0 files changed, 0 insertions, 0 deletions
diff --git a/.dir-locals.el b/.dir-locals.el
new file mode 100644
index 0000000000..8f4b96445c
--- /dev/null
+++ b/.dir-locals.el
@@ -0,0 +1,39 @@
+;; Copyright (c) 2018 Urabe, Shyouhei.  All rights reserved.
+;;
+;; This file is a part of  the programming language Ruby.  Permission is hereby
+;; granted, to either  redistribute and/or modify this file,  provided that the
+;; conditions mentioned  in the  file COPYING  are met.   Consult the  file for
+;; details.
+
+((nil .
+     ((indent-tabs-mode . nil)
+      (require-final-newline . t)
+      (tab-width . 8)
+      (show-trailing-whitespace . t)
+      (whitespace-line-column . 80))) ;; See also [Misc #12277]
+
+ ;; (bat-mode . ((buffer-file-coding-system . utf-8-dos)))
+
+ (ruby-mode . ((ruby-indent-level . 2)))
+
+ (rdoc-mode . ((fill-column . 74)))
+
+ (yaml-mode . ((yaml-indent-offset . 2)))
+
+ (makefile-mode . ((indent-tabs-mode . t)))
+
+ (c-mode . ((c-file-style . "ruby")))
+
+ (c++-mode . ((c-file-style . "ruby")))
+
+ (change-log-mode .
+     ((buffer-file-coding-system . us-ascii)
+      (indent-tabs-mode . t)
+      (change-log-indent-text . 2)
+      (add-log-time-format . (lambda (&optional x y)
+        (let* ((time (or x (current-time)))
+	       (system-time-locale "C")
+	       (diff (+ (cadr time) 32400))
+	       (lo (% diff 65536))
+	       (hi (+ (car time) (/ diff 65536))))
+        (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))))))
diff --git a/.document b/.document
index fb27ba325d..82ca602bfb 100644
--- a/.document
+++ b/.document
@@ -5,9 +5,36 @@
 
 # Process all the C source files
 *.c
+*.y
 
 # prelude
 prelude.rb
+rbconfig.rb
+
+array.rb
+ast.rb
+dir.rb
+gc.rb
+hash.rb
+io.rb
+kernel.rb
+marshal.rb
+numeric.rb
+nilclass.rb
+pack.rb
+pathname_builtin.rb
+ractor.rb
+string.rb
+symbol.rb
+timev.rb
+thread_sync.rb
+trace_point.rb
+warning.rb
+yjit.rb
+zjit.rb
+
+# Errno::*
+known_errors.inc
 
 # the lib/ directory (which has its own .document file)
 lib
@@ -16,11 +43,14 @@ lib
 ext
 
 # rdoc files
-ChangeLog
-
-NEWS
+NEWS.md
 
 README.md
 README.ja.md
 
+COPYING
+COPYING.ja
+
+LEGAL
+
 doc
diff --git a/.editorconfig b/.editorconfig
index 67abf4b978..4633a7acae 100644
--- a/.editorconfig
+++ b/.editorconfig
@@ -2,15 +2,29 @@ root = true
 
 [*]
 end_of_line = lf
+indent_size = 4
+indent_style = space
 insert_final_newline = true
-trim_trailing_whitespace = true
 tab_width = 8
-indent_style = tab
-indent_size = 4
+trim_trailing_whitespace = true
 
-[**.bat]
+[*.bat]
 end_of_line = crlf
 
-[**.rb]
-indent_style = space
+[*.gemspec]
+indent_size = 2
+
+[*.rb]
+indent_size = 2
+
+[*.yml]
+indent_size = 2
+
+[{*[Mm]akefile*,*.mak,*.mk,depend}]
+indent_style = tab
+
+[enc/*]
+indent_size = 2
+
+[reg*.[ch]]
 indent_size = 2
diff --git a/.gdbinit b/.gdbinit
index 5864bb15ce..bda544c641 100644
--- a/.gdbinit
+++ b/.gdbinit
@@ -1,21 +1,7 @@
-define hook-run
-  set $color_type = 0
-  set $color_highlite = 0
-  set $color_end = 0
-end
-
 define ruby_gdb_init
-  if !$color_type
-    set $color_type = "\033[31m"
-  end
-  if !$color_highlite
-    set $color_highlite = "\033[36m"
-  end
-  if !$color_end
-    set $color_end = "\033[m"
-  end
-  if ruby_dummy_gdb_enums.special_consts
-  end
+  init-if-undefined $color_type = "\033[31m"
+  init-if-undefined $color_highlite = "\033[36m"
+  init-if-undefined $color_end = "\033[m"
 end
 
 # set prompt \033[36m(gdb)\033[m\040
@@ -63,7 +49,15 @@ define rp
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
     printf "%sT_OBJECT%s: ", $color_type, $color_end
-    print (struct RObject *)($arg0)
+    print ((struct RObject *)($arg0))->basic
+    if ($flags & ROBJECT_EMBED)
+      print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (RSHAPE_CAPACITY(rb_obj_shape_id($arg0)))
+    else
+      print (((struct RObject *)($arg0))->as.heap)
+      if (((struct RObject*)($arg0))->as.heap.numiv) > 0
+        print/x *(((struct RObject*)($arg0))->as.heap.ivptr) @ (((struct RObject*)($arg0))->as.heap.numiv)
+      end
+    end
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
     printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
@@ -89,14 +83,13 @@ define rp
     set $regsrc = ((struct RRegexp*)($arg0))->src
     set $rsflags = ((struct RBasic*)$regsrc)->flags
     printf "%sT_REGEXP%s: ", $color_type, $color_end
+    set $len = ((struct RString*)($arg0))->len
     set print address off
-    output (char *)(($rsflags & RUBY_FL_USER1) ? \
-	    ((struct RString*)$regsrc)->as.heap.ptr : \
-	    ((struct RString*)$regsrc)->as.ary)
+    output *(char *)(($rsflags & RUBY_FL_USER1) ? \
+            ((struct RString*)$regsrc)->as.heap.ptr : \
+            ((struct RString*)$regsrc)->as.embed.ary) @ $len
     set print address on
-    printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
-            ((struct RString*)$regsrc)->as.heap.len : \
-            (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+    printf " len:%ld ", $len
     if $flags & RUBY_FL_USER6
       printf "(none) "
     end
@@ -115,26 +108,26 @@ define rp
       printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
       printf "(embed) "
       if ($len == 0)
-	printf "{(empty)} "
+        printf "{(empty)} "
       else
-	output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
-	printf " "
+        print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+        printf " "
       end
     else
       set $len = ((struct RArray*)($arg0))->as.heap.len
       printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
       if ($flags & RUBY_FL_USER2)
-	printf "(shared) shared="
-	output/x ((struct RArray*)($arg0))->as.heap.aux.shared
-	printf " "
+        printf "(shared) shared="
+        output/x ((struct RArray*)($arg0))->as.heap.aux.shared_root
+        printf " "
       else
-	printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+        printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
       end
       if ($len == 0)
-	printf "{(empty)} "
+        printf "{(empty)} "
       else
-	output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
-	printf " "
+        print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+        printf " "
       end
     end
     print (struct RArray *)($arg0)
@@ -145,34 +138,29 @@ define rp
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_HASH
     printf "%sT_HASH%s: ", $color_type, $color_end,
-    if ((struct RHash *)($arg0))->ntbl
-      printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
+    if (((struct RHash *)($arg0))->basic.flags & RHASH_ST_TABLE_FLAG)
+      set $st = (struct st_table *)((uintptr_t)($arg0) + sizeof(struct RHash))
+      printf "st len=%ld ", $st->num_entries
+      print $st
+    else
+      printf "li len=%ld bound=%ld ", \
+        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_SIZE_MASK) >> RHASH_AR_TABLE_SIZE_SHIFT), \
+        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_BOUND_MASK) >> RHASH_AR_TABLE_BOUND_SHIFT)
+	print (struct ar_table_struct *)((uintptr_t)($arg0) + sizeof(struct RHash))
     end
-    print (struct RHash *)($arg0)
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
-    printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, \
-      (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+    set $len = (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
        ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
        ((struct RStruct *)($arg0))->as.heap.len)
+    printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, $len
     print (struct RStruct *)($arg0)
-    x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
-          ((struct RStruct *)($arg0))->as.ary : \
-          ((struct RStruct *)($arg0))->as.heap.ptr)
+    output/x *(($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+              ((struct RStruct *)($arg0))->as.ary : \
+              ((struct RStruct *)($arg0))->as.heap.ptr) @ $len
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
-    printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
-      (($flags & RUBY_FL_USER1) != 0), \
-      (($flags & RUBY_FL_USER2) ? \
-       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
-       ((struct RBignum*)($arg0))->as.heap.len)
-    if $flags & RUBY_FL_USER2
-      printf "(embed) "
-    end
-    print (struct RBignum *)($arg0)
-    x/xw (($flags & RUBY_FL_USER2) ? \
-          ((struct RBignum*)($arg0))->as.ary : \
-          ((struct RBignum*)($arg0))->as.heap.digits)
+    rp_bignum $arg0
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
     printf "%sT_RATIONAL%s: ", $color_type, $color_end
@@ -197,12 +185,19 @@ define rp
     print (struct RBasic *)($arg0)
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_DATA
-    if ((struct RTypedData *)($arg0))->typed_flag == 1
-      printf "%sT_DATA%s(%s): ", $color_type, $color_end, ((struct RTypedData *)($arg0))->type->wrap_struct_name
-      print (struct RTypedData *)($arg0)
+    if ($flags & RUBY_TYPED_FL_IS_TYPED_DATA)
+      set $data = (struct RTypedData *)($arg0)
+      set $type = (const rb_data_type_t *)($data->type & ~1)
+      printf "%sT_DATA%s(%s): ", $color_type, $color_end, $type->wrap_struct_name
+      print *$type
+      if ($data->type & 1)
+        print (void *)&$data->data
+      else
+        print $data
+      end
     else
       printf "%sT_DATA%s: ", $color_type, $color_end
-      print (struct RData *)($arg0)
+      print *(struct RData *)($arg0)
     end
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
@@ -247,7 +242,7 @@ define rp
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
     printf "%sT_IMEMO%s(", $color_type, $color_end
-    output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&imemo_mask)
+    output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&RUBY_IMEMO_MASK)
     printf "): "
     rp_imemo $arg0
   else
@@ -261,6 +256,10 @@ define rp
     printf "%sT_ZOMBIE%s: ", $color_type, $color_end
     print (struct RData *)($arg0)
   else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MOVED
+    printf "%sT_MOVED%s: ", $color_type, $color_end
+    print *(struct RMoved *)$arg0
+  else
     printf "%sunknown%s: ", $color_type, $color_end
     print (struct RBasic *)($arg0)
   end
@@ -296,6 +295,7 @@ define rp
   end
   end
   end
+  end
 end
 document rp
   Print a Ruby's VALUE.
@@ -327,6 +327,9 @@ define rp_id
   if $id == idLTLT
     printf "(:<<)\n"
   else
+  if $id == idGTGT
+    printf "(:>>)\n"
+  else
   if $id == idLE
     printf "(:<=)\n"
   else
@@ -354,6 +357,18 @@ define rp_id
   if $id == idASET
     printf "(:[]=)\n"
   else
+  if $id == idCOLON2
+    printf "(:'::')\n"
+  else
+  if $id == idANDOP
+    printf "(:&&)\n"
+  else
+  if $id == idOROP
+    printf "(:||)\n"
+  else
+  if $id == idANDDOT
+    printf "(:&.)\n"
+  else
     if $id <= tLAST_OP_ID
       printf "O"
     else
@@ -385,12 +400,13 @@ define rp_id
       end
     end
     printf "(%ld): ", $id
-    set $str = lookup_id_str($id)
-    if $str
-      rp_string $str
-    else
-      echo undef\n
-    end
+    print_id $id
+    echo \n
+  end
+  end
+  end
+  end
+  end
   end
   end
   end
@@ -413,16 +429,31 @@ document rp_id
   Print an ID.
 end
 
-define rp_string
+define output_string
   set $flags = ((struct RBasic*)($arg0))->flags
-  set print address off
-  output (char *)(($flags & RUBY_FL_USER1) ? \
-	    ((struct RString*)($arg0))->as.heap.ptr : \
-	    ((struct RString*)($arg0))->as.ary)
-  set print address on
-  printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
-          ((struct RString*)($arg0))->as.heap.len : \
-          (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+  set $len = ((struct RString*)($arg0))->len
+  if $len > 0
+    output *(char *)(($flags & RUBY_FL_USER1) ? \
+            ((struct RString*)($arg0))->as.heap.ptr : \
+            ((struct RString*)($arg0))->as.embed.ary) @ $len
+  else
+    output ""
+  end
+end
+
+define print_string
+  set $flags = ((struct RBasic*)($arg0))->flags
+  set $len = ((struct RString*)($arg0))->len
+  if $len > 0
+    printf "%s", *(char *)(($flags & RUBY_FL_USER1) ? \
+            ((struct RString*)($arg0))->as.heap.ptr : \
+            ((struct RString*)($arg0))->as.embed.ary) @ $len
+  end
+end
+
+define rp_string
+  output_string $arg0
+  printf " bytesize:%ld ", $len
   if !($flags & RUBY_FL_USER1)
     printf "(embed) "
   else
@@ -453,22 +484,67 @@ document rp_string
   Print the content of a String.
 end
 
+define rp_bignum
+  set $flags = ((struct RBignum*)($arg0))->basic.flags
+  set $len = (($flags & RUBY_FL_USER2) ? \
+       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+       ((struct RBignum*)($arg0))->as.heap.len)
+  printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
+         (($flags & RUBY_FL_USER1) != 0), $len
+  if $flags & RUBY_FL_USER2
+    printf "(embed) "
+  end
+  print (struct RBignum *)($arg0)
+  set $ptr = (($flags & RUBY_FL_USER2) ? \
+              ((struct RBignum*)($arg0))->as.ary : \
+              ((struct RBignum*)($arg0))->as.heap.digits)
+  set $len = $len-1
+  printf "0x%x", $ptr[$len]
+  while $len > 0
+    set $len = $len-1
+    set $val = $ptr[$len]
+    set $w = sizeof($ptr[0])
+    printf "_"
+    if $w > 8
+      printf "%.32x", $val
+    else
+    if $w > 4
+      printf "%.16x", $val
+    else
+    if $w > 2
+      printf "%.8x", $val
+    else
+    if $w > 1
+      printf "%.4x", $val
+    else
+      printf "%.2x", $val
+    end
+    end
+    end
+    end
+  end
+  printf "\n"
+end
+document rp_bignum
+  Print the content of a Bignum.
+end
+
 define rp_class
+  set $class_and_classext = (struct RClass_and_rb_classext_t *)($arg0)
   printf "(struct RClass *) %p", (void*)$arg0
-  if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
-    printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
+  if $class_and_classext->classext->origin_ != (VALUE)$arg0
+    printf " -> %p", $class_and_classext->classext->origin_
   end
   printf "\n"
   rb_classname $arg0
-  print *(struct RClass *)($arg0)
-  print *((struct RClass *)($arg0))->ptr
+  print/x *$class_and_classext
 end
 document rp_class
   Print the content of a Class/Module.
 end
 
 define rp_imemo
-  set $flags = (((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & imemo_mask
+  set $flags = (enum imemo_type)((((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & RUBY_IMEMO_MASK)
   if $flags == imemo_cref
     printf "(rb_cref_t *) %p\n", (void*)$arg0
     print *(rb_cref_t *)$arg0
@@ -489,6 +565,14 @@ define rp_imemo
     printf "(struct MEMO *) %p\n", (void*)$arg0
     print *(struct MEMO *)$arg0
   else
+  if $flags == imemo_ment
+    printf "(rb_method_entry_t *) %p\n", (void*)$arg0
+    print *(rb_method_entry_t *)$arg0
+  else
+  if $flags == imemo_iseq
+    printf "(rb_iseq_t *) %p\n", (void*)$arg0
+    print *(rb_iseq_t *)$arg0
+  else
     printf "(struct RIMemo *) %p\n", (void*)$arg0
     print *(struct RIMemo *)$arg0
   end
@@ -496,6 +580,8 @@ define rp_imemo
   end
   end
   end
+  end
+  end
 end
 document rp_imemo
   Print the content of a memo
@@ -590,11 +676,6 @@ define nd_stts
 end
 
 
-define nd_entry
-  printf "%su3.entry%s: ", $color_highlite, $color_end
-  p ($arg0).u3.entry
-end
-
 define nd_vid
   printf "%su1.id%s: ", $color_highlite, $color_end
   p ($arg0).u1.id
@@ -610,12 +691,6 @@ define nd_cval
   rp ($arg0).u3.value
 end
 
-
-define nd_cnt
-  printf "%su3.cnt%s: ", $color_highlite, $color_end
-  p ($arg0).u3.cnt
-end
-
 define nd_tbl
   printf "%su1.tbl%s: ", $color_highlite, $color_end
   p ($arg0).u1.tbl
@@ -654,12 +729,6 @@ define nd_lit
   rp ($arg0).u1.value
 end
 
-
-define nd_frml
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
 define nd_rest
   printf "%su2.argc%s: ", $color_highlite, $color_end
   p ($arg0).u2.argc
@@ -686,12 +755,6 @@ define nd_args
   rp ($arg0).u3.node
 end
 
-
-define nd_noex
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
 define nd_defn
   printf "%su3.node%s: ", $color_highlite, $color_end
   rp ($arg0).u3.node
@@ -709,17 +772,6 @@ define nd_new
 end
 
 
-define nd_cfnc
-  printf "%su1.cfunc%s: ", $color_highlite, $color_end
-  p ($arg0).u1.cfunc
-end
-
-define nd_argc
-  printf "%su2.argc%s: ", $color_highlite, $color_end
-  p ($arg0).u2.argc
-end
-
-
 define nd_cname
   printf "%su1.id%s: ", $color_highlite, $color_end
   p ($arg0).u1.id
@@ -781,7 +833,7 @@ end
 
 define nd_tree
   set $buf = (struct RString *)rb_str_buf_new(0)
-  call dump_node((VALUE)($buf), rb_str_new(0, 0), 0, ($arg0))
+  call dump_node((VALUE)($buf), rb_str_tmp_new(0), 0, ($arg0))
   printf "%s\n", $buf->as.heap.ptr
 end
 
@@ -798,22 +850,22 @@ define rb_numtable_entry
     set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
     while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
       if $rb_numtable_p.k == $rb_numtable_id
-	set $rb_numtable_key = $rb_numtable_p.k
-	set $rb_numtable_rec = $rb_numtable_p.v
-	set $rb_numtable_p = 0
+        set $rb_numtable_key = $rb_numtable_p.k
+        set $rb_numtable_rec = $rb_numtable_p.v
+        set $rb_numtable_p = 0
       else
-	set $rb_numtable_p = $rb_numtable_p + 1
+        set $rb_numtable_p = $rb_numtable_p + 1
       end
     end
   else
     set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
     while $rb_numtable_p
       if $rb_numtable_p->key == $rb_numtable_id
-	set $rb_numtable_key = $rb_numtable_p->key
-	set $rb_numtable_rec = $rb_numtable_p->record
-	set $rb_numtable_p = 0
+        set $rb_numtable_key = $rb_numtable_p->key
+        set $rb_numtable_rec = $rb_numtable_p->record
+        set $rb_numtable_p = 0
       else
-	set $rb_numtable_p = $rb_numtable_p->next
+        set $rb_numtable_p = $rb_numtable_p->next
       end
     end
   end
@@ -851,11 +903,10 @@ document rb_method_entry
 end
 
 define rb_classname
-  # up to 128bit int
-  set $rb_classname_permanent = "0123456789ABCDEF"
-  set $rb_classname = classname($arg0, $rb_classname_permanent)
-  if $rb_classname != RUBY_Qnil
-    rp $rb_classname
+  set $rb_classname = ((struct RClass_and_rb_classext_t*)$arg0)->classext->classpath
+  if $rb_classname != RUBY_Qfalse
+    print_string $rb_classname
+    printf "\n"
   else
     echo anonymous class/module\n
   end
@@ -892,7 +943,7 @@ define iseq
       set $operand_size = ((INSN*)($arg0))->operand_size
       set $operands = ((INSN*)($arg0))->operands
       while $i < $operand_size
-	rp $operands[$i++]
+        rp $operands[$i++]
       end
     end
   end
@@ -902,7 +953,7 @@ define iseq
 end
 
 define rb_ps
-  rb_ps_vm ruby_current_vm
+  rb_ps_vm ruby_current_vm_ptr
 end
 document rb_ps
 Dump all threads and their callstacks
@@ -910,38 +961,309 @@ end
 
 define rb_ps_vm
   print $ps_vm = (rb_vm_t*)$arg0
-  set $ps_threads = (st_table*)$ps_vm->living_threads
-  if $ps_threads->entries_packed
-    set $ps_threads_i = 0
-    while $ps_threads_i < $ps_threads->num_entries
-      set $ps_threads_key = (st_data_t)$ps_threads->as.packed.entries[$ps_threads_i].key
-      set $ps_threads_val = (st_data_t)$ps_threads->as.packed.entries[$ps_threads_i].val
-      rb_ps_thread $ps_threads_key $ps_threads_val
-      set $ps_threads_i = $ps_threads_i + 1
-    end
-  else
-    set $ps_threads_ptr = (st_table_entry*)$ps_threads->head
-    while $ps_threads_ptr
-      set $ps_threads_key = (st_data_t)$ps_threads_ptr->key
-      set $ps_threads_val = (st_data_t)$ps_threads_ptr->record
-      rb_ps_thread $ps_threads_key $ps_threads_val
-      set $ps_threads_ptr = (st_table_entry*)$ps_threads_ptr->fore
+  set $ps_thread_ln      = $ps_vm->ractor.main_ractor.threads.set.n.next
+  set $ps_thread_ln_last = $ps_vm->ractor.main_ractor.threads.set.n.prev
+  while 1
+    set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
+    set $ps_thread = (VALUE)($ps_thread_th->self)
+    rb_ps_thread $ps_thread
+    if $ps_thread_ln == $ps_thread_ln_last
+      loop_break
     end
+    set $ps_thread_ln = $ps_thread_ln->next
   end
 end
 document rb_ps_vm
 Dump all threads in a (rb_vm_t*) and their callstacks
 end
 
-define rb_ps_thread
-  set $ps_thread = (struct RTypedData*)$arg0
-  set $ps_thread_id = $arg1
-  print $ps_thread_th = (rb_thread_t*)$ps_thread->data
+define print_lineno
+  set $cfp = $arg0
+  set $iseq = $cfp->iseq
+  set $pos = $cfp->pc - $iseq->body->iseq_encoded
+  if $pos != 0
+    set $pos = $pos - 1
+  end
+
+  set $index = 0
+  set $size = $iseq->body->insns_info.size
+  set $table = $iseq->body->insns_info.body
+  set $positions = $iseq->body->insns_info.positions
+  #printf "size: %d\n", $size
+  if $size == 0
+  else
+  if $size == 1
+    printf "%d", $table[0].line_no
+  else
+    if $positions
+      # get_insn_info_linear_search
+      set $index = 1
+      while $index < $size
+        #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $positions[$i], $table[$i].line_no, $pos
+        if $positions[$index] > $pos
+          loop_break
+        end
+        set $index = $index + 1
+        if $positions[$index] == $pos
+          loop_break
+        end
+      end
+    else
+      # get_insn_info_succinct_bitvector
+      set $sd = $iseq->body->insns_info.succ_index_table
+      set $immediate_table_size = sizeof($sd->imm_part) / sizeof(uint64_t) * 9
+      if $pos < $immediate_table_size
+        set $i = $pos / 9
+        set $j = $pos % 9
+        set $index = ((int)($sd->imm_part[$i] >> ($j * 7))) & 0x7f
+      else
+        set $block_index = ($pos - $immediate_table_size) / 512
+        set $block = &$sd->succ_part[$block_index]
+        set $block_bit_index = ($pos - $immediate_table_size) % 512
+        set $small_block_index = $block_bit_index / 64
+        set $small_block_popcount = $small_block_index == 0 ? 0 : (((int)($block->small_block_ranks >> (($small_block_index - 1) * 9))) & 0x1ff)
+        set $x = $block->bits[$small_block_index] << (63 - $block_bit_index % 64)
+        set $x = ($x & 0x5555555555555555) + ($x >> 1 & 0x5555555555555555)
+        set $x = ($x & 0x3333333333333333) + ($x >> 2 & 0x3333333333333333)
+        set $x = ($x & 0x0707070707070707) + ($x >> 4 & 0x0707070707070707)
+        set $x = ($x & 0x001f001f001f001f) + ($x >> 8 & 0x001f001f001f001f)
+        set $x = ($x & 0x0000003f0000003f) + ($x >>16 & 0x0000003f0000003f)
+        set $popcnt = ($x & 0x7f) + ($x >>32 & 0x7f)
+        set $index = $block->rank + $small_block_popcount + $popcnt
+      end
+    end
+    printf "%d", $table[$index-1].line_no
+  end
+  end
 end
 
-# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
+define check_method_entry
+  set $imemo = (struct RBasic *)$arg0
+  if $imemo != RUBY_Qfalse
+    set $type = ($imemo->flags >> 12) & 0x07
+    if $type == imemo_ment
+      set $me = (rb_callable_method_entry_t *)$imemo
+    else
+    if $type == imemo_svar
+      set $imemo = ((struct vm_svar *)$imemo)->cref_or_me
+      check_method_entry $imemo
+    end
+    end
+  end
+end
+
+define print_id
+  set $id = $arg0
+  # rb_id_to_serial
+  if $id > tLAST_OP_ID
+    set $serial = (rb_id_serial_t)($id >> RUBY_ID_SCOPE_SHIFT)
+  else
+    set $serial = (rb_id_serial_t)$id
+  end
+  if $serial && $serial <= ruby_global_symbols.last_id
+    set $idx = $serial / ID_ENTRY_UNIT
+    set $ids = (struct RArray *)ruby_global_symbols.ids
+    set $flags = $ids->basic.flags
+    if ($flags & RUBY_FL_USER1)
+      set $idsptr = $ids->as.ary
+      set $idslen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+    else
+      set $idsptr = $ids->as.heap.ptr
+      set $idslen = $ids->as.heap.len
+    end
+    if $idx < $idslen
+      set $t = 0
+      set $ary = (struct RArray *)$idsptr[$idx]
+      if $ary != RUBY_Qnil
+        set $flags = $ary->basic.flags
+        if ($flags & RUBY_FL_USER1)
+          set $aryptr = $ary->as.ary
+          set $arylen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+        else
+          set $aryptr = $ary->as.heap.ptr
+          set $arylen = $ary->as.heap.len
+        end
+        set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
+        if $result != RUBY_Qnil
+          print_string $result
+        else
+          echo undef
+        end
+      end
+    end
+  end
+end
+
+define print_pathobj
+  set $flags = ((struct RBasic*)($arg0))->flags
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+    print_string $arg0
+  end
+  if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+    if $flags & RUBY_FL_USER1
+      set $str = ((struct RArray*)($arg0))->as.ary[0]
+    else
+      set $str = ((struct RArray*)($arg0))->as.heap.ptr[0]
+    end
+    print_string $str
+  end
+end
+
+define rb_ps_thread
+  set $ps_thread = (struct RTypedData*)$arg0
+  set $ps_thread_th = (rb_thread_t*)$ps_thread->data
+  printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
+    $ps_thread, $ps_thread_th, $ps_thread_th->nt
+  set $cfp = $ps_thread_th->ec->cfp
+  set $cfpend = (rb_control_frame_t *)($ps_thread_th->ec->vm_stack + $ps_thread_th->ec->vm_stack_size)-1
+  while $cfp < $cfpend
+    if $cfp->iseq
+      if !((VALUE)$cfp->iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$cfp->iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
+        printf "%d:ifunc ", $cfpend-$cfp
+        set print symbol-filename on
+        output/a $cfp->iseq.body
+        set print symbol-filename off
+        printf "\n"
+      else
+      if $cfp->pc
+        set $location = $cfp->iseq->body->location
+        printf "%d:", $cfpend-$cfp
+        print_pathobj $location.pathobj
+        printf ":"
+        print_lineno $cfp
+        printf ":in `"
+        print_string $location.label
+        printf "'\n"
+      else
+        printf "%d: ???.rb:???:in `???'\n", $cfpend-$cfp
+      end
+      end
+    else
+      # if VM_FRAME_TYPE($cfp->flag) == VM_FRAME_MAGIC_CFUNC
+      set $ep = $cfp->ep
+      if ($ep[0] & 0xffff0001) == 0x55550001
+        #define VM_ENV_FLAG_LOCAL 0x02
+        #define VM_ENV_PREV_EP(ep)   GC_GUARDED_PTR_REF(ep[VM_ENV_DATA_INDEX_SPECVAL])
+        set $me = 0
+        set $env_specval = $ep[-1]
+        set $env_me_cref = $ep[-2]
+        while ($env_specval & 0x02) != 0
+          check_method_entry $env_me_cref
+          if $me != 0
+            loop_break
+          end
+          set $ep = $ep[0]
+          set $env_specval = $ep[-1]
+          set $env_me_cref = $ep[-2]
+        end
+        if $me == 0
+          check_method_entry $env_me_cref
+        end
+        printf "%d:", $cfpend-$cfp
+        set print symbol-filename on
+        output/a $me->def->body.cfunc.func
+        set print symbol-filename off
+        set $mid = $me->def->original_id
+        printf ":in `"
+        print_id $mid
+        printf "'\n"
+      else
+        printf "%d:unknown_frame:???:in `???'\n", $cfpend-$cfp
+      end
+    end
+    set $cfp = $cfp + 1
+  end
+end
+
+define rb_count_objects
+  set $objspace = ruby_current_vm_ptr->objspace
+  set $counts_00 = 0
+  set $counts_01 = 0
+  set $counts_02 = 0
+  set $counts_03 = 0
+  set $counts_04 = 0
+  set $counts_05 = 0
+  set $counts_06 = 0
+  set $counts_07 = 0
+  set $counts_08 = 0
+  set $counts_09 = 0
+  set $counts_0a = 0
+  set $counts_0b = 0
+  set $counts_0c = 0
+  set $counts_0d = 0
+  set $counts_0e = 0
+  set $counts_0f = 0
+  set $counts_10 = 0
+  set $counts_11 = 0
+  set $counts_12 = 0
+  set $counts_13 = 0
+  set $counts_14 = 0
+  set $counts_15 = 0
+  set $counts_16 = 0
+  set $counts_17 = 0
+  set $counts_18 = 0
+  set $counts_19 = 0
+  set $counts_1a = 0
+  set $counts_1b = 0
+  set $counts_1c = 0
+  set $counts_1d = 0
+  set $counts_1e = 0
+  set $counts_1f = 0
+  set $total = 0
+  set $i = 0
+  while $i < $objspace->heap_pages.allocated_pages
+    printf "\rcounting... %d/%d", $i, $objspace->heap_pages.allocated_pages
+    set $page = $objspace->heap_pages.sorted[$i]
+    set $p = $page->start
+    set $pend = $p + $page->total_slots
+    while $p < $pend
+      set $flags = $p->as.basic.flags & 0x1f
+      eval "set $counts_%02x = $counts_%02x + 1", $flags, $flags
+      set $p = $p + 1
+    end
+    set $total = $total + $page->total_slots
+    set $i = $i + 1
+  end
+  printf "\rTOTAL: %d, FREE: %d\n", $total, $counts_00
+  printf "T_OBJECT: %d\n", $counts_01
+  printf "T_CLASS: %d\n", $counts_02
+  printf "T_MODULE: %d\n", $counts_03
+  printf "T_FLOAT: %d\n", $counts_04
+  printf "T_STRING: %d\n", $counts_05
+  printf "T_REGEXP: %d\n", $counts_06
+  printf "T_ARRAY: %d\n", $counts_07
+  printf "T_HASH: %d\n", $counts_08
+  printf "T_STRUCT: %d\n", $counts_09
+  printf "T_BIGNUM: %d\n", $counts_0a
+  printf "T_FILE: %d\n", $counts_0b
+  printf "T_DATA: %d\n", $counts_0c
+  printf "T_MATCH: %d\n", $counts_0d
+  printf "T_COMPLEX: %d\n", $counts_0e
+  printf "T_RATIONAL: %d\n", $counts_0f
+  #printf "UNKNOWN_10: %d\n", $counts_10
+  printf "T_NIL: %d\n", $counts_11
+  printf "T_TRUE: %d\n", $counts_12
+  printf "T_FALSE: %d\n", $counts_13
+  printf "T_SYMBOL: %d\n", $counts_14
+  printf "T_FIXNUM: %d\n", $counts_15
+  printf "T_UNDEF: %d\n", $counts_16
+  #printf "UNKNOWN_17: %d\n", $counts_17
+  #printf "UNKNOWN_18: %d\n", $counts_18
+  #printf "UNKNOWN_19: %d\n", $counts_19
+  printf "T_IMEMO: %d\n", $counts_1a
+  printf "T_NODE: %d\n", $counts_1b
+  printf "T_ICLASS: %d\n", $counts_1c
+  printf "T_ZOMBIE: %d\n", $counts_1d
+  #printf "UNKNOWN_1E: %d\n", $counts_1e
+  printf "T_MASK: %d\n", $counts_1f
+end
+document rb_count_objects
+  Counts all objects grouped by type.
+end
+
+# Details: https://github.com/ruby/ruby/wiki/Machine-Instructions-Trace-with-GDB
 define trace_machine_instructions
-  set logging on
+  set logging enabled
   set height 0
   set width 0
   display/i $pc
@@ -955,3 +1277,60 @@ define SDR
   call rb_vmdebug_stack_dump_raw_current()
 end
 
