12
-rw-r--r--spec/ruby/core/rational/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/rational/marshal_dump_spec.rb11
-rw-r--r--spec/ruby/core/rational/minus_spec.rb51
-rw-r--r--spec/ruby/core/rational/modulo_spec.rb5
-rw-r--r--spec/ruby/core/rational/multiply_spec.rb19
-rw-r--r--spec/ruby/core/rational/numerator_spec.rb5
-rw-r--r--spec/ruby/core/rational/plus_spec.rb18
-rw-r--r--spec/ruby/core/rational/quo_spec.rb5
-rw-r--r--spec/ruby/core/rational/rational_spec.rb11
-rw-r--r--spec/ruby/core/rational/rationalize_spec.rb36
-rw-r--r--spec/ruby/core/rational/remainder_spec.rb5
-rw-r--r--spec/ruby/core/rational/round_spec.rb6
-rw-r--r--spec/ruby/core/rational/to_f_spec.rb5
-rw-r--r--spec/ruby/core/rational/to_i_spec.rb5
-rw-r--r--spec/ruby/core/rational/to_r_spec.rb20
-rw-r--r--spec/ruby/core/rational/to_s_spec.rb5
-rw-r--r--spec/ruby/core/rational/truncate_spec.rb5
-rw-r--r--spec/ruby/core/rational/zero_spec.rb13
-rw-r--r--spec/ruby/core/refinement/append_features_spec.rb21
-rw-r--r--spec/ruby/core/refinement/extend_object_spec.rb21
-rw-r--r--spec/ruby/core/refinement/import_methods_spec.rb34
-rw-r--r--spec/ruby/core/refinement/include_spec.rb27
-rw-r--r--spec/ruby/core/refinement/prepend_features_spec.rb21
-rw-r--r--spec/ruby/core/refinement/prepend_spec.rb27
-rw-r--r--spec/ruby/core/regexp/case_compare_spec.rb35
-rw-r--r--spec/ruby/core/regexp/casefold_spec.rb8
-rw-r--r--spec/ruby/core/regexp/compile_spec.rb19
-rw-r--r--spec/ruby/core/regexp/encoding_spec.rb62
-rw-r--r--spec/ruby/core/regexp/eql_spec.rb6
-rw-r--r--spec/ruby/core/regexp/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/regexp/escape_spec.rb6
-rw-r--r--spec/ruby/core/regexp/fixed_encoding_spec.rb36
-rw-r--r--spec/ruby/core/regexp/hash_spec.rb20
-rw-r--r--spec/ruby/core/regexp/initialize_spec.rb23
-rw-r--r--spec/ruby/core/regexp/inspect_spec.rb44
-rw-r--r--spec/ruby/core/regexp/last_match_spec.rb56
-rw-r--r--spec/ruby/core/regexp/match_spec.rb146
-rw-r--r--spec/ruby/core/regexp/named_captures_spec.rb35
-rw-r--r--spec/ruby/core/regexp/names_spec.rb29
-rw-r--r--spec/ruby/core/regexp/new_spec.rb19
-rw-r--r--spec/ruby/core/regexp/options_spec.rb54
-rw-r--r--spec/ruby/core/regexp/quote_spec.rb6
-rw-r--r--spec/ruby/core/regexp/shared/equal_value.rb31
-rw-r--r--spec/ruby/core/regexp/shared/new.rb609
-rw-r--r--spec/ruby/core/regexp/shared/quote.rb41
-rw-r--r--spec/ruby/core/regexp/source_spec.rb47
-rw-r--r--spec/ruby/core/regexp/timeout_spec.rb35
-rw-r--r--spec/ruby/core/regexp/to_s_spec.rb62
-rw-r--r--spec/ruby/core/regexp/try_convert_spec.rb21
-rw-r--r--spec/ruby/core/regexp/union_spec.rb159
-rw-r--r--spec/ruby/core/signal/fixtures/trap_all.rb15
-rw-r--r--spec/ruby/core/signal/list_spec.rb68
-rw-r--r--spec/ruby/core/signal/signame_spec.rb22
-rw-r--r--spec/ruby/core/signal/trap_spec.rb293
-rw-r--r--spec/ruby/core/sizedqueue/append_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/clear_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/close_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/closed_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/deq_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/empty_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/enq_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/length_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/max_spec.rb10
-rw-r--r--spec/ruby/core/sizedqueue/new_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/num_waiting_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/pop_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/push_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/shift_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/size_spec.rb6
-rw-r--r--spec/ruby/core/string/allocate_spec.rb19
-rw-r--r--spec/ruby/core/string/append_spec.rb13
-rw-r--r--spec/ruby/core/string/ascii_only_spec.rb83
-rw-r--r--spec/ruby/core/string/b_spec.rb15
-rw-r--r--spec/ruby/core/string/byteindex_spec.rb16
-rw-r--r--spec/ruby/core/string/bytes_spec.rb55
-rw-r--r--spec/ruby/core/string/bytesize_spec.rb33
-rw-r--r--spec/ruby/core/string/byteslice_spec.rb33
-rw-r--r--spec/ruby/core/string/capitalize_spec.rb216
-rw-r--r--spec/ruby/core/string/case_compare_spec.rb8
-rw-r--r--spec/ruby/core/string/casecmp_spec.rb194
-rw-r--r--spec/ruby/core/string/center_spec.rb130
-rw-r--r--spec/ruby/core/string/chars_spec.rb15
-rw-r--r--spec/ruby/core/string/chomp_spec.rb374
-rw-r--r--spec/ruby/core/string/chop_spec.rb126
-rw-r--r--spec/ruby/core/string/chr_spec.rb42
-rw-r--r--spec/ruby/core/string/clear_spec.rb37
-rw-r--r--spec/ruby/core/string/clone_spec.rb61
-rw-r--r--spec/ruby/core/string/codepoints_spec.rb18
-rw-r--r--spec/ruby/core/string/comparison_spec.rb112
-rw-r--r--spec/ruby/core/string/concat_spec.rb26
-rw-r--r--spec/ruby/core/string/count_spec.rb105
-rw-r--r--spec/ruby/core/string/crypt_spec.rb92
-rw-r--r--spec/ruby/core/string/dedup_spec.rb8
-rw-r--r--spec/ruby/core/string/delete_prefix_spec.rb91
-rw-r--r--spec/ruby/core/string/delete_spec.rb124
-rw-r--r--spec/ruby/core/string/delete_suffix_spec.rb91
-rw-r--r--spec/ruby/core/string/downcase_spec.rb202
-rw-r--r--spec/ruby/core/string/dump_spec.rb404
-rw-r--r--spec/ruby/core/string/dup_spec.rb65
-rw-r--r--spec/ruby/core/string/each_byte_spec.rb61
-rw-r--r--spec/ruby/core/string/each_char_spec.rb7
-rw-r--r--spec/ruby/core/string/each_codepoint_spec.rb8
-rw-r--r--spec/ruby/core/string/each_grapheme_cluster_spec.rb17
-rw-r--r--spec/ruby/core/string/each_line_spec.rb9
-rw-r--r--spec/ruby/core/string/element_reference_spec.rb35
-rw-r--r--spec/ruby/core/string/element_set_spec.rb588
-rw-r--r--spec/ruby/core/string/empty_spec.rb12
-rw-r--r--spec/ruby/core/string/encode_spec.rb226
-rw-r--r--spec/ruby/core/string/encoding_spec.rb188
-rw-r--r--spec/ruby/core/string/end_with_spec.rb8
-rw-r--r--spec/ruby/core/string/eql_spec.rb21
-rw-r--r--spec/ruby/core/string/equal_value_spec.rb8
-rw-r--r--spec/ruby/core/string/fixtures/classes.rb60
-rw-r--r--spec/ruby/core/string/fixtures/freeze_magic_comment.rb3
-rw-r--r--spec/ruby/core/string/fixtures/iso-8859-9-encoding.rb9
-rw-r--r--spec/ruby/core/string/fixtures/to_c.rb5
-rw-r--r--spec/ruby/core/string/fixtures/utf-8-encoding.rb7
-rw-r--r--spec/ruby/core/string/force_encoding_spec.rb71
-rw-r--r--spec/ruby/core/string/freeze_spec.rb17
-rw-r--r--spec/ruby/core/string/getbyte_spec.rb69
-rw-r--r--spec/ruby/core/string/grapheme_clusters_spec.rb13
-rw-r--r--spec/ruby/core/string/gsub_spec.rb625
-rw-r--r--spec/ruby/core/string/hash_spec.rb9
-rw-r--r--spec/ruby/core/string/hex_spec.rb49
-rw-r--r--spec/ruby/core/string/include_spec.rb49
-rw-r--r--spec/ruby/core/string/index_spec.rb332
-rw-r--r--spec/ruby/core/string/initialize_spec.rb26
-rw-r--r--spec/ruby/core/string/insert_spec.rb81
-rw-r--r--spec/ruby/core/string/inspect_spec.rb520
-rw-r--r--spec/ruby/core/string/intern_spec.rb7
-rw-r--r--spec/ruby/core/string/length_spec.rb7
-rw-r--r--spec/ruby/core/string/lines_spec.rb19
-rw-r--r--spec/ruby/core/string/ljust_spec.rb113
-rw-r--r--spec/ruby/core/string/lstrip_spec.rb77
-rw-r--r--spec/ruby/core/string/match_spec.rb167
-rw-r--r--spec/ruby/core/string/modulo_spec.rb778
-rw-r--r--spec/ruby/core/string/multiply_spec.rb7
-rw-r--r--spec/ruby/core/string/new_spec.rb61
-rw-r--r--spec/ruby/core/string/next_spec.rb11
-rw-r--r--spec/ruby/core/string/oct_spec.rb88
-rw-r--r--spec/ruby/core/string/ord_spec.rb33
-rw-r--r--spec/ruby/core/string/partition_spec.rb63
-rw-r--r--spec/ruby/core/string/plus_spec.rb36
-rw-r--r--spec/ruby/core/string/prepend_spec.rb54
-rw-r--r--spec/ruby/core/string/replace_spec.rb7
-rw-r--r--spec/ruby/core/string/reverse_spec.rb79
-rw-r--r--spec/ruby/core/string/rindex_spec.rb387
-rw-r--r--spec/ruby/core/string/rjust_spec.rb113
-rw-r--r--spec/ruby/core/string/rpartition_spec.rb71
-rw-r--r--spec/ruby/core/string/rstrip_spec.rb95
-rw-r--r--spec/ruby/core/string/scan_spec.rb175
-rw-r--r--spec/ruby/core/string/scrub_spec.rb175
-rw-r--r--spec/ruby/core/string/setbyte_spec.rb111
-rw-r--r--spec/ruby/core/string/shared/chars.rb66
-rw-r--r--spec/ruby/core/string/shared/codepoints.rb62
-rw-r--r--spec/ruby/core/string/shared/concat.rb150
-rw-r--r--spec/ruby/core/string/shared/dedup.rb57
-rw-r--r--spec/ruby/core/string/shared/each_char_without_block.rb26
-rw-r--r--spec/ruby/core/string/shared/each_codepoint_without_block.rb33
-rw-r--r--spec/ruby/core/string/shared/each_line.rb172
-rw-r--r--spec/ruby/core/string/shared/each_line_without_block.rb17
-rw-r--r--spec/ruby/core/string/shared/encode.rb247
-rw-r--r--spec/ruby/core/string/shared/eql.rb38
-rw-r--r--spec/ruby/core/string/shared/equal_value.rb29
-rw-r--r--spec/ruby/core/string/shared/grapheme_clusters.rb16
-rw-r--r--spec/ruby/core/string/shared/length.rb55
-rw-r--r--spec/ruby/core/string/shared/partition.rb51
-rw-r--r--spec/ruby/core/string/shared/replace.rb47
-rw-r--r--spec/ruby/core/string/shared/slice.rb562
-rw-r--r--spec/ruby/core/string/shared/strip.rb24
-rw-r--r--spec/ruby/core/string/shared/succ.rb96
-rw-r--r--spec/ruby/core/string/shared/to_a.rb9
-rw-r--r--spec/ruby/core/string/shared/to_s.rb13
-rw-r--r--spec/ruby/core/string/shared/to_sym.rb72
-rw-r--r--spec/ruby/core/string/size_spec.rb7
-rw-r--r--spec/ruby/core/string/slice_spec.rb441
-rw-r--r--spec/ruby/core/string/split_spec.rb614
-rw-r--r--spec/ruby/core/string/squeeze_spec.rb118
-rw-r--r--spec/ruby/core/string/start_with_spec.rb18
-rw-r--r--spec/ruby/core/string/string_spec.rb7
-rw-r--r--spec/ruby/core/string/strip_spec.rb61
-rw-r--r--spec/ruby/core/string/sub_spec.rb522
-rw-r--r--spec/ruby/core/string/succ_spec.rb11
-rw-r--r--spec/ruby/core/string/sum_spec.rb22
-rw-r--r--spec/ruby/core/string/swapcase_spec.rb201
-rw-r--r--spec/ruby/core/string/to_c_spec.rb41
-rw-r--r--spec/ruby/core/string/to_f_spec.rb70
-rw-r--r--spec/ruby/core/string/to_i_spec.rb337
-rw-r--r--spec/ruby/core/string/to_r_spec.rb58
-rw-r--r--spec/ruby/core/string/to_s_spec.rb7
-rw-r--r--spec/ruby/core/string/to_str_spec.rb7
-rw-r--r--spec/ruby/core/string/to_sym_spec.rb7
-rw-r--r--spec/ruby/core/string/tr_s_spec.rb131
-rw-r--r--spec/ruby/core/string/tr_spec.rb126
-rw-r--r--spec/ruby/core/string/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/string/uminus_spec.rb6
-rw-r--r--spec/ruby/core/string/undump_spec.rb441
-rw-r--r--spec/ruby/core/string/unicode_normalize_spec.rb115
-rw-r--r--spec/ruby/core/string/unicode_normalized_spec.rb74
-rw-r--r--spec/ruby/core/string/unpack/a_spec.rb66
-rw-r--r--spec/ruby/core/string/unpack/at_spec.rb29
-rw-r--r--spec/ruby/core/string/unpack/b_spec.rb217
-rw-r--r--spec/ruby/core/string/unpack/c_spec.rb73
-rw-r--r--spec/ruby/core/string/unpack/comment_spec.rb25
-rw-r--r--spec/ruby/core/string/unpack/d_spec.rb28
-rw-r--r--spec/ruby/core/string/unpack/e_spec.rb14
-rw-r--r--spec/ruby/core/string/unpack/f_spec.rb28
-rw-r--r--spec/ruby/core/string/unpack/g_spec.rb14
-rw-r--r--spec/ruby/core/string/unpack/h_spec.rb155
-rw-r--r--spec/ruby/core/string/unpack/i_spec.rb152
-rw-r--r--spec/ruby/core/string/unpack/j_spec.rb272
-rw-r--r--spec/ruby/core/string/unpack/l_spec.rb265
-rw-r--r--spec/ruby/core/string/unpack/m_spec.rb192
-rw-r--r--spec/ruby/core/string/unpack/n_spec.rb18
-rw-r--r--spec/ruby/core/string/unpack/p_spec.rb44
-rw-r--r--spec/ruby/core/string/unpack/percent_spec.rb7
-rw-r--r--spec/ruby/core/string/unpack/q_spec.rb64
-rw-r--r--spec/ruby/core/string/unpack/s_spec.rb152
-rw-r--r--spec/ruby/core/string/unpack/shared/basic.rb21
-rw-r--r--spec/ruby/core/string/unpack/shared/float.rb311
-rw-r--r--spec/ruby/core/string/unpack/shared/integer.rb399
-rw-r--r--spec/ruby/core/string/unpack/shared/string.rb51
-rw-r--r--spec/ruby/core/string/unpack/shared/taint.rb2
-rw-r--r--spec/ruby/core/string/unpack/shared/unicode.rb70
-rw-r--r--spec/ruby/core/string/unpack/u_spec.rb97
-rw-r--r--spec/ruby/core/string/unpack/v_spec.rb18
-rw-r--r--spec/ruby/core/string/unpack/w_spec.rb45
-rw-r--r--spec/ruby/core/string/unpack/x_spec.rb62
-rw-r--r--spec/ruby/core/string/unpack/z_spec.rb28
-rw-r--r--spec/ruby/core/string/unpack1_spec.rb36
-rw-r--r--spec/ruby/core/string/unpack_spec.rb34
-rw-r--r--spec/ruby/core/string/upcase_spec.rb194
-rw-r--r--spec/ruby/core/string/uplus_spec.rb22
-rw-r--r--spec/ruby/core/string/upto_spec.rb104
-rw-r--r--spec/ruby/core/string/valid_encoding/utf_8_spec.rb214
-rw-r--r--spec/ruby/core/string/valid_encoding_spec.rb135
-rw-r--r--spec/ruby/core/struct/clone_spec.rb7
-rw-r--r--spec/ruby/core/struct/deconstruct_keys_spec.rb76
-rw-r--r--spec/ruby/core/struct/deconstruct_spec.rb10
-rw-r--r--spec/ruby/core/struct/dig_spec.rb52
-rw-r--r--spec/ruby/core/struct/dup_spec.rb23
-rw-r--r--spec/ruby/core/struct/each_pair_spec.rb33
-rw-r--r--spec/ruby/core/struct/each_spec.rb27
-rw-r--r--spec/ruby/core/struct/element_reference_spec.rb52
-rw-r--r--spec/ruby/core/struct/element_set_spec.rb29
-rw-r--r--spec/ruby/core/struct/eql_spec.rb13
-rw-r--r--spec/ruby/core/struct/equal_value_spec.rb7
-rw-r--r--spec/ruby/core/struct/filter_spec.rb10
-rw-r--r--spec/ruby/core/struct/fixtures/classes.rb26
-rw-r--r--spec/ruby/core/struct/hash_spec.rb64
-rw-r--r--spec/ruby/core/struct/initialize_spec.rb51
-rw-r--r--spec/ruby/core/struct/inspect_spec.rb12
-rw-r--r--spec/ruby/core/struct/instance_variable_get_spec.rb16
-rw-r--r--spec/ruby/core/struct/instance_variables_spec.rb16
-rw-r--r--spec/ruby/core/struct/keyword_init_spec.rb21
-rw-r--r--spec/ruby/core/struct/length_spec.rb12
-rw-r--r--spec/ruby/core/struct/members_spec.rb13
-rw-r--r--spec/ruby/core/struct/new_spec.rb234
-rw-r--r--spec/ruby/core/struct/select_spec.rb10
-rw-r--r--spec/ruby/core/struct/shared/accessor.rb7
-rw-r--r--spec/ruby/core/struct/shared/dup.rb9
-rw-r--r--spec/ruby/core/struct/shared/equal_value.rb37
-rw-r--r--spec/ruby/core/struct/shared/inspect.rb5
-rw-r--r--spec/ruby/core/struct/shared/select.rb26
-rw-r--r--spec/ruby/core/struct/size_spec.rb11
-rw-r--r--spec/ruby/core/struct/struct_spec.rb43
-rw-r--r--spec/ruby/core/struct/to_a_spec.rb12
-rw-r--r--spec/ruby/core/struct/to_h_spec.rb56
-rw-r--r--spec/ruby/core/struct/to_s_spec.rb12
-rw-r--r--spec/ruby/core/struct/values_at_spec.rb59
-rw-r--r--spec/ruby/core/struct/values_spec.rb11
-rw-r--r--spec/ruby/core/symbol/all_symbols_spec.rb19
-rw-r--r--spec/ruby/core/symbol/capitalize_spec.rb41
-rw-r--r--spec/ruby/core/symbol/case_compare_spec.rb11
-rw-r--r--spec/ruby/core/symbol/casecmp_spec.rb144
-rw-r--r--spec/ruby/core/symbol/comparison_spec.rb51
-rw-r--r--spec/ruby/core/symbol/downcase_spec.rb25
-rw-r--r--spec/ruby/core/symbol/dup_spec.rb7
-rw-r--r--spec/ruby/core/symbol/element_reference_spec.rb6
-rw-r--r--spec/ruby/core/symbol/empty_spec.rb11
-rw-r--r--spec/ruby/core/symbol/encoding_spec.rb23
-rw-r--r--spec/ruby/core/symbol/end_with_spec.rb8
-rw-r--r--spec/ruby/core/symbol/equal_value_spec.rb14
-rw-r--r--spec/ruby/core/symbol/fixtures/classes.rb3
-rw-r--r--spec/ruby/core/symbol/id2name_spec.rb6
-rw-r--r--spec/ruby/core/symbol/inspect_spec.rb105
-rw-r--r--spec/ruby/core/symbol/intern_spec.rb11
-rw-r--r--spec/ruby/core/symbol/length_spec.rb6
-rw-r--r--spec/ruby/core/symbol/match_spec.rb77
-rw-r--r--spec/ruby/core/symbol/name_spec.rb19
-rw-r--r--spec/ruby/core/symbol/next_spec.rb6
-rw-r--r--spec/ruby/core/symbol/shared/id2name.rb16
-rw-r--r--spec/ruby/core/symbol/shared/length.rb23
-rw-r--r--spec/ruby/core/symbol/shared/slice.rb262
-rw-r--r--spec/ruby/core/symbol/shared/succ.rb18
-rw-r--r--spec/ruby/core/symbol/size_spec.rb6
-rw-r--r--spec/ruby/core/symbol/slice_spec.rb6
-rw-r--r--spec/ruby/core/symbol/start_with_spec.rb8
-rw-r--r--spec/ruby/core/symbol/succ_spec.rb6
-rw-r--r--spec/ruby/core/symbol/swapcase_spec.rb29
-rw-r--r--spec/ruby/core/symbol/symbol_spec.rb19
-rw-r--r--spec/ruby/core/symbol/to_proc_spec.rb99
-rw-r--r--spec/ruby/core/symbol/to_s_spec.rb6
-rw-r--r--spec/ruby/core/symbol/to_sym_spec.rb9
-rw-r--r--spec/ruby/core/symbol/upcase_spec.rb21
-rw-r--r--spec/ruby/core/systemexit/initialize_spec.rb26
-rw-r--r--spec/ruby/core/systemexit/success_spec.rb13
-rw-r--r--spec/ruby/core/thread/abort_on_exception_spec.rb106
-rw-r--r--spec/ruby/core/thread/add_trace_func_spec.rb5
-rw-r--r--spec/ruby/core/thread/alive_spec.rb58
-rw-r--r--spec/ruby/core/thread/allocate_spec.rb9
-rw-r--r--spec/ruby/core/thread/backtrace/limit_spec.rb15
-rw-r--r--spec/ruby/core/thread/backtrace/location/absolute_path_spec.rb102
-rw-r--r--spec/ruby/core/thread/backtrace/location/base_label_spec.rb49
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/absolute_path.rb4
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/absolute_path_main.rb2
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/absolute_path_method_added.rb10
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/classes.rb35
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/locations_in_main.rb5
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/locations_in_required.rb3
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/main.rb5
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/path.rb2
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/subdir/absolute_path_main_chdir.rb11
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/subdir/sibling.rb1
-rw-r--r--spec/ruby/core/thread/backtrace/location/inspect_spec.rb13
-rw-r--r--spec/ruby/core/thread/backtrace/location/label_spec.rb37
-rw-r--r--spec/ruby/core/thread/backtrace/location/lineno_spec.rb23
-rw-r--r--spec/ruby/core/thread/backtrace/location/path_spec.rb124
-rw-r--r--spec/ruby/core/thread/backtrace/location/to_s_spec.rb13
-rw-r--r--spec/ruby/core/thread/backtrace_locations_spec.rb79
-rw-r--r--spec/ruby/core/thread/backtrace_spec.rb69
-rw-r--r--spec/ruby/core/thread/current_spec.rb31
-rw-r--r--spec/ruby/core/thread/element_reference_spec.rb44
-rw-r--r--spec/ruby/core/thread/element_set_spec.rb51
-rw-r--r--spec/ruby/core/thread/exclusive_spec.rb49
-rw-r--r--spec/ruby/core/thread/exit_spec.rb15
-rw-r--r--spec/ruby/core/thread/fetch_spec.rb36
-rw-r--r--spec/ruby/core/thread/fixtures/classes.rb297
-rw-r--r--spec/ruby/core/thread/fork_spec.rb9
-rw-r--r--spec/ruby/core/thread/group_spec.rb5
-rw-r--r--spec/ruby/core/thread/handle_interrupt_spec.rb125
-rw-r--r--spec/ruby/core/thread/ignore_deadlock_spec.rb21
-rw-r--r--spec/ruby/core/thread/initialize_spec.rb27
-rw-r--r--spec/ruby/core/thread/inspect_spec.rb6
-rw-r--r--spec/ruby/core/thread/join_spec.rb70
-rw-r--r--spec/ruby/core/thread/key_spec.rb53
-rw-r--r--spec/ruby/core/thread/keys_spec.rb44
-rw-r--r--spec/ruby/core/thread/kill_spec.rb25
-rw-r--r--spec/ruby/core/thread/list_spec.rb55
-rw-r--r--spec/ruby/core/thread/main_spec.rb10
-rw-r--r--spec/ruby/core/thread/name_spec.rb54
-rw-r--r--spec/ruby/core/thread/native_thread_id_spec.rb17
-rw-r--r--spec/ruby/core/thread/new_spec.rb83
-rw-r--r--spec/ruby/core/thread/pass_spec.rb8
-rw-r--r--spec/ruby/core/thread/pending_interrupt_spec.rb32
-rw-r--r--spec/ruby/core/thread/priority_spec.rb72
-rw-r--r--spec/ruby/core/thread/raise_spec.rb232
-rw-r--r--spec/ruby/core/thread/report_on_exception_spec.rb157
-rw-r--r--spec/ruby/core/thread/run_spec.rb8
-rw-r--r--spec/ruby/core/thread/set_trace_func_spec.rb5
-rw-r--r--spec/ruby/core/thread/shared/exit.rb200
-rw-r--r--spec/ruby/core/thread/shared/start.rb41
-rw-r--r--spec/ruby/core/thread/shared/to_s.rb53
-rw-r--r--spec/ruby/core/thread/shared/wakeup.rb62
-rw-r--r--spec/ruby/core/thread/start_spec.rb9
-rw-r--r--spec/ruby/core/thread/status_spec.rb60
-rw-r--r--spec/ruby/core/thread/stop_spec.rb54
-rw-r--r--spec/ruby/core/thread/terminate_spec.rb7
-rw-r--r--spec/ruby/core/thread/thread_variable_get_spec.rb25
-rw-r--r--spec/ruby/core/thread/thread_variable_set_spec.rb26
-rw-r--r--spec/ruby/core/thread/thread_variable_spec.rb21
-rw-r--r--spec/ruby/core/thread/thread_variables_spec.rb29
-rw-r--r--spec/ruby/core/thread/to_s_spec.rb6
-rw-r--r--spec/ruby/core/thread/value_spec.rb31
-rw-r--r--spec/ruby/core/thread/wakeup_spec.rb7
-rw-r--r--spec/ruby/core/threadgroup/add_spec.rb39
-rw-r--r--spec/ruby/core/threadgroup/default_spec.rb11
-rw-r--r--spec/ruby/core/threadgroup/enclose_spec.rb24
-rw-r--r--spec/ruby/core/threadgroup/enclosed_spec.rb14
-rw-r--r--spec/ruby/core/threadgroup/list_spec.rb23
-rw-r--r--spec/ruby/core/time/_dump_spec.rb55
-rw-r--r--spec/ruby/core/time/_load_spec.rb52
-rw-r--r--spec/ruby/core/time/asctime_spec.rb6
-rw-r--r--spec/ruby/core/time/at_spec.rb291
-rw-r--r--spec/ruby/core/time/ceil_spec.rb44
-rw-r--r--spec/ruby/core/time/comparison_spec.rb104
-rw-r--r--spec/ruby/core/time/ctime_spec.rb6
-rw-r--r--spec/ruby/core/time/day_spec.rb6
-rw-r--r--spec/ruby/core/time/dst_spec.rb6
-rw-r--r--spec/ruby/core/time/dup_spec.rb46
-rw-r--r--spec/ruby/core/time/eql_spec.rb29
-rw-r--r--spec/ruby/core/time/fixtures/classes.rb106
-rw-r--r--spec/ruby/core/time/floor_spec.rb36
-rw-r--r--spec/ruby/core/time/friday_spec.rb11
-rw-r--r--spec/ruby/core/time/getgm_spec.rb6
-rw-r--r--spec/ruby/core/time/getlocal_spec.rb167
-rw-r--r--spec/ruby/core/time/getutc_spec.rb6
-rw-r--r--spec/ruby/core/time/gm_spec.rb10
-rw-r--r--spec/ruby/core/time/gmt_offset_spec.rb6
-rw-r--r--spec/ruby/core/time/gmt_spec.rb8
-rw-r--r--spec/ruby/core/time/gmtime_spec.rb6
-rw-r--r--spec/ruby/core/time/gmtoff_spec.rb6
-rw-r--r--spec/ruby/core/time/hash_spec.rb11
-rw-r--r--spec/ruby/core/time/hour_spec.rb17
-rw-r--r--spec/ruby/core/time/inspect_spec.rb33
-rw-r--r--spec/ruby/core/time/isdst_spec.rb6
-rw-r--r--spec/ruby/core/time/local_spec.rb11
-rw-r--r--spec/ruby/core/time/localtime_spec.rb152
-rw-r--r--spec/ruby/core/time/mday_spec.rb6
-rw-r--r--spec/ruby/core/time/min_spec.rb17
-rw-r--r--spec/ruby/core/time/minus_spec.rb121
-rw-r--r--spec/ruby/core/time/mktime_spec.rb11
-rw-r--r--spec/ruby/core/time/mon_spec.rb6
-rw-r--r--spec/ruby/core/time/monday_spec.rb11
-rw-r--r--spec/ruby/core/time/month_spec.rb6
-rw-r--r--spec/ruby/core/time/new_spec.rb458
-rw-r--r--spec/ruby/core/time/now_spec.rb51
-rw-r--r--spec/ruby/core/time/nsec_spec.rb31
-rw-r--r--spec/ruby/core/time/plus_spec.rb118
-rw-r--r--spec/ruby/core/time/round_spec.rb35
-rw-r--r--spec/ruby/core/time/saturday_spec.rb11
-rw-r--r--spec/ruby/core/time/sec_spec.rb7
-rw-r--r--spec/ruby/core/time/shared/asctime.rb6
-rw-r--r--spec/ruby/core/time/shared/day.rb15
-rw-r--r--spec/ruby/core/time/shared/getgm.rb9
-rw-r--r--spec/ruby/core/time/shared/gm.rb70
-rw-r--r--spec/ruby/core/time/shared/gmt_offset.rb59
-rw-r--r--spec/ruby/core/time/shared/gmtime.rb33
-rw-r--r--spec/ruby/core/time/shared/inspect.rb21
-rw-r--r--spec/ruby/core/time/shared/isdst.rb8
-rw-r--r--spec/ruby/core/time/shared/local.rb42
-rw-r--r--spec/ruby/core/time/shared/month.rb15
-rw-r--r--spec/ruby/core/time/shared/now.rb33
-rw-r--r--spec/ruby/core/time/shared/time_params.rb267
-rw-r--r--spec/ruby/core/time/shared/to_i.rb16
-rw-r--r--spec/ruby/core/time/strftime_spec.rb93
-rw-r--r--spec/ruby/core/time/subsec_spec.rb27
-rw-r--r--spec/ruby/core/time/succ_spec.rb39
-rw-r--r--spec/ruby/core/time/sunday_spec.rb11
-rw-r--r--spec/ruby/core/time/thursday_spec.rb11
-rw-r--r--spec/ruby/core/time/time_spec.rb7
-rw-r--r--spec/ruby/core/time/to_a_spec.rb12
-rw-r--r--spec/ruby/core/time/to_f_spec.rb7
-rw-r--r--spec/ruby/core/time/to_i_spec.rb6
-rw-r--r--spec/ruby/core/time/to_r_spec.rb11
-rw-r--r--spec/ruby/core/time/to_s_spec.rb6
-rw-r--r--spec/ruby/core/time/tuesday_spec.rb11
-rw-r--r--spec/ruby/core/time/tv_nsec_spec.rb5
-rw-r--r--spec/ruby/core/time/tv_sec_spec.rb6
-rw-r--r--spec/ruby/core/time/tv_usec_spec.rb5
-rw-r--r--spec/ruby/core/time/usec_spec.rb43
-rw-r--r--spec/ruby/core/time/utc_offset_spec.rb6
-rw-r--r--spec/ruby/core/time/utc_spec.rb58
-rw-r--r--spec/ruby/core/time/wday_spec.rb9
-rw-r--r--spec/ruby/core/time/wednesday_spec.rb11
-rw-r--r--spec/ruby/core/time/yday_spec.rb21
-rw-r--r--spec/ruby/core/time/year_spec.rb17
-rw-r--r--spec/ruby/core/time/zone_spec.rb104
-rw-r--r--spec/ruby/core/tracepoint/allow_reentry_spec.rb32
-rw-r--r--spec/ruby/core/tracepoint/binding_spec.rb21
-rw-r--r--spec/ruby/core/tracepoint/callee_id_spec.rb18
-rw-r--r--spec/ruby/core/tracepoint/defined_class_spec.rb27
-rw-r--r--spec/ruby/core/tracepoint/disable_spec.rb76
-rw-r--r--spec/ruby/core/tracepoint/enable_spec.rb574
-rw-r--r--spec/ruby/core/tracepoint/enabled_spec.rb15
-rw-r--r--spec/ruby/core/tracepoint/eval_script_spec.rb23
-rw-r--r--spec/ruby/core/tracepoint/event_spec.rb22
-rw-r--r--spec/ruby/core/tracepoint/fixtures/classes.rb40
-rw-r--r--spec/ruby/core/tracepoint/inspect_spec.rb134
-rw-r--r--spec/ruby/core/tracepoint/lineno_spec.rb20
-rw-r--r--spec/ruby/core/tracepoint/method_id_spec.rb15
-rw-r--r--spec/ruby/core/tracepoint/new_spec.rb72
-rw-r--r--spec/ruby/core/tracepoint/parameters_spec.rb28
-rw-r--r--spec/ruby/core/tracepoint/path_spec.rb26
-rw-r--r--spec/ruby/core/tracepoint/raised_exception_spec.rb20
-rw-r--r--spec/ruby/core/tracepoint/return_value_spec.rb17
-rw-r--r--spec/ruby/core/tracepoint/self_spec.rb26
-rw-r--r--spec/ruby/core/tracepoint/trace_spec.rb10
-rw-r--r--spec/ruby/core/true/and_spec.rb11
-rw-r--r--spec/ruby/core/true/case_compare_spec.rb13
-rw-r--r--spec/ruby/core/true/dup_spec.rb7
-rw-r--r--spec/ruby/core/true/inspect_spec.rb7
-rw-r--r--spec/ruby/core/true/or_spec.rb11
-rw-r--r--spec/ruby/core/true/to_s_spec.rb15
-rw-r--r--spec/ruby/core/true/trueclass_spec.rb15
-rw-r--r--spec/ruby/core/true/xor_spec.rb11
-rw-r--r--spec/ruby/core/unboundmethod/arity_spec.rb207
-rw-r--r--spec/ruby/core/unboundmethod/bind_call_spec.rb50
-rw-r--r--spec/ruby/core/unboundmethod/bind_spec.rb61
-rw-r--r--spec/ruby/core/unboundmethod/clone_spec.rb12
-rw-r--r--spec/ruby/core/unboundmethod/eql_spec.rb5
-rw-r--r--spec/ruby/core/unboundmethod/equal_value_spec.rb157
-rw-r--r--spec/ruby/core/unboundmethod/fixtures/classes.rb103
-rw-r--r--spec/ruby/core/unboundmethod/hash_spec.rb22
-rw-r--r--spec/ruby/core/unboundmethod/inspect_spec.rb7
-rw-r--r--spec/ruby/core/unboundmethod/name_spec.rb15
-rw-r--r--spec/ruby/core/unboundmethod/original_name_spec.rb22
-rw-r--r--spec/ruby/core/unboundmethod/owner_spec.rb33
-rw-r--r--spec/ruby/core/unboundmethod/parameters_spec.rb5
-rw-r--r--spec/ruby/core/unboundmethod/private_spec.rb21
-rw-r--r--spec/ruby/core/unboundmethod/protected_spec.rb21
-rw-r--r--spec/ruby/core/unboundmethod/public_spec.rb21
-rw-r--r--spec/ruby/core/unboundmethod/shared/to_s.rb44
-rw-r--r--spec/ruby/core/unboundmethod/source_location_spec.rb52
-rw-r--r--spec/ruby/core/unboundmethod/super_method_spec.rb51
-rw-r--r--spec/ruby/core/unboundmethod/to_s_spec.rb7
-rw-r--r--spec/ruby/core/warning/element_reference_spec.rb20
-rw-r--r--spec/ruby/core/warning/element_set_spec.rb35
-rw-r--r--spec/ruby/core/warning/warn_spec.rb90
-rw-r--r--spec/ruby/default.mspec50
-rw-r--r--spec/ruby/fixtures/basicobject/method_missing.rb55
-rw-r--r--spec/ruby/fixtures/class.rb142
-rw-r--r--spec/ruby/fixtures/class_variables.rb58
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.bundle1
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.dll1
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.dylib1
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.so1
-rw-r--r--spec/ruby/fixtures/code/b/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/c/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/concurrent.rb12
-rw-r--r--spec/ruby/fixtures/code/concurrent2.rb8
-rw-r--r--spec/ruby/fixtures/code/concurrent3.rb2
-rw-r--r--spec/ruby/fixtures/code/concurrent_require_fixture.rb4
-rw-r--r--spec/ruby/fixtures/code/file_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/gem/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/line_fixture.rb5
-rw-r--r--spec/ruby/fixtures/code/load_ext_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.bundle1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.dll1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.dylib1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.bundle1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.dll1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.dylib1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.so1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.so1
-rw-r--r--spec/ruby/fixtures/code/load_fixture_and__FILE__.rb1
-rw-r--r--spec/ruby/fixtures/code/load_wrap_fixture.rb12
-rw-r--r--spec/ruby/fixtures/code/load_wrap_method_fixture.rb9
-rw-r--r--spec/ruby/fixtures/code/methods_fixture.rb364
-rw-r--r--spec/ruby/fixtures/code/raise_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/recursive_load_fixture.rb5
-rw-r--r--spec/ruby/fixtures/code/recursive_require_fixture.rb3
-rw-r--r--spec/ruby/fixtures/code/symlink/symlink1.rb1
-rw-r--r--spec/ruby/fixtures/code/symlink/symlink2/symlink2.rb1
-rw-r--r--spec/ruby/fixtures/code_loading.rb41
-rw-r--r--spec/ruby/fixtures/constants.rb323
-rw-r--r--spec/ruby/fixtures/enumerator/classes.rb15
-rw-r--r--spec/ruby/fixtures/math/common.rb3
-rw-r--r--spec/ruby/fixtures/rational.rb14
-rw-r--r--spec/ruby/fixtures/reflection.rb352
-rw-r--r--spec/ruby/language/BEGIN_spec.rb41
-rw-r--r--spec/ruby/language/END_spec.rb15
-rw-r--r--spec/ruby/language/README30
-rw-r--r--spec/ruby/language/alias_spec.rb276
-rw-r--r--spec/ruby/language/and_spec.rb80
-rw-r--r--spec/ruby/language/array_spec.rb162
-rw-r--r--spec/ruby/language/block_spec.rb1102
-rw-r--r--spec/ruby/language/break_spec.rb383
-rw-r--r--spec/ruby/language/case_spec.rb445
-rw-r--r--spec/ruby/language/class_spec.rb363
-rw-r--r--spec/ruby/language/class_variable_spec.rb116
-rw-r--r--spec/ruby/language/comment_spec.rb13
-rw-r--r--spec/ruby/language/constants_spec.rb750
-rw-r--r--spec/ruby/language/def_spec.rb798
-rw-r--r--spec/ruby/language/defined_spec.rb1171
-rw-r--r--spec/ruby/language/delegation_spec.rb65
-rw-r--r--spec/ruby/language/encoding_spec.rb36
-rw-r--r--spec/ruby/language/ensure_spec.rb331
-rw-r--r--spec/ruby/language/execution_spec.rb15
-rw-r--r--spec/ruby/language/file_spec.rb21
-rw-r--r--spec/ruby/language/fixtures/argv_encoding.rb1
-rw-r--r--spec/ruby/language/fixtures/array.rb32
-rw-r--r--spec/ruby/language/fixtures/begin_file.rb3
-rw-r--r--spec/ruby/language/fixtures/binary_symbol.rb4
-rw-r--r--spec/ruby/language/fixtures/block.rb61
-rw-r--r--spec/ruby/language/fixtures/break.rb291
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel.rb9
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel_block.rb23
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel_method.rb17
-rw-r--r--spec/ruby/language/fixtures/bytes_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/case_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/classes.rb31
-rw-r--r--spec/ruby/language/fixtures/coding_us_ascii.rb11
-rw-r--r--spec/ruby/language/fixtures/coding_utf_8.rb11
-rw-r--r--spec/ruby/language/fixtures/constant_visibility.rb114
-rw-r--r--spec/ruby/language/fixtures/constants_sclass.rb54
-rw-r--r--spec/ruby/language/fixtures/def.rb14
-rw-r--r--spec/ruby/language/fixtures/defined.rb306
-rw-r--r--spec/ruby/language/fixtures/delegation.rb11
-rw-r--r--spec/ruby/language/fixtures/dollar_zero.rb6
-rw-r--r--spec/ruby/language/fixtures/emacs_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/ensure.rb121
-rw-r--r--spec/ruby/language/fixtures/file.rb1
-rw-r--r--spec/ruby/language/fixtures/for_scope.rb15
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files_diff_enc.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files_no_comment.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_one_literal.rb4
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required.rb3
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required_diff_enc.rbbin0 -> 181 bytes-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required_no_comment.rb1
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_two_literals.rb3
-rw-r--r--spec/ruby/language/fixtures/hash_strings_binary.rb7
-rw-r--r--spec/ruby/language/fixtures/hash_strings_usascii.rb7
-rw-r--r--spec/ruby/language/fixtures/hash_strings_utf8.rb7
-rw-r--r--spec/ruby/language/fixtures/magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/match_operators.rb9
-rw-r--r--spec/ruby/language/fixtures/metaclass.rb33
-rw-r--r--spec/ruby/language/fixtures/module.rb24
-rw-r--r--spec/ruby/language/fixtures/next.rb134
-rw-r--r--spec/ruby/language/fixtures/no_magic_comment.rb1
-rw-r--r--spec/ruby/language/fixtures/precedence.rb16
-rw-r--r--spec/ruby/language/fixtures/print_magic_comment_result_at_exit.rb3
-rw-r--r--spec/ruby/language/fixtures/private.rb59
-rw-r--r--spec/ruby/language/fixtures/rescue.rb67
-rw-r--r--spec/ruby/language/fixtures/rescue_captures.rb107
-rw-r--r--spec/ruby/language/fixtures/return.rb135
-rw-r--r--spec/ruby/language/fixtures/second_line_magic_comment.rb3
-rw-r--r--spec/ruby/language/fixtures/second_token_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/send.rb141
-rwxr-xr-xspec/ruby/language/fixtures/shebang_magic_comment.rb3
-rw-r--r--spec/ruby/language/fixtures/squiggly_heredoc.rb71
-rw-r--r--spec/ruby/language/fixtures/super.rb742
-rw-r--r--spec/ruby/language/fixtures/utf16-be-nobom.rbbin0 -> 68 bytes-rw-r--r--spec/ruby/language/fixtures/utf16-le-nobom.rbbin0 -> 69 bytes-rw-r--r--spec/ruby/language/fixtures/utf8-bom.rb2
-rw-r--r--spec/ruby/language/fixtures/utf8-nobom.rb2
-rw-r--r--spec/ruby/language/fixtures/variables.rb85
-rw-r--r--spec/ruby/language/fixtures/vim_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/yield.rb41
-rw-r--r--spec/ruby/language/for_spec.rb182
-rw-r--r--spec/ruby/language/hash_spec.rb258
-rw-r--r--spec/ruby/language/heredoc_spec.rb109
-rw-r--r--spec/ruby/language/if_spec.rb371
-rw-r--r--spec/ruby/language/keyword_arguments_spec.rb397
-rw-r--r--spec/ruby/language/lambda_spec.rb620
-rw-r--r--spec/ruby/language/line_spec.rb45
-rw-r--r--spec/ruby/language/loop_spec.rb67
-rw-r--r--spec/ruby/language/magic_comment_spec.rb92
-rw-r--r--spec/ruby/language/match_spec.rb81
-rw-r--r--spec/ruby/language/metaclass_spec.rb143
-rw-r--r--spec/ruby/language/method_spec.rb1856
-rw-r--r--spec/ruby/language/module_spec.rb110
-rw-r--r--spec/ruby/language/next_spec.rb410
-rw-r--r--spec/ruby/language/not_spec.rb51
-rw-r--r--spec/ruby/language/numbered_parameters_spec.rb118
-rw-r--r--spec/ruby/language/numbers_spec.rb105
-rw-r--r--spec/ruby/language/optional_assignments_spec.rb496
-rw-r--r--spec/ruby/language/or_spec.rb90
-rw-r--r--spec/ruby/language/order_spec.rb75
-rw-r--r--spec/ruby/language/pattern_matching_spec.rb1403
-rw-r--r--spec/ruby/language/precedence_spec.rb445
-rw-r--r--spec/ruby/language/predefined/data_spec.rb48
-rw-r--r--spec/ruby/language/predefined/fixtures/data1.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/data2.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/data3.rb6
-rw-r--r--spec/ruby/language/predefined/fixtures/data4.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/data5.rb5
-rw-r--r--spec/ruby/language/predefined/fixtures/data_offset.rb12
-rw-r--r--spec/ruby/language/predefined/fixtures/data_only.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/empty_data.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/print_data.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_dynamic.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_dynamic_required.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_id.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_id_required.rb1
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_required_before.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_values.rb9
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_variables.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_variables_required.rb2
-rw-r--r--spec/ruby/language/predefined/toplevel_binding_spec.rb34
-rw-r--r--spec/ruby/language/predefined_spec.rb1394
-rw-r--r--spec/ruby/language/private_spec.rb67
-rw-r--r--spec/ruby/language/proc_spec.rb247
-rw-r--r--spec/ruby/language/range_spec.rb30
-rw-r--r--spec/ruby/language/redo_spec.rb66
-rw-r--r--spec/ruby/language/regexp/anchors_spec.rb179
-rw-r--r--spec/ruby/language/regexp/back-references_spec.rb140
-rw-r--r--spec/ruby/language/regexp/character_classes_spec.rb642
-rw-r--r--spec/ruby/language/regexp/empty_checks_spec.rb135
-rw-r--r--spec/ruby/language/regexp/encoding_spec.rb148
-rw-r--r--spec/ruby/language/regexp/escapes_spec.rb169
-rw-r--r--spec/ruby/language/regexp/grouping_spec.rb63
-rw-r--r--spec/ruby/language/regexp/interpolation_spec.rb58
-rw-r--r--spec/ruby/language/regexp/modifiers_spec.rb115
-rw-r--r--spec/ruby/language/regexp/repetition_spec.rb142
-rw-r--r--spec/ruby/language/regexp/subexpression_call_spec.rb50
-rw-r--r--spec/ruby/language/regexp_spec.rb169
-rw-r--r--spec/ruby/language/rescue_spec.rb515
-rw-r--r--spec/ruby/language/retry_spec.rb52
-rw-r--r--spec/ruby/language/return_spec.rb490
-rw-r--r--spec/ruby/language/safe_navigator_spec.rb99
-rw-r--r--spec/ruby/language/safe_spec.rb27
-rw-r--r--spec/ruby/language/send_spec.rb570
-rw-r--r--spec/ruby/language/shared/__FILE__.rb23
-rw-r--r--spec/ruby/language/shared/__LINE__.rb15
-rw-r--r--spec/ruby/language/singleton_class_spec.rb293
-rw-r--r--spec/ruby/language/source_encoding_spec.rb61
-rw-r--r--spec/ruby/language/string_spec.rb299
-rw-r--r--spec/ruby/language/super_spec.rb434
-rw-r--r--spec/ruby/language/symbol_spec.rb106
-rw-r--r--spec/ruby/language/throw_spec.rb81
-rw-r--r--spec/ruby/language/undef_spec.rb72
-rw-r--r--spec/ruby/language/unless_spec.rb43
-rw-r--r--spec/ruby/language/until_spec.rb234
-rw-r--r--spec/ruby/language/variables_spec.rb870
-rw-r--r--spec/ruby/language/while_spec.rb344
-rw-r--r--spec/ruby/language/yield_spec.rb225
-rw-r--r--spec/ruby/library/English/English_spec.rb171
-rw-r--r--spec/ruby/library/English/alias_spec.rb14
-rw-r--r--spec/ruby/library/abbrev/abbrev_spec.rb31
-rw-r--r--spec/ruby/library/base64/decode64_spec.rb29
-rw-r--r--spec/ruby/library/base64/encode64_spec.rb23
-rw-r--r--spec/ruby/library/base64/strict_decode64_spec.rb41
-rw-r--r--spec/ruby/library/base64/strict_encode64_spec.rb19
-rw-r--r--spec/ruby/library/base64/urlsafe_decode64_spec.rb19
-rw-r--r--spec/ruby/library/base64/urlsafe_encode64_spec.rb20
-rw-r--r--spec/ruby/library/bigdecimal/BigDecimal_spec.rb269
-rw-r--r--spec/ruby/library/bigdecimal/abs_spec.rb50
-rw-r--r--spec/ruby/library/bigdecimal/add_spec.rb193
-rw-r--r--spec/ruby/library/bigdecimal/case_compare_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/ceil_spec.rb104
-rw-r--r--spec/ruby/library/bigdecimal/clone_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/coerce_spec.rb26
-rw-r--r--spec/ruby/library/bigdecimal/comparison_spec.rb81
-rw-r--r--spec/ruby/library/bigdecimal/constants_spec.rb70
-rw-r--r--spec/ruby/library/bigdecimal/div_spec.rb110
-rw-r--r--spec/ruby/library/bigdecimal/divide_spec.rb17
-rw-r--r--spec/ruby/library/bigdecimal/divmod_spec.rb180
-rw-r--r--spec/ruby/library/bigdecimal/double_fig_spec.rb9
-rw-r--r--spec/ruby/library/bigdecimal/dup_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/eql_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/equal_value_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/exponent_spec.rb27
-rw-r--r--spec/ruby/library/bigdecimal/finite_spec.rb34
-rw-r--r--spec/ruby/library/bigdecimal/fix_spec.rb57
-rw-r--r--spec/ruby/library/bigdecimal/fixtures/classes.rb17
-rw-r--r--spec/ruby/library/bigdecimal/floor_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/frac_spec.rb48
-rw-r--r--spec/ruby/library/bigdecimal/gt_spec.rb96
-rw-r--r--spec/ruby/library/bigdecimal/gte_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/hash_spec.rb30
-rw-r--r--spec/ruby/library/bigdecimal/infinite_spec.rb32
-rw-r--r--spec/ruby/library/bigdecimal/inspect_spec.rb30
-rw-r--r--spec/ruby/library/bigdecimal/limit_spec.rb55
-rw-r--r--spec/ruby/library/bigdecimal/lt_spec.rb94
-rw-r--r--spec/ruby/library/bigdecimal/lte_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/minus_spec.rb66
-rw-r--r--spec/ruby/library/bigdecimal/mode_spec.rb36
-rw-r--r--spec/ruby/library/bigdecimal/modulo_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/mult_spec.rb32
-rw-r--r--spec/ruby/library/bigdecimal/multiply_spec.rb41
-rw-r--r--spec/ruby/library/bigdecimal/nan_spec.rb23
-rw-r--r--spec/ruby/library/bigdecimal/nonzero_spec.rb29
-rw-r--r--spec/ruby/library/bigdecimal/plus_spec.rb54
-rw-r--r--spec/ruby/library/bigdecimal/power_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/precs_spec.rb55
-rw-r--r--spec/ruby/library/bigdecimal/quo_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/remainder_spec.rb92
-rw-r--r--spec/ruby/library/bigdecimal/round_spec.rb242
-rw-r--r--spec/ruby/library/bigdecimal/shared/clone.rb13
-rw-r--r--spec/ruby/library/bigdecimal/shared/eql.rb61
-rw-r--r--spec/ruby/library/bigdecimal/shared/modulo.rb125
-rw-r--r--spec/ruby/library/bigdecimal/shared/mult.rb97
-rw-r--r--spec/ruby/library/bigdecimal/shared/power.rb72
-rw-r--r--spec/ruby/library/bigdecimal/shared/quo.rb67
-rw-r--r--spec/ruby/library/bigdecimal/shared/to_int.rb16
-rw-r--r--spec/ruby/library/bigdecimal/sign_spec.rb46
-rw-r--r--spec/ruby/library/bigdecimal/split_spec.rb86
-rw-r--r--spec/ruby/library/bigdecimal/sqrt_spec.rb112
-rw-r--r--spec/ruby/library/bigdecimal/sub_spec.rb70
-rw-r--r--spec/ruby/library/bigdecimal/to_d_spec.rb10
-rw-r--r--spec/ruby/library/bigdecimal/to_f_spec.rb54
-rw-r--r--spec/ruby/library/bigdecimal/to_i_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/to_int_spec.rb8
-rw-r--r--spec/ruby/library/bigdecimal/to_r_spec.rb28
-rw-r--r--spec/ruby/library/bigdecimal/to_s_spec.rb97
-rw-r--r--spec/ruby/library/bigdecimal/truncate_spec.rb81
-rw-r--r--spec/ruby/library/bigdecimal/uminus_spec.rb58
-rw-r--r--spec/ruby/library/bigdecimal/uplus_spec.rb17
-rw-r--r--spec/ruby/library/bigdecimal/util_spec.rb40
-rw-r--r--spec/ruby/library/bigdecimal/zero_spec.rb27
-rw-r--r--spec/ruby/library/bigmath/log_spec.rb10
-rw-r--r--spec/ruby/library/cgi/cookie/domain_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/expires_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/initialize_spec.rb147
-rw-r--r--spec/ruby/library/cgi/cookie/name_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/parse_spec.rb26
-rw-r--r--spec/ruby/library/cgi/cookie/path_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/secure_spec.rb70
-rw-r--r--spec/ruby/library/cgi/cookie/to_s_spec.rb33
-rw-r--r--spec/ruby/library/cgi/cookie/value_spec.rb76
-rw-r--r--spec/ruby/library/cgi/escapeElement_spec.rb20
-rw-r--r--spec/ruby/library/cgi/escapeHTML_spec.rb17
-rw-r--r--spec/ruby/library/cgi/escape_spec.rb18
-rw-r--r--spec/ruby/library/cgi/htmlextension/a_spec.rb49
-rw-r--r--spec/ruby/library/cgi/htmlextension/base_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/blockquote_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/br_spec.rb22
-rw-r--r--spec/ruby/library/cgi/htmlextension/caption_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/checkbox_group_spec.rb76
-rw-r--r--spec/ruby/library/cgi/htmlextension/checkbox_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/doctype_spec.rb27
-rw-r--r--spec/ruby/library/cgi/htmlextension/file_field_spec.rb72
-rw-r--r--spec/ruby/library/cgi/htmlextension/fixtures/common.rb15
-rw-r--r--spec/ruby/library/cgi/htmlextension/form_spec.rb58
-rw-r--r--spec/ruby/library/cgi/htmlextension/frame_spec.rb14
-rw-r--r--spec/ruby/library/cgi/htmlextension/frameset_spec.rb14
-rw-r--r--spec/ruby/library/cgi/htmlextension/hidden_spec.rb59
-rw-r--r--spec/ruby/library/cgi/htmlextension/html_spec.rb66
-rw-r--r--spec/ruby/library/cgi/htmlextension/image_button_spec.rb69
-rw-r--r--spec/ruby/library/cgi/htmlextension/img_spec.rb83
-rw-r--r--spec/ruby/library/cgi/htmlextension/multipart_form_spec.rb64
-rw-r--r--spec/ruby/library/cgi/htmlextension/password_field_spec.rb84
-rw-r--r--spec/ruby/library/cgi/htmlextension/popup_menu_spec.rb8
-rw-r--r--spec/ruby/library/cgi/htmlextension/radio_button_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/radio_group_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/reset_spec.rb57
-rw-r--r--spec/ruby/library/cgi/htmlextension/scrolling_list_spec.rb8
-rw-r--r--spec/ruby/library/cgi/htmlextension/shared/popup_menu.rb94
-rw-r--r--spec/ruby/library/cgi/htmlextension/submit_spec.rb57
-rw-r--r--spec/ruby/library/cgi/htmlextension/text_field_spec.rb84
-rw-r--r--spec/ruby/library/cgi/htmlextension/textarea_spec.rb73
-rw-r--r--spec/ruby/library/cgi/http_header_spec.rb8
-rw-r--r--spec/ruby/library/cgi/initialize_spec.rb133
-rw-r--r--spec/ruby/library/cgi/out_spec.rb51
-rw-r--r--spec/ruby/library/cgi/parse_spec.rb24
-rw-r--r--spec/ruby/library/cgi/pretty_spec.rb24
-rw-r--r--spec/ruby/library/cgi/print_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_charset_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_encoding_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_language_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/auth_type_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/cache_control_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/content_length_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/content_type_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/cookies_spec.rb10
-rw-r--r--spec/ruby/library/cgi/queryextension/element_reference_spec.rb27
-rw-r--r--spec/ruby/library/cgi/queryextension/from_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/gateway_interface_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/has_key_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/host_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/include_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/key_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/keys_spec.rb20
-rw-r--r--spec/ruby/library/cgi/queryextension/multipart_spec.rb40
-rw-r--r--spec/ruby/library/cgi/queryextension/negotiate_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/params_spec.rb37
-rw-r--r--spec/ruby/library/cgi/queryextension/path_info_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/path_translated_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/pragma_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/query_string_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/raw_cookie2_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/raw_cookie_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/referer_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_addr_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_host_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_ident_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_user_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/request_method_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/script_name_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_name_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_port_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/server_protocol_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_software_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/shared/has_key.rb19
-rw-r--r--spec/ruby/library/cgi/queryextension/user_agent_spec.rb22
-rw-r--r--spec/ruby/library/cgi/rfc1123_date_spec.rb10
-rw-r--r--spec/ruby/library/cgi/shared/http_header.rb112
-rw-r--r--spec/ruby/library/cgi/unescapeElement_spec.rb20
-rw-r--r--spec/ruby/library/cgi/unescapeHTML_spec.rb44
-rw-r--r--spec/ruby/library/cgi/unescape_spec.rb15
-rw-r--r--spec/ruby/library/coverage/fixtures/eval_code.rb11
-rw-r--r--spec/ruby/library/coverage/fixtures/second_class.rb5
-rw-r--r--spec/ruby/library/coverage/fixtures/some_class.rb16
-rw-r--r--spec/ruby/library/coverage/fixtures/start_coverage.rb3
-rw-r--r--spec/ruby/library/coverage/peek_result_spec.rb64
-rw-r--r--spec/ruby/library/coverage/result_spec.rb141
-rw-r--r--spec/ruby/library/coverage/running_spec.rb20
-rw-r--r--spec/ruby/library/coverage/start_spec.rb12
-rw-r--r--spec/ruby/library/csv/basicwriter/close_on_terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/basicwriter/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/basicwriter/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/cell/data_spec.rb6
-rw-r--r--spec/ruby/library/csv/cell/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/fixtures/one_line.csv1
-rw-r--r--spec/ruby/library/csv/foreach_spec.rb6
-rw-r--r--spec/ruby/library/csv/generate_line_spec.rb30
-rw-r--r--spec/ruby/library/csv/generate_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/generate_spec.rb32
-rw-r--r--spec/ruby/library/csv/iobuf/close_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/close_on_terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/get_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/liberal_parsing_spec.rb19
-rw-r--r--spec/ruby/library/csv/open_spec.rb6
-rw-r--r--spec/ruby/library/csv/parse_spec.rb93
-rw-r--r--spec/ruby/library/csv/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/readlines_spec.rb35
-rw-r--r--spec/ruby/library/csv/streambuf/add_buf_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/buf_size_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/drop_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/element_reference_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/get_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/idx_is_eos_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/is_eos_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/rel_buf_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/stringreader/get_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/stringreader/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/add_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/append_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/close_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/create_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/generate_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/terminate_spec.rb6
-rw-r--r--spec/ruby/library/date/accessor_spec.rb91
-rw-r--r--spec/ruby/library/date/add_month_spec.rb38
-rw-r--r--spec/ruby/library/date/add_spec.rb30
-rw-r--r--spec/ruby/library/date/ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/ajd_to_amjd_spec.rb6
-rw-r--r--spec/ruby/library/date/ajd_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/amjd_spec.rb6
-rw-r--r--spec/ruby/library/date/amjd_to_ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/append_spec.rb6
-rw-r--r--spec/ruby/library/date/asctime_spec.rb6
-rw-r--r--spec/ruby/library/date/boat_spec.rb24
-rw-r--r--spec/ruby/library/date/case_compare_spec.rb6
-rw-r--r--spec/ruby/library/date/civil_spec.rb7
-rw-r--r--spec/ruby/library/date/commercial_spec.rb17
-rw-r--r--spec/ruby/library/date/commercial_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/comparison_spec.rb6
-rw-r--r--spec/ruby/library/date/constants_spec.rb48
-rw-r--r--spec/ruby/library/date/conversions_spec.rb43
-rw-r--r--spec/ruby/library/date/ctime_spec.rb6
-rw-r--r--spec/ruby/library/date/cwday_spec.rb6
-rw-r--r--spec/ruby/library/date/cweek_spec.rb6
-rw-r--r--spec/ruby/library/date/cwyear_spec.rb6
-rw-r--r--spec/ruby/library/date/day_fraction_spec.rb6
-rw-r--r--spec/ruby/library/date/day_fraction_to_time_spec.rb6
-rw-r--r--spec/ruby/library/date/day_spec.rb9
-rw-r--r--spec/ruby/library/date/downto_spec.rb18
-rw-r--r--spec/ruby/library/date/england_spec.rb6
-rw-r--r--spec/ruby/library/date/eql_spec.rb12
-rw-r--r--spec/ruby/library/date/format/bag/method_missing_spec.rb6
-rw-r--r--spec/ruby/library/date/format/bag/to_hash_spec.rb6
-rw-r--r--spec/ruby/library/date/friday_spec.rb12
-rw-r--r--spec/ruby/library/date/gregorian_leap_spec.rb15
-rw-r--r--spec/ruby/library/date/gregorian_spec.rb16
-rw-r--r--spec/ruby/library/date/hash_spec.rb8
-rw-r--r--spec/ruby/library/date/infinity/abs_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/coerce_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/comparison_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/d_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/finite_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/infinite_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/nan_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/uminus_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/uplus_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/zero_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity_spec.rb67
-rw-r--r--spec/ruby/library/date/inspect_spec.rb6
-rw-r--r--spec/ruby/library/date/iso8601_spec.rb35
-rw-r--r--spec/ruby/library/date/italy_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_spec.rb15
-rw-r--r--spec/ruby/library/date/jd_to_ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_civil_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_commercial_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_ld_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_mjd_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_ordinal_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_wday_spec.rb6
-rw-r--r--spec/ruby/library/date/julian_leap_spec.rb15
-rw-r--r--spec/ruby/library/date/julian_spec.rb16
-rw-r--r--spec/ruby/library/date/ld_spec.rb6
-rw-r--r--spec/ruby/library/date/ld_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/leap_spec.rb10
-rw-r--r--spec/ruby/library/date/mday_spec.rb6
-rw-r--r--spec/ruby/library/date/minus_month_spec.rb23
-rw-r--r--spec/ruby/library/date/minus_spec.rb30
-rw-r--r--spec/ruby/library/date/mjd_spec.rb6
-rw-r--r--spec/ruby/library/date/mjd_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/mon_spec.rb6
-rw-r--r--spec/ruby/library/date/monday_spec.rb8
-rw-r--r--spec/ruby/library/date/month_spec.rb9
-rw-r--r--spec/ruby/library/date/new_spec.rb8
-rw-r--r--spec/ruby/library/date/new_start_spec.rb6
-rw-r--r--spec/ruby/library/date/next_day_spec.rb14
-rw-r--r--spec/ruby/library/date/next_month_spec.rb29
-rw-r--r--spec/ruby/library/date/next_spec.rb6
-rw-r--r--spec/ruby/library/date/next_year_spec.rb12
-rw-r--r--spec/ruby/library/date/ordinal_spec.rb7
-rw-r--r--spec/ruby/library/date/ordinal_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/parse_spec.rb159
-rw-r--r--spec/ruby/library/date/plus_spec.rb20
-rw-r--r--spec/ruby/library/date/prev_day_spec.rb14
-rw-r--r--spec/ruby/library/date/prev_month_spec.rb29
-rw-r--r--spec/ruby/library/date/prev_year_spec.rb12
-rw-r--r--spec/ruby/library/date/relationship_spec.rb20
-rw-r--r--spec/ruby/library/date/rfc3339_spec.rb13
-rw-r--r--spec/ruby/library/date/right_shift_spec.rb6
-rw-r--r--spec/ruby/library/date/saturday_spec.rb8
-rw-r--r--spec/ruby/library/date/shared/civil.rb57
-rw-r--r--spec/ruby/library/date/shared/commercial.rb39
-rw-r--r--spec/ruby/library/date/shared/jd.rb14
-rw-r--r--spec/ruby/library/date/shared/new_bang.rb14
-rw-r--r--spec/ruby/library/date/shared/ordinal.rb22
-rw-r--r--spec/ruby/library/date/shared/parse.rb54
-rw-r--r--spec/ruby/library/date/shared/parse_eu.rb37
-rw-r--r--spec/ruby/library/date/shared/parse_us.rb36
-rw-r--r--spec/ruby/library/date/shared/valid_civil.rb36
-rw-r--r--spec/ruby/library/date/shared/valid_commercial.rb34
-rw-r--r--spec/ruby/library/date/shared/valid_jd.rb20
-rw-r--r--spec/ruby/library/date/shared/valid_ordinal.rb26
-rw-r--r--spec/ruby/library/date/start_spec.rb6
-rw-r--r--spec/ruby/library/date/step_spec.rb56
-rw-r--r--spec/ruby/library/date/strftime_spec.rb49
-rw-r--r--spec/ruby/library/date/strptime_spec.rb149
-rw-r--r--spec/ruby/library/date/succ_spec.rb6
-rw-r--r--spec/ruby/library/date/sunday_spec.rb8
-rw-r--r--spec/ruby/library/date/thursday_spec.rb8
-rw-r--r--spec/ruby/library/date/time_to_day_fraction_spec.rb6
-rw-r--r--spec/ruby/library/date/to_s_spec.rb6
-rw-r--r--spec/ruby/library/date/today_spec.rb14
-rw-r--r--spec/ruby/library/date/tuesday_spec.rb8
-rw-r--r--spec/ruby/library/date/upto_spec.rb16
-rw-r--r--spec/ruby/library/date/valid_civil_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_commercial_spec.rb8
-rw-r--r--spec/ruby/library/date/valid_date_spec.rb7
-rw-r--r--spec/ruby/library/date/valid_jd_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_ordinal_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_time_spec.rb6
-rw-r--r--spec/ruby/library/date/wday_spec.rb9
-rw-r--r--spec/ruby/library/date/wednesday_spec.rb8
-rw-r--r--spec/ruby/library/date/yday_spec.rb6
-rw-r--r--spec/ruby/library/date/year_spec.rb9
-rw-r--r--spec/ruby/library/date/zone_to_diff_spec.rb6
-rw-r--r--spec/ruby/library/datetime/_strptime_spec.rb6
-rw-r--r--spec/ruby/library/datetime/add_spec.rb9
-rw-r--r--spec/ruby/library/datetime/civil_spec.rb6
-rw-r--r--spec/ruby/library/datetime/commercial_spec.rb6
-rw-r--r--spec/ruby/library/datetime/hour_spec.rb47
-rw-r--r--spec/ruby/library/datetime/httpdate_spec.rb6
-rw-r--r--spec/ruby/library/datetime/iso8601_spec.rb10
-rw-r--r--spec/ruby/library/datetime/jd_spec.rb6
-rw-r--r--spec/ruby/library/datetime/jisx0301_spec.rb10
-rw-r--r--spec/ruby/library/datetime/min_spec.rb6
-rw-r--r--spec/ruby/library/datetime/minute_spec.rb6
-rw-r--r--spec/ruby/library/datetime/new_offset_spec.rb6
-rw-r--r--spec/ruby/library/datetime/new_spec.rb52
-rw-r--r--spec/ruby/library/datetime/now_spec.rb25
-rw-r--r--spec/ruby/library/datetime/offset_spec.rb6
-rw-r--r--spec/ruby/library/datetime/ordinal_spec.rb6
-rw-r--r--spec/ruby/library/datetime/parse_spec.rb127
-rw-r--r--spec/ruby/library/datetime/rfc2822_spec.rb6
-rw-r--r--spec/ruby/library/datetime/rfc3339_spec.rb10
-rw-r--r--spec/ruby/library/datetime/rfc822_spec.rb6
-rw-r--r--spec/ruby/library/datetime/sec_fraction_spec.rb6
-rw-r--r--spec/ruby/library/datetime/sec_spec.rb6
-rw-r--r--spec/ruby/library/datetime/second_fraction_spec.rb6
-rw-r--r--spec/ruby/library/datetime/second_spec.rb6
-rw-r--r--spec/ruby/library/datetime/shared/min.rb40
-rw-r--r--spec/ruby/library/datetime/shared/sec.rb45
-rw-r--r--spec/ruby/library/datetime/strftime_spec.rb61
-rw-r--r--spec/ruby/library/datetime/strptime_spec.rb6
-rw-r--r--spec/ruby/library/datetime/subtract_spec.rb19
-rw-r--r--spec/ruby/library/datetime/to_date_spec.rb37
-rw-r--r--spec/ruby/library/datetime/to_datetime_spec.rb9
-rw-r--r--spec/ruby/library/datetime/to_s_spec.rb17
-rw-r--r--spec/ruby/library/datetime/to_time_spec.rb50
-rw-r--r--spec/ruby/library/datetime/xmlschema_spec.rb10
-rw-r--r--spec/ruby/library/datetime/zone_spec.rb6
-rw-r--r--spec/ruby/library/delegate/delegate_class/instance_method_spec.rb52
-rw-r--r--spec/ruby/library/delegate/delegate_class/instance_methods_spec.rb26
-rw-r--r--spec/ruby/library/delegate/delegate_class/private_instance_methods_spec.rb23
-rw-r--r--spec/ruby/library/delegate/delegate_class/protected_instance_methods_spec.rb29
-rw-r--r--spec/ruby/library/delegate/delegate_class/public_instance_methods_spec.rb25
-rw-r--r--spec/ruby/library/delegate/delegate_class/respond_to_missing_spec.rb23
-rw-r--r--spec/ruby/library/delegate/delegator/case_compare_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/compare_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/complement_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/eql_spec.rb35
-rw-r--r--spec/ruby/library/delegate/delegator/equal_spec.rb13
-rw-r--r--spec/ruby/library/delegate/delegator/equal_value_spec.rb24
-rw-r--r--spec/ruby/library/delegate/delegator/frozen_spec.rb39
-rw-r--r--spec/ruby/library/delegate/delegator/hash_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/marshal_spec.rb21
-rw-r--r--spec/ruby/library/delegate/delegator/method_spec.rb69
-rw-r--r--spec/ruby/library/delegate/delegator/methods_spec.rb37
-rw-r--r--spec/ruby/library/delegate/delegator/not_equal_spec.rb24
-rw-r--r--spec/ruby/library/delegate/delegator/not_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/private_methods_spec.rb20
-rw-r--r--spec/ruby/library/delegate/delegator/protected_methods_spec.rb18
-rw-r--r--spec/ruby/library/delegate/delegator/public_methods_spec.rb18
-rw-r--r--spec/ruby/library/delegate/delegator/send_spec.rb26
-rw-r--r--spec/ruby/library/delegate/delegator/taint_spec.rb8
-rw-r--r--spec/ruby/library/delegate/delegator/tap_spec.rb16
-rw-r--r--spec/ruby/library/delegate/delegator/trust_spec.rb8
-rw-r--r--spec/ruby/library/delegate/delegator/untaint_spec.rb8
-rw-r--r--spec/ruby/library/delegate/delegator/untrust_spec.rb8
-rw-r--r--spec/ruby/library/delegate/fixtures/classes.rb60
-rw-r--r--spec/ruby/library/digest/bubblebabble_spec.rb29
-rw-r--r--spec/ruby/library/digest/hexencode_spec.rb31
-rw-r--r--spec/ruby/library/digest/instance/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/instance/new_spec.rb19
-rw-r--r--spec/ruby/library/digest/instance/shared/update.rb8
-rw-r--r--spec/ruby/library/digest/instance/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/md5/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/md5/equal_spec.rb37
-rw-r--r--spec/ruby/library/digest/md5/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/md5/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/md5/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/md5/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/md5/shared/constants.rb17
-rw-r--r--spec/ruby/library/digest/md5/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/md5/shared/sample.rb17
-rw-r--r--spec/ruby/library/digest/md5/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/md5/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/to_s_spec.rb24
-rw-r--r--spec/ruby/library/digest/md5/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha1/digest_spec.rb20
-rw-r--r--spec/ruby/library/digest/sha1/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha1/shared/constants.rb18
-rw-r--r--spec/ruby/library/digest/sha2/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha256/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha256/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha256/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha256/file_spec.rb47
-rw-r--r--spec/ruby/library/digest/sha256/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha256/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha256/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha256/shared/constants.rb18
-rw-r--r--spec/ruby/library/digest/sha256/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha256/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha256/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha256/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha384/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha384/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha384/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha384/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha384/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha384/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha384/shared/constants.rb19
-rw-r--r--spec/ruby/library/digest/sha384/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha384/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha384/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha384/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha512/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha512/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha512/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha512/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha512/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha512/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha512/shared/constants.rb18
-rw-r--r--spec/ruby/library/digest/sha512/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha512/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha512/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha512/update_spec.rb7
-rw-r--r--spec/ruby/library/drb/fixtures/test_server.rb8
-rw-r--r--spec/ruby/library/drb/start_service_spec.rb28
-rw-r--r--spec/ruby/library/erb/def_class_spec.rb29
-rw-r--r--spec/ruby/library/erb/def_method_spec.rb26
-rw-r--r--spec/ruby/library/erb/def_module_spec.rb27
-rw-r--r--spec/ruby/library/erb/defmethod/def_erb_method_spec.rb64
-rw-r--r--spec/ruby/library/erb/filename_spec.rb40
-rw-r--r--spec/ruby/library/erb/fixtures/classes.rb5
-rw-r--r--spec/ruby/library/erb/new_spec.rb157
-rw-r--r--spec/ruby/library/erb/result_spec.rb86
-rw-r--r--spec/ruby/library/erb/run_spec.rb96
-rw-r--r--spec/ruby/library/erb/src_spec.rb33
-rw-r--r--spec/ruby/library/erb/util/h_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/html_escape_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/shared/html_escape.rb42
-rw-r--r--spec/ruby/library/erb/util/shared/url_encode.rb42
-rw-r--r--spec/ruby/library/erb/util/u_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/url_encode_spec.rb7
-rw-r--r--spec/ruby/library/etc/confstr_spec.rb14
-rw-r--r--spec/ruby/library/etc/endgrent_spec.rb7
-rw-r--r--spec/ruby/library/etc/endpwent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getgrent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getgrgid_spec.rb69
-rw-r--r--spec/ruby/library/etc/getgrnam_spec.rb30
-rw-r--r--spec/ruby/library/etc/getlogin_spec.rb43
-rw-r--r--spec/ruby/library/etc/getpwent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getpwnam_spec.rb28
-rw-r--r--spec/ruby/library/etc/getpwuid_spec.rb36
-rw-r--r--spec/ruby/library/etc/group_spec.rb27
-rw-r--r--spec/ruby/library/etc/nprocessors_spec.rb9
-rw-r--r--spec/ruby/library/etc/passwd_spec.rb15
-rw-r--r--spec/ruby/library/etc/shared/windows.rb7
-rw-r--r--spec/ruby/library/etc/struct_group_spec.rb35
-rw-r--r--spec/ruby/library/etc/struct_passwd_spec.rb43
-rw-r--r--spec/ruby/library/etc/sysconf_spec.rb22
-rw-r--r--spec/ruby/library/etc/sysconfdir_spec.rb8
-rw-r--r--spec/ruby/library/etc/systmpdir_spec.rb8
-rw-r--r--spec/ruby/library/expect/expect_spec.rb62
-rw-r--r--spec/ruby/library/fiber/alive_spec.rb46
-rw-r--r--spec/ruby/library/fiber/current_spec.rb63
-rw-r--r--spec/ruby/library/fiber/resume_spec.rb35
-rw-r--r--spec/ruby/library/fiber/transfer_spec.rb128
-rw-r--r--spec/ruby/library/fiddle/handle/initialize_spec.rb10
-rw-r--r--spec/ruby/library/find/find_spec.rb30
-rw-r--r--spec/ruby/library/find/fixtures/common.rb174
-rw-r--r--spec/ruby/library/find/prune_spec.rb12
-rw-r--r--spec/ruby/library/getoptlong/each_option_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/each_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/error_message_spec.rb23
-rw-r--r--spec/ruby/library/getoptlong/get_option_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/get_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/initialize_spec.rb28
-rw-r--r--spec/ruby/library/getoptlong/ordering_spec.rb38
-rw-r--r--spec/ruby/library/getoptlong/set_options_spec.rb98
-rw-r--r--spec/ruby/library/getoptlong/shared/each.rb18
-rw-r--r--spec/ruby/library/getoptlong/shared/get.rb62
-rw-r--r--spec/ruby/library/getoptlong/terminate_spec.rb30
-rw-r--r--spec/ruby/library/getoptlong/terminated_spec.rb17
-rw-r--r--spec/ruby/library/io-wait/wait_readable_spec.rb27
-rw-r--r--spec/ruby/library/io-wait/wait_writable_spec.rb20
-rw-r--r--spec/ruby/library/ipaddr/hton_spec.rb30
-rw-r--r--spec/ruby/library/ipaddr/ipv4_conversion_spec.rb44
-rw-r--r--spec/ruby/library/ipaddr/new_spec.rb110
-rw-r--r--spec/ruby/library/ipaddr/operator_spec.rb82
-rw-r--r--spec/ruby/library/ipaddr/reverse_spec.rb27
-rw-r--r--spec/ruby/library/ipaddr/to_s_spec.rb20
-rw-r--r--spec/ruby/library/logger/device/close_spec.rb31
-rw-r--r--spec/ruby/library/logger/device/new_spec.rb47
-rw-r--r--spec/ruby/library/logger/device/write_spec.rb51
-rw-r--r--spec/ruby/library/logger/fixtures/common.rb9
-rw-r--r--spec/ruby/library/logger/logger/add_spec.rb81
-rw-r--r--spec/ruby/library/logger/logger/close_spec.rb20
-rw-r--r--spec/ruby/library/logger/logger/datetime_format_spec.rb60
-rw-r--r--spec/ruby/library/logger/logger/debug_spec.rb52
-rw-r--r--spec/ruby/library/logger/logger/error_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/fatal_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/info_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/new_spec.rb118
-rw-r--r--spec/ruby/library/logger/logger/unknown_spec.rb36
-rw-r--r--spec/ruby/library/logger/logger/warn_spec.rb53
-rw-r--r--spec/ruby/library/logger/severity_spec.rb13
-rw-r--r--spec/ruby/library/matrix/I_spec.rb9
-rw-r--r--spec/ruby/library/matrix/antisymmetric_spec.rb38
-rw-r--r--spec/ruby/library/matrix/build_spec.rb76
-rw-r--r--spec/ruby/library/matrix/clone_spec.rb28
-rw-r--r--spec/ruby/library/matrix/coerce_spec.rb11
-rw-r--r--spec/ruby/library/matrix/collect_spec.rb9
-rw-r--r--spec/ruby/library/matrix/column_size_spec.rb16
-rw-r--r--spec/ruby/library/matrix/column_spec.rb38
-rw-r--r--spec/ruby/library/matrix/column_vector_spec.rb28
-rw-r--r--spec/ruby/library/matrix/column_vectors_spec.rb29
-rw-r--r--spec/ruby/library/matrix/columns_spec.rb45
-rw-r--r--spec/ruby/library/matrix/conj_spec.rb9
-rw-r--r--spec/ruby/library/matrix/conjugate_spec.rb9
-rw-r--r--spec/ruby/library/matrix/constructor_spec.rb68
-rw-r--r--spec/ruby/library/matrix/det_spec.rb10
-rw-r--r--spec/ruby/library/matrix/determinant_spec.rb10
-rw-r--r--spec/ruby/library/matrix/diagonal_spec.rb75
-rw-r--r--spec/ruby/library/matrix/divide_spec.rb57
-rw-r--r--spec/ruby/library/matrix/each_spec.rb77
-rw-r--r--spec/ruby/library/matrix/each_with_index_spec.rb84
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvalue_matrix_spec.rb12
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvalues_spec.rb25
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvector_matrix_spec.rb23
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvectors_spec.rb25
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/initialize_spec.rb27
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/to_a_spec.rb21
-rw-r--r--spec/ruby/library/matrix/element_reference_spec.rb26
-rw-r--r--spec/ruby/library/matrix/empty_spec.rb71
-rw-r--r--spec/ruby/library/matrix/eql_spec.rb14
-rw-r--r--spec/ruby/library/matrix/equal_value_spec.rb14
-rw-r--r--spec/ruby/library/matrix/exponent_spec.rb67
-rw-r--r--spec/ruby/library/matrix/find_index_spec.rb149
-rw-r--r--spec/ruby/library/matrix/fixtures/classes.rb7
-rw-r--r--spec/ruby/library/matrix/hash_spec.rb18
-rw-r--r--spec/ruby/library/matrix/hermitian_spec.rb37
-rw-r--r--spec/ruby/library/matrix/identity_spec.rb9
-rw-r--r--spec/ruby/library/matrix/imag_spec.rb9
-rw-r--r--spec/ruby/library/matrix/imaginary_spec.rb9
-rw-r--r--spec/ruby/library/matrix/inspect_spec.rb30
-rw-r--r--spec/ruby/library/matrix/inv_spec.rb10
-rw-r--r--spec/ruby/library/matrix/inverse_from_spec.rb9
-rw-r--r--spec/ruby/library/matrix/inverse_spec.rb10
-rw-r--r--spec/ruby/library/matrix/lower_triangular_spec.rb27
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/determinant_spec.rb24
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/initialize_spec.rb16
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/l_spec.rb21
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/p_spec.rb21
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/solve_spec.rb56
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/to_a_spec.rb36
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/u_spec.rb21
-rw-r--r--spec/ruby/library/matrix/map_spec.rb9
-rw-r--r--spec/ruby/library/matrix/minor_spec.rb88
-rw-r--r--spec/ruby/library/matrix/minus_spec.rb45
-rw-r--r--spec/ruby/library/matrix/multiply_spec.rb71
-rw-r--r--spec/ruby/library/matrix/new_spec.rb11
-rw-r--r--spec/ruby/library/matrix/normal_spec.rb29
-rw-r--r--spec/ruby/library/matrix/orthogonal_spec.rb29
-rw-r--r--spec/ruby/library/matrix/permutation_spec.rb35
-rw-r--r--spec/ruby/library/matrix/plus_spec.rb45
-rw-r--r--spec/ruby/library/matrix/rank_spec.rb22
-rw-r--r--spec/ruby/library/matrix/real_spec.rb46
-rw-r--r--spec/ruby/library/matrix/rect_spec.rb9
-rw-r--r--spec/ruby/library/matrix/rectangular_spec.rb9
-rw-r--r--spec/ruby/library/matrix/regular_spec.rb34
-rw-r--r--spec/ruby/library/matrix/round_spec.rb24
-rw-r--r--spec/ruby/library/matrix/row_size_spec.rb16
-rw-r--r--spec/ruby/library/matrix/row_spec.rb39
-rw-r--r--spec/ruby/library/matrix/row_vector_spec.rb27
-rw-r--r--spec/ruby/library/matrix/row_vectors_spec.rb29
-rw-r--r--spec/ruby/library/matrix/rows_spec.rb44
-rw-r--r--spec/ruby/library/matrix/scalar/Fail_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/Raise_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/divide_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/exponent_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/included_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/initialize_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/minus_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/multiply_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/plus_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar_spec.rb70
-rw-r--r--spec/ruby/library/matrix/shared/collect.rb26
-rw-r--r--spec/ruby/library/matrix/shared/conjugate.rb20
-rw-r--r--spec/ruby/library/matrix/shared/determinant.rb38
-rw-r--r--spec/ruby/library/matrix/shared/equal_value.rb33
-rw-r--r--spec/ruby/library/matrix/shared/identity.rb19
-rw-r--r--spec/ruby/library/matrix/shared/imaginary.rb20
-rw-r--r--spec/ruby/library/matrix/shared/inverse.rb38
-rw-r--r--spec/ruby/library/matrix/shared/rectangular.rb18
-rw-r--r--spec/ruby/library/matrix/shared/trace.rb12
-rw-r--r--spec/ruby/library/matrix/shared/transpose.rb19
-rw-r--r--spec/ruby/library/matrix/singular_spec.rb34
-rw-r--r--spec/ruby/library/matrix/spec_helper.rb35
-rw-r--r--spec/ruby/library/matrix/square_spec.rb31
-rw-r--r--spec/ruby/library/matrix/symmetric_spec.rb32
-rw-r--r--spec/ruby/library/matrix/t_spec.rb9
-rw-r--r--spec/ruby/library/matrix/to_a_spec.rb14
-rw-r--r--spec/ruby/library/matrix/to_s_spec.rb9
-rw-r--r--spec/ruby/library/matrix/tr_spec.rb10
-rw-r--r--spec/ruby/library/matrix/trace_spec.rb10
-rw-r--r--spec/ruby/library/matrix/transpose_spec.rb9
-rw-r--r--spec/ruby/library/matrix/unit_spec.rb9
-rw-r--r--spec/ruby/library/matrix/unitary_spec.rb36
-rw-r--r--spec/ruby/library/matrix/upper_triangular_spec.rb27
-rw-r--r--spec/ruby/library/matrix/vector/cross_product_spec.rb17
-rw-r--r--spec/ruby/library/matrix/vector/each2_spec.rb52
-rw-r--r--spec/ruby/library/matrix/vector/eql_spec.rb19
-rw-r--r--spec/ruby/library/matrix/vector/inner_product_spec.rb25
-rw-r--r--spec/ruby/library/matrix/vector/normalize_spec.rb21
-rw-r--r--spec/ruby/library/matrix/zero_spec.rb55
-rw-r--r--spec/ruby/library/mkmf/mkmf_spec.rb7
-rw-r--r--spec/ruby/library/monitor/enter_spec.rb28
-rw-r--r--spec/ruby/library/monitor/mon_initialize_spec.rb31
-rw-r--r--spec/ruby/library/monitor/new_cond_spec.rb88
-rw-r--r--spec/ruby/library/monitor/synchronize_spec.rb41
-rw-r--r--spec/ruby/library/monitor/try_enter_spec.rb39
-rw-r--r--spec/ruby/library/net/FTPError_spec.rb11
-rw-r--r--spec/ruby/library/net/FTPPermError_spec.rb15
-rw-r--r--spec/ruby/library/net/FTPProtoError_spec.rb15
-rw-r--r--spec/ruby/library/net/FTPReplyError_spec.rb15
-rw-r--r--spec/ruby/library/net/FTPTempError_spec.rb15
-rw-r--r--spec/ruby/library/net/ftp/abort_spec.rb65
-rw-r--r--spec/ruby/library/net/ftp/acct_spec.rb61
-rw-r--r--spec/ruby/library/net/ftp/binary_spec.rb27
-rw-r--r--spec/ruby/library/net/ftp/chdir_spec.rb102
-rw-r--r--spec/ruby/library/net/ftp/close_spec.rb33
-rw-r--r--spec/ruby/library/net/ftp/closed_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/connect_spec.rb52
-rw-r--r--spec/ruby/library/net/ftp/debug_mode_spec.rb26
-rw-r--r--spec/ruby/library/net/ftp/default_passive_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/delete_spec.rb62
-rw-r--r--spec/ruby/library/net/ftp/dir_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/fixtures/default_passive.rb3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/passive.rb2
-rw-r--r--spec/ruby/library/net/ftp/fixtures/putbinaryfile3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/puttextfile3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/server.rb277
-rw-r--r--spec/ruby/library/net/ftp/get_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/getbinaryfile_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/getdir_spec.rb10
-rw-r--r--spec/ruby/library/net/ftp/gettextfile_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/help_spec.rb69
-rw-r--r--spec/ruby/library/net/ftp/initialize_spec.rb408
-rw-r--r--spec/ruby/library/net/ftp/last_response_code_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/last_response_spec.rb28
-rw-r--r--spec/ruby/library/net/ftp/lastresp_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/list_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/login_spec.rb198
-rw-r--r--spec/ruby/library/net/ftp/ls_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/mdtm_spec.rb41
-rw-r--r--spec/ruby/library/net/ftp/mkdir_spec.rb64
-rw-r--r--spec/ruby/library/net/ftp/mtime_spec.rb53
-rw-r--r--spec/ruby/library/net/ftp/nlst_spec.rb95
-rw-r--r--spec/ruby/library/net/ftp/noop_spec.rb41
-rw-r--r--spec/ruby/library/net/ftp/open_spec.rb58
-rw-r--r--spec/ruby/library/net/ftp/passive_spec.rb31
-rw-r--r--spec/ruby/library/net/ftp/put_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/putbinaryfile_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/puttextfile_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/pwd_spec.rb56
-rw-r--r--spec/ruby/library/net/ftp/quit_spec.rb36
-rw-r--r--spec/ruby/library/net/ftp/rename_spec.rb97
-rw-r--r--spec/ruby/library/net/ftp/resume_spec.rb26
-rw-r--r--spec/ruby/library/net/ftp/retrbinary_spec.rb33
-rw-r--r--spec/ruby/library/net/ftp/retrlines_spec.rb37
-rw-r--r--spec/ruby/library/net/ftp/return_code_spec.rb27
-rw-r--r--spec/ruby/library/net/ftp/rmdir_spec.rb61
-rw-r--r--spec/ruby/library/net/ftp/sendcmd_spec.rb57
-rw-r--r--spec/ruby/library/net/ftp/set_socket_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/shared/getbinaryfile.rb150
-rw-r--r--spec/ruby/library/net/ftp/shared/gettextfile.rb100
-rw-r--r--spec/ruby/library/net/ftp/shared/last_response_code.rb25
-rw-r--r--spec/ruby/library/net/ftp/shared/list.rb104
-rw-r--r--spec/ruby/library/net/ftp/shared/putbinaryfile.rb167
-rw-r--r--spec/ruby/library/net/ftp/shared/puttextfile.rb120
-rw-r--r--spec/ruby/library/net/ftp/shared/pwd.rb3
-rw-r--r--spec/ruby/library/net/ftp/site_spec.rb56
-rw-r--r--spec/ruby/library/net/ftp/size_spec.rb51
-rw-r--r--spec/ruby/library/net/ftp/spec_helper.rb5
-rw-r--r--spec/ruby/library/net/ftp/status_spec.rb70
-rw-r--r--spec/ruby/library/net/ftp/storbinary_spec.rb51
-rw-r--r--spec/ruby/library/net/ftp/storlines_spec.rb46
-rw-r--r--spec/ruby/library/net/ftp/system_spec.rb51
-rw-r--r--spec/ruby/library/net/ftp/voidcmd_spec.rb57
-rw-r--r--spec/ruby/library/net/ftp/welcome_spec.rb28
-rw-r--r--spec/ruby/library/net/http/HTTPBadResponse_spec.rb8
-rw-r--r--spec/ruby/library/net/http/HTTPClientExcepton_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPFatalError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPHeaderSyntaxError_spec.rb8
-rw-r--r--spec/ruby/library/net/http/HTTPRetriableError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPServerException_spec.rb12
-rw-r--r--spec/ruby/library/net/http/http/Proxy_spec.rb35
-rw-r--r--spec/ruby/library/net/http/http/active_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/address_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/close_on_empty_response_spec.rb10
-rw-r--r--spec/ruby/library/net/http/http/copy_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/delete_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/finish_spec.rb29
-rw-r--r--spec/ruby/library/net/http/http/fixtures/http_server.rb123
-rw-r--r--spec/ruby/library/net/http/http/get2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/get_print_spec.rb30
-rw-r--r--spec/ruby/library/net/http/http/get_response_spec.rb30
-rw-r--r--spec/ruby/library/net/http/http/get_spec.rb96
-rw-r--r--spec/ruby/library/net/http/http/head2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/head_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/http_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/https_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/initialize_spec.rb46
-rw-r--r--spec/ruby/library/net/http/http/inspect_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/is_version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/is_version_1_2_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/lock_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/mkcol_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/move_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/new_spec.rb86
-rw-r--r--spec/ruby/library/net/http/http/newobj_spec.rb48
-rw-r--r--spec/ruby/library/net/http/http/open_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/options_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/port_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/post2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/post_form_spec.rb22
-rw-r--r--spec/ruby/library/net/http/http/post_spec.rb74
-rw-r--r--spec/ruby/library/net/http/http/propfind_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/proppatch_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/proxy_address_spec.rb31
-rw-r--r--spec/ruby/library/net/http/http/proxy_class_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/proxy_pass_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/proxy_port_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/proxy_user_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/put2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/put_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/read_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/request_get_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_head_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_post_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_put_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_spec.rb109
-rw-r--r--spec/ruby/library/net/http/http/request_types_spec.rb254
-rw-r--r--spec/ruby/library/net/http/http/send_request_spec.rb61
-rw-r--r--spec/ruby/library/net/http/http/set_debug_output_spec.rb33
-rw-r--r--spec/ruby/library/net/http/http/shared/request_get.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_head.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_post.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_put.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/started.rb26
-rw-r--r--spec/ruby/library/net/http/http/shared/version_1_1.rb6
-rw-r--r--spec/ruby/library/net/http/http/shared/version_1_2.rb6
-rw-r--r--spec/ruby/library/net/http/http/socket_type_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/start_spec.rb111
-rw-r--r--spec/ruby/library/net/http/http/started_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/trace_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/unlock_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/use_ssl_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/version_1_2_spec.rb20
-rw-r--r--spec/ruby/library/net/http/httpexceptions/fixtures/classes.rb5
-rw-r--r--spec/ruby/library/net/http/httpexceptions/initialize_spec.rb17
-rw-r--r--spec/ruby/library/net/http/httpexceptions/response_spec.rb10
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_exist_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_spec.rb30
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_stream_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/exec_spec.rb131
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/inspect_spec.rb25
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/method_spec.rb15
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/path_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/request_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/response_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/set_body_internal_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/add_field_spec.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net/http/httpheader/canonical_each_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/chunked_spec.rb22
-rw-r--r--spec/ruby/library/net/http/httpheader/content_length_spec.rb54
-rw-r--r--spec/ruby/library/net/http/httpheader/content_range_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/content_type_spec.rb26
-rw-r--r--spec/ruby/library/net/http/httpheader/delete_spec.rb30
-rw-r--r--spec/ruby/library/net/http/httpheader/each_capitalized_name_spec.rb35
-rw-r--r--spec/ruby/library/net/http/httpheader/each_capitalized_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_header_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_key_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_name_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_value_spec.rb35
-rw-r--r--spec/ruby/library/net/http/httpheader/element_reference_spec.rb39
-rw-r--r--spec/ruby/library/net/http/httpheader/element_set_spec.rb41
-rw-r--r--spec/ruby/library/net/http/httpheader/fetch_spec.rb68
-rw-r--r--spec/ruby/library/net/http/httpheader/fixtures/classes.rb11
-rw-r--r--spec/ruby/library/net/http/httpheader/form_data_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/get_fields_spec.rb39
-rw-r--r--spec/ruby/library/net/http/httpheader/initialize_http_header_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/key_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/length_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/main_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpheader/proxy_basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net/http/httpheader/range_length_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/range_spec.rb48
-rw-r--r--spec/ruby/library/net/http/httpheader/set_content_type_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/set_form_data_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/set_range_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_capitalized.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_header.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_name.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_content_type.rb18
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_form_data.rb27
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_range.rb89
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/size.rb18
-rw-r--r--spec/ruby/library/net/http/httpheader/size_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/sub_type_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/to_hash_spec.rb25
-rw-r--r--spec/ruby/library/net/http/httpheader/type_params_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httprequest/initialize_spec.rb45
-rw-r--r--spec/ruby/library/net/http/httpresponse/body_permitted_spec.rb13
-rw-r--r--spec/ruby/library/net/http/httpresponse/body_spec.rb7
-rw-r--r--spec/ruby/library/net/http/httpresponse/code_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/code_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/entity_spec.rb7
-rw-r--r--spec/ruby/library/net/http/httpresponse/error_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/error_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/exception_type_spec.rb13
-rw-r--r--spec/ruby/library/net/http/httpresponse/header_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/http_version_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpresponse/initialize_spec.rb11
-rw-r--r--spec/ruby/library/net/http/httpresponse/inspect_spec.rb15
-rw-r--r--spec/ruby/library/net/http/httpresponse/message_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/msg_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_body_spec.rb86
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_header_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_new_spec.rb23
-rw-r--r--spec/ruby/library/net/http/httpresponse/reading_body_spec.rb58
-rw-r--r--spec/ruby/library/net/http/httpresponse/response_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/shared/body.rb20
-rw-r--r--spec/ruby/library/net/http/httpresponse/value_spec.rb24
-rw-r--r--spec/ruby/library/objectspace/fixtures/trace.rb5
-rw-r--r--spec/ruby/library/objectspace/memsize_of_all_spec.rb22
-rw-r--r--spec/ruby/library/objectspace/memsize_of_spec.rb34
-rw-r--r--spec/ruby/library/objectspace/reachable_objects_from_spec.rb61
-rw-r--r--spec/ruby/library/objectspace/trace_object_allocations_spec.rb149
-rw-r--r--spec/ruby/library/objectspace/trace_spec.rb15
-rw-r--r--spec/ruby/library/observer/add_observer_spec.rb23
-rw-r--r--spec/ruby/library/observer/count_observers_spec.rb23
-rw-r--r--spec/ruby/library/observer/delete_observer_spec.rb19
-rw-r--r--spec/ruby/library/observer/delete_observers_spec.rb19
-rw-r--r--spec/ruby/library/observer/fixtures/classes.rb17
-rw-r--r--spec/ruby/library/observer/notify_observers_spec.rb31
-rw-r--r--spec/ruby/library/open3/capture2_spec.rb6
-rw-r--r--spec/ruby/library/open3/capture2e_spec.rb6
-rw-r--r--spec/ruby/library/open3/capture3_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_r_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_rw_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_start_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_w_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen2_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen2e_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen3_spec.rb41
-rw-r--r--spec/ruby/library/openssl/cipher_spec.rb9
-rw-r--r--spec/ruby/library/openssl/config/freeze_spec.rb22
-rw-r--r--spec/ruby/library/openssl/digest_spec.rb63
-rw-r--r--spec/ruby/library/openssl/hmac/digest_spec.rb16
-rw-r--r--spec/ruby/library/openssl/hmac/hexdigest_spec.rb16
-rw-r--r--spec/ruby/library/openssl/random/pseudo_bytes_spec.rb8
-rw-r--r--spec/ruby/library/openssl/random/random_bytes_spec.rb6
-rw-r--r--spec/ruby/library/openssl/random/shared/random_bytes.rb29
-rw-r--r--spec/ruby/library/openssl/shared/constants.rb11
-rw-r--r--spec/ruby/library/openssl/x509/name/parse_spec.rb48
-rw-r--r--spec/ruby/library/openssl/x509/name/verify_spec.rb78
-rw-r--r--spec/ruby/library/openstruct/delete_field_spec.rb19
-rw-r--r--spec/ruby/library/openstruct/element_reference_spec.rb13
-rw-r--r--spec/ruby/library/openstruct/element_set_spec.rb13
-rw-r--r--spec/ruby/library/openstruct/equal_value_spec.rb28
-rw-r--r--spec/ruby/library/openstruct/fixtures/classes.rb4
-rw-r--r--spec/ruby/library/openstruct/frozen_spec.rb40
-rw-r--r--spec/ruby/library/openstruct/initialize_spec.rb8
-rw-r--r--spec/ruby/library/openstruct/inspect_spec.rb8
-rw-r--r--spec/ruby/library/openstruct/marshal_dump_spec.rb9
-rw-r--r--spec/ruby/library/openstruct/marshal_load_spec.rb12
-rw-r--r--spec/ruby/library/openstruct/method_missing_spec.rb24
-rw-r--r--spec/ruby/library/openstruct/new_spec.rb20
-rw-r--r--spec/ruby/library/openstruct/shared/inspect.rb20
-rw-r--r--spec/ruby/library/openstruct/to_h_spec.rb68
-rw-r--r--spec/ruby/library/openstruct/to_s_spec.rb8
-rw-r--r--spec/ruby/library/optionparser/order_spec.rb28
-rw-r--r--spec/ruby/library/optionparser/parse_spec.rb28
-rw-r--r--spec/ruby/library/pathname/absolute_spec.rb22
-rw-r--r--spec/ruby/library/pathname/birthtime_spec.rb16
-rw-r--r--spec/ruby/library/pathname/divide_spec.rb6
-rw-r--r--spec/ruby/library/pathname/empty_spec.rb32
-rw-r--r--spec/ruby/library/pathname/equal_value_spec.rb14
-rw-r--r--spec/ruby/library/pathname/glob_spec.rb84
-rw-r--r--spec/ruby/library/pathname/hash_spec.rb14
-rw-r--r--spec/ruby/library/pathname/inspect_spec.rb10
-rw-r--r--spec/ruby/library/pathname/join_spec.rb40
-rw-r--r--spec/ruby/library/pathname/new_spec.rb23
-rw-r--r--spec/ruby/library/pathname/parent_spec.rb18
-rw-r--r--spec/ruby/library/pathname/pathname_spec.rb19
-rw-r--r--spec/ruby/library/pathname/plus_spec.rb6
-rw-r--r--spec/ruby/library/pathname/realdirpath_spec.rb10
-rw-r--r--spec/ruby/library/pathname/realpath_spec.rb10
-rw-r--r--spec/ruby/library/pathname/relative_path_from_spec.rb51
-rw-r--r--spec/ruby/library/pathname/relative_spec.rb22
-rw-r--r--spec/ruby/library/pathname/root_spec.rb26
-rw-r--r--spec/ruby/library/pathname/shared/plus.rb8
-rw-r--r--spec/ruby/library/pathname/sub_spec.rb15
-rw-r--r--spec/ruby/library/pp/pp_spec.rb30
-rw-r--r--spec/ruby/library/prime/each_spec.rb170
-rw-r--r--spec/ruby/library/prime/instance_spec.rb24
-rw-r--r--spec/ruby/library/prime/int_from_prime_division_spec.rb16
-rw-r--r--spec/ruby/library/prime/integer/each_prime_spec.rb16
-rw-r--r--spec/ruby/library/prime/integer/from_prime_division_spec.rb16
-rw-r--r--spec/ruby/library/prime/integer/prime_division_spec.rb22
-rw-r--r--spec/ruby/library/prime/integer/prime_spec.rb20
-rw-r--r--spec/ruby/library/prime/next_spec.rb10
-rw-r--r--spec/ruby/library/prime/prime_division_spec.rb28
-rw-r--r--spec/ruby/library/prime/prime_spec.rb20
-rw-r--r--spec/ruby/library/prime/shared/next.rb8
-rw-r--r--spec/ruby/library/prime/succ_spec.rb10
-rw-r--r--spec/ruby/library/rbconfig/rbconfig_spec.rb101
-rw-r--r--spec/ruby/library/rbconfig/sizeof/limits_spec.rb40
-rw-r--r--spec/ruby/library/rbconfig/sizeof/sizeof_spec.rb30
-rw-r--r--spec/ruby/library/rbconfig/unicode_emoji_version_spec.rb23
-rw-r--r--spec/ruby/library/rbconfig/unicode_version_spec.rb23
-rw-r--r--spec/ruby/library/readline/basic_quote_characters_spec.rb18
-rw-r--r--spec/ruby/library/readline/basic_word_break_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completer_quote_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completer_word_break_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completion_append_character_spec.rb16
-rw-r--r--spec/ruby/library/readline/completion_case_fold_spec.rb18
-rw-r--r--spec/ruby/library/readline/completion_proc_spec.rb22
-rw-r--r--spec/ruby/library/readline/constants_spec.rb18
-rw-r--r--spec/ruby/library/readline/emacs_editing_mode_spec.rb11
-rw-r--r--spec/ruby/library/readline/filename_quote_characters_spec.rb18
-rw-r--r--spec/ruby/library/readline/history/append_spec.rb28
-rw-r--r--spec/ruby/library/readline/history/delete_at_spec.rb38
-rw-r--r--spec/ruby/library/readline/history/each_spec.rb23
-rw-r--r--spec/ruby/library/readline/history/element_reference_spec.rb35
-rw-r--r--spec/ruby/library/readline/history/element_set_spec.rb35
-rw-r--r--spec/ruby/library/readline/history/empty_spec.rb13
-rw-r--r--spec/ruby/library/readline/history/history_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/length_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/pop_spec.rb23
-rw-r--r--spec/ruby/library/readline/history/push_spec.rb26
-rw-r--r--spec/ruby/library/readline/history/shared/size.rb14
-rw-r--r--spec/ruby/library/readline/history/shift_spec.rb23
-rw-r--r--spec/ruby/library/readline/history/size_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/to_s_spec.rb9
-rw-r--r--spec/ruby/library/readline/readline_spec.rb26
-rw-r--r--spec/ruby/library/readline/spec_helper.rb11
-rw-r--r--spec/ruby/library/readline/vi_editing_mode_spec.rb11
-rw-r--r--spec/ruby/library/resolv/fixtures/hosts1
-rw-r--r--spec/ruby/library/resolv/get_address_spec.rb19
-rw-r--r--spec/ruby/library/resolv/get_addresses_spec.rb12
-rw-r--r--spec/ruby/library/resolv/get_name_spec.rb18
-rw-r--r--spec/ruby/library/resolv/get_names_spec.rb11
-rw-r--r--spec/ruby/library/rexml/attribute/clone_spec.rb14
-rw-r--r--spec/ruby/library/rexml/attribute/element_spec.rb26
-rw-r--r--spec/ruby/library/rexml/attribute/equal_value_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attribute/hash_spec.rb16
-rw-r--r--spec/ruby/library/rexml/attribute/initialize_spec.rb32
-rw-r--r--spec/ruby/library/rexml/attribute/inspect_spec.rb22
-rw-r--r--spec/ruby/library/rexml/attribute/namespace_spec.rb27
-rw-r--r--spec/ruby/library/rexml/attribute/node_type_spec.rb13
-rw-r--r--spec/ruby/library/rexml/attribute/prefix_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attribute/remove_spec.rb23
-rw-r--r--spec/ruby/library/rexml/attribute/to_s_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attribute/to_string_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attribute/value_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attribute/write_spec.rb26
-rw-r--r--spec/ruby/library/rexml/attribute/xpath_spec.rb22
-rw-r--r--spec/ruby/library/rexml/attributes/add_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/append_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/delete_all_spec.rb34
-rw-r--r--spec/ruby/library/rexml/attributes/delete_spec.rb30
-rw-r--r--spec/ruby/library/rexml/attributes/each_attribute_spec.rb25
-rw-r--r--spec/ruby/library/rexml/attributes/each_spec.rb26
-rw-r--r--spec/ruby/library/rexml/attributes/element_reference_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attributes/element_set_spec.rb28
-rw-r--r--spec/ruby/library/rexml/attributes/get_attribute_ns_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attributes/get_attribute_spec.rb32
-rw-r--r--spec/ruby/library/rexml/attributes/initialize_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attributes/length_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/namespaces_spec.rb9
-rw-r--r--spec/ruby/library/rexml/attributes/prefixes_spec.rb27
-rw-r--r--spec/ruby/library/rexml/attributes/shared/add.rb17
-rw-r--r--spec/ruby/library/rexml/attributes/shared/length.rb13
-rw-r--r--spec/ruby/library/rexml/attributes/size_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/to_a_spec.rb22
-rw-r--r--spec/ruby/library/rexml/cdata/clone_spec.rb13
-rw-r--r--spec/ruby/library/rexml/cdata/initialize_spec.rb27
-rw-r--r--spec/ruby/library/rexml/cdata/shared/to_s.rb11
-rw-r--r--spec/ruby/library/rexml/cdata/to_s_spec.rb10
-rw-r--r--spec/ruby/library/rexml/cdata/value_spec.rb10
-rw-r--r--spec/ruby/library/rexml/document/add_element_spec.rb34
-rw-r--r--spec/ruby/library/rexml/document/add_spec.rb60
-rw-r--r--spec/ruby/library/rexml/document/clone_spec.rb23
-rw-r--r--spec/ruby/library/rexml/document/doctype_spec.rb18
-rw-r--r--spec/ruby/library/rexml/document/encoding_spec.rb25
-rw-r--r--spec/ruby/library/rexml/document/expanded_name_spec.rb19
-rw-r--r--spec/ruby/library/rexml/document/new_spec.rb39
-rw-r--r--spec/ruby/library/rexml/document/node_type_spec.rb11
-rw-r--r--spec/ruby/library/rexml/document/root_spec.rb15
-rw-r--r--spec/ruby/library/rexml/document/stand_alone_spec.rb22
-rw-r--r--spec/ruby/library/rexml/document/version_spec.rb17
-rw-r--r--spec/ruby/library/rexml/document/write_spec.rb38
-rw-r--r--spec/ruby/library/rexml/document/xml_decl_spec.rb18
-rw-r--r--spec/ruby/library/rexml/element/add_attribute_spec.rb44
-rw-r--r--spec/ruby/library/rexml/element/add_attributes_spec.rb25
-rw-r--r--spec/ruby/library/rexml/element/add_element_spec.rb41
-rw-r--r--spec/ruby/library/rexml/element/add_namespace_spec.rb26
-rw-r--r--spec/ruby/library/rexml/element/add_text_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/attribute_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/attributes_spec.rb22
-rw-r--r--spec/ruby/library/rexml/element/cdatas_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/clone_spec.rb32
-rw-r--r--spec/ruby/library/rexml/element/comments_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/delete_attribute_spec.rb42
-rw-r--r--spec/ruby/library/rexml/element/delete_element_spec.rb52
-rw-r--r--spec/ruby/library/rexml/element/delete_namespace_spec.rb28
-rw-r--r--spec/ruby/library/rexml/element/document_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/each_element_with_attribute_spec.rb38
-rw-r--r--spec/ruby/library/rexml/element/each_element_with_text_spec.rb34
-rw-r--r--spec/ruby/library/rexml/element/element_reference_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/get_text_spec.rb21
-rw-r--r--spec/ruby/library/rexml/element/has_attributes_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/has_elements_spec.rb21
-rw-r--r--spec/ruby/library/rexml/element/has_text_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/inspect_spec.rb30
-rw-r--r--spec/ruby/library/rexml/element/instructions_spec.rb24
-rw-r--r--spec/ruby/library/rexml/element/namespace_spec.rb30
-rw-r--r--spec/ruby/library/rexml/element/namespaces_spec.rb35
-rw-r--r--spec/ruby/library/rexml/element/new_spec.rb38
-rw-r--r--spec/ruby/library/rexml/element/next_element_spec.rb22
-rw-r--r--spec/ruby/library/rexml/element/node_type_spec.rb11
-rw-r--r--spec/ruby/library/rexml/element/prefixes_spec.rb26
-rw-r--r--spec/ruby/library/rexml/element/previous_element_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/raw_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/root_spec.rb31
-rw-r--r--spec/ruby/library/rexml/element/text_spec.rb49
-rw-r--r--spec/ruby/library/rexml/element/texts_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/whitespace_spec.rb26
-rw-r--r--spec/ruby/library/rexml/node/each_recursive_spec.rb24
-rw-r--r--spec/ruby/library/rexml/node/find_first_recursive_spec.rb28
-rw-r--r--spec/ruby/library/rexml/node/index_in_parent_spec.rb18
-rw-r--r--spec/ruby/library/rexml/node/next_sibling_node_spec.rb24
-rw-r--r--spec/ruby/library/rexml/node/parent_spec.rb23
-rw-r--r--spec/ruby/library/rexml/node/previous_sibling_node_spec.rb24
-rw-r--r--spec/ruby/library/rexml/shared/each_element.rb36
-rw-r--r--spec/ruby/library/rexml/shared/elements_to_a.rb34
-rw-r--r--spec/ruby/library/rexml/text/append_spec.rb13
-rw-r--r--spec/ruby/library/rexml/text/clone_spec.rb13
-rw-r--r--spec/ruby/library/rexml/text/comparison_spec.rb28
-rw-r--r--spec/ruby/library/rexml/text/empty_spec.rb15
-rw-r--r--spec/ruby/library/rexml/text/indent_text_spec.rb26
-rw-r--r--spec/ruby/library/rexml/text/inspect_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/new_spec.rb51
-rw-r--r--spec/ruby/library/rexml/text/node_type_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/normalize_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/read_with_substitution_spec.rb15
-rw-r--r--spec/ruby/library/rexml/text/to_s_spec.rb20
-rw-r--r--spec/ruby/library/rexml/text/unnormalize_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/value_spec.rb40
-rw-r--r--spec/ruby/library/rexml/text/wrap_spec.rb23
-rw-r--r--spec/ruby/library/rexml/text/write_with_substitution_spec.rb36
-rw-r--r--spec/ruby/library/ripper/lex_spec.rb23
-rw-r--r--spec/ruby/library/ripper/sexp_spec.rb13
-rw-r--r--spec/ruby/library/rubygems/gem/bin_path_spec.rb34
-rw-r--r--spec/ruby/library/rubygems/gem/load_path_insert_index_spec.rb10
-rw-r--r--spec/ruby/library/securerandom/base64_spec.rb55
-rw-r--r--spec/ruby/library/securerandom/bytes_spec.rb8
-rw-r--r--spec/ruby/library/securerandom/hex_spec.rb54
-rw-r--r--spec/ruby/library/securerandom/random_bytes_spec.rb53
-rw-r--r--spec/ruby/library/securerandom/random_number_spec.rb97
-rw-r--r--spec/ruby/library/set/add_spec.rb27
-rw-r--r--spec/ruby/library/set/append_spec.rb7
-rw-r--r--spec/ruby/library/set/case_compare_spec.rb12
-rw-r--r--spec/ruby/library/set/case_equality_spec.rb7
-rw-r--r--spec/ruby/library/set/classify_spec.rb27
-rw-r--r--spec/ruby/library/set/clear_spec.rb17
-rw-r--r--spec/ruby/library/set/collect_spec.rb7
-rw-r--r--spec/ruby/library/set/compare_by_identity_spec.rb143
-rw-r--r--spec/ruby/library/set/comparison_spec.rb29
-rw-r--r--spec/ruby/library/set/constructor_spec.rb15
-rw-r--r--spec/ruby/library/set/delete_if_spec.rb38
-rw-r--r--spec/ruby/library/set/delete_spec.rb37
-rw-r--r--spec/ruby/library/set/difference_spec.rb7
-rw-r--r--spec/ruby/library/set/disjoint_spec.rb23
-rw-r--r--spec/ruby/library/set/divide_spec.rb34
-rw-r--r--spec/ruby/library/set/each_spec.rb26
-rw-r--r--spec/ruby/library/set/empty_spec.rb10
-rw-r--r--spec/ruby/library/set/enumerable/to_set_spec.rb21
-rw-r--r--spec/ruby/library/set/eql_spec.rb15
-rw-r--r--spec/ruby/library/set/equal_value_spec.rb33
-rw-r--r--spec/ruby/library/set/exclusion_spec.rb18
-rw-r--r--spec/ruby/library/set/filter_spec.rb6
-rw-r--r--spec/ruby/library/set/fixtures/set_like.rb31
-rw-r--r--spec/ruby/library/set/flatten_merge_spec.rb23
-rw-r--r--spec/ruby/library/set/flatten_spec.rb53
-rw-r--r--spec/ruby/library/set/hash_spec.rb13
-rw-r--r--spec/ruby/library/set/include_spec.rb7
-rw-r--r--spec/ruby/library/set/initialize_clone_spec.rb18
-rw-r--r--spec/ruby/library/set/initialize_spec.rb73
-rw-r--r--spec/ruby/library/set/inspect_spec.rb7
-rw-r--r--spec/ruby/library/set/intersect_spec.rb23
-rw-r--r--spec/ruby/library/set/intersection_spec.rb11
-rw-r--r--spec/ruby/library/set/join_spec.rb31
-rw-r--r--spec/ruby/library/set/keep_if_spec.rb38
-rw-r--r--spec/ruby/library/set/length_spec.rb7
-rw-r--r--spec/ruby/library/set/map_spec.rb7
-rw-r--r--spec/ruby/library/set/member_spec.rb7
-rw-r--r--spec/ruby/library/set/merge_spec.rb19
-rw-r--r--spec/ruby/library/set/minus_spec.rb7
-rw-r--r--spec/ruby/library/set/plus_spec.rb7
-rw-r--r--spec/ruby/library/set/pretty_print_cycle_spec.rb10
-rw-r--r--spec/ruby/library/set/pretty_print_spec.rb19
-rw-r--r--spec/ruby/library/set/proper_subset_spec.rb41
-rw-r--r--spec/ruby/library/set/proper_superset_spec.rb41
-rw-r--r--spec/ruby/library/set/reject_spec.rb42
-rw-r--r--spec/ruby/library/set/replace_spec.rb17
-rw-r--r--spec/ruby/library/set/select_spec.rb6
-rw-r--r--spec/ruby/library/set/shared/add.rb14
-rw-r--r--spec/ruby/library/set/shared/collect.rb20
-rw-r--r--spec/ruby/library/set/shared/difference.rb15
-rw-r--r--spec/ruby/library/set/shared/include.rb29
-rw-r--r--spec/ruby/library/set/shared/inspect.rb15
-rw-r--r--spec/ruby/library/set/shared/intersection.rb15
-rw-r--r--spec/ruby/library/set/shared/length.rb6
-rw-r--r--spec/ruby/library/set/shared/select.rb42
-rw-r--r--spec/ruby/library/set/shared/union.rb15
-rw-r--r--spec/ruby/library/set/size_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/add_spec.rb42
-rw-r--r--spec/ruby/library/set/sortedset/append_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/case_equality_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/classify_spec.rb30
-rw-r--r--spec/ruby/library/set/sortedset/clear_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/collect_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/constructor_spec.rb18
-rw-r--r--spec/ruby/library/set/sortedset/delete_if_spec.rb41
-rw-r--r--spec/ruby/library/set/sortedset/delete_spec.rb40
-rw-r--r--spec/ruby/library/set/sortedset/difference_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/divide_spec.rb37
-rw-r--r--spec/ruby/library/set/sortedset/each_spec.rb29
-rw-r--r--spec/ruby/library/set/sortedset/empty_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/eql_spec.rb19
-rw-r--r--spec/ruby/library/set/sortedset/equal_value_spec.rb16
-rw-r--r--spec/ruby/library/set/sortedset/exclusion_spec.rb21
-rw-r--r--spec/ruby/library/set/sortedset/filter_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/flatten_merge_spec.rb11
-rw-r--r--spec/ruby/library/set/sortedset/flatten_spec.rb47
-rw-r--r--spec/ruby/library/set/sortedset/hash_spec.rb16
-rw-r--r--spec/ruby/library/set/sortedset/include_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/initialize_spec.rb33
-rw-r--r--spec/ruby/library/set/sortedset/inspect_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/intersection_spec.rb14
-rw-r--r--spec/ruby/library/set/sortedset/keep_if_spec.rb34
-rw-r--r--spec/ruby/library/set/sortedset/length_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/map_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/member_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/merge_spec.rb22
-rw-r--r--spec/ruby/library/set/sortedset/minus_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/plus_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/pretty_print_cycle_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/pretty_print_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/proper_subset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/proper_superset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/reject_spec.rb45
-rw-r--r--spec/ruby/library/set/sortedset/replace_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/select_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/shared/add.rb14
-rw-r--r--spec/ruby/library/set/sortedset/shared/collect.rb20
-rw-r--r--spec/ruby/library/set/sortedset/shared/difference.rb15
-rw-r--r--spec/ruby/library/set/sortedset/shared/include.rb7
-rw-r--r--spec/ruby/library/set/sortedset/shared/intersection.rb15
-rw-r--r--spec/ruby/library/set/sortedset/shared/length.rb6
-rw-r--r--spec/ruby/library/set/sortedset/shared/select.rb35
-rw-r--r--spec/ruby/library/set/sortedset/shared/union.rb15
-rw-r--r--spec/ruby/library/set/sortedset/size_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/sortedset_spec.rb22
-rw-r--r--spec/ruby/library/set/sortedset/subset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/subtract_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/superset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/to_a_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/union_spec.rb14
-rw-r--r--spec/ruby/library/set/subset_spec.rb41
-rw-r--r--spec/ruby/library/set/subtract_spec.rb17
-rw-r--r--spec/ruby/library/set/superset_spec.rb41
-rw-r--r--spec/ruby/library/set/to_a_spec.rb8
-rw-r--r--spec/ruby/library/set/to_s_spec.rb11
-rw-r--r--spec/ruby/library/set/union_spec.rb11
-rw-r--r--spec/ruby/library/shellwords/shellwords_spec.rb34
-rw-r--r--spec/ruby/library/singleton/allocate_spec.rb8
-rw-r--r--spec/ruby/library/singleton/clone_spec.rb8
-rw-r--r--spec/ruby/library/singleton/dump_spec.rb14
-rw-r--r--spec/ruby/library/singleton/dup_spec.rb8
-rw-r--r--spec/ruby/library/singleton/fixtures/classes.rb18
-rw-r--r--spec/ruby/library/singleton/instance_spec.rb30
-rw-r--r--spec/ruby/library/singleton/load_spec.rb21
-rw-r--r--spec/ruby/library/singleton/new_spec.rb8
-rw-r--r--spec/ruby/library/socket/addrinfo/afamily_spec.rb37
-rw-r--r--spec/ruby/library/socket/addrinfo/bind_spec.rb28
-rw-r--r--spec/ruby/library/socket/addrinfo/canonname_spec.rb27
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_from_spec.rb75
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_to_spec.rb75
-rw-r--r--spec/ruby/library/socket/addrinfo/family_addrinfo_spec.rb115
-rw-r--r--spec/ruby/library/socket/addrinfo/foreach_spec.rb9
-rw-r--r--spec/ruby/library/socket/addrinfo/getaddrinfo_spec.rb91
-rw-r--r--spec/ruby/library/socket/addrinfo/getnameinfo_spec.rb42
-rw-r--r--spec/ruby/library/socket/addrinfo/initialize_spec.rb591
-rw-r--r--spec/ruby/library/socket/addrinfo/inspect_sockaddr_spec.rb50
-rw-r--r--spec/ruby/library/socket/addrinfo/inspect_spec.rb65
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_address_spec.rb66
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_port_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_spec.rb64
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_unpack_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_loopback_spec.rb43
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_multicast_spec.rb29
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_private_spec.rb47
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_linklocal_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_loopback_spec.rb45
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_global_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_linklocal_spec.rb19
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_nodelocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_orglocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_sitelocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_multicast_spec.rb48
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_sitelocal_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_to_ipv4_spec.rb71
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_unique_local_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_unspecified_spec.rb15
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_v4compat_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_v4mapped_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/listen_spec.rb34
-rw-r--r--spec/ruby/library/socket/addrinfo/marshal_dump_spec.rb84
-rw-r--r--spec/ruby/library/socket/addrinfo/marshal_load_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/pfamily_spec.rb43
-rw-r--r--spec/ruby/library/socket/addrinfo/protocol_spec.rb24
-rw-r--r--spec/ruby/library/socket/addrinfo/shared/to_sockaddr.rb51
-rw-r--r--spec/ruby/library/socket/addrinfo/socktype_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/tcp_spec.rb34
-rw-r--r--spec/ruby/library/socket/addrinfo/to_s_spec.rb6
-rw-r--r--spec/ruby/library/socket/addrinfo/to_sockaddr_spec.rb6
-rw-r--r--spec/ruby/library/socket/addrinfo/udp_spec.rb36
-rw-r--r--spec/ruby/library/socket/addrinfo/unix_path_spec.rb37
-rw-r--r--spec/ruby/library/socket/addrinfo/unix_spec.rb71
-rw-r--r--spec/ruby/library/socket/ancillarydata/cmsg_is_spec.rb33
-rw-r--r--spec/ruby/library/socket/ancillarydata/data_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/family_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/initialize_spec.rb284
-rw-r--r--spec/ruby/library/socket/ancillarydata/int_spec.rb43
-rw-r--r--spec/ruby/library/socket/ancillarydata/ip_pktinfo_spec.rb145
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_addr_spec.rb11
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_ifindex_spec.rb11
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_spec.rb89
-rw-r--r--spec/ruby/library/socket/ancillarydata/level_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/type_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/unix_rights_spec.rb61
-rw-r--r--spec/ruby/library/socket/basicsocket/close_read_spec.rb43
-rw-r--r--spec/ruby/library/socket/basicsocket/close_write_spec.rb48
-rw-r--r--spec/ruby/library/socket/basicsocket/connect_address_spec.rb154
-rw-r--r--spec/ruby/library/socket/basicsocket/do_not_reverse_lookup_spec.rb103
-rw-r--r--spec/ruby/library/socket/basicsocket/for_fd_spec.rb38
-rw-r--r--spec/ruby/library/socket/basicsocket/getpeereid_spec.rb36
-rw-r--r--spec/ruby/library/socket/basicsocket/getpeername_spec.rb25
-rw-r--r--spec/ruby/library/socket/basicsocket/getsockname_spec.rb28
-rw-r--r--spec/ruby/library/socket/basicsocket/getsockopt_spec.rb188
-rw-r--r--spec/ruby/library/socket/basicsocket/ioctl_spec.rb42
-rw-r--r--spec/ruby/library/socket/basicsocket/local_address_spec.rb10
-rw-r--r--spec/ruby/library/socket/basicsocket/read_nonblock_spec.rb44
-rw-r--r--spec/ruby/library/socket/basicsocket/recv_nonblock_spec.rb91
-rw-r--r--spec/ruby/library/socket/basicsocket/recv_spec.rb159
-rw-r--r--spec/ruby/library/socket/basicsocket/recvmsg_nonblock_spec.rb224
-rw-r--r--spec/ruby/library/socket/basicsocket/recvmsg_spec.rb197
-rw-r--r--spec/ruby/library/socket/basicsocket/remote_address_spec.rb10
-rw-r--r--spec/ruby/library/socket/basicsocket/send_spec.rb220
-rw-r--r--spec/ruby/library/socket/basicsocket/sendmsg_nonblock_spec.rb118
-rw-r--r--spec/ruby/library/socket/basicsocket/sendmsg_spec.rb111
-rw-r--r--spec/ruby/library/socket/basicsocket/setsockopt_spec.rb336
-rw-r--r--spec/ruby/library/socket/basicsocket/shutdown_spec.rb155
-rw-r--r--spec/ruby/library/socket/basicsocket/write_nonblock_spec.rb43
-rw-r--r--spec/ruby/library/socket/constants/constants_spec.rb108
-rw-r--r--spec/ruby/library/socket/fixtures/classes.rb164
-rw-r--r--spec/ruby/library/socket/fixtures/send_io.txt1
-rw-r--r--spec/ruby/library/socket/ipsocket/addr_spec.rb105
-rw-r--r--spec/ruby/library/socket/ipsocket/getaddress_spec.rb25
-rw-r--r--spec/ruby/library/socket/ipsocket/peeraddr_spec.rb117
-rw-r--r--spec/ruby/library/socket/ipsocket/recvfrom_spec.rb123
-rw-r--r--spec/ruby/library/socket/option/bool_spec.rb27
-rw-r--r--spec/ruby/library/socket/option/initialize_spec.rb83
-rw-r--r--spec/ruby/library/socket/option/inspect_spec.rb19
-rw-r--r--spec/ruby/library/socket/option/int_spec.rb43
-rw-r--r--spec/ruby/library/socket/option/linger_spec.rb76
-rw-r--r--spec/ruby/library/socket/option/new_spec.rb35
-rw-r--r--spec/ruby/library/socket/shared/address.rb249
-rw-r--r--spec/ruby/library/socket/shared/pack_sockaddr.rb106
-rw-r--r--spec/ruby/library/socket/shared/partially_closable_sockets.rb13
-rw-r--r--spec/ruby/library/socket/shared/socketpair.rb138
-rw-r--r--spec/ruby/library/socket/socket/accept_loop_spec.rb84
-rw-r--r--spec/ruby/library/socket/socket/accept_nonblock_spec.rb141
-rw-r--r--spec/ruby/library/socket/socket/accept_spec.rb121
-rw-r--r--spec/ruby/library/socket/socket/bind_spec.rb150
-rw-r--r--spec/ruby/library/socket/socket/connect_nonblock_spec.rb149
-rw-r--r--spec/ruby/library/socket/socket/connect_spec.rb56
-rw-r--r--spec/ruby/library/socket/socket/for_fd_spec.rb30
-rw-r--r--spec/ruby/library/socket/socket/getaddrinfo_spec.rb373
-rw-r--r--spec/ruby/library/socket/socket/gethostbyaddr_spec.rb124
-rw-r--r--spec/ruby/library/socket/socket/gethostbyname_spec.rb135
-rw-r--r--spec/ruby/library/socket/socket/gethostname_spec.rb8
-rw-r--r--spec/ruby/library/socket/socket/getifaddrs_spec.rb117
-rw-r--r--spec/ruby/library/socket/socket/getnameinfo_spec.rb147
-rw-r--r--spec/ruby/library/socket/socket/getservbyname_spec.rb32
-rw-r--r--spec/ruby/library/socket/socket/getservbyport_spec.rb23
-rw-r--r--spec/ruby/library/socket/socket/initialize_spec.rb87
-rw-r--r--spec/ruby/library/socket/socket/ip_address_list_spec.rb50
-rw-r--r--spec/ruby/library/socket/socket/ipv6only_bang_spec.rb20
-rw-r--r--spec/ruby/library/socket/socket/listen_spec.rb66
-rw-r--r--spec/ruby/library/socket/socket/local_address_spec.rb43
-rw-r--r--spec/ruby/library/socket/socket/new_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/pack_sockaddr_in_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/pack_sockaddr_un_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/pair_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/recvfrom_nonblock_spec.rb118
-rw-r--r--spec/ruby/library/socket/socket/recvfrom_spec.rb92
-rw-r--r--spec/ruby/library/socket/socket/remote_address_spec.rb54
-rw-r--r--spec/ruby/library/socket/socket/sockaddr_in_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/sockaddr_un_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/socket_spec.rb38
-rw-r--r--spec/ruby/library/socket/socket/socketpair_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/sysaccept_spec.rb91
-rw-r--r--spec/ruby/library/socket/socket/tcp_server_loop_spec.rb54
-rw-r--r--spec/ruby/library/socket/socket/tcp_server_sockets_spec.rb39
-rw-r--r--spec/ruby/library/socket/socket/tcp_spec.rb70
-rw-r--r--spec/ruby/library/socket/socket/udp_server_loop_on_spec.rb47
-rw-r--r--spec/ruby/library/socket/socket/udp_server_loop_spec.rb59
-rw-r--r--spec/ruby/library/socket/socket/udp_server_recv_spec.rb35
-rw-r--r--spec/ruby/library/socket/socket/udp_server_sockets_spec.rb39
-rw-r--r--spec/ruby/library/socket/socket/unix_server_loop_spec.rb58
-rw-r--r--spec/ruby/library/socket/socket/unix_server_socket_spec.rb48
-rw-r--r--spec/ruby/library/socket/socket/unix_spec.rb45
-rw-r--r--spec/ruby/library/socket/socket/unpack_sockaddr_in_spec.rb46
-rw-r--r--spec/ruby/library/socket/socket/unpack_sockaddr_un_spec.rb26
-rw-r--r--spec/ruby/library/socket/spec_helper.rb13
-rw-r--r--spec/ruby/library/socket/tcpserver/accept_nonblock_spec.rb85
-rw-r--r--spec/ruby/library/socket/tcpserver/accept_spec.rb119
-rw-r--r--spec/ruby/library/socket/tcpserver/gets_spec.rb16
-rw-r--r--spec/ruby/library/socket/tcpserver/initialize_spec.rb101
-rw-r--r--spec/ruby/library/socket/tcpserver/listen_spec.rb22
-rw-r--r--spec/ruby/library/socket/tcpserver/new_spec.rb131
-rw-r--r--spec/ruby/library/socket/tcpserver/sysaccept_spec.rb66
-rw-r--r--spec/ruby/library/socket/tcpsocket/gethostbyname_spec.rb119
-rw-r--r--spec/ruby/library/socket/tcpsocket/initialize_spec.rb66
-rw-r--r--spec/ruby/library/socket/tcpsocket/local_address_spec.rb73
-rw-r--r--spec/ruby/library/socket/tcpsocket/open_spec.rb5
-rw-r--r--spec/ruby/library/socket/tcpsocket/partially_closable_spec.rb21
-rw-r--r--spec/ruby/library/socket/tcpsocket/recv_nonblock_spec.rb48
-rw-r--r--spec/ruby/library/socket/tcpsocket/recv_spec.rb28
-rw-r--r--spec/ruby/library/socket/tcpsocket/remote_address_spec.rb72
-rw-r--r--spec/ruby/library/socket/tcpsocket/setsockopt_spec.rb45
-rw-r--r--spec/ruby/library/socket/tcpsocket/shared/new.rb102
-rw-r--r--spec/ruby/library/socket/udpsocket/bind_spec.rb83
-rw-r--r--spec/ruby/library/socket/udpsocket/connect_spec.rb35
-rw-r--r--spec/ruby/library/socket/udpsocket/initialize_spec.rb40
-rw-r--r--spec/ruby/library/socket/udpsocket/inspect_spec.rb17
-rw-r--r--spec/ruby/library/socket/udpsocket/local_address_spec.rb80
-rw-r--r--spec/ruby/library/socket/udpsocket/new_spec.rb34
-rw-r--r--spec/ruby/library/socket/udpsocket/open_spec.rb13
-rw-r--r--spec/ruby/library/socket/udpsocket/recvfrom_nonblock_spec.rb102
-rw-r--r--spec/ruby/library/socket/udpsocket/remote_address_spec.rb79
-rw-r--r--spec/ruby/library/socket/udpsocket/send_spec.rb154
-rw-r--r--spec/ruby/library/socket/udpsocket/write_spec.rb21
-rw-r--r--spec/ruby/library/socket/unixserver/accept_nonblock_spec.rb92
-rw-r--r--spec/ruby/library/socket/unixserver/accept_spec.rb117
-rw-r--r--spec/ruby/library/socket/unixserver/for_fd_spec.rb23
-rw-r--r--spec/ruby/library/socket/unixserver/initialize_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixserver/listen_spec.rb21
-rw-r--r--spec/ruby/library/socket/unixserver/new_spec.rb6
-rw-r--r--spec/ruby/library/socket/unixserver/open_spec.rb26
-rw-r--r--spec/ruby/library/socket/unixserver/shared/new.rb22
-rw-r--r--spec/ruby/library/socket/unixserver/sysaccept_spec.rb52
-rw-r--r--spec/ruby/library/socket/unixsocket/addr_spec.rb36
-rw-r--r--spec/ruby/library/socket/unixsocket/initialize_spec.rb38
-rw-r--r--spec/ruby/library/socket/unixsocket/inspect_spec.rb17
-rw-r--r--spec/ruby/library/socket/unixsocket/local_address_spec.rb96
-rw-r--r--spec/ruby/library/socket/unixsocket/new_spec.rb6
-rw-r--r--spec/ruby/library/socket/unixsocket/open_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixsocket/pair_spec.rb39
-rw-r--r--spec/ruby/library/socket/unixsocket/partially_closable_spec.rb25
-rw-r--r--spec/ruby/library/socket/unixsocket/path_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixsocket/peeraddr_spec.rb30
-rw-r--r--spec/ruby/library/socket/unixsocket/recv_io_spec.rb87
-rw-r--r--spec/ruby/library/socket/unixsocket/recvfrom_spec.rb98
-rw-r--r--spec/ruby/library/socket/unixsocket/remote_address_spec.rb45
-rw-r--r--spec/ruby/library/socket/unixsocket/send_io_spec.rb58
-rw-r--r--spec/ruby/library/socket/unixsocket/shared/new.rb24
-rw-r--r--spec/ruby/library/socket/unixsocket/socketpair_spec.rb40
-rw-r--r--spec/ruby/library/stringio/append_spec.rb81
-rw-r--r--spec/ruby/library/stringio/binmode_spec.rb23
-rw-r--r--spec/ruby/library/stringio/bytes_spec.rb29
-rw-r--r--spec/ruby/library/stringio/chars_spec.rb29
-rw-r--r--spec/ruby/library/stringio/close_read_spec.rb31
-rw-r--r--spec/ruby/library/stringio/close_spec.rb23
-rw-r--r--spec/ruby/library/stringio/close_write_spec.rb31
-rw-r--r--spec/ruby/library/stringio/closed_read_spec.rb12
-rw-r--r--spec/ruby/library/stringio/closed_spec.rb16
-rw-r--r--spec/ruby/library/stringio/closed_write_spec.rb12
-rw-r--r--spec/ruby/library/stringio/codepoints_spec.rb19
-rw-r--r--spec/ruby/library/stringio/each_byte_spec.rb11
-rw-r--r--spec/ruby/library/stringio/each_char_spec.rb11
-rw-r--r--spec/ruby/library/stringio/each_codepoint_spec.rb9
-rw-r--r--spec/ruby/library/stringio/each_line_spec.rb23
-rw-r--r--spec/ruby/library/stringio/each_spec.rb27
-rw-r--r--spec/ruby/library/stringio/eof_spec.rb11
-rw-r--r--spec/ruby/library/stringio/external_encoding_spec.rb25
-rw-r--r--spec/ruby/library/stringio/fcntl_spec.rb8
-rw-r--r--spec/ruby/library/stringio/fileno_spec.rb9
-rw-r--r--spec/ruby/library/stringio/fixtures/classes.rb15
-rw-r--r--spec/ruby/library/stringio/flush_spec.rb9
-rw-r--r--spec/ruby/library/stringio/fsync_spec.rb9
-rw-r--r--spec/ruby/library/stringio/getbyte_spec.rb19
-rw-r--r--spec/ruby/library/stringio/getc_spec.rb19
-rw-r--r--spec/ruby/library/stringio/getch_spec.rb44
-rw-r--r--spec/ruby/library/stringio/getpass_spec.rb11
-rw-r--r--spec/ruby/library/stringio/gets_spec.rb250
-rw-r--r--spec/ruby/library/stringio/initialize_spec.rb307
-rw-r--r--spec/ruby/library/stringio/inspect_spec.rb19
-rw-r--r--spec/ruby/library/stringio/internal_encoding_spec.rb10
-rw-r--r--spec/ruby/library/stringio/isatty_spec.rb7
-rw-r--r--spec/ruby/library/stringio/length_spec.rb7
-rw-r--r--spec/ruby/library/stringio/lineno_spec.rb30
-rw-r--r--spec/ruby/library/stringio/lines_spec.rb53
-rw-r--r--spec/ruby/library/stringio/new_spec.rb8
-rw-r--r--spec/ruby/library/stringio/open_spec.rb215
-rw-r--r--spec/ruby/library/stringio/path_spec.rb8
-rw-r--r--spec/ruby/library/stringio/pid_spec.rb8
-rw-r--r--spec/ruby/library/stringio/pos_spec.rb28
-rw-r--r--spec/ruby/library/stringio/print_spec.rb102
-rw-r--r--spec/ruby/library/stringio/printf_spec.rb91
-rw-r--r--spec/ruby/library/stringio/putc_spec.rb103
-rw-r--r--spec/ruby/library/stringio/puts_spec.rb184
-rw-r--r--spec/ruby/library/stringio/read_nonblock_spec.rb53
-rw-r--r--spec/ruby/library/stringio/read_spec.rb62
-rw-r--r--spec/ruby/library/stringio/readbyte_spec.rb20
-rw-r--r--spec/ruby/library/stringio/readchar_spec.rb20
-rw-r--r--spec/ruby/library/stringio/readline_spec.rb150
-rw-r--r--spec/ruby/library/stringio/readlines_spec.rb118
-rw-r--r--spec/ruby/library/stringio/readpartial_spec.rb80
-rw-r--r--spec/ruby/library/stringio/reopen_spec.rb281
-rw-r--r--spec/ruby/library/stringio/rewind_spec.rb24
-rw-r--r--spec/ruby/library/stringio/seek_spec.rb67
-rw-r--r--spec/ruby/library/stringio/set_encoding_spec.rb20
-rw-r--r--spec/ruby/library/stringio/shared/codepoints.rb45
-rw-r--r--spec/ruby/library/stringio/shared/each.rb163
-rw-r--r--spec/ruby/library/stringio/shared/each_byte.rb48
-rw-r--r--spec/ruby/library/stringio/shared/each_char.rb36
-rw-r--r--spec/ruby/library/stringio/shared/eof.rb24
-rw-r--r--spec/ruby/library/stringio/shared/getc.rb43
-rw-r--r--spec/ruby/library/stringio/shared/isatty.rb5
-rw-r--r--spec/ruby/library/stringio/shared/length.rb5
-rw-r--r--spec/ruby/library/stringio/shared/read.rb127
-rw-r--r--spec/ruby/library/stringio/shared/readchar.rb29
-rw-r--r--spec/ruby/library/stringio/shared/sysread.rb15
-rw-r--r--spec/ruby/library/stringio/shared/tell.rb12
-rw-r--r--spec/ruby/library/stringio/shared/write.rb121
-rw-r--r--spec/ruby/library/stringio/size_spec.rb7
-rw-r--r--spec/ruby/library/stringio/string_spec.rb50
-rw-r--r--spec/ruby/library/stringio/stringio_spec.rb8
-rw-r--r--spec/ruby/library/stringio/sync_spec.rb19
-rw-r--r--spec/ruby/library/stringio/sysread_spec.rb48
-rw-r--r--spec/ruby/library/stringio/syswrite_spec.rb19
-rw-r--r--spec/ruby/library/stringio/tell_spec.rb7
-rw-r--r--spec/ruby/library/stringio/truncate_spec.rb62
-rw-r--r--spec/ruby/library/stringio/tty_spec.rb7
-rw-r--r--spec/ruby/library/stringio/ungetbyte_spec.rb42
-rw-r--r--spec/ruby/library/stringio/ungetc_spec.rb72
-rw-r--r--spec/ruby/library/stringio/write_nonblock_spec.rb25
-rw-r--r--spec/ruby/library/stringio/write_spec.rb19
-rw-r--r--spec/ruby/library/stringscanner/append_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/beginning_of_line_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/bol_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/check_spec.rb25
-rw-r--r--spec/ruby/library/stringscanner/check_until_spec.rb21
-rw-r--r--spec/ruby/library/stringscanner/clear_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/concat_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/dup_spec.rb39
-rw-r--r--spec/ruby/library/stringscanner/element_reference_spec.rb60
-rw-r--r--spec/ruby/library/stringscanner/empty_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/eos_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/exist_spec.rb30
-rw-r--r--spec/ruby/library/stringscanner/get_byte_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/getbyte_spec.rb21
-rw-r--r--spec/ruby/library/stringscanner/getch_spec.rb35
-rw-r--r--spec/ruby/library/stringscanner/initialize_spec.rb27
-rw-r--r--spec/ruby/library/stringscanner/inspect_spec.rb20
-rw-r--r--spec/ruby/library/stringscanner/match_spec.rb28
-rw-r--r--spec/ruby/library/stringscanner/matched_size_spec.rb24
-rw-r--r--spec/ruby/library/stringscanner/matched_spec.rb41
-rw-r--r--spec/ruby/library/stringscanner/must_C_version_spec.rb8
-rw-r--r--spec/ruby/library/stringscanner/peek_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/peep_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/pointer_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/pos_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/post_match_spec.rb28
-rw-r--r--spec/ruby/library/stringscanner/pre_match_spec.rb41
-rw-r--r--spec/ruby/library/stringscanner/reset_spec.rb15
-rw-r--r--spec/ruby/library/stringscanner/rest_size_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/rest_spec.rb48
-rw-r--r--spec/ruby/library/stringscanner/restsize_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/scan_full_spec.rb30
-rw-r--r--spec/ruby/library/stringscanner/scan_spec.rb87
-rw-r--r--spec/ruby/library/stringscanner/scan_until_spec.rb29
-rw-r--r--spec/ruby/library/stringscanner/search_full_spec.rb36
-rw-r--r--spec/ruby/library/stringscanner/shared/bol.rb25
-rw-r--r--spec/ruby/library/stringscanner/shared/concat.rb30
-rw-r--r--spec/ruby/library/stringscanner/shared/eos.rb17
-rw-r--r--spec/ruby/library/stringscanner/shared/extract_range.rb11
-rw-r--r--spec/ruby/library/stringscanner/shared/extract_range_matched.rb13
-rw-r--r--spec/ruby/library/stringscanner/shared/get_byte.rb29
-rw-r--r--spec/ruby/library/stringscanner/shared/peek.rb39
-rw-r--r--spec/ruby/library/stringscanner/shared/pos.rb52
-rw-r--r--spec/ruby/library/stringscanner/shared/rest_size.rb18
-rw-r--r--spec/ruby/library/stringscanner/shared/terminate.rb8
-rw-r--r--spec/ruby/library/stringscanner/size_spec.rb17
-rw-r--r--spec/ruby/library/stringscanner/skip_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/skip_until_spec.rb24
-rw-r--r--spec/ruby/library/stringscanner/string_spec.rb40
-rw-r--r--spec/ruby/library/stringscanner/terminate_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/unscan_spec.rb28
-rw-r--r--spec/ruby/library/syslog/alert_spec.rb10
-rw-r--r--spec/ruby/library/syslog/close_spec.rb58
-rw-r--r--spec/ruby/library/syslog/constants_spec.rb41
-rw-r--r--spec/ruby/library/syslog/crit_spec.rb10
-rw-r--r--spec/ruby/library/syslog/debug_spec.rb10
-rw-r--r--spec/ruby/library/syslog/emerg_spec.rb16
-rw-r--r--spec/ruby/library/syslog/err_spec.rb10
-rw-r--r--spec/ruby/library/syslog/facility_spec.rb48
-rw-r--r--spec/ruby/library/syslog/ident_spec.rb35
-rw-r--r--spec/ruby/library/syslog/info_spec.rb10
-rw-r--r--spec/ruby/library/syslog/inspect_spec.rb39
-rw-r--r--spec/ruby/library/syslog/instance_spec.rb13
-rw-r--r--spec/ruby/library/syslog/log_spec.rb56
-rw-r--r--spec/ruby/library/syslog/mask_spec.rb113
-rw-r--r--spec/ruby/library/syslog/notice_spec.rb10
-rw-r--r--spec/ruby/library/syslog/open_spec.rb92
-rw-r--r--spec/ruby/library/syslog/opened_spec.rb39
-rw-r--r--spec/ruby/library/syslog/options_spec.rb48
-rw-r--r--spec/ruby/library/syslog/reopen_spec.rb10
-rw-r--r--spec/ruby/library/syslog/shared/log.rb39
-rw-r--r--spec/ruby/library/syslog/shared/reopen.rb40
-rw-r--r--spec/ruby/library/syslog/warning_spec.rb10
-rw-r--r--spec/ruby/library/tempfile/_close_spec.rb21
-rw-r--r--spec/ruby/library/tempfile/callback_spec.rb6
-rw-r--r--spec/ruby/library/tempfile/close_spec.rb57
-rw-r--r--spec/ruby/library/tempfile/delete_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/initialize_spec.rb46
-rw-r--r--spec/ruby/library/tempfile/length_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/open_spec.rb97
-rw-r--r--spec/ruby/library/tempfile/path_spec.rb26
-rw-r--r--spec/ruby/library/tempfile/shared/length.rb21
-rw-r--r--spec/ruby/library/tempfile/shared/unlink.rb12
-rw-r--r--spec/ruby/library/tempfile/size_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/unlink_spec.rb7
-rw-r--r--spec/ruby/library/thread/queue_spec.rb8
-rw-r--r--spec/ruby/library/thread/sizedqueue_spec.rb8
-rw-r--r--spec/ruby/library/time/httpdate_spec.rb21
-rw-r--r--spec/ruby/library/time/iso8601_spec.rb7
-rw-r--r--spec/ruby/library/time/rfc2822_spec.rb7
-rw-r--r--spec/ruby/library/time/rfc822_spec.rb7
-rw-r--r--spec/ruby/library/time/shared/rfc2822.rb65
-rw-r--r--spec/ruby/library/time/shared/xmlschema.rb53
-rw-r--r--spec/ruby/library/time/to_date_spec.rb42
-rw-r--r--spec/ruby/library/time/to_datetime_spec.rb41
-rw-r--r--spec/ruby/library/time/to_time_spec.rb15
-rw-r--r--spec/ruby/library/time/xmlschema_spec.rb7
-rw-r--r--spec/ruby/library/timeout/error_spec.rb8
-rw-r--r--spec/ruby/library/timeout/timeout_spec.rb42
-rw-r--r--spec/ruby/library/tmpdir/dir/mktmpdir_spec.rb117
-rw-r--r--spec/ruby/library/tmpdir/dir/tmpdir_spec.rb10
-rw-r--r--spec/ruby/library/uri/decode_www_form_component_spec.rb6
-rw-r--r--spec/ruby/library/uri/decode_www_form_spec.rb6
-rw-r--r--spec/ruby/library/uri/encode_www_form_component_spec.rb6
-rw-r--r--spec/ruby/library/uri/encode_www_form_spec.rb6
-rw-r--r--spec/ruby/library/uri/eql_spec.rb10
-rw-r--r--spec/ruby/library/uri/equality_spec.rb46
-rw-r--r--spec/ruby/library/uri/escape/decode_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/encode_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/escape_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/unescape_spec.rb6
-rw-r--r--spec/ruby/library/uri/extract_spec.rb86
-rw-r--r--spec/ruby/library/uri/fixtures/classes.rb11
-rw-r--r--spec/ruby/library/uri/fixtures/normalization.rb54
-rw-r--r--spec/ruby/library/uri/ftp/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/merge_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/new2_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/path_spec.rb26
-rw-r--r--spec/ruby/library/uri/ftp/set_typecode_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/to_s_spec.rb15
-rw-r--r--spec/ruby/library/uri/ftp/typecode_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/absolute_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/build2_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/coerce_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/component_ary_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/component_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/default_port_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/eql_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/equal_value_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/fragment_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/hash_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/hierarchical_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/host_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/inspect_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/merge_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/minus_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/normalize_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/opaque_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/password_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/path_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/plus_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/port_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/query_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/registry_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/relative_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/route_from_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/route_to_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/scheme_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/select_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_fragment_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_host_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_opaque_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_password_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_path_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_port_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_query_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_registry_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_scheme_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_user_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_userinfo_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/to_s_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/use_registry_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/user_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/userinfo_spec.rb10
-rw-r--r--spec/ruby/library/uri/http/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/http/request_uri_spec.rb16
-rw-r--r--spec/ruby/library/uri/join_spec.rb59
-rw-r--r--spec/ruby/library/uri/ldap/attributes_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/dn_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/extensions_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/filter_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/hierarchical_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/scope_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/set_attributes_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_dn_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_extensions_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_filter_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_scope_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/build_spec.rb92
-rw-r--r--spec/ruby/library/uri/mailto/headers_spec.rb10
-rw-r--r--spec/ruby/library/uri/mailto/set_headers_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/set_to_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_mailtext_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_rfc822text_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_s_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_spec.rb10
-rw-r--r--spec/ruby/library/uri/merge_spec.rb20
-rw-r--r--spec/ruby/library/uri/normalize_spec.rb35
-rw-r--r--spec/ruby/library/uri/parse_spec.rb203
-rw-r--r--spec/ruby/library/uri/parser/escape_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/extract_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/inspect_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/join_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/make_regexp_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/parse_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/split_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/unescape_spec.rb6
-rw-r--r--spec/ruby/library/uri/plus_spec.rb459
-rw-r--r--spec/ruby/library/uri/regexp_spec.rb18
-rw-r--r--spec/ruby/library/uri/route_from_spec.rb23
-rw-r--r--spec/ruby/library/uri/route_to_spec.rb26
-rw-r--r--spec/ruby/library/uri/select_spec.rb27
-rw-r--r--spec/ruby/library/uri/set_component_spec.rb45
-rw-r--r--spec/ruby/library/uri/shared/eql.rb17
-rw-r--r--spec/ruby/library/uri/shared/extract.rb83
-rw-r--r--spec/ruby/library/uri/shared/join.rb56
-rw-r--r--spec/ruby/library/uri/shared/parse.rb199
-rw-r--r--spec/ruby/library/uri/split_spec.rb6
-rw-r--r--spec/ruby/library/uri/uri_spec.rb29
-rw-r--r--spec/ruby/library/uri/util/make_components_hash_spec.rb6
-rw-r--r--spec/ruby/library/weakref/__getobj___spec.rb17
-rw-r--r--spec/ruby/library/weakref/allocate_spec.rb8
-rw-r--r--spec/ruby/library/weakref/fixtures/classes.rb26
-rw-r--r--spec/ruby/library/weakref/new_spec.rb13
-rw-r--r--spec/ruby/library/weakref/send_spec.rb37
-rw-r--r--spec/ruby/library/weakref/weakref_alive_spec.rb15
-rw-r--r--spec/ruby/library/win32ole/fixtures/classes.rb22
-rw-r--r--spec/ruby/library/win32ole/fixtures/event.xml4
-rw-r--r--spec/ruby/library/win32ole/win32ole/_getproperty_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole/_invoke_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/codepage_spec.rb13
-rw-r--r--spec/ruby/library/win32ole/win32ole/connect_spec.rb15
-rw-r--r--spec/ruby/library/win32ole/win32ole/const_load_spec.rb32
-rw-r--r--spec/ruby/library/win32ole/win32ole/constants_spec.rb42
-rw-r--r--spec/ruby/library/win32ole/win32ole/create_guid_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole/invoke_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole/locale_spec.rb29
-rw-r--r--spec/ruby/library/win32ole/win32ole/new_spec.rb25
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_func_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_get_methods_spec.rb16
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_method_help_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_method_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_obj_help_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_put_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/setproperty_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/shared/ole_method.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole/shared/setproperty.rb23
-rw-r--r--spec/ruby/library/win32ole/win32ole_event/new_spec.rb33
-rw-r--r--spec/ruby/library/win32ole/win32ole_event/on_event_spec.rb70
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/dispid_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/event_interface_spec.rb28
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/event_spec.rb22
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpcontext_spec.rb26
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpfile_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpstring_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/invkind_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/invoke_kind_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/new_spec.rb33
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/offset_vtbl_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/params_spec.rb28
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_type_detail_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_type_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_vtype_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/shared/name.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/size_opt_params_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/size_params_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/visible_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/default_spec.rb31
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/input_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/ole_type_detail_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/ole_type_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/optional_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/retval_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/shared/name.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/guid_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpcontext_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpfile_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpstring_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/major_version_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/minor_version_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/new_spec.rb40
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_classes_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_methods_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/progid_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/progids_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/shared/name.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/src_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/typekind_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/typelibs_spec.rb22
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/variables_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/visible_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/ole_type_detail_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/ole_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/shared/name.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/value_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/variable_kind_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/varkind_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/visible_spec.rb18
-rw-r--r--spec/ruby/library/yaml/dump_spec.rb56
-rw-r--r--spec/ruby/library/yaml/dump_stream_spec.rb8
-rw-r--r--spec/ruby/library/yaml/fixtures/common.rb4
-rw-r--r--spec/ruby/library/yaml/fixtures/example_class.rb7
-rw-r--r--spec/ruby/library/yaml/fixtures/strings.rb36
-rw-r--r--spec/ruby/library/yaml/fixtures/test_yaml.yml2
-rw-r--r--spec/ruby/library/yaml/load_file_spec.rb13
-rw-r--r--spec/ruby/library/yaml/load_spec.rb10
-rw-r--r--spec/ruby/library/yaml/load_stream_spec.rb8
-rw-r--r--spec/ruby/library/yaml/parse_file_spec.rb8
-rw-r--r--spec/ruby/library/yaml/parse_spec.rb22
-rw-r--r--spec/ruby/library/yaml/shared/each_document.rb18
-rw-r--r--spec/ruby/library/yaml/shared/load.rb136
-rw-r--r--spec/ruby/library/yaml/to_yaml_spec.rb98
-rw-r--r--spec/ruby/library/yaml/unsafe_load_spec.rb9
-rw-r--r--spec/ruby/library/zlib/adler32_spec.rb46
-rw-r--r--spec/ruby/library/zlib/crc32_spec.rb54
-rw-r--r--spec/ruby/library/zlib/crc_table_spec.rb80
-rw-r--r--spec/ruby/library/zlib/deflate/deflate_spec.rb133
-rw-r--r--spec/ruby/library/zlib/deflate/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/deflate/params_spec.rb17
-rw-r--r--spec/ruby/library/zlib/deflate/set_dictionary_spec.rb14
-rw-r--r--spec/ruby/library/zlib/deflate_spec.rb8
-rw-r--r--spec/ruby/library/zlib/gunzip_spec.rb14
-rw-r--r--spec/ruby/library/zlib/gzip_spec.rb15
-rw-r--r--spec/ruby/library/zlib/gzipfile/close_spec.rb21
-rw-r--r--spec/ruby/library/zlib/gzipfile/closed_spec.rb16
-rw-r--r--spec/ruby/library/zlib/gzipfile/comment_spec.rb26
-rw-r--r--spec/ruby/library/zlib/gzipfile/orig_name_spec.rb26
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_byte_spec.rb51
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_line_spec.rb5
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_spec.rb5
-rw-r--r--spec/ruby/library/zlib/gzipreader/eof_spec.rb54
-rw-r--r--spec/ruby/library/zlib/gzipreader/getc_spec.rb39
-rw-r--r--spec/ruby/library/zlib/gzipreader/gets_spec.rb22
-rw-r--r--spec/ruby/library/zlib/gzipreader/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/gzipreader/pos_spec.rb24
-rw-r--r--spec/ruby/library/zlib/gzipreader/read_spec.rb66
-rw-r--r--spec/ruby/library/zlib/gzipreader/readpartial_spec.rb17
-rw-r--r--spec/ruby/library/zlib/gzipreader/rewind_spec.rb47
-rw-r--r--spec/ruby/library/zlib/gzipreader/shared/each.rb49
-rw-r--r--spec/ruby/library/zlib/gzipreader/ungetbyte_spec.rb120
-rw-r--r--spec/ruby/library/zlib/gzipreader/ungetc_spec.rb284
-rw-r--r--spec/ruby/library/zlib/gzipwriter/append_spec.rb15
-rw-r--r--spec/ruby/library/zlib/gzipwriter/mtime_spec.rb38
-rw-r--r--spec/ruby/library/zlib/gzipwriter/write_spec.rb36
-rw-r--r--spec/ruby/library/zlib/inflate/append_spec.rb60
-rw-r--r--spec/ruby/library/zlib/inflate/finish_spec.rb28
-rw-r--r--spec/ruby/library/zlib/inflate/inflate_spec.rb159
-rw-r--r--spec/ruby/library/zlib/inflate/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/inflate/set_dictionary_spec.rb20
-rw-r--r--spec/ruby/library/zlib/inflate_spec.rb8
-rw-r--r--spec/ruby/library/zlib/zlib_version_spec.rb8
-rw-r--r--spec/ruby/library/zlib/zstream/adler_spec.rb11
-rw-r--r--spec/ruby/library/zlib/zstream/avail_in_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/avail_out_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/data_type_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/flush_next_out_spec.rb14
-rw-r--r--spec/ruby/optional/capi/README13
-rw-r--r--spec/ruby/optional/capi/array_spec.rb497
-rw-r--r--spec/ruby/optional/capi/basic_object_spec.rb24
-rw-r--r--spec/ruby/optional/capi/bignum_spec.rb224
-rw-r--r--spec/ruby/optional/capi/binding_spec.rb28
-rw-r--r--spec/ruby/optional/capi/boolean_spec.rb33
-rw-r--r--spec/ruby/optional/capi/class_spec.rb492
-rw-r--r--spec/ruby/optional/capi/complex_spec.rb45
-rw-r--r--spec/ruby/optional/capi/constants_spec.rb325
-rw-r--r--spec/ruby/optional/capi/data_spec.rb52
-rw-r--r--spec/ruby/optional/capi/debug_spec.rb66
-rw-r--r--spec/ruby/optional/capi/encoding_spec.rb694
-rw-r--r--spec/ruby/optional/capi/enumerator_spec.rb66
-rw-r--r--spec/ruby/optional/capi/exception_spec.rb147
-rw-r--r--spec/ruby/optional/capi/ext/.gitignore9
-rw-r--r--spec/ruby/optional/capi/ext/array_spec.c297
-rw-r--r--spec/ruby/optional/capi/ext/basic_object_spec.c19
-rw-r--r--spec/ruby/optional/capi/ext/bignum_spec.c106
-rw-r--r--spec/ruby/optional/capi/ext/binding_spec.c19
-rw-r--r--spec/ruby/optional/capi/ext/boolean_spec.c33
-rw-r--r--spec/ruby/optional/capi/ext/class_id_under_autoload_spec.c13
-rw-r--r--spec/ruby/optional/capi/ext/class_spec.c179
-rw-r--r--spec/ruby/optional/capi/ext/class_under_autoload_spec.c13
-rw-r--r--spec/ruby/optional/capi/ext/complex_spec.c45
-rw-r--r--spec/ruby/optional/capi/ext/constants_spec.c178
-rw-r--r--spec/ruby/optional/capi/ext/data_spec.c89
-rw-r--r--spec/ruby/optional/capi/ext/debug_spec.c93
-rw-r--r--spec/ruby/optional/capi/ext/encoding_spec.c371
-rw-r--r--spec/ruby/optional/capi/ext/enumerator_spec.c32
-rw-r--r--spec/ruby/optional/capi/ext/exception_spec.c59
-rw-r--r--spec/ruby/optional/capi/ext/fiber_spec.c69
-rw-r--r--spec/ruby/optional/capi/ext/file_spec.c29
-rw-r--r--spec/ruby/optional/capi/ext/fixnum_spec.c26
-rw-r--r--spec/ruby/optional/capi/ext/float_spec.c47
-rw-r--r--spec/ruby/optional/capi/ext/gc_spec.c97
-rw-r--r--spec/ruby/optional/capi/ext/globals_spec.c161
-rw-r--r--spec/ruby/optional/capi/ext/hash_spec.c160
-rw-r--r--spec/ruby/optional/capi/ext/integer_spec.c41
-rw-r--r--spec/ruby/optional/capi/ext/io_spec.c312
-rw-r--r--spec/ruby/optional/capi/ext/kernel_spec.c405
-rw-r--r--spec/ruby/optional/capi/ext/language_spec.c42
-rw-r--r--spec/ruby/optional/capi/ext/marshal_spec.c24
-rw-r--r--spec/ruby/optional/capi/ext/module_spec.c176
-rw-r--r--spec/ruby/optional/capi/ext/module_under_autoload_spec.c15
-rw-r--r--spec/ruby/optional/capi/ext/mutex_spec.c55
-rw-r--r--spec/ruby/optional/capi/ext/numeric_spec.c130
-rw-r--r--spec/ruby/optional/capi/ext/object_spec.c528
-rw-r--r--spec/ruby/optional/capi/ext/proc_spec.c132
-rw-r--r--spec/ruby/optional/capi/ext/range_spec.c50
-rw-r--r--spec/ruby/optional/capi/ext/rational_spec.c54
-rw-r--r--spec/ruby/optional/capi/ext/rbasic_spec.c100
-rw-r--r--spec/ruby/optional/capi/ext/regexp_spec.c74
-rw-r--r--spec/ruby/optional/capi/ext/rubyspec.h37
-rw-r--r--spec/ruby/optional/capi/ext/st_spec.c83
-rw-r--r--spec/ruby/optional/capi/ext/string_spec.c719
-rw-r--r--spec/ruby/optional/capi/ext/struct_spec.c85
-rw-r--r--spec/ruby/optional/capi/ext/symbol_spec.c116
-rw-r--r--spec/ruby/optional/capi/ext/thread_spec.c188
-rw-r--r--spec/ruby/optional/capi/ext/time_spec.c81
-rw-r--r--spec/ruby/optional/capi/ext/tracepoint_spec.c49
-rw-r--r--spec/ruby/optional/capi/ext/typed_data_spec.c189
-rw-r--r--spec/ruby/optional/capi/ext/util_spec.c126
-rw-r--r--spec/ruby/optional/capi/fiber_spec.rb89
-rw-r--r--spec/ruby/optional/capi/file_spec.rb89
-rw-r--r--spec/ruby/optional/capi/fixnum_spec.rb101
-rw-r--r--spec/ruby/optional/capi/fixtures/class.rb104
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_at.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_from.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_object.rb3
-rw-r--r--spec/ruby/optional/capi/fixtures/encoding.rb3
-rw-r--r--spec/ruby/optional/capi/fixtures/foo.rb1
-rw-r--r--spec/ruby/optional/capi/fixtures/module.rb39
-rw-r--r--spec/ruby/optional/capi/fixtures/module_autoload.rb4
-rw-r--r--spec/ruby/optional/capi/fixtures/object.rb29
-rw-r--r--spec/ruby/optional/capi/fixtures/path_to_class.rb6
-rw-r--r--spec/ruby/optional/capi/fixtures/proc.rb20
-rw-r--r--spec/ruby/optional/capi/fixtures/read.txt1
-rw-r--r--spec/ruby/optional/capi/float_spec.rb43
-rw-r--r--spec/ruby/optional/capi/gc_spec.rb105
-rw-r--r--spec/ruby/optional/capi/globals_spec.rb293
-rw-r--r--spec/ruby/optional/capi/hash_spec.rb274
-rw-r--r--spec/ruby/optional/capi/integer_spec.rb290
-rw-r--r--spec/ruby/optional/capi/io_spec.rb418
-rw-r--r--spec/ruby/optional/capi/kernel_spec.rb696
-rw-r--r--spec/ruby/optional/capi/language_spec.rb37
-rw-r--r--spec/ruby/optional/capi/marshal_spec.rb46
-rw-r--r--spec/ruby/optional/capi/module_spec.rb431
-rw-r--r--spec/ruby/optional/capi/mutex_spec.rb89
-rw-r--r--spec/ruby/optional/capi/numeric_spec.rb495
-rw-r--r--spec/ruby/optional/capi/object_spec.rb1007
-rw-r--r--spec/ruby/optional/capi/proc_spec.rb135
-rw-r--r--spec/ruby/optional/capi/rake_helper.rb22
-rw-r--r--spec/ruby/optional/capi/range_spec.rb95
-rw-r--r--spec/ruby/optional/capi/rational_spec.rb57
-rw-r--r--spec/ruby/optional/capi/rbasic_spec.rb42
-rw-r--r--spec/ruby/optional/capi/regexp_spec.rb128
-rw-r--r--spec/ruby/optional/capi/shared/rbasic.rb29
-rw-r--r--spec/ruby/optional/capi/spec_helper.rb147
-rw-r--r--spec/ruby/optional/capi/st_spec.rb41
-rw-r--r--spec/ruby/optional/capi/string_spec.rb1293
-rw-r--r--spec/ruby/optional/capi/struct_spec.rb211
-rw-r--r--spec/ruby/optional/capi/symbol_spec.rb180
-rw-r--r--spec/ruby/optional/capi/thread_spec.rb189
-rw-r--r--spec/ruby/optional/capi/time_spec.rb296
-rw-r--r--spec/ruby/optional/capi/tracepoint_spec.rb56
-rw-r--r--spec/ruby/optional/capi/typed_data_spec.rb88
-rw-r--r--spec/ruby/optional/capi/util_spec.rb326
-rw-r--r--spec/ruby/security/cve_2010_1330_spec.rb19
-rw-r--r--spec/ruby/security/cve_2011_4815_spec.rb47
-rw-r--r--spec/ruby/security/cve_2013_4164_spec.rb15
-rw-r--r--spec/ruby/security/cve_2014_8080_spec.rb34
-rw-r--r--spec/ruby/security/cve_2017_17742_spec.rb37
-rw-r--r--spec/ruby/security/cve_2018_16396_spec.rb7
-rw-r--r--spec/ruby/security/cve_2018_6914_spec.rb55
-rw-r--r--spec/ruby/security/cve_2018_8778_spec.rb10
-rw-r--r--spec/ruby/security/cve_2018_8779_spec.rb30
-rw-r--r--spec/ruby/security/cve_2018_8780_spec.rb43
-rw-r--r--spec/ruby/security/cve_2019_8321_spec.rb20
-rw-r--r--spec/ruby/security/cve_2019_8322_spec.rb21
-rw-r--r--spec/ruby/security/cve_2019_8323_spec.rb36
-rw-r--r--spec/ruby/security/cve_2019_8325_spec.rb46
-rw-r--r--spec/ruby/security/cve_2020_10663_spec.rb39
-rw-r--r--spec/ruby/shared/basicobject/method_missing.rb124
-rw-r--r--spec/ruby/shared/basicobject/send.rb128
-rw-r--r--spec/ruby/shared/enumerable/minmax.rb24
-rw-r--r--spec/ruby/shared/enumerator/enum_for.rb57
-rw-r--r--spec/ruby/shared/enumerator/with_index.rb33
-rw-r--r--spec/ruby/shared/enumerator/with_object.rb42
-rw-r--r--spec/ruby/shared/fiber/resume.rb58
-rw-r--r--spec/ruby/shared/file/blockdev.rb9
-rw-r--r--spec/ruby/shared/file/chardev.rb9
-rw-r--r--spec/ruby/shared/file/directory.rb66
-rw-r--r--spec/ruby/shared/file/executable.rb83
-rw-r--r--spec/ruby/shared/file/executable_real.rb81
-rw-r--r--spec/ruby/shared/file/exist.rb24
-rw-r--r--spec/ruby/shared/file/file.rb45
-rw-r--r--spec/ruby/shared/file/grpowned.rb39
-rw-r--r--spec/ruby/shared/file/identical.rb51
-rw-r--r--spec/ruby/shared/file/owned.rb3
-rw-r--r--spec/ruby/shared/file/pipe.rb3
-rw-r--r--spec/ruby/shared/file/readable.rb49
-rw-r--r--spec/ruby/shared/file/readable_real.rb39
-rw-r--r--spec/ruby/shared/file/setgid.rb2
-rw-r--r--spec/ruby/shared/file/setuid.rb2
-rw-r--r--spec/ruby/shared/file/size.rb124
-rw-r--r--spec/ruby/shared/file/socket.rb3
-rw-r--r--spec/ruby/shared/file/sticky.rb29
-rw-r--r--spec/ruby/shared/file/symlink.rb46
-rw-r--r--spec/ruby/shared/file/world_readable.rb49
-rw-r--r--spec/ruby/shared/file/world_writable.rb49
-rw-r--r--spec/ruby/shared/file/writable.rb44
-rw-r--r--spec/ruby/shared/file/writable_real.rb49
-rw-r--r--spec/ruby/shared/file/zero.rb68
-rw-r--r--spec/ruby/shared/hash/key_error.rb23
-rw-r--r--spec/ruby/shared/io/putc.rb57
-rw-r--r--spec/ruby/shared/kernel/complex.rb133
-rw-r--r--spec/ruby/shared/kernel/equal.rb54
-rw-r--r--spec/ruby/shared/kernel/object_id.rb80
-rw-r--r--spec/ruby/shared/kernel/raise.rb149
-rw-r--r--spec/ruby/shared/math/atanh.rb44
-rw-r--r--spec/ruby/shared/process/abort.rb36
-rw-r--r--spec/ruby/shared/process/exit.rb120
-rw-r--r--spec/ruby/shared/process/fork.rb90
-rw-r--r--spec/ruby/shared/queue/clear.rb12
-rw-r--r--spec/ruby/shared/queue/close.rb14
-rw-r--r--spec/ruby/shared/queue/closed.rb12
-rw-r--r--spec/ruby/shared/queue/deque.rb147
-rw-r--r--spec/ruby/shared/queue/empty.rb12
-rw-r--r--spec/ruby/shared/queue/enque.rb18
-rw-r--r--spec/ruby/shared/queue/length.rb9
-rw-r--r--spec/ruby/shared/queue/num_waiting.rb16
-rw-r--r--spec/ruby/shared/rational/Rational.rb141
-rw-r--r--spec/ruby/shared/rational/abs.rb11
-rw-r--r--spec/ruby/shared/rational/arithmetic_exception_in_coerce.rb11
-rw-r--r--spec/ruby/shared/rational/ceil.rb45
-rw-r--r--spec/ruby/shared/rational/coerce.rb34
-rw-r--r--spec/ruby/shared/rational/comparison.rb95
-rw-r--r--spec/ruby/shared/rational/denominator.rb14
-rw-r--r--spec/ruby/shared/rational/div.rb54
-rw-r--r--spec/ruby/shared/rational/divide.rb71
-rw-r--r--spec/ruby/shared/rational/divmod.rb42
-rw-r--r--spec/ruby/shared/rational/equal_value.rb39
-rw-r--r--spec/ruby/shared/rational/exponent.rb196
-rw-r--r--spec/ruby/shared/rational/fdiv.rb5
-rw-r--r--spec/ruby/shared/rational/floor.rb45
-rw-r--r--spec/ruby/shared/rational/hash.rb9
-rw-r--r--spec/ruby/shared/rational/inspect.rb14
-rw-r--r--spec/ruby/shared/rational/marshal_dump.rb5
-rw-r--r--spec/ruby/shared/rational/marshal_load.rb5
-rw-r--r--spec/ruby/shared/rational/modulo.rb43
-rw-r--r--spec/ruby/shared/rational/multiply.rb62
-rw-r--r--spec/ruby/shared/rational/numerator.rb10
-rw-r--r--spec/ruby/shared/rational/plus.rb48
-rw-r--r--spec/ruby/shared/rational/quo.rb5
-rw-r--r--spec/ruby/shared/rational/remainder.rb5
-rw-r--r--spec/ruby/shared/rational/round.rb106
-rw-r--r--spec/ruby/shared/rational/to_f.rb16
-rw-r--r--spec/ruby/shared/rational/to_i.rb12
-rw-r--r--spec/ruby/shared/rational/to_r.rb11
-rw-r--r--spec/ruby/shared/rational/to_s.rb14
-rw-r--r--spec/ruby/shared/rational/truncate.rb45
-rw-r--r--spec/ruby/shared/sizedqueue/enque.rb113
-rw-r--r--spec/ruby/shared/sizedqueue/max.rb47
-rw-r--r--spec/ruby/shared/sizedqueue/new.rb23
-rw-r--r--spec/ruby/shared/sizedqueue/num_waiting.rb12
-rw-r--r--spec/ruby/shared/string/end_with.rb61
-rw-r--r--spec/ruby/shared/string/start_with.rb76
-rw-r--r--spec/ruby/shared/string/times.rb68
-rw-r--r--spec/ruby/shared/time/strftime_for_date.rb273
-rw-r--r--spec/ruby/shared/time/strftime_for_time.rb181
-rw-r--r--spec/ruby/spec_helper.rb38
-rw-r--r--spec/syntax_suggest/fixtures/derailed_require_tree.rb.txt74
-rwxr-xr-xspec/syntax_suggest/fixtures/rexe.rb.txt569
-rw-r--r--spec/syntax_suggest/fixtures/routes.rb.txt121
-rw-r--r--spec/syntax_suggest/fixtures/ruby_buildpack.rb.txt1344
-rw-r--r--spec/syntax_suggest/fixtures/syntax_tree.rb.txt9234
-rw-r--r--spec/syntax_suggest/fixtures/this_project_extra_def.rb.txt64
-rw-r--r--spec/syntax_suggest/fixtures/webmock.rb.txt35
-rw-r--r--spec/syntax_suggest/integration/exe_cli_spec.rb27
-rw-r--r--spec/syntax_suggest/integration/ruby_command_line_spec.rb193
-rw-r--r--spec/syntax_suggest/integration/syntax_suggest_spec.rb239
-rw-r--r--spec/syntax_suggest/spec_helper.rb104
-rw-r--r--spec/syntax_suggest/unit/api_spec.rb108
-rw-r--r--spec/syntax_suggest/unit/around_block_scan_spec.rb165
-rw-r--r--spec/syntax_suggest/unit/block_expand_spec.rb230
-rw-r--r--spec/syntax_suggest/unit/capture/before_after_keyword_ends_spec.rb47
-rw-r--r--spec/syntax_suggest/unit/capture/falling_indent_lines_spec.rb44
-rw-r--r--spec/syntax_suggest/unit/capture_code_context_spec.rb229
-rw-r--r--spec/syntax_suggest/unit/clean_document_spec.rb260
-rw-r--r--spec/syntax_suggest/unit/cli_spec.rb224
-rw-r--r--spec/syntax_suggest/unit/code_block_spec.rb77
-rw-r--r--spec/syntax_suggest/unit/code_frontier_spec.rb135
-rw-r--r--spec/syntax_suggest/unit/code_line_spec.rb165
-rw-r--r--spec/syntax_suggest/unit/code_search_spec.rb505
-rw-r--r--spec/syntax_suggest/unit/core_ext_spec.rb34
-rw-r--r--spec/syntax_suggest/unit/display_invalid_blocks_spec.rb174
-rw-r--r--spec/syntax_suggest/unit/explain_syntax_spec.rb255
-rw-r--r--spec/syntax_suggest/unit/lex_all_spec.rb29
-rw-r--r--spec/syntax_suggest/unit/pathname_from_message_spec.rb56
-rw-r--r--spec/syntax_suggest/unit/priority_queue_spec.rb95
-rw-r--r--spec/syntax_suggest/unit/scan_history_spec.rb114
-rw-r--r--sprintf.c1966
-rw-r--r--st.c2747
-rw-r--r--strftime.c478
-rw-r--r--string.c12514
-rw-r--r--string.rb552
-rw-r--r--struct.c2282
-rw-r--r--symbian/README.SYMBIAN93
-rw-r--r--symbian/configure.bat123
-rw-r--r--symbian/missing-aeabi.c18
-rw-r--r--symbian/missing-pips.c65
-rw-r--r--symbian/pre-build83
-rw-r--r--symbian/setup440
-rw-r--r--symbol.c1267
-rw-r--r--symbol.h119
-rw-r--r--symbol.rb15
-rw-r--r--template/Doxyfile.tmpl2576
-rw-r--r--template/GNUmakefile.in34
-rw-r--r--template/Makefile.in727
-rw-r--r--template/builtin_binary.inc.tmpl30
-rw-r--r--template/call_iseq_optimized.inc.tmpl68
-rw-r--r--template/configure-ext.mk.tmpl46
-rw-r--r--template/depend.tmpl2
-rw-r--r--template/encdb.h.tmpl62
-rw-r--r--template/extinit.c.tmpl17
-rw-r--r--template/exts.mk.tmpl171
-rw-r--r--[-rwxr-xr-x]template/fake.rb.in100
-rw-r--r--template/id.c.tmpl41
-rw-r--r--template/id.h.tmpl176
-rw-r--r--template/insns.inc.tmpl20
-rw-r--r--template/insns_info.inc.tmpl83
-rw-r--r--template/known_errors.inc.tmpl2
-rw-r--r--template/limits.c.tmpl97
-rw-r--r--template/minsns.inc.tmpl14
-rw-r--r--template/opt_sc.inc.tmpl32
-rw-r--r--template/optinsn.inc.tmpl30
-rw-r--r--template/optunifs.inc.tmpl35
-rw-r--r--template/prelude.c.tmpl221
-rwxr-xr-xtemplate/ruby-gdb.in6
-rwxr-xr-xtemplate/ruby-lldb.in6
-rw-r--r--template/ruby-runner.h.in9
-rw-r--r--template/ruby.pc.in50
-rw-r--r--template/sizes.c.tmpl54
-rw-r--r--template/transdb.h.tmpl21
-rw-r--r--template/unicode_norm_gen.tmpl220
-rw-r--r--template/verconf.h.tmpl63
-rw-r--r--template/vm.inc.tmpl29
-rw-r--r--template/vmtc.inc.tmpl18
-rw-r--r--template/yarvarch.ja454
-rw-r--r--template/yasmdata.rb.tmpl20
-rw-r--r--test/-ext-/arith_seq/test_arith_seq_beg_len_step.rb52
-rw-r--r--test/-ext-/arith_seq/test_arith_seq_extract.rb40
-rw-r--r--test/-ext-/array/test_resize.rb9
-rw-r--r--test/-ext-/array/test_to_ary_concat.rb20
-rw-r--r--test/-ext-/bignum/test_big2str.rb28
-rw-r--r--test/-ext-/bignum/test_bigzero.rb18
-rw-r--r--test/-ext-/bignum/test_div.rb27
-rw-r--r--test/-ext-/bignum/test_mul.rb136
-rw-r--r--test/-ext-/bignum/test_pack.rb396
-rw-r--r--test/-ext-/bignum/test_str2big.rb36
-rw-r--r--test/-ext-/bug_reporter/test_bug_reporter.rb35
-rw-r--r--test/-ext-/class/test_class2name.rb19
-rw-r--r--test/-ext-/debug/test_debug.rb75
-rw-r--r--test/-ext-/debug/test_profile_frames.rb180
-rw-r--r--test/-ext-/econv/test_append.rb23
-rw-r--r--test/-ext-/eval/test_eval.rb12
-rw-r--r--test/-ext-/exception/test_data_error.rb14
-rw-r--r--test/-ext-/exception/test_enc_raise.rb16
-rw-r--r--test/-ext-/exception/test_ensured.rb32
-rw-r--r--test/-ext-/exception/test_exception_at_throwing.rb18
-rw-r--r--test/-ext-/file/test_stat.rb15
-rw-r--r--test/-ext-/float/test_nextafter.rb65
-rw-r--r--test/-ext-/funcall/test_passing_block.rb65
-rw-r--r--test/-ext-/gvl/test_last_thread.rb22
-rw-r--r--test/-ext-/gvl/test_ubf_async_safe.rb20
-rw-r--r--test/-ext-/hash/test_delete.rb20
-rw-r--r--test/-ext-/integer/test_integer.rb26
-rw-r--r--test/-ext-/integer/test_my_integer.rb48
-rw-r--r--test/-ext-/iseq_load/test_iseq_load.rb156
-rw-r--r--test/-ext-/iter/test_iter_break.rb16
-rw-r--r--test/-ext-/iter/test_yield_block.rb34
-rw-r--r--test/-ext-/load/script.rb2
-rw-r--r--test/-ext-/load/test_dot_dot.rb3
-rw-r--r--test/-ext-/load/test_protect.rb14
-rw-r--r--test/-ext-/marshal/test_internal_ivar.rb24
-rw-r--r--test/-ext-/marshal/test_usrmarshal.rb33
-rw-r--r--test/-ext-/method/test_arity.rb38
-rw-r--r--test/-ext-/num2int/test_num2int.rb265
-rw-r--r--test/-ext-/path_to_class/test_path_to_class.rb13
-rw-r--r--test/-ext-/popen_deadlock/test_popen_deadlock.rb36
-rw-r--r--test/-ext-/postponed_job/test_postponed_job.rb35
-rw-r--r--test/-ext-/proc/test_bmethod.rb38
-rw-r--r--test/-ext-/rational/test_rat.rb70
-rw-r--r--test/-ext-/st/test_foreach.rb16
-rw-r--r--test/-ext-/st/test_numhash.rb50
-rw-r--r--test/-ext-/st/test_update.rb51
-rw-r--r--test/-ext-/string/test_capacity.rb79
-rw-r--r--test/-ext-/string/test_coderange.rb60
-rw-r--r--test/-ext-/string/test_cstr.rb168
-rw-r--r--test/-ext-/string/test_ellipsize.rb47
-rw-r--r--test/-ext-/string/test_enc_associate.rb24
-rw-r--r--test/-ext-/string/test_enc_str_buf_cat.rb25
-rw-r--r--test/-ext-/string/test_external_new.rb17
-rw-r--r--test/-ext-/string/test_fstring.rb68
-rw-r--r--test/-ext-/string/test_interned_str.rb12
-rw-r--r--test/-ext-/string/test_modify_expand.rb26
-rw-r--r--test/-ext-/string/test_nofree.rb13
-rw-r--r--test/-ext-/string/test_normalize.rb110
-rw-r--r--test/-ext-/string/test_qsort.rb20
-rw-r--r--test/-ext-/string/test_rb_str_dup.rb18
-rw-r--r--test/-ext-/string/test_set_len.rb51
-rw-r--r--test/-ext-/struct/test_duplicate.rb22
-rw-r--r--test/-ext-/struct/test_len.rb10
-rw-r--r--test/-ext-/struct/test_member.rb14
-rw-r--r--test/-ext-/symbol/noninterned_name.rb17
-rw-r--r--test/-ext-/symbol/test_inadvertent_creation.rb493
-rw-r--r--test/-ext-/symbol/test_type.rb138
-rw-r--r--test/-ext-/test_abi.rb47
-rw-r--r--test/-ext-/test_add_suffix.rb47
-rw-r--r--test/-ext-/test_bug-14834.rb12
-rw-r--r--test/-ext-/test_bug-3571.rb4
-rw-r--r--test/-ext-/test_bug-3662.rb10
-rw-r--r--test/-ext-/test_bug-5832.rb22
-rw-r--r--test/-ext-/test_enumerator_kw.rb11
-rw-r--r--test/-ext-/test_notimplement.rb44
-rw-r--r--test/-ext-/test_printf.rb184
-rw-r--r--test/-ext-/test_random.rb45
-rw-r--r--test/-ext-/test_recursion.rb36
-rw-r--r--test/-ext-/test_scan_args.rb259
-rw-r--r--test/-ext-/thread/test_instrumentation_api.rb91
-rw-r--r--test/-ext-/thread_fd/test_thread_fd_close.rb24
-rw-r--r--test/-ext-/time/test_new.rb44
-rw-r--r--test/-ext-/tracepoint/test_tracepoint.rb88
-rw-r--r--test/-ext-/typeddata/test_typeddata.rb29
-rw-r--r--test/-ext-/vm/test_at_exit.rb19
-rw-r--r--test/-ext-/wait/test_wait.rb36
-rw-r--r--test/-ext-/win32/test_console_attr.rb55
-rw-r--r--test/-ext-/win32/test_dln.rb39
-rw-r--r--test/-ext-/win32/test_fd_setsize.rb25
-rw-r--r--test/base64/test_base64.rb16
-rw-r--r--test/benchmark/test_benchmark.rb167
-rw-r--r--test/bigdecimal/helper.rb39
-rw-r--r--test/bigdecimal/test_bigdecimal.rb1913
-rw-r--r--test/bigdecimal/test_bigdecimal_util.rb141
-rw-r--r--test/bigdecimal/test_bigmath.rb37
-rw-r--r--test/bigdecimal/test_ractor.rb23
-rw-r--r--test/bigdecimal/testbase.rb20
-rw-r--r--test/cgi/test_cgi_cookie.rb121
-rw-r--r--test/cgi/test_cgi_core.rb168
-rw-r--r--test/cgi/test_cgi_header.rb97
-rw-r--r--test/cgi/test_cgi_modruby.rb18
-rw-r--r--test/cgi/test_cgi_multipart.rb141
-rw-r--r--test/cgi/test_cgi_session.rb60
-rw-r--r--test/cgi/test_cgi_tag_helper.rb36
-rw-r--r--test/cgi/test_cgi_util.rb273
-rw-r--r--test/cgi/update_env.rb9
-rw-r--r--test/coverage/autostart.rb2
-rw-r--r--test/coverage/main.rb1
-rw-r--r--test/coverage/test_coverage.rb985
-rw-r--r--test/csv/base.rb8
-rw-r--r--test/csv/helper.rb42
-rw-r--r--test/csv/interface/test_delegation.rb47
-rw-r--r--test/csv/interface/test_read.rb381
-rw-r--r--test/csv/interface/test_read_write.rb124
-rw-r--r--test/csv/interface/test_write.rb217
-rw-r--r--test/csv/parse/test_column_separator.rb40
-rw-r--r--test/csv/parse/test_convert.rb165
-rw-r--r--test/csv/parse/test_each.rb23
-rw-r--r--test/csv/parse/test_general.rb341
-rw-r--r--test/csv/parse/test_header.rb342
-rw-r--r--test/csv/parse/test_inputs_scanner.rb63
-rw-r--r--test/csv/parse/test_invalid.rb52
-rw-r--r--test/csv/parse/test_liberal_parsing.rb171
-rw-r--r--test/csv/parse/test_quote_char_nil.rb93
-rw-r--r--test/csv/parse/test_read.rb27
-rw-r--r--test/csv/parse/test_rewind.rb40
-rw-r--r--test/csv/parse/test_row_separator.rb16
-rw-r--r--test/csv/parse/test_skip_lines.rb118
-rw-r--r--test/csv/parse/test_strip.rb112
-rw-r--r--test/csv/parse/test_unconverted_fields.rb117
-rwxr-xr-xtest/csv/test_csv_parsing.rb221
-rwxr-xr-xtest/csv/test_csv_writing.rb97
-rw-r--r--[-rwxr-xr-x]test/csv/test_data_converters.rb285
-rw-r--r--[-rwxr-xr-x]test/csv/test_encodings.rb238
-rw-r--r--[-rwxr-xr-x]test/csv/test_features.rb240
-rwxr-xr-xtest/csv/test_headers.rb289
-rwxr-xr-xtest/csv/test_interface.rb311
-rw-r--r--test/csv/test_patterns.rb27
-rw-r--r--[-rwxr-xr-x]test/csv/test_row.rb190
-rwxr-xr-xtest/csv/test_serialization.rb155
-rw-r--r--[-rwxr-xr-x]test/csv/test_table.rb387
-rw-r--r--test/csv/ts_all.rb21
-rw-r--r--test/csv/write/test_converters.rb53
-rw-r--r--test/csv/write/test_force_quotes.rb78
-rw-r--r--test/csv/write/test_general.rb246
-rw-r--r--test/csv/write/test_quote_empty.rb70
-rw-r--r--test/date/test_date.rb71
-rw-r--r--test/date/test_date_arith.rb60
-rw-r--r--test/date/test_date_attr.rb30
-rw-r--r--test/date/test_date_base.rb436
-rw-r--r--test/date/test_date_compat.rb1
-rw-r--r--test/date/test_date_conv.rb61
-rw-r--r--test/date/test_date_marshal.rb30
-rw-r--r--test/date/test_date_new.rb124
-rw-r--r--test/date/test_date_parse.rb1153
-rw-r--r--test/date/test_date_ractor.rb27
-rw-r--r--test/date/test_date_strftime.rb63
-rw-r--r--test/date/test_date_strptime.rb232
-rw-r--r--test/date/test_switch_hitter.rb637
-rw-r--r--test/dbm/test_dbm.rb559
-rw-r--r--test/did_you_mean/core_ext/test_name_error_extension.rb55
-rw-r--r--test/did_you_mean/edit_distance/test_jaro_winkler.rb36
-rw-r--r--test/did_you_mean/fixtures/book.rb4
-rw-r--r--test/did_you_mean/fixtures/mini_dir.yml15
-rw-r--r--test/did_you_mean/fixtures/rspec_dir.yml112
-rw-r--r--test/did_you_mean/helper.rb43
-rw-r--r--test/did_you_mean/spell_checking/test_class_name_check.rb81
-rw-r--r--test/did_you_mean/spell_checking/test_key_name_check.rb54
-rw-r--r--test/did_you_mean/spell_checking/test_method_name_check.rb165
-rw-r--r--test/did_you_mean/spell_checking/test_pattern_key_name_check.rb20
-rw-r--r--test/did_you_mean/spell_checking/test_require_path_check.rb32
-rw-r--r--test/did_you_mean/spell_checking/test_uncorrectable_name_check.rb15
-rw-r--r--test/did_you_mean/spell_checking/test_variable_name_check.rb152
-rw-r--r--test/did_you_mean/test_ractor_compatibility.rb117
-rw-r--r--test/did_you_mean/test_spell_checker.rb78
-rw-r--r--test/did_you_mean/test_tree_spell_checker.rb170
-rw-r--r--test/did_you_mean/tree_spell/change_word.rb61
-rw-r--r--test/did_you_mean/tree_spell/human_typo.rb69
-rw-r--r--test/did_you_mean/tree_spell/test_change_word.rb38
-rw-r--r--test/did_you_mean/tree_spell/test_human_typo.rb24
-rw-r--r--test/digest/digest/foo.rb11
-rw-r--r--[-rwxr-xr-x]test/digest/test_digest.rb159
-rw-r--r--test/digest/test_digest_extend.rb19
-rw-r--r--test/digest/test_digest_hmac.rb2
-rw-r--r--test/digest/test_ractor.rb97
-rw-r--r--test/dl/test_base.rb130
-rw-r--r--test/dl/test_callback.rb69
-rw-r--r--test/dl/test_cfunc.rb80
-rw-r--r--test/dl/test_cparser.rb13
-rw-r--r--test/dl/test_cptr.rb216
-rw-r--r--test/dl/test_dl2.rb154
-rw-r--r--test/dl/test_func.rb108
-rw-r--r--test/dl/test_handle.rb174
-rw-r--r--test/dl/test_import.rb164
-rw-r--r--test/dl/test_win32.rb54
-rw-r--r--test/drb/drbtest.rb201
-rw-r--r--test/drb/ignore_test_drb.rb20
-rw-r--r--test/drb/test_acl.rb106
-rw-r--r--test/drb/test_drb.rb236
-rw-r--r--test/drb/test_drbobject.rb69
-rw-r--r--test/drb/test_drbssl.rb62
-rw-r--r--test/drb/test_drbunix.rb26
-rw-r--r--test/drb/ut_array.rb4
-rw-r--r--test/drb/ut_array_drbssl.rb17
-rw-r--r--test/drb/ut_array_drbunix.rb2
-rw-r--r--test/drb/ut_drb.rb33
-rw-r--r--test/drb/ut_drb_drbssl.rb19
-rw-r--r--test/drb/ut_drb_drbunix.rb4
-rw-r--r--test/drb/ut_eq.rb37
-rw-r--r--test/drb/ut_eval.rb31
-rw-r--r--test/drb/ut_large.rb34
-rw-r--r--test/drb/ut_port.rb2
-rw-r--r--test/drb/ut_safe1.rb2
-rw-r--r--test/drb/ut_timerholder.rb107
-rw-r--r--test/dtrace/dummy.rb2
-rw-r--r--test/dtrace/helper.rb165
-rw-r--r--test/dtrace/test_array_create.rb36
-rw-r--r--test/dtrace/test_cmethod.rb50
-rw-r--r--test/dtrace/test_function_entry.rb89
-rw-r--r--test/dtrace/test_gc.rb27
-rw-r--r--test/dtrace/test_hash_create.rb53
-rw-r--r--test/dtrace/test_load.rb53
-rw-r--r--test/dtrace/test_method_cache.rb29
-rw-r--r--test/dtrace/test_object_create_start.rb36
-rw-r--r--test/dtrace/test_raise.rb30
-rw-r--r--test/dtrace/test_require.rb41
-rw-r--r--test/dtrace/test_singleton_function.rb57
-rw-r--r--test/dtrace/test_string.rb28
-rw-r--r--test/erb/test_erb.rb429
-rw-r--r--test/erb/test_erb_command.rb20
-rw-r--r--test/erb/test_erb_m17n.rb5
-rw-r--r--test/error_highlight/test_error_highlight.rb1290
-rw-r--r--test/etc/test_etc.rb133
-rw-r--r--test/excludes/TestArray.rb1
-rw-r--r--test/excludes/TestException.rb8
-rw-r--r--test/excludes/TestGem.rb4
-rw-r--r--test/excludes/TestIO_Console.rb2
-rw-r--r--test/excludes/TestISeq.rb1
-rw-r--r--test/excludes/TestThread.rb14
-rw-r--r--test/excludes/TestThreadQueue.rb9
-rw-r--r--test/excludes/_appveyor/TestArray.rb7
-rw-r--r--test/fiber/autoload.rb3
-rw-r--r--test/fiber/http.rb54
-rw-r--r--test/fiber/scheduler.rb363
-rw-r--r--test/fiber/test_address_resolve.rb278
-rw-r--r--test/fiber/test_backtrace.rb22
-rw-r--r--test/fiber/test_enumerator.rb53
-rw-r--r--test/fiber/test_io.rb222
-rw-r--r--test/fiber/test_io_buffer.rb158
-rw-r--r--test/fiber/test_mutex.rb240
-rw-r--r--test/fiber/test_process.rb72
-rw-r--r--test/fiber/test_queue.rb54
-rw-r--r--test/fiber/test_ractor.rb23
-rw-r--r--test/fiber/test_scheduler.rb185
-rw-r--r--test/fiber/test_sleep.rb71
-rw-r--r--test/fiber/test_storage.rb115
-rw-r--r--test/fiber/test_thread.rb130
-rw-r--r--test/fiber/test_timeout.rb51
-rw-r--r--test/fiddle/helper.rb125
-rw-r--r--test/fiddle/test_c_struct_builder.rb69
-rw-r--r--test/fiddle/test_c_struct_entry.rb165
-rw-r--r--test/fiddle/test_c_union_entity.rb36
-rw-r--r--test/fiddle/test_closure.rb123
-rw-r--r--test/fiddle/test_cparser.rb374
-rw-r--r--test/fiddle/test_fiddle.rb61
-rw-r--r--test/fiddle/test_func.rb149
-rw-r--r--test/fiddle/test_function.rb203
-rw-r--r--test/fiddle/test_handle.rb215
-rw-r--r--test/fiddle/test_import.rb490
-rw-r--r--test/fiddle/test_memory_view.rb143
-rw-r--r--test/fiddle/test_pack.rb37
-rw-r--r--test/fiddle/test_pinned.rb28
-rw-r--r--test/fiddle/test_pointer.rb290
-rw-r--r--test/fileutils/clobber.rb89
-rw-r--r--test/fileutils/fileasserts.rb142
-rw-r--r--test/fileutils/test_dryrun.rb21
-rw-r--r--test/fileutils/test_fileutils.rb1005
-rw-r--r--test/fileutils/test_nowrite.rb91
-rw-r--r--test/fileutils/test_verbose.rb19
-rw-r--r--test/fileutils/visibility_tests.rb39
-rw-r--r--test/fixtures/fake_sorted_set_gem/sorted_set.rb9
-rw-r--r--test/gdbm/test_gdbm.rb715
-rw-r--r--test/iconv/test_basic.rb59
-rw-r--r--test/iconv/test_option.rb43
-rw-r--r--test/iconv/test_partial.rb41
-rw-r--r--test/iconv/utils.rb29
-rw-r--r--test/inlinetest.rb55
-rw-r--r--test/io/console/test_io_console.rb495
-rw-r--r--test/io/nonblock/test_flush.rb38
-rw-r--r--test/io/wait/test_io_wait.rb207
-rw-r--r--test/io/wait/test_io_wait_uncommon.rb77
-rw-r--r--test/io/wait/test_ractor.rb17
-rw-r--r--test/irb/helper.rb76
-rw-r--r--test/irb/test_cmd.rb692
-rw-r--r--test/irb/test_color.rb291
-rw-r--r--test/irb/test_color_printer.rb69
-rw-r--r--test/irb/test_completion.rb363
-rw-r--r--test/irb/test_context.rb643
-rw-r--r--test/irb/test_debug_cmd.rb303
-rw-r--r--test/irb/test_history.rb209
-rw-r--r--test/irb/test_init.rb177
-rw-r--r--test/irb/test_input_method.rb79
-rw-r--r--test/irb/test_option.rb9
-rw-r--r--test/irb/test_raise_no_backtrace_exception.rb56
-rw-r--r--test/irb/test_ruby_lex.rb725
-rw-r--r--test/irb/test_workspace.rb129
-rw-r--r--test/irb/yamatanooroti/test_rendering.rb249
-rw-r--r--test/json/fixtures/fail1.json1
-rw-r--r--test/json/fixtures/fail18.json2
-rw-r--r--test/json/fixtures/fail29.json1
-rw-r--r--test/json/fixtures/fail30.json1
-rw-r--r--test/json/fixtures/fail31.json1
-rw-r--r--test/json/fixtures/fail32.json1
-rw-r--r--test/json/fixtures/obsolete_fail1.json1
-rw-r--r--test/json/json_addition_test.rb199
-rw-r--r--test/json/json_common_interface_test.rb169
-rw-r--r--test/json/json_encoding_test.rb107
-rw-r--r--test/json/json_ext_parser_test.rb15
-rw-r--r--test/json/json_fixtures_test.rb40
-rw-r--r--test/json/json_generator_test.rb399
-rw-r--r--test/json/json_generic_object_test.rb82
-rw-r--r--test/json/json_parser_test.rb502
-rw-r--r--test/json/json_string_matching_test.rb38
-rw-r--r--test/json/ractor_test.rb30
-rw-r--r--test/json/test_helper.rb17
-rwxr-xr-xtest/json/test_json.rb394
-rwxr-xr-xtest/json/test_json_addition.rb162
-rw-r--r--test/json/test_json_encoding.rb69
-rwxr-xr-xtest/json/test_json_fixtures.rb34
-rwxr-xr-xtest/json/test_json_generate.rb183
-rwxr-xr-xtest/json/test_json_unicode.rb76
-rw-r--r--test/lib/jit_support.rb98
-rw-r--r--test/lib/with_different_ofs.rb22
-rw-r--r--test/logger/test_formatter.rb35
-rw-r--r--test/logger/test_logdevice.rb859
-rw-r--r--test/logger/test_logger.rb442
-rw-r--r--test/logger/test_logperiod.rb80
-rw-r--r--test/logger/test_severity.rb26
-rw-r--r--test/matrix/test_matrix.rb427
-rw-r--r--test/matrix/test_vector.rb134
-rw-r--r--test/minitest/test_minitest_benchmark.rb104
-rw-r--r--test/minitest/test_minitest_mock.rb112
-rw-r--r--test/minitest/test_minitest_spec.rb235
-rw-r--r--test/minitest/test_minitest_unit.rb1104
-rw-r--r--test/mkmf/base.rb230
-rw-r--r--test/mkmf/test_config.rb15
-rw-r--r--test/mkmf/test_constant.rb44
-rw-r--r--test/mkmf/test_convertible.rb47
-rw-r--r--test/mkmf/test_egrep_cpp.rb13
-rw-r--r--test/mkmf/test_find_executable.rb71
-rw-r--r--test/mkmf/test_flags.rb78
-rw-r--r--test/mkmf/test_framework.rb47
-rw-r--r--test/mkmf/test_have_func.rb15
-rw-r--r--test/mkmf/test_have_library.rb54
-rw-r--r--test/mkmf/test_have_macro.rb34
-rw-r--r--test/mkmf/test_install.rb28
-rw-r--r--test/mkmf/test_libs.rb92
-rw-r--r--test/mkmf/test_mkmf.rb13
-rw-r--r--test/mkmf/test_pkg_config.rb66
-rw-r--r--test/mkmf/test_signedness.rb37
-rw-r--r--test/mkmf/test_sizeof.rb73
