summaryrefslogtreecommitdiff
path: root/spec/ruby/shared/file/exist.rb
diff options
context:
space:
mode:
Diffstat (limited to 'spec/ruby/shared/file/exist.rb')
-rw-r--r--spec/ruby/shared/file/exist.rb11
1 files changed, 3 insertions, 8 deletions
diff --git a/spec/ruby/shared/file/exist.rb b/spec/ruby/shared/file/exist.rb
index 3bd97711b4..5075fa74b9 100644
--- a/spec/ruby/shared/file/exist.rb
+++ b/spec/ruby/shared/file/exist.rb
@@ -4,18 +4,13 @@ describe :file_exist, shared: true do
@object.send(@method, 'a_fake_file').should == false
end
- it "returns true if the file exist using the alias exists?" do
- @object.send(@method, __FILE__).should == true
- @object.send(@method, 'a_fake_file').should == false
- end
-
it "raises an ArgumentError if not passed one argument" do
- -> { @object.send(@method) }.should raise_error(ArgumentError)
- -> { @object.send(@method, __FILE__, __FILE__) }.should raise_error(ArgumentError)
+ -> { @object.send(@method) }.should.raise(ArgumentError)
+ -> { @object.send(@method, __FILE__, __FILE__) }.should.raise(ArgumentError)
end
it "raises a TypeError if not passed a String type" do
- -> { @object.send(@method, nil) }.should raise_error(TypeError)
+ -> { @object.send(@method, nil) }.should.raise(TypeError)
end
it "accepts an object that has a #to_path method" do
td class='right'>77
-rw-r--r--.github/actions/setup/baseruby/action.yml73
-rw-r--r--.github/actions/setup/directories/action.yml205
-rw-r--r--.github/actions/setup/macos/action.yml29
-rw-r--r--.github/actions/setup/ubuntu/action.yml72
-rw-r--r--.github/actions/slack/action.yml51
-rw-r--r--.github/auto_request_review.yml21
-rw-r--r--.github/codeql/codeql-config.yml24
-rw-r--r--.github/dependabot.yml29
-rw-r--r--.github/labeler.yml7
-rw-r--r--.github/workflows/annocheck.yml111
-rw-r--r--.github/workflows/auto_request_review.yml20
-rw-r--r--.github/workflows/auto_review_pr.yml41
-rw-r--r--.github/workflows/baseruby.yml89
-rw-r--r--.github/workflows/bundled_gems.yml188
-rw-r--r--.github/workflows/check_branch.yml22
-rw-r--r--.github/workflows/check_dependencies.yml82
-rw-r--r--.github/workflows/check_misc.yml150
-rw-r--r--.github/workflows/check_sast.yml133
-rw-r--r--.github/workflows/codeql-analysis.yml43
-rw-r--r--.github/workflows/compilers.yml522
-rw-r--r--.github/workflows/crosscompile.yml123
-rw-r--r--.github/workflows/cygwin.yml75
-rw-r--r--.github/workflows/default_gems_list.yml99
-rw-r--r--.github/workflows/dependabot_automerge.yml32
-rw-r--r--.github/workflows/labeler.yml15
-rw-r--r--.github/workflows/macos.yml213
-rw-r--r--.github/workflows/mingw.yml315
-rw-r--r--.github/workflows/mjit.yml77
-rw-r--r--.github/workflows/modgc.yml179
-rw-r--r--.github/workflows/parse_y.yml101
-rw-r--r--.github/workflows/post_push.yml97
-rw-r--r--.github/workflows/pr-playground.yml131
-rw-r--r--.github/workflows/publish.yml114
-rw-r--r--.github/workflows/release.yml21
-rw-r--r--.github/workflows/rust-warnings.yml62
-rw-r--r--.github/workflows/scorecards.yml78
-rw-r--r--.github/workflows/spec_guards.yml67
-rw-r--r--.github/workflows/sync_default_gems.yml80
-rw-r--r--.github/workflows/tarball-macos.yml101
-rw-r--r--.github/workflows/tarball-non-development.yml87
-rw-r--r--.github/workflows/tarball-test-schedule.yml26
-rw-r--r--.github/workflows/tarball-test.yml104
-rw-r--r--.github/workflows/tarball-ubuntu.yml151
-rw-r--r--.github/workflows/tarball-windows.yml163
-rw-r--r--.github/workflows/ubuntu.yml316
-rw-r--r--.github/workflows/wasm.yml195
-rw-r--r--.github/workflows/windows.yml237
-rw-r--r--.github/workflows/wsl.yml73
-rw-r--r--.github/workflows/yjit-macos.yml201
-rw-r--r--.github/workflows/yjit-ubuntu.yml245
-rw-r--r--.github/workflows/zjit-macos.yml239
-rw-r--r--.github/workflows/zjit-ubuntu.yml293
-rw-r--r--.github/zizmor.yml33
-rw-r--r--.gitignore73
-rw-r--r--.indent.pro32
-rw-r--r--.mailmap431
-rw-r--r--.rdoc_options37
-rw-r--r--.travis.yml291
-rw-r--r--CONTRIBUTING.md5
-rw-r--r--COPYING2
-rw-r--r--COPYING.ja2
-rw-r--r--Cargo.lock766
-rw-r--r--Cargo.toml64
-rw-r--r--LEGAL429
-rw-r--r--NEWS.md257
-rw-r--r--README.EXT1
-rw-r--r--README.EXT.ja1
-rw-r--r--README.ja.md59
-rw-r--r--README.md143
-rw-r--r--aclocal.m448
-rw-r--r--addr2line.c1891
-rw-r--r--addr2line.h4
-rw-r--r--appveyor.yml96
-rw-r--r--array.c6827
-rw-r--r--array.rb320
-rw-r--r--ast.c931
-rw-r--r--ast.rb398
-rwxr-xr-xautogen.sh22
-rwxr-xr-xbasictest/test.rb21
-rw-r--r--benchmark/README.md9
-rw-r--r--benchmark/app_aobench.rb4
-rw-r--r--benchmark/app_fib.rb2
-rw-r--r--benchmark/array_large_literal.yml19
-rw-r--r--benchmark/array_sample.yml4
-rw-r--r--benchmark/array_sort_int.yml15
-rw-r--r--benchmark/attr_accessor.yml29
-rw-r--r--benchmark/buffer_each.yml27
-rw-r--r--benchmark/buffer_get.yml25
-rw-r--r--benchmark/cgi_escape_html.yml37
-rw-r--r--benchmark/class_superclass.yml23
-rw-r--r--benchmark/constant_invalidation.rb22
-rw-r--r--benchmark/dir_pwd.yml2
-rw-r--r--benchmark/enum_minmax.yml25
-rw-r--r--benchmark/enum_sort.yml15
-rw-r--r--benchmark/enum_sort_by.yml53
-rw-r--r--benchmark/enum_tally.yml4
-rw-r--r--benchmark/erb_escape_html.yml31
-rw-r--r--benchmark/file_basename.yml6
-rw-r--r--benchmark/file_dirname.yml6
-rw-r--r--benchmark/file_expand_path.yml4
-rw-r--r--benchmark/file_extname.yml6
-rw-r--r--benchmark/file_join.yml7
-rw-r--r--benchmark/float_neg_posi.yml8
-rw-r--r--benchmark/float_predicate.yml12
-rw-r--r--benchmark/float_to_s.yml7
-rw-r--r--benchmark/hash_aref_array.rb5
-rw-r--r--benchmark/hash_aref_str_lit.yml20
-rw-r--r--benchmark/hash_first.yml11
-rw-r--r--benchmark/hash_key.yml5
-rw-r--r--benchmark/hash_new.yml16
-rw-r--r--benchmark/int_to_s.yml25
-rw-r--r--benchmark/integer_predicate.yml9
-rw-r--r--benchmark/io_close.yml13
-rw-r--r--benchmark/io_close_contended.yml21
-rw-r--r--benchmark/io_write.rb22
-rw-r--r--benchmark/iseq_load_from_binary.yml25
-rw-r--r--benchmark/ivar_extend.yml23
-rw-r--r--benchmark/lib/benchmark_driver/runner/mjit.rb34
-rw-r--r--benchmark/lib/benchmark_driver/runner/mjit_exec.rb237
-rw-r--r--benchmark/lib/benchmark_driver/runner/ractor.rb122
-rw-r--r--benchmark/loop_each.yml4
-rw-r--r--benchmark/loop_generator.rb2
-rw-r--r--benchmark/loop_times_megamorphic.yml7
-rw-r--r--benchmark/marshal_dump_load_integer.yml22
-rw-r--r--benchmark/masgn.yml53
-rw-r--r--benchmark/method_bind_call.yml16
-rw-r--r--benchmark/mjit_exec_jt2jt.yml6
-rw-r--r--benchmark/mjit_exec_vm2jt.yml6
-rw-r--r--benchmark/mjit_exec_vm2vm.yml6
-rw-r--r--benchmark/mjit_exivar.yml18
-rw-r--r--benchmark/mjit_integer.yml30
-rw-r--r--benchmark/mjit_kernel.yml20
-rw-r--r--benchmark/mjit_leave.yml8
-rw-r--r--benchmark/mjit_opt_cc_insns.yml27
-rw-r--r--benchmark/mjit_struct_aref.yml10
-rw-r--r--benchmark/module_eqq.yml32
-rw-r--r--benchmark/nilclass.yml16
-rw-r--r--benchmark/numeric_methods.yml29
-rw-r--r--benchmark/object_allocate.yml28
-rw-r--r--benchmark/object_class.yml40
-rw-r--r--benchmark/object_id.yml4
-rw-r--r--benchmark/pathname.yml15
-rw-r--r--benchmark/ractor_const.yml4
-rw-r--r--benchmark/ractor_float_to_s.yml8
-rw-r--r--benchmark/ractor_string_fstring.yml18
-rw-r--r--benchmark/range_bsearch_bignum.yml10
-rw-r--r--benchmark/range_bsearch_endpointless.yml21
-rw-r--r--benchmark/range_bsearch_fixnum.yml10
-rw-r--r--benchmark/range_count.yml11
-rw-r--r--benchmark/range_min.yml2
-rw-r--r--benchmark/range_overlap.yml19
-rw-r--r--benchmark/range_reverse_each.yml16
-rw-r--r--benchmark/realpath.yml3
-rw-r--r--benchmark/regexp_dup.yml6
-rw-r--r--benchmark/regexp_new.yml7
-rw-r--r--benchmark/scan.yaml16
-rw-r--r--benchmark/search.yaml16
-rw-r--r--benchmark/set.yml261
-rw-r--r--benchmark/so_count_words.yml33
-rw-r--r--benchmark/so_meteor_contest.rb2
-rw-r--r--benchmark/so_nbody.rb58
-rw-r--r--benchmark/string_casecmp.yml2
-rw-r--r--benchmark/string_codepoints.yml9
-rw-r--r--benchmark/string_coderange_scan.yml10
-rw-r--r--benchmark/string_concat.yml51
-rw-r--r--benchmark/string_dup.yml7
-rw-r--r--benchmark/string_fstring.yml16
-rw-r--r--benchmark/string_gsub.yml54
-rw-r--r--benchmark/string_memsearch.yml75
-rw-r--r--benchmark/string_rpartition.yml18
-rw-r--r--benchmark/string_scrub.yml48
-rw-r--r--benchmark/struct_accessor.yml37
-rw-r--r--benchmark/time_at.yml7
-rw-r--r--benchmark/time_new.yml4
-rw-r--r--benchmark/time_now.yml4
-rw-r--r--benchmark/time_parse.yml10
-rw-r--r--benchmark/time_strftime.yml7
-rw-r--r--benchmark/time_xmlschema.yml27
-rw-r--r--benchmark/vm_call_bmethod.yml37
-rw-r--r--benchmark/vm_call_kw_and_kw_splat.yml25
-rw-r--r--benchmark/vm_call_method_missing.yml62
-rw-r--r--benchmark/vm_call_send_iseq.yml77
-rw-r--r--benchmark/vm_call_symproc.yml83
-rw-r--r--benchmark/vm_case_classes.yml9
-rw-r--r--benchmark/vm_const.yml6
-rw-r--r--benchmark/vm_cvar.yml20
-rw-r--r--benchmark/vm_dstr_ary.rb6
-rw-r--r--benchmark/vm_dstr_bool.rb7
-rw-r--r--benchmark/vm_dstr_class_module.rb10
-rw-r--r--benchmark/vm_dstr_digit.rb7
-rw-r--r--benchmark/vm_dstr_int.rb5
-rw-r--r--benchmark/vm_dstr_nil.rb6
-rw-r--r--benchmark/vm_dstr_obj.rb6
-rw-r--r--benchmark/vm_dstr_obj_def.rb8
-rw-r--r--benchmark/vm_dstr_str.rb6
-rw-r--r--benchmark/vm_dstr_sym.rb6
-rw-r--r--benchmark/vm_freezeobj.yml6
-rw-r--r--benchmark/vm_ivar_embedded_obj_init.yml14
-rw-r--r--benchmark/vm_ivar_extended_obj_init.yml16
-rw-r--r--benchmark/vm_ivar_generic_get.yml17
-rw-r--r--benchmark/vm_ivar_generic_set.yml14
-rw-r--r--benchmark/vm_ivar_get.yml100
-rw-r--r--benchmark/vm_ivar_get_unintialized.yml12
-rw-r--r--benchmark/vm_ivar_ic_miss.yml20
-rw-r--r--benchmark/vm_ivar_init.yml14
-rw-r--r--benchmark/vm_ivar_lazy_set.yml12
-rw-r--r--benchmark/vm_ivar_memoize.yml85
-rw-r--r--benchmark/vm_ivar_of_class.yml12
-rw-r--r--benchmark/vm_ivar_of_class_set.yml11
-rw-r--r--benchmark/vm_ivar_set_on_instance.yml94
-rw-r--r--benchmark/vm_ivar_set_subclass.yml9
-rw-r--r--benchmark/vm_lvar_cond_set.yml8
-rw-r--r--benchmark/vm_method_splat_calls.yml13
-rw-r--r--benchmark/vm_method_splat_calls2.yml27
-rw-r--r--benchmark/vm_regexp.yml6
-rw-r--r--benchmark/vm_send_cfunc.yml15
-rw-r--r--benchmark/vm_super_splat_calls.yml25
-rw-r--r--benchmark/vm_thread_condvar1.rb8
-rw-r--r--benchmark/vm_thread_condvar2.rb10
-rw-r--r--benchmark/vm_zsuper_splat_calls.yml28
-rw-r--r--bignum.c1703
-rwxr-xr-xbin/bundle27
-rwxr-xr-xbin/bundler27
-rwxr-xr-xbin/erb27
-rwxr-xr-xbin/gem21
-rwxr-xr-xbin/irb27
-rwxr-xr-xbin/racc27
-rwxr-xr-xbin/rdoc27
-rwxr-xr-xbin/ri27
-rwxr-xr-xbootstraptest/runner.rb913
-rw-r--r--bootstraptest/test_attr.rb16
-rw-r--r--bootstraptest/test_autoload.rb30
-rw-r--r--bootstraptest/test_constant_cache.rb187
-rw-r--r--bootstraptest/test_eval.rb74
-rw-r--r--bootstraptest/test_exception.rb2
-rw-r--r--bootstraptest/test_fiber.rb9
-rw-r--r--bootstraptest/test_finalizer.rb8
-rw-r--r--bootstraptest/test_flow.rb6
-rw-r--r--bootstraptest/test_fork.rb27
-rw-r--r--bootstraptest/test_insns.rb85
-rw-r--r--bootstraptest/test_io.rb7
-rw-r--r--bootstraptest/test_jump.rb6
-rw-r--r--bootstraptest/test_literal.rb16
-rw-r--r--bootstraptest/test_literal_suffix.rb12
-rw-r--r--bootstraptest/test_load.rb12
-rw-r--r--bootstraptest/test_method.rb298
-rw-r--r--bootstraptest/test_ractor.rb2100
-rw-r--r--bootstraptest/test_syntax.rb60
-rw-r--r--bootstraptest/test_thread.rb27
-rw-r--r--bootstraptest/test_yjit.rb5557
-rw-r--r--bootstraptest/test_yjit_30k_ifelse.rb241023
-rw-r--r--bootstraptest/test_yjit_30k_methods.rb121018
-rw-r--r--bootstraptest/test_yjit_rust_port.rb422
-rw-r--r--box.c1299
-rw-r--r--builtin.c101
-rw-r--r--builtin.h98
-rw-r--r--ccan/build_assert/build_assert.h12
-rw-r--r--ccan/check_type/check_type.h28
-rw-r--r--ccan/container_of/container_of.h52
-rw-r--r--ccan/list/list.h591
-rw-r--r--ccan/str/str.h9
-rw-r--r--class.c2328
-rw-r--r--common.mk15813
-rw-r--r--compar.c132
-rw-r--r--compile.c13820
-rw-r--r--complex.c1982
-rw-r--r--concurrent_set.c518
-rw-r--r--configure.ac2226
-rw-r--r--constant.h2
-rw-r--r--cont.c2004
-rw-r--r--coroutine/Stack.h16
-rw-r--r--coroutine/amd64/Context.S84
-rw-r--r--coroutine/amd64/Context.h33
-rw-r--r--coroutine/arm32/Context.S7
-rw-r--r--coroutine/arm32/Context.h8
-rw-r--r--coroutine/arm64/Context.S164
-rw-r--r--coroutine/arm64/Context.asm81
-rw-r--r--coroutine/arm64/Context.h74
-rw-r--r--coroutine/asyncify/Context.c10
-rw-r--r--coroutine/asyncify/Context.h93
-rw-r--r--coroutine/copy/Context.c162
-rw-r--r--coroutine/copy/Context.h90
-rw-r--r--coroutine/emscripten/Context.c8
-rw-r--r--coroutine/emscripten/Context.h77
-rw-r--r--coroutine/loongarch64/Context.S72
-rw-r--r--coroutine/loongarch64/Context.h46
-rw-r--r--coroutine/ppc/Context.S89
-rw-r--r--coroutine/ppc/Context.h58
-rw-r--r--coroutine/ppc64/Context.S88
-rw-r--r--coroutine/ppc64/Context.h57
-rw-r--r--coroutine/ppc64le/Context.S28
-rw-r--r--coroutine/ppc64le/Context.h8
-rw-r--r--coroutine/pthread/Context.c272
-rw-r--r--coroutine/pthread/Context.h63
-rw-r--r--coroutine/riscv64/Context.S86
-rw-r--r--coroutine/riscv64/Context.h46
-rw-r--r--coroutine/ucontext/Context.c1
-rw-r--r--coroutine/ucontext/Context.h9
-rw-r--r--coroutine/universal/Context.S16
-rw-r--r--coroutine/universal/Context.h21
-rw-r--r--coroutine/win32/Context.h9
-rw-r--r--coroutine/win64/Context.h11
-rw-r--r--coroutine/x86/Context.S7
-rw-r--r--coroutine/x86/Context.h8
-rw-r--r--coverage/README2
-rw-r--r--cygwin/GNUmakefile.in50
-rw-r--r--darray.h295
-rw-r--r--debug.c499
-rw-r--r--debug_counter.c38
-rw-r--r--debug_counter.h124
-rw-r--r--defs/gmake.mk462
-rw-r--r--defs/id.def48
-rw-r--r--defs/jit.mk107
-rw-r--r--defs/keywords2
-rw-r--r--defs/known_errors.def314
-rw-r--r--defs/lex.c.src2
-rw-r--r--defs/opt_insn_unif.def8
-rw-r--r--defs/tags.mk18
-rw-r--r--defs/universal.mk5
-rw-r--r--depend21719
-rw-r--r--dir.c3277
-rw-r--r--dir.rb532
-rw-r--r--dln.c1520
-rw-r--r--dln.h7
-rw-r--r--dln_find.c259
-rw-r--r--dmydln.c21
-rw-r--r--dmyenc.c16
-rw-r--r--dmyext.c14
-rw-r--r--doc/.document16
-rw-r--r--doc/ChangeLog-0.60_to_1.13955
-rw-r--r--doc/ChangeLog-1.9.392772
-rw-r--r--doc/ChangeLog-2.0.024015
-rw-r--r--doc/ChangeLog-2.1.018060
-rw-r--r--doc/ChangeLog-2.2.012157
-rw-r--r--doc/ChangeLog-2.3.012187
-rw-r--r--doc/ChangeLog-2.4.09492
-rw-r--r--doc/ChangeLog-YARV6917
-rw-r--r--doc/ChangeLog/ChangeLog-0.06_to_0.52 (renamed from doc/ChangeLog-0.06_to_0.52)0
-rw-r--r--doc/ChangeLog/ChangeLog-0.50_to_0.60 (renamed from doc/ChangeLog-0.50_to_0.60)0
-rw-r--r--doc/ChangeLog/ChangeLog-0.60_to_1.13955
-rw-r--r--doc/ChangeLog/ChangeLog-1.8.0 (renamed from doc/ChangeLog-1.8.0)0
-rw-r--r--doc/ChangeLog/ChangeLog-1.9.392772
-rw-r--r--doc/ChangeLog/ChangeLog-2.0.024015
-rw-r--r--doc/ChangeLog/ChangeLog-2.1.018060
-rw-r--r--doc/ChangeLog/ChangeLog-2.2.012157
-rw-r--r--doc/ChangeLog/ChangeLog-2.3.012188
-rw-r--r--doc/ChangeLog/ChangeLog-2.4.09492
-rw-r--r--doc/ChangeLog/ChangeLog-YARV6917
-rw-r--r--doc/NEWS-2.0.0529
-rw-r--r--doc/NEWS-2.5.0565
-rw-r--r--doc/NEWS-2.7.0826
-rw-r--r--doc/NEWS-3.0.0.md817
-rw-r--r--doc/NEWS/NEWS-1.8.7 (renamed from doc/NEWS-1.8.7)0
-rw-r--r--doc/NEWS/NEWS-1.9.1 (renamed from doc/NEWS-1.9.1)0
-rw-r--r--doc/NEWS/NEWS-1.9.2 (renamed from doc/NEWS-1.9.2)0
-rw-r--r--doc/NEWS/NEWS-1.9.3 (renamed from doc/NEWS-1.9.3)0
-rw-r--r--doc/NEWS/NEWS-2.0.0529
-rw-r--r--doc/NEWS/NEWS-2.1.0 (renamed from doc/NEWS-2.1.0)0
-rw-r--r--doc/NEWS/NEWS-2.2.0 (renamed from doc/NEWS-2.2.0)0
-rw-r--r--doc/NEWS/NEWS-2.3.0 (renamed from doc/NEWS-2.3.0)0
-rw-r--r--doc/NEWS/NEWS-2.4.0 (renamed from doc/NEWS-2.4.0)0
-rw-r--r--doc/NEWS/NEWS-2.5.0565
-rw-r--r--doc/NEWS/NEWS-2.6.0 (renamed from doc/NEWS-2.6.0)0
-rw-r--r--doc/NEWS/NEWS-2.7.0845
-rw-r--r--doc/NEWS/NEWS-3.0.0.md829
-rw-r--r--doc/NEWS/NEWS-3.1.0.md660
-rw-r--r--doc/NEWS/NEWS-3.2.0.md820
-rw-r--r--doc/NEWS/NEWS-3.3.0.md529
-rw-r--r--doc/NEWS/NEWS-3.4.0.md962
-rw-r--r--doc/NEWS/NEWS-4.0.0.md802
-rw-r--r--doc/_regexp.rdoc1291
-rw-r--r--doc/_timezones.rdoc163
-rw-r--r--doc/contributing.rdoc428
-rw-r--r--doc/contributing/bug_triaging.rdoc (renamed from doc/bug_triaging.rdoc)0
-rw-r--r--doc/contributing/building_ruby.md355
-rw-r--r--doc/contributing/concurrency_guide.md154
-rw-r--r--doc/contributing/contributing.md35
-rw-r--r--doc/contributing/documentation_guide.md659
-rw-r--r--doc/contributing/dtrace_probes.rdoc (renamed from doc/dtrace_probes.rdoc)0
-rw-r--r--doc/contributing/glossary.md48
-rw-r--r--doc/contributing/making_changes_to_ruby.md28
-rw-r--r--doc/contributing/making_changes_to_stdlibs.md49
-rw-r--r--doc/contributing/memory_view.md167
-rw-r--r--doc/contributing/reporting_issues.md102
-rw-r--r--doc/contributing/testing_ruby.md155
-rw-r--r--doc/contributing/vm_stack_and_frames.md163
-rw-r--r--doc/csv/arguments/io.rdoc5
-rw-r--r--doc/csv/options/common/col_sep.rdoc63
-rw-r--r--doc/csv/options/common/quote_char.rdoc42
-rw-r--r--doc/csv/options/common/row_sep.rdoc100
-rw-r--r--doc/csv/options/generating/force_quotes.rdoc17
-rw-r--r--doc/csv/options/generating/quote_empty.rdoc12
-rw-r--r--doc/csv/options/generating/write_converters.rdoc33
-rw-r--r--doc/csv/options/generating/write_empty_value.rdoc15
-rw-r--r--doc/csv/options/generating/write_headers.rdoc29
-rw-r--r--doc/csv/options/generating/write_nil_value.rdoc14
-rw-r--r--doc/csv/options/parsing/converters.rdoc46
-rw-r--r--doc/csv/options/parsing/empty_value.rdoc13
-rw-r--r--doc/csv/options/parsing/field_size_limit.rdoc39
-rw-r--r--doc/csv/options/parsing/header_converters.rdoc43
-rw-r--r--doc/csv/options/parsing/headers.rdoc63
-rw-r--r--doc/csv/options/parsing/liberal_parsing.rdoc19
-rw-r--r--doc/csv/options/parsing/nil_value.rdoc12
-rw-r--r--doc/csv/options/parsing/return_headers.rdoc22
-rw-r--r--doc/csv/options/parsing/skip_blanks.rdoc31
-rw-r--r--doc/csv/options/parsing/skip_lines.rdoc37
-rw-r--r--doc/csv/options/parsing/strip.rdoc15
-rw-r--r--doc/csv/options/parsing/unconverted_fields.rdoc27
-rw-r--r--doc/csv/recipes/filtering.rdoc156
-rw-r--r--doc/csv/recipes/generating.rdoc244
-rw-r--r--doc/csv/recipes/parsing.rdoc543
-rw-r--r--doc/csv/recipes/recipes.rdoc6
-rw-r--r--doc/distribution/distribution.md48
-rw-r--r--doc/distribution/windows.md304
-rw-r--r--doc/examples/files.rdoc26
-rw-r--r--doc/extension.ja.rdoc126
-rw-r--r--doc/extension.rdoc527
-rw-r--r--doc/fiber.md191
-rw-r--r--doc/file/filename_globbing.md301
-rw-r--r--doc/file/filename_matching.md356
-rw-r--r--doc/file/timestamps.md83
-rw-r--r--doc/float.rb128
-rw-r--r--doc/forwardable.rd.ja80
-rw-r--r--doc/globals.rdoc69
-rw-r--r--doc/implicit_conversion.rdoc198
-rw-r--r--doc/index.md65
-rw-r--r--doc/irb/irb-tools.rd.ja184
-rw-r--r--doc/irb/irb.rd.ja418
-rw-r--r--doc/jit/yjit.md547
-rw-r--r--doc/jit/zjit.md461
-rw-r--r--doc/keywords.rdoc162
-rw-r--r--doc/language/box.md357
-rw-r--r--doc/language/bsearch.rdoc120
-rw-r--r--doc/language/calendars.rdoc62
-rw-r--r--doc/language/case_mapping.rdoc106
-rw-r--r--doc/language/character_selectors.rdoc100
-rw-r--r--doc/language/dig_methods.rdoc (renamed from doc/dig_methods.rdoc)0
-rw-r--r--doc/language/encodings.rdoc482
-rw-r--r--doc/language/exceptions.md521
-rw-r--r--doc/language/fiber.md290
-rw-r--r--doc/language/format_specifications.rdoc354
-rw-r--r--doc/language/globals.md611
-rw-r--r--doc/language/hash_inclusion.rdoc31
-rw-r--r--doc/language/implicit_conversion.rdoc221
-rw-r--r--doc/language/marshal.rdoc318
-rw-r--r--doc/language/option_dump.md265
-rw-r--r--doc/language/options.md744
-rw-r--r--doc/language/packed_data.md886
-rw-r--r--doc/language/ractor.md797
-rw-r--r--doc/language/regexp/methods.rdoc41
-rw-r--r--doc/language/regexp/unicode_properties.rdoc718
-rw-r--r--doc/language/signals.rdoc106
-rw-r--r--doc/language/strftime_formatting.rdoc525
-rw-r--r--doc/maintainers.md722
-rw-r--r--doc/maintainers.rdoc417
-rw-r--r--doc/make_cheatsheet.md124
-rw-r--r--doc/marshal.rdoc313
-rw-r--r--doc/matchdata/begin.rdoc30
-rw-r--r--doc/matchdata/bytebegin.rdoc30
-rw-r--r--doc/matchdata/byteend.rdoc30
-rw-r--r--doc/matchdata/end.rdoc30
-rw-r--r--doc/matchdata/offset.rdoc31
-rw-r--r--doc/math/math.rdoc117
-rw-r--r--doc/memory_view.md167
-rw-r--r--doc/method_documentation.rdoc183
-rw-r--r--doc/net-http/examples.rdoc31
-rw-r--r--doc/net-http/included_getters.rdoc3
-rw-r--r--doc/optparse/.document1
-rw-r--r--doc/optparse/argument_converters.rdoc380
-rw-r--r--doc/optparse/creates_option.rdoc7
-rw-r--r--doc/optparse/option_params.rdoc520
-rw-r--r--doc/optparse/ruby/argument_abbreviation.rb9
-rw-r--r--doc/optparse/ruby/argument_keywords.rb6
-rw-r--r--doc/optparse/ruby/argument_strings.rb6
-rw-r--r--doc/optparse/ruby/argv.rb2
-rw-r--r--doc/optparse/ruby/array.rb6
-rw-r--r--doc/optparse/ruby/basic.rb17
-rw-r--r--doc/optparse/ruby/block.rb9
-rw-r--r--doc/optparse/ruby/collected_options.rb8
-rw-r--r--doc/optparse/ruby/custom_converter.rb9
-rw-r--r--doc/optparse/ruby/date.rb6
-rw-r--r--doc/optparse/ruby/datetime.rb6
-rw-r--r--doc/optparse/ruby/decimal_integer.rb7
-rw-r--r--doc/optparse/ruby/decimal_numeric.rb7
-rw-r--r--doc/optparse/ruby/default_values.rb8
-rw-r--r--doc/optparse/ruby/descriptions.rb15
-rw-r--r--doc/optparse/ruby/explicit_array_values.rb9
-rw-r--r--doc/optparse/ruby/explicit_hash_values.rb9
-rw-r--r--doc/optparse/ruby/false_class.rb6
-rw-r--r--doc/optparse/ruby/float.rb6
-rw-r--r--doc/optparse/ruby/help.rb18
-rw-r--r--doc/optparse/ruby/help_banner.rb7
-rw-r--r--doc/optparse/ruby/help_format.rb25
-rw-r--r--doc/optparse/ruby/help_program_name.rb7
-rw-r--r--doc/optparse/ruby/integer.rb6
-rw-r--r--doc/optparse/ruby/long_names.rb9
-rw-r--r--doc/optparse/ruby/long_optional.rb6
-rw-r--r--doc/optparse/ruby/long_required.rb6
-rw-r--r--doc/optparse/ruby/long_simple.rb9
-rw-r--r--doc/optparse/ruby/long_with_negation.rb6
-rw-r--r--doc/optparse/ruby/match_converter.rb9
-rw-r--r--doc/optparse/ruby/matched_values.rb12
-rw-r--r--doc/optparse/ruby/method.rb11
-rw-r--r--doc/optparse/ruby/missing_options.rb12
-rw-r--r--doc/optparse/ruby/mixed_names.rb12
-rw-r--r--doc/optparse/ruby/name_abbrev.rb9
-rw-r--r--doc/optparse/ruby/no_abbreviation.rb10
-rw-r--r--doc/optparse/ruby/numeric.rb6
-rw-r--r--doc/optparse/ruby/object.rb6
-rw-r--r--doc/optparse/ruby/octal_integer.rb7
-rw-r--r--doc/optparse/ruby/optional_argument.rb9
-rw-r--r--doc/optparse/ruby/parse.rb13
-rw-r--r--doc/optparse/ruby/parse_bang.rb13
-rw-r--r--doc/optparse/ruby/proc.rb13
-rw-r--r--doc/optparse/ruby/regexp.rb6
-rw-r--r--doc/optparse/ruby/required_argument.rb9
-rw-r--r--doc/optparse/ruby/shellwords.rb6
-rw-r--r--doc/optparse/ruby/short_names.rb9
-rw-r--r--doc/optparse/ruby/short_optional.rb6
-rw-r--r--doc/optparse/ruby/short_range.rb6
-rw-r--r--doc/optparse/ruby/short_required.rb6
-rw-r--r--doc/optparse/ruby/short_simple.rb9
-rw-r--r--doc/optparse/ruby/string.rb6
-rw-r--r--doc/optparse/ruby/terminator.rb6
-rw-r--r--doc/optparse/ruby/time.rb6
-rw-r--r--doc/optparse/ruby/true_class.rb6
-rw-r--r--doc/optparse/ruby/uri.rb6
-rw-r--r--doc/optparse/tutorial.rdoc858
-rw-r--r--doc/pty/README.expect.ja32
-rw-r--r--doc/pty/README.ja50
-rw-r--r--doc/ractor.md931
-rw-r--r--doc/regexp.rdoc724
-rw-r--r--doc/security.rdoc139
-rw-r--r--doc/security/command_injection.rdoc15
-rw-r--r--doc/security/security.rdoc127
-rw-r--r--doc/signals.rdoc106
-rw-r--r--doc/standard_library.md223
-rw-r--r--doc/standard_library.rdoc118
-rw-r--r--doc/string.rb421
-rw-r--r--doc/string/aref.rdoc96
-rw-r--r--doc/string/aset.rdoc179
-rw-r--r--doc/string/b.rdoc16
-rw-r--r--doc/string/bytes.rdoc7
-rw-r--r--doc/string/bytesize.rdoc12
-rw-r--r--doc/string/byteslice.rdoc54
-rw-r--r--doc/string/bytesplice.rdoc65
-rw-r--r--doc/string/capitalize.rdoc26
-rw-r--r--doc/string/center.rdoc19
-rw-r--r--doc/string/chars.rdoc7
-rw-r--r--doc/string/chomp.rdoc31
-rw-r--r--doc/string/chop.rdoc17
-rw-r--r--doc/string/chr.rdoc7
-rw-r--r--doc/string/codepoints.rdoc8
-rw-r--r--doc/string/concat.rdoc11
-rw-r--r--doc/string/count.rdoc74
-rw-r--r--doc/string/delete.rdoc75
-rw-r--r--doc/string/delete_prefix.rdoc9
-rw-r--r--doc/string/delete_suffix.rdoc10
-rw-r--r--doc/string/downcase.rdoc20
-rw-r--r--doc/string/dump.rdoc89
-rw-r--r--doc/string/each_byte.rdoc15
-rw-r--r--doc/string/each_char.rdoc17
-rw-r--r--doc/string/each_codepoint.rdoc18
-rw-r--r--doc/string/each_grapheme_cluster.rdoc19
-rw-r--r--doc/string/each_line.rdoc66
-rw-r--r--doc/string/encode.rdoc50
-rw-r--r--doc/string/end_with_p.rdoc9
-rw-r--r--doc/string/eql_p.rdoc18
-rw-r--r--doc/string/force_encoding.rdoc21
-rw-r--r--doc/string/getbyte.rdoc23
-rw-r--r--doc/string/grapheme_clusters.rdoc19
-rw-r--r--doc/string/hash.rdoc19
-rw-r--r--doc/string/index.rdoc38
-rw-r--r--doc/string/insert.rdoc15
-rw-r--r--doc/string/inspect.rdoc38
-rw-r--r--doc/string/intern.rdoc8
-rw-r--r--doc/string/length.rdoc11
-rw-r--r--doc/string/ljust.rdoc13
-rw-r--r--doc/string/new.rdoc51
-rw-r--r--doc/string/ord.rdoc7
-rw-r--r--doc/string/partition.rdoc43
-rw-r--r--doc/string/rindex.rdoc51
-rw-r--r--doc/string/rjust.rdoc17
-rw-r--r--doc/string/rpartition.rdoc47
-rw-r--r--doc/string/scan.rdoc35
-rw-r--r--doc/string/scrub.rdoc22
-rw-r--r--doc/string/split.rdoc101
-rw-r--r--doc/string/squeeze.rdoc33
-rw-r--r--doc/string/start_with_p.rdoc16
-rw-r--r--doc/string/sub.rdoc33
-rw-r--r--doc/string/succ.rdoc52
-rw-r--r--doc/string/sum.rdoc12
-rw-r--r--doc/string/swapcase.rdoc31
-rw-r--r--doc/string/unicode_normalize.rdoc28
-rw-r--r--doc/string/upcase.rdoc27
-rw-r--r--doc/string/upto.rdoc38
-rw-r--r--doc/string/valid_encoding_p.rdoc8
-rw-r--r--doc/stringio/each_byte.rdoc31
-rw-r--r--doc/stringio/each_char.rdoc31
-rw-r--r--doc/stringio/each_codepoint.rdoc33
-rw-r--r--doc/stringio/each_line.md189
-rw-r--r--doc/stringio/getbyte.rdoc24
-rw-r--r--doc/stringio/getc.rdoc30
-rw-r--r--doc/stringio/gets.rdoc99
-rw-r--r--doc/stringio/pread.rdoc65
-rw-r--r--doc/stringio/putc.rdoc82
-rw-r--r--doc/stringio/read.rdoc83
-rw-r--r--doc/stringio/size.rdoc4
-rw-r--r--doc/stringio/stringio.md702
-rw-r--r--doc/strscan/.document1
-rw-r--r--doc/strscan/helper_methods.md124
-rw-r--r--doc/strscan/link_refs.txt17
-rw-r--r--doc/strscan/methods/get_byte.md27
-rw-r--r--doc/strscan/methods/get_charpos.md16
-rw-r--r--doc/strscan/methods/get_pos.md11
-rw-r--r--doc/strscan/methods/getch.md40
-rw-r--r--doc/strscan/methods/scan.md48
-rw-r--r--doc/strscan/methods/scan_until.md49
-rw-r--r--doc/strscan/methods/set_pos.md23
-rw-r--r--doc/strscan/methods/skip.md40
-rw-r--r--doc/strscan/methods/skip_until.md48
-rw-r--r--doc/strscan/methods/terminate.md27
-rw-r--r--doc/strscan/strscan.md544
-rw-r--r--doc/symbol/casecmp.rdoc27
-rw-r--r--doc/symbol/casecmp_p.rdoc26
-rw-r--r--doc/syntax.rdoc8
-rw-r--r--doc/syntax/assignment.rdoc18
-rw-r--r--doc/syntax/calling_methods.rdoc117
-rw-r--r--doc/syntax/comments.rdoc12
-rw-r--r--doc/syntax/control_expressions.rdoc98
-rw-r--r--doc/syntax/exceptions.rdoc10
-rw-r--r--doc/syntax/keywords.rdoc162
-rw-r--r--doc/syntax/layout.rdoc118
-rw-r--r--doc/syntax/literals.rdoc447
-rw-r--r--doc/syntax/methods.rdoc112
-rw-r--r--doc/syntax/modules_and_classes.rdoc32
-rw-r--r--doc/syntax/operators.rdoc75
-rw-r--r--doc/syntax/pattern_matching.rdoc81
-rw-r--r--doc/syntax/precedence.rdoc2
-rw-r--r--doc/syntax/refinements.rdoc71
-rw-r--r--doc/yarvarch.en7
-rw-r--r--doc/yarvarch.ja454
-rw-r--r--enc/Makefile.in15
-rw-r--r--enc/ascii.c10
-rw-r--r--enc/big5.c12
-rw-r--r--enc/cesu_8.c23
-rw-r--r--enc/cp949.c4
-rw-r--r--enc/depend6174
-rw-r--r--enc/ebcdic.h2
-rw-r--r--enc/emacs_mule.c4
-rw-r--r--enc/encdb.c2
-rw-r--r--enc/encinit.c.erb4
-rw-r--r--enc/euc_jp.c4
-rw-r--r--enc/euc_kr.c8
-rw-r--r--enc/euc_tw.c4
-rw-r--r--enc/gb18030.c4
-rw-r--r--enc/gbk.c4
-rw-r--r--enc/iso_8859_1.c6
-rw-r--r--enc/iso_8859_10.c6
-rw-r--r--enc/iso_8859_11.c4
-rw-r--r--enc/iso_8859_13.c6
-rw-r--r--enc/iso_8859_14.c6
-rw-r--r--enc/iso_8859_15.c6
-rw-r--r--enc/iso_8859_16.c6
-rw-r--r--enc/iso_8859_2.c6
-rw-r--r--enc/iso_8859_3.c6
-rw-r--r--enc/iso_8859_4.c6
-rw-r--r--enc/iso_8859_5.c6
-rw-r--r--enc/iso_8859_6.c4
-rw-r--r--enc/iso_8859_7.c6
-rw-r--r--enc/iso_8859_8.c4
-rw-r--r--enc/iso_8859_9.c6
-rw-r--r--enc/jis/props.h.blt17
-rw-r--r--enc/jis/props.kwd2
-rw-r--r--enc/jis/props.src2
-rw-r--r--enc/koi8_r.c4
-rw-r--r--enc/koi8_u.c4
-rwxr-xr-xenc/make_encmake.rb38
-rw-r--r--enc/shift_jis.c4
-rw-r--r--enc/trans/big5-uao-tbl.rb2
-rw-r--r--enc/trans/cp850-tbl.rb2
-rw-r--r--enc/trans/cp852-tbl.rb2
-rw-r--r--enc/trans/cp855-tbl.rb2
-rw-r--r--enc/trans/gbk-tbl.rb2
-rw-r--r--enc/trans/ibm437-tbl.rb2
-rw-r--r--enc/trans/ibm775-tbl.rb2
-rw-r--r--enc/trans/ibm852-tbl.rb2
-rw-r--r--enc/trans/ibm855-tbl.rb2
-rw-r--r--enc/trans/ibm857-tbl.rb2
-rw-r--r--enc/trans/ibm860-tbl.rb2
-rw-r--r--enc/trans/ibm861-tbl.rb2
-rw-r--r--enc/trans/ibm862-tbl.rb2
-rw-r--r--enc/trans/ibm863-tbl.rb2
-rw-r--r--enc/trans/ibm864-tbl.rb126
-rw-r--r--enc/trans/ibm865-tbl.rb2
-rw-r--r--enc/trans/ibm866-tbl.rb2
-rw-r--r--enc/trans/ibm869-tbl.rb2
-rw-r--r--enc/trans/iso2022.trans148
-rw-r--r--enc/trans/koi8-r-tbl.rb2
-rw-r--r--enc/trans/koi8-u-tbl.rb2
-rw-r--r--enc/trans/maccroatian-tbl.rb2
-rw-r--r--enc/trans/maccyrillic-tbl.rb2
-rw-r--r--enc/trans/macgreek-tbl.rb2
-rw-r--r--enc/trans/maciceland-tbl.rb2
-rw-r--r--enc/trans/macroman-tbl.rb2
-rw-r--r--enc/trans/macromania-tbl.rb2
-rw-r--r--enc/trans/macturkish-tbl.rb2
-rw-r--r--enc/trans/macukraine-tbl.rb2
-rw-r--r--enc/trans/newline.trans20
-rw-r--r--enc/trans/single_byte.trans1
-rw-r--r--enc/trans/transdb.c2
-rw-r--r--enc/trans/windows-1250-tbl.rb2
-rw-r--r--enc/trans/windows-1251-tbl.rb2
-rw-r--r--enc/trans/windows-1252-tbl.rb2
-rw-r--r--enc/trans/windows-1253-tbl.rb2
-rw-r--r--enc/trans/windows-1254-tbl.rb2
-rw-r--r--enc/trans/windows-1256-tbl.rb2
-rw-r--r--enc/trans/windows-1257-tbl.rb2
-rw-r--r--enc/trans/windows-874-tbl.rb2
-rw-r--r--enc/unicode.c12
-rw-r--r--enc/unicode/12.1.0/casefold.h7428
-rw-r--r--enc/unicode/12.1.0/name2ctype.h41810
-rw-r--r--enc/unicode/17.0.0/casefold.h8013
-rw-r--r--enc/unicode/17.0.0/name2ctype.h49725
-rw-r--r--enc/unicode/case-folding.rb418
-rw-r--r--enc/us_ascii.c4
-rw-r--r--enc/utf_16_32.h2
-rw-r--r--enc/utf_16be.c4
-rw-r--r--enc/utf_16le.c4
-rw-r--r--enc/utf_32be.c4
-rw-r--r--enc/utf_32le.c4
-rw-r--r--enc/utf_8.c4
-rw-r--r--enc/windows_1250.c6
-rw-r--r--enc/windows_1251.c6
-rw-r--r--enc/windows_1252.c6
-rw-r--r--enc/windows_1253.c6
-rw-r--r--enc/windows_1254.c6
-rw-r--r--enc/windows_1257.c6
-rw-r--r--enc/windows_31j.c4
-rw-r--r--encindex.h6
-rw-r--r--encoding.c1195
-rw-r--r--enum.c3312
-rw-r--r--enumerator.c1840
-rw-r--r--error.c2537
-rw-r--r--eval.c1701
-rw-r--r--eval_error.c577
-rw-r--r--eval_intern.h153
-rw-r--r--eval_jump.c54
-rw-r--r--ext/-test-/RUBY_ALIGNOF/depend8
-rw-r--r--ext/-test-/abi/abi.c11
-rw-r--r--ext/-test-/abi/depend3
-rw-r--r--ext/-test-/abi/extconf.rb4
-rw-r--r--ext/-test-/arith_seq/beg_len_step/beg_len_step.c19
-rw-r--r--ext/-test-/arith_seq/beg_len_step/depend162
-rw-r--r--ext/-test-/arith_seq/beg_len_step/extconf.rb2
-rw-r--r--ext/-test-/arith_seq/extract/depend32
-rw-r--r--ext/-test-/array/concat/depend163
-rw-r--r--ext/-test-/array/concat/extconf.rb2
-rw-r--r--ext/-test-/array/concat/to_ary_concat.c38
-rw-r--r--ext/-test-/array/resize/depend32
-rw-r--r--ext/-test-/array/resize/resize.c6
-rw-r--r--ext/-test-/auto_ext.rb1
-rw-r--r--ext/-test-/bignum/big2str.c12
-rw-r--r--ext/-test-/bignum/depend248
-rw-r--r--ext/-test-/bignum/div.c8
-rw-r--r--ext/-test-/bignum/intpack.c40
-rw-r--r--ext/-test-/bignum/mul.c28
-rw-r--r--ext/-test-/bignum/str2big.c16
-rw-r--r--ext/-test-/box/yay1/extconf.rb1
-rw-r--r--ext/-test-/box/yay1/yay1.c28
-rw-r--r--ext/-test-/box/yay1/yay1.def3
-rw-r--r--ext/-test-/box/yay1/yay1.h4
-rw-r--r--ext/-test-/box/yay2/extconf.rb1
-rw-r--r--ext/-test-/box/yay2/yay2.c28
-rw-r--r--ext/-test-/box/yay2/yay2.def3
-rw-r--r--ext/-test-/box/yay2/yay2.h4
-rw-r--r--ext/-test-/bug-14834/bug-14384.c39
-rw-r--r--ext/-test-/bug-14834/bug-14834.c39
-rw-r--r--ext/-test-/bug-14834/depend322
-rw-r--r--ext/-test-/bug-3571/depend32
-rw-r--r--ext/-test-/bug-5832/depend32
-rw-r--r--ext/-test-/bug_reporter/depend32
-rw-r--r--ext/-test-/class/depend64
-rw-r--r--ext/-test-/class/init.c1
-rw-r--r--ext/-test-/cxxanyargs/cxxanyargs.cpp26
-rw-r--r--ext/-test-/cxxanyargs/depend12
-rw-r--r--ext/-test-/cxxanyargs/extconf.rb4
-rw-r--r--ext/-test-/debug/depend100
-rw-r--r--ext/-test-/debug/inspector.c14
-rw-r--r--ext/-test-/debug/profile_frames.c48
-rw-r--r--ext/-test-/dln/empty/depend160
-rw-r--r--ext/-test-/dln/empty/empty.c2
-rw-r--r--ext/-test-/econv/append.c17
-rw-r--r--ext/-test-/econv/depend336
-rw-r--r--ext/-test-/econv/extconf.rb3
-rw-r--r--ext/-test-/econv/init.c11
-rw-r--r--ext/-test-/ensure_and_callcc/depend163
-rw-r--r--ext/-test-/ensure_and_callcc/ensure_and_callcc.c58
-rw-r--r--ext/-test-/ensure_and_callcc/extconf.rb5
-rw-r--r--ext/-test-/enumerator_kw/depend32
-rw-r--r--ext/-test-/enumerator_kw/enumerator_kw.c3
-rw-r--r--ext/-test-/eval/depend162
-rw-r--r--ext/-test-/eval/eval.c13
-rw-r--r--ext/-test-/eval/extconf.rb2
-rw-r--r--ext/-test-/exception/depend139
-rw-r--r--ext/-test-/fatal/depend355
-rw-r--r--ext/-test-/fatal/extconf.rb3
-rw-r--r--ext/-test-/fatal/init.c10
-rw-r--r--ext/-test-/fatal/invalid.c22
-rw-r--r--ext/-test-/fatal/rb_fatal.c4
-rw-r--r--ext/-test-/file/depend291
-rw-r--r--ext/-test-/file/fs.c16
-rw-r--r--ext/-test-/file/newline_conv.c73
-rw-r--r--ext/-test-/float/depend64
-rw-r--r--ext/-test-/funcall/depend32
-rw-r--r--ext/-test-/funcall/funcall.c12
-rw-r--r--ext/-test-/gvl/call_without_gvl/call_without_gvl.c12
-rw-r--r--ext/-test-/gvl/call_without_gvl/depend32
-rw-r--r--ext/-test-/hash/depend64
-rw-r--r--ext/-test-/integer/core_ext.c16
-rw-r--r--ext/-test-/integer/depend100
-rw-r--r--ext/-test-/integer/my_integer.c6
-rw-r--r--ext/-test-/iseq_load/depend32
-rw-r--r--ext/-test-/iter/depend96
-rw-r--r--ext/-test-/load/dot.dot/depend160
-rw-r--r--ext/-test-/load/dot.dot/dot.dot.c2
-rw-r--r--ext/-test-/load/protect/depend32
-rw-r--r--ext/-test-/load/resolve_symbol_resolver/depend163
-rw-r--r--ext/-test-/load/resolve_symbol_resolver/extconf.rb1
-rw-r--r--ext/-test-/load/resolve_symbol_resolver/resolve_symbol_resolver.c56
-rw-r--r--ext/-test-/load/resolve_symbol_target/depend164
-rw-r--r--ext/-test-/load/resolve_symbol_target/extconf.rb1
-rw-r--r--ext/-test-/load/resolve_symbol_target/resolve_symbol_target.c15
-rw-r--r--ext/-test-/load/resolve_symbol_target/resolve_symbol_target.h4
-rw-r--r--ext/-test-/load/stringify_symbols/depend164
-rw-r--r--ext/-test-/load/stringify_symbols/extconf.rb1
-rw-r--r--ext/-test-/load/stringify_symbols/stringify_symbols.c29
-rw-r--r--ext/-test-/load/stringify_target/depend164
-rw-r--r--ext/-test-/load/stringify_target/extconf.rb1
-rw-r--r--ext/-test-/load/stringify_target/stringify_target.c15
-rw-r--r--ext/-test-/load/stringify_target/stringify_target.h4
-rw-r--r--ext/-test-/marshal/compat/depend32
-rw-r--r--ext/-test-/marshal/internal_ivar/depend32
-rw-r--r--ext/-test-/marshal/internal_ivar/internal_ivar.c20
-rw-r--r--ext/-test-/marshal/usr/depend32
-rw-r--r--ext/-test-/memory_status/depend7
-rw-r--r--ext/-test-/memory_status/memory_status.c31
-rw-r--r--ext/-test-/memory_view/depend8
-rw-r--r--ext/-test-/memory_view/extconf.rb2
-rw-r--r--ext/-test-/memory_view/memory_view.c11
-rw-r--r--ext/-test-/method/depend64
-rw-r--r--ext/-test-/notimplement/depend32
-rw-r--r--ext/-test-/num2int/depend32
-rw-r--r--ext/-test-/num2int/num2int.c26
-rw-r--r--ext/-test-/path_to_class/depend32
-rw-r--r--ext/-test-/popen_deadlock/depend33
-rw-r--r--ext/-test-/postponed_job/depend34
-rw-r--r--ext/-test-/postponed_job/postponed_job.c120
-rw-r--r--ext/-test-/printf/depend43
-rw-r--r--ext/-test-/printf/printf.c64
-rw-r--r--ext/-test-/proc/depend96
-rw-r--r--ext/-test-/proc/super.c2
-rw-r--r--ext/-test-/public_header_warnings/extconf.rb28
-rw-r--r--ext/-test-/random/bad_version.c135
-rw-r--r--ext/-test-/random/depend181
-rw-r--r--ext/-test-/random/loop.c12
-rw-r--r--ext/-test-/rational/depend37
-rw-r--r--ext/-test-/rational/rat.c15
-rw-r--r--ext/-test-/rb_call_super_kw/depend32
-rw-r--r--ext/-test-/rb_call_super_kw/rb_call_super_kw.c3
-rw-r--r--ext/-test-/recursion/depend32
-rw-r--r--ext/-test-/regexp/depend64
-rw-r--r--ext/-test-/sanitizers/depend162
-rw-r--r--ext/-test-/sanitizers/extconf.rb2
-rw-r--r--ext/-test-/sanitizers/sanitizers.c36
-rw-r--r--ext/-test-/scan_args/depend32
-rw-r--r--ext/-test-/scheduler/extconf.rb2
-rw-r--r--ext/-test-/scheduler/scheduler.c92
-rw-r--r--ext/-test-/st/foreach/depend32
-rw-r--r--ext/-test-/st/foreach/foreach.c108
-rw-r--r--ext/-test-/st/numhash/depend32
-rw-r--r--ext/-test-/st/numhash/numhash.c16
-rw-r--r--ext/-test-/st/update/depend32
-rw-r--r--ext/-test-/st/update/update.c12
-rw-r--r--ext/-test-/stack/depend179
-rw-r--r--ext/-test-/stack/extconf.rb3
-rw-r--r--ext/-test-/stack/stack.c35
-rw-r--r--ext/-test-/string/capacity.c9
-rw-r--r--ext/-test-/string/coderange.c8
-rw-r--r--ext/-test-/string/cstr.c23
-rw-r--r--ext/-test-/string/depend552
-rw-r--r--ext/-test-/string/enc_dummy.c15
-rw-r--r--ext/-test-/string/enc_str_buf_cat.c14
-rw-r--r--ext/-test-/string/fstring.c29
-rw-r--r--ext/-test-/string/qsort.c14
-rw-r--r--ext/-test-/string/set_len.c18
-rw-r--r--ext/-test-/struct/data.c13
-rw-r--r--ext/-test-/struct/depend289
-rw-r--r--ext/-test-/struct/member.c2
-rw-r--r--ext/-test-/symbol/depend64
-rw-r--r--ext/-test-/symbol/type.c6
-rw-r--r--ext/-test-/thread/id/depend163
-rw-r--r--ext/-test-/thread/id/extconf.rb3
-rw-r--r--ext/-test-/thread/id/id.c15
-rw-r--r--ext/-test-/thread/instrumentation/depend165
-rw-r--r--ext/-test-/thread/instrumentation/extconf.rb2
-rw-r--r--ext/-test-/thread/instrumentation/instrumentation.c218
-rw-r--r--ext/-test-/thread/lock_native_thread/depend163
-rw-r--r--ext/-test-/thread/lock_native_thread/extconf.rb2
-rw-r--r--ext/-test-/thread/lock_native_thread/lock_native_thread.c50
-rw-r--r--ext/-test-/thread_fd_close/depend162
-rw-r--r--ext/-test-/thread_fd_close/extconf.rb2
-rw-r--r--ext/-test-/thread_fd_close/thread_fd_close.c14
-rw-r--r--ext/-test-/time/depend97
-rw-r--r--ext/-test-/time/leap_second.c14
-rw-r--r--ext/-test-/tracepoint/depend68
-rw-r--r--ext/-test-/tracepoint/gc_hook.c46
-rw-r--r--ext/-test-/tracepoint/tracepoint.c64
-rw-r--r--ext/-test-/typeddata/depend32
-rw-r--r--ext/-test-/typeddata/typeddata.c2
-rw-r--r--ext/-test-/vm/at_exit.c12
-rw-r--r--ext/-test-/vm/depend32
-rw-r--r--ext/-test-/wait/depend175
-rw-r--r--ext/-test-/wait/extconf.rb2
-rw-r--r--ext/-test-/wait/wait.c39
-rw-r--r--ext/-test-/wait_for_single_fd/depend166
-rw-r--r--ext/-test-/wait_for_single_fd/extconf.rb8
-rw-r--r--ext/-test-/wait_for_single_fd/wait_for_single_fd.c94
-rw-r--r--ext/-test-/win32/console/attribute.c26
-rw-r--r--ext/-test-/win32/dln/extconf.rb1
-rw-r--r--ext/-test-/win32/fd_setsize/fd_setsize.c10
-rw-r--r--ext/.document29
-rw-r--r--ext/Setup16
-rw-r--r--ext/Setup.atheos25
-rw-r--r--ext/Setup.nt26
-rw-r--r--ext/bigdecimal/bigdecimal.c6823
-rw-r--r--ext/bigdecimal/bigdecimal.gemspec44
-rw-r--r--ext/bigdecimal/bigdecimal.h300
-rw-r--r--ext/bigdecimal/bits.h141
-rw-r--r--ext/bigdecimal/depend170
-rw-r--r--ext/bigdecimal/extconf.rb93
-rw-r--r--ext/bigdecimal/feature.h68
-rw-r--r--ext/bigdecimal/lib/bigdecimal.rb1
-rw-r--r--ext/bigdecimal/lib/bigdecimal/jacobian.rb90
-rw-r--r--ext/bigdecimal/lib/bigdecimal/ludcmp.rb89
-rw-r--r--ext/bigdecimal/lib/bigdecimal/math.rb232
-rw-r--r--ext/bigdecimal/lib/bigdecimal/newton.rb80
-rw-r--r--ext/bigdecimal/lib/bigdecimal/util.rb181
-rw-r--r--ext/bigdecimal/missing.h232
-rw-r--r--ext/bigdecimal/sample/linear.rb74
-rw-r--r--ext/bigdecimal/sample/nlsolve.rb40
-rw-r--r--ext/bigdecimal/sample/pi.rb21
-rw-r--r--ext/bigdecimal/static_assert.h54
-rw-r--r--ext/cgi/escape/depend43
-rw-r--r--ext/cgi/escape/escape.c410
-rw-r--r--ext/cgi/escape/extconf.rb6
-rw-r--r--ext/continuation/depend32
-rw-r--r--ext/coverage/coverage.c580
-rw-r--r--ext/coverage/depend28
-rw-r--r--ext/coverage/lib/coverage.rb5
-rw-r--r--ext/date/date.gemspec37
-rw-r--r--ext/date/date_core.c2576
-rw-r--r--ext/date/date_parse.c134
-rw-r--r--ext/date/date_strftime.c2
-rw-r--r--ext/date/date_strptime.c117
-rw-r--r--ext/date/depend161
-rw-r--r--ext/date/extconf.rb8
-rw-r--r--ext/date/lib/date.rb7
-rw-r--r--ext/date/prereq.mk9
-rw-r--r--ext/date/zonetab.h1250
-rw-r--r--ext/date/zonetab.list9
-rw-r--r--ext/dbm/dbm.c1156
-rw-r--r--ext/dbm/dbm.gemspec21
-rw-r--r--ext/dbm/depend163
-rw-r--r--ext/dbm/extconf.rb292
-rw-r--r--ext/digest/.document3
-rw-r--r--ext/digest/bubblebabble/bubblebabble.c9
-rw-r--r--ext/digest/bubblebabble/depend32
-rw-r--r--ext/digest/bubblebabble/extconf.rb2
-rw-r--r--ext/digest/defs.h22
-rw-r--r--ext/digest/depend32
-rw-r--r--ext/digest/digest.c56
-rw-r--r--ext/digest/digest.gemspec53
-rw-r--r--ext/digest/digest.h42
-rw-r--r--ext/digest/digest_conf.rb18
-rw-r--r--ext/digest/extconf.rb2
-rw-r--r--ext/digest/lib/digest.rb18
-rw-r--r--ext/digest/lib/digest/loader.rb3
-rw-r--r--ext/digest/lib/digest/version.rb6
-rw-r--r--ext/digest/md5/depend17
-rw-r--r--ext/digest/md5/extconf.rb2
-rw-r--r--ext/digest/md5/md5.c2
-rw-r--r--ext/digest/md5/md5cc.h12
-rw-r--r--ext/digest/md5/md5init.c4
-rw-r--r--ext/digest/rmd160/depend16
-rw-r--r--ext/digest/rmd160/extconf.rb4
-rw-r--r--ext/digest/rmd160/rmd160init.c3
-rw-r--r--ext/digest/sha1/depend17
-rw-r--r--ext/digest/sha1/extconf.rb2
-rw-r--r--ext/digest/sha1/sha1.c14
-rw-r--r--ext/digest/sha1/sha1cc.h8
-rw-r--r--ext/digest/sha1/sha1init.c3
-rw-r--r--ext/digest/sha2/depend17
-rw-r--r--ext/digest/sha2/extconf.rb2
-rw-r--r--ext/digest/sha2/lib/sha2.rb2
-rw-r--r--ext/digest/sha2/lib/sha2/loader.rb3
-rw-r--r--ext/digest/sha2/sha2.c16
-rw-r--r--ext/digest/sha2/sha2cc.h39
-rw-r--r--ext/digest/sha2/sha2init.c47
-rw-r--r--ext/digest/test.sh30
-rw-r--r--ext/erb/escape/escape.c114
-rw-r--r--ext/erb/escape/extconf.rb9
-rw-r--r--ext/etc/.document2
-rw-r--r--ext/etc/depend17
-rw-r--r--ext/etc/etc.c324
-rw-r--r--ext/etc/etc.gemspec16
-rw-r--r--ext/etc/extconf.rb64
-rw-r--r--ext/etc/mkconstants.rb32
-rwxr-xr-xext/extmk.rb212
-rw-r--r--ext/fcntl/depend32
-rw-r--r--ext/fcntl/fcntl.c155
-rw-r--r--ext/fcntl/fcntl.gemspec15
-rw-r--r--ext/fiber/depend3
-rw-r--r--ext/fiber/extconf.rb4
-rw-r--r--ext/fiber/fiber.c8
-rw-r--r--ext/fiddle/closure.c346
-rw-r--r--ext/fiddle/closure.h8
-rw-r--r--ext/fiddle/conversions.c330
-rw-r--r--ext/fiddle/conversions.h54
-rw-r--r--ext/fiddle/depend1383
-rw-r--r--ext/fiddle/extconf.rb225
-rw-r--r--ext/fiddle/extlibs13
-rw-r--r--ext/fiddle/fiddle.c553
-rw-r--r--ext/fiddle/fiddle.gemspec66
-rw-r--r--ext/fiddle/fiddle.h202
-rw-r--r--ext/fiddle/function.c483
-rw-r--r--ext/fiddle/function.h8
-rw-r--r--ext/fiddle/handle.c477
-rw-r--r--ext/fiddle/lib/fiddle.rb58
-rw-r--r--ext/fiddle/lib/fiddle/closure.rb49
-rw-r--r--ext/fiddle/lib/fiddle/cparser.rb262
-rw-r--r--ext/fiddle/lib/fiddle/function.rb23
-rw-r--r--ext/fiddle/lib/fiddle/import.rb320
-rw-r--r--ext/fiddle/lib/fiddle/pack.rb136
-rw-r--r--ext/fiddle/lib/fiddle/struct.rb468
-rw-r--r--ext/fiddle/lib/fiddle/types.rb72
-rw-r--r--ext/fiddle/lib/fiddle/value.rb122
-rw-r--r--ext/fiddle/lib/fiddle/version.rb3
-rw-r--r--ext/fiddle/memory_view.c254
-rw-r--r--ext/fiddle/pinned.c123
-rw-r--r--ext/fiddle/pointer.c844
-rw-r--r--ext/fiddle/win32/fficonfig.h29
-rw-r--r--ext/fiddle/win32/libffi-3.2.1-mswin.patch191
-rwxr-xr-xext/fiddle/win32/libffi-config.rb48
-rw-r--r--ext/fiddle/win32/libffi.mk.tmpl96
-rw-r--r--ext/gdbm/README1
-rw-r--r--ext/gdbm/depend163
-rw-r--r--ext/gdbm/extconf.rb19
-rw-r--r--ext/gdbm/gdbm.c1306
-rw-r--r--ext/gdbm/gdbm.gemspec21
-rw-r--r--ext/io/console/.document2
-rw-r--r--ext/io/console/console.c1071
-rw-r--r--ext/io/console/depend47
-rw-r--r--ext/io/console/extconf.rb31
-rw-r--r--ext/io/console/io-console.gemspec34
-rw-r--r--ext/io/console/win32_vk.inc325
-rw-r--r--ext/io/console/win32_vk.list2
-rw-r--r--ext/io/nonblock/depend43
-rw-r--r--ext/io/nonblock/extconf.rb7
-rw-r--r--ext/io/nonblock/io-nonblock.gemspec18
-rw-r--r--ext/io/nonblock/nonblock.c136
-rw-r--r--ext/io/wait/depend43
-rw-r--r--ext/io/wait/extconf.rb17
-rw-r--r--ext/io/wait/io-wait.gemspec36
-rw-r--r--ext/io/wait/wait.c267
-rw-r--r--ext/json/VERSION1
-rw-r--r--ext/json/fbuffer/fbuffer.h303
-rw-r--r--ext/json/generator/depend50
-rw-r--r--ext/json/generator/extconf.rb19
-rw-r--r--ext/json/generator/generator.c2545
-rw-r--r--ext/json/generator/generator.h174
-rw-r--r--ext/json/json.gemspec105
-rw-r--r--ext/json/json.h134
-rw-r--r--ext/json/lib/json.rb140
-rw-r--r--ext/json/lib/json/add/bigdecimal.rb49
-rw-r--r--ext/json/lib/json/add/complex.rb35
-rw-r--r--ext/json/lib/json/add/core.rb3
-rw-r--r--ext/json/lib/json/add/date.rb34
-rw-r--r--ext/json/lib/json/add/date_time.rb35
-rw-r--r--ext/json/lib/json/add/exception.rb32
-rw-r--r--ext/json/lib/json/add/ostruct.rb41
-rw-r--r--ext/json/lib/json/add/range.rb41
-rw-r--r--ext/json/lib/json/add/rational.rb34
-rw-r--r--ext/json/lib/json/add/regexp.rb34
-rw-r--r--ext/json/lib/json/add/set.rb31
-rw-r--r--ext/json/lib/json/add/string.rb35
-rw-r--r--ext/json/lib/json/add/struct.rb36
-rw-r--r--ext/json/lib/json/add/symbol.rb41
-rw-r--r--ext/json/lib/json/add/time.rb44
-rw-r--r--ext/json/lib/json/common.rb1004
-rw-r--r--ext/json/lib/json/ext.rb40
-rw-r--r--ext/json/lib/json/ext/generator/state.rb103
-rw-r--r--ext/json/lib/json/generic_object.rb18
-rw-r--r--ext/json/lib/json/version.rb10
-rw-r--r--ext/json/parser/depend50
-rw-r--r--ext/json/parser/extconf.rb36
-rw-r--r--ext/json/parser/parser.c3574
-rw-r--r--ext/json/parser/parser.h92
-rw-r--r--ext/json/parser/parser.rl939
-rw-r--r--ext/json/parser/prereq.mk12
-rw-r--r--ext/json/simd/conf.rb24
-rw-r--r--ext/json/simd/simd.h208
-rw-r--r--ext/json/vendor/fpconv.c480
-rw-r--r--ext/json/vendor/jeaiii-ltoa.h267
-rw-r--r--ext/json/vendor/ryu.h819
-rw-r--r--ext/monitor/depend162
-rw-r--r--ext/monitor/extconf.rb2
-rw-r--r--ext/monitor/lib/monitor.rb284
-rw-r--r--ext/monitor/monitor.c225
-rw-r--r--ext/nkf/depend174
-rw-r--r--ext/nkf/extconf.rb3
-rw-r--r--ext/nkf/lib/kconv.rb283
-rw-r--r--ext/nkf/nkf-utf8/config.h51
-rw-r--r--ext/nkf/nkf-utf8/nkf.c7205
-rw-r--r--ext/nkf/nkf-utf8/nkf.h189
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.c14638
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.h72
-rw-r--r--ext/nkf/nkf.c503
-rw-r--r--ext/nkf/nkf.gemspec24
-rw-r--r--ext/objspace/depend131
-rw-r--r--ext/objspace/lib/objspace.rb94
-rw-r--r--ext/objspace/lib/objspace/trace.rb45
-rw-r--r--ext/objspace/object_tracing.c215
-rw-r--r--ext/objspace/objspace.c661
-rw-r--r--ext/objspace/objspace_dump.c489
-rw-r--r--ext/openssl/History.md593
-rw-r--r--ext/openssl/depend837
-rw-r--r--ext/openssl/extconf.rb198
-rw-r--r--ext/openssl/lib/openssl.rb17
-rw-r--r--ext/openssl/lib/openssl/bn.rb2
-rw-r--r--ext/openssl/lib/openssl/buffering.rb95
-rw-r--r--ext/openssl/lib/openssl/cipher.rb2
-rw-r--r--ext/openssl/lib/openssl/config.rb501
-rw-r--r--ext/openssl/lib/openssl/digest.rb34
-rw-r--r--ext/openssl/lib/openssl/hmac.rb65
-rw-r--r--ext/openssl/lib/openssl/marshal.rb2
-rw-r--r--ext/openssl/lib/openssl/pkey.rb451
-rw-r--r--ext/openssl/lib/openssl/ssl.rb174
-rw-r--r--ext/openssl/lib/openssl/version.rb3
-rw-r--r--ext/openssl/lib/openssl/x509.rb43
-rw-r--r--ext/openssl/openssl.gemspec28
-rw-r--r--ext/openssl/openssl_missing.c106
-rw-r--r--ext/openssl/openssl_missing.h276
-rw-r--r--ext/openssl/ossl.c920
-rw-r--r--ext/openssl/ossl.h86
-rw-r--r--ext/openssl/ossl_asn1.c982
-rw-r--r--ext/openssl/ossl_asn1.h36
-rw-r--r--ext/openssl/ossl_bio.c14
-rw-r--r--ext/openssl/ossl_bio.h2
-rw-r--r--ext/openssl/ossl_bn.c905
-rw-r--r--ext/openssl/ossl_bn.h3
-rw-r--r--ext/openssl/ossl_cipher.c546
-rw-r--r--ext/openssl/ossl_cipher.h16
-rw-r--r--ext/openssl/ossl_config.c459
-rw-r--r--ext/openssl/ossl_config.h13
-rw-r--r--ext/openssl/ossl_digest.c198
-rw-r--r--ext/openssl/ossl_digest.h15
-rw-r--r--ext/openssl/ossl_engine.c153
-rw-r--r--ext/openssl/ossl_engine.h5
-rw-r--r--ext/openssl/ossl_hmac.c237
-rw-r--r--ext/openssl/ossl_hmac.h5
-rw-r--r--ext/openssl/ossl_kdf.c225
-rw-r--r--ext/openssl/ossl_ns_spki.c86
-rw-r--r--ext/openssl/ossl_ns_spki.h6
-rw-r--r--ext/openssl/ossl_ocsp.c538
-rw-r--r--ext/openssl/ossl_ocsp.h9
-rw-r--r--ext/openssl/ossl_pkcs12.c132
-rw-r--r--ext/openssl/ossl_pkcs12.h5
-rw-r--r--ext/openssl/ossl_pkcs7.c518
-rw-r--r--ext/openssl/ossl_pkcs7.h24
-rw-r--r--ext/openssl/ossl_pkey.c1621
-rw-r--r--ext/openssl/ossl_pkey.h305
-rw-r--r--ext/openssl/ossl_pkey_dh.c582
-rw-r--r--ext/openssl/ossl_pkey_dsa.c611
-rw-r--r--ext/openssl/ossl_pkey_ec.c934
-rw-r--r--ext/openssl/ossl_pkey_rsa.c801
-rw-r--r--ext/openssl/ossl_provider.c204
-rw-r--r--ext/openssl/ossl_provider.h5
-rw-r--r--ext/openssl/ossl_rand.c27
-rw-r--r--ext/openssl/ossl_rand.h5
-rw-r--r--ext/openssl/ossl_ssl.c1886
-rw-r--r--ext/openssl/ossl_ssl.h18
-rw-r--r--ext/openssl/ossl_ssl_session.c249
-rw-r--r--ext/openssl/ossl_ts.c394
-rw-r--r--ext/openssl/ossl_ts.h2
-rw-r--r--ext/openssl/ossl_x509.c45
-rw-r--r--ext/openssl/ossl_x509.h33
-rw-r--r--ext/openssl/ossl_x509attr.c156
-rw-r--r--ext/openssl/ossl_x509cert.c384
-rw-r--r--ext/openssl/ossl_x509crl.c196
-rw-r--r--ext/openssl/ossl_x509ext.c145
-rw-r--r--ext/openssl/ossl_x509name.c181
-rw-r--r--ext/openssl/ossl_x509req.c146
-rw-r--r--ext/openssl/ossl_x509revoked.c83
-rw-r--r--ext/openssl/ossl_x509store.c411
-rw-r--r--ext/openssl/ruby_missing.h24
-rw-r--r--ext/pathname/depend166
-rw-r--r--ext/pathname/extconf.rb4
-rw-r--r--ext/pathname/lib/pathname.rb599
-rw-r--r--ext/pathname/pathname.c1683
-rw-r--r--ext/pathname/pathname.gemspec25
-rw-r--r--ext/psych/.gitignore1
-rw-r--r--ext/psych/depend229
-rw-r--r--ext/psych/extconf.rb73
-rw-r--r--ext/psych/lib/psych.rb343
-rw-r--r--ext/psych/lib/psych/class_loader.rb11
-rw-r--r--ext/psych/lib/psych/core_ext.rb21
-rw-r--r--ext/psych/lib/psych/exception.rb18
-rw-r--r--ext/psych/lib/psych/handler.rb2
-rw-r--r--ext/psych/lib/psych/handlers/document_stream.rb2
-rw-r--r--ext/psych/lib/psych/handlers/recorder.rb2
-rw-r--r--ext/psych/lib/psych/json/stream.rb4
-rw-r--r--ext/psych/lib/psych/json/tree_builder.rb2
-rw-r--r--ext/psych/lib/psych/nodes.rb14
-rw-r--r--ext/psych/lib/psych/nodes/node.rb11
-rw-r--r--ext/psych/lib/psych/nodes/scalar.rb2
-rw-r--r--ext/psych/lib/psych/parser.rb13
-rw-r--r--ext/psych/lib/psych/scalar_scanner.rb46
-rw-r--r--ext/psych/lib/psych/syntax_error.rb2
-rw-r--r--ext/psych/lib/psych/tree_builder.rb6
-rw-r--r--ext/psych/lib/psych/versions.rb6
-rw-r--r--ext/psych/lib/psych/visitors.rb12
-rw-r--r--ext/psych/lib/psych/visitors/json_tree.rb2
-rw-r--r--ext/psych/lib/psych/visitors/to_ruby.rb87
-rw-r--r--ext/psych/lib/psych/visitors/visitor.rb2
-rw-r--r--ext/psych/lib/psych/visitors/yaml_tree.rb147
-rw-r--r--ext/psych/psych.c3
-rw-r--r--ext/psych/psych.gemspec57
-rw-r--r--ext/psych/psych_emitter.c276
-rw-r--r--ext/psych/psych_parser.c560
-rw-r--r--ext/psych/psych_to_ruby.c5
-rw-r--r--ext/psych/psych_yaml_tree.c1
-rw-r--r--ext/psych/yaml/api.c1393
-rw-r--r--ext/psych/yaml/config.h80
-rw-r--r--ext/psych/yaml/dumper.c394
-rw-r--r--ext/psych/yaml/emitter.c2358
-rw-r--r--ext/psych/yaml/loader.c544
-rw-r--r--ext/psych/yaml/parser.c1375
-rw-r--r--ext/psych/yaml/reader.c469
-rw-r--r--ext/psych/yaml/scanner.c3598
-rw-r--r--ext/psych/yaml/writer.c141
-rw-r--r--ext/psych/yaml/yaml.h1985
-rw-r--r--ext/psych/yaml/yaml_private.h688
-rw-r--r--ext/pty/depend47
-rw-r--r--ext/pty/extconf.rb15
-rw-r--r--ext/pty/lib/expect.rb16
-rw-r--r--ext/pty/pty.c393
-rw-r--r--ext/racc/cparse/README11
-rw-r--r--ext/racc/cparse/cparse.c863
-rw-r--r--ext/racc/cparse/depend163
-rw-r--r--ext/racc/cparse/extconf.rb8
-rw-r--r--ext/rbconfig/sizeof/depend64
-rw-r--r--ext/readline/.gitignore1
-rw-r--r--ext/readline/README10
-rw-r--r--ext/readline/README.ja386
-rw-r--r--ext/readline/depend167
-rw-r--r--ext/readline/depend-gem4
-rw-r--r--ext/readline/extconf.rb112
-rw-r--r--ext/readline/readline-ext.gemspec26
-rw-r--r--ext/readline/readline.c2141
-rw-r--r--ext/ripper/README1
-rw-r--r--ext/ripper/depend610
-rw-r--r--ext/ripper/eventids2.c32
-rw-r--r--ext/ripper/eventids2.h8
-rw-r--r--ext/ripper/extconf.rb16
-rw-r--r--ext/ripper/lib/ripper/lexer.rb96
-rw-r--r--ext/ripper/ripper_init.c.tmpl680
-rw-r--r--ext/ripper/ripper_init.h6
-rw-r--r--ext/ripper/tools/dsl.rb173
-rw-r--r--ext/ripper/tools/generate.rb51
-rw-r--r--ext/ripper/tools/preproc.rb115
-rw-r--r--ext/socket/addrinfo.h36
-rw-r--r--ext/socket/ancdata.c282
-rw-r--r--ext/socket/basicsocket.c155
-rw-r--r--ext/socket/constants.c6
-rw-r--r--ext/socket/depend1050
-rw-r--r--ext/socket/extconf.rb56
-rw-r--r--ext/socket/getaddrinfo.c898
-rw-r--r--ext/socket/getnameinfo.c224
-rw-r--r--ext/socket/ifaddr.c11
-rw-r--r--ext/socket/init.c375
-rw-r--r--ext/socket/ipsocket.c1479
-rw-r--r--ext/socket/lib/socket.rb535
-rw-r--r--ext/socket/mkconstants.rb86
-rw-r--r--ext/socket/option.c98
-rw-r--r--ext/socket/raddrinfo.c1140
-rw-r--r--ext/socket/rubysocket.h117
-rw-r--r--ext/socket/socket.c619
-rw-r--r--ext/socket/sockssocket.c9
-rw-r--r--ext/socket/tcpserver.c26
-rw-r--r--ext/socket/tcpsocket.c59
-rw-r--r--ext/socket/udpsocket.c102
-rw-r--r--ext/socket/unixserver.c31
-rw-r--r--ext/socket/unixsocket.c175
-rw-r--r--ext/stringio/.document1
-rw-r--r--ext/stringio/depend44
-rw-r--r--ext/stringio/extconf.rb9
-rw-r--r--ext/stringio/stringio.c948
-rw-r--r--ext/stringio/stringio.gemspec34
-rw-r--r--ext/strscan/depend43
-rw-r--r--ext/strscan/extconf.rb15
-rw-r--r--ext/strscan/lib/strscan.rb20
-rw-r--r--ext/strscan/lib/strscan/strscan.rb55
-rw-r--r--ext/strscan/strscan.c1956
-rw-r--r--ext/strscan/strscan.gemspec35
-rw-r--r--ext/syslog/depend163
-rw-r--r--ext/syslog/extconf.rb13
-rw-r--r--ext/syslog/lib/syslog/logger.rb209
-rw-r--r--ext/syslog/syslog.c588
-rw-r--r--ext/syslog/syslog.gemspec23
-rw-r--r--ext/syslog/syslog.txt124
-rw-r--r--ext/win32/lib/win32/registry.rb913
-rw-r--r--ext/win32/lib/win32/resolv.rb116
-rw-r--r--ext/win32/lib/win32/sspi.rb338
-rw-r--r--ext/win32/resolv/extconf.rb6
-rw-r--r--ext/win32/resolv/resolv.c228
-rw-r--r--ext/win32ole/depend12
-rw-r--r--ext/win32ole/extconf.rb45
-rw-r--r--ext/win32ole/lib/win32ole.rb33
-rw-r--r--ext/win32ole/lib/win32ole/property.rb17
-rw-r--r--ext/win32ole/sample/excel1.rb37
-rw-r--r--ext/win32ole/sample/excel2.rb31
-rw-r--r--ext/win32ole/sample/excel3.rb21
-rw-r--r--ext/win32ole/sample/ie.rb12
-rw-r--r--ext/win32ole/sample/ieconst.rb33
-rw-r--r--ext/win32ole/sample/ienavi.rb41
-rw-r--r--ext/win32ole/sample/ienavi2.rb41
-rw-r--r--ext/win32ole/sample/oledirs.rb24
-rw-r--r--ext/win32ole/sample/olegen.rb348
-rw-r--r--ext/win32ole/sample/xml.rb7307
-rw-r--r--ext/win32ole/win32ole.c4142
-rw-r--r--ext/win32ole/win32ole.gemspec21
-rw-r--r--ext/win32ole/win32ole.h155
-rw-r--r--ext/win32ole/win32ole_error.c87
-rw-r--r--ext/win32ole/win32ole_error.h9
-rw-r--r--ext/win32ole/win32ole_event.c1277
-rw-r--r--ext/win32ole/win32ole_event.h6
-rw-r--r--ext/win32ole/win32ole_method.c952
-rw-r--r--ext/win32ole/win32ole_method.h16
-rw-r--r--ext/win32ole/win32ole_param.c438
-rw-r--r--ext/win32ole/win32ole_param.h8
-rw-r--r--ext/win32ole/win32ole_record.c606
-rw-r--r--ext/win32ole/win32ole_record.h10
-rw-r--r--ext/win32ole/win32ole_type.c917
-rw-r--r--ext/win32ole/win32ole_type.h8
-rw-r--r--ext/win32ole/win32ole_typelib.c846
-rw-r--r--ext/win32ole/win32ole_typelib.h11
-rw-r--r--ext/win32ole/win32ole_variable.c382
-rw-r--r--ext/win32ole/win32ole_variable.h8
-rw-r--r--ext/win32ole/win32ole_variant.c735
-rw-r--r--ext/win32ole/win32ole_variant.h9
-rw-r--r--ext/win32ole/win32ole_variant_m.c151
-rw-r--r--ext/win32ole/win32ole_variant_m.h7
-rw-r--r--ext/zlib/depend43
-rw-r--r--ext/zlib/extconf.rb20
-rw-r--r--ext/zlib/extlibs8
-rw-r--r--ext/zlib/win32/zlib-1.2.11-mswin.patch95
-rw-r--r--ext/zlib/zlib.c621
-rw-r--r--ext/zlib/zlib.gemspec10
-rw-r--r--file.c5569
-rw-r--r--gc.c14267
-rw-r--r--gc.h140
-rw-r--r--gc.rb699
-rw-r--r--gc/README.md37
-rw-r--r--gc/default/default.c9888
-rw-r--r--gc/default/extconf.rb5
-rw-r--r--gc/extconf_base.rb14
-rw-r--r--gc/gc.h293
-rw-r--r--gc/gc_impl.h127
-rw-r--r--gc/mmtk/.gitignore1
-rw-r--r--gc/mmtk/Cargo.lock1108
-rw-r--r--gc/mmtk/Cargo.toml42
-rw-r--r--gc/mmtk/cbindgen.toml36
-rw-r--r--gc/mmtk/depend18
-rw-r--r--gc/mmtk/extconf.rb24
-rw-r--r--gc/mmtk/mmtk.c1658
-rw-r--r--gc/mmtk/mmtk.h175
-rw-r--r--gc/mmtk/src/abi.rs335
-rw-r--r--gc/mmtk/src/active_plan.rs56
-rw-r--r--gc/mmtk/src/api.rs551
-rw-r--r--gc/mmtk/src/binding.rs129
-rw-r--r--gc/mmtk/src/collection.rs122
-rw-r--r--gc/mmtk/src/heap/cpu_heap_trigger.rs370
-rw-r--r--gc/mmtk/src/heap/mod.rs9
-rw-r--r--gc/mmtk/src/heap/ruby_heap_trigger.rs105
-rw-r--r--gc/mmtk/src/lib.rs161
-rw-r--r--gc/mmtk/src/object_model.rs124
-rw-r--r--gc/mmtk/src/pinning_registry.rs187
-rw-r--r--gc/mmtk/src/reference_glue.rs26
-rw-r--r--gc/mmtk/src/scanning.rs291
-rw-r--r--gc/mmtk/src/utils.rs161
-rw-r--r--gc/mmtk/src/weak_proc.rs328
-rw-r--r--gc/wbcheck/extconf.rb3
-rw-r--r--gc/wbcheck/wbcheck.c1936
-rw-r--r--gem_prelude.rb18
-rw-r--r--gems/bundled_gems56
-rw-r--r--gems/lib/core_assertions.rb1
-rw-r--r--gems/lib/envutil.rb1
-rw-r--r--gems/lib/rake/extensiontask.rb14
-rw-r--r--goruby.c44
-rw-r--r--hash.c4732
-rw-r--r--hash.rb40
-rw-r--r--hrtime.h73
-rw-r--r--id_table.c371
-rw-r--r--id_table.h43
-rw-r--r--imemo.c744
-rw-r--r--include/ruby.h2
-rw-r--r--include/ruby/assert.h118
-rw-r--r--include/ruby/atomic.h1245
-rw-r--r--include/ruby/backward.h55
-rw-r--r--include/ruby/backward/2/assume.h27
-rw-r--r--include/ruby/backward/2/attributes.h31
-rw-r--r--include/ruby/backward/2/bool.h5
-rw-r--r--include/ruby/backward/2/gcc_version_since.h5
-rw-r--r--include/ruby/backward/2/inttypes.h3
-rw-r--r--include/ruby/backward/2/limits.h5
-rw-r--r--include/ruby/backward/2/long_long.h12
-rw-r--r--include/ruby/backward/2/r_cast.h5
-rw-r--r--include/ruby/backward/2/rmodule.h5
-rw-r--r--include/ruby/backward/2/stdalign.h6
-rw-r--r--include/ruby/backward/2/stdarg.h26
-rw-r--r--include/ruby/backward/cxxanyargs.hpp102
-rw-r--r--include/ruby/debug.h702
-rw-r--r--include/ruby/defines.h11
-rw-r--r--include/ruby/encoding.h412
-rw-r--r--include/ruby/fiber/scheduler.h505
-rw-r--r--include/ruby/intern.h2
-rw-r--r--include/ruby/internal/abi.h58
-rw-r--r--include/ruby/internal/anyargs.h45
-rw-r--r--include/ruby/internal/arithmetic.h5
-rw-r--r--include/ruby/internal/arithmetic/char.h31
-rw-r--r--include/ruby/internal/arithmetic/double.h49
-rw-r--r--include/ruby/internal/arithmetic/fixnum.h32
-rw-r--r--include/ruby/internal/arithmetic/gid_t.h9
-rw-r--r--include/ruby/internal/arithmetic/int.h131
-rw-r--r--include/ruby/internal/arithmetic/intptr_t.h50
-rw-r--r--include/ruby/internal/arithmetic/long.h174
-rw-r--r--include/ruby/internal/arithmetic/long_long.h108
-rw-r--r--include/ruby/internal/arithmetic/mode_t.h9
-rw-r--r--include/ruby/internal/arithmetic/off_t.h15
-rw-r--r--include/ruby/internal/arithmetic/pid_t.h9
-rw-r--r--include/ruby/internal/arithmetic/short.h85
-rw-r--r--include/ruby/internal/arithmetic/size_t.h24
-rw-r--r--include/ruby/internal/arithmetic/st_data_t.h28
-rw-r--r--include/ruby/internal/arithmetic/uid_t.h9
-rw-r--r--include/ruby/internal/assume.h7
-rw-r--r--include/ruby/internal/attr/alloc_size.h2
-rw-r--r--include/ruby/internal/attr/artificial.h2
-rw-r--r--include/ruby/internal/attr/cold.h4
-rw-r--r--include/ruby/internal/attr/const.h6
-rw-r--r--include/ruby/internal/attr/constexpr.h7
-rw-r--r--include/ruby/internal/attr/deprecated.h27
-rw-r--r--include/ruby/internal/attr/diagnose_if.h2
-rw-r--r--include/ruby/internal/attr/enum_extensibility.h2
-rw-r--r--include/ruby/internal/attr/error.h2
-rw-r--r--include/ruby/internal/attr/flag_enum.h2
-rw-r--r--include/ruby/internal/attr/forceinline.h4
-rw-r--r--include/ruby/internal/attr/format.h6
-rw-r--r--include/ruby/internal/attr/maybe_unused.h2
-rw-r--r--include/ruby/internal/attr/noalias.h15
-rw-r--r--include/ruby/internal/attr/nodiscard.h4
-rw-r--r--include/ruby/internal/attr/noexcept.h6
-rw-r--r--include/ruby/internal/attr/noinline.h2
-rw-r--r--include/ruby/internal/attr/nonnull.h4
-rw-r--r--include/ruby/internal/attr/nonstring.h40
-rw-r--r--include/ruby/internal/attr/noreturn.h2
-rw-r--r--include/ruby/internal/attr/packed_struct.h43
-rw-r--r--include/ruby/internal/attr/pure.h4
-rw-r--r--include/ruby/internal/attr/restrict.h7
-rw-r--r--include/ruby/internal/attr/returns_nonnull.h2
-rw-r--r--include/ruby/internal/attr/warning.h2
-rw-r--r--include/ruby/internal/attr/weakref.h2
-rw-r--r--include/ruby/internal/cast.h5
-rw-r--r--include/ruby/internal/compiler_is.h2
-rw-r--r--include/ruby/internal/compiler_is/apple.h5
-rw-r--r--include/ruby/internal/compiler_is/clang.h5
-rw-r--r--include/ruby/internal/compiler_is/gcc.h5
-rw-r--r--include/ruby/internal/compiler_is/intel.h5
-rw-r--r--include/ruby/internal/compiler_is/msvc.h18
-rw-r--r--include/ruby/internal/compiler_is/sunpro.h5
-rw-r--r--include/ruby/internal/compiler_since.h6
-rw-r--r--include/ruby/internal/config.h13
-rw-r--r--include/ruby/internal/constant_p.h3
-rw-r--r--include/ruby/internal/core.h4
-rw-r--r--include/ruby/internal/core/rarray.h345
-rw-r--r--include/ruby/internal/core/rbasic.h103
-rw-r--r--include/ruby/internal/core/rbignum.h39
-rw-r--r--include/ruby/internal/core/rclass.h62
-rw-r--r--include/ruby/internal/core/rdata.h162
-rw-r--r--include/ruby/internal/core/rfile.h21
-rw-r--r--include/ruby/internal/core/rhash.h101
-rw-r--r--include/ruby/internal/core/rmatch.h120
-rw-r--r--include/ruby/internal/core/robject.h115
-rw-r--r--include/ruby/internal/core/rregexp.h88
-rw-r--r--include/ruby/internal/core/rstring.h422
-rw-r--r--include/ruby/internal/core/rstruct.h48
-rw-r--r--include/ruby/internal/core/rtypeddata.h670
-rw-r--r--include/ruby/internal/ctype.h382
-rw-r--r--include/ruby/internal/dllexport.h46
-rw-r--r--include/ruby/internal/dosish.h28
-rw-r--r--include/ruby/internal/encoding/coderange.h202
-rw-r--r--include/ruby/internal/encoding/ctype.h258
-rw-r--r--include/ruby/internal/encoding/encoding.h1044
-rw-r--r--include/ruby/internal/encoding/pathname.h184
-rw-r--r--include/ruby/internal/encoding/re.h46
-rw-r--r--include/ruby/internal/encoding/sprintf.h78
-rw-r--r--include/ruby/internal/encoding/string.h375
-rw-r--r--include/ruby/internal/encoding/symbol.h100
-rw-r--r--include/ruby/internal/encoding/transcode.h562
-rw-r--r--include/ruby/internal/error.h591
-rw-r--r--include/ruby/internal/eval.h387
-rw-r--r--include/ruby/internal/event.h162
-rw-r--r--include/ruby/internal/fl_type.h671
-rw-r--r--include/ruby/internal/gc.h631
-rw-r--r--include/ruby/internal/glob.h88
-rw-r--r--include/ruby/internal/globals.h228
-rw-r--r--include/ruby/internal/has/attribute.h9
-rw-r--r--include/ruby/internal/has/builtin.h34
-rw-r--r--include/ruby/internal/has/c_attribute.h14
-rw-r--r--include/ruby/internal/has/cpp_attribute.h9
-rw-r--r--include/ruby/internal/has/declspec_attribute.h5
-rw-r--r--include/ruby/internal/has/extension.h2
-rw-r--r--include/ruby/internal/has/feature.h2
-rw-r--r--include/ruby/internal/has/warning.h2
-rw-r--r--include/ruby/internal/intern/array.h665
-rw-r--r--include/ruby/internal/intern/bignum.h860
-rw-r--r--include/ruby/internal/intern/class.h385
-rw-r--r--include/ruby/internal/intern/compar.h34
-rw-r--r--include/ruby/internal/intern/complex.h199
-rw-r--r--include/ruby/internal/intern/cont.h258
-rw-r--r--include/ruby/internal/intern/dir.h11
-rw-r--r--include/ruby/internal/intern/enum.h44
-rw-r--r--include/ruby/internal/intern/enumerator.h205
-rw-r--r--include/ruby/internal/intern/error.h265
-rw-r--r--include/ruby/internal/intern/eval.h183
-rw-r--r--include/ruby/internal/intern/file.h194
-rw-r--r--include/ruby/internal/intern/gc.h57
-rw-r--r--include/ruby/internal/intern/hash.h291
-rw-r--r--include/ruby/internal/intern/io.h635
-rw-r--r--include/ruby/internal/intern/load.h231
-rw-r--r--include/ruby/internal/intern/marshal.h83
-rw-r--r--include/ruby/internal/intern/numeric.h188
-rw-r--r--include/ruby/internal/intern/object.h499
-rw-r--r--include/ruby/internal/intern/parse.h156
-rw-r--r--include/ruby/internal/intern/proc.h340
-rw-r--r--include/ruby/internal/intern/process.h248
-rw-r--r--include/ruby/internal/intern/random.h75
-rw-r--r--include/ruby/internal/intern/range.h60
-rw-r--r--include/ruby/internal/intern/rational.h138
-rw-r--r--include/ruby/internal/intern/re.h222
-rw-r--r--include/ruby/internal/intern/ruby.h46
-rw-r--r--include/ruby/internal/intern/select.h40
-rw-r--r--include/ruby/internal/intern/select/largesize.h141
-rw-r--r--include/ruby/internal/intern/select/posix.h70
-rw-r--r--include/ruby/internal/intern/select/win32.h155
-rw-r--r--include/ruby/internal/intern/set.h111
-rw-r--r--include/ruby/internal/intern/signal.h123
-rw-r--r--include/ruby/internal/intern/sprintf.h132
-rw-r--r--include/ruby/internal/intern/string.h1658
-rw-r--r--include/ruby/internal/intern/struct.h206
-rw-r--r--include/ruby/internal/intern/thread.h452
-rw-r--r--include/ruby/internal/intern/time.h122
-rw-r--r--include/ruby/internal/intern/variable.h630
-rw-r--r--include/ruby/internal/intern/vm.h406
-rw-r--r--include/ruby/internal/interpreter.h235
-rw-r--r--include/ruby/internal/iterator.h439
-rw-r--r--include/ruby/internal/memory.h573
-rw-r--r--include/ruby/internal/method.h180
-rw-r--r--include/ruby/internal/module.h154
-rw-r--r--include/ruby/internal/newobj.h109
-rw-r--r--include/ruby/internal/rgengc.h199
-rw-r--r--include/ruby/internal/scan_args.h159
-rw-r--r--include/ruby/internal/special_consts.h232
-rw-r--r--include/ruby/internal/static_assert.h7
-rw-r--r--include/ruby/internal/stdalign.h10
-rw-r--r--include/ruby/internal/stdbool.h18
-rw-r--r--include/ruby/internal/stdckdint.h68
-rw-r--r--include/ruby/internal/symbol.h269
-rw-r--r--include/ruby/internal/token_paste.h75
-rw-r--r--include/ruby/internal/value.h71
-rw-r--r--include/ruby/internal/value_type.h210
-rw-r--r--include/ruby/internal/variable.h301
-rw-r--r--include/ruby/internal/warning_push.h43
-rw-r--r--include/ruby/internal/xmalloc.h357
-rw-r--r--include/ruby/io.h1084
-rw-r--r--include/ruby/io/buffer.h110
-rw-r--r--include/ruby/memory_view.h206
-rw-r--r--include/ruby/missing.h160
-rw-r--r--include/ruby/onigmo.h30
-rw-r--r--include/ruby/ractor.h229
-rw-r--r--include/ruby/random.h284
-rw-r--r--include/ruby/re.h154
-rw-r--r--include/ruby/regex.h1
-rw-r--r--include/ruby/ruby.h359
-rw-r--r--include/ruby/st.h7
-rw-r--r--include/ruby/subst.h1
-rw-r--r--include/ruby/thread.h311
-rw-r--r--include/ruby/thread_native.h154
-rw-r--r--include/ruby/util.h206
-rw-r--r--include/ruby/version.h109
-rw-r--r--include/ruby/vm.h26
-rw-r--r--include/ruby/win32.h123
-rw-r--r--inits.c34
-rw-r--r--insns.def690
-rw-r--r--internal.h26
-rw-r--r--internal/array.h88
-rw-r--r--internal/basic_operators.h66
-rw-r--r--internal/bignum.h46
-rw-r--r--internal/bits.h151
-rw-r--r--internal/box.h96
-rw-r--r--internal/class.h742
-rw-r--r--internal/cmdlineopt.h64
-rw-r--r--internal/compar.h34
-rw-r--r--internal/compile.h8
-rw-r--r--internal/compilers.h1
-rw-r--r--internal/complex.h2
-rw-r--r--internal/concurrent_set.h21
-rw-r--r--internal/cont.h17
-rw-r--r--internal/dir.h1
-rw-r--r--internal/enc.h1
-rw-r--r--internal/encoding.h15
-rw-r--r--internal/enum.h1
-rw-r--r--internal/enumerator.h1
-rw-r--r--internal/error.h141
-rw-r--r--internal/eval.h12
-rw-r--r--internal/file.h3
-rw-r--r--internal/fixnum.h4
-rw-r--r--internal/gc.h316
-rw-r--r--internal/hash.h107
-rw-r--r--internal/imemo.h212
-rw-r--r--internal/inits.h8
-rw-r--r--internal/io.h141
-rw-r--r--internal/load.h3
-rw-r--r--internal/loadpath.h1
-rw-r--r--internal/math.h1
-rw-r--r--internal/missing.h2
-rw-r--r--internal/numeric.h86
-rw-r--r--internal/object.h39
-rw-r--r--internal/parse.h118
-rw-r--r--internal/proc.h5
-rw-r--r--internal/process.h20
-rw-r--r--internal/ractor.h10
-rw-r--r--internal/random.h2
-rw-r--r--internal/range.h7
-rw-r--r--internal/rational.h25
-rw-r--r--internal/re.h64
-rw-r--r--internal/ruby_parser.h102
-rw-r--r--internal/sanitizers.h261
-rw-r--r--internal/scheduler.h44
-rw-r--r--internal/serial.h1
-rw-r--r--internal/set_table.h74
-rw-r--r--internal/signal.h7
-rw-r--r--internal/st.h20
-rw-r--r--internal/static_assert.h1
-rw-r--r--internal/string.h119
-rw-r--r--internal/struct.h120
-rw-r--r--internal/symbol.h7
-rw-r--r--internal/thread.h68
-rw-r--r--internal/time.h5
-rw-r--r--internal/transcode.h4
-rw-r--r--internal/util.h4
-rw-r--r--internal/variable.h80
-rw-r--r--internal/vm.h56
-rw-r--r--internal/warnings.h3
-rw-r--r--io.c10922
-rw-r--r--io.rb13
-rw-r--r--io_buffer.c4081
-rw-r--r--iseq.c3465
-rw-r--r--iseq.h169
-rw-r--r--jit.c844
-rw-r--r--jit/Cargo.toml6
-rw-r--r--jit/src/lib.rs38
-rw-r--r--jit_hook.rb12
-rw-r--r--jit_undef.rb4
-rw-r--r--kernel.rb210
-rw-r--r--lex.c.blt87
-rw-r--r--lib/.document26
-rw-r--r--lib/English.gemspec13
-rw-r--r--lib/English.rb110
-rw-r--r--lib/abbrev.gemspec22
-rw-r--r--lib/abbrev.rb132
-rw-r--r--lib/base64.gemspec22
-rw-r--r--lib/base64.rb108
-rw-r--r--lib/benchmark.rb565
-rw-r--r--lib/benchmark/benchmark.gemspec29
-rw-r--r--lib/benchmark/version.rb3
-rw-r--r--lib/bundled_gems.rb275
-rw-r--r--lib/bundler.rb407
-rw-r--r--lib/bundler/.document1
-rw-r--r--lib/bundler/build_metadata.rb22
-rw-r--r--lib/bundler/bundler.gemspec27
-rw-r--r--lib/bundler/capistrano.rb20
-rw-r--r--lib/bundler/checksum.rb270
-rw-r--r--lib/bundler/ci_detector.rb75
-rw-r--r--lib/bundler/cli.rb768
-rw-r--r--lib/bundler/cli/add.rb25
-rw-r--r--lib/bundler/cli/binstubs.rb16
-rw-r--r--lib/bundler/cli/cache.rb18
-rw-r--r--lib/bundler/cli/check.rb12
-rw-r--r--lib/bundler/cli/common.rb62
-rw-r--r--lib/bundler/cli/config.rb36
-rw-r--r--lib/bundler/cli/console.rb26
-rw-r--r--lib/bundler/cli/doctor.rb161
-rw-r--r--lib/bundler/cli/doctor/diagnose.rb167
-rw-r--r--lib/bundler/cli/doctor/ssl.rb249
-rw-r--r--lib/bundler/cli/exec.rb39
-rw-r--r--lib/bundler/cli/fund.rb2
-rw-r--r--lib/bundler/cli/gem.rb309
-rw-r--r--lib/bundler/cli/info.rb44
-rw-r--r--lib/bundler/cli/init.rb8
-rw-r--r--lib/bundler/cli/inject.rb60
-rw-r--r--lib/bundler/cli/install.rb170
-rw-r--r--lib/bundler/cli/issue.rb15
-rw-r--r--lib/bundler/cli/list.rb43
-rw-r--r--lib/bundler/cli/lock.rb83
-rw-r--r--lib/bundler/cli/open.rb19
-rw-r--r--lib/bundler/cli/outdated.rb136
-rw-r--r--lib/bundler/cli/platform.rb14
-rw-r--r--lib/bundler/cli/plugin.rb28
-rw-r--r--lib/bundler/cli/pristine.rb68
-rw-r--r--lib/bundler/cli/remove.rb3
-rw-r--r--lib/bundler/cli/show.rb18
-rw-r--r--lib/bundler/cli/update.rb38
-rw-r--r--lib/bundler/cli/viz.rb31
-rw-r--r--lib/bundler/compact_index_client.rb143
-rw-r--r--lib/bundler/compact_index_client/cache.rb122
-rw-r--r--lib/bundler/compact_index_client/cache_file.rb148
-rw-r--r--lib/bundler/compact_index_client/gem_parser.rb28
-rw-r--r--lib/bundler/compact_index_client/parser.rb87
-rw-r--r--lib/bundler/compact_index_client/updater.rb155
-rw-r--r--lib/bundler/constants.rb11
-rw-r--r--lib/bundler/current_ruby.rb91
-rw-r--r--lib/bundler/definition.rb1383
-rw-r--r--lib/bundler/dep_proxy.rb48
-rw-r--r--lib/bundler/dependency.rb195
-rw-r--r--lib/bundler/deployment.rb65
-rw-r--r--lib/bundler/digest.rb71
-rw-r--r--lib/bundler/dsl.rb429
-rw-r--r--lib/bundler/endpoint_specification.rb79
-rw-r--r--lib/bundler/env.rb12
-rw-r--r--lib/bundler/environment_preserver.rb31
-rw-r--r--lib/bundler/errors.rb177
-rw-r--r--lib/bundler/feature_flag.rb52
-rw-r--r--lib/bundler/fetcher.rb241
-rw-r--r--lib/bundler/fetcher/base.rb22
-rw-r--r--lib/bundler/fetcher/compact_index.rb88
-rw-r--r--lib/bundler/fetcher/dependency.rb21
-rw-r--r--lib/bundler/fetcher/downloader.rb81
-rw-r--r--lib/bundler/fetcher/gem_remote_fetcher.rb22
-rw-r--r--lib/bundler/fetcher/index.rb32
-rw-r--r--lib/bundler/force_platform.rb16
-rw-r--r--lib/bundler/friendly_errors.rb76
-rw-r--r--lib/bundler/gem_helper.rb58
-rw-r--r--lib/bundler/gem_helpers.rb110
-rw-r--r--lib/bundler/gem_version_promoter.rb179
-rw-r--r--lib/bundler/gemdeps.rb29
-rw-r--r--lib/bundler/graph.rb152
-rw-r--r--lib/bundler/index.rb164
-rw-r--r--lib/bundler/injector.rb59
-rw-r--r--lib/bundler/inline.rb122
-rw-r--r--lib/bundler/installer.rb190
-rw-r--r--lib/bundler/installer/gem_installer.rb77
-rw-r--r--lib/bundler/installer/parallel_installer.rb170
-rw-r--r--lib/bundler/installer/standalone.rb89
-rw-r--r--lib/bundler/lazy_specification.rb272
-rw-r--r--lib/bundler/lockfile_generator.rb34
-rw-r--r--lib/bundler/lockfile_parser.rb275
-rw-r--r--lib/bundler/man/bundle-add.1104
-rw-r--r--lib/bundler/man/bundle-add.1.ronn91
-rw-r--r--lib/bundler/man/bundle-binstubs.132
-rw-r--r--lib/bundler/man/bundle-binstubs.1.ronn15
-rw-r--r--lib/bundler/man/bundle-cache.153
-rw-r--r--lib/bundler/man/bundle-cache.1.ronn35
-rw-r--r--lib/bundler/man/bundle-check.124
-rw-r--r--lib/bundler/man/bundle-check.1.ronn10
-rw-r--r--lib/bundler/man/bundle-clean.115
-rw-r--r--lib/bundler/man/bundle-clean.1.ronn2
-rw-r--r--lib/bundler/man/bundle-config.1425
-rw-r--r--lib/bundler/man/bundle-config.1.ronn346
-rw-r--r--lib/bundler/man/bundle-console.133
-rw-r--r--lib/bundler/man/bundle-console.1.ronn39
-rw-r--r--lib/bundler/man/bundle-doctor.169
-rw-r--r--lib/bundler/man/bundle-doctor.1.ronn54
-rw-r--r--lib/bundler/man/bundle-env.19
-rw-r--r--lib/bundler/man/bundle-env.1.ronn10
-rw-r--r--lib/bundler/man/bundle-exec.197
-rw-r--r--lib/bundler/man/bundle-exec.1.ronn24
-rw-r--r--lib/bundler/man/bundle-fund.122
-rw-r--r--lib/bundler/man/bundle-fund.1.ronn25
-rw-r--r--lib/bundler/man/bundle-gem.1103
-rw-r--r--lib/bundler/man/bundle-gem.1.ronn67
-rw-r--r--lib/bundler/man/bundle-help.19
-rw-r--r--lib/bundler/man/bundle-help.1.ronn12
-rw-r--r--lib/bundler/man/bundle-info.119
-rw-r--r--lib/bundler/man/bundle-info.1.ronn14
-rw-r--r--lib/bundler/man/bundle-init.119
-rw-r--r--lib/bundler/man/bundle-init.1.ronn5
-rw-r--r--lib/bundler/man/bundle-inject.133
-rw-r--r--lib/bundler/man/bundle-inject.1.ronn22
-rw-r--r--lib/bundler/man/bundle-install.1252
-rw-r--r--lib/bundler/man/bundle-install.1.ronn199
-rw-r--r--lib/bundler/man/bundle-issue.145
-rw-r--r--lib/bundler/man/bundle-issue.1.ronn37
-rw-r--r--lib/bundler/man/bundle-licenses.19
-rw-r--r--lib/bundler/man/bundle-licenses.1.ronn10
-rw-r--r--lib/bundler/man/bundle-list.128
-rw-r--r--lib/bundler/man/bundle-list.1.ronn10
-rw-r--r--lib/bundler/man/bundle-lock.159
-rw-r--r--lib/bundler/man/bundle-lock.1.ronn29
-rw-r--r--lib/bundler/man/bundle-open.136
-rw-r--r--lib/bundler/man/bundle-open.1.ronn11
-rw-r--r--lib/bundler/man/bundle-outdated.1101
-rw-r--r--lib/bundler/man/bundle-outdated.1.ronn50
-rw-r--r--lib/bundler/man/bundle-platform.144
-rw-r--r--lib/bundler/man/bundle-platform.1.ronn21
-rw-r--r--lib/bundler/man/bundle-plugin.176
-rw-r--r--lib/bundler/man/bundle-plugin.1.ronn84
-rw-r--r--lib/bundler/man/bundle-pristine.121
-rw-r--r--lib/bundler/man/bundle-pristine.1.ronn2
-rw-r--r--lib/bundler/man/bundle-remove.124
-rw-r--r--lib/bundler/man/bundle-remove.1.ronn11
-rw-r--r--lib/bundler/man/bundle-show.113
-rw-r--r--lib/bundler/man/bundle-update.1188
-rw-r--r--lib/bundler/man/bundle-update.1.ronn43
-rw-r--r--lib/bundler/man/bundle-version.122
-rw-r--r--lib/bundler/man/bundle-version.1.ronn24
-rw-r--r--lib/bundler/man/bundle-viz.139
-rw-r--r--lib/bundler/man/bundle-viz.1.ronn30
-rw-r--r--lib/bundler/man/bundle.173
-rw-r--r--lib/bundler/man/bundle.1.ronn24
-rw-r--r--lib/bundler/man/gemfile.5551
-rw-r--r--lib/bundler/man/gemfile.5.ronn292
-rw-r--r--lib/bundler/man/index.txt10
-rw-r--r--lib/bundler/match_metadata.rb50
-rw-r--r--lib/bundler/match_platform.rb44
-rw-r--r--lib/bundler/match_remote_metadata.rb44
-rw-r--r--lib/bundler/materialization.rb59
-rw-r--r--lib/bundler/mirror.rb18
-rw-r--r--lib/bundler/override.rb69
-rw-r--r--lib/bundler/plugin.rb87
-rw-r--r--lib/bundler/plugin/api/source.rb54
-rw-r--r--lib/bundler/plugin/events.rb78
-rw-r--r--lib/bundler/plugin/index.rb79
-rw-r--r--lib/bundler/plugin/installer.rb70
-rw-r--r--lib/bundler/plugin/installer/git.rb4
-rw-r--r--lib/bundler/plugin/installer/path.rb26
-rw-r--r--lib/bundler/plugin/installer/rubygems.rb8
-rw-r--r--lib/bundler/plugin/source_list.rb6
-rw-r--r--lib/bundler/process_lock.rb24
-rw-r--r--lib/bundler/psyched_yaml.rb22
-rw-r--r--lib/bundler/remote_specification.rb23
-rw-r--r--lib/bundler/resolver.rb905
-rw-r--r--lib/bundler/resolver/base.rb119
-rw-r--r--lib/bundler/resolver/candidate.rb85
-rw-r--r--lib/bundler/resolver/incompatibility.rb15
-rw-r--r--lib/bundler/resolver/package.rb95
-rw-r--r--lib/bundler/resolver/root.rb25
-rw-r--r--lib/bundler/resolver/spec_group.rb122
-rw-r--r--lib/bundler/resolver/strategy.rb43
-rw-r--r--lib/bundler/retry.rb36
-rw-r--r--lib/bundler/ruby_dsl.rb63
-rw-r--r--lib/bundler/ruby_version.rb48
-rw-r--r--lib/bundler/rubygems_ext.rb447
-rw-r--r--lib/bundler/rubygems_gem_installer.rb215
-rw-r--r--lib/bundler/rubygems_integration.rb349
-rw-r--r--lib/bundler/runtime.rb140
-rw-r--r--lib/bundler/safe_marshal.rb31
-rw-r--r--lib/bundler/self_manager.rb197
-rw-r--r--lib/bundler/settings.rb300
-rw-r--r--lib/bundler/settings/validator.rb26
-rw-r--r--lib/bundler/setup.rb16
-rw-r--r--lib/bundler/shared_helpers.rb168
-rw-r--r--lib/bundler/similarity_detector.rb63
-rw-r--r--lib/bundler/source.rb38
-rw-r--r--lib/bundler/source/gemspec.rb5
-rw-r--r--lib/bundler/source/git.rb282
-rw-r--r--lib/bundler/source/git/git_proxy.rb432
-rw-r--r--lib/bundler/source/metadata.rb40
-rw-r--r--lib/bundler/source/path.rb70
-rw-r--r--lib/bundler/source/path/installer.rb29
-rw-r--r--lib/bundler/source/rubygems.rb581
-rw-r--r--lib/bundler/source/rubygems/remote.rb30
-rw-r--r--lib/bundler/source/rubygems_aggregate.rb71
-rw-r--r--lib/bundler/source_list.rb191
-rw-r--r--lib/bundler/source_map.rb72
-rw-r--r--lib/bundler/spec_set.rb377
-rw-r--r--lib/bundler/stub_specification.rb55
-rw-r--r--lib/bundler/templates/Executable15
-rw-r--r--lib/bundler/templates/Executable.bundler114
-rw-r--r--lib/bundler/templates/Executable.standalone8
-rw-r--r--lib/bundler/templates/Gemfile2
-rw-r--r--lib/bundler/templates/gems.rb8
-rw-r--r--lib/bundler/templates/newgem/CHANGELOG.md.tt5
-rw-r--r--lib/bundler/templates/newgem/CODE_OF_CONDUCT.md.tt88
-rw-r--r--lib/bundler/templates/newgem/Cargo.toml.tt13
-rw-r--r--lib/bundler/templates/newgem/Gemfile.tt12
-rw-r--r--lib/bundler/templates/newgem/README.md.tt32
-rw-r--r--lib/bundler/templates/newgem/Rakefile.tt38
-rw-r--r--lib/bundler/templates/newgem/bin/console.tt4
-rw-r--r--lib/bundler/templates/newgem/circleci/config.yml.tt24
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/Cargo.toml.tt22
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/build.rs.tt5
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/extconf-c.rb.tt10
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/extconf-go.rb.tt11
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/extconf-rust.rb.tt6
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/extconf.rb.tt5
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/go.mod.tt5
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/newgem-go.c.tt2
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/newgem.c.tt2
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/newgem.go.tt31
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/src/lib.rs.tt23
-rw-r--r--lib/bundler/templates/newgem/github/workflows/build-gems.yml.tt69
-rw-r--r--lib/bundler/templates/newgem/github/workflows/main.yml.tt52
-rw-r--r--lib/bundler/templates/newgem/gitignore.tt3
-rw-r--r--lib/bundler/templates/newgem/gitlab-ci.yml.tt26
-rw-r--r--lib/bundler/templates/newgem/lib/newgem.rb.tt2
-rw-r--r--lib/bundler/templates/newgem/newgem.gemspec.tt64
-rw-r--r--lib/bundler/templates/newgem/rubocop.yml.tt8
-rw-r--r--lib/bundler/templates/newgem/sig/newgem.rbs.tt8
-rw-r--r--lib/bundler/templates/newgem/spec/newgem_spec.rb.tt8
-rw-r--r--lib/bundler/templates/newgem/standard.yml.tt3
-rw-r--r--lib/bundler/templates/newgem/test/minitest/test_newgem.rb.tt8
-rw-r--r--lib/bundler/templates/newgem/travis.yml.tt6
-rw-r--r--lib/bundler/ui/rg_proxy.rb2
-rw-r--r--lib/bundler/ui/shell.rb97
-rw-r--r--lib/bundler/ui/silent.rb39
-rw-r--r--lib/bundler/uri_credentials_filter.rb6
-rw-r--r--lib/bundler/uri_normalizer.rb23
-rw-r--r--lib/bundler/vendor/.document1
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool.rb224
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/monotonic_time.rb66
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/timed_stack.rb153
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/version.rb2
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/wrapper.rb56
-rw-r--r--lib/bundler/vendor/fileutils/lib/fileutils.rb1779
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo.rb11
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/delegates/resolution_state.rb57
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/delegates/specification_provider.rb81
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph.rb256
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/action.rb36
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/add_edge_no_circular.rb66
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/add_vertex.rb62
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/delete_edge.rb63
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/detach_vertex_named.rb61
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/log.rb126
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/set_payload.rb46
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/tag.rb36
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/vertex.rb158
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/errors.rb143
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/gem_metadata.rb6
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/modules/specification_provider.rb101
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/modules/ui.rb67
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/resolution.rb835
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/resolver.rb46
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/state.rb58
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent.rb262
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/connection.rb7
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/pool.rb34
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/timed_stack_multi.rb5
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub.rb31
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/assignment.rb20
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/basic_package_source.rb169
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/failure_writer.rb182
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/incompatibility.rb150
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/package.rb43
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/partial_solution.rb121
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/rubygems.rb45
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/solve_failure.rb19
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/static_package_source.rb61
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/strategy.rb42
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/term.rb105
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version.rb3
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version_constraint.rb129
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version_range.rb423
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version_solver.rb236
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version_union.rb178
-rw-r--r--lib/bundler/vendor/securerandom/lib/securerandom.rb102
-rw-r--r--lib/bundler/vendor/thor/lib/thor.rb187
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions.rb40
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/create_file.rb5
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/directory.rb2
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/empty_directory.rb2
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/file_manipulation.rb88
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/inject_into_file.rb22
-rw-r--r--lib/bundler/vendor/thor/lib/thor/base.rb154
-rw-r--r--lib/bundler/vendor/thor/lib/thor/command.rb17
-rw-r--r--lib/bundler/vendor/thor/lib/thor/core_ext/hash_with_indifferent_access.rb10
-rw-r--r--lib/bundler/vendor/thor/lib/thor/error.rb38
-rw-r--r--lib/bundler/vendor/thor/lib/thor/group.rb13
-rw-r--r--lib/bundler/vendor/thor/lib/thor/invocation.rb2
-rw-r--r--lib/bundler/vendor/thor/lib/thor/nested_context.rb4
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/argument.rb18
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/arguments.rb46
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/option.rb37
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/options.rb90
-rw-r--r--lib/bundler/vendor/thor/lib/thor/rake_compat.rb4
-rw-r--r--lib/bundler/vendor/thor/lib/thor/runner.rb74
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell.rb4
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/basic.rb229
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/color.rb51