+define rbi
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_LABEL
+    p *(LABEL*)$arg0
+  else
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_INSN
+    p *(INSN*)$arg0
+  else
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_ADJUST
+    p *(ADJUST*)$arg0
+  else
+    print *$arg0
+  end
+  end
+  end
+end
+
+define dump_node
+  set $str = rb_parser_dump_tree($arg0, 0)
+  set $flags = ((struct RBasic*)($str))->flags
+  printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
+                        ((struct RString*)$str)->as.heap.ptr : \
+                        ((struct RString*)$str)->as.embed.ary)
+end
+
+define print_flags
+  printf "RUBY_FL_WB_PROTECTED: %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_WB_PROTECTED ? "1" : "0"
+  printf "RUBY_FL_PROMOTED    : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED ? "1" : "0"
+  printf "RUBY_FL_FINALIZE    : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FINALIZE ? "1" : "0"
+  printf "RUBY_FL_SHAREABLE   : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_SHAREABLE ? "1" : "0"
+  printf "RUBY_FL_EXIVAR      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_EXIVAR ? "1" : "0"
+  printf "RUBY_FL_FREEZE      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FREEZE ? "1" : "0"
+
+  printf "RUBY_FL_USER0       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER0 ? "1" : "0"
+  printf "RUBY_FL_USER1       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER1 ? "1" : "0"
+  printf "RUBY_FL_USER2       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER2 ? "1" : "0"
+  printf "RUBY_FL_USER3       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER3 ? "1" : "0"
+  printf "RUBY_FL_USER4       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER4 ? "1" : "0"
+  printf "RUBY_FL_USER5       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER5 ? "1" : "0"
+  printf "RUBY_FL_USER6       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER6 ? "1" : "0"
+  printf "RUBY_FL_USER7       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER7 ? "1" : "0"
+  printf "RUBY_FL_USER8       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER8 ? "1" : "0"
+  printf "RUBY_FL_USER9       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER9 ? "1" : "0"
+  printf "RUBY_FL_USER10      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER10 ? "1" : "0"
+  printf "RUBY_FL_USER11      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER11 ? "1" : "0"
+  printf "RUBY_FL_USER12      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER12 ? "1" : "0"
+  printf "RUBY_FL_USER13      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER13 ? "1" : "0"
+  printf "RUBY_FL_USER14      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER14 ? "1" : "0"
+  printf "RUBY_FL_USER15      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER15 ? "1" : "0"
+  printf "RUBY_FL_USER16      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER16 ? "1" : "0"
+  printf "RUBY_FL_USER17      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER17 ? "1" : "0"
+  printf "RUBY_FL_USER18      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER18 ? "1" : "0"
+end
+
+source -s misc/gdb.py
+
+# Moved from beginning, since it fails on older gdbs
+set startup-with-shell off
diff --git a/.git-blame-ignore-revs b/.git-blame-ignore-revs
new file mode 100644
index 0000000000..d98646febf
--- /dev/null
+++ b/.git-blame-ignore-revs
@@ -0,0 +1,41 @@
+# This is a file used by GitHub to ignore the following commits on `git blame`.
+#
+# You can also do the same thing in your local repository with:
+# $ git config --local blame.ignoreRevsFile .git-blame-ignore-revs
+
+# Expand tabs
+5b21e94bebed90180d8ff63dad03b8b948361089
+c5e9af9c9d890578182a21e7b71b50334cd5579e
+e63a2115f64433b21cb5dd67c5bf8b30f87ef293
+712ac99e4d0384a941c80a9f48f62943ba7d97c0
+d1474affa8e105bece209cc9d594bb0a989859e1
+2da92388b948821269b18d6b178a680f17e41750
+5062c0c621d887367af8a054e5e5d83d7ec57dd3
+
+# Enable Style/StringLiterals cop for RubyGems/Bundler
+d7ffd3fea402239b16833cc434404a7af82d44f3
+
+# [ruby/digest] Revert tab-expansion in external files
+48b09aae7ec5632209229dcc294dd0d75a93a17f
+8a65cf3b61c60e4cb886f59a73ff6db44364bfa9
+39dc9f9093901d40d2998653948d5da38b18ee2c
+
+# [ruby/io-nonblock] Revert tab expansion
+f28287d34c03f472ffe90ea262bdde9affd4b965
+0d842fecb4f75ab3b1d4097ebdb8e88f51558041
+4ba2c66761d6a293abdfba409241d31063cefd62
+
+# Make benchmark indentation consistent
+fc4acf8cae82e5196186d3278d831f2438479d91
+
+# Make prism_compile.c indentation consistent
+40b2c8e5e7e6e5f83cee9276dc9c1922a69292d6
+d2c5867357ed88eccc28c2b3bd4a46e206e7ff85
+
+# Miss-and-revived commits
+a0f7de814ae5c299d6ce99bed5fb308a05d50ba0
+d4e24021d39e1f80f0055b55d91f8d5f22e15084
+7a56c316418980b8a41fcbdc94067b2bda2ad112
+e90282be7ba1bc8e3119f6e1a2c80356ceb3f80a
+26a9e0b4e31f7b5a9cbd755e0a15823a8fa51bae
+2f53985da9ee593fe524d408256835667938c7d7
diff --git a/.gitattributes b/.gitattributes
new file mode 100644
index 0000000000..6ac6e6fcc3
--- /dev/null
+++ b/.gitattributes
@@ -0,0 +1,9 @@
+*.gemspec diff=ruby
+*.rb diff=ruby
+*.inc.rs linguist-generated=true
+bin svn-properties=svn:ignore=ruby
+bin/* diff=ruby
+tool/update-deps diff=ruby
+tool/make-snapshot diff=ruby
+tool/format-release diff=ruby
+tool/leaked-globals diff=ruby
diff --git a/.github/SECURITY.md b/.github/SECURITY.md
new file mode 100644
index 0000000000..56baa29942
--- /dev/null
+++ b/.github/SECURITY.md
@@ -0,0 +1,9 @@
+# Security Policy
+
+## Supported Versions
+
+See <https://www.ruby-lang.org/en/downloads/branches/>.
+
+## Reporting a Vulnerability
+
+See <https://www.ruby-lang.org/en/security/>.
diff --git a/.github/actions/capiext/action.yml b/.github/actions/capiext/action.yml
new file mode 100644
index 0000000000..49562725f4
--- /dev/null
+++ b/.github/actions/capiext/action.yml
@@ -0,0 +1,86 @@
+name: rubyspec C-API extensions
+
+inputs:
+  builddir:
+    required: false
+    default: '.'
+  make:
+    required: false
+    default: 'make -s'
+
+outputs:
+  key:
+    value: >-
+      ${{
+      !steps.restore.outputs.cache-hit &&
+      github.ref == 'refs/heads/master' &&
+      steps.config.outputs.key
+      }}
+
+runs:
+  using: composite
+
+  steps:
+    - id: config
+      shell: bash
+      run: |
+        eval $(grep -e '^arch *=' -e '^ruby_version *=' -e '^DLEXT *=' Makefile |
+            sed 's/ *= */=/')
+        case "${ruby_version}" in
+        *+*) key=capiexts-${arch}-${ruby_version}-${{ hashFiles('src/spec/ruby/optional/capi/ext/*.[ch]') }};;
+        *)   key=;;
+        esac
+        echo version=$ruby_version >> $GITHUB_OUTPUT
+        echo key="$key" >> $GITHUB_OUTPUT
+        echo DLEXT=$DLEXT >> $GITHUB_OUTPUT
+      working-directory: ${{ inputs.builddir }}
+
+    - name: Restore previous CAPI extensions
+      uses: actions/cache/restore@0400d5f644dc74513175e3cd8d07132dd4860809 # v4.2.4
+      id: cache
+      with:
+        path: ${{ inputs.builddir }}/spec/ruby/optional/capi/ext/
+        key: ${{ steps.config.outputs.key }}
+      if: ${{ steps.config.outputs.key }}
+
+    - name: Run test-spec with previous CAPI extension binaries
+      id: check
+      shell: bash
+      run: |
+        touch spec/ruby/optional/capi/ext/*.$DLEXT
+        [ ! -f spec/ruby/optional/capi/ext/\*.$DLEXT ]
+        ${{ inputs.make }} SPECOPTS=optional/capi test-spec
+      env:
+        DLEXT: ${{ steps.config.outputs.DLEXT }}
+      working-directory: ${{ inputs.builddir }}
+      if: ${{ steps.cache.outputs.cache-hit }}
+
+    - name: Strip CAPI extensions
+      id: strip
+      shell: bash
+      run: |
+        rm -f spec/ruby/optional/capi/ext/*.c
+        [ "$DLEXT" = bundle ] || # separated to .dSYM directories
+        strip spec/ruby/optional/capi/ext/*.$DLEXT
+      env:
+        DLEXT: ${{ steps.config.outputs.DLEXT }}
+      working-directory: ${{ inputs.builddir }}
+      if: >-
+        ${{true
+        && ! steps.cache.outputs.cache-hit
+        && github.ref_name == 'master'
+        }}
+
+    - name: Save CAPI extensions
+      uses: actions/cache/save@0400d5f644dc74513175e3cd8d07132dd4860809 # v4.2.4
+      with:
+        path: ${{ inputs.builddir }}/spec/ruby/optional/capi/ext/
+        key: ${{ steps.config.outputs.key }}
+      if: ${{ steps.strip.outcome == 'success' }}
+
+    - shell: bash
+      run: |
+        echo "::error::Change from ${prev} detected; bump up ABI version"
+      env:
+        prev: ${{ steps.config.outputs.version }}
+      if: ${{ always() && steps.check.outcome == 'failure' }}
diff --git a/.github/actions/compilers/action.yml b/.github/actions/compilers/action.yml
new file mode 100644
index 0000000000..ab5b56a889
--- /dev/null
+++ b/.github/actions/compilers/action.yml
@@ -0,0 +1,133 @@
+name: Compiles ruby in a container
+description: >-
+  Makes ruby using a dedicated container
+
+inputs:
+  tag:
+    required: false
+    default: clang-20
+    description: >-
+      container image tag to use in this run.
+
+  with_gcc:
+    required: false
+    description: >-
+      override compiler path & flags.
+
+  CFLAGS:
+    required: false
+    description: >-
+      C compiler flags to override.
+
+  CXXFLAGS:
+    required: false
+    description: >-
+      C++ compiler flags to override.
+
+  optflags:
+    required: false
+    # -O1 is faster than -O3 in our tests... Majority of time are consumed trying
+    # to optimize binaries.  Also GitHub Actions run on relatively modern CPUs
+    # compared to, say, GCC 4 or Clang 3.  We don't specify `-march=native`
+    # because compilers tend not understand what the CPU is.
+    default: '-O1'
+    description: >-
+      Compiler flags for optimisations.
+
+  cppflags:
+    required: false
+    description: >-
+      Additional preprocessor flags.
+
+  append_configure:
+    required: false
+    default: >-
+      --without-valgrind
+      --without-jemalloc
+      --without-gmp
+    description: >-
+      flags to append to configure.
+
+  enable_shared:
+    required: false
+    default: true
+    description: >-
+      Whether to build libruby.so.
+
+  check:
+    required: false
+    default: ''
+    description: >-
+      Whether to run `make check`
+
+  test_all:
+    required: false
+    default: ''
+    description: >-
+      Whether to run `make test-all` with options for test-all.
+
+  test_spec:
+    required: false
+    default: ''
+    description: >-
+      Whether to run `make test-spec` with options for mspec.
+
+  static_exts:
+    required: false
+    description: >-
+      whitespace separated list of extensions that need be linked statically.
+
+runs:
+  using: composite
+  steps:
+    - shell: bash
+      run: docker pull --quiet 'ghcr.io/ruby/ruby-ci-image:${{ inputs.tag }}'
+
+    - name: Enable Launchable conditionally
+      id: enable-launchable
+      run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
+      shell: bash
+      if: >-
+        ${{
+        github.repository == 'ruby/ruby' ||
+        (github.repository != 'ruby/ruby' && env.LAUNCHABLE_TOKEN)
+        }}
+
+    - name: compile
+      shell: bash
+      run: >-
+        docker run
+        --rm
+        --user=root
+        --volume '${{ github.workspace }}:/github/workspace:ro'
+        --workdir=/github/workspace
+        --entrypoint=/github/workspace/.github/actions/compilers/entrypoint.sh
+        --env CI
+        --env GITHUB_ACTION
+        --env INPUT_WITH_GCC='${{ inputs.with_gcc || inputs.tag }}'
+        --env INPUT_CFLAGS='${{ inputs.CFLAGS }}'
+        --env INPUT_CXXFLAGS='${{ inputs.CXXFLAGS }}'
+        --env INPUT_OPTFLAGS='${{ inputs.OPTFLAGS }}'
+        --env INPUT_CPPFLAGS='${{ inputs.cppflags }}'
+        --env INPUT_APPEND_CONFIGURE='${{ inputs.append_configure }}'
+        --env INPUT_CHECK='${{ inputs.check }}'
+        --env INPUT_TEST_ALL='${{ inputs.test_all }}'
+        --env INPUT_TEST_SPEC='${{ inputs.test_spec }}'
+        --env INPUT_ENABLE_SHARED='${{ inputs.enable_shared }}'
+        --env INPUT_STATIC_EXTS='${{ inputs.static_exts }}'
+        --env LAUNCHABLE_ORGANIZATION='${{ github.repository_owner }}'
+        --env LAUNCHABLE_WORKSPACE='${{ github.event.repository.name }}'
+        --env LAUNCHABLE_ENABLED='${{ steps.enable-launchable.outputs.enable-launchable || false }}'
+        --env GITHUB_PR_HEAD_SHA='${{ github.event.pull_request.head.sha || github.sha }}'
+        --env GITHUB_PULL_REQUEST_URL='${{ github.event.pull_request.html_url }}'
+        --env GITHUB_REF='${{ github.ref }}'
+        --env GITHUB_ACTIONS
+        --env GITHUB_RUN_ID
+        --env GITHUB_REPOSITORY
+        --env GITHUB_WORKFLOW
+        --env GITHUB_RUN_NUMBER
+        --env GITHUB_EVENT_NAME
+        --env GITHUB_SHA
+        --env GITHUB_HEAD_REF
+        --env GITHUB_SERVER_URL
+        'ghcr.io/ruby/ruby-ci-image:${{ inputs.tag }}'
diff --git a/.github/actions/compilers/entrypoint.sh b/.github/actions/compilers/entrypoint.sh
new file mode 100755
index 0000000000..b554151091
--- /dev/null
+++ b/.github/actions/compilers/entrypoint.sh
@@ -0,0 +1,90 @@
+#! /bin/bash
+
+# Copyright (c) 2024 Ruby developers.  All rights reserved.
+#
+# This file is  a part of the programming language  Ruby.  Permission is hereby
+# granted, to  either redistribute and/or  modify this file, provided  that the
+# conditions  mentioned in  the file  COPYING are  met.  Consult  the file  for
+# details.
+
+grouped()
+{
+    echo "::group::${@}"
+    "${@}"
+    echo "::endgroup::"
+}
+
+set -e
+set -u
+set -o pipefail
+
+srcdir="/github/workspace/src"
+builddir="$(mktemp -dt)"
+
+export GITHUB_WORKFLOW='Compilations'
+export CONFIGURE_TTY='never'
+export RUBY_DEBUG='ci rgengc'
+export RUBY_TESTOPTS='-q --color=always --tty=no'
+export RUBY_DEBUG_COUNTER_DISABLE='1'
+export GNUMAKEFLAGS="-j$((1 + $(nproc)))"
+
+case "x${INPUT_ENABLE_SHARED}" in
+x | xno | xfalse )
+    enable_shared='--disable-shared'
+    ;;
+*)
+    enable_shared='--enable-shared'
+    ;;
+esac
+
+pushd ${builddir}
+
+grouped git config --global --add safe.directory ${srcdir}
+
+grouped ${srcdir}/configure        \
+    -C                             \
+    --with-gcc="${INPUT_WITH_GCC}" \
+    --enable-debug-env             \
+    --disable-install-doc          \
+    --with-ext=-test-/cxxanyargs,+ \
+    --without-git                  \
+    ${enable_shared}               \
+    ${INPUT_APPEND_CONFIGURE}      \
+    CFLAGS="${INPUT_CFLAGS}"       \
+    CXXFLAGS="${INPUT_CXXFLAGS}"   \
+    optflags="${INPUT_OPTFLAGS}"   \
+    cppflags="${INPUT_CPPFLAGS}"   \
+    debugflags='-ggdb3' # -g0 disables backtraces when SEGV.  Do not set that.
+
+popd
+
+if [[ -n "${INPUT_STATIC_EXTS}" ]]; then
+    echo "::group::ext/Setup"
+    set -x
+    mkdir ${builddir}/ext
+    (
+        for ext in ${INPUT_STATIC_EXTS}; do
+            echo "${ext}"
+        done
+    ) >> ${builddir}/ext/Setup
+    set +x
+    echo "::endgroup::"
+fi
+
+if [ -n "$INPUT_TEST_ALL" ]; then
+  tests=" -- $INPUT_TEST_ALL"
+else
+  tests=" -- ruby -ext-"
+fi
+
+pushd ${builddir}
+
+grouped make showflags
+grouped make all
+# grouped make install
+
+# Run only `make test` by default. Run other tests if specified.
+grouped make test
+if [[ -n "$INPUT_CHECK" ]]; then grouped make test-tool; fi
+if [[ -n "$INPUT_CHECK" || -n "$INPUT_TEST_ALL" ]]; then grouped make test-all TESTS="$tests"; fi
+if [[ -n "$INPUT_CHECK" || -n "$INPUT_TEST_SPEC" ]]; then grouped env CHECK_LEAKS=true make test-spec MSPECOPT="$INPUT_TEST_SPEC"; fi
diff --git a/.github/actions/launchable/setup/action.yml b/.github/actions/launchable/setup/action.yml
new file mode 100644
index 0000000000..16af8fc3fd
--- /dev/null
+++ b/.github/actions/launchable/setup/action.yml
@@ -0,0 +1,313 @@
+name: Set up Launchable
+description: >-
+  Install the required dependencies and execute the necessary Launchable commands for test recording
+
+inputs:
+  os:
+    required: true
+    description: The operating system that CI runs on. This value is used in Launchable flavor.
+
+  test-opts:
+    default: none
+    required: false
+    description: >-
+      Test options that determine how tests are run.
+      This value is used in the Launchable flavor.
+
+  launchable-token:
+    required: false
+    description: >-
+      Launchable token is needed if you want to run Launchable on your forked repository.
+      See https://github.com/ruby/ruby/wiki/CI-Servers#launchable-ci for details.
+
+  builddir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Directory to create Launchable report file.
+
+  srcdir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Directory to (re-)checkout source codes. Launchable retrieves the commit information
+      from the directory.
+
+  test-task:
+    required: false
+    default: ${{ matrix.test_task }}
+    description: >-
+      Specifies a single test task to be executed.
+      This value is used in the Launchable flavor.
+      Either 'test-task' or 'multi-test-tasks' must be configured.
+
+  test-tasks:
+    required: false
+    default: '[]'
+    description: >-
+      Specifies an array of multiple test tasks to be executed.
+      For example: '["test", "test-all"]'.
+      If you want to run a single test task, use the 'test-task' input instead.
+
+  is-yjit:
+    required: false
+    default: 'false'
+    description: >-
+      Whether this workflow is executed on YJIT.
+
+outputs:
+  stdout_report_path:
+    value: ${{ steps.global.outputs.stdout_report_path }}
+    description: >-
+      Report file path for standard output.
+
+  stderr_report_path:
+    value: ${{ steps.global.outputs.stderr_report_path }}
+    description: >-
+      Report file path for standard error.
+
+runs:
+  using: composite
+
+  steps:
+    - name: Enable Launchable conditionally
+      id: enable-launchable
+      run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
+      shell: bash
+      if: >-
+        ${{
+        (github.repository == 'ruby/ruby'
+          || (github.repository != 'ruby/ruby'
+          && env.LAUNCHABLE_TOKEN))
+        && (inputs.test-task == 'check'
+          || inputs.test-task == 'test-all'
+          || inputs.test-task == 'test'
+          || contains(fromJSON(inputs.test-tasks), 'test-all')
+          || contains(fromJSON(inputs.test-tasks), 'test'))
+        }}
+
+    # Launchable CLI requires Python and Java.
+    # https://www.launchableinc.com/docs/resources/cli-reference/
+    - name: Set up Python
+      uses: actions/setup-python@871daa956ca9ea99f3c3e30acb424b7960676734 # v5.0.0
+      with:
+        python-version: "3.x"
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && !endsWith(inputs.os, 'ppc64le') && !endsWith(inputs.os, 's390x') }}
+
+    - name: Set up Java
+      uses: actions/setup-java@7a445ee88d4e23b52c33fdc7601e40278616c7f8 # v4.0.0
+      with:
+        distribution: 'temurin'
+        java-version: '17'
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && !endsWith(inputs.os, 'ppc64le') && !endsWith(inputs.os, 's390x') }}
+
+    - name: Set up Java ppc64le
+      uses: actions/setup-java@7a445ee88d4e23b52c33fdc7601e40278616c7f8 # v4.0.0
+      with:
+        distribution: 'semeru'
+        architecture: 'ppc64le'
+        java-version: '17'
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && endsWith(inputs.os, 'ppc64le') }}
+
+    - name: Set up Java s390x
+      uses: actions/setup-java@7a445ee88d4e23b52c33fdc7601e40278616c7f8 # v4.0.0
+      with:
+        distribution: 'semeru'
+        architecture: 's390x'
+        java-version: '17'
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && endsWith(inputs.os, 's390x') }}
+
+    - name: Set global vars
+      id: global
+      shell: bash
+      run: |
+        test_all_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test-all' || contains(fromJSON(inputs.test-tasks), 'test-all') }}"
+        btest_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test' || contains(fromJSON(inputs.test-tasks), 'test') }}"
+        test_spec_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test-spec' || contains(fromJSON(inputs.test-tasks), 'test-spec') }}"
+        echo test_all_enabled="${test_all_enabled}" >> $GITHUB_OUTPUT
+        echo btest_enabled="${btest_enabled}" >> $GITHUB_OUTPUT
+        echo test_spec_enabled="${test_spec_enabled}" >> $GITHUB_OUTPUT
+        echo test_all_report_file='launchable_test_all_report.json' >> $GITHUB_OUTPUT
+        echo btest_report_file='launchable_btest_report.json' >> $GITHUB_OUTPUT
+        echo test_spec_report_dir='launchable_test_spec_report' >> $GITHUB_OUTPUT
+        echo stdout_report_path="launchable_stdout.log" >> $GITHUB_OUTPUT
+        echo stderr_report_path="launchable_stderr.log" >> $GITHUB_OUTPUT
+      if: steps.enable-launchable.outputs.enable-launchable
+
+    - name: Set environment variables for Launchable
+      shell: bash
+      run: |
+        : # GITHUB_PULL_REQUEST_URL are used for commenting test reports in Launchable Github App.
+        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/link.py#L42
+        echo "GITHUB_PULL_REQUEST_URL=${{ github.event.pull_request.html_url }}" >> $GITHUB_ENV
+        : # The following envs are necessary in Launchable tokenless authentication.
+        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L20
+        echo "LAUNCHABLE_ORGANIZATION=${{ github.repository_owner }}" >> $GITHUB_ENV
+        echo "LAUNCHABLE_WORKSPACE=${{ github.event.repository.name }}" >> $GITHUB_ENV
+        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L71
+        echo "GITHUB_PR_HEAD_SHA=${{ github.event.pull_request.head.sha || github.sha }}" >> $GITHUB_ENV
+        echo "LAUNCHABLE_TOKEN=${{ inputs.launchable-token }}" >> $GITHUB_ENV
+        : # To prevent a slowdown in CI, disable request retries when the Launchable server is unstable.
+        echo "LAUNCHABLE_SKIP_TIMEOUT_RETRY=1" >> $GITHUB_ENV
+        echo "LAUNCHABLE_COMMIT_TIMEOUT=1" >> $GITHUB_ENV
+      if: steps.enable-launchable.outputs.enable-launchable
+
+    - name: Set up path
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      # Since updated PATH variable will be available in only subsequent actions, we need to add the path beforehand.
+      # https://docs.github.com/en/actions/using-workflows/workflow-commands-for-github-actions#adding-a-system-path
+      run: echo "$(python -msite --user-base)/bin" >> $GITHUB_PATH
+      if: >-
+        ${{
+        steps.enable-launchable.outputs.enable-launchable
+        && (startsWith(inputs.os, 'macos')
+          || endsWith(inputs.os, 'ppc64le')
+          || endsWith(inputs.os, 's390x'))
+        }}
+
+    - name: Set up Launchable
+      id: setup-launchable
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: |
+        set -x
+        pip install --user launchable
+        : # The build name cannot include a slash, so we replace the string here.
+        github_ref="${{ github.ref }}"
+        github_ref="${github_ref//\//_}"
+        : # With the --name option, we need to configure a unique identifier for this build.
+        : # To avoid setting the same build name as the CI which runs on other branches, we use the branch name here.
+        build_name="${github_ref}_${GITHUB_PR_HEAD_SHA}"
+        test_opts="${{ inputs.test-opts }}"
+        test_opts="${test_opts// /}"
+        test_opts="${test_opts//=/:}"
+        test_all_test_suite='test-all'
+        btest_test_suite='btest'
+        test_spec_test_suite='test-spec'
+        if [ "${{ inputs.is-yjit }}" = "true" ]; then
+          test_all_test_suite="yjit-${test_all_test_suite}"
+          btest_test_suite="yjit-${btest_test_suite}"
+          test_spec_test_suite="yjit-${test_spec_test_suite}"
+        fi
+        # launchable_setup target var -- refers ${target} prefixed variables
+        launchable_setup() {
+          local target=$1 session
+          eval [ "\${${target}_enabled}" = "true" ] || return
+          eval local suite=\${${target}_test_suite}
+          session=$(launchable record session \
+            --build "${build_name}" \
+            --observation \
+            --flavor os="${{ inputs.os }}" \
+            --flavor test_task="${{ inputs.test-task }}" \
+            --flavor test_opts="${test_opts}" \
+            --flavor workflow="${{ github.workflow }}" \
+            --test-suite ${suite} \
+            )
+          echo "${target}_session=${session}" >> $GITHUB_OUTPUT
+        }
+
+        launchable record build --name "${build_name}"
+        if launchable_setup test_all; then
+          echo "TESTS=${TESTS:+$TESTS }--launchable-test-reports=${test_all_report_file}" >> $GITHUB_ENV
+        fi
+        if launchable_setup btest; then
+          echo "BTESTS=${BTESTS:+$BTESTS }--launchable-test-reports=${btest_report_file}" >> $GITHUB_ENV
+        fi
+        if launchable_setup test_spec; then
+          echo "SPECOPTS=${SPECOPTS:$SPECOPTS }--launchable-test-reports=${test_spec_report_dir}" >> $GITHUB_ENV
+          echo test_spec_enabled=true >> $GITHUB_OUTPUT
+        fi
+
+        echo launchable_setup_dir=$(pwd) >> $GITHUB_OUTPUT
+      if: steps.enable-launchable.outputs.enable-launchable
+      env:
+        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
+        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
+        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
+        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+    - name: make test-spec report directory in build directory
+      shell: bash
+      working-directory: ${{ inputs.builddir }}
+      run: mkdir "${test_spec_report_dir}"
+      if: ${{ steps.setup-launchable.outputs.test_spec_enabled == 'true' }}
+      env:
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+    - name: Clean up test results in Launchable
+      uses: gacts/run-and-post-run@674528335da98a7afc80915ff2b4b860a0b3553a # v1.4.0
+      with:
+        shell: bash
+        working-directory: ${{ inputs.builddir }}
+        post: |
+          rm -f "${test_all_report_file}"
+          rm -f "${btest_report_file}"
+          rm -fr "${test_spec_report_dir}"
+          rm -f launchable_stdout.log
+          rm -f launchable_stderr.log
+      if: always() && steps.setup-launchable.outcome == 'success'
+      env:
+        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+    - name: Record test results in Launchable
+      uses: gacts/run-and-post-run@674528335da98a7afc80915ff2b4b860a0b3553a # v1.4.0
+      with:
+        shell: bash
+        working-directory: ${{ inputs.builddir }}
+        post: |
+          if [[ "${test_all_enabled}" = "true" ]]; then \
+            launchable record attachment \
+              --session "${test_all_session}" \
+              "${stdout_report_path}" \
+              "${stderr_report_path}"; \
+            launchable record tests \
+              --session "${test_all_session}" \
+              raw "${test_all_report_file}" || true; \
+          fi
+
+          if [[ "${btest_enabled}" = "true" ]]; then \
+            launchable record attachment \
+              --session "${btest_session}" \
+              "${stdout_report_path}" \
+              "${stderr_report_path}"; \
+            launchable record tests \
+              --session "${btest_session}" \
+              raw "${btest_report_file}" || true; \
+          fi
+
+          if [[ "${test_spec_enabled}" = "true" ]]; then \
+            launchable record attachment \
+              --session "${test_spec_session}" \
+              "${stdout_report_path}" \
+              "${stderr_report_path}"; \
+            launchable record tests \
+              --session "${test_spec_session}" \
+              raw ${test_spec_report_dir}/* || true; \
+          fi
+      if: ${{ always() && steps.setup-launchable.outcome == 'success' }}
+      env:
+        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
+        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
+        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
+        test_all_session: ${{ steps.setup-launchable.outputs.test_all_session }}
+        btest_session: ${{ steps.setup-launchable.outputs.btest_session }}
+        test_spec_session: ${{ steps.setup-launchable.outputs.test_spec_session }}
+        stdout_report_path: ${{ steps.global.outputs.stdout_report_path }}
+        stderr_report_path: ${{ steps.global.outputs.stderr_report_path }}
+        LAUNCHABLE_SETUP_DIR: ${{ steps.setup-launchable.outputs.launchable_setup_dir }}
diff --git a/.github/actions/setup/directories/action.yml b/.github/actions/setup/directories/action.yml
new file mode 100644
index 0000000000..0e8ffd59ef
--- /dev/null
+++ b/.github/actions/setup/directories/action.yml
@@ -0,0 +1,194 @@
+name: Setup directories etc.
+description: >-
+  Set up the source code and build directories (plus some
+  environmental tweaks)
+
+inputs:
+  srcdir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Directory to (re-)checkout source codes.  This will be created
+      if absent.  If there is no `configure` file that is also
+      generated inside.
+
+  builddir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Where binaries and other generated contents go.  This will be
+      created if absent.
+
+  make-command:
+    required: false
+    type: string
+    default: 'make'
+    description: >-
+      The command of `make`.
+
+  makeup:
+    required: false
+    type: boolean
+    # Note that `default: false` evaluates to a string constant
+    # `'false'`, which is a truthy value :sigh:
+    # https://github.com/actions/runner/issues/2238
+    default: ''
+    description: >-
+      If set to true, additionally runs `make up`.
+
+  checkout:
+    required: false
+    type: boolean
+    default: true
+    description: >-
+      If set to '' (false), skip running actions/checkout. This is useful when
+      you don't want to overwrite a GitHub token that is already set up.
+
+  dummy-files:
+    required: false
+    type: boolean
+    default: ''
+    description: >-
+      If set to true, creates dummy files in build dir.
+
+  fetch-depth:
+    required: false
+    default: '1'
+    description: The depth of commit history fetched from the remote repository
+
+  clean:
+    required: false
+    type: boolean
+    default: ''
+    description: >-
+      If set to true, clean build directory.
+
+outputs: {} # nothing?
+
+runs:
+  using: composite
+
+  steps:
+    # Note that `shell: bash` works on both Windows and Linux, but not
+    # `shell: sh`.  This is because GitHub hosted Windows runners have
+    # their bash manually installed.
+    - shell: bash
+      run: |
+        mkdir -p ${{ inputs.srcdir }}
+        mkdir -p ${{ inputs.builddir }}
+
+    # Did you know that actions/checkout works without git(1)?  We are
+    # checking that here.
+    - id: which
+      shell: bash
+      run: |
+        echo "git=`command -v git`" >> "$GITHUB_OUTPUT"
+        echo "sudo=`sudo true && command -v sudo`" >> "$GITHUB_OUTPUT"
+        echo "autoreconf=`command -v autoreconf`" >> "$GITHUB_OUTPUT"
+
+    - if: steps.which.outputs.git
+      shell: bash
+      run: |
+        git config --global core.autocrlf false
+        git config --global core.eol lf
+        git config --global advice.detachedHead 0
+        git config --global init.defaultBranch garbage
+
+    - if: inputs.checkout
+      uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+      with:
+        path: ${{ inputs.srcdir }}
+        fetch-depth: ${{ inputs.fetch-depth }}
+
+    - uses: actions/cache@8b402f58fbc84540c8b491a91e594a4576fec3d7 # v5.0.2
+      with:
+        path: ${{ inputs.srcdir }}/.downloaded-cache
+        key: ${{ runner.os }}-${{ runner.arch }}-downloaded-cache
+
+    - if: steps.which.outputs.autoreconf
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: ./autogen.sh --install
+
+    # This is for MinGW.
+    - if: runner.os == 'Windows'
+      shell: bash
+      run: echo "GNUMAKEFLAGS=-j$((2 * NUMBER_OF_PROCESSORS))" >> $GITHUB_ENV
+
+    - if: runner.os == 'Linux'
+      shell: bash
+      run: echo "GNUMAKEFLAGS=-sj$((1 + $(nproc)))" >> "$GITHUB_ENV"
+
+    # macOS' GNU make is so old that they doesn't understand `GNUMAKEFLAGS`.
+    - if: runner.os == 'macOS'
+      shell: bash
+      run: echo "MAKEFLAGS=-j$((1 + $(sysctl -n hw.activecpu)))" >> "$GITHUB_ENV"
+
+    - if: inputs.makeup
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: |
+        touch config.status .rbconfig.time
+        for mk in Makefile GNUmakefile; do
+          sed -f tool/prereq.status template/$mk.in > $mk
+        done
+        make up
+
+    # Cleanup, runs even on failure
+    - if: always() && inputs.makeup
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: |
+        rm -f config.status .rbconfig.time \
+          Makefile GNUmakefile uncommon.mk enc.mk noarch-fake.rb
+
+    - if: steps.which.outputs.sudo
+      shell: bash
+      run: |
+        sudo chmod -R go-w /usr/share
+        chmod -v go-w $HOME $HOME/.config || :
+        declare -a dirs # -A is not supported by old bash, e.g. macos
+        SAVE_IFS="$IFS" IFS=:; set $PATH
+        for d do
+          while [ -d "$d" ]; do
+            case "$IFS${dirs[*]}$IFS" in *"$IFS$d$IFS"*) ;; *) dirs+=("$d");; esac
+            d="${d%/*}"
+          done
+        done
+        IFS="$SAVE_IFS"
+        sudo chmod -v go-w "${dirs[@]}" || :
+
+    - if: inputs.dummy-files == 'true'
+      shell: bash
+      id: dummy-files
+      working-directory: ${{ inputs.builddir }}
+      run: |
+        : Create dummy files in build dir
+        set {{a..z},{A..Z},{0..9},foo,bar,test,zzz}.rb
+        for file; do \
+          echo > $file "raise 'do not load $file'"; \
+        done
+        # drop {a..z}.rb if case-insensitive filesystem
+        grep -F A.rb a.rb > /dev/null && set "${@:27}"
+        echo clean="cd ${{ inputs.builddir }} && rm $*" >> $GITHUB_OUTPUT
+
+    - if: inputs.clean == 'true'
+      shell: bash
+      id: clean
+      run: |
+        echo distclean='cd ${{ inputs.builddir }} && ${{ inputs.make-command }} distclean' >> $GITHUB_OUTPUT
+        echo remained-files='find ${{ inputs.builddir }} -ls' >> $GITHUB_OUTPUT
+        [ "${{ inputs.builddir }}" = "${{ inputs.srcdir }}" ] ||
+        echo final='rmdir ${{ inputs.builddir }}' >> $GITHUB_OUTPUT
+
+    - name: clean
+      uses: gacts/run-and-post-run@81b6ce503cde93862cec047c54652e45c5dca991 # v1.4.3
+      with:
+        working-directory:
+        post: |
+          ${{ steps.dummy-files.outputs.clean }}
+          ${{ steps.clean.outputs.distclean }}
+          ${{ steps.clean.outputs.remained-files }}
+          ${{ steps.clean.outputs.final }}
+      # rmdir randomly fails due to launchable files
+      continue-on-error: true
diff --git a/.github/actions/setup/macos/action.yml b/.github/actions/setup/macos/action.yml
new file mode 100644
index 0000000000..d0072ff828
--- /dev/null
+++ b/.github/actions/setup/macos/action.yml
@@ -0,0 +1,29 @@
+name: Setup macOS environment
+description: >-
+  Installs necessary packages via Homebrew.
+
+inputs: {} # nothing?
+
+outputs: {} # nothing?
+
+runs:
+  using: composite
+
+  steps:
+    - name: brew
+      shell: bash
+      run: |
+        brew install --quiet jemalloc gmp libffi openssl@3 zlib autoconf automake libtool
+
+    - name: Set ENV
+      shell: bash
+      run: |
+        dir_config() {
+          local args=() lib var="$1"; shift
+          for lib in "$@"; do
+            args+=("--with-${lib%@*}-dir=$(brew --prefix $lib)")
+          done
+          echo "$var=${args[*]}" >> $GITHUB_ENV
+        }
+        dir_config ruby_configure_args gmp
+        dir_config CONFIGURE_ARGS openssl@3
diff --git a/.github/actions/setup/ubuntu/action.yml b/.github/actions/setup/ubuntu/action.yml
new file mode 100644
index 0000000000..a9e5b41951
--- /dev/null
+++ b/.github/actions/setup/ubuntu/action.yml
@@ -0,0 +1,53 @@
+name: Setup ubuntu environment
+description: >-
+  At the beginning there was no way but to copy & paste `apt-get`
+  everywhere.  But now that we have composite actions, it seems better
+  merge them into one.
+
+inputs:
+  arch:
+    required: false
+    default: ''
+    description: >-
+      Architecture.  Because we run this on a GitHub-hosted runner
+      acceptable value for this input is very limited.
+
+outputs:
+  arch:
+    value: ${{ steps.uname.outputs.uname }}
+    description: >-
+      Actual architecture.  This could be different from the one
+      passed to the `inputs.arch`.  For instance giving `i386` to this
+      action yields `i686`.
+
+runs:
+  using: composite
+
+  steps:
+    - name: set SETARCH
+      shell: bash
+      run: echo "SETARCH=${setarch}" >> "$GITHUB_ENV"
+      env:
+        setarch: ${{ inputs.arch && format('setarch {0} --', inputs.arch) }}
+
+    - id: uname
+      name: uname
+      shell: bash
+      run: |
+        echo uname=`${SETARCH} uname -m` >> "$GITHUB_OUTPUT"
+        echo dpkg=`${SETARCH} uname -m | sed s/686/386/` >> "$GITHUB_OUTPUT"
+
+    - name: apt-get
+      shell: bash
+      env:
+        arch: ${{ inputs.arch && format(':{0}', steps.uname.outputs.dpkg) || '' }}
+      run: |
+        set -x
+        ${arch:+sudo dpkg --add-architecture ${arch#:}}
+        sudo apt-get update -qq || :
+        sudo apt-get install --no-install-recommends -qq -y -o=Dpkg::Use-Pty=0 \
+        ${arch:+cross}build-essential${arch/:/-} \
+        libssl-dev${arch} libyaml-dev${arch} libreadline6-dev${arch} \
+        zlib1g-dev${arch} libncurses5-dev${arch} libffi-dev${arch} \
+        autoconf ruby
+        sudo apt-get install -qq -y pkg-config${arch} || :
diff --git a/.github/actions/slack/action.yml b/.github/actions/slack/action.yml
new file mode 100644
index 0000000000..4a398da1d1
--- /dev/null
+++ b/.github/actions/slack/action.yml
@@ -0,0 +1,51 @@
+name: Post a message to slack
+description: >-
+  We have our ruby/action-slack webhook.  However its arguments are
+  bit verbose to be listed in every workflow files.  Better merge them
+  into one.
+
+inputs:
+  SLACK_WEBHOOK_URL:
+    required: true
+    description: >-
+      The URL to post the payload.  This is an input because it tends
+      to be stored in a secrets vault and a composite action cannot
+      look into one.
+
+  label:
+    required: false
+    description: >-
+      Human-readable description of the run, something like "DEBUG=1".
+      This need not be unique among runs.
+
+  event_name:
+    required: false
+    default: 'push'
+    description: >-
+      Target event to trigger notification. Notify only push by default.
+
+  extra_channel_id:
+    required: false
+    description: >-
+      Slack channel ID to notify besides #alerts and #alerts-emoji.
+
+outputs: {} # Nothing?
+
+runs:
+  using: composite
+
+  steps:
+    - uses: ruby/action-slack@54175162371f1f7c8eb94d7c8644ee2479fcd375 # v3.2.2
+      with:
+        payload: |
+          {
+            "ci": "GitHub Actions",
+            "env": "${{ github.workflow }}${{ inputs.label && format(' / {0}', inputs.label) }}",
+            "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+            "commit": "${{ github.sha }}",
+            "branch": "${{ github.ref_name }}"
+            ${{ inputs.extra_channel_id && format(', "extra_channel_id": "{0}"', inputs.extra_channel_id) }}
+          }
+      env:
+        SLACK_WEBHOOK_URL: ${{ inputs.SLACK_WEBHOOK_URL }}
+      if: ${{ github.event_name == inputs.event_name && startsWith(github.repository, 'ruby/') }}
diff --git a/.github/auto_request_review.yml b/.github/auto_request_review.yml
new file mode 100644
index 0000000000..38496d5ceb
--- /dev/null
+++ b/.github/auto_request_review.yml
@@ -0,0 +1,20 @@
+files:
+  'yjit*': [team:jit]
+  'yjit/**/*': [team:jit]
+  'yjit/src/cruby_bindings.inc.rs': []
+  'bootstraptest/test_yjit*': [team:jit]
+  'test/ruby/test_yjit*': [team:jit]
+  'zjit*': [team:jit]
+  'zjit/**/*': [team:jit]
+  'zjit/src/cruby_bindings.inc.rs': []
+  'test/ruby/test_zjit*': [team:jit]
+  'defs/jit.mk': [team:jit]
+  'tool/zjit_bisect.rb': [team:jit]
+  'doc/jit/*': [team:jit]
+  # Skip github workflow files because the team don't necessarily need to review dependabot updates for GitHub Actions. It's noisy in notifications, and they're auto-merged anyway.
+options:
+  ignore_draft: true
+  # This currently doesn't work as intended. We want to skip reviews when only
+  # cruby_bingings.inc.rs is modified, but this skips reviews even when other
+  # files are modified as well. To be enabled after fixing the behavior.
+  #last_files_match_only: true
diff --git a/.github/dependabot.yml b/.github/dependabot.yml
new file mode 100644
index 0000000000..2c2982d1d4
--- /dev/null
+++ b/.github/dependabot.yml
@@ -0,0 +1,22 @@
+version: 2
+updates:
+  - package-ecosystem: 'github-actions'
+    directory: '/'
+    schedule:
+      interval: 'daily'
+  - package-ecosystem: 'github-actions'
+    directory: '/.github/actions/slack'
+    schedule:
+      interval: 'daily'
+  - package-ecosystem: 'github-actions'
+    directory: '/.github/actions/setup/directories'
+    schedule:
+      interval: 'daily'
+  - package-ecosystem: 'cargo'
+    directory: '/yjit'
+    schedule:
+      interval: 'daily'
+  - package-ecosystem: 'vcpkg'
+    directory: '/'
+    schedule:
+      interval: 'daily'
diff --git a/.github/labeler.yml b/.github/labeler.yml
new file mode 100644
index 0000000000..e81aed8e98
--- /dev/null
+++ b/.github/labeler.yml
@@ -0,0 +1,6 @@
+Documentation:
+- changed-files:
+  - all-globs-to-all-files: doc/**
+
+Backport:
+- base-branch: 'ruby_3_\d'
diff --git a/.github/workflows/annocheck.yml b/.github/workflows/annocheck.yml
new file mode 100644
index 0000000000..899d601aef
--- /dev/null
+++ b/.github/workflows/annocheck.yml
@@ -0,0 +1,110 @@
+name: Annocheck
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  compile:
+    name: test-annocheck
+
+    runs-on: ubuntu-latest
+
+    container:
+      image: ghcr.io/ruby/ruby-ci-image:gcc-11
+      options: --user root
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    env:
+      CONFIGURE_TTY: never
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci rgengc
+      RUBY_TESTOPTS: >-
+        -q
+        --color=always
+        --tty=no
+      # FIXME: Drop skipping options
+      # https://bugs.ruby-lang.org/issues/18061
+      # https://sourceware.org/annobin/annobin.html/Test-pie.html
+      TEST_ANNOCHECK_OPTS: '--skip-pie --skip-gaps'
+
+    steps:
+      - run: id
+        working-directory:
+
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      # Minimal flags to pass the check.
+      # -g0 disables backtraces when SEGV.  Do not set that.
+      - name: Run configure
+        run: >
+          ../src/configure -C
+          --enable-debug-env
+          --disable-install-doc
+          --with-ext=-test-/cxxanyargs,+
+          --without-valgrind
+          --without-jemalloc
+          --without-gmp
+          --with-gcc="gcc-11 -fcf-protection -Wa,--generate-missing-build-notes=yes"
+          --enable-shared
+          debugflags=-ggdb3
+          optflags=-O2
+          LDFLAGS=-Wl,-z,now
+
+      - run: make showflags
+
+      - run: make
+
+      - run: make test-annocheck
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/auto_request_review.yml b/.github/workflows/auto_request_review.yml
new file mode 100644
index 0000000000..207315a084
--- /dev/null
+++ b/.github/workflows/auto_request_review.yml
@@ -0,0 +1,20 @@
+name: Auto Request Review
+on:
+  pull_request_target:
+    types: [opened, ready_for_review, reopened]
+    branches: [master]
+
+permissions:
+  contents: read
+
+jobs:
+  auto-request-review:
+    name: Auto Request Review
+    runs-on: ubuntu-latest
+    if: ${{ github.repository == 'ruby/ruby' && github.base_ref == 'master' }}
+    steps:
+      - name: Request review based on files changes and/or groups the author belongs to
+        uses: necojackarc/auto-request-review@e89da1a8cd7c8c16d9de9c6e763290b6b0e3d424 # v0.13.0
+        with:
+          # scope: public_repo
+          token: ${{ secrets.MATZBOT_AUTO_REQUEST_REVIEW_TOKEN }}
diff --git a/.github/workflows/auto_review_pr.yml b/.github/workflows/auto_review_pr.yml
new file mode 100644
index 0000000000..ad0e63ba12
--- /dev/null
+++ b/.github/workflows/auto_review_pr.yml
@@ -0,0 +1,33 @@
+name: Auto Review PR
+on:
+  pull_request_target:
+    types: [opened, ready_for_review, reopened]
+    branches: [master]
+
+permissions:
+  contents: read
+
+jobs:
+  auto-review-pr:
+    name: Auto Review PR
+    runs-on: ubuntu-latest
+    if: ${{ github.repository == 'ruby/ruby' && github.base_ref == 'master' }}
+
+    permissions:
+      pull-requests: write
+      contents: read
+
+    steps:
+      - name: Checkout repository
+        uses: actions/checkout@v6.0.1
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.4'
+          bundler: none
+
+      - name: Auto Review PR
+        run: ruby tool/auto_review_pr.rb "$GITHUB_PR_NUMBER"
+        env:
+          GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
+          GITHUB_PR_NUMBER: ${{ github.event.pull_request.number }}
diff --git a/.github/workflows/baseruby.yml b/.github/workflows/baseruby.yml
new file mode 100644
index 0000000000..d3e734f885
--- /dev/null
+++ b/.github/workflows/baseruby.yml
@@ -0,0 +1,74 @@
+name: BASERUBY Check
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  baseruby:
+    name: BASERUBY
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    strategy:
+      matrix:
+        ruby:
+          - ruby-3.1
+          - ruby-3.2
+          - ruby-3.3
+
+    steps:
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: ${{ matrix.ruby }}
+          bundler: none
+
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          makeup: true
+
+      - run: ./configure --disable-install-doc
+
+      - run: make all
+
+      - run: make test
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.ruby }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/bundled_gems.yml b/.github/workflows/bundled_gems.yml
new file mode 100644
index 0000000000..59f64e8312
--- /dev/null
+++ b/.github/workflows/bundled_gems.yml
@@ -0,0 +1,190 @@
+name: bundled_gems
+
+env:
+  UPDATE_ENABLED: true
+
+on:
+  push:
+    branches: ['master']
+    paths:
+      - '.github/workflows/bundled_gems.yml'
+      - 'gems/bundled_gems'
+  pull_request:
+    branches: ['master']
+    paths:
+      - '.github/workflows/bundled_gems.yml'
+      - 'gems/bundled_gems'
+  merge_group:
+  schedule:
+    - cron: '45 6 * * *'
+  workflow_dispatch:
+
+permissions: # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  update:
+    permissions:
+      contents: write # for Git to git push
+
+    if: ${{ github.event_name != 'schedule' || github.repository == 'ruby/ruby' }}
+
+    name: update ${{ github.workflow }}
+
+    runs-on: ubuntu-latest
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          # Skip overwriting MATZBOT_AUTO_UPDATE_TOKEN
+          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
+
+      - name: Set ENV
+        run: |
+          echo "TODAY=$(date +%F)" >> $GITHUB_ENV
+
+      - name: Download previous gems list
+        run: |
+          mkdir -p .downloaded-cache
+          for data in bundled_gems.json default_gems.json; do
+            ln -s .downloaded-cache/$data .
+            curl -O -R -z ./$data https://stdgems.org/$data
+          done
+
+      - name: Update bundled gems list
+        id: bundled_gems
+        run: |
+          ruby -i~ tool/update-bundled_gems.rb gems/bundled_gems >> $GITHUB_OUTPUT
+        if: ${{ env.UPDATE_ENABLED == 'true' }}
+
+      - name: Update spec/bundler/support/builders.rb
+        run: |
+          #!ruby
+          rake_version = File.read("gems/bundled_gems")[/^rake\s+(\S+)/, 1]
+          print ARGF.read.sub(/^ *def rake_version\s*\K".*?"/) {rake_version.dump}
+        shell: ruby -i~ {0} spec/bundler/support/builders.rb
+        if: ${{ env.UPDATE_ENABLED == 'true' }}
+
+      - name: Maintain updated gems list in NEWS
+        run: |
+          ruby tool/update-NEWS-gemlist.rb bundled
+        if: ${{ env.UPDATE_ENABLED == 'true' }}
+
+      - name: Check diffs
+        id: diff
+        run: |
+          news= gems=
+          git diff --color --no-ext-diff --ignore-submodules --exit-code -- NEWS.md ||
+          news=true
+          git diff --color --no-ext-diff --ignore-submodules --exit-code -- gems/bundled_gems ||
+          gems=true
+          git add -- NEWS.md gems/bundled_gems
+          git add -- spec/bundler/support/builders.rb
+          echo news=$news >> $GITHUB_OUTPUT
+          echo gems=$gems >> $GITHUB_OUTPUT
+          echo update=${news:-$gems} >> $GITHUB_OUTPUT
+
+      - name: Commit
+        id: commit
+        run: |
+          git pull --ff-only origin ${GITHUB_REF#refs/heads/}
+          message="Update bundled gems list"
+          if [ -z "${gems}" ]; then
+            git commit --message="[DOC] ${message} at ${GITHUB_SHA:0:30}"
+          else
+            git commit --message="${message} as of ${TODAY}"
+          fi
+        env:
+          TODAY: ${{ steps.bundled_gems.outputs.latest_date || env.TODAY }}
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+          gems: ${{ steps.diff.outputs.gems }}
+        if: ${{ steps.diff.outputs.update }}
+
+      - name: Development revision of bundled gems
+        run: |
+          #!ruby
+          file = "gems/bundled_gems"
+
+          SECONDS_IN_DAY = 86400
+          today = Time.new("#{ENV['TODAY']}Z")
+          if !(december = today.month == 12)
+            days = 30
+          elsif (days = 26 - today.day).positive?
+            days += 4
+          else
+            puts "::info:: just after released"
+            exit
+          end
+
+          since = "#{today.year-1}-12-26"
+          ref = ENV['GITHUB_REF']
+          puts "::group::\e[94mfetching \e[1m#{file}\e[22m since \e[1m#{since}\e[22m from \e[1m#{ref}\e[m"
+          system(*%W[git fetch --shallow-since=#{since} --no-tags origin #{ref}], exception: true)
+          puts "::endgroup::"
+
+          puts "\e[94mchecking development version bundled gems older than \e[1m#{days}\e[22m days\e[m"
+          limit = today.to_i - days * SECONDS_IN_DAY
+          old = 0
+          IO.popen(%W"git blame --line-porcelain -- #{file}") do |blame|