-rw-r--r--test/monitor/test_monitor.rb291
-rw-r--r--test/net/fixtures/Makefile15
-rw-r--r--test/net/fixtures/cacert.pem24
-rw-r--r--test/net/fixtures/dhparams.pem29
-rw-r--r--test/net/fixtures/server.crt21
-rw-r--r--test/net/fixtures/server.key27
-rw-r--r--test/net/http/test_buffered_io.rb1
-rw-r--r--test/net/http/test_http.rb1028
-rw-r--r--test/net/http/test_http_request.rb93
-rw-r--r--test/net/http/test_httpheader.rb162
-rw-r--r--test/net/http/test_httpresponse.rb726
-rw-r--r--test/net/http/test_httpresponses.rb25
-rw-r--r--test/net/http/test_https.rb277
-rw-r--r--test/net/http/test_https_proxy.rb38
-rw-r--r--test/net/http/utils.rb60
-rw-r--r--test/net/imap/cacert.pem60
-rw-r--r--test/net/imap/server.crt61
-rw-r--r--test/net/imap/server.key15
-rw-r--r--test/net/imap/test_imap.rb450
-rw-r--r--test/net/imap/test_imap_response_parser.rb75
-rw-r--r--test/net/pop/test_pop.rb132
-rw-r--r--test/net/protocol/test_protocol.rb159
-rw-r--r--test/net/smtp/test_response.rb99
-rw-r--r--test/net/smtp/test_smtp.rb16
-rw-r--r--test/net/smtp/test_ssl_socket.rb91
-rw-r--r--test/nkf/test_kconv.rb9
-rw-r--r--test/nkf/test_nkf.rb1
-rw-r--r--test/objspace/test_objspace.rb816
-rw-r--r--test/objspace/test_ractor.rb17
-rw-r--r--test/open-uri/test_open-uri.rb694
-rw-r--r--test/open-uri/test_ssl.rb594
-rw-r--r--test/openssl/fixtures/pkey/certificate.derbin0 -> 1325 bytes-rw-r--r--test/openssl/fixtures/pkey/dh-1.pem13
-rw-r--r--test/openssl/fixtures/pkey/dh1024.pem5
-rw-r--r--test/openssl/fixtures/pkey/dsa1024.pem12
-rw-r--r--test/openssl/fixtures/pkey/dsa256.pem8
-rw-r--r--test/openssl/fixtures/pkey/dsa512.pem8
-rw-r--r--test/openssl/fixtures/pkey/empty.der0
-rw-r--r--test/openssl/fixtures/pkey/empty.pem0
-rw-r--r--test/openssl/fixtures/pkey/fullchain.pem56
-rw-r--r--test/openssl/fixtures/pkey/garbage.txt1
-rw-r--r--test/openssl/fixtures/pkey/p256.pem5
-rw-r--r--test/openssl/fixtures/pkey/p256_too_large.pem5
-rw-r--r--test/openssl/fixtures/pkey/p384_invalid.pem6
-rw-r--r--test/openssl/fixtures/pkey/rsa-1.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa-2.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa-3.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa1024.pem15
-rw-r--r--test/openssl/fixtures/pkey/rsa2048.pem27
-rw-r--r--test/openssl/ssl_server.rb81
-rw-r--r--test/openssl/test_asn1.rb694
-rw-r--r--test/openssl/test_bn.rb367
-rw-r--r--test/openssl/test_buffering.rb97
-rw-r--r--test/openssl/test_cipher.rb402
-rw-r--r--test/openssl/test_config.rb231
-rw-r--r--test/openssl/test_digest.rb146
-rw-r--r--test/openssl/test_ec.rb123
-rw-r--r--test/openssl/test_engine.rb97
-rw-r--r--test/openssl/test_fips.rb30
-rw-r--r--test/openssl/test_hmac.rb85
-rw-r--r--test/openssl/test_kdf.rb183
-rw-r--r--test/openssl/test_ns_spki.rb13
-rw-r--r--test/openssl/test_ocsp.rb301
-rw-r--r--test/openssl/test_ossl.rb65
-rw-r--r--test/openssl/test_pair.rb498
-rw-r--r--test/openssl/test_pkcs12.rb267
-rw-r--r--test/openssl/test_pkcs7.rb218
-rw-r--r--test/openssl/test_pkey.rb177
-rw-r--r--test/openssl/test_pkey_dh.rb166
-rw-r--r--test/openssl/test_pkey_dsa.rb251
-rw-r--r--test/openssl/test_pkey_ec.rb474
-rw-r--r--test/openssl/test_pkey_rsa.rb533
-rw-r--r--test/openssl/test_random.rb19
-rw-r--r--test/openssl/test_ssl.rb2191
-rw-r--r--test/openssl/test_ssl_session.rb393
-rw-r--r--test/openssl/test_ts.rb680
-rw-r--r--test/openssl/test_x509attr.rb94
-rw-r--r--test/openssl/test_x509cert.rb303
-rw-r--r--test/openssl/test_x509crl.rb145
-rw-r--r--test/openssl/test_x509ext.rb61
-rw-r--r--test/openssl/test_x509name.rb251
-rw-r--r--test/openssl/test_x509req.rb81
-rw-r--r--test/openssl/test_x509store.rb436
-rw-r--r--test/openssl/ut_eof.rb137
-rw-r--r--test/openssl/utils.rb385
-rw-r--r--test/optparse/test_acceptable.rb198
-rw-r--r--test/optparse/test_autoconf.rb69
-rw-r--r--test/optparse/test_bash_completion.rb10
-rw-r--r--test/optparse/test_cclass.rb18
-rw-r--r--test/optparse/test_did_you_mean.rb48
-rw-r--r--test/optparse/test_getopts.rb5
-rw-r--r--test/optparse/test_kwargs.rb38
-rw-r--r--test/optparse/test_load.rb141
-rw-r--r--test/optparse/test_noarg.rb28
-rw-r--r--test/optparse/test_optarg.rb18
-rw-r--r--test/optparse/test_optparse.rb77
-rw-r--r--test/optparse/test_placearg.rb25
-rw-r--r--test/optparse/test_reqarg.rb30
-rw-r--r--test/optparse/test_summary.rb62
-rw-r--r--test/optparse/test_zsh_completion.rb5
-rw-r--r--test/ostruct/test_ostruct.rb361
-rw-r--r--test/pathname/test_pathname.rb470
-rw-r--r--test/pathname/test_ractor.rb22
-rw-r--r--test/profile_test_all.rb52
-rw-r--r--test/psych/handlers/test_recorder.rb26
-rw-r--r--test/psych/helper.rb113
-rw-r--r--test/psych/json/test_stream.rb51
-rw-r--r--test/psych/nodes/test_enumerable.rb44
-rw-r--r--test/psych/test_alias_and_anchor.rb75
-rw-r--r--test/psych/test_array.rb61
-rw-r--r--test/psych/test_boolean.rb1
-rw-r--r--test/psych/test_class.rb32
-rw-r--r--test/psych/test_coder.rb166
-rw-r--r--test/psych/test_date_time.rb73
-rw-r--r--test/psych/test_deprecated.rb131
-rw-r--r--test/psych/test_document.rb11
-rw-r--r--test/psych/test_emitter.rb34
-rw-r--r--test/psych/test_encoding.rb135
-rw-r--r--test/psych/test_engine_manager.rb57
-rw-r--r--test/psych/test_exception.rb161
-rw-r--r--test/psych/test_hash.rb153
-rw-r--r--test/psych/test_json_tree.rb19
-rw-r--r--test/psych/test_marshalable.rb63
-rw-r--r--test/psych/test_merge_keys.rb191
-rw-r--r--test/psych/test_nil.rb7
-rw-r--r--test/psych/test_null.rb3
-rw-r--r--test/psych/test_numeric.rb58
-rw-r--r--test/psych/test_object.rb29
-rw-r--r--test/psych/test_object_references.rb76
-rw-r--r--test/psych/test_omap.rb10
-rw-r--r--test/psych/test_parser.rb162
-rw-r--r--test/psych/test_psych.rb343
-rw-r--r--test/psych/test_ractor.rb50
-rw-r--r--test/psych/test_safe_load.rb140
-rw-r--r--test/psych/test_scalar.rb6
-rw-r--r--test/psych/test_scalar_scanner.rb167
-rw-r--r--test/psych/test_serialize_subclasses.rb5
-rw-r--r--test/psych/test_set.rb7
-rw-r--r--test/psych/test_stream.rb61
-rw-r--r--test/psych/test_string.rb209
-rw-r--r--test/psych/test_struct.rb13
-rw-r--r--test/psych/test_symbol.rb9
-rw-r--r--test/psych/test_to_yaml_properties.rb63
-rw-r--r--test/psych/test_tree_builder.rb15
-rw-r--r--test/psych/test_yaml.rb89
-rw-r--r--test/psych/test_yaml_special_cases.rb130
-rw-r--r--test/psych/test_yamldbm.rb193
-rw-r--r--test/psych/test_yamlstore.rb101
-rw-r--r--test/psych/visitors/test_depth_first.rb50
-rw-r--r--test/psych/visitors/test_emitter.rb19
-rw-r--r--test/psych/visitors/test_to_ruby.rb38
-rw-r--r--test/psych/visitors/test_yaml_tree.rb73
-rw-r--r--test/racc/assets/cadenza.y170
-rw-r--r--test/racc/assets/cast.y926
-rw-r--r--test/racc/assets/chk.y126
-rw-r--r--test/racc/assets/conf.y16
-rw-r--r--test/racc/assets/csspool.y729
-rw-r--r--test/racc/assets/digraph.y29
-rw-r--r--test/racc/assets/echk.y118
-rw-r--r--test/racc/assets/edtf.y583
-rw-r--r--test/racc/assets/err.y60
-rw-r--r--test/racc/assets/error_recovery.y35
-rw-r--r--test/racc/assets/expect.y7
-rw-r--r--test/racc/assets/firstline.y4
-rw-r--r--test/racc/assets/huia.y318
-rw-r--r--test/racc/assets/ichk.y102
-rw-r--r--test/racc/assets/ifelse.y14
-rw-r--r--test/racc/assets/intp.y546
-rw-r--r--test/racc/assets/journey.y47
-rw-r--r--test/racc/assets/liquor.y313
-rw-r--r--test/racc/assets/machete.y423
-rw-r--r--test/racc/assets/macruby.y2197
-rw-r--r--test/racc/assets/mailp.y437
-rw-r--r--test/racc/assets/mediacloth.y599
-rw-r--r--test/racc/assets/mof.y649
-rw-r--r--test/racc/assets/namae.y302
-rw-r--r--test/racc/assets/nasl.y626
-rw-r--r--test/racc/assets/newsyn.y25
-rw-r--r--test/racc/assets/noend.y4
-rw-r--r--test/racc/assets/nokogiri-css.y255
-rw-r--r--test/racc/assets/nonass.y41
-rw-r--r--test/racc/assets/normal.y27
-rw-r--r--test/racc/assets/norule.y4
-rw-r--r--test/racc/assets/nullbug1.y25
-rw-r--r--test/racc/assets/nullbug2.y15
-rw-r--r--test/racc/assets/opal.y1807
-rw-r--r--test/racc/assets/opt.y123
-rw-r--r--test/racc/assets/percent.y35
-rw-r--r--test/racc/assets/php_serialization.y98
-rw-r--r--test/racc/assets/recv.y97
-rw-r--r--test/racc/assets/riml.y665
-rw-r--r--test/racc/assets/rrconf.y14
-rw-r--r--test/racc/assets/ruby18.y1943
-rw-r--r--test/racc/assets/ruby19.y2174
-rw-r--r--test/racc/assets/ruby20.y2350
-rw-r--r--test/racc/assets/ruby21.y2359
-rw-r--r--test/racc/assets/ruby22.y2381
-rw-r--r--test/racc/assets/scan.y72
-rw-r--r--test/racc/assets/syntax.y50
-rw-r--r--test/racc/assets/tp_plus.y622
-rw-r--r--test/racc/assets/twowaysql.y278
-rw-r--r--test/racc/assets/unterm.y5
-rw-r--r--test/racc/assets/useless.y12
-rw-r--r--test/racc/assets/yyerr.y46
-rw-r--r--test/racc/bench.y36
-rw-r--r--test/racc/case.rb111
-rw-r--r--test/racc/infini.y8
-rw-r--r--test/racc/regress/README.txt7
-rw-r--r--test/racc/regress/cadenza796
-rw-r--r--test/racc/regress/cast3945
-rw-r--r--test/racc/regress/csspool2314
-rw-r--r--test/racc/regress/edtf1794
-rw-r--r--test/racc/regress/huia1681
-rw-r--r--test/racc/regress/journey222
-rw-r--r--test/racc/regress/liquor885
-rw-r--r--test/racc/regress/machete833
-rw-r--r--test/racc/regress/mediacloth1463
-rw-r--r--test/racc/regress/mof1368
-rw-r--r--test/racc/regress/namae634
-rw-r--r--test/racc/regress/nasl2548
-rw-r--r--test/racc/regress/nokogiri-css836
-rw-r--r--test/racc/regress/opal10107
-rw-r--r--test/racc/regress/php_serialization336
-rw-r--r--test/racc/regress/riml4037
-rw-r--r--test/racc/regress/ruby189945
-rw-r--r--test/racc/regress/ruby2211180
-rw-r--r--test/racc/regress/tp_plus1933
-rw-r--r--test/racc/regress/twowaysql556
-rw-r--r--test/racc/scandata/brace7
-rw-r--r--test/racc/scandata/gvar1
-rw-r--r--test/racc/scandata/normal4
-rw-r--r--test/racc/scandata/percent18
-rw-r--r--test/racc/scandata/slash10
-rw-r--r--test/racc/src.intp34
-rw-r--r--test/racc/start.y20
-rw-r--r--test/racc/test_chk_y.rb52
-rw-r--r--test/racc/test_grammar_file_parser.rb15
-rw-r--r--test/racc/test_racc_command.rb339
-rw-r--r--test/racc/test_scan_y.rb52
-rw-r--r--test/racc/testscanner.rb51
-rw-r--r--test/rake/capture_stdout.rb24
-rw-r--r--test/rake/check_expansion.rb5
-rw-r--r--test/rake/check_no_expansion.rb5
-rw-r--r--test/rake/contrib/test_ftp.rb55
-rw-r--r--test/rake/data/chains/Rakefile15
-rw-r--r--test/rake/data/default/Rakefile19
-rw-r--r--test/rake/data/dryrun/Rakefile22
-rw-r--r--test/rake/data/file_creation_task/Rakefile33
-rw-r--r--test/rake/data/imports/Rakefile19
-rw-r--r--test/rake/data/imports/deps.mf1
-rw-r--r--test/rake/data/multidesc/Rakefile17
-rw-r--r--test/rake/data/namespace/Rakefile57
-rw-r--r--test/rake/data/rakelib/test1.rake3
-rw-r--r--test/rake/data/rbext/rakefile.rb3
-rw-r--r--test/rake/data/sample.mf14
-rw-r--r--test/rake/data/statusreturn/Rakefile8
-rw-r--r--test/rake/data/unittest/Rakefile1
-rw-r--r--test/rake/data/unittest/subdir/.gitignore2
-rw-r--r--test/rake/filecreation.rb30
-rw-r--r--test/rake/in_environment.rb30
-rw-r--r--test/rake/rake_test_setup.rb9
-rw-r--r--test/rake/reqfile.rb3
-rw-r--r--test/rake/reqfile2.rb3
-rw-r--r--test/rake/reqfile3.rb3
-rwxr-xr-xtest/rake/shellcommand.rb3
-rw-r--r--test/rake/test_application.rb687
-rw-r--r--test/rake/test_clean.rb12
-rw-r--r--test/rake/test_definitions.rb81
-rw-r--r--test/rake/test_earlytime.rb33
-rw-r--r--test/rake/test_extension.rb61
-rw-r--r--test/rake/test_file_creation_task.rb60
-rw-r--r--test/rake/test_file_task.rb139
-rw-r--r--test/rake/test_filelist.rb625
-rw-r--r--test/rake/test_fileutils.rb262
-rw-r--r--test/rake/test_invocation_chain.rb75
-rw-r--r--test/rake/test_makefile_loader.rb24
-rw-r--r--test/rake/test_multitask.rb43
-rw-r--r--test/rake/test_namespace.rb44
-rw-r--r--test/rake/test_package_task.rb115
-rw-r--r--test/rake/test_pathmap.rb207
-rw-r--r--test/rake/test_pseudo_status.rb23
-rw-r--r--test/rake/test_rake.rb39
-rw-r--r--test/rake/test_require.rb32
-rw-r--r--test/rake/test_rules.rb352
-rw-r--r--test/rake/test_task_arguments.rb92
-rw-r--r--test/rake/test_task_manager.rb181
-rw-r--r--test/rake/test_tasklib.rb10
-rw-r--r--test/rake/test_tasks.rb370
-rw-r--r--test/rake/test_test_task.rb81
-rw-r--r--test/rake/test_top_level_functions.rb91
-rw-r--r--test/rake/test_win32.rb45
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Amps and angle encoding.text21
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Auto links.text13
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Backslash escapes.text120
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Blockquotes with code blocks.text11
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Code Blocks.text14
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Code Spans.text6
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Hard-wrapped paragraphs with list-like lines.text8
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Horizontal rules.text67
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML (Advanced).text15
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML (Simple).text69
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML comments.text13
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, inline style.text12
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, reference style.text71
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, shortcut references.text20
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Literal quotes in titles.text7
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Basics.text306
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Syntax.text888
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Nested blockquotes.text5
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Ordered and unordered lists.text131
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Strong and em together.text7
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Tabs.text21
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Tidyness.text5
-rw-r--r--test/rdoc/helper.rb5
-rw-r--r--test/rdoc/support/formatter_test_case.rb764
-rw-r--r--test/rdoc/support/test_case.rb217
-rw-r--r--test/rdoc/support/text_formatter_test_case.rb115
-rw-r--r--test/rdoc/test.ja.largedoc (renamed from test/rdoc/test.ja.large.rdoc)0
-rw-r--r--test/rdoc/test_attribute_manager.rb120
-rw-r--r--test/rdoc/test_rdoc_alias.rb4
-rw-r--r--test/rdoc/test_rdoc_any_method.rb519
-rw-r--r--test/rdoc/test_rdoc_attr.rb139
-rw-r--r--test/rdoc/test_rdoc_class_module.rb1370
-rw-r--r--test/rdoc/test_rdoc_code_object.rb307
-rw-r--r--test/rdoc/test_rdoc_comment.rb497
-rw-r--r--test/rdoc/test_rdoc_constant.rb169
-rw-r--r--test/rdoc/test_rdoc_context.rb635
-rw-r--r--test/rdoc/test_rdoc_context_section.rb147
-rw-r--r--test/rdoc/test_rdoc_cross_reference.rb219
-rw-r--r--test/rdoc/test_rdoc_encoding.rb158
-rw-r--r--test/rdoc/test_rdoc_extend.rb94
-rw-r--r--test/rdoc/test_rdoc_generator_darkfish.rb319
-rw-r--r--test/rdoc/test_rdoc_generator_json_index.rb361
-rw-r--r--test/rdoc/test_rdoc_generator_markup.rb60
-rw-r--r--test/rdoc/test_rdoc_generator_pot.rb92
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po.rb52
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po_entry.rb140
-rw-r--r--test/rdoc/test_rdoc_generator_ri.rb62
-rw-r--r--test/rdoc/test_rdoc_i18n_locale.rb74
-rw-r--r--test/rdoc/test_rdoc_i18n_text.rb124
-rw-r--r--test/rdoc/test_rdoc_include.rb27
-rw-r--r--test/rdoc/test_rdoc_markdown.rb1090
-rw-r--r--test/rdoc/test_rdoc_markdown_test.rb1883
-rw-r--r--test/rdoc/test_rdoc_markup.rb71
-rw-r--r--test/rdoc/test_rdoc_markup_attribute_manager.rb198
-rw-r--r--test/rdoc/test_rdoc_markup_attributes.rb40
-rw-r--r--test/rdoc/test_rdoc_markup_document.rb185
-rw-r--r--test/rdoc/test_rdoc_markup_formatter.rb175
-rw-r--r--test/rdoc/test_rdoc_markup_hard_break.rb32
-rw-r--r--test/rdoc/test_rdoc_markup_heading.rb30
-rw-r--r--test/rdoc/test_rdoc_markup_include.rb20
-rw-r--r--test/rdoc/test_rdoc_markup_indented_paragraph.rb54
-rw-r--r--test/rdoc/test_rdoc_markup_paragraph.rb34
-rw-r--r--test/rdoc/test_rdoc_markup_parser.rb495
-rw-r--r--test/rdoc/test_rdoc_markup_pre_process.rb444
-rw-r--r--test/rdoc/test_rdoc_markup_raw.rb22
-rw-r--r--test/rdoc/test_rdoc_markup_to_ansi.rb54
-rw-r--r--test/rdoc/test_rdoc_markup_to_bs.rb49
-rw-r--r--test/rdoc/test_rdoc_markup_to_html.rb721
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_crossref.rb305
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_snippet.rb709
-rw-r--r--test/rdoc/test_rdoc_markup_to_joined_paragraph.rb33
-rw-r--r--test/rdoc/test_rdoc_markup_to_label.rb113
-rw-r--r--test/rdoc/test_rdoc_markup_to_markdown.rb390
-rw-r--r--test/rdoc/test_rdoc_markup_to_rdoc.rb63
-rw-r--r--test/rdoc/test_rdoc_markup_to_table_of_contents.rb127
-rw-r--r--test/rdoc/test_rdoc_markup_to_tt_only.rb247
-rw-r--r--test/rdoc/test_rdoc_markup_verbatim.rb30
-rw-r--r--test/rdoc/test_rdoc_method_attr.rb79
-rw-r--r--test/rdoc/test_rdoc_normal_class.rb44
-rw-r--r--test/rdoc/test_rdoc_normal_module.rb17
-rw-r--r--test/rdoc/test_rdoc_options.rb651
-rw-r--r--test/rdoc/test_rdoc_parser.rb266
-rw-r--r--test/rdoc/test_rdoc_parser_c.rb1461
-rw-r--r--test/rdoc/test_rdoc_parser_changelog.rb485
-rw-r--r--test/rdoc/test_rdoc_parser_markdown.rb62
-rw-r--r--test/rdoc/test_rdoc_parser_rd.rb56
-rw-r--r--test/rdoc/test_rdoc_parser_ruby.rb3341
-rw-r--r--test/rdoc/test_rdoc_parser_simple.rb57
-rw-r--r--test/rdoc/test_rdoc_rd.rb31
-rw-r--r--test/rdoc/test_rdoc_rd_block_parser.rb557
-rw-r--r--test/rdoc/test_rdoc_rd_inline.rb64
-rw-r--r--test/rdoc/test_rdoc_rd_inline_parser.rb178
-rw-r--r--test/rdoc/test_rdoc_rdoc.rb521
-rw-r--r--test/rdoc/test_rdoc_require.rb10
-rw-r--r--test/rdoc/test_rdoc_ri_driver.rb1053
-rw-r--r--test/rdoc/test_rdoc_ri_paths.rb153
-rw-r--r--test/rdoc/test_rdoc_ri_store.rb352
-rw-r--r--test/rdoc/test_rdoc_ruby_lex.rb23
-rw-r--r--test/rdoc/test_rdoc_rubygems_hook.rb287
-rw-r--r--test/rdoc/test_rdoc_servlet.rb555
-rw-r--r--test/rdoc/test_rdoc_single_class.rb21
-rw-r--r--test/rdoc/test_rdoc_stats.rb715
-rw-r--r--test/rdoc/test_rdoc_store.rb1012
-rw-r--r--test/rdoc/test_rdoc_task.rb113
-rw-r--r--test/rdoc/test_rdoc_text.rb370
-rw-r--r--test/rdoc/test_rdoc_token_stream.rb58
-rw-r--r--test/rdoc/test_rdoc_tom_doc.rb579
-rw-r--r--test/rdoc/test_rdoc_top_level.rb274
-rw-r--r--test/rdoc/xref_data.rb90
-rw-r--r--test/rdoc/xref_test_case.rb73
-rw-r--r--test/readline/helper.rb29
-rw-r--r--test/readline/test_readline.rb977
-rw-r--r--test/readline/test_readline_history.rb241
-rw-r--r--test/reline/helper.rb125
-rw-r--r--test/reline/test_config.rb412
-rw-r--r--test/reline/test_history.rb308
-rw-r--r--test/reline/test_key_actor_emacs.rb2354
-rw-r--r--test/reline/test_key_actor_vi.rb1465
-rw-r--r--test/reline/test_key_stroke.rb79
-rw-r--r--test/reline/test_kill_ring.rb268
-rw-r--r--test/reline/test_macro.rb41
-rw-r--r--test/reline/test_reline.rb386
-rw-r--r--test/reline/test_reline_key.rb53
-rw-r--r--test/reline/test_string_processing.rb81
-rw-r--r--test/reline/test_terminfo.rb61
-rw-r--r--test/reline/test_unicode.rb25
-rw-r--r--test/reline/test_within_pipe.rb78
-rw-r--r--test/reline/windows/test_key_event_record.rb41
-rwxr-xr-xtest/reline/yamatanooroti/multiline_repl215
-rw-r--r--test/reline/yamatanooroti/termination_checker.rb30
-rw-r--r--test/reline/yamatanooroti/test_rendering.rb1345
-rw-r--r--test/resolv/test_addr.rb51
-rw-r--r--test/resolv/test_dns.rb473
-rw-r--r--test/resolv/test_mdns.rb27
-rw-r--r--test/resolv/test_resource.rb26
-rw-r--r--test/rexml/data/LostineRiver.kml.gzbin50154 -> 0 bytes-rw-r--r--test/rexml/data/ProductionSupport.xml29
-rw-r--r--test/rexml/data/axis.xml25
-rw-r--r--test/rexml/data/bad.xml5
-rw-r--r--test/rexml/data/basic.xml11
-rw-r--r--test/rexml/data/basicupdate.xml47
-rw-r--r--test/rexml/data/broken.rss20
-rw-r--r--test/rexml/data/contents.xml70
-rw-r--r--test/rexml/data/dash.xml12
-rw-r--r--test/rexml/data/defaultNamespace.xml6
-rw-r--r--test/rexml/data/doctype_test.xml34
-rw-r--r--test/rexml/data/documentation.xml542
-rw-r--r--test/rexml/data/euc.xml296
-rw-r--r--test/rexml/data/evaluate.xml28
-rw-r--r--test/rexml/data/fibo.xml29
-rw-r--r--test/rexml/data/foo.xml10
-rw-r--r--test/rexml/data/google.2.xml156
-rw-r--r--test/rexml/data/id.xml21
-rw-r--r--test/rexml/data/iso8859-1.xml4
-rw-r--r--test/rexml/data/jaxen24.xml2
-rw-r--r--test/rexml/data/jaxen3.xml15
-rw-r--r--test/rexml/data/lang.xml11
-rw-r--r--test/rexml/data/lang0.xml18
-rw-r--r--test/rexml/data/message.xml27
-rw-r--r--test/rexml/data/moreover.xml244
-rw-r--r--test/rexml/data/much_ado.xml6850
-rw-r--r--test/rexml/data/namespaces.xml18
-rw-r--r--test/rexml/data/nitf.xml67
-rw-r--r--test/rexml/data/numbers.xml18
-rw-r--r--test/rexml/data/ofbiz-issues-full-177.xml13971
-rw-r--r--test/rexml/data/pi.xml13
-rw-r--r--test/rexml/data/pi2.xml6
-rw-r--r--test/rexml/data/project.xml1
-rw-r--r--test/rexml/data/simple.xml2
-rw-r--r--test/rexml/data/stream_accents.xml4
-rw-r--r--test/rexml/data/t63-1.xmlbin161690 -> 0 bytes-rw-r--r--test/rexml/data/t63-2.svg2828
-rw-r--r--test/rexml/data/t75.xml31
-rw-r--r--test/rexml/data/test/tests.xml683
-rw-r--r--test/rexml/data/test/tests.xsl369
-rw-r--r--test/rexml/data/testNamespaces.xml22
-rw-r--r--test/rexml/data/testsrc.xml64
-rw-r--r--test/rexml/data/text.xml10
-rw-r--r--test/rexml/data/ticket_110_utf16.xmlbin207464 -> 0 bytes-rw-r--r--test/rexml/data/ticket_61.xml4
-rw-r--r--test/rexml/data/ticket_68.xml590
-rw-r--r--test/rexml/data/tutorial.xml678
-rw-r--r--test/rexml/data/underscore.xml6
-rw-r--r--test/rexml/data/web.xml42
-rw-r--r--test/rexml/data/web2.xml7
-rw-r--r--test/rexml/data/working.rss202
-rw-r--r--test/rexml/data/xmlfile-bug.xml15
-rw-r--r--test/rexml/data/xp.tst27
-rw-r--r--test/rexml/data/yahoo.xml80
-rw-r--r--test/rexml/listener.rb50
-rw-r--r--test/rexml/rexml_test_utils.rb5
-rw-r--r--test/rexml/test_attributes.rb198
-rw-r--r--test/rexml/test_attributes_mixin.rb32
-rw-r--r--test/rexml/test_changing_encoding.rb44
-rw-r--r--test/rexml/test_contrib.rb583
-rw-r--r--test/rexml/test_core.rb1427
-rw-r--r--test/rexml/test_doctype.rb107
-rw-r--r--test/rexml/test_document.rb109
-rw-r--r--test/rexml/test_elements.rb107
-rw-r--r--test/rexml/test_encoding.rb92
-rw-r--r--test/rexml/test_encoding_2.rb59
-rw-r--r--test/rexml/test_entity.rb148
-rw-r--r--test/rexml/test_functions.rb223
-rw-r--r--test/rexml/test_functions_number.rb32
-rw-r--r--test/rexml/test_jaxen.rb126
-rw-r--r--test/rexml/test_light.rb104
-rw-r--r--test/rexml/test_lightparser.rb12
-rw-r--r--test/rexml/test_listener.rb129
-rw-r--r--test/rexml/test_martin_fowler.rb37
-rw-r--r--test/rexml/test_notationdecl_mixin.rb58
-rw-r--r--test/rexml/test_notationdecl_parsetest.rb23
-rw-r--r--test/rexml/test_order.rb102
-rw-r--r--test/rexml/test_preceding_sibling.rb38
-rw-r--r--test/rexml/test_pullparser.rb100
-rw-r--r--test/rexml/test_rexml_issuezilla.rb14
-rw-r--r--test/rexml/test_sax.rb278
-rw-r--r--test/rexml/test_stream.rb104
-rw-r--r--test/rexml/test_ticket_80.rb56
-rw-r--r--test/rexml/test_validation_rng.rb790
-rw-r--r--test/rexml/test_xml_declaration_parent_child.rb33
-rw-r--r--test/rexml/test_xpath.rb1079
-rw-r--r--test/rexml/test_xpath_attribute_query.rb89
-rw-r--r--test/rexml/test_xpath_msw.rb38
-rw-r--r--test/rexml/test_xpath_pred.rb80
-rw-r--r--test/rexml/test_xpathtext.rb72
-rw-r--r--test/rinda/test_rinda.rb649
-rw-r--r--test/rinda/test_tuplebag.rb1
-rw-r--r--test/ripper/assert_parse_files.rb32
-rw-r--r--test/ripper/dummyparser.rb126
-rw-r--r--test/ripper/test_files.rb27
-rw-r--r--test/ripper/test_files_ext.rb8
-rw-r--r--test/ripper/test_files_lib.rb14
-rw-r--r--test/ripper/test_files_sample.rb8
-rw-r--r--test/ripper/test_files_test.rb8
-rw-r--r--test/ripper/test_files_test_1.rb9
-rw-r--r--test/ripper/test_files_test_2.rb9
-rw-r--r--test/ripper/test_filter.rb14
-rw-r--r--test/ripper/test_lexer.rb317
-rw-r--r--test/ripper/test_parser_events.rb738
-rw-r--r--test/ripper/test_ripper.rb183
-rw-r--r--test/ripper/test_scanner_events.rb387
-rw-r--r--test/ripper/test_sexp.rb537
-rw-r--r--test/rss/dot.pngbin111 -> 0 bytes-rw-r--r--test/rss/rss-assertions.rb2090
-rw-r--r--test/rss/rss-testcase.rb478
-rw-r--r--test/rss/test_1.0.rb295
-rw-r--r--test/rss/test_2.0.rb409
-rw-r--r--test/rss/test_accessor.rb103
-rw-r--r--test/rss/test_atom.rb681
-rw-r--r--test/rss/test_content.rb104
-rw-r--r--test/rss/test_dublincore.rb279
-rw-r--r--test/rss/test_image.rb214
-rw-r--r--test/rss/test_inherit.rb40
-rw-r--r--test/rss/test_itunes.rb347
-rw-r--r--test/rss/test_maker_0.9.rb474
-rw-r--r--test/rss/test_maker_1.0.rb516
-rw-r--r--test/rss/test_maker_2.0.rb757
-rw-r--r--test/rss/test_maker_atom_entry.rb393
-rw-r--r--test/rss/test_maker_atom_feed.rb454
-rw-r--r--test/rss/test_maker_content.rb47
-rw-r--r--test/rss/test_maker_dc.rb149
-rw-r--r--test/rss/test_maker_image.rb62
-rw-r--r--test/rss/test_maker_itunes.rb471
-rw-r--r--test/rss/test_maker_slash.rb37
-rw-r--r--test/rss/test_maker_sy.rb44
-rw-r--r--test/rss/test_maker_taxo.rb81
-rw-r--r--test/rss/test_maker_trackback.rb41
-rw-r--r--test/rss/test_maker_xml-stylesheet.rb83
-rw-r--r--test/rss/test_parser.rb62
-rw-r--r--test/rss/test_parser_1.0.rb528
-rw-r--r--test/rss/test_parser_2.0.rb122
-rw-r--r--test/rss/test_parser_atom_entry.rb163
-rw-r--r--test/rss/test_parser_atom_feed.rb276
-rw-r--r--test/rss/test_setup_maker_0.9.rb246
-rw-r--r--test/rss/test_setup_maker_1.0.rb550
-rw-r--r--test/rss/test_setup_maker_2.0.rb308
-rw-r--r--test/rss/test_setup_maker_atom_entry.rb409
-rw-r--r--test/rss/test_setup_maker_atom_feed.rb445
-rw-r--r--test/rss/test_setup_maker_itunes.rb144
-rw-r--r--test/rss/test_setup_maker_slash.rb38
-rw-r--r--test/rss/test_slash.rb64
-rw-r--r--test/rss/test_syndication.rb125
-rw-r--r--test/rss/test_taxonomy.rb172
-rw-r--r--test/rss/test_to_s.rb670
-rw-r--r--test/rss/test_trackback.rb135
-rw-r--r--test/rss/test_version.rb9
-rw-r--r--test/rss/test_xml-stylesheet.rb108
-rw-r--r--test/ruby/allpairs.rb2
-rw-r--r--test/ruby/beginmainend.rb5
-rw-r--r--test/ruby/bug-11928.rb14
-rw-r--r--test/ruby/bug-13526.rb22
-rw-r--r--test/ruby/enc/test_big5.rb1
-rw-r--r--test/ruby/enc/test_case_comprehensive.rb307
-rw-r--r--test/ruby/enc/test_case_mapping.rb231
-rw-r--r--test/ruby/enc/test_case_options.rb81
-rw-r--r--test/ruby/enc/test_cesu8.rb113
-rw-r--r--test/ruby/enc/test_cp949.rb1
-rw-r--r--test/ruby/enc/test_emoji.rb7
-rw-r--r--test/ruby/enc/test_emoji_breaks.rb155
-rw-r--r--test/ruby/enc/test_euc_jp.rb3
-rw-r--r--test/ruby/enc/test_euc_kr.rb9
-rw-r--r--test/ruby/enc/test_euc_tw.rb1
-rw-r--r--test/ruby/enc/test_gb18030.rb1
-rw-r--r--test/ruby/enc/test_gbk.rb1
-rw-r--r--test/ruby/enc/test_grapheme_breaks.rb92
-rw-r--r--test/ruby/enc/test_iso_8859.rb7
-rw-r--r--test/ruby/enc/test_koi8.rb1
-rw-r--r--test/ruby/enc/test_regex_casefold.rb120
-rw-r--r--test/ruby/enc/test_shift_jis.rb5
-rw-r--r--test/ruby/enc/test_utf16.rb123
-rw-r--r--test/ruby/enc/test_utf32.rb71
-rw-r--r--test/ruby/enc/test_windows_1251.rb1
-rw-r--r--test/ruby/enc/test_windows_1252.rb26
-rw-r--r--test/ruby/endblockwarn_rb12
-rw-r--r--test/ruby/envutil.rb202
-rw-r--r--test/ruby/lbtest.rb17
-rw-r--r--test/ruby/marshaltestlib.rb149
-rw-r--r--test/ruby/sentence.rb3
-rw-r--r--test/ruby/test_alias.rb214
-rw-r--r--test/ruby/test_argf.rb939
-rw-r--r--test/ruby/test_arithmetic_sequence.rb491
-rw-r--r--test/ruby/test_arity.rb70
-rw-r--r--test/ruby/test_array.rb1903
-rw-r--r--test/ruby/test_assignment.rb271
-rw-r--r--test/ruby/test_ast.rb1063
-rw-r--r--test/ruby/test_autoload.rb594
-rw-r--r--test/ruby/test_backtrace.rb431
-rw-r--r--test/ruby/test_basicinstructions.rb59
-rw-r--r--test/ruby/test_beginendblock.rb226
-rw-r--r--test/ruby/test_bignum.rb547
-rw-r--r--test/ruby/test_call.rb99
-rw-r--r--test/ruby/test_case.rb56
-rw-r--r--test/ruby/test_class.rb623
-rw-r--r--test/ruby/test_clone.rb89
-rw-r--r--test/ruby/test_comparable.rb75
-rw-r--r--test/ruby/test_complex.rb879
-rw-r--r--test/ruby/test_complex2.rb3
-rw-r--r--test/ruby/test_complexrational.rb43
-rw-r--r--test/ruby/test_condition.rb1
-rw-r--r--test/ruby/test_const.rb65
-rw-r--r--test/ruby/test_continuation.rb76
-rw-r--r--test/ruby/test_data.rb249
-rw-r--r--test/ruby/test_default_gems.rb16
-rw-r--r--test/ruby/test_defined.rb339
-rw-r--r--test/ruby/test_dir.rb549
-rw-r--r--test/ruby/test_dir_m17n.rb398
-rw-r--r--test/ruby/test_dup.rb110
-rw-r--r--test/ruby/test_econv.rb104
-rw-r--r--test/ruby/test_encoding.rb95
-rw-r--r--test/ruby/test_enum.rb1041
-rw-r--r--test/ruby/test_enumerator.rb646
-rw-r--r--test/ruby/test_env.rb1185
-rw-r--r--test/ruby/test_eval.rb433
-rw-r--r--test/ruby/test_exception.rb1338
-rw-r--r--test/ruby/test_fiber.rb347
-rw-r--r--test/ruby/test_file.rb525
-rw-r--r--test/ruby/test_file_exhaustive.rb1859
-rw-r--r--test/ruby/test_fixnum.rb181
-rw-r--r--test/ruby/test_flip.rb75
-rw-r--r--test/ruby/test_float.rb607
-rw-r--r--test/ruby/test_fnmatch.rb221
-rw-r--r--test/ruby/test_frozen.rb30
-rw-r--r--test/ruby/test_frozen_error.rb57
-rw-r--r--test/ruby/test_gc.rb563
-rw-r--r--test/ruby/test_gc_compact.rb446
-rw-r--r--test/ruby/test_hash.rb1706
-rw-r--r--test/ruby/test_ifunless.rb17
-rw-r--r--test/ruby/test_inlinecache.rb110
-rw-r--r--test/ruby/test_insns_leaf.rb46
-rw-r--r--test/ruby/test_integer.rb654
-rw-r--r--test/ruby/test_integer_comb.rb112
-rw-r--r--test/ruby/test_io.rb3345
-rw-r--r--test/ruby/test_io_buffer.rb501
-rw-r--r--test/ruby/test_io_m17n.rb848
-rw-r--r--test/ruby/test_io_timeout.rb58
-rw-r--r--test/ruby/test_iseq.rb768
-rw-r--r--test/ruby/test_iterator.rb75
-rw-r--r--test/ruby/test_key_error.rb42
-rw-r--r--test/ruby/test_keyword.rb4418
-rw-r--r--test/ruby/test_lambda.rb296
-rw-r--r--test/ruby/test_lazy_enumerator.rb709
-rw-r--r--test/ruby/test_literal.rb425
-rw-r--r--test/ruby/test_m17n.rb528
-rw-r--r--test/ruby/test_m17n_comb.rb427
-rw-r--r--test/ruby/test_marshal.rb696
-rw-r--r--test/ruby/test_math.rb230
-rw-r--r--test/ruby/test_memory_view.rb341
-rw-r--r--test/ruby/test_metaclass.rb1
-rw-r--r--test/ruby/test_method.rb1240
-rw-r--r--test/ruby/test_method_cache.rb76
-rw-r--r--test/ruby/test_mixed_unicode_escapes.rb11
-rw-r--r--test/ruby/test_mjit.rb1327
-rw-r--r--test/ruby/test_mjit_debug.rb17
-rw-r--r--test/ruby/test_module.rb2712
-rw-r--r--test/ruby/test_name_error.rb156
-rw-r--r--test/ruby/test_nomethod_error.rb109
-rw-r--r--test/ruby/test_not.rb13
-rw-r--r--test/ruby/test_notimp.rb64
-rw-r--r--test/ruby/test_numeric.rb481
-rw-r--r--test/ruby/test_object.rb774
-rw-r--r--test/ruby/test_objectspace.rb224
-rw-r--r--test/ruby/test_optimization.rb913
-rw-r--r--test/ruby/test_pack.rb300
-rw-r--r--test/ruby/test_parse.rb1117
-rw-r--r--test/ruby/test_path.rb21
-rw-r--r--test/ruby/test_pattern_matching.rb1713
-rw-r--r--test/ruby/test_pipe.rb33
-rw-r--r--test/ruby/test_primitive.rb85
-rw-r--r--test/ruby/test_proc.rb1216
-rw-r--r--test/ruby/test_process.rb1879
-rw-r--r--test/ruby/test_rand.rb491
-rw-r--r--test/ruby/test_random_formatter.rb123
-rw-r--r--test/ruby/test_range.rb782
-rw-r--r--test/ruby/test_rational.rb823
-rw-r--r--test/ruby/test_rational2.rb1
-rw-r--r--test/ruby/test_readpartial.rb9
-rw-r--r--test/ruby/test_refinement.rb2634
-rw-r--r--test/ruby/test_regexp.rb1124
-rw-r--r--test/ruby/test_require.rb984
-rw-r--r--test/ruby/test_require_lib.rb27
-rw-r--r--test/ruby/test_rubyoptions.rb960
-rw-r--r--test/ruby/test_rubyvm.rb71
-rw-r--r--test/ruby/test_rubyvm_mjit.rb105
-rw-r--r--test/ruby/test_settracefunc.rb2560
-rw-r--r--test/ruby/test_shapes.rb441
-rw-r--r--test/ruby/test_signal.rb324
-rw-r--r--test/ruby/test_sleep.rb10
-rw-r--r--test/ruby/test_sprintf.rb228
-rw-r--r--test/ruby/test_sprintf_comb.rb47
-rw-r--r--test/ruby/test_stack.rb82
-rw-r--r--test/ruby/test_string.rb2206
-rw-r--r--test/ruby/test_stringchar.rb41
-rw-r--r--test/ruby/test_struct.rb445
-rw-r--r--test/ruby/test_super.rb531
-rw-r--r--test/ruby/test_symbol.rb502
-rw-r--r--test/ruby/test_syntax.rb2029
-rw-r--r--test/ruby/test_system.rb101
-rw-r--r--test/ruby/test_thread.rb1374
-rw-r--r--test/ruby/test_thread_cv.rb252
-rw-r--r--test/ruby/test_thread_queue.rb708
-rw-r--r--test/ruby/test_threadgroup.rb57
-rw-r--r--test/ruby/test_time.rb993
-rw-r--r--test/ruby/test_time_tz.rb645
-rw-r--r--test/ruby/test_trace.rb12
-rw-r--r--test/ruby/test_transcode.rb398
-rw-r--r--test/ruby/test_undef.rb19
-rw-r--r--test/ruby/test_unicode_escape.rb23
-rw-r--r--test/ruby/test_variable.rb249
-rw-r--r--test/ruby/test_vm_dump.rb21
-rw-r--r--test/ruby/test_weakmap.rb216
-rw-r--r--test/ruby/test_whileuntil.rb13
-rw-r--r--test/ruby/test_yield.rb59
-rw-r--r--test/ruby/test_yjit.rb1333
-rw-r--r--test/ruby/test_yjit_exit_locations.rb110
-rw-r--r--test/ruby/ut_eof.rb5
-rw-r--r--test/rubygems/alternate_cert.pem19
-rw-r--r--test/rubygems/alternate_cert_32.pem19
-rw-r--r--test/rubygems/alternate_key.pem27
-rw-r--r--test/rubygems/bad_rake.rb3
-rw-r--r--test/rubygems/bogussources.rb14
-rw-r--r--test/rubygems/bundler_test_gem.rb421
-rw-r--r--test/rubygems/ca_cert.pem77
-rw-r--r--test/rubygems/child_cert.pem19
-rw-r--r--test/rubygems/child_cert_32.pem19
-rw-r--r--test/rubygems/child_key.pem27
-rw-r--r--test/rubygems/client.pem107
-rw-r--r--test/rubygems/data/excon-0.7.7.gemspec.rzbin0 -> 388 bytes-rw-r--r--test/rubygems/data/null-required-ruby-version.gemspec.rzbin0 -> 403 bytes-rw-r--r--test/rubygems/data/null-required-rubygems-version.gemspec.rzbin0 -> 421 bytes-rw-r--r--test/rubygems/data/pry-0.4.7.gemspec.rzbin0 -> 433 bytes-rw-r--r--test/rubygems/encrypted_private_key.pem30
-rw-r--r--test/rubygems/expired_cert.pem19
-rw-r--r--test/rubygems/fake_certlib/openssl.rb6
-rw-r--r--test/rubygems/foo/discover.rb7
-rw-r--r--test/rubygems/functional.rb98
-rw-r--r--test/rubygems/future_cert.pem19
-rw-r--r--test/rubygems/future_cert_32.pem19
-rw-r--r--test/rubygems/gem_installer_test_case.rb103
-rw-r--r--test/rubygems/gem_package_tar_test_case.rb140
-rw-r--r--test/rubygems/gemutilities.rb629
-rw-r--r--test/rubygems/good_rake.rb3
-rw-r--r--test/rubygems/grandchild_cert.pem19
-rw-r--r--test/rubygems/grandchild_cert_32.pem19
-rw-r--r--test/rubygems/grandchild_key.pem27
-rw-r--r--test/rubygems/helper.rb1643
-rw-r--r--test/rubygems/installer_test_case.rb248
-rw-r--r--test/rubygems/insure_session.rb49
-rw-r--r--test/rubygems/invalid_client.pem49
-rw-r--r--test/rubygems/invalid_issuer_cert.pem20
-rw-r--r--test/rubygems/invalid_issuer_cert_32.pem20
-rw-r--r--test/rubygems/invalid_key.pem27
-rw-r--r--test/rubygems/invalid_signer_cert.pem19
-rw-r--r--test/rubygems/invalid_signer_cert_32.pem19
-rw-r--r--test/rubygems/invalidchild_cert.pem19
-rw-r--r--test/rubygems/invalidchild_cert_32.pem19
-rw-r--r--test/rubygems/invalidchild_key.pem27
-rw-r--r--test/rubygems/mockgemui.rb65
-rw-r--r--test/rubygems/multifactor_auth_utilities.rb111
-rw-r--r--test/rubygems/package/tar_test_case.rb175
-rw-r--r--test/rubygems/packages/Bluebie-legs-0.6.2.gembin0 -> 14336 bytes-rw-r--r--test/rubygems/packages/ascii_binder-0.1.10.1.gembin0 -> 244736 bytes-rw-r--r--test/rubygems/packages/ill-formatted-platform-1.0.0.10.gembin0 -> 10240 bytes-rw-r--r--test/rubygems/plugin/exception/rubygems_plugin.rb8
-rw-r--r--test/rubygems/plugin/load/rubygems_plugin.rb10
-rw-r--r--test/rubygems/plugin/standarderror/rubygems_plugin.rb8
-rw-r--r--test/rubygems/private3072_key.pem40
-rw-r--r--test/rubygems/private_ec_key.pem9
-rw-r--r--test/rubygems/private_key.pem50
-rw-r--r--test/rubygems/public3072_cert.pem25
-rw-r--r--test/rubygems/public_cert.pem36
-rw-r--r--test/rubygems/public_cert_32.pem19
-rw-r--r--test/rubygems/public_key.pem9
-rw-r--r--test/rubygems/rubygems/commands/crash_command.rb10
-rw-r--r--test/rubygems/rubygems_plugin.rb17
-rw-r--r--test/rubygems/sff/discover.rb7
-rw-r--r--test/rubygems/simple_gem.rb12
-rw-r--r--test/rubygems/specifications/bar-0.0.2.gemspec9
-rw-r--r--test/rubygems/specifications/foo-0.0.1-x86-mswin32.gemspecbin0 -> 269 bytes-rw-r--r--test/rubygems/specifications/rubyforge-0.0.1.gemspec14
-rw-r--r--test/rubygems/ssl_cert.pem80
-rw-r--r--test/rubygems/ssl_key.pem27
-rw-r--r--test/rubygems/test_bundled_ca.rb61
-rw-r--r--test/rubygems/test_config.rb36
-rw-r--r--test/rubygems/test_deprecate.rb158
-rw-r--r--test/rubygems/test_exit.rb17
-rw-r--r--test/rubygems/test_gem.rb1754
-rw-r--r--test/rubygems/test_gem_available_set.rb130
-rw-r--r--test/rubygems/test_gem_builder.rb33
-rw-r--r--test/rubygems/test_gem_bundler_version_finder.rb127
-rw-r--r--test/rubygems/test_gem_command.rb299
-rw-r--r--test/rubygems/test_gem_command_manager.rb297
-rw-r--r--test/rubygems/test_gem_commands_build_command.rb712
-rw-r--r--test/rubygems/test_gem_commands_cert_command.rb854
-rw-r--r--test/rubygems/test_gem_commands_check_command.rb62
-rw-r--r--test/rubygems/test_gem_commands_cleanup_command.rb292
-rw-r--r--test/rubygems/test_gem_commands_contents_command.rb221
-rw-r--r--test/rubygems/test_gem_commands_dependency_command.rb180
-rw-r--r--test/rubygems/test_gem_commands_environment_command.rb110
-rw-r--r--test/rubygems/test_gem_commands_exec_command.rb853
-rw-r--r--test/rubygems/test_gem_commands_fetch_command.rb248
-rw-r--r--test/rubygems/test_gem_commands_generate_index_command.rb122
-rw-r--r--test/rubygems/test_gem_commands_help_command.rb94
-rw-r--r--test/rubygems/test_gem_commands_info_command.rb70
-rw-r--r--test/rubygems/test_gem_commands_install_command.rb1518
-rw-r--r--test/rubygems/test_gem_commands_list_command.rb27
-rw-r--r--test/rubygems/test_gem_commands_lock_command.rb35
-rw-r--r--test/rubygems/test_gem_commands_mirror.rb20
-rw-r--r--test/rubygems/test_gem_commands_open_command.rb98
-rw-r--r--test/rubygems/test_gem_commands_outdated_command.rb52
-rw-r--r--test/rubygems/test_gem_commands_owner_command.rb482
-rw-r--r--test/rubygems/test_gem_commands_pristine_command.rb658
-rw-r--r--test/rubygems/test_gem_commands_push_command.rb575
-rw-r--r--test/rubygems/test_gem_commands_query_command.rb760
-rw-r--r--test/rubygems/test_gem_commands_search_command.rb16
-rw-r--r--test/rubygems/test_gem_commands_server_command.rb61
-rw-r--r--test/rubygems/test_gem_commands_setup_command.rb474
-rw-r--r--test/rubygems/test_gem_commands_signin_command.rb259
-rw-r--r--test/rubygems/test_gem_commands_signout_command.rb30
-rw-r--r--test/rubygems/test_gem_commands_sources_command.rb447
-rw-r--r--test/rubygems/test_gem_commands_specification_command.rb230
-rw-r--r--test/rubygems/test_gem_commands_stale_command.rb35
-rw-r--r--test/rubygems/test_gem_commands_uninstall_command.rb505
-rw-r--r--test/rubygems/test_gem_commands_unpack_command.rb151
-rw-r--r--test/rubygems/test_gem_commands_update_command.rb821
-rw-r--r--test/rubygems/test_gem_commands_which_command.rb59
-rw-r--r--test/rubygems/test_gem_commands_yank_command.rb299
-rw-r--r--test/rubygems/test_gem_config_file.rb378
-rw-r--r--test/rubygems/test_gem_dependency.rb309
-rw-r--r--test/rubygems/test_gem_dependency_installer.rb1014
-rw-r--r--test/rubygems/test_gem_dependency_list.rb153
-rw-r--r--test/rubygems/test_gem_dependency_resolution_error.rb27
-rw-r--r--test/rubygems/test_gem_doc_manager.rb37
-rw-r--r--test/rubygems/test_gem_doctor.rb195
-rw-r--r--test/rubygems/test_gem_ext_builder.rb337
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder.rb167
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/.gitignore1
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/custom_name.gemspec10
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/ext/custom_name_lib/Cargo.lock233
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/ext/custom_name_lib/Cargo.toml10
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/ext/custom_name_lib/src/lib.rs27
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/lib/custom_name.rb3
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/.gitignore1
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/Cargo.lock247
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/Cargo.toml10
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/rust_ruby_example.gemspec10
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/src/lib.rs51
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder_link_flag_converter.rb34
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder_unit.rb60
-rw-r--r--test/rubygems/test_gem_ext_cmake_builder.rb84
-rw-r--r--test/rubygems/test_gem_ext_configure_builder.rb78
-rw-r--r--test/rubygems/test_gem_ext_ext_conf_builder.rb243
-rw-r--r--test/rubygems/test_gem_ext_rake_builder.rb125
-rw-r--r--test/rubygems/test_gem_format.rb76
-rw-r--r--test/rubygems/test_gem_gem_path_searcher.rb84
-rw-r--r--test/rubygems/test_gem_gem_runner.rb108
-rw-r--r--test/rubygems/test_gem_gemcutter_utilities.rb345
-rw-r--r--test/rubygems/test_gem_impossible_dependencies_error.rb60
-rw-r--r--test/rubygems/test_gem_indexer.rb569
-rw-r--r--test/rubygems/test_gem_install_update_options.rb180
-rw-r--r--test/rubygems/test_gem_installer.rb2450
-rw-r--r--test/rubygems/test_gem_local_remote_options.rb57
-rw-r--r--test/rubygems/test_gem_name_tuple.rb43
-rw-r--r--test/rubygems/test_gem_package.rb1190
-rw-r--r--test/rubygems/test_gem_package_old.rb91
-rw-r--r--test/rubygems/test_gem_package_tar_header.rb190
-rw-r--r--test/rubygems/test_gem_package_tar_input.rb118
-rw-r--r--test/rubygems/test_gem_package_tar_output.rb103
-rw-r--r--test/rubygems/test_gem_package_tar_reader.rb115
-rw-r--r--test/rubygems/test_gem_package_tar_reader_entry.rb239
-rw-r--r--test/rubygems/test_gem_package_tar_writer.rb297
-rw-r--r--test/rubygems/test_gem_package_task.rb96
-rw-r--r--test/rubygems/test_gem_path_support.rb139
-rw-r--r--test/rubygems/test_gem_platform.rb586
-rw-r--r--test/rubygems/test_gem_rdoc.rb137
-rw-r--r--test/rubygems/test_gem_remote_fetcher.rb1149
-rw-r--r--test/rubygems/test_gem_request.rb547
-rw-r--r--test/rubygems/test_gem_request_connection_pools.rb151
-rw-r--r--test/rubygems/test_gem_request_set.rb672
-rw-r--r--test/rubygems/test_gem_request_set_gem_dependency_api.rb846
-rw-r--r--test/rubygems/test_gem_request_set_lockfile.rb469
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_parser.rb544
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_tokenizer.rb307
-rw-r--r--test/rubygems/test_gem_requirement.rb293
-rw-r--r--test/rubygems/test_gem_resolver.rb859
-rw-r--r--test/rubygems/test_gem_resolver_activation_request.rb43
-rw-r--r--test/rubygems/test_gem_resolver_api_set.rb210
-rw-r--r--test/rubygems/test_gem_resolver_api_specification.rb167
-rw-r--r--test/rubygems/test_gem_resolver_best_set.rb159
-rw-r--r--test/rubygems/test_gem_resolver_composed_set.rb44
-rw-r--r--test/rubygems/test_gem_resolver_conflict.rb82
-rw-r--r--test/rubygems/test_gem_resolver_dependency_request.rb83
-rw-r--r--test/rubygems/test_gem_resolver_git_set.rb188
-rw-r--r--test/rubygems/test_gem_resolver_git_specification.rb114
-rw-r--r--test/rubygems/test_gem_resolver_index_set.rb88
-rw-r--r--test/rubygems/test_gem_resolver_index_specification.rb93
-rw-r--r--test/rubygems/test_gem_resolver_installed_specification.rb47
-rw-r--r--test/rubygems/test_gem_resolver_installer_set.rb320
-rw-r--r--test/rubygems/test_gem_resolver_local_specification.rb44
-rw-r--r--test/rubygems/test_gem_resolver_lock_set.rb62
-rw-r--r--test/rubygems/test_gem_resolver_lock_specification.rb98
-rw-r--r--test/rubygems/test_gem_resolver_requirement_list.rb19
-rw-r--r--test/rubygems/test_gem_resolver_specification.rb63
-rw-r--r--test/rubygems/test_gem_resolver_vendor_set.rb82
-rw-r--r--test/rubygems/test_gem_resolver_vendor_specification.rb82
-rw-r--r--test/rubygems/test_gem_security.rb349
-rw-r--r--test/rubygems/test_gem_security_policy.rb535
-rw-r--r--test/rubygems/test_gem_security_signer.rb218
-rw-r--r--test/rubygems/test_gem_security_trust_dir.rb99
-rw-r--r--test/rubygems/test_gem_server.rb232
-rw-r--r--test/rubygems/test_gem_silent_ui.rb123
-rw-r--r--test/rubygems/test_gem_source.rb254
-rw-r--r--test/rubygems/test_gem_source_fetch_problem.rb37
-rw-r--r--test/rubygems/test_gem_source_git.rb310
-rw-r--r--test/rubygems/test_gem_source_index.rb402
-rw-r--r--test/rubygems/test_gem_source_installed.rb35
-rw-r--r--test/rubygems/test_gem_source_list.rb119
-rw-r--r--test/rubygems/test_gem_source_local.rb107
-rw-r--r--test/rubygems/test_gem_source_lock.rb113
-rw-r--r--test/rubygems/test_gem_source_specific_file.rb76
-rw-r--r--test/rubygems/test_gem_source_subpath_problem.rb50
-rw-r--r--test/rubygems/test_gem_source_vendor.rb30
-rw-r--r--test/rubygems/test_gem_spec_fetcher.rb492
-rw-r--r--test/rubygems/test_gem_specification.rb3448
-rw-r--r--test/rubygems/test_gem_stream_ui.rb127
-rw-r--r--test/rubygems/test_gem_stub_specification.rb278
-rw-r--r--test/rubygems/test_gem_text.rb68
-rw-r--r--test/rubygems/test_gem_uninstaller.rb627
-rw-r--r--test/rubygems/test_gem_unsatisfiable_dependency_error.rb31
-rw-r--r--test/rubygems/test_gem_update_suggestion.rb209
-rw-r--r--test/rubygems/test_gem_uri.rb41
-rw-r--r--test/rubygems/test_gem_uri_formatter.rb27
-rw-r--r--test/rubygems/test_gem_util.rb91
-rw-r--r--test/rubygems/test_gem_validator.rb71
-rw-r--r--test/rubygems/test_gem_version.rb210
-rw-r--r--test/rubygems/test_gem_version_option.rb104
-rw-r--r--test/rubygems/test_kernel.rb128
-rw-r--r--test/rubygems/test_project_sanity.rb49
-rw-r--r--test/rubygems/test_remote_fetch_error.rb20
-rw-r--r--test/rubygems/test_require.rb734
-rw-r--r--test/rubygems/test_rubygems.rb76
-rw-r--r--test/rubygems/test_webauthn_listener.rb143
-rw-r--r--test/rubygems/test_webauthn_listener_response.rb93
-rw-r--r--test/rubygems/test_webauthn_poller.rb124
-rw-r--r--test/rubygems/utilities.rb435
-rw-r--r--test/rubygems/wrong_key_cert.pem19
-rw-r--r--test/rubygems/wrong_key_cert_32.pem19
-rw-r--r--test/runner.rb26
-rw-r--r--test/scanf/data.txt6
-rw-r--r--test/scanf/test_scanf.rb325
-rw-r--r--test/scanf/test_scanfblocks.rb81
-rw-r--r--test/scanf/test_scanfio.rb20
-rw-r--r--test/sdbm/test_sdbm.rb555
-rw-r--r--test/socket/test_addrinfo.rb101
-rw-r--r--test/socket/test_ancdata.rb2
-rw-r--r--test/socket/test_basicsocket.rb162
-rw-r--r--test/socket/test_nonblock.rb141
-rw-r--r--test/socket/test_socket.rb416
-rw-r--r--test/socket/test_sockopt.rb47
-rw-r--r--test/socket/test_tcp.rb153
-rw-r--r--test/socket/test_udp.rb77
-rw-r--r--test/socket/test_unix.rb543
-rw-r--r--test/stringio/test_ractor.rb23
-rw-r--r--test/stringio/test_stringio.rb462
-rw-r--r--test/strscan/test_ractor.rb28
-rw-r--r--test/strscan/test_stringscanner.rb417
-rw-r--r--test/syck/test_array.rb18
-rw-r--r--test/syck/test_boolean.rb37
-rw-r--r--test/syck/test_class.rb18
-rw-r--r--test/syck/test_engine_manager.rb3
-rw-r--r--test/syck/test_exception.rb46
-rw-r--r--test/syck/test_hash.rb29
-rw-r--r--test/syck/test_null.rb20
-rw-r--r--test/syck/test_omap.rb56
-rw-r--r--test/syck/test_set.rb31
-rw-r--r--test/syck/test_string.rb45
-rw-r--r--test/syck/test_struct.rb42
-rw-r--r--test/syck/test_symbol.rb22
-rw-r--r--test/syck/test_yaml.rb1408
-rw-r--r--test/syck/test_yaml_properties.rb64
-rw-r--r--test/syck/test_yamlstore.rb76
-rw-r--r--test/syslog/test_syslog_logger.rb588
-rw-r--r--test/test_abbrev.rb55
-rw-r--r--test/test_cmath.rb8
-rw-r--r--test/test_delegate.rb277
-rw-r--r--test/test_extlibs.rb79
-rw-r--r--test/test_find.rb134
-rw-r--r--test/test_forwardable.rb402
-rw-r--r--test/test_getoptlong.rb163
-rw-r--r--test/test_ipaddr.rb478
-rw-r--r--test/test_mathn.rb10
-rw-r--r--test/test_mutex_m.rb36
-rw-r--r--test/test_observer.rb66
-rw-r--r--test/test_open3.rb117
-rw-r--r--test/test_pp.rb112
-rw-r--r--test/test_prettyprint.rb14
-rw-r--r--test/test_prime.rb174
-rw-r--r--test/test_pstore.rb110
-rw-r--r--test/test_pty.rb116
-rw-r--r--test/test_rbconfig.rb54
-rw-r--r--test/test_securerandom.rb86
-rw-r--r--test/test_set.rb882
-rw-r--r--test/test_shellwords.rb108
-rw-r--r--test/test_singleton.rb93
-rw-r--r--test/test_sorted_set.rb45
-rw-r--r--test/test_syslog.rb121
-rw-r--r--test/test_tempfile.rb171
-rw-r--r--test/test_time.rb399
-rw-r--r--test/test_timeout.rb167
-rw-r--r--test/test_tmpdir.rb118
-rw-r--r--test/test_tracer.rb20
-rw-r--r--test/test_trick.rb214
-rw-r--r--test/test_tsort.rb71
-rw-r--r--test/test_unicode_normalize.rb212
-rw-r--r--test/test_weakref.rb72
-rw-r--r--test/testunit/test_assertion.rb8
-rw-r--r--test/thread/test_queue.rb38
-rw-r--r--test/uri/test_common.rb241
-rw-r--r--test/uri/test_file.rb67
-rw-r--r--test/uri/test_ftp.rb5
-rw-r--r--test/uri/test_generic.rb386
-rw-r--r--test/uri/test_http.rb36
-rw-r--r--test/uri/test_ldap.rb11
-rw-r--r--test/uri/test_mailto.rb91
-rw-r--r--test/uri/test_parser.rb63
-rw-r--r--test/uri/test_ws.rb71
-rw-r--r--test/uri/test_wss.rb71
-rw-r--r--test/webrick/test_cgi.rb133
-rw-r--r--test/webrick/test_cookie.rb104
-rw-r--r--test/webrick/test_filehandler.rb277
-rw-r--r--test/webrick/test_httpauth.rb82
-rw-r--r--test/webrick/test_httpproxy.rb282
-rw-r--r--test/webrick/test_httprequest.rb380
-rw-r--r--test/webrick/test_httpserver.rb278
-rw-r--r--test/webrick/test_httputils.rb96
-rw-r--r--test/webrick/test_httpversion.rb40
-rw-r--r--test/webrick/test_server.rb67
-rw-r--r--test/webrick/test_utils.rb64
-rw-r--r--test/webrick/utils.rb58
-rw-r--r--test/webrick/webrick.cgi36
-rw-r--r--test/webrick/webrick_long_filename.cgi36
-rw-r--r--test/win32ole/available_ole.rb41
-rw-r--r--test/win32ole/err_in_callback.rb1
-rw-r--r--test/win32ole/test_err_in_callback.rb40
-rw-r--r--test/win32ole/test_folderitem2_invokeverb.rb1
-rw-r--r--test/win32ole/test_nil2vtempty.rb1
-rw-r--r--test/win32ole/test_ole_methods.rb3
-rw-r--r--test/win32ole/test_propertyputref.rb1
-rw-r--r--test/win32ole/test_thread.rb28
-rw-r--r--test/win32ole/test_win32ole.rb44
-rw-r--r--test/win32ole/test_win32ole_event.rb197
-rw-r--r--test/win32ole/test_win32ole_method.rb24
-rw-r--r--test/win32ole/test_win32ole_method_event.rb36
-rw-r--r--test/win32ole/test_win32ole_param.rb54
-rw-r--r--test/win32ole/test_win32ole_param_event.rb30
-rw-r--r--test/win32ole/test_win32ole_record.rb209
-rw-r--r--test/win32ole/test_win32ole_type.rb55
-rw-r--r--test/win32ole/test_win32ole_type_event.rb44
-rw-r--r--test/win32ole/test_win32ole_typelib.rb3
-rw-r--r--test/win32ole/test_win32ole_variable.rb5
-rw-r--r--test/win32ole/test_win32ole_variant.rb153
-rw-r--r--test/win32ole/test_win32ole_variant_m.rb1
-rw-r--r--test/win32ole/test_win32ole_variant_outarg.rb16
-rw-r--r--test/win32ole/test_word.rb27
-rw-r--r--test/with_different_ofs.rb17
-rw-r--r--test/xmlrpc/data/bug_bool.expected3
-rw-r--r--test/xmlrpc/data/bug_bool.xml8
-rw-r--r--test/xmlrpc/data/bug_cdata.expected3
-rw-r--r--test/xmlrpc/data/bug_cdata.xml8
-rw-r--r--test/xmlrpc/data/bug_covert.expected10
-rw-r--r--test/xmlrpc/data/bug_covert.xml6
-rw-r--r--test/xmlrpc/data/datetime_iso8601.xml8
-rw-r--r--test/xmlrpc/data/fault.xml16
-rw-r--r--test/xmlrpc/data/value.expected7
-rw-r--r--test/xmlrpc/data/value.xml22
-rw-r--r--test/xmlrpc/data/xml1.expected243
-rw-r--r--test/xmlrpc/data/xml1.xml1
-rw-r--r--test/xmlrpc/test_cookie.rb96
-rw-r--r--test/xmlrpc/test_datetime.rb159
-rw-r--r--test/xmlrpc/test_features.rb48
-rw-r--r--test/xmlrpc/test_marshal.rb93
-rw-r--r--test/xmlrpc/test_parser.rb85
-rw-r--r--test/xmlrpc/test_webrick_server.rb98
-rw-r--r--test/xmlrpc/webrick_testing.rb38
-rw-r--r--test/yaml/test_store.rb180
-rw-r--r--test/zlib/test_zlib.rb1381
-rw-r--r--thread.c6532
-rw-r--r--thread_none.c284
-rw-r--r--thread_none.h20
-rw-r--r--thread_pthread.c2531
-rw-r--r--thread_pthread.h142
-rw-r--r--thread_sync.c1635
-rw-r--r--thread_sync.rb68
-rw-r--r--thread_win32.c819
-rw-r--r--thread_win32.h51
-rw-r--r--time.c4958
-rw-r--r--timev.h55
-rw-r--r--timev.rb404
-rw-r--r--tool/annocheck/Dockerfile4
-rw-r--r--tool/annocheck/Dockerfile-copy7
-rw-r--r--[-rwxr-xr-x]tool/asm_parse.rb8
-rwxr-xr-xtool/bisect.sh65
-rw-r--r--tool/bundler/dev_gems.rb19
-rw-r--r--tool/bundler/dev_gems.rb.lock57
-rw-r--r--tool/bundler/rubocop_gems.rb12
-rw-r--r--tool/bundler/rubocop_gems.rb.lock73
-rw-r--r--tool/bundler/standard_gems.rb12
-rw-r--r--tool/bundler/standard_gems.rb.lock81
-rw-r--r--tool/bundler/test_gems.rb12
-rw-r--r--tool/bundler/test_gems.rb.lock45
-rwxr-xr-xtool/change_maker.rb30
-rwxr-xr-xtool/checksum.rb70
-rw-r--r--tool/ci_functions.sh29
-rw-r--r--tool/colors3
-rwxr-xr-xtool/compile_prelude.rb199
-rwxr-xr-xtool/config.guess1501
-rwxr-xr-xtool/config.sub1705
-rwxr-xr-xtool/darwin-cc6
-rwxr-xr-xtool/disable_ipv6.sh9
-rw-r--r--tool/downloader.rb461
-rwxr-xr-xtool/enc-case-folding.rb416
-rw-r--r--tool/enc-emoji-citrus-gen.rb8
-rwxr-xr-xtool/enc-unicode.rb385
-rw-r--r--[-rwxr-xr-x]tool/eval.rb7
-rwxr-xr-xtool/expand-config.rb43
-rwxr-xr-xtool/extlibs.rb285
-rw-r--r--tool/fake.rb70
-rwxr-xr-xtool/fetch-bundled_gems.rb31
-rwxr-xr-xtool/file2lastrev.rb198
-rwxr-xr-xtool/format-release262
-rwxr-xr-xtool/gen-mailmap.rb47
-rwxr-xr-xtool/gen_dummy_probes.rb32
-rwxr-xr-xtool/gen_ruby_tapset.rb105
-rw-r--r--[-rwxr-xr-x]tool/generic_erb.rb57
-rwxr-xr-xtool/git-refresh46
-rw-r--r--tool/gperf.sed23
-rwxr-xr-xtool/id2token.rb23
-rwxr-xr-xtool/ifchange97
-rwxr-xr-xtool/insns2vm.rb18
-rw-r--r--tool/install-sh8
-rwxr-xr-xtool/instruction.rb1393
-rwxr-xr-xtool/intern_ids.rb35
-rw-r--r--tool/jisx0208.rb84
-rwxr-xr-xtool/leaked-globals65
-rw-r--r--tool/lib/-test-/integer.rb14
-rw-r--r--tool/lib/bundled_gem.rb55
-rw-r--r--tool/lib/colorize.rb55
-rw-r--r--tool/lib/core_assertions.rb796
-rw-r--r--tool/lib/envutil.rb380
-rw-r--r--tool/lib/find_executable.rb22
-rw-r--r--tool/lib/gc_checker.rb36
-rw-r--r--tool/lib/iseq_loader_checker.rb81
-rw-r--r--tool/lib/jisx0208.rb86
-rw-r--r--tool/lib/leakchecker.rb321
-rw-r--r--tool/lib/memory_status.rb151
-rw-r--r--tool/lib/output.rb57
-rw-r--r--tool/lib/profile_test_all.rb91
-rw-r--r--tool/lib/test/unit.rb1822
-rw-r--r--tool/lib/test/unit/assertions.rb833
-rw-r--r--tool/lib/test/unit/parallel.rb212
-rw-r--r--tool/lib/test/unit/testcase.rb296
-rw-r--r--tool/lib/tracepointchecker.rb126
-rw-r--r--tool/lib/vcs.rb845
-rw-r--r--tool/lib/vpath.rb92
-rw-r--r--tool/lib/webrick.rb232
-rw-r--r--tool/lib/webrick/.document6
-rw-r--r--tool/lib/webrick/accesslog.rb157
-rw-r--r--tool/lib/webrick/cgi.rb313
-rw-r--r--tool/lib/webrick/compat.rb36
-rw-r--r--tool/lib/webrick/config.rb158
-rw-r--r--tool/lib/webrick/cookie.rb172
-rw-r--r--tool/lib/webrick/htmlutils.rb30
-rw-r--r--tool/lib/webrick/httpauth.rb96
-rw-r--r--tool/lib/webrick/httpauth/authenticator.rb117
-rw-r--r--tool/lib/webrick/httpauth/basicauth.rb116
-rw-r--r--tool/lib/webrick/httpauth/digestauth.rb395
-rw-r--r--tool/lib/webrick/httpauth/htdigest.rb132
-rw-r--r--tool/lib/webrick/httpauth/htgroup.rb97
-rw-r--r--tool/lib/webrick/httpauth/htpasswd.rb158
-rw-r--r--tool/lib/webrick/httpauth/userdb.rb53
-rw-r--r--tool/lib/webrick/httpproxy.rb354
-rw-r--r--tool/lib/webrick/httprequest.rb636
-rw-r--r--tool/lib/webrick/httpresponse.rb564
-rw-r--r--tool/lib/webrick/https.rb152
-rw-r--r--tool/lib/webrick/httpserver.rb293
-rw-r--r--tool/lib/webrick/httpservlet.rb23
-rw-r--r--tool/lib/webrick/httpservlet/abstract.rb152
-rw-r--r--tool/lib/webrick/httpservlet/cgi_runner.rb47
-rw-r--r--tool/lib/webrick/httpservlet/cgihandler.rb126
-rw-r--r--tool/lib/webrick/httpservlet/erbhandler.rb88
-rw-r--r--tool/lib/webrick/httpservlet/filehandler.rb552
-rw-r--r--tool/lib/webrick/httpservlet/prochandler.rb47
-rw-r--r--tool/lib/webrick/httpstatus.rb194
-rw-r--r--tool/lib/webrick/httputils.rb512
-rw-r--r--tool/lib/webrick/httpversion.rb76
-rw-r--r--tool/lib/webrick/log.rb156
-rw-r--r--tool/lib/webrick/server.rb381
-rw-r--r--tool/lib/webrick/ssl.rb215
-rw-r--r--tool/lib/webrick/utils.rb265
-rw-r--r--tool/lib/webrick/version.rb18
-rw-r--r--tool/lib/zombie_hunter.rb10
-rwxr-xr-xtool/ln_sr.rb131
-rw-r--r--tool/m4/_colorize_result_prepare.m434
-rw-r--r--tool/m4/ac_msg_result.m45
-rw-r--r--tool/m4/colorize_result.m49
-rw-r--r--tool/m4/ruby_append_option.m45
-rw-r--r--tool/m4/ruby_append_options.m47
-rw-r--r--tool/m4/ruby_check_builtin_func.m410
-rw-r--r--tool/m4/ruby_check_builtin_setjmp.m427
-rw-r--r--tool/m4/ruby_check_printf_prefix.m429
-rw-r--r--tool/m4/ruby_check_setjmp.m417
-rw-r--r--tool/m4/ruby_check_signedness.m45
-rw-r--r--tool/m4/ruby_check_sizeof.m4108
-rw-r--r--tool/m4/ruby_check_sysconf.m413
-rw-r--r--tool/m4/ruby_cppoutfile.m418
-rw-r--r--tool/m4/ruby_decl_attribute.m445
-rw-r--r--tool/m4/ruby_default_arch.m412
-rw-r--r--tool/m4/ruby_define_if.m46
-rw-r--r--tool/m4/ruby_defint.m440
-rw-r--r--tool/m4/ruby_dtrace_available.m420
-rw-r--r--tool/m4/ruby_dtrace_postprocess.m430
-rw-r--r--tool/m4/ruby_func_attribute.m47
-rw-r--r--tool/m4/ruby_mingw32.m424
-rw-r--r--tool/m4/ruby_prepend_option.m45
-rw-r--r--tool/m4/ruby_prog_gnu_ld.m410
-rw-r--r--tool/m4/ruby_prog_makedirs.m49
-rw-r--r--tool/m4/ruby_replace_funcs.m413
-rw-r--r--tool/m4/ruby_replace_type.m468
-rw-r--r--tool/m4/ruby_require_funcs.m413
-rw-r--r--tool/m4/ruby_rm_recursive.m418
-rw-r--r--tool/m4/ruby_setjmp_type.m452
-rw-r--r--tool/m4/ruby_stack_grow_direction.m430
-rw-r--r--tool/m4/ruby_thread.m480
-rw-r--r--tool/m4/ruby_try_cflags.m419
-rw-r--r--tool/m4/ruby_try_cxxflags.m417
-rw-r--r--tool/m4/ruby_try_ldflags.m415
-rw-r--r--tool/m4/ruby_type_attribute.m48
-rw-r--r--tool/m4/ruby_universal_arch.m4122
-rw-r--r--tool/m4/ruby_wasm_tools.m424
-rw-r--r--tool/m4/ruby_werror_flag.m418
-rwxr-xr-xtool/make-snapshot621
-rw-r--r--tool/make_hgraph.rb94
-rwxr-xr-xtool/mdoc2man.rb66
-rwxr-xr-xtool/merger.rb461
-rwxr-xr-xtool/mjit/bindgen.rb435
-rw-r--r--tool/mjit_archflag.sh40
-rw-r--r--tool/mjit_tabs.rb67
-rw-r--r--tool/mk_builtin_loader.rb411
-rwxr-xr-xtool/mkconfig.rb285
-rwxr-xr-xtool/mkrunnable.rb151
-rwxr-xr-xtool/node_name.rb12
-rwxr-xr-xtool/outdate-bundled-gems.rb135
-rw-r--r--[-rwxr-xr-x]tool/parse.rb3
-rw-r--r--tool/prereq.status44
-rw-r--r--tool/probes_to_wiki.rb16
-rwxr-xr-xtool/rbinstall.rb772
-rw-r--r--tool/rbs_skip_tests11
-rwxr-xr-xtool/rbuninstall.rb73
-rwxr-xr-xtool/redmine-backporter.rb598
-rwxr-xr-xtool/release.sh19
-rwxr-xr-xtool/releng/gen-mail.rb55
-rwxr-xr-xtool/releng/gen-release-note.rb36
-rwxr-xr-xtool/releng/update-www-meta.rb213
-rwxr-xr-xtool/rmdirs3
-rw-r--r--tool/ruby_vm/controllers/application_controller.rb26
-rw-r--r--tool/ruby_vm/helpers/c_escape.rb128
-rw-r--r--tool/ruby_vm/helpers/dumper.rb114
-rw-r--r--tool/ruby_vm/helpers/scanner.rb53
-rw-r--r--tool/ruby_vm/loaders/insns_def.rb100
-rw-r--r--tool/ruby_vm/loaders/opt_insn_unif_def.rb34
-rw-r--r--tool/ruby_vm/loaders/opt_operand_def.rb56
-rw-r--r--tool/ruby_vm/loaders/vm_opts_h.rb37
-rw-r--r--tool/ruby_vm/models/attribute.rb59
-rwxr-xr-xtool/ruby_vm/models/bare_instructions.rb240
-rw-r--r--tool/ruby_vm/models/c_expr.rb41
-rw-r--r--tool/ruby_vm/models/instructions.rb22
-rw-r--r--tool/ruby_vm/models/instructions_unifications.rb43
-rw-r--r--tool/ruby_vm/models/operands_unifications.rb142
-rw-r--r--tool/ruby_vm/models/trace_instructions.rb71
-rw-r--r--tool/ruby_vm/models/typemap.rb63
-rw-r--r--tool/ruby_vm/scripts/converter.rb29
-rw-r--r--tool/ruby_vm/scripts/insns2vm.rb101
-rw-r--r--tool/ruby_vm/tests/.gitkeep0
-rw-r--r--tool/ruby_vm/views/_attributes.erb35
-rw-r--r--tool/ruby_vm/views/_c_expr.erb17
-rw-r--r--tool/ruby_vm/views/_comptime_insn_stack_increase.erb62
-rw-r--r--tool/ruby_vm/views/_copyright.erb31
-rw-r--r--tool/ruby_vm/views/_insn_entry.erb76
-rw-r--r--tool/ruby_vm/views/_insn_len_info.erb28
-rw-r--r--tool/ruby_vm/views/_insn_name_info.erb44
-rw-r--r--tool/ruby_vm/views/_insn_operand_info.erb53
-rw-r--r--tool/ruby_vm/views/_insn_sp_pc_dependency.erb27
-rw-r--r--tool/ruby_vm/views/_insn_type_chars.erb32
-rw-r--r--tool/ruby_vm/views/_leaf_helpers.erb54
-rw-r--r--tool/ruby_vm/views/_notice.erb22
-rw-r--r--tool/ruby_vm/views/_sp_inc_helpers.erb37
-rw-r--r--tool/ruby_vm/views/_trace_instruction.erb21
-rw-r--r--tool/ruby_vm/views/insns.inc.erb26
-rw-r--r--tool/ruby_vm/views/insns_info.inc.erb22
-rw-r--r--tool/ruby_vm/views/lib/ruby_vm/mjit/instruction.rb.erb40
-rw-r--r--tool/ruby_vm/views/mjit_sp_inc.inc.erb17
-rw-r--r--tool/ruby_vm/views/opt_sc.inc.erb40
-rw-r--r--tool/ruby_vm/views/optinsn.inc.erb71
-rw-r--r--tool/ruby_vm/views/optunifs.inc.erb21
-rw-r--r--tool/ruby_vm/views/vm.inc.erb30
-rw-r--r--tool/ruby_vm/views/vmtc.inc.erb21
-rwxr-xr-xtool/rubytest.rb28
-rw-r--r--tool/run-gcov.rb54
-rw-r--r--tool/run-lcov.rb164
-rwxr-xr-xtool/runruby.rb119
-rw-r--r--tool/search-cgvars.rb55
-rwxr-xr-xtool/strip-rdoc.rb32
-rwxr-xr-xtool/sync_default_gems.rb753
-rwxr-xr-xtool/test-annocheck.sh33
-rw-r--r--tool/test-bundled-gems.rb109
-rw-r--r--tool/test-coverage.rb118
-rw-r--r--tool/test/runner.rb23
-rw-r--r--tool/test/test_jisx0208.rb2
-rwxr-xr-xtool/test/test_sync_default_gems.rb76
-rw-r--r--tool/test/testunit/metametameta.rb70
-rw-r--r--tool/test/testunit/test4test_hideskip.rb14
-rw-r--r--tool/test/testunit/test4test_redefinition.rb14
-rw-r--r--tool/test/testunit/test4test_sorting.rb18
-rw-r--r--tool/test/testunit/test_assertion.rb53
-rw-r--r--tool/test/testunit/test_hideskip.rb21
-rw-r--r--tool/test/testunit/test_minitest_unit.rb1488
-rw-r--r--tool/test/testunit/test_parallel.rb219
-rw-r--r--tool/test/testunit/test_redefinition.rb11
-rw-r--r--tool/test/testunit/test_sorting.rb75
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_first.rb8
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_forth.rb30
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_second.rb12
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_third.rb11
-rw-r--r--tool/test/testunit/tests_for_parallel/runner.rb14
-rw-r--r--tool/test/testunit/tests_for_parallel/test4test_hungup.rb15
-rw-r--r--tool/test/webrick/.htaccess (renamed from test/webrick/.htaccess)0
-rw-r--r--tool/test/webrick/test_cgi.rb170
-rw-r--r--tool/test/webrick/test_config.rb17
-rw-r--r--tool/test/webrick/test_cookie.rb141
-rw-r--r--tool/test/webrick/test_do_not_reverse_lookup.rb71
-rw-r--r--tool/test/webrick/test_filehandler.rb403
-rw-r--r--tool/test/webrick/test_htgroup.rb19
-rw-r--r--tool/test/webrick/test_htmlutils.rb21
-rw-r--r--tool/test/webrick/test_httpauth.rb366
-rw-r--r--tool/test/webrick/test_httpproxy.rb467
-rw-r--r--tool/test/webrick/test_httprequest.rb488
-rw-r--r--tool/test/webrick/test_httpresponse.rb282
-rw-r--r--tool/test/webrick/test_https.rb112
-rw-r--r--tool/test/webrick/test_httpserver.rb543
-rw-r--r--tool/test/webrick/test_httpstatus.rb35
-rw-r--r--tool/test/webrick/test_httputils.rb101
-rw-r--r--tool/test/webrick/test_httpversion.rb41
-rw-r--r--tool/test/webrick/test_server.rb191
-rw-r--r--tool/test/webrick/test_ssl_server.rb67
-rw-r--r--tool/test/webrick/test_utils.rb110
-rw-r--r--tool/test/webrick/utils.rb84
-rw-r--r--tool/test/webrick/webrick.cgi38
-rw-r--r--tool/test/webrick/webrick.rhtml4
-rw-r--r--tool/test/webrick/webrick_long_filename.cgi36
-rw-r--r--[-rwxr-xr-x]tool/transcode-tblgen.rb236
-rw-r--r--tool/transform_mjit_header.rb319
-rwxr-xr-xtool/travis_retry.sh13
-rwxr-xr-xtool/travis_wait.sh18
-rw-r--r--tool/update-NEWS-refs.rb37
-rwxr-xr-xtool/update-bundled_gems.rb23
-rwxr-xr-xtool/update-deps651
-rw-r--r--[-rwxr-xr-x]tool/vtlh.rb2
-rwxr-xr-xtool/wasm-clangw9
-rwxr-xr-xtool/ytab.sed67
-rw-r--r--trace_point.rb420
-rw-r--r--transcode.c1140
-rw-r--r--transcode_data.h51
-rw-r--r--transient_heap.c991
-rw-r--r--transient_heap.h65
-rw-r--r--util.c3986
-rw-r--r--variable.c4187
-rw-r--r--variable.h29
-rw-r--r--version.c202
-rw-r--r--version.h90
-rw-r--r--vm.c4981
-rw-r--r--vm_args.c939
-rw-r--r--vm_backtrace.c1831
-rw-r--r--vm_callinfo.h550
-rw-r--r--vm_core.h2240
-rw-r--r--vm_debug.h122
-rw-r--r--vm_dump.c1473
-rw-r--r--vm_eval.c2867
-rw-r--r--vm_exec.c137
-rw-r--r--vm_exec.h123
-rw-r--r--vm_insnhelper.c7277
-rw-r--r--vm_insnhelper.h312
-rw-r--r--vm_method.c2861
-rw-r--r--vm_opts.h56
-rw-r--r--vm_sync.c301
-rw-r--r--vm_sync.h137
-rw-r--r--vm_trace.c1803
-rw-r--r--vsnprintf.c234
-rw-r--r--warning.rb53
-rw-r--r--wasm/GNUmakefile.in32
-rw-r--r--wasm/README.md70
-rw-r--r--wasm/asyncify.h23
-rw-r--r--wasm/fiber.c83
-rw-r--r--wasm/fiber.h43
-rw-r--r--wasm/machine.c62
-rw-r--r--wasm/machine.h25
-rw-r--r--wasm/machine_core.S25
-rw-r--r--wasm/missing.c199
-rw-r--r--wasm/runtime.c47
-rw-r--r--wasm/setjmp.c204
-rw-r--r--wasm/setjmp.h95
-rw-r--r--wasm/setjmp_core.S27
-rw-r--r--wasm/tests/fiber_test.c66
-rw-r--r--wasm/tests/machine_test.c115
-rw-r--r--wasm/tests/setjmp_test.c108
-rwxr-xr-xwasm/wasm-opt36
-rw-r--r--win32/.document1
-rw-r--r--win32/Makefile.sub822
-rw-r--r--win32/README.win32100
-rwxr-xr-xwin32/configure.bat193
-rw-r--r--win32/dir.h37
-rw-r--r--win32/file.c660
-rw-r--r--win32/file.h50
-rwxr-xr-xwin32/ifchange.bat90
-rwxr-xr-xwin32/makedirs.bat3
-rwxr-xr-xwin32/mkexports.rb45
-rwxr-xr-xwin32/resource.rb7
-rwxr-xr-xwin32/rm.bat4
-rw-r--r--win32/rmall.bat6
-rwxr-xr-xwin32/rmdirs.bat1
-rwxr-xr-xwin32/rtname.cmd35
-rw-r--r--win32/ruby.manifest8
-rw-r--r--win32/setup.mak313
-rw-r--r--win32/stub.c42
-rw-r--r--win32/win32.c8511
-rw-r--r--yjit.c1109
-rw-r--r--yjit.h70
-rw-r--r--yjit.rb356
-rw-r--r--yjit/.gitignore2
-rw-r--r--yjit/Cargo.lock49
-rw-r--r--yjit/Cargo.toml47
-rw-r--r--yjit/bindgen/Cargo.lock311
-rw-r--r--yjit/bindgen/Cargo.toml10
-rw-r--r--yjit/bindgen/src/main.rs430
-rw-r--r--yjit/not_gmake.mk14
-rw-r--r--yjit/src/asm/arm64/README.md16
-rw-r--r--yjit/src/asm/arm64/arg/bitmask_imm.rs255
-rw-r--r--yjit/src/asm/arm64/arg/condition.rs52
-rw-r--r--yjit/src/asm/arm64/arg/inst_offset.rs47
-rw-r--r--yjit/src/asm/arm64/arg/mod.rs18
-rw-r--r--yjit/src/asm/arm64/arg/sf.rs19
-rw-r--r--yjit/src/asm/arm64/arg/shifted_imm.rs81
-rw-r--r--yjit/src/asm/arm64/arg/sys_reg.rs6
-rw-r--r--yjit/src/asm/arm64/arg/truncate.rs66
-rw-r--r--yjit/src/asm/arm64/inst/atomic.rs86
-rw-r--r--yjit/src/asm/arm64/inst/branch.rs100
-rw-r--r--yjit/src/asm/arm64/inst/branch_cond.rs78
-rw-r--r--yjit/src/asm/arm64/inst/breakpoint.rs55
-rw-r--r--yjit/src/asm/arm64/inst/call.rs104
-rw-r--r--yjit/src/asm/arm64/inst/conditional.rs73
-rw-r--r--yjit/src/asm/arm64/inst/data_imm.rs143
-rw-r--r--yjit/src/asm/arm64/inst/data_reg.rs192
-rw-r--r--yjit/src/asm/arm64/inst/halfword_imm.rs179
-rw-r--r--yjit/src/asm/arm64/inst/load_literal.rs89
-rw-r--r--yjit/src/asm/arm64/inst/load_register.rs108
-rw-r--r--yjit/src/asm/arm64/inst/load_store.rs249
-rw-r--r--yjit/src/asm/arm64/inst/load_store_exclusive.rs109
-rw-r--r--yjit/src/asm/arm64/inst/logical_imm.rs154
-rw-r--r--yjit/src/asm/arm64/inst/logical_reg.rs207
-rw-r--r--yjit/src/asm/arm64/inst/mod.rs50
-rw-r--r--yjit/src/asm/arm64/inst/mov.rs155
-rw-r--r--yjit/src/asm/arm64/inst/nop.rs44
-rw-r--r--yjit/src/asm/arm64/inst/pc_rel.rs107
-rw-r--r--yjit/src/asm/arm64/inst/reg_pair.rs212
-rw-r--r--yjit/src/asm/arm64/inst/sbfm.rs103
-rw-r--r--yjit/src/asm/arm64/inst/shift_imm.rs147
-rw-r--r--yjit/src/asm/arm64/inst/sys_reg.rs86
-rw-r--r--yjit/src/asm/arm64/inst/test_bit.rs133
-rw-r--r--yjit/src/asm/arm64/mod.rs1580
-rw-r--r--yjit/src/asm/arm64/opnd.rs195
-rw-r--r--yjit/src/asm/mod.rs792
-rw-r--r--yjit/src/asm/x86_64/mod.rs1415
-rw-r--r--yjit/src/asm/x86_64/tests.rs449
-rw-r--r--yjit/src/backend/arm64/mod.rs1491
-rw-r--r--yjit/src/backend/ir.rs1576
-rw-r--r--yjit/src/backend/mod.rs8
-rw-r--r--yjit/src/backend/tests.rs331
-rw-r--r--yjit/src/backend/x86_64/mod.rs895
-rw-r--r--yjit/src/codegen.rs7721
-rw-r--r--yjit/src/core.rs2400
-rw-r--r--yjit/src/cruby.rs715
-rw-r--r--yjit/src/cruby_bindings.inc.rs1310
-rw-r--r--yjit/src/disasm.rs269
-rw-r--r--yjit/src/invariants.rs567
-rw-r--r--yjit/src/lib.rs18
-rw-r--r--yjit/src/options.rs174
-rw-r--r--yjit/src/stats.rs640
-rw-r--r--yjit/src/utils.rs274
-rw-r--r--yjit/src/virtualmem.rs443
-rw-r--r--yjit/src/yjit.rs136
-rw-r--r--yjit/yjit.mk69
11917 files changed, 1956643 insertions, 624485 deletions
diff --git a/.appveyor.yml b/.appveyor.yml
new file mode 100644
index 0000000000..05ff204541
--- /dev/null
+++ b/.appveyor.yml
@@ -0,0 +1,134 @@
+---
+version: '{build}'
+init:
+ - git config --global user.name git
+ - git config --global user.email svn-admin@ruby-lang.org
+ - git config --global core.autocrlf false
+ - git config --global core.eol lf
+ - git config --global advice.detachedHead 0
+shallow_clone: true
+clone_depth: 10
+platform:
+ - x64
+skip_commits:
+ message: /\[DOC\]/
+ files:
+ - doc/*
+ - '**/*.md'
+ - '**/*.rdoc'
+ - '**/.document'
+ - '**/*.[1-8]'
+ - '**/*.ronn'
+environment:
+ ruby_version: "24-%Platform%"
+ matrix:
+ # Test only the oldest supported version because AppVeyor is unstable, its concurrency
+ # is limited, and compatibility issues that happen only in newer versions are rare.
+ # You may test some other stuff on GitHub Actions instead.
+ - build: vs
+ vs: 120 # Visual Studio 2013
+ ssl: OpenSSL-v111
+ # The worker image name. This is NOT the Visual Studio version we're using here.
+ APPVEYOR_BUILD_WORKER_IMAGE: Visual Studio 2015
+ GEMS_FOR_TEST: ""
+ RELINE_TEST_ENCODING: "UTF-8"
+cache:
+ - c:\Tools\vcpkg\installed\
+for:
+-
+ matrix:
+ only:
+ - build: vs
+ install:
+ - ver
+ - chcp
+ - SET BITS=%Platform:x86=32%
+ - SET BITS=%BITS:x=%
+ - SET OPENSSL_DIR=C:\%ssl%-Win%BITS%
+ - cd C:\Tools\vcpkg
+ - git pull -q
+ - .\bootstrap-vcpkg.bat
+ - ps: Start-FileDownload 'https://github.com/microsoft/vcpkg-tool/releases/download/2023-08-09/vcpkg.exe' -FileName 'C:\Tools\vcpkg\vcpkg.exe'
+ - cd %APPVEYOR_BUILD_FOLDER%
+ - vcpkg --triplet %Platform%-windows install --x-use-aria2 libffi libyaml readline zlib
+ - CALL SET vcvars=%%^VS%VS%COMNTOOLS^%%..\..\VC\vcvarsall.bat
+ - SET vcvars
+ - '"%vcvars%" %Platform:x64=amd64%'
+ - SET ruby_path=C:\Ruby%ruby_version:-x86=%
+ - SET PATH=\usr\local\bin;%ruby_path%\bin;%PATH%;C:\msys64\mingw64\bin;C:\msys64\usr\bin
+ - ruby --version
+ - 'cl'
+ - echo> Makefile srcdir=.
+ - echo>> Makefile MSC_VER=0
+ - echo>> Makefile RT=none
+ - echo>> Makefile RT_VER=0
+ - echo>> Makefile BUILTIN_ENCOBJS=nul
+ - type win32\Makefile.sub >> Makefile
+ - nmake %mflags% up VCSUP="echo Update OK"
+ - nmake %mflags% extract-extlibs
+ - del Makefile
+ - mkdir \usr\local\bin
+ - mkdir \usr\local\include
+ - mkdir \usr\local\lib
+ - for %%I in (%OPENSSL_DIR%\*.dll) do mklink /h \usr\local\bin\%%~nxI %%I
+ - for %%I in (c:\Tools\vcpkg\installed\%Platform%-windows\bin\*.dll) do (
+ if not %%~nI == readline mklink \usr\local\bin\%%~nxI %%I
+ )
+ - attrib +r /s /d
+ - mkdir %Platform%-mswin_%vs%
+ build_script:
+ - set HAVE_GIT=no
+ - cd %APPVEYOR_BUILD_FOLDER%
+ - cd %Platform%-mswin_%vs%
+ - >-
+ ..\win32\configure.bat
+ --with-opt-dir="/usr/local;c:/Tools/vcpkg/installed/%Platform%-windows"
+ --with-openssl-dir=%OPENSSL_DIR:\=/%
+ - nmake -l
+ - nmake install-nodoc
+ - \usr\bin\ruby -v -e "p :locale => Encoding.find('locale'), :filesystem => Encoding.find('filesystem')"
+ - if not "%GEMS_FOR_TEST%" == "" \usr\bin\gem install --no-document %GEMS_FOR_TEST%
+ - \usr\bin\ruby -ropenssl -e "puts 'Build ' + OpenSSL::OPENSSL_VERSION, 'Runtime ' + OpenSSL::OPENSSL_LIBRARY_VERSION"
+ test_script:
+ - set /a JOBS=%NUMBER_OF_PROCESSORS%
+ - nmake -l "TESTOPTS=-v -q" btest
+ - nmake -l "TESTOPTS=-v -q" test-basic
+ - >-
+ nmake -l "TESTOPTS=--timeout-scale=3.0
+ --excludes=../test/excludes/_appveyor -j%JOBS%
+ --exclude win32ole
+ --exclude test_bignum
+ --exclude test_syntax
+ --exclude test_open-uri
+ --exclude test_bundled_ca
+ " test-all
+ # separately execute tests without -j which may crash worker with -j.
+ - >-
+ nmake -l
+ "TESTOPTS=--timeout-scale=3.0 --excludes=../test/excludes/_appveyor"
+ TESTS="
+ ../test/win32ole
+ ../test/ruby/test_bignum.rb
+ ../test/ruby/test_syntax.rb
+ ../test/open-uri/test_open-uri.rb
+ ../test/rubygems/test_bundled_ca.rb
+ " test-all
+ - nmake -l test-spec MSPECOPT=-fs # not using `-j` because sometimes `mspec -j` silently dies on Windows
+notifications:
+ - provider: Webhook
+ method: POST
+ url:
+ secure: CcFlJNDJ/a6to7u3Z4Fnz6dScEPNx7hTha2GkSRlV+1U6dqmxY/7uBcLXYb9gR3jfQk6w+2o/HrjNAyXMNGU/JOka3s2WRI4VKitzM+lQ08owvJIh0R7LxrGH0J2e81U # ruby-lang slack: ruby/simpler-alerts-bot
+ body: >-
+ {{^isPullRequest}}
+ {
+ "ci": "AppVeyor CI",
+ "env": "Visual Studio 2013",
+ "url": "{{buildUrl}}",
+ "commit": "{{commitId}}",
+ "branch": "{{branch}}"
+ }
+ {{/isPullRequest}}
+ on_build_success: false
+ on_build_failure: true
+ on_build_status_changed: false
diff --git a/.dir-locals.el b/.dir-locals.el
new file mode 100644
index 0000000000..8f4b96445c
--- /dev/null
+++ b/.dir-locals.el
@@ -0,0 +1,39 @@
+;; Copyright (c) 2018 Urabe, Shyouhei. All rights reserved.
+;;
+;; This file is a part of the programming language Ruby. Permission is hereby
+;; granted, to either redistribute and/or modify this file, provided that the
+;; conditions mentioned in the file COPYING are met. Consult the file for
+;; details.
+
+((nil .
+ ((indent-tabs-mode . nil)
+ (require-final-newline . t)
+ (tab-width . 8)
+ (show-trailing-whitespace . t)
+ (whitespace-line-column . 80))) ;; See also [Misc #12277]
+
+ ;; (bat-mode . ((buffer-file-coding-system . utf-8-dos)))
+
+ (ruby-mode . ((ruby-indent-level . 2)))
+
+ (rdoc-mode . ((fill-column . 74)))
+
+ (yaml-mode . ((yaml-indent-offset . 2)))
+
+ (makefile-mode . ((indent-tabs-mode . t)))
+
+ (c-mode . ((c-file-style . "ruby")))
+
+ (c++-mode . ((c-file-style . "ruby")))
+
+ (change-log-mode .
+ ((buffer-file-coding-system . us-ascii)
+ (indent-tabs-mode . t)
+ (change-log-indent-text . 2)
+ (add-log-time-format . (lambda (&optional x y)
+ (let* ((time (or x (current-time)))
+ (system-time-locale "C")
+ (diff (+ (cadr time) 32400))
+ (lo (% diff 65536))
+ (hi (+ (car time) (/ diff 65536))))
+ (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))))))
diff --git a/.document b/.document
index 8a05d61beb..3a6b0c238c 100644
--- a/.document
+++ b/.document
@@ -5,18 +5,50 @@
# Process all the C source files
*.c
+*.y
# prelude
prelude.rb
+rbconfig.rb
+
+array.rb
+ast.rb
+dir.rb
+gc.rb
+io.rb
+kernel.rb
+marshal.rb
+mjit.rb
+numeric.rb
+nilclass.rb
+pack.rb
+ractor.rb
+string.rb
+symbol.rb
+timev.rb
+thread_sync.rb
+trace_point.rb
+warning.rb
+yjit.rb
# the lib/ directory (which has its own .document file)
-
lib
-
# and some of the ext/ directory (which has its own .document file)
-
ext
# rdoc files
-doc/*.rdoc
+NEWS.md
+
+README.md
+README.ja.md
+
+COPYING
+COPYING.ja
+
+LEGAL
+
+# win32/README.win32 linked from README.md
+win32
+
+doc
diff --git a/.editorconfig b/.editorconfig
new file mode 100644
index 0000000000..4633a7acae
--- /dev/null
+++ b/.editorconfig
@@ -0,0 +1,30 @@
+root = true
+
+[*]
+end_of_line = lf
+indent_size = 4
+indent_style = space
+insert_final_newline = true
+tab_width = 8
+trim_trailing_whitespace = true
+
+[*.bat]
+end_of_line = crlf
+
+[*.gemspec]
+indent_size = 2
+
+[*.rb]
+indent_size = 2
+
+[*.yml]
+indent_size = 2
+
+[{*[Mm]akefile*,*.mak,*.mk,depend}]
+indent_style = tab
+
+[enc/*]
+indent_size = 2
+
+[reg*.[ch]]
+indent_size = 2
diff --git a/.gdbinit b/.gdbinit
index 2a38da8892..34d044caf6 100644
--- a/.gdbinit
+++ b/.gdbinit
@@ -1,80 +1,36 @@
-define rp
+set startup-with-shell off
+
+define hook-run
+ set $color_type = 0
+ set $color_highlite = 0
+ set $color_end = 0
+end
+
+define ruby_gdb_init
+ if !$color_type
+ set $color_type = "\033[31m"
+ end
+ if !$color_highlite
+ set $color_highlite = "\033[36m"
+ end
+ if !$color_end
+ set $color_end = "\033[m"
+ end
if ruby_dummy_gdb_enums.special_consts
end
+end
+
+# set prompt \033[36m(gdb)\033[m\040
+
+define rp
+ ruby_gdb_init
if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
printf "FIXNUM: %ld\n", (long)($arg0) >> 1
else
if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
- if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
- printf "SYMBOL(:%c)\n", $id
- else
- if $id == idDot2
- echo SYMBOL(:..)\n
- else
- if $id == idDot3
- echo SYMBOL(:...)\n
- else
- if $id == idUPlus
- echo SYMBOL(:+@)\n
- else
- if $id == idUMinus
- echo SYMBOL(:-@)\n
- else
- if $id == idPow
- echo SYMBOL(:**)\n
- else
- if $id == idCmp
- echo SYMBOL(:<=>)\n
- else
- if $id == idLTLT
- echo SYMBOL(:<<)\n
- else
- if $id == idLE
- echo SYMBOL(:<=)\n
- else
- if $id == idGE
- echo SYMBOL(:>=)\n
- else
- if $id == idEq
- echo SYMBOL(:==)\n
- else
- if $id == idEqq
- echo SYMBOL(:===)\n
- else
- if $id == idNeq
- echo SYMBOL(:!=)\n
- else
- if $id == idEqTilde
- echo SYMBOL(:=~)\n
- else
- if $id == idNeqTilde
- echo SYMBOL(:!~)\n
- else
- if $id == idAREF
- echo SYMBOL(:[])\n
- else
- if $id == idASET
- echo SYMBOL(:[]=)\n
- else
- printf "SYMBOL(%ld)\n", $id
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
+ printf "%sSYMBOL%s: ", $color_type, $color_end
+ rp_id $id
else
if ($arg0) == RUBY_Qfalse
echo false\n
@@ -89,85 +45,69 @@ define rp
echo undef\n
else
if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
- echo immediate\n
+ if ((VALUE)($arg0) & RUBY_FLONUM_MASK) == RUBY_FLONUM_FLAG
+ printf "%sFLONUM%s: %g\n", $color_type, $color_end, (double)rb_float_value($arg0)
+ else
+ echo immediate\n
+ end
else
set $flags = ((struct RBasic*)($arg0))->flags
+ if ($flags & RUBY_FL_PROMOTED) == RUBY_FL_PROMOTED
+ printf "[PROMOTED] "
+ end
if ($flags & RUBY_T_MASK) == RUBY_T_NONE
- printf "T_NONE: "
+ printf "%sT_NONE%s: ", $color_type, $color_end
print (struct RBasic *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_NIL
- printf "T_NIL: "
+ printf "%sT_NIL%s: ", $color_type, $color_end
print (struct RBasic *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
- printf "T_OBJECT: "
- print (struct RObject *)($arg0)
+ printf "%sT_OBJECT%s: ", $color_type, $color_end
+ print ((struct RObject *)($arg0))->basic
+ if ($flags & ROBJECT_EMBED)
+ print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (ROBJECT_EMBED_LEN_MAX+0)
+ else
+ print (((struct RObject *)($arg0))->as.heap)
+ if (((struct RObject*)($arg0))->as.heap.numiv) > 0
+ print/x *(((struct RObject*)($arg0))->as.heap.ivptr) @ (((struct RObject*)($arg0))->as.heap.numiv)
+ end
+ end
else
if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
- printf "T_CLASS%s: ", ($flags & RUBY_FL_SINGLETON) ? "*" : ""
- print (struct RClass *)($arg0)
+ printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
+ rp_class $arg0
else
if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
- printf "T_ICLASS: "
- print (struct RClass *)($arg0)
+ printf "%sT_ICLASS%s: ", $color_type, $color_end
+ rp_class $arg0
else
if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
- printf "T_MODULE: "
- print (struct RClass *)($arg0)
+ printf "%sT_MODULE%s: ", $color_type, $color_end
+ rp_class $arg0
else
if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
- printf "T_FLOAT: %.16g ", (((struct RFloat*)($arg0))->float_value)
+ printf "%sT_FLOAT%s: %.16g ", $color_type, $color_end, (((struct RFloat*)($arg0))->float_value)
print (struct RFloat *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_STRING
- printf "T_STRING: "
- set print address off
- output (char *)(($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.ptr : \
- ((struct RString*)($arg0))->as.ary)
- set print address on
- printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.len : \
- (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
- if !($flags & RUBY_FL_USER1)
- printf "(embed) "
- else
- if ($flags & RUBY_FL_USER2)
- printf "(shared) "
- end
- if ($flags & RUBY_FL_USER3)
- printf "(assoc) "
- end
- end
- printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
- if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
- printf "coderange:unknown "
- else
- if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
- printf "coderange:7bit "
- else
- if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
- printf "coderange:valid "
- else
- printf "coderange:broken "
- end
- end
- end
- print (struct RString *)($arg0)
+ printf "%sT_STRING%s: ", $color_type, $color_end
+ rp_string $arg0 $flags
else
if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
set $regsrc = ((struct RRegexp*)($arg0))->src
set $rsflags = ((struct RBasic*)$regsrc)->flags
- printf "T_REGEXP: "
+ printf "%sT_REGEXP%s: ", $color_type, $color_end
+ set $len = ($rsflags & RUBY_FL_USER1) ? \
+ ((struct RString*)$regsrc)->as.heap.len : \
+ (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
set print address off
- output (char *)(($rsflags & RUBY_FL_USER1) ? \
+ output *(char *)(($rsflags & RUBY_FL_USER1) ? \
((struct RString*)$regsrc)->as.heap.ptr : \
- ((struct RString*)$regsrc)->as.ary)
+ ((struct RString*)$regsrc)->as.ary) @ $len
set print address on
- printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
- ((struct RString*)$regsrc)->as.heap.len : \
- (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ printf " len:%ld ", $len
if $flags & RUBY_FL_USER6
printf "(none) "
end
@@ -183,20 +123,20 @@ define rp
if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
if ($flags & RUBY_FL_USER1)
set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
- printf "T_ARRAY: len=%ld ", $len
+ printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
printf "(embed) "
if ($len == 0)
printf "{(empty)} "
else
- output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+ print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
printf " "
end
else
set $len = ((struct RArray*)($arg0))->as.heap.len
- printf "T_ARRAY: len=%ld ", $len
+ printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
if ($flags & RUBY_FL_USER2)
printf "(shared) shared="
- output/x ((struct RArray*)($arg0))->as.heap.aux.shared
+ output/x ((struct RArray*)($arg0))->as.heap.aux.shared_root
printf " "
else
printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
@@ -204,101 +144,132 @@ define rp
if ($len == 0)
printf "{(empty)} "
else
- output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+ print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
printf " "
end
end
print (struct RArray *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
- printf "T_FIXNUM: "
+ printf "%sT_FIXNUM%s: ", $color_type, $color_end
print (struct RBasic *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_HASH
- printf "T_HASH: ",
- if ((struct RHash *)($arg0))->ntbl
- printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
+ printf "%sT_HASH%s: ", $color_type, $color_end,
+ if (((struct RHash *)($arg0))->basic.flags & RHASH_ST_TABLE_FLAG)
+ printf "st len=%ld ", ((struct RHash *)($arg0))->as.st->num_entries
+ else
+ printf "li len=%ld bound=%ld ", \
+ ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_SIZE_MASK) >> RHASH_AR_TABLE_SIZE_SHIFT), \
+ ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_BOUND_MASK) >> RHASH_AR_TABLE_BOUND_SHIFT)
end
print (struct RHash *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
- printf "T_STRUCT: len=%ld ", \
- (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+ set $len = (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
((struct RStruct *)($arg0))->as.heap.len)
+ printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, $len
print (struct RStruct *)($arg0)
- x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
- ((struct RStruct *)($arg0))->as.ary : \
- ((struct RStruct *)($arg0))->as.heap.ptr)
+ output/x *(($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+ ((struct RStruct *)($arg0))->as.ary : \
+ ((struct RStruct *)($arg0))->as.heap.ptr) @ $len
else
if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
- printf "T_BIGNUM: sign=%d len=%ld ", \
- (($flags & RUBY_FL_USER1) != 0), \
- (($flags & RUBY_FL_USER2) ? \
- ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
- ((struct RBignum*)($arg0))->as.heap.len)
- if $flags & RUBY_FL_USER2
- printf "(embed) "
- end
- print (struct RBignum *)($arg0)
- x/xw (($flags & RUBY_FL_USER2) ? \
- ((struct RBignum*)($arg0))->as.ary : \
- ((struct RBignum*)($arg0))->as.heap.digits)
+ rp_bignum $arg0
else
if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
- printf "T_RATIONAL: "
+ printf "%sT_RATIONAL%s: ", $color_type, $color_end
print (struct RRational *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
- printf "T_COMPLEX: "
+ printf "%sT_COMPLEX%s: ", $color_type, $color_end
print (struct RComplex *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_FILE
- printf "T_FILE: "
+ printf "%sT_FILE%s: ", $color_type, $color_end
print (struct RFile *)($arg0)
output *((struct RFile *)($arg0))->fptr
printf "\n"
else
if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
- printf "T_TRUE: "
+ printf "%sT_TRUE%s: ", $color_type, $color_end
print (struct RBasic *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
- printf "T_FALSE: "
+ printf "%sT_FALSE%s: ", $color_type, $color_end
print (struct RBasic *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_DATA
if ((struct RTypedData *)($arg0))->typed_flag == 1
- printf "T_DATA(%s): ", ((struct RTypedData *)($arg0))->type->wrap_struct_name
+ printf "%sT_DATA%s(%s): ", $color_type, $color_end, ((struct RTypedData *)($arg0))->type->wrap_struct_name
print (struct RTypedData *)($arg0)
else
- printf "T_DATA: "
+ printf "%sT_DATA%s: ", $color_type, $color_end
print (struct RData *)($arg0)
end
else
if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
- printf "T_MATCH: "
+ printf "%sT_MATCH%s: ", $color_type, $color_end
print (struct RMatch *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
- printf "T_SYMBOL: "
- print (struct RBasic *)($arg0)
+ printf "%sT_SYMBOL%s: ", $color_type, $color_end
+ print (struct RSymbol *)($arg0)
+ set $id_type = ((struct RSymbol *)($arg0))->id & RUBY_ID_SCOPE_MASK
+ if $id_type == RUBY_ID_LOCAL
+ printf "l"
+ else
+ if $id_type == RUBY_ID_INSTANCE
+ printf "i"
+ else
+ if $id_type == RUBY_ID_GLOBAL
+ printf "G"
+ else
+ if $id_type == RUBY_ID_ATTRSET
+ printf "a"
+ else
+ if $id_type == RUBY_ID_CONST
+ printf "C"
+ else
+ if $id_type == RUBY_ID_CLASS
+ printf "c"
+ else
+ printf "j"
+ end
+ end
+ end
+ end
+ end
+ end
+ set $id_fstr = ((struct RSymbol *)($arg0))->fstr
+ rp_string $id_fstr
else
if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
- printf "T_UNDEF: "
+ printf "%sT_UNDEF%s: ", $color_type, $color_end
print (struct RBasic *)($arg0)
else
+ if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
+ printf "%sT_IMEMO%s(", $color_type, $color_end
+ output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&RUBY_IMEMO_MASK)
+ printf "): "
+ rp_imemo $arg0
+ else
if ($flags & RUBY_T_MASK) == RUBY_T_NODE
- printf "T_NODE("
+ printf "%sT_NODE%s(", $color_type, $color_end
output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
printf "): "
print *(NODE *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
- printf "T_ZOMBIE: "
+ printf "%sT_ZOMBIE%s: ", $color_type, $color_end
print (struct RData *)($arg0)
else
- printf "unknown: "
+ if ($flags & RUBY_T_MASK) == RUBY_T_MOVED
+ printf "%sT_MOVED%s: ", $color_type, $color_end
+ print *(struct RMoved *)$arg0
+ else
+ printf "%sunknown%s: ", $color_type, $color_end
print (struct RBasic *)($arg0)
end
end
@@ -332,11 +303,303 @@ define rp
end
end
end
+ end
+ end
end
document rp
Print a Ruby's VALUE.
end
+define rp_id
+ set $id = (ID)$arg0
+ if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
+ printf "(:%c)\n", $id
+ else
+ if $id == idDot2
+ printf "(:..)\n"
+ else
+ if $id == idDot3
+ printf "(:...)\n"
+ else
+ if $id == idUPlus
+ printf "(:+@)\n"
+ else
+ if $id == idUMinus
+ printf "(:-@)\n"
+ else
+ if $id == idPow
+ printf "(:**)\n"
+ else
+ if $id == idCmp
+ printf "(:<=>)\n"
+ else
+ if $id == idLTLT
+ printf "(:<<)\n"
+ else
+ if $id == idGTGT
+ printf "(:>>)\n"
+ else
+ if $id == idLE
+ printf "(:<=)\n"
+ else
+ if $id == idGE
+ printf "(:>=)\n"
+ else
+ if $id == idEq
+ printf "(:==)\n"
+ else
+ if $id == idEqq
+ printf "(:===)\n"
+ else
+ if $id == idNeq
+ printf "(:!=)\n"
+ else
+ if $id == idEqTilde
+ printf "(:=~)\n"
+ else
+ if $id == idNeqTilde
+ printf "(:!~)\n"
+ else
+ if $id == idAREF
+ printf "(:[])\n"
+ else
+ if $id == idASET
+ printf "(:[]=)\n"
+ else
+ if $id == idCOLON2
+ printf "(:'::')\n"
+ else
+ if $id == idANDOP
+ printf "(:&&)\n"
+ else
+ if $id == idOROP
+ printf "(:||)\n"
+ else
+ if $id == idANDDOT
+ printf "(:&.)\n"
+ else
+ if $id <= tLAST_OP_ID
+ printf "O"
+ else
+ set $id_type = $id & RUBY_ID_SCOPE_MASK
+ if $id_type == RUBY_ID_LOCAL
+ printf "l"
+ else
+ if $id_type == RUBY_ID_INSTANCE
+ printf "i"
+ else
+ if $id_type == RUBY_ID_GLOBAL
+ printf "G"
+ else
+ if $id_type == RUBY_ID_ATTRSET
+ printf "a"
+ else
+ if $id_type == RUBY_ID_CONST
+ printf "C"
+ else
+ if $id_type == RUBY_ID_CLASS
+ printf "c"
+ else
+ printf "j"
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ printf "(%ld): ", $id
+ print_id $id
+ echo \n
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+end
+document rp_id
+ Print an ID.
+end
+
+define output_string
+ set $flags = ((struct RBasic*)($arg0))->flags
+ set $len = ($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.len : \
+ (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ if $len > 0
+ output *(char *)(($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.ptr : \
+ ((struct RString*)($arg0))->as.ary) @ $len
+ else
+ output ""
+ end
+end
+
+define print_string
+ set $flags = ((struct RBasic*)($arg0))->flags
+ set $len = ($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.len : \
+ (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ if $len > 0
+ printf "%s", *(char *)(($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.ptr : \
+ ((struct RString*)($arg0))->as.ary) @ $len
+ end
+end
+
+define rp_string
+ output_string $arg0
+ printf " bytesize:%ld ", $len
+ if !($flags & RUBY_FL_USER1)
+ printf "(embed) "
+ else
+ if ($flags & RUBY_FL_USER2)
+ printf "(shared) "
+ end
+ if ($flags & RUBY_FL_USER3)
+ printf "(assoc) "
+ end
+ end
+ printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+ if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
+ printf "coderange:unknown "
+ else
+ if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
+ printf "coderange:7bit "
+ else
+ if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
+ printf "coderange:valid "
+ else
+ printf "coderange:broken "
+ end
+ end
+ end
+ print (struct RString *)($arg0)
+end
+document rp_string
+ Print the content of a String.
+end
+
+define rp_bignum
+ set $flags = ((struct RBignum*)($arg0))->basic.flags
+ set $len = (($flags & RUBY_FL_USER2) ? \
+ ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+ ((struct RBignum*)($arg0))->as.heap.len)
+ printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
+ (($flags & RUBY_FL_USER1) != 0), $len
+ if $flags & RUBY_FL_USER2
+ printf "(embed) "
+ end
+ print (struct RBignum *)($arg0)
+ set $ptr = (($flags & RUBY_FL_USER2) ? \
+ ((struct RBignum*)($arg0))->as.ary : \
+ ((struct RBignum*)($arg0))->as.heap.digits)
+ set $len = $len-1
+ printf "0x%x", $ptr[$len]
+ while $len > 0
+ set $len = $len-1
+ set $val = $ptr[$len]
+ set $w = sizeof($ptr[0])
+ printf "_"
+ if $w > 8
+ printf "%.32x", $val
+ else
+ if $w > 4
+ printf "%.16x", $val
+ else
+ if $w > 2
+ printf "%.8x", $val
+ else
+ if $w > 1
+ printf "%.4x", $val
+ else
+ printf "%.2x", $val
+ end
+ end
+ end
+ end
+ end
+ printf "\n"
+end
+document rp_bignum
+ Print the content of a Bignum.
+end
+
+define rp_class
+ printf "(struct RClass *) %p", (void*)$arg0
+ if RCLASS_ORIGIN((struct RClass *)($arg0)) != $arg0
+ printf " -> %p", RCLASS_ORIGIN((struct RClass *)($arg0))
+ end
+ printf "\n"
+ rb_classname $arg0
+ print/x *(struct RClass *)($arg0)
+ print *RCLASS_EXT((struct RClass *)($arg0))
+end
+document rp_class
+ Print the content of a Class/Module.
+end
+
+define rp_imemo
+ set $flags = (enum imemo_type)((((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & RUBY_IMEMO_MASK)
+ if $flags == imemo_cref
+ printf "(rb_cref_t *) %p\n", (void*)$arg0
+ print *(rb_cref_t *)$arg0
+ else
+ if $flags == imemo_svar
+ printf "(struct vm_svar *) %p\n", (void*)$arg0
+ print *(struct vm_svar *)$arg0
+ else
+ if $flags == imemo_throw_data
+ printf "(struct vm_throw_data *) %p\n", (void*)$arg0
+ print *(struct vm_throw_data *)$arg0
+ else
+ if $flags == imemo_ifunc
+ printf "(struct vm_ifunc *) %p\n", (void*)$arg0
+ print *(struct vm_ifunc *)$arg0
+ else
+ if $flags == imemo_memo
+ printf "(struct MEMO *) %p\n", (void*)$arg0
+ print *(struct MEMO *)$arg0
+ else
+ if $flags == imemo_ment
+ printf "(rb_method_entry_t *) %p\n", (void*)$arg0
+ print *(rb_method_entry_t *)$arg0
+ else
+ if $flags == imemo_iseq
+ printf "(rb_iseq_t *) %p\n", (void*)$arg0
+ print *(rb_iseq_t *)$arg0
+ else
+ printf "(struct RIMemo *) %p\n", (void*)$arg0
+ print *(struct RIMemo *)$arg0
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+end
+document rp_imemo
+ Print the content of a memo
+end
+
define nd_type
print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
end
@@ -361,260 +624,237 @@ end
# Print members of ruby node.
define nd_head
- printf "u1.node: "
+ printf "%su1.node%s: ", $color_highlite, $color_end
rp ($arg0).u1.node
end
define nd_alen
- printf "u2.argc: "
+ printf "%su2.argc%s: ", $color_highlite, $color_end
p ($arg0).u2.argc
end
define nd_next
- printf "u3.node: "
+ printf "%su3.node%s: ", $color_highlite, $color_end
rp ($arg0).u3.node
end
define nd_cond
- printf "u1.node: "
+ printf "%su1.node%s: ", $color_highlite, $color_end
rp ($arg0).u1.node
end
define nd_body
- printf "u2.node: "
+ printf "%su2.node%s: ", $color_highlite, $color_end
rp ($arg0).u2.node
end
define nd_else
- printf "u3.node: "
+ printf "%su3.node%s: ", $color_highlite, $color_end
rp ($arg0).u3.node
end
define nd_orig
- printf "u3.value: "
+ printf "%su3.value%s: ", $color_highlite, $color_end
rp ($arg0).u3.value
end
define nd_resq
- printf "u2.node: "
+ printf "%su2.node%s: ", $color_highlite, $color_end
rp ($arg0).u2.node
end
define nd_ensr
- printf "u3.node: "
+ printf "%su3.node%s: ", $color_highlite, $color_end
rp ($arg0).u3.node
end
define nd_1st
- printf "u1.node: "
+ printf "%su1.node%s: ", $color_highlite, $color_end
rp ($arg0).u1.node
end
define nd_2nd
- printf "u2.node: "
+ printf "%su2.node%s: ", $color_highlite, $color_end
rp ($arg0).u2.node
end
define nd_stts
- printf "u1.node: "
+ printf "%su1.node%s: ", $color_highlite, $color_end
rp ($arg0).u1.node
end
define nd_entry
- printf "u3.entry: "
+ printf "%su3.entry%s: ", $color_highlite, $color_end
p ($arg0).u3.entry
end
define nd_vid
- printf "u1.id: "
+ printf "%su1.id%s: ", $color_highlite, $color_end
p ($arg0).u1.id
end
define nd_cflag
- printf "u2.id: "
+ printf "%su2.id%s: ", $color_highlite, $color_end
p ($arg0).u2.id
end
define nd_cval
- printf "u3.value: "
+ printf "%su3.value%s: ", $color_highlite, $color_end
rp ($arg0).u3.value
end
-
-define nd_cnt
- printf "u3.cnt: "
- p ($arg0).u3.cnt
-end
-
define nd_tbl
- printf "u1.tbl: "
+ printf "%su1.tbl%s: ", $color_highlite, $color_end
p ($arg0).u1.tbl
end
define nd_var
- printf "u1.node: "
+ printf "%su1.node%s: ", $color_highlite, $color_end
rp ($arg0).u1.node
end
define nd_ibdy
- printf "u2.node: "
+ printf "%su2.node%s: ", $color_highlite, $color_end
rp ($arg0).u2.node
end
define nd_iter
- printf "u3.node: "
+ printf "%su3.node%s: ", $color_highlite, $color_end
rp ($arg0).u3.node
end
define nd_value
- printf "u2.node: "
+ printf "%su2.node%s: ", $color_highlite, $color_end
rp ($arg0).u2.node
end
define nd_aid
- printf "u3.id: "
+ printf "%su3.id%s: ", $color_highlite, $color_end
p ($arg0).u3.id
end
define nd_lit
- printf "u1.value: "
+ printf "%su1.value%s: ", $color_highlite, $color_end
rp ($arg0).u1.value
end
-
-define nd_frml
- printf "u1.node: "
- rp ($arg0).u1.node
-end
-
define nd_rest
- printf "u2.argc: "
+ printf "%su2.argc%s: ", $color_highlite, $color_end
p ($arg0).u2.argc
end
define nd_opt
- printf "u1.node: "
+ printf "%su1.node%s: ", $color_highlite, $color_end
rp ($arg0).u1.node
end
define nd_recv
- printf "u1.node: "
+ printf "%su1.node%s: ", $color_highlite, $color_end
rp ($arg0).u1.node
end
define nd_mid
- printf "u2.id: "
+ printf "%su2.id%s: ", $color_highlite, $color_end
p ($arg0).u2.id
end
define nd_args
- printf "u3.node: "
+ printf "%su3.node%s: ", $color_highlite, $color_end
rp ($arg0).u3.node
end
-
-define nd_noex
- printf "u1.id: "
- p ($arg0).u1.id
-end
-
define nd_defn
- printf "u3.node: "
+ printf "%su3.node%s: ", $color_highlite, $color_end
rp ($arg0).u3.node
end
define nd_old
- printf "u1.id: "
+ printf "%su1.id%s: ", $color_highlite, $color_end
p ($arg0).u1.id
end
define nd_new
- printf "u2.id: "
+ printf "%su2.id%s: ", $color_highlite, $color_end
p ($arg0).u2.id
end
-define nd_cfnc
- printf "u1.cfunc: "
- p ($arg0).u1.cfunc
-end
-
-define nd_argc
- printf "u2.argc: "
- p ($arg0).u2.argc
-end
-
-
define nd_cname
- printf "u1.id: "
+ printf "%su1.id%s: ", $color_highlite, $color_end
p ($arg0).u1.id
end
define nd_super
- printf "u3.node: "
+ printf "%su3.node%s: ", $color_highlite, $color_end
rp ($arg0).u3.node
end
define nd_modl
- printf "u1.id: "
+ printf "%su1.id%s: ", $color_highlite, $color_end
p ($arg0).u1.id
end
define nd_clss
- printf "u1.value: "
+ printf "%su1.value%s: ", $color_highlite, $color_end
rp ($arg0).u1.value
end
define nd_beg
- printf "u1.node: "
+ printf "%su1.node%s: ", $color_highlite, $color_end
rp ($arg0).u1.node
end
define nd_end
- printf "u2.node: "
+ printf "%su2.node%s: ", $color_highlite, $color_end
rp ($arg0).u2.node
end
define nd_state
- printf "u3.state: "
+ printf "%su3.state%s: ", $color_highlite, $color_end
p ($arg0).u3.state
end
define nd_rval
- printf "u2.value: "
+ printf "%su2.value%s: ", $color_highlite, $color_end
rp ($arg0).u2.value
end
define nd_nth
- printf "u2.argc: "
+ printf "%su2.argc%s: ", $color_highlite, $color_end
p ($arg0).u2.argc
end
define nd_tag
- printf "u1.id: "
+ printf "%su1.id%s: ", $color_highlite, $color_end
p ($arg0).u1.id
end
define nd_tval
- printf "u2.value: "
+ printf "%su2.value%s: ", $color_highlite, $color_end
rp ($arg0).u2.value
end
+define nd_tree
+ set $buf = (struct RString *)rb_str_buf_new(0)
+ call dump_node((VALUE)($buf), rb_str_tmp_new(0), 0, ($arg0))
+ printf "%s\n", $buf->as.heap.ptr
+end
+
define rb_p
call rb_p($arg0)
end
@@ -625,18 +865,18 @@ define rb_numtable_entry
set $rb_numtable_key = 0
set $rb_numtable_rec = 0
if $rb_numtable_tbl->entries_packed
- set $rb_numtable_p = $rb_numtable_tbl->bins
- while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->bins+$rb_numtable_tbl->num_entries
- if (st_data_t)$rb_numtable_p[0] == $rb_numtable_id
- set $rb_numtable_key = (st_data_t)$rb_numtable_p[0]
- set $rb_numtable_rec = (st_data_t)$rb_numtable_p[1]
+ set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
+ while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
+ if $rb_numtable_p.k == $rb_numtable_id
+ set $rb_numtable_key = $rb_numtable_p.k
+ set $rb_numtable_rec = $rb_numtable_p.v
set $rb_numtable_p = 0
else
- set $rb_numtable_p = $rb_numtable_p + 2
+ set $rb_numtable_p = $rb_numtable_p + 1
end
end
else
- set $rb_numtable_p = $rb_numtable_tbl->bins[$rb_numtable_id % $rb_numtable_tbl->num_bins]
+ set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
while $rb_numtable_p
if $rb_numtable_p->key == $rb_numtable_id
set $rb_numtable_key = $rb_numtable_p->key
@@ -650,12 +890,9 @@ define rb_numtable_entry
end
define rb_id2name
- rb_numtable_entry global_symbols.id_str (ID)$arg0
- if $rb_numtable_rec
- rp $rb_numtable_rec
- else
- echo undef\n
- end
+ ruby_gdb_init
+ printf "%sID%s: ", $color_type, $color_end
+ rp_id $arg0
end
document rb_id2name
Print the name of id
@@ -666,10 +903,10 @@ define rb_method_entry
set $rb_method_entry_id = (ID)$arg1
set $rb_method_entry_me = (rb_method_entry_t *)0
while !$rb_method_entry_me && $rb_method_entry_klass
- rb_numtable_entry $rb_method_entry_klass->m_tbl $rb_method_entry_id
+ rb_numtable_entry $rb_method_entry_klass->m_tbl_wrapper->tbl $rb_method_entry_id
set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
if !$rb_method_entry_me
- set $rb_method_entry_klass = (struct RClass *)$rb_method_entry_klass->ptr->super
+ set $rb_method_entry_klass = (struct RClass *)RCLASS_SUPER($rb_method_entry_klass)
end
end
if $rb_method_entry_me
@@ -684,9 +921,24 @@ document rb_method_entry
end
define rb_classname
- call classname($arg0)
- rb_p $
- print *(struct RClass*)($arg0)
+ # up to 128bit int
+ set $rb_classname = rb_mod_name($arg0)
+ if $rb_classname != RUBY_Qnil
+ rp $rb_classname
+ else
+ echo anonymous class/module\n
+ end
+end
+
+define rb_ancestors
+ set $rb_ancestors_module = $arg0
+ while $rb_ancestors_module
+ rp_class $rb_ancestors_module
+ set $rb_ancestors_module = RCLASS_SUPER($rb_ancestors_module)
+ end
+end
+document rb_ancestors
+ Print ancestors.
end
define rb_backtrace
@@ -694,7 +946,7 @@ define rb_backtrace
end
define iseq
- if dummy_gdb_enums.special_consts
+ if ruby_dummy_gdb_enums.special_consts
end
if ($arg0)->type == ISEQ_ELEMENT_NONE
echo [none]\n
@@ -719,7 +971,7 @@ define iseq
end
define rb_ps
- rb_ps_vm ruby_current_vm
+ rb_ps_vm ruby_current_vm_ptr
end
document rb_ps
Dump all threads and their callstacks
@@ -727,31 +979,372 @@ end
define rb_ps_vm
print $ps_vm = (rb_vm_t*)$arg0
- set $ps_threads = (st_table*)$ps_vm->living_threads
- if $ps_threads->entries_packed
- set $ps_threads_i = 0
- while $ps_threads_i < $ps_threads->num_entries
- set $ps_threads_key = (st_data_t)$ps_threads->bins[$ps_threads_i * 2]
- set $ps_threads_val = (st_data_t)$ps_threads->bins[$ps_threads_i * 2 + 1]
- rb_ps_thread $ps_threads_key $ps_threads_val
- set $ps_threads_i = $ps_threads_i + 1
- end
- else
- set $ps_threads_ptr = (st_table_entry*)$ps_threads->head
- while $ps_threads_ptr
- set $ps_threads_key = (st_data_t)$ps_threads_ptr->key
- set $ps_threads_val = (st_data_t)$ps_threads_ptr->record
- rb_ps_thread $ps_threads_key $ps_threads_val
- set $ps_threads_ptr = (st_table_entry*)$ps_threads_ptr->fore
+ set $ps_thread_ln = $ps_vm->ractor.main_ractor.threads.set.n.next
+ set $ps_thread_ln_last = $ps_vm->ractor.main_ractor.threads.set.n.prev
+ while 1
+ set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
+ set $ps_thread = (VALUE)($ps_thread_th->self)
+ rb_ps_thread $ps_thread
+ if $ps_thread_ln == $ps_thread_ln_last
+ loop_break
end
+ set $ps_thread_ln = $ps_thread_ln->next
end
end
document rb_ps_vm
Dump all threads in a (rb_vm_t*) and their callstacks
end
+define print_lineno
+ set $cfp = $arg0
+ set $iseq = $cfp->iseq
+ set $pos = $cfp->pc - $iseq->body->iseq_encoded
+ if $pos != 0
+ set $pos = $pos - 1
+ end
+
+ set $index = 0
+ set $size = $iseq->body->insns_info.size
+ set $table = $iseq->body->insns_info.body
+ set $positions = $iseq->body->insns_info.positions
+ #printf "size: %d\n", $size
+ if $size == 0
+ else
+ if $size == 1
+ printf "%d", $table[0].line_no
+ else
+ if $positions
+ # get_insn_info_linear_search
+ set $index = 1
+ while $index < $size
+ #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $positions[$i], $table[$i].line_no, $pos
+ if $positions[$index] > $pos
+ loop_break
+ end
+ set $index = $index + 1
+ if $positions[$index] == $pos
+ loop_break
+ end
+ end
+ else
+ # get_insn_info_succinct_bitvector
+ set $sd = $iseq->body->insns_info.succ_index_table
+ set $immediate_table_size = sizeof($sd->imm_part) / sizeof(uint64_t) * 9
+ if $pos < $immediate_table_size
+ set $i = $pos / 9
+ set $j = $pos % 9
+ set $index = ((int)($sd->imm_part[$i] >> ($j * 7))) & 0x7f
+ else
+ set $block_index = ($pos - $immediate_table_size) / 512
+ set $block = &$sd->succ_part[$block_index]
+ set $block_bit_index = ($pos - $immediate_table_size) % 512
+ set $small_block_index = $block_bit_index / 64
+ set $small_block_popcount = $small_block_index == 0 ? 0 : (((int)($block->small_block_ranks >> (($small_block_index - 1) * 9))) & 0x1ff)
+ set $x = $block->bits[$small_block_index] << (63 - $block_bit_index % 64)
+ set $x = ($x & 0x5555555555555555) + ($x >> 1 & 0x5555555555555555)
+ set $x = ($x & 0x3333333333333333) + ($x >> 2 & 0x3333333333333333)
+ set $x = ($x & 0x0707070707070707) + ($x >> 4 & 0x0707070707070707)
+ set $x = ($x & 0x001f001f001f001f) + ($x >> 8 & 0x001f001f001f001f)
+ set $x = ($x & 0x0000003f0000003f) + ($x >>16 & 0x0000003f0000003f)
+ set $popcnt = ($x & 0x7f) + ($x >>32 & 0x7f)
+ set $index = $block->rank + $small_block_popcount + $popcnt
+ end
+ end
+ printf "%d", $table[$index-1].line_no
+ end
+ end
+end
+
+define check_method_entry
+ set $imemo = (struct RBasic *)$arg0
+ if $imemo != RUBY_Qfalse
+ set $type = ($imemo->flags >> 12) & 0x07
+ if $type == imemo_ment
+ set $me = (rb_callable_method_entry_t *)$imemo
+ else
+ if $type == imemo_svar
+ set $imemo = ((struct vm_svar *)$imemo)->cref_or_me
+ check_method_entry $imemo
+ end
+ end
+ end
+end
+
+define print_id
+ set $id = $arg0
+ # rb_id_to_serial
+ if $id > tLAST_OP_ID
+ set $serial = (rb_id_serial_t)($id >> RUBY_ID_SCOPE_SHIFT)
+ else
+ set $serial = (rb_id_serial_t)$id
+ end
+ if $serial && $serial <= ruby_global_symbols.last_id
+ set $idx = $serial / ID_ENTRY_UNIT
+ set $ids = (struct RArray *)ruby_global_symbols.ids
+ set $flags = $ids->basic.flags
+ if ($flags & RUBY_FL_USER1)
+ set $idsptr = $ids->as.ary
+ set $idslen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+ else
+ set $idsptr = $ids->as.heap.ptr
+ set $idslen = $ids->as.heap.len
+ end
+ if $idx < $idslen
+ set $t = 0
+ set $ary = (struct RArray *)$idsptr[$idx]
+ if $ary != RUBY_Qnil
+ set $flags = $ary->basic.flags
+ if ($flags & RUBY_FL_USER1)
+ set $aryptr = $ary->as.ary
+ set $arylen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+ else
+ set $aryptr = $ary->as.heap.ptr
+ set $arylen = $ary->as.heap.len
+ end
+ set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
+ if $result != RUBY_Qnil
+ print_string $result
+ else
+ echo undef
+ end
+ end
+ end
+ end
+end
+
+define print_pathobj
+ set $flags = ((struct RBasic*)($arg0))->flags
+ if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+ print_string $arg0
+ end
+ if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+ if $flags & RUBY_FL_USER1
+ set $str = ((struct RArray*)($arg0))->as.ary[0]
+ else
+ set $str = ((struct RArray*)($arg0))->as.heap.ptr[0]
+ end
+ print_string $str
+ end
+end
+
define rb_ps_thread
set $ps_thread = (struct RTypedData*)$arg0
- set $ps_thread_id = $arg1
- print $ps_thread_th = (rb_thread_t*)$ps_thread->data
+ set $ps_thread_th = (rb_thread_t*)$ps_thread->data
+ printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
+ $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
+ set $cfp = $ps_thread_th->ec->cfp
+ set $cfpend = (rb_control_frame_t *)($ps_thread_th->ec->vm_stack + $ps_thread_th->ec->vm_stack_size)-1
+ while $cfp < $cfpend
+ if $cfp->iseq
+ if !((VALUE)$cfp->iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$cfp->iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
+ printf "%d:ifunc ", $cfpend-$cfp
+ set print symbol-filename on
+ output/a $cfp->iseq.body
+ set print symbol-filename off
+ printf "\n"
+ else
+ if $cfp->pc
+ set $location = $cfp->iseq->body->location
+ printf "%d:", $cfpend-$cfp
+ print_pathobj $location.pathobj
+ printf ":"
+ print_lineno $cfp
+ printf ":in `"
+ print_string $location.label
+ printf "'\n"
+ else
+ printf "%d: ???.rb:???:in `???'\n", $cfpend-$cfp
+ end
+ end
+ else
+ # if VM_FRAME_TYPE($cfp->flag) == VM_FRAME_MAGIC_CFUNC
+ set $ep = $cfp->ep
+ if ($ep[0] & 0xffff0001) == 0x55550001
+ #define VM_ENV_FLAG_LOCAL 0x02
+ #define VM_ENV_PREV_EP(ep) GC_GUARDED_PTR_REF(ep[VM_ENV_DATA_INDEX_SPECVAL])
+ set $me = 0
+ set $env_specval = $ep[-1]
+ set $env_me_cref = $ep[-2]
+ while ($env_specval & 0x02) != 0
+ check_method_entry $env_me_cref
+ if $me != 0
+ loop_break
+ end
+ set $ep = $ep[0]
+ set $env_specval = $ep[-1]
+ set $env_me_cref = $ep[-2]
+ end
+ if $me == 0
+ check_method_entry $env_me_cref
+ end
+ printf "%d:", $cfpend-$cfp
+ set print symbol-filename on
+ output/a $me->def->body.cfunc.func
+ set print symbol-filename off
+ set $mid = $me->def->original_id
+ printf ":in `"
+ print_id $mid
+ printf "'\n"
+ else
+ printf "%d:unknown_frame:???:in `???'\n", $cfpend-$cfp
+ end
+ end
+ set $cfp = $cfp + 1
+ end
+end
+
+define rb_count_objects
+ set $objspace = ruby_current_vm_ptr->objspace
+ set $counts_00 = 0
+ set $counts_01 = 0
+ set $counts_02 = 0
+ set $counts_03 = 0
+ set $counts_04 = 0
+ set $counts_05 = 0
+ set $counts_06 = 0
+ set $counts_07 = 0
+ set $counts_08 = 0
+ set $counts_09 = 0
+ set $counts_0a = 0
+ set $counts_0b = 0
+ set $counts_0c = 0
+ set $counts_0d = 0
+ set $counts_0e = 0
+ set $counts_0f = 0
+ set $counts_10 = 0
+ set $counts_11 = 0
+ set $counts_12 = 0
+ set $counts_13 = 0
+ set $counts_14 = 0
+ set $counts_15 = 0
+ set $counts_16 = 0
+ set $counts_17 = 0
+ set $counts_18 = 0
+ set $counts_19 = 0
+ set $counts_1a = 0
+ set $counts_1b = 0
+ set $counts_1c = 0
+ set $counts_1d = 0
+ set $counts_1e = 0
+ set $counts_1f = 0
+ set $total = 0
+ set $i = 0
+ while $i < $objspace->heap_pages.allocated_pages
+ printf "\rcounting... %d/%d", $i, $objspace->heap_pages.allocated_pages
+ set $page = $objspace->heap_pages.sorted[$i]
+ set $p = $page->start
+ set $pend = $p + $page->total_slots
+ while $p < $pend
+ set $flags = $p->as.basic.flags & 0x1f
+ eval "set $counts_%02x = $counts_%02x + 1", $flags, $flags
+ set $p = $p + 1
+ end
+ set $total = $total + $page->total_slots
+ set $i = $i + 1
+ end
+ printf "\rTOTAL: %d, FREE: %d\n", $total, $counts_00
+ printf "T_OBJECT: %d\n", $counts_01
+ printf "T_CLASS: %d\n", $counts_02
+ printf "T_MODULE: %d\n", $counts_03
+ printf "T_FLOAT: %d\n", $counts_04
+ printf "T_STRING: %d\n", $counts_05
+ printf "T_REGEXP: %d\n", $counts_06
+ printf "T_ARRAY: %d\n", $counts_07
+ printf "T_HASH: %d\n", $counts_08
+ printf "T_STRUCT: %d\n", $counts_09
+ printf "T_BIGNUM: %d\n", $counts_0a
+ printf "T_FILE: %d\n", $counts_0b
+ printf "T_DATA: %d\n", $counts_0c
+ printf "T_MATCH: %d\n", $counts_0d
+ printf "T_COMPLEX: %d\n", $counts_0e
+ printf "T_RATIONAL: %d\n", $counts_0f
+ #printf "UNKNOWN_10: %d\n", $counts_10
+ printf "T_NIL: %d\n", $counts_11
+ printf "T_TRUE: %d\n", $counts_12
+ printf "T_FALSE: %d\n", $counts_13
+ printf "T_SYMBOL: %d\n", $counts_14
+ printf "T_FIXNUM: %d\n", $counts_15
+ printf "T_UNDEF: %d\n", $counts_16
+ #printf "UNKNOWN_17: %d\n", $counts_17
+ #printf "UNKNOWN_18: %d\n", $counts_18
+ #printf "UNKNOWN_19: %d\n", $counts_19
+ printf "T_IMEMO: %d\n", $counts_1a
+ printf "T_NODE: %d\n", $counts_1b
+ printf "T_ICLASS: %d\n", $counts_1c
+ printf "T_ZOMBIE: %d\n", $counts_1d
+ #printf "UNKNOWN_1E: %d\n", $counts_1e
+ printf "T_MASK: %d\n", $counts_1f
+end
+document rb_count_objects
+ Counts all objects grouped by type.
+end
+
+# Details: https://bugs.ruby-lang.org/projects/ruby-master/wiki/MachineInstructionsTraceWithGDB
+define trace_machine_instructions
+ set logging on
+ set height 0
+ set width 0
+ display/i $pc
+ while !$exit_code
+ info line *$pc
+ si
+ end
+end
+
+define SDR
+ call rb_vmdebug_stack_dump_raw_current()
+end
+
+define rbi
+ if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_LABEL
+ p *(LABEL*)$arg0
+ else
+ if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_INSN
+ p *(INSN*)$arg0
+ else
+ if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_ADJUST
+ p *(ADJUST*)$arg0
+ else
+ print *$arg0
+ end
+ end
+ end
+end
+
+define dump_node
+ set $str = rb_parser_dump_tree($arg0, 0)
+ set $flags = ((struct RBasic*)($str))->flags
+ printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)$str)->as.heap.ptr : \
+ ((struct RString*)$str)->as.ary)
+end
+
+define print_flags
+ printf "RUBY_FL_WB_PROTECTED: %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_WB_PROTECTED ? "1" : "0"
+ printf "RUBY_FL_PROMOTED0 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED0 ? "1" : "0"
+ printf "RUBY_FL_PROMOTED1 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED1 ? "1" : "0"
+ printf "RUBY_FL_FINALIZE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FINALIZE ? "1" : "0"
+ printf "RUBY_FL_SHAREABLE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_SHAREABLE ? "1" : "0"
+ printf "RUBY_FL_EXIVAR : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_EXIVAR ? "1" : "0"
+ printf "RUBY_FL_FREEZE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FREEZE ? "1" : "0"
+
+ printf "RUBY_FL_USER0 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER0 ? "1" : "0"
+ printf "RUBY_FL_USER1 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER1 ? "1" : "0"
+ printf "RUBY_FL_USER2 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER2 ? "1" : "0"
+ printf "RUBY_FL_USER3 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER3 ? "1" : "0"
+ printf "RUBY_FL_USER4 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER4 ? "1" : "0"
+ printf "RUBY_FL_USER5 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER5 ? "1" : "0"
+ printf "RUBY_FL_USER6 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER6 ? "1" : "0"
+ printf "RUBY_FL_USER7 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER7 ? "1" : "0"
+ printf "RUBY_FL_USER8 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER8 ? "1" : "0"
+ printf "RUBY_FL_USER9 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER9 ? "1" : "0"
+ printf "RUBY_FL_USER10 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER10 ? "1" : "0"
+ printf "RUBY_FL_USER11 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER11 ? "1" : "0"
+ printf "RUBY_FL_USER12 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER12 ? "1" : "0"
+ printf "RUBY_FL_USER13 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER13 ? "1" : "0"
+ printf "RUBY_FL_USER14 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER14 ? "1" : "0"
+ printf "RUBY_FL_USER15 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER15 ? "1" : "0"
+ printf "RUBY_FL_USER16 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER16 ? "1" : "0"
+ printf "RUBY_FL_USER17 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER17 ? "1" : "0"
+ printf "RUBY_FL_USER18 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER18 ? "1" : "0"
end
diff --git a/.git-blame-ignore-revs b/.git-blame-ignore-revs
new file mode 100644
index 0000000000..6c5eac5a0f
--- /dev/null
+++ b/.git-blame-ignore-revs
@@ -0,0 +1,23 @@
+# This is a file used by GitHub to ignore the following commits on `git blame`.
+#
+# You can also do the same thing in your local repository with:
+# $ git config --local blame.ignoreRevsFile .git-blame-ignore-revs
+
+# Expand tabs
+5b21e94bebed90180d8ff63dad03b8b948361089
+
+# Enable Style/StringLiterals cop for RubyGems/Bundler
+d7ffd3fea402239b16833cc434404a7af82d44f3
+
+# [ruby/digest] Revert tab-expansion in external files
+48b09aae7ec5632209229dcc294dd0d75a93a17f
+8a65cf3b61c60e4cb886f59a73ff6db44364bfa9
+39dc9f9093901d40d2998653948d5da38b18ee2c
+
+# [ruby/io-nonblock] Revert tab expansion
+f28287d34c03f472ffe90ea262bdde9affd4b965
+0d842fecb4f75ab3b1d4097ebdb8e88f51558041
+4ba2c66761d6a293abdfba409241d31063cefd62
+
+# Make benchmark indentation consistent
+fc4acf8cae82e5196186d3278d831f2438479d91
diff --git a/.gitattributes b/.gitattributes
new file mode 100644
index 0000000000..d0c2d266b4
--- /dev/null
+++ b/.gitattributes
@@ -0,0 +1,8 @@
+*.gemspec diff=ruby
+*.rb diff=ruby
+bin svn-properties=svn:ignore=ruby
+bin/* diff=ruby
+tool/update-deps diff=ruby
+tool/make-snapshot diff=ruby
+tool/format-release diff=ruby
+tool/leaked-globals diff=ruby
diff --git a/.github/SECURITY.md b/.github/SECURITY.md
new file mode 100644
index 0000000000..56baa29942
--- /dev/null
+++ b/.github/SECURITY.md
@@ -0,0 +1,9 @@
+# Security Policy
+
+## Supported Versions
+
+See <https://www.ruby-lang.org/en/downloads/branches/>.
+
+## Reporting a Vulnerability
+
+See <https://www.ruby-lang.org/en/security/>.
diff --git a/.github/auto_request_review.yml b/.github/auto_request_review.yml
new file mode 100644
index 0000000000..d058b6ca00
--- /dev/null
+++ b/.github/auto_request_review.yml
@@ -0,0 +1,9 @@
+files:
+ 'yjit*': [team:yjit]
+ 'yjit/**/*': [team:yjit]
+ 'doc/yjit/*': [team:yjit]
+ 'bootstraptest/test_yjit*': [team:yjit]
+ 'test/ruby/test_yjit*': [team:yjit]
+ '.github/workflows/yjit*': [team:yjit]
+options:
+ ignore_draft: true
diff --git a/.github/codeql/codeql-config.yml b/.github/codeql/codeql-config.yml
new file mode 100644
index 0000000000..91f82b842b
--- /dev/null
+++ b/.github/codeql/codeql-config.yml
@@ -0,0 +1,3 @@
+name: "CodeQL config for the Ruby language"
+
+languages: cpp
diff --git a/.github/dependabot.yml b/.github/dependabot.yml
new file mode 100644
index 0000000000..bc63aca35b
--- /dev/null
+++ b/.github/dependabot.yml
@@ -0,0 +1,6 @@
+version: 2
+updates:
+ - package-ecosystem: 'github-actions'
+ directory: '/'
+ schedule:
+ interval: 'monthly'
diff --git a/.github/workflows/auto_request_review.yml b/.github/workflows/auto_request_review.yml
new file mode 100644
index 0000000000..340aae4391
--- /dev/null
+++ b/.github/workflows/auto_request_review.yml
@@ -0,0 +1,19 @@
+name: Auto Request Review
+on:
+ pull_request_target:
+ types: [opened, ready_for_review, reopened]
+
+permissions:
+ contents: read
+
+jobs:
+ auto-request-review:
+ name: Auto Request Review
+ runs-on: ubuntu-latest
+ if: ${{ github.repository == 'ruby/ruby' }}
+ steps:
+ - name: Request review based on files changes and/or groups the author belongs to
+ uses: necojackarc/auto-request-review@5f91f424cabb3211c669e49e79da8363f7df395b # v0.10.0
+ with:
+ # scope: public_repo
+ token: ${{ secrets.MATZBOT_GITHUB_TOKEN }}
diff --git a/.github/workflows/baseruby.yml b/.github/workflows/baseruby.yml
new file mode 100644
index 0000000000..3b21225491
--- /dev/null
+++ b/.github/workflows/baseruby.yml
@@ -0,0 +1,80 @@
+name: BASERUBY Check
+
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ baseruby:
+ name: BASERUBY
+ runs-on: ubuntu-20.04
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ strategy:
+ matrix:
+ ruby:
+ - ruby-2.2
+# - ruby-2.3
+# - ruby-2.4
+# - ruby-2.5
+# - ruby-2.6
+# - ruby-2.7
+ - ruby-3.0
+ - ruby-3.1
+
+ steps:
+ - uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: .downloaded-cache
+ key: downloaded-cache
+ - uses: ruby/setup-ruby@4b2d1d631efa087f8896c15a0c6023dc2f483198 # v1.128.0
+ with:
+ ruby-version: ${{ matrix.ruby }}
+ bundler: none
+ - run: echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - run: sudo apt-get install build-essential autoconf bison libyaml-dev
+ - run: ./autogen.sh
+ - run: ./configure --disable-install-doc
+ - run: make common-srcs
+ - run: make incs
+ - run: make all
+ - run: make test
+ - uses: ruby/action-slack@b6882ea6ef8f556f9f9af9ec1220d3f1ced74acf # v3.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / BASERUBY @ ${{ matrix.ruby }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
diff --git a/.github/workflows/bundled_gems.yml b/.github/workflows/bundled_gems.yml
new file mode 100644
index 0000000000..d81059f298
--- /dev/null
+++ b/.github/workflows/bundled_gems.yml
@@ -0,0 +1,166 @@
+name: bundled_gems
+
+on:
+ push:
+ branches: [ "master" ]
+ paths:
+ - '.github/workflows/bundled_gems.yml'
+ - 'gems/bundled_gems'
+ pull_request:
+ branches: [ "master" ]
+ paths:
+ - '.github/workflows/bundled_gems.yml'
+ - 'gems/bundled_gems'
+ merge_group:
+ branches: [ "master" ]
+ paths:
+ - '.github/workflows/bundled_gems.yml'
+ - 'gems/bundled_gems'
+ schedule:
+ - cron: '45 6 * * *'
+ workflow_dispatch:
+
+permissions: # added using https://github.com/step-security/secure-workflows
+ contents: read
+
+jobs:
+ update:
+ permissions:
+ contents: write # for Git to git push
+ if: ${{ github.event_name != 'schedule' || github.repository == 'ruby/ruby' }}
+ name: update ${{ github.workflow }}
+ runs-on: ubuntu-latest
+ steps:
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+
+ - name: Set ENV
+ run: |
+ echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ echo "TODAY=$(date +%F)" >> $GITHUB_ENV
+
+ - uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: .downloaded-cache
+ key: downloaded-cache-${{ github.sha }}
+ restore-keys: |
+ downloaded-cache
+
+ - name: Download previous gems list
+ run: |
+ data=bundled_gems.json
+ mkdir -p .downloaded-cache
+ ln -s .downloaded-cache/$data .
+ curl -O -R -z ./$data https://stdgems.org/$data
+
+ - name: Update bundled gems list
+ run: |
+ ruby -i~ tool/update-bundled_gems.rb gems/bundled_gems
+
+ - name: Maintain updated gems list in NEWS
+ run: |
+ #!ruby
+ require 'json'
+ news = File.read("NEWS.md")
+ prev = news[/since the \*+(\d+\.\d+\.\d+)\*+/, 1]
+ prevs = [prev, prev.sub(/\.\d+\z/, '')]
+ %W[bundled].each do |type|
+ last = JSON.parse(File.read("#{type}_gems.json"))['gems'].filter_map do |g|
+ v = g['versions'].values_at(*prevs).compact.first
+ g = g['gem']
+ g = 'RubyGems' if g == 'rubygems'
+ [g, v] if v
+ end.to_h
+ changed = File.foreach("gems/#{type}_gems").filter_map do |l|
+ next if l.start_with?("#")
+ g, v = l.split(" ", 3)
+ [g, v] unless last[g] == v
+ end
+ changed, added = changed.partition {|g, _| last[g]}
+ news.sub!(/^\*( +)The following #{type} gems? are updated\.\n+\K(?: \1\*( +).*\n)*/) do
+ mark = "#{$1} *#{$2}"
+ changed.map {|g, v|"#{mark}#{g} #{v}\n"}.join("")
+ end or next
+ news.sub!(/^\*( +)The following default gems are now bundled gems\.\n+\K(?: \1\*( +).*\n)*/) do
+ mark = "#{$1} *#{$2}"
+ added.map {|g, v|"#{mark}#{g} #{v}\n"}.join("")
+ end or next unless added.empty?
+ File.write("NEWS.md", news)
+ end
+ shell: ruby {0}
+
+ - name: Check diffs
+ id: diff
+ run: |
+ git add -- NEWS.md
+ git diff --no-ext-diff --ignore-submodules --quiet -- gems/bundled_gems
+ continue-on-error: true
+
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+ if: ${{ steps.diff.outcome == 'failure' }}
+
+ - name: Build
+ run: |
+ ./autogen.sh
+ ./configure -C --disable-install-doc
+ make
+ if: ${{ steps.diff.outcome == 'failure' }}
+
+ - name: Prepare bundled gems
+ run: |
+ make -s prepare-gems
+ if: ${{ steps.diff.outcome == 'failure' }}
+
+ - name: Test bundled gems
+ run: |
+ make -s test-bundled-gems
+ git add -- gems/bundled_gems
+ timeout-minutes: 30
+ env:
+ RUBY_TESTOPTS: "-q --tty=no"
+ TEST_BUNDLED_GEMS_ALLOW_FAILURES: ""
+ if: ${{ steps.diff.outcome == 'failure' }}
+
+ - name: Show diffs
+ id: show
+ run: |
+ git diff --cached --color --no-ext-diff --ignore-submodules --exit-code --
+ continue-on-error: true
+
+ - name: Commit
+ run: |
+ git pull --ff-only origin ${GITHUB_REF#refs/heads/}
+ message="Update bundled gems list at "
+ if [ ${{ steps.diff.outcome }} = success ]; then
+ git commit --message="${message}${GITHUB_SHA:0:30} [ci skip]"
+ else
+ git commit --message="${message}${TODAY}"
+ fi
+ git push origin ${GITHUB_REF#refs/heads/}
+ env:
+ EMAIL: svn-admin@ruby-lang.org
+ GIT_AUTHOR_NAME: git
+ GIT_COMMITTER_NAME: git
+ if: ${{ github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull') && steps.show.outcome == 'failure' }}
+
+ - uses: ruby/action-slack@b6882ea6ef8f556f9f9af9ec1220d3f1ced74acf # v3.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / update",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
diff --git a/.github/workflows/check_dependencies.yml b/.github/workflows/check_dependencies.yml
new file mode 100644
index 0000000000..a2502d1106
--- /dev/null
+++ b/.github/workflows/check_dependencies.yml
@@ -0,0 +1,78 @@
+name: Check Dependencies
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ update-deps:
+ strategy:
+ matrix:
+ os: [ubuntu-20.04]
+ fail-fast: true
+ runs-on: ${{ matrix.os }}
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+ if: ${{ contains(matrix.os, 'ubuntu') }}
+ - name: Install libraries
+ run: |
+ brew install gmp libffi openssl@1.1 zlib autoconf automake libtool readline
+ if: ${{ contains(matrix.os, 'macos') }}
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: .downloaded-cache
+ key: downloaded-cache
+ - run: ./autogen.sh
+ - name: Run configure
+ run: ./configure -C --disable-install-doc --disable-rubygems --with-gcc 'optflags=-O0' 'debugflags=-save-temps=obj -g'
+ - run: make all golf
+ - run: ruby tool/update-deps --fix
+ - run: git diff --no-ext-diff --ignore-submodules --exit-code
+ - uses: ruby/action-slack@b6882ea6ef8f556f9f9af9ec1220d3f1ced74acf # v3.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ matrix.os }} / Dependencies need to update",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
diff --git a/.github/workflows/codeql-analysis.yml b/.github/workflows/codeql-analysis.yml
new file mode 100644
index 0000000000..b86bec4224
--- /dev/null
+++ b/.github/workflows/codeql-analysis.yml
@@ -0,0 +1,74 @@
+name: "Code scanning - action"
+
+on:
+ # push:
+ # paths-ignore:
+ # - 'doc/**'
+ # - '**/man'
+ # - '**.md'
+ # - '**.rdoc'
+ # - '**/.document'
+ # pull_request:
+ # paths-ignore:
+ # - 'doc/**'
+ # - '**/man'
+ # - '**.md'
+ # - '**.rdoc'
+ # - '**/.document'
+ schedule:
+ - cron: '0 12 * * *'
+ workflow_dispatch:
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions: # added using https://github.com/step-security/secure-workflows
+ contents: read
+
+jobs:
+ CodeQL-Build:
+
+ # CodeQL runs on ubuntu-latest and windows-latest
+ permissions:
+ actions: read # for github/codeql-action/init to get workflow details
+ contents: read # for actions/checkout to fetch code
+ security-events: write # for github/codeql-action/autobuild to send a status report
+ runs-on: ubuntu-latest
+ # CodeQL fails to run pull requests from dependabot due to missing write access to upload results.
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') && github.event.head_commit.pusher.name != 'dependabot[bot]' }}
+
+ env:
+ enable_install_doc: no
+
+ steps:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+
+ - name: Checkout repository
+ uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: .downloaded-cache
+ key: downloaded-cache
+
+ - name: Remove an obsolete rubygems vendored file
+ run: sudo rm /usr/lib/ruby/vendor_ruby/rubygems/defaults/operating_system.rb
+
+ - name: Initialize CodeQL
+ uses: github/codeql-action/init@959cbb7472c4d4ad70cdfe6f4976053fe48ab394 # v2.1.37
+ with:
+ config-file: ./.github/codeql/codeql-config.yml
+
+ - name: Set ENV
+ run: echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+
+ - name: Autobuild
+ uses: github/codeql-action/autobuild@959cbb7472c4d4ad70cdfe6f4976053fe48ab394 # v2.1.37
+
+ - name: Perform CodeQL Analysis
+ uses: github/codeql-action/analyze@959cbb7472c4d4ad70cdfe6f4976053fe48ab394 # v2.1.37
diff --git a/.github/workflows/compilers.yml b/.github/workflows/compilers.yml
new file mode 100644
index 0000000000..731bda1cda
--- /dev/null
+++ b/.github/workflows/compilers.yml
@@ -0,0 +1,293 @@
+name: Compilations
+
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+# GitHub actions does not support YAML anchors. This creative use of
+# environment variables (plus the "echo $GITHUB_ENV" hack) is to reroute that
+# restriction.
+env:
+ default_cc: clang-15
+ append_cc: ''
+
+ # -O1 is faster than -O3 in our tests... Majority of time are consumed trying
+ # to optimize binaries. Also GitHub Actions run on relatively modern CPUs
+ # compared to, say, GCC 4 or Clang 3. We don't specify `-march=native`
+ # because compilers tend not understand what the CPU is.
+ optflags: '-O1'
+
+ # -g0 disables backtraces when SEGV. Do not set that.
+ debugflags: '-ggdb3'
+
+ default_configure: >-
+ --enable-debug-env
+ --disable-install-doc
+ --with-ext=-test-/cxxanyargs,+
+ append_configure: >-
+ --without-valgrind
+ --without-jemalloc
+ --without-gmp
+
+ UPDATE_UNICODE: >-
+ UNICODE_FILES=.
+ UNICODE_PROPERTY_FILES=.
+ UNICODE_AUXILIARY_FILES=.
+ UNICODE_EMOJI_FILES=.
+ CONFIGURE_TTY: never
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ RUBY_DEBUG: ci rgengc
+ RUBY_TESTOPTS: >-
+ -q
+ --color=always
+ --tty=no
+
+permissions:
+ contents: read
+
+jobs:
+ compile:
+ strategy:
+ fail-fast: false
+ matrix:
+ env:
+ - {}
+ entry:
+ - { name: gcc-12, env: { default_cc: gcc-12 } }
+ - { name: gcc-11, env: { default_cc: gcc-11 } }
+ - { name: gcc-10, env: { default_cc: gcc-10 } }
+ - { name: gcc-9, env: { default_cc: gcc-9 } }
+ - { name: gcc-8, env: { default_cc: gcc-8 } }
+ - { name: gcc-7, env: { default_cc: gcc-7 } }
+ - name: 'gcc-13 LTO'
+ container: gcc-13
+ env:
+ default_cc: 'gcc-13 -flto=auto -ffat-lto-objects -Werror=lto-type-mismatch'
+ optflags: '-O2'
+ shared: disable
+ # check: true
+ - name: 'gcc-11 annocheck'
+ container: gcc-11
+ env:
+ # Minimal flags to pass the check.
+ default_cc: 'gcc-11 -fcf-protection -Wa,--generate-missing-build-notes=yes'
+ optflags: '-O2'
+ LDFLAGS: '-Wl,-z,now'
+ # FIXME: Drop skipping options
+ # https://bugs.ruby-lang.org/issues/18061
+ # https://sourceware.org/annobin/annobin.html/Test-pie.html
+ TEST_ANNOCHECK_OPTS: "--skip-pie --skip-gaps"
+ check: true
+ - { name: clang-16, env: { default_cc: clang-16 } }
+ - { name: clang-15, env: { default_cc: clang-15 } }
+ - { name: clang-14, env: { default_cc: clang-14 } }
+ - { name: clang-13, env: { default_cc: clang-13 } }
+ - { name: clang-12, env: { default_cc: clang-12 } }
+ - { name: clang-11, env: { default_cc: clang-11 } }
+ - { name: clang-10, env: { default_cc: clang-10 } }
+ # llvm-objcopy<=9 doesn't have --wildcard. It compiles, but leaves Rust symbols in libyjit.o.
+ - { name: clang-9, env: { default_cc: clang-9, append_configure: '--disable-yjit' } }
+ - { name: clang-8, env: { default_cc: clang-8, append_configure: '--disable-yjit' } }
+ - { name: clang-7, env: { default_cc: clang-7, append_configure: '--disable-yjit' } }
+ - { name: clang-6.0, env: { default_cc: clang-6.0, append_configure: '--disable-yjit' } }
+ - name: 'clang-16 LTO'
+ container: clang-16
+ env:
+ default_cc: 'clang-16 -flto=auto'
+ optflags: '-O2'
+ shared: disable
+ # check: true
+
+# - { name: aarch64-linux-gnu, crosshost: aarch64-linux-gnu, container: crossbuild-essential-arm64 }
+# - { name: arm-linux-gnueabi, crosshost: arm-linux-gnueabi }
+# - { name: arm-linux-gnueabihf, crosshost: arm-linux-gnueabihf }
+# - { name: i686-w64-mingw32, crosshost: i686-w64-mingw32 }
+# - { name: powerpc-linux-gnu, crosshost: powerpc-linux-gnu }
+# - { name: powerpc64le-linux-gnu, crosshost: powerpc64le-linux-gnu, container: crossbuild-essential-ppc64el }
+# - { name: s390x-linux-gnu, crosshost: s390x-linux-gnu, container: crossbuild-essential-s390x }
+# - { name: x86_64-w64-mingw32, crosshost: x86_64-w64-mingw32, container: mingw-w64 }
+
+ # -Wno-strict-prototypes is necessary with current clang-15 since
+ # older autoconf generate functions without prototype and -pedantic
+ # now implies strict-prototypes. Disabling the error but leaving the
+ # warning generates a lot of noise from use of ANYARGS in
+ # rb_define_method() and friends.
+ # See: https://github.com/llvm/llvm-project/commit/11da1b53d8cd3507959022cd790d5a7ad4573d94
+ - { name: c99, env: { append_cc: '-std=c99 -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
+# - { name: c11, env: { append_cc: '-std=c11 -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
+# - { name: c17, env: { append_cc: '-std=c17 -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
+ - { name: c2x, env: { append_cc: '-std=c2x -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
+ - { name: c++98, env: { CXXFLAGS: '-std=c++98 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+# - { name: c++11, env: { CXXFLAGS: '-std=c++11 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+# - { name: c++14, env: { CXXFLAGS: '-std=c++14 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+# - { name: c++17, env: { CXXFLAGS: '-std=c++17 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+ - { name: c++2a, env: { CXXFLAGS: '-std=c++2a -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+
+ - { name: '-O0', env: { optflags: '-O0 -march=x86-64 -mtune=generic' } }
+# - { name: '-O3', env: { optflags: '-O3 -march=x86-64 -mtune=generic' }, check: true }
+
+ - { name: gmp, env: { append_configure: '--with-gmp' } }
+ - { name: jemalloc, env: { append_configure: '--with-jemalloc' } }
+ - { name: valgrind, env: { append_configure: '--with-valgrind' } }
+ - { name: 'coroutine=ucontext', env: { append_configure: '--with-coroutine=ucontext' } }
+ - { name: 'coroutine=pthread', env: { append_configure: '--with-coroutine=pthread' } }
+ - { name: disable-jit-support, env: { append_configure: '--disable-jit-support' } }
+ - { name: disable-dln, env: { append_configure: '--disable-dln' } }
+ - { name: enable-mkmf-verbose, env: { append_configure: '--enable-mkmf-verbose' } }
+ - { name: disable-rubygems, env: { append_configure: '--disable-rubygems' } }
+ - { name: RUBY_DEVEL, env: { append_configure: '--enable-devel' } }
+
+ - { name: OPT_THREADED_CODE=1, env: { cppflags: '-DOPT_THREADED_CODE=1' } }
+ - { name: OPT_THREADED_CODE=2, env: { cppflags: '-DOPT_THREADED_CODE=2' } }
+ - { name: OPT_THREADED_CODE=3, env: { cppflags: '-DOPT_THREADED_CODE=3' } }
+
+ - { name: NDEBUG, env: { cppflags: '-DNDEBUG' } }
+ - { name: RUBY_DEBUG, env: { cppflags: '-DRUBY_DEBUG' } }
+# - { name: ARRAY_DEBUG, env: { cppflags: '-DARRAY_DEBUG' } }
+# - { name: BIGNUM_DEBUG, env: { cppflags: '-DBIGNUM_DEBUG' } }
+# - { name: CCAN_LIST_DEBUG, env: { cppflags: '-DCCAN_LIST_DEBUG' } }
+# - { name: CPDEBUG=-1, env: { cppflags: '-DCPDEBUG=-1' } }
+# - { name: ENC_DEBUG, env: { cppflags: '-DENC_DEBUG' } }
+# - { name: GC_DEBUG, env: { cppflags: '-DGC_DEBUG' } }
+# - { name: HASH_DEBUG, env: { cppflags: '-DHASH_DEBUG' } }
+# - { name: ID_TABLE_DEBUG, env: { cppflags: '-DID_TABLE_DEBUG' } }
+# - { name: RGENGC_DEBUG=-1, env: { cppflags: '-DRGENGC_DEBUG=-1' } }
+# - { name: SYMBOL_DEBUG, env: { cppflags: '-DSYMBOL_DEBUG' } }
+
+# - { name: RGENGC_CHECK_MODE, env: { cppflags: '-DRGENGC_CHECK_MODE' } }
+# - { name: TRANSIENT_HEAP_CHECK_MODE, env: { cppflags: '-DTRANSIENT_HEAP_CHECK_MODE' } }
+# - { name: VM_CHECK_MODE, env: { cppflags: '-DVM_CHECK_MODE' } }
+
+ - { name: USE_EMBED_CI=0, env: { cppflags: '-DUSE_EMBED_CI=0' } }
+ - name: USE_FLONUM=0,
+ env:
+ cppflags: '-DUSE_FLONUM=0'
+ # yjit requires FLONUM for the pointer tagging scheme
+ append_configure: '--disable-yjit'
+# - { name: USE_GC_MALLOC_OBJ_INFO_DETAILS, env: { cppflags: '-DUSE_GC_MALLOC_OBJ_INFO_DETAILS' } }
+ - { name: USE_LAZY_LOAD, env: { cppflags: '-DUSE_LAZY_LOAD' } }
+# - { name: USE_RINCGC=0, env: { cppflags: '-DUSE_RINCGC=0' } }
+# - { name: USE_SYMBOL_GC=0, env: { cppflags: '-DUSE_SYMBOL_GC=0' } }
+# - { name: USE_THREAD_CACHE=0, env: { cppflags: '-DUSE_THREAD_CACHE=0' } }
+# - { name: USE_TRANSIENT_HEAP=0, env: { cppflags: '-DUSE_TRANSIENT_HEAP=0' } }
+# - { name: USE_RUBY_DEBUG_LOG=1, env: { cppflags: '-DUSE_RUBY_DEBUG_LOG=1' } }
+ - { name: USE_RVARGC=0, env: { cppflags: '-DUSE_RVARGC=0' } }
+# - { name: USE_RVARGC=1, env: { cppflags: '-DUSE_RVARGC=1' } }
+# - { name: USE_DEBUG_COUNTER, env: { cppflags: '-DUSE_DEBUG_COUNTER=1', RUBY_DEBUG_COUNTER_DISABLE: '1' } }
+
+ - { name: DEBUG_FIND_TIME_NUMGUESS, env: { cppflags: '-DDEBUG_FIND_TIME_NUMGUESS' } }
+ - { name: DEBUG_INTEGER_PACK, env: { cppflags: '-DDEBUG_INTEGER_PACK' } }
+# - { name: ENABLE_PATH_CHECK, env: { cppflags: '-DENABLE_PATH_CHECK' } }
+
+ - { name: GC_DEBUG_STRESS_TO_CLASS, env: { cppflags: '-DGC_DEBUG_STRESS_TO_CLASS' } }
+# - { name: GC_ENABLE_LAZY_SWEEP=0, env: { cppflags: '-DGC_ENABLE_LAZY_SWEEP=0' } }
+# - { name: GC_PROFILE_DETAIL_MEMOTY, env: { cppflags: '-DGC_PROFILE_DETAIL_MEMOTY' } }
+# - { name: GC_PROFILE_MORE_DETAIL, env: { cppflags: '-DGC_PROFILE_MORE_DETAIL' } }
+
+# - { name: CALC_EXACT_MALLOC_SIZE, env: { cppflags: '-DCALC_EXACT_MALLOC_SIZE' } }
+# - { name: MALLOC_ALLOCATED_SIZE_CHECK, env: { cppflags: '-DMALLOC_ALLOCATED_SIZE_CHECK' } }
+
+# - { name: IBF_ISEQ_ENABLE_LOCAL_BUFFER, env: { cppflags: '-DIBF_ISEQ_ENABLE_LOCAL_BUFFER' } }
+
+# - { name: RGENGC_ESTIMATE_OLDMALLOC, env: { cppflags: '-DRGENGC_ESTIMATE_OLDMALLOC' } }
+# - { name: RGENGC_FORCE_MAJOR_GC, env: { cppflags: '-DRGENGC_FORCE_MAJOR_GC' } }
+# - { name: RGENGC_OBJ_INFO, env: { cppflags: '-DRGENGC_OBJ_INFO' } }
+# - { name: RGENGC_OLD_NEWOBJ_CHECK, env: { cppflags: '-DRGENGC_OLD_NEWOBJ_CHECK' } }
+# - { name: RGENGC_PROFILE, env: { cppflags: '-DRGENGC_PROFILE' } }
+
+# - { name: VM_DEBUG_BP_CHECK, env: { cppflags: '-DVM_DEBUG_BP_CHECK' } }
+# - { name: VM_DEBUG_VERIFY_METHOD_CACHE, env: { cppflags: '-DVM_DEBUG_VERIFY_METHOD_CACHE' } }
+
+ - { name: MJIT_FORCE_ENABLE, env: { cppflags: '-DMJIT_FORCE_ENABLE' } }
+ - { name: YJIT_FORCE_ENABLE, env: { cppflags: '-DYJIT_FORCE_ENABLE' } }
+
+ name: ${{ matrix.entry.name }}
+ runs-on: ubuntu-latest
+ container:
+ image: ghcr.io/ruby/ruby-ci-image:${{ matrix.entry.container || matrix.entry.env.default_cc || 'clang-15' }}
+ options: --user root
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ env: ${{ matrix.entry.env || matrix.env }}
+ steps:
+ - run: id
+ working-directory:
+ - run: mkdir build
+ working-directory:
+ - name: setenv
+ run: |
+ echo "GNUMAKEFLAGS=-sj$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+ with:
+ path: src
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: >
+ ../src/configure -C ${default_configure} ${append_configure}
+ --${{
+ matrix.entry.crosshost && 'host' || 'with-gcc'
+ }}=${{
+ matrix.entry.crosshost || '"${default_cc}${append_cc:+ $append_cc}"'
+ }}
+ --${{ matrix.entry.shared || 'enable' }}-shared
+ - run: make extract-extlibs
+ - run: make incs
+ - run: make showflags
+ - run: make
+ - run: make leaked-globals
+ - run: make test
+ - run: make install
+ if: ${{ matrix.entry.check }}
+ - run: make test-tool
+ if: ${{ matrix.entry.check }}
+ - run: make test-all TESTS='-- ruby -ext-'
+ if: ${{ matrix.entry.check }}
+ - run: make test-spec
+ env:
+ CHECK_LEAKS: true
+ if: ${{ matrix.entry.check }}
+ - run: make test-annocheck
+ if: ${{ matrix.entry.check && endsWith(matrix.entry.name, 'annocheck') }}
+
+ - uses: ruby/action-slack@b6882ea6ef8f556f9f9af9ec1220d3f1ced74acf # v3.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / ${{ matrix.entry.name }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/macos.yml b/.github/workflows/macos.yml
new file mode 100644
index 0000000000..8b72729f74
--- /dev/null
+++ b/.github/workflows/macos.yml
@@ -0,0 +1,112 @@
+name: macOS
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ make:
+ strategy:
+ matrix:
+ test_task: ["check"] # "test-bundler-parallel", "test-bundled-gems"
+ os:
+ - macos-12
+ - macos-13
+ fail-fast: false
+ env:
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ runs-on: ${{ matrix.os }}
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+ with:
+ path: src
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: Install libraries
+ run: |
+ brew install gmp libffi openssl@1.1 zlib autoconf automake libtool readline bison
+ working-directory: src
+ - name: Set ENV
+ run: |
+ echo "MAKEFLAGS=-j$((1 + $(sysctl -n hw.activecpu)))" >> $GITHUB_ENV
+ echo "PATH="/usr/local/opt/bison/bin:$PATH"" >> $GITHUB_ENV
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: ../src/configure -C --disable-install-doc --with-openssl-dir=$(brew --prefix openssl@1.1) --with-readline-dir=$(brew --prefix readline)
+ - run: make incs
+ - run: make prepare-gems
+ if: ${{ matrix.test_task == 'test-bundled-gems' }}
+ - run: make
+ - run: make leaked-globals
+ if: ${{ matrix.test_task == 'check' }}
+ - name: make ${{ matrix.test_task }}
+ run: |
+ make -s ${{ matrix.test_task }} ${TESTS:+TESTS=`echo "$TESTS" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|'`}
+ timeout-minutes: 40
+ env:
+ RUBY_TESTOPTS: "-q --tty=no"
+ TESTS: ${{ matrix.test_task == 'check' && matrix.skipped_tests || '' }}
+ TEST_BUNDLED_GEMS_ALLOW_FAILURES: ""
+ PRECHECK_BUNDLED_GEMS: "no"
+ - name: make skipped tests
+ run: |
+ make -s test-all TESTS=`echo "$TESTS" | sed 's| |$$/ -n/|g;s|^|-n/|;s|$|$$/|'`
+ env:
+ GNUMAKEFLAGS: ""
+ RUBY_TESTOPTS: "-v --tty=no"
+ TESTS: ${{ matrix.skipped_tests }}
+ PRECHECK_BUNDLED_GEMS: "no"
+ if: ${{ matrix.test_task == 'check' && matrix.skipped_tests != '' }}
+ continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+ - uses: ruby/action-slack@b6882ea6ef8f556f9f9af9ec1220d3f1ced74acf # v3.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ matrix.os }} / ${{ matrix.test_task }}${{ matrix.configure }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/mingw.yml b/.github/workflows/mingw.yml
new file mode 100644
index 0000000000..ba3886218a
--- /dev/null
+++ b/.github/workflows/mingw.yml
@@ -0,0 +1,179 @@
+name: MinGW
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+# Notes:
+# Actions console encoding causes issues, see test-all & test-spec steps
+#
+jobs:
+ make:
+ runs-on: windows-2022
+ name: ${{ github.workflow }} (${{ matrix.msystem }})
+ env:
+ MSYSTEM: ${{ matrix.msystem }}
+ MSYS2_ARCH: x86_64
+ CHOST: "x86_64-w64-mingw32"
+ CFLAGS: "-march=x86-64 -mtune=generic -O3 -pipe"
+ CXXFLAGS: "-march=x86-64 -mtune=generic -O3 -pipe"
+ CPPFLAGS: "-D_FORTIFY_SOURCE=2 -D__USE_MINGW_ANSI_STDIO=1 -DFD_SETSIZE=2048"
+ LDFLAGS: "-pipe"
+ UPDATE_UNICODE: "UNICODE_FILES=. UNICODE_PROPERTY_FILES=. UNICODE_AUXILIARY_FILES=. UNICODE_EMOJI_FILES=."
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ strategy:
+ matrix:
+ include:
+ # To mitigate flakiness of MinGW CI, we test only one runtime that newer MSYS2 uses.
+ - msystem: "UCRT64"
+ base_ruby: head
+ test_task: "check"
+ test-all-opts: "--name=!/TestObjSpace#test_reachable_objects_during_iteration/"
+ fail-fast: false
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: git config
+ run: |
+ git config --global core.autocrlf false
+ git config --global core.eol lf
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+ with:
+ path: src
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: Set up Ruby & MSYS2
+ uses: ruby/setup-ruby@4b2d1d631efa087f8896c15a0c6023dc2f483198 # v1.128.0
+ with:
+ ruby-version: ${{ matrix.base_ruby }}
+ - name: set env
+ run: |
+ echo "GNUMAKEFLAGS=-j$((2 * NUMBER_OF_PROCESSORS))" >> $GITHUB_ENV
+
+ - name: where check
+ run: |
+ # show where
+ mv /c/Windows/System32/libcrypto-1_1-x64.dll /c/Windows/System32/libcrypto-1_1-x64.dll_
+ mv /c/Windows/System32/libssl-1_1-x64.dll /c/Windows/System32/libssl-1_1-x64.dll_
+ result=true
+ for e in gcc.exe ragel.exe make.exe bison.exe libcrypto-1_1-x64.dll libssl-1_1-x64.dll; do
+ echo '##['group']'$'\033[93m'$e$'\033[m'
+ where $e || result=false
+ echo '##['endgroup']'
+ done
+ $result
+
+ - name: version check
+ run: |
+ # show version
+ result=true
+ for e in gcc ragel make bison "openssl version"; do
+ case "$e" in *" "*) ;; *) e="$e --version";; esac
+ echo '##['group']'$'\033[93m'$e$'\033[m'
+ $e || result=false
+ echo '##['endgroup']'
+ done
+ $result
+
+ - name: autogen
+ run: |
+ ./autogen.sh
+ working-directory: src
+
+ - name: configure
+ run: >
+ ../src/configure --disable-install-doc --prefix=/.
+ --build=$CHOST --host=$CHOST --target=$CHOST
+
+ - name: update
+ run: |
+ make incs
+
+ - name: download gems
+ run: |
+ make update-gems
+
+ - name: make all
+ timeout-minutes: 30
+ run: |
+ make
+
+ - run: make leaked-globals
+
+ - name: make install
+ run: |
+ make DESTDIR=../install install-nodoc
+
+ - name: test
+ timeout-minutes: 5
+ run: |
+ make test
+ if: ${{matrix.test_task == 'check' || matrix.test_task == 'test'}}
+
+ - name: test-all
+ timeout-minutes: 45
+ run: |
+ # Actions uses UTF8, causes test failures, similar to normal OS setup
+ chcp.com 437
+ make ${{ StartsWith(matrix.test_task, 'test/') && matrix.test_task || 'test-all' }}
+ env:
+ RUBY_TESTOPTS: >-
+ --retry --job-status=normal --show-skip --timeout-scale=1.5
+ ${{ matrix.test-all-opts }}
+ BUNDLER_VERSION:
+ if: ${{matrix.test_task == 'check' || matrix.test_task == 'test-all' || StartsWith(matrix.test_task, 'test/')}}
+
+ - name: test-spec
+ timeout-minutes: 10
+ run: |
+ make ${{ StartsWith(matrix.test_task, 'spec/') && matrix.test_task || 'test-spec' }}
+ if: ${{matrix.test_task == 'check' || matrix.test_task == 'test-spec' || StartsWith(matrix.test_task, 'spec/')}}
+
+ - uses: ruby/action-slack@b6882ea6ef8f556f9f9af9ec1220d3f1ced74acf # v3.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} ${{ matrix.msystem }} / ${{ matrix.test_task }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
+ shell: sh
diff --git a/.github/workflows/mjit-bindgen.yml b/.github/workflows/mjit-bindgen.yml
new file mode 100644
index 0000000000..553306a4f7
--- /dev/null
+++ b/.github/workflows/mjit-bindgen.yml
@@ -0,0 +1,104 @@
+name: MJIT bindgen
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ make:
+ strategy:
+ matrix:
+ include:
+ - task: mjit-bindgen
+ fail-fast: false
+ runs-on: ubuntu-20.04
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: Set ENV
+ run: |
+ echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y \
+ build-essential \
+ libssl-dev libyaml-dev libreadline6-dev \
+ zlib1g-dev libncurses5-dev libffi-dev \
+ libclang1-10 \
+ bison autoconf
+ sudo apt-get install -q -y pkg-config || :
+ - name: Set up Ruby
+ uses: ruby/setup-ruby@4b2d1d631efa087f8896c15a0c6023dc2f483198 # v1.128.0
+ with:
+ ruby-version: '3.1'
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+ with:
+ path: src
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: Fixed world writable dirs
+ run: |
+ chmod -v go-w $HOME $HOME/.config
+ sudo chmod -R go-w /usr/share
+ sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install --enable-yjit=dev_nodebug
+ - run: make incs
+ - run: make
+ - run: make install
+ - run: make ${{ matrix.task }}
+ - run: git diff --exit-code
+ working-directory: src
+ - uses: ruby/action-slack@b6882ea6ef8f556f9f9af9ec1220d3f1ced74acf # v3.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ matrix.os }} / ${{ matrix.test_task }}${{ matrix.configure }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/mjit.yml b/.github/workflows/mjit.yml
new file mode 100644
index 0000000000..8812d759d1
--- /dev/null
+++ b/.github/workflows/mjit.yml
@@ -0,0 +1,113 @@
+name: MJIT
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ - '**.[1-8]'
+ - '**.ronn'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ - '**.[1-8]'
+ - '**.ronn'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ make:
+ strategy:
+ matrix:
+ test_task: [check] # to make job names consistent
+ mjit_opts: [--mjit-wait]
+ fail-fast: false
+ runs-on: ubuntu-latest
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ env:
+ TESTOPTS: '-q --tty=no'
+ RUN_OPTS: '--disable-gems ${{ matrix.mjit_opts }} --mjit-debug=-ggdb3'
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+ with:
+ path: src
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: Fixed world writable dirs
+ run: |
+ chmod -v go-w $HOME $HOME/.config
+ sudo chmod -R go-w /usr/share
+ sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+ - name: Set ENV
+ run: |
+ echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: ../src/configure -C --disable-install-doc cppflags=-DVM_CHECK_MODE
+ - run: make incs
+ - run: make
+ - run: sudo make -s install
+ - name: Run test
+ run: |
+ unset GNUMAKEFLAGS
+ make -s test RUN_OPTS="$RUN_OPTS"
+ timeout-minutes: 60
+ # - name: Run test-all
+ # run: |
+ # ulimit -c unlimited
+ # make -s test-all RUN_OPTS="$RUN_OPTS"
+ # timeout-minutes: 60
+ - name: Run test-spec
+ run: |
+ unset GNUMAKEFLAGS
+ make -s test-spec RUN_OPTS="$RUN_OPTS"
+ timeout-minutes: 60
+ - uses: ruby/action-slack@b6882ea6ef8f556f9f9af9ec1220d3f1ced74acf # v3.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / ${{ matrix.test_task }} ${{ matrix.mjit_opts }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/scorecards.yml b/.github/workflows/scorecards.yml
new file mode 100644
index 0000000000..5e2397e693
--- /dev/null
+++ b/.github/workflows/scorecards.yml
@@ -0,0 +1,72 @@
+# This workflow uses actions that are not certified by GitHub. They are provided
+# by a third-party and are governed by separate terms of service, privacy
+# policy, and support documentation.
+
+name: Scorecards supply-chain security
+on:
+ # For Branch-Protection check. Only the default branch is supported. See
+ # https://github.com/ossf/scorecard/blob/main/docs/checks.md#branch-protection
+ branch_protection_rule:
+ # To guarantee Maintained check is occasionally updated. See
+ # https://github.com/ossf/scorecard/blob/main/docs/checks.md#maintained
+ schedule:
+ - cron: '22 4 * * 2'
+ push:
+ branches: [ "master" ]
+
+# Declare default permissions as read only.
+permissions: read-all
+
+jobs:
+ analysis:
+ name: Scorecards analysis
+ runs-on: ubuntu-latest
+ permissions:
+ # Needed to upload the results to code-scanning dashboard.
+ security-events: write
+ # Needed to publish results and get a badge (see publish_results below).
+ id-token: write
+ # Uncomment the permissions below if installing in a private repository.
+ # contents: read
+ # actions: read
+
+ steps:
+ - name: "Checkout code"
+ uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+ with:
+ persist-credentials: false
+
+ - name: "Run analysis"
+ uses: ossf/scorecard-action@e38b1902ae4f44df626f11ba0734b14fb91f8f86 # v2.1.2
+ with:
+ results_file: results.sarif
+ results_format: sarif
+ # (Optional) Read-only PAT token. Uncomment the `repo_token` line below if:
+ # - you want to enable the Branch-Protection check on a *public* repository, or
+ # - you are installing Scorecards on a *private* repository
+ # To create the PAT, follow the steps in https://github.com/ossf/scorecard-action#authentication-with-pat.
+ repo_token: ${{ secrets.SCORECARD_READ_TOKEN }}
+
+ # Public repositories:
+ # - Publish results to OpenSSF REST API for easy access by consumers
+ # - Allows the repository to include the Scorecard badge.
+ # - See https://github.com/ossf/scorecard-action#publishing-results.
+ # For private repositories:
+ # - `publish_results` will always be set to `false`, regardless
+ # of the value entered here.
+ publish_results: true
+
+ # Upload the results as artifacts (optional). Commenting out will disable uploads of run results in SARIF
+ # format to the repository Actions tab.
+ - name: "Upload artifact"
+ uses: actions/upload-artifact@83fd05a356d7e2593de66fc9913b3002723633cb # v3.1.1
+ with:
+ name: SARIF file
+ path: results.sarif
+ retention-days: 5
+
+ # Upload the results to GitHub's code scanning dashboard.
+ - name: "Upload to code-scanning"
+ uses: github/codeql-action/upload-sarif@959cbb7472c4d4ad70cdfe6f4976053fe48ab394 # v2.1.27
+ with:
+ sarif_file: results.sarif
diff --git a/.github/workflows/spec_guards.yml b/.github/workflows/spec_guards.yml
new file mode 100644
index 0000000000..3b32a9f434
--- /dev/null
+++ b/.github/workflows/spec_guards.yml
@@ -0,0 +1,73 @@
+name: Rubyspec Version Guards Check
+
+on:
+ push:
+ paths:
+ - 'spec/**'
+ - '!spec/*.md'
+ pull_request:
+ paths:
+ - 'spec/**'
+ - '!spec/*.md'
+ merge_group:
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ rubyspec:
+ name: Rubyspec
+
+ runs-on: ubuntu-20.04
+
+ if: >-
+ ${{!(false
+ || contains(github.event.head_commit.message, '[DOC]')
+ || contains(github.event.head_commit.message, 'Document')
+ || contains(github.event.pull_request.title, '[DOC]')
+ || contains(github.event.pull_request.title, 'Document')
+ || contains(github.event.pull_request.labels.*.name, 'Document')
+ || (github.event_name == 'push' && github.actor == 'dependabot[bot]')
+ )}}
+
+ strategy:
+ matrix:
+ # Specs from ruby/spec should still run on all supported Ruby versions.
+ # This also ensures the needed ruby_version_is guards are there, see spec/README.md.
+ ruby:
+ - ruby-3.0
+ - ruby-3.1
+ - ruby-3.2
+ - ruby-3.3
+
+ steps:
+ - uses: actions/checkout@692973e3d937129bcbf40652eb9f2f61becf3332 # v4.1.7
+
+ - uses: ruby/setup-ruby@97e35c5302afcf3f5ac1df3fca9343d32536b286 # v1.184.0
+ with:
+ ruby-version: ${{ matrix.ruby }}
+ bundler: none
+
+ - run: gem install webrick
+
+ - run: ruby ../mspec/bin/mspec
+ working-directory: spec/ruby
+ env:
+ CHECK_LEAKS: true
+ - uses: ruby/action-slack@b6882ea6ef8f556f9f9af9ec1220d3f1ced74acf # v3.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / rubyspec @ ${{ matrix.ruby }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() }}
diff --git a/.github/workflows/ubuntu.yml b/.github/workflows/ubuntu.yml
new file mode 100644
index 0000000000..637042426a
--- /dev/null
+++ b/.github/workflows/ubuntu.yml
@@ -0,0 +1,146 @@
+name: Ubuntu
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ make:
+ strategy:
+ matrix:
+ # main variables included in the job name
+ test_task: [check]
+ configure: [cppflags=-DRUBY_DEBUG] # default to use more assertions
+ arch: ['']
+ # specify all jobs with `include` to avoid testing duplicated things
+ include:
+ - test_task: check
+ - test_task: check
+ arch: i686
+ configure: '' # test without -DRUBY_DEBUG as well
+ - test_task: check
+ configure: "--enable-shared --enable-load-relative"
+ - test_task: test-all TESTS=--repeat-count=2
+ - test_task: test-bundler-parallel
+ - test_task: test-bundled-gems
+ fail-fast: false
+ env:
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ RUBY_DEBUG: ci
+ SETARCH: ${{ matrix.arch && format('setarch {0}', matrix.arch) }}
+ runs-on: ubuntu-20.04
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: Set ENV
+ run: |
+ echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - name: Install libraries
+ env:
+ arch: ${{matrix.arch}}
+ run: |
+ set -x
+ arch=${arch:+:${arch/i[3-6]86/i386}}
+ ${arch:+sudo dpkg --add-architecture ${arch#:}}
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y \
+ ${arch:+cross}build-essential${arch/:/-} \
+ libssl-dev${arch} libyaml-dev${arch} libreadline6-dev${arch} \
+ zlib1g-dev${arch} libncurses5-dev${arch} libffi-dev${arch} \
+ bison autoconf ruby
+ sudo apt-get install -q -y pkg-config${arch} || :
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+ with:
+ path: src
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: Fixed world writable dirs
+ run: |
+ chmod -v go-w $HOME $HOME/.config
+ sudo chmod -R go-w /usr/share
+ sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ env:
+ arch: ${{matrix.arch}}
+ run: >-
+ $SETARCH ../src/configure -C --disable-install-doc ${{ matrix.configure }}
+ ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
+ - run: $SETARCH make incs
+ - run: $SETARCH make prepare-gems
+ if: ${{ matrix.test_task == 'test-bundled-gems' }}
+ - run: $SETARCH make
+ - run: $SETARCH make leaked-globals
+ if: ${{ matrix.test_task == 'check' }}
+ - name: Create dummy files in build dir
+ run: |
+ $SETARCH ./miniruby -e '(("a".."z").to_a+("A".."Z").to_a+("0".."9").to_a+%w[foo bar test zzz]).each{|basename|File.write("#{basename}.rb", "raise %(do not load #{basename}.rb)")}'
+ if: ${{ matrix.test_task == 'check' }}
+ - name: make ${{ matrix.test_task }}
+ run: |
+ $SETARCH make -s ${{ matrix.test_task }} ${TESTS:+TESTS=`echo "$TESTS" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|'`}
+ timeout-minutes: 40
+ env:
+ RUBY_TESTOPTS: "-q --tty=no"
+ TESTS: ${{ matrix.test_task == 'check' && matrix.skipped_tests || '' }}
+ TEST_BUNDLED_GEMS_ALLOW_FAILURES: ""
+ PRECHECK_BUNDLED_GEMS: "no"
+ - name: make skipped tests
+ run: |
+ $SETARCH make -s test-all TESTS=`echo "$TESTS" | sed 's| |$$/ -n/|g;s|^|-n/|;s|$|$$/|'`
+ env:
+ GNUMAKEFLAGS: ""
+ RUBY_TESTOPTS: "-v --tty=no"
+ TESTS: ${{ matrix.skipped_tests }}
+ if: ${{ matrix.test_task == 'check' && matrix.skipped_tests != '' }}
+ continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+ - uses: ruby/action-slack@b6882ea6ef8f556f9f9af9ec1220d3f1ced74acf # v3.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/wasm.yml b/.github/workflows/wasm.yml
new file mode 100644
index 0000000000..1e907a0232
--- /dev/null
+++ b/.github/workflows/wasm.yml
@@ -0,0 +1,134 @@
+name: WebAssembly
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions: # added using https://github.com/step-security/secure-workflows
+ contents: read
+
+jobs:
+ make:
+ strategy:
+ matrix:
+ entry:
+# # wasmtime can't compile non-optimized Asyncified binary due to locals explosion
+# - { name: O0-debuginfo, optflags: "-O0", debugflags: "-g", wasmoptflags: "-O1" }
+# - { name: O1, optflags: "-O1", debugflags: "" , wasmoptflags: "-O1" }
+ - { name: O2, optflags: "-O2", debugflags: "" , wasmoptflags: "-O2" }
+# - { name: O3, optflags: "-O3", debugflags: "" , wasmoptflags: "-O3" }
+# # -O4 is equivalent to -O3 in clang, but it's different in wasm-opt
+# - { name: O4, optflags: "-O3", debugflags: "" , wasmoptflags: "-O4" }
+# - { name: Oz, optflags: "-Oz", debugflags: "" , wasmoptflags: "-Oz" }
+ fail-fast: false
+ env:
+ RUBY_TESTOPTS: '-q --tty=no'
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ WASI_SDK_VERSION_MAJOR: 14
+ WASI_SDK_VERSION_MINOR: 0
+ BINARYEN_VERSION: 109
+ WASMTIME_VERSION: v0.33.0
+ runs-on: ubuntu-20.04
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+ with:
+ path: src
+ - name: Install libraries
+ run: |
+ set -ex
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y ruby bison make autoconf git wget
+
+ wasi_sdk_deb="wasi-sdk_${WASI_SDK_VERSION_MAJOR}.${WASI_SDK_VERSION_MINOR}_amd64.deb"
+ wget "https://github.com/WebAssembly/wasi-sdk/releases/download/wasi-sdk-${WASI_SDK_VERSION_MAJOR}/${wasi_sdk_deb}"
+ sudo dpkg -i "$wasi_sdk_deb"
+ rm -f "$wasi_sdk_deb"
+
+ mkdir build-sdk
+ pushd build-sdk
+
+ wasmtime_url="https://github.com/bytecodealliance/wasmtime/releases/download/${WASMTIME_VERSION}/wasmtime-${WASMTIME_VERSION}-x86_64-linux.tar.xz"
+ wget -O - "$wasmtime_url" | tar xJf -
+ sudo ln -fs "$PWD/wasmtime-${WASMTIME_VERSION}-x86_64-linux/wasmtime" /usr/local/bin/wasmtime
+
+ binaryen_tarball="binaryen-version_${BINARYEN_VERSION}-x86_64-linux.tar.gz"
+ binaryen_url="https://github.com/WebAssembly/binaryen/releases/download/version_${BINARYEN_VERSION}/${binaryen_tarball}"
+ wget -O - "$binaryen_url" | tar xfz -
+ sudo ln -fs "$PWD/binaryen-version_${BINARYEN_VERSION}/bin/wasm-opt" /usr/local/bin/wasm-opt
+ working-directory: src
+ - name: Set ENV
+ run: |
+ echo "MAKEFLAGS=-j$((1 + $(sysctl -n hw.activecpu)))" >> $GITHUB_ENV
+ echo "WASI_SDK_PATH=/opt/wasi-sdk" >> $GITHUB_ENV
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: |
+ ../src/configure \
+ --host wasm32-unknown-wasi \
+ --with-static-linked-ext \
+ LDFLAGS=" \
+ -Xlinker --stack-first \
+ -Xlinker -z -Xlinker stack-size=16777216 \
+ " \
+ optflags="${{ matrix.entry.optflags }}" \
+ debugflags="${{ matrix.entry.debugflags }}" \
+ wasmoptflags="${{ matrix.entry.wasmoptflags }} ${{ matrix.entry.debugflags }}"
+
+ # miniruby may not be built when cross-compling
+ - run: make mini ruby
+ - name: Run basictest
+ run: wasmtime run ./../build/miniruby --mapdir /::./ -- basictest/test.rb
+ working-directory: src
+ - name: Run bootstraptest (no thread)
+ run: |
+ NO_THREAD_TESTS="$(grep -L Thread -R ./bootstraptest | awk -F/ '{ print $NF }' | uniq | sed -n 's/test_\(.*\).rb/\1/p' | paste -s -d, -)"
+ ruby ./bootstraptest/runner.rb --ruby="$(which wasmtime) run $PWD/../build/ruby --mapdir /::./ -- " --verbose "--sets=$NO_THREAD_TESTS"
+ working-directory: src
+
+ - uses: ruby/action-slack@b6882ea6ef8f556f9f9af9ec1220d3f1ced74acf # v3.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / ${{ matrix.name }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/windows.yml b/.github/workflows/windows.yml
new file mode 100644
index 0000000000..15233d257c
--- /dev/null
+++ b/.github/workflows/windows.yml
@@ -0,0 +1,153 @@
+name: Windows
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ make:
+ strategy:
+ matrix:
+ include:
+ - vs: 2019
+ - vs: 2022
+ fail-fast: false
+ runs-on: windows-${{ matrix.vs < 2022 && '2019' || matrix.vs }}
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ name: VisualStudio ${{ matrix.vs }}
+ env:
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ PATCH: C:\msys64\usr\bin\patch.exe
+ OS_VER: windows-${{ matrix.vs < 2022 && '2019' || matrix.vs }}
+ steps:
+ - run: md build
+ working-directory:
+ - uses: msys2/setup-msys2@d40200dc2db4c351366b048a9565ad82919e1c24 # v2
+ id: setup-msys2
+ with:
+ update: true
+ install: bison patch
+ - name: patch path
+ shell: msys2 {0}
+ run: echo PATCH=$(cygpath -wa $(command -v patch)) >> $GITHUB_ENV
+ if: ${{ steps.setup-msys2.outcome == 'success' }}
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: C:\vcpkg\downloads
+ key: ${{ runner.os }}-vcpkg-download-${{ env.OS_VER }}-${{ github.sha }}
+ restore-keys: |
+ ${{ runner.os }}-vcpkg-download-${{ env.OS_VER }}-
+ ${{ runner.os }}-vcpkg-download-
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: C:\vcpkg\installed
+ key: ${{ runner.os }}-vcpkg-installed-${{ matrix.os }}-${{ github.sha }}
+ restore-keys: |
+ ${{ runner.os }}-vcpkg-installed-${{ matrix.os }}-
+ ${{ runner.os }}-vcpkg-installed-
+ - name: Install libraries with vcpkg
+ run: |
+ vcpkg --triplet x64-windows install libffi libyaml openssl readline zlib
+ - name: git config
+ run: |
+ git config --global core.autocrlf false
+ git config --global core.eol lf
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+ with:
+ path: src
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: setup env
+ # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
+ # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
+ # msys2/setup-msys2 installs MSYS2 to D:/a/_temp/msys64/usr/bin
+ run: |
+ set Path=D:/a/_temp/msys64/usr/bin;%Path%
+ set VS=${{ matrix.vs }}
+ set VCVARS=${{ matrix.vcvars }}
+ if not "%VCVARS%" == "" goto :vcset
+ set VCVARS="C:\Program Files (x86)\Microsoft Visual Studio\%VS%\Enterprise\VC\Auxiliary\Build\vcvars64.bat"
+ if not exist %VCVARS% set VCVARS="C:\Program Files\Microsoft Visual Studio\%VS%\Enterprise\VC\Auxiliary\Build\vcvars64.bat"
+ :vcset
+ set | C:\msys64\usr\bin\sort > old.env
+ call %VCVARS%
+ set TMP=%USERPROFILE%\AppData\Local\Temp
+ set TEMP=%USERPROFILE%\AppData\Local\Temp
+ set /a TEST_JOBS=(15 * %NUMBER_OF_PROCESSORS% / 10) > nul
+ set | C:\msys64\usr\bin\sort > new.env
+ C:\msys64\usr\bin\comm -13 old.env new.env >> %GITHUB_ENV%
+ del *.env
+ - name: compiler version
+ run: cl
+ - name: link libraries
+ run: |
+ for %%I in (C:\vcpkg\installed\x64-windows\bin\*.dll) do (
+ if not %%~nI == readline mklink %%~nxI %%I
+ )
+ for %%I in (libcrypto-1_1-x64 libssl-1_1-x64) do (
+ ren c:\Windows\System32\%%I.dll %%I.dll_
+ )
+ - name: Configure
+ run: >-
+ ../src/win32/configure.bat --disable-install-doc
+ --with-opt-dir=C:/vcpkg/installed/x64-windows
+ - run: nmake incs
+ - run: nmake extract-extlibs
+ - run: nmake
+ env:
+ YACC: bison.exe
+ - run: nmake test
+ timeout-minutes: 5
+ - run: nmake test-spec
+ timeout-minutes: 10
+ - run: nmake test-all
+ env:
+ RUBY_TESTOPTS: -j${{env.TEST_JOBS}} --job-status=normal
+ timeout-minutes: 60
+ - uses: ruby/action-slack@b6882ea6ef8f556f9f9af9ec1220d3f1ced74acf # v3.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "VS${{ matrix.vs }} / ${{ matrix.test_task || 'check' }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
+ shell: cmd
diff --git a/.github/workflows/yjit-ubuntu.yml b/.github/workflows/yjit-ubuntu.yml
new file mode 100644
index 0000000000..be869d681d
--- /dev/null
+++ b/.github/workflows/yjit-ubuntu.yml
@@ -0,0 +1,168 @@
+name: YJIT Ubuntu
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ cargo:
+ name: Rust cargo test
+ # GitHub Action's image seems to already contain a Rust 1.58.0.
+ runs-on: ubuntu-20.04
+ steps:
+ - uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+ # For now we can't run cargo test --offline because it complains about the
+ # capstone dependency, even though the dependency is optional
+ #- run: cargo test --offline
+ - run: RUST_BACKTRACE=1 cargo test
+ working-directory: yjit
+ # Also compile and test with all features enabled
+ - run: RUST_BACKTRACE=1 cargo test --all-features
+ working-directory: yjit
+ # Check that we can build in release mode too
+ - run: cargo build --release
+ working-directory: yjit
+ make:
+ strategy:
+ fail-fast: false
+ matrix:
+ include:
+ - test_task: "yjit-bindgen"
+ hint: "To fix: use patch in logs"
+ configure: "--with-gcc=clang-12 --enable-yjit=dev"
+
+ - test_task: "check"
+ # YJIT should be automatically built in release mode on x86-64 Linux with rustc present
+ #configure: "--enable-yjit RUSTC='rustc +1.58.0'"
+ configure: "RUSTC='rustc +1.58.0'"
+ rust_version: "1.58.0"
+
+ - test_task: "check"
+ configure: "--enable-yjit=dev"
+
+ - test_task: "check"
+ configure: "--enable-yjit=dev"
+ yjit_opts: "--yjit-call-threshold=1 --yjit-verify-ctx"
+
+ - test_task: "test-all TESTS=--repeat-count=2"
+ configure: "--enable-yjit=dev"
+
+ - test_task: "test-bundled-gems"
+ configure: "--enable-yjit=dev"
+
+ - test_task: "yjit-bench"
+ configure: "--enable-yjit=dev"
+ yjit_bench_opts: "--yjit-stats"
+ env:
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ RUN_OPTS: ${{ matrix.yjit_opts }}
+ YJIT_BENCH_OPTS: ${{ matrix.yjit_bench_opts }}
+ RUBY_DEBUG: ci
+ BUNDLE_JOBS: 8 # for yjit-bench
+ runs-on: ubuntu-20.04
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+ - name: Install Rust
+ if: ${{ matrix.rust_version }}
+ run: rustup install ${{ matrix.rust_version }} --profile minimal
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@755da8c3cf115ac066823e79a1e1788f8940201b # v3.2.0
+ with:
+ path: src
+ - uses: actions/cache@c17f4bf4666a8001b1a45c09eb7a485c41aa64c3 # v3.2.0
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: Fixed world writable dirs
+ run: |
+ chmod -v go-w $HOME $HOME/.config
+ sudo chmod -R go-w /usr/share
+ sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+ - name: Set ENV
+ run: |
+ echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install ${{ matrix.configure }}
+ - run: make incs
+ - run: make prepare-gems
+ if: ${{ matrix.test_task == 'test-bundled-gems' }}
+ - run: make -j
+ - run: make leaked-globals
+ if: ${{ matrix.test_task == 'check' }}
+ - name: Create dummy files in build dir
+ run: |
+ ./miniruby -e '(("a".."z").to_a+("A".."Z").to_a+("0".."9").to_a+%w[foo bar test zzz]).each{|basename|File.write("#{basename}.rb", "raise %(do not load #{basename}.rb)")}'
+ if: ${{ matrix.test_task == 'check' }}
+ - name: Enable YJIT through ENV
+ run: echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
+ # Check that the binary was built with YJIT
+ - name: Check YJIT enabled
+ run: ./miniruby --yjit -v | grep "+YJIT"
+ - name: make ${{ matrix.test_task }}
+ run: make -s -j ${{ matrix.test_task }} RUN_OPTS="$RUN_OPTS" YJIT_BENCH_OPTS="$YJIT_BENCH_OPTS"
+ timeout-minutes: 60
+ env:
+ RUBY_TESTOPTS: "-q --tty=no"
+ TEST_BUNDLED_GEMS_ALLOW_FAILURES: ""
+ PRECHECK_BUNDLED_GEMS: "no"
+ continue-on-error: ${{ matrix.test_task == 'yjit-bench' }}
+ - name: Show ${{ github.event.pull_request.base.ref }} GitHub URL for yjit-bench comparison
+ run: echo "https://github.com/${BASE_REPO}/commit/${BASE_SHA}"
+ env:
+ BASE_REPO: ${{ github.event.pull_request.base.repo.full_name }}
+ BASE_SHA: ${{ github.event.pull_request.base.sha }}
+ if: ${{ matrix.test_task == 'yjit-bench' && startsWith(github.event_name, 'pull') }}
+ - uses: ruby/action-slack@b6882ea6ef8f556f9f9af9ec1220d3f1ced74acf # v3.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / ${{ matrix.test_task }} ${{ matrix.configure }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.gitignore b/.gitignore
index 1f76488f60..99d32a1825 100644
--- a/.gitignore
+++ b/.gitignore
@@ -1,32 +1,72 @@
-# /
+*-*-*.def
+*-*-*.exp
+*-*-*.lib
+*.a
*.bak
+*.bc
+*.bundle
+*.dSYM
+*.dmyh
*.dylib
+*.elc
+*.i
+*.ii
*.inc
+*.log
*.o
+*.o.tmp
+*.obj
+*.old
*.orig
+*.pch
+*.pdb
+*.rbinc
*.rej
+*.s
*.sav
+*.sl
+*.so
+*.so.*
*.swp
+*.yarb
*~
-.*-*
.*.list
.*.time
.DS_Store
+.bundle
.ccmalloc
.ext
.pc
.ppack
.svn
-/.git
+.time
+.ruby-version
+Makefile
+cygruby*.def
+extconf.h
+y.output
+y.tab.c
+*.gcda
+*.gcno
+*.gcov
+*.vscode
+lcov*.info
+
+# /
+/*-fake.rb
+/*.dll
+/*.exe
+/*.res
/*.pc
+/*.rc
/*_prelude.c
+/.downloaded-cache
+/.top-enc.mk
+/build*/
/COPYING.LIB
-/ChangeLog-1.8.0
-/ChangeLog.pre-alpha
-/ChangeLog.pre1_1
+/ChangeLog
/Doxyfile
/GNUmakefile
-/Makefile
/README.atheos
/README.fat-patch
/README.v6
@@ -34,23 +74,33 @@
/archive
/autom4te*.cache
/automake
+/benchmark/benchmark-driver
/beos
+/bmlog-*
/breakpoints.gdb
/config.cache
/config.h
/config.h.in
-/config.log
/config.status
/config.status.lineno
/configure
+/coverage/simplecov
+/coverage/simplecov-html
+/coverage/doclie
+/coverage/.last_run.json
+/coverage/.resultset.json*
+/coverage/assets
+/coverage/index.html
/doc/capi
/enc.mk
-/enc/trans/*.c
/encdb.h
-/ext/win32ole/.document
+/exts.mk
/goruby
-/id.h
+/id.[ch]
/largefile.h
+/lcov-c-out
+/lcov-rb-out
+/lcov-out
/lex.c
/libruby*.*
/miniprelude.c
@@ -66,391 +116,135 @@
/ppack
/prelude.c
/preview
+/probes.dmyh
+/probes.h
/rbconfig.rb
/rename2.h
/repack
/revision.h
+/revision.tmp
/riscos
/rubicon
/ruby
+/ruby-runner
+/ruby-runner.h
/ruby-man.rd.gz
+/rubyspec_temp
+/run.gdb
+/sizes.c
+/static-ruby
/test.rb
+/test-coverage.dat
/tmp
/transdb.h
/uncommon.mk
+/verconf.h
+/verconf.mk
/web
-/y.output
-/y.tab.c
/yasmdata.rb
+# /bin/
+
+/bin/*.exe
+/bin/*.dll
+/bin/goruby
+/bin/ruby
+
# /benchmark/
+/benchmark/bm_require.data
/benchmark/bmx_*.rb
+/benchmark/fasta.output.*
+/benchmark/wc.input
+
+/enc/*.def
+/enc/*.exp
+/enc/*.lib
+/enc/jis/props.h
+/enc/unicode/data
+
+# /coroutine/
+!/coroutine/**/*.s
# /enc/trans/
/enc/trans/*.c
+/enc/trans/*.def
+/enc/trans/*.exp
+/enc/trans/*.lib
+
+# /exe/
+/exe/goruby
+/exe/ruby
# /ext/
/ext/extinit.c
-/ext/*.log
-
-# /ext/-test-/
-/ext/-test-/*/Makefile
-/ext/-test-/*/extconf.h
-/ext/-test-/*/mkmf.log
-
-# /ext/bigdecimal/
-/ext/bigdecimal/*.def
-/ext/bigdecimal/Makefile
-/ext/bigdecimal/bigdecimal.a
-/ext/bigdecimal/extconf.h
-/ext/bigdecimal/mkmf.log
-/ext/bigdecimal/conftest.dSYM
-
-# /ext/continuation/
-/ext/continuation/extconf.h
-/ext/continuation/Makefile
+/ext/configure-ext.mk
+/ext/*/exts.mk
-# /ext/coverage/
-/ext/coverage/extconf.h
-/ext/coverage/Makefile
+# /ext/-test-/cxxanyargs
+/ext/-test-/cxxanyargs/failure*.failed
-# /ext/curses/
-/ext/curses/*.def
-/ext/curses/Makefile
-/ext/curses/curses.a
-/ext/curses/extconf.h
-/ext/curses/mkmf.log
-/ext/curses/conftest.dSYM
+# /ext/-test-/win32/dln/
+/ext/-test-/win32/dln/dlntest.dll
+/ext/-test-/win32/dln/dlntest.exp
+/ext/-test-/win32/dln/dlntest.lib
-# /ext/dbm/
-/ext/dbm/Makefile
-/ext/dbm/mkmf.log
-/ext/dbm/*.def
-/ext/dbm/extconf.h
-/ext/dbm/conftest.dSYM
-
-# /ext/digest/
-/ext/digest/*.def
-/ext/digest/Makefile
-/ext/digest/digest.a
-/ext/digest/extconf.h
-/ext/digest/mkmf.log
-
-# /ext/digest/bubblebabble/
-/ext/digest/bubblebabble/Makefile
-/ext/digest/bubblebabble/mkmf.log
-/ext/digest/bubblebabble/*.def
-/ext/digest/bubblebabble/extconf.h
-
-# /ext/digest/md5/
-/ext/digest/md5/*.def
-/ext/digest/md5/Makefile
-/ext/digest/md5/extconf.h
-/ext/digest/md5/md5.a
-/ext/digest/md5/mkmf.log
-/ext/digest/md5/conftest.dSYM
-
-# /ext/digest/rmd160/
-/ext/digest/rmd160/*.def
-/ext/digest/rmd160/Makefile
-/ext/digest/rmd160/extconf.h
-/ext/digest/rmd160/mkmf.log
-/ext/digest/rmd160/rmd160.a
-/ext/digest/rmd160/conftest.dSYM
-
-# /ext/digest/sha1/
-/ext/digest/sha1/*.def
-/ext/digest/sha1/Makefile
-/ext/digest/sha1/extconf.h
-/ext/digest/sha1/mkmf.log
-/ext/digest/sha1/sha1.a
-/ext/digest/sha1/conftest.dSYM
-
-# /ext/digest/sha2/
-/ext/digest/sha2/*.def
-/ext/digest/sha2/Makefile
-/ext/digest/sha2/extconf.h
-/ext/digest/sha2/mkmf.log
-/ext/digest/sha2/sha2.a
-
-# /ext/dl/
-/ext/dl/*.def
-/ext/dl/*.func
-/ext/dl/*.o
-/ext/dl/*~
-/ext/dl/Makefile
-/ext/dl/dl.a
-/ext/dl/extconf.h
-/ext/dl/mkmf.log
-/ext/dl/conftest.dSYM
-
-# /ext/dl/callback/
-/ext/dl/callback/*.def
-/ext/dl/callback/*.func
-/ext/dl/callback/*.o
-/ext/dl/callback/*~
-/ext/dl/callback/Makefile
-/ext/dl/callback/callback-*.c
-/ext/dl/callback/callback.a
-/ext/dl/callback/callback.c
-/ext/dl/callback/extconf.h
-/ext/dl/callback/mkmf.log
-/ext/dl/callback/conftest.dSYM
-
-# /ext/dl/win32/
-/ext/dl/win32/Makefile
+# /ext/-test-/gems
+/ext/-test-/gems
# /ext/etc/
-/ext/etc/*.def
-/ext/etc/Makefile
-/ext/etc/etc.a
-/ext/etc/extconf.h
-/ext/etc/mkmf.log
-/ext/etc/conftest.dSYM
-
-# /ext/fcntl/
-/ext/fcntl/*.def
-/ext/fcntl/Makefile
-/ext/fcntl/extconf.h
-/ext/fcntl/fcntl.a
-/ext/fcntl/mkmf.log
-
-# /ext/fiber/
-/ext/fiber/extconf.h
-/ext/fiber/Makefile
+/ext/etc/constdefs.h
# /ext/fiddle/
-/ext/fiddle/Makefile
-/ext/fiddle/extconf.h
-/ext/fiddle/mkmf.log
-/ext/fiddle/fiddle.a
-
-# /ext/gdbm/
-/ext/gdbm/Makefile
-/ext/gdbm/mkmf.log
-/ext/gdbm/*.def
-/ext/gdbm/extconf.h
-/ext/gdbm/conftest.dSYM
+/ext/fiddle/libffi-*
-# /ext/iconv/
-/ext/iconv/*.def
-/ext/iconv/Makefile
-/ext/iconv/config.charset
-/ext/iconv/extconf.h
-/ext/iconv/iconv.a
-/ext/iconv/iconv.rb
-/ext/iconv/mkmf.log
-/ext/iconv/conftest.dSYM
-
-# /ext/io/nonblock/
-/ext/io/nonblock/Makefile
-/ext/io/nonblock/extconf.h
-/ext/io/nonblock/mkmf.log
-/ext/io/nonblock/nonblock.a
-
-# /ext/io/console/
-/ext/io/console/Makefile
-/ext/io/console/extconf.h
-/ext/io/console/mkmf.log
-/ext/io/console/console.a
-
-# /ext/io/wait/
-/ext/io/wait/Makefile
-/ext/io/wait/extconf.h
-/ext/io/wait/mkmf.log
-/ext/io/wait/wait.a
-
-# /ext/json/
-/ext/json/Makefile
-/ext/json/extconf.h
-
-# /ext/json/ext/generator/
-/ext/json/ext/generator/*.def
-/ext/json/ext/generator/Makefile
-/ext/json/ext/generator/extconf.h
-/ext/json/ext/generator/mkmf.log
-/ext/json/ext/generator/generator.a
-/ext/json/generator/*.def
-/ext/json/generator/Makefile
-/ext/json/generator/extconf.h
-/ext/json/generator/mkmf.log
-/ext/json/generator/generator.a
-
-# /ext/json/ext/parser/
-/ext/json/ext/parser/*.def
-/ext/json/ext/parser/Makefile
-/ext/json/ext/parser/extconf.h
-/ext/json/ext/parser/mkmf.log
-/ext/json/ext/parser/parser.a
-/ext/json/parser/*.def
-/ext/json/parser/Makefile
-/ext/json/parser/extconf.h
-/ext/json/parser/mkmf.log
-/ext/json/parser/parser.a
-
-# /ext/mathn/complex/
-/ext/mathn/complex/Makefile
-/ext/mathn/complex/extconf.h
-
-# /ext/mathn/rational/
-/ext/mathn/rational/Makefile
-/ext/mathn/rational/extconf.h
-
-# /ext/nkf/
-/ext/nkf/*.def
-/ext/nkf/Makefile
-/ext/nkf/extconf.h
-/ext/nkf/mkmf.log
-/ext/nkf/nkf.a
-
-# /ext/objspace/
-/ext/objspace/Makefile
-/ext/objspace/extconf.h
-
-# /ext/openssl/
-/ext/openssl/GNUmakefile
-/ext/openssl/Makefile
-/ext/openssl/dep
-/ext/openssl/extconf.h
-/ext/openssl/mkmf.log
-/ext/openssl/openssl.a
-/ext/openssl/conftest.dSYM
-
-# /ext/pathname/
-/ext/pathname/*.def
-/ext/pathname/Makefile
-/ext/pathname/extconf.h
-/ext/pathname/mkmf.log
-/ext/pathname/pathname.a
-
-# /ext/psych/
-/ext/psych/Makefile
-/ext/psych/extconf.h
-/ext/psych/mkmf.log
-/ext/psych/psych.a
-
-# /ext/pty/
-/ext/pty/*.def
-/ext/pty/Makefile
-/ext/pty/extconf.h
-/ext/pty/mkmf.log
-/ext/pty/pty.a
-/ext/pty/conftest.dSYM
-
-# /ext/racc/cparse/
-/ext/racc/cparse/*.def
-/ext/racc/cparse/Makefile
-/ext/racc/cparse/cparse.a
-/ext/racc/cparse/extconf.h
-/ext/racc/cparse/mkmf.log
-/ext/racc/cparse/conftest.dSYM
-
-# /ext/readline/
-/ext/readline/*.def
-/ext/readline/Makefile
-/ext/readline/extconf.h
-/ext/readline/mkmf.log
-/ext/readline/readline.a
-/ext/readline/conftest.dSYM
+# /ext/rbconfig/
+/ext/rbconfig/sizeof/sizes.c
+/ext/rbconfig/sizeof/limits.c
# /ext/ripper/
-/ext/ripper/Makefile
-/ext/ripper/mkmf.log
/ext/ripper/eventids1.c
+/ext/ripper/.eventids2-check
/ext/ripper/eventids2table.c
/ext/ripper/ripper.*
/ext/ripper/ids1
/ext/ripper/ids2
-/ext/ripper/extconf.h
-/ext/ripper/y.output
-
-# /ext/sdbm/
-/ext/sdbm/*.def
-/ext/sdbm/Makefile
-/ext/sdbm/extconf.h
-/ext/sdbm/mkmf.log
-/ext/sdbm/sdbm.a
# /ext/socket/
-/ext/socket/*.def
-/ext/socket/Makefile
/ext/socket/constants.h
/ext/socket/constdefs.h
/ext/socket/constdefs.c
-/ext/socket/extconf.h
-/ext/socket/mkmf.log
-/ext/socket/socket.a
-/ext/socket/conftest.dSYM
-
-# /ext/stringio/
-/ext/stringio/*.def
-/ext/stringio/Makefile
-/ext/stringio/extconf.h
-/ext/stringio/mkmf.log
-/ext/stringio/stringio.a
-# /ext/strscan/
-/ext/strscan/*.def
-/ext/strscan/Makefile
-/ext/strscan/extconf.h
-/ext/strscan/mkmf.log
-/ext/strscan/strscan.a
+# /gems
+/gems/*.gem
+/gems/src
+/gems/*-*
-# /ext/syck/
-/ext/syck/*.def
-/ext/syck/Makefile
-/ext/syck/extconf.h
-/ext/syck/mkmf.log
-/ext/syck/syck.a
+# /lib/
+/lib/ruby/[1-9]*.*
+/lib/ruby/vendor_ruby
-# /ext/syslog/
-/ext/syslog/*.def
-/ext/syslog/Makefile
-/ext/syslog/extconf.h
-/ext/syslog/mkmf.log
-/ext/syslog/syslog.a
-/ext/syslog/conftest.dSYM
+# /misc/
+/misc/**/__pycache__
-# /ext/tmpdir/
-/ext/tmpdir/Makefile
-/ext/tmpdir/extconf.h
-/ext/tmpdir/mkmf.log
-/ext/tmpdir/tmpdir.a
+# /spec/bundler
+/.rspec_status
-# /ext/tk/
-/ext/tk/Makefile
-/ext/tk/*.log
-/ext/tk/*.def
-/ext/tk/conftest.dSYM
-/ext/tk/extconf.h
-/ext/tk/config_list
+# /tool/
+/tool/config.guess
+/tool/config.sub
-# /ext/tk/tkutil/
-/ext/tk/tkutil/Makefile
-/ext/tk/tkutil/*.log
-/ext/tk/tkutil/*.def
-/ext/tk/tkutil/conftest.dSYM
-/ext/tk/tkutil/extconf.h
-
-# /ext/win32ole/
-/ext/win32ole/Makefile
-/ext/win32ole/mkmf.log
-/ext/win32ole/*.log
-/ext/win32ole/.document
-
-# /ext/zlib/
-/ext/zlib/*.def
-/ext/zlib/Makefile
-/ext/zlib/extconf.h
-/ext/zlib/mkmf.log
-/ext/zlib/zlib.a
-/ext/zlib/conftest.dSYM
+# /win32/
+/win32/*.ico
-# /lib/rexml/
+# MJIT
+/include/ruby-*/*/rb_mjit_min_header-*.h
+/lib/ruby_vm/mjit/instruction.rb
+/mjit_config.h
+/rb_mjit_header.h
-# /spec/
-/spec/mspec
-/spec/rubyspec
+# YJIT
+/yjit-bench
+/yjit_exit_locations.dump
-# /win32/
-/win32/*.ico
+# /wasm/
+/wasm/tests/*.wasm
diff --git a/.indent.pro b/.indent.pro
index 6a207a0554..1d61cbcad1 100644
--- a/.indent.pro
+++ b/.indent.pro
@@ -2,12 +2,15 @@
-nbbb
-nbc
-br
+-brs
-nbs
-ncdb
--ce
--cli0.5
+-nce
+-cdw
+-cli2
+-cbi2
-ndj
--ei
+-ncs
-nfc1
-i4
-l120
@@ -16,6 +19,14 @@
-psl
-sc
-sob
+-sbi4
+-nut
+-par
-TID
-TVALUE
+-Tst_data_t
+-Tst_index_t
+-Tst_table
+-Trb_data_type_t
+-TFILE
diff --git a/.rdoc_options b/.rdoc_options
new file mode 100644
index 0000000000..760507c7a2
--- /dev/null
+++ b/.rdoc_options
@@ -0,0 +1,4 @@
+---
+page_dir: doc
+main_page: README.md
+title: Documentation for Ruby development version
diff --git a/.rspec_parallel b/.rspec_parallel
new file mode 100644
index 0000000000..aaff198a32
--- /dev/null
+++ b/.rspec_parallel
@@ -0,0 +1,2 @@
+--format progress
+--format ParallelTests::RSpec::RuntimeLogger --out tmp/parallel_runtime_rspec.log
diff --git a/.travis.yml b/.travis.yml
new file mode 100644
index 0000000000..741c0a32ef
--- /dev/null
+++ b/.travis.yml
@@ -0,0 +1,152 @@
+# -*- YAML -*-
+# Copyright (C) 2011 Urabe, Shyouhei. All rights reserved.