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/column_printer.rb29
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/html.rb47
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/table_printer.rb118
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/terminal.rb42
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/wrapped_printer.rb38
-rw-r--r--lib/bundler/vendor/thor/lib/thor/util.rb17
-rw-r--r--lib/bundler/vendor/thor/lib/thor/version.rb2
-rw-r--r--lib/bundler/vendor/tmpdir/lib/tmpdir.rb154
-rw-r--r--lib/bundler/vendor/tsort/lib/tsort.rb455
-rw-r--r--lib/bundler/vendor/uri/lib/uri.rb24
-rw-r--r--lib/bundler/vendor/uri/lib/uri/common.rb618
-rw-r--r--lib/bundler/vendor/uri/lib/uri/file.rb14
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ftp.rb6
-rw-r--r--lib/bundler/vendor/uri/lib/uri/generic.rb158
-rw-r--r--lib/bundler/vendor/uri/lib/uri/http.rb55
-rw-r--r--lib/bundler/vendor/uri/lib/uri/https.rb4
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ldap.rb4
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ldaps.rb3
-rw-r--r--lib/bundler/vendor/uri/lib/uri/mailto.rb5
-rw-r--r--lib/bundler/vendor/uri/lib/uri/rfc2396_parser.rb71
-rw-r--r--lib/bundler/vendor/uri/lib/uri/rfc3986_parser.rb181
-rw-r--r--lib/bundler/vendor/uri/lib/uri/version.rb4
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ws.rb83
-rw-r--r--lib/bundler/vendor/uri/lib/uri/wss.rb23
-rw-r--r--lib/bundler/vendored_molinillo.rb4
-rw-r--r--lib/bundler/vendored_net_http.rb23
-rw-r--r--lib/bundler/vendored_persistent.rb36
-rw-r--r--lib/bundler/vendored_pub_grub.rb4
-rw-r--r--lib/bundler/vendored_securerandom.rb12
-rw-r--r--lib/bundler/vendored_timeout.rb12
-rw-r--r--lib/bundler/vendored_tmpdir.rb4
-rw-r--r--lib/bundler/vendored_tsort.rb4
-rw-r--r--lib/bundler/vendored_uri.rb19
-rw-r--r--lib/bundler/version.rb16
-rw-r--r--lib/bundler/version_ranges.rb122
-rw-r--r--lib/bundler/vlad.rb15
-rw-r--r--lib/bundler/worker.rb49
-rw-r--r--lib/bundler/yaml_serializer.rb35
-rw-r--r--lib/cgi.rb300
-rw-r--r--lib/cgi/cgi.gemspec31
-rw-r--r--lib/cgi/cookie.rb182
-rw-r--r--lib/cgi/core.rb889
-rw-r--r--lib/cgi/escape.rb232
-rw-r--r--lib/cgi/html.rb1035
-rw-r--r--lib/cgi/session.rb534
-rw-r--r--lib/cgi/session/pstore.rb100
-rw-r--r--lib/cgi/util.rb226
-rw-r--r--lib/csv.rb2659
-rw-r--r--lib/csv/core_ext/array.rb9
-rw-r--r--lib/csv/core_ext/string.rb9
-rw-r--r--lib/csv/csv.gemspec64
-rw-r--r--lib/csv/delete_suffix.rb18
-rw-r--r--lib/csv/fields_converter.rb84
-rw-r--r--lib/csv/match_p.rb20
-rw-r--r--lib/csv/parser.rb1142
-rw-r--r--lib/csv/row.rb624
-rw-r--r--lib/csv/table.rb621
-rw-r--r--lib/csv/version.rb6
-rw-r--r--lib/csv/writer.rb209
-rw-r--r--lib/debug.gemspec22
-rw-r--r--lib/debug.rb1106
-rw-r--r--lib/delegate.gemspec29
-rw-r--r--lib/delegate.rb73
-rw-r--r--lib/delegate/delegate.gemspec31
-rw-r--r--lib/did_you_mean.rb39
-rw-r--r--lib/did_you_mean/core_ext/name_error.rb54
-rw-r--r--lib/did_you_mean/did_you_mean.gemspec2
-rw-r--r--lib/did_you_mean/formatter.rb44
-rw-r--r--lib/did_you_mean/formatters/plain_formatter.rb35
-rw-r--r--lib/did_you_mean/formatters/verbose_formatter.rb49
-rw-r--r--lib/did_you_mean/jaro_winkler.rb7
-rw-r--r--lib/did_you_mean/spell_checker.rb18
-rw-r--r--lib/did_you_mean/spell_checkers/key_error_checker.rb10
-rw-r--r--lib/did_you_mean/spell_checkers/method_name_checker.rb10
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers/variable_name_checker.rb5
-rw-r--r--lib/did_you_mean/spell_checkers/pattern_key_name_checker.rb28
-rw-r--r--lib/did_you_mean/spell_checkers/require_path_checker.rb6
-rw-r--r--lib/did_you_mean/verbose.rb6
-rw-r--r--lib/did_you_mean/version.rb2
-rw-r--r--lib/drb.rb3
-rw-r--r--lib/drb/acl.rb239
-rw-r--r--lib/drb/drb.gemspec43
-rw-r--r--lib/drb/drb.rb1937
-rw-r--r--lib/drb/eq.rb15
-rw-r--r--lib/drb/extserv.rb44
-rw-r--r--lib/drb/extservm.rb92
-rw-r--r--lib/drb/gw.rb161
-rw-r--r--lib/drb/invokemethod.rb35
-rw-r--r--lib/drb/observer.rb26
-rw-r--r--lib/drb/ssl.rb344
-rw-r--r--lib/drb/timeridconv.rb97
-rw-r--r--lib/drb/unix.rb118
-rw-r--r--lib/drb/version.rb3
-rw-r--r--lib/drb/weakidconv.rb59
-rw-r--r--lib/erb.gemspec24
-rw-r--r--lib/erb.rb1852
-rw-r--r--lib/erb/compiler.rb487
-rw-r--r--lib/erb/def_method.rb47
-rw-r--r--lib/erb/erb.gemspec37
-rw-r--r--lib/erb/util.rb77
-rw-r--r--lib/erb/version.rb5
-rw-r--r--lib/error_highlight.rb2
-rw-r--r--lib/error_highlight/base.rb938
-rw-r--r--lib/error_highlight/core_ext.rb76
-rw-r--r--lib/error_highlight/error_highlight.gemspec27
-rw-r--r--lib/error_highlight/formatter.rb74
-rw-r--r--lib/error_highlight/version.rb3
-rw-r--r--lib/fileutils.gemspec4
-rw-r--r--lib/fileutils.rb1752
-rw-r--r--lib/find.gemspec13
-rw-r--r--lib/find.rb89
-rw-r--r--lib/forwardable.rb55
-rw-r--r--lib/forwardable/forwardable.gemspec4
-rw-r--r--lib/forwardable/impl.rb16
-rw-r--r--lib/getoptlong.rb616
-rw-r--r--lib/getoptlong/getoptlong.gemspec32
-rw-r--r--lib/ipaddr.gemspec22
-rw-r--r--lib/ipaddr.rb261
-rw-r--r--lib/irb.rb950
-rw-r--r--lib/irb/.document1
-rw-r--r--lib/irb/cmd/chws.rb34
-rw-r--r--lib/irb/cmd/fork.rb37
-rw-r--r--lib/irb/cmd/help.rb46
-rw-r--r--lib/irb/cmd/info.rb24
-rw-r--r--lib/irb/cmd/load.rb67
-rw-r--r--lib/irb/cmd/measure.rb34
-rw-r--r--lib/irb/cmd/nop.rb39
-rw-r--r--lib/irb/cmd/pushws.rb40
-rw-r--r--lib/irb/cmd/subirb.rb43
-rw-r--r--lib/irb/color.rb248
-rw-r--r--lib/irb/color_printer.rb27
-rw-r--r--lib/irb/completion.rb333
-rw-r--r--lib/irb/context.rb490
-rw-r--r--lib/irb/easter-egg.rb138
-rw-r--r--lib/irb/ext/change-ws.rb45
-rw-r--r--lib/irb/ext/history.rb155
-rw-r--r--lib/irb/ext/loader.rb128
-rw-r--r--lib/irb/ext/multi-irb.rb265
-rw-r--r--lib/irb/ext/save-history.rb120
-rw-r--r--lib/irb/ext/tracer.rb84
-rw-r--r--lib/irb/ext/use-loader.rb75
-rw-r--r--lib/irb/ext/workspaces.rb66
-rw-r--r--lib/irb/extend-command.rb339
-rw-r--r--lib/irb/frame.rb86
-rw-r--r--lib/irb/help.rb36
-rw-r--r--lib/irb/init.rb391
-rw-r--r--lib/irb/input-method.rb354
-rw-r--r--lib/irb/inspector.rb138
-rw-r--r--lib/irb/irb.gemspec86
-rw-r--r--lib/irb/lc/error.rb71
-rw-r--r--lib/irb/lc/help-message52
-rw-r--r--lib/irb/lc/ja/encoding_aliases.rb11
-rw-r--r--lib/irb/lc/ja/error.rb72
-rw-r--r--lib/irb/lc/ja/help-message55
-rw-r--r--lib/irb/locale.rb191
-rw-r--r--lib/irb/magic-file.rb38
-rw-r--r--lib/irb/notifier.rb236
-rw-r--r--lib/irb/output-method.rb92
-rw-r--r--lib/irb/ruby-lex.rb692
-rw-r--r--lib/irb/ruby_logo.aa37
-rw-r--r--lib/irb/src_encoding.rb7
-rw-r--r--lib/irb/version.rb17
-rw-r--r--lib/irb/workspace.rb183
-rw-r--r--lib/irb/ws-for-case-2.rb15
-rw-r--r--lib/irb/xmp.rb170
-rw-r--r--lib/logger.rb588
-rw-r--r--lib/logger/errors.rb9
-rw-r--r--lib/logger/formatter.rb36
-rw-r--r--lib/logger/log_device.rb205
-rw-r--r--lib/logger/logger.gemspec29
-rw-r--r--lib/logger/period.rb47
-rw-r--r--lib/logger/severity.rb19
-rw-r--r--lib/logger/version.rb5
-rw-r--r--lib/matrix.rb2464
-rw-r--r--lib/matrix/eigenvalue_decomposition.rb882
-rw-r--r--lib/matrix/lup_decomposition.rb219
-rw-r--r--lib/matrix/matrix.gemspec29
-rw-r--r--lib/matrix/version.rb5
-rw-r--r--lib/mkmf.rb670
-rw-r--r--lib/monitor.rb216
-rw-r--r--lib/mutex_m.gemspec27
-rw-r--r--lib/mutex_m.rb117
-rw-r--r--lib/net/ftp.rb1534
-rw-r--r--lib/net/http.rb2326
-rw-r--r--lib/net/http/backward.rb26
-rw-r--r--lib/net/http/exceptions.rb56
-rw-r--r--lib/net/http/generic_request.rb156
-rw-r--r--lib/net/http/header.rb801
-rw-r--r--lib/net/http/net-http.gemspec23
-rw-r--r--lib/net/http/proxy_delta.rb2
-rw-r--r--lib/net/http/request.rb79
-rw-r--r--lib/net/http/requests.rb373
-rw-r--r--lib/net/http/response.rb370
-rw-r--r--lib/net/http/responses.rb1385
-rw-r--r--lib/net/http/status.rb13
-rw-r--r--lib/net/https.rb2
-rw-r--r--lib/net/imap.rb3730
-rw-r--r--lib/net/net-ftp.gemspec36
-rw-r--r--lib/net/net-imap.gemspec37
-rw-r--r--lib/net/net-pop.gemspec34
-rw-r--r--lib/net/net-protocol.gemspec15
-rw-r--r--lib/net/net-smtp.gemspec35
-rw-r--r--lib/net/pop.rb1022
-rw-r--r--lib/net/protocol.rb101
-rw-r--r--lib/net/smtp.rb1112
-rw-r--r--lib/observer.rb229
-rw-r--r--lib/observer/observer.gemspec32
-rw-r--r--lib/open-uri.gemspec16
-rw-r--r--lib/open-uri.rb138
-rw-r--r--lib/open3.gemspec33
-rw-r--r--lib/open3.rb1274
-rw-r--r--lib/open3/open3.gemspec33
-rw-r--r--lib/open3/version.rb4
-rw-r--r--lib/optparse.rb624
-rw-r--r--lib/optparse/ac.rb18
-rw-r--r--lib/optparse/date.rb2
-rw-r--r--lib/optparse/kwargs.rb18
-rw-r--r--lib/optparse/optparse.gemspec15
-rw-r--r--lib/optparse/shellwords.rb2
-rw-r--r--lib/optparse/time.rb2
-rw-r--r--lib/optparse/uri.rb2
-rw-r--r--lib/optparse/version.rb9
-rw-r--r--lib/ostruct.rb432
-rw-r--r--lib/ostruct/ostruct.gemspec29
-rw-r--r--lib/pathname.rb151
-rw-r--r--lib/pp.gemspec14
-rw-r--r--lib/pp.rb265
-rw-r--r--lib/prettyprint.gemspec11
-rw-r--r--lib/prettyprint.rb25
-rw-r--r--lib/prime.gemspec28
-rw-r--r--lib/prime.rb561
-rw-r--r--lib/prism.rb145
-rw-r--r--lib/prism/desugar_compiler.rb463
-rw-r--r--lib/prism/ffi.rb611
-rw-r--r--lib/prism/lex_compat.rb906
-rw-r--r--lib/prism/node_ext.rb388
-rw-r--r--lib/prism/node_find.rb185
-rw-r--r--lib/prism/parse_result.rb1211
-rw-r--r--lib/prism/parse_result/comments.rb219
-rw-r--r--lib/prism/parse_result/errors.rb72
-rw-r--r--lib/prism/parse_result/newlines.rb204
-rw-r--r--lib/prism/pattern.rb314
-rw-r--r--lib/prism/polyfill/append_as_bytes.rb15
-rw-r--r--lib/prism/polyfill/byteindex.rb13
-rw-r--r--lib/prism/polyfill/scan_byte.rb14
-rw-r--r--lib/prism/polyfill/unpack1.rb14
-rw-r--r--lib/prism/polyfill/warn.rb36
-rw-r--r--lib/prism/prism.gemspec232
-rw-r--r--lib/prism/relocation.rb665
-rw-r--r--lib/prism/string_query.rb46
-rw-r--r--lib/prism/translation.rb20
-rw-r--r--lib/prism/translation/parser.rb376
-rw-r--r--lib/prism/translation/parser/builder.rb70
-rw-r--r--lib/prism/translation/parser/compiler.rb2219
-rw-r--r--lib/prism/translation/parser/lexer.rb819
-rw-r--r--lib/prism/translation/parser_current.rb26
-rw-r--r--lib/prism/translation/parser_versions.rb36
-rw-r--r--lib/prism/translation/ripper.rb4266
-rw-r--r--lib/prism/translation/ripper/filter.rb53
-rw-r--r--lib/prism/translation/ripper/lexer.rb133
-rw-r--r--lib/prism/translation/ripper/sexp.rb118
-rw-r--r--lib/prism/translation/ripper/shim.rb7
-rw-r--r--lib/prism/translation/ruby_parser.rb1676
-rw-r--r--lib/pstore.rb493
-rw-r--r--lib/pstore/pstore.gemspec32
-rw-r--r--lib/racc.rb6
-rw-r--r--lib/racc/compat.rb33
-rw-r--r--lib/racc/debugflags.rb60
-rw-r--r--lib/racc/exception.rb16
-rw-r--r--lib/racc/grammar.rb1118
-rw-r--r--lib/racc/grammarfileparser.rb561
-rw-r--r--lib/racc/info.rb17
-rw-r--r--lib/racc/iset.rb92
-rw-r--r--lib/racc/logfilegenerator.rb212
-rw-r--r--lib/racc/parser-text.rb637
-rw-r--r--lib/racc/parser.rb632
-rw-r--r--lib/racc/parserfilegenerator.rb512
-rw-r--r--lib/racc/pre-setup13
-rw-r--r--lib/racc/racc.gemspec107
-rw-r--r--lib/racc/rdoc/grammar.en.rdoc219
-rw-r--r--lib/racc/sourcetext.rb35
-rw-r--r--lib/racc/state.rb972
-rw-r--r--lib/racc/statetransitiontable.rb317
-rw-r--r--lib/racc/static.rb5
-rw-r--r--lib/random/formatter.rb372
-rw-r--r--lib/rdoc.rb201
-rw-r--r--lib/rdoc/.document2
-rw-r--r--lib/rdoc/alias.rb112
-rw-r--r--lib/rdoc/anon_class.rb11
-rw-r--r--lib/rdoc/any_method.rb361
-rw-r--r--lib/rdoc/attr.rb176
-rw-r--r--lib/rdoc/class_module.rb802
-rw-r--r--lib/rdoc/code_object.rb421
-rw-r--r--lib/rdoc/code_objects.rb6
-rw-r--r--lib/rdoc/comment.rb250
-rw-r--r--lib/rdoc/constant.rb187
-rw-r--r--lib/rdoc/context.rb1266
-rw-r--r--lib/rdoc/context/section.rb232
-rw-r--r--lib/rdoc/cross_reference.rb202
-rw-r--r--lib/rdoc/encoding.rb136
-rw-r--r--lib/rdoc/erb_partial.rb19
-rw-r--r--lib/rdoc/erbio.rb42
-rw-r--r--lib/rdoc/extend.rb10
-rw-r--r--lib/rdoc/generator.rb51
-rw-r--r--lib/rdoc/generator/darkfish.rb790
-rw-r--r--lib/rdoc/generator/json_index.rb300
-rw-r--r--lib/rdoc/generator/markup.rb160
-rw-r--r--lib/rdoc/generator/pot.rb98
-rw-r--r--lib/rdoc/generator/pot/message_extractor.rb68
-rw-r--r--lib/rdoc/generator/pot/po.rb84
-rw-r--r--lib/rdoc/generator/pot/po_entry.rb141
-rw-r--r--lib/rdoc/generator/ri.rb31
-rw-r--r--lib/rdoc/generator/template/darkfish/_footer.rhtml5
-rw-r--r--lib/rdoc/generator/template/darkfish/_head.rhtml22
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_VCS_info.rhtml19
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_classes.rhtml9
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_extends.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_in_files.rhtml9
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_includes.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_installed.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_methods.rhtml12
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_navigation.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_pages.rhtml12
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_parent.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_search.rhtml14
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_sections.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_table_of_contents.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/class.rhtml172
-rw-r--r--lib/rdoc/generator/template/darkfish/css/fonts.css167
-rw-r--r--lib/rdoc/generator/template/darkfish/css/rdoc.css619
-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-Light.ttfbin94668 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-LightItalic.ttfbin94196 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-Regular.ttfbin96184 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-RegularItalic.ttfbin95316 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Bold.ttfbin71200 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Regular.ttfbin71692 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/add.pngbin733 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/arrow_up.pngbin372 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick.pngbin452 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick_link.pngbin764 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bug.pngbin774 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_black.pngbin211 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_minus.pngbin207 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_plus.pngbin209 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/date.pngbin626 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/delete.pngbin715 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/find.pngbin659 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/loadingAnimation.gifbin5886 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/macFFBgHack.pngbin207 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/package.pngbin853 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_green.pngbin621 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_text.pngbin342 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_width.pngbin309 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/plugin.pngbin591 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/ruby.pngbin592 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/tag_blue.pngbin1880 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/tag_green.pngbin613 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/transparent.pngbin97 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench.pngbin610 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench_orange.pngbin584 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/zoom.pngbin692 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/index.rhtml22
-rw-r--r--lib/rdoc/generator/template/darkfish/js/darkfish.js84
-rw-r--r--lib/rdoc/generator/template/darkfish/js/search.js110
-rw-r--r--lib/rdoc/generator/template/darkfish/page.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_not_found.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_root.rhtml62
-rw-r--r--lib/rdoc/generator/template/darkfish/table_of_contents.rhtml58
-rw-r--r--lib/rdoc/generator/template/json_index/.document1
-rw-r--r--lib/rdoc/generator/template/json_index/js/navigation.js105
-rw-r--r--lib/rdoc/generator/template/json_index/js/searcher.js229
-rw-r--r--lib/rdoc/ghost_method.rb7
-rw-r--r--lib/rdoc/i18n.rb10
-rw-r--r--lib/rdoc/i18n/locale.rb102
-rw-r--r--lib/rdoc/i18n/text.rb126
-rw-r--r--lib/rdoc/include.rb10
-rw-r--r--lib/rdoc/known_classes.rb73
-rw-r--r--lib/rdoc/markdown.rb16287
-rw-r--r--lib/rdoc/markdown/entities.rb2132
-rw-r--r--lib/rdoc/markdown/literals.rb417
-rw-r--r--lib/rdoc/markup.rb866
-rw-r--r--lib/rdoc/markup/attr_changer.rb23
-rw-r--r--lib/rdoc/markup/attr_span.rb30
-rw-r--r--lib/rdoc/markup/attribute_manager.rb344
-rw-r--r--lib/rdoc/markup/attributes.rb71
-rw-r--r--lib/rdoc/markup/blank_line.rb28
-rw-r--r--lib/rdoc/markup/block_quote.rb15
-rw-r--r--lib/rdoc/markup/document.rb165
-rw-r--r--lib/rdoc/markup/formatter.rb266
-rw-r--r--lib/rdoc/markup/hard_break.rb32
-rw-r--r--lib/rdoc/markup/heading.rb79
-rw-r--r--lib/rdoc/markup/include.rb43
-rw-r--r--lib/rdoc/markup/indented_paragraph.rb48
-rw-r--r--lib/rdoc/markup/list.rb102
-rw-r--r--lib/rdoc/markup/list_item.rb100
-rw-r--r--lib/rdoc/markup/paragraph.rb29
-rw-r--r--lib/rdoc/markup/parser.rb575
-rw-r--r--lib/rdoc/markup/pre_process.rb296
-rw-r--r--lib/rdoc/markup/raw.rb70
-rw-r--r--lib/rdoc/markup/regexp_handling.rb41
-rw-r--r--lib/rdoc/markup/rule.rb21
-rw-r--r--lib/rdoc/markup/to_ansi.rb94
-rw-r--r--lib/rdoc/markup/to_bs.rb77
-rw-r--r--lib/rdoc/markup/to_html.rb417
-rw-r--r--lib/rdoc/markup/to_html_crossref.rb176
-rw-r--r--lib/rdoc/markup/to_html_snippet.rb285
-rw-r--r--lib/rdoc/markup/to_joined_paragraph.rb46
-rw-r--r--lib/rdoc/markup/to_label.rb75
-rw-r--r--lib/rdoc/markup/to_markdown.rb192
-rw-r--r--lib/rdoc/markup/to_rdoc.rb334
-rw-r--r--lib/rdoc/markup/to_table_of_contents.rb88
-rw-r--r--lib/rdoc/markup/to_test.rb70
-rw-r--r--lib/rdoc/markup/to_tt_only.rb121
-rw-r--r--lib/rdoc/markup/verbatim.rb84
-rw-r--r--lib/rdoc/meta_method.rb7
-rw-r--r--lib/rdoc/method_attr.rb419
-rw-r--r--lib/rdoc/mixin.rb121
-rw-r--r--lib/rdoc/normal_class.rb93
-rw-r--r--lib/rdoc/normal_module.rb74
-rw-r--r--lib/rdoc/options.rb1253
-rw-r--r--lib/rdoc/parser.rb277
-rw-r--r--lib/rdoc/parser/c.rb1225
-rw-r--r--lib/rdoc/parser/changelog.rb204
-rw-r--r--lib/rdoc/parser/markdown.rb24
-rw-r--r--lib/rdoc/parser/rd.rb23
-rw-r--r--lib/rdoc/parser/ripper_state_lex.rb590
-rw-r--r--lib/rdoc/parser/ruby.rb2327
-rw-r--r--lib/rdoc/parser/ruby_tools.rb167
-rw-r--r--lib/rdoc/parser/simple.rb61
-rw-r--r--lib/rdoc/parser/text.rb12
-rw-r--r--lib/rdoc/rd.rb100
-rw-r--r--lib/rdoc/rd/block_parser.rb1056
-rw-r--r--lib/rdoc/rd/inline.rb72
-rw-r--r--lib/rdoc/rd/inline_parser.rb1208
-rw-r--r--lib/rdoc/rdoc.gemspec246
-rw-r--r--lib/rdoc/rdoc.rb572
-rw-r--r--lib/rdoc/require.rb52
-rw-r--r--lib/rdoc/ri.rb21
-rw-r--r--lib/rdoc/ri/driver.rb1572
-rw-r--r--lib/rdoc/ri/formatter.rb6
-rw-r--r--lib/rdoc/ri/paths.rb171
-rw-r--r--lib/rdoc/ri/store.rb7
-rw-r--r--lib/rdoc/ri/task.rb71
-rw-r--r--lib/rdoc/rubygems_hook.rb246
-rw-r--r--lib/rdoc/servlet.rb451
-rw-r--r--lib/rdoc/single_class.rb26
-rw-r--r--lib/rdoc/stats.rb462
-rw-r--r--lib/rdoc/stats/normal.rb58
-rw-r--r--lib/rdoc/stats/quiet.rb60
-rw-r--r--lib/rdoc/stats/verbose.rb46
-rw-r--r--lib/rdoc/store.rb979
-rw-r--r--lib/rdoc/task.rb329
-rw-r--r--lib/rdoc/text.rb304
-rw-r--r--lib/rdoc/token_stream.rb119
-rw-r--r--lib/rdoc/tom_doc.rb263
-rw-r--r--lib/rdoc/top_level.rb289
-rw-r--r--lib/rdoc/version.rb8
-rw-r--r--lib/readline.gemspec35
-rw-r--r--lib/readline.rb6
-rw-r--r--lib/reline.rb465
-rw-r--r--lib/reline/ansi.rb259
-rw-r--r--lib/reline/config.rb347
-rw-r--r--lib/reline/general_io.rb93
-rw-r--r--lib/reline/history.rb76
-rw-r--r--lib/reline/key_actor.rb7
-rw-r--r--lib/reline/key_actor/base.rb7
-rw-r--r--lib/reline/key_actor/emacs.rb517
-rw-r--r--lib/reline/key_actor/vi_command.rb518
-rw-r--r--lib/reline/key_actor/vi_insert.rb517
-rw-r--r--lib/reline/key_stroke.rb55
-rw-r--r--lib/reline/kill_ring.rb125
-rw-r--r--lib/reline/line_editor.rb2640
-rw-r--r--lib/reline/reline.gemspec27
-rw-r--r--lib/reline/unicode.rb625
-rw-r--r--lib/reline/unicode/east_asian_width.rb1164
-rw-r--r--lib/reline/version.rb3
-rw-r--r--lib/reline/windows.rb303
-rw-r--r--lib/resolv-replace.gemspec24
-rw-r--r--lib/resolv-replace.rb76
-rw-r--r--lib/resolv.gemspec19
-rw-r--r--lib/resolv.rb873
-rw-r--r--lib/rinda/rinda.gemspec28
-rw-r--r--lib/rinda/rinda.rb327
-rw-r--r--lib/rinda/ring.rb484
-rw-r--r--lib/rinda/tuplespace.rb641
-rw-r--r--lib/ruby2_keywords.gemspec23
-rw-r--r--lib/rubygems.rb576
-rw-r--r--lib/rubygems/available_set.rb15
-rw-r--r--lib/rubygems/basic_specification.rb171
-rw-r--r--lib/rubygems/bundler_version_finder.rb132
-rw-r--r--lib/rubygems/ci_detector.rb75
-rw-r--r--lib/rubygems/command.rb144
-rw-r--r--lib/rubygems/command_manager.rb75
-rw-r--r--lib/rubygems/commands/build_command.rb32
-rw-r--r--lib/rubygems/commands/cert_command.rb155
-rw-r--r--lib/rubygems/commands/check_command.rb55
-rw-r--r--lib/rubygems/commands/cleanup_command.rb79
-rw-r--r--lib/rubygems/commands/contents_command.rb58
-rw-r--r--lib/rubygems/commands/dependency_command.rb93
-rw-r--r--lib/rubygems/commands/environment_command.rb30
-rw-r--r--lib/rubygems/commands/exec_command.rb259
-rw-r--r--lib/rubygems/commands/fetch_command.rb60
-rw-r--r--lib/rubygems/commands/generate_index_command.rb114
-rw-r--r--lib/rubygems/commands/help_command.rb33
-rw-r--r--lib/rubygems/commands/info_command.rb10
-rw-r--r--lib/rubygems/commands/install_command.rb79
-rw-r--r--lib/rubygems/commands/list_command.rb11
-rw-r--r--lib/rubygems/commands/lock_command.rb11
-rw-r--r--lib/rubygems/commands/mirror_command.rb7
-rw-r--r--lib/rubygems/commands/open_command.rb25
-rw-r--r--lib/rubygems/commands/outdated_command.rb11
-rw-r--r--lib/rubygems/commands/owner_command.rb53
-rw-r--r--lib/rubygems/commands/pristine_command.rb171
-rw-r--r--lib/rubygems/commands/push_command.rb118
-rw-r--r--lib/rubygems/commands/query_command.rb43
-rw-r--r--lib/rubygems/commands/rdoc_command.rb59
-rw-r--r--lib/rubygems/commands/rebuild_command.rb261
-rw-r--r--lib/rubygems/commands/search_command.rb11
-rw-r--r--lib/rubygems/commands/server_command.rb92
-rw-r--r--lib/rubygems/commands/setup_command.rb424
-rw-r--r--lib/rubygems/commands/signin_command.rb19
-rw-r--r--lib/rubygems/commands/signout_command.rb15
-rw-r--r--lib/rubygems/commands/sources_command.rb228
-rw-r--r--lib/rubygems/commands/specification_command.rb51
-rw-r--r--lib/rubygems/commands/stale_command.rb9
-rw-r--r--lib/rubygems/commands/uninstall_command.rb127
-rw-r--r--lib/rubygems/commands/unpack_command.rb53
-rw-r--r--lib/rubygems/commands/update_command.rb158
-rw-r--r--lib/rubygems/commands/which_command.rb17
-rw-r--r--lib/rubygems/commands/yank_command.rb29
-rw-r--r--lib/rubygems/compatibility.rb40
-rw-r--r--lib/rubygems/config_file.rb265
-rw-r--r--lib/rubygems/core_ext/kernel_gem.rb13
-rw-r--r--lib/rubygems/core_ext/kernel_require.rb205
-rw-r--r--lib/rubygems/core_ext/kernel_warn.rb69
-rw-r--r--lib/rubygems/core_ext/tcpsocket_init.rb54
-rw-r--r--lib/rubygems/defaults.rb106
-rw-r--r--lib/rubygems/dependency.rb74
-rw-r--r--lib/rubygems/dependency_installer.rb175
-rw-r--r--lib/rubygems/dependency_list.rb18
-rw-r--r--lib/rubygems/deprecate.rb242
-rw-r--r--lib/rubygems/doctor.rb51
-rw-r--r--lib/rubygems/errors.rb22
-rw-r--r--lib/rubygems/exceptions.rb101
-rw-r--r--lib/rubygems/ext.rb14
-rw-r--r--lib/rubygems/ext/build_error.rb3
-rw-r--r--lib/rubygems/ext/builder.rb129
-rw-r--r--lib/rubygems/ext/cargo_builder.rb349
-rw-r--r--lib/rubygems/ext/cargo_builder/link_flag_converter.rb27
-rw-r--r--lib/rubygems/ext/cmake_builder.rb106
-rw-r--r--lib/rubygems/ext/configure_builder.rb12
-rw-r--r--lib/rubygems/ext/ext_conf_builder.rb116
-rw-r--r--lib/rubygems/ext/rake_builder.rb20
-rw-r--r--lib/rubygems/gem_runner.rb35
-rw-r--r--lib/rubygems/gemcutter_utilities.rb223
-rw-r--r--lib/rubygems/gemcutter_utilities/webauthn_listener.rb112
-rw-r--r--lib/rubygems/gemcutter_utilities/webauthn_listener/response.rb163
-rw-r--r--lib/rubygems/gemcutter_utilities/webauthn_poller.rb80
-rw-r--r--lib/rubygems/gemspec_helpers.rb19
-rw-r--r--lib/rubygems/indexer.rb425
-rw-r--r--lib/rubygems/install_default_message.rb12
-rw-r--r--lib/rubygems/install_message.rb5
-rw-r--r--lib/rubygems/install_update_options.rb161
-rw-r--r--lib/rubygems/installer.rb541
-rw-r--r--lib/rubygems/installer_test_case.rb247
-rw-r--r--lib/rubygems/installer_uninstaller_utils.rb11
-rw-r--r--lib/rubygems/local_remote_options.rb62
-rw-r--r--lib/rubygems/mock_gem_ui.rb85
-rw-r--r--lib/rubygems/name_tuple.rb32
-rw-r--r--lib/rubygems/package.rb339
-rw-r--r--lib/rubygems/package/digest_io.rb3
-rw-r--r--lib/rubygems/package/file_source.rb5
-rw-r--r--lib/rubygems/package/io_source.rb5
-rw-r--r--lib/rubygems/package/old.rb23
-rw-r--r--lib/rubygems/package/source.rb1
-rw-r--r--lib/rubygems/package/tar_header.rb216
-rw-r--r--lib/rubygems/package/tar_reader.rb57
-rw-r--r--lib/rubygems/package/tar_reader/entry.rb135
-rw-r--r--lib/rubygems/package/tar_test_case.rb139
-rw-r--r--lib/rubygems/package/tar_writer.rb62
-rw-r--r--lib/rubygems/package_task.rb13
-rw-r--r--lib/rubygems/path_support.rb29
-rw-r--r--lib/rubygems/platform.rb353
-rw-r--r--lib/rubygems/psych_additions.rb10
-rw-r--r--lib/rubygems/psych_tree.rb9
-rw-r--r--lib/rubygems/query_utils.rb124
-rw-r--r--lib/rubygems/rdoc.rb24
-rw-r--r--lib/rubygems/remote_fetcher.rb160
-rw-r--r--lib/rubygems/request.rb95
-rw-r--r--lib/rubygems/request/connection_pools.rb21
-rw-r--r--lib/rubygems/request/http_pool.rb18
-rw-r--r--lib/rubygems/request/https_pool.rb1
-rw-r--r--lib/rubygems/request_set.rb132
-rw-r--r--lib/rubygems/request_set/gem_dependency_api.rb285
-rw-r--r--lib/rubygems/request_set/lockfile.rb36
-rw-r--r--lib/rubygems/request_set/lockfile/parser.rb343
-rw-r--r--lib/rubygems/request_set/lockfile/tokenizer.rb112
-rw-r--r--lib/rubygems/requirement.rb84
-rw-r--r--lib/rubygems/resolver.rb598
-rw-r--r--lib/rubygems/resolver/activation_request.rb17
-rw-r--r--lib/rubygems/resolver/api_set.rb43
-rw-r--r--lib/rubygems/resolver/api_set/gem_parser.rb9
-rw-r--r--lib/rubygems/resolver/api_specification.rb19
-rw-r--r--lib/rubygems/resolver/best_set.rb39
-rw-r--r--lib/rubygems/resolver/composed_set.rb7
-rw-r--r--lib/rubygems/resolver/conflict.rb153
-rw-r--r--lib/rubygems/resolver/current_set.rb1
-rw-r--r--lib/rubygems/resolver/dependency_request.rb5
-rw-r--r--lib/rubygems/resolver/git_set.rb4
-rw-r--r--lib/rubygems/resolver/git_specification.rb13
-rw-r--r--lib/rubygems/resolver/incompatibility.rb10
-rw-r--r--lib/rubygems/resolver/index_set.rb19
-rw-r--r--lib/rubygems/resolver/index_specification.rb19
-rw-r--r--lib/rubygems/resolver/installed_specification.rb11
-rw-r--r--lib/rubygems/resolver/installer_set.rb69
-rw-r--r--lib/rubygems/resolver/local_specification.rb7
-rw-r--r--lib/rubygems/resolver/lock_set.rb11
-rw-r--r--lib/rubygems/resolver/lock_specification.rb9
-rw-r--r--lib/rubygems/resolver/molinillo.rb2
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo.rb11
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/resolution_state.rb57
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/specification_provider.rb81
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph.rb256
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/action.rb36
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_edge_no_circular.rb66
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_vertex.rb62
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/delete_edge.rb63
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/detach_vertex_named.rb61
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/log.rb126
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/set_payload.rb46
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/tag.rb36
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/vertex.rb158
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/errors.rb143
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/gem_metadata.rb6
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/specification_provider.rb101
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/ui.rb67
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolution.rb835
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolver.rb46
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/state.rb58
-rw-r--r--lib/rubygems/resolver/requirement_list.rb1
-rw-r--r--lib/rubygems/resolver/set.rb2
-rw-r--r--lib/rubygems/resolver/source_set.rb4
-rw-r--r--lib/rubygems/resolver/spec_specification.rb8
-rw-r--r--lib/rubygems/resolver/specification.rb3
-rw-r--r--lib/rubygems/resolver/stats.rb45
-rw-r--r--lib/rubygems/resolver/strategy.rb44
-rw-r--r--lib/rubygems/resolver/vendor_set.rb3
-rw-r--r--lib/rubygems/resolver/vendor_specification.rb7
-rw-r--r--lib/rubygems/s3_uri_signer.rb103
-rw-r--r--lib/rubygems/safe_marshal.rb75
-rw-r--r--lib/rubygems/safe_marshal/elements.rb146
-rw-r--r--lib/rubygems/safe_marshal/reader.rb325
-rw-r--r--lib/rubygems/safe_marshal/visitors/stream_printer.rb31
-rw-r--r--lib/rubygems/safe_marshal/visitors/to_ruby.rb428
-rw-r--r--lib/rubygems/safe_marshal/visitors/visitor.rb74
-rw-r--r--lib/rubygems/safe_yaml.rb50
-rw-r--r--lib/rubygems/security.rb147
-rw-r--r--lib/rubygems/security/policies.rb97
-rw-r--r--lib/rubygems/security/policy.rb61
-rw-r--r--lib/rubygems/security/signer.rb32
-rw-r--r--lib/rubygems/security/trust_dir.rb24
-rw-r--r--lib/rubygems/security_option.rb15
-rw-r--r--lib/rubygems/server.rb882
-rw-r--r--lib/rubygems/source.rb135
-rw-r--r--lib/rubygems/source/git.rb72
-rw-r--r--lib/rubygems/source/installed.rb7
-rw-r--r--lib/rubygems/source/local.rb102
-rw-r--r--lib/rubygems/source/lock.rb5
-rw-r--r--lib/rubygems/source/specific_file.rb10
-rw-r--r--lib/rubygems/source/vendor.rb3
-rw-r--r--lib/rubygems/source_list.rb50
-rw-r--r--lib/rubygems/spec_fetcher.rb177
-rw-r--r--lib/rubygems/specification.rb1051
-rw-r--r--lib/rubygems/specification_policy.rb264
-rw-r--r--lib/rubygems/specification_record.rb225
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/GlobalSign.pem (renamed from lib/rubygems/ssl_certs/rubygems.org/GlobalSignRootCA_R3.pem)0
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/GlobalSignRootCA.pem21
-rw-r--r--lib/rubygems/stub_specification.rb116
-rw-r--r--lib/rubygems/syck_hack.rb77
-rw-r--r--lib/rubygems/target_rbconfig.rb50
-rw-r--r--lib/rubygems/test_case.rb1524
-rw-r--r--lib/rubygems/test_utilities.rb373
-rw-r--r--lib/rubygems/text.rb9
-rw-r--r--lib/rubygems/uninstaller.rb190
-rw-r--r--lib/rubygems/update_suggestion.rb56
-rw-r--r--lib/rubygems/uri.rb126
-rw-r--r--lib/rubygems/uri_formatter.rb5
-rw-r--r--lib/rubygems/uri_parser.rb34
-rw-r--r--lib/rubygems/uri_parsing.rb23
-rw-r--r--lib/rubygems/user_interaction.rb95
-rw-r--r--lib/rubygems/util.rb55
-rw-r--r--lib/rubygems/util/atomic_file_writer.rb76
-rw-r--r--lib/rubygems/util/licenses.rb531
-rw-r--r--lib/rubygems/util/list.rb37
-rw-r--r--lib/rubygems/validator.rb31
-rw-r--r--lib/rubygems/vendor/.document1
-rw-r--r--lib/rubygems/vendor/net-http/lib/net/http.rb2608
-rw-r--r--lib/rubygems/vendor/net-http/lib/net/http/exceptions.rb35
-rw-r--r--lib/rubygems/vendor/net-http/lib/net/http/generic_request.rb429
-rw-r--r--lib/rubygems/vendor/net-http/lib/net/http/header.rb985
-rw-r--r--lib/rubygems/vendor/net-http/lib/net/http/proxy_delta.rb17
-rw-r--r--lib/rubygems/vendor/net-http/lib/net/http/request.rb88
-rw-r--r--lib/rubygems/vendor/net-http/lib/net/http/requests.rb444
-rw-r--r--lib/rubygems/vendor/net-http/lib/net/http/response.rb739
-rw-r--r--lib/rubygems/vendor/net-http/lib/net/http/responses.rb1242
-rw-r--r--lib/rubygems/vendor/net-http/lib/net/http/status.rb84
-rw-r--r--lib/rubygems/vendor/net-http/lib/net/https.rb23
-rw-r--r--lib/rubygems/vendor/net-protocol/lib/net/protocol.rb544
-rw-r--r--lib/rubygems/vendor/optparse/lib/optionparser.rb2
-rw-r--r--lib/rubygems/vendor/optparse/lib/optparse.rb2467
-rw-r--r--lib/rubygems/vendor/optparse/lib/optparse/ac.rb70
-rw-r--r--lib/rubygems/vendor/optparse/lib/optparse/date.rb18
-rw-r--r--lib/rubygems/vendor/optparse/lib/optparse/kwargs.rb27
-rw-r--r--lib/rubygems/vendor/optparse/lib/optparse/shellwords.rb7
-rw-r--r--lib/rubygems/vendor/optparse/lib/optparse/time.rb11
-rw-r--r--lib/rubygems/vendor/optparse/lib/optparse/uri.rb7
-rw-r--r--lib/rubygems/vendor/optparse/lib/optparse/version.rb80
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub.rb53
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/assignment.rb20
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/basic_package_source.rb169
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/failure_writer.rb182
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/incompatibility.rb150
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/package.rb43
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/partial_solution.rb121
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/rubygems.rb45
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/solve_failure.rb19
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/static_package_source.rb61
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/strategy.rb42
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/term.rb105
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/version.rb3
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/version_constraint.rb129
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/version_range.rb423
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/version_solver.rb236
-rw-r--r--lib/rubygems/vendor/pub_grub/lib/pub_grub/version_union.rb178
-rw-r--r--lib/rubygems/vendor/resolv/lib/resolv.rb3499
-rw-r--r--lib/rubygems/vendor/securerandom/lib/securerandom.rb102
-rw-r--r--lib/rubygems/vendor/timeout/lib/timeout.rb201
-rw-r--r--lib/rubygems/vendor/tsort/lib/tsort.rb455
-rw-r--r--lib/rubygems/vendor/uri/lib/uri.rb104
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/common.rb922
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/file.rb100
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/ftp.rb267
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/generic.rb1592
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/http.rb137
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/https.rb23
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/ldap.rb261
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/ldaps.rb22
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/mailto.rb293
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/rfc2396_parser.rb547
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/rfc3986_parser.rb206
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/version.rb6
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/ws.rb83
-rw-r--r--lib/rubygems/vendor/uri/lib/uri/wss.rb23
-rw-r--r--lib/rubygems/vendored_net_http.rb5
-rw-r--r--lib/rubygems/vendored_optparse.rb3
-rw-r--r--lib/rubygems/vendored_pub_grub.rb3
-rw-r--r--lib/rubygems/vendored_securerandom.rb3
-rw-r--r--lib/rubygems/vendored_timeout.rb5
-rw-r--r--lib/rubygems/vendored_tsort.rb3
-rw-r--r--lib/rubygems/version.rb428
-rw-r--r--lib/rubygems/version_option.rb18
-rw-r--r--lib/rubygems/win_platform.rb30
-rw-r--r--lib/rubygems/yaml_serializer.rb845
-rw-r--r--lib/securerandom.gemspec23
-rw-r--r--lib/securerandom.rb275
-rw-r--r--lib/set.rb692
-rw-r--r--lib/set/set.gemspec25
-rw-r--r--lib/set/sorted_set.rb6
-rw-r--r--lib/set/subclass_compatible.rb347
-rw-r--r--lib/shellwords.gemspec19
-rw-r--r--lib/shellwords.rb32
-rw-r--r--lib/singleton.gemspec30
-rw-r--r--lib/singleton.rb115
-rw-r--r--lib/singleton/singleton.gemspec30
-rw-r--r--lib/syntax_suggest.rb3
-rw-r--r--lib/syntax_suggest/api.rb200
-rw-r--r--lib/syntax_suggest/around_block_scan.rb232
-rw-r--r--lib/syntax_suggest/block_expand.rb165
-rw-r--r--lib/syntax_suggest/capture/before_after_keyword_ends.rb85
-rw-r--r--lib/syntax_suggest/capture/falling_indent_lines.rb71
-rw-r--r--lib/syntax_suggest/capture_code_context.rb245
-rw-r--r--lib/syntax_suggest/clean_document.rb223
-rw-r--r--lib/syntax_suggest/cli.rb130
-rw-r--r--lib/syntax_suggest/code_block.rb100
-rw-r--r--lib/syntax_suggest/code_frontier.rb178
-rw-r--r--lib/syntax_suggest/code_line.rb222
-rw-r--r--lib/syntax_suggest/code_search.rb139
-rw-r--r--lib/syntax_suggest/core_ext.rb47
-rw-r--r--lib/syntax_suggest/display_code_with_line_numbers.rb70
-rw-r--r--lib/syntax_suggest/display_invalid_blocks.rb83
-rw-r--r--lib/syntax_suggest/explain_syntax.rb109
-rw-r--r--lib/syntax_suggest/left_right_token_count.rb162
-rw-r--r--lib/syntax_suggest/mini_stringio.rb30
-rw-r--r--lib/syntax_suggest/parse_blocks_from_indent_line.rb60
-rw-r--r--lib/syntax_suggest/pathname_from_message.rb59
-rw-r--r--lib/syntax_suggest/priority_engulf_queue.rb63
-rw-r--r--lib/syntax_suggest/priority_queue.rb105
-rw-r--r--lib/syntax_suggest/scan_history.rb134
-rw-r--r--lib/syntax_suggest/syntax_suggest.gemspec32
-rw-r--r--lib/syntax_suggest/token.rb49
-rw-r--r--lib/syntax_suggest/unvisited_lines.rb36
-rw-r--r--lib/syntax_suggest/version.rb5
-rw-r--r--lib/syntax_suggest/visitor.rb80
-rw-r--r--lib/tempfile.gemspec21
-rw-r--r--lib/tempfile.rb440
-rw-r--r--lib/time.gemspec22
-rw-r--r--lib/time.rb123
-rw-r--r--lib/timeout.gemspec33
-rw-r--r--lib/timeout.rb328
-rw-r--r--lib/timeout/timeout.gemspec30
-rw-r--r--lib/tmpdir.gemspec12
-rw-r--r--lib/tmpdir.rb79
-rw-r--r--lib/tracer.rb292
-rw-r--r--lib/tracer/tracer.gemspec25
-rw-r--r--lib/tsort.gemspec22
-rw-r--r--lib/tsort.rb452
-rw-r--r--lib/un.gemspec14
-rw-r--r--lib/un.rb51
-rw-r--r--lib/unicode_normalize/normalize.rb32
-rw-r--r--lib/unicode_normalize/tables.rb408
-rw-r--r--lib/uri.rb23
-rw-r--r--lib/uri/common.rb543
-rw-r--r--lib/uri/file.rb14
-rw-r--r--lib/uri/ftp.rb5
-rw-r--r--lib/uri/generic.rb149
-rw-r--r--lib/uri/http.rb54
-rw-r--r--lib/uri/https.rb3
-rw-r--r--lib/uri/ldap.rb2
-rw-r--r--lib/uri/ldaps.rb3
-rw-r--r--lib/uri/mailto.rb4
-rw-r--r--lib/uri/rfc2396_parser.rb56
-rw-r--r--lib/uri/rfc3986_parser.rb168
-rw-r--r--lib/uri/uri.gemspec21
-rw-r--r--lib/uri/version.rb4
-rw-r--r--lib/uri/ws.rb3
-rw-r--r--lib/uri/wss.rb3
-rw-r--r--lib/weakref.gemspec32
-rw-r--r--lib/weakref.rb8
-rw-r--r--lib/weakref/weakref.gemspec34
-rw-r--r--lib/yaml.rb16
-rw-r--r--lib/yaml/dbm.rb31
-rw-r--r--lib/yaml/store.rb20
-rw-r--r--lib/yaml/yaml.gemspec13
-rwxr-xr-xlibexec/bundle31
-rwxr-xr-xlibexec/bundler2
-rwxr-xr-xlibexec/erb62
-rwxr-xr-xlibexec/irb11
-rwxr-xr-xlibexec/racc320
-rwxr-xr-xlibexec/rdoc44
-rwxr-xr-xlibexec/ri12
-rwxr-xr-xlibexec/syntax_suggest7
-rw-r--r--load.c1527
-rw-r--r--localeinit.c12
-rw-r--r--main.c28
-rw-r--r--man/erb.14
-rw-r--r--man/goruby.14
-rw-r--r--man/index.txt25
-rw-r--r--man/irb.1207
-rw-r--r--man/ri.1247
-rw-r--r--man/ruby.1241
-rw-r--r--marshal.c2167
-rw-r--r--marshal.rb40
-rw-r--r--math.c842
-rw-r--r--memory_view.c66
-rw-r--r--method.h66
-rw-r--r--mini_builtin.c120
-rw-r--r--miniinit.c58
-rw-r--r--misc/.vscode/launch.json13
-rw-r--r--misc/.vscode/settings.json10
-rw-r--r--misc/.vscode/tasks.json14
-rw-r--r--misc/README1
-rw-r--r--misc/call_fuzzer.rb372
-rwxr-xr-xmisc/call_fuzzer.sh13
-rwxr-xr-xmisc/expand_tabs.rb55
-rw-r--r--misc/gdb.py181
-rwxr-xr-xmisc/jit_perf.py116
-rw-r--r--[-rwxr-xr-x]misc/lldb_cruby.py349
-rw-r--r--misc/lldb_disasm.py29
-rw-r--r--misc/lldb_rb/commands/command_template.py30
-rw-r--r--misc/lldb_rb/commands/heap_page_command.py27
-rw-r--r--misc/lldb_rb/commands/print_flags_command.py31
-rw-r--r--misc/lldb_rb/commands/rb_id2str_command.py49
-rw-r--r--misc/lldb_rb/commands/rclass_ext_command.py14
-rw-r--r--misc/lldb_rb/commands/rp_command.py15
-rw-r--r--misc/lldb_rb/constants.py6
-rw-r--r--misc/lldb_rb/lldb_interface.py18
-rw-r--r--misc/lldb_rb/rb_base_command.py57
-rw-r--r--misc/lldb_rb/rb_heap_structs.py152
-rw-r--r--misc/lldb_rb/utils.py506
-rw-r--r--misc/rb_optparse.bash5
-rw-r--r--[-rwxr-xr-x]misc/rb_optparse.zsh13
-rw-r--r--misc/ruby-style.el15
-rw-r--r--misc/tsan_suppressions.txt109
-rw-r--r--missing/dtoa.c334
-rw-r--r--missing/dup2.c60
-rw-r--r--missing/erf.c15
-rw-r--r--missing/explicit_bzero.c5
-rw-r--r--missing/finite.c9
-rw-r--r--missing/flock.c9
-rw-r--r--missing/isinf.c69
-rw-r--r--missing/isnan.c32
-rw-r--r--missing/langinfo.c2
-rw-r--r--missing/procstat_vm.c34
-rw-r--r--missing/setproctitle.c68
-rw-r--r--missing/signbit.c19
-rw-r--r--missing/tgamma.c15
-rw-r--r--mjit.c975
-rw-r--r--mjit.h203
-rw-r--r--mjit_compile.c594
-rw-r--r--mjit_worker.c1446
-rw-r--r--nilclass.rb63
-rw-r--r--node.c1593
-rw-r--r--node.h532
-rw-r--r--node_dump.c1325
-rw-r--r--numeric.c5520
-rw-r--r--numeric.rb436
-rw-r--r--object.c3188
-rw-r--r--pack.c2473
-rw-r--r--pack.rb283
-rw-r--r--parse.y21218
-rw-r--r--parser_bits.h647
-rw-r--r--parser_node.h32
-rw-r--r--parser_st.c171
-rw-r--r--parser_st.h161
-rw-r--r--parser_value.h106
-rw-r--r--pathname.c372
-rw-r--r--pathname_builtin.rb1895
-rw-r--r--prelude.rb27
-rw-r--r--prism/arena.c117
-rw-r--r--prism/arena.h37
-rw-r--r--prism/buffer.c374
-rw-r--r--prism/buffer.h52
-rw-r--r--prism/char.c274
-rw-r--r--prism/comments.h43
-rw-r--r--prism/compiler/accel.h19
-rw-r--r--prism/compiler/align.h36
-rw-r--r--prism/compiler/exported.h24
-rw-r--r--prism/compiler/fallthrough.h22
-rw-r--r--prism/compiler/filesystem.h32
-rw-r--r--prism/compiler/flex_array.h19
-rw-r--r--prism/compiler/force_inline.h21
-rw-r--r--prism/compiler/format.h25
-rw-r--r--prism/compiler/inline.h17
-rw-r--r--prism/compiler/nodiscard.h22
-rw-r--r--prism/compiler/nonnull.h18
-rw-r--r--prism/compiler/unused.h18
-rw-r--r--prism/config.yml4740
-rw-r--r--prism/constant_pool.c360
-rw-r--r--prism/constant_pool.h81
-rw-r--r--prism/diagnostic.h93
-rw-r--r--prism/encoding.c5345
-rw-r--r--prism/excludes.h29
-rw-r--r--prism/extension.c1489
-rw-r--r--prism/extension.h19
-rw-r--r--prism/integer.c681
-rw-r--r--prism/integer.h41
-rw-r--r--prism/internal/allocator.h68
-rw-r--r--prism/internal/allocator_debug.h88
-rw-r--r--prism/internal/arena.h108
-rw-r--r--prism/internal/bit.h42
-rw-r--r--prism/internal/buffer.h91
-rw-r--r--prism/internal/char.h139
-rw-r--r--prism/internal/comments.h20
-rw-r--r--prism/internal/constant_pool.h117
-rw-r--r--prism/internal/encoding.h242
-rw-r--r--prism/internal/integer.h68
-rw-r--r--prism/internal/isinf.h16
-rw-r--r--prism/internal/line_offset_list.h34
-rw-r--r--prism/internal/list.h62
-rw-r--r--prism/internal/magic_comments.h23
-rw-r--r--prism/internal/memchr.h15
-rw-r--r--prism/internal/node.h32
-rw-r--r--prism/internal/options.h212
-rw-r--r--prism/internal/parser.h958
-rw-r--r--prism/internal/regexp.h41
-rw-r--r--prism/internal/serialize.h34
-rw-r--r--prism/internal/source.h72
-rw-r--r--prism/internal/static_literals.h98
-rw-r--r--prism/internal/stringy.h30
-rw-r--r--prism/internal/strncasecmp.h18
-rw-r--r--prism/internal/strpbrk.h33
-rw-r--r--prism/internal/tokens.h11
-rw-r--r--prism/json.h32
-rw-r--r--prism/line_offset_list.c100
-rw-r--r--prism/line_offset_list.h61
-rw-r--r--prism/list.c24
-rw-r--r--prism/magic_comments.h35
-rw-r--r--prism/memchr.c37
-rw-r--r--prism/node.h94
-rw-r--r--prism/options.c420
-rw-r--r--prism/options.h319
-rw-r--r--prism/parser.c302
-rw-r--r--prism/parser.h348
-rw-r--r--prism/prettyprint.h31
-rw-r--r--prism/prism.c22943
-rw-r--r--prism/prism.h130
-rw-r--r--prism/regexp.c1717
-rw-r--r--prism/serialize.h96
-rw-r--r--prism/source.c491
-rw-r--r--prism/source.h148
-rw-r--r--prism/srcs.mk160
-rw-r--r--prism/srcs.mk.in52
-rw-r--r--prism/static_literals.c641
-rw-r--r--prism/stream.h28
-rw-r--r--prism/string_query.c166
-rw-r--r--prism/string_query.h63
-rw-r--r--prism/stringy.c91
-rw-r--r--prism/stringy.h72
-rw-r--r--prism/strncasecmp.c37
-rw-r--r--prism/strpbrk.c439
-rw-r--r--prism/templates/ext/prism/api_node.c.erb296
-rw-r--r--prism/templates/include/prism/ast.h.erb278
-rw-r--r--prism/templates/include/prism/internal/diagnostic.h.erb60
-rw-r--r--prism/templates/lib/prism/compiler.rb.erb52
-rw-r--r--prism/templates/lib/prism/dispatcher.rb.erb111
-rw-r--r--prism/templates/lib/prism/dot_visitor.rb.erb215
-rw-r--r--prism/templates/lib/prism/dsl.rb.erb172
-rw-r--r--prism/templates/lib/prism/inspect_visitor.rb.erb147
-rw-r--r--prism/templates/lib/prism/mutation_compiler.rb.erb22
-rw-r--r--prism/templates/lib/prism/node.rb.erb748
-rw-r--r--prism/templates/lib/prism/reflection.rb.erb145
-rw-r--r--prism/templates/lib/prism/serialize.rb.erb702
-rw-r--r--prism/templates/lib/prism/visitor.rb.erb73
-rw-r--r--prism/templates/src/diagnostic.c.erb554
-rw-r--r--prism/templates/src/json.c.erb130
-rw-r--r--prism/templates/src/node.c.erb166
-rw-r--r--prism/templates/src/prettyprint.c.erb177
-rw-r--r--prism/templates/src/serialize.c.erb404
-rw-r--r--prism/templates/src/tokens.c.erb367
-rwxr-xr-xprism/templates/template.rb723
-rw-r--r--prism/version.h38
-rw-r--r--prism_compile.c11720
-rw-r--r--prism_compile.h198
-rw-r--r--prism_init.c9
-rw-r--r--prism_xallocator.h6
-rw-r--r--probes_helper.h16
-rw-r--r--proc.c2304
-rw-r--r--process.c5386
-rw-r--r--ractor.c2394
-rw-r--r--ractor.rb1070
-rw-r--r--ractor_core.h274
-rw-r--r--ractor_sync.c1489
-rw-r--r--random.c936
-rw-r--r--range.c2538
-rw-r--r--rational.c1149
-rw-r--r--re.c3742
-rw-r--r--regcomp.c2561
-rw-r--r--regenc.c118
-rw-r--r--regenc.h27
-rw-r--r--regerror.c111
-rw-r--r--regexec.c3555
-rw-r--r--regint.h100
-rw-r--r--regparse.c2947
-rw-r--r--regparse.h9
-rw-r--r--ruby-runner.c98
-rw-r--r--ruby.c3310
-rw-r--r--ruby.rs4
-rw-r--r--ruby_assert.h1
-rw-r--r--ruby_atomic.h90
-rw-r--r--ruby_parser.c1119
-rw-r--r--rubyparser.h1376
-rw-r--r--rubystub.c29
-rw-r--r--sample/all-ruby-quine.rb24
-rw-r--r--sample/coverage.rb2
-rw-r--r--sample/dir.rb11
-rw-r--r--sample/drb/README.ja.rdoc59
-rw-r--r--sample/drb/README.rdoc56
-rw-r--r--sample/drb/acl.rb15
-rw-r--r--sample/drb/darray.rb12
-rw-r--r--sample/drb/darrayc.rb47
-rw-r--r--sample/drb/dbiff.rb51
-rw-r--r--sample/drb/dcdbiff.rb43
-rw-r--r--sample/drb/dchatc.rb41
-rw-r--r--sample/drb/dchats.rb69
-rw-r--r--sample/drb/dhasen.rb41
-rw-r--r--sample/drb/dhasenc.rb14
-rw-r--r--sample/drb/dlogc.rb16
-rw-r--r--sample/drb/dlogd.rb38
-rw-r--r--sample/drb/dqin.rb13
-rw-r--r--sample/drb/dqlib.rb14
-rw-r--r--sample/drb/dqout.rb14
-rw-r--r--sample/drb/dqueue.rb11
-rw-r--r--sample/drb/drbc.rb45
-rw-r--r--sample/drb/drbch.rb48
-rw-r--r--sample/drb/drbm.rb60
-rw-r--r--sample/drb/drbmc.rb22
-rw-r--r--sample/drb/drbs-acl.rb51
-rw-r--r--sample/drb/drbs.rb64
-rw-r--r--sample/drb/drbssl_c.rb19
-rw-r--r--sample/drb/drbssl_s.rb31
-rw-r--r--sample/drb/extserv_test.rb80
-rw-r--r--sample/drb/gw_ct.rb29
-rw-r--r--sample/drb/gw_cu.rb28
-rw-r--r--sample/drb/gw_s.rb10
-rw-r--r--sample/drb/holderc.rb22
-rw-r--r--sample/drb/holders.rb63
-rw-r--r--sample/drb/http0.rb77
-rw-r--r--sample/drb/http0serv.rb120
-rw-r--r--sample/drb/name.rb117
-rw-r--r--sample/drb/namec.rb36
-rw-r--r--sample/drb/old_tuplespace.rb212
-rw-r--r--sample/drb/rinda_ts.rb7
-rw-r--r--sample/drb/rindac.rb17
-rw-r--r--sample/drb/rindas.rb18
-rw-r--r--sample/drb/ring_echo.rb29
-rw-r--r--sample/drb/ring_inspect.rb30
-rw-r--r--sample/drb/ring_place.rb25
-rw-r--r--sample/drb/simpletuple.rb89
-rw-r--r--sample/drb/speedc.rb21
-rw-r--r--sample/drb/speeds.rb31
-rw-r--r--sample/exyacc.rb2
-rw-r--r--sample/from.rb2
-rwxr-xr-xsample/mine.rb8
-rw-r--r--sample/mpart.rb44
-rw-r--r--sample/net-imap.rb167
-rw-r--r--sample/openssl/c_rehash.rb5
-rw-r--r--sample/openssl/cert2text.rb7
-rw-r--r--sample/openssl/certstore.rb7
-rw-r--r--sample/openssl/echo_cli.rb2
-rw-r--r--sample/openssl/echo_svr.rb8
-rw-r--r--sample/openssl/gen_csr.rb14
-rw-r--r--sample/openssl/smime_read.rb11
-rw-r--r--sample/openssl/smime_write.rb15
-rw-r--r--sample/prism/find_calls.rb105
-rw-r--r--sample/prism/find_comments.rb100
-rw-r--r--sample/prism/locate_nodes.rb84
-rw-r--r--sample/prism/make_tags.rb302
-rw-r--r--sample/prism/multiplex_constants.rb138
-rw-r--r--sample/prism/relocate_constants.rb43
-rw-r--r--sample/prism/visit_nodes.rb63
-rwxr-xr-xsample/rss/blend.rb79
-rwxr-xr-xsample/rss/convert.rb69
-rwxr-xr-xsample/rss/list_description.rb91
-rwxr-xr-xsample/rss/re_read.rb64
-rwxr-xr-xsample/rss/rss_recent.rb85
-rw-r--r--sample/testunit/adder.rb13
-rw-r--r--sample/testunit/subtracter.rb12
-rw-r--r--sample/testunit/tc_adder.rb18
-rw-r--r--sample/testunit/tc_subtracter.rb18
-rw-r--r--sample/testunit/ts_examples.rb7
-rw-r--r--sample/trick2015/kinaba/entry.rb4
-rw-r--r--sample/trick2018/01-kinaba/remarks.markdown2
-rw-r--r--sample/trick2018/02-mame/entry.rb4
-rw-r--r--sample/trick2022/01-tompng/Gemfile2
-rw-r--r--sample/trick2022/01-tompng/Gemfile.lock13
-rw-r--r--sample/trick2022/01-tompng/authors.markdown3
-rw-r--r--sample/trick2022/01-tompng/entry.rb40
-rw-r--r--sample/trick2022/01-tompng/remarks.markdown51
-rw-r--r--sample/trick2022/02-tompng/authors.markdown3
-rw-r--r--sample/trick2022/02-tompng/entry.rb32
-rw-r--r--sample/trick2022/02-tompng/remarks.markdown32
-rw-r--r--sample/trick2022/03-mame/authors.markdown3
-rw-r--r--sample/trick2022/03-mame/entry.rb27
-rw-r--r--sample/trick2022/03-mame/remarks.markdown96
-rw-r--r--sample/trick2022/03-mame/test.txt13
-rw-r--r--sample/trick2022/README.md14
-rw-r--r--sample/trick2025/01-omoikane/authors.markdown5
-rw-r--r--sample/trick2025/01-omoikane/bf.rb81
-rw-r--r--sample/trick2025/01-omoikane/entry.rb32
-rw-r--r--sample/trick2025/01-omoikane/remarks.markdown71
-rw-r--r--sample/trick2025/01-omoikane/sample_input.txt35
-rw-r--r--sample/trick2025/01-omoikane/spoiler_rot13.txt470
-rw-r--r--sample/trick2025/02-mame/authors.markdown3
-rw-r--r--sample/trick2025/02-mame/entry.rb34
-rw-r--r--sample/trick2025/02-mame/remarks.markdown141
-rw-r--r--sample/trick2025/02-mame/sample.orig.rb8
-rw-r--r--sample/trick2025/02-mame/test.patch16
-rw-r--r--sample/trick2025/03-tompng/authors.markdown3
-rw-r--r--sample/trick2025/03-tompng/entry.rb74
-rw-r--r--sample/trick2025/03-tompng/remarks.markdown146
-rw-r--r--sample/trick2025/04-tompng/authors.markdown3
-rw-r--r--sample/trick2025/04-tompng/entry.rb36
-rw-r--r--sample/trick2025/04-tompng/remarks.markdown43
-rw-r--r--sample/trick2025/05-tompng/authors.markdown3
-rw-r--r--sample/trick2025/05-tompng/entry.rb118
-rw-r--r--sample/trick2025/05-tompng/remarks.markdown106
-rw-r--r--sample/trick2025/README.md16
-rw-r--r--sample/uumerge.rb4
-rw-r--r--scheduler.c1157
-rw-r--r--set.c2311
-rw-r--r--shape.c1711
-rw-r--r--shape.h659
-rw-r--r--signal.c771
-rw-r--r--siphash.c105
-rw-r--r--sparc.c4
-rw-r--r--spec/README.md42
-rwxr-xr-xspec/bin/bundle6
-rwxr-xr-xspec/bin/parallel_rspec7
-rwxr-xr-xspec/bin/rspec7
-rw-r--r--spec/bundled_gems.mspec14
-rw-r--r--spec/bundled_gems_spec.rb422
-rw-r--r--spec/bundler/bundler/build_metadata_spec.rb23
-rw-r--r--spec/bundler/bundler/bundler_spec.rb338
-rw-r--r--spec/bundler/bundler/ci_detector_spec.rb21
-rw-r--r--spec/bundler/bundler/cli_common_spec.rb22
-rw-r--r--spec/bundler/bundler/cli_spec.rb194
-rw-r--r--spec/bundler/bundler/compact_index_client/parser_spec.rb249
-rw-r--r--spec/bundler/bundler/compact_index_client/updater_spec.rb228
-rw-r--r--spec/bundler/bundler/current_ruby_spec.rb157
-rw-r--r--spec/bundler/bundler/definition_spec.rb261
-rw-r--r--spec/bundler/bundler/dep_proxy_spec.rb22
-rw-r--r--spec/bundler/bundler/dependency_spec.rb49
-rw-r--r--spec/bundler/bundler/digest_spec.rb24
-rw-r--r--spec/bundler/bundler/dsl_spec.rb373
-rw-r--r--spec/bundler/bundler/endpoint_specification_spec.rb90
-rw-r--r--spec/bundler/bundler/env_spec.rb79
-rw-r--r--spec/bundler/bundler/environment_preserver_spec.rb16
-rw-r--r--spec/bundler/bundler/errors_spec.rb91
-rw-r--r--spec/bundler/bundler/fetcher/base_spec.rb11
-rw-r--r--spec/bundler/bundler/fetcher/compact_index_spec.rb18
-rw-r--r--spec/bundler/bundler/fetcher/dependency_spec.rb57
-rw-r--r--spec/bundler/bundler/fetcher/downloader_spec.rb219
-rw-r--r--spec/bundler/bundler/fetcher/gem_remote_fetcher_spec.rb60
-rw-r--r--spec/bundler/bundler/fetcher/index_spec.rb54
-rw-r--r--spec/bundler/bundler/fetcher_spec.rb130
-rw-r--r--spec/bundler/bundler/friendly_errors_spec.rb51
-rw-r--r--spec/bundler/bundler/gem_helper_spec.rb112
-rw-r--r--spec/bundler/bundler/gem_version_promoter_spec.rb246
-rw-r--r--spec/bundler/bundler/installer/gem_installer_spec.rb29
-rw-r--r--spec/bundler/bundler/installer/parallel_installer_spec.rb100
-rw-r--r--spec/bundler/bundler/installer/spec_installation_spec.rb73
-rw-r--r--spec/bundler/bundler/lockfile_parser_spec.rb166
-rw-r--r--spec/bundler/bundler/mirror_spec.rb16
-rw-r--r--spec/bundler/bundler/override_spec.rb175
-rw-r--r--spec/bundler/bundler/plugin/api/source_spec.rb4
-rw-r--r--spec/bundler/bundler/plugin/dsl_spec.rb8
-rw-r--r--spec/bundler/bundler/plugin/events_spec.rb12
-rw-r--r--spec/bundler/bundler/plugin/index_spec.rb103
-rw-r--r--spec/bundler/bundler/plugin/installer_spec.rb30
-rw-r--r--spec/bundler/bundler/plugin_spec.rb79
-rw-r--r--spec/bundler/bundler/psyched_yaml_spec.rb9
-rw-r--r--spec/bundler/bundler/remote_specification_spec.rb14
-rw-r--r--spec/bundler/bundler/resolver/candidate_spec.rb20
-rw-r--r--spec/bundler/bundler/resolver/cooldown_spec.rb148
-rw-r--r--spec/bundler/bundler/retry_spec.rb113
-rw-r--r--spec/bundler/bundler/ruby_dsl_spec.rb163
-rw-r--r--spec/bundler/bundler/ruby_version_spec.rb68
-rw-r--r--spec/bundler/bundler/rubygems_ext_spec.rb39
-rw-r--r--spec/bundler/bundler/rubygems_integration_spec.rb96
-rw-r--r--spec/bundler/bundler/settings/validator_spec.rb6
-rw-r--r--spec/bundler/bundler/settings_spec.rb126
-rw-r--r--spec/bundler/bundler/shared_helpers_spec.rb75
-rw-r--r--spec/bundler/bundler/source/git/git_proxy_spec.rb305
-rw-r--r--spec/bundler/bundler/source/git_spec.rb99
-rw-r--r--spec/bundler/bundler/source/rubygems/remote_spec.rb55
-rw-r--r--spec/bundler/bundler/source/rubygems_spec.rb71
-rw-r--r--spec/bundler/bundler/source_list_spec.rb126
-rw-r--r--spec/bundler/bundler/source_spec.rb58
-rw-r--r--spec/bundler/bundler/spec_set_spec.rb97
-rw-r--r--spec/bundler/bundler/specifications/foo.gemspec13
-rw-r--r--spec/bundler/bundler/stub_specification_spec.rb62
-rw-r--r--spec/bundler/bundler/ui/shell_spec.rb54
-rw-r--r--spec/bundler/bundler/uri_credentials_filter_spec.rb20
-rw-r--r--spec/bundler/bundler/uri_normalizer_spec.rb25
-rw-r--r--spec/bundler/bundler/vendored_persistent_spec.rb77
-rw-r--r--spec/bundler/bundler/version_ranges_spec.rb40
-rw-r--r--spec/bundler/bundler/worker_spec.rb67
-rw-r--r--spec/bundler/bundler/yaml_serializer_spec.rb61
-rw-r--r--spec/bundler/cache/cache_path_spec.rb14
-rw-r--r--spec/bundler/cache/gems_spec.rb322
-rw-r--r--spec/bundler/cache/git_spec.rb365
-rw-r--r--spec/bundler/cache/path_spec.rb62
-rw-r--r--spec/bundler/cache/platform_spec.rb18
-rw-r--r--spec/bundler/commands/add_spec.rb299
-rw-r--r--spec/bundler/commands/binstubs_spec.rb375
-rw-r--r--spec/bundler/commands/cache_spec.rb474
-rw-r--r--spec/bundler/commands/check_spec.rb479
-rw-r--r--spec/bundler/commands/clean_spec.rb459
-rw-r--r--spec/bundler/commands/config_spec.rb240
-rw-r--r--spec/bundler/commands/console_spec.rb217
-rw-r--r--spec/bundler/commands/doctor_spec.rb121
-rw-r--r--spec/bundler/commands/exec_spec.rb689
-rw-r--r--spec/bundler/commands/fund_spec.rb66
-rw-r--r--spec/bundler/commands/help_spec.rb14
-rw-r--r--spec/bundler/commands/info_spec.rb114
-rw-r--r--spec/bundler/commands/init_spec.rb78
-rw-r--r--spec/bundler/commands/inject_spec.rb117
-rw-r--r--spec/bundler/commands/install_spec.rb1892
-rw-r--r--spec/bundler/commands/issue_spec.rb2
-rw-r--r--spec/bundler/commands/licenses_spec.rb6
-rw-r--r--spec/bundler/commands/list_spec.rb178
-rw-r--r--spec/bundler/commands/lock_spec.rb2590
-rw-r--r--spec/bundler/commands/newgem_spec.rb2030
-rw-r--r--spec/bundler/commands/open_spec.rb102
-rw-r--r--spec/bundler/commands/outdated_spec.rb853
-rw-r--r--spec/bundler/commands/platform_spec.rb1260
-rw-r--r--spec/bundler/commands/post_bundle_message_spec.rb250
-rw-r--r--spec/bundler/commands/pristine_spec.rb108
-rw-r--r--spec/bundler/commands/remove_spec.rb425
-rw-r--r--spec/bundler/commands/show_spec.rb93
-rw-r--r--spec/bundler/commands/ssl_spec.rb373
-rw-r--r--spec/bundler/commands/update_spec.rb1754
-rw-r--r--spec/bundler/commands/version_spec.rb54
-rw-r--r--spec/bundler/commands/viz_spec.rb146
-rw-r--r--spec/bundler/install/allow_offline_install_spec.rb51
-rw-r--r--spec/bundler/install/binstubs_spec.rb26
-rw-r--r--spec/bundler/install/bundler_spec.rb189
-rw-r--r--spec/bundler/install/cooldown_spec.rb272
-rw-r--r--spec/bundler/install/deploy_spec.rb462
-rw-r--r--spec/bundler/install/failure_spec.rb133
-rw-r--r--spec/bundler/install/force_spec.rb71
-rw-r--r--spec/bundler/install/gemfile/eval_gemfile_spec.rb63
-rw-r--r--spec/bundler/install/gemfile/force_ruby_platform_spec.rb136
-rw-r--r--spec/bundler/install/gemfile/gemspec_spec.rb572
-rw-r--r--spec/bundler/install/gemfile/git_spec.rb772
-rw-r--r--spec/bundler/install/gemfile/groups_spec.rb201
-rw-r--r--spec/bundler/install/gemfile/install_if_spec.rb27
-rw-r--r--spec/bundler/install/gemfile/lockfile_spec.rb32
-rw-r--r--spec/bundler/install/gemfile/override_spec.rb401
-rw-r--r--spec/bundler/install/gemfile/path_spec.rb570
-rw-r--r--spec/bundler/install/gemfile/platform_spec.rb646
-rw-r--r--spec/bundler/install/gemfile/ruby_spec.rb128
-rw-r--r--spec/bundler/install/gemfile/sources_spec.rb1356
-rw-r--r--spec/bundler/install/gemfile/specific_platform_spec.rb1917
-rw-r--r--spec/bundler/install/gemfile_spec.rb130
-rw-r--r--spec/bundler/install/gems/compact_index_spec.rb722
-rw-r--r--spec/bundler/install/gems/dependency_api_fallback_spec.rb19
-rw-r--r--spec/bundler/install/gems/dependency_api_spec.rb451
-rw-r--r--spec/bundler/install/gems/env_spec.rb36
-rw-r--r--spec/bundler/install/gems/flex_spec.rb337
-rw-r--r--spec/bundler/install/gems/fund_spec.rb63
-rw-r--r--spec/bundler/install/gems/gemfile_source_header_spec.rb24
-rw-r--r--spec/bundler/install/gems/mirror_probe_spec.rb68
-rw-r--r--spec/bundler/install/gems/mirror_spec.rb24
-rw-r--r--spec/bundler/install/gems/native_extensions_spec.rb30
-rw-r--r--spec/bundler/install/gems/no_build_extension_spec.rb54
-rw-r--r--spec/bundler/install/gems/no_install_plugin_spec.rb53
-rw-r--r--spec/bundler/install/gems/post_install_spec.rb48
-rw-r--r--spec/bundler/install/gems/resolving_spec.rb640
-rw-r--r--spec/bundler/install/gems/standalone_spec.rb370
-rw-r--r--spec/bundler/install/gems/sudo_spec.rb190
-rw-r--r--spec/bundler/install/gems/win32_spec.rb10
-rw-r--r--spec/bundler/install/gemspecs_spec.rb80
-rw-r--r--spec/bundler/install/git_spec.rb340
-rw-r--r--spec/bundler/install/global_cache_spec.rb238
-rw-r--r--spec/bundler/install/path_spec.rb156
-rw-r--r--spec/bundler/install/prereleases_spec.rb18
-rw-r--r--spec/bundler/install/process_lock_spec.rb88
-rw-r--r--spec/bundler/install/redownload_spec.rb90
-rw-r--r--spec/bundler/install/security_policy_spec.rb20
-rw-r--r--spec/bundler/install/yanked_spec.rb223
-rw-r--r--spec/bundler/lock/git_spec.rb226
-rw-r--r--spec/bundler/lock/lockfile_spec.rb1880
-rw-r--r--spec/bundler/other/cli_dispatch_spec.rb12
-rw-r--r--spec/bundler/other/cli_man_pages_spec.rb100
-rw-r--r--spec/bundler/other/ext_spec.rb67
-rw-r--r--spec/bundler/other/major_deprecation_spec.rb732
-rw-r--r--spec/bundler/other/platform_spec.rb1272
-rw-r--r--spec/bundler/plugins/command_spec.rb48
-rw-r--r--spec/bundler/plugins/hook_spec.rb256
-rw-r--r--spec/bundler/plugins/install_spec.rb213
-rw-r--r--spec/bundler/plugins/list_spec.rb4
-rw-r--r--spec/bundler/plugins/source/example_spec.rb86
-rw-r--r--spec/bundler/plugins/source_spec.rb16
-rw-r--r--spec/bundler/plugins/uninstall_spec.rb29
-rw-r--r--spec/bundler/quality_es_spec.rb8
-rw-r--r--spec/bundler/quality_spec.rb110
-rw-r--r--spec/bundler/realworld/dependency_api_spec.rb46
-rw-r--r--spec/bundler/realworld/double_check_spec.rb6
-rw-r--r--spec/bundler/realworld/edgecases_spec.rb414
-rw-r--r--spec/bundler/realworld/ffi_spec.rb57
-rw-r--r--spec/bundler/realworld/fixtures/tapioca/Gemfile5
-rw-r--r--spec/bundler/realworld/fixtures/tapioca/Gemfile.lock49
-rw-r--r--spec/bundler/realworld/fixtures/warbler/Gemfile6
-rw-r--r--spec/bundler/realworld/fixtures/warbler/Gemfile.lock30
-rw-r--r--spec/bundler/realworld/gemfile_source_header_spec.rb53
-rw-r--r--spec/bundler/realworld/git_spec.rb11
-rw-r--r--spec/bundler/realworld/mirror_probe_spec.rb144
-rw-r--r--spec/bundler/realworld/parallel_spec.rb10
-rw-r--r--spec/bundler/realworld/slow_perf_spec.rb35
-rw-r--r--spec/bundler/resolver/basic_spec.rb178
-rw-r--r--spec/bundler/resolver/platform_spec.rb291
-rw-r--r--spec/bundler/runtime/env_helpers_spec.rb236
-rw-r--r--spec/bundler/runtime/executable_spec.rb115
-rw-r--r--spec/bundler/runtime/gem_tasks_spec.rb86
-rw-r--r--spec/bundler/runtime/inline_spec.rb489
-rw-r--r--spec/bundler/runtime/load_spec.rb30
-rw-r--r--spec/bundler/runtime/platform_spec.rb370
-rw-r--r--spec/bundler/runtime/require_spec.rb138
-rw-r--r--spec/bundler/runtime/requiring_spec.rb15
-rw-r--r--spec/bundler/runtime/self_management_spec.rb279
-rw-r--r--spec/bundler/runtime/setup_spec.rb961
-rw-r--r--spec/bundler/runtime/with_unbundled_env_spec.rb302
-rw-r--r--spec/bundler/spec_helper.rb144
-rw-r--r--spec/bundler/support/activate.rb9
-rw-r--r--spec/bundler/support/artifice/compact_index.rb118
-rw-r--r--spec/bundler/support/artifice/compact_index_api_missing.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_basic_authentication.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_checksum_mismatch.rb10
-rw-r--r--spec/bundler/support/artifice/compact_index_concurrent_download.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_cooldown.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_creds_diff_host.rb8
-rw-r--r--spec/bundler/support/artifice/compact_index_etag_match.rb16
-rw-r--r--spec/bundler/support/artifice/compact_index_extra.rb35
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_api.rb50
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_api_missing.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_missing.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_forbidden.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_host_redirect.rb8
-rw-r--r--spec/bundler/support/artifice/compact_index_mirror_down.rb21
-rw-r--r--spec/bundler/support/artifice/compact_index_no_checksums.rb16
-rw-r--r--spec/bundler/support/artifice/compact_index_no_gem.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_partial_update.rb8
-rw-r--r--spec/bundler/support/artifice/compact_index_partial_update_bad_digest.rb40
-rw-r--r--spec/bundler/support/artifice/compact_index_partial_update_no_digest_not_incremental.rb42
-rw-r--r--spec/bundler/support/artifice/compact_index_precompiled_before.rb25
-rw-r--r--spec/bundler/support/artifice/compact_index_range_ignored.rb40
-rw-r--r--spec/bundler/support/artifice/compact_index_range_not_satisfiable.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_rate_limited.rb8
-rw-r--r--spec/bundler/support/artifice/compact_index_redirects.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_strict_basic_authentication.rb8
-rw-r--r--spec/bundler/support/artifice/compact_index_wrong_dependencies.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_wrong_gem_checksum.rb9
-rw-r--r--spec/bundler/support/artifice/endpoint.rb95
-rw-r--r--spec/bundler/support/artifice/endpoint_500.rb7
-rw-r--r--spec/bundler/support/artifice/endpoint_api_forbidden.rb6
-rw-r--r--spec/bundler/support/artifice/endpoint_api_missing.rb18
-rw-r--r--spec/bundler/support/artifice/endpoint_basic_authentication.rb6
-rw-r--r--spec/bundler/support/artifice/endpoint_creds_diff_host.rb8
-rw-r--r--spec/bundler/support/artifice/endpoint_extra.rb6
-rw-r--r--spec/bundler/support/artifice/endpoint_extra_api.rb6
-rw-r--r--spec/bundler/support/artifice/endpoint_extra_missing.rb6
-rw-r--r--spec/bundler/support/artifice/endpoint_fallback.rb6
-rw-r--r--spec/bundler/support/artifice/endpoint_host_redirect.rb8
-rw-r--r--spec/bundler/support/artifice/endpoint_marshal_fail.rb11
-rw-r--r--spec/bundler/support/artifice/endpoint_marshal_fail_basic_authentication.rb6
-rw-r--r--spec/bundler/support/artifice/endpoint_mirror_source.rb6
-rw-r--r--spec/bundler/support/artifice/endpoint_redirect.rb6
-rw-r--r--spec/bundler/support/artifice/endpoint_strict_basic_authentication.rb8
-rw-r--r--spec/bundler/support/artifice/endpoint_timeout.rb6
-rw-r--r--spec/bundler/support/artifice/fail.rb25
-rw-r--r--spec/bundler/support/artifice/helpers/artifice.rb30
-rw-r--r--spec/bundler/support/artifice/helpers/compact_index.rb128
-rw-r--r--spec/bundler/support/artifice/helpers/compact_index_cooldown.rb13
-rw-r--r--spec/bundler/support/artifice/helpers/compact_index_extra.rb33
-rw-r--r--spec/bundler/support/artifice/helpers/compact_index_extra_api.rb48
-rw-r--r--spec/bundler/support/artifice/helpers/endpoint.rb113
-rw-r--r--spec/bundler/support/artifice/helpers/endpoint_extra.rb29
-rw-r--r--spec/bundler/support/artifice/helpers/endpoint_fallback.rb15
-rw-r--r--spec/bundler/support/artifice/helpers/endpoint_marshal_fail.rb9
-rw-r--r--spec/bundler/support/artifice/helpers/rack_request.rb100
-rw-r--r--spec/bundler/support/artifice/vcr.rb60
-rw-r--r--spec/bundler/support/artifice/windows.rb11
-rw-r--r--spec/bundler/support/build_metadata.rb20
-rw-r--r--spec/bundler/support/builders.rb420
-rwxr-xr-xspec/bundler/support/bundle6
-rw-r--r--spec/bundler/support/bundle.rb7
-rw-r--r--spec/bundler/support/checksums.rb135
-rw-r--r--spec/bundler/support/command_execution.rb47
-rw-r--r--spec/bundler/support/env.rb13
-rw-r--r--spec/bundler/support/filters.rb42
-rw-r--r--spec/bundler/support/hax.rb82
-rw-r--r--spec/bundler/support/helpers.rb583
-rw-r--r--spec/bundler/support/indexes.rb69
-rw-r--r--spec/bundler/support/matchers.rb104
-rw-r--r--spec/bundler/support/options.rb15
-rw-r--r--spec/bundler/support/path.rb223
-rw-r--r--spec/bundler/support/platforms.rb77
-rw-r--r--spec/bundler/support/rubygems_ext.rb184
-rw-r--r--spec/bundler/support/rubygems_version_manager.rb53
-rw-r--r--spec/bundler/support/setup.rb9
-rw-r--r--spec/bundler/support/shards.rb200
-rw-r--r--spec/bundler/support/silent_logger.rb10
-rw-r--r--spec/bundler/support/sometimes.rb57
-rw-r--r--spec/bundler/support/subprocess.rb115
-rw-r--r--spec/bundler/support/sudo.rb18
-rw-r--r--spec/bundler/support/switch_rubygems.rb1
-rw-r--r--spec/bundler/support/the_bundle.rb16
-rw-r--r--spec/bundler/support/vendored_net_http.rb23
-rw-r--r--spec/bundler/update/force_spec.rb30
-rw-r--r--spec/bundler/update/gemfile_spec.rb26
-rw-r--r--spec/bundler/update/gems/fund_spec.rb22
-rw-r--r--spec/bundler/update/gems/post_install_spec.rb24
-rw-r--r--spec/bundler/update/git_spec.rb185
-rw-r--r--spec/bundler/update/path_spec.rb5
-rw-r--r--spec/bundler/update/redownload_spec.rb34
-rw-r--r--spec/default.mspec151
-rw-r--r--spec/lib/formatter_overrides.rb6
-rw-r--r--spec/lib/spec_coverage.rb1
-rw-r--r--spec/mmtk.mspec12
-rw-r--r--spec/mspec/.rspec1
-rw-r--r--spec/mspec/Gemfile2
-rw-r--r--spec/mspec/Gemfile.lock25
-rw-r--r--spec/mspec/README.md2
-rwxr-xr-xspec/mspec/bin/mspec2
-rw-r--r--[-rwxr-xr-x]spec/mspec/lib/mspec/commands/mkspec.rb18
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-ci.rb5
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-run.rb8
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-tag.rb3
-rw-r--r--[-rwxr-xr-x]spec/mspec/lib/mspec/commands/mspec.rb13
-rw-r--r--spec/mspec/lib/mspec/expectations/expectations.rb4
-rw-r--r--spec/mspec/lib/mspec/expectations/should.rb10
-rw-r--r--spec/mspec/lib/mspec/guards/platform.rb28
-rw-r--r--spec/mspec/lib/mspec/guards/superuser.rb10
-rw-r--r--spec/mspec/lib/mspec/guards/version.rb28
-rw-r--r--spec/mspec/lib/mspec/helpers/datetime.rb1
-rw-r--r--spec/mspec/lib/mspec/helpers/io.rb4
-rw-r--r--spec/mspec/lib/mspec/helpers/numeric.rb30
-rw-r--r--spec/mspec/lib/mspec/helpers/ruby_exe.rb54
-rw-r--r--spec/mspec/lib/mspec/helpers/tmp.rb18
-rw-r--r--spec/mspec/lib/mspec/helpers/warning.rb2
-rw-r--r--spec/mspec/lib/mspec/matchers/base.rb46
-rw-r--r--spec/mspec/lib/mspec/matchers/complain.rb2
-rw-r--r--spec/mspec/lib/mspec/matchers/match_yaml.rb6
-rw-r--r--spec/mspec/lib/mspec/matchers/output.rb8
-rw-r--r--spec/mspec/lib/mspec/matchers/raise_error.rb71
-rw-r--r--spec/mspec/lib/mspec/mocks/mock.rb25
-rw-r--r--spec/mspec/lib/mspec/runner/actions/leakchecker.rb67
-rw-r--r--spec/mspec/lib/mspec/runner/actions/timeout.rb89
-rw-r--r--spec/mspec/lib/mspec/runner/context.rb1
-rw-r--r--spec/mspec/lib/mspec/runner/exception.rb2
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/base.rb34
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/junit.rb6
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/launchable.rb88
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/multi.rb2
-rw-r--r--spec/mspec/lib/mspec/runner/mspec.rb12
-rw-r--r--spec/mspec/lib/mspec/runner/shared.rb8
-rw-r--r--spec/mspec/lib/mspec/utils/name_map.rb20
-rw-r--r--spec/mspec/lib/mspec/utils/options.rb34
-rw-r--r--spec/mspec/lib/mspec/utils/script.rb28
-rw-r--r--spec/mspec/lib/mspec/utils/warnings.rb43
-rw-r--r--spec/mspec/spec/commands/mkspec_spec.rb196
-rw-r--r--spec/mspec/spec/commands/mspec_ci_spec.rb77
-rw-r--r--spec/mspec/spec/commands/mspec_run_spec.rb79
-rw-r--r--spec/mspec/spec/commands/mspec_spec.rb119
-rw-r--r--spec/mspec/spec/commands/mspec_tag_spec.rb170
-rw-r--r--spec/mspec/spec/expectations/expectations_spec.rb18
-rw-r--r--spec/mspec/spec/expectations/should.rb73
-rw-r--r--spec/mspec/spec/expectations/should_spec.rb18
-rw-r--r--spec/mspec/spec/fixtures/should.rb75
-rw-r--r--spec/mspec/spec/guards/block_device_spec.rb26
-rw-r--r--spec/mspec/spec/guards/bug_spec.rb84
-rw-r--r--spec/mspec/spec/guards/conflict_spec.rb30
-rw-r--r--spec/mspec/spec/guards/endian_spec.rb34
-rw-r--r--spec/mspec/spec/guards/feature_spec.rb82
-rw-r--r--spec/mspec/spec/guards/guard_spec.rb218
-rw-r--r--spec/mspec/spec/guards/platform_spec.rb208
-rw-r--r--spec/mspec/spec/guards/quarantine_spec.rb20
-rw-r--r--spec/mspec/spec/guards/superuser_spec.rb22
-rw-r--r--spec/mspec/spec/guards/support_spec.rb28
-rw-r--r--spec/mspec/spec/guards/user_spec.rb10
-rw-r--r--spec/mspec/spec/guards/version_spec.rb92
-rw-r--r--spec/mspec/spec/helpers/argf_spec.rb16
-rw-r--r--spec/mspec/spec/helpers/argv_spec.rb10
-rw-r--r--spec/mspec/spec/helpers/datetime_spec.rb18
-rw-r--r--spec/mspec/spec/helpers/fixture_spec.rb8
-rw-r--r--spec/mspec/spec/helpers/flunk_spec.rb10
-rw-r--r--spec/mspec/spec/helpers/fs_spec.rb60
-rw-r--r--spec/mspec/spec/helpers/io_spec.rb48
-rw-r--r--spec/mspec/spec/helpers/mock_to_path_spec.rb14
-rw-r--r--spec/mspec/spec/helpers/numeric_spec.rb20
-rw-r--r--spec/mspec/spec/helpers/ruby_exe_spec.rb165
-rw-r--r--spec/mspec/spec/helpers/scratch_spec.rb10
-rw-r--r--spec/mspec/spec/helpers/suppress_warning_spec.rb4
-rw-r--r--spec/mspec/spec/helpers/tmp_spec.rb10
-rw-r--r--spec/mspec/spec/integration/interpreter_spec.rb8
-rw-r--r--spec/mspec/spec/integration/object_methods_spec.rb6
-rw-r--r--spec/mspec/spec/integration/run_spec.rb43
-rw-r--r--spec/mspec/spec/integration/tag_spec.rb19
-rw-r--r--spec/mspec/spec/matchers/base_spec.rb140
-rw-r--r--spec/mspec/spec/matchers/be_an_instance_of_spec.rb22
-rw-r--r--spec/mspec/spec/matchers/be_ancestor_of_spec.rb10
-rw-r--r--spec/mspec/spec/matchers/be_close_spec.rb24
-rw-r--r--spec/mspec/spec/matchers/be_computed_by_spec.rb14
-rw-r--r--spec/mspec/spec/matchers/be_empty_spec.rb10
-rw-r--r--spec/mspec/spec/matchers/be_false_spec.rb16
-rw-r--r--spec/mspec/spec/matchers/be_kind_of_spec.rb22
-rw-r--r--spec/mspec/spec/matchers/be_nan_spec.rb12
-rw-r--r--spec/mspec/spec/matchers/be_nil_spec.rb14
-rw-r--r--spec/mspec/spec/matchers/be_true_or_false_spec.rb8
-rw-r--r--spec/mspec/spec/matchers/be_true_spec.rb16
-rw-r--r--spec/mspec/spec/matchers/block_caller_spec.rb6
-rw-r--r--spec/mspec/spec/matchers/complain_spec.rb43
-rw-r--r--spec/mspec/spec/matchers/eql_spec.rb22
-rw-r--r--spec/mspec/spec/matchers/equal_element_spec.rb78
-rw-r--r--spec/mspec/spec/matchers/equal_spec.rb20
-rw-r--r--spec/mspec/spec/matchers/have_class_variable_spec.rb18
-rw-r--r--spec/mspec/spec/matchers/have_constant_spec.rb14
-rw-r--r--spec/mspec/spec/matchers/have_instance_method_spec.rb20
-rw-r--r--spec/mspec/spec/matchers/have_instance_variable_spec.rb18
-rw-r--r--spec/mspec/spec/matchers/have_method_spec.rb24
-rw-r--r--spec/mspec/spec/matchers/have_private_instance_method_spec.rb20
-rw-r--r--spec/mspec/spec/matchers/have_private_method_spec.rb16
-rw-r--r--spec/mspec/spec/matchers/have_protected_instance_method_spec.rb20
-rw-r--r--spec/mspec/spec/matchers/have_public_instance_method_spec.rb20
-rw-r--r--spec/mspec/spec/matchers/have_singleton_method_spec.rb16
-rw-r--r--spec/mspec/spec/matchers/include_any_of_spec.rb26
-rw-r--r--spec/mspec/spec/matchers/include_spec.rb22
-rw-r--r--spec/mspec/spec/matchers/infinity_spec.rb18
-rw-r--r--spec/mspec/spec/matchers/match_yaml_spec.rb22
-rw-r--r--spec/mspec/spec/matchers/output_spec.rb48
-rw-r--r--spec/mspec/spec/matchers/output_to_fd_spec.rb30
-rw-r--r--spec/mspec/spec/matchers/raise_error_spec.rb163
-rw-r--r--spec/mspec/spec/matchers/respond_to_spec.rb26
-rw-r--r--spec/mspec/spec/matchers/signed_zero_spec.rb18
-rw-r--r--spec/mspec/spec/mocks/mock_spec.rb241
-rw-r--r--spec/mspec/spec/mocks/proxy_spec.rb196
-rw-r--r--spec/mspec/spec/runner/actions/filter_spec.rb44
-rw-r--r--spec/mspec/spec/runner/actions/tag_spec.rb144
-rw-r--r--spec/mspec/spec/runner/actions/taglist_spec.rb70
-rw-r--r--spec/mspec/spec/runner/actions/tagpurge_spec.rb66
-rw-r--r--spec/mspec/spec/runner/actions/tally_spec.rb167
-rw-r--r--spec/mspec/spec/runner/actions/timer_spec.rb22
-rw-r--r--spec/mspec/spec/runner/context_spec.rb342
-rw-r--r--spec/mspec/spec/runner/example_spec.rb50
-rw-r--r--spec/mspec/spec/runner/exception_spec.rb50
-rw-r--r--spec/mspec/spec/runner/filters/match_spec.rb16
-rw-r--r--spec/mspec/spec/runner/filters/profile_spec.rb70
-rw-r--r--spec/mspec/spec/runner/filters/regexp_spec.rb18
-rw-r--r--spec/mspec/spec/runner/filters/tag_spec.rb48
-rw-r--r--spec/mspec/spec/runner/formatters/describe_spec.rb24
-rw-r--r--spec/mspec/spec/runner/formatters/dotted_spec.rb119
-rw-r--r--spec/mspec/spec/runner/formatters/file_spec.rb34
-rw-r--r--spec/mspec/spec/runner/formatters/html_spec.rb88
-rw-r--r--spec/mspec/spec/runner/formatters/junit_spec.rb100
-rw-r--r--spec/mspec/spec/runner/formatters/method_spec.rb69
-rw-r--r--spec/mspec/spec/runner/formatters/multi_spec.rb20
-rw-r--r--spec/mspec/spec/runner/formatters/specdoc_spec.rb30
-rw-r--r--spec/mspec/spec/runner/formatters/spinner_spec.rb32
-rw-r--r--spec/mspec/spec/runner/formatters/summary_spec.rb4
-rw-r--r--spec/mspec/spec/runner/formatters/unit_spec.rb33
-rw-r--r--spec/mspec/spec/runner/formatters/yaml_spec.rb79
-rw-r--r--spec/mspec/spec/runner/mspec_spec.rb287
-rw-r--r--spec/mspec/spec/runner/shared_spec.rb20
-rw-r--r--spec/mspec/spec/runner/tag_spec.rb96
-rw-r--r--spec/mspec/spec/spec_helper.rb23
-rw-r--r--spec/mspec/spec/utils/deprecate_spec.rb10
-rw-r--r--spec/mspec/spec/utils/fixtures/this_file_raises.rb1
-rw-r--r--spec/mspec/spec/utils/fixtures/this_file_raises2.rb1
-rw-r--r--spec/mspec/spec/utils/name_map_spec.rb90
-rw-r--r--spec/mspec/spec/utils/options_spec.rb476
-rw-r--r--spec/mspec/spec/utils/script_spec.rb255
-rw-r--r--spec/mspec/spec/utils/version_spec.rb30
-rwxr-xr-xspec/mspec/tool/check_require_spec_helper.rb34
-rwxr-xr-x[-rw-r--r--]spec/mspec/tool/remove_old_guards.rb91
-rw-r--r--spec/mspec/tool/sync/sync-rubyspec.rb61
-rwxr-xr-xspec/mspec/tool/tag_from_output.rb39
-rw-r--r--spec/ruby/.mspec.constants5
-rw-r--r--spec/ruby/.rubocop.yml77
-rw-r--r--spec/ruby/.rubocop_todo.yml80
-rw-r--r--spec/ruby/CONTRIBUTING.md97
-rw-r--r--spec/ruby/README.md39
-rwxr-xr-xspec/ruby/bin/rubocop12
-rw-r--r--spec/ruby/command_line/backtrace_limit_spec.rb93
-rwxr-xr-xspec/ruby/command_line/dash_0_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_a_spec.rb4
-rw-r--r--spec/ruby/command_line/dash_encoding_spec.rb8
-rw-r--r--spec/ruby/command_line/dash_l_spec.rb8
-rw-r--r--spec/ruby/command_line/dash_n_spec.rb8
-rw-r--r--spec/ruby/command_line/dash_p_spec.rb4
-rw-r--r--spec/ruby/command_line/dash_r_spec.rb10
-rw-r--r--spec/ruby/command_line/dash_upper_e_spec.rb3
-rw-r--r--spec/ruby/command_line/dash_upper_f_spec.rb2
-rw-r--r--spec/ruby/command_line/dash_upper_i_spec.rb10
-rw-r--r--spec/ruby/command_line/dash_upper_s_spec.rb42
-rw-r--r--spec/ruby/command_line/dash_upper_u_spec.rb37
-rw-r--r--spec/ruby/command_line/dash_upper_w_spec.rb42
-rw-r--r--spec/ruby/command_line/dash_v_spec.rb7
-rw-r--r--spec/ruby/command_line/dash_w_spec.rb4
-rw-r--r--spec/ruby/command_line/dash_x_spec.rb4
-rw-r--r--spec/ruby/command_line/error_message_spec.rb9
-rw-r--r--spec/ruby/command_line/feature_spec.rb28
-rw-r--r--spec/ruby/command_line/fixtures/backtrace.rb35
-rw-r--r--spec/ruby/command_line/fixtures/bin/bad_embedded_ruby.txt2
-rw-r--r--spec/ruby/command_line/fixtures/bin/embedded_ruby.txt4
-rw-r--r--spec/ruby/command_line/fixtures/debug_info.rb1
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_required_diff_enc.rbbin121 -> 90 bytes-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_two_literals.rb2
-rw-r--r--spec/ruby/command_line/fixtures/string_literal_frozen_comment.rb4
-rw-r--r--spec/ruby/command_line/fixtures/string_literal_mutable_comment.rb4
-rw-r--r--spec/ruby/command_line/fixtures/string_literal_raw.rb3
-rw-r--r--spec/ruby/command_line/frozen_strings_spec.rb73
-rw-r--r--spec/ruby/command_line/rubylib_spec.rb16
-rw-r--r--spec/ruby/command_line/rubyopt_spec.rb90
-rw-r--r--spec/ruby/command_line/syntax_error_spec.rb8
-rw-r--r--spec/ruby/core/argf/argf_spec.rb4
-rw-r--r--spec/ruby/core/argf/argv_spec.rb2
-rw-r--r--spec/ruby/core/argf/binmode_spec.rb2
-rw-r--r--spec/ruby/core/argf/bytes_spec.rb16
-rw-r--r--spec/ruby/core/argf/chars_spec.rb16
-rw-r--r--spec/ruby/core/argf/close_spec.rb8
-rw-r--r--spec/ruby/core/argf/closed_spec.rb2
-rw-r--r--spec/ruby/core/argf/codepoints_spec.rb16
-rw-r--r--spec/ruby/core/argf/each_byte_spec.rb58
-rw-r--r--spec/ruby/core/argf/each_char_spec.rb58
-rw-r--r--spec/ruby/core/argf/each_codepoint_spec.rb58
-rw-r--r--spec/ruby/core/argf/each_line_spec.rb62
-rw-r--r--spec/ruby/core/argf/each_spec.rb5
-rw-r--r--spec/ruby/core/argf/eof_spec.rb28
-rw-r--r--spec/ruby/core/argf/filename_spec.rb28
-rw-r--r--spec/ruby/core/argf/fileno_spec.rb24
-rw-r--r--spec/ruby/core/argf/inspect_spec.rb7
-rw-r--r--spec/ruby/core/argf/lines_spec.rb16
-rw-r--r--spec/ruby/core/argf/path_spec.rb5
-rw-r--r--spec/ruby/core/argf/pos_spec.rb31
-rw-r--r--spec/ruby/core/argf/read_nonblock_spec.rb2
-rw-r--r--spec/ruby/core/argf/readchar_spec.rb2
-rw-r--r--spec/ruby/core/argf/readline_spec.rb2
-rw-r--r--spec/ruby/core/argf/readlines_spec.rb22
-rw-r--r--spec/ruby/core/argf/readpartial_spec.rb10
-rw-r--r--spec/ruby/core/argf/rewind_spec.rb2
-rw-r--r--spec/ruby/core/argf/seek_spec.rb2
-rw-r--r--spec/ruby/core/argf/shared/each_byte.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_char.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_codepoint.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_line.rb62
-rw-r--r--spec/ruby/core/argf/shared/eof.rb24
-rw-r--r--spec/ruby/core/argf/shared/filename.rb28
-rw-r--r--spec/ruby/core/argf/shared/fileno.rb24
-rw-r--r--spec/ruby/core/argf/shared/getc.rb2
-rw-r--r--spec/ruby/core/argf/shared/pos.rb31
-rw-r--r--spec/ruby/core/argf/shared/read.rb4
-rw-r--r--spec/ruby/core/argf/shared/readlines.rb22
-rw-r--r--spec/ruby/core/argf/skip_spec.rb2
-rw-r--r--spec/ruby/core/argf/tell_spec.rb5
-rw-r--r--spec/ruby/core/argf/to_a_spec.rb5
-rw-r--r--spec/ruby/core/argf/to_i_spec.rb5
-rw-r--r--spec/ruby/core/argf/to_io_spec.rb2
-rw-r--r--spec/ruby/core/array/all_spec.rb13
-rw-r--r--spec/ruby/core/array/allocate_spec.rb4
-rw-r--r--spec/ruby/core/array/any_spec.rb12
-rw-r--r--spec/ruby/core/array/append_spec.rb11
-rw-r--r--spec/ruby/core/array/assoc_spec.rb40
-rw-r--r--spec/ruby/core/array/at_spec.rb4
-rw-r--r--spec/ruby/core/array/bsearch_index_spec.rb32
-rw-r--r--spec/ruby/core/array/bsearch_spec.rb26
-rw-r--r--spec/ruby/core/array/clear_spec.rb28
-rw-r--r--spec/ruby/core/array/clone_spec.rb8
-rw-r--r--spec/ruby/core/array/collect_spec.rb138
-rw-r--r--spec/ruby/core/array/combination_spec.rb6
-rw-r--r--spec/ruby/core/array/compact_spec.rb44
-rw-r--r--spec/ruby/core/array/comparison_spec.rb2
-rw-r--r--spec/ruby/core/array/concat_spec.rb68
-rw-r--r--spec/ruby/core/array/constructor_spec.rb4
-rw-r--r--spec/ruby/core/array/count_spec.rb11
-rw-r--r--spec/ruby/core/array/cycle_spec.rb20
-rw-r--r--spec/ruby/core/array/deconstruct_spec.rb10
-rw-r--r--spec/ruby/core/array/delete_at_spec.rb24
-rw-r--r--spec/ruby/core/array/delete_if_spec.rb52
-rw-r--r--spec/ruby/core/array/delete_spec.rb24
-rw-r--r--spec/ruby/core/array/difference_spec.rb28
-rw-r--r--spec/ruby/core/array/dig_spec.rb8
-rw-r--r--spec/ruby/core/array/drop_spec.rb11
-rw-r--r--spec/ruby/core/array/drop_while_spec.rb9
-rw-r--r--spec/ruby/core/array/dup_spec.rb12
-rw-r--r--spec/ruby/core/array/each_index_spec.rb20
-rw-r--r--spec/ruby/core/array/each_spec.rb42
-rw-r--r--spec/ruby/core/array/element_reference_spec.rb861
-rw-r--r--spec/ruby/core/array/element_set_spec.rb192
-rw-r--r--spec/ruby/core/array/eql_spec.rb4
-rw-r--r--spec/ruby/core/array/equal_value_spec.rb10
-rw-r--r--spec/ruby/core/array/fetch_spec.rb10
-rw-r--r--spec/ruby/core/array/fetch_values_spec.rb55
-rw-r--r--spec/ruby/core/array/fill_spec.rb152
-rw-r--r--spec/ruby/core/array/filter_spec.rb17
-rw-r--r--spec/ruby/core/array/find_index_spec.rb40
-rw-r--r--spec/ruby/core/array/first_spec.rb24
-rw-r--r--spec/ruby/core/array/fixtures/classes.rb790
-rw-r--r--spec/ruby/core/array/fixtures/encoded_strings.rb18
-rw-r--r--spec/ruby/core/array/flatten_spec.rb62
-rw-r--r--spec/ruby/core/array/hash_spec.rb8
-rw-r--r--spec/ruby/core/array/index_spec.rb5
-rw-r--r--spec/ruby/core/array/initialize_spec.rb34
-rw-r--r--spec/ruby/core/array/insert_spec.rb14
-rw-r--r--spec/ruby/core/array/inspect_spec.rb105
-rw-r--r--spec/ruby/core/array/intersect_spec.rb64
-rw-r--r--spec/ruby/core/array/intersection_spec.rb16
-rw-r--r--spec/ruby/core/array/join_spec.rb102
-rw-r--r--spec/ruby/core/array/keep_if_spec.rb3
-rw-r--r--spec/ruby/core/array/last_spec.rb22
-rw-r--r--spec/ruby/core/array/length_spec.rb11
-rw-r--r--spec/ruby/core/array/map_spec.rb10
-rw-r--r--spec/ruby/core/array/max_spec.rb8
-rw-r--r--spec/ruby/core/array/min_spec.rb10
-rw-r--r--spec/ruby/core/array/multiply_spec.rb74
-rw-r--r--spec/ruby/core/array/new_spec.rb30
-rw-r--r--spec/ruby/core/array/none_spec.rb13
-rw-r--r--spec/ruby/core/array/one_spec.rb13
-rw-r--r--spec/ruby/core/array/pack/a_spec.rb17
-rw-r--r--spec/ruby/core/array/pack/at_spec.rb2
-rw-r--r--spec/ruby/core/array/pack/b_spec.rb9
-rw-r--r--spec/ruby/core/array/pack/buffer_spec.rb26
-rw-r--r--spec/ruby/core/array/pack/c_spec.rb8
-rw-r--r--spec/ruby/core/array/pack/comment_spec.rb2
-rw-r--r--spec/ruby/core/array/pack/h_spec.rb7
-rw-r--r--spec/ruby/core/array/pack/l_spec.rb16
-rw-r--r--spec/ruby/core/array/pack/m_spec.rb24
-rw-r--r--spec/ruby/core/array/pack/p_spec.rb24
-rw-r--r--spec/ruby/core/array/pack/percent_spec.rb2
-rw-r--r--spec/ruby/core/array/pack/r_spec.rb89
-rw-r--r--spec/ruby/core/array/pack/shared/basic.rb46
-rw-r--r--spec/ruby/core/array/pack/shared/encodings.rb4
-rw-r--r--spec/ruby/core/array/pack/shared/float.rb60
-rw-r--r--spec/ruby/core/array/pack/shared/integer.rb48
-rw-r--r--spec/ruby/core/array/pack/shared/numeric_basic.rb24
-rw-r--r--spec/ruby/core/array/pack/shared/string.rb10
-rw-r--r--spec/ruby/core/array/pack/shared/taint.rb33
-rw-r--r--spec/ruby/core/array/pack/shared/unicode.rb14
-rw-r--r--spec/ruby/core/array/pack/u_spec.rb20
-rw-r--r--spec/ruby/core/array/pack/w_spec.rb10
-rw-r--r--spec/ruby/core/array/pack/x_spec.rb7
-rw-r--r--spec/ruby/core/array/pack/z_spec.rb14
-rw-r--r--spec/ruby/core/array/partition_spec.rb6
-rw-r--r--spec/ruby/core/array/permutation_spec.rb10
-rw-r--r--spec/ruby/core/array/plus_spec.rb43
-rw-r--r--spec/ruby/core/array/pop_spec.rb76
-rw-r--r--spec/ruby/core/array/prepend_spec.rb6
-rw-r--r--spec/ruby/core/array/product_spec.rb19
-rw-r--r--spec/ruby/core/array/push_spec.rb33
-rw-r--r--spec/ruby/core/array/rassoc_spec.rb16
-rw-r--r--spec/ruby/core/array/reject_spec.rb29
-rw-r--r--spec/ruby/core/array/repeated_combination_spec.rb8
-rw-r--r--spec/ruby/core/array/repeated_permutation_spec.rb4
-rw-r--r--spec/ruby/core/array/replace_spec.rb60
-rw-r--r--spec/ruby/core/array/reverse_each_spec.rb18
-rw-r--r--spec/ruby/core/array/reverse_spec.rb6
-rw-r--r--spec/ruby/core/array/rindex_spec.rb21
-rw-r--r--spec/ruby/core/array/rotate_spec.rb42
-rw-r--r--spec/ruby/core/array/sample_spec.rb61
-rw-r--r--spec/ruby/core/array/select_spec.rb35