+            while head = blame.gets("\n\t") and s = blame.gets
+              next unless (gem = s.split(/\s+|#.*/)).size > 3
+              time = head[/^committer-time \K\d+/].to_i
+              next if (d = limit - time) <= 0
+              d /= SECONDS_IN_DAY
+              line = head[/\A\h+ \d+ \K\d+/].to_i
+              level = if d < days; 'warning'; else old += 1; 'error'; end
+              d += days
+              puts "::#{level} file=#{file},line=#{line},title=Older than #{d} days::#{gem[0]} #{gem[3]}"
+            end
+          end
+          abort "::error title=Too long-standing gems::The release comes soon." if december and old.nonzero?
+        shell: ruby {0}
+        env:
+          file: ${{ steps.logs.outputs.file }}
+          days: ${{ steps.logs.outputs.days }}
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/ubuntu
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Build
+        run: |
+          ./autogen.sh
+          ./configure -C --disable-install-doc
+          make
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Prepare bundled gems
+        run: |
+          make -s prepare-gems
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Test bundled gems
+        run: |
+          make -s test-bundled-gems
+        timeout-minutes: 30
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Push
+        run: |
+          git push origin ${GITHUB_REF#refs/heads/}
+        if: >-
+          ${{
+          github.repository == 'ruby/ruby' &&
+          !startsWith(github.event_name, 'pull') &&
+          steps.commit.outcome == 'success'
+          }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/check_dependencies.yml b/.github/workflows/check_dependencies.yml
new file mode 100644
index 0000000000..c5dec65e48
--- /dev/null
+++ b/.github/workflows/check_dependencies.yml
@@ -0,0 +1,59 @@
+name: Check Dependencies
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  update-deps:
+    name: Dependency checks
+
+    strategy:
+      matrix:
+        os: [ubuntu-latest]
+      fail-fast: true
+
+    runs-on: ${{ matrix.os }}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - uses: ./.github/actions/setup/ubuntu
+        if: ${{ contains(matrix.os, 'ubuntu') }}
+
+      - uses: ./.github/actions/setup/macos
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - uses: ./.github/actions/setup/directories
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - name: Run configure
+        run: ./configure -C --disable-install-doc --disable-rubygems --with-gcc 'optflags=-O0' 'debugflags=-save-temps=obj -g'
+
+      - run: make fix-depends
+
+      - run: git diff --no-ext-diff --ignore-submodules --exit-code
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.os }} / Dependencies need to update
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/check_misc.yml b/.github/workflows/check_misc.yml
new file mode 100644
index 0000000000..2a2bd1df53
--- /dev/null
+++ b/.github/workflows/check_misc.yml
@@ -0,0 +1,127 @@
+name: Misc
+on: [push, pull_request, merge_group]
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  checks:
+    name: Miscellaneous checks
+
+    permissions:
+      contents: write # for Git to git push
+
+    runs-on: ubuntu-latest
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          makeup: true
+          # Skip overwriting MATZBOT_AUTO_UPDATE_TOKEN
+          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
+
+      - name: Check for code styles
+        run: |
+          set -x
+          ruby tool/auto-style.rb "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA"
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.pull_request.base.sha }}
+          GITHUB_NEW_SHA: ${{ github.event.pull_request.merge_commit_sha }}
+        # Skip 'push' events because post_push.yml fixes them on push
+        if: ${{ github.repository == 'ruby/ruby' && startsWith(github.event_name, 'pull') }}
+
+      - name: Check for bash specific substitution in configure.ac
+        run: |
+          git grep -n '\${[A-Za-z_0-9]*/' -- configure.ac && exit 1 || :
+
+      - name: Check for header macros
+        run: |
+          fail=
+          for header in ruby/*.h; do
+            git grep -l -F -e $header -e HAVE_`echo $header | tr a-z./ A-Z__` -- . > /dev/null && continue
+            fail=1
+            echo $header
+          done
+          exit $fail
+        working-directory: include
+
+      - id: now
+        run: |
+          date +"mon=%-m"%n"day=%-d" >> $GITHUB_OUTPUT
+        env:
+          TZ: Tokyo/Asia
+
+      - id: deprecation
+        run: |
+          eval $(sed -n 's/^#define RUBY_API_VERSION_\(MAJOR\|MINOR\) /\1=/p' include/ruby/version.h)
+          if git --no-pager grep --color -o 'rb_warn_deprecated_to_remove_at('$MAJOR'\.'$MINOR',.*' -- '*.c' >&2; then
+              false
+          else
+              true
+          fi
+        continue-on-error: ${{ steps.now.outputs.mon < 12 }}
+
+      - name: Check if to generate documents
+        id: rdoc
+        run: |
+          set -- $(sed 's/#.*//;/^rdoc /!d' gems/bundled_gems)
+          { echo version=$2; echo ref=$4; } >> $GITHUB_OUTPUT
+          echo RDOC='ruby -W0 --disable-gems tool/rdoc-srcdir -q' >> $GITHUB_ENV
+
+      - name: Checkout rdoc
+        uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          repository: ruby/rdoc
+          ref: ${{ steps.rdoc.outputs.ref }}
+          path: .bundle/gems/rdoc-${{ steps.rdoc.outputs.version }}
+        if: ${{ steps.rdoc.outputs.ref != '' }}
+
+      - name: Generate rdoc
+        run: |
+          set -x
+          gempath=$(ruby -e 'print Gem.user_dir, "/bin"')
+          PATH=$gempath:$PATH
+          gem install --user bundler
+          bundle config --local path vendor/bundle
+          bundle install --jobs 4
+          bundle exec rake generate
+        working-directory: .bundle/gems/rdoc-${{ steps.rdoc.outputs.version }}
+        if: ${{ steps.rdoc.outputs.ref != '' }}
+
+      - name: Core docs coverage
+        run: |
+          $RDOC -C -x ^ext -x ^lib .
+
+      - name: Generate docs
+        id: docs
+        run: |
+          $RDOC --op html .
+          echo htmlout=ruby-html-${GITHUB_SHA:0:10} >> $GITHUB_OUTPUT
+        # Generate only when document commit/PR
+        if: >-
+          ${{false
+          || contains(github.event.head_commit.message, '[ruby/rdoc]')
+          || contains(github.event.head_commit.message, '[DOC]')
+          || contains(github.event.pull_request.title, '[DOC]')
+          || contains(github.event.pull_request.labels.*.name, 'Documentation')
+          }}
+
+      - name: Upload docs
+        uses: actions/upload-artifact@v6.0.0
+        with:
+          path: html
+          name: ${{ steps.docs.outputs.htmlout }}
+        if: ${{ steps.docs.outcome == 'success' }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/codeql-analysis.yml b/.github/workflows/codeql-analysis.yml
new file mode 100644
index 0000000000..a92c93b476
--- /dev/null
+++ b/.github/workflows/codeql-analysis.yml
@@ -0,0 +1,121 @@
+name: 'CodeQL'
+
+on:
+  push:
+    branches: ['master']
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  schedule:
+    - cron: '0 12 * * *'
+  workflow_dispatch:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions: # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  analyze:
+    name: Analyze
+    runs-on: ubuntu-latest
+    permissions:
+      actions: read # for github/codeql-action/init to get workflow details
+      contents: read # for actions/checkout to fetch code
+      security-events: write # for github/codeql-action/autobuild to send a status report
+    # CodeQL fails to run pull requests from dependabot due to missing write access to upload results.
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    env:
+      enable_install_doc: no
+
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - language: cpp
+          - language: ruby
+
+    steps:
+      - name: Checkout repository
+        uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - name: Install libraries
+        if: ${{ contains(matrix.os, 'macos') }}
+        uses: ./.github/actions/setup/macos
+
+      - name: Install libraries
+        if : ${{ matrix.os == 'ubuntu-latest' }}
+        uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+
+      - name: Remove an obsolete rubygems vendored file
+        if: ${{ matrix.os == 'ubuntu-latest' }}
+        run: sudo rm /usr/lib/ruby/vendor_ruby/rubygems/defaults/operating_system.rb
+
+      - name: Initialize CodeQL
+        uses: github/codeql-action/init@e296a935590eb16afc0c0108289f68c87e2a89a5 # v4.30.7
+        with:
+          languages: ${{ matrix.language }}
+          trap-caching: false
+          debug: true
+
+      - name: Autobuild
+        uses: github/codeql-action/autobuild@e296a935590eb16afc0c0108289f68c87e2a89a5 # v4.30.7
+
+      - name: Perform CodeQL Analysis
+        uses: github/codeql-action/analyze@e296a935590eb16afc0c0108289f68c87e2a89a5 # v4.30.7
+        with:
+          category: '/language:${{ matrix.language }}'
+          upload: False
+          output: sarif-results
+
+      - name: filter-sarif
+        uses: advanced-security/filter-sarif@f3b8118a9349d88f7b1c0c488476411145b6270d # v1.0.1
+        with:
+          patterns: |
+            +**/*.rb
+            -lib/uri/mailto.rb:rb/overly-large-range
+            -lib/uri/rfc3986_parser.rb:rb/overly-large-range
+            -lib/bundler/vendor/uri/lib/uri/mailto.rb:rb/overly-large-range
+            -lib/bundler/vendor/uri/lib/uri/rfc3986_parser.rb:rb/overly-large-range
+            -test/ruby/test_io.rb:rb/non-constant-kernel-open
+            -test/open-uri/test_open-uri.rb:rb/non-constant-kernel-open
+            -test/open-uri/test_ssl.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/binread_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/readlines_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/foreach_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/write_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/read_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/kernel/open_spec.rb:rb/non-constant-kernel-open
+          input: sarif-results/${{ matrix.language }}.sarif
+          output: sarif-results/${{ matrix.language }}.sarif
+        if: ${{ matrix.language == 'ruby' }}
+        continue-on-error: true
+
+      - name: Upload SARIF
+        uses: github/codeql-action/upload-sarif@e296a935590eb16afc0c0108289f68c87e2a89a5 # v4.30.7
+        with:
+          sarif_file: sarif-results/${{ matrix.language }}.sarif
+        continue-on-error: true
diff --git a/.github/workflows/compilers.yml b/.github/workflows/compilers.yml
new file mode 100644
index 0000000000..8c0ca54e0b
--- /dev/null
+++ b/.github/workflows/compilers.yml
@@ -0,0 +1,335 @@
+# Some tests depending on this name 'Compilations' via $GITHUB_WORKFLOW. Make sure to update such tests when renaming this workflow.
+name: Compilations
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+# Each job is split so that they roughly take 30min to run through.
+jobs:
+  compile-if:
+    name: 'omnibus compilations, trigger'
+    runs-on: ubuntu-latest
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+    steps:
+      - run: true
+        working-directory:
+
+  compile1:
+    name: 'omnibus compilations, #1'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      # Set fetch-depth: 10 so that Launchable can receive commits information.
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - name: 'clang 18 LTO'
+        uses: './.github/actions/compilers'
+        with:
+          tag: clang-18
+          with_gcc: 'clang-18 -flto=auto'
+          optflags: '-O2'
+          enable_shared: false
+        timeout-minutes: 30
+      - { uses: './.github/actions/compilers', name: '-O0', with: { optflags: '-O0 -march=x86-64 -mtune=generic' }, timeout-minutes: 5 }
+      # - { uses: './.github/actions/compilers', name: '-O3', with: { optflags: '-O3 -march=x86-64 -mtune=generic', check: true } }
+
+  compile2:
+    name: 'omnibus compilations, #2'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - name: 'GCC 15 LTO'
+        uses: './.github/actions/compilers'
+        with:
+          tag: gcc-15
+          with_gcc: 'gcc-15 -flto=auto -ffat-lto-objects -Werror=lto-type-mismatch'
+          optflags: '-O2'
+          enable_shared: false
+        timeout-minutes: 10
+      - { uses: './.github/actions/compilers', name: 'ext/Setup', with: { static_exts: 'etc json/* */escape' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 15', with: { tag: 'gcc-15' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 14', with: { tag: 'gcc-14' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 13', with: { tag: 'gcc-13' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 12', with: { tag: 'gcc-12' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 11', with: { tag: 'gcc-11' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 10', with: { tag: 'gcc-10' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 9',  with: { tag: 'gcc-9'  }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 8',  with: { tag: 'gcc-8'  }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 7',  with: { tag: 'gcc-7'  }, timeout-minutes: 5 }
+
+  compile3:
+    name: 'omnibus compilations, #3'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'clang 22', with: { tag: 'clang-22' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 21', with: { tag: 'clang-21' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 20', with: { tag: 'clang-20' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 19', with: { tag: 'clang-19' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 18', with: { tag: 'clang-18' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 17', with: { tag: 'clang-17' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 16', with: { tag: 'clang-16' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 15', with: { tag: 'clang-15' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 14', with: { tag: 'clang-14' }, timeout-minutes: 5 }
+
+  compile4:
+    name: 'omnibus compilations, #4'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'clang 13', with: { tag: 'clang-13' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 12', with: { tag: 'clang-12' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 11', with: { tag: 'clang-11' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 10', with: { tag: 'clang-10' }, timeout-minutes: 5 }
+        # llvm-objcopy<=9 doesn't have --wildcard. It compiles, but leaves Rust symbols in libyjit.o and fail `make test-leaked-globals`.
+      - { uses: './.github/actions/compilers', name: 'clang 9',  with: { tag: 'clang-9',   append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 8',  with: { tag: 'clang-8',   append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 7',  with: { tag: 'clang-7',   append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 6',  with: { tag: 'clang-6.0', append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+
+  compile5:
+    name: 'omnibus compilations, #5'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      # -Wno-strict-prototypes is necessary with current clang-15 since
+      # older autoconf generate functions without prototype and -pedantic
+      # now implies strict-prototypes. Disabling the error but leaving the
+      # warning generates a lot of noise from use of ANYARGS in
+      # rb_define_method() and friends.
+      # See: https://github.com/llvm/llvm-project/commit/11da1b53d8cd3507959022cd790d5a7ad4573d94
+      - { uses: './.github/actions/compilers', name: 'C99',      with: { CFLAGS: '-std=c99 -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C11',   with: { CFLAGS:   '-std=c11   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C17',   with: { CFLAGS:   '-std=c17   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C23',   with: { CFLAGS:   '-std=c2x   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++98', with: { CXXFLAGS: '-std=c++98 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++11', with: { CXXFLAGS: '-std=c++11 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++14', with: { CXXFLAGS: '-std=c++14 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++17', with: { CXXFLAGS: '-std=c++17 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+
+  compile6:
+    name: 'omnibus compilations, #6'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'C++20', with: { CXXFLAGS: '-std=c++20 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++23', with: { CXXFLAGS: '-std=c++23 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++26', with: { CXXFLAGS: '-std=c++26 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'gmp',                 with: { append_configure: '--with-gmp', test_all: 'ruby/test_bignum.rb', test_spec: "/github/workspace/src/spec/ruby/core/integer" }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'jemalloc',            with: { append_configure: '--with-jemalloc' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'valgrind',            with: { append_configure: '--with-valgrind' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'coroutine=ucontext',  with: { append_configure: '--with-coroutine=ucontext' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'coroutine=pthread',   with: { append_configure: '--with-coroutine=pthread' }, timeout-minutes: 5 }
+
+  compile7:
+    name: 'omnibus compilations, #7'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'disable-jit',         with: { append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-yjit',        with: { append_configure: '--disable-yjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-zjit',        with: { append_configure: '--disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-dln',         with: { append_configure: '--disable-dln' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'enable-mkmf-verbose', with: { append_configure: '--enable-mkmf-verbose' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-rubygems',    with: { append_configure: '--disable-rubygems' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RUBY_DEVEL',          with: { append_configure: '--enable-devel' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=0',            with: { cppflags: '-DOPT_THREADED_CODE=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=1',            with: { cppflags: '-DOPT_THREADED_CODE=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=2',            with: { cppflags: '-DOPT_THREADED_CODE=2' }, timeout-minutes: 5 }
+
+  compile8:
+    name: 'omnibus compilations, #8'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'NDEBUG',                         with: { cppflags: '-DNDEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RUBY_DEBUG',                     with: { cppflags: '-DRUBY_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'ARRAY_DEBUG',                    with: { cppflags: '-DARRAY_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'BIGNUM_DEBUG',                   with: { cppflags: '-DBIGNUM_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'CCAN_LIST_DEBUG',                with: { cppflags: '-DCCAN_LIST_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'CPDEBUG=-1',                     with: { cppflags: '-DCPDEBUG=-1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'ENC_DEBUG',                      with: { cppflags: '-DENC_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_DEBUG',                       with: { cppflags: '-DGC_DEBUG' }, timeout-minutes: 5 }
+
+  compile9:
+    name: 'omnibus compilations, #9'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'HASH_DEBUG',                     with: { cppflags: '-DHASH_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'ID_TABLE_DEBUG',                 with: { cppflags: '-DID_TABLE_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_DEBUG=-1',                with: { cppflags: '-DRGENGC_DEBUG=-1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'SYMBOL_DEBUG',                   with: { cppflags: '-DSYMBOL_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_CHECK_MODE',              with: { cppflags: '-DRGENGC_CHECK_MODE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'VM_CHECK_MODE',                  with: { cppflags: '-DVM_CHECK_MODE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_EMBED_CI=0',                 with: { cppflags: '-DUSE_EMBED_CI=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_FLONUM=0',                   with: { cppflags: '-DUSE_FLONUM=0', append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+
+  compileX:
+    name: 'omnibus compilations, #10'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'USE_LAZY_LOAD',                  with: { cppflags: '-DUSE_LAZY_LOAD' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_SYMBOL_GC=0',                with: { cppflags: '-DUSE_SYMBOL_GC=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_THREAD_CACHE=0',             with: { cppflags: '-DUSE_THREAD_CACHE=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_RUBY_DEBUG_LOG=1',           with: { cppflags: '-DUSE_RUBY_DEBUG_LOG=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_DEBUG_COUNTER',              with: { cppflags: '-DUSE_DEBUG_COUNTER=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'SHARABLE_MIDDLE_SUBSTRING',      with: { cppflags: '-DSHARABLE_MIDDLE_SUBSTRING=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'DEBUG_FIND_TIME_NUMGUESS',       with: { cppflags: '-DDEBUG_FIND_TIME_NUMGUESS' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'DEBUG_INTEGER_PACK',             with: { cppflags: '-DDEBUG_INTEGER_PACK' }, timeout-minutes: 5 }
+
+  compileB:
+    name: 'omnibus compilations, #11'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'GC_DEBUG_STRESS_TO_CLASS',       with: { cppflags: '-DGC_DEBUG_STRESS_TO_CLASS' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_ENABLE_LAZY_SWEEP=0',         with: { cppflags: '-DGC_ENABLE_LAZY_SWEEP=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_PROFILE_DETAIL_MEMORY',       with: { cppflags: '-DGC_PROFILE_DETAIL_MEMORY' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_PROFILE_MORE_DETAIL',         with: { cppflags: '-DGC_PROFILE_MORE_DETAIL' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'MALLOC_ALLOCATED_SIZE_CHECK',    with: { cppflags: '-DMALLOC_ALLOCATED_SIZE_CHECK' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_ESTIMATE_OLDMALLOC',      with: { cppflags: '-DRGENGC_ESTIMATE_OLDMALLOC' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_PROFILE',                 with: { cppflags: '-DRGENGC_PROFILE' }, timeout-minutes: 5 }
+
+  compileC:
+    name: 'omnibus compilations, #12'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'VM_DEBUG_BP_CHECK',              with: { cppflags: '-DVM_DEBUG_BP_CHECK' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'VM_DEBUG_VERIFY_METHOD_CACHE',   with: { cppflags: '-DVM_DEBUG_VERIFY_METHOD_CACHE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'YJIT_FORCE_ENABLE',              with: { cppflags: '-DYJIT_FORCE_ENABLE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'UNIVERSAL_PARSER',               with: { cppflags: '-DUNIVERSAL_PARSER' }, timeout-minutes: 5 }
+
+  compilemax:
+    name: 'omnibus compilations, result'
+    runs-on: ubuntu-latest
+    if: ${{ always() }}
+    needs:
+      - 'compile1'
+      - 'compile2'
+      - 'compile3'
+      - 'compile4'
+      - 'compile5'
+      - 'compile6'
+      - 'compile7'
+      - 'compile8'
+      - 'compile9'
+      - 'compileX'
+      - 'compileB'
+      - 'compileC'
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - uses: ./.github/actions/slack
+        with:
+          label: 'omnibus'
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+      - run: false
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/cygwin.yml b/.github/workflows/cygwin.yml
new file mode 100644
index 0000000000..ac73991fe8
--- /dev/null
+++ b/.github/workflows/cygwin.yml
@@ -0,0 +1,71 @@
+name: Cygwin
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    runs-on: windows-2022
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - run: git config --global core.autocrlf input
+
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - name: Setup Cygwin
+        uses: cygwin/cygwin-install-action@master
+        with:
+          packages: ruby gcc-core make autoconf libtool libssl-devel libyaml-devel libffi-devel zlib-devel rubygems
+
+      - name: configure
+        run: |
+          ./autogen.sh
+          ./configure --disable-install-doc
+        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
+
+      - name: Extract bundled gems
+        run: |
+          make ruby -j5
+          make extract-gems
+        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
+
+      - name: make all
+        timeout-minutes: 30
+        run: make -j4 V=1
+        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: Cygwin
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/default_gems_list.yml b/.github/workflows/default_gems_list.yml
new file mode 100644
index 0000000000..1c7e2195c8
--- /dev/null
+++ b/.github/workflows/default_gems_list.yml
@@ -0,0 +1,99 @@
+name: Update default gems list
+on: [push, pull_request, merge_group]
+
+env:
+  UPDATE_NEWS_ENABLED: true
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  update_default_gems_list:
+    name: Update default gems list
+
+    permissions:
+      contents: write # for Git to git push
+
+    runs-on: ubuntu-latest
+
+    if: ${{ github.repository == 'ruby/ruby' }}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - id: gems
+        run: true
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          makeup: true
+          # Skip overwriting MATZBOT_AUTO_UPDATE_TOKEN
+          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Download previous gems list
+        run: |
+          data=default_gems.json
+          mkdir -p .downloaded-cache
+          ln -s .downloaded-cache/$data .
+          curl -O -R -z ./$data https://stdgems.org/$data
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Make default gems list
+        run: |
+          #!ruby
+          require 'rubygems'
+          $:.unshift "lib"
+          rgver = File.foreach("lib/rubygems.rb") do |line|
+            break $1 if /^\s*VERSION\s*=\s*"([^"]+)"/ =~ line
+          end
+          gems = Dir.glob("{ext,lib}/**/*.gemspec").map do |f|
+            spec = Gem::Specification.load(f)
+            "#{spec.name} #{spec.version}"
+          end.sort
+          File.open("gems/default_gems", "w") do |f|
+            f.puts "RubyGems #{rgver}"
+            f.puts gems
+          end
+        shell: ruby --disable=gems {0}
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Maintain updated gems list in NEWS
+        run: |
+          ruby tool/update-NEWS-gemlist.rb default
+        if: ${{ steps.gems.outcome == 'success' && env.UPDATE_NEWS_ENABLED == 'true' }}
+
+      - name: Check diffs
+        id: diff
+        run: |
+          git diff --color --no-ext-diff --ignore-submodules --exit-code NEWS.md ||
+          echo update=true >> $GITHUB_OUTPUT
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Commit
+        run: |
+          git pull --ff-only origin ${GITHUB_REF#refs/heads/}
+          git commit --message="Update default gems list at ${GITHUB_SHA:0:30} [ci skip]" NEWS.md
+          git push origin ${GITHUB_REF#refs/heads/}
+        env:
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+        if: >-
+          ${{
+          github.repository == 'ruby/ruby' &&
+          !startsWith(github.event_name, 'pull') &&
+          steps.diff.outputs.update
+          }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/dependabot_automerge.yml b/.github/workflows/dependabot_automerge.yml
new file mode 100644
index 0000000000..a95c7005c4
--- /dev/null
+++ b/.github/workflows/dependabot_automerge.yml
@@ -0,0 +1,32 @@
+# from https://github.com/gofiber/swagger/blob/main/.github/workflows/dependabot_automerge.yml
+name: Dependabot auto-merge
+on:
+  pull_request:
+
+permissions:
+  contents: write
+  pull-requests: write
+
+jobs:
+  automerge:
+    runs-on: ubuntu-latest
+    if: github.event.pull_request.user.login == 'dependabot[bot]' && github.repository == 'ruby/ruby'
+    steps:
+      - name: Dependabot metadata
+        uses: dependabot/fetch-metadata@21025c705c08248db411dc16f3619e6b5f9ea21a # v2.5.0
+        id: metadata
+
+      - name: Wait for status checks
+        uses: lewagon/wait-on-check-action@3603e826ee561ea102b58accb5ea55a1a7482343 # v1.4.1
+        with:
+          repo-token: ${{ secrets.GITHUB_TOKEN }}
+          ref: ${{ github.event.pull_request.head.sha || github.sha }}
+          check-regexp: 'make \(check, .*\)'
+          wait-interval: 30
+
+      - name: Auto-merge for Dependabot PRs
+        if: ${{ steps.metadata.outputs.update-type == 'version-update:semver-minor' || steps.metadata.outputs.update-type == 'version-update:semver-patch' }}
+        run: gh pr merge --auto --rebase "$PR_URL"
+        env:
+          PR_URL: ${{ github.event.pull_request.html_url }}
+          GITHUB_TOKEN: ${{ secrets.MATZBOT_DEPENDABOT_MERGE_TOKEN }}
diff --git a/.github/workflows/labeler.yml b/.github/workflows/labeler.yml
new file mode 100644
index 0000000000..16dbac1afa
--- /dev/null
+++ b/.github/workflows/labeler.yml
@@ -0,0 +1,12 @@
+name: "Pull Request Labeler"
+on:
+- pull_request_target
+
+jobs:
+  labeler:
+    permissions:
+      contents: read
+      pull-requests: write
+    runs-on: ubuntu-latest
+    steps:
+    - uses: actions/labeler@v6
diff --git a/.github/workflows/macos.yml b/.github/workflows/macos.yml
new file mode 100644
index 0000000000..29adcab39a
--- /dev/null
+++ b/.github/workflows/macos.yml
@@ -0,0 +1,202 @@
+name: macOS
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - test_task: check
+            os: macos-14
+          - test_task: check
+            os: macos-14
+            configure_args: '--with-gcc=gcc-14'
+          - test_task: check
+            os: macos-14
+            configure_args: '--with-jemalloc --with-opt-dir=$(brew --prefix jemalloc)'
+          - test_task: check
+            os: macos-14
+            configure_args: '--with-gmp'
+          - test_task: test-all
+            test_opts: --repeat-count=2
+            os: macos-14
+          - test_task: test-bundler-parallel
+            os: macos-14
+          - test_task: test-bundled-gems
+            os: macos-14
+          - test_task: check
+            os: macos-15
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    runs-on: ${{ matrix.os }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 0 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: make sure that kern.coredump=1
+        run: |
+          sysctl -n kern.coredump
+          sudo sysctl -w kern.coredump=1
+          sudo chmod -R +rwx /cores/
+
+      - name: Delete unused SDKs
+        # To free up disk space to not run out during the run
+        run: |
+          sudo rm -rf ~/.dotnet
+          sudo rm -rf /Library/Android
+          sudo rm -rf /Library/Developer/CoreSimulator
+        continue-on-error: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc ${ruby_configure_args} ${{ matrix.configure_args }}
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - run: make hello
+
+      - name: runirb
+        run: |
+          echo IRB::VERSION | make runirb RUNOPT="-- -f"
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.os }}
+          test-opts: ${{ matrix.test_opts }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: Set extra test options
+        run: |
+          echo "TESTS=$TESTS ${{ matrix.test_opts }}" >> $GITHUB_ENV
+          echo "RUBY_TEST_TIMEOUT_SCALE=10" >> $GITHUB_ENV # With --repeat-count=2, flaky test by timeout occurs frequently for some reason
+        if: matrix.test_opts
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          ulimit -c unlimited
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"}
+        timeout-minutes: 90
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+
+      - name: make skipped tests
+        run: |
+          make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+          PRECHECK_BUNDLED_GEMS: 'no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - name: CAPI extensions
+        uses: ./.github/actions/capiext
+        with:
+          builddir: build
+        env:
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ contains(matrix.extra_checks, 'capi') }}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.os }} / ${{ matrix.test_task }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+      - name: Resolve job ID
+        id: job_id
+        uses: actions/github-script@main
+        env:
+          matrix: ${{ toJson(matrix) }}
+        with:
+          script: |
+            const { data: workflow_run } = await github.rest.actions.listJobsForWorkflowRun({
+              owner: context.repo.owner,
+              repo: context.repo.repo,
+              run_id: context.runId
+            });
+            const matrix = JSON.parse(process.env.matrix);
+            const job_name = `${context.job}${matrix ? ` (${Object.values(matrix).join(", ")})` : ""}`;
+            return workflow_run.jobs.find((job) => job.name === job_name).id;
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: macos-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/mingw.yml b/.github/workflows/mingw.yml
new file mode 100644
index 0000000000..5c639ad48b
--- /dev/null
+++ b/.github/workflows/mingw.yml
@@ -0,0 +1,243 @@
+name: MinGW
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+# Notes:
+# Actions console encoding causes issues, see test-all & test-spec steps
+#
+jobs:
+  make:
+    runs-on: windows-${{ matrix.os }}
+
+    name: ${{ github.workflow }} (${{ matrix.msystem }})
+
+    env:
+      MSYSTEM: ${{ matrix.msystem }}
+      MSYS2_ARCH: >-
+        ${{
+        contains(matrix.msystem, 'arm64') && 'aarch64' ||
+        contains(matrix.msystem, '64') && 'x86_64' || 'i686'
+        }}
+      MINGW_PACKAGE_PREFIX: >-
+        mingw-w${{
+        endsWith(matrix.msystem, '64') && '64' || '32'
+        }}-${{
+        startsWith(matrix.msystem, 'clang') && 'clang' ||
+        startsWith(matrix.msystem, 'ucrt') && 'ucrt' ||
+        'mingw'
+        }}-${{
+        contains(matrix.msystem, 'arm64') && 'aarch64' ||
+        endsWith(matrix.msystem, '64') && 'x86_64' || 'i686'
+        }}
+      CFLAGS: '-mtune=generic -O3 -pipe'
+      CXXFLAGS: '-mtune=generic -O3 -pipe'
+      CPPFLAGS: '-D_FORTIFY_SOURCE=2 -D__USE_MINGW_ANSI_STDIO=1 -DFD_SETSIZE=2048'
+      LDFLAGS: '-pipe'
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    strategy:
+      matrix:
+        include:
+          # To mitigate flakiness of MinGW CI, we test only one runtime that newer MSYS2 uses.
+          # Ruby 3.2 is the first Windows Ruby to use OpenSSL 3.x
+          - msystem: 'UCRT64'
+            os: 2022
+            test_task: 'check'
+            test-all-opts: '--name=!/TestObjSpace#test_reachable_objects_during_iteration/'
+          - msystem: 'CLANGARM64'
+            os: 11-arm
+            test_task: 'check'
+      fail-fast: false
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: msys2/setup-msys2@4f806de0a5a7294ffabaff804b38a9b435a73bda # v2.30.0
+        id: msys2
+        with:
+          msystem: ${{ matrix.msystem }}
+          update: true
+          install: >-
+            git
+            make
+            ruby
+            autoconf
+            ${{ env.MINGW_PACKAGE_PREFIX }}-gcc
+            ${{ env.MINGW_PACKAGE_PREFIX }}-ragel
+            ${{ env.MINGW_PACKAGE_PREFIX }}-openssl
+            ${{ env.MINGW_PACKAGE_PREFIX }}-libyaml
+            ${{ env.MINGW_PACKAGE_PREFIX }}-libffi
+
+      - name: Set up env
+        id: setup-env
+        working-directory:
+        run: |
+          $msys2 = ${env:MSYS2_LOCATION}
+          $msystem = ${env:MSYSTEM}.ToLower()
+          echo $msys2\usr\bin $msys2\$msystem\bin |
+            Tee-Object ${env:GITHUB_PATH} -Append -Encoding utf-8
+
+          # Use the fast device for the temporary directory.
+          # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
+          # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
+          $tmp = ${env:RUNNER_TEMP}
+          echo HOME=$home TMP=$tmp TEMP=$tmp TMPDIR=$tmp |
+            Tee-Object ${env:GITHUB_ENV} -Append -Encoding utf-8
+        shell: pwsh             # cmd.exe does not strip spaces before `|`.
+        env:
+          MSYS2_LOCATION: ${{ steps.msys2.outputs.msys2-location }}
+          MSYSTEM: ${{ matrix.msystem }}
+
+      - name: Remove Strawberry Perl pkg-config
+        working-directory:
+        # `pkg-config.bat` included in Strawberry Perl is written in
+        # Perl and doesn't work when another msys2 `perl` precede its
+        # own `perl`.
+        #
+        # ```
+        # Can't find C:\Strawberry\perl\bin\pkg-config.bat on PATH, '.' not in PATH.
+        # ```
+        run: |
+          Get-Command pkg-config.bat | % { ren $_.path ($_.path + "~") }
+        shell: pwsh
+
+      - name: Misc system & package info
+        working-directory:
+        run: |
+          group() { echo ::group::$'\e[94;1m'"$*"$'\e[m'; }
+          endgroup() { echo ::endgroup::; }
+
+          group Path
+          cygpath -wa / . $(type -p cygpath bash sh)
+          endgroup
+
+          I() {
+              group $1
+              run Where type -pa $1 && { [ $# -eq 1 ] || run Version "$@"; } ||
+                  failed+=($1)
+              endgroup
+          }
+          run() { local w m=$1; shift; w="$("$@")" && show "$m" && indent "$w"; }
+          indent() { [ -z "$1" ] || echo "$1" | /bin/sed '/^$/!s/^/  /'; }
+          show() { echo $'\e[96m'"$*"$'\e[m'; }
+
+          failed=()
+
+          I gcc.exe --version
+          I ragel.exe --version
+          I make.exe --version
+          I openssl.exe version
+          I libcrypto-3-x64.dll
+          I libssl-3-x64.dll
+
+          group Packages
+          pacman -Qs $MINGW_PACKAGE_PREFIX-* | /bin/sed -n "s,local/$MINGW_PACKAGE_PREFIX-,,p"
+          endgroup
+
+          [ ${#failed[@]} -eq 0 ]
+        shell: sh
+
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: configure
+        run: >
+          ../src/configure --disable-install-doc --prefix=/.
+          --build=$CHOST --host=$CHOST --target=$CHOST
+        shell: sh
+        env:
+          CHOST: ${{ env.MSYS2_ARCH }}-w64-mingw32
+
+      - name: make all
+        timeout-minutes: 30
+        run: make -j4
+
+      - name: make install
+        run: make DESTDIR=../install install-nodoc
+
+      - name: Set up Launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: windows-2022
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          test-tasks: '["test", "test-all", "test-spec"]'
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: test
+        timeout-minutes: 30
+        run: make test test-tool
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test' }}
+
+      - name: test-all
+        timeout-minutes: 45
+        run: |
+          make ${{ StartsWith(matrix.test_task, 'test/') && matrix.test_task || 'test-all' }}
+        env:
+          RUBY_TESTOPTS: >-
+            --retry --job-status=normal --show-skip --timeout-scale=1.5 -j4
+            ${{ matrix.test-all-opts }}
+            ${{ env.TESTS }}
+          BUNDLER_VERSION:
+        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test-all' || StartsWith(matrix.test_task, 'test/') }}
+
+      - name: test-spec
+        timeout-minutes: 10
+        run: |
+          make ${{ StartsWith(matrix.test_task, 'spec/') && matrix.test_task || 'test-spec' }}
+        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test-spec' || StartsWith(matrix.test_task, 'spec/') }}
+
+      - uses: ./src/.github/actions/slack
+        with:
+          label: ${{ matrix.msystem }} / ${{ matrix.test_task }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
+    shell: cmd
diff --git a/.github/workflows/modgc.yml b/.github/workflows/modgc.yml
new file mode 100644
index 0000000000..1d14934df8
--- /dev/null
+++ b/.github/workflows/modgc.yml
@@ -0,0 +1,176 @@
+name: ModGC
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  check:
+    strategy:
+      matrix:
+        gc:
+          - name: default
+          - name: mmtk
+            mmtk_build: release
+        os: [macos-latest, ubuntu-latest]
+        include:
+          - test_task: check
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci
+
+    runs-on: ${{ matrix.os }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - name: Install libraries (macOS)
+        uses: ./.github/actions/setup/macos
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - name: Install libraries (Ubuntu)
+        uses: ./.github/actions/setup/ubuntu
+        if: ${{ contains(matrix.os, 'ubuntu') }}
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+        if: ${{ contains(matrix.os, 'ubuntu') }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: false
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: make sure that kern.coredump=1
+        run: |
+          sysctl -n kern.coredump
+          sudo sysctl -w kern.coredump=1
+          sudo chmod -R +rwx /cores/
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - name: Delete unused SDKs
+        # To free up disk space to not run out during the run
+        run: |
+          sudo rm -rf ~/.dotnet
+          sudo rm -rf /Library/Android
+          sudo rm -rf /Library/Developer/CoreSimulator
+        continue-on-error: true
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - name: Setup Ruby GC Directory
+        run: |
+          echo "MODULAR_GC_DIR=$HOME/ruby_gc" >> $GITHUB_ENV
+
+      - name: Run configure
+        env:
+          arch: ${{ matrix.arch }}
+        run: >-
+          $SETARCH ../src/configure -C --disable-install-doc --with-modular-gc=${{ env.MODULAR_GC_DIR }}
+          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
+
+      - uses: actions-rust-lang/setup-rust-toolchain@v1
+      - name: Set MMTk environment variables
+        run: |
+          echo 'EXCLUDES=../src/test/.excludes-mmtk' >> $GITHUB_ENV
+          echo 'MSPECOPT=-B../src/spec/mmtk.mspec' >> $GITHUB_ENV
+        if: ${{ matrix.gc.name == 'mmtk' }}
+
+      - run: $SETARCH make
+
+      - name: Build Modular  GC
+        run: |
+          echo "RUBY_GC_LIBRARY=${{ matrix.gc.name }}" >> $GITHUB_ENV
+          make install-modular-gc MODULAR_GC=${{ matrix.gc.name }} MMTK_BUILD=${{ matrix.gc.mmtk_build }}
+          make distclean-modular-gc MODULAR_GC=${{ matrix.gc.name }}
+
+      - run: $SETARCH make hello
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.os || 'ubuntu-22.04' }}
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          $SETARCH make -s ${{ matrix.test_task }} \
+            ${TESTS:+TESTS="$TESTS"} \
+            ${{ !contains(matrix.test_task, 'bundle') && 'RUBYOPT=-w' || '' }}
+        timeout-minutes: ${{ matrix.gc.timeout || 40 }}
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+
+      - name: make skipped tests
+        run: |
+          $SETARCH make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/parse_y.yml b/.github/workflows/parse_y.yml
new file mode 100644
index 0000000000..87facc8a55
--- /dev/null
+++ b/.github/workflows/parse_y.yml
@@ -0,0 +1,100 @@
+name: parse.y
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - test_task: check
+          - test_task: test-bundler-parallel
+          - test_task: test-bundled-gems
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci
+      SETARCH: ${{ matrix.arch && format('setarch {0}', matrix.arch) }}
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc cppflags=-DRUBY_DEBUG --with-parser=parse.y
+
+      - run: make
+
+      - run: make TESTRUN_SCRIPT='-renvutil -v -e "exit EnvUtil.current_parser == %[parse.y]"' run
+        env:
+          RUNOPT0: -I$(tooldir)/lib
+
+      - name: make ${{ matrix.test_task }}
+        run: make -s ${{ matrix.test_task }} RUN_OPTS="$RUN_OPTS" SPECOPTS="$SPECOPTS"
+        env:
+          RUBY_TESTOPTS: ${{ matrix.testopts }}
+          EXCLUDES: '../src/test/.excludes-parsey'
+          RUN_OPTS: ${{ matrix.run_opts || '--parser=parse.y' }}
+          SPECOPTS: ${{ matrix.specopts || '-T --parser=parse.y' }}
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.run_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/post_push.yml b/.github/workflows/post_push.yml
new file mode 100644
index 0000000000..318444c0a2
--- /dev/null
+++ b/.github/workflows/post_push.yml
@@ -0,0 +1,85 @@
+name: Post-push
+on:
+  push:
+    branches:
+      - master
+      - 'ruby_*_*'
+jobs:
+  hooks:
+    name: Post-push hooks
+    runs-on: ubuntu-latest
+    if: ${{ github.repository == 'ruby/ruby' }}
+    steps:
+      - name: Sync git.ruby-lang.org
+        run: |
+          mkdir -p ~/.ssh
+          (umask 066; printenv RUBY_GIT_SYNC_PRIVATE_KEY > ~/.ssh/id_ed25519)
+          ssh-keyscan -t ed25519 git.ruby-lang.org >> ~/.ssh/known_hosts
+          ssh -i ~/.ssh/id_ed25519 git-sync@git.ruby-lang.org "sudo -u git /home/git/git.ruby-lang.org/bin/update-ruby.sh $GITHUB_REF"
+        env:
+          GITHUB_REF: ${{ github.ref }}
+          RUBY_GIT_SYNC_PRIVATE_KEY: ${{ secrets.RUBY_GIT_SYNC_PRIVATE_KEY }}
+        if: ${{ github.ref == 'refs/heads/master' || startsWith(github.ref, 'refs/heads/ruby_') }}
+
+      - name: Fetch changesets on bugs.ruby-lang.org
+        run: |
+          curl "https://bugs.ruby-lang.org/sys/fetch_changesets?key=${REDMINE_SYS_API_KEY}" -s --fail-with-body -w '* status: %{http_code}\n'
+        env:
+          REDMINE_SYS_API_KEY: ${{ secrets.REDMINE_SYS_API_KEY }}
+        if: ${{ github.ref == 'refs/heads/master' || startsWith(github.ref, 'refs/heads/ruby_') }}
+
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          fetch-depth: 500 # for notify-slack-commits
+          token: ${{ secrets.MATZBOT_AUTO_UPDATE_TOKEN }}
+
+      - name: Notify commit to Slack
+        run: ruby tool/notify-slack-commits.rb "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" refs/heads/master
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          SLACK_WEBHOOK_URL_ALERTS: ${{ secrets.SLACK_WEBHOOK_URL_ALERTS }}
+          SLACK_WEBHOOK_URL_COMMITS: ${{ secrets.SLACK_WEBHOOK_URL_COMMITS }}
+          SLACK_WEBHOOK_URL_RUBY_JP: ${{ secrets.SLACK_WEBHOOK_URL_RUBY_JP }}
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - name: Notify commit to ruby-cvs
+        run: |
+          SENDMAIL="ssh -i ${HOME}/.ssh/id_ed25519 git-sync@git.ruby-lang.org /usr/sbin/sendmail" \
+            ruby tool/commit-email.rb . ruby-cvs@g.ruby-lang.org \
+            "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" "$GITHUB_REF" \
+            --viewer-uri "https://github.com/ruby/ruby/commit/" \
+            --error-to cvs-admin@ruby-lang.org
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          GITHUB_REF: ${{ github.ref }}
+        if: ${{ github.ref == 'refs/heads/master' || startsWith(github.ref, 'refs/heads/ruby_') }}
+
+      - name: Auto-correct code styles
+        run: |
+          set -x
+          ruby tool/auto-style.rb "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" refs/heads/master
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+          EMAIL: svn-admin@ruby-lang.org
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - name: Push PR notes to GitHub
+        run: ruby tool/notes-github-pr.rb "$(pwd)/.git" "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" refs/heads/master
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+          EMAIL: svn-admin@ruby-lang.org
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/pr-playground.yml b/.github/workflows/pr-playground.yml
new file mode 100644
index 0000000000..f3c0556429
--- /dev/null
+++ b/.github/workflows/pr-playground.yml
@@ -0,0 +1,127 @@
+name: Post Playground link to PR
+on:
+  pull_request_target:
+    types: [labeled]
+  workflow_run:
+    workflows: ["WebAssembly"]
+    types: [completed]
+
+jobs:
+  post-summary:
+    name: Post Playground link
+    runs-on: ubuntu-latest
+    permissions:
+      pull-requests: write
+    # Post a comment only if the PR status check is passed and the PR is labeled with `Playground`.
+    # Triggered twice: when the PR is labeled and when PR build is passed.
+    if: >-
+      ${{ false
+      || (true
+        && github.event_name == 'pull_request_target'
+        && contains(github.event.pull_request.labels.*.name, 'Playground'))
+      || (true
+        && github.event_name == 'workflow_run'
+        && github.event.workflow_run.conclusion == 'success'
+        && github.event.workflow_run.event == 'pull_request')
+      }}
+    steps:
+      - uses: actions/github-script@ed597411d8f924073f98dfc5c65a23a2325f34cd # v8.0.0
+        with:
+          github-token: ${{ secrets.GITHUB_TOKEN }}
+          script: |
+            const fs = require('fs/promises');
+
+            const buildWorkflowPath = '.github/workflows/wasm.yml';
+            const findSuccessfuBuildRun = async (pr) => {
+              const opts = github.rest.actions.listWorkflowRunsForRepo.endpoint.merge({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                status: 'success',
+                branch: pr.head.ref,
+              });
+              const runs = await github.paginate(opts);
+              const buildRun = runs.find(run => run.path == buildWorkflowPath);
+              return buildRun;
+            }
+
+            const postComment = async (body, pr) => {
+              const { data: comments } = await github.rest.issues.listComments({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                issue_number: pr.number,
+              });
+
+              const commentOpts = { owner: context.repo.owner, repo: context.repo.repo, body: comment };
+
+              const existingComment = comments.find(comment => comment.body.startsWith(magicComment));
+              if (existingComment) {
+                core.info(`Updating existing comment: ${existingComment.html_url}`);