+#
+# This file is a part of the programming language Ruby. Permission is hereby
+# granted, to either redistribute or modify this file, provided that the
+# conditions mentioned in the file COPYING are met. Consult the file for
+# details.
+
+# When you see Travis CI issues, or you are interested in understanding how to
+# manage, please check the link below.
+# https://github.com/ruby/ruby/wiki/CI-Servers#travis-ci
+
+# We enable Travis on the specific branches or forked repositories here.
+if: >-
+ (repo != ruby/ruby OR branch = master OR branch =~ /^ruby_\d_\d$/)
+ AND (commit_message !~ /\[DOC\]/)
+
+language: c
+
+os: linux
+
+dist: jammy
+
+git:
+ quiet: true
+
+env:
+ global:
+ - NPROC="$(nproc)"
+ - JOBS="-j${NPROC}"
+ # SETARCH are overridden when necessary. See below.
+ - SETARCH=
+ # https://github.com/travis-ci/travis-build/blob/e411371dda21430a60f61b8f3f57943d2fe4d344/lib/travis/build/bash/travis_apt_get_options.bash#L7
+ - travis_apt_get_options='--allow-downgrades --allow-remove-essential --allow-change-held-packages'
+ - travis_apt_get_options="-yq --no-install-suggests --no-install-recommends $travis_apt_get_options"
+ # -g0 disables backtraces when SEGV. Do not set that.
+ - debugflags=-ggdb3
+ - RUBY_TESTOPTS="$JOBS -q --tty=no"
+
+.org.ruby-lang.ci.matrix-definitions:
+ - &gcc-11
+ compiler: gcc-11
+ before_install:
+ - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
+ - >-
+ tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install
+ gcc-11
+ g++-11
+ libffi-dev
+ libncurses-dev
+ libncursesw5-dev
+ libreadline-dev
+ libssl-dev
+ libyaml-dev
+ openssl
+ zlib1g-dev
+ - gcc-11 --version
+ - &arm64-linux
+ name: arm64-linux
+ arch: arm64
+ <<: *gcc-11
+ - &ppc64le-linux
+ name: ppc64le-linux
+ arch: ppc64le
+ <<: *gcc-11
+ - &s390x-linux
+ name: s390x-linux
+ arch: s390x
+ <<: *gcc-11
+ env:
+ # Avoid possible test failures with the zlib applying the following patch
+ # on s390x CPU architecture.
+ # https://github.com/madler/zlib/pull/410
+ - DFLTCC=0
+ - &arm32-linux
+ name: arm32-linux
+ arch: arm64
+ # https://packages.ubuntu.com/jammy/crossbuild-essential-armhf
+ compiler: arm-linux-gnueabihf-gcc
+ env:
+ - SETARCH='setarch linux32 --verbose --32bit'
+ # Still keep the -O1 for only arm32, while we want to test with the
+ # default optflags -O3.
+ # Because bootstraptest/test_ractor.rb fails with segfualt with the
+ # default -O3.
+ # https://bugs.ruby-lang.org/issues/19981
+ - optflags=-O1
+ before_install:
+ - sudo dpkg --add-architecture armhf
+ - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
+ - >-
+ tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install
+ crossbuild-essential-armhf
+ libc6:armhf
+ libstdc++-10-dev:armhf
+ libffi-dev:armhf
+ libncurses-dev:armhf
+ libncursesw5-dev:armhf
+ libreadline-dev:armhf
+ libssl-dev:armhf
+ libyaml-dev:armhf
+ linux-libc-dev:armhf
+ zlib1g-dev:armhf
+
+matrix:
+ include:
+ - <<: *arm64-linux
+ - <<: *ppc64le-linux
+ - <<: *s390x-linux
+ # FIXME: lib/rubygems/util.rb:104 glob_files_in_dir -
+ # <internal:dir>:411:in glob: File name too long - (Errno::ENAMETOOLONG)
+ # https://github.com/rubygems/rubygems/issues/7132
+ - <<: *arm32-linux
+ allow_failures:
+ # Allow failures for the unstable jobs.
+ # - name: arm64-linux
+ # - name: ppc64le-linux
+ # - name: s390x-linux
+ # The 2nd arm64 pipeline may be unstable.
+ # - name: arm32-linux
+ fast_finish: true
+
+before_script:
+ - ./autogen.sh
+ - mkdir build
+ - cd build
+ - $SETARCH ../configure -C --disable-install-doc --prefix=$(pwd)/install
+ - $SETARCH make -s $JOBS
+ - make -s $JOBS install
+ # Useful info to report issues to the Ruby.
+ - $SETARCH $(pwd)/install/bin/ruby -v
+ # Useful info To report issues to the RubyGems.
+ - $SETARCH $(pwd)/install/bin/gem env
+
+script:
+ - $SETARCH make -s test
+ - ../tool/travis_wait.sh $SETARCH make -s test-all RUBYOPT="-w"
+ - $SETARCH make -s test-spec
+
+# We want to be notified when something happens.
+notifications:
+ webhooks:
+ urls:
+ # ruby-lang slack: ruby/simpler-alerts-bot (travis)
+ - secure: mRsoS/UbqDkKkW5p3AEqM27d4SZnV6Gsylo3bm8T/deltQzTsGzZwrm7OIBXZv0UFZdE68XmPlyHfZFLSP2V9QZ7apXMf9/vw0GtcSe1gchtnjpAPF6lYBn7nMCbVPPx9cS0dwL927fjdRM1vj7IKZ2bk4F0lAJ25R25S6teqdk=
+ on_success: never
+ on_failure: always
+ email:
+ recipients:
+ - jaruga@ruby-lang.org
+ on_success: never
+ on_failure: always
diff --git a/BSDL b/BSDL
index 82725534fa..66d93598aa 100644
--- a/BSDL
+++ b/BSDL
@@ -1,13 +1,13 @@
-Copyright (C) 1993-2010 Yukihiro Matsumoto. All rights reserved.
+Copyright (C) 1993-2013 Yukihiro Matsumoto. All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
are met:
1. Redistributions of source code must retain the above copyright
-notice, this list of conditions and the following disclaimer.
+ notice, this list of conditions and the following disclaimer.
2. Redistributions in binary form must reproduce the above copyright
-notice, this list of conditions and the following disclaimer in the
-documentation and/or other materials provided with the distribution.
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
new file mode 100644
index 0000000000..13df6087ca
--- /dev/null
+++ b/CONTRIBUTING.md
@@ -0,0 +1 @@
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing_md.html), which includes setup and build instructions.
diff --git a/COPYING b/COPYING
index a1f19ff99d..48e5a96de7 100644
--- a/COPYING
+++ b/COPYING
@@ -2,55 +2,55 @@ Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
You can redistribute it and/or modify it under either the terms of the
2-clause BSDL (see the file BSDL), or the conditions below:
- 1. You may make and give away verbatim copies of the source form of the
- software without restriction, provided that you duplicate all of the
- original copyright notices and associated disclaimers.
+1. You may make and give away verbatim copies of the source form of the
+ software without restriction, provided that you duplicate all of the
+ original copyright notices and associated disclaimers.
- 2. You may modify your copy of the software in any way, provided that
- you do at least ONE of the following:
+2. You may modify your copy of the software in any way, provided that
+ you do at least ONE of the following:
- a) place your modifications in the Public Domain or otherwise
- make them Freely Available, such as by posting said
- modifications to Usenet or an equivalent medium, or by allowing
- the author to include your modifications in the software.
+ a. place your modifications in the Public Domain or otherwise
+ make them Freely Available, such as by posting said
+ modifications to Usenet or an equivalent medium, or by allowing
+ the author to include your modifications in the software.
- b) use the modified software only within your corporation or
- organization.
+ b. use the modified software only within your corporation or
+ organization.
- c) give non-standard binaries non-standard names, with
- instructions on where to get the original software distribution.
+ c. give non-standard binaries non-standard names, with
+ instructions on where to get the original software distribution.
- d) make other distribution arrangements with the author.
+ d. make other distribution arrangements with the author.
- 3. You may distribute the software in object code or binary form,
- provided that you do at least ONE of the following:
+3. You may distribute the software in object code or binary form,
+ provided that you do at least ONE of the following:
- a) distribute the binaries and library files of the software,
- together with instructions (in the manual page or equivalent)
- on where to get the original distribution.
+ a. distribute the binaries and library files of the software,
+ together with instructions (in the manual page or equivalent)
+ on where to get the original distribution.
- b) accompany the distribution with the machine-readable source of
- the software.
+ b. accompany the distribution with the machine-readable source of
+ the software.
- c) give non-standard binaries non-standard names, with
- instructions on where to get the original software distribution.
+ c. give non-standard binaries non-standard names, with
+ instructions on where to get the original software distribution.
- d) make other distribution arrangements with the author.
+ d. make other distribution arrangements with the author.
- 4. You may modify and include the part of the software into any other
- software (possibly commercial). But some files in the distribution
- are not written by the author, so that they are not under these terms.
+4. You may modify and include the part of the software into any other
+ software (possibly commercial). But some files in the distribution
+ are not written by the author, so that they are not under these terms.
- For the list of those files and their copying conditions, see the
- file LEGAL.
+ For the list of those files and their copying conditions, see the
+ file LEGAL.
- 5. The scripts and library files supplied as input to or produced as
- output from the software do not automatically fall under the
- copyright of the software, but belong to whomever generated them,
- and may be sold commercially, and may be aggregated with this
- software.
+5. The scripts and library files supplied as input to or produced as
+ output from the software do not automatically fall under the
+ copyright of the software, but belong to whomever generated them,
+ and may be sold commercially, and may be aggregated with this
+ software.
- 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
- IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
- WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
- PURPOSE.
+6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+ IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+ WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
index 5b5b91c149..230376bc60 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -1,51 +1,51 @@
-$BK\%W%m%0%i%`$O%U%j!<%=%U%H%&%'%"$G$9!%(B2-clause BSDL
-$B$^$?$O0J2<$K<($9>r7o$GK\%W%m%0%i%`$r:FG[I[$G$-$^$9(B
-2-clause BSDL$B$K$D$$$F$O(BBSDL$B%U%!%$%k$r;2>H$7$F2<$5$$!%(B
+本プログラムã¯ãƒ•リーソフトウェアã§ã™ï¼Ž2-clause BSDL
+ã¾ãŸã¯ä»¥ä¸‹ã«ç¤ºã™æ¡ä»¶ã§æœ¬ãƒ—ログラムをå†é…布ã§ãã¾ã™
+2-clause BSDLã«ã¤ã„ã¦ã¯BSDLファイルをå‚ç…§ã—ã¦ä¸‹ã•ã„.
- 1. $BJ#@=$O@)8B$J$/<+M3$G$9!%(B
+1. 複製ã¯åˆ¶é™ãªã自由ã§ã™ï¼Ž
- 2. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$N%=!<%9$r(B
- $B<+M3$KJQ99$G$-$^$9!%(B
+2. ä»¥ä¸‹ã®æ¡ä»¶ã®ã„ãšã‚Œã‹ã‚’満ãŸã™æ™‚ã«æœ¬ãƒ—ログラムã®ã‚½ãƒ¼ã‚¹ã‚’
+ 自由ã«å¤‰æ›´ã§ãã¾ã™ï¼Ž
- (a) $B%M%C%H%K%e!<%:$K%]%9%H$7$?$j!$:n<T$KJQ99$rAwIU$9$k(B
- $B$J$I$NJ}K!$G!$JQ99$r8x3+$9$k!%(B
+ a. ãƒãƒƒãƒˆãƒ‹ãƒ¥ãƒ¼ã‚ºã«ãƒã‚¹ãƒˆã—ãŸã‚Šï¼Œä½œè€…ã«å¤‰æ›´ã‚’é€ä»˜ã™ã‚‹
+ ãªã©ã®æ–¹æ³•ã§ï¼Œå¤‰æ›´ã‚’公開ã™ã‚‹ï¼Ž
- (b) $BJQ99$7$?K\%W%m%0%i%`$r<+J,$N=jB0$9$kAH?%FbIt$@$1$G(B
- $B;H$&!%(B
+ b. 変更ã—ãŸæœ¬ãƒ—ãƒ­ã‚°ãƒ©ãƒ ã‚’è‡ªåˆ†ã®æ‰€å±žã™ã‚‹çµ„織内部ã ã‘ã§
+ 使ã†ï¼Ž
- (c) $BJQ99E@$rL@<($7$?$&$(!$%=%U%H%&%'%"$NL>A0$rJQ99$9$k!%(B
- $B$=$N%=%U%H%&%'%"$rG[I[$9$k;~$K$OJQ99A0$NK\%W%m%0%i(B
- $B%`$bF1;~$KG[I[$9$k!%$^$?$OJQ99A0$NK\%W%m%0%i%`$N%=!<(B
- $B%9$NF~<jK!$rL@<($9$k!%(B
+ c. 変更点を明示ã—ãŸã†ãˆï¼Œã‚½ãƒ•トウェアã®åå‰ã‚’変更ã™ã‚‹ï¼Ž
+ ãã®ã‚½ãƒ•トウェアをé…布ã™ã‚‹æ™‚ã«ã¯å¤‰æ›´å‰ã®æœ¬ãƒ—ログラ
+ ãƒ ã‚‚åŒæ™‚ã«é…布ã™ã‚‹ï¼Žã¾ãŸã¯å¤‰æ›´å‰ã®æœ¬ãƒ—ログラムã®ã‚½ãƒ¼
+ スã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
- (d) $B$=$NB>$NJQ99>r7o$r:n<T$H9g0U$9$k!%(B
+ d. ãã®ä»–ã®å¤‰æ›´æ¡ä»¶ã‚’作者ã¨åˆæ„ã™ã‚‹ï¼Ž
- 3. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$r%3%s%Q%$(B
- $B%k$7$?%*%V%8%'%/%H%3!<%I$d<B9T7A<0$G$bG[I[$G$-$^$9!%(B
+3. ä»¥ä¸‹ã®æ¡ä»¶ã®ã„ãšã‚Œã‹ã‚’満ãŸã™æ™‚ã«æœ¬ãƒ—ログラムをコンパイ
+ ルã—ãŸã‚ªãƒ–ジェクトコードや実行形å¼ã§ã‚‚é…布ã§ãã¾ã™ï¼Ž
- (a) $B%P%$%J%j$r<u$1<h$C$??M$,%=!<%9$rF~<j$G$-$k$h$&$K!$(B
- $B%=!<%9$NF~<jK!$rL@<($9$k!%(B
+ a. ãƒã‚¤ãƒŠãƒªã‚’å—ã‘å–ã£ãŸäººãŒã‚½ãƒ¼ã‚¹ã‚’入手ã§ãるよã†ã«ï¼Œ
+ ソースã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
- (b) $B5!3#2DFI$J%=!<%9%3!<%I$rE:IU$9$k!%(B
+ b. 機械å¯èª­ãªã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã‚’添付ã™ã‚‹ï¼Ž
- (c) $BJQ99$r9T$C$?%P%$%J%j$OL>A0$rJQ99$7$?$&$(!$%*%j%8%J(B
- $B%k$N%=!<%9%3!<%I$NF~<jK!$rL@<($9$k!%(B
+ c. 変更を行ã£ãŸãƒã‚¤ãƒŠãƒªã¯åå‰ã‚’変更ã—ãŸã†ãˆï¼Œã‚ªãƒªã‚¸ãƒŠ
+ ルã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
- (d) $B$=$NB>$NG[I[>r7o$r:n<T$H9g0U$9$k!%(B
+ d. ãã®ä»–ã®é…布æ¡ä»¶ã‚’作者ã¨åˆæ„ã™ã‚‹ï¼Ž
- 4. $BB>$N%W%m%0%i%`$X$N0zMQ$O$$$+$J$kL\E*$G$"$l<+M3$G$9!%$?(B
- $B$@$7!$K\%W%m%0%i%`$K4^$^$l$kB>$N:n<T$K$h$k%3!<%I$O!$$=(B
- $B$l$>$l$N:n<T$N0U8~$K$h$k@)8B$,2C$($i$l$k>l9g$,$"$j$^$9!%(B
+4. ä»–ã®ãƒ—ログラムã¸ã®å¼•用ã¯ã„ã‹ãªã‚‹ç›®çš„ã§ã‚れ自由ã§ã™ï¼ŽãŸ
+ ã ã—,本プログラムã«å«ã¾ã‚Œã‚‹ä»–ã®ä½œè€…ã«ã‚ˆã‚‹ã‚³ãƒ¼ãƒ‰ã¯ï¼Œã
+ れãžã‚Œã®ä½œè€…ã®æ„å‘ã«ã‚ˆã‚‹åˆ¶é™ãŒåŠ ãˆã‚‰ã‚Œã‚‹å ´åˆãŒã‚りã¾ã™ï¼Ž
- $B$=$l$i%U%!%$%k$N0lMw$H$=$l$>$l$NG[I[>r7o$J$I$KIU$$$F$O(B
- LEGAL$B%U%!%$%k$r;2>H$7$F$/$@$5$$!%(B
+ ãれらファイルã®ä¸€è¦§ã¨ãれãžã‚Œã®é…布æ¡ä»¶ãªã©ã«ä»˜ã„ã¦ã¯
+ LEGALファイルをå‚ç…§ã—ã¦ãã ã•ã„.
- 5. $BK\%W%m%0%i%`$X$NF~NO$H$J$k%9%/%j%W%H$*$h$S!$K\%W%m%0%i(B
- $B%`$+$i$N=PNO$N8"Mx$OK\%W%m%0%i%`$N:n<T$G$O$J$/!$$=$l$>(B
- $B$l$NF~=PNO$r@8@.$7$??M$KB0$7$^$9!%$^$?!$K\%W%m%0%i%`$K(B
- $BAH$_9~$^$l$k$?$a$N3HD%%i%$%V%i%j$K$D$$$F$bF1MM$G$9!%(B
+5. 本プログラムã¸ã®å…¥åŠ›ã¨ãªã‚‹ã‚¹ã‚¯ãƒªãƒ—トãŠã‚ˆã³ï¼Œæœ¬ãƒ—ログラ
+ ムã‹ã‚‰ã®å‡ºåŠ›ã®æ¨©åˆ©ã¯æœ¬ãƒ—ログラムã®ä½œè€…ã§ã¯ãªã,ãれãž
+ れã®å…¥å‡ºåŠ›ã‚’ç”Ÿæˆã—ãŸäººã«å±žã—ã¾ã™ï¼Žã¾ãŸï¼Œæœ¬ãƒ—ログラムã«
+ 組ã¿è¾¼ã¾ã‚Œã‚‹ãŸã‚ã®æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã«ã¤ã„ã¦ã‚‚åŒæ§˜ã§ã™ï¼Ž
- 6. $BK\%W%m%0%i%`$OL5J]>Z$G$9!%:n<T$OK\%W%m%0%i%`$r%5%]!<%H(B
- $B$9$k0U;V$O$"$j$^$9$,!$%W%m%0%i%`<+?H$N%P%0$"$k$$$OK\%W(B
- $B%m%0%i%`$N<B9T$J$I$+$iH/@8$9$k$$$+$J$kB;32$KBP$7$F$b@U(B
- $BG$$r;}$A$^$;$s!%(B
+6. 本プログラムã¯ç„¡ä¿è¨¼ã§ã™ï¼Žä½œè€…ã¯æœ¬ãƒ—ログラムをサãƒãƒ¼ãƒˆ
+ ã™ã‚‹æ„å¿—ã¯ã‚りã¾ã™ãŒï¼Œãƒ—ログラム自身ã®ãƒã‚°ã‚ã‚‹ã„ã¯æœ¬ãƒ—
+ ログラムã®å®Ÿè¡Œãªã©ã‹ã‚‰ç™ºç”Ÿã™ã‚‹ã„ã‹ãªã‚‹æå®³ã«å¯¾ã—ã¦ã‚‚責
+ 任をæŒã¡ã¾ã›ã‚“.
diff --git a/ChangeLog b/ChangeLog
deleted file mode 100644
index 04a49d545e..0000000000
--- a/ChangeLog
+++ /dev/null
@@ -1,4920 +0,0 @@
-Thu Jan 20 12:15:44 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * configure.in: Add stdlib.h inclusion into rb_cv_negative_time_t
- test becuase it's required for exit(3). The patch is
- created by Tomoyuki Chikanaga. [Bug #4287] [ruby-dev:43060]
-
-Thu Jan 20 11:39:41 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/webrick/utils.rb (TestWEBrick::RubyBin): test CGI does not need
- to load rubygems. if it activated, ruby raises LoadError about
- rbconfig.rb.
-
-Thu Jan 20 09:19:42 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/json_tree.rb: Fix JSON emit for
- DateTime and Time classes.
-
- * test/psych/test_json_tree.rb: test for JSON emit
-
-Thu Jan 20 08:02:46 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/coder.rb (represent_object): arbitrary objects
- may be passed to the Psych::Coder object.
-
- * ext/psych/lib/psych/visitors/yaml_tree.rb: support for visiting
- arbitrary objects set on the coder.
-
- * test/psych/test_coder.rb: supporting test case.
-
-Thu Jan 20 06:03:17 2011 Tanaka Akira <akr@fsij.org>
-
- * method.h: parenthesize macro arguments.
-
-Wed Jan 19 13:16:05 2011 Eric Hodel <drbrain@segment7.net>
-
- * lib/rubygems/commands/sources_command.rb: Finish removing code,
- (fixes sources command test).
-
-Wed Jan 19 13:04:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * proc.c (proc_call): Add gc guard to avoid segfault. The fix
- is created by Tomoyuki Chikanaga. [Bug #4238][ruby-dev:42963]
-
-Wed Jan 19 12:31:28 2011 Eric Hodel <drbrain@segment7.net>
-
- * lib/rubygems.rb: Since gem_prelude requires rubygems, enable
- custom_require always.
-
-Wed Jan 19 12:08:08 2011 Eric Hodel <drbrain@segment7.net>
-
- * lib/rubygems/commands/dependency_command.rb: Remove require of
- deleted file.
- * lib/rubygems/commands/fetch_command.rb: ditto
- * lib/rubygems/commands/setup_command.rb: ditto
- * lib/rubygems/commands/sources_command.rb: ditto
- * lib/rubygems/commands/specification_command.rb: ditto
-
-Wed Jan 19 08:13:59 2011 Ryan Davis <ryand-ruby@zenspider.com>
-
- * lib/rubygems*: Import rubygems 1.5.0 (release candidate)
- * test/rubygems: Ditto
-
-Tue Jan 18 23:31:01 2011 Yusuke Endoh <mame@tsg.ne.jp>
-
- * parse.y: avoid NULL reference. [ruby-dev:43067]
-
-Wed Jan 19 02:54:04 2011 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vsnprintf.c (cvt): set first byte of buf to NUL for the case when
- no bytes are written to the buf. [ruby-dev:43062]
-
-Tue Jan 18 23:04:51 2011 Tanaka Akira <akr@fsij.org>
-
- * gc.h: parenthesize macro arguments.
-
-Tue Jan 18 18:31:14 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
-
- * lib/irb/comletion.rb: Irb tab completion support for XX::method forms.
-
-Tue Jan 18 15:05:55 2011 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/logger.rb: added RDoc document for logging message escape
- by Hal Brodigan. See #3869
-
-Tue Jan 18 07:53:52 2011 Tanaka Akira <akr@fsij.org>
-
- * eval_intern.h: parenthesize macro arguments.
-
-Tue Jan 18 04:42:44 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/parser.rb (Mark): Adding a class to wrap
- marker information
-
- * ext/psych/parser.c (mark): Add a method to return the mark object
- for the parser
-
- * test/psych/test_parser.rb: tests for the Mark class.
-
-Tue Jan 18 02:46:55 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/json_tree.rb (visit_String): JSON
- strings should be dumped with double quotes. [ruby-core:34186]
-
- * test/psych/test_json_tree.rb: test for double quotes
-
-Mon Jan 17 23:36:33 2011 Tanaka Akira <akr@fsij.org>
-
- * array.c (rb_ary_times): less MEMCPY calls.
-
-Mon Jan 17 22:54:33 2011 Tanaka Akira <akr@fsij.org>
-
- * debug.h: parenthesize macro arguments.
-
-Mon Jan 17 21:40:25 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (process_options): revert r30549.
-
-Sun Jan 16 20:55:45 2011 Tanaka Akira <akr@fsij.org>
-
- * vsnprintf.c: parenthesize macro arguments.
-
-Sat Jan 15 11:57:30 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (warnflags): add -Werror=implicit-function-declaration
- if available.
-
- * lib/mkmf.rb (init_mkmf): ignore warnings in mkmf tests.
-
- * test/mkmf/base.rb (setup, teardown): restore config values.
-
- * test/mkmf/test_flags.rb: split from test_find_executable.rb.
-
-Sat Jan 15 10:04:14 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (process_options): autoload rubygems.
-
- * tool/compile_prelude.rb (Prelude#initialize): ignore empty
- preludes.
-
- * ruby.c (ruby_init_prelude): get rid of global namespace
- pullution.
-
-Sat Jan 15 09:42:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/io.h: missing prototypes.
-
-Fri Jan 14 23:25:55 2011 Tanaka Akira <akr@fsij.org>
-
- * vm_method.c: parenthesize macro arguments.
-
-Fri Jan 14 15:32:29 2011 Shugo Maeda <shugo@ruby-lang.org>
-
- * test/net/imap/test_imap.rb: call neither logout nor disconnect
- unless connected. patch by Kazuhiro NISHIYAMA. [ruby-dev:42860]
-
-Fri Jan 14 14:56:57 2011 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/imap.rb: use bytesize for binary strings.
- patched by Yoshimasa Niwa. [ruby-core:34222]
-
-Fri Jan 14 14:01:12 2011 NARUSE, Yui <naruse@ruby-lang.org>
-
- * pack.c (pack_unpack): the resulted string of unpack('M') must have
- ASCII-8BIT encoding (and ENC_CODERANGE_VALID). [ruby-core:34482]
-
-Fri Jan 14 13:38:58 2011 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/zlib/zlib.c (gzfile_check_footer): ISIZE (Input SIZE) in
- gzip's header is the size of uncompressed input data modulo 2^32.
- [ruby-core:34481] http://www.ietf.org/rfc/rfc1952.txt
-
-Fri Jan 14 11:36:25 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * configure.in, win32/Makefile.sub (RUNRUBY): require path should
- include "." because rbconfig.rb is there.
-
-Fri Jan 14 10:40:11 2011 Ryan Davis <ryan@lust.local>
-
- * gem_prelude.rb: Just require rubygems. Fixes rubygems 1.4.
- * lib/rubygems.rb: removed all Gem::Quickloader code.
- * ruby.c: renamed ruby_init_gems to ruby_init_prelude. Set
- $disable_rubygems since there is no fine grained mechanism to
- skip parts of the prelude. Open to suggestions on how to do this
- better.
- * test/*.rb: Load path isn't set up correctly, so add
- --disable-gems as needed to failing tests that are explicitly
- testing stderr w/ ==.
-
-Fri Jan 14 07:30:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (argf_next_argv): go advance when the next file cannot be
- read. [ruby-core:34446]
-
-Thu Jan 13 20:49:19 2011 Tanaka Akira <akr@fsij.org>
-
- * vm_insnhelper.c: parenthesize macro arguments.
-
-Thu Jan 13 13:21:00 2011 Kenta Murata <mrkn@mrkn.jp>
-
- * vm_dump.c: delete dashes to make lines 80 chars, Patched by
- Shota Fukumori (sora_h). [Bug #4275] [ruby-dev:43021]
-
-Thu Jan 13 13:21:00 2011 Kenta Murata <mrkn@mrkn.jp>
-
- * vm_dump.c: fix misspelling of CrashReporter, Patched by Shota
- Fukumori (sora_h). [Bug #4275] [ruby-dev:43021]
-
-Thu Jan 13 06:27:29 2011 Ryan Davis <ryand-ruby@zenspider.com>
-
- * error.c: Exception#to_s should actually call to_s.
-
-Thu Jan 13 00:32:54 2011 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (get_nth_dirname): decrement the directory index
- because the index specifies the index of given included_directories
- which is separated by NUL and its index is begun from 1.
- Note that 0 specifies the current directory of the compilation.
- see also http://www.dwarfstd.org/doc/dwarf-2.0.0.pdf
-
-Thu Jan 13 00:06:38 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * io.c (rb_f_syscall): Add warning messages. [ruby-core:34062]
-
-Thu Jan 13 00:00:07 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * io.c (rb_f_syscall): Some syscall return unsigned or pointer value.
- Therefore we should only check the result is -1 or not. [ruby-core:34062]
-
-Wed Jan 12 23:55:48 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * io.c (rb_f_syscall): Add 64bit Linux support. Some syscall takes
- long type arguments.
-
-Wed Jan 12 19:37:10 2011 Tanaka Akira <akr@fsij.org>
-
- * vm_dump.c: parenthesize macro arguments.
-
-Wed Jan 12 19:28:23 2011 Tanaka Akira <akr@fsij.org>
-
- * vm.c (thread_free): reset ruby_current_thread if it points the
- thread to free.
- * gc.c (slot_sweep): don't call RUBY_VM_SET_FINALIZER_INTERRUPT if
- there is no current thread.
- [ruby-dev:43000]
-
-Wed Jan 12 19:09:29 2011 Tanaka Akira <akr@fsij.org>
-
- * enum.c (sort_by_i): reenter check more strictly.
- (sort_by_cmp): ditto.
- [ruby-dev:43003] reported by Usaku NAKAMURA.
-
-Wed Jan 12 16:25:12 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * lib/net/http.rb (Net::HTTP#connect): makes it timeout during
- SSL handshake too. [ruby-core:34203]
- Patch by Marc Slemko.
-
- * test/net/http/test_http.rb (TestNetHTTP_v1_2#test_timeout_during_HTTP_session):
- test for [ruby-core:34203]
-
- * test/net/http/test_https.rb (TestNetHTTPS#test_timeout_during_SSL_handshake):
- ditto.
-
-Wed Jan 12 16:24:53 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * ext/readline/extconf.rb: new checks for RL_PROMPT_START_IGNORE
- and RL_PROMPT_END_IGNORE. [ruby-core:34331]
-
- * ext/readline/readline.c: enables USE_INSERT_IGNORE_ESCAPE only if
- RL_PROMPT_{START,END}_IGNORE are available to get rid of compilation
- error with libedit.
-
-Wed Jan 12 15:53:49 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * README.EXT.ja (rb_ensure): typo.
-
-Wed Jan 12 11:33:46 2011 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c: OpenBSD uses the elf_abi.h header file instead of the
- elf.h header file. patched by Jeremy Evans [ruby-core:34384]
-
-Wed Jan 12 03:59:36 2011 NARUSE, Yui <naruse@ruby-lang.org>
-
- * test/webrick/test_cgi.rb: Removes usage of deprecated
- :RequestHandler option.
- patched by Peter Weldon [ruby-core:34010]
-
- * test/webrick/test_httpproxy.rb: ditto.
-
- * test/webrick/test_httpserver.rb: Add a test of the deprecation
- behaviour.
-
-Wed Jan 12 08:37:07 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (hash_i): return different values for inverse hash.
- [ruby-core:34334]
-
-Tue Jan 11 20:32:59 2011 Tanaka Akira <akr@fsij.org>
-
- * variable.c: parenthesize macro arguments.
-
-Tue Jan 11 13:06:38 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * array.c (rb_ary_resize): should care of embeded array when extending
- the array.
-
- * array.c (rb_ary_resize): need to set capa when changing the real
- size of the array.
- these are latent bugs.
-
-Mon Jan 10 22:46:43 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/defines.h (CASEFOLD_FILESYSTEM): HFS+ is case
- insensitive.
-
- * load.c (loaded_feature_path, rb_feature_p, load_lock): on a
- case-insensitive filesystem, loaded features search should
- ignore case. [ruby-core:34297]
-
-Mon Jan 10 21:34:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (showflags): show LD commands.
-
-Mon Jan 10 14:32:55 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/ruby/test_method.rb (TestMethod#test_define_method): method
- transplanting between class and module is impossible.
-
-Mon Jan 10 13:51:17 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/rdoc-mode.el (rdoc-mode): show trailing whitespace.
-
-Mon Jan 10 11:22:02 2011 Tanaka Akira <akr@fsij.org>
-
- * util.c: parenthesize macro arguments.
-
-Mon Jan 10 07:41:31 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * misc/README: mention rdoc-mode.el and ruby-style.el.
-
-Sun Jan 9 20:37:21 2011 Tanaka Akira <akr@fsij.org>
-
- * transcode.c: parenthesize macro arguments.
-
-Sun Jan 9 16:31:53 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * io.c (Kernel.#syscall): implemented on LP64/LLP64 environments too.
- also uses __syscall if available for *BSD on 64bit architecture.
- [ruby-core:34062]
-
-Sun Jan 9 16:31:34 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * lib/irb/locale.rb (IRB::Locale::LOCALE_NAME_RE):
- some platform has a locale without territory but with
- encoding.
- (#each_sub_locale): ditto.
-
-Sun Jan 9 14:47:50 2011 TAKAO Kouji <kouji@takao7.net>
-
- * ext/readline/readline.c: apply a patch from Nobuyoshi Nakada.
- fixed #3616 [ruby-core:31484] IRB + readline incorrectly counts
- non-printing characters in prompt
-
-Sat Jan 8 21:47:26 2011 Tanaka Akira <akr@fsij.org>
-
- * enum.c (enum_sort_by): use rb_ary_resize.
- (ary_cutoff): removed.
-
-Sat Jan 8 21:24:17 2011 Tanaka Akira <akr@fsij.org>
-
- * pack.c (swapf): compilation condition simplified.
- (swapd): ditto.
-
-Sat Jan 8 20:51:25 2011 Tanaka Akira <akr@fsij.org>
-
- * pack.c (swapd): remove duplicated code.
-
-Sat Jan 8 19:28:55 2011 Tanaka Akira <akr@fsij.org>
-
- * thread.c: parenthesize macro arguments.
-
-Fri Jan 7 23:07:40 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (configuration): backref needs to capture.
-
-Fri Jan 7 21:57:22 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-mode-variables), misc/ruby-style.el:
- show trailing whitespace.
-
- * misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): highlight
- regexp after open bracket. [ruby-core:34183]
-
-Fri Jan 7 00:37:35 2011 Tanaka Akira <akr@fsij.org>
-
- * string.c: parenthesize macro arguments.
-
-Thu Jan 6 22:42:02 2011 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * bignum.c (bigmul1_karatsuba): avoid overflow that make assertion
- fail in certain case. this patch is contributed from Ray Chason
- <chasonr at gmail.com> in personal communication.
-
-Thu Jan 6 20:55:49 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/mkmf.rb (create_makefile): ignore rest from first dot from
- TARGET to generate init function name.
- this is followup of r30464.
-
-Thu Jan 6 11:27:01 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/json/tree_builder.rb (start_mapping): tags
- should not be included in JSON mapping
-
-Thu Jan 6 09:23:33 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * lib/net/protocol.rb (eof?): BufferedIO should proxy eof? to the
- underlying IO object.
-
-Thu Jan 6 09:12:31 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * lib/mkmf.rb (configuration): fixing gsub when multiple error flags
- are passed to GCC.
-
-Thu Jan 6 05:25:49 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (rb_ary_modify): export.
-
-Thu Jan 6 05:14:41 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (get_strio, strio_set_string)
- (strio_reopen): check if frozen. [ruby-core:33648]
-
-Thu Jan 6 05:10:58 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (rb_ary_resize): new utility function. [ruby-dev:42912]
-
-Thu Jan 6 05:03:26 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dln.c (init_funcname_len): ignore rest from first dot.
- [ruby-dev:41774]
-
-Thu Jan 6 02:55:48 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/yaml_tree.rb: use YAML 1.0 output
- format for serializing nil values. Thanks Eric Hodel!
-
- * test/psych/test_nil.rb: test for nil values
-
-Wed Jan 5 14:21:34 2011 Mark Dodwell <hi@mkdynamic.co.uk>
-
- * string.c: fix rdoc typo.
- https://github.com/shyouhei/ruby/pull/3
-
-Wed Jan 5 14:06:01 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/rdoc/test_rdoc_options.rb (TestRDocOptions#test_check_files):
- skip on Windows because chmod 0 doesn't mean unreadable by owner.
-
-Wed Jan 5 13:56:54 2011 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/net/http.rb (Net::HTTP#get): A header hash given should not
- be modified.
-
-Wed Jan 5 12:10:08 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/dl/{cfunc.c,dl.h,handle.c}, ext/fiddle/fiddle.{h,c}: Use _WIN32
- rather than checking for windows.h. Thanks Jon Forums!
- [ruby-core:33977]
-
-Sat Jan 1 17:02:50 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * lib/irb/locale.rb (IRB::Locale#search_file): make it possible
- to load a localization from a gem.
- (IRB::Locale#lc_path): obsoleted because of the change of #search_file
- (IRB::Locale#each_localized_path): new private method, based on lc_path
- (IRB::Locale#find): follows the change of #search_file.
- (IRB::Locale#load): removed duplicate with #find.
-
-Sat Jan 1 11:44:42 2011 Tanaka Akira <akr@fsij.org>
-
- * strftime.c: parenthesize macro arguments.
-
-Sat Jan 1 11:10:29 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/zlib/zlib.c: take care of platforms where long is bigger
- than int.
-
-Sat Jan 1 11:03:58 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * NEWS (optparse): shell completion support.
-
- * misc/README (rb_optparse.{bash,zsh}): for shell completion.
-
- * include/ruby/intern.h (VALUE rb_ary_print_on): I have never seen
- this function anywhere.
-
-Sat Jan 1 04:20:11 2011 NARUSE, Yui <naruse@ruby-lang.org>
-
- * win32/win32.c (rb_w32_write_console): don't raise exception when
- the conversion is for writing to console.
- Patched by Heesob Park [ruby-core:33999]
-
-Fri Dec 31 12:02:06 2010 Tanaka Akira <akr@fsij.org>
-
- * enum.c (enum_sort_by): use less temporary objects.
-
-Fri Dec 31 11:46:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (warnflags), lib/mkmf.rb (configuration): turn
- warnings into errors only for bundled extensions.
- [ruby-core:33815]
-
-Fri Dec 31 11:15:57 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/zlib/zlib.c (sizeof): zlib.h mistakenly assumes the result
- of sizeof to be int, not size_t.
-
-Fri Dec 31 10:27:34 2010 Tanaka Akira <akr@fsij.org>
-
- * st.c: parenthesize macro arguments.
-
-Fri Dec 31 03:23:26 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vsnprintf.c (BSD__uqtoa): Fix overflow when long != quad_t.
- patched by Peter Weldon <peter.weldon AT null.net>
- [ruby-core:33985]
-
-Fri Dec 31 03:00:34 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * Makefile.in: remove unnecessary semicolons.
-
-Thu Dec 30 23:09:47 2010 wanabe <s.wanabe@gmail.com>
-
- * vm.c (vm_define_method): guard iseq from GC while method definition.
- [ruby-dev:42832]
-
-Thu Dec 30 20:18:32 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * win32/Makefile.sub: ditto.
-
-Thu Dec 30 20:57:09 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * Makefile.in: Check V=1 argument if run "make clean" or similar.
-
-Thu Dec 30 20:41:50 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * Makefile.in: Kill ugly line continuation.
-
-Thu Dec 30 11:49:40 2010 Tanaka Akira <akr@fsij.org>
-
- * sprintf.c: parenthesize macro arguments.
-
-Wed Dec 29 21:20:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (maygvl_copy_stream_wait_readwrite): define if USE_SENDFILE
-
-Wed Dec 29 20:37:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: strip current directory prefix.
-
- * enc/depend (clean): remove name2ctype.h when out-of-place build.
-
- * win32/Makefile.sub (clean-enc): pass V to inferior make.
-
-Wed Dec 29 18:23:46 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * re.c (rb_reg_expr_str): need to escape if the coderange is invalid.
-
-Wed Dec 29 10:06:51 2010 Tanaka Akira <akr@fsij.org>
-
- * signal.c: parenthesize macro arguments.
-
-Wed Dec 29 07:22:15 2010 Eric Hodel <drbrain@segment7.net>
-
- * lib/rake/rdoctask.rb: Deprecate in favor of rdoc/task.
-
-Wed Dec 29 07:07:06 2010 Eric Hodel <drbrain@segment7.net>
-
- * lib/rdoc: Import RDoc 3.1
-
-Tue Dec 28 18:36:38 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * error.c, include/ruby/intern.h (rb_compile_error_with_enc): new
- function to raise syntax error, with source encoding'ed message.
-
- * parse.y (compile_error): use above function.
- [ruby-core:33951] (#4217)
-
-Tue Dec 28 07:37:38 2010 Tanaka Akira <akr@fsij.org>
-
- * ruby.c: parenthesize macro arguments.
-
-Tue Dec 28 07:17:11 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * NEWS: add ARGF.write and so on.
-
-Tue Dec 28 07:12:38 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * NEWS: add new magic-comment. (warn-indent) [ruby-core:25442]
-
-Tue Dec 28 04:32:37 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/fiddle/extconf.rb: check for windows.h while building fiddle.
- Thanks Jon Forums! [ruby-core:33923]
-
-Tue Dec 28 01:45:12 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * NEWS: Add Zlib.deflate and Zlib.inflate.
- [ruby-dev:42833]
-
-Mon Dec 27 21:22:33 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * win32/configure.bat: Remove obsoleted coding rule. Now, we
- don't support to build on Windows 95/98 and Me.
-
-Mon Dec 27 18:27:13 2010 Tanaka Akira <akr@fsij.org>
-
- * re.c: parenthesize macro arguments.
-
-Mon Dec 27 15:22:23 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/README.win32: note to need NT based OS to build ruby.
-
-Mon Dec 27 12:14:46 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * common.mk (EXTMK_ARGS): specify to pass macro V, because nmake
- doesn't pass it via MAKEFLAGS.
-
-Mon Dec 27 10:33:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/zlib/zlib.c (Init_zlib): Add Zlib.deflate and Zlib.inflate.
- [ruby-dev:42833]
-
-Mon Dec 27 07:38:07 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * misc/rb_optparse.zsh: add compdef for generator.
-
-Mon Dec 27 07:32:07 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * lib/optparse.rb (OptionParser#compsys): escape brackets too.
- [ruby-dev:42754]
-
-Mon Dec 27 01:30:08 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/mkconstants.rb: add IF_NAMESIZE.
- add a default for INET6_ADDRSTRLEN.
-
-Sun Dec 26 23:49:47 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * win32/Makefile.sub: suppress a strange error message when RMALL
- found no such file.
- * win32/rmall.bat: new.
-
-Sun Dec 26 21:23:23 2010 <kosaki.motohiro@gmail.com>
-
- * win32/Makefile.sub: fix 'nmake clean-enc' breakage since r28322.
-
-Sun Dec 26 22:25:07 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/ripper/depend (ripper.y): fix messages with nmake.
- [ruby-dev:42896]
-
-Sun Dec 26 22:24:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (file_expand_path): get rid of warnings caused by
- -Wdeclaration-after-statement on cygwin.
-
-Sun Dec 26 20:28:34 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * process.c (before_exec): add small comment.
-
-Sun Dec 26 20:52:21 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/mkconstants.rb: define INET_ADDRSTRLEN as 16 if not
- available. fix compilation error on mswin32-60. reported by nobu.
-
-Sun Dec 26 19:37:37 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/option.c: define IFNAMSIZ if not available.
- fix compilation error on mingw32. reported by nobu.
-
-Sun Dec 26 12:16:29 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rdoc/ri/paths.rb (RDoc::RI::Paths::HOMEDIR): no exception if
- HOME is not set. [ruby-core:33867]
-
-Sun Dec 26 11:39:11 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (stmt): missing ripper rule. i.e., `a::B ||= c 1'.
- http://twitter.com/#!/wannabe53/status/18797576396472321
- http://twitter.com/#!/wannabe53/status/18798416150663168
-
-Sun Dec 26 11:15:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/with_different_ofs.rb (DifferentOFS): should not affect
- original classes.
-
-Sun Dec 26 09:35:07 2010 Tanaka Akira <akr@fsij.org>
-
- * rational.c: parenthesize macro arguments.
-
-Sun Dec 26 09:22:19 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/option.c (rb_if_indextoname): new function to abstract
- environments without if_indextoname.
- (inspect_ipv6_multicast_if): new function to inspect
- IPV6_MULTICAST_IF.
- Socket::Option.new(:INET6, :IPV6, :MULTICAST_IF,
- [2].pack("I!")).inspect is
- "#<Socket::Option: INET6 IPV6 MULTICAST_IF eth0>".
-
-Sun Dec 26 04:31:15 2010 Luis Lavena <luislavena@gmail.com>
-
- * ext/dl/win32/registry.rb: Corrected RegCreateKeyExA signature.
- Patch by Rafal Michalski [ruby-core:33874] [Ruby 1.9-Bug#4203]
-
-Sun Dec 26 02:31:58 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * io.c (advice_arg_check): Change argument check.
- Now, an unsupported advice makes NotImplementedError.
- [ruby-dev:42887] [Ruby 1.9-Feature#4204]
-
-Sun Dec 26 03:00:53 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * ext/socket/extconf.rb: Fix build error which was introduced r30372.
-
-Sun Dec 26 01:37:10 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/socket/extconf.rb: check the existence of if_indextoname().
-
- * ext/socket/option.c: yesterday's akr's commits destroyed the build of
- some unrelated platforms (such as Windows).
-
-Sat Dec 25 23:29:11 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/option.c (inspect_ipv4_add_drop_membership): new function
- to inspect struct ip_mreq and struct ip_mreqn for
- IP_ADD_MEMBERSHIP and IP_DROP_MEMBERSHIP.
- Socket::Option.new(:INET, :IP, :ADD_MEMBERSHIP,
- [239,255,99,81, 0,0,0,0].pack("CCCCCCCC")).inspect is now
- "#<Socket::Option: INET IP ADD_MEMBERSHIP 239.255.99.81 0.0.0.0>".
- (inspect_ipv4_multicast_if): new function to inspect struct in_addr
- and struct ip_mreqn for IP_MULTICAST_IF.
- Socket::Option.new(:INET, :IP, :MULTICAST_IF,
- [192,168,0,7].pack("CCCC")).inspect is now
- "#<Socket::Option: INET IP MULTICAST_IF 192.168.0.7>".
-
- * ext/socket/extconf.rb: check struct ip_mreq and struct ip_mreqn.
-
-Sat Dec 25 22:49:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/csv: DifferentOFS needs to be include in each classes.
-
- * test/digest/test_digest_extend.rb (TestDigestExtend#setup):
- should not depend on the result of previous tests
-
- * test/with_different_ofs.rb (DifferentOFS::WithDifferentOFS): give
- name.
-
- * test/with_different_ofs.rb (DifferentOFS): test suite for test
- suites affected by $,.
-
- * test/digest/test_digest_extend.rb (TestDigestExtend): should not
- assume $, invariant.
-
- * test/csv/test_data_converters.rb, test/csv/test_table.rb: don't
- call setup within tests.
-
-Sat Dec 25 20:01:40 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * io.c (pipe_open): Added rb_thread_atfork(). We must reinitialize
- GVL at new process creation.
-
-Sat Dec 25 18:26:55 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/option.c (inspect_ipv6_mreq): new function to inspect
- struct ipv6_mreq for IPV6_JOIN_GROUP and IPV6_LEAVE_GROUP.
- Socket::Option.new(:INET6, :IPV6, :JOIN_GROUP,
- [0xff12,0,0,0,0,0,0,1, 2].pack("nnnnnnnnI!")).inspect is now
- "#<Socket::Option: INET6 IPV6 JOIN_GROUP ff12::1 eth0>".
-
- * ext/socket/extconf.rb: check struct ipv6_mreq.
-
-Sat Dec 25 18:04:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/csv.rb (CSV.foreach): 'rb' mode is defaulted in open.
-
- * lib/csv.rb (CSV#init_separators): cannonicalize encoding options
- as Encoding objects.
-
-Sat Dec 25 18:30:34 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * thread.c (rb_thread_atfork): Add small comment why we need
- reset random seed.
-
-Sat Dec 25 17:33:55 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/csv/base.rb (TestCSV.with_different_ofs): give name to
- anonymous classes.
-
- * lib/csv.rb (CSV#init_separators): use IO#gets with length
- parameter to get rid of wrong convertion.
-
- * lib/csv.rb (CSV::foreach, CSV#initialize): directly use encoding
-
- * lib/csv.rb, test/csv: should not assume $, invariant.
-
-Sat Dec 25 16:08:06 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * signal.c: change rb_atomic_t definition from uchar to uint.
-
-Sat Dec 25 15:04:05 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/csv/test_encodings.rb (TestEncodings#setup): fix evil test
- suite writing to the source directory.
-
-Sat Dec 25 15:08:08 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * ext/pty/pty.c (chfunc): Added rb_thread_atfork_before_exec().
- We must reinitialize GVL at new process creation. Otherwise
- we may meet an insane deadlock. [Bug#4121][ruby-dev:42686]
-
-Sat Dec 25 14:27:09 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_extract_encoding_option): accept Encoding object as
- encoding: optional argument. [ruby-dev:42884]
-
-Sat Dec 25 13:37:55 2010 Ryan Davis <ryand-ruby@zenspider.com>
-
- * lib/minitest/*.rb: Imported minitest 2.0.2 r6093.
-
-Sat Dec 25 13:05:59 2010 Tanaka Akira <akr@fsij.org>
-
- * random.c: parenthesize macro arguments.
-
-Sat Dec 25 12:48:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * load.c (rb_f_require_relative): don't omit return type.
-
-Sat Dec 25 11:06:00 2010 Eric Hodel <drbrain@segment7.net>
-
- * load.c (rb_f_require_relative): Add documentation.
-
-Sat Dec 25 11:02:52 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/zlib/zlib.c (gzreader_gets): support optional length
- parameter.
-
- * ext/zlib/zlib.c (gzfile_read, gzfile_readpartial): length should
- be long.
-
-Sat Dec 25 10:51:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/json/generator/generator.{c,h} (fbuffer_free_only_buffer):
- unused.
-
- * ext/openssl/ossl_pkcs5.c (ossl_pkcs5_pbkdf2_hmac): add casts.
-
-Fri Dec 24 08:46:04 2010 Tanaka Akira <akr@fsij.org>
-
- * process.c: parenthesize macro arguments.
-
-Thu Dec 23 19:17:14 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * test/net/imap/cacert.pem: updated because it has been expired.
-
- * test/net/imap/server.crt: signed again because CA cert was expired.
-
-Thu Dec 23 11:16:52 2010 Tanaka Akira <akr@fsij.org>
-
- * parse.y: parenthesize macro arguments.
-
-Thu Dec 23 11:00:09 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (rb_check_type): check for type from extensions for ruby
- 1.8. see [ruby-core:33797].
-
-Thu Dec 23 08:12:59 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * lib/net/smtp.rb: refactoring Net::SMTP#esmtp= to use an
- attr_accessor
-
-Thu Dec 23 06:35:41 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * lib/net/smtp.rb: Net::SMTP should close the SSL connection if the
- connection verification fails.
-
-Thu Dec 23 01:47:58 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * NEWS: remove #object_id. [ruby-dev:42840]
-
-Wed Dec 22 08:56:39 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * NEWS: add Module#private_constant and Module#public_constant.
- [ruby-dev:39685][ruby-core:32698]
-
-Wed Dec 22 07:59:23 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * NEWS: add IO#advise. [ruby-core:33110] [Ruby 1.9-Feature#4038]
-
-Tue Dec 21 23:45:31 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (Init_GC): move back object_id to Kernel. [ruby-dev:42840]
-
-Tue Dec 21 12:45:16 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (target_archs): remove temporary objects.
-
- * enc/Makefile.in, enc/depend (clean): remove work directories.
-
-Tue Dec 21 07:39:12 2010 Tanaka Akira <akr@fsij.org>
-
- * pack.c: parenthesize macro arguments.
-
-Tue Dec 21 06:25:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/rexml/test_contrib.rb (ContribTester#test_pos): should not
- use fixed path name for tests. [ruby-dev:42827]
-
- * test/rexml/test_sax.rb (SAX2Tester#test_socket): should not use
- fixed port for tests. [ruby-dev:42828]
-
-Tue Dec 21 06:10:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (setup_args), vm.c (invoke_block_from_c),
- vm_insnhelper.c (caller_setup_args): reverted r30241 and r30243
- except for the test.
-
-Tue Dec 21 01:41:42 2010 Masaya Tarui <tarui@ruby-lnag.org>
-
- * io.c : add an extra byte to buffer for the specification of read
- in Windows. see [ruby-core:33460] and r29980. and, we have to
- discuss how to do this one byte.
-
-Tue Dec 21 01:18:06 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * error.c: Fix build error for win32. This regression was
- introduced by r30271.
-
-Tue Dec 21 00:59:40 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * thread.c (thread_cleanup_func): Moved interrupted_lock
- destroying code from native_thread_destroy() to
- thread_cleanup_func() because it's platform independent logic.
-
- * thread_win32.c (native_thread_destroy): ditto.
- * thread_pthread.c (native_thread_destroy): ditto.
-
-Tue Dec 21 00:46:20 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * thread.c (thread_cleanup_func): Don't touch native threading
- resource at fork. Sadly this is purely bandaid. We need to
- implement proper fix later. [Bug #4169] [ruby-core:33767]
-
-Tue Dec 21 00:22:44 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * error.c (exit_success_p): Check status code more carefully.
- status code may have garbage in upper bit.
-
-Mon Dec 20 23:12:37 2010 Tanaka Akira <akr@fsij.org>
-
- * node.c: parenthesize macro arguments.
-
-Mon Dec 20 20:04:41 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * NEWS: add #__id__ and #object_id. [ruby-dev:42778]
-
-Mon Dec 20 20:03:21 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * thread_pthread.c (native_thread_destroy): Fixed gvl_cond leak.
-
-Mon Dec 20 13:49:05 2010 Eric Hodel <drbrain@segment7.net>
-
- * NEWS: Add item for RDoc 3.0.1
-
- * lib/rdoc: Import RDoc 3.0.1, remove require for perl parser.
-
-Mon Dec 20 12:15:32 2010 Eric Hodel <drbrain@segment7.net>
-
- * lib/rdoc: Import RDoc 3.0.
-
-Mon Dec 20 01:55:03 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * io.c (Init_IO): Added O_DIRECT. This feature was proposed by Run Paint Run Run.
- [Feature #4015] [ruby-core:33018]
-
-Sun Dec 19 19:15:23 2010 Tanaka Akira <akr@fsij.org>
-
- * marshal.c: parenthesize macro arguments.
-
-Sat Dec 18 21:52:37 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * vsnprintf.c (BSD_vfprintf): suppress warning: "_WIN32" is not
- defined.
-
-Sat Dec 18 16:02:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (setup_args), vm.c (invoke_block_from_c),
- vm_insnhelper.c (caller_setup_args): fix of r30241. lambda block
- should check argument number.
-
-Sat Dec 18 14:42:29 2010 Tanaka Akira <akr@fsij.org>
-
- * load.c: parenthesize macro arguments.
-
-Sat Dec 18 10:07:04 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (setup_args, iseq_compile_each): optimize AMPER LAMBDA
- combination as block.
-
-Fri Dec 17 22:07:16 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (Init_GC): move #__id__ and #object_id to BasicObject.
- [ruby-dev:42778]
-
-Fri Dec 17 19:35:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/mkmf/base.rb (TestMkmf::FakeLog): capture output from mkmf.
-
- * test/mkmf/test_find_executable.rb (test_find_executable):
- suppress meaningless differences for chkbuild.
-
-Fri Dec 17 13:26:54 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/setup.mak (BASERUBY): quit with an error when BASERUBY was not
- able to set, just like configure.in does. [ruby-dev:42782]
-
-Fri Dec 17 07:04:09 2010 Tanaka Akira <akr@fsij.org>
-
- * iseq.c: parenthesize macro arguments.
-
-Fri Dec 17 04:18:37 2010 Eric Hodel <drbrain@segment7.net>
-
- * transcode.c (str_encode): Alter comment for better wording and ri
- output.
-
-Fri Dec 17 00:05:40 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * io.c (rb_io_advise): New API. IO#advise() allows to tell the
- ruby runtime how it expects to use a file handle. This feature
- can be improved a performance some situations.
- Note: This feature is mainly developed by Run Paint Run Run.
- Thank you! [ruby-core:33110] [Ruby 1.9-Feature#4038]
-
- * io.c (do_io_advise): Helper function.
- * io.c (io_advise_sym_to_const): ditto.
-
-Thu Dec 16 23:29:20 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/rbinstall.rb (bin-comm): use transformed name.
- [ruby-dev:42777]
-
-Thu Dec 16 21:52:07 2010 Tanaka Akira <akr@fsij.org>
-
- * io.c: parenthesize macro arguments.
-
-Thu Dec 16 21:46:39 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/mkconfig.rb (RbConfig): honor ARCHFLAGS and RC_ARCHS to
- override embedded ARCH_FLAG value on universal-darwin.
-
-Thu Dec 16 19:50:12 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/{configure.bat,setup.mak,Makefile.sub} (PROGRAM_PREFIX,
- PROGRAM_SUFFIX): unite the differences of the names of macros of
- prefix and suffix.
- reported by HANEDA Norikatsu. [ruby-dev:42775]
-
-Thu Dec 16 08:04:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * node.h (RNode): match the type of flags to RBasic, and renamed
- nd_file as nd_reserved.
-
- * iseq.c (set_relation), vm_insnhelper.c (vm_cref_push): nd_file
- is always zero-cleared.
-
-Thu Dec 16 07:22:30 2010 Ryan Davis <ryand-ruby@zenspider.com>
-
- * lib/minitest/unit.rb: Imported minitest 2.0.1 r6079.
-
-Wed Dec 15 20:45:02 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/test/unit.rb (process_args): need to setup @help to print options.
-
-Wed Dec 15 11:19:33 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/zlib/test_zlib.rb (test_to_io): forgotten to fix with r30201.
-
-Wed Dec 15 11:07:34 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (simple_sendfile): enable on Mac OS X.
-
- * io.c (nogvl_copy_stream_sendfile): moved precheck of copy length.
-
- * io.c (nogvl_copy_stream_sendfile): should wait for both of
- read/write fds.
-
-Wed Dec 15 07:11:55 2010 Tanaka Akira <akr@fsij.org>
-
- * hash.c: parenthesize macro arguments.
-
-Wed Dec 15 04:02:00 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_config):
- fix compile error when !HAVE_X509V3_SET_NCONF. Thanks
- Chikanaga-san. [ruby-dev:42761] [Ruby 1.9-Bug#4158]
-
-Wed Dec 15 03:41:31 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * test/ripper/test_parser_events.rb (TestRipper#test_block_variables):
- Limit address space 100MB instead 100KB. Quite frankly, This
- margin is too narrow to contain ruby. [ruby-dev:42763] [Bug#4159]
-
-Tue Dec 14 23:53:52 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * io.c (simple_sendfile): improve linux compatibility on FreeBSD,
- and now it works. But without cpuset -l 0, it still gets stuck.
-
-Tue Dec 14 20:31:33 2010 Tanaka Akira <akr@fsij.org>
-
- * gc.c: parenthesize macro arguments.
-
-Tue Dec 14 18:31:48 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/test/unit.rb: help messages.
-
-Tue Dec 14 18:19:03 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * common.mk (help): there is no reason to use the abbreviation for here.
-
-Tue Dec 14 15:03:46 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_io.rb (test_reopen, test_reinitialize): should close
- the temporary files.
-
-Tue Dec 14 14:24:15 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_io.rb (make_tempfile): change the prefix from 'foo'
- to 'test_io' because the old one is meaningless and inconvenient.
-
- * test/ruby/test_io.rb (test_binmode_after_closed): the temporary file
- maked by make_temfile is already closed.
-
-Tue Dec 14 13:52:19 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_io.rb (test_flush_in_finalizer[12]): should close
- temporary file because it's only used for taking pathname and
- unlinking the file after the end of the test (in GC phase).
-
-Tue Dec 14 13:34:33 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/zlib/zlib.c (gzfile_s_open): should close the IO if some error
- occurs in initializing.
-
-Tue Dec 14 13:04:16 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http.rb (Net::HTTPRequest#send_request_body_data):
- set binmode to tempfile.
-
-Tue Dec 14 12:55:46 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/zlib/test_zlib.rb (*): should close files associated with zlib.
-
-Tue Dec 14 11:30:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_argf.rb (test_inplace_rename_impossible): unlink
- the renamed temporary file on no_safe_rename platforms.
-
- * test/ruby/test_argf.rb (test_readlines_limit_0,
- test_each_line_limit_0): should close argf because the associated
- Tempfile object cannot unlink the temporary file when it's gc'ed
- on some platforms (Windows, etc.)
-
-Tue Dec 14 11:27:07 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/minitest/unit.rb (Minitest::Unit#_run_suite): split test
- name and its time. Thiw allows to know test's name when you are
- running tests and meet a test which spends long time at realtime.
-
-Tue Dec 14 11:25:20 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: Add -Werror=declaration-after-statement to default
- warning flag. If you are using GCC, this flag is useful to
- prevent breaking VC build.
-
-Tue Dec 14 10:25:57 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/openssl/ossl_asn1.c (ossl_asn1_decode0): how many gcc-c99isms
- must a man mend; before he can build with VC? r30178
-
-Mon Dec 13 21:26:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * io.c (simple_sendfile): disable the use of sendfile(2) on
- FreeBSD. It blocks on TestIO#test_copy_stream_socket.
-
-Mon Dec 13 18:35:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * io.c: define USE_SENDFILE on FreeBSD or DragonFly BSD.
- Remove Mac OS X because its argument is different from them.
-
-Mon Dec 13 12:00:09 2010 Tanaka Akira <akr@fsij.org>
-
- * file.c: parenthesize macro arguments.
-
-Mon Dec 13 11:21:14 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * io.c (simple_sendfile): added for BSD version of sendfile(2).
-
-Mon Dec 13 09:50:09 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http.rb (Net::HTTPRequest#set_form): Added to support
- both application/x-www-form-urlencoded and multipart/form-data.
- There is a similar API, Net::HTTPRequest#set_form_data, but
- to keep its compatibility this is newly added. [ruby-dev:42729]
-
-Sun Dec 12 23:45:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (iseq_compile_each): fix for __goto__ and __label__
- where were totally broken.
-
-Sun Dec 12 22:45:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (ID_H_INCLUDES): now id.h depends on vm_opts.h.
-
-Sun Dec 12 20:42:47 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * template/id.h.tmpl: suppress all warning: "SUPPORT_JOKE" is not
- defined. [ruby-dev:42730]
-
-Sun Dec 12 20:35:07 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * misc/rb_optparse.zsh: update how to install.
-
- * misc/rb_optparse.zsh: avoid error when setopt noclobber.
-
- * lib/optparse.rb: fix typo. pointed out at
- <http://d.hatena.ne.jp/nagachika/20101207>.
-
-Sun Dec 12 13:27:35 2010 Tanaka Akira <akr@fsij.org>
-
- * eval_error.c: parenthesize macro arguments.
-
-Sun Dec 12 11:53:24 2010 Tanaka Akira <akr@fsij.org>
-
- * error.c: parenthesize macro arguments.
-
-Sun Dec 12 04:01:58 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (rb_str_inspect): fix: extra back slash is added when
- the string is dummy encoding and includes \x22 or \x5C.
-
-Sun Dec 12 02:42:24 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/openssl/ossl_asn1.c: indefinite length BER to DER encoding is
- properly supported. Thanks Martin Bosslet! [ruby-core:33082]
-
-Sat Dec 11 17:43:34 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * ext/bigdecimal/bigdecimal.h: suppress "warning: 'VPrint' declared
- 'static' but never defined".
-
-Sat Dec 11 09:24:57 2010 Tanaka Akira <akr@fsij.org>
-
- * encoding.c: parenthesize macro arguments.
-
-Sat Dec 11 08:12:48 2010 Eric Hodel <drbrain@segment7.net>
-
- * ext/openssl/ossl.c, ext/openssl/ossl_pkey_rsa.c: Document RSA, RSA
- encryption/decryption and PKCS #5 encryption/decryption.
-
-Sat Dec 11 06:23:41 2010 Eric Hodel <drbrain@segment7.net>
-
- * ext/openssl/ossl_x509name.c: include Comparable to provide #==.
- Document OpenSSL::X509::Name#<=>. [Ruby 1.9-Feature#4116]
-
-Sat Dec 11 05:48:28 2010 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: infinite loop on method_missing at loading.
- [ruby-dev:42716] [Ruby 1.9-Bug#4129]
-
- * ext/tk/lib/multi-tk.rb: when no eventloop is running, ruby freezes at exit.
-
-Sat Dec 11 02:23:15 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/openssl/extconf.rb: try pkgconfig first, then fall back to
- normal have_library, etc. Thanks Erik Hollensbe. [ruby-core:32406]
-
-Fri Dec 10 22:33:39 2010 Tanaka Akira <akr@fsij.org>
-
- * dln_find.c: parenthesize macro arguments.
-
-Fri Dec 10 20:05:42 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * template/id.h.tmpl (ruby_method_ids): suppress warnings.
- [ruby-dev:42730]
-
-Fri Dec 10 18:29:20 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (ruby_init_loadpath_safe): relatively called non-shared
- binary cannot be found in PATH, so use given pathname.
-
-Fri Dec 10 18:28:40 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * cygwin/GNUmakefile.in (SCRIPTPROGRAMS): ignore backup files and etc.
-
- * cygwin/GNUmakefile.in (scriptbin): set executable bit.
-
- * tool/rbinstall.rb (install_recursive): always skip default ignored
- files. if block is given, call it instead of calling install.
-
- * tool/rbinstall.rb (bin-comm): use install_recursive.
-
-Fri Dec 10 18:12:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/mkmf/base.rb (TestMkmf#config_value): extract macro value from
- config.h.
-
- * test/mkmf/test_sizeof.rb (TestMkmf::TestSizeof#test_sizeof_builtin),
- (TestMkmf::TestSizeof#test_sizeof_struct): more tests.
-
- * lib/mkmf.rb (check_signedness): should use the prelude code.
- [ruby-dev:42731]
-
- * lib/mkmf.rb (Logging.log_close): separate from Logging.logfile.
-
- * test/mkmf/base.rb (TestMkmf::MKMFLOG): show mkmf.log at failures.
-
- * test/mkmf/base.rb (TestMkmf#teardown): close log file for each tests.
-
-Fri Dec 10 11:36:43 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * compile.c (enum): remove a comma at end of enumerator list.
-
- * constant.h (rb_const_flag_t): ditto.
-
- * iseq.h (enum catch_type): ditto.
-
- * iseq.h (enum defined_type): ditto.
-
- * vm_core.h (enum iseq_type): ditto.
-
- * vm_core.h (enum vm_special_object_type): ditto.
-
-Fri Dec 10 10:47:53 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * sprintf.c (_HAVE_SANE_QUAD_): Don't forget LP64, r30156.
-
-Fri Dec 10 10:37:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * sprintf.c (_HAVE_SANE_QUAD_): if a certain platform has LONG_LONG in
- 8 byte, it might be sane quad. [ruby-core:33634]
-
-Fri Dec 10 10:07:59 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http.rb: remove version 1.1 features.
-
-Fri Dec 10 02:18:02 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/openssl/ossl_x509store.c (ossl_x509stctx_cleanup): removing C
- implementation of `cleanup`.
-
- * ext/openssl/lib/openssl/x509.rb: adding ruby implementation of
- `cleanup`. OpenSSL::X509::StoreContext#cleanup is deprecated since
- reusing the underlying struct doesn't make sense. [ruby-dev:42546]
-
-Thu Dec 9 20:14:39 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (lvar_defined_gen, shadowing_lvar_gen, dvar_defined): no
- warnings for unused method and block arguments.
- [ruby-dev:42718] [ruby-dev:42724]
-
-Thu Dec 9 19:25:49 2010 Tanaka Akira <akr@fsij.org>
-
- * dln.c: parenthesize macro arguments.
-
-Thu Dec 9 18:51:06 2010 Tanaka Akira <akr@fsij.org>
-
- * lib/webrick/accesslog.rb (WEBrick::AccessLog#format): support
- %{remote}p for logging remote (client) port number.
- [ruby-dev:42670]
-
-Thu Dec 9 11:00:30 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_dup): should copy contents only. no instance
- variable, no class would be copied. it would affect methods
- #sort, #reject, #transpose, #uniq, #compact, and #shuffle.
- [ruby-core:33640]
-
- * array.c (rb_ary_reverse_m): ditto.
-
- * array.c (rb_ary_rotate_m): ditto.
-
-Wed Dec 8 21:38:40 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/dl/lib/dl/struct.rb: clean a warning: assigned but unused
- variable. patched by Kouhei Yanagita. [ruby-dev:42722]
-
- * ext/dl/lib/dl/import.rb: ditto.
-
-Wed Dec 8 21:36:16 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (shadowing_lvar_gen): fix line number. [ruby-dev:42718]
-
-Wed Dec 8 20:37:11 2010 Tanaka Akira <akr@fsij.org>
-
- * dir.c: parenthesize macro arguments.
-
-Tue Dec 7 22:37:15 2010 Masaya Tarui <tarui@ruby-lnag.org>
-
- * io.c (io_read): duplicate string if shared. [ruby-dev:42719]
-
-Tue Dec 7 22:31:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser::Officious): separate completion
- options from --help. [ruby-dev:42690]
-
- * lib/optparse.rb (OptionParser::Completion#candidate),
- (OptionParser::Switch#compsys): remove unused variables.
-
-Tue Dec 7 22:05:25 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * transcode.c (transcode_loop): call default handler of the given
- hash, method, proc or [] method as fallback. [ruby-dev:42692]
-
-Tue Dec 7 21:59:37 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rexml/light/node.rb: remove circular require.
-
-Tue Dec 7 21:56:01 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_light.rb: really suppress a warning.
-
-Tue Dec 7 21:51:57 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_light.rb: suppress a warning.
-
-Tue Dec 7 21:14:03 2010 Tanaka Akira <akr@fsij.org>
-
- * debug.c: parenthesize macro arguments.
-
-Tue Dec 7 21:06:38 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rexml/doctype.rb, test/rexml/test_doctype.rb: suppress warnings.
- [ruby-core:33305]
- Reported by Aaron Patterson. Thanks!!!
-
-Tue Dec 7 18:56:52 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/lib/kconv.rb (String#kconv): fix typo and update rdoc.
- patched by Kouhei Yanagita [ruby-dev:42696]
-
-Tue Dec 7 20:32:11 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_doctype.rb: add Accessor to test case name.
-
-Tue Dec 7 20:31:02 2010 Kouhei Sutou <kou@clear-code.com>
-
- * test/rexml/test_doctype.rb: Doctype -> DocType.
-
-Tue Dec 7 20:29:23 2010 Kouhei Sutou <kou@clear-code.com>
-
- * test/rexml/test_doctype_mixin.rb: rename to ...
- * test/rexml/test_doctype.rb: ... this to remove needless name.
-
-Tue Dec 7 17:03:16 2010 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (xlist): supported the XLIST command, which is an
- extension by Apple and Google. patch by Geoff Youngs.
- [ruby-core:33521]
-
-Tue Dec 7 08:00:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in, win32/Makefile.sub (WERRORFLAG): flag to treat
- warnings as errors.
-
- * lib/mkmf.rb (Logging.postpone): yield log file object.
-
- * lib/mkmf.rb (xsystem): add options, :werror only right now.
-
- * lib/mkmf.rb (with_werror): check as if warnings are errors.
-
- * lib/mkmf.rb (convertible_int): make declaration conflict
- warnings errors not to pass wrong type. [ruby-dev:42684]
-
- * lib/mkmf.rb (COMMON_MACROS): get rid of conflicts.
-
- * win32/Makefile.sub (WARNFLAGS): make declaration conflict
- warnings errors if possible.
-
-Sun Dec 7 21:16:10 2010 Tanaka Akira <akr@fsij.org>
-
- * cont.c: parenthesize macro arguments.
-
-Tue Dec 7 00:27:14 2010 Masaya Tarui <tarui@ruby-lnag.org>
-
- * win32/win32.c (rb_w32_read): fixed more for readline,
- and so on. [ruby-core:33511]
-
-Mon Dec 6 23:18:22 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/mkmf/base.rb (TestMkmf#setup): run quietly.
-
- * test/mkmf/test_find_executable.rb (test_find_executable): use
- configured results.
-
- * common.mk (test-build): test for build process.
-
-Mon Dec 6 22:47:15 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser#candidate): skip separators.
-
- * sample/optparse/opttest.rb: should not override --help.
- [ruby-dev:42690]
-
-Mon Dec 6 19:00:48 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * misc/rb_optparse.zsh: fix typos.
-
-Mon Dec 6 18:59:04 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * NEWS: add new encodings.
-
-Mon Dec 6 18:56:42 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * test/ruby/test_string.rb (TestString#test_scan): add a test for
- [ruby-core:33338] #4087.
-
-Mon Dec 6 18:55:36 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * test/uri/test_common.rb (TestCommon#test_encode_www_form): add
- tests for r30015.
-
-Mon Dec 6 10:39:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/common.rb (URI::Parser#initialize_pattern):
- refix for restrict the pattern.
-
-Mon Dec 6 09:45:11 2010 Eric Hodel <drbrain@segment7.net>
-
- * ext/openssl (OpenSSL): add toplevel documentation
- * ext/openssl/ossl_ssl.c (SSLContext, SSLSocket: add additional
- documentation
- * ext/openssl: move "let rdoc know about mOSSL" comments so they don't
- show up in output
-
-Mon Dec 6 09:16:46 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/common.rb (URI::Parser#initialize_pattern):
- workaround fix pattern of hostname for RFC 3986. [ruby-dev:42672]
-
-Mon Dec 6 09:14:38 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/mkmf.rb (check_signedness): rename unused variable prelude.
-
-Sun Dec 5 17:56:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * class.c (make_metaclass): fix probable typo. builtin type flag
- cannot be used with FL_TEST.
-
-Sun Dec 5 12:09:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/irb/init.rb (IRB.parse_opts): fix typo. [ruby-core:33574]
-
-Sun Dec 5 11:27:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (load_file_internal): decrement for ungotten line.
- [ruby-dev:42680]
-
-Sun Dec 5 10:32:11 2010 Tanaka Akira <akr@fsij.org>
-
- * complex.c: parenthesize macro arguments.
-
-Sat Dec 4 11:39:17 2010 Eric Hodel <drbrain@segment7.net>
-
- * ext/openssl/ossl_x509ext.c (initialize): add documentation.
-
-Sat Dec 4 11:21:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (rb_hash_update_by): new API for Hash#update.
-
-Sat Dec 4 11:18:10 2010 Tanaka Akira <akr@fsij.org>
-
- * class.c: parenthesize macro arguments.
-
-Sat Dec 4 11:07:57 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_core.h (rb_vm_inc_const_missing_count): missing prototype.
-
-Sat Dec 4 08:50:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/iconv.c (Init_iconv): no warnings if $VERBOSE is nil.
-
-Sat Dec 4 08:25:15 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_insnhelper.c (vm_call_method): revert r30064 and r30071,
- because of [ruby-core:26761]. Bug#4106 rejected.
-
-Sat Dec 4 07:46:48 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (String#tr_cpp): substitute * with P like as
- autoconf.
-
-Fri Dec 3 22:36:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_insnhelper.c (vm_call_method): protected methods should be
- checked against the real class.
-
-Fri Dec 3 20:23:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (convertible_int): define printf format prefix too.
-
- * lib/mkmf.rb (convertible_int): detect convertible integer type.
- port RUBY_REPLACE_INT from configure.in.
-
- * lib/mkmf.rb (check_sizeof): should return integer always.
-
-Fri Dec 3 12:54:48 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub (RCFLAGS): VC10 and after only. fixed the problem
- of r30015. [ruby-core:33530]
-
-Fri Dec 3 12:41:52 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * gc.c (rb_objspace_free): With our "lazy-sweep" GC engine, it is
- possible for an object to survive until its surrounding object
- space is about to be freed. Those objects, if any, remains
- leaked for the rest of a process life. This is problematic
- because for instance a T_DATA object may have its own destructor
- to terminate something.
-
- * vm.c (ruby_vm_destruct): ruby_current_vm termination should be
- somewhere after rb_objspace_free for above reason.
-
-Fri Dec 3 12:17:19 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_insnhelper.c (vm_call_method): protected singleton methods should
- be visible from same real class methods. [ruby-core:33506]
-
-Fri Dec 3 07:08:42 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_getline): round upto next char
- boundary. [ruby-dev:42674]
-
-Fri Dec 3 06:52:46 2010 Tanaka Akira <akr@fsij.org>
-
- * compile.c: parenthesize macro arguments.
-
-Fri Dec 3 04:08:59 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * encoding.c (enc_alias_internal): use st_insert2 and change return
- value to int.
-
- * encoding.c (enc_alias): follow enc_alias_internal.
-
-Fri Dec 3 01:52:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * encoding.c (enc_alias_internal): use xfree instead of free.
-
-Thu Dec 2 23:52:26 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * NEWS: entry for ruby_vm_at_exit().
-
- * eval.c (ruby_cleanup): bug fix around at_exit (1) timing was
- wrong. (2) execution order was opposite.
-
-Thu Dec 2 23:05:14 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub (RCFLAGS): -nologo switch is only available in
- newer versions of rc.exe. fixed the problem of r30012.
-
-Thu Dec 2 21:28:07 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/json/lib/json/add/rails.rb: removed.
-
-Thu Dec 2 21:22:05 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * encoding.c (enc_alias_internal): free the copied key and
- return NULL when given key is already registered.
-
- * encoding.c (enc_alias): call set_encoding_const only when the
- alias is not registered yet.
-
-Thu Dec 2 19:58:24 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * vm.c (ruby_vm_at_exit): new API. This enables extension libs to
- hook a VM termination. Right now, because the VM we have is
- process global, most extensions do not deallocate resources and
- leave them to Operating System's reaping userland processes. But
- in a future we plan to have multiple VMs to run simultaneously in
- a single process (MVM project). At that stage we can no longer
- rely on OSes and have to manage every resources to be reclaimed
- properly. So it is. For a forward-compatibility reason this API
- is introduced now, encouraging you to be as gentle as you can for
- your resources; that is, tidy up your room.
-
- * include/ruby/vm.h: ditto.
-
- * vm_core.h (rb_vm_struct): new field.
-
- * vm.c (vm_init2): initialize above new field.
-
- * eval.c (ruby_cleanup): trigger those hooks.
-
-Thu Dec 2 17:00:44 2010 Tanaka Akira <akr@fsij.org>
-
- * bignum.c: parenthesize macro arguments.
-
-Thu Dec 2 15:31:14 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_read): more fix. [ruby-core:33513]
-
-Thu Dec 2 13:41:43 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_read): workaround for console reading troubles.
- fixed [ruby-core:33511]
-
-Thu Dec 2 13:10:42 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/common.rb (URI.encode_www_form):
- split key-value when the value is Array like object.
-
-Thu Dec 2 10:39:39 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http.rb (Net::HTTP#set_form_data):
- use URI.encode_www_form for application/x-www-form-urlencoded.
-
-Thu Dec 2 10:38:40 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/extmk.rb: remove $makeflags.defined?, it should be $mflags.
-
-Thu Dec 2 10:19:47 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub (rc): suppress meaningless message.
-
-Thu Dec 2 10:09:40 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/json/generator/extconf.rb: remove the lines which set -O3
- when -O option is not set.
- Note that -O3 doesn't always exist.
-
- * ext/json/parser/extconf.rb: ditto.
-
-Thu Dec 2 10:01:59 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/extmk.rb: define $makeflags.defined? like $mflags.
-
-Thu Dec 2 07:20:20 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit.rb (Test::Unit::GCStressOption): --gc-stress
- option.
-
- * lib/test/unit.rb (Test::Unit::Mini#_run_suites): show the result
- even when interrupted on the way.
-
-Thu Dec 2 07:08:38 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/io/console/console.c (setattr): should retry on EINTR.
- [ruby-dev:42666]
-
-Thu Dec 2 02:30:50 2010 Eric Hodel <drbrain@segment7.net>
-
- * lib/net/http.rb: fixed positional wording to match revised order.
-
-Thu Dec 2 01:24:39 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/json/lib/json/common.rb: don't use iconv on 1.9.
- patched by Shota Fukumori [ruby-core:33164]
-
-Thu Dec 2 01:02:03 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/json: Update github/flori/json from 1.4.2+ to
- e22b2f2bdfe6a9b0. this fixes some bugs.
-
-Thu Dec 2 00:05:44 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http.rb: improve rdoc.
- This change the order of chapter because such overview should
- begin with simple examples.
- patched by Eric Hodel [ruby-core:33469]
-
-Wed Dec 1 22:01:49 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * numeric.c (Init_Numeric): fixed a potential bug when using bccwin32
- ruby with Microsoft's dll, though we already gave up of supporting
- bccwin32. [ruby-core:33503]
-
-Wed Dec 1 21:43:21 2010 Tanaka Akira <akr@fsij.org>
-
- * array.c: parenthesize macro arguments.
-
-Wed Dec 1 21:41:57 2010 Tanaka Akira <akr@fsij.org>
-
- * test/socket/test_addrinfo.rb: extract Errno::EADDRINUSE as a method.
-
- * test/socket/test_socket.rb: ditto.
-
-Wed Dec 1 15:08:32 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/openssl/test_ssl.rb (test_not_started_session): non socket
- argument of SSLSocket.new is not supported on Windows.
-
-Wed Dec 1 14:36:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_memhash): zero-filled strings should return
- different values. [ruby-core:33500]
-
-Wed Dec 1 14:27:49 2010 Ryan Davis <ryand-ruby@zenspider.com>
-
- * lib/minitest/*.rb: Imported minitest 2.0.0 r5952.
- * test/minitest/*.rb: ditto.
- * lib/test/unit.rb: Compatibility fix for minitest changes.
-
-Wed Dec 1 10:16:41 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (rb_str_inspect): fix typo (not 0xFD but 0xFE).
-
-Wed Dec 1 09:28:27 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c: Follow .gnu_debuglink section.
- A user of distribution provided ruby will see line
- info if s/he has a debug package for ruby.
- patched by Shinichiro Hamaji [ruby-dev:42655]
-
-Wed Dec 1 01:29:15 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (rb_str_inspect): inspect as a dummy encoding string
- when a UTF-16/32 (not BE/LE) string does not have a BOM.
- Unicode and some RFCs say that a string labeled as UTF-16/32
- doesn't have a BOM, it should be considered big endian.
- But many Windows programs generates little endian UTF-16
- strings without a BOM. So String#inspect treats a string
- labeled UTF-16/32 without a BOM as a dummy encoding string.
- patched by Martin Duerst. [ruby-core:33461]
-
-Tue Nov 30 17:04:10 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (parse_debug_line_cu): ignore DW_LNE_set_discriminator.
- To ignore, it needs to read a single unsigned LEB128 integer.
-
-Tue Nov 30 16:29:19 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vm_dump.c: undef HAVE_BACKTRACE when the OS is FreeBSD (in other
- words backtrace() is libexecinfo) and it is optimized.
- This temporary hack may be also applied to other libexecinfo
- environments.
-
-Tue Nov 30 16:23:23 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http.rb: improve rdoc.
- patched by Eric Hodel ref #4100
-
-Tue Nov 30 12:23:52 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_read): read only 1 byte at once on console.
- workaround of Windows bug. see [ruby-core:33460].
- this is not the final solution.
-
-Tue Nov 30 11:39:13 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http.rb: improve rdoc.
- patched by mathew murphy [ruby-core:33472] ref #4100
-
-Tue Nov 30 05:03:44 2010 Eric Hodel <drbrain@segment7.net>
-
- * lib/uri/common.rb (encode_www_form, encode_www_form_component):
- Improve English in documentation.
-
- * ext/openssl/ossl_ssl.c (ssl_version=, ciphers=): Document
- #ssl_version=, add documentation for #ciphers=.
-
-Mon Nov 29 22:55:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/uri/common.rb (URI::WFKV_): get rid of backtrack explosion
- by nested repeat operators. [ruby-core:33464]
-
-Mon Nov 29 22:53:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/Makefile.sub (scriptbin.mk): fix generated rules.
-
- * win32/win32.c (rb_w32_write_console): fix argument type.
-
-Mon Nov 29 21:12:51 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-forward-sexp): stop after literal hash
- key labels.
-
- * misc/ruby-mode.el (ruby-font-lock-keywords): highlight literal
- hash key labels as symbols.
-
-Mon Nov 29 18:31:31 2010 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/test_transcode.rb (test_unicode_public_review_issue_121):
- - Removed commented-out options that are no longer under discussion.
- - Added two more tests for forthcomming clarifications.
-
-Mon Nov 29 14:31:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_isatty): use GetConsoleMode() to determine the
- fd is console or not, just like rb_w32_write_console(). [experimental]
-
-Mon Nov 29 14:19:40 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * include/ruby/win32.h (rb_w32_write_console): wrong prototype.
-
-Mon Nov 29 14:10:55 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_write_console): fixed indentation.
-
-Sun Nov 28 22:13:39 2010 Koichi Sasada <ko1@atdot.net>
-
- * thread_pthread.c (NATIVE_MUTEX_LOCK_DEBUG): move and use it.
-
- * ChangeLog: fix my timezone.
-
-Mon Nov 28 21:58:58 2010 Koichi Sasada <ko1@atdot.net>
-
- * thread_pthread.c: remove pthread_atfork().
-
-Mon Nov 28 21:54:22 2010 Koichi Sasada <ko1@atdot.net>
-
- * thread_pthread.c (native_cond_*): Check return code.
- (Some OSes except Linux return error code).
-
-Sun Nov 28 21:46:21 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread_pthread.c (thread_start_func_1): initialize native thread
- data immediately before starting.
-
-Sun Nov 28 14:56:32 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (struct argf): make lineno long, and reorder members.
-
-Sun Nov 28 14:55:42 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread_win32.c (gvl_release, gvl_init): suppress warnings.
-
-Sun Nov 28 14:48:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread_pthread.c (gvl_release, gvl_init): suppress warnings.
-
- * vm_core.h (rb_vm_gvl_destroy): add prototype.
-
-Sun Nov 28 14:46:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread_pthread.c (gvl_reinit): register atfork handler only in
- the parent process, to get rid of dead lock.
-
-Sun Nov 28 12:23:57 2010 Koichi Sasada <ko1@atdot.net>
-
- * thread.c, vm_core.h: make gvl_acquire/release/init/destruct
- APIs to modularize GVL implementation.
-
- * thread_pthread.c, thread_pthread.h: Two GVL implementations.
- (1) Simple locking GVL which is same as existing GVL.
- (2) Wake-up queued threads. The wake-up order is simple FIFO.
- (We can make several queues to support exact priorities, however
- this causes some issues such as priority inversion and so on.)
- This impl. prevents spin-loop (*1) caused on SMP environments.
- *1: Only one Ruby thread acquires GVL again and again.
- Bug #2359 [ruby-core:26694]
-
- * thread_win32.c, thread_win32.h: Using simple lock
- not by CRITICAL_SECTION but by Mutex.
- Bug #3890 [ruby-dev:42315]
-
- * vm.c (ruby_vm_destruct): ditto.
-
-Sun Nov 28 04:40:00 2010 Luis Lavena <luislavena@gmail.com>
-
- * io.c (io_fwrite): use rb_w32_write_console under Windows.
-
- * win32/win32.c (rb_w32_write_console): added to write to write
- Unicode using WriteConsoleW for stdout/stderr. [ruby-core:33166]
-
-Sun Nov 28 03:58:47 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http.rb: improve rdoc.
- patched by Mike Perham [ruby-core:33433]
-
-Sat Nov 27 19:12:10 2010 Tanaka Akira <akr@fsij.org>
-
- * time.c: parenthesize macro arguments.
-
-Sat Nov 27 18:08:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * time.c (leap_year_v_p): fixed typo. [ruby-dev:42631]
-
-Sat Nov 27 17:57:08 2010 Tanaka Akira <akr@fsij.org>
-
- * resolv.rb (Resolv::DNS): use the same DNS server when retry using
- TCP. reported by Julian Mehnle. [ruby-core:32970]
-
-Sat Nov 27 15:45:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_dump.c (rb_vm_bugreport): see CrashReport log on Mac OS X.
-
- * configure.in: link addr2line only for ELF.
-
-Sat Nov 27 13:58:55 2010 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser#candidate): : was missing. Thanks,
- Shota Fukumori. [ruby-dev:42634]
-
-Sat Nov 27 12:07:05 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * man/ruby.1: Ruby man page from Arthur Gunn in [ruby-core:33412]
-
-Sat Nov 27 11:29:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser#candidate): get rid of 1.9 syntax
- so that BASERUBY can be 1.8.
-
-Sat Nov 27 08:16:21 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * addr2line.c (rb_dump_backtrace_with_lines): should close fd on
- edge case.
-
-Fri Nov 26 13:33:24 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c: apply a patch from shinichiro.h.
-
-Fri Nov 26 12:21:20 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c: added to show source filename and line number of
- functions in backtrace. [ruby-dev:42625]
- a patch from shinichiro.h <shinichiro.hamaji AT gmail.com>
-
- * addr2line.h: ditto.
-
- * common.mk: add addr2line.$(OBJEXT).
-
- * configure.in: check dl_iterate_phdr.
-
- * vm_dump.c (rb_vm_bugreport): use rb_dump_backtrace_with_lines in
- addr2line.c when the binary is ELF.
-
-Fri Nov 26 12:12:50 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regcomp.c (setup_tree): restart setup_tree() for a node whose
- AnchorNode's type is ANCHOR_PREC_BEHIND or ANCHOR_PREC_BEHIND_NOT
- and divide_look_behind_alternatives() divided it to NT_ALT or
- NT_LIST. [ruby-core:33370]
-
-Fri Nov 26 11:40:11 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * vm_dump.c (dump_thread): get only required rights of the target
- thread because THREAD_ALL_ACCESS causes an access error on XP.
- reported by Masaya TARUI via IRC.
-
-Fri Nov 26 11:09:07 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * vm_dump.c (dump_thread): show the displacement from the beginning
- of the symbol.
-
-Fri Nov 26 10:48:23 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * vm_dump.c (dump_thread): follow the output of glibc.
- see [ruby-dev:42627]
-
-Fri Nov 26 09:48:45 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * re.c (rb_reg_initialize_str): should succeed the taint status from
- the origin. [ruby-core:33338]
-
-Fri Nov 26 09:32:37 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * vm_dump.c (dump_thread): seems to be necessary the 3rd argument of
- SymGetLineFromAddr64(), even though MSDN says it can be zero.
-
-Fri Nov 26 09:03:38 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regcomp.c (onig_is_prelude): added to check whether ruby is still
- in prelude (or other boot processes) or not.
-
- * regcomp.c (optimize_node_left): use onig_is_prelude for printing.
-
- * regcomp.c (set_optimize_info_from_tree): ditto.
-
- * regcomp.c (onig_compile): ditto.
-
- * regcomp.c (print_compiled_byte_code_list): print its address.
-
- * regcomp.c (print_indent_tree): print its contents tree of
- ANCHOR_PREC_READ(_NOT) and ANCHOR_PREC_BEHIND(_NOT).
-
-Thu Nov 25 23:10:49 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regcomp.c (print_distance_range): use PRIuSIZE.
-
- * regcomp.c (print_optimize_info): use %ld because the type of
- calculated value of integers is long.
-
- * regexec.c (onig_print_compiled_byte_code): add prototype.
-
- * regexec.c (match_at): add 2nd argument.
-
-Thu Nov 25 10:29:55 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/dl/callback/mkcallback.rb (gencallback): shouldn't assume that
- VALUE is the same size with long.
-
-Thu Nov 25 10:03:14 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/win32ole/test_err_in_callback.rb (teardown): remove tmp file
- only when it exists.
-
-Thu Nov 25 01:38:25 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * enc/trans/big5-hkscs-tbl.rb: Update table as HKSCS-2008.
- patched by oCameLo oTnTh [ruby-core:33256]
-
- * enc/big5.c: add alias Big5-HKSCS:2008 to Big5-HKSCS.
-
-Wed Nov 24 15:18:07 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * vsnprintf (BSD_vfprintf): use QUADINT macro only when _HAVE_SANE_QUAD_
- macro is defined.
-
-Wed Nov 24 12:47:16 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * vsnprintf (BSD_vfprintf): added VC++ compatible size specifications
- (I, I32, I64).
-
-Wed Nov 24 11:19:13 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (rb_str_inspect): treat UTF-16 and UTF-32 as BE or LE.
-
-Wed Nov 24 06:35:32 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * enc/trans/utf_16_32.trans: add the UTF-32 converter.
-
-Wed Nov 24 05:40:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
-Wed Nov 24 06:13:32 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (filecp, wstr_to_mbstr, mbstr_to_wstr):
- refactored.
-
-Wed Nov 24 05:40:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * enc/trans/utf_16_32.trans: add a converter from UTF-8 to UTF-16.
-
-Wed Nov 24 03:21:35 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * enc/trans/utf_16_32.trans: raise error on unpaired upper
- surrogates.
-
-Wed Nov 24 01:40:23 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * enc/utf_16_32.h: add UTF-16 and UTF-32 as a dummy encoding.
-
- * enc/trans/utf_16_32.trans: add a converter from UTF-16 to UTF-8.
-
-Tue Nov 23 21:59:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (wlink, rb_w32_getppid): use typedef instead of
- repeating complicated function prototypes.
-
-Tue Nov 23 18:54:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm.c (rb_thread_mark): should mark self in control
- frames. [ruby-core:33289]
-
-Tue Nov 23 07:57:31 2010 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date/delta/parser.{ry,rb}: fixed a bug of token scanner.
-
-Tue Nov 23 07:29:24 2010 Tadayoshi Funaba <tadf@dotrb.org>
-
- * complex.c, rational.c ({nucomp,nurat}_expt): added a check.
-
-Tue Nov 23 07:27:27 2010 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date.rb (daynum): should be private.
-
-Tue Nov 23 07:22:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ChangeLog (change-log-indent-text): hanging indent.
-
-Tue Nov 23 06:30:51 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (SITE_DIR, VENDOR_DIR),
- version.c (ruby_initial_load_paths): exclude directories that
- are configured without them from $LOAD_PATH. [ruby-core:33267]
-
- * configure.in (rubylibprefix): No ruby, No libprefix.
-
-Tue Nov 23 01:05:27 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vsnprintf.c (BSD_vfprintf): don't output floating point
- when the precision is 0. [ruby-dev:42615]
-
-Mon Nov 22 21:30:57 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_inspect): fix for ascii-compatible external
- encoding and different encoding string. [ruby-core:33283]
-
-Mon Nov 22 18:45:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (create_makefile): should not duplicate rules.
- bug fix of r29842.
-
-Mon Nov 22 18:04:40 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * enc/big5.c: split CP950 from Big5.
-
- * enc/big5.c: split CP951 from Big5-HKSCS.
-
- * enc/trans/big5.trans: import conversion table of Big5, Big5-HKSCS,
- CP950, and CP951 from ICU. they need fallback conversions.
- ref [ruby-core:33256]
- http://source.icu-project.org/repos/icu/data/trunk/charset/data/ucm/
-
- * tool/transcode-tblgen.rb (import_ucm): add to import ucm files.
-
-Mon Nov 22 18:33:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_inspect): append for each chars instead of bulk
- copy if encoding conversion is needed. [ruby-core:33283]
-
-Mon Nov 22 14:22:45 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * time.c (time_zone): use rb_locale_str_new_cstr to set encoding
- as locale and convert its content to internal encoding.
- [ruby-core:33278]
-
-Mon Nov 22 11:58:11 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (rb_str_concat): set ENC_CODERANGE_VALID when the
- receiver is 7BIT and the argument is non ASCII.
-
-Mon Nov 22 01:48:58 2010 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date.rb: some improvements for performance.
-
-Sat Nov 20 07:45:50 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * lib/mkmf.rb: adding compilation support for ObjC/ObjC++ extensions.
- Thanks Scott Gonyea! [ruby-core:33260]
-
-Sat Nov 20 01:57:55 2010 Akio Tajima <artonx@yahoo.co.jp>
-
- * common.mk: add dependency(insns.inc) to compile.obj
-
-Fri Nov 19 23:05:48 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/Makefile.sub (insns_rules.mk): remove extra backslash.
-
- * cygwin/GNUmakefile.in, win32/Makefile.sub (clean): rc files are
- made at compile time, so should be removed by clean.
-
-Fri Nov 19 22:09:46 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_core.rb
- (Tester#test_pretty_format_long_text_finite): skip a test that
- uses long string on small memory system. [ruby-dev:42599]
-
-Fri Nov 19 21:07:06 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb: shell completion support for zsh. based on
- <http://d.hatena.ne.jp/rubikitch/20071002/zshcomplete>
-
- * lib/optparse.rb: shell completion support for bash.
-
-Fri Nov 19 00:00:00 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * cygwin/GNUmakefile.in (SCRIPTPROGRAMS): no needs on cygwin.
-
- * win32/Makefile.sub (scriptbin): create script binaries.
-
-Thu Nov 18 23:21:23 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rexml/formatters/pretty.rb (REXML::Formatters::Pretty#wrap):
- REXML::Formatters::Pretty#wrap used a recursive method call to
- format text. This switches it to use an iterative approach.
- [ruby-core:33245]
- Patch by Jeremy Evans. Thanks!!!
-
- * test/rexml/test_core.rb: add a test for it.
-
-Thu Nov 18 22:58:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/io.h (rb_io_buffer_t): extract from rb_io_t.
-
-Thu Nov 18 07:37:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in (reconfig): force reconfigure with previous options.
-
- * common.mk (showconfig): show configure flags, like as
- `config.status --config' generated by recent autoconf.
-
-Thu Nov 18 07:16:49 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * missing/langinfo.c (strncasecmp): get rid of redefinition.
-
-Thu Nov 18 00:02:17 2010 James Edward Gray II <jeg2@ruby-lang.org>
-
- * lib/csv.rb: Upgrading output encoding with ASCII content
- as needed. [ruby-core:33229]
-
-Wed Nov 17 23:19:21 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/configure.bat: remove quotes from arguments to be quoted.
-
- * lib/mkmf.rb (create_makefile): use forward slashes in messages.
-
- * lib/mkmf.rb (create_makefile): make extension libraries messages
- brief.
-
- * win32/Makefile.sub (MAKEDIRS): should not include silent flag.
-
- * common.mk (ext/ripper/ripper.c, ext/json/parser/parser.c): pass
- Q and ECHO. [ruby-core:33226]
-
-Wed Nov 17 16:09:52 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * test/test_tracer.rb: new test case.
- minimal regression test for r29280.
-
-Wed Nov 17 16:04:23 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * test/ruby/envutil.rb (Test::Unit::Assersions#assert_warn):
- new assertion to assert that a particular warning message is
- displayed.
- forward port from branches/ruby_1_9_2@29795.
-
-Wed Nov 17 15:16:48 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regint.h (OnigOpInfoType): constify name.
-
- * regcomp.c (op2name): constify return value.
-
- * regcomp.c (onig_print_compiled_byte_code): use PRIuPTR and
- uintptr_t to clean warnings.
-
- * regcomp.c (print_indent_tree): use PRIxPTR and intptr_t.
-
- * regexec.c (match_at): use PRIdPTR and intptr_t.
-
-Wed Nov 17 09:49:10 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * enc/shift_jis.c (property_name_to_ctype): fix memory leak.
-
- * enc/euc_jp.c (property_name_to_ctype): ditto.
-
-Wed Nov 17 08:54:04 2010 James Edward Gray II <jeg2@ruby-lang.org>
-
- * lib/csv.rb: Upgrading output encoding as needed. [ruby-core:33135]
-
-Tue Nov 16 22:30:39 2010 Yusuke Endoh <mame@tsg.ne.jp>
-
- * vm_insnhelper.c (vm_throw): remove fear of undefined behavior :-)
- Coverity Scan found this bug.
-
-Tue Nov 16 09:33:00 2010 Kenta Murata <mrkn@mrkn.jp>
-
- * ext/bigdecimal/lib/bigdecimal/util.rb (to_digits): avoid unused
- variables warning, reported by Aaron Patterson.
-
-Tue Nov 16 06:39:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * pack.c (PACK_ITEM_ADJUST): return nil not result array and yield
- values if block is given. [ruby-core:33193]
-
-Tue Nov 16 00:21:20 2010 Yusuke Endoh <mame@tsg.ne.jp>
-
- * regparse.c (and_cclass, or_cclass): fix memory leak. Coverity Scan
- found this bug. [ruby-dev:42579]
-
-Tue Nov 16 00:07:32 2010 Yusuke Endoh <mame@tsg.ne.jp>
-
- * gc.c (assign_heap_slot): fix fear of memory leak and memory
- violation. Coverity Scan found this bug.
-
-Mon Nov 15 23:54:45 2010 Yusuke Endoh <mame@tsg.ne.jp>
-
- * eval_intern.h (CHECK_STACK_OVERFLOW): it was not intended to add
- size_t to a pointer typed VALUE*. Coverity Scan found this defect.
-
-Mon Nov 15 23:41:21 2010 Yusuke Endoh <mame@tsg.ne.jp>
-
- * compile.c (iseq_set_exception_local_table, iseq_set_local_table,
- rb_iseq_build_from_ary): fix type inconsistency (which is benign
- because sizeof(ID) == sizeof(ID*), though). Coverity Scan found
- these bugs.
-
-Mon Nov 15 22:47:27 2010 Yusuke Endoh <mame@tsg.ne.jp>
-
- * vm_eval.c (rb_funcall): ensure va_end after va_init_list. Coverity
- Scan found this bug.
-
-Mon Nov 15 08:36:12 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * lib/racc/parser.rb (do_parse, yyparse): using class eval to define
- method and avoid __send__.
-
-Mon Nov 15 06:43:48 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * etc/openssl/ossl_ssl.c (ossl_ssl_get_cert): raise exception if
- pointer is invalid. Thanks Ippei Obayashi! [ruby-dev:42573]
-
-Sun Nov 14 17:57:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enc/Makefile.in (distclean): should not remove sources which are
- distributed in tarball.
-
-Sun Nov 14 16:48:56 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_set_token_info): turn on/off with directives.
- [ruby-core:25442]
-
-Sun Nov 14 12:05:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (argf_readlines): forward to current_file for arguments
- check. http://twitter.com/nagachika/status/3634254856589312
-
-Sun Nov 14 08:48:06 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/setup.mak (-basic-vars-, -runtime-): suppress trailing
- space and compiler command line.
-
-Sun Nov 14 04:22:32 2010 Alexander Zavorine <alexandre.zavorine@nokia.com>
-
- * symbian/setup (config.h): Added HAVE_LABS and HAVE_LLABS to config.h.
-
- * symbian/configure.bat: Changed packaging version in line with API style 3 versioning.
-
-Sat Nov 13 16:37:56 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (showflags, help): emit messages at once.
-
- * win32/Makefile.sub (MSG, EOM): remove surrounding quotes by %~I.
-
-Sat Nov 13 01:31:30 2010 Akio Tajima <artonx@yahoo.co.jp>
-
- * win32/Makefile.sub: reorder variable End Of Message (don't display it)
-
-Fri Nov 12 20:52:34 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (showflags, help): use caret to quote leading spaces on Windows.
-
- * Makefile.in, common.mk, cygwin/GNUmakefile.in, enc/depend,
- ext/ripper/depend, lib/mkmf.rb, win32/Makefile.sub: caddle up.
-
-Fri Nov 12 16:35:31 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: support C level backtrace information on FreeBSD.
- When devel/libexecinfo is installed on FreeBSD, now ruby
- can show C level backtrace information.
- http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/libexecinfo/
-
-Fri Nov 12 09:58:30 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/setup.mak: use findstr.exe instead of find.exe, because all
- target build platforms should have findstr.exe, and, find.exe often
- means another command such as cygwin's.
-
-Fri Nov 12 00:30:19 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/Makefile.sub (config.h): need PRI_LL_PREFIX.
-
-Thu Nov 11 23:38:32 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: ANSI C-conforming const and volatile are mandatory
-
- * configure.in (AC_C_CONST, AC_C_INLINE, AC_C_VOLATILE): check
- before used in other checks.
-
- * configure.in (RUBY_CHECK_PRINTF_PREFIX): should not break from
- RUBY_WERROR_FLAG, so that ac_c_werror_flag gets restored.
-
-Thu Nov 11 23:04:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/iconv.c (warn_deprecated): show caller position.
-
-Thu Nov 11 23:03:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (argf_close): untie tied io before closing.
-
- * io.c (argf_write): add ARGF.write and so on.
-
- * io.c (argf_read_nonblock): add ARGF.read_nonblock.
-
-Thu Nov 11 21:49:06 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rdoc/stats.rb (RDoc#print): get rid of NaN.
-
-Thu Nov 11 21:47:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (SHOWFLAGS): show compile flags.
-
- * common.mk: hide long command lines by default. verbose-mode is
- turned on by V=1 as before.
- http://jarp.does.notwork.org/diary/200605b.html#200605121
-
-Thu Nov 11 21:32:09 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (try_func): accept variable address.
-
- * ext/win32ole/extconf.rb: libuuid is needed on cygwin.
-
-Thu Nov 11 21:24:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (file_expand_path): use cygwin_conv_path on cygwin 1.7 or
- later.
-
- * ruby.c (push_include_cygwin): ditto.
-
-Thu Nov 11 20:49:48 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (PRI_LL_PREFIX): format type specifier for
- LONG_LONG may vary on platforms.
-
-Thu Nov 11 20:45:23 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (SYMBOL_PREFIX): separate from EXPORT_PREFIX.
-
- * win32/mkexports.rb (Exports#each_export): use SYMBOL_PREFIX.
-
-Wed Nov 10 07:20:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * cygwin/GNUmakefile.in (scriptbin): make executable file from
- scripts with stub.
-
- * ruby.c (load_file_internal): assume xflag for exe file as well
- as no-shebang file.
-
- * tool/rbinstall.rb: install script programs.
-
- * win32/mkexports.rb (Exports#initialize): alias ruby_sysinit for
- stub.
-
- * win32/stub.c: stub for scripts. [EXPERIMENTAL]
-
-Tue Nov 9 21:57:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dln.c (init_funcname): allocate and build initialization
- funciton name at once.
-
-Tue Nov 9 21:14:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (AC_FUNC_GETPGRP, AC_FUNC_SETPGRP): no need when
- not used.
-
- * configure.in (EXPORT_PREFIX): check generic prefix.
-
-Tue Nov 9 13:24:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regenc.c (onigenc_minimum_property_name_to_ctype):
- \p{...} should be case insensitive. [ruby-core:33000]
-
- * regenc.c (onigenc_property_list_add_property):
- ditto.
-
- * enc/euc_jp.c (init_property_list, property_name_to_ctype):
- to lowercase property names.
-
- * enc/shift_jis.c (init_property_list, property_name_to_ctype):
- ditto.
-
-Tue Nov 9 13:29:36 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (overlapped_socket_io): get rid of a warning of 64bit
- mingw.
-
-Tue Nov 9 10:44:19 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * util.c (ruby_strtod): this code uses FPU's rounding system.
- But x86's FPU calculates double precision floating-point
- numbers in 80bit precision, so it fails to round the value.
- So ensure the value is assigned a variable. [ruby-dev:42551]
- see also [ruby-math:00802]
- http://www.shudo.net/java-grandprix99/strictfp/
-
-Tue Nov 9 07:30:15 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (rb_syserr_new): new function to make SystemCallError
- instance without errno. [EXPERIMENTAL]
-
- * error.c (rb_syserr_fail, rb_mod_syserr_fail): ditto.
-
-Tue Nov 9 05:54:57 2010 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/*.rb: Remove unused variable warnings.
- Patch by Run Paint [ruby-core:30991]
-
- * lib/rubygems/*, lib/rdoc/*.rb, lib/rake/*.rb: ditto
-
-Mon Nov 8 18:26:03 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * util.c (ruby_hdtoa): fix type cast and bufsize.
-
-Mon Nov 8 15:40:56 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vsnprintf.c (BSD_vfprintf): fix precision specifier doesn't
- work well on %f. [ruby-dev:42552]
-
-Mon Nov 8 14:41:40 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (get_wsa_extension_function): typos.
-
-Mon Nov 8 13:41:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/enc-unicode.rb,
- enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
- enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
- Add Age property to regexp. [ruby-core:33019]
- patched by Ammar Ali, tested by Run Paint Run Run
-
-Mon Nov 8 12:16:39 2010 Ben Walton <bwalton@artsci.utoronto.ca>
-
- * configure.in: support -h for solaris linker when gcc not used
-
-Mon Nov 8 11:47:39 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (finish_overlapped_socket): refactoring.
-
-Mon Nov 8 11:02:21 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (get_proc_address): refactoring.
-
- * win32/win32.c (get_wsa_exetinsion_function): refactoring.
-
-Mon Nov 8 09:45:35 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * enc/trans/gbk-tbl.rb: Add euro sign. [ruby-core:33094]
- CP936, which is de facto definition of GBK, has it.
- http://msdn.microsoft.com/en-us/goglobal/cc305153.aspx
-
-Mon Nov 8 07:26:20 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: check only the first symbol to get rid of
- duplication. [ruby-core:33084] #4031
-
-Sun Nov 7 10:13:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (NM): check on all platforms. #4031
-
-Sun Nov 7 06:16:33 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * test/openssl/test_ocsp.rb: adding test for r29699. Thanks Elise
- Huard! [ruby-core:32460]
-
-Sat Nov 6 07:33:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_export_prefix): check for prefixed
- underscore of exported symbols
-
- * tool/rbinstall.rb (bin-comm): prepend prolog shell script if
- necessary.
-
- * configure.in (LIBRUBY_RELATIVE): use rpath token expansion.
-
-Sat Nov 6 07:24:01 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * template/ruby.pc.in (arch, sitearch): reordered.
-
- * configure.in: keep failed file.
-
-Sat Nov 6 07:03:49 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (rb_fork_err): save errinfo before fdopen.
-
-Sat Nov 6 00:43:58 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/openssl/ossl_ocsp.c (ossl_ocspcid_initialize): an optional
- parameter may be used to specify the OpenSSL::OCSP::CertificateId on
- initialization. Thanks Elise Huard! [ruby-core:32460]
-
-Fri Nov 5 12:23:01 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/ruby/test_{process,system}.rb (test_fallback_to_sh):
- meaningless and wrong tests where /bin/sh does not exist.
-
- * process.c (proc_spawn_v): should spawn, not exec.
-
-Fri Nov 5 01:21:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (proc_exec_v, proc_spawn_v): try to execute with sh if
- no shebang. [ruby-core:32745] [EXPERIMENTAL]
-
-Fri Nov 5 00:39:00 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_readlines, rb_io_each_line): limit must not be zero.
- a patch from Tomoyuki Chikanaga at [ruby-dev:42538]. #4024
-
-Fri Nov 5 00:14:15 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/fiddle/extconf.rb: fixing ffi library location on windows.
- Thanks Usa! [ruby-core:32930]
-
-Thu Nov 4 20:04:44 2010 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (rb_newobj): force garbage_collect() if GC.stress == true.
-
-Thu Nov 4 19:48:22 2010 Koichi Sasada <ko1@atdot.net>
-
- * ChangeLog: missed to write a last ChangeLog.
-
- * gc.c (gc_finalize_deferred): removed.
-
- * gc.c (rb_gc_finalize_deferred): Do not invoke a free_unused_heaps().
-
-Thu Nov 4 19:45:27 2010 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (run_final): do not need argument obj.
-
-Thu Nov 4 19:26:10 2010 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (before_gc_sweep): fix commit miss.
-
-Thu Nov 4 19:20:46 2010 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (after_gc_sweep, before_gc_sweep):
- invoke rb_sweep_method_entry() as soon as possible.
-
-Thu Nov 4 19:13:58 2010 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (after_gc_sweep, slot_sweep): finalizers should be invoked
- as soon as possible.
-
-Thu Nov 4 10:30:40 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * configure.in (--with-valgrind): Now this option is default on.
- You can still explicitly disable this feature by specifying
- --without-valgrind.
-
-Thu Nov 4 02:06:16 2010 Yusuke Endoh <mame@tsg.ne.jp>
-
- * cont.c (fiber_t_alloc): raise an error when fiber is going to be
- initialized twice. [ruby-dev:42524]
-
-Thu Nov 4 02:04:25 2010 Yusuke Endoh <mame@tsg.ne.jp>
-
- * cont.c (rb_fiber_resume): raise an "double resume" error when root
- fiber is going to be resumed. [ruby-dev:42523]
-
-Wed Nov 3 14:17:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/ostruct.rb (OpenStruct#delete_field): also undefine
- accessor methods. [ruby-core:33010]
-
-Wed Nov 3 14:13:46 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_enc_cr_str_buf_cat): concatenation of valid
- encoding string and invalid encoding string should result
- invalid encoding. [ruby-core:33027]
-
-Wed Nov 3 08:58:59 2010 Koichi Sasada <ko1@atdot.net>
-
- * gc.c, vm.c, vm_core.h: remove USE_VALUE_CACHE option.
-
-Wed Nov 3 07:47:25 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/irb/ruby-lex.rb (RubyLex#identify_string): parse multiple
- regex options. a patch from Heesob Park in [ruby-core:32988].
-
-Wed Nov 3 07:33:57 2010 Tanaka Akira <akr@fsij.org>
-
- * vm_method.c (rb_clear_cache_by_class): just return if the class has
- no method. reported by Eric Wong. [ruby-core:32689]
-
-Tue Nov 2 22:50:25 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/visitor.rb (initialize): push accessor
- methods to subclass that actually uses them.
-
-Tue Nov 2 22:47:08 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/visitor.rb (accept): switch to
- a dispatch cache rather than case / when statement.
-
-Tue Nov 2 21:46:52 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * NEWS: fix a typo.
-
-Tue Nov 2 20:10:32 2010 Tajima Akio <artonx@yahoo.co.jp>
-
- * test/rake/test_tasks.rb: clear env var which is used by the test.
- [ruby-dev:42508]
-
-Tue Nov 2 00:25:54 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/socket/extconf.rb: win64 is just same with win32 about socket.
- notice: but wince is not same.
-
-Mon Nov 1 21:25:57 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * main.c: <stdlib.h> is needed, to introduce the getenv(3)
- prototype declaration. Without it a C compiler shall infer
- the getenv type as "int getenv(...);", but this is totally
- wrong, especially when your machine's sizeof(int) and
- sizeof(char*) differs. On such environment a return value
- of getenv(3), which is in fact a char*, might first casted
- into a int (loses data here), and then casted back to char*
- by automatic integral promotion to fit to the prototype of
- ruby_set_debug_option().
-
-Sun Oct 31 23:27:09 2010 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (finalizer_table, objspace->final.table):
- Create finalizer_table at Init_heap().
- Remove all null checks of finalizer_table.
-
- * gc.c (mark_tbl): skip if no table entries.
-
- * gc.c (slot_swee): remove useless need_call_final check.
-
-Sun Oct 31 22:32:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (rb_objspace_free): finalizers should be called separately
- from freeing objspace. [ruby-dev:42479]
-
-Sun Oct 31 22:24:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (ruby_cleanup): free current VM and its objspace even
- when exiting by SystemExit.
-
-Sun Oct 31 22:10:56 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (new_child_iseq): adjust argument types.
-
- * iseq.c (prepare_iseq_build, rb_iseq_new),
- (rb_iseq_new_with_bopt_and_opt, rb_iseq_new_with_opt),
- (rb_iseq_new_with_bopt): ditto.
-
- * compile.c (iseq_set_exception_table): suppress warnings.
-
- * insns.def (putspecialobject, defined): ditto.
-
- * iseq.c (iseq_load): ditto.
-
-Sun Oct 31 09:30:51 2010 Koichi Sasada <ko1@atdot.net>
-
- * vm_core.h: some refactoring.
- - move decl. of rb_compile_option_struct to iseq.h.
- - define enum iseq_type.
- - define enum vm_special_object_type.
-
- * compile.c: some refactoring.
- - apply above changes.
- - (struct iseq_link_element): change value of type.
- - remove unused decl.
- - fix comment.
- - rename iseq_build_body and iseq_build_exception to
- iseq_build_from_ary_body and iseq_build_from_ary_exception.
-
- * iseq.h: define enum catch_type and enum defined_type.
-
- * insns.def: apply above changes.
-
- * iseq.c: define ISEQ_MAJOR_VERSION and ISEQ_MINOR_VERSION.
-
-Sat Oct 30 23:38:59 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rexml/encoding.rb: untabify.
-
-Sat Oct 30 21:06:37 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rexml/encoding.rb: use Ruby native encoding mechanism.
- [ruby-dev:42464]
- * lib/rexml/encodings/: remove.
-
- * lib/rexml/document.rb, lib/rexml/formatters/default.rb,
- lib/rexml/output.rb, lib/rexml/parseexception.rb,
- lib/rexml/parsers/baseparser.rb, lib/rexml/source.rb,
- lib/rexml/xmldecl.rb: use Ruby's native Encoding object.
-
- * test/rexml/, test/rss/: follow the above encoding changes.
-
- * NEWS: add REXML's incompatible change about encoding.
-
-Sat Oct 30 17:23:19 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * util.c (ruby_strtod): get rid of overflow/underflow as possible.
-
-Sat Oct 30 14:37:39 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (ruby_pc): erase runtime-defined variables and
- check if generated pc file is valid.
-
- * template/ruby.pc.in (DEFFILE): need for mingw.
-
- * template/ruby.pc.in (LIBRUBY): fix the order.
-
-Sat Oct 30 11:33:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/Makefile.sub (ruby_pc): ignore missing variables.
-
- * template/ruby.pc.in: add missing variables for mswin.
-
-Sat Oct 30 10:24:35 2010 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * object.c: Make BasicObject.new accept no parameter.
- Revert of r26135 [ruby-core:27080], as per [ruby-core:32952].
-
-Sat Oct 30 09:40:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enum.c: use constants in id.h.
-
-Sat Oct 30 09:08:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/fiddle/closure.c (fiddle_closure): embed cif not reference
- so that the content surely get initialized. [ruby-dev:42480]
-
-Sat Oct 30 07:01:53 2010 Tanaka Akira <akr@fsij.org>
-
- * lib/resolv-replace.rb: suppress warning.
-
- * lib/open-uri.rb: ditto.
-
-Sat Oct 30 06:32:52 2010 Tanaka Akira <akr@fsij.org>
-
- * test/pathname/test_pathname.rb (TestPathname#test_grpowned?): the
- group of the created file is inherited from the parent
- directory on BSDs and MacOS X. Linux also inherit the group if
- the setgid bit of the directory is set. It causes the test fail.
- fixed by Shota Fukumori. [ruby-dev:42458]
-
-Sat Oct 30 05:58:54 2010 Tanaka Akira <akr@fsij.org>
-
- * lib/resolv.rb: retry via TCP if UDP reply is truncated.
- fixed by Julian Mehnle. [ruby-core:32407]
-
-Sat Oct 30 00:35:13 2010 Koichi Sasada <ko1@atdot.net>
-
- * iseq.c (iseq_s_compile): fix optional argument.
- a patch from Yutaka HARA [ruby-core:32953] [Ruby 1.9-Bug#4001]
-
-Sat Oct 30 00:24:42 2010 Koichi Sasada <ko1@atdot.net>
-
- * ext/objspace/objspace.c (memsize_of): take care of
- T_CLASS/const_tbl.
- a patch from nagachika <nagachika00@gmail.com> [ruby-dev:42490]
-
-Fri Oct 29 23:32:36 2010 Koichi Sasada <ko1@atdot.net>
-
- * test/profile_test_all.rb: added.
- You can use test-all profiler with the following command:
- RUBY_TEST_ALL_PROFILE=true make test-all
- This command generates ./test_all_profile and you can analyze
- which tests consume memories.
-
- * test/runner.rb: ditto.
-
-Fri Oct 29 10:02:03 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/enc-unicode.rb,
- enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
- enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
- Add 'Unknown' Script.
- patched by Run Paint Run Run. [ruby-core:32937] #3998
-
-Fri Oct 29 05:13:34 2010 Koichi Sasada <ko1@atdot.net>
-
- * ext/objspace/objspace.c (ObjectSpace.memsize_of_all): rename
- ObjectSpace.total_memsize_of_all_objects() to
- ObjectSpace.memsize_of_all([klass]).
- Accept Class object to filter the objects.
-
- * test/objspace/test_objspace.rb: fix test for above change.
-
-Fri Oct 29 03:04:16 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_dump): fix expected length. [ruby-core:32935]
-
-Thu Oct 28 23:31:39 2010 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (before_gc_sweep, run_final): fix decrement timing of final_num.
-
-Thu Oct 28 20:11:30 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/enc-unicode.rb,
- enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
- enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
- Update Oniguruma for Unicode 6.
- patched by Run Paint Run Run. [ruby-core:32923] #3989
-
-Thu Oct 28 20:06:25 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * include/ruby/oniguruma.h (ONIGENC_CTYPE_SPECIAL_MASK):
- change mask from 128 to 256. [ruby-core:32931]
-
-Thu Oct 28 12:06:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/webrick/httprequest.rb (read_request_line): extend max
- length to 2083. This is from Internet Explorer's max uri
- length. http://support.microsoft.com/kb/208427 [ruby-core:32924]
-
-Thu Oct 28 04:00:08 2010 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (GC.stat): added. [ruby-dev:38607]
-
- * test/ruby/test_gc.rb: add a test for above.
-
-Thu Oct 28 03:13:06 2010 Koichi Sasada <ko1@atdot.net>
-
- * ext/objspace/objspace.c (memsize_of): fix rdoc.
-
- * ext/objspace/objspace.c (total_memsize_of_all_objects): added.
-
- * test/objspace/test_objspace.rb:
- - add a test for ObjectSpace.total_memsize_of_all_objects.
- - add two tests for ObjectSpace.memsize_of (for nil and Fixnum).
-
-Wed Oct 27 23:55:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/iconv.c (Init_iconv): warn deprecated use.
-
-Wed Oct 27 18:50:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * bignum.c (rb_big2long, rb_big2ulong): rb2ulong() returns VALUE, but
- its real range is ulong. So, if the size of VALUE is bigger than
- ulong, upper bits are always zero even if the actual value is
- negative.
- fixed #3490
-
-Wed Oct 27 18:27:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_io.rb (TestIO#pipe): should close write end of pipe
- before closing read end, to get rid of timing problem.
-
- * test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
-
-Wed Oct 27 18:14:27 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_getppid): support Win64.
-
-Wed Oct 27 15:07:19 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * thread_win32.c (w32_error): should get error no only once, because
- the result of the second getting will indicate the error of the
- first FormatMessage() call.
-
-Wed Oct 27 13:51:25 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_io.rb (TestIO#pipe): need to propagate exceptions
- in read/write thread. fix r29541.
-
- * test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
-
-Wed Oct 27 12:05:40 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * class.c (clone_const): need to return value. fix r29602.
-
-Wed Oct 27 11:58:58 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * include/ruby/ruby.h (NUM2LONG_internal): add cast to get rid of a
- non GCC compiler warning. this is intentional type conversion.
-
-Wed Oct 27 09:25:46 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * cont.c: apply documentation patch by Run Paint Run Run.
- [ruby-core:32915]
-
-Wed Oct 27 02:12:10 2010 Yusuke Endoh <mame@tsg.ne.jp>
-
- * object.c (Init_Object), constant.h, variable.c
- (rb_mod_private_constant, rb_mod_public_constant,
- set_const_visibility, rb_const_get_0): add Module#public_constant
- and private_constant. [ruby-dev:39685][ruby-core:32698]
-
- * test/ruby/test_module.rb: add tests for above.
-
-Wed Oct 27 02:02:54 2010 Yusuke Endoh <mame@tsg.ne.jp>
-
- * class.c, constant.h, gc.c, method.h, object.c, variable.c,
- vm_insnhelper.c: use struct rb_constant_entry_t as entry of
- RCLASS_CONST_TBL. RCLASS_CONST_TBL has contained VALUE of constant
- directly. Now instead rb_const_entry_t is contained in
- RCLASS_CONST_TBL, rb_const_entry_t is managed by malloc, and
- have not only the value itself but also visibility flag.
- This is another preparation for private constant (see
- [ruby-dev:39685][ruby-core:32698]).
-
-Wed Oct 27 01:56:34 2010 Yusuke Endoh <mame@tsg.ne.jp>
-
- * class.c, gc.c, object.c, variable.c, vm_insnhelper.c,
- include/ruby/ruby.h: separate RCLASS_CONST_TBL from RCLASS_IV_TBL.
- RCLASS_IV_TBL has contained not only instance variable table but
- also constant table. Now the two table are separated to
- RCLASS_CONST_TBL and RCLASS_IV_TBL. This is a preparation for
- private constant (see [ruby-dev:39685][ruby-core:32698]).
-
-Tue Oct 26 18:51:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/scanf.rb (extract_float): allow 2.e+2 style.
- [ruby-dev:42452] #3978
-
-Tue Oct 26 18:09:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in (ASFLAGS): needs INCFLAGS.
-
- * configure.in (rb_cv_dynamic_alloca): check if extra source for
- dynamic size alloca.
-
- * missing/x86_64-chkstk.s (___chkstk): necessary for alloca of
- amd64-mingw32msvc-gcc on Ubuntu.
-
- * thread_win32.c (ruby_alloca_chkstk): check stack overflow
-
-Tue Oct 26 18:04:53 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * template/ruby.pc.in (Libs): needs DLDFLAGS.
-
-Tue Oct 26 12:47:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (pkgconfig-data): moved from Makefile.in.
-
- * tool/rbinstall.rb: install pc file only if non-empty.
- [ruby-core:32901] #3983
-
- * win32/Makefile.sub (ruby_pc): create pc file.
-
-Tue Oct 26 09:13:34 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_gcc_atomic_builtins): check for atomic
- builtins, all are not available in Apple derivative gcc.
-
-Tue Oct 26 00:29:26 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in (pkgconfig-data): create pkg-config metadata file.
-
- * tool/rbinstall.rb: install pkg-config metadata file.
-
- * template/ruby.pc.in: template of pkg-config metadata file.
-
-Mon Oct 25 16:38:07 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * signal.c (rb_atomic_t): GCC (of at least recent versions)
- has ubiquitous support for atomic operations. On that
- compiler a C program can issue a memory barrier using these
- dedicated instructions. According to the GCC manual they
- cargo culted this feature form the Itanium ABI so chances
- are that other compilers could also support this feature.
- But so far GCC is the only compiler that I know to have it.
- Also note that this works on non-Itanium machines.
-
-Mon Oct 25 06:21:35 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vsnprintf.c (BSD_vfprintf): prec digits fractal part should be
- appended to 0 if prec is given. [ruby-dev:42453] #3979
-
-Mon Oct 25 02:57:21 2010 Koichi Sasada <ko1@atdot.net>
-
- * common.mk (run.gdb): Quit gdb on 'make gdb' when
- no signals are received.
-
-Mon Oct 25 00:25:23 2010 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date.rb: some corrections of documentation.
-
-Sun Oct 24 17:14:00 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c, gc.c, hash.c, object.c, string.c, struct.c,
- transcode.c, variable.c, vm.c, vm_insnhelper.c, vm_method.c:
- replace calls to rb_error_frozen() with rb_check_frozen(). a
- patch from Run Paint Run Run at [ruby-core:32014]
-
- * include/ruby/intern.h (rb_check_frozen): optimize.
- [ruby-core:32878]
-
-Sun Oct 24 15:16:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit.rb (Test::Unit::Mini#run): abort if interrupted.
-
- * lib/test/unit.rb (Test::Unit::Mini#run_test_suites): show the
- result even when interrupted on the way.
-
- * lib/test/unit.rb (Test::Unit::Mini#run_test_suites): ensure
- output sync mode to be restored.
-
-Sun Oct 24 14:11:16 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm.c (vm_define_method): defined method is run with the default
- public visibility regardless the visibility context of definition.
- [ruby-core:30638]
-
-Sun Oct 24 12:08:54 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * lib/test/unit.rb: make test/unit play nicely with the rake test
- loader. [ruby-core:32864]
-
-Sun Oct 24 00:25:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/ruby/test_rubyoptions.rb (test_segv_test): follow up the
- change at r29556.
-
-Sat Oct 23 14:39:58 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb: $extmk should be true for test/runner.
-
-Sat Oct 23 10:55:37 2010 Koichi Sasada <ko1@atdot.net>
-
- * vm_dump.c (rb_vm_bugreport): fix to add bug outputs.
- - loaded script ($0)
- - loaded features ($")
- - process memory map on Linux (/proc/self/maps)
-
- * vm_dump.c (rb_vmdebug_stack_dump_raw): fix header message.
-
-Fri Oct 22 14:50:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
- assertion message must not be nil.
-
-Fri Oct 22 13:59:50 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
- treat nil case. Please run test-all before commit such change.
-
-Thu Oct 21 23:58:14 2010 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_lazy_sweep): Variable declarations should be at
- the head of block.
-
-Thu Oct 21 23:56:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (objspace_each_objects, rb_objspace_each_objects): use
- struct.
-
- * gc.c (objspace_each_objects): fix return with no value.
-
-Thu Oct 21 23:47:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (dir_initialize): remove useless intermediate variable.
-
-Thu Oct 21 16:07:20 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * io.c (rb_f_select): change rdoc.
- patched by Eito Katagiri [ruby-core:31805]
-
-Thu Oct 21 15:55:21 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/webrick/httpauth/digestauth.rb
- (WEBrick::HTTPAuth::ProxyDigestAuth#check_uri): privated.
- [ruby-dev:42344]
-
-Thu Oct 21 15:50:25 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * io.c (rb_f_select): add correct rdoc.
- patched by Dave Thomas [ruby-core:32467]
-
-Thu Oct 21 15:42:01 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/telnet.rb (Net::Telnet#close): added.
- patched by Erik Hollensbe [ruby-dev:42260] #3830
-
-Thu Oct 21 13:08:00 2010 Narihiro Nakamura <authornari@gmail.com>
-
- * gc.c (rb_objspace_each_objects): don't lazy sweep in
- rb_objspace_each_objects. [Bug #3940] [ruby-dev:42369]
-
-Thu Oct 21 00:05:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/ruby/test_io.rb (TestIO#pipe): get rid of deadlock on pipe.
- a patch from Tomoyuki Chikanaga at [ruby-dev:42435]. #3970
-
- * test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
-
-Wed Oct 20 23:54:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/dbm/dbm.c: rdoc based on a patch by mathew meta AT
- pobox.com, at [ruby-core:32853].
-
-Wed Oct 20 10:47:21 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * util.c (ruby_strtod): reject 0x1.p+0. [ruby-dev:42432] #3966
-
-Wed Oct 20 10:00:57 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vsnprintf.c (BSD_vfprintf): print floating point on "%#a".
- [ruby-dev:42431] Bug#3965
-
-Tue Oct 19 19:30:11 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vsnprintf.c (BSD_vfprintf): clear ALT flag for %a.
- [ruby-core:32841] [ruby-core:32848]
-
-Tue Oct 19 12:19:25 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vsnprintf.c (BSD_vfprintf): fix over-count of field size.
-
-Tue Oct 19 03:08:52 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vsnprintf.c (BSD_vfprintf): use HEXPREFIX flag for prefix of %a.
- [ruby-core:32841]
-
-Mon Oct 18 13:18:01 2010 Akinori MUSHA <knu@iDaemons.org>
-
- * ext/digest/digest.c (rb_digest_class_init): Define
- Digest::Class.new(). [Feature #3954]
-
-Mon Oct 18 12:58:40 2010 Tanaka Akira <akr@fsij.org>
-
- * pack.c (pack_pack): refine the document. [ruby-dev:42397]
- (pack_unpack): ditto.
-
-Mon Oct 18 10:19:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http.rb (transport_request): @socket may be nil.
- patched by Egbert Eich [ruby-core:32829]
-
-Mon Oct 18 09:57:28 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * sprintf.c (BSD_vfprintf): wrong padding around prefix and
- floating point with %a. [ruby-dev:42403] Bug #3956
-
-Sun Oct 17 22:36:33 2010 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date/delta.rb: added an rdoc tag.
-
-Sun Oct 17 10:47:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * variable.c (rb_mod_remove_const): update rdoc.
- [ruby-core:31957]
-
-Sun Oct 17 10:40:17 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * class.c (rb_define_{class,module}_id_under): register to be
- marked, which probably are defined and used internally.
-
-Sat Oct 16 11:10:55 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_encoding2cp): set codepage 20936
- according to GB2312. [Bug #3937] [ruby-core:32758]
-
-Sat Oct 16 10:54:57 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in (CPP): already used in .c.i rule.
-
- * cygwin/GNUmakefile.in (DLLWRAP, WINDRES): add --driver-name and
- --preprocessor options explicitly. [ruby-core:32776]
-
-Sat Oct 16 10:06:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/sdbm/_sdbm.c (SEEDUPS, BADMESS): make settable using command
- line options.
-
- * ext/sdbm/_sdbm.c (makroom): suppress unused result warning.
-
- * ext/sdbm/extconf.rb: disable BADMESS, a library should not emit
- messages directly.
-
-Sat Oct 16 08:39:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dln.c (dln_strerror): get English message first, instead of
- system default. see [ruby-dev:42358].
-
-Sat Oct 16 00:08:00 2010 Koichi Sasada <ko1@atdot.net>
-
- * hash.c (rb_hash_aref): skip calling "default" method
- if it is not needed, for speed-up.
-
-Fri Oct 15 23:36:25 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (NUM2DEVT, DEVT2NUM, PRI_DEVT_PREFIX): fallback to
- unsigned int.
-
-Fri Oct 15 22:54:46 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_hresult2msg): get English message first,
- instead of system default. [ruby-core:32765]
-
-Fri Oct 15 22:47:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (VALUE): prefer long over uintptr_t,
- FIX2LONG expects VALUE to be long at least.
-
- * include/ruby/ruby.h (FIX2LONG): parenthesize the argument.
-
-Fri Oct 15 20:30:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (dev_t): use RUBY_REPLACE_TYPE.
-
- * file.c (rb_stat_inspect): use PRI_DEVT_PREFIX.
-
-Fri Oct 15 17:26:57 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * pack.c (pack_pack): simplify comparison of explicit_endian
- as pointed by nobu.
-
- * pack.c (pack_unpack): ditto.
-
-Fri Oct 15 16:40:37 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * pack.c (pack_pack): fix more than one modifiers appear in the
- format string. [ruby-core:32793]
-
- * pack.c (pack_unpack): ditto.
-
-Thu Oct 14 23:20:42 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * test/win32ole/test_folderitem2_invokeverb.rb: refactoring.
-
-Thu Oct 14 22:18:29 2010 Koichi Sasada <ko1@atdot.net>
-
- * insns.def, iseq.c, vm_insnhelper.c: rename variable name
- (ip -> iseq).
-
-Thu Oct 14 20:41:27 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * pack.c (pack_pack): support endian modifiers: < and >.
- [ruby-dev:42376] Feature #3491
-
- * pack.c (pack_unpack): ditto.
-
-Thu Oct 14 20:50:51 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (reg_get_val): expand environment in
- the pathname. [Bug #3907]
-
-Thu Oct 14 07:35:07 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * file.c (DEVT2NUM): added. Size of dev_t is depend on the
- environment even if POSIX defines dev_t as unsigned integer.
- For example, OpenVMS, 64bit Solaris 9, and NetBSD 6 defines
- dev_t as 64bit unsigned integer.
-
- * file.c (rb_stat_dev): use DEVT2NUM.
-
- * file.c (rb_stat_dev_major): dev_t is not long. major(3)'s return
- value is int.
-
- * file.c (rb_stat_dev_minor): dev_t is not long. minor(3)'s return
- value is int.
-
- * configure.in: check size of dev_t.
-
-Thu Oct 14 07:22:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (rb_ary_and, rb_ary_or), class.c (rb_mod_init_copy),
- gc.c (undefine_final), time.c (time_mload): get rid of
- type-punning casts.
-
-Thu Oct 14 04:16:41 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * numeric.c (ruby_float_step): fix Numeric#step with infinity unit
- doesn't works well. [ruby-core:32779]
-
-Wed Oct 13 23:16:46 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/enc-unicode.rb: get rid of lots of warnings.
-
- * iseq.c (insn_operand_intern, rb_iseq_disasm): fix format specifiers.
-
- * vm.c (thread_free): ditto.
-
- * numeric.c (check_uint): get rid of overflow on LLP64 platforms.
-
- * insns.def (opt_case_dispatch): use st_data_t.
-
-Wed Oct 13 22:32:34 2010 Takeyuki FUJIOKA <xibbar@ruby-lang.org>
-
- * lib/cgi/util.rb (CGI::unescape): bugfix to unescape the multibyte
- string. Thanks nobu and tDiary dev members. [Bug #3909]
-
-Wed Oct 13 21:13:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * numeric.c (int_chr): raise error when the value is negative.
-
-Wed Oct 13 19:24:08 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * vm.c (ruby_vm_destruct): This function type was wrong; correct to the prototype.
-
-Wed Oct 13 14:58:09 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * numeric.c (rb_num_to_uint): fix 32bit logic.
-
-Wed Oct 13 12:53:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * numeric.c (rb_num_to_uint): added to check the range of arguments.
- Mainly for negative value with NUM2UINT on 32bit environment.
-
- * string.c (rb_str_concat): use rb_num_to_uint.
-
-Wed Oct 13 12:10:02 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * thread_win32.c (w32_error): get English message first, instead
- of system default. see [ruby-core:32765].
- [experimental]
-
-Wed Oct 13 11:04:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * debug.c (ruby_set_debug_option): define always for binary
- compatibility with debug env enabled binary.
-
- * signal.c (ruby_enable_coredump): ditto.
-
-Wed Oct 13 10:52:51 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (ruby_executable_node): missing prototype.
-
-Wed Oct 13 05:23:04 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * missing/strchr.c: add strlen's prototype.
-
- * missing/strstr.c: ditto.
-
-Wed Oct 13 00:21:17 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/syck/rubyext.c (struct mktime_arg): constified.
-
- * ext/syck/rubyext.c (mktime_do, mktime_r, rb_syck_mktime): fix
- function signatures.
-
-Wed Oct 13 00:18:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * st.c (MurmurMagic): get rid of literal overflow.
-
- * configure.in (RUBY_CHECK_PRINTF_PREFIX): check for printf format
- specifier if possible.
-
-Tue Oct 12 23:58:19 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (rb_w32_open_osfhandle, rb_w32_wopen, rb_w32_pipe):
- use uintptr_t instead of long for win64.
-
- * win32/win32.c (socketpair_internal): suppress warnings.
-
- * win32/win32.c (ftruncate): use HANDLE instead of long for win64.
-
- * vsnprintf.c (BSD_vfprintf): fix cast.
-
- * numeric.c (rb_num2fix): result of rb_num2long is SIGNED_VALUE.
-
- * compile.c (iseq_build_body), error.c (set_syserr, get_syserr),
- (syserr_initialize), gc.c (define_final, rb_gc_copy_finalizer),
- (run_final), hash.c (rb_hash_aref, rb_hash_lookup2),
- (rb_hash_fetch_m, rb_hash_clear, rb_hash_aset, eql_i),
- iseq.c (iseq_load, iseq_data_to_ary), marshal.c (r_symlink),
- thread.c (rb_thread_local_aref),
- variable.c (generic_ivar_remove, ivar_get, rb_const_get_0),
- (rb_cvar_get), vm.c (rb_vm_check_redefinition_opt_method),
- vm_insnhelper.c (vm_get_ev_const), vm_method.c (remove_method),
- ext/iconv/iconv.c (map_charset): use st_data_t.
-
- * compile.c (iseq_build_body), insns.def (getglobal, setglobal),
- iseq.c (iseq_load, iseq_data_to_ary), util.c (valid_filename):
- use VALUE.
-
- * gc.c (obj_free, rb_objspace_call_finalizer): fix truncating
- cast.
-
- * gc.c (mark_current_machine_context): suppress warnings.
-
- * compile.c (iseq_compile_each): fix truncating cast.
-
- * cont.c (fiber_setcontext): missing variable definition.
-
-Tue Oct 12 19:25:13 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * error.c (exc_to_s): use OBJ_INFECT.
-
- * error.c (name_err_to_s): ditto.
-
- * error.c (name_err_mesg_to_str): ditto.
-
- * error.c (syserr_initialize): ditto.
-
-Tue Oct 12 19:07:55 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * error.c (syserr_initialize): taint message if mesg is given
- and it is tainted.
-
-Tue Oct 12 18:25:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * io.c (rb_io_ungetc): always see Bignum. On 32bit valid value
- may be a Bignum. On 64bit for errors. [ruby-dev:42366]
-
-Tue Oct 12 18:25:04 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (rb_str_concat): use unsigned int for GB18030.
-
-Tue Oct 12 17:53:49 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * numeric (check_uint): the mask must refer to VALUE.
-
-Tue Oct 12 17:47:10 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * numeric (check_uint): set MSB for negative value.
-
- * numeric (rb_num2uint): return value's type of rb_num2ulong
- is VALUE.
-
- * numeric (int_chr): variable i can't be negative.
-
-Tue Oct 12 16:04:37 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_strerror): get English message first, instead
- of system default. see [ruby-dev:42358].
- [experimental]
-
-Tue Oct 12 15:52:35 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_strerror): unmap some range of errno for
- workaround of VC10's strerror() and sys_nerr problem.
- based on a patch from Akio Tajima, [ruby-dev:42355].
-
-Tue Oct 12 15:36:09 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * io.c (rb_io_ungetc): use unsigned int for GB18030.
-
-Tue Oct 12 15:14:21 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * io.c (rb_io_putc): support multibyte characters.
- [ruby-core:30697]
-
-Tue Oct 12 15:10:31 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * numeric.c (rb_enc_uint_chr): split from int_chr.
-
- * numeric.c (int_chr): use rb_enc_uint_chr.
-
- * include/ruby/encoding.h (rb_enc_uint_chr): added.
-
-Tue Oct 12 14:04:41 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * numeric.c (int_chr): a codepoint of Ruby M17N must be 32bit
- unsigned int; GB18030 uses MSB. Also note that OnigCodePoint
- is defined as unsigned int.
-
-Tue Oct 12 12:20:54 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * vm_dump.c (dump_thread): foolish mistake.
-
-Tue Oct 12 10:39:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (RUBY_MINGW32): canonicalize only on mingw.
-
-Mon Oct 11 20:20:23 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http.rb (HTTP.get): specify ASCII-8BIT as the result
- encoding of Zlib::GzipReader.
- http://hibari.2ch.net/test/read.cgi/tech/1281473294/271
-
-Mon Oct 11 17:42:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * error.c (syserr_initialize): use mesg's encoding when locale
- encoding is US-ASCII. If locale encoding is not US-ASCII,
- assume err has non ASCII characters. [ruby-dev:42358]
-
-Mon Oct 11 14:03:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * error.c (syserr_initialize): set the encoding of Errno::*#message
- as locale. [ruby-dev:42358]
-
-Mon Oct 11 06:38:27 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_set_encoding):
- StringIO#set_encoding can get 2nd argument and optional hash
- for API compatibility to IO. [ruby-dev:42356]
-
-Mon Oct 11 06:11:30 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * io.c (rb_io_set_encoding): use rb_funcall2 when the io is not
- a T_FILE. [ruby-dev:42356]
-
-Sun Oct 10 18:42:23 2010 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/set.rb (Set#replace): Apply a bit of optimization.
-
-Sun Oct 10 10:20:07 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (RUBY_MINGW32): canonicalize as like mswin version.
-
-Sun Oct 10 05:33:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_core.h (rb_signal_buff_size, rb_signal_exec): moved
- declarations from thread.c.
-
-Sat Oct 9 16:54:28 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (RSHIFT): quote to get rid of argument expansion
- for autoconf 2.68.
-
-Sat Oct 9 11:00:06 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread.c (thread_reset_event_flags, exec_event_hooks): ignore
- hooks marked as removed.
-
- * thread.c (thread_exec_event_hooks): remove hooks to be removed.
-
- * thread.c (rb_threadptr_remove_event_hook, rb_remove_event_hook):
- defer removing hooks if running the hooks. [ruby-dev:42350]
-
-Sat Oct 9 10:51:00 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread.c (rb_threadptr_exec_event_hooks): suppress each event
- hooks separately.
-
- * thread.c (thread_suppress_tracing): split from
- ruby_suppress_tracing, accepting thread pointer and event mask.
-
-Sat Oct 9 08:16:01 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread.c (rb_threadptr_remove_event_hook): fix typo.
-
-Fri Oct 8 10:52:25 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (RBCONFIG): depends on version.h due to
- RUBY_PATCHLEVEL. [ruby-core:32709]
-
-Fri Oct 8 00:24:54 2010 James Edward Gray II <jeg2@ruby-lang.org>
-
- * lib/csv.rb: Fixing documentation typos. [ruby-core:32712]
-
-Thu Oct 7 09:14:28 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vm_exec.c (vm_exec_core): Treat clang as non gcc on this
- context: It has __asm__ but doesn't works well.
-
-Wed Oct 6 12:28:22 2010 Tanaka Akira <akr@fsij.org>
-
- * lib/uri/generic.rb (URI::Generic#hostname): new method.
- (URI::Generic#hostname=): ditto.
-
- * lib/open-uri.rb: use URI#hostname
-
- * lib/net/http.rb: ditto.
-
- reported by Adam Majer. [ruby-core:32056]
-
-Wed Oct 6 11:52:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (fptr_finalize): write_mutex might have been destroyed
- already in finalization phase, as the order of finalizers is not
- guaranteed. rb_mutex_t should be used in place of Mutex object
- in the future.
-
-Tue Oct 5 22:17:02 2010 wanabe <s.wanabe@gmail.com>
-
- * win32/mkexports.rb: revert r29320 and r29402.
-
-Mon Oct 4 12:43:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (regexp): dregexp has literal string only at the head
- and successors are array. [ruby-core:32682]
-
-Mon Oct 4 10:22:21 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * random.c (rand_init): This checks the value is in 32bit or not,
- so use int32_t, not int.
-
-Mon Oct 4 09:47:39 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * random.c (rand_init): remove useless assignment.
-
- * re.c (update_char_offset): remove unused variable.
-
- * re.c (read_escaped_byte): ditto.
-
-Mon Oct 4 09:30:42 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/openssl/lib/openssl/bn.rb (Integer#to_bn): OpenSSL::BN.new
- accepts only Strings, so call Integer#to_s(16).
- 16 is for an optimization. [ruby-dev:42336]
-
-Mon Oct 4 07:57:51 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * cont.c (fiber_memsize): Return size.
- Before this change, fiber_memsize always returns 0.
-
-Mon Oct 4 07:16:55 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * enc/unicode.c (onigenc_unicode_property_name_to_ctype):
- remove useless assignment.
-
- * vm.c (vm_make_proc_from_block): ditto.
-
- * variable.c (rb_ivar_count): ditto.
-
-Mon Oct 4 06:40:24 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * Makefile.in (clean-rdoc): Don't use \ in variable expansion.
- BSD make treats it as an escape character.
-
-Mon Oct 4 00:01:53 2010 wanabe <s.wanabe@gmail.com>
-
- * tool/config.sub: revert r29320, r29324, r29347, r29354, r29365
- to automake-1.11.1. [ruby-core:32634]
-
- * win32/mkexports.rb: no longer use 'mingw64'. a patch from Luis Lavena
- at [ruby-core:32678].
-
-Sun Oct 3 20:36:37 2010 Akio Tajima (arton) <artonx@yahoo.co.jp>
-
- * test/win32ole/test_folderitem2_invokeverb.rb: Change creating
- shortcut verb to 'Link' [Bug #3339]
-
-Sun Oct 3 19:44:23 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (Makefile): get rid of duplicated ruby target when
- already there it was.
-
-Sat Oct 2 22:59:32 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * test/win32ole/test_thread.rb: add for win32ole with Thread.
-
-Fri Oct 1 17:03:00 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * test/webrick/test_httpproxy.rb (TestWEBrickHTTPProxy::test_upstream_proxy):
- My machine fails this test at this line, saying 503 service unavailable.
-
-Thu Sep 30 16:11:08 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_getenv): should return NULL if specified name
- is empty. a patch from Heesob Park at [ruby-core:32650]
-
-Thu Sep 30 15:18:23 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (command_asgn): allow command_call to be right hand side
- expression of chained assignment. [ruby-dev:42313]
-
-Thu Sep 30 10:55:38 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * hash.c (ruby_setenv): workaround for old Windows. a patch from
- Heesob Park. [ruby-core:32353]
-
-Thu Sep 30 09:29:06 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/common.rb (URI.encode_www_form): change treatment of
- undefined value in given array as latest internet draft for
- application/www-form-urlencoded.
- http://tools.ietf.org/html/draft-hoehrmann-urlencoded-01
-
-Thu Sep 30 09:34:03 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * vm_dump.c (dump_thread): fixed wrong type of return value of
- SymGetModuleBase64(). [ruby-dev:42306]
-
-Wed Sep 29 21:04:05 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * test/ruby/test_rubyoptions.rb (TestRubyOptions::test_script_from_stdin):
- As usual, PTY is not always available.
-
-Wed Sep 29 18:38:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/config.sub (x64): regularize only for pc vendor, and strip
- useless 64 suffix.
-
-Wed Sep 29 17:53:02 2010 Kenta Murata <mrkn@mrkn.jp>
-
- * ext/bigdecimal/bigdecimal.c (BIGDECIMAL_ENABLE_VPRINT):
- VPrint is usually disabled. It's only used in debugging.
-
-Wed Sep 29 17:41:34 2010 Kenta Murata <mrkn@mrkn.jp>
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_save_limit):
- return the result of a block.
-
- * test/bigdecimal/test_bigdecimal.rb (test_save_limit):
- add a test for the above change.
-
-Wed Sep 29 16:18:03 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * vm_dump.c (dump_thread): remove unused optional arguments.
-
-Wed Sep 29 13:26:30 2010 Kenta Murata <mrkn@mrkn.jp>
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_save_rounding_mode):
- return the result of a block.
-
- * test/bigdecimal/test_bigdecimal.rb (test_save_rounding_mode):
- add a test for the above change.
-
- * test/bigdecimal/test_bigdecimal.rb (test_save_exception_mode):
- add a test for the return value of BigDecimal.save_exception_mode.
-
-Wed Sep 29 12:45:30 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_div2, BigDecimal_add2,
- BigDecimal_sub2, BigDecimal_mult2, VpLimitRound): remove meaningless
- casts to get rid of compiler warnings.
-
-Wed Sep 29 12:35:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c (VPrint, VpToString): fix format.
-
-Wed Sep 29 12:31:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rdoc/known_classes.rb (RDoc::KNOWN_CLASSES): add Encoding.
-
-Tue Sep 28 20:50:23 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/config.sub (x64): regularize same as mswin.
-
-Tue Sep 28 20:06:14 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * vm_dump.c (rb_vm_bugreport): add windows support.
- based on patches from Peter Weldon at [ruby-core:32551]
-
-Mon Sep 27 23:30:34 2010 Koichi Sasada <ko1@atdot.net>
-
- * insns.def (opt_case_dispatch), vm_insnhelper.c:
- execute the procedures of "when" clauses by bytecode
- instead of st_foreach() when the object does not hit
- prepared hash. [ruby-dev:42304]
-
-Mon Sep 27 15:54:03 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * test/net/http/test_https.rb: As always, localhost is not
- guaranteed to be resolved as 127.0.0.1. But a SSL
- certificate needs a socket to listen on a specific address
- where a CN resolves to. On situations where localhost is
- not 127.0.0.1, these tests are not possible.
-
-Mon Sep 27 15:25:05 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * test/net/imap/test_imap.rb: resurrection of r29259.
- this change depends on minitest 1.7.1.
-
- * lib/test/unit/assertions.rb: ditto.
-
-Sun Sep 26 22:59:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/config.sub (x86_64-pc-mingw64): regularize.
-
-Sun Sep 26 22:21:07 2010 wanabe <s.wanabe@gmail.com>
-
- * ext/openssl/ossl_hmac.c (ossl_hmac_hexdigest, ossl_hmac_s_hexdigest),
- ext/openssl/ossl_pkey_ec.c (ossl_ec_group_set_seed),
- ext/openssl/ossl_ssl_session.c (ossl_ssl_session_to_der),
- ext/openssl/ossl_pkcs7.c (numberof): suppress warnings.
- [ruby-core:31932]
-
-Sun Sep 26 10:25:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/config.{guess,sub}: updated to automake-1.11.1.
-
-Sat Sep 25 22:48:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (LIBRUBY_DLDFLAGS): fix quoting.
-
-Sat Sep 25 10:30:37 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (LIBRUBY_DLDFLAGS): use -unexported_symbol only
- when available. http://trac.macports.org/ticket/26341
-
-Sat Sep 25 10:05:49 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * configure.in: Always add -mieee for Renesas SH4.
- Thanks, Nobuhiro Iwamatsu. [Feature #3874] [ruby-core:32548]
-
-Sat Sep 25 01:34:41 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in (install-cross): target to install cross-compiling
- stuff.
-
-Fri Sep 24 23:44:59 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (sym_call), vm.c (invoke_block_from_c),
- vm_insnhelper.c (vm_yield_with_cfunc): pass given block.
- [ruby-core:32075]
-
- * vm_eval.c (rb_funcall_passing_block): new function to call
- method with passing given block.
-
-Fri Sep 24 15:50:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (rb_str_to_i): fix rdoc: String#to_i raises an
- exception when base is invalid. [ruby-core:31685]
-
-Fri Sep 24 15:28:35 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (rb_str_rindex): use rb_enc_prev_char instead of repeated str_nth.
- patched by Michael Selig [ruby-core:32498]
-
-Fri Sep 24 14:19:12 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * test/test_pty.rb: Same as 229281; existence of PTY class do not
- guarantee a successful pty operation.
-
-Fri Sep 24 06:25:55 2010 Ryan Davis <ryand-ruby@zenspider.com>
-
- * lib/minitest/*.rb: Imported minitest 1.7.2 r5879.
- * test/minitest/*.rb: ditto.
-
-Thu Sep 23 23:09:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_insnhelper.c (vm_get_cref0): cref is stacked only in normal
- iseqs, so check if it is the case first.
-
-Thu Sep 23 23:08:41 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/config.sub: mingw64 should use x86_64. [ruby-core:32514]
-
-Thu Sep 23 21:40:40 2010 wanabe <s.wanabe@gmail.com>
-
- * ext/socket/raddrinfo.c (init_addrinfo, inspect_sockaddr): suppress
- warnings. see [ruby-core:31932].
-
-Thu Sep 23 19:27:57 2010 wanabe <s.wanabe@gmail.com>
-
- * thread_win32.c (w32_wait_events, w32_close_handle): suppress warnings.
- see [ruby-core:31932].
-
-Thu Sep 23 18:54:39 2010 wanabe <s.wanabe@gmail.com>
-
- * tool/config.sub: add mingw64.
-
- * win32/mkexports.rb (Exports::Mingw64): added.
-
- * win32/mkexports.rb (Exports::Mingw32): renamed from Exports::Mingw.
-
-Thu Sep 23 09:01:28 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_insnhelper.c (vm_cref_push): no outer cref is needed for proc
- from method. Bug #3786, Bug #3860, [ruby-core:32501]
-
-Wed Sep 22 17:12:01 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * test/openssl/utils.rb (OpenSSL#silent): always restore $VERBOSE.
- [ruby-dev:42285]
-
-Wed Sep 22 16:59:40 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * test/test_prime.rb (TestPrime#test_new): the warning expected have
- not been displayed when $VERBOSE == nil. Patch by Shota Fukumori
- a.k.a. sora_h. [ruby-dev:42272]
- Recovers $stderr even if StringIO.new fails. Reported by unak.
-
-Wed Sep 22 01:55:48 2010 Koichi Sasada <ko1@atdot.net>
-
- * bootstraptest/test_method.rb: fix last commit.
-
-Wed Sep 22 01:49:52 2010 Koichi Sasada <ko1@atdot.net>
-
- * bootstraptest/test_method.rb: add a test for [ruby-core:30534].
-
-Wed Sep 22 00:52:44 2010 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * lib/rdoc/ri/store.rb (save_cache): remove duplicate entries.
-
-Wed Sep 22 00:00:05 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_f_pathname): Pathname() translated
- from pathname.rb.
-
-Tue Sep 21 22:18:30 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * tool/mkconfig.rb: fixed build problem on mswin64 introduced in r29278.
-
-Tue Sep 21 02:42:35 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * test/pathname/test_pathname.rb (TestPathname#test_mkdir): fix typo.
-
-Mon Sep 20 23:23:05 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (bracket): get rid of scanning at the end of the pattern
- string, not to raise an exception while globbing command line.
- [ruby-core:32478]
-
-Mon Sep 20 11:25:49 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (Init_pathname): Pathname#=~ undefinition
- translated from pathname.rb.
-
-Mon Sep 20 02:34:11 2010 Kenta Murata <mrkn@mrkn.jp>
-
- * ext/bigdecimal/bigdecimal.c (check_rounding_mode, BigDecimal_mode):
- raise ArgumentError instead of TypeError passing invalid modes.
-
- * test/bigdecimal/test_bigdecimal.rb (test_mode, test_round):
- change against the above modifications.
-
-Sun Sep 19 22:08:39 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * lib/mkmf.rb (try_link): rdoc
- (try_compile): ditto
- (try_cpp): ditto
- (try_func): ditto
- (try_var): ditto
- (try_run): ditto
- (egrep_cpp): ditto
-
-Sun Sep 19 20:43:33 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * configure.in (--disable-install-doc): disables capi too, in addition
- to rdoc.
- (--disable-install-rdoc): a new option for disabling only rdoc.
- (--disable-install-capi): a new option for disabling only capi.
-
-Sun Sep 19 20:37:45 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * common.mk (clean): removes all documents on cleaning.o
- (CAPIOUT): new variable.
- (clean-capi, distclean-capi, realclean-capi): new targets
-
- * Makefile.in (clean-capi, distclean-capi, realclean-capi): ditto.
-
- * win32/Makefile.sub (clean-capi, distclean-capi, realclean-capi):
- ditto.
-
-Sun Sep 19 13:44:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (LIBRUBY_SO): fix an oversight of replace
- RUBY_INSTALL_NAME with RUBY_SO_NAME. a patch from Jeremy Evans
- at [ruby-core:32474].
-
-Sun Sep 19 07:48:20 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_unlink): Pathname#unlink and
- Pathname#delete translated from pathname.rb.
-
-Sun Sep 19 06:06:07 2010 Kenta Murata <mrkn@mrkn.jp>
-
- * ext/bigdecimal/bigdecimal.c (check_rounding_mode): added for
- converting symbol to rounding mode number.
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_mode, BigDecimal_round):
- support to specify rounding mode by symbol.
-
- * test/bigdecimal/test_bigdecimal.rb (test_mode, test_round):
- add tests for above changes.
-
-Sun Sep 19 05:14:35 2010 Kenta Murata <mrkn@mrkn.jp>
-
- * ext/bigdecimal/bigdecimal.c: fix rounding algorithms for half-down
- and half-even. This change is based on the patch created by Matthew
- Willson, the reporter of this bug. [Bug #3803] [ruby-core:32136]
-
- * test/bigdecimal/test_bigdecimal.rb: add tests for above changes.
-
-Sat Sep 18 20:09:51 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_each_entry): Pathname#each_entry
- translated from pathname.rb.
-
-Fri Sep 17 23:44:07 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rexml/xpath_parser.rb, test/rexml/test_xpath.rb:
- add missing method availability check. [ruby-core:32447]
- Reported by Wiebe Cazemier. Thanks!!!
-
-Fri Sep 17 23:23:26 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_sax.rb: don't use thread and sleep to avoid slow test.
-
-Fri Sep 17 23:10:44 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_core.rb: enable.
-
-Fri Sep 17 22:46:02 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/: untabify.
-
-Fri Sep 17 22:29:56 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/: fix fixture data path. All REXML tests are worked.
-
-Fri Sep 17 22:15:15 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_listener.rb: remove needless codes.
-
-Fri Sep 17 22:12:23 2010 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/: import REXML tests from
- http://www.germane-software.com/repos/rexml/trunk/test/.
- Many tests are failed temporary. I'll fix them quickly. Sorry.
-
-Fri Sep 17 16:48:49 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * test/io/console/test_io_console.rb (TestIO_Console::helper):
- PTY.open is not guaranteed to work. On my machine opening a
- pty is prohibited via process control group. On those cases
- exceptions shall occur, and that doesn't mean our fault.
- Skip those tests on such situations.
-
-Fri Sep 17 08:30:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/tracer.rb: count only non-internal libraries in stack trace,
- ignoring custom_require. [ruby-core:31858]
-
-Fri Sep 17 02:18:41 2010 Akinori MUSHA <knu@iDaemons.org>
-
- * tool/mkconfig.rb: Fix build with m4 1.4.15 generating duplicate
- lines in config.status. According to nobu, the mswin32 port may
- depend on the piece of code in question, so the behavior is left
- unchanged on mswin32.
-
-Thu Sep 16 23:47:59 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_opendir): Pathname#opendir translated
- from pathname.rb.
-
-Thu Sep 16 21:40:37 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit.rb (Test::Unit::GlobOption): merged RejectOption.
-
- * test/runner.rb: utilize GlobOption.
-
-Thu Sep 16 21:31:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rdoc/ri/driver.rb (RDoc::RI::Driver.setup_options)
- (RDoc::RI::Driver.fixup_options): split from process_args.
- libraries should not parse ARGV inside, since it's a task of
- applications, not libraries.
-
-Thu Sep 16 21:02:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rdoc/ri/paths.rb (RDoc::RI::Paths.each): HOMEDIR can be nil
- if $HOME is unset.
-
-Thu Sep 16 14:50:42 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * test/ruby/test_file_exhaustive.rb (TestFileExhaustive::test_expand_path):
- ENV["HOME"] might not be set. On those cases without it an
- exception raises here, which effectively disables later
- tests on this method.
-
-Thu Sep 16 08:30:28 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): fix rdoc. pointed out by Tomoyuki
- Chikanaga at [ruby-core:32395], and a patch from Daniel
- Bovensiepen at [ruby-core:32403].
-
-Thu Sep 16 08:27:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/etc/extconf.rb: use expanded sysconfdir with empty DESTDIR.
- [ruby-core:32394]
-
-Thu Sep 16 06:07:24 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_rmdir): Pathname#rmdir translated
- from pathname.rb.
-
-Thu Sep 16 00:36:25 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/readline/extconf.rb: Remove Readline 6 check because
- Ruby's license is now GPLv3 compatible. [ruby-core:28736]
-
-Thu Sep 16 00:26:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * COPYING: change Ruby's License from a dual license with GPLv2
- to a dual license with 2-clause BSDL.
- [ruby-dev:42166] [ruby-core:31971]
- [ruby-dev:39167] [ruby-core:25272]
-
- * COPYING.ja: ditto.
-
- * BSDL: added. this is from The FreeBSD License.
-
-Wed Sep 15 21:07:06 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_mkdir): Pathname#mkdir translated
- from pathname.rb.
-
-Wed Sep 15 13:37:00 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * test/net/imap/test_imap.rb: "localhost" not guaranteed to
- resolve to "127.0.0.1". On my machine it is "::1" instead.
- The problem is, you have to connect to the imaps server via
- the canonical name written in a server certificate, and that
- of the server.cert is "localhost". So you have to listen to
- the address of what "localhost" resolves to. I think this
- situation cannot be resolved in a handy manner because the
- test "test_imaps_post_connection_check" is actually
- expecting to connect to a server via an address other than
- the CN. On my machine several assertions won't pass because
- the test cannot connect to the server.
-
-Wed Sep 15 09:12:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_puts): fix for wide char encoding strings.
- [ruby-dev:42212]
-
-Wed Sep 15 07:27:52 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_format_m): mentioned about Hash argument. a patch
- from Daniel Bovensiepen at [ruby-core:32386].
-
- * sprintf.c (get_hash): ditto, and fix typo.
-
-Wed Sep 15 07:22:20 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_entries): Pathname#entries translated
- from pathname.rb.
-
-Wed Sep 15 02:13:44 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/fiddle/closure.c : Don't use FFI closure alloc on OpenBSD.
- Thanks Jeremy Evans! [ruby-core:32384]
-
-Tue Sep 14 20:17:48 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_s_getwd): Pathname.getwd and
- Pathname.pwd translated from pathname.rb.
-
-Tue Sep 14 05:13:04 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_s_glob): Pathname.glob translated
- from pathname.rb.
-
-Tue Sep 14 01:24:51 2010 Yutaka Kanemoto <kanemoto@ruby-lang.org>
-
- * ext/socket/raddrinfo.c (ruby_getaddrinfo__aix): suppress a
- warning.
-
-Mon Sep 13 20:48:30 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_zero_p): Pathname#zero? translated
- from pathname.rb.
-
-Mon Sep 13 19:56:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/rubysocket.h (__DARWIN_ALIGNBYTES): workaround of a
- bug in system header of darwin 9. [ruby-core:32341]
-
-Mon Sep 13 18:11:55 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (try_do): fix typo. a patch from Peter Weldon
- at [ruby-core:32327].
-
-Mon Sep 13 10:12:09 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * util.c (ruby_strtod): reject Float('0x0.').
- [ruby-dev:42239] Bug #3820
-
-Mon Sep 13 09:23:58 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/openssl/ossl_bn.c (ossl_bn_is_prime): fix comparison
- with rb_scan_args. Before this fix, OpenSSL::BN#prime?
- is fully broken. [ruby-dev:42225]
-
-Mon Sep 13 06:45:24 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_writable_real_p):
- Pathname#writable_real? translated from pathname.rb.
-
-Sun Sep 12 21:21:50 2010 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date.rb: [ruby-core:32096] Thanks Colin Bartlett.
-
-Sun Sep 12 19:30:27 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_world_writable_p):
- Pathname#world_writable? translated from pathname.rb.
-
-Sun Sep 12 09:16:06 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_writable_p): Pathname#writable?
- translated from pathname.rb.
-
-Sun Sep 12 08:36:15 2010 Tanaka Akira <akr@fsij.org>
-
- * process.c (rlimit_resource_name2int): support more limits:
- RLIMIT_MSGQUEUE, RLIMIT_NICE, RLIMIT_RTPRIO, RLIMIT_RTTIME and
- RLIMIT_SIGPENDING.
- (Init_process): ditto.
- patch by Run Paint Run Run. [ruby-core:32262]
-
-Sun Sep 12 04:27:13 2010 Tanaka Akira <akr@fsij.org>
-
- * process.c (rlimit_resource_name2int): use STRCASECMP to avoid
- ALLOCA_N.
-
-Sat Sep 11 16:47:41 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (ruby_setenv): raise if putenv and SetEnvironmentVariable
- failed, because of the restriction of the size on Windows.
- based on a patch from Peter Weldon at [ruby-core:32304]. fix:
- Bug#3812, [ruby-core:32250]
-
-Sat Sep 11 15:19:57 2010 Eric Hodel <drbrain@segment7.net>
-
- * lib/webrick/httpauth/digestauth.rb (WEBrick::Config::DigestAuth):
- Add documentation
-
- * lib/webrick/config.rb (WEBrick::Config::DigestAuth): Add
- documentation
-
-Sat Sep 11 12:32:05 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/intern.h (rb_set_kcode, rb_get_kcode): removed
- zombie prototype declarations. a patch from Eric Hodel
- at [ruby-core:32305].
-
-Sat Sep 11 06:53:12 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_symlink_p): Pathname#symlink?
- translated from pathname.rb.
-
-Fri Sep 10 23:03:43 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_sticky_p): Pathname#sticky? translated
- from pathname.rb.
-
-Fri Sep 10 19:11:13 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#continue): add
- method for generating HTTP/1.1 100 continue response if the client
- expects it, otherwise does nothing. Patch by Brian Candler.
- ref #855.
-
- * test/webrick/test_httprequest.rb: test added.
-
-Fri Sep 10 17:49:34 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * ext/openssl/lib/openssl/x509-internal.rb: removed unused local
- variable.
-
- * test/openssl/*: less warnings while test running with -w.
-
-Fri Sep 10 16:49:20 2010 Akinori MUSHA <knu@iDaemons.org>
-
- * class.c (rb_scan_args): Add support for optional keyword
- argument hash. [ruby-dev:42221] [ruby-dev:38048]
-
- * README.EXT, README.EXT.ja: Update documentation accordingly.
-
- * dir.c (dir_initialize): Make use of the new rb_scan_args()
- feature.
-
- * io.c (rb_io_s_popen, rb_scan_open_args, rb_io_initialize)
- (rb_io_s_pipe, open_key_args, io_s_foreach, io_s_readlines)
- (rb_io_s_read, rb_io_set_encoding): Ditto.
-
- * transcode.c (str_transcode, econv_args)
- (econv_primitive_convert): Ditto.
-
- * ext/zlib/zlib.c (rb_gzreader_initialize): Ditto.
-
-Fri Sep 10 10:33:18 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * random.c (rb_genrand_ulong_limited): renamed from
- rb_rand_internal and now this is public API.
-
- * include/ruby/ruby.h (rb_genrand_ulong_limited): added.
-
- * bignum.c (big_sparse_p): use rb_genrand_ulong_limited.
-
-Fri Sep 10 13:07:22 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * ext/digest/lib/digest.rb: removed unused exception variable
- assignment to avoid a warning.
-
-Fri Sep 10 07:29:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/etc/etc.c (etc_systmpdir): assume system default tmpdir
- safe. [ruby-dev:42089]
-
-Fri Sep 10 07:03:23 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_size_p): Pathname#size? translated from
- pathname.rb.
-
-Fri Sep 10 02:15:29 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/option.c (inspect_peercred): support OpenBSD-current.
- patch by Jeremy Evans. [ruby-core:32240]
-
-Thu Sep 9 23:25:53 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm.c (vm_backtrace_each): skip allocator frames which have no
- name. [ruby-core:32231]
-
-Thu Sep 9 22:39:08 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_size): Pathname#size translated from
- pathname.rb.
-
-Thu Sep 9 22:34:48 2010 wanabe <s.wanabe@gmail.com>
-
- * compile.c (case_when_optimizable_literal): When float value can be
- treated as integer, add to table hash of case that way.
- based on a patch from Ikuo KOBORI. [ruby-dev:42038]
-
- * insns.def (opt_case_dispatch): ditto.
-
- * test/ruby/test_case.rb: add tests.
-
-Thu Sep 9 17:15:15 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/net/http/test_https.rb (test_identity_verify_failure): follows
- the SSL hostname check error message of openssl.
-
-Thu Sep 9 10:44:46 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * test/ruby/test_env.rb (test_aset): OpenBSD acts like NetBSD in
- that it ignores characters after = in ENV.
- patched by Jeremy Evans [ruby-core:32184]
-
-Thu Sep 9 09:02:01 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/rbinstall.rb (install?): gemspec filename should include
- its version. patched by Luis Lavena [ruby-core:32165]
-
-Wed Sep 8 22:46:31 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * ext/openssl/ossl_ssl.c (ssl_get_error): Thread context switch was
- blocked on Windows while blocking call for SSLSocket. Need to
- convert errno for letting rb_io_wait_readable detect EWOULDBLOCK.
- Patch by arton. ref #3794.
-
-Wed Sep 8 20:56:57 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_setgid_p): Pathname#setgid? translated
- from pathname.rb.
-
-Wed Sep 8 06:25:41 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_setuid_p): Pathname#setuid? translated
- from pathname.rb.
-
-Tue Sep 7 21:03:35 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_readable_real_p):
- Pathname#readable_real? translated from pathname.rb.
-
-Mon Sep 6 23:07:25 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_world_readable_p):
- Pathname#world_readable? translated from pathname.rb.
-
-Mon Sep 6 11:03:13 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * Fixed wrong check of missing functions. Patch by Adrian Quark.
- ref #3400
- The patch contains following comment:
- This patch should avoid unnecessary incompatibility with future
- versions of Openssl. Changes suggested by bmaher_at_amazon.com.
-
-Mon Sep 6 10:46:55 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * Fixed exception message for SSL post connection check failure. Patch
- by Paul Betteridge. ref [Bug #3704]
-
-Mon Sep 6 10:31:59 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/readline/readline.c (readline_s_get_line_buffer):
- Readline.line_buffer should return locale string.
- [ruby-dev:42184] #3791
-
-Mon Sep 6 09:47:24 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * util.c (ruby_strtod): check there is at least 1 digit after
- "0x" before ".". [ruby-dev:42183] #3790
-
-Mon Sep 6 09:44:50 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * util.c (ruby_strtod): check integer overflow.
- [ruby-dev:42180] #3789
-
-Mon Sep 6 06:17:21 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_readable_p): Pathname#readable?
- translated from pathname.rb.
-
-Sun Sep 5 23:02:34 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_owned_p): Pathname#owned?
- translated from pathname.rb.
-
-Sat Sep 4 23:48:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_file_s_readlink): symlink target should be in
- filesystem encoding.
-
-Sat Sep 4 10:40:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * load.c (ruby_init_ext): export for golfers.
-
- * vm_core.h (rb_iseq_eval, rb_iseq_compile_with_option): ditto.
-
-Sun May 23 17:29:41 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * common.mk (capi): uses a timestamp file to get rid of
- generating twice.
-
-Fri Jun 18 01:33:21 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-
- * enc/Makefile.in (realclean): has been missing. necessary
- for make realclean-enc.
-
-Fri Sep 3 23:51:26 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_socket_p): Pathname#socket?
- translated from pathname.rb.
-
-Fri Sep 3 06:40:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/pty/pty.c (chfunc): pass through exceptions.
-
- * io.c (rb_io_bufwrite, rb_io_bufread): added.
-
- * process.c (rb_fork_err): protect from exceptions.
-
-Fri Sep 3 06:16:07 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_pipe_p): Pathname#pipe?
- translated from pathname.rb.
-
-Fri Sep 3 06:14:40 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/pty/pty.c (chfunc): restore errno from SystemCallError and
- propagate proper exception to the parent. [ruby-dev:41965]
-
-Thu Sep 2 22:10:38 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_file_p): Pathname#file?
- translated from pathname.rb.
-
-Thu Sep 2 09:12:02 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_spawn, rb_w32_aspawn): don't forget to free
- memory.
-
-Thu Sep 2 09:01:13 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (CreateChild): unicodize.
-
- * win32/win32.c (rb_w32_spawn, rb_w32_aspawn): convert arguments of
- CreateChild() from ACP to WideChar.
-
-Thu Sep 2 06:53:43 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_directory_p): Pathname#directory?
- translated from pathname.rb.
-
-Wed Sep 1 22:03:41 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_grpowned_p): Pathname#grpowned?
- translated from pathname.rb.
-
-Wed Sep 1 17:39:02 2010 Ryan Davis <ryand-ruby@zenspider.com>
-
- * lib/minitest/*.rb: Imported minitest 1.7.1 r5835.
- * test/minitest/*.rb: ditto.
-
-Wed Sep 1 16:50:42 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (tr_setup_table): optimized. don't create hash objects
- when given pattern is ASCII only.
-
- * string.c (tr_find): ditto.
-
-Wed Sep 1 14:35:29 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * array.c (rb_ary_rotate_m): fix typo of rdoc.
- patched by Andrei Kulakov [ruby-core:31975]
-
-Wed Sep 1 14:33:36 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * enum.c (enum_zip): fix typo of rdoc.
- patched by Andrei Kulakov [ruby-core:31974]
-
-Wed Sep 1 12:56:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread.c (ruby_suppress_tracing): restore the state and invoke
- the func with normal state. a patch from Satoshi Shiba <shiba
- AT rvm.jp> at [ruby-dev:42162]. [ruby-core:31783]
-
-Tue Aug 31 21:10:23 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_exist_p): Pathname#exist? translated
- from pathname.rb.
-
-Tue Aug 31 17:32:34 2010 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/stubs.c: fix [Bug #3771] "VC++ can't make ext/tk with enabling
- stubs". Thanks, Akio Tajima [ruby-dev:42159].
-
-Tue Aug 31 03:42:14 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (tr_setup_table): fix bug in r29146.
- Initialize table even if cflag is 0; tr_find see whether
- del is empty or not.
-
- * string.c (tr_find): nodel can't be NULL; if NULL, it means
- it is not specified.
-
-Mon Aug 30 21:29:21 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_executable_real_p):
- Pathname#executable_real? translated from pathname.rb.
-
-Mon Aug 30 15:00:13 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (tr_setup_table): initialize negating table when
- negating string is given. [ruby-core:31851]
-
- * string.c (tr_find): add a sentence for the time when
- target characters include negating one.
-
- * string.c (rb_str_count): move definition.
-
-Mon Aug 30 07:32:41 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_executable_p): Pathname#executable?
- translated from pathname.rb.
-
-Sun Aug 29 23:54:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rdoc/parser/ruby.rb (RDoc#parse_call_parameters): don't
- include assignment. [Bug #3759], [ruby-dev:42154]
-
- * lib/rdoc/parser/ruby.rb (RDoc#parse_class): ignore non-constant
- name singleton class. [Bug #3759], [ruby-dev:42154]
-
-Sun Aug 29 23:25:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_get_path_check): clarify error message for
- ASCII-incompatible path name.
-
-Sun Aug 29 16:02:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * common.mk (node_name.inc): remove command option -n and give
- file as stdin, because IronRuby 1.1 still doesn't support it.
- So now we can use ir.exe as BASERUBY.
-
- * tool/node_name.rb: read stdin with while gets.
-
-Sun Aug 29 13:22:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm.c (rb_thread_method_id_and_class): curried proc has no
- method. [ruby-core:31871]
-
-Sun Aug 29 12:51:33 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * load.c (rb_provide_feature): clarify error message for frozen
- $LOADED_FEATURES. based on a patch from Run Paint Run Run at
- [ruby-core:31913].
-
-Sun Aug 29 12:19:58 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * load.c (load_failed): should honor encoding. [ruby-core:31915]
-
-Sun Aug 29 09:35:10 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * common.mk (clean): exclude *.inc. [ruby-dev:41931]
-
- * common.mk (distclean): include *.inc.
-
- * common.mk (help): change description about clean and distclean.
-
-Sat Aug 29 06:34:52 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_chardev_p): Pathname#chardev?
- translated from pathname.rb.
-
-Sat Aug 28 17:39:33 2010 Kenta Murata <mrkn@mrkn.jp>
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_save_exception_mode,
- BigDecimal_save_rounding_mode, BigDecimal_save_limit): added.
-
- * test/bigdecimal/test_bigdecimal.rb: added tests for the above
- features.
-
-Sat Aug 28 08:11:05 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_blockdev_p): Pathname#blockdev?
- translated from pathname.rb.
-
-Fri Aug 27 16:20:01 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * string.c (rb_str_prepend): new method by Shota Fukumori (sora_h)
- [Feature #3765]
-
-Fri Aug 27 15:24:20 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * math.c (math_atan2): you should know that M_PI is not the feature
- of C90.
- fixed build failure caused by r29115.
-
-Fri Aug 27 15:26:33 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (null_device): move from io.c.
-
-Fri Aug 27 12:47:44 2010 Kenta Murata <mrkn@mrkn.jp>
-
- * math.c (math_atan2): change the behavior when x and y are zero.
- [ruby-dev:42090] [Bug #3736] [ruby-dev:42116]
-
- * test/ruby/test_math.rb (test_atan2): add tests for the above
- changes.
-
-Fri Aug 27 12:26:23 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * object.c (rb_obj_class): remove mention of obsolete method.
- a patch from Run Paint Run Run at [ruby-core:31842].
-
-Fri Aug 27 12:25:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (null_device): the name of null device. [ruby-dev:41791]
-
-Fri Aug 27 07:57:34 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (rb_ary_shuffle_bang): bail out from modification during
- shuffle.
-
- * array.c (rb_ary_sample): ditto.
-
-Fri Aug 27 05:11:51 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_sysopen): Pathname#sysopen translated
- from pathname.rb.
-
-Thu Aug 26 22:53:56 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (rb_ary_shuffle): rdoc fix. argument name was missing.
- a patch from Run Paint Run Run at [ruby-core:31848].
-
-Thu Aug 26 21:49:46 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_readlines): Pathname#readlines
- translated from pathname.rb.
-
-Thu Aug 26 10:37:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regint.h (OnigStackIndex): the type should be intptr_t.
- Original Oniguruma assumes the size of long and that of void *
- are equal, but it's not true on LLP64 platform: mswin64.
- originally patched by shintaro kuwamoto [ruby-dev:42133]
-
-Thu Aug 26 10:38:11 2010 Yutaka Kanemoto <kanemoto@ruby-lang.org>
-
- * test/dl/test_base.rb: AIX does not have dynamically loadable lib[cm].
-
- * test/fiddle/helper.rb: AIX does not have dynamically loadable lib[cm].
-
-Thu Aug 26 09:49:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (rb_ary_shuffle_bang): check number of argument.
-
-Tue Aug 26 09:11:40 2010 Kenta Murata <mrkn@mrkn.jp>
-
- * ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
- rmpd_set_thread_local_exception_mode, VpGetException,
- VpSetException): thread-local exception mode.
-
- * ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
- rmpd_set_thread_local_precision_limit, VpGetPrecLimit,
- VpSetPrecLimit): thread-local precision limit.
-
- * ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
- rmpd_set_thread_local_rounding_mode, VpGetRoundMode,
- VpSetRoundMode, VpException, VpInternalRound):
- thread-local rounding mode.
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_mode, BigDecimal_round,
- VpIsRoundMode, VpGetRoundMode, VpSetRoundMode, VpActiveRound,
- VpMidRound, VpLeftRound), ext/bigdecimal/bigdecimal.h:
- use unsigned short for rounding mode.
-
- * test/bigdecimal/test_bigdecimal.rb (test_mode): add test for
- setting rounding mode.
-
- * test/bigdecimal/test_bigdecimal.rb (test_thread_local_mode):
- add test for setting mode thread-locally.
-
-Thu Aug 26 07:29:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (rb_ary_{shuffle_bang,sample}): use Random class object.
-
- * random.c (try_get_rnd): use default_rand for Random as same as
- singleton methods.
-
- * random.c (rb_random_real): check the range of result.
-
-Wed Aug 25 22:11:11 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_binread): Pathname#binread translated
- from pathname.rb.
-
-Wed Aug 25 03:42:43 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/dl/cfunc.c (rb_dlcfunc_call): workaround for VC9 for x64.
- reported by kuwamoto shintaro in [ruby-dev:42125].
-
-Tue Aug 24 23:28:50 2010 Yusuke Endoh <mame@tsg.ne.jp>
-
- * .gitignore: updated.
-
-Tue Aug 24 22:07:28 2010 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_read): Pathname#read translated from
- pathname.rb.
-
-Tue Aug 24 10:11:04 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: read API version from include/ruby/version.h.
-
- * {bcc,win}32/setup.mak (-version-): ditto.
-
- * version.h (RUBY_LIB_VERSION): use API version numbers.
-
-Tue Aug 24 07:07:28 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (rb_ary_shuffle_bang, rb_ary_sample): add optional
- argument random. [ruby-dev:41923] [EXPERIMENTAL]
-
- * random.c (rb_random_{int32,real,bytes}): fallback to normal
- method invocation.
-
-Tue Aug 24 06:08:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/version.h (RUBY_API_VERSION_*): renamed and moved
- from version.h. [ruby-dev:42103]
-
-Tue Aug 24 05:58:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ChangeLog: flushed. [ruby-dev:42050]
-
-For the changes before 1.9.3, see doc/ChangeLog-1.9.3
-For the changes before 1.8.0, see doc/ChangeLog-1.8.0
-
-Local variables:
-add-log-time-format: (lambda ()
- (let* ((time (current-time))
- (system-time-locale "C")
- (diff (+ (cadr time) 32400))
- (lo (% diff 65536))
- (hi (+ (car time) (/ diff 65536))))
- (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
-indent-tabs-mode: t
-tab-width: 8
-change-log-indent-text: 2
-end:
diff --git a/GPL b/GPL
index 5b6e7c66c2..d159169d10 100644
--- a/GPL
+++ b/GPL
@@ -1,12 +1,12 @@
- GNU GENERAL PUBLIC LICENSE
- Version 2, June 1991
+ GNU GENERAL PUBLIC LICENSE
+ Version 2, June 1991
- Copyright (C) 1989, 1991 Free Software Foundation, Inc.
- 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
+ Copyright (C) 1989, 1991 Free Software Foundation, Inc.,
+ 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA
Everyone is permitted to copy and distribute verbatim copies
of this license document, but changing it is not allowed.
- Preamble
+ Preamble
The licenses for most software are designed to take away your
freedom to share and change it. By contrast, the GNU General Public
@@ -15,7 +15,7 @@ software--to make sure the software is free for all its users. This
General Public License applies to most of the Free Software
Foundation's software and to any other program whose authors commit to
using it. (Some other Free Software Foundation software is covered by
-the GNU Library General Public License instead.) You can apply it to
+the GNU Lesser General Public License instead.) You can apply it to
your programs, too.
When we speak of free software, we are referring to freedom, not
@@ -55,8 +55,8 @@ patent must be licensed for everyone's free use or not licensed at all.
The precise terms and conditions for copying, distribution and
modification follow.
-
- GNU GENERAL PUBLIC LICENSE
+
+ GNU GENERAL PUBLIC LICENSE
TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
0. This License applies to any program or other work which contains
@@ -110,7 +110,7 @@ above, provided that you also meet all of these conditions:
License. (Exception: if the Program itself is interactive but
does not normally print such an announcement, your work based on
the Program is not required to print an announcement.)
-
+
These requirements apply to the modified work as a whole. If
identifiable sections of that work are not derived from the Program,
and can be reasonably considered independent and separate works in
@@ -168,7 +168,7 @@ access to copy from a designated place, then offering equivalent
access to copy the source code from the same place counts as
distribution of the source code, even though third parties are not
compelled to copy the source along with the object code.
-
+
4. You may not copy, modify, sublicense, or distribute the Program
except as expressly provided under this License. Any attempt
otherwise to copy, modify, sublicense or distribute the Program is
@@ -225,7 +225,7 @@ impose that choice.
This section is intended to make thoroughly clear what is believed to
be a consequence of the rest of this License.
-
+
8. If the distribution and/or use of the Program is restricted in
certain countries either by patents or by copyrighted interfaces, the
original copyright holder who places the Program under this License
@@ -255,7 +255,7 @@ make exceptions for this. Our decision will be guided by the two goals
of preserving the free status of all derivatives of our free software and
of promoting the sharing and reuse of software generally.
- NO WARRANTY
+ NO WARRANTY
11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN
@@ -277,9 +277,9 @@ YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
POSSIBILITY OF SUCH DAMAGES.
- END OF TERMS AND CONDITIONS
-
- How to Apply These Terms to Your New Programs
+ END OF TERMS AND CONDITIONS
+
+ How to Apply These Terms to Your New Programs
If you develop a new program, and you want it to be of the greatest
possible use to the public, the best way to achieve this is to make it
@@ -303,10 +303,9 @@ the "copyright" line and a pointer to where the full notice is found.
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
GNU General Public License for more details.
- You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
-
+ You should have received a copy of the GNU General Public License along
+ with this program; if not, write to the Free Software Foundation, Inc.,
+ 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
Also add information on how to contact you by electronic and paper mail.
@@ -336,5 +335,5 @@ necessary. Here is a sample; alter the names:
This General Public License does not permit incorporating your program into
proprietary programs. If your program is a subroutine library, you may
consider it more useful to permit linking proprietary applications with the
-library. If this is what you want to do, use the GNU Library General
+library. If this is what you want to do, use the GNU Lesser General
Public License instead of this License.
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
index 5c0e4d5156..35a8e75876 100644
--- a/KNOWNBUGS.rb
+++ b/KNOWNBUGS.rb
@@ -1,16 +1,7 @@
#
-# This test file concludes tests which point out known bugs.
+# IMPORTANT: Always keep the first 7 lines (comments),
+# even if this file is otherwise empty.
+#
+# This test file includes tests which point out known bugs.
# So all tests will cause failure.
#
-
-assert_normal_exit %q{
- open("tst-remove-load.rb", "w") {|f|
- f << <<-'End'
- module Kernel
- remove_method :load
- end
- raise
- End
- }
- load "tst-remove-load.rb"
-}, '[ruby-dev:40234] [ruby-core:27959]', :timeout => 1
diff --git a/LEGAL b/LEGAL
index 3ddf571175..0423d57ac9 100644
--- a/LEGAL
+++ b/LEGAL
@@ -1,85 +1,331 @@
-LEGAL NOTICE INFORMATION
-------------------------
+# -*- rdoc -*-
+
+= LEGAL NOTICE INFORMATION
+--------------------------
All the files in this distribution are covered under either the Ruby's
license (see the file COPYING) or public-domain except some files
mentioned below.
-include/ruby/oniguruma.h:
-regcomp.c:
-regenc.[ch]:
-regerror.c:
-regexec.c:
-regint.h:
-regparse.[ch]:
-enc/ascii.c
-enc/big5.c
-enc/cp949.c
-enc/emacs_mule.c
-enc/encdb.c
-enc/euc_jp.c
-enc/euc_kr.c
-enc/euc_tw.c
-enc/gb18030.c
-enc/gb2312.c
-enc/gbk.c
-enc/iso_8859_1.c
-enc/iso_8859_10.c
-enc/iso_8859_11.c
-enc/iso_8859_13.c
-enc/iso_8859_14.c
-enc/iso_8859_15.c
-enc/iso_8859_16.c
-enc/iso_8859_2.c
-enc/iso_8859_3.c
-enc/iso_8859_4.c
-enc/iso_8859_5.c
-enc/iso_8859_6.c
-enc/iso_8859_7.c
-enc/iso_8859_8.c
-enc/iso_8859_9.c
-enc/koi8_r.c
-enc/koi8_u.c
-enc/shift_jis.c
-enc/unicode.c
-enc/us_ascii.c
-enc/utf_16be.c
-enc/utf_16le.c
-enc/utf_32be.c
-enc/utf_32le.c
-enc/utf_8.c
-enc/windows_1251.c
-
-Oniguruma ---- (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
-
-http://www.geocities.jp/kosako3/oniguruma/
-http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
-http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
-
- When this software is partly used or it is distributed with Ruby,
- this of Ruby follows the license of Ruby.
-
-configure:
+[addr2line.c]
+
+ A part of this file is from FreeBSD.
+
+ >>>
+ Copyright (c) 1986, 1988, 1991, 1993::
+ The Regents of the University of California. All rights reserved.
+
+ (c) UNIX System Laboratories, Inc.
+
+ All or some portions of this file are derived from material licensed
+ to the University of California by American Telephone and Telegraph
+ Co. or Unix System Laboratories, Inc. and are reproduced herein with
+ the permission of UNIX System Laboratories, Inc.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 4. Neither the name of the University nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ @(#)subr_prf.c 8.3 (Berkeley) 1/21/94
+
+
+[ccan/build_assert/build_assert.h]
+[ccan/check_type/check_type.h]
+[ccan/container_of/container_of.h]
+[ccan/str/str.h]
+
+ These files are licensed under the {CC0}[https://creativecommons.org/choose/zero/].
+
+[ccan/list/list.h]
+
+ This file is licensed under the {MIT License}[rdoc-label:label-MIT+License].
+
+[coroutine]
+
+ Unless otherwise specified, these files are licensed under the
+ {MIT License}[rdoc-label:label-MIT+License].
+
+[include/ruby/onigmo.h]
+[include/ruby/oniguruma.h]
+[regcomp.c]
+[regenc.c]
+[regenc.h]
+[regerror.c]
+[regexec.c]
+[regint.h]
+[regparse.c]
+[regparse.h]
+[enc/ascii.c]
+[enc/big5.c]
+[enc/cp949.c]
+[enc/emacs_mule.c]
+[enc/encdb.c]
+[enc/euc_jp.c]
+[enc/euc_kr.c]
+[enc/euc_tw.c]
+[enc/gb18030.c]
+[enc/gb2312.c]
+[enc/gbk.c]
+[enc/iso_8859_1.c]
+[enc/iso_8859_10.c]
+[enc/iso_8859_11.c]
+[enc/iso_8859_13.c]
+[enc/iso_8859_14.c]
+[enc/iso_8859_15.c]
+[enc/iso_8859_16.c]
+[enc/iso_8859_2.c]
+[enc/iso_8859_3.c]
+[enc/iso_8859_4.c]
+[enc/iso_8859_5.c]
+[enc/iso_8859_6.c]
+[enc/iso_8859_7.c]
+[enc/iso_8859_8.c]
+[enc/iso_8859_9.c]
+[enc/koi8_r.c]
+[enc/koi8_u.c]
+[enc/shift_jis.c]
+[enc/unicode.c]
+[enc/us_ascii.c]
+[enc/utf_16be.c]
+[enc/utf_16le.c]
+[enc/utf_32be.c]
+[enc/utf_32le.c]
+[enc/utf_8.c]
+[enc/windows_1251.c]
+[enc/windows_31j.c]
+
+ Onigmo (Oniguruma-mod) LICENSE
+
+ >>>
+ Copyright (c) 2002-2009:: K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ Copyright (c) 2011-2014:: K.Takata <kentkt AT csc DOT jp>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ Oniguruma LICENSE
+
+ >>>
+ Copyright (c) 2002-2009:: K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ * https://github.com/k-takata/Onigmo/
+ * https://github.com/kkos/oniguruma
+ * https://svnweb.freebsd.org/ports/head/devel/oniguruma/
+
+ When this software is partly used or it is distributed with Ruby,
+ this of Ruby follows the license of Ruby.
+
+[enc/windows_1250.c]
+[enc/windows_1252.c]
+
+ >>>
+ Copyright (c) 2006-2007:: Byte <byte AT mail DOT kna DOT ru>
+ K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+[enc/cesu_8.c]
+[enc/windows_1253.c]
+[enc/windows_1254.c]
+[enc/windows_1257.c]
+
+ >>>
+ Copyright (c) 2002-2007:: K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+[enc/trans/GB/GB12345%UCS.src]
+[enc/trans/GB/UCS%GB12345.src]
+[enc/trans/GB/GB2312%UCS.src]
+[enc/trans/GB/UCS%GB2312.src]
+
+ These files have this explanatory texts.
+
+ >>>
+ This mapping data was created from files provided by Unicode, Inc.
+ (The Unicode Consortium). The files were used to create a product supporting
+ Unicode, as explicitly permitted in the files' copyright notices.
+ Please note that Unicode, Inc. never made any claims as to fitness of these
+ files for any particular purpose, and has ceased to publish the files many
+ years ago.
+
+[enc/trans/JIS/JISX0201-KANA%UCS.src]
+[enc/trans/JIS/JISX0208\@1990%UCS.src]
+[enc/trans/JIS/JISX0212%UCS.src]
+[enc/trans/JIS/UCS%JISX0201-KANA.src]
+[enc/trans/JIS/UCS%JISX0208@1990.src]
+[enc/trans/JIS/UCS%JISX0212.src]
+
+ These files are copyrighted as the following.
+
+ >>>
+ © 2015 Unicode®, Inc.
+
+ For terms of use, see http://www.unicode.org/terms_of_use.html
+
+[enc/trans/JIS/JISX0213-1%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-1%UCS@SIP.src]
+[enc/trans/JIS/JISX0213-2%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-2%UCS@SIP.src]
+
+ These files are copyrighted as the following.
+
+ >>>
+ Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+ Copyright (C) 2001:: I'O, All Rights Reserved.
+ Copyright (C) 2006:: Project X0213, All Rights Reserved.
+ You can use, modify, distribute this table freely.
+
+[enc/trans/JIS/UCS@BMP%JISX0213-1.src]
+[enc/trans/JIS/UCS@BMP%JISX0213-2.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-1.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-2.src]
+
+ These files are copyrighted as the following.
+
+ >>>
+ Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+ Copyright (C) 2001:: I'O, All Rights Reserved.
+ You can use, modify, distribute this table freely.
+
+[enc/trans/ucm/glibc-BIG5-2.3.3.ucm]
+[enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm]
+
+ >>>
+ Copyright (C) 2001-2005:: International Business Machines
+ Corporation and others. All Rights Reserved.
+
+[enc/trans/ucm/windows-950-2000.ucm]
+[enc/trans/ucm/windows-950_hkscs-2001.ucm]
+
+ >>>
+ Copyright (C) 2001-2002:: International Business Machines
+ Corporation and others. All Rights Reserved.
+
+
+[configure]
This file is free software.
- Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
+ >>>
+ Copyright (C) 1992-1996, 1998-2012:: Free Software Foundation, Inc.
This configure script is free software; the Free Software Foundation
gives unlimited permission to copy, distribute and modify it.
-tool/config.guess:
-tool/config.sub:
+[tool/config.guess]
+[tool/config.sub]
As long as you distribute these files with the file configure, they
are covered under the Ruby's license.
- Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
- Free Software Foundation, Inc.
+ >>>
+ Copyright 1992-2018:: Free Software Foundation, Inc.
This file is free software; you can redistribute it and/or modify it
under the terms of the GNU General Public License as published by
- the Free Software Foundation; either version 2 of the License, or
+ the Free Software Foundation; either version 3 of the License, or
(at your option) any later version.
This program is distributed in the hope that it will be useful, but
@@ -88,54 +334,85 @@ tool/config.sub:
General Public License for more details.
You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ along with this program; if not, see <https://www.gnu.org/licenses/>.
As a special exception to the GNU General Public License, if you
distribute this file as part of a program that contains a
configuration script generated by Autoconf, you may include it under
- the same distribution terms that you use for the rest of that program.
-
-parse.c:
-
- This file is licensed under the GPL, but is incorporated into Ruby and
+ the same distribution terms that you use for the rest of that
+ program. This Exception is an additional permission under section 7
+ of the GNU General Public License, version 3 ("GPLv3").
+
+[tool/lib/test/*]
+[tool/lib/core_assertions.rb]
+
+ Some of methods on these files are based on MiniTest 4. MiniTest 4 is
+ distributed under the MIT License.
+
+ >>>
+ Copyright (c) Ryan Davis, seattle.rb
+
+ Permission is hereby granted, free of charge, to any person obtaining
+ a copy of this software and associated documentation files (the
+ 'Software'), to deal in the Software without restriction, including
+ without limitation the rights to use, copy, modify, merge, publish,
+ distribute, sublicense, and/or sell copies of the Software, and to
+ permit persons to whom the Software is furnished to do so, subject to
+ the following conditions:
+
+ The above copyright notice and this permission notice shall be
+ included in all copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND,
+ EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+ MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
+ IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
+ CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
+ TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
+ SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+[parse.c]
+[parse.h]
+
+ These files are licensed under the GPL, but are incorporated into Ruby and
redistributed under the terms of the Ruby license, as permitted by the
exception to the GPL below.
- Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
- Free Software Foundation, Inc.
+ >>>
+ Copyright (C) 1984, 1989-1990, 2000-2015, 2018:: Free Software Foundation, Inc.
- This program is free software; you can redistribute it and/or modify
- it under the terms of the GNU General Public License as published by
- the Free Software Foundation; either version 2, or (at your option)
- any later version.
+ This program is free software: you can redistribute it and/or modify
+ it under the terms of the GNU General Public License as published by
+ the Free Software Foundation, either version 3 of the License, or
+ (at your option) any later version.
- This program is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- GNU General Public License for more details.
+ This program is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ GNU General Public License for more details.
- You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 51 Franklin Street, Fifth Floor,
- Boston, MA 02110-1301, USA. */
+ You should have received a copy of the GNU General Public License
+ along with this program. If not, see <http://www.gnu.org/licenses/>.
- /* As a special exception, you may create a larger work that contains
- part or all of the Bison parser skeleton and distribute that work
- under terms of your choice, so long as that work isn't itself a
- parser generator using the skeleton or a modified version thereof
- as a parser skeleton. Alternatively, if you modify or redistribute
- the parser skeleton itself, you may (at your option) remove this
- special exception, which will cause the skeleton and the resulting
- Bison output files to be licensed under the GNU General Public
- License without this special exception.
+ As a special exception, you may create a larger work that contains
+ part or all of the Bison parser skeleton and distribute that work
+ under terms of your choice, so long as that work isn't itself a
+ parser generator using the skeleton or a modified version thereof
+ as a parser skeleton. Alternatively, if you modify or redistribute
+ the parser skeleton itself, you may (at your option) remove this
+ special exception, which will cause the skeleton and the resulting
+ Bison output files to be licensed under the GNU General Public
+ License without this special exception.
- This special exception was added by the Free Software Foundation in
- version 2.2 of Bison. */
+ This special exception was added by the Free Software Foundation in
+ version 2.2 of Bison.
-util.c (partly):
+[missing/dtoa.c]
- Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
+ This file is under these licenses.
+
+ >>>
+ Copyright (c) 1991, 2000, 2001:: by Lucent Technologies.
Permission to use, copy, modify, and distribute this software for any
purpose without fee is hereby granted, provided that this entire notice
@@ -148,72 +425,74 @@ util.c (partly):
REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
-util.c (partly):
-win32/win32.[ch]:
+ >>>
+ Copyright (c) 2004-2008:: David Schultz <das@FreeBSD.ORG>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+[win32/win32.c]
+[include/ruby/win32.h]
You can apply the Artistic License to these files. (or GPL,
alternatively)
- Copyright (c) 1993, Intergraph Corporation
+ >>>
+ Copyright (c) 1993:: Intergraph Corporation
You may distribute under the terms of either the GNU General Public
License or the Artistic License, as specified in the perl README file.
-util.c (partly):
-
- Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
-
- THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-random.c
+[missing/mt19937.c]
This file is under the new-style BSD license.
- A C-program for MT19937, with initialization improved 2002/2/10.
+ >>>
+ A C-program for MT19937, with initialization improved 2002/2/10.::
Coded by Takuji Nishimura and Makoto Matsumoto.
+
This is a faster version by taking Shawn Cokus's optimization,
Matthe Bellew's simplification, Isaku Wada's real version.
- Before using, initialize the state by using init_genrand(seed)
+ Before using, initialize the state by using init_genrand(seed)
or init_by_array(init_key, key_length).
- Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
- All rights reserved.
+ Copyright (C) 1997 - 2002:: Makoto Matsumoto and Takuji Nishimura,
+ All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
- 3. The names of its contributors may not be used to endorse or promote
- products derived from this software without specific prior written
- permission.
+ 3. The names of its contributors may not be used to endorse or promote
+ products derived from this software without specific prior written
+ permission.
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
"AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
@@ -232,36 +511,15 @@ random.c
http://www.math.keio.ac.jp/matumoto/emt.html
email: matumoto@math.keio.ac.jp
-st.[ch]:
-missing/alloca.c:
-missing/dup2.c:
-missing/finite.c:
-missing/hypot.c:
-missing/isinf.c:
-missing/isnan.c:
-missing/memcmp.c:
-missing/memmove.c:
-missing/strchr.c:
-missing/strstr.c:
-missing/strtol.c:
-ext/digest/sha1/sha1.[ch]:
+ The Wayback Machine url: http://web.archive.org/web/19990429082237/http://www.math.keio.ac.jp/matumoto/emt.html
- These files are all under public domain.
+[missing/procstat_vm.c]
-missing/erf.c:
-missing/tgamma.c:
-missing/lgamma_r.c:
-missing/crypt.c:
-missing/vsnprintf.c:
-
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
-
- Copyright (c) 1990, 1993
- The Regents of the University of California. All rights reserved.
+ This file is under the new-style BSD license.
- This code is derived from software contributed to Berkeley by
- Chris Torek.
+ >>>
+ Copyright (c) 2007:: Robert N. M. Watson
+ All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
@@ -271,14 +529,11 @@ missing/vsnprintf.c:
2. Redistributions in binary form must reproduce the above copyright
notice, this list of conditions and the following disclaimer in the
documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
@@ -287,58 +542,100 @@ missing/vsnprintf.c:
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
- IMPORTANT NOTE:
- --------------
- From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
- paragraph 3 above is now null and void.
+ $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
-missing/strlcat.c
-missing/strlcpy.c
+[vsnprintf.c]
- These files are under the new-style BSD license.
+ This file is under the {old-style BSD license}[rdoc-label:label-Old-style+BSD+license].
+
+ >>>
+ Copyright (c) 1990, 1993::
+ The Regents of the University of California. All rights reserved.
- Copyright (c) 1998 Todd C. Miller <Todd.Miller@courtesan.com>
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. The name of the author may not be used to endorse or promote products
- derived from this software without specific prior written permission.
-
- THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES,
- INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY
- AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL
- THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
- EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
- PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
- OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
- WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
- OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
- ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
-
-missing/langinfo.c
+ This code is derived from software contributed to Berkeley by
+ Chris Torek.
+
+[st.c]
+[strftime.c]
+[include/ruby/st.h]
+[missing/acosh.c]
+[missing/alloca.c]
+[missing/erf.c]
+[missing/hypot.c]
+[missing/lgamma_r.c]
+[missing/memcmp.c]
+[missing/memmove.c]
+[missing/strchr.c]
+[missing/strerror.c]
+[missing/strstr.c]
+[missing/tgamma.c]
+[ext/date/date_strftime.c]
+[ext/digest/sha1/sha1.c]
+[ext/digest/sha1/sha1.h]
+
+ These files are all under public domain.
+
+[missing/crypt.c]
+
+ This file is under the {old-style BSD license}[rdoc-label:label-Old-style+BSD+license].
+
+ >>>
+ Copyright (c) 1989, 1993::
+ The Regents of the University of California. All rights reserved.
+
+ This code is derived from software contributed to Berkeley by
+ Tom Truscott.
+
+[missing/setproctitle.c]
+
+ This file is under the {old-style BSD license}[rdoc-label:label-Old-style+BSD+license].
+
+ >>>
+ Copyright 2003:: Damien Miller
+ Copyright (c) 1983, 1995-1997:: Eric P. Allman
+ Copyright (c) 1988, 1993::
+ The Regents of the University of California. All rights reserved.
+
+[missing/strlcat.c]
+[missing/strlcpy.c]
+
+ These files are under an ISC-style license.
+
+ >>>
+ Copyright (c) 1998, 2015:: Todd C. Miller <Todd.Miller@courtesan.com>
+
+ Permission to use, copy, modify, and distribute this software for any
+ purpose with or without fee is hereby granted, provided that the above
+ copyright notice and this permission notice appear in all copies.
+
+ THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
+ WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
+ MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
+ ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
+ WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
+ ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
+ OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
+
+[missing/langinfo.c]
This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
Ruby uses a modified version. The file contains the following
author/copyright notice:
- Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
- Permission to use, copy, modify, and distribute this software
- for any purpose and without fee is hereby granted. The author
- disclaims all warranties with regard to this software.
+ >>>
+ Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11::
+ Permission to use, copy, modify, and distribute this software
+ for any purpose and without fee is hereby granted. The author
+ disclaims all warranties with regard to this software.
-ext/digest/md5/md5.[ch]:
+[ext/digest/md5/md5.c]
+[ext/digest/md5/md5.h]
These files are under the following license. Ruby uses modified
versions of them.
- Copyright (C) 1999, 2000 Aladdin Enterprises. All rights reserved.
+ >>>
+ Copyright (C) 1999, 2000:: Aladdin Enterprises. All rights reserved.
This software is provided 'as-is', without any express or implied
warranty. In no event will the authors be held liable for any damages
@@ -359,23 +656,27 @@ ext/digest/md5/md5.[ch]:
L. Peter Deutsch
ghost@aladdin.com
-ext/digest/rmd160/rmd160.[ch]:
+[ext/digest/rmd160/rmd160.c]
+[ext/digest/rmd160/rmd160.h]
These files have the following copyright information, and by the
author we are allowed to use it under the new-style BSD license.
- AUTHOR: Antoon Bosselaers, ESAT-COSIC
+ >>>
+ AUTHOR:: Antoon Bosselaers, ESAT-COSIC
(Arranged for libc by Todd C. Miller)
- DATE: 1 March 1996
+ DATE:: 1 March 1996
- Copyright (c) Katholieke Universiteit Leuven
+ Copyright (c):: Katholieke Universiteit Leuven
1996, All Rights Reserved
-ext/digest/sha2/sha2.[ch]:
+[ext/digest/sha2/sha2.c]
+[ext/digest/sha2/sha2.h]
These files are under the new-style BSD license.
- Copyright 2000 Aaron D. Gifford. All rights reserved.
+ >>>
+ Copyright 2000:: Aaron D. Gifford. All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
@@ -401,29 +702,123 @@ ext/digest/sha2/sha2.[ch]:
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
-ext/nkf/nkf-utf8/config.h:
-ext/nkf/nkf-utf8/nkf.c:
-ext/nkf/nkf-utf8/utf8tbl.c:
+[ext/json/generator/generator.c]
+
+ The file contains the following copyright notice.
+
+ >>>
+ Copyright 2001-2004:: Unicode, Inc.