-rw-r--r--spec/ruby/core/array/shared/clone.rb32
-rw-r--r--spec/ruby/core/array/shared/collect.rb140
-rw-r--r--spec/ruby/core/array/shared/difference.rb8
-rw-r--r--spec/ruby/core/array/shared/enumeratorize.rb2
-rw-r--r--spec/ruby/core/array/shared/eql.rb66
-rw-r--r--spec/ruby/core/array/shared/index.rb37
-rw-r--r--spec/ruby/core/array/shared/inspect.rb133
-rw-r--r--spec/ruby/core/array/shared/intersection.rb9
-rw-r--r--spec/ruby/core/array/shared/iterable_and_tolerating_size_increasing.rb25
-rw-r--r--spec/ruby/core/array/shared/join.rb166
-rw-r--r--spec/ruby/core/array/shared/keep_if.rb49
-rw-r--r--spec/ruby/core/array/shared/length.rb11
-rw-r--r--spec/ruby/core/array/shared/push.rb33
-rw-r--r--spec/ruby/core/array/shared/replace.rb60
-rw-r--r--spec/ruby/core/array/shared/select.rb32
-rw-r--r--spec/ruby/core/array/shared/slice.rb560
-rw-r--r--spec/ruby/core/array/shared/union.rb6
-rw-r--r--spec/ruby/core/array/shared/unshift.rb46
-rw-r--r--spec/ruby/core/array/shift_spec.rb36
-rw-r--r--spec/ruby/core/array/shuffle_spec.rb51
-rw-r--r--spec/ruby/core/array/size_spec.rb6
-rw-r--r--spec/ruby/core/array/slice_spec.rb83
-rw-r--r--spec/ruby/core/array/sort_by_spec.rb47
-rw-r--r--spec/ruby/core/array/sort_spec.rb40
-rw-r--r--spec/ruby/core/array/sum_spec.rb50
-rw-r--r--spec/ruby/core/array/take_spec.rb7
-rw-r--r--spec/ruby/core/array/take_while_spec.rb11
-rw-r--r--spec/ruby/core/array/to_a_spec.rb4
-rw-r--r--spec/ruby/core/array/to_ary_spec.rb4
-rw-r--r--spec/ruby/core/array/to_h_spec.rb92
-rw-r--r--spec/ruby/core/array/to_s_spec.rb7
-rw-r--r--spec/ruby/core/array/transpose_spec.rb10
-rw-r--r--spec/ruby/core/array/try_convert_spec.rb16
-rw-r--r--spec/ruby/core/array/union_spec.rb26
-rw-r--r--spec/ruby/core/array/uniq_spec.rb132
-rw-r--r--spec/ruby/core/array/unshift_spec.rb64
-rw-r--r--spec/ruby/core/array/values_at_spec.rb19
-rw-r--r--spec/ruby/core/array/zip_spec.rb8
-rw-r--r--spec/ruby/core/basicobject/__send___spec.rb2
-rw-r--r--spec/ruby/core/basicobject/basicobject_spec.rb20
-rw-r--r--spec/ruby/core/basicobject/equal_spec.rb20
-rw-r--r--spec/ruby/core/basicobject/equal_value_spec.rb2
-rw-r--r--spec/ruby/core/basicobject/fixtures/classes.rb228
-rw-r--r--spec/ruby/core/basicobject/initialize_spec.rb4
-rw-r--r--spec/ruby/core/basicobject/instance_eval_spec.rb203
-rw-r--r--spec/ruby/core/basicobject/instance_exec_spec.rb48
-rw-r--r--spec/ruby/core/basicobject/method_missing_spec.rb3
-rw-r--r--spec/ruby/core/basicobject/not_equal_spec.rb16
-rw-r--r--spec/ruby/core/basicobject/not_spec.rb4
-rw-r--r--spec/ruby/core/basicobject/singleton_method_added_spec.rb65
-rw-r--r--spec/ruby/core/basicobject/singleton_method_removed_spec.rb2
-rw-r--r--spec/ruby/core/basicobject/singleton_method_undefined_spec.rb2
-rw-r--r--spec/ruby/core/binding/clone_spec.rb6
-rw-r--r--spec/ruby/core/binding/dup_spec.rb23
-rw-r--r--spec/ruby/core/binding/eval_spec.rb91
-rw-r--r--spec/ruby/core/binding/fixtures/irb.rb3
-rw-r--r--spec/ruby/core/binding/fixtures/irbrc1
-rw-r--r--spec/ruby/core/binding/irb_spec.rb16
-rw-r--r--spec/ruby/core/binding/local_variable_get_spec.rb10
-rw-r--r--spec/ruby/core/binding/local_variable_set_spec.rb8
-rw-r--r--spec/ruby/core/binding/local_variables_spec.rb2
-rw-r--r--spec/ruby/core/binding/shared/clone.rb22
-rw-r--r--spec/ruby/core/binding/source_location_spec.rb15
-rw-r--r--spec/ruby/core/builtin_constants/builtin_constants_spec.rb120
-rw-r--r--spec/ruby/core/class/allocate_spec.rb6
-rw-r--r--spec/ruby/core/class/attached_object_spec.rb29
-rw-r--r--spec/ruby/core/class/dup_spec.rb7
-rw-r--r--spec/ruby/core/class/inherited_spec.rb21
-rw-r--r--spec/ruby/core/class/initialize_spec.rb10
-rw-r--r--spec/ruby/core/class/new_spec.rb24
-rw-r--r--spec/ruby/core/class/subclasses_spec.rb85
-rw-r--r--spec/ruby/core/class/superclass_spec.rb2
-rw-r--r--spec/ruby/core/comparable/clamp_spec.rb201
-rw-r--r--spec/ruby/core/comparable/equal_value_spec.rb10
-rw-r--r--spec/ruby/core/comparable/fixtures/classes.rb1
-rw-r--r--spec/ruby/core/comparable/gt_spec.rb2
-rw-r--r--spec/ruby/core/comparable/gte_spec.rb2
-rw-r--r--spec/ruby/core/comparable/lt_spec.rb6
-rw-r--r--spec/ruby/core/comparable/lte_spec.rb2
-rw-r--r--spec/ruby/core/complex/abs_spec.rb10
-rw-r--r--spec/ruby/core/complex/angle_spec.rb5
-rw-r--r--spec/ruby/core/complex/arg_spec.rb9
-rw-r--r--spec/ruby/core/complex/coerce_spec.rb32
-rw-r--r--spec/ruby/core/complex/comparision_spec.rb27
-rw-r--r--spec/ruby/core/complex/comparison_spec.rb25
-rw-r--r--spec/ruby/core/complex/conj_spec.rb5
-rw-r--r--spec/ruby/core/complex/conjugate_spec.rb8
-rw-r--r--spec/ruby/core/complex/constants_spec.rb2
-rw-r--r--spec/ruby/core/complex/divide_spec.rb82
-rw-r--r--spec/ruby/core/complex/eql_spec.rb12
-rw-r--r--spec/ruby/core/complex/equal_value_spec.rb10
-rw-r--r--spec/ruby/core/complex/exponent_spec.rb4
-rw-r--r--spec/ruby/core/complex/fdiv_spec.rb42
-rw-r--r--spec/ruby/core/complex/imag_spec.rb5
-rw-r--r--spec/ruby/core/complex/imaginary_spec.rb8
-rw-r--r--spec/ruby/core/complex/inspect_spec.rb21
-rw-r--r--spec/ruby/core/complex/integer_spec.rb4
-rw-r--r--spec/ruby/core/complex/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/complex/marshal_dump_spec.rb2
-rw-r--r--spec/ruby/core/complex/negative_spec.rb4
-rw-r--r--spec/ruby/core/complex/phase_spec.rb5
-rw-r--r--spec/ruby/core/complex/polar_spec.rb18
-rw-r--r--spec/ruby/core/complex/positive_spec.rb4
-rw-r--r--spec/ruby/core/complex/quo_spec.rb5
-rw-r--r--spec/ruby/core/complex/rationalize_spec.rb8
-rw-r--r--spec/ruby/core/complex/real_spec.rb8
-rw-r--r--spec/ruby/core/complex/rect_spec.rb9
-rw-r--r--spec/ruby/core/complex/rectangular_spec.rb110
-rw-r--r--spec/ruby/core/complex/shared/abs.rb10
-rw-r--r--spec/ruby/core/complex/shared/arg.rb9
-rw-r--r--spec/ruby/core/complex/shared/conjugate.rb8
-rw-r--r--spec/ruby/core/complex/shared/divide.rb82
-rw-r--r--spec/ruby/core/complex/shared/image.rb8
-rw-r--r--spec/ruby/core/complex/shared/rect.rb94
-rw-r--r--spec/ruby/core/complex/to_c_spec.rb2
-rw-r--r--spec/ruby/core/complex/to_f_spec.rb4
-rw-r--r--spec/ruby/core/complex/to_i_spec.rb4
-rw-r--r--spec/ruby/core/complex/to_r_spec.rb14
-rw-r--r--spec/ruby/core/complex/to_s_spec.rb11
-rw-r--r--spec/ruby/core/conditionvariable/broadcast_spec.rb39
-rw-r--r--spec/ruby/core/conditionvariable/marshal_dump_spec.rb8
-rw-r--r--spec/ruby/core/conditionvariable/signal_spec.rb76
-rw-r--r--spec/ruby/core/conditionvariable/wait_spec.rb174
-rw-r--r--spec/ruby/core/data/constants_spec.rb22
-rw-r--r--spec/ruby/core/data/deconstruct_keys_spec.rb110
-rw-r--r--spec/ruby/core/data/deconstruct_spec.rb8
-rw-r--r--spec/ruby/core/data/define_spec.rb34
-rw-r--r--spec/ruby/core/data/eql_spec.rb63
-rw-r--r--spec/ruby/core/data/equal_value_spec.rb63
-rw-r--r--spec/ruby/core/data/fixtures/classes.rb41
-rw-r--r--spec/ruby/core/data/hash_spec.rb25
-rw-r--r--spec/ruby/core/data/initialize_spec.rb204
-rw-r--r--spec/ruby/core/data/inspect_spec.rb63
-rw-r--r--spec/ruby/core/data/members_spec.rb21
-rw-r--r--spec/ruby/core/data/to_h_spec.rb63
-rw-r--r--spec/ruby/core/data/to_s_spec.rb9
-rw-r--r--spec/ruby/core/data/with_spec.rb55
-rw-r--r--spec/ruby/core/dir/chdir_spec.rb126
-rw-r--r--spec/ruby/core/dir/children_spec.rb125
-rw-r--r--spec/ruby/core/dir/chroot_spec.rb6
-rw-r--r--spec/ruby/core/dir/close_spec.rb42
-rw-r--r--spec/ruby/core/dir/each_child_spec.rb94
-rw-r--r--spec/ruby/core/dir/each_spec.rb15
-rw-r--r--spec/ruby/core/dir/empty_spec.rb8
-rw-r--r--spec/ruby/core/dir/entries_spec.rb16
-rw-r--r--spec/ruby/core/dir/exist_spec.rb63
-rw-r--r--spec/ruby/core/dir/fchdir_spec.rb71
-rw-r--r--spec/ruby/core/dir/fileno_spec.rb4
-rw-r--r--spec/ruby/core/dir/fixtures/common.rb65
-rw-r--r--spec/ruby/core/dir/for_fd_spec.rb77
-rw-r--r--spec/ruby/core/dir/foreach_spec.rb18
-rw-r--r--spec/ruby/core/dir/getwd_spec.rb12
-rw-r--r--spec/ruby/core/dir/glob_spec.rb188
-rw-r--r--spec/ruby/core/dir/home_spec.rb54
-rw-r--r--spec/ruby/core/dir/inspect_spec.rb4
-rw-r--r--spec/ruby/core/dir/mkdir_spec.rb26
-rw-r--r--spec/ruby/core/dir/open_spec.rb73
-rw-r--r--spec/ruby/core/dir/path_spec.rb26
-rw-r--r--spec/ruby/core/dir/pos_spec.rb23
-rw-r--r--spec/ruby/core/dir/pwd_spec.rb45
-rw-r--r--spec/ruby/core/dir/read_spec.rb35
-rw-r--r--spec/ruby/core/dir/scan_spec.rb224
-rw-r--r--spec/ruby/core/dir/shared/chroot.rb15
-rw-r--r--spec/ruby/core/dir/shared/closed.rb2
-rw-r--r--spec/ruby/core/dir/shared/delete.rb24
-rw-r--r--spec/ruby/core/dir/shared/exist.rb56
-rw-r--r--spec/ruby/core/dir/shared/glob.rb77
-rw-r--r--spec/ruby/core/dir/shared/open.rb73
-rw-r--r--spec/ruby/core/dir/shared/path.rb30
-rw-r--r--spec/ruby/core/dir/shared/pos.rb27
-rw-r--r--spec/ruby/core/dir/shared/pwd.rb45
-rw-r--r--spec/ruby/core/dir/tell_spec.rb27
-rw-r--r--spec/ruby/core/dir/to_path_spec.rb12
-rw-r--r--spec/ruby/core/encoding/aliases_spec.rb10
-rw-r--r--spec/ruby/core/encoding/ascii_compatible_spec.rb15
-rw-r--r--spec/ruby/core/encoding/compatible_spec.rb499
-rw-r--r--spec/ruby/core/encoding/converter/asciicompat_encoding_spec.rb6
-rw-r--r--spec/ruby/core/encoding/converter/constants_spec.rb52
-rw-r--r--spec/ruby/core/encoding/converter/convert_spec.rb22
-rw-r--r--spec/ruby/core/encoding/converter/finish_spec.rb6
-rw-r--r--spec/ruby/core/encoding/converter/last_error_spec.rb50
-rw-r--r--spec/ruby/core/encoding/converter/new_spec.rb14
-rw-r--r--spec/ruby/core/encoding/converter/primitive_convert_spec.rb31
-rw-r--r--spec/ruby/core/encoding/converter/primitive_errinfo_spec.rb7
-rw-r--r--spec/ruby/core/encoding/converter/putback_spec.rb23
-rw-r--r--spec/ruby/core/encoding/converter/replacement_spec.rb28
-rw-r--r--spec/ruby/core/encoding/converter/search_convpath_spec.rb6
-rw-r--r--spec/ruby/core/encoding/default_external_spec.rb12
-rw-r--r--spec/ruby/core/encoding/default_internal_spec.rb12
-rw-r--r--spec/ruby/core/encoding/dummy_spec.rb21
-rw-r--r--spec/ruby/core/encoding/find_spec.rb8
-rw-r--r--spec/ruby/core/encoding/fixtures/classes.rb2
-rw-r--r--spec/ruby/core/encoding/inspect_spec.rb22
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_name_spec.rb5
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_spec.rb5
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/error_bytes_spec.rb7
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/incomplete_input_spec.rb12
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/readagain_bytes_spec.rb11
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_name_spec.rb3
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_spec.rb5
-rw-r--r--spec/ruby/core/encoding/list_spec.rb16
-rw-r--r--spec/ruby/core/encoding/locale_charmap_spec.rb76
-rw-r--r--spec/ruby/core/encoding/name_list_spec.rb8
-rw-r--r--spec/ruby/core/encoding/name_spec.rb14
-rw-r--r--spec/ruby/core/encoding/names_spec.rb6
-rw-r--r--spec/ruby/core/encoding/replicate_spec.rb44
-rw-r--r--spec/ruby/core/encoding/shared/name.rb15
-rw-r--r--spec/ruby/core/encoding/to_s_spec.rb6
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_name_spec.rb3
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_spec.rb3
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/error_char_spec.rb5
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_name_spec.rb3
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_spec.rb5
-rw-r--r--spec/ruby/core/enumerable/all_spec.rb35
-rw-r--r--spec/ruby/core/enumerable/any_spec.rb35
-rw-r--r--spec/ruby/core/enumerable/chain_spec.rb30
-rw-r--r--spec/ruby/core/enumerable/chunk_spec.rb18
-rw-r--r--spec/ruby/core/enumerable/chunk_while_spec.rb4
-rw-r--r--spec/ruby/core/enumerable/collect_concat_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/collect_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/compact_spec.rb9
-rw-r--r--spec/ruby/core/enumerable/cycle_spec.rb10
-rw-r--r--spec/ruby/core/enumerable/detect_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/drop_spec.rb10
-rw-r--r--spec/ruby/core/enumerable/drop_while_spec.rb4
-rw-r--r--spec/ruby/core/enumerable/each_cons_spec.rb26
-rw-r--r--spec/ruby/core/enumerable/each_entry_spec.rb8
-rw-r--r--spec/ruby/core/enumerable/each_slice_spec.rb28
-rw-r--r--spec/ruby/core/enumerable/each_with_index_spec.rb6
-rw-r--r--spec/ruby/core/enumerable/each_with_object_spec.rb8
-rw-r--r--spec/ruby/core/enumerable/entries_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/filter_map_spec.rb34
-rw-r--r--spec/ruby/core/enumerable/filter_spec.rb6
-rw-r--r--spec/ruby/core/enumerable/find_all_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/find_index_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/find_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/first_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/fixtures/classes.rb5
-rw-r--r--spec/ruby/core/enumerable/flat_map_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/grep_spec.rb35
-rw-r--r--spec/ruby/core/enumerable/grep_v_spec.rb37
-rw-r--r--spec/ruby/core/enumerable/group_by_spec.rb18
-rw-r--r--spec/ruby/core/enumerable/lazy_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/map_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/max_by_spec.rb8
-rw-r--r--spec/ruby/core/enumerable/max_spec.rb8
-rw-r--r--spec/ruby/core/enumerable/min_by_spec.rb8
-rw-r--r--spec/ruby/core/enumerable/min_spec.rb10
-rw-r--r--spec/ruby/core/enumerable/minmax_by_spec.rb6
-rw-r--r--spec/ruby/core/enumerable/none_spec.rb43
-rw-r--r--spec/ruby/core/enumerable/one_spec.rb48
-rw-r--r--spec/ruby/core/enumerable/partition_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/reject_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/reverse_each_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/select_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/shared/collect.rb18
-rw-r--r--spec/ruby/core/enumerable/shared/collect_concat.rb4
-rw-r--r--spec/ruby/core/enumerable/shared/entries.rb10
-rw-r--r--spec/ruby/core/enumerable/shared/find.rb2
-rw-r--r--spec/ruby/core/enumerable/shared/find_all.rb2
-rw-r--r--spec/ruby/core/enumerable/shared/include.rb2
-rw-r--r--spec/ruby/core/enumerable/shared/inject.rb87
-rw-r--r--spec/ruby/core/enumerable/shared/take.rb8
-rw-r--r--spec/ruby/core/enumerable/shared/value_packing.rb26
-rw-r--r--spec/ruby/core/enumerable/slice_after_spec.rb10
-rw-r--r--spec/ruby/core/enumerable/slice_before_spec.rb10
-rw-r--r--spec/ruby/core/enumerable/slice_when_spec.rb4
-rw-r--r--spec/ruby/core/enumerable/sort_by_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/sort_spec.rb6
-rw-r--r--spec/ruby/core/enumerable/sum_spec.rb26
-rw-r--r--spec/ruby/core/enumerable/take_spec.rb10
-rw-r--r--spec/ruby/core/enumerable/take_while_spec.rb4
-rw-r--r--spec/ruby/core/enumerable/tally_spec.rb116
-rw-r--r--spec/ruby/core/enumerable/to_a_spec.rb2
-rw-r--r--spec/ruby/core/enumerable/to_h_spec.rb92
-rw-r--r--spec/ruby/core/enumerable/to_set_spec.rb30
-rw-r--r--spec/ruby/core/enumerable/uniq_spec.rb76
-rw-r--r--spec/ruby/core/enumerable/zip_spec.rb5
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/begin_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/each_spec.rb24
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/end_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/eq_spec.rb24
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/exclude_end_spec.rb22
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/first_spec.rb12
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/hash_spec.rb26
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/inspect_spec.rb26
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/last_spec.rb12
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/new_spec.rb24
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/size_spec.rb22
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/step_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/chain/each_spec.rb18
-rw-r--r--spec/ruby/core/enumerator/chain/initialize_spec.rb44
-rw-r--r--spec/ruby/core/enumerator/chain/inspect_spec.rb24
-rw-r--r--spec/ruby/core/enumerator/chain/rewind_spec.rb96
-rw-r--r--spec/ruby/core/enumerator/chain/size_spec.rb30
-rw-r--r--spec/ruby/core/enumerator/each_spec.rb47
-rw-r--r--spec/ruby/core/enumerator/each_with_index_spec.rb12
-rw-r--r--spec/ruby/core/enumerator/each_with_object_spec.rb2
-rw-r--r--spec/ruby/core/enumerator/enum_for_spec.rb2
-rw-r--r--spec/ruby/core/enumerator/feed_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/fixtures/classes.rb (renamed from spec/ruby/fixtures/enumerator/classes.rb)0
-rw-r--r--spec/ruby/core/enumerator/generator/each_spec.rb40
-rw-r--r--spec/ruby/core/enumerator/generator/initialize_spec.rb26
-rw-r--r--spec/ruby/core/enumerator/initialize_spec.rb24
-rw-r--r--spec/ruby/core/enumerator/inspect_spec.rb5
-rw-r--r--spec/ruby/core/enumerator/lazy/chunk_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/lazy/chunk_while_spec.rb5
-rw-r--r--spec/ruby/core/enumerator/lazy/compact_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/lazy/drop_spec.rb4
-rw-r--r--spec/ruby/core/enumerator/lazy/drop_while_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/lazy/eager_spec.rb38
-rw-r--r--spec/ruby/core/enumerator/lazy/filter_map_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/lazy/filter_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/lazy/grep_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/grep_v_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/initialize_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/lazy/lazy_spec.rb13
-rw-r--r--spec/ruby/core/enumerator/lazy/reject_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/collect.rb4
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/collect_concat.rb10
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/select.rb6
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/to_enum.rb6
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_after_spec.rb5
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_before_spec.rb5
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_when_spec.rb5
-rw-r--r--spec/ruby/core/enumerator/lazy/take_spec.rb12
-rw-r--r--spec/ruby/core/enumerator/lazy/take_while_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/lazy/uniq_spec.rb4
-rw-r--r--spec/ruby/core/enumerator/lazy/with_index_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/lazy/zip_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/new_spec.rb118
-rw-r--r--spec/ruby/core/enumerator/next_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/next_values_spec.rb10
-rw-r--r--spec/ruby/core/enumerator/peek_spec.rb2
-rw-r--r--spec/ruby/core/enumerator/peek_values_spec.rb10
-rw-r--r--spec/ruby/core/enumerator/plus_spec.rb46
-rw-r--r--spec/ruby/core/enumerator/produce_spec.rb84
-rw-r--r--spec/ruby/core/enumerator/product/each_spec.rb85
-rw-r--r--spec/ruby/core/enumerator/product/initialize_copy_spec.rb52
-rw-r--r--spec/ruby/core/enumerator/product/initialize_spec.rb31
-rw-r--r--spec/ruby/core/enumerator/product/inspect_spec.rb20
-rw-r--r--spec/ruby/core/enumerator/product/rewind_spec.rb62
-rw-r--r--spec/ruby/core/enumerator/product/size_spec.rb64
-rw-r--r--spec/ruby/core/enumerator/product_spec.rb91
-rw-r--r--spec/ruby/core/enumerator/rewind_spec.rb4
-rw-r--r--spec/ruby/core/enumerator/shared/enum_for.rb57
-rw-r--r--spec/ruby/core/enumerator/shared/with_index.rb33
-rw-r--r--spec/ruby/core/enumerator/shared/with_object.rb42
-rw-r--r--spec/ruby/core/enumerator/size_spec.rb2
-rw-r--r--spec/ruby/core/enumerator/to_enum_spec.rb4
-rw-r--r--spec/ruby/core/enumerator/with_index_spec.rb27
-rw-r--r--spec/ruby/core/enumerator/with_object_spec.rb2
-rw-r--r--spec/ruby/core/enumerator/yielder/append_spec.rb47
-rw-r--r--spec/ruby/core/enumerator/yielder/initialize_spec.rb18
-rw-r--r--spec/ruby/core/enumerator/yielder/to_proc_spec.rb18
-rw-r--r--spec/ruby/core/enumerator/yielder/yield_spec.rb33
-rw-r--r--spec/ruby/core/env/assoc_spec.rb2
-rw-r--r--spec/ruby/core/env/clear_spec.rb2
-rw-r--r--spec/ruby/core/env/clone_spec.rb21
-rw-r--r--spec/ruby/core/env/delete_if_spec.rb10
-rw-r--r--spec/ruby/core/env/delete_spec.rb18
-rw-r--r--spec/ruby/core/env/dup_spec.rb9
-rw-r--r--spec/ruby/core/env/each_key_spec.rb8
-rw-r--r--spec/ruby/core/env/each_value_spec.rb8
-rw-r--r--spec/ruby/core/env/element_reference_spec.rb6
-rw-r--r--spec/ruby/core/env/except_spec.rb34
-rw-r--r--spec/ruby/core/env/fetch_spec.rb6
-rw-r--r--spec/ruby/core/env/fetch_values_spec.rb51
-rw-r--r--spec/ruby/core/env/filter_spec.rb16
-rw-r--r--spec/ruby/core/env/index_spec.rb14
-rw-r--r--spec/ruby/core/env/indexes_spec.rb1
-rw-r--r--spec/ruby/core/env/indices_spec.rb1
-rw-r--r--spec/ruby/core/env/inspect_spec.rb2
-rw-r--r--spec/ruby/core/env/keep_if_spec.rb10
-rw-r--r--spec/ruby/core/env/key_spec.rb32
-rw-r--r--spec/ruby/core/env/length_spec.rb2
-rw-r--r--spec/ruby/core/env/merge_spec.rb6
-rw-r--r--spec/ruby/core/env/rassoc_spec.rb2
-rw-r--r--spec/ruby/core/env/reject_spec.rb14
-rw-r--r--spec/ruby/core/env/replace_spec.rb16
-rw-r--r--spec/ruby/core/env/shared/each.rb12
-rw-r--r--spec/ruby/core/env/shared/include.rb9
-rw-r--r--spec/ruby/core/env/shared/key.rb31
-rw-r--r--spec/ruby/core/env/shared/select.rb4
-rw-r--r--spec/ruby/core/env/shared/store.rb14
-rw-r--r--spec/ruby/core/env/shared/to_hash.rb4
-rw-r--r--spec/ruby/core/env/shared/update.rb50
-rw-r--r--spec/ruby/core/env/shared/value.rb7
-rw-r--r--spec/ruby/core/env/shift_spec.rb45
-rw-r--r--spec/ruby/core/env/size_spec.rb2
-rw-r--r--spec/ruby/core/env/slice_spec.rb50
-rw-r--r--spec/ruby/core/env/to_a_spec.rb5
-rw-r--r--spec/ruby/core/env/to_h_spec.rb112
-rw-r--r--spec/ruby/core/env/values_at_spec.rb2
-rw-r--r--spec/ruby/core/exception/backtrace_locations_spec.rb6
-rw-r--r--spec/ruby/core/exception/backtrace_spec.rb37
-rw-r--r--spec/ruby/core/exception/case_compare_spec.rb2
-rw-r--r--spec/ruby/core/exception/cause_spec.rb54
-rw-r--r--spec/ruby/core/exception/detailed_message_spec.rb50
-rw-r--r--spec/ruby/core/exception/dup_spec.rb14
-rw-r--r--spec/ruby/core/exception/equal_value_spec.rb18
-rw-r--r--spec/ruby/core/exception/errno_spec.rb21
-rw-r--r--spec/ruby/core/exception/exception_spec.rb4
-rw-r--r--spec/ruby/core/exception/exit_value_spec.rb2
-rw-r--r--spec/ruby/core/exception/fixtures/common.rb7
-rw-r--r--spec/ruby/core/exception/fixtures/syntax_error.rb3
-rw-r--r--spec/ruby/core/exception/fixtures/thread_fiber_ensure.rb22
-rw-r--r--spec/ruby/core/exception/fixtures/thread_fiber_ensure_non_root_fiber.rb25
-rw-r--r--spec/ruby/core/exception/frozen_error_spec.rb60
-rw-r--r--spec/ruby/core/exception/full_message_spec.rb246
-rw-r--r--spec/ruby/core/exception/interrupt_spec.rb27
-rw-r--r--spec/ruby/core/exception/io_error_spec.rb16
-rw-r--r--spec/ruby/core/exception/key_error_spec.rb22
-rw-r--r--spec/ruby/core/exception/name_error_spec.rb12
-rw-r--r--spec/ruby/core/exception/name_spec.rb12
-rw-r--r--spec/ruby/core/exception/no_method_error_spec.rb178
-rw-r--r--spec/ruby/core/exception/reason_spec.rb2
-rw-r--r--spec/ruby/core/exception/receiver_spec.rb16
-rw-r--r--spec/ruby/core/exception/result_spec.rb8
-rw-r--r--spec/ruby/core/exception/set_backtrace_spec.rb51
-rw-r--r--spec/ruby/core/exception/shared/new.rb4
-rw-r--r--spec/ruby/core/exception/shared/set_backtrace.rb64
-rw-r--r--spec/ruby/core/exception/signal_exception_spec.rb20
-rw-r--r--spec/ruby/core/exception/signm_spec.rb2
-rw-r--r--spec/ruby/core/exception/signo_spec.rb2
-rw-r--r--spec/ruby/core/exception/standard_error_spec.rb2
-rw-r--r--spec/ruby/core/exception/status_spec.rb2
-rw-r--r--spec/ruby/core/exception/success_spec.rb4
-rw-r--r--spec/ruby/core/exception/syntax_error_spec.rb25
-rw-r--r--spec/ruby/core/exception/system_call_error_spec.rb60
-rw-r--r--spec/ruby/core/exception/system_exit_spec.rb46
-rw-r--r--spec/ruby/core/exception/to_s_spec.rb2
-rw-r--r--spec/ruby/core/exception/top_level_spec.rb66
-rw-r--r--spec/ruby/core/false/case_compare_spec.rb14
-rw-r--r--spec/ruby/core/false/dup_spec.rb2
-rw-r--r--spec/ruby/core/false/falseclass_spec.rb4
-rw-r--r--spec/ruby/core/false/singleton_method_spec.rb13
-rw-r--r--spec/ruby/core/false/to_s_spec.rb12
-rw-r--r--spec/ruby/core/fiber/alive_spec.rb44
-rw-r--r--spec/ruby/core/fiber/blocking_spec.rb73
-rw-r--r--spec/ruby/core/fiber/current_spec.rb50
-rw-r--r--spec/ruby/core/fiber/fixtures/classes.rb16
-rw-r--r--spec/ruby/core/fiber/fixtures/scheduler.rb35
-rw-r--r--spec/ruby/core/fiber/inspect_spec.rb35
-rw-r--r--spec/ruby/core/fiber/kill_spec.rb88
-rw-r--r--spec/ruby/core/fiber/new_spec.rb8
-rw-r--r--spec/ruby/core/fiber/raise_spec.rb186
-rw-r--r--spec/ruby/core/fiber/resume_spec.rb30
-rw-r--r--spec/ruby/core/fiber/scheduler_spec.rb8
-rw-r--r--spec/ruby/core/fiber/set_scheduler_spec.rb8
-rw-r--r--spec/ruby/core/fiber/shared/blocking.rb41
-rw-r--r--spec/ruby/core/fiber/shared/resume.rb58
-rw-r--r--spec/ruby/core/fiber/shared/scheduler.rb51
-rw-r--r--spec/ruby/core/fiber/storage_spec.rb177
-rw-r--r--spec/ruby/core/fiber/transfer_spec.rb84
-rw-r--r--spec/ruby/core/fiber/yield_spec.rb4
-rw-r--r--spec/ruby/core/file/absolute_path_spec.rb76
-rw-r--r--spec/ruby/core/file/atime_spec.rb29
-rw-r--r--spec/ruby/core/file/basename_spec.rb49
-rw-r--r--spec/ruby/core/file/birthtime_spec.rb68
-rw-r--r--spec/ruby/core/file/chmod_spec.rb12
-rw-r--r--spec/ruby/core/file/chown_spec.rb18
-rw-r--r--spec/ruby/core/file/constants/constants_spec.rb8
-rw-r--r--spec/ruby/core/file/ctime_spec.rb11
-rw-r--r--spec/ruby/core/file/dirname_spec.rb98
-rw-r--r--spec/ruby/core/file/empty_spec.rb6
-rw-r--r--spec/ruby/core/file/exist_spec.rb6
-rw-r--r--spec/ruby/core/file/expand_path_spec.rb22
-rw-r--r--spec/ruby/core/file/extname_spec.rb16
-rw-r--r--spec/ruby/core/file/flock_spec.rb36
-rw-r--r--spec/ruby/core/file/ftype_spec.rb8
-rw-r--r--spec/ruby/core/file/inspect_spec.rb2
-rw-r--r--spec/ruby/core/file/join_spec.rb14
-rw-r--r--spec/ruby/core/file/lchmod_spec.rb2
-rw-r--r--spec/ruby/core/file/link_spec.rb12
-rw-r--r--spec/ruby/core/file/lutime_spec.rb9
-rw-r--r--spec/ruby/core/file/mkfifo_spec.rb4
-rw-r--r--spec/ruby/core/file/mtime_spec.rb27
-rw-r--r--spec/ruby/core/file/new_spec.rb99
-rw-r--r--spec/ruby/core/file/open_spec.rb183
-rw-r--r--spec/ruby/core/file/path_spec.rb41
-rw-r--r--spec/ruby/core/file/readlink_spec.rb6
-rw-r--r--spec/ruby/core/file/realdirpath_spec.rb6
-rw-r--r--spec/ruby/core/file/realpath_spec.rb10
-rw-r--r--spec/ruby/core/file/rename_spec.rb8
-rw-r--r--spec/ruby/core/file/setuid_spec.rb4
-rw-r--r--spec/ruby/core/file/shared/fnmatch.rb91
-rw-r--r--spec/ruby/core/file/shared/open.rb2
-rw-r--r--spec/ruby/core/file/shared/path.rb16
-rw-r--r--spec/ruby/core/file/shared/read.rb8
-rw-r--r--spec/ruby/core/file/shared/stat.rb6
-rw-r--r--spec/ruby/core/file/shared/unlink.rb4
-rw-r--r--spec/ruby/core/file/shared/update_time.rb105
-rw-r--r--spec/ruby/core/file/size_spec.rb6
-rw-r--r--spec/ruby/core/file/socket_spec.rb32
-rw-r--r--spec/ruby/core/file/split_spec.rb6
-rw-r--r--spec/ruby/core/file/stat/atime_spec.rb2
-rw-r--r--spec/ruby/core/file/stat/birthtime_spec.rb36
-rw-r--r--spec/ruby/core/file/stat/blocks_spec.rb2
-rw-r--r--spec/ruby/core/file/stat/ctime_spec.rb2
-rw-r--r--spec/ruby/core/file/stat/dev_major_spec.rb4
-rw-r--r--spec/ruby/core/file/stat/dev_minor_spec.rb4
-rw-r--r--spec/ruby/core/file/stat/dev_spec.rb2
-rw-r--r--spec/ruby/core/file/stat/ftype_spec.rb2
-rw-r--r--spec/ruby/core/file/stat/ino_spec.rb4
-rw-r--r--spec/ruby/core/file/stat/mtime_spec.rb2
-rw-r--r--spec/ruby/core/file/stat/new_spec.rb4
-rw-r--r--spec/ruby/core/file/stat/rdev_major_spec.rb17
-rw-r--r--spec/ruby/core/file/stat/rdev_minor_spec.rb17
-rw-r--r--spec/ruby/core/file/stat/rdev_spec.rb2
-rw-r--r--spec/ruby/core/file/stat_spec.rb12
-rw-r--r--spec/ruby/core/file/symlink_spec.rb12
-rw-r--r--spec/ruby/core/file/truncate_spec.rb24
-rw-r--r--spec/ruby/core/file/umask_spec.rb8
-rw-r--r--spec/ruby/core/file/utime_spec.rb87
-rw-r--r--spec/ruby/core/file/world_readable_spec.rb2
-rw-r--r--spec/ruby/core/file/world_writable_spec.rb2
-rw-r--r--spec/ruby/core/file/zero_spec.rb6
-rw-r--r--spec/ruby/core/filetest/exist_spec.rb6
-rw-r--r--spec/ruby/core/filetest/grpowned_spec.rb2
-rw-r--r--spec/ruby/core/filetest/socket_spec.rb4
-rw-r--r--spec/ruby/core/filetest/zero_spec.rb6
-rw-r--r--spec/ruby/core/float/ceil_spec.rb31
-rw-r--r--spec/ruby/core/float/coerce_spec.rb4
-rw-r--r--spec/ruby/core/float/comparison_spec.rb75
-rw-r--r--spec/ruby/core/float/constants_spec.rb2
-rw-r--r--spec/ruby/core/float/denominator_spec.rb2
-rw-r--r--spec/ruby/core/float/divide_spec.rb24
-rw-r--r--spec/ruby/core/float/divmod_spec.rb24
-rw-r--r--spec/ruby/core/float/dup_spec.rb2
-rw-r--r--spec/ruby/core/float/eql_spec.rb8
-rw-r--r--spec/ruby/core/float/float_spec.rb4
-rw-r--r--spec/ruby/core/float/floor_spec.rb31
-rw-r--r--spec/ruby/core/float/gt_spec.rb25
-rw-r--r--spec/ruby/core/float/gte_spec.rb25
-rw-r--r--spec/ruby/core/float/lt_spec.rb25
-rw-r--r--spec/ruby/core/float/lte_spec.rb25
-rw-r--r--spec/ruby/core/float/magnitude_spec.rb1
-rw-r--r--spec/ruby/core/float/minus_spec.rb2
-rw-r--r--spec/ruby/core/float/multiply_spec.rb6
-rw-r--r--spec/ruby/core/float/negative_spec.rb10
-rw-r--r--spec/ruby/core/float/next_float_spec.rb2
-rw-r--r--spec/ruby/core/float/numerator_spec.rb4
-rw-r--r--spec/ruby/core/float/plus_spec.rb2
-rw-r--r--spec/ruby/core/float/positive_spec.rb10
-rw-r--r--spec/ruby/core/float/prev_float_spec.rb2
-rw-r--r--spec/ruby/core/float/rationalize_spec.rb8
-rw-r--r--spec/ruby/core/float/round_spec.rb174
-rw-r--r--spec/ruby/core/float/shared/abs.rb2
-rw-r--r--spec/ruby/core/float/shared/arg.rb4
-rw-r--r--spec/ruby/core/float/shared/arithmetic_exception_in_coerce.rb2
-rw-r--r--spec/ruby/core/float/shared/comparison_exception_in_coerce.rb2
-rw-r--r--spec/ruby/core/float/shared/equal.rb21
-rw-r--r--spec/ruby/core/float/shared/modulo.rb12
-rw-r--r--spec/ruby/core/float/shared/quo.rb8
-rw-r--r--spec/ruby/core/float/shared/to_i.rb16
-rw-r--r--spec/ruby/core/float/shared/to_s.rb4
-rw-r--r--spec/ruby/core/float/truncate_spec.rb10
-rw-r--r--spec/ruby/core/float/uplus_spec.rb2
-rw-r--r--spec/ruby/core/gc/auto_compact_spec.rb24
-rw-r--r--spec/ruby/core/gc/config_spec.rb97
-rw-r--r--spec/ruby/core/gc/count_spec.rb2
-rw-r--r--spec/ruby/core/gc/disable_spec.rb2
-rw-r--r--spec/ruby/core/gc/enable_spec.rb2
-rw-r--r--spec/ruby/core/gc/measure_total_time_spec.rb17
-rw-r--r--spec/ruby/core/gc/profiler/enabled_spec.rb4
-rw-r--r--spec/ruby/core/gc/profiler/result_spec.rb2
-rw-r--r--spec/ruby/core/gc/profiler/total_time_spec.rb2
-rw-r--r--spec/ruby/core/gc/stat_spec.rb64
-rw-r--r--spec/ruby/core/gc/stress_spec.rb8
-rw-r--r--spec/ruby/core/gc/total_time_spec.rb13
-rw-r--r--spec/ruby/core/hash/allocate_spec.rb2
-rw-r--r--spec/ruby/core/hash/assoc_spec.rb14
-rw-r--r--spec/ruby/core/hash/clear_spec.rb6
-rw-r--r--spec/ruby/core/hash/clone_spec.rb2
-rw-r--r--spec/ruby/core/hash/compact_spec.rb30
-rw-r--r--spec/ruby/core/hash/compare_by_identity_spec.rb47
-rw-r--r--spec/ruby/core/hash/constructor_spec.rb72
-rw-r--r--spec/ruby/core/hash/deconstruct_keys_spec.rb32
-rw-r--r--spec/ruby/core/hash/default_proc_spec.rb20
-rw-r--r--spec/ruby/core/hash/default_spec.rb4
-rw-r--r--spec/ruby/core/hash/delete_if_spec.rb8
-rw-r--r--spec/ruby/core/hash/delete_spec.rb20
-rw-r--r--spec/ruby/core/hash/dig_spec.rb18
-rw-r--r--spec/ruby/core/hash/each_key_spec.rb2
-rw-r--r--spec/ruby/core/hash/each_pair_spec.rb106
-rw-r--r--spec/ruby/core/hash/each_spec.rb10
-rw-r--r--spec/ruby/core/hash/each_value_spec.rb2
-rw-r--r--spec/ruby/core/hash/element_reference_spec.rb6
-rw-r--r--spec/ruby/core/hash/element_set_spec.rb118
-rw-r--r--spec/ruby/core/hash/equal_value_spec.rb2
-rw-r--r--spec/ruby/core/hash/except_spec.rb60
-rw-r--r--spec/ruby/core/hash/fetch_spec.rb8
-rw-r--r--spec/ruby/core/hash/fetch_values_spec.rb2
-rw-r--r--spec/ruby/core/hash/filter_spec.rb13
-rw-r--r--spec/ruby/core/hash/flatten_spec.rb4
-rw-r--r--spec/ruby/core/hash/gt_spec.rb2
-rw-r--r--spec/ruby/core/hash/gte_spec.rb2
-rw-r--r--spec/ruby/core/hash/has_key_spec.rb6
-rw-r--r--spec/ruby/core/hash/has_value_spec.rb15
-rw-r--r--spec/ruby/core/hash/hash_spec.rb7
-rw-r--r--spec/ruby/core/hash/include_spec.rb39
-rw-r--r--spec/ruby/core/hash/index_spec.rb9
-rw-r--r--spec/ruby/core/hash/initialize_spec.rb12
-rw-r--r--spec/ruby/core/hash/inspect_spec.rb122
-rw-r--r--spec/ruby/core/hash/invert_spec.rb21
-rw-r--r--spec/ruby/core/hash/keep_if_spec.rb10
-rw-r--r--spec/ruby/core/hash/key_spec.rb30
-rw-r--r--spec/ruby/core/hash/keys_spec.rb4
-rw-r--r--spec/ruby/core/hash/length_spec.rb6
-rw-r--r--spec/ruby/core/hash/lt_spec.rb2
-rw-r--r--spec/ruby/core/hash/lte_spec.rb2
-rw-r--r--spec/ruby/core/hash/member_spec.rb6
-rw-r--r--spec/ruby/core/hash/merge_spec.rb55
-rw-r--r--spec/ruby/core/hash/new_spec.rb40
-rw-r--r--spec/ruby/core/hash/rassoc_spec.rb10
-rw-r--r--spec/ruby/core/hash/rehash_spec.rb54
-rw-r--r--spec/ruby/core/hash/reject_spec.rb38
-rw-r--r--spec/ruby/core/hash/replace_spec.rb76
-rw-r--r--spec/ruby/core/hash/ruby2_keywords_hash_spec.rb118
-rw-r--r--spec/ruby/core/hash/select_spec.rb108
-rw-r--r--spec/ruby/core/hash/shared/comparison.rb10
-rw-r--r--spec/ruby/core/hash/shared/each.rb124
-rw-r--r--spec/ruby/core/hash/shared/eql.rb168
-rw-r--r--spec/ruby/core/hash/shared/equal.rb90
-rw-r--r--spec/ruby/core/hash/shared/greater_than.rb6
-rw-r--r--spec/ruby/core/hash/shared/index.rb37
-rw-r--r--spec/ruby/core/hash/shared/iteration.rb6
-rw-r--r--spec/ruby/core/hash/shared/key.rb38
-rw-r--r--spec/ruby/core/hash/shared/length.rb12
-rw-r--r--spec/ruby/core/hash/shared/less_than.rb6
-rw-r--r--spec/ruby/core/hash/shared/replace.rb51
-rw-r--r--spec/ruby/core/hash/shared/select.rb91
-rw-r--r--spec/ruby/core/hash/shared/store.rb115
-rw-r--r--spec/ruby/core/hash/shared/to_s.rb98
-rw-r--r--spec/ruby/core/hash/shared/update.rb78
-rw-r--r--spec/ruby/core/hash/shared/value.rb14
-rw-r--r--spec/ruby/core/hash/shared/values_at.rb9
-rw-r--r--spec/ruby/core/hash/shift_spec.rb19
-rw-r--r--spec/ruby/core/hash/size_spec.rb13
-rw-r--r--spec/ruby/core/hash/slice_spec.rb25
-rw-r--r--spec/ruby/core/hash/store_spec.rb6
-rw-r--r--spec/ruby/core/hash/to_a_spec.rb14
-rw-r--r--spec/ruby/core/hash/to_h_spec.rb114
-rw-r--r--spec/ruby/core/hash/to_hash_spec.rb4
-rw-r--r--spec/ruby/core/hash/to_proc_spec.rb32
-rw-r--r--spec/ruby/core/hash/to_s_spec.rb6
-rw-r--r--spec/ruby/core/hash/transform_keys_spec.rb98
-rw-r--r--spec/ruby/core/hash/transform_values_spec.rb39
-rw-r--r--spec/ruby/core/hash/try_convert_spec.rb16
-rw-r--r--spec/ruby/core/hash/update_spec.rb76
-rw-r--r--spec/ruby/core/hash/value_spec.rb6
-rw-r--r--spec/ruby/core/hash/values_at_spec.rb10
-rw-r--r--spec/ruby/core/hash/values_spec.rb2
-rw-r--r--spec/ruby/core/integer/allbits_spec.rb8
-rw-r--r--spec/ruby/core/integer/anybits_spec.rb8
-rw-r--r--spec/ruby/core/integer/bit_and_spec.rb24
-rw-r--r--spec/ruby/core/integer/bit_or_spec.rb43
-rw-r--r--spec/ruby/core/integer/bit_xor_spec.rb45
-rw-r--r--spec/ruby/core/integer/ceil_spec.rb12
-rw-r--r--spec/ruby/core/integer/ceildiv_spec.rb20
-rw-r--r--spec/ruby/core/integer/chr_spec.rb87
-rw-r--r--spec/ruby/core/integer/coerce_spec.rb41
-rw-r--r--spec/ruby/core/integer/comparison_spec.rb14
-rw-r--r--spec/ruby/core/integer/complement_spec.rb6
-rw-r--r--spec/ruby/core/integer/constants_spec.rb20
-rw-r--r--spec/ruby/core/integer/digits_spec.rb15
-rw-r--r--spec/ruby/core/integer/div_spec.rb52
-rw-r--r--spec/ruby/core/integer/divide_spec.rb65
-rw-r--r--spec/ruby/core/integer/divmod_spec.rb46
-rw-r--r--spec/ruby/core/integer/downto_spec.rb8
-rw-r--r--spec/ruby/core/integer/dup_spec.rb4
-rw-r--r--spec/ruby/core/integer/element_reference_spec.rb130
-rw-r--r--spec/ruby/core/integer/eql_spec.rb25
-rw-r--r--spec/ruby/core/integer/even_spec.rb26
-rw-r--r--spec/ruby/core/integer/fdiv_spec.rb59
-rw-r--r--spec/ruby/core/integer/fixtures/classes.rb10
-rw-r--r--spec/ruby/core/integer/floor_spec.rb12
-rw-r--r--spec/ruby/core/integer/gcd_spec.rb16
-rw-r--r--spec/ruby/core/integer/gcdlcm_spec.rb16
-rw-r--r--spec/ruby/core/integer/gt_spec.rb13
-rw-r--r--spec/ruby/core/integer/gte_spec.rb13
-rw-r--r--spec/ruby/core/integer/integer_spec.rb4
-rw-r--r--spec/ruby/core/integer/lcm_spec.rb16
-rw-r--r--spec/ruby/core/integer/left_shift_spec.rb77
-rw-r--r--spec/ruby/core/integer/lt_spec.rb13
-rw-r--r--spec/ruby/core/integer/lte_spec.rb13
-rw-r--r--spec/ruby/core/integer/minus_spec.rb35
-rw-r--r--spec/ruby/core/integer/multiply_spec.rb18
-rw-r--r--spec/ruby/core/integer/nobits_spec.rb8
-rw-r--r--spec/ruby/core/integer/odd_spec.rb26
-rw-r--r--spec/ruby/core/integer/ord_spec.rb16
-rw-r--r--spec/ruby/core/integer/plus_spec.rb52
-rw-r--r--spec/ruby/core/integer/pow_spec.rb28
-rw-r--r--spec/ruby/core/integer/pred_spec.rb10
-rw-r--r--spec/ruby/core/integer/rationalize_spec.rb6
-rw-r--r--spec/ruby/core/integer/remainder_spec.rb20
-rw-r--r--spec/ruby/core/integer/right_shift_spec.rb81
-rw-r--r--spec/ruby/core/integer/round_spec.rb66
-rw-r--r--spec/ruby/core/integer/shared/abs.rb4
-rw-r--r--spec/ruby/core/integer/shared/arithmetic_coerce.rb22
-rw-r--r--spec/ruby/core/integer/shared/comparison_coerce.rb2
-rw-r--r--spec/ruby/core/integer/shared/equal.rb5
-rw-r--r--spec/ruby/core/integer/shared/exponent.rb141
-rw-r--r--spec/ruby/core/integer/shared/integer_ceil_precision.rb54
-rw-r--r--spec/ruby/core/integer/shared/integer_floor_precision.rb42
-rw-r--r--spec/ruby/core/integer/shared/integer_rounding.rb6
-rw-r--r--spec/ruby/core/integer/shared/modulo.rb84
-rw-r--r--spec/ruby/core/integer/shared/to_i.rb8
-rw-r--r--spec/ruby/core/integer/size_spec.rb4
-rw-r--r--spec/ruby/core/integer/sqrt_spec.rb6
-rw-r--r--spec/ruby/core/integer/to_f_spec.rb6
-rw-r--r--spec/ruby/core/integer/to_r_spec.rb8
-rw-r--r--spec/ruby/core/integer/to_s_spec.rb30
-rw-r--r--spec/ruby/core/integer/truncate_spec.rb12
-rw-r--r--spec/ruby/core/integer/try_convert_spec.rb48
-rw-r--r--spec/ruby/core/integer/uminus_spec.rb8
-rw-r--r--spec/ruby/core/integer/upto_spec.rb8
-rw-r--r--spec/ruby/core/integer/zero_spec.rb13
-rw-r--r--spec/ruby/core/io/advise_spec.rb40
-rw-r--r--spec/ruby/core/io/autoclose_spec.rb77
-rw-r--r--spec/ruby/core/io/binmode_spec.rb12
-rw-r--r--spec/ruby/core/io/binread_spec.rb14
-rw-r--r--spec/ruby/core/io/buffer/and_spec.rb62
-rw-r--r--spec/ruby/core/io/buffer/bit_count_spec.rb64
-rw-r--r--spec/ruby/core/io/buffer/empty_spec.rb27
-rw-r--r--spec/ruby/core/io/buffer/external_spec.rb23
-rw-r--r--spec/ruby/core/io/buffer/for_spec.rb95
-rw-r--r--spec/ruby/core/io/buffer/free_spec.rb102
-rw-r--r--spec/ruby/core/io/buffer/initialize_spec.rb119
-rw-r--r--spec/ruby/core/io/buffer/internal_spec.rb23
-rw-r--r--spec/ruby/core/io/buffer/locked_spec.rb75
-rw-r--r--spec/ruby/core/io/buffer/map_spec.rb343
-rw-r--r--spec/ruby/core/io/buffer/mapped_spec.rb23
-rw-r--r--spec/ruby/core/io/buffer/not_spec.rb37
-rw-r--r--spec/ruby/core/io/buffer/null_spec.rb27
-rw-r--r--spec/ruby/core/io/buffer/or_spec.rb62
-rw-r--r--spec/ruby/core/io/buffer/private_spec.rb23
-rw-r--r--spec/ruby/core/io/buffer/readonly_spec.rb28
-rw-r--r--spec/ruby/core/io/buffer/resize_spec.rb151
-rw-r--r--spec/ruby/core/io/buffer/shared/null_and_empty.rb57
-rw-r--r--spec/ruby/core/io/buffer/shared_spec.rb33
-rw-r--r--spec/ruby/core/io/buffer/string_spec.rb62
-rw-r--r--spec/ruby/core/io/buffer/transfer_spec.rb117
-rw-r--r--spec/ruby/core/io/buffer/valid_spec.rb99
-rw-r--r--spec/ruby/core/io/buffer/xor_spec.rb62
-rw-r--r--spec/ruby/core/io/bytes_spec.rb47
-rw-r--r--spec/ruby/core/io/chars_spec.rb30
-rw-r--r--spec/ruby/core/io/close_on_exec_spec.rb8
-rw-r--r--spec/ruby/core/io/close_read_spec.rb13
-rw-r--r--spec/ruby/core/io/close_spec.rb59
-rw-r--r--spec/ruby/core/io/close_write_spec.rb24
-rw-r--r--spec/ruby/core/io/closed_spec.rb4
-rw-r--r--spec/ruby/core/io/codepoints_spec.rb38
-rw-r--r--spec/ruby/core/io/copy_stream_spec.rb53
-rw-r--r--spec/ruby/core/io/dup_spec.rb55
-rw-r--r--spec/ruby/core/io/each_byte_spec.rb6
-rw-r--r--spec/ruby/core/io/each_codepoint_spec.rb4
-rw-r--r--spec/ruby/core/io/eof_spec.rb8
-rw-r--r--spec/ruby/core/io/external_encoding_spec.rb51
-rw-r--r--spec/ruby/core/io/fcntl_spec.rb2
-rw-r--r--spec/ruby/core/io/fileno_spec.rb2
-rw-r--r--spec/ruby/core/io/fixtures/classes.rb29
-rw-r--r--spec/ruby/core/io/flush_spec.rb16
-rw-r--r--spec/ruby/core/io/foreach_spec.rb55
-rw-r--r--spec/ruby/core/io/fsync_spec.rb2
-rw-r--r--spec/ruby/core/io/getbyte_spec.rb18
-rw-r--r--spec/ruby/core/io/getc_spec.rb6
-rw-r--r--spec/ruby/core/io/gets_spec.rb95
-rw-r--r--spec/ruby/core/io/initialize_spec.rb21
-rw-r--r--spec/ruby/core/io/inspect_spec.rb4
-rw-r--r--spec/ruby/core/io/internal_encoding_spec.rb33
-rw-r--r--spec/ruby/core/io/ioctl_spec.rb8
-rw-r--r--spec/ruby/core/io/lineno_spec.rb51
-rw-r--r--spec/ruby/core/io/lines_spec.rb46
-rw-r--r--spec/ruby/core/io/new_spec.rb8
-rw-r--r--spec/ruby/core/io/nonblock_spec.rb48
-rw-r--r--spec/ruby/core/io/open_spec.rb23
-rw-r--r--spec/ruby/core/io/output_spec.rb2
-rw-r--r--spec/ruby/core/io/path_spec.rb12
-rw-r--r--spec/ruby/core/io/pid_spec.rb4
-rw-r--r--spec/ruby/core/io/pipe_spec.rb39
-rw-r--r--spec/ruby/core/io/popen_spec.rb34
-rw-r--r--spec/ruby/core/io/pread_spec.rb162
-rw-r--r--spec/ruby/core/io/print_spec.rb27
-rw-r--r--spec/ruby/core/io/printf_spec.rb2
-rw-r--r--spec/ruby/core/io/puts_spec.rb6
-rw-r--r--spec/ruby/core/io/pwrite_spec.rb86
-rw-r--r--spec/ruby/core/io/read_nonblock_spec.rb67
-rw-r--r--spec/ruby/core/io/read_spec.rb273
-rw-r--r--spec/ruby/core/io/readbyte_spec.rb2
-rw-r--r--spec/ruby/core/io/readchar_spec.rb72
-rw-r--r--spec/ruby/core/io/readline_spec.rb37
-rw-r--r--spec/ruby/core/io/readlines_spec.rb103
-rw-r--r--spec/ruby/core/io/readpartial_spec.rb41
-rw-r--r--spec/ruby/core/io/reopen_spec.rb26
-rw-r--r--spec/ruby/core/io/rewind_spec.rb17
-rw-r--r--spec/ruby/core/io/seek_spec.rb2
-rw-r--r--spec/ruby/core/io/select_spec.rb110
-rw-r--r--spec/ruby/core/io/set_encoding_by_bom_spec.rb265
-rw-r--r--spec/ruby/core/io/set_encoding_spec.rb79
-rw-r--r--spec/ruby/core/io/shared/binwrite.rb15
-rw-r--r--spec/ruby/core/io/shared/chars.rb10
-rw-r--r--spec/ruby/core/io/shared/codepoints.rb6
-rw-r--r--spec/ruby/core/io/shared/each.rb88
-rw-r--r--spec/ruby/core/io/shared/gets_ascii.rb2
-rw-r--r--spec/ruby/core/io/shared/new.rb119
-rw-r--r--spec/ruby/core/io/shared/pos.rb14
-rw-r--r--spec/ruby/core/io/shared/readlines.rb148
-rw-r--r--spec/ruby/core/io/shared/tty.rb2
-rw-r--r--spec/ruby/core/io/shared/write.rb81
-rw-r--r--spec/ruby/core/io/stat_spec.rb9
-rw-r--r--spec/ruby/core/io/sync_spec.rb4
-rw-r--r--spec/ruby/core/io/sysopen_spec.rb16
-rw-r--r--spec/ruby/core/io/sysread_spec.rb55
-rw-r--r--spec/ruby/core/io/sysseek_spec.rb11
-rw-r--r--spec/ruby/core/io/syswrite_spec.rb11
-rw-r--r--spec/ruby/core/io/to_i_spec.rb2
-rw-r--r--spec/ruby/core/io/to_io_spec.rb4
-rw-r--r--spec/ruby/core/io/try_convert_spec.rb12
-rw-r--r--spec/ruby/core/io/ungetbyte_spec.rb39
-rw-r--r--spec/ruby/core/io/ungetc_spec.rb28
-rw-r--r--spec/ruby/core/io/write_nonblock_spec.rb21
-rw-r--r--spec/ruby/core/io/write_spec.rb168
-rw-r--r--spec/ruby/core/kernel/Array_spec.rb6
-rw-r--r--spec/ruby/core/kernel/Complex_spec.rb195
-rw-r--r--spec/ruby/core/kernel/Float_spec.rb266
-rw-r--r--spec/ruby/core/kernel/Hash_spec.rb6
-rw-r--r--spec/ruby/core/kernel/Integer_spec.rb425
-rw-r--r--spec/ruby/core/kernel/Rational_spec.rb234
-rw-r--r--spec/ruby/core/kernel/String_spec.rb16
-rw-r--r--spec/ruby/core/kernel/__dir___spec.rb16
-rw-r--r--spec/ruby/core/kernel/abort_spec.rb2
-rw-r--r--spec/ruby/core/kernel/at_exit_spec.rb62
-rw-r--r--spec/ruby/core/kernel/autoload_relative_spec.rb114
-rw-r--r--spec/ruby/core/kernel/autoload_spec.rb34
-rw-r--r--spec/ruby/core/kernel/backtick_spec.rb14
-rw-r--r--spec/ruby/core/kernel/binding_spec.rb4
-rw-r--r--spec/ruby/core/kernel/block_given_spec.rb7
-rw-r--r--spec/ruby/core/kernel/caller_locations_spec.rb63
-rw-r--r--spec/ruby/core/kernel/caller_spec.rb95
-rw-r--r--spec/ruby/core/kernel/case_compare_spec.rb14
-rw-r--r--spec/ruby/core/kernel/catch_spec.rb10
-rw-r--r--spec/ruby/core/kernel/chomp_spec.rb2
-rw-r--r--spec/ruby/core/kernel/chop_spec.rb2
-rw-r--r--spec/ruby/core/kernel/class_spec.rb22
-rw-r--r--spec/ruby/core/kernel/clone_spec.rb101
-rw-r--r--spec/ruby/core/kernel/comparison_spec.rb6
-rw-r--r--spec/ruby/core/kernel/define_singleton_method_spec.rb37
-rw-r--r--spec/ruby/core/kernel/dup_spec.rb8
-rw-r--r--spec/ruby/core/kernel/eql_spec.rb2
-rw-r--r--spec/ruby/core/kernel/eval_spec.rb286
-rw-r--r--spec/ruby/core/kernel/exec_spec.rb6
-rw-r--r--spec/ruby/core/kernel/exit_spec.rb14
-rw-r--r--spec/ruby/core/kernel/extend_spec.rb20
-rw-r--r--spec/ruby/core/kernel/fail_spec.rb10
-rw-r--r--spec/ruby/core/kernel/fixtures/Complex.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/at_exit.rb3
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_relative_b.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_relative_d.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/classes.rb105
-rw-r--r--spec/ruby/core/kernel/fixtures/warn_core_method.rb2
-rw-r--r--spec/ruby/core/kernel/fork_spec.rb2
-rw-r--r--spec/ruby/core/kernel/format_spec.rb35
-rw-r--r--spec/ruby/core/kernel/freeze_spec.rb28
-rw-r--r--spec/ruby/core/kernel/frozen_spec.rb22
-rw-r--r--spec/ruby/core/kernel/gets_spec.rb2
-rw-r--r--spec/ruby/core/kernel/global_variables_spec.rb6
-rw-r--r--spec/ruby/core/kernel/gsub_spec.rb8
-rw-r--r--spec/ruby/core/kernel/initialize_clone_spec.rb26
-rw-r--r--spec/ruby/core/kernel/initialize_copy_spec.rb21
-rw-r--r--spec/ruby/core/kernel/initialize_dup_spec.rb20
-rw-r--r--spec/ruby/core/kernel/inspect_spec.rb92
-rw-r--r--spec/ruby/core/kernel/instance_of_spec.rb6
-rw-r--r--spec/ruby/core/kernel/instance_variable_defined_spec.rb12
-rw-r--r--spec/ruby/core/kernel/instance_variable_get_spec.rb32
-rw-r--r--spec/ruby/core/kernel/instance_variable_set_spec.rb34
-rw-r--r--spec/ruby/core/kernel/instance_variables_spec.rb13
-rw-r--r--spec/ruby/core/kernel/is_a_spec.rb2
-rw-r--r--spec/ruby/core/kernel/iterator_spec.rb14
-rw-r--r--spec/ruby/core/kernel/itself_spec.rb2
-rw-r--r--spec/ruby/core/kernel/kind_of_spec.rb2
-rw-r--r--spec/ruby/core/kernel/lambda_spec.rb88
-rw-r--r--spec/ruby/core/kernel/load_spec.rb2
-rw-r--r--spec/ruby/core/kernel/local_variables_spec.rb11
-rw-r--r--spec/ruby/core/kernel/loop_spec.rb6
-rw-r--r--spec/ruby/core/kernel/match_spec.rb21
-rw-r--r--spec/ruby/core/kernel/method_spec.rb59
-rw-r--r--spec/ruby/core/kernel/methods_spec.rb34
-rw-r--r--spec/ruby/core/kernel/nil_spec.rb10
-rw-r--r--spec/ruby/core/kernel/not_match_spec.rb4
-rw-r--r--spec/ruby/core/kernel/open_spec.rb130
-rw-r--r--spec/ruby/core/kernel/p_spec.rb8
-rw-r--r--spec/ruby/core/kernel/print_spec.rb14
-rw-r--r--spec/ruby/core/kernel/printf_spec.rb9
-rw-r--r--spec/ruby/core/kernel/private_methods_spec.rb10
-rw-r--r--spec/ruby/core/kernel/proc_spec.rb38
-rw-r--r--spec/ruby/core/kernel/protected_methods_spec.rb10
-rw-r--r--spec/ruby/core/kernel/public_method_spec.rb6
-rw-r--r--spec/ruby/core/kernel/public_methods_spec.rb19
-rw-r--r--spec/ruby/core/kernel/public_send_spec.rb20
-rw-r--r--spec/ruby/core/kernel/putc_spec.rb2
-rw-r--r--spec/ruby/core/kernel/puts_spec.rb2
-rw-r--r--spec/ruby/core/kernel/raise_spec.rb198
-rw-r--r--spec/ruby/core/kernel/rand_spec.rb116
-rw-r--r--spec/ruby/core/kernel/readline_spec.rb2
-rw-r--r--spec/ruby/core/kernel/readlines_spec.rb2
-rw-r--r--spec/ruby/core/kernel/remove_instance_variable_spec.rb23
-rw-r--r--spec/ruby/core/kernel/require_relative_spec.rb142
-rw-r--r--spec/ruby/core/kernel/require_spec.rb35
-rw-r--r--spec/ruby/core/kernel/respond_to_missing_spec.rb20
-rw-r--r--spec/ruby/core/kernel/respond_to_spec.rb33
-rw-r--r--spec/ruby/core/kernel/select_spec.rb6
-rw-r--r--spec/ruby/core/kernel/set_trace_func_spec.rb2
-rw-r--r--spec/ruby/core/kernel/shared/dup_clone.rb32
-rw-r--r--spec/ruby/core/kernel/shared/kind_of.rb8
-rw-r--r--spec/ruby/core/kernel/shared/lambda.rb2
-rw-r--r--spec/ruby/core/kernel/shared/load.rb123
-rw-r--r--spec/ruby/core/kernel/shared/method.rb18
-rw-r--r--spec/ruby/core/kernel/shared/require.rb290
-rw-r--r--spec/ruby/core/kernel/shared/sprintf.rb201
-rw-r--r--spec/ruby/core/kernel/shared/sprintf_encoding.rb49
-rw-r--r--spec/ruby/core/kernel/shared/then.rb12
-rw-r--r--spec/ruby/core/kernel/singleton_class_spec.rb51
-rw-r--r--spec/ruby/core/kernel/singleton_method_spec.rb52
-rw-r--r--spec/ruby/core/kernel/singleton_methods_spec.rb65
-rw-r--r--spec/ruby/core/kernel/sleep_spec.rb80
-rw-r--r--spec/ruby/core/kernel/spawn_spec.rb2
-rw-r--r--spec/ruby/core/kernel/sprintf_spec.rb48
-rw-r--r--spec/ruby/core/kernel/srand_spec.rb24
-rw-r--r--spec/ruby/core/kernel/sub_spec.rb4
-rw-r--r--spec/ruby/core/kernel/syscall_spec.rb2
-rw-r--r--spec/ruby/core/kernel/system_spec.rb43
-rw-r--r--spec/ruby/core/kernel/taint_spec.rb58
-rw-r--r--spec/ruby/core/kernel/tainted_spec.rb27
-rw-r--r--spec/ruby/core/kernel/tap_spec.rb4
-rw-r--r--spec/ruby/core/kernel/test_spec.rb16
-rw-r--r--spec/ruby/core/kernel/then_spec.rb6
-rw-r--r--spec/ruby/core/kernel/throw_spec.rb14
-rw-r--r--spec/ruby/core/kernel/to_s_spec.rb10
-rw-r--r--spec/ruby/core/kernel/trace_var_spec.rb4
-rw-r--r--spec/ruby/core/kernel/trap_spec.rb7
-rw-r--r--spec/ruby/core/kernel/trust_spec.rb39
-rw-r--r--spec/ruby/core/kernel/untaint_spec.rb39
-rw-r--r--spec/ruby/core/kernel/untrace_var_spec.rb2
-rw-r--r--spec/ruby/core/kernel/untrust_spec.rb38
-rw-r--r--spec/ruby/core/kernel/untrusted_spec.rb42
-rw-r--r--spec/ruby/core/kernel/warn_spec.rb131
-rw-r--r--spec/ruby/core/main/define_method_spec.rb6
-rw-r--r--spec/ruby/core/main/fixtures/using.rb1
-rw-r--r--spec/ruby/core/main/fixtures/using_in_main.rb5
-rw-r--r--spec/ruby/core/main/fixtures/using_in_method.rb5
-rw-r--r--spec/ruby/core/main/include_spec.rb4
-rw-r--r--spec/ruby/core/main/private_spec.rb24
-rw-r--r--spec/ruby/core/main/public_spec.rb25
-rw-r--r--spec/ruby/core/main/ruby2_keywords_spec.rb9
-rw-r--r--spec/ruby/core/main/using_spec.rb26
-rw-r--r--spec/ruby/core/marshal/dump_spec.rb638
-rw-r--r--spec/ruby/core/marshal/fixtures/classes.rb4
-rw-r--r--spec/ruby/core/marshal/fixtures/marshal_data.rb157
-rw-r--r--spec/ruby/core/marshal/fixtures/marshal_multibyte_data.rb12
-rw-r--r--spec/ruby/core/marshal/float_spec.rb2
-rw-r--r--spec/ruby/core/marshal/shared/load.rb713
-rw-r--r--spec/ruby/core/matchdata/allocate_spec.rb8
-rw-r--r--spec/ruby/core/matchdata/begin_spec.rb30
-rw-r--r--spec/ruby/core/matchdata/bytebegin_spec.rb132
-rw-r--r--spec/ruby/core/matchdata/byteend_spec.rb104
-rw-r--r--spec/ruby/core/matchdata/byteoffset_spec.rb93
-rw-r--r--spec/ruby/core/matchdata/captures_spec.rb5
-rw-r--r--spec/ruby/core/matchdata/deconstruct_keys_spec.rb78
-rw-r--r--spec/ruby/core/matchdata/deconstruct_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/element_reference_spec.rb43
-rw-r--r--spec/ruby/core/matchdata/end_spec.rb2
-rw-r--r--spec/ruby/core/matchdata/fixtures/classes.rb3
-rw-r--r--spec/ruby/core/matchdata/inspect_spec.rb2
-rw-r--r--spec/ruby/core/matchdata/integer_at_spec.rb38
-rw-r--r--spec/ruby/core/matchdata/match_length_spec.rb32
-rw-r--r--spec/ruby/core/matchdata/match_spec.rb32
-rw-r--r--spec/ruby/core/matchdata/named_captures_spec.rb10
-rw-r--r--spec/ruby/core/matchdata/names_spec.rb4
-rw-r--r--spec/ruby/core/matchdata/offset_spec.rb106
-rw-r--r--spec/ruby/core/matchdata/post_match_spec.rb32
-rw-r--r--spec/ruby/core/matchdata/pre_match_spec.rb32
-rw-r--r--spec/ruby/core/matchdata/regexp_spec.rb2
-rw-r--r--spec/ruby/core/matchdata/shared/captures.rb13
-rw-r--r--spec/ruby/core/matchdata/shared/eql.rb8
-rw-r--r--spec/ruby/core/matchdata/string_spec.rb7
-rw-r--r--spec/ruby/core/matchdata/to_a_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/to_s_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/values_at_spec.rb71
-rw-r--r--spec/ruby/core/math/acos_spec.rb14
-rw-r--r--spec/ruby/core/math/acosh_spec.rb14
-rw-r--r--spec/ruby/core/math/asin_spec.rb12
-rw-r--r--spec/ruby/core/math/asinh_spec.rb8
-rw-r--r--spec/ruby/core/math/atan2_spec.rb14
-rw-r--r--spec/ruby/core/math/atan_spec.rb8
-rw-r--r--spec/ruby/core/math/atanh_spec.rb4
-rw-r--r--spec/ruby/core/math/cbrt_spec.rb6
-rw-r--r--spec/ruby/core/math/cos_spec.rb32
-rw-r--r--spec/ruby/core/math/cosh_spec.rb8
-rw-r--r--spec/ruby/core/math/erf_spec.rb8
-rw-r--r--spec/ruby/core/math/erfc_spec.rb8
-rw-r--r--spec/ruby/core/math/exp_spec.rb8
-rw-r--r--spec/ruby/core/math/expm1_spec.rb37
-rw-r--r--spec/ruby/core/math/fixtures/common.rb (renamed from spec/ruby/fixtures/math/common.rb)0
-rw-r--r--spec/ruby/core/math/frexp_spec.rb6
-rw-r--r--spec/ruby/core/math/gamma_spec.rb6
-rw-r--r--spec/ruby/core/math/hypot_spec.rb12
-rw-r--r--spec/ruby/core/math/ldexp_spec.rb20
-rw-r--r--spec/ruby/core/math/lgamma_spec.rb13
-rw-r--r--spec/ruby/core/math/log10_spec.rb14
-rw-r--r--spec/ruby/core/math/log1p_spec.rb49
-rw-r--r--spec/ruby/core/math/log2_spec.rb12
-rw-r--r--spec/ruby/core/math/log_spec.rb16
-rw-r--r--spec/ruby/core/math/shared/atanh.rb44
-rw-r--r--spec/ruby/core/math/sin_spec.rb8
-rw-r--r--spec/ruby/core/math/sinh_spec.rb8
-rw-r--r--spec/ruby/core/math/sqrt_spec.rb12
-rw-r--r--spec/ruby/core/math/tan_spec.rb8
-rw-r--r--spec/ruby/core/math/tanh_spec.rb8
-rw-r--r--spec/ruby/core/method/clone_spec.rb15
-rw-r--r--spec/ruby/core/method/compose_spec.rb133
-rw-r--r--spec/ruby/core/method/curry_spec.rb18
-rw-r--r--spec/ruby/core/method/dup_spec.rb15
-rw-r--r--spec/ruby/core/method/fixtures/classes.rb31
-rw-r--r--spec/ruby/core/method/inspect_spec.rb2
-rw-r--r--spec/ruby/core/method/original_name_spec.rb37
-rw-r--r--spec/ruby/core/method/owner_spec.rb4
-rw-r--r--spec/ruby/core/method/parameters_spec.rb62
-rw-r--r--spec/ruby/core/method/private_spec.rb9
-rw-r--r--spec/ruby/core/method/protected_spec.rb9
-rw-r--r--spec/ruby/core/method/public_spec.rb9
-rw-r--r--spec/ruby/core/method/receiver_spec.rb8
-rw-r--r--spec/ruby/core/method/shared/aliased_inspect.rb31
-rw-r--r--spec/ruby/core/method/shared/call.rb4
-rw-r--r--spec/ruby/core/method/shared/dup.rb32
-rw-r--r--spec/ruby/core/method/shared/eql.rb32
-rw-r--r--spec/ruby/core/method/shared/to_s.rb60
-rw-r--r--spec/ruby/core/method/source_location_spec.rb21
-rw-r--r--spec/ruby/core/method/super_method_spec.rb19
-rw-r--r--spec/ruby/core/method/to_proc_spec.rb2
-rw-r--r--spec/ruby/core/method/to_s_spec.rb2
-rw-r--r--spec/ruby/core/method/unbind_spec.rb4
-rw-r--r--spec/ruby/core/module/alias_method_spec.rb62
-rw-r--r--spec/ruby/core/module/allocate_spec.rb14
-rw-r--r--spec/ruby/core/module/ancestors_spec.rb40
-rw-r--r--spec/ruby/core/module/append_features_spec.rb28
-rw-r--r--spec/ruby/core/module/attr_accessor_spec.rb46
-rw-r--r--spec/ruby/core/module/attr_reader_spec.rb27
-rw-r--r--spec/ruby/core/module/attr_spec.rb37
-rw-r--r--spec/ruby/core/module/attr_writer_spec.rb37
-rw-r--r--spec/ruby/core/module/autoload_relative_spec.rb128
-rw-r--r--spec/ruby/core/module/autoload_spec.rb294
-rw-r--r--spec/ruby/core/module/class_variable_defined_spec.rb12
-rw-r--r--spec/ruby/core/module/class_variable_get_spec.rb16
-rw-r--r--spec/ruby/core/module/class_variable_set_spec.rb12
-rw-r--r--spec/ruby/core/module/class_variables_spec.rb16
-rw-r--r--spec/ruby/core/module/const_added_spec.rb238
-rw-r--r--spec/ruby/core/module/const_defined_spec.rb85
-rw-r--r--spec/ruby/core/module/const_get_spec.rb86
-rw-r--r--spec/ruby/core/module/const_missing_spec.rb2
-rw-r--r--spec/ruby/core/module/const_set_spec.rb58
-rw-r--r--spec/ruby/core/module/const_source_location_spec.rb381
-rw-r--r--spec/ruby/core/module/constants_spec.rb13
-rw-r--r--spec/ruby/core/module/define_method_spec.rb281
-rw-r--r--spec/ruby/core/module/deprecate_constant_spec.rb40
-rw-r--r--spec/ruby/core/module/extend_object_spec.rb24
-rw-r--r--spec/ruby/core/module/extended_spec.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_const_source_location.rb6
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_autoload_after_define.rb6
-rw-r--r--spec/ruby/core/module/fixtures/autoload_relative_a.rb9
-rw-r--r--spec/ruby/core/module/fixtures/classes.rb41
-rw-r--r--spec/ruby/core/module/fixtures/const_added.rb4
-rw-r--r--spec/ruby/core/module/fixtures/module.rb4
-rw-r--r--spec/ruby/core/module/fixtures/name.rb3
-rw-r--r--spec/ruby/core/module/fixtures/set_temporary_name.rb4
-rw-r--r--spec/ruby/core/module/gt_spec.rb10
-rw-r--r--spec/ruby/core/module/gte_spec.rb2
-rw-r--r--spec/ruby/core/module/include_spec.rb408
-rw-r--r--spec/ruby/core/module/included_modules_spec.rb8
-rw-r--r--spec/ruby/core/module/included_spec.rb2
-rw-r--r--spec/ruby/core/module/instance_method_spec.rb53
-rw-r--r--spec/ruby/core/module/instance_methods_spec.rb30
-rw-r--r--spec/ruby/core/module/lt_spec.rb10
-rw-r--r--spec/ruby/core/module/lte_spec.rb2
-rw-r--r--spec/ruby/core/module/method_added_spec.rb77
-rw-r--r--spec/ruby/core/module/method_defined_spec.rb96
-rw-r--r--spec/ruby/core/module/method_removed_spec.rb2
-rw-r--r--spec/ruby/core/module/method_undefined_spec.rb2
-rw-r--r--spec/ruby/core/module/module_function_spec.rb177
-rw-r--r--spec/ruby/core/module/name_spec.rb133
-rw-r--r--spec/ruby/core/module/new_spec.rb4
-rw-r--r--spec/ruby/core/module/prepend_features_spec.rb22
-rw-r--r--spec/ruby/core/module/prepend_spec.rb529
-rw-r--r--spec/ruby/core/module/prepended_spec.rb2
-rw-r--r--spec/ruby/core/module/private_class_method_spec.rb30
-rw-r--r--spec/ruby/core/module/private_constant_spec.rb8
-rw-r--r--spec/ruby/core/module/private_instance_methods_spec.rb18
-rw-r--r--spec/ruby/core/module/private_method_defined_spec.rb98
-rw-r--r--spec/ruby/core/module/private_spec.rb22
-rw-r--r--spec/ruby/core/module/protected_instance_methods_spec.rb12
-rw-r--r--spec/ruby/core/module/protected_method_defined_spec.rb98
-rw-r--r--spec/ruby/core/module/protected_spec.rb20
-rw-r--r--spec/ruby/core/module/public_class_method_spec.rb28
-rw-r--r--spec/ruby/core/module/public_constant_spec.rb2
-rw-r--r--spec/ruby/core/module/public_instance_method_spec.rb20
-rw-r--r--spec/ruby/core/module/public_instance_methods_spec.rb14
-rw-r--r--spec/ruby/core/module/public_method_defined_spec.rb10
-rw-r--r--spec/ruby/core/module/public_spec.rb19
-rw-r--r--spec/ruby/core/module/refine_spec.rb565
-rw-r--r--spec/ruby/core/module/refinements_spec.rb43
-rw-r--r--spec/ruby/core/module/remove_class_variable_spec.rb12
-rw-r--r--spec/ruby/core/module/remove_const_spec.rb53
-rw-r--r--spec/ruby/core/module/remove_method_spec.rb38
-rw-r--r--spec/ruby/core/module/ruby2_keywords_spec.rb248
-rw-r--r--spec/ruby/core/module/set_temporary_name_spec.rb145
-rw-r--r--spec/ruby/core/module/shared/attr_added.rb34
-rw-r--r--spec/ruby/core/module/shared/class_eval.rb29
-rw-r--r--spec/ruby/core/module/shared/class_exec.rb12
-rw-r--r--spec/ruby/core/module/shared/set_visibility.rb60
-rw-r--r--spec/ruby/core/module/to_s_spec.rb25
-rw-r--r--spec/ruby/core/module/undef_method_spec.rb34
-rw-r--r--spec/ruby/core/module/undefined_instance_methods_spec.rb25
-rw-r--r--spec/ruby/core/module/used_refinements_spec.rb85
-rw-r--r--spec/ruby/core/module/using_spec.rb14
-rw-r--r--spec/ruby/core/mutex/lock_spec.rb70
-rw-r--r--spec/ruby/core/mutex/locked_spec.rb8
-rw-r--r--spec/ruby/core/mutex/owned_spec.rb22
-rw-r--r--spec/ruby/core/mutex/sleep_spec.rb28
-rw-r--r--spec/ruby/core/mutex/synchronize_spec.rb8
-rw-r--r--spec/ruby/core/mutex/try_lock_spec.rb8
-rw-r--r--spec/ruby/core/mutex/unlock_spec.rb6
-rw-r--r--spec/ruby/core/nil/dup_spec.rb2
-rw-r--r--spec/ruby/core/nil/match_spec.rb30
-rw-r--r--spec/ruby/core/nil/nilclass_spec.rb4
-rw-r--r--spec/ruby/core/nil/rationalize_spec.rb4
-rw-r--r--spec/ruby/core/nil/singleton_method_spec.rb13
-rw-r--r--spec/ruby/core/nil/to_c_spec.rb2
-rw-r--r--spec/ruby/core/nil/to_s_spec.rb12
-rw-r--r--spec/ruby/core/numeric/abs2_spec.rb4
-rw-r--r--spec/ruby/core/numeric/clone_spec.rb15
-rw-r--r--spec/ruby/core/numeric/coerce_spec.rb12
-rw-r--r--spec/ruby/core/numeric/comparison_spec.rb8
-rw-r--r--spec/ruby/core/numeric/div_spec.rb6
-rw-r--r--spec/ruby/core/numeric/dup_spec.rb4
-rw-r--r--spec/ruby/core/numeric/eql_spec.rb12
-rw-r--r--spec/ruby/core/numeric/fdiv_spec.rb5
-rw-r--r--spec/ruby/core/numeric/finite_spec.rb2
-rw-r--r--spec/ruby/core/numeric/i_spec.rb2
-rw-r--r--spec/ruby/core/numeric/magnitude_spec.rb1
-rw-r--r--spec/ruby/core/numeric/negative_spec.rb12
-rw-r--r--spec/ruby/core/numeric/polar_spec.rb6
-rw-r--r--spec/ruby/core/numeric/positive_spec.rb12
-rw-r--r--spec/ruby/core/numeric/quo_spec.rb32
-rw-r--r--spec/ruby/core/numeric/real_spec.rb4
-rw-r--r--spec/ruby/core/numeric/remainder_spec.rb7
-rw-r--r--spec/ruby/core/numeric/shared/conj.rb2
-rw-r--r--spec/ruby/core/numeric/shared/imag.rb6
-rw-r--r--spec/ruby/core/numeric/shared/quo.rb7
-rw-r--r--spec/ruby/core/numeric/shared/rect.rb28
-rw-r--r--spec/ruby/core/numeric/shared/step.rb103
-rw-r--r--spec/ruby/core/numeric/singleton_method_added_spec.rb8
-rw-r--r--spec/ruby/core/numeric/step_spec.rb123
-rw-r--r--spec/ruby/core/numeric/to_c_spec.rb4
-rw-r--r--spec/ruby/core/objectspace/_id2ref_spec.rb74
-rw-r--r--spec/ruby/core/objectspace/add_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/call_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/define_finalizer_spec.rb149
-rw-r--r--spec/ruby/core/objectspace/each_object_spec.rb46
-rw-r--r--spec/ruby/core/objectspace/finalizers_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/garbage_collect_spec.rb8
-rw-r--r--spec/ruby/core/objectspace/remove_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/undefine_finalizer_spec.rb30
-rw-r--r--spec/ruby/core/objectspace/weakkeymap/clear_spec.rb25
-rw-r--r--spec/ruby/core/objectspace/weakkeymap/delete_spec.rb49
-rw-r--r--spec/ruby/core/objectspace/weakkeymap/element_reference_spec.rb105
-rw-r--r--spec/ruby/core/objectspace/weakkeymap/element_set_spec.rb80
-rw-r--r--spec/ruby/core/objectspace/weakkeymap/fixtures/classes.rb5
-rw-r--r--spec/ruby/core/objectspace/weakkeymap/getkey_spec.rb26
-rw-r--r--spec/ruby/core/objectspace/weakkeymap/inspect_spec.rb19
-rw-r--r--spec/ruby/core/objectspace/weakkeymap/key_spec.rb42
-rw-r--r--spec/ruby/core/objectspace/weakmap/delete_spec.rb28
-rw-r--r--spec/ruby/core/objectspace/weakmap/element_set_spec.rb53
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/each.rb2
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/include.rb16
-rw-r--r--spec/ruby/core/proc/allocate_spec.rb2
-rw-r--r--spec/ruby/core/proc/arity_spec.rb16
-rw-r--r--spec/ruby/core/proc/binding_spec.rb2
-rw-r--r--spec/ruby/core/proc/block_pass_spec.rb26
-rw-r--r--spec/ruby/core/proc/clone_spec.rb22
-rw-r--r--spec/ruby/core/proc/compose_spec.rb226
-rw-r--r--spec/ruby/core/proc/curry_spec.rb69
-rw-r--r--spec/ruby/core/proc/dup_spec.rb20
-rw-r--r--spec/ruby/core/proc/element_reference_spec.rb10
-rw-r--r--spec/ruby/core/proc/eql_spec.rb8
-rw-r--r--spec/ruby/core/proc/equal_value_spec.rb8
-rw-r--r--spec/ruby/core/proc/fixtures/common.rb23
-rw-r--r--spec/ruby/core/proc/fixtures/proc_aref.rb1
-rw-r--r--spec/ruby/core/proc/hash_spec.rb6
-rw-r--r--spec/ruby/core/proc/lambda_spec.rb43
-rw-r--r--spec/ruby/core/proc/new_spec.rb94
-rw-r--r--spec/ruby/core/proc/parameters_spec.rb100
-rw-r--r--spec/ruby/core/proc/ruby2_keywords_spec.rb66
-rw-r--r--spec/ruby/core/proc/shared/call.rb11
-rw-r--r--spec/ruby/core/proc/shared/compose.rb51
-rw-r--r--spec/ruby/core/proc/shared/dup.rb31
-rw-r--r--spec/ruby/core/proc/shared/equal.rb51
-rw-r--r--spec/ruby/core/proc/shared/to_s.rb22
-rw-r--r--spec/ruby/core/proc/source_location_spec.rb37
-rw-r--r--spec/ruby/core/proc/to_proc_spec.rb2
-rw-r--r--spec/ruby/core/process/_fork_spec.rb24
-rw-r--r--spec/ruby/core/process/argv0_spec.rb23
-rw-r--r--spec/ruby/core/process/clock_gettime_spec.rb133
-rw-r--r--spec/ruby/core/process/constants_spec.rb135
-rw-r--r--spec/ruby/core/process/daemon_spec.rb5
-rw-r--r--spec/ruby/core/process/detach_spec.rb41
-rw-r--r--spec/ruby/core/process/egid_spec.rb43
-rw-r--r--spec/ruby/core/process/euid_spec.rb18
-rw-r--r--spec/ruby/core/process/exec_spec.rb62
-rw-r--r--spec/ruby/core/process/exit_spec.rb2
-rw-r--r--spec/ruby/core/process/fixtures/argv0.rb6
-rw-r--r--spec/ruby/core/process/fixtures/clocks.rb2
-rw-r--r--spec/ruby/core/process/fixtures/kill.rb2
-rw-r--r--spec/ruby/core/process/getpriority_spec.rb8
-rw-r--r--spec/ruby/core/process/getrlimit_spec.rb14
-rw-r--r--spec/ruby/core/process/gid_spec.rb4
-rw-r--r--spec/ruby/core/process/groups_spec.rb4
-rw-r--r--spec/ruby/core/process/initgroups_spec.rb2
-rw-r--r--spec/ruby/core/process/kill_spec.rb8
-rw-r--r--spec/ruby/core/process/last_status_spec.rb2
-rw-r--r--spec/ruby/core/process/maxgroups_spec.rb2
-rw-r--r--spec/ruby/core/process/pid_spec.rb2
-rw-r--r--spec/ruby/core/process/set_proctitle_spec.rb2
-rw-r--r--spec/ruby/core/process/setrlimit_spec.rb108
-rw-r--r--spec/ruby/core/process/spawn_spec.rb187
-rw-r--r--spec/ruby/core/process/status/bit_and_spec.rb37
-rw-r--r--spec/ruby/core/process/status/equal_value_spec.rb4
-rw-r--r--spec/ruby/core/process/status/exited_spec.rb13
-rw-r--r--spec/ruby/core/process/status/exitstatus_spec.rb4
-rw-r--r--spec/ruby/core/process/status/right_shift_spec.rb36
-rw-r--r--spec/ruby/core/process/status/signaled_spec.rb12
-rw-r--r--spec/ruby/core/process/status/success_spec.rb22
-rw-r--r--spec/ruby/core/process/status/termsig_spec.rb10
-rw-r--r--spec/ruby/core/process/status/to_i_spec.rb8
-rw-r--r--spec/ruby/core/process/status/wait_spec.rb100
-rw-r--r--spec/ruby/core/process/times_spec.rb34
-rw-r--r--spec/ruby/core/process/tms/cstime_spec.rb17
-rw-r--r--spec/ruby/core/process/tms/cutime_spec.rb17
-rw-r--r--spec/ruby/core/process/tms/stime_spec.rb17
-rw-r--r--spec/ruby/core/process/tms/utime_spec.rb17
-rw-r--r--spec/ruby/core/process/uid_spec.rb6
-rw-r--r--spec/ruby/core/process/wait2_spec.rb19
-rw-r--r--spec/ruby/core/process/wait_spec.rb18
-rw-r--r--spec/ruby/core/process/waitall_spec.rb10
-rw-r--r--spec/ruby/core/process/waitpid_spec.rb3
-rw-r--r--spec/ruby/core/process/warmup_spec.rb9
-rw-r--r--spec/ruby/core/queue/deq_spec.rb5
-rw-r--r--spec/ruby/core/queue/freeze_spec.rb6
-rw-r--r--spec/ruby/core/queue/initialize_spec.rb60
-rw-r--r--spec/ruby/core/queue/pop_spec.rb5
-rw-r--r--spec/ruby/core/queue/shift_spec.rb5
-rw-r--r--spec/ruby/core/random/bytes_spec.rb11
-rw-r--r--spec/ruby/core/random/default_spec.rb35
-rw-r--r--spec/ruby/core/random/new_seed_spec.rb2
-rw-r--r--spec/ruby/core/random/new_spec.rb9
-rw-r--r--spec/ruby/core/random/rand_spec.rb39
-rw-r--r--spec/ruby/core/random/random_number_spec.rb4
-rw-r--r--spec/ruby/core/random/raw_seed_spec.rb6
-rw-r--r--spec/ruby/core/random/seed_spec.rb2
-rw-r--r--spec/ruby/core/random/shared/bytes.rb2
-rw-r--r--spec/ruby/core/random/shared/rand.rb4
-rw-r--r--spec/ruby/core/random/shared/urandom.rb23
-rw-r--r--spec/ruby/core/random/urandom_spec.rb25
-rw-r--r--spec/ruby/core/range/bsearch_spec.rb460
-rw-r--r--spec/ruby/core/range/case_compare_spec.rb30
-rw-r--r--spec/ruby/core/range/clone_spec.rb26
-rw-r--r--spec/ruby/core/range/count_spec.rb16
-rw-r--r--spec/ruby/core/range/cover_spec.rb6
-rw-r--r--spec/ruby/core/range/dup_spec.rb10
-rw-r--r--spec/ruby/core/range/each_spec.rb63
-rw-r--r--spec/ruby/core/range/eql_spec.rb2
-rw-r--r--spec/ruby/core/range/equal_value_spec.rb12
-rw-r--r--spec/ruby/core/range/first_spec.rb14
-rw-r--r--spec/ruby/core/range/frozen_spec.rb25
-rw-r--r--spec/ruby/core/range/hash_spec.rb8
-rw-r--r--spec/ruby/core/range/include_spec.rb6
-rw-r--r--spec/ruby/core/range/initialize_spec.rb31
-rw-r--r--spec/ruby/core/range/inspect_spec.rb36
-rw-r--r--spec/ruby/core/range/last_spec.rb18
-rw-r--r--spec/ruby/core/range/max_spec.rb64
-rw-r--r--spec/ruby/core/range/member_spec.rb2
-rw-r--r--spec/ruby/core/range/min_spec.rb42
-rw-r--r--spec/ruby/core/range/minmax_spec.rb146
-rw-r--r--spec/ruby/core/range/new_spec.rb58
-rw-r--r--spec/ruby/core/range/overlap_spec.rb87
-rw-r--r--spec/ruby/core/range/percent_spec.rb24
-rw-r--r--spec/ruby/core/range/reverse_each_spec.rb125
-rw-r--r--spec/ruby/core/range/shared/cover.rb182
-rw-r--r--spec/ruby/core/range/shared/cover_and_include.rb57
-rw-r--r--spec/ruby/core/range/shared/equal_value.rb10
-rw-r--r--spec/ruby/core/range/shared/include.rb34
-rw-r--r--spec/ruby/core/range/size_spec.rb82
-rw-r--r--spec/ruby/core/range/step_spec.rb643
-rw-r--r--spec/ruby/core/range/to_a_spec.rb19
-rw-r--r--spec/ruby/core/range/to_s_spec.rb23
-rw-r--r--spec/ruby/core/range/to_set_spec.rb54
-rw-r--r--spec/ruby/core/rational/abs_spec.rb3
-rw-r--r--spec/ruby/core/rational/ceil_spec.rb47
-rw-r--r--spec/ruby/core/rational/coerce_spec.rb5
-rw-r--r--spec/ruby/core/rational/comparison_spec.rb85
-rw-r--r--spec/ruby/core/rational/denominator_spec.rb13
-rw-r--r--spec/ruby/core/rational/div_spec.rb47
-rw-r--r--spec/ruby/core/rational/divide_spec.rb67
-rw-r--r--spec/ruby/core/rational/divmod_spec.rb37
-rw-r--r--spec/ruby/core/rational/equal_value_spec.rb32
-rw-r--r--spec/ruby/core/rational/exponent_spec.rb235
-rw-r--r--spec/ruby/core/rational/fdiv_spec.rb4
-rw-r--r--spec/ruby/core/rational/fixtures/rational.rb (renamed from spec/ruby/fixtures/rational.rb)0
-rw-r--r--spec/ruby/core/rational/floor_spec.rb48
-rw-r--r--spec/ruby/core/rational/hash_spec.rb8
-rw-r--r--spec/ruby/core/rational/inspect_spec.rb13
-rw-r--r--spec/ruby/core/rational/integer_spec.rb5
-rw-r--r--spec/ruby/core/rational/magnitude_spec.rb3
-rw-r--r--spec/ruby/core/rational/marshal_dump_spec.rb2
-rw-r--r--spec/ruby/core/rational/minus_spec.rb50
-rw-r--r--spec/ruby/core/rational/modulo_spec.rb42
-rw-r--r--spec/ruby/core/rational/multiply_spec.rb58
-rw-r--r--spec/ruby/core/rational/numerator_spec.rb9
-rw-r--r--spec/ruby/core/rational/plus_spec.rb44
-rw-r--r--spec/ruby/core/rational/quo_spec.rb24
-rw-r--r--spec/ruby/core/rational/rational_spec.rb4
-rw-r--r--spec/ruby/core/rational/rationalize_spec.rb4
-rw-r--r--spec/ruby/core/rational/remainder_spec.rb4
-rw-r--r--spec/ruby/core/rational/round_spec.rb104
-rw-r--r--spec/ruby/core/rational/shared/abs.rb11
-rw-r--r--spec/ruby/core/rational/shared/arithmetic_exception_in_coerce.rb11
-rw-r--r--spec/ruby/core/rational/to_f_spec.rb15
-rw-r--r--spec/ruby/core/rational/to_i_spec.rb11
-rw-r--r--spec/ruby/core/rational/to_r_spec.rb14
-rw-r--r--spec/ruby/core/rational/to_s_spec.rb13
-rw-r--r--spec/ruby/core/rational/truncate_spec.rb70
-rw-r--r--spec/ruby/core/rational/zero_spec.rb7
-rw-r--r--spec/ruby/core/refinement/append_features_spec.rb19
-rw-r--r--spec/ruby/core/refinement/extend_object_spec.rb21
-rw-r--r--spec/ruby/core/refinement/fixtures/classes.rb10
-rw-r--r--spec/ruby/core/refinement/import_methods_spec.rb287
-rw-r--r--spec/ruby/core/refinement/include_spec.rb13
-rw-r--r--spec/ruby/core/refinement/prepend_features_spec.rb19
-rw-r--r--spec/ruby/core/refinement/prepend_spec.rb13
-rw-r--r--spec/ruby/core/refinement/refined_class_spec.rb34
-rw-r--r--spec/ruby/core/refinement/shared/target.rb13
-rw-r--r--spec/ruby/core/refinement/target_spec.rb6
-rw-r--r--spec/ruby/core/regexp/case_compare_spec.rb22
-rw-r--r--spec/ruby/core/regexp/compile_spec.rb4
-rw-r--r--spec/ruby/core/regexp/encoding_spec.rb2
-rw-r--r--spec/ruby/core/regexp/fixed_encoding_spec.rb16
-rw-r--r--spec/ruby/core/regexp/initialize_spec.rb24
-rw-r--r--spec/ruby/core/regexp/last_match_spec.rb6
-rw-r--r--spec/ruby/core/regexp/linear_time_spec.rb80
-rw-r--r--spec/ruby/core/regexp/match_spec.rb38
-rw-r--r--spec/ruby/core/regexp/named_captures_spec.rb4
-rw-r--r--spec/ruby/core/regexp/names_spec.rb4
-rw-r--r--spec/ruby/core/regexp/new_spec.rb14
-rw-r--r--spec/ruby/core/regexp/options_spec.rb6
-rw-r--r--spec/ruby/core/regexp/shared/new.rb398
-rw-r--r--spec/ruby/core/regexp/shared/quote.rb26
-rw-r--r--spec/ruby/core/regexp/source_spec.rb26
-rw-r--r--spec/ruby/core/regexp/timeout_spec.rb33
-rw-r--r--spec/ruby/core/regexp/try_convert_spec.rb8
-rw-r--r--spec/ruby/core/regexp/union_spec.rb51
-rw-r--r--spec/ruby/core/set/add_spec.rb34
-rw-r--r--spec/ruby/core/set/append_spec.rb6
-rw-r--r--spec/ruby/core/set/case_compare_spec.rb11
-rw-r--r--spec/ruby/core/set/case_equality_spec.rb6
-rw-r--r--spec/ruby/core/set/classify_spec.rb26
-rw-r--r--spec/ruby/core/set/clear_spec.rb16
-rw-r--r--spec/ruby/core/set/collect_spec.rb6
-rw-r--r--spec/ruby/core/set/compare_by_identity_spec.rb153
-rw-r--r--spec/ruby/core/set/comparison_spec.rb26
-rw-r--r--spec/ruby/core/set/constructor_spec.rb14
-rw-r--r--spec/ruby/core/set/delete_if_spec.rb37
-rw-r--r--spec/ruby/core/set/delete_spec.rb36
-rw-r--r--spec/ruby/core/set/difference_spec.rb6
-rw-r--r--spec/ruby/core/set/disjoint_spec.rb22
-rw-r--r--spec/ruby/core/set/divide_spec.rb68
-rw-r--r--spec/ruby/core/set/each_spec.rb26
-rw-r--r--spec/ruby/core/set/empty_spec.rb9
-rw-r--r--spec/ruby/core/set/enumerable/to_set_spec.rb12
-rw-r--r--spec/ruby/core/set/eql_spec.rb14
-rw-r--r--spec/ruby/core/set/equal_value_spec.rb34
-rw-r--r--spec/ruby/core/set/exclusion_spec.rb17
-rw-r--r--spec/ruby/core/set/filter_spec.rb6
-rw-r--r--spec/ruby/core/set/fixtures/set_like.rb30
-rw-r--r--spec/ruby/core/set/flatten_merge_spec.rb24
-rw-r--r--spec/ruby/core/set/flatten_spec.rb49
-rw-r--r--spec/ruby/core/set/hash_spec.rb19
-rw-r--r--spec/ruby/core/set/include_spec.rb6
-rw-r--r--spec/ruby/core/set/initialize_clone_spec.rb15
-rw-r--r--spec/ruby/core/set/initialize_spec.rb88
-rw-r--r--spec/ruby/core/set/inspect_spec.rb6
-rw-r--r--spec/ruby/core/set/intersect_spec.rb22
-rw-r--r--spec/ruby/core/set/intersection_spec.rb10
-rw-r--r--spec/ruby/core/set/join_spec.rb30
-rw-r--r--spec/ruby/core/set/keep_if_spec.rb37
-rw-r--r--spec/ruby/core/set/length_spec.rb6
-rw-r--r--spec/ruby/core/set/map_spec.rb6
-rw-r--r--spec/ruby/core/set/member_spec.rb6
-rw-r--r--spec/ruby/core/set/merge_spec.rb29
-rw-r--r--spec/ruby/core/set/minus_spec.rb6
-rw-r--r--spec/ruby/core/set/plus_spec.rb6
-rw-r--r--spec/ruby/core/set/pretty_print_cycle_spec.rb14
-rw-r--r--spec/ruby/core/set/proper_subset_spec.rb35
-rw-r--r--spec/ruby/core/set/proper_superset_spec.rb42
-rw-r--r--spec/ruby/core/set/reject_spec.rb41
-rw-r--r--spec/ruby/core/set/replace_spec.rb24
-rw-r--r--spec/ruby/core/set/select_spec.rb (renamed from spec/ruby/library/set/select_spec.rb)0
-rw-r--r--spec/ruby/core/set/set_spec.rb10
-rw-r--r--spec/ruby/core/set/shared/add.rb14
-rw-r--r--spec/ruby/core/set/shared/collect.rb20
-rw-r--r--spec/ruby/core/set/shared/difference.rb15
-rw-r--r--spec/ruby/core/set/shared/include.rb29
-rw-r--r--spec/ruby/core/set/shared/inspect.rb45
-rw-r--r--spec/ruby/core/set/shared/intersection.rb15
-rw-r--r--spec/ruby/core/set/shared/length.rb (renamed from spec/ruby/library/set/shared/length.rb)0
-rw-r--r--spec/ruby/core/set/shared/select.rb41
-rw-r--r--spec/ruby/core/set/shared/union.rb15
-rw-r--r--spec/ruby/core/set/size_spec.rb6
-rw-r--r--spec/ruby/core/set/sortedset/sortedset_spec.rb13
-rw-r--r--spec/ruby/core/set/subset_spec.rb35
-rw-r--r--spec/ruby/core/set/subtract_spec.rb16
-rw-r--r--spec/ruby/core/set/superset_spec.rb42
-rw-r--r--spec/ruby/core/set/to_a_spec.rb7
-rw-r--r--spec/ruby/core/set/to_s_spec.rb11
-rw-r--r--spec/ruby/core/set/union_spec.rb10
-rw-r--r--spec/ruby/core/signal/signame_spec.rb14
-rw-r--r--spec/ruby/core/signal/trap_spec.rb188
-rw-r--r--spec/ruby/core/sizedqueue/append_spec.rb5
-rw-r--r--spec/ruby/core/sizedqueue/deq_spec.rb5
-rw-r--r--spec/ruby/core/sizedqueue/enq_spec.rb5
-rw-r--r--spec/ruby/core/sizedqueue/freeze_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/pop_spec.rb5
-rw-r--r--spec/ruby/core/sizedqueue/push_spec.rb5
-rw-r--r--spec/ruby/core/sizedqueue/shift_spec.rb5
-rw-r--r--spec/ruby/core/string/allocate_spec.rb4
-rw-r--r--spec/ruby/core/string/append_as_bytes_spec.rb60
-rw-r--r--spec/ruby/core/string/append_spec.rb6
-rw-r--r--spec/ruby/core/string/ascii_only_spec.rb41
-rw-r--r--spec/ruby/core/string/b_spec.rb12
-rw-r--r--spec/ruby/core/string/byteindex_spec.rb298
-rw-r--r--spec/ruby/core/string/byterindex_spec.rb353
-rw-r--r--spec/ruby/core/string/bytes_spec.rb8
-rw-r--r--spec/ruby/core/string/bytesize_spec.rb12
-rw-r--r--spec/ruby/core/string/byteslice_spec.rb18
-rw-r--r--spec/ruby/core/string/bytesplice_spec.rb290
-rw-r--r--spec/ruby/core/string/capitalize_spec.rb75
-rw-r--r--spec/ruby/core/string/casecmp_spec.rb20
-rw-r--r--spec/ruby/core/string/center_spec.rb71
-rw-r--r--spec/ruby/core/string/chars_spec.rb8
-rw-r--r--spec/ruby/core/string/chilled_string_spec.rb151
-rw-r--r--spec/ruby/core/string/chomp_spec.rb116
-rw-r--r--spec/ruby/core/string/chop_spec.rb35
-rw-r--r--spec/ruby/core/string/chr_spec.rb4
-rw-r--r--spec/ruby/core/string/clear_spec.rb7
-rw-r--r--spec/ruby/core/string/clone_spec.rb8
-rw-r--r--spec/ruby/core/string/codepoints_spec.rb8
-rw-r--r--spec/ruby/core/string/comparison_spec.rb14
-rw-r--r--spec/ruby/core/string/concat_spec.rb9
-rw-r--r--spec/ruby/core/string/count_spec.rb14
-rw-r--r--spec/ruby/core/string/crypt_spec.rb60
-rw-r--r--spec/ruby/core/string/dedup_spec.rb6
-rw-r--r--spec/ruby/core/string/delete_prefix_spec.rb37
-rw-r--r--spec/ruby/core/string/delete_spec.rb42
-rw-r--r--spec/ruby/core/string/delete_suffix_spec.rb37
-rw-r--r--spec/ruby/core/string/downcase_spec.rb53
-rw-r--r--spec/ruby/core/string/dump_spec.rb34
-rw-r--r--spec/ruby/core/string/dup_spec.rb19
-rw-r--r--spec/ruby/core/string/each_byte_spec.rb20
-rw-r--r--spec/ruby/core/string/each_char_spec.rb1
-rw-r--r--spec/ruby/core/string/each_grapheme_cluster_spec.rb7
-rw-r--r--spec/ruby/core/string/element_set_spec.rb117
-rw-r--r--spec/ruby/core/string/encode_spec.rb128
-rw-r--r--spec/ruby/core/string/encoding_spec.rb37
-rw-r--r--spec/ruby/core/string/eql_spec.rb8
-rw-r--r--spec/ruby/core/string/fixtures/iso-8859-9-encoding.rb2
-rw-r--r--spec/ruby/core/string/fixtures/to_c.rb5
-rw-r--r--spec/ruby/core/string/fixtures/utf-8-encoding.rb7
-rw-r--r--spec/ruby/core/string/force_encoding_spec.rb13
-rw-r--r--spec/ruby/core/string/freeze_spec.rb5
-rw-r--r--spec/ruby/core/string/getbyte_spec.rb12
-rw-r--r--spec/ruby/core/string/grapheme_clusters_spec.rb1
-rw-r--r--spec/ruby/core/string/gsub_spec.rb249
-rw-r--r--spec/ruby/core/string/include_spec.rb22
-rw-r--r--spec/ruby/core/string/index_spec.rb39
-rw-r--r--spec/ruby/core/string/initialize_spec.rb4
-rw-r--r--spec/ruby/core/string/insert_spec.rb39
-rw-r--r--spec/ruby/core/string/inspect_spec.rb40
-rw-r--r--spec/ruby/core/string/lines_spec.rb1
-rw-r--r--spec/ruby/core/string/ljust_spec.rb69
-rw-r--r--spec/ruby/core/string/lstrip_spec.rb64
-rw-r--r--spec/ruby/core/string/match_spec.rb34
-rw-r--r--spec/ruby/core/string/modulo_spec.rb249
-rw-r--r--spec/ruby/core/string/new_spec.rb10
-rw-r--r--spec/ruby/core/string/ord_spec.rb9
-rw-r--r--spec/ruby/core/string/partition_spec.rb29
-rw-r--r--spec/ruby/core/string/plus_spec.rb36
-rw-r--r--spec/ruby/core/string/prepend_spec.rb23
-rw-r--r--spec/ruby/core/string/reverse_spec.rb38
-rw-r--r--spec/ruby/core/string/rindex_spec.rb38
-rw-r--r--spec/ruby/core/string/rjust_spec.rb69
-rw-r--r--spec/ruby/core/string/rpartition_spec.rb42
-rw-r--r--spec/ruby/core/string/rstrip_spec.rb50
-rw-r--r--spec/ruby/core/string/scan_spec.rb82
-rw-r--r--spec/ruby/core/string/scrub_spec.rb69
-rw-r--r--spec/ruby/core/string/setbyte_spec.rb23
-rw-r--r--spec/ruby/core/string/shared/byte_index_common.rb63
-rw-r--r--spec/ruby/core/string/shared/chars.rb44
-rw-r--r--spec/ruby/core/string/shared/codepoints.rb27
-rw-r--r--spec/ruby/core/string/shared/concat.rb75
-rw-r--r--spec/ruby/core/string/shared/dedup.rb51
-rw-r--r--spec/ruby/core/string/shared/each_char_without_block.rb2
-rw-r--r--spec/ruby/core/string/shared/each_codepoint_without_block.rb14
-rw-r--r--spec/ruby/core/string/shared/each_line.rb92
-rw-r--r--spec/ruby/core/string/shared/each_line_without_block.rb2
-rw-r--r--spec/ruby/core/string/shared/encode.rb215
-rw-r--r--spec/ruby/core/string/shared/eql.rb22
-rw-r--r--spec/ruby/core/string/shared/equal_value.rb10
-rw-r--r--spec/ruby/core/string/shared/grapheme_clusters.rb11
-rw-r--r--spec/ruby/core/string/shared/length.rb28
-rw-r--r--spec/ruby/core/string/shared/partition.rb33
-rw-r--r--spec/ruby/core/string/shared/replace.rb45
-rw-r--r--spec/ruby/core/string/shared/slice.rb350
-rw-r--r--spec/ruby/core/string/shared/strip.rb14
-rw-r--r--spec/ruby/core/string/shared/succ.rb35
-rw-r--r--spec/ruby/core/string/shared/to_a.rb9
-rw-r--r--spec/ruby/core/string/shared/to_s.rb11
-rw-r--r--spec/ruby/core/string/shared/to_sym.rb43
-rw-r--r--spec/ruby/core/string/slice_spec.rb222
-rw-r--r--spec/ruby/core/string/split_spec.rb401
-rw-r--r--spec/ruby/core/string/squeeze_spec.rb48
-rw-r--r--spec/ruby/core/string/start_with_spec.rb10
-rw-r--r--spec/ruby/core/string/strip_spec.rb42
-rw-r--r--spec/ruby/core/string/sub_spec.rb208
-rw-r--r--spec/ruby/core/string/swapcase_spec.rb57
-rw-r--r--spec/ruby/core/string/to_c_spec.rb116
-rw-r--r--spec/ruby/core/string/to_f_spec.rb104
-rw-r--r--spec/ruby/core/string/to_i_spec.rb30
-rw-r--r--spec/ruby/core/string/to_r_spec.rb6
-rw-r--r--spec/ruby/core/string/tr_s_spec.rb39
-rw-r--r--spec/ruby/core/string/tr_spec.rb43
-rw-r--r--spec/ruby/core/string/try_convert_spec.rb16
-rw-r--r--spec/ruby/core/string/uminus_spec.rb77
-rw-r--r--spec/ruby/core/string/undump_spec.rb48
-rw-r--r--spec/ruby/core/string/unicode_normalize_spec.rb9
-rw-r--r--spec/ruby/core/string/unicode_normalized_spec.rb21
-rw-r--r--spec/ruby/core/string/unpack/a_spec.rb4
-rw-r--r--spec/ruby/core/string/unpack/at_spec.rb4
-rw-r--r--spec/ruby/core/string/unpack/b_spec.rb22
-rw-r--r--spec/ruby/core/string/unpack/c_spec.rb8
-rw-r--r--spec/ruby/core/string/unpack/carret_spec.rb43
-rw-r--r--spec/ruby/core/string/unpack/comment_spec.rb2
-rw-r--r--spec/ruby/core/string/unpack/h_spec.rb14
-rw-r--r--spec/ruby/core/string/unpack/l_spec.rb16
-rw-r--r--spec/ruby/core/string/unpack/m_spec.rb9
-rw-r--r--spec/ruby/core/string/unpack/p_spec.rb16
-rw-r--r--spec/ruby/core/string/unpack/percent_spec.rb2
-rw-r--r--spec/ruby/core/string/unpack/r_spec.rb85
-rw-r--r--spec/ruby/core/string/unpack/shared/basic.rb18
-rw-r--r--spec/ruby/core/string/unpack/shared/float.rb36
-rw-r--r--spec/ruby/core/string/unpack/shared/integer.rb40
-rw-r--r--spec/ruby/core/string/unpack/shared/taint.rb81
-rw-r--r--spec/ruby/core/string/unpack/shared/unicode.rb6
-rw-r--r--spec/ruby/core/string/unpack/u_spec.rb8
-rw-r--r--spec/ruby/core/string/unpack/w_spec.rb8
-rw-r--r--spec/ruby/core/string/unpack/x_spec.rb8
-rw-r--r--spec/ruby/core/string/unpack/z_spec.rb7
-rw-r--r--spec/ruby/core/string/unpack1_spec.rb51
-rw-r--r--spec/ruby/core/string/unpack_spec.rb46
-rw-r--r--spec/ruby/core/string/upcase_spec.rb55
-rw-r--r--spec/ruby/core/string/uplus_spec.rb48
-rw-r--r--spec/ruby/core/string/upto_spec.rb14
-rw-r--r--spec/ruby/core/string/valid_encoding/utf_8_spec.rb214
-rw-r--r--spec/ruby/core/string/valid_encoding_spec.rb210
-rw-r--r--spec/ruby/core/struct/constants_spec.rb13
-rw-r--r--spec/ruby/core/struct/deconstruct_keys_spec.rb200
-rw-r--r--spec/ruby/core/struct/deconstruct_spec.rb12
-rw-r--r--spec/ruby/core/struct/dig_spec.rb14
-rw-r--r--spec/ruby/core/struct/each_pair_spec.rb4
-rw-r--r--spec/ruby/core/struct/each_spec.rb2
-rw-r--r--spec/ruby/core/struct/element_reference_spec.rb14
-rw-r--r--spec/ruby/core/struct/element_set_spec.rb15
-rw-r--r--spec/ruby/core/struct/eql_spec.rb2
-rw-r--r--spec/ruby/core/struct/filter_spec.rb10
-rw-r--r--spec/ruby/core/struct/fixtures/classes.rb9
-rw-r--r--spec/ruby/core/struct/hash_spec.rb8
-rw-r--r--spec/ruby/core/struct/initialize_spec.rb33
-rw-r--r--spec/ruby/core/struct/inspect_spec.rb5
-rw-r--r--spec/ruby/core/struct/instance_variable_get_spec.rb2
-rw-r--r--spec/ruby/core/struct/keyword_init_spec.rb45
-rw-r--r--spec/ruby/core/struct/members_spec.rb12
-rw-r--r--spec/ruby/core/struct/new_spec.rb118
-rw-r--r--spec/ruby/core/struct/shared/inspect.rb35
-rw-r--r--spec/ruby/core/struct/shared/select.rb6
-rw-r--r--spec/ruby/core/struct/struct_spec.rb9
-rw-r--r--spec/ruby/core/struct/to_h_spec.rb90
-rw-r--r--spec/ruby/core/struct/values_at_spec.rb55
-rw-r--r--spec/ruby/core/symbol/all_symbols_spec.rb8
-rw-r--r--spec/ruby/core/symbol/capitalize_spec.rb2
-rw-r--r--spec/ruby/core/symbol/casecmp_spec.rb14
-rw-r--r--spec/ruby/core/symbol/comparison_spec.rb6
-rw-r--r--spec/ruby/core/symbol/downcase_spec.rb2
-rw-r--r--spec/ruby/core/symbol/dup_spec.rb2
-rw-r--r--spec/ruby/core/symbol/empty_spec.rb4
-rw-r--r--spec/ruby/core/symbol/end_with_spec.rb6
-rw-r--r--spec/ruby/core/symbol/inspect_spec.rb34
-rw-r--r--spec/ruby/core/symbol/intern_spec.rb2
-rw-r--r--spec/ruby/core/symbol/match_spec.rb18
-rw-r--r--spec/ruby/core/symbol/name_spec.rb17
-rw-r--r--spec/ruby/core/symbol/shared/id2name.rb21
-rw-r--r--spec/ruby/core/symbol/shared/slice.rb78
-rw-r--r--spec/ruby/core/symbol/start_with_spec.rb6
-rw-r--r--spec/ruby/core/symbol/swapcase_spec.rb2
-rw-r--r--spec/ruby/core/symbol/symbol_spec.rb4