+                await github.rest.issues.updateComment({
+                  ...commentOpts, comment_id: existingComment.id
+                });
+              } else {
+                await github.rest.issues.createComment({
+                  ...commentOpts, issue_number: pr.number
+                });
+              }
+            }
+
+            const derivePRNumber = async () => {
+              if (context.payload.pull_request) {
+                return context.payload.pull_request.number;
+              }
+              // Workaround for https://github.com/orgs/community/discussions/25220
+
+              const { data: { artifacts } } = await github.rest.actions.listWorkflowRunArtifacts({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                run_id: context.payload.workflow_run.id,
+              });
+              const artifact = artifacts.find(artifact => artifact.name == 'github-pr-info');
+              if (!artifact) {
+                throw new Error('Cannot find github-pr-info.txt artifact');
+              }
+
+              const { data } = await github.rest.actions.downloadArtifact({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                artifact_id: artifact.id,
+                archive_format: 'zip',
+              });
+
+              await fs.writeFile('pr-info.zip', Buffer.from(data));
+              await exec.exec('unzip', ['pr-info.zip']);
+              return await fs.readFile('github-pr-info.txt', 'utf8');
+            }
+
+            const prNumber = await derivePRNumber();
+
+            const { data: pr } = await github.rest.pulls.get({
+              owner: context.repo.owner,
+              repo: context.repo.repo,
+              pull_number: prNumber,
+            });
+
+            core.info(`Checking if the PR ${prNumber} is labeled with Playground...`);
+            if (!pr.labels.some(label => label.name == 'Playground')) {
+              core.info(`The PR is not labeled with Playground.`);
+              return;
+            }
+
+            core.info(`Checking if the build is successful for ${pr.head.ref} in ${pr.head.repo.owner.login}/${pr.head.repo.name}...`);
+            const buildRun = await findSuccessfuBuildRun(pr);
+            if (!buildRun) {
+              core.info(`No successful build run found for ${buildWorkflowPath} on ${pr.head.ref} yet.`);
+              return;
+            }
+            core.info(`Found a successful build run: ${buildRun.html_url}`);
+
+            const runLink = `${process.env.GITHUB_SERVER_URL}/${process.env.GITHUB_REPOSITORY}/actions/runs/${process.env.GITHUB_RUN_ID}`;
+            const magicComment = `<!-- AUTO-GENERATED-COMMENT-PR-PLAYGROUND -->`;
+            const comment = `${magicComment}
+            **Try on Playground**: https://ruby.github.io/play-ruby?run=${buildRun.id}
+            This is an automated comment by [\`pr-playground.yml\`](${runLink}) workflow.
+            `;
+            core.info(`Comment: ${comment}`);
+            await postComment(comment, pr);
+
diff --git a/.github/workflows/publish.yml b/.github/workflows/publish.yml
new file mode 100644
index 0000000000..3caeee9a3b
--- /dev/null
+++ b/.github/workflows/publish.yml
@@ -0,0 +1,107 @@
+name: Publish Ruby packages
+
+on:
+  repository_dispatch:
+    types:
+      - release
+  workflow_dispatch:
+    inputs:
+      version:
+        description: 'Version of the Ruby package to release'
+        required: true
+        default: '3.3.4'
+
+jobs:
+  release:
+    runs-on: ubuntu-latest
+    steps:
+      - uses: actions/checkout@v6.0.1
+
+      - uses: ruby/setup-ruby@v1
+        with:
+          ruby-version: 3.3.4
+
+      - name: Store Ruby version
+        run: |
+          echo "RUBY_VERSION=${{ github.event.client_payload.version || github.event.inputs.version }}" >> $GITHUB_ENV
+
+      - name: Store ABI version
+        run: echo "ABI_VERSION=$(echo ${{ env.RUBY_VERSION }} | cut -d '.' -f 1-2)" >> $GITHUB_ENV
+
+      - name: Copy draft package `/tmp` to `/pub` directory
+        run: tool/release.sh ${{ env.RUBY_VERSION }}
+        env:
+          AWS_ACCESS_KEY_ID: ${{ secrets.FTP_R_L_O_AWS_ACCESS_KEY_ID }}
+          AWS_SECRET_ACCESS_KEY: ${{ secrets.FTP_R_L_O_AWS_SECRET_ACCESS_KEY }}
+          AWS_DEFAULT_REGION: us-west-2
+
+      - name: Purge URLs of release package
+        run: |
+          curl -X POST \
+            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
+            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${{ env.ABI_VERSION }}/ruby-${{ env.RUBY_VERSION }}.tar.gz
+          curl -X POST \
+            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
+            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${{ env.ABI_VERSION }}/ruby-${{ env.RUBY_VERSION }}.tar.xz
+          curl -X POST \
+            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
+            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${{ env.ABI_VERSION }}/ruby-${{ env.RUBY_VERSION }}.zip
+
+      - name: Create a release on GitHub
+        run: |
+          RELEASE_TAG=$(ruby tool/ruby-version.rb tag "${{ env.RUBY_VERSION }}")
+          echo $RELEASE_TAG
+          PREVIOUS_RELEASE_TAG=$(ruby tool/ruby-version.rb previous-tag "${{ env.RUBY_VERSION }}")
+          echo $PREVIOUS_RELEASE_TAG
+          tool/gen-github-release.rb $PREVIOUS_RELEASE_TAG $RELEASE_TAG --no-dry-run
+        env:
+          GITHUB_TOKEN: ${{ secrets.MATZBOT_AUTO_UPDATE_TOKEN }}
+
+      - name: Update versions index
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/actions/dispatches \
+            -d '{"event_type": "update_index"}'
+
+      - name: Build and push Docker images
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/docker-images/actions/workflows/build.yml/dispatches \
+            -d '{"ref": "master", "inputs": {"ruby_version": "${{ env.RUBY_VERSION }}"}}'
+
+      - name: Build snapcraft packages
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/snap.ruby/dispatches \
+            -d '{"event_type": "build", "client_payload": {"ruby_version": "${{ env.RUBY_VERSION }}"}}'
+
+      - name: Store the latest LTS version of OpenSSL
+        run: |
+          echo "OPENSSL_VERSION=`curl -s https://api.github.com/repos/openssl/openssl/releases | jq -r '.[].tag_name | select(startswith("openssl-3.0"))' | sort -Vr | head -n1 | cut -d'-' -f2`" >> $GITHUB_ENV
+
+      - name: Update ruby-build definition
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.RUBY_BUILD_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/rbenv/ruby-build/dispatches \
+            -d '{"event_type": "update-ruby", "client_payload": {"ruby_version": "${{ env.RUBY_VERSION }}", "openssl_version": "${{ env.OPENSSL_VERSION }}"}}'
+
+      - name: Update all-ruby definition
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/all-ruby/dispatches \
+            -d '{"event_type": "update"}'
diff --git a/.github/workflows/release.yml b/.github/workflows/release.yml
new file mode 100644
index 0000000000..5d4474d978
--- /dev/null
+++ b/.github/workflows/release.yml
@@ -0,0 +1,18 @@
+name: Start release workflow
+on:
+  push:
+    tags:
+      - '*'
+
+jobs:
+  notify:
+    runs-on: ubuntu-latest
+    steps:
+      - name: Build release package
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/actions/dispatches \
+            -d '{"event_type": "${{ github.ref }}"}'
diff --git a/.github/workflows/rust-warnings.yml b/.github/workflows/rust-warnings.yml
new file mode 100644
index 0000000000..a2e3208e52
--- /dev/null
+++ b/.github/workflows/rust-warnings.yml
@@ -0,0 +1,60 @@
+# Surface Rust warnings on PRs that touch any Rust code.
+# Not a required check so we never block people over new warnings
+# that might come from a new Rust version being released.
+name: Rust warnings
+on:
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    paths:
+      - '**.rs'
+      - '!**.inc.rs'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  rust-warnings:
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    runs-on: ubuntu-24.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - name: Install Rust
+        run: rustup default beta
+
+      - name: Rust warnings
+        shell: bash
+        run: |
+          set -eu
+          cargo check --quiet --all-features --message-format=json \
+            | jq -r 'select(.message.level | IN("warning", "error")) | .message.rendered' \
+            | tee messages.txt
+          (exit "${PIPESTATUS[0]}") && ! grep --quiet '[^[:space:]]' messages.txt
+
+      - name: "📜 `rustdoc` warnings"
+        shell: bash
+        run: |
+          set -eu
+          cargo doc --document-private-items --all --no-deps --message-format=json \
+            | jq -r 'select(.message.level | IN("warning", "error")) | .message.rendered' \
+            | tee messages.txt
+          (exit "${PIPESTATUS[0]}") && ! grep --quiet '[^[:space:]]' messages.txt
diff --git a/.github/workflows/scorecards.yml b/.github/workflows/scorecards.yml
new file mode 100644
index 0000000000..c607098997
--- /dev/null
+++ b/.github/workflows/scorecards.yml
@@ -0,0 +1,78 @@
+# This workflow uses actions that are not certified by GitHub. They are provided
+# by a third-party and are governed by separate terms of service, privacy
+# policy, and support documentation.
+
+name: Scorecard supply-chain security
+on:
+  # For Branch-Protection check. Only the default branch is supported. See
+  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#branch-protection
+  branch_protection_rule:
+  # To guarantee Maintained check is occasionally updated. See
+  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#maintained
+  schedule:
+    - cron: '39 3 * * 5'
+  # push:
+  #   branches: [ "master" ]
+
+# Declare default permissions as read only.
+permissions: read-all
+
+jobs:
+  analysis:
+    name: Scorecard analysis
+    runs-on: ubuntu-latest
+    # `publish_results: true` only works when run from the default branch. conditional can be removed if disabled.
+    if: github.event.repository.default_branch == github.ref_name || github.event_name == 'pull_request'
+    permissions:
+      # Needed to upload the results to code-scanning dashboard.
+      security-events: write
+      # Needed to publish results and get a badge (see publish_results below).
+      id-token: write
+      # Uncomment the permissions below if installing in a private repository.
+      # contents: read
+      # actions: read
+
+    steps:
+      - name: "Checkout code"
+        uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          persist-credentials: false
+
+      - name: "Run analysis"
+        uses: ossf/scorecard-action@4eaacf0543bb3f2c246792bd56e8cdeffafb205a # v2.4.3
+        with:
+          results_file: results.sarif
+          results_format: sarif
+          # (Optional) "write" PAT token. Uncomment the `repo_token` line below if:
+          # - you want to enable the Branch-Protection check on a *public* repository, or
+          # - you are installing Scorecard on a *private* repository
+          # To create the PAT, follow the steps in https://github.com/ossf/scorecard-action?tab=readme-ov-file#authentication-with-fine-grained-pat-optional.
+          # repo_token: ${{ secrets.SCORECARD_TOKEN }}
+
+          # Public repositories:
+          #   - Publish results to OpenSSF REST API for easy access by consumers
+          #   - Allows the repository to include the Scorecard badge.
+          #   - See https://github.com/ossf/scorecard-action#publishing-results.
+          # For private repositories:
+          #   - `publish_results` will always be set to `false`, regardless
+          #     of the value entered here.
+          publish_results: true
+
+          # (Optional) Uncomment file_mode if you have a .gitattributes with files marked export-ignore
+          # file_mode: git
+
+      # Upload the results as artifacts (optional). Commenting out will disable uploads of run results in SARIF
+      # format to the repository Actions tab.
+      - name: "Upload artifact"
+        uses: actions/upload-artifact@b7c566a772e6b6bfb58ed0dc250532a479d7789f # v6.0.0
+        with:
+          name: SARIF file
+          path: results.sarif
+          retention-days: 5
+
+      # Upload the results to GitHub's code scanning dashboard (optional).
+      # Commenting out will disable upload of results to your repo's Code Scanning dashboard
+      - name: "Upload to code-scanning"
+        uses: github/codeql-action/upload-sarif@v4
+        with:
+          sarif_file: results.sarif
diff --git a/.github/workflows/spec_guards.yml b/.github/workflows/spec_guards.yml
new file mode 100644
index 0000000000..cf4661555c
--- /dev/null
+++ b/.github/workflows/spec_guards.yml
@@ -0,0 +1,67 @@
+name: Rubyspec Version Guards Check
+
+on:
+  push:
+    paths:
+      - '.github/workflows/spec_guards.yml'
+      - 'spec/**'
+      - '!spec/*.md'
+  pull_request:
+    paths:
+      - '.github/workflows/spec_guards.yml'
+      - 'spec/**'
+      - '!spec/*.md'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  rubyspec:
+    name: Rubyspec
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    strategy:
+      matrix:
+        # Specs from ruby/spec should still run on all supported Ruby versions.
+        # This also ensures the needed ruby_version_is guards are there, see spec/README.md.
+        ruby:
+          - ruby-3.2
+          - ruby-3.3
+          - ruby-3.4
+          - ruby-4.0
+      fail-fast: false
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: ${{ matrix.ruby }}
+          bundler: none
+
+      - run: gem install webrick
+
+      - run: ruby ../mspec/bin/mspec
+        working-directory: spec/ruby
+        env:
+          CHECK_LEAKS: true
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.ruby }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/sync_default_gems.yml b/.github/workflows/sync_default_gems.yml
new file mode 100644
index 0000000000..9ff97d5a4e
--- /dev/null
+++ b/.github/workflows/sync_default_gems.yml
@@ -0,0 +1,77 @@
+name: Sync default gems
+
+env:
+  DEFAULT_GEM_SYNC_ENABLED: true
+
+on:
+  workflow_dispatch:
+    inputs:
+      gem:
+        required: true
+        description: 'Name of the gem to be synchronized'
+        type: string
+      before:
+        required: true
+        description: 'Gem commit SHA before sync'
+        type: string
+      after:
+        required: true
+        description: 'Gem commit SHA after sync'
+        type: string
+
+jobs:
+  sync_default_gems:
+    name: Sync default gem ${{ github.event.inputs.gem }}
+
+    permissions:
+      contents: write # for Git to git push
+
+    runs-on: ubuntu-latest
+
+    if: ${{ github.repository == 'ruby/ruby' }}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        name: Check out ruby/ruby
+        with:
+          token: ${{ github.repository == 'ruby/ruby' && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.4'
+          bundler: none
+
+      - name: Run tool/sync_default_gems.rb
+        id: sync
+        run: |
+          ruby_before=$(git rev-parse HEAD)
+          set -x
+          ruby tool/sync_default_gems.rb "${gem_name}" "${gem_before}..${gem_after}"
+          if [[ "$(git rev-parse HEAD)" != "$ruby_before" ]]; then
+            echo update=true >> $GITHUB_OUTPUT
+          fi
+        env:
+          gem_name: ${{ github.event.inputs.gem }}
+          gem_before: ${{ github.event.inputs.before }}
+          gem_after: ${{ github.event.inputs.after }}
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+
+      - name: Push
+        run: |
+          git pull --rebase origin ${GITHUB_REF#refs/heads/}
+          git push origin ${GITHUB_REF#refs/heads/}
+        if: ${{ steps.sync.outputs.update && env.DEFAULT_GEM_SYNC_ENABLED == 'true' }}
+        env:
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+          label: "${{ github.event.inputs.gem }} (<https://github.com/${{ github.event.inputs.gem == 'rubygems' && 'rubygems' || 'ruby' }}/${{ github.event.inputs.gem }}/compare/${{ github.event.inputs.before }}...${{ github.event.inputs.after }}|diff>)"
+          event_name: workflow_dispatch
+          extra_channel_id: C05FPKAU743 # alerts-sync
+        if: ${{ failure() }}
diff --git a/.github/workflows/ubuntu.yml b/.github/workflows/ubuntu.yml
new file mode 100644
index 0000000000..88c19b6fe6
--- /dev/null
+++ b/.github/workflows/ubuntu.yml
@@ -0,0 +1,269 @@
+name: Ubuntu
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        # We enumerate every job in matrix.include to save build time
+        include:
+          - test_task: check
+            configure: 'cppflags=-DVM_CHECK_MODE'
+          - test_task: check
+            arch: i686
+          - test_task: check
+            configure: '--disable-yjit'
+          - test_task: check
+            configure: '--enable-shared --enable-load-relative'
+          - test_task: test-bundler-parallel
+            timeout: 50
+          - test_task: test-bundled-gems
+          - test_task: check
+            os: ubuntu-24.04
+            extra_checks: [capi]
+          # ubuntu-24.04-arm jobs don't start on ruby/ruby as of 2025-10-29
+          #- test_task: check
+          #  os: ubuntu-24.04-arm
+      fail-fast: false
+
+    env: &make-env
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci
+
+    runs-on: ${{ matrix.os || 'ubuntu-22.04' }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps: &make-steps
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/ubuntu
+        with:
+          arch: ${{ matrix.arch }}
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+        if: >-
+          ${{ !endsWith(matrix.os, 'arm')
+          && !endsWith(matrix.os, 'ppc64le') && !endsWith(matrix.os, 's390x') }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Run configure
+        env:
+          arch: ${{ matrix.arch }}
+          configure: ${{ matrix.configure }}
+        run: >-
+          $SETARCH ../src/configure -C --disable-install-doc ${configure:-cppflags=-DRUBY_DEBUG}
+          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
+
+      - run: $SETARCH make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: $SETARCH make
+
+      - run: $SETARCH make hello
+
+      - name: runirb
+        run: |
+          echo IRB::VERSION | $SETARCH make runirb RUNOPT="-- -f"
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.os || 'ubuntu-22.04' }}
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+        continue-on-error: true
+        timeout-minutes: 3
+
+      # Avoid possible test failures with the zlib applying the following patch
+      # on s390x CPU architecture.
+      # https://github.com/madler/zlib/pull/410
+      - name: Disable DFLTCC
+        run: echo "DFLTCC=0" >> $GITHUB_ENV
+        if: ${{ endsWith(matrix.os, 's390x') }}
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          $SETARCH make -s ${{ matrix.test_task }} \
+          ${TESTS:+TESTS="$TESTS"} \
+          ${{ !contains(matrix.test_task, 'bundle') && 'RUBYOPT=-w' || '' }}
+        timeout-minutes: ${{ matrix.timeout || 40 }}
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+
+      - name: make skipped tests
+        run: |
+          $SETARCH make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - name: test-pc
+        run: |
+          DESTDIR=${RUNNER_TEMP-${TMPDIR-/tmp}}/installed
+          $SETARCH make test-pc "DESTDIR=$DESTDIR"
+
+      - name: CAPI extensions
+        uses: ./.github/actions/capiext
+        with:
+          builddir: build
+          make: '$SETARCH make'
+        env:
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ contains(matrix.extra_checks, 'capi') }}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}${{ matrix.os }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  make-ibm:
+    strategy:
+      matrix:
+        include:
+          - test_task: check
+            os: ubuntu-24.04-ppc64le
+          - test_task: check
+            os: ubuntu-24.04-s390x
+      fail-fast: false
+
+    env: *make-env
+
+    runs-on: ${{ matrix.os }}
+
+    if: >-
+      ${{github.repository == 'ruby/ruby'
+      && !(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps: *make-steps
+
+  # Separated from `make` job to avoid making it a required status check
+  ruby-bench:
+    strategy:
+      matrix:
+        include:
+          # Using the same setup as ZJIT jobs
+          - bench_opts: '--warmup=1 --bench=1 --excludes=lobsters'
+
+    runs-on: ubuntu-24.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix="$(pwd)/install"
+
+      - run: make install
+
+      - name: Checkout ruby-bench
+        uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          repository: ruby/ruby-bench
+          path: ruby-bench
+
+      # If you want to skip failing benchmark, consider using `--excludes`.
+      # e.g. `bench_opts: '--warmup=1 --bench=1 --excludes=railsbench,lobsters'`
+      - name: Run ruby-bench
+        run: ruby run_benchmarks.rb -e "ruby::../build/install/bin/ruby" ${{ matrix.bench_opts }}
+        working-directory: ruby-bench
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ruby-bench ${{ matrix.bench_opts }} ${{ matrix.ruby_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/wasm.yml b/.github/workflows/wasm.yml
new file mode 100644
index 0000000000..0d2a6f0545
--- /dev/null
+++ b/.github/workflows/wasm.yml
@@ -0,0 +1,179 @@
+name: WebAssembly
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions: # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        entry:
+#         # wasmtime can't compile non-optimized Asyncified binary due to locals explosion
+#         - { name: O0-debuginfo, optflags: '-O0', debugflags: '-g', wasmoptflags: '-O1' }
+#         - { name: O1,           optflags: '-O1', debugflags: ''  , wasmoptflags: '-O1' }
+          - { name: O2, optflags: '-O2', debugflags: '', wasmoptflags: '-O2' }
+#         - { name: O3,           optflags: '-O3', debugflags: ''  , wasmoptflags: '-O3' }
+#         # -O4 is equivalent to -O3 in clang, but it's different in wasm-opt
+#         - { name: O4,           optflags: '-O3', debugflags: ''  , wasmoptflags: '-O4' }
+#         - { name: Oz,           optflags: '-Oz', debugflags: ''  , wasmoptflags: '-Oz' }
+      fail-fast: false
+
+    env:
+      RUBY_TESTOPTS: '-q --tty=no'
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      WASI_SDK_VERSION_MAJOR: 25
+      WASI_SDK_VERSION_MINOR: 0
+      BINARYEN_VERSION: 113
+      WASMTIME_VERSION: v15.0.0
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Install libraries
+        run: |
+          set -ex
+          sudo apt-get update -q || :
+          sudo apt-get install --no-install-recommends -q -y ruby make autoconf git wget
+
+          wasi_sdk_deb="wasi-sdk-${WASI_SDK_VERSION_MAJOR}.${WASI_SDK_VERSION_MINOR}-x86_64-linux.deb"
+          wget "https://github.com/WebAssembly/wasi-sdk/releases/download/wasi-sdk-${WASI_SDK_VERSION_MAJOR}/${wasi_sdk_deb}"
+          sudo dpkg -i "$wasi_sdk_deb"
+          rm -f "$wasi_sdk_deb"
+
+          mkdir build-sdk
+          pushd build-sdk
+
+          wasmtime_url="https://github.com/bytecodealliance/wasmtime/releases/download/${WASMTIME_VERSION}/wasmtime-${WASMTIME_VERSION}-x86_64-linux.tar.xz"
+          wget -O - "$wasmtime_url" | tar xJf -
+          sudo ln -fs "$PWD/wasmtime-${WASMTIME_VERSION}-x86_64-linux/wasmtime" /usr/local/bin/wasmtime
+
+          binaryen_tarball="binaryen-version_${BINARYEN_VERSION}-x86_64-linux.tar.gz"
+          binaryen_url="https://github.com/WebAssembly/binaryen/releases/download/version_${BINARYEN_VERSION}/${binaryen_tarball}"
+          wget -O - "$binaryen_url" | tar xfz -
+          sudo ln -fs "$PWD/binaryen-version_${BINARYEN_VERSION}/bin/wasm-opt" /usr/local/bin/wasm-opt
+        working-directory: src
+
+      - name: Set ENV
+        run: |
+          echo "WASI_SDK_PATH=/opt/wasi-sdk" >> $GITHUB_ENV
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - name: Build baseruby
+        run: |
+          set -ex
+          mkdir ../baseruby
+          pushd ../baseruby
+          ../src/configure --prefix=$PWD/install
+          make
+          make install
+
+      - name: Download config.guess with wasi version
+        run: |
+          rm tool/config.guess tool/config.sub
+          ruby tool/downloader.rb -d tool -e gnu config.guess config.sub
+        working-directory: src
+
+      - name: Run configure
+        run: |
+          ../src/configure \
+            --host wasm32-unknown-wasi \
+            --with-baseruby=$PWD/../baseruby/install/bin/ruby \
+            --with-static-linked-ext \
+            --with-ext=cgi/escape,continuation,coverage,date,digest/bubblebabble,digest,digest/md5,digest/rmd160,digest/sha1,digest/sha2,etc,fcntl,json,json/generator,json/parser,objspace,pathname,rbconfig/sizeof,ripper,stringio,strscan,monitor \
+            LDFLAGS=" \
+              -Xlinker --stack-first \
+              -Xlinker -z -Xlinker stack-size=16777216 \
+            " \
+            optflags="${{ matrix.entry.optflags }}" \
+            debugflags="${{ matrix.entry.debugflags }}" \
+            wasmoptflags="${{ matrix.entry.wasmoptflags }} ${{ matrix.entry.debugflags }}"
+
+      # miniruby may not be built when cross-compling
+      - run: make mini ruby
+
+      - run: make install DESTDIR=$PWD/../install
+      - run: tar cfz ../install.tar.gz -C ../install .
+
+      - name: Upload artifacts
+        uses: actions/upload-artifact@b7c566a772e6b6bfb58ed0dc250532a479d7789f # v6.0.0
+        with:
+          name: ruby-wasm-install
+          path: ${{ github.workspace }}/install.tar.gz
+      - name: Show Playground URL to try the build
+        run: |
+          echo "Try on Playground: https://ruby.github.io/play-ruby?run=$GITHUB_RUN_ID" >> $GITHUB_STEP_SUMMARY
+
+      - name: Run basictest
+        run: wasmtime run ./../build/miniruby --mapdir /::./ -- basictest/test.rb
+        working-directory: src
+
+      - name: Run bootstraptest (no thread)
+        run: |
+          NO_THREAD_TESTS="$(grep -L Thread -R ./bootstraptest | awk -F/ '{ print $NF }' | uniq | sed -n 's/test_\(.*\).rb/\1/p' | paste -s -d, -)"
+          ruby ./bootstraptest/runner.rb --ruby="$(which wasmtime) run $PWD/../build/ruby --mapdir /::./ -- " --verbose "--sets=$NO_THREAD_TESTS"
+        working-directory: src
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.entry.name }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+      # Workaround for https://github.com/orgs/community/discussions/25220
+      - name: Save Pull Request number
+        if: ${{ github.event_name == 'pull_request' }}
+        run: echo "${{ github.event.pull_request.number }}" >> ${{ github.workspace }}/github-pr-info.txt
+      - uses: actions/upload-artifact@b7c566a772e6b6bfb58ed0dc250532a479d7789f # v6.0.0
+        if: ${{ github.event_name == 'pull_request' }}
+        with:
+          name: github-pr-info
+          path: ${{ github.workspace }}/github-pr-info.txt
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/windows.yml b/.github/workflows/windows.yml
new file mode 100644
index 0000000000..1d44a5482c
--- /dev/null
+++ b/.github/workflows/windows.yml
@@ -0,0 +1,201 @@
+name: Windows
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - os: 2022
+            vc: 2022
+            test_task: check
+          - os: 2025
+            vc: 2022
+            test_task: check
+          - os: 11-arm
+            test_task: 'btest test-basic test-tool' # check and test-spec are broken yet.
+            target: arm64
+          - os: 2025
+            vc: 2022
+            test_task: test-bundled-gems
+      fail-fast: false
+
+    runs-on: windows-${{ matrix.os }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    name: Windows ${{ matrix.os }}/Visual C++ ${{ matrix.vc }} (${{ matrix.test_task }})
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      VCPKG_DEFAULT_TRIPLET: ${{ matrix.target || 'x64' }}-windows
+
+    steps:
+      - run: md build
+        working-directory:
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          # windows-11-arm has only 3.4.1, 3.4.2, 3.4.3, head
+          ruby-version: ${{ !endsWith(matrix.os, 'arm') && '3.1' || '3.4' }}
+          bundler: none
+          windows-toolchain: none
+
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          make-command: nmake
+          clean: true
+
+      - name: Install tools with scoop
+        run: |
+          Set-ExecutionPolicy -ExecutionPolicy RemoteSigned -Scope CurrentUser
+          iwr -useb get.scoop.sh | iex
+          Join-Path (Resolve-Path ~).Path "scoop\shims" >> $Env:GITHUB_PATH
+          scoop install vcpkg uutils-coreutils
+        shell: pwsh
+
+      - name: Restore vcpkg artifact
+        id: restore-vcpkg
+        uses: actions/cache/restore@8b402f58fbc84540c8b491a91e594a4576fec3d7 # v5.0.2
+        with:
+          path: src\vcpkg_installed
+          key: windows-${{ matrix.os }}-vcpkg-${{ hashFiles('src/vcpkg.json') }}
+
+      - name: Install libraries with vcpkg
+        run: |
+          vcpkg install --vcpkg-root=%USERPROFILE%\scoop\apps\vcpkg\current
+        working-directory: src
+        if: ${{ ! steps.restore-vcpkg.outputs.cache-hit }}
+
+      - name: Save vcpkg artifact
+        uses: actions/cache/save@8b402f58fbc84540c8b491a91e594a4576fec3d7 # v5.0.2
+        with:
+          path: src\vcpkg_installed
+          key: windows-${{ matrix.os }}-vcpkg-${{ hashFiles('src/vcpkg.json') }}
+        if: ${{ ! steps.restore-vcpkg.outputs.cache-hit && (github.ref_name == 'master' || startsWith(github.ref_name, 'ruby_')) }}
+
+      - name: setup env
+        # Available Ruby versions: https://github.com/actions/runner-images/blob/main/images/windows/Windows2019-Readme.md#ruby
+        # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
+        # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
+        run: |
+          ::- Set up VC ${{ matrix.vc }}
+          set | sort > old.env
+          call ..\src\win32\vssetup.cmd ^
+            -arch=${{ matrix.target || 'amd64' }} ^
+            ${{ matrix.vcvars && '-vcvars_ver=' || '' }}${{ matrix.vcvars }}
+          nmake -f nul
+          set TMP=%RUNNER_TEMP%
+          set TEMP=%RUNNER_TEMP%
+          set MAKEFLAGS=l
+          set /a TEST_JOBS=(15 * %NUMBER_OF_PROCESSORS% / 10) > nul
+          set RUBY_OPT_DIR=%GITHUB_WORKSPACE:\=/%/src/vcpkg_installed/%VCPKG_DEFAULT_TRIPLET%
+          set | sort > new.env
+          comm -13 old.env new.env >> %GITHUB_ENV%
+          del *.env
+
+      - name: baseruby version
+        run: ruby -v
+
+      - name: compiler version
+        run: cl
+
+      - name: volume info
+        run: Get-Volume
+        shell: pwsh
+
+      # TODO: We should use `../src` instead of `D:/a/ruby/ruby/src`
+      - name: Configure
+        run: >-
+          ../src/win32/configure.bat --disable-install-doc
+          --with-opt-dir=%RUBY_OPT_DIR%
+          --with-gmp
+
+      - run: nmake prepare-vcpkg
+
+      - run: nmake incs
+
+      - run: nmake extract-extlibs
+
+      # On all other platforms, test-spec depending on extract-gems (in common.mk) is enough.
+      # But not for this Visual Studio workflow. So here we extract gems before building.
+      - run: nmake extract-gems
+
+      # windows-11-arm runner cannot run `ruby tool/file2lastrev.rb --revision.h --output=revision.h`
+      - name: make revision.h
+        run: |
+          win32\lastrev.bat | win32\ifchange.bat --timestamp=.revision.time revision.h -
+          type revision.h
+        working-directory: src
+
+      - run: nmake
+
+      - name: Set up Launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: windows-${{ matrix.os }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          test-task: ${{ matrix.test_task || 'check' }}
+        continue-on-error: true
+        if: ${{ matrix.test_task != 'test-bundled-gems' }}
+        timeout-minutes: 3
+
+      - run: nmake ${{ matrix.test_task || 'check' }}
+        env:
+          RUBY_TESTOPTS: -j${{ env.TEST_JOBS || 4 }}
+        timeout-minutes: 70
+
+      - uses: ./.github/actions/slack
+        with:
+          label: Windows ${{ matrix.os }} / VC ${{ matrix.vc }} / ${{ matrix.test_task || 'check' }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: windows-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
+    shell: cmd
diff --git a/.github/workflows/wsl.yml b/.github/workflows/wsl.yml
new file mode 100644
index 0000000000..640f18ce42
--- /dev/null
+++ b/.github/workflows/wsl.yml
@@ -0,0 +1,70 @@
+name: Ubuntu on WSL
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+jobs:
+  wsl:
+    runs-on: windows-2025
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - name: Install or update WSL
+        uses: Ubuntu/WSL/.github/actions/wsl-install@main
+        with:
+          distro: Ubuntu-24.04
+
+      - name: Install dependencies
+        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
+        with:
+         distro: Ubuntu-24.04
+         working-dir: /tmp/github/
+         exec: |
+            DEBIAN_FRONTEND=noninteractive sudo apt update
+            DEBIAN_FRONTEND=noninteractive sudo apt install -y ruby build-essential autoconf libssl-dev libyaml-dev zlib1g-dev libgmp-dev libffi-dev
+
+      - name: Check out the repository
+        uses: Ubuntu/WSL/.github/actions/wsl-checkout@main
+        with:
+          distro: Ubuntu-24.04
+          working-dir: /tmp/github/
+          submodules: true
+
+      - name: Build
+        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
+        with:
+         distro: Ubuntu-24.04
+         working-dir: /tmp/github/
+         exec: |
+            ./autogen.sh
+            ./configure --disable-install-doc
+            make ruby -j4
+            make extract-gems
+            make -j4
+
+      - name: Test
+        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
+        with:
+         distro: Ubuntu-24.04
+         working-dir: /tmp/github/
+         exec: |
+            ./ruby -v
+            # make check TESTS="-j4" MSPECOPT="-j"
diff --git a/.github/workflows/yjit-macos.yml b/.github/workflows/yjit-macos.yml
new file mode 100644
index 0000000000..a59b4d6508
--- /dev/null
+++ b/.github/workflows/yjit-macos.yml
@@ -0,0 +1,198 @@
+name: YJIT macOS
+on:
+  push:
+    branches:
+      - master
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  cargo:
+    name: cargo test
+
+    runs-on: macos-14
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - run: RUST_BACKTRACE=1 cargo test
+        working-directory: yjit
+
+      # Also compile and test with all features enabled
+      - run: RUST_BACKTRACE=1 cargo test --all-features
+        working-directory: yjit
+
+      # Check that we can build in release mode too
+      - run: cargo build --release
+        working-directory: yjit
+
+  make:
+    strategy:
+      matrix:
+        include:
+          - test_task: 'check'
+            configure: '--enable-yjit'
+            yjit_opts: '--yjit'
+          - test_task: 'check'
+            configure: '--enable-yjit=dev'
+            yjit_opts: '--yjit-call-threshold=1 --yjit-verify-ctx --yjit-code-gc'
+            specopts: '-T --yjit-call-threshold=1 -T --yjit-verify-ctx -T --yjit-code-gc'
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.yjit_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+
+    runs-on: macos-14
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc ${{ matrix.configure }}
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - name: Verify that --yjit-dump-disasm works
+        run: |
+          ./miniruby --yjit-call-threshold=1 --yjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      - name: Set ENV for YJIT
+        run: |
+          echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: macos-14
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          is-yjit: true
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" \
+            SPECOPTS="$SPECOPTS"
+        timeout-minutes: 60
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          SYNTAX_SUGGEST_TIMEOUT: '5'
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: make skipped tests
+        run: |
+          make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+          PRECHECK_BUNDLED_GEMS: 'no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }} ${{ matrix.yjit_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: macos-14
+    needs: [make]
+    steps:
+      - name: ${{ github.workflow }} jobs have failed
+        run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/yjit-ubuntu.yml b/.github/workflows/yjit-ubuntu.yml
new file mode 100644
index 0000000000..150f0b3275
--- /dev/null
+++ b/.github/workflows/yjit-ubuntu.yml
@@ -0,0 +1,240 @@
+name: YJIT Ubuntu
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  cargo:
+    name: cargo test
+
+    # GitHub Action's image seems to already contain a Rust 1.58.0.
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      # For now we can't run cargo test --offline because it complains about the
+      # capstone dependency, even though the dependency is optional
+      #- run: cargo test --offline
+
+      - run: RUST_BACKTRACE=1 cargo test
+        working-directory: yjit
+
+      # Also compile and test with all features enabled
+      - run: RUST_BACKTRACE=1 cargo test --all-features
+        working-directory: yjit
+
+      # Check that we can build in release mode too
+      - run: cargo build --release
+        working-directory: yjit
+
+  lint:
+    name: cargo clippy
+
+    # GitHub Action's image seems to already contain a Rust 1.58.0.
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      # Check that we don't have linting errors in release mode, too
+      - run: cargo clippy --all-targets --all-features
+        working-directory: yjit
+
+  make:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - test_task: 'yjit-bindgen'
+            hint: 'To fix: use patch in logs'
+            # Build with YJIT+ZJIT for output that works in the most number of configurations
+            configure: '--with-gcc=clang-14 --enable-yjit=dev --enable-zjit'
+            libclang_path: '/usr/lib/llvm-14/lib/libclang.so.1'
+
+          - test_task: 'check'
+            # YJIT should be automatically built in release mode on x86-64 Linux with rustc present
+            #configure: "--enable-yjit RUSTC='rustc +1.58.0'"
+            configure: "RUSTC='rustc +1.58.0'"
+            rust_version: '1.58.0'
+
+          - test_task: 'check'
+            configure: '--enable-yjit=dev'
+
+          - test_task: 'check'
+            configure: '--enable-yjit=dev'
+            yjit_opts: '--yjit-call-threshold=1 --yjit-verify-ctx --yjit-code-gc'
+            specopts: '-T --yjit-call-threshold=1 -T --yjit-verify-ctx -T --yjit-code-gc'
+
+          - test_task: 'test-bundled-gems'
+            configure: '--enable-yjit=dev'
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.yjit_opts }}
+      YJIT_BENCH_OPTS: ${{ matrix.yjit_bench_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+      RUBY_DEBUG: ci
+      RUST_BACKTRACE: 1
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Install Rust
+        if: ${{ matrix.rust_version }}
+        run: rustup install ${{ matrix.rust_version }} --profile minimal
+
+      - name: Remove cargo
+        # Since this tests a `rustc` build for release, remove `cargo` to ensure
+        # that only `rustc` is used.
+        if: ${{ contains(matrix.configure, 'rustc') }}
+        run: sudo rm $(which -a cargo | uniq)
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install ${{ matrix.configure }}
+
+      - run: make incs
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - name: Verify that --yjit-dump-disasm works
+        run: |
+          ./miniruby --yjit-call-threshold=1 --yjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      - name: Set ENV for YJIT
+        run: |
+          echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      # Check that the binary was built with YJIT
+      - name: Check YJIT enabled
+        run: ./miniruby --yjit -v | grep "+YJIT"
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ubuntu-22.04
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          is-yjit: true
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" MSPECOPT=--debug SPECOPTS="$SPECOPTS" \
+            YJIT_BENCH_OPTS="$YJIT_BENCH_OPTS" YJIT_BINDGEN_DIFF_OPTS="$YJIT_BINDGEN_DIFF_OPTS"
+        timeout-minutes: 90
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          SYNTAX_SUGGEST_TIMEOUT: '5'
+          YJIT_BINDGEN_DIFF_OPTS: '--exit-code'
+          LIBCLANG_PATH: ${{ matrix.libclang_path }}
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/zjit-macos.yml b/.github/workflows/zjit-macos.yml
new file mode 100644
index 0000000000..a638907811
--- /dev/null
+++ b/.github/workflows/zjit-macos.yml
@@ -0,0 +1,214 @@
+name: ZJIT macOS
+on:
+  push:
+    branches:
+      - master
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - test_task: 'check'
+            run_opts: '--zjit-call-threshold=1'
+            specopts: '-T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'check'
+            run_opts: '--zjit-disable-hir-opt --zjit-call-threshold=1'
+            specopts: '-T --zjit-disable-hir-opt -T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'zjit-check' # zjit-test + quick feedback of test_zjit.rb
+            configure: '--enable-yjit=dev --enable-zjit'
+            rust_version: "1.85.0"
+
+          - test_task: 'ruby'
+            hint: 'combo build test'
+            configure: '--enable-yjit --enable-zjit'
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.run_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+      TESTOPTS: ${{ matrix.testopts }}
+      ZJIT_RB_BUG: 1
+
+    runs-on: macos-14
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Install Rust
+        if: ${{ matrix.rust_version }}
+        run: |
+          rustup install ${{ matrix.rust_version }} --profile minimal
+          rustup default ${{ matrix.rust_version }}
+
+      - uses: taiki-e/install-action@v2
+        with:
+          tool: nextest@0.9
+        if: ${{ matrix.test_task == 'zjit-check' }}
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc ${{ matrix.configure }}
+
+      - run: make
+
+      - name: Verify that --zjit-dump-disasm works
+        run: |
+          ./miniruby --zjit-call-threshold=1 --zjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      - name: Set ENV for ZJIT
+        run: |
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" \
+            SPECOPTS="$SPECOPTS" \
+            TESTOPTS="$TESTOPTS"
+        timeout-minutes: 60
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          EXCLUDES: '../src/test/.excludes-zjit'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          SYNTAX_SUGGEST_TIMEOUT: '5'
+          PRECHECK_BUNDLED_GEMS: 'no'
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: macos-14
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+  # Separated from `make` job to avoid making it a required status check for now
+  ruby-bench:
+    strategy:
+      matrix:
+        include:
+          # Test --call-threshold=2 with 2 iterations in total
+          - ruby_opts: '--zjit-call-threshold=2'
+            bench_opts: '--warmup=1 --bench=1 --excludes=lobsters'
+            configure: '--enable-zjit=dev_nodebug' # --enable-zjit=dev is too slow
+
+    runs-on: macos-14
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix="$(pwd)/install" ${{ matrix.configure }}
+
+      - run: make install
+
+      # setup/directories set MAKEFLAGS=-j4 for macOS, which randomly fails sqlite3.gem builds
+      - name: Unset MAKEFLAGS
+        run: echo "MAKEFLAGS=" >> "$GITHUB_ENV"
+
+      - name: Checkout ruby-bench
+        uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          repository: ruby/ruby-bench
+          path: ruby-bench
+
+      # If you want to skip failing benchmark, consider using `--excludes`.
+      # e.g. `bench_opts: '--warmup=1 --bench=1 --excludes=railsbench,lobsters'`
+      - name: Run ruby-bench
+        run: ruby run_benchmarks.rb -e "zjit::../build/install/bin/ruby ${{ matrix.ruby_opts }}" ${{ matrix.bench_opts }}
+        working-directory: ruby-bench
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ruby-bench ${{ matrix.bench_opts }} ${{ matrix.ruby_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/zjit-ubuntu.yml b/.github/workflows/zjit-ubuntu.yml
new file mode 100644
index 0000000000..28bfec963e
--- /dev/null
+++ b/.github/workflows/zjit-ubuntu.yml
@@ -0,0 +1,267 @@
+name: ZJIT Ubuntu
+on:
+  push:
+    branches:
+      - master
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  lint:
+    name: cargo clippy
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - run: cargo clippy --all-targets --all-features
+        working-directory: zjit
+
+  make:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - test_task: 'check'
+            run_opts: '--zjit-call-threshold=1'
+            specopts: '-T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'check'
+            run_opts: '--zjit-disable-hir-opt --zjit-call-threshold=1'
+            specopts: '-T --zjit-disable-hir-opt -T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+            # The optimizer benefits from at least 1 iteration of profiling. Also, many
+            # regression tests in bootstraptest/test_yjit.rb assume call-threshold=2.
+          - test_task: 'btest'
+            run_opts: '--zjit-call-threshold=2'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'zjit-check' # zjit-test + quick feedback of test_zjit.rb
+            configure: '--enable-yjit --enable-zjit=dev'
+            rust_version: '1.85.0'
+
+          - test_task: 'zjit-bindgen'
+            hint: 'To fix: use patch in logs'
+            # Build with YJIT+ZJIT for output that works in the most number of configurations
+            configure: '--enable-zjit=dev --enable-yjit --with-gcc=clang-16'
+            clang_path: '/usr/bin/clang-16'
+            runs-on: 'ubuntu-24.04' # for clang-16
+
+          - test_task: 'test-bundled-gems'
+            configure: '--enable-zjit=dev'
+            run_opts: '--zjit-call-threshold=1'
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.run_opts }}
+      YJIT_BENCH_OPTS: ${{ matrix.yjit_bench_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+      TESTOPTS: ${{ matrix.testopts }}
+      RUBY_DEBUG: ci
+      BUNDLE_JOBS: 8 # for yjit-bench
+      RUST_BACKTRACE: 1
+      ZJIT_RB_BUG: 1
+
+    runs-on: ${{ matrix.runs-on || 'ubuntu-22.04' }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: taiki-e/install-action@v2
+        with:
+          tool: nextest@0.9
+        if: ${{ matrix.test_task == 'zjit-check' }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Install Rust
+        if: ${{ matrix.rust_version }}
+        run: |
+          rustup install ${{ matrix.rust_version }} --profile minimal
+          rustup default ${{ matrix.rust_version }}
+
+      - name: Install rustfmt
+        if: ${{ matrix.test_task == 'zjit-bindgen' }}
+        run: rustup component add rustfmt
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install ${{ matrix.configure }}
+
+      - run: make incs
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - name: Verify that --zjit-dump-disasm works
+        run: |
+          ./miniruby --zjit-call-threshold=1 --zjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      # Check that the binary was built with ZJIT
+      - name: Check ZJIT enabled
+        run: ./miniruby --zjit -v | grep "+ZJIT"
+        if: ${{ matrix.configure != '--disable-zjit' }}
+
+      - name: Set ENV for ZJIT
+        run: |
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" MSPECOPT=--debug SPECOPTS="$SPECOPTS" \
+            TESTOPTS="$TESTOPTS" \
+            ZJIT_BINDGEN_DIFF_OPTS="$ZJIT_BINDGEN_DIFF_OPTS"
+        timeout-minutes: 90
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          EXCLUDES: '../src/test/.excludes-zjit'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          SYNTAX_SUGGEST_TIMEOUT: '5'
+          ZJIT_BINDGEN_DIFF_OPTS: '--exit-code'
+          CLANG_PATH: ${{ matrix.clang_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-22.04
+    needs: [make]
+    steps:
+      - name: ${{ github.workflow }} jobs have failed
+        run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+  # Separated from `make` job to avoid making it a required status check for now
+  ruby-bench:
+    strategy:
+      matrix:
+        include:
+          # Test --call-threshold=2 with 2 iterations in total
+          - ruby_opts: '--zjit-call-threshold=2'
+            bench_opts: '--warmup=1 --bench=1 --excludes=lobsters'
+            configure: '--enable-zjit=dev_nodebug' # --enable-zjit=dev is too slow
+
+    runs-on: ubuntu-24.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix="$(pwd)/install" ${{ matrix.configure }}
+
+      - run: make install
+
+      - name: Checkout ruby-bench
+        uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          repository: ruby/ruby-bench
+          path: ruby-bench
+
+      # If you want to skip failing benchmark, consider using `--excludes`.
+      # e.g. `bench_opts: '--warmup=1 --bench=1 --excludes=railsbench,lobsters'`
+      - name: Run ruby-bench
+        run: ruby run_benchmarks.rb -e "zjit::../build/install/bin/ruby ${{ matrix.ruby_opts }}" ${{ matrix.bench_opts }}
+        working-directory: ruby-bench
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ruby-bench ${{ matrix.bench_opts }} ${{ matrix.ruby_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.gitignore b/.gitignore
index 6d48164a4c..6cf5fb5f32 100644
--- a/.gitignore
+++ b/.gitignore
@@ -1,44 +1,74 @@
 *-*-*.def
+*-*-*.exp
+*-*-*.lib
 *.a
 *.bak
+*.bc
+*.bundle
 *.dSYM
 *.dmyh
 *.dylib
 *.elc
+*.i
+*.ii
 *.inc
 *.log
 *.o
+*.o.tmp
+*.obj
+*.old
 *.orig
+*.pch
+*.pdb
+*.rbinc
+*.rbbin
 *.rej
+*.s
 *.sav
+*.sl
+*.so
+*.so.*
 *.swp
+*.yarb
 *~
-.*-*
 .*.list
 .*.time
 .DS_Store
+.bundle
 .ccmalloc
 .ext
 .pc
 .ppack
 .svn
+.time
+.ruby-version
 Makefile
-Makefile.old
+cygruby*.def
 extconf.h
 y.output
 y.tab.c
+*.gcda
+*.gcno
+*.gcov
+*.vscode
+!misc/.vscode
+lcov*.info
 