+
+ Disclaimer::
+
+ This source code is provided as is by Unicode, Inc. No claims are
+ made as to fitness for any particular purpose. No warranties of any
+ kind are expressed or implied. The recipient agrees to determine
+ applicability of information provided. If this file has been
+ purchased on magnetic or optical media from Unicode, Inc., the
+ sole remedy for any claim will be exchange of defective media
+ within 90 days of receipt.
+
+ Limitations on Rights to Redistribute This Code::
+
+ Unicode, Inc. hereby grants the right to freely use the information
+ supplied in this file in the creation of products supporting the
+ Unicode Standard, and to make copies of this file in any form
+ for internal or external distribution as long as this notice
+ remains attached.
+
+[ext/nkf/nkf-utf8/config.h]
+[ext/nkf/nkf-utf8/nkf.c]
+[ext/nkf/nkf-utf8/utf8tbl.c]
These files are under the following license. So to speak, it is
copyrighted semi-public-domain software.
- Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
- Everyone is permitted to do anything on this program
- including copying, modifying, improving,
- as long as you don't try to pretend that you wrote it.
- i.e., the above copyright notice has to appear in all copies.
- Binary distribution requires original version messages.
- You don't have to ask before copying, redistribution or publishing.
- THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+ >>>
+ Copyright (C) 1987:: Fujitsu LTD. (Itaru ICHIKAWA)
+
+ Everyone is permitted to do anything on this program
+ including copying, modifying, improving,
+ as long as you don't try to pretend that you wrote it.
+ i.e., the above copyright notice has to appear in all copies.
+ Binary distribution requires original version messages.
+ You don't have to ask before copying, redistribution or publishing.
+ THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+
+[ext/psych]
+[test/psych]
+
+ The files under these directories are under the following license, except for
+ ext/psych/yaml.
+
+ >>>
+ Copyright 2009:: Aaron Patterson, et al.
+
+ Permission is hereby granted, free of charge, to any person obtaining a copy of
+ this software and associated documentation files (the 'Software'), to deal in
+ the Software without restriction, including without limitation the rights to
+ use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+ of the Software, and to permit persons to whom the Software is furnished to do
+ so, subject to the following conditions:
+
+ The above copyright notice and this permission notice shall be included in all
+ copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+ IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+ FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+ AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+ LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+ OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+ SOFTWARE.
+
+[ext/psych/yaml]
+
+ The files under this directory are under the following license.
+
+ >>>
+ Copyright (c) 2006:: Kirill Simonov
+
+ Permission is hereby granted, free of charge, to any person obtaining a copy of
+ this software and associated documentation files (the "Software"), to deal in
+ the Software without restriction, including without limitation the rights to
+ use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+ of the Software, and to permit persons to whom the Software is furnished to do
+ so, subject to the following conditions:
-ext/socket/addrinfo.h:
-ext/socket/getaddrinfo.c:
-ext/socket/getnameinfo.c:
+ The above copyright notice and this permission notice shall be included in all
+ copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+ IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+ FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+ AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+ LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+ OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+ SOFTWARE.
+
+[ext/pty/pty.c]
+
+ >>>
+ C) Copyright 1998:: by Akinori Ito.
+
+ This software may be redistributed freely for this purpose, in full
+ or in part, provided that this entire copyright notice is included
+ on any copies of this software and applications and derivations thereof.
+
+ This software is provided on an "as is" basis, without warranty of any
+ kind, either expressed or implied, as to any matter including, but not
+ limited to warranty of fitness of purpose, or merchantability, or
+ results obtained from use of this software.
+
+[ext/socket/addrinfo.h]
+[ext/socket/getaddrinfo.c]
+[ext/socket/getnameinfo.c]
These files are under the new-style BSD license.
- Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
+ >>>
+ Copyright (C) 1995, 1996, 1997, 1998, and 1999:: WIDE Project.
All rights reserved.
Redistribution and use in source and binary forms, with or without
@@ -450,17 +845,275 @@ ext/socket/getnameinfo.c:
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
-ext/win32ole/win32ole.c:
+[ext/win32ole/win32ole.c]
You can apply the Artistic License to this file. (or GPL,
alternatively)
- (c) 1995 Microsoft Corporation. All rights reserved.
+ >>>
+ (c) 1995:: Microsoft Corporation. All rights reserved.
Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
- Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
+ Other modifications Copyright (c) 1997, 1998:: by Gurusamy Sarathy
<gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
-
+
You may distribute under the terms of either the GNU General Public
License or the Artistic License, as specified in the README file
of the Perl distribution.
+
+ The Wayback Machine url: http://web.archive.org/web/19970607104352/http://www.activeware.com:80/
+
+[lib/rdoc/generator/template/darkfish/css/fonts.css]
+
+ This file is licensed under the {SIL Open Font License}[http://scripts.sil.org/OFL].
+
+[spec/mspec]
+[spec/ruby]
+
+ The files under these directories are under the following license.
+
+ >>>
+ Copyright (c) 2008:: Engine Yard, Inc. All rights reserved.
+
+ Permission is hereby granted, free of charge, to any person
+ obtaining a copy of this software and associated documentation
+ files (the "Software"), to deal in the Software without
+ restriction, including without limitation the rights to use,
+ copy, modify, merge, publish, distribute, sublicense, and/or sell
+ copies of the Software, and to permit persons to whom the
+ Software is furnished to do so, subject to the following
+ conditions:
+
+ The above copyright notice and this permission notice shall be
+ included in all copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+ EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
+ OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+ NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
+ HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
+ WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
+ FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
+ OTHER DEALINGS IN THE SOFTWARE.
+
+[lib/rubygems.rb]
+[lib/rubygems]
+[test/rubygems]
+
+ RubyGems is under the following license.
+
+ >>>
+ RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
+ Weirich and others. You can redistribute it and/or modify it under
+ either the terms of the {MIT license}[rdoc-label:label-MIT+License], or the conditions
+ below:
+
+ 1. You may make and give away verbatim copies of the source form of the
+ software without restriction, provided that you duplicate all of the
+ original copyright notices and associated disclaimers.
+
+ 2. You may modify your copy of the software in any way, provided that
+ you do at least ONE of the following:
+
+ a. place your modifications in the Public Domain or otherwise
+ make them Freely Available, such as by posting said
+ modifications to Usenet or an equivalent medium, or by allowing
+ the author to include your modifications in the software.
+
+ b. use the modified software only within your corporation or
+ organization.
+
+ c. give non-standard executables non-standard names, with
+ instructions on where to get the original software distribution.
+
+ d. make other distribution arrangements with the author.
+
+ 3. You may distribute the software in object code or executable
+ form, provided that you do at least ONE of the following:
+
+ a. distribute the executables and library files of the software,
+ together with instructions (in the manual page or equivalent)
+ on where to get the original distribution.
+
+ b. accompany the distribution with the machine-readable source of
+ the software.
+
+ c. give non-standard executables non-standard names, with
+ instructions on where to get the original software distribution.
+
+ d. make other distribution arrangements with the author.
+
+ 4. You may modify and include the part of the software into any other
+ software (possibly commercial).
+
+ 5. The scripts and library files supplied as input to or produced as
+ output from the software do not automatically fall under the
+ copyright of the software, but belong to whomever generated them,
+ and may be sold commercially, and may be aggregated with this
+ software.
+
+ 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+ IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+ WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ PURPOSE.
+
+[lib/bundler]
+[lib/bundler.rb]
+[spec/bundler]
+
+ Bundler is under the following license.
+
+ >>>
+ Portions copyright (c) 2010:: Andre Arko
+ Portions copyright (c) 2009:: Engine Yard
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/bundler/vendor/thor]
+
+ Thor is under the following license.
+
+ >>>
+ Copyright (c) 2008 Yehuda Katz, Eric Hodel, et al.
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/rubygems/resolver/molinillo]
+
+ molinillo is under the following license.
+
+ >>>
+ Copyright (c) 2014 Samuel E. Giddins segiddins@segiddins.me
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/bundler/vendor/pub_grub]
+
+ pub_grub is under the following license.
+
+ >>>
+ Copyright (c) 2018 John Hawthorn
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/bundler/vendor/connection_pool]
+
+ connection_pool is under the following license.
+
+ >>>
+ Copyright (c) 2011 Mike Perham
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/bundler/vendor/net-http-persistent]
+
+ net-http-persistent is under the following license.
+
+ >>>
+ Copyright (c) Eric Hodel, Aaron Patterson
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/did_you_mean]
+[lib/did_you_mean.rb]
+[test/did_you_mean]
+
+ did_you_mean is under the following license.
+
+ >>>
+ Copyright (c) 2014-2016 Yuki Nishijima
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/error_highlight]
+[lib/error_highlight.rb]
+[test/error_highlight]
+
+ error_highlight is under the following license.
+
+ >>>
+ Copyright (c) 2021 Yusuke Endoh
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[benchmark/so_ackermann.rb]
+[benchmark/so_array.rb]
+[benchmark/so_binary_trees.rb]
+[benchmark/so_concatenate.rb]
+[benchmark/so_count_words.yml]
+[benchmark/so_exception.rb]
+[benchmark/so_fannkuch.rb]
+[benchmark/so_fasta.rb]
+[benchmark/so_k_nucleotide.yml]
+[benchmark/so_lists.rb]
+[benchmark/so_mandelbrot.rb]
+[benchmark/so_matrix.rb]
+[benchmark/so_meteor_contest.rb]
+[benchmark/so_nbody.rb]
+[benchmark/so_nested_loop.rb]
+[benchmark/so_nsieve.rb]
+[benchmark/so_nsieve_bits.rb]
+[benchmark/so_object.rb]
+[benchmark/so_partial_sums.rb]
+[benchmark/so_pidigits.rb]
+[benchmark/so_random.rb]
+[benchmark/so_reverse_complement.yml]
+[benchmark/so_sieve.rb]
+[benchmark/so_spectralnorm.rb]
+
+ These files are very old copy of then-called "The Great Computer Language
+ Shootout". LEGAL SITUATION OF THESE FILES ARE UNCLEAR because the original
+ site has been lost. Upstream diverged to delete several benchmarks listed
+ above.
+
+== MIT License
+>>>
+ Permission is hereby granted, free of charge, to any person obtaining
+ a copy of this software and associated documentation files (the
+ "Software"), to deal in the Software without restriction, including
+ without limitation the rights to use, copy, modify, merge, publish,
+ distribute, sublicense, and/or sell copies of the Software, and to
+ permit persons to whom the Software is furnished to do so, subject to
+ the following conditions:
+
+ The above copyright notice and this permission notice shall be
+ included in all copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+ EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+ MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+ NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
+ LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
+ OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
+ WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+== Old-style BSD license
+>>>
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. Neither the name of the University nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ IMPORTANT NOTE::
+
+ From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+ paragraph 3 above is now null and void.
diff --git a/Makefile.in b/Makefile.in
deleted file mode 100644
index 91cac5ba78..0000000000
--- a/Makefile.in
+++ /dev/null
@@ -1,381 +0,0 @@
-SHELL = /bin/sh
-NULLCMD = :
-RUNCMD = $(SHELL)
-CHDIR = @CHDIR@
-exec = exec
-
-#### Start of system configuration section. ####
-
-srcdir = @srcdir@
-top_srcdir = $(srcdir)
-hdrdir = $(srcdir)/include
-
-CC = @CC@
-CPP = @CPP@
-YACC = bison
-PURIFY =
-AUTOCONF = autoconf
-@SET_MAKE@
-MKFILES = @MAKEFILES@
-BASERUBY = @BASERUBY@
-TEST_RUNNABLE = @TEST_RUNNABLE@
-DOXYGEN = @DOXYGEN@
-
-prefix = @prefix@
-exec_prefix = @exec_prefix@
-bindir = @bindir@
-sbindir = @sbindir@
-libdir = @libdir@
-libexecdir = @libexecdir@
-datarootdir = @datarootdir@
-datadir = @datadir@
-arch = @arch@
-sitearch = @sitearch@
-sitedir = @sitedir@
-ruby_version = @ruby_version@
-
-TESTUI = console
-TESTS =
-INSTALLDOC = @INSTALLDOC@
-DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
-
-EXTOUT = @EXTOUT@
-arch_hdrdir = $(EXTOUT)/include/$(arch)
-VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/enc:$(srcdir)/missing
-
-empty =
-OUTFLAG = @OUTFLAG@$(empty)
-COUTFLAG = @COUTFLAG@$(empty)
-ARCH_FLAG = @ARCH_FLAG@
-CFLAGS = @CFLAGS@
-cflags = @cflags@
-optflags = @optflags@
-debugflags = @debugflags@
-warnflags = @warnflags@
-INCFLAGS = -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir)
-XCFLAGS = @XCFLAGS@
-CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
-LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLDFLAGS =
-XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
-EXTLIBS =
-LIBS = @LIBS@ $(EXTLIBS)
-MISSING = @LIBOBJS@ @ALLOCA@
-LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(EXTLDFLAGS) $(ARCH_FLAG)
-SOLIBS = @SOLIBS@
-MAINLIBS = @MAINLIBS@
-ARCHMINIOBJS = @MINIOBJS@
-BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
-BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
-BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
-
-RUBY_BASE_NAME=@RUBY_BASE_NAME@
-RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
-RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
-RUBY_SO_NAME=@RUBY_SO_NAME@
-EXEEXT = @EXEEXT@
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@\
- $(MINIRUBYOPT)
-RUNRUBY = @RUNRUBY@ $(RUNRUBYOPT) --
-XRUBY = @XRUBY@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-XRUBY_LIBDIR = @XRUBY_LIBDIR@
-XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
-XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
-
-#### End of system configuration section. ####
-
-MAJOR= @MAJOR@
-MINOR= @MINOR@
-TEENY= @TEENY@
-
-LIBRUBY_A = @LIBRUBY_A@
-LIBRUBY_SO = @LIBRUBY_SO@
-LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
-LIBRUBY = @LIBRUBY@
-LIBRUBYARG = @LIBRUBYARG@
-LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
-LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
-
-THREAD_MODEL = @THREAD_MODEL@
-
-PREP = @PREP@
-ARCHFILE = @ARCHFILE@
-SETUP =
-EXTSTATIC = @EXTSTATIC@
-SET_LC_MESSAGES = env LC_MESSAGES=C
-
-MAKEDIRS = @MKDIR_P@
-CP = cp
-MV = mv
-RM = rm -f
-RMDIR = @RMDIR@
-RMDIRS = @RMDIRS@
-RMALL = @RMALL@
-NM = @NM@
-AR = @AR@
-ARFLAGS = rcu
-RANLIB = @RANLIB@
-AS = @AS@
-ASFLAGS = @ASFLAGS@ $(INCFLAGS)
-IFCHANGE = $(srcdir)/tool/ifchange
-SET_LC_MESSAGES = env LC_MESSAGES=C
-OBJDUMP = @OBJDUMP@
-OBJCOPY = @OBJCOPY@
-VCS = @VCS@
-VCSUP = @VCSUP@
-
-OBJEXT = @OBJEXT@
-ASMEXT = S
-DLEXT = @DLEXT@
-MANTYPE = @MANTYPE@
-SYMBOL_PREFIX = @SYMBOL_PREFIX@
-
-INSTALLED_LIST= .installed.list
-
-MKMAIN_CMD = mkmain.sh
-
-SRC_FILE = $<
-
-MESSAGE_BEGIN = @for line in
-MESSAGE_END = ; do echo "$$line"; done
-
-configure_args = @configure_args@
-#### End of variables
-
-all:
-
-.DEFAULT: all
-
-# Prevent GNU make v3 from overflowing arg limit on SysV.
-.NOEXPORT:
-
-miniruby$(EXEEXT):
- @-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
- $(ECHO) linking $@
- $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(DMYEXT) $(LIBS) $(OUTFLAG)$@
-
-$(PROGRAM):
- @$(RM) $@
- $(ECHO) linking $@
- $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) $(OUTFLAG)$@
-
-# We must `rm' the library each time this rule is invoked because "updating" a
-# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
-# supported.
-$(LIBRUBY_A):
- @$(RM) $@
- $(ECHO) linking static-library $@
- $(Q) $(AR) $(ARFLAGS) $@ $(OBJS) $(DMYEXT)
- @-$(RANLIB) $@ 2> /dev/null || true
-
-$(LIBRUBY_SO):
- @-$(PRE_LIBRUBY_UPDATE)
- $(ECHO) linking shared-library $@
- $(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(OUTFLAG)$@
- -$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)*_threadptr_*' $@
- @-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link if File.exist? link; \
- File.symlink "$(LIBRUBY_SO)", link}' \
- $(LIBRUBY_ALIASES) || true
-
-fake: $(arch)-fake.rb
-$(arch)-fake.rb: config.status $(srcdir)/template/fake.rb.in
- @./config.status --file=$@:$(srcdir)/template/fake.rb.in
- @chmod +x $@
-
-ruby_pc = @ruby_pc@
-$(ruby_pc):
- @./config.status --file=$@:$(srcdir)/template/ruby.pc.in
-
-install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
- $(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
- $(ECHO) installing cross-compiling stuff
- $(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
- $(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
- $(Q) $(BASERUBY) -p \
- -e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
- -e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
- rbconfig.rb > fake-rbconfig.rb
- $(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
- $(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
- @$(RM) fake.rb fake-rbconfig.rb
- $(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
- $(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
- $(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
- $(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
-
-Makefile: $(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
-
-$(MKFILES): config.status
- MAKE=$(MAKE) $(SHELL) ./config.status
- @{ \
- echo "all:; -@rm -f conftest.mk"; \
- echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
- echo ".force:"; \
- } > conftest.mk || exit 1; \
- $(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
- { echo "Makefile updated, restart."; exit 1; }
-
-uncommon.mk: $(srcdir)/common.mk
- sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
-
-.PHONY: reconfig
-reconfig-args = $(srcdir)/configure $(configure_args)
-config.status-args = ./config.status --recheck
-reconfig-exec-0 = exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3`
-reconfig-exec-1 = set -x; "$$@"
-
-reconfig config.status: $(srcdir)/configure $(srcdir)/enc/Makefile.in
- @PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
- set $(SHELL) $($@-args); $(reconfig-exec-$(V))
-
-$(srcdir)/configure: $(srcdir)/configure.in
- $(CHDIR) $(srcdir) && exec $(AUTOCONF)
-
-incs: id.h
-
-# Things which should be considered:
-# * with gperf v.s. without gperf
-# * committers may have various versions of gperf
-# * ./configure v.s. ../ruby/configure
-# * GNU make v.s. HP-UX make # HP-UX make invokes the action if lex.c and keywords has same mtime.
-# * svn checkout generate a file with mtime as current time
-# * ext4 and XFS has a mtime with fractional part
-lex.c: defs/keywords
- @\
- if cmp -s $(srcdir)/defs/lex.c.src $?; then \
- [ $(Q) ] && echo copying $@ || set -x; \
- $(CP) $(srcdir)/lex.c.blt $@; \
- else \
- [ $(Q) ] && echo generating $@ || set -x; \
- gperf -C -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@.tmp && \
- $(MV) $@.tmp $@ && \
- $(CP) $? $(srcdir)/defs/lex.c.src && \
- $(CP) $@ $(srcdir)/lex.c.blt; \
- fi
-
-NAME2CTYPE_OPTIONS = -7 -c -j1 -i1 -t -C -P -T -H uniname2ctype_hash -Q uniname2ctype_pool -N uniname2ctype_p
-
-enc/unicode/name2ctype.h: enc/unicode/name2ctype.kwd
- $(MAKEDIRS) $(@D)
- @set +e; \
- if cmp -s $(?:.kwd=.src) $?; then \
- set -x; \
- $(CP) $(?:.kwd=.h.blt) $@; \
- else \
- trap '$(RM) $@-1.h $@-2.h' 0 && \
- set -x; \
- sed '/^#ifdef USE_UNICODE_PROPERTIES/,/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-1.h && \
- gperf $(NAME2CTYPE_OPTIONS) < $? > $@-2.h && \
- diff -DUSE_UNICODE_PROPERTIES $@-1.h $@-2.h > $@.tmp || :; \
- $(MV) $@.tmp $@ && \
- $(CP) $? $(?:.kwd=.src) && \
- $(CP) $@ $(?:.kwd=.h.blt); \
- fi
-
-.c.@OBJEXT@:
- @$(ECHO) compiling $<
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
-
-.s.@OBJEXT@:
- @$(ECHO) assembling $<
- $(Q) $(AS) $(ASFLAGS) -o $@ $<
-
-.c.S:
- @$(ECHO) translating $<
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
-
-.c.i:
- @$(ECHO) preprocessing $<
- $(Q) $(CPP) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
-
-clean-local::
- $(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output
- -$(Q)$(RM) $(pkgconfig_DATA)
-
-distclean-local::
- $(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
- -$(Q)$(RM) run.gdb
- -$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h
- -$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
-
-clean-ext distclean-ext realclean-ext::
- @cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
- test "$$#" = 0 && set .; \
- set dummy `\
- find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$:~:' | sort | sed 's:~$$::'; \
- `; shift; \
- cd ..; \
- for dir do \
- echo $(@:-ext=)ing "$$dir"; \
- (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
- case "$@" in \
- *distclean-ext*|*realclean-ext*) \
- $(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
- esac; \
- done
-
-distclean-ext realclean-ext::
- -$(Q)$(RMDIR) ext 2> /dev/null || true
-
-clean-extout:
- -$(Q)$(RMDIRS) $(EXTOUT) 2> /dev/null || true
-
-clean-enc distclean-enc realclean-enc:
- @test -f "$(ENC_MK)" || exit 0; \
- echo $(@:-enc=ing) encodings; \
- exec $(MAKE) -f $(ENC_MK) $(MFLAGS) $(@:-enc=)
-
-clean-rdoc distclean-rdoc realclean-rdoc:
- @echo $(@:-rdoc=ing) rdoc
- $(Q)$(RMALL) $(RDOCOUT)
-clean-capi distclean-capi realclean-capi:
- @echo $(@:-capi=ing) capi
- $(Q)$(RMALL) $(CAPIOUT)
-
-
-ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
- $(ECHO) compiling $@
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
-
-up::
- @$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
-
-update-mspec:
- @$(CHDIR) $(srcdir); \
- if [ -d spec/mspec ]; then \
- cd spec/mspec; \
- echo updating mspec ...; \
- exec git pull; \
- else \
- echo retrieving mspec ...; \
- exec git clone $(MSPEC_GIT_URL) spec/mspec; \
- fi
-
-update-rubyspec: update-mspec
- @$(CHDIR) $(srcdir); \
- if [ -d spec/rubyspec ]; then \
- cd spec/rubyspec; \
- echo updating rubyspec ...; \
- exec git pull; \
- else \
- echo retrieving rubyspec ...; \
- exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
- fi
-
-test-rubyspec-precheck:
- @if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here. make update-rubyspec first.; exit 1; fi
-
-INSNS = opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
- vmtc.inc vm.inc
-
-$(INSNS): $(srcdir)/insns.def vm_opts.h \
- $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
- $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
- $(BASERUBY) -Ks $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
diff --git a/NEWS b/NEWS
deleted file mode 100644
index 7a749daca2..0000000000
--- a/NEWS
+++ /dev/null
@@ -1,150 +0,0 @@
-# -*- rd -*-
-= NEWS
-
-This document is a list of user visible feature changes made between
-releases except for bug fixes.
-
-Note that each entry is kept so brief that no reason behind or
-reference information is supplied with. For a full list of changes
-with all sufficient information, see the ChangeLog file.
-
-== Changes since the 1.9.2 release
-=== License
-
-* Ruby's License is changed from a dual license with GPLv2
- to a dual license with 2-clause BSDL.
-
-=== C API updates
-
-* rb_scan_args() is enhanced with support for option hash argument
- extraction.
-
-* ruby_vm_at_exit() added. This enables extension libs to hook a VM
- termination.
-
-=== Library updates (outstanding ones only)
-
-* builtin classes
-
- * ARGF
- * new methods:
- * ARGF.print
- * ARGF.printf
- * ARGF.putc
- * ARGF.puts
- * ARGF.read_nonblock
- * ARGF.to_write_io
- * ARGF.write
-
- * Array
- * extended method:
- * Array#pack supports endian modifiers
-
- * Encoding
- * new encodings:
- * CP950
- * CP951
- * UTF-16
- * UTF-32
-
- * Float
- * new constant:
- * File::NULL
- name of NULL device.
- * extended method:
- * String#unpack supports endian modifiers
-
- * IO
- * extended method:
- * IO#putc supports multibyte characters
- * new method:
- * IO#advise
-
- * Kernel
- * Kernel#respond_to? now returns false for protected methods.
- * move #__id__ to BasicObject.
-
- * Module
- * new methods:
- * Module#private_constant
- * Module#public_constant
-
- * String
- * new method:
- * String#prepend
-
- * Time
- * extended method:
- * Time#strftime supports %:z and %::z.
-
-* io/console
- * new methods:
- * IO#noecho {|io| }
- * IO#echo=
- * IO#echo?
- * IO#raw {|io| }
- * IO#raw!
- * IO#getch
- * IO#winsize
- * IO.console
-
-* optparse
- * support for bash/zsh completion.
-
-* RDoc
- * RDoc has been upgraded to RDoc 3.1. For full release notes see
- http://rdoc.rubyforge.org/History_txt.html
-
-* rexml
- * [incompatible] support Ruby native encoding mechanism
- and iconv dependency is dropped. This means encoding
- methods (Document#encoding, XMLDecl#encoding,
- Output#encoding and Source#encoding) return an Encoding
- object instead of an encoding name.
-
-* Rubygems
- * Rubygems has been upgraded to rubygems 1.5.0. For full release notes see
- http://rubygems.rubyforge.org/rubygems-update/History_txt.html
-
-* stringio
- * extended method:
- * StringIO#set_encoding can get 2nd argument and optional hash.
-
-* uri
- * new methods:
- * URI::Generic#hostname
- * URI::Generic#hostname=
-
-* webrick
- * new method:
- * WEBrick::HTTPRequest#continue for generating '100 continue' response.
- * new logging directive:
- * %{remote}p for remote (client) port number.
-
-* zlib
- * new methods:
- * Zlib.deflate
- * Zlib.inflate
-
-=== Language changes
-
-* Regexps now support Unicode 6.0. (new characters and scripts)
-
-* [experimental] Regexps now support Age property.
- Unlike Perl, current implementation takes interpretation of the
- interpretation of UTS #18.
- http://www.unicode.org/reports/tr18/
-
-* Turning on/off indentation warnings with directives.
- ("# -*- warn-indent: true -*-" / "# -*- warn-indent: false -*-")
-
-=== Compatibility issues (excluding feature bug fixes)
-
-* Kernel#respond_to?
-
- See above.
-
-* REXML::Document#encoding, REXML::XMLDecl#encoding,
- REXML::Output#encoding and REXML::Source#encoding
-
- Return an Encoding object not encoding name as a String.
diff --git a/NEWS.md b/NEWS.md
new file mode 100644
index 0000000000..f6c3c6fc97
--- /dev/null
+++ b/NEWS.md
@@ -0,0 +1,820 @@
+# NEWS for Ruby 3.2.0
+
+This document is a list of user-visible feature changes
+since the **3.1.0** release, except for bug fixes.
+
+Note that each entry is kept to a minimum, see links for details.
+
+## Language changes
+
+* Anonymous rest and keyword rest arguments can now be passed as
+ arguments, instead of just used in method parameters.
+ [[Feature #18351]]
+
+ ```ruby
+ def foo(*)
+ bar(*)
+ end
+ def baz(**)
+ quux(**)
+ end
+ ```
+
+* A proc that accepts a single positional argument and keywords will
+ no longer autosplat. [[Bug #18633]]
+
+ ```ruby
+ proc{|a, **k| a}.call([1, 2])
+ # Ruby 3.1 and before
+ # => 1
+ # Ruby 3.2 and after
+ # => [1, 2]
+ ```
+
+* Constant assignment evaluation order for constants set on explicit
+ objects has been made consistent with single attribute assignment
+ evaluation order. With this code:
+
+ ```ruby
+ foo::BAR = baz
+ ```
+
+ `foo` is now called before `baz`. Similarly, for multiple assignments
+ to constants, left-to-right evaluation order is used. With this
+ code:
+
+ ```ruby
+ foo1::BAR1, foo2::BAR2 = baz1, baz2
+ ```
+
+ The following evaluation order is now used:
+
+ 1. `foo1`
+ 2. `foo2`
+ 3. `baz1`
+ 4. `baz2`
+
+ [[Bug #15928]]
+
+* "Find pattern" is no longer experimental.
+ [[Feature #18585]]
+
+* Methods taking a rest parameter (like `*args`) and wishing to delegate keyword
+ arguments through `foo(*args)` must now be marked with `ruby2_keywords`
+ (if not already the case). In other words, all methods wishing to delegate
+ keyword arguments through `*args` must now be marked with `ruby2_keywords`,
+ with no exception. This will make it easier to transition to other ways of
+ delegation once a library can require Ruby 3+. Previously, the `ruby2_keywords`
+ flag was kept if the receiving method took `*args`, but this was a bug and an
+ inconsistency. A good technique to find the potentially-missing `ruby2_keywords`
+ is to run the test suite, for where it fails find the last method which must
+ receive keyword arguments, use `puts nil, caller, nil` there, and check each
+ method/block on the call chain which must delegate keywords is correctly marked
+ as `ruby2_keywords`. [[Bug #18625]] [[Bug #16466]]
+
+ ```ruby
+ def target(**kw)
+ end
+
+ # Accidentally worked without ruby2_keywords in Ruby 2.7-3.1, ruby2_keywords
+ # needed in 3.2+. Just like (*args, **kwargs) or (...) would be needed on
+ # both #foo and #bar when migrating away from ruby2_keywords.
+ ruby2_keywords def bar(*args)
+ target(*args)
+ end
+
+ ruby2_keywords def foo(*args)
+ bar(*args)
+ end
+
+ foo(k: 1)
+ ```
+
+## Core classes updates
+
+Note: We're only listing outstanding class updates.
+
+* Fiber
+
+ * Introduce Fiber.[] and Fiber.[]= for inheritable fiber storage.
+ Introduce Fiber#storage and Fiber#storage= (experimental) for
+ getting and resetting the current storage. Introduce
+ `Fiber.new(storage:)` for setting the storage when creating a
+ fiber. [[Feature #19078]]
+
+ Existing Thread and Fiber local variables can be tricky to use.
+ Thread-local variables are shared between all fibers, making it
+ hard to isolate, while Fiber-local variables can be hard to
+ share. It is often desirable to define unit of execution
+ ("execution context") such that some state is shared between all
+ fibers and threads created in that context. This is what Fiber
+ storage provides.
+
+ ```ruby
+ def log(message)
+ puts "#{Fiber[:request_id]}: #{message}"
+ end
+
+ def handle_requests
+ while request = read_request
+ Fiber.schedule do
+ Fiber[:request_id] = SecureRandom.uuid
+
+ request.messages.each do |message|
+ Fiber.schedule do
+ log("Handling #{message}") # Log includes inherited request_id.
+ end
+ end
+ end
+ end
+ end
+ ```
+
+ You should generally consider Fiber storage for any state which
+ you want to be shared implicitly between all fibers and threads
+ created in a given context, e.g. a connection pool, a request
+ id, a logger level, environment variables, configuration, etc.
+
+* Fiber::Scheduler
+
+ * Introduce `Fiber::Scheduler#io_select` for non-blocking IO.select.
+ [[Feature #19060]]
+
+* IO
+
+ * Introduce IO#timeout= and IO#timeout which can cause
+ IO::TimeoutError to be raised if a blocking operation exceeds the
+ specified timeout. [[Feature #18630]]
+
+ ```ruby
+ STDIN.timeout = 1
+ STDIN.read # => Blocking operation timed out! (IO::TimeoutError)
+ ```
+
+ * Introduce `IO.new(..., path:)` and promote `File#path` to `IO#path`.
+ [[Feature #19036]]
+
+* Class
+
+ * Class#attached_object, which returns the object for which
+ the receiver is the singleton class. Raises TypeError if the
+ receiver is not a singleton class.
+ [[Feature #12084]]
+
+ ```ruby
+ class Foo; end
+
+ Foo.singleton_class.attached_object #=> Foo
+ Foo.new.singleton_class.attached_object #=> #<Foo:0x000000010491a370>
+ Foo.attached_object #=> TypeError: `Foo' is not a singleton class
+ nil.singleton_class.attached_object #=> TypeError: `NilClass' is not a singleton class
+ ```
+
+* Data
+
+ * New core class to represent simple immutable value object. The class is
+ similar to Struct and partially shares an implementation, but has more
+ lean and strict API. [[Feature #16122]]
+
+ ```ruby
+ Measure = Data.define(:amount, :unit)
+ distance = Measure.new(100, 'km') #=> #<data Measure amount=100, unit="km">
+ weight = Measure.new(amount: 50, unit: 'kg') #=> #<data Measure amount=50, unit="kg">
+ weight.with(amount: 40) #=> #<data Measure amount=40, unit="kg">
+ weight.amount #=> 50
+ weight.amount = 40 #=> NoMethodError: undefined method `amount='
+ ```
+
+* Encoding
+
+ * Encoding#replicate has been deprecated and will be removed in 3.3. [[Feature #18949]]
+ * The dummy `Encoding::UTF_16` and `Encoding::UTF_32` encodings no longer
+ try to dynamically guess the endian based on a byte order mark.
+ Use `Encoding::UTF_16BE`/`UTF_16LE` and `Encoding::UTF_32BE`/`UTF_32LE` instead.
+ This change speeds up getting the encoding of a String. [[Feature #18949]]
+ * Limit maximum encoding set size by 256.
+ If exceeding maximum size, `EncodingError` will be raised. [[Feature #18949]]
+
+* Enumerator
+
+ * Enumerator.product has been added. Enumerator::Product is the implementation. [[Feature #18685]]
+
+* Exception
+
+ * Exception#detailed_message has been added.
+ The default error printer calls this method on the Exception object
+ instead of #message. [[Feature #18564]]
+
+* Hash
+
+ * Hash#shift now always returns nil if the hash is
+ empty, instead of returning the default value or
+ calling the default proc. [[Bug #16908]]
+
+* Integer
+
+ * Integer#ceildiv has been added. [[Feature #18809]]
+
+* Kernel
+
+ * Kernel#binding raises RuntimeError if called from a non-Ruby frame
+ (such as a method defined in C). [[Bug #18487]]
+
+* MatchData
+
+ * MatchData#byteoffset has been added. [[Feature #13110]]
+ * MatchData#deconstruct has been added. [[Feature #18821]]
+ * MatchData#deconstruct_keys has been added. [[Feature #18821]]
+
+* Module
+
+ * Module.used_refinements has been added. [[Feature #14332]]
+ * Module#refinements has been added. [[Feature #12737]]
+ * Module#const_added has been added. [[Feature #17881]]
+ * Module#undefined_instance_methods has been added. [[Feature #12655]]
+
+* Proc
+
+ * Proc#dup returns an instance of subclass. [[Bug #17545]]
+ * Proc#parameters now accepts lambda keyword. [[Feature #15357]]
+
+* Process
+ * Added `RLIMIT_NPTS` constant to FreeBSD platform
+
+* Regexp
+
+ * The cache-based optimization is introduced.
+ Many (but not all) Regexp matching is now in linear time, which
+ will prevent regular expression denial of service (ReDoS)
+ vulnerability. [[Feature #19104]]
+
+ * Regexp.linear_time? is introduced. [[Feature #19194]]
+
+ * Regexp.new now supports passing the regexp flags not only as an Integer,
+ but also as a String. Unknown flags raise ArgumentError.
+ Otherwise, anything other than `true`, `false`, `nil` or Integer will be warned.
+ [[Feature #18788]]
+
+ * Regexp.timeout= has been added. Also, Regexp.new new supports timeout keyword.
+ See [[Feature #17837]]
+
+* Refinement
+
+ * Refinement#refined_class has been added. [[Feature #12737]]
+
+* RubyVM::AbstractSyntaxTree
+
+ * Add `error_tolerant` option for `parse`, `parse_file` and `of`. [[Feature #19013]]
+ With this option
+
+ 1. SyntaxError is suppressed
+ 2. AST is returned for invalid input
+ 3. `end` is complemented when a parser reaches to the end of input but `end` is insufficient
+ 4. `end` is treated as keyword based on indent
+
+ ```ruby
+ # Without error_tolerant option
+ root = RubyVM::AbstractSyntaxTree.parse(<<~RUBY)
+ def m
+ a = 10
+ if
+ end
+ RUBY
+ # => <internal:ast>:33:in `parse': syntax error, unexpected `end' (SyntaxError)
+
+ # With error_tolerant option
+ root = RubyVM::AbstractSyntaxTree.parse(<<~RUBY, error_tolerant: true)
+ def m
+ a = 10
+ if
+ end
+ RUBY
+ p root # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-4:3>
+
+ # `end` is treated as keyword based on indent
+ root = RubyVM::AbstractSyntaxTree.parse(<<~RUBY, error_tolerant: true)
+ module Z
+ class Foo
+ foo.
+ end
+
+ def bar
+ end
+ end
+ RUBY
+ p root.children[-1].children[-1].children[-1].children[-2..-1]
+ # => [#<RubyVM::AbstractSyntaxTree::Node:CLASS@2:2-4:5>, #<RubyVM::AbstractSyntaxTree::Node:DEFN@6:2-7:5>]
+ ```
+
+ * Add `keep_tokens` option for `parse`, `parse_file` and `of`. Add `#tokens` and `#all_tokens`
+ for RubyVM::AbstractSyntaxTree::Node [[Feature #19070]]
+
+ ```ruby
+ root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+ root.tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+ root.tokens.map{_1[2]}.join # => "x = 1 + 2"
+ ```
+
+* Set
+
+ * Set is now available as a built-in class without the need for `require "set"`. [[Feature #16989]]
+ It is currently autoloaded via the Set constant or a call to Enumerable#to_set.
+
+* String
+
+ * String#byteindex and String#byterindex have been added. [[Feature #13110]]
+ * Update Unicode to Version 15.0.0 and Emoji Version 15.0. [[Feature #18639]]
+ (also applies to Regexp)
+ * String#bytesplice has been added. [[Feature #18598]]
+ * String#dedup has been added as an alias to String#-@. [[Feature #18595]]
+
+* Struct
+
+ * A Struct class can also be initialized with keyword arguments
+ without `keyword_init: true` on Struct.new [[Feature #16806]]
+
+ ```ruby
+ Post = Struct.new(:id, :name)
+ Post.new(1, "hello") #=> #<struct Post id=1, name="hello">
+ # From Ruby 3.2, the following code also works without keyword_init: true.
+ Post.new(id: 1, name: "hello") #=> #<struct Post id=1, name="hello">
+ ```
+
+* Thread
+
+ * Thread.each_caller_location is added. [[Feature #16663]]
+
+* Thread::Queue
+
+ * Thread::Queue#pop(timeout: sec) is added. [[Feature #18774]]
+
+* Thread::SizedQueue
+
+ * Thread::SizedQueue#pop(timeout: sec) is added. [[Feature #18774]]
+ * Thread::SizedQueue#push(timeout: sec) is added. [[Feature #18944]]
+
+* Time
+
+ * Time#deconstruct_keys is added, allowing to use Time instances
+ in pattern-matching expressions [[Feature #19071]]
+
+ * Time.new now can parse a string like generated by Time#inspect
+ and return a Time instance based on the given argument.
+ [[Feature #18033]]
+
+* SyntaxError
+ * SyntaxError#path has been added. [[Feature #19138]]
+
+* TracePoint
+
+ * TracePoint#binding now returns `nil` for `c_call`/`c_return` TracePoints.
+ [[Bug #18487]]
+ * TracePoint#enable `target_thread` keyword argument now defaults to the
+ current thread if a block is given and `target` and `target_line` keyword
+ arguments are not passed. [[Bug #16889]]
+
+* UnboundMethod
+
+ * `UnboundMethod#==` returns `true` if the actual method is same. For example,
+ `String.instance_method(:object_id) == Array.instance_method(:object_id)`
+ returns `true`. [[Feature #18798]]
+
+ * `UnboundMethod#inspect` does not show the receiver of `instance_method`.
+ For example `String.instance_method(:object_id).inspect` returns
+ `"#<UnboundMethod: Kernel#object_id()>"`
+ (was `"#<UnboundMethod: String(Kernel)#object_id()>"`).
+
+* GC
+
+ * Expose `need_major_gc` via `GC.latest_gc_info`. [GH-6791]
+
+* ObjectSpace
+
+ * `ObjectSpace.dump_all` dump shapes as well. [GH-6868]
+
+## Stdlib updates
+
+* Bundler
+
+ * Bundler now uses [PubGrub] resolver instead of [Molinillo] for performance improvement.
+ * Add --ext=rust support to bundle gem for creating simple gems with Rust extensions.
+ [[GH-rubygems-6149]]
+ * Make cloning git repos faster [[GH-rubygems-4475]]
+
+* RubyGems
+
+ * Add mswin support for cargo builder. [[GH-rubygems-6167]]
+
+* CGI
+
+ * `CGI.escapeURIComponent` and `CGI.unescapeURIComponent` are added.
+ [[Feature #18822]]
+
+* Coverage
+
+ * `Coverage.setup` now accepts `eval: true`. By this, `eval` and related methods are
+ able to generate code coverage. [[Feature #19008]]
+
+ * `Coverage.supported?(mode)` enables detection of what coverage modes are
+ supported. [[Feature #19026]]
+
+* Date
+
+ * Added `Date#deconstruct_keys` and `DateTime#deconstruct_keys` same as [[Feature #19071]]
+
+* ERB
+
+ * `ERB::Util.html_escape` is made faster than `CGI.escapeHTML`.
+ * It no longer allocates a String object when no character needs to be escaped.
+ * It skips calling `#to_s` method when an argument is already a String.
+ * `ERB::Escape.html_escape` is added as an alias to `ERB::Util.html_escape`,
+ which has not been monkey-patched by Rails.
+ * `ERB::Util.url_encode` is made faster using `CGI.escapeURIComponent`.
+ * `-S` option is removed from `erb` command.
+
+* FileUtils
+
+ * Add FileUtils.ln_sr method and `relative:` option to FileUtils.ln_s.
+ [[Feature #18925]]
+
+* IRB
+
+ * debug.gem integration commands have been added: `debug`, `break`, `catch`,
+ `next`, `delete`, `step`, `continue`, `finish`, `backtrace`, `info`
+ * They work even if you don't have `gem "debug"` in your Gemfile.
+ * See also: [What's new in Ruby 3.2's IRB?](https://st0012.dev/whats-new-in-ruby-3-2-irb)
+ * More Pry-like commands and features have been added.
+ * `edit` and `show_cmds` (like Pry's `help`) are added.
+ * `ls` takes `-g` or `-G` option to filter out outputs.
+ * `show_source` is aliased from `$` and accepts unquoted inputs.
+ * `whereami` is aliased from `@`.
+
+* Net::Protocol
+
+ * Improve `Net::BufferedIO` performance. [[GH-net-protocol-14]]
+
+* Pathname
+
+ * Added `Pathname#lutime`. [[GH-pathname-20]]
+
+* Socket
+
+ * Added the following constants for supported platforms.
+ * `SO_INCOMING_CPU`
+ * `SO_INCOMING_NAPI_ID`
+ * `SO_RTABLE`
+ * `SO_SETFIB`
+ * `SO_USER_COOKIE`
+ * `TCP_KEEPALIVE`
+ * `TCP_CONNECTION_INFO`
+
+* SyntaxSuggest
+
+ * The feature of `syntax_suggest` formerly `dead_end` is integrated in Ruby.
+ [[Feature #18159]]
+
+* UNIXSocket
+
+ * Add support for UNIXSocket on Windows. Emulate anonymous sockets. Add
+ support for File.socket? and File::Stat#socket? where possible.
+ [[Feature #19135]]
+
+* The following default gems are updated.
+
+ * RubyGems 3.4.1
+ * abbrev 0.1.1
+ * benchmark 0.2.1
+ * bigdecimal 3.1.3
+ * bundler 2.4.1
+ * cgi 0.3.6
+ * csv 3.2.6
+ * date 3.3.3
+ * delegate 0.3.0
+ * did_you_mean 1.6.3
+ * digest 3.1.1
+ * drb 2.1.1
+ * english 0.7.2
+ * erb 4.0.2
+ * error_highlight 0.5.1
+ * etc 1.4.2
+ * fcntl 1.0.2
+ * fiddle 1.1.1
+ * fileutils 1.7.0
+ * forwardable 1.3.3
+ * getoptlong 0.2.0
+ * io-console 0.6.0
+ * io-nonblock 0.2.0
+ * io-wait 0.3.0
+ * ipaddr 1.2.5
+ * irb 1.6.2
+ * json 2.6.3
+ * logger 1.5.3
+ * mutex_m 0.1.2
+ * net-http 0.4.0
+ * net-protocol 0.2.1
+ * nkf 0.1.2
+ * open-uri 0.3.0
+ * open3 0.1.2
+ * openssl 3.1.0
+ * optparse 0.3.1
+ * ostruct 0.5.5
+ * pathname 0.2.1
+ * pp 0.4.0
+ * pstore 0.1.2
+ * psych 5.0.1
+ * racc 1.6.2
+ * rdoc 6.5.0
+ * readline-ext 0.1.5
+ * reline 0.3.2
+ * resolv 0.2.2
+ * resolv-replace 0.1.1
+ * securerandom 0.2.2
+ * set 1.0.3
+ * stringio 3.0.4
+ * strscan 3.0.5
+ * syntax_suggest 1.0.2
+ * syslog 0.1.1
+ * tempfile 0.1.3
+ * time 0.2.1
+ * timeout 0.3.1
+ * tmpdir 0.1.3
+ * tsort 0.1.1
+ * un 0.2.1
+ * uri 0.12.0
+ * weakref 0.1.2
+ * win32ole 1.8.9
+ * yaml 0.2.1
+ * zlib 3.0.0
+
+* The following bundled gems are updated.
+
+ * minitest 5.16.3
+ * power_assert 2.0.3
+ * test-unit 3.5.7
+ * net-ftp 0.2.0
+ * net-imap 0.3.4
+ * net-pop 0.1.2
+ * net-smtp 0.3.3
+ * rbs 2.8.2
+ * typeprof 0.21.3
+ * debug 1.7.1
+
+See GitHub releases like [GitHub Releases of Logger](https://github.com/ruby/logger/releases) or changelog for details of the default gems or bundled gems.
+
+## Supported platforms
+
+* WebAssembly/WASI is added. See [wasm/README.md] and [ruby.wasm] for more details. [[Feature #18462]]
+
+## Compatibility issues
+
+* `String#to_c` currently treat a sequence of underscores as an end of Complex
+ string. [[Bug #19087]]
+
+* Now `ENV.clone` raises `TypeError` as well as `ENV.dup` [[Bug #17767]]
+
+### Removed constants
+
+The following deprecated constants are removed.
+
+* `Fixnum` and `Bignum` [[Feature #12005]]
+* `Random::DEFAULT` [[Feature #17351]]
+* `Struct::Group`
+* `Struct::Passwd`
+
+### Removed methods
+
+The following deprecated methods are removed.
+
+* `Dir.exists?` [[Feature #17391]]
+* `File.exists?` [[Feature #17391]]
+* `Kernel#=~` [[Feature #15231]]
+* `Kernel#taint`, `Kernel#untaint`, `Kernel#tainted?`
+ [[Feature #16131]]
+* `Kernel#trust`, `Kernel#untrust`, `Kernel#untrusted?`
+ [[Feature #16131]]
+* `Method#public?`, `Method#private?`, `Method#protected?`,
+ `UnboundMethod#public?`, `UnboundMethod#private?`, `UnboundMethod#protected?`
+ [[Bug #18729]] [[Bug #18751]] [[Bug #18435]]
+
+### Source code incompatibility of extension libraries
+
+* Extension libraries provide PRNG, subclasses of Random, need updates.
+ See [PRNG update] below for more information. [[Bug #19100]]
+
+### Error printer
+
+* Ruby no longer escapes control characters and backslashes in an
+ error message. [[Feature #18367]]
+
+### Constant lookup when defining a class/module
+
+* When defining a class/module directly under the Object class by class/module
+ statement, if there is already a class/module defined by `Module#include`
+ with the same name, the statement was handled as "open class" in Ruby 3.1 or before.
+ Since Ruby 3.2, a new class is defined instead. [[Feature #18832]]
+
+## Stdlib compatibility issues
+
+* Psych no longer bundles libyaml sources.
+ And also Fiddle no longer bundles libffi sources.
+ Users need to install the libyaml/libffi library themselves via the package
+ manager like apt, yum, brew, etc.
+
+ Psych and fiddle supported the static build with specific version of libyaml
+ and libffi sources. You can build psych with libyaml-0.2.5 like this.
+
+ ```bash
+ $ ./configure --with-libyaml-source-dir=/path/to/libyaml-0.2.5
+ ```
+
+ And you can build fiddle with libffi-3.4.4 like this.
+
+ ```bash
+ $ ./configure --with-libffi-source-dir=/path/to/libffi-3.4.4
+ ```
+
+ [[Feature #18571]]
+
+* Check cookie name/path/domain characters in `CGI::Cookie`. [[CVE-2021-33621]]
+
+* `URI.parse` return empty string in host instead of nil. [[sec-156615]]
+
+## C API updates
+
+### Updated C APIs
+
+The following APIs are updated.
+
+* PRNG update
+
+ `rb_random_interface_t` in ruby/random.h updated and versioned.
+ Extension libraries which use this interface and built for older
+ versions need to rebuild with adding `init_int32` function.
+
+### Added C APIs
+
+* `VALUE rb_hash_new_capa(long capa)` was added to created hashes with the desired capacity.
+* `rb_internal_thread_add_event_hook` and `rb_internal_thread_add_event_hook` were added to instrument threads scheduling.
+ The following events are available:
+ * `RUBY_INTERNAL_THREAD_EVENT_STARTED`
+ * `RUBY_INTERNAL_THREAD_EVENT_READY`
+ * `RUBY_INTERNAL_THREAD_EVENT_RESUMED`
+ * `RUBY_INTERNAL_THREAD_EVENT_SUSPENDED`
+ * `RUBY_INTERNAL_THREAD_EVENT_EXITED`
+* `rb_debug_inspector_current_depth` and `rb_debug_inspector_frame_depth` are added for debuggers.
+
+### Removed C APIs
+
+The following deprecated APIs are removed.
+
+* `rb_cData` variable.
+* "taintedness" and "trustedness" functions. [[Feature #16131]]
+
+## Implementation improvements
+
+* Fixed several race conditions in Kernel#autoload. [[Bug #18782]]
+* Cache invalidation for expressions referencing constants is now
+ more fine-grained. `RubyVM.stat(:global_constant_state)` was
+ removed because it was closely tied to the previous caching scheme
+ where setting any constant invalidates all caches in the system.
+ New keys, `:constant_cache_invalidations` and `:constant_cache_misses`,
+ were introduced to help with use cases for `:global_constant_state`.
+ [[Feature #18589]]
+* The cache-based optimization for Regexp matching is introduced.
+ [[Feature #19104]]
+* [Variable Width Allocation](https://shopify.engineering/ruby-variable-width-allocation)
+ is now enabled by default. [[Feature #18239]]
+* Added a new instance variable caching mechanism, called object shapes, which
+ improves inline cache hits for most objects and allows us to generate very
+ efficient JIT code. Objects whose instance variables are defined in a
+ consistent order will see the most performance benefits.
+ [[Feature #18776]]
+* Speed up marking instruction sequences by using a bitmap to find "markable"
+ objects. This change results in faster major collections.
+ [[Feature #18875]]
+
+## JIT
+
+### YJIT
+
+* YJIT is no longer experimental
+ * Has been tested on production workloads for over a year and proven to be quite stable.
+* YJIT now supports both x86-64 and arm64/aarch64 CPUs on Linux, MacOS, BSD and other UNIX platforms.
+ * This release brings support for Mac M1/M2, AWS Graviton and Raspberry Pi 4.
+* Building YJIT now requires Rust 1.58.0+. [[Feature #18481]]
+ * In order to ensure that CRuby is built with YJIT, please install `rustc` >= 1.58.0
+ before running `./configure`
+ * Please reach out to the YJIT team should you run into any issues.
+* Physical memory for JIT code is lazily allocated. Unlike Ruby 3.1,
+ the RSS of a Ruby process is minimized because virtual memory pages
+ allocated by `--yjit-exec-mem-size` will not be mapped to physical
+ memory pages until actually utilized by JIT code.
+* Introduce Code GC that frees all code pages when the memory consumption
+ by JIT code reaches `--yjit-exec-mem-size`.
+ * `RubyVM::YJIT.runtime_stats` returns Code GC metrics in addition to
+ existing `inline_code_size` and `outlined_code_size` keys:
+ `code_gc_count`, `live_page_count`, `freed_page_count`, and `freed_code_size`.
+* Most of the statistics produced by `RubyVM::YJIT.runtime_stats` are now available in release builds.
+ * Simply run ruby with `--yjit-stats` to compute and dump stats (incurs some run-time overhead).
+* YJIT is now optimized to take advantage of object shapes. [[Feature #18776]]
+* Take advantage of finer-grained constant invalidation to invalidate less code when defining new constants. [[Feature #18589]]
+* The default `--yjit-exec-mem-size` is changed to 64 (MiB).
+* The default `--yjit-call-threshold` is changed to 30.
+
+### MJIT
+
+* The MJIT compiler is re-implemented in Ruby as `ruby_vm/mjit/compiler`.
+* MJIT compiler is executed under a forked Ruby process instead of
+ doing it in a native thread called MJIT worker. [[Feature #18968]]
+ * As a result, Microsoft Visual Studio (MSWIN) is no longer supported.
+* MinGW is no longer supported. [[Feature #18824]]
+* Rename `--mjit-min-calls` to `--mjit-call-threshold`.
+* Change default `--mjit-max-cache` back from 10000 to 100.
+
+[Feature #12005]: https://bugs.ruby-lang.org/issues/12005
+[Feature #12084]: https://bugs.ruby-lang.org/issues/12084
+[Feature #12655]: https://bugs.ruby-lang.org/issues/12655
+[Feature #12737]: https://bugs.ruby-lang.org/issues/12737
+[Feature #13110]: https://bugs.ruby-lang.org/issues/13110
+[Feature #14332]: https://bugs.ruby-lang.org/issues/14332
+[Feature #15231]: https://bugs.ruby-lang.org/issues/15231
+[Feature #15357]: https://bugs.ruby-lang.org/issues/15357
+[Bug #15928]: https://bugs.ruby-lang.org/issues/15928
+[Feature #16122]: https://bugs.ruby-lang.org/issues/16122
+[Feature #16131]: https://bugs.ruby-lang.org/issues/16131
+[Bug #16466]: https://bugs.ruby-lang.org/issues/16466
+[Feature #16663]: https://bugs.ruby-lang.org/issues/16663
+[Feature #16806]: https://bugs.ruby-lang.org/issues/16806
+[Bug #16889]: https://bugs.ruby-lang.org/issues/16889
+[Bug #16908]: https://bugs.ruby-lang.org/issues/16908
+[Feature #16989]: https://bugs.ruby-lang.org/issues/16989
+[Feature #17351]: https://bugs.ruby-lang.org/issues/17351
+[Feature #17391]: https://bugs.ruby-lang.org/issues/17391
+[Bug #17545]: https://bugs.ruby-lang.org/issues/17545
+[Bug #17767]: https://bugs.ruby-lang.org/issues/17767
+[Feature #17837]: https://bugs.ruby-lang.org/issues/17837
+[Feature #17881]: https://bugs.ruby-lang.org/issues/17881
+[Feature #18033]: https://bugs.ruby-lang.org/issues/18033
+[Feature #18159]: https://bugs.ruby-lang.org/issues/18159
+[Feature #18239]: https://bugs.ruby-lang.org/issues/18239#note-17
+[Feature #18351]: https://bugs.ruby-lang.org/issues/18351
+[Feature #18367]: https://bugs.ruby-lang.org/issues/18367
+[Bug #18435]: https://bugs.ruby-lang.org/issues/18435
+[Feature #18462]: https://bugs.ruby-lang.org/issues/18462
+[Feature #18481]: https://bugs.ruby-lang.org/issues/18481
+[Bug #18487]: https://bugs.ruby-lang.org/issues/18487
+[Feature #18564]: https://bugs.ruby-lang.org/issues/18564
+[Feature #18571]: https://bugs.ruby-lang.org/issues/18571
+[Feature #18585]: https://bugs.ruby-lang.org/issues/18585
+[Feature #18589]: https://bugs.ruby-lang.org/issues/18589
+[Feature #18595]: https://bugs.ruby-lang.org/issues/18595
+[Feature #18598]: https://bugs.ruby-lang.org/issues/18598
+[Bug #18625]: https://bugs.ruby-lang.org/issues/18625
+[Feature #18630]: https://bugs.ruby-lang.org/issues/18630
+[Bug #18633]: https://bugs.ruby-lang.org/issues/18633
+[Feature #18639]: https://bugs.ruby-lang.org/issues/18639
+[Feature #18685]: https://bugs.ruby-lang.org/issues/18685
+[Bug #18729]: https://bugs.ruby-lang.org/issues/18729
+[Bug #18751]: https://bugs.ruby-lang.org/issues/18751
+[Feature #18774]: https://bugs.ruby-lang.org/issues/18774
+[Feature #18776]: https://bugs.ruby-lang.org/issues/18776
+[Bug #18782]: https://bugs.ruby-lang.org/issues/18782
+[Feature #18788]: https://bugs.ruby-lang.org/issues/18788
+[Feature #18798]: https://bugs.ruby-lang.org/issues/18798
+[Feature #18809]: https://bugs.ruby-lang.org/issues/18809
+[Feature #18821]: https://bugs.ruby-lang.org/issues/18821
+[Feature #18822]: https://bugs.ruby-lang.org/issues/18822
+[Feature #18824]: https://bugs.ruby-lang.org/issues/18824
+[Feature #18832]: https://bugs.ruby-lang.org/issues/18832
+[Feature #18875]: https://bugs.ruby-lang.org/issues/18875
+[Feature #18925]: https://bugs.ruby-lang.org/issues/18925
+[Feature #18944]: https://bugs.ruby-lang.org/issues/18944
+[Feature #18949]: https://bugs.ruby-lang.org/issues/18949
+[Feature #18968]: https://bugs.ruby-lang.org/issues/18968
+[Feature #19008]: https://bugs.ruby-lang.org/issues/19008
+[Feature #19013]: https://bugs.ruby-lang.org/issues/19013
+[Feature #19026]: https://bugs.ruby-lang.org/issues/19026
+[Feature #19036]: https://bugs.ruby-lang.org/issues/19036
+[Feature #19060]: https://bugs.ruby-lang.org/issues/19060
+[Feature #19070]: https://bugs.ruby-lang.org/issues/19070
+[Feature #19071]: https://bugs.ruby-lang.org/issues/19071
+[Feature #19078]: https://bugs.ruby-lang.org/issues/19078
+[Bug #19087]: https://bugs.ruby-lang.org/issues/19087
+[Bug #19100]: https://bugs.ruby-lang.org/issues/19100
+[Feature #19104]: https://bugs.ruby-lang.org/issues/19104
+[Feature #19135]: https://bugs.ruby-lang.org/issues/19135
+[Feature #19138]: https://bugs.ruby-lang.org/issues/19138
+[Feature #19194]: https://bugs.ruby-lang.org/issues/19194
+[Molinillo]: https://github.com/CocoaPods/Molinillo
+[PubGrub]: https://github.com/jhawthorn/pub_grub
+[GH-net-protocol-14]: https://github.com/ruby/net-protocol/pull/14
+[GH-pathname-20]: https://github.com/ruby/pathname/pull/20
+[GH-6791]: https://github.com/ruby/ruby/pull/6791
+[GH-6868]: https://github.com/ruby/ruby/pull/6868
+[GH-rubygems-4475]: https://github.com/rubygems/rubygems/pull/4475
+[GH-rubygems-6149]: https://github.com/rubygems/rubygems/pull/6149
+[GH-rubygems-6167]: https://github.com/rubygems/rubygems/pull/6167
+[sec-156615]: https://hackerone.com/reports/156615
+[CVE-2021-33621]: https://www.ruby-lang.org/en/news/2022/11/22/http-response-splitting-in-cgi-cve-2021-33621/
+[wasm/README.md]: https://github.com/ruby/ruby/blob/master/wasm/README.md
+[ruby.wasm]: https://github.com/ruby/ruby.wasm
diff --git a/README b/README
deleted file mode 100644
index 3d2e636e4d..0000000000
--- a/README
+++ /dev/null
@@ -1,140 +0,0 @@
-* What's Ruby
-
-Ruby is the interpreted scripting language for quick and
-easy object-oriented programming. It has many features to
-process text files and to do system management tasks (as in
-Perl). It is simple, straight-forward, and extensible.
-
-
-* Features of Ruby
-
- + Simple Syntax
- + *Normal* Object-Oriented features(ex. class, method calls)
- + *Advanced* Object-Oriented features(ex. Mix-in, Singleton-method)
- + Operator Overloading
- + Exception Handling
- + Iterators and Closures
- + Garbage Collection
- + Dynamic Loading of Object files(on some architecture)
- + Highly Portable (works on many Unix-like/POSIX compatible platforms
- as well as Windows, Mac OS X, BeOS etc.)
- cf. http://redmine.ruby-lang.org/wiki/ruby-19/SupportedPlatforms
-
-
-* How to get Ruby
-
-The Ruby distribution files can be found in the following FTP site:
-
- ftp://ftp.ruby-lang.org/pub/ruby/
-
-The trunk of the Ruby source tree can be checked out with the
-following command:
-
- $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
-
-There are some other branches under development. Try the following
-command and see the list of branches:
-
- $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
-
-
-* Ruby home-page
-
-The URL of the Ruby home-page is:
-
- http://www.ruby-lang.org/
-
-
-* Mailing list
-
-There is a mailing list to talk about Ruby.
-To subscribe this list, please send the following phrase
-
- subscribe YourFirstName YourFamilyName
-e.g.
- subscribe Joseph Smith
-
-in the mail body (not subject) to the address <ruby-talk-ctl@ruby-lang.org>.
-
-
-* How to compile and install
-
-This is what you need to do to compile and install Ruby:
-
- 1. If ./configure does not exist or is older than configure.in,
- run autoconf to (re)generate configure.
-
- 2. Run ./configure, which will generate config.h and Makefile.
-
- Some C compiler flags may be added by default depending on your
- environment. Specify optflags=.. and warnflags=.. as necessary
- to override them.
-
- 3. Edit defines.h if you need. Usually this step will not be needed.
-
- 4. Remove comment mark(#) before the module names from ext/Setup (or
- add module names if not present), if you want to link modules
- statically.
-
- If you don't want to compile non static extension modules
- (probably on architectures which does not allow dynamic loading),
- remove comment mark from the line "#option nodynamic" in
- ext/Setup.
-
- 5. Run make.
-
- 6. Optionally, run 'make test' to check whether the compiled Ruby
- interpreter works well. If you see the message "test succeeded",
- your ruby works as it should (hopefully).
-
- 7. Run 'make install'
-
- This command will create following directories and install files
- onto them.
-
- * ${DESTDIR}${prefix}/bin
- * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib
- * ${DESTDIR}${prefix}/lib/ruby
- * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib/ruby/site_ruby
- * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby
- * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/share/man/man1
- * ${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system
-
- If Ruby's API version is `x.y.z', the ((|${MAJOR}|)) is `x', the
- ((|${MINOR}|)) is `y', and the ((|${TEENY}|)) is `z'.
-
- NOTE: teeny of the API version may be different from one of
- Ruby's program version
-
- You may have to be a super user to install ruby.
-
-If you fail to compile ruby, please send the detailed error report with
-the error log and machine/OS type, to help others.
-
-
-* Copying
-
-See the file COPYING.
-
-
-* The Author
-
-Feel free to send comments and bug reports to the author. Here is the
-author's latest mail address:
-
- matz@netlab.jp
-
--------------------------------------------------------
-created at: Thu Aug 3 11:57:36 JST 1995
-Local variables:
-mode: indented-text
-end:
diff --git a/README.EXT b/README.EXT
index c2b2d9d52d..48b8d964c4 100644
--- a/README.EXT
+++ b/README.EXT
@@ -1,1466 +1 @@
-.\" README.EXT - -*- Text -*- created at: Mon Aug 7 16:45:54 JST 1995
-
-This document explains how to make extension libraries for Ruby.
-
-1. Basic knowledge
-
-In C, variables have types and data do not have types. In contrast,
-Ruby variables do not have a static type, and data themselves have
-types, so data will need to be converted between the languages.
-
-Data in Ruby are represented by the C type `VALUE'. Each VALUE data
-has its data-type.
-
-To retrieve C data from a VALUE, you need to:
-
- (1) Identify the VALUE's data type
- (2) Convert the VALUE into C data
-
-Converting to the wrong data type may cause serious problems.
-
-
-1.1 Data-types
-
-The Ruby interpreter has the following data types:
-
- T_NIL nil
- T_OBJECT ordinary object
- T_CLASS class
- T_MODULE module
- T_FLOAT floating point number
- T_STRING string
- T_REGEXP regular expression
- T_ARRAY array
- T_HASH associative array
- T_STRUCT (Ruby) structure
- T_BIGNUM multi precision integer
- T_FIXNUM Fixnum(31bit or 63bit integer)
- T_COMPLEX complex number
- T_RATIONAL rational number
- T_FILE IO
- T_TRUE true
- T_FALSE false
- T_DATA data
- T_SYMBOL symbol
-
-In addition, there are several other types used internally:
-
- T_ICLASS
- T_MATCH
- T_UNDEF
- T_NODE
- T_ZOMBIE
-
-Most of the types are represented by C structures.
-
-1.2 Check Data Type of the VALUE
-
-The macro TYPE() defined in ruby.h shows the data type of the VALUE.
-TYPE() returns the constant number T_XXXX described above. To handle
-data types, your code will look something like this:
-
- switch (TYPE(obj)) {
- case T_FIXNUM:
- /* process Fixnum */
- break;
- case T_STRING:
- /* process String */
- break;
- case T_ARRAY:
- /* process Array */
- break;
- default:
- /* raise exception */
- rb_raise(rb_eTypeError, "not valid value");
- break;
- }
-
-There is the data-type check function
-
- void Check_Type(VALUE value, int type)
-
-which raises an exception if the VALUE does not have the type
-specified.
-
-There are also faster check macros for fixnums and nil.
-
- FIXNUM_P(obj)
- NIL_P(obj)
-
-1.3 Convert VALUE into C data
-
-The data for type T_NIL, T_FALSE, T_TRUE are nil, false, true
-respectively. They are singletons for the data type.
-The equivalent C constants are: Qnil, Qfalse, Qtrue.
-Note that Qfalse is false in C also (i.e. 0), but not Qnil.
-
-The T_FIXNUM data is a 31bit or 63bit length fixed integer.
-This size is depend on the size of long: if long is 32bit then
-T_FIXNUM is 31bit, if long is 64bit then T_FIXNUM is 63bit.
-T_FIXNUM can be converted to a C integer by using the
-FIX2INT() macro or FIX2LONG(). Though you have to check that the
-data is really FIXNUM before using them, they are faster. FIX2LONG()
-never raises exceptions, but FIX2INT() raises RangeError if the
-result is bigger or smaller than the size of int.
-There are also NUM2INT() and NUM2LONG() which converts any Ruby
-numbers into C integers. These macros includes a type check,
-so an exception will be raised if the conversion failed. NUM2DBL()
-can be used to retrieve the double float value in the same way.
-
-You can use the macros
-StringValue() and StringValuePtr() to get a char* from a VALUE.
-StringValue(var) replaces var's value with the result of "var.to_str()".
-StringValuePtr(var) does same replacement and returns char*
-representation of var. These macros will skip the replacement if var
-is a String. Notice that the macros take only the lvalue as their
-argument, to change the value of var in place.
-
-You can also use the macro named StringValueCStr(). This is just
-like StringValuePtr(), but always add nul character at the end of
-the result. If the result contains nul character, this macro causes
-the ArgumentError exception.
-StringValuePtr() doesn't guarantee the existence of a nul at the end
-of the result, and the result may contain nul.
-
-Other data types have corresponding C structures, e.g. struct RArray
-for T_ARRAY etc. The VALUE of the type which has the corresponding
-structure can be cast to retrieve the pointer to the struct. The
-casting macro will be of the form RXXXX for each data type; for
-instance, RARRAY(obj). See "ruby.h".
-
-There are some accessing macros for structure members, for example
-`RSTRING_LEN(str)' to get the size of the Ruby String object. The
-allocated region can be accessed by `RSTRING_PTR(str)'. For arrays,
-use `RARRAY_LEN(ary)' and `RARRAY_PTR(ary)' respectively.
-
-Notice: Do not change the value of the structure directly, unless you
-are responsible for the result. This ends up being the cause of
-interesting bugs.
-
-1.4 Convert C data into VALUE
-
-To convert C data to Ruby values:
-
- * FIXNUM
-
- left shift 1 bit, and turn on LSB.
-
- * Other pointer values
-
- cast to VALUE.
-
-You can determine whether a VALUE is pointer or not by checking its LSB.
-
-Notice Ruby does not allow arbitrary pointer values to be a VALUE. They
-should be pointers to the structures which Ruby knows about. The known
-structures are defined in <ruby.h>.
-
-To convert C numbers to Ruby values, use these macros.
-
- INT2FIX() for integers within 31bits.
- INT2NUM() for arbitrary sized integer.
-
-INT2NUM() converts an integer into a Bignum if it is out of the FIXNUM
-range, but is a bit slower.
-
-1.5 Manipulating Ruby data
-
-As I already mentioned, it is not recommended to modify an object's
-internal structure. To manipulate objects, use the functions supplied
-by the Ruby interpreter. Some (not all) of the useful functions are
-listed below:
-
- String functions
-
- rb_str_new(const char *ptr, long len)
-
- Creates a new Ruby string.
-
- rb_str_new2(const char *ptr)
- rb_str_new_cstr(const char *ptr)
-
- Creates a new Ruby string from a C string. This is equivalent to
- rb_str_new(ptr, strlen(ptr)).
-
- rb_tainted_str_new(const char *ptr, long len)
-
- Creates a new tainted Ruby string. Strings from external data
- sources should be tainted.
-
- rb_tainted_str_new2(const char *ptr)
- rb_tainted_str_new_cstr(const char *ptr)
-
- Creates a new tainted Ruby string from a C string.
-
- rb_sprintf(const char *format, ...)
- rb_vsprintf(const char *format, va_list ap)
-
- Creates a new Ruby string with printf(3) format.
-
- rb_str_cat(VALUE str, const char *ptr, long len)
-
- Appends len bytes of data from ptr to the Ruby string.
-
- rb_str_cat2(VALUE str, const char* ptr)
-
- Appends C string ptr to Ruby string str. This function is
- equivalent to rb_str_cat(str, ptr, strlen(ptr)).
-
- rb_str_catf(VALUE str, const char* format, ...)
- rb_str_vcatf(VALUE str, const char* format, va_list ap)
-
- Appends C string format and successive arguments to Ruby string
- str according to a printf-like format. These functions are
- equivalent to rb_str_cat2(str, rb_sprintf(format, ...)) and
- rb_str_cat2(str, rb_vsprintf(format, ap)), respectively.
-
- rb_enc_str_new(const char *ptr, long len, rb_encoding *enc)
-
- Creates a new Ruby string with the specified encoding.
-
- rb_usascii_str_new(const char *ptr, long len)
- rb_usascii_str_new_cstr(const char *ptr)
-
- Creates a new Ruby string with encoding US-ASCII.
-
- rb_str_resize(VALUE str, long len)
-
- Resizes Ruby string to len bytes. If str is not modifiable, this
- function raises an exception. The length of str must be set in
- advance. If len is less than the old length the content beyond
- len bytes is discarded, else if len is greater than the old length
- the content beyond the old length bytes will not be preserved but
- will be garbage. Note that RSTRING_PTR(str) may change by calling
- this function.
-
- rb_str_set_len(VALUE str, long len)
-
- Sets the length of Ruby string. If str is not modifiable, this
- function raises an exception. This function preserves the content
- upto len bytes, regardless RSTRING_LEN(str). len must not exceed
- the capacity of str.
-
- Array functions
-
- rb_ary_new()
-
- Creates an array with no elements.
-
- rb_ary_new2(long len)
-
- Creates an array with no elements, allocating internal buffer
- for len elements.
-
- rb_ary_new3(long n, ...)
-
- Creates an n-element array from the arguments.
-
- rb_ary_new4(long n, VALUE *elts)
-
- Creates an n-element array from a C array.
-
- rb_ary_to_ary(VALUE obj)
-
- Converts the object into an array.
- Equivalent to Object#to_ary.
-
- There are many functions to operate an array.
- They may dump core if other types are given.
-
- rb_ary_aref(argc, VALUE *argv, VALUE ary)
-
- Equivaelent to Array#[].
-
- rb_ary_entry(VALUE ary, long offset)
-
- ary[offset]
-
- rb_ary_subseq(VALUE ary, long beg, long len)
-
- ary[beg, len]
-
- rb_ary_push(VALUE ary, VALUE val)
- rb_ary_pop(VALUE ary)
- rb_ary_shift(VALUE ary)
- rb_ary_unshift(VALUE ary, VALUE val)
-
-
-2. Extending Ruby with C
-
-2.1 Adding new features to Ruby
-
-You can add new features (classes, methods, etc.) to the Ruby
-interpreter. Ruby provides APIs for defining the following things:
-
- * Classes, Modules
- * Methods, Singleton Methods
- * Constants
-
-2.1.1 Class/module definition
-
-To define a class or module, use the functions below:
-
- VALUE rb_define_class(const char *name, VALUE super)
- VALUE rb_define_module(const char *name)
-
-These functions return the newly created class or module. You may
-want to save this reference into a variable to use later.
-
-To define nested classes or modules, use the functions below:
-
- VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
- VALUE rb_define_module_under(VALUE outer, const char *name)
-
-2.1.2 Method/singleton method definition
-
-To define methods or singleton methods, use these functions:
-
- void rb_define_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
-
- void rb_define_singleton_method(VALUE object, const char *name,
- VALUE (*func)(), int argc)
-
-The `argc' represents the number of the arguments to the C function,
-which must be less than 17. But I doubt you'll need that many.
-
-If `argc' is negative, it specifies the calling sequence, not number of
-the arguments.
-
-If argc is -1, the function will be called as:
-
- VALUE func(int argc, VALUE *argv, VALUE obj)
-
-where argc is the actual number of arguments, argv is the C array of
-the arguments, and obj is the receiver.
-
-If argc is -2, the arguments are passed in a Ruby array. The function
-will be called like:
-
- VALUE func(VALUE obj, VALUE args)
-
-where obj is the receiver, and args is the Ruby array containing
-actual arguments.
-
-There are some more functions to define methods. One takes an ID
-as the name of method to be defined. See 2.2.2 for IDs.
-
- void rb_define_method_id(VALUE klass, ID name,
- VALUE (*func)(ANYARGS), int argc)
-
-There are two functions to define private/protected methods:
-
- void rb_define_private_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
- void rb_define_protected_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
-
-At last, rb_define_module_function defines a module functions,
-which are private AND singleton methods of the module.
-For example, sqrt is the module function defined in Math module.
-It can be called in the following way:
-
- Math.sqrt(4)
-
-or
-
- include Math
- sqrt(4)
-
-To define module functions, use:
-
- void rb_define_module_function(VALUE module, const char *name,
- VALUE (*func)(), int argc)
-
-In addition, function-like methods, which are private methods defined
-in the Kernel module, can be defined using:
-
- void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-
-To define an alias for the method,
-
- void rb_define_alias(VALUE module, const char* new, const char* old);
-
-To define a reader/writer for an attribute,
-
- void rb_define_attr(VALUE klass, const char *name, int read, int write)
-
-To define and undefine the `allocate' class method,
-
- void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
- void rb_undef_alloc_func(VALUE klass);
-
-func has to take the klass as the argument and return a newly
-allocated instance. This instance should be as empty as possible,
-without any expensive (including external) resources.
-
-2.1.3 Constant definition
-
-We have 2 functions to define constants:
-
- void rb_define_const(VALUE klass, const char *name, VALUE val)
- void rb_define_global_const(const char *name, VALUE val)
-
-The former is to define a constant under specified class/module. The
-latter is to define a global constant.
-
-2.2 Use Ruby features from C
-
-There are several ways to invoke Ruby's features from C code.
-
-2.2.1 Evaluate Ruby Programs in a String
-
-The easiest way to use Ruby's functionality from a C program is to
-evaluate the string as Ruby program. This function will do the job:
-
- VALUE rb_eval_string(const char *str)
-
-Evaluation is done under the current context, thus current local variables
-of the innermost method (which is defined by Ruby) can be accessed.
-
-Note that the evaluation can raise an exception. There is a safer
-function:
-
- VALUE rb_eval_string_protect(const char *str, int *state)
-
-It returns nil when an error occur. Moreover, *state is zero if str was
-successfully evaluated, or nonzero otherwise.
-
-
-2.2.2 ID or Symbol
-
-You can invoke methods directly, without parsing the string. First I
-need to explain about ID. ID is the integer number to represent
-Ruby's identifiers such as variable names. The Ruby data type
-corresponding to ID is Symbol. It can be accessed from Ruby in the
-form:
-
- :Identifier
-or
- :"any kind of string"
-
-You can get the ID value from a string within C code by using
-
- rb_intern(const char *name)
-
-You can retrieve ID from Ruby object (Symbol or String) given as an
-argument by using
-
- rb_to_id(VALUE symbol)
-
-You can convert C ID to Ruby Symbol by using
-
- VALUE ID2SYM(ID id)
-
-and to convert Ruby Symbol object to ID, use
-
- ID SYM2ID(VALUE symbol)
-
-2.2.3 Invoke Ruby method from C
-
-To invoke methods directly, you can use the function below
-
- VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
-
-This function invokes a method on the recv, with the method name
-specified by the symbol mid.
-
-2.2.4 Accessing the variables and constants
-
-You can access class variables and instance variables using access
-functions. Also, global variables can be shared between both
-environments. There's no way to access Ruby's local variables.
-
-The functions to access/modify instance variables are below:
-
- VALUE rb_ivar_get(VALUE obj, ID id)
- VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
-
-id must be the symbol, which can be retrieved by rb_intern().
-
-To access the constants of the class/module:
-
- VALUE rb_const_get(VALUE obj, ID id)
-
-See 2.1.3 for defining new constant.
-
-3. Information sharing between Ruby and C
-
-3.1 Ruby constants that C can be accessed from C
-
-As stated in section 1.3,
-the following Ruby constants can be referred from C.
-
- Qtrue
- Qfalse
-
-Boolean values. Qfalse is false in C also (i.e. 0).
-
- Qnil
-
-Ruby nil in C scope.
-
-3.2 Global variables shared between C and Ruby
-
-Information can be shared between the two environments using shared global
-variables. To define them, you can use functions listed below:
-
- void rb_define_variable(const char *name, VALUE *var)
-
-This function defines the variable which is shared by both environments.
-The value of the global variable pointed to by `var' can be accessed
-through Ruby's global variable named `name'.
-
-You can define read-only (from Ruby, of course) variables using the
-function below.
-
- void rb_define_readonly_variable(const char *name, VALUE *var)
-
-You can defined hooked variables. The accessor functions (getter and
-setter) are called on access to the hooked variables.
-
- void rb_define_hooked_variable(const char *name, VALUE *var,
- VALUE (*getter)(), void (*setter)())
-
-If you need to supply either setter or getter, just supply 0 for the
-hook you don't need. If both hooks are 0, rb_define_hooked_variable()
-works just like rb_define_variable().
-
-The prototypes of the getter and setter functions are as follows:
-
- VALUE (*getter)(ID id, VALUE *var);
- void (*setter)(VALUE val, ID id, VALUE *var);
-
-
-Also you can define a Ruby global variable without a corresponding C
-variable. The value of the variable will be set/get only by hooks.
-
- void rb_define_virtual_variable(const char *name,
- VALUE (*getter)(), void (*setter)())
-
-The prototypes of the getter and setter functions are as follows:
-
- VALUE (*getter)(ID id);
- void (*setter)(VALUE val, ID id);
-
-
-3.3 Encapsulate C data into a Ruby object
-
-To wrap and objectify a C pointer as a Ruby object (so called
-DATA), use Data_Wrap_Struct().
-
- Data_Wrap_Struct(klass, mark, free, ptr)
-
-Data_Wrap_Struct() returns a created DATA object. The klass argument
-is the class for the DATA object. The mark argument is the function
-to mark Ruby objects pointed by this data. The free argument is the
-function to free the pointer allocation. If this is -1, the pointer
-will be just freed. The functions mark and free will be called from
-garbage collector.
-
-These mark / free functions are invoked during GC execution. No
-object allocations are allowed during it, so do not allocate ruby
-objects inside them.
-
-You can allocate and wrap the structure in one step.
-
- Data_Make_Struct(klass, type, mark, free, sval)
-
-This macro returns an allocated Data object, wrapping the pointer to
-the structure, which is also allocated. This macro works like:
-
- (sval = ALLOC(type), Data_Wrap_Struct(klass, mark, free, sval))
-
-Arguments klass, mark, and free work like their counterparts in
-Data_Wrap_Struct(). A pointer to the allocated structure will be
-assigned to sval, which should be a pointer of the type specified.
-
-To retrieve the C pointer from the Data object, use the macro
-Data_Get_Struct().
-
- Data_Get_Struct(obj, type, sval)
-
-A pointer to the structure will be assigned to the variable sval.
-
-See the example below for details.
-
-4. Example - Creating dbm extension
-
-OK, here's the example of making an extension library. This is the
-extension to access DBMs. The full source is included in the ext/
-directory in the Ruby's source tree.
-
-(1) make the directory
-
- % mkdir ext/dbm
-
-Make a directory for the extension library under ext directory.
-
-(2) design the library
-
-You need to design the library features, before making it.
-
-(3) write C code.
-
-You need to write C code for your extension library. If your library
-has only one source file, choosing ``LIBRARY.c'' as a file name is
-preferred. On the other hand, in case your library has multiple source
-files, avoid choosing ``LIBRARY.c'' for a file name. It may conflict
-with an intermediate file ``LIBRARY.o'' on some platforms.
-
-Ruby will execute the initializing function named ``Init_LIBRARY'' in
-the library. For example, ``Init_dbm()'' will be executed when loading
-the library.
-
-Here's the example of an initializing function.
-
---
-void
-Init_dbm(void)
-{
- /* define DBM class */
- cDBM = rb_define_class("DBM", rb_cObject);
- /* DBM includes Enumerate module */
- rb_include_module(cDBM, rb_mEnumerable);
-
- /* DBM has class method open(): arguments are received as C array */
- rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
-
- /* DBM instance method close(): no args */
- rb_define_method(cDBM, "close", fdbm_close, 0);
- /* DBM instance method []: 1 argument */
- rb_define_method(cDBM, "[]", fdbm_fetch, 1);
- :
-
- /* ID for a instance variable to store DBM data */
- id_dbm = rb_intern("dbm");
-}
---
-
-The dbm extension wraps the dbm struct in the C environment using
-Data_Make_Struct.
-
---
-struct dbmdata {
- int di_size;
- DBM *di_dbm;
-};
-
-
-obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
---
-
-This code wraps the dbmdata structure into a Ruby object. We avoid
-wrapping DBM* directly, because we want to cache size information.
-
-To retrieve the dbmdata structure from a Ruby object, we define the
-following macro:
-
---
-#define GetDBM(obj, dbmp) {\
- Data_Get_Struct(obj, struct dbmdata, dbmp);\
- if (dbmp->di_dbm == 0) closed_dbm();\
-}
---
-
-This sort of complicated macro does the retrieving and close checking for
-the DBM.
-
-There are three kinds of way to receive method arguments. First,
-methods with a fixed number of arguments receive arguments like this:
-
---
-static VALUE
-fdbm_delete(VALUE obj, VALUE keystr)
-{
- :
-}
---
-
-The first argument of the C function is the self, the rest are the
-arguments to the method.
-
-Second, methods with an arbitrary number of arguments receive
-arguments like this:
-
---
-static VALUE
-fdbm_s_open(int argc, VALUE *argv, VALUE klass)
-{
- :
- if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
- mode = 0666; /* default value */
- }
- :
-}
---
-
-The first argument is the number of method arguments, the second
-argument is the C array of the method arguments, and the third
-argument is the receiver of the method.
-
-You can use the function rb_scan_args() to check and retrieve the
-arguments. The third argument is a string that specifies how to
-capture method arguments and assign them to the following VALUE
-references.
-
-
-The following is an example of a method that takes arguments by Ruby's
-array:
-
---
-static VALUE
-thread_initialize(VALUE thread, VALUE args)
-{
- :
-}
---
-
-The first argument is the receiver, the second one is the Ruby array
-which contains the arguments to the method.
-
-** Notice
-
-GC should know about global variables which refer to Ruby's objects, but
-are not exported to the Ruby world. You need to protect them by
-
- void rb_global_variable(VALUE *var)
-
-(4) prepare extconf.rb
-
-If the file named extconf.rb exists, it will be executed to generate
-Makefile.
-
-extconf.rb is the file for checking compilation conditions etc. You
-need to put
-
- require 'mkmf'
-
-at the top of the file. You can use the functions below to check
-various conditions.
-
- have_library(lib, func): check whether library containing function exists.
- have_func(func, header): check whether function exists
- have_header(header): check whether header file exists
- create_makefile(target): generate Makefile
-
-The value of the variables below will affect the Makefile.
-
- $CFLAGS: included in CFLAGS make variable (such as -O)
- $CPPFLAGS: included in CPPFLAGS make variable (such as -I, -D)
- $LDFLAGS: included in LDFLAGS make variable (such as -L)
- $objs: list of object file names
-
-Normally, the object files list is automatically generated by searching
-source files, but you must define them explicitly if any sources will
-be generated while building.
-
-If a compilation condition is not fulfilled, you should not call
-``create_makefile''. The Makefile will not be generated, compilation will
-not be done.
-
-(5) prepare depend (optional)
-
-If the file named depend exists, Makefile will include that file to
-check dependencies. You can make this file by invoking
-
- % gcc -MM *.c > depend
-
-It's harmless. Prepare it.
-
-(6) generate Makefile
-
-Try generating the Makefile by:
-
- ruby extconf.rb
-
-If the library should be installed under vendor_ruby directory
-instead of site_ruby directory, use --vendor option as follows.
-
- ruby extconf.rb --vendor
-
-You don't need this step if you put the extension library under the ext
-directory of the ruby source tree. In that case, compilation of the
-interpreter will do this step for you.
-
-(7) make
-
-Type
-
- make
-
-to compile your extension. You don't need this step either if you have
-put the extension library under the ext directory of the ruby source tree.
-
-(8) debug
-
-You may need to rb_debug the extension. Extensions can be linked
-statically by adding the directory name in the ext/Setup file so that
-you can inspect the extension with the debugger.
-
-(9) done, now you have the extension library
-
-You can do anything you want with your library. The author of Ruby
-will not claim any restrictions on your code depending on the Ruby API.
-Feel free to use, modify, distribute or sell your program.
-
-Appendix A. Ruby source files overview
-
-ruby language core
-
- class.c : classes and modules
- error.c : exception classes and exception mechanism
- gc.c : memory management
- load.c : library loading
- object.c : objects
- variable.c : variables and constants
-
-ruby syntax parser
- parse.y
- -> parse.c : automatically generated
- keywords : reserved keywords
- -> lex.c : automatically generated
-
-ruby evaluator (a.k.a. YARV)
- compile.c
- eval.c
- eval_error.c
- eval_jump.c
- eval_safe.c
- insns.def : definition of VM instructions
- iseq.c : implementation of VM::ISeq
- thread.c : thread management and context swiching
- thread_win32.c : thread implementation
- thread_pthread.c : ditto
- vm.c
- vm_dump.c
- vm_eval.c
- vm_exec.c
- vm_insnhelper.c
- vm_method.c
-
- opt_insns_unif.def : instruction unification
- opt_operand.def : definitions for optimization
-
- -> insn*.inc : automatically generated
- -> opt*.inc : automatically generated
- -> vm.inc : automatically generated
-
-regular expression engine (oniguruma)
- regex.c
- regcomp.c
- regenc.c
- regerror.c
- regexec.c
- regparse.c
- regsyntax.c
-
-utility functions
-
- debug.c : debug symbols for C debuggger
- dln.c : dynamic loading
- st.c : general purpose hash table
- strftime.c : formatting times
- util.c : misc utilities
-
-ruby interpreter implementation
-
- dmyext.c
- dmydln.c
- dmyencoding.c
- id.c
- inits.c
- main.c
- ruby.c
- version.c
-
- gem_prelude.rb
- prelude.rb
-
-
-class library
-
- array.c : Array
- bignum.c : Bignum
- compar.c : Comparable
- complex.c : Complex
- cont.c : Fiber, Continuation
- dir.c : Dir
- enum.c : Enumerable
- enumerator.c : Enumerator
- file.c : File
- hash.c : Hash
- io.c : IO
- marshal.c : Marshal
- math.c : Math
- numeric.c : Numeric, Integer, Fixnum, Float
- pack.c : Array#pack, String#unpack
- proc.c : Binding, Proc
- process.c : Process
- random.c : random number
- range.c : Range
- rational.c : Rational
- re.c : Regexp, MatchData
- signal.c : Signal
- sprintf.c :
- string.c : String
- struct.c : Struct
- time.c : Time
-
- defs/knwon_errors.def : Errno::* exception classes
- -> known_errors.inc : automatically generated
-
-multilingualization
- encoding.c : Encoding
- transcode.c : Encoding::Converter
- enc/*.c : encoding classes
- enc/trans/* : codepoint mapping tables
-
-goruby interpreter implementation
-
- goruby.c
- golf_prelude.rb : goruby specific libraries.
- -> golf_prelude.c : automatically generated
-
-
-Appendix B. Ruby extension API reference
-
-** Types
-
- VALUE
-
-The type for the Ruby object. Actual structures are defined in ruby.h,
-such as struct RString, etc. To refer the values in structures, use
-casting macros like RSTRING(obj).
-
-** Variables and constants
-
- Qnil
-
-const: nil object
-
- Qtrue
-
-const: true object(default true value)
-
- Qfalse
-
-const: false object
-
-** C pointer wrapping
-
- Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
-
-Wrap a C pointer into a Ruby object. If object has references to other
-Ruby objects, they should be marked by using the mark function during
-the GC process. Otherwise, mark should be 0. When this object is no
-longer referred by anywhere, the pointer will be discarded by free
-function.
-
- Data_Make_Struct(klass, type, mark, free, sval)
-
-This macro allocates memory using malloc(), assigns it to the variable
-sval, and returns the DATA encapsulating the pointer to memory region.
-
- Data_Get_Struct(data, type, sval)
-
-This macro retrieves the pointer value from DATA, and assigns it to
-the variable sval.
-
-** Checking data types
-
-TYPE(value)
-FIXNUM_P(value)
-NIL_P(value)
-void Check_Type(VALUE value, int type)
-void Check_SafeStr(VALUE value)
-
-** Data type conversion
-
-FIX2INT(value), INT2FIX(i)
-FIX2LONG(value), LONG2FIX(l)
-NUM2INT(value), INT2NUM(i)
-NUM2UINT(value), UINT2NUM(ui)
-NUM2LONG(value), LONG2NUM(l)
-NUM2ULONG(value), ULONG2NUM(ul)
-NUM2LL(value), LL2NUM(ll)
-NUM2ULL(value), ULL2NUM(ull)
-NUM2OFFT(value), OFFT2NUM(off)
-NUM2SIZET(value), SIZET2NUM(size)
-NUM2SSIZET(value), SSIZET2NUM(ssize)
-NUM2DBL(value)
-rb_float_new(f)
-StringValue(value)
-StringValuePtr(value)
-StringValueCStr(value)
-rb_str_new2(s)
-
-** defining class/module
-
- VALUE rb_define_class(const char *name, VALUE super)
-
-Defines a new Ruby class as a subclass of super.
-
- VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
-
-Creates a new Ruby class as a subclass of super, under the module's
-namespace.
-
- VALUE rb_define_module(const char *name)
-
-Defines a new Ruby module.
-
- VALUE rb_define_module_under(VALUE module, const char *name)
-
-Defines a new Ruby module under the module's namespace.
-
- void rb_include_module(VALUE klass, VALUE module)
-
-Includes module into class. If class already includes it, just
-ignored.
-
- void rb_extend_object(VALUE object, VALUE module)
-
-Extend the object with the module's attributes.
-
-** Defining Global Variables
-
- void rb_define_variable(const char *name, VALUE *var)
-
-Defines a global variable which is shared between C and Ruby. If name
-contains a character which is not allowed to be part of the symbol,
-it can't be seen from Ruby programs.
-
- void rb_define_readonly_variable(const char *name, VALUE *var)
-
-Defines a read-only global variable. Works just like
-rb_define_variable(), except the defined variable is read-only.
-
- void rb_define_virtual_variable(const char *name,
- VALUE (*getter)(), VALUE (*setter)())
-
-Defines a virtual variable, whose behavior is defined by a pair of C
-functions. The getter function is called when the variable is
-referenced. The setter function is called when the variable is set to a
-value. The prototype for getter/setter functions are:
-
- VALUE getter(ID id)
- void setter(VALUE val, ID id)
-
-The getter function must return the value for the access.
-
- void rb_define_hooked_variable(const char *name, VALUE *var,
- VALUE (*getter)(), VALUE (*setter)())
-
-Defines hooked variable. It's a virtual variable with a C variable.
-The getter is called as
-
- VALUE getter(ID id, VALUE *var)
-
-returning a new value. The setter is called as
-
- void setter(VALUE val, ID id, VALUE *var)
-
-GC requires C global variables which hold Ruby values to be marked.
-
- void rb_global_variable(VALUE *var)
-
-Tells GC to protect these variables.
-
-** Constant Definition
-
- void rb_define_const(VALUE klass, const char *name, VALUE val)
-
-Defines a new constant under the class/module.
-
- void rb_define_global_const(const char *name, VALUE val)
-
-Defines a global constant. This is just the same as
-
- rb_define_const(cKernal, name, val)
-
-** Method Definition
-
- rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-Defines a method for the class. func is the function pointer. argc
-is the number of arguments. if argc is -1, the function will receive
-3 arguments: argc, argv, and self. if argc is -2, the function will
-receive 2 arguments, self and args, where args is a Ruby array of
-the method arguments.
-
- rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-Defines a private method for the class. Arguments are same as
-rb_define_method().
-
- rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-Defines a singleton method. Arguments are same as rb_define_method().
-
- rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
-
-Retrieve argument from argc and argv to given VALUE references
-according to the format string. The format can be described in ABNF
-as follows:
-
---
-scan-arg-spec := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
-
-param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec / pre-opt-post-arg-spec
-pre-arg-spec := num-of-leading-mandatory-args [num-of-optional-args]
-post-arg-spec := sym-for-variable-length-args [num-of-trailing-mandatory-args]
-pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args num-of-trailing-mandatory-args
-option-hash-arg-spec := sym-for-option-hash-arg
-block-arg-spec := sym-for-block-arg
-
-num-of-leading-mandatory-args := DIGIT ; The number of leading
- ; mandatory arguments
-num-of-optional-args := DIGIT ; The number of optional
- ; arguments
-sym-for-variable-length-args := "*" ; Indicates that variable
- ; length arguments are
- ; captured as a ruby array
-num-of-trailing-mandatory-args := DIGIT ; The number of trailing
- ; mandatory arguments
-sym-for-option-hash-arg := ":" ; Indicates that an option
- ; hash is captured if the last
- ; argument is a hash or can be
- ; converted to a hash with
- ; #to_hash. When the last
- ; argument is nil, it is
- ; captured if it is not
- ; ambiguous to take it as
- ; empty option hash; i.e. '*'
- ; is not specified and
- ; arguments are given more
- ; than sufficient.
-sym-for-block-arg := "&" ; Indicates that an iterator
- ; block should be captured if
- ; given
---
-
-For example, "12" means that the method requires at least one
-argument, and at most receives three (1+2) arguments. So, the format
-string must be followed by three variable references, which are to be
-assigned to captured arguments. For omitted arguments, variables are
-set to Qnil. NULL can be put in place of a variable reference, which
-means the corresponding captured argument(s) should be just dropped.
-
-The number of given arguments, excluding an option hash or iterator
-block, is returned.
-
-** Invoking Ruby method
-
- VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
-
-Invokes a method. To retrieve mid from a method name, use rb_intern().
-
- VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-
-Invokes a method, passing arguments by an array of values.
-
- VALUE rb_eval_string(const char *str)
-
-Compiles and executes the string as a Ruby program.
-
- ID rb_intern(const char *name)
-
-Returns ID corresponding to the name.
-
- char *rb_id2name(ID id)
-
-Returns the name corresponding ID.
-
- char *rb_class2name(VALUE klass)
-
-Returns the name of the class.
-
- int rb_respond_to(VALUE object, ID id)
-
-Returns true if the object responds to the message specified by id.
-
-** Instance Variables
-
- VALUE rb_iv_get(VALUE obj, const char *name)
-
-Retrieve the value of the instance variable. If the name is not
-prefixed by `@', that variable shall be inaccessible from Ruby.
-
- VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
-
-Sets the value of the instance variable.
-
-** Control Structure
-
- VALUE rb_block_call(VALUE recv, ID mid, int argc, VALUE * argv,
- VALUE (*func) (ANYARGS), VALUE data2)
-
-Calls a method on the recv, with the method name specified by the
-symbol mid, with argc arguments in argv, supplying func as the
-block. When func is called as the block, it will receive the value
-from yield as the first argument, and data2 as the second argument.
-When yielded with multiple values (in C, rb_yield_values(),
-rb_yield_values2() and rb_yield_splat()), data2 is packed as an Array,
-whereas yielded values can be gotten via argc/argv of the third/fourth
-arguments.
-
- [OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
-
-Calls the function func1, supplying func2 as the block. func1 will be
-called with the argument arg1. func2 receives the value from yield as
-the first argument, arg2 as the second argument.
-
-When rb_iterate is used in 1.9, func1 has to call some Ruby-level method.
-This function is obsolete since 1.9; use rb_block_call instead.
-
- VALUE rb_yield(VALUE val)
-
-Evaluates the block with value val.
-
- VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
-
-Calls the function func1, with arg1 as the argument. If an exception
-occurs during func1, it calls func2 with arg2 as the argument. The
-return value of rb_rescue() is the return value from func1 if no
-exception occurs, from func2 otherwise.
-
- VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
-
-Calls the function func1 with arg1 as the argument, then calls func2
-with arg2 if execution terminated. The return value from
-rb_ensure() is that of func1 when no exception occured.
-
- VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state)
-
-Calls the function func with arg as the argument. If no exception
-occured during func, it returns the result of func and *state is zero.
-Otherwise, it returns Qnil and sets *state to nonzero. If state is
-NULL, it is not set in both cases.
-
- void rb_jump_tag(int state)
-
-Continues the exception caught by rb_protect() and rb_eval_string_protect().
-state must be the returned value from those functions. This function
-never return to the caller.
-
-** Exceptions and Errors
-
- void rb_warn(const char *fmt, ...)
-
-Prints a warning message according to a printf-like format.
-
- void rb_warning(const char *fmt, ...)
-
-Prints a warning message according to a printf-like format, if
-$VERBOSE is true.
-
-void rb_raise(rb_eRuntimeError, const char *fmt, ...)
-
-Raises RuntimeError. The fmt is a format string just like printf().
-
- void rb_raise(VALUE exception, const char *fmt, ...)
-
-Raises a class exception. The fmt is a format string just like printf().
-
- void rb_fatal(const char *fmt, ...)
-
-Raises a fatal error, terminates the interpreter. No exception handling
-will be done for fatal errors, but ensure blocks will be executed.
-
- void rb_bug(const char *fmt, ...)
-
-Terminates the interpreter immediately. This function should be
-called under the situation caused by the bug in the interpreter. No
-exception handling nor ensure execution will be done.
-
-** Initialize and Start the Interpreter
-
-The embedding API functions are below (not needed for extension libraries):
-
- void ruby_init()
-
-Initializes the interpreter.
-
- void ruby_options(int argc, char **argv)
-
-Process command line arguments for the interpreter.
-
- void ruby_run()
-
-Starts execution of the interpreter.
-
- void ruby_script(char *name)
-
-Specifies the name of the script ($0).
-
-** Hooks for the Interpreter Events
-
- void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events, VALUE data)
-
-Adds a hook function for the specified interpreter events.
-events should be Or'ed value of:
-
- RUBY_EVENT_LINE
- RUBY_EVENT_CLASS
- RUBY_EVENT_END
- RUBY_EVENT_CALL
- RUBY_EVENT_RETURN
- RUBY_EVENT_C_CALL
- RUBY_EVENT_C_RETURN
- RUBY_EVENT_RAISE
- RUBY_EVENT_ALL
-
-The definition of rb_event_hook_func_t is below:
-
- typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
- VALUE self, ID id, VALUE klass)
-
-The third argument `data' to rb_add_event_hook() is passed to the hook
-function as the second argument, which was the pointer to the current
-NODE in 1.8. See RB_EVENT_HOOKS_HAVE_CALLBACK_DATA below.
-
- int rb_remove_event_hook(rb_event_hook_func_t func)
-
-Removes the specified hook function.
-
-** Macros for the Compatibilities
-
-Some macros to check API compatibilities are available by default.
-
- NORETURN_STYLE_NEW
-
-Means that NORETURN macro is functional style instead of prefix.
-
- HAVE_RB_DEFINE_ALLOC_FUNC
-
-Means that function rb_define_alloc_func() is provided, that means the
-allocation framework is used. This is same as the result of
-have_func("rb_define_alloc_func", "ruby.h").
-
- HAVE_RB_REG_NEW_STR
-
-Means that function rb_reg_new_str() is provided, that creates Regexp
-object from String object. This is same as the result of
-have_func("rb_reg_new_str", "ruby.h").
-
- HAVE_RB_IO_T
-
-Means that type rb_io_t is provided.
-
- USE_SYMBOL_AS_METHOD_NAME
-
-Means that Symbols will be returned as method names, e.g.,
-Module#methods, #singleton_methods and so on.
-
- HAVE_RUBY_*_H
-
-Defined in ruby.h and means correspoinding header is available. For
-instance, when HAVE_RUBY_ST_H is defined you should use ruby/st.h not
-mere st.h.
-
- RB_EVENT_HOOKS_HAVE_CALLBACK_DATA
-
-Means that rb_add_event_hook() takes the third argument `data', to be
-passed to the given event hook function.
-
-Appendix C. Functions Available in extconf.rb
-
-These functions are available in extconf.rb:
-
- have_macro(macro, headers)
-
-Checks whether macro is defined with header. Returns true if the macro
-is defined.
-
- have_library(lib, func)
-
-Checks whether the library exists, containing the specified function.
-Returns true if the library exists.
-
- find_library(lib, func, path...)
-
-Checks whether a library which contains the specified function exists in
-path. Returns true if the library exists.
-
- have_func(func, header)
-
-Checks whether func exists with header. Returns true if the function
-exists. To check functions in an additional library, you need to
-check that library first using have_library().
-
- have_var(var, header)
-
-Checks whether var exists with header. Returns true if the variable
-exists. To check variables in an additional library, you need to
-check that library first using have_library().
-
- have_header(header)
-
-Checks whether header exists. Returns true if the header file exists.
-
- find_header(header, path...)
-
-Checks whether header exists in path. Returns true if the header file
-exists.
-
- have_struct_member(type, member, header)
-
-Checks whether type has member with header. Returns true if the type
-is defined and has the member.
-
- have_type(type, header, opt)
-
-Checks whether type is defined with header. Returns true if the type
-is defined.
-
- check_sizeof(type, header)
-
-Checks the size of type in char with header. Returns the size if the
-type is defined, otherwise nil.
-
- create_makefile(target)
-
-Generates the Makefile for the extension library. If you don't invoke
-this method, the compilation will not be done.
-
- find_executable(bin, path)
-
-Finds command in path, which is File::PATH_SEPARATOR-separated list of
-directories. If path is nil or omitted, environment variable PATH
-will be used. Returns the path name of the command if it is found,
-otherwise nil.
-
- with_config(withval[, default=nil])
-
-Parses the command line options and returns the value specified by
---with-<withval>.
-
- enable_config(config, *defaults)
- disable_config(config, *defaults)
-
-Parses the command line options for boolean. Returns true if
---enable-<config> is given, or false if --disable-<config> is given.
-Otherwise, yields defaults to the given block and returns the result
-if it is called with a block, or returns defaults.
-
- dir_config(target[, default_dir])
- dir_config(target[, default_include, default_lib])
-
-Parses the command line options and adds the directories specified by
---with-<target>-dir, --with-<target>-include, and/or --with-<target>-lib
-to $CFLAGS and/or $LDFLAGS. --with-<target>-dir=/path is equivalent to
---with-<target>-include=/path/include --with-<target>-lib=/path/lib.
-Returns an array of the added directories ([include_dir, lib_dir]).
-
- pkg_config(pkg)
-
-Obtains the information for pkg by pkg-config command. The actual
-command name can be overridden by --with-pkg-config command line
-option.
-
-/*
- * Local variables:
- * fill-column: 70
- * end:
- */
+Moved to doc/extension.rdoc
diff --git a/README.EXT.ja b/README.EXT.ja
index d6dac19861..f884ecbb0e 100644
--- a/README.EXT.ja
+++ b/README.EXT.ja
@@ -1,1567 +1 @@
-.\" README.EXT.ja - -*- Text -*- created at: Mon Aug 7 16:45:54 JST 1995
-
-Ruby¤Î³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Îºî¤êÊý¤òÀâÌÀ¤·¤Þ¤¹¡¥
-
-1¡¥´ðÁÃÃμ±
-
-C¤ÎÊÑ¿ô¤Ë¤Ï·¿¤¬¤¢¤ê¡¤¥Ç¡¼¥¿¤Ë¤Ï·¿¤¬¤¢¤ê¤Þ¤»¤ó¡¥¤Ç¤¹¤«¤é¡¤¤¿
-¤È¤¨¤Ð¥Ý¥¤¥ó¥¿¤òint¤ÎÊÑ¿ô¤ËÂåÆþ¤¹¤ë¤È¡¤¤½¤ÎÃͤÏÀ°¿ô¤È¤·¤Æ¼è
-¤ê°·¤ï¤ì¤Þ¤¹¡¥µÕ¤ËRuby¤ÎÊÑ¿ô¤Ë¤Ï·¿¤¬¤Ê¤¯¡¤¥Ç¡¼¥¿¤Ë·¿¤¬¤¢¤ê¤Þ
-¤¹¡¥¤³¤Î°ã¤¤¤Î¤¿¤á¡¤C¤ÈRuby¤ÏÁê¸ß¤ËÊÑ´¹¤·¤Ê¤±¤ì¤Ð¡¤¤ª¸ß¤¤¤Î
-¥Ç¡¼¥¿¤ò¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤»¤ó¡¥
-
-Ruby¤Î¥Ç¡¼¥¿¤ÏVALUE¤È¤¤¤¦C¤Î·¿¤Çɽ¸½¤µ¤ì¤Þ¤¹¡¥VALUE·¿¤Î¥Ç¡¼
-¥¿¤Ï¤½¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ò¼«Ê¬¤ÇÃΤäƤ¤¤Þ¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤È
-¤¤¤¦¤Î¤Ï¥Ç¡¼¥¿(¥ª¥Ö¥¸¥§¥¯¥È)¤Î¼ÂºÝ¤Î¹½Â¤¤ò°ÕÌ£¤·¤Æ¤¤¤Æ¡¤Ruby
-¤Î¥¯¥é¥¹¤È¤Ï¤Þ¤¿°ã¤Ã¤¿¤â¤Î¤Ç¤¹¡¥
-
-VALUE¤«¤éC¤Ë¤È¤Ã¤Æ°ÕÌ£¤Î¤¢¤ë¥Ç¡¼¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á¤Ë¤Ï
-
- (1) VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤òÃΤë
- (2) VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
-
-¤ÎξÊý¤¬É¬ÍפǤ¹¡¥(1)¤ò˺¤ì¤ë¤È´Ö°ã¤Ã¤¿¥Ç¡¼¥¿¤ÎÊÑ´¹¤¬¹Ô¤ï¤ì
-¤Æ¡¤ºÇ°­¥×¥í¥°¥é¥à¤¬core dump¤·¤Þ¤¹¡¥
-
-1.1 ¥Ç¡¼¥¿¥¿¥¤¥×
-
-Ruby¤Ë¤Ï¥æ¡¼¥¶¤¬»È¤¦²ÄǽÀ­¤Î¤¢¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
-
- T_NIL nil
- T_OBJECT Ä̾ï¤Î¥ª¥Ö¥¸¥§¥¯¥È
- T_CLASS ¥¯¥é¥¹
- T_MODULE ¥â¥¸¥å¡¼¥ë
- T_FLOAT ÉâÆ°¾®¿ôÅÀ¿ô
- T_STRING ʸ»úÎó
- T_REGEXP Àµµ¬É½¸½
- T_ARRAY ÇÛÎó
- T_HASH Ï¢ÁÛÇÛÎó
- T_STRUCT (Ruby¤Î)¹½Â¤ÂÎ
- T_BIGNUM ¿ÇÜĹÀ°¿ô
- T_FIXNUM Fixnum(31bit¤Þ¤¿¤Ï63bitĹÀ°¿ô)
- T_COMPLEX Ê£ÁÇ¿ô
- T_RATIONAL Í­Íý¿ô
- T_FILE Æþ½ÐÎÏ
- T_TRUE ¿¿
- T_FALSE µ¶
- T_DATA ¥Ç¡¼¥¿
- T_SYMBOL ¥·¥ó¥Ü¥ë
-
-¤½¤Î¾¤ËÆâÉô¤ÇÍøÍѤµ¤ì¤Æ¤¤¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
-
- T_ICLASS
- T_MATCH
- T_UNDEF
- T_NODE
- T_ZOMBIE
-
-¤Û¤È¤ó¤É¤Î¥¿¥¤¥×¤ÏC¤Î¹½Â¤ÂΤǼÂÁõ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
-1.2 VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ò¥Á¥§¥Ã¥¯¤¹¤ë
-
-ruby.h¤Ç¤ÏTYPE()¤È¤¤¤¦¥Þ¥¯¥í¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤Æ¡¤VALUE¤Î¥Ç¡¼¥¿
-¥¿¥¤¥×¤òÃΤ뤳¤È¤¬½ÐÍè¤Þ¤¹¡¥TYPE()¥Þ¥¯¥í¤Ï¾å¤Ç¾Ò²ð¤·¤¿T_XXXX
-¤Î·Á¼°¤ÎÄê¿ô¤òÊÖ¤·¤Þ¤¹¡¥VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Ë±þ¤¸¤Æ½èÍý¤¹¤ë
-¾ì¹ç¤Ë¤Ï¡¤TYPE()¤ÎÃͤÇʬ´ô¤¹¤ë¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
- switch (TYPE(obj)) {
- case T_FIXNUM:
- /* FIXNUM¤Î½èÍý */
- break;
- case T_STRING:
- /* ʸ»úÎó¤Î½èÍý */
- break;
- case T_ARRAY:
- /* ÇÛÎó¤Î½èÍý */
- break;
- default:
- /* Îã³°¤òȯÀ¸¤µ¤»¤ë */
- rb_raise(rb_eTypeError, "not valid value");
- break;
- }
-
-¤½¤ì¤È¥Ç¡¼¥¿¥¿¥¤¥×¤ò¥Á¥§¥Ã¥¯¤·¤Æ¡¤Àµ¤·¤¯¤Ê¤±¤ì¤ÐÎã³°¤òȯÀ¸¤¹
-¤ë´Ø¿ô¤¬ÍѰդµ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- void Check_Type(VALUE value, int type)
-
-¤³¤Î´Ø¿ô¤Ïvalue¤¬type¤Ç̵¤±¤ì¤Ð¡¤Îã³°¤òȯÀ¸¤µ¤»¤Þ¤¹¡¥°ú¿ô¤È
-¤·¤ÆÍ¿¤¨¤é¤ì¤¿VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤¬Àµ¤·¤¤¤«¤É¤¦¤«¥Á¥§¥Ã¥¯¤¹
-¤ë¤¿¤á¤Ë¤Ï¡¤¤³¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
-FIXNUM¤ÈNIL¤Ë´Ø¤·¤Æ¤Ï¤è¤ê¹â®¤ÊȽÊÌ¥Þ¥¯¥í¤¬ÍѰդµ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- FIXNUM_P(obj)
- NIL_P(obj)
-
-1.3 VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
-
-¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_NIL¡¤T_FALSE¡¤T_TRUE¤Ç¤¢¤ë»þ¡¤¥Ç¡¼¥¿¤Ï¤½¤ì¤¾
-¤ìnil¡¤false¡¤true¤Ç¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Ï¤Ò¤È
-¤Ä¤º¤Ä¤·¤«Â¸ºß¤·¤Þ¤»¤ó¡¥
-
-¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_FIXNUM¤Î»þ¡¤¤³¤ì¤Ï31bit¤Þ¤¿¤Ï63bit¤Î¥µ¥¤¥º¤ò
-»ý¤ÄÀ°¿ô¤Ç¤¹¡¥long¤Î¥µ¥¤¥º¤¬32bit¤Î¥×¥é¥Ã¥È¥Õ¥©¡¼¥à¤Ç¤¢¤ì¤Ð
-31bit¤Ë¡¤long¤Î¥µ¥¤¥º¤¬64bit¤Î¥×¥é¥Ã¥È¥Õ¥©¡¼¥à¤Ç¤¢¤ì¤Ð63bit
-¤Ë¤Ê¤ê¤Þ¤¹. FIXNUM ¤ò C ¤ÎÀ°¿ô¤ËÊÑ´¹¤¹¤ë¤¿¤á¤Ë¤Ï¥Þ¥¯¥í
-¡ÖFIX2INT()¡×¤Þ¤¿¤Ï¡ÖFIX2LONG()¡×¤ò»È¤¤¤Þ¤¹¡¥¤³¤ì¤é¤Î¥Þ¥¯¥í
-¤ò»ÈÍѤ¹¤ëºÝ¤Ë¤Ï»öÁ°¤Ë¥Ç¡¼¥¿¥¿¥¤¥×¤¬FIXNUM¤Ç¤¢¤ë¤³¤È¤ò³Îǧ¤¹
-¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¤¬¡¤Èæ³ÓŪ¹â®¤ËÊÑ´¹¤ò¹Ô¤¦¤³¤È¤¬¤Ç¤­¤Þ¤¹¡¥¤Þ
-¤¿¡¤¡ÖFIX2LONG()¡×¤ÏÎã³°¤òȯÀ¸¤·¤Þ¤»¤ó¤¬¡¤¡ÖFIX2INT()¡×¤ÏÊÑ
-´¹·ë²Ì¤¬int¤Î¥µ¥¤¥º¤Ë¼ý¤Þ¤é¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤òȯÀ¸¤·¤Þ¤¹¡¥
-¤½¤ì¤«¤é¡¤FIXNUM¤Ë¸Â¤é¤ºRuby¤Î¥Ç¡¼¥¿¤òÀ°¿ô¤ËÊÑ´¹¤¹¤ë
-¡ÖNUM2INT()¡×¤ª¤è¤Ó¡ÖNUM2LONG()¡×¤È¤¤¤¦¥Þ¥¯¥í¤¬¤¢¤ê¤Þ¤¹¡¥¤³
-¤ì¤é¤Î¥Þ¥¯¥í¤Ï¥Þ¥¯¥í¤Ï¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤Þ¤¹
-(À°¿ô¤ËÊÑ´¹¤Ç¤­¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤¬È¯À¸¤¹¤ë)¡¥Æ±Íͤ˥Á¥§¥Ã¥¯Ìµ
-¤Ç»È¤¨¤ëÊÑ´¹¥Þ¥¯¥í¤Ïdouble¤ò¼è¤ê½Ð¤¹¡ÖNUM2DBL()¡×¤¬¤¢¤ê¤Þ¤¹¡¥
-
-char* ¤ò¼è¤ê½Ð¤¹¾ì¹ç¡¤ StringValue() ¤È StringValuePtr()
-¤ò»È¤¤¤Þ¤¹¡¥
-StringValue(var) ¤Ï var ¤¬ String
-¤Ç¤¢¤ì¤Ð²¿¤â¤»¤º¡¤¤½¤¦¤Ç¤Ê¤±¤ì¤Ð var ¤ò var.to_str() ¤Î·ë²Ì
-¤ËÃÖ¤­´¹¤¨¤ë¥Þ¥¯¥í¡¤StringValuePtr(var) ¤ÏƱÍÍ¤Ë var ¤ò
-String ¤ËÃÖ¤­´¹¤¨¤Æ¤«¤é var ¤Î¥Ð¥¤¥ÈÎóɽ¸½¤ËÂФ¹¤ë char* ¤ò
-ÊÖ¤¹¥Þ¥¯¥í¤Ç¤¹¡¥var ¤ÎÆâÍÆ¤òľÀÜÃÖ¤­´¹¤¨¤ë½èÍý¤¬Æþ¤ë¤Î¤Ç¡¤
-var ¤Ï lvalue ¤Ç¤¢¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
-¤Þ¤¿¡¤StringValuePtr() ¤ËÎà»÷¤·¤¿ StringValueCStr() ¤È¤¤¤¦¥Þ
-¥¯¥í¤â¤¢¤ê¤Þ¤¹¡¥StringValueCStr(var) ¤Ï var ¤ò String ¤ËÃÖ¤­
-´¹¤¨¤Æ¤«¤é var ¤Îʸ»úÎóɽ¸½¤ËÂФ¹¤ë char* ¤òÊÖ¤·¤Þ¤¹¡¥ÊÖ¤µ¤ì
-¤ëʸ»úÎó¤ÎËöÈø¤Ë¤Ï nul ʸ»ú¤¬Éղ䵤ì¤Þ¤¹¡¥¤Ê¤ª¡¤ÅÓÃæ¤Ë nul
-ʸ»ú¤¬´Þ¤Þ¤ì¤ë¾ì¹ç¤Ï ArgumentError ¤¬È¯À¸¤·¤Þ¤¹¡¥
-°ìÊý¡¤StringValuePtr() ¤Ç¤Ï¡¤ËöÈø¤Ë nul ʸ»ú¤¬¤¢¤ëÊݾڤϤʤ¯¡¤
-ÅÓÃæ¤Ë nul ʸ»ú¤¬´Þ¤Þ¤ì¤Æ¤¤¤ë²ÄǽÀ­¤â¤¢¤ê¤Þ¤¹¡¥
-
-¤½¤ì°Ê³°¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ÏÂбþ¤¹¤ëC¤Î¹½Â¤ÂΤ¬¤¢¤ê¤Þ¤¹¡¥Âбþ¤¹
-¤ë¹½Â¤ÂΤΤ¢¤ëVALUE¤Ï¤½¤Î¤Þ¤Þ¥­¥ã¥¹¥È(·¿ÊÑ´¹)¤¹¤ì¤Ð¹½Â¤ÂΤÎ
-¥Ý¥¤¥ó¥¿¤ËÊÑ´¹¤Ç¤­¤Þ¤¹¡¥
-
-¹½Â¤ÂΤϡÖstruct RXxxxx¡×¤È¤¤¤¦Ì¾Á°¤Çruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤Þ
-¤¹¡¥Î㤨¤Ðʸ»úÎó¤Ï¡Östruct RString¡×¤Ç¤¹¡¥¼ÂºÝ¤Ë»È¤¦²ÄǽÀ­¤¬
-¤¢¤ë¤Î¤Ïʸ»úÎó¤ÈÇÛÎ󤯤餤¤À¤È»×¤¤¤Þ¤¹¡¥
-
-ruby.h¤Ç¤Ï¹½Â¤ÂΤإ­¥ã¥¹¥È¤¹¤ë¥Þ¥¯¥í¤â¡ÖRXXXXX()¡×(Á´ÉôÂçʸ
-»ú¤Ë¤·¤¿¤â¤Î)¤È¤¤¤¦Ì¾Á°¤ÇÄ󶡤µ¤ì¤Æ¤¤¤Þ¤¹(Îã: RSTRING())¡¥
-
-¹½Â¤ÂΤ«¤é¥Ç¡¼¥¿¤ò¼è¤ê½Ð¤¹¥Þ¥¯¥í¤¬Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥Ê¸»úÎó
-str¤ÎŤµ¤òÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING_LEN(str)¡×¤È¤·¡¤Ê¸»úÎóstr¤ò
-char*¤È¤·¤ÆÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING_PTR(str)¡×¤È¤·¤Þ¤¹¡¥ÇÛÎó¤Î
-¾ì¹ç¤Ë¤Ï¡¤¤½¤ì¤¾¤ì¡ÖRARRAY_LEN(ary)¡×¡¤¡ÖRARRAY_PTR(ary)¡×¤È
-¤Ê¤ê¤Þ¤¹¡¥
-
-Ruby¤Î¹½Â¤ÂΤòľÀÜ¥¢¥¯¥»¥¹¤¹¤ë»þ¤Ëµ¤¤ò¤Ä¤±¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¤³
-¤È¤Ï¡¤ÇÛÎó¤äʸ»úÎó¤Î¹½Â¤ÂΤÎÃæ¿È¤Ï»²¾È¤¹¤ë¤À¤±¤Ç¡¤Ä¾ÀÜÊѹ¹¤·
-¤Ê¤¤¤³¤È¤Ç¤¹¡¥Ä¾ÀÜÊѹ¹¤·¤¿¾ì¹ç¡¤¥ª¥Ö¥¸¥§¥¯¥È¤ÎÆâÍÆ¤ÎÀ°¹çÀ­¤¬
-¤È¤ì¤Ê¤¯¤Ê¤Ã¤Æ¡¤»×¤ï¤Ì¥Ð¥°¤Î¸¶°ø¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-1.4 C¤Î¥Ç¡¼¥¿¤òVALUE¤ËÊÑ´¹¤¹¤ë
-
-VALUE¤Î¼ÂºÝ¤Î¹½Â¤¤Ï
-
- * FIXNUM¤Î¾ì¹ç
-
- 1bitº¸¥·¥Õ¥È¤·¤Æ¡¤LSB¤òΩ¤Æ¤ë¡¥
-
- * ¤½¤Î¾¤Î¥Ý¥¤¥ó¥¿¤Î¾ì¹ç
-
- ¤½¤Î¤Þ¤ÞVALUE¤Ë¥­¥ã¥¹¥È¤¹¤ë¡¥
-
-¤È¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥¤è¤Ã¤Æ¡¤LSB¤ò¥Á¥§¥Ã¥¯¤¹¤ì¤ÐVALUE¤¬FIXNUM¤«¤É
-¤¦¤«¤ï¤«¤ë¤ï¤±¤Ç¤¹(¥Ý¥¤¥ó¥¿¤ÎLSB¤¬Î©¤Ã¤Æ¤¤¤Ê¤¤¤³¤È¤ò²¾Äꤷ¤Æ
-¤¤¤ë)¡¥
-
-¤Ç¤¹¤«¤é¡¤FIXNUM°Ê³°¤ÎRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Î¹½Â¤ÂΤÏñ¤ËVALUE
-¤Ë¥­¥ã¥¹¥È¤¹¤ë¤À¤±¤ÇVALUE¤ËÊÑ´¹½ÐÍè¤Þ¤¹¡¥¤¿¤À¤·¡¤Ç¤°Õ¤Î¹½Â¤
-ÂΤ¬VALUE¤Ë¥­¥ã¥¹¥È½ÐÍè¤ë¤ï¤±¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥¥­¥ã¥¹¥È¤¹¤ë¤Î
-¤ÏRuby¤ÎÃΤäƤ¤¤ë¹½Â¤ÂÎ(ruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ëstruct RXxxx
-¤Î¤â¤Î)¤À¤±¤Ç¤¹¡¥
-
-FIXNUM¤Ë´Ø¤·¤Æ¤ÏÊÑ´¹¥Þ¥¯¥í¤ò·Ðͳ¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥C¤ÎÀ°¿ô
-¤«¤éVALUE¤ËÊÑ´¹¤¹¤ë¥Þ¥¯¥í¤Ï°Ê²¼¤Î¤â¤Î¤¬¤¢¤ê¤Þ¤¹¡¥É¬Íפ˱þ¤¸
-¤Æ»È¤¤Ê¬¤±¤Æ¤¯¤À¤µ¤¤¡¥
-
- INT2FIX() ¤â¤È¤ÎÀ°¿ô¤¬31bit¤Þ¤¿¤Ï63bit°ÊÆâ¤Ë¼ý¤Þ¤ë¼«¿®
- ¤¬¤¢¤ë»þ
- INT2NUM() Ǥ°Õ¤ÎÀ°¿ô¤«¤éVALUE¤Ø
-
-INT2NUM()¤ÏÀ°¿ô¤¬FIXNUM¤ÎÈϰϤ˼ý¤Þ¤é¤Ê¤¤¾ì¹ç¡¤Bignum¤ËÊÑ´¹
-¤·¤Æ¤¯¤ì¤Þ¤¹(¤¬¡¤¾¯¤·ÃÙ¤¤)¡¥
-
-1.5 Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë
-
-ÀèÄø¤â½Ò¤Ù¤¿Ä̤ꡤRuby¤Î¹½Â¤ÂΤò¥¢¥¯¥»¥¹¤¹¤ë»þ¤ËÆâÍÆ¤Î¹¹¿·¤ò
-¹Ô¤¦¤³¤È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥¤Ç¡¤Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë»þ¤Ë¤Ï
-Ruby¤¬ÍѰդ·¤Æ¤¤¤ë´Ø¿ô¤òÍѤ¤¤Æ¤¯¤À¤µ¤¤¡¥
-
-¤³¤³¤Ç¤Ï¤â¤Ã¤È¤â»È¤ï¤ì¤ë¤Ç¤¢¤í¤¦Ê¸»úÎó¤ÈÇÛÎó¤ÎÀ¸À®/Áàºî¤ò¹Ô
-¤¤´Ø¿ô¤ò¤¢¤²¤Þ¤¹(Á´Éô¤Ç¤Ï¤Ê¤¤¤Ç¤¹)¡¥
-
- ʸ»úÎó¤ËÂФ¹¤ë´Ø¿ô
-
- rb_str_new(const char *ptr, long len)
-
- ¿·¤·¤¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_str_new2(const char *ptr)
- rb_str_new_cstr(const char *ptr)
-
- C¤Îʸ»úÎ󤫤éRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï
- rb_str_new(ptr, strlen(ptr))¤ÈƱÅù¤Ç¤¢¤ë¡¥
-
- rb_tainted_str_new(const char *ptr, long len)
-
- ±øÀ÷¥Þ¡¼¥¯¤¬Éղ䵤줿¿·¤·¤¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥³°Éô
- ¤«¤é¤Î¥Ç¡¼¥¿¤Ë´ð¤Å¤¯Ê¸»úÎó¤Ë¤Ï±øÀ÷¥Þ¡¼¥¯¤¬Éղ䵤ì¤ë¤Ù¤­
- ¤Ç¤¢¤ë¡¥
-
- rb_tainted_str_new2(const char *ptr)
- rb_tainted_str_new_cstr(const char *ptr)
-
- C¤Îʸ»úÎ󤫤鱸À÷¥Þ¡¼¥¯¤¬Éղ䵤줿Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_sprintf(const char *format, ...)
- rb_vsprintf(const char *format, va_list ap)
-
- C¤Îʸ»úÎóformat¤È³¤¯°ú¿ô¤òprintf(3)¤Î¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë¤·¤¿¤¬¤Ã¤Æ
- À°·Á¤·¡¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_str_cat(VALUE str, const char *ptr, long len)
-
- Ruby¤Îʸ»úÎóstr¤Ëlen¥Ð¥¤¥È¤Îʸ»úÎóptr¤òÄɲ乤롥
-
- rb_str_cat2(VALUE str, const char* ptr)
-
- Ruby¤Îʸ»úÎóstr¤ËC¤Îʸ»úÎóptr¤òÄɲ乤롥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï
- rb_str_cat(str, ptr, strlen(ptr))¤ÈƱÅù¤Ç¤¢¤ë¡¥
-
- rb_str_catf(VALUE str, const char* format, ...)
- rb_str_vcatf(VALUE str, const char* format, va_list ap)
-
- C¤Îʸ»úÎóformat¤È³¤¯°ú¿ô¤òprintf(3)¤Î¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë¤·¤¿¤¬¤Ã¤Æ
- À°·Á¤·¡¤Ruby¤Îʸ»úÎóstr¤ËÄɲ乤롥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï¡¤¤½¤ì¤¾¤ì
- rb_str_cat2(str, rb_sprintf(format, ...)) ¤ä
- rb_str_cat2(str, rb_vsprintf(format, ap)) ¤ÈƱÅù¤Ç¤¢¤ë¡¥
-
- rb_enc_str_new(const char *ptr, long len, rb_encoding *enc)
-
- »ØÄꤵ¤ì¤¿¥¨¥ó¥³¡¼¥Ç¥£¥ó¥°¤ÇRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë.
-
- rb_usascii_str_new(const char *ptr, long len)
- rb_usascii_str_new_cstr(const char *ptr)
-
- ¥¨¥ó¥³¡¼¥Ç¥£¥ó¥°¤¬US-ASCII¤ÎRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë.
-
- rb_str_resize(VALUE str, long len)
-
- Ruby¤Îʸ»úÎó¤Î¥µ¥¤¥º¤òlen¥Ð¥¤¥È¤ËÊѹ¹¤¹¤ë¡¥str¤ÎŤµ¤ÏÁ°
- °Ê¤Æ¥»¥Ã¥È¤µ¤ì¤Æ¤¤¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¡¥len¤¬¸µ¤ÎŤµ¤è¤ê¤âû
- ¤¤»þ¤Ï¡¤len¥Ð¥¤¥È¤ò±Û¤¨¤¿Éôʬ¤ÎÆâÍÆ¤Ï¼Î¤Æ¤é¤ì¤ë¡¥len¤¬¸µ
- ¤ÎŤµ¤è¤ê¤âŤ¤»þ¤Ï¡¤¸µ¤ÎŤµ¤ò±Û¤¨¤¿Éôʬ¤ÎÆâÍÆ¤ÏÊݸ¤µ
- ¤ì¤Ê¤¤¤Ç¥´¥ß¤Ë¤Ê¤ë¤À¤í¤¦¡¥¤³¤Î´Ø¿ô¤Î¸Æ¤Ó½Ð¤·¤Ë¤è¤Ã¤Æ
- RSTRING_PTR(str)¤¬Êѹ¹¤µ¤ì¤ë¤«¤â¤·¤ì¤Ê¤¤¤³¤È¤ËÃí°Õ¡¥
-
- rb_str_set_len(VALUE str, long len)
-
- Ruby¤Îʸ»úÎó¤Î¥µ¥¤¥º¤òlen¥Ð¥¤¥È¤Ë¥»¥Ã¥È¤¹¤ë¡¥str¤¬Êѹ¹²Ä
- ǽ¤Ç¤Ê¤±¤ì¤ÐÎã³°¤¬È¯À¸¤¹¤ë¡¥RSTRING_LEN(str)¤È¤Ï̵´Ø·¸¤Ë¡¤
- len¥Ð¥¤¥È¤Þ¤Ç¤ÎÆâÍÆ¤ÏÊݸ¤µ¤ì¤ë¡¥len¤Ïstr¤ÎÍÆÎ̤ò±Û¤¨¤Æ¤¤
- ¤Æ¤Ï¤Ê¤é¤Ê¤¤¡¥
-
-
- ÇÛÎó¤ËÂФ¹¤ë´Ø¿ô
-
- rb_ary_new()
-
- Í×ÁǤ¬0¤ÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_ary_new2(long len)
-
- Í×ÁǤ¬0¤ÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥lenÍ×ÁÇʬ¤ÎÎΰè¤ò¤¢¤é¤«¤¸¤á³ä¤ê
- Åö¤Æ¤Æ¤ª¤¯¡¥
-
- rb_ary_new3(long n, ...)
-
- °ú¿ô¤Ç»ØÄꤷ¤¿nÍ×ÁǤò´Þ¤àÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_ary_new4(long n, VALUE *elts)
-
- ÇÛÎó¤ÇÍ¿¤¨¤¿nÍ×ÁǤÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_ary_to_ary(VALUE obj)
-
- ¥ª¥Ö¥¸¥§¥¯¥È¤òÇÛÎó¤ËÊÑ´¹¤¹¤ë.
- Object#to_ary¤ÈƱÅù¤Ç¤¢¤ë.
-
- ¾¤Ë¤âÇÛÎó¤òÁàºî¤¹¤ë´Ø¿ô¤¬Â¿¿ô¤¢¤ë. ¤³¤ì¤é¤Ï
- °ú¿ôary¤ËÇÛÎó¤òÅϤµ¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤. ¤µ¤â¤Ê¤¤¤È
- ¥³¥¢¤òÅǤ¯.
-
- rb_ary_aref(argc, VALUE *argv, VALUE ary)
-
- Array#[]¤ÈƱÅù.
-
- rb_ary_entry(VALUE ary, long offset)
-
- ary[offset]
-
- rb_ary_subseq(VALUE ary, long beg, long len)
-
- ary[beg, len]
-
- rb_ary_push(VALUE ary, VALUE val)
- rb_ary_pop(VALUE ary)
- rb_ary_shift(VALUE ary)
- rb_ary_unshift(VALUE ary, VALUE val)
-
-2¡¥Ruby¤Îµ¡Ç½¤ò»È¤¦
-
-¸¶ÍýŪ¤ËRuby¤Ç½ñ¤±¤ë¤³¤È¤ÏC¤Ç¤â½ñ¤±¤Þ¤¹¡¥Ruby¤½¤Î¤â¤Î¤¬C¤Çµ­
-½Ò¤µ¤ì¤Æ¤¤¤ë¤ó¤Ç¤¹¤«¤é¡¤ÅöÁ³¤È¤¤¤¨¤ÐÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¥¤³¤³¤Ç
-¤ÏRuby¤Î³ÈÄ¥¤Ë»È¤¦¤³¤È¤¬Â¿¤¤¤À¤í¤¦¤Èͽ¬¤µ¤ì¤ëµ¡Ç½¤òÃæ¿´¤Ë¾Ò
-²ð¤·¤Þ¤¹¡¥
-
-2.1 Ruby¤Ëµ¡Ç½¤òÄɲ乤ë
-
-Ruby¤ÇÄ󶡤µ¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤¨¤ÐRuby¥¤¥ó¥¿¥×¥ê¥¿¤Ë¿·¤·¤¤µ¡Ç½
-¤òÄɲ乤뤳¤È¤¬¤Ç¤­¤Þ¤¹¡¥Ruby¤Ç¤Ï°Ê²¼¤Îµ¡Ç½¤òÄɲä¹¤ë´Ø¿ô¤¬
-Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- * ¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë
- * ¥á¥½¥Ã¥É¡¤ÆÃ°Û¥á¥½¥Ã¥É¤Ê¤É
- * Äê¿ô
-
-¤Ç¤Ï½ç¤Ë¾Ò²ð¤·¤Þ¤¹¡¥
-
-2.1.1 ¥¯¥é¥¹/¥â¥¸¥å¡¼¥ëÄêµÁ
-
-¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- VALUE rb_define_class(const char *name, VALUE super)
- VALUE rb_define_module(const char *name)
-
-¤³¤ì¤é¤Î´Ø¿ô¤Ï¿·¤·¤¯ÄêµÁ¤µ¤ì¤¿¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÊÖ¤·¤Þ¤¹¡¥
-¥á¥½¥Ã¥É¤äÄê¿ô¤ÎÄêµÁ¤Ë¤³¤ì¤é¤ÎÃͤ¬É¬ÍפʤΤǡ¤¤Û¤È¤ó¤É¤Î¾ì¹ç
-¤ÏÌá¤êÃͤòÊÑ¿ô¤Ë³ÊǼ¤·¤Æ¤ª¤¯É¬Íפ¬¤¢¤ë¤Ç¤·¤ç¤¦¡¥
-
-¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤ò¾¤Î¥¯¥é¥¹¤ÎÆâÉô¤Ë¥Í¥¹¥È¤·¤ÆÄêµÁ¤¹¤ë»þ¤Ë
-¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
- VALUE rb_define_module_under(VALUE outer, const char *name)
-
-2.1.2 ¥á¥½¥Ã¥É/ÆÃ°Û¥á¥½¥Ã¥ÉÄêµÁ
-
-¥á¥½¥Ã¥É¤äÆÃ°Û¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- void rb_define_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
-
- void rb_define_singleton_method(VALUE object, const char *name,
- VALUE (*func)(), int argc)
-
-
-ǰ¤Î¤¿¤áÀâÌÀ¤¹¤ë¤È¡ÖÆÃ°Û¥á¥½¥Ã¥É¡×¤È¤Ï¡¤¤½¤ÎÆÃÄê¤Î¥ª¥Ö¥¸¥§¥¯
-¥È¤ËÂФ·¤Æ¤À¤±Í­¸ú¤Ê¥á¥½¥Ã¥É¤Ç¤¹¡¥Ruby¤Ç¤Ï¤è¤¯Smalltalk¤Ë¤ª
-¤±¤ë¥¯¥é¥¹¥á¥½¥Ã¥É¤È¤·¤Æ¡¤¥¯¥é¥¹¤ËÂФ¹¤ëÆÃ°Û¥á¥½¥Ã¥É¤¬»È¤ï¤ì
-¤Þ¤¹¡¥
-
-¤³¤ì¤é¤Î´Ø¿ô¤Î argc¤È¤¤¤¦°ú¿ô¤ÏC¤Î´Ø¿ô¤ØÅϤµ¤ì¤ë°ú¿ô¤Î¿ô(¤È
-·Á¼°)¤ò·è¤á¤Þ¤¹¡¥argc¤¬0°Ê¾å¤Î»þ¤Ï´Ø¿ô¤Ë°ú¤­ÅϤ¹°ú¿ô¤Î¿ô¤ò°Õ
-Ì£¤·¤Þ¤¹¡¥16¸Ä°Ê¾å¤Î°ú¿ô¤Ï»È¤¨¤Þ¤»¤ó(¤¬¡¤Íפê¤Þ¤»¤ó¤è¤Í¡¤¤½
-¤ó¤Ê¤Ë)¡¥¼ÂºÝ¤Î´Ø¿ô¤Ë¤ÏÀèÆ¬¤Î°ú¿ô¤È¤·¤Æself¤¬Í¿¤¨¤é¤ì¤Þ¤¹¤Î
-¤Ç¡¤»ØÄꤷ¤¿¿ô¤è¤ê1¿¤¤°ú¿ô¤ò»ý¤Ä¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-argc¤¬Éé¤Î»þ¤Ï°ú¿ô¤Î¿ô¤Ç¤Ï¤Ê¤¯¡¤·Á¼°¤ò»ØÄꤷ¤¿¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
-argc¤¬-1¤Î»þ¤Ï°ú¿ô¤òÇÛÎó¤ËÆþ¤ì¤ÆÅϤµ¤ì¤Þ¤¹¡¥argc¤¬-2¤Î»þ¤Ï°ú
-¿ô¤ÏRuby¤ÎÇÛÎó¤È¤·¤ÆÅϤµ¤ì¤Þ¤¹¡¥
-
-¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï¤Þ¤À¤¤¤¯¤Ä¤«¤¢¤ê¤Þ¤¹. ¤Ò¤È¤Ä¤Ï¥á¥½¥Ã¥É
-̾¤È¤·¤ÆID¤ò¼è¤ê¤Þ¤¹. ID¤Ë¤Ä¤¤¤Æ¤Ï2.2.2¤ò»²¾È.
-
- void rb_define_method_id(VALUE klass, ID name,
- VALUE (*func)(ANYARGS), int argc)
-
-private/protected¤Ê¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¤Õ¤¿¤Ä¤Î´Ø¿ô¤¬¤¢¤ê¤Þ¤¹.
-
- void rb_define_private_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
- void rb_define_protected_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
-
-private¥á¥½¥Ã¥É¤È¤Ï´Ø¿ô·Á¼°¤Ç¤·¤«¸Æ¤Ó½Ð¤¹¤³¤È¤Î½ÐÍè¤Ê¤¤¥á¥½¥Ã
-¥É¤Ç¤¹¡¥
-
-ºÇ¸å¤Ë¡¤ rb_define_module´Ø¿ô¤Ï¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤·¤Þ¤¹¡¥
-¥â¥¸¥å¡¼¥ë´Ø¿ô¤È¤Ï¥â¥¸¥å¡¼¥ë¤ÎÆÃ°Û¥á¥½¥Ã¥É¤Ç¤¢¤ê¡¤Æ±»þ¤Ë
-private¥á¥½¥Ã¥É¤Ç¤â¤¢¤ë¤â¤Î¤Ç¤¹¡¥Îã¤ò¤¢¤²¤ë¤ÈMath¥â¥¸¥å¡¼¥ë
-¤Îsqrt()¤Ê¤É¤¬¤¢¤²¤é¤ì¤Þ¤¹¡¥¤³¤Î¥á¥½¥Ã¥É¤Ï
-
- Math.sqrt(4)
-
-¤È¤¤¤¦·Á¼°¤Ç¤â
-
- include Math
- sqrt(4)
-
-¤È¤¤¤¦·Á¼°¤Ç¤â»È¤¨¤Þ¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤Î
-Ä̤ê¤Ç¤¹¡¥
-
- void rb_define_module_function(VALUE module, const char *name,
- VALUE (*func)(), int argc)
-
-´Ø¿ôŪ¥á¥½¥Ã¥É(Kernel¥â¥¸¥å¡¼¥ë¤Îprivate method)¤òÄêµÁ¤¹¤ë¤¿
-¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
-
- void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-
-
-¥á¥½¥Ã¥É¤ÎÊÌ̾¤òÄêµÁ¤¹¤ë¤¿¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
-
- void rb_define_alias(VALUE module, const char* new, const char* old);
-
-°À­¤Î¼èÆÀ¡¦ÀßÄê¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¤Ë¤Ï
-
- void rb_define_attr(VALUE klass, const char *name, int read, int write)
-
-¥¯¥é¥¹¥á¥½¥Ã¥Éallocate¤òÄêµÁ¤·¤¿¤êºï½ü¤·¤¿¤ê¤¹¤ë¤¿¤á¤Î´Ø¿ô¤Ï
-°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
-
- void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
- void rb_undef_alloc_func(VALUE klass);
-
-func¤Ï¥¯¥é¥¹¤ò°ú¿ô¤È¤·¤Æ¼õ¤±¼è¤Ã¤Æ¡¤¿·¤·¤¯³ä¤êÅö¤Æ¤é¤ì¤¿¥¤¥ó
-¥¹¥¿¥ó¥¹¤òÊÖ¤µ¤Ê¤¯¤Æ¤Ï¤Ê¤ê¤Þ¤»¤ó¡¥¤³¤Î¥¤¥ó¥¹¥¿¥ó¥¹¤Ï¡¤³°Éô¥ê
-¥½¡¼¥¹¤Ê¤É¤ò´Þ¤Þ¤Ê¤¤¡¤¤Ç¤­¤ë¤À¤±¡Ö¶õ¡×¤Î¤Þ¤Þ¤Ë¤·¤Æ¤ª¤¤¤¿¤Û¤¦
-¤¬¤è¤¤¤Ç¤·¤ç¤¦¡¥
-
-2.1.3 Äê¿ôÄêµÁ
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤¬É¬ÍפÊÄê¿ô¤Ï¤¢¤é¤«¤¸¤áÄêµÁ¤·¤Æ¤ª¤¤¤¿Êý¤¬Îɤ¤
-¤Ç¤·¤ç¤¦¡¥Äê¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤ÏÆó¤Ä¤¢¤ê¤Þ¤¹¡¥
-
- void rb_define_const(VALUE klass, const char *name, VALUE val)
- void rb_define_global_const(const char *name, VALUE val)
-
-Á°¼Ô¤ÏÆÃÄê¤Î¥¯¥é¥¹/¥â¥¸¥å¡¼¥ë¤Ë°¤¹¤ëÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¡¤¸å
-¼Ô¤Ï¥°¥í¡¼¥Ð¥ë¤ÊÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥
-
-2.2 Ruby¤Îµ¡Ç½¤òC¤«¤é¸Æ¤Ó½Ð¤¹
-
-´û¤Ë¡Ø1.5 Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë¡Ù¤Ç°ìÉô¾Ò²ð¤·¤¿¤è¤¦¤Ê´Ø¿ô¤ò
-»È¤¨¤Ð¡¤Ruby¤Îµ¡Ç½¤ò¼Â¸½¤·¤Æ¤¤¤ë´Ø¿ô¤òľÀܸƤӽФ¹¤³¤È¤¬½ÐÍè
-¤Þ¤¹¡¥
-
-# ¤³¤Î¤è¤¦¤Ê´Ø¿ô¤Î°ìÍ÷ɽ¤Ï¤¤¤Þ¤Î¤È¤³¤í¤¢¤ê¤Þ¤»¤ó¡¥¥½¡¼¥¹¤ò¸«
-# ¤ë¤·¤«¤Ê¤¤¤Ç¤¹¤Í¡¥
-
-¤½¤ì°Ê³°¤Ë¤âRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹ÊýË¡¤Ï¤¤¤¯¤Ä¤«¤¢¤ê¤Þ¤¹¡¥
-
-2.2.1 Ruby¤Î¥×¥í¥°¥é¥à¤òeval¤¹¤ë
-
-C¤«¤éRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹¤â¤Ã¤È¤â´Êñ¤ÊÊýË¡¤È¤·¤Æ¡¤Ê¸»úÎó¤Ç
-Í¿¤¨¤é¤ì¤¿Ruby¤Î¥×¥í¥°¥é¥à¤òɾ²Á¤¹¤ë°Ê²¼¤Î´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
-
- VALUE rb_eval_string(const char *str)
-
-¤³¤Îɾ²Á¤Ï¸½ºß¤Î´Ä¶­¤Ç¹Ô¤ï¤ì¤Þ¤¹¡¥¤Ä¤Þ¤ê¡¤¸½ºß¤Î¥í¡¼¥«¥ëÊÑ¿ô
-¤Ê¤É¤ò¼õ¤±·Ñ¤®¤Þ¤¹¡¥
-
-ɾ²Á¤ÏÎã³°¤òȯÀ¸¤¹¤ë¤«¤â¤·¤ì¤Ê¤¤¤³¤È¤ËÃí°Õ¤·¤Þ¤·¤ç¤¦. ¤è¤ê°ÂÁ´
-¤Ê´Ø¿ô¤â¤¢¤ê¤Þ¤¹.
-
- VALUE rb_eval_string_protect(const char *str, int *state)
-
-¤³¤Î´Ø¿ô¤Ï¥¨¥é¡¼¤¬È¯À¸¤¹¤ë¤Ènil¤òÊÖ¤·¤Þ¤¹¡¥¤½¤·¤Æ¡¤À®¸ù»þ¤Ë¤Ï
-*state¤Ï¥¼¥í¤Ë¡¤¤µ¤â¤Ê¤¯¤ÐÈó¥¼¥í¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-
-2.2.2 ID¤Þ¤¿¤Ï¥·¥ó¥Ü¥ë
-
-C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤³¤È¤â¤Ç¤­¤Þ
-¤¹¡¥¤½¤ÎÁ°¤Ë¡¤Ruby¥¤¥ó¥¿¥×¥ê¥¿Æâ¤Ç¥á¥½¥Ã¥É¤äÊÑ¿ô̾¤ò»ØÄꤹ¤ë
-»þ¤Ë»È¤ï¤ì¤Æ¤¤¤ëID¤Ë¤Ä¤¤¤ÆÀâÌÀ¤·¤Æ¤ª¤­¤Þ¤·¤ç¤¦¡¥
-
-ID¤È¤ÏÊÑ¿ô̾¡¤¥á¥½¥Ã¥É̾¤òɽ¤¹À°¿ô¤Ç¤¹¡¥Ruby¤ÎÃæ¤Ç¤Ï
-
- :¼±ÊÌ»Ò
-¤Þ¤¿¤Ï
- :"Ǥ°Õ¤Îʸ»úÎó"
-
-¤Ç¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤¹¡¥C¤«¤é¤³¤ÎÀ°¿ô¤òÆÀ¤ë¤¿¤á¤Ë¤Ï´Ø¿ô
-
- rb_intern(const char *name)
-
-¤ò»È¤¤¤Þ¤¹¡¥Ruby¤«¤é°ú¿ô¤È¤·¤ÆÍ¿¤¨¤é¤ì¤¿¥·¥ó¥Ü¥ë(¤Þ¤¿¤Ïʸ»ú
-Îó)¤òID¤ËÊÑ´¹¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- rb_to_id(VALUE symbol)
-
-2.2.3 C¤«¤éRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹
-
-C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤¿¤á¤Ë¤Ï°Ê²¼
-¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
-
-¤³¤Î´Ø¿ô¤Ï¥ª¥Ö¥¸¥§¥¯¥Èrecv¤Îmid¤Ç»ØÄꤵ¤ì¤ë¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð
-¤·¤Þ¤¹¡¥¤½¤Î¾¤Ë°ú¿ô¤Î»ØÄê¤Î»ÅÊý¤¬°ã¤¦°Ê²¼¤Î´Ø¿ô¤â¤¢¤ê¤Þ¤¹¡¥
-
- VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
- VALUE rb_apply(VALUE recv, ID mid, VALUE args)
-
-apply¤Ë¤Ï°ú¿ô¤È¤·¤ÆRuby¤ÎÇÛÎó¤òÍ¿¤¨¤Þ¤¹¡¥
-
-2.2.4 ÊÑ¿ô/Äê¿ô¤ò»²¾È/¹¹¿·¤¹¤ë
-
-C¤«¤é´Ø¿ô¤ò»È¤Ã¤Æ»²¾È¡¦¹¹¿·¤Ç¤­¤ë¤Î¤Ï¡¤Äê¿ô¡¤¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ
-¿ô¤Ç¤¹¡¥Âç°èÊÑ¿ô¤Ï°ìÉô¤Î¤â¤Î¤ÏC¤ÎÂç°èÊÑ¿ô¤È¤·¤Æ¥¢¥¯¥»¥¹¤Ç¤­
-¤Þ¤¹¡¥¥í¡¼¥«¥ëÊÑ¿ô¤ò»²¾È¤¹¤ëÊýË¡¤Ï¸ø³«¤·¤Æ¤¤¤Þ¤»¤ó¡¥
-
-¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ò»²¾È¡¦¹¹¿·¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤ÎÄÌ
-¤ê¤Ç¤¹¡¥
-
- VALUE rb_ivar_get(VALUE obj, ID id)
- VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
-
-id¤Ïrb_intern()¤ÇÆÀ¤é¤ì¤ë¤â¤Î¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
-Äê¿ô¤ò»²¾È¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
- VALUE rb_const_get(VALUE obj, ID id)
-
-Äê¿ô¤ò¿·¤·¤¯ÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡Ø2.1.3 Äê¿ôÄêµÁ¡Ù¤Ç¾Ò²ð¤µ
-¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
-3¡¥Ruby¤ÈC¤È¤Î¾ðÊó¶¦Í­
-
-C¸À¸ì¤ÈRuby¤Î´Ö¤Ç¾ðÊó¤ò¶¦Í­¤¹¤ëÊýË¡¤Ë¤Ä¤¤¤Æ²òÀ⤷¤Þ¤¹¡¥
-
-3.1 C¤«¤é»²¾È¤Ç¤­¤ëRuby¤ÎÄê¿ô
-
-°Ê²¼¤ÎRuby¤ÎÄê¿ô¤ÏC¤Î¥ì¥Ù¥ë¤«¤é»²¾È¤Ç¤­¤Þ¤¹¡¥
-
- Qtrue
- Qfalse
-
- ¿¿µ¶ÃÍ¡¥Qfalse¤ÏC¸À¸ì¤Ç¤âµ¶¤È¤ß¤Ê¤µ¤ì¤Þ¤¹(¤Ä¤Þ¤ê0)¡¥
-
- Qnil
-
- C¸À¸ì¤«¤é¸«¤¿¡Önil¡×¡¥
-
-3.2 C¤ÈRuby¤Ç¶¦Í­¤µ¤ì¤ëÂç°èÊÑ¿ô
-
-C¤ÈRuby¤ÇÂç°èÊÑ¿ô¤ò»È¤Ã¤Æ¾ðÊó¤ò¶¦Í­¤Ç¤­¤Þ¤¹¡¥¶¦Í­¤Ç¤­¤ëÂç°è
-ÊÑ¿ô¤Ë¤Ï¤¤¤¯¤Ä¤«¤Î¼ïÎब¤¢¤ê¤Þ¤¹¡¥¤½¤Î¤Ê¤«¤Ç¤â¤Ã¤È¤âÎɤ¯»È¤ï
-¤ì¤ë¤È»×¤ï¤ì¤ë¤Î¤Ïrb_define_variable()¤Ç¤¹¡¥
-
- void rb_define_variable(const char *name, VALUE *var)
-
-¤³¤Î´Ø¿ô¤ÏRuby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëÂç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ¤¹¡¥ÊÑ¿ô̾¤¬
-`$'¤Ç»Ï¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤ÎÃͤòÊÑ
-¹¹¤¹¤ë¤È¼«Æ°Åª¤ËRuby¤ÎÂбþ¤¹¤ëÊÑ¿ô¤ÎÃͤâÊѤï¤ê¤Þ¤¹¡¥
-
-¤Þ¤¿Ruby¦¤«¤é¤Ï¹¹¿·¤Ç¤­¤Ê¤¤ÊÑ¿ô¤â¤¢¤ê¤Þ¤¹¡¥¤³¤Îread only¤Î
-ÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ÇÄêµÁ¤·¤Þ¤¹¡¥
-
- void rb_define_readonly_variable(const char *name, VALUE *var)
-
-¤³¤ì¤éÊÑ¿ô¤Î¾¤Ëhook¤ò¤Ä¤±¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤Ç¤­¤Þ¤¹¡¥hookÉÕ¤­
-¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤òÍѤ¤¤ÆÄêµÁ¤·¤Þ¤¹¡¥hookÉÕ¤­Âç°èÊÑ¿ô¤Î
-Ãͤλ²¾È¤äÀßÄê¤Ïhook¤Ç¹Ô¤¦É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
-
- void rb_define_hooked_variable(const char *name, VALUE *var,
- VALUE (*getter)(), void (*setter)())
-
-¤³¤Î´Ø¿ô¤ÏC¤Î´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ
-¤¹¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï´Ø¿ôgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì
-¤¿»þ¤Ë¤Ï´Ø¿ôsetter¤¬¸Æ¤Ð¤ì¤ë¡¥hook¤ò»ØÄꤷ¤Ê¤¤¾ì¹ç¤Ïgetter¤ä
-setter¤Ë0¤ò»ØÄꤷ¤Þ¤¹¡¥
-# getter¤âsetter¤â0¤Ê¤é¤Ðrb_define_variable()¤ÈƱ¤¸¤Ë¤Ê¤ë¡¥
-
-getter¤Èsetter¤Î»ÅÍͤϼ¡¤ÎÄ̤ê¤Ç¤¹¡¥
-
- VALUE (*getter)(ID id, VALUE *var);
- void (*setter)(VALUE val, ID id, VALUE *var);
-
-
-¤½¤ì¤«¤é¡¤Âбþ¤¹¤ëC¤ÎÊÑ¿ô¤ò»ý¤¿¤Ê¤¤Ruby¤ÎÂç°èÊÑ¿ô¤òÄêµÁ¤¹¤ë
-¤³¤È¤â¤Ç¤­¤Þ¤¹. ¤½¤ÎÊÑ¿ô¤ÎÃͤϥե寴ؿô¤Î¤ß¤Ë¤è¤Ã¤Æ¼èÆÀ¡¦ÀßÄê
-¤µ¤ì¤Þ¤¹.
-
- void rb_define_virtual_variable(const char *name,
- VALUE (*getter)(), void (*setter)())
-
-¤³¤Î´Ø¿ô¤Ë¤è¤Ã¤ÆÄêµÁ¤µ¤ì¤¿Ruby¤ÎÂç°èÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï
-getter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì¤Þ¤¹¡¥
-
-getter¤Èsetter¤Î»ÅÍͤϰʲ¼¤ÎÄ̤ê¤Ç¤¹¡¥
-
- (*getter)(ID id);
- (*setter)(VALUE val, ID id);
-
-3.3 C¤Î¥Ç¡¼¥¿¤òRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤¹¤ë
-
-C¤ÎÀ¤³¦¤ÇÄêµÁ¤µ¤ì¤¿¥Ç¡¼¥¿(¹½Â¤ÂÎ)¤òRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ
-¼è¤ê°·¤¤¤¿¤¤¾ì¹ç¤¬¤¢¤ê¤¨¤Þ¤¹¡¥¤³¤Î¤è¤¦¤Ê¾ì¹ç¤Ë¤Ï¡¤Data¤È¤¤¤¦
-Ruby¥ª¥Ö¥¸¥§¥¯¥È¤ËC¤Î¹½Â¤ÂÎ(¤Ø¤Î¥Ý¥¤¥ó¥¿)¤ò¤¯¤ë¤à¤³¤È¤ÇRuby
-¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ¼è¤ê°·¤¨¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-Data¥ª¥Ö¥¸¥§¥¯¥È¤òÀ¸À®¤·¤Æ¹½Â¤ÂΤòRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¥«¥×¥»¥ë
-²½¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤¤¤Þ¤¹¡¥
-
- Data_Wrap_Struct(klass, mark, free, ptr)
-
-¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
-
-klass¤Ï¤³¤ÎData¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¯¥é¥¹¤Ç¤¹¡¥ptr¤Ï¥«¥×¥»¥ë²½¤¹¤ë
-C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤Ç¤¹¡¥mark¤Ï¤³¤Î¹½Â¤ÂΤ¬Ruby¤Î¥ª¥Ö¥¸¥§
-¥¯¥È¤Ø¤Î»²¾È¤¬¤¢¤ë»þ¤Ë»È¤¦´Ø¿ô¤Ç¤¹¡¥¤½¤Î¤è¤¦¤Ê»²¾È¤ò´Þ¤Þ¤Ê¤¤
-»þ¤Ë¤Ï0¤ò»ØÄꤷ¤Þ¤¹¡¥
-
-# ¤½¤Î¤è¤¦¤Ê»²¾È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥
-
-free¤Ï¤³¤Î¹½Â¤ÂΤ¬¤â¤¦ÉÔÍפˤʤä¿»þ¤Ë¸Æ¤Ð¤ì¤ë´Ø¿ô¤Ç¤¹¡¥¤³¤Î
-´Ø¿ô¤¬¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿¤«¤é¸Æ¤Ð¤ì¤Þ¤¹¡¥¤³¤ì¤¬-1¤Î¾ì¹ç¤Ï¡¤Ã±
-½ã¤Ë³«Êü¤µ¤ì¤Þ¤¹¡¥
-
-mark¤ª¤è¤Ófree´Ø¿ô¤ÏGC¼Â¹ÔÃæ¤Ë¸Æ¤Ó½Ð¤µ¤ì¤Þ¤¹.
-¤Ê¤ª, GC¼Â¹ÔÃæ¤ÏRuby¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¢¥í¥±¡¼¥·¥ç¥ó¤Ï¶Ø»ß¤µ¤ì¤Þ
-¤¹. ¤è¤Ã¤Æ, mark¤ª¤è¤Ófree´Ø¿ô¤ÇRuby¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¢¥í¥±¡¼¥·
-¥ç¥ó¤Ï¹Ô¤ï¤Ê¤¤¤Ç¤¯¤À¤µ¤¤.
-
-C¤Î¹½Â¤ÂΤγäÅö¤ÈData¥ª¥Ö¥¸¥§¥¯¥È¤ÎÀ¸À®¤òƱ»þ¤Ë¹Ô¤¦¥Þ¥¯¥í¤È
-¤·¤Æ°Ê²¼¤Î¤â¤Î¤¬Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- Data_Make_Struct(klass, type, mark, free, sval)
-
-¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
-
-klass, mark, free¤ÏData_Wrap_Struct¤ÈƱ¤¸Æ¯¤­¤ò¤·¤Þ¤¹¡¥type
-¤Ï³ä¤êÅö¤Æ¤ëC¹½Â¤ÂΤη¿¤Ç¤¹¡¥³ä¤êÅö¤Æ¤é¤ì¤¿¹½Â¤ÂΤÏÊÑ¿ôsval
-¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤Î·¿¤Ï (type*) ¤Ç¤¢¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
-
-Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤é¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤Î¤Ï°Ê²¼¤Î¥Þ¥¯¥í¤òÍѤ¤
-¤Þ¤¹¡¥
-
- Data_Get_Struct(obj, type, sval)
-
-C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤ÏÊÑ¿ôsval¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥
-
-¤³¤ì¤é¤ÎData¤Î»È¤¤Êý¤Ï¤Á¤ç¤Ã¤Èʬ¤«¤ê¤Ë¤¯¤¤¤Î¤Ç¡¤¸å¤ÇÀâÌÀ¤¹¤ë
-ÎãÂê¤ò»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-4¡¥ÎãÂê - dbm¥Ñ¥Ã¥±¡¼¥¸¤òºî¤ë
-
-¤³¤³¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤È¤ê¤¢¤¨¤º³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ïºî¤ì¤ë¤Ï¤º¤Ç¤¹¡¥
-Ruby¤Îext¥Ç¥£¥ì¥¯¥È¥ê¤Ë¤¹¤Ç¤Ë´Þ¤Þ¤ì¤Æ¤¤¤ëdbm¥é¥¤¥Ö¥é¥ê¤òÎã¤Ë
-¤·¤ÆÃʳ¬Åª¤ËÀâÌÀ¤·¤Þ¤¹¡¥
-
-(1) ¥Ç¥£¥ì¥¯¥È¥ê¤òºî¤ë
-
- % mkdir ext/dbm
-
-Ruby 1.1¤«¤é¤ÏǤ°Õ¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç¥À¥¤¥Ê¥ß¥Ã¥¯¥é¥¤¥Ö¥é¥ê¤òºî
-¤ë¤³¤È¤¬¤Ç¤­¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤·¤¿¡¥Ruby¤ËÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë¾ì¹ç¤Ë
-¤ÏRuby¤òŸ³«¤·¤¿¥Ç¥£¥ì¥¯¥È¥ê¤Î²¼¡¤ext¥Ç¥£¥ì¥¯¥È¥ê¤ÎÃæ¤Ë³ÈÄ¥
-¥é¥¤¥Ö¥é¥êÍѤΥǥ£¥ì¥¯¥È¥ê¤òºî¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥Ì¾Á°¤ÏŬÅö¤Ë
-Áª¤ó¤Ç¹½¤¤¤Þ¤»¤ó¡¥
-
-(2) À߷פ¹¤ë
-
-¤Þ¤¢¡¤ÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¤¤É¤¦¤¤¤¦µ¡Ç½¤ò¼Â¸½¤¹¤ë¤«¤É¤¦¤«¤Þ¤ºÀß
-·×¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¤É¤ó¤Ê¥¯¥é¥¹¤ò¤Ä¤¯¤ë¤«¡¤¤½¤Î¥¯¥é¥¹¤Ë¤Ï
-¤É¤ó¤Ê¥á¥½¥Ã¥É¤¬¤¢¤ë¤«¡¤¥¯¥é¥¹¤¬Ä󶡤¹¤ëÄê¿ô¤Ê¤É¤Ë¤Ä¤¤¤ÆÀß·×
-¤·¤Þ¤¹¡¥
-
-(3) C¥³¡¼¥É¤ò½ñ¤¯
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥êËÜÂΤȤʤëC¸À¸ì¤Î¥½¡¼¥¹¤ò½ñ¤­¤Þ¤¹¡¥C¸À¸ì¤Î¥½¡¼
-¥¹¤¬¤Ò¤È¤Ä¤Î»þ¤Ë¤Ï¡Ö¥é¥¤¥Ö¥é¥ê̾.c¡×¤òÁª¤Ö¤ÈÎɤ¤¤Ç¤·¤ç¤¦¡¥C
-¸À¸ì¤Î¥½¡¼¥¹¤¬Ê£¿ô¤Î¾ì¹ç¤Ë¤ÏµÕ¤Ë¡Ö¥é¥¤¥Ö¥é¥ê̾.c¡×¤È¤¤¤¦¥Õ¥¡
-¥¤¥ë̾¤ÏÈò¤±¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤È¥â¥¸¥å¡¼
-¥ëÀ¸À®»þ¤ËÃæ´ÖŪ¤ËÀ¸À®¤µ¤ì¤ë¡Ö¥é¥¤¥Ö¥é¥ê̾.o¡×¤È¤¤¤¦¥Õ¥¡¥¤¥ë
-¤È¤¬¾×ÆÍ¤¹¤ë¤«¤é¤Ç¤¹¡¥
-
-Ruby¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ò¥í¡¼¥É¤¹¤ë»þ¤Ë¡ÖInit_¥é¥¤¥Ö¥é¥ê̾¡×¤È
-¤¤¤¦´Ø¿ô¤ò¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Þ¤¹¡¥dbm¥é¥¤¥Ö¥é¥ê¤Î¾ì¹ç¡ÖInit_dbm¡×
-¤Ç¤¹¡¥¤³¤Î´Ø¿ô¤ÎÃæ¤Ç¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë¡¤¥á¥½¥Ã¥É¡¤Äê¿ô¤Ê¤É¤Î
-ÄêµÁ¤ò¹Ô¤¤¤Þ¤¹¡¥dbm.c¤«¤é°ìÉô°úÍѤ·¤Þ¤¹¡¥
-
---
-void
-Init_dbm(void)
-{
- /* DBM¥¯¥é¥¹¤òÄêµÁ¤¹¤ë */
- cDBM = rb_define_class("DBM", rb_cObject);
- /* DBM¤ÏEnumerate¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë */
- rb_include_module(cDBM, rb_mEnumerable);
-
- /* DBM¥¯¥é¥¹¤Î¥¯¥é¥¹¥á¥½¥Ã¥Éopen(): °ú¿ô¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë */
- rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
-
- /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥Éclose(): °ú¿ô¤Ï¤Ê¤· */
- rb_define_method(cDBM, "close", fdbm_close, 0);
- /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥É[]: °ú¿ô¤Ï1¸Ä */
- rb_define_method(cDBM, "[]", fdbm_fetch, 1);
- :
-
- /* DBM¥Ç¡¼¥¿¤ò³ÊǼ¤¹¤ë¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô̾¤Î¤¿¤á¤ÎID */
- id_dbm = rb_intern("dbm");
-}
---
-
-DBM¥é¥¤¥Ö¥é¥ê¤Ïdbm¤Î¥Ç¡¼¥¿¤ÈÂбþ¤¹¤ë¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤Ê¤ë¤Ï¤º¤Ç
-¤¹¤«¤é¡¤C¤ÎÀ¤³¦¤Îdbm¤òRuby¤ÎÀ¤³¦¤Ë¼è¤ê¹þ¤àɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
-
-
-dbm.c¤Ç¤ÏData_Make_Struct¤ò°Ê²¼¤Î¤è¤¦¤Ë»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-struct dbmdata {
- int di_size;
- DBM *di_dbm;
-};
-
-
-obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
---
-
-¤³¤³¤Ç¤Ïdbmstruct¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤òData¤Ë¥«¥×¥»¥ë²½¤·¤Æ¤¤
-¤Þ¤¹¡¥DBM*¤òľÀÜ¥«¥×¥»¥ë²½¤·¤Ê¤¤¤Î¤Ïclose()¤·¤¿»þ¤Î½èÍý¤ò¹Í
-¤¨¤Æ¤Î¤³¤È¤Ç¤¹¡¥
-
-Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤édbmstruct¹½Â¤ÂΤΥݥ¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á
-¤Ë°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-#define GetDBM(obj, dbmp) {\
- Data_Get_Struct(obj, struct dbmdata, dbmp);\
- if (dbmp->di_dbm == 0) closed_dbm();\
-}
---
-
-¤Á¤ç¤Ã¤ÈÊ£»¨¤Ê¥Þ¥¯¥í¤Ç¤¹¤¬¡¤Íפ¹¤ë¤Ëdbmdata¹½Â¤ÂΤΥݥ¤¥ó¥¿
-¤Î¼è¤ê½Ð¤·¤È¡¤close¤µ¤ì¤Æ¤¤¤ë¤«¤É¤¦¤«¤Î¥Á¥§¥Ã¥¯¤ò¤Þ¤È¤á¤Æ¤¤
-¤ë¤À¤±¤Ç¤¹¡¥
-
-DBM¥¯¥é¥¹¤Ë¤Ï¤¿¤¯¤µ¤ó¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¤¬¡¤Ê¬Îह¤ë¤È3¼ïÎà¤Î
-°ú¿ô¤Î¼õ¤±Êý¤¬¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ï°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¤â¤Î¤Ç¡¤Îã¤È
-¤·¤Æ¤Ïdelete¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¡¥delete¥á¥½¥Ã¥É¤ò¼ÂÁõ¤·¤Æ¤¤¤ë
-fdbm_delete()¤Ï¤³¤Î¤è¤¦¤Ë¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-static VALUE
-fdbm_delete(VALUE obj, VALUE keystr)
-{
- :
-}
---
-
-°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¥¿¥¤¥×¤ÏÂè1°ú¿ô¤¬self¡¤Âè2°ú¿ô°Ê¹ß¤¬¥á¥½¥Ã¥É
-¤Î°ú¿ô¤È¤Ê¤ê¤Þ¤¹¡¥
-
-°ú¿ô¤Î¿ô¤¬ÉÔÄê¤Î¤â¤Î¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î¤ÈRuby¤ÎÇÛÎó¤Ç¼õ¤±
-¤ë¤â¤Î¤È¤¬¤¢¤ê¤Þ¤¹¡¥dbm¥é¥¤¥Ö¥é¥ê¤ÎÃæ¤Ç¡¤C¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î
-¤ÏDBM¤Î¥¯¥é¥¹¥á¥½¥Ã¥É¤Ç¤¢¤ëopen()¤Ç¤¹¡¥¤³¤ì¤ò¼ÂÁõ¤·¤Æ¤¤¤ë´Ø
-¿ôfdbm_s_open()¤Ï¤³¤¦¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-static VALUE
-fdbm_s_open(int argc, VALUE *argv, VALUE klass)
-{
- :
- if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
- mode = 0666; /* default value */
- }
- :
-}
---
-
-¤³¤Î¥¿¥¤¥×¤Î´Ø¿ô¤ÏÂè1°ú¿ô¤¬Í¿¤¨¤é¤ì¤¿°ú¿ô¤Î¿ô¡¤Âè2°ú¿ô¤¬Í¿¤¨
-¤é¤ì¤¿°ú¿ô¤ÎÆþ¤Ã¤Æ¤¤¤ëÇÛÎó¤Ë¤Ê¤ê¤Þ¤¹¡¥self¤ÏÂè3°ú¿ô¤È¤·¤ÆÍ¿
-¤¨¤é¤ì¤Þ¤¹¡¥
-
-¤³¤ÎÇÛÎó¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤ò²òÀϤ¹¤ë¤¿¤á¤Î´Ø¿ô¤¬open()¤Ç¤â»È¤ï
-¤ì¤Æ¤¤¤ërb_scan_args()¤Ç¤¹¡¥Âè3°ú¿ô¤Ë»ØÄꤷ¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë½¾
-¤¤¡¤Âè4ÊÑ¿ô°Ê¹ß¤Ë»ØÄꤷ¤¿VALUE¤Ø¤Î»²¾È¤ËÃͤòÂåÆþ¤·¤Æ¤¯¤ì¤Þ
-¤¹¡¥
-
-
-°ú¿ô¤òRuby¤ÎÇÛÎó¤È¤·¤Æ¼õ¤±¼è¤ë¥á¥½¥Ã¥É¤ÎÎã¤Ë¤Ï
-Thread#initialize¤¬¤¢¤ê¤Þ¤¹¡¥¼ÂÁõ¤Ï¤³¤¦¤Ç¤¹¡¥
-
---
-static VALUE
-thread_initialize(VALUE thread, VALUE args)
-{
- :
-}
---
-
-Âè1°ú¿ô¤Ïself¡¤Âè2°ú¿ô¤ÏRuby¤ÎÇÛÎó¤Ç¤¹¡¥
-
-** Ãí°Õ»ö¹à
-
-Ruby¤È¶¦Í­¤Ï¤·¤Ê¤¤¤¬Ruby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤ò³ÊǼ¤¹¤ë²ÄǽÀ­¤Î¤¢¤ë
-C¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤ÆRuby¥¤¥ó¥¿¥×¥ê¥¿¤ËÊÑ¿ô¤Î¸ºß
-¤ò¶µ¤¨¤Æ¤¢¤²¤Æ¤¯¤À¤µ¤¤¡¥¤Ç¤Ê¤¤¤ÈGC¤Ç¥È¥é¥Ö¥ë¤òµ¯¤³¤·¤Þ¤¹¡¥
-
- void rb_global_variable(VALUE *var)
-
-(4) extconf.rb¤òÍѰդ¹¤ë
-
-Makefile¤òºî¤ë¾ì¹ç¤Î¿÷·¿¤Ë¤Ê¤ëextconf.rb¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤òºî¤ê
-¤Þ¤¹¡¥extconf.rb¤Ï¥é¥¤¥Ö¥é¥ê¤Î¥³¥ó¥Ñ¥¤¥ë¤ËɬÍפʾò·ï¤Î¥Á¥§¥Ã
-¥¯¤Ê¤É¤ò¹Ô¤¦¤³¤È¤¬ÌÜŪ¤Ç¤¹¡¥¤Þ¤º¡¤
-
- require 'mkmf'
-
-¤òextconf.rb¤ÎÀèÆ¬¤ËÃÖ¤­¤Þ¤¹¡¥extconf.rb¤ÎÃæ¤Ç¤Ï°Ê²¼¤ÎRuby´Ø
-¿ô¤ò»È¤¦¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥
-
- have_library(lib, func): ¥é¥¤¥Ö¥é¥ê¤Î¸ºß¥Á¥§¥Ã¥¯
- have_func(func, header): ´Ø¿ô¤Î¸ºß¥Á¥§¥Ã¥¯
- have_header(header): ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¥Á¥§¥Ã¥¯
- create_makefile(target): Makefile¤ÎÀ¸À®
-
-°Ê²¼¤ÎÊÑ¿ô¤ò»È¤¦¤³¤È¤¬¤Ç¤­¤Þ¤¹¡¥
-
- $CFLAGS: ¥³¥ó¥Ñ¥¤¥ë»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-O¤Ê¤É)
- $CPPFLAGS: ¥×¥ê¥×¥í¥»¥Ã¥µ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-I¤ä-D¤Ê¤É)
- $LDFLAGS: ¥ê¥ó¥¯»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-L¤Ê¤É)
- $objs: ¥ê¥ó¥¯¤µ¤ì¤ë¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë̾¤Î¥ê¥¹¥È
-
-¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤Î¥ê¥¹¥È¤Ï¡¤Ä̾ï¤Ï¥½¡¼¥¹¥Õ¥¡¥¤¥ë¤ò¸¡º÷¤·
-¤Æ¼«Æ°Åª¤ËÀ¸À®¤µ¤ì¤Þ¤¹¤¬¡¤make¤ÎÅÓÃæ¤Ç¥½¡¼¥¹¤òÀ¸À®¤¹¤ë¤è¤¦¤Ê
-¾ì¹ç¤ÏÌÀ¼¨Åª¤Ë»ØÄꤹ¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
-
-¥é¥¤¥Ö¥é¥ê¤ò¥³¥ó¥Ñ¥¤¥ë¤¹¤ë¾ò·ï¤¬Â·¤ï¤º¡¤¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥³¥ó
-¥Ñ¥¤¥ë¤·¤Ê¤¤»þ¤Ë¤Ïcreate_makefile¤ò¸Æ¤Ð¤Ê¤±¤ì¤ÐMakefile¤ÏÀ¸
-À®¤µ¤ì¤º¡¤¥³¥ó¥Ñ¥¤¥ë¤â¹Ô¤ï¤ì¤Þ¤»¤ó¡¥
-
-(5) depend¤òÍѰդ¹¤ë
-
-¤â¤·¡¤¥Ç¥£¥ì¥¯¥È¥ê¤Ëdepend¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹¤ì¤Ð¡¤
-Makefile¤¬°Í¸´Ø·¸¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤¯¤ì¤Þ¤¹¡¥
-
- % gcc -MM *.c > depend
-
-¤Ê¤É¤Çºî¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤¢¤Ã¤ÆÂ»¤Ï̵¤¤¤Ç¤·¤ç¤¦¡¥
-
-(6) Makefile¤òÀ¸À®¤¹¤ë
-
-Makefile¤ò¼ÂºÝ¤ËÀ¸À®¤¹¤ë¤¿¤á¤Ë¤Ï
-
- ruby extconf.rb
-
-¤È¤·¤Þ¤¹¡¥extconf.rb¤Ë require 'mkmf' ¤Î¹Ô¤¬¤Ê¤¤¾ì¹ç¤Ë¤Ï¥¨¥é¡¼
-¤Ë¤Ê¤ê¤Þ¤¹¤Î¤Ç¡¤°ú¿ô¤òÄɲä·¤Æ
-
- ruby -r mkmf extconf.rb
-
-¤È¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-site_ruby ¥Ç¥£¥ì¥¯¥È¥ê¤Ç¤Ê¤¯¡¤
-vendor_ruby ¥Ç¥£¥ì¥¯¥È¥ê¤Ë¥¤¥ó¥¹¥È¡¼¥ë¤¹¤ë¾ì¹ç¤Ë¤Ï
-°Ê²¼¤Î¤è¤¦¤Ë --vendor ¥ª¥×¥·¥ç¥ó¤ò²Ã¤¨¤Æ¤¯¤À¤µ¤¤¡¥
-
- ruby extconf.rb --vendor
-
-¥Ç¥£¥ì¥¯¥È¥ê¤òext°Ê²¼¤ËÍѰդ·¤¿¾ì¹ç¤Ë¤ÏRubyÁ´ÂΤÎmake¤Î»þ¤Ë
-¼«Æ°Åª¤ËMakefile¤¬À¸À®¤µ¤ì¤Þ¤¹¤Î¤Ç¡¤¤³¤Î¥¹¥Æ¥Ã¥×¤ÏÉÔÍפǤ¹¡¥
-
-(7) make¤¹¤ë
-
-ưŪ¥ê¥ó¥¯¥é¥¤¥Ö¥é¥ê¤òÀ¸À®¤¹¤ë¾ì¹ç¤Ë¤Ï¤½¤Î¾ì¤Çmake¤·¤Æ¤¯¤À¤µ
-¤¤¡¥É¬ÍפǤ¢¤ì¤Ð make install ¤Ç¥¤¥ó¥¹¥È¡¼¥ë¤µ¤ì¤Þ¤¹¡¥
-
-ext°Ê²¼¤Ë¥Ç¥£¥ì¥¯¥È¥ê¤òÍѰդ·¤¿¾ì¹ç¤Ï¡¤Ruby¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç
-make¤ò¼Â¹Ô¤¹¤ë¤ÈMakefile¤òÀ¸À®¤«¤émake¡¤É¬Íפˤè¤Ã¤Æ¤Ï¤½¤Î¥â
-¥¸¥å¡¼¥ë¤ÎRuby¤Ø¤Î¥ê¥ó¥¯¤Þ¤Ç¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Æ¤¯¤ì¤Þ¤¹¡¥
-extconf.rb¤ò½ñ¤­´¹¤¨¤ë¤Ê¤É¤·¤ÆMakefile¤ÎºÆÀ¸À®¤¬É¬Íפʻþ¤Ï¤Þ
-¤¿Ruby¥Ç¥£¥ì¥¯¥È¥ê¤Çmake¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ïmake install¤ÇRuby¥é¥¤¥Ö¥é¥ê¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Î
-²¼¤Ë¥³¥Ô¡¼¤µ¤ì¤Þ¤¹¡¥¤â¤·³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤È¶¨Ä´¤·¤Æ»È¤¦Ruby¤Çµ­
-½Ò¤µ¤ì¤¿¥×¥í¥°¥é¥à¤¬¤¢¤ê¡¤Ruby¥é¥¤¥Ö¥é¥ê¤ËÃÖ¤­¤¿¤¤¾ì¹ç¤Ë¤Ï¡¤
-³ÈÄ¥¥é¥¤¥Ö¥é¥êÍѤΥǥ£¥ì¥¯¥È¥ê¤Î²¼¤Ë lib ¤È¤¤¤¦¥Ç¥£¥ì¥¯¥È¥ê
-¤òºî¤ê¡¤¤½¤³¤Ë ³ÈÄ¥»Ò .rb ¤Î¥Õ¥¡¥¤¥ë¤òÃÖ¤¤¤Æ¤ª¤±¤ÐƱ»þ¤Ë¥¤¥ó
-¥¹¥È¡¼¥ë¤µ¤ì¤Þ¤¹¡¥
-
-(8) ¥Ç¥Ð¥Ã¥°
-
-¤Þ¤¢¡¤¥Ç¥Ð¥Ã¥°¤·¤Ê¤¤¤Èư¤«¤Ê¤¤¤Ç¤·¤ç¤¦¤Í¡¥ext/Setup¤Ë¥Ç¥£¥ì
-¥¯¥È¥ê̾¤ò½ñ¤¯¤ÈÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë¤Î¤Ç¥Ç¥Ð¥Ã¥¬¤¬»È¤¨¤ë¤è¤¦¤Ë¤Ê
-¤ê¤Þ¤¹¡¥¤½¤Îʬ¥³¥ó¥Ñ¥¤¥ë¤¬ÃÙ¤¯¤Ê¤ê¤Þ¤¹¤±¤É¡¥
-
-(9) ¤Ç¤­¤¢¤¬¤ê
-
-¸å¤Ï¤³¤Ã¤½¤ê»È¤¦¤Ê¤ê¡¤¹­¤¯¸ø³«¤¹¤ë¤Ê¤ê¡¤Çä¤ë¤Ê¤ê¡¤¤´¼«Í³¤Ë¤ª
-»È¤¤¤¯¤À¤µ¤¤¡¥Ruby¤Îºî¼Ô¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ë´Ø¤·¤Æ°ìÀڤθ¢Íø¤ò
-¼çÄ¥¤·¤Þ¤»¤ó¡¥
-
-Appendix A. Ruby¤Î¥½¡¼¥¹¥³¡¼¥É¤ÎʬÎà
-
-Ruby¤Î¥½¡¼¥¹¤Ï¤¤¤¯¤Ä¤«¤ËʬÎह¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤³¤Î¤¦¤Á¥¯¥é
-¥¹¥é¥¤¥Ö¥é¥ê¤ÎÉôʬ¤Ï´ðËÜŪ¤Ë³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ÈƱ¤¸ºî¤êÊý¤Ë¤Ê¤Ã
-¤Æ¤¤¤Þ¤¹¡¥¤³¤ì¤é¤Î¥½¡¼¥¹¤Ïº£¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤Û¤È¤ó¤ÉÍý²ò¤Ç¤­¤ë¤È
-»×¤¤¤Þ¤¹¡¥
-
-Ruby¸À¸ì¤Î¥³¥¢
-
- class.c : ¥¯¥é¥¹¤È¥â¥¸¥å¡¼¥ë
- error.c : Îã³°¥¯¥é¥¹¤ÈÎã³°µ¡¹½
- gc.c : µ­²±Îΰè´ÉÍý
- load.c : ¥é¥¤¥Ö¥é¥ê¤Î¥í¡¼¥É
- object.c : ¥ª¥Ö¥¸¥§¥¯¥È
- variable.c : ÊÑ¿ô¤ÈÄê¿ô
-
-Ruby¤Î¹½Ê¸²òÀÏ´ï
- parse.y : »ú¶ç²òÀÏ´ï¤È¹½Ê¸ÄêµÁ
- -> parse.c : ¼«Æ°À¸À®
- keywords : ͽÌó¸ì
- -> lex.c : ¼«Æ°À¸À®
-
-Ruby¤Îɾ²Á´ï (Ä̾ÎYARV)
- compile.c
- eval.c
- eval_error.c
- eval_jump.c
- eval_safe.c
- insns.def : ²¾ÁÛµ¡³£¸ì¤ÎÄêµÁ
- iseq.c : VM::ISeq¤Î¼ÂÁõ
- thread.c : ¥¹¥ì¥Ã¥É´ÉÍý¤È¥³¥ó¥Æ¥­¥¹¥ÈÀÚ¤êÂØ¤¨
- thread_win32.c : ¥¹¥ì¥Ã¥É¼ÂÁõ
- thread_pthread.c : Ʊ¾å
- vm.c
- vm_dump.c
- vm_eval.c
- vm_exec.c
- vm_insnhelper.c
- vm_method.c
-
- opt_insns_unif.def : Ì¿ÎáÍ»¹ç
- opt_operand.def : ºÇŬ²½¤Î¤¿¤á¤ÎÄêµÁ
-
- -> insn*.inc : ¼«Æ°À¸À®
- -> opt*.inc : ¼«Æ°À¸À®
- -> vm.inc : ¼«Æ°À¸À®
-
-Àµµ¬É½¸½¥¨¥ó¥¸¥ó (µ´¼Ö)
- regex.c
- regcomp.c
- regenc.c
- regerror.c
- regexec.c
- regparse.c
- regsyntax.c
-
-¥æ¡¼¥Æ¥£¥ê¥Æ¥£´Ø¿ô
-
- debug.c : C¥Ç¥Ð¥Ã¥¬ÍѤΥǥХå°¥·¥ó¥Ü¥ë
- dln.c : ưŪ¥í¡¼¥Ç¥£¥ó¥°
- st.c : ÈÆÍѥϥå·¥åɽ
- strftime.c : »þ¹ïÀ°·Á
- util.c : ¤½¤Î¾¤Î¥æ¡¼¥Æ¥£¥ê¥Æ¥£
-
-Ruby¥³¥Þ¥ó¥É¤Î¼ÂÁõ
-
- dmyext.c
- dmydln.c
- dmyencoding.c
- id.c
- inits.c
- main.c
- ruby.c
- version.c
-
- gem_prelude.rb
- prelude.rb
-
-¥¯¥é¥¹¥é¥¤¥Ö¥é¥ê
-
- array.c : Array
- bignum.c : Bignum
- compar.c : Comparable
- complex.c : Complex
- cont.c : Fiber, Continuation
- dir.c : Dir
- enum.c : Enumerable
- enumerator.c : Enumerator
- file.c : File
- hash.c : Hash
- io.c : IO
- marshal.c : Marshal
- math.c : Math
- numeric.c : Numeric, Integer, Fixnum, Float
- pack.c : Array#pack, String#unpack
- proc.c : Binding, Proc
- process.c : Process
- random.c : Íð¿ô
- range.c : Range
- rational.c : Rational
- re.c : Regexp, MatchData
- signal.c : Signal
- sprintf.c :
- string.c : String
- struct.c : Struct
- time.c : Time
-
- defs/knwon_errors.def : Îã³°¥¯¥é¥¹ Errno::*
- -> known_errors.inc : ¼«Æ°À¸À®
-
-¿¸À¸ì²½
- encoding.c : Encoding
- transcode.c : Encoding::Converter
- enc/*.c : ¥¨¥ó¥³¡¼¥Ç¥£¥ó¥°¥¯¥é¥¹·²
- enc/trans/* : ¥³¡¼¥É¥Ý¥¤¥ó¥ÈÂбþɽ
-
-goruby¥³¥Þ¥ó¥É¤Î¼ÂÁõ
-
- goruby.c
- golf_prelude.rb : goruby¸ÇÍ­¤Î¥é¥¤¥Ö¥é¥ê
- -> golf_prelude.c : ¼«Æ°À¸À®
-
-
-Appendix B. ³ÈÄ¥ÍÑ´Ø¿ô¥ê¥Õ¥¡¥ì¥ó¥¹
-
-C¸À¸ì¤«¤éRuby¤Îµ¡Ç½¤òÍøÍѤ¹¤ëAPI¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
-
-** ·¿
-
-VALUE
-
- Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òɽ¸½¤¹¤ë·¿¡¥É¬Íפ˱þ¤¸¤Æ¥­¥ã¥¹¥È¤·¤ÆÍѤ¤¤ë¡¥
- ÁȤ߹þ¤ß·¿¤òɽ¸½¤¹¤ëC¤Î·¿¤Ïruby.h¤Ëµ­½Ò¤·¤Æ¤¢¤ëR¤Ç»Ï¤Þ¤ë¹½Â¤
- ÂΤǤ¢¤ë¡¥VALUE·¿¤ò¤³¤ì¤é¤Ë¥­¥ã¥¹¥È¤¹¤ë¤¿¤á¤ËR¤Ç»Ï¤Þ¤ë¹½Â¤ÂÎ
- ̾¤òÁ´¤ÆÂçʸ»ú¤Ë¤·¤¿Ì¾Á°¤Î¥Þ¥¯¥í¤¬ÍѰդµ¤ì¤Æ¤¤¤ë¡¥
-
-** ÊÑ¿ô¡¦Äê¿ô
-
-Qnil
-
- Äê¿ô: nil¥ª¥Ö¥¸¥§¥¯¥È
-
-Qtrue
-
- Äê¿ô: true¥ª¥Ö¥¸¥§¥¯¥È(¿¿¤Î¥Ç¥Õ¥©¥ë¥ÈÃÍ)
-
-Qfalse
-
- Äê¿ô: false¥ª¥Ö¥¸¥§¥¯¥È
-
-** C¥Ç¡¼¥¿¤Î¥«¥×¥»¥ë²½
-
-Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
-
- C¤ÎǤ°Õ¤Î¥Ý¥¤¥ó¥¿¤ò¥«¥×¥»¥ë²½¤·¤¿Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òÊÖ¤¹¡¥¤³
- ¤Î¥Ý¥¤¥ó¥¿¤¬Ruby¤«¤é¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¯¤Ê¤Ã¤¿»þ¡¤free¤Ç»ØÄꤷ¤¿
- ´Ø¿ô¤¬¸Æ¤Ð¤ì¤ë¡¥¤Þ¤¿¡¤¤³¤Î¥Ý¥¤¥ó¥¿¤Î»Ø¤¹¥Ç¡¼¥¿¤¬Â¾¤ÎRuby¥ª¥Ö
- ¥¸¥§¥¯¥È¤ò»Ø¤·¤Æ¤¤¤ë¾ì¹ç¡¤mark¤Ë»ØÄꤹ¤ë´Ø¿ô¤Ç¥Þ¡¼¥¯¤¹¤ëɬÍ×
- ¤¬¤¢¤ë¡¥
-
-Data_Make_Struct(klass, type, mark, free, sval)
-
- type·¿¤Î¥á¥â¥ê¤òmalloc¤·¡¤ÊÑ¿ôsval¤ËÂåÆþ¤·¤¿¸å¡¤¤½¤ì¤ò¥«¥×¥»
- ¥ë²½¤·¤¿¥Ç¡¼¥¿¤òÊÖ¤¹¥Þ¥¯¥í¡¥
-
-Data_Get_Struct(data, type, sval)
-
- data¤«¤étype·¿¤Î¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤·ÊÑ¿ôsval¤ËÂåÆþ¤¹¤ë¥Þ¥¯¥í¡¥
-
-** ·¿¥Á¥§¥Ã¥¯
-
-TYPE(value)
-FIXNUM_P(value)
-NIL_P(value)
-void Check_Type(VALUE value, int type)
-void Check_SafeStr(VALUE value)
-
-** ·¿ÊÑ´¹
-
-FIX2INT(value), INT2FIX(i)
-FIX2LONG(value), LONG2FIX(l)
-NUM2INT(value), INT2NUM(i)
-NUM2UINT(value), UINT2NUM(ui)
-NUM2LONG(value), LONG2NUM(l)
-NUM2ULONG(value), ULONG2NUM(ul)
-NUM2LL(value), LL2NUM(ll)
-NUM2ULL(value), ULL2NUM(ull)
-NUM2OFFT(value), OFFT2NUM(off)
-NUM2SIZET(value), SIZET2NUM(size)
-NUM2SSIZET(value), SSIZET2NUM(ssize)
-NUM2DBL(value)
-rb_float_new(f)
-StringValue(value)
-StringValuePtr(value)
-StringValueCStr(value)
-rb_str_new2(s)
-
-** ¥¯¥é¥¹/¥â¥¸¥å¡¼¥ëÄêµÁ
-
-VALUE rb_define_class(const char *name, VALUE super)
-
- super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤¹¤ë¡¥
-
-VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
-
- super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤·¡¤module¤Î
- Äê¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
-
-VALUE rb_define_module(const char *name)
-
- ¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¡¥
-
-VALUE rb_define_module_under(VALUE module, const char *name)
-
- ¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤·¡¤module¤ÎÄê¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
-
-void rb_include_module(VALUE klass, VALUE module)
-
- ¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë¡¥class¤¬¤¹¤Ç¤Ëmodule¤ò¥¤¥ó¥¯
- ¥ë¡¼¥É¤·¤Æ¤¤¤ë»þ¤Ë¤Ï²¿¤â¤·¤Ê¤¤(¿½Å¥¤¥ó¥¯¥ë¡¼¥É¤Î¶Ø»ß)¡¥
-
-void rb_extend_object(VALUE object, VALUE module)
-
- ¥ª¥Ö¥¸¥§¥¯¥È¤ò¥â¥¸¥å¡¼¥ë(¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ë¥á¥½¥Ã¥É)¤Ç³ÈÄ¥¤¹¤ë¡¥
-
-** Âç°èÊÑ¿ôÄêµÁ
-
-void rb_define_variable(const char *name, VALUE *var)
-
- Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ë¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô̾¤¬`$'¤Ç
- »Ï¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤ë¡¥name¤È¤·¤ÆRuby¤Î¼±ÊÌ»Ò
- ¤È¤·¤Æµö¤µ¤ì¤Ê¤¤Ê¸»ú(Î㤨¤Ð` ')¤ò´Þ¤à¾ì¹ç¤Ë¤ÏRuby¥×¥í¥°¥é
- ¥à¤«¤é¤Ï¸«¤¨¤Ê¤¯¤Ê¤ë¡¥
-
-void rb_define_readonly_variable(const char *name, VALUE *var)
-
- Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëread only¤Î¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥
- read only¤Ç¤¢¤ë¤³¤È°Ê³°¤Ïrb_define_variable()¤ÈƱ¤¸¡¥
-
-void rb_define_virtual_variable(const char *name,
- VALUE (*getter)(), void (*setter)())
-
- ´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRubyÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿
- »þ¤Ë¤Ïgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì
- ¤ë¡¥
-
-void rb_define_hooked_variable(const char *name, VALUE *var,
- VALUE (*getter)(), void (*setter)())
-
- ´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô
- ¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ïgetter¤¬¡¤´Ø¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ï
- setter¤¬¸Æ¤Ð¤ì¤ë¡¥getter¤äsetter¤Ë0¤ò»ØÄꤷ¤¿»þ¤Ë¤Ïhook¤ò
- »ØÄꤷ¤Ê¤¤¤Î¤ÈƱ¤¸»ö¤Ë¤Ê¤ë¡¥
-
-void rb_global_variable(VALUE *var)
-
- GC¤Î¤¿¤á¡¤Ruby¥×¥í¥°¥é¥à¤«¤é¤Ï¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¤¤¬, Ruby¥ª¥Ö
- ¥¸¥§¥¯¥È¤ò´Þ¤àÂç°èÊÑ¿ô¤ò¥Þ¡¼¥¯¤¹¤ë¡¥
-
-** Äê¿ô
-
-void rb_define_const(VALUE klass, const char *name, VALUE val)
-
- Äê¿ô¤òÄêµÁ¤¹¤ë¡¥
-
-void rb_define_global_const(const char *name, VALUE val)
-
- Âç°èÄê¿ô¤òÄêµÁ¤¹¤ë¡¥
-
- rb_define_const(rb_cObject, name, val)
-
- ¤ÈƱ¤¸°ÕÌ£¡¥
-
-** ¥á¥½¥Ã¥ÉÄêµÁ
-
-rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
- ¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥argc¤Ïself¤ò½ü¤¯°ú¿ô¤Î¿ô¡¥argc¤¬-1¤Î»þ,
- ´Ø¿ô¤Ë¤Ï°ú¿ô¤Î¿ô(self¤ò´Þ¤Þ¤Ê¤¤)¤òÂè1°ú¿ô, °ú¿ô¤ÎÇÛÎó¤òÂè2
- °ú¿ô¤È¤¹¤ë·Á¼°¤ÇÍ¿¤¨¤é¤ì¤ë(Âè3°ú¿ô¤Ïself)¡¥argc¤¬-2¤Î»þ,
- Âè1°ú¿ô¤¬self, Âè2°ú¿ô¤¬args(args¤Ï°ú¿ô¤ò´Þ¤àRuby¤ÎÇÛÎó)¤È
- ¤¤¤¦·Á¼°¤ÇÍ¿¤¨¤é¤ì¤ë¡¥
-
-rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
- private¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
-
-rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
- ÆÃ°Û¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
-
-rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
-
- argc, argv·Á¼°¤ÇÍ¿¤¨¤é¤ì¤¿»ØÄꤵ¤ì¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë½¾¤Ã¤Æ°ú
- ¿ô¤òʬ²ò¤·¡¤Â³¤¯VALUE¤Ø¤Î»²¾È¤Ë¥»¥Ã¥È¤·¤Þ¤¹¡¥¤³¤Î¥Õ¥©¡¼¥Þ¥Ã
- ¥È¤Ï¡¤ABNF¤Çµ­½Ò¤¹¤ë¤È°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
-
---
-scan-arg-spec := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
-
-param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec / pre-opt-post-arg-spec
-pre-arg-spec := num-of-leading-mandatory-args [num-of-optional-args]
-post-arg-spec := sym-for-variable-length-args [num-of-trailing-mandatory-args]
-pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args num-of-trailing-mandatory-args
-option-hash-arg-spec := sym-for-option-hash-arg
-block-arg-spec := sym-for-block-arg
-
-num-of-leading-mandatory-args := DIGIT ; ÀèÆ¬¤ËÃÖ¤«¤ì¤ë¾ÊάÉÔǽ¤Ê°ú¿ô¤Î¿ô
-num-of-optional-args := DIGIT ; ³¤¤¤ÆÃÖ¤«¤ì¤ë¾Êά²Äǽ¤Ê°ú¿ô¤Î¿ô
-sym-for-variable-length-args := "*" ; ³¤¤¤ÆÃÖ¤«¤ì¤ë²ÄÊÑŰú¿ô¤ò
- ; Ruby¤ÎÇÛÎó¤Ç¼èÆÀ¤¹¤ë¤¿¤á¤Î»ØÄê
-num-of-trailing-mandatory-args := DIGIT ; ½ªÃ¼¤ËÃÖ¤«¤ì¤ë¾ÊάÉÔǽ¤Ê°ú¿ô¤Î¿ô
-sym-for-option-hash-arg := ":" ; ¥ª¥×¥·¥ç¥ó¥Ï¥Ã¥·¥å¤ò¼èÆÀ¤¹¤ë
- ; ¤¿¤á¤Î»ØÄê; ¾ÊάÉÔǽ¤Ê°ú¿ô¤Î
- ; ¿ô¤è¤ê¤â¿¤¯¤Î°ú¿ô¤¬»ØÄꤵ¤ì¡¤
- ; ºÇ¸å¤Î°ú¿ô¤¬¥Ï¥Ã¥·¥å¡Ê¤Þ¤¿¤Ï
- ; #to_hash¤ÇÊÑ´¹²Äǽ¡Ë¤Î¾ì¹ç¤Ë
- ; ¼èÆÀ¤µ¤ì¤ë¡¥ºÇ¸å¤Î°ú¿ô¤¬nil¤Î
- ; ¾ì¹ç¡¤²ÄÊÑŰú¿ô»ØÄ꤬¤Ê¤¯¡¤
- ; ¾ÊάÉÔǽ°ú¿ô¤Î¿ô¤è¤ê¤â¿¤¯¤Î
- ; °ú¿ô¤¬»ØÄꤵ¤ì¤¿¾ì¹ç¤Ë¼èÆÀ¤µ¤ì¤ë
-sym-for-block-arg := "&" ; ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¼èÆÀ¤¹¤ë¤¿¤á¤Î
- ; »ØÄê
---
-
- ¥Õ¥©¡¼¥Þ¥Ã¥È¤¬"12"¤Î¾ì¹ç¡¤°ú¿ô¤ÏºÇÄã1¤Ä¤Ç¡¤3¤Ä(1+2)¤Þ¤Çµö¤µ
- ¤ì¤ë¤È¤¤¤¦°ÕÌ£¤Ë¤Ê¤ê¤Þ¤¹¡¥½¾¤Ã¤Æ¡¤¥Õ¥©¡¼¥Þ¥Ã¥Èʸ»úÎó¤Ë³¤¤
- ¤Æ3¤Ä¤ÎVALUE¤Ø¤Î»²¾È¤òÃÖ¤¯É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥¤½¤ì¤é¤Ë¤Ï¼èÆÀ¤·¤¿
- ÊÑ¿ô¤¬¥»¥Ã¥È¤µ¤ì¤Þ¤¹¡¥ÊÑ¿ô¤Ø¤Î»²¾È¤ÎÂå¤ï¤ê¤ËNULL¤ò»ØÄꤹ¤ë
- ¤³¤È¤â¤Ç¤­¡¤¤½¤Î¾ì¹ç¤Ï¼èÆÀ¤·¤¿°ú¿ô¤ÎÃͤϼΤƤé¤ì¤Þ¤¹¡¥¤Ê¤ª¡¤
- ¾Êά²Äǽ°ú¿ô¤¬¾Êά¤µ¤ì¤¿»þ¤ÎÊÑ¿ô¤ÎÃͤÏnil(C¸À¸ì¤Î¥ì¥Ù¥ë¤Ç¤Ï
- Qnil)¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
- ÊÖ¤êÃͤÏÍ¿¤¨¤é¤ì¤¿°ú¿ô¤Î¿ô¤Ç¤¹¡¥¥ª¥×¥·¥ç¥ó¥Ï¥Ã¥·¥å¤ª¤è¤Ó¥¤
- ¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤Ï¿ô¤¨¤Þ¤»¤ó¡¥
-
-** Ruby¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·
-
-VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
-
- ¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥Ê¸»úÎ󤫤émid¤òÆÀ¤ë¤¿¤á¤Ë¤Ïrb_intern()¤ò
- »È¤¦¡¥
-
-VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-
- ¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥°ú¿ô¤òargc, argv·Á¼°¤ÇÅϤ¹¡¥
-
-VALUE rb_eval_string(const char *str)
-
- ʸ»úÎó¤òRuby¥¹¥¯¥ê¥×¥È¤È¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¡¦¼Â¹Ô¤¹¤ë¡¥
-
-ID rb_intern(const char *name)
-
- ʸ»úÎó¤ËÂбþ¤¹¤ëID¤òÊÖ¤¹¡¥
-
-char *rb_id2name(ID id)
-
- ID¤ËÂбþ¤¹¤ëʸ»úÎó¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥
-
-char *rb_class2name(VALUE klass)
-
- ¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥¥¯¥é¥¹¤¬Ì¾Á°¤ò»ý¤¿¤Ê¤¤»þ¤Ë
- ¤Ï, ÁÄÀè¤òÁ̤äÆÌ¾Á°¤ò»ý¤Ä¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹¡¥
-
-int rb_respond_to(VALUE obj, ID id)
-
- obj¤¬id¤Ç¼¨¤µ¤ì¤ë¥á¥½¥Ã¥É¤ò»ý¤Ä¤«¤É¤¦¤«¤òÊÖ¤¹¡¥
-
-** ¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô
-
-VALUE rb_iv_get(VALUE obj, const char *name)
-
- obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ÎÃͤòÆÀ¤ë¡¥`@'¤Ç»Ï¤Þ¤é¤Ê¤¤¥¤¥ó¥¹¥¿¥ó
- ¥¹ÊÑ¿ô¤Ï Ruby¥×¥í¥°¥é¥à¤«¤é¥¢¥¯¥»¥¹¤Ç¤­¤Ê¤¤¡Ö±£¤ì¤¿¡×¥¤¥ó
- ¥¹¥¿¥ó¥¹ÊÑ¿ô¤Ë¤Ê¤ë¡¥Äê¿ô¤ÏÂçʸ»ú¤Î̾Á°¤ò»ý¤Ä¥¯¥é¥¹(¤Þ¤¿¤Ï
- ¥â¥¸¥å¡¼¥ë)¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤È¤·¤Æ¼ÂÁõ¤µ¤ì¤Æ¤¤¤ë¡¥
-
-VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
-
- obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤òval¤Ë¥»¥Ã¥È¤¹¤ë¡¥
-
-** À©¸æ¹½Â¤
-
-VALUE rb_block_call(VALUE obj, ID mid, int argc, VALUE * argv,
- VALUE (*func) (ANYARGS), VALUE data2)
-
- func¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ¡¤obj¤ò¥ì¥·¡¼¥Ð¡¤argc¤Èargv¤ò°ú¿ô
- ¤È¤·¤Æmid¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¡¥func¤ÏÂè°ì°ú¿ô¤Ëyield¤µ¤ì¤¿ÃÍ¡¤
- ÂèÆó°ú¿ô¤Ëdata2¤ò¼õ¤±¼è¤ë¡¥Ê£¿ô¤ÎÃͤ¬yield¤µ¤ì¤¿¾ì¹ç(C¤Ç¤Ï
- rb_yield_values()¤Èrb_yield_values2(), rb_yield_splat())¡¤
- data2¤ÏArray¤È¤·¤Æ¥Ñ¥Ã¥¯¤µ¤ì¤Æ¤¤¤ë¡¥Âè»°, Âè»Í°ú¿ô¤Îargc¤È
- argv¤Ë¤è¤Ã¤Æyield¤µ¤ì¤¿Ãͤò¼è¤ê½Ð¤¹¤³¤È¤¬¤Ç¤­¤ë¡¥
-
-[OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
-
- func2¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ, func1¤ò¥¤¥Æ¥ì¡¼¥¿¤È¤·¤Æ¸Æ¤Ö¡¥
- func1¤Ë¤Ï arg1¤¬°ú¿ô¤È¤·¤ÆÅϤµ¤ì, func2¤Ë¤ÏÂè1°ú¿ô¤Ë¥¤¥Æ¥ì¡¼
- ¥¿¤«¤éÍ¿¤¨¤é¤ì¤¿ÃÍ, Âè2°ú¿ô¤Ëarg2¤¬ÅϤµ¤ì¤ë¡¥
-
- 1.9¤Çrb_iterate¤ò»È¤¦¾ì¹ç¤Ï, func1¤ÎÃæ¤ÇRuby¥ì¥Ù¥ë¤Î¥á¥½¥Ã¥É
- ¤ò¸Æ¤Ó½Ð¤µ¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤.
- 1.9¤Çobsolete¤È¤Ê¤Ã¤¿. Âå¤ï¤ê¤Ërb_block_call¤¬ÍѰդµ¤ì¤¿.
-
-VALUE rb_yield(VALUE val)
-
- val¤òÃͤȤ·¤Æ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¸Æ¤Ó½Ð¤¹¡¥
-
-VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
-
- ´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤Ë¸Æ¤Ó½Ð¤¹¡¥func1¤Î¼Â¹ÔÃæ¤ËÎã³°¤¬È¯À¸
- ¤·¤¿»þ¤Ë¤Ï func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¸Æ¤Ö¡¥Ìá¤êÃͤÏÎã³°¤¬È¯À¸
- ¤·¤Ê¤«¤Ã¤¿»þ¤Ïfunc1¤ÎÌá¤êÃÍ, Îã³°¤¬È¯À¸¤·¤¿»þ¤Ë¤Ïfunc2¤ÎÌá
- ¤êÃͤǤ¢¤ë¡¥
-
-VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
-
- ´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, ¼Â¹Ô½ªÎ»¸å(¤¿¤È¤¨Îã³°¤¬
- ȯÀ¸¤·¤Æ¤â) func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤¹¤ë¡¥Ìá¤êÃͤÏfunc1
- ¤ÎÌá¤êÃͤǤ¢¤ë(Îã³°¤¬È¯À¸¤·¤¿»þ¤ÏÌá¤é¤Ê¤¤)¡¥
-
-VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state)
-
- ´Ø¿ôfunc¤òarg¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, Îã³°¤¬È¯À¸¤·¤Ê¤±¤ì¤Ð¤½¤ÎÌá
- ¤êÃͤòÊÖ¤¹¡¥Îã³°¤¬È¯À¸¤·¤¿¾ì¹ç¤Ï, *state¤ËÈó0¤ò¥»¥Ã¥È¤·¤Æ
- Qnil¤òÊÖ¤¹¡¥
-
-void rb_jump_tag(int state)
-
- rb_protect()¤ärb_eval_string_protect()¤ÇÊ᪤µ¤ì¤¿Îã³°¤òºÆ
- Á÷¤¹¤ë¡¥state¤Ï¤½¤ì¤é¤Î´Ø¿ô¤«¤éÊÖ¤µ¤ì¤¿ÃͤǤʤ±¤ì¤Ð¤Ê¤é¤Ê¤¤¡¥
- ¤³¤Î´Ø¿ô¤ÏľÀܤθƤӽФ·¸µ¤ËÌá¤é¤Ê¤¤¡¥
-
-** Îã³°¡¦¥¨¥é¡¼
-
-void rb_warning(const char *fmt, ...)
-
- rb_verbose»þ¤Ëɸ½à¥¨¥é¡¼½ÐÎϤ˷ٹð¾ðÊó¤òɽ¼¨¤¹¤ë¡¥°ú¿ô¤Ï
- printf()¤ÈƱ¤¸¡¥
-
-void rb_raise(rb_eRuntimeError, const char *fmt, ...)
-
- RuntimeErrorÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
-
-void rb_raise(VALUE exception, const char *fmt, ...)
-
- exception¤Ç»ØÄꤷ¤¿Îã³°¤òȯÀ¸¤µ¤»¤ë¡¥fmt°Ê²¼¤Î°ú¿ô¤Ï
- printf()¤ÈƱ¤¸¡¥
-
-void rb_fatal(const char *fmt, ...)
-
- Ã×̿ŪÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥Ä̾ï¤ÎÎã³°½èÍý¤Ï¹Ô¤Ê¤ï¤ì¤º, ¥¤¥ó¥¿¡¼
- ¥×¥ê¥¿¤¬½ªÎ»¤¹¤ë(¤¿¤À¤·ensure¤Ç»ØÄꤵ¤ì¤¿¥³¡¼¥É¤Ï½ªÎ»Á°¤Ë
- ¼Â¹Ô¤µ¤ì¤ë)¡¥
-
-void rb_bug(const char *fmt, ...)
-
- ¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ê¤É¥×¥í¥°¥é¥à¤Î¥Ð¥°¤Ç¤·¤«È¯À¸¤¹¤ë¤Ï¤º¤Î¤Ê¤¤
- ¾õ¶·¤Î»þ¸Æ¤Ö¡¥¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ï¥³¥¢¥À¥ó¥×¤·Ä¾¤Á¤Ë½ªÎ»¤¹¤ë¡¥
- Îã³°½èÍý¤Ï°ìÀڹԤʤï¤ì¤Ê¤¤¡¥
-
-** Ruby¤Î½é´ü²½¡¦¼Â¹Ô
-
-Ruby¤ò¥¢¥×¥ê¥±¡¼¥·¥ç¥ó¤ËËä¤á¹þ¤à¾ì¹ç¤Ë¤Ï°Ê²¼¤Î¥¤¥ó¥¿¥Õ¥§¡¼¥¹
-¤ò»È¤¦¡¥Ä̾ï¤Î³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ë¤ÏɬÍפʤ¤¡¥
-
-void ruby_init()
-
- Ruby¥¤¥ó¥¿¥×¥ê¥¿¤Î½é´ü²½¤ò¹Ô¤Ê¤¦¡¥
-
-void ruby_options(int argc, char **argv)
-
- Ruby¥¤¥ó¥¿¥×¥ê¥¿¤Î¥³¥Þ¥ó¥É¥é¥¤¥ó°ú¿ô¤Î½èÍý¤ò¹Ô¤Ê¤¦¡¥
-
-void ruby_run()
-
- Ruby¥¤¥ó¥¿¥×¥ê¥¿¤ò¼Â¹Ô¤¹¤ë¡¥
-
-void ruby_script(char *name)
-
- Ruby¤Î¥¹¥¯¥ê¥×¥È̾($0)¤òÀßÄꤹ¤ë¡¥
-
-** ¥¤¥ó¥¿¥×¥ê¥¿¤Î¥¤¥Ù¥ó¥È¤Î¥Õ¥Ã¥¯
-
- void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events, VALUE data)
-
-»ØÄꤵ¤ì¤¿¥¤¥ó¥¿¥×¥ê¥¿¤Î¥¤¥Ù¥ó¥È¤ËÂФ¹¤ë¥Õ¥Ã¥¯´Ø¿ô¤òÄɲä·¤Þ¤¹¡¥
-events¤Ï°Ê²¼¤ÎÃͤÎor¤Ç¤Ê¤±¤ì¤Ð¤Ê¤ê¤Þ¤»¤ó:
-
- RUBY_EVENT_LINE
- RUBY_EVENT_CLASS
- RUBY_EVENT_END
- RUBY_EVENT_CALL
- RUBY_EVENT_RETURN
- RUBY_EVENT_C_CALL
- RUBY_EVENT_C_RETURN
- RUBY_EVENT_RAISE
- RUBY_EVENT_ALL
-
-rb_event_hook_func_t¤ÎÄêµÁ¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹:
-
- typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
- VALUE self, ID id, VALUE klass)
-
-rb_add_event_hook() ¤ÎÂè3°ú¿ô data ¤Ï¡¤¥Õ¥Ã¥¯´Ø¿ô¤ÎÂè2°ú¿ô¤È
-¤·¤ÆÅϤµ¤ì¤Þ¤¹¡¥¤³¤ì¤Ï1.8¤Ç¤Ï¸½ºß¤ÎNODE¤Ø¤Î¥Ý¥¤¥ó¥¿¤Ç¤·¤¿¡¥°Ê
-²¼¤Î RB_EVENT_HOOKS_HAVE_CALLBACK_DATA ¤â»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
- int rb_remove_event_hook(rb_event_hook_func_t func)
-
-»ØÄꤵ¤ì¤¿¥Õ¥Ã¥¯´Ø¿ô¤òºï½ü¤·¤Þ¤¹¡¥
-
-** ¸ß´¹À­¤Î¤¿¤á¤Î¥Þ¥¯¥í
-
-API¤Î¸ß´¹À­¤ò¥Á¥§¥Ã¥¯¤¹¤ë¤¿¤á¤Ë°Ê²¼¤Î¥Þ¥¯¥í¤¬¥Ç¥Õ¥©¥ë¥È¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
-NORETURN_STYLE_NEW
-
- NORETURN ¥Þ¥¯¥í¤¬´Ø¿ô·¿¥Þ¥¯¥í¤È¤·¤ÆÄêµÁ¤µ¤ì¤Æ¤¤¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
-
-HAVE_RB_DEFINE_ALLOC_FUNC
-
- rb_define_alloc_func() ´Ø¿ô¤¬Ä󶡤µ¤ì¤Æ¤¤¤ë¤³¤È¡¤¤Ä¤Þ¤ê
- allocation framework ¤¬»È¤ï¤ì¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
- have_func("rb_define_alloc_func", "ruby.h")
- ¤Î·ë²Ì¤ÈƱ¤¸¡¥
-
-HAVE_RB_REG_NEW_STR
-
- String¥ª¥Ö¥¸¥§¥¯¥È¤«¤éRegexp¥ª¥Ö¥¸¥§¥¯¥È¤òºî¤ë
- rb_reg_new_str() ´Ø¿ô¤¬Ä󶡤µ¤ì¤Æ¤¤¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
- have_func("rb_reg_new_str", "ruby.h").