-rw-r--r--spec/ruby/core/symbol/to_proc_spec.rb62
-rw-r--r--spec/ruby/core/symbol/upcase_spec.rb2
-rw-r--r--spec/ruby/core/thread/abort_on_exception_spec.rb10
-rw-r--r--spec/ruby/core/thread/allocate_spec.rb2
-rw-r--r--spec/ruby/core/thread/backtrace/limit_spec.rb13
-rw-r--r--spec/ruby/core/thread/backtrace/location/absolute_path_spec.rb20
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/classes.rb104
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/subdir/absolute_path_main_chdir.rb11
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/subdir/sibling.rb1
-rw-r--r--spec/ruby/core/thread/backtrace/location/inspect_spec.rb2
-rw-r--r--spec/ruby/core/thread/backtrace/location/label_spec.rb204
-rw-r--r--spec/ruby/core/thread/backtrace/location/lineno_spec.rb2
-rw-r--r--spec/ruby/core/thread/backtrace/location/path_spec.rb2
-rw-r--r--spec/ruby/core/thread/backtrace/location/to_s_spec.rb2
-rw-r--r--spec/ruby/core/thread/backtrace_locations_spec.rb30
-rw-r--r--spec/ruby/core/thread/backtrace_spec.rb6
-rw-r--r--spec/ruby/core/thread/current_spec.rb10
-rw-r--r--spec/ruby/core/thread/each_caller_location_spec.rb47
-rw-r--r--spec/ruby/core/thread/element_reference_spec.rb15
-rw-r--r--spec/ruby/core/thread/element_set_spec.rb31
-rw-r--r--spec/ruby/core/thread/exclusive_spec.rb49
-rw-r--r--spec/ruby/core/thread/exit_spec.rb2
-rw-r--r--spec/ruby/core/thread/fetch_spec.rb36
-rw-r--r--spec/ruby/core/thread/fixtures/classes.rb27
-rw-r--r--spec/ruby/core/thread/group_spec.rb15
-rw-r--r--spec/ruby/core/thread/handle_interrupt_spec.rb125
-rw-r--r--spec/ruby/core/thread/ignore_deadlock_spec.rb19
-rw-r--r--spec/ruby/core/thread/initialize_spec.rb2
-rw-r--r--spec/ruby/core/thread/join_spec.rb20
-rw-r--r--spec/ruby/core/thread/key_spec.rb23
-rw-r--r--spec/ruby/core/thread/keys_spec.rb12
-rw-r--r--spec/ruby/core/thread/kill_spec.rb6
-rw-r--r--spec/ruby/core/thread/list_spec.rb12
-rw-r--r--spec/ruby/core/thread/name_spec.rb2
-rw-r--r--spec/ruby/core/thread/native_thread_id_spec.rb31
-rw-r--r--spec/ruby/core/thread/new_spec.rb4
-rw-r--r--spec/ruby/core/thread/pending_interrupt_spec.rb32
-rw-r--r--spec/ruby/core/thread/priority_spec.rb8
-rw-r--r--spec/ruby/core/thread/raise_spec.rb91
-rw-r--r--spec/ruby/core/thread/report_on_exception_spec.rb57
-rw-r--r--spec/ruby/core/thread/shared/exit.rb47
-rw-r--r--spec/ruby/core/thread/shared/start.rb8
-rw-r--r--spec/ruby/core/thread/shared/to_s.rb24
-rw-r--r--spec/ruby/core/thread/shared/wakeup.rb5
-rw-r--r--spec/ruby/core/thread/thread_variable_get_spec.rb45
-rw-r--r--spec/ruby/core/thread/thread_variable_set_spec.rb44
-rw-r--r--spec/ruby/core/thread/thread_variable_spec.rb47
-rw-r--r--spec/ruby/core/thread/thread_variables_spec.rb25
-rw-r--r--spec/ruby/core/thread/value_spec.rb2
-rw-r--r--spec/ruby/core/threadgroup/default_spec.rb2
-rw-r--r--spec/ruby/core/threadgroup/enclose_spec.rb2
-rw-r--r--spec/ruby/core/threadgroup/enclosed_spec.rb4
-rw-r--r--spec/ruby/core/threadgroup/list_spec.rb4
-rw-r--r--spec/ruby/core/time/_dump_spec.rb6
-rw-r--r--spec/ruby/core/time/_load_spec.rb7
-rw-r--r--spec/ruby/core/time/at_spec.rb168
-rw-r--r--spec/ruby/core/time/ceil_spec.rb64
-rw-r--r--spec/ruby/core/time/comparison_spec.rb28
-rw-r--r--spec/ruby/core/time/deconstruct_keys_spec.rb43
-rw-r--r--spec/ruby/core/time/dup_spec.rb14
-rw-r--r--spec/ruby/core/time/eql_spec.rb16
-rw-r--r--spec/ruby/core/time/fixtures/classes.rb1
-rw-r--r--spec/ruby/core/time/floor_spec.rb52
-rw-r--r--spec/ruby/core/time/getlocal_spec.rb151
-rw-r--r--spec/ruby/core/time/hash_spec.rb2
-rw-r--r--spec/ruby/core/time/inspect_spec.rb34
-rw-r--r--spec/ruby/core/time/iso8601_spec.rb6
-rw-r--r--spec/ruby/core/time/localtime_spec.rb83
-rw-r--r--spec/ruby/core/time/minus_spec.rb28
-rw-r--r--spec/ruby/core/time/new_spec.rb752
-rw-r--r--spec/ruby/core/time/now_spec.rb175
-rw-r--r--spec/ruby/core/time/plus_spec.rb28
-rw-r--r--spec/ruby/core/time/round_spec.rb4
-rw-r--r--spec/ruby/core/time/shared/gmtime.rb17
-rw-r--r--spec/ruby/core/time/shared/inspect.rb2
-rw-r--r--spec/ruby/core/time/shared/local.rb11
-rw-r--r--spec/ruby/core/time/shared/now.rb16
-rw-r--r--spec/ruby/core/time/shared/time_params.rb41
-rw-r--r--spec/ruby/core/time/shared/xmlschema.rb31
-rw-r--r--spec/ruby/core/time/strftime_spec.rb41
-rw-r--r--spec/ruby/core/time/subsec_spec.rb12
-rw-r--r--spec/ruby/core/time/succ_spec.rb41
-rw-r--r--spec/ruby/core/time/to_r_spec.rb4
-rw-r--r--spec/ruby/core/time/utc_spec.rb49
-rw-r--r--spec/ruby/core/time/xmlschema_spec.rb6
-rw-r--r--spec/ruby/core/time/yday_spec.rb13
-rw-r--r--spec/ruby/core/time/zone_spec.rb31
-rw-r--r--spec/ruby/core/tracepoint/allow_reentry_spec.rb30
-rw-r--r--spec/ruby/core/tracepoint/binding_spec.rb2
-rw-r--r--spec/ruby/core/tracepoint/defined_class_spec.rb10
-rw-r--r--spec/ruby/core/tracepoint/enable_spec.rb560
-rw-r--r--spec/ruby/core/tracepoint/eval_script_spec.rb30
-rw-r--r--spec/ruby/core/tracepoint/event_spec.rb6
-rw-r--r--spec/ruby/core/tracepoint/inspect_spec.rb48
-rw-r--r--spec/ruby/core/tracepoint/lineno_spec.rb2
-rw-r--r--spec/ruby/core/tracepoint/method_id_spec.rb2
-rw-r--r--spec/ruby/core/tracepoint/new_spec.rb22
-rw-r--r--spec/ruby/core/tracepoint/parameters_spec.rb42
-rw-r--r--spec/ruby/core/tracepoint/path_spec.rb4
-rw-r--r--spec/ruby/core/tracepoint/raised_exception_spec.rb18
-rw-r--r--spec/ruby/core/tracepoint/self_spec.rb4
-rw-r--r--spec/ruby/core/true/dup_spec.rb2
-rw-r--r--spec/ruby/core/true/singleton_method_spec.rb13
-rw-r--r--spec/ruby/core/true/to_s_spec.rb12
-rw-r--r--spec/ruby/core/true/trueclass_spec.rb4
-rw-r--r--spec/ruby/core/unboundmethod/bind_call_spec.rb82
-rw-r--r--spec/ruby/core/unboundmethod/bind_spec.rb24
-rw-r--r--spec/ruby/core/unboundmethod/clone_spec.rb13
-rw-r--r--spec/ruby/core/unboundmethod/dup_spec.rb15
-rw-r--r--spec/ruby/core/unboundmethod/equal_value_spec.rb86
-rw-r--r--spec/ruby/core/unboundmethod/fixtures/classes.rb37
-rw-r--r--spec/ruby/core/unboundmethod/hash_spec.rb7
-rw-r--r--spec/ruby/core/unboundmethod/inspect_spec.rb2
-rw-r--r--spec/ruby/core/unboundmethod/original_name_spec.rb37
-rw-r--r--spec/ruby/core/unboundmethod/owner_spec.rb5
-rw-r--r--spec/ruby/core/unboundmethod/private_spec.rb9
-rw-r--r--spec/ruby/core/unboundmethod/protected_spec.rb9
-rw-r--r--spec/ruby/core/unboundmethod/public_spec.rb9
-rw-r--r--spec/ruby/core/unboundmethod/shared/dup.rb32
-rw-r--r--spec/ruby/core/unboundmethod/shared/to_s.rb9
-rw-r--r--spec/ruby/core/unboundmethod/source_location_spec.rb13
-rw-r--r--spec/ruby/core/unboundmethod/super_method_spec.rb21
-rw-r--r--spec/ruby/core/unboundmethod/to_s_spec.rb2
-rw-r--r--spec/ruby/core/warning/categories_spec.rb12
-rw-r--r--spec/ruby/core/warning/element_reference_spec.rb33
-rw-r--r--spec/ruby/core/warning/element_set_spec.rb52
-rw-r--r--spec/ruby/core/warning/performance_warning_spec.rb28
-rw-r--r--spec/ruby/core/warning/warn_spec.rb138
-rw-r--r--spec/ruby/default.mspec6
-rw-r--r--spec/ruby/fixtures/class.rb4
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.dylib1
-rw-r--r--spec/ruby/fixtures/code/c/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/concurrent.rb2
-rw-r--r--spec/ruby/fixtures/code/concurrent_require_fixture.rb4
-rw-r--r--spec/ruby/fixtures/code/d/load_fixture.rb.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.dylib1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.dylib1
-rw-r--r--spec/ruby/fixtures/code/load_wrap_fixture.rb12
-rw-r--r--spec/ruby/fixtures/code/wrap_fixture.rb9
-rw-r--r--spec/ruby/fixtures/constants.rb26
-rw-r--r--spec/ruby/fixtures/io.rb12
-rw-r--r--spec/ruby/language/BEGIN_spec.rb2
-rw-r--r--spec/ruby/language/END_spec.rb26
-rw-r--r--spec/ruby/language/alias_spec.rb45
-rw-r--r--spec/ruby/language/and_spec.rb16
-rw-r--r--spec/ruby/language/array_spec.rb18
-rw-r--r--spec/ruby/language/assignments_spec.rb582
-rw-r--r--spec/ruby/language/block_spec.rb564
-rw-r--r--spec/ruby/language/break_spec.rb37
-rw-r--r--spec/ruby/language/case_spec.rb214
-rw-r--r--spec/ruby/language/class_spec.rb128
-rw-r--r--spec/ruby/language/class_variable_spec.rb44
-rw-r--r--spec/ruby/language/comment_spec.rb16
-rw-r--r--spec/ruby/language/constants_spec.rb310
-rw-r--r--spec/ruby/language/def_spec.rb158
-rw-r--r--spec/ruby/language/defined_spec.rb442
-rw-r--r--spec/ruby/language/delegation_spec.rb171
-rw-r--r--spec/ruby/language/encoding_spec.rb12
-rw-r--r--spec/ruby/language/ensure_spec.rb49
-rw-r--r--spec/ruby/language/execution_spec.rb78
-rw-r--r--spec/ruby/language/file_spec.rb18
-rw-r--r--spec/ruby/language/fixtures/class_with_class_variable.rb9
-rw-r--r--spec/ruby/language/fixtures/constant_visibility.rb18
-rw-r--r--spec/ruby/language/fixtures/defined.rb36
-rw-r--r--spec/ruby/language/fixtures/delegation.rb4
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files.rb3
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files_diff_enc.rb3
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files_no_comment.rb3
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_one_literal.rb4
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required.rb2
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required_diff_enc.rbbin181 -> 107 bytes-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required_no_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_two_literals.rb2
-rw-r--r--spec/ruby/language/fixtures/module.rb9
-rw-r--r--spec/ruby/language/fixtures/private.rb26
-rw-r--r--spec/ruby/language/fixtures/rescue/top_level.rb7
-rw-r--r--spec/ruby/language/fixtures/return.rb8
-rw-r--r--spec/ruby/language/fixtures/send.rb16
-rw-r--r--spec/ruby/language/fixtures/squiggly_heredoc.rb8
-rw-r--r--spec/ruby/language/fixtures/super.rb64
-rw-r--r--spec/ruby/language/fixtures/variables.rb72
-rw-r--r--spec/ruby/language/for_spec.rb202
-rw-r--r--spec/ruby/language/hash_spec.rb208
-rw-r--r--spec/ruby/language/heredoc_spec.rb33
-rw-r--r--spec/ruby/language/if_spec.rb53
-rw-r--r--spec/ruby/language/it_parameter_spec.rb108
-rw-r--r--spec/ruby/language/keyword_arguments_spec.rb398
-rw-r--r--spec/ruby/language/lambda_spec.rb269
-rw-r--r--spec/ruby/language/line_spec.rb2
-rw-r--r--spec/ruby/language/loop_spec.rb2
-rw-r--r--spec/ruby/language/magic_comment_spec.rb3
-rw-r--r--spec/ruby/language/match_spec.rb8
-rw-r--r--spec/ruby/language/metaclass_spec.rb22
-rw-r--r--spec/ruby/language/method_spec.rb1279
-rw-r--r--spec/ruby/language/module_spec.rb84
-rw-r--r--spec/ruby/language/next_spec.rb4
-rw-r--r--spec/ruby/language/not_spec.rb32
-rw-r--r--spec/ruby/language/numbered_parameters_spec.rb179
-rw-r--r--spec/ruby/language/numbers_spec.rb12
-rw-r--r--spec/ruby/language/optional_assignments_spec.rb423
-rw-r--r--spec/ruby/language/or_spec.rb32
-rw-r--r--spec/ruby/language/pattern_matching_spec.rb1989
-rw-r--r--spec/ruby/language/precedence_spec.rb114
-rw-r--r--spec/ruby/language/predefined_spec.rb869
-rw-r--r--spec/ruby/language/private_spec.rb22
-rw-r--r--spec/ruby/language/proc_spec.rb73
-rw-r--r--spec/ruby/language/range_spec.rb22
-rw-r--r--spec/ruby/language/redo_spec.rb2
-rw-r--r--spec/ruby/language/regexp/anchors_spec.rb62
-rw-r--r--spec/ruby/language/regexp/back-references_spec.rb68
-rw-r--r--spec/ruby/language/regexp/character_classes_spec.rb238
-rw-r--r--spec/ruby/language/regexp/empty_checks_spec.rb135
-rw-r--r--spec/ruby/language/regexp/encoding_spec.rb63
-rw-r--r--spec/ruby/language/regexp/escapes_spec.rb96
-rw-r--r--spec/ruby/language/regexp/grouping_spec.rb41
-rw-r--r--spec/ruby/language/regexp/interpolation_spec.rb6
-rw-r--r--spec/ruby/language/regexp/modifiers_spec.rb40
-rw-r--r--spec/ruby/language/regexp/repetition_spec.rb21
-rw-r--r--spec/ruby/language/regexp_spec.rb62
-rw-r--r--spec/ruby/language/rescue_spec.rb193
-rw-r--r--spec/ruby/language/reserved_keywords.rb149
-rw-r--r--spec/ruby/language/retry_spec.rb7
-rw-r--r--spec/ruby/language/return_spec.rb73
-rw-r--r--spec/ruby/language/safe_navigator_spec.rb84
-rw-r--r--spec/ruby/language/safe_spec.rb153
-rw-r--r--spec/ruby/language/send_spec.rb125
-rw-r--r--spec/ruby/language/shared/__FILE__.rb4
-rw-r--r--spec/ruby/language/shared/__LINE__.rb2
-rw-r--r--spec/ruby/language/singleton_class_spec.rb129
-rw-r--r--spec/ruby/language/source_encoding_spec.rb6
-rw-r--r--spec/ruby/language/string_spec.rb70
-rw-r--r--spec/ruby/language/super_spec.rb54
-rw-r--r--spec/ruby/language/symbol_spec.rb34
-rw-r--r--spec/ruby/language/throw_spec.rb10
-rw-r--r--spec/ruby/language/undef_spec.rb23
-rw-r--r--spec/ruby/language/variables_spec.rb223
-rw-r--r--spec/ruby/language/while_spec.rb16
-rw-r--r--spec/ruby/language/yield_spec.rb59
-rw-r--r--spec/ruby/library/English/English_spec.rb62
-rw-r--r--spec/ruby/library/English/alias_spec.rb6
-rw-r--r--spec/ruby/library/base64/decode64_spec.rb4
-rw-r--r--spec/ruby/library/base64/strict_decode64_spec.rb8
-rw-r--r--spec/ruby/library/bigdecimal/BigDecimal_spec.rb115
-rw-r--r--spec/ruby/library/bigdecimal/add_spec.rb20
-rw-r--r--spec/ruby/library/bigdecimal/ceil_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/constants_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/core_spec.rb62
-rw-r--r--spec/ruby/library/bigdecimal/div_spec.rb28
-rw-r--r--spec/ruby/library/bigdecimal/divmod_spec.rb88
-rw-r--r--spec/ruby/library/bigdecimal/exponent_spec.rb11
-rw-r--r--spec/ruby/library/bigdecimal/fix_spec.rb30
-rw-r--r--spec/ruby/library/bigdecimal/floor_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/gt_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/gte_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/lt_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/lte_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/mode_spec.rb10
-rw-r--r--spec/ruby/library/bigdecimal/mult_spec.rb8
-rw-r--r--spec/ruby/library/bigdecimal/nonzero_spec.rb10
-rw-r--r--spec/ruby/library/bigdecimal/precs_spec.rb55
-rw-r--r--spec/ruby/library/bigdecimal/remainder_spec.rb27
-rw-r--r--spec/ruby/library/bigdecimal/round_spec.rb16
-rw-r--r--spec/ruby/library/bigdecimal/shared/clone.rb2
-rw-r--r--spec/ruby/library/bigdecimal/shared/modulo.rb22
-rw-r--r--spec/ruby/library/bigdecimal/shared/power.rb4
-rw-r--r--spec/ruby/library/bigdecimal/shared/quo.rb1
-rw-r--r--spec/ruby/library/bigdecimal/shared/to_int.rb6
-rw-r--r--spec/ruby/library/bigdecimal/split_spec.rb20
-rw-r--r--spec/ruby/library/bigdecimal/sqrt_spec.rb24
-rw-r--r--spec/ruby/library/bigdecimal/sub_spec.rb8
-rw-r--r--spec/ruby/library/bigdecimal/to_f_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/to_i_spec.rb2
-rw-r--r--spec/ruby/library/bigdecimal/to_r_spec.rb18
-rw-r--r--spec/ruby/library/bigdecimal/to_s_spec.rb27
-rw-r--r--spec/ruby/library/bigdecimal/truncate_spec.rb16
-rw-r--r--spec/ruby/library/bigdecimal/util_spec.rb8
-rw-r--r--spec/ruby/library/bigmath/log_spec.rb10
-rw-r--r--spec/ruby/library/cgi/cookie/domain_spec.rb33
-rw-r--r--spec/ruby/library/cgi/cookie/expires_spec.rb33
-rw-r--r--spec/ruby/library/cgi/cookie/initialize_spec.rb235
-rw-r--r--spec/ruby/library/cgi/cookie/name_spec.rb33
-rw-r--r--spec/ruby/library/cgi/cookie/parse_spec.rb41
-rw-r--r--spec/ruby/library/cgi/cookie/path_spec.rb33
-rw-r--r--spec/ruby/library/cgi/cookie/secure_spec.rb99
-rw-r--r--spec/ruby/library/cgi/cookie/to_s_spec.rb51
-rw-r--r--spec/ruby/library/cgi/cookie/value_spec.rb121
-rw-r--r--spec/ruby/library/cgi/escapeElement_spec.rb8
-rw-r--r--spec/ruby/library/cgi/escapeHTML_spec.rb6
-rw-r--r--spec/ruby/library/cgi/escapeURIComponent_spec.rb78
-rw-r--r--spec/ruby/library/cgi/escape_spec.rb6
-rw-r--r--spec/ruby/library/cgi/htmlextension/a_spec.rb73
-rw-r--r--spec/ruby/library/cgi/htmlextension/base_spec.rb47
-rw-r--r--spec/ruby/library/cgi/htmlextension/blockquote_spec.rb47
-rw-r--r--spec/ruby/library/cgi/htmlextension/br_spec.rb31
-rw-r--r--spec/ruby/library/cgi/htmlextension/caption_spec.rb47
-rw-r--r--spec/ruby/library/cgi/htmlextension/checkbox_group_spec.rb121
-rw-r--r--spec/ruby/library/cgi/htmlextension/checkbox_spec.rb113
-rw-r--r--spec/ruby/library/cgi/htmlextension/doctype_spec.rb41
-rw-r--r--spec/ruby/library/cgi/htmlextension/file_field_spec.rb105
-rw-r--r--spec/ruby/library/cgi/htmlextension/form_spec.rb85
-rw-r--r--spec/ruby/library/cgi/htmlextension/frame_spec.rb21
-rw-r--r--spec/ruby/library/cgi/htmlextension/frameset_spec.rb21
-rw-r--r--spec/ruby/library/cgi/htmlextension/hidden_spec.rb87
-rw-r--r--spec/ruby/library/cgi/htmlextension/html_spec.rb99
-rw-r--r--spec/ruby/library/cgi/htmlextension/image_button_spec.rb101
-rw-r--r--spec/ruby/library/cgi/htmlextension/img_spec.rb123
-rw-r--r--spec/ruby/library/cgi/htmlextension/multipart_form_spec.rb93
-rw-r--r--spec/ruby/library/cgi/htmlextension/password_field_spec.rb123
-rw-r--r--spec/ruby/library/cgi/htmlextension/popup_menu_spec.rb13
-rw-r--r--spec/ruby/library/cgi/htmlextension/radio_button_spec.rb113
-rw-r--r--spec/ruby/library/cgi/htmlextension/radio_group_spec.rb123
-rw-r--r--spec/ruby/library/cgi/htmlextension/reset_spec.rb83
-rw-r--r--spec/ruby/library/cgi/htmlextension/scrolling_list_spec.rb13
-rw-r--r--spec/ruby/library/cgi/htmlextension/submit_spec.rb83
-rw-r--r--spec/ruby/library/cgi/htmlextension/text_field_spec.rb123
-rw-r--r--spec/ruby/library/cgi/htmlextension/textarea_spec.rb107
-rw-r--r--spec/ruby/library/cgi/http_header_spec.rb11
-rw-r--r--spec/ruby/library/cgi/initialize_spec.rb209
-rw-r--r--spec/ruby/library/cgi/out_spec.rb97
-rw-r--r--spec/ruby/library/cgi/parse_spec.rb37
-rw-r--r--spec/ruby/library/cgi/pretty_spec.rb19
-rw-r--r--spec/ruby/library/cgi/print_spec.rb39
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_charset_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_encoding_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_language_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/auth_type_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/cache_control_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/content_length_spec.rb39
-rw-r--r--spec/ruby/library/cgi/queryextension/content_type_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/cookies_spec.rb15
-rw-r--r--spec/ruby/library/cgi/queryextension/element_reference_spec.rb41
-rw-r--r--spec/ruby/library/cgi/queryextension/from_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/gateway_interface_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/has_key_spec.rb11
-rw-r--r--spec/ruby/library/cgi/queryextension/host_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/include_spec.rb11
-rw-r--r--spec/ruby/library/cgi/queryextension/key_spec.rb11
-rw-r--r--spec/ruby/library/cgi/queryextension/keys_spec.rb29
-rw-r--r--spec/ruby/library/cgi/queryextension/multipart_spec.rb47
-rw-r--r--spec/ruby/library/cgi/queryextension/negotiate_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/params_spec.rb55
-rw-r--r--spec/ruby/library/cgi/queryextension/path_info_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/path_translated_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/pragma_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/query_string_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/raw_cookie2_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/raw_cookie_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/referer_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_addr_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_host_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_ident_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_user_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/request_method_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/script_name_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/server_name_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/server_port_spec.rb39
-rw-r--r--spec/ruby/library/cgi/queryextension/server_protocol_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/server_software_spec.rb33
-rw-r--r--spec/ruby/library/cgi/queryextension/shared/has_key.rb6
-rw-r--r--spec/ruby/library/cgi/queryextension/user_agent_spec.rb33
-rw-r--r--spec/ruby/library/cgi/rfc1123_date_spec.rb15
-rw-r--r--spec/ruby/library/cgi/shared/http_header.rb10
-rw-r--r--spec/ruby/library/cgi/unescapeElement_spec.rb8
-rw-r--r--spec/ruby/library/cgi/unescapeHTML_spec.rb6
-rw-r--r--spec/ruby/library/cgi/unescapeURIComponent_spec.rb128
-rw-r--r--spec/ruby/library/cgi/unescape_spec.rb8
-rw-r--r--spec/ruby/library/cmath/math/acos_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/acosh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/asin_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/asinh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/atan2_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/atan_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/atanh_spec.rb20
-rw-r--r--spec/ruby/library/cmath/math/cos_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/cosh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/exp_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/fixtures/classes.rb4
-rw-r--r--spec/ruby/library/cmath/math/log10_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/log_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/shared/acos.rb41
-rw-r--r--spec/ruby/library/cmath/math/shared/acosh.rb37
-rw-r--r--spec/ruby/library/cmath/math/shared/asin.rb47
-rw-r--r--spec/ruby/library/cmath/math/shared/asinh.rb32
-rw-r--r--spec/ruby/library/cmath/math/shared/atan.rb32
-rw-r--r--spec/ruby/library/cmath/math/shared/atan2.rb34
-rw-r--r--spec/ruby/library/cmath/math/shared/atanh.rb30
-rw-r--r--spec/ruby/library/cmath/math/shared/cos.rb30
-rw-r--r--spec/ruby/library/cmath/math/shared/cosh.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/exp.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/log.rb39
-rw-r--r--spec/ruby/library/cmath/math/shared/log10.rb41
-rw-r--r--spec/ruby/library/cmath/math/shared/sin.rb30
-rw-r--r--spec/ruby/library/cmath/math/shared/sinh.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/sqrt.rb34
-rw-r--r--spec/ruby/library/cmath/math/shared/tan.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/tanh.rb32
-rw-r--r--spec/ruby/library/cmath/math/sin_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/sinh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/sqrt_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/tan_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/tanh_spec.rb18
-rw-r--r--spec/ruby/library/conditionvariable/broadcast_spec.rb40
-rw-r--r--spec/ruby/library/conditionvariable/marshal_dump_spec.rb9
-rw-r--r--spec/ruby/library/conditionvariable/signal_spec.rb77
-rw-r--r--spec/ruby/library/conditionvariable/wait_spec.rb175
-rw-r--r--spec/ruby/library/coverage/fixtures/code_with_begin.rb3
-rw-r--r--spec/ruby/library/coverage/result_spec.rb275
-rw-r--r--spec/ruby/library/coverage/running_spec.rb20
-rw-r--r--spec/ruby/library/coverage/start_spec.rb83
-rw-r--r--spec/ruby/library/coverage/supported_spec.rb30
-rw-r--r--spec/ruby/library/csv/generate_spec.rb4
-rw-r--r--spec/ruby/library/csv/parse_spec.rb4
-rw-r--r--spec/ruby/library/csv/readlines_spec.rb2
-rw-r--r--spec/ruby/library/date/accessor_spec.rb2
-rw-r--r--spec/ruby/library/date/add_month_spec.rb8
-rw-r--r--spec/ruby/library/date/add_spec.rb8
-rw-r--r--spec/ruby/library/date/civil_spec.rb7
-rw-r--r--spec/ruby/library/date/constants_spec.rb4
-rw-r--r--spec/ruby/library/date/deconstruct_keys_spec.rb42
-rw-r--r--spec/ruby/library/date/eql_spec.rb4
-rw-r--r--spec/ruby/library/date/friday_spec.rb4
-rw-r--r--spec/ruby/library/date/gregorian_leap_spec.rb10
-rw-r--r--spec/ruby/library/date/gregorian_spec.rb6
-rw-r--r--spec/ruby/library/date/iso8601_spec.rb28
-rw-r--r--spec/ruby/library/date/julian_leap_spec.rb10
-rw-r--r--spec/ruby/library/date/julian_spec.rb4
-rw-r--r--spec/ruby/library/date/minus_month_spec.rb8
-rw-r--r--spec/ruby/library/date/minus_spec.rb6
-rw-r--r--spec/ruby/library/date/mon_spec.rb3
-rw-r--r--spec/ruby/library/date/monday_spec.rb2
-rw-r--r--spec/ruby/library/date/month_spec.rb6
-rw-r--r--spec/ruby/library/date/new_spec.rb1
-rw-r--r--spec/ruby/library/date/parse_spec.rb16
-rw-r--r--spec/ruby/library/date/plus_spec.rb2
-rw-r--r--spec/ruby/library/date/saturday_spec.rb2
-rw-r--r--spec/ruby/library/date/shared/civil.rb16
-rw-r--r--spec/ruby/library/date/shared/commercial.rb18
-rw-r--r--spec/ruby/library/date/shared/month.rb6
-rw-r--r--spec/ruby/library/date/shared/new_bang.rb14
-rw-r--r--spec/ruby/library/date/shared/parse.rb4
-rw-r--r--spec/ruby/library/date/shared/parse_eu.rb8
-rw-r--r--spec/ruby/library/date/shared/parse_us.rb8
-rw-r--r--spec/ruby/library/date/shared/valid_civil.rb16
-rw-r--r--spec/ruby/library/date/shared/valid_commercial.rb24
-rw-r--r--spec/ruby/library/date/shared/valid_jd.rb30
-rw-r--r--spec/ruby/library/date/strftime_spec.rb7
-rw-r--r--spec/ruby/library/date/sunday_spec.rb2
-rw-r--r--spec/ruby/library/date/thursday_spec.rb2
-rw-r--r--spec/ruby/library/date/time/to_date_spec.rb42
-rw-r--r--spec/ruby/library/date/today_spec.rb2
-rw-r--r--spec/ruby/library/date/tuesday_spec.rb2
-rw-r--r--spec/ruby/library/date/wednesday_spec.rb2
-rw-r--r--spec/ruby/library/date/yday_spec.rb3
-rw-r--r--spec/ruby/library/datetime/deconstruct_keys_spec.rb44
-rw-r--r--spec/ruby/library/datetime/hour_spec.rb10
-rw-r--r--spec/ruby/library/datetime/new_spec.rb2
-rw-r--r--spec/ruby/library/datetime/now_spec.rb2
-rw-r--r--spec/ruby/library/datetime/parse_spec.rb12
-rw-r--r--spec/ruby/library/datetime/rfc2822_spec.rb4
-rw-r--r--spec/ruby/library/datetime/shared/min.rb10
-rw-r--r--spec/ruby/library/datetime/shared/sec.rb6
-rw-r--r--spec/ruby/library/datetime/strftime_spec.rb7
-rw-r--r--spec/ruby/library/datetime/time/to_datetime_spec.rb40
-rw-r--r--spec/ruby/library/datetime/to_date_spec.rb2
-rw-r--r--spec/ruby/library/datetime/to_s_spec.rb2
-rw-r--r--spec/ruby/library/datetime/to_time_spec.rb18
-rw-r--r--spec/ruby/library/datetime/yday_spec.rb7
-rw-r--r--spec/ruby/library/delegate/delegate_class/instance_method_spec.rb14
-rw-r--r--spec/ruby/library/delegate/delegate_class/instance_methods_spec.rb12
-rw-r--r--spec/ruby/library/delegate/delegate_class/private_instance_methods_spec.rb12
-rw-r--r--spec/ruby/library/delegate/delegate_class/protected_instance_methods_spec.rb12
-rw-r--r--spec/ruby/library/delegate/delegate_class/public_instance_methods_spec.rb10
-rw-r--r--spec/ruby/library/delegate/delegate_class/respond_to_missing_spec.rb1
-rw-r--r--spec/ruby/library/delegate/delegator/eql_spec.rb8
-rw-r--r--spec/ruby/library/delegate/delegator/equal_spec.rb6
-rw-r--r--spec/ruby/library/delegate/delegator/equal_value_spec.rb6
-rw-r--r--spec/ruby/library/delegate/delegator/frozen_spec.rb14
-rw-r--r--spec/ruby/library/delegate/delegator/marshal_spec.rb2
-rw-r--r--spec/ruby/library/delegate/delegator/method_spec.rb18
-rw-r--r--spec/ruby/library/delegate/delegator/methods_spec.rb14
-rw-r--r--spec/ruby/library/delegate/delegator/not_equal_spec.rb6
-rw-r--r--spec/ruby/library/delegate/delegator/private_methods_spec.rb8
-rw-r--r--spec/ruby/library/delegate/delegator/protected_methods_spec.rb4
-rw-r--r--spec/ruby/library/delegate/delegator/public_methods_spec.rb4
-rw-r--r--spec/ruby/library/delegate/delegator/send_spec.rb8
-rw-r--r--spec/ruby/library/delegate/delegator/taint_spec.rb17
-rw-r--r--spec/ruby/library/delegate/delegator/tap_spec.rb2
-rw-r--r--spec/ruby/library/delegate/delegator/trust_spec.rb16
-rw-r--r--spec/ruby/library/delegate/delegator/untaint_spec.rb18
-rw-r--r--spec/ruby/library/delegate/delegator/untrust_spec.rb17
-rw-r--r--spec/ruby/library/digest/bubblebabble_spec.rb6
-rw-r--r--spec/ruby/library/digest/hexencode_spec.rb4
-rw-r--r--spec/ruby/library/digest/instance/shared/update.rb2
-rw-r--r--spec/ruby/library/digest/md5/append_spec.rb2
-rw-r--r--spec/ruby/library/digest/md5/file_spec.rb8
-rw-r--r--spec/ruby/library/digest/md5/shared/constants.rb2
-rw-r--r--spec/ruby/library/digest/md5/shared/sample.rb17
-rw-r--r--spec/ruby/library/digest/sha1/file_spec.rb8
-rw-r--r--spec/ruby/library/digest/sha1/shared/constants.rb2
-rw-r--r--spec/ruby/library/digest/sha256/append_spec.rb2
-rw-r--r--spec/ruby/library/digest/sha256/file_spec.rb8
-rw-r--r--spec/ruby/library/digest/sha256/shared/constants.rb2
-rw-r--r--spec/ruby/library/digest/sha384/append_spec.rb2
-rw-r--r--spec/ruby/library/digest/sha384/file_spec.rb8
-rw-r--r--spec/ruby/library/digest/sha384/shared/constants.rb2
-rw-r--r--spec/ruby/library/digest/sha512/append_spec.rb2
-rw-r--r--spec/ruby/library/digest/sha512/file_spec.rb8
-rw-r--r--spec/ruby/library/digest/sha512/shared/constants.rb2
-rw-r--r--spec/ruby/library/drb/start_service_spec.rb47
-rw-r--r--spec/ruby/library/erb/def_class_spec.rb2
-rw-r--r--spec/ruby/library/erb/def_module_spec.rb3
-rw-r--r--spec/ruby/library/erb/defmethod/def_erb_method_spec.rb2
-rw-r--r--spec/ruby/library/erb/filename_spec.rb4
-rw-r--r--spec/ruby/library/erb/fixtures/classes.rb6
-rw-r--r--spec/ruby/library/erb/new_spec.rb41
-rw-r--r--spec/ruby/library/erb/result_spec.rb4
-rw-r--r--spec/ruby/library/erb/run_spec.rb6
-rw-r--r--spec/ruby/library/etc/confstr_spec.rb6
-rw-r--r--spec/ruby/library/etc/getgrgid_spec.rb8
-rw-r--r--spec/ruby/library/etc/getgrnam_spec.rb2
-rw-r--r--spec/ruby/library/etc/getlogin_spec.rb4
-rw-r--r--spec/ruby/library/etc/getpwnam_spec.rb2
-rw-r--r--spec/ruby/library/etc/getpwuid_spec.rb2
-rw-r--r--spec/ruby/library/etc/group_spec.rb4
-rw-r--r--spec/ruby/library/etc/nprocessors_spec.rb2
-rw-r--r--spec/ruby/library/etc/passwd_spec.rb4
-rw-r--r--spec/ruby/library/etc/sysconf_spec.rb4
-rw-r--r--spec/ruby/library/etc/sysconfdir_spec.rb4
-rw-r--r--spec/ruby/library/etc/systmpdir_spec.rb4
-rw-r--r--spec/ruby/library/etc/uname_spec.rb14
-rw-r--r--spec/ruby/library/expect/expect_spec.rb7
-rw-r--r--spec/ruby/library/fiber/alive_spec.rb46
-rw-r--r--spec/ruby/library/fiber/current_spec.rb63
-rw-r--r--spec/ruby/library/fiber/resume_spec.rb23
-rw-r--r--spec/ruby/library/fiber/transfer_spec.rb128
-rw-r--r--spec/ruby/library/fiddle/handle/initialize_spec.rb10
-rw-r--r--spec/ruby/library/find/find_spec.rb2
-rw-r--r--spec/ruby/library/find/fixtures/common.rb14
-rw-r--r--spec/ruby/library/getoptlong/error_message_spec.rb2
-rw-r--r--spec/ruby/library/getoptlong/ordering_spec.rb4
-rw-r--r--spec/ruby/library/getoptlong/set_options_spec.rb14
-rw-r--r--spec/ruby/library/getoptlong/shared/get.rb2
-rw-r--r--spec/ruby/library/io-wait/wait_readable_spec.rb42
-rw-r--r--spec/ruby/library/io-wait/wait_spec.rb162
-rw-r--r--spec/ruby/library/io-wait/wait_writable_spec.rb37
-rw-r--r--spec/ruby/library/ipaddr/new_spec.rb9
-rw-r--r--spec/ruby/library/ipaddr/operator_spec.rb16
-rw-r--r--spec/ruby/library/ipaddr/reverse_spec.rb4
-rw-r--r--spec/ruby/library/irb/fixtures/irb.rb3
-rw-r--r--spec/ruby/library/irb/irb_spec.rb19
-rw-r--r--spec/ruby/library/logger/device/close_spec.rb15
-rw-r--r--spec/ruby/library/logger/device/new_spec.rb8
-rw-r--r--spec/ruby/library/logger/device/write_spec.rb15
-rw-r--r--spec/ruby/library/logger/logger/add_spec.rb6
-rw-r--r--spec/ruby/library/logger/logger/datetime_format_spec.rb2
-rw-r--r--spec/ruby/library/logger/logger/new_spec.rb32
-rw-r--r--spec/ruby/library/logger/logger/unknown_spec.rb2
-rw-r--r--spec/ruby/library/matrix/antisymmetric_spec.rb53
-rw-r--r--spec/ruby/library/matrix/build_spec.rb20
-rw-r--r--spec/ruby/library/matrix/clone_spec.rb8
-rw-r--r--spec/ruby/library/matrix/coerce_spec.rb2
-rw-r--r--spec/ruby/library/matrix/column_spec.rb6
-rw-r--r--spec/ruby/library/matrix/column_vector_spec.rb6
-rw-r--r--spec/ruby/library/matrix/column_vectors_spec.rb4
-rw-r--r--spec/ruby/library/matrix/columns_spec.rb4
-rw-r--r--spec/ruby/library/matrix/constructor_spec.rb20
-rw-r--r--spec/ruby/library/matrix/diagonal_spec.rb16
-rw-r--r--spec/ruby/library/matrix/divide_spec.rb16
-rw-r--r--spec/ruby/library/matrix/each_spec.rb10
-rw-r--r--spec/ruby/library/matrix/each_with_index_spec.rb10
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/initialize_spec.rb6
-rw-r--r--spec/ruby/library/matrix/element_reference_spec.rb4
-rw-r--r--spec/ruby/library/matrix/empty_spec.rb22
-rw-r--r--spec/ruby/library/matrix/eql_spec.rb2
-rw-r--r--spec/ruby/library/matrix/exponent_spec.rb25
-rw-r--r--spec/ruby/library/matrix/find_index_spec.rb16
-rw-r--r--spec/ruby/library/matrix/hash_spec.rb2
-rw-r--r--spec/ruby/library/matrix/hermitian_spec.rb12
-rw-r--r--spec/ruby/library/matrix/lower_triangular_spec.rb22
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/determinant_spec.rb2
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/initialize_spec.rb4
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/l_spec.rb2
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/p_spec.rb2
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/solve_spec.rb6
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/to_a_spec.rb4
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/u_spec.rb2
-rw-r--r--spec/ruby/library/matrix/minor_spec.rb2
-rw-r--r--spec/ruby/library/matrix/minus_spec.rb20
-rw-r--r--spec/ruby/library/matrix/multiply_spec.rb19
-rw-r--r--spec/ruby/library/matrix/new_spec.rb2
-rw-r--r--spec/ruby/library/matrix/normal_spec.rb2
-rw-r--r--spec/ruby/library/matrix/orthogonal_spec.rb2
-rw-r--r--spec/ruby/library/matrix/permutation_spec.rb14
-rw-r--r--spec/ruby/library/matrix/plus_spec.rb20
-rw-r--r--spec/ruby/library/matrix/real_spec.rb12
-rw-r--r--spec/ruby/library/matrix/regular_spec.rb12
-rw-r--r--spec/ruby/library/matrix/round_spec.rb2
-rw-r--r--spec/ruby/library/matrix/row_spec.rb6
-rw-r--r--spec/ruby/library/matrix/row_vector_spec.rb4
-rw-r--r--spec/ruby/library/matrix/row_vectors_spec.rb4
-rw-r--r--spec/ruby/library/matrix/rows_spec.rb8
-rw-r--r--spec/ruby/library/matrix/scalar_spec.rb4
-rw-r--r--spec/ruby/library/matrix/shared/collect.rb6
-rw-r--r--spec/ruby/library/matrix/shared/conjugate.rb2
-rw-r--r--spec/ruby/library/matrix/shared/determinant.rb4
-rw-r--r--spec/ruby/library/matrix/shared/equal_value.rb20
-rw-r--r--spec/ruby/library/matrix/shared/identity.rb4
-rw-r--r--spec/ruby/library/matrix/shared/imaginary.rb2
-rw-r--r--spec/ruby/library/matrix/shared/inverse.rb6
-rw-r--r--spec/ruby/library/matrix/shared/rectangular.rb2
-rw-r--r--spec/ruby/library/matrix/shared/trace.rb2
-rw-r--r--spec/ruby/library/matrix/shared/transpose.rb2
-rw-r--r--spec/ruby/library/matrix/singular_spec.rb12
-rw-r--r--spec/ruby/library/matrix/square_spec.rb16
-rw-r--r--spec/ruby/library/matrix/symmetric_spec.rb8
-rw-r--r--spec/ruby/library/matrix/unitary_spec.rb9
-rw-r--r--spec/ruby/library/matrix/upper_triangular_spec.rb22
-rw-r--r--spec/ruby/library/matrix/vector/cross_product_spec.rb2
-rw-r--r--spec/ruby/library/matrix/vector/each2_spec.rb12
-rw-r--r--spec/ruby/library/matrix/vector/eql_spec.rb4
-rw-r--r--spec/ruby/library/matrix/vector/inner_product_spec.rb2
-rw-r--r--spec/ruby/library/matrix/vector/normalize_spec.rb4
-rw-r--r--spec/ruby/library/matrix/zero_spec.rb4
-rw-r--r--spec/ruby/library/monitor/enter_spec.rb28
-rw-r--r--spec/ruby/library/monitor/exit_spec.rb10
-rw-r--r--spec/ruby/library/monitor/mon_initialize_spec.rb2
-rw-r--r--spec/ruby/library/monitor/new_cond_spec.rb88
-rw-r--r--spec/ruby/library/monitor/synchronize_spec.rb41
-rw-r--r--spec/ruby/library/monitor/try_enter_spec.rb39
-rw-r--r--spec/ruby/library/net-ftp/FTPError_spec.rb11
-rw-r--r--spec/ruby/library/net-ftp/FTPPermError_spec.rb15
-rw-r--r--spec/ruby/library/net-ftp/FTPProtoError_spec.rb15
-rw-r--r--spec/ruby/library/net-ftp/FTPReplyError_spec.rb15
-rw-r--r--spec/ruby/library/net-ftp/FTPTempError_spec.rb15
-rw-r--r--spec/ruby/library/net-ftp/abort_spec.rb65
-rw-r--r--spec/ruby/library/net-ftp/acct_spec.rb61
-rw-r--r--spec/ruby/library/net-ftp/binary_spec.rb27
-rw-r--r--spec/ruby/library/net-ftp/chdir_spec.rb102
-rw-r--r--spec/ruby/library/net-ftp/close_spec.rb33
-rw-r--r--spec/ruby/library/net-ftp/closed_spec.rb24
-rw-r--r--spec/ruby/library/net-ftp/connect_spec.rb46
-rw-r--r--spec/ruby/library/net-ftp/debug_mode_spec.rb26
-rw-r--r--spec/ruby/library/net-ftp/default_passive_spec.rb11
-rw-r--r--spec/ruby/library/net-ftp/delete_spec.rb62
-rw-r--r--spec/ruby/library/net-ftp/dir_spec.rb11
-rw-r--r--spec/ruby/library/net-ftp/fixtures/default_passive.rb (renamed from spec/ruby/library/net/ftp/fixtures/default_passive.rb)0
-rw-r--r--spec/ruby/library/net-ftp/fixtures/passive.rb (renamed from spec/ruby/library/net/ftp/fixtures/passive.rb)0
-rw-r--r--spec/ruby/library/net-ftp/fixtures/putbinaryfile (renamed from spec/ruby/library/net/ftp/fixtures/putbinaryfile)0
-rw-r--r--spec/ruby/library/net-ftp/fixtures/puttextfile (renamed from spec/ruby/library/net/ftp/fixtures/puttextfile)0
-rw-r--r--spec/ruby/library/net-ftp/fixtures/server.rb279
-rw-r--r--spec/ruby/library/net-ftp/get_spec.rb24
-rw-r--r--spec/ruby/library/net-ftp/getbinaryfile_spec.rb11
-rw-r--r--spec/ruby/library/net-ftp/getdir_spec.rb10
-rw-r--r--spec/ruby/library/net-ftp/gettextfile_spec.rb11
-rw-r--r--spec/ruby/library/net-ftp/help_spec.rb69
-rw-r--r--spec/ruby/library/net-ftp/initialize_spec.rb408
-rw-r--r--spec/ruby/library/net-ftp/last_response_code_spec.rb11
-rw-r--r--spec/ruby/library/net-ftp/last_response_spec.rb28
-rw-r--r--spec/ruby/library/net-ftp/lastresp_spec.rb11
-rw-r--r--spec/ruby/library/net-ftp/list_spec.rb11
-rw-r--r--spec/ruby/library/net-ftp/login_spec.rb198
-rw-r--r--spec/ruby/library/net-ftp/ls_spec.rb11
-rw-r--r--spec/ruby/library/net-ftp/mdtm_spec.rb41
-rw-r--r--spec/ruby/library/net-ftp/mkdir_spec.rb64
-rw-r--r--spec/ruby/library/net-ftp/mtime_spec.rb53
-rw-r--r--spec/ruby/library/net-ftp/nlst_spec.rb95
-rw-r--r--spec/ruby/library/net-ftp/noop_spec.rb41
-rw-r--r--spec/ruby/library/net-ftp/open_spec.rb58
-rw-r--r--spec/ruby/library/net-ftp/passive_spec.rb31
-rw-r--r--spec/ruby/library/net-ftp/put_spec.rb24
-rw-r--r--spec/ruby/library/net-ftp/putbinaryfile_spec.rb11
-rw-r--r--spec/ruby/library/net-ftp/puttextfile_spec.rb11
-rw-r--r--spec/ruby/library/net-ftp/pwd_spec.rb56
-rw-r--r--spec/ruby/library/net-ftp/quit_spec.rb36
-rw-r--r--spec/ruby/library/net-ftp/rename_spec.rb97
-rw-r--r--spec/ruby/library/net-ftp/resume_spec.rb26
-rw-r--r--spec/ruby/library/net-ftp/retrbinary_spec.rb33
-rw-r--r--spec/ruby/library/net-ftp/retrlines_spec.rb37
-rw-r--r--spec/ruby/library/net-ftp/return_code_spec.rb27
-rw-r--r--spec/ruby/library/net-ftp/rmdir_spec.rb61
-rw-r--r--spec/ruby/library/net-ftp/sendcmd_spec.rb57
-rw-r--r--spec/ruby/library/net-ftp/set_socket_spec.rb11
-rw-r--r--spec/ruby/library/net-ftp/shared/getbinaryfile.rb152
-rw-r--r--spec/ruby/library/net-ftp/shared/gettextfile.rb102
-rw-r--r--spec/ruby/library/net-ftp/shared/last_response_code.rb27
-rw-r--r--spec/ruby/library/net-ftp/shared/list.rb106
-rw-r--r--spec/ruby/library/net-ftp/shared/putbinaryfile.rb169
-rw-r--r--spec/ruby/library/net-ftp/shared/puttextfile.rb130
-rw-r--r--spec/ruby/library/net-ftp/shared/pwd.rb5
-rw-r--r--spec/ruby/library/net-ftp/site_spec.rb56
-rw-r--r--spec/ruby/library/net-ftp/size_spec.rb51
-rw-r--r--spec/ruby/library/net-ftp/spec_helper.rb7
-rw-r--r--spec/ruby/library/net-ftp/status_spec.rb70
-rw-r--r--spec/ruby/library/net-ftp/storbinary_spec.rb52
-rw-r--r--spec/ruby/library/net-ftp/storlines_spec.rb47
-rw-r--r--spec/ruby/library/net-ftp/system_spec.rb51
-rw-r--r--spec/ruby/library/net-ftp/voidcmd_spec.rb57
-rw-r--r--spec/ruby/library/net-ftp/welcome_spec.rb28
-rw-r--r--spec/ruby/library/net-http/HTTPBadResponse_spec.rb8
-rw-r--r--spec/ruby/library/net-http/HTTPClientExcepton_spec.rb12
-rw-r--r--spec/ruby/library/net-http/HTTPError_spec.rb12
-rw-r--r--spec/ruby/library/net-http/HTTPFatalError_spec.rb12
-rw-r--r--spec/ruby/library/net-http/HTTPHeaderSyntaxError_spec.rb8
-rw-r--r--spec/ruby/library/net-http/HTTPRetriableError_spec.rb12
-rw-r--r--spec/ruby/library/net-http/HTTPServerException_spec.rb12
-rw-r--r--spec/ruby/library/net-http/http/Proxy_spec.rb35
-rw-r--r--spec/ruby/library/net-http/http/active_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/address_spec.rb9
-rw-r--r--spec/ruby/library/net-http/http/close_on_empty_response_spec.rb10
-rw-r--r--spec/ruby/library/net-http/http/copy_spec.rb21
-rw-r--r--spec/ruby/library/net-http/http/default_port_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/delete_spec.rb21
-rw-r--r--spec/ruby/library/net-http/http/finish_spec.rb29
-rw-r--r--spec/ruby/library/net-http/http/fixtures/http_server.rb123
-rw-r--r--spec/ruby/library/net-http/http/get2_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/get_print_spec.rb30
-rw-r--r--spec/ruby/library/net-http/http/get_response_spec.rb30
-rw-r--r--spec/ruby/library/net-http/http/get_spec.rb94
-rw-r--r--spec/ruby/library/net-http/http/head2_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/head_spec.rb25
-rw-r--r--spec/ruby/library/net-http/http/http_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/https_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/initialize_spec.rb46
-rw-r--r--spec/ruby/library/net-http/http/inspect_spec.rb24
-rw-r--r--spec/ruby/library/net-http/http/is_version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net-http/http/is_version_1_2_spec.rb7
-rw-r--r--spec/ruby/library/net-http/http/lock_spec.rb21
-rw-r--r--spec/ruby/library/net-http/http/mkcol_spec.rb21
-rw-r--r--spec/ruby/library/net-http/http/move_spec.rb25
-rw-r--r--spec/ruby/library/net-http/http/new_spec.rb86
-rw-r--r--spec/ruby/library/net-http/http/newobj_spec.rb48
-rw-r--r--spec/ruby/library/net-http/http/open_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net-http/http/options_spec.rb25
-rw-r--r--spec/ruby/library/net-http/http/port_spec.rb9
-rw-r--r--spec/ruby/library/net-http/http/post2_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/post_form_spec.rb22
-rw-r--r--spec/ruby/library/net-http/http/post_spec.rb76
-rw-r--r--spec/ruby/library/net-http/http/propfind_spec.rb24
-rw-r--r--spec/ruby/library/net-http/http/proppatch_spec.rb24
-rw-r--r--spec/ruby/library/net-http/http/proxy_address_spec.rb31
-rw-r--r--spec/ruby/library/net-http/http/proxy_class_spec.rb9
-rw-r--r--spec/ruby/library/net-http/http/proxy_pass_spec.rb39
-rw-r--r--spec/ruby/library/net-http/http/proxy_port_spec.rb39
-rw-r--r--spec/ruby/library/net-http/http/proxy_user_spec.rb39
-rw-r--r--spec/ruby/library/net-http/http/put2_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/put_spec.rb24
-rw-r--r--spec/ruby/library/net-http/http/read_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net-http/http/request_get_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/request_head_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/request_post_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/request_put_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/request_spec.rb109
-rw-r--r--spec/ruby/library/net-http/http/request_types_spec.rb254
-rw-r--r--spec/ruby/library/net-http/http/send_request_spec.rb61
-rw-r--r--spec/ruby/library/net-http/http/set_debug_output_spec.rb33
-rw-r--r--spec/ruby/library/net-http/http/shared/request_get.rb41
-rw-r--r--spec/ruby/library/net-http/http/shared/request_head.rb41
-rw-r--r--spec/ruby/library/net-http/http/shared/request_post.rb41
-rw-r--r--spec/ruby/library/net-http/http/shared/request_put.rb41
-rw-r--r--spec/ruby/library/net-http/http/shared/started.rb26
-rw-r--r--spec/ruby/library/net-http/http/shared/version_1_1.rb6
-rw-r--r--spec/ruby/library/net-http/http/shared/version_1_2.rb6
-rw-r--r--spec/ruby/library/net-http/http/socket_type_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/start_spec.rb111
-rw-r--r--spec/ruby/library/net-http/http/started_spec.rb8
-rw-r--r--spec/ruby/library/net-http/http/trace_spec.rb24
-rw-r--r--spec/ruby/library/net-http/http/unlock_spec.rb24
-rw-r--r--spec/ruby/library/net-http/http/use_ssl_spec.rb9
-rw-r--r--spec/ruby/library/net-http/http/version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net-http/http/version_1_2_spec.rb20
-rw-r--r--spec/ruby/library/net-http/httpexceptions/fixtures/classes.rb (renamed from spec/ruby/library/net/http/httpexceptions/fixtures/classes.rb)0
-rw-r--r--spec/ruby/library/net-http/httpexceptions/initialize_spec.rb17
-rw-r--r--spec/ruby/library/net-http/httpexceptions/response_spec.rb10
-rw-r--r--spec/ruby/library/net-http/httpgenericrequest/body_exist_spec.rb21
-rw-r--r--spec/ruby/library/net-http/httpgenericrequest/body_spec.rb30
-rw-r--r--spec/ruby/library/net-http/httpgenericrequest/body_stream_spec.rb32
-rw-r--r--spec/ruby/library/net-http/httpgenericrequest/exec_spec.rb135
-rw-r--r--spec/ruby/library/net-http/httpgenericrequest/inspect_spec.rb25
-rw-r--r--spec/ruby/library/net-http/httpgenericrequest/method_spec.rb15
-rw-r--r--spec/ruby/library/net-http/httpgenericrequest/path_spec.rb12
-rw-r--r--spec/ruby/library/net-http/httpgenericrequest/request_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net-http/httpgenericrequest/response_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net-http/httpgenericrequest/set_body_internal_spec.rb21
-rw-r--r--spec/ruby/library/net-http/httpheader/add_field_spec.rb31
-rw-r--r--spec/ruby/library/net-http/httpheader/basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net-http/httpheader/canonical_each_spec.rb8
-rw-r--r--spec/ruby/library/net-http/httpheader/chunked_spec.rb22
-rw-r--r--spec/ruby/library/net-http/httpheader/content_length_spec.rb54
-rw-r--r--spec/ruby/library/net-http/httpheader/content_range_spec.rb32
-rw-r--r--spec/ruby/library/net-http/httpheader/content_type_spec.rb26
-rw-r--r--spec/ruby/library/net-http/httpheader/delete_spec.rb30
-rw-r--r--spec/ruby/library/net-http/httpheader/each_capitalized_name_spec.rb35
-rw-r--r--spec/ruby/library/net-http/httpheader/each_capitalized_spec.rb8
-rw-r--r--spec/ruby/library/net-http/httpheader/each_header_spec.rb8
-rw-r--r--spec/ruby/library/net-http/httpheader/each_key_spec.rb8
-rw-r--r--spec/ruby/library/net-http/httpheader/each_name_spec.rb8
-rw-r--r--spec/ruby/library/net-http/httpheader/each_spec.rb8
-rw-r--r--spec/ruby/library/net-http/httpheader/each_value_spec.rb35
-rw-r--r--spec/ruby/library/net-http/httpheader/element_reference_spec.rb39
-rw-r--r--spec/ruby/library/net-http/httpheader/element_set_spec.rb41
-rw-r--r--spec/ruby/library/net-http/httpheader/fetch_spec.rb68
-rw-r--r--spec/ruby/library/net-http/httpheader/fixtures/classes.rb (renamed from spec/ruby/library/net/http/httpheader/fixtures/classes.rb)0
-rw-r--r--spec/ruby/library/net-http/httpheader/form_data_spec.rb8
-rw-r--r--spec/ruby/library/net-http/httpheader/get_fields_spec.rb39
-rw-r--r--spec/ruby/library/net-http/httpheader/initialize_http_header_spec.rb21
-rw-r--r--spec/ruby/library/net-http/httpheader/key_spec.rb21
-rw-r--r--spec/ruby/library/net-http/httpheader/length_spec.rb8
-rw-r--r--spec/ruby/library/net-http/httpheader/main_type_spec.rb24
-rw-r--r--spec/ruby/library/net-http/httpheader/proxy_basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net-http/httpheader/range_length_spec.rb32
-rw-r--r--spec/ruby/library/net-http/httpheader/range_spec.rb48
-rw-r--r--spec/ruby/library/net-http/httpheader/set_content_type_spec.rb8
-rw-r--r--spec/ruby/library/net-http/httpheader/set_form_data_spec.rb8
-rw-r--r--spec/ruby/library/net-http/httpheader/set_range_spec.rb8
-rw-r--r--spec/ruby/library/net-http/httpheader/shared/each_capitalized.rb31
-rw-r--r--spec/ruby/library/net-http/httpheader/shared/each_header.rb31
-rw-r--r--spec/ruby/library/net-http/httpheader/shared/each_name.rb31
-rw-r--r--spec/ruby/library/net-http/httpheader/shared/set_content_type.rb (renamed from spec/ruby/library/net/http/httpheader/shared/set_content_type.rb)0
-rw-r--r--spec/ruby/library/net-http/httpheader/shared/set_form_data.rb (renamed from spec/ruby/library/net/http/httpheader/shared/set_form_data.rb)0
-rw-r--r--spec/ruby/library/net-http/httpheader/shared/set_range.rb89
-rw-r--r--spec/ruby/library/net-http/httpheader/shared/size.rb18
-rw-r--r--spec/ruby/library/net-http/httpheader/size_spec.rb8
-rw-r--r--spec/ruby/library/net-http/httpheader/sub_type_spec.rb32
-rw-r--r--spec/ruby/library/net-http/httpheader/to_hash_spec.rb25
-rw-r--r--spec/ruby/library/net-http/httpheader/type_params_spec.rb24
-rw-r--r--spec/ruby/library/net-http/httprequest/initialize_spec.rb45
-rw-r--r--spec/ruby/library/net-http/httpresponse/body_permitted_spec.rb13
-rw-r--r--spec/ruby/library/net-http/httpresponse/body_spec.rb7
-rw-r--r--spec/ruby/library/net-http/httpresponse/code_spec.rb24
-rw-r--r--spec/ruby/library/net-http/httpresponse/code_type_spec.rb24
-rw-r--r--spec/ruby/library/net-http/httpresponse/entity_spec.rb7
-rw-r--r--spec/ruby/library/net-http/httpresponse/error_spec.rb24
-rw-r--r--spec/ruby/library/net-http/httpresponse/error_type_spec.rb24
-rw-r--r--spec/ruby/library/net-http/httpresponse/exception_type_spec.rb13
-rw-r--r--spec/ruby/library/net-http/httpresponse/header_spec.rb9
-rw-r--r--spec/ruby/library/net-http/httpresponse/http_version_spec.rb12
-rw-r--r--spec/ruby/library/net-http/httpresponse/initialize_spec.rb11
-rw-r--r--spec/ruby/library/net-http/httpresponse/inspect_spec.rb15
-rw-r--r--spec/ruby/library/net-http/httpresponse/message_spec.rb9
-rw-r--r--spec/ruby/library/net-http/httpresponse/msg_spec.rb9
-rw-r--r--spec/ruby/library/net-http/httpresponse/read_body_spec.rb86
-rw-r--r--spec/ruby/library/net-http/httpresponse/read_header_spec.rb9
-rw-r--r--spec/ruby/library/net-http/httpresponse/read_new_spec.rb23
-rw-r--r--spec/ruby/library/net-http/httpresponse/reading_body_spec.rb58
-rw-r--r--spec/ruby/library/net-http/httpresponse/response_spec.rb9
-rw-r--r--spec/ruby/library/net-http/httpresponse/shared/body.rb20
-rw-r--r--spec/ruby/library/net-http/httpresponse/value_spec.rb24
-rw-r--r--spec/ruby/library/net/FTPError_spec.rb8
-rw-r--r--spec/ruby/library/net/FTPPermError_spec.rb12
-rw-r--r--spec/ruby/library/net/FTPProtoError_spec.rb12
-rw-r--r--spec/ruby/library/net/FTPReplyError_spec.rb12
-rw-r--r--spec/ruby/library/net/FTPTempError_spec.rb12
-rw-r--r--spec/ruby/library/net/ftp/abort_spec.rb62
-rw-r--r--spec/ruby/library/net/ftp/acct_spec.rb58
-rw-r--r--spec/ruby/library/net/ftp/binary_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/chdir_spec.rb99
-rw-r--r--spec/ruby/library/net/ftp/close_spec.rb30
-rw-r--r--spec/ruby/library/net/ftp/closed_spec.rb21
-rw-r--r--spec/ruby/library/net/ftp/connect_spec.rb49
-rw-r--r--spec/ruby/library/net/ftp/debug_mode_spec.rb23
-rw-r--r--spec/ruby/library/net/ftp/default_passive_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/delete_spec.rb59
-rw-r--r--spec/ruby/library/net/ftp/dir_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/fixtures/server.rb277
-rw-r--r--spec/ruby/library/net/ftp/get_spec.rb21
-rw-r--r--spec/ruby/library/net/ftp/getbinaryfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/getdir_spec.rb7
-rw-r--r--spec/ruby/library/net/ftp/gettextfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/help_spec.rb66
-rw-r--r--spec/ruby/library/net/ftp/initialize_spec.rb405
-rw-r--r--spec/ruby/library/net/ftp/last_response_code_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/last_response_spec.rb25
-rw-r--r--spec/ruby/library/net/ftp/lastresp_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/list_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/login_spec.rb195
-rw-r--r--spec/ruby/library/net/ftp/ls_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/mdtm_spec.rb38
-rw-r--r--spec/ruby/library/net/ftp/mkdir_spec.rb61
-rw-r--r--spec/ruby/library/net/ftp/mtime_spec.rb50
-rw-r--r--spec/ruby/library/net/ftp/nlst_spec.rb92
-rw-r--r--spec/ruby/library/net/ftp/noop_spec.rb38
-rw-r--r--spec/ruby/library/net/ftp/open_spec.rb55
-rw-r--r--spec/ruby/library/net/ftp/passive_spec.rb28
-rw-r--r--spec/ruby/library/net/ftp/put_spec.rb21
-rw-r--r--spec/ruby/library/net/ftp/putbinaryfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/puttextfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/pwd_spec.rb53
-rw-r--r--spec/ruby/library/net/ftp/quit_spec.rb33
-rw-r--r--spec/ruby/library/net/ftp/rename_spec.rb94
-rw-r--r--spec/ruby/library/net/ftp/resume_spec.rb23
-rw-r--r--spec/ruby/library/net/ftp/retrbinary_spec.rb30
-rw-r--r--spec/ruby/library/net/ftp/retrlines_spec.rb34
-rw-r--r--spec/ruby/library/net/ftp/return_code_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/rmdir_spec.rb58
-rw-r--r--spec/ruby/library/net/ftp/sendcmd_spec.rb54
-rw-r--r--spec/ruby/library/net/ftp/set_socket_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/shared/getbinaryfile.rb150
-rw-r--r--spec/ruby/library/net/ftp/shared/gettextfile.rb100
-rw-r--r--spec/ruby/library/net/ftp/shared/last_response_code.rb25
-rw-r--r--spec/ruby/library/net/ftp/shared/list.rb104
-rw-r--r--spec/ruby/library/net/ftp/shared/putbinaryfile.rb167
-rw-r--r--spec/ruby/library/net/ftp/shared/puttextfile.rb120
-rw-r--r--spec/ruby/library/net/ftp/shared/pwd.rb3
-rw-r--r--spec/ruby/library/net/ftp/site_spec.rb53
-rw-r--r--spec/ruby/library/net/ftp/size_spec.rb48
-rw-r--r--spec/ruby/library/net/ftp/spec_helper.rb5
-rw-r--r--spec/ruby/library/net/ftp/status_spec.rb67
-rw-r--r--spec/ruby/library/net/ftp/storbinary_spec.rb48
-rw-r--r--spec/ruby/library/net/ftp/storlines_spec.rb43
-rw-r--r--spec/ruby/library/net/ftp/system_spec.rb48
-rw-r--r--spec/ruby/library/net/ftp/voidcmd_spec.rb54
-rw-r--r--spec/ruby/library/net/ftp/welcome_spec.rb25
-rw-r--r--spec/ruby/library/net/http/HTTPBadResponse_spec.rb8
-rw-r--r--spec/ruby/library/net/http/HTTPClientExcepton_spec.rb14
-rw-r--r--spec/ruby/library/net/http/HTTPError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPFatalError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPHeaderSyntaxError_spec.rb8
-rw-r--r--spec/ruby/library/net/http/HTTPRetriableError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPServerException_spec.rb26
-rw-r--r--spec/ruby/library/net/http/http/Proxy_spec.rb35
-rw-r--r--spec/ruby/library/net/http/http/active_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/address_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/close_on_empty_response_spec.rb10
-rw-r--r--spec/ruby/library/net/http/http/copy_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/delete_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/finish_spec.rb29
-rw-r--r--spec/ruby/library/net/http/http/fixtures/http_server.rb109
-rw-r--r--spec/ruby/library/net/http/http/get2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/get_print_spec.rb30
-rw-r--r--spec/ruby/library/net/http/http/get_response_spec.rb30
-rw-r--r--spec/ruby/library/net/http/http/get_spec.rb95
-rw-r--r--spec/ruby/library/net/http/http/head2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/head_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/http_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/https_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/initialize_spec.rb46
-rw-r--r--spec/ruby/library/net/http/http/inspect_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/is_version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/is_version_1_2_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/lock_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/mkcol_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/move_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/new_spec.rb86
-rw-r--r--spec/ruby/library/net/http/http/newobj_spec.rb48
-rw-r--r--spec/ruby/library/net/http/http/open_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/options_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/port_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/post2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/post_form_spec.rb22
-rw-r--r--spec/ruby/library/net/http/http/post_spec.rb74
-rw-r--r--spec/ruby/library/net/http/http/propfind_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/proppatch_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/proxy_address_spec.rb31
-rw-r--r--spec/ruby/library/net/http/http/proxy_class_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/proxy_pass_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/proxy_port_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/proxy_user_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/put2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/put_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/read_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/request_get_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_head_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_post_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_put_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_spec.rb109
-rw-r--r--spec/ruby/library/net/http/http/request_types_spec.rb254
-rw-r--r--spec/ruby/library/net/http/http/send_request_spec.rb61
-rw-r--r--spec/ruby/library/net/http/http/set_debug_output_spec.rb33
-rw-r--r--spec/ruby/library/net/http/http/shared/request_get.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_head.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_post.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_put.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/started.rb26
-rw-r--r--spec/ruby/library/net/http/http/shared/version_1_1.rb6
-rw-r--r--spec/ruby/library/net/http/http/shared/version_1_2.rb6
-rw-r--r--spec/ruby/library/net/http/http/socket_type_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/start_spec.rb111
-rw-r--r--spec/ruby/library/net/http/http/started_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/trace_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/unlock_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/use_ssl_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/version_1_2_spec.rb20
-rw-r--r--spec/ruby/library/net/http/httpexceptions/initialize_spec.rb17
-rw-r--r--spec/ruby/library/net/http/httpexceptions/response_spec.rb10
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_exist_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_spec.rb30
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_stream_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/exec_spec.rb131
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/inspect_spec.rb25
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/method_spec.rb15
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/path_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/request_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/response_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/set_body_internal_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/add_field_spec.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net/http/httpheader/canonical_each_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/chunked_spec.rb22
-rw-r--r--spec/ruby/library/net/http/httpheader/content_length_spec.rb54
-rw-r--r--spec/ruby/library/net/http/httpheader/content_range_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/content_type_spec.rb26
-rw-r--r--spec/ruby/library/net/http/httpheader/delete_spec.rb30
-rw-r--r--spec/ruby/library/net/http/httpheader/each_capitalized_name_spec.rb35
-rw-r--r--spec/ruby/library/net/http/httpheader/each_capitalized_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_header_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_key_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_name_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_value_spec.rb35
-rw-r--r--spec/ruby/library/net/http/httpheader/element_reference_spec.rb39
-rw-r--r--spec/ruby/library/net/http/httpheader/element_set_spec.rb41
-rw-r--r--spec/ruby/library/net/http/httpheader/fetch_spec.rb68
-rw-r--r--spec/ruby/library/net/http/httpheader/form_data_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/get_fields_spec.rb39
-rw-r--r--spec/ruby/library/net/http/httpheader/initialize_http_header_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/key_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/length_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/main_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpheader/proxy_basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net/http/httpheader/range_length_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/range_spec.rb48
-rw-r--r--spec/ruby/library/net/http/httpheader/set_content_type_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/set_form_data_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/set_range_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_capitalized.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_header.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_name.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_range.rb89
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/size.rb18
-rw-r--r--spec/ruby/library/net/http/httpheader/size_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/sub_type_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/to_hash_spec.rb25
-rw-r--r--spec/ruby/library/net/http/httpheader/type_params_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httprequest/initialize_spec.rb45
-rw-r--r--spec/ruby/library/net/http/httpresponse/body_permitted_spec.rb13
-rw-r--r--spec/ruby/library/net/http/httpresponse/body_spec.rb7
-rw-r--r--spec/ruby/library/net/http/httpresponse/code_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/code_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/entity_spec.rb7
-rw-r--r--spec/ruby/library/net/http/httpresponse/error_spec.rb29
-rw-r--r--spec/ruby/library/net/http/httpresponse/error_type_spec.rb29
-rw-r--r--spec/ruby/library/net/http/httpresponse/exception_type_spec.rb18
-rw-r--r--spec/ruby/library/net/http/httpresponse/header_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/http_version_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpresponse/initialize_spec.rb11
-rw-r--r--spec/ruby/library/net/http/httpresponse/inspect_spec.rb15
-rw-r--r--spec/ruby/library/net/http/httpresponse/message_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/msg_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_body_spec.rb85
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_header_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_new_spec.rb22
-rw-r--r--spec/ruby/library/net/http/httpresponse/reading_body_spec.rb58
-rw-r--r--spec/ruby/library/net/http/httpresponse/response_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/shared/body.rb18
-rw-r--r--spec/ruby/library/net/http/httpresponse/value_spec.rb29
-rw-r--r--spec/ruby/library/objectspace/dump_all_spec.rb112
-rw-r--r--spec/ruby/library/objectspace/dump_spec.rb70
-rw-r--r--spec/ruby/library/objectspace/fixtures/trace.rb6
-rw-r--r--spec/ruby/library/objectspace/memsize_of_all_spec.rb22
-rw-r--r--spec/ruby/library/objectspace/memsize_of_spec.rb6
-rw-r--r--spec/ruby/library/objectspace/reachable_objects_from_spec.rb14
-rw-r--r--spec/ruby/library/objectspace/trace_object_allocations_spec.rb163
-rw-r--r--spec/ruby/library/objectspace/trace_spec.rb13
-rw-r--r--spec/ruby/library/observer/notify_observers_spec.rb2
-rw-r--r--spec/ruby/library/open3/popen3_spec.rb8
-rw-r--r--spec/ruby/library/openssl/cipher_spec.rb2
-rw-r--r--spec/ruby/library/openssl/config/freeze_spec.rb22
-rw-r--r--spec/ruby/library/openssl/digest/append_spec.rb6
-rw-r--r--spec/ruby/library/openssl/digest/block_length_spec.rb44
-rw-r--r--spec/ruby/library/openssl/digest/digest_length_spec.rb44
-rw-r--r--spec/ruby/library/openssl/digest/digest_spec.rb62
-rw-r--r--spec/ruby/library/openssl/digest/initialize_spec.rb137
-rw-r--r--spec/ruby/library/openssl/digest/name_spec.rb16
-rw-r--r--spec/ruby/library/openssl/digest/reset_spec.rb36
-rw-r--r--spec/ruby/library/openssl/digest/shared/update.rb123
-rw-r--r--spec/ruby/library/openssl/digest/update_spec.rb6
-rw-r--r--spec/ruby/library/openssl/digest_spec.rb63
-rw-r--r--spec/ruby/library/openssl/fixed_length_secure_compare_spec.rb42
-rw-r--r--spec/ruby/library/openssl/kdf/pbkdf2_hmac_spec.rb162
-rw-r--r--spec/ruby/library/openssl/kdf/scrypt_spec.rb210
-rw-r--r--spec/ruby/library/openssl/random/shared/random_bytes.rb6
-rw-r--r--spec/ruby/library/openssl/secure_compare_spec.rb38
-rw-r--r--spec/ruby/library/openssl/shared/constants.rb2
-rw-r--r--spec/ruby/library/openssl/x509/name/parse_spec.rb4
-rw-r--r--spec/ruby/library/openssl/x509/store/verify_spec.rb78
-rw-r--r--spec/ruby/library/openstruct/delete_field_spec.rb6
-rw-r--r--spec/ruby/library/openstruct/equal_value_spec.rb22
-rw-r--r--spec/ruby/library/openstruct/frozen_spec.rb12
-rw-r--r--spec/ruby/library/openstruct/initialize_spec.rb2
-rw-r--r--spec/ruby/library/openstruct/marshal_load_spec.rb2
-rw-r--r--spec/ruby/library/openstruct/method_missing_spec.rb12
-rw-r--r--spec/ruby/library/openstruct/new_spec.rb4
-rw-r--r--spec/ruby/library/openstruct/shared/inspect.rb2
-rw-r--r--spec/ruby/library/openstruct/to_h_spec.rb62
-rw-r--r--spec/ruby/library/pathname/birthtime_spec.rb16
-rw-r--r--spec/ruby/library/pathname/empty_spec.rb8
-rw-r--r--spec/ruby/library/pathname/glob_spec.rb59
-rw-r--r--spec/ruby/library/pathname/inspect_spec.rb10
-rw-r--r--spec/ruby/library/pathname/new_spec.rb19
-rw-r--r--spec/ruby/library/pathname/pathname_spec.rb23
-rw-r--r--spec/ruby/library/pathname/realdirpath_spec.rb2
-rw-r--r--spec/ruby/library/pathname/realpath_spec.rb2
-rw-r--r--spec/ruby/library/pathname/relative_path_from_spec.rb8
-rw-r--r--spec/ruby/library/pp/pp_spec.rb7
-rw-r--r--spec/ruby/library/prime/each_spec.rb22
-rw-r--r--spec/ruby/library/prime/instance_spec.rb8
-rw-r--r--spec/ruby/library/prime/integer/prime_division_spec.rb2
-rw-r--r--spec/ruby/library/prime/integer/prime_spec.rb14
-rw-r--r--spec/ruby/library/prime/prime_division_spec.rb4
-rw-r--r--spec/ruby/library/prime/prime_spec.rb14
-rw-r--r--spec/ruby/library/random/formatter/alphanumeric_spec.rb54
-rw-r--r--spec/ruby/library/rbconfig/rbconfig_spec.rb87
-rw-r--r--spec/ruby/library/rbconfig/sizeof/limits_spec.rb6
-rw-r--r--spec/ruby/library/rbconfig/sizeof/sizeof_spec.rb6
-rw-r--r--spec/ruby/library/rbconfig/unicode_emoji_version_spec.rb19
-rw-r--r--spec/ruby/library/rbconfig/unicode_version_spec.rb25
-rw-r--r--spec/ruby/library/readline/basic_quote_characters_spec.rb2
-rw-r--r--spec/ruby/library/readline/basic_word_break_characters_spec.rb2
-rw-r--r--spec/ruby/library/readline/completer_quote_characters_spec.rb2
-rw-r--r--spec/ruby/library/readline/completer_word_break_characters_spec.rb2
-rw-r--r--spec/ruby/library/readline/completion_append_character_spec.rb2
-rw-r--r--spec/ruby/library/readline/completion_case_fold_spec.rb2
-rw-r--r--spec/ruby/library/readline/completion_proc_spec.rb4
-rw-r--r--spec/ruby/library/readline/constants_spec.rb4
-rw-r--r--spec/ruby/library/readline/emacs_editing_mode_spec.rb2
-rw-r--r--spec/ruby/library/readline/filename_quote_characters_spec.rb2
-rw-r--r--spec/ruby/library/readline/history/append_spec.rb2
-rw-r--r--spec/ruby/library/readline/history/delete_at_spec.rb13
-rw-r--r--spec/ruby/library/readline/history/each_spec.rb8
-rw-r--r--spec/ruby/library/readline/history/element_reference_spec.rb19
-rw-r--r--spec/ruby/library/readline/history/element_set_spec.rb4
-rw-r--r--spec/ruby/library/readline/history/empty_spec.rb6
-rw-r--r--spec/ruby/library/readline/history/history_spec.rb2
-rw-r--r--spec/ruby/library/readline/history/pop_spec.rb11
-rw-r--r--spec/ruby/library/readline/history/push_spec.rb2
-rw-r--r--spec/ruby/library/readline/history/shift_spec.rb11
-rw-r--r--spec/ruby/library/readline/readline_spec.rb7
-rw-r--r--spec/ruby/library/readline/vi_editing_mode_spec.rb2
-rw-r--r--spec/ruby/library/resolv/get_address_spec.rb2
-rw-r--r--spec/ruby/library/resolv/get_name_spec.rb2
-rw-r--r--spec/ruby/library/rexml/attribute/clone_spec.rb14
-rw-r--r--spec/ruby/library/rexml/attribute/element_spec.rb26
-rw-r--r--spec/ruby/library/rexml/attribute/equal_value_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attribute/hash_spec.rb16
-rw-r--r--spec/ruby/library/rexml/attribute/initialize_spec.rb32
-rw-r--r--spec/ruby/library/rexml/attribute/inspect_spec.rb22
-rw-r--r--spec/ruby/library/rexml/attribute/namespace_spec.rb27
-rw-r--r--spec/ruby/library/rexml/attribute/node_type_spec.rb13
-rw-r--r--spec/ruby/library/rexml/attribute/prefix_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attribute/remove_spec.rb23
-rw-r--r--spec/ruby/library/rexml/attribute/to_s_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attribute/to_string_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attribute/value_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attribute/write_spec.rb26
-rw-r--r--spec/ruby/library/rexml/attribute/xpath_spec.rb22
-rw-r--r--spec/ruby/library/rexml/attributes/add_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/append_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/delete_all_spec.rb34
-rw-r--r--spec/ruby/library/rexml/attributes/delete_spec.rb30
-rw-r--r--spec/ruby/library/rexml/attributes/each_attribute_spec.rb25
-rw-r--r--spec/ruby/library/rexml/attributes/each_spec.rb26
-rw-r--r--spec/ruby/library/rexml/attributes/element_reference_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attributes/element_set_spec.rb28
-rw-r--r--spec/ruby/library/rexml/attributes/get_attribute_ns_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attributes/get_attribute_spec.rb32
-rw-r--r--spec/ruby/library/rexml/attributes/initialize_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attributes/length_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/namespaces_spec.rb9
-rw-r--r--spec/ruby/library/rexml/attributes/prefixes_spec.rb27
-rw-r--r--spec/ruby/library/rexml/attributes/shared/add.rb17
-rw-r--r--spec/ruby/library/rexml/attributes/shared/length.rb13
-rw-r--r--spec/ruby/library/rexml/attributes/size_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/to_a_spec.rb22
-rw-r--r--spec/ruby/library/rexml/cdata/clone_spec.rb13
-rw-r--r--spec/ruby/library/rexml/cdata/initialize_spec.rb27
-rw-r--r--spec/ruby/library/rexml/cdata/shared/to_s.rb11
-rw-r--r--spec/ruby/library/rexml/cdata/to_s_spec.rb10
-rw-r--r--spec/ruby/library/rexml/cdata/value_spec.rb10
-rw-r--r--spec/ruby/library/rexml/document/add_element_spec.rb34
-rw-r--r--spec/ruby/library/rexml/document/add_spec.rb60
-rw-r--r--spec/ruby/library/rexml/document/clone_spec.rb23
-rw-r--r--spec/ruby/library/rexml/document/doctype_spec.rb18
-rw-r--r--spec/ruby/library/rexml/document/encoding_spec.rb25
-rw-r--r--spec/ruby/library/rexml/document/expanded_name_spec.rb19
-rw-r--r--spec/ruby/library/rexml/document/new_spec.rb39
-rw-r--r--spec/ruby/library/rexml/document/node_type_spec.rb11
-rw-r--r--spec/ruby/library/rexml/document/root_spec.rb15
-rw-r--r--spec/ruby/library/rexml/document/stand_alone_spec.rb22
-rw-r--r--spec/ruby/library/rexml/document/version_spec.rb17
-rw-r--r--spec/ruby/library/rexml/document/write_spec.rb38
-rw-r--r--spec/ruby/library/rexml/document/xml_decl_spec.rb18
-rw-r--r--spec/ruby/library/rexml/element/add_attribute_spec.rb44
-rw-r--r--spec/ruby/library/rexml/element/add_attributes_spec.rb25
-rw-r--r--spec/ruby/library/rexml/element/add_element_spec.rb41
-rw-r--r--spec/ruby/library/rexml/element/add_namespace_spec.rb26
-rw-r--r--spec/ruby/library/rexml/element/add_text_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/attribute_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/attributes_spec.rb22
-rw-r--r--spec/ruby/library/rexml/element/cdatas_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/clone_spec.rb32
-rw-r--r--spec/ruby/library/rexml/element/comments_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/delete_attribute_spec.rb42
-rw-r--r--spec/ruby/library/rexml/element/delete_element_spec.rb52
-rw-r--r--spec/ruby/library/rexml/element/delete_namespace_spec.rb28
-rw-r--r--spec/ruby/library/rexml/element/document_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/each_element_with_attribute_spec.rb38
-rw-r--r--spec/ruby/library/rexml/element/each_element_with_text_spec.rb34
-rw-r--r--spec/ruby/library/rexml/element/element_reference_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/get_text_spec.rb21
-rw-r--r--spec/ruby/library/rexml/element/has_attributes_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/has_elements_spec.rb21
-rw-r--r--spec/ruby/library/rexml/element/has_text_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/inspect_spec.rb30
-rw-r--r--spec/ruby/library/rexml/element/instructions_spec.rb24
-rw-r--r--spec/ruby/library/rexml/element/namespace_spec.rb30
-rw-r--r--spec/ruby/library/rexml/element/namespaces_spec.rb35
-rw-r--r--spec/ruby/library/rexml/element/new_spec.rb38
-rw-r--r--spec/ruby/library/rexml/element/next_element_spec.rb22
-rw-r--r--spec/ruby/library/rexml/element/node_type_spec.rb11
-rw-r--r--spec/ruby/library/rexml/element/prefixes_spec.rb26
-rw-r--r--spec/ruby/library/rexml/element/previous_element_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/raw_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/root_spec.rb31
-rw-r--r--spec/ruby/library/rexml/element/text_spec.rb49
-rw-r--r--spec/ruby/library/rexml/element/texts_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/whitespace_spec.rb26
-rw-r--r--spec/ruby/library/rexml/node/each_recursive_spec.rb24
-rw-r--r--spec/ruby/library/rexml/node/find_first_recursive_spec.rb28
-rw-r--r--spec/ruby/library/rexml/node/index_in_parent_spec.rb18
-rw-r--r--spec/ruby/library/rexml/node/next_sibling_node_spec.rb24
-rw-r--r--spec/ruby/library/rexml/node/parent_spec.rb23
-rw-r--r--spec/ruby/library/rexml/node/previous_sibling_node_spec.rb24
-rw-r--r--spec/ruby/library/rexml/shared/each_element.rb36
-rw-r--r--spec/ruby/library/rexml/shared/elements_to_a.rb34
-rw-r--r--spec/ruby/library/rexml/text/append_spec.rb13
-rw-r--r--spec/ruby/library/rexml/text/clone_spec.rb13
-rw-r--r--spec/ruby/library/rexml/text/comparison_spec.rb28
-rw-r--r--spec/ruby/library/rexml/text/empty_spec.rb15
-rw-r--r--spec/ruby/library/rexml/text/indent_text_spec.rb26
-rw-r--r--spec/ruby/library/rexml/text/inspect_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/new_spec.rb51
-rw-r--r--spec/ruby/library/rexml/text/node_type_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/normalize_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/read_with_substitution_spec.rb15
-rw-r--r--spec/ruby/library/rexml/text/to_s_spec.rb20
-rw-r--r--spec/ruby/library/rexml/text/unnormalize_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/value_spec.rb40
-rw-r--r--spec/ruby/library/rexml/text/wrap_spec.rb23
-rw-r--r--spec/ruby/library/rexml/text/write_with_substitution_spec.rb36
-rw-r--r--spec/ruby/library/ripper/lex_spec.rb6
-rw-r--r--spec/ruby/library/rubygems/gem/bin_path_spec.rb1
-rw-r--r--spec/ruby/library/rubygems/gem/load_path_insert_index_spec.rb10
-rw-r--r--spec/ruby/library/scanf/io/block_scanf_spec.rb10
-rw-r--r--spec/ruby/library/scanf/io/fixtures/date.txt4
-rw-r--r--spec/ruby/library/scanf/io/fixtures/helloworld.txt1
-rw-r--r--spec/ruby/library/scanf/io/scanf_spec.rb38
-rw-r--r--spec/ruby/library/scanf/io/shared/block_scanf.rb28
-rw-r--r--spec/ruby/library/scanf/string/block_scanf_spec.rb10
-rw-r--r--spec/ruby/library/scanf/string/scanf_spec.rb56
-rw-r--r--spec/ruby/library/scanf/string/shared/block_scanf.rb25
-rw-r--r--spec/ruby/library/securerandom/base64_spec.rb10
-rw-r--r--spec/ruby/library/securerandom/hex_spec.rb14
-rw-r--r--spec/ruby/library/securerandom/random_bytes_spec.rb12
-rw-r--r--spec/ruby/library/securerandom/random_number_spec.rb52
-rw-r--r--spec/ruby/library/set/add_spec.rb27
-rw-r--r--spec/ruby/library/set/append_spec.rb7
-rw-r--r--spec/ruby/library/set/case_compare_spec.rb12
-rw-r--r--spec/ruby/library/set/case_equality_spec.rb7
-rw-r--r--spec/ruby/library/set/classify_spec.rb27
-rw-r--r--spec/ruby/library/set/clear_spec.rb17
-rw-r--r--spec/ruby/library/set/collect_spec.rb7
-rw-r--r--spec/ruby/library/set/compare_by_identity_spec.rb143
-rw-r--r--spec/ruby/library/set/constructor_spec.rb15
-rw-r--r--spec/ruby/library/set/delete_if_spec.rb38
-rw-r--r--spec/ruby/library/set/delete_spec.rb37
-rw-r--r--spec/ruby/library/set/difference_spec.rb7
-rw-r--r--spec/ruby/library/set/disjoint_spec.rb23
-rw-r--r--spec/ruby/library/set/divide_spec.rb34
-rw-r--r--spec/ruby/library/set/each_spec.rb26
-rw-r--r--spec/ruby/library/set/empty_spec.rb10
-rw-r--r--spec/ruby/library/set/enumerable/to_set_spec.rb21
-rw-r--r--spec/ruby/library/set/eql_spec.rb15
-rw-r--r--spec/ruby/library/set/equal_value_spec.rb33
-rw-r--r--spec/ruby/library/set/exclusion_spec.rb18
-rw-r--r--spec/ruby/library/set/filter_spec.rb8
-rw-r--r--spec/ruby/library/set/fixtures/set_like.rb31
-rw-r--r--spec/ruby/library/set/flatten_merge_spec.rb23
-rw-r--r--spec/ruby/library/set/flatten_spec.rb53
-rw-r--r--spec/ruby/library/set/hash_spec.rb13
-rw-r--r--spec/ruby/library/set/include_spec.rb7
-rw-r--r--spec/ruby/library/set/initialize_spec.rb48
-rw-r--r--spec/ruby/library/set/inspect_spec.rb7
-rw-r--r--spec/ruby/library/set/intersect_spec.rb23
-rw-r--r--spec/ruby/library/set/intersection_spec.rb11
-rw-r--r--spec/ruby/library/set/keep_if_spec.rb38
-rw-r--r--spec/ruby/library/set/length_spec.rb7
-rw-r--r--spec/ruby/library/set/map_spec.rb7
-rw-r--r--spec/ruby/library/set/member_spec.rb7
-rw-r--r--spec/ruby/library/set/merge_spec.rb19
-rw-r--r--spec/ruby/library/set/minus_spec.rb7
-rw-r--r--spec/ruby/library/set/plus_spec.rb7
-rw-r--r--spec/ruby/library/set/pretty_print_cycle_spec.rb10
-rw-r--r--spec/ruby/library/set/pretty_print_spec.rb17
-rw-r--r--spec/ruby/library/set/proper_subset_spec.rb41
-rw-r--r--spec/ruby/library/set/proper_superset_spec.rb41
-rw-r--r--spec/ruby/library/set/reject_spec.rb42
-rw-r--r--spec/ruby/library/set/replace_spec.rb17
-rw-r--r--spec/ruby/library/set/shared/add.rb14
-rw-r--r--spec/ruby/library/set/shared/collect.rb20
-rw-r--r--spec/ruby/library/set/shared/difference.rb15
-rw-r--r--spec/ruby/library/set/shared/include.rb29
-rw-r--r--spec/ruby/library/set/shared/inspect.rb15
-rw-r--r--spec/ruby/library/set/shared/intersection.rb15
-rw-r--r--spec/ruby/library/set/shared/select.rb42
-rw-r--r--spec/ruby/library/set/shared/union.rb15
-rw-r--r--spec/ruby/library/set/size_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/add_spec.rb42
-rw-r--r--spec/ruby/library/set/sortedset/append_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/case_equality_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/classify_spec.rb30
-rw-r--r--spec/ruby/library/set/sortedset/clear_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/collect_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/constructor_spec.rb18
-rw-r--r--spec/ruby/library/set/sortedset/delete_if_spec.rb41
-rw-r--r--spec/ruby/library/set/sortedset/delete_spec.rb40
-rw-r--r--spec/ruby/library/set/sortedset/difference_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/divide_spec.rb37
-rw-r--r--spec/ruby/library/set/sortedset/each_spec.rb29
-rw-r--r--spec/ruby/library/set/sortedset/empty_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/eql_spec.rb19
-rw-r--r--spec/ruby/library/set/sortedset/equal_value_spec.rb16
-rw-r--r--spec/ruby/library/set/sortedset/exclusion_spec.rb21
-rw-r--r--spec/ruby/library/set/sortedset/filter_spec.rb12
-rw-r--r--spec/ruby/library/set/sortedset/flatten_merge_spec.rb11
-rw-r--r--spec/ruby/library/set/sortedset/flatten_spec.rb47
-rw-r--r--spec/ruby/library/set/sortedset/hash_spec.rb16
-rw-r--r--spec/ruby/library/set/sortedset/include_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/initialize_spec.rb33
-rw-r--r--spec/ruby/library/set/sortedset/inspect_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/intersection_spec.rb14
-rw-r--r--spec/ruby/library/set/sortedset/keep_if_spec.rb34
-rw-r--r--spec/ruby/library/set/sortedset/length_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/map_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/member_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/merge_spec.rb22
-rw-r--r--spec/ruby/library/set/sortedset/minus_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/plus_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/pretty_print_cycle_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/pretty_print_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/proper_subset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/proper_superset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/reject_spec.rb45
-rw-r--r--spec/ruby/library/set/sortedset/replace_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/select_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/shared/add.rb14
-rw-r--r--spec/ruby/library/set/sortedset/shared/collect.rb20
-rw-r--r--spec/ruby/library/set/sortedset/shared/difference.rb15
-rw-r--r--spec/ruby/library/set/sortedset/shared/include.rb7
-rw-r--r--spec/ruby/library/set/sortedset/shared/intersection.rb15
-rw-r--r--spec/ruby/library/set/sortedset/shared/length.rb6
-rw-r--r--spec/ruby/library/set/sortedset/shared/select.rb35
-rw-r--r--spec/ruby/library/set/sortedset/shared/union.rb15
-rw-r--r--spec/ruby/library/set/sortedset/size_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/subset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/subtract_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/superset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/to_a_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/union_spec.rb14
-rw-r--r--spec/ruby/library/set/subset_spec.rb41
-rw-r--r--spec/ruby/library/set/subtract_spec.rb17
-rw-r--r--spec/ruby/library/set/superset_spec.rb41
-rw-r--r--spec/ruby/library/set/to_a_spec.rb8
-rw-r--r--spec/ruby/library/set/to_s_spec.rb11
-rw-r--r--spec/ruby/library/set/union_spec.rb11
-rw-r--r--spec/ruby/library/shellwords/shellwords_spec.rb15
-rw-r--r--spec/ruby/library/singleton/allocate_spec.rb2
-rw-r--r--spec/ruby/library/singleton/clone_spec.rb2
-rw-r--r--spec/ruby/library/singleton/dup_spec.rb2
-rw-r--r--spec/ruby/library/singleton/instance_spec.rb12
-rw-r--r--spec/ruby/library/singleton/load_spec.rb13
-rw-r--r--spec/ruby/library/singleton/new_spec.rb2
-rw-r--r--spec/ruby/library/socket/addrinfo/afamily_spec.rb16
-rw-r--r--spec/ruby/library/socket/addrinfo/bind_spec.rb8
-rw-r--r--spec/ruby/library/socket/addrinfo/canonname_spec.rb4
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_from_spec.rb12
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_spec.rb6
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_to_spec.rb12
-rw-r--r--spec/ruby/library/socket/addrinfo/family_addrinfo_spec.rb62
-rw-r--r--spec/ruby/library/socket/addrinfo/foreach_spec.rb2
-rw-r--r--spec/ruby/library/socket/addrinfo/getaddrinfo_spec.rb24
-rw-r--r--spec/ruby/library/socket/addrinfo/getnameinfo_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/initialize_spec.rb92
-rw-r--r--spec/ruby/library/socket/addrinfo/inspect_sockaddr_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/inspect_spec.rb26
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_address_spec.rb14
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_port_spec.rb14
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_unpack_spec.rb14
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_loopback_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_multicast_spec.rb14
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_private_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_loopback_spec.rb22
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_multicast_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_to_ipv4_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/listen_spec.rb4
-rw-r--r--spec/ruby/library/socket/addrinfo/marshal_dump_spec.rb58
-rw-r--r--spec/ruby/library/socket/addrinfo/marshal_load_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/pfamily_spec.rb16
-rw-r--r--spec/ruby/library/socket/addrinfo/protocol_spec.rb14
-rw-r--r--spec/ruby/library/socket/addrinfo/shared/to_sockaddr.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/socktype_spec.rb14
-rw-r--r--spec/ruby/library/socket/addrinfo/tcp_spec.rb2
-rw-r--r--spec/ruby/library/socket/addrinfo/udp_spec.rb8
-rw-r--r--spec/ruby/library/socket/addrinfo/unix_path_spec.rb46
-rw-r--r--spec/ruby/library/socket/addrinfo/unix_spec.rb52
-rw-r--r--spec/ruby/library/socket/ancillarydata/cmsg_is_spec.rb2
-rw-r--r--spec/ruby/library/socket/ancillarydata/initialize_spec.rb36
-rw-r--r--spec/ruby/library/socket/ancillarydata/int_spec.rb4
-rw-r--r--spec/ruby/library/socket/ancillarydata/ip_pktinfo_spec.rb16
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_addr_spec.rb2