 # /
 /*-fake.rb
+/*.dll
+/*.exe
+/*.res
 /*.pc
+/*.rc
 /*_prelude.c
+/.downloaded-cache
+/.top-enc.mk
+/build*/
 /COPYING.LIB
-/ChangeLog-*
-/ChangeLog.pre-alpha
-/ChangeLog.pre1_1
+/ChangeLog
 /Doxyfile
 /GNUmakefile
-/GNUmakefile.old
 /README.atheos
 /README.fat-patch
 /README.v6
@@ -46,6 +76,7 @@ y.tab.c
 /archive
 /autom4te*.cache
 /automake
+/benchmark/benchmark-driver
 /beos
 /bmlog-*
 /breakpoints.gdb
@@ -56,6 +87,8 @@ y.tab.c
 /config.status.lineno
 /configure
 /coverage/simplecov
+/coverage/simplecov-html
+/coverage/doclie
 /coverage/.last_run.json
 /coverage/.resultset.json*
 /coverage/assets
@@ -67,6 +100,9 @@ y.tab.c
 /goruby
 /id.[ch]
 /largefile.h
+/lcov-c-out
+/lcov-rb-out
+/lcov-out
 /lex.c
 /libruby*.*
 /miniprelude.c
@@ -82,41 +118,82 @@ y.tab.c
 /ppack
 /prelude.c
 /preview
+/probes.dmyh
 /probes.h
 /rbconfig.rb
 /rename2.h
 /repack
 /revision.h
+/revision.tmp
+/ripper.tmp.y
 /riscos
 /rubicon
 /ruby
+/ruby-runner
+/ruby-runner.h
 /ruby-man.rd.gz
+/rubyspec_temp
+/run.gdb
 /sizes.c
+/static-ruby
 /test.rb
+/test-coverage.dat
 /tmp
+/vcpkg_installed
 /transdb.h
 /uncommon.mk
 /verconf.h
+/verconf.mk
 /web
-/yasmdata.rb
+
+# /bin/
+
+/bin/*.exe
+/bin/*.dll
+/bin/goruby
+/bin/ruby
 