- ¤Î·ë²Ì¤ÈƱ¤¸¡¥
-
-HAVE_RB_IO_T
-
- rb_io_t ·¿¤¬Ä󶡤µ¤ì¤Æ¤¤¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
-
-USE_SYMBOL_AS_METHOD_NAME
-
- ¥á¥½¥Ã¥É̾¤òÊÖ¤¹¥á¥½¥Ã¥É¡¤Module#methods, #singleton_methods
- ¤Ê¤É¤¬Symbol¤òÊÖ¤¹¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
-
-HAVE_RUBY_*_H
-
- ruby.h ¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ë¡¥Âбþ¤¹¤ë¥Ø¥Ã¥À¤¬Ä󶡤µ¤ì¤Æ¤¤¤ë¤³¤È
- ¤ò°ÕÌ£¤¹¤ë¡¥¤¿¤È¤¨¤Ð¡¤HAVE_RUBY_ST_H ¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤ë¾ì¹ç¤Ï
- ñ¤Ê¤ë st.h ¤Ç¤Ï¤Ê¤¯ ruby/st.h ¤ò»ÈÍѤ¹¤ë¡¥
-
-RB_EVENT_HOOKS_HAVE_CALLBACK_DATA
-
- rb_add_event_hook() ¤¬¥Õ¥Ã¥¯´Ø¿ô¤ËÅϤ¹ data ¤òÂè3°ú¿ô¤È¤·¤Æ
- ¼õ¤±¼è¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
-
-Appendix C. extconf.rb¤Ç»È¤¨¤ë´Ø¿ô¤¿¤Á
-
-extconf.rb¤ÎÃæ¤Ç¤ÏÍøÍѲÄǽ¤Ê¥³¥ó¥Ñ¥¤¥ë¾ò·ï¥Á¥§¥Ã¥¯¤Î´Ø¿ô¤Ï°Ê
-²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
-
-have_macro(macro, headers)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ¥Þ¥¯¥ímacro¤¬ÄêµÁ¤µ
- ¤ì¤Æ¤¤¤ë¤«¤É¤¦¤«¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥Þ¥¯¥í¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤ë»þtrue
- ¤òÊÖ¤¹¡¥
-
-have_library(lib, func)
-
- ´Ø¿ôfunc¤òÄêµÁ¤·¤Æ¤¤¤ë¥é¥¤¥Ö¥é¥êlib¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥
- ¥é¥¤¥Ö¥é¥ê¤¬Â¸ºß¤¹¤ë»þ¡¤true¤òÊÖ¤¹¡¥
-
-find_library(lib, func, path...)
-
- ´Ø¿ôfunc¤òÄêµÁ¤·¤Æ¤¤¤ë¥é¥¤¥Ö¥é¥êlib¤Î¸ºß¤ò -Lpath ¤òÄɲÃ
- ¤·¤Ê¤¬¤é¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥é¥¤¥Ö¥é¥ê¤¬¸«ÉÕ¤«¤Ã¤¿»þ¡¤true¤òÊÖ¤¹¡¥
-
-have_func(func, header)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ´Ø¿ôfunc¤Î¸ºß¤ò¥Á¥§
- ¥Ã¥¯¤¹¤ë¡¥func¤¬É¸½à¤Ç¤Ï¥ê¥ó¥¯¤µ¤ì¤Ê¤¤¥é¥¤¥Ö¥é¥êÆâ¤Î¤â¤Î¤Ç
- ¤¢¤ë»þ¤Ë¤ÏÀè¤Ëhave_library¤Ç¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤ª
- ¤¯»ö¡¥´Ø¿ô¤¬Â¸ºß¤¹¤ë»þtrue¤òÊÖ¤¹¡¥
-
-have_var(var, header)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤ÆÊÑ¿ôvar¤Î¸ºß¤ò¥Á¥§¥Ã
- ¥¯¤¹¤ë¡¥var¤¬É¸½à¤Ç¤Ï¥ê¥ó¥¯¤µ¤ì¤Ê¤¤¥é¥¤¥Ö¥é¥êÆâ¤Î¤â¤Î¤Ç¤¢
- ¤ë»þ¤Ë¤ÏÀè¤Ëhave_library¤Ç¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤ª¤¯
- »ö¡¥ÊÑ¿ô¤¬Â¸ºß¤¹¤ë»þtrue¤òÊÖ¤¹¡¥
-
-have_header(header)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹
- ¤ë»þtrue¤òÊÖ¤¹¡¥
-
-find_header(header, path...)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤Î¸ºß¤ò -Ipath ¤òÄɲ䷤ʤ¬¤é¥Á¥§¥Ã¥¯
- ¤¹¤ë¡¥¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤¬¸«ÉÕ¤«¤Ã¤¿»þ¡¤true¤òÊÖ¤¹¡¥
-
-have_struct_member(type, member, header)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ·¿type¤Ë¥á¥ó¥Ðmember
- ¤¬Â¸ºß¤¹¤ë¤«¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥type¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤Æ¡¤member¤ò
- »ý¤Ä¤¹¤ë»þtrue¤òÊÖ¤¹¡¥
-
-have_type(type, header, opt)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ·¿type¤¬Â¸ºß¤¹¤ë¤«¤ò
- ¥Á¥§¥Ã¥¯¤¹¤ë¡¥type¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤ë»þtrue¤òÊÖ¤¹¡¥
-
-check_sizeof(type, header)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ·¿type¤Îcharñ°Ì¥µ¥¤
- ¥º¤òÄ´¤Ù¤ë¡¥type¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤ë»þ¤½¤Î¥µ¥¤¥º¤òÊÖ¤¹¡¥ÄêµÁ¤µ
- ¤ì¤Æ¤¤¤Ê¤¤¤È¤­¤Ïnil¤òÊÖ¤¹¡¥
-
-create_makefile(target)
-
- ³ÈÄ¥¥é¥¤¥Ö¥é¥êÍѤÎMakefile¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤ò¸Æ¤Ð¤Ê¤±¤ì
- ¤Ð¤½¤Î¥é¥¤¥Ö¥é¥ê¤Ï¥³¥ó¥Ñ¥¤¥ë¤µ¤ì¤Ê¤¤¡¥target¤Ï¥â¥¸¥å¡¼¥ë̾
- ¤òɽ¤¹¡¥
-
-find_executable(command, path)
-
- ¥³¥Þ¥ó¥Écommand¤òFile::PATH_SEPARATOR¤Ç¶èÀÚ¤é¤ì¤¿¥Ñ¥¹Ì¾¤Î
- ¥ê¥¹¥Èpath¤«¤éõ¤¹¡¥path¤¬nil¤Þ¤¿¤Ï¾Êά¤µ¤ì¤¿¾ì¹ç¤Ï¡¤´Ä¶­
- ÊÑ¿ôPATH¤ÎÃͤò»ÈÍѤ¹¤ë¡¥¼Â¹Ô²Äǽ¤Ê¥³¥Þ¥ó¥É¤¬¸«¤Ä¤«¤Ã¤¿¾ì¹ç
- ¤Ï¥Ñ¥¹¤ò´Þ¤à¥Õ¥¡¥¤¥ë̾¡¤¸«¤Ä¤«¤é¤Ê¤«¤Ã¤¿¾ì¹ç¤Ïnil¤òÊÖ¤¹¡¥
-
-with_config(withval[, default=nil])
-
- ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--with-<withval>¤Ç»ØÄꤵ¤ì¤¿¥ª¥×¥·¥ç¥óÃÍ
- ¤òÆÀ¤ë¡¥
-
-enable_config(config, *defaults)
-disable_config(config, *defaults)
-
- ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--enable-<config>¤Þ¤¿¤Ï
- --disable-<config>¤Ç»ØÄꤵ¤ì¤¿¿¿µ¶ÃͤòÆÀ¤ë¡¥
- --enable-<config>¤¬»ØÄꤵ¤ì¤Æ¤¤¤¿¾ì¹ç¤Ïtrue¡¤
- --disable-<config>¤¬»ØÄꤵ¤ì¤Æ¤¤¤¿¾ì¹ç¤Ïfalse¤òÊÖ¤¹¡¥
- ¤É¤Á¤é¤â»ØÄꤵ¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤Ï¡¤¥Ö¥í¥Ã¥¯¤Ä¤­¤Ç¸Æ¤Ó½Ð¤µ¤ì¤Æ
- ¤¤¤ë¾ì¹ç¤Ï*defaults¤òyield¤·¤¿·ë²Ì¡¤¥Ö¥í¥Ã¥¯¤Ê¤·¤Ê¤é
- *defaults¤òÊÖ¤¹¡¥
-
-dir_config(target[, default_dir])
-dir_config(target[, default_include, default_lib])
-
- ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--with-<target>-dir, --with-<target>-include,
- --with-<target>-lib¤Î¤¤¤º¤ì¤«¤Ç»ØÄꤵ¤ì¤ë¥Ç¥£¥ì¥¯¥È¥ê¤ò
- $CFLAGS ¤ä $LDFLAGS ¤ËÄɲ乤롥--with-<target>-dir=/path¤Ï
- --with-<target>-include=/path/include --with-<target>-lib=/path/lib
- ¤ÈÅù²Á¤Ç¤¢¤ë¡¥Äɲ䵤줿 include ¥Ç¥£¥ì¥¯¥È¥ê¤È lib ¥Ç¥£¥ì
- ¥¯¥È¥ê¤ÎÇÛÎó¤òÊÖ¤¹¡¥ ([include_dir, lib_dir])
-
-pkg_config(pkg)
-
- pkg-config¥³¥Þ¥ó¥É¤«¤é¥Ñ¥Ã¥±¡¼¥¸pkg¤Î¾ðÊó¤òÆÀ¤ë¡¥
- pkg-config¤Î¼ÂºÝ¤Î¥³¥Þ¥ó¥É̾¤Ï¡¤--with-pkg-config¥³¥Þ¥ó¥É
- ¥é¥¤¥ó¥ª¥×¥·¥ç¥ó¤Ç»ØÄê²Äǽ¡¥
-
-/*
- * Local variables:
- * fill-column: 60
- * end:
- */
+doc/extension.ja.rdocã«ç§»å‹•ã—ã¾ã—ãŸ
diff --git a/README.ja b/README.ja
deleted file mode 100644
index dd7f67ca59..0000000000
--- a/README.ja
+++ /dev/null
@@ -1,185 +0,0 @@
-* Ruby¤È¤Ï
-
-Ruby¤Ï¥·¥ó¥×¥ë¤«¤Ä¶¯ÎϤʥª¥Ö¥¸¥§¥¯¥È»Ø¸þ¥¹¥¯¥ê¥×¥È¸À¸ì¤Ç¤¹¡¥
-Ruby¤ÏºÇ½é¤«¤é½ã¿è¤Ê¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þ¸À¸ì¤È¤·¤ÆÀ߷פµ¤ì¤Æ¤¤¤Þ
-¤¹¤«¤é¡¤¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þ¥×¥í¥°¥é¥ß¥ó¥°¤ò¼ê·Ú¤Ë¹Ô¤¦»ö¤¬½ÐÍè¤Þ
-¤¹¡¥¤â¤Á¤í¤óÄ̾ï¤Î¼ê³¤­·¿¤Î¥×¥í¥°¥é¥ß¥ó¥°¤â²Äǽ¤Ç¤¹¡¥
-
-Ruby¤Ï¥Æ¥­¥¹¥È½èÍý´Ø·¸¤ÎǽÎϤʤɤËÍ¥¤ì¡¤Perl¤ÈƱ¤¸¤¯¤é¤¤¶¯ÎÏ
-¤Ç¤¹¡¥¤µ¤é¤Ë¥·¥ó¥×¥ë¤Êʸˡ¤È¡¤Îã³°½èÍý¤ä¥¤¥Æ¥ì¡¼¥¿¤Ê¤É¤Îµ¡¹½
-¤Ë¤è¤Ã¤Æ¡¤¤è¤êʬ¤«¤ê¤ä¤¹¤¤¥×¥í¥°¥é¥ß¥ó¥°¤¬½ÐÍè¤Þ¤¹¡¥
-
-
-* Ruby¤ÎÆÃĹ
-
- + ¥·¥ó¥×¥ë¤Êʸˡ
- + ÉáÄ̤Υª¥Ö¥¸¥§¥¯¥È»Ø¸þµ¡Ç½(¥¯¥é¥¹¡¤¥á¥½¥Ã¥É¥³¡¼¥ë¤Ê¤É)
- + ÆÃ¼ì¤Ê¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þµ¡Ç½(Mixin, ÆÃ°Û¥á¥½¥Ã¥É¤Ê¤É)
- + ±é»»»Ò¥ª¡¼¥Ð¡¼¥í¡¼¥É
- + Îã³°½èÍýµ¡Ç½
- + ¥¤¥Æ¥ì¡¼¥¿¤È¥¯¥í¡¼¥¸¥ã
- + ¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿
- + ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥° (¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤è¤ë)
- + °Ü¿¢À­¤¬¹â¤¤¡¥Â¿¤¯¤ÎUnix-like/POSIX¸ß´¹¥×¥é¥Ã¥È¥Õ¥©¡¼¥à¾å¤Ç
- ư¤¯¤À¤±¤Ç¤Ê¤¯¡¤Windows¡¤ Mac OS X¡¤BeOS¤Ê¤É¤Î¾å¤Ç¤âư¤¯
- cf. http://redmine.ruby-lang.org/wiki/ruby-19/SupportedPlatformsJa
-
-* Æþ¼êË¡
-
-** FTP¤Ç
-
-°Ê²¼¤Î¾ì½ê¤Ë¤ª¤¤¤Æ¤¢¤ê¤Þ¤¹¡¥
-
- ftp://ftp.ruby-lang.org/pub/ruby/
-
-** Subversion¤Ç
-
-³«È¯Àèü¤Î¥½¡¼¥¹¥³¡¼¥É¤Ï¼¡¤Î¥³¥Þ¥ó¥É¤Ç¼èÆÀ¤Ç¤­¤Þ¤¹¡¥
-
- $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
-
-¾¤Ë³«È¯Ãæ¤Î¥Ö¥é¥ó¥Á¤Î°ìÍ÷¤Ï¼¡¤Î¥³¥Þ¥ó¥É¤Ç¸«¤é¤ì¤Þ¤¹¡¥
-
- $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
-
-
-* ¥Û¡¼¥à¥Ú¡¼¥¸
-
-Ruby¤Î¥Û¡¼¥à¥Ú¡¼¥¸¤ÎURL¤Ï
-
- http://www.ruby-lang.org/
-
-¤Ç¤¹¡¥
-
-
-* ¥á¡¼¥ê¥ó¥°¥ê¥¹¥È
-
-Ruby¤Î¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤¬¤¢¤ê¤Þ¤¹¡£»²²Ã´õ˾¤ÎÊý¤Ï
-
- ruby-list-ctl@ruby-lang.org
-
-¤Þ¤ÇËÜʸ¤Ë
-
- subscribe YourFirstName YourFamilyName
-
-¤È½ñ¤¤¤ÆÁ÷¤Ã¤Æ²¼¤µ¤¤¡£
-
-Ruby³«È¯¼Ô¸þ¤±¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤â¤¢¤ê¤Þ¤¹¡£¤³¤Á¤é¤Ç¤Ïruby¤Î¥Ð
-¥°¡¢¾­Íè¤Î»ÅÍͳÈÄ¥¤Ê¤É¼ÂÁõ¾å¤ÎÌäÂê¤Ë¤Ä¤¤¤ÆµÄÏÀ¤µ¤ì¤Æ¤¤¤Þ¤¹¡£
-»²²Ã´õ˾¤ÎÊý¤Ï
-
- ruby-dev-ctl@ruby-lang.org
-
-¤Þ¤Çruby-list¤ÈƱÍͤÎÊýË¡¤Ç¥á¡¼¥ë¤·¤Æ¤¯¤À¤µ¤¤¡£
-
-Ruby³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë¤Ä¤¤¤ÆÏ䷹礦ruby-ext¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤È
-¿ô³Ø´Ø·¸¤ÎÏÃÂê¤Ë¤Ä¤¤¤ÆÏ䷹礦ruby-math¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤È
-±Ñ¸ì¤ÇÏ䷹礦ruby-talk¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤â¤¢¤ê¤Þ¤¹¡£»²²ÃÊýË¡
-¤Ï¤É¤ì¤âƱ¤¸¤Ç¤¹¡£
-
-
-* ¥³¥ó¥Ñ¥¤¥ë¡¦¥¤¥ó¥¹¥È¡¼¥ë
-
-°Ê²¼¤Î¼ê½ç¤Ç¹Ô¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
- 1. ¤â¤·configure¥Õ¥¡¥¤¥ë¤¬¸«¤Ä¤«¤é¤Ê¤¤¡¢¤â¤·¤¯¤Ï
- configure.in¤è¤ê¸Å¤¤¤è¤¦¤Ê¤é¡¢autoconf¤ò¼Â¹Ô¤·¤Æ
- ¿·¤·¤¯configure¤òÀ¸À®¤¹¤ë
-
- 2. configure¤ò¼Â¹Ô¤·¤ÆMakefile¤Ê¤É¤òÀ¸À®¤¹¤ë
-
- ´Ä¶­¤Ë¤è¤Ã¤Æ¤Ï¥Ç¥Õ¥©¥ë¥È¤ÎC¥³¥ó¥Ñ¥¤¥éÍÑ¥ª¥×¥·¥ç¥ó¤¬ÉÕ¤­
- ¤Þ¤¹¡¥configure¥ª¥×¥·¥ç¥ó¤Ç optflags=.. warnflags=.. Åù
- ¤Ç¾å½ñ¤­¤Ç¤­¤Þ¤¹¡¥
-
- 3. (ɬÍפʤé¤Ð)defines.h¤òÊÔ½¸¤¹¤ë
-
- ¿ʬ¡¤É¬Í×̵¤¤¤È»×¤¤¤Þ¤¹¡¥
-
- 4. (ɬÍפʤé¤Ð)ext/Setup¤ËÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë³ÈÄ¥¥â¥¸¥å¡¼¥ë¤ò
- »ØÄꤹ¤ë
-
- ext/Setup¤Ëµ­½Ò¤·¤¿¥â¥¸¥å¡¼¥ë¤ÏÀÅŪ¤Ë¥ê¥ó¥¯¤µ¤ì¤Þ¤¹¡¥
-
- ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥°¤ò¥µ¥Ý¡¼¥È¤·¤Æ¤¤¤Ê¤¤¥¢¡¼¥­¥Æ¥¯
- ¥Á¥ã¤Ç¤ÏSetup¤Î1¹ÔÌܤΡÖoption nodynamic¡×¤È¤¤¤¦¹Ô¤Î¥³
- ¥á¥ó¥È¤ò³°¤¹É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥¤Þ¤¿¡¤¤³¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ç
- ³ÈÄ¥¥â¥¸¥å¡¼¥ë¤òÍøÍѤ¹¤ë¤¿¤á¤Ë¤Ï¡¤¤¢¤é¤«¤¸¤áÀÅŪ¤Ë¥ê¥ó
- ¥¯¤·¤Æ¤ª¤¯É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
-
- 5. make¤ò¼Â¹Ô¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¤¹¤ë
-
- 6. make test¤Ç¥Æ¥¹¥È¤ò¹Ô¤¦¡¥
-
- ¡Ötest succeeded¡×¤Èɽ¼¨¤µ¤ì¤ì¤ÐÀ®¸ù¤Ç¤¹¡¥¤¿¤À¤·¥Æ¥¹¥È
- ¤ËÀ®¸ù¤·¤Æ¤â´°àú¤À¤ÈÊݾڤµ¤ì¤Æ¤¤¤ëÌõ¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥
-
- 7. make install
-
- °Ê²¼¤Î¥Ç¥£¥ì¥¯¥È¥ê¤òºî¤Ã¤Æ¡¤¤½¤³¤Ë¥Õ¥¡¥¤¥ë¤ò¥¤¥ó¥¹¥È¡¼
- ¥ë¤·¤Þ¤¹¡¥
-
- * ${DESTDIR}${prefix}/bin
- * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib
- * ${DESTDIR}${prefix}/lib/ruby
- * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib/ruby/site_ruby
- * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby
- * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/share/man/man1
- * ${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system
-
- Ruby¤ÎAPI¥Ð¡¼¥¸¥ç¥ó¤¬`x.y.z'¤Ç¤¢¤ì¤Ð¡¤((|${MAJOR}|))¤Ï
- `x'¤Ç¡¤((|${MINOR}|))¤Ï`y'¡¤((|${TEENY}|))¤Ï`z'¤Ç¤¹¡¥
-
- Ãí°Õ: API¥Ð¡¼¥¸¥ç¥ó¤Îteeny¤Ï¡¤Ruby¥×¥í¥°¥é¥à¤Î¥Ð¡¼¥¸¥ç
- ¥ó¤È¤Ï°Û¤Ê¤ë¤³¤È¤¬¤¢¤ê¤Þ¤¹¡¥
-
- root¤Çºî¶È¤¹¤ëɬÍפ¬¤¢¤ë¤«¤â¤·¤ì¤Þ¤»¤ó¡¥
-
-¤â¤·¡¤¥³¥ó¥Ñ¥¤¥ë»þ¤Ë¥¨¥é¡¼¤¬È¯À¸¤·¤¿¾ì¹ç¤Ë¤Ï¥¨¥é¡¼¤Î¥í¥°¤È¥Þ
-¥·¥ó¡¤OS¤Î¼ïÎà¤ò´Þ¤à¤Ç¤­¤ë¤À¤±¾Ü¤·¤¤¥ì¥Ý¡¼¥È¤òºî¼Ô¤ËÁ÷¤Ã¤Æ¤¯
-¤À¤µ¤ë¤È¾¤ÎÊý¤Î¤¿¤á¤Ë¤â¤Ê¤ê¤Þ¤¹¡¥
-
-
-* °Ü¿¢
-
-UNIX¤Ç¤¢¤ì¤Ðconfigure¤¬¤Û¤È¤ó¤É¤Îº¹°Û¤òµÛ¼ý¤·¤Æ¤¯¤ì¤ë¤Ï¤º¤Ç
-¤¹¤¬¡¤»×¤ï¤Ì¸«Íî¤È¤·¤¬¤¢¤Ã¤¿¾ì¹ç(¤¢¤ë¤Ë°ã¤¤¤Ê¤¤)¡¤ºî¼Ô¤Ë¤½¤Î
-¤³¤È¤ò¥ì¥Ý¡¼¥È¤¹¤ì¤Ð¡¤²ò·è¤Ç¤­¤ë¤«¤âÃΤì¤Þ¤»¤ó¡¥
-
-¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤â¤Ã¤È¤â°Í¸¤¹¤ë¤Î¤ÏGCÉô¤Ç¤¹¡¥Ruby¤ÎGC¤ÏÂоÝ
-¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤¬setjmp()¤Þ¤¿¤Ïgetcontext()¤Ë¤è¤Ã¤ÆÁ´¤Æ¤Î¥ì
-¥¸¥¹¥¿¤òjmp_buf¤äucontext_t¤Ë³ÊǼ¤¹¤ë¤³¤È¤È¡¤jmp_buf¤ä
-ucontext_t¤È¥¹¥¿¥Ã¥¯¤¬32bit¥¢¥é¥¤¥ó¥á¥ó¥È¤µ¤ì¤Æ¤¤¤ë¤³¤È¤ò²¾Äê
-¤·¤Æ¤¤¤Þ¤¹¡¥ÆÃ¤ËÁ°¼Ô¤¬À®Î©¤·¤Ê¤¤¾ì¹ç¤ÎÂбþ¤ÏÈó¾ï¤Ëº¤Æñ¤Ç¤·¤ç
-¤¦¡¥¸å¼Ô¤Î²ò·è¤ÏÈæ³ÓŪ´Êñ¤Ç¡¤gc.c¤Ç¥¹¥¿¥Ã¥¯¤ò¥Þ¡¼¥¯¤·¤Æ¤¤¤ë
-Éôʬ¤Ë¥¢¥é¥¤¥ó¥á¥ó¥È¤Î¥Ð¥¤¥È¿ô¤À¤±¤º¤é¤·¤Æ¥Þ¡¼¥¯¤¹¤ë¥³¡¼¥É¤ò
-Äɲ乤ë¤À¤±¤ÇºÑ¤ß¤Þ¤¹¡¥¡Ödefined(__mc68000__)¡×¤Ç³ç¤é¤ì¤Æ¤¤
-¤ëÉôʬ¤ò»²¹Í¤Ë¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò»ý¤ÄCPU¤Ç¤Ï¡¤¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò¥¹¥¿¥Ã
-¥¯¤Ë¥Õ¥é¥Ã¥·¥å¤¹¤ë¥¢¥»¥ó¥Ö¥é¥³¡¼¥É¤òÄɲ乤ëɬÍפ¬¤¢¤ë¤«¤âÃÎ
-¤ì¤Þ¤»¤ó¡¥
-
-
-* ÇÛÉÛ¾ò·ï
-
-COPYING.ja¥Õ¥¡¥¤¥ë¤ò»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡£
-
-
-* Ãø¼Ô
-
-¥³¥á¥ó¥È¡¤¥Ð¥°¥ì¥Ý¡¼¥È¤½¤Î¾¤Ï matz@netlab.jp ¤Þ¤Ç¡¥
--------------------------------------------------------
-created at: Thu Aug 3 11:57:36 JST 1995
-Local variables:
-mode: indented-text
-end:
diff --git a/README.ja.md b/README.ja.md
new file mode 100644
index 0000000000..93c0131690
--- /dev/null
+++ b/README.ja.md
@@ -0,0 +1,182 @@
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: MJIT](https://github.com/ruby/ruby/workflows/MJIT/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MJIT")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![AppVeyor status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
+
+# Rubyã¨ã¯
+
+Rubyã¯ã‚·ãƒ³ãƒ—ルã‹ã¤å¼·åŠ›ãªã‚ªãƒ–ジェクト指å‘スクリプト言語ã§ã™ï¼Ž Rubyã¯ç´”粋ãªã‚ªãƒ–ジェクト指å‘言語ã¨ã—ã¦è¨­è¨ˆã•れã¦ã„ã‚‹ã®ã§ï¼Œ
+オブジェクト指å‘プログラミングを手軽ã«è¡Œã†äº‹ãŒå‡ºæ¥ã¾ã™ï¼Žã‚‚ã¡ã‚ã‚“æ™®é€šã®æ‰‹ç¶šãåž‹ã®ãƒ—ログラミングもå¯èƒ½ã§ã™ï¼Ž
+
+Rubyã¯ãƒ†ã‚­ã‚¹ãƒˆå‡¦ç†é–¢ä¿‚ã®èƒ½åŠ›ãªã©ã«å„ªã‚Œï¼ŒPerlã¨åŒã˜ãらã„強力ã§ã™ï¼Žã•らã«ã‚·ãƒ³ãƒ—ãƒ«ãªæ–‡æ³•ã¨ï¼Œ
+例外処ç†ã‚„イテレータãªã©ã®æ©Ÿæ§‹ã«ã‚ˆã£ã¦ï¼Œã‚ˆã‚Šåˆ†ã‹ã‚Šã‚„ã™ã„プログラミングãŒå‡ºæ¥ã¾ã™ï¼Ž
+
+## Rubyã®ç‰¹é•·
+
+* ã‚·ãƒ³ãƒ—ãƒ«ãªæ–‡æ³•
+* 普通ã®ã‚ªãƒ–ã‚¸ã‚§ã‚¯ãƒˆæŒ‡å‘æ©Ÿèƒ½(クラス,メソッドコールãªã©)
+* 特殊ãªã‚ªãƒ–ã‚¸ã‚§ã‚¯ãƒˆæŒ‡å‘æ©Ÿèƒ½(Mixin,特異メソッドãªã©)
+* 演算å­ã‚ªãƒ¼ãƒãƒ¼ãƒ­ãƒ¼ãƒ‰
+* ä¾‹å¤–å‡¦ç†æ©Ÿèƒ½
+* イテレータã¨ã‚¯ãƒ­ãƒ¼ã‚¸ãƒ£
+* ガーベージコレクタ
+* ダイナミックローディング (アーキテクãƒãƒ£ã«ã‚ˆã‚‹)
+* ç§»æ¤æ€§ãŒé«˜ã„.多ãã®Unix-like/POSIX互æ›ãƒ—ラットフォーム上ã§å‹•ãã ã‘ã§ãªã,Windows, macOS,
+ Haikuãªã©ã®ä¸Šã§ã‚‚å‹•ã cf.
+ https://github.com/ruby/ruby/blob/master/doc/contributing.rdoc#platform-maintainers
+
+
+## 入手法
+
+サードパーティーツールを使ã£ãŸæ–¹æ³•ã‚’å«ã‚€Rubyã®ã‚¤ãƒ³ã‚¹ãƒˆãƒ¼ãƒ«æ–¹æ³•ã®ä¸€è¦§ã¯
+
+https://www.ruby-lang.org/ja/downloads/
+
+ã‚’å‚ç…§ã—ã¦ãã ã•ã„.
+
+### Git
+
+ミラーをGitHubã«å…¬é–‹ã—ã¦ã„ã¾ã™ï¼Ž 以下ã®ã‚³ãƒžãƒ³ãƒ‰ã§ãƒªãƒã‚¸ãƒˆãƒªã‚’å–å¾—ã§ãã¾ã™ï¼Ž
+
+ $ git clone https://github.com/ruby/ruby.git
+
+ä»–ã®ãƒ–ランãƒã®ä¸€è¦§ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§è¦‹ã‚‰ã‚Œã¾ã™ï¼Ž
+
+ $ git ls-remote https://github.com/ruby/ruby.git
+
+Rubyリãƒã‚¸ãƒˆãƒªã®æœ¬æ¥ã®master㯠https://git.ruby-lang.org/ruby.git ã«ã‚りã¾ã™ï¼Ž
+コミッタã¯ã“ã¡ã‚‰ã‚’使ã„ã¾ã™ï¼Ž
+
+### Subversion
+
+å¤ã„Rubyã®ãƒãƒ¼ã‚¸ãƒ§ãƒ³ã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§ã‚‚å–å¾—ã§ãã¾ã™ï¼Ž
+
+ $ svn co https://svn.ruby-lang.org/repos/ruby/branches/ruby_2_6/ ruby
+
+ä»–ã®ãƒ–ランãƒã®ä¸€è¦§ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§è¦‹ã‚‰ã‚Œã¾ã™ï¼Ž
+
+ $ svn ls https://svn.ruby-lang.org/repos/ruby/branches/
+
+
+## ホームページ
+
+Rubyã®ãƒ›ãƒ¼ãƒ ãƒšãƒ¼ã‚¸ã®URLã¯
+
+https://www.ruby-lang.org/
+
+ã§ã™ï¼Ž
+
+## メーリングリスト
+
+Rubyã®ãƒ¡ãƒ¼ãƒªãƒ³ã‚°ãƒªã‚¹ãƒˆãŒã‚りã¾ã™ï¼Žå‚åŠ å¸Œæœ›ã®æ–¹ã¯ [ruby-list-request@ruby-lang.org] ã¾ã§æœ¬æ–‡ã«
+
+ subscribe
+
+ã¨æ›¸ã„ã¦é€ã£ã¦ä¸‹ã•ã„.
+
+Ruby開発者å‘ã‘メーリングリストもã‚りã¾ã™ï¼Žã“ã¡ã‚‰ã§ã¯rubyã®ãƒã‚°ï¼Œå°†æ¥ã®ä»•様拡張ãªã©å®Ÿè£…上ã®å•題ã«ã¤ã„ã¦è­°è«–ã•れã¦ã„ã¾ã™ï¼Ž
+å‚åŠ å¸Œæœ›ã®æ–¹ã¯ [ruby-dev-request@ruby-lang.org] ã¾ã§ruby-listã¨åŒæ§˜ã®æ–¹æ³•ã§ãƒ¡ãƒ¼ãƒ«ã—ã¦ãã ã•ã„.
+
+Ruby拡張モジュールã«ã¤ã„ã¦è©±ã—åˆã†ruby-extãƒ¡ãƒ¼ãƒªãƒ³ã‚°ãƒªã‚¹ãƒˆã¨æ•°å­¦é–¢ä¿‚ã®è©±é¡Œã«ã¤ã„ã¦è©±ã—åˆã†ruby-mathメーリングリストã¨
+英語ã§rubyã«ã¤ã„ã¦è©±ã—åˆã†ruby-talkメーリングリストもã‚りã¾ã™ï¼Žå‚加方法ã¯ã©ã‚Œã‚‚åŒã˜ã§ã™ï¼Ž
+
+[ruby-list-request@ruby-lang.org]: mailto:ruby-list-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe
+[ruby-dev-request@ruby-lang.org]: mailto:ruby-dev-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe
+
+## コンパイル・インストール
+
+ä»¥ä¸‹ã®æ‰‹é †ã§è¡Œã£ã¦ãã ã•ã„.
+
+1. (Gitリãƒã‚¸ãƒˆãƒªã‹ã‚‰å–å¾—ã—ãŸã‚½ãƒ¼ã‚¹ã‚’ビルドã™ã‚‹å ´åˆ) `./autogen.sh` を実行ã—ã¦æ–°ã—ã `configure` を生æˆã™ã‚‹
+
+2. `configure` を実行ã—㦠`Makefile` ãªã©ã‚’生æˆã™ã‚‹
+
+ 環境ã«ã‚ˆã£ã¦ã¯ãƒ‡ãƒ•ォルトã®Cコンパイラ用オプションãŒä»˜ãã¾ã™ï¼Ž `configure` オプション㧠`optflags=..`
+ `warnflags=..` ç­‰ã§ä¸Šæ›¸ãã§ãã¾ã™ï¼Ž
+
+3. (å¿…è¦ãªã‚‰ã°)`include/ruby/defines.h` を編集ã™ã‚‹
+
+ 多分,必è¦ç„¡ã„ã¨æ€ã„ã¾ã™ï¼Ž
+
+4. (å¿…è¦ãªã‚‰ã°)`ext/Setup` ã«é™çš„ã«ãƒªãƒ³ã‚¯ã™ã‚‹æ‹¡å¼µãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã‚’指定ã™ã‚‹
+
+ `ext/Setup` ã«è¨˜è¿°ã—ãŸãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã¯é™çš„ã«ãƒªãƒ³ã‚¯ã•れã¾ã™ï¼Ž
+
+ ダイナミックローディングをサãƒãƒ¼ãƒˆã—ã¦ã„ãªã„アーキテクãƒãƒ£ã§ã¯ `Setup` ã®1行目ã®ã€Œ`option nodynamic`ã€ã¨ã„ã†è¡Œã®ã‚³
+ メントを外ã™å¿…è¦ãŒã‚りã¾ã™ï¼Ž
+ ã¾ãŸï¼Œã“ã®ã‚¢ãƒ¼ã‚­ãƒ†ã‚¯ãƒãƒ£ã§æ‹¡å¼µãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã‚’利用ã™ã‚‹ãŸã‚ã«ã¯ï¼Œã‚らã‹ã˜ã‚é™çš„ã«ãƒªãƒ³ã‚¯ã‚’ã—ã¦ãŠãå¿…è¦ãŒã‚りã¾ã™ï¼Ž
+
+5. `make` を実行ã—ã¦ã‚³ãƒ³ãƒ‘イルã™ã‚‹
+
+6. `make check`ã§ãƒ†ã‚¹ãƒˆã‚’行ã†ï¼Ž
+
+ 「`check succeeded`ã€ã¨è¡¨ç¤ºã•ã‚Œã‚Œã°æˆåŠŸã§ã™ï¼ŽãŸã ã—ãƒ†ã‚¹ãƒˆã«æˆåŠŸã—ã¦ã‚‚完璧ã ã¨ä¿è¨¼ã•れã¦ã„る訳ã§ã¯ã‚りã¾ã›ã‚“.
+
+7. `make install`
+
+ 以下ã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã‚’作ã£ã¦ï¼Œãã“ã«ãƒ•ァイルをインストー ルã—ã¾ã™ï¼Ž
+
+ * `${DESTDIR}${prefix}/bin`
+ * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib`
+ * `${DESTDIR}${prefix}/lib/ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/share/man/man1`
+ * `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
+
+
+ Rubyã®APIãƒãƒ¼ã‚¸ãƒ§ãƒ³ãŒ'*x.y.z*'ã§ã‚れã°ï¼Œ`${MAJOR}`ã¯
+ '*x*'ã§ï¼Œ`${MINOR}`ã¯'*y*',`${TEENY}`ã¯'*z*'ã§ã™ï¼Ž
+
+ **注æ„**: APIãƒãƒ¼ã‚¸ãƒ§ãƒ³ã® `teeny` ã¯ï¼ŒRubyプログラムã®ãƒãƒ¼ã‚¸ãƒ§ãƒ³ã¨ã¯ç•°ãªã‚‹ã“ã¨ãŒã‚りã¾ã™ï¼Ž
+
+ `root` ã§ä½œæ¥­ã™ã‚‹å¿…è¦ãŒã‚ã‚‹ã‹ã‚‚ã—れã¾ã›ã‚“.
+
+
+ã‚‚ã—,コンパイル時ã«ã‚¨ãƒ©ãƒ¼ãŒç™ºç”Ÿã—ãŸå ´åˆã«ã¯ã‚¨ãƒ©ãƒ¼ã®ãƒ­ã‚°ã¨ãƒžã‚·ãƒ³ï¼ŒOSã®ç¨®é¡žã‚’å«ã‚€ã§ãã‚‹ã ã‘詳ã—ã„レãƒãƒ¼ãƒˆã‚’作者ã«é€ã£ã¦ä¸‹ã•ã‚‹ã¨ä»–ã®æ–¹ã®ãŸã‚ã«ã‚‚ãªã‚Šã¾ã™ï¼Ž
+
+## ç§»æ¤
+
+UNIXã§ã‚れ㰠`configure` ãŒã»ã¨ã‚“ã©ã®å·®ç•°ã‚’å¸åŽã—ã¦ãれるã¯ãšã§ã™ãŒï¼Œæ€ã‚ã¬è¦‹è½ã¨ã—ãŒã‚ã£ãŸå ´åˆ(ã‚る事ãŒå¤šã„),作者ã«ãã®
+ã“ã¨ã‚’報告ã™ã‚Œã°ï¼Œè§£æ±ºã§ãã‚‹å¯èƒ½æ€§ãŒã‚りã¾ã™ï¼Ž
+
+アーキテクãƒãƒ£ã«ã‚‚ã£ã¨ã‚‚ä¾å­˜ã™ã‚‹ã®ã¯GC部ã§ã™ï¼ŽRubyã®GCã¯å¯¾è±¡
+ã®ã‚¢ãƒ¼ã‚­ãƒ†ã‚¯ãƒãƒ£ãŒ`setjmp()`ã¾ãŸã¯`getcontext()`ã«ã‚ˆã£ã¦å…¨ã¦ã®ãƒ¬ã‚¸ã‚¹ã‚¿ã‚’ `jmp_buf` ã‚„ `ucontext_t`
+ã«æ ¼ç´ã™ã‚‹ã“ã¨ã¨ï¼Œ `jmp_buf` ã‚„ `ucontext_t` ã¨ã‚¹ã‚¿ãƒƒã‚¯ãŒ32bitアラインメントã•れã¦ã„ã‚‹ã“ã¨ã‚’仮定
+ã—ã¦ã„ã¾ã™ï¼Žç‰¹ã«å‰è€…ãŒæˆç«‹ã—ãªã„å ´åˆã®å¯¾å¿œã¯éžå¸¸ã«å›°é›£ã§ã—ょã†ï¼Ž 後者ã®è§£æ±ºã¯æ¯”較的簡å˜ã§ï¼Œ `gc.c` ã§ã‚¹ã‚¿ãƒƒã‚¯ã‚’マークã—ã¦ã„ã‚‹
+部分ã«ã‚¢ãƒ©ã‚¤ãƒ³ãƒ¡ãƒ³ãƒˆã®ãƒã‚¤ãƒˆæ•°ã ã‘ãšã‚‰ã—ã¦ãƒžãƒ¼ã‚¯ã™ã‚‹ã‚³ãƒ¼ãƒ‰ã‚’追加ã™ã‚‹ã ã‘ã§æ¸ˆã¿ã¾ã™ï¼Ž`defined(__mc68000__)`ã§æ‹¬ã‚‰ã‚Œã¦ã„
+る部分をå‚考ã«ã—ã¦ãã ã•ã„.
+
+レジスタウィンドウをæŒã¤CPUã§ã¯ï¼Œãƒ¬ã‚¸ã‚¹ã‚¿ã‚¦ã‚£ãƒ³ãƒ‰ã‚¦ã‚’スタックã«ãƒ•ラッシュã™ã‚‹ã‚¢ã‚»ãƒ³ãƒ–ラコードを追加ã™ã‚‹å¿…è¦ãŒã‚ã‚‹ã‹ã‚‚ã—れã¾ã›ã‚“.
+
+## é…布æ¡ä»¶
+
+[COPYING.ja](COPYING.ja) ファイルをå‚ç…§ã—ã¦ãã ã•ã„.
+
+## フィードãƒãƒƒã‚¯
+
+Rubyã«é–¢ã™ã‚‹è³ªå•㯠[Ruby-Talk](英語)や [Ruby-List](日本語)や,
+[stackoverflow] ãªã©ã®Webã‚µã‚¤ãƒˆã«æŠ•ç¨¿ã—ã¦ãã ã•ã„.
+
+ãƒã‚°å ±å‘Šã¯ https://bugs.ruby-lang.org ã§å—ã‘付ã‘ã¦ã„ã¾ã™ï¼Ž
+
+[Ruby-Talk]: https://www.ruby-lang.org/en/community/mailing-lists
+[Ruby-List]: https://www.ruby-lang.org/ja/community/mailing-lists
+[stackoverflow]: https://ja.stackoverflow.com/
+
+## 著者
+
+Rubyã®ã‚ªãƒªã‚¸ãƒŠãƒ«ç‰ˆã¯ï¼Œ1995å¹´ã«ã¾ã¤ã‚‚ã¨ã‚†ãã²ã‚æ°ã«ã‚ˆã£ã¦è¨­è¨ˆãƒ»é–‹ç™ºã•れã¾ã—ãŸï¼Ž
+
+<mailto:matz@ruby-lang.org>
diff --git a/README.md b/README.md
new file mode 100644
index 0000000000..c445448c71
--- /dev/null
+++ b/README.md
@@ -0,0 +1,91 @@
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: MJIT](https://github.com/ruby/ruby/workflows/MJIT/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MJIT")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![AppVeyor status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
+
+# What is Ruby?
+
+Ruby is an interpreted object-oriented programming language often
+used for web development. It also offers many scripting features
+to process plain text and serialized files, or manage system tasks.
+It is simple, straightforward, and extensible.
+
+## Features of Ruby
+
+* Simple Syntax
+* **Normal** Object-oriented Features (e.g. class, method calls)
+* **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
+* Operator Overloading
+* Exception Handling
+* Iterators and Closures
+* Garbage Collection
+* Dynamic Loading of Object Files (on some architectures)
+* Highly Portable (works on many Unix-like/POSIX compatible platforms as
+ well as Windows, macOS, etc.) cf.
+ https://github.com/ruby/ruby/blob/master/doc/maintainers.rdoc#label-Platform+Maintainers
+
+## How to get Ruby with Git
+
+For a complete list of ways to install Ruby, including using third-party tools
+like rvm, see:
+
+https://www.ruby-lang.org/en/downloads/
+
+The mirror of the Ruby source tree can be checked out with the following command:
+
+ $ git clone https://github.com/ruby/ruby.git
+
+There are some other branches under development. Try the following command
+to see the list of branches:
+
+ $ git ls-remote https://github.com/ruby/ruby.git
+
+You may also want to use https://git.ruby-lang.org/ruby.git (actual master of Ruby source)
+if you are a committer.
+
+## How to build
+
+see [Building Ruby](doc/contributing/building_ruby.md)
+
+## Ruby home page
+
+https://www.ruby-lang.org/
+
+## Documentation
+
+- [English](https://docs.ruby-lang.org/en/master/index.html)
+- [Japanese](https://docs.ruby-lang.org/ja/master/index.html)
+
+## Mailing list
+
+There is a mailing list to discuss Ruby. To subscribe to this list, please
+send the following phrase:
+
+ subscribe
+
+in the mail body (not subject) to the address [ruby-talk-request@ruby-lang.org].
+
+[ruby-talk-request@ruby-lang.org]: mailto:ruby-talk-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe
+
+## Copying
+
+See the file [COPYING](rdoc-ref:COPYING).
+
+## Feedback
+
+Questions about the Ruby language can be asked on the [Ruby-Talk](https://www.ruby-lang.org/en/community/mailing-lists) mailing list
+or on websites like https://stackoverflow.com.
+
+Bugs should be reported at https://bugs.ruby-lang.org. Read ["Reporting Issues"](https://docs.ruby-lang.org/en/master/contributing/reporting_issues_md.html) for more information.
+
+## Contributing
+
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing_md.html), which includes setup and build instructions.
+
+## The Author
+
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in 1995.
+
+<matz@ruby-lang.org>
diff --git a/ToDo b/ToDo
deleted file mode 100644
index 7e5ef523a8..0000000000
--- a/ToDo
+++ /dev/null
@@ -1,124 +0,0 @@
-Language Spec.
-
-- Class#allocate - basicNew
-- class Foo::Bar<Baz .. end, module Boo::Bar .. end
-- raise exception by `` error
-- a +1 to be a+1, not a(+1).
-- clarify evaluation order of operator argument (=~, .., ...)
-- :symbol => value hash in the form of {symbol: value, ...} ??
-* operator !! for rescue. ???
-* objectify characters
-* ../... outside condition invokes operator method too.
-* ... inside condition turns off just before right condition.???
-* package or access control for global variables??
-* named arguments like foo(nation:="german") or foo(nation: "german").
-* method to retrieve argument information (needs new C API)
-* multiple return values, yield values. maybe incompatible ???
-* cascading method invocation ???
-* def Class#method .. end ??
-* def Foo::Bar::baz() .. end ??
-* I18N (or M17N) script/string/regexp
-* discourage use of symbol variables (e.g. $/, etc.) in manual
-* discourage use of Perlish features by giving warnings.
-* non confusing in-block local variable (is it possible?)
- + remove scope by block
- + variables appears within block may have independent values.
-* Regexp: make /o thread safe.
-* decide whether begin with rescue or ensure make do..while loop.
-* unify == and eql? again
-* to_i returns nil if str contains no digit.
-* jar like combined library package. -> RubyGems?
-* method combination, e.g. before, after, around, etc.
-* .. or something like defadvice in Emacs.
-* property - for methods, or for objects in general.
-* "in" modifier, to annotate, or to encourage assertion.
-* selector namespace - something like generic-flet in CLOS, to help RubyBehavior
-* private instance variable (as in Python?) @_foo in class Foo => @_Foo_foo
-* warn/error "bare word" method, like "foo", you should type "foo()"
-
-Hacking Interpreter
-
-- generational GC
-* non-blocking open (e.g. for named pipe) for thread
-* avoid blocking with gethostbyname/gethostbyaddr (use fork ???)
-* objectify interpreters ???
-* remove rb_eval() recursions
-* syntax tree -> bytecode ???
-* scrambled script, or script filter
-* setuid ruby
-* performance tune for in-block (dynamic) local variables.
-* give warnings to assign magic variables.
-* export rb_io_{addstr,printf,puts,print}
-* autoload should work with threads [ruby-talk:4589]
-* remove stdio dependency from IOs.
-* warn for inconsistent local variable usage (lv m and method m at the same time).
-* MicroRuby
-* Built-in Interactive Ruby.
-* Parser API
-* trap every method invocation, which can be enabled by e.g. trap_call :method.
-* unify Errno exceptions of same errno, or new exception comparison scheme.
-* 2.times{|i| if i==0 then a = 15 else puts eval("a") end} should print nil.
-* Thread#max_stack_size attribute (possible??)
-
-Standard Libraries
-
-- Module#define_method which takes a name and a body (block, proc or method).
-- Enume#inject
-- Array#fetch
-- IO::for_fd
-- Process::waitall [ruby-talk:4557]
-- Process::Status
-- File::lchown, File::lchmod; xxx - still need work for non existing platforms
-- move Time::times to Process.
-- Enumerable#sort_by for Schwartzian transformation
-- fork_and_kill_other_threads.
-- signal list (Signal::trap, Signal::list).
-- move NameError under StandardError.
-- Integer#to_s(base)
-- Hash::new{default}
-- hash etc. should handle self referenceing array/hash
-- Array#select(n1,n2...) works like Array#indexes(n1,n2...)
-- use Mersenne Twister RNG for random.
-- deprecate Array#indexes, and Array#indices.
-- remove dependency on MAXPATHLEN.
-- String#scanf(?)
-* Object#fmt(?)
-* Time::strptime
-* Integer[num], Float[num]; Fixnum[num]?
-* method to retrieve non-number trailer for to_i/to_f.
-* Stream or Port, abstract superclass of IO ?
-* String#{pred,prev}, String#downto
-* optional stepsize argument for succ()
-* Ruby module -- Ruby::Version, Ruby::Interpreter
-* introduce Boolean class; super of TrueClass, FalseClass
-* synchronized method - synchronized{...}, synchronized :foo, :bar
-* Array#&, Array#| to allow duplication. ???
-* way to specify immortal (fork endurance) thread;
-* or raise ForkException to every thread but fork caller.
-* new user-defined marshal scheme. _dump(dumper), _load(restorer)
-* library to load per-user profile seeking .ruby_profile or ruby.ini file.
-* warning framework (warn, warning for Ruby level)
-* marshal should not depend on sprintf (works bad with locale).
-* ternary arg pow: a.pow(b,c) == a**b%c
-* new caller(), e.g. call_stack; needs better name.
-* pointer share mechanism similar to one in String for Array.
-* require "1.6" etc. by /usr/lib/ruby/1.6/1.6.rb ;-)
-* save both "feature names" and "normalized path" in $"
-* implement Mutex_m (or MutexMixin) using Mutex.
-
-Extension Libraries
-
-* ptk.rb pTk wrapper that is compatible to tk.rb
-* Berkeley DB extension
-* BitVector
-* thread-safe fcgi
-
-Ruby Libraries
-
-- urllib.rb, nttplib.rb, etc.
-* format like perl's
-
-Tools
-
-* freeze or undump to bundle everything
-* bundle using zlib
diff --git a/aclocal.m4 b/aclocal.m4
new file mode 100644
index 0000000000..e69de29bb2
--- /dev/null
+++ b/aclocal.m4
diff --git a/addr2line.c b/addr2line.c
index 91b4be99ab..e5f25293e2 100644
--- a/addr2line.c
+++ b/addr2line.c
@@ -1,6 +1,6 @@
/**********************************************************************
- addr2line.h -
+ addr2line.c -
$Author$
@@ -8,21 +8,31 @@
**********************************************************************/
+#if defined(__clang__)
+#pragma clang diagnostic ignored "-Wgnu-empty-initializer"
+#pragma clang diagnostic ignored "-Wgcc-compat"
+#endif
+
+#include "ruby/internal/config.h"
+#include "ruby/defines.h"
+#include "ruby/missing.h"
#include "addr2line.h"
#include <stdio.h>
#include <errno.h>
-#ifdef __ELF__
-
-#ifdef __OpenBSD__
-#include <elf_abi.h>
-#else
-#include <elf.h>
+#ifdef HAVE_LIBPROC_H
+#include <libproc.h>
#endif
+
+#include "ruby/internal/stdbool.h"
+
+#if defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H)
+
#include <fcntl.h>
#include <limits.h>
#include <stdio.h>
+#include <stdint.h>
#include <stdlib.h>
#include <string.h>
#include <sys/mman.h>
@@ -30,11 +40,72 @@
#include <sys/stat.h>
#include <unistd.h>
-#ifdef HAVE_DL_ITERATE_PHDR
-# ifndef _GNU_SOURCE
-# define _GNU_SOURCE
+/* Make alloca work the best possible way. */
+#ifdef __GNUC__
+# ifndef alloca
+# define alloca __builtin_alloca
# endif
-# include <link.h>
+#else
+# ifdef HAVE_ALLOCA_H
+# include <alloca.h>
+# else
+# ifdef _AIX
+#pragma alloca
+# else
+# ifndef alloca /* predefined by HP cc +Olibcalls */
+void *alloca();
+# endif
+# endif /* AIX */
+# endif /* HAVE_ALLOCA_H */
+#endif /* __GNUC__ */
+
+#ifdef HAVE_DLADDR
+# include <dlfcn.h>
+#endif
+
+#ifdef HAVE_MACH_O_LOADER_H
+# include <crt_externs.h>
+# include <mach-o/fat.h>
+# include <mach-o/loader.h>
+# include <mach-o/nlist.h>
+# include <mach-o/stab.h>
+#endif
+
+#ifdef USE_ELF
+# ifdef __OpenBSD__
+# include <elf_abi.h>
+# else
+# include <elf.h>
+# endif
+
+#ifndef ElfW
+# if SIZEOF_VOIDP == 8
+# define ElfW(x) Elf64##_##x
+# else
+# define ElfW(x) Elf32##_##x
+# endif
+#endif
+#ifndef ELF_ST_TYPE
+# if SIZEOF_VOIDP == 8
+# define ELF_ST_TYPE ELF64_ST_TYPE
+# else
+# define ELF_ST_TYPE ELF32_ST_TYPE
+# endif
+#endif
+#endif
+
+#ifdef SHF_COMPRESSED
+# if defined(ELFCOMPRESS_ZLIB) && defined(HAVE_LIBZ)
+ /* FreeBSD 11.0 lacks ELFCOMPRESS_ZLIB */
+# include <zlib.h>
+# define SUPPORT_COMPRESSED_DEBUG_LINE
+# endif
+#else /* compatibility with glibc < 2.22 */
+# define SHF_COMPRESSED 0
+#endif
+
+#ifndef PATH_MAX
+#define PATH_MAX 4096
#endif
#define DW_LNS_copy 0x01
@@ -56,36 +127,85 @@
#define DW_LNE_define_file 0x03
#define DW_LNE_set_discriminator 0x04 /* DWARF4 */
-#ifndef ElfW
-# if SIZEOF_VOIDP == 8
-# define ElfW(x) Elf64##_##x
-# else
-# define ElfW(x) Elf32##_##x
-# endif
-#endif
+PRINTF_ARGS(static int kprintf(const char *fmt, ...), 1, 2);
-typedef struct {
+typedef struct line_info {
const char *dirname;
const char *filename;
+ const char *path; /* object path */
int line;
- int fd;
- void *mapped;
- size_t mapped_size;
- unsigned long base_addr;
+ uintptr_t base_addr;
+ uintptr_t saddr;
+ const char *sname; /* function name */
+
+ struct line_info *next;
} line_info_t;
+struct dwarf_section {
+ char *ptr;
+ size_t size;
+ uint64_t flags;
+};
+
+typedef struct obj_info {
+ const char *path; /* object path */
+ char *mapped;
+ size_t mapped_size;
+ void *uncompressed;
+ uintptr_t base_addr;
+ uintptr_t vmaddr;
+ struct dwarf_section debug_abbrev;
+ struct dwarf_section debug_info;
+ struct dwarf_section debug_line;
+ struct dwarf_section debug_ranges;
+ struct dwarf_section debug_str_offsets;
+ struct dwarf_section debug_addr;
+ struct dwarf_section debug_rnglists;
+ struct dwarf_section debug_str;
+ struct dwarf_section debug_line_str;
+ struct obj_info *next;
+} obj_info_t;
+
+#define DWARF_SECTION_COUNT 9
+
+static struct dwarf_section *
+obj_dwarf_section_at(obj_info_t *obj, int n)
+{
+ struct dwarf_section *ary[] = {
+ &obj->debug_abbrev,
+ &obj->debug_info,
+ &obj->debug_line,
+ &obj->debug_ranges,
+ &obj->debug_str_offsets,
+ &obj->debug_addr,
+ &obj->debug_rnglists,
+ &obj->debug_str,
+ &obj->debug_line_str
+ };
+ if (n < 0 || DWARF_SECTION_COUNT <= n) {
+ abort();
+ }
+ return ary[n];
+}
+
+struct debug_section_definition {
+ const char *name;
+ struct dwarf_section *dwarf;
+};
+
/* Avoid consuming stack as this module may be used from signal handler */
-static char binary_filename[PATH_MAX];
+static char binary_filename[PATH_MAX + 1];
static unsigned long
-uleb128(char **p) {
+uleb128(const char **p)
+{
unsigned long r = 0;
int s = 0;
for (;;) {
- unsigned char b = *(unsigned char *)(*p)++;
+ unsigned char b = (unsigned char)*(*p)++;
if (b < 0x80) {
- r += b << s;
+ r += (unsigned long)b << s;
break;
}
r += (b & 0x7f) << s;
@@ -95,11 +215,12 @@ uleb128(char **p) {
}
static long
-sleb128(char **p) {
+sleb128(const char **p)
+{
long r = 0;
int s = 0;
for (;;) {
- unsigned char b = *(unsigned char *)(*p)++;
+ unsigned char b = (unsigned char)*(*p)++;
if (b < 0x80) {
if (b & 0x40) {
r -= (0x80 - b) << s;
@@ -116,7 +237,7 @@ sleb128(char **p) {
}
static const char *
-get_nth_dirname(int dir, char *p)
+get_nth_dirname(unsigned long dir, const char *p)
{
if (!dir--) {
return "";
@@ -125,7 +246,7 @@ get_nth_dirname(int dir, char *p)
while (*p) p++;
p++;
if (!*p) {
- fprintf(stderr, "Unexpected directory number %d in %s\n",
+ kprintf("Unexpected directory number %lu in %s\n",
dir, binary_filename);
return "";
}
@@ -133,155 +254,191 @@ get_nth_dirname(int dir, char *p)
return p;
}
+static const char *parse_ver5_debug_line_header(const char *p, int idx, uint8_t format, obj_info_t *obj, const char **out_path, uint64_t *out_directory_index);
+
static void
-fill_filename(int file, char *include_directories, char *filenames,
- line_info_t *line)
+fill_filename(int file, uint8_t format, uint16_t version, const char *include_directories, const char *filenames, line_info_t *line, obj_info_t *obj)
{
int i;
- char *p = filenames;
- char *filename;
+ const char *p = filenames;
+ const char *filename;
unsigned long dir;
- for (i = 1; i <= file; i++) {
- filename = p;
- if (!*p) {
- /* Need to output binary file name? */
- fprintf(stderr, "Unexpected file number %d in %s\n",
- file, binary_filename);
- return;
- }
- while (*p) p++;
- p++;
- dir = uleb128(&p);
- /* last modified. */
- uleb128(&p);
- /* size of the file. */
- uleb128(&p);
-
- if (i == file) {
- line->filename = filename;
- line->dirname = get_nth_dirname(dir, include_directories);
- }
- }
-}
-
-static int
-get_path_from_symbol(const char *symbol, const char **p, size_t *len)
-{
- if (symbol[0] == '0') {
- /* libexecinfo */
- *p = strchr(symbol, '/');
- if (*p == NULL) return 0;
- *len = strlen(*p);
+ if (version >= 5) {
+ const char *path;
+ uint64_t directory_index = -1;
+ parse_ver5_debug_line_header(filenames, file, format, obj, &path, &directory_index);
+ line->filename = path;
+ parse_ver5_debug_line_header(include_directories, (int)directory_index, format, obj, &path, NULL);
+ line->dirname = path;
}
else {
- /* glibc */
- const char *q;
- *p = symbol;
- q = strchr(symbol, '(');
- if (q == NULL) return 0;
- *len = q - symbol;
+ for (i = 1; i <= file; i++) {
+ filename = p;
+ if (!*p) {
+ /* Need to output binary file name? */
+ kprintf("Unexpected file number %d in %s at %tx\n",
+ file, binary_filename, filenames - obj->mapped);
+ return;
+ }
+ while (*p) p++;
+ p++;
+ dir = uleb128(&p);
+ /* last modified. */
+ uleb128(&p);
+ /* size of the file. */
+ uleb128(&p);
+
+ if (i == file) {
+ line->filename = filename;
+ line->dirname = get_nth_dirname(dir, include_directories);
+ }
+ }
}
- return 1;
}
static void
-fill_line(int num_traces, void **traces,
- unsigned long addr, int file, int line,
- char *include_directories, char *filenames, line_info_t *lines)
+fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
+ uint8_t format, uint16_t version, const char *include_directories, const char *filenames,
+ obj_info_t *obj, line_info_t *lines, int offset)
{
int i;
- for (i = 0; i < num_traces; i++) {
- unsigned long a = (unsigned long)traces[i] - lines[i].base_addr;
+ addr += obj->base_addr - obj->vmaddr;
+ for (i = offset; i < num_traces; i++) {
+ uintptr_t a = (uintptr_t)traces[i];
/* We assume one line code doesn't result >100 bytes of native code.
We may want more reliable way eventually... */
if (addr < a && a < addr + 100) {
- fill_filename(file, include_directories, filenames, &lines[i]);
+ fill_filename(file, format, version, include_directories, filenames, &lines[i], obj);
lines[i].line = line;
}
}
}
-static void
-parse_debug_line_cu(int num_traces, void **traces,
- char **debug_line, line_info_t *lines)
+struct LineNumberProgramHeader {
+ uint64_t unit_length;
+ uint16_t version;
+ uint8_t format; /* 4 or 8 */
+ uint64_t header_length;
+ uint8_t minimum_instruction_length;
+ uint8_t maximum_operations_per_instruction;
+ uint8_t default_is_stmt;
+ int8_t line_base;
+ uint8_t line_range;
+ uint8_t opcode_base;
+ /* uint8_t standard_opcode_lengths[opcode_base-1]; */
+ const char *include_directories;
+ const char *filenames;
+ const char *cu_start;
+ const char *cu_end;
+};
+
+static int
+parse_debug_line_header(obj_info_t *obj, const char **pp, struct LineNumberProgramHeader *header)
{
- char *p, *cu_end, *cu_start, *include_directories, *filenames;
- unsigned long unit_length;
- int default_is_stmt, line_base;
- unsigned int header_length, minimum_instruction_length, line_range,
- opcode_base;
- unsigned char *standard_opcode_lengths;
+ const char *p = *pp;
+ header->unit_length = *(uint32_t *)p;
+ p += sizeof(uint32_t);
+
+ header->format = 4;
+ if (header->unit_length == 0xffffffff) {
+ header->unit_length = *(uint64_t *)p;
+ p += sizeof(uint64_t);
+ header->format = 8;
+ }
- /* The registers. */
- unsigned long addr = 0;
- unsigned int file = 1;
- unsigned int line = 1;
- unsigned int column = 0;
- int is_stmt;
- int basic_block = 0;
- int end_sequence = 0;
- int prologue_end = 0;
- int epilogue_begin = 0;
- unsigned int isa = 0;
+ header->cu_end = p + header->unit_length;
- p = *debug_line;
+ header->version = *(uint16_t *)p;
+ p += sizeof(uint16_t);
+ if (header->version > 5) return -1;
- unit_length = *(unsigned int *)p;
- p += sizeof(unsigned int);
- if (unit_length == 0xffffffff) {
- unit_length = *(unsigned long *)p;
- p += sizeof(unsigned long);
+ if (header->version >= 5) {
+ /* address_size = *(uint8_t *)p++; */
+ /* segment_selector_size = *(uint8_t *)p++; */
+ p += 2;
}
- cu_end = p + unit_length;
-
- /*dwarf_version = *(unsigned short *)p;*/
- p += 2;
-
- header_length = *(unsigned int *)p;
- p += sizeof(unsigned int);
+ header->header_length = header->format == 4 ? *(uint32_t *)p : *(uint64_t *)p;
+ p += header->format;
+ header->cu_start = p + header->header_length;
- cu_start = p + header_length;
+ header->minimum_instruction_length = *(uint8_t *)p++;
- minimum_instruction_length = *(unsigned char *)p;
- p++;
+ if (header->version >= 4) {
+ /* maximum_operations_per_instruction = *(uint8_t *)p; */
+ if (*p != 1) return -1; /* For non-VLIW architectures, this field is 1 */
+ p++;
+ }
- is_stmt = default_is_stmt = *(unsigned char *)p;
- p++;
+ header->default_is_stmt = *(uint8_t *)p++;
+ header->line_base = *(int8_t *)p++;
+ header->line_range = *(uint8_t *)p++;
+ header->opcode_base = *(uint8_t *)p++;
+ /* header->standard_opcode_lengths = (uint8_t *)p - 1; */
+ p += header->opcode_base - 1;
+
+ if (header->version >= 5) {
+ header->include_directories = p;
+ p = parse_ver5_debug_line_header(p, -1, header->format, obj, NULL, NULL);
+ header->filenames = p;
+ }
+ else {
+ header->include_directories = p;
- line_base = *(char *)p;
- p++;
+ /* temporary measure for compress-debug-sections */
+ if (p >= header->cu_end) return -1;
- line_range = *(unsigned char *)p;
- p++;
+ /* skip include directories */
+ while (*p) {
+ p = memchr(p, '\0', header->cu_end - p);
+ if (!p) return -1;
+ p++;
+ }
+ p++;
- opcode_base = *(unsigned char *)p;
- p++;
+ header->filenames = p;
+ }
- standard_opcode_lengths = (unsigned char *)p - 1;
- p += opcode_base - 1;
+ *pp = header->cu_start;
- include_directories = p;
+ return 0;
+}
- /* skip include directories */
- while (*p) {
- while (*p) p++;
- p++;
- }
- p++;
+static int
+parse_debug_line_cu(int num_traces, void **traces, const char **debug_line,
+ obj_info_t *obj, line_info_t *lines, int offset)
+{
+ const char *p = (const char *)*debug_line;
+ struct LineNumberProgramHeader header;
- filenames = p;
+ /* The registers. */
+ unsigned long addr = 0;
+ unsigned int file = 1;
+ unsigned int line = 1;
+ /* unsigned int column = 0; */
+ int is_stmt;
+ /* int basic_block = 0; */
+ /* int end_sequence = 0; */
+ /* int prologue_end = 0; */
+ /* int epilogue_begin = 0; */
+ /* unsigned int isa = 0; */
- p = cu_start;
+ if (parse_debug_line_header(obj, &p, &header))
+ return -1;
+ is_stmt = header.default_is_stmt;
#define FILL_LINE() \
do { \
fill_line(num_traces, traces, addr, file, line, \
- include_directories, filenames, lines); \
- basic_block = prologue_end = epilogue_begin = 0; \
+ header.format, \
+ header.version, \
+ header.include_directories, \
+ header.filenames, \
+ obj, lines, offset); \
+ /*basic_block = prologue_end = epilogue_begin = 0;*/ \
} while (0)
- while (p < cu_end) {
+ while (p < header.cu_end) {
unsigned long a;
unsigned char op = *p++;
switch (op) {
@@ -289,7 +446,7 @@ parse_debug_line_cu(int num_traces, void **traces,
FILL_LINE();
break;
case DW_LNS_advance_pc:
- a = uleb128(&p);
+ a = uleb128(&p) * header.minimum_instruction_length;
addr += a;
break;
case DW_LNS_advance_line: {
@@ -298,56 +455,57 @@ parse_debug_line_cu(int num_traces, void **traces,
break;
}
case DW_LNS_set_file:
- file = uleb128(&p);
+ file = (unsigned int)uleb128(&p);
break;
case DW_LNS_set_column:
- column = uleb128(&p);
+ /*column = (unsigned int)*/(void)uleb128(&p);
break;
case DW_LNS_negate_stmt:
is_stmt = !is_stmt;
break;
case DW_LNS_set_basic_block:
- basic_block = 1;
+ /*basic_block = 1; */
break;
case DW_LNS_const_add_pc:
- a = ((255 - opcode_base) / line_range) *
- minimum_instruction_length;
+ a = ((255UL - header.opcode_base) / header.line_range) *
+ header.minimum_instruction_length;
addr += a;
break;
case DW_LNS_fixed_advance_pc:
- a = *(unsigned char *)p++;
+ a = *(uint16_t *)p;
+ p += sizeof(uint16_t);
addr += a;
break;
case DW_LNS_set_prologue_end:
- prologue_end = 1;
+ /* prologue_end = 1; */
break;
case DW_LNS_set_epilogue_begin:
- epilogue_begin = 1;
+ /* epilogue_begin = 1; */
break;
case DW_LNS_set_isa:
- isa = uleb128(&p);
+ /* isa = (unsigned int)*/(void)uleb128(&p);
break;
case 0:
- a = *(unsigned char *)p++;
+ a = uleb128(&p);
op = *p++;
switch (op) {
case DW_LNE_end_sequence:
- end_sequence = 1;
+ /* end_sequence = 1; */
FILL_LINE();
addr = 0;
file = 1;
line = 1;
- column = 0;
- is_stmt = default_is_stmt;
- end_sequence = 0;
- isa = 0;
+ /* column = 0; */
+ is_stmt = header.default_is_stmt;
+ /* end_sequence = 0; */
+ /* isa = 0; */
break;
case DW_LNE_set_address:
addr = *(unsigned long *)p;
p += sizeof(unsigned long);
break;
case DW_LNE_define_file:
- fprintf(stderr, "Unsupported operation in %s\n",
+ kprintf("Unsupported operation in %s\n",
binary_filename);
break;
case DW_LNE_set_discriminator:
@@ -355,53 +513,79 @@ parse_debug_line_cu(int num_traces, void **traces,
uleb128(&p);
break;
default:
- fprintf(stderr, "Unknown extended opcode: %d in %s\n",
+ kprintf("Unknown extended opcode: %d in %s\n",
op, binary_filename);
}
break;
default: {
- unsigned int addr_incr;
- int line_incr;
- a = op - opcode_base;
- addr_incr = (a / line_range) * minimum_instruction_length;
- line_incr = line_base + (a % line_range);
- addr += addr_incr;
- line += line_incr;
+ uint8_t adjusted_opcode = op - header.opcode_base;
+ uint8_t operation_advance = adjusted_opcode / header.line_range;
+ /* NOTE: this code doesn't support VLIW */
+ addr += operation_advance * header.minimum_instruction_length;
+ line += header.line_base + (adjusted_opcode % header.line_range);
FILL_LINE();
}
}
}
- *debug_line = p;
+ *debug_line = (char *)p;
+ return 0;
}
-static void
+static int
parse_debug_line(int num_traces, void **traces,
- char *debug_line, unsigned long size, line_info_t *lines)
+ const char *debug_line, unsigned long size,
+ obj_info_t *obj, line_info_t *lines, int offset)
{
- char *debug_line_end = debug_line + size;
+ const char *debug_line_end = debug_line + size;
while (debug_line < debug_line_end) {
- parse_debug_line_cu(num_traces, traces, &debug_line, lines);
+ if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset))
+ return -1;
}
if (debug_line != debug_line_end) {
- fprintf(stderr, "Unexpected size of .debug_line in %s\n",
+ kprintf("Unexpected size of .debug_line in %s\n",
binary_filename);
}
+ return 0;
}
/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+ obj_info_t **objp, line_info_t *lines, int offset);
+
static void
-fill_lines(int num_traces, void **traces, char **syms, int check_debuglink,
- line_info_t *current_line, line_info_t *lines);
+append_obj(obj_info_t **objp)
+{
+ obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
+ if (*objp) (*objp)->next = newobj;
+ *objp = newobj;
+}
+#ifdef USE_ELF
+/* Ideally we should check 4 paths to follow gnu_debuglink:
+ *
+ * - /usr/lib/debug/.build-id/ab/cdef1234.debug
+ * - /usr/bin/ruby.debug
+ * - /usr/bin/.debug/ruby.debug
+ * - /usr/lib/debug/usr/bin/ruby.debug.
+ *
+ * but we handle only two cases for now as the two formats are
+ * used by some linux distributions.
+ *
+ * See GDB's info for detail.
+ * https://sourceware.org/gdb/onlinedocs/gdb/Separate-Debug-Files.html
+ */
+
+// check the path pattern of "/usr/lib/debug/usr/bin/ruby.debug"
static void
-follow_debuglink(char *debuglink, int num_traces, void **traces, char **syms,
- line_info_t *current_line, line_info_t *lines)
+follow_debuglink(const char *debuglink, int num_traces, void **traces,
+ obj_info_t **objp, line_info_t *lines, int offset)
{
- /* Ideally we should check 4 paths to follow gnu_debuglink,
- but we handle only one case for now as this format is used
- by some linux distributions. See GDB's info for detail. */
static const char global_debug_dir[] = "/usr/lib/debug";
- char *p, *subdir;
+ const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+ char *p;
+ obj_info_t *o1 = *objp, *o2;
+ size_t len;
p = strrchr(binary_filename, '/');
if (!p) {
@@ -409,191 +593,2493 @@ follow_debuglink(char *debuglink, int num_traces, void **traces, char **syms,
}
p[1] = '\0';
- subdir = (char *)alloca(strlen(binary_filename) + 1);
- strcpy(subdir, binary_filename);
- strcpy(binary_filename, global_debug_dir);
- strncat(binary_filename, subdir,
- PATH_MAX - strlen(binary_filename) - 1);
- strncat(binary_filename, debuglink,
- PATH_MAX - strlen(binary_filename) - 1);
+ len = strlen(binary_filename);
+ if (len >= PATH_MAX - global_debug_dir_len)
+ len = PATH_MAX - global_debug_dir_len - 1;
+ memmove(binary_filename + global_debug_dir_len, binary_filename, len);
+ memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+ len += global_debug_dir_len;
+ strlcpy(binary_filename + len, debuglink, PATH_MAX - len);
+
+ append_obj(objp);
+ o2 = *objp;
+ o2->base_addr = o1->base_addr;
+ o2->path = o1->path;
+ fill_lines(num_traces, traces, 0, objp, lines, offset);
+}
+
+// check the path pattern of "/usr/lib/debug/.build-id/ab/cdef1234.debug"
+static void
+follow_debuglink_build_id(const char *build_id, size_t build_id_size, int num_traces, void **traces,
+ obj_info_t **objp, line_info_t *lines, int offset)
+{
+ static const char global_debug_dir[] = "/usr/lib/debug/.build-id/";
+ const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+ char *p;
+ obj_info_t *o1 = *objp, *o2;
+ size_t i;
+
+ if (PATH_MAX < global_debug_dir_len + 1 + build_id_size * 2 + 6) return;
+
+ memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+ p = binary_filename + global_debug_dir_len;
+ for (i = 0; i < build_id_size; i++) {
+ static const char tbl[] = "0123456789abcdef";
+ unsigned char n = build_id[i];
+ *p++ = tbl[n / 16];
+ *p++ = tbl[n % 16];
+ if (i == 0) *p++ = '/';
+ }
+ strcpy(p, ".debug");
- munmap(current_line->mapped, current_line->mapped_size);
- close(current_line->fd);
- fill_lines(num_traces, traces, syms, 0, current_line, lines);
+ append_obj(objp);
+ o2 = *objp;
+ o2->base_addr = o1->base_addr;
+ o2->path = o1->path;
+ fill_lines(num_traces, traces, 0, objp, lines, offset);
+}
+#endif
+
+enum
+{
+ DW_TAG_compile_unit = 0x11,
+ DW_TAG_inlined_subroutine = 0x1d,
+ DW_TAG_subprogram = 0x2e,
+};
+
+/* Attributes encodings */
+enum
+{
+ DW_AT_sibling = 0x01,
+ DW_AT_location = 0x02,
+ DW_AT_name = 0x03,
+ /* Reserved 0x04 */
+ /* Reserved 0x05 */
+ /* Reserved 0x06 */
+ /* Reserved 0x07 */
+ /* Reserved 0x08 */
+ DW_AT_ordering = 0x09,
+ /* Reserved 0x0a */
+ DW_AT_byte_size = 0x0b,
+ /* Reserved 0x0c */
+ DW_AT_bit_size = 0x0d,
+ /* Reserved 0x0e */
+ /* Reserved 0x0f */
+ DW_AT_stmt_list = 0x10,
+ DW_AT_low_pc = 0x11,
+ DW_AT_high_pc = 0x12,
+ DW_AT_language = 0x13,
+ /* Reserved 0x14 */
+ DW_AT_discr = 0x15,
+ DW_AT_discr_value = 0x16,
+ DW_AT_visibility = 0x17,
+ DW_AT_import = 0x18,
+ DW_AT_string_length = 0x19,
+ DW_AT_common_reference = 0x1a,
+ DW_AT_comp_dir = 0x1b,
+ DW_AT_const_value = 0x1c,
+ DW_AT_containing_type = 0x1d,
+ DW_AT_default_value = 0x1e,
+ /* Reserved 0x1f */
+ DW_AT_inline = 0x20,
+ DW_AT_is_optional = 0x21,
+ DW_AT_lower_bound = 0x22,
+ /* Reserved 0x23 */
+ /* Reserved 0x24 */
+ DW_AT_producer = 0x25,
+ /* Reserved 0x26 */
+ DW_AT_prototyped = 0x27,
+ /* Reserved 0x28 */
+ /* Reserved 0x29 */
+ DW_AT_return_addr = 0x2a,
+ /* Reserved 0x2b */
+ DW_AT_start_scope = 0x2c,
+ /* Reserved 0x2d */
+ DW_AT_bit_stride = 0x2e,
+ DW_AT_upper_bound = 0x2f,
+ /* Reserved 0x30 */
+ DW_AT_abstract_origin = 0x31,
+ DW_AT_accessibility = 0x32,
+ DW_AT_address_class = 0x33,
+ DW_AT_artificial = 0x34,
+ DW_AT_base_types = 0x35,
+ DW_AT_calling_convention = 0x36,
+ DW_AT_count = 0x37,
+ DW_AT_data_member_location = 0x38,
+ DW_AT_decl_column = 0x39,
+ DW_AT_decl_file = 0x3a,
+ DW_AT_decl_line = 0x3b,
+ DW_AT_declaration = 0x3c,
+ DW_AT_discr_list = 0x3d,
+ DW_AT_encoding = 0x3e,
+ DW_AT_external = 0x3f,
+ DW_AT_frame_base = 0x40,
+ DW_AT_friend = 0x41,
+ DW_AT_identifier_case = 0x42,
+ /* Reserved 0x43 */
+ DW_AT_namelist_item = 0x44,
+ DW_AT_priority = 0x45,
+ DW_AT_segment = 0x46,
+ DW_AT_specification = 0x47,
+ DW_AT_static_link = 0x48,
+ DW_AT_type = 0x49,
+ DW_AT_use_location = 0x4a,
+ DW_AT_variable_parameter = 0x4b,
+ DW_AT_virtuality = 0x4c,
+ DW_AT_vtable_elem_location = 0x4d,
+ DW_AT_allocated = 0x4e,
+ DW_AT_associated = 0x4f,
+ DW_AT_data_location = 0x50,
+ DW_AT_byte_stride = 0x51,
+ DW_AT_entry_pc = 0x52,
+ DW_AT_use_UTF8 = 0x53,
+ DW_AT_extension = 0x54,
+ DW_AT_ranges = 0x55,
+ DW_AT_trampoline = 0x56,
+ DW_AT_call_column = 0x57,
+ DW_AT_call_file = 0x58,
+ DW_AT_call_line = 0x59,
+ DW_AT_description = 0x5a,
+ DW_AT_binary_scale = 0x5b,
+ DW_AT_decimal_scale = 0x5c,
+ DW_AT_small = 0x5d,
+ DW_AT_decimal_sign = 0x5e,
+ DW_AT_digit_count = 0x5f,
+ DW_AT_picture_string = 0x60,
+ DW_AT_mutable = 0x61,
+ DW_AT_threads_scaled = 0x62,
+ DW_AT_explicit = 0x63,
+ DW_AT_object_pointer = 0x64,
+ DW_AT_endianity = 0x65,
+ DW_AT_elemental = 0x66,
+ DW_AT_pure = 0x67,
+ DW_AT_recursive = 0x68,
+ DW_AT_signature = 0x69,
+ DW_AT_main_subprogram = 0x6a,
+ DW_AT_data_bit_offset = 0x6b,
+ DW_AT_const_expr = 0x6c,
+ DW_AT_enum_class = 0x6d,
+ DW_AT_linkage_name = 0x6e,
+ DW_AT_string_length_bit_size = 0x6f,
+ DW_AT_string_length_byte_size = 0x70,
+ DW_AT_rank = 0x71,
+ DW_AT_str_offsets_base = 0x72,
+ DW_AT_addr_base = 0x73,
+ DW_AT_rnglists_base = 0x74,
+ /* Reserved 0x75 */
+ DW_AT_dwo_name = 0x76,
+ DW_AT_reference = 0x77,
+ DW_AT_rvalue_reference = 0x78,
+ DW_AT_macros = 0x79,
+ DW_AT_call_all_calls = 0x7a,
+ DW_AT_call_all_source_calls = 0x7b,
+ DW_AT_call_all_tail_calls = 0x7c,
+ DW_AT_call_return_pc = 0x7d,
+ DW_AT_call_value = 0x7e,
+ DW_AT_call_origin = 0x7f,
+ DW_AT_call_parameter = 0x80,
+ DW_AT_call_pc = 0x81,
+ DW_AT_call_tail_call = 0x82,
+ DW_AT_call_target = 0x83,
+ DW_AT_call_target_clobbered = 0x84,
+ DW_AT_call_data_location = 0x85,
+ DW_AT_call_data_value = 0x86,
+ DW_AT_noreturn = 0x87,
+ DW_AT_alignment = 0x88,
+ DW_AT_export_symbols = 0x89,
+ DW_AT_deleted = 0x8a,
+ DW_AT_defaulted = 0x8b,
+ DW_AT_loclists_base = 0x8c,
+ DW_AT_lo_user = 0x2000,
+ DW_AT_hi_user = 0x3fff
+};
+
+/* Attribute form encodings */
+enum
+{
+ DW_FORM_addr = 0x01,
+ /* Reserved 0x02 */
+ DW_FORM_block2 = 0x03,
+ DW_FORM_block4 = 0x04,
+ DW_FORM_data2 = 0x05,
+ DW_FORM_data4 = 0x06,
+ DW_FORM_data8 = 0x07,
+ DW_FORM_string = 0x08,
+ DW_FORM_block = 0x09,
+ DW_FORM_block1 = 0x0a,
+ DW_FORM_data1 = 0x0b,
+ DW_FORM_flag = 0x0c,
+ DW_FORM_sdata = 0x0d,
+ DW_FORM_strp = 0x0e,
+ DW_FORM_udata = 0x0f,
+ DW_FORM_ref_addr = 0x10,
+ DW_FORM_ref1 = 0x11,
+ DW_FORM_ref2 = 0x12,
+ DW_FORM_ref4 = 0x13,
+ DW_FORM_ref8 = 0x14,
+ DW_FORM_ref_udata = 0x15,
+ DW_FORM_indirect = 0x16,
+ DW_FORM_sec_offset = 0x17,
+ DW_FORM_exprloc = 0x18,
+ DW_FORM_flag_present = 0x19,
+ DW_FORM_strx = 0x1a,
+ DW_FORM_addrx = 0x1b,
+ DW_FORM_ref_sup4 = 0x1c,
+ DW_FORM_strp_sup = 0x1d,
+ DW_FORM_data16 = 0x1e,
+ DW_FORM_line_strp = 0x1f,
+ DW_FORM_ref_sig8 = 0x20,
+ DW_FORM_implicit_const = 0x21,
+ DW_FORM_loclistx = 0x22,
+ DW_FORM_rnglistx = 0x23,
+ DW_FORM_ref_sup8 = 0x24,
+ DW_FORM_strx1 = 0x25,
+ DW_FORM_strx2 = 0x26,
+ DW_FORM_strx3 = 0x27,
+ DW_FORM_strx4 = 0x28,
+ DW_FORM_addrx1 = 0x29,
+ DW_FORM_addrx2 = 0x2a,
+ DW_FORM_addrx3 = 0x2b,
+ DW_FORM_addrx4 = 0x2c
+};
+
+/* Range list entry encodings */
+enum {
+ DW_RLE_end_of_list = 0x00,
+ DW_RLE_base_addressx = 0x01,
+ DW_RLE_startx_endx = 0x02,
+ DW_RLE_startx_length = 0x03,
+ DW_RLE_offset_pair = 0x04,
+ DW_RLE_base_address = 0x05,
+ DW_RLE_start_end = 0x06,
+ DW_RLE_start_length = 0x07
+};
+
+enum {
+ VAL_none = 0,
+ VAL_cstr = 1,
+ VAL_data = 2,
+ VAL_uint = 3,
+ VAL_int = 4,
+ VAL_addr = 5
+};
+
+# define ABBREV_TABLE_SIZE 256
+typedef struct {
+ obj_info_t *obj;
+ const char *file;
+ uint8_t current_version;
+ const char *current_cu;
+ uint64_t current_low_pc;
+ uint64_t current_str_offsets_base;
+ uint64_t current_addr_base;
+ uint64_t current_rnglists_base;
+ const char *debug_line_cu_end;
+ uint8_t debug_line_format;
+ uint16_t debug_line_version;
+ const char *debug_line_files;
+ const char *debug_line_directories;
+ const char *p;
+ const char *cu_end;
+ const char *pend;
+ const char *q0;
+ const char *q;
+ int format; // 4 or 8
+ uint8_t address_size;
+ int level;
+ const char *abbrev_table[ABBREV_TABLE_SIZE];
+} DebugInfoReader;
+
+typedef struct {
+ ptrdiff_t pos;
+ int tag;
+ int has_children;
+} DIE;
+
+typedef struct {
+ union {
+ const char *ptr;
+ uint64_t uint64;
+ int64_t int64;
+ uint64_t addr_idx;
+ } as;
+ uint64_t off;
+ uint64_t at;
+ uint64_t form;
+ size_t size;
+ int type;
+} DebugInfoValue;
+
+#if defined(WORDS_BIGENDIAN)
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(a)<<sz)|(b))
+#else
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(b)<<sz)|(a))
+#endif
+
+static uint16_t
+get_uint16(const uint8_t *p)
+{
+ return (uint16_t)MERGE_2INTS(p[0],p[1],8);
+}
+
+static uint32_t
+get_uint32(const uint8_t *p)
+{
+ return (uint32_t)MERGE_2INTS(get_uint16(p),get_uint16(p+2),16);
+}
+
+static uint64_t
+get_uint64(const uint8_t *p)
+{
+ return MERGE_2INTS(get_uint32(p),get_uint32(p+4),32);
+}
+
+static uint8_t
+read_uint8(const char **ptr)
+{
+ const char *p = *ptr;
+ *ptr = (p + 1);
+ return (uint8_t)*p;
+}
+
+static uint16_t
+read_uint16(const char **ptr)
+{
+ const char *p = *ptr;
+ *ptr = (p + 2);
+ return get_uint16((const uint8_t *)p);
+}
+
+static uint32_t
+read_uint24(const char **ptr)
+{
+ const char *p = *ptr;
+ *ptr = (p + 3);
+ return ((uint8_t)*p << 16) | get_uint16((const uint8_t *)p+1);
+}
+
+static uint32_t
+read_uint32(const char **ptr)
+{
+ const char *p = *ptr;
+ *ptr = (p + 4);
+ return get_uint32((const uint8_t *)p);
+}
+
+static uint64_t
+read_uint64(const char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + 8);
+ return get_uint64(p);
+}
+
+static uintptr_t
+read_uintptr(const char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + SIZEOF_VOIDP);
+#if SIZEOF_VOIDP == 8
+ return get_uint64(p);
+#else
+ return get_uint32(p);
+#endif
+}
+
+static uint64_t
+read_uint(DebugInfoReader *reader)
+{
+ if (reader->format == 4) {
+ return read_uint32(&reader->p);
+ } else { /* 64 bit */
+ return read_uint64(&reader->p);
+ }
+}
+
+static uint64_t
+read_uleb128(DebugInfoReader *reader)
+{
+ return uleb128(&reader->p);
+}
+
+static int64_t
+read_sleb128(DebugInfoReader *reader)
+{
+ return sleb128(&reader->p);
}
-/* read file and fill lines */
static void
-fill_lines(int num_traces, void **traces, char **syms, int check_debuglink,
- line_info_t *current_line, line_info_t *lines)
+debug_info_reader_init(DebugInfoReader *reader, obj_info_t *obj)
{
- int i;
+ reader->file = obj->mapped;
+ reader->obj = obj;
+ reader->p = obj->debug_info.ptr;
+ reader->pend = obj->debug_info.ptr + obj->debug_info.size;
+ reader->debug_line_cu_end = obj->debug_line.ptr;
+ reader->current_low_pc = 0;
+ reader->current_str_offsets_base = 0;
+ reader->current_addr_base = 0;
+ reader->current_rnglists_base = 0;
+}
+
+static void
+di_skip_die_attributes(const char **p)
+{
+ for (;;) {
+ uint64_t at = uleb128(p);
+ uint64_t form = uleb128(p);
+ if (!at && !form) break;
+ switch (form) {
+ default:
+ break;
+ case DW_FORM_implicit_const:
+ sleb128(p);
+ break;
+ }
+ }
+}
+
+static void
+di_read_debug_abbrev_cu(DebugInfoReader *reader)
+{
+ uint64_t prev = 0;
+ const char *p = reader->q0;
+ for (;;) {
+ uint64_t abbrev_number = uleb128(&p);
+ if (abbrev_number <= prev) break;
+ if (abbrev_number < ABBREV_TABLE_SIZE) {
+ reader->abbrev_table[abbrev_number] = p;
+ }
+ prev = abbrev_number;
+ uleb128(&p); /* tag */
+ p++; /* has_children */
+ di_skip_die_attributes(&p);
+ }
+}
+
+static int
+di_read_debug_line_cu(DebugInfoReader *reader)
+{
+ const char *p;
+ struct LineNumberProgramHeader header;
+
+ p = (const char *)reader->debug_line_cu_end;
+ if (parse_debug_line_header(reader->obj, &p, &header))
+ return -1;
+
+ reader->debug_line_cu_end = (char *)header.cu_end;
+ reader->debug_line_format = header.format;
+ reader->debug_line_version = header.version;
+ reader->debug_line_directories = (char *)header.include_directories;
+ reader->debug_line_files = (char *)header.filenames;
+
+ return 0;
+}
+
+static void
+set_addr_idx_value(DebugInfoValue *v, uint64_t n)
+{
+ v->as.addr_idx = n;
+ v->type = VAL_addr;
+}
+
+static void
+set_uint_value(DebugInfoValue *v, uint64_t n)
+{
+ v->as.uint64 = n;
+ v->type = VAL_uint;
+}
+
+static void
+set_int_value(DebugInfoValue *v, int64_t n)
+{
+ v->as.int64 = n;
+ v->type = VAL_int;
+}
+
+static void
+set_cstr_value(DebugInfoValue *v, const char *s)
+{
+ v->as.ptr = s;
+ v->off = 0;
+ v->type = VAL_cstr;
+}
+
+static void
+set_cstrp_value(DebugInfoValue *v, const char *s, uint64_t off)
+{
+ v->as.ptr = s;
+ v->off = off;
+ v->type = VAL_cstr;
+}
+
+static void
+set_data_value(DebugInfoValue *v, const char *s)
+{
+ v->as.ptr = s;
+ v->type = VAL_data;
+}
+
+static const char *
+get_cstr_value(DebugInfoValue *v)
+{
+ if (v->as.ptr) {
+ return v->as.ptr + v->off;
+ } else {
+ return NULL;
+ }
+}
+
+static const char *
+resolve_strx(DebugInfoReader *reader, uint64_t idx)
+{
+ const char *p = reader->obj->debug_str_offsets.ptr + reader->current_str_offsets_base;
+ uint64_t off;
+ if (reader->format == 4) {
+ off = ((uint32_t *)p)[idx];
+ }
+ else {
+ off = ((uint64_t *)p)[idx];
+ }
+ return reader->obj->debug_str.ptr + off;
+}
+
+static void
+debug_info_reader_read_addr_value(DebugInfoReader *reader, DebugInfoValue *v)
+{
+ if (reader->address_size == 4) {
+ set_uint_value(v, read_uint32(&reader->p));
+ } else if (reader->address_size == 8) {
+ set_uint_value(v, read_uint64(&reader->p));
+ } else {
+ fprintf(stderr,"unknown address_size:%d", reader->address_size);
+ abort();
+ }
+}
+
+static void
+debug_info_reader_read_value(DebugInfoReader *reader, uint64_t form, DebugInfoValue *v)
+{
+ switch (form) {
+ case DW_FORM_addr:
+ debug_info_reader_read_addr_value(reader, v);
+ break;
+ case DW_FORM_block2:
+ v->size = read_uint16(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_block4:
+ v->size = read_uint32(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_data2:
+ set_uint_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_data4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_data8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_string:
+ v->size = strlen(reader->p);
+ set_cstr_value(v, reader->p);
+ reader->p += v->size + 1;
+ break;
+ case DW_FORM_block:
+ v->size = uleb128(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_block1:
+ v->size = read_uint8(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_data1:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_flag:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_sdata:
+ set_int_value(v, read_sleb128(reader));
+ break;
+ case DW_FORM_strp:
+ set_cstrp_value(v, reader->obj->debug_str.ptr, read_uint(reader));
+ break;
+ case DW_FORM_udata:
+ set_uint_value(v, read_uleb128(reader));
+ break;
+ case DW_FORM_ref_addr:
+ if (reader->current_version <= 2) {
+ // DWARF Version 2 specifies that references have
+ // the same size as an address on the target system
+ debug_info_reader_read_addr_value(reader, v);
+ } else {
+ if (reader->format == 4) {
+ set_uint_value(v, read_uint32(&reader->p));
+ } else if (reader->format == 8) {
+ set_uint_value(v, read_uint64(&reader->p));
+ } else {
+ fprintf(stderr,"unknown format:%d", reader->format);
+ abort();
+ }
+ }
+ break;
+ case DW_FORM_ref1:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_ref2:
+ set_uint_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_ref4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_ref8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_ref_udata:
+ set_uint_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_indirect:
+ /* TODO: read the referred value */
+ set_uint_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_sec_offset:
+ set_uint_value(v, read_uint(reader)); /* offset */
+ /* addrptr: debug_addr */
+ /* lineptr: debug_line */
+ /* loclist: debug_loclists */
+ /* loclistptr: debug_loclists */
+ /* macptr: debug_macro */
+ /* rnglist: debug_rnglists */
+ /* rnglistptr: debug_rnglists */
+ /* stroffsetsptr: debug_str_offsets */
+ break;
+ case DW_FORM_exprloc:
+ v->size = (size_t)read_uleb128(reader);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_flag_present:
+ set_uint_value(v, 1);
+ break;
+ case DW_FORM_strx:
+ set_cstr_value(v, resolve_strx(reader, uleb128(&reader->p)));
+ break;
+ case DW_FORM_addrx:
+ set_addr_idx_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_ref_sup4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_strp_sup:
+ set_uint_value(v, read_uint(reader));
+ /* *p = reader->sup_file + reader->sup_str->sh_offset + ret; */
+ break;
+ case DW_FORM_data16:
+ v->size = 16;
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_line_strp:
+ set_cstrp_value(v, reader->obj->debug_line_str.ptr, read_uint(reader));
+ break;
+ case DW_FORM_ref_sig8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_implicit_const:
+ set_int_value(v, sleb128(&reader->q));
+ break;
+ case DW_FORM_loclistx:
+ set_uint_value(v, read_uleb128(reader));
+ break;
+ case DW_FORM_rnglistx:
+ set_uint_value(v, read_uleb128(reader));
+ break;
+ case DW_FORM_ref_sup8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_strx1:
+ set_cstr_value(v, resolve_strx(reader, read_uint8(&reader->p)));
+ break;
+ case DW_FORM_strx2:
+ set_cstr_value(v, resolve_strx(reader, read_uint16(&reader->p)));
+ break;
+ case DW_FORM_strx3:
+ set_cstr_value(v, resolve_strx(reader, read_uint24(&reader->p)));
+ break;
+ case DW_FORM_strx4:
+ set_cstr_value(v, resolve_strx(reader, read_uint32(&reader->p)));
+ break;
+ case DW_FORM_addrx1:
+ set_addr_idx_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_addrx2:
+ set_addr_idx_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_addrx3:
+ set_addr_idx_value(v, read_uint24(&reader->p));
+ break;
+ case DW_FORM_addrx4:
+ set_addr_idx_value(v, read_uint32(&reader->p));
+ break;
+ case 0:
+ goto fail;
+ break;
+ }
+ return;
+
+ fail:
+ fprintf(stderr, "%d: unsupported form: %#"PRIx64"\n", __LINE__, form);
+ exit(1);
+}
+
+/* find abbrev in current compilation unit */
+static const char *
+di_find_abbrev(DebugInfoReader *reader, uint64_t abbrev_number)
+{
+ const char *p;
+ if (abbrev_number < ABBREV_TABLE_SIZE) {
+ return reader->abbrev_table[abbrev_number];
+ }
+ p = reader->abbrev_table[ABBREV_TABLE_SIZE-1];
+ /* skip 255th record */
+ uleb128(&p); /* tag */
+ p++; /* has_children */
+ di_skip_die_attributes(&p);
+ for (uint64_t n = uleb128(&p); abbrev_number != n; n = uleb128(&p)) {
+ if (n == 0) {
+ fprintf(stderr,"%d: Abbrev Number %"PRId64" not found\n",__LINE__, abbrev_number);
+ exit(1);
+ }
+ uleb128(&p); /* tag */
+ p++; /* has_children */
+ di_skip_die_attributes(&p);
+ }
+ return p;
+}
+
+#if 0
+static void
+hexdump0(const unsigned char *p, size_t n)
+{
+ size_t i;
+ fprintf(stderr, " 0 1 2 3 4 5 6 7 8 9 A B C D E F\n");
+ for (i=0; i < n; i++){
+ switch (i & 15) {
+ case 0:
+ fprintf(stderr, "%02" PRIdSIZE ": %02X ", i/16, p[i]);
+ break;
+ case 15:
+ fprintf(stderr, "%02X\n", p[i]);
+ break;
+ default:
+ fprintf(stderr, "%02X ", p[i]);
+ break;
+ }
+ }
+ if ((i & 15) != 15) {
+ fprintf(stderr, "\n");
+ }
+}
+#define hexdump(p,n) hexdump0((const unsigned char *)p, n)
+
+static void
+div_inspect(DebugInfoValue *v)
+{
+ switch (v->type) {
+ case VAL_uint:
+ fprintf(stderr,"%d: type:%d size:%" PRIxSIZE " v:%"PRIx64"\n",__LINE__,v->type,v->size,v->as.uint64);
+ break;
+ case VAL_int:
+ fprintf(stderr,"%d: type:%d size:%" PRIxSIZE " v:%"PRId64"\n",__LINE__,v->type,v->size,(int64_t)v->as.uint64);
+ break;
+ case VAL_cstr:
+ fprintf(stderr,"%d: type:%d size:%" PRIxSIZE " v:'%s'\n",__LINE__,v->type,v->size,v->as.ptr);
+ break;
+ case VAL_data:
+ fprintf(stderr,"%d: type:%d size:%" PRIxSIZE " v:\n",__LINE__,v->type,v->size);
+ hexdump(v->as.ptr, 16);
+ break;
+ }
+}
+#endif
+
+static DIE *
+di_read_die(DebugInfoReader *reader, DIE *die)
+{
+ uint64_t abbrev_number = uleb128(&reader->p);
+ if (abbrev_number == 0) {
+ reader->level--;
+ return NULL;
+ }
+
+ reader->q = di_find_abbrev(reader, abbrev_number);
+
+ die->pos = reader->p - reader->obj->debug_info.ptr - 1;
+ die->tag = (int)uleb128(&reader->q); /* tag */
+ die->has_children = *reader->q++; /* has_children */
+ if (die->has_children) {
+ reader->level++;
+ }
+ return die;
+}
+
+static DebugInfoValue *
+di_read_record(DebugInfoReader *reader, DebugInfoValue *vp)
+{
+ uint64_t at = uleb128(&reader->q);
+ uint64_t form = uleb128(&reader->q);
+ if (!at || !form) return NULL;
+ vp->at = at;
+ vp->form = form;
+ debug_info_reader_read_value(reader, form, vp);
+ return vp;
+}
+
+static void
+di_skip_records(DebugInfoReader *reader)
+{
+ for (;;) {
+ DebugInfoValue v = {{}};
+ uint64_t at = uleb128(&reader->q);
+ uint64_t form = uleb128(&reader->q);
+ if (!at || !form) return;
+ debug_info_reader_read_value(reader, form, &v);
+ }
+}
+
+typedef struct addr_header {
+ const char *ptr;
+ uint64_t unit_length;
+ uint8_t format;
+ uint8_t address_size;
+ /* uint8_t segment_selector_size; */
+} addr_header_t;
+
+static void
+addr_header_init(obj_info_t *obj, addr_header_t *header) {
+ const char *p = obj->debug_addr.ptr;
+
+ header->ptr = p;
+
+ if (!p) return;
+
+ header->unit_length = *(uint32_t *)p;
+ p += sizeof(uint32_t);
+
+ header->format = 4;
+ if (header->unit_length == 0xffffffff) {
+ header->unit_length = *(uint64_t *)p;
+ p += sizeof(uint64_t);
+ header->format = 8;
+ }
+
+ p += 2; /* version */
+ header->address_size = *p++;
+ p++; /* segment_selector_size */
+}
+
+static uint64_t
+read_addr(addr_header_t *header, uint64_t addr_base, uint64_t idx) {
+ if (header->address_size == 4) {
+ return ((uint32_t*)(header->ptr + addr_base))[idx];
+ }
+ else {
+ return ((uint64_t*)(header->ptr + addr_base))[idx];
+ }
+}
+
+typedef struct rnglists_header {
+ uint64_t unit_length;
+ uint8_t format;
+ uint8_t address_size;
+ uint32_t offset_entry_count;
+} rnglists_header_t;
+
+static void
+rnglists_header_init(obj_info_t *obj, rnglists_header_t *header) {
+ const char *p = obj->debug_rnglists.ptr;
+
+ if (!p) return;
+
+ header->unit_length = *(uint32_t *)p;
+ p += sizeof(uint32_t);
+
+ header->format = 4;
+ if (header->unit_length == 0xffffffff) {
+ header->unit_length = *(uint64_t *)p;
+ p += sizeof(uint64_t);
+ header->format = 8;
+ }
+
+ p += 2; /* version */
+ header->address_size = *p++;
+ p++; /* segment_selector_size */
+ header->offset_entry_count = *(uint32_t *)p;
+}
+
+typedef struct {
+ uint64_t low_pc;
+ uint64_t high_pc;
+ uint64_t ranges;
+ bool low_pc_set;
+ bool high_pc_set;
+ bool ranges_set;
+} ranges_t;
+
+static void
+ranges_set(ranges_t *ptr, DebugInfoValue *v, addr_header_t *addr_header, uint64_t addr_base)
+{
+ uint64_t n = 0;
+ if (v->type == VAL_uint) {
+ n = v->as.uint64;
+ }
+ else if (v->type == VAL_addr) {
+ n = read_addr(addr_header, addr_base, v->as.addr_idx);
+ }
+ switch (v->at) {
+ case DW_AT_low_pc:
+ ptr->low_pc = n;
+ ptr->low_pc_set = true;
+ break;
+ case DW_AT_high_pc:
+ if (v->form == DW_FORM_addr) {
+ ptr->high_pc = n;
+ }
+ else {
+ ptr->high_pc = ptr->low_pc + n;
+ }
+ ptr->high_pc_set = true;
+ break;
+ case DW_AT_ranges:
+ ptr->ranges = n;
+ ptr->ranges_set = true;
+ break;
+ }
+}
+
+static uint64_t
+read_dw_form_addr(DebugInfoReader *reader, const char **ptr)
+{
+ const char *p = *ptr;
+ *ptr = p + reader->address_size;
+ if (reader->address_size == 4) {
+ return read_uint32(&p);
+ } else if (reader->address_size == 8) {
+ return read_uint64(&p);
+ } else {
+ fprintf(stderr,"unknown address_size:%d", reader->address_size);
+ abort();
+ }
+}
+
+static uintptr_t
+ranges_include(DebugInfoReader *reader, ranges_t *ptr, uint64_t addr, rnglists_header_t *rnglists_header)
+{
+ if (ptr->high_pc_set) {
+ if (ptr->ranges_set || !ptr->low_pc_set) {
+ exit(1);
+ }
+ if (ptr->low_pc <= addr && addr <= ptr->high_pc) {
+ return (uintptr_t)ptr->low_pc;
+ }
+ }
+ else if (ptr->ranges_set) {
+ /* TODO: support base address selection entry */
+ const char *p;
+ uint64_t base = ptr->low_pc_set ? ptr->low_pc : reader->current_low_pc;
+ bool base_valid = true;
+ if (reader->current_version >= 5) {
+ if (rnglists_header->offset_entry_count == 0) {
+ // DW_FORM_sec_offset
+ p = reader->obj->debug_rnglists.ptr + ptr->ranges + reader->current_rnglists_base;
+ }
+ else {
+ // DW_FORM_rnglistx
+ const char *offset_array = reader->obj->debug_rnglists.ptr + reader->current_rnglists_base;
+ if (rnglists_header->format == 4) {
+ p = offset_array + ((uint32_t *)offset_array)[ptr->ranges];
+ }
+ else {
+ p = offset_array + ((uint64_t *)offset_array)[ptr->ranges];
+ }
+ }
+ for (;;) {
+ uint8_t rle = read_uint8(&p);
+ uintptr_t from = 0, to = 0;
+ if (rle == DW_RLE_end_of_list) break;
+ switch (rle) {
+ case DW_RLE_base_addressx:
+ uleb128(&p);
+ base_valid = false; /* not supported yet */
+ break;
+ case DW_RLE_startx_endx:
+ uleb128(&p);
+ uleb128(&p);
+ break;
+ case DW_RLE_startx_length:
+ uleb128(&p);
+ uleb128(&p);
+ break;
+ case DW_RLE_offset_pair:
+ if (!base_valid) break;
+ from = (uintptr_t)base + uleb128(&p);
+ to = (uintptr_t)base + uleb128(&p);
+ break;
+ case DW_RLE_base_address:
+ base = read_dw_form_addr(reader, &p);
+ base_valid = true;
+ break;
+ case DW_RLE_start_end:
+ from = (uintptr_t)read_dw_form_addr(reader, &p);
+ to = (uintptr_t)read_dw_form_addr(reader, &p);
+ break;
+ case DW_RLE_start_length:
+ from = (uintptr_t)read_dw_form_addr(reader, &p);
+ to = from + uleb128(&p);
+ break;
+ }
+ if (from <= addr && addr < to) {
+ return from;
+ }
+ }
+ return false;
+ }
+ p = reader->obj->debug_ranges.ptr + ptr->ranges;
+ for (;;) {
+ uintptr_t from = read_uintptr(&p);
+ uintptr_t to = read_uintptr(&p);
+ if (!from && !to) break;
+ if (from == UINTPTR_MAX) {
+ /* base address selection entry */
+ base = to;
+ }
+ else if (base + from <= addr && addr < base + to) {
+ return (uintptr_t)base + from;
+ }
+ }
+ }
+ else if (ptr->low_pc_set) {
+ if (ptr->low_pc == addr) {
+ return (uintptr_t)ptr->low_pc;
+ }
+ }
+ return false;
+}
+
+#if 0
+static void
+ranges_inspect(DebugInfoReader *reader, ranges_t *ptr)
+{
+ if (ptr->high_pc_set) {
+ if (ptr->ranges_set || !ptr->low_pc_set) {
+ fprintf(stderr,"low_pc_set:%d high_pc_set:%d ranges_set:%d\n",ptr->low_pc_set,ptr->high_pc_set,ptr->ranges_set);
+ exit(1);
+ }
+ fprintf(stderr,"low_pc:%"PRIx64" high_pc:%"PRIx64"\n",ptr->low_pc,ptr->high_pc);
+ }
+ else if (ptr->ranges_set) {
+ char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
+ fprintf(stderr,"low_pc:%"PRIx64" ranges:%"PRIx64" %lx ",ptr->low_pc,ptr->ranges, p-reader->obj->mapped);
+ for (;;) {
+ uintptr_t from = read_uintptr(&p);
+ uintptr_t to = read_uintptr(&p);
+ if (!from && !to) break;
+ fprintf(stderr,"%"PRIx64"-%"PRIx64" ",ptr->low_pc+from,ptr->low_pc+to);
+ }
+ fprintf(stderr,"\n");
+ }
+ else if (ptr->low_pc_set) {
+ fprintf(stderr,"low_pc:%"PRIx64"\n",ptr->low_pc);
+ }
+ else {
+ fprintf(stderr,"empty\n");
+ }
+}
+#endif
+
+static int
+di_read_cu(DebugInfoReader *reader)
+{
+ uint64_t unit_length;
+ uint16_t version;
+ uint64_t debug_abbrev_offset;
+ reader->format = 4;
+ reader->current_cu = reader->p;
+ unit_length = read_uint32(&reader->p);
+ if (unit_length == 0xffffffff) {
+ unit_length = read_uint64(&reader->p);
+ reader->format = 8;
+ }
+ reader->cu_end = reader->p + unit_length;
+ version = read_uint16(&reader->p);
+ reader->current_version = version;
+ if (version > 5) {
+ return -1;
+ }
+ else if (version == 5) {
+ /* unit_type = */ read_uint8(&reader->p);
+ reader->address_size = read_uint8(&reader->p);
+ debug_abbrev_offset = read_uint(reader);
+ }
+ else {
+ debug_abbrev_offset = read_uint(reader);
+ reader->address_size = read_uint8(&reader->p);
+ }
+ reader->q0 = reader->obj->debug_abbrev.ptr + debug_abbrev_offset;
+
+ reader->level = 0;
+ di_read_debug_abbrev_cu(reader);
+ if (di_read_debug_line_cu(reader)) return -1;
+
+#if defined(__GNUC__) && !defined(__clang__) && !defined(__INTEL_COMPILER_BUILD_DATE)
+ /* Though DWARF specifies "the applicable base address defaults to the base
+ address of the compilation unit", but GCC seems to use zero as default */
+#else
+ do {
+ DIE die;
+
+ if (!di_read_die(reader, &die)) continue;
+
+ if (die.tag != DW_TAG_compile_unit) {
+ di_skip_records(reader);
+ break;
+ }
+
+ reader->current_str_offsets_base = 0;
+ reader->current_addr_base = 0;
+ reader->current_rnglists_base = 0;
+
+ DebugInfoValue low_pc = {{}};
+ /* enumerate abbrev */
+ for (;;) {
+ DebugInfoValue v = {{}};
+ if (!di_read_record(reader, &v)) break;
+ switch (v.at) {
+ case DW_AT_low_pc:
+ // clang may output DW_AT_addr_base after DW_AT_low_pc.
+ // We need to resolve the DW_FORM_addr* after DW_AT_addr_base is parsed.
+ low_pc = v;
+ break;
+ case DW_AT_str_offsets_base:
+ reader->current_str_offsets_base = v.as.uint64;
+ break;
+ case DW_AT_addr_base:
+ reader->current_addr_base = v.as.uint64;
+ break;
+ case DW_AT_rnglists_base:
+ reader->current_rnglists_base = v.as.uint64;
+ break;
+ }
+ }
+ // Resolve the DW_FORM_addr of DW_AT_low_pc
+ switch (low_pc.type) {
+ case VAL_uint:
+ reader->current_low_pc = low_pc.as.uint64;
+ break;
+ case VAL_addr:
+ {
+ addr_header_t header;
+ addr_header_init(reader->obj, &header);
+ reader->current_low_pc = read_addr(&header, reader->current_addr_base, low_pc.as.addr_idx);
+ }
+ break;
+ }
+ } while (0);
+#endif
+ return 0;
+}
+
+static void
+read_abstract_origin(DebugInfoReader *reader, uint64_t form, uint64_t abstract_origin, line_info_t *line)
+{
+ const char *p = reader->p;
+ const char *q = reader->q;
+ int level = reader->level;
+ DIE die;
+
+ switch (form) {
+ case DW_FORM_ref1:
+ case DW_FORM_ref2:
+ case DW_FORM_ref4:
+ case DW_FORM_ref8:
+ case DW_FORM_ref_udata:
+ reader->p = reader->current_cu + abstract_origin;
+ break;
+ case DW_FORM_ref_addr:
+ goto finish; /* not supported yet */
+ case DW_FORM_ref_sig8:
+ goto finish; /* not supported yet */
+ case DW_FORM_ref_sup4:
+ case DW_FORM_ref_sup8:
+ goto finish; /* not supported yet */
+ default:
+ goto finish;
+ }
+ if (!di_read_die(reader, &die)) goto finish;
+
+ /* enumerate abbrev */
+ for (;;) {
+ DebugInfoValue v = {{}};
+ if (!di_read_record(reader, &v)) break;
+ switch (v.at) {
+ case DW_AT_name:
+ line->sname = get_cstr_value(&v);
+ break;
+ }
+ }
+
+ finish:
+ reader->p = p;
+ reader->q = q;
+ reader->level = level;
+}
+
+static void
+debug_info_read(DebugInfoReader *reader, int num_traces, void **traces,
+ line_info_t *lines, int offset) {
+
+ addr_header_t addr_header = {};
+ addr_header_init(reader->obj, &addr_header);
+
+ rnglists_header_t rnglists_header = {};
+ rnglists_header_init(reader->obj, &rnglists_header);
+
+ while (reader->p < reader->cu_end) {
+ DIE die;
+ ranges_t ranges = {};
+ line_info_t line = {};
+
+ if (!di_read_die(reader, &die)) continue;
+ /* fprintf(stderr,"%d:%tx: <%d>\n",__LINE__,die.pos,reader->level,die.tag); */
+
+ if (die.tag != DW_TAG_subprogram && die.tag != DW_TAG_inlined_subroutine) {
+ skip_die:
+ di_skip_records(reader);
+ continue;
+ }
+
+ /* enumerate abbrev */
+ for (;;) {
+ DebugInfoValue v = {{}};
+ /* ptrdiff_t pos = reader->p - reader->p0; */
+ if (!di_read_record(reader, &v)) break;
+ /* fprintf(stderr,"\n%d:%tx: AT:%lx FORM:%lx\n",__LINE__,pos,v.at,v.form); */
+ /* div_inspect(&v); */
+ switch (v.at) {
+ case DW_AT_name:
+ line.sname = get_cstr_value(&v);
+ break;
+ case DW_AT_call_file:
+ fill_filename((int)v.as.uint64, reader->debug_line_format, reader->debug_line_version, reader->debug_line_directories, reader->debug_line_files, &line, reader->obj);
+ break;
+ case DW_AT_call_line:
+ line.line = (int)v.as.uint64;
+ break;
+ case DW_AT_low_pc:
+ case DW_AT_high_pc:
+ case DW_AT_ranges:
+ ranges_set(&ranges, &v, &addr_header, reader->current_addr_base);
+ break;
+ case DW_AT_declaration:
+ goto skip_die;
+ case DW_AT_inline:
+ /* 1 or 3 */
+ break; /* goto skip_die; */
+ case DW_AT_abstract_origin:
+ read_abstract_origin(reader, v.form, v.as.uint64, &line);
+ break; /* goto skip_die; */
+ }
+ }
+ /* ranges_inspect(reader, &ranges); */
+ /* fprintf(stderr,"%d:%tx: %x ",__LINE__,diepos,die.tag); */
+ for (int i=offset; i < num_traces; i++) {
+ uintptr_t addr = (uintptr_t)traces[i];
+ uintptr_t offset = addr - reader->obj->base_addr + reader->obj->vmaddr;
+ uintptr_t saddr = ranges_include(reader, &ranges, offset, &rnglists_header);
+ if (saddr) {
+ /* fprintf(stdout, "%d:%tx: %d %lx->%lx %x %s: %s/%s %d %s %s %s\n",__LINE__,die.pos, i,addr,offset, die.tag,line.sname,line.dirname,line.filename,line.line,reader->obj->path,line.sname,lines[i].sname); */
+ if (lines[i].sname) {
+ line_info_t *lp = malloc(sizeof(line_info_t));
+ memcpy(lp, &lines[i], sizeof(line_info_t));
+ lines[i].next = lp;
+ lp->dirname = line.dirname;
+ lp->filename = line.filename;
+ lp->line = line.line;
+ lp->saddr = 0;
+ }
+ lines[i].path = reader->obj->path;
+ lines[i].base_addr = line.base_addr;
+ lines[i].sname = line.sname;
+ lines[i].saddr = saddr + reader->obj->base_addr - reader->obj->vmaddr;
+ }
+ }
+ }
+}
+
+// This function parses the following attributes of Line Number Program Header in DWARF 5:
+//
+// * directory_entry_format_count
+// * directory_entry_format
+// * directories_count
+// * directories
+//
+// or
+//
+// * file_name_entry_format_count
+// * file_name_entry_format
+// * file_names_count
+// * file_names
+//
+// It records DW_LNCT_path and DW_LNCT_directory_index at the index "idx".
+static const char *
+parse_ver5_debug_line_header(const char *p, int idx, uint8_t format, obj_info_t *obj, const char **out_path, uint64_t *out_directory_index) {
+ int i, j;
+ int entry_format_count = *(uint8_t *)p++;
+ const char *entry_format = p;
+
+ /* skip the part of entry_format */
+ for (i = 0; i < entry_format_count * 2; i++) uleb128(&p);
+
+ int entry_count = (int)uleb128(&p);
+
+ DebugInfoReader reader;
+ debug_info_reader_init(&reader, obj);
+ reader.format = format;
+ reader.p = p;
+ for (j = 0; j < entry_count; j++) {
+ const char *format = entry_format;
+ for (i = 0; i < entry_format_count; i++) {
+ DebugInfoValue v = {{}};
+ unsigned long dw_lnct = uleb128(&format);
+ unsigned long dw_form = uleb128(&format);
+ debug_info_reader_read_value(&reader, dw_form, &v);
+ if (dw_lnct == 1 /* DW_LNCT_path */ && v.type == VAL_cstr && out_path)
+ *out_path = v.as.ptr + v.off;
+ if (dw_lnct == 2 /* DW_LNCT_directory_index */ && v.type == VAL_uint && out_directory_index)
+ *out_directory_index = v.as.uint64;
+ }
+ if (j == idx) return 0;
+ }
+
+ return reader.p;
+}
+
+#ifdef USE_ELF
+static unsigned long
+uncompress_debug_section(ElfW(Shdr) *shdr, char *file, char **ptr)
+{
+ *ptr = NULL;
+#ifdef SUPPORT_COMPRESSED_DEBUG_LINE
+ ElfW(Chdr) *chdr = (ElfW(Chdr) *)(file + shdr->sh_offset);
+ unsigned long destsize = chdr->ch_size;
+ int ret = 0;
+
+ if (chdr->ch_type != ELFCOMPRESS_ZLIB) {
+ /* unsupported compression type */
+ return 0;
+ }
+
+ *ptr = malloc(destsize);
+ if (!*ptr) return 0;
+ ret = uncompress((Bytef *)*ptr, &destsize,
+ (const Bytef*)chdr + sizeof(ElfW(Chdr)),
+ shdr->sh_size - sizeof(ElfW(Chdr)));
+ if (ret != Z_OK) goto fail;
+ return destsize;
+
+fail:
+ free(*ptr);
+ *ptr = NULL;
+#endif
+ return 0;
+}
+
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+ obj_info_t **objp, line_info_t *lines, int offset)
+{
+ int i, j;
char *shstr;
- char *section_name;
ElfW(Ehdr) *ehdr;
ElfW(Shdr) *shdr, *shstr_shdr;
- ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
+ ElfW(Shdr) *gnu_debuglink_shdr = NULL;
+ ElfW(Shdr) *note_gnu_build_id = NULL;
int fd;
off_t filesize;
char *file;
+ ElfW(Shdr) *symtab_shdr = NULL, *strtab_shdr = NULL;
+ ElfW(Shdr) *dynsym_shdr = NULL, *dynstr_shdr = NULL;
+ obj_info_t *obj = *objp;
+ uintptr_t dladdr_fbase = 0;
fd = open(binary_filename, O_RDONLY);
if (fd < 0) {
- return;
+ goto fail;
}
filesize = lseek(fd, 0, SEEK_END);
+ if (filesize < 0) {
+ int e = errno;
+ close(fd);
+ kprintf("lseek: %s\n", strerror(e));
+ goto fail;
+ }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+ if (filesize > (off_t)SIZE_MAX) {
+ close(fd);
+ kprintf("Too large file %s\n", binary_filename);
+ goto fail;
+ }
+#endif
lseek(fd, 0, SEEK_SET);
/* async-signal unsafe */
- file = (char *)mmap(NULL, filesize, PROT_READ, MAP_SHARED, fd, 0);
+ file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
if (file == MAP_FAILED) {
int e = errno;
close(fd);
- fprintf(stderr, "mmap: %s\n", strerror(e));
- return;
+ kprintf("mmap: %s\n", strerror(e));
+ goto fail;
}
+ close(fd);
- current_line->fd = fd;
- current_line->mapped = file;
- current_line->mapped_size = filesize;
-
- for (i = 0; i < num_traces; i++) {
- const char *path;
- size_t len;
- if (get_path_from_symbol(syms[i], &path, &len) &&
- !strncmp(path, binary_filename, len)) {
- lines[i].line = -1;
- }
+ ehdr = (ElfW(Ehdr) *)file;
+ if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
+ /*
+ * Huh? Maybe filename was overridden by setproctitle() and
+ * it match non-elf file.
+ */
+ goto fail;
}
+ obj->mapped = file;
+ obj->mapped_size = (size_t)filesize;
- ehdr = (ElfW(Ehdr) *)file;
shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
shstr_shdr = shdr + ehdr->e_shstrndx;
shstr = file + shstr_shdr->sh_offset;
for (i = 0; i < ehdr->e_shnum; i++) {
- section_name = shstr + shdr[i].sh_name;
- if (!strcmp(section_name, ".debug_line")) {
- debug_line_shdr = shdr + i;
+ char *section_name = shstr + shdr[i].sh_name;
+ switch (shdr[i].sh_type) {
+ case SHT_STRTAB:
+ if (!strcmp(section_name, ".strtab")) {
+ strtab_shdr = shdr + i;
+ }
+ else if (!strcmp(section_name, ".dynstr")) {
+ dynstr_shdr = shdr + i;
+ }
+ break;
+ case SHT_SYMTAB:
+ /* if (!strcmp(section_name, ".symtab")) */
+ symtab_shdr = shdr + i;
+ break;
+ case SHT_DYNSYM:
+ /* if (!strcmp(section_name, ".dynsym")) */
+ dynsym_shdr = shdr + i;
+ break;
+ case SHT_NOTE:
+ if (!strcmp(section_name, ".note.gnu.build-id")) {
+ note_gnu_build_id = shdr + i;
+ }
+ break;
+ case SHT_PROGBITS:
+ if (!strcmp(section_name, ".gnu_debuglink")) {
+ gnu_debuglink_shdr = shdr + i;
+ }
+ else {
+ const char *debug_section_names[] = {
+ ".debug_abbrev",
+ ".debug_info",
+ ".debug_line",
+ ".debug_ranges",
+ ".debug_str_offsets",
+ ".debug_addr",
+ ".debug_rnglists",
+ ".debug_str",
+ ".debug_line_str"
+ };
+
+ for (j=0; j < DWARF_SECTION_COUNT; j++) {
+ struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+ if (strcmp(section_name, debug_section_names[j]) != 0)
+ continue;
+
+ s->ptr = file + shdr[i].sh_offset;
+ s->size = shdr[i].sh_size;
+ s->flags = shdr[i].sh_flags;
+ if (s->flags & SHF_COMPRESSED) {
+ s->size = uncompress_debug_section(&shdr[i], file, &s->ptr);
+ if (!s->size) goto fail;
+ }
+ break;
+ }
+ }
break;
- } else if (!strcmp(section_name, ".gnu_debuglink")) {
- gnu_debuglink_shdr = shdr + i;
}
}
- if (!debug_line_shdr) {
+ if (offset == -1) {
+ /* main executable */
+ offset = 0;
+ if (dynsym_shdr && dynstr_shdr) {
+ char *strtab = file + dynstr_shdr->sh_offset;
+ ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
+ int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
+ void *handle = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+ if (handle) {
+ for (j = 0; j < symtab_count; j++) {
+ ElfW(Sym) *sym = &symtab[j];
+ Dl_info info;
+ void *s;
+ if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size == 0) continue;
+ s = dlsym(handle, strtab + sym->st_name);
+ if (s && dladdr(s, &info)) {
+ obj->base_addr = dladdr_fbase;
+ dladdr_fbase = (uintptr_t)info.dli_fbase;
+ break;
+ }
+ }
+ dlclose(handle);
+ }
+ if (ehdr->e_type == ET_EXEC) {
+ obj->base_addr = 0;
+ }
+ else {
+ /* PIE (position-independent executable) */
+ obj->base_addr = dladdr_fbase;
+ }
+ }
+ }
+
+ if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+ DebugInfoReader reader;
+ debug_info_reader_init(&reader, obj);
+ i = 0;
+ while (reader.p < reader.pend) {
+ /* fprintf(stderr, "%d:%tx: CU[%d]\n", __LINE__, reader.p - reader.obj->debug_info.ptr, i++); */
+ if (di_read_cu(&reader)) goto use_symtab;
+ debug_info_read(&reader, num_traces, traces, lines, offset);
+ }
+ }
+ else {
+ /* This file doesn't have dwarf, use symtab or dynsym */
+use_symtab:
+ if (!symtab_shdr) {
+ /* This file doesn't have symtab, use dynsym instead */
+ symtab_shdr = dynsym_shdr;
+ strtab_shdr = dynstr_shdr;
+ }
+
+ if (symtab_shdr && strtab_shdr) {
+ char *strtab = file + strtab_shdr->sh_offset;
+ ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+ int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+ for (j = 0; j < symtab_count; j++) {
+ ElfW(Sym) *sym = &symtab[j];
+ uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+ if (ELF_ST_TYPE(sym->st_info) != STT_FUNC) continue;
+ for (i = offset; i < num_traces; i++) {
+ uintptr_t d = (uintptr_t)traces[i] - saddr;
+ if (lines[i].line > 0 || d > (uintptr_t)sym->st_size)
+ continue;
+ /* fill symbol name and addr from .symtab */
+ if (!lines[i].sname) lines[i].sname = strtab + sym->st_name;
+ lines[i].saddr = saddr;
+ lines[i].path = obj->path;
+ lines[i].base_addr = obj->base_addr;
+ }
+ }
+ }
+ }
+
+ if (!obj->debug_line.ptr) {
/* This file doesn't have .debug_line section,
let's check .gnu_debuglink section instead. */
if (gnu_debuglink_shdr && check_debuglink) {
follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
- num_traces, traces, syms,
- current_line, lines);
+ num_traces, traces,
+ objp, lines, offset);
}
- return;
+ if (note_gnu_build_id && check_debuglink) {
+ ElfW(Nhdr) *nhdr = (ElfW(Nhdr)*) (file + note_gnu_build_id->sh_offset);
+ const char *build_id = (char *)(nhdr + 1) + nhdr->n_namesz;
+ follow_debuglink_build_id(build_id, nhdr->n_descsz,
+ num_traces, traces,
+ objp, lines, offset);
+ }
+ goto finish;
}
- parse_debug_line(num_traces, traces,
- file + debug_line_shdr->sh_offset,
- debug_line_shdr->sh_size,
- lines);
+ if (parse_debug_line(num_traces, traces,
+ obj->debug_line.ptr,
+ obj->debug_line.size,
+ obj, lines, offset) == -1)
+ goto fail;
+
+finish:
+ return dladdr_fbase;
+fail:
+ return (uintptr_t)-1;
}
+#else /* Mach-O */
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+ obj_info_t **objp, line_info_t *lines, int offset)
+{
+# ifdef __LP64__
+# define LP(x) x##_64
+# else
+# define LP(x) x
+# endif
+ int fd;
+ off_t filesize;
+ char *file, *p = NULL;
+ obj_info_t *obj = *objp;
+ struct LP(mach_header) *header;
+ uintptr_t dladdr_fbase = 0;
+
+ {
+ char *s = binary_filename;
+ char *base = strrchr(binary_filename, '/')+1;
+ size_t max = PATH_MAX;
+ size_t size = strlen(binary_filename);
+ size_t basesize = size - (base - binary_filename);
+ s += size;
+ max -= size;
+ p = s;
+ size = strlcpy(s, ".dSYM/Contents/Resources/DWARF/", max);
+ if (size == 0) goto fail;
+ s += size;
+ max -= size;
+ if (max <= basesize) goto fail;
+ memcpy(s, base, basesize);
+ s[basesize] = 0;
+
+ fd = open(binary_filename, O_RDONLY);
+ if (fd < 0) {
+ *p = 0; /* binary_filename becomes original file name */
+ fd = open(binary_filename, O_RDONLY);
+ if (fd < 0) {
+ goto fail;
+ }
+ }
+ }
-#ifdef HAVE_DL_ITERATE_PHDR
+ filesize = lseek(fd, 0, SEEK_END);
+ if (filesize < 0) {
+ int e = errno;
+ close(fd);
+ kprintf("lseek: %s\n", strerror(e));
+ goto fail;
+ }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+ if (filesize > (off_t)SIZE_MAX) {
+ close(fd);
+ kprintf("Too large file %s\n", binary_filename);
+ goto fail;
+ }
+#endif
+ lseek(fd, 0, SEEK_SET);
+ /* async-signal unsafe */
+ file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+ if (file == MAP_FAILED) {
+ int e = errno;
+ close(fd);
+ kprintf("mmap: %s\n", strerror(e));
+ goto fail;
+ }
+ close(fd);
-typedef struct {
- int num_traces;
- char **syms;
- line_info_t *lines;
-} fill_base_addr_state_t;
+ obj->mapped = file;
+ obj->mapped_size = (size_t)filesize;
-static int
-fill_base_addr(struct dl_phdr_info *info, size_t size, void *data)
+ header = (struct LP(mach_header) *)file;
+ if (header->magic == LP(MH_MAGIC)) {
+ /* non universal binary */
+ p = file;
+ }
+ else if (header->magic == FAT_CIGAM) {
+ struct LP(mach_header) *mhp = _NSGetMachExecuteHeader();
+ struct fat_header *fat = (struct fat_header *)file;
+ char *q = file + sizeof(*fat);
+ uint32_t nfat_arch = __builtin_bswap32(fat->nfat_arch);
+ /* fprintf(stderr,"%d: fat:%s %d\n",__LINE__, binary_filename,nfat_arch); */
+ for (uint32_t i = 0; i < nfat_arch; i++) {
+ struct fat_arch *arch = (struct fat_arch *)q;
+ cpu_type_t cputype = __builtin_bswap32(arch->cputype);
+ cpu_subtype_t cpusubtype = __builtin_bswap32(arch->cpusubtype);
+ uint32_t offset = __builtin_bswap32(arch->offset);
+ /* fprintf(stderr,"%d: fat %d %x/%x %x/%x\n",__LINE__, i, mhp->cputype,mhp->cpusubtype, cputype,cpusubtype); */
+ if (mhp->cputype == cputype &&
+ (cpu_subtype_t)(mhp->cpusubtype & ~CPU_SUBTYPE_MASK) == cpusubtype) {
+ p = file + offset;
+ file = p;
+ header = (struct LP(mach_header) *)p;
+ if (header->magic == LP(MH_MAGIC)) {
+ goto found_mach_header;
+ }
+ break;
+ }
+ q += sizeof(*arch);
+ }
+ kprintf("'%s' is not a Mach-O universal binary file!\n",binary_filename);
+ close(fd);
+ goto fail;
+ }
+ else {
+ kprintf("'%s' is not a "
+# ifdef __LP64__
+ "64"
+# else
+ "32"
+# endif
+ "-bit Mach-O file!\n",binary_filename);
+ close(fd);
+ goto fail;
+ }
+found_mach_header:
+ p += sizeof(*header);
+
+ for (uint32_t i = 0; i < (uint32_t)header->ncmds; i++) {
+ struct load_command *lcmd = (struct load_command *)p;
+ switch (lcmd->cmd) {
+ case LP(LC_SEGMENT):
+ {
+ static const char *debug_section_names[] = {
+ "__debug_abbrev",
+ "__debug_info",
+ "__debug_line",
+ "__debug_ranges",
+ "__debug_str_offsets",
+ "__debug_addr",
+ "__debug_rnglists",
+ "__debug_str",
+ "__debug_line_str",
+ };
+ struct LP(segment_command) *scmd = (struct LP(segment_command) *)lcmd;
+ if (strcmp(scmd->segname, "__TEXT") == 0) {
+ obj->vmaddr = scmd->vmaddr;
+ }
+ else if (strcmp(scmd->segname, "__DWARF") == 0) {
+ p += sizeof(struct LP(segment_command));
+ for (uint64_t i = 0; i < scmd->nsects; i++) {
+ struct LP(section) *sect = (struct LP(section) *)p;
+ p += sizeof(struct LP(section));
+ for (int j=0; j < DWARF_SECTION_COUNT; j++) {
+ struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+ if (strcmp(sect->sectname, debug_section_names[j]) != 0)
+ continue;
+
+ s->ptr = file + sect->offset;
+ s->size = sect->size;
+ s->flags = sect->flags;
+ if (s->flags & SHF_COMPRESSED) {
+ goto fail;
+ }
+ break;
+ }
+ }
+ }
+ }
+ break;
+
+ case LC_SYMTAB:
+ {
+ struct symtab_command *cmd = (struct symtab_command *)lcmd;
+ struct LP(nlist) *nl = (struct LP(nlist) *)(file + cmd->symoff);
+ char *strtab = file + cmd->stroff, *sname = 0;
+ uint32_t j;
+ uintptr_t saddr = 0;
+ /* kprintf("[%2d]: %x/symtab %p\n", i, cmd->cmd, (void *)p); */
+ for (j = 0; j < cmd->nsyms; j++) {
+ uintptr_t symsize, d;
+ struct LP(nlist) *e = &nl[j];
+ /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+ if (e->n_type != N_FUN) continue;
+ if (e->n_sect) {
+ saddr = (uintptr_t)e->n_value + obj->base_addr - obj->vmaddr;
+ sname = strtab + e->n_un.n_strx;
+ /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+ continue;
+ }
+ for (int k = offset; k < num_traces; k++) {
+ d = (uintptr_t)traces[k] - saddr;
+ symsize = e->n_value;
+ /* kprintf("%lx %lx %lx\n",saddr,symsize,traces[k]); */
+ if (lines[k].line > 0 || d > (uintptr_t)symsize)
+ continue;
+ /* fill symbol name and addr from .symtab */
+ if (!lines[k].sname) lines[k].sname = sname;
+ lines[k].saddr = saddr;
+ lines[k].path = obj->path;
+ lines[k].base_addr = obj->base_addr;
+ }
+ }
+ }
+ }
+ p += lcmd->cmdsize;
+ }
+
+ if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+ DebugInfoReader reader;
+ debug_info_reader_init(&reader, obj);
+ while (reader.p < reader.pend) {
+ if (di_read_cu(&reader)) goto fail;
+ debug_info_read(&reader, num_traces, traces, lines, offset);
+ }
+ }
+
+ if (parse_debug_line(num_traces, traces,
+ obj->debug_line.ptr,
+ obj->debug_line.size,
+ obj, lines, offset) == -1)
+ goto fail;
+
+ return dladdr_fbase;
+fail:
+ return (uintptr_t)-1;
+}
+#endif
+
+#define HAVE_MAIN_EXE_PATH
+#if defined(__FreeBSD__) || defined(__DragonFly__)
+# include <sys/sysctl.h>
+#endif
+/* ssize_t main_exe_path(void)
+ *
+ * store the path of the main executable to `binary_filename`,
+ * and returns strlen(binary_filename).
+ * it is NUL terminated.
+ */
+#if defined(__linux__) || defined(__NetBSD__)
+static ssize_t
+main_exe_path(void)
{
- int i;
- fill_base_addr_state_t *st = (fill_base_addr_state_t *)data;
- for (i = 0; i < st->num_traces; i++) {
- const char *path;
- size_t len;
- size_t name_len = strlen(info->dlpi_name);
-
- if (get_path_from_symbol(st->syms[i], &path, &len) &&
- (len == name_len || (len > name_len && path[len-name_len-1] == '/')) &&
- !strncmp(path+len-name_len, info->dlpi_name, name_len)) {
- st->lines[i].base_addr = info->dlpi_addr;
- }
+# if defined(__linux__)
+# define PROC_SELF_EXE "/proc/self/exe"
+# elif defined(__NetBSD__)
+# define PROC_SELF_EXE "/proc/curproc/exe"
+# endif
+ ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
+ if (len < 0) return 0;
+ binary_filename[len] = 0;
+ return len;
+}
+#elif defined(__FreeBSD__) || defined(__DragonFly__)
+static ssize_t
+main_exe_path(void)
+{
+ int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
+ size_t len = PATH_MAX;
+ int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
+ if (err) {
+ kprintf("Can't get the path of ruby");
+ return -1;
+ }
+ len--; /* sysctl sets strlen+1 */
+ return len;
+}
+#elif defined(HAVE_LIBPROC_H)
+static ssize_t
+main_exe_path(void)
+{
+ int len = proc_pidpath(getpid(), binary_filename, PATH_MAX);
+ if (len == 0) return 0;
+ binary_filename[len] = 0;
+ return len;
+}
+#else
+#undef HAVE_MAIN_EXE_PATH
+#endif
+
+static void
+print_line0(line_info_t *line, void *address)
+{
+ uintptr_t addr = (uintptr_t)address;
+ uintptr_t d = addr - line->saddr;
+ if (!address) {
+ /* inlined */
+ if (line->dirname && line->dirname[0]) {
+ kprintf("%s(%s) %s/%s:%d\n", line->path, line->sname, line->dirname, line->filename, line->line);
+ }
+ else {
+ kprintf("%s(%s) %s:%d\n", line->path, line->sname, line->filename, line->line);
+ }
+ }
+ else if (!line->path) {
+ kprintf("[0x%"PRIxPTR"]\n", addr);
+ }
+ else if (!line->sname) {
+ kprintf("%s(0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, addr-line->base_addr, addr);
+ }
+ else if (!line->saddr) {
+ kprintf("%s(%s) [0x%"PRIxPTR"]\n", line->path, line->sname, addr);
+ }
+ else if (line->line <= 0) {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, line->sname,
+ d, addr);
+ }
+ else if (!line->filename) {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] ???:%d\n", line->path, line->sname,
+ d, addr, line->line);
+ }
+ else if (line->dirname && line->dirname[0]) {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s/%s:%d\n", line->path, line->sname,
+ d, addr, line->dirname, line->filename, line->line);
+ }
+ else {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s:%d\n", line->path, line->sname,
+ d, addr, line->filename, line->line);
}
- return 0;
}
-#endif /* HAVE_DL_ITERATE_PHDR */
+static void
+print_line(line_info_t *line, void *address)
+{
+ print_line0(line, address);
+ if (line->next) {
+ print_line(line->next, NULL);
+ }
+}
void
-rb_dump_backtrace_with_lines(int num_traces, void **trace, char **syms)
+rb_dump_backtrace_with_lines(int num_traces, void **traces)
{
int i;
/* async-signal unsafe */
- line_info_t *lines = (line_info_t *)calloc(num_traces,
- sizeof(line_info_t));
-
- /* Note that line info of shared objects might not be shown
- if we don't have dl_iterate_phdr */
-#ifdef HAVE_DL_ITERATE_PHDR
- fill_base_addr_state_t fill_base_addr_state;
-
- fill_base_addr_state.num_traces = num_traces;
- fill_base_addr_state.syms = syms;
- fill_base_addr_state.lines = lines;
- /* maybe async-signal unsafe */
- dl_iterate_phdr(fill_base_addr, &fill_base_addr_state);
-#endif /* HAVE_DL_ITERATE_PHDR */
-
- for (i = 0; i < num_traces; i++) {
- const char *path;
- size_t len;
- if (lines[i].line) {
- continue;
- }
-
- if (!get_path_from_symbol(syms[i], &path, &len)) {
- continue;
+ line_info_t *lines = (line_info_t *)calloc(num_traces, sizeof(line_info_t));
+ obj_info_t *obj = NULL;
+ /* 2 is NULL + main executable */
+ void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
+
+#ifdef HAVE_MAIN_EXE_PATH
+ char *main_path = NULL; /* used on printing backtrace */
+ ssize_t len;
+ if ((len = main_exe_path()) > 0) {
+ main_path = (char *)alloca(len + 1);
+ if (main_path) {
+ uintptr_t addr;
+ memcpy(main_path, binary_filename, len+1);
+ append_obj(&obj);
+ obj->path = main_path;
+ addr = fill_lines(num_traces, traces, 1, &obj, lines, -1);
+ if (addr != (uintptr_t)-1) {
+ dladdr_fbases[0] = (void *)addr;
+ }
}
-
- strncpy(binary_filename, path, len);
- binary_filename[len] = '\0';
-
- fill_lines(num_traces, trace, syms, 1, &lines[i], lines);
}
+#endif
- /* fprintf may not be async-signal safe */
+ /* fill source lines by reading dwarf */
for (i = 0; i < num_traces; i++) {
- line_info_t *line = &lines[i];
-
- if (line->line > 0) {
- fprintf(stderr, "%s ", syms[i]);
- if (line->filename) {
- if (line->dirname && line->dirname[0]) {
- fprintf(stderr, "%s/", line->dirname);
+ Dl_info info;
+ if (lines[i].line) continue;
+ if (dladdr(traces[i], &info)) {
+ const char *path;
+ void **p;
+
+ /* skip symbols which is in already checked objects */
+ /* if the binary is strip-ed, this may effect */
+ for (p=dladdr_fbases; *p; p++) {
+ if (*p == info.dli_fbase) {
+ if (info.dli_fname) lines[i].path = info.dli_fname;
+ if (info.dli_sname) lines[i].sname = info.dli_sname;
+ goto next_line;
}
- fprintf(stderr, "%s", line->filename);
- } else {
- fprintf(stderr, "???");
}
- fprintf(stderr, ":%d\n", line->line);
- } else {
- fprintf(stderr, "%s\n", syms[i]);
+ *p = info.dli_fbase;
+
+ append_obj(&obj);
+ obj->base_addr = (uintptr_t)info.dli_fbase;
+ path = info.dli_fname;
+ obj->path = path;
+ if (path) lines[i].path = path;
+ if (info.dli_sname) {
+ lines[i].sname = info.dli_sname;
+ lines[i].saddr = (uintptr_t)info.dli_saddr;
+ }
+ strlcpy(binary_filename, path, PATH_MAX);
+ if (fill_lines(num_traces, traces, 1, &obj, lines, i) == (uintptr_t)-1)
+ break;
}
+next_line:
+ continue;
}
+ /* output */
for (i = 0; i < num_traces; i++) {
- line_info_t *line = &lines[i];
- if (line->fd) {
- munmap(line->mapped, line->mapped_size);
- close(line->fd);
+ print_line(&lines[i], traces[i]);
+
+ /* FreeBSD's backtrace may show _start and so on */
+ if (lines[i].sname && strcmp("main", lines[i].sname) == 0)
+ break;
+ }
+
+ /* free */
+ while (obj) {
+ obj_info_t *o = obj;
+ for (i=0; i < DWARF_SECTION_COUNT; i++) {
+ struct dwarf_section *s = obj_dwarf_section_at(obj, i);
+ if (s->flags & SHF_COMPRESSED) {
+ free(s->ptr);
+ }
+ }
+ if (obj->mapped_size) {
+ munmap(obj->mapped, obj->mapped_size);
}
+ obj = o->next;
+ free(o);
+ }
+ for (i = 0; i < num_traces; i++) {
+ line_info_t *line = lines[i].next;
+ while (line) {
+ line_info_t *l = line;
+ line = line->next;
+ free(l);
+ }
}
free(lines);
+ free(dladdr_fbases);
+}
+
+/* From FreeBSD's lib/libstand/printf.c */
+/*-
+ * Copyright (c) 1986, 1988, 1991, 1993
+ * The Regents of the University of California. All rights reserved.
+ * (c) UNIX System Laboratories, Inc.
+ * All or some portions of this file are derived from material licensed
+ * to the University of California by American Telephone and Telegraph
+ * Co. or Unix System Laboratories, Inc. and are reproduced herein with
+ * the permission of UNIX System Laboratories, Inc.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ * notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ * notice, this list of conditions and the following disclaimer in the
+ * documentation and/or other materials provided with the distribution.
+ * 4. Neither the name of the University nor the names of its contributors
+ * may be used to endorse or promote products derived from this software
+ * without specific prior written permission.
+ *
+ * THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ * ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ * SUCH DAMAGE.
+ *
+ * @(#)subr_prf.c 8.3 (Berkeley) 1/21/94
+ */
+
+#include <stdarg.h>
+#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
+static inline int toupper(int c) { return ('A' <= c && c <= 'Z') ? (c&0x5f) : c; }
+#define hex2ascii(hex) (hex2ascii_data[hex])
+static const char hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
+static inline int imax(int a, int b) { return (a > b ? a : b); }
+static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
+
+static void putce(int c)
+{
+ char s[1];
+ ssize_t ret;
+
+ s[0] = (char)c;
+ ret = write(2, s, 1);
+ (void)ret;
+}
+
+static int
+kprintf(const char *fmt, ...)
+{
+ va_list ap;
+ int retval;
+
+ va_start(ap, fmt);
+ retval = kvprintf(fmt, putce, NULL, 10, ap);
+ va_end(ap);
+ return retval;
}
-#else /* defined(__ELF__) */
+/*
+ * Put a NUL-terminated ASCII number (base <= 36) in a buffer in reverse
+ * order; return an optional length and a pointer to the last character
+ * written in the buffer (i.e., the first character of the string).
+ * The buffer pointed to by `nbuf' must have length >= MAXNBUF.
+ */
+static char *
+ksprintn(char *nbuf, uintmax_t num, int base, int *lenp, int upper)
+{
+ char *p, c;
+
+ p = nbuf;
+ *p = '\0';
+ do {
+ c = hex2ascii(num % base);
+ *++p = upper ? toupper(c) : c;
+ } while (num /= base);
+ if (lenp)
+ *lenp = (int)(p - nbuf);
+ return (p);
+}
+
+/*
+ * Scaled down version of printf(3).
+ *
+ * Two additional formats:
+ *
+ * The format %b is supported to decode error registers.
+ * Its usage is:
+ *
+ * printf("reg=%b\n", regval, "<base><arg>*");
+ *
+ * where <base> is the output base expressed as a control character, e.g.
+ * \10 gives octal; \20 gives hex. Each arg is a sequence of characters,
+ * the first of which gives the bit number to be inspected (origin 1), and
+ * the next characters (up to a control character, i.e. a character <= 32),
+ * give the name of the register. Thus:
+ *
+ * kvprintf("reg=%b\n", 3, "\10\2BITTWO\1BITONE\n");
+ *
+ * would produce output:
+ *
+ * reg=3<BITTWO,BITONE>
+ *
+ * XXX: %D -- Hexdump, takes pointer and separator string:
+ * ("%6D", ptr, ":") -> XX:XX:XX:XX:XX:XX
+ * ("%*D", len, ptr, " " -> XX XX XX XX ...
+ */
+static int
+kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap)
+{
+#define PCHAR(c) {int cc=(c); if (func) (*func)(cc); else *d++ = cc; retval++; }
+ char nbuf[MAXNBUF];
+ char *d;
+ const char *p, *percent, *q;
+ unsigned char *up;
+ int ch, n;
+ uintmax_t num;
+ int base, lflag, qflag, tmp, width, ladjust, sharpflag, neg, sign, dot;
+ int cflag, hflag, jflag, tflag, zflag;
+ int dwidth, upper;
+ char padc;
+ int stop = 0, retval = 0;
+
+ num = 0;
+ if (!func)
+ d = (char *) arg;
+ else
+ d = NULL;
+
+ if (fmt == NULL)
+ fmt = "(fmt null)\n";
+
+ if (radix < 2 || radix > 36)
+ radix = 10;
+
+ for (;;) {
+ padc = ' ';
+ width = 0;
+ while ((ch = (unsigned char)*fmt++) != '%' || stop) {
+ if (ch == '\0')
+ return (retval);
+ PCHAR(ch);
+ }
+ percent = fmt - 1;
+ qflag = 0; lflag = 0; ladjust = 0; sharpflag = 0; neg = 0;
+ sign = 0; dot = 0; dwidth = 0; upper = 0;
+ cflag = 0; hflag = 0; jflag = 0; tflag = 0; zflag = 0;
+reswitch: switch (ch = (unsigned char)*fmt++) {
+ case '.':
+ dot = 1;
+ goto reswitch;
+ case '#':
+ sharpflag = 1;
+ goto reswitch;
+ case '+':
+ sign = 1;
+ goto reswitch;
+ case '-':
+ ladjust = 1;
+ goto reswitch;
+ case '%':
+ PCHAR(ch);
+ break;
+ case '*':
+ if (!dot) {
+ width = va_arg(ap, int);
+ if (width < 0) {
+ ladjust = !ladjust;
+ width = -width;
+ }
+ } else {
+ dwidth = va_arg(ap, int);
+ }
+ goto reswitch;
+ case '0':
+ if (!dot) {
+ padc = '0';
+ goto reswitch;
+ }
+ case '1': case '2': case '3': case '4':
+ case '5': case '6': case '7': case '8': case '9':
+ for (n = 0;; ++fmt) {
+ n = n * 10 + ch - '0';
+ ch = *fmt;
+ if (ch < '0' || ch > '9')
+ break;
+ }
+ if (dot)
+ dwidth = n;
+ else
+ width = n;
+ goto reswitch;
+ case 'b':
+ num = (unsigned int)va_arg(ap, int);
+ p = va_arg(ap, char *);
+ for (q = ksprintn(nbuf, num, *p++, NULL, 0); *q;)
+ PCHAR(*q--);
+
+ if (num == 0)
+ break;
+
+ for (tmp = 0; *p;) {
+ n = *p++;
+ if (num & (1 << (n - 1))) {
+ PCHAR(tmp ? ',' : '<');
+ for (; (n = *p) > ' '; ++p)
+ PCHAR(n);
+ tmp = 1;
+ } else
+ for (; *p > ' '; ++p)
+ continue;
+ }
+ if (tmp)
+ PCHAR('>');
+ break;
+ case 'c':
+ PCHAR(va_arg(ap, int));
+ break;
+ case 'D':
+ up = va_arg(ap, unsigned char *);
+ p = va_arg(ap, char *);
+ if (!width)
+ width = 16;
+ while(width--) {
+ PCHAR(hex2ascii(*up >> 4));
+ PCHAR(hex2ascii(*up & 0x0f));
+ up++;
+ if (width)
+ for (q=p;*q;q++)
+ PCHAR(*q);
+ }
+ break;
+ case 'd':
+ case 'i':
+ base = 10;
+ sign = 1;
+ goto handle_sign;
+ case 'h':
+ if (hflag) {
+ hflag = 0;
+ cflag = 1;
+ } else
+ hflag = 1;
+ goto reswitch;
+ case 'j':
+ jflag = 1;
+ goto reswitch;
+ case 'l':
+ if (lflag) {
+ lflag = 0;
+ qflag = 1;
+ } else
+ lflag = 1;
+ goto reswitch;
+ case 'n':
+ if (jflag)
+ *(va_arg(ap, intmax_t *)) = retval;
+ else if (qflag)
+ *(va_arg(ap, int64_t *)) = retval;
+ else if (lflag)
+ *(va_arg(ap, long *)) = retval;
+ else if (zflag)
+ *(va_arg(ap, size_t *)) = retval;
+ else if (hflag)
+ *(va_arg(ap, short *)) = retval;
+ else if (cflag)
+ *(va_arg(ap, char *)) = retval;
+ else
+ *(va_arg(ap, int *)) = retval;
+ break;
+ case 'o':
+ base = 8;
+ goto handle_nosign;
+ case 'p':
+ base = 16;
+ sharpflag = (width == 0);
+ sign = 0;
+ num = (uintptr_t)va_arg(ap, void *);
+ goto number;
+ case 'q':
+ qflag = 1;
+ goto reswitch;
+ case 'r':
+ base = radix;
+ if (sign)
+ goto handle_sign;
+ goto handle_nosign;
+ case 's':
+ p = va_arg(ap, char *);
+ if (p == NULL)
+ p = "(null)";
+ if (!dot)
+ n = (int)strlen (p);
+ else
+ for (n = 0; n < dwidth && p[n]; n++)
+ continue;
+
+ width -= n;
+
+ if (!ladjust && width > 0)
+ while (width--)
+ PCHAR(padc);
+ while (n--)
+ PCHAR(*p++);
+ if (ladjust && width > 0)
+ while (width--)
+ PCHAR(padc);
+ break;
+ case 't':
+ tflag = 1;
+ goto reswitch;
+ case 'u':
+ base = 10;
+ goto handle_nosign;
+ case 'X':
+ upper = 1;
+ case 'x':
+ base = 16;
+ goto handle_nosign;
+ case 'y':
+ base = 16;
+ sign = 1;
+ goto handle_sign;
+ case 'z':
+ zflag = 1;
+ goto reswitch;
+handle_nosign:
+ sign = 0;
+ if (jflag)
+ num = va_arg(ap, uintmax_t);
+ else if (qflag)
+ num = va_arg(ap, uint64_t);
+ else if (tflag)
+ num = va_arg(ap, ptrdiff_t);
+ else if (lflag)
+ num = va_arg(ap, unsigned long);
+ else if (zflag)
+ num = va_arg(ap, size_t);
+ else if (hflag)
+ num = (unsigned short)va_arg(ap, int);
+ else if (cflag)
+ num = (unsigned char)va_arg(ap, int);
+ else
+ num = va_arg(ap, unsigned int);
+ goto number;
+handle_sign:
+ if (jflag)
+ num = va_arg(ap, intmax_t);
+ else if (qflag)
+ num = va_arg(ap, int64_t);
+ else if (tflag)
+ num = va_arg(ap, ptrdiff_t);
+ else if (lflag)
+ num = va_arg(ap, long);
+ else if (zflag)
+ num = va_arg(ap, ssize_t);
+ else if (hflag)
+ num = (short)va_arg(ap, int);
+ else if (cflag)
+ num = (char)va_arg(ap, int);
+ else
+ num = va_arg(ap, int);
+number:
+ if (sign && (intmax_t)num < 0) {
+ neg = 1;
+ num = -(intmax_t)num;
+ }
+ p = ksprintn(nbuf, num, base, &n, upper);
+ tmp = 0;
+ if (sharpflag && num != 0) {
+ if (base == 8)
+ tmp++;
+ else if (base == 16)
+ tmp += 2;
+ }
+ if (neg)
+ tmp++;
+
+ if (!ladjust && padc == '0')
+ dwidth = width - tmp;
+ width -= tmp + imax(dwidth, n);
+ dwidth -= n;
+ if (!ladjust)
+ while (width-- > 0)
+ PCHAR(' ');
+ if (neg)
+ PCHAR('-');
+ if (sharpflag && num != 0) {
+ if (base == 8) {
+ PCHAR('0');
+ } else if (base == 16) {
+ PCHAR('0');
+ PCHAR('x');
+ }
+ }
+ while (dwidth-- > 0)
+ PCHAR('0');
+
+ while (*p)
+ PCHAR(*p--);
+
+ if (ladjust)
+ while (width-- > 0)
+ PCHAR(' ');
+
+ break;
+ default:
+ while (percent < fmt)
+ PCHAR(*percent++);
+ /*
+ * Since we ignore an formatting argument it is no
+ * longer safe to obey the remaining formatting
+ * arguments as the arguments will no longer match
+ * the format specs.
+ */
+ stop = 1;
+ break;
+ }
+ }
+#undef PCHAR
+}
+#else /* defined(USE_ELF) */
#error not supported
#endif
diff --git a/addr2line.h b/addr2line.h
index cbb18e5a9f..f09b665800 100644
--- a/addr2line.h
+++ b/addr2line.h
@@ -1,3 +1,5 @@
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
/**********************************************************************
addr2line.h -
@@ -8,14 +10,11 @@
**********************************************************************/
-#ifndef RUBY_ADDR2LINE_H
-#define RUBY_ADDR2LINE_H
-
-#ifdef __ELF__
+#if (defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H))
void
-rb_dump_backtrace_with_lines(int num_traces, void **traces, char **syms);
+rb_dump_backtrace_with_lines(int num_traces, void **traces);
-#endif /* __ELF__ */
+#endif /* USE_ELF */
#endif /* RUBY_ADDR2LINE_H */
diff --git a/array.c b/array.c
index 7624e1ffe5..b76e9a64a3 100644
--- a/array.c
+++ b/array.c
@@ -11,67 +11,107 @@
**********************************************************************/
-#include "ruby/ruby.h"
-#include "ruby/util.h"
+#include "debug_counter.h"
+#include "id.h"
+#include "internal.h"
+#include "internal/array.h"
+#include "internal/compar.h"
+#include "internal/enum.h"
+#include "internal/gc.h"
+#include "internal/hash.h"
+#include "internal/numeric.h"
+#include "internal/object.h"
+#include "internal/proc.h"
+#include "internal/rational.h"
+#include "internal/vm.h"
+#include "probes.h"
+#include "ruby/encoding.h"
#include "ruby/st.h"
+#include "ruby/util.h"
+#include "transient_heap.h"
+#include "builtin.h"
-#ifndef ARRAY_DEBUG
+#if !ARRAY_DEBUG
+# undef NDEBUG
# define NDEBUG
#endif
-#include <assert.h>
-
-#define numberof(array) (int)(sizeof(array) / sizeof((array)[0]))
+#include "ruby_assert.h"
VALUE rb_cArray;
-static ID id_cmp;
+/* Flags of RArray
+ *
+ * 1: RARRAY_EMBED_FLAG
+ * The array is embedded (its contents follow the header, rather than
+ * being on a separately allocated buffer).
+ * 2: RARRAY_SHARED_FLAG (equal to ELTS_SHARED)
+ * The array is shared. The buffer this array points to is owned by
+ * another array (the shared root).
+ * if USE_RVARGC
+ * 3-9: RARRAY_EMBED_LEN
+ * The length of the array when RARRAY_EMBED_FLAG is set.
+ * else
+ * 3-4: RARRAY_EMBED_LEN
+ * The length of the array when RARRAY_EMBED_FLAG is set.
+ * endif
+ * 12: RARRAY_SHARED_ROOT_FLAG
+ * The array is a shared root that does reference counting. The buffer
+ * this array points to is owned by this array but may be pointed to
+ * by other arrays.
+ * Note: Frozen arrays may be a shared root without this flag being
+ * set. Frozen arrays do not have reference counting because
+ * they cannot be modified. Not updating the reference count
+ * improves copy-on-write performance. Their reference count is
+ * assumed to be infinity.
+ * 13: RARRAY_TRANSIENT_FLAG
+ * The buffer of the array is allocated on the transient heap.
+ * 14: RARRAY_PTR_IN_USE_FLAG
+ * The buffer of the array is in use. This is only used during
+ * debugging.
+ */
+
+/* for OPTIMIZED_CMP: */
+#define id_cmp idCmp
#define ARY_DEFAULT_SIZE 16
#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
+#define SMALL_ARRAY_LEN 16
-void
-rb_mem_clear(register VALUE *mem, register long size)
-{
- while (size--) {
- *mem++ = Qnil;
- }
-}
-
-static inline void
-memfill(register VALUE *mem, register long size, register VALUE val)
+RBIMPL_ATTR_MAYBE_UNUSED()
+static int
+should_be_T_ARRAY(VALUE ary)
{
- while (size--) {
- *mem++ = val;
- }
+ return RB_TYPE_P(ary, T_ARRAY);
}
-# define ARY_SHARED_P(ary) \
- (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
- FL_TEST((ary),ELTS_SHARED)!=0)
-# define ARY_EMBED_P(ary) \
- (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
- FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
-
#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_HEAP_CAPA(a) (assert(!ARY_EMBED_P(a)), assert(!ARY_SHARED_ROOT_P(a)), \
+ RARRAY(a)->as.heap.aux.capa)
+
#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
#define ARY_EMBED_LEN(a) \
(assert(ARY_EMBED_P(a)), \
(long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
- (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+ (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), ARY_CAPA(a) * sizeof(VALUE))
+
+#define ARY_OWNS_HEAP_P(a) (assert(should_be_T_ARRAY((VALUE)(a))), \
+ !FL_TEST_RAW((a), RARRAY_SHARED_FLAG|RARRAY_EMBED_FLAG))
-#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
#define FL_SET_EMBED(a) do { \
assert(!ARY_SHARED_P(a)); \
- assert(!OBJ_FROZEN(a)); \
FL_SET((a), RARRAY_EMBED_FLAG); \
+ RARY_TRANSIENT_UNSET(a); \
+ ary_verify(a); \
} while (0)
+
#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
#define FL_SET_SHARED(ary) do { \
assert(!ARY_EMBED_P(ary)); \
- FL_SET((ary), ELTS_SHARED); \
+ FL_SET((ary), RARRAY_SHARED_FLAG); \
} while (0)
-#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), RARRAY_SHARED_FLAG)
#define ARY_SET_PTR(ary, p) do { \
assert(!ARY_EMBED_P(ary)); \
@@ -81,7 +121,6 @@ memfill(register VALUE *mem, register long size, register VALUE val)
#define ARY_SET_EMBED_LEN(ary, n) do { \
long tmp_n = (n); \
assert(ARY_EMBED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
} while (0)
@@ -113,8 +152,8 @@ memfill(register VALUE *mem, register long size, register VALUE val)
} \
} while (0)
-#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
- ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? ary_embed_capa(ary) : \
+ ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : ARY_HEAP_CAPA(ary))
#define ARY_SET_CAPA(ary, n) do { \
assert(!ARY_EMBED_P(ary)); \
assert(!ARY_SHARED_P(ary)); \
@@ -122,57 +161,424 @@ memfill(register VALUE *mem, register long size, register VALUE val)
RARRAY(ary)->as.heap.aux.capa = (n); \
} while (0)
-#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
#define ARY_SET_SHARED(ary, value) do { \
- assert(!ARY_EMBED_P(ary)); \
- assert(ARY_SHARED_P(ary)); \
- assert(ARY_SHARED_ROOT_P(value)); \
- RARRAY(ary)->as.heap.aux.shared = (value); \
+ const VALUE _ary_ = (ary); \
+ const VALUE _value_ = (value); \
+ assert(!ARY_EMBED_P(_ary_)); \
+ assert(ARY_SHARED_P(_ary_)); \
+ assert(!OBJ_FROZEN(_ary_)); \
+ assert(ARY_SHARED_ROOT_P(_value_) || OBJ_FROZEN(_value_)); \
+ RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared_root, _value_); \
} while (0)
-#define RARRAY_SHARED_ROOT_FLAG FL_USER5
-#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
-#define ARY_SHARED_NUM(ary) \
- (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SET_SHARED_NUM(ary, value) do { \
+
+#define ARY_SHARED_ROOT_OCCUPIED(ary) (!OBJ_FROZEN(ary) && ARY_SHARED_ROOT_REFCNT(ary) == 1)
+#define ARY_SET_SHARED_ROOT_REFCNT(ary, value) do { \
assert(ARY_SHARED_ROOT_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ assert((value) >= 0); \
RARRAY(ary)->as.heap.aux.capa = (value); \
} while (0)
#define FL_SET_SHARED_ROOT(ary) do { \
+ assert(!OBJ_FROZEN(ary)); \
assert(!ARY_EMBED_P(ary)); \
+ assert(!RARRAY_TRANSIENT_P(ary)); \
FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
} while (0)
+static inline void
+ARY_SET(VALUE a, long i, VALUE v)
+{
+ assert(!ARY_SHARED_P(a));
+ assert(!OBJ_FROZEN(a));
+
+ RARRAY_ASET(a, i, v);
+}
+#undef RARRAY_ASET
+
+static long
+ary_embed_capa(VALUE ary)
+{
+#if USE_RVARGC
+ size_t size = rb_gc_obj_slot_size(ary) - offsetof(struct RArray, as.ary);
+ assert(size % sizeof(VALUE) == 0);
+ return size / sizeof(VALUE);
+#else
+ return RARRAY_EMBED_LEN_MAX;
+#endif
+}
+
+static size_t
+ary_embed_size(long capa)
+{
+ return offsetof(struct RArray, as.ary) + (sizeof(VALUE) * capa);
+}
+
+static bool
+ary_embeddable_p(long capa)
+{
+#if USE_RVARGC
+ return rb_gc_size_allocatable_p(ary_embed_size(capa));
+#else
+ return capa <= RARRAY_EMBED_LEN_MAX;
+#endif
+}
+
+bool
+rb_ary_embeddable_p(VALUE ary)
+{
+ /* An array cannot be turned embeddable when the array is:
+ * - Shared root: other objects may point to the buffer of this array
+ * so we cannot make it embedded.
+ * - Frozen: this array may also be a shared root without the shared root
+ * flag.
+ * - Shared: we don't want to re-embed an array that points to a shared
+ * root (to save memory).
+ */
+ return !(ARY_SHARED_ROOT_P(ary) || OBJ_FROZEN(ary) || ARY_SHARED_P(ary));
+}
+
+size_t
+rb_ary_size_as_embedded(VALUE ary)
+{
+ size_t real_size;
+
+ if (ARY_EMBED_P(ary)) {
+ real_size = ary_embed_size(ARY_EMBED_LEN(ary));
+ }
+ else if (rb_ary_embeddable_p(ary)) {
+ real_size = ary_embed_size(ARY_HEAP_CAPA(ary));
+ }
+ else {
+ real_size = sizeof(struct RArray);
+ }
+ return real_size;
+}
+
+
+#if ARRAY_DEBUG
+#define ary_verify(ary) ary_verify_(ary, __FILE__, __LINE__)
+
+static VALUE
+ary_verify_(VALUE ary, const char *file, int line)
+{
+ assert(RB_TYPE_P(ary, T_ARRAY));
+
+ if (ARY_SHARED_P(ary)) {
+ VALUE root = ARY_SHARED_ROOT(ary);
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
+ const VALUE *root_ptr = RARRAY_CONST_PTR_TRANSIENT(root);
+ long len = ARY_HEAP_LEN(ary), root_len = RARRAY_LEN(root);
+ assert(ARY_SHARED_ROOT_P(root) || OBJ_FROZEN(root));
+ assert(root_ptr <= ptr && ptr + len <= root_ptr + root_len);
+ ary_verify(root);
+ }
+ else if (ARY_EMBED_P(ary)) {
+ assert(!RARRAY_TRANSIENT_P(ary));
+ assert(!ARY_SHARED_P(ary));
+ assert(RARRAY_LEN(ary) <= ary_embed_capa(ary));
+ }
+ else {
+#if 1
+ const VALUE *ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
+ long i, len = RARRAY_LEN(ary);
+ volatile VALUE v;
+ if (len > 1) len = 1; /* check only HEAD */
+ for (i=0; i<len; i++) {
+ v = ptr[i]; /* access check */
+ }
+ v = v;
+#endif
+ }
+
+#if USE_TRANSIENT_HEAP
+ if (RARRAY_TRANSIENT_P(ary)) {
+ assert(rb_transient_heap_managed_ptr_p(RARRAY_CONST_PTR_TRANSIENT(ary)));
+ }
+#endif
+
+ rb_transient_heap_verify();
+
+ return ary;
+}
+
+void
+rb_ary_verify(VALUE ary)
+{
+ ary_verify(ary);
+}
+#else
+#define ary_verify(ary) ((void)0)
+#endif
+
+VALUE *
+rb_ary_ptr_use_start(VALUE ary)
+{
+#if ARRAY_DEBUG
+ FL_SET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+ return (VALUE *)RARRAY_CONST_PTR_TRANSIENT(ary);
+}
+
+void
+rb_ary_ptr_use_end(VALUE ary)
+{
+#if ARRAY_DEBUG
+ FL_UNSET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+}
+
+void
+rb_mem_clear(VALUE *mem, long size)
+{
+ while (size--) {
+ *mem++ = Qnil;
+ }
+}
+
+static void
+ary_mem_clear(VALUE ary, long beg, long size)
+{
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ rb_mem_clear(ptr + beg, size);
+ });
+}
+
+static inline void
+memfill(register VALUE *mem, register long size, register VALUE val)
+{
+ while (size--) {
+ *mem++ = val;
+ }
+}
+
+static void
+ary_memfill(VALUE ary, long beg, long size, VALUE val)
+{
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ memfill(ptr + beg, size, val);
+ RB_OBJ_WRITTEN(ary, Qundef, val);
+ });
+}
+
+static void
+ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
+{
+ assert(!ARY_SHARED_P(buff_owner_ary));
+
+ if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
+ rb_gc_writebarrier_remember(buff_owner_ary);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMCPY(ptr+beg, argv, VALUE, argc);
+ });
+ }
+ else {
+ int i;
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ for (i=0; i<argc; i++) {
+ RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+ }
+ });
+ }
+}
+
+static void
+ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
+{
+ ary_memcpy0(ary, beg, argc, argv, ary);
+}
+
+static VALUE *
+ary_heap_alloc(VALUE ary, size_t capa)
+{
+ VALUE *ptr = rb_transient_heap_alloc(ary, sizeof(VALUE) * capa);
+
+ if (ptr != NULL) {
+ RARY_TRANSIENT_SET(ary);
+ }
+ else {
+ RARY_TRANSIENT_UNSET(ary);
+ ptr = ALLOC_N(VALUE, capa);
+ }
+
+ return ptr;
+}
+
+static void
+ary_heap_free_ptr(VALUE ary, const VALUE *ptr, long size)
+{
+ if (RARRAY_TRANSIENT_P(ary)) {
+ /* ignore it */
+ }
+ else {
+ ruby_sized_xfree((void *)ptr, size);
+ }
+}
+
+static void
+ary_heap_free(VALUE ary)
+{
+ if (RARRAY_TRANSIENT_P(ary)) {
+ RARY_TRANSIENT_UNSET(ary);
+ }
+ else {
+ ary_heap_free_ptr(ary, ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+ }
+}
+
+static size_t
+ary_heap_realloc(VALUE ary, size_t new_capa)
+{
+ size_t alloc_capa = new_capa;
+ size_t old_capa = ARY_HEAP_CAPA(ary);
+
+ if (RARRAY_TRANSIENT_P(ary)) {
+ if (new_capa <= old_capa) {
+ /* do nothing */
+ alloc_capa = old_capa;
+ }
+ else {
+ VALUE *new_ptr = rb_transient_heap_alloc(ary, sizeof(VALUE) * new_capa);
+
+ if (new_ptr == NULL) {
+ new_ptr = ALLOC_N(VALUE, new_capa);
+ RARY_TRANSIENT_UNSET(ary);
+ }
+
+ MEMCPY(new_ptr, ARY_HEAP_PTR(ary), VALUE, old_capa);
+ ARY_SET_PTR(ary, new_ptr);
+ }
+ }
+ else {
+ SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, new_capa, old_capa);
+ }
+ ary_verify(ary);
+
+ return alloc_capa;
+}
+
+#if USE_TRANSIENT_HEAP
+static inline void
+rb_ary_transient_heap_evacuate_(VALUE ary, int transient, int promote)
+{
+ if (transient) {
+ assert(!ARY_SHARED_ROOT_P(ary));
+
+ VALUE *new_ptr;
+ const VALUE *old_ptr = ARY_HEAP_PTR(ary);
+ long capa = ARY_HEAP_CAPA(ary);
+
+ assert(ARY_OWNS_HEAP_P(ary));
+ assert(RARRAY_TRANSIENT_P(ary));
+ assert(!ARY_PTR_USING_P(ary));
+
+ if (promote) {
+ new_ptr = ALLOC_N(VALUE, capa);
+ RARY_TRANSIENT_UNSET(ary);
+ }
+ else {
+ new_ptr = ary_heap_alloc(ary, capa);
+ }
+
+ MEMCPY(new_ptr, old_ptr, VALUE, capa);
+ /* do not use ARY_SET_PTR() because they assert !frozen */
+ RARRAY(ary)->as.heap.ptr = new_ptr;
+ }
+
+ ary_verify(ary);
+}
+
+void
+rb_ary_transient_heap_evacuate(VALUE ary, int promote)
+{
+ rb_ary_transient_heap_evacuate_(ary, RARRAY_TRANSIENT_P(ary), promote);
+}
+
+void
+rb_ary_detransient(VALUE ary)
+{
+ assert(RARRAY_TRANSIENT_P(ary));
+ rb_ary_transient_heap_evacuate_(ary, TRUE, TRUE);
+}
+#else
+void
+rb_ary_detransient(VALUE ary)
+{
+ /* do nothing */
+}
+#endif
+
+void
+rb_ary_make_embedded(VALUE ary)
+{
+ assert(rb_ary_embeddable_p(ary));
+ if (!ARY_EMBED_P(ary)) {
+ const VALUE *buf = ARY_HEAP_PTR(ary);
+ long len = ARY_HEAP_LEN(ary);
+ bool was_transient = RARRAY_TRANSIENT_P(ary);
+
+ // FL_SET_EMBED also unsets the transient flag
+ FL_SET_EMBED(ary);
+ ARY_SET_EMBED_LEN(ary, len);
+
+ MEMCPY((void *)ARY_EMBED_PTR(ary), (void *)buf, VALUE, len);
+
+ if (!was_transient) {
+ ary_heap_free_ptr(ary, buf, len * sizeof(VALUE));
+ }
+ }
+}
+
static void
ary_resize_capa(VALUE ary, long capacity)
{
assert(RARRAY_LEN(ary) <= capacity);
assert(!OBJ_FROZEN(ary));
assert(!ARY_SHARED_P(ary));
- if (capacity > RARRAY_EMBED_LEN_MAX) {
+
+ if (capacity > ary_embed_capa(ary)) {
+ size_t new_capa = capacity;
if (ARY_EMBED_P(ary)) {
long len = ARY_EMBED_LEN(ary);
- VALUE *ptr = ALLOC_N(VALUE, (capacity));
+ VALUE *ptr = ary_heap_alloc(ary, capacity);
+
MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
FL_UNSET_EMBED(ary);
ARY_SET_PTR(ary, ptr);
ARY_SET_HEAP_LEN(ary, len);
}
else {
- REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, (capacity));
+ new_capa = ary_heap_realloc(ary, capacity);
}
- ARY_SET_CAPA(ary, (capacity));
+ ARY_SET_CAPA(ary, new_capa);
}
else {
if (!ARY_EMBED_P(ary)) {
- long len = RARRAY_LEN(ary);
- VALUE *ptr = RARRAY_PTR(ary);
+ long len = ARY_HEAP_LEN(ary);
+ long old_capa = ARY_HEAP_CAPA(ary);
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
+
if (len > capacity) len = capacity;
- MEMCPY(RARRAY(ary)->as.ary, ptr, VALUE, len);
+ MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
+ ary_heap_free_ptr(ary, ptr, old_capa);
+
FL_SET_EMBED(ary);
ARY_SET_LEN(ary, len);
- xfree(ptr);
}
}
+
+ ary_verify(ary);
+}
+
+static inline void
+ary_shrink_capa(VALUE ary)
+{
+ long capacity = ARY_HEAP_LEN(ary);
+ long old_capa = ARY_HEAP_CAPA(ary);
+ assert(!ARY_SHARED_P(ary));
+ assert(old_capa >= capacity);
+ if (old_capa > capacity) ary_heap_realloc(ary, capacity);
+
+ ary_verify(ary);
}
static void
@@ -181,145 +587,268 @@ ary_double_capa(VALUE ary, long min)
long new_capa = ARY_CAPA(ary) / 2;
if (new_capa < ARY_DEFAULT_SIZE) {
- new_capa = ARY_DEFAULT_SIZE;
+ new_capa = ARY_DEFAULT_SIZE;
}
if (new_capa >= ARY_MAX_SIZE - min) {
- new_capa = (ARY_MAX_SIZE - min) / 2;
+ new_capa = (ARY_MAX_SIZE - min) / 2;
}
new_capa += min;
ary_resize_capa(ary, new_capa);
+
+ ary_verify(ary);
}
static void
-rb_ary_decrement_share(VALUE shared)
+rb_ary_decrement_share(VALUE shared_root)
{
- if (shared) {
- long num = ARY_SHARED_NUM(shared) - 1;
- if (num == 0) {
- rb_ary_free(shared);
- rb_gc_force_recycle(shared);
- }
- else if (num > 0) {
- ARY_SET_SHARED_NUM(shared, num);
- }
+ if (!OBJ_FROZEN(shared_root)) {
+ long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+ ARY_SET_SHARED_ROOT_REFCNT(shared_root, num - 1);
}
}
static void
rb_ary_unshare(VALUE ary)
{
- VALUE shared = RARRAY(ary)->as.heap.aux.shared;
- rb_ary_decrement_share(shared);
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+ rb_ary_decrement_share(shared_root);
FL_UNSET_SHARED(ary);
}
-static inline void
-rb_ary_unshare_safe(VALUE ary)
+static void
+rb_ary_reset(VALUE ary)
{
- if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
+ if (ARY_OWNS_HEAP_P(ary)) {
+ ary_heap_free(ary);
+ }
+ else if (ARY_SHARED_P(ary)) {
+ rb_ary_unshare(ary);
}
+
+ FL_SET_EMBED(ary);
+ ARY_SET_EMBED_LEN(ary, 0);
}
static VALUE
-rb_ary_increment_share(VALUE shared)
+rb_ary_increment_share(VALUE shared_root)
{
- long num = ARY_SHARED_NUM(shared);
- if (num >= 0) {
- ARY_SET_SHARED_NUM(shared, num + 1);
+ if (!OBJ_FROZEN(shared_root)) {
+ long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+ assert(num >= 0);
+ ARY_SET_SHARED_ROOT_REFCNT(shared_root, num + 1);
}
- return shared;
+ return shared_root;
}
static void
-rb_ary_set_shared(VALUE ary, VALUE shared)
+rb_ary_set_shared(VALUE ary, VALUE shared_root)
{
- rb_ary_increment_share(shared);
+ rb_ary_increment_share(shared_root);
FL_SET_SHARED(ary);
- ARY_SET_SHARED(ary, shared);
+ RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+ ARY_SET_SHARED(ary, shared_root);
}
static inline void
rb_ary_modify_check(VALUE ary)
{
rb_check_frozen(ary);
- if (!OBJ_UNTRUSTED(ary) && rb_safe_level() >= 4)
- rb_raise(rb_eSecurityError, "Insecure: can't modify array");
+ ary_verify(ary);
}
void
-rb_ary_modify(VALUE ary)
+rb_ary_cancel_sharing(VALUE ary)
{
- rb_ary_modify_check(ary);
if (ARY_SHARED_P(ary)) {
- long len = RARRAY_LEN(ary);
- if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE *ptr = ARY_HEAP_PTR(ary);
- VALUE shared = ARY_SHARED(ary);
+ long shared_len, len = RARRAY_LEN(ary);
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+
+ ary_verify(shared_root);
+
+ if (len <= ary_embed_capa(ary)) {
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
FL_UNSET_SHARED(ary);
FL_SET_EMBED(ary);
- MEMCPY(ARY_EMBED_PTR(ary), ptr, VALUE, len);
- rb_ary_decrement_share(shared);
+ MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+ rb_ary_decrement_share(shared_root);
ARY_SET_EMBED_LEN(ary, len);
}
+ else if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && len > ((shared_len = RARRAY_LEN(shared_root))>>1)) {
+ long shift = RARRAY_CONST_PTR_TRANSIENT(ary) - RARRAY_CONST_PTR_TRANSIENT(shared_root);
+ FL_UNSET_SHARED(ary);
+ ARY_SET_PTR(ary, RARRAY_CONST_PTR_TRANSIENT(shared_root));
+ ARY_SET_CAPA(ary, shared_len);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr, ptr+shift, VALUE, len);
+ });
+ FL_SET_EMBED(shared_root);
+ rb_ary_decrement_share(shared_root);
+ }
else {
- VALUE *ptr = ALLOC_N(VALUE, len);
- MEMCPY(ptr, RARRAY_PTR(ary), VALUE, len);
+ VALUE *ptr = ary_heap_alloc(ary, len);
+ MEMCPY(ptr, ARY_HEAP_PTR(ary), VALUE, len);
rb_ary_unshare(ary);
ARY_SET_CAPA(ary, len);
ARY_SET_PTR(ary, ptr);
}
+
+ rb_gc_writebarrier_remember(ary);
}
+ ary_verify(ary);
}
-VALUE
-rb_ary_freeze(VALUE ary)
+void
+rb_ary_modify(VALUE ary)
{
- return rb_obj_freeze(ary);
+ rb_ary_modify_check(ary);
+ rb_ary_cancel_sharing(ary);
+}
+
+static VALUE
+ary_ensure_room_for_push(VALUE ary, long add_len)
+{
+ long old_len = RARRAY_LEN(ary);
+ long new_len = old_len + add_len;
+ long capa;
+
+ if (old_len > ARY_MAX_SIZE - add_len) {
+ rb_raise(rb_eIndexError, "index %ld too big", new_len);
+ }
+ if (ARY_SHARED_P(ary)) {
+ if (new_len > ary_embed_capa(ary)) {
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+ if (ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+ if (ARY_HEAP_PTR(ary) - RARRAY_CONST_PTR_TRANSIENT(shared_root) + new_len <= RARRAY_LEN(shared_root)) {
+ rb_ary_modify_check(ary);
+
+ ary_verify(ary);
+ ary_verify(shared_root);
+ return shared_root;
+ }
+ else {
+ /* if array is shared, then it is likely it participate in push/shift pattern */
+ rb_ary_modify(ary);
+ capa = ARY_CAPA(ary);
+ if (new_len > capa - (capa >> 6)) {
+ ary_double_capa(ary, new_len);
+ }
+ ary_verify(ary);
+ return ary;
+ }
+ }
+ }
+ ary_verify(ary);
+ rb_ary_modify(ary);
+ }
+ else {
+ rb_ary_modify_check(ary);
+ }
+ capa = ARY_CAPA(ary);
+ if (new_len > capa) {
+ ary_double_capa(ary, new_len);
+ }
+
+ ary_verify(ary);
+ return ary;
}
/*
* call-seq:
- * ary.frozen? -> true or false
+ * array.freeze -> self
+ *
+ * Freezes +self+; returns +self+:
*
- * Return <code>true</code> if this array is frozen (or temporarily frozen
- * while being sorted).
+ * a = []
+ * a.frozen? # => false
+ * a.freeze
+ * a.frozen? # => true
+ *
+ * An attempt to modify a frozen \Array raises FrozenError.
*/
-static VALUE
-rb_ary_frozen_p(VALUE ary)
+VALUE
+rb_ary_freeze(VALUE ary)
+{
+ return rb_obj_freeze(ary);
+}
+
+/* This can be used to take a snapshot of an array (with
+ e.g. rb_ary_replace) and check later whether the array has been
+ modified from the snapshot. The snapshot is cheap, though if
+ something does modify the array it will pay the cost of copying
+ it. If Array#pop or Array#shift has been called, the array will
+ be still shared with the snapshot, but the array length will
+ differ. */
+VALUE
+rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
{
- if (OBJ_FROZEN(ary)) return Qtrue;
+ if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
+ !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
+ ARY_SHARED_ROOT(ary1) == ARY_SHARED_ROOT(ary2) &&
+ ARY_HEAP_LEN(ary1) == ARY_HEAP_LEN(ary2)) {
+ return Qtrue;
+ }
return Qfalse;
}
static VALUE
-ary_alloc(VALUE klass)
+ary_alloc_embed(VALUE klass, long capa)
{
- NEWOBJ(ary, struct RArray);
- OBJSETUP(ary, klass, T_ARRAY);
- FL_SET_EMBED((VALUE)ary);
- ARY_SET_EMBED_LEN((VALUE)ary, 0);
+ size_t size = ary_embed_size(capa);
+ assert(rb_gc_size_allocatable_p(size));
+#if !USE_RVARGC
+ assert(size <= sizeof(struct RArray));
+#endif
+ RVARGC_NEWOBJ_OF(ary, struct RArray, klass,
+ T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+ size);
+ /* Created array is:
+ * FL_SET_EMBED((VALUE)ary);
+ * ARY_SET_EMBED_LEN((VALUE)ary, 0);
+ */
+ return (VALUE)ary;
+}
+static VALUE
+ary_alloc_heap(VALUE klass)
+{
+ RVARGC_NEWOBJ_OF(ary, struct RArray, klass,
+ T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+ sizeof(struct RArray));
return (VALUE)ary;
}
static VALUE
+empty_ary_alloc(VALUE klass)
+{
+ RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
+ return ary_alloc_embed(klass, 0);
+}
+
+static VALUE
ary_new(VALUE klass, long capa)
{
- VALUE ary;
+ VALUE ary,*ptr;
if (capa < 0) {
- rb_raise(rb_eArgError, "negative array size (or size too big)");
+ rb_raise(rb_eArgError, "negative array size (or size too big)");
}
if (capa > ARY_MAX_SIZE) {
- rb_raise(rb_eArgError, "array size too big");
+ rb_raise(rb_eArgError, "array size too big");
+ }
+
+ RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+ if (ary_embeddable_p(capa)) {
+ ary = ary_alloc_embed(klass, capa);
}
- ary = ary_alloc(klass);
- if (capa > RARRAY_EMBED_LEN_MAX) {
- FL_UNSET_EMBED(ary);
- ARY_SET_PTR(ary, ALLOC_N(VALUE, capa));
+ else {
+ ary = ary_alloc_heap(klass);
ARY_SET_CAPA(ary, capa);
+ assert(!ARY_EMBED_P(ary));
+
+ ptr = ary_heap_alloc(ary, capa);
+ ARY_SET_PTR(ary, ptr);
ARY_SET_HEAP_LEN(ary, 0);
}
@@ -327,22 +856,19 @@ ary_new(VALUE klass, long capa)
}
VALUE
-rb_ary_new2(long capa)
+rb_ary_new_capa(long capa)
{
return ary_new(rb_cArray, capa);
}
-
VALUE
rb_ary_new(void)
{
- return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
+ return rb_ary_new_capa(0);
}
-#include <stdarg.h>
-
VALUE
-rb_ary_new3(long n, ...)
+(rb_ary_new_from_args)(long n, ...)
{
va_list ar;
VALUE ary;
@@ -352,7 +878,7 @@ rb_ary_new3(long n, ...)
va_start(ar, n);
for (i=0; i<n; i++) {
- RARRAY_PTR(ary)[i] = va_arg(ar, VALUE);
+ ARY_SET(ary, i, va_arg(ar, VALUE));
}
va_end(ar);
@@ -360,31 +886,141 @@ rb_ary_new3(long n, ...)
return ary;
}
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_tmp_new_from_values(VALUE klass, long n, const VALUE *elts)
+{
+ VALUE ary;
+
+ ary = ary_new(klass, n);
+ if (n > 0 && elts) {
+ ary_memcpy(ary, 0, n, elts);
+ ARY_SET_LEN(ary, n);
+ }
+
+ return ary;
+}
+
VALUE
-rb_ary_new4(long n, const VALUE *elts)
+rb_ary_new_from_values(long n, const VALUE *elts)
+{
+ return rb_ary_tmp_new_from_values(rb_cArray, n, elts);
+}
+
+static VALUE
+ec_ary_alloc_embed(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+ size_t size = ary_embed_size(capa);
+ assert(rb_gc_size_allocatable_p(size));
+#if !USE_RVARGC
+ assert(size <= sizeof(struct RArray));
+#endif
+ RB_RVARGC_EC_NEWOBJ_OF(ec, ary, struct RArray, klass,
+ T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+ size);
+ /* Created array is:
+ * FL_SET_EMBED((VALUE)ary);
+ * ARY_SET_EMBED_LEN((VALUE)ary, 0);
+ */
+ return (VALUE)ary;
+}
+
+static VALUE
+ec_ary_alloc_heap(rb_execution_context_t *ec, VALUE klass)
+{
+ RB_RVARGC_EC_NEWOBJ_OF(ec, ary, struct RArray, klass,
+ T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+ sizeof(struct RArray));
+ return (VALUE)ary;
+}
+
+static VALUE
+ec_ary_new(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+ VALUE ary,*ptr;
+
+ if (capa < 0) {
+ rb_raise(rb_eArgError, "negative array size (or size too big)");
+ }
+ if (capa > ARY_MAX_SIZE) {
+ rb_raise(rb_eArgError, "array size too big");
+ }
+
+ RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+ if (ary_embeddable_p(capa)) {
+ ary = ec_ary_alloc_embed(ec, klass, capa);
+ }
+ else {
+ ary = ec_ary_alloc_heap(ec, klass);
+ ARY_SET_CAPA(ary, capa);
+ assert(!ARY_EMBED_P(ary));
+
+ ptr = ary_heap_alloc(ary, capa);
+ ARY_SET_PTR(ary, ptr);
+ ARY_SET_HEAP_LEN(ary, 0);
+ }
+
+ return ary;
+}
+
+VALUE
+rb_ec_ary_new_from_values(rb_execution_context_t *ec, long n, const VALUE *elts)
{
VALUE ary;
- ary = rb_ary_new2(n);
+ ary = ec_ary_new(ec, rb_cArray, n);
if (n > 0 && elts) {
- MEMCPY(RARRAY_PTR(ary), elts, VALUE, n);
- ARY_SET_LEN(ary, n);
+ ary_memcpy(ary, 0, n, elts);
+ ARY_SET_LEN(ary, n);
}
return ary;
}
VALUE
-rb_ary_tmp_new(long capa)
+rb_ary_hidden_new(long capa)
+{
+ VALUE ary = ary_new(0, capa);
+ rb_ary_transient_heap_evacuate(ary, TRUE);
+ return ary;
+}
+
+VALUE
+rb_ary_hidden_new_fill(long capa)
{
- return ary_new(0, capa);
+ VALUE ary = rb_ary_hidden_new(capa);
+ ary_memfill(ary, 0, capa, Qnil);
+ ARY_SET_LEN(ary, capa);
+ return ary;
}
void
rb_ary_free(VALUE ary)
{
if (ARY_OWNS_HEAP_P(ary)) {
- xfree(ARY_HEAP_PTR(ary));
+ if (USE_DEBUG_COUNTER &&
+ !ARY_SHARED_ROOT_P(ary) &&
+ ARY_HEAP_CAPA(ary) > RARRAY_LEN(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_extracapa);
+ }
+
+ if (RARRAY_TRANSIENT_P(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_transient);
+ }
+ else {
+ RB_DEBUG_COUNTER_INC(obj_ary_ptr);
+ ary_heap_free(ary);
+ }
+ }
+ else {
+ RB_DEBUG_COUNTER_INC(obj_ary_embed);
+ }
+
+ if (ARY_SHARED_P(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_shared);
+ }
+ if (ARY_SHARED_ROOT_P(ary) && ARY_SHARED_ROOT_OCCUPIED(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_shared_root_occupied);
}
}
@@ -392,61 +1028,83 @@ RUBY_FUNC_EXPORTED size_t
rb_ary_memsize(VALUE ary)
{
if (ARY_OWNS_HEAP_P(ary)) {
- return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
+ return ARY_CAPA(ary) * sizeof(VALUE);
}
else {
- return 0;
+ return 0;
}
}
-static inline void
-ary_discard(VALUE ary)
-{
- rb_ary_free(ary);
- RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
- RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
-}
-
static VALUE
ary_make_shared(VALUE ary)
{
- assert(!ARY_EMBED_P(ary));
+ assert(USE_RVARGC || !ARY_EMBED_P(ary));
+ ary_verify(ary);
+
if (ARY_SHARED_P(ary)) {
- return ARY_SHARED(ary);
+ return ARY_SHARED_ROOT(ary);
}
else if (ARY_SHARED_ROOT_P(ary)) {
- return ary;
+ return ary;
}
else if (OBJ_FROZEN(ary)) {
- ary_resize_capa(ary, ARY_HEAP_LEN(ary));
- FL_SET_SHARED_ROOT(ary);
- ARY_SET_SHARED_NUM(ary, 1);
- return ary;
+ if (!ARY_EMBED_P(ary)) {
+ rb_ary_transient_heap_evacuate(ary, TRUE);
+ ary_shrink_capa(ary);
+ }
+ return ary;
}
else {
- NEWOBJ(shared, struct RArray);
- OBJSETUP(shared, 0, T_ARRAY);
- FL_UNSET_EMBED(shared);
+ rb_ary_transient_heap_evacuate(ary, TRUE);
+
+ long capa = ARY_CAPA(ary);
+ long len = RARRAY_LEN(ary);
- ARY_SET_LEN((VALUE)shared, RARRAY_LEN(ary));
- ARY_SET_PTR((VALUE)shared, RARRAY_PTR(ary));
- FL_SET_SHARED_ROOT(shared);
- ARY_SET_SHARED_NUM((VALUE)shared, 1);
- FL_SET_SHARED(ary);
- ARY_SET_SHARED(ary, (VALUE)shared);
- OBJ_FREEZE(shared);
- return (VALUE)shared;
+ /* Shared roots cannot be embedded because the reference count
+ * (refcnt) is stored in as.heap.aux.capa. */
+ VALUE shared = ary_alloc_heap(0);
+ FL_SET_SHARED_ROOT(shared);
+
+ if (ARY_EMBED_P(ary)) {
+ /* Cannot use ary_heap_alloc because we don't want to allocate
+ * on the transient heap. */
+ VALUE *ptr = ALLOC_N(VALUE, capa);
+ ARY_SET_PTR(shared, ptr);
+ ary_memcpy(shared, 0, len, RARRAY_PTR(ary));
+
+ FL_UNSET_EMBED(ary);
+ ARY_SET_HEAP_LEN(ary, len);
+ ARY_SET_PTR(ary, ptr);
+ }
+ else {
+ ARY_SET_PTR(shared, RARRAY_PTR(ary));
+ }
+
+ ARY_SET_LEN(shared, capa);
+ ary_mem_clear(shared, len, capa - len);
+ ARY_SET_SHARED_ROOT_REFCNT(shared, 1);
+ FL_SET_SHARED(ary);
+ RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+ ARY_SET_SHARED(ary, shared);
+
+ ary_verify(shared);
+ ary_verify(ary);
+
+ return shared;
}
}
-
static VALUE
ary_make_substitution(VALUE ary)
{
- if (RARRAY_LEN(ary) <= RARRAY_EMBED_LEN_MAX) {
- VALUE subst = rb_ary_new2(RARRAY_LEN(ary));
- MEMCPY(ARY_EMBED_PTR(subst), RARRAY_PTR(ary), VALUE, RARRAY_LEN(ary));
- ARY_SET_EMBED_LEN(subst, RARRAY_LEN(ary));
+ long len = RARRAY_LEN(ary);
+
+ if (ary_embeddable_p(len)) {
+ VALUE subst = rb_ary_new_capa(len);
+ assert(ARY_EMBED_P(subst));
+
+ ary_memcpy(subst, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary));
+ ARY_SET_EMBED_LEN(subst, len);
return subst;
}
else {
@@ -460,36 +1118,43 @@ rb_assoc_new(VALUE car, VALUE cdr)
return rb_ary_new3(2, car, cdr);
}
-static VALUE
-to_ary(VALUE ary)
+VALUE
+rb_to_array_type(VALUE ary)
{
- return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
+ return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
}
+#define to_ary rb_to_array_type
VALUE
rb_check_array_type(VALUE ary)
{
- return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
+ return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_check_to_array(VALUE ary)
+{
+ return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
+}
+
+VALUE
+rb_to_array(VALUE ary)
+{
+ return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
}
/*
* call-seq:
- * Array.try_convert(obj) -> array or nil
+ * Array.try_convert(object) -> object, new_array, or nil
*
- * Try to convert <i>obj</i> into an array, using +to_ary+ method.
- * Returns converted array or +nil+ if <i>obj</i> cannot be converted
- * for any reason. This method can be used to check if an argument is an
- * array.
+ * If +object+ is an \Array object, returns +object+.
*
- * Array.try_convert([1]) #=> [1]
- * Array.try_convert("1") #=> nil
+ * Otherwise if +object+ responds to <tt>:to_ary</tt>,
+ * calls <tt>object.to_ary</tt> and returns the result.
*
- * if tmp = Array.try_convert(arg)
- * # the argument is an array
- * elsif tmp = String.try_convert(arg)
- * # the argument is a string
- * end
+ * Returns +nil+ if +object+ does not respond to <tt>:to_ary</tt>
*
+ * Raises an exception unless <tt>object.to_ary</tt> returns an \Array object.
*/
static VALUE
@@ -498,42 +1163,76 @@ rb_ary_s_try_convert(VALUE dummy, VALUE ary)
return rb_check_array_type(ary);
}
+/* :nodoc: */
+static VALUE
+rb_ary_s_new(int argc, VALUE *argv, VALUE klass)
+{
+ VALUE ary;
+
+ if (klass == rb_cArray) {
+ long size = 0;
+ if (argc > 0 && FIXNUM_P(argv[0])) {
+ size = FIX2LONG(argv[0]);
+ if (size < 0) size = 0;
+ }
+
+ ary = ary_new(klass, size);
+
+ rb_obj_call_init_kw(ary, argc, argv, RB_PASS_CALLED_KEYWORDS);
+ }
+ else {
+ ary = rb_class_new_instance_pass_kw(argc, argv, klass);
+ }
+
+ return ary;
+}
+
/*
* call-seq:
- * Array.new(size=0, obj=nil)
- * Array.new(array)
- * Array.new(size) {|index| block }
- *
- * Returns a new array. In the first form, the new array is
- * empty. In the second it is created with _size_ copies of _obj_
- * (that is, _size_ references to the same
- * _obj_). The third form creates a copy of the array
- * passed as a parameter (the array is generated by calling
- * to_ary on the parameter). In the last form, an array
- * of the given size is created. Each element in this array is
- * calculated by passing the element's index to the given block and
- * storing the return value.
- *
- * Array.new
- * Array.new(2)
- * Array.new(5, "A")
- *
- * # only one copy of the object is created
- * a = Array.new(2, Hash.new)
- * a[0]['cat'] = 'feline'
- * a
- * a[1]['cat'] = 'Felix'
- * a
- *
- * # here multiple copies are created
- * a = Array.new(2) { Hash.new }
- * a[0]['cat'] = 'feline'
- * a
- *
- * squares = Array.new(5) {|i| i*i}
- * squares
- *
- * copy = Array.new(squares)
+ * Array.new -> new_empty_array
+ * Array.new(array) -> new_array
+ * Array.new(size) -> new_array
+ * Array.new(size, default_value) -> new_array
+ * Array.new(size) {|index| ... } -> new_array
+ *
+ * Returns a new \Array.
+ *
+ * With no block and no arguments, returns a new empty \Array object.
+ *
+ * With no block and a single \Array argument +array+,
+ * returns a new \Array formed from +array+:
+ *
+ * a = Array.new([:foo, 'bar', 2])
+ * a.class # => Array
+ * a # => [:foo, "bar", 2]
+ *
+ * With no block and a single \Integer argument +size+,
+ * returns a new \Array of the given size
+ * whose elements are all +nil+:
+ *
+ * a = Array.new(3)
+ * a # => [nil, nil, nil]
+ *
+ * With no block and arguments +size+ and +default_value+,
+ * returns an \Array of the given size;
+ * each element is that same +default_value+:
+ *
+ * a = Array.new(3, 'x')
+ * a # => ['x', 'x', 'x']
+ *
+ * With a block and argument +size+,
+ * returns an \Array of the given size;
+ * the block is called with each successive integer +index+;
+ * the element for that +index+ is the return value from the block:
+ *
+ * a = Array.new(3) {|index| "Element #{index}" }
+ * a # => ["Element 0", "Element 1", "Element 2"]
+ *
+ * Raises ArgumentError if +size+ is negative.
+ *
+ * With a block and no argument,
+ * or a single argument +0+,
+ * ignores the block and returns a new empty \Array.
*/
static VALUE
@@ -544,68 +1243,66 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
rb_ary_modify(ary);
if (argc == 0) {
- if (ARY_OWNS_HEAP_P(ary) && RARRAY_PTR(ary)) {
- xfree(RARRAY_PTR(ary));
- }
- rb_ary_unshare_safe(ary);
- FL_SET_EMBED(ary);
- ARY_SET_EMBED_LEN(ary, 0);
- if (rb_block_given_p()) {
- rb_warning("given block not used");
- }
- return ary;
+ rb_ary_reset(ary);
+ assert(ARY_EMBED_P(ary));
+ assert(ARY_EMBED_LEN(ary) == 0);
+ if (rb_block_given_p()) {
+ rb_warning("given block not used");
+ }
+ return ary;
}
rb_scan_args(argc, argv, "02", &size, &val);
if (argc == 1 && !FIXNUM_P(size)) {
- val = rb_check_array_type(size);
- if (!NIL_P(val)) {
- rb_ary_replace(ary, val);
- return ary;
- }
+ val = rb_check_array_type(size);
+ if (!NIL_P(val)) {
+ rb_ary_replace(ary, val);
+ return ary;
+ }
}
len = NUM2LONG(size);
+ /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
if (len < 0) {
- rb_raise(rb_eArgError, "negative array size");
+ rb_raise(rb_eArgError, "negative array size");
}
if (len > ARY_MAX_SIZE) {
- rb_raise(rb_eArgError, "array size too big");
+ rb_raise(rb_eArgError, "array size too big");
}
+ /* recheck after argument conversion */
rb_ary_modify(ary);
ary_resize_capa(ary, len);
if (rb_block_given_p()) {
- long i;
+ long i;
- if (argc == 2) {
- rb_warn("block supersedes default value argument");
- }
- for (i=0; i<len; i++) {
- rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
- ARY_SET_LEN(ary, i + 1);
- }
+ if (argc == 2) {
+ rb_warn("block supersedes default value argument");
+ }
+ for (i=0; i<len; i++) {
+ rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
+ ARY_SET_LEN(ary, i + 1);
+ }
}
else {
- memfill(RARRAY_PTR(ary), len, val);
- ARY_SET_LEN(ary, len);
+ ary_memfill(ary, 0, len, val);
+ ARY_SET_LEN(ary, len);
}
return ary;
}
-
/*
-* Returns a new array populated with the given objects.
-*
-* Array.[]( 1, 'a', /^A/ )
-* Array[ 1, 'a', /^A/ ]
-* [ 1, 'a', /^A/ ]
-*/
+ * Returns a new array populated with the given objects.
+ *
+ * Array.[]( 1, 'a', /^A/) # => [1, "a", /^A/]
+ * Array[ 1, 'a', /^A/ ] # => [1, "a", /^A/]
+ * [ 1, 'a', /^A/ ] # => [1, "a", /^A/]
+ */
static VALUE
rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
{
VALUE ary = ary_new(klass, argc);
if (argc > 0 && argv) {
- MEMCPY(RARRAY_PTR(ary), argv, VALUE, argc);
+ ary_memcpy(ary, 0, argc, argv);
ARY_SET_LEN(ary, argc);
}
@@ -615,30 +1312,31 @@ rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
void
rb_ary_store(VALUE ary, long idx, VALUE val)
{
+ long len = RARRAY_LEN(ary);
+
if (idx < 0) {
- idx += RARRAY_LEN(ary);
- if (idx < 0) {
- rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
- idx - RARRAY_LEN(ary), -RARRAY_LEN(ary));
- }
+ idx += len;
+ if (idx < 0) {
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ idx - len, -len);
+ }
}
else if (idx >= ARY_MAX_SIZE) {
- rb_raise(rb_eIndexError, "index %ld too big", idx);
+ rb_raise(rb_eIndexError, "index %ld too big", idx);
}
rb_ary_modify(ary);
if (idx >= ARY_CAPA(ary)) {
- ary_double_capa(ary, idx);
+ ary_double_capa(ary, idx);
}
- if (idx > RARRAY_LEN(ary)) {
- rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary),
- idx-RARRAY_LEN(ary) + 1);
+ if (idx > len) {
+ ary_mem_clear(ary, len, idx - len + 1);
}
- if (idx >= RARRAY_LEN(ary)) {
- ARY_SET_LEN(ary, idx + 1);
+ if (idx >= len) {
+ ARY_SET_LEN(ary, idx + 1);
}
- RARRAY_PTR(ary)[idx] = val;
+ ARY_SET(ary, idx, val);
}
static VALUE
@@ -648,31 +1346,87 @@ ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
assert(len >= 0);
assert(offset+len <= RARRAY_LEN(ary));
- if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE result = ary_alloc(klass);
- MEMCPY(ARY_EMBED_PTR(result), RARRAY_PTR(ary) + offset, VALUE, len);
+ const size_t rarray_embed_capa_max = (sizeof(struct RArray) - offsetof(struct RArray, as.ary)) / sizeof(VALUE);
+
+ if ((size_t)len <= rarray_embed_capa_max && ary_embeddable_p(len)) {
+ VALUE result = ary_alloc_embed(klass, len);
+ ary_memcpy(result, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary) + offset);
ARY_SET_EMBED_LEN(result, len);
return result;
}
else {
- VALUE shared, result = ary_alloc(klass);
- FL_UNSET_EMBED(result);
+ VALUE shared = ary_make_shared(ary);
+
+ VALUE result = ary_alloc_heap(klass);
+ assert(!ARY_EMBED_P(result));
- shared = ary_make_shared(ary);
- ARY_SET_PTR(result, RARRAY_PTR(ary));
+ ARY_SET_PTR(result, RARRAY_CONST_PTR_TRANSIENT(ary));
ARY_SET_LEN(result, RARRAY_LEN(ary));
rb_ary_set_shared(result, shared);
ARY_INCREASE_PTR(result, offset);
ARY_SET_LEN(result, len);
+
+ ary_verify(shared);
+ ary_verify(result);
+ return result;
+ }
+}
+
+static VALUE
+ary_make_partial_step(VALUE ary, VALUE klass, long offset, long len, long step)
+{
+ assert(offset >= 0);
+ assert(len >= 0);
+ assert(offset+len <= RARRAY_LEN(ary));
+ assert(step != 0);
+
+ const VALUE *values = RARRAY_CONST_PTR_TRANSIENT(ary);
+ const long orig_len = len;
+
+ if (step > 0 && step >= len) {
+ VALUE result = ary_new(klass, 1);
+ VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+ RB_OBJ_WRITE(result, ptr, values[offset]);
+ ARY_SET_EMBED_LEN(result, 1);
return result;
}
+ else if (step < 0 && step < -len) {
+ step = -len;
+ }
+
+ long ustep = (step < 0) ? -step : step;
+ len = roomof(len, ustep);
+
+ long i;
+ long j = offset + ((step > 0) ? 0 : (orig_len - 1));
+
+ VALUE result = ary_new(klass, len);
+ if (ARY_EMBED_P(result)) {
+ VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+ for (i = 0; i < len; ++i) {
+ RB_OBJ_WRITE(result, ptr+i, values[j]);
+ j += step;
+ }
+ ARY_SET_EMBED_LEN(result, len);
+ }
+ else {
+ RARRAY_PTR_USE_TRANSIENT(result, ptr, {
+ for (i = 0; i < len; ++i) {
+ RB_OBJ_WRITE(result, ptr+i, values[j]);
+ j += step;
+ }
+ });
+ ARY_SET_LEN(result, len);
+ }
+
+ return result;
}
static VALUE
ary_make_shared_copy(VALUE ary)
{
- return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+ return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
}
enum ary_take_pos_flags
@@ -682,82 +1436,98 @@ enum ary_take_pos_flags
};
static VALUE
-ary_take_first_or_last(int argc, VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
{
- VALUE nv;
long n;
+ long len;
long offset = 0;
- rb_scan_args(argc, argv, "1", &nv);
- n = NUM2LONG(nv);
- if (n > RARRAY_LEN(ary)) {
- n = RARRAY_LEN(ary);
+ argc = rb_check_arity(argc, 0, 1);
+ /* the case optional argument is omitted should be handled in
+ * callers of this function. if another arity case is added,
+ * this arity check needs to rewrite. */
+ RUBY_ASSERT_ALWAYS(argc == 1);
+
+ n = NUM2LONG(argv[0]);
+ len = RARRAY_LEN(ary);
+ if (n > len) {
+ n = len;
}
else if (n < 0) {
- rb_raise(rb_eArgError, "negative array size");
+ rb_raise(rb_eArgError, "negative array size");
}
if (last) {
- offset = RARRAY_LEN(ary) - n;
+ offset = len - n;
}
return ary_make_partial(ary, rb_cArray, offset, n);
}
-static VALUE rb_ary_push_1(VALUE ary, VALUE item);
-
/*
* call-seq:
- * ary << obj -> ary
+ * array << object -> self
+ *
+ * Appends +object+ to +self+; returns +self+:
*
- * Append---Pushes the given object on to the end of this array. This
- * expression returns the array itself, so several appends
- * may be chained together.
+ * a = [:foo, 'bar', 2]
+ * a << :baz # => [:foo, "bar", 2, :baz]
*
- * [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
- * #=> [ 1, 2, "c", "d", [ 3, 4 ] ]
+ * Appends +object+ as one element, even if it is another \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a1 = a << [3, 4]
+ * a1 # => [:foo, "bar", 2, [3, 4]]
*
*/
VALUE
rb_ary_push(VALUE ary, VALUE item)
{
- rb_ary_modify(ary);
- return rb_ary_push_1(ary, item);
+ long idx = RARRAY_LEN((ary_verify(ary), ary));
+ VALUE target_ary = ary_ensure_room_for_push(ary, 1);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ RB_OBJ_WRITE(target_ary, &ptr[idx], item);
+ });
+ ARY_SET_LEN(ary, idx + 1);
+ ary_verify(ary);
+ return ary;
}
-static VALUE
-rb_ary_push_1(VALUE ary, VALUE item)
+VALUE
+rb_ary_cat(VALUE ary, const VALUE *argv, long len)
{
- long idx = RARRAY_LEN(ary);
-
- if (idx >= ARY_CAPA(ary)) {
- ary_double_capa(ary, idx);
- }
- RARRAY_PTR(ary)[idx] = item;
- ARY_SET_LEN(ary, idx + 1);
+ long oldlen = RARRAY_LEN(ary);
+ VALUE target_ary = ary_ensure_room_for_push(ary, len);
+ ary_memcpy0(ary, oldlen, len, argv, target_ary);
+ ARY_SET_LEN(ary, oldlen + len);
return ary;
}
/*
* call-seq:
- * ary.push(obj, ... ) -> ary
+ * array.push(*objects) -> self
+ *
+ * Appends trailing elements.
*
- * Append---Pushes the given object(s) on to the end of this array. This
- * expression returns the array itself, so several appends
- * may be chained together.
+ * Appends each argument in +objects+ to +self+; returns +self+:
*
- * a = [ "a", "b", "c" ]
- * a.push("d", "e", "f")
- * #=> ["a", "b", "c", "d", "e", "f"]
+ * a = [:foo, 'bar', 2]
+ * a.push(:baz, :bat) # => [:foo, "bar", 2, :baz, :bat]
+ *
+ * Appends each argument as one element, even if it is another \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a1 = a.push([:baz, :bat], [:bam, :bad])
+ * a1 # => [:foo, "bar", 2, [:baz, :bat], [:bam, :bad]]
+ *
+ * Array#append is an alias for Array#push.
+ *
+ * Related: #pop, #shift, #unshift.
*/
static VALUE
rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
{
- rb_ary_modify(ary);
- while (argc--) {
- rb_ary_push_1(ary, *argv++);
- }
- return ary;
+ return rb_ary_cat(ary, argv, argc);
}
VALUE
@@ -765,33 +1535,49 @@ rb_ary_pop(VALUE ary)
{
long n;
rb_ary_modify_check(ary);
- if (RARRAY_LEN(ary) == 0) return Qnil;
+ n = RARRAY_LEN(ary);
+ if (n == 0) return Qnil;
if (ARY_OWNS_HEAP_P(ary) &&
- RARRAY_LEN(ary) * 3 < ARY_CAPA(ary) &&
- ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+ n * 3 < ARY_CAPA(ary) &&
+ ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
{
- ary_resize_capa(ary, RARRAY_LEN(ary) * 2);
+ ary_resize_capa(ary, n * 2);
}
- n = RARRAY_LEN(ary)-1;
+ --n;
ARY_SET_LEN(ary, n);
- return RARRAY_PTR(ary)[n];
+ ary_verify(ary);
+ return RARRAY_AREF(ary, n);
}
/*
* call-seq:
- * ary.pop -> obj or nil
- * ary.pop(n) -> new_ary
+ * array.pop -> object or nil
+ * array.pop(n) -> new_array
+ *
+ * Removes and returns trailing elements.
+ *
+ * When no argument is given and +self+ is not empty,
+ * removes and returns the last element:
*
- * Removes the last element from +self+ and returns it, or
- * <code>nil</code> if the array is empty.
+ * a = [:foo, 'bar', 2]
+ * a.pop # => 2
+ * a # => [:foo, "bar"]
*
- * If a number _n_ is given, returns an array of the last n elements
- * (or less) just like <code>array.slice!(-n, n)</code> does.
+ * Returns +nil+ if the array is empty.