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_spec.rb10
-rw-r--r--spec/ruby/library/socket/ancillarydata/unix_rights_spec.rb10
-rw-r--r--spec/ruby/library/socket/basicsocket/close_read_spec.rb12
-rw-r--r--spec/ruby/library/socket/basicsocket/close_write_spec.rb12
-rw-r--r--spec/ruby/library/socket/basicsocket/connect_address_spec.rb86
-rw-r--r--spec/ruby/library/socket/basicsocket/do_not_reverse_lookup_spec.rb2
-rw-r--r--spec/ruby/library/socket/basicsocket/for_fd_spec.rb6
-rw-r--r--spec/ruby/library/socket/basicsocket/getpeereid_spec.rb4
-rw-r--r--spec/ruby/library/socket/basicsocket/getpeername_spec.rb2
-rw-r--r--spec/ruby/library/socket/basicsocket/getsockname_spec.rb4
-rw-r--r--spec/ruby/library/socket/basicsocket/getsockopt_spec.rb12
-rw-r--r--spec/ruby/library/socket/basicsocket/local_address_spec.rb10
-rw-r--r--spec/ruby/library/socket/basicsocket/read_nonblock_spec.rb32
-rw-r--r--spec/ruby/library/socket/basicsocket/read_spec.rb47
-rw-r--r--spec/ruby/library/socket/basicsocket/recv_nonblock_spec.rb88
-rw-r--r--spec/ruby/library/socket/basicsocket/recv_spec.rb120
-rw-r--r--spec/ruby/library/socket/basicsocket/recvmsg_nonblock_spec.rb80
-rw-r--r--spec/ruby/library/socket/basicsocket/recvmsg_spec.rb76
-rw-r--r--spec/ruby/library/socket/basicsocket/remote_address_spec.rb10
-rw-r--r--spec/ruby/library/socket/basicsocket/send_spec.rb102
-rw-r--r--spec/ruby/library/socket/basicsocket/sendmsg_nonblock_spec.rb9
-rw-r--r--spec/ruby/library/socket/basicsocket/sendmsg_spec.rb2
-rw-r--r--spec/ruby/library/socket/basicsocket/setsockopt_spec.rb58
-rw-r--r--spec/ruby/library/socket/basicsocket/shutdown_spec.rb44
-rw-r--r--spec/ruby/library/socket/constants/constants_spec.rb28
-rw-r--r--spec/ruby/library/socket/fixtures/classes.rb6
-rw-r--r--spec/ruby/library/socket/ipsocket/addr_spec.rb8
-rw-r--r--spec/ruby/library/socket/ipsocket/getaddress_spec.rb9
-rw-r--r--spec/ruby/library/socket/ipsocket/inspect_spec.rb24
-rw-r--r--spec/ruby/library/socket/ipsocket/peeraddr_spec.rb4
-rw-r--r--spec/ruby/library/socket/ipsocket/recvfrom_spec.rb60
-rw-r--r--spec/ruby/library/socket/option/bool_spec.rb4
-rw-r--r--spec/ruby/library/socket/option/initialize_spec.rb18
-rw-r--r--spec/ruby/library/socket/option/int_spec.rb6
-rw-r--r--spec/ruby/library/socket/option/linger_spec.rb18
-rw-r--r--spec/ruby/library/socket/option/new_spec.rb6
-rw-r--r--spec/ruby/library/socket/shared/address.rb259
-rw-r--r--spec/ruby/library/socket/shared/pack_sockaddr.rb69
-rw-r--r--spec/ruby/library/socket/shared/partially_closable_sockets.rb2
-rw-r--r--spec/ruby/library/socket/shared/socketpair.rb38
-rw-r--r--spec/ruby/library/socket/socket/accept_loop_spec.rb8
-rw-r--r--spec/ruby/library/socket/socket/accept_nonblock_spec.rb21
-rw-r--r--spec/ruby/library/socket/socket/accept_spec.rb12
-rw-r--r--spec/ruby/library/socket/socket/bind_spec.rb34
-rw-r--r--spec/ruby/library/socket/socket/connect_nonblock_spec.rb68
-rw-r--r--spec/ruby/library/socket/socket/connect_spec.rb24
-rw-r--r--spec/ruby/library/socket/socket/getaddrinfo_spec.rb70
-rw-r--r--spec/ruby/library/socket/socket/gethostbyaddr_spec.rb37
-rw-r--r--spec/ruby/library/socket/socket/gethostbyname_spec.rb12
-rw-r--r--spec/ruby/library/socket/socket/gethostname_spec.rb12
-rw-r--r--spec/ruby/library/socket/socket/getifaddrs_spec.rb42
-rw-r--r--spec/ruby/library/socket/socket/getnameinfo_spec.rb18
-rw-r--r--spec/ruby/library/socket/socket/getservbyname_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/getservbyport_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/initialize_spec.rb16
-rw-r--r--spec/ruby/library/socket/socket/ip_address_list_spec.rb10
-rw-r--r--spec/ruby/library/socket/socket/listen_spec.rb6
-rw-r--r--spec/ruby/library/socket/socket/local_address_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/new_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/pack_sockaddr_in_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/pair_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/recvfrom_nonblock_spec.rb78
-rw-r--r--spec/ruby/library/socket/socket/recvfrom_spec.rb69
-rw-r--r--spec/ruby/library/socket/socket/remote_address_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/socketpair_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/sysaccept_spec.rb10
-rw-r--r--spec/ruby/library/socket/socket/tcp_server_loop_spec.rb4
-rw-r--r--spec/ruby/library/socket/socket/tcp_server_sockets_spec.rb8
-rw-r--r--spec/ruby/library/socket/socket/tcp_spec.rb30
-rw-r--r--spec/ruby/library/socket/socket/udp_server_loop_on_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/udp_server_loop_spec.rb6
-rw-r--r--spec/ruby/library/socket/socket/udp_server_recv_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/udp_server_sockets_spec.rb8
-rw-r--r--spec/ruby/library/socket/socket/unix_server_loop_spec.rb76
-rw-r--r--spec/ruby/library/socket/socket/unix_server_socket_spec.rb56
-rw-r--r--spec/ruby/library/socket/socket/unix_spec.rb56
-rw-r--r--spec/ruby/library/socket/socket/unpack_sockaddr_in_spec.rb16
-rw-r--r--spec/ruby/library/socket/socket/unpack_sockaddr_un_spec.rb34
-rw-r--r--spec/ruby/library/socket/spec_helper.rb21
-rw-r--r--spec/ruby/library/socket/tcpserver/accept_nonblock_spec.rb12
-rw-r--r--spec/ruby/library/socket/tcpserver/accept_spec.rb23
-rw-r--r--spec/ruby/library/socket/tcpserver/gets_spec.rb2
-rw-r--r--spec/ruby/library/socket/tcpserver/initialize_spec.rb12
-rw-r--r--spec/ruby/library/socket/tcpserver/listen_spec.rb2
-rw-r--r--spec/ruby/library/socket/tcpserver/new_spec.rb34
-rw-r--r--spec/ruby/library/socket/tcpserver/sysaccept_spec.rb4
-rw-r--r--spec/ruby/library/socket/tcpsocket/gethostbyname_spec.rb18
-rw-r--r--spec/ruby/library/socket/tcpsocket/initialize_spec.rb49
-rw-r--r--spec/ruby/library/socket/tcpsocket/local_address_spec.rb2
-rw-r--r--spec/ruby/library/socket/tcpsocket/new_spec.rb5
-rw-r--r--spec/ruby/library/socket/tcpsocket/open_spec.rb1
-rw-r--r--spec/ruby/library/socket/tcpsocket/partially_closable_spec.rb2
-rw-r--r--spec/ruby/library/socket/tcpsocket/recv_nonblock_spec.rb14
-rw-r--r--spec/ruby/library/socket/tcpsocket/remote_address_spec.rb2
-rw-r--r--spec/ruby/library/socket/tcpsocket/shared/new.rb69
-rw-r--r--spec/ruby/library/socket/udpsocket/bind_spec.rb4
-rw-r--r--spec/ruby/library/socket/udpsocket/initialize_spec.rb27
-rw-r--r--spec/ruby/library/socket/udpsocket/inspect_spec.rb17
-rw-r--r--spec/ruby/library/socket/udpsocket/local_address_spec.rb2
-rw-r--r--spec/ruby/library/socket/udpsocket/new_spec.rb18
-rw-r--r--spec/ruby/library/socket/udpsocket/open_spec.rb2
-rw-r--r--spec/ruby/library/socket/udpsocket/recvfrom_nonblock_spec.rb24
-rw-r--r--spec/ruby/library/socket/udpsocket/remote_address_spec.rb2
-rw-r--r--spec/ruby/library/socket/udpsocket/send_spec.rb14
-rw-r--r--spec/ruby/library/socket/udpsocket/write_spec.rb2
-rw-r--r--spec/ruby/library/socket/unixserver/accept_nonblock_spec.rb113
-rw-r--r--spec/ruby/library/socket/unixserver/accept_spec.rb161
-rw-r--r--spec/ruby/library/socket/unixserver/for_fd_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixserver/initialize_spec.rb36
-rw-r--r--spec/ruby/library/socket/unixserver/listen_spec.rb24
-rw-r--r--spec/ruby/library/socket/unixserver/new_spec.rb6
-rw-r--r--spec/ruby/library/socket/unixserver/open_spec.rb26
-rw-r--r--spec/ruby/library/socket/unixserver/shared/new.rb26
-rw-r--r--spec/ruby/library/socket/unixserver/sysaccept_spec.rb64
-rw-r--r--spec/ruby/library/socket/unixsocket/addr_spec.rb47
-rw-r--r--spec/ruby/library/socket/unixsocket/initialize_spec.rb62
-rw-r--r--spec/ruby/library/socket/unixsocket/inspect_spec.rb18
-rw-r--r--spec/ruby/library/socket/unixsocket/local_address_spec.rb132
-rw-r--r--spec/ruby/library/socket/unixsocket/new_spec.rb6
-rw-r--r--spec/ruby/library/socket/unixsocket/open_spec.rb26
-rw-r--r--spec/ruby/library/socket/unixsocket/pair_spec.rb41
-rw-r--r--spec/ruby/library/socket/unixsocket/partially_closable_spec.rb32
-rw-r--r--spec/ruby/library/socket/unixsocket/path_spec.rb34
-rw-r--r--spec/ruby/library/socket/unixsocket/peeraddr_spec.rb38
-rw-r--r--spec/ruby/library/socket/unixsocket/recv_io_spec.rb15
-rw-r--r--spec/ruby/library/socket/unixsocket/recvfrom_spec.rb138
-rw-r--r--spec/ruby/library/socket/unixsocket/remote_address_spec.rb60
-rw-r--r--spec/ruby/library/socket/unixsocket/send_io_spec.rb9
-rw-r--r--spec/ruby/library/socket/unixsocket/shared/new.rb28
-rw-r--r--spec/ruby/library/socket/unixsocket/shared/pair.rb47
-rw-r--r--spec/ruby/library/socket/unixsocket/socketpair_spec.rb46
-rw-r--r--spec/ruby/library/stringio/append_spec.rb32
-rw-r--r--spec/ruby/library/stringio/binmode_spec.rb4
-rw-r--r--spec/ruby/library/stringio/bytes_spec.rb29
-rw-r--r--spec/ruby/library/stringio/chars_spec.rb29
-rw-r--r--spec/ruby/library/stringio/close_read_spec.rb10
-rw-r--r--spec/ruby/library/stringio/close_spec.rb8
-rw-r--r--spec/ruby/library/stringio/close_write_spec.rb12
-rw-r--r--spec/ruby/library/stringio/closed_read_spec.rb6
-rw-r--r--spec/ruby/library/stringio/closed_spec.rb10
-rw-r--r--spec/ruby/library/stringio/closed_write_spec.rb6
-rw-r--r--spec/ruby/library/stringio/codepoints_spec.rb19
-rw-r--r--spec/ruby/library/stringio/each_line_spec.rb8
-rw-r--r--spec/ruby/library/stringio/each_spec.rb12
-rw-r--r--spec/ruby/library/stringio/fcntl_spec.rb2
-rw-r--r--spec/ruby/library/stringio/fileno_spec.rb5
-rw-r--r--spec/ruby/library/stringio/fixtures/classes.rb4
-rw-r--r--spec/ruby/library/stringio/flush_spec.rb4
-rw-r--r--spec/ruby/library/stringio/fsync_spec.rb4
-rw-r--r--spec/ruby/library/stringio/gets_spec.rb259
-rw-r--r--spec/ruby/library/stringio/initialize_spec.rb278
-rw-r--r--spec/ruby/library/stringio/inspect_spec.rb2
-rw-r--r--spec/ruby/library/stringio/lineno_spec.rb8
-rw-r--r--spec/ruby/library/stringio/lines_spec.rb53
-rw-r--r--spec/ruby/library/stringio/new_spec.rb10
-rw-r--r--spec/ruby/library/stringio/open_spec.rb188
-rw-r--r--spec/ruby/library/stringio/path_spec.rb2
-rw-r--r--spec/ruby/library/stringio/pid_spec.rb2
-rw-r--r--spec/ruby/library/stringio/pos_spec.rb2
-rw-r--r--spec/ruby/library/stringio/print_spec.rb22
-rw-r--r--spec/ruby/library/stringio/printf_spec.rb45
-rw-r--r--spec/ruby/library/stringio/putc_spec.rb33
-rw-r--r--spec/ruby/library/stringio/puts_spec.rb30
-rw-r--r--spec/ruby/library/stringio/read_nonblock_spec.rb15
-rw-r--r--spec/ruby/library/stringio/read_spec.rb6
-rw-r--r--spec/ruby/library/stringio/readline_spec.rb140
-rw-r--r--spec/ruby/library/stringio/readlines_spec.rb32
-rw-r--r--spec/ruby/library/stringio/readpartial_spec.rb50
-rw-r--r--spec/ruby/library/stringio/reopen_spec.rb159
-rw-r--r--spec/ruby/library/stringio/rewind_spec.rb2
-rw-r--r--spec/ruby/library/stringio/seek_spec.rb24
-rw-r--r--spec/ruby/library/stringio/set_encoding_by_bom_spec.rb237
-rw-r--r--spec/ruby/library/stringio/set_encoding_spec.rb8
-rw-r--r--spec/ruby/library/stringio/shared/codepoints.rb12
-rw-r--r--spec/ruby/library/stringio/shared/each.rb112
-rw-r--r--spec/ruby/library/stringio/shared/each_byte.rb12
-rw-r--r--spec/ruby/library/stringio/shared/each_char.rb10
-rw-r--r--spec/ruby/library/stringio/shared/eof.rb10
-rw-r--r--spec/ruby/library/stringio/shared/getc.rb22
-rw-r--r--spec/ruby/library/stringio/shared/gets.rb249
-rw-r--r--spec/ruby/library/stringio/shared/isatty.rb2
-rw-r--r--spec/ruby/library/stringio/shared/read.rb58
-rw-r--r--spec/ruby/library/stringio/shared/readchar.rb8
-rw-r--r--spec/ruby/library/stringio/shared/sysread.rb4
-rw-r--r--spec/ruby/library/stringio/shared/write.rb82
-rw-r--r--spec/ruby/library/stringio/string_spec.rb12
-rw-r--r--spec/ruby/library/stringio/stringio_spec.rb2
-rw-r--r--spec/ruby/library/stringio/sync_spec.rb4
-rw-r--r--spec/ruby/library/stringio/sysread_spec.rb7
-rw-r--r--spec/ruby/library/stringio/truncate_spec.rb34
-rw-r--r--spec/ruby/library/stringio/ungetbyte_spec.rb38
-rw-r--r--spec/ruby/library/stringio/ungetc_spec.rb24
-rw-r--r--spec/ruby/library/stringio/write_nonblock_spec.rb6
-rw-r--r--spec/ruby/library/stringscanner/captures_spec.rb36
-rw-r--r--spec/ruby/library/stringscanner/charpos_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/check_spec.rb77
-rw-r--r--spec/ruby/library/stringscanner/check_until_spec.rb120
-rw-r--r--spec/ruby/library/stringscanner/clear_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/dup_spec.rb4
-rw-r--r--spec/ruby/library/stringscanner/element_reference_spec.rb19
-rw-r--r--spec/ruby/library/stringscanner/empty_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/eos_spec.rb17
-rw-r--r--spec/ruby/library/stringscanner/exist_spec.rb99
-rw-r--r--spec/ruby/library/stringscanner/fixed_anchor_spec.rb17
-rw-r--r--spec/ruby/library/stringscanner/get_byte_spec.rb81
-rw-r--r--spec/ruby/library/stringscanner/getbyte_spec.rb21
-rw-r--r--spec/ruby/library/stringscanner/getch_spec.rb65
-rw-r--r--spec/ruby/library/stringscanner/initialize_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/inspect_spec.rb2
-rw-r--r--spec/ruby/library/stringscanner/match_spec.rb23
-rw-r--r--spec/ruby/library/stringscanner/matched_size_spec.rb21
-rw-r--r--spec/ruby/library/stringscanner/matched_spec.rb4
-rw-r--r--spec/ruby/library/stringscanner/must_C_version_spec.rb2
-rw-r--r--spec/ruby/library/stringscanner/named_captures_spec.rb28
-rw-r--r--spec/ruby/library/stringscanner/peek_byte_spec.rb35
-rw-r--r--spec/ruby/library/stringscanner/peek_spec.rb39
-rw-r--r--spec/ruby/library/stringscanner/peep_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/rest_size_spec.rb27
-rw-r--r--spec/ruby/library/stringscanner/rest_spec.rb6
-rw-r--r--spec/ruby/library/stringscanner/restsize_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/scan_byte_spec.rb98
-rw-r--r--spec/ruby/library/stringscanner/scan_full_spec.rb14
-rw-r--r--spec/ruby/library/stringscanner/scan_integer_spec.rb157
-rw-r--r--spec/ruby/library/stringscanner/scan_spec.rb70
-rw-r--r--spec/ruby/library/stringscanner/scan_until_spec.rb120
-rw-r--r--spec/ruby/library/stringscanner/search_full_spec.rb105
-rw-r--r--spec/ruby/library/stringscanner/shared/bol.rb16
-rw-r--r--spec/ruby/library/stringscanner/shared/concat.rb16
-rw-r--r--spec/ruby/library/stringscanner/shared/eos.rb17
-rw-r--r--spec/ruby/library/stringscanner/shared/extract_range.rb17
-rw-r--r--spec/ruby/library/stringscanner/shared/extract_range_matched.rb15
-rw-r--r--spec/ruby/library/stringscanner/shared/get_byte.rb29
-rw-r--r--spec/ruby/library/stringscanner/shared/matched_size.rb21
-rw-r--r--spec/ruby/library/stringscanner/shared/peek.rb49
-rw-r--r--spec/ruby/library/stringscanner/shared/pos.rb11
-rw-r--r--spec/ruby/library/stringscanner/shared/rest_size.rb18
-rw-r--r--spec/ruby/library/stringscanner/shared/terminate.rb8
-rw-r--r--spec/ruby/library/stringscanner/size_spec.rb17
-rw-r--r--spec/ruby/library/stringscanner/skip_spec.rb14
-rw-r--r--spec/ruby/library/stringscanner/skip_until_spec.rb116
-rw-r--r--spec/ruby/library/stringscanner/string_spec.rb4
-rw-r--r--spec/ruby/library/stringscanner/terminate_spec.rb8
-rw-r--r--spec/ruby/library/stringscanner/unscan_spec.rb6
-rw-r--r--spec/ruby/library/stringscanner/values_at_spec.rb68
-rw-r--r--spec/ruby/library/syslog/close_spec.rb16
-rw-r--r--spec/ruby/library/syslog/constants_spec.rb4
-rw-r--r--spec/ruby/library/syslog/facility_spec.rb6
-rw-r--r--spec/ruby/library/syslog/ident_spec.rb4
-rw-r--r--spec/ruby/library/syslog/inspect_spec.rb4
-rw-r--r--spec/ruby/library/syslog/log_spec.rb10
-rw-r--r--spec/ruby/library/syslog/mask_spec.rb14
-rw-r--r--spec/ruby/library/syslog/open_spec.rb10
-rw-r--r--spec/ruby/library/syslog/opened_spec.rb16
-rw-r--r--spec/ruby/library/syslog/options_spec.rb6
-rw-r--r--spec/ruby/library/syslog/shared/log.rb6
-rw-r--r--spec/ruby/library/syslog/shared/reopen.rb14
-rw-r--r--spec/ruby/library/tempfile/_close_spec.rb4
-rw-r--r--spec/ruby/library/tempfile/callback_spec.rb6
-rw-r--r--spec/ruby/library/tempfile/close_spec.rb6
-rw-r--r--spec/ruby/library/tempfile/create_spec.rb176
-rw-r--r--spec/ruby/library/tempfile/initialize_spec.rb2
-rw-r--r--spec/ruby/library/tempfile/open_spec.rb18
-rw-r--r--spec/ruby/library/tempfile/path_spec.rb2
-rw-r--r--spec/ruby/library/tempfile/shared/length.rb6
-rw-r--r--spec/ruby/library/thread/queue_spec.rb4
-rw-r--r--spec/ruby/library/thread/sizedqueue_spec.rb4
-rw-r--r--spec/ruby/library/time/iso8601_spec.rb4
-rw-r--r--spec/ruby/library/time/shared/rfc2822.rb26
-rw-r--r--spec/ruby/library/time/shared/xmlschema.rb52
-rw-r--r--spec/ruby/library/time/to_date_spec.rb42
-rw-r--r--spec/ruby/library/time/to_datetime_spec.rb27
-rw-r--r--spec/ruby/library/time/to_time_spec.rb4
-rw-r--r--spec/ruby/library/time/xmlschema_spec.rb2
-rw-r--r--spec/ruby/library/timeout/error_spec.rb2
-rw-r--r--spec/ruby/library/timeout/timeout_spec.rb16
-rw-r--r--spec/ruby/library/tmpdir/dir/mktmpdir_spec.rb18
-rw-r--r--spec/ruby/library/tmpdir/dir/tmpdir_spec.rb4
-rw-r--r--spec/ruby/library/uri/generic/host_spec.rb5
-rw-r--r--spec/ruby/library/uri/generic/to_s_spec.rb5
-rw-r--r--spec/ruby/library/uri/join_spec.rb2
-rw-r--r--spec/ruby/library/uri/mailto/build_spec.rb2
-rw-r--r--spec/ruby/library/uri/parse_spec.rb24
-rw-r--r--spec/ruby/library/uri/plus_spec.rb170
-rw-r--r--spec/ruby/library/uri/select_spec.rb6
-rw-r--r--spec/ruby/library/uri/set_component_spec.rb60
-rw-r--r--spec/ruby/library/uri/shared/eql.rb6
-rw-r--r--spec/ruby/library/uri/shared/join.rb2
-rw-r--r--spec/ruby/library/uri/shared/parse.rb37
-rw-r--r--spec/ruby/library/uri/uri_spec.rb4
-rw-r--r--spec/ruby/library/weakref/__getobj___spec.rb4
-rw-r--r--spec/ruby/library/weakref/allocate_spec.rb2
-rw-r--r--spec/ruby/library/weakref/fixtures/classes.rb6
-rw-r--r--spec/ruby/library/weakref/send_spec.rb4
-rw-r--r--spec/ruby/library/weakref/weakref_alive_spec.rb4
-rw-r--r--spec/ruby/library/win32ole/fixtures/classes.rb17
-rw-r--r--spec/ruby/library/win32ole/win32ole/_getproperty_spec.rb1
-rw-r--r--spec/ruby/library/win32ole/win32ole/_invoke_spec.rb7
-rw-r--r--spec/ruby/library/win32ole/win32ole/codepage_spec.rb1
-rw-r--r--spec/ruby/library/win32ole/win32ole/connect_spec.rb5
-rw-r--r--spec/ruby/library/win32ole/win32ole/const_load_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole/constants_spec.rb1
-rw-r--r--spec/ruby/library/win32ole/win32ole/create_guid_spec.rb1
-rw-r--r--spec/ruby/library/win32ole/win32ole/invoke_spec.rb1
-rw-r--r--spec/ruby/library/win32ole/win32ole/locale_spec.rb5
-rw-r--r--spec/ruby/library/win32ole/win32ole/new_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_func_methods_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_get_methods_spec.rb5
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_method_help_spec.rb1
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_method_spec.rb1
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_methods_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_obj_help_spec.rb7
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_put_methods_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole/setproperty_spec.rb1
-rw-r--r--spec/ruby/library/win32ole/win32ole/shared/ole_method.rb6
-rw-r--r--spec/ruby/library/win32ole/win32ole/shared/setproperty.rb2
-rw-r--r--spec/ruby/library/win32ole/win32ole_event/new_spec.rb15
-rw-r--r--spec/ruby/library/win32ole/win32ole_event/on_event_spec.rb13
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/dispid_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/event_interface_spec.rb15
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/event_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpcontext_spec.rb13
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpfile_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpstring_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/invkind_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/invoke_kind_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/name_spec.rb3
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/new_spec.rb23
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/offset_vtbl_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/params_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_type_detail_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_type_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_vtype_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/shared/name.rb6
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/size_opt_params_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/size_params_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/to_s_spec.rb3
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/visible_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/default_spec.rb17
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/input_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/name_spec.rb3
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/ole_type_detail_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/ole_type_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/optional_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/retval_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/shared/name.rb6
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/to_s_spec.rb3
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/guid_spec.rb5
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpcontext_spec.rb7
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpfile_spec.rb7
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpstring_spec.rb5
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/major_version_spec.rb7
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/minor_version_spec.rb7
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/name_spec.rb3
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/new_spec.rb35
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_classes_spec.rb7
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_methods_spec.rb7
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_type_spec.rb5
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/progid_spec.rb5
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/progids_spec.rb7
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/shared/name.rb4
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/src_type_spec.rb7
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/to_s_spec.rb3
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/typekind_spec.rb7
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/typelibs_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/variables_spec.rb5
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/visible_spec.rb7
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/name_spec.rb1
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/ole_type_detail_spec.rb7
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/ole_type_spec.rb5
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/shared/name.rb4
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/to_s_spec.rb1
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/value_spec.rb5
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/variable_kind_spec.rb5
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/varkind_spec.rb5
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/visible_spec.rb5
-rw-r--r--spec/ruby/library/yaml/dump_spec.rb20
-rw-r--r--spec/ruby/library/yaml/dump_stream_spec.rb3
-rw-r--r--spec/ruby/library/yaml/fixtures/common.rb10
-rw-r--r--spec/ruby/library/yaml/fixtures/strings.rb56
-rw-r--r--spec/ruby/library/yaml/load_file_spec.rb13
-rw-r--r--spec/ruby/library/yaml/load_spec.rb135
-rw-r--r--spec/ruby/library/yaml/load_stream_spec.rb3
-rw-r--r--spec/ruby/library/yaml/parse_file_spec.rb8
-rw-r--r--spec/ruby/library/yaml/parse_spec.rb9
-rw-r--r--spec/ruby/library/yaml/shared/each_document.rb5
-rw-r--r--spec/ruby/library/yaml/shared/load.rb142
-rw-r--r--spec/ruby/library/yaml/to_yaml_spec.rb52
-rw-r--r--spec/ruby/library/yaml/unsafe_load_spec.rb9
-rw-r--r--spec/ruby/library/zlib/adler32_spec.rb2
-rw-r--r--spec/ruby/library/zlib/crc32_spec.rb2
-rw-r--r--spec/ruby/library/zlib/crc_table_spec.rb143
-rw-r--r--spec/ruby/library/zlib/deflate/deflate_spec.rb9
-rw-r--r--spec/ruby/library/zlib/deflate/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/deflate/params_spec.rb2
-rw-r--r--spec/ruby/library/zlib/gzipfile/close_spec.rb6
-rw-r--r--spec/ruby/library/zlib/gzipfile/comment_spec.rb3
-rw-r--r--spec/ruby/library/zlib/gzipfile/orig_name_spec.rb3
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_char_spec.rb51
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_line_spec.rb1
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_spec.rb1
-rw-r--r--spec/ruby/library/zlib/gzipreader/eof_spec.rb22
-rw-r--r--spec/ruby/library/zlib/gzipreader/getc_spec.rb2
-rw-r--r--spec/ruby/library/zlib/gzipreader/gets_spec.rb2
-rw-r--r--spec/ruby/library/zlib/gzipreader/mtime_spec.rb11
-rw-r--r--spec/ruby/library/zlib/gzipreader/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/gzipreader/read_spec.rb6
-rw-r--r--spec/ruby/library/zlib/gzipreader/ungetbyte_spec.rb4
-rw-r--r--spec/ruby/library/zlib/gzipreader/ungetc_spec.rb12
-rw-r--r--spec/ruby/library/zlib/gzipwriter/append_spec.rb2
-rw-r--r--spec/ruby/library/zlib/gzipwriter/mtime_spec.rb3
-rw-r--r--spec/ruby/library/zlib/inflate/append_spec.rb2
-rw-r--r--spec/ruby/library/zlib/inflate/finish_spec.rb3
-rw-r--r--spec/ruby/library/zlib/inflate/inflate_spec.rb19
-rw-r--r--spec/ruby/library/zlib/inflate/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/inflate/set_dictionary_spec.rb2
-rw-r--r--spec/ruby/library/zlib/zlib_version_spec.rb2
-rw-r--r--spec/ruby/optional/capi/array_spec.rb82
-rw-r--r--spec/ruby/optional/capi/bignum_spec.rb42
-rw-r--r--spec/ruby/optional/capi/binding_spec.rb7
-rw-r--r--spec/ruby/optional/capi/class_spec.rb188
-rw-r--r--spec/ruby/optional/capi/constants_spec.rb2
-rw-r--r--spec/ruby/optional/capi/data_spec.rb68
-rw-r--r--spec/ruby/optional/capi/debug_spec.rb74
-rw-r--r--spec/ruby/optional/capi/digest_spec.rb103
-rw-r--r--spec/ruby/optional/capi/encoding_spec.rb284
-rw-r--r--spec/ruby/optional/capi/exception_spec.rb116
-rw-r--r--spec/ruby/optional/capi/ext/array_spec.c32
-rw-r--r--spec/ruby/optional/capi/ext/class_spec.c46
-rw-r--r--spec/ruby/optional/capi/ext/constants_spec.c6
-rw-r--r--spec/ruby/optional/capi/ext/data_spec.c10
-rw-r--r--spec/ruby/optional/capi/ext/debug_spec.c93
-rw-r--r--spec/ruby/optional/capi/ext/digest_spec.c168
-rw-r--r--spec/ruby/optional/capi/ext/encoding_spec.c72
-rw-r--r--spec/ruby/optional/capi/ext/exception_spec.c32
-rw-r--r--spec/ruby/optional/capi/ext/fiber_spec.c64
-rw-r--r--spec/ruby/optional/capi/ext/finalizer_spec.c25
-rw-r--r--spec/ruby/optional/capi/ext/gc_spec.c118
-rw-r--r--spec/ruby/optional/capi/ext/globals_spec.c34
-rw-r--r--spec/ruby/optional/capi/ext/hash_spec.c20
-rw-r--r--spec/ruby/optional/capi/ext/integer_spec.c7
-rw-r--r--spec/ruby/optional/capi/ext/io_spec.c186
-rw-r--r--spec/ruby/optional/capi/ext/kernel_spec.c132
-rw-r--r--spec/ruby/optional/capi/ext/module_spec.c41
-rw-r--r--spec/ruby/optional/capi/ext/mutex_spec.c23
-rw-r--r--spec/ruby/optional/capi/ext/object_spec.c143
-rw-r--r--spec/ruby/optional/capi/ext/proc_spec.c74
-rw-r--r--spec/ruby/optional/capi/ext/range_spec.c50
-rw-r--r--spec/ruby/optional/capi/ext/rbasic_spec.c68
-rw-r--r--spec/ruby/optional/capi/ext/regexp_spec.c13
-rw-r--r--spec/ruby/optional/capi/ext/rubyspec.h71
-rw-r--r--spec/ruby/optional/capi/ext/set_spec.c65
-rw-r--r--spec/ruby/optional/capi/ext/string_spec.c219
-rw-r--r--spec/ruby/optional/capi/ext/struct_spec.c42
-rw-r--r--spec/ruby/optional/capi/ext/symbol_spec.c11
-rw-r--r--spec/ruby/optional/capi/ext/thread_spec.c61
-rw-r--r--spec/ruby/optional/capi/ext/tracepoint_spec.c2
-rw-r--r--spec/ruby/optional/capi/ext/typed_data_spec.c29
-rw-r--r--spec/ruby/optional/capi/ext/util_spec.c38
-rw-r--r--spec/ruby/optional/capi/fiber_spec.rb86
-rw-r--r--spec/ruby/optional/capi/file_spec.rb10
-rw-r--r--spec/ruby/optional/capi/finalizer_spec.rb40
-rw-r--r--spec/ruby/optional/capi/fixnum_spec.rb24
-rw-r--r--spec/ruby/optional/capi/fixtures/class.rb13
-rw-r--r--spec/ruby/optional/capi/fixtures/kernel.rb19
-rw-r--r--spec/ruby/optional/capi/fixtures/module.rb4
-rw-r--r--spec/ruby/optional/capi/fixtures/object.rb29
-rw-r--r--spec/ruby/optional/capi/fixtures/read.txt1
-rw-r--r--spec/ruby/optional/capi/float_spec.rb4
-rw-r--r--spec/ruby/optional/capi/gc_spec.rb97
-rw-r--r--spec/ruby/optional/capi/globals_spec.rb81
-rw-r--r--spec/ruby/optional/capi/hash_spec.rb107
-rw-r--r--spec/ruby/optional/capi/integer_spec.rb19
-rw-r--r--spec/ruby/optional/capi/io_spec.rb479
-rw-r--r--spec/ruby/optional/capi/kernel_spec.rb469
-rw-r--r--spec/ruby/optional/capi/module_spec.rb115
-rw-r--r--spec/ruby/optional/capi/mutex_spec.rb47
-rw-r--r--spec/ruby/optional/capi/numeric_spec.rb64
-rw-r--r--spec/ruby/optional/capi/object_spec.rb361
-rw-r--r--spec/ruby/optional/capi/proc_spec.rb129
-rw-r--r--spec/ruby/optional/capi/range_spec.rb158
-rw-r--r--spec/ruby/optional/capi/rbasic_spec.rb40
-rw-r--r--spec/ruby/optional/capi/regexp_spec.rb47
-rw-r--r--spec/ruby/optional/capi/set_spec.rb96
-rw-r--r--spec/ruby/optional/capi/shared/rbasic.rb58
-rw-r--r--spec/ruby/optional/capi/spec_helper.rb62
-rw-r--r--spec/ruby/optional/capi/string_spec.rb735
-rw-r--r--spec/ruby/optional/capi/struct_spec.rb133
-rw-r--r--spec/ruby/optional/capi/symbol_spec.rb8
-rw-r--r--spec/ruby/optional/capi/thread_spec.rb92
-rw-r--r--spec/ruby/optional/capi/time_spec.rb111
-rw-r--r--spec/ruby/optional/capi/tracepoint_spec.rb2
-rw-r--r--spec/ruby/optional/capi/typed_data_spec.rb29
-rw-r--r--spec/ruby/optional/capi/util_spec.rb124
-rw-r--r--spec/ruby/optional/thread_safety/fixtures/classes.rb39
-rw-r--r--spec/ruby/optional/thread_safety/hash_spec.rb210
-rw-r--r--spec/ruby/security/cve_2010_1330_spec.rb6
-rw-r--r--spec/ruby/security/cve_2013_4164_spec.rb4
-rw-r--r--spec/ruby/security/cve_2014_8080_spec.rb35
-rw-r--r--spec/ruby/security/cve_2017_17742_spec.rb34
-rw-r--r--spec/ruby/security/cve_2018_16396_spec.rb18
-rw-r--r--spec/ruby/security/cve_2018_8778_spec.rb4
-rw-r--r--spec/ruby/security/cve_2018_8779_spec.rb4
-rw-r--r--spec/ruby/security/cve_2018_8780_spec.rb12
-rw-r--r--spec/ruby/security/cve_2019_8321_spec.rb26
-rw-r--r--spec/ruby/security/cve_2019_8322_spec.rb11
-rw-r--r--spec/ruby/security/cve_2019_8323_spec.rb58
-rw-r--r--spec/ruby/security/cve_2019_8325_spec.rb58
-rw-r--r--spec/ruby/security/cve_2020_10663_spec.rb46
-rw-r--r--spec/ruby/security/cve_2024_49761_spec.rb7
-rw-r--r--spec/ruby/shared/basicobject/method_missing.rb18
-rw-r--r--spec/ruby/shared/basicobject/send.rb18
-rw-r--r--spec/ruby/shared/enumerable/minmax.rb6
-rw-r--r--spec/ruby/shared/enumerator/enum_for.rb57
-rw-r--r--spec/ruby/shared/enumerator/with_index.rb33
-rw-r--r--spec/ruby/shared/enumerator/with_object.rb42
-rw-r--r--spec/ruby/shared/fiber/resume.rb58
-rw-r--r--spec/ruby/shared/file/directory.rb18
-rw-r--r--spec/ruby/shared/file/executable.rb43
-rw-r--r--spec/ruby/shared/file/executable_real.rb43
-rw-r--r--spec/ruby/shared/file/exist.rb11
-rw-r--r--spec/ruby/shared/file/file.rb8
-rw-r--r--spec/ruby/shared/file/grpowned.rb6
-rw-r--r--spec/ruby/shared/file/identical.rb18
-rw-r--r--spec/ruby/shared/file/readable.rb16
-rw-r--r--spec/ruby/shared/file/readable_real.rb16
-rw-r--r--spec/ruby/shared/file/size.rb4
-rw-r--r--spec/ruby/shared/file/socket.rb32
-rw-r--r--spec/ruby/shared/file/sticky.rb2
-rw-r--r--spec/ruby/shared/file/world_readable.rb10
-rw-r--r--spec/ruby/shared/file/world_writable.rb10
-rw-r--r--spec/ruby/shared/file/writable.rb16
-rw-r--r--spec/ruby/shared/file/writable_real.rb24
-rw-r--r--spec/ruby/shared/file/zero.rb10
-rw-r--r--spec/ruby/shared/hash/key_error.rb8
-rw-r--r--spec/ruby/shared/io/putc.rb10
-rw-r--r--spec/ruby/shared/kernel/at_exit.rb73
-rw-r--r--spec/ruby/shared/kernel/complex.rb133
-rw-r--r--spec/ruby/shared/kernel/equal.rb4
-rw-r--r--spec/ruby/shared/kernel/fixtures/END.rb3
-rw-r--r--spec/ruby/shared/kernel/fixtures/at_exit.rb3
-rw-r--r--spec/ruby/shared/kernel/object_id.rb30
-rw-r--r--spec/ruby/shared/kernel/raise.rb379
-rw-r--r--spec/ruby/shared/math/atanh.rb44
-rw-r--r--spec/ruby/shared/process/abort.rb12
-rw-r--r--spec/ruby/shared/process/exit.rb42
-rw-r--r--spec/ruby/shared/process/fork.rb39
-rw-r--r--spec/ruby/shared/queue/clear.rb4
-rw-r--r--spec/ruby/shared/queue/close.rb4
-rw-r--r--spec/ruby/shared/queue/closed.rb4
-rw-r--r--spec/ruby/shared/queue/deque.rb83
-rw-r--r--spec/ruby/shared/queue/empty.rb4
-rw-r--r--spec/ruby/shared/queue/enque.rb2
-rw-r--r--spec/ruby/shared/queue/freeze.rb8
-rw-r--r--spec/ruby/shared/rational/Rational.rb143
-rw-r--r--spec/ruby/shared/rational/abs.rb11
-rw-r--r--spec/ruby/shared/rational/arithmetic_exception_in_coerce.rb11
-rw-r--r--spec/ruby/shared/rational/ceil.rb45
-rw-r--r--spec/ruby/shared/rational/coerce.rb34
-rw-r--r--spec/ruby/shared/rational/comparison.rb95
-rw-r--r--spec/ruby/shared/rational/denominator.rb14
-rw-r--r--spec/ruby/shared/rational/div.rb54
-rw-r--r--spec/ruby/shared/rational/divide.rb71
-rw-r--r--spec/ruby/shared/rational/divmod.rb42
-rw-r--r--spec/ruby/shared/rational/equal_value.rb39
-rw-r--r--spec/ruby/shared/rational/exponent.rb196
-rw-r--r--spec/ruby/shared/rational/fdiv.rb5
-rw-r--r--spec/ruby/shared/rational/floor.rb45
-rw-r--r--spec/ruby/shared/rational/hash.rb9
-rw-r--r--spec/ruby/shared/rational/inspect.rb14
-rw-r--r--spec/ruby/shared/rational/marshal_dump.rb5
-rw-r--r--spec/ruby/shared/rational/marshal_load.rb5
-rw-r--r--spec/ruby/shared/rational/minus.rb48
-rw-r--r--spec/ruby/shared/rational/modulo.rb43
-rw-r--r--spec/ruby/shared/rational/multiply.rb62
-rw-r--r--spec/ruby/shared/rational/numerator.rb10
-rw-r--r--spec/ruby/shared/rational/plus.rb48
-rw-r--r--spec/ruby/shared/rational/quo.rb5
-rw-r--r--spec/ruby/shared/rational/remainder.rb5
-rw-r--r--spec/ruby/shared/rational/round.rb106
-rw-r--r--spec/ruby/shared/rational/to_f.rb10
-rw-r--r--spec/ruby/shared/rational/to_i.rb12
-rw-r--r--spec/ruby/shared/rational/to_r.rb11
-rw-r--r--spec/ruby/shared/rational/to_s.rb14
-rw-r--r--spec/ruby/shared/rational/truncate.rb45
-rw-r--r--spec/ruby/shared/sizedqueue/enque.rb83
-rw-r--r--spec/ruby/shared/sizedqueue/max.rb10
-rw-r--r--spec/ruby/shared/sizedqueue/new.rb17
-rw-r--r--spec/ruby/shared/string/end_with.rb17
-rw-r--r--spec/ruby/shared/string/start_with.rb20
-rw-r--r--spec/ruby/shared/string/times.rb52
-rw-r--r--spec/ruby/shared/time/strftime_for_time.rb8
-rw-r--r--spec/ruby/shared/time/yday.rb18
-rw-r--r--spec/ruby/shared/types/rb_num2dbl_fails.rb17
-rw-r--r--spec/ruby/spec_helper.rb12
-rw-r--r--spec/syntax_suggest/fixtures/derailed_require_tree.rb.txt74
-rwxr-xr-xspec/syntax_suggest/fixtures/rexe.rb.txt569
-rw-r--r--spec/syntax_suggest/fixtures/routes.rb.txt121
-rw-r--r--spec/syntax_suggest/fixtures/ruby_buildpack.rb.txt1344
-rw-r--r--spec/syntax_suggest/fixtures/syntax_tree.rb.txt9234
-rw-r--r--spec/syntax_suggest/fixtures/this_project_extra_def.rb.txt64
-rw-r--r--spec/syntax_suggest/fixtures/webmock.rb.txt35
-rw-r--r--spec/syntax_suggest/integration/exe_cli_spec.rb27
-rw-r--r--spec/syntax_suggest/integration/ruby_command_line_spec.rb189
-rw-r--r--spec/syntax_suggest/integration/syntax_suggest_spec.rb260
-rw-r--r--spec/syntax_suggest/spec_helper.rb117
-rw-r--r--spec/syntax_suggest/unit/api_spec.rb104
-rw-r--r--spec/syntax_suggest/unit/around_block_scan_spec.rb165
-rw-r--r--spec/syntax_suggest/unit/block_expand_spec.rb230
-rw-r--r--spec/syntax_suggest/unit/capture/before_after_keyword_ends_spec.rb47
-rw-r--r--spec/syntax_suggest/unit/capture/falling_indent_lines_spec.rb44
-rw-r--r--spec/syntax_suggest/unit/capture_code_context_spec.rb229
-rw-r--r--spec/syntax_suggest/unit/clean_document_spec.rb260
-rw-r--r--spec/syntax_suggest/unit/cli_spec.rb224
-rw-r--r--spec/syntax_suggest/unit/code_block_spec.rb77
-rw-r--r--spec/syntax_suggest/unit/code_frontier_spec.rb135
-rw-r--r--spec/syntax_suggest/unit/code_line_spec.rb164
-rw-r--r--spec/syntax_suggest/unit/code_search_spec.rb505
-rw-r--r--spec/syntax_suggest/unit/core_ext_spec.rb32
-rw-r--r--spec/syntax_suggest/unit/display_invalid_blocks_spec.rb174
-rw-r--r--spec/syntax_suggest/unit/explain_syntax_spec.rb283
-rw-r--r--spec/syntax_suggest/unit/mini_stringio_spec.rb25
-rw-r--r--spec/syntax_suggest/unit/pathname_from_message_spec.rb65
-rw-r--r--spec/syntax_suggest/unit/priority_queue_spec.rb95
-rw-r--r--spec/syntax_suggest/unit/scan_history_spec.rb114
-rw-r--r--spec/syntax_suggest/unit/visitor_spec.rb119
-rw-r--r--sprintf.c1387
-rw-r--r--st.c1939
-rw-r--r--strftime.c29
-rw-r--r--string.c11257
-rw-r--r--struct.c2009
-rw-r--r--symbol.c1364
-rw-r--r--symbol.h41
-rw-r--r--symbol.rb42
-rw-r--r--template/Doxyfile.tmpl2670
-rw-r--r--template/GNUmakefile.in26
-rw-r--r--template/Makefile.in392
-rw-r--r--template/builtin_binary.inc.tmpl30
-rw-r--r--template/builtin_binary.rbbin.tmpl35
-rw-r--r--template/configure-ext.mk.tmpl41
-rw-r--r--template/encdb.h.tmpl53
-rw-r--r--template/extinit.c.tmpl2
-rw-r--r--template/exts.mk.tmpl67
-rw-r--r--template/fake.rb.in46
-rw-r--r--template/id.c.tmpl7
-rw-r--r--template/id.h.tmpl27
-rw-r--r--template/known_errors.inc.tmpl8
-rw-r--r--template/limits.c.tmpl19
-rw-r--r--template/prelude.c.tmpl179
-rw-r--r--template/ruby-runner.h.in2
-rw-r--r--template/ruby.pc.in18
-rw-r--r--template/sizes.c.tmpl23
-rw-r--r--template/transdb.h.tmpl39
-rw-r--r--template/unicode_norm_gen.tmpl37
-rwxr-xr-xtemplate/unicode_properties.rdoc.tmpl59
-rw-r--r--test/-ext-/arith_seq/test_arith_seq_beg_len_step.rb52
-rw-r--r--test/-ext-/array/test_resize.rb6
-rw-r--r--test/-ext-/array/test_to_ary_concat.rb20
-rw-r--r--test/-ext-/bignum/test_big2str.rb38
-rw-r--r--test/-ext-/bignum/test_bigzero.rb20
-rw-r--r--test/-ext-/bignum/test_div.rb38
-rw-r--r--test/-ext-/bignum/test_mul.rb260
-rw-r--r--test/-ext-/bignum/test_pack.rb737
-rw-r--r--test/-ext-/bignum/test_str2big.rb52
-rw-r--r--test/-ext-/box/test_load_ext.rb97
-rw-r--r--test/-ext-/bug_reporter/test_bug_reporter.rb16
-rw-r--r--test/-ext-/debug/test_debug.rb67
-rw-r--r--test/-ext-/debug/test_profile_frames.rb90
-rw-r--r--test/-ext-/econv/test_append.rb23
-rw-r--r--test/-ext-/eval/test_eval.rb12
-rw-r--r--test/-ext-/float/test_nextafter.rb4
-rw-r--r--test/-ext-/funcall/test_funcall.rb11
-rw-r--r--test/-ext-/funcall/test_passing_block.rb5
-rw-r--r--test/-ext-/gvl/test_last_thread.rb5
-rw-r--r--test/-ext-/gvl/test_ubf_async_safe.rb4
-rw-r--r--test/-ext-/integer/test_integer.rb10
-rw-r--r--test/-ext-/integer/test_my_integer.rb34
-rw-r--r--test/-ext-/iseq_load/test_iseq_load.rb8
-rw-r--r--test/-ext-/load/test_resolve_symbol.rb27
-rw-r--r--test/-ext-/load/test_stringify_symbols.rb35
-rw-r--r--test/-ext-/marshal/test_internal_ivar.rb10
-rw-r--r--test/-ext-/num2int/test_num2int.rb4
-rw-r--r--test/-ext-/postponed_job/test_postponed_job.rb44
-rw-r--r--test/-ext-/rational/test_rat.rb26
-rw-r--r--test/-ext-/required.rb10
-rw-r--r--test/-ext-/scheduler/test_interrupt_with_scheduler.rb54
-rw-r--r--test/-ext-/stack/test_stack_overflow.rb55
-rw-r--r--test/-ext-/string/test_capacity.rb45
-rw-r--r--test/-ext-/string/test_cstr.rb6
-rw-r--r--test/-ext-/string/test_enc_str_buf_cat.rb9
-rw-r--r--test/-ext-/string/test_fstring.rb42
-rw-r--r--test/-ext-/string/test_interned_str.rb5
-rw-r--r--test/-ext-/string/test_rb_str_dup.rb6
-rw-r--r--test/-ext-/string/test_set_len.rb57
-rw-r--r--test/-ext-/string/test_too_many_dummy_encodings.rb15
-rw-r--r--test/-ext-/struct/test_data.rb18
-rw-r--r--test/-ext-/symbol/test_type.rb30
-rw-r--r--test/-ext-/test_abi.rb55
-rw-r--r--test/-ext-/test_bug-3571.rb4
-rw-r--r--test/-ext-/test_ensure_and_callcc.rb40
-rw-r--r--test/-ext-/test_printf.rb4
-rw-r--r--test/-ext-/test_random.rb26
-rw-r--r--test/-ext-/thread/helper.rb51
-rw-r--r--test/-ext-/thread/test_instrumentation_api.rb291
-rw-r--r--test/-ext-/thread/test_lock_native_thread.rb54
-rw-r--r--test/-ext-/thread_fd_close/test_thread_fd_close.rb25
-rw-r--r--test/-ext-/tracepoint/test_tracepoint.rb21
-rw-r--r--test/-ext-/wait/test_wait.rb36
-rw-r--r--test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb49
-rw-r--r--test/-ext-/win32/test_console_attr.rb14
-rw-r--r--test/.excludes-mmtk/TestArgf.rb1
-rw-r--r--test/.excludes-mmtk/TestEtc.rb1
-rw-r--r--test/.excludes-mmtk/TestGc.rb26
-rw-r--r--test/.excludes-mmtk/TestObjSpace.rb4
-rw-r--r--test/.excludes-mmtk/TestObjectSpace.rb1
-rw-r--r--test/.excludes-mmtk/TestProcess.rb4
-rw-r--r--test/.excludes-mmtk/TestTracepointObj.rb1
-rw-r--r--test/.excludes-zjit/TestResolvDNS.rb1
-rw-r--r--test/.excludes/JSONGenericObjectTest.rb4
-rw-r--r--test/.excludes/TestArray.rb1
-rw-r--r--test/.excludes/TestArraySubclass.rb1
-rw-r--r--test/.excludes/TestException.rb (renamed from test/excludes/TestException.rb)0
-rw-r--r--test/.excludes/TestGem.rb4
-rw-r--r--test/.excludes/TestIO_Console.rb (renamed from test/excludes/TestIO_Console.rb)0
-rw-r--r--test/.excludes/TestISeq.rb (renamed from test/excludes/TestISeq.rb)0
-rw-r--r--test/.excludes/TestPatternMatching.rb1
-rw-r--r--test/.excludes/TestThread.rb20
-rw-r--r--test/.excludes/TestThreadQueue.rb9
-rw-r--r--test/.excludes/URI/TestMailTo.rb1
-rw-r--r--test/base64/test_base64.rb115
-rw-r--r--test/benchmark/test_benchmark.rb158
-rw-r--r--test/bigdecimal/test_bigdecimal.rb2083
-rw-r--r--test/bigdecimal/test_bigdecimal_util.rb117
-rw-r--r--test/bigdecimal/test_bigmath.rb81
-rw-r--r--test/bigdecimal/test_ractor.rb23
-rw-r--r--test/bigdecimal/testbase.rb28
-rw-r--r--test/cgi/test_cgi_cookie.rb121
-rw-r--r--test/cgi/test_cgi_core.rb307
-rw-r--r--test/cgi/test_cgi_escape.rb325
-rw-r--r--test/cgi/test_cgi_header.rb184
-rw-r--r--test/cgi/test_cgi_modruby.rb149
-rw-r--r--test/cgi/test_cgi_multipart.rb385
-rw-r--r--test/cgi/test_cgi_session.rb169
-rw-r--r--test/cgi/test_cgi_tag_helper.rb355
-rw-r--r--test/cgi/test_cgi_util.rb193
-rw-r--r--test/cgi/testdata/file1.html10
-rw-r--r--test/cgi/testdata/large.pngbin156414 -> 0 bytes-rw-r--r--test/cgi/testdata/small.pngbin82 -> 0 bytes-rw-r--r--test/coverage/autostart.rb2
-rw-r--r--test/coverage/main.rb1
-rw-r--r--test/coverage/test_coverage.rb407
-rw-r--r--test/csv/helper.rb42
-rw-r--r--test/csv/interface/test_delegation.rb47
-rw-r--r--test/csv/interface/test_read.rb339
-rw-r--r--test/csv/interface/test_read_write.rb115
-rw-r--r--test/csv/interface/test_write.rb174
-rw-r--r--test/csv/line_endings.gzbin59 -> 0 bytes-rw-r--r--test/csv/parse/test_column_separator.rb40
-rw-r--r--test/csv/parse/test_convert.rb110
-rw-r--r--test/csv/parse/test_each.rb23
-rw-r--r--test/csv/parse/test_general.rb259
-rw-r--r--test/csv/parse/test_header.rb335
-rw-r--r--test/csv/parse/test_invalid.rb39
-rw-r--r--test/csv/parse/test_liberal_parsing.rb160
-rw-r--r--test/csv/parse/test_quote_char_nil.rb93
-rw-r--r--test/csv/parse/test_rewind.rb40
-rw-r--r--test/csv/parse/test_row_separator.rb16
-rw-r--r--test/csv/parse/test_skip_lines.rb118
-rw-r--r--test/csv/parse/test_strip.rb83
-rw-r--r--test/csv/parse/test_unconverted_fields.rb117
-rw-r--r--test/csv/test_data_converters.rb106
-rw-r--r--test/csv/test_encodings.rb372
-rw-r--r--test/csv/test_features.rb359
-rw-r--r--test/csv/test_row.rb435
-rw-r--r--test/csv/test_table.rb620
-rw-r--r--test/csv/write/test_converters.rb53
-rw-r--r--test/csv/write/test_force_quotes.rb78
-rw-r--r--test/csv/write/test_general.rb246
-rw-r--r--test/csv/write/test_quote_empty.rb70
-rw-r--r--test/date/test_date.rb45
-rw-r--r--test/date/test_date_conv.rb32
-rw-r--r--test/date/test_date_parse.rb88
-rw-r--r--test/date/test_date_ractor.rb4
-rw-r--r--test/date/test_date_strftime.rb13
-rw-r--r--test/date/test_date_strptime.rb24
-rw-r--r--test/date/test_switch_hitter.rb5
-rw-r--r--test/dbm/test_dbm.rb634
-rw-r--r--test/did_you_mean/core_ext/test_name_error_extension.rb27
-rw-r--r--test/did_you_mean/helper.rb14
-rw-r--r--test/did_you_mean/spell_checking/test_key_name_check.rb14
-rw-r--r--test/did_you_mean/spell_checking/test_method_name_check.rb42
-rw-r--r--test/did_you_mean/spell_checking/test_pattern_key_name_check.rb20
-rw-r--r--test/did_you_mean/spell_checking/test_require_path_check.rb10
-rw-r--r--test/did_you_mean/spell_checking/test_uncorrectable_name_check.rb2
-rw-r--r--test/did_you_mean/spell_checking/test_variable_name_check.rb36
-rw-r--r--test/did_you_mean/test_ractor_compatibility.rb117
-rw-r--r--test/did_you_mean/test_spell_checker.rb1
-rw-r--r--test/did_you_mean/test_verbose_formatter.rb23
-rw-r--r--test/did_you_mean/tree_spell/test_change_word.rb2
-rw-r--r--test/digest/test_digest_extend.rb13
-rw-r--r--test/digest/test_ractor.rb12
-rw-r--r--test/drb/drbtest.rb394
-rw-r--r--test/drb/ignore_test_drb.rb14
-rw-r--r--test/drb/test_acl.rb207
-rw-r--r--test/drb/test_drb.rb368
-rw-r--r--test/drb/test_drbobject.rb69
-rw-r--r--test/drb/test_drbssl.rb72
-rw-r--r--test/drb/test_drbunix.rb60
-rw-r--r--test/drb/ut_array.rb17
-rw-r--r--test/drb/ut_array_drbssl.rb39
-rw-r--r--test/drb/ut_array_drbunix.rb17
-rw-r--r--test/drb/ut_drb.rb189
-rw-r--r--test/drb/ut_drb_drbssl.rb40
-rw-r--r--test/drb/ut_drb_drbunix.rb18
-rw-r--r--test/drb/ut_eq.rb37
-rw-r--r--test/drb/ut_large.rb62
-rw-r--r--test/drb/ut_port.rb16
-rw-r--r--test/drb/ut_safe1.rb17
-rw-r--r--test/drb/ut_timerholder.rb74
-rw-r--r--test/dtrace/helper.rb8
-rw-r--r--test/erb/test_erb.rb147
-rw-r--r--test/erb/test_erb_command.rb22
-rw-r--r--test/error_highlight/test_error_highlight.rb1768
-rw-r--r--test/etc/test_etc.rb80
-rw-r--r--test/excludes/TestThread.rb2
-rw-r--r--test/excludes/_appveyor/TestArray.rb7
-rw-r--r--test/fiber/autoload.rb3
-rw-r--r--test/fiber/http.rb11
-rw-r--r--test/fiber/scheduler.rb467
-rw-r--r--test/fiber/test_address_resolve.rb278
-rw-r--r--test/fiber/test_enumerator.rb16
-rw-r--r--test/fiber/test_io.rb227
-rw-r--r--test/fiber/test_io_buffer.rb200
-rw-r--r--test/fiber/test_io_close.rb107
-rw-r--r--test/fiber/test_mutex.rb42
-rw-r--r--test/fiber/test_process.rb44
-rw-r--r--test/fiber/test_queue.rb54
-rw-r--r--test/fiber/test_ractor.rb4
-rw-r--r--test/fiber/test_scheduler.rb314
-rw-r--r--test/fiber/test_sleep.rb29
-rw-r--r--test/fiber/test_storage.rb115
-rw-r--r--test/fiber/test_thread.rb175
-rw-r--r--test/fiber/test_timeout.rb51
-rw-r--r--test/fiddle/helper.rb170
-rw-r--r--test/fiddle/test_c_struct_entry.rb165
-rw-r--r--test/fiddle/test_c_union_entity.rb36
-rw-r--r--test/fiddle/test_closure.rb85
-rw-r--r--test/fiddle/test_cparser.rb330
-rw-r--r--test/fiddle/test_fiddle.rb17
-rw-r--r--test/fiddle/test_func.rb138
-rw-r--r--test/fiddle/test_function.rb147
-rw-r--r--test/fiddle/test_handle.rb175
-rw-r--r--test/fiddle/test_import.rb479
-rw-r--r--test/fiddle/test_memory_view.rb115
-rw-r--r--test/fiddle/test_pinned.rb27
-rw-r--r--test/fiddle/test_pointer.rb288
-rw-r--r--test/fileutils/clobber.rb5
-rw-r--r--test/fileutils/test_dryrun.rb2
-rw-r--r--test/fileutils/test_fileutils.rb198
-rw-r--r--test/fileutils/test_nowrite.rb2
-rw-r--r--test/fileutils/test_verbose.rb2
-rw-r--r--test/fileutils/visibility_tests.rb5
-rw-r--r--test/fixtures/fake_sorted_set_gem/sorted_set.rb9
-rw-r--r--test/gdbm/test_gdbm.rb734
-rw-r--r--test/io/console/test_io_console.rb133
-rw-r--r--test/io/console/test_ractor.rb42
-rw-r--r--test/io/nonblock/test_flush.rb2
-rw-r--r--test/io/wait/test_io_wait.rb67
-rw-r--r--test/io/wait/test_io_wait_uncommon.rb51
-rw-r--r--test/io/wait/test_ractor.rb21
-rw-r--r--test/irb/test_cmd.rb279
-rw-r--r--test/irb/test_color.rb236
-rw-r--r--test/irb/test_completion.rb51
-rw-r--r--test/irb/test_context.rb412
-rw-r--r--test/irb/test_history.rb173
-rw-r--r--test/irb/test_init.rb73
-rw-r--r--test/irb/test_option.rb13
-rw-r--r--test/irb/test_raise_no_backtrace_exception.rb25
-rw-r--r--test/irb/test_ruby_lex.rb478
-rw-r--r--test/irb/test_workspace.rb105
-rw-r--r--test/json/fixtures/fail15.json (renamed from test/json/fixtures/pass15.json)0
-rw-r--r--test/json/fixtures/fail16.json (renamed from test/json/fixtures/pass16.json)0
-rw-r--r--test/json/fixtures/fail17.json (renamed from test/json/fixtures/pass17.json)0
-rw-r--r--test/json/fixtures/fail26.json (renamed from test/json/fixtures/pass26.json)0
-rw-r--r--test/json/fixtures/fail4.json1
-rw-r--r--test/json/fixtures/fail9.json1
-rw-r--r--test/json/fixtures/pass1.json2
-rw-r--r--test/json/json_addition_test.rb33
-rwxr-xr-xtest/json/json_coder_test.rb154
-rw-r--r--test/json/json_common_interface_test.rb248
-rw-r--r--test/json/json_encoding_test.rb256
-rw-r--r--test/json/json_ext_parser_test.rb76
-rw-r--r--test/json/json_fixtures_test.rb42
-rwxr-xr-x[-rw-r--r--]test/json/json_generator_test.rb1004
-rw-r--r--test/json/json_generic_object_test.rb35
-rw-r--r--test/json/json_parser_test.rb625
-rw-r--r--test/json/json_ryu_fallback_test.rb191
-rw-r--r--test/json/json_string_matching_test.rb4
-rw-r--r--test/json/ractor_test.rb108
-rw-r--r--test/json/test_helper.rb63
-rw-r--r--test/lib/!Nothing_to_test.rb5
-rw-r--r--test/lib/jit_support.rb92
-rw-r--r--test/lib/parser_support.rb20
-rw-r--r--test/logger/helper.rb13
-rw-r--r--test/logger/test_logdevice.rb858
-rw-r--r--test/logger/test_logger.rb393
-rw-r--r--test/logger/test_logperiod.rb80
-rw-r--r--test/logger/test_severity.rb26
-rw-r--r--test/matrix/test_matrix.rb832
-rw-r--r--test/matrix/test_vector.rb335
-rw-r--r--test/mkmf/base.rb233
-rw-r--r--test/mkmf/test_config.rb62
-rw-r--r--test/mkmf/test_configuration.rb39
-rw-r--r--test/mkmf/test_constant.rb60
-rw-r--r--test/mkmf/test_convertible.rb48
-rw-r--r--test/mkmf/test_egrep_cpp.rb27
-rw-r--r--test/mkmf/test_find_executable.rb82
-rw-r--r--test/mkmf/test_flags.rb92
-rw-r--r--test/mkmf/test_framework.rb70
-rw-r--r--test/mkmf/test_have_func.rb18
-rw-r--r--test/mkmf/test_have_library.rb84
-rw-r--r--test/mkmf/test_have_macro.rb46
-rw-r--r--test/mkmf/test_install.rb28
-rw-r--r--test/mkmf/test_libs.rb153
-rw-r--r--test/mkmf/test_mkmf.rb14
-rw-r--r--test/mkmf/test_pkg_config.rb71
-rw-r--r--test/mkmf/test_signedness.rb38
-rw-r--r--test/mkmf/test_sizeof.rb74
-rw-r--r--test/mmtk/helper.rb32
-rw-r--r--test/mmtk/test_configuration.rb93
-rw-r--r--test/monitor/test_monitor.rb35
-rw-r--r--test/net/fixtures/Makefile6
-rw-r--r--test/net/fixtures/cacert.pem44
-rw-r--r--test/net/fixtures/server.crt99
-rw-r--r--test/net/fixtures/server.key55
-rw-r--r--test/net/ftp/test_buffered_socket.rb48
-rw-r--r--test/net/ftp/test_ftp.rb2585
-rw-r--r--test/net/ftp/test_mlsx_entry.rb98
-rw-r--r--test/net/http/test_http.rb253
-rw-r--r--test/net/http/test_http_request.rb40
-rw-r--r--test/net/http/test_httpheader.rb27
-rw-r--r--test/net/http/test_httpresponse.rb289
-rw-r--r--test/net/http/test_https.rb199
-rw-r--r--test/net/http/test_https_proxy.rb51
-rw-r--r--test/net/http/utils.rb364
-rw-r--r--test/net/imap/test_imap.rb844
-rw-r--r--test/net/imap/test_imap_response_parser.rb311
-rw-r--r--test/net/pop/test_pop.rb166
-rw-r--r--test/net/protocol/test_protocol.rb37
-rw-r--r--test/net/smtp/test_response.rb100
-rw-r--r--test/net/smtp/test_smtp.rb301
-rw-r--r--test/net/smtp/test_ssl_socket.rb99
-rw-r--r--test/net/smtp/test_sslcontext.rb129
-rw-r--r--test/net/smtp/test_starttls.rb122
-rw-r--r--test/nkf/test_kconv.rb82
-rw-r--r--test/nkf/test_nkf.rb23
-rw-r--r--test/objspace/test_objspace.rb589
-rw-r--r--test/objspace/test_ractor.rb83
-rw-r--r--test/open-uri/test_ftp.rb216
-rw-r--r--test/open-uri/test_open-uri.rb619
-rw-r--r--test/open-uri/test_proxy.rb174
-rw-r--r--test/open-uri/test_ssl.rb446
-rw-r--r--test/open-uri/utils.rb738
-rw-r--r--test/openssl/fixtures/pkey/dh1024.pem5
-rw-r--r--test/openssl/fixtures/pkey/dh2048_ffdhe2048.pem8
-rw-r--r--test/openssl/fixtures/pkey/dsa1024.pem12
-rw-r--r--test/openssl/fixtures/pkey/dsa2048.pem15
-rw-r--r--test/openssl/fixtures/pkey/dsa256.pem8
-rw-r--r--test/openssl/fixtures/pkey/dsa512.pem8
-rw-r--r--test/openssl/fixtures/pkey/mldsa65-1.pem88
-rw-r--r--test/openssl/fixtures/pkey/mldsa65-2.pem88
-rw-r--r--test/openssl/fixtures/pkey/rsa1024.pem15
-rw-r--r--test/openssl/test_asn1.rb154
-rw-r--r--test/openssl/test_bn.rb136
-rw-r--r--test/openssl/test_buffering.rb2
-rw-r--r--test/openssl/test_cipher.rb196
-rw-r--r--test/openssl/test_config.rb194
-rw-r--r--test/openssl/test_digest.rb109
-rw-r--r--test/openssl/test_engine.rb38
-rw-r--r--test/openssl/test_fips.rb45
-rw-r--r--test/openssl/test_hmac.rb39
-rw-r--r--test/openssl/test_kdf.rb138
-rw-r--r--test/openssl/test_ns_spki.rb12
-rw-r--r--test/openssl/test_ocsp.rb56
-rw-r--r--test/openssl/test_ossl.rb86
-rw-r--r--test/openssl/test_pair.rb46
-rw-r--r--test/openssl/test_pkcs12.rb396
-rw-r--r--test/openssl/test_pkcs7.rb420
-rw-r--r--test/openssl/test_pkey.rb318
-rw-r--r--test/openssl/test_pkey_dh.rb215
-rw-r--r--test/openssl/test_pkey_dsa.rb236
-rw-r--r--test/openssl/test_pkey_ec.rb269
-rw-r--r--test/openssl/test_pkey_rsa.rb653
-rw-r--r--test/openssl/test_provider.rb84
-rw-r--r--test/openssl/test_ssl.rb1431
-rw-r--r--test/openssl/test_ssl_session.rb107
-rw-r--r--test/openssl/test_ts.rb109
-rw-r--r--test/openssl/test_x509attr.rb4
-rw-r--r--test/openssl/test_x509cert.rb307
-rw-r--r--test/openssl/test_x509crl.rb85
-rw-r--r--test/openssl/test_x509ext.rb37
-rw-r--r--test/openssl/test_x509name.rb16
-rw-r--r--test/openssl/test_x509req.rb101
-rw-r--r--test/openssl/test_x509store.rb427
-rw-r--r--test/openssl/ut_eof.rb8
-rw-r--r--test/openssl/utils.rb167
-rw-r--r--test/optparse/test_acceptable.rb10
-rw-r--r--test/optparse/test_autoconf.rb4
-rw-r--r--test/optparse/test_bash_completion.rb4
-rw-r--r--test/optparse/test_cclass.rb2
-rw-r--r--test/optparse/test_did_you_mean.rb22
-rw-r--r--test/optparse/test_getopts.rb20
-rw-r--r--test/optparse/test_kwargs.rb4
-rw-r--r--test/optparse/test_load.rb188
-rw-r--r--test/optparse/test_noarg.rb6
-rw-r--r--test/optparse/test_optarg.rb18
-rw-r--r--test/optparse/test_optparse.rb153
-rw-r--r--test/optparse/test_placearg.rb53
-rw-r--r--test/optparse/test_reqarg.rb16
-rw-r--r--test/optparse/test_summary.rb25
-rw-r--r--test/optparse/test_switch.rb50
-rw-r--r--test/optparse/test_zsh_completion.rb4
-rw-r--r--test/ostruct/test_ostruct.rb349
-rw-r--r--test/pathname/test_pathname.rb182
-rw-r--r--test/pathname/test_ractor.rb14
-rw-r--r--test/prism/api/command_line_test.rb114
-rw-r--r--test/prism/api/dump_test.rb56
-rw-r--r--test/prism/api/freeze_test.rb65
-rw-r--r--test/prism/api/lex_test.rb23
-rw-r--r--test/prism/api/parse_comments_test.rb33
-rw-r--r--test/prism/api/parse_stream_test.rb118
-rw-r--r--test/prism/api/parse_success_test.rb16
-rw-r--r--test/prism/api/parse_test.rb189
-rw-r--r--test/prism/bom_test.rb60
-rw-r--r--test/prism/encoding/encodings_test.rb91
-rw-r--r--test/prism/encoding/regular_expression_encoding_test.rb115
-rw-r--r--test/prism/encoding/string_encoding_test.rb136
-rw-r--r--test/prism/encoding/symbol_encoding_test.rb108
-rw-r--r--test/prism/errors/1_2_3.txt11
-rw-r--r--test/prism/errors/3.3-3.3/circular_parameters.txt12
-rw-r--r--test/prism/errors/3.3-3.4/leading_logical.txt34
-rw-r--r--test/prism/errors/3.3-3.4/private_endless_method.txt3
-rw-r--r--test/prism/errors/3.3-4.0/do_not_allow_trailing_commas_in_method_parameters.txt3
-rw-r--r--test/prism/errors/3.3-4.0/noblock.txt6
-rw-r--r--test/prism/errors/3.3-4.0/singleton_method_with_void_value.txt3
-rw-r--r--test/prism/errors/3.4-4.0/void_value.txt18
-rw-r--r--test/prism/errors/3.4/block_args_in_array_assignment.txt3
-rw-r--r--test/prism/errors/3.4/dont_allow_return_inside_sclass_body.txt3
-rw-r--r--test/prism/errors/3.4/it_with_ordinary_parameter.txt3
-rw-r--r--test/prism/errors/3.4/keyword_args_in_array_assignment.txt3
-rw-r--r--test/prism/errors/4.1/do_not_allow_trailing_commas_after_terminating_arguments.txt6
-rw-r--r--test/prism/errors/4.1/end_block_exit.txt10
-rw-r--r--test/prism/errors/4.1/multiple_blocks.txt12
-rw-r--r--test/prism/errors/4.1/singleton_method_with_void_value.txt4
-rw-r--r--test/prism/errors/4.1/void_value.txt44
-rw-r--r--test/prism/errors/aliasing_global_variable_with_global_number_variable.txt3
-rw-r--r--test/prism/errors/aliasing_global_variable_with_non_global_variable.txt3
-rw-r--r--test/prism/errors/aliasing_non_global_variable_with_global_variable.txt3
-rw-r--r--test/prism/errors/alnum_delimiters.txt3
-rw-r--r--test/prism/errors/alnum_delimiters_2.txt3
-rw-r--r--test/prism/errors/alnum_delimiters_3.txt3
-rw-r--r--test/prism/errors/alnum_delimiters_4.txt3
-rw-r--r--test/prism/errors/alnum_delimiters_5.txt3
-rw-r--r--test/prism/errors/alnum_delimiters_6.txt3
-rw-r--r--test/prism/errors/alnum_delimiters_7.txt3
-rw-r--r--test/prism/errors/alnum_delimiters_8.txt3
-rw-r--r--test/prism/errors/alnum_delimiters_9.txt3
-rw-r--r--test/prism/errors/amperand_dot_after_endless_range.txt3
-rw-r--r--test/prism/errors/argument_after_ellipsis.txt3
-rw-r--r--test/prism/errors/argument_forwarding_only_effects_its_own_internals.txt3
-rw-r--r--test/prism/errors/argument_forwarding_when_parent_is_not_forwarding.txt3
-rw-r--r--test/prism/errors/arguments_after_block.txt17
-rw-r--r--test/prism/errors/arguments_binding_power_for_and.txt5
-rw-r--r--test/prism/errors/arguments_invalid_comma.txt4
-rw-r--r--test/prism/errors/arguments_splat_after_star_star.txt3
-rw-r--r--test/prism/errors/array_invalid_comma.txt4
-rw-r--r--test/prism/errors/array_with_double_commas.txt3
-rw-r--r--test/prism/errors/assign_to_numbered_parameter.txt11
-rw-r--r--test/prism/errors/bad_arguments.txt6
-rw-r--r--test/prism/errors/begin_at_toplevel.txt3
-rw-r--r--test/prism/errors/binary_range_with_left_unary_range.txt8
-rw-r--r--test/prism/errors/block_arg_and_block.txt3
-rw-r--r--test/prism/errors/block_args_with_endless_def.txt5
-rw-r--r--test/prism/errors/block_beginning_with_brace_and_ending_with_end.txt5
-rw-r--r--test/prism/errors/block_pass_return_value.txt33
-rw-r--r--test/prism/errors/break_1.txt4
-rw-r--r--test/prism/errors/break_1_2_3.txt8
-rw-r--r--test/prism/errors/call_with_block_and_write.txt4
-rw-r--r--test/prism/errors/call_with_block_operator_write.txt4
-rw-r--r--test/prism/errors/call_with_block_or_write.txt4
-rw-r--r--test/prism/errors/cannot_assign_to_a_reserved_numbered_parameter.txt14
-rw-r--r--test/prism/errors/case_without_clauses.txt4
-rw-r--r--test/prism/errors/case_without_when_clauses_errors_on_else_clause.txt5
-rw-r--r--test/prism/errors/check_value_expression.txt20
-rw-r--r--test/prism/errors/class_definition_in_method_body.txt3
-rw-r--r--test/prism/errors/class_definition_in_method_defs.txt7
-rw-r--r--test/prism/errors/class_name.txt3
-rw-r--r--test/prism/errors/command_call_in.txt6
-rw-r--r--test/prism/errors/command_call_in_2.txt4
-rw-r--r--test/prism/errors/command_call_in_3.txt4
-rw-r--r--test/prism/errors/command_call_in_4.txt4
-rw-r--r--test/prism/errors/command_call_in_5.txt4
-rw-r--r--test/prism/errors/command_call_in_6.txt4
-rw-r--r--test/prism/errors/command_call_in_7.txt4
-rw-r--r--test/prism/errors/command_call_value_and.txt3
-rw-r--r--test/prism/errors/command_call_value_or.txt3
-rw-r--r--test/prism/errors/command_calls.txt10
-rw-r--r--test/prism/errors/command_calls_10.txt3
-rw-r--r--test/prism/errors/command_calls_11.txt3
-rw-r--r--test/prism/errors/command_calls_12.txt3
-rw-r--r--test/prism/errors/command_calls_13.txt3
-rw-r--r--test/prism/errors/command_calls_14.txt3
-rw-r--r--test/prism/errors/command_calls_15.txt3
-rw-r--r--test/prism/errors/command_calls_16.txt3
-rw-r--r--test/prism/errors/command_calls_17.txt5
-rw-r--r--test/prism/errors/command_calls_18.txt3
-rw-r--r--test/prism/errors/command_calls_19.txt3
-rw-r--r--test/prism/errors/command_calls_2.txt6
-rw-r--r--test/prism/errors/command_calls_20.txt3
-rw-r--r--test/prism/errors/command_calls_21.txt5
-rw-r--r--test/prism/errors/command_calls_22.txt3
-rw-r--r--test/prism/errors/command_calls_23.txt3
-rw-r--r--test/prism/errors/command_calls_24.txt5
-rw-r--r--test/prism/errors/command_calls_25.txt8
-rw-r--r--test/prism/errors/command_calls_26.txt3
-rw-r--r--test/prism/errors/command_calls_27.txt3
-rw-r--r--test/prism/errors/command_calls_28.txt3
-rw-r--r--test/prism/errors/command_calls_29.txt3
-rw-r--r--test/prism/errors/command_calls_3.txt3
-rw-r--r--test/prism/errors/command_calls_30.txt3
-rw-r--r--test/prism/errors/command_calls_31.txt17
-rw-r--r--test/prism/errors/command_calls_32.txt19
-rw-r--r--test/prism/errors/command_calls_33.txt6
-rw-r--r--test/prism/errors/command_calls_34.txt31
-rw-r--r--test/prism/errors/command_calls_35.txt50
-rw-r--r--test/prism/errors/command_calls_4.txt3
-rw-r--r--test/prism/errors/command_calls_5.txt3
-rw-r--r--test/prism/errors/command_calls_6.txt6
-rw-r--r--test/prism/errors/command_calls_7.txt6
-rw-r--r--test/prism/errors/command_calls_8.txt6
-rw-r--r--test/prism/errors/command_calls_9.txt6
-rw-r--r--test/prism/errors/conditional_predicate_closed.txt6
-rw-r--r--test/prism/errors/constant_assignment_in_method.txt3
-rw-r--r--test/prism/errors/constant_path_with_invalid_token_after.txt4
-rw-r--r--test/prism/errors/content_after_unterminated_heredoc.txt4
-rw-r--r--test/prism/errors/cr_without_lf_in_percent_expression.txt3
-rw-r--r--test/prism/errors/def_endless_do.txt6
-rw-r--r--test/prism/errors/def_ivar.txt3
-rw-r--r--test/prism/errors/def_with_empty_expression_receiver.txt3
-rw-r--r--test/prism/errors/def_with_expression_receiver_and_no_identifier.txt4
-rw-r--r--test/prism/errors/def_with_multiple_statements_receiver.txt10
-rw-r--r--test/prism/errors/def_with_optional_splat.txt6
-rw-r--r--test/prism/errors/defined_empty.txt3
-rw-r--r--test/prism/errors/defining_numbered_parameter.txt3
-rw-r--r--test/prism/errors/defining_numbered_parameter_2.txt3
-rw-r--r--test/prism/errors/defs_endless_method.txt12
-rw-r--r--test/prism/errors/destroy_call_operator_write_arguments.txt11
-rw-r--r--test/prism/errors/do_not_allow_characters_other_than_0_9_a_f_and_A_F_in_u_Unicode_character_notation.txt4
-rw-r--r--test/prism/errors/do_not_allow_forward_arguments_in_blocks.txt13
-rw-r--r--test/prism/errors/do_not_allow_forward_arguments_in_lambda_literals.txt13
-rw-r--r--test/prism/errors/do_not_allow_more_than_6_hexadecimal_digits_in_u_Unicode_character_notation.txt3
-rw-r--r--test/prism/errors/do_not_allow_multiple_codepoints_in_a_single_character_literal.txt3
-rw-r--r--test/prism/errors/do_not_allow_trailing_commas_in_lambda_parameters.txt3
-rw-r--r--test/prism/errors/dont_allow_return_inside_class_body.txt3
-rw-r--r--test/prism/errors/dont_allow_return_inside_module_body.txt3
-rw-r--r--test/prism/errors/dont_allow_setting_to_back_and_nth_reference.txt7
-rw-r--r--test/prism/errors/double_arguments_forwarding.txt4
-rw-r--r--test/prism/errors/double_scope_numbered_parameters.txt3
-rw-r--r--test/prism/errors/double_scope_repeated_numbered_parameters.txt3
-rw-r--r--test/prism/errors/double_splat_followed_by_splat_argument.txt3
-rw-r--r--test/prism/errors/double_splat_with_double_commas.txt3
-rw-r--r--test/prism/errors/duplicate_pattern_capture.txt17
-rw-r--r--test/prism/errors/duplicate_pattern_hash_key.txt4
-rw-r--r--test/prism/errors/duplicate_pattern_hash_key_2.txt3
-rw-r--r--test/prism/errors/duplicated_parameter_names.txt3
-rw-r--r--test/prism/errors/duplicated_parameter_names_2.txt3
-rw-r--r--test/prism/errors/duplicated_parameter_names_3.txt3
-rw-r--r--test/prism/errors/duplicated_parameter_names_4.txt3
-rw-r--r--test/prism/errors/duplicated_parameter_names_5.txt3
-rw-r--r--test/prism/errors/dynamic_label_pattern.txt3
-rw-r--r--test/prism/errors/ellipsis_in_no_paren_call.txt3
-rw-r--r--test/prism/errors/endless_method_command_call.txt3
-rw-r--r--test/prism/errors/endless_method_command_call_parameters.txt27
-rw-r--r--test/prism/errors/escape_unicode_curly_whitespace.txt5
-rw-r--r--test/prism/errors/for_loop_delimiter.txt3
-rw-r--r--test/prism/errors/for_loops_index_missing.txt5
-rw-r--r--test/prism/errors/for_loops_only_end.txt6
-rw-r--r--test/prism/errors/forwarding_arg_after_keyword_rest.txt3
-rw-r--r--test/prism/errors/forwarding_arg_and_block.txt3
-rw-r--r--test/prism/errors/heredoc_percent_q_newline_delimiter.txt11
-rw-r--r--test/prism/errors/heredoc_unterminated.txt9
-rw-r--r--test/prism/errors/incomplete_instance_var_string.txt4
-rw-r--r--test/prism/errors/index_call_with_block_and_write.txt5
-rw-r--r--test/prism/errors/index_call_with_block_operator_write.txt5
-rw-r--r--test/prism/errors/index_call_with_block_or_write.txt5
-rw-r--r--test/prism/errors/infix_after_label.txt6
-rw-r--r--test/prism/errors/interpolated_regular_expression_with_unknown_regexp_options.txt3
-rw-r--r--test/prism/errors/interpolated_symbol_pattern_hash_key.txt3
-rw-r--r--test/prism/errors/invalid_global_variable_write.txt4
-rw-r--r--test/prism/errors/invalid_hex_escape.txt3
-rw-r--r--test/prism/errors/invalid_multi_target.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_10.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_11.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_12.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_13.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_14.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_15.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_16.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_17.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_18.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_19.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_2.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_20.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_3.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_4.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_5.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_6.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_7.txt3
-rw-r--r--test/prism/errors/invalid_multi_target_8.txt4
-rw-r--r--test/prism/errors/invalid_multi_target_9.txt4
-rw-r--r--test/prism/errors/invalid_number_underscores.txt3
-rw-r--r--test/prism/errors/invalid_number_underscores_10.txt3
-rw-r--r--test/prism/errors/invalid_number_underscores_11.txt3
-rw-r--r--test/prism/errors/invalid_number_underscores_12.txt3
-rw-r--r--test/prism/errors/invalid_number_underscores_2.txt3
-rw-r--r--test/prism/errors/invalid_number_underscores_3.txt3
-rw-r--r--test/prism/errors/invalid_number_underscores_4.txt3
-rw-r--r--test/prism/errors/invalid_number_underscores_5.txt3
-rw-r--r--test/prism/errors/invalid_number_underscores_6.txt3
-rw-r--r--test/prism/errors/invalid_number_underscores_7.txt3
-rw-r--r--test/prism/errors/invalid_number_underscores_8.txt3
-rw-r--r--test/prism/errors/invalid_number_underscores_9.txt3
-rw-r--r--test/prism/errors/invalid_operator_write_dot.txt3
-rw-r--r--test/prism/errors/invalid_operator_write_fcall.txt3
-rw-r--r--test/prism/errors/invalid_splat.txt4
-rw-r--r--test/prism/errors/keywords_parameters_before_required_parameters.txt4
-rw-r--r--test/prism/errors/label_in_interpolated_string.txt14
-rw-r--r--test/prism/errors/label_in_parentheses.txt3
-rw-r--r--test/prism/errors/loop_conditional_is_closed.txt4
-rw-r--r--test/prism/errors/match_plus.txt7
-rw-r--r--test/prism/errors/match_predicate_after_and_with_dot_method_call.txt3
-rw-r--r--test/prism/errors/match_predicate_after_and_with_opreator.txt3
-rw-r--r--test/prism/errors/match_predicate_after_or_with_dot_method_call.txt3
-rw-r--r--test/prism/errors/match_predicate_after_or_with_opreator.txt3
-rw-r--r--test/prism/errors/match_predicate_after_rescue_with_dot_method_call.txt4
-rw-r--r--test/prism/errors/match_predicate_after_rescue_with_opreator.txt4
-rw-r--r--test/prism/errors/match_required_after_and_with_dot_method_call.txt3
-rw-r--r--test/prism/errors/match_required_after_and_with_opreator.txt3
-rw-r--r--test/prism/errors/match_required_after_or_with_dot_method_call.txt3
-rw-r--r--test/prism/errors/match_required_after_or_with_opreator.txt3
-rw-r--r--test/prism/errors/match_required_after_rescue_with_dot_method_call.txt4
-rw-r--r--test/prism/errors/match_required_after_rescue_with_opreator.txt4
-rw-r--r--test/prism/errors/method_parameters_after_arguments_forwarding.txt4
-rw-r--r--test/prism/errors/method_parameters_after_block.txt4
-rw-r--r--test/prism/errors/method_with_arguments_after_anonymous_block.txt4
-rw-r--r--test/prism/errors/missing_terminator_in_parentheses.txt3
-rw-r--r--test/prism/errors/modifier_conditional_in_predicate.txt12
-rw-r--r--test/prism/errors/module_definition_in_method_body.txt3
-rw-r--r--test/prism/errors/module_definition_in_method_body_within_block.txt7
-rw-r--r--test/prism/errors/module_definition_in_method_defs.txt7
-rw-r--r--test/prism/errors/module_name_recoverable.txt4
-rw-r--r--test/prism/errors/multi_target_parens.txt19
-rw-r--r--test/prism/errors/multi_target_star.txt17
-rw-r--r--test/prism/errors/multiple_error_in_parameters_order.txt5
-rw-r--r--test/prism/errors/next_1.txt4
-rw-r--r--test/prism/errors/next_1_2_3.txt8
-rw-r--r--test/prism/errors/non_assoc_equality.txt25
-rw-r--r--test/prism/errors/non_assoc_range.txt5
-rw-r--r--test/prism/errors/not_without_parens_assignment.txt4
-rw-r--r--test/prism/errors/not_without_parens_call.txt7
-rw-r--r--test/prism/errors/not_without_parens_command.txt4
-rw-r--r--test/prism/errors/not_without_parens_command_call.txt4
-rw-r--r--test/prism/errors/not_without_parens_return.txt4
-rw-r--r--test/prism/errors/numbered_and_write.txt3
-rw-r--r--test/prism/errors/numbered_operator_write.txt3
-rw-r--r--test/prism/errors/numbered_or_write.txt3
-rw-r--r--test/prism/errors/numbered_parameters_in_block_arguments.txt3
-rw-r--r--test/prism/errors/optional_block_parameters_with_unary_operator.txt3
-rw-r--r--test/prism/errors/optional_block_parameters_with_unary_operator_2.txt3
-rw-r--r--test/prism/errors/optional_block_parameters_with_unary_operator_3.txt3
-rw-r--r--test/prism/errors/optional_block_parameters_with_unary_operator_4.txt3
-rw-r--r--test/prism/errors/parameter_name_ending_with_bang_or_question_mark.txt4
-rw-r--r--test/prism/errors/parameters_invalid_comma.txt4
-rw-r--r--test/prism/errors/pattern-capture-in-alt-array.txt4
-rw-r--r--test/prism/errors/pattern-capture-in-alt-hash.txt3
-rw-r--r--test/prism/errors/pattern-capture-in-alt-name.txt3
-rw-r--r--test/prism/errors/pattern-capture-in-alt-top.txt4
-rw-r--r--test/prism/errors/pattern_arithmetic_expressions.txt3
-rw-r--r--test/prism/errors/pattern_match_implicit_rest.txt3
-rw-r--r--test/prism/errors/pattern_string_key.txt8
-rw-r--r--test/prism/errors/pre_execution_context.txt4
-rw-r--r--test/prism/errors/pre_execution_missing_brace.txt3
-rw-r--r--test/prism/errors/range_and_bin_op.txt5
-rw-r--r--test/prism/errors/range_and_bin_op_2.txt5
-rw-r--r--test/prism/errors/range_and_bin_op_3.txt3
-rw-r--r--test/prism/errors/range_and_bin_op_4.txt5
-rw-r--r--test/prism/errors/range_and_bin_op_5.txt6
-rw-r--r--test/prism/errors/range_and_bin_op_6.txt3
-rw-r--r--test/prism/errors/range_and_bin_op_7.txt3
-rw-r--r--test/prism/errors/range_and_bin_op_8.txt4
-rw-r--r--test/prism/errors/range_doubled.txt3
-rw-r--r--test/prism/errors/rational_number_with_exponential_portion.txt4
-rw-r--r--test/prism/errors/regexp_unicode_too_short.txt4
-rw-r--r--test/prism/errors/regular_expression_with_unknown_regexp_options.txt3
-rw-r--r--test/prism/errors/repeated_parameter_name_in_destructured_params.txt3
-rw-r--r--test/prism/errors/rescue_pattern.txt4
-rw-r--r--test/prism/errors/rest_keywords_parameters_before_required_parameters.txt4
-rw-r--r--test/prism/errors/return_1.txt3
-rw-r--r--test/prism/errors/return_1_2_3.txt7
-rw-r--r--test/prism/errors/returning_to_optional_parameters_multiple_times.txt4
-rw-r--r--test/prism/errors/semicolon_after_inheritance_operator.txt3
-rw-r--r--test/prism/errors/setter_method_cannot_be_defined_in_an_endless_method_definition.txt6
-rw-r--r--test/prism/errors/shadow_args_in_block.txt3
-rw-r--r--test/prism/errors/shadow_args_in_lambda.txt5
-rw-r--r--test/prism/errors/singleton_class_delimiter.txt3
-rw-r--r--test/prism/errors/singleton_method_for_literals.txt37
-rw-r--r--test/prism/errors/splat_argument_after_keyword_argument.txt3
-rw-r--r--test/prism/errors/statement_at_non_statement.txt9
-rw-r--r--test/prism/errors/statement_operators.txt25
-rw-r--r--test/prism/errors/switching_to_named_arguments_twice.txt5
-rw-r--r--test/prism/errors/switching_to_optional_arguments_twice.txt5
-rw-r--r--test/prism/errors/symbol_in_hash.txt3
-rw-r--r--test/prism/errors/symbol_in_keyword_parameter.txt3
-rw-r--r--test/prism/errors/targeting_numbered_parameter.txt3
-rw-r--r--test/prism/errors/top_level_constant_starting_with_downcased_identifier.txt4
-rw-r--r--test/prism/errors/top_level_constant_with_downcased_identifier.txt4
-rw-r--r--test/prism/errors/trailing_comma_after_block.txt3
-rw-r--r--test/prism/errors/trailing_comma_in_calls.txt3
-rw-r--r--test/prism/errors/unexpected_block.txt3
-rw-r--r--test/prism/errors/unterminated_W_list.txt3
-rw-r--r--test/prism/errors/unterminated_argument_expression.txt5
-rw-r--r--test/prism/errors/unterminated_begin.txt4
-rw-r--r--test/prism/errors/unterminated_begin_upcase.txt4
-rw-r--r--test/prism/errors/unterminated_block.txt4
-rw-r--r--test/prism/errors/unterminated_block_do_end.txt4
-rw-r--r--test/prism/errors/unterminated_class.txt4
-rw-r--r--test/prism/errors/unterminated_def.txt5
-rw-r--r--test/prism/errors/unterminated_embdoc.txt3
-rw-r--r--test/prism/errors/unterminated_embdoc_2.txt3
-rw-r--r--test/prism/errors/unterminated_empty_string.txt3
-rw-r--r--test/prism/errors/unterminated_end_upcase.txt4
-rw-r--r--test/prism/errors/unterminated_for.txt5
-rw-r--r--test/prism/errors/unterminated_global_variable.txt3
-rw-r--r--test/prism/errors/unterminated_global_variable_2.txt3
-rw-r--r--test/prism/errors/unterminated_heredoc_and_embexpr.txt11
-rw-r--r--test/prism/errors/unterminated_heredoc_and_embexpr_2.txt9
-rw-r--r--test/prism/errors/unterminated_i_list.txt3
-rw-r--r--test/prism/errors/unterminated_if.txt5
-rw-r--r--test/prism/errors/unterminated_if_else.txt5
-rw-r--r--test/prism/errors/unterminated_interpolated_string.txt3
-rw-r--r--test/prism/errors/unterminated_interpolated_symbol.txt3
-rw-r--r--test/prism/errors/unterminated_lambda_brace.txt4
-rw-r--r--test/prism/errors/unterminated_method_parameters.txt3
-rw-r--r--test/prism/errors/unterminated_module.txt4
-rw-r--r--test/prism/errors/unterminated_parenthesized_expression.txt4
-rw-r--r--test/prism/errors/unterminated_pattern_bracket.txt7
-rw-r--r--test/prism/errors/unterminated_pattern_paren.txt7
-rw-r--r--test/prism/errors/unterminated_regular_expression.txt3
-rw-r--r--test/prism/errors/unterminated_regular_expression_with_heredoc.txt4
-rw-r--r--test/prism/errors/unterminated_s_symbol.txt3
-rw-r--r--test/prism/errors/unterminated_string.txt3
-rw-r--r--test/prism/errors/unterminated_unicode_brackets_should_be_a_syntax_error.txt3
-rw-r--r--test/prism/errors/unterminated_until.txt5
-rw-r--r--test/prism/errors/unterminated_xstring.txt3
-rw-r--r--test/prism/errors/void_value_expression_in_arguments.txt17
-rw-r--r--test/prism/errors/void_value_expression_in_array.txt15
-rw-r--r--test/prism/errors/void_value_expression_in_assignment.txt9
-rw-r--r--test/prism/errors/void_value_expression_in_begin_statement.txt19
-rw-r--r--test/prism/errors/void_value_expression_in_binary_call.txt11
-rw-r--r--test/prism/errors/void_value_expression_in_call.txt11
-rw-r--r--test/prism/errors/void_value_expression_in_constant_path.txt5
-rw-r--r--test/prism/errors/void_value_expression_in_def.txt10
-rw-r--r--test/prism/errors/void_value_expression_in_expression.txt19
-rw-r--r--test/prism/errors/void_value_expression_in_hash.txt9
-rw-r--r--test/prism/errors/void_value_expression_in_modifier.txt13
-rw-r--r--test/prism/errors/void_value_expression_in_statement.txt26
-rw-r--r--test/prism/errors/void_value_expression_in_unary_call.txt5
-rw-r--r--test/prism/errors/while_endless_method.txt5
-rw-r--r--test/prism/errors/writing_numbered_parameter.txt3
-rw-r--r--test/prism/errors/xstring_concat.txt5
-rw-r--r--test/prism/errors_test.rb135
-rw-r--r--test/prism/fixtures/3.3-3.3/block_args_in_array_assignment.txt1
-rw-r--r--test/prism/fixtures/3.3-3.3/it.txt5
-rw-r--r--test/prism/fixtures/3.3-3.3/it_indirect_writes.txt23
-rw-r--r--test/prism/fixtures/3.3-3.3/it_read_and_assignment.txt1
-rw-r--r--test/prism/fixtures/3.3-3.3/it_with_ordinary_parameter.txt1
-rw-r--r--test/prism/fixtures/3.3-3.3/keyword_args_in_array_assignment.txt1
-rw-r--r--test/prism/fixtures/3.3-3.3/return_in_sclass.txt1
-rw-r--r--test/prism/fixtures/3.3-4.0/end_block_exit.txt11
-rw-r--r--test/prism/fixtures/3.3-4.0/void_value.txt29
-rw-r--r--test/prism/fixtures/3.4/circular_parameters.txt4
-rw-r--r--test/prism/fixtures/3.4/it.txt5
-rw-r--r--test/prism/fixtures/3.4/it_indirect_writes.txt23
-rw-r--r--test/prism/fixtures/3.4/it_read_and_assignment.txt1
-rw-r--r--test/prism/fixtures/4.0/endless_methods_command_call.txt11
-rw-r--r--test/prism/fixtures/4.0/leading_logical.txt16
-rw-r--r--test/prism/fixtures/4.1/noblock.txt4
-rw-r--r--test/prism/fixtures/4.1/trailing_comma_after_method_arguments.txt15
-rw-r--r--test/prism/fixtures/4.1/void_value.txt7
-rw-r--r--test/prism/fixtures/__END__.txt3
-rw-r--r--test/prism/fixtures/alias.txt23
-rw-r--r--test/prism/fixtures/and_or_with_suffix.txt17
-rw-r--r--test/prism/fixtures/arithmetic.txt13
-rw-r--r--test/prism/fixtures/arrays.txt122
-rw-r--r--test/prism/fixtures/begin_ensure.txt21
-rw-r--r--test/prism/fixtures/begin_rescue.txt85
-rw-r--r--test/prism/fixtures/blocks.txt62
-rw-r--r--test/prism/fixtures/bom_leading_space.txt1
-rw-r--r--test/prism/fixtures/bom_spaces.txt1
-rw-r--r--test/prism/fixtures/boolean_operators.txt5
-rw-r--r--test/prism/fixtures/booleans.txt3
-rw-r--r--test/prism/fixtures/break.txt33
-rw-r--r--test/prism/fixtures/case.txt55
-rw-r--r--test/prism/fixtures/case_in_hash_key.txt6
-rw-r--r--test/prism/fixtures/case_in_in.txt4
-rw-r--r--test/prism/fixtures/character_literal.txt2
-rw-r--r--test/prism/fixtures/classes.txt35
-rw-r--r--test/prism/fixtures/command_method_call.txt41
-rw-r--r--test/prism/fixtures/command_method_call_2.txt1
-rw-r--r--test/prism/fixtures/command_method_call_3.txt19
-rw-r--r--test/prism/fixtures/comment_single.txt1
-rw-r--r--test/prism/fixtures/comments.txt24
-rw-r--r--test/prism/fixtures/constants.txt184
-rw-r--r--test/prism/fixtures/dash_heredocs.txt63
-rw-r--r--test/prism/fixtures/defined.txt19
-rw-r--r--test/prism/fixtures/dos_endings.txt20
-rw-r--r--test/prism/fixtures/dstring.txt42
-rw-r--r--test/prism/fixtures/dsym_str.txt5
-rw-r--r--test/prism/fixtures/embdoc_no_newline_at_end.txt2
-rw-r--r--test/prism/fixtures/emoji_method_calls.txt1
-rw-r--r--test/prism/fixtures/encoding_binary.txt9
-rw-r--r--test/prism/fixtures/encoding_euc_jp.txt6
-rw-r--r--test/prism/fixtures/endless_method_as_default_arg.txt11
-rw-r--r--test/prism/fixtures/endless_methods.txt11
-rw-r--r--test/prism/fixtures/endless_range_in_conditional.txt3
-rw-r--r--test/prism/fixtures/escaped_newline_with_trailing_content.txt2
-rw-r--r--test/prism/fixtures/for.txt19
-rw-r--r--test/prism/fixtures/global_variables.txt93
-rw-r--r--test/prism/fixtures/hashes.txt28
-rw-r--r--test/prism/fixtures/heredoc.txt2
-rw-r--r--test/prism/fixtures/heredoc_dedent_line_continuation.txt5
-rw-r--r--test/prism/fixtures/heredoc_percent_q_newline_delimiter.txt22
-rw-r--r--test/prism/fixtures/heredoc_with_carriage_returns.txt2
-rw-r--r--test/prism/fixtures/heredoc_with_comment.txt3
-rw-r--r--test/prism/fixtures/heredoc_with_escaped_newline_at_start.txt7
-rw-r--r--test/prism/fixtures/heredoc_with_trailing_newline.txt2
-rw-r--r--test/prism/fixtures/heredocs_leading_whitespace.txt29
-rw-r--r--test/prism/fixtures/heredocs_nested.txt22
-rw-r--r--test/prism/fixtures/heredocs_with_fake_newlines.txt55
-rw-r--r--test/prism/fixtures/heredocs_with_ignored_newlines.txt14
-rw-r--r--test/prism/fixtures/heredocs_with_ignored_newlines_and_non_empty.txt4
-rw-r--r--test/prism/fixtures/if.txt42
-rw-r--r--test/prism/fixtures/indented_file_end.txt4
-rw-r--r--test/prism/fixtures/integer_operations.txt63
-rw-r--r--test/prism/fixtures/it_assignment.txt1
-rw-r--r--test/prism/fixtures/keyword_method_names.txt20
-rw-r--r--test/prism/fixtures/keywords.txt11
-rw-r--r--test/prism/fixtures/lambda.txt27
-rw-r--r--test/prism/fixtures/method_calls.txt156
-rw-r--r--test/prism/fixtures/methods.txt190
-rw-r--r--test/prism/fixtures/modules.txt18
-rw-r--r--test/prism/fixtures/multi_write.txt4
-rw-r--r--test/prism/fixtures/newline_terminated.txtbin0 -> 212 bytes-rw-r--r--test/prism/fixtures/next.txt28
-rw-r--r--test/prism/fixtures/nils.txt13
-rw-r--r--test/prism/fixtures/non_alphanumeric_methods.txt105
-rw-r--r--test/prism/fixtures/non_void_value.txt31
-rw-r--r--test/prism/fixtures/not.txt37
-rw-r--r--test/prism/fixtures/numbers.txt67
-rw-r--r--test/prism/fixtures/patterns.txt224
-rw-r--r--test/prism/fixtures/procs.txt27
-rw-r--r--test/prism/fixtures/range_begin_open_exclusive.txt1
-rw-r--r--test/prism/fixtures/range_begin_open_inclusive.txt1
-rw-r--r--test/prism/fixtures/range_beginless.txt5
-rw-r--r--test/prism/fixtures/range_end_open_exclusive.txt1
-rw-r--r--test/prism/fixtures/range_end_open_inclusive.txt1
-rw-r--r--test/prism/fixtures/ranges.txt51
-rw-r--r--test/prism/fixtures/regex.txt58
-rw-r--r--test/prism/fixtures/regex_char_width.txt3
-rw-r--r--test/prism/fixtures/regex_escape_encoding.txt3
-rw-r--r--test/prism/fixtures/regex_with_fake_newlines.txt41
-rw-r--r--test/prism/fixtures/repeat_parameters.txt38
-rw-r--r--test/prism/fixtures/rescue.txt39
-rw-r--r--test/prism/fixtures/rescue_modifier.txt7
-rw-r--r--test/prism/fixtures/return.txt27
-rw-r--r--test/prism/fixtures/seattlerb/BEGIN.txt1
-rw-r--r--test/prism/fixtures/seattlerb/README.rdoc113
-rw-r--r--test/prism/fixtures/seattlerb/TestRubyParserShared.txt92
-rw-r--r--test/prism/fixtures/seattlerb/__ENCODING__.txt1
-rw-r--r--test/prism/fixtures/seattlerb/alias_gvar_backref.txt1
-rw-r--r--test/prism/fixtures/seattlerb/alias_resword.txt1
-rw-r--r--test/prism/fixtures/seattlerb/and_multi.txt3
-rw-r--r--test/prism/fixtures/seattlerb/aref_args_assocs.txt1
-rw-r--r--test/prism/fixtures/seattlerb/aref_args_lit_assocs.txt1
-rw-r--r--test/prism/fixtures/seattlerb/args_kw_block.txt1
-rw-r--r--test/prism/fixtures/seattlerb/array_line_breaks.txt4
-rw-r--r--test/prism/fixtures/seattlerb/array_lits_trailing_calls.txt3
-rw-r--r--test/prism/fixtures/seattlerb/assoc__bare.txt1
-rw-r--r--test/prism/fixtures/seattlerb/assoc_label.txt1
-rw-r--r--test/prism/fixtures/seattlerb/attr_asgn_colon_id.txt1
-rw-r--r--test/prism/fixtures/seattlerb/attrasgn_array_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/attrasgn_array_lhs.txt1
-rw-r--r--test/prism/fixtures/seattlerb/attrasgn_primary_dot_constant.txt1
-rw-r--r--test/prism/fixtures/seattlerb/backticks_interpolation_line.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bang_eq.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bdot2.txt3
-rw-r--r--test/prism/fixtures/seattlerb/bdot3.txt3
-rw-r--r--test/prism/fixtures/seattlerb/begin_ensure_no_bodies.txt3
-rw-r--r--test/prism/fixtures/seattlerb/begin_rescue_else_ensure_bodies.txt9
-rw-r--r--test/prism/fixtures/seattlerb/begin_rescue_else_ensure_no_bodies.txt9
-rw-r--r--test/prism/fixtures/seattlerb/begin_rescue_ensure_no_bodies.txt4
-rw-r--r--test/prism/fixtures/seattlerb/block_arg__bare.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_arg_kwsplat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_arg_opt_arg_block.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_arg_opt_splat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_arg_opt_splat_arg_block_omfg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_arg_optional.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_arg_scope.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_arg_scope2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_arg_splat_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_args_kwargs.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_args_no_kwargs.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_args_opt1.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_args_opt2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_args_opt2_2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_args_opt3.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_call_defn_call_block_call.txt4
-rw-r--r--test/prism/fixtures/seattlerb/block_call_dot_op2_brace_block.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_call_dot_op2_cmd_args_do_block.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_call_operation_colon.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_call_operation_dot.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_call_paren_call_block_call.txt2