 # /benchmark/
+/benchmark/bm_require.data
 /benchmark/bmx_*.rb
 /benchmark/fasta.output.*
 /benchmark/wc.input
 
+/enc/*.def
+/enc/*.exp
+/enc/*.lib
+/enc/jis/props.h
 /enc/unicode/data
 
+# /coroutine/
+!/coroutine/**/*.s
+!/coroutine/**/*.S
+
 # /enc/trans/
 /enc/trans/*.c
-/enc/trans/.time
+/enc/trans/*.def
+/enc/trans/*.exp
+/enc/trans/*.lib
+
+# /exe/
+/exe/goruby
+/exe/ruby
 
 # /ext/
 /ext/extinit.c
+/ext/configure-ext.mk
+/ext/*/exts.mk
 
-# /ext/dl/callback/
-/ext/dl/callback/callback-*.c
-/ext/dl/callback/callback.c
+# /ext/-test-/cxxanyargs
+/ext/-test-/cxxanyargs/failure*.failed
+
+# /ext/-test-/win32/dln/
+/ext/-test-/win32/dln/dlntest.dll
+/ext/-test-/win32/dln/dlntest.exp
+/ext/-test-/win32/dln/dlntest.lib
+
+# /ext/-test-/gems
+/ext/-test-/gems
 
 # /ext/etc/
 /ext/etc/constdefs.h
@@ -126,10 +203,14 @@ y.tab.c
 
 # /ext/rbconfig/
 /ext/rbconfig/sizeof/sizes.c
+/ext/rbconfig/sizeof/limits.c
 
 # /ext/ripper/
 /ext/ripper/eventids1.c
+/ext/ripper/eventids1.h
+/ext/ripper/.eventids2-check
 /ext/ripper/eventids2table.c
+/ext/ripper/ripper_init.c
 /ext/ripper/ripper.*
 /ext/ripper/ids1
 /ext/ripper/ids2
@@ -139,15 +220,20 @@ y.tab.c
 /ext/socket/constdefs.h
 /ext/socket/constdefs.c
 
-# /ext/tk/
-/ext/tk/config_list
-
 # /gems
 /gems/*.gem
+/gems/src
+/gems/*-*
+
+# /lib/
+/lib/ruby/[1-9]*.*
+/lib/ruby/vendor_ruby
 
-# /spec/
-/spec/mspec
-/spec/rubyspec
+# /misc/
+/misc/**/__pycache__
+
+# for `make test-bundler`
+/.rspec_status
 
 # /tool/
 /tool/config.guess
@@ -155,4 +241,40 @@ y.tab.c
 
 # /win32/
 /win32/*.ico
-/win32/.time
+
+
+# YJIT
+/yjit-bench
+/yjit_exit_locations.dump
+
+# Rust
+/target
+
+# /wasm/
+/wasm/tests/*.wasm
+
+# prism
+/lib/prism/compiler.rb
+/lib/prism/dispatcher.rb
+/lib/prism/dot_visitor.rb
+/lib/prism/dsl.rb
+/lib/prism/inspect_visitor.rb
+/lib/prism/mutation_compiler.rb
+/lib/prism/node.rb
+/lib/prism/reflection.rb
+/lib/prism/serialize.rb
+/lib/prism/visitor.rb
+/prism/api_node.c
+/prism/ast.h
+/prism/diagnostic.c
+/prism/diagnostic.h
+/prism/node.c
+/prism/prettyprint.c
+/prism/serialize.c
+/prism/token_type.c
+/prism/srcs.mk
+
+# tool/update-NEWS-gemlist.rb
+/bundled_gems.json
+/default_gems.json
+/gems/default_gems
diff --git a/.indent.pro b/.indent.pro
index 6a207a0554..1d61cbcad1 100644
--- a/.indent.pro
+++ b/.indent.pro
@@ -2,12 +2,15 @@
 -nbbb
 -nbc
 -br
+-brs
 -nbs
 -ncdb
--ce
--cli0.5
+-nce
+-cdw
+-cli2
+-cbi2
 -ndj
--ei
+-ncs
 -nfc1
 -i4
 -l120
@@ -16,6 +19,14 @@
 -psl
 -sc
 -sob
+-sbi4
+-nut
+-par
 