*
- * a = [ "a", "b", "c", "d" ]
- * a.pop #=> "d"
- * a.pop(2) #=> ["b", "c"]
- * a #=> ["a"]
+ * When a non-negative \Integer argument +n+ is given and is in range,
+ *
+ * removes and returns the last +n+ elements in a new \Array:
+ * a = [:foo, 'bar', 2]
+ * a.pop(2) # => ["bar", 2]
+ *
+ * If +n+ is positive and out of range,
+ * removes and returns all elements:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.pop(50) # => [:foo, "bar", 2]
+ *
+ * Related: #push, #shift, #unshift.
*/
static VALUE
@@ -800,12 +1586,13 @@ rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
VALUE result;
if (argc == 0) {
- return rb_ary_pop(ary);
+ return rb_ary_pop(ary);
}
rb_ary_modify_check(ary);
result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+ ary_verify(ary);
return result;
}
@@ -813,49 +1600,51 @@ VALUE
rb_ary_shift(VALUE ary)
{
VALUE top;
+ long len = RARRAY_LEN(ary);
- rb_ary_modify_check(ary);
- if (RARRAY_LEN(ary) == 0) return Qnil;
- top = RARRAY_PTR(ary)[0];
- if (!ARY_SHARED_P(ary)) {
- if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
- MEMMOVE(RARRAY_PTR(ary), RARRAY_PTR(ary)+1, VALUE, RARRAY_LEN(ary)-1);
- ARY_INCREASE_LEN(ary, -1);
- return top;
- }
- assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
-
- RARRAY_PTR(ary)[0] = Qnil;
- ary_make_shared(ary);
- }
- else if (ARY_SHARED_NUM(ARY_SHARED(ary)) == 1) {
- RARRAY_PTR(ary)[0] = Qnil;
+ if (len == 0) {
+ rb_ary_modify_check(ary);
+ return Qnil;
}
- ARY_INCREASE_PTR(ary, 1); /* shift ptr */
- ARY_INCREASE_LEN(ary, -1);
+
+ top = RARRAY_AREF(ary, 0);
+
+ rb_ary_behead(ary, 1);
return top;
}
/*
* call-seq:
- * ary.shift -> obj or nil
- * ary.shift(n) -> new_ary
+ * array.shift -> object or nil
+ * array.shift(n) -> new_array
+ *
+ * Removes and returns leading elements.
+ *
+ * When no argument is given, removes and returns the first element:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.shift # => :foo
+ * a # => ['bar', 2]
+ *
+ * Returns +nil+ if +self+ is empty.
*
- * Returns the first element of +self+ and removes it (shifting all
- * other elements down by one). Returns <code>nil</code> if the array
- * is empty.
+ * When positive \Integer argument +n+ is given, removes the first +n+ elements;
+ * returns those elements in a new \Array:
*
- * If a number _n_ is given, returns an array of the first n elements
- * (or less) just like <code>array.slice!(0, n)</code> does.
+ * a = [:foo, 'bar', 2]
+ * a.shift(2) # => [:foo, 'bar']
+ * a # => [2]
*
- * args = [ "-m", "-q", "filename" ]
- * args.shift #=> "-m"
- * args #=> ["-q", "filename"]
+ * If +n+ is as large as or larger than <tt>self.length</tt>,
+ * removes all elements; returns those elements in a new \Array:
*
- * args = [ "-m", "-q", "filename" ]
- * args.shift(2) #=> ["-m", "-q"]
- * args #=> ["filename"]
+ * a = [:foo, 'bar', 2]
+ * a.shift(3) # => [:foo, 'bar', 2]
+ *
+ * If +n+ is zero, returns a new empty \Array; +self+ is unmodified.
+ *
+ * Related: #push, #pop, #unshift.
*/
static VALUE
@@ -865,54 +1654,163 @@ rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
long n;
if (argc == 0) {
- return rb_ary_shift(ary);
+ return rb_ary_shift(ary);
}
rb_ary_modify_check(ary);
result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
n = RARRAY_LEN(result);
- if (ARY_SHARED_P(ary)) {
- if (ARY_SHARED_NUM(ARY_SHARED(ary)) == 1) {
- rb_mem_clear(RARRAY_PTR(ary), n);
- }
- ARY_INCREASE_PTR(ary, n);
+ rb_ary_behead(ary,n);
+
+ return result;
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_behead(VALUE ary, long n)
+{
+ if (n <= 0) {
+ return ary;
}
- else {
- MEMMOVE(RARRAY_PTR(ary), RARRAY_PTR(ary)+n, VALUE, RARRAY_LEN(ary)-n);
+
+ rb_ary_modify_check(ary);
+
+ if (!ARY_SHARED_P(ary)) {
+ if (ARY_EMBED_P(ary) || RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr, ptr + n, VALUE, RARRAY_LEN(ary) - n);
+ }); /* WB: no new reference */
+ ARY_INCREASE_LEN(ary, -n);
+ ary_verify(ary);
+ return ary;
+ }
+
+ ary_mem_clear(ary, 0, n);
+ ary_make_shared(ary);
}
+ else if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
+ ary_mem_clear(ary, 0, n);
+ }
+
+ ARY_INCREASE_PTR(ary, n);
ARY_INCREASE_LEN(ary, -n);
+ ary_verify(ary);
- return result;
+ return ary;
+}
+
+static VALUE
+make_room_for_unshift(VALUE ary, const VALUE *head, VALUE *sharedp, int argc, long capa, long len)
+{
+ if (head - sharedp < argc) {
+ long room = capa - len - argc;
+
+ room -= room >> 4;
+ MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+ head = sharedp + argc + room;
+ }
+ ARY_SET_PTR(ary, head - argc);
+ assert(ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary)));
+
+ ary_verify(ary);
+ return ARY_SHARED_ROOT(ary);
+}
+
+static VALUE
+ary_modify_for_unshift(VALUE ary, int argc)
+{
+ long len = RARRAY_LEN(ary);
+ long new_len = len + argc;
+ long capa;
+ const VALUE *head, *sharedp;
+
+ rb_ary_modify(ary);
+ capa = ARY_CAPA(ary);
+ if (capa - (capa >> 6) <= new_len) {
+ ary_double_capa(ary, new_len);
+ }
+
+ /* use shared array for big "queues" */
+ if (new_len > ARY_DEFAULT_SIZE * 4 && !ARY_EMBED_P(ary)) {
+ ary_verify(ary);
+
+ /* make a room for unshifted items */
+ capa = ARY_CAPA(ary);
+ ary_make_shared(ary);
+
+ head = sharedp = RARRAY_CONST_PTR_TRANSIENT(ary);
+ return make_room_for_unshift(ary, head, (void *)sharedp, argc, capa, len);
+ }
+ else {
+ /* sliding items */
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr + argc, ptr, VALUE, len);
+ });
+
+ ary_verify(ary);
+ return ary;
+ }
+}
+
+static VALUE
+ary_ensure_room_for_unshift(VALUE ary, int argc)
+{
+ long len = RARRAY_LEN(ary);
+ long new_len = len + argc;
+
+ if (len > ARY_MAX_SIZE - argc) {
+ rb_raise(rb_eIndexError, "index %ld too big", new_len);
+ }
+ else if (! ARY_SHARED_P(ary)) {
+ return ary_modify_for_unshift(ary, argc);
+ }
+ else {
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+ long capa = RARRAY_LEN(shared_root);
+
+ if (! ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+ return ary_modify_for_unshift(ary, argc);
+ }
+ else if (new_len > capa) {
+ return ary_modify_for_unshift(ary, argc);
+ }
+ else {
+ const VALUE * head = RARRAY_CONST_PTR_TRANSIENT(ary);
+ void *sharedp = (void *)RARRAY_CONST_PTR_TRANSIENT(shared_root);
+
+ rb_ary_modify_check(ary);
+ return make_room_for_unshift(ary, head, sharedp, argc, capa, len);
+ }
+ }
}
/*
* call-seq:
- * ary.unshift(obj, ...) -> ary
+ * array.unshift(*objects) -> self
*
- * Prepends objects to the front of +self+,
- * moving other elements upwards.
+ * Prepends the given +objects+ to +self+:
*
- * a = [ "b", "c", "d" ]
- * a.unshift("a") #=> ["a", "b", "c", "d"]
- * a.unshift(1, 2) #=> [ 1, 2, "a", "b", "c", "d"]
+ * a = [:foo, 'bar', 2]
+ * a.unshift(:bam, :bat) # => [:bam, :bat, :foo, "bar", 2]
+ *
+ * Array#prepend is an alias for Array#unshift.
+ *
+ * Related: #push, #pop, #shift.
*/
static VALUE
rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
{
- long len;
+ long len = RARRAY_LEN(ary);
+ VALUE target_ary;
- rb_ary_modify(ary);
- if (argc == 0) return ary;
- if (ARY_CAPA(ary) <= (len = RARRAY_LEN(ary)) + argc) {
- ary_double_capa(ary, len + argc);
+ if (argc == 0) {
+ rb_ary_modify_check(ary);
+ return ary;
}
- /* sliding items */
- MEMMOVE(RARRAY_PTR(ary) + argc, RARRAY_PTR(ary), VALUE, len);
- MEMCPY(RARRAY_PTR(ary), argv, VALUE, argc);
- ARY_INCREASE_LEN(ary, argc);
-
+ target_ary = ary_ensure_room_for_unshift(ary, argc);
+ ary_memcpy0(ary, 0, argc, argv, target_ary);
+ ARY_SET_LEN(ary, len + argc);
return ary;
}
@@ -926,119 +1824,210 @@ rb_ary_unshift(VALUE ary, VALUE item)
static inline VALUE
rb_ary_elt(VALUE ary, long offset)
{
- if (RARRAY_LEN(ary) == 0) return Qnil;
- if (offset < 0 || RARRAY_LEN(ary) <= offset) {
- return Qnil;
+ long len = RARRAY_LEN(ary);
+ if (len == 0) return Qnil;
+ if (offset < 0 || len <= offset) {
+ return Qnil;
}
- return RARRAY_PTR(ary)[offset];
+ return RARRAY_AREF(ary, offset);
}
VALUE
rb_ary_entry(VALUE ary, long offset)
{
- if (offset < 0) {
- offset += RARRAY_LEN(ary);
- }
- return rb_ary_elt(ary, offset);
+ return rb_ary_entry_internal(ary, offset);
}
VALUE
-rb_ary_subseq(VALUE ary, long beg, long len)
+rb_ary_subseq_step(VALUE ary, long beg, long len, long step)
{
VALUE klass;
+ long alen = RARRAY_LEN(ary);
- if (beg > RARRAY_LEN(ary)) return Qnil;
+ if (beg > alen) return Qnil;
if (beg < 0 || len < 0) return Qnil;
- if (RARRAY_LEN(ary) < len || RARRAY_LEN(ary) < beg + len) {
- len = RARRAY_LEN(ary) - beg;
+ if (alen < len || alen < beg + len) {
+ len = alen - beg;
}
- klass = rb_obj_class(ary);
+ klass = rb_cArray;
if (len == 0) return ary_new(klass, 0);
+ if (step == 0)
+ rb_raise(rb_eArgError, "slice step cannot be zero");
+ if (step == 1)
+ return ary_make_partial(ary, klass, beg, len);
+ else
+ return ary_make_partial_step(ary, klass, beg, len, step);
+}
- return ary_make_partial(ary, klass, beg, len);
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
+{
+ return rb_ary_subseq_step(ary, beg, len, 1);
}
+static VALUE rb_ary_aref2(VALUE ary, VALUE b, VALUE e);
+
/*
* call-seq:
- * ary[index] -> obj or nil
- * ary[start, length] -> new_ary or nil
- * ary[range] -> new_ary or nil
- * ary.slice(index) -> obj or nil
- * ary.slice(start, length) -> new_ary or nil
- * ary.slice(range) -> new_ary or nil
- *
- * Element Reference---Returns the element at _index_,
- * or returns a subarray starting at _start_ and
- * continuing for _length_ elements, or returns a subarray
- * specified by _range_.
- * Negative indices count backward from the end of the
- * array (-1 is the last element). Returns +nil+ if the index
- * (or starting index) are out of range.
- *
- * a = [ "a", "b", "c", "d", "e" ]
- * a[2] + a[0] + a[1] #=> "cab"
- * a[6] #=> nil
- * a[1, 2] #=> [ "b", "c" ]
- * a[1..3] #=> [ "b", "c", "d" ]
- * a[4..7] #=> [ "e" ]
- * a[6..10] #=> nil
- * a[-3, 3] #=> [ "c", "d", "e" ]
- * # special cases
- * a[5] #=> nil
- * a[5, 1] #=> []
- * a[5..10] #=> []
+ * array[index] -> object or nil
+ * array[start, length] -> object or nil
+ * array[range] -> object or nil
+ * array[aseq] -> object or nil
+ * array.slice(index) -> object or nil
+ * array.slice(start, length) -> object or nil
+ * array.slice(range) -> object or nil
+ * array.slice(aseq) -> object or nil
+ *
+ * Returns elements from +self+; does not modify +self+.
+ *
+ * When a single \Integer argument +index+ is given, returns the element at offset +index+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0] # => :foo
+ * a[2] # => 2
+ * a # => [:foo, "bar", 2]
+ *
+ * If +index+ is negative, counts relative to the end of +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[-1] # => 2
+ * a[-2] # => "bar"
+ *
+ * If +index+ is out of range, returns +nil+.
+ *
+ * When two \Integer arguments +start+ and +length+ are given,
+ * returns a new \Array of size +length+ containing successive elements beginning at offset +start+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0, 2] # => [:foo, "bar"]
+ * a[1, 2] # => ["bar", 2]
+ *
+ * If <tt>start + length</tt> is greater than <tt>self.length</tt>,
+ * returns all elements from offset +start+ to the end:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0, 4] # => [:foo, "bar", 2]
+ * a[1, 3] # => ["bar", 2]
+ * a[2, 2] # => [2]
+ *
+ * If <tt>start == self.size</tt> and <tt>length >= 0</tt>,
+ * returns a new empty \Array.
+ *
+ * If +length+ is negative, returns +nil+.
+ *
+ * When a single \Range argument +range+ is given,
+ * treats <tt>range.min</tt> as +start+ above
+ * and <tt>range.size</tt> as +length+ above:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0..1] # => [:foo, "bar"]
+ * a[1..2] # => ["bar", 2]
+ *
+ * Special case: If <tt>range.start == a.size</tt>, returns a new empty \Array.
+ *
+ * If <tt>range.end</tt> is negative, calculates the end index from the end:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0..-1] # => [:foo, "bar", 2]
+ * a[0..-2] # => [:foo, "bar"]
+ * a[0..-3] # => [:foo]
+ *
+ * If <tt>range.start</tt> is negative, calculates the start index from the end:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[-1..2] # => [2]
+ * a[-2..2] # => ["bar", 2]
+ * a[-3..2] # => [:foo, "bar", 2]
+ *
+ * If <tt>range.start</tt> is larger than the array size, returns +nil+.
+ *
+ * a = [:foo, 'bar', 2]
+ * a[4..1] # => nil
+ * a[4..0] # => nil
+ * a[4..-1] # => nil
+ *
+ * When a single Enumerator::ArithmeticSequence argument +aseq+ is given,
+ * returns an \Array of elements corresponding to the indexes produced by
+ * the sequence.
+ *
+ * a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ * a[(1..).step(2)] # => ["data1", "data2", "data3"]
*
+ * Unlike slicing with range, if the start or the end of the arithmetic sequence
+ * is larger than array size, throws RangeError.
+ *
+ * a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ * a[(1..11).step(2)]
+ * # RangeError (((1..11).step(2)) out of range)
+ * a[(7..).step(2)]
+ * # RangeError (((7..).step(2)) out of range)
+ *
+ * If given a single argument, and its type is not one of the listed, tries to
+ * convert it to Integer, and raises if it is impossible:
+ *
+ * a = [:foo, 'bar', 2]
+ * # Raises TypeError (no implicit conversion of Symbol into Integer):
+ * a[:foo]
+ *
+ * Array#slice is an alias for Array#[].
*/
VALUE
-rb_ary_aref(int argc, VALUE *argv, VALUE ary)
+rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
{
- VALUE arg;
- long beg, len;
-
+ rb_check_arity(argc, 1, 2);
if (argc == 2) {
- beg = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
- if (beg < 0) {
- beg += RARRAY_LEN(ary);
- }
- return rb_ary_subseq(ary, beg, len);
+ return rb_ary_aref2(ary, argv[0], argv[1]);
}
- if (argc != 1) {
- rb_scan_args(argc, argv, "11", 0, 0);
+ return rb_ary_aref1(ary, argv[0]);
+}
+
+static VALUE
+rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
+{
+ long beg = NUM2LONG(b);
+ long len = NUM2LONG(e);
+ if (beg < 0) {
+ beg += RARRAY_LEN(ary);
}
- arg = argv[0];
+ return rb_ary_subseq(ary, beg, len);
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_aref1(VALUE ary, VALUE arg)
+{
+ long beg, len, step;
+
/* special case - speeding up */
if (FIXNUM_P(arg)) {
- return rb_ary_entry(ary, FIX2LONG(arg));
+ return rb_ary_entry(ary, FIX2LONG(arg));
}
- /* check if idx is Range */
- switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
+ /* check if idx is Range or ArithmeticSequence */
+ switch (rb_arithmetic_sequence_beg_len_step(arg, &beg, &len, &step, RARRAY_LEN(ary), 0)) {
case Qfalse:
- break;
+ break;
case Qnil:
- return Qnil;
+ return Qnil;
default:
- return rb_ary_subseq(ary, beg, len);
+ return rb_ary_subseq_step(ary, beg, len, step);
}
+
return rb_ary_entry(ary, NUM2LONG(arg));
}
/*
* call-seq:
- * ary.at(index) -> obj or nil
+ * array.at(index) -> object
*
- * Returns the element at _index_. A
- * negative index counts from the end of +self+. Returns +nil+
- * if the index is out of range. See also <code>Array#[]</code>.
+ * Returns the element at \Integer offset +index+; does not modify +self+.
+ * a = [:foo, 'bar', 2]
+ * a.at(0) # => :foo
+ * a.at(2) # => 2
*
- * a = [ "a", "b", "c", "d", "e" ]
- * a.at(0) #=> "a"
- * a.at(-1) #=> "e"
*/
-static VALUE
+VALUE
rb_ary_at(VALUE ary, VALUE pos)
{
return rb_ary_entry(ary, NUM2LONG(pos));
@@ -1046,73 +2035,131 @@ rb_ary_at(VALUE ary, VALUE pos)
/*
* call-seq:
- * ary.first -> obj or nil
- * ary.first(n) -> new_ary
+ * array.first -> object or nil
+ * array.first(n) -> new_array
+ *
+ * Returns elements from +self+; does not modify +self+.
+ *
+ * When no argument is given, returns the first element:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.first # => :foo
+ * a # => [:foo, "bar", 2]
+ *
+ * If +self+ is empty, returns +nil+.
+ *
+ * When non-negative \Integer argument +n+ is given,
+ * returns the first +n+ elements in a new \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.first(2) # => [:foo, "bar"]
+ *
+ * If <tt>n >= array.size</tt>, returns all elements:
*
- * Returns the first element, or the first +n+ elements, of the array.
- * If the array is empty, the first form returns <code>nil</code>, and the
- * second form returns an empty array.
+ * a = [:foo, 'bar', 2]
+ * a.first(50) # => [:foo, "bar", 2]
*
- * a = [ "q", "r", "s", "t" ]
- * a.first #=> "q"
- * a.first(2) #=> ["q", "r"]
+ * If <tt>n == 0</tt> returns an new empty \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.first(0) # []
+ *
+ * Related: #last.
*/
-
static VALUE
rb_ary_first(int argc, VALUE *argv, VALUE ary)
{
if (argc == 0) {
- if (RARRAY_LEN(ary) == 0) return Qnil;
- return RARRAY_PTR(ary)[0];
+ if (RARRAY_LEN(ary) == 0) return Qnil;
+ return RARRAY_AREF(ary, 0);
}
else {
- return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+ return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
}
}
/*
* call-seq:
- * ary.last -> obj or nil
- * ary.last(n) -> new_ary
+ * array.last -> object or nil
+ * array.last(n) -> new_array
+ *
+ * Returns elements from +self+; +self+ is not modified.
+ *
+ * When no argument is given, returns the last element:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.last # => 2
+ * a # => [:foo, "bar", 2]
+ *
+ * If +self+ is empty, returns +nil+.
+ *
+ * When non-negative \Integer argument +n+ is given,
+ * returns the last +n+ elements in a new \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.last(2) # => ["bar", 2]
*
- * Returns the last element(s) of +self+. If the array is empty,
- * the first form returns <code>nil</code>.
+ * If <tt>n >= array.size</tt>, returns all elements:
*
- * a = [ "w", "x", "y", "z" ]
- * a.last #=> "z"
- * a.last(2) #=> ["y", "z"]
+ * a = [:foo, 'bar', 2]
+ * a.last(50) # => [:foo, "bar", 2]
+ *
+ * If <tt>n == 0</tt>, returns an new empty \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.last(0) # []
+ *
+ * Related: #first.
*/
VALUE
-rb_ary_last(int argc, VALUE *argv, VALUE ary)
+rb_ary_last(int argc, const VALUE *argv, VALUE ary)
{
if (argc == 0) {
- if (RARRAY_LEN(ary) == 0) return Qnil;
- return RARRAY_PTR(ary)[RARRAY_LEN(ary)-1];
+ long len = RARRAY_LEN(ary);
+ if (len == 0) return Qnil;
+ return RARRAY_AREF(ary, len-1);
}
else {
- return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+ return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
}
}
/*
* call-seq:
- * ary.fetch(index) -> obj
- * ary.fetch(index, default ) -> obj
- * ary.fetch(index) {|index| block } -> obj
- *
- * Tries to return the element at position <i>index</i>. If the index
- * lies outside the array, the first form throws an
- * <code>IndexError</code> exception, the second form returns
- * <i>default</i>, and the third form returns the value of invoking
- * the block, passing in the index. Negative values of <i>index</i>
- * count from the end of the array.
- *
- * a = [ 11, 22, 33, 44 ]
- * a.fetch(1) #=> 22
- * a.fetch(-1) #=> 44
- * a.fetch(4, 'cat') #=> "cat"
- * a.fetch(4) { |i| i*i } #=> 16
+ * array.fetch(index) -> element
+ * array.fetch(index, default_value) -> element
+ * array.fetch(index) {|index| ... } -> element
+ *
+ * Returns the element at offset +index+.
+ *
+ * With the single \Integer argument +index+,
+ * returns the element at offset +index+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.fetch(1) # => "bar"
+ *
+ * If +index+ is negative, counts from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.fetch(-1) # => 2
+ * a.fetch(-2) # => "bar"
+ *
+ * With arguments +index+ and +default_value+,
+ * returns the element at offset +index+ if index is in range,
+ * otherwise returns +default_value+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.fetch(1, nil) # => "bar"
+ *
+ * With argument +index+ and a block,
+ * returns the element at offset +index+ if index is in range
+ * (and the block is not called); otherwise calls the block with index and returns its return value:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.fetch(1) {|index| raise 'Cannot happen' } # => "bar"
+ * a.fetch(50) {|index| "Value for #{index}" } # => "Value for 50"
+ *
*/
static VALUE
@@ -1125,44 +2172,60 @@ rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
rb_scan_args(argc, argv, "11", &pos, &ifnone);
block_given = rb_block_given_p();
if (block_given && argc == 2) {
- rb_warn("block supersedes default value argument");
+ rb_warn("block supersedes default value argument");
}
idx = NUM2LONG(pos);
if (idx < 0) {
- idx += RARRAY_LEN(ary);
+ idx += RARRAY_LEN(ary);
}
if (idx < 0 || RARRAY_LEN(ary) <= idx) {
- if (block_given) return rb_yield(pos);
- if (argc == 1) {
- rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
- idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
- }
- return ifnone;
+ if (block_given) return rb_yield(pos);
+ if (argc == 1) {
+ rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+ idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+ }
+ return ifnone;
}
- return RARRAY_PTR(ary)[idx];
+ return RARRAY_AREF(ary, idx);
}
/*
* call-seq:
- * ary.index(obj) -> int or nil
- * ary.index {|item| block} -> int or nil
- * ary.index -> an_enumerator
+ * array.index(object) -> integer or nil
+ * array.index {|element| ... } -> integer or nil
+ * array.index -> new_enumerator
+ *
+ * Returns the index of a specified element.
+ *
+ * When argument +object+ is given but no block,
+ * returns the index of the first element +element+
+ * for which <tt>object == element</tt>:
+ *
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.index('bar') # => 1
*
- * Returns the index of the first object in +self+ such that is
- * <code>==</code> to <i>obj</i>. If a block is given instead of an
- * argument, returns first object for which <em>block</em> is true.
- * Returns <code>nil</code> if no match is found.
- * See also <code>Array#rindex</code>.
+ * Returns +nil+ if no such element found.
*
- * If neither block nor argument is given, an enumerator is returned instead.
+ * When both argument +object+ and a block are given,
+ * calls the block with each successive element;
+ * returns the index of the first element for which the block returns a truthy value:
*
- * a = [ "a", "b", "c" ]
- * a.index("b") #=> 1
- * a.index("z") #=> nil
- * a.index{|x|x=="b"} #=> 1
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.index {|element| element == 'bar' } # => 1
*
- * This is an alias of <code>#find_index</code>.
+ * Returns +nil+ if the block never returns a truthy value.
+ *
+ * When neither an argument nor a block is given, returns a new Enumerator:
+ *
+ * a = [:foo, 'bar', 2]
+ * e = a.index
+ * e # => #<Enumerator: [:foo, "bar", 2]:index>
+ * e.each {|element| element == 'bar' } # => 1
+ *
+ * Array#find_index is an alias for Array#index.
+ *
+ * Related: #rindex.
*/
static VALUE
@@ -1172,71 +2235,89 @@ rb_ary_index(int argc, VALUE *argv, VALUE ary)
long i;
if (argc == 0) {
- RETURN_ENUMERATOR(ary, 0, 0);
- for (i=0; i<RARRAY_LEN(ary); i++) {
- if (RTEST(rb_yield(RARRAY_PTR(ary)[i]))) {
- return LONG2NUM(i);
- }
- }
- return Qnil;
- }
- rb_scan_args(argc, argv, "1", &val);
+ RETURN_ENUMERATOR(ary, 0, 0);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+ return LONG2NUM(i);
+ }
+ }
+ return Qnil;
+ }
+ rb_check_arity(argc, 0, 1);
+ val = argv[0];
if (rb_block_given_p())
- rb_warn("given block not used");
+ rb_warn("given block not used");
for (i=0; i<RARRAY_LEN(ary); i++) {
- if (rb_equal(RARRAY_PTR(ary)[i], val))
- return LONG2NUM(i);
+ VALUE e = RARRAY_AREF(ary, i);
+ if (rb_equal(e, val)) {
+ return LONG2NUM(i);
+ }
}
return Qnil;
}
/*
* call-seq:
- * ary.rindex(obj) -> int or nil
- * ary.rindex {|item| block} -> int or nil
- * ary.rindex -> an_enumerator
- *
- * Returns the index of the last object in +self+
- * <code>==</code> to <i>obj</i>. If a block is given instead of an
- * argument, returns first object for which <em>block</em> is
- * true, starting from the last object.
- * Returns <code>nil</code> if no match is found.
- * See also <code>Array#index</code>.
- *
- * If neither block nor argument is given, an enumerator is returned instead.
- *
- * a = [ "a", "b", "b", "b", "c" ]
- * a.rindex("b") #=> 3
- * a.rindex("z") #=> nil
- * a.rindex{|x|x=="b"} #=> 3
+ * array.rindex(object) -> integer or nil
+ * array.rindex {|element| ... } -> integer or nil
+ * array.rindex -> new_enumerator
+ *
+ * Returns the index of the last element for which <tt>object == element</tt>.
+ *
+ * When argument +object+ is given but no block, returns the index of the last such element found:
+ *
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.rindex('bar') # => 3
+ *
+ * Returns +nil+ if no such object found.
+ *
+ * When a block is given but no argument, calls the block with each successive element;
+ * returns the index of the last element for which the block returns a truthy value:
+ *
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.rindex {|element| element == 'bar' } # => 3
+ *
+ * Returns +nil+ if the block never returns a truthy value.
+ *
+ * When neither an argument nor a block is given, returns a new \Enumerator:
+ *
+ * a = [:foo, 'bar', 2, 'bar']
+ * e = a.rindex
+ * e # => #<Enumerator: [:foo, "bar", 2, "bar"]:rindex>
+ * e.each {|element| element == 'bar' } # => 3
+ *
+ * Related: #index.
*/
static VALUE
rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
{
VALUE val;
- long i = RARRAY_LEN(ary);
+ long i = RARRAY_LEN(ary), len;
if (argc == 0) {
- RETURN_ENUMERATOR(ary, 0, 0);
- while (i--) {
- if (RTEST(rb_yield(RARRAY_PTR(ary)[i])))
- return LONG2NUM(i);
- if (i > RARRAY_LEN(ary)) {
- i = RARRAY_LEN(ary);
- }
- }
- return Qnil;
- }
- rb_scan_args(argc, argv, "1", &val);
+ RETURN_ENUMERATOR(ary, 0, 0);
+ while (i--) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
+ return LONG2NUM(i);
+ if (i > (len = RARRAY_LEN(ary))) {
+ i = len;
+ }
+ }
+ return Qnil;
+ }
+ rb_check_arity(argc, 0, 1);
+ val = argv[0];
if (rb_block_given_p())
- rb_warn("given block not used");
+ rb_warn("given block not used");
while (i--) {
- if (rb_equal(RARRAY_PTR(ary)[i], val))
- return LONG2NUM(i);
- if (i > RARRAY_LEN(ary)) {
- i = RARRAY_LEN(ary);
- }
+ VALUE e = RARRAY_AREF(ary, i);
+ if (rb_equal(e, val)) {
+ return LONG2NUM(i);
+ }
+ if (i > RARRAY_LEN(ary)) {
+ break;
+ }
}
return Qnil;
}
@@ -1251,71 +2332,90 @@ rb_ary_to_ary(VALUE obj)
}
static void
-rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
+rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
{
- long rlen;
+ long olen;
+ long rofs;
if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
+ olen = RARRAY_LEN(ary);
if (beg < 0) {
- beg += RARRAY_LEN(ary);
- if (beg < 0) {
- rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
- beg - RARRAY_LEN(ary), -RARRAY_LEN(ary));
- }
+ beg += olen;
+ if (beg < 0) {
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ beg - olen, -olen);
+ }
}
- if (RARRAY_LEN(ary) < len || RARRAY_LEN(ary) < beg + len) {
- len = RARRAY_LEN(ary) - beg;
+ if (olen < len || olen < beg + len) {
+ len = olen - beg;
}
- if (rpl == Qundef) {
- rlen = 0;
+ {
+ const VALUE *optr = RARRAY_CONST_PTR_TRANSIENT(ary);
+ rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
+ }
+
+ if (beg >= olen) {
+ VALUE target_ary;
+ if (beg > ARY_MAX_SIZE - rlen) {
+ rb_raise(rb_eIndexError, "index %ld too big", beg);
+ }
+ target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+ len = beg + rlen;
+ ary_mem_clear(ary, olen, beg - olen);
+ if (rlen > 0) {
+ if (rofs != -1) rptr = RARRAY_CONST_PTR_TRANSIENT(ary) + rofs;
+ ary_memcpy0(ary, beg, rlen, rptr, target_ary);
+ }
+ ARY_SET_LEN(ary, len);
}
else {
- rpl = rb_ary_to_ary(rpl);
- rlen = RARRAY_LEN(rpl);
+ long alen;
+
+ if (olen - len > ARY_MAX_SIZE - rlen) {
+ rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
+ }
+ rb_ary_modify(ary);
+ alen = olen + rlen - len;
+ if (alen >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, alen);
+ }
+
+ if (len != rlen) {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr,
+ MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+ VALUE, olen - (beg + len)));
+ ARY_SET_LEN(ary, alen);
+ }
+ if (rlen > 0) {
+ if (rofs != -1) rptr = RARRAY_CONST_PTR_TRANSIENT(ary) + rofs;
+ /* give up wb-protected ary */
+ RB_OBJ_WB_UNPROTECT_FOR(ARRAY, ary);
+
+ /* do not use RARRAY_PTR() because it can causes GC.
+ * ary can contain T_NONE object because it is not cleared.
+ */
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr,
+ MEMMOVE(ptr + beg, rptr, VALUE, rlen));
+ }
}
- rb_ary_modify(ary);
- if (beg >= RARRAY_LEN(ary)) {
- if (beg > ARY_MAX_SIZE - rlen) {
- rb_raise(rb_eIndexError, "index %ld too big", beg);
- }
- len = beg + rlen;
- if (len >= ARY_CAPA(ary)) {
- ary_double_capa(ary, len);
- }
- rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary), beg - RARRAY_LEN(ary));
- if (rlen > 0) {
- MEMCPY(RARRAY_PTR(ary) + beg, RARRAY_PTR(rpl), VALUE, rlen);
- }
- ARY_SET_LEN(ary, len);
+}
+
+void
+rb_ary_set_len(VALUE ary, long len)
+{
+ long capa;
+
+ rb_ary_modify_check(ary);
+ if (ARY_SHARED_P(ary)) {
+ rb_raise(rb_eRuntimeError, "can't set length of shared ");
}
- else {
- long alen;
-
- alen = RARRAY_LEN(ary) + rlen - len;
- if (alen >= ARY_CAPA(ary)) {
- ary_double_capa(ary, alen);
- }
-
- if (len != rlen) {
- MEMMOVE(RARRAY_PTR(ary) + beg + rlen, RARRAY_PTR(ary) + beg + len,
- VALUE, RARRAY_LEN(ary) - (beg + len));
- ARY_SET_LEN(ary, alen);
- }
- if (rlen > 0) {
- MEMMOVE(RARRAY_PTR(ary) + beg, RARRAY_PTR(rpl), VALUE, rlen);
- }
- }
-}
-
-/*!
- * expands or shrinks \a ary to \a len elements.
- * expanded region will be filled with Qnil.
- * \param ary an array
- * \param len new size
- * \return \a ary
- * \post the size of \a ary is \a len.
- */
+ if (len > (capa = (long)ARY_CAPA(ary))) {
+ rb_bug("probable buffer overflow: %ld for %ld", len, capa);
+ }
+ ARY_SET_LEN(ary, len);
+}
+
VALUE
rb_ary_resize(VALUE ary, long len)
{
@@ -1325,61 +2425,170 @@ rb_ary_resize(VALUE ary, long len)
olen = RARRAY_LEN(ary);
if (len == olen) return ary;
if (len > ARY_MAX_SIZE) {
- rb_raise(rb_eIndexError, "index %ld too big", len);
+ rb_raise(rb_eIndexError, "index %ld too big", len);
}
if (len > olen) {
- if (len >= ARY_CAPA(ary)) {
- ary_double_capa(ary, len);
- }
- rb_mem_clear(RARRAY_PTR(ary) + olen, len - olen);
+ if (len >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, len);
+ }
+ ary_mem_clear(ary, olen, len - olen);
ARY_SET_LEN(ary, len);
}
else if (ARY_EMBED_P(ary)) {
ARY_SET_EMBED_LEN(ary, len);
}
- else if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE tmp[RARRAY_EMBED_LEN_MAX];
- MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
- ary_discard(ary);
- MEMCPY(ARY_EMBED_PTR(ary), tmp, VALUE, len);
+ else if (len <= ary_embed_capa(ary)) {
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
+ long ptr_capa = ARY_HEAP_SIZE(ary);
+ bool is_malloc_ptr = !ARY_SHARED_P(ary) && !RARRAY_TRANSIENT_P(ary);
+
+ FL_UNSET(ary, RARRAY_TRANSIENT_FLAG);
+ FL_SET_EMBED(ary);
+
+ MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len); /* WB: no new reference */
ARY_SET_EMBED_LEN(ary, len);
+
+ if (is_malloc_ptr) ruby_sized_xfree((void *)ptr, ptr_capa);
}
else {
- if (olen > len + ARY_DEFAULT_SIZE) {
- REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len);
- ARY_SET_CAPA(ary, len);
- }
- ARY_SET_HEAP_LEN(ary, len);
+ if (olen > len + ARY_DEFAULT_SIZE) {
+ size_t new_capa = ary_heap_realloc(ary, len);
+ ARY_SET_CAPA(ary, new_capa);
+ }
+ ARY_SET_HEAP_LEN(ary, len);
}
+ ary_verify(ary);
return ary;
}
+static VALUE
+ary_aset_by_rb_ary_store(VALUE ary, long key, VALUE val)
+{
+ rb_ary_store(ary, key, val);
+ return val;
+}
+
+static VALUE
+ary_aset_by_rb_ary_splice(VALUE ary, long beg, long len, VALUE val)
+{
+ VALUE rpl = rb_ary_to_ary(val);
+ rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR_TRANSIENT(rpl), RARRAY_LEN(rpl));
+ RB_GC_GUARD(rpl);
+ return val;
+}
+
/*
* call-seq:
- * ary[index] = obj -> obj
- * ary[start, length] = obj or other_ary or nil -> obj or other_ary or nil
- * ary[range] = obj or other_ary or nil -> obj or other_ary or nil
- *
- * Element Assignment---Sets the element at _index_,
- * or replaces a subarray starting at _start_ and
- * continuing for _length_ elements, or replaces a subarray
- * specified by _range_. If indices are greater than
- * the current capacity of the array, the array grows
- * automatically. A negative indices will count backward
- * from the end of the array. Inserts elements if _length_ is
- * zero. An +IndexError+ is raised if a negative index points
- * past the beginning of the array. See also
- * <code>Array#push</code>, and <code>Array#unshift</code>.
- *
- * a = Array.new
- * a[4] = "4"; #=> [nil, nil, nil, nil, "4"]
- * a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
- * a[1..2] = [ 1, 2 ] #=> ["a", 1, 2, nil, "4"]
- * a[0, 2] = "?" #=> ["?", 2, nil, "4"]
- * a[0..2] = "A" #=> ["A", "4"]
- * a[-1] = "Z" #=> ["A", "Z"]
- * a[1..-1] = nil #=> ["A", nil]
- * a[1..-1] = [] #=> ["A"]
+ * array[index] = object -> object
+ * array[start, length] = object -> object
+ * array[range] = object -> object
+ *
+ * Assigns elements in +self+; returns the given +object+.
+ *
+ * When \Integer argument +index+ is given, assigns +object+ to an element in +self+.
+ *
+ * If +index+ is non-negative, assigns +object+ the element at offset +index+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0] = 'foo' # => "foo"
+ * a # => ["foo", "bar", 2]
+ *
+ * If +index+ is greater than <tt>self.length</tt>, extends the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[7] = 'foo' # => "foo"
+ * a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
+ *
+ * If +index+ is negative, counts backwards from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[-1] = 'two' # => "two"
+ * a # => [:foo, "bar", "two"]
+ *
+ * When \Integer arguments +start+ and +length+ are given and +object+ is not an \Array,
+ * removes <tt>length - 1</tt> elements beginning at offset +start+,
+ * and assigns +object+ at offset +start+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0, 2] = 'foo' # => "foo"
+ * a # => ["foo", 2]
+ *
+ * If +start+ is negative, counts backwards from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[-2, 2] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ *
+ * If +start+ is non-negative and outside the array (<tt> >= self.size</tt>),
+ * extends the array with +nil+, assigns +object+ at offset +start+,
+ * and ignores +length+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[6, 50] = 'foo' # => "foo"
+ * a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ * If +length+ is zero, shifts elements at and following offset +start+
+ * and assigns +object+ at offset +start+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[1, 0] = 'foo' # => "foo"
+ * a # => [:foo, "foo", "bar", 2]
+ *
+ * If +length+ is too large for the existing array, does not extend the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[1, 5] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ *
+ * When \Range argument +range+ is given and +object+ is an \Array,
+ * removes <tt>length - 1</tt> elements beginning at offset +start+,
+ * and assigns +object+ at offset +start+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0..1] = 'foo' # => "foo"
+ * a # => ["foo", 2]
+ *
+ * if <tt>range.begin</tt> is negative, counts backwards from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[-2..2] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ *
+ * If the array length is less than <tt>range.begin</tt>,
+ * assigns +object+ at offset <tt>range.begin</tt>, and ignores +length+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[6..50] = 'foo' # => "foo"
+ * a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ * If <tt>range.end</tt> is zero, shifts elements at and following offset +start+
+ * and assigns +object+ at offset +start+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[1..0] = 'foo' # => "foo"
+ * a # => [:foo, "foo", "bar", 2]
+ *
+ * If <tt>range.end</tt> is negative, assigns +object+ at offset +start+,
+ * retains <tt>range.end.abs -1</tt> elements past that, and removes those beyond:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[1..-1] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ * a = [:foo, 'bar', 2]
+ * a[1..-2] = 'foo' # => "foo"
+ * a # => [:foo, "foo", 2]
+ * a = [:foo, 'bar', 2]
+ * a[1..-3] = 'foo' # => "foo"
+ * a # => [:foo, "foo", "bar", 2]
+ * a = [:foo, 'bar', 2]
+ *
+ * If <tt>range.end</tt> is too large for the existing array,
+ * replaces array elements, but does not extend the array with +nil+ values:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[1..5] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ *
*/
static VALUE
@@ -1387,43 +2596,60 @@ rb_ary_aset(int argc, VALUE *argv, VALUE ary)
{
long offset, beg, len;
+ rb_check_arity(argc, 2, 3);
+ rb_ary_modify_check(ary);
if (argc == 3) {
- rb_ary_modify_check(ary);
- beg = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
- rb_ary_splice(ary, beg, len, argv[2]);
- return argv[2];
- }
- if (argc != 2) {
- rb_raise(rb_eArgError, "wrong number of arguments (%d for 2)", argc);
+ beg = NUM2LONG(argv[0]);
+ len = NUM2LONG(argv[1]);
+ return ary_aset_by_rb_ary_splice(ary, beg, len, argv[2]);
}
- rb_ary_modify_check(ary);
if (FIXNUM_P(argv[0])) {
- offset = FIX2LONG(argv[0]);
- goto fixnum;
+ offset = FIX2LONG(argv[0]);
+ return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
}
if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
- /* check if idx is Range */
- rb_ary_splice(ary, beg, len, argv[1]);
- return argv[1];
+ /* check if idx is Range */
+ return ary_aset_by_rb_ary_splice(ary, beg, len, argv[1]);
}
offset = NUM2LONG(argv[0]);
-fixnum:
- rb_ary_store(ary, offset, argv[1]);
- return argv[1];
+ return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
}
/*
* call-seq:
- * ary.insert(index, obj...) -> ary
+ * array.insert(index, *objects) -> self
+ *
+ * Inserts given +objects+ before or after the element at \Integer index +offset+;
+ * returns +self+.
+ *
+ * When +index+ is non-negative, inserts all given +objects+
+ * before the element at offset +index+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.insert(1, :bat, :bam) # => [:foo, :bat, :bam, "bar", 2]
+ *
+ * Extends the array if +index+ is beyond the array (<tt>index >= self.size</tt>):
+ *
+ * a = [:foo, 'bar', 2]
+ * a.insert(5, :bat, :bam)
+ * a # => [:foo, "bar", 2, nil, nil, :bat, :bam]
+ *
+ * Does nothing if no objects given:
*
- * Inserts the given values before the element with the given index
- * (which may be negative).
+ * a = [:foo, 'bar', 2]
+ * a.insert(1)
+ * a.insert(50)
+ * a.insert(-50)
+ * a # => [:foo, "bar", 2]
+ *
+ * When +index+ is negative, inserts all given +objects+
+ * _after_ the element at offset <tt>index+self.size</tt>:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.insert(-2, :bat, :bam)
+ * a # => [:foo, "bar", :bat, :bam, 2]
*
- * a = %w{ a b c d }
- * a.insert(2, 99) #=> ["a", "b", 99, "c", "d"]
- * a.insert(-2, 1, 2, 3) #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
*/
static VALUE
@@ -1431,97 +2657,191 @@ rb_ary_insert(int argc, VALUE *argv, VALUE ary)
{
long pos;
- if (argc < 1) {
- rb_raise(rb_eArgError, "wrong number of arguments (at least 1)");
- }
+ rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
rb_ary_modify_check(ary);
- if (argc == 1) return ary;
pos = NUM2LONG(argv[0]);
+ if (argc == 1) return ary;
if (pos == -1) {
- pos = RARRAY_LEN(ary);
+ pos = RARRAY_LEN(ary);
}
- if (pos < 0) {
- pos++;
+ else if (pos < 0) {
+ long minpos = -RARRAY_LEN(ary) - 1;
+ if (pos < minpos) {
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ pos, minpos);
+ }
+ pos++;
}
- rb_ary_splice(ary, pos, 0, rb_ary_new4(argc - 1, argv + 1));
+ rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
return ary;
}
+static VALUE
+rb_ary_length(VALUE ary);
+
+static VALUE
+ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
+{
+ return rb_ary_length(ary);
+}
+
/*
* call-seq:
- * ary.each {|item| block } -> ary
- * ary.each -> an_enumerator
+ * array.each {|element| ... } -> self
+ * array.each -> Enumerator
+ *
+ * Iterates over array elements.
+ *
+ * When a block given, passes each successive array element to the block;
+ * returns +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.each {|element| puts "#{element.class} #{element}" }
+ *
+ * Output:
+ *
+ * Symbol foo
+ * String bar
+ * Integer 2
*
- * Calls <i>block</i> once for each element in +self+, passing that
- * element as a parameter.
+ * Allows the array to be modified during iteration:
*
- * If no block is given, an enumerator is returned instead.
+ * a = [:foo, 'bar', 2]
+ * a.each {|element| puts element; a.clear if element.to_s.start_with?('b') }
*
- * a = [ "a", "b", "c" ]
- * a.each {|x| print x, " -- " }
+ * Output:
*
- * produces:
+ * foo
+ * bar
*
- * a -- b -- c --
+ * When no block given, returns a new \Enumerator:
+ * a = [:foo, 'bar', 2]
+ *
+ * e = a.each
+ * e # => #<Enumerator: [:foo, "bar", 2]:each>
+ * a1 = e.each {|element| puts "#{element.class} #{element}" }
+ *
+ * Output:
+ *
+ * Symbol foo
+ * String bar
+ * Integer 2
+ *
+ * Related: #each_index, #reverse_each.
*/
VALUE
rb_ary_each(VALUE ary)
{
long i;
-
- RETURN_ENUMERATOR(ary, 0, 0);
+ ary_verify(ary);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_yield(RARRAY_PTR(ary)[i]);
+ rb_yield(RARRAY_AREF(ary, i));
}
return ary;
}
/*
* call-seq:
- * ary.each_index {|index| block } -> ary
- * ary.each_index -> an_enumerator
+ * array.each_index {|index| ... } -> self
+ * array.each_index -> Enumerator
+ *
+ * Iterates over array indexes.
+ *
+ * When a block given, passes each successive array index to the block;
+ * returns +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.each_index {|index| puts "#{index} #{a[index]}" }
*
- * Same as <code>Array#each</code>, but passes the index of the element
- * instead of the element itself.
+ * Output:
*
- * If no block is given, an enumerator is returned instead.
+ * 0 foo
+ * 1 bar
+ * 2 2
*
+ * Allows the array to be modified during iteration:
*
- * a = [ "a", "b", "c" ]
- * a.each_index {|x| print x, " -- " }
+ * a = [:foo, 'bar', 2]
+ * a.each_index {|index| puts index; a.clear if index > 0 }
*
- * produces:
+ * Output:
*
- * 0 -- 1 -- 2 --
+ * 0
+ * 1
+ *
+ * When no block given, returns a new \Enumerator:
+ *
+ * a = [:foo, 'bar', 2]
+ * e = a.each_index
+ * e # => #<Enumerator: [:foo, "bar", 2]:each_index>
+ * a1 = e.each {|index| puts "#{index} #{a[index]}"}
+ *
+ * Output:
+ *
+ * 0 foo
+ * 1 bar
+ * 2 2
+ *
+ * Related: #each, #reverse_each.
*/
static VALUE
rb_ary_each_index(VALUE ary)
{
long i;
- RETURN_ENUMERATOR(ary, 0, 0);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_yield(LONG2NUM(i));
+ rb_yield(LONG2NUM(i));
}
return ary;
}
/*
* call-seq:
- * ary.reverse_each {|item| block } -> ary
- * ary.reverse_each -> an_enumerator
+ * array.reverse_each {|element| ... } -> self
+ * array.reverse_each -> Enumerator
+ *
+ * Iterates backwards over array elements.
+ *
+ * When a block given, passes, in reverse order, each element to the block;
+ * returns +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.reverse_each {|element| puts "#{element.class} #{element}" }
*
- * Same as <code>Array#each</code>, but traverses +self+ in reverse
- * order.
+ * Output:
*
- * a = [ "a", "b", "c" ]
- * a.reverse_each {|x| print x, " " }
+ * Integer 2
+ * String bar
+ * Symbol foo
*
- * produces:
+ * Allows the array to be modified during iteration:
*
- * c b a
+ * a = [:foo, 'bar', 2]
+ * a.reverse_each {|element| puts element; a.clear if element.to_s.start_with?('b') }
+ *
+ * Output:
+ *
+ * 2
+ * bar
+ *
+ * When no block given, returns a new \Enumerator:
+ *
+ * a = [:foo, 'bar', 2]
+ * e = a.reverse_each
+ * e # => #<Enumerator: [:foo, "bar", 2]:reverse_each>
+ * a1 = e.each {|element| puts "#{element.class} #{element}" }
+ *
+ * Output:
+ *
+ * Integer 2
+ * String bar
+ * Symbol foo
+ *
+ * Related: #each, #each_index.
*/
static VALUE
@@ -1529,24 +2849,24 @@ rb_ary_reverse_each(VALUE ary)
{
long len;
- RETURN_ENUMERATOR(ary, 0, 0);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
len = RARRAY_LEN(ary);
while (len--) {
- rb_yield(RARRAY_PTR(ary)[len]);
- if (RARRAY_LEN(ary) < len) {
- len = RARRAY_LEN(ary);
- }
+ long nlen;
+ rb_yield(RARRAY_AREF(ary, len));
+ nlen = RARRAY_LEN(ary);
+ if (nlen < len) {
+ len = nlen;
+ }
}
return ary;
}
/*
* call-seq:
- * ary.length -> int
+ * array.length -> an_integer
*
- * Returns the number of elements in +self+. May be zero.
- *
- * [ 1, 2, 3, 4, 5 ].length #=> 5
+ * Returns the count of elements in +self+.
*/
static VALUE
@@ -1558,39 +2878,40 @@ rb_ary_length(VALUE ary)
/*
* call-seq:
- * ary.empty? -> true or false
- *
- * Returns <code>true</code> if +self+ contains no elements.
+ * array.empty? -> true or false
*
- * [].empty? #=> true
+ * Returns +true+ if the count of elements in +self+ is zero,
+ * +false+ otherwise.
*/
static VALUE
rb_ary_empty_p(VALUE ary)
{
- if (RARRAY_LEN(ary) == 0)
- return Qtrue;
- return Qfalse;
+ return RBOOL(RARRAY_LEN(ary) == 0);
}
VALUE
rb_ary_dup(VALUE ary)
{
- VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
- MEMCPY(RARRAY_PTR(dup), RARRAY_PTR(ary), VALUE, RARRAY_LEN(ary));
- ARY_SET_LEN(dup, RARRAY_LEN(ary));
+ long len = RARRAY_LEN(ary);
+ VALUE dup = rb_ary_new2(len);
+ ary_memcpy(dup, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary));
+ ARY_SET_LEN(dup, len);
+
+ ary_verify(ary);
+ ary_verify(dup);
return dup;
}
VALUE
rb_ary_resurrect(VALUE ary)
{
- return rb_ary_new4(RARRAY_LEN(ary), RARRAY_PTR(ary));
+ return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
}
extern VALUE rb_output_fs;
-static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result);
+static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
static VALUE
recursive_join(VALUE obj, VALUE argp, int recur)
@@ -1599,77 +2920,87 @@ recursive_join(VALUE obj, VALUE argp, int recur)
VALUE ary = arg[0];
VALUE sep = arg[1];
VALUE result = arg[2];
+ int *first = (int *)arg[3];
if (recur) {
- rb_raise(rb_eArgError, "recursive array join");
+ rb_raise(rb_eArgError, "recursive array join");
}
else {
- ary_join_1(obj, ary, sep, 0, result);
+ ary_join_1(obj, ary, sep, 0, result, first);
}
return Qnil;
}
-static void
+static long
ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
{
long i;
VALUE val;
+ if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
for (i=0; i<max; i++) {
- val = RARRAY_PTR(ary)[i];
- if (i > 0 && !NIL_P(sep))
- rb_str_buf_append(result, sep);
- rb_str_buf_append(result, val);
- if (OBJ_TAINTED(val)) OBJ_TAINT(result);
- if (OBJ_UNTRUSTED(val)) OBJ_TAINT(result);
+ val = RARRAY_AREF(ary, i);
+ if (!RB_TYPE_P(val, T_STRING)) break;
+ if (i > 0 && !NIL_P(sep))
+ rb_str_buf_append(result, sep);
+ rb_str_buf_append(result, val);
}
+ return i;
}
static void
-ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result)
+ary_join_1_str(VALUE dst, VALUE src, int *first)
+{
+ rb_str_buf_append(dst, src);
+ if (*first) {
+ rb_enc_copy(dst, src);
+ *first = FALSE;
+ }
+}
+
+static void
+ary_join_1_ary(VALUE obj, VALUE ary, VALUE sep, VALUE result, VALUE val, int *first)
+{
+ if (val == ary) {
+ rb_raise(rb_eArgError, "recursive array join");
+ }
+ else {
+ VALUE args[4];
+
+ *first = FALSE;
+ args[0] = val;
+ args[1] = sep;
+ args[2] = result;
+ args[3] = (VALUE)first;
+ rb_exec_recursive(recursive_join, obj, (VALUE)args);
+ }
+}
+
+static void
+ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
{
VALUE val, tmp;
for (; i<RARRAY_LEN(ary); i++) {
- if (i > 0 && !NIL_P(sep))
- rb_str_buf_append(result, sep);
-
- val = RARRAY_PTR(ary)[i];
- switch (TYPE(val)) {
- case T_STRING:
- str_join:
- rb_str_buf_append(result, val);
- break;
- case T_ARRAY:
- obj = val;
- ary_join:
- if (val == ary) {
- rb_raise(rb_eArgError, "recursive array join");
- }
- else {
- VALUE args[3];
-
- args[0] = val;
- args[1] = sep;
- args[2] = result;
- rb_exec_recursive(recursive_join, obj, (VALUE)args);
- }
- break;
- default:
- tmp = rb_check_string_type(val);
- if (!NIL_P(tmp)) {
- val = tmp;
- goto str_join;
- }
- tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
- if (!NIL_P(tmp)) {
- obj = val;
- val = tmp;
- goto ary_join;
- }
- val = rb_obj_as_string(val);
- goto str_join;
- }
+ if (i > 0 && !NIL_P(sep))
+ rb_str_buf_append(result, sep);
+
+ val = RARRAY_AREF(ary, i);
+ if (RB_TYPE_P(val, T_STRING)) {
+ ary_join_1_str(result, val, first);
+ }
+ else if (RB_TYPE_P(val, T_ARRAY)) {
+ ary_join_1_ary(val, ary, sep, result, val, first);
+ }
+ else if (!NIL_P(tmp = rb_check_string_type(val))) {
+ ary_join_1_str(result, tmp, first);
+ }
+ else if (!NIL_P(tmp = rb_check_array_type(val))) {
+ ary_join_1_ary(val, ary, sep, result, tmp, first);
+ }
+ else {
+ ary_join_1_str(result, rb_obj_as_string(val), first);
+ }
}
}
@@ -1677,37 +3008,36 @@ VALUE
rb_ary_join(VALUE ary, VALUE sep)
{
long len = 1, i;
- int taint = FALSE;
- int untrust = FALSE;
VALUE val, tmp, result;
- if (RARRAY_LEN(ary) == 0) return rb_str_new(0, 0);
- if (OBJ_TAINTED(ary) || OBJ_TAINTED(sep)) taint = TRUE;
- if (OBJ_UNTRUSTED(ary) || OBJ_UNTRUSTED(sep)) untrust = TRUE;
+ if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
if (!NIL_P(sep)) {
- StringValue(sep);
- len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+ StringValue(sep);
+ len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
}
for (i=0; i<RARRAY_LEN(ary); i++) {
- val = RARRAY_PTR(ary)[i];
- tmp = rb_check_string_type(val);
-
- if (NIL_P(tmp) || tmp != val) {
- result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
- if (taint) OBJ_TAINT(result);
- if (untrust) OBJ_UNTRUST(result);
- ary_join_0(ary, sep, i, result);
- ary_join_1(ary, ary, sep, i, result);
- return result;
- }
+ val = RARRAY_AREF(ary, i);
+ tmp = rb_check_string_type(val);
+
+ if (NIL_P(tmp) || tmp != val) {
+ int first;
+ long n = RARRAY_LEN(ary);
+ if (i > n) i = n;
+ result = rb_str_buf_new(len + (n-i)*10);
+ rb_enc_associate(result, rb_usascii_encoding());
+ i = ary_join_0(ary, sep, i, result);
+ first = i == 0;
+ ary_join_1(ary, ary, sep, i, result, &first);
+ return result;
+ }
- len += RSTRING_LEN(tmp);
+ len += RSTRING_LEN(tmp);
}
- result = rb_str_buf_new(len);
- if (taint) OBJ_TAINT(result);
- if (untrust) OBJ_UNTRUST(result);
+ result = rb_str_new(0, len);
+ rb_str_set_len(result, 0);
+
ary_join_0(ary, sep, RARRAY_LEN(ary), result);
return result;
@@ -1715,22 +3045,43 @@ rb_ary_join(VALUE ary, VALUE sep)
/*
* call-seq:
- * ary.join(sep=$,) -> str
+ * array.join ->new_string
+ * array.join(separator = $,) -> new_string
+ *
+ * Returns the new \String formed by joining the array elements after conversion.
+ * For each element +element+:
+ *
+ * - Uses <tt>element.to_s</tt> if +element+ is not a <tt>kind_of?(Array)</tt>.
+ * - Uses recursive <tt>element.join(separator)</tt> if +element+ is a <tt>kind_of?(Array)</tt>.
+ *
+ * With no argument, joins using the output field separator, <tt>$,</tt>:
+ *
+ * a = [:foo, 'bar', 2]
+ * $, # => nil
+ * a.join # => "foobar2"
*
- * Returns a string created by converting each element of the array to
- * a string, separated by <i>sep</i>.
+ * With \string argument +separator+, joins using that separator:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.join("\n") # => "foo\nbar\n2"
+ *
+ * Joins recursively for nested Arrays:
+ *
+ * a = [:foo, [:bar, [:baz, :bat]]]
+ * a.join # => "foobarbazbat"
*
- * [ "a", "b", "c" ].join #=> "abc"
- * [ "a", "b", "c" ].join("-") #=> "a-b-c"
*/
-
static VALUE
rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
{
VALUE sep;
- rb_scan_args(argc, argv, "01", &sep);
- if (NIL_P(sep)) sep = rb_output_fs;
+ if (rb_check_arity(argc, 0, 1) == 0 || NIL_P(sep = argv[0])) {
+ sep = rb_output_fs;
+ if (!NIL_P(sep)) {
+ rb_category_warn(RB_WARN_CATEGORY_DEPRECATED, "$, is set to non-nil value");
+ }
+ }
return rb_ary_join(ary, sep);
}
@@ -1738,32 +3089,32 @@ rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
static VALUE
inspect_ary(VALUE ary, VALUE dummy, int recur)
{
- int tainted = OBJ_TAINTED(ary);
- int untrust = OBJ_UNTRUSTED(ary);
long i;
VALUE s, str;
- if (recur) return rb_tainted_str_new2("[...]");
+ if (recur) return rb_usascii_str_new_cstr("[...]");
str = rb_str_buf_new2("[");
for (i=0; i<RARRAY_LEN(ary); i++) {
- s = rb_inspect(RARRAY_PTR(ary)[i]);
- if (OBJ_TAINTED(s)) tainted = TRUE;
- if (OBJ_UNTRUSTED(s)) untrust = TRUE;
- if (i > 0) rb_str_buf_cat2(str, ", ");
- rb_str_buf_append(str, s);
+ s = rb_inspect(RARRAY_AREF(ary, i));
+ if (i > 0) rb_str_buf_cat2(str, ", ");
+ else rb_enc_copy(str, s);
+ rb_str_buf_append(str, s);
}
rb_str_buf_cat2(str, "]");
- if (tainted) OBJ_TAINT(str);
- if (untrust) OBJ_UNTRUST(str);
return str;
}
/*
* call-seq:
- * ary.to_s -> string
- * ary.inspect -> string
+ * array.inspect -> new_string
+ *
+ * Returns the new \String formed by calling method <tt>#inspect</tt>
+ * on each array element:
*
- * Creates a string representation of +self+.
+ * a = [:foo, 'bar', 2]
+ * a.inspect # => "[:foo, \"bar\", 2]"
+ *
+ * Array#to_s is an alias for Array#inspect.
*/
static VALUE
@@ -1781,26 +3132,88 @@ rb_ary_to_s(VALUE ary)
/*
* call-seq:
- * ary.to_a -> ary
+ * to_a -> self or new_array
+ *
+ * When +self+ is an instance of \Array, returns +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.to_a # => [:foo, "bar", 2]
+ *
+ * Otherwise, returns a new \Array containing the elements of +self+:
+ *
+ * class MyArray < Array; end
+ * a = MyArray.new(['foo', 'bar', 'two'])
+ * a.instance_of?(Array) # => false
+ * a.kind_of?(Array) # => true
+ * a1 = a.to_a
+ * a1 # => ["foo", "bar", "two"]
+ * a1.class # => Array # Not MyArray
*
- * Returns +self+. If called on a subclass of Array, converts
- * the receiver to an Array object.
*/
static VALUE
rb_ary_to_a(VALUE ary)
{
if (rb_obj_class(ary) != rb_cArray) {
- VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
- rb_ary_replace(dup, ary);
- return dup;
+ VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+ rb_ary_replace(dup, ary);
+ return dup;
}
return ary;
}
/*
* call-seq:
- * ary.to_ary -> ary
+ * array.to_h -> new_hash
+ * array.to_h {|item| ... } -> new_hash
+ *
+ * Returns a new \Hash formed from +self+.
+ *
+ * When a block is given, calls the block with each array element;
+ * the block must return a 2-element \Array whose two elements
+ * form a key-value pair in the returned \Hash:
+ *
+ * a = ['foo', :bar, 1, [2, 3], {baz: 4}]
+ * h = a.to_h {|item| [item, item] }
+ * h # => {"foo"=>"foo", :bar=>:bar, 1=>1, [2, 3]=>[2, 3], {:baz=>4}=>{:baz=>4}}
+ *
+ * When no block is given, +self+ must be an \Array of 2-element sub-arrays,
+ * each sub-array is formed into a key-value pair in the new \Hash:
+ *
+ * [].to_h # => {}
+ * a = [['foo', 'zero'], ['bar', 'one'], ['baz', 'two']]
+ * h = a.to_h
+ * h # => {"foo"=>"zero", "bar"=>"one", "baz"=>"two"}
+ *
+ */
+
+static VALUE
+rb_ary_to_h(VALUE ary)
+{
+ long i;
+ VALUE hash = rb_hash_new_with_size(RARRAY_LEN(ary));
+ int block_given = rb_block_given_p();
+
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ const VALUE e = rb_ary_elt(ary, i);
+ const VALUE elt = block_given ? rb_yield_force_blockarg(e) : e;
+ const VALUE key_value_pair = rb_check_array_type(elt);
+ if (NIL_P(key_value_pair)) {
+ rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
+ rb_obj_class(elt), i);
+ }
+ if (RARRAY_LEN(key_value_pair) != 2) {
+ rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
+ i, RARRAY_LEN(key_value_pair));
+ }
+ rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
+ }
+ return hash;
+}
+
+/*
+ * call-seq:
+ * array.to_ary -> self
*
* Returns +self+.
*/
@@ -1812,39 +3225,40 @@ rb_ary_to_ary_m(VALUE ary)
}
static void
-ary_reverse(p1, p2)
- VALUE *p1, *p2;
+ary_reverse(VALUE *p1, VALUE *p2)
{
while (p1 < p2) {
- VALUE tmp = *p1;
- *p1++ = *p2;
- *p2-- = tmp;
+ VALUE tmp = *p1;
+ *p1++ = *p2;
+ *p2-- = tmp;
}
}
VALUE
rb_ary_reverse(VALUE ary)
{
- VALUE *p1, *p2;
+ VALUE *p2;
+ long len = RARRAY_LEN(ary);
rb_ary_modify(ary);
- if (RARRAY_LEN(ary) > 1) {
- p1 = RARRAY_PTR(ary);
- p2 = p1 + RARRAY_LEN(ary) - 1; /* points last item */
- ary_reverse(p1, p2);
+ if (len > 1) {
+ RARRAY_PTR_USE_TRANSIENT(ary, p1, {
+ p2 = p1 + len - 1; /* points last item */
+ ary_reverse(p1, p2);
+ }); /* WB: no new reference */
}
return ary;
}
/*
* call-seq:
- * ary.reverse! -> ary
+ * array.reverse! -> self
+ *
+ * Reverses +self+ in place:
*
- * Reverses +self+ in place.
+ * a = ['foo', 'bar', 'two']
+ * a.reverse! # => ["two", "bar", "foo"]
*
- * a = [ "a", "b", "c" ]
- * a.reverse! #=> ["c", "b", "a"]
- * a #=> ["c", "b", "a"]
*/
static VALUE
@@ -1855,12 +3269,14 @@ rb_ary_reverse_bang(VALUE ary)
/*
* call-seq:
- * ary.reverse -> new_ary
+ * array.reverse -> new_array
*
- * Returns a new array containing +self+'s elements in reverse order.
+ * Returns a new \Array with the elements of +self+ in reverse order:
+ *
+ * a = ['foo', 'bar', 'two']
+ * a1 = a.reverse
+ * a1 # => ["two", "bar", "foo"]
*
- * [ "a", "b", "c" ].reverse #=> ["c", "b", "a"]
- * [ 1 ].reverse #=> [1]
*/
static VALUE
@@ -1870,9 +3286,9 @@ rb_ary_reverse_m(VALUE ary)
VALUE dup = rb_ary_new2(len);
if (len > 0) {
- VALUE *p1 = RARRAY_PTR(ary);
- VALUE *p2 = RARRAY_PTR(dup) + len - 1;
- do *p2-- = *p1++; while (--len > 0);
+ const VALUE *p1 = RARRAY_CONST_PTR_TRANSIENT(ary);
+ VALUE *p2 = (VALUE *)RARRAY_CONST_PTR_TRANSIENT(dup) + len - 1;
+ do *p2-- = *p1++; while (--len > 0);
}
ARY_SET_LEN(dup, RARRAY_LEN(ary));
return dup;
@@ -1884,92 +3300,161 @@ rotate_count(long cnt, long len)
return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
}
+static void
+ary_rotate_ptr(VALUE *ptr, long len, long cnt)
+{
+ if (cnt == 1) {
+ VALUE tmp = *ptr;
+ memmove(ptr, ptr + 1, sizeof(VALUE)*(len - 1));
+ *(ptr + len - 1) = tmp;
+ }
+ else if (cnt == len - 1) {
+ VALUE tmp = *(ptr + len - 1);
+ memmove(ptr + 1, ptr, sizeof(VALUE)*(len - 1));
+ *ptr = tmp;
+ }
+ else {
+ --len;
+ if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+ if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+ if (len > 0) ary_reverse(ptr, ptr + len);
+ }
+}
+
VALUE
rb_ary_rotate(VALUE ary, long cnt)
{
rb_ary_modify(ary);
if (cnt != 0) {
- VALUE *ptr = RARRAY_PTR(ary);
- long len = RARRAY_LEN(ary);
-
- if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
- --len;
- if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
- if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
- if (len > 0) ary_reverse(ptr, ptr + len);
- return ary;
- }
+ long len = RARRAY_LEN(ary);
+ if (len > 1 && (cnt = rotate_count(cnt, len)) > 0) {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, ary_rotate_ptr(ptr, len, cnt));
+ return ary;
+ }
}
-
return Qnil;
}
/*
* call-seq:
- * ary.rotate!(cnt=1) -> ary
+ * array.rotate! -> self
+ * array.rotate!(count) -> self
+ *
+ * Rotates +self+ in place by moving elements from one end to the other; returns +self+.
+ *
+ * When no argument given, rotates the first element to the last position:
+ *
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.rotate! # => ["bar", 2, "bar", :foo]
+ *
+ * When given a non-negative \Integer +count+,
+ * rotates +count+ elements from the beginning to the end:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(2)
+ * a # => [2, :foo, "bar"]
*
- * Rotates +self+ in place so that the element at +cnt+ comes first,
- * and returns +self+. If +cnt+ is negative then it rotates in
- * counter direction.
+ * If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(20)
+ * a # => [2, :foo, "bar"]
+ *
+ * If +count+ is zero, returns +self+ unmodified:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(0)
+ * a # => [:foo, "bar", 2]
+ *
+ * When given a negative Integer +count+, rotates in the opposite direction,
+ * from end to beginning:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(-2)
+ * a # => ["bar", 2, :foo]
+ *
+ * If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(-5)
+ * a # => ["bar", 2, :foo]
*
- * a = [ "a", "b", "c", "d" ]
- * a.rotate! #=> ["b", "c", "d", "a"]
- * a #=> ["b", "c", "d", "a"]
- * a.rotate!(2) #=> ["d", "a", "b", "c"]
- * a.rotate!(-3) #=> ["a", "b", "c", "d"]
*/
static VALUE
rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
{
- long n = 1;
-
- switch (argc) {
- case 1: n = NUM2LONG(argv[0]);
- case 0: break;
- default: rb_scan_args(argc, argv, "01", NULL);
- }
+ long n = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
rb_ary_rotate(ary, n);
return ary;
}
/*
* call-seq:
- * ary.rotate([cnt = 1]) -> new_ary
+ * array.rotate -> new_array
+ * array.rotate(count) -> new_array
+ *
+ * Returns a new \Array formed from +self+ with elements
+ * rotated from one end to the other.
+ *
+ * When no argument given, returns a new \Array that is like +self+,
+ * except that the first element has been rotated to the last position:
+ *
+ * a = [:foo, 'bar', 2, 'bar']
+ * a1 = a.rotate
+ * a1 # => ["bar", 2, "bar", :foo]
+ *
+ * When given a non-negative \Integer +count+,
+ * returns a new \Array with +count+ elements rotated from the beginning to the end:
+ *
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(2)
+ * a1 # => [2, :foo, "bar"]
+ *
+ * If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ *
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(20)
+ * a1 # => [2, :foo, "bar"]
+ *
+ * If +count+ is zero, returns a copy of +self+, unmodified:
*
- * Returns new array by rotating +self+, whose first element is the
- * element at +cnt+ in +self+. If +cnt+ is negative then it rotates
- * in counter direction.
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(0)
+ * a1 # => [:foo, "bar", 2]
+ *
+ * When given a negative \Integer +count+, rotates in the opposite direction,
+ * from end to beginning:
+ *
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(-2)
+ * a1 # => ["bar", 2, :foo]
+ *
+ * If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(-5)
+ * a1 # => ["bar", 2, :foo]
*
- * a = [ "a", "b", "c", "d" ]
- * a.rotate #=> ["b", "c", "d", "a"]
- * a #=> ["a", "b", "c", "d"]
- * a.rotate(2) #=> ["c", "d", "a", "b"]
- * a.rotate(-3) #=> ["b", "c", "d", "a"]
*/
static VALUE
rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
{
- VALUE rotated, *ptr, *ptr2;
- long len, cnt = 1;
-
- switch (argc) {
- case 1: cnt = NUM2LONG(argv[0]);
- case 0: break;
- default: rb_scan_args(argc, argv, "01", NULL);
- }
+ VALUE rotated;
+ const VALUE *ptr;
+ long len;
+ long cnt = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
len = RARRAY_LEN(ary);
rotated = rb_ary_new2(len);
if (len > 0) {
- cnt = rotate_count(cnt, len);
- ptr = RARRAY_PTR(ary);
- ptr2 = RARRAY_PTR(rotated);
- len -= cnt;
- MEMCPY(ptr2, ptr + cnt, VALUE, len);
- MEMCPY(ptr2 + len, ptr, VALUE, cnt);
+ cnt = rotate_count(cnt, len);
+ ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
+ len -= cnt;
+ ary_memcpy(rotated, 0, len, ptr + cnt);
+ ary_memcpy(rotated, len, cnt, ptr);
}
ARY_SET_LEN(rotated, RARRAY_LEN(ary));
return rotated;
@@ -1977,46 +3462,41 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
struct ary_sort_data {
VALUE ary;
- int opt_methods;
- int opt_inited;
-};
-
-enum {
- sort_opt_Fixnum,
- sort_opt_String,
- sort_optimizable_count
+ VALUE receiver;
};
-#define STRING_P(s) (TYPE(s) == T_STRING && CLASS_OF(s) == rb_cString)
-
-#define SORT_OPTIMIZABLE_BIT(type) (1U << TOKEN_PASTE(sort_opt_,type))
-#define SORT_OPTIMIZABLE(data, type) \
- (((data)->opt_inited & SORT_OPTIMIZABLE_BIT(type)) ? \
- ((data)->opt_methods & SORT_OPTIMIZABLE_BIT(type)) : \
- (((data)->opt_inited |= SORT_OPTIMIZABLE_BIT(type)), \
- rb_method_basic_definition_p(TOKEN_PASTE(rb_c,type), id_cmp) && \
- ((data)->opt_methods |= SORT_OPTIMIZABLE_BIT(type))))
-
static VALUE
sort_reentered(VALUE ary)
{
if (RBASIC(ary)->klass) {
- rb_raise(rb_eRuntimeError, "sort reentered");
+ rb_raise(rb_eRuntimeError, "sort reentered");
}
return Qnil;
}
+static void
+sort_returned(struct ary_sort_data *data)
+{
+ if (rb_obj_frozen_p(data->receiver)) {
+ rb_raise(rb_eFrozenError, "array frozen during sort");
+ }
+ sort_reentered(data->ary);
+}
+
static int
sort_1(const void *ap, const void *bp, void *dummy)
{
struct ary_sort_data *data = dummy;
VALUE retval = sort_reentered(data->ary);
VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+ VALUE args[2];
int n;
- retval = rb_yield_values(2, a, b);
+ args[0] = a;
+ args[1] = b;
+ retval = rb_yield_values2(2, args);
n = rb_cmpint(retval, a, b);
- sort_reentered(data->ary);
+ sort_returned(data);
return n;
}
@@ -2028,36 +3508,64 @@ sort_2(const void *ap, const void *bp, void *dummy)
VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
int n;
- if (FIXNUM_P(a) && FIXNUM_P(b) && SORT_OPTIMIZABLE(data, Fixnum)) {
- if ((long)a > (long)b) return 1;
- if ((long)a < (long)b) return -1;
- return 0;
+ if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(INTEGER)) {
+ if ((long)a > (long)b) return 1;
+ if ((long)a < (long)b) return -1;
+ return 0;
+ }
+ if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(STRING)) {
+ return rb_str_cmp(a, b);
}
- if (STRING_P(a) && STRING_P(b) && SORT_OPTIMIZABLE(data, String)) {
- return rb_str_cmp(a, b);
+ if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(FLOAT)) {
+ return rb_float_cmp(a, b);
}
- retval = rb_funcall(a, id_cmp, 1, b);
+ retval = rb_funcallv(a, id_cmp, 1, &b);
n = rb_cmpint(retval, a, b);
- sort_reentered(data->ary);
+ sort_returned(data);
return n;
}
/*
* call-seq:
- * ary.sort! -> ary
- * ary.sort! {| a,b | block } -> ary
- *
- * Sorts +self+. Comparisons for
- * the sort will be done using the <code><=></code> operator or using
- * an optional code block. The block implements a comparison between
- * <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
- * <code>Enumerable#sort_by</code>.
- *
- * a = [ "d", "a", "e", "c", "b" ]
- * a.sort #=> ["a", "b", "c", "d", "e"]
- * a.sort {|x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
+ * array.sort! -> self
+ * array.sort! {|a, b| ... } -> self
+ *
+ * Returns +self+ with its elements sorted in place.
+ *
+ * With no block, compares elements using operator <tt><=></tt>
+ * (see Comparable):
+ *
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a.sort!
+ * a # => ["a", "b", "c", "d", "e"]
+ *
+ * With a block, calls the block with each element pair;
+ * for each element pair +a+ and +b+, the block should return an integer:
+ *
+ * - Negative when +b+ is to follow +a+.
+ * - Zero when +a+ and +b+ are equivalent.
+ * - Positive when +a+ is to follow +b+.
+ *
+ * Example:
+ *
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a.sort! {|a, b| a <=> b }
+ * a # => ["a", "b", "c", "d", "e"]
+ * a.sort! {|a, b| b <=> a }
+ * a # => ["e", "d", "c", "b", "a"]
+ *
+ * When the block returns zero, the order for +a+ and +b+ is indeterminate,
+ * and may be unstable:
+ *
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a.sort! {|a, b| 0 }
+ * a # => ["d", "e", "c", "a", "b"]
+ *
*/
VALUE
@@ -2066,31 +3574,29 @@ rb_ary_sort_bang(VALUE ary)
rb_ary_modify(ary);
assert(!ARY_SHARED_P(ary));
if (RARRAY_LEN(ary) > 1) {
- VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
- struct ary_sort_data data;
-
- RBASIC(tmp)->klass = 0;
- data.ary = tmp;
- data.opt_methods = 0;
- data.opt_inited = 0;
- ruby_qsort(RARRAY_PTR(tmp), RARRAY_LEN(tmp), sizeof(VALUE),
- rb_block_given_p()?sort_1:sort_2, &data);
-
+ VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+ struct ary_sort_data data;
+ long len = RARRAY_LEN(ary);
+ RBASIC_CLEAR_CLASS(tmp);
+ data.ary = tmp;
+ data.receiver = ary;
+ RARRAY_PTR_USE(tmp, ptr, {
+ ruby_qsort(ptr, len, sizeof(VALUE),
+ rb_block_given_p()?sort_1:sort_2, &data);
+ }); /* WB: no new reference */
+ rb_ary_modify(ary);
if (ARY_EMBED_P(tmp)) {
- assert(ARY_EMBED_P(tmp));
if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
rb_ary_unshare(ary);
+ FL_SET_EMBED(ary);
}
- FL_SET_EMBED(ary);
- MEMCPY(RARRAY_PTR(ary), ARY_EMBED_PTR(tmp), VALUE, ARY_EMBED_LEN(tmp));
+ ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
}
else {
- assert(!ARY_EMBED_P(tmp));
- if (ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
- assert(!ARY_EMBED_P(ary));
+ if (!ARY_EMBED_P(ary) && ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
FL_UNSET_SHARED(ary);
- ARY_SET_CAPA(ary, ARY_CAPA(tmp));
+ ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
}
else {
assert(!ARY_SHARED_P(tmp));
@@ -2102,38 +3608,65 @@ rb_ary_sort_bang(VALUE ary)
rb_ary_unshare(ary);
}
else {
- xfree(ARY_HEAP_PTR(ary));
+ ary_heap_free(ary);
}
- ARY_SET_PTR(ary, RARRAY_PTR(tmp));
- ARY_SET_HEAP_LEN(ary, RARRAY_LEN(tmp));
- ARY_SET_CAPA(ary, ARY_CAPA(tmp));
+ ARY_SET_PTR(ary, ARY_HEAP_PTR(tmp));
+ ARY_SET_HEAP_LEN(ary, len);
+ ARY_SET_CAPA(ary, ARY_HEAP_LEN(tmp));
}
/* tmp was lost ownership for the ptr */
FL_UNSET(tmp, FL_FREEZE);
FL_SET_EMBED(tmp);
ARY_SET_EMBED_LEN(tmp, 0);
FL_SET(tmp, FL_FREEZE);
- }
+ }
/* tmp will be GC'ed. */
- RBASIC(tmp)->klass = rb_cArray;
+ RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
}
+ ary_verify(ary);
return ary;
}
/*
* call-seq:
- * ary.sort -> new_ary
- * ary.sort {| a,b | block } -> new_ary
- *
- * Returns a new array created by sorting +self+. Comparisons for
- * the sort will be done using the <code><=></code> operator or using
- * an optional code block. The block implements a comparison between
- * <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
- * <code>Enumerable#sort_by</code>.
- *
- * a = [ "d", "a", "e", "c", "b" ]
- * a.sort #=> ["a", "b", "c", "d", "e"]
- * a.sort {|x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
+ * array.sort -> new_array
+ * array.sort {|a, b| ... } -> new_array
+ *
+ * Returns a new \Array whose elements are those from +self+, sorted.
+ *
+ * With no block, compares elements using operator <tt><=></tt>
+ * (see Comparable):
+ *
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a1 = a.sort
+ * a1 # => ["a", "b", "c", "d", "e"]
+ *
+ * With a block, calls the block with each element pair;
+ * for each element pair +a+ and +b+, the block should return an integer:
+ *
+ * - Negative when +b+ is to follow +a+.
+ * - Zero when +a+ and +b+ are equivalent.
+ * - Positive when +a+ is to follow +b+.
+ *
+ * Example:
+ *
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a1 = a.sort {|a, b| a <=> b }
+ * a1 # => ["a", "b", "c", "d", "e"]
+ * a2 = a.sort {|a, b| b <=> a }
+ * a2 # => ["e", "d", "c", "b", "a"]
+ *
+ * When the block returns zero, the order for +a+ and +b+ is indeterminate,
+ * and may be unstable:
+ *
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a1 = a.sort {|a, b| 0 }
+ * a1 # => ["c", "e", "b", "d", "a"]
+ *
+ * Related: Enumerable#sort_by.
*/
VALUE
@@ -2144,22 +3677,115 @@ rb_ary_sort(VALUE ary)
return ary;
}
+static VALUE rb_ary_bsearch_index(VALUE ary);
+
+/*
+ * call-seq:
+ * array.bsearch {|element| ... } -> object
+ * array.bsearch -> new_enumerator
+ *
+ * Returns an element from +self+ selected by a binary search.
+ *
+ * See {Binary Searching}[rdoc-ref:bsearch.rdoc].
+ */
+
+static VALUE
+rb_ary_bsearch(VALUE ary)
+{
+ VALUE index_result = rb_ary_bsearch_index(ary);
+
+ if (FIXNUM_P(index_result)) {
+ return rb_ary_entry(ary, FIX2LONG(index_result));
+ }
+ return index_result;
+}
+
+/*
+ * call-seq:
+ * array.bsearch_index {|element| ... } -> integer or nil
+ * array.bsearch_index -> new_enumerator
+ *
+ * Searches +self+ as described at method #bsearch,
+ * but returns the _index_ of the found element instead of the element itself.
+ */
+
+static VALUE
+rb_ary_bsearch_index(VALUE ary)
+{
+ long low = 0, high = RARRAY_LEN(ary), mid;
+ int smaller = 0, satisfied = 0;
+ VALUE v, val;
+
+ RETURN_ENUMERATOR(ary, 0, 0);
+ while (low < high) {
+ mid = low + ((high - low) / 2);
+ val = rb_ary_entry(ary, mid);
+ v = rb_yield(val);
+ if (FIXNUM_P(v)) {
+ if (v == INT2FIX(0)) return INT2FIX(mid);
+ smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
+ }
+ else if (v == Qtrue) {
+ satisfied = 1;
+ smaller = 1;
+ }
+ else if (!RTEST(v)) {
+ smaller = 0;
+ }
+ else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
+ const VALUE zero = INT2FIX(0);
+ switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
+ case 0: return INT2FIX(mid);
+ case 1: smaller = 0; break;
+ case -1: smaller = 1;
+ }
+ }
+ else {
+ rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
+ " (must be numeric, true, false or nil)",
+ rb_obj_class(v));
+ }
+ if (smaller) {
+ high = mid;
+ }
+ else {
+ low = mid + 1;
+ }
+ }
+ if (!satisfied) return Qnil;
+ return INT2FIX(low);
+}
+
static VALUE
-sort_by_i(VALUE i)
+sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
{
return rb_yield(i);
}
/*
* call-seq:
- * ary.sort_by! {| obj | block } -> ary
- * ary.sort_by! -> an_enumerator
+ * array.sort_by! {|element| ... } -> self
+ * array.sort_by! -> new_enumerator
+ *
+ * Sorts the elements of +self+ in place,
+ * using an ordering determined by the block; returns self.
+ *
+ * Calls the block with each successive element;
+ * sorts elements based on the values returned from the block.
+ *
+ * For duplicates returned by the block, the ordering is indeterminate, and may be unstable.
+ *
+ * This example sorts strings based on their sizes:
*
- * Sorts +self+ in place using a set of keys generated by mapping the
- * values in +self+ through the given block.
+ * a = ['aaaa', 'bbb', 'cc', 'd']
+ * a.sort_by! {|element| element.size }
+ * a # => ["d", "cc", "bbb", "aaaa"]
*
- * If no block is given, an enumerator is returned instead.
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = ['aaaa', 'bbb', 'cc', 'd']
+ * a.sort_by! # => #<Enumerator: ["aaaa", "bbb", "cc", "d"]:sort_by!>
*
*/
@@ -2168,7 +3794,7 @@ rb_ary_sort_by_bang(VALUE ary)
{
VALUE sorted;
- RETURN_ENUMERATOR(ary, 0, 0);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
rb_ary_modify(ary);
sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
rb_ary_replace(ary, sorted);
@@ -2178,20 +3804,22 @@ rb_ary_sort_by_bang(VALUE ary)
/*
* call-seq:
- * ary.collect {|item| block } -> new_ary
- * ary.map {|item| block } -> new_ary
- * ary.collect -> an_enumerator
- * ary.map -> an_enumerator
+ * array.map {|element| ... } -> new_array
+ * array.map -> new_enumerator
*
- * Invokes <i>block</i> once for each element of +self+. Creates a
- * new array containing the values returned by the block.
- * See also <code>Enumerable#collect</code>.
+ * Calls the block, if given, with each element of +self+;
+ * returns a new \Array whose elements are the return values from the block:
*
- * If no block is given, an enumerator is returned instead.
+ * a = [:foo, 'bar', 2]
+ * a1 = a.map {|element| element.class }
+ * a1 # => [Symbol, String, Integer]
*
- * a = [ "a", "b", "c", "d" ]
- * a.collect {|x| x + "!" } #=> ["a!", "b!", "c!", "d!"]
- * a #=> ["a", "b", "c", "d"]
+ * Returns a new \Enumerator if no block given:
+ * a = [:foo, 'bar', 2]
+ * a1 = a.map
+ * a1 # => #<Enumerator: [:foo, "bar", 2]:map>
+ *
+ * Array#collect is an alias for Array#map.
*/
static VALUE
@@ -2200,10 +3828,10 @@ rb_ary_collect(VALUE ary)
long i;
VALUE collect;
- RETURN_ENUMERATOR(ary, 0, 0);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
collect = rb_ary_new2(RARRAY_LEN(ary));
for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_ary_push(collect, rb_yield(RARRAY_PTR(ary)[i]));
+ rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
}
return collect;
}
@@ -2211,20 +3839,22 @@ rb_ary_collect(VALUE ary)
/*
* call-seq:
- * ary.collect! {|item| block } -> ary
- * ary.map! {|item| block } -> ary
- * ary.collect -> an_enumerator
- * ary.map -> an_enumerator
+ * array.map! {|element| ... } -> self
+ * array.map! -> new_enumerator
*
- * Invokes the block once for each element of +self+, replacing the
- * element with the value returned by _block_.
- * See also <code>Enumerable#collect</code>.
+ * Calls the block, if given, with each element;
+ * replaces the element with the block's return value:
*
- * If no block is given, an enumerator is returned instead.
+ * a = [:foo, 'bar', 2]
+ * a.map! { |element| element.class } # => [Symbol, String, Integer]
*
- * a = [ "a", "b", "c", "d" ]
- * a.collect! {|x| x + "!" }
- * a #=> [ "a!", "b!", "c!", "d!" ]
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [:foo, 'bar', 2]
+ * a1 = a.map!
+ * a1 # => #<Enumerator: [:foo, "bar", 2]:map!>
+ *
+ * Array#collect! is an alias for Array#map!.
*/
static VALUE
@@ -2232,78 +3862,143 @@ rb_ary_collect_bang(VALUE ary)
{
long i;
- RETURN_ENUMERATOR(ary, 0, 0);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
rb_ary_modify(ary);
for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_ary_store(ary, i, rb_yield(RARRAY_PTR(ary)[i]));
+ rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
}
return ary;
}
VALUE
-rb_get_values_at(VALUE obj, long olen, int argc, VALUE *argv, VALUE (*func) (VALUE, long))
+rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func) (VALUE, long))
{
VALUE result = rb_ary_new2(argc);
long beg, len, i, j;
for (i=0; i<argc; i++) {
- if (FIXNUM_P(argv[i])) {
- rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
- continue;
- }
- /* check if idx is Range */
- switch (rb_range_beg_len(argv[i], &beg, &len, olen, 0)) {
- case Qfalse:
- break;
- case Qnil:
- continue;
- default:
- for (j=0; j<len; j++) {
- rb_ary_push(result, (*func)(obj, j+beg));
- }
- continue;
- }
- rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
+ if (FIXNUM_P(argv[i])) {
+ rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
+ continue;
+ }
+ /* check if idx is Range */
+ if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
+ long end = olen < beg+len ? olen : beg+len;
+ for (j = beg; j < end; j++) {
+ rb_ary_push(result, (*func)(obj, j));
+ }
+ if (beg + len > j)
+ rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
+ continue;
+ }
+ rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
}
return result;
}
+static VALUE
+append_values_at_single(VALUE result, VALUE ary, long olen, VALUE idx)
+{
+ long beg, len;
+ if (FIXNUM_P(idx)) {
+ beg = FIX2LONG(idx);
+ }
+ /* check if idx is Range */
+ else if (rb_range_beg_len(idx, &beg, &len, olen, 1)) {
+ if (len > 0) {
+ const VALUE *const src = RARRAY_CONST_PTR_TRANSIENT(ary);
+ const long end = beg + len;
+ const long prevlen = RARRAY_LEN(result);
+ if (beg < olen) {
+ rb_ary_cat(result, src + beg, end > olen ? olen-beg : len);
+ }
+ if (end > olen) {
+ rb_ary_store(result, prevlen + len - 1, Qnil);
+ }
+ }
+ return result;
+ }
+ else {
+ beg = NUM2LONG(idx);
+ }
+ return rb_ary_push(result, rb_ary_entry(ary, beg));
+}
+
/*
* call-seq:
- * ary.values_at(selector,... ) -> new_ary
- *
- * Returns an array containing the elements in
- * +self+ corresponding to the given selector(s). The selectors
- * may be either integer indices or ranges.
- * See also <code>Array#select</code>.
- *
- * a = %w{ a b c d e f }
- * a.values_at(1, 3, 5)
- * a.values_at(1, 3, 5, 7)
- * a.values_at(-1, -3, -5, -7)
- * a.values_at(1..3, 2...5)
+ * array.values_at(*indexes) -> new_array
+ *
+ * Returns a new \Array whose elements are the elements
+ * of +self+ at the given \Integer or \Range +indexes+.
+ *
+ * For each positive +index+, returns the element at offset +index+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.values_at(0, 2) # => [:foo, 2]
+ * a.values_at(0..1) # => [:foo, "bar"]
+ *
+ * The given +indexes+ may be in any order, and may repeat:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.values_at(2, 0, 1, 0, 2) # => [2, :foo, "bar", :foo, 2]
+ * a.values_at(1, 0..2) # => ["bar", :foo, "bar", 2]
+ *
+ * Assigns +nil+ for an +index+ that is too large:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.values_at(0, 3, 1, 3) # => [:foo, nil, "bar", nil]
+ *
+ * Returns a new empty \Array if no arguments given.
+ *
+ * For each negative +index+, counts backward from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.values_at(-1, -3) # => [2, :foo]
+ *
+ * Assigns +nil+ for an +index+ that is too small:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.values_at(0, -5, 1, -6, 2) # => [:foo, nil, "bar", nil, 2]
+ *
+ * The given +indexes+ may have a mixture of signs:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.values_at(0, -2, 1, -1) # => [:foo, "bar", "bar", 2]
+ *
*/
static VALUE
rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
{
- return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
+ long i, olen = RARRAY_LEN(ary);
+ VALUE result = rb_ary_new_capa(argc);
+ for (i = 0; i < argc; ++i) {
+ append_values_at_single(result, ary, olen, argv[i]);
+ }
+ RB_GC_GUARD(ary);
+ return result;
}
/*
* call-seq:
- * ary.select {|item| block } -> new_ary
- * ary.select -> an_enumerator
+ * array.select {|element| ... } -> new_array
+ * array.select -> new_enumerator
+ *
+ * Calls the block, if given, with each element of +self+;
+ * returns a new \Array containing those elements of +self+
+ * for which the block returns a truthy value:
+ *
+ * a = [:foo, 'bar', 2, :bam]
+ * a1 = a.select {|element| element.to_s.start_with?('b') }
+ * a1 # => ["bar", :bam]
*
- * Invokes the block passing in successive elements from +self+,
- * returning an array containing those elements for which the block
- * returns a true value (equivalent to <code>Enumerable#select</code>).
+ * Returns a new \Enumerator if no block given:
*
- * If no block is given, an enumerator is returned instead.
+ * a = [:foo, 'bar', 2, :bam]
+ * a.select # => #<Enumerator: [:foo, "bar", 2, :bam]:select>
*
- * a = %w{ a b c d e f }
- * a.select {|v| v =~ /[aeiou]/} #=> ["a", "e"]
+ * Array#filter is an alias for Array#select.
*/
static VALUE
@@ -2312,93 +4007,170 @@ rb_ary_select(VALUE ary)
VALUE result;
long i;
- RETURN_ENUMERATOR(ary, 0, 0);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
result = rb_ary_new2(RARRAY_LEN(ary));
for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (RTEST(rb_yield(RARRAY_PTR(ary)[i]))) {
- rb_ary_push(result, rb_ary_elt(ary, i));
- }
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+ rb_ary_push(result, rb_ary_elt(ary, i));
+ }
}
return result;
}
+struct select_bang_arg {
+ VALUE ary;
+ long len[2];
+};
+
+static VALUE
+select_bang_i(VALUE a)
+{
+ volatile struct select_bang_arg *arg = (void *)a;
+ VALUE ary = arg->ary;
+ long i1, i2;
+
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+ VALUE v = RARRAY_AREF(ary, i1);
+ if (!RTEST(rb_yield(v))) continue;
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, v);
+ }
+ arg->len[1] = ++i2;
+ }
+ return (i1 == i2) ? Qnil : ary;
+}
+
+static VALUE
+select_bang_ensure(VALUE a)
+{
+ volatile struct select_bang_arg *arg = (void *)a;
+ VALUE ary = arg->ary;
+ long len = RARRAY_LEN(ary);
+ long i1 = arg->len[0], i2 = arg->len[1];
+
+ if (i2 < len && i2 < i1) {
+ long tail = 0;
+ rb_ary_modify(ary);
+ if (i1 < len) {
+ tail = len - i1;
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
+ });
+ }
+ ARY_SET_LEN(ary, i2 + tail);
+ }
+ return ary;
+}
+
/*
* call-seq:
- * ary.select! {|item| block } -> new_ary or nil
- * ary.select! -> an_enumerator
+ * array.select! {|element| ... } -> self or nil
+ * array.select! -> new_enumerator
+ *
+ * Calls the block, if given with each element of +self+;
+ * removes from +self+ those elements for which the block returns +false+ or +nil+.
+ *
+ * Returns +self+ if any elements were removed:
+ *
+ * a = [:foo, 'bar', 2, :bam]
+ * a.select! {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
*
- * Invokes the block passing in successive elements from
- * +self+, deleting elements for which the block returns a
- * false value. It returns +self+ if changes were made,
- * otherwise it returns <code>nil</code>.
- * See also <code>Array#keep_if</code>
+ * Returns +nil+ if no elements were removed.
*
- * If no block is given, an enumerator is returned instead.
+ * Returns a new \Enumerator if no block given:
*
+ * a = [:foo, 'bar', 2, :bam]
+ * a.select! # => #<Enumerator: [:foo, "bar", 2, :bam]:select!>
+ *
+ * Array#filter! is an alias for Array#select!.
*/
static VALUE
rb_ary_select_bang(VALUE ary)
{
- long i1, i2;
+ struct select_bang_arg args;
- RETURN_ENUMERATOR(ary, 0, 0);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
rb_ary_modify(ary);
- for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
- VALUE v = RARRAY_PTR(ary)[i1];
- if (!RTEST(rb_yield(v))) continue;
- if (i1 != i2) {
- rb_ary_store(ary, i2, v);
- }
- i2++;
- }
- if (RARRAY_LEN(ary) == i2) return Qnil;
- if (i2 < RARRAY_LEN(ary))
- ARY_SET_LEN(ary, i2);
- return ary;
+ args.ary = ary;
+ args.len[0] = args.len[1] = 0;
+ return rb_ensure(select_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
}
/*
* call-seq:
- * ary.keep_if {|item| block } -> ary
- * ary.keep_if -> an_enumerator
+ * array.keep_if {|element| ... } -> self
+ * array.keep_if -> new_enumeration
+ *
+ * Retains those elements for which the block returns a truthy value;
+ * deletes all other elements; returns +self+:
*
- * Deletes every element of +self+ for which <i>block</i> evaluates
- * to false.
- * See also <code>Array#select!</code>
+ * a = [:foo, 'bar', 2, :bam]
+ * a.keep_if {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
*
- * If no block is given, an enumerator is returned instead.
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [:foo, 'bar', 2, :bam]
+ * a.keep_if # => #<Enumerator: [:foo, "bar", 2, :bam]:keep_if>
*
- * a = %w{ a b c d e f }
- * a.keep_if {|v| v =~ /[aeiou]/} #=> ["a", "e"]
*/
static VALUE
rb_ary_keep_if(VALUE ary)
{
- RETURN_ENUMERATOR(ary, 0, 0);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
rb_ary_select_bang(ary);
return ary;
}
+static void
+ary_resize_smaller(VALUE ary, long len)
+{
+ rb_ary_modify(ary);
+ if (RARRAY_LEN(ary) > len) {
+ ARY_SET_LEN(ary, len);
+ if (len * 2 < ARY_CAPA(ary) &&
+ ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+ ary_resize_capa(ary, len * 2);
+ }
+ }
+}
+
/*
* call-seq:
- * ary.delete(obj) -> obj or nil
- * ary.delete(obj) { block } -> obj or nil
- *
- * Deletes items from +self+ that are equal to <i>obj</i>.
- * If any items are found, returns <i>obj</i>. If
- * the item is not found, returns <code>nil</code>. If the optional
- * code block is given, returns the result of <i>block</i> if the item
- * is not found. (To remove <code>nil</code> elements and
- * get an informative return value, use #compact!)
- *
- * a = [ "a", "b", "b", "b", "c" ]
- * a.delete("b") #=> "b"
- * a #=> ["a", "c"]
- * a.delete("z") #=> nil
- * a.delete("z") { "not found" } #=> "not found"
+ * array.delete(obj) -> deleted_object
+ * array.delete(obj) {|nosuch| ... } -> deleted_object or block_return
+ *
+ * Removes zero or more elements from +self+.
+ *
+ * When no block is given,
+ * removes from +self+ each element +ele+ such that <tt>ele == obj</tt>;
+ * returns the last deleted element:
+ *
+ * s1 = 'bar'; s2 = 'bar'
+ * a = [:foo, s1, 2, s2]
+ * a.delete('bar') # => "bar"
+ * a # => [:foo, 2]
+ *
+ * Returns +nil+ if no elements removed.
+ *
+ * When a block is given,
+ * removes from +self+ each element +ele+ such that <tt>ele == obj</tt>.
+ *
+ * If any such elements are found, ignores the block
+ * and returns the last deleted element:
+ *
+ * s1 = 'bar'; s2 = 'bar'
+ * a = [:foo, s1, 2, s2]
+ * deleted_obj = a.delete('bar') {|obj| fail 'Cannot happen' }
+ * a # => [:foo, 2]
+ *
+ * If no such elements are found, returns the block's return value:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.delete(:nosuch) {|obj| "#{obj} not found" } # => "nosuch not found"
+ *
*/
VALUE
@@ -2408,36 +4180,53 @@ rb_ary_delete(VALUE ary, VALUE item)
long i1, i2;
for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
- VALUE e = RARRAY_PTR(ary)[i1];
+ VALUE e = RARRAY_AREF(ary, i1);
- if (rb_equal(e, item)) {
- v = e;
- continue;
- }
- if (i1 != i2) {
- rb_ary_store(ary, i2, e);
- }
- i2++;
+ if (rb_equal(e, item)) {
+ v = e;
+ continue;
+ }
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, e);
+ }
+ i2++;
}
if (RARRAY_LEN(ary) == i2) {
- if (rb_block_given_p()) {
- return rb_yield(item);
- }
- return Qnil;
+ if (rb_block_given_p()) {
+ return rb_yield(item);
+ }
+ return Qnil;
}
- rb_ary_modify(ary);
- if (RARRAY_LEN(ary) > i2) {
- ARY_SET_LEN(ary, i2);
- if (i2 * 2 < ARY_CAPA(ary) &&
- ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
- ary_resize_capa(ary, i2*2);
- }
- }
+ ary_resize_smaller(ary, i2);
+ ary_verify(ary);
return v;
}
+void
+rb_ary_delete_same(VALUE ary, VALUE item)
+{
+ long i1, i2;
+
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+ VALUE e = RARRAY_AREF(ary, i1);
+
+ if (e == item) {
+ continue;
+ }
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, e);
+ }
+ i2++;
+ }
+ if (RARRAY_LEN(ary) == i2) {
+ return;
+ }
+
+ ary_resize_smaller(ary, i2);
+}
+
VALUE
rb_ary_delete_at(VALUE ary, long pos)
{
@@ -2446,31 +4235,41 @@ rb_ary_delete_at(VALUE ary, long pos)
if (pos >= len) return Qnil;
if (pos < 0) {
- pos += len;
- if (pos < 0) return Qnil;
+ pos += len;
+ if (pos < 0) return Qnil;
}
rb_ary_modify(ary);
- del = RARRAY_PTR(ary)[pos];
- MEMMOVE(RARRAY_PTR(ary)+pos, RARRAY_PTR(ary)+pos+1, VALUE,
- RARRAY_LEN(ary)-pos-1);
+ del = RARRAY_AREF(ary, pos);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+ });
ARY_INCREASE_LEN(ary, -1);
-
+ ary_verify(ary);
return del;
}
/*
* call-seq:
- * ary.delete_at(index) -> obj or nil
+ * array.delete_at(index) -> deleted_object or nil
+ *
+ * Deletes an element from +self+, per the given \Integer +index+.
+ *
+ * When +index+ is non-negative, deletes the element at offset +index+:
*
- * Deletes the element at the specified index, returning that element,
- * or <code>nil</code> if the index is out of range. See also
- * <code>Array#slice!</code>.
+ * a = [:foo, 'bar', 2]
+ * a.delete_at(1) # => "bar"
+ * a # => [:foo, 2]
*
- * a = %w( ant bat cat dog )
- * a.delete_at(2) #=> "cat"
- * a #=> ["ant", "bat", "dog"]
- * a.delete_at(99) #=> nil
+ * If index is too large, returns +nil+.
+ *
+ * When +index+ is negative, counts backward from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.delete_at(-2) # => "bar"
+ * a # => [:foo, 2]
+ *
+ * If +index+ is too small (far from zero), returns nil.
*/
static VALUE
@@ -2479,163 +4278,274 @@ rb_ary_delete_at_m(VALUE ary, VALUE pos)
return rb_ary_delete_at(ary, NUM2LONG(pos));
}
+static VALUE
+ary_slice_bang_by_rb_ary_splice(VALUE ary, long pos, long len)
+{
+ const long orig_len = RARRAY_LEN(ary);
+
+ if (len < 0) {
+ return Qnil;
+ }
+ else if (pos < -orig_len) {
+ return Qnil;
+ }
+ else if (pos < 0) {
+ pos += orig_len;
+ }
+ else if (orig_len < pos) {
+ return Qnil;
+ }
+ if (orig_len < pos + len) {
+ len = orig_len - pos;
+ }
+ if (len == 0) {
+ return rb_ary_new2(0);
+ }
+ else {
+ VALUE arg2 = rb_ary_new4(len, RARRAY_CONST_PTR_TRANSIENT(ary)+pos);
+ rb_ary_splice(ary, pos, len, 0, 0);
+ return arg2;
+ }
+}
+
/*
* call-seq:
- * ary.slice!(index) -> obj or nil
- * ary.slice!(start, length) -> new_ary or nil
- * ary.slice!(range) -> new_ary or nil
- *
- * Deletes the element(s) given by an index (optionally with a length)
- * or by a range. Returns the deleted object (or objects), or
- * <code>nil</code> if the index is out of range.
- *
- * a = [ "a", "b", "c" ]
- * a.slice!(1) #=> "b"
- * a #=> ["a", "c"]
- * a.slice!(-1) #=> "c"
- * a #=> ["a"]
- * a.slice!(100) #=> nil
- * a #=> ["a"]
+ * array.slice!(n) -> object or nil
+ * array.slice!(start, length) -> new_array or nil
+ * array.slice!(range) -> new_array or nil
+ *
+ * Removes and returns elements from +self+.
+ *
+ * When the only argument is an \Integer +n+,
+ * removes and returns the _nth_ element in +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(1) # => "bar"
+ * a # => [:foo, 2]
+ *
+ * If +n+ is negative, counts backwards from the end of +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(-1) # => 2
+ * a # => [:foo, "bar"]
+ *
+ * If +n+ is out of range, returns +nil+.
+ *
+ * When the only arguments are Integers +start+ and +length+,
+ * removes +length+ elements from +self+ beginning at offset +start+;
+ * returns the deleted objects in a new \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(0, 2) # => [:foo, "bar"]
+ * a # => [2]
+ *
+ * If <tt>start + length</tt> exceeds the array size,
+ * removes and returns all elements from offset +start+ to the end:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(1, 50) # => ["bar", 2]
+ * a # => [:foo]
+ *
+ * If <tt>start == a.size</tt> and +length+ is non-negative,
+ * returns a new empty \Array.
+ *
+ * If +length+ is negative, returns +nil+.
+ *
+ * When the only argument is a \Range object +range+,
+ * treats <tt>range.min</tt> as +start+ above and <tt>range.size</tt> as +length+ above:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(1..2) # => ["bar", 2]
+ * a # => [:foo]
+ *
+ * If <tt>range.start == a.size</tt>, returns a new empty \Array.
+ *
+ * If <tt>range.start</tt> is larger than the array size, returns +nil+.
+ *
+ * If <tt>range.end</tt> is negative, counts backwards from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(0..-2) # => [:foo, "bar"]
+ * a # => [2]
+ *
+ * If <tt>range.start</tt> is negative,
+ * calculates the start index backwards from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(-2..2) # => ["bar", 2]
+ * a # => [:foo]
+ *
*/
static VALUE
rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
{
- VALUE arg1, arg2;
- long pos, len, orig_len;
+ VALUE arg1;
+ long pos, len;
rb_ary_modify_check(ary);
+ rb_check_arity(argc, 1, 2);
+ arg1 = argv[0];
+
if (argc == 2) {
- pos = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
- delete_pos_len:
- if (len < 0) return Qnil;
- orig_len = RARRAY_LEN(ary);
- if (pos < 0) {
- pos += orig_len;
- if (pos < 0) return Qnil;
- }
- else if (orig_len < pos) return Qnil;
- if (orig_len < pos + len) {
- len = orig_len - pos;
- }
- if (len == 0) return rb_ary_new2(0);
- arg2 = rb_ary_new4(len, RARRAY_PTR(ary)+pos);
- RBASIC(arg2)->klass = rb_obj_class(ary);
- rb_ary_splice(ary, pos, len, Qundef);
- return arg2;
- }
-
- if (argc != 1) {
- /* error report */
- rb_scan_args(argc, argv, "11", NULL, NULL);
+ pos = NUM2LONG(argv[0]);
+ len = NUM2LONG(argv[1]);
+ return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
}
- arg1 = argv[0];
if (!FIXNUM_P(arg1)) {
- switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
- case Qtrue:
- /* valid range */
- goto delete_pos_len;
- case Qnil:
- /* invalid range */
- return Qnil;
- default:
- /* not a range */
- break;
- }
+ switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+ case Qtrue:
+ /* valid range */
+ return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
+ case Qnil:
+ /* invalid range */
+ return Qnil;
+ default:
+ /* not a range */
+ break;
+ }
}
return rb_ary_delete_at(ary, NUM2LONG(arg1));
}
+static VALUE
+ary_reject(VALUE orig, VALUE result)
+{
+ long i;
+
+ for (i = 0; i < RARRAY_LEN(orig); i++) {
+ VALUE v = RARRAY_AREF(orig, i);
+
+ if (!RTEST(rb_yield(v))) {
+ rb_ary_push(result, v);
+ }
+ }
+ return result;
+}
+
+static VALUE
+reject_bang_i(VALUE a)
+{
+ volatile struct select_bang_arg *arg = (void *)a;
+ VALUE ary = arg->ary;
+ long i1, i2;
+
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+ VALUE v = RARRAY_AREF(ary, i1);
+ if (RTEST(rb_yield(v))) continue;
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, v);
+ }
+ arg->len[1] = ++i2;
+ }
+ return (i1 == i2) ? Qnil : ary;
+}
+
+static VALUE
+ary_reject_bang(VALUE ary)
+{
+ struct select_bang_arg args;
+ rb_ary_modify_check(ary);
+ args.ary = ary;
+ args.len[0] = args.len[1] = 0;
+ return rb_ensure(reject_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
+}
+
/*
* call-seq:
- * ary.reject! {|item| block } -> ary or nil
- * ary.reject! -> an_enumerator
+ * array.reject! {|element| ... } -> self or nil
+ * array.reject! -> new_enumerator
+ *
+ * Removes each element for which the block returns a truthy value.
+ *
+ * Returns +self+ if any elements removed:
+ *
+ * a = [:foo, 'bar', 2, 'bat']
+ * a.reject! {|element| element.to_s.start_with?('b') } # => [:foo, 2]
*
- * Equivalent to <code>Array#delete_if</code>, deleting elements from
- * +self+ for which the block evaluates to true, but returns
- * <code>nil</code> if no changes were made.
- * See also <code>Enumerable#reject</code> and <code>Array#delete_if</code>.
+ * Returns +nil+ if no elements removed.
*
- * If no block is given, an enumerator is returned instead.
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.reject! # => #<Enumerator: [:foo, "bar", 2]:reject!>
*
*/
static VALUE
rb_ary_reject_bang(VALUE ary)
{
- long i1, i2;
-
- RETURN_ENUMERATOR(ary, 0, 0);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
rb_ary_modify(ary);
- for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
- VALUE v = RARRAY_PTR(ary)[i1];
- if (RTEST(rb_yield(v))) continue;
- if (i1 != i2) {
- rb_ary_store(ary, i2, v);
- }
- i2++;
- }
-
- if (RARRAY_LEN(ary) == i2) return Qnil;
- if (i2 < RARRAY_LEN(ary))
- ARY_SET_LEN(ary, i2);
- return ary;
+ return ary_reject_bang(ary);
}
/*
* call-seq:
- * ary.reject {|item| block } -> new_ary
- * ary.reject -> an_enumerator
+ * array.reject {|element| ... } -> new_array
+ * array.reject -> new_enumerator
+ *
+ * Returns a new \Array whose elements are all those from +self+
+ * for which the block returns +false+ or +nil+:
*
- * Returns a new array containing the items in +self+
- * for which the block is not true.
- * See also <code>Array#delete_if</code>
+ * a = [:foo, 'bar', 2, 'bat']
+ * a1 = a.reject {|element| element.to_s.start_with?('b') }
+ * a1 # => [:foo, 2]
*
- * If no block is given, an enumerator is returned instead.
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.reject # => #<Enumerator: [:foo, "bar", 2]:reject>
*
*/
static VALUE
rb_ary_reject(VALUE ary)
{
- RETURN_ENUMERATOR(ary, 0, 0);
- ary = rb_ary_dup(ary);
- rb_ary_reject_bang(ary);
- return ary;
+ VALUE rejected_ary;
+
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ rejected_ary = rb_ary_new();
+ ary_reject(ary, rejected_ary);
+ return rejected_ary;
}
/*
* call-seq:
- * ary.delete_if {|item| block } -> ary
- * ary.delete_if -> an_enumerator
+ * array.delete_if {|element| ... } -> self
+ * array.delete_if -> Enumerator
*
- * Deletes every element of +self+ for which <i>block</i> evaluates
- * to true.
- * See also <code>Array#reject!</code>
+ * Removes each element in +self+ for which the block returns a truthy value;
+ * returns +self+:
*
- * If no block is given, an enumerator is returned instead.
+ * a = [:foo, 'bar', 2, 'bat']
+ * a.delete_if {|element| element.to_s.start_with?('b') } # => [:foo, 2]
*
- * a = [ "a", "b", "c" ]
- * a.delete_if {|x| x >= "b" } #=> ["a"]
- */
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.delete_if # => #<Enumerator: [:foo, "bar", 2]:delete_if>
+ *
+3 */
static VALUE
rb_ary_delete_if(VALUE ary)
{
- RETURN_ENUMERATOR(ary, 0, 0);
- rb_ary_reject_bang(ary);
+ ary_verify(ary);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ ary_reject_bang(ary);
return ary;
}
static VALUE
-take_i(VALUE val, VALUE *args, int argc, VALUE *argv)
+take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
{
- if (args[1]-- == 0) rb_iter_break();
+ VALUE *args = (VALUE *)cbarg;
if (argc > 1) val = rb_ary_new4(argc, argv);
rb_ary_push(args[0], val);
+ if (--args[1] == 0) rb_iter_break();
return Qnil;
}
@@ -2645,76 +4555,141 @@ take_items(VALUE obj, long n)
VALUE result = rb_check_array_type(obj);
VALUE args[2];
+ if (n == 0) return result;
if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
result = rb_ary_new2(n);
args[0] = result; args[1] = (VALUE)n;
- rb_block_call(obj, rb_intern("each"), 0, 0, take_i, (VALUE)args);
+ if (UNDEF_P(rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args)))
+ rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
+ rb_obj_class(obj));
return result;
}
/*
* call-seq:
- * ary.zip(arg, ...) -> new_ary
- * ary.zip(arg, ...) {| arr | block } -> nil
- *
- * Converts any arguments to arrays, then merges elements of
- * +self+ with corresponding elements from each argument. This
- * generates a sequence of <code>self.size</code> <em>n</em>-element
- * arrays, where <em>n</em> is one more that the count of arguments. If
- * the size of any argument is less than <code>enumObj.size</code>,
- * <code>nil</code> values are supplied. If a block is given, it is
- * invoked for each output array, otherwise an array of arrays is
- * returned.
- *
- * a = [ 4, 5, 6 ]
- * b = [ 7, 8, 9 ]
- * [1,2,3].zip(a, b) #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
- * [1,2].zip(a,b) #=> [[1, 4, 7], [2, 5, 8]]
- * a.zip([1,2],[8]) #=> [[4,1,8], [5,2,nil], [6,nil,nil]]
+ * array.zip(*other_arrays) -> new_array
+ * array.zip(*other_arrays) {|other_array| ... } -> nil
+ *
+ * When no block given, returns a new \Array +new_array+ of size <tt>self.size</tt>
+ * whose elements are Arrays.
+ *
+ * Each nested array <tt>new_array[n]</tt> is of size <tt>other_arrays.size+1</tt>,
+ * and contains:
+ *
+ * - The _nth_ element of +self+.
+ * - The _nth_ element of each of the +other_arrays+.
+ *
+ * If all +other_arrays+ and +self+ are the same size:
+ *
+ * a = [:a0, :a1, :a2, :a3]
+ * b = [:b0, :b1, :b2, :b3]
+ * c = [:c0, :c1, :c2, :c3]
+ * d = a.zip(b, c)
+ * d # => [[:a0, :b0, :c0], [:a1, :b1, :c1], [:a2, :b2, :c2], [:a3, :b3, :c3]]
+ *
+ * If any array in +other_arrays+ is smaller than +self+,
+ * fills to <tt>self.size</tt> with +nil+:
+ *
+ * a = [:a0, :a1, :a2, :a3]
+ * b = [:b0, :b1, :b2]
+ * c = [:c0, :c1]
+ * d = a.zip(b, c)
+ * d # => [[:a0, :b0, :c0], [:a1, :b1, :c1], [:a2, :b2, nil], [:a3, nil, nil]]
+ *
+ * If any array in +other_arrays+ is larger than +self+,
+ * its trailing elements are ignored:
+ *
+ * a = [:a0, :a1, :a2, :a3]
+ * b = [:b0, :b1, :b2, :b3, :b4]
+ * c = [:c0, :c1, :c2, :c3, :c4, :c5]
+ * d = a.zip(b, c)
+ * d # => [[:a0, :b0, :c0], [:a1, :b1, :c1], [:a2, :b2, :c2], [:a3, :b3, :c3]]
+ *
+ * When a block is given, calls the block with each of the sub-arrays (formed as above); returns +nil+:
+ *
+ * a = [:a0, :a1, :a2, :a3]
+ * b = [:b0, :b1, :b2, :b3]
+ * c = [:c0, :c1, :c2, :c3]
+ * a.zip(b, c) {|sub_array| p sub_array} # => nil
+ *
+ * Output:
+ *
+ * [:a0, :b0, :c0]
+ * [:a1, :b1, :c1]
+ * [:a2, :b2, :c2]
+ * [:a3, :b3, :c3]
+ *
*/
static VALUE
rb_ary_zip(int argc, VALUE *argv, VALUE ary)
{
int i, j;
- long len;
+ long len = RARRAY_LEN(ary);
VALUE result = Qnil;
- len = RARRAY_LEN(ary);
for (i=0; i<argc; i++) {
- argv[i] = take_items(argv[i], len);
+ argv[i] = take_items(argv[i], len);
}
- if (!rb_block_given_p()) {
- result = rb_ary_new2(len);
+
+ if (rb_block_given_p()) {
+ int arity = rb_block_arity();
+
+ if (arity > 1) {
+ VALUE work, *tmp;
+
+ tmp = ALLOCV_N(VALUE, work, argc+1);
+
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ tmp[0] = RARRAY_AREF(ary, i);
+ for (j=0; j<argc; j++) {
+ tmp[j+1] = rb_ary_elt(argv[j], i);
+ }
+ rb_yield_values2(argc+1, tmp);
+ }
+
+ if (work) ALLOCV_END(work);
+ }
+ else {
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ VALUE tmp = rb_ary_new2(argc+1);
+
+ rb_ary_push(tmp, RARRAY_AREF(ary, i));
+ for (j=0; j<argc; j++) {
+ rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+ }
+ rb_yield(tmp);
+ }
+ }
}
+ else {
+ result = rb_ary_new_capa(len);
- for (i=0; i<RARRAY_LEN(ary); i++) {
- VALUE tmp = rb_ary_new2(argc+1);
-
- rb_ary_push(tmp, rb_ary_elt(ary, i));
- for (j=0; j<argc; j++) {
- rb_ary_push(tmp, rb_ary_elt(argv[j], i));
- }
- if (NIL_P(result)) {
- rb_yield(tmp);
- }
- else {
- rb_ary_push(result, tmp);
- }
+ for (i=0; i<len; i++) {
+ VALUE tmp = rb_ary_new_capa(argc+1);
+
+ rb_ary_push(tmp, RARRAY_AREF(ary, i));
+ for (j=0; j<argc; j++) {
+ rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+ }
+ rb_ary_push(result, tmp);
+ }
}
+
return result;
}
/*
* call-seq:
- * ary.transpose -> new_ary
+ * array.transpose -> new_array
+ *
+ * Transposes the rows and columns in an \Array of Arrays;
+ * the nested Arrays must all be the same size:
*
- * Assumes that +self+ is an array of arrays and transposes the
- * rows and columns.
+ * a = [[:a0, :a1], [:b0, :b1], [:c0, :c1]]
+ * a.transpose # => [[:a0, :b0, :c0], [:a1, :b1, :c1]]
*
- * a = [[1,2], [3,4], [5,6]]
- * a.transpose #=> [[1, 3, 5], [2, 4, 6]]
*/
static VALUE
@@ -2726,35 +4701,34 @@ rb_ary_transpose(VALUE ary)
alen = RARRAY_LEN(ary);
if (alen == 0) return rb_ary_dup(ary);
for (i=0; i<alen; i++) {
- tmp = to_ary(rb_ary_elt(ary, i));
- if (elen < 0) { /* first element */
- elen = RARRAY_LEN(tmp);
- result = rb_ary_new2(elen);
- for (j=0; j<elen; j++) {
- rb_ary_store(result, j, rb_ary_new2(alen));
- }
- }
- else if (elen != RARRAY_LEN(tmp)) {
- rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
- RARRAY_LEN(tmp), elen);
- }
- for (j=0; j<elen; j++) {
- rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
- }
+ tmp = to_ary(rb_ary_elt(ary, i));
+ if (elen < 0) { /* first element */
+ elen = RARRAY_LEN(tmp);
+ result = rb_ary_new2(elen);
+ for (j=0; j<elen; j++) {
+ rb_ary_store(result, j, rb_ary_new2(alen));
+ }
+ }
+ else if (elen != RARRAY_LEN(tmp)) {
+ rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+ RARRAY_LEN(tmp), elen);
+ }
+ for (j=0; j<elen; j++) {
+ rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
+ }
}
return result;
}
/*
* call-seq:
- * ary.replace(other_ary) -> ary
+ * array.replace(other_array) -> self
+ *
+ * Replaces the content of +self+ with the content of +other_array+; returns +self+:
*
- * Replaces the contents of +self+ with the contents of
- * <i>other_ary</i>, truncating or expanding if necessary.
+ * a = [:foo, 'bar', 2]
+ * a.replace(['foo', :bar, 3]) # => ["foo", :bar, 3]
*
- * a = [ "a", "b", "c", "d", "e" ]
- * a.replace([ "x", "y", "z" ]) #=> ["x", "y", "z"]
- * a #=> ["x", "y", "z"]
*/
VALUE
@@ -2764,290 +4738,490 @@ rb_ary_replace(VALUE copy, VALUE orig)
orig = to_ary(orig);
if (copy == orig) return copy;
- if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
- VALUE *ptr;
- VALUE shared = 0;
+ rb_ary_reset(copy);
- if (ARY_OWNS_HEAP_P(copy)) {
- xfree(RARRAY_PTR(copy));
- }
- else if (ARY_SHARED_P(copy)) {
- shared = ARY_SHARED(copy);
- FL_UNSET_SHARED(copy);
- }
- FL_SET_EMBED(copy);
- ptr = RARRAY_PTR(orig);
- MEMCPY(RARRAY_PTR(copy), ptr, VALUE, RARRAY_LEN(orig));
- if (shared) {
- rb_ary_decrement_share(shared);
- }
- ARY_SET_LEN(copy, RARRAY_LEN(orig));
+ /* orig has enough space to embed the contents of orig. */
+ if (RARRAY_LEN(orig) <= ary_embed_capa(copy)) {
+ assert(ARY_EMBED_P(copy));
+ ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR_TRANSIENT(orig));
+ ARY_SET_EMBED_LEN(copy, RARRAY_LEN(orig));
+ }
+#if USE_RVARGC
+ /* orig is embedded but copy does not have enough space to embed the
+ * contents of orig. */
+ else if (ARY_EMBED_P(orig)) {
+ long len = ARY_EMBED_LEN(orig);
+ VALUE *ptr = ary_heap_alloc(copy, len);
+
+ FL_UNSET_EMBED(copy);
+ ARY_SET_PTR(copy, ptr);
+ ARY_SET_LEN(copy, len);
+ ARY_SET_CAPA(copy, len);
+
+ // No allocation and exception expected that could leave `copy` in a
+ // bad state from the edits above.
+ ary_memcpy(copy, 0, len, RARRAY_CONST_PTR_TRANSIENT(orig));
}
+#endif
+ /* Otherwise, orig is on heap and copy does not have enough space to embed
+ * the contents of orig. */
else {
- VALUE shared = ary_make_shared(orig);
- if (ARY_OWNS_HEAP_P(copy)) {
- xfree(RARRAY_PTR(copy));
- }
- else {
- rb_ary_unshare_safe(copy);
- }
+ VALUE shared_root = ary_make_shared(orig);
FL_UNSET_EMBED(copy);
- ARY_SET_PTR(copy, RARRAY_PTR(orig));
- ARY_SET_LEN(copy, RARRAY_LEN(orig));
- rb_ary_set_shared(copy, shared);
+ ARY_SET_PTR(copy, ARY_HEAP_PTR(orig));
+ ARY_SET_LEN(copy, ARY_HEAP_LEN(orig));
+ rb_ary_set_shared(copy, shared_root);
}
+ ary_verify(copy);
return copy;
}
/*
* call-seq:
- * ary.clear -> ary
+ * array.clear -> self
*
- * Removes all elements from +self+.
+ * Removes all elements from +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.clear # => []
*
- * a = [ "a", "b", "c", "d", "e" ]
- * a.clear #=> [ ]
*/
VALUE
rb_ary_clear(VALUE ary)
{
rb_ary_modify_check(ary);
- ARY_SET_LEN(ary, 0);
if (ARY_SHARED_P(ary)) {
- if (!ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
- FL_SET_EMBED(ary);
- }
+ if (!ARY_EMBED_P(ary)) {
+ rb_ary_unshare(ary);
+ FL_SET_EMBED(ary);
+ ARY_SET_EMBED_LEN(ary, 0);
+ }
}
- else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
- ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+ else {
+ ARY_SET_LEN(ary, 0);
+ if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+ ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+ }
}
+ ary_verify(ary);
return ary;
}
/*
* call-seq:
- * ary.fill(obj) -> ary
- * ary.fill(obj, start [, length]) -> ary
- * ary.fill(obj, range ) -> ary
- * ary.fill {|index| block } -> ary
- * ary.fill(start [, length] ) {|index| block } -> ary
- * ary.fill(range) {|index| block } -> ary
- *
- * The first three forms set the selected elements of +self+ (which
- * may be the entire array) to <i>obj</i>. A <i>start</i> of
- * <code>nil</code> is equivalent to zero. A <i>length</i> of
- * <code>nil</code> is equivalent to <i>self.length</i>. The last three
- * forms fill the array with the value of the block. The block is
- * passed the absolute index of each element to be filled.
- * Negative values of <i>start</i> count from the end of the array.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.fill("x") #=> ["x", "x", "x", "x"]
- * a.fill("z", 2, 2) #=> ["x", "x", "z", "z"]
- * a.fill("y", 0..1) #=> ["y", "y", "z", "z"]
- * a.fill {|i| i*i} #=> [0, 1, 4, 9]
- * a.fill(-2) {|i| i*i*i} #=> [0, 1, 8, 27]
+ * array.fill(obj) -> self
+ * array.fill(obj, start) -> self
+ * array.fill(obj, start, length) -> self
+ * array.fill(obj, range) -> self
+ * array.fill {|index| ... } -> self
+ * array.fill(start) {|index| ... } -> self
+ * array.fill(start, length) {|index| ... } -> self
+ * array.fill(range) {|index| ... } -> self
+ *
+ * Replaces specified elements in +self+ with specified objects; returns +self+.
+ *
+ * With argument +obj+ and no block given, replaces all elements with that one object:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a # => ["a", "b", "c", "d"]
+ * a.fill(:X) # => [:X, :X, :X, :X]
+ *
+ * With arguments +obj+ and \Integer +start+, and no block given,
+ * replaces elements based on the given start.
+ *
+ * If +start+ is in range (<tt>0 <= start < array.size</tt>),
+ * replaces all elements from offset +start+ through the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 2) # => ["a", "b", :X, :X]
+ *
+ * If +start+ is too large (<tt>start >= array.size</tt>), does nothing:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 4) # => ["a", "b", "c", "d"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 5) # => ["a", "b", "c", "d"]
+ *
+ * If +start+ is negative, counts from the end (starting index is <tt>start + array.size</tt>):
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, -2) # => ["a", "b", :X, :X]
+ *
+ * If +start+ is too small (less than and far from zero), replaces all elements:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, -6) # => [:X, :X, :X, :X]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, -50) # => [:X, :X, :X, :X]
+ *
+ * With arguments +obj+, \Integer +start+, and \Integer +length+, and no block given,
+ * replaces elements based on the given +start+ and +length+.
+ *
+ * If +start+ is in range, replaces +length+ elements beginning at offset +start+:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 1, 1) # => ["a", :X, "c", "d"]
+ *
+ * If +start+ is negative, counts from the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, -2, 1) # => ["a", "b", :X, "d"]
+ *
+ * If +start+ is large (<tt>start >= array.size</tt>), extends +self+ with +nil+:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 5, 0) # => ["a", "b", "c", "d", nil]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 5, 2) # => ["a", "b", "c", "d", nil, :X, :X]
+ *
+ * If +length+ is zero or negative, replaces no elements:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 1, 0) # => ["a", "b", "c", "d"]
+ * a.fill(:X, 1, -1) # => ["a", "b", "c", "d"]
+ *
+ * With arguments +obj+ and \Range +range+, and no block given,
+ * replaces elements based on the given range.
+ *
+ * If the range is positive and ascending (<tt>0 < range.begin <= range.end</tt>),
+ * replaces elements from <tt>range.begin</tt> to <tt>range.end</tt>:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (1..1)) # => ["a", :X, "c", "d"]
+ *
+ * If <tt>range.first</tt> is negative, replaces no elements:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (-1..1)) # => ["a", "b", "c", "d"]
+ *
+ * If <tt>range.last</tt> is negative, counts from the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (0..-2)) # => [:X, :X, :X, "d"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (1..-2)) # => ["a", :X, :X, "d"]
+ *
+ * If <tt>range.last</tt> and <tt>range.last</tt> are both negative,
+ * both count from the end of the array:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (-1..-1)) # => ["a", "b", "c", :X]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (-2..-2)) # => ["a", "b", :X, "d"]
+ *
+ * With no arguments and a block given, calls the block with each index;
+ * replaces the corresponding element with the block's return value:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "new_3"]
+ *
+ * With argument +start+ and a block given, calls the block with each index
+ * from offset +start+ to the end; replaces the corresponding element
+ * with the block's return value.
+ *
+ * If start is in range (<tt>0 <= start < array.size</tt>),
+ * replaces from offset +start+ to the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1) { |index| "new_#{index}" } # => ["a", "new_1", "new_2", "new_3"]
+ *
+ * If +start+ is too large(<tt>start >= array.size</tt>), does nothing:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(4) { |index| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(4) { |index| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ * If +start+ is negative, counts from the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-2) { |index| "new_#{index}" } # => ["a", "b", "new_2", "new_3"]
+ *
+ * If start is too small (<tt>start <= -array.size</tt>, replaces all elements:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-6) { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "new_3"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-50) { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "new_3"]
+ *
+ * With arguments +start+ and +length+, and a block given,
+ * calls the block for each index specified by start length;
+ * replaces the corresponding element with the block's return value.
+ *
+ * If +start+ is in range, replaces +length+ elements beginning at offset +start+:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1, 1) { |index| "new_#{index}" } # => ["a", "new_1", "c", "d"]
+ *
+ * If start is negative, counts from the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-2, 1) { |index| "new_#{index}" } # => ["a", "b", "new_2", "d"]
+ *
+ * If +start+ is large (<tt>start >= array.size</tt>), extends +self+ with +nil+:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(5, 0) { |index| "new_#{index}" } # => ["a", "b", "c", "d", nil]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(5, 2) { |index| "new_#{index}" } # => ["a", "b", "c", "d", nil, "new_5", "new_6"]
+ *
+ * If +length+ is zero or less, replaces no elements:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1, 0) { |index| "new_#{index}" } # => ["a", "b", "c", "d"]
+ * a.fill(1, -1) { |index| "new_#{index}" } # => ["a", "b", "c", "d"]
+ *
+ * With arguments +obj+ and +range+, and a block given,
+ * calls the block with each index in the given range;
+ * replaces the corresponding element with the block's return value.
+ *
+ * If the range is positive and ascending (<tt>range 0 < range.begin <= range.end</tt>,
+ * replaces elements from <tt>range.begin</tt> to <tt>range.end</tt>:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1..1) { |index| "new_#{index}" } # => ["a", "new_1", "c", "d"]
+ *
+ * If +range.first+ is negative, does nothing:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-1..1) { |index| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ * If <tt>range.last</tt> is negative, counts from the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(0..-2) { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "d"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1..-2) { |index| "new_#{index}" } # => ["a", "new_1", "new_2", "d"]
+ *
+ * If <tt>range.first</tt> and <tt>range.last</tt> are both negative,
+ * both count from the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-1..-1) { |index| "new_#{index}" } # => ["a", "b", "c", "new_3"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-2..-2) { |index| "new_#{index}" } # => ["a", "b", "new_2", "d"]
+ *
*/
static VALUE
rb_ary_fill(int argc, VALUE *argv, VALUE ary)
{
- VALUE item, arg1, arg2;
+ VALUE item = Qundef, arg1, arg2;
long beg = 0, end = 0, len = 0;
- VALUE *p, *pend;
- int block_p = FALSE;
if (rb_block_given_p()) {
- block_p = TRUE;
- rb_scan_args(argc, argv, "02", &arg1, &arg2);
- argc += 1; /* hackish */
+ rb_scan_args(argc, argv, "02", &arg1, &arg2);
+ argc += 1; /* hackish */
}
else {
- rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+ rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
}
switch (argc) {
case 1:
- beg = 0;
- len = RARRAY_LEN(ary);
- break;
+ beg = 0;
+ len = RARRAY_LEN(ary);
+ break;
case 2:
- if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
- break;
- }
- /* fall through */
+ if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+ break;
+ }
+ /* fall through */
case 3:
- beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
- if (beg < 0) {
- beg = RARRAY_LEN(ary) + beg;
- if (beg < 0) beg = 0;
- }
- len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
- break;
+ beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
+ if (beg < 0) {
+ beg = RARRAY_LEN(ary) + beg;
+ if (beg < 0) beg = 0;
+ }
+ len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+ break;
}
rb_ary_modify(ary);
if (len < 0) {
return ary;
}
if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
- rb_raise(rb_eArgError, "argument too big");
+ rb_raise(rb_eArgError, "argument too big");
}
end = beg + len;
if (RARRAY_LEN(ary) < end) {
- if (end >= ARY_CAPA(ary)) {
- ary_resize_capa(ary, end);
- }
- rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary), end - RARRAY_LEN(ary));
- ARY_SET_LEN(ary, end);
+ if (end >= ARY_CAPA(ary)) {
+ ary_resize_capa(ary, end);
+ }
+ ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+ ARY_SET_LEN(ary, end);
}
- if (block_p) {
- VALUE v;
- long i;
+ if (UNDEF_P(item)) {
+ VALUE v;
+ long i;
- for (i=beg; i<end; i++) {
- v = rb_yield(LONG2NUM(i));
- if (i>=RARRAY_LEN(ary)) break;
- RARRAY_PTR(ary)[i] = v;
- }
+ for (i=beg; i<end; i++) {
+ v = rb_yield(LONG2NUM(i));
+ if (i>=RARRAY_LEN(ary)) break;
+ ARY_SET(ary, i, v);
+ }
}
else {
- p = RARRAY_PTR(ary) + beg;
- pend = p + len;
- while (p < pend) {
- *p++ = item;
- }
+ ary_memfill(ary, beg, len, item);
}
return ary;
}
/*
* call-seq:
- * ary + other_ary -> new_ary
+ * array + other_array -> new_array
*
- * Concatenation---Returns a new array built by concatenating the
- * two arrays together to produce a third array.
+ * Returns a new \Array containing all elements of +array+
+ * followed by all elements of +other_array+:
*
- * [ 1, 2, 3 ] + [ 4, 5 ] #=> [ 1, 2, 3, 4, 5 ]
+ * a = [0, 1] + [2, 3]
+ * a # => [0, 1, 2, 3]
+ *
+ * Related: #concat.
*/
VALUE
rb_ary_plus(VALUE x, VALUE y)
{
VALUE z;
- long len;
+ long len, xlen, ylen;
y = to_ary(y);
- len = RARRAY_LEN(x) + RARRAY_LEN(y);
+ xlen = RARRAY_LEN(x);
+ ylen = RARRAY_LEN(y);
+ len = xlen + ylen;
z = rb_ary_new2(len);
- MEMCPY(RARRAY_PTR(z), RARRAY_PTR(x), VALUE, RARRAY_LEN(x));
- MEMCPY(RARRAY_PTR(z) + RARRAY_LEN(x), RARRAY_PTR(y), VALUE, RARRAY_LEN(y));
+
+ ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR_TRANSIENT(x));
+ ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR_TRANSIENT(y));
ARY_SET_LEN(z, len);
return z;
}
+static VALUE
+ary_append(VALUE x, VALUE y)
+{
+ long n = RARRAY_LEN(y);
+ if (n > 0) {
+ rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR_TRANSIENT(y), n);
+ }
+ RB_GC_GUARD(y);
+ return x;
+}
+
/*
* call-seq:
- * ary.concat(other_ary) -> ary
+ * array.concat(*other_arrays) -> self
*
- * Appends the elements of <i>other_ary</i> to +self+.
+ * Adds to +array+ all elements from each \Array in +other_arrays+; returns +self+:
*
- * [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
+ * a = [0, 1]
+ * a.concat([2, 3], [4, 5]) # => [0, 1, 2, 3, 4, 5]
*/
+static VALUE
+rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
+{
+ rb_ary_modify_check(ary);
+
+ if (argc == 1) {
+ rb_ary_concat(ary, argv[0]);
+ }
+ else if (argc > 1) {
+ int i;
+ VALUE args = rb_ary_hidden_new(argc);
+ for (i = 0; i < argc; i++) {
+ rb_ary_concat(args, argv[i]);
+ }
+ ary_append(ary, args);
+ }
+
+ ary_verify(ary);
+ return ary;
+}
VALUE
rb_ary_concat(VALUE x, VALUE y)
{
- rb_ary_modify_check(x);
- y = to_ary(y);
- if (RARRAY_LEN(y) > 0) {
- rb_ary_splice(x, RARRAY_LEN(x), 0, y);
- }
- return x;
+ return ary_append(x, to_ary(y));
}
-
/*
* call-seq:
- * ary * int -> new_ary
- * ary * str -> new_string
+ * array * n -> new_array
+ * array * string_separator -> new_string
+ *
+ * When non-negative argument \Integer +n+ is given,
+ * returns a new \Array built by concatenating the +n+ copies of +self+:
*
- * Repetition---With a String argument, equivalent to
- * self.join(str). Otherwise, returns a new array
- * built by concatenating the _int_ copies of +self+.
+ * a = ['x', 'y']
+ * a * 3 # => ["x", "y", "x", "y", "x", "y"]
*
+ * When \String argument +string_separator+ is given,
+ * equivalent to <tt>array.join(string_separator)</tt>:
*
- * [ 1, 2, 3 ] * 3 #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
- * [ 1, 2, 3 ] * "," #=> "1,2,3"
+ * [0, [0, 1], {foo: 0}] * ', ' # => "0, 0, 1, {:foo=>0}"
*
*/
static VALUE
rb_ary_times(VALUE ary, VALUE times)
{
- VALUE ary2, tmp, *ptr, *ptr2;
+ VALUE ary2, tmp;
+ const VALUE *ptr;
long t, len;
tmp = rb_check_string_type(times);
if (!NIL_P(tmp)) {
- return rb_ary_join(ary, tmp);
+ return rb_ary_join(ary, tmp);
}
len = NUM2LONG(times);
if (len == 0) {
- ary2 = ary_new(rb_obj_class(ary), 0);
- goto out;
+ ary2 = ary_new(rb_cArray, 0);
+ goto out;
}
if (len < 0) {
- rb_raise(rb_eArgError, "negative argument");
+ rb_raise(rb_eArgError, "negative argument");
}
if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
- rb_raise(rb_eArgError, "argument too big");
+ rb_raise(rb_eArgError, "argument too big");
}
len *= RARRAY_LEN(ary);
- ary2 = ary_new(rb_obj_class(ary), len);
+ ary2 = ary_new(rb_cArray, len);
ARY_SET_LEN(ary2, len);
- ptr = RARRAY_PTR(ary);
- ptr2 = RARRAY_PTR(ary2);
+ ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
t = RARRAY_LEN(ary);
if (0 < t) {
- MEMCPY(ptr2, ptr, VALUE, t);
+ ary_memcpy(ary2, 0, t, ptr);
while (t <= len/2) {
- MEMCPY(ptr2+t, ptr2, VALUE, t);
+ ary_memcpy(ary2, t, t, RARRAY_CONST_PTR_TRANSIENT(ary2));
t *= 2;
}
if (t < len) {
- MEMCPY(ptr2+t, ptr2, VALUE, len-t);
+ ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR_TRANSIENT(ary2));
}
}
out:
- OBJ_INFECT(ary2, ary);
-
return ary2;
}
/*
* call-seq:
- * ary.assoc(obj) -> new_ary or nil
- *
- * Searches through an array whose elements are also arrays
- * comparing _obj_ with the first element of each contained array
- * using obj.==.
- * Returns the first contained array that matches (that
- * is, the first associated array),
- * or +nil+ if no match is found.
- * See also <code>Array#rassoc</code>.
- *
- * s1 = [ "colors", "red", "blue", "green" ]
- * s2 = [ "letters", "a", "b", "c" ]
- * s3 = "foo"
- * a = [ s1, s2, s3 ]
- * a.assoc("letters") #=> [ "letters", "a", "b", "c" ]
- * a.assoc("foo") #=> nil
+ * array.assoc(obj) -> found_array or nil
+ *
+ * Returns the first element in +self+ that is an \Array
+ * whose first element <tt>==</tt> +obj+:
+ *
+ * a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ * a.assoc(4) # => [4, 5, 6]
+ *
+ * Returns +nil+ if no such element is found.
+ *
+ * Related: #rassoc.
*/
VALUE
@@ -3057,26 +5231,27 @@ rb_ary_assoc(VALUE ary, VALUE key)
VALUE v;
for (i = 0; i < RARRAY_LEN(ary); ++i) {
- v = rb_check_array_type(RARRAY_PTR(ary)[i]);
- if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
- rb_equal(RARRAY_PTR(v)[0], key))
- return v;
+ v = rb_check_array_type(RARRAY_AREF(ary, i));
+ if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+ rb_equal(RARRAY_AREF(v, 0), key))
+ return v;
}
return Qnil;
}
/*
* call-seq:
- * ary.rassoc(obj) -> new_ary or nil
+ * array.rassoc(obj) -> found_array or nil
+ *
+ * Returns the first element in +self+ that is an \Array
+ * whose second element <tt>==</tt> +obj+:
+ *
+ * a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ * a.rassoc(4) # => [2, 4]
*
- * Searches through the array whose elements are also arrays. Compares
- * _obj_ with the second element of each contained array using
- * <code>==</code>. Returns the first contained array that matches. See
- * also <code>Array#assoc</code>.
+ * Returns +nil+ if no such element is found.
*
- * a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
- * a.rassoc("two") #=> [2, "two"]
- * a.rassoc("four") #=> nil
+ * Related: #assoc.
*/
VALUE
@@ -3086,11 +5261,11 @@ rb_ary_rassoc(VALUE ary, VALUE value)
VALUE v;
for (i = 0; i < RARRAY_LEN(ary); ++i) {
- v = RARRAY_PTR(ary)[i];
- if (TYPE(v) == T_ARRAY &&
- RARRAY_LEN(v) > 1 &&
- rb_equal(RARRAY_PTR(v)[1], value))
- return v;
+ v = RARRAY_AREF(ary, i);
+ if (RB_TYPE_P(v, T_ARRAY) &&
+ RARRAY_LEN(v) > 1 &&
+ rb_equal(RARRAY_AREF(v, 1), value))
+ return v;
}
return Qnil;
}
@@ -3098,41 +5273,67 @@ rb_ary_rassoc(VALUE ary, VALUE value)
static VALUE
recursive_equal(VALUE ary1, VALUE ary2, int recur)
{
- long i;
+ long i, len1;
+ const VALUE *p1, *p2;
if (recur) return Qtrue; /* Subtle! */
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- if (!rb_equal(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
- return Qfalse;
+
+ /* rb_equal() can evacuate ptrs */
+ p1 = RARRAY_CONST_PTR(ary1);
+ p2 = RARRAY_CONST_PTR(ary2);
+ len1 = RARRAY_LEN(ary1);
+
+ for (i = 0; i < len1; i++) {
+ if (*p1 != *p2) {
+ if (rb_equal(*p1, *p2)) {
+ len1 = RARRAY_LEN(ary1);
+ if (len1 != RARRAY_LEN(ary2))
+ return Qfalse;
+ if (len1 < i)
+ return Qtrue;
+ p1 = RARRAY_CONST_PTR(ary1) + i;
+ p2 = RARRAY_CONST_PTR(ary2) + i;
+ }
+ else {
+ return Qfalse;
+ }
+ }
+ p1++;
+ p2++;
}
return Qtrue;
}
/*
* call-seq:
- * ary == other_ary -> bool
+ * array == other_array -> true or false
*
- * Equality---Two arrays are equal if they contain the same number
- * of elements and if each element is equal to (according to
- * Object.==) the corresponding element in the other array.
+ * Returns +true+ if both <tt>array.size == other_array.size</tt>
+ * and for each index +i+ in +array+, <tt>array[i] == other_array[i]</tt>:
*
- * [ "a", "c" ] == [ "a", "c", 7 ] #=> false
- * [ "a", "c", 7 ] == [ "a", "c", 7 ] #=> true
- * [ "a", "c", 7 ] == [ "a", "d", "f" ] #=> false
+ * a0 = [:foo, 'bar', 2]
+ * a1 = [:foo, 'bar', 2.0]
+ * a1 == a0 # => true
+ * [] == [] # => true
*
+ * Otherwise, returns +false+.
+ *
+ * This method is different from method Array#eql?,
+ * which compares elements using <tt>Object#eql?</tt>.
*/
static VALUE
rb_ary_equal(VALUE ary1, VALUE ary2)
{
if (ary1 == ary2) return Qtrue;
- if (TYPE(ary2) != T_ARRAY) {
- if (!rb_respond_to(ary2, rb_intern("to_ary"))) {
- return Qfalse;
- }
- return rb_equal(ary2, ary1);
+ if (!RB_TYPE_P(ary2, T_ARRAY)) {
+ if (!rb_respond_to(ary2, idTo_ary)) {
+ return Qfalse;
+ }
+ return rb_equal(ary2, ary1);
}
if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+ if (RARRAY_CONST_PTR_TRANSIENT(ary1) == RARRAY_CONST_PTR_TRANSIENT(ary2)) return Qtrue;
return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
}
@@ -3143,90 +5344,109 @@ recursive_eql(VALUE ary1, VALUE ary2, int recur)
if (recur) return Qtrue; /* Subtle! */
for (i=0; i<RARRAY_LEN(ary1); i++) {
- if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
- return Qfalse;
+ if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+ return Qfalse;
}
return Qtrue;
}
/*
* call-seq:
- * ary.eql?(other) -> true or false
+ * array.eql? other_array -> true or false
*
- * Returns <code>true</code> if +self+ and _other_ are the same object,
- * or are both arrays with the same content.
+ * Returns +true+ if +self+ and +other_array+ are the same size,
+ * and if, for each index +i+ in +self+, <tt>self[i].eql? other_array[i]</tt>:
+ *
+ * a0 = [:foo, 'bar', 2]
+ * a1 = [:foo, 'bar', 2]
+ * a1.eql?(a0) # => true
+ *
+ * Otherwise, returns +false+.
+ *
+ * This method is different from method Array#==,
+ * which compares using method <tt>Object#==</tt>.
*/
static VALUE
rb_ary_eql(VALUE ary1, VALUE ary2)
{
if (ary1 == ary2) return Qtrue;
- if (TYPE(ary2) != T_ARRAY) return Qfalse;
+ if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+ if (RARRAY_CONST_PTR_TRANSIENT(ary1) == RARRAY_CONST_PTR_TRANSIENT(ary2)) return Qtrue;
return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
}
+/*
+ * call-seq:
+ * array.hash -> integer
+ *
+ * Returns the integer hash value for +self+.
+ *
+ * Two arrays with the same content will have the same hash code (and will compare using eql?):
+ *
+ * [0, 1, 2].hash == [0, 1, 2].hash # => true
+ * [0, 1, 2].hash == [0, 1, 3].hash # => false
+ *
+ */
+
static VALUE
-recursive_hash(VALUE ary, VALUE dummy, int recur)
+rb_ary_hash(VALUE ary)
{
long i;
st_index_t h;
VALUE n;
h = rb_hash_start(RARRAY_LEN(ary));
- if (recur) {
- h = rb_hash_uint(h, NUM2LONG(rb_hash(rb_cArray)));
- }
- else {
- for (i=0; i<RARRAY_LEN(ary); i++) {
- n = rb_hash(RARRAY_PTR(ary)[i]);
- h = rb_hash_uint(h, NUM2LONG(n));
- }
+ h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ n = rb_hash(RARRAY_AREF(ary, i));
+ h = rb_hash_uint(h, NUM2LONG(n));
}
h = rb_hash_end(h);
- return LONG2FIX(h);
-}
-
-/*
- * call-seq:
- * ary.hash -> fixnum
- *
- * Compute a hash-code for this array. Two arrays with the same content
- * will have the same hash code (and will compare using <code>eql?</code>).
- */
-
-static VALUE
-rb_ary_hash(VALUE ary)
-{
- return rb_exec_recursive_outer(recursive_hash, ary, 0);
+ return ST2FIX(h);
}
/*
* call-seq:
- * ary.include?(obj) -> true or false
+ * array.include?(obj) -> true or false
*
- * Returns <code>true</code> if the given object is present in
- * +self+ (that is, if any object <code>==</code> <i>anObject</i>),
- * <code>false</code> otherwise.
+ * Returns +true+ if for some index +i+ in +self+, <tt>obj == self[i]</tt>;
+ * otherwise +false+:
*
- * a = [ "a", "b", "c" ]
- * a.include?("b") #=> true
- * a.include?("z") #=> false
+ * [0, 1, 2].include?(2) # => true
+ * [0, 1, 2].include?(3) # => false
*/
VALUE
rb_ary_includes(VALUE ary, VALUE item)
{
long i;
+ VALUE e;
for (i=0; i<RARRAY_LEN(ary); i++) {
- if (rb_equal(RARRAY_PTR(ary)[i], item)) {
- return Qtrue;
- }
+ e = RARRAY_AREF(ary, i);
+ if (rb_equal(e, item)) {
+ return Qtrue;
+ }
}
return Qfalse;
}
+static VALUE
+rb_ary_includes_by_eql(VALUE ary, VALUE item)
+{
+ long i;
+ VALUE e;
+
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (rb_eql(item, e)) {
+ return Qtrue;
+ }
+ }
+ return Qfalse;
+}
static VALUE
recursive_cmp(VALUE ary1, VALUE ary2, int recur)
@@ -3236,34 +5456,46 @@ recursive_cmp(VALUE ary1, VALUE ary2, int recur)
if (recur) return Qundef; /* Subtle! */
len = RARRAY_LEN(ary1);
if (len > RARRAY_LEN(ary2)) {
- len = RARRAY_LEN(ary2);
+ len = RARRAY_LEN(ary2);
}
for (i=0; i<len; i++) {
- VALUE v = rb_funcall(rb_ary_elt(ary1, i), id_cmp, 1, rb_ary_elt(ary2, i));
- if (v != INT2FIX(0)) {
- return v;
- }
+ VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
+ VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
+ if (v != INT2FIX(0)) {
+ return v;
+ }
}
return Qundef;
}
/*
* call-seq:
- * ary <=> other_ary -> -1, 0, +1 or nil
- *
- * Comparison---Returns an integer (-1, 0,
- * or +1) if this array is less than, equal to, or greater than
- * <i>other_ary</i>. Each object in each array is compared
- * (using <=>). If any value isn't
- * equal, then that inequality is the return value. If all the
- * values found are equal, then the return is based on a
- * comparison of the array lengths. Thus, two arrays are
- * ``equal'' according to <code>Array#<=></code> if and only if they have
- * the same length and the value of each element is equal to the
- * value of the corresponding element in the other array.
- *
- * [ "a", "a", "c" ] <=> [ "a", "b", "c" ] #=> -1
- * [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ] #=> +1
+ * array <=> other_array -> -1, 0, or 1
+ *
+ * Returns -1, 0, or 1 as +self+ is less than, equal to, or greater than +other_array+.
+ * For each index +i+ in +self+, evaluates <tt>result = self[i] <=> other_array[i]</tt>.
+ *
+ * Returns -1 if any result is -1:
+ *
+ * [0, 1, 2] <=> [0, 1, 3] # => -1
+ *
+ * Returns 1 if any result is 1:
+ *
+ * [0, 1, 2] <=> [0, 1, 1] # => 1
+ *
+ * When all results are zero:
+ *
+ * - Returns -1 if +array+ is smaller than +other_array+:
+ *
+ * [0, 1, 2] <=> [0, 1, 2, 3] # => -1
+ *
+ * - Returns 1 if +array+ is larger than +other_array+:
+ *
+ * [0, 1, 2] <=> [0, 1] # => 1
+ *
+ * - Returns 0 if +array+ and +other_array+ are the same size:
+ *
+ * [0, 1, 2] <=> [0, 1, 2] # => 0
*
*/
@@ -3277,7 +5509,7 @@ rb_ary_cmp(VALUE ary1, VALUE ary2)
if (NIL_P(ary2)) return Qnil;
if (ary1 == ary2) return INT2FIX(0);
v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
- if (v != Qundef) return v;
+ if (!UNDEF_P(v)) return v;
len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
if (len == 0) return INT2FIX(0);
if (len > 0) return INT2FIX(1);
@@ -3290,24 +5522,26 @@ ary_add_hash(VALUE hash, VALUE ary)
long i;
for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_hash_aset(hash, RARRAY_PTR(ary)[i], Qtrue);
+ VALUE elt = RARRAY_AREF(ary, i);
+ rb_hash_add_new_element(hash, elt, elt);
}
return hash;
}
static inline VALUE
-ary_tmp_hash_new(void)
+ary_tmp_hash_new(VALUE ary)
{
- VALUE hash = rb_hash_new();
+ long size = RARRAY_LEN(ary);
+ VALUE hash = rb_hash_new_with_size(size);
- RBASIC(hash)->klass = 0;
+ RBASIC_CLEAR_CLASS(hash);
return hash;
}
static VALUE
ary_make_hash(VALUE ary)
{
- VALUE hash = ary_tmp_hash_new();
+ VALUE hash = ary_tmp_hash_new(ary);
return ary_add_hash(hash, ary);
}
@@ -3317,10 +5551,8 @@ ary_add_hash_by(VALUE hash, VALUE ary)
long i;
for (i = 0; i < RARRAY_LEN(ary); ++i) {
- VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
- if (rb_hash_lookup2(hash, k, Qundef) == Qundef) {
- rb_hash_aset(hash, k, v);
- }
+ VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+ rb_hash_add_new_element(hash, k, v);
}
return hash;
}
@@ -3328,45 +5560,61 @@ ary_add_hash_by(VALUE hash, VALUE ary)
static VALUE
ary_make_hash_by(VALUE ary)
{
- VALUE hash = ary_tmp_hash_new();
+ VALUE hash = ary_tmp_hash_new(ary);
return ary_add_hash_by(hash, ary);
}
static inline void
ary_recycle_hash(VALUE hash)
{
- if (RHASH(hash)->ntbl) {
- st_table *tbl = RHASH(hash)->ntbl;
- RHASH(hash)->ntbl = 0;
- st_free_table(tbl);
+ assert(RBASIC_CLASS(hash) == 0);
+ if (RHASH_ST_TABLE_P(hash)) {
+ st_table *tbl = RHASH_ST_TABLE(hash);
+ st_free_table(tbl);
+ RHASH_ST_CLEAR(hash);
}
}
/*
* call-seq:
- * ary - other_ary -> new_ary
+ * array - other_array -> new_array
+ *
+ * Returns a new \Array containing only those elements from +array+
+ * that are not found in \Array +other_array+;
+ * items are compared using <tt>eql?</tt>;
+ * the order from +array+ is preserved:
*
- * Array Difference---Returns a new array that is a copy of
- * the original array, removing any items that also appear in
- * <i>other_ary</i>. (If you need set-like behavior, see the
- * library class Set.)
+ * [0, 1, 1, 2, 1, 1, 3, 1, 1] - [1] # => [0, 2, 3]
+ * [0, 1, 2, 3] - [3, 0] # => [1, 2]
+ * [0, 1, 2] - [4] # => [0, 1, 2]
*
- * [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ] #=> [ 3, 3, 5 ]
+ * Related: Array#difference.
*/
-static VALUE
+VALUE
rb_ary_diff(VALUE ary1, VALUE ary2)
{
VALUE ary3;
- volatile VALUE hash;
+ VALUE hash;
long i;
- hash = ary_make_hash(to_ary(ary2));
+ ary2 = to_ary(ary2);
+ if (RARRAY_LEN(ary2) == 0) { return ary_make_shared_copy(ary1); }
ary3 = rb_ary_new();
+ if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN || RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ VALUE elt = rb_ary_elt(ary1, i);
+ if (rb_ary_includes_by_eql(ary2, elt)) continue;
+ rb_ary_push(ary3, elt);
+ }
+ return ary3;
+ }
+
+ hash = ary_make_hash(ary2);
for (i=0; i<RARRAY_LEN(ary1); i++) {
- if (st_lookup(RHASH_TBL(hash), RARRAY_PTR(ary1)[i], 0)) continue;
- rb_ary_push(ary3, rb_ary_elt(ary1, i));
+ if (rb_hash_stlike_lookup(hash, RARRAY_AREF(ary1, i), NULL)) continue;
+ rb_ary_push(ary3, rb_ary_elt(ary1, i));
}
ary_recycle_hash(hash);
return ary3;
@@ -3374,12 +5622,73 @@ rb_ary_diff(VALUE ary1, VALUE ary2)
/*
* call-seq:
- * ary & other_ary -> new_ary
+ * array.difference(*other_arrays) -> new_array
+ *
+ * Returns a new \Array containing only those elements from +self+
+ * that are not found in any of the Arrays +other_arrays+;
+ * items are compared using <tt>eql?</tt>; order from +self+ is preserved:
+ *
+ * [0, 1, 1, 2, 1, 1, 3, 1, 1].difference([1]) # => [0, 2, 3]
+ * [0, 1, 2, 3].difference([3, 0], [1, 3]) # => [2]
+ * [0, 1, 2].difference([4]) # => [0, 1, 2]
+ *
+ * Returns a copy of +self+ if no arguments given.
+ *
+ * Related: Array#-.
+ */
+
+static VALUE
+rb_ary_difference_multi(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE ary_diff;
+ long i, length;
+ volatile VALUE t0;
+ bool *is_hash = ALLOCV_N(bool, t0, argc);
+ ary_diff = rb_ary_new();
+ length = RARRAY_LEN(ary);
+
+ for (i = 0; i < argc; i++) {
+ argv[i] = to_ary(argv[i]);
+ is_hash[i] = (length > SMALL_ARRAY_LEN && RARRAY_LEN(argv[i]) > SMALL_ARRAY_LEN);
+ if (is_hash[i]) argv[i] = ary_make_hash(argv[i]);
+ }
+
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ int j;
+ VALUE elt = rb_ary_elt(ary, i);
+ for (j = 0; j < argc; j++) {
+ if (is_hash[j]) {
+ if (rb_hash_stlike_lookup(argv[j], RARRAY_AREF(ary, i), NULL))
+ break;
+ }
+ else {
+ if (rb_ary_includes_by_eql(argv[j], elt)) break;
+ }
+ }
+ if (j == argc) rb_ary_push(ary_diff, elt);
+ }
+
+ ALLOCV_END(t0);
+
+ return ary_diff;
+}
+
+
+/*
+ * call-seq:
+ * array & other_array -> new_array
+ *
+ * Returns a new \Array containing each element found in both +array+ and \Array +other_array+;
+ * duplicates are omitted; items are compared using <tt>eql?</tt>:
+ *
+ * [0, 1, 2, 3] & [1, 2] # => [1, 2]
+ * [0, 1, 0, 1] & [0, 1] # => [0, 1]
*
- * Set Intersection---Returns a new array
- * containing elements common to the two arrays, with no duplicates.
+ * Preserves order from +array+:
*
- * [ 1, 1, 3, 5 ] & [ 1, 2, 3 ] #=> [ 1, 3 ]
+ * [0, 1, 2] & [3, 2, 1, 0] # => [0, 1, 2]
+ *
+ * Related: Array#intersection.
*/
@@ -3391,18 +5700,27 @@ rb_ary_and(VALUE ary1, VALUE ary2)
long i;
ary2 = to_ary(ary2);
- ary3 = rb_ary_new2(RARRAY_LEN(ary1) < RARRAY_LEN(ary2) ?
- RARRAY_LEN(ary1) : RARRAY_LEN(ary2));
- hash = ary_make_hash(ary2);
-
- if (RHASH_EMPTY_P(hash))
+ ary3 = rb_ary_new();
+ if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return ary3;
+
+ if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ v = RARRAY_AREF(ary1, i);
+ if (!rb_ary_includes_by_eql(ary2, v)) continue;
+ if (rb_ary_includes_by_eql(ary3, v)) continue;
+ rb_ary_push(ary3, v);
+ }
return ary3;
+ }
+
+ hash = ary_make_hash(ary2);
for (i=0; i<RARRAY_LEN(ary1); i++) {
- vv = (st_data_t)(v = rb_ary_elt(ary1, i));
- if (st_delete(RHASH_TBL(hash), &vv, 0)) {
- rb_ary_push(ary3, v);
- }
+ v = RARRAY_AREF(ary1, i);
+ vv = (st_data_t)v;
+ if (rb_hash_stlike_delete(hash, &vv, 0)) {
+ rb_ary_push(ary3, v);
+ }
}
ary_recycle_hash(hash);
@@ -3411,40 +5729,572 @@ rb_ary_and(VALUE ary1, VALUE ary2)
/*
* call-seq:
- * ary | other_ary -> new_ary
+ * array.intersection(*other_arrays) -> new_array
+ *
+ * Returns a new \Array containing each element found both in +self+
+ * and in all of the given Arrays +other_arrays+;
+ * duplicates are omitted; items are compared using <tt>eql?</tt>:
+ *
+ * [0, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
+ * [0, 0, 1, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
+ *
+ * Preserves order from +self+:
+ *
+ * [0, 1, 2].intersection([2, 1, 0]) # => [0, 1, 2]
+ *
+ * Returns a copy of +self+ if no arguments given.
+ *
+ * Related: Array#&.
+ */
+
+static VALUE
+rb_ary_intersection_multi(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE result = rb_ary_dup(ary);
+ int i;
+
+ for (i = 0; i < argc; i++) {
+ result = rb_ary_and(result, argv[i]);
+ }
+
+ return result;
+}
+
+static int
+ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
+{
+ if (existing) return ST_STOP;
+ *key = *value = (VALUE)arg;
+ return ST_CONTINUE;
+}
+
+static void
+rb_ary_union(VALUE ary_union, VALUE ary)
+{
+ long i;
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ VALUE elt = rb_ary_elt(ary, i);
+ if (rb_ary_includes_by_eql(ary_union, elt)) continue;
+ rb_ary_push(ary_union, elt);
+ }
+}
+
+static void
+rb_ary_union_hash(VALUE hash, VALUE ary2)
+{
+ long i;
+ for (i = 0; i < RARRAY_LEN(ary2); i++) {
+ VALUE elt = RARRAY_AREF(ary2, i);
+ if (!rb_hash_stlike_update(hash, (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+ RB_OBJ_WRITTEN(hash, Qundef, elt);
+ }
+ }
+}
+
+/*
+ * call-seq:
+ * array | other_array -> new_array
+ *
+ * Returns the union of +array+ and \Array +other_array+;
+ * duplicates are removed; order is preserved;
+ * items are compared using <tt>eql?</tt>:
*
- * Set Union---Returns a new array by joining this array with
- * <i>other_ary</i>, removing duplicates.
+ * [0, 1] | [2, 3] # => [0, 1, 2, 3]
+ * [0, 1, 1] | [2, 2, 3] # => [0, 1, 2, 3]
+ * [0, 1, 2] | [3, 2, 1, 0] # => [0, 1, 2, 3]
*
- * [ "a", "b", "c" ] | [ "c", "d", "a" ]
- * #=> [ "a", "b", "c", "d" ]
+ * Related: Array#union.
*/
static VALUE
rb_ary_or(VALUE ary1, VALUE ary2)
{
- VALUE hash, ary3, v;
+ VALUE hash, ary3;
+
+ ary2 = to_ary(ary2);
+ if (RARRAY_LEN(ary1) + RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ ary3 = rb_ary_new();
+ rb_ary_union(ary3, ary1);
+ rb_ary_union(ary3, ary2);
+ return ary3;
+ }
+
+ hash = ary_make_hash(ary1);
+ rb_ary_union_hash(hash, ary2);
+
+ ary3 = rb_hash_values(hash);
+ ary_recycle_hash(hash);
+ return ary3;
+}
+
+/*
+ * call-seq:
+ * array.union(*other_arrays) -> new_array
+ *
+ * Returns a new \Array that is the union of +self+ and all given Arrays +other_arrays+;
+ * duplicates are removed; order is preserved; items are compared using <tt>eql?</tt>:
+ *
+ * [0, 1, 2, 3].union([4, 5], [6, 7]) # => [0, 1, 2, 3, 4, 5, 6, 7]
+ * [0, 1, 1].union([2, 1], [3, 1]) # => [0, 1, 2, 3]
+ * [0, 1, 2, 3].union([3, 2], [1, 0]) # => [0, 1, 2, 3]
+ *
+ * Returns a copy of +self+ if no arguments given.
+ *
+ * Related: Array#|.
+ */
+
+static VALUE
+rb_ary_union_multi(int argc, VALUE *argv, VALUE ary)
+{
+ int i;
+ long sum;
+ VALUE hash, ary_union;
+
+ sum = RARRAY_LEN(ary);
+ for (i = 0; i < argc; i++) {
+ argv[i] = to_ary(argv[i]);
+ sum += RARRAY_LEN(argv[i]);
+ }
+
+ if (sum <= SMALL_ARRAY_LEN) {
+ ary_union = rb_ary_new();
+
+ rb_ary_union(ary_union, ary);
+ for (i = 0; i < argc; i++) rb_ary_union(ary_union, argv[i]);
+
+ return ary_union;
+ }
+
+ hash = ary_make_hash(ary);
+ for (i = 0; i < argc; i++) rb_ary_union_hash(hash, argv[i]);
+
+ ary_union = rb_hash_values(hash);
+ ary_recycle_hash(hash);
+ return ary_union;
+}
+
+/*
+ * call-seq:
+ * ary.intersect?(other_ary) -> true or false
+ *
+ * Returns +true+ if the array and +other_ary+ have at least one element in
+ * common, otherwise returns +false+:
+ *
+ * a = [ 1, 2, 3 ]
+ * b = [ 3, 4, 5 ]
+ * c = [ 5, 6, 7 ]
+ * a.intersect?(b) #=> true
+ * a.intersect?(c) #=> false
+ *
+ */
+
+static VALUE
+rb_ary_intersect_p(VALUE ary1, VALUE ary2)
+{
+ VALUE hash, v, result, shorter, longer;
st_data_t vv;
long i;
ary2 = to_ary(ary2);
- ary3 = rb_ary_new2(RARRAY_LEN(ary1)+RARRAY_LEN(ary2));
- hash = ary_add_hash(ary_make_hash(ary1), ary2);
+ if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return Qfalse;
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- vv = (st_data_t)(v = rb_ary_elt(ary1, i));
- if (st_delete(RHASH_TBL(hash), &vv, 0)) {
- rb_ary_push(ary3, v);
- }
+ if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ v = RARRAY_AREF(ary1, i);
+ if (rb_ary_includes_by_eql(ary2, v)) return Qtrue;
+ }
+ return Qfalse;
}
- for (i=0; i<RARRAY_LEN(ary2); i++) {
- vv = (st_data_t)(v = rb_ary_elt(ary2, i));
- if (st_delete(RHASH_TBL(hash), &vv, 0)) {
- rb_ary_push(ary3, v);
- }
+
+ shorter = ary1;
+ longer = ary2;
+ if (RARRAY_LEN(ary1) > RARRAY_LEN(ary2)) {
+ longer = ary1;
+ shorter = ary2;
+ }
+
+ hash = ary_make_hash(shorter);
+ result = Qfalse;
+
+ for (i=0; i<RARRAY_LEN(longer); i++) {
+ v = RARRAY_AREF(longer, i);
+ vv = (st_data_t)v;
+ if (rb_hash_stlike_lookup(hash, vv, 0)) {
+ result = Qtrue;
+ break;
+ }
}
ary_recycle_hash(hash);
- return ary3;
+
+ return result;
+}
+
+static VALUE
+ary_max_generic(VALUE ary, long i, VALUE vmax)
+{
+ RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+ VALUE v;
+ for (; i < RARRAY_LEN(ary); ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (rb_cmpint(rb_funcallv(vmax, id_cmp, 1, &v), vmax, v) < 0) {
+ vmax = v;
+ }
+ }
+
+ return vmax;
+}
+
+static VALUE
+ary_max_opt_fixnum(VALUE ary, long i, VALUE vmax)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(FIXNUM_P(vmax));
+
+ VALUE v;
+ for (; i < n; ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (FIXNUM_P(v)) {
+ if ((long)vmax < (long)v) {
+ vmax = v;
+ }
+ }
+ else {
+ return ary_max_generic(ary, i, vmax);
+ }
+ }
+
+ return vmax;
+}
+
+static VALUE
+ary_max_opt_float(VALUE ary, long i, VALUE vmax)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(RB_FLOAT_TYPE_P(vmax));
+
+ VALUE v;
+ for (; i < n; ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (RB_FLOAT_TYPE_P(v)) {
+ if (rb_float_cmp(vmax, v) < 0) {
+ vmax = v;
+ }
+ }
+ else {
+ return ary_max_generic(ary, i, vmax);
+ }
+ }
+
+ return vmax;
+}
+
+static VALUE
+ary_max_opt_string(VALUE ary, long i, VALUE vmax)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(STRING_P(vmax));
+
+ VALUE v;
+ for (; i < n; ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (STRING_P(v)) {
+ if (rb_str_cmp(vmax, v) < 0) {
+ vmax = v;
+ }
+ }
+ else {
+ return ary_max_generic(ary, i, vmax);
+ }
+ }
+
+ return vmax;
+}
+
+/*
+ * call-seq:
+ * array.max -> element
+ * array.max {|a, b| ... } -> element
+ * array.max(n) -> new_array
+ * array.max(n) {|a, b| ... } -> new_array
+ *
+ * Returns one of the following:
+ *
+ * - The maximum-valued element from +self+.
+ * - A new \Array of maximum-valued elements selected from +self+.
+ *
+ * When no block is given, each element in +self+ must respond to method <tt><=></tt>
+ * with an \Integer.
+ *
+ * With no argument and no block, returns the element in +self+
+ * having the maximum value per method <tt><=></tt>:
+ *
+ * [0, 1, 2].max # => 2
+ *
+ * With an argument \Integer +n+ and no block, returns a new \Array with at most +n+ elements,
+ * in descending order per method <tt><=></tt>:
+ *
+ * [0, 1, 2, 3].max(3) # => [3, 2, 1]
+ * [0, 1, 2, 3].max(6) # => [3, 2, 1, 0]
+ *
+ * When a block is given, the block must return an \Integer.
+ *
+ * With a block and no argument, calls the block <tt>self.size-1</tt> times to compare elements;
+ * returns the element having the maximum value per the block:
+ *
+ * ['0', '00', '000'].max {|a, b| a.size <=> b.size } # => "000"
+ *
+ * With an argument +n+ and a block, returns a new \Array with at most +n+ elements,
+ * in descending order per the block:
+ *
+ * ['0', '00', '000'].max(2) {|a, b| a.size <=> b.size } # => ["000", "00"]
+ *
+ */
+static VALUE
+rb_ary_max(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE result = Qundef, v;
+ VALUE num;
+ long i;
+
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+ return rb_nmin_run(ary, num, 0, 1, 1);
+
+ const long n = RARRAY_LEN(ary);
+ if (rb_block_given_p()) {
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
+ result = v;
+ }
+ }
+ }
+ else if (n > 0) {
+ result = RARRAY_AREF(ary, 0);
+ if (n > 1) {
+ if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+ return ary_max_opt_fixnum(ary, 1, result);
+ }
+ else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+ return ary_max_opt_string(ary, 1, result);
+ }
+ else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+ return ary_max_opt_float(ary, 1, result);
+ }
+ else {
+ return ary_max_generic(ary, 1, result);
+ }
+ }
+ }
+ if (UNDEF_P(result)) return Qnil;
+ return result;
+}
+
+static VALUE
+ary_min_generic(VALUE ary, long i, VALUE vmin)
+{
+ RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+ VALUE v;
+ for (; i < RARRAY_LEN(ary); ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (rb_cmpint(rb_funcallv(vmin, id_cmp, 1, &v), vmin, v) > 0) {
+ vmin = v;
+ }
+ }
+
+ return vmin;
+}
+
+static VALUE
+ary_min_opt_fixnum(VALUE ary, long i, VALUE vmin)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(FIXNUM_P(vmin));
+
+ VALUE a;
+ for (; i < n; ++i) {
+ a = RARRAY_AREF(ary, i);
+
+ if (FIXNUM_P(a)) {
+ if ((long)vmin > (long)a) {
+ vmin = a;
+ }
+ }
+ else {
+ return ary_min_generic(ary, i, vmin);
+ }
+ }
+
+ return vmin;
+}
+
+static VALUE
+ary_min_opt_float(VALUE ary, long i, VALUE vmin)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(RB_FLOAT_TYPE_P(vmin));
+
+ VALUE a;
+ for (; i < n; ++i) {
+ a = RARRAY_AREF(ary, i);
+
+ if (RB_FLOAT_TYPE_P(a)) {
+ if (rb_float_cmp(vmin, a) > 0) {
+ vmin = a;
+ }
+ }
+ else {
+ return ary_min_generic(ary, i, vmin);
+ }
+ }
+
+ return vmin;
+}
+
+static VALUE
+ary_min_opt_string(VALUE ary, long i, VALUE vmin)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(STRING_P(vmin));
+
+ VALUE a;
+ for (; i < n; ++i) {
+ a = RARRAY_AREF(ary, i);
+
+ if (STRING_P(a)) {
+ if (rb_str_cmp(vmin, a) > 0) {
+ vmin = a;
+ }
+ }
+ else {
+ return ary_min_generic(ary, i, vmin);
+ }
+ }
+
+ return vmin;
+}
+
+/*
+ * call-seq:
+ * array.min -> element
+ * array.min { |a, b| ... } -> element
+ * array.min(n) -> new_array
+ * array.min(n) { |a, b| ... } -> new_array
+ *
+ * Returns one of the following:
+ *
+ * - The minimum-valued element from +self+.
+ * - A new \Array of minimum-valued elements selected from +self+.
+ *
+ * When no block is given, each element in +self+ must respond to method <tt><=></tt>
+ * with an \Integer.
+ *
+ * With no argument and no block, returns the element in +self+
+ * having the minimum value per method <tt><=></tt>:
+ *
+ * [0, 1, 2].min # => 0
+ *
+ * With \Integer argument +n+ and no block, returns a new \Array with at most +n+ elements,
+ * in ascending order per method <tt><=></tt>:
+ *
+ * [0, 1, 2, 3].min(3) # => [0, 1, 2]
+ * [0, 1, 2, 3].min(6) # => [0, 1, 2, 3]
+ *
+ * When a block is given, the block must return an Integer.
+ *
+ * With a block and no argument, calls the block <tt>self.size-1</tt> times to compare elements;
+ * returns the element having the minimum value per the block:
+ *
+ * ['0', '00', '000'].min { |a, b| a.size <=> b.size } # => "0"
+ *
+ * With an argument +n+ and a block, returns a new \Array with at most +n+ elements,
+ * in ascending order per the block:
+ *
+ * ['0', '00', '000'].min(2) {|a, b| a.size <=> b.size } # => ["0", "00"]
+ *
+ */
+static VALUE
+rb_ary_min(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE result = Qundef, v;
+ VALUE num;
+ long i;
+
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+ return rb_nmin_run(ary, num, 0, 0, 1);
+
+ const long n = RARRAY_LEN(ary);
+ if (rb_block_given_p()) {
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
+ result = v;
+ }
+ }
+ }
+ else if (n > 0) {
+ result = RARRAY_AREF(ary, 0);
+ if (n > 1) {
+ if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+ return ary_min_opt_fixnum(ary, 1, result);
+ }
+ else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+ return ary_min_opt_string(ary, 1, result);
+ }
+ else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+ return ary_min_opt_float(ary, 1, result);
+ }
+ else {
+ return ary_min_generic(ary, 1, result);
+ }
+ }
+ }
+ if (UNDEF_P(result)) return Qnil;
+ return result;
+}
+
+/*
+ * call-seq:
+ * array.minmax -> [min_val, max_val]
+ * array.minmax {|a, b| ... } -> [min_val, max_val]
+ *
+ * Returns a new 2-element \Array containing the minimum and maximum values
+ * from +self+, either per method <tt><=></tt> or per a given block:.
+ *
+ * When no block is given, each element in +self+ must respond to method <tt><=></tt>
+ * with an \Integer;
+ * returns a new 2-element \Array containing the minimum and maximum values
+ * from +self+, per method <tt><=></tt>:
+ *
+ * [0, 1, 2].minmax # => [0, 2]
+ *
+ * When a block is given, the block must return an \Integer;
+ * the block is called <tt>self.size-1</tt> times to compare elements;
+ * returns a new 2-element \Array containing the minimum and maximum values
+ * from +self+, per the block:
+ *
+ * ['0', '00', '000'].minmax {|a, b| a.size <=> b.size } # => ["0", "000"]
+ *
+ */
+static VALUE
+rb_ary_minmax(VALUE ary)
+{
+ if (rb_block_given_p()) {
+ return rb_call_super(0, NULL);
+ }
+ return rb_assoc_new(rb_ary_min(0, 0, ary), rb_ary_max(0, 0, ary));
}
static int
@@ -3456,51 +6306,59 @@ push_value(st_data_t key, st_data_t val, st_data_t ary)
/*
* call-seq:
- * ary.uniq! -> ary or nil
- *
- * Removes duplicate elements from +self+.
- * Returns <code>nil</code> if no changes are made (that is, no
- * duplicates are found).
- *
- * a = [ "a", "a", "b", "b", "c" ]
- * a.uniq! #=> ["a", "b", "c"]
- * b = [ "a", "b", "c" ]
- * b.uniq! #=> nil
- * c = [ "a:def", "a:xyz", "b:abc", "b:xyz", "c:jkl" ]
- * c.uniq! {|s| s[/^\w+/]} #=> [ "a:def", "b:abc", "c:jkl" ]
+ * array.uniq! -> self or nil
+ * array.uniq! {|element| ... } -> self or nil
+ *
+ * Removes duplicate elements from +self+, the first occurrence always being retained;
+ * returns +self+ if any elements removed, +nil+ otherwise.
+ *
+ * With no block given, identifies and removes elements using method <tt>eql?</tt>
+ * to compare.
+ *
+ * Returns +self+ if any elements removed:
+ *
+ * a = [0, 0, 1, 1, 2, 2]
+ * a.uniq! # => [0, 1, 2]
+ *
+ * Returns +nil+ if no elements removed.
+ *
+ * With a block given, calls the block for each element;
+ * identifies (using method <tt>eql?</tt>) and removes
+ * elements for which the block returns duplicate values.
+ *
+ * Returns +self+ if any elements removed:
+ *
+ * a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ * a.uniq! {|element| element.size } # => ['a', 'aa', 'aaa']
+ *
+ * Returns +nil+ if no elements removed.
*/
-
static VALUE
rb_ary_uniq_bang(VALUE ary)
{
- VALUE hash, v;
- long i, j;
+ VALUE hash;
+ long hash_size;
rb_ary_modify_check(ary);
if (RARRAY_LEN(ary) <= 1)
return Qnil;
- if (rb_block_given_p()) {
- hash = ary_make_hash_by(ary);
- if (RARRAY_LEN(ary) == (i = RHASH_SIZE(hash))) {
- return Qnil;
- }
- ary_resize_capa(ary, i);
- ARY_SET_LEN(ary, 0);
- st_foreach(RHASH_TBL(hash), push_value, ary);
+ if (rb_block_given_p())
+ hash = ary_make_hash_by(ary);
+ else
+ hash = ary_make_hash(ary);
+
+ hash_size = RHASH_SIZE(hash);
+ if (RARRAY_LEN(ary) == hash_size) {
+ return Qnil;
}
- else {
- hash = ary_make_hash(ary);
- if (RARRAY_LEN(ary) == (long)RHASH_SIZE(hash)) {
- return Qnil;
- }
- for (i=j=0; i<RARRAY_LEN(ary); i++) {
- st_data_t vv = (st_data_t)(v = rb_ary_elt(ary, i));
- if (st_delete(RHASH_TBL(hash), &vv, 0)) {
- rb_ary_store(ary, j++, v);
- }
- }
- ARY_SET_LEN(ary, j);
+ rb_ary_modify_check(ary);
+ ARY_SET_LEN(ary, 0);
+ if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+ rb_ary_unshare(ary);
+ FL_SET_EMBED(ary);
}
+ ary_resize_capa(ary, hash_size);
+ rb_hash_foreach(hash, push_value, ary);
ary_recycle_hash(hash);
return ary;
@@ -3508,54 +6366,58 @@ rb_ary_uniq_bang(VALUE ary)
/*
* call-seq:
- * ary.uniq -> new_ary
+ * array.uniq -> new_array
+ * array.uniq {|element| ... } -> new_array
+ *
+ * Returns a new \Array containing those elements from +self+ that are not duplicates,
+ * the first occurrence always being retained.
+ *
+ * With no block given, identifies and omits duplicates using method <tt>eql?</tt>
+ * to compare:
*
- * Returns a new array by removing duplicate values in +self+.
+ * a = [0, 0, 1, 1, 2, 2]
+ * a.uniq # => [0, 1, 2]
+ *
+ * With a block given, calls the block for each element;
+ * identifies (using method <tt>eql?</tt>) and omits duplicate values,
+ * that is, those elements for which the block returns the same value:
+ *
+ * a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ * a.uniq {|element| element.size } # => ["a", "aa", "aaa"]
*
- * a = [ "a", "a", "b", "b", "c" ]
- * a.uniq #=> ["a", "b", "c"]
- * c = [ "a:def", "a:xyz", "b:abc", "b:xyz", "c:jkl" ]
- * c.uniq {|s| s[/^\w+/]} #=> [ "a:def", "b:abc", "c:jkl" ]
*/
static VALUE
rb_ary_uniq(VALUE ary)
{
- VALUE hash, uniq, v;
- long i;
+ VALUE hash, uniq;
- if (RARRAY_LEN(ary) <= 1)
- return rb_ary_dup(ary);
- if (rb_block_given_p()) {
- hash = ary_make_hash_by(ary);
- uniq = ary_new(rb_obj_class(ary), RHASH_SIZE(hash));
- st_foreach(RHASH_TBL(hash), push_value, uniq);
+ if (RARRAY_LEN(ary) <= 1) {
+ hash = 0;
+ uniq = rb_ary_dup(ary);
+ }
+ else if (rb_block_given_p()) {
+ hash = ary_make_hash_by(ary);
+ uniq = rb_hash_values(hash);
}
else {
- hash = ary_make_hash(ary);
- uniq = ary_new(rb_obj_class(ary), RHASH_SIZE(hash));
- for (i=0; i<RARRAY_LEN(ary); i++) {
- st_data_t vv = (st_data_t)(v = rb_ary_elt(ary, i));
- if (st_delete(RHASH_TBL(hash), &vv, 0)) {
- rb_ary_push(uniq, v);
- }
- }
+ hash = ary_make_hash(ary);
+ uniq = rb_hash_values(hash);
+ }
+ if (hash) {
+ ary_recycle_hash(hash);
}
- ary_recycle_hash(hash);
return uniq;
}
/*
* call-seq:
- * ary.compact! -> ary or nil
+ * array.compact! -> self or nil
*
- * Removes +nil+ elements from the array.
- * Returns +nil+ if no changes were made, otherwise returns
- * </i>ary</i>.
+ * Removes all +nil+ elements from +self+.
*
- * [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
- * [ "a", "b", "c" ].compact! #=> nil
+ * Returns +self+ if any elements removed, otherwise +nil+.
*/
static VALUE
@@ -3565,33 +6427,30 @@ rb_ary_compact_bang(VALUE ary)
long n;
rb_ary_modify(ary);
- p = t = RARRAY_PTR(ary);
+ p = t = (VALUE *)RARRAY_CONST_PTR_TRANSIENT(ary); /* WB: no new reference */
end = p + RARRAY_LEN(ary);
while (t < end) {
- if (NIL_P(*t)) t++;
- else *p++ = *t++;
+ if (NIL_P(*t)) t++;
+ else *p++ = *t++;
}
- n = p - RARRAY_PTR(ary);
+ n = p - RARRAY_CONST_PTR_TRANSIENT(ary);
if (RARRAY_LEN(ary) == n) {
- return Qnil;
- }
- ARY_SET_LEN(ary, n);
- if (n * 2 < ARY_CAPA(ary) && ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
- ary_resize_capa(ary, n * 2);
+ return Qnil;
}
+ ary_resize_smaller(ary, n);
return ary;
}
/*
* call-seq:
- * ary.compact -> new_ary
+ * array.compact -> new_array
*
- * Returns a copy of +self+ with all +nil+ elements removed.
+ * Returns a new \Array containing all non-+nil+ elements from +self+:
*
- * [ "a", nil, "b", nil, "c", nil ].compact
- * #=> [ "a", "b", "c" ]
+ * a = [nil, 0, nil, 1, nil, 2, nil]
+ * a.compact # => [0, 1, 2]
*/
static VALUE
@@ -3604,121 +6463,182 @@ rb_ary_compact(VALUE ary)
/*
* call-seq:
- * ary.count -> int
- * ary.count(obj) -> int
- * ary.count { |item| block } -> int
+ * array.count -> an_integer
+ * array.count(obj) -> an_integer
+ * array.count {|element| ... } -> an_integer
+ *
+ * Returns a count of specified elements.
+ *
+ * With no argument and no block, returns the count of all elements:
*
- * Returns the number of elements. If an argument is given, counts
- * the number of elements which equals to <i>obj</i>. If a block is
- * given, counts the number of elements yielding a true value.
+ * [0, 1, 2].count # => 3
+ * [].count # => 0
*
- * ary = [1, 2, 4, 2]
- * ary.count #=> 4
- * ary.count(2) #=> 2
- * ary.count{|x|x%2==0} #=> 3
+ * With argument +obj+, returns the count of elements <tt>==</tt> to +obj+:
*
+ * [0, 1, 2, 0.0].count(0) # => 2
+ * [0, 1, 2].count(3) # => 0
+ *
+ * With no argument and a block given, calls the block with each element;
+ * returns the count of elements for which the block returns a truthy value:
+ *
+ * [0, 1, 2, 3].count {|element| element > 1} # => 2
+ *
+ * With argument +obj+ and a block given, issues a warning, ignores the block,
+ * and returns the count of elements <tt>==</tt> to +obj+.
*/
static VALUE
rb_ary_count(int argc, VALUE *argv, VALUE ary)
{
- long n = 0;
+ long i, n = 0;
- if (argc == 0) {
- VALUE *p, *pend;
+ if (rb_check_arity(argc, 0, 1) == 0) {
+ VALUE v;
- if (!rb_block_given_p())
- return LONG2NUM(RARRAY_LEN(ary));
+ if (!rb_block_given_p())
+ return LONG2NUM(RARRAY_LEN(ary));
- for (p = RARRAY_PTR(ary), pend = p + RARRAY_LEN(ary); p < pend; p++) {
- if (RTEST(rb_yield(*p))) n++;
- }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (RTEST(rb_yield(v))) n++;
+ }
}
else {
- VALUE obj, *p, *pend;
+ VALUE obj = argv[0];
- rb_scan_args(argc, argv, "1", &obj);
- if (rb_block_given_p()) {
- rb_warn("given block not used");
- }
- for (p = RARRAY_PTR(ary), pend = p + RARRAY_LEN(ary); p < pend; p++) {
- if (rb_equal(*p, obj)) n++;
- }
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
+ }
}
return LONG2NUM(n);
}
static VALUE
-flatten(VALUE ary, int level, int *modified)
+flatten(VALUE ary, int level)
{
- long i = 0;
- VALUE stack, result, tmp, elt;
- st_table *memo;
+ long i;
+ VALUE stack, result, tmp = 0, elt, vmemo;
+ st_table *memo = 0;
st_data_t id;
- stack = ary_new(0, ARY_DEFAULT_SIZE);
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ elt = RARRAY_AREF(ary, i);
+ tmp = rb_check_array_type(elt);
+ if (!NIL_P(tmp)) {
+ break;
+ }
+ }
+ if (i == RARRAY_LEN(ary)) {
+ return ary;
+ }
+
result = ary_new(0, RARRAY_LEN(ary));
- memo = st_init_numtable();
- st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
- *modified = 0;
+ ary_memcpy(result, 0, i, RARRAY_CONST_PTR_TRANSIENT(ary));
+ ARY_SET_LEN(result, i);
+
+ stack = ary_new(0, ARY_DEFAULT_SIZE);
+ rb_ary_push(stack, ary);
+ rb_ary_push(stack, LONG2NUM(i + 1));
+
+ if (level < 0) {
+ vmemo = rb_hash_new();
+ RBASIC_CLEAR_CLASS(vmemo);
+ memo = st_init_numtable();
+ rb_hash_st_table_set(vmemo, memo);
+ st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
+ st_insert(memo, (st_data_t)tmp, (st_data_t)Qtrue);
+ }
+
+ ary = tmp;
+ i = 0;
while (1) {
- while (i < RARRAY_LEN(ary)) {
- elt = RARRAY_PTR(ary)[i++];
- tmp = rb_check_array_type(elt);
- if (RBASIC(result)->klass) {
- rb_raise(rb_eRuntimeError, "flatten reentered");
- }
- if (NIL_P(tmp) || (level >= 0 && RARRAY_LEN(stack) / 2 >= level)) {
- rb_ary_push(result, elt);
- }
- else {
- *modified = 1;
- id = (st_data_t)tmp;
- if (st_lookup(memo, id, 0)) {
- st_free_table(memo);
- rb_raise(rb_eArgError, "tried to flatten recursive array");
- }
- st_insert(memo, id, (st_data_t)Qtrue);
- rb_ary_push(stack, ary);
- rb_ary_push(stack, LONG2NUM(i));
- ary = tmp;
- i = 0;
- }
- }
- if (RARRAY_LEN(stack) == 0) {
- break;
- }
- id = (st_data_t)ary;
- st_delete(memo, &id, 0);
- tmp = rb_ary_pop(stack);
- i = NUM2LONG(tmp);
- ary = rb_ary_pop(stack);
- }
-
- st_free_table(memo);
-
- RBASIC(result)->klass = rb_class_of(ary);
+ while (i < RARRAY_LEN(ary)) {
+ elt = RARRAY_AREF(ary, i++);
+ if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
+ rb_ary_push(result, elt);
+ continue;
+ }
+ tmp = rb_check_array_type(elt);
+ if (RBASIC(result)->klass) {
+ if (memo) {
+ RB_GC_GUARD(vmemo);
+ st_clear(memo);
+ }
+ rb_raise(rb_eRuntimeError, "flatten reentered");
+ }
+ if (NIL_P(tmp)) {
+ rb_ary_push(result, elt);
+ }
+ else {
+ if (memo) {
+ id = (st_data_t)tmp;
+ if (st_is_member(memo, id)) {
+ st_clear(memo);
+ rb_raise(rb_eArgError, "tried to flatten recursive array");
+ }
+ st_insert(memo, id, (st_data_t)Qtrue);
+ }
+ rb_ary_push(stack, ary);
+ rb_ary_push(stack, LONG2NUM(i));
+ ary = tmp;
+ i = 0;
+ }
+ }
+ if (RARRAY_LEN(stack) == 0) {
+ break;
+ }
+ if (memo) {
+ id = (st_data_t)ary;
+ st_delete(memo, &id, 0);
+ }
+ tmp = rb_ary_pop(stack);
+ i = NUM2LONG(tmp);
+ ary = rb_ary_pop(stack);
+ }
+
+ if (memo) {
+ st_clear(memo);
+ }
+
+ RBASIC_SET_CLASS(result, rb_cArray);
return result;
}
/*
* call-seq:
- * ary.flatten! -> ary or nil
- * ary.flatten!(level) -> array or nil
- *
- * Flattens +self+ in place.
- * Returns <code>nil</code> if no modifications were made (i.e.,
- * <i>ary</i> contains no subarrays.) If the optional <i>level</i>
- * argument determines the level of recursion to flatten.
- *
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten! #=> [1, 2, 3, 4, 5]
- * a.flatten! #=> nil
- * a #=> [1, 2, 3, 4, 5]
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten!(1) #=> [1, 2, 3, [4, 5]]
+ * array.flatten! -> self or nil
+ * array.flatten!(level) -> self or nil
+ *
+ * Replaces each nested \Array in +self+ with the elements from that \Array;
+ * returns +self+ if any changes, +nil+ otherwise.
+ *
+ * With non-negative \Integer argument +level+, flattens recursively through +level+ levels:
+ *
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(1) # => [0, 1, [2, 3], 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(2) # => [0, 1, 2, 3, 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(3) # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten!(1) # => nil
+ *
+ * With no argument, a +nil+ argument, or with negative argument +level+, flattens all levels:
+ *
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten! # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten! # => nil
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(-1) # => [0, 1, 2, 3, 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(-2) # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten!(-1) # => nil
+ *
*/
static VALUE
@@ -3727,15 +6647,14 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
int mod = 0, level = -1;
VALUE result, lv;
- rb_scan_args(argc, argv, "01", &lv);
+ lv = (rb_check_arity(argc, 0, 1) ? argv[0] : Qnil);
rb_ary_modify_check(ary);
if (!NIL_P(lv)) level = NUM2INT(lv);
if (level == 0) return Qnil;
- result = flatten(ary, level, &mod);
- if (mod == 0) {
- ary_discard(result);
- return Qnil;
+ result = flatten(ary, level);
+ if (result == ary) {
+ return Qnil;
}
if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
rb_ary_replace(ary, result);
@@ -3746,597 +6665,889 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
/*
* call-seq:
- * ary.flatten -> new_ary
- * ary.flatten(level) -> new_ary
- *
- * Returns a new array that is a one-dimensional flattening of this
- * array (recursively). That is, for every element that is an array,
- * extract its elements into the new array. If the optional
- * <i>level</i> argument determines the level of recursion to flatten.
- *
- * s = [ 1, 2, 3 ] #=> [1, 2, 3]
- * t = [ 4, 5, 6, [7, 8] ] #=> [4, 5, 6, [7, 8]]
- * a = [ s, t, 9, 10 ] #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- * a.flatten #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten(1) #=> [1, 2, 3, [4, 5]]
+ * array.flatten -> new_array
+ * array.flatten(level) -> new_array
+ *
+ * Returns a new \Array that is a recursive flattening of +self+:
+ * - Each non-Array element is unchanged.
+ * - Each \Array is replaced by its individual elements.
+ *
+ * With non-negative \Integer argument +level+, flattens recursively through +level+ levels:
+ *
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(0) # => [0, [1, [2, 3], 4], 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(1) # => [0, 1, [2, 3], 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(2) # => [0, 1, 2, 3, 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(3) # => [0, 1, 2, 3, 4, 5]
+ *
+ * With no argument, a +nil+ argument, or with negative argument +level+, flattens all levels:
+ *
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten # => [0, 1, 2]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(-1) # => [0, 1, 2, 3, 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(-2) # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten(-1) # => [0, 1, 2]
+ *
*/
static VALUE
rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
{
- int mod = 0, level = -1;
- VALUE result, lv;
+ int level = -1;
+ VALUE result;
- rb_scan_args(argc, argv, "01", &lv);
- if (!NIL_P(lv)) level = NUM2INT(lv);
- if (level == 0) return ary_make_shared_copy(ary);
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0])) {
+ level = NUM2INT(argv[0]);
+ if (level == 0) return ary_make_shared_copy(ary);
+ }
- result = flatten(ary, level, &mod);
- OBJ_INFECT(result, ary);
+ result = flatten(ary, level);
+ if (result == ary) {
+ result = ary_make_shared_copy(ary);
+ }
return result;
}
-#define OPTHASH_GIVEN_P(opts) \
- (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
-static VALUE sym_random;
-
-#define RAND_UPTO(max) (long)(rb_random_real(randgen)*(max))
-
-/*
- * call-seq:
- * ary.shuffle! -> ary
- * ary.shuffle!(random: rng) -> ary
- *
- * Shuffles elements in +self+ in place.
- * If +rng+ is given, it will be used as the random number generator.
- */
+#define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
static VALUE
-rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_shuffle_bang(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
{
- VALUE *ptr, opts, *snap_ptr, randgen = rb_cRandom;
- long i, snap_len;
+ long i, len;
- if (OPTHASH_GIVEN_P(opts)) {
- randgen = rb_hash_lookup2(opts, sym_random, randgen);
- }
- if (argc > 0) {
- rb_raise(rb_eArgError, "wrong number of arguments (%d for 0)", argc);
- }
rb_ary_modify(ary);
- i = RARRAY_LEN(ary);
- ptr = RARRAY_PTR(ary);
- snap_len = i;
- snap_ptr = ptr;
- while (i) {
- long j = RAND_UPTO(i);
- VALUE tmp;
- if (snap_len != RARRAY_LEN(ary) || snap_ptr != RARRAY_PTR(ary)) {
- rb_raise(rb_eRuntimeError, "modified during shuffle");
- }
- tmp = ptr[--i];
- ptr[i] = ptr[j];
- ptr[j] = tmp;
- }
+ i = len = RARRAY_LEN(ary);
+ RARRAY_PTR_USE(ary, ptr, {
+ while (i) {
+ long j = RAND_UPTO(i);
+ VALUE tmp;
+ if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR_TRANSIENT(ary)) {
+ rb_raise(rb_eRuntimeError, "modified during shuffle");
+ }
+ tmp = ptr[--i];
+ ptr[i] = ptr[j];
+ ptr[j] = tmp;
+ }
+ }); /* WB: no new reference */
return ary;
}
-
-/*
- * call-seq:
- * ary.shuffle -> new_ary
- * ary.shuffle(random: rng) -> new_ary
- *
- * Returns a new array with elements of this array shuffled.
- *
- * a = [ 1, 2, 3 ] #=> [1, 2, 3]
- * a.shuffle #=> [2, 3, 1]
- *
- * If +rng+ is given, it will be used as the random number generator.
- *
- * a.shuffle(random: Random.new(1)) #=> [1, 3, 2]
- */
-
static VALUE
-rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
+rb_ary_shuffle(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
{
ary = rb_ary_dup(ary);
- rb_ary_shuffle_bang(argc, argv, ary);
+ rb_ary_shuffle_bang(ec, ary, randgen);
return ary;
}
-
-/*
- * call-seq:
- * ary.sample -> obj
- * ary.sample(random: rng) -> obj
- * ary.sample(n) -> new_ary
- * ary.sample(n, random: rng) -> new_ary
- *
- * Choose a random element or +n+ random elements from the array. The elements
- * are chosen by using random and unique indices into the array in order to
- * ensure that an element doesn't repeat itself unless the array already
- * contained duplicate elements. If the array is empty the first form returns
- * <code>nil</code> and the second form returns an empty array.
- *
- * If +rng+ is given, it will be used as the random number generator.
- */
-
-
static VALUE
-rb_ary_sample(int argc, VALUE *argv, VALUE ary)
+ary_sample(rb_execution_context_t *ec, VALUE ary, VALUE randgen, VALUE nv, VALUE to_array)
{
- VALUE nv, result, *ptr;
- VALUE opts, randgen = rb_cRandom;
+ VALUE result;
long n, len, i, j, k, idx[10];
- double rnds[numberof(idx)];
+ long rnds[numberof(idx)];
+ long memo_threshold;
- if (OPTHASH_GIVEN_P(opts)) {
- randgen = rb_hash_lookup2(opts, sym_random, randgen);
- }
- ptr = RARRAY_PTR(ary);
len = RARRAY_LEN(ary);
- if (argc == 0) {
- if (len == 0) return Qnil;
- if (len == 1) {
- i = 0;
- }
- else {
- double x = rb_random_real(randgen);
- if ((len = RARRAY_LEN(ary)) == 0) return Qnil;
- i = (long)(x * len);
- }
- return RARRAY_PTR(ary)[i];
- }
- rb_scan_args(argc, argv, "1", &nv);
+ if (!to_array) {
+ if (len < 2)
+ i = 0;
+ else
+ i = RAND_UPTO(len);
+
+ return rb_ary_elt(ary, i);
+ }
n = NUM2LONG(nv);
if (n < 0) rb_raise(rb_eArgError, "negative sample number");
if (n > len) n = len;
if (n <= numberof(idx)) {
- for (i = 0; i < n; ++i) {
- rnds[i] = rb_random_real(randgen);
- }
+ for (i = 0; i < n; ++i) {
+ rnds[i] = RAND_UPTO(len - i);
+ }
}
+ k = len;
len = RARRAY_LEN(ary);
- ptr = RARRAY_PTR(ary);
+ if (len < k && n <= numberof(idx)) {
+ for (i = 0; i < n; ++i) {
+ if (rnds[i] >= len) return rb_ary_new_capa(0);
+ }
+ }
if (n > len) n = len;
switch (n) {
case 0:
- return rb_ary_new2(0);
+ return rb_ary_new_capa(0);
case 1:
- i = (long)(rnds[0] * len);
- return rb_ary_new4(1, &ptr[i]);
+ i = rnds[0];
+ return rb_ary_new_from_args(1, RARRAY_AREF(ary, i));
case 2:
- i = (long)(rnds[0] * len);
- j = (long)(rnds[1] * (len-1));
- if (j >= i) j++;
- return rb_ary_new3(2, ptr[i], ptr[j]);
+ i = rnds[0];
+ j = rnds[1];
+ if (j >= i) j++;
+ return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
case 3:
- i = (long)(rnds[0] * len);
- j = (long)(rnds[1] * (len-1));
- k = (long)(rnds[2] * (len-2));
- {
- long l = j, g = i;
- if (j >= i) l = i, g = ++j;
- if (k >= l && (++k >= g)) ++k;
- }
- return rb_ary_new3(3, ptr[i], ptr[j], ptr[k]);
+ i = rnds[0];
+ j = rnds[1];
+ k = rnds[2];
+ {
+ long l = j, g = i;
+ if (j >= i) l = i, g = ++j;
+ if (k >= l && (++k >= g)) ++k;
+ }
+ return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
}
+ memo_threshold =
+ len < 2560 ? len / 128 :
+ len < 5120 ? len / 64 :
+ len < 10240 ? len / 32 :
+ len / 16;
if (n <= numberof(idx)) {
- VALUE *ptr_result;
- long sorted[numberof(idx)];
- sorted[0] = idx[0] = (long)(rnds[0] * len);
- for (i=1; i<n; i++) {
- k = (long)(rnds[i] * --len);
- for (j = 0; j < i; ++j) {
- if (k < sorted[j]) break;
- ++k;
- }
- memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
- sorted[j] = idx[i] = k;
- }
- result = rb_ary_new2(n);
- ptr_result = RARRAY_PTR(result);
- for (i=0; i<n; i++) {
- ptr_result[i] = ptr[idx[i]];
- }
+ long sorted[numberof(idx)];
+ sorted[0] = idx[0] = rnds[0];
+ for (i=1; i<n; i++) {
+ k = rnds[i];
+ for (j = 0; j < i; ++j) {
+ if (k < sorted[j]) break;
+ ++k;
+ }
+ memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+ sorted[j] = idx[i] = k;
+ }
+ result = rb_ary_new_capa(n);
+ RARRAY_PTR_USE_TRANSIENT(result, ptr_result, {
+ for (i=0; i<n; i++) {
+ ptr_result[i] = RARRAY_AREF(ary, idx[i]);
+ }
+ });
+ }
+ else if (n <= memo_threshold / 2) {
+ long max_idx = 0;
+#undef RUBY_UNTYPED_DATA_WARNING
+#define RUBY_UNTYPED_DATA_WARNING 0
+ VALUE vmemo = Data_Wrap_Struct(0, 0, st_free_table, 0);
+ st_table *memo = st_init_numtable_with_size(n);
+ DATA_PTR(vmemo) = memo;
+ result = rb_ary_new_capa(n);
+ RARRAY_PTR_USE(result, ptr_result, {
+ for (i=0; i<n; i++) {
+ long r = RAND_UPTO(len-i) + i;
+ ptr_result[i] = r;
+ if (r > max_idx) max_idx = r;
+ }
+ len = RARRAY_LEN(ary);
+ if (len <= max_idx) n = 0;
+ else if (n > len) n = len;
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr_ary, {
+ for (i=0; i<n; i++) {
+ long j2 = j = ptr_result[i];
+ long i2 = i;
+ st_data_t value;
+ if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
+ if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
+ st_insert(memo, (st_data_t)j, (st_data_t)i2);
+ ptr_result[i] = ptr_ary[j2];
+ }
+ });
+ });
+ DATA_PTR(vmemo) = 0;
+ st_free_table(memo);
}
else {
- VALUE *ptr_result;
- result = rb_ary_new4(len, ptr);
- RBASIC(result)->klass = 0;
- ptr_result = RARRAY_PTR(result);
- RB_GC_GUARD(ary);
- for (i=0; i<n; i++) {
- j = RAND_UPTO(len-i) + i;
- nv = ptr_result[j];
- ptr_result[j] = ptr_result[i];
- ptr_result[i] = nv;
- }
- RBASIC(result)->klass = rb_cArray;
+ result = rb_ary_dup(ary);
+ RBASIC_CLEAR_CLASS(result);
+ RB_GC_GUARD(ary);
+ RARRAY_PTR_USE(result, ptr_result, {
+ for (i=0; i<n; i++) {
+ j = RAND_UPTO(len-i) + i;
+ nv = ptr_result[j];
+ ptr_result[j] = ptr_result[i];
+ ptr_result[i] = nv;
+ }
+ });
+ RBASIC_SET_CLASS_RAW(result, rb_cArray);
}
ARY_SET_LEN(result, n);
return result;
}
+static VALUE
+ary_sample0(rb_execution_context_t *ec, VALUE ary)
+{
+ return ary_sample(ec, ary, rb_cRandom, Qfalse, Qfalse);
+}
+
+static VALUE
+rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
+{
+ long mul;
+ VALUE n = Qnil;
+ if (args && (RARRAY_LEN(args) > 0)) {
+ n = RARRAY_AREF(args, 0);
+ }
+ if (RARRAY_LEN(self) == 0) return INT2FIX(0);
+ if (NIL_P(n)) return DBL2NUM(HUGE_VAL);
+ mul = NUM2LONG(n);
+ if (mul <= 0) return INT2FIX(0);
+ n = LONG2FIX(mul);
+ return rb_fix_mul_fix(rb_ary_length(self), n);
+}
/*
* call-seq:
- * ary.cycle(n=nil) {|obj| block } -> nil
- * ary.cycle(n=nil) -> an_enumerator
+ * array.cycle {|element| ... } -> nil
+ * array.cycle(count) {|element| ... } -> nil
+ * array.cycle -> new_enumerator
+ * array.cycle(count) -> new_enumerator
+ *
+ * When called with positive \Integer argument +count+ and a block,
+ * calls the block with each element, then does so again,
+ * until it has done so +count+ times; returns +nil+:
*
- * Calls <i>block</i> for each element repeatedly _n_ times or
- * forever if none or +nil+ is given. If a non-positive number is
- * given or the array is empty, does nothing. Returns +nil+ if the
- * loop has finished without getting interrupted.
+ * output = []
+ * [0, 1].cycle(2) {|element| output.push(element) } # => nil
+ * output # => [0, 1, 0, 1]
*
- * If no block is given, an enumerator is returned instead.
+ * If +count+ is zero or negative, does not call the block:
*
+ * [0, 1].cycle(0) {|element| fail 'Cannot happen' } # => nil
+ * [0, 1].cycle(-1) {|element| fail 'Cannot happen' } # => nil
*
- * a = ["a", "b", "c"]
- * a.cycle {|x| puts x } # print, a, b, c, a, b, c,.. forever.
- * a.cycle(2) {|x| puts x } # print, a, b, c, a, b, c.
+ * When a block is given, and argument is omitted or +nil+, cycles forever:
+ *
+ * # Prints 0 and 1 forever.
+ * [0, 1].cycle {|element| puts element }
+ * [0, 1].cycle(nil) {|element| puts element }
+ *
+ * When no block is given, returns a new \Enumerator:
+ *
+ * [0, 1].cycle(2) # => #<Enumerator: [0, 1]:cycle(2)>
+ * [0, 1].cycle # => # => #<Enumerator: [0, 1]:cycle>
+ * [0, 1].cycle.first(5) # => [0, 1, 0, 1, 0]
*
*/
-
static VALUE
rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
{
long n, i;
- VALUE nv = Qnil;
- rb_scan_args(argc, argv, "01", &nv);
+ rb_check_arity(argc, 0, 1);
- RETURN_ENUMERATOR(ary, argc, argv);
- if (NIL_P(nv)) {
+ RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
+ if (argc == 0 || NIL_P(argv[0])) {
n = -1;
}
else {
- n = NUM2LONG(nv);
+ n = NUM2LONG(argv[0]);
if (n <= 0) return Qnil;
}
while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_yield(RARRAY_PTR(ary)[i]);
+ rb_yield(RARRAY_AREF(ary, i));
}
}
return Qnil;
}
-#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
-#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC(s)->klass = rb_cString)
-#define tmpary(n) rb_ary_tmp_new(n)
-#define tmpary_discard(a) (ary_discard(a), RBASIC(a)->klass = rb_cArray)
+/*
+ * Build a ruby array of the corresponding values and yield it to the
+ * associated block.
+ * Return the class of +values+ for reentry check.
+ */
+static int
+yield_indexed_values(const VALUE values, const long r, const long *const p)
+{
+ const VALUE result = rb_ary_new2(r);
+ long i;
+
+ for (i = 0; i < r; i++) ARY_SET(result, i, RARRAY_AREF(values, p[i]));
+ ARY_SET_LEN(result, r);
+ rb_yield(result);
+ return !RBASIC(values)->klass;
+}
/*
- * Recursively compute permutations of r elements of the set [0..n-1].
- * When we have a complete permutation of array indexes, copy the values
- * at those indexes into a new array and yield that array.
+ * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
+ *
+ * When we have a complete permutation of array indices, copy the values
+ * at those indices into a new array and yield that array.
*
* n: the size of the set
* r: the number of elements in each permutation
* p: the array (of size r) that we're filling in
- * index: what index we're filling in now
* used: an array of booleans: whether a given index is already used
* values: the Ruby array that holds the actual values to permute
*/
static void
-permute0(long n, long r, long *p, long index, char *used, VALUE values)
+permute0(const long n, const long r, long *const p, char *const used, const VALUE values)
{
- long i,j;
- for (i = 0; i < n; i++) {
- if (used[i] == 0) {
- p[index] = i;
- if (index < r-1) { /* if not done yet */
- used[i] = 1; /* mark index used */
- permute0(n, r, p, index+1, /* recurse */
- used, values);
- used[i] = 0; /* index unused */
- }
- else {
- /* We have a complete permutation of array indexes */
- /* Build a ruby array of the corresponding values */
- /* And yield it to the associated block */
- VALUE result = rb_ary_new2(r);
- VALUE *result_array = RARRAY_PTR(result);
- const VALUE *values_array = RARRAY_PTR(values);
-
- for (j = 0; j < r; j++) result_array[j] = values_array[p[j]];
- ARY_SET_LEN(result, r);
- rb_yield(result);
- if (RBASIC(values)->klass) {
- rb_raise(rb_eRuntimeError, "permute reentered");
- }
- }
- }
+ long i = 0, index = 0;
+
+ for (;;) {
+ const char *const unused = memchr(&used[i], 0, n-i);
+ if (!unused) {
+ if (!index) break;
+ i = p[--index]; /* pop index */
+ used[i++] = 0; /* index unused */
+ }
+ else {
+ i = unused - used;
+ p[index] = i;
+ used[i] = 1; /* mark index used */
+ ++index;
+ if (index < r-1) { /* if not done yet */
+ p[index] = i = 0;
+ continue;
+ }
+ for (i = 0; i < n; ++i) {
+ if (used[i]) continue;
+ p[index] = i;
+ if (!yield_indexed_values(values, r, p)) {
+ rb_raise(rb_eRuntimeError, "permute reentered");
+ }
+ }
+ i = p[--index]; /* pop index */
+ used[i] = 0; /* index unused */
+ p[index] = ++i;
+ }
+ }
+}
+
+/*
+ * Returns the product of from, from-1, ..., from - how_many + 1.
+ * https://en.wikipedia.org/wiki/Pochhammer_symbol
+ */
+static VALUE
+descending_factorial(long from, long how_many)
+{
+ VALUE cnt;
+ if (how_many > 0) {
+ cnt = LONG2FIX(from);
+ while (--how_many > 0) {
+ long v = --from;
+ cnt = rb_int_mul(cnt, LONG2FIX(v));
+ }
+ }
+ else {
+ cnt = LONG2FIX(how_many == 0);
+ }
+ return cnt;
+}
+
+static VALUE
+binomial_coefficient(long comb, long size)
+{
+ VALUE r;
+ long i;
+ if (comb > size-comb) {
+ comb = size-comb;
}
+ if (comb < 0) {
+ return LONG2FIX(0);
+ }
+ else if (comb == 0) {
+ return LONG2FIX(1);
+ }
+ r = LONG2FIX(size);
+ for (i = 1; i < comb; ++i) {
+ r = rb_int_mul(r, LONG2FIX(size - i));
+ r = rb_int_idiv(r, LONG2FIX(i + 1));
+ }
+ return r;
+}
+
+static VALUE
+rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+{
+ long n = RARRAY_LEN(ary);
+ long k = (args && (RARRAY_LEN(args) > 0)) ? NUM2LONG(RARRAY_AREF(args, 0)) : n;
+
+ return descending_factorial(n, k);
}
/*
* call-seq:
- * ary.permutation { |p| block } -> ary
- * ary.permutation -> an_enumerator
- * ary.permutation(n) { |p| block } -> ary
- * ary.permutation(n) -> an_enumerator
- *
- * When invoked with a block, yield all permutations of length <i>n</i>
- * of the elements of <i>ary</i>, then return the array itself.