-rw-r--r--test/prism/fixtures/seattlerb/block_command_operation_colon.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_command_operation_dot.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_decomp_anon_splat_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_decomp_arg_splat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_decomp_arg_splat_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_decomp_splat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_kw.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_kw__required.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_kwarg_lvar.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_kwarg_lvar_multiple.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_opt_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_opt_splat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_opt_splat_arg_block_omfg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_optarg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_paren_splat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_reg_optarg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_return.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_scope.txt1
-rw-r--r--test/prism/fixtures/seattlerb/block_splat_reg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug169.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug179.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug190.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug191.txt3
-rw-r--r--test/prism/fixtures/seattlerb/bug202.txt2
-rw-r--r--test/prism/fixtures/seattlerb/bug236.txt3
-rw-r--r--test/prism/fixtures/seattlerb/bug290.txt3
-rw-r--r--test/prism/fixtures/seattlerb/bug_187.txt3
-rw-r--r--test/prism/fixtures/seattlerb/bug_215.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug_249.txt4
-rw-r--r--test/prism/fixtures/seattlerb/bug_and.txt4
-rw-r--r--test/prism/fixtures/seattlerb/bug_args__19.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug_args_masgn.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug_args_masgn2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug_args_masgn_outer_parens__19.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug_call_arglist_parens.txt11
-rw-r--r--test/prism/fixtures/seattlerb/bug_case_when_regexp.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug_comma.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug_cond_pct.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug_hash_args.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug_hash_args_trailing_comma.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug_hash_interp_array.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug_masgn_right.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug_not_parens.txt1
-rw-r--r--test/prism/fixtures/seattlerb/bug_op_asgn_rescue.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_and.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_arg_assoc.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_arg_assoc_kwsplat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_arg_kwsplat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_args_assoc_quoted.txt5
-rw-r--r--test/prism/fixtures/seattlerb/call_args_assoc_trailing_comma.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_args_command.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_array_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_array_block_call.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_array_lambda_block_call.txt2
-rw-r--r--test/prism/fixtures/seattlerb/call_array_lit_inline_hash.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_assoc.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_assoc_new.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_assoc_new_if_multiline.txt5
-rw-r--r--test/prism/fixtures/seattlerb/call_assoc_trailing_comma.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_bang_command_call.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_bang_squiggle.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_begin_call_block_call.txt3
-rw-r--r--test/prism/fixtures/seattlerb/call_block_arg_named.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_carat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_colon2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_colon_parens.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_div.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_dot_parens.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_env.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_eq3.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_gt.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_kwsplat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_leading_dots.txt3
-rw-r--r--test/prism/fixtures/seattlerb/call_leading_dots_comment.txt4
-rw-r--r--test/prism/fixtures/seattlerb/call_lt.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_lte.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_not.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_pipe.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_rshift.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_self_brackets.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_spaceship.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_stabby_do_end_with_block.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_stabby_with_braces_block.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_star.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_star2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_trailing_comma.txt1
-rw-r--r--test/prism/fixtures/seattlerb/call_trailing_dots.txt3
-rw-r--r--test/prism/fixtures/seattlerb/call_unary_bang.txt1
-rw-r--r--test/prism/fixtures/seattlerb/case_in.txt111
-rw-r--r--test/prism/fixtures/seattlerb/case_in_31.txt4
-rw-r--r--test/prism/fixtures/seattlerb/case_in_37.txt4
-rw-r--r--test/prism/fixtures/seattlerb/case_in_42.txt3
-rw-r--r--test/prism/fixtures/seattlerb/case_in_42_2.txt3
-rw-r--r--test/prism/fixtures/seattlerb/case_in_47.txt4
-rw-r--r--test/prism/fixtures/seattlerb/case_in_67.txt3
-rw-r--r--test/prism/fixtures/seattlerb/case_in_86.txt3
-rw-r--r--test/prism/fixtures/seattlerb/case_in_86_2.txt3
-rw-r--r--test/prism/fixtures/seattlerb/case_in_array_pat_const.txt4
-rw-r--r--test/prism/fixtures/seattlerb/case_in_array_pat_const2.txt4
-rw-r--r--test/prism/fixtures/seattlerb/case_in_array_pat_paren_assign.txt4
-rw-r--r--test/prism/fixtures/seattlerb/case_in_const.txt4
-rw-r--r--test/prism/fixtures/seattlerb/case_in_else.txt7
-rw-r--r--test/prism/fixtures/seattlerb/case_in_find.txt3
-rw-r--r--test/prism/fixtures/seattlerb/case_in_find_array.txt3
-rw-r--r--test/prism/fixtures/seattlerb/case_in_hash_pat.txt5
-rw-r--r--test/prism/fixtures/seattlerb/case_in_hash_pat_assign.txt4
-rw-r--r--test/prism/fixtures/seattlerb/case_in_hash_pat_paren_assign.txt4
-rw-r--r--test/prism/fixtures/seattlerb/case_in_hash_pat_paren_true.txt5
-rw-r--r--test/prism/fixtures/seattlerb/case_in_hash_pat_rest.txt3
-rw-r--r--test/prism/fixtures/seattlerb/case_in_hash_pat_rest_solo.txt3
-rw-r--r--test/prism/fixtures/seattlerb/case_in_if_unless_post_mod.txt6
-rw-r--r--test/prism/fixtures/seattlerb/case_in_multiple.txt6
-rw-r--r--test/prism/fixtures/seattlerb/case_in_or.txt5
-rw-r--r--test/prism/fixtures/seattlerb/class_comments.txt9
-rw-r--r--test/prism/fixtures/seattlerb/cond_unary_minus.txt1
-rw-r--r--test/prism/fixtures/seattlerb/const_2_op_asgn_or2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/const_3_op_asgn_or.txt1
-rw-r--r--test/prism/fixtures/seattlerb/const_op_asgn_and1.txt1
-rw-r--r--test/prism/fixtures/seattlerb/const_op_asgn_and2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/const_op_asgn_or.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defined_eh_parens.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_arg_asplat_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_arg_forward_args.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_args_forward_args.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_comments.txt5
-rw-r--r--test/prism/fixtures/seattlerb/defn_endless_command.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_endless_command_rescue.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_forward_args.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_forward_args__no_parens.txt3
-rw-r--r--test/prism/fixtures/seattlerb/defn_kwarg_env.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_kwarg_kwarg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_kwarg_kwsplat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_kwarg_kwsplat_anon.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_kwarg_lvar.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_kwarg_no_parens.txt2
-rw-r--r--test/prism/fixtures/seattlerb/defn_kwarg_val.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_no_kwargs.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_oneliner.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_oneliner_eq2.txt3
-rw-r--r--test/prism/fixtures/seattlerb/defn_oneliner_noargs.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_oneliner_noargs_parentheses.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_oneliner_rescue.txt13
-rw-r--r--test/prism/fixtures/seattlerb/defn_opt_last_arg.txt2
-rw-r--r--test/prism/fixtures/seattlerb/defn_opt_reg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_opt_splat_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_powarg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_reg_opt_reg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_splat_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defn_unary_not.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defns_reserved.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defs_as_arg_with_do_block_inside.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defs_comments.txt5
-rw-r--r--test/prism/fixtures/seattlerb/defs_endless_command.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defs_endless_command_rescue.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defs_kwarg.txt2
-rw-r--r--test/prism/fixtures/seattlerb/defs_oneliner.txt1
-rw-r--r--test/prism/fixtures/seattlerb/defs_oneliner_eq2.txt3
-rw-r--r--test/prism/fixtures/seattlerb/defs_oneliner_rescue.txt13
-rw-r--r--test/prism/fixtures/seattlerb/difficult0_.txt4
-rw-r--r--test/prism/fixtures/seattlerb/difficult1_line_numbers.txt13
-rw-r--r--test/prism/fixtures/seattlerb/difficult1_line_numbers2.txt8
-rw-r--r--test/prism/fixtures/seattlerb/difficult2_.txt2
-rw-r--r--test/prism/fixtures/seattlerb/difficult3_.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult3_2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult3_3.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult3_4.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult3_5.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult3__10.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult3__11.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult3__12.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult3__6.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult3__7.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult3__8.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult3__9.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult4__leading_dots.txt2
-rw-r--r--test/prism/fixtures/seattlerb/difficult4__leading_dots2.txt2
-rw-r--r--test/prism/fixtures/seattlerb/difficult6_.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult6__7.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult6__8.txt1
-rw-r--r--test/prism/fixtures/seattlerb/difficult7_.txt5
-rw-r--r--test/prism/fixtures/seattlerb/do_bug.txt4
-rw-r--r--test/prism/fixtures/seattlerb/do_lambda.txt1
-rw-r--r--test/prism/fixtures/seattlerb/dot2_nil__26.txt1
-rw-r--r--test/prism/fixtures/seattlerb/dot3_nil__26.txt1
-rw-r--r--test/prism/fixtures/seattlerb/dstr_evstr.txt1
-rw-r--r--test/prism/fixtures/seattlerb/dstr_evstr_empty_end.txt1
-rw-r--r--test/prism/fixtures/seattlerb/dstr_lex_state.txt1
-rw-r--r--test/prism/fixtures/seattlerb/dstr_str.txt1
-rw-r--r--test/prism/fixtures/seattlerb/dsym_esc_to_sym.txt1
-rw-r--r--test/prism/fixtures/seattlerb/dsym_to_sym.txt3
-rw-r--r--test/prism/fixtures/seattlerb/eq_begin_line_numbers.txt6
-rw-r--r--test/prism/fixtures/seattlerb/eq_begin_why_wont_people_use_their_spacebar.txt3
-rw-r--r--test/prism/fixtures/seattlerb/evstr_evstr.txt1
-rw-r--r--test/prism/fixtures/seattlerb/evstr_str.txt1
-rw-r--r--test/prism/fixtures/seattlerb/expr_not_bang.txt1
-rw-r--r--test/prism/fixtures/seattlerb/f_kw.txt1
-rw-r--r--test/prism/fixtures/seattlerb/f_kw__required.txt1
-rw-r--r--test/prism/fixtures/seattlerb/flip2_env_lvar.txt1
-rw-r--r--test/prism/fixtures/seattlerb/float_with_if_modifier.txt1
-rw-r--r--test/prism/fixtures/seattlerb/heredoc__backslash_dos_format.txt5
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_backslash_nl.txt8
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_bad_hex_escape.txt3
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_bad_oct_escape.txt5
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_comma_arg.txt7
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_lineno.txt7
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_nested.txt7
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_squiggly.txt7
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_squiggly_blank_line_plus_interpolation.txt4
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_squiggly_blank_lines.txt7
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_squiggly_empty.txt2
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_squiggly_interp.txt5
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_squiggly_no_indent.txt3
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_squiggly_tabs.txt6
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_squiggly_tabs_extra.txt6
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_squiggly_visually_blank_lines.txt7
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_trailing_slash_continued_call.txt4
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_unicode.txt4
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_with_carriage_return_escapes.txt5
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_with_carriage_return_escapes_windows.txt5
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_with_extra_carriage_horrible_mix.txt4
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_with_extra_carriage_returns.txt5
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_with_extra_carriage_returns_windows.txt5
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_with_interpolation_and_carriage_return_escapes.txt4
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_with_interpolation_and_carriage_return_escapes_windows.txt4
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_with_not_global_interpolation.txt3
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_with_only_carriage_returns.txt6
-rw-r--r--test/prism/fixtures/seattlerb/heredoc_with_only_carriage_returns_windows.txt6
-rw-r--r--test/prism/fixtures/seattlerb/if_elsif.txt1
-rw-r--r--test/prism/fixtures/seattlerb/if_symbol.txt1
-rw-r--r--test/prism/fixtures/seattlerb/in_expr_no_case.txt1
-rw-r--r--test/prism/fixtures/seattlerb/index_0.txt1
-rw-r--r--test/prism/fixtures/seattlerb/index_0_opasgn.txt1
-rw-r--r--test/prism/fixtures/seattlerb/integer_with_if_modifier.txt1
-rw-r--r--test/prism/fixtures/seattlerb/interpolated_symbol_array_line_breaks.txt5
-rw-r--r--test/prism/fixtures/seattlerb/interpolated_word_array_line_breaks.txt5
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_1.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_10_1.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_10_2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_11_1.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_11_2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_2__19.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_3.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_4.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_5.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_6.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_7_1.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_7_2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_8_1.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_8_2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_9_1.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_args_9_2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_kwarg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/iter_kwarg_kwsplat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/label_vs_string.txt2
-rw-r--r--test/prism/fixtures/seattlerb/lambda_do_vs_brace.txt7
-rw-r--r--test/prism/fixtures/seattlerb/lasgn_arg_rescue_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/lasgn_call_bracket_rescue_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/lasgn_call_nobracket_rescue_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/lasgn_command.txt1
-rw-r--r--test/prism/fixtures/seattlerb/lasgn_env.txt1
-rw-r--r--test/prism/fixtures/seattlerb/lasgn_ivar_env.txt1
-rw-r--r--test/prism/fixtures/seattlerb/lasgn_lasgn_command_call.txt1
-rw-r--r--test/prism/fixtures/seattlerb/lasgn_middle_splat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/magic_encoding_comment.txt4
-rw-r--r--test/prism/fixtures/seattlerb/masgn_anon_splat_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/masgn_arg_colon_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/masgn_arg_ident.txt1
-rw-r--r--test/prism/fixtures/seattlerb/masgn_arg_splat_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/masgn_colon2.txt1
-rw-r--r--test/prism/fixtures/seattlerb/masgn_colon3.txt1
-rw-r--r--test/prism/fixtures/seattlerb/masgn_command_call.txt1
-rw-r--r--test/prism/fixtures/seattlerb/masgn_double_paren.txt1
-rw-r--r--test/prism/fixtures/seattlerb/masgn_lhs_splat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/masgn_paren.txt1
-rw-r--r--test/prism/fixtures/seattlerb/masgn_splat_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/masgn_splat_arg_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/masgn_star.txt1
-rw-r--r--test/prism/fixtures/seattlerb/masgn_var_star_var.txt1
-rw-r--r--test/prism/fixtures/seattlerb/messy_op_asgn_lineno.txt1
-rw-r--r--test/prism/fixtures/seattlerb/method_call_assoc_trailing_comma.txt1
-rw-r--r--test/prism/fixtures/seattlerb/method_call_trailing_comma.txt1
-rw-r--r--test/prism/fixtures/seattlerb/mlhs_back_anonsplat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/mlhs_back_splat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/mlhs_front_anonsplat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/mlhs_front_splat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/mlhs_keyword.txt1
-rw-r--r--test/prism/fixtures/seattlerb/mlhs_mid_anonsplat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/mlhs_mid_splat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/mlhs_rescue.txt1
-rw-r--r--test/prism/fixtures/seattlerb/module_comments.txt10
-rw-r--r--test/prism/fixtures/seattlerb/multiline_hash_declaration.txt8
-rw-r--r--test/prism/fixtures/seattlerb/non_interpolated_symbol_array_line_breaks.txt5
-rw-r--r--test/prism/fixtures/seattlerb/non_interpolated_word_array_line_breaks.txt5
-rw-r--r--test/prism/fixtures/seattlerb/op_asgn_command_call.txt1
-rw-r--r--test/prism/fixtures/seattlerb/op_asgn_dot_ident_command_call.txt1
-rw-r--r--test/prism/fixtures/seattlerb/op_asgn_index_command_call.txt1
-rw-r--r--test/prism/fixtures/seattlerb/op_asgn_primary_colon_const_command_call.txt1
-rw-r--r--test/prism/fixtures/seattlerb/op_asgn_primary_colon_identifier1.txt1
-rw-r--r--test/prism/fixtures/seattlerb/op_asgn_primary_colon_identifier_command_call.txt1
-rw-r--r--test/prism/fixtures/seattlerb/op_asgn_val_dot_ident_command_call.txt1
-rw-r--r--test/prism/fixtures/seattlerb/parse_def_special_name.txt1
-rw-r--r--test/prism/fixtures/seattlerb/parse_if_not_canonical.txt2
-rw-r--r--test/prism/fixtures/seattlerb/parse_if_not_noncanonical.txt2
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_block.txt2
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_block_inline_comment.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_block_inline_comment_leading_newlines.txt7
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_block_inline_multiline_comment.txt4
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_call_ivar_arg_no_parens_line_break.txt2
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_call_ivar_line_break_paren.txt2
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_call_no_args.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_defn_complex.txt5
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_defn_no_parens.txt6
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_defn_no_parens_args.txt2
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_dot2.txt5
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_dot2_open.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_dot3.txt5
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_dot3_open.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_dstr_escaped_newline.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_dstr_soft_newline.txt4
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_evstr_after_break.txt2
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_hash_lit.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_heredoc.txt5
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_heredoc_evstr.txt4
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_heredoc_hardnewline.txt7
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_heredoc_regexp_chars.txt5
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_iter_call_no_parens.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_iter_call_parens.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_multiline_str.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_multiline_str_literal_n.txt2
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_newlines.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_op_asgn.txt4
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_postexe.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_preexe.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_rescue.txt8
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_return.txt6
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_str_with_newline_escape.txt1
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_to_ary.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_line_trailing_newlines.txt2
-rw-r--r--test/prism/fixtures/seattlerb/parse_opt_call_args_assocs_comma.txt1
-rw-r--r--test/prism/fixtures/seattlerb/parse_opt_call_args_lit_comma.txt1
-rw-r--r--test/prism/fixtures/seattlerb/parse_pattern_019.txt5
-rw-r--r--test/prism/fixtures/seattlerb/parse_pattern_044.txt5
-rw-r--r--test/prism/fixtures/seattlerb/parse_pattern_051.txt5
-rw-r--r--test/prism/fixtures/seattlerb/parse_pattern_058.txt5
-rw-r--r--test/prism/fixtures/seattlerb/parse_pattern_058_2.txt5
-rw-r--r--test/prism/fixtures/seattlerb/parse_pattern_069.txt5
-rw-r--r--test/prism/fixtures/seattlerb/parse_pattern_076.txt5
-rw-r--r--test/prism/fixtures/seattlerb/parse_until_not_canonical.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_until_not_noncanonical.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_while_not_canonical.txt3
-rw-r--r--test/prism/fixtures/seattlerb/parse_while_not_noncanonical.txt3
-rw-r--r--test/prism/fixtures/seattlerb/pctW_lineno.txt5
-rw-r--r--test/prism/fixtures/seattlerb/pct_Q_backslash_nl.txt2
-rw-r--r--test/prism/fixtures/seattlerb/pct_nl.txt3
-rw-r--r--test/prism/fixtures/seattlerb/pct_w_heredoc_interp_nested.txt4
-rw-r--r--test/prism/fixtures/seattlerb/pipe_semicolon.txt1
-rw-r--r--test/prism/fixtures/seattlerb/pipe_space.txt1
-rw-r--r--test/prism/fixtures/seattlerb/qWords_space.txt1
-rw-r--r--test/prism/fixtures/seattlerb/qsymbols.txt1
-rw-r--r--test/prism/fixtures/seattlerb/qsymbols_empty.txt1
-rw-r--r--test/prism/fixtures/seattlerb/qsymbols_empty_space.txt1
-rw-r--r--test/prism/fixtures/seattlerb/qsymbols_interp.txt1
-rw-r--r--test/prism/fixtures/seattlerb/quoted_symbol_hash_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/quoted_symbol_keys.txt1
-rw-r--r--test/prism/fixtures/seattlerb/qw_escape.txt1
-rw-r--r--test/prism/fixtures/seattlerb/qw_escape_term.txt1
-rw-r--r--test/prism/fixtures/seattlerb/qwords_empty.txt1
-rw-r--r--test/prism/fixtures/seattlerb/read_escape_unicode_curlies.txt1
-rw-r--r--test/prism/fixtures/seattlerb/read_escape_unicode_h4.txt1
-rw-r--r--test/prism/fixtures/seattlerb/regexp.txt9
-rw-r--r--test/prism/fixtures/seattlerb/regexp_esc_C_slash.txt1
-rw-r--r--test/prism/fixtures/seattlerb/regexp_esc_u.txt1
-rw-r--r--test/prism/fixtures/seattlerb/regexp_escape_extended.txt1
-rw-r--r--test/prism/fixtures/seattlerb/regexp_unicode_curlies.txt3
-rw-r--r--test/prism/fixtures/seattlerb/required_kwarg_no_value.txt2
-rw-r--r--test/prism/fixtures/seattlerb/rescue_do_end_ensure_result.txt5
-rw-r--r--test/prism/fixtures/seattlerb/rescue_do_end_no_raise.txt9
-rw-r--r--test/prism/fixtures/seattlerb/rescue_do_end_raised.txt5
-rw-r--r--test/prism/fixtures/seattlerb/rescue_do_end_rescued.txt9
-rw-r--r--test/prism/fixtures/seattlerb/rescue_in_block.txt4
-rw-r--r--test/prism/fixtures/seattlerb/rescue_parens.txt1
-rw-r--r--test/prism/fixtures/seattlerb/return_call_assocs.txt11
-rw-r--r--test/prism/fixtures/seattlerb/rhs_asgn.txt1
-rw-r--r--test/prism/fixtures/seattlerb/ruby21_numbers.txt1
-rw-r--r--test/prism/fixtures/seattlerb/safe_attrasgn.txt1
-rw-r--r--test/prism/fixtures/seattlerb/safe_attrasgn_constant.txt1
-rw-r--r--test/prism/fixtures/seattlerb/safe_call.txt1
-rw-r--r--test/prism/fixtures/seattlerb/safe_call_after_newline.txt2
-rw-r--r--test/prism/fixtures/seattlerb/safe_call_dot_parens.txt1
-rw-r--r--test/prism/fixtures/seattlerb/safe_call_newline.txt2
-rw-r--r--test/prism/fixtures/seattlerb/safe_call_operator.txt1
-rw-r--r--test/prism/fixtures/seattlerb/safe_call_rhs_newline.txt2
-rw-r--r--test/prism/fixtures/seattlerb/safe_calls.txt1
-rw-r--r--test/prism/fixtures/seattlerb/safe_op_asgn.txt1
-rw-r--r--test/prism/fixtures/seattlerb/safe_op_asgn2.txt2
-rw-r--r--test/prism/fixtures/seattlerb/slashy_newlines_within_string.txt7
-rw-r--r--test/prism/fixtures/seattlerb/stabby_arg_no_paren.txt1
-rw-r--r--test/prism/fixtures/seattlerb/stabby_arg_opt_splat_arg_block_omfg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/stabby_block_iter_call.txt4
-rw-r--r--test/prism/fixtures/seattlerb/stabby_block_iter_call_no_target_with_arg.txt4
-rw-r--r--test/prism/fixtures/seattlerb/stabby_block_kw.txt1
-rw-r--r--test/prism/fixtures/seattlerb/stabby_block_kw__required.txt1
-rw-r--r--test/prism/fixtures/seattlerb/stabby_proc_scope.txt1
-rw-r--r--test/prism/fixtures/seattlerb/str_backslashes.txt1
-rw-r--r--test/prism/fixtures/seattlerb/str_double_double_escaped_newline.txt1
-rw-r--r--test/prism/fixtures/seattlerb/str_double_escaped_newline.txt1
-rw-r--r--test/prism/fixtures/seattlerb/str_double_newline.txt2
-rw-r--r--test/prism/fixtures/seattlerb/str_evstr.txt1
-rw-r--r--test/prism/fixtures/seattlerb/str_evstr_escape.txt1
-rw-r--r--test/prism/fixtures/seattlerb/str_heredoc_interp.txt5
-rw-r--r--test/prism/fixtures/seattlerb/str_interp_ternary_or_label.txt1
-rw-r--r--test/prism/fixtures/seattlerb/str_lit_concat_bad_encodings.txt2
-rw-r--r--test/prism/fixtures/seattlerb/str_newline_hash_line_number.txt2
-rw-r--r--test/prism/fixtures/seattlerb/str_pct_Q_nested.txt1
-rw-r--r--test/prism/fixtures/seattlerb/str_pct_nested_nested.txt1
-rw-r--r--test/prism/fixtures/seattlerb/str_pct_q.txt1
-rw-r--r--test/prism/fixtures/seattlerb/str_single_double_escaped_newline.txt1
-rw-r--r--test/prism/fixtures/seattlerb/str_single_escaped_newline.txt1
-rw-r--r--test/prism/fixtures/seattlerb/str_single_newline.txt2
-rw-r--r--test/prism/fixtures/seattlerb/str_str.txt1
-rw-r--r--test/prism/fixtures/seattlerb/str_str_str.txt1
-rw-r--r--test/prism/fixtures/seattlerb/super_arg.txt1
-rw-r--r--test/prism/fixtures/seattlerb/symbol_empty.txt1
-rw-r--r--test/prism/fixtures/seattlerb/symbol_list.txt1
-rw-r--r--test/prism/fixtures/seattlerb/symbols.txt1
-rw-r--r--test/prism/fixtures/seattlerb/symbols_empty.txt1
-rw-r--r--test/prism/fixtures/seattlerb/symbols_empty_space.txt1
-rw-r--r--test/prism/fixtures/seattlerb/symbols_interp.txt1
-rw-r--r--test/prism/fixtures/seattlerb/thingy.txt3
-rw-r--r--test/prism/fixtures/seattlerb/uminus_float.txt1
-rw-r--r--test/prism/fixtures/seattlerb/unary_minus.txt1
-rw-r--r--test/prism/fixtures/seattlerb/unary_plus.txt1
-rw-r--r--test/prism/fixtures/seattlerb/unary_plus_on_literal.txt1
-rw-r--r--test/prism/fixtures/seattlerb/unary_tilde.txt1
-rw-r--r--test/prism/fixtures/seattlerb/utf8_bom.txt3
-rw-r--r--test/prism/fixtures/seattlerb/when_splat.txt1
-rw-r--r--test/prism/fixtures/seattlerb/words_interp.txt1
-rw-r--r--test/prism/fixtures/single_method_call_with_bang.txt1
-rw-r--r--test/prism/fixtures/single_quote_heredocs.txt3
-rw-r--r--test/prism/fixtures/spanning_heredoc.txt63
-rw-r--r--test/prism/fixtures/spanning_heredoc_newlines.txt23
-rw-r--r--test/prism/fixtures/string_concatination_frozen_false.txt5
-rw-r--r--test/prism/fixtures/string_concatination_frozen_true.txt5
-rw-r--r--test/prism/fixtures/strings.txt185
-rw-r--r--test/prism/fixtures/super.txt17
-rw-r--r--test/prism/fixtures/symbols.txt104
-rw-r--r--test/prism/fixtures/ternary_operator.txt15
-rw-r--r--test/prism/fixtures/tilde_heredocs.txt97
-rw-r--r--test/prism/fixtures/unary_method_calls.txt8
-rw-r--r--test/prism/fixtures/undef.txt17
-rw-r--r--test/prism/fixtures/unescaping.txt9
-rw-r--r--test/prism/fixtures/unless.txt14
-rw-r--r--test/prism/fixtures/unparser/LICENSE20
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/alias.txt2
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/assignment.txt53
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/block.txt96
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/case.txt37
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/class.txt35
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/def.txt134
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/defined.txt3
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/defs.txt40
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/dstr.txt37
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/empty.txt (renamed from lib/rdoc/generator/template/darkfish/.document)0
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/empty_begin.txt1
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/flipflop.txt10
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/for.txt12
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/hookexe.txt7
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/if.txt36
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/kwbegin.txt80
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/lambda.txt13
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/literal.txt91
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/module.txt16
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/opasgn.txt24
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/pattern.txt41
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/pragma.txt4
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/range.txt4
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/rescue.txt3
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/send.txt84
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/since/27.txt4
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/since/30.txt4
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/since/31.txt7
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/since/32.txt11
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/singletons.txt4
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/super.txt21
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/unary.txt9
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/undef.txt2
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/variables.txt10
-rw-r--r--test/prism/fixtures/unparser/corpus/literal/while.txt73
-rw-r--r--test/prism/fixtures/unparser/corpus/semantic/and.txt8
-rw-r--r--test/prism/fixtures/unparser/corpus/semantic/block.txt26
-rw-r--r--test/prism/fixtures/unparser/corpus/semantic/def.txt7
-rw-r--r--test/prism/fixtures/unparser/corpus/semantic/dstr.txt127
-rw-r--r--test/prism/fixtures/unparser/corpus/semantic/kwbegin.txt42
-rw-r--r--test/prism/fixtures/unparser/corpus/semantic/literal.txt14
-rw-r--r--test/prism/fixtures/unparser/corpus/semantic/opasgn.txt1
-rw-r--r--test/prism/fixtures/unparser/corpus/semantic/send.txt6
-rw-r--r--test/prism/fixtures/unparser/corpus/semantic/undef.txt2
-rw-r--r--test/prism/fixtures/unparser/corpus/semantic/while.txt25
-rw-r--r--test/prism/fixtures/until.txt13
-rw-r--r--test/prism/fixtures/variables.txt49
-rw-r--r--test/prism/fixtures/while.txt23
-rw-r--r--test/prism/fixtures/whitequark/LICENSE26
-rw-r--r--test/prism/fixtures/whitequark/__ENCODING__.txt1
-rw-r--r--test/prism/fixtures/whitequark/__ENCODING___legacy_.txt1
-rw-r--r--test/prism/fixtures/whitequark/alias.txt1
-rw-r--r--test/prism/fixtures/whitequark/alias_gvar.txt3
-rw-r--r--test/prism/fixtures/whitequark/ambiuous_quoted_label_in_ternary_operator.txt1
-rw-r--r--test/prism/fixtures/whitequark/and.txt3
-rw-r--r--test/prism/fixtures/whitequark/and_asgn.txt3
-rw-r--r--test/prism/fixtures/whitequark/and_or_masgn.txt3
-rw-r--r--test/prism/fixtures/whitequark/anonymous_blockarg.txt1
-rw-r--r--test/prism/fixtures/whitequark/arg.txt3
-rw-r--r--test/prism/fixtures/whitequark/arg_combinations.txt29
-rw-r--r--test/prism/fixtures/whitequark/arg_duplicate_ignored.txt3
-rw-r--r--test/prism/fixtures/whitequark/arg_label.txt6
-rw-r--r--test/prism/fixtures/whitequark/arg_scope.txt1
-rw-r--r--test/prism/fixtures/whitequark/args.txt63
-rw-r--r--test/prism/fixtures/whitequark/args_args_assocs.txt3
-rw-r--r--test/prism/fixtures/whitequark/args_args_assocs_comma.txt1
-rw-r--r--test/prism/fixtures/whitequark/args_args_comma.txt1
-rw-r--r--test/prism/fixtures/whitequark/args_args_star.txt3
-rw-r--r--test/prism/fixtures/whitequark/args_assocs_comma.txt1
-rw-r--r--test/prism/fixtures/whitequark/args_block_pass.txt1
-rw-r--r--test/prism/fixtures/whitequark/args_cmd.txt1
-rw-r--r--test/prism/fixtures/whitequark/args_star.txt3
-rw-r--r--test/prism/fixtures/whitequark/array_assocs.txt3
-rw-r--r--test/prism/fixtures/whitequark/array_plain.txt1
-rw-r--r--test/prism/fixtures/whitequark/array_splat.txt5
-rw-r--r--test/prism/fixtures/whitequark/array_symbols.txt1
-rw-r--r--test/prism/fixtures/whitequark/array_symbols_empty.txt3
-rw-r--r--test/prism/fixtures/whitequark/array_symbols_interp.txt3
-rw-r--r--test/prism/fixtures/whitequark/array_words.txt1
-rw-r--r--test/prism/fixtures/whitequark/array_words_empty.txt3
-rw-r--r--test/prism/fixtures/whitequark/array_words_interp.txt3
-rw-r--r--test/prism/fixtures/whitequark/asgn_cmd.txt3
-rw-r--r--test/prism/fixtures/whitequark/asgn_mrhs.txt5
-rw-r--r--test/prism/fixtures/whitequark/back_ref.txt1
-rw-r--r--test/prism/fixtures/whitequark/bang.txt1
-rw-r--r--test/prism/fixtures/whitequark/bang_cmd.txt1
-rw-r--r--test/prism/fixtures/whitequark/begin_cmdarg.txt1
-rw-r--r--test/prism/fixtures/whitequark/beginless_erange_after_newline.txt2
-rw-r--r--test/prism/fixtures/whitequark/beginless_irange_after_newline.txt2
-rw-r--r--test/prism/fixtures/whitequark/beginless_range.txt3
-rw-r--r--test/prism/fixtures/whitequark/block_arg_combinations.txt57
-rw-r--r--test/prism/fixtures/whitequark/block_kwarg.txt1
-rw-r--r--test/prism/fixtures/whitequark/block_kwarg_combinations.txt5
-rw-r--r--test/prism/fixtures/whitequark/blockarg.txt1
-rw-r--r--test/prism/fixtures/whitequark/blockargs.txt71
-rw-r--r--test/prism/fixtures/whitequark/bug_435.txt1
-rw-r--r--test/prism/fixtures/whitequark/bug_447.txt3
-rw-r--r--test/prism/fixtures/whitequark/bug_452.txt1
-rw-r--r--test/prism/fixtures/whitequark/bug_466.txt1
-rw-r--r--test/prism/fixtures/whitequark/bug_473.txt1
-rw-r--r--test/prism/fixtures/whitequark/bug_480.txt1
-rw-r--r--test/prism/fixtures/whitequark/bug_481.txt1
-rw-r--r--test/prism/fixtures/whitequark/bug_ascii_8bit_in_literal.txt2
-rw-r--r--test/prism/fixtures/whitequark/bug_cmd_string_lookahead.txt1
-rw-r--r--test/prism/fixtures/whitequark/bug_cmdarg.txt5
-rw-r--r--test/prism/fixtures/whitequark/bug_def_no_paren_eql_begin.txt4
-rw-r--r--test/prism/fixtures/whitequark/bug_do_block_in_call_args.txt1
-rw-r--r--test/prism/fixtures/whitequark/bug_do_block_in_cmdarg.txt1
-rw-r--r--test/prism/fixtures/whitequark/bug_do_block_in_hash_brace.txt9
-rw-r--r--test/prism/fixtures/whitequark/bug_heredoc_do.txt3
-rw-r--r--test/prism/fixtures/whitequark/bug_interp_single.txt3
-rw-r--r--test/prism/fixtures/whitequark/bug_lambda_leakage.txt1
-rw-r--r--test/prism/fixtures/whitequark/bug_regex_verification.txt1
-rw-r--r--test/prism/fixtures/whitequark/bug_rescue_empty_else.txt1
-rw-r--r--test/prism/fixtures/whitequark/bug_while_not_parens_do.txt1
-rw-r--r--test/prism/fixtures/whitequark/case_cond.txt1
-rw-r--r--test/prism/fixtures/whitequark/case_cond_else.txt1
-rw-r--r--test/prism/fixtures/whitequark/case_expr.txt1
-rw-r--r--test/prism/fixtures/whitequark/case_expr_else.txt1
-rw-r--r--test/prism/fixtures/whitequark/casgn_scoped.txt1
-rw-r--r--test/prism/fixtures/whitequark/casgn_toplevel.txt1
-rw-r--r--test/prism/fixtures/whitequark/casgn_unscoped.txt1
-rw-r--r--test/prism/fixtures/whitequark/character.txt1
-rw-r--r--test/prism/fixtures/whitequark/class.txt3
-rw-r--r--test/prism/fixtures/whitequark/class_super.txt1
-rw-r--r--test/prism/fixtures/whitequark/class_super_label.txt1
-rw-r--r--test/prism/fixtures/whitequark/comments_before_leading_dot__27.txt19
-rw-r--r--test/prism/fixtures/whitequark/complex.txt7
-rw-r--r--test/prism/fixtures/whitequark/cond_begin.txt1
-rw-r--r--test/prism/fixtures/whitequark/cond_begin_masgn.txt1
-rw-r--r--test/prism/fixtures/whitequark/cond_eflipflop.txt3
-rw-r--r--test/prism/fixtures/whitequark/cond_eflipflop_with_beginless_range.txt1
-rw-r--r--test/prism/fixtures/whitequark/cond_eflipflop_with_endless_range.txt1
-rw-r--r--test/prism/fixtures/whitequark/cond_iflipflop.txt3
-rw-r--r--test/prism/fixtures/whitequark/cond_iflipflop_with_beginless_range.txt1
-rw-r--r--test/prism/fixtures/whitequark/cond_iflipflop_with_endless_range.txt1
-rw-r--r--test/prism/fixtures/whitequark/cond_match_current_line.txt3
-rw-r--r--test/prism/fixtures/whitequark/const_op_asgn.txt9
-rw-r--r--test/prism/fixtures/whitequark/const_scoped.txt1
-rw-r--r--test/prism/fixtures/whitequark/const_toplevel.txt1
-rw-r--r--test/prism/fixtures/whitequark/const_unscoped.txt1
-rw-r--r--test/prism/fixtures/whitequark/cpath.txt3
-rw-r--r--test/prism/fixtures/whitequark/cvar.txt1
-rw-r--r--test/prism/fixtures/whitequark/cvasgn.txt1
-rw-r--r--test/prism/fixtures/whitequark/dedenting_heredoc.txt75
-rw-r--r--test/prism/fixtures/whitequark/dedenting_interpolating_heredoc_fake_line_continuation.txt4
-rw-r--r--test/prism/fixtures/whitequark/dedenting_non_interpolating_heredoc_line_continuation.txt4
-rw-r--r--test/prism/fixtures/whitequark/def.txt11
-rw-r--r--test/prism/fixtures/whitequark/defined.txt5
-rw-r--r--test/prism/fixtures/whitequark/defs.txt9
-rw-r--r--test/prism/fixtures/whitequark/emit_arg_inside_procarg0_legacy.txt1
-rw-r--r--test/prism/fixtures/whitequark/empty_stmt.txt1
-rw-r--r--test/prism/fixtures/whitequark/endless_comparison_method.txt11
-rw-r--r--test/prism/fixtures/whitequark/endless_method.txt7
-rw-r--r--test/prism/fixtures/whitequark/endless_method_command_syntax.txt15
-rw-r--r--test/prism/fixtures/whitequark/endless_method_forwarded_args_legacy.txt1
-rw-r--r--test/prism/fixtures/whitequark/endless_method_with_rescue_mod.txt3
-rw-r--r--test/prism/fixtures/whitequark/endless_method_without_args.txt7
-rw-r--r--test/prism/fixtures/whitequark/ensure.txt1
-rw-r--r--test/prism/fixtures/whitequark/ensure_empty.txt1
-rw-r--r--test/prism/fixtures/whitequark/false.txt1
-rw-r--r--test/prism/fixtures/whitequark/find_pattern.txt7
-rw-r--r--test/prism/fixtures/whitequark/float.txt3
-rw-r--r--test/prism/fixtures/whitequark/for.txt3
-rw-r--r--test/prism/fixtures/whitequark/for_mlhs.txt1
-rw-r--r--test/prism/fixtures/whitequark/forward_arg.txt1
-rw-r--r--test/prism/fixtures/whitequark/forward_arg_with_open_args.txt27
-rw-r--r--test/prism/fixtures/whitequark/forward_args_legacy.txt5
-rw-r--r--test/prism/fixtures/whitequark/forwarded_argument_with_kwrestarg.txt1
-rw-r--r--test/prism/fixtures/whitequark/forwarded_argument_with_restarg.txt1
-rw-r--r--test/prism/fixtures/whitequark/forwarded_kwrestarg.txt1
-rw-r--r--test/prism/fixtures/whitequark/forwarded_kwrestarg_with_additional_kwarg.txt1
-rw-r--r--test/prism/fixtures/whitequark/forwarded_restarg.txt1
-rw-r--r--test/prism/fixtures/whitequark/gvar.txt1
-rw-r--r--test/prism/fixtures/whitequark/gvasgn.txt1
-rw-r--r--test/prism/fixtures/whitequark/hash_empty.txt1
-rw-r--r--test/prism/fixtures/whitequark/hash_hashrocket.txt3
-rw-r--r--test/prism/fixtures/whitequark/hash_kwsplat.txt1
-rw-r--r--test/prism/fixtures/whitequark/hash_label.txt1
-rw-r--r--test/prism/fixtures/whitequark/hash_label_end.txt5
-rw-r--r--test/prism/fixtures/whitequark/hash_pair_value_omission.txt5
-rw-r--r--test/prism/fixtures/whitequark/heredoc.txt14
-rw-r--r--test/prism/fixtures/whitequark/if.txt3
-rw-r--r--test/prism/fixtures/whitequark/if_else.txt3
-rw-r--r--test/prism/fixtures/whitequark/if_elsif.txt1
-rw-r--r--test/prism/fixtures/whitequark/if_masgn__24.txt1
-rw-r--r--test/prism/fixtures/whitequark/if_mod.txt1
-rw-r--r--test/prism/fixtures/whitequark/if_nl_then.txt2
-rw-r--r--test/prism/fixtures/whitequark/int.txt5
-rw-r--r--test/prism/fixtures/whitequark/int___LINE__.txt1
-rw-r--r--test/prism/fixtures/whitequark/interp_digit_var.txt87
-rw-r--r--test/prism/fixtures/whitequark/ivar.txt1
-rw-r--r--test/prism/fixtures/whitequark/ivasgn.txt1
-rw-r--r--test/prism/fixtures/whitequark/keyword_argument_omission.txt1
-rw-r--r--test/prism/fixtures/whitequark/kwarg.txt1
-rw-r--r--test/prism/fixtures/whitequark/kwarg_combinations.txt7
-rw-r--r--test/prism/fixtures/whitequark/kwarg_no_paren.txt5
-rw-r--r--test/prism/fixtures/whitequark/kwbegin_compstmt.txt1
-rw-r--r--test/prism/fixtures/whitequark/kwnilarg.txt5
-rw-r--r--test/prism/fixtures/whitequark/kwoptarg.txt1
-rw-r--r--test/prism/fixtures/whitequark/kwoptarg_with_kwrestarg_and_forwarded_args.txt1
-rw-r--r--test/prism/fixtures/whitequark/kwrestarg_named.txt1
-rw-r--r--test/prism/fixtures/whitequark/kwrestarg_unnamed.txt1
-rw-r--r--test/prism/fixtures/whitequark/lbrace_arg_after_command_args.txt1
-rw-r--r--test/prism/fixtures/whitequark/lparenarg_after_lvar__since_25.txt3
-rw-r--r--test/prism/fixtures/whitequark/lvar.txt1
-rw-r--r--test/prism/fixtures/whitequark/lvar_injecting_match.txt3
-rw-r--r--test/prism/fixtures/whitequark/lvasgn.txt1
-rw-r--r--test/prism/fixtures/whitequark/marg_combinations.txt19
-rw-r--r--test/prism/fixtures/whitequark/masgn.txt5
-rw-r--r--test/prism/fixtures/whitequark/masgn_attr.txt5
-rw-r--r--test/prism/fixtures/whitequark/masgn_cmd.txt1
-rw-r--r--test/prism/fixtures/whitequark/masgn_const.txt3
-rw-r--r--test/prism/fixtures/whitequark/masgn_nested.txt3
-rw-r--r--test/prism/fixtures/whitequark/masgn_splat.txt19
-rw-r--r--test/prism/fixtures/whitequark/method_definition_in_while_cond.txt7
-rw-r--r--test/prism/fixtures/whitequark/module.txt1
-rw-r--r--test/prism/fixtures/whitequark/multiple_args_with_trailing_comma.txt1
-rw-r--r--test/prism/fixtures/whitequark/multiple_pattern_matches.txt5
-rw-r--r--test/prism/fixtures/whitequark/newline_in_hash_argument.txt14
-rw-r--r--test/prism/fixtures/whitequark/nil.txt1
-rw-r--r--test/prism/fixtures/whitequark/nil_expression.txt3
-rw-r--r--test/prism/fixtures/whitequark/non_lvar_injecting_match.txt1
-rw-r--r--test/prism/fixtures/whitequark/not.txt5
-rw-r--r--test/prism/fixtures/whitequark/not_cmd.txt1
-rw-r--r--test/prism/fixtures/whitequark/not_masgn__24.txt1
-rw-r--r--test/prism/fixtures/whitequark/nth_ref.txt1
-rw-r--r--test/prism/fixtures/whitequark/numbered_args_after_27.txt7
-rw-r--r--test/prism/fixtures/whitequark/numparam_outside_block.txt9
-rw-r--r--test/prism/fixtures/whitequark/numparam_ruby_bug_19025.txt1
-rw-r--r--test/prism/fixtures/whitequark/op_asgn.txt5
-rw-r--r--test/prism/fixtures/whitequark/op_asgn_cmd.txt7
-rw-r--r--test/prism/fixtures/whitequark/op_asgn_index.txt1
-rw-r--r--test/prism/fixtures/whitequark/op_asgn_index_cmd.txt1
-rw-r--r--test/prism/fixtures/whitequark/optarg.txt3
-rw-r--r--test/prism/fixtures/whitequark/or.txt3
-rw-r--r--test/prism/fixtures/whitequark/or_asgn.txt3
-rw-r--r--test/prism/fixtures/whitequark/parser_bug_272.txt1
-rw-r--r--test/prism/fixtures/whitequark/parser_bug_490.txt5
-rw-r--r--test/prism/fixtures/whitequark/parser_bug_507.txt1
-rw-r--r--test/prism/fixtures/whitequark/parser_bug_518.txt2
-rw-r--r--test/prism/fixtures/whitequark/parser_bug_525.txt1
-rw-r--r--test/prism/fixtures/whitequark/parser_bug_604.txt1
-rw-r--r--test/prism/fixtures/whitequark/parser_bug_640.txt4
-rw-r--r--test/prism/fixtures/whitequark/parser_bug_645.txt1
-rw-r--r--test/prism/fixtures/whitequark/parser_bug_830.txt1
-rw-r--r--test/prism/fixtures/whitequark/parser_bug_989.txt3
-rw-r--r--test/prism/fixtures/whitequark/parser_drops_truncated_parts_of_squiggly_heredoc.txt3
-rw-r--r--test/prism/fixtures/whitequark/parser_slash_slash_n_escaping_in_literals.txt62
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching__FILE__LINE_literals.txt4
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_blank_else.txt1
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_const_pattern.txt11
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_constants.txt5
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_else.txt1
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_explicit_array_match.txt19
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_expr_in_paren.txt1
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_hash.txt48
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_if_unless_modifiers.txt3
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_implicit_array_match.txt15
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_keyword_variable.txt1
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_lambda.txt1
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_match_alt.txt1
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_match_as.txt1
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_nil_pattern.txt1
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_no_body.txt1
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_ranges.txt11
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_single_line.txt3
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_single_line_allowed_omission_of_parentheses.txt11
-rw-r--r--test/prism/fixtures/whitequark/pattern_matching_single_match.txt1
-rw-r--r--test/prism/fixtures/whitequark/pin_expr.txt14
-rw-r--r--test/prism/fixtures/whitequark/postexe.txt1
-rw-r--r--test/prism/fixtures/whitequark/preexe.txt1
-rw-r--r--test/prism/fixtures/whitequark/procarg0.txt3
-rw-r--r--test/prism/fixtures/whitequark/procarg0_legacy.txt1
-rw-r--r--test/prism/fixtures/whitequark/range_exclusive.txt1
-rw-r--r--test/prism/fixtures/whitequark/range_inclusive.txt1
-rw-r--r--test/prism/fixtures/whitequark/rational.txt3
-rw-r--r--test/prism/fixtures/whitequark/regex_interp.txt1
-rw-r--r--test/prism/fixtures/whitequark/regex_plain.txt1
-rw-r--r--test/prism/fixtures/whitequark/resbody_list.txt1
-rw-r--r--test/prism/fixtures/whitequark/resbody_list_mrhs.txt1
-rw-r--r--test/prism/fixtures/whitequark/resbody_list_var.txt1
-rw-r--r--test/prism/fixtures/whitequark/resbody_var.txt3
-rw-r--r--test/prism/fixtures/whitequark/rescue.txt1
-rw-r--r--test/prism/fixtures/whitequark/rescue_else.txt1
-rw-r--r--test/prism/fixtures/whitequark/rescue_else_ensure.txt1
-rw-r--r--test/prism/fixtures/whitequark/rescue_ensure.txt1
-rw-r--r--test/prism/fixtures/whitequark/rescue_in_lambda_block.txt1
-rw-r--r--test/prism/fixtures/whitequark/rescue_mod.txt1
-rw-r--r--test/prism/fixtures/whitequark/rescue_mod_asgn.txt1
-rw-r--r--test/prism/fixtures/whitequark/rescue_mod_masgn.txt1
-rw-r--r--test/prism/fixtures/whitequark/rescue_mod_op_assign.txt1
-rw-r--r--test/prism/fixtures/whitequark/rescue_without_begin_end.txt1
-rw-r--r--test/prism/fixtures/whitequark/restarg_named.txt1
-rw-r--r--test/prism/fixtures/whitequark/restarg_unnamed.txt1
-rw-r--r--test/prism/fixtures/whitequark/return.txt7
-rw-r--r--test/prism/fixtures/whitequark/return_block.txt1
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_10279.txt1
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_10653.txt5
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_11107.txt1
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_11380.txt1
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_11873.txt23
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_11873_a.txt39
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_11873_b.txt1
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_11989.txt3
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_11990.txt3
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_12073.txt3
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_12402.txt27
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_12669.txt7
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_12686.txt1
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_13547.txt1
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_14690.txt1
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_15789.txt3
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_18878.txt1
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_19281.txt7
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_19539.txt9
-rw-r--r--test/prism/fixtures/whitequark/ruby_bug_9669.txt8
-rw-r--r--test/prism/fixtures/whitequark/sclass.txt1
-rw-r--r--test/prism/fixtures/whitequark/self.txt1
-rw-r--r--test/prism/fixtures/whitequark/send_attr_asgn.txt7
-rw-r--r--test/prism/fixtures/whitequark/send_attr_asgn_conditional.txt1
-rw-r--r--test/prism/fixtures/whitequark/send_binary_op.txt41
-rw-r--r--test/prism/fixtures/whitequark/send_block_chain_cmd.txt13
-rw-r--r--test/prism/fixtures/whitequark/send_block_conditional.txt1
-rw-r--r--test/prism/fixtures/whitequark/send_call.txt3
-rw-r--r--test/prism/fixtures/whitequark/send_conditional.txt1
-rw-r--r--test/prism/fixtures/whitequark/send_index.txt1
-rw-r--r--test/prism/fixtures/whitequark/send_index_asgn.txt1
-rw-r--r--test/prism/fixtures/whitequark/send_index_asgn_legacy.txt1
-rw-r--r--test/prism/fixtures/whitequark/send_index_cmd.txt1
-rw-r--r--test/prism/fixtures/whitequark/send_index_legacy.txt1
-rw-r--r--test/prism/fixtures/whitequark/send_lambda.txt5
-rw-r--r--test/prism/fixtures/whitequark/send_lambda_args.txt3
-rw-r--r--test/prism/fixtures/whitequark/send_lambda_args_noparen.txt3
-rw-r--r--test/prism/fixtures/whitequark/send_lambda_args_shadow.txt1
-rw-r--r--test/prism/fixtures/whitequark/send_lambda_legacy.txt1
-rw-r--r--test/prism/fixtures/whitequark/send_op_asgn_conditional.txt1
-rw-r--r--test/prism/fixtures/whitequark/send_plain.txt5
-rw-r--r--test/prism/fixtures/whitequark/send_plain_cmd.txt5
-rw-r--r--test/prism/fixtures/whitequark/send_self.txt5
-rw-r--r--test/prism/fixtures/whitequark/send_self_block.txt7
-rw-r--r--test/prism/fixtures/whitequark/send_unary_op.txt5
-rw-r--r--test/prism/fixtures/whitequark/slash_newline_in_heredocs.txt13
-rw-r--r--test/prism/fixtures/whitequark/space_args_arg.txt1
-rw-r--r--test/prism/fixtures/whitequark/space_args_arg_block.txt5
-rw-r--r--test/prism/fixtures/whitequark/space_args_arg_call.txt1
-rw-r--r--test/prism/fixtures/whitequark/space_args_arg_newline.txt2
-rw-r--r--test/prism/fixtures/whitequark/space_args_block.txt1
-rw-r--r--test/prism/fixtures/whitequark/space_args_cmd.txt1
-rw-r--r--test/prism/fixtures/whitequark/string___FILE__.txt1
-rw-r--r--test/prism/fixtures/whitequark/string_concat.txt1
-rw-r--r--test/prism/fixtures/whitequark/string_dvar.txt1
-rw-r--r--test/prism/fixtures/whitequark/string_interp.txt1
-rw-r--r--test/prism/fixtures/whitequark/string_plain.txt3
-rw-r--r--test/prism/fixtures/whitequark/super.txt5
-rw-r--r--test/prism/fixtures/whitequark/super_block.txt3
-rw-r--r--test/prism/fixtures/whitequark/symbol_interp.txt1
-rw-r--r--test/prism/fixtures/whitequark/symbol_plain.txt3
-rw-r--r--test/prism/fixtures/whitequark/ternary.txt1
-rw-r--r--test/prism/fixtures/whitequark/ternary_ambiguous_symbol.txt1
-rw-r--r--test/prism/fixtures/whitequark/trailing_forward_arg.txt1
-rw-r--r--test/prism/fixtures/whitequark/true.txt1
-rw-r--r--test/prism/fixtures/whitequark/unary_num_pow_precedence.txt5
-rw-r--r--test/prism/fixtures/whitequark/undef.txt1
-rw-r--r--test/prism/fixtures/whitequark/unless.txt3
-rw-r--r--test/prism/fixtures/whitequark/unless_else.txt3
-rw-r--r--test/prism/fixtures/whitequark/unless_mod.txt1
-rw-r--r--test/prism/fixtures/whitequark/until.txt3
-rw-r--r--test/prism/fixtures/whitequark/until_mod.txt1
-rw-r--r--test/prism/fixtures/whitequark/until_post.txt1
-rw-r--r--test/prism/fixtures/whitequark/var_and_asgn.txt1
-rw-r--r--test/prism/fixtures/whitequark/var_op_asgn.txt7
-rw-r--r--test/prism/fixtures/whitequark/var_op_asgn_cmd.txt1
-rw-r--r--test/prism/fixtures/whitequark/var_or_asgn.txt1
-rw-r--r--test/prism/fixtures/whitequark/when_multi.txt1
-rw-r--r--test/prism/fixtures/whitequark/when_splat.txt1
-rw-r--r--test/prism/fixtures/whitequark/when_then.txt1
-rw-r--r--test/prism/fixtures/whitequark/while.txt3
-rw-r--r--test/prism/fixtures/whitequark/while_mod.txt1
-rw-r--r--test/prism/fixtures/whitequark/while_post.txt1
-rw-r--r--test/prism/fixtures/whitequark/xstring_interp.txt1
-rw-r--r--test/prism/fixtures/whitequark/xstring_plain.txt1
-rw-r--r--test/prism/fixtures/whitequark/zsuper.txt1
-rw-r--r--test/prism/fixtures/write_command_operator.txt3
-rw-r--r--test/prism/fixtures/xstring.txt21
-rw-r--r--test/prism/fixtures/xstring_with_backslash.txt1
-rw-r--r--test/prism/fixtures/yield.txt7
-rw-r--r--test/prism/fixtures_test.rb38
-rw-r--r--test/prism/fuzzer_test.rb67
-rw-r--r--test/prism/heredoc_dedent_test.rb134
-rw-r--r--test/prism/lex_test.rb123
-rw-r--r--test/prism/library_symbols_test.rb104
-rw-r--r--test/prism/locals_test.rb245
-rw-r--r--test/prism/magic_comment_test.rb122
-rw-r--r--test/prism/newline_offsets_test.rb45
-rw-r--r--test/prism/newline_test.rb101
-rw-r--r--test/prism/onigmo_test.rb66
-rw-r--r--test/prism/percent_delimiter_string_test.rb82
-rw-r--r--test/prism/ractor_test.rb74
-rw-r--r--test/prism/regexp_test.rb265
-rw-r--r--test/prism/result/attribute_write_test.rb56
-rw-r--r--test/prism/result/breadth_first_search_test.rb29
-rw-r--r--test/prism/result/comments_test.rb138
-rw-r--r--test/prism/result/constant_path_node_test.rb91
-rw-r--r--test/prism/result/continuable_test.rb124
-rw-r--r--test/prism/result/equality_test.rb22
-rw-r--r--test/prism/result/error_recovery_test.rb237
-rw-r--r--test/prism/result/heredoc_test.rb19
-rw-r--r--test/prism/result/implicit_array_test.rb59
-rw-r--r--test/prism/result/index_write_test.rb89
-rw-r--r--test/prism/result/integer_base_flags_test.rb33
-rw-r--r--test/prism/result/integer_parse_test.rb41
-rw-r--r--test/prism/result/named_capture_test.rb29
-rw-r--r--test/prism/result/node_id_test.rb27
-rw-r--r--test/prism/result/numeric_value_test.rb32
-rw-r--r--test/prism/result/overlap_test.rb48
-rw-r--r--test/prism/result/regular_expression_options_test.rb25
-rw-r--r--test/prism/result/source_location_test.rb954
-rw-r--r--test/prism/result/static_inspect_test.rb89
-rw-r--r--test/prism/result/static_literals_test.rb92
-rw-r--r--test/prism/result/string_test.rb32
-rw-r--r--test/prism/result/warnings_test.rb451
-rw-r--r--test/prism/ruby/compiler_test.rb31
-rw-r--r--test/prism/ruby/desugar_compiler_test.rb80
-rw-r--r--test/prism/ruby/dispatcher_test.rb55
-rw-r--r--test/prism/ruby/find_fixtures.rb69
-rw-r--r--test/prism/ruby/find_test.rb242
-rw-r--r--test/prism/ruby/location_test.rb254
-rw-r--r--test/prism/ruby/parameters_signature_test.rb105
-rw-r--r--test/prism/ruby/parser_test.rb323
-rw-r--r--test/prism/ruby/pattern_test.rb132
-rw-r--r--test/prism/ruby/reflection_test.rb22
-rw-r--r--test/prism/ruby/relocation_test.rb192
-rw-r--r--test/prism/ruby/ripper_test.rb309
-rw-r--r--test/prism/ruby/ruby_parser_test.rb140
-rw-r--r--test/prism/ruby/source_test.rb51
-rw-r--r--test/prism/ruby/string_query_test.rb60
-rw-r--r--test/prism/ruby/tunnel_test.rb26
-rw-r--r--test/prism/snippets_test.rb43
-rw-r--r--test/prism/test_helper.rb386
-rw-r--r--test/prism/unescape_test.rb245
-rw-r--r--test/prism/version_test.rb11
-rw-r--r--test/psych/helper.rb41
-rw-r--r--test/psych/test_alias_and_anchor.rb12
-rw-r--r--test/psych/test_array.rb22
-rw-r--r--test/psych/test_class.rb4
-rw-r--r--test/psych/test_coder.rb141
-rw-r--r--test/psych/test_data.rb93
-rw-r--r--test/psych/test_date_time.rb40
-rw-r--r--test/psych/test_deprecated.rb4
-rw-r--r--test/psych/test_document.rb2
-rw-r--r--test/psych/test_emitter.rb10
-rw-r--r--test/psych/test_encoding.rb15
-rw-r--r--test/psych/test_exception.rb57
-rw-r--r--test/psych/test_hash.rb80
-rw-r--r--test/psych/test_marshalable.rb12
-rw-r--r--test/psych/test_merge_keys.rb24
-rw-r--r--test/psych/test_numeric.rb21
-rw-r--r--test/psych/test_object.rb15
-rw-r--r--test/psych/test_object_references.rb25
-rw-r--r--test/psych/test_omap.rb4
-rw-r--r--test/psych/test_parser.rb89
-rw-r--r--test/psych/test_psych.rb146
-rw-r--r--test/psych/test_psych_set.rb57
-rw-r--r--test/psych/test_ractor.rb10
-rw-r--r--test/psych/test_safe_load.rb107
-rw-r--r--test/psych/test_scalar_scanner.rb93
-rw-r--r--test/psych/test_serialize_subclasses.rb22
-rw-r--r--test/psych/test_set.rb54
-rw-r--r--test/psych/test_stream.rb8
-rw-r--r--test/psych/test_string.rb37
-rw-r--r--test/psych/test_stringio.rb14
-rw-r--r--test/psych/test_struct.rb6
-rw-r--r--test/psych/test_yaml.rb966
-rw-r--r--test/psych/test_yaml_special_cases.rb18
-rw-r--r--test/psych/test_yamlstore.rb63
-rw-r--r--test/psych/visitors/test_emitter.rb16
-rw-r--r--test/psych/visitors/test_to_ruby.rb12
-rw-r--r--test/psych/visitors/test_yaml_tree.rb42
-rw-r--r--test/racc/assets/cadenza.y170
-rw-r--r--test/racc/assets/cast.y926
-rw-r--r--test/racc/assets/chk.y126
-rw-r--r--test/racc/assets/conf.y16
-rw-r--r--test/racc/assets/csspool.y729
-rw-r--r--test/racc/assets/digraph.y29
-rw-r--r--test/racc/assets/echk.y118
-rw-r--r--test/racc/assets/edtf.y583
-rw-r--r--test/racc/assets/err.y60
-rw-r--r--test/racc/assets/error_recovery.y35
-rw-r--r--test/racc/assets/expect.y7
-rw-r--r--test/racc/assets/firstline.y4
-rw-r--r--test/racc/assets/huia.y318
-rw-r--r--test/racc/assets/ichk.y102
-rw-r--r--test/racc/assets/ifelse.y14
-rw-r--r--test/racc/assets/intp.y546
-rw-r--r--test/racc/assets/journey.y47
-rw-r--r--test/racc/assets/liquor.y313
-rw-r--r--test/racc/assets/machete.y423
-rw-r--r--test/racc/assets/macruby.y2197
-rw-r--r--test/racc/assets/mailp.y437
-rw-r--r--test/racc/assets/mediacloth.y599
-rw-r--r--test/racc/assets/mof.y649
-rw-r--r--test/racc/assets/namae.y302
-rw-r--r--test/racc/assets/nasl.y626
-rw-r--r--test/racc/assets/newsyn.y25
-rw-r--r--test/racc/assets/noend.y4
-rw-r--r--test/racc/assets/nokogiri-css.y255
-rw-r--r--test/racc/assets/nonass.y41
-rw-r--r--test/racc/assets/normal.y27
-rw-r--r--test/racc/assets/norule.y4
-rw-r--r--test/racc/assets/nullbug1.y25
-rw-r--r--test/racc/assets/nullbug2.y15
-rw-r--r--test/racc/assets/opal.y1807
-rw-r--r--test/racc/assets/opt.y123
-rw-r--r--test/racc/assets/percent.y35
-rw-r--r--test/racc/assets/php_serialization.y98
-rw-r--r--test/racc/assets/recv.y97
-rw-r--r--test/racc/assets/riml.y665
-rw-r--r--test/racc/assets/rrconf.y14
-rw-r--r--test/racc/assets/ruby18.y1943
-rw-r--r--test/racc/assets/ruby19.y2174
-rw-r--r--test/racc/assets/ruby20.y2350
-rw-r--r--test/racc/assets/ruby21.y2359
-rw-r--r--test/racc/assets/ruby22.y2381
-rw-r--r--test/racc/assets/scan.y72
-rw-r--r--test/racc/assets/syntax.y50
-rw-r--r--test/racc/assets/tp_plus.y622
-rw-r--r--test/racc/assets/twowaysql.y278
-rw-r--r--test/racc/assets/unterm.y5
-rw-r--r--test/racc/assets/useless.y12
-rw-r--r--test/racc/assets/yyerr.y46
-rw-r--r--test/racc/bench.y36
-rw-r--r--test/racc/helper.rb115
-rw-r--r--test/racc/infini.y8
-rw-r--r--test/racc/regress/README.txt7
-rw-r--r--test/racc/regress/cadenza796
-rw-r--r--test/racc/regress/cast3428
-rw-r--r--test/racc/regress/csspool2314
-rw-r--r--test/racc/regress/edtf1794
-rw-r--r--test/racc/regress/huia1392
-rw-r--r--test/racc/regress/journey222
-rw-r--r--test/racc/regress/liquor885
-rw-r--r--test/racc/regress/machete833
-rw-r--r--test/racc/regress/mediacloth1463
-rw-r--r--test/racc/regress/mof1368
-rw-r--r--test/racc/regress/namae634
-rw-r--r--test/racc/regress/nasl2058
-rw-r--r--test/racc/regress/nokogiri-css836
-rw-r--r--test/racc/regress/opal6431
-rw-r--r--test/racc/regress/php_serialization336
-rw-r--r--test/racc/regress/riml3283
-rw-r--r--test/racc/regress/ruby186344
-rw-r--r--test/racc/regress/ruby227460
-rw-r--r--test/racc/regress/tp_plus1933
-rw-r--r--test/racc/regress/twowaysql556
-rw-r--r--test/racc/scandata/brace7
-rw-r--r--test/racc/scandata/gvar1
-rw-r--r--test/racc/scandata/normal4
-rw-r--r--test/racc/scandata/percent18
-rw-r--r--test/racc/scandata/slash10
-rw-r--r--test/racc/src.intp34
-rw-r--r--test/racc/start.y20
-rw-r--r--test/racc/test_chk_y.rb52
-rw-r--r--test/racc/test_grammar_file_parser.rb15
-rw-r--r--test/racc/test_racc_command.rb339
-rw-r--r--test/racc/test_scan_y.rb52
-rw-r--r--test/racc/testscanner.rb51
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Amps and angle encoding.text21
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Auto links.text13
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Backslash escapes.text120
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Blockquotes with code blocks.text11
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Code Blocks.text14
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Code Spans.text6
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Hard-wrapped paragraphs with list-like lines.text8
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Horizontal rules.text67
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML (Advanced).text15
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML (Simple).text69
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML comments.text13
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, inline style.text12
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, reference style.text71
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, shortcut references.text20
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Literal quotes in titles.text7
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Basics.text306
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Syntax.text888
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Nested blockquotes.text5
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Ordered and unordered lists.text131
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Strong and em together.text7
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Tabs.text21
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Tidyness.text5
-rw-r--r--test/rdoc/README1
-rw-r--r--test/rdoc/binary.datbin1024 -> 0 bytes-rw-r--r--test/rdoc/helper.rb5
-rw-r--r--test/rdoc/hidden.zip.txt1
-rw-r--r--test/rdoc/support/formatter_test_case.rb764
-rw-r--r--test/rdoc/support/test_case.rb228
-rw-r--r--test/rdoc/support/text_formatter_test_case.rb115
-rw-r--r--test/rdoc/test.ja.largedoc3
-rw-r--r--test/rdoc/test.ja.rdoc10
-rw-r--r--test/rdoc/test.ja.txt8
-rw-r--r--test/rdoc/test.txt1
-rw-r--r--test/rdoc/test_rdoc_alias.rb14
-rw-r--r--test/rdoc/test_rdoc_any_method.rb509
-rw-r--r--test/rdoc/test_rdoc_attr.rb190
-rw-r--r--test/rdoc/test_rdoc_class_module.rb1504
-rw-r--r--test/rdoc/test_rdoc_code_object.rb440
-rw-r--r--test/rdoc/test_rdoc_comment.rb497
-rw-r--r--test/rdoc/test_rdoc_constant.rb182
-rw-r--r--test/rdoc/test_rdoc_context.rb965
-rw-r--r--test/rdoc/test_rdoc_context_section.rb147
-rw-r--r--test/rdoc/test_rdoc_cross_reference.rb207
-rw-r--r--test/rdoc/test_rdoc_encoding.rb184
-rw-r--r--test/rdoc/test_rdoc_extend.rb95
-rw-r--r--test/rdoc/test_rdoc_generator_darkfish.rb246
-rw-r--r--test/rdoc/test_rdoc_generator_json_index.rb349
-rw-r--r--test/rdoc/test_rdoc_generator_markup.rb60
-rw-r--r--test/rdoc/test_rdoc_generator_pot.rb92
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po.rb52
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po_entry.rb140
-rw-r--r--test/rdoc/test_rdoc_generator_ri.rb76
-rw-r--r--test/rdoc/test_rdoc_i18n_locale.rb74
-rw-r--r--test/rdoc/test_rdoc_i18n_text.rb124
-rw-r--r--test/rdoc/test_rdoc_include.rb109
-rw-r--r--test/rdoc/test_rdoc_markdown.rb1020
-rw-r--r--test/rdoc/test_rdoc_markdown_test.rb1883
-rw-r--r--test/rdoc/test_rdoc_markup.rb96
-rw-r--r--test/rdoc/test_rdoc_markup_attribute_manager.rb375
-rw-r--r--test/rdoc/test_rdoc_markup_attributes.rb40
-rw-r--r--test/rdoc/test_rdoc_markup_document.rb208
-rw-r--r--test/rdoc/test_rdoc_markup_formatter.rb175
-rw-r--r--test/rdoc/test_rdoc_markup_hard_break.rb32
-rw-r--r--test/rdoc/test_rdoc_markup_heading.rb30
-rw-r--r--test/rdoc/test_rdoc_markup_include.rb20
-rw-r--r--test/rdoc/test_rdoc_markup_indented_paragraph.rb54
-rw-r--r--test/rdoc/test_rdoc_markup_paragraph.rb33
-rw-r--r--test/rdoc/test_rdoc_markup_parser.rb1684
-rw-r--r--test/rdoc/test_rdoc_markup_pre_process.rb467
-rw-r--r--test/rdoc/test_rdoc_markup_raw.rb23
-rw-r--r--test/rdoc/test_rdoc_markup_to_ansi.rb370
-rw-r--r--test/rdoc/test_rdoc_markup_to_bs.rb352
-rw-r--r--test/rdoc/test_rdoc_markup_to_html.rb809
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_crossref.rb263
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_snippet.rb709
-rw-r--r--test/rdoc/test_rdoc_markup_to_joined_paragraph.rb33
-rw-r--r--test/rdoc/test_rdoc_markup_to_label.rb113
-rw-r--r--test/rdoc/test_rdoc_markup_to_markdown.rb390
-rw-r--r--test/rdoc/test_rdoc_markup_to_rdoc.rb378
-rw-r--r--test/rdoc/test_rdoc_markup_to_table_of_contents.rb127
-rw-r--r--test/rdoc/test_rdoc_markup_to_tt_only.rb247
-rw-r--r--test/rdoc/test_rdoc_markup_verbatim.rb30
-rw-r--r--test/rdoc/test_rdoc_method_attr.rb194
-rw-r--r--test/rdoc/test_rdoc_normal_class.rb48
-rw-r--r--test/rdoc/test_rdoc_normal_module.rb43
-rw-r--r--test/rdoc/test_rdoc_options.rb780
-rw-r--r--test/rdoc/test_rdoc_parser.rb323
-rw-r--r--test/rdoc/test_rdoc_parser_c.rb1945
-rw-r--r--test/rdoc/test_rdoc_parser_changelog.rb318
-rw-r--r--test/rdoc/test_rdoc_parser_markdown.rb62
-rw-r--r--test/rdoc/test_rdoc_parser_rd.rb56
-rw-r--r--test/rdoc/test_rdoc_parser_ruby.rb4300
-rw-r--r--test/rdoc/test_rdoc_parser_simple.rb116
-rw-r--r--test/rdoc/test_rdoc_rd.rb31
-rw-r--r--test/rdoc/test_rdoc_rd_block_parser.rb536
-rw-r--r--test/rdoc/test_rdoc_rd_inline.rb64
-rw-r--r--test/rdoc/test_rdoc_rd_inline_parser.rb178
-rw-r--r--test/rdoc/test_rdoc_rdoc.rb572
-rw-r--r--test/rdoc/test_rdoc_require.rb26
-rw-r--r--test/rdoc/test_rdoc_ri_driver.rb1556
-rw-r--r--test/rdoc/test_rdoc_ri_paths.rb158
-rw-r--r--test/rdoc/test_rdoc_rubygems_hook.rb256
-rw-r--r--test/rdoc/test_rdoc_servlet.rb551
-rw-r--r--test/rdoc/test_rdoc_single_class.rb21
-rw-r--r--test/rdoc/test_rdoc_stats.rb723
-rw-r--r--test/rdoc/test_rdoc_store.rb1011
-rw-r--r--test/rdoc/test_rdoc_task.rb174
-rw-r--r--test/rdoc/test_rdoc_text.rb575
-rw-r--r--test/rdoc/test_rdoc_token_stream.rb58
-rw-r--r--test/rdoc/test_rdoc_tom_doc.rb579
-rw-r--r--test/rdoc/test_rdoc_top_level.rb288
-rw-r--r--test/rdoc/xref_data.rb135
-rw-r--r--test/rdoc/xref_test_case.rb86
-rw-r--r--test/readline/helper.rb24
-rw-r--r--test/readline/test_readline.rb816
-rw-r--r--test/readline/test_readline_history.rb287
-rw-r--r--test/reline/helper.rb99
-rw-r--r--test/reline/test_config.rb325
-rw-r--r--test/reline/test_history.rb301
-rw-r--r--test/reline/test_key_actor_emacs.rb2260
-rw-r--r--test/reline/test_key_actor_vi.rb1437
-rw-r--r--test/reline/test_key_stroke.rb49
-rw-r--r--test/reline/test_kill_ring.rb268
-rw-r--r--test/reline/test_macro.rb39
-rw-r--r--test/reline/test_reline.rb315
-rw-r--r--test/reline/test_string_processing.rb23
-rw-r--r--test/reline/test_unicode.rb16
-rw-r--r--test/reline/test_within_pipe.rb62
-rw-r--r--test/reline/yamatanooroti/test_rendering.rb632
-rw-r--r--test/resolv/test_addr.rb4
-rw-r--r--test/resolv/test_dns.rb528
-rw-r--r--test/resolv/test_resource.rb144
-rw-r--r--test/resolv/test_svcb_https.rb231
-rw-r--r--test/resolv/test_win32_config.rb26
-rw-r--r--test/rinda/test_rinda.rb894
-rw-r--r--test/rinda/test_tuplebag.rb173
-rw-r--r--test/ripper/assert_parse_files.rb26
-rw-r--r--test/ripper/dummyparser.rb53
-rw-r--r--test/ripper/test_lexer.rb440
-rw-r--r--test/ripper/test_parser_events.rb224
-rw-r--r--test/ripper/test_ripper.rb75
-rw-r--r--test/ripper/test_scanner_events.rb76
-rw-r--r--test/ripper/test_sexp.rb76
-rw-r--r--test/ruby/box/a.1_1_0.rb17
-rw-r--r--test/ruby/box/a.1_2_0.rb17
-rw-r--r--test/ruby/box/a.rb15
-rw-r--r--test/ruby/box/autoloading.rb8
-rw-r--r--test/ruby/box/blank.rb2
-rw-r--r--test/ruby/box/blank1.rb2
-rw-r--r--test/ruby/box/blank2.rb2
-rw-r--r--test/ruby/box/box.rb10
-rw-r--r--test/ruby/box/call_proc.rb5
-rw-r--r--test/ruby/box/call_toplevel.rb8
-rw-r--r--test/ruby/box/consts.rb148
-rw-r--r--test/ruby/box/define_toplevel.rb5
-rw-r--r--test/ruby/box/global_vars.rb37
-rw-r--r--test/ruby/box/instance_variables.rb21
-rw-r--r--test/ruby/box/line_splitter.rb9
-rw-r--r--test/ruby/box/load_path.rb26
-rw-r--r--test/ruby/box/open_class_with_include.rb31
-rw-r--r--test/ruby/box/proc_callee.rb14
-rw-r--r--test/ruby/box/proc_caller.rb5
-rw-r--r--test/ruby/box/procs.rb64
-rw-r--r--test/ruby/box/raise.rb3
-rw-r--r--test/ruby/box/returns_proc.rb12
-rw-r--r--test/ruby/box/singleton_methods.rb65
-rw-r--r--test/ruby/box/string_ext.rb13
-rw-r--r--test/ruby/box/string_ext_caller.rb5
-rw-r--r--test/ruby/box/string_ext_calling.rb1
-rw-r--r--test/ruby/box/string_ext_eval_caller.rb12
-rw-r--r--test/ruby/box/top_level.rb33
-rw-r--r--test/ruby/enc/test_case_comprehensive.rb65
-rw-r--r--test/ruby/enc/test_case_mapping.rb10
-rw-r--r--test/ruby/enc/test_case_options.rb12
-rw-r--r--test/ruby/enc/test_cesu8.rb4
-rw-r--r--test/ruby/enc/test_emoji_breaks.rb205
-rw-r--r--test/ruby/enc/test_grapheme_breaks.rb117
-rw-r--r--test/ruby/enc/test_regex_casefold.rb4
-rw-r--r--test/ruby/marshaltestlib.rb2
-rw-r--r--test/ruby/sentence.rb2
-rw-r--r--test/ruby/test_alias.rb88
-rw-r--r--test/ruby/test_allocation.rb957
-rw-r--r--test/ruby/test_argf.rb195
-rw-r--r--test/ruby/test_arity.rb43
-rw-r--r--test/ruby/test_array.rb489
-rw-r--r--test/ruby/test_assignment.rb176
-rw-r--r--test/ruby/test_ast.rb1416
-rw-r--r--test/ruby/test_autoload.rb252
-rw-r--r--test/ruby/test_backtrace.rb161
-rw-r--r--test/ruby/test_beginendblock.rb17
-rw-r--r--test/ruby/test_bignum.rb115
-rw-r--r--test/ruby/test_box.rb1219
-rw-r--r--test/ruby/test_call.rb1384
-rw-r--r--test/ruby/test_case.rb21
-rw-r--r--test/ruby/test_class.rb279
-rw-r--r--test/ruby/test_clone.rb53
-rw-r--r--test/ruby/test_comparable.rb10
-rw-r--r--test/ruby/test_compile_prism.rb2761
-rw-r--r--test/ruby/test_complex.rb218
-rw-r--r--test/ruby/test_complex2.rb2
-rw-r--r--test/ruby/test_complexrational.rb4
-rw-r--r--test/ruby/test_continuation.rb4
-rw-r--r--test/ruby/test_data.rb308
-rw-r--r--test/ruby/test_default_gems.rb21
-rw-r--r--test/ruby/test_defined.rb208
-rw-r--r--test/ruby/test_dir.rb249
-rw-r--r--test/ruby/test_dir_m17n.rb46
-rw-r--r--test/ruby/test_dup.rb110
-rw-r--r--test/ruby/test_econv.rb4
-rw-r--r--test/ruby/test_encoding.rb89
-rw-r--r--test/ruby/test_enum.rb98
-rw-r--r--test/ruby/test_enumerator.rb204
-rw-r--r--test/ruby/test_env.rb988
-rw-r--r--test/ruby/test_eval.rb123
-rw-r--r--test/ruby/test_exception.rb419
-rw-r--r--test/ruby/test_fiber.rb94
-rw-r--r--test/ruby/test_file.rb382
-rw-r--r--test/ruby/test_file_exhaustive.rb232
-rw-r--r--test/ruby/test_float.rb128
-rw-r--r--test/ruby/test_frozen.rb46
-rw-r--r--test/ruby/test_gc.rb635
-rw-r--r--test/ruby/test_gc_compact.rb433
-rw-r--r--test/ruby/test_hash.rb1088
-rw-r--r--test/ruby/test_inlinecache.rb2
-rw-r--r--test/ruby/test_insns_leaf.rb46
-rw-r--r--test/ruby/test_integer.rb186
-rw-r--r--test/ruby/test_integer_comb.rb23
-rw-r--r--test/ruby/test_io.rb653
-rw-r--r--test/ruby/test_io_buffer.rb1068
-rw-r--r--test/ruby/test_io_m17n.rb119
-rw-r--r--test/ruby/test_io_timeout.rb58
-rw-r--r--test/ruby/test_iseq.rb500
-rw-r--r--test/ruby/test_iterator.rb16
-rw-r--r--test/ruby/test_jit.rb1232
-rw-r--r--test/ruby/test_jit_debug.rb17
-rw-r--r--test/ruby/test_keyword.rb510
-rw-r--r--test/ruby/test_lambda.rb113
-rw-r--r--test/ruby/test_lazy_enumerator.rb54
-rw-r--r--test/ruby/test_literal.rb119
-rw-r--r--test/ruby/test_m17n.rb278
-rw-r--r--test/ruby/test_m17n_comb.rb15
-rw-r--r--test/ruby/test_marshal.rb275
-rw-r--r--test/ruby/test_math.rb94
-rw-r--r--test/ruby/test_memory_view.rb2
-rw-r--r--test/ruby/test_metaclass.rb2
-rw-r--r--test/ruby/test_method.rb612
-rw-r--r--test/ruby/test_method_cache.rb11
-rw-r--r--test/ruby/test_mixed_unicode_escapes.rb2
-rw-r--r--test/ruby/test_module.rb678
-rw-r--r--test/ruby/test_name_error.rb2
-rw-r--r--test/ruby/test_nomethod_error.rb50
-rw-r--r--test/ruby/test_numeric.rb58
-rw-r--r--test/ruby/test_object.rb255
-rw-r--r--test/ruby/test_object_id.rb303
-rw-r--r--test/ruby/test_objectspace.rb113
-rw-r--r--test/ruby/test_optimization.rb446
-rw-r--r--test/ruby/test_pack.rb340
-rw-r--r--test/ruby/test_parse.rb677
-rw-r--r--test/ruby/test_pattern_matching.rb328
-rw-r--r--test/ruby/test_proc.rb589
-rw-r--r--test/ruby/test_process.rb612
-rw-r--r--test/ruby/test_ractor.rb377
-rw-r--r--test/ruby/test_rand.rb19
-rw-r--r--test/ruby/test_random_formatter.rb183
-rw-r--r--test/ruby/test_range.rb756
-rw-r--r--test/ruby/test_rational.rb66
-rw-r--r--test/ruby/test_refinement.rb1412
-rw-r--r--test/ruby/test_regexp.rb1122
-rw-r--r--test/ruby/test_require.rb257
-rw-r--r--test/ruby/test_require_lib.rb32
-rw-r--r--test/ruby/test_rubyoptions.rb522
-rw-r--r--test/ruby/test_rubyvm.rb59
-rw-r--r--test/ruby/test_rubyvm_mjit.rb91
-rw-r--r--test/ruby/test_set.rb1072
-rw-r--r--test/ruby/test_settracefunc.rb1097
-rw-r--r--test/ruby/test_shapes.rb1323
-rw-r--r--test/ruby/test_signal.rb82
-rw-r--r--test/ruby/test_sleep.rb35
-rw-r--r--test/ruby/test_sprintf.rb53
-rw-r--r--test/ruby/test_stack.rb1
-rw-r--r--test/ruby/test_string.rb1779
-rw-r--r--test/ruby/test_string_memory.rb65
-rw-r--r--test/ruby/test_struct.rb100
-rw-r--r--test/ruby/test_super.rb128
-rw-r--r--test/ruby/test_symbol.rb29
-rw-r--r--test/ruby/test_syntax.rb917
-rw-r--r--test/ruby/test_system.rb13
-rw-r--r--test/ruby/test_thread.rb336
-rw-r--r--test/ruby/test_thread_cv.rb73
-rw-r--r--test/ruby/test_thread_queue.rb207
-rw-r--r--test/ruby/test_time.rb288
-rw-r--r--test/ruby/test_time_tz.rb43
-rw-r--r--test/ruby/test_transcode.rb644
-rw-r--r--test/ruby/test_undef.rb16
-rw-r--r--test/ruby/test_variable.rb348
-rw-r--r--test/ruby/test_vm_dump.rb14
-rw-r--r--test/ruby/test_warning.rb32
-rw-r--r--test/ruby/test_weakkeymap.rb159
-rw-r--r--test/ruby/test_weakmap.rb139
-rw-r--r--test/ruby/test_whileuntil.rb18
-rw-r--r--test/ruby/test_yield.rb2
-rw-r--r--test/ruby/test_yjit.rb2085
-rw-r--r--test/ruby/test_yjit_exit_locations.rb96
-rw-r--r--test/ruby/test_zjit.rb556
-rw-r--r--test/rubygems/alternate_cert.pem28
-rw-r--r--test/rubygems/alternate_cert_32.pem30
-rw-r--r--test/rubygems/alternate_key.pem50
-rw-r--r--test/rubygems/bad_rake.rb1
-rw-r--r--test/rubygems/bogussources.rb9
-rw-r--r--test/rubygems/bundler_test_gem.rb424
-rw-r--r--test/rubygems/child_cert.pem31
-rw-r--r--test/rubygems/child_cert_32.pem31
-rw-r--r--test/rubygems/child_key.pem50
-rw-r--r--test/rubygems/coverage_setup.rb9
-rw-r--r--test/rubygems/data/excon-0.7.7.gemspec.rzbin0 -> 388 bytes-rw-r--r--test/rubygems/data/null-required-ruby-version.gemspec.rzbin0 -> 403 bytes-rw-r--r--test/rubygems/data/null-type.gemspec.rzbin554 -> 0 bytes-rw-r--r--test/rubygems/data/pry-0.4.7.gemspec.rzbin0 -> 433 bytes-rw-r--r--test/rubygems/encrypted_private_key.pem52
-rw-r--r--test/rubygems/expired_cert.pem30
-rw-r--r--test/rubygems/fake_certlib/openssl.rb1
-rw-r--r--test/rubygems/future_cert.pem30
-rw-r--r--test/rubygems/future_cert_32.pem30
-rw-r--r--test/rubygems/good_rake.rb1
-rw-r--r--test/rubygems/grandchild_cert.pem31
-rw-r--r--test/rubygems/grandchild_cert_32.pem31
-rw-r--r--test/rubygems/grandchild_key.pem50
-rw-r--r--test/rubygems/helper.rb1690
-rw-r--r--test/rubygems/installer_test_case.rb240
-rw-r--r--test/rubygems/invalid_issuer_cert.pem32
-rw-r--r--test/rubygems/invalid_issuer_cert_32.pem32
-rw-r--r--test/rubygems/invalid_key.pem50
-rw-r--r--test/rubygems/invalid_signer_cert.pem30
-rw-r--r--test/rubygems/invalid_signer_cert_32.pem30
-rw-r--r--test/rubygems/invalidchild_cert.pem31
-rw-r--r--test/rubygems/invalidchild_cert_32.pem31
-rw-r--r--test/rubygems/invalidchild_key.pem50
-rw-r--r--test/rubygems/mock_gem_ui.rb86
-rw-r--r--test/rubygems/multifactor_auth_utilities.rb111
-rw-r--r--test/rubygems/package/tar_test_case.rb179
-rw-r--r--test/rubygems/packages/Bluebie-legs-0.6.2.gembin0 -> 14336 bytes-rw-r--r--test/rubygems/packages/ascii_binder-0.1.10.1.gembin0 -> 244736 bytes-rw-r--r--test/rubygems/packages/ill-formatted-platform-1.0.0.10.gembin0 -> 10240 bytes-rw-r--r--test/rubygems/plugin/exception/rubygems_plugin.rb3
-rw-r--r--test/rubygems/plugin/load/rubygems_plugin.rb1
-rw-r--r--test/rubygems/plugin/scripterror/rubygems_plugin.rb4
-rw-r--r--test/rubygems/plugin/standarderror/rubygems_plugin.rb3
-rw-r--r--test/rubygems/private_ec_key.pem9
-rw-r--r--test/rubygems/private_key.pem50
-rw-r--r--test/rubygems/public_cert.pem32
-rw-r--r--test/rubygems/public_cert_32.pem30
-rw-r--r--test/rubygems/public_key.pem14
-rw-r--r--test/rubygems/rubygems/commands/crash_command.rb1
-rw-r--r--test/rubygems/rubygems/commands/ins_command.rb7
-rw-r--r--test/rubygems/rubygems/commands/interrupt_command.rb11
-rw-r--r--test/rubygems/rubygems_plugin.rb20
-rw-r--r--test/rubygems/simple_gem.rb3
-rw-r--r--test/rubygems/specifications/bar-0.0.2.gemspec2
-rw-r--r--test/rubygems/specifications/rubyforge-0.0.1.gemspec23
-rw-r--r--test/rubygems/test_bundled_ca.rb35
-rw-r--r--test/rubygems/test_config.rb18
-rw-r--r--test/rubygems/test_deprecate.rb71
-rw-r--r--test/rubygems/test_exit.rb17
-rw-r--r--test/rubygems/test_gem.rb1544
-rw-r--r--test/rubygems/test_gem_available_set.rb49
-rw-r--r--test/rubygems/test_gem_bundler_version_finder.rb240
-rw-r--r--test/rubygems/test_gem_ci_detector.rb32
-rw-r--r--test/rubygems/test_gem_command.rb126
-rw-r--r--test/rubygems/test_gem_command_manager.rb252
-rw-r--r--test/rubygems/test_gem_commands_build_command.rb150
-rw-r--r--test/rubygems/test_gem_commands_cert_command.rb371
-rw-r--r--test/rubygems/test_gem_commands_check_command.rb19
-rw-r--r--test/rubygems/test_gem_commands_cleanup_command.rb149
-rw-r--r--test/rubygems/test_gem_commands_contents_command.rb77
-rw-r--r--test/rubygems/test_gem_commands_dependency_command.rb77
-rw-r--r--test/rubygems/test_gem_commands_environment_command.rb102
-rw-r--r--test/rubygems/test_gem_commands_exec_command.rb888
-rw-r--r--test/rubygems/test_gem_commands_fetch_command.rb222
-rw-r--r--test/rubygems/test_gem_commands_generate_index_command.rb80
-rw-r--r--test/rubygems/test_gem_commands_help_command.rb34
-rw-r--r--test/rubygems/test_gem_commands_info_command.rb80
-rw-r--r--test/rubygems/test_gem_commands_install_command.rb728
-rw-r--r--test/rubygems/test_gem_commands_list_command.rb40
-rw-r--r--test/rubygems/test_gem_commands_lock_command.rb23
-rw-r--r--test/rubygems/test_gem_commands_mirror.rb7
-rw-r--r--test/rubygems/test_gem_commands_open_command.rb39
-rw-r--r--test/rubygems/test_gem_commands_outdated_command.rb31
-rw-r--r--test/rubygems/test_gem_commands_owner_command.rb403
-rw-r--r--test/rubygems/test_gem_commands_pristine_command.rb342
-rw-r--r--test/rubygems/test_gem_commands_push_command.rb459
-rw-r--r--test/rubygems/test_gem_commands_query_command.rb857
-rw-r--r--test/rubygems/test_gem_commands_rebuild_command.rb154
-rw-r--r--test/rubygems/test_gem_commands_search_command.rb5
-rw-r--r--test/rubygems/test_gem_commands_server_command.rb55
-rw-r--r--test/rubygems/test_gem_commands_setup_command.rb361
-rw-r--r--test/rubygems/test_gem_commands_signin_command.rb261
-rw-r--r--test/rubygems/test_gem_commands_signout_command.rb12
-rw-r--r--test/rubygems/test_gem_commands_sources_command.rb789
-rw-r--r--test/rubygems/test_gem_commands_specification_command.rb107
-rw-r--r--test/rubygems/test_gem_commands_stale_command.rb13
-rw-r--r--test/rubygems/test_gem_commands_uninstall_command.rb277
-rw-r--r--test/rubygems/test_gem_commands_unpack_command.rb71
-rw-r--r--test/rubygems/test_gem_commands_update_command.rb413
-rw-r--r--test/rubygems/test_gem_commands_which_command.rb33
-rw-r--r--test/rubygems/test_gem_commands_yank_command.rb222
-rw-r--r--test/rubygems/test_gem_config_file.rb404
-rw-r--r--test/rubygems/test_gem_console_ui.rb19
-rw-r--r--test/rubygems/test_gem_dependency.rb192
-rw-r--r--test/rubygems/test_gem_dependency_installer.rb763
-rw-r--r--test/rubygems/test_gem_dependency_list.rb107
-rw-r--r--test/rubygems/test_gem_dependency_resolution_error.rb28
-rw-r--r--test/rubygems/test_gem_doctor.rb97
-rw-r--r--test/rubygems/test_gem_ext_builder.rb372
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder.rb229
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/.gitignore1
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/custom_name.gemspec10
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/ext/custom_name_lib/Cargo.lock250
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/ext/custom_name_lib/Cargo.toml10
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/ext/custom_name_lib/src/lib.rs27
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/lib/custom_name.rb3
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/.gitignore1
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/Cargo.lock250
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/Cargo.toml10
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/rust_ruby_example.gemspec10
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/src/lib.rs51
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder_link_flag_converter.rb34
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder_unit.rb60
-rw-r--r--test/rubygems/test_gem_ext_cmake_builder.rb126
-rw-r--r--test/rubygems/test_gem_ext_configure_builder.rb37
-rw-r--r--test/rubygems/test_gem_ext_ext_conf_builder.rb142
-rw-r--r--test/rubygems/test_gem_ext_rake_builder.rb57
-rw-r--r--test/rubygems/test_gem_gem_runner.rb41
-rw-r--r--test/rubygems/test_gem_gemcutter_utilities.rb313
-rw-r--r--test/rubygems/test_gem_impossible_dependencies_error.rb59
-rw-r--r--test/rubygems/test_gem_indexer.rb357
-rw-r--r--test/rubygems/test_gem_install_update_options.rb70
-rw-r--r--test/rubygems/test_gem_installer.rb1609
-rw-r--r--test/rubygems/test_gem_local_remote_options.rb25
-rw-r--r--test/rubygems/test_gem_name_tuple.rb75
-rw-r--r--test/rubygems/test_gem_package.rb917
-rw-r--r--test/rubygems/test_gem_package_old.rb41
-rw-r--r--test/rubygems/test_gem_package_tar_header.rb147
-rw-r--r--test/rubygems/test_gem_package_tar_header_ractor.rb61
-rw-r--r--test/rubygems/test_gem_package_tar_reader.rb81
-rw-r--r--test/rubygems/test_gem_package_tar_reader_entry.rb254
-rw-r--r--test/rubygems/test_gem_package_tar_writer.rb240
-rw-r--r--test/rubygems/test_gem_package_task.rb41
-rw-r--r--test/rubygems/test_gem_path_support.rb41
-rw-r--r--test/rubygems/test_gem_platform.rb774
-rw-r--r--test/rubygems/test_gem_rdoc.rb51
-rw-r--r--test/rubygems/test_gem_remote_fetcher.rb1033
-rw-r--r--test/rubygems/test_gem_remote_fetcher_local_server.rb220
-rw-r--r--test/rubygems/test_gem_remote_fetcher_local_ssl_server.rb195
-rw-r--r--test/rubygems/test_gem_remote_fetcher_s3.rb437
-rw-r--r--test/rubygems/test_gem_request.rb259
-rw-r--r--test/rubygems/test_gem_request_connection_pools.rb77