 -TID
 -TVALUE
+-Tst_data_t
+-Tst_index_t
+-Tst_table
+-Trb_data_type_t
+-TFILE
diff --git a/.mailmap b/.mailmap
new file mode 100644
index 0000000000..213a0f4916
--- /dev/null
+++ b/.mailmap
@@ -0,0 +1,431 @@
+git[bot]                                <svn-admin@ruby-lang.org>
+git[bot]                                <svn-admin@ruby-lang.org> git <svn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+svn[bot]                                <svn-admin@ruby-lang.org> svn <svn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# a_matsuda
+Akira Matsuda                           <ronnie@dio.jp>
+Akira Matsuda                           <ronnie@dio.jp> <a_matsuda@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# aamine
+Minero Aoki                             <aamine@loveruby.net>
+Minero Aoki                             <aamine@loveruby.net> <aamine@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# akira
+akira yamada                            <akira@ruby-lang.org>
+## akira yamada                         <akira@ruby-lang.org> <akira@rice.p.arika.org>
+akira yamada                            <akira@ruby-lang.org> <akira@arika.org>
+akira yamada                            <akira@ruby-lang.org> <akira@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# akiyoshi
+AKIYOSHI, Masamichi                     <masamichi.akiyoshi@hp.com>
+AKIYOSHI, Masamichi                     <masamichi.akiyoshi@hp.com> <akiyoshi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# akr
+Tanaka Akira                            <akr@fsij.org>
+Tanaka Akira                            <akr@fsij.org> <akr@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# arai
+Koji Arai                               <jca02266@nifty.ne.jp>
+Koji Arai                               <jca02266@nifty.ne.jp> <arai@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# arton
+Akio Tajima                             <artonx@yahoo.co.jp>
+Akio Tajima                             <artonx@yahoo.co.jp> <arton@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# aycabta
+aycabta                                 <aycabta@gmail.com>
+aycabta                                 <aycabta@gmail.com> <aycabta@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ayumin
+Ayumu AIZAWA                            <ayumu.aizawa@gmail.com>
+Ayumu AIZAWA                            <ayumu.aizawa@gmail.com> <ayumin@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# azav
+Alexander Zavorine                      <alexandre.zavorine@nokia.com>
+Alexander Zavorine                      <alexandre.zavorine@nokia.com> <azav@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# charliesome
+Charlie Somerville                      <charliesome@ruby-lang.org>
+Charlie Somerville                      <charliesome@ruby-lang.org> <charliesome@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# dave
+Dave Thomas                             <dave@pragprog.com>
+Dave Thomas                             <dave@pragprog.com> <dave@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# davidflanagan
+David Flanagan                          <davidflanagan@ruby-lang.org>
+David Flanagan                          <davidflanagan@ruby-lang.org> <david@think32>
+David Flanagan                          <davidflanagan@ruby-lang.org> <david@davidflanagan.com>
+David Flanagan                          <davidflanagan@ruby-lang.org> <davidflanagan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# dblack
+David A. Black                          <dblack@rubypal.com>
+David A. Black                          <dblack@rubypal.com> <dblack@wobblini.net>
+David A. Black                          <dblack@rubypal.com> <dblack@superlink.net>
+David A. Black                          <dblack@rubypal.com> <dblack@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# drbrain
+Eric Hodel                              <drbrain@segment7.net>
+Eric Hodel                              <drbrain@segment7.net> <drbrain@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# duerst
+Martin Dürst                            <duerst@it.aoyama.ac.jp>
+Martin Dürst                            <duerst@it.aoyama.ac.jp> <duerst@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# eban
+WATANABE Hirofumi                       <eban@ruby-lang.org>
+WATANABE Hirofumi                       <eban@ruby-lang.org> <eban@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# emboss
+Martin Bosslet                          <Martin.Bosslet@gmail.com>
+Martin Bosslet                          <Martin.Bosslet@gmail.com> <Martin.Bosslet@googlemail.com>
+Martin Bosslet                          <Martin.Bosslet@gmail.com> <emboss@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# eregon
+Benoit Daloze                           <eregontp@gmail.com>
+Benoit Daloze                           <eregontp@gmail.com> <eregon@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# evan
+Evan Phoenix                            <evan@ruby-lang.org>
+Evan Phoenix                            <evan@ruby-lang.org> <evan@fallingsnow.net>
+Evan Phoenix                            <evan@ruby-lang.org> <evan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# glass
+Masaki Matsushita                       <glass.saga@gmail.com>
+Masaki Matsushita                       <glass.saga@gmail.com> <glass@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gogotanaka
+Kazuki Tanaka                           <gogotanaka@ruby-lang.org>
+Kazuki Tanaka                           <gogotanaka@ruby-lang.org> <gogotanaka@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gotoken
+Kentaro Goto                            <gotoken@gmail.com>
+Kentaro Goto                            <gotoken@gmail.com> <gotoken@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gotoyuzo
+GOTOU Yuuzou                            <gotoyuzo@notwork.org>
+GOTOU Yuuzou                            <gotoyuzo@notwork.org> <gotoyuzo@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gsinclair
+Gavin Sinclair                          <gsinclair@soyabean.com.au>
+Gavin Sinclair                          <gsinclair@soyabean.com.au> <gsinclair@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# H_Konishi
+KONISHI Hiromasa                        <konishih@fd6.so-net.ne.jp>
+KONISHI Hiromasa                        <konishih@fd6.so-net.ne.jp> <H_Konishi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# headius
+Charles Oliver Nutter                   <headius@headius.com>
+Charles Oliver Nutter                   <headius@headius.com> <headius@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# hone
+Terence Lee                             <hone@heroku.com>
+Terence Lee                             <hone@heroku.com> <hone@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# hsbt
+Hiroshi SHIBATA                         <hsbt@ruby-lang.org>
+Hiroshi SHIBATA                         <hsbt@ruby-lang.org> <hsbt@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# iwamatsu
+Nobuhiro Iwamatsu                       <iwamatsu@nigauri.org>
+Nobuhiro Iwamatsu                       <iwamatsu@nigauri.org> <iwamatsu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# jeg2
+James Edward Gray II                    <james@graysoftinc.com>
+James Edward Gray II                    <james@graysoftinc.com> <jeg2@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# jim
+Jim Weirich                             <jim@tardis.local>
+Jim Weirich                             <jim@tardis.local> <jim@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# k0kubun
+Takashi Kokubun                         <takashikkbn@gmail.com>
+Takashi Kokubun                         <takashikkbn@gmail.com> <k0kubun@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kanemoto
+Yutaka Kanemoto                         <kanemoto@ruby-lang.org>
+Yutaka Kanemoto                         <kanemoto@ruby-lang.org> <kanemoto@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# katsu
+UENO Katsuhiro                          <katsu@blue.sky.or.jp>
+UENO Katsuhiro                          <katsu@blue.sky.or.jp> <katsu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kazu
+Kazuhiro NISHIYAMA                      <zn@mbf.nifty.com>
+Kazuhiro NISHIYAMA                      <zn@mbf.nifty.com> <kazu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# keiju
+Keiju Ishitsuka                         <keiju@ishitsuka.com>
+Keiju Ishitsuka                         <keiju@ishitsuka.com> <keiju@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# knu
+Akinori MUSHA                           <knu@iDaemons.org>
+Akinori MUSHA                           <knu@iDaemons.org> <knu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ko1
+Koichi Sasada                           <ko1@atdot.net>
+Koichi Sasada                           <ko1@atdot.net> <ko1@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kosaki
+KOSAKI Motohiro                         <kosaki.motohiro@gmail.com>
+KOSAKI Motohiro                         <kosaki.motohiro@gmail.com> <kosaki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kosako
+K.Kosako                                <sndgk393@ybb.ne.jp>
+K.Kosako                                <sndgk393@ybb.ne.jp> <kosako@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kou
+Sutou Kouhei                            <kou@clear-code.com>
+Sutou Kouhei                            <kou@clear-code.com> <kou@cozmixng.org>
+Sutou Kouhei                            <kou@clear-code.com> <kou@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kouji
+Kouji Takao                             <kouji.takao@gmail.com>
+Kouji Takao                             <kouji.takao@gmail.com> <kouji@takao7.net>
+Kouji Takao                             <kouji.takao@gmail.com> <kouji@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ksaito
+Kazuo Saito                             <ksaito@uranus.dti.ne.jp>
+Kazuo Saito                             <ksaito@uranus.dti.ne.jp> <ksaito@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ktsj
+Kazuki Tsujimoto                        <kazuki@callcc.net>
+Kazuki Tsujimoto                        <kazuki@callcc.net> <ktsj@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# luislavena
+Luis Lavena                             <luislavena@gmail.com>
+Luis Lavena                             <luislavena@gmail.com> <luislavena@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# mame
+Yusuke Endoh                            <mame@ruby-lang.org>
+## Yusuke Endoh                         <mame@ruby-lang.org> <mame@tsg.ne.jp>
+Yusuke Endoh                            <mame@ruby-lang.org> <mame@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# marcandre
+Marc-Andre Lafortune                    <github@marc-andre.ca>
+Marc-Andre Lafortune                    <ruby-core@marc-andre.ca>
+Marc-Andre Lafortune                    <ruby-core@marc-andre.ca> <marcandre@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# matz
+Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp>
+Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp> <matz@ruby-lang.org>
+Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp> <matz@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# michal
+Michal Rokos                            <michal@ruby-lang.org>
+Michal Rokos                            <michal@ruby-lang.org> <michal@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# mneumann
+Michael Neumann                         <mneumann@ruby-lang.org>
+Michael Neumann                         <mneumann@ruby-lang.org> <mneumann@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# mrkn
+Kenta Murata                            <mrkn@mrkn.jp>
+Kenta Murata                            <mrkn@mrkn.jp> <muraken@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+Kenta Murata                            <mrkn@mrkn.jp> <3959+mrkn@users.noreply.github.com>
+Kenta Murata                            <mrkn@mrkn.jp> <mrkn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nagachika
+nagachika                               <nagachika@ruby-lang.org>
+nagachika                               <nagachika@ruby-lang.org> <nagachika@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nagai
+Hidetoshi NAGAI                         <nagai@ai.kyutech.ac.jp>
+Hidetoshi NAGAI                         <nagai@ai.kyutech.ac.jp> <nagai@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nahi
+Hiroshi Nakamura                        <nahi@ruby-lang.org>
+Hiroshi Nakamura                        <nahi@ruby-lang.org> <nahi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nari
+Narihiro Nakamura                       <authornari@gmail.com>
+Narihiro Nakamura                       <authornari@gmail.com> <nari@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# naruse
+NARUSE, Yui                             <naruse@airemix.jp>
+NARUSE, Yui                             <naruse@airemix.jp> <naruse@ruby-lang.org>
+NARUSE, Yui                             <naruse@airemix.jp> <naruse@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ngoto
+Naohisa Goto                            <ngotogenome@gmail.com>
+Naohisa Goto                            <ngotogenome@gmail.com> <ngoto@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nobu
+Nobuyoshi Nakada                        <nobu@ruby-lang.org>
+Nobuyoshi Nakada                        <nobu@ruby-lang.org> <nobu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# normal
+Eric Wong                               <normal@ruby-lang.org>
+Eric Wong                               <normal@ruby-lang.org> <e@80x24.org>
+Eric Wong                               <normal@ruby-lang.org> <normal@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ntalbott
+Nathaniel Talbott                       <ntalbott@ruby-lang.org>
+Nathaniel Talbott                       <ntalbott@ruby-lang.org> <ntalbott@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ocean
+Hirokazu Yamamoto                       <ocean@m2.ccsnet.ne.jp>
+Hirokazu Yamamoto                       <ocean@m2.ccsnet.ne.jp> <ocean@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# odaira
+Rei Odaira                              <rodaira@us.ibm.com>
+Rei Odaira                              <rodaira@us.ibm.com> <Rei.Odaira@gmail.com>
+Rei Odaira                              <rodaira@us.ibm.com> <odaira@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# okkez
+okkez                                   <okkez000@gmail.com>
+okkez                                   <okkez000@gmail.com> <okkez@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# rhe
+Kazuki Yamaguchi                        <k@rhe.jp>
+Kazuki Yamaguchi                        <k@rhe.jp> <rhe@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ryan
+Ryan Davis                              <ryand-github@zenspider.com>
+Ryan Davis                              <ryand-github@zenspider.com> <ryand-ruby@zenspider.com>
+Ryan Davis                              <ryand-github@zenspider.com> <ryan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# samuel
+Samuel Williams                         <samuel.williams@oriontransfer.co.nz>
+Samuel Williams                         <samuel.williams@oriontransfer.co.nz> <samuel@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# seki
+Masatoshi SEKI                          <m_seki@mva.biglobe.ne.jp>
+Masatoshi SEKI                          <m_seki@mva.biglobe.ne.jp> <seki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ser
+Sean Russell                            <ser@germane-software.com>
+Sean Russell                            <ser@germane-software.com> <ser@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shigek
+Shigeo Kobayashi                        <shigek@ruby-lang.org>
+Shigeo Kobayashi                        <shigek@ruby-lang.org> <shigek@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shirosaki
+Hiroshi Shirosaki                       <h.shirosaki@gmail.com>
+Hiroshi Shirosaki                       <h.shirosaki@gmail.com> <shirosaki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# sho-h
+Sho Hashimoto                           <sho-h@ruby-lang.org>
+Sho Hashimoto                           <sho-h@ruby-lang.org> <sho-h@netlab.jp>
+Sho Hashimoto                           <sho-h@ruby-lang.org> <sho.hsmt@gmail.com>
+Sho Hashimoto                           <sho-h@ruby-lang.org> <sho-h@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shugo
+Shugo Maeda                             <shugo@ruby-lang.org>
+Shugo Maeda                             <shugo@ruby-lang.org> <shugo@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shyouhei
+卜部昌平                                    <shyouhei@ruby-lang.org>
+卜部昌平                                    <shyouhei@ruby-lang.org> <shyouhei@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# siena
+Siena.                                  <siena@faculty.chiba-u.jp>
+Siena.                                  <siena@faculty.chiba-u.jp> <siena@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# sonots
+sonots                                  <sonots@gmail.com>
+sonots                                  <sonots@gmail.com> <sonots@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# sorah
+Sorah Fukumori                          <her@sorah.jp>
+Sorah Fukumori                          <her@sorah.jp> <sorah@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# stomar
+Marcus Stollsteimer                     <sto.mar@web.de>
+Marcus Stollsteimer                     <sto.mar@web.de> <stomar@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# suke
+Masaki Suketa                           <masaki.suketa@nifty.ne.jp>
+Masaki Suketa                           <masaki.suketa@nifty.ne.jp> <suke@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tadd
+Tadashi Saito                           <tad.a.digger@gmail.com>
+Tadashi Saito                           <tad.a.digger@gmail.com> <tadd@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tadf
+Tadayoshi Funaba                        <tadf@dotrb.org>
+Tadayoshi Funaba                        <tadf@dotrb.org> <tadf@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# takano32
+TAKANO Mitsuhiro                        <takano32@gmail.com>
+TAKANO Mitsuhiro                        <takano32@gmail.com> <takano32@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tarui
+Masaya Tarui                            <tarui@ruby-lang.org>
+Masaya Tarui                            <tarui@ruby-lang.org> <tarui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# technorama
+Technorama Ltd.                         <oss-ruby@technorama.net>
+Technorama Ltd.                         <oss-ruby@technorama.net> <technorama@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tenderlove
+Aaron Patterson                         <tenderlove@ruby-lang.org>
+Aaron Patterson                         <tenderlove@ruby-lang.org> <tenderlove@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tmm1
+Aman Gupta                              <ruby@tmm1.net>
+Aman Gupta                              <ruby@tmm1.net> <tmm1@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ts
+Guy Decoux                              <ts@moulon.inra.fr>
+Guy Decoux                              <ts@moulon.inra.fr> <ts@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ttate
+Takaaki Tateishi                        <ttate@ttsky.net>
+## Takaaki Tateishi                     <ttate@ttsky.net> <ttate@kt.jaist.ac.jp>
+Takaaki Tateishi                        <ttate@ttsky.net> <ttate@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# uema2
+Takaaki Uematsu                         <uema2x@jcom.home.ne.jp>
+Takaaki Uematsu                         <uema2x@jcom.home.ne.jp> <uema2@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# usa
+U.Nakamura                              <usa@ruby-lang.org>
+U.Nakamura                              <usa@ruby-lang.org> <usa@garbagecollect.jp>
+U.Nakamura                              <usa@ruby-lang.org> <usa@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# wakou
+Wakou Aoyama                            <wakou@ruby-lang.org>
+Wakou Aoyama                            <wakou@ruby-lang.org> <wakou@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# wanabe
+wanabe                                  <s.wanabe@gmail.com>
+wanabe                                  <s.wanabe@gmail.com> <wanabe@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# watson1978
+Watson                                  <watson1978@gmail.com>
+Watson                                  <watson1978@gmail.com> <watson1978@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# wew
+William Webber                          <william@williamwebber.com>
+William Webber                          <william@williamwebber.com> <wew@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# why
+why the lucky stiff                     <why@ruby-lang.org>
+why the lucky stiff                     <why@ruby-lang.org> <why@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# xibbar
+Takeyuki FUJIOKA                        <xibbar@ruby-lang.org>
+Takeyuki FUJIOKA                        <xibbar@ruby-lang.org> <xibbar@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# yugui
+Yuki Yugui Sonoda                       <yugui@yugui.jp>
+Yuki Yugui Sonoda                       <yugui@yugui.jp> <yugui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# yui-knk
+yui-knk                                 <spiketeika@gmail.com>
+yui-knk                                 <spiketeika@gmail.com> <yui-knk@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# yuki
+Yuki Nishijima                          <yuki24@hey.com>
+Yuki Nishijima                          <yuki24@hey.com> <mail@yukinishijima.net>
+Yuki Nishijima                          <yuki24@hey.com> <yuki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# zsombor
+Dee Zsombor                             <zsombor@ruby-lang.org>
+Dee Zsombor                             <zsombor@ruby-lang.org> <zsombor@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# zzak
+zzak                                    <zzakscott@gmail.com>
+zzak                                    <zzakscott@gmail.com> <zzak@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
diff --git a/.rdoc_options b/.rdoc_options
new file mode 100644
index 0000000000..89265cafd4
--- /dev/null
+++ b/.rdoc_options
@@ -0,0 +1,39 @@
+---
+page_dir: doc
+charset: UTF-8
+encoding: UTF-8
+main_page: index.md
+title: Documentation for Ruby development version
+visibility: :private
+rdoc_include:
+- doc
+
+exclude:
+- \.gemspec\z
+- lib/set/subclass_compatible.rb
+
+autolink_excluded_words:
+- Box
+- Class
+- Method
+- Module
+- Process
+- RDoc
+- Ruby
+- Set
+- ZJIT
+- YJIT
+
+canonical_root: https://docs.ruby-lang.org/en/master
+
+footer_content:
+  Ruby:
+    Documentation: index.html
+    Official Website: https://www.ruby-lang.org/
+    Playground: https://ruby.github.io/play-ruby/
+  Resources:
+    GitHub: https://github.com/ruby/ruby
+    Issue Tracker: https://bugs.ruby-lang.org/projects/ruby-master/issues
+    RubyGems: https://rubygems.org/
+  Community:
+    X: https://x.com/rubylangorg
diff --git a/.rspec_parallel b/.rspec_parallel
new file mode 100644
index 0000000000..aaff198a32
--- /dev/null
+++ b/.rspec_parallel
@@ -0,0 +1,2 @@
+--format progress
+--format ParallelTests::RSpec::RuntimeLogger --out tmp/parallel_runtime_rspec.log
diff --git a/.travis.yml b/.travis.yml
deleted file mode 100644
index 992f40fa10..0000000000
--- a/.travis.yml
+++ /dev/null
@@ -1,111 +0,0 @@
-# Copyright (C) 2011 Urabe, Shyouhei.  All rights reserved.
-#
-# This file is  a part of the programming language  Ruby.  Permission is hereby
-# granted,  to either  redistribute  or  modify this  file,  provided that  the
-# conditions  mentioned in  the file  COPYING are  met.  Consult  the  file for
-# details.
-
-# This is  a Travis-CI  build configuration file.   The list  of configurations
-# available is located in
-#
-#     http://about.travis-ci.org/docs/user/build-configuration/
-#
-# and as Ruby itself is a project written in C language,
-#
-#     http://about.travis-ci.org/docs/user/languages/c/
-#
-# is also a good place to look at.
-
-# Language specification.
-language: c
-
-# Compilers.  Several  compilers are  provided in Travis,  so we try  them all.
-# The value set here is visible via $CC environment variable.
-compiler:
-  - gcc
-  - clang
-
-os:
-  - linux
-  - osx
-
-# Dependencies.  Some  header files are missing  in a Travis' worker  VM, so we
-# have  to install  them.  The  "1.9.1" here  is OK.   It is  the  most adopted
-# version string  for Debian/Ubuntu, and  no dependencies have been  changed so
-# far since the 1.9.1 release.
-before_install:
-  - "CONFIG_FLAG="
-  - "if [[ $TRAVIS_OS_NAME = 'linux' ]]; then sudo apt-get -qq update; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'linux' ]]; then sudo apt-get -qq install $CC; fi" # upgrade if any
-  - "if [[ $TRAVIS_OS_NAME = 'linux' ]]; then JOBS='-j'; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then brew install autoconf gdbm openssl; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then CONFIG_FLAG=\"$CONFIG_FLAG --with-gdbm-dir=`brew --prefix gdbm`\"; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then CONFIG_FLAG=\"$CONFIG_FLAG --with-openssl-dir=`brew --prefix openssl`\"; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' && $CC = 'gcc' ]]; then CC='gcc-4.9'; fi"
-install: "if [[ $TRAVIS_OS_NAME = 'linux' ]]; then sudo apt-get -qq build-dep ruby1.9.1 2>/dev/null; fi"
-
-# Script is where the test runs.  Note  we just do "make test", not other tests
-# like  test-all, test-rubyspec.   This is  because  they take  too much  time,
-# enough for Travis to shut down the VM as being stalled.
-before_script:
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then rm -f ~/Library/Logs/DiagnosticReports/ruby_*.crash; fi"
-  - "uname -a"
-  - "uname -r"
-  - "rm -fr .ext autom4te.cache"
-  - "make -f common.mk BASERUBY=ruby MAKEDIRS='mkdir -p' srcdir=. update-config_files"
-  - "autoconf"
-  - "mkdir config_1st config_2nd"
-  - "./configure -C --disable-install-doc --with-gcc=$CC $CONFIG_FLAG"
-  - "cp -pr config.status .ext/include config_1st"
-  - "make reconfig"
-  - "cp -pr config.status .ext/include config_2nd"
-  - "diff -ru config_1st config_2nd"
-  - "make -s $JOBS encs"
-  - "make -s $JOBS exts"
-  - "make update-rubyspec"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then echo 'exclude :test_deadlock_by_signal_at_forking, \"under investigation\"' >> test/excludes/TestProcess.rb; fi"
-script:
-  - "make test"
-  - "make test-all TESTOPTS='-q -j2'"
-  - "make test-rubyspec"
-after_failure:
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then find ~/Library/Logs/DiagnosticReports -type f -name ruby_\\*.crash -ls -execdir cat {} \\; -delete; fi"
-
-# Branch matrix.  Not all branches are Travis-ready so we limit branches here.
-branches:
-  only:
-    - trunk
-    - ruby_2_0_0
-    - ruby_2_1
-    - ruby_2_2
-
-# We want to be notified when something happens.
-notifications:
-  irc:
-    channels:
-      - "irc.freenode.org#ruby-core"
-      - "irc.freenode.org#ruby-ja"
-    on_success: change # [always|never|change] # default: always
-    on_failure: change # [always|never|change] # default: always
-    template:
-      - "%{message} by @%{author}: See %{build_url}"
-
-  # Update ruby-head installed on Travis CI so other projects can test against it.
-  webhooks:
-    urls:
-      - "https://rubies.travis-ci.org/rebuild/ruby-head"
-    on_success: always
-    on_failure: never
-
-  email:
-    - ko1c-failure@atdot.net
-    - shibata.hiroshi@gmail.com
-
-# Local Variables:
-# mode: YAML
-# coding: utf-8-unix
-# indent-tabs-mode: nil
-# tab-width: 4
-# fill-column: 79
-# default-justification: full
-# End:
diff --git a/BSDL b/BSDL
index a009caefea..66d93598aa 100644
--- a/BSDL
+++ b/BSDL
@@ -4,10 +4,10 @@ Redistribution and use in source and binary forms, with or without
 modification, are permitted provided that the following conditions
 are met:
 1. Redistributions of source code must retain the above copyright
-notice, this list of conditions and the following disclaimer.
+   notice, this list of conditions and the following disclaimer.
 2. Redistributions in binary form must reproduce the above copyright
-notice, this list of conditions and the following disclaimer in the
-documentation and/or other materials provided with the distribution.
+   notice, this list of conditions and the following disclaimer in the
+   documentation and/or other materials provided with the distribution.
 
 THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
 ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
index ffdf2dd4b8..35e79dd3b9 100644
--- a/CONTRIBUTING.md
+++ b/CONTRIBUTING.md
@@ -1,4 +1 @@
-Please see the [official issue tracker] and wiki [HowToContribute].
-
-[official issue tracker]: https://bugs.ruby-lang.org
-[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing/contributing_md.html), which includes setup and build instructions.
diff --git a/COPYING b/COPYING
index a1f19ff99d..428ce03ed7 100644
--- a/COPYING
+++ b/COPYING
@@ -1,56 +1,58 @@
+{日本語}[rdoc-ref:COPYING.ja]
+
 Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
 You can redistribute it and/or modify it under either the terms of the
 2-clause BSDL (see the file BSDL), or the conditions below:
 
-  1. You may make and give away verbatim copies of the source form of the
-     software without restriction, provided that you duplicate all of the
-     original copyright notices and associated disclaimers.
+1. You may make and give away verbatim copies of the source form of the
+   software without restriction, provided that you duplicate all of the
+   original copyright notices and associated disclaimers.
 
-  2. You may modify your copy of the software in any way, provided that
-     you do at least ONE of the following:
+2. You may modify your copy of the software in any way, provided that
+   you do at least ONE of the following:
 
-       a) place your modifications in the Public Domain or otherwise
-          make them Freely Available, such as by posting said
-	  modifications to Usenet or an equivalent medium, or by allowing
-	  the author to include your modifications in the software.
+   a. place your modifications in the Public Domain or otherwise
+      make them Freely Available, such as by posting said
+      modifications to Usenet or an equivalent medium, or by allowing
+      the author to include your modifications in the software.
 
-       b) use the modified software only within your corporation or
-          organization.
+   b. use the modified software only within your corporation or
+      organization.
 
-       c) give non-standard binaries non-standard names, with
-          instructions on where to get the original software distribution.
+   c. give non-standard binaries non-standard names, with
+      instructions on where to get the original software distribution.
 
-       d) make other distribution arrangements with the author.
+   d. make other distribution arrangements with the author.
 
-  3. You may distribute the software in object code or binary form,
-     provided that you do at least ONE of the following:
+3. You may distribute the software in object code or binary form,
+   provided that you do at least ONE of the following:
 
-       a) distribute the binaries and library files of the software,
-	  together with instructions (in the manual page or equivalent)
-	  on where to get the original distribution.
+   a. distribute the binaries and library files of the software,
+      together with instructions (in the manual page or equivalent)
+      on where to get the original distribution.
 
-       b) accompany the distribution with the machine-readable source of
-	  the software.
+   b. accompany the distribution with the machine-readable source of
+      the software.
 
-       c) give non-standard binaries non-standard names, with
-          instructions on where to get the original software distribution.
+   c. give non-standard binaries non-standard names, with
+      instructions on where to get the original software distribution.
 
-       d) make other distribution arrangements with the author.
+   d. make other distribution arrangements with the author.
 
-  4. You may modify and include the part of the software into any other
-     software (possibly commercial).  But some files in the distribution
-     are not written by the author, so that they are not under these terms.
+4. You may modify and include the part of the software into any other
+   software (possibly commercial).  But some files in the distribution
+   are not written by the author, so that they are not under these terms.
 
-     For the list of those files and their copying conditions, see the
-     file LEGAL.
+   For the list of those files and their copying conditions, see the
+   file LEGAL.
 
-  5. The scripts and library files supplied as input to or produced as 
-     output from the software do not automatically fall under the
-     copyright of the software, but belong to whomever generated them, 
-     and may be sold commercially, and may be aggregated with this
-     software.
+5. The scripts and library files supplied as input to or produced as
+   output from the software do not automatically fall under the
+   copyright of the software, but belong to whomever generated them,
+   and may be sold commercially, and may be aggregated with this
+   software.
 
-  6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
-     IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
-     WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-     PURPOSE.
+6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+   IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+   WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+   PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
index e50d01c8d1..5de2dbcc8f 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -1,51 +1,53 @@
+{English}[rdoc-ref:COPYING]
+
 本プログラムはフリーソフトウェアです．2-clause BSDL
 または以下に示す条件で本プログラムを再配布できます
 2-clause BSDLについてはBSDLファイルを参照して下さい．
 
-  1. 複製は制限なく自由です．
+1. 複製は制限なく自由です．
 
-  2. 以下の条件のいずれかを満たす時に本プログラムのソースを
-     自由に変更できます．
+2. 以下の条件のいずれかを満たす時に本プログラムのソースを
+   自由に変更できます．
 
-     (a) ネットニューズにポストしたり，作者に変更を送付する
-         などの方法で，変更を公開する．
+   a.  ネットニューズにポストしたり，作者に変更を送付する
+       などの方法で，変更を公開する．
 
-     (b) 変更した本プログラムを自分の所属する組織内部だけで
-         使う．
+   b.  変更した本プログラムを自分の所属する組織内部だけで
+       使う．
 
-     (c) 変更点を明示したうえ，ソフトウェアの名前を変更する．
-         そのソフトウェアを配布する時には変更前の本プログラ
-         ムも同時に配布する．または変更前の本プログラムのソー
-         スの入手法を明示する．
+   c.  変更点を明示したうえ，ソフトウェアの名前を変更する．
+       そのソフトウェアを配布する時には変更前の本プログラ
+       ムも同時に配布する．または変更前の本プログラムのソー
+       スの入手法を明示する．
 
-     (d) その他の変更条件を作者と合意する．
+   d.  その他の変更条件を作者と合意する．
 
-  3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
-     ルしたオブジェクトコードや実行形式でも配布できます．
+3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
+   ルしたオブジェクトコードや実行形式でも配布できます．
 
-     (a) バイナリを受け取った人がソースを入手できるように，
-         ソースの入手法を明示する．
+   a.  バイナリを受け取った人がソースを入手できるように，
+       ソースの入手法を明示する．
 
-     (b) 機械可読なソースコードを添付する．
+   b.  機械可読なソースコードを添付する．
 
-     (c) 変更を行ったバイナリは名前を変更したうえ，オリジナ
-         ルのソースコードの入手法を明示する．
+   c.  変更を行ったバイナリは名前を変更したうえ，オリジナ
+       ルのソースコードの入手法を明示する．
 
-     (d) その他の配布条件を作者と合意する．
+   d.  その他の配布条件を作者と合意する．
 
-  4. 他のプログラムへの引用はいかなる目的であれ自由です．た
-     だし，本プログラムに含まれる他の作者によるコードは，そ
-     れぞれの作者の意向による制限が加えられる場合があります．
+4. 他のプログラムへの引用はいかなる目的であれ自由です．た
+   だし，本プログラムに含まれる他の作者によるコードは，そ
+   れぞれの作者の意向による制限が加えられる場合があります．
 
-     それらファイルの一覧とそれぞれの配布条件などに付いては
-     LEGALファイルを参照してください．
+   それらファイルの一覧とそれぞれの配布条件などに付いては
+   LEGALファイルを参照してください．
 
-  5. 本プログラムへの入力となるスクリプトおよび，本プログラ
-     ムからの出力の権利は本プログラムの作者ではなく，それぞ
-     れの入出力を生成した人に属します．また，本プログラムに
-     組み込まれるための拡張ライブラリについても同様です．
+5. 本プログラムへの入力となるスクリプトおよび，本プログラ
+   ムからの出力の権利は本プログラムの作者ではなく，それぞ
+   れの入出力を生成した人に属します．また，本プログラムに
+   組み込まれるための拡張ライブラリについても同様です．
 