- * If <i>n</i> is not specified, yield all permutations of all elements.
- * The implementation makes no guarantees about the order in which
- * the permutations are yielded.
- *
- * If no block is given, an enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2, 3]
- * a.permutation.to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- * a.permutation(1).to_a #=> [[1],[2],[3]]
- * a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
- * a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- * a.permutation(0).to_a #=> [[]] # one permutation of length 0
- * a.permutation(4).to_a #=> [] # no permutations of length 4
+ * array.permutation {|element| ... } -> self
+ * array.permutation(n) {|element| ... } -> self
+ * array.permutation -> new_enumerator
+ * array.permutation(n) -> new_enumerator
+ *
+ * When invoked with a block, yield all permutations of elements of +self+; returns +self+.
+ * The order of permutations is indeterminate.
+ *
+ * When a block and an in-range positive \Integer argument +n+ (<tt>0 < n <= self.size</tt>)
+ * are given, calls the block with all +n+-tuple permutations of +self+.
+ *
+ * Example:
+ *
+ * a = [0, 1, 2]
+ * a.permutation(2) {|permutation| p permutation }
+ *
+ * Output:
+ *
+ * [0, 1]
+ * [0, 2]
+ * [1, 0]
+ * [1, 2]
+ * [2, 0]
+ * [2, 1]
+ *
+ * Another example:
+ *
+ * a = [0, 1, 2]
+ * a.permutation(3) {|permutation| p permutation }
+ *
+ * Output:
+ *
+ * [0, 1, 2]
+ * [0, 2, 1]
+ * [1, 0, 2]
+ * [1, 2, 0]
+ * [2, 0, 1]
+ * [2, 1, 0]
+ *
+ * When +n+ is zero, calls the block once with a new empty \Array:
+ *
+ * a = [0, 1, 2]
+ * a.permutation(0) {|permutation| p permutation }
+ *
+ * Output:
+ *
+ * []
+ *
+ * When +n+ is out of range (negative or larger than <tt>self.size</tt>),
+ * does not call the block:
+ *
+ * a = [0, 1, 2]
+ * a.permutation(-1) {|permutation| fail 'Cannot happen' }
+ * a.permutation(4) {|permutation| fail 'Cannot happen' }
+ *
+ * When a block given but no argument,
+ * behaves the same as <tt>a.permutation(a.size)</tt>:
+ *
+ * a = [0, 1, 2]
+ * a.permutation {|permutation| p permutation }
+ *
+ * Output:
+ *
+ * [0, 1, 2]
+ * [0, 2, 1]
+ * [1, 0, 2]
+ * [1, 2, 0]
+ * [2, 0, 1]
+ * [2, 1, 0]
+ *
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [0, 1, 2]
+ * a.permutation # => #<Enumerator: [0, 1, 2]:permutation>
+ * a.permutation(2) # => #<Enumerator: [0, 1, 2]:permutation(2)>
+ *
*/
static VALUE
rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
{
- VALUE num;
long r, n, i;
n = RARRAY_LEN(ary); /* Array length */
- RETURN_ENUMERATOR(ary, argc, argv); /* Return enumerator if no block */
- rb_scan_args(argc, argv, "01", &num);
- r = NIL_P(num) ? n : NUM2LONG(num); /* Permutation size from argument */
+ RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size); /* Return enumerator if no block */
+ r = n;
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0]))
+ r = NUM2LONG(argv[0]); /* Permutation size from argument */
if (r < 0 || n < r) {
- /* no permutations: yield nothing */
+ /* no permutations: yield nothing */
}
else if (r == 0) { /* exactly one permutation: the zero-length array */
- rb_yield(rb_ary_new2(0));
+ rb_yield(rb_ary_new2(0));
}
else if (r == 1) { /* this is a special, easy case */
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
- }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
}
else { /* this is the general case */
- volatile VALUE t0 = tmpbuf(n,sizeof(long));
- long *p = (long*)RSTRING_PTR(t0);
- volatile VALUE t1 = tmpbuf(n,sizeof(char));
- char *used = (char*)RSTRING_PTR(t1);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC(ary0)->klass = 0;
+ volatile VALUE t0;
+ long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
+ char *used = (char*)(p + r);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC_CLEAR_CLASS(ary0);
- MEMZERO(used, char, n); /* initialize array */
+ MEMZERO(used, char, n); /* initialize array */
- permute0(n, r, p, 0, used, ary0); /* compute and yield permutations */
- tmpbuf_discard(t0);
- tmpbuf_discard(t1);
- RBASIC(ary0)->klass = rb_cArray;
+ permute0(n, r, p, used, ary0); /* compute and yield permutations */
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
}
return ary;
}
+static void
+combinate0(const long len, const long n, long *const stack, const VALUE values)
+{
+ long lev = 0;
+
+ MEMZERO(stack+1, long, n);
+ stack[0] = -1;
+ for (;;) {
+ for (lev++; lev < n; lev++) {
+ stack[lev+1] = stack[lev]+1;
+ }
+ if (!yield_indexed_values(values, n, stack+1)) {
+ rb_raise(rb_eRuntimeError, "combination reentered");
+ }
+ do {
+ if (lev == 0) return;
+ stack[lev--]++;
+ } while (stack[lev+1]+n == len+lev+1);
+ }
+}
+
+static VALUE
+rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
+{
+ long n = RARRAY_LEN(ary);
+ long k = NUM2LONG(RARRAY_AREF(args, 0));
+
+ return binomial_coefficient(k, n);
+}
+
/*
* call-seq:
- * ary.combination(n) { |c| block } -> ary
- * ary.combination(n) -> an_enumerator
+ * array.combination(n) {|element| ... } -> self
+ * array.combination(n) -> new_enumerator
+ *
+ * Calls the block, if given, with combinations of elements of +self+;
+ * returns +self+. The order of combinations is indeterminate.
+ *
+ * When a block and an in-range positive \Integer argument +n+ (<tt>0 < n <= self.size</tt>)
+ * are given, calls the block with all +n+-tuple combinations of +self+.
+ *
+ * Example:
+ *
+ * a = [0, 1, 2]
+ * a.combination(2) {|combination| p combination }
+ *
+ * Output:
+ *
+ * [0, 1]
+ * [0, 2]
+ * [1, 2]
+ *
+ * Another example:
*
- * When invoked with a block, yields all combinations of length <i>n</i>
- * of elements from <i>ary</i> and then returns <i>ary</i> itself.
- * The implementation makes no guarantees about the order in which
- * the combinations are yielded.
+ * a = [0, 1, 2]
+ * a.combination(3) {|combination| p combination }
*
- * If no block is given, an enumerator is returned instead.
+ * Output:
*
- * Examples:
+ * [0, 1, 2]
*
- * a = [1, 2, 3, 4]
- * a.combination(1).to_a #=> [[1],[2],[3],[4]]
- * a.combination(2).to_a #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
- * a.combination(3).to_a #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
- * a.combination(4).to_a #=> [[1,2,3,4]]
- * a.combination(0).to_a #=> [[]] # one combination of length 0
- * a.combination(5).to_a #=> [] # no combinations of length 5
+ * When +n+ is zero, calls the block once with a new empty \Array:
+ *
+ * a = [0, 1, 2]
+ * a1 = a.combination(0) {|combination| p combination }
+ *
+ * Output:
+ *
+ * []
+ *
+ * When +n+ is out of range (negative or larger than <tt>self.size</tt>),
+ * does not call the block:
+ *
+ * a = [0, 1, 2]
+ * a.combination(-1) {|combination| fail 'Cannot happen' }
+ * a.combination(4) {|combination| fail 'Cannot happen' }
+ *
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [0, 1, 2]
+ * a.combination(2) # => #<Enumerator: [0, 1, 2]:combination(2)>
*
*/
static VALUE
rb_ary_combination(VALUE ary, VALUE num)
{
- long n, i, len;
+ long i, n, len;
n = NUM2LONG(num);
- RETURN_ENUMERATOR(ary, 1, &num);
+ RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
len = RARRAY_LEN(ary);
if (n < 0 || len < n) {
- /* yield nothing */
+ /* yield nothing */
}
else if (n == 0) {
- rb_yield(rb_ary_new2(0));
+ rb_yield(rb_ary_new2(0));
}
else if (n == 1) {
- for (i = 0; i < len; i++) {
- rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
- }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
}
else {
- volatile VALUE t0 = tmpbuf(n+1, sizeof(long));
- long *stack = (long*)RSTRING_PTR(t0);
- volatile VALUE cc = tmpary(n);
- VALUE *chosen = RARRAY_PTR(cc);
- long lev = 0;
-
- MEMZERO(stack, long, n);
- stack[0] = -1;
- for (;;) {
- chosen[lev] = RARRAY_PTR(ary)[stack[lev+1]];
- for (lev++; lev < n; lev++) {
- chosen[lev] = RARRAY_PTR(ary)[stack[lev+1] = stack[lev]+1];
- }
- rb_yield(rb_ary_new4(n, chosen));
- if (RBASIC(t0)->klass) {
- rb_raise(rb_eRuntimeError, "combination reentered");
- }
- do {
- if (lev == 0) goto done;
- stack[lev--]++;
- } while (stack[lev+1]+n == len+lev+1);
- }
- done:
- tmpbuf_discard(t0);
- tmpary_discard(cc);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ volatile VALUE t0;
+ long *stack = ALLOCV_N(long, t0, n+1);
+
+ RBASIC_CLEAR_CLASS(ary0);
+ combinate0(len, n, stack, ary0);
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
}
return ary;
}
/*
- * Recursively compute repeated permutations of r elements of the set
- * [0..n-1].
- * When we have a complete repeated permutation of array indexes, copy the
- * values at those indexes into a new array and yield that array.
+ * Compute repeated permutations of +r+ elements of the set
+ * <code>[0..n-1]</code>.
+ *
+ * When we have a complete repeated permutation of array indices, copy the
+ * values at those indices into a new array and yield that array.
*
* n: the size of the set
* r: the number of elements in each permutation
* p: the array (of size r) that we're filling in
- * index: what index we're filling in now
* values: the Ruby array that holds the actual values to permute
*/
static void
-rpermute0(long n, long r, long *p, long index, VALUE values)
-{
- long i, j;
- for (i = 0; i < n; i++) {
- p[index] = i;
- if (index < r-1) { /* if not done yet */
- rpermute0(n, r, p, index+1, values); /* recurse */
- }
- else {
- /* We have a complete permutation of array indexes */
- /* Build a ruby array of the corresponding values */
- /* And yield it to the associated block */
- VALUE result = rb_ary_new2(r);
- VALUE *result_array = RARRAY_PTR(result);
- const VALUE *values_array = RARRAY_PTR(values);
-
- for (j = 0; j < r; j++) result_array[j] = values_array[p[j]];
- ARY_SET_LEN(result, r);
- rb_yield(result);
- if (RBASIC(values)->klass) {
- rb_raise(rb_eRuntimeError, "repeated permute reentered");
- }
- }
+rpermute0(const long n, const long r, long *const p, const VALUE values)
+{
+ long i = 0, index = 0;
+
+ p[index] = i;
+ for (;;) {
+ if (++index < r-1) {
+ p[index] = i = 0;
+ continue;
+ }
+ for (i = 0; i < n; ++i) {
+ p[index] = i;
+ if (!yield_indexed_values(values, r, p)) {
+ rb_raise(rb_eRuntimeError, "repeated permute reentered");
+ }
+ }
+ do {
+ if (index <= 0) return;
+ } while ((i = ++p[--index]) >= n);
+ }
+}
+
+static VALUE
+rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+{
+ long n = RARRAY_LEN(ary);
+ long k = NUM2LONG(RARRAY_AREF(args, 0));
+
+ if (k < 0) {
+ return LONG2FIX(0);
}
+ if (n <= 0) {
+ return LONG2FIX(!k);
+ }
+ return rb_int_positive_pow(n, (unsigned long)k);
}
/*
* call-seq:
- * ary.repeated_permutation(n) { |p| block } -> ary
- * ary.repeated_permutation(n) -> an_enumerator
+ * array.repeated_permutation(n) {|permutation| ... } -> self
+ * array.repeated_permutation(n) -> new_enumerator
+ *
+ * Calls the block with each repeated permutation of length +n+ of the elements of +self+;
+ * each permutation is an \Array;
+ * returns +self+. The order of the permutations is indeterminate.
+ *
+ * When a block and a positive \Integer argument +n+ are given, calls the block with each
+ * +n+-tuple repeated permutation of the elements of +self+.
+ * The number of permutations is <tt>self.size**n</tt>.
+ *
+ * +n+ = 1:
*
- * When invoked with a block, yield all repeated permutations of length
- * <i>n</i> of the elements of <i>ary</i>, then return the array itself.
- * The implementation makes no guarantees about the order in which
- * the repeated permutations are yielded.
+ * a = [0, 1, 2]
+ * a.repeated_permutation(1) {|permutation| p permutation }
*
- * If no block is given, an enumerator is returned instead.
+ * Output:
*
- * Examples:
+ * [0]
+ * [1]
+ * [2]
+ *
+ * +n+ = 2:
+ *
+ * a.repeated_permutation(2) {|permutation| p permutation }
+ *
+ * Output:
+ *
+ * [0, 0]
+ * [0, 1]
+ * [0, 2]
+ * [1, 0]
+ * [1, 1]
+ * [1, 2]
+ * [2, 0]
+ * [2, 1]
+ * [2, 2]
+ *
+ * If +n+ is zero, calls the block once with an empty \Array.
+ *
+ * If +n+ is negative, does not call the block:
+ *
+ * a.repeated_permutation(-1) {|permutation| fail 'Cannot happen' }
+ *
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [0, 1, 2]
+ * a.repeated_permutation(2) # => #<Enumerator: [0, 1, 2]:permutation(2)>
+ *
+ * Using Enumerators, it's convenient to show the permutations and counts
+ * for some values of +n+:
+ *
+ * e = a.repeated_permutation(0)
+ * e.size # => 1
+ * e.to_a # => [[]]
+ * e = a.repeated_permutation(1)
+ * e.size # => 3
+ * e.to_a # => [[0], [1], [2]]
+ * e = a.repeated_permutation(2)
+ * e.size # => 9
+ * e.to_a # => [[0, 0], [0, 1], [0, 2], [1, 0], [1, 1], [1, 2], [2, 0], [2, 1], [2, 2]]
*
- * a = [1, 2]
- * a.repeated_permutation(1).to_a #=> [[1], [2]]
- * a.repeated_permutation(2).to_a #=> [[1,1],[1,2],[2,1],[2,2]]
- * a.repeated_permutation(3).to_a #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
- * # [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
- * a.repeated_permutation(0).to_a #=> [[]] # one permutation of length 0
*/
-
static VALUE
rb_ary_repeated_permutation(VALUE ary, VALUE num)
{
long r, n, i;
n = RARRAY_LEN(ary); /* Array length */
- RETURN_ENUMERATOR(ary, 1, &num); /* Return enumerator if no block */
+ RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_permutation_size); /* Return Enumerator if no block */
r = NUM2LONG(num); /* Permutation size from argument */
if (r < 0) {
- /* no permutations: yield nothing */
+ /* no permutations: yield nothing */
}
else if (r == 0) { /* exactly one permutation: the zero-length array */
- rb_yield(rb_ary_new2(0));
+ rb_yield(rb_ary_new2(0));
}
else if (r == 1) { /* this is a special, easy case */
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
- }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
}
else { /* this is the general case */
- volatile VALUE t0 = tmpbuf(r, sizeof(long));
- long *p = (long*)RSTRING_PTR(t0);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC(ary0)->klass = 0;
+ volatile VALUE t0;
+ long *p = ALLOCV_N(long, t0, r);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC_CLEAR_CLASS(ary0);
- rpermute0(n, r, p, 0, ary0); /* compute and yield repeated permutations */
- tmpbuf_discard(t0);
- RBASIC(ary0)->klass = rb_cArray;
+ rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
}
return ary;
}
static void
-rcombinate0(long n, long r, long *p, long index, long rest, VALUE values)
+rcombinate0(const long n, const long r, long *const p, const long rest, const VALUE values)
{
- long j;
- if (rest > 0) {
- for (; index < n; ++index) {
- p[r-rest] = index;
- rcombinate0(n, r, p, index, rest-1, values);
- }
+ long i = 0, index = 0;
+
+ p[index] = i;
+ for (;;) {
+ if (++index < r-1) {
+ p[index] = i;
+ continue;
+ }
+ for (; i < n; ++i) {
+ p[index] = i;
+ if (!yield_indexed_values(values, r, p)) {
+ rb_raise(rb_eRuntimeError, "repeated combination reentered");
+ }
+ }
+ do {
+ if (index <= 0) return;
+ } while ((i = ++p[--index]) >= n);
}
- else {
- VALUE result = rb_ary_new2(r);
- VALUE *result_array = RARRAY_PTR(result);
- const VALUE *values_array = RARRAY_PTR(values);
+}
- for (j = 0; j < r; ++j) result_array[j] = values_array[p[j]];
- ARY_SET_LEN(result, r);
- rb_yield(result);
- if (RBASIC(values)->klass) {
- rb_raise(rb_eRuntimeError, "repeated combination reentered");
- }
+static VALUE
+rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
+{
+ long n = RARRAY_LEN(ary);
+ long k = NUM2LONG(RARRAY_AREF(args, 0));
+ if (k == 0) {
+ return LONG2FIX(1);
}
+ return binomial_coefficient(k, n + k - 1);
}
/*
* call-seq:
- * ary.repeated_combination(n) { |c| block } -> ary
- * ary.repeated_combination(n) -> an_enumerator
+ * array.repeated_combination(n) {|combination| ... } -> self
+ * array.repeated_combination(n) -> new_enumerator
+ *
+ * Calls the block with each repeated combination of length +n+ of the elements of +self+;
+ * each combination is an \Array;
+ * returns +self+. The order of the combinations is indeterminate.
+ *
+ * When a block and a positive \Integer argument +n+ are given, calls the block with each
+ * +n+-tuple repeated combination of the elements of +self+.
+ * The number of combinations is <tt>(n+1)(n+2)/2</tt>.
+ *
+ * +n+ = 1:
+ *
+ * a = [0, 1, 2]
+ * a.repeated_combination(1) {|combination| p combination }
+ *
+ * Output:
*
- * When invoked with a block, yields all repeated combinations of
- * length <i>n</i> of elements from <i>ary</i> and then returns
- * <i>ary</i> itself.
- * The implementation makes no guarantees about the order in which
- * the repeated combinations are yielded.
+ * [0]
+ * [1]
+ * [2]
*
- * If no block is given, an enumerator is returned instead.
+ * +n+ = 2:
*
- * Examples:
+ * a.repeated_combination(2) {|combination| p combination }
*
- * a = [1, 2, 3]
- * a.repeated_combination(1).to_a #=> [[1], [2], [3]]
- * a.repeated_combination(2).to_a #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
- * a.repeated_combination(3).to_a #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
- * # [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
- * a.repeated_combination(4).to_a #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
- * # [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
- * # [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
- * a.repeated_combination(0).to_a #=> [[]] # one combination of length 0
+ * Output:
+ *
+ * [0, 0]
+ * [0, 1]
+ * [0, 2]
+ * [1, 1]
+ * [1, 2]
+ * [2, 2]
+ *
+ * If +n+ is zero, calls the block once with an empty \Array.
+ *
+ * If +n+ is negative, does not call the block:
+ *
+ * a.repeated_combination(-1) {|combination| fail 'Cannot happen' }
+ *
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [0, 1, 2]
+ * a.repeated_combination(2) # => #<Enumerator: [0, 1, 2]:combination(2)>
+ *
+ * Using Enumerators, it's convenient to show the combinations and counts
+ * for some values of +n+:
+ *
+ * e = a.repeated_combination(0)
+ * e.size # => 1
+ * e.to_a # => [[]]
+ * e = a.repeated_combination(1)
+ * e.size # => 3
+ * e.to_a # => [[0], [1], [2]]
+ * e = a.repeated_combination(2)
+ * e.size # => 6
+ * e.to_a # => [[0, 0], [0, 1], [0, 2], [1, 1], [1, 2], [2, 2]]
*
*/
@@ -4346,69 +7557,108 @@ rb_ary_repeated_combination(VALUE ary, VALUE num)
long n, i, len;
n = NUM2LONG(num); /* Combination size from argument */
- RETURN_ENUMERATOR(ary, 1, &num); /* Return enumerator if no block */
+ RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size); /* Return enumerator if no block */
len = RARRAY_LEN(ary);
if (n < 0) {
- /* yield nothing */
+ /* yield nothing */
}
else if (n == 0) {
- rb_yield(rb_ary_new2(0));
+ rb_yield(rb_ary_new2(0));
}
else if (n == 1) {
- for (i = 0; i < len; i++) {
- rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
- }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
}
else if (len == 0) {
- /* yield nothing */
+ /* yield nothing */
}
else {
- volatile VALUE t0 = tmpbuf(n, sizeof(long));
- long *p = (long*)RSTRING_PTR(t0);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC(ary0)->klass = 0;
+ volatile VALUE t0;
+ long *p = ALLOCV_N(long, t0, n);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC_CLEAR_CLASS(ary0);
- rcombinate0(len, n, p, 0, n, ary0); /* compute and yield repeated combinations */
- tmpbuf_discard(t0);
- RBASIC(ary0)->klass = rb_cArray;
+ rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
}
return ary;
}
/*
* call-seq:
- * ary.product(other_ary, ...) -> new_ary
- * ary.product(other_ary, ...) { |p| block } -> ary
- *
- * Returns an array of all combinations of elements from all arrays,
- * The length of the returned array is the product of the length
- * of +self+ and the argument arrays.
- * If given a block, <i>product</i> will yield all combinations
- * and return +self+ instead.
- *
- *
- * [1,2,3].product([4,5]) #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
- * [1,2].product([1,2]) #=> [[1,1],[1,2],[2,1],[2,2]]
- * [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
- * # [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
- * [1,2].product() #=> [[1],[2]]
- * [1,2].product([]) #=> []
+ * array.product(*other_arrays) -> new_array
+ * array.product(*other_arrays) {|combination| ... } -> self
+ *
+ * Computes and returns or yields all combinations of elements from all the Arrays,
+ * including both +self+ and +other_arrays+:
+ *
+ * - The number of combinations is the product of the sizes of all the arrays,
+ * including both +self+ and +other_arrays+.
+ * - The order of the returned combinations is indeterminate.
+ *
+ * When no block is given, returns the combinations as an \Array of Arrays:
+ *
+ * a = [0, 1, 2]
+ * a1 = [3, 4]
+ * a2 = [5, 6]
+ * p = a.product(a1)
+ * p.size # => 6 # a.size * a1.size
+ * p # => [[0, 3], [0, 4], [1, 3], [1, 4], [2, 3], [2, 4]]
+ * p = a.product(a1, a2)
+ * p.size # => 12 # a.size * a1.size * a2.size
+ * p # => [[0, 3, 5], [0, 3, 6], [0, 4, 5], [0, 4, 6], [1, 3, 5], [1, 3, 6], [1, 4, 5], [1, 4, 6], [2, 3, 5], [2, 3, 6], [2, 4, 5], [2, 4, 6]]
+ *
+ * If any argument is an empty \Array, returns an empty \Array.
+ *
+ * If no argument is given, returns an \Array of 1-element Arrays,
+ * each containing an element of +self+:
+ *
+ * a.product # => [[0], [1], [2]]
+ *
+ * When a block is given, yields each combination as an \Array; returns +self+:
+ *
+ * a.product(a1) {|combination| p combination }
+ *
+ * Output:
+ *
+ * [0, 3]
+ * [0, 4]
+ * [1, 3]
+ * [1, 4]
+ * [2, 3]
+ * [2, 4]
+ *
+ * If any argument is an empty \Array, does not call the block:
+ *
+ * a.product(a1, a2, []) {|combination| fail 'Cannot happen' }
+ *
+ * If no argument is given, yields each element of +self+ as a 1-element \Array:
+ *
+ * a.product {|combination| p combination }
+ *
+ * Output:
+ *
+ * [0]
+ * [1]
+ * [2]
+ *
*/
static VALUE
rb_ary_product(int argc, VALUE *argv, VALUE ary)
{
int n = argc+1; /* How many arrays we're operating on */
- volatile VALUE t0 = tmpary(n);
- volatile VALUE t1 = tmpbuf(n, sizeof(int));
+ volatile VALUE t0 = rb_ary_hidden_new(n);
+ volatile VALUE t1 = Qundef;
VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
- int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
+ int *counters = ALLOCV_N(int, t1, n); /* The current position in each one */
VALUE result = Qnil; /* The array we'll be returning, when no block given */
long i,j;
long resultlen = 1;
- RBASIC(t0)->klass = 0;
- RBASIC(t1)->klass = 0;
+ RBASIC_CLEAR_CLASS(t0);
/* initialize the arrays of arrays */
ARY_SET_LEN(t0, n);
@@ -4421,78 +7671,84 @@ rb_ary_product(int argc, VALUE *argv, VALUE ary)
/* Otherwise, allocate and fill in an array of results */
if (rb_block_given_p()) {
- /* Make defensive copies of arrays; exit if any is empty */
- for (i = 0; i < n; i++) {
- if (RARRAY_LEN(arrays[i]) == 0) goto done;
- arrays[i] = ary_make_shared_copy(arrays[i]);
- }
+ /* Make defensive copies of arrays; exit if any is empty */
+ for (i = 0; i < n; i++) {
+ if (RARRAY_LEN(arrays[i]) == 0) goto done;
+ arrays[i] = ary_make_shared_copy(arrays[i]);
+ }
}
else {
- /* Compute the length of the result array; return [] if any is empty */
- for (i = 0; i < n; i++) {
- long k = RARRAY_LEN(arrays[i]), l = resultlen;
- if (k == 0) {
- result = rb_ary_new2(0);
- goto done;
- }
- resultlen *= k;
- if (resultlen < k || resultlen < l || resultlen / k != l) {
- rb_raise(rb_eRangeError, "too big to product");
- }
- }
- result = rb_ary_new2(resultlen);
+ /* Compute the length of the result array; return [] if any is empty */
+ for (i = 0; i < n; i++) {
+ long k = RARRAY_LEN(arrays[i]);
+ if (k == 0) {
+ result = rb_ary_new2(0);
+ goto done;
+ }
+ if (MUL_OVERFLOW_LONG_P(resultlen, k))
+ rb_raise(rb_eRangeError, "too big to product");
+ resultlen *= k;
+ }
+ result = rb_ary_new2(resultlen);
}
for (;;) {
- int m;
- /* fill in one subarray */
- VALUE subarray = rb_ary_new2(n);
- for (j = 0; j < n; j++) {
- rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
- }
-
- /* put it on the result array */
- if(NIL_P(result)) {
- FL_SET(t0, FL_USER5);
- rb_yield(subarray);
- if (! FL_TEST(t0, FL_USER5)) {
- rb_raise(rb_eRuntimeError, "product reentered");
- }
- else {
- FL_UNSET(t0, FL_USER5);
- }
- }
- else {
- rb_ary_push(result, subarray);
- }
-
- /*
- * Increment the last counter. If it overflows, reset to 0
- * and increment the one before it.
- */
- m = n-1;
- counters[m]++;
- while (counters[m] == RARRAY_LEN(arrays[m])) {
- counters[m] = 0;
- /* If the first counter overflows, we are done */
- if (--m < 0) goto done;
- counters[m]++;
- }
+ int m;
+ /* fill in one subarray */
+ VALUE subarray = rb_ary_new2(n);
+ for (j = 0; j < n; j++) {
+ rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+ }
+
+ /* put it on the result array */
+ if (NIL_P(result)) {
+ FL_SET(t0, RARRAY_SHARED_ROOT_FLAG);
+ rb_yield(subarray);
+ if (!FL_TEST(t0, RARRAY_SHARED_ROOT_FLAG)) {
+ rb_raise(rb_eRuntimeError, "product reentered");
+ }
+ else {
+ FL_UNSET(t0, RARRAY_SHARED_ROOT_FLAG);
+ }
+ }
+ else {
+ rb_ary_push(result, subarray);
+ }
+
+ /*
+ * Increment the last counter. If it overflows, reset to 0
+ * and increment the one before it.
+ */
+ m = n-1;
+ counters[m]++;
+ while (counters[m] == RARRAY_LEN(arrays[m])) {
+ counters[m] = 0;
+ /* If the first counter overflows, we are done */
+ if (--m < 0) goto done;
+ counters[m]++;
+ }
}
+
done:
- tmpary_discard(t0);
- tmpbuf_discard(t1);
+ ALLOCV_END(t1);
return NIL_P(result) ? ary : result;
}
/*
* call-seq:
- * ary.take(n) -> new_ary
+ * array.take(n) -> new_array
*
- * Returns first n elements from <i>ary</i>.
+ * Returns a new \Array containing the first +n+ element of +self+,
+ * where +n+ is a non-negative \Integer;
+ * does not modify +self+.
*
- * a = [1, 2, 3, 4, 5, 0]
- * a.take(3) #=> [1, 2, 3]
+ * Examples:
+ *
+ * a = [0, 1, 2, 3, 4, 5]
+ * a.take(1) # => [0]
+ * a.take(2) # => [0, 1]
+ * a.take(50) # => [0, 1, 2, 3, 4, 5]
+ * a # => [0, 1, 2, 3, 4, 5]
*
*/
@@ -4501,23 +7757,31 @@ rb_ary_take(VALUE obj, VALUE n)
{
long len = NUM2LONG(n);
if (len < 0) {
- rb_raise(rb_eArgError, "attempt to take negative size");
+ rb_raise(rb_eArgError, "attempt to take negative size");
}
return rb_ary_subseq(obj, 0, len);
}
/*
* call-seq:
- * ary.take_while {|arr| block } -> new_ary
- * ary.take_while -> an_enumerator
+ * array.take_while {|element| ... } -> new_array
+ * array.take_while -> new_enumerator
+ *
+ * Returns a new \Array containing zero or more leading elements of +self+;
+ * does not modify +self+.
*
- * Passes elements to the block until the block returns +nil+ or +false+,
- * then stops iterating and returns an array of all prior elements.
+ * With a block given, calls the block with each successive element of +self+;
+ * stops if the block returns +false+ or +nil+;
+ * returns a new \Array containing those elements for which the block returned a truthy value:
*
- * If no block is given, an enumerator is returned instead.
+ * a = [0, 1, 2, 3, 4, 5]
+ * a.take_while {|element| element < 3 } # => [0, 1, 2]
+ * a.take_while {|element| true } # => [0, 1, 2, 3, 4, 5]
+ * a # => [0, 1, 2, 3, 4, 5]
*
- * a = [1, 2, 3, 4, 5, 0]
- * a.take_while {|i| i < 3 } #=> [1, 2]
+ * With no block given, returns a new \Enumerator:
+ *
+ * [0, 1].take_while # => #<Enumerator: [0, 1]:take_while>
*
*/
@@ -4528,20 +7792,25 @@ rb_ary_take_while(VALUE ary)
RETURN_ENUMERATOR(ary, 0, 0);
for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (!RTEST(rb_yield(RARRAY_PTR(ary)[i]))) break;
+ if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
}
return rb_ary_take(ary, LONG2FIX(i));
}
/*
* call-seq:
- * ary.drop(n) -> new_ary
+ * array.drop(n) -> new_array
+ *
+ * Returns a new \Array containing all but the first +n+ element of +self+,
+ * where +n+ is a non-negative \Integer;
+ * does not modify +self+.
*
- * Drops first n elements from <i>ary</i>, and returns rest elements
- * in an array.
+ * Examples:
*
- * a = [1, 2, 3, 4, 5, 0]
- * a.drop(3) #=> [4, 5, 0]
+ * a = [0, 1, 2, 3, 4, 5]
+ * a.drop(0) # => [0, 1, 2, 3, 4, 5]
+ * a.drop(1) # => [1, 2, 3, 4, 5]
+ * a.drop(2) # => [2, 3, 4, 5]
*
*/
@@ -4551,27 +7820,32 @@ rb_ary_drop(VALUE ary, VALUE n)
VALUE result;
long pos = NUM2LONG(n);
if (pos < 0) {
- rb_raise(rb_eArgError, "attempt to drop negative size");
+ rb_raise(rb_eArgError, "attempt to drop negative size");
}
result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
- if (result == Qnil) result = rb_ary_new();
+ if (NIL_P(result)) result = rb_ary_new();
return result;
}
/*
* call-seq:
- * ary.drop_while {|arr| block } -> new_ary
- * ary.drop_while -> an_enumerator
+ * array.drop_while {|element| ... } -> new_array
+ * array.drop_while -> new_enumerator
+
+ * Returns a new \Array containing zero or more trailing elements of +self+;
+ * does not modify +self+.
+ *
+ * With a block given, calls the block with each successive element of +self+;
+ * stops if the block returns +false+ or +nil+;
+ * returns a new \Array _omitting_ those elements for which the block returned a truthy value:
*
- * Drops elements up to, but not including, the first element for
- * which the block returns +nil+ or +false+ and returns an array
- * containing the remaining elements.
+ * a = [0, 1, 2, 3, 4, 5]
+ * a.drop_while {|element| element < 3 } # => [3, 4, 5]
*
- * If no block is given, an enumerator is returned instead.
+ * With no block given, returns a new \Enumerator:
*
- * a = [1, 2, 3, 4, 5, 0]
- * a.drop_while {|i| i < 3 } #=> [3, 4, 5, 0]
+ * [0, 1].drop_while # => # => #<Enumerator: [0, 1]:drop_while>
*
*/
@@ -4582,30 +7856,967 @@ rb_ary_drop_while(VALUE ary)
RETURN_ENUMERATOR(ary, 0, 0);
for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (!RTEST(rb_yield(RARRAY_PTR(ary)[i]))) break;
+ if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
}
return rb_ary_drop(ary, LONG2FIX(i));
}
+/*
+ * call-seq:
+ * array.any? -> true or false
+ * array.any? {|element| ... } -> true or false
+ * array.any?(obj) -> true or false
+ *
+ * Returns +true+ if any element of +self+ meets a given criterion.
+ *
+ * With no block given and no argument, returns +true+ if +self+ has any truthy element,
+ * +false+ otherwise:
+ *
+ * [nil, 0, false].any? # => true
+ * [nil, false].any? # => false
+ * [].any? # => false
+ *
+ * With a block given and no argument, calls the block with each element in +self+;
+ * returns +true+ if the block returns any truthy value, +false+ otherwise:
+ *
+ * [0, 1, 2].any? {|element| element > 1 } # => true
+ * [0, 1, 2].any? {|element| element > 2 } # => false
+ *
+ * If argument +obj+ is given, returns +true+ if +obj+.<tt>===</tt> any element,
+ * +false+ otherwise:
+ *
+ * ['food', 'drink'].any?(/foo/) # => true
+ * ['food', 'drink'].any?(/bar/) # => false
+ * [].any?(/foo/) # => false
+ * [0, 1, 2].any?(1) # => true
+ * [0, 1, 2].any?(3) # => false
+ *
+ * Related: Enumerable#any?
+ */
+
+static VALUE
+rb_ary_any_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qfalse;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qtrue;
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (RTEST(RARRAY_AREF(ary, i))) return Qtrue;
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
+ }
+ }
+ return Qfalse;
+}
+
+/*
+ * call-seq:
+ * array.all? -> true or false
+ * array.all? {|element| ... } -> true or false
+ * array.all?(obj) -> true or false
+ *
+ * Returns +true+ if all elements of +self+ meet a given criterion.
+ *
+ * With no block given and no argument, returns +true+ if +self+ contains only truthy elements,
+ * +false+ otherwise:
+ *
+ * [0, 1, :foo].all? # => true
+ * [0, nil, 2].all? # => false
+ * [].all? # => true
+ *
+ * With a block given and no argument, calls the block with each element in +self+;
+ * returns +true+ if the block returns only truthy values, +false+ otherwise:
+ *
+ * [0, 1, 2].all? { |element| element < 3 } # => true
+ * [0, 1, 2].all? { |element| element < 2 } # => false
+ *
+ * If argument +obj+ is given, returns +true+ if <tt>obj.===</tt> every element, +false+ otherwise:
+ *
+ * ['food', 'fool', 'foot'].all?(/foo/) # => true
+ * ['food', 'drink'].all?(/bar/) # => false
+ * [].all?(/foo/) # => true
+ * [0, 0, 0].all?(0) # => true
+ * [0, 1, 2].all?(1) # => false
+ *
+ * Related: Enumerable#all?
+ */
+
+static VALUE
+rb_ary_all_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qtrue;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (!RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (!RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ return Qtrue;
+}
+
+/*
+ * call-seq:
+ * array.none? -> true or false
+ * array.none? {|element| ... } -> true or false
+ * array.none?(obj) -> true or false
+ *
+ * Returns +true+ if no element of +self+ meet a given criterion.
+ *
+ * With no block given and no argument, returns +true+ if +self+ has no truthy elements,
+ * +false+ otherwise:
+ *
+ * [nil, false].none? # => true
+ * [nil, 0, false].none? # => false
+ * [].none? # => true
+ *
+ * With a block given and no argument, calls the block with each element in +self+;
+ * returns +true+ if the block returns no truthy value, +false+ otherwise:
+ *
+ * [0, 1, 2].none? {|element| element > 3 } # => true
+ * [0, 1, 2].none? {|element| element > 1 } # => false
+ *
+ * If argument +obj+ is given, returns +true+ if <tt>obj.===</tt> no element, +false+ otherwise:
+ *
+ * ['food', 'drink'].none?(/bar/) # => true
+ * ['food', 'drink'].none?(/foo/) # => false
+ * [].none?(/foo/) # => true
+ * [0, 1, 2].none?(3) # => true
+ * [0, 1, 2].none?(1) # => false
+ *
+ * Related: Enumerable#none?
+ */
+
+static VALUE
+rb_ary_none_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qtrue;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ return Qtrue;
+}
+
+/*
+ * call-seq:
+ * array.one? -> true or false
+ * array.one? {|element| ... } -> true or false
+ * array.one?(obj) -> true or false
+ *
+ * Returns +true+ if exactly one element of +self+ meets a given criterion.
+ *
+ * With no block given and no argument, returns +true+ if +self+ has exactly one truthy element,
+ * +false+ otherwise:
+ *
+ * [nil, 0].one? # => true
+ * [0, 0].one? # => false
+ * [nil, nil].one? # => false
+ * [].one? # => false
+ *
+ * With a block given and no argument, calls the block with each element in +self+;
+ * returns +true+ if the block a truthy value for exactly one element, +false+ otherwise:
+ *
+ * [0, 1, 2].one? {|element| element > 0 } # => false
+ * [0, 1, 2].one? {|element| element > 1 } # => true
+ * [0, 1, 2].one? {|element| element > 2 } # => false
+ *
+ * If argument +obj+ is given, returns +true+ if <tt>obj.===</tt> exactly one element,
+ * +false+ otherwise:
+ *
+ * [0, 1, 2].one?(0) # => true
+ * [0, 0, 1].one?(0) # => false
+ * [1, 1, 2].one?(0) # => false
+ * ['food', 'drink'].one?(/bar/) # => false
+ * ['food', 'drink'].one?(/foo/) # => true
+ * [].one?(/foo/) # => false
+ *
+ * Related: Enumerable#one?
+ */
+
+static VALUE
+rb_ary_one_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+ VALUE result = Qfalse;
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qfalse;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) {
+ if (result) return Qfalse;
+ result = Qtrue;
+ }
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (RTEST(RARRAY_AREF(ary, i))) {
+ if (result) return Qfalse;
+ result = Qtrue;
+ }
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+ if (result) return Qfalse;
+ result = Qtrue;
+ }
+ }
+ }
+ return result;
+}
+
+/*
+ * call-seq:
+ * array.dig(index, *identifiers) -> object
+ *
+ * Finds and returns the object in nested objects
+ * that is specified by +index+ and +identifiers+.
+ * The nested objects may be instances of various classes.
+ * See {Dig Methods}[rdoc-ref:dig_methods.rdoc].
+ *
+ * Examples:
+ *
+ * a = [:foo, [:bar, :baz, [:bat, :bam]]]
+ * a.dig(1) # => [:bar, :baz, [:bat, :bam]]
+ * a.dig(1, 2) # => [:bat, :bam]
+ * a.dig(1, 2, 0) # => :bat
+ * a.dig(1, 2, 3) # => nil
+ *
+ */
+
+static VALUE
+rb_ary_dig(int argc, VALUE *argv, VALUE self)
+{
+ rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+ self = rb_ary_at(self, *argv);
+ if (!--argc) return self;
+ ++argv;
+ return rb_obj_dig(argc, argv, self, Qnil);
+}
+
+static inline VALUE
+finish_exact_sum(long n, VALUE r, VALUE v, int z)
+{
+ if (n != 0)
+ v = rb_fix_plus(LONG2FIX(n), v);
+ if (!UNDEF_P(r)) {
+ v = rb_rational_plus(r, v);
+ }
+ else if (!n && z) {
+ v = rb_fix_plus(LONG2FIX(0), v);
+ }
+ return v;
+}
+
+/*
+ * call-seq:
+ * array.sum(init = 0) -> object
+ * array.sum(init = 0) {|element| ... } -> object
+ *
+ * When no block is given, returns the object equivalent to:
+ *
+ * sum = init
+ * array.each {|element| sum += element }
+ * sum
+ *
+ * For example, <tt>[e1, e2, e3].sum</tt> returns <tt>init + e1 + e2 + e3</tt>.
+ *
+ * Examples:
+ *
+ * a = [0, 1, 2, 3]
+ * a.sum # => 6
+ * a.sum(100) # => 106
+ *
+ * The elements need not be numeric, but must be <tt>+</tt>-compatible
+ * with each other and with +init+:
+ *
+ * a = ['abc', 'def', 'ghi']
+ * a.sum('jkl') # => "jklabcdefghi"
+ *
+ * When a block is given, it is called with each element
+ * and the block's return value (instead of the element itself) is used as the addend:
+ *
+ * a = ['zero', 1, :two]
+ * s = a.sum('Coerced and concatenated: ') {|element| element.to_s }
+ * s # => "Coerced and concatenated: zero1two"
+ *
+ * Notes:
+ *
+ * - Array#join and Array#flatten may be faster than Array#sum
+ * for an \Array of Strings or an \Array of Arrays.
+ * - Array#sum method may not respect method redefinition of "+" methods such as Integer#+.
+ *
+ */
+
+static VALUE
+rb_ary_sum(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE e, v, r;
+ long i, n;
+ int block_given;
+
+ v = (rb_check_arity(argc, 0, 1) ? argv[0] : LONG2FIX(0));
+
+ block_given = rb_block_given_p();
+
+ if (RARRAY_LEN(ary) == 0)
+ return v;
+
+ n = 0;
+ r = Qundef;
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (block_given)
+ e = rb_yield(e);
+ if (FIXNUM_P(e)) {
+ n += FIX2LONG(e); /* should not overflow long type */
+ if (!FIXABLE(n)) {
+ v = rb_big_plus(LONG2NUM(n), v);
+ n = 0;
+ }
+ }
+ else if (RB_BIGNUM_TYPE_P(e))
+ v = rb_big_plus(e, v);
+ else if (RB_TYPE_P(e, T_RATIONAL)) {
+ if (UNDEF_P(r))
+ r = e;
+ else
+ r = rb_rational_plus(r, e);
+ }
+ else
+ goto not_exact;
+ }
+ v = finish_exact_sum(n, r, v, argc!=0);
+ return v;
+
+ not_exact:
+ v = finish_exact_sum(n, r, v, i!=0);
+
+ if (RB_FLOAT_TYPE_P(e)) {
+ /*
+ * Kahan-Babuska balancing compensated summation algorithm
+ * See https://link.springer.com/article/10.1007/s00607-005-0139-x
+ */
+ double f, c;
+ double x, t;
+
+ f = NUM2DBL(v);
+ c = 0.0;
+ goto has_float_value;
+ for (; i < RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (block_given)
+ e = rb_yield(e);
+ if (RB_FLOAT_TYPE_P(e))
+ has_float_value:
+ x = RFLOAT_VALUE(e);
+ else if (FIXNUM_P(e))
+ x = FIX2LONG(e);
+ else if (RB_BIGNUM_TYPE_P(e))
+ x = rb_big2dbl(e);
+ else if (RB_TYPE_P(e, T_RATIONAL))
+ x = rb_num2dbl(e);
+ else
+ goto not_float;
+
+ if (isnan(f)) continue;
+ if (isnan(x)) {
+ f = x;
+ continue;
+ }
+ if (isinf(x)) {
+ if (isinf(f) && signbit(x) != signbit(f))
+ f = NAN;
+ else
+ f = x;
+ continue;
+ }
+ if (isinf(f)) continue;
+
+ t = f + x;
+ if (fabs(f) >= fabs(x))
+ c += ((f - t) + x);
+ else
+ c += ((x - t) + f);
+ f = t;
+ }
+ f += c;
+ return DBL2NUM(f);
+
+ not_float:
+ v = DBL2NUM(f);
+ }
+
+ goto has_some_value;
+ for (; i < RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (block_given)
+ e = rb_yield(e);
+ has_some_value:
+ v = rb_funcall(v, idPLUS, 1, e);
+ }
+ return v;
+}
+static VALUE
+rb_ary_deconstruct(VALUE ary)
+{
+ return ary;
+}
-/* Arrays are ordered, integer-indexed collections of any object.
- * Array indexing starts at 0, as in C or Java. A negative index is
- * assumed to be relative to the end of the array---that is, an index of -1
- * indicates the last element of the array, -2 is the next to last
- * element in the array, and so on.
+/*
+ * An \Array is an ordered, integer-indexed collection of objects, called _elements_.
+ * Any object (even another array) may be an array element,
+ * and an array can contain objects of different types.
+ *
+ * == \Array Indexes
+ *
+ * \Array indexing starts at 0, as in C or Java.
+ *
+ * A positive index is an offset from the first element:
+ *
+ * - Index 0 indicates the first element.
+ * - Index 1 indicates the second element.
+ * - ...
+ *
+ * A negative index is an offset, backwards, from the end of the array:
+ *
+ * - Index -1 indicates the last element.
+ * - Index -2 indicates the next-to-last element.
+ * - ...
+ *
+ * A non-negative index is <i>in range</i> if and only if it is smaller than
+ * the size of the array. For a 3-element array:
+ *
+ * - Indexes 0 through 2 are in range.
+ * - Index 3 is out of range.
+ *
+ * A negative index is <i>in range</i> if and only if its absolute value is
+ * not larger than the size of the array. For a 3-element array:
+ *
+ * - Indexes -1 through -3 are in range.
+ * - Index -4 is out of range.
+ *
+ * Although the effective index into an array is always an integer,
+ * some methods (both within and outside of class \Array)
+ * accept one or more non-integer arguments that are
+ * {integer-convertible objects}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *
+ *
+ * == Creating Arrays
+ *
+ * You can create an \Array object explicitly with:
+ *
+ * - An {array literal}[rdoc-ref:literals.rdoc@Array+Literals]:
+ *
+ * [1, 'one', :one, [2, 'two', :two]]
+ *
+ * - A {%w or %W: string-array Literal}[rdoc-ref:literals.rdoc@25w+and+-25W-3A+String-Array+Literals]:
+ *
+ * %w[foo bar baz] # => ["foo", "bar", "baz"]
+ * %w[1 % *] # => ["1", "%", "*"]
+ *
+ * - A {%i pr %I: symbol-array Literal}[rdoc-ref:literals.rdoc@25i+and+-25I-3A+Symbol-Array+Literals]:
+ *
+ * %i[foo bar baz] # => [:foo, :bar, :baz]
+ * %i[1 % *] # => [:"1", :%, :*]
+ *
+ * - \Method Kernel#Array:
+ *
+ * Array(["a", "b"]) # => ["a", "b"]
+ * Array(1..5) # => [1, 2, 3, 4, 5]
+ * Array(key: :value) # => [[:key, :value]]
+ * Array(nil) # => []
+ * Array(1) # => [1]
+ * Array({:a => "a", :b => "b"}) # => [[:a, "a"], [:b, "b"]]
+ *
+ * - \Method Array.new:
+ *
+ * Array.new # => []
+ * Array.new(3) # => [nil, nil, nil]
+ * Array.new(4) {Hash.new} # => [{}, {}, {}, {}]
+ * Array.new(3, true) # => [true, true, true]
+ *
+ * Note that the last example above populates the array
+ * with references to the same object.
+ * This is recommended only in cases where that object is a natively immutable object
+ * such as a symbol, a numeric, +nil+, +true+, or +false+.
+ *
+ * Another way to create an array with various objects, using a block;
+ * this usage is safe for mutable objects such as hashes, strings or
+ * other arrays:
+ *
+ * Array.new(4) {|i| i.to_s } # => ["0", "1", "2", "3"]
+ *
+ * Here is a way to create a multi-dimensional array:
+ *
+ * Array.new(3) {Array.new(3)}
+ * # => [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *
+ * A number of Ruby methods, both in the core and in the standard library,
+ * provide instance method +to_a+, which converts an object to an array.
+ *
+ * - ARGF#to_a
+ * - Array#to_a
+ * - Enumerable#to_a
+ * - Hash#to_a
+ * - MatchData#to_a
+ * - NilClass#to_a
+ * - OptionParser#to_a
+ * - Range#to_a
+ * - Set#to_a
+ * - Struct#to_a
+ * - Time#to_a
+ * - Benchmark::Tms#to_a
+ * - CSV::Table#to_a
+ * - Enumerator::Lazy#to_a
+ * - Gem::List#to_a
+ * - Gem::NameTuple#to_a
+ * - Gem::Platform#to_a
+ * - Gem::RequestSet::Lockfile::Tokenizer#to_a
+ * - Gem::SourceList#to_a
+ * - OpenSSL::X509::Extension#to_a
+ * - OpenSSL::X509::Name#to_a
+ * - Racc::ISet#to_a
+ * - Rinda::RingFinger#to_a
+ * - Ripper::Lexer::Elem#to_a
+ * - RubyVM::InstructionSequence#to_a
+ * - YAML::DBM#to_a
+ *
+ * == Example Usage
+ *
+ * In addition to the methods it mixes in through the Enumerable module, the
+ * \Array class has proprietary methods for accessing, searching and otherwise
+ * manipulating arrays.
+ *
+ * Some of the more common ones are illustrated below.
+ *
+ * == Accessing Elements
+ *
+ * Elements in an array can be retrieved using the Array#[] method. It can
+ * take a single integer argument (a numeric index), a pair of arguments
+ * (start and length) or a range. Negative indices start counting from the end,
+ * with -1 being the last element.
+ *
+ * arr = [1, 2, 3, 4, 5, 6]
+ * arr[2] #=> 3
+ * arr[100] #=> nil
+ * arr[-3] #=> 4
+ * arr[2, 3] #=> [3, 4, 5]
+ * arr[1..4] #=> [2, 3, 4, 5]
+ * arr[1..-3] #=> [2, 3, 4]
+ *
+ * Another way to access a particular array element is by using the #at method
+ *
+ * arr.at(0) #=> 1
+ *
+ * The #slice method works in an identical manner to Array#[].
+ *
+ * To raise an error for indices outside of the array bounds or else to
+ * provide a default value when that happens, you can use #fetch.
+ *
+ * arr = ['a', 'b', 'c', 'd', 'e', 'f']
+ * arr.fetch(100) #=> IndexError: index 100 outside of array bounds: -6...6
+ * arr.fetch(100, "oops") #=> "oops"
+ *
+ * The special methods #first and #last will return the first and last
+ * elements of an array, respectively.
+ *
+ * arr.first #=> 1
+ * arr.last #=> 6
+ *
+ * To return the first +n+ elements of an array, use #take
+ *
+ * arr.take(3) #=> [1, 2, 3]
+ *
+ * #drop does the opposite of #take, by returning the elements after +n+
+ * elements have been dropped:
+ *
+ * arr.drop(3) #=> [4, 5, 6]
+ *
+ * == Obtaining Information about an \Array
+ *
+ * Arrays keep track of their own length at all times. To query an array
+ * about the number of elements it contains, use #length, #count or #size.
+ *
+ * browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
+ * browsers.length #=> 5
+ * browsers.count #=> 5
+ *
+ * To check whether an array contains any elements at all
+ *
+ * browsers.empty? #=> false
+ *
+ * To check whether a particular item is included in the array
+ *
+ * browsers.include?('Konqueror') #=> false
+ *
+ * == Adding Items to Arrays
+ *
+ * Items can be added to the end of an array by using either #push or #<<
+ *
+ * arr = [1, 2, 3, 4]
+ * arr.push(5) #=> [1, 2, 3, 4, 5]
+ * arr << 6 #=> [1, 2, 3, 4, 5, 6]
+ *
+ * #unshift will add a new item to the beginning of an array.
+ *
+ * arr.unshift(0) #=> [0, 1, 2, 3, 4, 5, 6]
+ *
+ * With #insert you can add a new element to an array at any position.
+ *
+ * arr.insert(3, 'apple') #=> [0, 1, 2, 'apple', 3, 4, 5, 6]
+ *
+ * Using the #insert method, you can also insert multiple values at once:
+ *
+ * arr.insert(3, 'orange', 'pear', 'grapefruit')
+ * #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
+ *
+ * == Removing Items from an \Array
+ *
+ * The method #pop removes the last element in an array and returns it:
+ *
+ * arr = [1, 2, 3, 4, 5, 6]
+ * arr.pop #=> 6
+ * arr #=> [1, 2, 3, 4, 5]
+ *
+ * To retrieve and at the same time remove the first item, use #shift:
+ *
+ * arr.shift #=> 1
+ * arr #=> [2, 3, 4, 5]
+ *
+ * To delete an element at a particular index:
+ *
+ * arr.delete_at(2) #=> 4
+ * arr #=> [2, 3, 5]
+ *
+ * To delete a particular element anywhere in an array, use #delete:
+ *
+ * arr = [1, 2, 2, 3]
+ * arr.delete(2) #=> 2
+ * arr #=> [1,3]
+ *
+ * A useful method if you need to remove +nil+ values from an array is
+ * #compact:
+ *
+ * arr = ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ * arr.compact #=> ['foo', 0, 'bar', 7, 'baz']
+ * arr #=> ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ * arr.compact! #=> ['foo', 0, 'bar', 7, 'baz']
+ * arr #=> ['foo', 0, 'bar', 7, 'baz']
+ *
+ * Another common need is to remove duplicate elements from an array.
+ *
+ * It has the non-destructive #uniq, and destructive method #uniq!
+ *
+ * arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
+ * arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
+ *
+ * == Iterating over Arrays
+ *
+ * Like all classes that include the Enumerable module, \Array has an each
+ * method, which defines what elements should be iterated over and how. In
+ * case of Array's #each, all elements in the \Array instance are yielded to
+ * the supplied block in sequence.
+ *
+ * Note that this operation leaves the array unchanged.
+ *
+ * arr = [1, 2, 3, 4, 5]
+ * arr.each {|a| print a -= 10, " "}
+ * # prints: -9 -8 -7 -6 -5
+ * #=> [1, 2, 3, 4, 5]
+ *
+ * Another sometimes useful iterator is #reverse_each which will iterate over
+ * the elements in the array in reverse order.
+ *
+ * words = %w[first second third fourth fifth sixth]
+ * str = ""
+ * words.reverse_each {|word| str += "#{word} "}
+ * p str #=> "sixth fifth fourth third second first "
+ *
+ * The #map method can be used to create a new array based on the original
+ * array, but with the values modified by the supplied block:
+ *
+ * arr.map {|a| 2*a} #=> [2, 4, 6, 8, 10]
+ * arr #=> [1, 2, 3, 4, 5]
+ * arr.map! {|a| a**2} #=> [1, 4, 9, 16, 25]
+ * arr #=> [1, 4, 9, 16, 25]
+ *
+ *
+ * == Selecting Items from an \Array
+ *
+ * Elements can be selected from an array according to criteria defined in a
+ * block. The selection can happen in a destructive or a non-destructive
+ * manner. While the destructive operations will modify the array they were
+ * called on, the non-destructive methods usually return a new array with the
+ * selected elements, but leave the original array unchanged.
+ *
+ * === Non-destructive Selection
+ *
+ * arr = [1, 2, 3, 4, 5, 6]
+ * arr.select {|a| a > 3} #=> [4, 5, 6]
+ * arr.reject {|a| a < 3} #=> [3, 4, 5, 6]
+ * arr.drop_while {|a| a < 4} #=> [4, 5, 6]
+ * arr #=> [1, 2, 3, 4, 5, 6]
+ *
+ * === Destructive Selection
+ *
+ * #select! and #reject! are the corresponding destructive methods to #select
+ * and #reject
+ *
+ * Similar to #select vs. #reject, #delete_if and #keep_if have the exact
+ * opposite result when supplied with the same block:
+ *
+ * arr.delete_if {|a| a < 4} #=> [4, 5, 6]
+ * arr #=> [4, 5, 6]
+ *
+ * arr = [1, 2, 3, 4, 5, 6]
+ * arr.keep_if {|a| a < 4} #=> [1, 2, 3]
+ * arr #=> [1, 2, 3]
+ *
+ * == What's Here
+ *
+ * First, what's elsewhere. \Class \Array:
+ *
+ * - Inherits from {class Object}[rdoc-ref:Object@What-27s+Here].
+ * - Includes {module Enumerable}[rdoc-ref:Enumerable@What-27s+Here],
+ * which provides dozens of additional methods.
+ *
+ * Here, class \Array provides methods that are useful for:
+ *
+ * - {Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array]
+ * - {Querying}[rdoc-ref:Array@Methods+for+Querying]
+ * - {Comparing}[rdoc-ref:Array@Methods+for+Comparing]
+ * - {Fetching}[rdoc-ref:Array@Methods+for+Fetching]
+ * - {Assigning}[rdoc-ref:Array@Methods+for+Assigning]
+ * - {Deleting}[rdoc-ref:Array@Methods+for+Deleting]
+ * - {Combining}[rdoc-ref:Array@Methods+for+Combining]
+ * - {Iterating}[rdoc-ref:Array@Methods+for+Iterating]
+ * - {Converting}[rdoc-ref:Array@Methods+for+Converting]
+ * - {And more....}[rdoc-ref:Array@Other+Methods]
+ *
+ * === Methods for Creating an \Array
+ *
+ * - ::[]: Returns a new array populated with given objects.
+ * - ::new: Returns a new array.
+ * - ::try_convert: Returns a new array created from a given object.
+ *
+ * === Methods for Querying
+ *
+ * - #length, #size: Returns the count of elements.
+ * - #include?: Returns whether any element <tt>==</tt> a given object.
+ * - #empty?: Returns whether there are no elements.
+ * - #all?: Returns whether all elements meet a given criterion.
+ * - #any?: Returns whether any element meets a given criterion.
+ * - #none?: Returns whether no element <tt>==</tt> a given object.
+ * - #one?: Returns whether exactly one element <tt>==</tt> a given object.
+ * - #count: Returns the count of elements that meet a given criterion.
+ * - #find_index, #index: Returns the index of the first element that meets a given criterion.
+ * - #rindex: Returns the index of the last element that meets a given criterion.
+ * - #hash: Returns the integer hash code.
+ *
+ * === Methods for Comparing
+ *
+ * - #<=>: Returns -1, 0, or 1 * as +self+ is less than, equal to, or
+ * greater than a given object.
+ * - #==: Returns whether each element in +self+ is <tt>==</tt> to the corresponding element
+ * in a given object.
+ * - #eql?: Returns whether each element in +self+ is <tt>eql?</tt> to the corresponding
+ * element in a given object.
+
+ * === Methods for Fetching
+ *
+ * These methods do not modify +self+.
+ *
+ * - #[]: Returns one or more elements.
+ * - #fetch: Returns the element at a given offset.
+ * - #first: Returns one or more leading elements.
+ * - #last: Returns one or more trailing elements.
+ * - #max: Returns one or more maximum-valued elements,
+ * as determined by <tt><=></tt> or a given block.
+ * - #min: Returns one or more minimum-valued elements,
+ * as determined by <tt><=></tt> or a given block.
+ * - #minmax: Returns the minimum-valued and maximum-valued elements,
+ * as determined by <tt><=></tt> or a given block.
+ * - #assoc: Returns the first element that is an array
+ * whose first element <tt>==</tt> a given object.
+ * - #rassoc: Returns the first element that is an array
+ * whose second element <tt>==</tt> a given object.
+ * - #at: Returns the element at a given offset.
+ * - #values_at: Returns the elements at given offsets.
+ * - #dig: Returns the object in nested objects
+ * that is specified by a given index and additional arguments.
+ * - #drop: Returns trailing elements as determined by a given index.
+ * - #take: Returns leading elements as determined by a given index.
+ * - #drop_while: Returns trailing elements as determined by a given block.
+ * - #take_while: Returns leading elements as determined by a given block.
+ * - #slice: Returns consecutive elements as determined by a given argument.
+ * - #sort: Returns all elements in an order determined by <tt><=></tt> or a given block.
+ * - #reverse: Returns all elements in reverse order.
+ * - #compact: Returns an array containing all non-+nil+ elements.
+ * - #select, #filter: Returns an array containing elements selected by a given block.
+ * - #uniq: Returns an array containing non-duplicate elements.
+ * - #rotate: Returns all elements with some rotated from one end to the other.
+ * - #bsearch: Returns an element selected via a binary search
+ * as determined by a given block.
+ * - #bsearch_index: Returns the index of an element selected via a binary search
+ * as determined by a given block.
+ * - #sample: Returns one or more random elements.
+ * - #shuffle: Returns elements in a random order.
+ *
+ * === Methods for Assigning
+ *
+ * These methods add, replace, or reorder elements in +self+.
+ *
+ * - #[]=: Assigns specified elements with a given object.
+ * - #push, #append, #<<: Appends trailing elements.
+ * - #unshift, #prepend: Prepends leading elements.
+ * - #insert: Inserts given objects at a given offset; does not replace elements.
+ * - #concat: Appends all elements from given arrays.
+ * - #fill: Replaces specified elements with specified objects.
+ * - #replace: Replaces the content of +self+ with the content of a given array.
+ * - #reverse!: Replaces +self+ with its elements reversed.
+ * - #rotate!: Replaces +self+ with its elements rotated.
+ * - #shuffle!: Replaces +self+ with its elements in random order.
+ * - #sort!: Replaces +self+ with its elements sorted,
+ * as determined by <tt><=></tt> or a given block.
+ * - #sort_by!: Replaces +self+ with its elements sorted, as determined by a given block.
+ *
+ * === Methods for Deleting
+ *
+ * Each of these methods removes elements from +self+:
+ *
+ * - #pop: Removes and returns the last element.
+ * - #shift: Removes and returns the first element.
+ * - #compact!: Removes all +nil+ elements.
+ * - #delete: Removes elements equal to a given object.
+ * - #delete_at: Removes the element at a given offset.
+ * - #delete_if: Removes elements specified by a given block.
+ * - #keep_if: Removes elements not specified by a given block.
+ * - #reject!: Removes elements specified by a given block.
+ * - #select!, #filter!: Removes elements not specified by a given block.
+ * - #slice!: Removes and returns a sequence of elements.
+ * - #uniq!: Removes duplicates.
+ *
+ * === Methods for Combining
+ *
+ * - #&: Returns an array containing elements found both in +self+ and a given array.
+ * - #intersection: Returns an array containing elements found both in +self+
+ * and in each given array.
+ * - #+: Returns an array containing all elements of +self+ followed by all elements of a given array.
+ * - #-: Returns an array containing all elements of +self+ that are not found in a given array.
+ * - #|: Returns an array containing all elements of +self+ and all elements of a given array,
+ * duplicates removed.
+ * - #union: Returns an array containing all elements of +self+ and all elements of given arrays,
+ * duplicates removed.
+ * - #difference: Returns an array containing all elements of +self+ that are not found
+ * in any of the given arrays..
+ * - #product: Returns or yields all combinations of elements from +self+ and given arrays.
+ *
+ * === Methods for Iterating
+ *
+ * - #each: Passes each element to a given block.
+ * - #reverse_each: Passes each element, in reverse order, to a given block.
+ * - #each_index: Passes each element index to a given block.
+ * - #cycle: Calls a given block with each element, then does so again,
+ * for a specified number of times, or forever.
+ * - #combination: Calls a given block with combinations of elements of +self+;
+ * a combination does not use the same element more than once.
+ * - #permutation: Calls a given block with permutations of elements of +self+;
+ * a permutation does not use the same element more than once.
+ * - #repeated_combination: Calls a given block with combinations of elements of +self+;
+ * a combination may use the same element more than once.
+ * - #repeated_permutation: Calls a given block with permutations of elements of +self+;
+ * a permutation may use the same element more than once.
+ *
+ * === Methods for Converting
+ *
+ * - #map, #collect: Returns an array containing the block return-value for each element.
+ * - #map!, #collect!: Replaces each element with a block return-value.
+ * - #flatten: Returns an array that is a recursive flattening of +self+.
+ * - #flatten!: Replaces each nested array in +self+ with the elements from that array.
+ * - #inspect, #to_s: Returns a new String containing the elements.
+ * - #join: Returns a newsString containing the elements joined by the field separator.
+ * - #to_a: Returns +self+ or a new array containing all elements.
+ * - #to_ary: Returns +self+.
+ * - #to_h: Returns a new hash formed from the elements.
+ * - #transpose: Transposes +self+, which must be an array of arrays.
+ * - #zip: Returns a new array of arrays containing +self+ and given arrays;
+ * follow the link for details.
+ *
+ * === Other Methods
+ *
+ * - #*: Returns one of the following:
+ *
+ * - With integer argument +n+, a new array that is the concatenation
+ * of +n+ copies of +self+.
+ * - With string argument +field_separator+, a new string that is equivalent to
+ * <tt>join(field_separator)</tt>.
+ *
+ * - #abbrev: Returns a hash of unambiguous abbreviations for elements.
+ * - #pack: Packs the elements into a binary sequence.
+ * - #sum: Returns a sum of elements according to either <tt>+</tt> or a given block.
*/
void
Init_Array(void)
{
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
-
rb_cArray = rb_define_class("Array", rb_cObject);
rb_include_module(rb_cArray, rb_mEnumerable);
- rb_define_alloc_func(rb_cArray, ary_alloc);
+ rb_define_alloc_func(rb_cArray, empty_ary_alloc);
+ rb_define_singleton_method(rb_cArray, "new", rb_ary_s_new, -1);
rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
@@ -4614,8 +8825,8 @@ Init_Array(void)
rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
rb_define_alias(rb_cArray, "to_s", "inspect");
rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
+ rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
- rb_define_method(rb_cArray, "frozen?", rb_ary_frozen_p, 0);
rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
@@ -4627,18 +8838,24 @@ Init_Array(void)
rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
rb_define_method(rb_cArray, "first", rb_ary_first, -1);
rb_define_method(rb_cArray, "last", rb_ary_last, -1);
- rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
+ rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
+ rb_define_method(rb_cArray, "union", rb_ary_union_multi, -1);
+ rb_define_method(rb_cArray, "difference", rb_ary_difference_multi, -1);
+ rb_define_method(rb_cArray, "intersection", rb_ary_intersection_multi, -1);
+ rb_define_method(rb_cArray, "intersect?", rb_ary_intersect_p, 1);
rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
+ rb_define_alias(rb_cArray, "append", "push");
rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
+ rb_define_alias(rb_cArray, "prepend", "unshift");
rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
rb_define_method(rb_cArray, "each", rb_ary_each, 0);
rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
rb_define_method(rb_cArray, "length", rb_ary_length, 0);
- rb_define_alias(rb_cArray, "size", "length");
+ rb_define_method(rb_cArray, "size", rb_ary_length, 0);
rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
rb_define_method(rb_cArray, "index", rb_ary_index, -1);
@@ -4657,6 +8874,8 @@ Init_Array(void)
rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
rb_define_method(rb_cArray, "select", rb_ary_select, 0);
rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+ rb_define_method(rb_cArray, "filter", rb_ary_select, 0);
+ rb_define_method(rb_cArray, "filter!", rb_ary_select_bang, 0);
rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
@@ -4685,6 +8904,10 @@ Init_Array(void)
rb_define_method(rb_cArray, "&", rb_ary_and, 1);
rb_define_method(rb_cArray, "|", rb_ary_or, 1);
+ rb_define_method(rb_cArray, "max", rb_ary_max, -1);
+ rb_define_method(rb_cArray, "min", rb_ary_min, -1);
+ rb_define_method(rb_cArray, "minmax", rb_ary_minmax, 0);
+
rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
@@ -4692,9 +8915,6 @@ Init_Array(void)
rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
rb_define_method(rb_cArray, "count", rb_ary_count, -1);
- rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
- rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
- rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
@@ -4706,7 +8926,16 @@ Init_Array(void)
rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
+ rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
+ rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
+ rb_define_method(rb_cArray, "any?", rb_ary_any_p, -1);
+ rb_define_method(rb_cArray, "all?", rb_ary_all_p, -1);
+ rb_define_method(rb_cArray, "none?", rb_ary_none_p, -1);
+ rb_define_method(rb_cArray, "one?", rb_ary_one_p, -1);
+ rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
+ rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
- id_cmp = rb_intern("<=>");
- sym_random = ID2SYM(rb_intern("random"));
+ rb_define_method(rb_cArray, "deconstruct", rb_ary_deconstruct, 0);
}
+
+#include "array.rbinc"
diff --git a/array.rb b/array.rb
new file mode 100644
index 0000000000..b9fa9844e6
--- /dev/null
+++ b/array.rb
@@ -0,0 +1,69 @@
+class Array
+ # call-seq:
+ # array.shuffle!(random: Random) -> array
+ #
+ # Shuffles the elements of +self+ in place.
+ # a = [1, 2, 3] #=> [1, 2, 3]
+ # a.shuffle! #=> [2, 3, 1]
+ # a #=> [2, 3, 1]
+ #
+ # The optional +random+ argument will be used as the random number generator:
+ # a.shuffle!(random: Random.new(1)) #=> [1, 3, 2]
+ def shuffle!(random: Random)
+ Primitive.rb_ary_shuffle_bang(random)
+ end
+
+ # call-seq:
+ # array.shuffle(random: Random) -> new_ary
+ #
+ # Returns a new array with elements of +self+ shuffled.
+ # a = [1, 2, 3] #=> [1, 2, 3]
+ # a.shuffle #=> [2, 3, 1]
+ # a #=> [1, 2, 3]
+ #
+ # The optional +random+ argument will be used as the random number generator:
+ # a.shuffle(random: Random.new(1)) #=> [1, 3, 2]
+ def shuffle(random: Random)
+ Primitive.rb_ary_shuffle(random)
+ end
+
+ # call-seq:
+ # array.sample(random: Random) -> object
+ # array.sample(n, random: Random) -> new_ary
+ #
+ # Returns random elements from +self+.
+ #
+ # When no arguments are given, returns a random element from +self+:
+ # a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ # a.sample # => 3
+ # a.sample # => 8
+ # If +self+ is empty, returns +nil+.
+ #
+ # When argument +n+ is given, returns a new \Array containing +n+ random
+ # elements from +self+:
+ # a.sample(3) # => [8, 9, 2]
+ # a.sample(6) # => [9, 6, 10, 3, 1, 4]
+ # Returns no more than <tt>a.size</tt> elements
+ # (because no new duplicates are introduced):
+ # a.sample(a.size * 2) # => [6, 4, 1, 8, 5, 9, 10, 2, 3, 7]
+ # But +self+ may contain duplicates:
+ # a = [1, 1, 1, 2, 2, 3]
+ # a.sample(a.size * 2) # => [1, 1, 3, 2, 1, 2]
+ # The argument +n+ must be a non-negative numeric value.
+ # The order of the result array is unrelated to the order of +self+.
+ # Returns a new empty \Array if +self+ is empty.
+ #
+ # The optional +random+ argument will be used as the random number generator:
+ # a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ # a.sample(random: Random.new(1)) #=> 6
+ # a.sample(4, random: Random.new(1)) #=> [6, 10, 9, 2]
+ def sample(n = (ary = false), random: Random)
+ if Primitive.mandatory_only?
+ # Primitive.cexpr! %{ rb_ary_sample(self, rb_cRandom, Qfalse, Qfalse) }
+ Primitive.ary_sample0
+ else
+ # Primitive.cexpr! %{ rb_ary_sample(self, random, n, ary) }
+ Primitive.ary_sample(random, n, ary)
+ end
+ end
+end
diff --git a/ast.c b/ast.c
new file mode 100644
index 0000000000..adb7287ed3
--- /dev/null
+++ b/ast.c
@@ -0,0 +1,773 @@
+/* indent-tabs-mode: nil */
+#include "internal.h"
+#include "internal/parse.h"
+#include "internal/symbol.h"
+#include "internal/warnings.h"
+#include "iseq.h"
+#include "node.h"
+#include "ruby.h"
+#include "ruby/encoding.h"
+#include "ruby/util.h"
+#include "vm_core.h"
+
+#include "builtin.h"
+
+static VALUE rb_mAST;
+static VALUE rb_cNode;
+
+struct ASTNodeData {
+ rb_ast_t *ast;
+ const NODE *node;
+};
+
+static void
+node_gc_mark(void *ptr)
+{
+ struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+ rb_gc_mark((VALUE)data->ast);
+}
+
+static size_t
+node_memsize(const void *ptr)
+{
+ struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+ return rb_ast_memsize(data->ast);
+}
+
+static const rb_data_type_t rb_node_type = {
+ "AST/node",
+ {node_gc_mark, RUBY_TYPED_DEFAULT_FREE, node_memsize,},
+ 0, 0,
+ RUBY_TYPED_FREE_IMMEDIATELY,
+};
+
+static VALUE rb_ast_node_alloc(VALUE klass);
+
+static void
+setup_node(VALUE obj, rb_ast_t *ast, const NODE *node)
+{
+ struct ASTNodeData *data;
+
+ TypedData_Get_Struct(obj, struct ASTNodeData, &rb_node_type, data);
+ data->ast = ast;
+ data->node = node;
+}
+
+static VALUE
+ast_new_internal(rb_ast_t *ast, const NODE *node)
+{
+ VALUE obj;
+
+ obj = rb_ast_node_alloc(rb_cNode);
+ setup_node(obj, ast, node);
+
+ return obj;
+}
+
+static VALUE rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+static VALUE rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+
+static VALUE
+ast_parse_new(void)
+{
+ return rb_parser_set_context(rb_parser_new(), NULL, 0);
+}
+
+static VALUE
+ast_parse_done(rb_ast_t *ast)
+{
+ if (!ast->body.root) {
+ rb_ast_dispose(ast);
+ rb_exc_raise(GET_EC()->errinfo);
+ }
+
+ return ast_new_internal(ast, (NODE *)ast->body.root);
+}
+
+static VALUE
+ast_s_parse(rb_execution_context_t *ec, VALUE module, VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+ return rb_ast_parse_str(str, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+ rb_ast_t *ast = 0;
+
+ StringValue(str);
+ VALUE vparser = ast_parse_new();
+ if (RTEST(keep_script_lines)) rb_parser_keep_script_lines(vparser);
+ if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
+ if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
+ ast = rb_parser_compile_string_path(vparser, Qnil, str, 1);
+ return ast_parse_done(ast);
+}
+
+static VALUE
+ast_s_parse_file(rb_execution_context_t *ec, VALUE module, VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+ return rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+ VALUE f;
+ rb_ast_t *ast = 0;
+ rb_encoding *enc = rb_utf8_encoding();
+
+ FilePathValue(path);
+ f = rb_file_open_str(path, "r");
+ rb_funcall(f, rb_intern("set_encoding"), 2, rb_enc_from_encoding(enc), rb_str_new_cstr("-"));
+ VALUE vparser = ast_parse_new();
+ if (RTEST(keep_script_lines)) rb_parser_keep_script_lines(vparser);
+ if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
+ if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
+ ast = rb_parser_compile_file_path(vparser, Qnil, f, 1);
+ rb_io_close(f);
+ return ast_parse_done(ast);
+}
+
+static VALUE
+lex_array(VALUE array, int index)
+{
+ VALUE str = rb_ary_entry(array, index);
+ if (!NIL_P(str)) {
+ StringValue(str);
+ if (!rb_enc_asciicompat(rb_enc_get(str))) {
+ rb_raise(rb_eArgError, "invalid source encoding");
+ }
+ }
+ return str;
+}
+
+static VALUE
+rb_ast_parse_array(VALUE array, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+ rb_ast_t *ast = 0;
+
+ array = rb_check_array_type(array);
+ VALUE vparser = ast_parse_new();
+ if (RTEST(keep_script_lines)) rb_parser_keep_script_lines(vparser);
+ if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
+ if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
+ ast = rb_parser_compile_generic(vparser, lex_array, Qnil, array, 1);
+ return ast_parse_done(ast);
+}
+
+static VALUE node_children(rb_ast_t*, const NODE*);
+
+static VALUE
+node_find(VALUE self, const int node_id)
+{
+ VALUE ary;
+ long i;
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ if (nd_node_id(data->node) == node_id) return self;
+
+ ary = node_children(data->ast, data->node);
+
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ VALUE child = RARRAY_AREF(ary, i);
+
+ if (CLASS_OF(child) == rb_cNode) {
+ VALUE result = node_find(child, node_id);
+ if (RTEST(result)) return result;
+ }
+ }
+
+ return Qnil;
+}
+
+extern VALUE rb_e_script;
+
+static VALUE
+script_lines(VALUE path)
+{
+ VALUE hash, lines;
+ ID script_lines;
+ CONST_ID(script_lines, "SCRIPT_LINES__");
+ if (!rb_const_defined_at(rb_cObject, script_lines)) return Qnil;
+ hash = rb_const_get_at(rb_cObject, script_lines);
+ if (!RB_TYPE_P(hash, T_HASH)) return Qnil;
+ lines = rb_hash_lookup(hash, path);
+ if (!RB_TYPE_P(lines, T_ARRAY)) return Qnil;
+ return lines;
+}
+
+static VALUE
+node_id_for_backtrace_location(rb_execution_context_t *ec, VALUE module, VALUE location)
+{
+ int node_id;
+
+ if (!rb_frame_info_p(location)) {
+ rb_raise(rb_eTypeError, "Thread::Backtrace::Location object expected");
+ }
+
+ node_id = rb_get_node_id_from_frame_info(location);
+ if (node_id == -1) {
+ return Qnil;
+ }
+
+ return INT2NUM(node_id);
+}
+
+static VALUE
+ast_s_of(rb_execution_context_t *ec, VALUE module, VALUE body, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+ VALUE node, lines = Qnil;
+ const rb_iseq_t *iseq;
+ int node_id;
+
+ if (rb_frame_info_p(body)) {
+ iseq = rb_get_iseq_from_frame_info(body);
+ node_id = rb_get_node_id_from_frame_info(body);
+ }
+ else {
+ iseq = NULL;
+
+ if (rb_obj_is_proc(body)) {
+ iseq = vm_proc_iseq(body);
+
+ if (!rb_obj_is_iseq((VALUE)iseq)) return Qnil;
+ }
+ else {
+ iseq = rb_method_iseq(body);
+ }
+ if (iseq) {
+ node_id = ISEQ_BODY(iseq)->location.node_id;
+ }
+ }
+
+ if (!iseq) {
+ return Qnil;
+ }
+ lines = ISEQ_BODY(iseq)->variable.script_lines;
+
+ VALUE path = rb_iseq_path(iseq);
+ int e_option = RSTRING_LEN(path) == 2 && memcmp(RSTRING_PTR(path), "-e", 2) == 0;
+
+ if (NIL_P(lines) && rb_iseq_from_eval_p(iseq) && !e_option) {
+ rb_raise(rb_eArgError, "cannot get AST for method defined in eval");
+ }
+
+ if (!NIL_P(lines) || !NIL_P(lines = script_lines(path))) {
+ node = rb_ast_parse_array(lines, keep_script_lines, error_tolerant, keep_tokens);
+ }
+ else if (e_option) {
+ node = rb_ast_parse_str(rb_e_script, keep_script_lines, error_tolerant, keep_tokens);
+ }
+ else {
+ node = rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+ }
+
+ return node_find(node, node_id);
+}
+
+static VALUE
+rb_ast_node_alloc(VALUE klass)
+{
+ struct ASTNodeData *data;
+ VALUE obj = TypedData_Make_Struct(klass, struct ASTNodeData, &rb_node_type, data);
+
+ return obj;
+}
+
+static const char*
+node_type_to_str(const NODE *node)
+{
+ return (ruby_node_name(nd_type(node)) + rb_strlen_lit("NODE_"));
+}
+
+static VALUE
+ast_node_type(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return rb_sym_intern_ascii_cstr(node_type_to_str(data->node));
+}
+
+static VALUE
+ast_node_node_id(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2FIX(nd_node_id(data->node));
+}
+
+#define NEW_CHILD(ast, node) node ? ast_new_internal(ast, node) : Qnil
+
+static VALUE
+rb_ary_new_from_node_args(rb_ast_t *ast, long n, ...)
+{
+ va_list ar;
+ VALUE ary;
+ long i;
+
+ ary = rb_ary_new2(n);
+
+ va_start(ar, n);
+ for (i=0; i<n; i++) {
+ NODE *node;
+ node = va_arg(ar, NODE *);
+ rb_ary_push(ary, NEW_CHILD(ast, node));
+ }
+ va_end(ar);
+ return ary;
+}
+
+static VALUE
+dump_block(rb_ast_t *ast, const NODE *node)
+{
+ VALUE ary = rb_ary_new();
+ do {
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+ } while (node->nd_next &&
+ nd_type_p(node->nd_next, NODE_BLOCK) &&
+ (node = node->nd_next, 1));
+ if (node->nd_next) {
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_next));
+ }
+
+ return ary;
+}
+
+static VALUE
+dump_array(rb_ast_t *ast, const NODE *node)
+{
+ VALUE ary = rb_ary_new();
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+
+ while (node->nd_next && nd_type_p(node->nd_next, NODE_LIST)) {
+ node = node->nd_next;
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+ }
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_next));
+
+ return ary;
+}
+
+static VALUE
+var_name(ID id)
+{
+ if (!id) return Qnil;
+ if (!rb_id2str(id)) return Qnil;
+ return ID2SYM(id);
+}
+
+static VALUE
+no_name_rest(void)
+{
+ ID rest;
+ CONST_ID(rest, "NODE_SPECIAL_NO_NAME_REST");
+ return ID2SYM(rest);
+}
+
+static VALUE
+rest_arg(rb_ast_t *ast, const NODE *rest_arg)
+{
+ return NODE_NAMED_REST_P(rest_arg) ? NEW_CHILD(ast, rest_arg) : no_name_rest();
+}
+
+static VALUE
+node_children(rb_ast_t *ast, const NODE *node)
+{
+ char name[DECIMAL_SIZE_OF_BITS(sizeof(long) * CHAR_BIT) + 2]; /* including '$' */
+
+ enum node_type type = nd_type(node);
+ switch (type) {
+ case NODE_BLOCK:
+ return dump_block(ast, node);
+ case NODE_IF:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_cond, node->nd_body, node->nd_else);
+ case NODE_UNLESS:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_cond, node->nd_body, node->nd_else);
+ case NODE_CASE:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_CASE2:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_CASE3:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_WHEN:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_body, node->nd_next);
+ case NODE_IN:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_body, node->nd_next);
+ case NODE_WHILE:
+ case NODE_UNTIL:
+ return rb_ary_push(rb_ary_new_from_node_args(ast, 2, node->nd_cond, node->nd_body),
+ RBOOL(node->nd_state));
+ case NODE_ITER:
+ case NODE_FOR:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_iter, node->nd_body);
+ case NODE_FOR_MASGN:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_var);
+ case NODE_BREAK:
+ case NODE_NEXT:
+ case NODE_RETURN:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_stts);
+ case NODE_REDO:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_RETRY:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_BEGIN:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_RESCUE:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_resq, node->nd_else);
+ case NODE_RESBODY:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_args, node->nd_body, node->nd_head);
+ case NODE_ENSURE:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_ensr);
+ case NODE_AND:
+ case NODE_OR:
+ {
+ VALUE ary = rb_ary_new();
+
+ while (1) {
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_1st));
+ if (!node->nd_2nd || !nd_type_p(node->nd_2nd, type))
+ break;
+ node = node->nd_2nd;
+ }
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_2nd));
+ return ary;
+ }
+ case NODE_MASGN:
+ if (NODE_NAMED_REST_P(node->nd_args)) {
+ return rb_ary_new_from_node_args(ast, 3, node->nd_value, node->nd_head, node->nd_args);
+ }
+ else {
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_value),
+ NEW_CHILD(ast, node->nd_head),
+ no_name_rest());
+ }
+ case NODE_LASGN:
+ case NODE_DASGN:
+ case NODE_IASGN:
+ case NODE_CVASGN:
+ case NODE_GASGN:
+ if (NODE_REQUIRED_KEYWORD_P(node)) {
+ return rb_ary_new_from_args(2, var_name(node->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
+ }
+ return rb_ary_new_from_args(2, var_name(node->nd_vid), NEW_CHILD(ast, node->nd_value));
+ case NODE_CDECL:
+ if (node->nd_vid) {
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_vid), NEW_CHILD(ast, node->nd_value));
+ }
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_else), ID2SYM(node->nd_else->nd_mid), NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_ASGN1:
+ return rb_ary_new_from_args(4, NEW_CHILD(ast, node->nd_recv),
+ ID2SYM(node->nd_mid),
+ NEW_CHILD(ast, node->nd_args->nd_head),
+ NEW_CHILD(ast, node->nd_args->nd_body));
+ case NODE_OP_ASGN2:
+ return rb_ary_new_from_args(5, NEW_CHILD(ast, node->nd_recv),
+ RBOOL(node->nd_next->nd_aid),
+ ID2SYM(node->nd_next->nd_vid),
+ ID2SYM(node->nd_next->nd_mid),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_ASGN_AND:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head), ID2SYM(idANDOP),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_ASGN_OR:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head), ID2SYM(idOROP),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_CDECL:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head),
+ ID2SYM(node->nd_aid),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_CALL:
+ case NODE_OPCALL:
+ case NODE_QCALL:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv),
+ ID2SYM(node->nd_mid),
+ NEW_CHILD(ast, node->nd_args));
+ case NODE_FCALL:
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_mid),
+ NEW_CHILD(ast, node->nd_args));
+ case NODE_VCALL:
+ return rb_ary_new_from_args(1, ID2SYM(node->nd_mid));
+ case NODE_SUPER:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_args);
+ case NODE_ZSUPER:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_LIST:
+ case NODE_VALUES:
+ return dump_array(ast, node);
+ case NODE_ZLIST:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_HASH:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_YIELD:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_LVAR:
+ case NODE_DVAR:
+ return rb_ary_new_from_args(1, var_name(node->nd_vid));
+ case NODE_IVAR:
+ case NODE_CONST:
+ case NODE_CVAR:
+ case NODE_GVAR:
+ return rb_ary_new_from_args(1, ID2SYM(node->nd_vid));
+ case NODE_NTH_REF:
+ snprintf(name, sizeof(name), "$%ld", node->nd_nth);
+ return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+ case NODE_BACK_REF:
+ name[0] = '$';
+ name[1] = (char)node->nd_nth;
+ name[2] = '\0';
+ return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+ case NODE_MATCH2:
+ if (node->nd_args) {
+ return rb_ary_new_from_node_args(ast, 3, node->nd_recv, node->nd_value, node->nd_args);
+ }
+ return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_value);
+ case NODE_MATCH3:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_value);
+ case NODE_MATCH:
+ case NODE_LIT:
+ case NODE_STR:
+ case NODE_XSTR:
+ return rb_ary_new_from_args(1, node->nd_lit);
+ case NODE_ONCE:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_DSTR:
+ case NODE_DXSTR:
+ case NODE_DREGX:
+ case NODE_DSYM:
+ {
+ NODE *n = node->nd_next;
+ VALUE head = Qnil, next = Qnil;
+ if (n) {
+ head = NEW_CHILD(ast, n->nd_head);
+ next = NEW_CHILD(ast, n->nd_next);
+ }
+ return rb_ary_new_from_args(3, node->nd_lit, head, next);
+ }
+ case NODE_EVSTR:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_ARGSCAT:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_ARGSPUSH:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_SPLAT:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_BLOCK_PASS:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_DEFN:
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_defn));
+ case NODE_DEFS:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv), ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_defn));
+ case NODE_ALIAS:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_1st, node->nd_2nd);
+ case NODE_VALIAS:
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_alias), ID2SYM(node->nd_orig));
+ case NODE_UNDEF:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_undef);
+ case NODE_CLASS:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_cpath, node->nd_super, node->nd_body);
+ case NODE_MODULE:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_cpath, node->nd_body);
+ case NODE_SCLASS:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_body);
+ case NODE_COLON2:
+ return rb_ary_new_from_args(2, NEW_CHILD(ast, node->nd_head), ID2SYM(node->nd_mid));
+ case NODE_COLON3:
+ return rb_ary_new_from_args(1, ID2SYM(node->nd_mid));
+ case NODE_DOT2:
+ case NODE_DOT3:
+ case NODE_FLIP2:
+ case NODE_FLIP3:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_beg, node->nd_end);
+ case NODE_SELF:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_NIL:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_TRUE:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_FALSE:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_ERRINFO:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_DEFINED:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_POSTEXE:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_ATTRASGN:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv), ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_args));
+ case NODE_LAMBDA:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_OPT_ARG:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_body, node->nd_next);
+ case NODE_KW_ARG:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_body, node->nd_next);
+ case NODE_POSTARG:
+ if (NODE_NAMED_REST_P(node->nd_1st)) {
+ return rb_ary_new_from_node_args(ast, 2, node->nd_1st, node->nd_2nd);
+ }
+ return rb_ary_new_from_args(2, no_name_rest(),
+ NEW_CHILD(ast, node->nd_2nd));
+ case NODE_ARGS:
+ {
+ struct rb_args_info *ainfo = node->nd_ainfo;
+ return rb_ary_new_from_args(10,
+ INT2NUM(ainfo->pre_args_num),
+ NEW_CHILD(ast, ainfo->pre_init),
+ NEW_CHILD(ast, ainfo->opt_args),
+ var_name(ainfo->first_post_arg),
+ INT2NUM(ainfo->post_args_num),
+ NEW_CHILD(ast, ainfo->post_init),
+ (ainfo->rest_arg == NODE_SPECIAL_EXCESSIVE_COMMA
+ ? ID2SYM(rb_intern("NODE_SPECIAL_EXCESSIVE_COMMA"))
+ : var_name(ainfo->rest_arg)),
+ (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast, ainfo->kw_args)),
+ (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast, ainfo->kw_rest_arg)),
+ var_name(ainfo->block_arg));
+ }
+ case NODE_SCOPE:
+ {
+ rb_ast_id_table_t *tbl = node->nd_tbl;
+ int i, size = tbl ? tbl->size : 0;
+ VALUE locals = rb_ary_new_capa(size);
+ for (i = 0; i < size; i++) {
+ rb_ary_push(locals, var_name(tbl->ids[i]));
+ }
+ return rb_ary_new_from_args(3, locals, NEW_CHILD(ast, node->nd_args), NEW_CHILD(ast, node->nd_body));
+ }
+ case NODE_ARYPTN:
+ {
+ struct rb_ary_pattern_info *apinfo = node->nd_apinfo;
+ VALUE rest = rest_arg(ast, apinfo->rest_arg);
+ return rb_ary_new_from_args(4,
+ NEW_CHILD(ast, node->nd_pconst),
+ NEW_CHILD(ast, apinfo->pre_args),
+ rest,
+ NEW_CHILD(ast, apinfo->post_args));
+ }
+ case NODE_FNDPTN:
+ {
+ struct rb_fnd_pattern_info *fpinfo = node->nd_fpinfo;
+ VALUE pre_rest = rest_arg(ast, fpinfo->pre_rest_arg);
+ VALUE post_rest = rest_arg(ast, fpinfo->post_rest_arg);
+ return rb_ary_new_from_args(4,
+ NEW_CHILD(ast, node->nd_pconst),
+ pre_rest,
+ NEW_CHILD(ast, fpinfo->args),
+ post_rest);
+ }
+ case NODE_HSHPTN:
+ {
+ VALUE kwrest = node->nd_pkwrestarg == NODE_SPECIAL_NO_REST_KEYWORD ? ID2SYM(rb_intern("NODE_SPECIAL_NO_REST_KEYWORD")) :
+ NEW_CHILD(ast, node->nd_pkwrestarg);
+
+ return rb_ary_new_from_args(3,
+ NEW_CHILD(ast, node->nd_pconst),
+ NEW_CHILD(ast, node->nd_pkwargs),
+ kwrest);
+ }
+ case NODE_ERROR:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_ARGS_AUX:
+ case NODE_LAST:
+ break;
+ }
+
+ rb_bug("node_children: unknown node: %s", ruby_node_name(type));
+}
+
+static VALUE
+ast_node_children(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return node_children(data->ast, data->node);
+}
+
+static VALUE
+ast_node_first_lineno(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_first_lineno(data->node));
+}
+
+static VALUE
+ast_node_first_column(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_first_column(data->node));
+}
+
+static VALUE
+ast_node_last_lineno(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_last_lineno(data->node));
+}
+
+static VALUE
+ast_node_last_column(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_last_column(data->node));
+}
+
+static VALUE
+ast_node_all_tokens(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return rb_ast_tokens(data->ast);
+}
+
+static VALUE
+ast_node_inspect(rb_execution_context_t *ec, VALUE self)
+{
+ VALUE str;
+ VALUE cname;
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ cname = rb_class_path(rb_obj_class(self));
+ str = rb_str_new2("#<");
+
+ rb_str_append(str, cname);
+ rb_str_catf(str, ":%s@%d:%d-%d:%d>",
+ node_type_to_str(data->node),
+ nd_first_lineno(data->node), nd_first_column(data->node),
+ nd_last_lineno(data->node), nd_last_column(data->node));
+
+ return str;
+}
+
+static VALUE
+ast_node_script_lines(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+ VALUE ret = data->ast->body.script_lines;
+ if (!RB_TYPE_P(ret, T_ARRAY)) return Qnil;
+ return ret;
+}
+
+#include "ast.rbinc"
+
+void
+Init_ast(void)
+{
+ rb_mAST = rb_define_module_under(rb_cRubyVM, "AbstractSyntaxTree");
+ rb_cNode = rb_define_class_under(rb_mAST, "Node", rb_cObject);
+ rb_undef_alloc_func(rb_cNode);
+}
diff --git a/ast.rb b/ast.rb
new file mode 100644
index 0000000000..f3f72c747f
--- /dev/null
+++ b/ast.rb
@@ -0,0 +1,276 @@
+# for ast.c
+
+# AbstractSyntaxTree provides methods to parse Ruby code into
+# abstract syntax trees. The nodes in the tree
+# are instances of RubyVM::AbstractSyntaxTree::Node.
+#
+# This module is MRI specific as it exposes implementation details
+# of the MRI abstract syntax tree.
+#
+# This module is experimental and its API is not stable, therefore it might
+# change without notice. As examples, the order of children nodes is not
+# guaranteed, the number of children nodes might change, there is no way to
+# access children nodes by name, etc.
+#
+# If you are looking for a stable API or an API working under multiple Ruby
+# implementations, consider using the _parser_ gem or Ripper. If you would
+# like to make RubyVM::AbstractSyntaxTree stable, please join the discussion
+# at https://bugs.ruby-lang.org/issues/14844.
+#
+module RubyVM::AbstractSyntaxTree
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.parse(string, keep_script_lines: false, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+ #
+ # Parses the given _string_ into an abstract syntax tree,
+ # returning the root node of that tree.
+ #
+ # RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-1:9>
+ #
+ # If <tt>keep_script_lines: true</tt> option is provided, the text of the parsed
+ # source is associated with nodes and is available via Node#script_lines.
+ #
+ # If <tt>keep_tokens: true</tt> option is provided, Node#tokens are populated.
+ #
+ # SyntaxError is raised if the given _string_ is invalid syntax. To overwrite this
+ # behavior, <tt>error_tolerant: true</tt> can be provided. In this case, the parser
+ # will produce a tree where expressions with syntax errors would be represented by
+ # Node with <tt>type=:ERROR</tt>.
+ #
+ # root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2")
+ # # <internal:ast>:33:in `parse': syntax error, unexpected ';', expecting ')' (SyntaxError)
+ # # x = 1; p(x; y=2
+ # # ^
+ #
+ # root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2", error_tolerant: true)
+ # # (SCOPE@1:0-1:15
+ # # tbl: [:x, :y]
+ # # args: nil
+ # # body: (BLOCK@1:0-1:15 (LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)) (ERROR@1:7-1:11) (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))))
+ # root.children.last.children
+ # # [(LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)),
+ # # (ERROR@1:7-1:11),
+ # # (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))]
+ #
+ # Note that parsing continues even after the errored expresion.
+ #
+ def self.parse string, keep_script_lines: false, error_tolerant: false, keep_tokens: false
+ Primitive.ast_s_parse string, keep_script_lines, error_tolerant, keep_tokens
+ end
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.parse_file(pathname, keep_script_lines: false, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+ #
+ # Reads the file from _pathname_, then parses it like ::parse,
+ # returning the root node of the abstract syntax tree.
+ #
+ # SyntaxError is raised if _pathname_'s contents are not
+ # valid Ruby syntax.
+ #
+ # RubyVM::AbstractSyntaxTree.parse_file("my-app/app.rb")
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-31:3>
+ #
+ # See ::parse for explanation of keyword argument meaning and usage.
+ def self.parse_file pathname, keep_script_lines: false, error_tolerant: false, keep_tokens: false
+ Primitive.ast_s_parse_file pathname, keep_script_lines, error_tolerant, keep_tokens
+ end
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.of(proc, keep_script_lines: false, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+ # RubyVM::AbstractSyntaxTree.of(method, keep_script_lines: false, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+ #
+ # Returns AST nodes of the given _proc_ or _method_.
+ #
+ # RubyVM::AbstractSyntaxTree.of(proc {1 + 2})
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:35-1:42>
+ #
+ # def hello
+ # puts "hello, world"
+ # end
+ #
+ # RubyVM::AbstractSyntaxTree.of(method(:hello))
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-3:3>
+ #
+ # See ::parse for explanation of keyword argument meaning and usage.
+ def self.of body, keep_script_lines: false, error_tolerant: false, keep_tokens: false
+ Primitive.ast_s_of body, keep_script_lines, error_tolerant, keep_tokens
+ end
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(backtrace_location) -> integer
+ #
+ # Returns the node id for the given backtrace location.
+ #
+ # begin
+ # raise
+ # rescue => e
+ # loc = e.backtrace_locations.first
+ # RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(loc)
+ # end # => 0
+ def self.node_id_for_backtrace_location backtrace_location
+ Primitive.node_id_for_backtrace_location backtrace_location
+ end
+
+ # RubyVM::AbstractSyntaxTree::Node instances are created by parse methods in
+ # RubyVM::AbstractSyntaxTree.
+ #
+ # This class is MRI specific.
+ #
+ class Node
+
+ # call-seq:
+ # node.type -> symbol
+ #
+ # Returns the type of this node as a symbol.
+ #
+ # root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+ # root.type # => :SCOPE
+ # lasgn = root.children[2]
+ # lasgn.type # => :LASGN
+ # call = lasgn.children[1]
+ # call.type # => :OPCALL
+ def type
+ Primitive.ast_node_type
+ end
+
+ # call-seq:
+ # node.first_lineno -> integer
+ #
+ # The line number in the source code where this AST's text began.
+ def first_lineno
+ Primitive.ast_node_first_lineno
+ end
+
+ # call-seq:
+ # node.first_column -> integer
+ #
+ # The column number in the source code where this AST's text began.
+ def first_column
+ Primitive.ast_node_first_column
+ end
+
+ # call-seq:
+ # node.last_lineno -> integer
+ #
+ # The line number in the source code where this AST's text ended.
+ def last_lineno
+ Primitive.ast_node_last_lineno
+ end
+
+ # call-seq:
+ # node.last_column -> integer
+ #
+ # The column number in the source code where this AST's text ended.
+ def last_column
+ Primitive.ast_node_last_column
+ end
+
+ # call-seq:
+ # node.tokens -> array
+ #
+ # Returns tokens corresponding to the location of the node.
+ # Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+ #
+ # root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+ # root.tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+ # root.tokens.map{_1[2]}.join # => "x = 1 + 2"
+ #
+ # Token is an array of:
+ #
+ # - id
+ # - token type
+ # - source code text
+ # - location [ first_lineno, first_column, last_lineno, last_column ]
+ def tokens
+ return nil unless all_tokens
+
+ all_tokens.each_with_object([]) do |token, a|
+ loc = token.last
+ if ([first_lineno, first_column] <=> [loc[0], loc[1]]) <= 0 &&
+ ([last_lineno, last_column] <=> [loc[2], loc[3]]) >= 0
+ a << token
+ end
+ end
+ end
+
+ # call-seq:
+ # node.all_tokens -> array
+ #
+ # Returns all tokens for the input script regardless the receiver node.
+ # Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+ #
+ # root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+ # root.all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+ # root.children[-1].all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+ def all_tokens
+ Primitive.ast_node_all_tokens
+ end
+
+ # call-seq:
+ # node.children -> array
+ #
+ # Returns AST nodes under this one. Each kind of node
+ # has different children, depending on what kind of node it is.
+ #
+ # The returned array may contain other nodes or <code>nil</code>.
+ def children
+ Primitive.ast_node_children
+ end
+
+ # call-seq:
+ # node.inspect -> string
+ #
+ # Returns debugging information about this node as a string.
+ def inspect
+ Primitive.ast_node_inspect
+ end
+
+ # call-seq:
+ # node.node_id -> integer
+ #
+ # Returns an internal node_id number.
+ # Note that this is an API for ruby internal use, debugging,
+ # and research. Do not use this for any other purpose.
+ # The compatibility is not guaranteed.
+ def node_id
+ Primitive.ast_node_node_id
+ end
+
+ # call-seq:
+ # node.script_lines -> array
+ #
+ # Returns the original source code as an array of lines.
+ #
+ # Note that this is an API for ruby internal use, debugging,
+ # and research. Do not use this for any other purpose.
+ # The compatibility is not guaranteed.
+ def script_lines
+ Primitive.ast_node_script_lines
+ end
+
+ # call-seq:
+ # node.source -> string
+ #
+ # Returns the code fragment that corresponds to this AST.
+ #
+ # Note that this is an API for ruby internal use, debugging,
+ # and research. Do not use this for any other purpose.
+ # The compatibility is not guaranteed.
+ #
+ # Also note that this API may return an incomplete code fragment
+ # that does not parse; for example, a here document following
+ # an expression may be dropped.
+ def source
+ lines = script_lines
+ if lines
+ lines = lines[first_lineno - 1 .. last_lineno - 1]
+ lines[-1] = lines[-1][0...last_column]
+ lines[0] = lines[0][first_column..-1]
+ lines.join
+ else
+ nil
+ end
+ end
+ end
+end
diff --git a/autogen.sh b/autogen.sh
new file mode 100755
index 0000000000..f8cdf3c0c1
--- /dev/null
+++ b/autogen.sh
@@ -0,0 +1,17 @@
+#!/bin/sh
+
+PWD=
+case "$0" in
+*/*) srcdir=`dirname $0`;;
+*) srcdir="";;
+esac
+
+symlink='--install --symlink'
+case " $* " in
+ *" -i "*|*" --install "*)
+ # reset to copy missing standard auxiliary files, instead of symlinks
+ symlink=
+ ;;
+esac
+
+exec ${AUTORECONF:-autoreconf} ${symlink} "$@" ${srcdir:+"$srcdir"}
diff --git a/basictest/runner.rb b/basictest/runner.rb
new file mode 100755
index 0000000000..0f398e7acc
--- /dev/null
+++ b/basictest/runner.rb
@@ -0,0 +1,33 @@
+#! ./miniruby
+
+exit if defined?(CROSS_COMPILING) and CROSS_COMPILING
+ruby = ENV["RUBY"]
+unless ruby
+ load './rbconfig.rb'
+ ruby = "./#{RbConfig::CONFIG['ruby_install_name']}#{RbConfig::CONFIG['EXEEXT']}"
+end
+unless File.exist? ruby
+ print "#{ruby} is not found.\n"
+ print "Try `make' first, then `make test', please.\n"
+ exit false
+end
+ARGV[0] and opt = ARGV[0][/\A--run-opt=(.*)/, 1] and ARGV.shift
+
+$stderr.reopen($stdout)
+error = ''
+
+srcdir = File.expand_path('..', File.dirname(__FILE__))
+if env = ENV["RUBYOPT"]
+ ENV["RUBYOPT"] = env + " -W1"
+end
+`#{ruby} #{opt} -W1 #{srcdir}/basictest/test.rb #{ARGV.join(' ')}`.each_line do |line|
+ if line =~ /^end of test/
+ print "\ntest succeeded\n"
+ exit true
+ end
+ error << line if %r:^(basictest/test.rb|not): =~ line
+end
+puts
+print error
+print "test failed\n"
+exit false
diff --git a/basictest/test.rb b/basictest/test.rb
new file mode 100755
index 0000000000..95875b52a6
--- /dev/null
+++ b/basictest/test.rb
@@ -0,0 +1,2367 @@
+#! /usr/bin/env ruby
+# -*- coding: us-ascii -*-
+
+$testnum=0
+$ntest=0
+$failed = 0
+class Progress
+ def initialize
+ @color = nil
+ @tty = nil
+ @quiet = nil
+ @verbose = nil
+ ARGV.each do |arg|
+ case arg
+ when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
+ warn "unknown --color argument: #$3" if $3
+ @color = $1 ? nil : !$2
+ when /\A--tty(=(?:yes|(no)|(.*)))?\z/
+ warn "unknown --tty argument: #$3" if $3
+ @tty = !$1 || !$2
+ true
+ when /\A-(q|-quiet)\z/
+ @quiet = true
+ when /\A-(v|-verbose)\z/
+ @verbose = true
+ end
+ end
+ @tty = STDERR.tty? && !STDOUT.tty? && /dumb/ !~ ENV["TERM"] if @tty.nil?
+ @eol = @tty && !@verbose ? "\r\e[K\r" : "\n"
+ case @color
+ when nil
+ @color = @tty
+ end
+ if @color
+ # dircolors-like style
+ colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
+ begin
+ File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
+ colors[n] ||= c
+ end
+ rescue
+ end
+ @passed = "\e[;#{colors["pass"] || "32"}m"
+ @failed = "\e[;#{colors["fail"] || "31"}m"
+ @reset = "\e[m"
+ else
+ @passed = @failed = @reset = ""
+ end
+ extend(Rotator) if @tty
+ end
+
+ def passed_string
+ "."
+ end
+ def failed_string
+ "#{@failed}F#{@reset}"
+ end
+ def init_string
+ end
+ def finish_string
+ if @quiet
+ @eol
+ else
+ "#{@passed}#{@ok ? 'OK' : ''} #{$testnum}#{@reset}#{@eol}"
+ end
+ end
+ def pass
+ STDERR.print passed_string
+ end
+ def fail
+ @ok = false
+ STDERR.print failed_string
+ end
+ def init
+ @ok = true
+ STDERR.print init_string
+ end
+ def finish
+ STDERR.print finish_string
+ end
+
+ module Rotator
+ ROTATOR = %w[- \\ | /]
+ BS = "\b" * ROTATOR[0].size
+ def passed_string
+ "#{BS}#{ROTATOR[(@count += 1) % ROTATOR.size]}"
+ end
+ def failed_string
+ "#{BS}#{super}#{ROTATOR[@count % ROTATOR.size]}"
+ end
+ def init_string
+ @count = 0
+ " "
+ end
+ def finish_string
+ s = "#{BS}#{' ' * BS.size}#{BS}#{super}"
+ s.gsub!(/\n/, "\r\e[2K\r") if @quiet
+ s
+ end
+ end
+end
+PROGRESS = Progress.new
+
+def test_check(what)
+ unless $ntest.zero?
+ PROGRESS.finish
+ end
+ STDERR.print "#{$0}:#{what} "
+ PROGRESS.init
+ $what = what
+ $testnum = 0
+end
+
+def test_ok(cond,n=1)
+ $testnum+=1
+ $ntest+=1
+ where = (st = caller(n)) ? st[0] : "caller error! (n=#{n}, trace=#{caller(0).join(', ')}"
+ if cond
+ PROGRESS.pass
+ printf "ok %d (%s)\n", $testnum, where
+ else
+ PROGRESS.fail
+ printf "not ok %s %d -- %s\n", $what, $testnum, where
+ $failed+=1
+ end
+ STDOUT.flush
+ STDERR.flush
+end
+
+# make sure conditional operators work
+
+test_check "assignment"
+
+a=[]; a[0] ||= "bar";
+test_ok(a[0] == "bar")
+h={}; h["foo"] ||= "bar";
+test_ok(h["foo"] == "bar")
+
+aa = 5
+aa ||= 25
+test_ok(aa == 5)
+bb ||= 25
+test_ok(bb == 25)
+cc &&=33
+test_ok(cc == nil)
+cc = 5
+cc &&=44
+test_ok(cc == 44)
+
+a = nil; test_ok(a == nil)
+a = 1; test_ok(a == 1)
+a = []; test_ok(a == [])
+a = [1]; test_ok(a == [1])
+a = [nil]; test_ok(a == [nil])
+a = [[]]; test_ok(a == [[]])
+a = [1,2]; test_ok(a == [1,2])
+a = [*[]]; test_ok(a == [])
+a = [*[1]]; test_ok(a == [1])
+a = [*[1,2]]; test_ok(a == [1,2])
+
+a = *[]; test_ok(a == [])
+a = *[1]; test_ok(a == [1])
+a = *[nil]; test_ok(a == [nil])
+a = *[[]]; test_ok(a == [[]])
+a = *[1,2]; test_ok(a == [1,2])
+a = *[*[]]; test_ok(a == [])
+a = *[*[1]]; test_ok(a == [1])
+a = *[*[1,2]]; test_ok(a == [1,2])
+
+a, = nil; test_ok(a == nil)
+a, = 1; test_ok(a == 1)
+a, = []; test_ok(a == nil)
+a, = [1]; test_ok(a == 1)
+a, = [nil]; test_ok(a == nil)
+a, = [[]]; test_ok(a == [])
+a, = 1,2; test_ok(a == 1)
+a, = [1,2]; test_ok(a == 1)
+a, = [*[]]; test_ok(a == nil)
+a, = [*[1]]; test_ok(a == 1)
+a, = *[1,2]; test_ok(a == 1)
+a, = [*[1,2]]; test_ok(a == 1)
+
+a, = *[]; test_ok(a == nil)
+a, = *[1]; test_ok(a == 1)
+a, = *[nil]; test_ok(a == nil)
+a, = *[[]]; test_ok(a == [])
+a, = *[1,2]; test_ok(a == 1)
+a, = *[*[]]; test_ok(a == nil)
+a, = *[*[1]]; test_ok(a == 1)
+a, = *[*[1,2]]; test_ok(a == 1)
+
+*a = nil; test_ok(a == [nil])
+*a = 1; test_ok(a == [1])
+*a = []; test_ok(a == [])
+*a = [1]; test_ok(a == [1])
+*a = [nil]; test_ok(a == [nil])
+*a = [[]]; test_ok(a == [[]])
+*a = [1,2]; test_ok(a == [1,2])
+*a = [*[]]; test_ok(a == [])
+*a = [*[1]]; test_ok(a == [1])
+*a = [*[1,2]]; test_ok(a == [1,2])
+
+*a = *[]; test_ok(a == [])
+*a = *[1]; test_ok(a == [1])
+*a = *[nil]; test_ok(a == [nil])
+*a = *[[]]; test_ok(a == [[]])
+*a = *[1,2]; test_ok(a == [1,2])
+*a = *[*[]]; test_ok(a == [])
+*a = *[*[1]]; test_ok(a == [1])
+*a = *[*[1,2]]; test_ok(a == [1,2])
+
+a,b,*c = nil; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = 1; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = []; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = [1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = [*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = *[]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = *[1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = *[*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+def f; yield nil; end; f {|a| test_ok(a == nil)}
+def f; yield 1; end; f {|a| test_ok(a == 1)}
+def f; yield []; end; f {|a| test_ok(a == [])}
+def f; yield [1]; end; f {|a| test_ok(a == [1])}
+def f; yield [nil]; end; f {|a| test_ok(a == [nil])}
+def f; yield [[]]; end; f {|a| test_ok(a == [[]])}
+def f; yield [*[]]; end; f {|a| test_ok(a == [])}
+def f; yield [*[1]]; end; f {|a| test_ok(a == [1])}
+def f; yield [*[1,2]]; end; f {|a| test_ok(a == [1,2])}
+def f; yield *[]; end; f {|a| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a| test_ok(a == [])}
+def f; yield *[*[]]; end; f {|a| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a| test_ok(a == 1)}
+
+def f; yield; end; f {|a,| test_ok(a == nil)}
+def f; yield nil; end; f {|a,| test_ok(a == nil)}
+def f; yield 1; end; f {|a,| test_ok(a == 1)}
+def f; yield []; end; f {|a,| test_ok(a == nil)}
+def f; yield [1]; end; f {|a,| test_ok(a == 1)}
+def f; yield [nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield [[]]; end; f {|a,| test_ok(a == [])}
+def f; yield [*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield [*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield [*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield *[]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield; end; f {|*a| test_ok(a == [])}
+def f; yield nil; end; f {|*a| test_ok(a == [nil])}
+def f; yield 1; end; f {|*a| test_ok(a == [1])}
+def f; yield []; end; f {|*a| test_ok(a == [[]])}
+def f; yield [1]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [nil]; end; f {|*a| test_ok(a == [[nil]])}
+def f; yield [[]]; end; f {|*a| test_ok(a == [[[]]])}
+def f; yield [1,2]; end; f {|*a| test_ok(a == [[1,2]])}
+def f; yield [*[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield [*[1]]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [*[1,2]]; end; f {|*a| test_ok(a == [[1,2]])}
+
+def f; yield *[]; end; f {|*a| test_ok(a == [])}
+def f; yield *[1]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[nil]; end; f {|*a| test_ok(a == [nil])}
+def f; yield *[[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield *[*[]]; end; f {|*a| test_ok(a == [])}
+def f; yield *[*[1]]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[*[1,2]]; end; f {|*a| test_ok(a == [1,2])}
+
+def f; yield; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield nil; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield 1; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield []; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [[]]; end; f {|a,b,*c| test_ok([a,b,c] == [[],nil,[]])}
+def f; yield [*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def f; yield *[]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def r; return; end; a = r(); test_ok(a == nil)
+def r; return nil; end; a = r(); test_ok(a == nil)
+def r; return 1; end; a = r(); test_ok(a == 1)
+def r; return []; end; a = r(); test_ok(a == [])
+def r; return [1]; end; a = r(); test_ok(a == [1])
+def r; return [nil]; end; a = r(); test_ok(a == [nil])
+def r; return [[]]; end; a = r(); test_ok(a == [[]])
+def r; return [*[]]; end; a = r(); test_ok(a == [])
+def r; return [*[1]]; end; a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; a = r(); test_ok(a == [])
+def r; return *[1]; end; a = r(); test_ok(a == [1])
+def r; return *[nil]; end; a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; a = r(); test_ok(a == [[]])
+def r; return *[*[]]; end; a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; a = *r(); test_ok(a == [[]])
+def r; return *[*[1,2]]; end; a = *r(); test_ok(a == [1,2])
+
+def r; return; end; *a = r(); test_ok(a == [nil])
+def r; return nil; end; *a = r(); test_ok(a == [nil])
+def r; return 1; end; *a = r(); test_ok(a == [1])
+def r; return []; end; *a = r(); test_ok(a == [])
+def r; return [1]; end; *a = r(); test_ok(a == [1])
+def r; return [nil]; end; *a = r(); test_ok(a == [nil])
+def r; return [[]]; end; *a = r(); test_ok(a == [[]])
+def r; return [1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return [*[]]; end; *a = r(); test_ok(a == [])
+def r; return [*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; *a = r(); test_ok(a == [])
+def r; return *[1]; end; *a = r(); test_ok(a == [1])
+def r; return *[nil]; end; *a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; *a = r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return *[*[]]; end; *a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; *a = *r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = *r(); test_ok(a == [1,2])
+def r; return *[*[1,2]]; end; *a = *r(); test_ok(a == [1,2])
+
+def r; return; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return nil; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return 1; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return []; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return [1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return [*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+def r; return *[]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return *[1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return *[*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+f = lambda {|r,| test_ok([] == r)}
+f.call([], *[])
+
+f = lambda {|r,*l| test_ok([] == r); test_ok([1] == l)}
+f.call([], *[1])
+
+f = lambda{|x| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|x,| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|*x| x}
+test_ok(f.call(42) == [42])
+test_ok(f.call([42]) == [[42]])
+test_ok(f.call([[42]]) == [[[42]]])
+test_ok(f.call([42,55]) == [[42,55]])
+test_ok(f.call(42,55) == [42,55])
+
+f = lambda { |a, b=42, *c| [a,b,c] }
+test_ok(f.call(1 ) == [1,42,[ ]] )
+test_ok(f.call(1,43 ) == [1,43,[ ]] )
+test_ok(f.call(1,43,44) == [1,43,[44]] )
+
+f = lambda { |a, b=(a|16), *c, &block| [a,b,c,block&&block[]] }
+test_ok(f.call(8 ) == [8,24,[ ],nil] )
+test_ok(f.call(8,43 ) == [8,43,[ ],nil] )
+test_ok(f.call(8,43,44) == [8,43,[44],nil] )
+test_ok(f.call(8 ){45} == [8,24,[ ],45 ] )
+test_ok(f.call(8,43 ){45} == [8,43,[ ],45 ] )
+test_ok(f.call(8,43,44){45} == [8,43,[44],45 ] )
+
+f = lambda { |a, b=42, *c, d| [a,b,c,d] }
+test_ok(f.call(1 ,99) == [1,42,[ ],99] )
+test_ok(f.call(1,43 ,99) == [1,43,[ ],99] )
+test_ok(f.call(1,43,44,99) == [1,43,[44],99] )
+
+f = lambda { |a, b=(a|16), &block| [a,b,block&&block[]] }
+test_ok(f.call(8 ) == [8,24,nil] )
+test_ok(f.call(8,43) == [8,43,nil] )
+test_ok(f.call(8,43) == [8,43,nil] )
+test_ok(f.call(8 ){45} == [8,24,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+
+f = lambda { |a, b=42, d| [a,b,d] }
+test_ok(f.call(1 ,99) == [1,42,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+
+f = lambda { |b=42, *c, &block| [b,c,block&&block[]] }
+test_ok(f.call( ) == [42,[ ],nil] )
+test_ok(f.call(43 ) == [43,[ ],nil] )
+test_ok(f.call(43,44) == [43,[44],nil] )
+test_ok(f.call( ){45} == [42,[ ],45 ] )
+test_ok(f.call(43 ){45} == [43,[ ],45 ] )
+test_ok(f.call(43,44){45} == [43,[44],45 ] )
+
+f = lambda { |b=42, *c, d| [b,c,d] }
+test_ok(f.call( 99) == [42,[ ],99] )
+test_ok(f.call(43 ,99) == [43,[ ],99] )
+test_ok(f.call(43,44,99) == [43,[44],99] )
+
+f = lambda { |b=42, &block| [b,block&&block[]] }
+test_ok(f.call( ) == [42,nil] )
+test_ok(f.call(43) == [43,nil] )
+test_ok(f.call(43) == [43,nil] )
+test_ok(f.call( ){45} == [42,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+
+f = lambda { |b=42, d| [b,d] }
+test_ok(f.call( 99) == [42,99] )
+test_ok(f.call(43,99) == [43,99] )
+test_ok(f.call(43,99) == [43,99] )
+
+
+a,=*[1]
+test_ok(a == 1)
+a,=*[[1]]
+test_ok(a == [1])
+a,=*[[[1]]]
+test_ok(a == [[1]])
+
+x, (y, z) = 1, 2, 3
+test_ok([1,2,nil] == [x,y,z])
+x, (y, z) = 1, [2,3]
+test_ok([1,2,3] == [x,y,z])
+x, (y, z) = 1, [2]
+test_ok([1,2,nil] == [x,y,z])
+
+a = loop do break; end; test_ok(a == nil)
+a = loop do break nil; end; test_ok(a == nil)
+a = loop do break 1; end; test_ok(a == 1)
+a = loop do break []; end; test_ok(a == [])
+a = loop do break [1]; end; test_ok(a == [1])
+a = loop do break [nil]; end; test_ok(a == [nil])
+a = loop do break [[]]; end; test_ok(a == [[]])
+a = loop do break [*[]]; end; test_ok(a == [])
+a = loop do break [*[1]]; end; test_ok(a == [1])
+a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+a = loop do break *[]; end; test_ok(a == [])
+a = loop do break *[1]; end; test_ok(a == [1])
+a = loop do break *[nil]; end; test_ok(a == [nil])
+a = loop do break *[[]]; end; test_ok(a == [[]])
+a = loop do break *[*[]]; end; test_ok(a == [])
+a = loop do break *[*[1]]; end; test_ok(a == [1])
+a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break; end; test_ok(a == [nil])
+*a = loop do break nil; end; test_ok(a == [nil])
+*a = loop do break 1; end; test_ok(a == [1])
+*a = loop do break []; end; test_ok(a == [])
+*a = loop do break [1]; end; test_ok(a == [1])
+*a = loop do break [nil]; end; test_ok(a == [nil])
+*a = loop do break [[]]; end; test_ok(a == [[]])
+*a = loop do break [1,2]; end; test_ok(a == [1,2])
+*a = loop do break [*[]]; end; test_ok(a == [])
+*a = loop do break [*[1]]; end; test_ok(a == [1])
+*a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break *[]; end; test_ok(a == [])
+*a = loop do break *[1]; end; test_ok(a == [1])
+*a = loop do break *[nil]; end; test_ok(a == [nil])
+*a = loop do break *[[]]; end; test_ok(a == [[]])
+*a = loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = loop do break *[*[]]; end; test_ok(a == [])
+*a = loop do break *[*[1]]; end; test_ok(a == [1])
+*a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = *loop do break *[[]]; end; test_ok(a == [[]])
+*a = *loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = *loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+a,b,*c = loop do break; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break nil; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break 1; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break []; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break [1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break [*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = loop do break *[]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break *[1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break *[*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+def r(val); a = yield(); test_ok(a == val, 2); end
+r(nil){next}
+r(nil){next nil}
+r(1){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+r([]){next *[]}
+r([1]){next *[1]}
+r([nil]){next *[nil]}
+r([[]]){next *[[]]}
+r([]){next *[*[]]}
+r([1]){next *[*[1]]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); *a = yield(); test_ok(a == val, 2); end
+r([nil]){next}
+r([nil]){next nil}
+r([1]){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([1,2]){next [1,2]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+def r(val); *a = *yield(); test_ok(a == val, 2); end
+r([[]]){next *[[]]}
+r([1,2]){next *[1,2]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); a,b,*c = yield(); test_ok([a,b,c] == val, 2); end
+r([nil,nil,[]]){next}
+r([nil,nil,[]]){next nil}
+r([1,nil,[]]){next 1}
+r([nil,nil,[]]){next []}
+r([1,nil,[]]){next [1]}
+r([nil,nil,[]]){next [nil]}
+r([[],nil,[]]){next [[]]}
+r([1,2,[]]){next [1,2]}
+r([nil,nil,[]]){next [*[]]}
+r([1,nil,[]]){next [*[1]]}
+r([1,2,[]]){next [*[1,2]]}
+
+def r(val); a,b,*c = *yield(); test_ok([a,b,c] == val, 2); end
+r([[],nil,[]]){next *[[]]}
+r([1,2,[]]){next *[1,2]}
+r([1,2,[]]){next *[*[1,2]]}
+
+test_check "condition"
+
+$x = '0';
+
+$x == $x && test_ok(true)
+$x != $x && test_ok(false)
+$x == $x || test_ok(false)
+$x != $x || test_ok(true)
+
+# first test to see if we can run the tests.
+
+test_check "if/unless";
+
+$x = 'test';
+test_ok(if $x == $x then true else false end)
+$bad = false
+unless $x == $x
+ $bad = true
+end
+test_ok(!$bad)
+test_ok(unless $x != $x then true else false end)
+
+test_check "case"
+
+case 5
+when 1, 2, 3, 4, 6, 7, 8
+ test_ok(false)
+when 5
+ test_ok(true)
+end
+
+case 5
+when 5
+ test_ok(true)
+when 1..10
+ test_ok(false)
+end
+
+case 5
+when 1..10
+ test_ok(true)
+else
+ test_ok(false)
+end
+
+case 5
+when 5
+ test_ok(true)
+else
+ test_ok(false)
+end
+
+case "foobar"
+when /^f.*r$/
+ test_ok(true)
+else
+ test_ok(false)
+end
+
+test_check "while/until";
+
+while_tmp = "while_tmp.#{$$}"
+tmp = open(while_tmp, "w")
+tmp.print "tvi925\n";
+tmp.print "tvi920\n";
+tmp.print "vt100\n";
+tmp.print "Amiga\n";
+tmp.print "paper\n";
+tmp.close
+
+# test break
+
+tmp = open(while_tmp, "r")
+test_ok(tmp.kind_of?(File))
+
+while line = tmp.gets()
+ break if /vt100/ =~ line
+end
+
+test_ok(!tmp.eof? && /vt100/ =~ line)
+tmp.close
+
+# test next
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+ next if /vt100/ =~ line
+ $bad = 1 if /vt100/ =~ line
+end
+test_ok(!(!tmp.eof? || /vt100/ =~ line || $bad))
+tmp.close
+
+# test redo
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+ lastline = line
+ line = line.gsub(/vt100/, 'VT100')
+ if lastline != line
+ line.gsub!('VT100', 'Vt100')
+ redo
+ end
+ $bad = 1 if /vt100/ =~ line
+ $bad = 1 if /VT100/ =~ line
+end
+test_ok(tmp.eof? && !$bad)
+tmp.close
+
+sum=0
+for i in 1..10
+ sum += i
+ i -= 1
+ if i > 0
+ redo
+ end
+end
+test_ok(sum == 220)
+
+# test interval
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+ break if 3
+ case line
+ when /vt100/, /Amiga/, /paper/
+ $bad = true
+ end
+end
+test_ok(!$bad)
+tmp.close
+
+File.unlink while_tmp or `/bin/rm -f "#{while_tmp}"`
+test_ok(!File.exist?(while_tmp))
+
+i = 0
+until i>4
+ i+=1
+end
+test_ok(i>4)
+
+
+# exception handling
+test_check "exception";
+
+begin
+ raise "this must be handled"
+ test_ok(false)
+rescue
+ test_ok(true)
+end
+
+$bad = true
+begin
+ raise "this must be handled no.2"
+rescue
+ if $bad
+ $bad = false
+ retry
+ test_ok(false)
+ end
+end
+test_ok(true)
+
+# exception in rescue clause
+$string = "this must be handled no.3"
+begin
+ begin
+ raise "exception in rescue clause"
+ rescue
+ raise $string
+ end
+ test_ok(false)
+rescue => e
+ test_ok($! == e)
+ test_ok(e.message == $string)
+ test_ok(e != $string)
+end
+
+# exception in ensure clause
+begin
+ begin
+ raise "this must be handled no.4"
+ ensure
+ raise "exception in ensure clause"
+ end
+ test_ok(false)
+rescue
+ test_ok(true)
+end
+
+$bad = true
+begin
+ begin
+ raise "this must be handled no.5"
+ ensure
+ $bad = false
+ end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+begin
+ begin
+ raise "this must be handled no.6"
+ ensure
+ $bad = false
+ end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+while true
+ begin
+ break
+ ensure
+ $bad = false
+ end
+end
+test_ok(!$bad)
+
+test_ok(catch(:foo) {
+ loop do
+ loop do
+ throw :foo, true
+ break
+ end
+ break
+ test_ok(false) # should not reach here
+ end
+ false
+ })
+
+test_check "array"
+test_ok([1, 2] + [3, 4] == [1, 2, 3, 4])
+test_ok([1, 2] * 2 == [1, 2, 1, 2])
+test_ok([1, 2] * ":" == "1:2")
+
+test_ok([1, 2].hash == [1, 2].hash)
+
+test_ok([1,2,3] & [2,3,4] == [2,3])
+test_ok([1,2,3] | [2,3,4] == [1,2,3,4])
+test_ok([1,2,3] - [2,3] == [1])
+
+$x = [0, 1, 2, 3, 4, 5]
+test_ok($x[2] == 2)
+test_ok($x[1..3] == [1, 2, 3])
+test_ok($x[1,3] == [1, 2, 3])
+
+$x[0, 2] = 10
+test_ok($x[0] == 10 && $x[1] == 2)
+
+$x[0, 0] = -1
+test_ok($x[0] == -1 && $x[1] == 10)
+
+$x[-1, 1] = 20
+test_ok($x[-1] == 20 && $x.pop == 20)
+
+# array and/or
+test_ok(([1,2,3]&[2,4,6]) == [2])
+test_ok(([1,2,3]|[2,4,6]) == [1,2,3,4,6])
+
+# compact
+$x = [nil, 1, nil, nil, 5, nil, nil]
+$x.compact!
+test_ok($x == [1, 5])
+
+# uniq
+$x = [1, 1, 4, 2, 5, 4, 5, 1, 2]
+$x.uniq!
+test_ok($x == [1, 4, 2, 5])
+
+# empty?
+test_ok(!$x.empty?)
+$x = []
+test_ok($x.empty?)
+
+# sort
+$x = ["it", "came", "to", "pass", "that", "..."]
+$x = $x.sort.join(" ")
+test_ok($x == "... came it pass that to")
+$x = [2,5,3,1,7]
+$x.sort!{|a,b| a<=>b} # sort with condition
+test_ok($x == [1,2,3,5,7])
+$x.sort!{|a,b| b-a} # reverse sort
+test_ok($x == [7,5,3,2,1])
+
+# split test
+$x = "The Book of Mormon"
+test_ok($x.split(//).reverse!.join == $x.reverse)
+test_ok($x.reverse == $x.reverse!)
+test_ok("1 byte string".split(//).reverse.join(":") == "g:n:i:r:t:s: :e:t:y:b: :1")
+$x = "a b c d"
+test_ok($x.split == ['a', 'b', 'c', 'd'])
+test_ok($x.split(' ') == ['a', 'b', 'c', 'd'])
+test_ok(defined? "a".chomp)
+test_ok("abc".scan(/./) == ["a", "b", "c"])
+test_ok("1a2b3c".scan(/(\d.)/) == [["1a"], ["2b"], ["3c"]])
+# non-greedy match
+test_ok("a=12;b=22".scan(/(.*?)=(\d*);?/) == [["a", "12"], ["b", "22"]])
+
+$x = [1]
+test_ok(($x * 5).join(":") == '1:1:1:1:1')
+test_ok(($x * 1).join(":") == '1')
+test_ok(($x * 0).join(":") == '')
+
+*$x = *(1..7).to_a
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+$x = [1,2,3]
+$x[1,0] = $x
+test_ok($x == [1,1,2,3,2,3])
+
+$x = [1,2,3]
+$x[-1,0] = $x
+test_ok($x == [1,2,1,2,3,3])
+
+$x = [1,2,3]
+$x.concat($x)
+test_ok($x == [1,2,3,1,2,3])
+
+test_check "hash"
+$x = {1=>2, 2=>4, 3=>6}
+
+test_ok($x[1] == 2)
+
+test_ok(begin
+ for k,v in $x
+ raise if k*2 != v
+ end
+ true
+ rescue
+ false
+ end)
+
+test_ok($x.length == 3)
+test_ok($x.has_key?(1))
+test_ok($x.has_value?(4))
+test_ok($x.values_at(2,3) == [4,6])
+test_ok($x == {1=>2, 2=>4, 3=>6})
+
+$z = $x.keys.sort.join(":")
+test_ok($z == "1:2:3")
+
+$z = $x.values.sort.join(":")
+test_ok($z == "2:4:6")
+test_ok($x == $x)
+
+$x.shift
+test_ok($x.length == 2)
+
+$z = [1,2]
+$x[$z] = 256
+test_ok($x[$z] == 256)
+
+$x = Hash.new(0)
+$x[1] = 1
+test_ok($x[1] == 1)
+test_ok($x[2] == 0)
+
+$x = Hash.new([])
+test_ok($x[22] == [])
+test_ok($x[22].equal?($x[22]))
+
+$x = Hash.new{[]}
+test_ok($x[22] == [])
+test_ok(!$x[22].equal?($x[22]))
+
+$x = Hash.new{|h,k| $z = k; h[k] = k*2}
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+$x.default = 5
+test_ok($x[23] == 5)
+
+$x = Hash.new
+def $x.default(k)
+ $z = k
+ self[k] = k*2
+end
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+
+test_check "iterator"
+
+# yield at top level
+test_ok(!defined?(yield))
+
+$x = [1, 2, 3, 4]
+$y = []
+
+# iterator over array
+for i in $x
+ $y.push i
+end
+test_ok($x == $y)
+
+# nested iterator
+def tt
+ 1.upto(10) {|i|
+ yield i
+ }
+end
+
+i=0
+tt{|i| break if i == 5}
+test_ok(i == 0)
+
+def tt2(dummy)
+ yield 1
+end
+
+def tt3(&block)
+ tt2(raise(ArgumentError,""),&block)
+end
+
+$x = false
+begin
+ tt3{}
+rescue ArgumentError
+ $x = true
+rescue Exception
+end
+test_ok($x)
+
+def tt4 &block
+ tt2(raise(ArgumentError,""),&block)
+end
+$x = false
+begin
+ tt4{}
+rescue ArgumentError
+ $x = true
+rescue Exception
+end
+test_ok($x)
+
+# iterator break/redo/next/retry
+done = true
+loop{
+ break
+ done = false # should not reach here
+}
+test_ok(done)
+
+done = false
+$bad = false
+loop {
+ break if done
+ done = true
+ next
+ $bad = true # should not reach here
+}
+test_ok(!$bad)
+
+done = false
+$bad = false
+loop {
+ break if done
+ done = true
+ redo
+ $bad = true # should not reach here
+}
+test_ok(!$bad)
+
+$x = []
+for i in 1 .. 7
+ $x.push i
+end
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+# append method to built-in class
+class Array
+ def iter_test1
+ collect{|e| [e, yield(e)]}.sort{|a,b|a[1]<=>b[1]}
+ end
+ def iter_test2
+ a = collect{|e| [e, yield(e)]}
+ a.sort{|a,b|a[1]<=>b[1]}
+ end
+end
+$x = [[1,2],[3,4],[5,6]]
+test_ok($x.iter_test1{|x|x} == $x.iter_test2{|x|x})
+
+class IterTest
+ def initialize(e); @body = e; end
+
+ def each0(&block); @body.each(&block); end
+ def each1(&block); @body.each {|*x| block.call(*x) } end
+ def each2(&block); @body.each {|*x| block.call(x) } end
+ def each3(&block); @body.each {|x| block.call(*x) } end
+ def each4(&block); @body.each {|x| block.call(x) } end
+ def each5; @body.each {|*x| yield(*x) } end
+ def each6; @body.each {|*x| yield(x) } end
+ def each7; @body.each {|x| yield(*x) } end
+ def each8; @body.each {|x| yield(x) } end
+
+ def f(a)
+ a
+ end
+end
+test_ok(IterTest.new(nil).method(:f).to_proc.call([1]) == [1])
+m = /\w+/.match("abc")
+test_ok(IterTest.new(nil).method(:f).to_proc.call([m]) == [m])
+
+IterTest.new([0]).each0 {|x| test_ok(x == 0)}
+IterTest.new([1]).each1 {|x| test_ok(x == 1)}
+IterTest.new([2]).each2 {|x| test_ok(x == [2])}
+#IterTest.new([3]).each3 {|x| test_ok(x == 3)}
+IterTest.new([4]).each4 {|x| test_ok(x == 4)}
+IterTest.new([5]).each5 {|x| test_ok(x == 5)}
+IterTest.new([6]).each6 {|x| test_ok(x == [6])}
+#IterTest.new([7]).each7 {|x| test_ok(x == 7)}
+IterTest.new([8]).each8 {|x| test_ok(x == 8)}
+
+IterTest.new([[0]]).each0 {|x| test_ok(x == [0])}
+IterTest.new([[1]]).each1 {|x| test_ok(x == [1])}
+IterTest.new([[2]]).each2 {|x| test_ok(x == [[2]])}
+IterTest.new([[3]]).each3 {|x| test_ok(x == 3)}
+IterTest.new([[4]]).each4 {|x| test_ok(x == [4])}
+IterTest.new([[5]]).each5 {|x| test_ok(x == [5])}
+IterTest.new([[6]]).each6 {|x| test_ok(x == [[6]])}
+IterTest.new([[7]]).each7 {|x| test_ok(x == 7)}
+IterTest.new([[8]]).each8 {|x| test_ok(x == [8])}
+
+IterTest.new([[0,0]]).each0 {|*x| test_ok(x == [[0,0]])}
+IterTest.new([[8,8]]).each8 {|*x| test_ok(x == [[8,8]])}
+
+def m0(v)
+ v
+end
+
+def m1
+ m0(block_given?)
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+def m
+ m0(block_given?,&Proc.new{})
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+class C
+ include Enumerable
+ def initialize
+ @a = [1,2,3]
+ end
+ def each(&block)
+ @a.each(&block)
+ end
+end
+
+test_ok(C.new.collect{|n| n} == [1,2,3])
+
+test_ok(Proc == lambda{}.class)
+test_ok(Proc == Proc.new{}.class)
+lambda{|a|test_ok(a==1)}.call(1)
+def block_test(klass, &block)
+ test_ok(klass === block)
+end
+
+block_test(NilClass)
+block_test(Proc){}
+
+def call_argument_test(state, proc, *args)
+ x = state
+ begin
+ proc.call(*args)
+ rescue ArgumentError
+ x = !x
+ end
+ test_ok(x,2)
+end
+
+call_argument_test(true, lambda{||})
+call_argument_test(false, lambda{||}, 1)
+call_argument_test(true, lambda{|a,|}, 1)
+call_argument_test(false, lambda{|a,|})
+call_argument_test(false, lambda{|a,|}, 1,2)
+
+call_argument_test(true, Proc.new{||})
+call_argument_test(true, Proc.new{||}, 1)
+call_argument_test(true, Proc.new{|a,|}, 1)
+call_argument_test(true, Proc.new{|a,|})
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+def block_get(&block)
+ block
+end
+
+test_ok(Proc == block_get{}.class)
+call_argument_test(true, block_get{||})
+call_argument_test(true, block_get{||}, 1)
+call_argument_test(true, block_get{|a,|}, 1)
+call_argument_test(true, block_get{|a,|})
+call_argument_test(true, block_get{|a,|}, 1,2)
+
+call_argument_test(true, block_get(&lambda{||}))
+call_argument_test(false, block_get(&lambda{||}),1)
+call_argument_test(true, block_get(&lambda{|a,|}),1)
+call_argument_test(false, block_get(&lambda{|a,|}),1,2)
+
+blk = block_get{11}
+test_ok(blk.class == Proc)
+test_ok(blk.to_proc.class == Proc)
+test_ok(blk.clone.call == 11)
+test_ok(block_get(&blk).class == Proc)
+
+lmd = lambda{44}
+test_ok(lmd.class == Proc)
+test_ok(lmd.to_proc.class == Proc)
+test_ok(lmd.clone.call == 44)
+test_ok(block_get(&lmd).class == Proc)
+
+test_ok(Proc.new{|a,| a}.yield(1,2,3) == 1)
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+test_ok(Proc.new{|&b| b.call(10)}.call {|x| x} == 10)
+test_ok(Proc.new{|a,&b| b.call(a)}.call(12) {|x| x} == 12)
+
+def test_return1
+ Proc.new {
+ return 55
+ }.yield + 5
+end
+test_ok(test_return1() == 55)
+def test_return2
+ lambda {
+ return 55
+ }.call + 5
+end
+test_ok(test_return2() == 60)
+
+def proc_call(&b)
+ b.call
+end
+def proc_yield()
+ yield
+end
+def proc_return1
+ lambda{return 42}.call+1
+end
+test_ok(proc_return1() == 43)
+def proc_return2
+ ->{return 42}.call+1
+end
+test_ok(proc_return2() == 43)
+def proc_return3
+ proc_call{return 42}+1
+end
+test_ok(proc_return3() == 42)
+def proc_return4
+ proc_yield{return 42}+1
+end
+test_ok(proc_return4() == 42)
+
+def ljump_test(state, proc, *args)
+ x = state
+ begin
+ proc.call(*args)
+ rescue LocalJumpError
+ x = !x
+ end
+ test_ok(x,2)
+end
+
+ljump_test(false, block_get{break})
+ljump_test(true, lambda{break})
+
+def exit_value_test(&block)
+ block.call
+rescue LocalJumpError
+ $!.exit_value
+end
+
+test_ok(45 == exit_value_test{break 45})
+
+test_ok(55 == begin
+ block_get{break 55}.call
+ rescue LocalJumpError
+ $!.exit_value
+ end)
+
+def block_call(&block)
+ block.call
+end
+
+def test_b1
+ block_call{break 11}
+end
+test_ok(test_b1() == 11)
+
+def ljump_rescue(r)
+ begin
+ yield
+ rescue LocalJumpError => e
+ r if /from proc-closure/ =~ e.message
+ end
+end
+
+def test_b2
+ ljump_rescue(22) do
+ block_get{break 21}.call
+ end
+end
+test_ok(test_b2() == 22)
+
+def test_b3
+ ljump_rescue(33) do
+ Proc.new{break 31}.yield
+ end
+end
+test_ok(test_b3() == 33)
+
+def test_b4
+ lambda{break 44}.call
+end
+test_ok(test_b4() == 44)
+
+def test_b5
+ ljump_rescue(55) do
+ b = block_get{break 54}
+ block_call(&b)
+ end
+end
+test_ok(test_b5() == 55)
+
+def test_b6
+ b = lambda{break 67}
+ block_call(&b)
+ 66
+end
+test_ok(test_b6() == 66)
+
+def util_r7
+ block_get{break 78}
+end
+
+def test_b7
+ b = util_r7()
+ ljump_rescue(77) do
+ block_call(&b)
+ end
+end
+test_ok(test_b7() == 77)
+
+def util_b8(&block)
+ block_call(&block)
+end
+
+def test_b8
+ util_b8{break 88}
+end
+test_ok(test_b8() == 88)
+
+def util_b9(&block)
+ lambda{block.call; 98}.call
+end
+
+def test_b9
+ util_b9{break 99}
+end
+test_ok(test_b9() == 99)
+
+def util_b10
+ util_b9{break 100}
+end
+
+def test_b10
+ util_b10()
+end
+test_ok(test_b10() == 100)
+
+def test_b11
+ ljump_rescue(111) do
+ loop do
+ Proc.new{break 110}.yield
+ break 112
+ end
+ end
+end
+test_ok(test_b11() == 111)
+
+def test_b12
+ loop do
+ break lambda{break 122}.call
+ break 121
+ end
+end
+test_ok(test_b12() == 122)
+
+def test_b13
+ ljump_rescue(133) do
+ while true
+ Proc.new{break 130}.yield
+ break 131
+ end
+ end
+end
+test_ok(test_b13() == 133)
+
+def test_b14
+ while true
+ break lambda{break 144}.call
+ break 143
+ end
+end
+test_ok(test_b14() == 144)
+
+def test_b15
+ [0].each {|c| yield 1 }
+ 156
+end
+test_ok(test_b15{|e| break 155 } == 155)
+
+def marity_test(m)
+ method = method(m)
+ test_ok(method.arity == method.to_proc.arity, 2)
+end
+marity_test(:test_ok)
+marity_test(:marity_test)
+marity_test(:p)
+
+class ITER_TEST1
+ def a
+ block_given?
+ end
+end
+
+class ITER_TEST2 < ITER_TEST1
+ def a
+ test_ok(super)
+ super
+ end
+end
+test_ok(ITER_TEST2.new.a {})
+
+class ITER_TEST3
+ def foo x
+ return yield if block_given?
+ x
+ end
+end
+
+class ITER_TEST4 < ITER_TEST3
+ def foo x
+ test_ok(super == yield)
+ test_ok(super(x, &nil) == x)
+ end
+end
+
+ITER_TEST4.new.foo(44){55}
+
+class ITER_TEST5
+ def tt(aa)
+ aa
+ end
+
+ def uu(a)
+ class << self
+ define_method(:tt) do |sym|
+ super(sym)
+ end
+ end
+ end
+
+ def xx(*x)
+ x.size
+ end
+end
+
+a = ITER_TEST5.new
+a.uu(12)
+test_ok(a.tt(1) == 1)
+
+class ITER_TEST6 < ITER_TEST5
+ def xx(*a)
+ a << 12
+ super
+ end
+end
+
+test_ok(ITER_TEST6.new.xx([24]) == 2)
+
+test_check "float"
+test_ok(2.6.floor == 2)
+test_ok((-2.6).floor == -3)
+test_ok(2.6.ceil == 3)
+test_ok((-2.6).ceil == -2)
+test_ok(2.6.truncate == 2)
+test_ok((-2.6).truncate == -2)
+test_ok(2.6.round == 3)
+test_ok((-2.4).truncate == -2)
+test_ok((13.4 % 1 - 0.4).abs < 0.0001)
+nan = 0.0/0
+def nan_test(x,y)
+ test_ok(x != y)
+ test_ok((x < y) == false)
+ test_ok((x > y) == false)
+ test_ok((x <= y) == false)
+ test_ok((x >= y) == false)
+end
+nan_test(nan, nan)
+nan_test(nan, 0)
+nan_test(nan, 1)
+nan_test(nan, -1)
+nan_test(nan, 1000)
+nan_test(nan, -1000)
+nan_test(nan, 1_000_000_000_000)
+nan_test(nan, -1_000_000_000_000)
+nan_test(nan, 100.0);
+nan_test(nan, -100.0);
+nan_test(nan, 0.001);
+nan_test(nan, -0.001);
+nan_test(nan, 1.0/0);
+nan_test(nan, -1.0/0);
+
+#s = "3.7517675036461267e+17"
+#test_ok(s == sprintf("%.16e", s.to_f))
+f = 3.7517675036461267e+17
+test_ok(f == sprintf("%.16e", f).to_f)
+
+
+test_check "bignum"
+def fact(n)
+ return 1 if n == 0
+ f = 1
+ while n>0
+ f *= n
+ n -= 1
+ end
+ return f
+end
+$x = fact(40)
+test_ok($x == $x)
+test_ok($x == fact(40))
+test_ok($x < $x+2)
+test_ok($x > $x-2)
+test_ok($x == 815915283247897734345611269596115894272000000000)
+test_ok($x != 815915283247897734345611269596115894272000000001)
+test_ok($x+1 == 815915283247897734345611269596115894272000000001)
+test_ok($x/fact(20) == 335367096786357081410764800000)
+$x = -$x
+test_ok($x == -815915283247897734345611269596115894272000000000)
+test_ok(2-(2**32) == -(2**32-2))
+test_ok(2**32 - 5 == (2**32-3)-2)
+
+$good = true;
+for i in 1000..1014
+ $good = false if ((1 << i) != (2**i))
+end
+test_ok($good)
+
+$good = true;
+n1= 1 << 1000
+for i in 1000..1014
+ $good = false if ((1 << i) != n1)
+ n1 *= 2
+end
+test_ok($good)
+
+$good = true;
+n2=n1
+for i in 1..10
+ n1 = n1 / 2
+ n2 = n2 >> 1
+ $good = false if (n1 != n2)
+end
+test_ok($good)
+
+$good = true;
+for i in 4000..4096
+ n1 = 1 << i;
+ if (n1**2-1) / (n1+1) != (n1-1)
+ $good = false
+ end
+end
+test_ok($good)
+
+b = 10**80
+a = b * 9 + 7
+test_ok(7 == a.modulo(b))
+test_ok(-b + 7 == a.modulo(-b))
+test_ok(b + -7 == (-a).modulo(b))
+test_ok(-7 == (-a).modulo(-b))
+test_ok(7 == a.remainder(b))
+test_ok(7 == a.remainder(-b))
+test_ok(-7 == (-a).remainder(b))
+test_ok(-7 == (-a).remainder(-b))
+
+test_ok(10**40+10**20 == 10000000000000000000100000000000000000000)
+test_ok(10**40/10**20 == 100000000000000000000)
+
+a = 677330545177305025495135714080
+b = 14269972710765292560
+test_ok(a % b == 0)
+test_ok(-a % b == 0)
+
+def shift_test(a)
+ b = a / (2 ** 32)
+ c = a >> 32
+ test_ok(b == c)
+
+ b = a * (2 ** 32)
+ c = a << 32
+ test_ok(b == c)
+end
+
+shift_test(-4518325415524767873)
+shift_test(-0xfffffffffffffffff)
+
+test_check "string & char"
+
+test_ok("abcd" == "abcd")
+test_ok("abcd" =~ /abcd/)
+test_ok("abcd" === "abcd")
+# compile time string concatenation
+test_ok("ab" "cd" == "abcd")
+test_ok("#{22}aa" "cd#{44}" == "22aacd44")
+test_ok("#{22}aa" "cd#{44}" "55" "#{66}" == "22aacd445566")
+test_ok("abc" !~ /^$/)
+test_ok("abc\n" !~ /^$/)
+test_ok("abc" !~ /^d*$/)
+test_ok(("abc" =~ /d*$/) == 3)
+test_ok("" =~ /^$/)
+test_ok("\n" =~ /^$/)
+test_ok("a\n\n" =~ /^$/)
+test_ok("abcabc" =~ /.*a/ && $& == "abca")
+test_ok("abcabc" =~ /.*c/ && $& == "abcabc")
+test_ok("abcabc" =~ /.*?a/ && $& == "a")
+test_ok("abcabc" =~ /.*?c/ && $& == "abc")
+test_ok(/(.|\n)*?\n(b|\n)/ =~ "a\nb\n\n" && $& == "a\nb")
+
+test_ok(/^(ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(ab+)+/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+/ =~ "ababb" && $& == "ababb")
+
+test_ok(/(\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+test_ok(/(?:\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+
+$x = <<END;
+ABCD
+ABCD
+END
+$x.gsub!(/((.|\n)*?)B((.|\n)*?)D/, '\1\3')
+test_ok($x == "AC\nAC\n")
+
+test_ok("foobar" =~ /foo(?=(bar)|(baz))/)
+test_ok("foobaz" =~ /foo(?=(bar)|(baz))/)
+
+$foo = "abc"
+test_ok("#$foo = abc" == "abc = abc")
+test_ok("#{$foo} = abc" == "abc = abc")
+
+foo = "abc"
+test_ok("#{foo} = abc" == "abc = abc")
+
+test_ok('-' * 5 == '-----')
+test_ok('-' * 1 == '-')
+test_ok('-' * 0 == '')
+
+foo = '-'
+test_ok(foo * 5 == '-----')
+test_ok(foo * 1 == '-')
+test_ok(foo * 0 == '')
+
+$x = "a.gif"
+test_ok($x.sub(/.*\.([^\.]+)$/, '\1') == "gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'b.\1') == "b.gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, '\2') == "")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'a\2b') == "ab")
+test_ok($x.sub(/.*\.([^\.]+)$/, '<\&>') == "<a.gif>")
+
+# character constants(assumes ASCII)
+test_ok("a"[0] == ?a)
+test_ok(?a == ?a)
+test_ok(?\C-a == "\1")
+test_ok(?\M-a == "\341")
+test_ok(?\M-\C-a == "\201")
+test_ok("a".upcase![0] == ?A)
+test_ok("A".downcase![0] == ?a)
+test_ok("abc".tr!("a-z", "A-Z") == "ABC")
+test_ok("aabbcccc".tr_s!("a-z", "A-Z") == "ABC")
+test_ok("abcc".squeeze!("a-z") == "abc")
+test_ok("abcd".delete!("bc") == "ad")
+
+$x = "abcdef"
+$y = [ ?a, ?b, ?c, ?d, ?e, ?f ]
+$bad = false
+$x.each_byte {|i|
+ if i.chr != $y.shift
+ $bad = true
+ break
+ end
+}
+test_ok(!$bad)
+
+s = "a string"
+s[0..s.size]="another string"
+test_ok(s == "another string")
+
+s = <<EOS
+#{
+[1,2,3].join(",")
+}
+EOS
+test_ok(s == "1,2,3\n")
+test_ok("Just".to_i(36) == 926381)
+test_ok("-another".to_i(36) == -23200231779)
+test_ok(1299022.to_s(36) == "ruby")
+test_ok(-1045307475.to_s(36) == "-hacker")
+test_ok("Just_another_Ruby_hacker".to_i(36) == 265419172580680477752431643787347)
+test_ok(-265419172580680477752431643787347.to_s(36) == "-justanotherrubyhacker")
+
+a = []
+(0..255).each {|n|
+ ch = [n].pack("C")
+ a.push ch if /a#{Regexp.quote ch}b/x =~ "ab"
+}
+test_ok(a.size == 0)
+
+test_check "assignment"
+a = nil
+test_ok(defined?(a))
+test_ok(a == nil)
+
+# multiple assignment
+a, b = 1, 2
+test_ok(a == 1 && b == 2)
+
+a, b = b, a
+test_ok(a == 2 && b == 1)
+
+a, = 1,2
+test_ok(a == 1)
+
+a, *b = 1, 2, 3
+test_ok(a == 1 && b == [2, 3])
+
+a, (b, c), d = 1, [2, 3], 4
+test_ok(a == 1 && b == 2 && c == 3 && d == 4)
+
+*a = 1, 2, 3
+test_ok(a == [1, 2, 3])
+
+*a = 4
+test_ok(a == [4])
+
+*a = nil
+test_ok(a == [nil])
+
+test_check "call"
+def aaa(a, b=100, *rest)
+ res = [a, b]
+ res += rest if rest
+ return res
+end
+
+# not enough argument
+begin
+ aaa() # need at least 1 arg
+ test_ok(false)
+rescue
+ test_ok(true)
+end
+
+begin
+ aaa # no arg given (exception raised)
+ test_ok(false)
+rescue
+ test_ok(true)
+end
+
+test_ok(aaa(1) == [1, 100])
+test_ok(aaa(1, 2) == [1, 2])
+test_ok(aaa(1, 2, 3, 4) == [1, 2, 3, 4])
+test_ok(aaa(1, *[2, 3, 4]) == [1, 2, 3, 4])
+
+test_check "proc"
+$proc = Proc.new{|i| i}
+test_ok($proc.call(2) == 2)
+test_ok($proc.call(3) == 3)
+
+$proc = Proc.new{|i| i*2}
+test_ok($proc.call(2) == 4)
+test_ok($proc.call(3) == 6)
+
+Proc.new{
+ iii=5 # nested local variable
+ $proc = Proc.new{|i|
+ iii = i
+ }
+ $proc2 = Proc.new {
+ $x = iii # nested variables shared by procs
+ }
+ # scope of nested variables
+ test_ok(defined?(iii))
+}.call
+test_ok(!defined?(iii)) # out of scope
+
+loop{iii=5; test_ok(eval("defined? iii")); break}
+loop {
+ iii = 10
+ def dyna_var_check
+ loop {
+ test_ok(!defined?(iii))
+ break
+ }
+ end
+ dyna_var_check
+ break
+}
+$x=0
+$proc.call(5)
+$proc2.call
+test_ok($x == 5)
+
+if defined? Process.kill
+ test_check "signal"
+
+ $x = 0
+ trap "SIGINT", Proc.new{|sig| $x = 2}
+ Process.kill "SIGINT", $$
+ 100.times {
+ sleep 0.1
+ break if $x != 0
+ }
+ test_ok($x == 2)
+
+ trap "SIGINT", Proc.new{raise "Interrupt"}
+
+ x = false
+ begin
+ Process.kill "SIGINT", $$
+ sleep 0.1
+ rescue
+ x = $!
+ end
+ test_ok(x && /Interrupt/ =~ x.message)
+end
+
+test_check "eval"
+test_ok(eval("") == nil)
+$bad=false
+eval 'while false; $bad = true; print "foo\n" end'
+test_ok(!$bad)
+
+test_ok(eval('Object'))
+test_ok(eval('true'))
+test_ok(!eval('nil'))
+test_ok(!eval('false'))
+
+$foo = 'test_ok(true)'
+begin
+ eval $foo
+rescue
+ test_ok(false)
+end
+
+test_ok(eval("$foo") == 'test_ok(true)')
+test_ok(eval("true") == true)
+i = 5
+test_ok(eval("i == 5"))
+test_ok(eval("i") == 5)
+test_ok(eval("defined? i"))
+
+# eval with binding
+def test_ev
+ local1 = "local1"
+ lambda {
+ local2 = "local2"
+ return binding
+ }.call
+end
+
+$x = test_ev
+test_ok(eval("local1", $x) == "local1") # normal local var
+test_ok(eval("local2", $x) == "local2") # nested local var
+$bad = true
+begin
+ p eval("local1")
+rescue NameError # must raise error
+ $bad = false
+end
+test_ok(!$bad)
+
+module EvTest
+ EVTEST1 = 25
+ evtest2 = 125
+ $x = binding
+end
+test_ok(eval("EVTEST1", $x) == 25) # constant in module
+test_ok(eval("evtest2", $x) == 125) # local var in module
+$bad = true
+begin
+ eval("EVTEST1")
+rescue NameError # must raise error
+ $bad = false
+end
+test_ok(!$bad)
+
+x = binding #! YARV Limitation: Proc.new{}
+eval "i4 = 1", x
+test_ok(eval("i4", x) == 1)
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "i4 = 22", x
+test_ok(eval("i4", x) == 22)
+$x = []
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+
+x = binding
+eval "i = 1", x
+test_ok(eval("i", x) == 1)
+x = Proc.new{binding}.call
+eval "i = 22", x
+test_ok(eval("i", x) == 22)
+$x = []
+x = Proc.new{binding}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+x = Proc.new{binding}.call
+eval "for i6 in 1..1; j6=i6; end", x
+test_ok(eval("defined? i6", x))
+test_ok(eval("defined? j6", x))
+
+Proc.new {
+ p = binding
+ eval "foo11 = 1", p
+ foo22 = 5
+ Proc.new{foo11=22}.call
+ Proc.new{foo22=55}.call
+ test_ok(eval("foo11", p) == eval("foo11"))
+ test_ok(eval("foo11") == 1)
+ test_ok(eval("foo22", p) == eval("foo22"))
+ test_ok(eval("foo22") == 55)
+}.call if false #! YARV Limitation
+
+#! YARV Limitation: p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+p1 = Proc.new{i7 = 0; binding}.call
+#! YARV Limitation: test_ok(p1.call == 0)
+eval "i7=5", p1
+#! YARV Limitation: test_ok(p1.call == 5)
+test_ok(!defined?(i7))
+
+if false #! YARV Limitation
+p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+i7 = nil
+test_ok(p1.call == 0)
+eval "i7=1", p1
+test_ok(p1.call == 1)
+eval "i7=5", p1
+test_ok(p1.call == 5)
+test_ok(i7 == nil)
+end
+
+# WASI doesn't support spawning a new process for now.
+unless /wasi/ =~ RUBY_PLATFORM
+test_check "system"
+test_ok(`echo foobar` == "foobar\n")
+test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
+
+script_tmp = "script_tmp.#{$$}"
+tmp = open(script_tmp, "w")
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby -s #{script_tmp} -zzz` == 'true')
+test_ok(`./miniruby -s #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby #{script_tmp} -zzz=678` == '678')
+
+tmp = open(script_tmp, "w")
+tmp.print "this is a leading junk\n";
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.print "__END__\n";
+tmp.print "this is a trailing junk\n";
+tmp.close
+
+test_ok(`./miniruby -x #{script_tmp}` == '')
+test_ok(`./miniruby -x #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+for i in 1..5
+ tmp.print i, "\n"
+end
+tmp.close
+
+`./miniruby -i.bak -pe '$_.sub!(/^[0-9]+$/){$&.to_i * 5}' #{script_tmp}`
+done = true
+tmp = open(script_tmp, "r")
+while tmp.gets
+ if $_.to_i % 5 != 0
+ done = false
+ break
+ end
+end
+tmp.close
+test_ok(done)
+
+File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
+File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
+end # not /wasi/ =~ RUBY_PLATFORM
+
+test_check "const"
+TEST1 = 1
+TEST2 = 2
+
+module Const
+ TEST3 = 3
+ TEST4 = 4
+end
+
+module Const2
+ TEST3 = 6
+ TEST4 = 8
+end
+
+include Const
+
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,3,4])
+
+include Const2
+STDERR.print "intentionally redefines TEST3, TEST4\n" if $VERBOSE
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,6,8])
+
+
+test_ok((String <=> Object) == -1)
+test_ok((Object <=> String) == 1)
+test_ok((Array <=> String) == nil)
+
+test_check "clone"
+foo = Object.new
+def foo.test
+ "test"
+end
+bar = foo.clone
+def bar.test2
+ "test2"
+end
+
+test_ok(bar.test2 == "test2")
+test_ok(bar.test == "test")
+test_ok(foo.test == "test")
+
+begin
+ foo.test2
+ test_ok false
+rescue NoMethodError
+ test_ok true
+end
+
+module M001; end
+module M002; end
+module M003; include M002; end
+module M002; include M001; end
+module M003; include M002; end
+
+test_ok(M003.ancestors == [M003, M002, M001])
+
+test_check "marshal"
+$x = [1,2,3,[4,5,"foo"],{1=>"bar"},2.5,fact(30)]
+$y = Marshal.dump($x)
+test_ok($x == Marshal.load($y))
+
+StrClone=String.clone;
+test_ok(Marshal.load(Marshal.dump(StrClone.new("abc"))).class == StrClone)
+
+[[1,2,3,4], [81, 2, 118, 3146]].each { |w,x,y,z|
+ a = (x.to_f + y.to_f / z.to_f) * Math.exp(w.to_f / (x.to_f + y.to_f / z.to_f))
+ ma = Marshal.dump(a)
+ b = Marshal.load(ma)
+ test_ok(a == b)
+}
+
+test_check "pack"
+
+$format = "c2x5CCxsdils_l_a6";
+# Need the expression in here to force ary[5] to be numeric. This avoids
+# test2 failing because ary2 goes str->numeric->str and ary does not.
+ary = [1,-100,127,128,32767,987.654321098 / 100.0,12345,123456,-32767,-123456,"abcdef"]
+$x = ary.pack($format)
+ary2 = $x.unpack($format)
+
+test_ok(ary.length == ary2.length)
+test_ok(ary.join(':') == ary2.join(':'))
+test_ok($x =~ /def/)
+
+$x = [-1073741825]
+test_ok($x.pack("q").unpack("q") == $x)
+
+test_check "math"
+test_ok(Math.sqrt(4) == 2)
+
+include Math
+test_ok(sqrt(4) == 2)
+
+test_check "struct"
+struct_test = Struct.new("Test", :foo, :bar)
+test_ok(struct_test == Struct::Test)
+
+test = struct_test.new(1, 2)
+test_ok(test.foo == 1 && test.bar == 2)
+test_ok(test[0] == 1 && test[1] == 2)
+
+a, b = test.to_a
+test_ok(a == 1 && b == 2)
+
+test[0] = 22
+test_ok(test.foo == 22)
+
+test.bar = 47
+test_ok(test.bar == 47)
+
+test_check "variable"
+test_ok($$.instance_of?(Integer))
+
+# read-only variable
+begin
+ $$ = 5
+ test_ok false
+rescue NameError
+ test_ok true
+end
+
+foobar = "foobar"
+$_ = foobar
+test_ok($_ == foobar)
+
+class Gods
+ @@rule = "Uranus"
+ def ruler0
+ @@rule
+ end
+
+ def self.ruler1 # <= per method definition style
+ @@rule
+ end
+ class << self # <= multiple method definition style
+ def ruler2
+ @@rule
+ end
+ end
+end
+
+module Olympians
+ @@rule ="Zeus"
+ def ruler3
+ @@rule
+ end
+end
+
+class Titans < Gods
+ @@rule = "Cronus" # modifies @@rule in Gods
+ include Olympians
+ def ruler4
+ @@rule
+ end
+end
+
+test_ok(Gods.new.ruler0 == "Cronus")
+test_ok(Gods.ruler1 == "Cronus")
+test_ok(Gods.ruler2 == "Cronus")
+test_ok(Titans.ruler1 == "Cronus")
+test_ok(Titans.ruler2 == "Cronus")
+atlas = Titans.new
+test_ok(atlas.ruler0 == "Cronus")
+test_ok(atlas.ruler3 == "Zeus")
+begin
+ atlas.ruler4
+rescue RuntimeError => e
+ test_ok(e.message.include?("class variable @@rule of Olympians is overtaken by Gods"))
+else
+ test_ok(false)
+end
+test_ok(atlas.ruler3 == "Zeus")
+
+test_check "trace"
+$x = 1234
+$y = 0
+trace_var :$x, Proc.new{$y = $x}
+$x = 40414
+test_ok($y == $x)
+
+untrace_var :$x
+$x = 19660208
+test_ok($y != $x)
+
+trace_var :$x, Proc.new{$x *= 2}
+$x = 5
+test_ok($x == 10)
+
+untrace_var :$x
+
+test_check "defined?"
+
+test_ok(defined?($x)) # global variable
+test_ok(defined?($x) == 'global-variable')# returns description
+
+foo=5
+test_ok(defined?(foo)) # local variable
+
+test_ok(defined?(Array)) # constant
+test_ok(defined?(Object.new)) # method
+test_ok(!defined?(Object.print))# private method
+test_ok(defined?(1 == 2)) # operator expression
+
+class Foo
+ def foo
+ p :foo
+ end
+ protected :foo
+ def bar(f)
+ test_ok(defined?(self.foo))
+ test_ok(defined?(f.foo))
+ end
+end
+f = Foo.new
+test_ok(defined?(f.foo) == nil)
+f.bar(f)
+
+def defined_test
+ return !defined?(yield)
+end
+
+test_ok(defined_test) # not iterator
+test_ok(!defined_test{}) # called as iterator
+
+test_check "alias"
+class Alias0
+ def foo; "foo" end
+end
+class Alias1 < Alias0
+ alias bar foo
+ def foo; "foo+" + super end
+end
+class Alias2 < Alias1
+ alias baz foo
+ undef foo
+end
+
+x = Alias2.new
+test_ok(x.bar == "foo")
+test_ok(x.baz == "foo+foo")
+
+# test_check for cache
+test_ok(x.baz == "foo+foo")
+
+class Alias3 < Alias2
+ def foo
+ defined? super
+ end
+ def bar
+ defined? super
+ end
+ def quux
+ defined? super
+ end
+end
+x = Alias3.new
+test_ok(!x.foo)
+test_ok(x.bar)
+test_ok(!x.quux)
+
+test_check "path"
+test_ok(File.basename("a") == "a")
+test_ok(File.basename("a/b") == "b")
+test_ok(File.basename("a/b/") == "b")
+test_ok(File.basename("/") == "/")
+test_ok(File.basename("//") == "/")
+test_ok(File.basename("///") == "/")
+test_ok(File.basename("a/b////") == "b")
+test_ok(File.basename("a.rb", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".*") == "a")
+test_ok(File.basename("a.rb///", ".c") == "a.rb")
+test_ok(File.dirname("a") == ".")
+test_ok(File.dirname("/") == "/")
+test_ok(File.dirname("/a") == "/")
+test_ok(File.dirname("a/b") == "a")
+test_ok(File.dirname("a/b/c") == "a/b")
+test_ok(File.dirname("/a/b/c") == "/a/b")
+test_ok(File.dirname("/a/b/") == "/a")
+test_ok(File.dirname("/a/b///") == "/a")
+case Dir.pwd
+when %r'\A\w:'
+ test_ok(/\A\w:\/\z/ =~ File.expand_path(".", "/"))
+ test_ok(/\A\w:\/a\z/ =~ File.expand_path("a", "/"))
+ dosish = true
+when %r'\A//'
+ test_ok(%r'\A//[^/]+/[^/]+\z' =~ File.expand_path(".", "/"))
+ test_ok(%r'\A//[^/]+/[^/]+/a\z' =~ File.expand_path(".", "/"))
+ dosish = true
+else
+ test_ok(File.expand_path(".", "/") == "/")
+ test_ok(File.expand_path("sub", "/") == "/sub")
+end
+if dosish
+ test_ok(File.expand_path("/", "//machine/share/sub") == "//machine/share")
+ test_ok(File.expand_path("/dir", "//machine/share/sub") == "//machine/share/dir")
+ test_ok(File.expand_path("/", "z:/sub") == "z:/")
+ test_ok(File.expand_path("/dir", "z:/sub") == "z:/dir")
+end
+test_ok(File.expand_path(".", "//") == "//")
+test_ok(File.expand_path("sub", "//") == "//sub")
+
+# test_check "Proc#binding"
+ObjectSpace.each_object(Proc){|o|
+ begin
+ b = o.binding
+ eval 'self', b
+ rescue ArgumentError
+ end
+}
+
+test_check "gc"
+begin
+ 1.upto(10000) {
+ tmp = [0,1,2,3,4,5,6,7,8,9]
+ }
+ tmp = nil
+ test_ok true
+rescue
+ test_ok false
+end
+class S
+ def initialize(a)
+ @a = a
+ end
+end
+l=nil
+100000.times {
+ l = S.new(l)
+}
+GC.start
+test_ok true # reach here or dumps core
+l = []
+100000.times {
+ l.push([l])
+}
+GC.start
+test_ok true # reach here or dumps core
+
+ObjectSpace.each_object{|o|
+ o.class.name
+}
+
+test_ok true # reach here or dumps core
+
+PROGRESS.finish
+if $failed > 0
+ printf "not ok/test: %d failed %d\n", $ntest, $failed
+else
+ printf "end of test(test: %d)\n", $ntest
+end
diff --git a/bcc32/Makefile.sub b/bcc32/Makefile.sub
deleted file mode 100644
index 1cd26a8643..0000000000
--- a/bcc32/Makefile.sub
+++ /dev/null
@@ -1,617 +0,0 @@
-# -*- makefile -*-
-
-SHELL = $(COMSPEC)
-MKFILES = Makefile
-
-!ifndef MFLAGS
-MFLAGS=-
-!endif
-
-#### Start of system configuration section. ####
-!ifndef OS
-OS = bccwin32
-!endif
-!if !defined(RT)
-!error RT not defined. Retry from configure pass.
-!endif
-
-arch = $(ARCH)-$(OS)
-
-## variables may be overridden by $(compile_dir)/Makefile
-!ifndef srcdir
-srcdir = ..
-!endif
-!ifndef RUBY_INSTALL_NAME
-RUBY_INSTALL_NAME = ruby
-!endif
-!ifndef RUBYW_INSTALL_NAME
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
-!elif "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
-!endif
-!if "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME)w
-!endif
-!ifndef RUBY_SO_NAME
-RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)$(TEENY)
-!endif
-!ifndef icondirs
-!ifdef ICONDIRS
-icondirs=$(ICONDIRS)
-!endif
-!endif
-!ifdef icondirs
-icondirs=$(icondirs:\=/)
-iconinc=-I$(icondirs: = -I)
-!endif
-###############
-
-.SUFFIXES: .y
-
-!ifndef CC
-CC = bcc32
-!endif
-!ifndef CPP
-CPP = cpp32
-!endif
-!ifndef RC
-RC = brcc32
-!endif
-!ifndef YACC
-YACC = bison
-!endif
-!ifndef AR
-AR = tlib
-!endif
-!ifndef BASERUBY
-BASERUBY = ruby
-!endif
-
-PURIFY =
-AUTOCONF = autoconf
-IFCHANGE = $(srcdir:/=\)\win32\ifchange.bat
-RM = $(srcdir:/=\)\win32\rm.bat
-CP = copy > nul
-MV = move > nul
-
-!if !defined(PROCESSOR_ARCHITECTURE)
-PROCESSOR_ARCHITECTURE = x86
-!endif
-MACHINE = $(PROCESSOR_ARCHITECTURE)
-!if "$(PROCESSOR_ARCHITECTURE)" == "x86"
-!ifndef PROCESSOR_LEVEL
-PROCESSOR_LEVEL = 5
-!endif
-!if 6 < $(PROCESSOR_LEVEL)
-PROCESSOR_LEVEL = 6
-!endif
-PROCESSOR_FLAG = -$(PROCESSOR_LEVEL)
-CPU = i$(PROCESSOR_LEVEL)86
-ARCH = i386
-!else
-CPU = $(PROCESSOR_ARCHITECTURE)
-ARCH = $(PROCESSOR_ARCHITECTURE)
-!endif
-!ifndef DEBUGFLAGS
-DEBUGFLAGS =
-!endif
-!ifndef OPTFLAGS
-OPTFLAGS = -O
-!endif
-
-!ifndef prefix
-prefix = /usr
-!endif
-!ifndef exec_prefix
-exec_prefix = $(prefix)
-!endif
-!ifndef libdir
-libdir = $(exec_prefix)/lib
-!endif
-!if !defined(datadir)
-datadir = $(prefix)/share
-!endif
-!ifndef EXTOUT
-EXTOUT = .ext
-!endif
-!ifndef TESTUI
-TESTUI = console
-!endif
-!ifndef TESTS
-TESTS =
-!endif
-!ifndef RDOCTARGET
-RDOCTARGET = install-doc
-!endif
-
-OUTFLAG = -o
-COUTFLAG = -o
-!ifndef CFLAGS
-CFLAGS = -q -tWR -tWC $(DEBUGFLAGS) $(OPTFLAGS) $(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
-!endif
-!ifndef DEFS
-DEFS =
-!endif
-!ifndef CPPFLAGS
-CPPFLAGS =
-!endif
-CPPFLAGS = $(DEFS) $(CPPFLAGS)
-!ifndef CXXFLAGS
-CXXFLAGS = $(CFLAGS)
-!endif
-!ifndef LDFLAGS
-LDFLAGS = -S:$(STACK)
-!endif
-!ifndef RFLAGS
-RFLAGS = $(iconinc)
-!endif
-!ifndef EXTLIBS
-EXTLIBS =
-!endif
-!ifndef MEMLIB
-MEMLIB =
-!endif
-LIBS = $(MEMLIB) cw32i.lib import32.lib ws2_32.lib $(EXTLIBS)
-MISSING = acosh.obj cbrt.obj crypt.obj erf.obj lgamma_r.obj strlcat.obj strlcpy.obj tgamma.obj win32.obj
-
-!ifndef STACK
-STACK = 0x2000000
-!endif
-
-XCFLAGS = -DRUBY_EXPORT -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir) -I$(srcdir)/missing
-
-ARFLAGS = /a /p32
-LD = ilink32 -q -Gn
-LDSHARED = $(LD)
-XLDFLAGS = -Tpe c0x32.obj
-WLDFLAGS = -aa -Tpe c0w32.obj
-DLDFLAGS = -Tpd c0d32.obj
-LIBRUBY_LDSHARED = $(LDSHARED)
-LIBRUBY_DLDFLAGS = -Gi $(DLDFLAGS) $(EXTLDFLAGS)
-LDOBJECTS = $(MAINOBJ)
-
-SOLIBS =
-
-EXEEXT = .exe
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-WPROGRAM=$(RUBYW_INSTALL_NAME)$(EXEEXT)
-RUBYDEF = $(RUBY_SO_NAME).def
-MINIRUBY = .\miniruby$(EXEEXT) -I$(srcdir)/lib $(MINIRUBYOPT)
-RUNRUBY = .\$(PROGRAM) -i"$(EXTOUT)/$(arch)" "$(srcdir)/runruby.rb" --extout="$(EXTOUT)" --
-
-ORGLIBPATH = $(LIB)
-
-#### End of system configuration section. ####
-
-LIBRUBY_A = $(RUBY_SO_NAME)-static.lib
-LIBRUBY_SO = $(RUBY_SO_NAME).dll
-LIBRUBY = $(RUBY_SO_NAME).lib
-LIBRUBYARG = $(LIBRUBY)
-THREAD_MODEL = win32
-
-PREP = miniruby$(EXEEXT)
-
-OBJEXT = obj
-ASMEXT = asm
-
-INSTALLED_LIST= .installed.list
-
-MKMAIN_CMD = mkmain.bat
-
-SRC_FILE = $(<:\=/)
-
-WINMAINOBJ = winmain.$(OBJEXT)
-ARCHMINIOBJS = dmydln.$(OBJEXT)
-
-arch_hdrdir = $(EXTOUT)/include/$(arch)
-hdrdir = $(srcdir)/include
-VPATH = $(arch_hdrdir)/ruby;$(hdrdir)/ruby;$(srcdir);$(srcdir)/enc;$(srcdir)/missing;$(srcdir)/win32
-
-.path.c = .;$(srcdir);$(srcdir)/enc;$(srcdir)/win32;$(srcdir)/missing
-.path.ci = $(srcdir)
-.path.inc = .;$(srcdir)
-.path.def = .;$(srcdir)
-.path.h = .;$(arch_hdrdir)/ruby;$(hdrdir)/ruby;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
-.path.y = $(srcdir)
-.path. = $(srcdir)
-
-.c.obj:
- $(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) $(COUTFLAG)$@ -c $(<:/=\)
-
-.c.asm:
- $(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) $(COUTFLAG)$@ -S $(<:\=/)
-
-.rc.res:
- $(RC) $(RFLAGS) -I. -I$(<D). $(iconinc) -I$(srcdir)/win32 $(RFLAGS) -fo$@ $(<:/=\)
-
-all: $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
-
-ruby: $(PROGRAM)
-rubyw: $(WPROGRAM)
-
-!include $(srcdir)/common.mk
-
-$(MKFILES): $(srcdir)/bcc32/Makefile.sub $(srcdir)/bcc32/configure.bat $(srcdir)/bcc32/setup.mak
- $(COMSPEC) /C $(srcdir:/=\)\bcc32\configure.bat $(configure_args)
- @echo $(MKFILES) should be updated, re-run $(MAKE).
- @$(MAKE) > nul -q -f &&|
-PHONY: nul
- @exit
-|
-
-PHONY: nul
-
-RUBY_CONFIG_H = $(arch_hdrdir)/ruby/config.h
-CONFIG_H = ./.config.h.time
-
-config: config.status
-
-config.status: $(CONFIG_H)
-
-guard = INCLUDE_RUBY_CONFIG_H
-
-$(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
- @if not exist $(arch_hdrdir:/=\) md $(arch_hdrdir:/=\)
- @if not exist $(arch_hdrdir:/=\)\ruby md $(arch_hdrdir:/=\)\ruby
- @$(IFCHANGE) $(RUBY_CONFIG_H:/=\) &&|
-\#ifndef $(guard)
-\#define $(guard) 1
-\#define NO_BIG_INLINE 1
-\#define HAVE_SYS_TYPES_H 1
-\#define HAVE_SYS_STAT_H 1
-\#define HAVE_STDLIB_H 1
-\#define HAVE_STRING_H 1
-\#define HAVE_MEMORY_H 1
-\#define HAVE_LONG_LONG 1
-\#define HAVE_OFF_T 1
-\#define SIZEOF_INT 4
-\#define SIZEOF_SHORT 2
-\#define SIZEOF_LONG 4
-\#define SIZEOF_LONG_LONG 0
-\#define SIZEOF___INT64 8
-\#define SIZEOF_OFF_T 8
-\#define SIZEOF_VOIDP 4
-\#define SIZEOF_FLOAT 4
-\#define SIZEOF_DOUBLE 8
-\#define SIZEOF_TIME_T 4
-\#define SIZEOF_RLIM_T 0
-\#define SIZEOF_SIZE_T 4
-\#define SIZEOF_PTRDIFF_T 4
-\#define HAVE_PROTOTYPES 1
-\#define TOKEN_PASTE(x,y) x\#\#y
-\#define HAVE_STDARG_PROTOTYPES 1
-\#define NORETURN(x) x
-\#define RUBY_EXTERN extern __declspec(dllimport)
-\#define HAVE_DECL_SYS_NERR 1
-\#define HAVE_LIMITS_H 1
-\#define HAVE_FCNTL_H 1
-\#define HAVE_UTIME_H 1
-\#define HAVE_FLOAT_H 1
-\#define rb_uid_t uid_t
-\#define rb_gid_t gid_t
-\#define rb_pid_t int
-\#define HAVE_STRUCT_STAT_ST_RDEV 1
-\#define HAVE_ST_RDEV 1
-!if $(BORLANDC) < 0x0580
-\#define int8_t signed char
-\#define uint8_t unsigned char
-\#define int16_t short
-\#define uint16_t unsigned short
-\#define int32_t int
-\#define uint32_t unsigned int
-\#define int64_t __int64
-\#define uint64_t unsigned __int64
-\#define ssize_t int
-!endif
-\#define HAVE_INT8_T 1
-\#define HAVE_UINT8_T 1
-\#define SIZEOF_INT8_T 1
-\#define HAVE_INT16_T 1
-\#define HAVE_UINT16_T 1
-\#define SIZEOF_INT32_T 2
-\#define HAVE_INT32_T 1
-\#define HAVE_UINT32_T 1
-\#define SIZEOF_INT32_T 4
-\#define HAVE_INT64_T 1
-\#define HAVE_UINT64_T 1
-\#define SIZEOF_INT64_T 8
-\#define HAVE_INTPTR_T 1
-\#define HAVE_UINTPTR_T 1
-\#define HAVE_SSIZE_T 1
-\#define GETGROUPS_T int
-\#define RETSIGTYPE void
-\#define HAVE_ALLOCA 1
-\#define HAVE_DUP2 1
-\#define HAVE_MEMMOVE 1
-\#define HAVE_MKDIR 1
-\#define HAVE_STRCASECMP 1
-\#define HAVE_STRNCASECMP 1
-\#define HAVE_STRERROR 1
-\#define HAVE_STRFTIME 1
-\#define HAVE_STRCHR 1
-\#define HAVE_STRSTR 1
-\#define HAVE_STRTOD 1
-\#define HAVE_STRTOL 1
-\#define HAVE_STRTOUL 1
-\#define HAVE_SNPRINTF 1
-\#define HAVE_VSNPRINTF 1
-\#define HAVE_ISNAN 1
-\#define HAVE_FINITE 1
-\#define HAVE_HYPOT 1
-\#define HAVE_FMOD 1
-\#define HAVE_WAITPID 1
-\#define HAVE_FSYNC 1
-\#define HAVE_GETCWD 1
-\#define HAVE_TRUNCATE 1
-\#define HAVE_FTRUNCATE 1
-\#define HAVE_FSEEKO 1
-\#define HAVE_FTELLO 1
-\#define HAVE_TIMES 1
-\#define HAVE_FCNTL 1
-\#define HAVE_LINK 1
-\#define HAVE_TELLDIR 1
-\#define HAVE_SEEKDIR 1
-\#define HAVE_COSH 1
-\#define HAVE_SINH 1
-\#define HAVE_TANH 1
-\#define RSHIFT(x,y) ((x)>>(int)y)
-\#define FILE_COUNT level
-\#define FILE_READPTR curp
-\#define RUBY_SETJMP(env) setjmp(env)
-\#define RUBY_LONGJMP(env,val) longjmp(env,val)
-\#define RUBY_JMP_BUF jmp_buf
-\#define inline __inline
-\#define NEED_IO_SEEK_BETWEEN_RW 1
-\#define STACK_GROW_DIRECTION -1
-\#define DEFAULT_KCODE KCODE_NONE
-\#define LOAD_RELATIVE 1
-\#define DLEXT ".so"
-\#define RUBY_LIB_PREFIX "/lib/ruby"
-\#define RUBY_PLATFORM "$(ARCH)-$(OS)"
-\#endif /* $(guard) */
-|
- @exit > $(@:/=\)
-
-config.status: $(MKFILES) $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
- @echo Creating $@
- @type > $@ &&|
-# Generated automatically by Makefile.sub.
-s,@SHELL@,$$(COMSPEC),;t t
-s,@BUILD_FILE_SEPARATOR@,\,;t t
-s,@PATH_SEPARATOR@,;,;t t
-s,@CFLAGS@,$(CFLAGS),;t t
-s,@DEFS@,$(DEFS),;t t
-s,@CPPFLAGS@,$(CPPFLAGS),;t t
-s,@CXXFLAGS@,$(CXXFLAGS),;t t
-s,@FFLAGS@,$(FFLAGS),;t t
-s,@LDFLAGS@,,;t t
-s,@LIBS@,$(LIBS),;t t
-s,@exec_prefix@,$${prefix},;t t
-s,@prefix@,$(prefix),;t t
-s,@program_transform_name@,s,,,,;t t
-s,@bindir@,$${exec_prefix}/bin,;t t
-s,@sbindir@,$${exec_prefix}/sbin,;t t
-s,@libexecdir@,$${exec_prefix}/libexec,;t t
-s,@datadir@,$${prefix}/share,;t t
-s,@sysconfdir@,$${prefix}/etc,;t t
-s,@sharedstatedir@,/etc,;t t
-s,@localstatedir@,/var,;t t
-s,@libdir@,$${exec_prefix}/lib,;t t
-s,@includedir@,$${prefix}/include,;t t
-s,@oldincludedir@,/usr/include,;t t
-s,@infodir@,$${prefix}/info,;t t
-s,@mandir@,$${prefix}/man,;t t
-s,@ridir@,$${prefix}/share/ri,;t t
-s,@build@,$(CPU)-pc-$(OS),;t t
-s,@build_alias@,$(CPU)-$(OS),;t t
-s,@build_cpu@,$(CPU),;t t
-s,@build_vendor@,pc,;t t
-s,@build_os@,$(OS),;t t
-s,@host@,$(CPU)-pc-$(OS),;t t
-s,@host_alias@,$(CPU)-$(OS),;t t
-s,@host_cpu@,$(CPU),;t t
-s,@host_vendor@,pc,;t t
-s,@host_os@,$(OS),;t t
-s,@target@,$(ARCH)-pc-$(OS),;t t
-s,@target_alias@,$(ARCH)-$(OS),;t t
-s,@target_cpu@,$(ARCH),;t t
-s,@target_vendor@,pc,;t t
-s,@target_os@,$(OS),;t t
-s,@CC@,$(CC),;t t
-s,@CPP@,cpp32,;t t
-s,@CXX@,$$(CC),;t t
-s,@LD@,$(LD),;t t
-s,@YACC@,$(YACC),;t t
-s,@RANLIB@,,;t t
-s,@AR@,$(AR),;t t
-s,@ARFLAGS@,$(ARFLAGS) ,;t t
-s,@LN_S@,$(LN_S),;t t
-s,@SET_MAKE@,MFLAGS = -$$(MAKEFLAGS),;t t
-s,@RM@,$$(top_srcdir:/=\)\win32\rm.bat,;t t
-s,@CP@,copy > nul,;t t
-s,@LIBOBJS@, $(MISSING),;t t
-s,@ALLOCA@,$(ALLOCA),;t t
-s,@DEFAULT_KCODE@,$(DEFAULT_KCODE),;t t
-s,@EXEEXT@,.exe,;t t
-s,@OBJEXT@,obj,;t t
-s,@XCFLAGS@,$(XCFLAGS),;t t
-s,@XLDFLAGS@,$(XLDFLAGS),;t t
-s,@DLDFLAGS@,$(DLDFLAGS),;t t
-s,@ARCH_FLAG@,$(ARCH_FLAG),;t t
-s,@STATIC@,$(STATIC),;t t
-s,@CCDLFLAGS@,,;t t
-s,@LDSHARED@,$(LDSHARED),;t t
-s,@DLEXT@,so,;t t
-s,@LIBEXT@,lib,;t t
-s,@STRIP@,$(STRIP),;t t
-s,@EXTSTATIC@,$(EXTSTATIC),;t t
-s,@setup@,Setup,;t t
-s,@MINIRUBY@,$(MINIRUBY),;t t
-s,@PREP@,miniruby$(EXEEXT),;t t
-s,@RUNRUBY@,$(RUNRUBY),;t t
-s,@EXTOUT@,$(EXTOUT),;t t
-s,@ARCHFILE@,,;t t
-s,@RDOCTARGET@,,;t t
-s,@LIBRUBY_LDSHARED@,$$(LDSHARED),;t t
-s,@LIBRUBY_DLDFLAGS@,-Gi $$(DLDFLAGS),;t t
-s,@RUBY_INSTALL_NAME@,$(RUBY_INSTALL_NAME),;t t
-s,@rubyw_install_name@,$(RUBYW_INSTALL_NAME),;t t
-s,@RUBYW_INSTALL_NAME@,$(RUBYW_INSTALL_NAME),;t t
-s,@RUBY_SO_NAME@,$(RUBY_SO_NAME),;t t
-s,@LIBRUBY_A@,$$(RUBY_SO_NAME)-static.lib,;t t
-s,@LIBRUBY_SO@,$$(RUBY_SO_NAME).dll,;t t
-s,@LIBRUBY_ALIASES@,$(LIBRUBY_ALIASES),;t t
-s,@LIBRUBY@,$$(RUBY_SO_NAME).lib,;t t
-s,@LIBRUBYARG@,$$(LIBRUBYARG_SHARED),;t t
-s,@LIBRUBYARG_STATIC@,$$(LIBRUBY_A),;t t
-s,@LIBRUBYARG_SHARED@,$$(LIBRUBY),;t t
-s,@SOLIBS@,$(SOLIBS),;t t
-s,@DLDLIBS@,$(DLDLIBS),;t t
-s,@ENABLE_SHARED@,yes,;t t
-s,@OUTFLAG@,$(OUTFLAG),;t t
-s,@COUTFLAG@,$(COUTFLAG),;t t
-s,@CPPOUTFILE@,,;t t
-s,@LIBPATHFLAG@, -L"%s",;t t
-s,@RPATHFLAG@,,;t t
-s,@LIBARG@,%s.lib,;t t
-s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS:/=\), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE:/=\), $$(RESFILE:/=\),;t t
-s,@COMPILE_C@,$$(CC) $$(INCFLAGS) $$(CFLAGS) $$(CPPFLAGS) $(COUTFLAG)$$(@) -c $$(<:/=\),;t t
-s,@COMPILE_CXX@,$$(CXX) $$(INCFLAGS) $$(CXXFLAGS) $$(CPPFLAGS) -P $(COUTFLAG)$$(@) -c $$(<:/=\),;t t
-s,@COMPILE_RULES@,{$$(srcdir)}.%s{}.%s: {$$(topdir)}.%s{}.%s: {$$(hdrdir)}.%s{}.%s: .%s.%s:,;t t
-s,@RULE_SUBST@,{.;$$(VPATH)}%s,;t t
-s,@COMMON_LIBS@,m advapi32 avicap32 avifil32 cap comctl32 comdlg32 dlcapi gdi32 glu32 imagehlp imm32 inetmib1 kernel32 loadperf lsapi32 lz32 mapi32 mgmtapi mpr msacm32 msvfw32 nddeapi netapi32 ole32 oleaut32 oledlg olepro32 opengl32 pdh pkpd32 rasapi32 rasdlg rassapi rpcrt4 setupapi shell32 shfolder snmpapi sporder tapi32 url user32 vdmdbg version win32spl winmm wintrust wsock32,;t t
-s,@COMMON_MACROS@,WIN32_LEAN_AND_MEAN WIN32,;t t
-s,@COMMON_HEADERS@,winsock2.h windows.h,;t t
-s,@cleanlibs@,$$*.tds,;t t
-s,@cleanobjs@,$$*-$$(arch).def $$*.il? $$*.lib,;t t
-s,@TRY_LINK@,$$(CC) -oconftest $$(INCFLAGS) -I$$(hdrdir) $$(CPPFLAGS) $$(CFLAGS) $$(LIBPATH) $$(LDFLAGS) $$(src) $$(LOCAL_LIBS) $$(LIBS),;t t
-s,@EXPORT_PREFIX@,_,;t t
-s,@arch@,$(ARCH)-$(OS),;t t
-s,@sitearch@,$(ARCH)-$(OS),;t t
-s,@sitedir@,$${prefix}/lib/ruby/site_ruby,;t t
-s,@vendordir@,$${prefix}/lib/ruby/vendor_ruby,;t t
-s,@rubyhdrdir@,$$(includedir)/ruby-$$(MAJOR).$$(MINOR).$$(TEENY),;t t
-s,@sitehdrdir@,$$(rubyhdrdir)/site_ruby,;t t
-s,@vendorhdrdir@,$$(rubyhdrdir)/vendor_ruby,;t t
-s,@configure_args@,--enable-shared $(configure_args),;t t
-s,@configure_input@,$$configure_input,;t t
-s,@srcdir@,$(srcdir),;t t
-s,@top_srcdir@,$(srcdir),;t t
-|
-
-miniruby$(EXEEXT):
- @echo $(LIBS)
- $(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(MINIOBJS) $(COMMONOBJS:/=\) $(DMYEXT),$@,nul,$(LIBS)
-
-$(PROGRAM): $(MAINOBJ) $(LIBRUBY_SO) $(RUBY_INSTALL_NAME).res
- $(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBY_INSTALL_NAME).res
-
-$(WPROGRAM): $(MAINOBJ) $(WINMAINOBJ) $(LIBRUBY_SO) $(RUBYW_INSTALL_NAME).res
- $(LD) $(LDFLAGS) $(WLDFLAGS) $(MAINOBJ) $(WINMAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBYW_INSTALL_NAME).res
-
-$(LIBRUBY_A): $(OBJS) $(DMYEXT)
- @-if exist $@ del $@
- $(AR) $(ARFLAGS) "$@" $(OBJS) $(DMYEXT)
-
-# $(LIBRUBY): $(LIBRUBY_SO)
-# implib $@ $(LIBRUBY_SO)
-
-$(LIBRUBY_SO): $(LIBRUBY_A) $(DLDOBJS) $(RUBYDEF) $(RUBY_SO_NAME).res
- @echo $(DLDOBJS)
- @$(PRE_LIBRUBY_UPDATE)
- $(LIBRUBY_LDSHARED) $(LIBRUBY_DLDFLAGS) $(DLDOBJS:/=\),$(LIBRUBY_SO),nul,$(LIBRUBY_A) $(LIBS),$(RUBYDEF),$(RUBY_SO_NAME).res
-
-$(LIBRUBY): $(LIBRUBY_SO)
-
-$(RUBYDEF): $(LIBRUBY_A) $(PREP)
- $(MINIRUBY) $(srcdir)/bcc32/mkexports.rb -output=$@ -base=$(RUBY_SO_NAME) $(LIBRUBY_A)
-
-$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb $(srcdir)/revision.h $(srcdir)/win32/resource.rb
- @$(MINIRUBY) $(srcdir)/win32/resource.rb \
- -ruby_name=$(RUBY_INSTALL_NAME) \
- -rubyw_name=$(RUBYW_INSTALL_NAME) \
- -so_name=$(RUBY_SO_NAME) \
- . $(icondirs) $(srcdir)/win32
-
-lex.c: {$(srcdir)}lex.c.blt
- copy "$(?:/=\)" $@
-
-post-install-bin::
- @$(NULLCMD)
-post-install-lib::
- @$(NULLCMD)
-post-install-ext-comm::
- @$(NULLCMD)
-post-install-ext-arch::
- @$(NULLCMD)
-post-install-man::
- @$(NULLCMD)
-post-install-doc::
- @$(NULLCMD)
-
-clean-local::
- @$(RM) $(WINMAINOBJ) ext\extinit.c ext\extinit.$(OBJEXT) *.tds *.il? $(RUBY_SO_NAME).lib
- @$(RM) $(RUBY_INSTALL_NAME).res $(RUBYW_INSTALL_NAME).res $(RUBY_SO_NAME).res
- @$(RM) *.map *.pdb *.ilk *.exp $(RUBYDEF) ext\ripper\y.output
-
-distclean-local::
- @$(RM) ext\config.cache $(RBCONFIG:/=\)
- @$(RM) $(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc
-
-clean-ext distclean-ext realclean-ext::
- @for /R ext %I in (.) do @if exist %I\Makefile ( \
- echo $(@:-ext=)ing %~nI & \
- cd %I & \
- $(MAKE) $(MFLAGS) $(@:-ext=) & \
- cd %CD% \
- )
-
-ext/extinit.obj: ext/extinit.c $(SETUP)
- $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
-
-main.$(OBJEXT): win32.h
-ascii.$(OBJEXT): win32.h
-array.$(OBJEXT): win32.h
-bignum.$(OBJEXT): win32.h
-class.$(OBJEXT): win32.h
-compar.$(OBJEXT): win32.h
-dir.$(OBJEXT): dir.h win32.h
-dln.$(OBJEXT): win32.h
-enum.$(OBJEXT): win32.h
-error.$(OBJEXT): win32.h
-euc_jp.$(OBJEXT): win32.h
-eval.$(OBJEXT): win32.h
-file.$(OBJEXT): win32.h
-gc.$(OBJEXT): win32.h
-hash.$(OBJEXT): win32.h
-inits.$(OBJEXT): win32.h
-io.$(OBJEXT): win32.h
-marshal.$(OBJEXT): win32.h
-math.$(OBJEXT): win32.h
-numeric.$(OBJEXT): win32.h
-object.$(OBJEXT): win32.h
-pack.$(OBJEXT): win32.h
-parse.$(OBJEXT): win32.h
-process.$(OBJEXT): win32.h
-prec.$(OBJEXT): win32.h
-random.$(OBJEXT): win32.h
-range.$(OBJEXT): win32.h
-re.$(OBJEXT): win32.h
-regcomp.$(OBJEXT): win32.h
-regenc.$(OBJEXT): win32.h
-regerror.$(OBJEXT): win32.h
-regexec.$(OBJEXT): win32.h
-reggnu.$(OBJEXT): win32.h
-regparse.$(OBJEXT): win32.h
-ruby.$(OBJEXT): win32.h
-signal.$(OBJEXT): win32.h
-sjis.$(OBJEXT): win32.h
-sprintf.$(OBJEXT): win32.h
-st.$(OBJEXT): win32.h
-string.$(OBJEXT): win32.h
-struct.$(OBJEXT): win32.h
-time.$(OBJEXT): win32.h
-utf_8.$(OBJEXT): win32.h
-util.$(OBJEXT): win32.h
-variable.$(OBJEXT): win32.h
-version.$(OBJEXT): win32.h
diff --git a/bcc32/README.bcc32 b/bcc32/README.bcc32
deleted file mode 100644
index cd33eec0a1..0000000000
--- a/bcc32/README.bcc32
+++ /dev/null
@@ -1,130 +0,0 @@
-=begin
-
-= How to build ruby using Borland C++
-
-== Requirement
-
-(1) Borland C++ 5.0 or later.
-
-(2) Please set environment variable (({PATH}))
- to run required commands properly from the command line.
-
- Note: building ruby requires following commands.
- * make
- * bcc32
- * tlib
- * ilink32
-
-(3) If you want to build from CVS source, following commands are required.
- * bison ((<URL:http://gnuwin32.sourceforge.net/packages/bison.htm>))
- * sed ((<URL:http://gnuwin32.sourceforge.net/packages/sed.htm>))
-
-(4) We strongly recommend to build ruby on C++Builder, to link following files.
- * usebormm.lib
- * memmgr.lib
-
- RTL's internal memory manager cannot handle large memory block properly,
- so we should use borlndmm.dll instead.
- 10000.times { "" << "." * 529671; GC.start } # crash
-
-== How to compile and install
-
-(1) Execute bcc32\configure.bat on your build directory.
- ex. c:\src\ruby> bcc32\configure.bat
- You can specify the target platform as an argument.
- For example, run `((%configure i686-bccwin32%))'
- You can also specify the install directory.
- For example, run `((%configure --prefix=<install_directory>%))'
- Default of the install directory is /usr .
- The default ((|<PLATFORM>|)) is `(({i386-bccwin32}))'.
-
-(2) Change ((|RUBY_INSTALL_NAME|)) and ((|RUBY_SO_NAME|)) in (({Makefile}))
- if you want to change the name of the executable files.
- And add ((|RUBYW_INSTALL_NAME|)) to change the name of the
- executable without console window if also you want.
-
-(3) Run `((%make%))'
-
-(4) Run `((%make test%))'
-
-(5) Run `((%make install%))'
-
-(6) Requires dynamic RTL (cc3250.dll on C++Builder5) and borlndmm.dll (If built with
- usebormm.lib) to use installed binary. These files are ordinary in bcc32's bin
- directory.
-
-== Icons
-
-Any icon files(*.ico) in the build directory, directories specified with
-((|icondirs|)) make variable and (({win32})) directory under the ruby
-source directory will be included in DLL or executable files, according
-to their base names.
- $(RUBY_INSTALL_NAME).ico or ruby.ico --> $(RUBY_INSTALL_NAME).exe
- $(RUBYW_INSTALL_NAME).ico or rubyw.ico --> $(RUBYW_INSTALL_NAME).exe
- the others --> $(RUBY_SO_NAME).dll
-
-Although no icons are distributed with the ruby source or in the official
-site, you can use anything you like. For example, followings are written
-in Japanese, but you can download at least.
-
-* ((<URL:http://member.nifty.ne.jp/ueivu/rubyico.html>)) or
- ((<zipped icons|URL:http://member.nifty.ne.jp/ueivu/Ruby_ico.zip>))
-* ((<URL:http://homepage1.nifty.com/a_nakata/ruby/>)) or
- ((<icon itself|URL:http://homepage1.nifty.com/a_nakata/ruby/RubyIcon.ico>))
-
-== Build examples
-
-* Build on the ruby source directory.
-
- ex.)
- ruby source directory: C:\ruby
- build directory: C:\ruby
- install directory: C:\usr\local
-
- C:
- cd \ruby
- bcc32\configure --prefix=/usr/local
- make
- make test
- make install
-
-* Build on the relative directory from the ruby source directory and CPU type
- i386.
-
- ex.)
- ruby source directory: C:\ruby
- build directory: C:\ruby\bccwin32
- install directory: C:\usr\local
- CPU i386
-
- C:
- cd \ruby
- mkdir bccwin32
- cd bccwin32
- ..\bcc32\configure --prefix=/usr/local
- make
- make test
- make install
-
-* Build on the different drive.
-
- ex.)
- ruby source directory: C:\src\ruby
- build directory: D:\build\ruby
- install directory: C:\usr\local
-
- D:
- cd D:\build\ruby
- C:\src\ruby\bcc32\configure --prefix=C:/usr/local
- make
- make test
- make install
-
-== Bugs
-
-You can ((*NOT*)) use a path name contains any white space characters as
-the ruby source directory, this restriction comes from the behavior of
-(({!INCLUDE})) directives of (({MAKE})).
-((- you may call it a bug. -))
-
-=end
diff --git a/bcc32/configure.bat b/bcc32/configure.bat
deleted file mode 100755
index 8cdfc64b03..0000000000
--- a/bcc32/configure.bat
+++ /dev/null
@@ -1,163 +0,0 @@
-@echo off
-::: Don't set environment variable in batch file other than autoexec.bat
-::: to avoid "Out of environment space" problem on Windows 95/98.
-::: set TMPMAKE=~tmp~.mak
-
-echo> ~tmp~.mak ####
-echo>> ~tmp~.mak conf = %0
-echo>> ~tmp~.mak $(conf:\=/): nul
-echo>> ~tmp~.mak @del ~setup~.mak
-echo>> ~tmp~.mak @-$(MAKE) -l$(MAKEFLAGS) -f $(@D)setup.mak \
-if exist pathlist.tmp del pathlist.tmp
-if exist confargs.mk del confargs.mk
-:loop
-if "%1" == "" goto :end
-if "%1" == "--prefix" goto :prefix
-if "%1" == "prefix" goto :prefix
-if "%1" == "--srcdir" goto :srcdir
-if "%1" == "srcdir" goto :srcdir
-if "%1" == "--target" goto :target
-if "%1" == "target" goto :target
-if "%1" == "--with-static-linked-ext" goto :extstatic
-if "%1" == "--program-suffix" goto :suffix
-if "%1" == "RUBY_SUFFIX" goto :suffix
-if "%1" == "--program-name" goto :installname
-if "%1" == "--install-name" goto :installname
-if "%1" == "RUBY_INSTALL_NAME" goto :installname
-if "%1" == "--so-name" goto :soname
-if "%1" == "RUBY_SO_NAME" goto :soname
-if "%1" == "--enable-install-doc" goto :enable-rdoc
-if "%1" == "--disable-install-doc" goto :disable-rdoc
-if "%1" == "--extout" goto :extout
-if "%1" == "EXTOUT" goto :extout
-if "%1" == "--with-baseruby" goto :baseruby
-if "%1" == "BASERUBY" goto :baseruby
-if "%1" == "--path" goto :path
-if "%1" == "-h" goto :help
-if "%1" == "--help" goto :help
- echo>>confargs.tmp %1 \
- shift
-goto :loop
-:srcdir
- echo>> ~tmp~.mak -Dsrcdir=%2 \
- echo>>confargs.tmp --srcdir=%2 \
- shift
- shift
-goto :loop
-:prefix
- echo>> ~tmp~.mak -Dprefix=%2 \
- echo>>confargs.tmp %1=%2 \
- shift
- shift
-goto :loop
-:suffix
- echo>>confargs.mk !ifndef RUBY_SUFFIX
- echo>>confargs.mk RUBY_SUFFIX = %2
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1=%2 \
- shift
- shift
-goto :loop
-:installname
- echo>>confargs.mk !ifndef RUBY_INSTALL_NAME
- echo>>confargs.mk RUBY_INSTALL_NAME = %2
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1=%2 \
- shift
- shift
-goto :loop
-:soname
- echo>>confargs.mk !ifndef RUBY_SO_NAME
- echo>>confargs.mk RUBY_SO_NAME = %2
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1=%2 \
- shift
- shift
-goto :loop
-:target
- echo>> ~tmp~.mak %2 \
- echo>>confargs.tmp --target=%2 \
- shift
- shift
-goto :loop
-:extstatic
- echo>>confargs.mk !ifndef EXTSTATIC
- echo>>confargs.mk EXTSTATIC = static
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1 \
- shift
-goto :loop
-:enable-rdoc
- echo>>confargs.mk !ifndef RDOCTARGET
- echo>>confargs.mk RDOCTARGET = install-doc
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1 \
- shift
-goto :loop
-:disable-rdoc
- echo>>confargs.mk !ifndef RDOCTARGET
- echo>>confargs.mk RDOCTARGET = install-nodoc
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1 \
- shift
-goto :loop
-:extout
- echo>>confargs.mk !ifndef EXTOUT
- echo>>confargs.mk EXTOUT = %2
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1=%2 \
- shift
- shift
-goto :loop
-:baseruby
- echo>>confargs.mk !ifndef BASERUBY
- echo>>confargs.mk BASERUBY = %2
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1=%2 \
- shift
- shift
-goto :loop
-:path
- echo>>pathlist.tmp %2;\
- echo>>confargs.tmp %1=%2 \
- shift
- shift
-goto :loop
-:help
- echo Configuration:
- echo --help display this help
- echo --srcdir=DIR find the sources in DIR [configure dir or `..']
- echo Installation directories:
- echo --prefix=PREFIX install files in PREFIX (ignored currently)
- echo System types:
- echo --target=TARGET configure for TARGET [i386-bccwin32]
- echo Optional Package:
- echo --with-baseruby=RUBY use RUBY as baseruby [ruby]
- echo --with-static-linked-ext link external modules statically
- echo --enable-install-doc install rdoc indexes during install
- del *.tmp
- del ~tmp~.mak
-goto :exit
-:end
-echo>> ~tmp~.mak -Dbcc32dir=$(@D)
-if not exist confargs.tmp goto :noconfargs
- echo>>confargs.mk configure_args = \
- type>>confargs.mk confargs.tmp
- echo.>>confargs.mk
- echo>>confargs.mk ####
-:noconfargs
-if not exist pathlist.tmp goto :nopathlist
- echo>>confargs.mk pathlist = \
- type>>confargs.mk pathlist.tmp
- echo.>>confargs.mk
- echo>>confargs.mk ####
- echo>>confargs.mk PATH = $(pathlist:;=/bin;)$(PATH)
- echo>>confargs.mk INCLUDE = $(pathlist:;=/include;)
- echo>>confargs.mk LIB = $(pathlist:;=/lib;)
-:nopathlist
-if exist confargs.mk copy confargs.mk ~setup~.mak > nul
-type>>~setup~.mak ~tmp~.mak
-del *.tmp > nul
-del ~tmp~.mak > nul
-make -s -f ~setup~.mak
-:exit
diff --git a/bcc32/mkexports.rb b/bcc32/mkexports.rb
deleted file mode 100755
index 888ab2e2a6..0000000000
--- a/bcc32/mkexports.rb
+++ /dev/null
@@ -1,26 +0,0 @@
-#!./miniruby -s
-
-$:.unshift(File.expand_path("../..", __FILE__))
-require 'win32/mkexports'
-
-class Exports::Bcc < Exports
- def forwarding(internal, export)
- internal[/\A_?/]+export
- end
-
- def each_line(objs, &block)
- objs.each do |obj|
- opt = /\.(?:so|dll)\z/i =~ obj ? "-ee" : "-oiPUBDEF -oiPUBD32"
- IO.foreach("|tdump -q #{opt} #{obj.tr('/', '\\')} < nul", &block)
- end
- end
-
- def each_export(objs)
- objdump(objs) do |l|
- next unless /(?:PUBDEF|PUBD32|EXPORT)/ =~ l
- yield $1 if /'(.*?)'/ =~ l
- end
- yield "_strcasecmp", "_stricmp"
- yield "_strncasecmp", "_strnicmp"
- end
-end
diff --git a/bcc32/setup.mak b/bcc32/setup.mak
deleted file mode 100644
index df2fd3c128..0000000000
--- a/bcc32/setup.mak
+++ /dev/null
@@ -1,179 +0,0 @@
-# -*- makefile -*-
-
-!if "$(srcdir)" != ""
-bcc32dir = $(srcdir)/bcc32
-!elseif "$(bcc32dir)" == "bcc32/"
-srcdir = .
-!elseif "$(bcc32dir:/bcc32/=)/bcc32/" == "$(bcc32dir)"
-srcdir = $(bcc32dir:/bcc32/=)
-!else
-srcdir = $(bcc32dir)/..
-!endif
-!ifndef prefix
-prefix = /usr
-!endif
-OS = bccwin32
-RT = $(OS)
-BANG = !