-rw-r--r--test/rubygems/test_gem_request_set.rb390
-rw-r--r--test/rubygems/test_gem_request_set_gem_dependency_api.rb505
-rw-r--r--test/rubygems/test_gem_request_set_lockfile.rb179
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_parser.rb543
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_tokenizer.rb306
-rw-r--r--test/rubygems/test_gem_requirement.rb189
-rw-r--r--test/rubygems/test_gem_resolver.rb814
-rw-r--r--test/rubygems/test_gem_resolver_activation_request.rb21
-rw-r--r--test/rubygems/test_gem_resolver_api_set.rb133
-rw-r--r--test/rubygems/test_gem_resolver_api_specification.rb115
-rw-r--r--test/rubygems/test_gem_resolver_best_set.rb131
-rw-r--r--test/rubygems/test_gem_resolver_composed_set.rb3
-rw-r--r--test/rubygems/test_gem_resolver_conflict.rb81
-rw-r--r--test/rubygems/test_gem_resolver_dependency_request.rb55
-rw-r--r--test/rubygems/test_gem_resolver_git_set.rb45
-rw-r--r--test/rubygems/test_gem_resolver_git_specification.rb83
-rw-r--r--test/rubygems/test_gem_resolver_index_set.rb51
-rw-r--r--test/rubygems/test_gem_resolver_index_specification.rb36
-rw-r--r--test/rubygems/test_gem_resolver_installed_specification.rb11
-rw-r--r--test/rubygems/test_gem_resolver_installer_set.rb147
-rw-r--r--test/rubygems/test_gem_resolver_local_specification.rb15
-rw-r--r--test/rubygems/test_gem_resolver_lock_set.rb31
-rw-r--r--test/rubygems/test_gem_resolver_lock_specification.rb37
-rw-r--r--test/rubygems/test_gem_resolver_requirement_list.rb3
-rw-r--r--test/rubygems/test_gem_resolver_specification.rb19
-rw-r--r--test/rubygems/test_gem_resolver_strategy.rb163
-rw-r--r--test/rubygems/test_gem_resolver_vendor_set.rb17
-rw-r--r--test/rubygems/test_gem_resolver_vendor_specification.rb22
-rw-r--r--test/rubygems/test_gem_safe_marshal.rb518
-rw-r--r--test/rubygems/test_gem_safe_yaml.rb1326
-rw-r--r--test/rubygems/test_gem_security.rb205
-rw-r--r--test/rubygems/test_gem_security_policy.rb232
-rw-r--r--test/rubygems/test_gem_security_signer.rb97
-rw-r--r--test/rubygems/test_gem_security_trust_dir.rb35
-rw-r--r--test/rubygems/test_gem_server.rb608
-rw-r--r--test/rubygems/test_gem_silent_ui.rb88
-rw-r--r--test/rubygems/test_gem_source.rb118
-rw-r--r--test/rubygems/test_gem_source_fetch_problem.rb25
-rw-r--r--test/rubygems/test_gem_source_git.rb154
-rw-r--r--test/rubygems/test_gem_source_installed.rb38
-rw-r--r--test/rubygems/test_gem_source_list.rb138
-rw-r--r--test/rubygems/test_gem_source_local.rb60
-rw-r--r--test/rubygems/test_gem_source_lock.rb67
-rw-r--r--test/rubygems/test_gem_source_specific_file.rb41
-rw-r--r--test/rubygems/test_gem_source_subpath_problem.rb19
-rw-r--r--test/rubygems/test_gem_source_vendor.rb27
-rw-r--r--test/rubygems/test_gem_spec_fetcher.rb191
-rw-r--r--test/rubygems/test_gem_specification.rb2574
-rw-r--r--test/rubygems/test_gem_stream_ui.rb91
-rw-r--r--test/rubygems/test_gem_stub_specification.rb206
-rw-r--r--test/rubygems/test_gem_text.rb3
-rw-r--r--test/rubygems/test_gem_uninstaller.rb441
-rw-r--r--test/rubygems/test_gem_unsatisfiable_dependency_error.rb7
-rw-r--r--test/rubygems/test_gem_update_suggestion.rb209
-rw-r--r--test/rubygems/test_gem_uri.rb41
-rw-r--r--test/rubygems/test_gem_uri_formatter.rb29
-rw-r--r--test/rubygems/test_gem_util.rb74
-rw-r--r--test/rubygems/test_gem_util_atomic_file_writer.rb12
-rw-r--r--test/rubygems/test_gem_validator.rb18
-rw-r--r--test/rubygems/test_gem_version.rb131
-rw-r--r--test/rubygems/test_gem_version_option.rb67
-rw-r--r--test/rubygems/test_kernel.rb121
-rw-r--r--test/rubygems/test_project_sanity.rb45
-rw-r--r--test/rubygems/test_remote_fetch_error.rb17
-rw-r--r--test/rubygems/test_require.rb482
-rw-r--r--test/rubygems/test_rubygems.rb77
-rw-r--r--test/rubygems/test_webauthn_listener.rb143
-rw-r--r--test/rubygems/test_webauthn_listener_response.rb93
-rw-r--r--test/rubygems/test_webauthn_poller.rb134
-rw-r--r--test/rubygems/utilities.rb452
-rw-r--r--test/rubygems/wrong_key_cert.pem30
-rw-r--r--test/rubygems/wrong_key_cert_32.pem30
-rw-r--r--test/runner.rb8
-rw-r--r--test/socket/test_addrinfo.rb25
-rw-r--r--test/socket/test_basicsocket.rb4
-rw-r--r--test/socket/test_nonblock.rb16
-rw-r--r--test/socket/test_socket.rb462
-rw-r--r--test/socket/test_sockopt.rb2
-rw-r--r--test/socket/test_tcp.rb319
-rw-r--r--test/socket/test_udp.rb2
-rw-r--r--test/socket/test_unix.rb236
-rw-r--r--test/stringio/test_ractor.rb8
-rw-r--r--test/stringio/test_stringio.rb401
-rw-r--r--test/strscan/test_ractor.rb8
-rw-r--r--test/strscan/test_stringscanner.rb1003
-rw-r--r--test/syslog/test_syslog_logger.rb588
-rw-r--r--test/test_abbrev.rb55
-rw-r--r--test/test_bundled_gems.rb73
-rw-r--r--test/test_delegate.rb66
-rw-r--r--test/test_extlibs.rb13
-rw-r--r--test/test_find.rb16
-rw-r--r--test/test_forwardable.rb2
-rw-r--r--test/test_ipaddr.rb285
-rw-r--r--test/test_mutex_m.rb58
-rw-r--r--test/test_observer.rb66
-rw-r--r--test/test_open3.rb5
-rw-r--r--test/test_pp.rb165
-rw-r--r--test/test_prettyprint.rb71
-rw-r--r--test/test_prime.rb299
-rw-r--r--test/test_pstore.rb150
-rw-r--r--test/test_pty.rb38
-rw-r--r--test/test_rbconfig.rb22
-rw-r--r--test/test_securerandom.rb129
-rw-r--r--test/test_set.rb837
-rw-r--r--test/test_shellwords.rb9
-rw-r--r--test/test_singleton.rb21
-rw-r--r--test/test_sorted_set.rb45
-rw-r--r--test/test_syslog.rb193
-rw-r--r--test/test_tempfile.rb118
-rw-r--r--test/test_time.rb18
-rw-r--r--test/test_timeout.rb443
-rw-r--r--test/test_tmpdir.rb73
-rw-r--r--test/test_tracer.rb234
-rw-r--r--test/test_trick.rb114
-rw-r--r--test/test_tsort.rb115
-rw-r--r--test/test_unicode_normalize.rb30
-rw-r--r--test/uri/test_common.rb172
-rw-r--r--test/uri/test_ftp.rb20
-rw-r--r--test/uri/test_generic.rb123
-rw-r--r--test/uri/test_http.rb55
-rw-r--r--test/uri/test_ldap.rb14
-rw-r--r--test/uri/test_mailto.rb72
-rw-r--r--test/uri/test_parser.rb87
-rw-r--r--test/uri/test_ws.rb24
-rw-r--r--test/uri/test_wss.rb65
-rw-r--r--test/win32ole/available_ole.rb41
-rw-r--r--test/win32ole/err_in_callback.rb10
-rw-r--r--test/win32ole/orig_data.csv5
-rw-r--r--test/win32ole/test_err_in_callback.rb56
-rw-r--r--test/win32ole/test_folderitem2_invokeverb.rb66
-rw-r--r--test/win32ole/test_nil2vtempty.rb37
-rw-r--r--test/win32ole/test_ole_methods.rb35
-rw-r--r--test/win32ole/test_propertyputref.rb31
-rw-r--r--test/win32ole/test_thread.rb34
-rw-r--r--test/win32ole/test_win32ole.rb534
-rw-r--r--test/win32ole/test_win32ole_event.rb406
-rw-r--r--test/win32ole/test_win32ole_method.rb134
-rw-r--r--test/win32ole/test_win32ole_method_event.rb36
-rw-r--r--test/win32ole/test_win32ole_param.rb98
-rw-r--r--test/win32ole/test_win32ole_param_event.rb30
-rw-r--r--test/win32ole/test_win32ole_record.rb209
-rw-r--r--test/win32ole/test_win32ole_type.rb200
-rw-r--r--test/win32ole/test_win32ole_type_event.rb44
-rw-r--r--test/win32ole/test_win32ole_typelib.rb117
-rw-r--r--test/win32ole/test_win32ole_variable.rb62
-rw-r--r--test/win32ole/test_win32ole_variant.rb722
-rw-r--r--test/win32ole/test_win32ole_variant_m.rb36
-rw-r--r--test/win32ole/test_win32ole_variant_outarg.rb69
-rw-r--r--test/win32ole/test_word.rb73
-rw-r--r--test/yaml/test_dbm.rb46
-rw-r--r--test/yaml/test_store.rb14
-rw-r--r--test/zlib/test_zlib.rb308
-rw-r--r--thread.c3440
-rw-r--r--thread_none.c344
-rw-r--r--thread_none.h21
-rw-r--r--thread_pthread.c3880
-rw-r--r--thread_pthread.h187
-rw-r--r--thread_pthread_mn.c1125
-rw-r--r--thread_sync.c1878
-rw-r--r--thread_sync.rb715
-rw-r--r--thread_win32.c635
-rw-r--r--thread_win32.h25
-rw-r--r--time.c3175
-rw-r--r--timev.h11
-rw-r--r--timev.rb512
-rw-r--r--tool/annocheck/Dockerfile4
-rw-r--r--tool/annocheck/Dockerfile-copy6
-rwxr-xr-xtool/auto-style.rb284
-rwxr-xr-xtool/auto_review_pr.rb172
-rw-r--r--tool/bundler/dev_gems.rb21
-rw-r--r--tool/bundler/dev_gems.rb.lock144
-rw-r--r--tool/bundler/rubocop_gems.rb13
-rw-r--r--tool/bundler/rubocop_gems.rb.lock160
-rw-r--r--tool/bundler/standard_gems.rb13
-rw-r--r--tool/bundler/standard_gems.rb.lock180
-rw-r--r--tool/bundler/test_gems.rb20
-rw-r--r--tool/bundler/test_gems.rb.lock116
-rw-r--r--tool/bundler/vendor_gems.rb17
-rw-r--r--tool/bundler/vendor_gems.rb.lock75
-rwxr-xr-xtool/checksum.rb4
-rwxr-xr-xtool/commit-email.rb372
-rwxr-xr-xtool/darwin-ar6
-rwxr-xr-xtool/darwin-cc3
-rwxr-xr-xtool/disable_ipv6.sh9
-rw-r--r--tool/downloader.rb277
-rw-r--r--tool/dump_ast.c77
-rwxr-xr-xtool/dump_ast.mkmf.rb37
-rwxr-xr-xtool/enc-case-folding.rb416
-rw-r--r--tool/enc-emoji-citrus-gen.rb4
-rwxr-xr-xtool/enc-unicode.rb160
-rwxr-xr-xtool/expand-config.rb14
-rwxr-xr-xtool/extlibs.rb180
-rw-r--r--tool/fake.rb15
-rwxr-xr-xtool/fetch-bundled_gems.rb43
-rwxr-xr-xtool/file2lastrev.rb90
-rwxr-xr-xtool/format-release78
-rw-r--r--tool/gem-unpack.rb19
-rwxr-xr-xtool/gen-github-release.rb66
-rwxr-xr-xtool/gen-mailmap.rb4
-rw-r--r--tool/generic_erb.rb52
-rw-r--r--tool/gperf.sed18
-rwxr-xr-xtool/id2token.rb11
-rwxr-xr-xtool/ifchange10
-rwxr-xr-xtool/intern_ids.rb35
-rwxr-xr-xtool/leaked-globals69
-rw-r--r--tool/lib/-test-/integer.rb4
-rw-r--r--tool/lib/_tmpdir.rb105
-rw-r--r--tool/lib/bundle_env.rb4
-rw-r--r--tool/lib/bundled_gem.rb175
-rw-r--r--tool/lib/colorize.rb89
-rw-r--r--tool/lib/core_assertions.rb1034
-rw-r--r--tool/lib/dump.gdb17
-rw-r--r--tool/lib/dump.lldb13
-rw-r--r--tool/lib/envutil.rb210
-rw-r--r--tool/lib/gc_checker.rb36
-rw-r--r--tool/lib/gc_compact_checker.rb10
-rw-r--r--tool/lib/gem_env.rb1
-rw-r--r--tool/lib/iseq_loader_checker.rb9
-rw-r--r--tool/lib/launchable.rb91
-rw-r--r--tool/lib/leakchecker.rb76
-rw-r--r--tool/lib/memory_status.rb102
-rw-r--r--tool/lib/minitest/README.txt457
-rw-r--r--tool/lib/minitest/autorun.rb14
-rw-r--r--tool/lib/minitest/benchmark.rb418
-rw-r--r--tool/lib/minitest/mock.rb196
-rw-r--r--tool/lib/minitest/unit.rb1475
-rw-r--r--tool/lib/output.rb71
-rw-r--r--tool/lib/path.rb101
-rw-r--r--tool/lib/profile_test_all.rb2
-rw-r--r--tool/lib/test/jobserver.rb47
-rw-r--r--tool/lib/test/unit.rb922
-rw-r--r--tool/lib/test/unit/assertions.rb623
-rw-r--r--tool/lib/test/unit/core_assertions.rb763
-rw-r--r--tool/lib/test/unit/parallel.rb58
-rw-r--r--tool/lib/test/unit/testcase.rb286
-rw-r--r--tool/lib/vcs.rb557
-rw-r--r--tool/lib/vpath.rb7
-rw-r--r--tool/lib/webrick.rb232
-rw-r--r--tool/lib/webrick/.document6
-rw-r--r--tool/lib/webrick/accesslog.rb157
-rw-r--r--tool/lib/webrick/cgi.rb313
-rw-r--r--tool/lib/webrick/compat.rb36
-rw-r--r--tool/lib/webrick/config.rb158
-rw-r--r--tool/lib/webrick/cookie.rb172
-rw-r--r--tool/lib/webrick/htmlutils.rb30
-rw-r--r--tool/lib/webrick/httpauth.rb96
-rw-r--r--tool/lib/webrick/httpauth/authenticator.rb117
-rw-r--r--tool/lib/webrick/httpauth/basicauth.rb116
-rw-r--r--tool/lib/webrick/httpauth/digestauth.rb395
-rw-r--r--tool/lib/webrick/httpauth/htdigest.rb132
-rw-r--r--tool/lib/webrick/httpauth/htgroup.rb97
-rw-r--r--tool/lib/webrick/httpauth/htpasswd.rb158
-rw-r--r--tool/lib/webrick/httpauth/userdb.rb53
-rw-r--r--tool/lib/webrick/httpproxy.rb354
-rw-r--r--tool/lib/webrick/httprequest.rb636
-rw-r--r--tool/lib/webrick/httpresponse.rb564
-rw-r--r--tool/lib/webrick/https.rb152
-rw-r--r--tool/lib/webrick/httpserver.rb294
-rw-r--r--tool/lib/webrick/httpservlet.rb23
-rw-r--r--tool/lib/webrick/httpservlet/abstract.rb152
-rw-r--r--tool/lib/webrick/httpservlet/cgi_runner.rb47
-rw-r--r--tool/lib/webrick/httpservlet/cgihandler.rb126
-rw-r--r--tool/lib/webrick/httpservlet/erbhandler.rb88
-rw-r--r--tool/lib/webrick/httpservlet/filehandler.rb552
-rw-r--r--tool/lib/webrick/httpservlet/prochandler.rb47
-rw-r--r--tool/lib/webrick/httpstatus.rb194
-rw-r--r--tool/lib/webrick/httputils.rb512
-rw-r--r--tool/lib/webrick/httpversion.rb76
-rw-r--r--tool/lib/webrick/log.rb156
-rw-r--r--tool/lib/webrick/server.rb381
-rw-r--r--tool/lib/webrick/ssl.rb215
-rw-r--r--tool/lib/webrick/utils.rb265
-rw-r--r--tool/lib/webrick/version.rb18
-rwxr-xr-xtool/ln_sr.rb131
-rw-r--r--tool/lrama/LEGAL.md12
-rw-r--r--tool/lrama/MIT21
-rw-r--r--tool/lrama/NEWS.md1072
-rwxr-xr-xtool/lrama/exe/lrama7
-rw-r--r--tool/lrama/lib/lrama.rb22
-rw-r--r--tool/lrama/lib/lrama/bitmap.rb47
-rw-r--r--tool/lrama/lib/lrama/command.rb120
-rw-r--r--tool/lrama/lib/lrama/context.rb497
-rw-r--r--tool/lrama/lib/lrama/counterexamples.rb426
-rw-r--r--tool/lrama/lib/lrama/counterexamples/derivation.rb76
-rw-r--r--tool/lrama/lib/lrama/counterexamples/example.rb154
-rw-r--r--tool/lrama/lib/lrama/counterexamples/node.rb30
-rw-r--r--tool/lrama/lib/lrama/counterexamples/path.rb27
-rw-r--r--tool/lrama/lib/lrama/counterexamples/state_item.rb31
-rw-r--r--tool/lrama/lib/lrama/counterexamples/triple.rb41
-rw-r--r--tool/lrama/lib/lrama/diagram.rb77
-rw-r--r--tool/lrama/lib/lrama/digraph.rb104
-rw-r--r--tool/lrama/lib/lrama/erb.rb29
-rw-r--r--tool/lrama/lib/lrama/grammar.rb603
-rw-r--r--tool/lrama/lib/lrama/grammar/auxiliary.rb14
-rw-r--r--tool/lrama/lib/lrama/grammar/binding.rb80
-rw-r--r--tool/lrama/lib/lrama/grammar/code.rb68
-rw-r--r--tool/lrama/lib/lrama/grammar/code/destructor_code.rb53
-rw-r--r--tool/lrama/lib/lrama/grammar/code/initial_action_code.rb39
-rw-r--r--tool/lrama/lib/lrama/grammar/code/no_reference_code.rb33
-rw-r--r--tool/lrama/lib/lrama/grammar/code/printer_code.rb53
-rw-r--r--tool/lrama/lib/lrama/grammar/code/rule_action.rb128
-rw-r--r--tool/lrama/lib/lrama/grammar/counter.rb27
-rw-r--r--tool/lrama/lib/lrama/grammar/destructor.rb24
-rw-r--r--tool/lrama/lib/lrama/grammar/error_token.rb24
-rw-r--r--tool/lrama/lib/lrama/grammar/inline.rb3
-rw-r--r--tool/lrama/lib/lrama/grammar/inline/resolver.rb80
-rw-r--r--tool/lrama/lib/lrama/grammar/parameterized.rb5
-rw-r--r--tool/lrama/lib/lrama/grammar/parameterized/resolver.rb73
-rw-r--r--tool/lrama/lib/lrama/grammar/parameterized/rhs.rb45
-rw-r--r--tool/lrama/lib/lrama/grammar/parameterized/rule.rb36
-rw-r--r--tool/lrama/lib/lrama/grammar/percent_code.rb25
-rw-r--r--tool/lrama/lib/lrama/grammar/precedence.rb55
-rw-r--r--tool/lrama/lib/lrama/grammar/printer.rb20
-rw-r--r--tool/lrama/lib/lrama/grammar/reference.rb29
-rw-r--r--tool/lrama/lib/lrama/grammar/rule.rb135
-rw-r--r--tool/lrama/lib/lrama/grammar/rule_builder.rb270
-rw-r--r--tool/lrama/lib/lrama/grammar/stdlib.y142
-rw-r--r--tool/lrama/lib/lrama/grammar/symbol.rb149
-rw-r--r--tool/lrama/lib/lrama/grammar/symbols.rb3
-rw-r--r--tool/lrama/lib/lrama/grammar/symbols/resolver.rb362
-rw-r--r--tool/lrama/lib/lrama/grammar/type.rb32
-rw-r--r--tool/lrama/lib/lrama/grammar/union.rb23
-rw-r--r--tool/lrama/lib/lrama/lexer.rb219
-rw-r--r--tool/lrama/lib/lrama/lexer/grammar_file.rb40
-rw-r--r--tool/lrama/lib/lrama/lexer/location.rb132
-rw-r--r--tool/lrama/lib/lrama/lexer/token.rb20
-rw-r--r--tool/lrama/lib/lrama/lexer/token/base.rb73
-rw-r--r--tool/lrama/lib/lrama/lexer/token/char.rb24
-rw-r--r--tool/lrama/lib/lrama/lexer/token/empty.rb14
-rw-r--r--tool/lrama/lib/lrama/lexer/token/ident.rb11
-rw-r--r--tool/lrama/lib/lrama/lexer/token/instantiate_rule.rb30
-rw-r--r--tool/lrama/lib/lrama/lexer/token/int.rb14
-rw-r--r--tool/lrama/lib/lrama/lexer/token/str.rb11
-rw-r--r--tool/lrama/lib/lrama/lexer/token/tag.rb16
-rw-r--r--tool/lrama/lib/lrama/lexer/token/token.rb11
-rw-r--r--tool/lrama/lib/lrama/lexer/token/user_code.rb109
-rw-r--r--tool/lrama/lib/lrama/logger.rb31
-rw-r--r--tool/lrama/lib/lrama/option_parser.rb223
-rw-r--r--tool/lrama/lib/lrama/options.rb46
-rw-r--r--tool/lrama/lib/lrama/output.rb452
-rw-r--r--tool/lrama/lib/lrama/parser.rb2285
-rw-r--r--tool/lrama/lib/lrama/reporter.rb39
-rw-r--r--tool/lrama/lib/lrama/reporter/conflicts.rb44
-rw-r--r--tool/lrama/lib/lrama/reporter/grammar.rb39
-rw-r--r--tool/lrama/lib/lrama/reporter/precedences.rb54
-rw-r--r--tool/lrama/lib/lrama/reporter/profile.rb4
-rw-r--r--tool/lrama/lib/lrama/reporter/profile/call_stack.rb45
-rw-r--r--tool/lrama/lib/lrama/reporter/profile/memory.rb44
-rw-r--r--tool/lrama/lib/lrama/reporter/rules.rb43
-rw-r--r--tool/lrama/lib/lrama/reporter/states.rb387
-rw-r--r--tool/lrama/lib/lrama/reporter/terms.rb44
-rw-r--r--tool/lrama/lib/lrama/state.rb534
-rw-r--r--tool/lrama/lib/lrama/state/action.rb5
-rw-r--r--tool/lrama/lib/lrama/state/action/goto.rb33
-rw-r--r--tool/lrama/lib/lrama/state/action/reduce.rb71
-rw-r--r--tool/lrama/lib/lrama/state/action/shift.rb39
-rw-r--r--tool/lrama/lib/lrama/state/inadequacy_annotation.rb140
-rw-r--r--tool/lrama/lib/lrama/state/item.rb120
-rw-r--r--tool/lrama/lib/lrama/state/reduce_reduce_conflict.rb24
-rw-r--r--tool/lrama/lib/lrama/state/resolved_conflict.rb65
-rw-r--r--tool/lrama/lib/lrama/state/shift_reduce_conflict.rb24
-rw-r--r--tool/lrama/lib/lrama/states.rb867
-rw-r--r--tool/lrama/lib/lrama/tracer.rb51
-rw-r--r--tool/lrama/lib/lrama/tracer/actions.rb22
-rw-r--r--tool/lrama/lib/lrama/tracer/closure.rb30
-rw-r--r--tool/lrama/lib/lrama/tracer/duration.rb38
-rw-r--r--tool/lrama/lib/lrama/tracer/only_explicit_rules.rb24
-rw-r--r--tool/lrama/lib/lrama/tracer/rules.rb23
-rw-r--r--tool/lrama/lib/lrama/tracer/state.rb33
-rw-r--r--tool/lrama/lib/lrama/version.rb6
-rw-r--r--tool/lrama/lib/lrama/warnings.rb33
-rw-r--r--tool/lrama/lib/lrama/warnings/conflicts.rb27
-rw-r--r--tool/lrama/lib/lrama/warnings/implicit_empty.rb29
-rw-r--r--tool/lrama/lib/lrama/warnings/name_conflicts.rb63
-rw-r--r--tool/lrama/lib/lrama/warnings/redefined_rules.rb23
-rw-r--r--tool/lrama/lib/lrama/warnings/required.rb23
-rw-r--r--tool/lrama/lib/lrama/warnings/useless_precedence.rb25
-rw-r--r--tool/lrama/template/bison/_yacc.h79
-rw-r--r--tool/lrama/template/bison/yacc.c2068
-rw-r--r--tool/lrama/template/bison/yacc.h40
-rw-r--r--tool/lrama/template/diagram/diagram.html102
-rw-r--r--tool/m4/_colorize_result_prepare.m43
-rw-r--r--tool/m4/ac_msg_result.m42
-rw-r--r--tool/m4/colorize_result.m42
-rw-r--r--tool/m4/ruby_append_option.m46
-rw-r--r--tool/m4/ruby_append_options.m42
-rw-r--r--tool/m4/ruby_check_builtin_func.m42
-rw-r--r--tool/m4/ruby_check_builtin_overflow.m428
-rw-r--r--tool/m4/ruby_check_builtin_setjmp.m412
-rw-r--r--tool/m4/ruby_check_header.m48
-rw-r--r--tool/m4/ruby_check_printf_prefix.m411
-rw-r--r--tool/m4/ruby_check_setjmp.m410
-rw-r--r--tool/m4/ruby_check_signedness.m42
-rw-r--r--tool/m4/ruby_check_sizeof.m42
-rw-r--r--tool/m4/ruby_check_sysconf.m48
-rw-r--r--tool/m4/ruby_cppoutfile.m46
-rw-r--r--tool/m4/ruby_decl_attribute.m46
-rw-r--r--tool/m4/ruby_default_arch.m428
-rw-r--r--tool/m4/ruby_define_if.m412
-rw-r--r--tool/m4/ruby_defint.m45
-rw-r--r--tool/m4/ruby_dtrace_available.m44
-rw-r--r--tool/m4/ruby_dtrace_postprocess.m44
-rw-r--r--tool/m4/ruby_func_attribute.m42
-rw-r--r--tool/m4/ruby_mingw32.m46
-rw-r--r--tool/m4/ruby_modular_gc.m441
-rw-r--r--tool/m4/ruby_prepend_option.m42
-rw-r--r--tool/m4/ruby_prog_gnu_ld.m42
-rw-r--r--tool/m4/ruby_prog_makedirs.m49
-rw-r--r--tool/m4/ruby_replace_funcs.m412
-rw-r--r--tool/m4/ruby_replace_type.m414
-rw-r--r--tool/m4/ruby_require_funcs.m413
-rw-r--r--tool/m4/ruby_rm_recursive.m42
-rw-r--r--tool/m4/ruby_setjmp_type.m421
-rw-r--r--tool/m4/ruby_stack_grow_direction.m48
-rw-r--r--tool/m4/ruby_thread.m480
-rw-r--r--tool/m4/ruby_try_cflags.m441
-rw-r--r--tool/m4/ruby_try_cxxflags.m44
-rw-r--r--tool/m4/ruby_try_ldflags.m44
-rw-r--r--tool/m4/ruby_type_attribute.m42
-rw-r--r--tool/m4/ruby_universal_arch.m442
-rw-r--r--tool/m4/ruby_wasm_tools.m425
-rw-r--r--tool/m4/ruby_werror_flag.m42
-rwxr-xr-xtool/make-snapshot193
-rw-r--r--tool/make_hgraph.rb7
-rwxr-xr-xtool/merger.rb211
-rwxr-xr-xtool/missing-baseruby.bat30
-rw-r--r--tool/mjit_archflag.sh40
-rw-r--r--tool/mjit_tabs.rb65
-rw-r--r--tool/mk_builtin_loader.rb466
-rwxr-xr-xtool/mk_rbbin.rb48
-rwxr-xr-xtool/mkconfig.rb55
-rwxr-xr-xtool/mkrunnable.rb94
-rw-r--r--tool/notes-github-pr.rb138
-rw-r--r--tool/notify-slack-commits.rb87
-rwxr-xr-xtool/outdate-bundled-gems.rb205
-rw-r--r--tool/prereq.status11
-rwxr-xr-xtool/pure_parser.rb24
-rwxr-xr-xtool/rbinstall.rb1027
-rw-r--r--tool/rbs_skip_tests52
-rw-r--r--tool/rbs_skip_tests_windows111
-rwxr-xr-xtool/rbuninstall.rb36
-rwxr-xr-xtool/rdoc-srcdir27
-rwxr-xr-xtool/redmine-backporter.rb171
-rwxr-xr-xtool/release.sh12
-rwxr-xr-xtool/releng/gen-mail.rb15
-rwxr-xr-xtool/releng/update-www-meta.rb25
-rwxr-xr-xtool/ruby-version.rb52
-rw-r--r--tool/ruby_vm/controllers/application_controller.rb6
-rw-r--r--tool/ruby_vm/helpers/c_escape.rb6
-rw-r--r--tool/ruby_vm/helpers/dumper.rb14
-rw-r--r--tool/ruby_vm/helpers/scanner.rb1
-rw-r--r--tool/ruby_vm/loaders/insns_def.rb1
-rw-r--r--tool/ruby_vm/loaders/opt_insn_unif_def.rb1
-rw-r--r--tool/ruby_vm/loaders/opt_operand_def.rb1
-rw-r--r--tool/ruby_vm/loaders/vm_opts_h.rb1
-rw-r--r--tool/ruby_vm/models/attribute.rb3
-rw-r--r--tool/ruby_vm/models/bare_instruction.rb236
-rwxr-xr-xtool/ruby_vm/models/bare_instructions.rb240
-rw-r--r--tool/ruby_vm/models/c_expr.rb7
-rw-r--r--tool/ruby_vm/models/instructions.rb19
-rw-r--r--tool/ruby_vm/models/instructions_unification.rb42
-rw-r--r--tool/ruby_vm/models/instructions_unifications.rb43
-rw-r--r--tool/ruby_vm/models/operands_unification.rb141
-rw-r--r--tool/ruby_vm/models/operands_unifications.rb142
-rw-r--r--tool/ruby_vm/models/trace_instruction.rb70
-rw-r--r--tool/ruby_vm/models/trace_instructions.rb71
-rw-r--r--tool/ruby_vm/models/typemap.rb2
-rw-r--r--tool/ruby_vm/models/zjit_instruction.rb56
-rw-r--r--tool/ruby_vm/scripts/insns2vm.rb13
-rw-r--r--tool/ruby_vm/tests/.gitkeep0
-rw-r--r--tool/ruby_vm/views/_comptime_insn_stack_increase.erb27
-rw-r--r--tool/ruby_vm/views/_insn_entry.erb9
-rw-r--r--tool/ruby_vm/views/_insn_leaf_info.erb18
-rw-r--r--tool/ruby_vm/views/_insn_len_info.erb31
-rw-r--r--tool/ruby_vm/views/_insn_name_info.erb59
-rw-r--r--tool/ruby_vm/views/_insn_operand_info.erb57
-rw-r--r--tool/ruby_vm/views/_insn_sp_pc_dependency.erb27
-rw-r--r--tool/ruby_vm/views/_insn_type_chars.erb19
-rw-r--r--tool/ruby_vm/views/_leaf_helpers.erb7
-rw-r--r--tool/ruby_vm/views/_mjit_compile_getinlinecache.erb31
-rw-r--r--tool/ruby_vm/views/_mjit_compile_insn.erb92
-rw-r--r--tool/ruby_vm/views/_mjit_compile_insn_body.erb129
-rw-r--r--tool/ruby_vm/views/_mjit_compile_invokebuiltin.erb29
-rw-r--r--tool/ruby_vm/views/_mjit_compile_ivar.erb101
-rw-r--r--tool/ruby_vm/views/_mjit_compile_pc_and_sp.erb38
-rw-r--r--tool/ruby_vm/views/_mjit_compile_send.erb117
-rw-r--r--tool/ruby_vm/views/_sp_inc_helpers.erb2
-rw-r--r--tool/ruby_vm/views/_trace_instruction.erb7
-rw-r--r--tool/ruby_vm/views/_zjit_helpers.erb31
-rw-r--r--tool/ruby_vm/views/_zjit_instruction.erb12
-rw-r--r--tool/ruby_vm/views/insns.inc.erb17
-rw-r--r--tool/ruby_vm/views/insns_info.inc.erb6
-rw-r--r--tool/ruby_vm/views/lib/ruby_vm/rjit/instruction.rb.erb14
-rw-r--r--tool/ruby_vm/views/mjit_compile.inc.erb111
-rw-r--r--tool/ruby_vm/views/opt_sc.inc.erb40
-rw-r--r--tool/ruby_vm/views/optinsn.inc.erb12
-rw-r--r--tool/ruby_vm/views/optunifs.inc.erb5
-rw-r--r--tool/ruby_vm/views/vm.inc.erb12
-rw-r--r--tool/ruby_vm/views/vmtc.inc.erb10
-rw-r--r--tool/run-gcov.rb3
-rw-r--r--tool/run-lcov.rb14
-rwxr-xr-xtool/runruby.rb29
-rwxr-xr-xtool/strip-rdoc.rb30
-rwxr-xr-x[-rw-r--r--]tool/sync_default_gems.rb1334
-rwxr-xr-xtool/test-annocheck.sh40
-rw-r--r--tool/test-bundled-gems.rb246
-rw-r--r--tool/test-coverage.rb25
-rw-r--r--tool/test/init.rb26
-rw-r--r--tool/test/minitest/metametameta.rb71
-rw-r--r--tool/test/minitest/test_minitest_benchmark.rb131
-rw-r--r--tool/test/minitest/test_minitest_mock.rb404
-rw-r--r--tool/test/minitest/test_minitest_unit.rb1793
-rw-r--r--tool/test/runner.rb13
-rw-r--r--tool/test/test_commit_email.rb102
-rwxr-xr-xtool/test/test_sync_default_gems.rb379
-rw-r--r--tool/test/testunit/metametameta.rb70
-rw-r--r--tool/test/testunit/test4test_hideskip.rb8
-rw-r--r--tool/test/testunit/test4test_load_failure.rb1
-rw-r--r--tool/test/testunit/test4test_sorting.rb2
-rw-r--r--tool/test/testunit/test4test_timeout.rb15
-rw-r--r--tool/test/testunit/test_assertion.rb201
-rw-r--r--tool/test/testunit/test_hideskip.rb7
-rw-r--r--tool/test/testunit/test_launchable.rb70
-rw-r--r--tool/test/testunit/test_load_failure.rb23
-rw-r--r--tool/test/testunit/test_minitest_unit.rb1489
-rw-r--r--tool/test/testunit/test_parallel.rb107
-rw-r--r--tool/test/testunit/test_redefinition.rb13
-rw-r--r--tool/test/testunit/test_sorting.rb59
-rw-r--r--tool/test/testunit/test_timeout.rb10
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_forth.rb8
-rw-r--r--tool/test/testunit/tests_for_parallel/slow_helper.rb8
-rw-r--r--tool/test/testunit/tests_for_parallel/test4test_hungup.rb15
-rw-r--r--tool/test/webrick/.htaccess1
-rw-r--r--tool/test/webrick/test_cgi.rb170
-rw-r--r--tool/test/webrick/test_config.rb17
-rw-r--r--tool/test/webrick/test_cookie.rb141
-rw-r--r--tool/test/webrick/test_do_not_reverse_lookup.rb71
-rw-r--r--tool/test/webrick/test_filehandler.rb402
-rw-r--r--tool/test/webrick/test_htgroup.rb19
-rw-r--r--tool/test/webrick/test_htmlutils.rb21
-rw-r--r--tool/test/webrick/test_httpauth.rb366
-rw-r--r--tool/test/webrick/test_httpproxy.rb466
-rw-r--r--tool/test/webrick/test_httprequest.rb488
-rw-r--r--tool/test/webrick/test_httpresponse.rb282
-rw-r--r--tool/test/webrick/test_https.rb112
-rw-r--r--tool/test/webrick/test_httpserver.rb543
-rw-r--r--tool/test/webrick/test_httpstatus.rb35
-rw-r--r--tool/test/webrick/test_httputils.rb101
-rw-r--r--tool/test/webrick/test_httpversion.rb41
-rw-r--r--tool/test/webrick/test_server.rb191
-rw-r--r--tool/test/webrick/test_ssl_server.rb67
-rw-r--r--tool/test/webrick/test_utils.rb110
-rw-r--r--tool/test/webrick/utils.rb82
-rw-r--r--tool/test/webrick/webrick.cgi38
-rw-r--r--tool/test/webrick/webrick.rhtml4
-rw-r--r--tool/test/webrick/webrick_long_filename.cgi36
-rw-r--r--tool/transcode-tblgen.rb8
-rw-r--r--tool/transform_mjit_header.rb326
-rwxr-xr-xtool/travis_wait.sh18
-rwxr-xr-xtool/update-NEWS-gemlist.rb68
-rwxr-xr-xtool/update-NEWS-github-release.rb395
-rw-r--r--tool/update-NEWS-refs.rb38
-rwxr-xr-x[-rw-r--r--]tool/update-bundled_gems.rb51
-rwxr-xr-xtool/update-deps83
-rwxr-xr-xtool/wasm-clangw9
-rwxr-xr-xtool/ytab.sed80
-rwxr-xr-xtool/zjit_bisect.rb165
-rwxr-xr-xtool/zjit_diff.rb272
-rw-r--r--tool/zjit_iongraph.html551
-rwxr-xr-xtool/zjit_iongraph.rb38
-rw-r--r--trace_point.rb406
-rw-r--r--transcode.c1206
-rw-r--r--transcode_data.h32
-rw-r--r--transient_heap.c989
-rw-r--r--transient_heap.h65
-rw-r--r--universal_parser.c211
-rw-r--r--util.c272
-rw-r--r--variable.c4035
-rw-r--r--variable.h19
-rw-r--r--vcpkg.json11
-rw-r--r--version.c230
-rw-r--r--version.h62
-rw-r--r--vm.c3478
-rw-r--r--vm_args.c1171
-rw-r--r--vm_backtrace.c1638
-rw-r--r--vm_callinfo.h358
-rw-r--r--vm_core.h1238
-rw-r--r--vm_debug.h48
-rw-r--r--vm_dump.c1744
-rw-r--r--vm_eval.c1985
-rw-r--r--vm_exec.c88
-rw-r--r--vm_exec.h70
-rw-r--r--vm_insnhelper.c5811
-rw-r--r--vm_insnhelper.h79
-rw-r--r--vm_method.c2444
-rw-r--r--vm_opts.h8
-rw-r--r--vm_sync.c203
-rw-r--r--vm_sync.h34
-rw-r--r--vm_trace.c1347
-rw-r--r--vsnprintf.c27
-rw-r--r--warning.rb14
-rw-r--r--wasm/GNUmakefile.in32
-rw-r--r--wasm/README.md78
-rw-r--r--wasm/asyncify.h23
-rw-r--r--wasm/fiber.c83
-rw-r--r--wasm/fiber.h43
-rw-r--r--wasm/machine.c62
-rw-r--r--wasm/machine.h25
-rw-r--r--wasm/machine_core.S25
-rw-r--r--wasm/missing.c192
-rw-r--r--wasm/runtime.c54
-rw-r--r--wasm/setjmp.c223
-rw-r--r--wasm/setjmp.h96
-rw-r--r--wasm/setjmp_core.S27
-rw-r--r--wasm/tests/fiber_test.c66
-rw-r--r--wasm/tests/machine_test.c115
-rw-r--r--wasm/tests/setjmp_test.c108
-rwxr-xr-xwasm/wasm-opt36
-rw-r--r--weakmap.c1003
-rw-r--r--win32/.document1
-rw-r--r--win32/Makefile.sub649
-rw-r--r--win32/README.win32149
-rw-r--r--[-rwxr-xr-x]win32/configure.bat491
-rw-r--r--win32/dir.h4
-rw-r--r--win32/enc-setup.mak4
-rw-r--r--win32/file.c626
-rw-r--r--win32/file.h41
-rwxr-xr-xwin32/ifchange.bat135
-rwxr-xr-xwin32/install-buildtools.cmd14
-rwxr-xr-xwin32/install-msys-packages.cmd29
-rwxr-xr-xwin32/lastrev.bat30
-rwxr-xr-xwin32/makedirs.bat2
-rwxr-xr-xwin32/mkexports.rb38
-rwxr-xr-xwin32/resource.rb4
-rwxr-xr-xwin32/rm.bat72
-rwxr-xr-xwin32/rmdirs.bat8
-rwxr-xr-xwin32/rtname.cmd71
-rw-r--r--win32/ruby.manifest8
-rw-r--r--win32/setup.mak280
-rw-r--r--win32/shellsplit.cmd114
-rw-r--r--win32/test_shellsplit.cmd28
-rwxr-xr-xwin32/vssetup.cmd56
-rw-r--r--win32/win32.c6611
-rw-r--r--win32/winmain.c4
-rw-r--r--yjit.c562
-rw-r--r--yjit.h83
-rw-r--r--yjit.rb554
-rw-r--r--yjit/.gitignore2
-rw-r--r--yjit/Cargo.lock46
-rw-r--r--yjit/Cargo.toml28
-rw-r--r--yjit/bindgen/Cargo.lock392
-rw-r--r--yjit/bindgen/Cargo.toml12
-rw-r--r--yjit/bindgen/src/main.rs416
-rw-r--r--yjit/not_gmake.mk18
-rw-r--r--yjit/src/asm/arm64/README.md16
-rw-r--r--yjit/src/asm/arm64/arg/bitmask_imm.rs255
-rw-r--r--yjit/src/asm/arm64/arg/condition.rs52
-rw-r--r--yjit/src/asm/arm64/arg/inst_offset.rs47
-rw-r--r--yjit/src/asm/arm64/arg/mod.rs18
-rw-r--r--yjit/src/asm/arm64/arg/sf.rs19
-rw-r--r--yjit/src/asm/arm64/arg/shifted_imm.rs81
-rw-r--r--yjit/src/asm/arm64/arg/sys_reg.rs6
-rw-r--r--yjit/src/asm/arm64/arg/truncate.rs66
-rw-r--r--yjit/src/asm/arm64/inst/atomic.rs86
-rw-r--r--yjit/src/asm/arm64/inst/branch.rs100
-rw-r--r--yjit/src/asm/arm64/inst/branch_cond.rs78
-rw-r--r--yjit/src/asm/arm64/inst/breakpoint.rs55
-rw-r--r--yjit/src/asm/arm64/inst/call.rs104
-rw-r--r--yjit/src/asm/arm64/inst/conditional.rs73
-rw-r--r--yjit/src/asm/arm64/inst/data_imm.rs143
-rw-r--r--yjit/src/asm/arm64/inst/data_reg.rs192
-rw-r--r--yjit/src/asm/arm64/inst/halfword_imm.rs179
-rw-r--r--yjit/src/asm/arm64/inst/load_literal.rs89
-rw-r--r--yjit/src/asm/arm64/inst/load_register.rs108
-rw-r--r--yjit/src/asm/arm64/inst/load_store.rs249
-rw-r--r--yjit/src/asm/arm64/inst/load_store_exclusive.rs109
-rw-r--r--yjit/src/asm/arm64/inst/logical_imm.rs154
-rw-r--r--yjit/src/asm/arm64/inst/logical_reg.rs207
-rw-r--r--yjit/src/asm/arm64/inst/madd.rs73
-rw-r--r--yjit/src/asm/arm64/inst/mod.rs54
-rw-r--r--yjit/src/asm/arm64/inst/mov.rs155
-rw-r--r--yjit/src/asm/arm64/inst/nop.rs44
-rw-r--r--yjit/src/asm/arm64/inst/pc_rel.rs107
-rw-r--r--yjit/src/asm/arm64/inst/reg_pair.rs212
-rw-r--r--yjit/src/asm/arm64/inst/sbfm.rs103
-rw-r--r--yjit/src/asm/arm64/inst/shift_imm.rs147
-rw-r--r--yjit/src/asm/arm64/inst/smulh.rs60
-rw-r--r--yjit/src/asm/arm64/inst/sys_reg.rs86
-rw-r--r--yjit/src/asm/arm64/inst/test_bit.rs133
-rw-r--r--yjit/src/asm/arm64/mod.rs1680
-rw-r--r--yjit/src/asm/arm64/opnd.rs195
-rw-r--r--yjit/src/asm/mod.rs847
-rw-r--r--yjit/src/asm/x86_64/mod.rs1456
-rw-r--r--yjit/src/asm/x86_64/tests.rs460
-rw-r--r--yjit/src/backend/arm64/mod.rs1829
-rw-r--r--yjit/src/backend/ir.rs2156
-rw-r--r--yjit/src/backend/mod.rs14
-rw-r--r--yjit/src/backend/tests.rs329
-rw-r--r--yjit/src/backend/x86_64/mod.rs1340
-rw-r--r--yjit/src/codegen.rs11469
-rw-r--r--yjit/src/core.rs4608
-rw-r--r--yjit/src/cruby.rs838
-rw-r--r--yjit/src/cruby_bindings.inc.rs1339
-rw-r--r--yjit/src/disasm.rs400
-rw-r--r--yjit/src/invariants.rs709
-rw-r--r--yjit/src/lib.rs31
-rw-r--r--yjit/src/log.rs179
-rw-r--r--yjit/src/options.rs432
-rw-r--r--yjit/src/stats.rs1068
-rw-r--r--yjit/src/utils.rs287
-rw-r--r--yjit/src/virtualmem.rs488
-rw-r--r--yjit/src/yjit.rs289
-rw-r--r--yjit/yjit.mk60
-rw-r--r--zjit.c255
-rw-r--r--zjit.h119
-rw-r--r--zjit.rb284
-rw-r--r--zjit/.gitignore2
-rw-r--r--zjit/Cargo.lock594
-rw-r--r--zjit/Cargo.toml25
-rw-r--r--zjit/bindgen/Cargo.lock392
-rw-r--r--zjit/bindgen/Cargo.toml12
-rw-r--r--zjit/bindgen/src/main.rs470
-rw-r--r--zjit/build.rs29
-rw-r--r--zjit/src/asm/arm64/README.md16
-rw-r--r--zjit/src/asm/arm64/arg/bitmask_imm.rs255
-rw-r--r--zjit/src/asm/arm64/arg/condition.rs52
-rw-r--r--zjit/src/asm/arm64/arg/inst_offset.rs47
-rw-r--r--zjit/src/asm/arm64/arg/mod.rs18
-rw-r--r--zjit/src/asm/arm64/arg/sf.rs19
-rw-r--r--zjit/src/asm/arm64/arg/shifted_imm.rs80
-rw-r--r--zjit/src/asm/arm64/arg/sys_reg.rs6
-rw-r--r--zjit/src/asm/arm64/arg/truncate.rs66
-rw-r--r--zjit/src/asm/arm64/inst/atomic.rs86
-rw-r--r--zjit/src/asm/arm64/inst/branch.rs100
-rw-r--r--zjit/src/asm/arm64/inst/branch_cond.rs78
-rw-r--r--zjit/src/asm/arm64/inst/breakpoint.rs55
-rw-r--r--zjit/src/asm/arm64/inst/call.rs104
-rw-r--r--zjit/src/asm/arm64/inst/conditional.rs73
-rw-r--r--zjit/src/asm/arm64/inst/data_imm.rs143
-rw-r--r--zjit/src/asm/arm64/inst/data_reg.rs192
-rw-r--r--zjit/src/asm/arm64/inst/halfword_imm.rs179
-rw-r--r--zjit/src/asm/arm64/inst/load_literal.rs91
-rw-r--r--zjit/src/asm/arm64/inst/load_register.rs108
-rw-r--r--zjit/src/asm/arm64/inst/load_store.rs255
-rw-r--r--zjit/src/asm/arm64/inst/load_store_exclusive.rs109
-rw-r--r--zjit/src/asm/arm64/inst/logical_imm.rs154
-rw-r--r--zjit/src/asm/arm64/inst/logical_reg.rs207
-rw-r--r--zjit/src/asm/arm64/inst/madd.rs73
-rw-r--r--zjit/src/asm/arm64/inst/mod.rs56
-rw-r--r--zjit/src/asm/arm64/inst/mov.rs192
-rw-r--r--zjit/src/asm/arm64/inst/nop.rs44
-rw-r--r--zjit/src/asm/arm64/inst/pc_rel.rs107
-rw-r--r--zjit/src/asm/arm64/inst/reg_pair.rs212
-rw-r--r--zjit/src/asm/arm64/inst/sbfm.rs103
-rw-r--r--zjit/src/asm/arm64/inst/shift_imm.rs147
-rw-r--r--zjit/src/asm/arm64/inst/smulh.rs60
-rw-r--r--zjit/src/asm/arm64/inst/sys_reg.rs86
-rw-r--r--zjit/src/asm/arm64/inst/test_bit.rs133
-rw-r--r--zjit/src/asm/arm64/inst/udf.rs52
-rw-r--r--zjit/src/asm/arm64/mod.rs1987
-rw-r--r--zjit/src/asm/arm64/opnd.rs270
-rw-r--r--zjit/src/asm/mod.rs463
-rw-r--r--zjit/src/asm/x86_64/mod.rs1439
-rw-r--r--zjit/src/asm/x86_64/tests.rs966
-rw-r--r--zjit/src/backend/arm64/mod.rs2929
-rw-r--r--zjit/src/backend/lir.rs4471
-rw-r--r--zjit/src/backend/mod.rs19
-rw-r--r--zjit/src/backend/parcopy.rs368
-rw-r--r--zjit/src/backend/tests.rs261
-rw-r--r--zjit/src/backend/x86_64/mod.rs2461
-rw-r--r--zjit/src/bitset.rs225
-rw-r--r--zjit/src/cast.rs64
-rw-r--r--zjit/src/codegen.rs3644
-rw-r--r--zjit/src/codegen_tests.rs5768
-rw-r--r--zjit/src/cruby.rs1659
-rw-r--r--zjit/src/cruby_bindings.inc.rs2326
-rw-r--r--zjit/src/cruby_methods.rs1040
-rw-r--r--zjit/src/disasm.rs72
-rw-r--r--zjit/src/distribution.rs282
-rw-r--r--zjit/src/gc.rs244
-rw-r--r--zjit/src/hir.rs9484
-rw-r--r--zjit/src/hir/opt_tests.rs17281
-rw-r--r--zjit/src/hir/tests.rs6433
-rw-r--r--zjit/src/hir_effect/gen_hir_effect.rb126
-rw-r--r--zjit/src/hir_effect/hir_effect.inc.rs63
-rw-r--r--zjit/src/hir_effect/mod.rs420
-rw-r--r--zjit/src/hir_type/gen_hir_type.rb251
-rw-r--r--zjit/src/hir_type/hir_type.inc.rs300
-rw-r--r--zjit/src/hir_type/mod.rs1107
-rw-r--r--zjit/src/invariants.rs543
-rw-r--r--zjit/src/jit_frame.rs314
-rw-r--r--zjit/src/json.rs700
-rw-r--r--zjit/src/lib.rs46
-rw-r--r--zjit/src/options.rs631
-rw-r--r--zjit/src/payload.rs135
-rw-r--r--zjit/src/profile.rs582
-rw-r--r--zjit/src/state.rs541
-rw-r--r--zjit/src/stats.rs1280
-rw-r--r--zjit/src/ttycolors.rs31
-rw-r--r--zjit/src/virtualmem.rs504
-rw-r--r--zjit/zjit.mk141
10694 files changed, 1485608 insertions, 874374 deletions
diff --git a/.document b/.document
index a3f7571ea7..753d6f9892 100644
--- a/.document
+++ b/.document
@@ -10,17 +10,31 @@
# prelude
prelude.rb
rbconfig.rb
+
array.rb
ast.rb
dir.rb
gc.rb
-numeric.rb
+hash.rb
io.rb
kernel.rb
+marshal.rb
+numeric.rb
+nilclass.rb
pack.rb
+pathname_builtin.rb
+ractor.rb
+string.rb
+symbol.rb
+timev.rb
+thread_sync.rb
trace_point.rb
warning.rb
-ractor.rb
+yjit.rb
+zjit.rb
+
+# Errno::*
+known_errors.inc
# the lib/ directory (which has its own .document file)
lib
@@ -28,6 +42,9 @@ lib
# and some of the ext/ directory (which has its own .document file)
ext
+# For `prism`, ruby code is in lib and c in the prism folder
+prism
+
# rdoc files
NEWS.md
@@ -36,11 +53,7 @@ README.ja.md
COPYING
COPYING.ja
-CONTRIBUTING.md
LEGAL
-# win32/README.win32 linked from README.md
-win32
-
doc
diff --git a/.gdbinit b/.gdbinit
index 49380951b8..4457f6f12b 100644
--- a/.gdbinit
+++ b/.gdbinit
@@ -1,23 +1,7 @@
-set startup-with-shell off
-
-define hook-run
- set $color_type = 0
- set $color_highlite = 0
- set $color_end = 0
-end
-
define ruby_gdb_init
- if !$color_type
- set $color_type = "\033[31m"
- end
- if !$color_highlite
- set $color_highlite = "\033[36m"
- end
- if !$color_end
- set $color_end = "\033[m"
- end
- if ruby_dummy_gdb_enums.special_consts
- end
+ init-if-undefined $color_type = "\033[31m"
+ init-if-undefined $color_highlite = "\033[36m"
+ init-if-undefined $color_end = "\033[m"
end
# set prompt \033[36m(gdb)\033[m\040
@@ -67,7 +51,7 @@ define rp
printf "%sT_OBJECT%s: ", $color_type, $color_end
print ((struct RObject *)($arg0))->basic
if ($flags & ROBJECT_EMBED)
- print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (ROBJECT_EMBED_LEN_MAX+0)
+ print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (RSHAPE_CAPACITY(rb_obj_shape_id($arg0)))
else
print (((struct RObject *)($arg0))->as.heap)
if (((struct RObject*)($arg0))->as.heap.numiv) > 0
@@ -99,13 +83,11 @@ define rp
set $regsrc = ((struct RRegexp*)($arg0))->src
set $rsflags = ((struct RBasic*)$regsrc)->flags
printf "%sT_REGEXP%s: ", $color_type, $color_end
- set $len = ($rsflags & RUBY_FL_USER1) ? \
- ((struct RString*)$regsrc)->as.heap.len : \
- (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ set $len = ((struct RString*)($arg0))->len
set print address off
output *(char *)(($rsflags & RUBY_FL_USER1) ? \
- ((struct RString*)$regsrc)->as.heap.ptr : \
- ((struct RString*)$regsrc)->as.ary) @ $len
+ ((struct RString*)$regsrc)->as.heap.ptr : \
+ ((struct RString*)$regsrc)->as.embed.ary) @ $len
set print address on
printf " len:%ld ", $len
if $flags & RUBY_FL_USER6
@@ -126,26 +108,26 @@ define rp
printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
printf "(embed) "
if ($len == 0)
- printf "{(empty)} "
+ printf "{(empty)} "
else
- print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
- printf " "
+ print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+ printf " "
end
else
set $len = ((struct RArray*)($arg0))->as.heap.len
printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
if ($flags & RUBY_FL_USER2)
- printf "(shared) shared="
- output/x ((struct RArray*)($arg0))->as.heap.aux.shared_root
- printf " "
+ printf "(shared) shared="
+ output/x ((struct RArray*)($arg0))->as.heap.aux.shared_root
+ printf " "
else
- printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+ printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
end
if ($len == 0)
- printf "{(empty)} "
+ printf "{(empty)} "
else
- print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
- printf " "
+ print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+ printf " "
end
end
print (struct RArray *)($arg0)
@@ -157,13 +139,15 @@ define rp
if ($flags & RUBY_T_MASK) == RUBY_T_HASH
printf "%sT_HASH%s: ", $color_type, $color_end,
if (((struct RHash *)($arg0))->basic.flags & RHASH_ST_TABLE_FLAG)
- printf "st len=%ld ", ((struct RHash *)($arg0))->as.st->num_entries
+ set $st = (struct st_table *)((uintptr_t)($arg0) + sizeof(struct RHash))
+ printf "st len=%ld ", $st->num_entries
+ print $st
else
printf "li len=%ld bound=%ld ", \
((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_SIZE_MASK) >> RHASH_AR_TABLE_SIZE_SHIFT), \
((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_BOUND_MASK) >> RHASH_AR_TABLE_BOUND_SHIFT)
+ print (struct ar_table_struct *)((uintptr_t)($arg0) + sizeof(struct RHash))
end
- print (struct RHash *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
set $len = (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
@@ -201,12 +185,14 @@ define rp
print (struct RBasic *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_DATA
- if ((struct RTypedData *)($arg0))->typed_flag == 1
- printf "%sT_DATA%s(%s): ", $color_type, $color_end, ((struct RTypedData *)($arg0))->type->wrap_struct_name
- print (struct RTypedData *)($arg0)
+ set $data = (struct RTypedData *)($arg0)
+ set $type = (const rb_data_type_t *)($data->type & ~1)
+ printf "%sT_DATA%s(%s): ", $color_type, $color_end, $type->wrap_struct_name
+ print *$type
+ if ($data->type & 1)
+ print (void *)&$data->data
else
- printf "%sT_DATA%s: ", $color_type, $color_end
- print (struct RData *)($arg0)
+ print $data
end
else
if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
@@ -440,13 +426,11 @@ end
define output_string
set $flags = ((struct RBasic*)($arg0))->flags
- set $len = ($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.len : \
- (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ set $len = ((struct RString*)($arg0))->len
if $len > 0
output *(char *)(($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.ptr : \
- ((struct RString*)($arg0))->as.ary) @ $len
+ ((struct RString*)($arg0))->as.heap.ptr : \
+ ((struct RString*)($arg0))->as.embed.ary) @ $len
else
output ""
end
@@ -454,13 +438,11 @@ end
define print_string
set $flags = ((struct RBasic*)($arg0))->flags
- set $len = ($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.len : \
- (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ set $len = ((struct RString*)($arg0))->len
if $len > 0
printf "%s", *(char *)(($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.ptr : \
- ((struct RString*)($arg0))->as.ary) @ $len
+ ((struct RString*)($arg0))->as.heap.ptr : \
+ ((struct RString*)($arg0))->as.embed.ary) @ $len
end
end
@@ -543,14 +525,14 @@ document rp_bignum
end
define rp_class
+ set $class_and_classext = (struct RClass_and_rb_classext_t *)($arg0)
printf "(struct RClass *) %p", (void*)$arg0
- if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
- printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
+ if $class_and_classext->classext->origin_ != (VALUE)$arg0
+ printf " -> %p", $class_and_classext->classext->origin_
end
printf "\n"
rb_classname $arg0
- print/x *(struct RClass *)($arg0)
- print *((struct RClass *)($arg0))->ptr
+ print/x *$class_and_classext
end
document rp_class
Print the content of a Class/Module.
@@ -689,11 +671,6 @@ define nd_stts
end
-define nd_entry
- printf "%su3.entry%s: ", $color_highlite, $color_end
- p ($arg0).u3.entry
-end
-
define nd_vid
printf "%su1.id%s: ", $color_highlite, $color_end
p ($arg0).u1.id
@@ -868,22 +845,22 @@ define rb_numtable_entry
set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
if $rb_numtable_p.k == $rb_numtable_id
- set $rb_numtable_key = $rb_numtable_p.k
- set $rb_numtable_rec = $rb_numtable_p.v
- set $rb_numtable_p = 0
+ set $rb_numtable_key = $rb_numtable_p.k
+ set $rb_numtable_rec = $rb_numtable_p.v
+ set $rb_numtable_p = 0
else
- set $rb_numtable_p = $rb_numtable_p + 1
+ set $rb_numtable_p = $rb_numtable_p + 1
end
end
else
set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
while $rb_numtable_p
if $rb_numtable_p->key == $rb_numtable_id
- set $rb_numtable_key = $rb_numtable_p->key
- set $rb_numtable_rec = $rb_numtable_p->record
- set $rb_numtable_p = 0
+ set $rb_numtable_key = $rb_numtable_p->key
+ set $rb_numtable_rec = $rb_numtable_p->record
+ set $rb_numtable_p = 0
else
- set $rb_numtable_p = $rb_numtable_p->next
+ set $rb_numtable_p = $rb_numtable_p->next
end
end
end
@@ -921,10 +898,10 @@ document rb_method_entry
end
define rb_classname
- # up to 128bit int
- set $rb_classname = rb_mod_name($arg0)
- if $rb_classname != RUBY_Qnil
- rp $rb_classname
+ set $rb_classname = ((struct RClass_and_rb_classext_t*)$arg0)->classext->classpath
+ if $rb_classname != RUBY_Qfalse
+ print_string $rb_classname
+ printf "\n"
else
echo anonymous class/module\n
end
@@ -961,7 +938,7 @@ define iseq
set $operand_size = ((INSN*)($arg0))->operand_size
set $operands = ((INSN*)($arg0))->operands
while $i < $operand_size
- rp $operands[$i++]
+ rp $operands[$i++]
end
end
end
@@ -979,8 +956,8 @@ end
define rb_ps_vm
print $ps_vm = (rb_vm_t*)$arg0
- set $ps_thread_ln = $ps_vm->living_threads.n.next
- set $ps_thread_ln_last = $ps_vm->living_threads.n.prev
+ set $ps_thread_ln = $ps_vm->ractor.main_ractor.threads.set.n.next
+ set $ps_thread_ln_last = $ps_vm->ractor.main_ractor.threads.set.n.prev
while 1
set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
set $ps_thread = (VALUE)($ps_thread_th->self)
@@ -997,7 +974,7 @@ end
define print_lineno
set $cfp = $arg0
- set $iseq = $cfp->iseq
+ set $iseq = rb_get_cfp_iseq($cfp)
set $pos = $cfp->pc - $iseq->body->iseq_encoded
if $pos != 0
set $pos = $pos - 1
@@ -1078,7 +1055,7 @@ define print_id
else
set $serial = (rb_id_serial_t)$id
end
- if $serial && $serial <= ruby_global_symbols.last_id
+ if $serial && $serial < ruby_global_symbols.next_id
set $idx = $serial / ID_ENTRY_UNIT
set $ids = (struct RArray *)ruby_global_symbols.ids
set $flags = $ids->basic.flags
@@ -1101,12 +1078,12 @@ define print_id
set $aryptr = $ary->as.heap.ptr
set $arylen = $ary->as.heap.len
end
- set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
- if $result != RUBY_Qnil
+ set $result = $aryptr[($serial % ID_ENTRY_UNIT) + $t]
+ if $result != RUBY_Qnil
print_string $result
- else
- echo undef
- end
+ else
+ echo undef
+ end
end
end
end
@@ -1131,20 +1108,21 @@ define rb_ps_thread
set $ps_thread = (struct RTypedData*)$arg0
set $ps_thread_th = (rb_thread_t*)$ps_thread->data
printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
- $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
+ $ps_thread, $ps_thread_th, $ps_thread_th->nt
set $cfp = $ps_thread_th->ec->cfp
set $cfpend = (rb_control_frame_t *)($ps_thread_th->ec->vm_stack + $ps_thread_th->ec->vm_stack_size)-1
while $cfp < $cfpend
- if $cfp->iseq
- if !((VALUE)$cfp->iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$cfp->iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
+ if $cfp->_iseq
+ set $iseq = rb_get_cfp_iseq($cfp)
+ if !((VALUE)$iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
printf "%d:ifunc ", $cfpend-$cfp
set print symbol-filename on
- output/a $cfp->iseq.body
+ output/a $iseq.body
set print symbol-filename off
printf "\n"
else
if $cfp->pc
- set $location = $cfp->iseq->body->location
+ set $location = $iseq->body->location
printf "%d:", $cfpend-$cfp
print_pathobj $location.pathobj
printf ":"
@@ -1279,9 +1257,9 @@ document rb_count_objects
Counts all objects grouped by type.
end
-# Details: https://bugs.ruby-lang.org/projects/ruby-master/wiki/MachineInstructionsTraceWithGDB
+# Details: https://github.com/ruby/ruby/wiki/Machine-Instructions-Trace-with-GDB
define trace_machine_instructions
- set logging on
+ set logging enabled
set height 0
set width 0
display/i $pc
@@ -1316,16 +1294,14 @@ define dump_node
set $flags = ((struct RBasic*)($str))->flags
printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
((struct RString*)$str)->as.heap.ptr : \
- ((struct RString*)$str)->as.ary)
+ ((struct RString*)$str)->as.embed.ary)
end
define print_flags
printf "RUBY_FL_WB_PROTECTED: %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_WB_PROTECTED ? "1" : "0"
- printf "RUBY_FL_PROMOTED0 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED0 ? "1" : "0"
- printf "RUBY_FL_PROMOTED1 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED1 ? "1" : "0"
+ printf "RUBY_FL_PROMOTED : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED ? "1" : "0"
printf "RUBY_FL_FINALIZE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FINALIZE ? "1" : "0"
- printf "RUBY_FL_TAINT : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_TAINT ? "1" : "0"
- printf "RUBY_FL_UNTRUSTED : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_UNTRUSTED ? "1" : "0"
+ printf "RUBY_FL_SHAREABLE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_SHAREABLE ? "1" : "0"
printf "RUBY_FL_EXIVAR : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_EXIVAR ? "1" : "0"
printf "RUBY_FL_FREEZE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FREEZE ? "1" : "0"
@@ -1349,3 +1325,8 @@ define print_flags
printf "RUBY_FL_USER17 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER17 ? "1" : "0"
printf "RUBY_FL_USER18 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER18 ? "1" : "0"
end
+
+source -s misc/gdb.py
+
+# Moved from beginning, since it fails on older gdbs
+set startup-with-shell off
diff --git a/.git-blame-ignore-revs b/.git-blame-ignore-revs
new file mode 100644
index 0000000000..d752612085
--- /dev/null
+++ b/.git-blame-ignore-revs
@@ -0,0 +1,54 @@
+# This is a file used by GitHub to ignore the following commits on `git blame`.
+#
+# You can also do the same thing in your local repository with:
+# $ git config --local blame.ignoreRevsFile .git-blame-ignore-revs
+
+# Expand tabs
+5b21e94bebed90180d8ff63dad03b8b948361089
+c5e9af9c9d890578182a21e7b71b50334cd5579e
+e63a2115f64433b21cb5dd67c5bf8b30f87ef293
+712ac99e4d0384a941c80a9f48f62943ba7d97c0
+d1474affa8e105bece209cc9d594bb0a989859e1
+2da92388b948821269b18d6b178a680f17e41750
+5062c0c621d887367af8a054e5e5d83d7ec57dd3
+
+# Indentation
+0e4bad888e605d424b9222ae0ca43f85c1634e5e
+61aa46c41648c6d1e9b0daa1a292de551fde78df
+
+# Enable Style/StringLiterals cop for RubyGems/Bundler
+d7ffd3fea402239b16833cc434404a7af82d44f3
+
+# [ruby/digest] Revert tab-expansion in external files
+48b09aae7ec5632209229dcc294dd0d75a93a17f
+8a65cf3b61c60e4cb886f59a73ff6db44364bfa9
+39dc9f9093901d40d2998653948d5da38b18ee2c
+
+# [ruby/io-nonblock] Revert tab expansion
+f28287d34c03f472ffe90ea262bdde9affd4b965
+0d842fecb4f75ab3b1d4097ebdb8e88f51558041
+4ba2c66761d6a293abdfba409241d31063cefd62
+
+# Make benchmark indentation consistent
+fc4acf8cae82e5196186d3278d831f2438479d91
+
+# Make prism_compile.c indentation consistent
+40b2c8e5e7e6e5f83cee9276dc9c1922a69292d6
+d2c5867357ed88eccc28c2b3bd4a46e206e7ff85
+
+# Miss-and-revived commits
+a0f7de814ae5c299d6ce99bed5fb308a05d50ba0
+d4e24021d39e1f80f0055b55d91f8d5f22e15084
+7a56c316418980b8a41fcbdc94067b2bda2ad112
+e90282be7ba1bc8e3119f6e1a2c80356ceb3f80a
+26a9e0b4e31f7b5a9cbd755e0a15823a8fa51bae
+2f53985da9ee593fe524d408256835667938c7d7
+bf01f6ae89a95d8f5572e050facfe311c8c28aaf
+7480cd8d37fd71a41ce12b759090051c7e14fb5a
+
+# Win32: EOL code of batch files
+23f9a0d655c4d405bb2397a147a1523436205486
+b839989fd22fef85e2af19de1bc83aa72a5b22bd
+
+# ZJIT cargo-insta snapshot raw string literals
+b78e0a6ddf7df8a7568ea71284f593423c739551
diff --git a/.gitattributes b/.gitattributes
index d0c2d266b4..f98c091e3f 100644
--- a/.gitattributes
+++ b/.gitattributes
@@ -1,8 +1,14 @@
*.gemspec diff=ruby
*.rb diff=ruby
+*.inc.rs linguist-generated=true
bin svn-properties=svn:ignore=ruby
bin/* diff=ruby
tool/update-deps diff=ruby
tool/make-snapshot diff=ruby
tool/format-release diff=ruby
tool/leaked-globals diff=ruby
+
+# To strip CR from the batch files, set the `diff.dos.textconv` filter
+# like as `git config diff.dos.textconv $'sed \'s/\r$//\''`.
+*.bat diff=dos
+*.cmd diff=dos
diff --git a/.github/actions/capiext/action.yml b/.github/actions/capiext/action.yml
new file mode 100644
index 0000000000..ed69c8ac5e
--- /dev/null
+++ b/.github/actions/capiext/action.yml
@@ -0,0 +1,86 @@
+name: rubyspec C-API extensions
+
+inputs:
+ builddir:
+ required: false
+ default: '.'
+ make:
+ required: false
+ default: 'make -s'
+
+outputs:
+ key:
+ value: >-
+ ${{
+ !steps.restore.outputs.cache-hit &&
+ github.ref == 'refs/heads/master' &&
+ steps.config.outputs.key
+ }}
+
+runs:
+ using: composite
+
+ steps:
+ - id: config
+ shell: bash
+ run: |
+ eval $(grep -e '^arch *=' -e '^ruby_version *=' -e '^DLEXT *=' Makefile |
+ sed 's/ *= */=/')
+ case "${ruby_version}" in
+ *+*) key=capiexts-${arch}-${ruby_version}-${{ hashFiles('src/spec/ruby/optional/capi/ext/*.[ch]') }};;
+ *) key=;;
+ esac
+ echo version=$ruby_version >> $GITHUB_OUTPUT
+ echo key="$key" >> $GITHUB_OUTPUT
+ echo DLEXT=$DLEXT >> $GITHUB_OUTPUT
+ working-directory: ${{ inputs.builddir }}
+
+ - name: Restore previous CAPI extensions
+ uses: actions/cache/restore@0400d5f644dc74513175e3cd8d07132dd4860809 # v4.2.4
+ id: cache
+ with:
+ path: ${{ inputs.builddir }}/spec/ruby/optional/capi/ext/
+ key: ${{ steps.config.outputs.key }}
+ if: ${{ steps.config.outputs.key }}
+
+ - name: Run test-spec with previous CAPI extension binaries
+ id: check
+ shell: bash
+ run: | # zizmor: ignore[template-injection]
+ touch spec/ruby/optional/capi/ext/*.$DLEXT
+ [ ! -f spec/ruby/optional/capi/ext/\*.$DLEXT ]
+ ${{ inputs.make }} SPECOPTS=optional/capi test-spec
+ env:
+ DLEXT: ${{ steps.config.outputs.DLEXT }}
+ working-directory: ${{ inputs.builddir }}
+ if: ${{ steps.cache.outputs.cache-hit }}
+
+ - name: Strip CAPI extensions
+ id: strip
+ shell: bash
+ run: |
+ rm -f spec/ruby/optional/capi/ext/*.c
+ [ "$DLEXT" = bundle ] || # separated to .dSYM directories
+ strip spec/ruby/optional/capi/ext/*.$DLEXT
+ env:
+ DLEXT: ${{ steps.config.outputs.DLEXT }}
+ working-directory: ${{ inputs.builddir }}
+ if: >-
+ ${{true
+ && ! steps.cache.outputs.cache-hit
+ && github.ref_name == 'master'
+ }}
+
+ - name: Save CAPI extensions
+ uses: actions/cache/save@0400d5f644dc74513175e3cd8d07132dd4860809 # v4.2.4
+ with:
+ path: ${{ inputs.builddir }}/spec/ruby/optional/capi/ext/
+ key: ${{ steps.config.outputs.key }}
+ if: ${{ steps.strip.outcome == 'success' }}
+
+ - shell: bash
+ run: |
+ echo "::error::Change from ${prev} detected; bump up ABI version"
+ env:
+ prev: ${{ steps.config.outputs.version }}
+ if: ${{ always() && steps.check.outcome == 'failure' }}
diff --git a/.github/actions/compilers/action.yml b/.github/actions/compilers/action.yml
new file mode 100644
index 0000000000..c700bbfe9e
--- /dev/null
+++ b/.github/actions/compilers/action.yml
@@ -0,0 +1,164 @@
+name: Compiles ruby in a container
+description: >-
+ Makes ruby using a dedicated container
+
+inputs:
+ tag:
+ required: false
+ default: clang-20
+ description: >-
+ container image tag to use in this run.
+
+ with_gcc:
+ required: false
+ description: >-
+ override compiler path & flags.
+
+ CFLAGS:
+ required: false
+ description: >-
+ C compiler flags to override.
+
+ CXXFLAGS:
+ required: false
+ description: >-
+ C++ compiler flags to override.
+
+ optflags:
+ required: false
+ # -O1 is faster than -O3 in our tests... Majority of time are consumed trying
+ # to optimize binaries. Also GitHub Actions run on relatively modern CPUs
+ # compared to, say, GCC 4 or Clang 3. We don't specify `-march=native`
+ # because compilers tend not understand what the CPU is.
+ default: '-O1'
+ description: >-
+ Compiler flags for optimisations.
+
+ cppflags:
+ required: false
+ description: >-
+ Additional preprocessor flags.
+
+ append_configure:
+ required: false
+ default: >-
+ --without-valgrind
+ --without-jemalloc
+ --without-gmp
+ description: >-
+ flags to append to configure.
+
+ enable_shared:
+ required: false
+ default: true
+ description: >-
+ Whether to build libruby.so.
+
+ check:
+ required: false
+ default: ''
+ description: >-
+ Whether to run `make check`
+
+ test_all:
+ required: false
+ default: ''
+ description: >-
+ Whether to run `make test-all` with options for test-all.
+
+ test_spec:
+ required: false
+ default: ''
+ description: >-
+ Whether to run `make test-spec` with options for mspec.
+
+ static_exts:
+ required: false
+ description: >-
+ whitespace separated list of extensions that need be linked statically.
+
+runs:
+ using: composite
+ steps:
+ - shell: bash
+ run: docker pull --quiet "ghcr.io/ruby/ruby-ci-image:${INPUT_TAG}"
+ env:
+ INPUT_TAG: ${{ inputs.tag }}
+
+ - name: Enable Launchable conditionally
+ id: enable-launchable
+ run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
+ shell: bash
+ if: >-
+ ${{
+ github.repository == 'ruby/ruby' ||
+ (github.repository != 'ruby/ruby' && env.LAUNCHABLE_TOKEN)
+ }}
+
+ - name: compile
+ shell: bash
+ run: >-
+ docker run
+ --rm
+ --user=root
+ --volume "${GITHUB_WORKSPACE}:/github/workspace:ro"
+ --workdir=/github/workspace
+ --entrypoint=/github/workspace/.github/actions/compilers/entrypoint.sh
+ --env CI
+ --env GITHUB_ACTION
+ --env INPUT_WITH_GCC
+ --env INPUT_CFLAGS
+ --env INPUT_CXXFLAGS
+ --env INPUT_OPTFLAGS
+ --env INPUT_CPPFLAGS
+ --env INPUT_APPEND_CONFIGURE
+ --env INPUT_CHECK
+ --env INPUT_TEST_ALL
+ --env INPUT_TEST_SPEC
+ --env INPUT_ENABLE_SHARED
+ --env INPUT_STATIC_EXTS
+ --env LAUNCHABLE_ORGANIZATION
+ --env LAUNCHABLE_WORKSPACE
+ --env LAUNCHABLE_ENABLED
+ --env GITHUB_PR_HEAD_SHA
+ --env GITHUB_PULL_REQUEST_URL
+ --env GITHUB_REF
+ --env GITHUB_ACTIONS
+ --env GITHUB_RUN_ID
+ --env GITHUB_REPOSITORY
+ --env GITHUB_WORKFLOW
+ --env GITHUB_RUN_NUMBER
+ --env GITHUB_EVENT_NAME
+ --env GITHUB_SHA
+ --env GITHUB_HEAD_REF
+ --env GITHUB_SERVER_URL
+ "ghcr.io/ruby/ruby-ci-image:${INPUT_TAG}"
+ env:
+ INPUT_TAG: ${{ inputs.tag }}
+ INPUT_WITH_GCC: ${{ inputs.with_gcc || inputs.tag }}
+ INPUT_CFLAGS: ${{ inputs.CFLAGS }}
+ INPUT_CXXFLAGS: ${{ inputs.CXXFLAGS }}
+ INPUT_OPTFLAGS: ${{ inputs.OPTFLAGS }}
+ INPUT_CPPFLAGS: ${{ inputs.cppflags }}
+ INPUT_APPEND_CONFIGURE: ${{ inputs.append_configure }}
+ INPUT_CHECK: ${{ inputs.check }}
+ INPUT_TEST_ALL: ${{ inputs.test_all }}
+ INPUT_TEST_SPEC: ${{ inputs.test_spec }}
+ INPUT_ENABLE_SHARED: ${{ inputs.enable_shared }}
+ INPUT_STATIC_EXTS: ${{ inputs.static_exts }}
+ LAUNCHABLE_ORGANIZATION: ${{ github.repository_owner }}
+ LAUNCHABLE_WORKSPACE: ${{ github.event.repository.name }}
+ LAUNCHABLE_ENABLED: ${{ steps.enable-launchable.outputs.enable-launchable || false }}
+ GITHUB_PR_HEAD_SHA: ${{ github.event.pull_request.head.sha || github.sha }}
+ GITHUB_PULL_REQUEST_URL: ${{ github.event.pull_request.html_url }}
+ GITHUB_REF: ${{ github.ref }}
+
+ # Clean up non-default docker images to save disk space.
+ # The default image (clang-20) is reused across multiple steps
+ # within the same job, so we keep it to avoid redundant pulls.
+ - name: clean up docker image
+ shell: bash
+ run: docker rmi "ghcr.io/ruby/ruby-ci-image:${INPUT_TAG}" || true
+ if: ${{ always() && inputs.tag != 'clang-20' }}
+ env:
+ INPUT_TAG: ${{ inputs.tag }}
diff --git a/.github/actions/compilers/entrypoint.sh b/.github/actions/compilers/entrypoint.sh
new file mode 100755
index 0000000000..b554151091
--- /dev/null
+++ b/.github/actions/compilers/entrypoint.sh
@@ -0,0 +1,90 @@
+#! /bin/bash
+
+# Copyright (c) 2024 Ruby developers. All rights reserved.
+#
+# This file is a part of the programming language Ruby. Permission is hereby
+# granted, to either redistribute and/or modify this file, provided that the
+# conditions mentioned in the file COPYING are met. Consult the file for
+# details.
+
+grouped()
+{
+ echo "::group::${@}"
+ "${@}"
+ echo "::endgroup::"
+}
+
+set -e
+set -u
+set -o pipefail
+
+srcdir="/github/workspace/src"
+builddir="$(mktemp -dt)"
+
+export GITHUB_WORKFLOW='Compilations'
+export CONFIGURE_TTY='never'
+export RUBY_DEBUG='ci rgengc'
+export RUBY_TESTOPTS='-q --color=always --tty=no'
+export RUBY_DEBUG_COUNTER_DISABLE='1'
+export GNUMAKEFLAGS="-j$((1 + $(nproc)))"
+
+case "x${INPUT_ENABLE_SHARED}" in
+x | xno | xfalse )
+ enable_shared='--disable-shared'
+ ;;
+*)
+ enable_shared='--enable-shared'
+ ;;
+esac
+
+pushd ${builddir}
+
+grouped git config --global --add safe.directory ${srcdir}
+
+grouped ${srcdir}/configure \
+ -C \
+ --with-gcc="${INPUT_WITH_GCC}" \
+ --enable-debug-env \
+ --disable-install-doc \
+ --with-ext=-test-/cxxanyargs,+ \
+ --without-git \
+ ${enable_shared} \
+ ${INPUT_APPEND_CONFIGURE} \
+ CFLAGS="${INPUT_CFLAGS}" \
+ CXXFLAGS="${INPUT_CXXFLAGS}" \
+ optflags="${INPUT_OPTFLAGS}" \
+ cppflags="${INPUT_CPPFLAGS}" \
+ debugflags='-ggdb3' # -g0 disables backtraces when SEGV. Do not set that.
+
+popd
+
+if [[ -n "${INPUT_STATIC_EXTS}" ]]; then
+ echo "::group::ext/Setup"
+ set -x
+ mkdir ${builddir}/ext
+ (
+ for ext in ${INPUT_STATIC_EXTS}; do
+ echo "${ext}"
+ done
+ ) >> ${builddir}/ext/Setup
+ set +x
+ echo "::endgroup::"
+fi
+
+if [ -n "$INPUT_TEST_ALL" ]; then
+ tests=" -- $INPUT_TEST_ALL"
+else
+ tests=" -- ruby -ext-"
+fi
+
+pushd ${builddir}
+
+grouped make showflags
+grouped make all
+# grouped make install
+
+# Run only `make test` by default. Run other tests if specified.
+grouped make test
+if [[ -n "$INPUT_CHECK" ]]; then grouped make test-tool; fi
+if [[ -n "$INPUT_CHECK" || -n "$INPUT_TEST_ALL" ]]; then grouped make test-all TESTS="$tests"; fi
+if [[ -n "$INPUT_CHECK" || -n "$INPUT_TEST_SPEC" ]]; then grouped env CHECK_LEAKS=true make test-spec MSPECOPT="$INPUT_TEST_SPEC"; fi
diff --git a/.github/actions/launchable/setup/action.yml b/.github/actions/launchable/setup/action.yml
new file mode 100644
index 0000000000..305878492c
--- /dev/null
+++ b/.github/actions/launchable/setup/action.yml
@@ -0,0 +1,337 @@
+name: Set up Launchable
+description: >-
+ Install the required dependencies and execute the necessary Launchable commands for test recording
+
+inputs:
+ os:
+ required: true
+ description: The operating system that CI runs on. This value is used in Launchable flavor.
+
+ test-opts:
+ default: none
+ required: false
+ description: >-
+ Test options that determine how tests are run.
+ This value is used in the Launchable flavor.
+
+ launchable-token:
+ required: false
+ description: >-
+ Launchable token is needed if you want to run Launchable on your forked repository.
+ See https://github.com/ruby/ruby/wiki/CI-Servers#launchable-ci for details.
+
+ builddir:
+ required: false
+ default: ${{ github.workspace }}
+ description: >-
+ Directory to create Launchable report file.
+
+ srcdir:
+ required: false
+ default: ${{ github.workspace }}
+ description: >-
+ Directory to (re-)checkout source codes. Launchable retrieves the commit information
+ from the directory.
+
+ test-task:
+ required: false
+ default: ${{ matrix.test_task }}
+ description: >-
+ Specifies a single test task to be executed.
+ This value is used in the Launchable flavor.
+ Either 'test-task' or 'multi-test-tasks' must be configured.
+
+ test-tasks:
+ required: false
+ default: '[]'
+ description: >-
+ Specifies an array of multiple test tasks to be executed.
+ For example: '["test", "test-all"]'.
+ If you want to run a single test task, use the 'test-task' input instead.
+
+ is-yjit:
+ required: false
+ default: 'false'
+ description: >-
+ Whether this workflow is executed on YJIT.
+
+ is-zjit:
+ required: false
+ default: 'false'
+ description: >-
+ Whether this workflow is executed on ZJIT.
+
+outputs:
+ stdout_report_path:
+ value: ${{ steps.global.outputs.stdout_report_path }}
+ description: >-
+ Report file path for standard output.
+
+ stderr_report_path:
+ value: ${{ steps.global.outputs.stderr_report_path }}
+ description: >-
+ Report file path for standard error.
+
+runs:
+ using: composite
+
+ steps:
+ - name: Enable Launchable conditionally
+ id: enable-launchable
+ run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
+ shell: bash
+ if: >-
+ ${{
+ (github.repository == 'ruby/ruby'
+ || (github.repository != 'ruby/ruby'
+ && env.LAUNCHABLE_TOKEN))
+ && (inputs.test-task == 'check'
+ || inputs.test-task == 'test-all'
+ || inputs.test-task == 'test'
+ || contains(fromJSON(inputs.test-tasks), 'test-all')
+ || contains(fromJSON(inputs.test-tasks), 'test'))
+ }}
+
+ # Launchable CLI requires Python and Java.
+ # https://www.launchableinc.com/docs/resources/cli-reference/
+ - name: Set up Python
+ uses: actions/setup-python@a26af69be951a213d495a4c3e4e4022e16d87065 # v5.6.0
+ with:
+ python-version: "3.x"
+ if: >-
+ ${{ steps.enable-launchable.outputs.enable-launchable
+ && !endsWith(inputs.os, 'ppc64le') && !endsWith(inputs.os, 's390x') }}
+
+ - name: Set up Java
+ uses: actions/setup-java@c1e323688fd81a25caa38c78aa6df2d33d3e20d9 # v4.8.0
+ with:
+ distribution: 'temurin'
+ java-version: '17'
+ if: >-
+ ${{ steps.enable-launchable.outputs.enable-launchable
+ && !endsWith(inputs.os, 'ppc64le') && !endsWith(inputs.os, 's390x') }}
+
+ - name: Set up Java ppc64le
+ uses: actions/setup-java@c1e323688fd81a25caa38c78aa6df2d33d3e20d9 # v4.8.0
+ with:
+ distribution: 'semeru'
+ architecture: 'ppc64le'
+ java-version: '17'
+ if: >-
+ ${{ steps.enable-launchable.outputs.enable-launchable
+ && endsWith(inputs.os, 'ppc64le') }}
+
+ - name: Set up Java s390x
+ uses: actions/setup-java@c1e323688fd81a25caa38c78aa6df2d33d3e20d9 # v4.8.0
+ with:
+ distribution: 'semeru'
+ architecture: 's390x'
+ java-version: '17'
+ if: >-
+ ${{ steps.enable-launchable.outputs.enable-launchable
+ && endsWith(inputs.os, 's390x') }}
+
+ - name: Set global vars
+ id: global
+ shell: bash
+ run: |
+ test_all_enabled="${{ inputs.test-task == 'check' || inputs.test-task == 'test-all' || contains(fromJSON(inputs.test-tasks), 'test-all') }}"
+ btest_enabled="${{ inputs.test-task == 'check' || inputs.test-task == 'test' || contains(fromJSON(inputs.test-tasks), 'test') }}"
+ test_spec_enabled="${{ inputs.test-task == 'check' || inputs.test-task == 'test-spec' || contains(fromJSON(inputs.test-tasks), 'test-spec') }}"
+ echo test_all_enabled="${test_all_enabled}" >> $GITHUB_OUTPUT
+ echo btest_enabled="${btest_enabled}" >> $GITHUB_OUTPUT
+ echo test_spec_enabled="${test_spec_enabled}" >> $GITHUB_OUTPUT
+ echo test_all_report_file='launchable_test_all_report.json' >> $GITHUB_OUTPUT
+ echo btest_report_file='launchable_btest_report.json' >> $GITHUB_OUTPUT
+ echo test_spec_report_dir='launchable_test_spec_report' >> $GITHUB_OUTPUT
+ echo stdout_report_path="launchable_stdout.log" >> $GITHUB_OUTPUT
+ echo stderr_report_path="launchable_stderr.log" >> $GITHUB_OUTPUT
+ if: steps.enable-launchable.outputs.enable-launchable
+
+ - name: Set environment variables for Launchable
+ shell: bash
+ run: | # zizmor: ignore[github-env]
+ : # GITHUB_PULL_REQUEST_URL are used for commenting test reports in Launchable Github App.
+ : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/link.py#L42
+ echo "GITHUB_PULL_REQUEST_URL=${INPUT_PR_HTML_URL}" >> $GITHUB_ENV
+ : # The following envs are necessary in Launchable tokenless authentication.
+ : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L20
+ echo "LAUNCHABLE_ORGANIZATION=${INPUT_REPOSITORY_OWNER}" >> $GITHUB_ENV
+ echo "LAUNCHABLE_WORKSPACE=${INPUT_REPOSITORY_NAME}" >> $GITHUB_ENV
+ : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L71
+ echo "GITHUB_PR_HEAD_SHA=${INPUT_PR_HEAD_SHA}" >> $GITHUB_ENV
+ echo "LAUNCHABLE_TOKEN=${INPUT_LAUNCHABLE_TOKEN}" >> $GITHUB_ENV
+ : # To prevent a slowdown in CI, disable request retries when the Launchable server is unstable.
+ echo "LAUNCHABLE_SKIP_TIMEOUT_RETRY=1" >> $GITHUB_ENV
+ echo "LAUNCHABLE_COMMIT_TIMEOUT=1" >> $GITHUB_ENV
+ env:
+ INPUT_PR_HTML_URL: ${{ github.event.pull_request.html_url }}
+ INPUT_REPOSITORY_OWNER: ${{ github.repository_owner }}
+ INPUT_REPOSITORY_NAME: ${{ github.event.repository.name }}
+ INPUT_PR_HEAD_SHA: ${{ github.event.pull_request.head.sha || github.sha }}
+ INPUT_LAUNCHABLE_TOKEN: ${{ inputs.launchable-token }}
+ if: steps.enable-launchable.outputs.enable-launchable
+
+ - name: Set up path
+ shell: bash
+ working-directory: ${{ inputs.srcdir }}
+ # Since updated PATH variable will be available in only subsequent actions, we need to add the path beforehand.
+ # https://docs.github.com/en/actions/using-workflows/workflow-commands-for-github-actions#adding-a-system-path
+ run: echo "$(python -msite --user-base)/bin" >> $GITHUB_PATH # zizmor: ignore[github-env]
+ if: >-
+ ${{
+ steps.enable-launchable.outputs.enable-launchable
+ && (startsWith(inputs.os, 'macos')
+ || endsWith(inputs.os, 'ppc64le')
+ || endsWith(inputs.os, 's390x'))
+ }}
+
+ - name: Set up Launchable
+ id: setup-launchable
+ shell: bash
+ working-directory: ${{ inputs.srcdir }}
+ run: | # zizmor: ignore[github-env]
+ set -x
+ pip install --user launchable
+ : # The build name cannot include a slash, so we replace the string here.
+ github_ref="${INPUT_GITHUB_REF}"
+ github_ref="${github_ref//\//_}"
+ : # With the --name option, we need to configure a unique identifier for this build.
+ : # To avoid setting the same build name as the CI which runs on other branches, we use the branch name here.
+ build_name="${github_ref}_${GITHUB_PR_HEAD_SHA}"
+ test_opts="${INPUT_TEST_OPTS}"
+ test_opts="${test_opts// /}"
+ test_opts="${test_opts//=/:}"
+ test_all_test_suite='test-all'
+ btest_test_suite='btest'
+ test_spec_test_suite='test-spec'
+ if [ "${INPUT_IS_YJIT}" = "true" ]; then
+ test_all_test_suite="yjit-${test_all_test_suite}"
+ btest_test_suite="yjit-${btest_test_suite}"
+ test_spec_test_suite="yjit-${test_spec_test_suite}"
+ fi
+ if [ "${INPUT_IS_ZJIT}" = "true" ]; then
+ test_all_test_suite="zjit-${test_all_test_suite}"
+ btest_test_suite="zjit-${btest_test_suite}"
+ test_spec_test_suite="zjit-${test_spec_test_suite}"
+ fi
+ # launchable_setup target var -- refers ${target} prefixed variables
+ launchable_setup() {
+ local target=$1 session
+ eval [ "\${${target}_enabled}" = "true" ] || return
+ eval local suite=\${${target}_test_suite}
+ session=$(launchable record session \
+ --build "${build_name}" \
+ --observation \
+ --flavor os="${INPUT_OS}" \
+ --flavor test_task="${INPUT_TEST_TASK}" \
+ --flavor test_opts="${test_opts}" \
+ --flavor workflow="${INPUT_WORKFLOW}" \
+ --test-suite ${suite} \
+ )
+ echo "${target}_session=${session}" >> $GITHUB_OUTPUT
+ }
+
+ launchable record build --name "${build_name}"
+ if launchable_setup test_all; then
+ echo "TESTS=${TESTS:+$TESTS }--launchable-test-reports=${test_all_report_file}" >> $GITHUB_ENV
+ fi
+ if launchable_setup btest; then
+ echo "BTESTS=${BTESTS:+$BTESTS }--launchable-test-reports=${btest_report_file}" >> $GITHUB_ENV
+ fi
+ if launchable_setup test_spec; then
+ echo "SPECOPTS=${SPECOPTS:$SPECOPTS }--launchable-test-reports=${test_spec_report_dir}" >> $GITHUB_ENV
+ echo test_spec_enabled=true >> $GITHUB_OUTPUT
+ fi
+
+ echo launchable_setup_dir=$(pwd) >> $GITHUB_OUTPUT
+ if: steps.enable-launchable.outputs.enable-launchable
+ env:
+ INPUT_GITHUB_REF: ${{ github.ref }}
+ INPUT_TEST_OPTS: ${{ inputs.test-opts }}
+ INPUT_IS_YJIT: ${{ inputs.is-yjit }}
+ INPUT_IS_ZJIT: ${{ inputs.is-zjit }}
+ INPUT_OS: ${{ inputs.os }}
+ INPUT_TEST_TASK: ${{ inputs.test-task }}
+ INPUT_WORKFLOW: ${{ github.workflow }}
+ test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
+ btest_enabled: ${{ steps.global.outputs.btest_enabled }}
+ test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
+ test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+ btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+ test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+ - name: make test-spec report directory in build directory
+ shell: bash
+ working-directory: ${{ inputs.builddir }}
+ run: mkdir "${test_spec_report_dir}"
+ if: ${{ steps.setup-launchable.outputs.test_spec_enabled == 'true' }}
+ env:
+ test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+ - name: Clean up test results in Launchable
+ uses: gacts/run-and-post-run@81b6ce503cde93862cec047c54652e45c5dca991 # v1.4.3
+ with:
+ shell: bash
+ working-directory: ${{ inputs.builddir }}
+ post: |
+ rm -f "${test_all_report_file}"
+ rm -f "${btest_report_file}"
+ rm -fr "${test_spec_report_dir}"
+ rm -f launchable_stdout.log
+ rm -f launchable_stderr.log
+ if: always() && steps.setup-launchable.outcome == 'success'
+ env:
+ test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+ btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+ test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+ - name: Record test results in Launchable
+ uses: gacts/run-and-post-run@81b6ce503cde93862cec047c54652e45c5dca991 # v1.4.3
+ with:
+ shell: bash
+ working-directory: ${{ inputs.builddir }}
+ post: |
+ if [[ "${test_all_enabled}" = "true" ]]; then \
+ launchable record attachment \
+ --session "${test_all_session}" \
+ "${stdout_report_path}" \
+ "${stderr_report_path}"; \
+ launchable record tests \
+ --session "${test_all_session}" \
+ raw "${test_all_report_file}" || true; \
+ fi
+
+ if [[ "${btest_enabled}" = "true" ]]; then \
+ launchable record attachment \
+ --session "${btest_session}" \
+ "${stdout_report_path}" \
+ "${stderr_report_path}"; \
+ launchable record tests \
+ --session "${btest_session}" \
+ raw "${btest_report_file}" || true; \
+ fi
+
+ if [[ "${test_spec_enabled}" = "true" ]]; then \
+ launchable record attachment \
+ --session "${test_spec_session}" \
+ "${stdout_report_path}" \
+ "${stderr_report_path}"; \
+ launchable record tests \
+ --session "${test_spec_session}" \
+ raw ${test_spec_report_dir}/* || true; \
+ fi
+ if: ${{ always() && steps.setup-launchable.outcome == 'success' }}
+ env:
+ test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+ btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+ test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+ test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
+ btest_enabled: ${{ steps.global.outputs.btest_enabled }}
+ test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
+ test_all_session: ${{ steps.setup-launchable.outputs.test_all_session }}
+ btest_session: ${{ steps.setup-launchable.outputs.btest_session }}
+ test_spec_session: ${{ steps.setup-launchable.outputs.test_spec_session }}
+ stdout_report_path: ${{ steps.global.outputs.stdout_report_path }}
+ stderr_report_path: ${{ steps.global.outputs.stderr_report_path }}
+ LAUNCHABLE_SETUP_DIR: ${{ steps.setup-launchable.outputs.launchable_setup_dir }}
diff --git a/.github/actions/make-snapshot/action.yml b/.github/actions/make-snapshot/action.yml
new file mode 100644
index 0000000000..4552f0e067
--- /dev/null
+++ b/.github/actions/make-snapshot/action.yml
@@ -0,0 +1,77 @@
+name: 'make-snapshot'
+description: 'Make snapshot tarballs'
+inputs:
+ archname:
+ description: 'archname passed to tool/make-snapshot (e.g. snapshot-master)'
+ required: true
+ version:
+ description: 'Target Version'
+ required: false
+ shallow-since:
+ description: 'git fetch --shallow-since'
+ required: true
+ default: '2018-12-25 00:00:00'
+ fetch-branch:
+ description: 'fetch branch'
+ required: false
+ srcdir:
+ description: 'srcdir for tool/make-snapshot. Empty = clone ruby/ruby into ./ruby.'
+ required: false
+ default: ''
+ upload-artifact:
+ description: 'Upload Packages and Info as workflow artifacts. Pass "false" when callers run in a matrix that would collide on artifact names.'
+ required: false
+ default: 'true'
+
+runs:
+ using: "composite"
+ steps:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential git bison autoconf ruby p7zip-full curl
+ shell: bash
+ - name: Checkout ruby/ruby for tool/make-snapshot
+ if: inputs.srcdir == ''
+ run: git clone --single-branch --depth=1 https://github.com/ruby/ruby ruby
+ shell: bash
+ - name: Fetch branches and notes (clone mode)
+ if: inputs.srcdir == ''
+ env:
+ SHALLOW_SINCE: ${{ inputs.shallow-since }}
+ FETCH_BRANCH: ${{ inputs.fetch-branch }}
+ run: |
+ set -x
+ cd ruby
+ git fetch --shallow-since="$SHALLOW_SINCE"
+ [ -n "$FETCH_BRANCH" ] && git fetch origin "+$FETCH_BRANCH:$FETCH_BRANCH"
+ git fetch origin '+refs/notes/commits:refs/notes/commits'
+ git fetch origin '+refs/notes/log-fix:refs/notes/log-fix'
+ shell: bash
+ - name: Fetch notes (local srcdir mode)
+ if: inputs.srcdir != ''
+ working-directory: ${{ inputs.srcdir }}
+ run: |
+ git fetch origin '+refs/notes/commits:refs/notes/commits' || :
+ git fetch origin '+refs/notes/log-fix:refs/notes/log-fix' || :
+ shell: bash
+ - name: Make snapshot
+ env:
+ ARCHNAME: ${{ inputs.archname }}
+ SRCDIR: ${{ inputs.srcdir }}
+ VERSION: ${{ inputs.version }}
+ run: |
+ [ -z "$SRCDIR" ] && SRCDIR=ruby
+ ruby "$SRCDIR/tool/make-snapshot" "-archname=$ARCHNAME" -srcdir="$SRCDIR" -packages=gzip,xz,zip pkg $VERSION
+ shell: bash
+ - uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+ with:
+ name: Packages
+ path: pkg
+ if: ${{ inputs.upload-artifact == 'true' }}
+ - uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+ with:
+ name: Info
+ path: pkg/info
+ if: ${{ inputs.upload-artifact == 'true' }}
diff --git a/.github/actions/setup/baseruby/action.yml b/.github/actions/setup/baseruby/action.yml
new file mode 100644
index 0000000000..76fe068897
--- /dev/null
+++ b/.github/actions/setup/baseruby/action.yml
@@ -0,0 +1,73 @@
+name: Setup directories etc.
+description: >-
+ Build baseruby for cross-compiling
+
+inputs:
+ srcdir:
+ required: true
+ default: ${{ github.workspace }}
+ description: >-
+ Directory of source codes.
+
+ builddir:
+ required: false
+ default: ${{ github.workspace }}/baseruby
+ description: >-
+ Where baseruby will be built.
+
+ installdir:
+ required: false
+ default: install
+ description: >-
+ The path where the baseruby will be installed to.
+ This is relative from the workspace.
+
+outputs:
+ ruby:
+ value: ${{ steps.build.outputs.installdir }}/bin/ruby
+ description: >-
+ The path of the executable baseruby.
+ dump_ast:
+ value: ${{ steps.build.outputs.installdir }}/bin/dump_ast
+ description: >-
+ The path of the executable dump_ast.
+
+runs:
+ using: composite
+
+ steps:
+ - name: Build baseruby
+ shell: bash
+ id: build
+ run: |
+ case "$installdir" in /*) ;; *) installdir="$PWD/$installdir";; esac
+ mkdir "$builddir"
+ ln -sr "$srcdir" "$builddir/.src"
+ pushd "$builddir"
+ .src/configure "--prefix=${installdir}" --disable-install-doc
+ CONFIGURE_ARGS=--with-out-ext=-test- make install
+ install dump_ast "${installdir}/bin"
+ {
+ echo "${installdir}/bin/dump_ast"
+ echo "${installdir}/.installed.list"
+ echo "${installdir}/"
+ } >> .installed.list
+ cp .installed.list "${installdir}/"
+ make distclean
+ rm .src
+ popd
+ rmdir "$builddir"
+ {
+ echo "installdir=${installdir}"
+ } | tee -a "$GITHUB_OUTPUT"
+ env:
+ srcdir: ${{ inputs.srcdir }}
+ builddir: ${{ inputs.builddir }}
+ installdir: ${{ inputs.installdir }}
+
+ - name: clean
+ uses: gacts/run-and-post-run@598d7a875d5620e0457490555b5e18e46082aa47 # v1.4.4
+ with:
+ working-directory: ${{ inputs.srcdir }}
+ post: |
+ ruby tool/rbuninstall.rb "${{ steps.build.outputs.installdir }}/.installed.list" > /dev/null
diff --git a/.github/actions/setup/directories/action.yml b/.github/actions/setup/directories/action.yml
new file mode 100644
index 0000000000..15dc097b6e
--- /dev/null
+++ b/.github/actions/setup/directories/action.yml
@@ -0,0 +1,205 @@
+name: Setup directories etc.
+description: >-
+ Set up the source code and build directories (plus some
+ environmental tweaks)
+
+inputs:
+ srcdir:
+ required: false
+ default: ${{ github.workspace }}
+ description: >-
+ Directory to (re-)checkout source codes. This will be created
+ if absent. If there is no `configure` file that is also
+ generated inside.
+
+ builddir:
+ required: false
+ default: ${{ github.workspace }}
+ description: >-
+ Where binaries and other generated contents go. This will be
+ created if absent.
+
+ make-command:
+ required: false
+ type: string
+ default: 'make'
+ description: >-
+ The command of `make`.
+
+ makeup:
+ required: false
+ type: boolean
+ # Note that `default: false` evaluates to a string constant
+ # `'false'`, which is a truthy value :sigh:
+ # https://github.com/actions/runner/issues/2238
+ default: ''
+ description: >-
+ If set to true, additionally runs `make up`.
+
+ checkout:
+ required: false
+ type: boolean
+ default: true
+ description: >-
+ If set to '' (false), skip running actions/checkout. This is useful when
+ you don't want to overwrite a GitHub token that is already set up.
+
+ dummy-files:
+ required: false
+ type: boolean
+ default: ''
+ description: >-
+ If set to true, creates dummy files in build dir.
+
+ fetch-depth:
+ required: false
+ default: '1'
+ description: The depth of commit history fetched from the remote repository
+
+ clean:
+ required: false
+ type: boolean
+ default: ''
+ description: >-
+ If set to true, clean build directory.
+
+outputs: {} # nothing?
+
+runs:
+ using: composite
+
+ steps:
+ # Note that `shell: bash` works on both Windows and Linux, but not
+ # `shell: sh`. This is because GitHub hosted Windows runners have
+ # their bash manually installed.
+ - shell: bash
+ run: |
+ mkdir -p "${INPUT_SRCDIR}"
+ mkdir -p "${INPUT_BUILDDIR}"
+ env:
+ INPUT_SRCDIR: ${{ inputs.srcdir }}
+ INPUT_BUILDDIR: ${{ inputs.builddir }}
+
+ # Did you know that actions/checkout works without git(1)? We are
+ # checking that here.
+ - id: which
+ shell: bash
+ run: |
+ echo "git=`command -v git`" >> "$GITHUB_OUTPUT"
+ echo "sudo=`sudo true && command -v sudo`" >> "$GITHUB_OUTPUT"
+ echo "autoreconf=`command -v autoreconf`" >> "$GITHUB_OUTPUT"
+
+ - if: steps.which.outputs.git
+ shell: bash
+ run: |
+ git config --global core.autocrlf false
+ git config --global core.eol lf
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+
+ - if: inputs.checkout
+ uses: actions/checkout@df4cb1c069e1874edd31b4311f1884172cec0e10 # v6.0.3
+ with:
+ path: ${{ inputs.srcdir }}
+ fetch-depth: ${{ inputs.fetch-depth }}
+ persist-credentials: false
+
+ - uses: actions/cache@27d5ce7f107fe9357f9df03efb73ab90386fccae # v5.0.5
+ with:
+ path: ${{ inputs.srcdir }}/.downloaded-cache
+ key: ${{ runner.os }}-${{ runner.arch }}-downloaded-cache
+
+ - if: steps.which.outputs.autoreconf
+ shell: bash
+ working-directory: ${{ inputs.srcdir }}
+ run: ./autogen.sh --install
+
+ # This is for MinGW.
+ - if: runner.os == 'Windows'
+ shell: bash
+ run: echo "GNUMAKEFLAGS=-j$((2 * NUMBER_OF_PROCESSORS))" >> $GITHUB_ENV # zizmor: ignore[github-env]
+
+ - if: runner.os == 'Linux'
+ shell: bash
+ run: echo "GNUMAKEFLAGS=-sj$((1 + $(nproc)))" >> "$GITHUB_ENV" # zizmor: ignore[github-env]
+
+ # macOS' GNU make is so old that they doesn't understand `GNUMAKEFLAGS`.
+ - if: runner.os == 'macOS'
+ shell: bash
+ run: echo "MAKEFLAGS=-j$((1 + $(sysctl -n hw.activecpu)))" >> "$GITHUB_ENV" # zizmor: ignore[github-env]
+
+ - if: inputs.makeup
+ shell: bash
+ working-directory: ${{ inputs.srcdir }}
+ run: |
+ touch config.status .rbconfig.time
+ for mk in Makefile GNUmakefile; do
+ sed -f tool/prereq.status template/$mk.in > $mk
+ done
+ make up
+
+ # Cleanup, runs even on failure
+ - if: always() && inputs.makeup
+ shell: bash
+ working-directory: ${{ inputs.srcdir }}
+ run: |
+ rm -f config.status .rbconfig.time \
+ Makefile GNUmakefile uncommon.mk enc.mk noarch-fake.rb
+ rm -f prism/.time prism/util/.time
+
+ - if: steps.which.outputs.sudo
+ shell: bash
+ run: |
+ sudo chmod -R go-w /usr/share
+ chmod -v go-w $HOME $HOME/.config || :
+ declare -a dirs # -A is not supported by old bash, e.g. macos
+ SAVE_IFS="$IFS" IFS=:; set $PATH
+ for d do
+ while [ -d "$d" ]; do
+ case "$IFS${dirs[*]}$IFS" in *"$IFS$d$IFS"*) ;; *) dirs+=("$d");; esac
+ d="${d%/*}"
+ done
+ done
+ IFS="$SAVE_IFS"
+ sudo chmod -v go-w "${dirs[@]}" || :
+
+ - if: inputs.dummy-files == 'true'
+ shell: bash
+ id: dummy-files
+ working-directory: ${{ inputs.builddir }}
+ run: |
+ : Create dummy files in build dir
+ set {{a..z},{A..Z},{0..9},foo,bar,test,zzz}.rb
+ for file; do \
+ echo > $file "raise 'do not load $file'"; \
+ done
+ # drop {a..z}.rb if case-insensitive filesystem
+ grep -F A.rb a.rb > /dev/null && set "${@:27}"
+ echo clean="cd ${INPUT_BUILDDIR} && rm $*" >> $GITHUB_OUTPUT
+ env:
+ INPUT_BUILDDIR: ${{ inputs.builddir }}
+
+ - if: inputs.clean == 'true'
+ shell: bash
+ id: clean
+ run: |
+ echo distclean="cd ${INPUT_BUILDDIR} && ${INPUT_MAKE_COMMAND} distclean" >> $GITHUB_OUTPUT
+ echo remained-files="find ${INPUT_BUILDDIR} -ls" >> $GITHUB_OUTPUT
+ [ "${INPUT_BUILDDIR}" = "${INPUT_SRCDIR}" ] ||
+ echo final="rmdir ${INPUT_BUILDDIR}" >> $GITHUB_OUTPUT
+ env:
+ INPUT_BUILDDIR: ${{ inputs.builddir }}
+ INPUT_SRCDIR: ${{ inputs.srcdir }}
+ INPUT_MAKE_COMMAND: ${{ inputs.make-command }}
+
+ - name: clean
+ uses: gacts/run-and-post-run@598d7a875d5620e0457490555b5e18e46082aa47 # v1.4.4
+ with:
+ working-directory:
+ post: |
+ ${{ steps.dummy-files.outputs.clean }}
+ ${{ steps.clean.outputs.distclean }}
+ ${{ steps.clean.outputs.remained-files }}
+ ${{ steps.clean.outputs.final }}
+ # rmdir randomly fails due to launchable files
+ continue-on-error: true
diff --git a/.github/actions/setup/macos/action.yml b/.github/actions/setup/macos/action.yml
new file mode 100644
index 0000000000..9cd37a9b12
--- /dev/null
+++ b/.github/actions/setup/macos/action.yml
@@ -0,0 +1,29 @@
+name: Setup macOS environment
+description: >-
+ Installs necessary packages via Homebrew.
+
+inputs: {} # nothing?
+
+outputs: {} # nothing?
+
+runs:
+ using: composite
+
+ steps:
+ - name: brew
+ shell: bash
+ run: |
+ brew install --quiet jemalloc gmp libffi openssl@3 zlib autoconf automake libtool
+
+ - name: Set ENV
+ shell: bash
+ run: | # zizmor: ignore[github-env]
+ dir_config() {
+ local args=() lib var="$1"; shift
+ for lib in "$@"; do
+ args+=("--with-${lib%@*}-dir=$(brew --prefix $lib)")
+ done
+ echo "$var=${args[*]}" >> $GITHUB_ENV
+ }
+ dir_config ruby_configure_args gmp
+ dir_config CONFIGURE_ARGS openssl@3
diff --git a/.github/actions/setup/ubuntu/action.yml b/.github/actions/setup/ubuntu/action.yml
new file mode 100644
index 0000000000..5209ccc03f
--- /dev/null
+++ b/.github/actions/setup/ubuntu/action.yml
@@ -0,0 +1,72 @@
+name: Setup ubuntu environment
+description: >-
+ At the beginning there was no way but to copy & paste `apt-get`
+ everywhere. But now that we have composite actions, it seems better
+ merge them into one.