-APPEND = echo.>>$(MAKEFILE)
-!ifdef MAKEFILE
-MAKE = $(MAKE) -f $(MAKEFILE)
-!else
-MAKEFILE = Makefile
-!endif
-
-all: Makefile
-Makefile: -prologue- -generic- -epilogue-
-i386-$(OS): -prologue- -i386- -epilogue-
-i486-$(OS): -prologue- -i486- -epilogue-
-i586-$(OS): -prologue- -i586- -epilogue-
-i686-$(OS): -prologue- -i686- -epilogue-
-alpha-$(OS): -prologue- -alpha- -epilogue-
-
--prologue-: -basic-vars- -version- -system-vars-
-
--basic-vars-: nul
- @echo Creating $(MAKEFILE)
- @type > $(MAKEFILE) &&|
-\#\#\# Makefile for ruby $(OS) \#\#\#
-$(BANG)ifndef srcdir
-srcdir = $(srcdir:\=/)
-$(BANG)endif
-$(BANG)ifndef prefix
-prefix = $(prefix:\=/)
-$(BANG)endif
-$(BANG)if !defined(BASERUBY)
-!if defined(BASERUBY)
-BASERUBY = $(BASERUBY)
-!endif
-|
-!if !defined(BASERUBY)
- @for %I in (ruby.exe) do @echo BASERUBY = "%~$$PATH:I" >> $(MAKEFILE)
-!endif
- @type >> $(MAKEFILE) &&|
-$(BANG)endif
-|
-!if exist(confargs.mk)
- @type confargs.mk >> $(MAKEFILE)
- @del confargs.mk
-!endif
-
--system-vars-: -runtime- -bormm-
-
--bormm-: nul
- @-ilink32 -q -Gn -x usebormm.lib > nul
- @-if exist usebormm.tds $(APPEND) MEMLIB = usebormm.lib
- @if exist usebormm.* del usebormm.*
-
--osname-: nul
- @echo OS = >>$(MAKEFILE)
-
--runtime-: nul
- type > conftest.c &&|
-\#include <stdio.h>
-int main(){printf("");return 0;}
-|
- bcc32 conftest.c cw32i.lib > nul
- tdump conftest.exe < nul > conftest.i
- grep "^Imports from CC" conftest.i > conftest.c
- cpp32 -P- -DFile=\# -DImports=RTNAME -Dfrom== conftest.c > nul
- $(MAKE) > nul -DBANG=$(BANG) -f &&|
--runtime-: nul
-$(BANG)include conftest.i
-RT = $$(RTNAME:.DLL=)
-OS = $$(RT:CC32=)
--runtime-:
- del conftest.*
-$(BANG)if "$$(OS)" == "50"
- echo OS = bccwin32 >> $(MAKEFILE)
-$(BANG)else
- echo OS = bccwin32_$$(OS) >> $(MAKEFILE)
-$(BANG)endif
-|
- @echo RT = $$(OS) >> $(MAKEFILE)
-
--version-: nul
- @cpp32 -I$(srcdir) -P- -o$(MAKEFILE) > nul &&|
-\#define RUBY_REVISION 0
-\#include "version.h"
-MAJOR = RUBY_API_VERSION_MAJOR
-MINOR = RUBY_API_VERSION_MINOR
-TEENY = RUBY_API_VERSION_TEENY
-
-BORLANDC = __BORLANDC__
-|
- @$(MAKE) > nul -DBANG=$(BANG) -f &&,
--version-: nul
-$(BANG)include $(MAKEFILE)
-$(BANG)include $(MAKEFILE).i
--version-:
- @del $(MAKEFILE).i
- @type >> $(MAKEFILE) &&|
-MAJOR = $$(MAJOR)
-MINOR = $$(MINOR)
-TEENY = $$(TEENY)
-BORLANDC = $$(BORLANDC)
-|
-,
-
--generic-: nul
-!if defined(PROCESSOR_ARCHITECTURE) || defined(PROCESSOR_LEVEL)
- @type >> $(MAKEFILE) &&|
-!if defined(PROCESSOR_ARCHITECTURE)
-$(BANG)ifndef PROCESSOR_ARCHITECTURE
-PROCESSOR_ARCHITECTURE = $(PROCESSOR_ARCHITECTURE)
-$(BANG)endif
-!endif
-!if defined(PROCESSOR_LEVEL)
-$(BANG)ifndef PROCESSOR_LEVEL
-PROCESSOR_LEVEL = $(PROCESSOR_LEVEL)
-$(BANG)endif
-!endif
-|
-!endif
-
--alpha-: nul
- @$(APPEND) !ifndef PROCESSOR_ARCHITECTURE
- @$(APPEND) PROCESSOR_ARCHITECTURE = alpha
- @$(APPEND) !endif
--ix86-: nul
- @$(APPEND) !ifndef PROCESSOR_ARCHITECTURE
- @$(APPEND) PROCESSOR_ARCHITECTURE = x86
- @$(APPEND) !endif
-
--i386-: -ix86-
- @$(APPEND) !ifndef PROCESSOR_LEVEL
- @$(APPEND) PROCESSOR_LEVEL = 3
- @$(APPEND) !endif
--i486-: -ix86-
- @$(APPEND) !ifndef PROCESSOR_LEVEL
- @$(APPEND) PROCESSOR_LEVEL = 4
- @$(APPEND) !endif
--i586-: -ix86-
- @$(APPEND) !ifndef PROCESSOR_LEVEL
- @$(APPEND) PROCESSOR_LEVEL = 5
- @$(APPEND) !endif
--i686-: -ix86-
- @$(APPEND) !ifndef PROCESSOR_LEVEL
- @$(APPEND) PROCESSOR_LEVEL = 6
- @$(APPEND) !endif
-
--epilogue-: -encs-
-
--encs-: nul
- @$(MAKE) -f $(srcdir)/win32/enc-setup.mak srcdir="$(srcdir)" MAKEFILE=$(MAKEFILE)
-
--epilogue-: nul
- @type >> $(MAKEFILE) &&|
-
-\# RUBY_INSTALL_NAME = ruby
-\# RUBY_SO_NAME = $$(RT)-$$(RUBY_INSTALL_NAME)$$(MAJOR)$$(MINOR)
-\# CFLAGS = -q $$(DEBUGFLAGS) $$(OPTFLAGS) $$(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
-\# CPPFLAGS = -I. -I$$(srcdir) -I$$(srcdir)/missing -DLIBRUBY_SO=\"$$(LIBRUBY_SO)\"
-\# STACK = 0x2000000
-\# LDFLAGS = -S:$$(STACK)
-\# RFLAGS = $$(iconinc)
-\# EXTLIBS = cw32.lib import32.lib user32.lib kernel32.lib
-$(BANG)include $$(srcdir)/bcc32/Makefile.sub
-|
- @echo type "`$(MAKE)'" to make ruby for $(OS).
diff --git a/benchmark/README.md b/benchmark/README.md
new file mode 100644
index 0000000000..e11381cad9
--- /dev/null
+++ b/benchmark/README.md
@@ -0,0 +1,74 @@
+# ruby/benchmark
+
+This directory has benchmark definitions to be run with
+[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
+
+## Normal usage
+
+Execute `gem install benchmark_driver` and run a command like:
+
+```bash
+# Run a benchmark script with the ruby in the $PATH
+benchmark-driver benchmark/app_fib.rb
+
+# Run benchmark scripts with multiple Ruby executables or options
+benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
+
+# Or compare Ruby versions managed by rbenv
+benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
+
+# You can collect many metrics in many ways
+benchmark-driver benchmark/*.rb --runner memory --output markdown
+
+# Some are defined with YAML for complex setup or accurate measurement
+benchmark-driver benchmark/*.yml
+```
+
+See also:
+
+```console
+Usage: benchmark-driver [options] RUBY|YAML...
+ -r, --runner TYPE Specify runner type: ips, time, memory, once, block (default: ips)
+ -o, --output TYPE Specify output type: compare, simple, markdown, record, all (default: compare)
+ -e, --executables EXECS Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
+ --rbenv VERSIONS Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
+ --repeat-count NUM Try benchmark NUM times and use the fastest result or the worst memory usage
+ --repeat-result TYPE Yield "best", "average" or "worst" result with --repeat-count (default: best)
+ --alternate Alternate executables instead of running the same executable in a row with --repeat-count
+ --bundler Install and use gems specified in Gemfile
+ --filter REGEXP Filter out benchmarks with given regexp
+ --run-duration SECONDS Warmup estimates loop_count to run for this duration (default: 3)
+ --timeout SECONDS Timeout ruby command execution with timeout(1)
+ -v, --verbose Verbose mode. Multiple -v options increase visilibity (max: 2)
+```
+
+## make benchmark
+
+Using `make benchmark`, `make update-benchmark-driver` automatically downloads
+the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
+benchmark\_driver.
+
+```bash
+# Run all benchmarks with the ruby in the $PATH and the built ruby
+make benchmark
+
+# Or compare with specific ruby binary
+make benchmark COMPARE_RUBY="/path/to/ruby --jit"
+
+# Run vm benchmarks
+make benchmark ITEM=vm
+
+# Run some limited benchmarks in ITEM-matched files
+make benchmark ITEM=vm OPTS=--filter=block
+
+# You can specify the benchmark by an exact filename instead of using the default argument:
+# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
+make benchmark ARGS=benchmark/erb_render.yml
+
+# You can specify any option via $OPTS
+make benchmark OPTS="--help"
+
+# With `make benchmark`, some special runner plugins are available:
+# -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
+make benchmark ITEM=vm_bigarray OPTS="-r peak"
+```
diff --git a/benchmark/bm_app_answer.rb b/benchmark/app_answer.rb
index 3cd8a8fd37..3cd8a8fd37 100644
--- a/benchmark/bm_app_answer.rb
+++ b/benchmark/app_answer.rb
diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb
new file mode 100644
index 0000000000..16296af12b
--- /dev/null
+++ b/benchmark/app_aobench.rb
@@ -0,0 +1,297 @@
+# coding: US-ASCII
+
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+# https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+srand(0)
+
+class Vec
+ def initialize(x, y, z)
+ @x = x
+ @y = y
+ @z = z
+ end
+
+ attr_accessor :x, :y, :z
+
+ def vadd(b)
+ Vec.new(@x + b.x, @y + b.y, @z + b.z)
+ end
+
+ def vsub(b)
+ Vec.new(@x - b.x, @y - b.y, @z - b.z)
+ end
+
+ def vcross(b)
+ Vec.new(@y * b.z - @z * b.y,
+ @z * b.x - @x * b.z,
+ @x * b.y - @y * b.x)
+ end
+
+ def vdot(b)
+ @x * b.x + @y * b.y + @z * b.z
+ end
+
+ def vlength
+ Math.sqrt(@x * @x + @y * @y + @z * @z)
+ end
+
+ def vnormalize
+ len = vlength
+ v = Vec.new(@x, @y, @z)
+ if len > 1.0e-17 then
+ v.x = v.x / len
+ v.y = v.y / len
+ v.z = v.z / len
+ end
+ v
+ end
+end
+
+
+class Sphere
+ def initialize(center, radius)
+ @center = center
+ @radius = radius
+ end
+
+ attr_reader :center, :radius
+
+ def intersect(ray, isect)
+ rs = ray.org.vsub(@center)
+ b = rs.vdot(ray.dir)
+ c = rs.vdot(rs) - (@radius * @radius)
+ d = b * b - c
+ if d > 0.0 then
+ t = - b - Math.sqrt(d)
+
+ if t > 0.0 and t < isect.t then
+ isect.t = t
+ isect.hit = true
+ isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+ ray.org.y + ray.dir.y * t,
+ ray.org.z + ray.dir.z * t)
+ n = isect.pl.vsub(@center)
+ isect.n = n.vnormalize
+ else
+ 0.0
+ end
+ end
+ nil
+ end
+end
+
+class Plane
+ def initialize(p, n)
+ @p = p
+ @n = n
+ end
+
+ def intersect(ray, isect)
+ d = -@p.vdot(@n)
+ v = ray.dir.vdot(@n)
+ v0 = v
+ if v < 0.0 then
+ v0 = -v
+ end
+ if v0 < 1.0e-17 then
+ return
+ end
+
+ t = -(ray.org.vdot(@n) + d) / v
+
+ if t > 0.0 and t < isect.t then
+ isect.hit = true
+ isect.t = t
+ isect.n = @n
+ isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+ ray.org.y + t * ray.dir.y,
+ ray.org.z + t * ray.dir.z)
+ end
+ nil
+ end
+end
+
+class Ray
+ def initialize(org, dir)
+ @org = org
+ @dir = dir
+ end
+
+ attr_accessor :org, :dir
+end
+
+class Isect
+ def initialize
+ @t = 10000000.0
+ @hit = false
+ @pl = Vec.new(0.0, 0.0, 0.0)
+ @n = Vec.new(0.0, 0.0, 0.0)
+ end
+
+ attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+ i = f * 255.5
+ if i > 255.0 then
+ i = 255.0
+ end
+ if i < 0.0 then
+ i = 0.0
+ end
+ i.to_i
+end
+
+def otherBasis(basis, n)
+ basis[2] = Vec.new(n.x, n.y, n.z)
+ basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+ if n.x < 0.6 and n.x > -0.6 then
+ basis[1].x = 1.0
+ elsif n.y < 0.6 and n.y > -0.6 then
+ basis[1].y = 1.0
+ elsif n.z < 0.6 and n.z > -0.6 then
+ basis[1].z = 1.0
+ else
+ basis[1].x = 1.0
+ end
+
+ basis[0] = basis[1].vcross(basis[2])
+ basis[0] = basis[0].vnormalize
+
+ basis[1] = basis[2].vcross(basis[0])
+ basis[1] = basis[1].vnormalize
+end
+
+class Scene
+ def initialize
+ @spheres = Array.new
+ @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+ @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+ @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+ @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+ end
+
+ def ambient_occlusion(isect)
+ basis = Array.new
+ otherBasis(basis, isect.n)
+
+ ntheta = NAO_SAMPLES
+ nphi = NAO_SAMPLES
+ eps = 0.0001
+ occlusion = 0.0
+
+ p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+ isect.pl.y + eps * isect.n.y,
+ isect.pl.z + eps * isect.n.z)
+ nphi.times do |j|
+ ntheta.times do |i|
+ r = rand
+ phi = 2.0 * 3.14159265 * rand
+ x = Math.cos(phi) * Math.sqrt(1.0 - r)
+ y = Math.sin(phi) * Math.sqrt(1.0 - r)
+ z = Math.sqrt(r)
+
+ rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+ ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+ rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+ raydir = Vec.new(rx, ry, rz)
+ ray = Ray.new(p0, raydir)
+
+ occisect = Isect.new
+ @spheres[0].intersect(ray, occisect)
+ @spheres[1].intersect(ray, occisect)
+ @spheres[2].intersect(ray, occisect)
+ @plane.intersect(ray, occisect)
+ if occisect.hit then
+ occlusion = occlusion + 1.0
+ else
+ 0.0
+ end
+ end
+ end
+
+ occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+ Vec.new(occlusion, occlusion, occlusion)
+ end
+
+ def render(w, h, nsubsamples)
+ cnt = 0
+ nsf = nsubsamples.to_f
+ h.times do |y|
+ w.times do |x|
+ rad = Vec.new(0.0, 0.0, 0.0)
+
+ # Subsampling
+ nsubsamples.times do |v|
+ nsubsamples.times do |u|
+
+ cnt = cnt + 1
+ wf = w.to_f
+ hf = h.to_f
+ xf = x.to_f
+ yf = y.to_f
+ uf = u.to_f
+ vf = v.to_f
+
+ px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+ py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+ eye = Vec.new(px, py, -1.0).vnormalize
+
+ ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+ isect = Isect.new
+ @spheres[0].intersect(ray, isect)
+ @spheres[1].intersect(ray, isect)
+ @spheres[2].intersect(ray, isect)
+ @plane.intersect(ray, isect)
+ if isect.hit then
+ col = ambient_occlusion(isect)
+ rad.x = rad.x + col.x
+ rad.y = rad.y + col.y
+ rad.z = rad.z + col.z
+ end
+ end
+ end
+
+ r = rad.x / (nsf * nsf)
+ g = rad.y / (nsf * nsf)
+ b = rad.z / (nsf * nsf)
+ printf("%c", clamp(r))
+ printf("%c", clamp(g))
+ printf("%c", clamp(b))
+ end
+ nil
+ end
+
+ nil
+ end
+end
+
+alias printf_orig printf
+def printf *args
+ # $fp.printf(*args)
+end
+
+# File.open("ao.ppm", "w") do |fp|
+ # $fp = fp
+ printf("P6\n")
+ printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+ printf("255\n")
+ Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
new file mode 100644
index 0000000000..31e29b7644
--- /dev/null
+++ b/benchmark/app_erb.yml
@@ -0,0 +1,23 @@
+#
+# Create many HTML strings with ERB.
+#
+prelude: |
+ require 'erb'
+
+ data = <<erb
+ <html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+ </html>
+ erb
+
+ title = "hello world!"
+ content = "hello world!\n" * 10
+benchmark:
+ app_erb: ERB.new(data).result(binding)
+loop_count: 15000
diff --git a/benchmark/app_factorial.rb b/benchmark/app_factorial.rb
new file mode 100644
index 0000000000..45f471dfdb
--- /dev/null
+++ b/benchmark/app_factorial.rb
@@ -0,0 +1,11 @@
+def fact(n)
+ if(n > 1)
+ n * fact(n-1)
+ else
+ 1
+ end
+end
+
+100.times {
+ fact(5000)
+}
diff --git a/benchmark/bm_app_fib.rb b/benchmark/app_fib.rb
index 34a7b2e725..34a7b2e725 100644
--- a/benchmark/bm_app_fib.rb
+++ b/benchmark/app_fib.rb
diff --git a/benchmark/app_lc_fizzbuzz.rb b/benchmark/app_lc_fizzbuzz.rb
new file mode 100644
index 0000000000..f09574bbeb
--- /dev/null
+++ b/benchmark/app_lc_fizzbuzz.rb
@@ -0,0 +1,52 @@
+#
+# FizzBuzz program using only lambda calculus
+#
+# This program is quoted from
+# "Understanding Computation" by Tom Stuart
+# http://computationbook.com/
+#
+# You can understand why this program works fine by reading this book.
+#
+
+solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }]
+
+FIRST = -> l { LEFT[RIGHT[l]] }
+IF = -> b { b }
+LEFT = -> p { p[-> x { -> y { x } } ] }
+RIGHT = -> p { p[-> x { -> y { y } } ] }
+IS_EMPTY = LEFT
+REST = -> l { RIGHT[RIGHT[l]] }
+
+def to_integer(proc)
+ proc[-> n { n + 1 }][0]
+end
+
+def to_boolean(proc)
+ IF[proc][true][false]
+end
+
+def to_array(proc)
+ array = []
+
+ until to_boolean(IS_EMPTY[proc])
+ array.push(FIRST[proc])
+ proc = REST[proc]
+ end
+
+ array
+end
+
+def to_char(c)
+ '0123456789BFiuz'.slice(to_integer(c))
+end
+
+def to_string(s)
+ to_array(s).map { |c| to_char(c) }.join
+end
+
+answer = to_array(solution).map do |p|
+ to_string(p)
+end
+
+answer_ary = answer.to_a
+# puts answer_ary
diff --git a/benchmark/app_mandelbrot.rb b/benchmark/app_mandelbrot.rb
new file mode 100644
index 0000000000..801b75e8e2
--- /dev/null
+++ b/benchmark/app_mandelbrot.rb
@@ -0,0 +1,23 @@
+require 'complex'
+
+def mandelbrot? z
+ i = 0
+ while i<100
+ i += 1
+ z = z * z
+ return false if z.abs > 2
+ end
+ true
+end
+
+ary = []
+
+(0..1000).each{|dx|
+ (0..1000).each{|dy|
+ x = dx / 50.0
+ y = dy / 50.0
+ c = Complex(x, y)
+ ary << c if mandelbrot?(c)
+ }
+}
+
diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb
new file mode 100644
index 0000000000..47be7b203f
--- /dev/null
+++ b/benchmark/app_pentomino.rb
@@ -0,0 +1,130 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+ nb.each{|x|
+ a[n] = x
+ if n == NP-1
+ $p << [a.sort]
+ else
+ nbc=nb.dup
+ [-ROW, -1, 1, ROW].each{|d|
+ if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+ nbc << x+d
+ end
+ }
+ nbc.delete x
+ piece(n+1,a[0..n],nbc)
+ end
+ }
+end
+
+def kikaku(a)
+ a.collect {|x| x - a[0]}
+end
+def ud(a)
+ kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+ kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+ kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+ piece(0,[],[0])
+ $p.each do |a|
+ a0 = a[0]
+ a[1] = ud(a0)
+ a[2] = rl(a0)
+ a[3] = ud(rl(a0))
+ a[4] = xy(a0)
+ a[5] = ud(xy(a0))
+ a[6] = rl(xy(a0))
+ a[7] = ud(rl(xy(a0)))
+ a.sort!
+ a.uniq!
+ end
+ $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+ (0...ROW*COL).each{|i|
+ if i % ROW >= ROW-NP
+ $b[i] = -2
+ else
+ $b[i] = -1
+ end
+ $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+ }
+end
+
+def pboard
+ return # skip print
+ print "No. #$no\n"
+ (0...COL).each{|i|
+ print "|"
+ (0...ROW-NP).each{|j|
+ x = $b[i*ROW+j]
+ if x < 0
+ print "..|"
+ else
+ printf "%2d|",x+1
+ end
+ }
+ print "\n"
+ }
+ print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+ if a.length == $p.length then
+ $no += 1
+ pboard
+ return
+ end
+ while $b[pos] != -1
+ pos += 1
+ end
+ ($pnum - a).each do |i|
+ $p[i].each do |x|
+ f = 0
+ x.each{|s|
+ if $b[pos+s] != -1
+ f=1
+ break
+ end
+ }
+ if f == 0 then
+ x.each{|s|
+ $b[pos+s] = i
+ }
+ a << i
+ setpiece(a.dup, pos)
+ a.pop
+ x.each{|s|
+ $b[pos+s] = -1
+ }
+ end
+ end
+ end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/app_raise.rb b/benchmark/app_raise.rb
new file mode 100644
index 0000000000..5db8f95d50
--- /dev/null
+++ b/benchmark/app_raise.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<300000
+ i += 1
+ begin
+ raise
+ rescue
+ end
+end
diff --git a/benchmark/app_strconcat.rb b/benchmark/app_strconcat.rb
new file mode 100644
index 0000000000..7eed7c1aed
--- /dev/null
+++ b/benchmark/app_strconcat.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<2_000_000
+ "#{1+1} #{1+1} #{1+1}"
+ i += 1
+end
diff --git a/benchmark/bm_app_tak.rb b/benchmark/app_tak.rb
index efe5380f4e..efe5380f4e 100644
--- a/benchmark/bm_app_tak.rb
+++ b/benchmark/app_tak.rb
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/app_tarai.rb
index 4c146f5ccf..4c146f5ccf 100644
--- a/benchmark/bm_app_tarai.rb
+++ b/benchmark/app_tarai.rb
diff --git a/benchmark/bm_app_uri.rb b/benchmark/app_uri.rb
index 586edfd5dc..586edfd5dc 100644
--- a/benchmark/bm_app_uri.rb
+++ b/benchmark/app_uri.rb
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
new file mode 100644
index 0000000000..88ef544ba0
--- /dev/null
+++ b/benchmark/array_flatten.yml
@@ -0,0 +1,19 @@
+prelude: |
+ small_flat_ary = 5.times.to_a
+ large_flat_ary = 100.times.to_a
+ small_pairs_ary = [[1, 2]] * 5
+ large_pairs_ary = [[1, 2]] * 100
+ mostly_flat_ary = 100.times.to_a.push([101, 102])
+
+benchmark:
+ small_flat_ary.flatten: small_flat_ary.flatten
+ small_flat_ary.flatten!: small_flat_ary.flatten!
+ large_flat_ary.flatten: large_flat_ary.flatten
+ large_flat_ary.flatten!: large_flat_ary.flatten!
+ small_pairs_ary.flatten: small_pairs_ary.flatten
+ small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
+ large_pairs_ary.flatten: large_pairs_ary.flatten
+ large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
+ mostly_flat_ary.flatten: mostly_flat_ary.flatten
+ mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
+loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
new file mode 100644
index 0000000000..26705323fd
--- /dev/null
+++ b/benchmark/array_intersection.yml
@@ -0,0 +1,14 @@
+prelude: |
+ small1 = [1, 2, 3]
+ small2 = [1, 2, 3, 4, 5]
+ small3 = [2, 3, 4, 5]
+ small4 = [2]
+ big1 = [1, 2, 3, 4] * 64
+ big2 = [1, 2, 3] * 64
+ big3 = [1, 2] * 64
+
+benchmark:
+ small-&: small1 & small2 & small3 & small4
+ small-intersection: small1.intersection(small2, small3, small4)
+ big-&: big1 & big2 & big3
+ big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_max_float.yml b/benchmark/array_max_float.yml
new file mode 100644
index 0000000000..ace1ae2e14
--- /dev/null
+++ b/benchmark/array_max_float.yml
@@ -0,0 +1,30 @@
+prelude: |
+ ary2 = 2.times.map(&:to_f).shuffle
+ ary10 = 10.times.map(&:to_f).shuffle
+ ary100 = 100.times.map(&:to_f).shuffle
+ ary500 = 500.times.map(&:to_f).shuffle
+ ary1000 = 1000.times.map(&:to_f).shuffle
+ ary2000 = 2500.times.map(&:to_f).shuffle
+ ary3000 = 2500.times.map(&:to_f).shuffle
+ ary5000 = 5000.times.map(&:to_f).shuffle
+ ary10000 = 10000.times.map(&:to_f).shuffle
+ ary20000 = 20000.times.map(&:to_f).shuffle
+ ary50000 = 50000.times.map(&:to_f).shuffle
+ ary100000 = 100000.times.map(&:to_f).shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_max_int.yml b/benchmark/array_max_int.yml
new file mode 100644
index 0000000000..acd83684d0
--- /dev/null
+++ b/benchmark/array_max_int.yml
@@ -0,0 +1,31 @@
+prelude: |
+ ary2 = 2.times.to_a.shuffle
+ ary10 = 10.times.to_a.shuffle
+ ary100 = 100.times.to_a.shuffle
+ ary500 = 500.times.to_a.shuffle
+ ary1000 = 1000.times.to_a.shuffle
+ ary2000 = 2500.times.to_a.shuffle
+ ary3000 = 2500.times.to_a.shuffle
+ ary5000 = 5000.times.to_a.shuffle
+ ary10000 = 10000.times.to_a.shuffle
+ ary20000 = 20000.times.to_a.shuffle
+ ary50000 = 50000.times.to_a.shuffle
+ ary100000 = 100000.times.to_a.shuffle
+ ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+ ary1000000.max: ary1000000.max
+
+loop_count: 10000
diff --git a/benchmark/array_max_str.yml b/benchmark/array_max_str.yml
new file mode 100644
index 0000000000..2aeed010f2
--- /dev/null
+++ b/benchmark/array_max_str.yml
@@ -0,0 +1,30 @@
+prelude: |
+ ary2 = 2.times.map(&:to_s).shuffle
+ ary10 = 10.times.map(&:to_s).shuffle
+ ary100 = 100.times.map(&:to_s).shuffle
+ ary500 = 500.times.map(&:to_s).shuffle
+ ary1000 = 1000.times.map(&:to_s).shuffle
+ ary2000 = 2500.times.map(&:to_s).shuffle
+ ary3000 = 2500.times.map(&:to_s).shuffle
+ ary5000 = 5000.times.map(&:to_s).shuffle
+ ary10000 = 10000.times.map(&:to_s).shuffle
+ ary20000 = 20000.times.map(&:to_s).shuffle
+ ary50000 = 50000.times.map(&:to_s).shuffle
+ ary100000 = 100000.times.map(&:to_s).shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_min.yml b/benchmark/array_min.yml
new file mode 100644
index 0000000000..53e5072b14
--- /dev/null
+++ b/benchmark/array_min.yml
@@ -0,0 +1,31 @@
+prelude: |
+ ary2 = 2.times.to_a.shuffle
+ ary10 = 10.times.to_a.shuffle
+ ary100 = 100.times.to_a.shuffle
+ ary500 = 500.times.to_a.shuffle
+ ary1000 = 1000.times.to_a.shuffle
+ ary2000 = 2500.times.to_a.shuffle
+ ary3000 = 2500.times.to_a.shuffle
+ ary5000 = 5000.times.to_a.shuffle
+ ary10000 = 10000.times.to_a.shuffle
+ ary20000 = 20000.times.to_a.shuffle
+ ary50000 = 50000.times.to_a.shuffle
+ ary100000 = 100000.times.to_a.shuffle
+ ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+ ary2.min: ary2.min
+ ary10.min: ary10.min
+ ary100.min: ary100.min
+ ary500.min: ary500.min
+ ary1000.min: ary1000.min
+ ary2000.min: ary2000.min
+ ary3000.min: ary3000.min
+ ary5000.min: ary5000.min
+ ary10000.min: ary10000.min
+ ary20000.min: ary20000.min
+ ary50000.min: ary50000.min
+ ary100000.min: ary100000.min
+ ary1000000.min: ary1000000.min
+
+loop_count: 10000
diff --git a/benchmark/array_sample.yml b/benchmark/array_sample.yml
new file mode 100644
index 0000000000..1cd2b34794
--- /dev/null
+++ b/benchmark/array_sample.yml
@@ -0,0 +1,4 @@
+prelude: ary = (1..10_000).to_a
+benchmark:
+ - ary.sample
+ - ary.sample(2)
diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb
new file mode 100644
index 0000000000..5f41ecc32b
--- /dev/null
+++ b/benchmark/array_sample_100k_10.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10}
diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb
new file mode 100644
index 0000000000..18b1715319
--- /dev/null
+++ b/benchmark/array_sample_100k_11.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 11}
diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb
new file mode 100644
index 0000000000..22863afe89
--- /dev/null
+++ b/benchmark/array_sample_100k__100.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 100}
diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb
new file mode 100644
index 0000000000..4cd79e6c67
--- /dev/null
+++ b/benchmark/array_sample_100k__1k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 1000}
diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb
new file mode 100644
index 0000000000..b3d264249e
--- /dev/null
+++ b/benchmark/array_sample_100k__6k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 6000}
diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb
new file mode 100644
index 0000000000..5dd55ec058
--- /dev/null
+++ b/benchmark/array_sample_100k___10k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10_000}
diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb
new file mode 100644
index 0000000000..1506732c3c
--- /dev/null
+++ b/benchmark/array_sample_100k___50k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 50_000}
diff --git a/benchmark/array_shift.rb b/benchmark/array_shift.rb
new file mode 100644
index 0000000000..798bb9e3f4
--- /dev/null
+++ b/benchmark/array_shift.rb
@@ -0,0 +1,14 @@
+require 'benchmark'
+
+Benchmark.bm do |x|
+ [10_000,1_000_000,100_000_000].each do |n|
+ ary = Array.new(n,0)
+ GC.start
+ x.report("#{n}:shift"){ ary.shift }
+ (0..4).each do |i|
+ ary = Array.new(n,0)
+ GC.start
+ x.report("#{n}:shift(#{i})"){ ary.shift(i) }
+ end
+ end
+end
diff --git a/benchmark/array_small_and.rb b/benchmark/array_small_and.rb
new file mode 100644
index 0000000000..e53a6edae6
--- /dev/null
+++ b/benchmark/array_small_and.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 & arr2
+ end
+ end
+end
diff --git a/benchmark/array_small_diff.rb b/benchmark/array_small_diff.rb
new file mode 100644
index 0000000000..9661ee48db
--- /dev/null
+++ b/benchmark/array_small_diff.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 - arr2
+ end
+ end
+end
diff --git a/benchmark/array_small_or.rb b/benchmark/array_small_or.rb
new file mode 100644
index 0000000000..c58b5fd1ff
--- /dev/null
+++ b/benchmark/array_small_or.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 | arr2
+ end
+ end
+end
diff --git a/benchmark/array_sort_block.rb b/benchmark/array_sort_block.rb
new file mode 100644
index 0000000000..3579786056
--- /dev/null
+++ b/benchmark/array_sort_block.rb
@@ -0,0 +1,2 @@
+ary = Array.new(1000) { rand(1000) }
+10000.times { ary.sort { |a, b| a <=> b } }
diff --git a/benchmark/array_sort_float.rb b/benchmark/array_sort_float.rb
new file mode 100644
index 0000000000..9a6e2f8bd2
--- /dev/null
+++ b/benchmark/array_sort_float.rb
@@ -0,0 +1,2 @@
+arr = Array.new(1000) { rand }
+10000.times { arr.sort }
diff --git a/benchmark/array_sort_int.yml b/benchmark/array_sort_int.yml
new file mode 100644
index 0000000000..7b9027ebf7
--- /dev/null
+++ b/benchmark/array_sort_int.yml
@@ -0,0 +1,15 @@
+prelude: |
+ ary2 = 2.times.to_a.shuffle
+ ary10 = 10.times.to_a.shuffle
+ ary100 = 100.times.to_a.shuffle
+ ary1000 = 1000.times.to_a.shuffle
+ ary10000 = 10000.times.to_a.shuffle
+
+benchmark:
+ ary2.sort: ary2.sort
+ ary10.sort: ary10.sort
+ ary100.sort: ary100.sort
+ ary1000.sort: ary1000.sort
+ ary10000.sort: ary10000.sort
+
+loop_count: 10000
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
new file mode 100644
index 0000000000..6cb394cb9f
--- /dev/null
+++ b/benchmark/array_values_at_int.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
new file mode 100644
index 0000000000..5b53806d1c
--- /dev/null
+++ b/benchmark/array_values_at_range.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/attr_accessor.yml b/benchmark/attr_accessor.yml
new file mode 100644
index 0000000000..82134cdf9b
--- /dev/null
+++ b/benchmark/attr_accessor.yml
@@ -0,0 +1,29 @@
+prelude: |
+ class C
+ attr_accessor :x
+ def initialize
+ @x = nil
+ end
+ class_eval <<-END
+ def ar
+ #{'x;'*256}
+ end
+ def aw
+ #{'self.x = nil;'*256}
+ end
+ def arm
+ m = method(:x)
+ #{'m.call;'*256}
+ end
+ def awm
+ m = method(:x=)
+ #{'m.call(nil);'*256}
+ end
+ END
+ end
+ obj = C.new
+benchmark:
+ attr_reader: "obj.ar"
+ attr_writer: "obj.aw"
+ attr_reader_method: "obj.arm"
+ attr_writer_method: "obj.awm"
diff --git a/benchmark/bighash.rb b/benchmark/bighash.rb
new file mode 100644
index 0000000000..e2ad5a5c94
--- /dev/null
+++ b/benchmark/bighash.rb
@@ -0,0 +1 @@
+h = {}; 5000000.times {|n| h[n] = n }
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
deleted file mode 100644
index e58b7a34a1..0000000000
--- a/benchmark/bm_app_erb.rb
+++ /dev/null
@@ -1,26 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-
-require 'erb'
-
-data = DATA.read
-max = 5_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-max.times{
- ERB.new(data).result(binding)
-}
-
-__END__
-
-<html>
- <head> <%= title %> </head>
- <body>
- <h1> <%= title %> </h1>
- <p>
- <%= content %>
- </p>
- </body>
-</html>
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/bm_app_factorial.rb
deleted file mode 100644
index a5a5de0426..0000000000
--- a/benchmark/bm_app_factorial.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-def fact(n)
- if(n > 1)
- n * fact(n-1)
- else
- 1
- end
-end
-
-8.times{
- fact(5000)
-} \ No newline at end of file
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
deleted file mode 100644
index a0dcf5e874..0000000000
--- a/benchmark/bm_app_mandelbrot.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-require 'complex'
-
-def mandelbrot? z
- i = 0
- while i<100
- i+=1
- z = z * z
- return false if z.abs > 2
- end
- true
-end
-
-ary = []
-
-(0..100).each{|dx|
- (0..100).each{|dy|
- x = dx / 50.0
- y = dy / 50.0
- c = Complex(x, y)
- ary << c if mandelbrot?(c)
- }
-}
-
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
deleted file mode 100644
index 59c63f358e..0000000000
--- a/benchmark/bm_app_pentomino.rb
+++ /dev/null
@@ -1,259 +0,0 @@
-#!/usr/local/bin/ruby
-# This program is contributed by Shin Nishiyama
-
-
-# modified by K.Sasada
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n, a, nb)
- nb.each{|x|
- a[n] = x
- if n == NP-1
- $p << [a.sort]
- else
- nbc=nb.dup
- [-ROW, -1, 1, ROW].each{|d|
- if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
- nbc << x+d
- end
- }
- nbc.delete x
- piece(n+1,a[0..n],nbc)
- end
- }
-end
-
-def kikaku(a)
- a.collect {|x| x - a[0]}
-end
-def ud(a)
- kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
- kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
- kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
- piece(0,[],[0])
- $p.each do |a|
- a0 = a[0]
- a[1] = ud(a0)
- a[2] = rl(a0)
- a[3] = ud(rl(a0))
- a[4] = xy(a0)
- a[5] = ud(xy(a0))
- a[6] = rl(xy(a0))
- a[7] = ud(rl(xy(a0)))
- a.sort!
- a.uniq!
- end
- $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
- (0...ROW*COL).each{|i|
- if i % ROW >= ROW-NP
- $b[i] = -2
- else
- $b[i] = -1
- end
- $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
- }
-end
-
-def pboard
- return # skip print
- print "No. #$no\n"
- (0...COL).each{|i|
- print "|"
- (0...ROW-NP).each{|j|
- x = $b[i*ROW+j]
- if x < 0
- print "..|"
- else
- printf "%2d|",x+1
- end
- }
- print "\n"
- }
- print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
- if a.length == $p.length then
- $no += 1
- pboard
- return
- end
- while $b[pos] != -1
- pos += 1
- end
- ($pnum - a).each do |i|
- $p[i].each do |x|
- f = 0
- x.each{|s|
- if $b[pos+s] != -1
- f=1
- break
- end
- }
- if f == 0 then
- x.each{|s|
- $b[pos+s] = i
- }
- a << i
- setpiece(a.dup, pos)
- a.pop
- x.each{|s|
- $b[pos+s] = -1
- }
- end
- end
- end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
-
-
-__END__
-
-# original
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n,a,nb)
- for x in nb
- a[n] = x
- if n == NP-1
- $p << [a.sort]
- else
- nbc=nb.dup
- for d in [-ROW, -1, 1, ROW]
- if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
- nbc << x+d
- end
- end
- nbc.delete x
- piece(n+1,a[0..n],nbc)
- end
- end
-end
-
-def kikaku(a)
- a.collect {|x| x - a[0]}
-end
-def ud(a)
- kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
- kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
- kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
- piece(0,[],[0])
- $p.each do |a|
- a0 = a[0]
- a[1] = ud(a0)
- a[2] = rl(a0)
- a[3] = ud(rl(a0))
- a[4] = xy(a0)
- a[5] = ud(xy(a0))
- a[6] = rl(xy(a0))
- a[7] = ud(rl(xy(a0)))
- a.sort!
- a.uniq!
- end
- $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
- for i in 0...ROW*COL
- if i % ROW >= ROW-NP
- $b[i] = -2
- else
- $b[i] = -1
- end
- $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
- end
-end
-
-def pboard
- print "No. #$no\n"
- for i in 0...COL
- print "|"
- for j in 0...ROW-NP
- x = $b[i*ROW+j]
- if x < 0
- print "..|"
- else
- printf "%2d|",x+1
- end
- end
- print "\n"
- end
- print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
- if a.length == $p.length then
- $no += 1
- pboard
- return
- end
- while $b[pos] != -1
- pos += 1
- end
- ($pnum - a).each do |i|
- $p[i].each do |x|
- f = 0
- for s in x do
- if $b[pos+s] != -1
- f=1
- break
- end
- end
- if f == 0 then
- for s in x do
- $b[pos+s] = i
- end
- a << i
- setpiece(a.dup, pos)
- a.pop
- for s in x do
- $b[pos+s] = -1
- end
- end
- end
- end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/bm_app_raise.rb
deleted file mode 100644
index 01d2ae3219..0000000000
--- a/benchmark/bm_app_raise.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i=0
-while i<300000
- i+=1
- begin
- raise
- rescue
- end
-end
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/bm_app_strconcat.rb
deleted file mode 100644
index c6ef817263..0000000000
--- a/benchmark/bm_app_strconcat.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i=0
-while i<500000
- "#{1+1} #{1+1} #{1+1}"
- i+=1
-end
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb
deleted file mode 100644
index 7adbe9ea5e..0000000000
--- a/benchmark/bm_io_file_create.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-#
-# Create files
-#
-
-max = 50_000
-file = './tmpfile_of_bm_io_file_create'
-
-max.times{
- f = open(file, 'w')
- f.close#(true)
-}
-File.unlink(file)
-
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb
deleted file mode 100644
index 2b4212db76..0000000000
--- a/benchmark/bm_io_file_read.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-#
-# Seek and Read file.
-#
-
-require 'tempfile'
-
-max = 20_000
-str = "Hello world! " * 1000
-f = Tempfile.new('yarv-benchmark')
-f.write str
-
-max.times{
- f.seek 0
- f.read
-}
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb
deleted file mode 100644
index 3cec58c6ae..0000000000
--- a/benchmark/bm_io_file_write.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-#
-# Seek and Write file.
-#
-
-require 'tempfile'
-
-max = 20_000
-str = "Hello world! " * 1000
-f = Tempfile.new('yarv-benchmark')
-
-max.times{
- f.seek 0
- f.write str
-}
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
deleted file mode 100644
index 43d35e1131..0000000000
--- a/benchmark/bm_loop_whileloop.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i=0
-while i<30_000_000 # benchmark loop 1
- i+=1
-end
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
deleted file mode 100644
index e514989661..0000000000
--- a/benchmark/bm_loop_whileloop2.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i=0
-while i< 6_000_000 # benchmark loop 2
- i+=1
-end
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
deleted file mode 100644
index 7db5be9050..0000000000
--- a/benchmark/bm_so_ackermann.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-def ack(m, n)
- if m == 0 then
- n + 1
- elsif n == 0 then
- ack(m - 1, 1)
- else
- ack(m - 1, ack(m, n - 1))
- end
-end
-
-NUM = 9
-ack(3, NUM)
-
-
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
deleted file mode 100644
index 2b8fce8f99..0000000000
--- a/benchmark/bm_so_array.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan and Mark Hubbart
-
-n = 9000 # Integer(ARGV.shift || 1)
-
-x = Array.new(n)
-y = Array.new(n, 0)
-
-n.times{|bi|
- x[bi] = bi + 1
-}
-
-(0 .. 999).each do |e|
- (n-1).step(0,-1) do |bi|
- y[bi] += x.at(bi)
- end
-end
-# puts "#{y.first} #{y.last}"
-
-
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
deleted file mode 100644
index 6a26465578..0000000000
--- a/benchmark/bm_so_binary_trees.rb
+++ /dev/null
@@ -1,57 +0,0 @@
-# The Computer Language Shootout Benchmarks
-# http://shootout.alioth.debian.org
-#
-# contributed by Jesse Millikan
-
-# disable output
-def STDOUT.write_ *args
-end
-
-def item_check(tree)
- if tree[0] == nil
- tree[1]
- else
- tree[1] + item_check(tree[0]) - item_check(tree[2])
- end
-end
-
-def bottom_up_tree(item, depth)
- if depth > 0
- item_item = 2 * item
- depth -= 1
- [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
- else
- [nil, item, nil]
- end
-end
-
-max_depth = 12 # 16 # ARGV[0].to_i
-min_depth = 4
-
-max_depth = min_depth + 2 if min_depth + 2 > max_depth
-
-stretch_depth = max_depth + 1
-stretch_tree = bottom_up_tree(0, stretch_depth)
-
-puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
-stretch_tree = nil
-
-long_lived_tree = bottom_up_tree(0, max_depth)
-
-min_depth.step(max_depth + 1, 2) do |depth|
- iterations = 2**(max_depth - depth + min_depth)
-
- check = 0
-
- for i in 1..iterations
- temp_tree = bottom_up_tree(i, depth)
- check += item_check(temp_tree)
-
- temp_tree = bottom_up_tree(-i, depth)
- check += item_check(temp_tree)
- end
-
- puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
-end
-
-puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
deleted file mode 100644
index 82629688b7..0000000000
--- a/benchmark/bm_so_concatenate.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
-
-STUFF = "hello\n"
-i=0
-while i<10
- i+=1
- hello = ''
- 400000.times do |e|
- hello << STUFF
- end
-end
-# puts hello.length
-
-
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
deleted file mode 100644
index 65f6337a4a..0000000000
--- a/benchmark/bm_so_count_words.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan
-
-input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
-
-nl = nw = nc = 0
-while true
- tmp = input.read(4096) or break
- data = tmp << (input.gets || "")
- nc += data.length
- nl += data.count("\n")
- ((data.strip! || data).tr!("\n", " ") || data).squeeze!
- nw += data.count(" ") + 1
-end
-# STDERR.puts "#{nl} #{nw} #{nc}"
-
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
deleted file mode 100644
index d8b461290c..0000000000
--- a/benchmark/bm_so_exception.rb
+++ /dev/null
@@ -1,61 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-$HI = 0
-$LO = 0
-NUM = 250000 # Integer(ARGV[0] || 1)
-
-
-class Lo_Exception < Exception
- def initialize(num)
- @value = num
- end
-end
-
-class Hi_Exception < Exception
- def initialize(num)
- @value = num
- end
-end
-
-def some_function(num)
- begin
- hi_function(num)
- rescue
- print "We shouldn't get here, exception is: #{$!.type}\n"
- end
-end
-
-def hi_function(num)
- begin
- lo_function(num)
- rescue Hi_Exception
- $HI = $HI + 1
- end
-end
-
-def lo_function(num)
- begin
- blowup(num)
- rescue Lo_Exception
- $LO = $LO + 1
- end
-end
-
-def blowup(num)
- if num % 2 == 0
- raise Lo_Exception.new(num)
- else
- raise Hi_Exception.new(num)
- end
-end
-
-
-i = 1
-max = NUM+1
-while i < max
- i+=1
- some_function(i+1)
-end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
deleted file mode 100644
index a214f2e205..0000000000
--- a/benchmark/bm_so_fannkuch.rb
+++ /dev/null
@@ -1,45 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-# Modified by Ryan Williams
-
-def fannkuch(n)
- maxFlips, m, r, check = 0, n-1, n, 0
- count = (1..n).to_a
- perm = (1..n).to_a
-
- while true
- if check < 30
- puts "#{perm}"
- check += 1
- end
-
- while r != 1
- count[r-1] = r
- r -= 1
- end
-
- if perm[0] != 1 and perm[m] != n
- perml = perm.clone #.dup
- flips = 0
- while (k = perml.first ) != 1
- perml = perml.slice!(0, k).reverse + perml
- flips += 1
- end
- maxFlips = flips if flips > maxFlips
- end
- while true
- if r==n then return maxFlips end
- perm.insert r,perm.shift
- break if (count[r] -= 1) > 0
- r += 1
- end
- end
-end
-
-def puts *args
-end
-
-N = 10 # (ARGV[0] || 1).to_i
-puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
-
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
deleted file mode 100644
index 3f759ba7ae..0000000000
--- a/benchmark/bm_so_fasta.rb
+++ /dev/null
@@ -1,81 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-$last = 42.0
-def gen_random (max,im=139968,ia=3877,ic=29573)
- (max * ($last = ($last * ia + ic) % im)) / im
-end
-
-alu =
- "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
- "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
- "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
- "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
- "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
- "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
- "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-iub = [
- ["a", 0.27],
- ["c", 0.12],
- ["g", 0.12],
- ["t", 0.27],
-
- ["B", 0.02],
- ["D", 0.02],
- ["H", 0.02],
- ["K", 0.02],
- ["M", 0.02],
- ["N", 0.02],
- ["R", 0.02],
- ["S", 0.02],
- ["V", 0.02],
- ["W", 0.02],
- ["Y", 0.02],
-]
-homosapiens = [
- ["a", 0.3029549426680],
- ["c", 0.1979883004921],
- ["g", 0.1975473066391],
- ["t", 0.3015094502008],
-]
-
-def make_repeat_fasta(id, desc, src, n)
- puts ">#{id} #{desc}"
- v = nil
- width = 60
- l = src.length
- s = src * ((n / l) + 1)
- s.slice!(n, l)
- puts(s.scan(/.{1,#{width}}/).join("\n"))
-end
-
-def make_random_fasta(id, desc, table, n)
- puts ">#{id} #{desc}"
- rand, v = nil,nil
- width = 60
- chunk = 1 * width
- prob = 0.0
- table.each{|v| v[1]= (prob += v[1])}
- for i in 1..(n/width)
- puts((1..width).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
- if n%width != 0
- puts((1..(n%width)).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
-end
-
-
-n = (ARGV[0] or 250_000).to_i
-
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
deleted file mode 100644
index dadab3e79c..0000000000
--- a/benchmark/bm_so_k_nucleotide.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
- n, table = seq.length - length + 1, Hash.new(0)
- f, i = nil, nil
- (0 ... length).each do |f|
- (f ... n).step(length) do |i|
- table[seq[i,length]] += 1
- end
- end
- [n,table]
-
-end
-
-def sort_by_freq( seq,length )
- n,table = frecuency( seq,length )
- a, b, v = nil, nil, nil
- table.sort{|a,b| b[1] <=> a[1]}.each do |v|
- puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
- end
- puts
-end
-
-def find_seq( seq,s )
- n,table = frecuency( seq,s.length )
- puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
- seq << line.chomp
- line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
diff --git a/benchmark/bm_so_lists.rb b/benchmark/bm_so_lists.rb
deleted file mode 100644
index 3652288881..0000000000
--- a/benchmark/bm_so_lists.rb
+++ /dev/null
@@ -1,47 +0,0 @@
-#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
-
-NUM = 100
-SIZE = 10000
-
-def test_lists()
- # create a list of integers (Li1) from 1 to SIZE
- li1 = (1..SIZE).to_a
- # copy the list to li2 (not by individual items)
- li2 = li1.dup
- # remove each individual item from left side of li2 and
- # append to right side of li3 (preserving order)
- li3 = Array.new
- while (not li2.empty?)
- li3.push(li2.shift)
- end
- # li2 must now be empty
- # remove each individual item from right side of li3 and
- # append to right side of li2 (reversing list)
- while (not li3.empty?)
- li2.push(li3.pop)
- end
- # li3 must now be empty
- # reverse li1 in place
- li1.reverse!
- # check that first item is now SIZE
- if li1[0] != SIZE then
- p "not SIZE"
- 0
- else
- # compare li1 and li2 for equality
- if li1 != li2 then
- return(0)
- else
- # return the length of the list
- li1.length
- end
- end
-end
-
-i = 0
-while i<NUM
- i+=1
- result = test_lists()
-end
-
-result
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
deleted file mode 100644
index 0f274ad06c..0000000000
--- a/benchmark/bm_so_matrix.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-n = 60 #Integer(ARGV.shift || 1)
-
-size = 30
-
-def mkmatrix(rows, cols)
- count = 1
- mx = Array.new(rows)
- (0 .. (rows - 1)).each do |bi|
- row = Array.new(cols, 0)
- (0 .. (cols - 1)).each do |j|
- row[j] = count
- count += 1
- end
- mx[bi] = row
- end
- mx
-end
-
-def mmult(rows, cols, m1, m2)
- m3 = Array.new(rows)
- (0 .. (rows - 1)).each do |bi|
- row = Array.new(cols, 0)
- (0 .. (cols - 1)).each do |j|
- val = 0
- (0 .. (cols - 1)).each do |k|
- val += m1.at(bi).at(k) * m2.at(k).at(j)
- end
- row[j] = val
- end
- m3[bi] = row
- end
- m3
-end
-
-m1 = mkmatrix(size, size)
-m2 = mkmatrix(size, size)
-mm = Array.new
-n.times do
- mm = mmult(size, size, m1, m2)
-end
-# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
-
-
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
deleted file mode 100644
index 99cf6a91cc..0000000000
--- a/benchmark/bm_so_meteor_contest.rb
+++ /dev/null
@@ -1,564 +0,0 @@
-#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-# contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM: the main body is at the bottom.
-# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# 2) see how I represent a board as a bitmask by reading the blank_board comments
-# 3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
- # an array (by location) containing a bit mask for how the piece maps at the given location.
- # if the rotation is invalid at that location the mask will contain false
- attr_reader :start_masks
-
- # maps a direction to a relative location. these differ depending on whether it is an even or
- # odd row being mapped from
- @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
- @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
- def initialize( directions )
- @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
- @even_mask = mask_for_offsets( @even_offsets)
- @odd_mask = mask_for_offsets( @odd_offsets)
-
- @start_masks = Array.new(60)
-
- # create the rotational masks by placing the base mask at the location and seeing if
- # 1) it overlaps the boundries and 2) it produces a prunable board. if either of these
- # is true the piece cannot be placed
- 0.upto(59) do | offset |
- mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
- if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
- imask = compute_required( mask, offset)
- @start_masks[offset] = [ mask, imask, imask | mask ]
- else
- @start_masks[offset] = false
- end
- end
- end
-
- def compute_required( mask, offset )
- board = blank_board
- 0.upto(offset) { | i | board |= 1 << i }
- board |= mask
- return 0 if (!prunable(board | mask, offset))
- board = flood_fill(board,58)
- count = 0
- imask = 0
- 0.upto(59) do | i |
- if (board[i] == 0) then
- imask |= (1 << i)
- count += 1
- end
- end
- (count > 0 && count < 5) ? imask : 0
- end
-
- def flood_fill( board, location)
- return board if (board[location] == 1)
- board |= 1 << location
- row, col = location.divmod(6)
- board = flood_fill( board, location - 1) if (col > 0)
- board = flood_fill( board, location + 1) if (col < 4)
- if (row % 2 == 0) then
- board = flood_fill( board, location - 7) if (col > 0 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 5) if (col > 0 && row < 9)
- else
- board = flood_fill( board, location - 5) if (col < 4 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 7) if (col < 4 && row < 9)
- end
- board
- end
-
- # given a location, produces a list of relative locations covered by the piece at this rotation
- def offsets( location)
- if is_even( location) then
- @even_offsets.collect { | value | value + location }
- else
- @odd_offsets.collect { | value | value + location }
- end
- end
-
- # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
- # this is hard to explain. imagine we have this partial board:
- # 0 0 0 0 0 x [positions 0-5]
- # 0 0 1 1 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 1 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # The top-left of the piece is at position 8, the
- # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
- # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
- # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
- # 0 0 0 1 1 x [positions 0-5]
- # 0 0 1 0 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 0 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
- # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
- # this function would return
- def normalize_offsets( values)
- min = values.min
- even_min = is_even(min)
- other_min = even_min ? min + 6 : min + 7
- other_values = values.collect do | value |
- if is_even(value) then
- value + 6 - other_min
- else
- value + 7 - other_min
- end
- end
- values.collect! { | value | value - min }
-
- if even_min then
- [values, other_values]
- else
- [other_values, values]
- end
- end
-
- # produce a bitmask representation of an array of offset locations
- def mask_for_offsets( offsets )
- mask = 0
- offsets.each { | value | mask = mask + ( 1 << value ) }
- mask
- end
-
- # finds a "safe" position that a position as described by a list of directions can be placed
- # without falling off any edge of the board. the values returned a location to place the first piece
- # at so it will fit after making the described moves
- def start_adjust( directions )
- south = east = 0;
- directions.each do | direction |
- east += 1 if ( direction == :sw || direction == :nw || direction == :west )
- south += 1 if ( direction == :nw || direction == :ne )
- end
- south * 6 + east
- end
-
- # given a set of directions places the piece (as defined by a set of directions) on the board at
- # a location that will not take it off the edge
- def get_values ( directions )
- start = start_adjust(directions)
- values = [ start ]
- directions.each do | direction |
- if (start % 12 >= 6) then
- start += @@rotation_odd_adder[direction]
- else
- start += @@rotation_even_adder[direction]
- end
- values += [ start ]
- end
-
- # some moves take you back to an existing location, we'll strip duplicates
- values.uniq
- end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-# rotations -- all the rotations of the piece
-# type -- a numeic "name" of the piece
-# masks -- an array by location of all legal rotational masks (a n inner array) for that location
-# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
- attr_reader :rotations, :type, :masks
- attr_accessor :placed
-
- # transform hashes that change one direction into another when you either flip or rotate a set of directions
- @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
- @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
- def initialize( directions, type )
- @type = type
- @rotations = Array.new();
- @map = {}
-
- generate_rotations( directions )
- directions.collect! { | value | @@flip_converter[value] }
- generate_rotations( directions )
-
- # creates the masks AND a map that returns [location, rotation] for any given mask
- # this is used when a board is found and we want to draw it, otherwise the map is unused
- @masks = Array.new();
- 0.upto(59) do | i |
- even = true
- @masks[i] = @rotations.collect do | rotation |
- mask = rotation.start_masks[i]
- @map[mask[0]] = [ i, rotation ] if (mask)
- mask || nil
- end
- @masks[i].compact!
- end
- end
-
- # rotates a set of directions through all six angles and adds a Rotation to the list for each one
- def generate_rotations( directions )
- 6.times do
- rotations.push( Rotation.new(directions))
- directions.collect! { | value | @@rotate_converter[value] }
- end
- end
-
- # given a board string, adds this piece to the board at whatever location/rotation
- # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
- def fill_string( board_string)
- location, rotation = @map[@placed]
- rotation.offsets(location).each do | offset |
- row, col = offset.divmod(6)
- board_string[ row*5 + col, 1 ] = @type.to_s
- end
- end
-end
-
-# a blank bit board having this form:
-#
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
- 0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
- 0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
- (location % 12) < 6
-end
-
-# support function that create three utility maps:
-# $converter -- for each row an array that maps a five bit row (via array mapping)
-# to the a a five bit representation of the bits below it
-# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-# a region array has three values the first is a mask of bits in the region,
-# the second is the count of those bits and the third is identical to the first
-# examples:
-# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-# 0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
- odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
- even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
- all_odds = Array.new(0b100000)
- all_evens = Array.new(0b100000)
- bit_counts = Array.new(0b100000)
- new_regions = Array.new(0b100000)
- 0.upto(0b11111) do | i |
- bit_count = odd = even = 0
- 0.upto(4) do | bit |
- if (i[bit] == 1) then
- bit_count += 1
- odd |= odd_map[bit]
- even |= even_map[bit]
- end
- end
- all_odds[i] = odd
- all_evens[i] = even
- bit_counts[i] = bit_count
- new_regions[i] = create_regions( i)
- end
-
- $converter = []
- 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
- $bit_counts = bit_counts
- $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five. The following board is an example of a prunable board:
-# 0 0 1 0 0
-# 0 1 0 0 0
-# 1 1 0 0 0
-# 0 1 0 0 0
-# 0 0 0 0 0
-# ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-# board -- an initial bit board (6 bit padded rows, see blank_board for format)
-# location -- starting location, everything above and to the left is already full
-# slotting -- set to true only when testing initial pieces, when filling normally
-# additional assumptions are possible
-#
-# Algorithm:
-# The algorithm starts at the top row (as determined by location) and iterates a row at a time
-# maintainng counts of active open areas (kept in the collector array) each collector contains
-# three values at the start of an iteration:
-# 0: mask of bits that would be adjacent to the collector in this row
-# 1: the number of bits collected so far
-# 2: a scratch space starting as zero, but used during the computation to represent
-# the empty bits in the new row that are adjacent (position 0)
-# The exact procedure is described in-code
-def prunable( board, location, slotting = false)
- collectors = []
- # loop accross the rows
- (location / 6).to_i.upto(9) do | row_on |
- # obtain a set of regions representing the bits of the curent row.
- regions = $regions[(board >> (row_on * 6)) & 0b11111]
- converter = $converter[row_on]
-
- # track the number of collectors at the start of the cycle so that
- # we don't compute against newly created collectors, only existing collectors
- initial_collector_count = collectors.length
-
- # loop against the regions. For each region of the row
- # we will see if it connects to one or more existing collectors.
- # if it connects to 1 collector, the bits from the region are added to the
- # bits of the collector and the mask is placed in collector[2]
- # If the region overlaps more than one collector then all the collectors
- # it overlaps with are merged into the first one (the others are set to nil in the array)
- # if NO collectors are found then the region is copied as a new collector
- regions.each do | region |
- collector_found = nil
- region_mask = region[2]
- initial_collector_count.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- collector_mask = collector[0]
- if (collector_mask & region_mask != 0) then
- if (collector_found) then
- collector_found[0] |= collector_mask
- collector_found[1] += collector[1]
- collector_found[2] |= collector[2]
- collectors[collector_num] = nil
- else
- collector_found = collector
- collector[1] += region[1]
- collector[2] |= region_mask
- end
- end
- end
- end
- if (collector_found == nil) then
- collectors.push(Array.new(region))
- end
- end
-
- # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
- # be zero. The size of any such reaason is tested if it is not a muliple of five true is returned since
- # the board is prunable. if it is a multiple of five it is removed.
- # Collector that are still active have a new adjacent value [0] set based n the matched bits
- # and have [2] cleared out for the next cycle.
- collectors.length.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- if (collector[2] == 0) then
- return true if (collector[1] % 5 != 0)
- collectors[collector_num] = nil
- else
- # if a collector matches all bits in the row then we can return unprunable early for the
- # follwing reasons:
- # 1) there can be no more unavailable bits bince we fill from the top left downward
- # 2) all previous regions have been closed or joined so only this region can fail
- # 3) this region must be good since there can never be only 1 region that is nuot
- # a multiple of five
- # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
- # in pieces to see what configurations work for them (the only other time this algorithm is used).
- return false if (collector[2] == 0b11111 && !slotting)
- collector[0] = converter[collector[2]]
- collector[2] = 0
- end
- end
- end
-
- # get rid of all the empty converters for the next round
- collectors.compact!
- end
- return false if (collectors.length <= 1) # 1 collector or less and the region is fine
- collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask. see prunable for what a "region" is
-def create_regions( value )
- regions = []
- cur_region = 0
- 5.times do | bit |
- if (value[bit] == 0) then
- cur_region |= 1 << bit
- else
- if (cur_region != 0 ) then
- regions.push( cur_region)
- cur_region = 0;
- end
- end
- end
- regions.push(cur_region) if (cur_region != 0)
- regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
- find_top( 1)
- find_top( 0)
- print_results
-end
-
-# show the board
-def print_results
- print "#{@boards_found} solutions found\n\n"
- print_full_board( @min_board)
- print "\n"
- print_full_board( @max_board)
- print "\n"
-end
-
-# finds solutions. This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece. It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-# Since any found solution has an inverse we want to maximize finding solutions that are not already found
-# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
-# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
-# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
-# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-# maximum number
-def find_top( rotation_skip)
- board = blank_board
- (@pieces.length-1).times do
- piece = @pieces.shift
- piece.masks[0].each do | mask, imask, cmask |
- if ((rotation_skip += 1) % 2 == 0) then
- piece.placed = mask
- find( 1, 1, board | mask)
- end
- end
- @pieces.push(piece)
- end
- piece = @pieces.shift
- @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found. depth is acheived via recursion. the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-# start_location -- where to start looking for place for the next piece at
-# placed -- number of pieces placed
-# board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
- # find the next location to place a piece by looking for an empty bit
- while board[start_location] == 1
- start_location += 1
- end
-
- @pieces.length.times do
- piece = @pieces.shift
- piece.masks[start_location].each do | mask, imask, cmask |
- if ( board & cmask == imask) then
- piece.placed = mask
- if (placed == 9) then
- add_board
- else
- find( start_location + 1, placed + 1, board | mask)
- end
- end
- end
- @pieces.push(piece)
- end
-end
-
-# print the board
-def print_full_board( board_string)
- 10.times do | row |
- print " " if (row % 2 == 1)
- 5.times do | col |
- print "#{board_string[row*5 + col,1]} "
- end
- print "\n"
- end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
- board_string = "99999999999999999999999999999999999999999999999999"
- @all_pieces.each { | piece | piece.fill_string( board_string ) }
- save( board_string)
- save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
- if (@all_boards[board_string] == nil) then
- @min_board = board_string if (board_string < @min_board)
- @max_board = board_string if (board_string > @max_board)
- @all_boards.store(board_string,true)
- @boards_found += 1
-
- # the exit motif is a time saver. Ideally the function should return, but those tests
- # take noticable time (performance).
- if (@boards_found == @stop_count) then
- print_results
- exit(0)
- end
- end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
- Piece.new( [ :nw, :ne, :east, :east ], 2),
- Piece.new( [ :ne, :se, :east, :ne ], 7),
- Piece.new( [ :ne, :east, :ne, :nw ], 1),
- Piece.new( [ :east, :sw, :sw, :se ], 6),
- Piece.new( [ :east, :ne, :se, :ne ], 5),
- Piece.new( [ :east, :east, :east, :se ], 0),
- Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
- Piece.new( [ :se, :se, :se, :west ], 9),
- Piece.new( [ :se, :se, :east, :se ], 8),
- Piece.new( [ :east, :east, :sw, :se ], 3)
- ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
-
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
deleted file mode 100644
index d6c5bb9e61..0000000000
--- a/benchmark/bm_so_nbody.rb
+++ /dev/null
@@ -1,148 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
- attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
- def initialize(x, y, z, vx, vy, vz, mass)
- @x, @y, @z = x, y, z
- @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
- @mass = mass * SOLAR_MASS
- end
-
- def move_from_i(bodies, nbodies, dt, i)
- while i < nbodies
- b2 = bodies[i]
- dx = @x - b2.x
- dy = @y - b2.y
- dz = @z - b2.z
-
- distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
- mag = dt / (distance * distance * distance)
- b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
- @vx -= dx * b2_mass_mag
- @vy -= dy * b2_mass_mag
- @vz -= dz * b2_mass_mag
- b2.vx += dx * b_mass_mag
- b2.vy += dy * b_mass_mag
- b2.vz += dz * b_mass_mag
- i += 1
- end
-
- @x += dt * @vx
- @y += dt * @vy
- @z += dt * @vz
- end
-end
-
-def energy(bodies)
- e = 0.0
- nbodies = bodies.size
-
- for i in 0 ... nbodies
- b = bodies[i]
- e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
- for j in (i + 1) ... nbodies
- b2 = bodies[j]
- dx = b.x - b2.x
- dy = b.y - b2.y
- dz = b.z - b2.z
- distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
- e -= (b.mass * b2.mass) / distance
- end
- end
- e
-end
-
-def offset_momentum(bodies)
- px, py, pz = 0.0, 0.0, 0.0
-
- for b in bodies
- m = b.mass
- px += b.vx * m
- py += b.vy * m
- pz += b.vz * m
- end
-
- b = bodies[0]
- b.vx = - px / SOLAR_MASS
- b.vy = - py / SOLAR_MASS
- b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
- # sun
- Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
- # jupiter
- Planet.new(
- 4.84143144246472090e+00,
- -1.16032004402742839e+00,
- -1.03622044471123109e-01,
- 1.66007664274403694e-03,
- 7.69901118419740425e-03,
- -6.90460016972063023e-05,
- 9.54791938424326609e-04),
-
- # saturn
- Planet.new(
- 8.34336671824457987e+00,
- 4.12479856412430479e+00,
- -4.03523417114321381e-01,
- -2.76742510726862411e-03,
- 4.99852801234917238e-03,
- 2.30417297573763929e-05,
- 2.85885980666130812e-04),
-
- # uranus
- Planet.new(
- 1.28943695621391310e+01,
- -1.51111514016986312e+01,
- -2.23307578892655734e-01,
- 2.96460137564761618e-03,
- 2.37847173959480950e-03,
- -2.96589568540237556e-05,
- 4.36624404335156298e-05),
-
- # neptune
- Planet.new(
- 1.53796971148509165e+01,
- -2.59193146099879641e+01,
- 1.79258772950371181e-01,
- 2.68067772490389322e-03,
- 1.62824170038242295e-03,
- -9.51592254519715870e-05,
- 5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
- i = 0
- while i < nbodies
- b = BODIES[i]
- b.move_from_i(BODIES, nbodies, dt, i + 1)
- i += 1
- end
-end
-
-puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
deleted file mode 100644
index a0513f8c47..0000000000
--- a/benchmark/bm_so_nested_loop.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# from Avi Bryant
-
-n = 16 # Integer(ARGV.shift || 1)
-x = 0
-n.times do
- n.times do
- n.times do
- n.times do
- n.times do
- n.times do
- x += 1
- end
- end
- end
- end
- end
-end
-# puts x
-
-
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/bm_so_nsieve_bits.rb
deleted file mode 100644
index 019b8b6382..0000000000
--- a/benchmark/bm_so_nsieve_bits.rb
+++ /dev/null
@@ -1,42 +0,0 @@
-#!/usr/bin/ruby
-#
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# nsieve-bits in Ruby
-# Contributed by Glenn Parker, March 2005
-
-CharExponent = 3
-BitsPerChar = 1 << CharExponent
-LowMask = BitsPerChar - 1
-
-def sieve(m)
- items = "\xFF" * ((m / BitsPerChar) + 1)
- masks = ""
- BitsPerChar.times do |b|
- masks << (1 << b).chr
- end
-
- count = 0
- pmax = m - 1
- 2.step(pmax, 1) do |p|
- if items[p >> CharExponent][p & LowMask] == 1
- count += 1
- p.step(pmax, p) do |mult|
- a = mult >> CharExponent
- b = mult & LowMask
- items[a] -= masks[b] if items[a][b] != 0
- end
- end
- end
- count
-end
-
-n = 9 # (ARGV[0] || 2).to_i
-n.step(n - 2, -1) do |exponent|
- break if exponent < 0
- m = 2 ** exponent * 10_000
- count = sieve(m)
- printf "Primes up to %8d %8d\n", m, count
-end
-
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
deleted file mode 100644
index e8607c7199..0000000000
--- a/benchmark/bm_so_object.rb
+++ /dev/null
@@ -1,56 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Aristarkh Zagorodnikov
-
-class Toggle
- def initialize(start_state)
- @bool = start_state
- end
-
- def value
- @bool
- end
-
- def activate
- @bool = !@bool
- self
- end
-end
-
-class NthToggle < Toggle
- def initialize(start_state, max_counter)
- super start_state
- @count_max = max_counter
- @counter = 0
- end
-
- def activate
- @counter += 1
- if @counter >= @count_max
- @bool = !@bool
- @counter = 0
- end
- self
- end
-end
-
-n = 1500000 # (ARGV.shift || 1).to_i
-
-toggle = Toggle.new 1
-5.times do
- toggle.activate.value ? 'true' : 'false'
-end
-n.times do
- toggle = Toggle.new 1
-end
-
-ntoggle = NthToggle.new 1, 3
-8.times do
- ntoggle.activate.value ? 'true' : 'false'
-end
-n.times do
- ntoggle = NthToggle.new 1, 3
-end
-
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
deleted file mode 100644
index c7d6fbfb4d..0000000000
--- a/benchmark/bm_so_pidigits.rb
+++ /dev/null
@@ -1,92 +0,0 @@
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Gabriele Renzi
-
-class PiDigitSpigot
-
- def initialize()
- @z = Transformation.new 1,0,0,1
- @x = Transformation.new 0,0,0,0
- @inverse = Transformation.new 0,0,0,0
- end
-
- def next!
- @y = @z.extract(3)
- if safe? @y
- @z = produce(@y)
- @y
- else
- @z = consume @x.next!()
- next!()
- end
- end
-
- def safe?(digit)
- digit == @z.extract(4)
- end
-
- def produce(i)
- @inverse.qrst(10,-10*i,0,1).compose(@z)
- end
-
- def consume(a)
- @z.compose(a)
- end
-end
-
-
-class Transformation
- attr_reader :q, :r, :s, :t
- def initialize (q, r, s, t)
- @q,@r,@s,@t,@k = q,r,s,t,0
- end
-
- def next!()
- @q = @k = @k + 1
- @r = 4 * @k + 2
- @s = 0
- @t = 2 * @k + 1
- self
- end
-
- def extract(j)
- (@q * j + @r) / (@s * j + @t)
- end
-
- def compose(a)
- self.class.new( @q * a.q,
- @q * a.r + r * a.t,
- @s * a.q + t * a.s,
- @s * a.r + t * a.t
- )
- end
-
- def qrst *args
- initialize *args
- self
- end
-
-
-end
-
-
-WIDTH = 10
-n = 2_500 # Integer(ARGV[0])
-j = 0
-
-digits = PiDigitSpigot.new
-
-while n > 0
- if n >= WIDTH
- WIDTH.times {print digits.next!}
- j += WIDTH
- else
- n.times {print digits.next!}
- (WIDTH-n).times {print " "}
- j += n
- end
- puts "\t:"+j.to_s
- n -= WIDTH
-end
-
diff --git a/benchmark/bm_so_random.rb b/benchmark/bm_so_random.rb
deleted file mode 100644
index 83c0d6d380..0000000000
--- a/benchmark/bm_so_random.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
-
-IM = 139968.0
-IA = 3877.0
-IC = 29573.0
-
-$last = 42.0
-
-def gen_random(max)
- (max * ($last = ($last * IA + IC) % IM)) / IM
-end
-
-N = 1000000
-
-i=0
-while i<N
- i+=1
- gen_random(100.0)
-end
-# "%.9f" % gen_random(100.0)
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
deleted file mode 100644
index 82ea666994..0000000000
--- a/benchmark/bm_so_reverse_complement.rb
+++ /dev/null
@@ -1,30 +0,0 @@
-#!/usr/bin/ruby
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# Contributed by Peter Bjarke Olsen
-# Modified by Doug King
-
-seq=Array.new
-
-def revcomp(seq)
- seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
- stringlen=seq.length
- 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-while input.gets
- if $_ =~ />/
- if seq.length != 0
- revcomp(seq.join)
- seq=Array.new
- end
- puts $_
- else
- $_.sub(/\n/,'')
- seq.push $_
- end
-end
-revcomp(seq.join)
diff --git a/benchmark/bm_so_sieve.rb b/benchmark/bm_so_sieve.rb
deleted file mode 100644
index dbe2bfa63d..0000000000
--- a/benchmark/bm_so_sieve.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
-num = 40
-count = i = j = 0
-flags0 = Array.new(8192,1)
-k = 0
-while k < num
- k+=1
- count = 0
- flags = flags0.dup
- i = 2
- while i<8192
- i+=1
- if flags[i]
- # remove all multiples of prime: i
- j = i*i
- while j < 8192
- j += i
- flags[j] = nil
- end
- count += 1
- end
- end
-end
-count
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
deleted file mode 100644
index 2dc4e72be5..0000000000
--- a/benchmark/bm_vm1_block.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
- yield
-end
-
-i=0
-while i<30000000 # while loop 1
- i+=1
- m{
- }
-end \ No newline at end of file
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
deleted file mode 100644
index 3e395d9478..0000000000
--- a/benchmark/bm_vm1_const.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-Const = 1
-
-i = 0
-while i<30000000 # while loop 1
- i+= 1
- j = Const
- k = Const
-end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
deleted file mode 100644
index c3b71ead5a..0000000000
--- a/benchmark/bm_vm1_ensure.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-i=0
-while i<30000000 # benchmark loop 1
- i+=1
- begin
- begin
- ensure
- end
- ensure
- end
-end
-
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
deleted file mode 100644
index 4de833a316..0000000000
--- a/benchmark/bm_vm1_ivar.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-@a = 1
-
-i = 0
-while i<30000000 # while loop 1
- i+= 1
- j = @a
- k = @a
-end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
deleted file mode 100644
index c8076c6ab6..0000000000
--- a/benchmark/bm_vm1_ivar_set.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- i+= 1
- @a = 1
- @b = 2
-end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
deleted file mode 100644
index 2d7d7f0b52..0000000000
--- a/benchmark/bm_vm1_length.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-a = 'abc'
-b = [1, 2, 3]
-i=0
-while i<30000000 # while loop 1
- i+=1
- a.length
- b.length
-end
-
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
deleted file mode 100644
index 212f056c6e..0000000000
--- a/benchmark/bm_vm1_neq.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-obj1 = Object.new
-obj2 = Object.new
-
-while i<30000000 # while loop 1
- i+= 1
- obj1 != obj2
-end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
deleted file mode 100644
index f139fed8be..0000000000
--- a/benchmark/bm_vm1_not.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-obj = Object.new
-
-while i<30000000 # while loop 1
- i+= 1
- !obj
-end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
deleted file mode 100644
index 0c98d00e0d..0000000000
--- a/benchmark/bm_vm1_rescue.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i=0
-while i<30000000 # while loop 1
- i+=1
- begin
- rescue
- end
-end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
deleted file mode 100644
index c843ee3d97..0000000000
--- a/benchmark/bm_vm1_simplereturn.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
- return 1
-end
-i=0
-while i<30000000 # while loop 1
- i+=1
- m
-end
-
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
deleted file mode 100644
index a565b6f6dc..0000000000
--- a/benchmark/bm_vm1_swap.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-a = 1
-b = 2
-i=0
-while i<30000000 # while loop 1
- i+=1
- a, b = b, a
-end
-
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
deleted file mode 100644
index e29c11200f..0000000000
--- a/benchmark/bm_vm2_array.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i=0
-while i<6000000 # benchmark loop 2
- i+=1
- a = [1,2,3,4,5,6,7,8,9,10]
-end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
deleted file mode 100644
index 1ec34ad692..0000000000
--- a/benchmark/bm_vm2_case.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-i=0
-while i<6000000 # while loop 2
- case :foo
- when :bar
- raise
- when :baz
- raise
- when :boo
- raise
- when :foo
- i+=1
- end
-end
-
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
deleted file mode 100644
index 375dccc00e..0000000000
--- a/benchmark/bm_vm2_eval.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i=0
-while i<6000000 # benchmark loop 2
- i+=1
- eval("1")
-end
-
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
deleted file mode 100644
index cc94b8ab3d..0000000000
--- a/benchmark/bm_vm2_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
- nil
-end
-
-i=0
-while i<6000000 # benchmark loop 2
- i+=1
- m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
deleted file mode 100644
index 9ec1a0f136..0000000000
--- a/benchmark/bm_vm2_mutex.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-require 'thread'
-
-m = Mutex.new
-
-i=0
-while i<6000000 # benchmark loop 2
- i+=1
- m.synchronize{}
-end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
deleted file mode 100644
index ac9953ce5f..0000000000
--- a/benchmark/bm_vm2_poly_method.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
- def m
- 1
- end
-end
-class C2
- def m
- 2
- end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i=0
-while i<6000000 # benchmark loop 2
- o = (i % 2 == 0) ? o1 : o2
- o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
- i+=1
-end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
deleted file mode 100644
index 856ba9b161..0000000000
--- a/benchmark/bm_vm2_poly_method_ov.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
- def m
- 1
- end
-end
-class C2
- def m
- 2
- end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i=0
-while i<6000000 # benchmark loop 2
- o = (i % 2 == 0) ? o1 : o2
-# o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
- i+=1
-end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
deleted file mode 100644
index 0bd05b9544..0000000000
--- a/benchmark/bm_vm2_proc.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-def m &b
- b
-end
-
-pr = m{
- a = 1
-}
-
-i=0
-while i<6000000 # benchmark loop 2
- i+=1
- pr.call
-end
-
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
deleted file mode 100644
index 44f6ed402e..0000000000
--- a/benchmark/bm_vm2_regexp.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i=0
-str = 'xxxhogexxx'
-while i<6000000 # benchmark loop 2
- /hoge/ =~ str
- i+=1
-end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
deleted file mode 100644
index c20dbdd26c..0000000000
--- a/benchmark/bm_vm2_send.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
- def m
- end
-end
-
-o = C.new
-
-i=0
-while i<6000000 # benchmark loop 2
- i+=1
- o.__send__ :m
-end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
deleted file mode 100644
index 70c86b376f..0000000000
--- a/benchmark/bm_vm2_super.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-
-class C
- def m
- 1
- end
-end
-
-class CC < C
- def m
- super()
- end
-end
-
-obj = CC.new
-
-i = 0
-while i<6000000 # benchmark loop 2
- obj.m
- i+=1
-end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
deleted file mode 100644
index e12bd2ade0..0000000000
--- a/benchmark/bm_vm2_unif1.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-def m a, b
-end
-
-while i<6000000 # benchmark loop 2
- i+=1
- m 100, 200
-end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
deleted file mode 100644
index 3a75960403..0000000000
--- a/benchmark/bm_vm2_zsuper.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-i = 0
-
-class C
- def m a
- 1
- end
-end
-
-class CC < C
- def m a
- super
- end
-end
-
-obj = CC.new
-
-while i<6000000 # benchmark loop 2
- obj.m 10
- i+=1
-end
diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/bm_vm3_gc.rb
deleted file mode 100755
index 7db9829d44..0000000000
--- a/benchmark/bm_vm3_gc.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-#! /usr/bin/ruby
-5000.times do
- 100.times do
- {"xxxx"=>"yyyy"}
- end
- GC.start
-end
diff --git a/benchmark/bm_vm3_thread_create_join.rb b/benchmark/bm_vm3_thread_create_join.rb
deleted file mode 100644
index 325a66d587..0000000000
--- a/benchmark/bm_vm3_thread_create_join.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i=0
-while i<100_000 # benchmark loop 3
- i+=1
- Thread.new{
- }.join
-end
diff --git a/benchmark/bm_vm3_thread_mutex.rb b/benchmark/bm_vm3_thread_mutex.rb
deleted file mode 100644
index 649f1fddac..0000000000
--- a/benchmark/bm_vm3_thread_mutex.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-require 'thread'
-m = Mutex.new
-r = 0
-max = 1000
-(1..max).map{
- Thread.new{
- i=0
- while i<max
- i+=1
- m.synchronize{
- r += 1
- }
- end
- }
-}.each{|e|
- e.join
-}
-raise r.to_s if r != max * max
diff --git a/benchmark/bmx_temp.rb b/benchmark/bmx_temp.rb
deleted file mode 100644
index 0b4b219ca2..0000000000
--- a/benchmark/bmx_temp.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
- nil
-end
-
-i=0
-while i<800000 # benchmark loop 2
- i+=1
- m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/buffer_each.yml b/benchmark/buffer_each.yml
new file mode 100644
index 0000000000..417941104e
--- /dev/null
+++ b/benchmark/buffer_each.yml
@@ -0,0 +1,27 @@
+prelude: |
+ # frozen_string_literal: true
+ Warning[:experimental] = false
+ string = "The quick brown fox jumped over the lazy dog."
+ array = string.bytes
+ buffer = IO::Buffer.for(string)
+benchmark:
+ string.each_byte: |
+ upcased = String.new
+ string.each_byte do |byte|
+ upcased << (byte ^ 32)
+ end
+ array.each: |
+ upcased = String.new
+ array.each do |byte|
+ upcased << (byte ^ 32)
+ end
+ buffer.each: |
+ upcased = String.new
+ buffer.each(:U8) do |offset, byte|
+ upcased << (byte ^ 32)
+ end
+ buffer.each_byte: |
+ upcased = String.new
+ buffer.each_byte do |byte|
+ upcased << (byte ^ 32)
+ end
diff --git a/benchmark/buffer_get.yml b/benchmark/buffer_get.yml
new file mode 100644
index 0000000000..9e1f99d64e
--- /dev/null
+++ b/benchmark/buffer_get.yml
@@ -0,0 +1,25 @@
+prelude: |
+ # frozen_string_literal: true
+ Warning[:experimental] = false
+ string = "The quick brown fox jumped over the lazy dog."
+ buffer = IO::Buffer.for(string)
+ format = [:U32, :U32, :U32, :U32]
+benchmark:
+ string.unpack1: |
+ [
+ string.unpack1("N"),
+ string.unpack1("N", offset: 4),
+ string.unpack1("N", offset: 8),
+ string.unpack1("N", offset: 12),
+ ]
+ buffer.get_value: |
+ [
+ buffer.get_value(:U32, 0),
+ buffer.get_value(:U32, 4),
+ buffer.get_value(:U32, 8),
+ buffer.get_value(:U32, 12),
+ ]
+ buffer.get_values: |
+ buffer.get_values(format, 0)
+ string.unpack: |
+ string.unpack("NNNN")
diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml
new file mode 100644
index 0000000000..655be9d7d8
--- /dev/null
+++ b/benchmark/cgi_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+ # frozen_string_literal: true
+ require 'cgi/escape'
+benchmark:
+ - script: CGI.escapeHTML("")
+ loop_count: 20000000
+ - script: CGI.escapeHTML("abcde")
+ loop_count: 20000000
+ - script: CGI.escapeHTML("abcd<")
+ loop_count: 20000000
+ - script: CGI.escapeHTML("'&\"<>")
+ loop_count: 5000000
+ - prelude: long_no_escape = "abcde" * 300
+ script: CGI.escapeHTML(long_no_escape)
+ loop_count: 1000000
+ - prelude: long_all_escape = "'&\"<>" * 10
+ script: CGI.escapeHTML(long_all_escape)
+ loop_count: 1000000
+ - prelude: | # http://example.com/
+ example_html = <<~HTML
+ <body>
+ <div>
+ <h1>Example Domain</h1>
+ <p>This domain is established to be used for illustrative examples in documents. You may use this
+ domain in examples without prior coordination or asking for permission.</p>
+ <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+ </div>
+ </body>
+ HTML
+ script: CGI.escapeHTML(example_html)
+ loop_count: 1000000
diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml
new file mode 100644
index 0000000000..d0150c5e5b
--- /dev/null
+++ b/benchmark/complex_float_add.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_add: c = a + b
+loop_count: 1000000
diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml
new file mode 100644
index 0000000000..b9f5e1d51c
--- /dev/null
+++ b/benchmark/complex_float_div.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_div: c = a / b
+loop_count: 1000000
diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml
new file mode 100644
index 0000000000..59b096a6dc
--- /dev/null
+++ b/benchmark/complex_float_mul.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_mul: c = a * b
+loop_count: 1000000
diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml
new file mode 100644
index 0000000000..6fcde3125b
--- /dev/null
+++ b/benchmark/complex_float_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_new: c = Complex(a, b)
+loop_count: 1000000
diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml
new file mode 100644
index 0000000000..c40a31ab55
--- /dev/null
+++ b/benchmark/complex_float_power.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_power: c = a ** b
+loop_count: 1000000
diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml
new file mode 100644
index 0000000000..3fafe7cdbe
--- /dev/null
+++ b/benchmark/complex_float_sub.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_sub: c = a - b
+loop_count: 1000000
diff --git a/benchmark/constant_invalidation.rb b/benchmark/constant_invalidation.rb
new file mode 100644
index 0000000000..a95ec6f37e
--- /dev/null
+++ b/benchmark/constant_invalidation.rb
@@ -0,0 +1,22 @@
+$VERBOSE = nil
+
+CONSTANT1 = 1
+CONSTANT2 = 1
+CONSTANT3 = 1
+CONSTANT4 = 1
+CONSTANT5 = 1
+
+def constants
+ [CONSTANT1, CONSTANT2, CONSTANT3, CONSTANT4, CONSTANT5]
+end
+
+500_000.times do
+ constants
+
+ # With previous behavior, this would cause all of the constant caches
+ # associated with the constant lookups listed above to invalidate, meaning
+ # they would all have to be fetched again. With current behavior, it only
+ # invalidates when a name matches, so the following constant set shouldn't
+ # impact the constant lookups listed above.
+ INVALIDATE = true
+end
diff --git a/benchmark/dir_empty_p.rb b/benchmark/dir_empty_p.rb
new file mode 100644
index 0000000000..8329c757cf
--- /dev/null
+++ b/benchmark/dir_empty_p.rb
@@ -0,0 +1,5 @@
+require 'tmpdir'
+max = 100_000
+Dir.mktmpdir('bm_dir_empty_p') do |dir|
+ max.times { Dir.empty?(dir) }
+end
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
deleted file mode 100644
index 687dec26f1..0000000000
--- a/benchmark/driver.rb
+++ /dev/null
@@ -1,251 +0,0 @@
-#
-# Ruby Benchmark driver
-#
-
-first = true
-
-begin
- require 'optparse'
-rescue LoadError
- if first
- first = false
- $:.unshift File.join(File.dirname(__FILE__), '../lib')
- retry
- else
- raise
- end
-end
-
-require 'benchmark'
-require 'pp'
-
-class BenchmarkDriver
- def self.benchmark(opt)
- driver = self.new(opt[:execs], opt[:dir], opt)
- begin
- driver.run
- ensure
- driver.show_results
- end
- end
-
- def output *args
- puts(*args)
- @output and @output.puts(*args)
- end
-
- def message *args
- output(*args) if @verbose
- end
-
- def message_print *args
- if @verbose
- print(*args)
- STDOUT.flush
- @output and @output.print(*args)
- end
- end
-
- def progress_message *args
- unless STDOUT.tty?
- STDERR.print(*args)
- STDERR.flush
- end
- end
-
- def initialize execs, dir, opt = {}
- @execs = execs.map{|e|
- e.strip!
- next if e.empty?
-
- if /(.+)::(.+)/ =~ e
- # ex) ruby-a::/path/to/ruby-a
- v = $1.strip
- e = $2
- else
- v = `#{e} -v`.chomp
- v.sub!(/ patchlevel \d+/, '')
- end
- [e, v]
- }.compact
-
- @dir = dir
- @repeat = opt[:repeat] || 1
- @repeat = 1 if @repeat < 1
- @pattern = opt[:pattern] || nil
- @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
- @output = opt[:output] ? open(opt[:output], 'w') : nil
- @loop_wl1 = @loop_wl2 = nil
- @opt = opt
-
- # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
- @results = []
-
- if @verbose
- @start_time = Time.now
- message @start_time
- @execs.each_with_index{|(e, v), i|
- message "target #{i}: #{v}"
- }
- end
- end
-
- def show_results
- output
-
- if @verbose
- message '-----------------------------------------------------------'
- message 'raw data:'
- message
- message PP.pp(@results, "", 79)
- message
- message "Elapesed time: #{Time.now - @start_time} (sec)"
- end
-
- output '-----------------------------------------------------------'
- output 'benchmark results:'
-
- if @verbose and @repeat > 1
- output "minimum results in each #{@repeat} measurements."
- end
-
- output "name\t#{@execs.map{|(e, v)| v}.join("\t")}"
- @results.each{|v, result|
- rets = []
- s = nil
- result.each_with_index{|e, i|
- r = e.min
- case v
- when /^vm1_/
- if @loop_wl1
- r -= @loop_wl1[i]
- s = '*'
- end
- when /^vm2_/
- if @loop_wl2
- r -= @loop_wl2[i]
- s = '*'
- end
- end
- rets << sprintf("%.3f", r)
- }
- output "#{v}#{s}\t#{rets.join("\t")}"
- }
- end
-
- def files
- flag = {}
- vm1 = vm2 = wl1 = wl2 = false
- @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
- next if @pattern && /#{@pattern}/ !~ File.basename(file)
- case file
- when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
- flag[$1] = true
- end
- file
- }.compact
-
- if flag['vm1'] && !flag['whileloop']
- @files << File.join(@dir, 'bm_loop_whileloop.rb')
- elsif flag['vm2'] && !flag['whileloop2']
- @files << File.join(@dir, 'bm_loop_whileloop2.rb')
- end
-
- @files.sort!
- progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
- @files
- end
-
- def run
- files.each_with_index{|file, i|
- @i = i
- r = measure_file(file)
-
- if /bm_loop_whileloop.rb/ =~ file
- @loop_wl1 = r[1].map{|e| e.min}
- elsif /bm_loop_whileloop2.rb/ =~ file
- @loop_wl2 = r[1].map{|e| e.min}
- end
- }
- end
-
- def measure_file file
- name = File.basename(file, '.rb').sub(/^bm_/, '')
- prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
- load prepare_file if FileTest.exist?(prepare_file)
-
- if @verbose
- output
- output '-----------------------------------------------------------'
- output name
- output
- output File.read(file)
- output
- end
-
- result = [name]
- result << @execs.map{|(e, v)|
- (0...@repeat).map{
- message_print "#{v}\t"
- progress_message '.'
-
- m = measure(e, file)
- message "#{m}"
- m
- }
- }
- @results << result
- result
- end
-
- def measure executable, file
- cmd = "#{executable} #{file}"
- m = Benchmark.measure{
- `#{cmd}`
- }
-
- if $? != 0
- raise "Benchmark process exited with abnormal status (#{$?})"
- end
-
- m.real
- end
-end
-
-if __FILE__ == $0
- opt = {
- :execs => ['ruby'],
- :dir => './',
- :repeat => 1,
- :output => "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}",
- }
-
- parser = OptionParser.new{|o|
- o.on('-e', '--executables [EXECS]',
- "Specify benchmark one or more targets. (exec1; exec2; exec3, ...)"){|e|
- opt[:execs] = e.split(/;/)
- }
- o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
- opt[:dir] = d
- }
- o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
- opt[:pattern] = p
- }
- o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
- opt[:repeat] = n.to_i
- }
- o.on('-o', '--output-file [FILE]', "Output file"){|o|
- opt[:output] = o
- }
- o.on('-q', '--quiet', "Run without notify information except result table."){|q|
- opt[:quiet] = q
- }
- o.on('-v', '--verbose'){|v|
- opt[:verbose] = v
- }
- }
-
- parser.parse!(ARGV)
- BenchmarkDriver.benchmark(opt)
-end
-
diff --git a/benchmark/enum_lazy_flat_map.yml b/benchmark/enum_lazy_flat_map.yml
new file mode 100644
index 0000000000..0ee390a441
--- /dev/null
+++ b/benchmark/enum_lazy_flat_map.yml
@@ -0,0 +1,16 @@
+prelude: |
+ num = (1..).lazy.take(100)
+ ary2 = [[1,2]].cycle.lazy.take(10)
+ ary10 = [[*1..10]].cycle.lazy.take(10)
+ ary20 = [[*1..20]].cycle.lazy.take(10)
+ ary50 = [[*1..50]].cycle.lazy.take(10)
+ ary100 = [[*1..100]].cycle.lazy.take(10)
+
+benchmark:
+ num3: num.flat_map {|x| x}.take(3).to_a
+ num10: num.flat_map {|x| x}.take(3).to_a
+ ary2: ary2.flat_map {|x| x}.take(3).to_a
+ ary10: ary10.flat_map {|x| x}.take(3).to_a
+ ary20: ary20.flat_map {|x| x}.take(3).to_a
+ ary50: ary50.flat_map {|x| x}.take(3).to_a
+ ary100: ary100.flat_map {|x| x}.take(3).to_a
diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb
new file mode 100644
index 0000000000..8832392e65
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_100.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb
new file mode 100644
index 0000000000..329509fa8f
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_20.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb
new file mode 100644
index 0000000000..02ea4d4e71
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_50.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb
new file mode 100644
index 0000000000..2e6434d9c4
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_100.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb
new file mode 100644
index 0000000000..75e6398fee
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_20.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb
new file mode 100644
index 0000000000..59a39b78ff
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_50.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_zip.yml b/benchmark/enum_lazy_zip.yml
new file mode 100644
index 0000000000..4566ff0261
--- /dev/null
+++ b/benchmark/enum_lazy_zip.yml
@@ -0,0 +1,22 @@
+prelude: |
+ a = (1..3).lazy
+ b = a.map {|x| x}
+
+benchmark:
+ first_ary: a.zip(["a", "b", "c"]).first
+ first_nonary: a.zip("a".."c").first
+ first_noarg: a.zip.first
+
+ take3_ary: a.zip(["a", "b", "c"]).take(3).force
+ take3_nonary: a.zip("a".."c").take(3).force
+ take3_noarg: a.zip.take(3).force
+
+ chain-first_ary: b.zip(["a", "b", "c"]).first
+ chain-first_nonary: b.zip("a".."c").first
+ chain-first_noarg: b.zip.first
+
+ chain-take3_ary: b.zip(["a", "b", "c"]).take(3).force
+ chain-take3_nonary: b.zip("a".."c").take(3).force
+ chain-take3_noarg: b.zip.take(3).force
+
+ block: a.zip("a".."c") {|x, y| [x, y]}
diff --git a/benchmark/enum_minmax.yml b/benchmark/enum_minmax.yml
new file mode 100644
index 0000000000..9d01731abb
--- /dev/null
+++ b/benchmark/enum_minmax.yml
@@ -0,0 +1,25 @@
+prelude: |
+ set2 = 2.times.to_a.shuffle.to_set
+ set10 = 10.times.to_a.shuffle.to_set
+ set100 = 100.times.to_a.shuffle.to_set
+ set1000 = 1000.times.to_a.shuffle.to_set
+ set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+ set2.min: set2.min
+ set10.min: set10.min
+ set100.min: set100.min
+ set1000.min: set1000.min
+ set10000.min: set10000.min
+ set2.max: set2.max
+ set10.max: set10.max
+ set100.max: set100.max
+ set1000.max: set1000.max
+ set10000.max: set10000.max
+ set2.minmax: set2.minmax
+ set10.minmax: set10.minmax
+ set100.minmax: set100.minmax
+ set1000.minmax: set1000.minmax
+ set10000.minmax: set10000.minmax
+
+loop_count: 10000
diff --git a/benchmark/enum_sort.yml b/benchmark/enum_sort.yml
new file mode 100644
index 0000000000..6f26e748c6
--- /dev/null
+++ b/benchmark/enum_sort.yml
@@ -0,0 +1,15 @@
+prelude: |
+ set2 = 2.times.to_a.shuffle.to_set
+ set10 = 10.times.to_a.shuffle.to_set
+ set100 = 100.times.to_a.shuffle.to_set
+ set1000 = 1000.times.to_a.shuffle.to_set
+ set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+ set2.sort_by: set2.sort_by { 0 }
+ set10.sort_by: set10.sort_by { 0 }
+ set100.sort_by: set100.sort_by { 0 }
+ set1000.sort_by: set1000.sort_by { 0 }
+ set10000.sort_by: set10000.sort_by { 0 }
+
+loop_count: 10000
diff --git a/benchmark/enum_tally.yml b/benchmark/enum_tally.yml
new file mode 100644
index 0000000000..edd2e040a0
--- /dev/null
+++ b/benchmark/enum_tally.yml
@@ -0,0 +1,4 @@
+prelude: |
+ list = ("aaa".."zzz").to_a*10
+benchmark:
+ tally: list.tally
diff --git a/benchmark/erb_escape_html.yml b/benchmark/erb_escape_html.yml
new file mode 100644
index 0000000000..ca28d756e7
--- /dev/null
+++ b/benchmark/erb_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+ # frozen_string_literal: true
+ require 'erb'
+benchmark:
+ - script: ERB::Util.html_escape("")
+ loop_count: 20000000
+ - script: ERB::Util.html_escape("abcde")
+ loop_count: 20000000
+ - script: ERB::Util.html_escape("abcd<")
+ loop_count: 20000000
+ - script: ERB::Util.html_escape("'&\"<>")
+ loop_count: 5000000
+ - prelude: long_no_escape = "abcde" * 300
+ script: ERB::Util.html_escape(long_no_escape)
+ loop_count: 1000000
+ - prelude: long_all_escape = "'&\"<>" * 10
+ script: ERB::Util.html_escape(long_all_escape)
+ loop_count: 1000000
+ - prelude: | # http://example.com/
+ example_html = <<~HTML
+ <body>
+ <div>
+ <h1>Example Domain</h1>
+ <p>This domain is established to be used for illustrative examples in documents. You may use this
+ domain in examples without prior coordination or asking for permission.</p>
+ <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+ </div>
+ </body>
+ HTML
+ script: ERB::Util.html_escape(example_html)
+ loop_count: 1000000
diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml
new file mode 100644
index 0000000000..15f6c3880b
--- /dev/null
+++ b/benchmark/erb_render.yml
@@ -0,0 +1,24 @@
+prelude: |
+ require 'erb'
+
+ data = <<erb
+ <html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+ </html>
+ erb
+
+ title = "hello world!"
+ content = "hello world!\n" * 10
+
+ src = "def self.render(title, content); #{ERB.new(data).src}; end"
+ mod = Module.new
+ mod.instance_eval(src, "(ERB)")
+benchmark:
+ erb_render: mod.render(title, content)
+loop_count: 1500000
diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml
new file mode 100644
index 0000000000..a36c759f8e
--- /dev/null
+++ b/benchmark/fiber_chain.yml
@@ -0,0 +1,36 @@
+prelude: |
+ def make_link(previous)
+ Fiber.new do
+ while message = previous.resume
+ Fiber.yield(message)
+ end
+ end
+ end
+
+ def make_chain(length = 1000, &block)
+ chain = Fiber.new(&block)
+
+ (length - 1).times do
+ chain = make_link(chain)
+ end
+
+ return chain
+ end
+
+ message = "Hello World!"
+
+ chain = make_chain do
+ while true
+ Fiber.yield(message)
+ end
+ end
+benchmark:
+ make_chain: |
+ make_chain(100) do
+ while true
+ Fiber.yield(message)
+ end
+ end
+ resume_chain: |
+ chain.resume
+loop_count: 5000
diff --git a/benchmark/fiber_locals.yml b/benchmark/fiber_locals.yml
new file mode 100644
index 0000000000..8588686477
--- /dev/null
+++ b/benchmark/fiber_locals.yml
@@ -0,0 +1,8 @@
+prelude: |
+ th = Thread.current
+ th[:key] = :val
+benchmark:
+ key?: th.key?(:key)
+ []: th[:key]
+ keys: th.keys
+loop_count: 1_000_000
diff --git a/benchmark/file_chmod.rb b/benchmark/file_chmod.rb
new file mode 100644
index 0000000000..1cd4760c9d
--- /dev/null
+++ b/benchmark/file_chmod.rb
@@ -0,0 +1,9 @@
+# chmod file
+require 'tempfile'
+max = 200_000
+tmp = Tempfile.new('chmod')
+path = tmp.path
+max.times do
+ File.chmod(0777, path)
+end
+tmp.close!
diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb
new file mode 100644
index 0000000000..bbb44aebac
--- /dev/null
+++ b/benchmark/file_rename.rb
@@ -0,0 +1,11 @@
+# rename file
+require 'tempfile'
+
+max = 100_000
+tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
+a, b = tmp.map { |x| x.path }
+tmp.each { |t| t.close } # Windows can't rename files without closing them
+max.times do
+ File.rename(a, b)
+ File.rename(b, a)
+end
diff --git a/benchmark/float_methods.yml b/benchmark/float_methods.yml
new file mode 100644
index 0000000000..56ea41effc
--- /dev/null
+++ b/benchmark/float_methods.yml
@@ -0,0 +1,14 @@
+prelude: |
+ flo = 4.2
+benchmark:
+ to_f: |
+ flo.to_f
+ abs: |
+ flo.abs
+ magnitude: |
+ flo.magnitude
+ -@: |
+ -flo
+ zero?: |
+ flo.zero?
+loop_count: 20000000
diff --git a/benchmark/float_neg_posi.yml b/benchmark/float_neg_posi.yml
new file mode 100644
index 0000000000..172db1bf6d
--- /dev/null
+++ b/benchmark/float_neg_posi.yml
@@ -0,0 +1,8 @@
+prelude: |
+ flo = 4.2
+benchmark:
+ negative?: |
+ flo.negative?
+ positive?: |
+ flo.positive?
+loop_count: 20000000
diff --git a/benchmark/float_to_s.yml b/benchmark/float_to_s.yml
new file mode 100644
index 0000000000..0abae5cdb8
--- /dev/null
+++ b/benchmark/float_to_s.yml
@@ -0,0 +1,7 @@
+prelude: |
+ floats = [*0.0.step(1.0, 0.0001)]
+
+benchmark:
+ to_s: floats.each {|f| f.to_s}
+
+loop_count: 1000
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
new file mode 100644
index 0000000000..275f58b924
--- /dev/null
+++ b/benchmark/gc/aobench.rb
@@ -0,0 +1 @@
+require_relative '../app_aobench'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
new file mode 100644
index 0000000000..83347cdd20
--- /dev/null
+++ b/benchmark/gc/binary_trees.rb
@@ -0,0 +1 @@
+require_relative '../so_binary_trees'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
new file mode 100644
index 0000000000..23d0b91c6c
--- /dev/null
+++ b/benchmark/gc/gcbench.rb
@@ -0,0 +1,57 @@
+require 'benchmark'
+require 'pp'
+require 'optparse'
+
+$list = true
+$gcprof = false
+
+opt = OptionParser.new
+opt.on('-q'){$list = false}
+opt.on('-d'){$gcprof = false}
+opt.on('-p'){$gcprof = true}
+opt.parse!(ARGV)
+
+script = File.join(File.dirname(__FILE__), ARGV.shift)
+script += '.rb' unless FileTest.exist?(script)
+raise "#{script} not found" unless FileTest.exist?(script)
+
+puts "Script: #{script}"
+
+if $gcprof
+ GC::Profiler.enable
+end
+
+tms = Benchmark.measure{|x|
+ load script
+}
+
+gc_time = 0
+
+if $gcprof
+ gc_time = GC::Profiler.total_time
+ GC::Profiler.report if $list and RUBY_VERSION >= '2.0.0' # before 1.9.3, report() may run infinite loop
+ GC::Profiler.disable
+end
+
+pp GC.stat
+
+puts "#{RUBY_DESCRIPTION} #{GC::OPTS.inspect}" if defined?(GC::OPTS)
+
+desc = "#{RUBY_VERSION}#{RUBY_PATCHLEVEL >= 0 ? "p#{RUBY_PATCHLEVEL}" : "dev"}"
+name = File.basename(script, '.rb')
+
+puts
+puts script
+puts Benchmark::CAPTION
+puts tms
+puts "GC total time (sec): #{gc_time}"
+
+# show High-Water Mark on Linux
+if File.exist?('/proc/self/status') && /VmHWM:\s*(\d+.+)/ =~ File.read('/proc/self/status')
+ puts
+ puts "VmHWM: #{$1.chomp}"
+end
+
+puts
+puts "Summary of #{name} on #{desc}\t#{tms.real}\t#{gc_time}\t#{GC.count}"
+puts " (real time in sec, GC time in sec, GC count)"
diff --git a/benchmark/gc/hash1.rb b/benchmark/gc/hash1.rb
new file mode 100644
index 0000000000..cb030d458d
--- /dev/null
+++ b/benchmark/gc/hash1.rb
@@ -0,0 +1,11 @@
+value = 0.01
+h = {}
+n = 50_000
+
+1.upto(n){|i|
+ h["%020d" % i] = "v-#{i}"
+}
+
+(n * 1_000).times{
+ ''
+}
diff --git a/benchmark/gc/hash2.rb b/benchmark/gc/hash2.rb
new file mode 100644
index 0000000000..e8c943fb21
--- /dev/null
+++ b/benchmark/gc/hash2.rb
@@ -0,0 +1,7 @@
+value = 0.01
+h = {}
+n = 4*(10**6)
+
+1.upto(n){|i|
+ h["%020d" % i] = value * i
+}
diff --git a/benchmark/gc/null.rb b/benchmark/gc/null.rb
new file mode 100644
index 0000000000..c05a79f561
--- /dev/null
+++ b/benchmark/gc/null.rb
@@ -0,0 +1 @@
+# null
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
new file mode 100644
index 0000000000..8ebdff7d1d
--- /dev/null
+++ b/benchmark/gc/pentomino.rb
@@ -0,0 +1 @@
+require_relative '../app_pentomino'
diff --git a/benchmark/gc/rdoc.rb b/benchmark/gc/rdoc.rb
new file mode 100644
index 0000000000..14c89f5611
--- /dev/null
+++ b/benchmark/gc/rdoc.rb
@@ -0,0 +1,13 @@
+require 'rdoc/rdoc'
+require 'tmpdir'
+
+srcdir = File.expand_path('../..', __dir__)
+
+Dir.mktmpdir('rdocbench-'){|d|
+ dir = File.join(d, 'rdocbench')
+ args = %W(--root #{srcdir} --page-dir #{srcdir}/doc --encoding=UTF-8 --no-force-update --all --ri --debug --quiet #{srcdir})
+ args << '--op' << dir
+
+ r = RDoc::RDoc.new
+ r.document args
+}
diff --git a/benchmark/gc/redblack.rb b/benchmark/gc/redblack.rb
new file mode 100644
index 0000000000..c66290140a
--- /dev/null
+++ b/benchmark/gc/redblack.rb
@@ -0,0 +1,366 @@
+# This benchmark is imported from https://github.com/jruby/rubybench/blob/master/time/bench_red_black.rb
+# License is License is Apache-2
+
+require 'benchmark'
+
+# Algorithm based on "Introduction to Algorithms" by Cormen and others
+class RedBlackTree
+ class Node
+ attr_accessor :color
+ attr_accessor :key
+ attr_accessor :left
+ attr_accessor :right
+ attr_accessor :parent
+
+ RED = :red
+ BLACK = :black
+ COLORS = [RED, BLACK].freeze
+
+ def initialize(key, color = RED)
+ raise ArgumentError, "Bad value for color parameter" unless COLORS.include?(color)
+ @color = color
+ @key = key
+ @left = @right = @parent = NilNode.instance
+ end
+
+ def black?
+ return color == BLACK
+ end
+
+ def red?
+ return color == RED
+ end
+ end
+
+ class NilNode < Node
+ class << self
+ private :new
+
+ # it's not thread safe
+ def instance
+ @instance ||= begin
+ def instance
+ return @instance
+ end
+
+ new
+ end
+ end
+ end
+
+ def initialize
+ self.color = BLACK
+ self.key = 0
+ self.left = nil
+ self.right = nil
+ self.parent = nil
+ end
+
+ def nil?
+ return true
+ end
+ end
+
+ include Enumerable
+
+ attr_accessor :root
+ attr_accessor :size
+
+ def initialize
+ self.root = NilNode.instance
+ self.size = 0
+ end
+
+ def add(key)
+ insert(Node.new(key))
+ end
+
+ def insert(x)
+ insert_helper(x)
+
+ x.color = Node::RED
+ while x != root && x.parent.color == Node::RED
+ if x.parent == x.parent.parent.left
+ y = x.parent.parent.right
+ if !y.nil? && y.color == Node::RED
+ x.parent.color = Node::BLACK
+ y.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ x = x.parent.parent
+ else
+ if x == x.parent.right
+ x = x.parent
+ left_rotate(x)
+ end
+ x.parent.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ right_rotate(x.parent.parent)
+ end
+ else
+ y = x.parent.parent.left
+ if !y.nil? && y.color == Node::RED
+ x.parent.color = Node::BLACK
+ y.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ x = x.parent.parent
+ else
+ if x == x.parent.left
+ x = x.parent
+ right_rotate(x)
+ end
+ x.parent.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ left_rotate(x.parent.parent)
+ end
+ end
+ end
+ root.color = Node::BLACK
+ end
+
+ alias << insert
+
+ def delete(z)
+ y = (z.left.nil? || z.right.nil?) ? z : successor(z)
+ x = y.left.nil? ? y.right : y.left
+ x.parent = y.parent
+
+ if y.parent.nil?
+ self.root = x
+ else
+ if y == y.parent.left
+ y.parent.left = x
+ else
+ y.parent.right = x
+ end
+ end
+
+ z.key = y.key if y != z
+
+ if y.color == Node::BLACK
+ delete_fixup(x)
+ end
+
+ self.size -= 1
+ return y
+ end
+
+ def minimum(x = root)
+ while !x.left.nil?
+ x = x.left
+ end
+ return x
+ end
+
+ def maximum(x = root)
+ while !x.right.nil?
+ x = x.right
+ end
+ return x
+ end
+
+ def successor(x)
+ if !x.right.nil?
+ return minimum(x.right)
+ end
+ y = x.parent
+ while !y.nil? && x == y.right
+ x = y
+ y = y.parent
+ end
+ return y
+ end
+
+ def predecessor(x)
+ if !x.left.nil?
+ return maximum(x.left)
+ end
+ y = x.parent
+ while !y.nil? && x == y.left
+ x = y
+ y = y.parent
+ end
+ return y
+ end
+
+ def inorder_walk(x = root)
+ x = self.minimum
+ while !x.nil?
+ yield x.key
+ x = successor(x)
+ end
+ end
+
+ alias each inorder_walk
+
+ def reverse_inorder_walk(x = root)
+ x = self.maximum
+ while !x.nil?
+ yield x.key
+ x = predecessor(x)
+ end
+ end
+
+ alias reverse_each reverse_inorder_walk
+
+ def search(key, x = root)
+ while !x.nil? && x.key != key
+ key < x.key ? x = x.left : x = x.right
+ end
+ return x
+ end
+
+ def empty?
+ return self.root.nil?
+ end
+
+ def black_height(x = root)
+ height = 0
+ while !x.nil?
+ x = x.left
+ height +=1 if x.nil? || x.black?
+ end
+ return height
+ end
+
+private
+
+ def left_rotate(x)
+ raise "x.right is nil!" if x.right.nil?
+ y = x.right
+ x.right = y.left
+ y.left.parent = x if !y.left.nil?
+ y.parent = x.parent
+ if x.parent.nil?
+ self.root = y
+ else
+ if x == x.parent.left
+ x.parent.left = y
+ else
+ x.parent.right = y
+ end
+ end
+ y.left = x
+ x.parent = y
+ end
+
+ def right_rotate(x)
+ raise "x.left is nil!" if x.left.nil?
+ y = x.left
+ x.left = y.right
+ y.right.parent = x if !y.right.nil?
+ y.parent = x.parent
+ if x.parent.nil?
+ self.root = y
+ else
+ if x == x.parent.left
+ x.parent.left = y
+ else
+ x.parent.right = y
+ end
+ end
+ y.right = x
+ x.parent = y
+ end
+
+ def insert_helper(z)
+ y = NilNode.instance
+ x = root
+ while !x.nil?
+ y = x
+ z.key < x.key ? x = x.left : x = x.right
+ end
+ z.parent = y
+ if y.nil?
+ self.root = z
+ else
+ z.key < y.key ? y.left = z : y.right = z
+ end
+ self.size += 1
+ end
+
+ def delete_fixup(x)
+ while x != root && x.color == Node::BLACK
+ if x == x.parent.left
+ w = x.parent.right
+ if w.color == Node::RED
+ w.color = Node::BLACK
+ x.parent.color = Node::RED
+ left_rotate(x.parent)
+ w = x.parent.right
+ end
+ if w.left.color == Node::BLACK && w.right.color == Node::BLACK
+ w.color = Node::RED
+ x = x.parent
+ else
+ if w.right.color == Node::BLACK
+ w.left.color = Node::BLACK
+ w.color = Node::RED
+ right_rotate(w)
+ w = x.parent.right
+ end
+ w.color = x.parent.color
+ x.parent.color = Node::BLACK
+ w.right.color = Node::BLACK
+ left_rotate(x.parent)
+ x = root
+ end
+ else
+ w = x.parent.left
+ if w.color == Node::RED
+ w.color = Node::BLACK
+ x.parent.color = Node::RED
+ right_rotate(x.parent)
+ w = x.parent.left
+ end
+ if w.right.color == Node::BLACK && w.left.color == Node::BLACK
+ w.color = Node::RED
+ x = x.parent
+ else
+ if w.left.color == Node::BLACK
+ w.right.color = Node::BLACK
+ w.color = Node::RED
+ left_rotate(w)
+ w = x.parent.left
+ end
+ w.color = x.parent.color
+ x.parent.color = Node::BLACK
+ w.left.color = Node::BLACK
+ right_rotate(x.parent)
+ x = root
+ end
+ end
+ end
+ x.color = Node::BLACK
+ end
+end
+
+def rbt_bm
+ n = 100_000
+ a1 = []; n.times { a1 << rand(999_999) }
+ a2 = []; n.times { a2 << rand(999_999) }
+
+ start = Time.now
+
+ tree = RedBlackTree.new
+
+ n.times {|i| tree.add(i) }
+ n.times { tree.delete(tree.root) }
+
+ tree = RedBlackTree.new
+ a1.each {|e| tree.add(e) }
+ a2.each {|e| tree.search(e) }
+ tree.inorder_walk {|key| key + 1 }
+ tree.reverse_inorder_walk {|key| key + 1 }
+ n.times { tree.minimum }
+ n.times { tree.maximum }
+
+ return Time.now - start
+end
+
+N = (ARGV[0] || 10).to_i
+
+N.times do
+ # puts rbt_bm.to_f
+ rbt_bm.to_f
+ # puts "GC.count = #{GC.count}" if GC.respond_to?(:count)
+end
diff --git a/benchmark/gc/ring.rb b/benchmark/gc/ring.rb
new file mode 100644
index 0000000000..be2c7b7250
--- /dev/null
+++ b/benchmark/gc/ring.rb
@@ -0,0 +1,29 @@
+# create many old objects
+
+max = 30_000_000
+
+class Ring
+ attr_reader :next_ring
+ def initialize n = nil
+ @next_ring = n
+ end
+
+
+ def size
+ s = 1
+ ring = self
+ while ring.next_ring
+ s += 1
+ ring = ring.next_ring
+ end
+ s
+ end
+end
+
+ring = Ring.new
+
+max.times{
+ ring = Ring.new(ring)
+}
+
+# p ring.size
diff --git a/benchmark/hash_aref_array.rb b/benchmark/hash_aref_array.rb
new file mode 100644
index 0000000000..ac7a683d95
--- /dev/null
+++ b/benchmark/hash_aref_array.rb
@@ -0,0 +1,5 @@
+h = {}
+arrays = (0..99).each_slice(10).to_a
+#STDERR.puts arrays.inspect
+arrays.each { |s| h[s] = s }
+200_000.times { arrays.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym.rb b/benchmark/hash_aref_dsym.rb
new file mode 100644
index 0000000000..af4f8c36d4
--- /dev/null
+++ b/benchmark/hash_aref_dsym.rb
@@ -0,0 +1,4 @@
+h = {}
+syms = ('a'..'z').map { |s| s.to_sym }
+syms.each { |s| h[s] = 1 }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym_long.rb b/benchmark/hash_aref_dsym_long.rb
new file mode 100644
index 0000000000..9d7759379e
--- /dev/null
+++ b/benchmark/hash_aref_dsym_long.rb
@@ -0,0 +1,21 @@
+# [ruby-core:70129] [Bug #11396]
+collection_size = 200000
+sample_size = 10000
+
+values = (1..collection_size).to_a.map do |x|
+ "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
+end
+
+symbol_hash = {}
+
+values.each do |x|
+ symbol_hash[x.to_sym] = 1
+end
+
+# use the same samples each time to minimize deviations
+rng = Random.new(0)
+symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
+
+3000.times do
+ symbol_sample_array.each { |x| symbol_hash[x] }
+end
diff --git a/benchmark/hash_aref_fix.rb b/benchmark/hash_aref_fix.rb
new file mode 100644
index 0000000000..1346890582
--- /dev/null
+++ b/benchmark/hash_aref_fix.rb
@@ -0,0 +1,4 @@
+h = {}
+nums = (1..26).to_a
+nums.each { |i| h[i] = i }
+200_000.times { nums.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_flo.rb b/benchmark/hash_aref_flo.rb
new file mode 100644
index 0000000000..2217274c82
--- /dev/null
+++ b/benchmark/hash_aref_flo.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = [*1..10000].map! {|i| i.fdiv(10)}
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_miss.rb b/benchmark/hash_aref_miss.rb
new file mode 100644
index 0000000000..b0913dd4bb
--- /dev/null
+++ b/benchmark/hash_aref_miss.rb
@@ -0,0 +1,5 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+strs = ('A'..'Z').to_a
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_str.rb b/benchmark/hash_aref_str.rb
new file mode 100644
index 0000000000..19439b061b
--- /dev/null
+++ b/benchmark/hash_aref_str.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_sym.rb b/benchmark/hash_aref_sym.rb
new file mode 100644
index 0000000000..f75d163fe6
--- /dev/null
+++ b/benchmark/hash_aref_sym.rb
@@ -0,0 +1,9 @@
+h = {}
+syms = ('a'..'z').to_a
+begin
+ syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+ syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_sym_long.rb b/benchmark/hash_aref_sym_long.rb
new file mode 100644
index 0000000000..9dab8df7be
--- /dev/null
+++ b/benchmark/hash_aref_sym_long.rb
@@ -0,0 +1,13 @@
+h = {}
+syms = %w[puts warn syswrite write stat bacon lettuce tomato
+some symbols in this array may already be interned others should not be
+hash browns make good breakfast but not cooked using prime numbers
+shift for division entries delete_if keys exist?
+]
+begin
+ syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+ syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_defaults.yml b/benchmark/hash_defaults.yml
new file mode 100644
index 0000000000..833f10e1c7
--- /dev/null
+++ b/benchmark/hash_defaults.yml
@@ -0,0 +1,6 @@
+prelude: |
+ h = Hash.new { :foo }
+benchmark:
+ default_aref: h[1]
+ default_method: h.default(1)
+loop_count: 1000000
diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml
new file mode 100644
index 0000000000..65f521ec94
--- /dev/null
+++ b/benchmark/hash_dup.yml
@@ -0,0 +1,8 @@
+prelude: |
+ small_hash = { a: 1 }
+ larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h
+
+benchmark:
+ dup_small: small_hash.dup
+ dup_larger: larger_hash.dup
+loop_count: 10000
diff --git a/benchmark/hash_first.yml b/benchmark/hash_first.yml
new file mode 100644
index 0000000000..c26df1a7ed
--- /dev/null
+++ b/benchmark/hash_first.yml
@@ -0,0 +1,11 @@
+prelude: |
+ hash1 = 1_000_000.times.to_h { [rand, true]}
+ hash2 = hash1.dup
+ hash2.keys[1..100_000].each { hash2.delete _1 }
+ hash2.delete hash2.first[0]
+
+benchmark:
+ hash1: hash1.first
+ hash2: hash2.first
+
+loop_count: 100_000
diff --git a/benchmark/hash_flatten.rb b/benchmark/hash_flatten.rb
new file mode 100644
index 0000000000..e944aae9f2
--- /dev/null
+++ b/benchmark/hash_flatten.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+1000.times do
+ h.flatten
+end
diff --git a/benchmark/hash_ident_flo.rb b/benchmark/hash_ident_flo.rb
new file mode 100644
index 0000000000..0c7edfed3e
--- /dev/null
+++ b/benchmark/hash_ident_flo.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = (1..10000).to_a.map!(&:to_f)
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_ident_num.rb b/benchmark/hash_ident_num.rb
new file mode 100644
index 0000000000..b226736c6f
--- /dev/null
+++ b/benchmark/hash_ident_num.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+nums = (1..26).to_a
+nums.each { |n| h[n] = n }
+200_000.times { nums.each { |n| h[n] } }
diff --git a/benchmark/hash_ident_obj.rb b/benchmark/hash_ident_obj.rb
new file mode 100644
index 0000000000..4b3b58edec
--- /dev/null
+++ b/benchmark/hash_ident_obj.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+objs = 26.times.map { Object.new }
+objs.each { |o| h[o] = o }
+200_000.times { objs.each { |o| h[o] } }
diff --git a/benchmark/hash_ident_str.rb b/benchmark/hash_ident_str.rb
new file mode 100644
index 0000000000..8582b38e31
--- /dev/null
+++ b/benchmark/hash_ident_str.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = ('a'..'z').to_a
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_ident_sym.rb b/benchmark/hash_ident_sym.rb
new file mode 100644
index 0000000000..4c81e3d28e
--- /dev/null
+++ b/benchmark/hash_ident_sym.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+syms = ('a'..'z').to_a.map(&:to_sym)
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_keys.rb b/benchmark/hash_keys.rb
new file mode 100644
index 0000000000..6863cd01f9
--- /dev/null
+++ b/benchmark/hash_keys.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do
+ h.keys
+end
diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb
new file mode 100644
index 0000000000..c188529260
--- /dev/null
+++ b/benchmark/hash_literal_small2.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz" } }
diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb
new file mode 100644
index 0000000000..739f71b5b0
--- /dev/null
+++ b/benchmark/hash_literal_small4.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } }
diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb
new file mode 100644
index 0000000000..53d80af535
--- /dev/null
+++ b/benchmark/hash_literal_small8.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } }
diff --git a/benchmark/hash_long.rb b/benchmark/hash_long.rb
new file mode 100644
index 0000000000..03d9109602
--- /dev/null
+++ b/benchmark/hash_long.rb
@@ -0,0 +1,4 @@
+k1 = "Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong";
+k2 = "Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping";
+h = {k1 => 0, k2 => 0};
+3000000.times{|i| k = i % 2 ? k2 : k1; h [k] = h[k] + 1}
diff --git a/benchmark/hash_shift.rb b/benchmark/hash_shift.rb
new file mode 100644
index 0000000000..a645671a5b
--- /dev/null
+++ b/benchmark/hash_shift.rb
@@ -0,0 +1,10 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+50000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_shift_u16.rb b/benchmark/hash_shift_u16.rb
new file mode 100644
index 0000000000..ec800d0342
--- /dev/null
+++ b/benchmark/hash_shift_u16.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(16384..65536).each do |i|
+ h[i] = nil
+end
+
+300000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_shift_u24.rb b/benchmark/hash_shift_u24.rb
new file mode 100644
index 0000000000..de4e0fa696
--- /dev/null
+++ b/benchmark/hash_shift_u24.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xff4000..0xffffff).each do |i|
+ h[i] = nil
+end
+
+300000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_shift_u32.rb b/benchmark/hash_shift_u32.rb
new file mode 100644
index 0000000000..656aa55583
--- /dev/null
+++ b/benchmark/hash_shift_u32.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xffff4000..0xffffffff).each do |i|
+ h[i] = nil
+end
+
+300000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_small2.rb b/benchmark/hash_small2.rb
new file mode 100644
index 0000000000..45485d9c71
--- /dev/null
+++ b/benchmark/hash_small2.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 2.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small4.rb b/benchmark/hash_small4.rb
new file mode 100644
index 0000000000..acd4084334
--- /dev/null
+++ b/benchmark/hash_small4.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 4.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small8.rb b/benchmark/hash_small8.rb
new file mode 100644
index 0000000000..9cffcc91b6
--- /dev/null
+++ b/benchmark/hash_small8.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 8.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_to_proc.rb b/benchmark/hash_to_proc.rb
new file mode 100644
index 0000000000..2b675bf509
--- /dev/null
+++ b/benchmark/hash_to_proc.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do |i|
+ [i].map(&h)
+end
diff --git a/benchmark/hash_values.rb b/benchmark/hash_values.rb
new file mode 100644
index 0000000000..069441302f
--- /dev/null
+++ b/benchmark/hash_values.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do
+ h.values
+end
diff --git a/benchmark/int_quo.rb b/benchmark/int_quo.rb
new file mode 100644
index 0000000000..e22a3f8c30
--- /dev/null
+++ b/benchmark/int_quo.rb
@@ -0,0 +1 @@
+5000000.times { 42.quo(3) }
diff --git a/benchmark/io_copy_stream_write.rb b/benchmark/io_copy_stream_write.rb
new file mode 100644
index 0000000000..3fd87250a4
--- /dev/null
+++ b/benchmark/io_copy_stream_write.rb
@@ -0,0 +1,24 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+
+class Zero
+ def initialize
+ @n = 100000
+ @in = File.open('/dev/zero', 'rb')
+ end
+
+ def read(len, buf)
+ return if (@n -= 1) == 0
+ @in.read(len, buf)
+ end
+end
+
+begin
+ src = Zero.new
+ dst = File.open(IO::NULL, 'wb')
+ n = IO.copy_stream(src, dst)
+rescue Errno::ENOENT
+ # not *nix
+end if IO.respond_to?(:copy_stream) && IO.const_defined?(:NULL)
diff --git a/benchmark/io_copy_stream_write_socket.rb b/benchmark/io_copy_stream_write_socket.rb
new file mode 100644
index 0000000000..11f369bd0d
--- /dev/null
+++ b/benchmark/io_copy_stream_write_socket.rb
@@ -0,0 +1,35 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+class Zero
+ def initialize
+ @n = 100000
+ @in = File.open('/dev/zero', 'rb')
+ end
+
+ def read(len, buf)
+ return if (@n -= 1) == 0
+ @in.read(len, buf)
+ end
+end
+
+begin
+ require 'socket'
+ src = Zero.new
+ rd, wr = UNIXSocket.pair
+ pid = fork do
+ wr.close
+ buf = String.new
+ while rd.read(16384, buf)
+ end
+ end
+ rd.close
+ IO.copy_stream(src, wr)
+rescue Errno::ENOENT, NotImplementedError, NameError
+ # not *nix: missing /dev/zero, fork, or UNIXSocket
+rescue LoadError # no socket?
+ensure
+ wr.close if wr
+ Process.waitpid(pid) if pid
+end if IO.respond_to?(:copy_stream)
diff --git a/benchmark/io_file_create.rb b/benchmark/io_file_create.rb
new file mode 100644
index 0000000000..2f205c1333
--- /dev/null
+++ b/benchmark/io_file_create.rb
@@ -0,0 +1,13 @@
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+ f = open(file, 'w')
+ f.close#(true)
+}
+File.unlink(file)
+
diff --git a/benchmark/io_file_read.rb b/benchmark/io_file_read.rb
new file mode 100644
index 0000000000..b9e796ed30
--- /dev/null
+++ b/benchmark/io_file_read.rb
@@ -0,0 +1,15 @@
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world! " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+ f.seek 0
+ f.read
+}
diff --git a/benchmark/io_file_write.rb b/benchmark/io_file_write.rb
new file mode 100644
index 0000000000..aa1be0e5fe
--- /dev/null
+++ b/benchmark/io_file_write.rb
@@ -0,0 +1,14 @@
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world! " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+ f.seek 0
+ f.write str
+}
diff --git a/benchmark/io_nonblock_noex.rb b/benchmark/io_nonblock_noex.rb
new file mode 100644
index 0000000000..da9357fdc6
--- /dev/null
+++ b/benchmark/io_nonblock_noex.rb
@@ -0,0 +1,22 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+noex = { exception: false }
+begin
+ r, w = IO.pipe
+ while i < nr
+ i += 1
+ w.write_nonblock(msg, noex)
+ r.read_nonblock(1, buf, noex)
+ end
+rescue ArgumentError # old Rubies
+ while i < nr
+ i += 1
+ w.write_nonblock(msg)
+ r.read_nonblock(1, buf)
+ end
+ensure
+ r.close
+ w.close
+end
diff --git a/benchmark/io_nonblock_noex2.rb b/benchmark/io_nonblock_noex2.rb
new file mode 100644
index 0000000000..56819d049b
--- /dev/null
+++ b/benchmark/io_nonblock_noex2.rb
@@ -0,0 +1,21 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+begin
+ r, w = IO.pipe
+ while i < nr
+ i += 1
+ w.write_nonblock(msg, exception: false)
+ r.read_nonblock(1, buf, exception: false)
+ end
+rescue ArgumentError # old Rubies
+ while i < nr
+ i += 1
+ w.write_nonblock(msg)
+ r.read_nonblock(1, buf)
+ end
+ensure
+ r.close
+ w.close
+end
diff --git a/benchmark/io_pipe_rw.rb b/benchmark/io_pipe_rw.rb
new file mode 100644
index 0000000000..6862a8ae61
--- /dev/null
+++ b/benchmark/io_pipe_rw.rb
@@ -0,0 +1,13 @@
+# Measure uncontended GVL performance via read/write with 1:1 threading
+# If we switch to M:N threading, this will benchmark something else...
+r, w = IO.pipe
+src = '0'.freeze
+dst = String.new
+i = 0
+while i < 1_000_000
+ i += 1
+ w.write(src)
+ r.read(1, dst)
+end
+w.close
+r.close
diff --git a/benchmark/io_select.rb b/benchmark/io_select.rb
new file mode 100644
index 0000000000..19248daeb1
--- /dev/null
+++ b/benchmark/io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+ IO.select nil, w
+}
+
diff --git a/benchmark/io_select2.rb b/benchmark/io_select2.rb
new file mode 100644
index 0000000000..10e37d71b2
--- /dev/null
+++ b/benchmark/io_select2.rb
@@ -0,0 +1,22 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+if defined?(Process::RLIMIT_NOFILE)
+ max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+ max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+ ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+ IO.select nil, last
+end
+
diff --git a/benchmark/io_select3.rb b/benchmark/io_select3.rb
new file mode 100644
index 0000000000..7d0ba1f092
--- /dev/null
+++ b/benchmark/io_select3.rb
@@ -0,0 +1,21 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+if defined?(Process::RLIMIT_NOFILE)
+ max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+ max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+ r, w = IO.pipe
+ r.close
+ ios.push w
+end
+
+nr.times do
+ IO.select nil, ios
+end
+
diff --git a/benchmark/io_write.rb b/benchmark/io_write.rb
new file mode 100644
index 0000000000..cdb409948b
--- /dev/null
+++ b/benchmark/io_write.rb
@@ -0,0 +1,22 @@
+#!/usr/bin/env ruby
+
+require 'benchmark'
+
+i, o = IO.pipe
+o.sync = true
+
+DOT = ".".freeze
+
+chunks = 100_000.times.collect{DOT}
+
+thread = Thread.new do
+ while i.read(1024)
+ end
+end
+
+100.times do
+ o.write(*chunks)
+end
+
+o.close
+thread.join
diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml
new file mode 100644
index 0000000000..ebdc8d7e8b
--- /dev/null
+++ b/benchmark/irb_color.yml
@@ -0,0 +1,13 @@
+prelude: |
+ require 'irb/color'
+ code = <<~'CODE'
+ def self.foo # bar
+ :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}"
+ end
+ CODE
+benchmark:
+ irb_color_complete: |
+ IRB::Color.colorize_code(code, complete: true)
+ irb_color_incomplete: |
+ IRB::Color.colorize_code(code, complete: false)
+loop_count: 2000000
diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml
new file mode 100644
index 0000000000..28933f8b38
--- /dev/null
+++ b/benchmark/irb_exec.yml
@@ -0,0 +1,10 @@
+prelude: |
+ # frozen_string_literal: true
+ require 'rbconfig'
+ irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f']
+benchmark:
+ irb_exec: |
+ IO.popen(irb_f, 'w') do |io|
+ io.write('exit')
+ end
+loop_count: 30
diff --git a/benchmark/iseq_load_from_binary.yml b/benchmark/iseq_load_from_binary.yml
new file mode 100644
index 0000000000..7e9d73bdd4
--- /dev/null
+++ b/benchmark/iseq_load_from_binary.yml
@@ -0,0 +1,25 @@
+prelude: |
+ symbol = RubyVM::InstructionSequence.compile(":foo; :bar; :baz; :egg; :spam").to_binary
+
+ define_method = RubyVM::InstructionSequence.compile(%{
+ def foo; end
+ def bar; end
+ def baz; end
+ def egg; end
+ def spam; end
+ }).to_binary
+
+ all = RubyVM::InstructionSequence.compile(%{
+ module Foo; def foo; :foo; end; end
+ module Bar; def bar; :bar; end; end
+ module Baz; def baz; :baz; end; end
+ class Egg; def egg; :egg; end; end
+ class Spaml; def spam; :spam; end; end
+ }).to_binary
+
+benchmark:
+ symbol: RubyVM::InstructionSequence.load_from_binary(symbol)
+ define_method: RubyVM::InstructionSequence.load_from_binary(define_method)
+ all: RubyVM::InstructionSequence.load_from_binary(all)
+
+loop_count: 100_000
diff --git a/benchmark/ivar_extend.yml b/benchmark/ivar_extend.yml
new file mode 100644
index 0000000000..eb9ee923f5
--- /dev/null
+++ b/benchmark/ivar_extend.yml
@@ -0,0 +1,23 @@
+prelude: |
+ class Embedded
+ def initialize
+ @a = 1
+ @b = 1
+ @c = 1
+ end
+ end
+
+ class Extended
+ def initialize
+ @a = 1
+ @b = 1
+ @c = 1
+ @d = 1
+ @e = 1
+ @f = 1
+ end
+ end
+benchmark:
+ embedded: Embedded.new
+ extended: Extended.new
+loop_count: 20_000_000
diff --git a/benchmark/kernel_clone.yml b/benchmark/kernel_clone.yml
new file mode 100644
index 0000000000..069b23abcd
--- /dev/null
+++ b/benchmark/kernel_clone.yml
@@ -0,0 +1,6 @@
+prelude: "object = Object.new"
+benchmark:
+ clone: "object.clone"
+ clone_true: "object.clone(freeze: true)"
+ clone_false: "object.clone(freeze: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_float.yml b/benchmark/kernel_float.yml
new file mode 100644
index 0000000000..215f6750fc
--- /dev/null
+++ b/benchmark/kernel_float.yml
@@ -0,0 +1,5 @@
+benchmark:
+ float: "Float(42)"
+ float_true: "Float(42, exception: true)"
+ float_false: "Float(42, exception: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_tap.yml b/benchmark/kernel_tap.yml
new file mode 100644
index 0000000000..4dcbb31b4d
--- /dev/null
+++ b/benchmark/kernel_tap.yml
@@ -0,0 +1,6 @@
+prelude: |
+ obj = Object.new
+ x = nil
+benchmark:
+ kernel_tap: obj.tap { |o| x = o }
+loop_count: 20000000
diff --git a/benchmark/kernel_then.yml b/benchmark/kernel_then.yml
new file mode 100644
index 0000000000..85f7341e33
--- /dev/null
+++ b/benchmark/kernel_then.yml
@@ -0,0 +1,6 @@
+benchmark:
+ kernel_then: 1.then { |i| i + 1 }
+ kernel_then_enum: 1.then
+ kernel_yield_self: 1.yield_self { |i| i + 1 }
+ kernel_yield_self_enum: 1.yield_self
+loop_count: 20000000
diff --git a/benchmark/keyword_arguments.yml b/benchmark/keyword_arguments.yml
new file mode 100644
index 0000000000..fce6bce0b8
--- /dev/null
+++ b/benchmark/keyword_arguments.yml
@@ -0,0 +1,13 @@
+prelude: |
+ h = {a: 1}
+ def kw(a: 1) a end
+ def kws(**kw) kw end
+benchmark:
+ kw_to_kw: "kw(a: 1)"
+ kw_splat_to_kw: "kw(**h)"
+ kw_to_kw_splat: "kws(a: 1)"
+ kw_splat_to_kw_splat: "kws(**h)"
+ kw_and_splat_to_kw: "kw(a: 1, **h)"
+ kw_splats_to_kw: "kw(**h, **h)"
+ kw_and_splat_to_kw_splat: "kws(a: 1, **h)"
+ kw_splats_to_kw_splat: "kws(**h, **h)"
diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb
new file mode 100644
index 0000000000..d22236e9fb
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/output/driver.rb
@@ -0,0 +1,36 @@
+require 'benchmark_driver/output/simple'
+
+# This replicates the legacy benchmark/driver.rb behavior.
+class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple
+ def initialize(*)
+ super
+ @stdout = $stdout
+ @strio = StringIO.new
+ $stdout = IOMultiplexer.new(@stdout, @strio)
+ end
+
+ def with_benchmark(*)
+ super
+ ensure
+ logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log"
+ puts "\nLog file: #{logfile}"
+
+ $stdout = @stdout
+ File.write(logfile, @strio.tap(&:rewind).read)
+ end
+
+ class IOMultiplexer
+ def initialize(io1, io2)
+ @io1 = io1
+ @io2 = io2
+ end
+
+ [:write, :sync, :sync=, :puts, :print, :flush].each do |method|
+ define_method(method) do |*args|
+ @io1.send(method, *args)
+ @io2.send(method, *args)
+ end
+ end
+ end
+ private_constant :IOMultiplexer
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb
new file mode 100644
index 0000000000..3c3453e527
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cstime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :cstime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb
new file mode 100644
index 0000000000..e139962ef2
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cutime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :cutime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/mjit.rb b/benchmark/lib/benchmark_driver/runner/mjit.rb
new file mode 100644
index 0000000000..3a58a620de
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/mjit.rb
@@ -0,0 +1,34 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'erb'
+
+# A runner to measure after-JIT performance easily
+class BenchmarkDriver::Runner::Mjit < BenchmarkDriver::Runner::Ips
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
+ def parse(**)
+ jobs = super
+ jobs.map do |job|
+ job = job.dup
+ job.prelude = "#{job.prelude}\n#{<<~EOS}"
+ if defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled?
+ __bmdv_ruby_i = 0
+ while __bmdv_ruby_i < 10000 # MJIT call threshold
+ #{job.script}
+ __bmdv_ruby_i += 1
+ end
+ RubyVM::MJIT.pause # compile
+ #{job.script}
+ RubyVM::MJIT.resume; RubyVM::MJIT.pause # recompile
+ #{job.script}
+ RubyVM::MJIT.resume; RubyVM::MJIT.pause # recompile 2
+ end
+ EOS
+ job
+ end
+ end
+ })
+end
diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb
new file mode 100644
index 0000000000..d04f2e51ff
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/peak.rb
@@ -0,0 +1,151 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Peak
+ METRIC = BenchmarkDriver::Metric.new(
+ name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger',
+ )
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ # @param [BenchmarkDriver::Config::RunnerConfig] config
+ # @param [BenchmarkDriver::Output] output
+ # @param [BenchmarkDriver::Context] contexts
+ def initialize(config:, output:, contexts:)
+ @config = config
+ @output = output
+ @contexts = contexts
+ end
+
+ # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+ # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
+ def run(jobs)
+ if jobs.any? { |job| job.loop_count.nil? }
+ jobs = jobs.map do |job|
+ job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1))
+ end
+ end
+
+ @output.with_benchmark do
+ jobs.each do |job|
+ @output.with_job(name: job.name) do
+ job.runnable_contexts(@contexts).each do |context|
+ value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+ run_benchmark(job, context: context)
+ end
+ @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+ @output.report(values: { metric => value }, loop_count: job.loop_count)
+ end
+ end
+ end
+ end
+ end
+ end
+
+ private
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__)
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ with_script(benchmark.render) do |path|
+ output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read)
+ if $?.success?
+ Integer(f.read)
+ else
+ $stdout.print(output)
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ end
+ end
+
+ # Overridden by BenchmarkDriver::Runner::Size
+ def target
+ 'peak'
+ end
+
+ # Overridden by BenchmarkDriver::Runner::Size
+ def metric
+ METRIC
+ end
+
+ def with_script(script)
+ if @config.verbose >= 2
+ sep = '-' * 30
+ $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+ end
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ f.puts script
+ f.close
+ return yield(f.path)
+ end
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ def render
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ <<-RUBY
+#{prelude}
+#{while_loop(script, loop_count)}
+#{teardown}
+
+result_file, target, memory_status = ARGV
+require_relative memory_status
+
+ms = Memory::Status.new
+case target.to_sym
+when :peak
+ key = ms.respond_to?(:hwm) ? :hwm : :peak
+when :size
+ key = ms.respond_to?(:rss) ? :rss : :size
+else
+ raise('unexpected target: ' + target)
+end
+
+File.write(result_file, ms[key])
+ RUBY
+ end
+
+ private
+
+ def while_loop(content, times)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ end
+
+ if times > 1
+ <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+ #{content}
+ __bmdv_i += 1
+end
+ RUBY
+ else
+ content
+ end
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/ractor.rb b/benchmark/lib/benchmark_driver/runner/ractor.rb
new file mode 100644
index 0000000000..c730b8e4a5
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/ractor.rb
@@ -0,0 +1,122 @@
+require 'erb'
+
+# A runner to measure performance *inside* Ractor
+class BenchmarkDriver::Runner::Ractor < BenchmarkDriver::Runner::Ips
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob) do
+ attr_accessor :ractor
+ end
+
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
+ def parse(ractor: 1, **kwargs)
+ super(**kwargs).each do |job|
+ job.ractor = ractor
+ end
+ end
+ })
+
+ private
+
+ unless private_instance_methods.include?(:run_benchmark)
+ raise "#run_benchmark is no longer defined in BenchmarkDriver::Runner::Ips"
+ end
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ results = job.ractor.times.map do
+ Tempfile.open('benchmark_driver_result')
+ end
+ duration = with_script(benchmark.render(results: results.map(&:path))) do |path|
+ success = execute(*context.executable.command, path, exception: false)
+ if success && ((value = results.map { |f| Float(f.read) }.max) > 0)
+ value
+ else
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ results.each(&:close)
+
+ value_duration(
+ loop_count: job.loop_count,
+ duration: duration,
+ )
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(results:)
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ ERB.new(<<-RUBY).result_with_hash(results: results)
+Warning[:experimental] = false
+# shareable-constant-value: experimental_everything
+#{prelude}
+
+if #{loop_count} == 1
+ __bmdv_loop_before = 0
+ __bmdv_loop_after = 0
+else
+ __bmdv_loop_before = Time.new
+ #{while_loop('', loop_count, id: 0)}
+ __bmdv_loop_after = Time.new
+end
+
+__bmdv_ractors = []
+<% results.size.times do %>
+__bmdv_ractors << Ractor.new(__bmdv_loop_after - __bmdv_loop_before) { |__bmdv_loop_time|
+ __bmdv_time = Time
+ __bmdv_script_before = __bmdv_time.new
+ #{while_loop(script, loop_count, id: 1)}
+ __bmdv_script_after = __bmdv_time.new
+
+ (__bmdv_script_after - __bmdv_script_before) - __bmdv_loop_time
+}
+<% end %>
+
+# Wait for all Ractors before executing code to write results
+__bmdv_ractors.map!(&:take)
+
+<% results.each do |result| %>
+File.write(<%= result.dump %>, __bmdv_ractors.shift)
+<% end %>
+
+#{teardown}
+ RUBY
+ end
+
+ private
+
+ # id is to prevent:
+ # can not isolate a Proc because it accesses outer variables (__bmdv_i)
+ def while_loop(content, times, id:)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ elsif times == 1
+ return content
+ end
+
+ # TODO: execute in batch
+ <<-RUBY
+__bmdv_i#{id} = 0
+while __bmdv_i#{id} < #{times}
+ #{content}
+ __bmdv_i#{id} += 1
+end
+ RUBY
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb
new file mode 100644
index 0000000000..1b31f901c7
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/size.rb
@@ -0,0 +1,25 @@
+require 'benchmark_driver/runner/peak'
+
+# Actually the same as BenchmarkDriver::Runner::Memory
+class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak
+ METRIC = BenchmarkDriver::Metric.new(
+ name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger',
+ )
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Peak#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Peak#target
+ def target
+ 'size'
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb
new file mode 100644
index 0000000000..4577fb0bf8
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/stime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :stime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb
new file mode 100644
index 0000000000..64dc14f84e
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/total.rb
@@ -0,0 +1,137 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ # @param [BenchmarkDriver::Config::RunnerConfig] config
+ # @param [BenchmarkDriver::Output] output
+ # @param [BenchmarkDriver::Context] contexts
+ def initialize(config:, output:, contexts:)
+ @config = config
+ @output = output
+ @contexts = contexts
+ end
+
+ # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+ # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs
+ def run(jobs)
+ if jobs.any? { |job| job.loop_count.nil? }
+ raise 'missing loop_count is not supported in Ruby repository'
+ end
+
+ @output.with_benchmark do
+ jobs.each do |job|
+ @output.with_job(name: job.name) do
+ job.runnable_contexts(@contexts).each do |context|
+ duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+ run_benchmark(job, context: context)
+ end
+ @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+ @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count)
+ end
+ end
+ end
+ end
+ end
+ end
+
+ private
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ with_script(benchmark.render(result: f.path, target: target)) do |path|
+ IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2
+ if $?.success?
+ Float(f.read)
+ else
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ end
+ end
+
+ # This method is overridden by some subclasses
+ def metric
+ METRIC
+ end
+
+ # This method is overridden by some subclasses
+ def target
+ :total
+ end
+
+ def with_script(script)
+ if @config.verbose >= 2
+ sep = '-' * 30
+ $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+ end
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ f.puts script
+ f.close
+ return yield(f.path)
+ end
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(result:, target:)
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ <<-RUBY
+#{prelude}
+
+require 'benchmark'
+__bmdv_result = Benchmark.measure {
+ #{while_loop(script, loop_count)}
+}
+
+#{teardown}
+
+File.write(#{result.dump}, __bmdv_result.#{target})
+ RUBY
+ end
+
+ private
+
+ def while_loop(content, times)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ elsif times == 1
+ return content
+ end
+
+ # TODO: execute in batch
+ <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+ #{content}
+ __bmdv_i += 1
+end
+ RUBY
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb
new file mode 100644
index 0000000000..b61d83a188
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/utime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :utime
+ end
+end
diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb
new file mode 100644
index 0000000000..31b770c484
--- /dev/null
+++ b/benchmark/lib/load.rb
@@ -0,0 +1,18 @@
+# How to use this file:
+# 1. write a `$(srcdir)/test.rb` like:
+=begin
+require_relative 'benchmark/lib/load'
+
+Benchmark.driver(repeat_count: 5){|x|
+ x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby'
+ x.executable name: 'modif-miniruby', command: %w'./miniruby'
+
+ x.report %q{
+ h = {a: 1, b: 2, c: 3, d: 4}
+ }
+}
+=end
+#
+# 2. `make run`
+$:.unshift(File.join(__dir__, '../benchmark-driver/lib'))
+require 'benchmark_driver'
diff --git a/benchmark/bm_loop_for.rb b/benchmark/loop_for.rb
index 0fc4cc1511..0fc4cc1511 100644
--- a/benchmark/bm_loop_for.rb
+++ b/benchmark/loop_for.rb
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/loop_generator.rb
index d3375c744c..d3375c744c 100644
--- a/benchmark/bm_loop_generator.rb
+++ b/benchmark/loop_generator.rb
diff --git a/benchmark/bm_loop_times.rb b/benchmark/loop_times.rb
index 521f72ad1a..521f72ad1a 100644
--- a/benchmark/bm_loop_times.rb
+++ b/benchmark/loop_times.rb
diff --git a/benchmark/loop_whileloop.rb b/benchmark/loop_whileloop.rb
new file mode 100644
index 0000000000..0072822c06
--- /dev/null
+++ b/benchmark/loop_whileloop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+ i += 1
+end
diff --git a/benchmark/loop_whileloop2.rb b/benchmark/loop_whileloop2.rb
new file mode 100644
index 0000000000..47d02dffc4
--- /dev/null
+++ b/benchmark/loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i = 0
+while i< 6_000_000 # benchmark loop 2
+ i += 1
+end
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
deleted file mode 100644
index b6d787ae27..0000000000
--- a/benchmark/make_fasta_output.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-# prepare 'fasta.output'
-
-def prepare_fasta_output n
- filebase = File.join(File.dirname($0), 'fasta.output')
- script = File.join(File.dirname($0), 'bm_so_fasta.rb')
- file = "#{filebase}.#{n}"
-
- unless FileTest.exist?(file)
- STDERR.puts "preparing #{file}"
-
- open(file, 'w'){|f|
- ARGV[0] = n
- $stdout = f
- load script
- $stdout = STDOUT
- }
- end
-end
-
diff --git a/benchmark/marshal_dump_flo.rb b/benchmark/marshal_dump_flo.rb
new file mode 100644
index 0000000000..9b8d0c6afb
--- /dev/null
+++ b/benchmark/marshal_dump_flo.rb
@@ -0,0 +1,2 @@
+bug10761 = 10000.times.map { |x| x.to_f }
+100.times { Marshal.dump(bug10761) }
diff --git a/benchmark/marshal_dump_load_geniv.rb b/benchmark/marshal_dump_load_geniv.rb
new file mode 100644
index 0000000000..8252ad90fa
--- /dev/null
+++ b/benchmark/marshal_dump_load_geniv.rb
@@ -0,0 +1,10 @@
+a = ''
+a.instance_eval do
+ @a = :a
+ @b = :b
+ @c = :c
+end
+100000.times do
+ a = Marshal.load(Marshal.dump(a))
+end
+#p(a.instance_eval { @a == :a && @b == :b && @c == :c })
diff --git a/benchmark/marshal_dump_load_integer.yml b/benchmark/marshal_dump_load_integer.yml
new file mode 100644
index 0000000000..78ebf823d2
--- /dev/null
+++ b/benchmark/marshal_dump_load_integer.yml
@@ -0,0 +1,22 @@
+prelude: |
+ smallint_array = 1000.times.map { |x| x }
+ bigint32_array = 1000.times.map { |x| x + 2**32 }
+ bigint64_array = 1000.times.map { |x| x + 2**64 }
+
+ smallint_dump = Marshal.dump(smallint_array)
+ bigint32_dump = Marshal.dump(bigint32_array)
+ bigint64_dump = Marshal.dump(bigint64_array)
+benchmark:
+ marshal_dump_integer_small: |
+ Marshal.dump(smallint_array)
+ marshal_dump_integer_over_32_bit: |
+ Marshal.dump(bigint32_array)
+ marshal_dump_integer_over_64_bit: |
+ Marshal.dump(bigint64_array)
+ marshal_load_integer_small: |
+ Marshal.load(smallint_dump)
+ marshal_load_integer_over_32_bit: |
+ Marshal.load(bigint32_dump)
+ marshal_load_integer_over_64_bit: |
+ Marshal.load(bigint64_dump)
+loop_count: 4000
diff --git a/benchmark/marshal_dump_load_time.rb b/benchmark/marshal_dump_load_time.rb
new file mode 100644
index 0000000000..e29743b791
--- /dev/null
+++ b/benchmark/marshal_dump_load_time.rb
@@ -0,0 +1 @@
+100000.times { Marshal.load(Marshal.dump(Time.now)) }
diff --git a/benchmark/masgn.yml b/benchmark/masgn.yml
new file mode 100644
index 0000000000..31cb8ee4a3
--- /dev/null
+++ b/benchmark/masgn.yml
@@ -0,0 +1,53 @@
+prelude: |
+ a = [nil] * 3
+ b = Class.new{attr_writer :a, :b, :c}.new
+ c = d = e = f = g = h = i = nil
+benchmark:
+ array2_2: "c = (a[0], a[1] = 1, 2)"
+ array2_3: "c = (a[0], a[1] = 1, 2, 3)"
+ array3_2: "c = (a[0], a[1], a[2] = 1, 2)"
+ array3_3: "c = (a[0], a[1], a[2] = 1, 2, 3)"
+ attr2_2: "c = (b.a, b.b = 1, 2)"
+ attr2_3: "c = (b.a, b.b = 1, 2, 3)"
+ attr3_2: "c = (b.a, b.b, b.c = 1, 2)"
+ attr3_3: "c = (b.a, b.b, b.c = 1, 2, 3)"
+ lvar2_2: "c = (d, e = 1, 2)"
+ lvar2_3: "c = (d, e = 1, 2, 3)"
+ lvar3_2: "c = (d, e, f = 1, 2)"
+ lvar3_3: "c = (d, e, f = 1, 2, 3)"
+ array2_2p: "(a[0], a[1] = 1, 2; nil)"
+ array2_3p: "(a[0], a[1] = 1, 2, 3; nil)"
+ array3_2p: "(a[0], a[1], a[2] = 1, 2; nil)"
+ array3_3p: "(a[0], a[1], a[2] = 1, 2, 3; nil)"
+ attr2_2p: "(b.a, b.b = 1, 2; nil)"
+ attr2_3p: "(b.a, b.b = 1, 2, 3; nil)"
+ attr3_2p: "(b.a, b.b, b.c = 1, 2; nil)"
+ attr3_3p: "(b.a, b.b, b.c = 1, 2, 3; nil)"
+ lvar2_2p: "(d, e = 1, 2; nil)"
+ lvar2_3p: "(d, e = 1, 2, 3; nil)"
+ lvar3_2p: "(d, e, f = 1, 2; nil)"
+ lvar3_3p: "(d, e, f = 1, 2, 3; nil)"
+ array2_2lv: "c = (a[0], a[1] = g, h)"
+ array2_ilv: "c = (a[0], a[1] = g, h, i)"
+ arrayi_2lv: "c = (a[0], a[1], a[2] = g, h)"
+ arrayi_ilv: "c = (a[0], a[1], a[2] = g, h, i)"
+ attr2_2lv: "c = (b.a, b.b = g, h)"
+ attr2_ilv: "c = (b.a, b.b = g, h, i)"
+ attri_2lv: "c = (b.a, b.b, b.c = g, h)"
+ attri_ilv: "c = (b.a, b.b, b.c = g, h, i)"
+ lvar2_2lv: "c = (d, e = g, h)"
+ lvar2_ilv: "c = (d, e = g, h, i)"
+ lvari_2lv: "c = (d, e, f = g, h)"
+ lvari_ilv: "c = (d, e, f = g, h, i)"
+ array2_2plv: "(a[0], a[1] = g, h; nil)"
+ array2_iplv: "(a[0], a[1] = g, h, i; nil)"
+ arrayi_2plv: "(a[0], a[1], a[2] = g, h; nil)"
+ arrayi_iplv: "(a[0], a[1], a[2] = g, h, i; nil)"
+ attr2_2plv: "(b.a, b.b = g, h; nil)"
+ attr2_iplv: "(b.a, b.b = g, h, i; nil)"
+ attri_2plv: "(b.a, b.b, b.c = g, h; nil)"
+ attri_iplv: "(b.a, b.b, b.c = g, h, i; nil)"
+ lvar2_2plv: "(d, e = g, h; nil)"
+ lvar2_iplv: "(d, e = g, h, i; nil)"
+ lvari_2plv: "(d, e, f = g, h; nil)"
+ lvari_iplv: "(d, e, f = g, h, i; nil)"
diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb
new file mode 100644
index 0000000000..ffda109912
--- /dev/null
+++ b/benchmark/match_gt4.rb
@@ -0,0 +1 @@
+1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") }
diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb
new file mode 100644
index 0000000000..3b743d484a
--- /dev/null
+++ b/benchmark/match_small.rb
@@ -0,0 +1 @@
+1000000.times { 'haystack'.match(/hay/) }
diff --git a/benchmark/method_bind_call.yml b/benchmark/method_bind_call.yml
new file mode 100644
index 0000000000..9e0e046ed4
--- /dev/null
+++ b/benchmark/method_bind_call.yml
@@ -0,0 +1,16 @@
+prelude: |
+ named_module = Kernel
+
+ module FakeName
+ def self.name
+ "NotMyame".freeze
+ end
+ end
+
+ MOD_NAME = Module.instance_method(:name)
+
+benchmark:
+ fastpath: MOD_NAME.bind_call(Kernel)
+ slowpath: MOD_NAME.bind_call(FakeName)
+
+loop_count: 100_000
diff --git a/benchmark/mjit_exivar.yml b/benchmark/mjit_exivar.yml
new file mode 100644
index 0000000000..2584fa6410
--- /dev/null
+++ b/benchmark/mjit_exivar.yml
@@ -0,0 +1,18 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ class Bench < Hash
+ def initialize
+ @exivar = nil
+ end
+
+ def exivar
+ @exivar
+ end
+ end
+
+ bench = Bench.new
+
+benchmark:
+ mjit_exivar: bench.exivar
+
+loop_count: 200000000
diff --git a/benchmark/mjit_integer.yml b/benchmark/mjit_integer.yml
new file mode 100644
index 0000000000..a6b5c9ee16
--- /dev/null
+++ b/benchmark/mjit_integer.yml
@@ -0,0 +1,32 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def mjit_abs(int) int.abs end
+ def mjit_bit_length(int) int.bit_length end
+ def mjit_comp(int) ~int end
+ def mjit_even?(int) int.even? end
+ def mjit_integer?(int) int.integer? end
+ def mjit_magnitude(int) int.magnitude end
+ def mjit_odd?(int) int.odd? end
+ def mjit_ord(int) int.ord end
+ def mjit_size(int) int.size end
+ def mjit_to_i(int) int.to_i end
+ def mjit_to_int(int) int.to_int end
+ def mjit_uminus(int) -int end
+ def mjit_zero?(int) int.zero? end
+
+benchmark:
+ - mjit_abs(-1)
+ - mjit_bit_length(100)
+ - mjit_comp(1)
+ - mjit_even?(2)
+ - mjit_integer?(0)
+ - mjit_magnitude(-1)
+ - mjit_odd?(1)
+ - mjit_ord(1)
+ - mjit_size(1)
+ - mjit_to_i(1)
+ - mjit_to_int(1)
+ - mjit_uminus(1)
+ - mjit_zero?(0)
+
+loop_count: 40000000
diff --git a/benchmark/mjit_kernel.yml b/benchmark/mjit_kernel.yml
new file mode 100644
index 0000000000..7720e65c2c
--- /dev/null
+++ b/benchmark/mjit_kernel.yml
@@ -0,0 +1,20 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def mjit_class(obj)
+ obj.class
+ end
+
+ def mjit_frozen?(obj)
+ obj.frozen?
+ end
+
+ str = ""
+ fstr = "".freeze
+
+benchmark:
+ - mjit_class(self)
+ - mjit_class(1)
+ - mjit_frozen?(str)
+ - mjit_frozen?(fstr)
+
+loop_count: 40000000
diff --git a/benchmark/mjit_leave.yml b/benchmark/mjit_leave.yml
new file mode 100644
index 0000000000..9ac68b164b
--- /dev/null
+++ b/benchmark/mjit_leave.yml
@@ -0,0 +1,8 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def leave
+ nil
+ end
+benchmark:
+ mjit_leave: leave
+loop_count: 200000000
diff --git a/benchmark/mjit_opt_cc_insns.yml b/benchmark/mjit_opt_cc_insns.yml
new file mode 100644
index 0000000000..fed6d34bd5
--- /dev/null
+++ b/benchmark/mjit_opt_cc_insns.yml
@@ -0,0 +1,27 @@
+# opt_* insns using vm_method_cfunc_is with send-compatible operands:
+# * opt_nil_p
+# * opt_not
+# * opt_eq
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def mjit_nil?(obj)
+ obj.nil?
+ end
+
+ def mjit_not(obj)
+ !obj
+ end
+
+ def mjit_eq(a, b)
+ a == b
+ end
+
+benchmark:
+ - script: mjit_nil?(1)
+ loop_count: 40000000
+ - script: mjit_not(1)
+ loop_count: 40000000
+ - script: mjit_eq(1, nil)
+ loop_count: 8000000
+ - script: mjit_eq(nil, 1)
+ loop_count: 8000000
diff --git a/benchmark/mjit_struct_aref.yml b/benchmark/mjit_struct_aref.yml
new file mode 100644
index 0000000000..bfba1323f2
--- /dev/null
+++ b/benchmark/mjit_struct_aref.yml
@@ -0,0 +1,10 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def mjit_struct_aref(struct)
+ struct.aa
+ end
+ struct = Struct.new(:a0, :a1, :a2, :a3, :a4, :a5, :a6, :a7, :a8, :a9, :aa).new
+
+benchmark: mjit_struct_aref(struct)
+
+loop_count: 40000000
diff --git a/benchmark/module_eqq.yml b/benchmark/module_eqq.yml
new file mode 100644
index 0000000000..a561fb86dc
--- /dev/null
+++ b/benchmark/module_eqq.yml
@@ -0,0 +1,27 @@
+prelude: |
+ class SimpleClass; end
+ class MediumClass
+ 10.times { include Module.new }
+ end
+ class LargeClass
+ 100.times { include Module.new }
+ end
+ class HugeClass
+ 300.times { include Module.new }
+ end
+ SimpleObj = SimpleClass.new
+ MediumObj = MediumClass.new
+ LargeObj = LargeClass.new
+ HugeObj = HugeClass.new
+benchmark:
+ simple_class_eqq_simple_obj: |
+ SimpleClass === SimpleObj
+ medium_class_eqq_simple_obj: |
+ MediumClass === SimpleObj
+ simple_class_eqq_medium_obj: |
+ SimpleClass === MediumObj
+ simple_class_eqq_large_obj: |
+ SimpleClass === LargeObj
+ simple_class_eqq_huge_obj: |
+ SimpleClass === HugeObj
+loop_count: 20000000
diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml
new file mode 100644
index 0000000000..79ba4f2177
--- /dev/null
+++ b/benchmark/nil_p.yml
@@ -0,0 +1,9 @@
+prelude: |
+ class Niller; def nil?; true; end; end
+ xnil, notnil = nil, Object.new
+ niller = Niller.new
+benchmark:
+ - xnil.nil?
+ - notnil.nil?
+ - niller.nil?
+loop_count: 10000000
diff --git a/benchmark/nilclass.yml b/benchmark/nilclass.yml
new file mode 100644
index 0000000000..fba67a5f6a
--- /dev/null
+++ b/benchmark/nilclass.yml
@@ -0,0 +1,6 @@
+benchmark:
+ to_i: |
+ nil.to_i
+ to_f: |
+ nil.to_f
+loop_count: 100000
diff --git a/benchmark/num_zero_p.yml b/benchmark/num_zero_p.yml
new file mode 100644
index 0000000000..2195963433
--- /dev/null
+++ b/benchmark/num_zero_p.yml
@@ -0,0 +1,8 @@
+benchmark:
+ - 0.zero?
+ - 1.zero?
+ - 0r.zero?
+ - 1r.zero?
+ - 0i.zero?
+ - 1i.zero?
+loop_count: 50000000
diff --git a/benchmark/numeric_methods.yml b/benchmark/numeric_methods.yml
new file mode 100644
index 0000000000..1384902935
--- /dev/null
+++ b/benchmark/numeric_methods.yml
@@ -0,0 +1,29 @@
+prelude: |
+ int = 42
+ flo = 4.2
+benchmark:
+ real?: |
+ int.real?
+ integer?: |
+ flo.integer?
+ finite?: |
+ int.finite?
+ infinite?: |
+ int.infinite?
+ integer_real: |
+ int.real
+ float_real: |
+ flo.real
+ integr_imag: |
+ int.imag
+ float_imag: |
+ flo.imag
+ integer_conj: |
+ int.conj
+ float_conj: |
+ flo.conj
+ integer_numerator: |
+ int.numerator
+ integer_denominator: |
+ int.denominator
+loop_count: 20000000
diff --git a/benchmark/object_allocate.yml b/benchmark/object_allocate.yml
new file mode 100644
index 0000000000..93ff463e41
--- /dev/null
+++ b/benchmark/object_allocate.yml
@@ -0,0 +1,21 @@
+prelude: |
+ class Eight
+ 8.times { include(Module.new) }
+ end
+ class ThirtyTwo
+ 32.times { include(Module.new) }
+ end
+ class SixtyFour
+ 64.times { include(Module.new) }
+ end
+ class OneTwentyEight
+ 128.times { include(Module.new) }
+ end
+ # Disable GC to see raw throughput:
+ GC.disable
+benchmark:
+ allocate_8_deep: Eight.new
+ allocate_32_deep: ThirtyTwo.new
+ allocate_64_deep: SixtyFour.new
+ allocate_128_deep: OneTwentyEight.new
+loop_count: 100000
diff --git a/benchmark/objspace_dump_all.yml b/benchmark/objspace_dump_all.yml
new file mode 100644
index 0000000000..ebab562d2e
--- /dev/null
+++ b/benchmark/objspace_dump_all.yml
@@ -0,0 +1,13 @@
+prelude: |
+ require 'objspace'
+ require 'tempfile'
+ $objs = 1_000.times.map { Object.new }
+ $strings = 1_000.times.map { |i| "string #{i}" }
+ $file = Tempfile.new('heap')
+ $dev_null = File.open(File::NULL, 'w+')
+
+benchmark:
+ dump_all_string: "ObjectSpace.dump_all(output: :string)"
+ dump_all_file: "ObjectSpace.dump_all(output: $file)"
+ dump_all_dev_null: "ObjectSpace.dump_all(output: $dev_null)"
+loop_count: 1
diff --git a/benchmark/other-lang/eval.rb b/benchmark/other-lang/eval.rb
index 3875927389..48a2cea019 100644
--- a/benchmark/other-lang/eval.rb
+++ b/benchmark/other-lang/eval.rb
@@ -51,14 +51,14 @@ Bench.each{|b|
require 'pp'
# utime
-puts Lang.join("\t")
+puts Lang.join("\t")
Bench.each_with_index{|b, bi|
print b, "\t"
puts Result[bi].map{|e| e[0]}.join("\t")
}
# rtime
-puts Lang.join("\t")
+puts Lang.join("\t")
Bench.each_with_index{|b, bi|
print b, "\t"
puts Result[bi].map{|e| e[1]}.join("\t")
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
index 01593965d9..1ce9f76275 100644
--- a/benchmark/other-lang/fact.py
+++ b/benchmark/other-lang/fact.py
@@ -3,7 +3,7 @@
def factL(n):
r = 1
- for x in range(2, n):
+ for x in range(2, n+1):
r *= x
return r
diff --git a/benchmark/other-lang/fact.rb b/benchmark/other-lang/fact.rb
index 7e97b22b39..6cedc752cd 100644
--- a/benchmark/other-lang/fact.rb
+++ b/benchmark/other-lang/fact.rb
@@ -6,8 +6,8 @@ def fact(n)
end
end
-i=0
+i = 0
while i<10000
- i+=1
+ i += 1
fact(100)
end
diff --git a/benchmark/other-lang/loop.rb b/benchmark/other-lang/loop.rb
index d43cef61f3..b367b9dbf3 100644
--- a/benchmark/other-lang/loop.rb
+++ b/benchmark/other-lang/loop.rb
@@ -1,4 +1,4 @@
-i=0
+i = 0
while i<30000000
- i+=1
+ i += 1
end
diff --git a/benchmark/pm_array.yml b/benchmark/pm_array.yml
new file mode 100644
index 0000000000..babb65a289
--- /dev/null
+++ b/benchmark/pm_array.yml
@@ -0,0 +1,19 @@
+prelude: |
+ def call(*val)
+ case val
+ in [String => body]
+ [200, {}, [body]]
+ in [Integer => status]
+ [status, {}, [""]]
+ in [Integer, String] => response
+ [response[0], {}, [response[1]]]
+ in [Integer, Hash, String] => response
+ [response[0], response[1], [response[2]]]
+ end
+ end
+
+benchmark:
+ first_match: call("ok")
+ second_match: call(401)
+ third_match: call(200, "ok")
+ fourth_match: call(201, {}, "created")
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
deleted file mode 100644
index ee2138cdb2..0000000000
--- a/benchmark/prepare_so_count_words.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# prepare 'wc.input'
-
-def prepare_wc_input
- wcinput = File.join(File.dirname($0), 'wc.input')
- wcbase = File.join(File.dirname($0), 'wc.input.base')
- unless FileTest.exist?(wcinput)
- data = File.read(wcbase)
- 13.times{
- data << data
- }
- open(wcinput, 'w'){|f| f.write data}
- end
-end
-
-prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
deleted file mode 100644
index f28f4460a1..0000000000
--- a/benchmark/prepare_so_k_nucleotide.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require File.join(File.dirname(__FILE__), 'make_fasta_output')
-prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
deleted file mode 100644
index 7f089109de..0000000000
--- a/benchmark/prepare_so_reverse_complement.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require File.join(File.dirname(__FILE__), 'make_fasta_output')
-prepare_fasta_output(2_500_000)
diff --git a/benchmark/ractor_const.yml b/benchmark/ractor_const.yml
new file mode 100644
index 0000000000..d7ab74bdca
--- /dev/null
+++ b/benchmark/ractor_const.yml
@@ -0,0 +1,4 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+ ractor_const: Object
+ractor: 1
diff --git a/benchmark/ractor_float_to_s.yml b/benchmark/ractor_float_to_s.yml
new file mode 100644
index 0000000000..8f492be668
--- /dev/null
+++ b/benchmark/ractor_float_to_s.yml
@@ -0,0 +1,8 @@
+type: lib/benchmark_driver/runner/ractor
+prelude: |
+ FLOATS = [*0.0.step(1.0, 0.001)]
+benchmark:
+ ractor_float_to_s: |
+ FLOATS.each {|f| f.to_s}
+loop_count: 100
+ractor: 2
diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml
new file mode 100644
index 0000000000..a6674f82ee
--- /dev/null
+++ b/benchmark/range_last.yml
@@ -0,0 +1,4 @@
+benchmark:
+ - (1..1_000_000).last(100)
+ - (1..1_000_000).last(1000)
+ - (1..1_000_000).last(10000)
diff --git a/benchmark/range_min.yml b/benchmark/range_min.yml
new file mode 100644
index 0000000000..9e60dd7308
--- /dev/null
+++ b/benchmark/range_min.yml
@@ -0,0 +1,2 @@
+benchmark:
+ - (1..10).min
diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml
new file mode 100644
index 0000000000..90a029d5b9
--- /dev/null
+++ b/benchmark/realpath.yml
@@ -0,0 +1,30 @@
+prelude: |
+ f = File
+ pwd = Dir.pwd
+ Dir.mkdir('b') unless f.directory?('b')
+ f.write('b/a', '') unless f.file?('b/a')
+
+ relative = 'b/a'
+ absolute = File.join(pwd, relative)
+ dir = 'b'
+ file = 'a'
+
+ relative_dir = 'b/c'
+ absolute_dir = File.join(pwd, relative_dir)
+ file_dir = 'c'
+benchmark:
+ relative_nil: "f.realpath(relative, nil)"
+ absolute_nil: "f.realpath(absolute, nil)"
+ relative_relative: "f.realpath(file, dir)"
+ absolute_relative: "f.realpath(absolute, dir)"
+ relative_absolute: "f.realpath(relative, pwd)"
+ relative_nil_dir: "f.realdirpath(relative_dir, nil)"
+ absolute_nil_dir: "f.realdirpath(absolute_dir, nil)"
+ relative_relative_dir: "f.realdirpath(file_dir, dir)"
+ absolute_relative_dir: "f.realdirpath(absolute_dir, dir)"
+ relative_absolute_dir: "f.realdirpath(relative_dir, pwd)"
+ relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil"
+ absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil"
+ relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil"
+ absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil"
+ relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil"
diff --git a/benchmark/report.rb b/benchmark/report.rb
deleted file mode 100644
index 7aa852fc85..0000000000
--- a/benchmark/report.rb
+++ /dev/null
@@ -1,79 +0,0 @@
-#
-# YARV benchmark driver
-#
-
-require 'yarvutil'
-require 'benchmark'
-require 'rbconfig'
-
-def exec_command type, file, w
- <<-EOP
- $DRIVER_PATH = '#{File.dirname($0)}'
- $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
- require 'benchmark'
- require 'yarvutil'
-# print '#{type}'
- begin
- puts Benchmark.measure{
- #{w}('#{file}')
- }.utime
- rescue Exception => exec_command_error_variable
- puts "\t" + exec_command_error_variable.message
- end
- EOP
-end
-
-def benchmark cmd
- rubybin = ENV['RUBY'] || RbConfig.ruby
-
- IO.popen(rubybin, 'r+'){|io|
- io.write cmd
- io.close_write
- return io.gets
- }
-end
-
-def ruby_exec file
- prog = exec_command 'ruby', file, 'load'
- benchmark prog
-end
-
-def yarv_exec file
- prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
- benchmark prog
-end
-
-$wr = $wy = nil
-
-def measure bench
- file = File.dirname($0) + "/bm_#{bench}.rb"
- r = ruby_exec(file).to_f
- y = yarv_exec(file).to_f
- puts "#{bench}\t#{r}\t#{y}"
-end
-
-def measure2
- r = ruby_exec.to_f
- y = yarv_exec.to_f
- puts r/y
-end
-
-if $0 == __FILE__
- %w{
- whileloop
- whileloop2
- times
- const
- method
- poly_method
- block
- rescue
- rescue2
- }.each{|bench|
- measure bench
- }
-end
-
-
-
-
diff --git a/benchmark/require.yml b/benchmark/require.yml
new file mode 100644
index 0000000000..09f218cf08
--- /dev/null
+++ b/benchmark/require.yml
@@ -0,0 +1,32 @@
+prelude: |
+ require "fileutils"
+
+ def prepare
+ num_files = 10000
+
+ basename = File.dirname($0)
+ data_dir = File.join(basename, "bm_require.data")
+
+ # skip if all of files exists
+ if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+ return
+ end
+
+ FileUtils.mkdir_p(data_dir)
+
+ 1.upto(num_files) do |i|
+ File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+ end
+ end
+
+ prepare
+benchmark:
+ require: |
+ $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+ 1.upto(10000) do |i|
+ require "c#{i}"
+ end
+
+ $:.pop
+loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
new file mode 100644
index 0000000000..0c63257106
--- /dev/null
+++ b/benchmark/require_thread.yml
@@ -0,0 +1,40 @@
+prelude: |
+ require "fileutils"
+
+ def prepare
+ num_files = 10000
+
+ basename = File.dirname($0)
+ data_dir = File.join(basename, "bm_require.data")
+
+ # skip if all of files exists
+ if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+ return
+ end
+
+ FileUtils.mkdir_p(data_dir)
+
+ 1.upto(num_files) do |i|
+ File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+ end
+ end
+
+ prepare
+benchmark:
+ require_thread: |
+ $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+ i=0
+ t = Thread.new do
+ while true
+ i = i+1 # dummy loop
+ end
+ end
+
+ 1.upto(100) do |i|
+ require "c#{i}"
+ end
+
+ $:.pop
+ t.kill
+loop_count: 1
diff --git a/benchmark/run.rb b/benchmark/run.rb
deleted file mode 100644
index 6ef2943642..0000000000
--- a/benchmark/run.rb
+++ /dev/null
@@ -1,127 +0,0 @@
-#
-# Ruby benchmark driver
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$matzrubyonly = false
-$rubyonly = false
-
-$results = []
-
-# prepare 'wc.input'
-def prepare_wc_input
- wcinput = File.join(File.dirname($0), 'wc.input')
- wcbase = File.join(File.dirname($0), 'wc.input.base')
- unless FileTest.exist?(wcinput)
- data = File.read(wcbase)
- 13.times{
- data << data
- }
- open(wcinput, 'w'){|f| f.write data}
- end
-end
-
-prepare_wc_input
-
-def bm file
- prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
- return if prog.empty?
-
- /[a-z]+_(.+)\.rb/ =~ file
- bm_name = $1
- puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
- puts "#{bm_name}: "
-
-
-puts <<EOS unless $matzrubyonly || $rubyonly
-#{prog}
---
-EOS
- begin
- result = [bm_name]
- result << matzruby_exec(file) unless $rubyonly
- result << ruby_exec(file) unless $matzrubyonly
- $results << result
-
- rescue Exception => e
- puts
- puts "** benchmark failure: #{e}"
- puts e.backtrace
- end
-end
-
-def benchmark file, bin
- m = Benchmark.measure{
- `#{bin} #{$opts} #{file}`
- }
- sec = '%.3f' % m.real
- puts " #{sec}"
- sec
-end
-
-def ruby_exec file
- print 'ruby'
- benchmark file, $ruby_program
-end
-
-def matzruby_exec file
- print 'matz'
- rubylib = ENV['RUBYLIB']
- ENV['RUBYLIB'] = ''
- r = benchmark file, $matzruby_program
- ENV['RUBYLIB'] = rubylib
- r
-end
-
-if $0 == __FILE__
- ARGV.each{|arg|
- case arg
- when /\A--ruby=(.+)/
- $ruby_program = $1
- when /\A--matzruby=(.+)/
- $matzruby_program = $1
- when /\A--opts=(.+)/
- $opts = $1
- when /\A(-r|--only-ruby)\z/
- $rubyonly = true
- when /\A(-m|--only-matzruby)\z/
- $matzrubyonly = true
- end
- }
- ARGV.delete_if{|arg|
- /\A-/ =~ arg
- }
-
- puts "MatzRuby:"
- system("#{$matzruby_program} -v")
- puts "Ruby:"
- system("#{$ruby_program} -v")
- puts
-
- if ARGV.empty?
- Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
- bm file
- }
- else
- ARGV.each{|file|
- Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
- # file = "#{File.dirname(__FILE__)}/#{file}.rb"
- bm ef
- }
- }
- end
-
- puts
- puts "-- benchmark summary ---------------------------"
- $results.each{|res|
- print res.shift, "\t"
- (res||[]).each{|result|
- /([\d\.]+)/ =~ result
- print $1 + "\t" if $1
- }
- puts
- }
-end
-
diff --git a/benchmark/runc.rb b/benchmark/runc.rb
deleted file mode 100644
index 97c5cef045..0000000000
--- a/benchmark/runc.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-#
-#
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$rubybin = ENV['RUBY'] || RbConfig.ruby
-
-def runfile file
- puts file
- file = File.join(File.dirname($0), 'contrib', file)
- Benchmark.bm{|x|
- x.report('ruby'){
- system("#{$rubybin} #{file}")
- }
- x.report('yarv'){
- system("#{$rubybin} -rite -I.. #{file}")
- }
- }
-end
-
-ARGV.each{|file|
- runfile file
-}
-
-
diff --git a/benchmark/securerandom.rb b/benchmark/securerandom.rb
new file mode 100644
index 0000000000..a082ea6d5b
--- /dev/null
+++ b/benchmark/securerandom.rb
@@ -0,0 +1,5 @@
+require "securerandom"
+
+20_0000.times do
+ SecureRandom.random_number(100)
+end
diff --git a/benchmark/so_ackermann.rb b/benchmark/so_ackermann.rb
new file mode 100644
index 0000000000..4effa1ecaf
--- /dev/null
+++ b/benchmark/so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/so_array.rb b/benchmark/so_array.rb
new file mode 100644
index 0000000000..767e03db5f
--- /dev/null
+++ b/benchmark/so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+ x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+ (n-1).step(0,-1) do |bi|
+ y[bi] += x.at(bi)
+ end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/so_binary_trees.rb b/benchmark/so_binary_trees.rb
new file mode 100644
index 0000000000..b1693e4109
--- /dev/null
+++ b/benchmark/so_binary_trees.rb
@@ -0,0 +1,62 @@
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+alias puts_orig puts
+def puts str
+ # disable puts
+end
+
+def item_check(tree)
+ if tree[0] == nil
+ tree[1]
+ else
+ tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+ item_item = 2 * item
+ depth -= 1
+ [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+ [nil, item, nil]
+ end
+end
+
+max_depth = 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+ temp_tree = bottom_up_tree(i, depth)
+ check += item_check(temp_tree)
+
+ temp_tree = bottom_up_tree(-i, depth)
+ check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
+
+undef puts
+alias puts puts_orig
diff --git a/benchmark/so_concatenate.rb b/benchmark/so_concatenate.rb
new file mode 100644
index 0000000000..4468e20ac8
--- /dev/null
+++ b/benchmark/so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+ i += 1
+ hello = ''
+ 4_000_000.times do |e|
+ hello << STUFF
+ end
+end
+# puts hello.length
+
+
diff --git a/benchmark/so_count_words.yml b/benchmark/so_count_words.yml
new file mode 100644
index 0000000000..99683505f9
--- /dev/null
+++ b/benchmark/so_count_words.yml
@@ -0,0 +1,65 @@
+prelude: |
+ #!/usr/bin/ruby
+
+ wc_input_base = <<EOS
+ Subject: Re: Who was Izchak Miller?
+ From: "Jane D. Anonymous" <nobody@yale.edu>
+ Date: 1996/04/28
+ Message-Id: <4lv7bc$oh@news.ycc.yale.edu>
+ References: <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+ To: 75176.2330@compuserve.com
+ Content-Type: text/plain; charset=us-ascii
+ Organization: Yale University
+ X-Url: news:4lk6vl$gde@ns.oar.net
+ Mime-Version: 1.0
+ Newsgroups: rec.games.roguelike.nethack
+ X-Mailer: Mozilla 1.1N (Macintosh; I; 68K)
+
+ Hello there, Izchak Miller was my father. When I was younger I spent
+ many a night, hunched over the keyboard with a cup of tea, playing
+ nethack with him and my brother. my dad was a philosopher with a strong
+ weakness for fantasy/sci fi. I remember when he started to get involved
+ with the Nethack team- my brother's Dungeons and Dragons monster book
+ found a regular place beside my dad's desk. it's nice to see him living
+ on in the game he loved so much :-).
+ Tamar Miller
+
+ The following is a really long word of 5000 characters:
+
+ wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
+ EOS
+
+ # prepare 'wc.input'
+
+ def prepare_wc_input(wcbase)
+ wcinput = File.join(File.dirname($0), 'wc.input')
+ unless FileTest.exist?(wcinput)
+ data = wcbase.dup
+ 13.times{
+ data << data
+ }
+ open(wcinput, 'w'){|f| f.write data}
+ end
+ end
+
+ prepare_wc_input(wc_input_base)
+
+benchmark:
+ so_count_words: |
+ # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+ # http://www.bagley.org/~doug/shootout/
+ # with help from Paul Brannan
+ input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+ nl = nw = nc = 0
+ while true
+ tmp = input.read(4096) or break
+ data = tmp << (input.gets || "")
+ nc += data.length
+ nl += data.count("\n")
+ ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+ nw += data.count(" ") + 1
+ end
+ # STDERR.puts "#{nl} #{nw} #{nc}"
+
+loop_count: 1
diff --git a/benchmark/so_exception.rb b/benchmark/so_exception.rb
new file mode 100644
index 0000000000..eb205b4df1
--- /dev/null
+++ b/benchmark/so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+class Hi_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+def some_function(num)
+ begin
+ hi_function(num)
+ rescue
+ print "We shouldn't get here, exception is: #{$!.type}\n"
+ end
+end
+
+def hi_function(num)
+ begin
+ lo_function(num)
+ rescue Hi_Exception
+ $HI = $HI + 1
+ end
+end
+
+def lo_function(num)
+ begin
+ blowup(num)
+ rescue Lo_Exception
+ $LO = $LO + 1
+ end
+end
+
+def blowup(num)
+ if num % 2 == 0
+ raise Lo_Exception.new(num)
+ else
+ raise Hi_Exception.new(num)
+ end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+ i += 1
+ some_function(i+1)
+end
diff --git a/benchmark/so_fannkuch.rb b/benchmark/so_fannkuch.rb
new file mode 100644
index 0000000000..bac5ecd44c
--- /dev/null
+++ b/benchmark/so_fannkuch.rb
@@ -0,0 +1,45 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+ maxFlips, m, r, check = 0, n-1, n, 0
+ count = (1..n).to_a
+ perm = (1..n).to_a
+
+ while true
+ if check < 30
+ puts "#{perm}"
+ check += 1
+ end
+
+ while r != 1
+ count[r-1] = r
+ r -= 1
+ end
+
+ if perm[0] != 1 and perm[m] != n
+ perml = perm.clone #.dup
+ flips = 0
+ while (k = perml.first ) != 1
+ perml = perml.slice!(0, k).reverse + perml
+ flips += 1
+ end
+ maxFlips = flips if flips > maxFlips
+ end
+ while true
+ if r==n then return maxFlips end
+ perm.insert r,perm.shift
+ break if (count[r] -= 1) > 0
+ r += 1
+ end
+ end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/benchmark/so_fasta.rb b/benchmark/so_fasta.rb
new file mode 100644
index 0000000000..dcc6b39507
--- /dev/null
+++ b/benchmark/so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+]
+homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
new file mode 100644
index 0000000000..d7df086c39
--- /dev/null
+++ b/benchmark/so_k_nucleotide.yml
@@ -0,0 +1,155 @@
+prelude: |
+ bm_so_fasta = <<'EOS'
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ # Contributed by Sokolov Yura
+
+ $last = 42.0
+ def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+ end
+
+ alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+ iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+ ]
+ homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+ ]
+
+ def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+ end
+
+ def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ end
+
+
+ n = (ARGV[0] or 250_000).to_i
+
+ make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+ make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+ make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+ EOS
+benchmark:
+ - name: so_k_nucleotide
+ prelude: |
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ File.write(script, bm_so_fasta)
+
+ def prepare_fasta_output n
+ filebase = File.join(File.dirname($0), 'fasta.output')
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ file = "#{filebase}.#{n}"
+
+ unless FileTest.exist?(file)
+ STDERR.puts "preparing #{file}"
+
+ open(file, 'w'){|f|
+ ARGV[0] = n
+ $stdout = f
+ load script
+ $stdout = STDOUT
+ }
+ end
+ end
+ prepare_fasta_output(100_000)
+ script: |
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org
+ #
+ # contributed by jose fco. gonzalez
+ # modified by Sokolov Yura
+
+ seq = String.new
+
+ def frecuency( seq,length )
+ n, table = seq.length - length + 1, Hash.new(0)
+ f, i = nil, nil
+ (0 ... length).each do |f|
+ (f ... n).step(length) do |i|
+ table[seq[i,length]] += 1
+ end
+ end
+ [n,table]
+
+ end
+
+ def sort_by_freq( seq,length )
+ n,table = frecuency( seq,length )
+ a, b, v = nil, nil, nil
+ table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+ puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+ end
+ puts
+ end
+
+ def find_seq( seq,s )
+ n,table = frecuency( seq,s.length )
+ puts "#{table[s].to_s}\t#{s.upcase}"
+ end
+
+ input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+ line = input.gets while line !~ /^>THREE/
+ line = input.gets
+
+ while (line !~ /^>/) & line do
+ seq << line.chomp
+ line = input.gets
+ end
+
+ [1,2].each {|i| sort_by_freq( seq,i ) }
+
+ %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+ loop_count: 1
diff --git a/benchmark/so_lists.rb b/benchmark/so_lists.rb
new file mode 100644
index 0000000000..e8f4a2a5f7
--- /dev/null
+++ b/benchmark/so_lists.rb
@@ -0,0 +1,47 @@
+#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
+
+NUM = 300
+SIZE = 10000
+
+def test_lists()
+ # create a list of integers (Li1) from 1 to SIZE
+ li1 = (1..SIZE).to_a
+ # copy the list to li2 (not by individual items)
+ li2 = li1.dup
+ # remove each individual item from left side of li2 and
+ # append to right side of li3 (preserving order)
+ li3 = Array.new
+ while (not li2.empty?)
+ li3.push(li2.shift)
+ end
+ # li2 must now be empty
+ # remove each individual item from right side of li3 and
+ # append to right side of li2 (reversing list)
+ while (not li3.empty?)
+ li2.push(li3.pop)
+ end
+ # li3 must now be empty
+ # reverse li1 in place
+ li1.reverse!
+ # check that first item is now SIZE
+ if li1[0] != SIZE then
+ p "not SIZE"
+ 0
+ else
+ # compare li1 and li2 for equality
+ if li1 != li2 then
+ return(0)
+ else
+ # return the length of the list
+ li1.length
+ end
+ end
+end
+
+i = 0
+while i<NUM
+ i += 1
+ result = test_lists()
+end
+
+result
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/so_mandelbrot.rb
index 76331c64b8..76331c64b8 100644
--- a/benchmark/bm_so_mandelbrot.rb
+++ b/benchmark/so_mandelbrot.rb
diff --git a/benchmark/so_matrix.rb b/benchmark/so_matrix.rb
new file mode 100644
index 0000000000..2d1e72bda9
--- /dev/null
+++ b/benchmark/so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+ count = 1
+ mx = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ row[j] = count
+ count += 1
+ end
+ mx[bi] = row
+ end
+ mx
+end
+
+def mmult(rows, cols, m1, m2)
+ m3 = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ val = 0
+ (0 .. (cols - 1)).each do |k|
+ val += m1.at(bi).at(k) * m2.at(k).at(j)
+ end
+ row[j] = val
+ end
+ m3[bi] = row
+ end
+ m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+ mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/so_meteor_contest.rb b/benchmark/so_meteor_contest.rb
new file mode 100644
index 0000000000..8c136baa6c
--- /dev/null
+++ b/benchmark/so_meteor_contest.rb
@@ -0,0 +1,563 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+# contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM: the main body is at the bottom.
+# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# 2) see how I represent a board as a bitmask by reading the blank_board comments
+# 3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+ # an array (by location) containing a bit mask for how the piece maps at the given location.
+ # if the rotation is invalid at that location the mask will contain false
+ attr_reader :start_masks
+
+ # maps a direction to a relative location. these differ depending on whether it is an even or
+ # odd row being mapped from
+ @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+ @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+ def initialize( directions )
+ @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+ @even_mask = mask_for_offsets( @even_offsets)
+ @odd_mask = mask_for_offsets( @odd_offsets)
+
+ @start_masks = Array.new(60)
+
+ # create the rotational masks by placing the base mask at the location and seeing if
+ # 1) it overlaps the boundaries and 2) it produces a prunable board. if either of these
+ # is true the piece cannot be placed
+ 0.upto(59) do | offset |
+ mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+ if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+ imask = compute_required( mask, offset)
+ @start_masks[offset] = [ mask, imask, imask | mask ]
+ else
+ @start_masks[offset] = false
+ end
+ end
+ end
+
+ def compute_required( mask, offset )
+ board = blank_board
+ 0.upto(offset) { | i | board |= 1 << i }
+ board |= mask
+ return 0 if (!prunable(board | mask, offset))
+ board = flood_fill(board,58)
+ count = 0
+ imask = 0
+ 0.upto(59) do | i |
+ if (board[i] == 0) then
+ imask |= (1 << i)
+ count += 1
+ end
+ end
+ (count > 0 && count < 5) ? imask : 0
+ end
+
+ def flood_fill( board, location)
+ return board if (board[location] == 1)
+ board |= 1 << location
+ row, col = location.divmod(6)
+ board = flood_fill( board, location - 1) if (col > 0)
+ board = flood_fill( board, location + 1) if (col < 4)
+ if (row % 2 == 0) then
+ board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+ else
+ board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+ end
+ board
+ end
+
+ # given a location, produces a list of relative locations covered by the piece at this rotation
+ def offsets( location)
+ if is_even( location) then
+ @even_offsets.collect { | value | value + location }
+ else
+ @odd_offsets.collect { | value | value + location }
+ end
+ end
+
+ # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+ # this is hard to explain. imagine we have this partial board:
+ # 0 0 0 0 0 x [positions 0-5]
+ # 0 0 1 1 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 1 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # The top-left of the piece is at position 8, the
+ # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+ # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+ # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
+ # 0 0 0 1 1 x [positions 0-5]
+ # 0 0 1 0 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 0 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+ # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+ # this function would return
+ def normalize_offsets( values)
+ min = values.min
+ even_min = is_even(min)
+ other_min = even_min ? min + 6 : min + 7
+ other_values = values.collect do | value |
+ if is_even(value) then
+ value + 6 - other_min
+ else
+ value + 7 - other_min
+ end
+ end
+ values.collect! { | value | value - min }
+
+ if even_min then
+ [values, other_values]
+ else
+ [other_values, values]
+ end
+ end
+
+ # produce a bitmask representation of an array of offset locations
+ def mask_for_offsets( offsets )
+ mask = 0
+ offsets.each { | value | mask = mask + ( 1 << value ) }
+ mask
+ end
+
+ # finds a "safe" position that a position as described by a list of directions can be placed
+ # without falling off any edge of the board. the values returned a location to place the first piece
+ # at so it will fit after making the described moves
+ def start_adjust( directions )
+ south = east = 0;
+ directions.each do | direction |
+ east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+ south += 1 if ( direction == :nw || direction == :ne )
+ end
+ south * 6 + east
+ end
+
+ # given a set of directions places the piece (as defined by a set of directions) on the board at
+ # a location that will not take it off the edge
+ def get_values( directions )
+ start = start_adjust(directions)
+ values = [ start ]
+ directions.each do | direction |
+ if (start % 12 >= 6) then
+ start += @@rotation_odd_adder[direction]
+ else
+ start += @@rotation_even_adder[direction]
+ end
+ values += [ start ]
+ end
+
+ # some moves take you back to an existing location, we'll strip duplicates
+ values.uniq
+ end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+# rotations -- all the rotations of the piece
+# type -- a numeic "name" of the piece
+# masks -- an array by location of all legal rotational masks (a n inner array) for that location
+# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+ attr_reader :rotations, :type, :masks
+ attr_accessor :placed
+
+ # transform hashes that change one direction into another when you either flip or rotate a set of directions
+ @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+ @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+ def initialize( directions, type )
+ @type = type
+ @rotations = Array.new();
+ @map = {}
+
+ generate_rotations( directions )
+ directions.collect! { | value | @@flip_converter[value] }
+ generate_rotations( directions )
+
+ # creates the masks AND a map that returns [location, rotation] for any given mask
+ # this is used when a board is found and we want to draw it, otherwise the map is unused
+ @masks = Array.new();
+ 0.upto(59) do | i |
+ even = true
+ @masks[i] = @rotations.collect do | rotation |
+ mask = rotation.start_masks[i]
+ @map[mask[0]] = [ i, rotation ] if (mask)
+ mask || nil
+ end
+ @masks[i].compact!
+ end
+ end
+
+ # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+ def generate_rotations( directions )
+ 6.times do
+ rotations.push( Rotation.new(directions))
+ directions.collect! { | value | @@rotate_converter[value] }
+ end
+ end
+
+ # given a board string, adds this piece to the board at whatever location/rotation
+ # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+ def fill_string( board_string)
+ location, rotation = @map[@placed]
+ rotation.offsets(location).each do | offset |
+ row, col = offset.divmod(6)
+ board_string[ row*5 + col, 1 ] = @type.to_s
+ end
+ end
+end
+
+# a blank bit board having this form:
+#
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+ 0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+ 0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+ (location % 12) < 6
+end
+
+# support function that create three utility maps:
+# $converter -- for each row an array that maps a five bit row (via array mapping)
+# to the a five bit representation of the bits below it
+# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+# a region array has three values the first is a mask of bits in the region,
+# the second is the count of those bits and the third is identical to the first
+# examples:
+# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+# 0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+ odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+ even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+ all_odds = Array.new(0b100000)
+ all_evens = Array.new(0b100000)
+ bit_counts = Array.new(0b100000)
+ new_regions = Array.new(0b100000)
+ 0.upto(0b11111) do | i |
+ bit_count = odd = even = 0
+ 0.upto(4) do | bit |
+ if (i[bit] == 1) then
+ bit_count += 1
+ odd |= odd_map[bit]
+ even |= even_map[bit]
+ end
+ end
+ all_odds[i] = odd
+ all_evens[i] = even
+ bit_counts[i] = bit_count
+ new_regions[i] = create_regions( i)
+ end
+
+ $converter = []
+ 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+ $bit_counts = bit_counts
+ $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five. The following board is an example of a prunable board:
+# 0 0 1 0 0
+# 0 1 0 0 0
+# 1 1 0 0 0
+# 0 1 0 0 0
+# 0 0 0 0 0
+# ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+# board -- an initial bit board (6 bit padded rows, see blank_board for format)
+# location -- starting location, everything above and to the left is already full
+# slotting -- set to true only when testing initial pieces, when filling normally
+# additional assumptions are possible
+#
+# Algorithm:
+# The algorithm starts at the top row (as determined by location) and iterates a row at a time
+# maintainng counts of active open areas (kept in the collector array) each collector contains
+# three values at the start of an iteration:
+# 0: mask of bits that would be adjacent to the collector in this row
+# 1: the number of bits collected so far
+# 2: a scratch space starting as zero, but used during the computation to represent
+# the empty bits in the new row that are adjacent (position 0)
+# The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+ collectors = []
+ # loop across the rows
+ (location / 6).to_i.upto(9) do | row_on |
+ # obtain a set of regions representing the bits of the current row.
+ regions = $regions[(board >> (row_on * 6)) & 0b11111]
+ converter = $converter[row_on]
+
+ # track the number of collectors at the start of the cycle so that
+ # we don't compute against newly created collectors, only existing collectors
+ initial_collector_count = collectors.length
+
+ # loop against the regions. For each region of the row
+ # we will see if it connects to one or more existing collectors.
+ # if it connects to 1 collector, the bits from the region are added to the
+ # bits of the collector and the mask is placed in collector[2]
+ # If the region overlaps more than one collector then all the collectors
+ # it overlaps with are merged into the first one (the others are set to nil in the array)
+ # if NO collectors are found then the region is copied as a new collector
+ regions.each do | region |
+ collector_found = nil
+ region_mask = region[2]
+ initial_collector_count.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ collector_mask = collector[0]
+ if (collector_mask & region_mask != 0) then
+ if (collector_found) then
+ collector_found[0] |= collector_mask
+ collector_found[1] += collector[1]
+ collector_found[2] |= collector[2]
+ collectors[collector_num] = nil
+ else
+ collector_found = collector
+ collector[1] += region[1]
+ collector[2] |= region_mask
+ end
+ end
+ end
+ end
+ if (collector_found == nil) then
+ collectors.push(Array.new(region))
+ end
+ end
+
+ # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+ # be zero. The size of any such reaason is tested if it is not a multiple of five true is returned since
+ # the board is prunable. if it is a multiple of five it is removed.
+ # Collector that are still active have a new adjacent value [0] set based n the matched bits
+ # and have [2] cleared out for the next cycle.
+ collectors.length.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ if (collector[2] == 0) then
+ return true if (collector[1] % 5 != 0)
+ collectors[collector_num] = nil
+ else
+ # if a collector matches all bits in the row then we can return unprunable early for the
+ # following reasons:
+ # 1) there can be no more unavailable bits bince we fill from the top left downward
+ # 2) all previous regions have been closed or joined so only this region can fail
+ # 3) this region must be good since there can never be only 1 region that is nuot
+ # a multiple of five
+ # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+ # in pieces to see what configurations work for them (the only other time this algorithm is used).
+ return false if (collector[2] == 0b11111 && !slotting)
+ collector[0] = converter[collector[2]]
+ collector[2] = 0
+ end
+ end
+ end
+
+ # get rid of all the empty converters for the next round
+ collectors.compact!
+ end
+ return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+ collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask. see prunable for what a "region" is
+def create_regions( value )
+ regions = []
+ cur_region = 0
+ 5.times do | bit |
+ if (value[bit] == 0) then
+ cur_region |= 1 << bit
+ else
+ if (cur_region != 0 ) then
+ regions.push( cur_region)
+ cur_region = 0;
+ end
+ end
+ end
+ regions.push(cur_region) if (cur_region != 0)
+ regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+ find_top( 1)
+ find_top( 0)
+ print_results
+end
+
+# show the board
+def print_results
+ print "#{@boards_found} solutions found\n\n"
+ print_full_board( @min_board)
+ print "\n"
+ print_full_board( @max_board)
+ print "\n"
+end
+
+# finds solutions. This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece. It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+# Since any found solution has an inverse we want to maximize finding solutions that are not already found
+# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
+# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
+# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
+# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+# maximum number
+def find_top( rotation_skip)
+ board = blank_board
+ (@pieces.length-1).times do
+ piece = @pieces.shift
+ piece.masks[0].each do | mask, imask, cmask |
+ if ((rotation_skip += 1) % 2 == 0) then
+ piece.placed = mask
+ find( 1, 1, board | mask)
+ end
+ end
+ @pieces.push(piece)
+ end
+ piece = @pieces.shift
+ @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found. depth is achieved via recursion. the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+# start_location -- where to start looking for place for the next piece at
+# placed -- number of pieces placed
+# board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+ # find the next location to place a piece by looking for an empty bit
+ while board[start_location] == 1
+ start_location += 1
+ end
+
+ @pieces.length.times do
+ piece = @pieces.shift
+ piece.masks[start_location].each do | mask, imask, cmask |
+ if ( board & cmask == imask) then
+ piece.placed = mask
+ if (placed == 9) then
+ add_board
+ else
+ find( start_location + 1, placed + 1, board | mask)
+ end
+ end
+ end
+ @pieces.push(piece)
+ end
+end
+
+# print the board
+def print_full_board( board_string)
+ 10.times do | row |
+ print " " if (row % 2 == 1)
+ 5.times do | col |
+ print "#{board_string[row*5 + col,1]} "
+ end
+ print "\n"
+ end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+ board_string = "99999999999999999999999999999999999999999999999999"
+ @all_pieces.each { | piece | piece.fill_string( board_string ) }
+ save( board_string)
+ save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+ if (@all_boards[board_string] == nil) then
+ @min_board = board_string if (board_string < @min_board)
+ @max_board = board_string if (board_string > @max_board)
+ @all_boards.store(board_string,true)
+ @boards_found += 1
+
+ # the exit motif is a time saver. Ideally the function should return, but those tests
+ # take noticeable time (performance).
+ if (@boards_found == @stop_count) then
+ print_results
+ exit(0)
+ end
+ end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+ Piece.new( [ :nw, :ne, :east, :east ], 2),
+ Piece.new( [ :ne, :se, :east, :ne ], 7),
+ Piece.new( [ :ne, :east, :ne, :nw ], 1),
+ Piece.new( [ :east, :sw, :sw, :se ], 6),
+ Piece.new( [ :east, :ne, :se, :ne ], 5),
+ Piece.new( [ :east, :east, :east, :se ], 0),
+ Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+ Piece.new( [ :se, :se, :se, :west ], 9),
+ Piece.new( [ :se, :se, :east, :se ], 8),
+ Piece.new( [ :east, :east, :sw, :se ], 3)
+ ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
diff --git a/benchmark/so_nbody.rb b/benchmark/so_nbody.rb
new file mode 100644
index 0000000000..9884fc4edc
--- /dev/null
+++ b/benchmark/so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+ def initialize(x, y, z, vx, vy, vz, mass)
+ @x, @y, @z = x, y, z
+ @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+ @mass = mass * SOLAR_MASS
+ end
+
+ def move_from_i(bodies, nbodies, dt, i)
+ while i < nbodies
+ b2 = bodies[i]
+ dx = @x - b2.x
+ dy = @y - b2.y
+ dz = @z - b2.z
+
+ distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+ mag = dt / (distance * distance * distance)
+ b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+ @vx -= dx * b2_mass_mag
+ @vy -= dy * b2_mass_mag
+ @vz -= dz * b2_mass_mag
+ b2.vx += dx * b_mass_mag
+ b2.vy += dy * b_mass_mag
+ b2.vz += dz * b_mass_mag
+ i += 1
+ end
+
+ @x += dt * @vx
+ @y += dt * @vy
+ @z += dt * @vz
+ end
+end
+
+def energy(bodies)
+ e = 0.0
+ nbodies = bodies.size
+
+ for i in 0 ... nbodies
+ b = bodies[i]
+ e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+ for j in (i + 1) ... nbodies
+ b2 = bodies[j]
+ dx = b.x - b2.x
+ dy = b.y - b2.y
+ dz = b.z - b2.z
+ distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+ e -= (b.mass * b2.mass) / distance
+ end
+ end
+ e
+end
+
+def offset_momentum(bodies)
+ px, py, pz = 0.0, 0.0, 0.0
+
+ for b in bodies
+ m = b.mass
+ px += b.vx * m
+ py += b.vy * m
+ pz += b.vz * m
+ end
+
+ b = bodies[0]
+ b.vx = - px / SOLAR_MASS
+ b.vy = - py / SOLAR_MASS
+ b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+ # sun
+ Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+ # jupiter
+ Planet.new(
+ 4.84143144246472090e+00,
+ -1.16032004402742839e+00,
+ -1.03622044471123109e-01,
+ 1.66007664274403694e-03,
+ 7.69901118419740425e-03,
+ -6.90460016972063023e-05,
+ 9.54791938424326609e-04),
+
+ # saturn
+ Planet.new(
+ 8.34336671824457987e+00,
+ 4.12479856412430479e+00,
+ -4.03523417114321381e-01,
+ -2.76742510726862411e-03,
+ 4.99852801234917238e-03,
+ 2.30417297573763929e-05,
+ 2.85885980666130812e-04),
+
+ # uranus
+ Planet.new(
+ 1.28943695621391310e+01,
+ -1.51111514016986312e+01,
+ -2.23307578892655734e-01,
+ 2.96460137564761618e-03,
+ 2.37847173959480950e-03,
+ -2.96589568540237556e-05,
+ 4.36624404335156298e-05),
+
+ # neptune
+ Planet.new(
+ 1.53796971148509165e+01,
+ -2.59193146099879641e+01,
+ 1.79258772950371181e-01,
+ 2.68067772490389322e-03,
+ 1.62824170038242295e-03,
+ -9.51592254519715870e-05,
+ 5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+ i = 0
+ while i < nbodies
+ b = BODIES[i]
+ b.move_from_i(BODIES, nbodies, dt, i + 1)
+ i += 1
+ end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/so_nested_loop.rb b/benchmark/so_nested_loop.rb
new file mode 100644
index 0000000000..766fcf7b84
--- /dev/null
+++ b/benchmark/so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+ n.times do
+ n.times do
+ n.times do
+ n.times do
+ n.times do
+ x += 1
+ end
+ end
+ end
+ end
+ end
+end
+# puts x
+
+
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/so_nsieve.rb
index a65cc78233..a65cc78233 100644
--- a/benchmark/bm_so_nsieve.rb
+++ b/benchmark/so_nsieve.rb
diff --git a/benchmark/so_nsieve_bits.rb b/benchmark/so_nsieve_bits.rb
new file mode 100644
index 0000000000..6f958ee44e
--- /dev/null
+++ b/benchmark/so_nsieve_bits.rb
@@ -0,0 +1,43 @@
+#!/usr/bin/ruby
+#coding: us-ascii
+#
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# nsieve-bits in Ruby
+# Contributed by Glenn Parker, March 2005
+
+CharExponent = 3
+BitsPerChar = 1 << CharExponent
+LowMask = BitsPerChar - 1
+
+def sieve(m)
+ items = "\xFF" * ((m / BitsPerChar) + 1)
+ masks = ""
+ BitsPerChar.times do |b|
+ masks << (1 << b).chr
+ end
+
+ count = 0
+ pmax = m - 1
+ 2.step(pmax, 1) do |p|
+ if items[p >> CharExponent][p & LowMask] == 1
+ count += 1
+ p.step(pmax, p) do |mult|
+ a = mult >> CharExponent
+ b = mult & LowMask
+ items[a] -= masks[b] if items[a][b] != 0
+ end
+ end
+ end
+ count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+n.step(n - 2, -1) do |exponent|
+ break if exponent < 0
+ m = 2 ** exponent * 10_000
+ count = sieve(m)
+ printf "Primes up to %8d %8d\n", m, count
+end
+
diff --git a/benchmark/so_object.rb b/benchmark/so_object.rb
new file mode 100644
index 0000000000..131f44624c
--- /dev/null
+++ b/benchmark/so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+ def initialize(start_state)
+ @bool = start_state
+ end
+
+ def value
+ @bool
+ end
+
+ def activate
+ @bool = !@bool
+ self
+ end
+end
+
+class NthToggle < Toggle
+ def initialize(start_state, max_counter)
+ super start_state
+ @count_max = max_counter
+ @counter = 0
+ end
+
+ def activate
+ @counter += 1
+ if @counter >= @count_max
+ @bool = !@bool
+ @counter = 0
+ end
+ self
+ end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+ toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+ toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+ ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+ ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/so_partial_sums.rb
index 630b45cb8d..630b45cb8d 100644
--- a/benchmark/bm_so_partial_sums.rb
+++ b/benchmark/so_partial_sums.rb
diff --git a/benchmark/so_pidigits.rb b/benchmark/so_pidigits.rb
new file mode 100644
index 0000000000..9a537b2d1c
--- /dev/null
+++ b/benchmark/so_pidigits.rb
@@ -0,0 +1,92 @@
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+ def initialize()
+ @z = Transformation.new 1,0,0,1
+ @x = Transformation.new 0,0,0,0
+ @inverse = Transformation.new 0,0,0,0
+ end
+
+ def next!
+ @y = @z.extract(3)
+ if safe? @y
+ @z = produce(@y)
+ @y
+ else
+ @z = consume @x.next!()
+ next!()
+ end
+ end
+
+ def safe?(digit)
+ digit == @z.extract(4)
+ end
+
+ def produce(i)
+ @inverse.qrst(10,-10*i,0,1).compose(@z)
+ end
+
+ def consume(a)
+ @z.compose(a)
+ end
+end
+
+
+class Transformation
+ attr_reader :q, :r, :s, :t
+ def initialize(q, r, s, t)
+ @q,@r,@s,@t,@k = q,r,s,t,0
+ end
+
+ def next!()
+ @q = @k = @k + 1
+ @r = 4 * @k + 2
+ @s = 0
+ @t = 2 * @k + 1
+ self
+ end
+
+ def extract(j)
+ (@q * j + @r) / (@s * j + @t)
+ end
+
+ def compose(a)
+ self.class.new( @q * a.q,
+ @q * a.r + r * a.t,
+ @s * a.q + t * a.s,
+ @s * a.r + t * a.t
+ )
+ end
+
+ def qrst *args
+ initialize *args
+ self
+ end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+ if n >= WIDTH
+ WIDTH.times {print digits.next!}
+ j += WIDTH
+ else
+ n.times {print digits.next!}
+ (WIDTH-n).times {print " "}
+ j += n
+ end
+ puts "\t:"+j.to_s
+ n -= WIDTH
+end
+
diff --git a/benchmark/so_random.rb b/benchmark/so_random.rb
new file mode 100644
index 0000000000..a66b9e8e63
--- /dev/null
+++ b/benchmark/so_random.rb
@@ -0,0 +1,20 @@
+# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
+
+IM = 139968.0
+IA = 3877.0
+IC = 29573.0
+
+$last = 42.0
+
+def gen_random(max)
+ (max * ($last = ($last * IA + IC) % IM)) / IM
+end
+
+N = 3_000_000
+
+i = 0
+while i<N
+ i +=1
+ gen_random(100.0)
+end
+# "%.9f" % gen_random(100.0)
diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml
new file mode 100644
index 0000000000..de05eedfc4
--- /dev/null
+++ b/benchmark/so_reverse_complement.yml
@@ -0,0 +1,137 @@
+prelude: |
+ bm_so_fasta = <<'EOS'
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ # Contributed by Sokolov Yura
+
+ $last = 42.0
+ def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+ end
+
+ alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+ iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+ ]
+ homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+ ]
+
+ def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+ end
+
+ def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ end
+
+
+ n = (ARGV[0] or 250_000).to_i
+
+ make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+ make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+ make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+ EOS
+benchmark:
+ - name: so_reverse_complement
+ prelude: |
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ File.write(script, bm_so_fasta)
+
+ def prepare_fasta_output n
+ filebase = File.join(File.dirname($0), 'fasta.output')
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ file = "#{filebase}.#{n}"
+
+ unless FileTest.exist?(file)
+ STDERR.puts "preparing #{file}"
+
+ open(file, 'w'){|f|
+ ARGV[0] = n
+ $stdout = f
+ load script
+ $stdout = STDOUT
+ }
+ end
+ end
+ prepare_fasta_output(2_500_000)
+ script: |
+ # The Great Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ #
+ # Contributed by Peter Bjarke Olsen
+ # Modified by Doug King
+
+ seq=Array.new
+
+ def revcomp(seq)
+ seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+ stringlen=seq.length
+ 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+ end
+
+ input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+ while input.gets
+ if $_ =~ />/
+ if seq.length != 0
+ revcomp(seq.join)
+ seq=Array.new
+ end
+ puts $_
+ else
+ $_.sub(/\n/,'')
+ seq.push $_
+ end
+ end
+ revcomp(seq.join)
+ loop_count: 1
diff --git a/benchmark/so_sieve.rb b/benchmark/so_sieve.rb
new file mode 100644
index 0000000000..43dc302648
--- /dev/null
+++ b/benchmark/so_sieve.rb
@@ -0,0 +1,24 @@
+# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
+num = 500
+count = i = j = 0
+flags0 = Array.new(8192,1)
+k = 0
+while k < num
+ k += 1
+ count = 0
+ flags = flags0.dup
+ i = 2
+ while i<8192
+ i += 1
+ if flags[i]
+ # remove all multiples of prime: i
+ j = i*i
+ while j < 8192
+ j += i
+ flags[j] = nil
+ end
+ count += 1
+ end
+ end
+end
+count
diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/so_spectralnorm.rb
index 6b97206689..6b97206689 100644
--- a/benchmark/bm_so_spectralnorm.rb
+++ b/benchmark/so_spectralnorm.rb
diff --git a/benchmark/string_capitalize.yml b/benchmark/string_capitalize.yml
new file mode 100644
index 0000000000..7d23fd3d35
--- /dev/null
+++ b/benchmark/string_capitalize.yml
@@ -0,0 +1,10 @@
+prelude: |
+ str1 = [*"a".."m",*"N".."Z",*"0".."9"].join("")
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+benchmark:
+ capitalize-1: str1.capitalize
+ capitalize-10: str10.capitalize
+ capitalize-100: str100.capitalize
+ capitalize-1000: str1000.capitalize
diff --git a/benchmark/string_casecmp.yml b/benchmark/string_casecmp.yml
new file mode 100644
index 0000000000..2354040a04
--- /dev/null
+++ b/benchmark/string_casecmp.yml
@@ -0,0 +1,26 @@
+prelude: |
+ lstr1 = [*"a".."z",*"0".."9"].join("")
+ lstr10 = lstr1 * 10
+ lstr100 = lstr10 * 10
+ lstr1000 = lstr100 * 10
+ lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+ lnonascii10 = lnonascii1 * 10
+ lnonascii100 = lnonascii10 * 10
+ lnonascii1000 = lnonascii100 * 10
+ ustr1 = [*"A".."Z",*"0".."9"].join("")
+ ustr10 = ustr1 * 10
+ ustr100 = ustr10 * 10
+ ustr1000 = ustr100 * 10
+ unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+ unonascii10 = unonascii1 * 10
+ unonascii100 = unonascii10 * 10
+ unonascii1000 = unonascii100 * 10
+benchmark:
+ casecmp-1: lstr1.casecmp(ustr1)
+ casecmp-10: lstr10.casecmp(ustr10)
+ casecmp-100: lstr100.casecmp(ustr100)
+ casecmp-1000: lstr1000.casecmp(ustr1000)
+ casecmp-nonascii1: lnonascii1.casecmp(unonascii1)
+ casecmp-nonascii10: lnonascii10.casecmp(unonascii10)
+ casecmp-nonascii100: lnonascii100.casecmp(unonascii100)
+ casecmp-nonascii1000: lnonascii1000.casecmp(unonascii1000)
diff --git a/benchmark/string_casecmp_p.yml b/benchmark/string_casecmp_p.yml
new file mode 100644
index 0000000000..a790ce7d55
--- /dev/null
+++ b/benchmark/string_casecmp_p.yml
@@ -0,0 +1,26 @@
+prelude: |
+ lstr1 = [*"a".."z",*"0".."9"].join("")
+ lstr10 = lstr1 * 10
+ lstr100 = lstr10 * 10