+
+inputs:
+ arch:
+ required: false
+ default: ''
+ description: >-
+ Architecture. Because we run this on a GitHub-hosted runner
+ acceptable value for this input is very limited.
+
+outputs:
+ arch:
+ value: ${{ steps.uname.outputs.uname }}
+ description: >-
+ Actual architecture. This could be different from the one
+ passed to the `inputs.arch`. For instance giving `i386` to this
+ action yields `i686`.
+
+runs:
+ using: composite
+
+ steps:
+ - id: uname
+ name: uname
+ shell: bash
+ env:
+ arch: ${{ inputs.arch }}
+ run: |
+ setarch="${arch:+setarch $arch --}"
+ # normalize `uname`
+ if uname=$(${setarch} uname -m 2> /dev/null); then
+ # `setarch` works, `$arch` is a valid architecture name.
+ echo "setarch=${setarch}" >> "$GITHUB_OUTPUT"
+ else
+ # if `setarch` failed, take the given `arch` as-is.
+ uname="${arch}"
+ setarch=""
+ fi
+ echo "uname=$uname" >> "$GITHUB_OUTPUT"
+ echo "dpkg=${uname/686/386}" >> "$GITHUB_OUTPUT"
+
+ - name: set SETARCH
+ shell: bash
+ run: echo "SETARCH=${setarch}" >> "$GITHUB_ENV" # zizmor: ignore[github-env]
+ env:
+ setarch: ${{ steps.uname.outputs.setarch }} # validated
+
+ - name: dpkg setup
+ shell: bash
+ run: sudo dpkg --add-architecture "${dpkg}"
+ # `dpkg` is valid, also `uname`.
+ if: ${{ inputs.arch }}
+ env:
+ dpkg: ${{ steps.uname.outputs.dpkg }}
+
+ - name: apt-get
+ shell: bash
+ env:
+ arch: ${{ inputs.arch && format(':{0}', steps.uname.outputs.dpkg) || '' }}
+ run: |
+ set -x
+ sudo apt-get update -qq || :
+ sudo apt-get install --no-install-recommends -qq -y -o=Dpkg::Use-Pty=0 \
+ ${arch:+cross}build-essential${arch/:/-} \
+ libssl-dev${arch} libyaml-dev${arch} libreadline6-dev${arch} \
+ zlib1g-dev${arch} libncurses5-dev${arch} libffi-dev${arch} \
+ autoconf ruby
+ sudo apt-get install -qq -y pkg-config${arch} || :
diff --git a/.github/actions/slack/action.yml b/.github/actions/slack/action.yml
new file mode 100644
index 0000000000..6f89bef11a
--- /dev/null
+++ b/.github/actions/slack/action.yml
@@ -0,0 +1,51 @@
+name: Post a message to slack
+description: >-
+ We have our ruby/action-slack webhook. However its arguments are
+ bit verbose to be listed in every workflow files. Better merge them
+ into one.
+
+inputs:
+ SLACK_WEBHOOK_URL:
+ required: true
+ description: >-
+ The URL to post the payload. This is an input because it tends
+ to be stored in a secrets vault and a composite action cannot
+ look into one.
+
+ label:
+ required: false
+ description: >-
+ Human-readable description of the run, something like "DEBUG=1".
+ This need not be unique among runs.
+
+ event_name:
+ required: false
+ default: 'push'
+ description: >-
+ Target event to trigger notification. Notify only push by default.
+
+ extra_channel_id:
+ required: false
+ description: >-
+ Slack channel ID to notify besides #alerts and #alerts-emoji.
+
+outputs: {} # Nothing?
+
+runs:
+ using: composite
+
+ steps:
+ - uses: ruby/action-slack@d260b61aa817726d5bedd22dd6cc305787fa4cdd # v4.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }}${{ inputs.label && format(' / {0}', inputs.label) }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ ${{ inputs.extra_channel_id && format(', "extra_channel_id": "{0}"', inputs.extra_channel_id) }}
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ inputs.SLACK_WEBHOOK_URL }}
+ if: ${{ github.event_name == inputs.event_name && startsWith(github.repository, 'ruby/') }}
diff --git a/.github/auto_request_review.yml b/.github/auto_request_review.yml
new file mode 100644
index 0000000000..9e20cb7459
--- /dev/null
+++ b/.github/auto_request_review.yml
@@ -0,0 +1,21 @@
+files:
+ 'yjit*': [team:jit]
+ 'yjit/**/*': [team:jit]
+ 'yjit/src/cruby_bindings.inc.rs': []
+ 'bootstraptest/test_yjit*': [team:jit]
+ 'test/ruby/test_yjit*': [team:jit]
+ 'zjit*': [team:jit]
+ 'zjit/**/*': [team:jit]
+ 'zjit/src/cruby_bindings.inc.rs': []
+ 'test/ruby/test_zjit*': [team:jit]
+ 'defs/jit.mk': [team:jit]
+ 'tool/zjit_bisect.rb': [team:jit]
+ 'doc/jit/*': [team:jit]
+ # Skip files updated by dependabot. It's noisy in notifications, and they're auto-merged anyway.
+ 'yjit/Cargo.lock': []
+ 'zjit/Cargo.lock': []
+ '.github/workflows/yjit-*.yml': []
+ '.github/workflows/zjit-*.yml': []
+options:
+ ignore_draft: true
+ last_files_match_only: true
diff --git a/.github/codeql/codeql-config.yml b/.github/codeql/codeql-config.yml
index 7196708b21..f5d33545c1 100644
--- a/.github/codeql/codeql-config.yml
+++ b/.github/codeql/codeql-config.yml
@@ -1,4 +1,22 @@
-name: "CodeQL config for the Ruby language"
-
paths-ignore:
- - '/ext/**/*/conftest.c'
+ - benchmark
+ - sample
+ - spec/ruby/command_line/fixtures
+ - spec/ruby/core/enumerable/shared/inject.rb
+ - spec/ruby/core/exception/fixtures
+ - spec/ruby/core/proc/parameters_spec.rb
+ - spec/ruby/core/proc/ruby2_keywords_spec.rb
+ - spec/ruby/core/range/reverse_each_spec.rb
+ - spec/ruby/language/fixtures
+ - spec/ruby/language/lambda_spec.rb
+ - spec/ruby/language/method_spec.rb
+ - spec/ruby/language/string_spec.rb
+ - test/error_highlight/test_error_highlight.rb
+ - test/prism/result/named_capture_test.rb
+ - test/ruby/test_call.rb
+ - test/ruby/test_signal.rb
+ - test/ruby/test_super.rb
+ - test/ruby/test_syntax.rb
+ - test/ruby/test_unicode_escape.rb
+ - test/rubygems/specifications/foo-0.0.1-x86-mswin32.gemspec
+ - trace_point.rb
diff --git a/.github/dependabot.yml b/.github/dependabot.yml
new file mode 100644
index 0000000000..57da742e5c
--- /dev/null
+++ b/.github/dependabot.yml
@@ -0,0 +1,29 @@
+version: 2
+updates:
+ - package-ecosystem: 'github-actions'
+ directories:
+ - '/'
+ - '/.github/actions/slack'
+ - '/.github/actions/setup/directories'
+ schedule:
+ interval: 'daily'
+ groups:
+ github-actions:
+ patterns:
+ - "*"
+ - package-ecosystem: 'cargo'
+ directories:
+ - '/yjit'
+ - '/zjit'
+ exclude-paths:
+ - 'gc/mmtk/**'
+ schedule:
+ interval: 'monthly'
+ groups:
+ jit:
+ patterns:
+ - "*"
+ - package-ecosystem: 'vcpkg'
+ directory: '/'
+ schedule:
+ interval: 'daily'
diff --git a/.github/labeler.yml b/.github/labeler.yml
new file mode 100644
index 0000000000..f39fcec386
--- /dev/null
+++ b/.github/labeler.yml
@@ -0,0 +1,7 @@
+Documentation:
+- changed-files:
+ - all-globs-to-all-files: doc/**
+
+Backport:
+- base-branch: 'ruby_3_\d'
+- base-branch: 'ruby_4_\d'
diff --git a/.github/workflows/annocheck.yml b/.github/workflows/annocheck.yml
new file mode 100644
index 0000000000..5991165d43
--- /dev/null
+++ b/.github/workflows/annocheck.yml
@@ -0,0 +1,111 @@
+name: Annocheck
+
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man/*'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ - '.*.yml'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man/*'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ - '.*.yml'
+ merge_group:
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ compile:
+ name: test-annocheck
+
+ runs-on: ubuntu-latest
+
+ container:
+ image: ghcr.io/ruby/ruby-ci-image:gcc-11
+ options: --user root
+
+ if: >-
+ ${{!(false
+ || contains(github.event.head_commit.message, '[DOC]')
+ || contains(github.event.pull_request.title, '[DOC]')
+ || contains(github.event.pull_request.labels.*.name, 'Documentation')
+ || (github.event.pull_request.user.login == 'dependabot[bot]')
+ )}}
+
+ env:
+ CONFIGURE_TTY: never
+ GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+ RUBY_DEBUG: ci rgengc
+ RUBY_TESTOPTS: >-
+ -q
+ --color=always
+ --tty=no
+ # FIXME: Drop skipping options
+ # https://bugs.ruby-lang.org/issues/18061
+ # https://sourceware.org/annobin/annobin.html/Test-pie.html
+ TEST_ANNOCHECK_OPTS: '--skip-pie --skip-gaps'
+
+ steps:
+ - run: id
+ working-directory:
+
+ - uses: actions/checkout@df4cb1c069e1874edd31b4311f1884172cec0e10 # v6.0.3
+ with:
+ sparse-checkout-cone-mode: false
+ sparse-checkout: /.github
+ persist-credentials: false
+
+ - uses: ./.github/actions/setup/directories
+ with:
+ srcdir: src
+ builddir: build
+ makeup: true
+
+ - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+ with:
+ ruby-version: '3.1'
+ bundler: none
+
+ # Minimal flags to pass the check.
+ # -g0 disables backtraces when SEGV. Do not set that.
+ - name: Run configure
+ run: >
+ ../src/configure -C
+ --enable-debug-env
+ --disable-install-doc
+ --with-ext=-test-/cxxanyargs,+
+ --without-valgrind
+ --without-jemalloc
+ --without-gmp
+ --with-gcc="gcc-11 -fcf-protection -Wa,--generate-missing-build-notes=yes"
+ --enable-shared
+ debugflags=-ggdb3
+ optflags=-O2
+ LDFLAGS=-Wl,-z,now
+
+ - run: make showflags
+
+ - run: make
+
+ - run: make test-annocheck
+
+ - uses: ./.github/actions/slack
+ with:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/auto_request_review.yml b/.github/workflows/auto_request_review.yml
new file mode 100644
index 0000000000..1be2b11b86
--- /dev/null
+++ b/.github/workflows/auto_request_review.yml
@@ -0,0 +1,20 @@
+name: Auto Request Review
+on:
+ pull_request_target:
+ types: [opened, ready_for_review, reopened]
+ branches: [master]
+
+permissions:
+ contents: read
+
+jobs:
+ auto-request-review:
+ name: Auto Request Review
+ runs-on: ubuntu-latest
+ if: ${{ github.repository == 'ruby/ruby' && github.base_ref == 'master' }}
+ steps:
+ - name: Request review based on files changes and/or groups the author belongs to
+ uses: necojackarc/auto-request-review@5d3060495e58e9cb41f51de50e808d3135d5374e # master
+ with:
+ # scope: public_repo
+ token: ${{ secrets.MATZBOT_AUTO_REQUEST_REVIEW_TOKEN }}
diff --git a/.github/workflows/auto_review_pr.yml b/.github/workflows/auto_review_pr.yml
new file mode 100644
index 0000000000..bb84a51573
--- /dev/null
+++ b/.github/workflows/auto_review_pr.yml
@@ -0,0 +1,41 @@
+name: Auto Review PR
+on:
+ pull_request_target:
+ types: [opened, ready_for_review, reopened]
+ branches: [master]
+ workflow_dispatch:
+ inputs:
+ pr_number:
+ description: 'PR number to review'
+ required: true
+ type: number
+
+permissions:
+ contents: read
+
+jobs:
+ auto-review-pr:
+ name: Auto Review PR
+ runs-on: ubuntu-latest
+ if: ${{ github.repository == 'ruby/ruby' && (github.base_ref == 'master' || github.event_name == 'workflow_dispatch') }}
+
+ permissions:
+ pull-requests: write
+ contents: read
+
+ steps:
+ - name: Checkout repository
+ uses: actions/checkout@df4cb1c069e1874edd31b4311f1884172cec0e10 # v6.0.3
+ with:
+ persist-credentials: false
+
+ - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+ with:
+ ruby-version: '3.4'
+ bundler: none
+
+ - name: Auto Review PR
+ run: ruby tool/auto_review_pr.rb "$GITHUB_PR_NUMBER"
+ env:
+ GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
+ GITHUB_PR_NUMBER: ${{ github.event.pull_request.number || github.event.inputs.pr_number }}
diff --git a/.github/workflows/baseruby.yml b/.github/workflows/baseruby.yml
index bdb9011f25..9e7720f659 100644
--- a/.github/workflows/baseruby.yml
+++ b/.github/workflows/baseruby.yml
@@ -1,47 +1,76 @@
name: BASERUBY Check
-on: [push, pull_request]
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man/*'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ - '.*.yml'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man/*'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ - '.*.yml'
+ merge_group:
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
jobs:
baseruby:
name: BASERUBY
- runs-on: ubuntu-20.04
- if: "!contains(github.event.head_commit.message, '[ci skip]')"
+
+ runs-on: ubuntu-22.04
+
+ if: >-
+ ${{!(false
+ || contains(github.event.head_commit.message, '[DOC]')
+ || contains(github.event.pull_request.title, '[DOC]')
+ || contains(github.event.pull_request.labels.*.name, 'Documentation')
+ || (github.event.pull_request.user.login == 'dependabot[bot]')
+ )}}
+
strategy:
matrix:
ruby:
- - ruby-2.2
-# - ruby-2.3
-# - ruby-2.4
-# - ruby-2.5
-# - ruby-2.6
- - ruby-2.7
+ - ruby-3.1
+ - ruby-3.2
+ - ruby-3.3
steps:
- - uses: actions/checkout@v2
- - uses: ruby/setup-ruby@v1
+ - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
with:
ruby-version: ${{ matrix.ruby }}
bundler: none
- - run: echo "make=make -sj$((1 + $(nproc --all)))" >> $GITHUB_ENV
- - run: sudo apt-get install build-essential autoconf bison
- - run: autoconf
+
+ - uses: actions/checkout@df4cb1c069e1874edd31b4311f1884172cec0e10 # v6.0.3
+ with:
+ persist-credentials: false
+
+ - uses: ./.github/actions/setup/ubuntu
+
+ - uses: ./.github/actions/setup/directories
+ with:
+ makeup: true
+
- run: ./configure --disable-install-doc
- - run: $make update-unicode
- - run: $make common-srcs
- - run: $make incs
- - run: $make all
- - run: $make test
- - uses: k0kubun/action-slack@v2.0.0
+
+ - run: make all
+
+ - run: make test
+
+ - uses: ./.github/actions/slack
with:
- payload: |
- {
- "ci": "GitHub Actions",
- "env": "${{ github.workflow }} / BASERUBY @ ${{ matrix.ruby }}",
- "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
- "commit": "${{ github.sha }}",
- "branch": "${{ github.ref }}".split('/').reverse()[0]
- }
- env:
+ label: ${{ matrix.ruby }}
SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
- if: failure() && github.event_name == 'push'
+ if: ${{ failure() }}
diff --git a/.github/workflows/bundled_gems.yml b/.github/workflows/bundled_gems.yml
index 8377b92248..d329ee9b4b 100644
--- a/.github/workflows/bundled_gems.yml
+++ b/.github/workflows/bundled_gems.yml
@@ -1,20 +1,186 @@
-name: "Update bundled_gems"
+name: bundled_gems
+
+env:
+ UPDATE_ENABLED: true
on:
+ push:
+ branches: ['master']
+ paths:
+ - '.github/workflows/bundled_gems.yml'
+ - 'gems/bundled_gems'
+ pull_request:
+ branches: ['master']
+ paths:
+ - '.github/workflows/bundled_gems.yml'
+ - 'gems/bundled_gems'
+ merge_group:
schedule:
- - cron: '10 8 * * *'
+ - cron: '45 6 * * *'
+ workflow_dispatch:
+
+permissions: # added using https://github.com/step-security/secure-workflows
+ contents: read
jobs:
- Update-bundled_gems:
+ update:
+ permissions:
+ contents: write # for Git to git push
+
+ if: ${{ github.event_name != 'schedule' || github.repository == 'ruby/ruby' }}
+
+ name: update ${{ github.workflow }}
runs-on: ubuntu-latest
steps:
- - name: Checkout repository
- uses: actions/checkout@v2
-
- - name: Update
- run: |
- ruby -rrubygems tool/update-bundled_gems.rb gems/bundled_gems |
- tool/ifchange gems/bundled_gems -
- git diff --no-ext-diff --ignore-submodules --exit-code
+ - uses: actions/checkout@df4cb1c069e1874edd31b4311f1884172cec0e10 # v6.0.3
+ with:
+ token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+ - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+ with:
+ ruby-version: 4.0
+
+ - uses: ./.github/actions/setup/directories
+ with:
+ # Skip overwriting MATZBOT_AUTO_UPDATE_TOKEN
+ checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
+
+ - name: Set ENV
+ run: |
+ echo "TODAY=$(date +%F)" >> $GITHUB_ENV
+
+ - name: Download previous gems list
+ run: |
+ mkdir -p .downloaded-cache
+ for data in bundled_gems.json default_gems.json; do
+ ln -s .downloaded-cache/$data .
+ curl --retry 5 --retry-connrefused --retry-delay 2 --retry-max-time 60 -O -R -z ./$data https://stdgems.org/$data
+ done
+
+ - name: Update bundled gems list
+ id: bundled_gems
+ run: |
+ ruby -i~ tool/update-bundled_gems.rb gems/bundled_gems >> $GITHUB_OUTPUT
+ if: ${{ env.UPDATE_ENABLED == 'true' }}
+
+ - name: Maintain updated gems list in NEWS
+ run: |
+ ruby tool/update-NEWS-gemlist.rb bundled
+ ruby tool/update-NEWS-github-release.rb --update
+ if: ${{ env.UPDATE_ENABLED == 'true' }}
+
+ - name: Check diffs
+ id: diff
+ run: |
+ news= gems=
+ git diff --color --no-ext-diff --ignore-submodules --exit-code -- NEWS.md ||
+ news=true
+ git diff --color --no-ext-diff --ignore-submodules --exit-code -- gems/bundled_gems ||
+ gems=true
+ git add -- NEWS.md gems/bundled_gems
+ echo news=$news >> $GITHUB_OUTPUT
+ echo gems=$gems >> $GITHUB_OUTPUT
+ echo update=${news:-$gems} >> $GITHUB_OUTPUT
+
+ - name: Commit
+ id: commit
+ run: |
+ git pull --ff-only origin ${GITHUB_REF#refs/heads/}
+ message="Update bundled gems list"
+ if [ -z "${gems}" ]; then
+ git commit --message="[DOC] ${message} at ${GITHUB_SHA:0:30}"
+ else
+ git commit --message="${message} as of ${TODAY}"
+ fi
+ env:
+ TODAY: ${{ steps.bundled_gems.outputs.latest_date || env.TODAY }}
+ EMAIL: svn-admin@ruby-lang.org
+ GIT_AUTHOR_NAME: git
+ GIT_COMMITTER_NAME: git
+ gems: ${{ steps.diff.outputs.gems }}
+ if: ${{ steps.diff.outputs.update }}
+
+ - name: Development revision of bundled gems
+ run: |
+ #!ruby
+ file = "gems/bundled_gems"
+
+ SECONDS_IN_DAY = 86400
+ today = Time.new("#{ENV['TODAY']}Z")
+ if !(december = today.month == 12)
+ days = 30
+ elsif (days = 26 - today.day).positive?
+ days += 4
+ else
+ puts "::info:: just after released"
+ exit
+ end
+
+ since = "#{today.year-1}-12-26"
+ ref = ENV['GITHUB_REF']
+ puts "::group::\e[94mfetching \e[1m#{file}\e[22m since \e[1m#{since}\e[22m from \e[1m#{ref}\e[m"
+ system(*%W[git fetch --shallow-since=#{since} --no-tags origin #{ref}], exception: true)
+ puts "::endgroup::"
+
+ puts "\e[94mchecking development version bundled gems older than \e[1m#{days}\e[22m days\e[m"
+ limit = today.to_i - days * SECONDS_IN_DAY
+ old = 0
+ IO.popen(%W"git blame --line-porcelain -- #{file}") do |blame|
+ while head = blame.gets("\n\t") and s = blame.gets
+ next unless (gem = s.split(/\s+|#.*/)).size > 3
+ time = head[/^committer-time \K\d+/].to_i
+ next if (d = limit - time) <= 0
+ d /= SECONDS_IN_DAY
+ line = head[/\A\h+ \d+ \K\d+/].to_i
+ level = if d < days; 'warning'; else old += 1; 'error'; end
+ d += days
+ puts "::#{level} file=#{file},line=#{line},title=Older than #{d} days::#{gem[0]} #{gem[3]}"
+ end
+ end
+ abort "::error title=Too long-standing gems::The release comes soon." if december and old.nonzero?
+ shell: ruby {0}
+ env:
+ file: ${{ steps.logs.outputs.file }}
+ days: ${{ steps.logs.outputs.days }}
+
+ - name: Install libraries
+ uses: ./.github/actions/setup/ubuntu
+ if: ${{ steps.diff.outputs.gems }}
+
+ - name: Build
+ run: |
+ ./autogen.sh
+ ./configure -C --disable-install-doc
+ make
+ if: ${{ steps.diff.outputs.gems }}
+
+ - name: Prepare bundled gems
+ run: |
+ make -s prepare-gems
+ if: ${{ steps.diff.outputs.gems }}
+
+ - name: Test bundled gems
+ run: |
+ make -s test-bundled-gems
+ timeout-minutes: 30
+ env:
+ RUBY_TESTOPTS: '-q --tty=no'
+ TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+ if: ${{ steps.diff.outputs.gems }}
+
+ - name: Push
+ run: |
+ git push origin ${GITHUB_REF#refs/heads/}
+ if: >-
+ ${{
+ github.repository == 'ruby/ruby' &&
+ !startsWith(github.event_name, 'pull') &&
+ steps.commit.outcome == 'success'
+ }}
+
+ - uses: ./.github/actions/slack
+ with:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() }}
diff --git a/.github/workflows/check_branch.yml b/.github/workflows/check_branch.yml
deleted file mode 100644
index 37cf3a9a8f..0000000000
--- a/+ rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
@@ -1,490 +0,0 @@
-# -*- makefile -*-
-
-SHELL = $(COMSPEC)
-MKFILES = Makefile
-
-#### Start of system configuration section. ####
-OS = bccwin32
-RT = $(OS)
-
-## variables may be overridden by $(compile_dir)/Makefile
-!ifndef srcdir
-srcdir = ..
-!endif
-!ifndef RUBY_INSTALL_NAME
-RUBY_INSTALL_NAME = ruby
-!endif
-!ifndef RUBYW_INSTALL_NAME
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
-!elif "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
-!endif
-!if "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME)w
-!endif
-!ifndef RUBY_SO_NAME
-RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)
-!endif
-!ifndef icondirs
-!ifdef ICONDIRS
-icondirs=$(ICONDIRS)
-!endif
-!endif
-!ifdef icondirs
-icondirs=$(icondirs:\=/)
-iconinc=-I$(icondirs: = -I)
-!endif
-###############
-
-VPATH = $(srcdir):$(srcdir)/missing
-.SUFFIXES: .y
-
-!ifndef CC
-CC = bcc32
-!endif
-!ifndef CPP
-CPP = cpp32
-!endif
-!ifndef RC
-RC = brcc32
-!endif
-!ifndef YACC
-YACC = byacc
-!endif
-!ifndef AR
-AR = tlib
-!endif
-
-PURIFY =
-AUTOCONF = autoconf
-RM = $(srcdir:/=\)\win32\rm.bat
-
-!if !defined(PROCESSOR_ARCHITECTURE)
-PROCESSOR_ARCHITECTURE = x86
-!endif
-MACHINE = $(PROCESSOR_ARCHITECTURE)
-!if "$(PROCESSOR_ARCHITECTURE)" == "x86"
-!ifndef PROCESSOR_LEVEL
-PROCESSOR_LEVEL = 5
-!endif
-!if 6 < $(PROCESSOR_LEVEL)
-PROCESSOR_LEVEL = 6
-!endif
-PROCESSOR_FLAG = -$(PROCESSOR_LEVEL)
-CPU = i$(PROCESSOR_LEVEL)86
-ARCH = i386
-!else
-CPU = $(PROCESSOR_ARCHITECTURE)
-ARCH = $(PROCESSOR_ARCHITECTURE)
-!endif
-!ifndef DEBUGFLAGS
-DEBUGFLAGS =
-!endif
-!ifndef OPTFLAGS
-OPTFLAGS = -O
-!endif
-
-!ifndef prefix
-prefix = /usr
-!endif
-!ifndef exec_prefix
-exec_prefix = $(prefix)
-!endif
-!ifndef libdir
-libdir = $(exec_prefix)/lib
-!endif
-!if !defined(datadir)
-datadir = /share
-!endif
-!ifndef EXTOUT
-EXTOUT = .ext
-!endif
-!ifndef RIDATADIR
-RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
-!endif
-!ifndef TESTUI
-TESTUI = console
-!endif
-!ifndef TESTS
-TESTS =
-!endif
-!ifndef RDOCTARGET
-RDOCTARGET = install-nodoc
-!endif
-
-OUTFLAG = -o
-!ifndef CFLAGS
-CFLAGS = -q -tWR -tWC $(DEBUGFLAGS) $(OPTFLAGS) $(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
-!endif
-!ifndef LDFLAGS
-LDFLAGS = -S:$(STACK)
-!endif
-!ifndef RFLAGS
-RFLAGS = $(iconinc)
-!endif
-!ifndef EXTLIBS
-EXTLIBS =
-!endif
-!ifndef MEMLIB
-MEMLIB =
-!endif
-LIBS = $(MEMLIB) cw32i.lib import32.lib ws2_32.lib $(EXTLIBS)
-MISSING = acosh.obj crypt.obj erf.obj win32.obj
-
-!ifndef STACK
-STACK = 0x2000000
-!endif
-
-XCFLAGS = -DRUBY_EXPORT -I. -I$(srcdir) -I$(srcdir)/missing
-
-ARFLAGS = /a
-LD = ilink32 -q -Gn
-LDSHARED = $(LD)
-XLDFLAGS = -Tpe c0x32.obj
-WLDFLAGS = -aa -Tpe c0w32.obj
-DLDFLAGS = -Tpd c0d32.obj
-LIBRUBY_LDSHARED = $(LDSHARED)
-LIBRUBY_DLDFLAGS = -Gi $(DLDFLAGS) $(EXTLDFLAGS)
-LDOBJECTS = $(MAINOBJ)
-
-SOLIBS =
-
-EXEEXT = .exe
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-WPROGRAM=$(RUBYW_INSTALL_NAME)$(EXEEXT)
-RUBYDEF = $(RUBY_SO_NAME).def
-MINIRUBY = .\miniruby$(EXEEXT)
-RUNRUBY = .\ruby$(EXEEXT) "$(srcdir)/runruby.rb" --extout="$(EXTOUT)" --
-
-ORGLIBPATH = $(LIB)
-
-#### End of system configuration section. ####
-
-LIBRUBY_A = $(RUBY_SO_NAME)-static.lib
-LIBRUBY_SO = $(RUBY_SO_NAME).dll
-LIBRUBY = $(RUBY_SO_NAME).lib
-LIBRUBYARG = $(LIBRUBY)
-
-PREP = miniruby$(EXEEXT)
-
-OBJEXT = obj
-
-WINMAINOBJ = winmain.$(OBJEXT)
-MINIOBJS = dmydln.$(OBJEXT)
-
-.path.c = .;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
-.path.h = .;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
-.path.y = $(srcdir)
-.path. = $(srcdir)
-
-.c.obj:
- $(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) -c $(<:/=\)
-
-.rc.res:
- $(RC) $(RFLAGS) -I. -I$(<D). $(iconinc) -I$(srcdir)/win32 $(RFLAGS) -fo$@ $(<:/=\)
-
-.y.c:
- $(YACC) $(YFLAGS) $(<:\=/)
- sed -e "s!^ *extern char \*getenv();!/* & */!;s/^\(#.*\)y\.tab/\1parse/" y.tab.c > $(@F)
- @del y.tab.c
-
-all: $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
-
-ruby: $(PROGRAM)
-rubyw: $(WPROGRAM)
-
-!include $(srcdir)/common.mk
-
-PHONY: Makefile
-
-CONFIG_H = ./.config.h.time
-
-config: config.status
-
-config.status: $(CONFIG_H)
-
-$(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
- @$(srcdir:/=\)\win32\ifchange.bat config.h &&|
-\#define HAVE_SYS_TYPES_H 1
-\#define HAVE_SYS_STAT_H 1
-\#define HAVE_STDLIB_H 1
-\#define HAVE_STRING_H 1
-\#define HAVE_MEMORY_H 1
-\#define HAVE_OFF_T 1
-\#define SIZEOF_INT 4
-\#define SIZEOF_SHORT 2
-\#define SIZEOF_LONG 4
-\#define SIZEOF_LONG_LONG 0
-\#define SIZEOF___INT64 8
-\#define SIZEOF_OFF_T 4
-\#define SIZEOF_VOIDP 4
-\#define SIZEOF_FLOAT 4
-\#define SIZEOF_DOUBLE 8
-\#define SIZEOF_TIME_T 4
-\#define HAVE_PROTOTYPES 1
-\#define TOKEN_PASTE(x,y) x\#\#y
-\#define HAVE_STDARG_PROTOTYPES 1
-\#define NORETURN(x) x
-\#define RUBY_EXTERN extern __declspec(dllimport)
-\#define HAVE_DECL_SYS_NERR 1
-\#define HAVE_LIMITS_H 1
-\#define HAVE_FCNTL_H 1
-\#define HAVE_UTIME_H 1
-\#define HAVE_FLOAT_H 1
-\#define rb_uid_t uid_t
-\#define rb_gid_t gid_t
-\#define rb_pid_t int
-\#define HAVE_STRUCT_STAT_ST_RDEV 1
-\#define HAVE_ST_RDEV 1
-\#define GETGROUPS_T int
-\#define RETSIGTYPE void
-\#define HAVE_ALLOCA 1
-\#define HAVE_DUP2 1
-\#define HAVE_MEMMOVE 1
-\#define HAVE_MKDIR 1
-\#define HAVE_STRCASECMP 1
-\#define HAVE_STRNCASECMP 1
-\#define HAVE_STRERROR 1
-\#define HAVE_STRFTIME 1
-\#define HAVE_STRCHR 1
-\#define HAVE_STRSTR 1
-\#define HAVE_STRTOD 1
-\#define HAVE_STRTOL 1
-\#define HAVE_STRTOUL 1
-\#define HAVE_ISNAN 1
-\#define HAVE_FINITE 1
-\#define HAVE_HYPOT 1
-\#define HAVE_FMOD 1
-\#define HAVE_WAITPID 1
-\#define HAVE_FSYNC 1
-\#define HAVE_GETCWD 1
-\#define HAVE_CHSIZE 1
-\#define HAVE_TIMES 1
-\#define HAVE_FCNTL 1
-\#define HAVE_LINK 1
-\#define HAVE_TELLDIR 1
-\#define HAVE_SEEKDIR 1
-\#define HAVE_COSH 1
-\#define HAVE_SINH 1
-\#define HAVE_TANH 1
-\#define RSHIFT(x,y) ((x)>>(int)y)
-\#define FILE_COUNT level
-\#define FILE_READPTR curp
-\#define inline __inline
-\#define NEED_IO_SEEK_BETWEEN_RW 1
-\#define STACK_GROW_DIRECTION -1
-\#define DEFAULT_KCODE KCODE_NONE
-\#define DLEXT ".so"
-\#define RUBY_LIB "/lib/ruby/$(MAJOR).$(MINOR)"
-\#define RUBY_SITE_LIB "/lib/ruby/site_ruby"
-\#define RUBY_SITE_LIB2 "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)"
-\#define RUBY_PLATFORM "$(ARCH)-$(OS)"
-\#define RUBY_ARCHLIB "/lib/ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
-\#define RUBY_SITE_ARCHLIB "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
-|
- @exit > $@
-
-config.status: $(MKFILES) $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
- @echo Creating $@
- @type > $@ &&|
-# Generated automatically by Makefile.sub.
-s,@SHELL@,$$(COMSPEC),;t t
-s,@BUILD_FILE_SEPARATOR@,\,;t t
-s,@PATH_SEPARATOR@,;,;t t
-s,@CFLAGS@,$(CFLAGS),;t t
-s,@CPPFLAGS@,$(CPPFLAGS),;t t
-s,@CXXFLAGS@,$(CXXFLAGS),;t t
-s,@FFLAGS@,$(FFLAGS),;t t
-s,@LDFLAGS@,,;t t
-s,@LIBS@,$(LIBS),;t t
-s,@exec_prefix@,$${prefix},;t t
-s,@prefix@,,;t t
-s,@program_transform_name@,s,,,,;t t
-s,@bindir@,$${exec_prefix}/bin,;t t
-s,@sbindir@,$${exec_prefix}/sbin,;t t
-s,@libexecdir@,$${exec_prefix}/libexec,;t t
-s,@datadir@,$${prefix}/share,;t t
-s,@sysconfdir@,$${prefix}/etc,;t t
-s,@sharedstatedir@,/etc,;t t
-s,@localstatedir@,/var,;t t
-s,@libdir@,$${exec_prefix}/lib,;t t
-s,@includedir@,$${prefix}/include,;t t
-s,@oldincludedir@,/usr/include,;t t
-s,@infodir@,$${prefix}/info,;t t
-s,@mandir@,$${prefix}/man,;t t
-s,@build@,$(CPU)-pc-$(OS),;t t
-s,@build_alias@,$(CPU)-$(OS),;t t
-s,@build_cpu@,$(CPU),;t t
-s,@build_vendor@,pc,;t t
-s,@build_os@,$(OS),;t t
-s,@host@,$(CPU)-pc-$(OS),;t t
-s,@host_alias@,$(CPU)-$(OS),;t t
-s,@host_cpu@,$(CPU),;t t
-s,@host_vendor@,pc,;t t
-s,@host_os@,$(OS),;t t
-s,@target@,$(ARCH)-pc-$(OS),;t t
-s,@target_alias@,$(ARCH)-$(OS),;t t
-s,@target_cpu@,$(ARCH),;t t
-s,@target_vendor@,pc,;t t
-s,@target_os@,$(OS),;t t
-s,@CC@,$(CC),;t t
-s,@CPP@,cpp32,;t t
-s,@YACC@,$(YACC),;t t
-s,@RANLIB@,,;t t
-s,@AR@,$(AR),;t t
-s,@ARFLAGS@,$(ARFLAGS) ,;t t
-s,@LN_S@,$(LN_S),;t t
-s,@SET_MAKE@,$(SET_MAKE),;t t
-s,@CP@,copy > nul,;t t
-s,@INSTALL@,copy > nul,;t t
-s,@INSTALL_PROG@,$$(INSTALL),;t t
-s,@INSTALL_DATA@,$$(INSTALL),;t t
-s,@LIBOBJS@, acosh.obj crypt.obj erf.obj win32.obj,;t t
-s,@ALLOCA@,$(ALLOCA),;t t
-s,@DEFAULT_KCODE@,$(DEFAULT_KCODE),;t t
-s,@EXEEXT@,.exe,;t t
-s,@OBJEXT@,obj,;t t
-s,@XCFLAGS@,$(XCFLAGS),;t t
-s,@XLDFLAGS@,$(XLDFLAGS),;t t
-s,@DLDFLAGS@,$(DLDFLAGS),;t t
-s,@ARCH_FLAG@,$(ARCH_FLAG),;t t
-s,@STATIC@,$(STATIC),;t t
-s,@CCDLFLAGS@,,;t t
-s,@LDSHARED@,$(LDSHARED),;t t
-s,@DLEXT@,so,;t t
-s,@LIBEXT@,lib,;t t
-s,@STRIP@,$(STRIP),;t t
-s,@EXTSTATIC@,$(EXTSTATIC),;t t
-s,@setup@,Setup,;t t
-s,@MINIRUBY@,$(MINIRUBY),;t t
-s,@PREP@,miniruby$(EXEEXT),;t t
-s,@RUNRUBY@,$(RUNRUBY),;t t
-s,@EXTOUT@,$(EXTOUT),;t t
-s,@ARCHFILE@,,;t t
-s,@RDOCTARGET@,,;t t
-s,@LIBRUBY_LDSHARED@,$$(LDSHARED),;t t
-s,@LIBRUBY_DLDFLAGS@,-Gi $$(DLDFLAGS),;t t
-s,@RUBY_INSTALL_NAME@,$(RUBY_INSTALL_NAME),;t t
-s,@rubyw_install_name@,$(RUBYW_INSTALL_NAME),;t t
-s,@RUBYW_INSTALL_NAME@,$(RUBYW_INSTALL_NAME),;t t
-s,@RUBY_SO_NAME@,$(RUBY_SO_NAME),;t t
-s,@LIBRUBY_A@,$$(RUBY_SO_NAME)-static.lib,;t t
-s,@LIBRUBY_SO@,$$(RUBY_SO_NAME).dll,;t t
-s,@LIBRUBY_ALIASES@,$(LIBRUBY_ALIASES),;t t
-s,@LIBRUBY@,$$(RUBY_SO_NAME).lib,;t t
-s,@LIBRUBYARG@,$$(LIBRUBYARG_SHARED),;t t
-s,@LIBRUBYARG_STATIC@,$$(LIBRUBY_A),;t t
-s,@LIBRUBYARG_SHARED@,$$(LIBRUBY),;t t
-s,@SOLIBS@,$(SOLIBS),;t t
-s,@DLDLIBS@,$(DLDLIBS),;t t
-s,@ENABLE_SHARED@,yes,;t t
-s,@OUTFLAG@,$(OUTFLAG),;t t
-s,@CPPOUTFILE@,,;t t
-s,@LIBPATHFLAG@, -L"%s",;t t
-s,@RPATHFLAG@,,;t t
-s,@LIBARG@,%s.lib,;t t
-s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE), $$(RESFILE),;t t
-s,@COMPILE_C@,$$(CC) $$(INCFLAGS) $$(CFLAGS) $$(CPPFLAGS) -c $$(<:/=\),;t t
-s,@COMPILE_CXX@,$$(CXX) $$(INCFLAGS) $$(CXXFLAGS) $$(CPPFLAGS) -P -c $$(<:/=\),;t t
-s,@COMPILE_RULES@,{$$(srcdir)}.%s{}.%s: {$$(topdir)}.%s{}.%s: {$$(hdrdir)}.%s{}.%s: .%s.%s:,;t t
-s,@RULE_SUBST@,{.;$$(VPATH)}%s,;t t
-s,@COMMON_LIBS@,m advapi32 avicap32 avifil32 cap comctl32 comdlg32 dlcapi gdi32 glu32 imagehlp imm32 inetmib1 kernel32 loadperf lsapi32 lz32 mapi32 mgmtapi mpr msacm32 msvfw32 nddeapi netapi32 ole32 oleaut32 oledlg olepro32 opengl32 pdh pkpd32 rasapi32 rasdlg rassapi rpcrt4 setupapi shell32 shfolder snmpapi sporder tapi32 url user32 vdmdbg version win32spl winmm wintrust wsock32,;t t
-s,@COMMON_MACROS@,WIN32_LEAN_AND_MEAN;t t
-s,@COMMON_HEADERS@,winsock2.h windows.h,;t t
-s,@TRY_LINK@,$$(CC) -oconftest $$(INCFLAGS) -I$$(hdrdir) $$(CPPFLAGS) $$(CFLAGS) $$(LIBPATH) $$(LDFLAGS) $$(src) $$(LOCAL_LIBS) $$(LIBS),;t t
-s,@EXPORT_PREFIX@,_,;t t
-s,@arch@,$(ARCH)-$(OS),;t t
-s,@sitearch@,$(ARCH)-$(OS),;t t
-s,@sitedir@,$${prefix}/lib/ruby/site_ruby,;t t
-s,@configure_args@,--enable-shared $(configure_args),;t t
-s,@configure_input@,$$configure_input,;t t
-s,@srcdir@,$(srcdir),;t t
-s,@top_srcdir@,$(srcdir),;t t
-|
-
-miniruby$(EXEEXT):
- @echo $(LIBS)
- $(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(MINIOBJS),$@,nul,$(LIBRUBY_A) $(LIBS)
-
-$(PROGRAM): $(MAINOBJ) $(LIBRUBY_SO) $(RUBY_INSTALL_NAME).res
- $(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBY_INSTALL_NAME).res
-
-$(WPROGRAM): $(MAINOBJ) $(WINMAINOBJ) $(LIBRUBY_SO) $(RUBYW_INSTALL_NAME).res
- $(LD) $(LDFLAGS) $(WLDFLAGS) $(MAINOBJ) $(WINMAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBYW_INSTALL_NAME).res
-
-$(LIBRUBY_A): $(OBJS) $(DMYEXT)
- @-if exist $@ del $@
- $(AR) $(ARFLAGS) "$@" $(OBJS) $(DMYEXT)
-
-# $(LIBRUBY): $(LIBRUBY_SO)
-# implib $@ $(LIBRUBY_SO)
-
-$(LIBRUBY_SO): $(LIBRUBY_A) $(DLDOBJS) $(RUBYDEF) $(RUBY_SO_NAME).res
- @echo $(DLDOBJS)
- $(LIBRUBY_LDSHARED) $(LIBRUBY_DLDFLAGS) $(DLDOBJS:/=\),$(LIBRUBY_SO),nul,$(LIBRUBY_A) $(LIBS),$(RUBYDEF),$(RUBY_SO_NAME).res
-
-$(LIBRUBY): $(LIBRUBY_SO)
-
-$(RUBYDEF): $(LIBRUBY_A) $(PREP)
- $(MINIRUBY) $(srcdir)/bcc32/mkexports.rb -output=$@ -base=$(RUBY_SO_NAME) $(LIBRUBY_A)
-
-$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb
- @$(MINIRUBY) $(srcdir)/win32/resource.rb \
- -ruby_name=$(RUBY_INSTALL_NAME) \
- -rubyw_name=$(RUBYW_INSTALL_NAME) \
- -so_name=$(RUBY_SO_NAME) \
- . $(icondirs) $(srcdir)/win32
-
-post-install-ext::
- $(MINIRUBY) -I$(srcdir)lib -rrbconfig -rfileutils \
- -e "FileUtils.rm_f(Dir[ARGV[0]+Config::CONFIG['archdir']+'/**/*.tds'])" "$(DESTDIR:\=/)"
-
-clean-local::
- @$(RM) ext\extinit.c ext\extinit.$(OBJEXT) *.tds *.il? $(RUBY_SO_NAME).lib
- @$(RM) $(RUBY_INSTALL_NAME).res $(RUBYW_INSTALL_NAME).res $(RUBY_SO_NAME).res
-
-distclean-local::
- @$(RM) ext\config.cache $(RBCONFIG:/=\)
- @$(RM) *.map *.pdb *.ilk *.exp $(RUBYDEF)
- @$(RM) $(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc
-
-ext/extinit.obj: ext/extinit.c $(SETUP)
- $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) -o$@ -c ext/extinit.c
-
-main.$(OBJEXT): win32.h
-array.$(OBJEXT): win32.h
-bignum.$(OBJEXT): win32.h
-class.$(OBJEXT): win32.h
-compar.$(OBJEXT): win32.h
-dir.$(OBJEXT): dir.h win32.h
-dln.$(OBJEXT): win32.h
-enum.$(OBJEXT): win32.h
-error.$(OBJEXT): win32.h
-eval.$(OBJEXT): win32.h
-file.$(OBJEXT): win32.h
-gc.$(OBJEXT): win32.h
-hash.$(OBJEXT): win32.h
-inits.$(OBJEXT): win32.h
-io.$(OBJEXT): win32.h
-marshal.$(OBJEXT): win32.h
-math.$(OBJEXT): win32.h
-numeric.$(OBJEXT): win32.h
-object.$(OBJEXT): win32.h
-pack.$(OBJEXT): win32.h
-parse.$(OBJEXT): win32.h
-process.$(OBJEXT): win32.h
-prec.$(OBJEXT): win32.h
-random.$(OBJEXT): win32.h
-range.$(OBJEXT): win32.h
-re.$(OBJEXT): win32.h
-regex.$(OBJEXT): win32.h
-ruby.$(OBJEXT): win32.h
-signal.$(OBJEXT): win32.h
-sprintf.$(OBJEXT): win32.h
-st.$(OBJEXT): win32.h
-string.$(OBJEXT): win32.h
-struct.$(OBJEXT): win32.h
-time.$(OBJEXT): win32.h
-util.$(OBJEXT): win32.h
-variable.$(OBJEXT): win32.h
-version.$(OBJEXT): win32.h
diff --git a/bcc32/README.bcc32 b/bcc32/README.bcc32
deleted file mode 100644
index c27a1261f1..0000000000
--- a/bcc32/README.bcc32
+++ /dev/null
@@ -1,137 +0,0 @@
-=begin
-
-= How to build ruby using Borland C++
-
-== Requirement
-
-(1) Borland C++ 5.0 or later.
-
-(2) Please set environment variable (({PATH}))
- to run required commands properly from the command line.
-
- Note: building ruby requires following commands.
- * make
- * bcc32
- * tlib
- * ilink32
-
-(3) If you want to build from CVS source, following commands are required.
- * byacc ((<URL:http://gnuwin32.sourceforge.net/packages/byacc.htm>))
- * sed ((<URL:http://gnuwin32.sourceforge.net/packages/sed.htm>))
-
-(4) We strongly recommend to build ruby on C++Builder, to link following files.
- * usebormm.lib
- * memmgr.lib
-
- RTL's internal memory manager cannot handle large memory block properly,
- so we should use borlndmm.dll instead.
- 10000.times { "" << "." * 529671; GC.start } # crash
-
-== How to compile and install
-
-(1) Execute bcc32\configure.bat on your build directory.
- ex. c:\ruby-1.6.7>bcc32\configure.bat
-
-(2) Change ((|RUBY_INSTALL_NAME|)) and ((|RUBY_SO_NAME|)) in (({Makefile}))
- if you want to change the name of the executable files.
- And add ((|RUBYW_INSTALL_NAME|)) to change the name of the
- executable without console window if also you want.
-
-(3) Run `((%make%))'
-
-(4) Run `((%make test%))'
-
-(5) Run `((%make DESTDIR=<install_directory> install%))'
-
- This command will create following directories and install files onto them.
- * <install_directory>\bin
- * <install_directory>\lib
- * <install_directory>\lib\ruby
- * <install_directory>\lib\ruby\<MAJOR>.<MINOR>
- * <install_directory>\lib\ruby\<MAJOR>.<MINOR>\<PLATFORM>
- * <install_directory>\lib\ruby\site_ruby
- * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>
- * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>\<PLATFORM>
- * <install_directory>\man\man1
- If Ruby's version is `x.y.z', the ((|<MAJOR>|)) is `x' and the ((|<MINOR>|)) is `y'.
- The ((|<PLATFORM>|)) is usually `(({i586-bccwin32}))'.
-
-(6) Requires dynamic RTL (cc3250.dll on C++Builder5) and borlndmm.dll (If built with
- usebormm.lib) to use installed binary. These files are ordinary in bcc32's bin
- directory.
-
-== Icons
-
-Any icon files(*.ico) in the build directory, directories specified with
-((|icondirs|)) make variable and (({win32})) directory under the ruby
-source directory will be included in DLL or executable files, according
-to their base names.
- $(RUBY_INSTALL_NAME).ico or ruby.ico --> $(RUBY_INSTALL_NAME).exe
- $(RUBYW_INSTALL_NAME).ico or rubyw.ico --> $(RUBYW_INSTALL_NAME).exe
- the others --> $(RUBY_SO_NAME).dll
-
-Although no icons are distributed with the ruby source or in the official
-site, you can use anything you like. For example, followings are written
-in Japanese, but you can download at least.
-
-* ((<URL:http://member.nifty.ne.jp/ueivu/rubyico.html>)) or
- ((<zipped icons|URL:http://member.nifty.ne.jp/ueivu/Ruby_ico.zip>))
-* ((<URL:http://homepage1.nifty.com/a_nakata/ruby/>)) or
- ((<icon itself|URL:http://homepage1.nifty.com/a_nakata/ruby/RubyIcon.ico>))
-
-== Build examples
-
-* Build on the ruby source directory.
-
- ex.)
- ruby source directory: C:\ruby
- build directory: C:\ruby
- install directory: C:\usr\local
-
- C:
- cd \ruby
- bcc32\configure
- make
- make test
- make DESTDIR=/usr/local install
-
-* Build on the relative directory from the ruby source directory and CPU type
- i386.
-
- ex.)
- ruby source directory: C:\ruby
- build directory: C:\ruby\bccwin32
- install directory: C:\usr\local
- CPU i386
-
- C:
- cd \ruby
- mkdir bccwin32
- cd bccwin32
- ..\bcc32\configure target i386-bccwin32
- make
- make test
- make DESTDIR=/usr/local install
-
-* Build on the different drive.
-
- ex.)
- ruby source directory: C:\src\ruby
- build directory: D:\build\ruby
- install directory: C:\usr\local
-
- D:
- cd D:\build\ruby
- C:\src\ruby\bcc32\configure
- make
- make test
- make DESTDIR=C:/usr/local install
-
-== Bugs
-
-You can ((*NOT*)) use a path name contains any white space characters as
-the ruby source directory, this restriction comes from the behavior of
-(({!INCLUDE})) directives of (({MAKE})).
-((- you may call it a bug. -))
-
-=end
diff --git a/bcc32/configure.bat b/bcc32/configure.bat
deleted file mode 100755
index 123a3f23c8..0000000000
--- a/bcc32/configure.bat
+++ /dev/null
@@ -1,92 +0,0 @@
-@echo off
-::: Don't set environment variable in batch file other than autoexec.bat
-::: to avoid "Out of environment space" problem on Windows 95/98.
-::: set TMPMAKE=~tmp~.mak
-
-echo> ~tmp~.mak ####
-echo>> ~tmp~.mak conf = %0
-echo>> ~tmp~.mak $(conf:\=/): nul
-echo>> ~tmp~.mak @del ~tmp~.mak
-echo>> ~tmp~.mak @-$(MAKE) -l$(MAKEFLAGS) -f $(@D)setup.mak \
-:loop
-if "%1" == "" goto :end
-if "%1" == "--prefix" goto :prefix
-if "%1" == "--srcdir" goto :srcdir
-if "%1" == "srcdir" goto :srcdir
-if "%1" == "--target" goto :target
-if "%1" == "target" goto :target
-if "%1" == "--with-static-linked-ext" goto :extstatic
-if "%1" == "--program-suffix" goto :suffix
-if "%1" == "--program-name" goto :progname
-if "%1" == "--enable-install-doc" goto :enable-rdoc
-if "%1" == "--disable-install-doc" goto :disable-rdoc
-if "%1" == "--extout" goto :extout
-if "%1" == "-h" goto :help
-if "%1" == "--help" goto :help
- echo>> ~tmp~.mak "%1" \
- shift
-goto :loop
-:srcdir
- echo>> ~tmp~.mak -D"srcdir=%2" \
- shift
- shift
-goto :loop
-:prefix
- echo>> ~tmp~.mak -D"prefix=%2" \
- shift
- shift
-goto :loop
-:suffix
- echo>> ~tmp~.mak -D"RUBY_SUFFIX=%2" \
- shift
- shift
-goto :loop
-:installname
- echo>> ~tmp~.mak -D"RUBY_INSTALL_NAME=%2" \
- shift
- shift
-goto :loop
-:soname
- echo>> ~tmp~.mak -D"RUBY_SO_NAME=%2" \
- shift
- shift
-goto :loop
-:target
- echo>> ~tmp~.mak "%2" \
- shift
- shift
-goto :loop
-:extstatic
- echo>> ~tmp~.mak -D"EXTSTATIC=static" \
- shift
-goto :loop
-:enable-rdoc
- echo>> ~tmp~.mak -D"RDOCTARGET=install-doc" \
- shift
-goto :loop
-:disable-rdoc
- echo>> ~tmp~.mak -D"RDOCTARGET=install-nodoc" \
- shift
-goto :loop
-:extout
- echo>> ~tmp~.mak "EXTOUT=%2" \
- shift
- shift
-goto :loop
-:help
- echo Configuration:
- echo --help display this help
- echo --srcdir=DIR find the sources in DIR [configure dir or `..']
- echo Installation directories:
- echo --prefix=PREFIX install files in PREFIX (ignored currently)
- echo System types:
- echo --target=TARGET configure for TARGET [i386-bccwin32]
- echo Optional Package:
- echo --with-static-linked-ext link external modules statically
- echo --enable-install-doc install rdoc indexes during install
- del ~tmp~.mak
-goto :exit
-:end
-echo>> ~tmp~.mak bcc32dir="$(@D)"
-make -s -f ~tmp~.mak
-:exit
diff --git a/bcc32/mkexports.rb b/bcc32/mkexports.rb
deleted file mode 100644
index e34b441e2f..0000000000
--- a/bcc32/mkexports.rb
+++ /dev/null
@@ -1,25 +0,0 @@
-#!./miniruby -s
-
-SYM = {}
-STDIN.reopen(open("nul"))
-ARGV.each do |obj|
- IO.foreach("|tdump -q -oiPUBDEF -oiPUBD32 #{obj.tr('/', '\\')}") do |l|
- next unless /(?:PUBDEF|PUBD32)/ =~ l
- SYM[$1] = true if /'(.*?)'/ =~ l
- end
-end
-
-exports = []
-if $name
- exports << "Name " + $name
-elsif $library
- exports << "Library " + $library
-end
-exports << "Description " + $description.dump if $description
-exports << "EXPORTS" << SYM.keys.sort
-
-if $output
- open($output, 'w') {|f| f.puts exports.join("\n")}
-else
- puts exports.join("\n")
-end
diff --git a/bcc32/setup.mak b/bcc32/setup.mak
deleted file mode 100644
index b7a2539d0a..0000000000
--- a/bcc32/setup.mak
+++ /dev/null
@@ -1,133 +0,0 @@
-# -*- makefile -*-
-
-!if "$(srcdir)" != ""
-bcc32dir = $(srcdir)/bcc32
-!elseif "$(bcc32dir)" == "bcc32/"
-srcdir = .
-!elseif "$(bcc32dir:/bcc32/=)/bcc32/" == "$(bcc32dir)"
-srcdir = $(bcc32dir:/bcc32/=)
-!else
-srcdir = $(bcc32dir)/..
-!endif
-!ifndef prefix
-prefix = /usr
-!endif
-OS = bccwin32
-RT = $(OS)
-BANG = !
-APPEND = echo>>$(MAKEFILE)
-!ifdef MAKEFILE
-MAKE = $(MAKE) -f $(MAKEFILE)
-!else
-MAKEFILE = Makefile
-!endif
-
-all: Makefile
-Makefile: -prologue- -generic- -epilogue-
-i386-$(OS): -prologue- -i386- -epilogue-
-i486-$(OS): -prologue- -i486- -epilogue-
-i586-$(OS): -prologue- -i586- -epilogue-
-i686-$(OS): -prologue- -i686- -epilogue-
-alpha-$(OS): -prologue- -alpha- -epilogue-
-
--prologue-: nul
- @echo Creating $(MAKEFILE)
- @type > $(MAKEFILE) &&|
-\#\#\# Makefile for ruby $(OS) \#\#\#
-$(BANG)ifndef srcdir
-srcdir = $(srcdir:\=/)
-$(BANG)endif
-$(BANG)ifndef prefix
-prefix = $(prefix:\=/)
-$(BANG)endif
-$(BANG)ifndef EXTSTATIC
-EXTSTATIC = $(EXTSTATIC)
-$(BANG)endif
-!if defined(RDOCTARGET)
-$(BANG)ifndef RDOCTARGET
-RDOCTARGET = $(RDOCTARGET)
-$(BANG)endif
-!endif
-!if defined(EXTOUT)
-$(BANG)ifndef EXTOUT
-EXTOUT = $(EXTOUT)
-$(BANG)endif
-!endif
-|
- @type > usebormm.bat &&|
-@echo off
-ilink32 -Gn -x usebormm.lib > nul
-if exist usebormm.tds echo MEMLIB = usebormm.lib
-|
- @usebormm.bat >> $(MAKEFILE)
- @del usebormm.*
-
- @cpp32 -I$(srcdir) -P- -o$(MAKEFILE) > nul &&|
-\#include "version.h"
-MAJOR = RUBY_VERSION_MAJOR
-MINOR = RUBY_VERSION_MINOR
-TEENY = RUBY_VERSION_TEENY
-|
- @type $(MAKEFILE).i >> $(MAKEFILE)
- @del $(MAKEFILE).i
-
--generic-: nul
-!if defined(PROCESSOR_ARCHITECTURE) || defined(PROCESSOR_LEVEL)
- @type >> $(MAKEFILE) &&|
-!if defined(PROCESSOR_ARCHITECTURE)
-$(BANG)ifndef PROCESSOR_ARCHITECTURE
-PROCESSOR_ARCHITECTURE = $(PROCESSOR_ARCHITECTURE)
-$(BANG)endif
-!endif
-!if defined(PROCESSOR_LEVEL)
-$(BANG)ifndef PROCESSOR_LEVEL
-PROCESSOR_LEVEL = $(PROCESSOR_LEVEL)
-$(BANG)endif
-!endif
-
-|
-!endif
-
--alpha-: nul
- @$(APPEND) !ifndef PROCESSOR_ARCHITECTURE
- @$(APPEND) PROCESSOR_ARCHITECTURE = alpha
- @$(APPEND) !endif
--ix86-: nul
- @$(APPEND) !ifndef PROCESSOR_ARCHITECTURE
- @$(APPEND) PROCESSOR_ARCHITECTURE = x86
- @$(APPEND) !endif
-
--i386-: -ix86-
- @$(APPEND) !ifndef PROCESSOR_LEVEL
- @$(APPEND) PROCESSOR_LEVEL = 3
- @$(APPEND) !endif
--i486-: -ix86-
- @$(APPEND) !ifndef PROCESSOR_LEVEL
- @$(APPEND) PROCESSOR_LEVEL = 4
- @$(APPEND) !endif
--i586-: -ix86-
- @$(APPEND) !ifndef PROCESSOR_LEVEL
- @$(APPEND) PROCESSOR_LEVEL = 5
- @$(APPEND) !endif
--i686-: -ix86-
- @$(APPEND) !ifndef PROCESSOR_LEVEL
- @$(APPEND) PROCESSOR_LEVEL = 6
- @$(APPEND) !endif
-
--epilogue-: nul
- @type >> $(MAKEFILE) &&|
-
-\# OS = $(OS)
-\# RT = $(RT)
-\# RUBY_INSTALL_NAME = ruby
-\# RUBY_SO_NAME = $$(RT)-$$(RUBY_INSTALL_NAME)$$(MAJOR)$$(MINOR)
-\# CFLAGS = -q $$(DEBUGFLAGS) $$(OPTFLAGS) $$(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
-\# CPPFLAGS = -I. -I$$(srcdir) -I$$(srcdir)/missing -DLIBRUBY_SO=\"$$(LIBRUBY_SO)\"
-\# STACK = 0x2000000
-\# LDFLAGS = -S:$$(STACK)
-\# RFLAGS = $$(iconinc)
-\# EXTLIBS = cw32.lib import32.lib user32.lib kernel32.lib
-$(BANG)include $$(srcdir)/bcc32/Makefile.sub
-|
- @$(srcdir:/=\)\win32\rm.bat config.h config.status
- @echo type "`$(MAKE)'" to make ruby for $(OS).
diff --git a/benchmark/bm_app_answer.rb b/benchmark/bm_app_answer.rb
new file mode 100644
index 0000000000..3cd8a8fd37
--- /dev/null
+++ b/benchmark/bm_app_answer.rb
@@ -0,0 +1,15 @@
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+def the_answer_to_life_the_universe_and_everything
+ (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
+end
+
+answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
new file mode 100644
index 0000000000..807349089f
--- /dev/null
+++ b/benchmark/bm_app_aobench.rb
@@ -0,0 +1,292 @@
+# AO rebder benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+# http://lucille.atso-net.jp/blog/?p=642
+# http://lucille.atso-net.jp/blog/?p=711
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+class Vec
+ def initialize(x, y, z)
+ @x = x
+ @y = y
+ @z = z
+ end
+
+ attr_accessor :x, :y, :z
+
+ def vadd(b)
+ Vec.new(@x + b.x, @y + b.y, @z + b.z)
+ end
+
+ def vsub(b)
+ Vec.new(@x - b.x, @y - b.y, @z - b.z)
+ end
+
+ def vcross(b)
+ Vec.new(@y * b.z - @z * b.y,
+ @z * b.x - @x * b.z,
+ @x * b.y - @y * b.x)
+ end
+
+ def vdot(b)
+ @x * b.x + @y * b.y + @z * b.z
+ end
+
+ def vlength
+ Math.sqrt(@x * @x + @y * @y + @z * @z)
+ end
+
+ def vnormalize
+ len = vlength
+ v = Vec.new(@x, @y, @z)
+ if len > 1.0e-17 then
+ v.x = v.x / len
+ v.y = v.y / len
+ v.z = v.z / len
+ end
+ v
+ end
+end
+
+
+class Sphere
+ def initialize(center, radius)
+ @center = center
+ @radius = radius
+ end
+
+ attr_reader :center, :radius
+
+ def intersect(ray, isect)
+ rs = ray.org.vsub(@center)
+ b = rs.vdot(ray.dir)
+ c = rs.vdot(rs) - (@radius * @radius)
+ d = b * b - c
+ if d > 0.0 then
+ t = - b - Math.sqrt(d)
+
+ if t > 0.0 and t < isect.t then
+ isect.t = t
+ isect.hit = true
+ isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+ ray.org.y + ray.dir.y * t,
+ ray.org.z + ray.dir.z * t)
+ n = isect.pl.vsub(@center)
+ isect.n = n.vnormalize
+ else
+ 0.0
+ end
+ end
+ nil
+ end
+end
+
+class Plane
+ def initialize(p, n)
+ @p = p
+ @n = n
+ end
+
+ def intersect(ray, isect)
+ d = -@p.vdot(@n)
+ v = ray.dir.vdot(@n)
+ v0 = v
+ if v < 0.0 then
+ v0 = -v
+ end
+ if v0 < 1.0e-17 then
+ return
+ end
+
+ t = -(ray.org.vdot(@n) + d) / v
+
+ if t > 0.0 and t < isect.t then
+ isect.hit = true
+ isect.t = t
+ isect.n = @n
+ isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+ ray.org.y + t * ray.dir.y,
+ ray.org.z + t * ray.dir.z)
+ end
+ nil
+ end
+end
+
+class Ray
+ def initialize(org, dir)
+ @org = org
+ @dir = dir
+ end
+
+ attr_accessor :org, :dir
+end
+
+class Isect
+ def initialize
+ @t = 10000000.0
+ @hit = false
+ @pl = Vec.new(0.0, 0.0, 0.0)
+ @n = Vec.new(0.0, 0.0, 0.0)
+ end
+
+ attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+ i = f * 255.5
+ if i > 255.0 then
+ i = 255.0
+ end
+ if i < 0.0 then
+ i = 0.0
+ end
+ i.to_i
+end
+
+def otherBasis(basis, n)
+ basis[2] = Vec.new(n.x, n.y, n.z)
+ basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+ if n.x < 0.6 and n.x > -0.6 then
+ basis[1].x = 1.0
+ elsif n.y < 0.6 and n.y > -0.6 then
+ basis[1].y = 1.0
+ elsif n.z < 0.6 and n.z > -0.6 then
+ basis[1].z = 1.0
+ else
+ basis[1].x = 1.0
+ end
+
+ basis[0] = basis[1].vcross(basis[2])
+ basis[0] = basis[0].vnormalize
+
+ basis[1] = basis[2].vcross(basis[0])
+ basis[1] = basis[1].vnormalize
+end
+
+class Scene
+ def initialize
+ @spheres = Array.new
+ @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+ @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+ @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+ @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+ end
+
+ def ambient_occlusion(isect)
+ basis = Array.new
+ otherBasis(basis, isect.n)
+
+ ntheta = NAO_SAMPLES
+ nphi = NAO_SAMPLES
+ eps = 0.0001
+ occlusion = 0.0
+
+ p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+ isect.pl.y + eps * isect.n.y,
+ isect.pl.z + eps * isect.n.z)
+ nphi.times do |j|
+ ntheta.times do |i|
+ r = rand
+ phi = 2.0 * 3.14159265 * rand
+ x = Math.cos(phi) * Math.sqrt(1.0 - r)
+ y = Math.sin(phi) * Math.sqrt(1.0 - r)
+ z = Math.sqrt(r)
+
+ rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+ ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+ rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+ raydir = Vec.new(rx, ry, rz)
+ ray = Ray.new(p0, raydir)
+
+ occisect = Isect.new
+ @spheres[0].intersect(ray, occisect)
+ @spheres[1].intersect(ray, occisect)
+ @spheres[2].intersect(ray, occisect)
+ @plane.intersect(ray, occisect)
+ if occisect.hit then
+ occlusion = occlusion + 1.0
+ else
+ 0.0
+ end
+ end
+ end
+
+ occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+ Vec.new(occlusion, occlusion, occlusion)
+ end
+
+ def render(w, h, nsubsamples)
+ cnt = 0
+ nsf = nsubsamples.to_f
+ h.times do |y|
+ w.times do |x|
+ rad = Vec.new(0.0, 0.0, 0.0)
+
+ # Subsmpling
+ nsubsamples.times do |v|
+ nsubsamples.times do |u|
+
+ cnt = cnt + 1
+ wf = w.to_f
+ hf = h.to_f
+ xf = x.to_f
+ yf = y.to_f
+ uf = u.to_f
+ vf = v.to_f
+
+ px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+ py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+ eye = Vec.new(px, py, -1.0).vnormalize
+
+ ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+ isect = Isect.new
+ @spheres[0].intersect(ray, isect)
+ @spheres[1].intersect(ray, isect)
+ @spheres[2].intersect(ray, isect)
+ @plane.intersect(ray, isect)
+ if isect.hit then
+ col = ambient_occlusion(isect)
+ rad.x = rad.x + col.x
+ rad.y = rad.y + col.y
+ rad.z = rad.z + col.z
+ end
+ end
+ end
+
+ r = rad.x / (nsf * nsf)
+ g = rad.y / (nsf * nsf)
+ b = rad.z / (nsf * nsf)
+ printf("%c", clamp(r))
+ printf("%c", clamp(g))
+ printf("%c", clamp(b))
+ end
+ nil
+ end
+
+ nil
+ end
+end
+
+alias printf_orig printf
+def printf *args
+end
+
+# File.open("ao.ppm", "w") do |fp|
+ printf("P6\n")
+ printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+ printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+ Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
new file mode 100644
index 0000000000..77c66a7949
--- /dev/null
+++ b/benchmark/bm_app_erb.rb
@@ -0,0 +1,26 @@
+#
+# Create many HTML strings with ERB.
+#
+
+require 'erb'
+
+data = DATA.read
+max = 15_000
+title = "hello world!"
+content = "hello world!\n" * 10
+
+max.times{
+ ERB.new(data).result(binding)
+}
+
+__END__
+
+<html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+</html>
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/bm_app_factorial.rb
new file mode 100644
index 0000000000..45f471dfdb
--- /dev/null
+++ b/benchmark/bm_app_factorial.rb
@@ -0,0 +1,11 @@
+def fact(n)
+ if(n > 1)
+ n * fact(n-1)
+ else
+ 1
+ end
+end
+
+100.times {
+ fact(5000)
+}
diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb
new file mode 100644
index 0000000000..34a7b2e725
--- /dev/null
+++ b/benchmark/bm_app_fib.rb
@@ -0,0 +1,10 @@
+def fib n
+ if n < 3
+ 1
+ else
+ fib(n-1) + fib(n-2)
+ end
+end
+
+fib(34)
+
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
new file mode 100644
index 0000000000..801b75e8e2
--- /dev/null
+++ b/benchmark/bm_app_mandelbrot.rb
@@ -0,0 +1,23 @@
+require 'complex'
+
+def mandelbrot? z
+ i = 0
+ while i<100
+ i += 1
+ z = z * z
+ return false if z.abs > 2
+ end
+ true
+end
+
+ary = []
+
+(0..1000).each{|dx|
+ (0..1000).each{|dy|
+ x = dx / 50.0
+ y = dy / 50.0
+ c = Complex(x, y)
+ ary << c if mandelbrot?(c)
+ }
+}
+
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
new file mode 100644
index 0000000000..59c63f358e
--- /dev/null
+++ b/benchmark/bm_app_pentomino.rb
@@ -0,0 +1,259 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+ nb.each{|x|
+ a[n] = x
+ if n == NP-1
+ $p << [a.sort]
+ else
+ nbc=nb.dup
+ [-ROW, -1, 1, ROW].each{|d|
+ if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+ nbc << x+d
+ end
+ }
+ nbc.delete x
+ piece(n+1,a[0..n],nbc)
+ end
+ }
+end
+
+def kikaku(a)
+ a.collect {|x| x - a[0]}
+end
+def ud(a)
+ kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+ kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+ kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+ piece(0,[],[0])
+ $p.each do |a|
+ a0 = a[0]
+ a[1] = ud(a0)
+ a[2] = rl(a0)
+ a[3] = ud(rl(a0))
+ a[4] = xy(a0)
+ a[5] = ud(xy(a0))
+ a[6] = rl(xy(a0))
+ a[7] = ud(rl(xy(a0)))
+ a.sort!
+ a.uniq!
+ end
+ $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+ (0...ROW*COL).each{|i|
+ if i % ROW >= ROW-NP
+ $b[i] = -2
+ else
+ $b[i] = -1
+ end
+ $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+ }
+end
+
+def pboard
+ return # skip print
+ print "No. #$no\n"
+ (0...COL).each{|i|
+ print "|"
+ (0...ROW-NP).each{|j|
+ x = $b[i*ROW+j]
+ if x < 0
+ print "..|"
+ else
+ printf "%2d|",x+1
+ end
+ }
+ print "\n"
+ }
+ print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+ if a.length == $p.length then
+ $no += 1
+ pboard
+ return
+ end
+ while $b[pos] != -1
+ pos += 1
+ end
+ ($pnum - a).each do |i|
+ $p[i].each do |x|
+ f = 0
+ x.each{|s|
+ if $b[pos+s] != -1
+ f=1
+ break
+ end
+ }
+ if f == 0 then
+ x.each{|s|
+ $b[pos+s] = i
+ }
+ a << i
+ setpiece(a.dup, pos)
+ a.pop
+ x.each{|s|
+ $b[pos+s] = -1
+ }
+ end
+ end
+ end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
+
+
+__END__
+
+# original
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n,a,nb)
+ for x in nb
+ a[n] = x
+ if n == NP-1
+ $p << [a.sort]
+ else
+ nbc=nb.dup
+ for d in [-ROW, -1, 1, ROW]
+ if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+ nbc << x+d
+ end
+ end
+ nbc.delete x
+ piece(n+1,a[0..n],nbc)
+ end
+ end
+end
+
+def kikaku(a)
+ a.collect {|x| x - a[0]}
+end
+def ud(a)
+ kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+ kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+ kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+ piece(0,[],[0])
+ $p.each do |a|
+ a0 = a[0]
+ a[1] = ud(a0)
+ a[2] = rl(a0)
+ a[3] = ud(rl(a0))
+ a[4] = xy(a0)
+ a[5] = ud(xy(a0))
+ a[6] = rl(xy(a0))
+ a[7] = ud(rl(xy(a0)))
+ a.sort!
+ a.uniq!
+ end
+ $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+ for i in 0...ROW*COL
+ if i % ROW >= ROW-NP
+ $b[i] = -2
+ else
+ $b[i] = -1
+ end
+ $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+ end
+end
+
+def pboard
+ print "No. #$no\n"
+ for i in 0...COL
+ print "|"
+ for j in 0...ROW-NP
+ x = $b[i*ROW+j]
+ if x < 0
+ print "..|"
+ else
+ printf "%2d|",x+1
+ end
+ end
+ print "\n"
+ end
+ print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+ if a.length == $p.length then
+ $no += 1
+ pboard
+ return
+ end
+ while $b[pos] != -1
+ pos += 1
+ end
+ ($pnum - a).each do |i|
+ $p[i].each do |x|
+ f = 0
+ for s in x do
+ if $b[pos+s] != -1
+ f=1
+ break
+ end
+ end
+ if f == 0 then
+ for s in x do
+ $b[pos+s] = i
+ end
+ a << i
+ setpiece(a.dup, pos)
+ a.pop
+ for s in x do
+ $b[pos+s] = -1
+ end
+ end
+ end
+ end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/bm_app_raise.rb
new file mode 100644
index 0000000000..5db8f95d50
--- /dev/null
+++ b/benchmark/bm_app_raise.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<300000
+ i += 1
+ begin
+ raise
+ rescue
+ end
+end
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/bm_app_strconcat.rb
new file mode 100644
index 0000000000..7eed7c1aed
--- /dev/null
+++ b/benchmark/bm_app_strconcat.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<2_000_000
+ "#{1+1} #{1+1} #{1+1}"
+ i += 1
+end
diff --git a/benchmark/bm_app_tak.rb b/benchmark/bm_app_tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/bm_app_tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+ unless y < x
+ z
+ else
+ tak( tak(x-1, y, z),
+ tak(y-1, z, x),
+ tak(z-1, x, y))
+ end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/bm_app_tarai.rb
new file mode 100644
index 0000000000..4c146f5ccf
--- /dev/null
+++ b/benchmark/bm_app_tarai.rb
@@ -0,0 +1,10 @@
+def tarai( x, y, z )
+ if x <= y
+ then y
+ else tarai(tarai(x-1, y, z),
+ tarai(y-1, z, x),
+ tarai(z-1, x, y))
+ end
+end
+
+tarai(12, 6, 0)
diff --git a/benchmark/bm_app_uri.rb b/benchmark/bm_app_uri.rb
new file mode 100644
index 0000000000..586edfd5dc
--- /dev/null
+++ b/benchmark/bm_app_uri.rb
@@ -0,0 +1,8 @@
+require 'uri'
+
+100_000.times{
+ uri = URI.parse('http://www.ruby-lang.org')
+ uri.scheme
+ uri.host
+ uri.port
+}
diff --git a/benchmark/bm_hash_flatten.rb b/benchmark/bm_hash_flatten.rb
new file mode 100644
index 0000000000..e944aae9f2
--- /dev/null
+++ b/benchmark/bm_hash_flatten.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+1000.times do
+ h.flatten
+end
diff --git a/benchmark/bm_hash_keys.rb b/benchmark/bm_hash_keys.rb
new file mode 100644
index 0000000000..6863cd01f9
--- /dev/null
+++ b/benchmark/bm_hash_keys.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do
+ h.keys
+end
diff --git a/benchmark/bm_hash_shift.rb b/benchmark/bm_hash_shift.rb
new file mode 100644
index 0000000000..a645671a5b
--- /dev/null
+++ b/benchmark/bm_hash_shift.rb
@@ -0,0 +1,10 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+50000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/bm_hash_values.rb b/benchmark/bm_hash_values.rb
new file mode 100644
index 0000000000..069441302f
--- /dev/null
+++ b/benchmark/bm_hash_values.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do
+ h.values
+end
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb
new file mode 100644
index 0000000000..2f205c1333
--- /dev/null
+++ b/benchmark/bm_io_file_create.rb
@@ -0,0 +1,13 @@
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+ f = open(file, 'w')
+ f.close#(true)
+}
+File.unlink(file)
+
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb
new file mode 100644
index 0000000000..b9e796ed30
--- /dev/null
+++ b/benchmark/bm_io_file_read.rb
@@ -0,0 +1,15 @@
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world! " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+ f.seek 0
+ f.read
+}
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb
new file mode 100644
index 0000000000..aa1be0e5fe
--- /dev/null
+++ b/benchmark/bm_io_file_write.rb
@@ -0,0 +1,14 @@
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world! " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+ f.seek 0
+ f.write str
+}
diff --git a/benchmark/bm_io_select.rb b/benchmark/bm_io_select.rb
new file mode 100644
index 0000000000..19248daeb1
--- /dev/null
+++ b/benchmark/bm_io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+ IO.select nil, w
+}
+
diff --git a/benchmark/bm_io_select2.rb b/benchmark/bm_io_select2.rb
new file mode 100644
index 0000000000..10e37d71b2
--- /dev/null
+++ b/benchmark/bm_io_select2.rb
@@ -0,0 +1,22 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+if defined?(Process::RLIMIT_NOFILE)
+ max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+ max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+ ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+ IO.select nil, last
+end
+
diff --git a/benchmark/bm_io_select3.rb b/benchmark/bm_io_select3.rb
new file mode 100644
index 0000000000..7d0ba1f092
--- /dev/null
+++ b/benchmark/bm_io_select3.rb
@@ -0,0 +1,21 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+if defined?(Process::RLIMIT_NOFILE)
+ max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+ max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+ r, w = IO.pipe
+ r.close
+ ios.push w
+end
+
+nr.times do
+ IO.select nil, ios
+end
+
diff --git a/benchmark/bm_loop_for.rb b/benchmark/bm_loop_for.rb
new file mode 100644
index 0000000000..0fc4cc1511
--- /dev/null
+++ b/benchmark/bm_loop_for.rb
@@ -0,0 +1,3 @@
+for i in 1..30_000_000
+ #
+end
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
new file mode 100644
index 0000000000..d3375c744c
--- /dev/null
+++ b/benchmark/bm_loop_generator.rb
@@ -0,0 +1,14 @@
+max = 600000
+
+if defined? Fiber
+ gen = (1..max).each
+ loop do
+ gen.next
+ end
+else
+ require 'generator'
+ gen = Generator.new((0..max))
+ while gen.next?
+ gen.next
+ end
+end
diff --git a/benchmark/bm_loop_times.rb b/benchmark/bm_loop_times.rb
new file mode 100644
index 0000000000..521f72ad1a
--- /dev/null
+++ b/benchmark/bm_loop_times.rb
@@ -0,0 +1 @@
+30_000_000.times{|e|}
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
new file mode 100644
index 0000000000..0072822c06
--- /dev/null
+++ b/benchmark/bm_loop_whileloop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+ i += 1
+end
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
new file mode 100644
index 0000000000..47d02dffc4
--- /dev/null
+++ b/benchmark/bm_loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i = 0
+while i< 6_000_000 # benchmark loop 2
+ i += 1
+end
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
new file mode 100644
index 0000000000..7db5be9050
--- /dev/null
+++ b/benchmark/bm_so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
new file mode 100644
index 0000000000..2b8fce8f99
--- /dev/null
+++ b/benchmark/bm_so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+ x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+ (n-1).step(0,-1) do |bi|
+ y[bi] += x.at(bi)
+ end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
new file mode 100644
index 0000000000..b1693e4109
--- /dev/null
+++ b/benchmark/bm_so_binary_trees.rb
@@ -0,0 +1,62 @@
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+alias puts_orig puts
+def puts str
+ # disable puts
+end
+
+def item_check(tree)
+ if tree[0] == nil
+ tree[1]
+ else
+ tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+ item_item = 2 * item
+ depth -= 1
+ [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+ [nil, item, nil]
+ end
+end
+
+max_depth = 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+ temp_tree = bottom_up_tree(i, depth)
+ check += item_check(temp_tree)
+
+ temp_tree = bottom_up_tree(-i, depth)
+ check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
+
+undef puts
+alias puts puts_orig
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
new file mode 100644
index 0000000000..873214de7c
--- /dev/null
+++ b/benchmark/bm_so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+ i += 1
+ hello = ''
+ 4_000_000.times do |e|
+ hello << STUFF
+ end
+end
+# puts hello.length
+
+
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
new file mode 100644
index 0000000000..65f6337a4a
--- /dev/null
+++ b/benchmark/bm_so_count_words.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan
+
+input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+nl = nw = nc = 0
+while true
+ tmp = input.read(4096) or break
+ data = tmp << (input.gets || "")
+ nc += data.length
+ nl += data.count("\n")
+ ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+ nw += data.count(" ") + 1
+end
+# STDERR.puts "#{nl} #{nw} #{nc}"
+
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
new file mode 100644
index 0000000000..deb003a594
--- /dev/null
+++ b/benchmark/bm_so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+class Hi_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+def some_function(num)
+ begin
+ hi_function(num)
+ rescue
+ print "We shouldn't get here, exception is: #{$!.type}\n"
+ end
+end
+
+def hi_function(num)
+ begin
+ lo_function(num)
+ rescue Hi_Exception
+ $HI = $HI + 1
+ end
+end
+
+def lo_function(num)
+ begin
+ blowup(num)
+ rescue Lo_Exception
+ $LO = $LO + 1
+ end
+end
+
+def blowup(num)
+ if num % 2 == 0
+ raise Lo_Exception.new(num)
+ else
+ raise Hi_Exception.new(num)
+ end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+ i += 1
+ some_function(i+1)
+end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
new file mode 100644
index 0000000000..bac5ecd44c
--- /dev/null
+++ b/benchmark/bm_so_fannkuch.rb
@@ -0,0 +1,45 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+ maxFlips, m, r, check = 0, n-1, n, 0
+ count = (1..n).to_a
+ perm = (1..n).to_a
+
+ while true
+ if check < 30
+ puts "#{perm}"
+ check += 1
+ end
+
+ while r != 1
+ count[r-1] = r
+ r -= 1
+ end
+
+ if perm[0] != 1 and perm[m] != n
+ perml = perm.clone #.dup
+ flips = 0
+ while (k = perml.first ) != 1
+ perml = perml.slice!(0, k).reverse + perml
+ flips += 1
+ end
+ maxFlips = flips if flips > maxFlips
+ end
+ while true
+ if r==n then return maxFlips end
+ perm.insert r,perm.shift
+ break if (count[r] -= 1) > 0
+ r += 1
+ end
+ end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
new file mode 100644
index 0000000000..3f759ba7ae
--- /dev/null
+++ b/benchmark/bm_so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random (max,im=139968,ia=3877,ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+]
+homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
new file mode 100644
index 0000000000..dadab3e79c
--- /dev/null
+++ b/benchmark/bm_so_k_nucleotide.rb
@@ -0,0 +1,48 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# contributed by jose fco. gonzalez
+# modified by Sokolov Yura
+
+seq = String.new
+
+def frecuency( seq,length )
+ n, table = seq.length - length + 1, Hash.new(0)
+ f, i = nil, nil
+ (0 ... length).each do |f|
+ (f ... n).step(length) do |i|
+ table[seq[i,length]] += 1
+ end
+ end
+ [n,table]
+
+end
+
+def sort_by_freq( seq,length )
+ n,table = frecuency( seq,length )
+ a, b, v = nil, nil, nil
+ table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+ puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+ end
+ puts
+end
+
+def find_seq( seq,s )
+ n,table = frecuency( seq,s.length )
+ puts "#{table[s].to_s}\t#{s.upcase}"
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+line = input.gets while line !~ /^>THREE/
+line = input.gets
+
+while (line !~ /^>/) & line do
+ seq << line.chomp
+ line = input.gets
+end
+
+[1,2].each {|i| sort_by_freq( seq,i ) }
+
+%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+
diff --git a/benchmark/bm_so_lists.rb b/benchmark/bm_so_lists.rb
new file mode 100644
index 0000000000..e8f4a2a5f7
--- /dev/null
+++ b/benchmark/bm_so_lists.rb
@@ -0,0 +1,47 @@
+#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
+
+NUM = 300
+SIZE = 10000
+
+def test_lists()
+ # create a list of integers (Li1) from 1 to SIZE
+ li1 = (1..SIZE).to_a
+ # copy the list to li2 (not by individual items)
+ li2 = li1.dup
+ # remove each individual item from left side of li2 and
+ # append to right side of li3 (preserving order)
+ li3 = Array.new
+ while (not li2.empty?)
+ li3.push(li2.shift)
+ end
+ # li2 must now be empty
+ # remove each individual item from right side of li3 and
+ # append to right side of li2 (reversing list)
+ while (not li3.empty?)
+ li2.push(li3.pop)
+ end
+ # li3 must now be empty
+ # reverse li1 in place
+ li1.reverse!
+ # check that first item is now SIZE
+ if li1[0] != SIZE then
+ p "not SIZE"
+ 0
+ else
+ # compare li1 and li2 for equality
+ if li1 != li2 then
+ return(0)
+ else
+ # return the length of the list
+ li1.length
+ end
+ end
+end
+
+i = 0
+while i<NUM
+ i += 1
+ result = test_lists()
+end
+
+result
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb
new file mode 100644
index 0000000000..76331c64b8
--- /dev/null
+++ b/benchmark/bm_so_mandelbrot.rb
@@ -0,0 +1,57 @@
+# The Computer Language Benchmarks Game
+# http://shootout.alioth.debian.org/
+#
+# contributed by Karl von Laudermann
+# modified by Jeremy Echols
+
+size = 600 # ARGV[0].to_i
+
+puts "P4\n#{size} #{size}"
+
+ITER = 49 # Iterations - 1 for easy for..in looping
+LIMIT_SQUARED = 4.0 # Presquared limit
+
+byte_acc = 0
+bit_num = 0
+
+count_size = size - 1 # Precomputed size for easy for..in looping
+
+# For..in loops are faster than .upto, .downto, .times, etc.
+for y in 0..count_size
+ for x in 0..count_size
+ zr = 0.0
+ zi = 0.0
+ cr = (2.0*x/size)-1.5
+ ci = (2.0*y/size)-1.0
+ escape = false
+
+ # To make use of the for..in code, we use a dummy variable,
+ # like one would in C
+ for dummy in 0..ITER
+ tr = zr*zr - zi*zi + cr
+ ti = 2*zr*zi + ci
+ zr, zi = tr, ti
+
+ if (zr*zr+zi*zi) > LIMIT_SQUARED
+ escape = true
+ break
+ end
+ end
+
+ byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
+ bit_num += 1
+
+ # Code is very similar for these cases, but using separate blocks
+ # ensures we skip the shifting when it's unnecessary, which is most cases.
+ if (bit_num == 8)
+ print byte_acc.chr
+ byte_acc = 0
+ bit_num = 0
+ elsif (x == count_size)
+ byte_acc <<= (8 - bit_num)
+ print byte_acc.chr
+ byte_acc = 0
+ bit_num = 0
+ end
+ end
+end
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
new file mode 100644
index 0000000000..e2c5c8e559
--- /dev/null
+++ b/benchmark/bm_so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+ count = 1
+ mx = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ row[j] = count
+ count += 1
+ end
+ mx[bi] = row
+ end
+ mx
+end
+
+def mmult(rows, cols, m1, m2)
+ m3 = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ val = 0
+ (0 .. (cols - 1)).each do |k|
+ val += m1.at(bi).at(k) * m2.at(k).at(j)
+ end
+ row[j] = val
+ end
+ m3[bi] = row
+ end
+ m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+ mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
new file mode 100644
index 0000000000..99cf6a91cc
--- /dev/null
+++ b/benchmark/bm_so_meteor_contest.rb
@@ -0,0 +1,564 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+# contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM: the main body is at the bottom.
+# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# 2) see how I represent a board as a bitmask by reading the blank_board comments
+# 3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+ # an array (by location) containing a bit mask for how the piece maps at the given location.
+ # if the rotation is invalid at that location the mask will contain false
+ attr_reader :start_masks
+
+ # maps a direction to a relative location. these differ depending on whether it is an even or
+ # odd row being mapped from
+ @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+ @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+ def initialize( directions )
+ @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+ @even_mask = mask_for_offsets( @even_offsets)
+ @odd_mask = mask_for_offsets( @odd_offsets)
+
+ @start_masks = Array.new(60)
+
+ # create the rotational masks by placing the base mask at the location and seeing if
+ # 1) it overlaps the boundries and 2) it produces a prunable board. if either of these
+ # is true the piece cannot be placed
+ 0.upto(59) do | offset |
+ mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+ if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+ imask = compute_required( mask, offset)
+ @start_masks[offset] = [ mask, imask, imask | mask ]
+ else
+ @start_masks[offset] = false
+ end
+ end
+ end
+
+ def compute_required( mask, offset )
+ board = blank_board
+ 0.upto(offset) { | i | board |= 1 << i }
+ board |= mask
+ return 0 if (!prunable(board | mask, offset))
+ board = flood_fill(board,58)
+ count = 0
+ imask = 0
+ 0.upto(59) do | i |
+ if (board[i] == 0) then
+ imask |= (1 << i)
+ count += 1
+ end
+ end
+ (count > 0 && count < 5) ? imask : 0
+ end
+
+ def flood_fill( board, location)
+ return board if (board[location] == 1)
+ board |= 1 << location
+ row, col = location.divmod(6)
+ board = flood_fill( board, location - 1) if (col > 0)
+ board = flood_fill( board, location + 1) if (col < 4)
+ if (row % 2 == 0) then
+ board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+ else
+ board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+ end
+ board
+ end
+
+ # given a location, produces a list of relative locations covered by the piece at this rotation
+ def offsets( location)
+ if is_even( location) then
+ @even_offsets.collect { | value | value + location }
+ else
+ @odd_offsets.collect { | value | value + location }
+ end
+ end
+
+ # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+ # this is hard to explain. imagine we have this partial board:
+ # 0 0 0 0 0 x [positions 0-5]
+ # 0 0 1 1 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 1 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # The top-left of the piece is at position 8, the
+ # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+ # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+ # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
+ # 0 0 0 1 1 x [positions 0-5]
+ # 0 0 1 0 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 0 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+ # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+ # this function would return
+ def normalize_offsets( values)
+ min = values.min
+ even_min = is_even(min)
+ other_min = even_min ? min + 6 : min + 7
+ other_values = values.collect do | value |
+ if is_even(value) then
+ value + 6 - other_min
+ else
+ value + 7 - other_min
+ end
+ end
+ values.collect! { | value | value - min }
+
+ if even_min then
+ [values, other_values]
+ else
+ [other_values, values]
+ end
+ end
+
+ # produce a bitmask representation of an array of offset locations
+ def mask_for_offsets( offsets )
+ mask = 0
+ offsets.each { | value | mask = mask + ( 1 << value ) }
+ mask
+ end
+
+ # finds a "safe" position that a position as described by a list of directions can be placed
+ # without falling off any edge of the board. the values returned a location to place the first piece
+ # at so it will fit after making the described moves
+ def start_adjust( directions )
+ south = east = 0;
+ directions.each do | direction |
+ east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+ south += 1 if ( direction == :nw || direction == :ne )
+ end
+ south * 6 + east
+ end
+
+ # given a set of directions places the piece (as defined by a set of directions) on the board at
+ # a location that will not take it off the edge
+ def get_values ( directions )
+ start = start_adjust(directions)
+ values = [ start ]
+ directions.each do | direction |
+ if (start % 12 >= 6) then
+ start += @@rotation_odd_adder[direction]
+ else
+ start += @@rotation_even_adder[direction]
+ end
+ values += [ start ]
+ end
+
+ # some moves take you back to an existing location, we'll strip duplicates
+ values.uniq
+ end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+# rotations -- all the rotations of the piece
+# type -- a numeic "name" of the piece
+# masks -- an array by location of all legal rotational masks (a n inner array) for that location
+# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+ attr_reader :rotations, :type, :masks
+ attr_accessor :placed
+
+ # transform hashes that change one direction into another when you either flip or rotate a set of directions
+ @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+ @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+ def initialize( directions, type )
+ @type = type
+ @rotations = Array.new();
+ @map = {}
+
+ generate_rotations( directions )
+ directions.collect! { | value | @@flip_converter[value] }
+ generate_rotations( directions )
+
+ # creates the masks AND a map that returns [location, rotation] for any given mask
+ # this is used when a board is found and we want to draw it, otherwise the map is unused
+ @masks = Array.new();
+ 0.upto(59) do | i |
+ even = true
+ @masks[i] = @rotations.collect do | rotation |
+ mask = rotation.start_masks[i]
+ @map[mask[0]] = [ i, rotation ] if (mask)
+ mask || nil
+ end
+ @masks[i].compact!
+ end
+ end
+
+ # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+ def generate_rotations( directions )
+ 6.times do
+ rotations.push( Rotation.new(directions))
+ directions.collect! { | value | @@rotate_converter[value] }
+ end
+ end
+
+ # given a board string, adds this piece to the board at whatever location/rotation
+ # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+ def fill_string( board_string)
+ location, rotation = @map[@placed]
+ rotation.offsets(location).each do | offset |
+ row, col = offset.divmod(6)
+ board_string[ row*5 + col, 1 ] = @type.to_s
+ end
+ end
+end
+
+# a blank bit board having this form:
+#
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+ 0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+ 0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+ (location % 12) < 6
+end
+
+# support function that create three utility maps:
+# $converter -- for each row an array that maps a five bit row (via array mapping)
+# to the a a five bit representation of the bits below it
+# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+# a region array has three values the first is a mask of bits in the region,
+# the second is the count of those bits and the third is identical to the first
+# examples:
+# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+# 0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+ odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+ even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+ all_odds = Array.new(0b100000)
+ all_evens = Array.new(0b100000)
+ bit_counts = Array.new(0b100000)
+ new_regions = Array.new(0b100000)
+ 0.upto(0b11111) do | i |
+ bit_count = odd = even = 0
+ 0.upto(4) do | bit |
+ if (i[bit] == 1) then
+ bit_count += 1
+ odd |= odd_map[bit]
+ even |= even_map[bit]
+ end
+ end
+ all_odds[i] = odd
+ all_evens[i] = even
+ bit_counts[i] = bit_count
+ new_regions[i] = create_regions( i)
+ end
+
+ $converter = []
+ 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+ $bit_counts = bit_counts
+ $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five. The following board is an example of a prunable board:
+# 0 0 1 0 0
+# 0 1 0 0 0
+# 1 1 0 0 0
+# 0 1 0 0 0
+# 0 0 0 0 0
+# ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+# board -- an initial bit board (6 bit padded rows, see blank_board for format)
+# location -- starting location, everything above and to the left is already full
+# slotting -- set to true only when testing initial pieces, when filling normally
+# additional assumptions are possible
+#
+# Algorithm:
+# The algorithm starts at the top row (as determined by location) and iterates a row at a time
+# maintainng counts of active open areas (kept in the collector array) each collector contains
+# three values at the start of an iteration:
+# 0: mask of bits that would be adjacent to the collector in this row
+# 1: the number of bits collected so far
+# 2: a scratch space starting as zero, but used during the computation to represent
+# the empty bits in the new row that are adjacent (position 0)
+# The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+ collectors = []
+ # loop accross the rows
+ (location / 6).to_i.upto(9) do | row_on |
+ # obtain a set of regions representing the bits of the curent row.
+ regions = $regions[(board >> (row_on * 6)) & 0b11111]
+ converter = $converter[row_on]
+
+ # track the number of collectors at the start of the cycle so that
+ # we don't compute against newly created collectors, only existing collectors
+ initial_collector_count = collectors.length
+
+ # loop against the regions. For each region of the row
+ # we will see if it connects to one or more existing collectors.
+ # if it connects to 1 collector, the bits from the region are added to the
+ # bits of the collector and the mask is placed in collector[2]
+ # If the region overlaps more than one collector then all the collectors
+ # it overlaps with are merged into the first one (the others are set to nil in the array)
+ # if NO collectors are found then the region is copied as a new collector
+ regions.each do | region |
+ collector_found = nil
+ region_mask = region[2]
+ initial_collector_count.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ collector_mask = collector[0]
+ if (collector_mask & region_mask != 0) then
+ if (collector_found) then
+ collector_found[0] |= collector_mask
+ collector_found[1] += collector[1]
+ collector_found[2] |= collector[2]
+ collectors[collector_num] = nil
+ else
+ collector_found = collector
+ collector[1] += region[1]
+ collector[2] |= region_mask
+ end
+ end
+ end
+ end
+ if (collector_found == nil) then
+ collectors.push(Array.new(region))
+ end
+ end
+
+ # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+ # be zero. The size of any such reaason is tested if it is not a muliple of five true is returned since
+ # the board is prunable. if it is a multiple of five it is removed.
+ # Collector that are still active have a new adjacent value [0] set based n the matched bits
+ # and have [2] cleared out for the next cycle.
+ collectors.length.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ if (collector[2] == 0) then
+ return true if (collector[1] % 5 != 0)
+ collectors[collector_num] = nil
+ else
+ # if a collector matches all bits in the row then we can return unprunable early for the
+ # follwing reasons:
+ # 1) there can be no more unavailable bits bince we fill from the top left downward
+ # 2) all previous regions have been closed or joined so only this region can fail
+ # 3) this region must be good since there can never be only 1 region that is nuot
+ # a multiple of five
+ # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+ # in pieces to see what configurations work for them (the only other time this algorithm is used).
+ return false if (collector[2] == 0b11111 && !slotting)
+ collector[0] = converter[collector[2]]
+ collector[2] = 0
+ end
+ end
+ end
+
+ # get rid of all the empty converters for the next round
+ collectors.compact!
+ end
+ return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+ collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask. see prunable for what a "region" is
+def create_regions( value )
+ regions = []
+ cur_region = 0
+ 5.times do | bit |
+ if (value[bit] == 0) then
+ cur_region |= 1 << bit
+ else
+ if (cur_region != 0 ) then
+ regions.push( cur_region)
+ cur_region = 0;
+ end
+ end
+ end
+ regions.push(cur_region) if (cur_region != 0)
+ regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+ find_top( 1)
+ find_top( 0)
+ print_results
+end
+
+# show the board
+def print_results
+ print "#{@boards_found} solutions found\n\n"
+ print_full_board( @min_board)
+ print "\n"
+ print_full_board( @max_board)
+ print "\n"
+end
+
+# finds solutions. This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece. It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+# Since any found solution has an inverse we want to maximize finding solutions that are not already found
+# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
+# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
+# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
+# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+# maximum number
+def find_top( rotation_skip)
+ board = blank_board
+ (@pieces.length-1).times do
+ piece = @pieces.shift
+ piece.masks[0].each do | mask, imask, cmask |
+ if ((rotation_skip += 1) % 2 == 0) then
+ piece.placed = mask
+ find( 1, 1, board | mask)
+ end
+ end
+ @pieces.push(piece)
+ end
+ piece = @pieces.shift
+ @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found. depth is acheived via recursion. the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+# start_location -- where to start looking for place for the next piece at
+# placed -- number of pieces placed
+# board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+ # find the next location to place a piece by looking for an empty bit
+ while board[start_location] == 1
+ start_location += 1
+ end
+
+ @pieces.length.times do
+ piece = @pieces.shift
+ piece.masks[start_location].each do | mask, imask, cmask |
+ if ( board & cmask == imask) then
+ piece.placed = mask
+ if (placed == 9) then
+ add_board
+ else
+ find( start_location + 1, placed + 1, board | mask)
+ end
+ end
+ end
+ @pieces.push(piece)
+ end
+end
+
+# print the board
+def print_full_board( board_string)
+ 10.times do | row |
+ print " " if (row % 2 == 1)
+ 5.times do | col |
+ print "#{board_string[row*5 + col,1]} "
+ end
+ print "\n"
+ end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+ board_string = "99999999999999999999999999999999999999999999999999"
+ @all_pieces.each { | piece | piece.fill_string( board_string ) }
+ save( board_string)
+ save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+ if (@all_boards[board_string] == nil) then
+ @min_board = board_string if (board_string < @min_board)
+ @max_board = board_string if (board_string > @max_board)
+ @all_boards.store(board_string,true)
+ @boards_found += 1
+
+ # the exit motif is a time saver. Ideally the function should return, but those tests
+ # take noticable time (performance).
+ if (@boards_found == @stop_count) then
+ print_results
+ exit(0)
+ end
+ end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+ Piece.new( [ :nw, :ne, :east, :east ], 2),
+ Piece.new( [ :ne, :se, :east, :ne ], 7),
+ Piece.new( [ :ne, :east, :ne, :nw ], 1),
+ Piece.new( [ :east, :sw, :sw, :se ], 6),
+ Piece.new( [ :east, :ne, :se, :ne ], 5),
+ Piece.new( [ :east, :east, :east, :se ], 0),
+ Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+ Piece.new( [ :se, :se, :se, :west ], 9),
+ Piece.new( [ :se, :se, :east, :se ], 8),
+ Piece.new( [ :east, :east, :sw, :se ], 3)
+ ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
+
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
new file mode 100644
index 0000000000..d6c5bb9e61
--- /dev/null
+++ b/benchmark/bm_so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+ def initialize(x, y, z, vx, vy, vz, mass)
+ @x, @y, @z = x, y, z
+ @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+ @mass = mass * SOLAR_MASS
+ end
+
+ def move_from_i(bodies, nbodies, dt, i)
+ while i < nbodies
+ b2 = bodies[i]
+ dx = @x - b2.x
+ dy = @y - b2.y
+ dz = @z - b2.z
+
+ distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+ mag = dt / (distance * distance * distance)
+ b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+ @vx -= dx * b2_mass_mag
+ @vy -= dy * b2_mass_mag
+ @vz -= dz * b2_mass_mag
+ b2.vx += dx * b_mass_mag
+ b2.vy += dy * b_mass_mag
+ b2.vz += dz * b_mass_mag
+ i += 1
+ end
+
+ @x += dt * @vx
+ @y += dt * @vy
+ @z += dt * @vz
+ end
+end
+
+def energy(bodies)
+ e = 0.0
+ nbodies = bodies.size
+
+ for i in 0 ... nbodies
+ b = bodies[i]
+ e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+ for j in (i + 1) ... nbodies
+ b2 = bodies[j]
+ dx = b.x - b2.x
+ dy = b.y - b2.y
+ dz = b.z - b2.z
+ distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+ e -= (b.mass * b2.mass) / distance
+ end
+ end
+ e
+end
+
+def offset_momentum(bodies)
+ px, py, pz = 0.0, 0.0, 0.0
+
+ for b in bodies
+ m = b.mass
+ px += b.vx * m
+ py += b.vy * m
+ pz += b.vz * m
+ end
+
+ b = bodies[0]
+ b.vx = - px / SOLAR_MASS
+ b.vy = - py / SOLAR_MASS
+ b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+ # sun
+ Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+ # jupiter
+ Planet.new(
+ 4.84143144246472090e+00,
+ -1.16032004402742839e+00,
+ -1.03622044471123109e-01,
+ 1.66007664274403694e-03,
+ 7.69901118419740425e-03,
+ -6.90460016972063023e-05,
+ 9.54791938424326609e-04),
+
+ # saturn
+ Planet.new(
+ 8.34336671824457987e+00,
+ 4.12479856412430479e+00,
+ -4.03523417114321381e-01,
+ -2.76742510726862411e-03,
+ 4.99852801234917238e-03,
+ 2.30417297573763929e-05,
+ 2.85885980666130812e-04),
+
+ # uranus
+ Planet.new(
+ 1.28943695621391310e+01,
+ -1.51111514016986312e+01,
+ -2.23307578892655734e-01,
+ 2.96460137564761618e-03,
+ 2.37847173959480950e-03,
+ -2.96589568540237556e-05,
+ 4.36624404335156298e-05),
+
+ # neptune
+ Planet.new(
+ 1.53796971148509165e+01,
+ -2.59193146099879641e+01,
+ 1.79258772950371181e-01,
+ 2.68067772490389322e-03,
+ 1.62824170038242295e-03,
+ -9.51592254519715870e-05,
+ 5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+ i = 0
+ while i < nbodies
+ b = BODIES[i]
+ b.move_from_i(BODIES, nbodies, dt, i + 1)
+ i += 1
+ end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
new file mode 100644
index 0000000000..a0513f8c47
--- /dev/null
+++ b/benchmark/bm_so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+ n.times do
+ n.times do
+ n.times do
+ n.times do
+ n.times do
+ x += 1
+ end
+ end
+ end
+ end
+ end
+end
+# puts x
+
+
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/bm_so_nsieve.rb
new file mode 100644
index 0000000000..a65cc78233
--- /dev/null
+++ b/benchmark/bm_so_nsieve.rb
@@ -0,0 +1,35 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Glenn Parker, March 2005
+# modified by Evan Phoenix, Sept 2006
+
+def sieve(m)
+ flags = Flags.dup[0,m]
+ count = 0
+ pmax = m - 1
+ p = 2
+ while p <= pmax
+ unless flags[p].zero?
+ count += 1
+ mult = p
+ while mult <= pmax
+ flags[mult] = 0
+ mult += p
+ end
+ end
+ p += 1
+ end
+ count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
+
+n.downto(n-2) do |exponent|
+ break if exponent < 0
+ m = (1 << exponent) * 10_000
+ # m = (2 ** exponent) * 10_000
+ count = sieve(m)
+ printf "Primes up to %8d %8d\n", m, count
+end
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/bm_so_nsieve_bits.rb
new file mode 100644
index 0000000000..6f958ee44e
--- /dev/null
+++ b/benchmark/bm_so_nsieve_bits.rb
@@ -0,0 +1,43 @@
+#!/usr/bin/ruby
+#coding: us-ascii
+#
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# nsieve-bits in Ruby
+# Contributed by Glenn Parker, March 2005
+
+CharExponent = 3
+BitsPerChar = 1 << CharExponent
+LowMask = BitsPerChar - 1
+
+def sieve(m)
+ items = "\xFF" * ((m / BitsPerChar) + 1)
+ masks = ""
+ BitsPerChar.times do |b|
+ masks << (1 << b).chr
+ end
+
+ count = 0
+ pmax = m - 1
+ 2.step(pmax, 1) do |p|
+ if items[p >> CharExponent][p & LowMask] == 1
+ count += 1
+ p.step(pmax, p) do |mult|
+ a = mult >> CharExponent
+ b = mult & LowMask
+ items[a] -= masks[b] if items[a][b] != 0
+ end
+ end
+ end
+ count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+n.step(n - 2, -1) do |exponent|
+ break if exponent < 0
+ m = 2 ** exponent * 10_000
+ count = sieve(m)
+ printf "Primes up to %8d %8d\n", m, count
+end
+
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
new file mode 100644
index 0000000000..e8607c7199
--- /dev/null
+++ b/benchmark/bm_so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+ def initialize(start_state)
+ @bool = start_state
+ end
+
+ def value
+ @bool
+ end
+
+ def activate
+ @bool = !@bool
+ self
+ end
+end
+
+class NthToggle < Toggle
+ def initialize(start_state, max_counter)
+ super start_state
+ @count_max = max_counter
+ @counter = 0
+ end
+
+ def activate
+ @counter += 1
+ if @counter >= @count_max
+ @bool = !@bool
+ @counter = 0
+ end
+ self
+ end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+ toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+ toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+ ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+ ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/bm_so_partial_sums.rb
new file mode 100644
index 0000000000..630b45cb8d
--- /dev/null
+++ b/benchmark/bm_so_partial_sums.rb
@@ -0,0 +1,31 @@
+n = 2_500_000 # (ARGV.shift || 1).to_i
+
+alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
+
+1.upto(n) do |d|
+ d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
+
+ s0 += (2.0 / 3.0) ** (d - 1.0)
+ s1 += 1.0 / Math.sqrt(d)
+ s2 += 1.0 / (d * (d + 1.0))
+ s3 += 1.0 / (d3 * ds * ds)
+ s4 += 1.0 / (d3 * dc * dc)
+ s5 += 1.0 / d
+ s6 += 1.0 / d2
+ s7 += alt / d
+ s8 += alt / (2.0 * d - 1.0)
+
+ alt = -alt
+end
+
+if false
+ printf("%.9f\t(2/3)^k\n", s0)
+ printf("%.9f\tk^-0.5\n", s1)
+ printf("%.9f\t1/k(k+1)\n", s2)
+ printf("%.9f\tFlint Hills\n", s3)
+ printf("%.9f\tCookson Hills\n", s4)
+ printf("%.9f\tHarmonic\n", s5)
+ printf("%.9f\tRiemann Zeta\n", s6)
+ printf("%.9f\tAlternating Harmonic\n", s7)
+ printf("%.9f\tGregory\n", s8)
+end
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
new file mode 100644