-  6. 本プログラムは無保証です．作者は本プログラムをサポート
-     する意志はありますが，プログラム自身のバグあるいは本プ
-     ログラムの実行などから発生するいかなる損害に対しても責
-     任を持ちません．
+6. 本プログラムは無保証です．作者は本プログラムをサポート
+   する意志はありますが，プログラム自身のバグあるいは本プ
+   ログラムの実行などから発生するいかなる損害に対しても責
+   任を持ちません．
diff --git a/Cargo.lock b/Cargo.lock
new file mode 100644
index 0000000000..9a4b2ebbba
--- /dev/null
+++ b/Cargo.lock
@@ -0,0 +1,193 @@
+# This file is automatically @generated by Cargo.
+# It is not intended for manual editing.
+version = 3
+
+[[package]]
+name = "capstone"
+version = "0.13.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "015ef5d5ca1743e3f94af9509ba6bd2886523cfee46e48d15c2ef5216fd4ac9a"
+dependencies = [
+ "capstone-sys",
+ "libc",
+]
+
+[[package]]
+name = "capstone-sys"
+version = "0.17.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "2267cb8d16a1e4197863ec4284ffd1aec26fe7e57c58af46b02590a0235809a0"
+dependencies = [
+ "cc",
+ "libc",
+]
+
+[[package]]
+name = "cc"
+version = "1.2.18"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "525046617d8376e3db1deffb079e91cef90a89fc3ca5c185bbf8c9ecdd15cd5c"
+dependencies = [
+ "shlex",
+]
+
+[[package]]
+name = "console"
+version = "0.15.8"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0e1f83fc076bd6dd27517eacdf25fef6c4dfe5f1d7448bafaaf3a26f13b5e4eb"
+dependencies = [
+ "encode_unicode",
+ "lazy_static",
+ "libc",
+ "windows-sys",
+]
+
+[[package]]
+name = "encode_unicode"
+version = "0.3.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "a357d28ed41a50f9c765dbfe56cbc04a64e53e5fc58ba79fbc34c10ef3df831f"
+
+[[package]]
+name = "insta"
+version = "1.43.1"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "154934ea70c58054b556dd430b99a98c2a7ff5309ac9891597e339b5c28f4371"
+dependencies = [
+ "console",
+ "once_cell",
+ "similar",
+]
+
+[[package]]
+name = "jit"
+version = "0.1.0"
+
+[[package]]
+name = "lazy_static"
+version = "1.5.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "bbd2bcb4c963f2ddae06a2efc7e9f3591312473c50c6685e1f298068316e66fe"
+
+[[package]]
+name = "libc"
+version = "0.2.171"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "c19937216e9d3aa9956d9bb8dfc0b0c8beb6058fc4f7a4dc4d850edf86a237d6"
+
+[[package]]
+name = "once_cell"
+version = "1.21.3"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "42f5e15c9953c5e4ccceeb2e7382a716482c34515315f7b03532b8b4e8393d2d"
+
+[[package]]
+name = "ruby"
+version = "0.0.0"
+dependencies = [
+ "yjit",
+ "zjit",
+]
+
+[[package]]
+name = "shlex"
+version = "1.3.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0fda2ff0d084019ba4d7c6f371c95d8fd75ce3524c3cb8fb653a3023f6323e64"
+
+[[package]]
+name = "similar"
+version = "2.4.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "32fea41aca09ee824cc9724996433064c89f7777e60762749a4170a14abbfa21"
+
+[[package]]
+name = "windows-sys"
+version = "0.52.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "282be5f36a8ce781fad8c8ae18fa3f9beff57ec1b52cb3de0789201425d9a33d"
+dependencies = [
+ "windows-targets",
+]
+
+[[package]]
+name = "windows-targets"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9b724f72796e036ab90c1021d4780d4d3d648aca59e491e6b98e725b84e99973"
+dependencies = [
+ "windows_aarch64_gnullvm",
+ "windows_aarch64_msvc",
+ "windows_i686_gnu",
+ "windows_i686_gnullvm",
+ "windows_i686_msvc",
+ "windows_x86_64_gnu",
+ "windows_x86_64_gnullvm",
+ "windows_x86_64_msvc",
+]
+
+[[package]]
+name = "windows_aarch64_gnullvm"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "32a4622180e7a0ec044bb555404c800bc9fd9ec262ec147edd5989ccd0c02cd3"
+
+[[package]]
+name = "windows_aarch64_msvc"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "09ec2a7bb152e2252b53fa7803150007879548bc709c039df7627cabbd05d469"
+
+[[package]]
+name = "windows_i686_gnu"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "8e9b5ad5ab802e97eb8e295ac6720e509ee4c243f69d781394014ebfe8bbfa0b"
+
+[[package]]
+name = "windows_i686_gnullvm"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0eee52d38c090b3caa76c563b86c3a4bd71ef1a819287c19d586d7334ae8ed66"
+
+[[package]]
+name = "windows_i686_msvc"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "240948bc05c5e7c6dabba28bf89d89ffce3e303022809e73deaefe4f6ec56c66"
+
+[[package]]
+name = "windows_x86_64_gnu"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "147a5c80aabfbf0c7d901cb5895d1de30ef2907eb21fbbab29ca94c5b08b1a78"
+
+[[package]]
+name = "windows_x86_64_gnullvm"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "24d5b23dc417412679681396f2b49f3de8c1473deb516bd34410872eff51ed0d"
+
+[[package]]
+name = "windows_x86_64_msvc"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "589f6da84c646204747d1270a2a5661ea66ed1cced2631d546fdfb155959f9ec"
+
+[[package]]
+name = "yjit"
+version = "0.1.0"
+dependencies = [
+ "capstone",
+ "jit",
+]
+
+[[package]]
+name = "zjit"
+version = "0.0.1"
+dependencies = [
+ "capstone",
+ "insta",
+ "jit",
+]
diff --git a/Cargo.toml b/Cargo.toml
new file mode 100644
index 0000000000..521129d92d
--- /dev/null
+++ b/Cargo.toml
@@ -0,0 +1,60 @@
+# This is the root Cargo [workspace](https://doc.rust-lang.org/cargo/reference/workspaces.html)
+# and the root package for all the rust code that are statically linked into ruby. Rust tooling
+# limitations means all Rust code need to share a single archive library (staticlib) at the
+# integration point with non-rust code. (See rustlang/rust#44322 and #104707 for a taste of
+# the linking challenges.)
+#
+# Do not add required dependencies. This is a policy that helps downstream consumers and give
+# us tight control over what we ship. All of the optional dependencies are used exclusively
+# during development.
+#
+# Release builds avoid Cargo entirely because offline builds can fail even when none of the
+# optional dependencies are built (rust-lang/cargo#10352).
+
+[workspace]
+members = ["zjit", "yjit", "jit"]
+
+[package]
+name = "ruby"
+version = "0.0.0"
+edition = "2024"
+rust-version = "1.85.0"
+publish = false # Don't publish to crates.io
+
+[dependencies]
+yjit = { path = "yjit", optional = true }
+zjit = { path = "zjit", optional = true }
+
+[lib]
+crate-type = ["staticlib"]
+path = "ruby.rs"
+
+[features]
+disasm = ["yjit?/disasm", "zjit?/disasm"]
+runtime_checks = ["yjit?/runtime_checks", "zjit?/runtime_checks"]
+yjit = [ "dep:yjit" ]
+zjit = [ "dep:zjit" ]
+
+[profile.dev]
+opt-level = 0
+debug = true
+debug-assertions = true
+overflow-checks = true
+
+[profile.dev_nodebug]
+inherits = "dev"
+
+[profile.stats]
+inherits = "release"
+
+[profile.release]
+# NOTE: --enable-yjit and zjit builds use `rustc` without going through Cargo. You
+# might want to update the `rustc` invocation if you change this profile.
+opt-level = 3
+# The extra robustness that comes from checking for arithmetic overflow is
+# worth the performance cost for the compiler.
+overflow-checks = true
+# Generate debug info
+debug = true
+# Use ThinLTO. Much smaller output for a small amount of build time increase.
+lto = "thin"
diff --git a/ChangeLog b/ChangeLog
deleted file mode 100644
index a279220b1e..0000000000
--- a/ChangeLog
+++ /dev/null
@@ -1,3111 +0,0 @@
-Wed Apr 15 07:51:23 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
-
-	* doc/extension.ja.rdoc: Added description of TypedData_XXX.
-	  Deprecated the old DATA_XXX.
-	  Reviewed by ko1 and nobu.
-	  Fixes [ruby-dev:40881] #3064
-
-	* doc/extension.rdoc: ditto.
-
-Wed Apr 15 07:34:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* thread_pthread.c (reserve_stack): keep sp safe zone to get rid
-	  of crash by -fstack-check.  [ruby-core:68740] [Bug #11030]
-
-Tue Apr 14 16:03:49 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/merger.rb (versionup): should also increment revision when
-	  changing teeny.
-
-Tue Apr 14 11:24:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/-test-/printf/printf.c (uint_to_str): renamed to get rid of
-	  conflict on cygwin.  [ruby-core:68877] [Bug #11065]
-
-Tue Apr 14 08:59:04 2015  Zachary Scott  <e@zzak.io>
-
-        * gc.c: [DOC] Improve documentation for ObjectSpace.count_objects
-          with regards to `:TOTAL` key, with patch by @schneems [Fixes GH-871]
-          https://github.com/ruby/ruby/pull/871 [Bug #11067]
-
-Mon Apr 13 22:44:07 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/lib/envutil.rb (File.mkfifo): Defined using mkfifo command.
-
-	* test/ruby/test_io.rb: Use File.mkfifo.
-
-	* test/ruby/test_file_exhaustive.rb: Ditto.
-
-	* test/ruby/test_process.rb: Ditto.
-
-Mon Apr 13 21:20:20 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb: stricter hostname verification
-	  following RFC 6125. with the patch provided by Tony Arcieri and
-	  Hiroshi Nakamura [ruby-core:61545] [Bug #9644]
-	* test/openssl/test_ssl.rb: add tests for above.
-
-Sun Apr 12 18:40:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json/json.gemspec: bump version to 1.8.2.
-	* ext/json/lib/json/version.rb: ditto.
-
-Sun Apr 12 18:12:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json/json.gemspec, lib/rdoc/rdoc.gemspec: added gemspec directly.
-	* defs/default_gems, tool/rbinstall.rb: removed default_gems definition.
-	  it make simple installation for default gems.
-
-Sun Apr 12 17:35:17 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json/*, test/json/*: Reverted r50231.  Because it's not
-	  working with cross-compile environment.
-
-Sun Apr 12 15:34:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (arg): fix segfault by null caused by syntax error.
-	  [ruby-core:68851] [Bug #10957]
-
-Sun Apr 12 15:11:16 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems/test_case.rb: use explicitly exception class and reverted
-	  to require JSON library for rubygems tests with Ruby 2.2.0 or earlier.
-
-Sun Apr 12 15:10:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/io/wait/wait.c (io_wait_readable): simply returns that IO is
-	  readable without blocking, but no longer returns EOF.
-
-	* ext/io/wait/wait.c (io_ready_p, io_wait_readable): try polling
-	  first and check FIONREAD optionally to see if EOF.
-	  [ruby-core:36805] [Feature #4849]
-
-Sun Apr 12 14:53:23 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems/test_case.rb: fixed json load error for rubygems tests.
-
-Sun Apr 12 14:13:28 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* gc.c: Document require name for ObjectSpace methods.
-	  [ci skip][fix GH-860] Patch by @schneems
-
-Sun Apr 12 13:54:05 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_io.rb: New test that open(fifo) doesn't block other
-	  threads.
-
-Sun Apr 12 13:52:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/coverage/coverage.c: Remove extension from require argument.
-	  [ci skip][fix GH-870] Patch by @yui-knk
-
-Sun Apr 12 10:29:14 2015  Eric Wong  <e@80x24.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_connect_nonblock):
-	  support `exception: false'
-	* (get_no_exception): move function location
-	* ext/socket/socket.c (sock_connect_nonblock):
-	  support `exception: false'
-	* test/openssl/test_pair.rb (test_connect_accept_nonblock_no_exception):
-	  test `exception: false' on connect,
-	  rename from `test_accept_nonblock_no_exception'
-	* test/socket/test_nonblock.rb (test_connect_nonblock_no_exception):
-	  new test
-
-Sun Apr 12 09:57:16 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test a block device on GNU/Linux.
-
-Sun Apr 12 09:24:03 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test a file not owned.
-
-Sun Apr 12 09:05:44 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/fiddle/depend: Fix "Wrong mix of special targets" error with
-	  OpenBSD make.
-
-Sun Apr 12 09:04:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_file_exhaustive.rb: Windows doesn't support Unix file
-	  modes.
-
-Sun Apr 12 08:56:44 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/-test-/file/fs.c: OpenBSD needs sys/param.h before sys/mount.h.
-
-Sun Apr 12 08:52:01 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test suid, sgid and sticky file.
-
-Sat Apr 11 23:48:30 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* template/fake.rb.in: Don't assign baseruby, Because it's affect to
-	  Makefile of native gem like json on bundled gems.
-
-Sat Apr 11 23:33:22 2015  Tanaka Akira  <akr@fsij.org>
-
-	* file.c (rb_f_test): Consider nsec for "=", "<" and ">" for "test"
-	  method.
-
-Sat Apr 11 23:26:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/rbinstall.rb: support destdir for native extention gem.
-
-Sat Apr 11 21:02:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_file_exhaustive.rb
-	  (TestFileExhaustive#test_stat_socket_p): r50226 accidentally missed
-	  the guard for non-unix environments.
-
-Sat Apr 11 20:14:21 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json/*, test/json/*, defs/default_gems: Gemify JSON library.
-	  [fix GH-867][Feature #11057]
-	* test/ruby/test_extlibs.rb: removed json gem from existence extentions.
-	* gems/bundled_gems: added json gem into bundled gem.
-	* lib/rdoc/rubygems_hook.rb: ignored no json environment.
-	* lib/rubygems/test_case.rb, test/rubygems/*: ditto.
-	* lib/rdoc/test_case.rb, test/rdoc/*: ditto.
-
-Sat Apr 11 15:56:58 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Create sample files lazily.
-
-Sat Apr 11 14:03:47 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test character device using
-	  /dev/null.
-
-Sat Apr 11 10:59:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (append_cppflags, append_cflags, append_ldflags):
-	  utility methods to append compiler options.
-
-Sat Apr 11 08:22:24 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rdoc/text.rb: removed duplicated code.
-
-Sat Apr 11 04:46:42 2015  Eric Wong  <e@80x24.org>
-
-	* lib/net/protocol.rb (rbuf_fill): avoid exception with read_nonblock
-	  [ruby-core:68787] [Feature #11044]
-
-Fri Apr 10 23:57:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (need_normalization): use getattrlist() if fgetattrlist()
-	  is unavailable, on OSX 10.5.  [ruby-core:68829] [Bug #11054]
-
-Fri Apr 10 22:29:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (try_compile): pass the given werror flag to try_do
-	  to check if stderr is empty.
-
-	* lib/mkmf.rb (try_cflags, try_ldflags): default werror to true.
-
-	* win32/Makefile.sub (WERRORFLAG): remove useless option.  VC does
-	  not make warnings of unknown command option an error.
-
-Fri Apr 10 19:34:24 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test socket.
-
-Fri Apr 10 19:38:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/objspace/test_objspace.rb: remove debug prints.
-
-Fri Apr 10 19:35:51 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* ext/objspace/objspace.c: add ObjectSpace.count_imemo_objects method
-	  to count imemo objects for each type.
-
-	* test/objspace/test_objspace.rb: add a test.
-
-	* NEWS: describe about this addition.
-
-Fri Apr 10 19:34:24 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test anonymous pipe.
-
-Fri Apr 10 19:31:56 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test named pipe.
-
-Fri Apr 10 19:10:34 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* ext/objspace/objspace.c (setup_hash): unify common routine.
-
-Fri Apr 10 18:29:49 2015  Tanaka Akira  <akr@fsij.org>
-
-	* process.c (rb_execarg_parent_start1): Handle EINTR.
-
-Fri Apr 10 17:27:58 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c (vm_exec): check other events when RETURN is thrown.
-	  [Bug #10724]
-
-	* test/ruby/test_settracefunc.rb: add a test.
-
-Fri Apr 10 11:44:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/date/extconf.rb: check warnings.
-
-	* lib/mkmf.rb (try_cflags): pass options to try_compile.
-
-	* win32/Makefile.sub (WERRORFLAG): make unknown command line
-	  options an error.
-
-Fri Apr 10 08:00:17 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_process.rb: unfortunately, windows is not POSIX...
-	  cygwin has mkfifo command, but it does not affect system-wide.
-
-Fri Apr 10 02:18:53 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_process.rb: Use mkfifo command instead of mknod
-	  command to create a named pipe.  mkfifo command is defined by POSIX.
-
-Fri Apr 10 01:29:05 2015  Tanaka Akira  <akr@fsij.org>
-
-	* process.c: Release GVL when opening a file in spawn() to avoid whole
-	  process blocking when opening a named pipe.
-	  (open_func): New function.
-	  (rb_execarg_parent_start1): Extracted from rb_execarg_parent_start and
-	  use rb_thread_call_without_gvl2 to release GVL when opening a file.
-	  (rb_execarg_parent_start): Invoke rb_execarg_parent_start1 via
-	  rb_protect and invoke rb_execarg_parent_end when error.
-
-Thu Apr  9 22:19:19 2015  Tanaka Akira  <akr@fsij.org>
-
-	* process.c (redirect_open): Removed.
-
-Thu Apr  9 21:38:20 2015  Tanaka Akira  <akr@fsij.org>
-
-	* internal.h (rb_execarg_parent_end): Declared.
-
-	* process.c: "spawn" opens files in the parent process.
-	  (check_exec_redirect): Add an placeholder for fd in parameters
-	  for fd_open.
-	  (check_exec_fds_1): Delete fd_open condition.
-	  (check_exec_fds): Don't call check_exec_fds_1 with fd_open.
-	  (rb_execarg_parent_start): Open files specified as "spawn" options
-	  and add "dup2" options.
-	  (rb_execarg_parent_end): New function to close opened fds.
-	  (run_exec_open): Removed.
-	  (rb_execarg_run_options): Don't call run_exec_open.
-	  (rb_spawn_internal): Call rb_execarg_parent_end.
-
-	* io.c (pipe_open): Call rb_execarg_parent_end.
-
-	* ext/pty/pty.c (establishShell): Call rb_execarg_parent_end.
-
-Thu Apr  9 20:52:31 2015  Tanaka Akira  <akr@fsij.org>
-
-	* internal.h (rb_execarg_parent_start): Renamed from rb_execarg_fixup.
-
-	* process.c: Follows the above change.
-
-	* io.c: Ditto.
-
-	* ext/pty/pty.c: Ditto.
-
-Thu Apr  9 20:35:12 2015  Tanaka Akira  <akr@fsij.org>
-
-	* process.c (fd_clear_cloexec): Extracted from run_exec_dup2.
-
-Thu Apr  9 09:26:47 2015  Eric Wong  <e@80x24.org>
-
-	* ccan/list/list.h: sync with ccan upstream
-	  [ccan commit c2fbfe5282ba264f3485586e7efa8a5967f2d386]
-
-Thu Apr  9 08:24:03 2015  Masahiro Tomita  <tommy@tmtm.org>
-
-	* ext/socket/raddrinfo.c (addrinfo_mload): fix memory leak of
-	  addrinfo.  [ruby-dev:48923] [Bug #11051]
-
-Wed Apr  8 17:45:02 2015  Shannon Skipper  <shannonskipper@gmail.com>
-
-	* version.c (Init_version): the version of the engine or
-	  interpreter.  [Fix GH-858]
-
-Wed Apr  8 16:15:30 2015  Kenta Murata  <mrkn@cookpad.com>
-
-	* bigdecimal: conform to ruby's license.  [ruby-core:68466] [Bug #10952]
-
-Wed Apr  8 14:57:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_wreadlink): should treat junctions like as
-	  symlinks.
-
-Wed Apr  8 14:03:47 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/ruby/test_symbol.rb: fix syntax error.
-
-Wed Apr  8 13:01:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (rb_any_hash): Symbols are compared by the identities
-	  always.  [ruby-core:68767] [Bug #11035]
-
-Tue Apr  7 10:22:51 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* internal.h: fix typo. Patch by @sferik [fix GH-865]
-
-Mon Apr  6 22:52:35 2015  Tanaka Akira  <akr@fsij.org>
-
-	* enum.c: Enumerable#chunk and Enumerable#slice_before no longer takes
-	  the initial_state argument.  [Feature #10958]
-
-Mon Apr  6 16:09:58 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_args.c: protect value stack from calling other methods
-	  during complex parameter setting process (splat, kw, and so on).
-	  [Bug #11027]
-
-	* vm_core.h: remove rb_thead_t::mark_stack_len.
-	  With this modification, we don't need to use th->mark_stack_len.
-
-	* test/ruby/test_keyword.rb: add a test.
-
-	* cont.c (cont_capture): catch up this fix.
-
-	* vm.c (rb_thread_mark): ditto.
-
-Mon Apr  6 11:26:42 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* tool/downloader.rb (http_options): prevent content auto decoding
-	  because this is a downloader.
-
-Sun Apr  5 09:55:18 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* doc/contributing.rdoc: update Maintainers list.
-
-Sun Apr  5 09:11:00 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/rbinstall.rb: fix bin script permission of bundled gems.
-
-Sun Apr  5 08:46:08 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/rbinstall.rb: support --program-suffix option.
-
-Sat Apr  4 21:31:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rake/*: Gemify rake [fix GH-862][Feature #11025]
-	* test/rake/*: ditto.
-	* tool/rbinstall.rb: ditto.
-
-Sat Apr  4 11:30:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_setbyte): check the argument first not to
-	  discard shared string and code range unnecessarily until
-	  actually changing the contents.  pointed out by headius.
-
-Sat Apr  4 08:16:43 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* lib/net/http.rb (edit_path): use path which is absolute ftp url
-	  on using ftp_proxy.
-
-Fri Apr  3 11:43:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (vm_call0_cfunc): update invoker arguments.
-
-	* vm_insnhelper.c (vm_call_cfunc_latter): ditto.
-
-	* vm_insnhelper.c (rb_vm_call_cfunc_push_frame): ditto, and prefix
-	  with rb_.
-
-Thu Apr  2 16:26:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk, tool/mkconfig.rb: check the running ruby version in
-	  rbconfig.rb with the program version, as RUBY_VERSION has never
-	  been affected by --with-ruby-version option.
-	  [ruby-core:68639] [Bug #11002]
-
-	* configure.in (LIBRUBY_DLDFLAGS): compatibility_version must be
-	  valid version numbers, not an arbitrary string.
-
-Wed Apr  1 11:09:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (push_glob): remove indirect links of arguments for
-	  trampoline.
-
-Wed Apr  1 09:59:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/fileutils.rb (FileUtils#mv): show the exact target path in
-	  the error message instead of the destination parent directory
-	  name.  patched by Joao Britto <jabcalves AT gmail.com> at
-	  [ruby-core:68706].  [Bug #11021]
-
-Tue Mar 31 15:25:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/ChangeLog-0.06_to_0.52: added archived Changelog.
-	  [ruby-list:50105]
-	* doc/ChangeLog-0.50_to_0.60: ditto.
-	* doc/ChangeLog-0.60_to_1.1: ditto.
-
-Mon Mar 30 22:02:55 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* README.EXT.ja: add redirect [ruby-core:68631]
-
-Mon Mar 30 14:42:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (fileattr_to_unixmode, winnt_lstat): deal with
-	  symbolic link than directory, and set executable bits.
-
-Mon Mar 30 11:27:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (copy_stream_body): use the arguments without conversion if
-	  having read, readpartial, and write methods, than conversion by
-	  to_path method.  [ruby-core:68676] [Bug #11015]
-
-Sun Mar 29 21:08:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* gc.c (objspace_allrefs_destruct_i): fix a typo.
-	  [Bug #11013]
-
-Sun Mar 29 11:51:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* proc.c (proc_binding): replicate env from method object, and
-	  allocate the local variable area for the iseq local table.
-	  [ruby-core:68673] [Bug #11012]
-
-Sat Mar 28 09:19:41 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/date/extconf.rb: try_cflags("-std=iso9899:1999") [Bug #10906]
-	  ruby itself (including numeric.c) is built with strict compile
-	  options including -std=iso9899:1999, but ext/date is not.
-	  By the way -std=iso9899:1999 is not only a warning option but also
-	  changes behavior like MACRO definitions for example INFINITY.
-	  gcc on Solaris affect this.
-
-Fri Mar 27 16:34:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk: revert using BOOTSTRAPRUBY for enc.mk, as
-	  enc/depend uses CONFIG.  [ruby-core:68647] [Bug #11004]
-
-Thu Mar 26 10:05:13 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* test/test_observer.rb: add tests for Observable module.
-	  [fix GH-859] Patch by @brightbits
-
-Thu Mar 26 06:35:10 2015  Eric Wong  <e@80x24.org>
-
-	* README.EXT: add redirect [ruby-core:68631]
-
-Wed Mar 25 16:46:49 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/socket/extconf.rb: Solaris 11 has struct tcp_info.tcpi_ca_state,
-	  but it is a dummy.
-
-	* ext/socket/option.c: Solaris 11 doesn't have u_intN_t.
-
-	* ext/socket/option.c: Solaris 11 needs inspect_tcpi_msec.
-
-	* ext/socket/raddrinfo.c: Solaris 11 has AF_PACKET but doesn't have
-	  related macros.
-
-Wed Mar 25 17:03:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/-test-/file/fs.c (get_fsname): try magic number only if
-	  f_type is included.  [ruby-dev:48913] [Bug #11000]
-
-Wed Mar 25 11:20:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* benchmark/bm_hash_aref_flo.rb: make more realistic data.
-	  [ruby-core:68632] [[Bug #10999]
-
-Wed Mar 25 10:39:06 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .document: removed needless entries.
-
-Wed Mar 25 08:07:28 2015  Eric Wong  <e@80x24.org>
-
-	* doc/extension.rdoc: fix spelling of filename
-	* doc/extension.ja.rdoc: ditto.
-
-Tue Mar 25 06:55:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* complex.c (k_inexact_p, k_exact_zero_p): use k_exact_zero_p macro
-	  to remove k_inexact_p macro.
-
-	* complex.c (k_exact_one_p): remove unused macro k_exact_one_p.
-
-Tue Mar 24 22:23:33 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/extention.rdoc: move from toplevel document and added extname.
-	* doc/extention.ja.rdoc: ditto.
-
-Tue Mar 24 22:06:58 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/standard_library.rdoc: strip.
-
-Tue Mar 24 22:06:27 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/standard_library.rdoc: move Thread to Extensions.
-
-Tue Mar 24 21:59:10 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/contributing.rdoc: update Maintainers list.
-
-Tue Mar 24 19:10:24 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_writebarrier_generational): fix messages for rb_bug().
-	  Remove `rb_' prefix.
-
-	* gc.c (gc_writebarrier_incremental): ditto.
-
-Tue Mar 24 17:34:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* README.ja.md: should be chunibyo.
-
-Tue Mar 24 17:30:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/-test-/file/fs.c (get_fsname): return filesystem name by
-	  statfs/statvfs.  [ruby-core:68624] [Bug #10998]
-
-Tue Mar 24 16:46:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: now doesn't required spaces just after
-	  `!`.
-
-Mon Mar 23 23:18:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (dir_close): don't raise on double close for consistent to
-	  IO#close.  [Feature #10950]
-
-Mon Mar 23 21:22:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/file.c (rb_readlink): move from file.c for better buffer
-	  allocation and the result encoding.
-
-	* win32/win32.c (wreadlink, rb_w32_ureadlink): implement readlink().
-
-Mon Mar 23 14:40:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (winnt_stat): stat with following symbolic links.
-
-	* win32/win32.c (winnt_lstat): rename old winnt_stat, which does
-	  not follow symbolic links.
-
-Mon Mar 23 01:44:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (r_symreal): register symbol names as strings first so
-	  that r_symlink always returns valid names.
-	  [ruby-core:68587] [Bug #10991]
-
-	* marshal.c (r_ivar, r_object0): now need to intern symbol names.
-
-	* marshal.c (r_object0): compare with symbol names.
-
-Sun Mar 22 22:07:40 2015  Kouhei Sutou  <kou@cozmixng.org>
-
-	* doc/etc.rd.ja: Fix wrong coding for Emacs.
-
-Sun Mar 22 09:53:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/make-snapshot (package): add default CONFIGURE name to
-	  follow r50039.
-
-	* tool/make-snapshot (package): substitute configuration variables
-	  in Makefile.in instead of passing by the command line, and make
-	  temporary Makefile instead of a pipe.
-
-Sun Mar 22 08:09:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk (ext/ripper/ripper.c, ext/rbconfig/sizeof/sizes.c):
-	  strip autogenerated dependencies which have invalid syntax in
-	  other than nmake.
-
-Sat Mar 21 15:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/io/console/console.c (console_set_winsize): use handle for
-	  writing.  GetConsoleScreenBufferInfo seems failing on a handle
-	  for reading.
-
-	* io.c: [DOC] update the example of IO#winsize to use $stdout
-	  instead of $stdin, which does not work on Windows.  a patch by
-	  Jan Lelis <mail AT janlelis.de> at [ruby-core:68574].
-	  [Bug #10986]
-
-Fri Mar 20 18:41:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* proc.c (respond_to_missing_p): check if the receiver responds to
-	  the given method by respond_to_missing?.
-
-	* proc.c (mnew_missing): create Method object for method_missing.
-	  [ruby-core:68564] [Bug #10985]
-
-Fri Mar 20 17:43:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .travis.yml: enabled email notification.
-
-Fri Mar 20 17:39:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .travis.yml: removed Ruby 1.9.3 build on Travis CI
-
-Fri Mar 20 12:38:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): obj_info() can receive internal objects.
-
-	* gc.c (check_rvalue_consistency): obj_info() returns const char *.
-
-Fri Mar 20 12:14:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): show class name and T_DATA type_name.
-
-Thu Mar 19 22:12:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_copy_wb_protected_attribute): `dest' can be WB unprotected.
-
-Thu Mar 19 21:25:25 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_copy_wb_protected_attribute): demote `dest' object.
-
-Thu Mar 19 16:18:00 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c, internal.h: export rb_gc_verify_internal_consistency().
-
-Thu Mar 19 16:15:24 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): show allocation site if GC_DEBUG is not 0.
-
-Thu Mar 19 16:12:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (newobj_of): fix RGENGC_OLD_NEWOBJ_CHECK logics.
-	  * skip on incremental marking because not sure what happen :p
-	  * rb_gc_writebarrier_remember() is enough to mark children.
-
-Thu Mar 19 16:08:42 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_copy_wb_protected_attribute): need demote for old objects.
-
-Thu Mar 19 10:31:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* random.c (fill_random_bytes): release the handle in the static
-	  variable, not a local variable.
-
-Thu Mar 19 06:30:35 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* object.c (rb_obj_clone): do not touch age (FL_PROMOTED[01]) because
-	  rb_obj_alloc() can return old object in debug.
-
-Thu Mar 19 06:29:28 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/objspace/test_objspace.rb: flag name was changed
-	  (long_lived -> uncollectible).
-
-Thu Mar 19 05:30:13 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c (iseq_mark): skip some marking if iseq->orig is available.
-
-	* iseq.c (rb_iseq_clone): need WB for iseq1->klass = iseq0->klass
-	  (done in MEMCPY).
-
-Thu Mar 19 04:55:53 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h (IMEMO_DEBUG): added.
-
-	* internal.h: remove unused FL_IMEMO_MARK_V[0-3].
-
-	* gc.c (rb_imemo_new_debug): added.
-
-	* gc.c (obj_info): show imemo type name.
-
-Thu Mar 19 04:52:26 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (RGENGC_OLD_NEWOBJ_CHECK): add check mechanism.
-
-	  If RGENGC_OLD_NEWOBJ_CHECK > 0, then create old objects
-	  (not new objects) periodically.
-
-	  Create one old objects per RGENGC_OLD_NEWOBJ_CHECK objects are
-	  created.
-
-Thu Mar 19 04:46:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* enum.c (enum_sort_by): add WBs.
-
-Thu Mar 19 03:37:52 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (check_rvalue_consistency): refactoring.
-	  * not inline on RGENGC_CHECK_MODE > 0.
-	  * check SPECIAL_CONST_P(obj) first.
-	  * add a check that remembered_bit is only TRUE when old (age == 3).
-
-	* gc.c (RVALUE_DEMOTE): should clear RVALUE_REMEMBERED bit.
-
-	  remembered_bit should be TRUE only for old (age == 3) objects.
-
-	  Actually there are no effect because demoted objects will be
-	  uncollectible WB unprotected objects (marked at the beginning of
-	  every minor GC).
-
-Thu Mar 19 02:52:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c: rename terminologies.
-	  * long_lived -> uncollectible:
-	    because this bitmap does not mean "long lived objects in past",
-	    but means "prohibit collection these objects until next major GC".
-
-	    Uncollectible objects consist of two types objects, one is old
-	    objects (WB protected objects which age == 3) and another is
-	    uncollectible WB unprotected objects which are referred from old
-	    objects
-
-	  * remembered_wb_unprotected_objects ->
-	    uncollectible_wb_unprotected_objects:
-	    because uncollectible objects does not mean remembered objects.
-
-Wed Mar 18 17:21:12 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_writebarrier_generational): add an alternative write
-	  barrier (WB) implementation.
-	  When finding reference from [Old obj] to [New obj] by WB, current
-	  implementation marks [Old obj] as remembered old objects and marks
-	  children of [Old obj] at the beginning of marking.
-
-	  Added (but disabled) code changes current behaviour. This fix promote
-	  [New obj] to old and marks as a remembered old object. We can assume
-	  "new objects referred from old objects are maybe long-lived old
-	  objects".
-
-	  Disadvantage of added algorithm is we may promote unwilling
-	  short-lived objects. For example, consider many new objects push and
-	  pop to an old stack object. All of new objects (short-lived objects)
-	  promote to old objects unexpectedly.
-
-	  To compare these behaviour, I add this new code (but disabled it).
-
-Wed Mar 18 17:14:39 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (RVALUE_PROMOTE_RAW): rename to RVALUE_OLD_LONG_LIVED_SET()
-	  to make clear.
-
-Wed Mar 18 17:10:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (check_rvalue_consistency): do not need to check is_sweeping().
-
-Wed Mar 18 14:13:22 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* benchmark/bm_vm1_gc_wb_ary.rb: run GC to finish "marking" phase.
-
-	* benchmark/bm_vm1_gc_wb_obj.rb: ditto.
-
-	* benchmark/bm_vm1_gc_wb_ary_promoted.rb: add parameter
-	  full_mark: false to invoke only minor GC.
-
-	* benchmark/bm_vm1_gc_wb_obj_promoted.rb: ditto.
-
-Wed Mar 18 12:07:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* string.c: add a comment about RSTRING_FSTR.
-
-Wed Mar 18 12:01:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (rb_any_hash): use same hash values with Float#hash so
-	  that -0.0 and +0.0 will be identical.
-	  [ruby-core:68541] [Bug #10979]
-
-Wed Mar 18 05:34:32 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* string.c: introduce STR_FAKESTR to show string is FAKESTR or not.
-
-	* string.c (STR_SET_SHARED): ignore FAKESTR because only Ruby objects
-	  can use write barrier.
-
-Tue Mar 17 18:59:16 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* include/ruby/ruby.h: use rb_gc_writebrrier() simply.
-	  For incremental GC, we need to get a pointer to the objspace.
-	  We can share this pointer for the following WB process.
-	  And considering icache hit ratio, process in the GC.
-
-	* gc.c (rb_gc_writebarrier): added.
-
-	* gc.c (gc_writebarrier_generational, gc_writebarrier_incremental):
-	  make them NOINLINE because inlining them into rb_gc_writebarrier()
-	  makes a prologue code of rb_gc_writebarrier() longer (storing callee
-	  save registers).
-
-	  This patch improve the performance of WB on micro-benchmarks.
-
-	  name                   ruby 2.1   trunk   modified
-	  vm1_gc_wb_ary*            0.511   0.632      0.532
-	  vm1_gc_wb_ary_promoted*   0.578   0.701      0.674
-	  vm1_gc_wb_obj*            0.419   0.575      0.492
-	  vm1_gc_wb_obj_promoted*   0.537   0.664      0.618
-	                                                 (sec)
-
-Tue Mar 17 18:51:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* benchmark/bm_vm1_gc_wb_ary(_promoted).rb: separate fastpath and
-	  slowpath for WB.
-
-	  Before this change bm_vm1_gc_wb_ary.rb tried to check the performance
-	  for WB slowpath (making a reference from oldobj to newobj). However,
-	  from Ruby 2.2, 3 GCs are needed to promote new objects because
-	  only 3 age objects are promoted objects.
-
-	  To compare fastpath and slowpath, introduce new "promoted" version
-	  benchmark.
-
-	  bm_vm1_gc_wb_ary.rb is for fastpath and
-	  bm_vm1_gc_wb_ary_promoted.rb is for slowpath.
-
-	* benchmark/bm_vm1_gc_wb_obj(_promoted).rb: ditto.
-
-Tue Mar 17 17:23:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): distinguish not-yet-stated and DT_UNKNOWN
-	  by readdir, and traverse recursively for the former.  Linux
-	  readdir returns DT_UNKNOWN on some filesystems, e.g., smbfs,
-	  iso9660.
-
-Mon Mar 16 17:43:21 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/webrick/server.rb: Fix regression bug in WEBrick's
-	  :DoNotReverseLookup config option implementation.
-	  [fix GH-731] Patch by @vais
-	* test/webrick/test_do_not_reverse_lookup.rb: ditto.
-
-Sat Mar 14 20:05:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c (math_gamma): optimization for passed small integer.
-
-Sat Mar 14 18:07:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* enum.c: [DOC] Fixes Enumerable#member? documentation
-	  [fix GH-756][ci skip] Patch by @shamanime
-
-Sat Mar 14 12:23:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): use d_type to reduce lstat system calls.
-
-	* win32/dir.h (struct direct): add d_type instead of d_isdir and
-	  d_isrep.  SYMLINKD is unreliable, since the target can be
-	  replaced after a link was created.
-
-	* win32/win32.c (readdir_internal): set d_type.
-
-Sat Mar 14 02:14:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (primary): empty parentheses at cmdarg can be null.
-	  [ruby-core:68477] [Bug #10957]
-
-Fri Mar 13 15:04:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_close): don't raise on double
-	  close for consistent to IO#close.
-
-Fri Mar 13 15:03:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_close_read, rb_io_close_write): don't raise after
-	  close same as IO#close.
-
-Fri Mar 13 12:29:07 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/readline/test_readline.rb: Restore environment variables:
-	  COLUMNS LINES
-
-Fri Mar 13 11:37:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/fiddle/extconf.rb: needs --enable-shared when linked to
-	  libruby or fiddle.so.  since --with-static-linked-ext does no
-	  longer link extensions to ruby program with --enable-shared, the
-	  only combination needs --enable-static is --disable-shared and
-	  --with-static-linked-ext.  [ruby-dev:48901] [Bug #10960]
-
-Fri Mar 13 07:02:20 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/init.c (rsock_s_accept_nonblock): use rb_hash_lookup2
-	* ext/openssl/ossl_ssl.c (get_no_exception): new function
-	  (ossl_ssl_accept_nonblock): use get_no_exception
-	  (ossl_ssl_read_internal): ditto
-	  (ossl_ssl_write_nonblock): ditto
-	  [ruby-core:68511]
-
-Fri Mar 13 07:01:38 2015  Eric Wong  <e@80x24.org>
-
-	* ext/openssl/ossl_ssl.c: predefine wait_*able symbols
-
-Thu Mar 12 22:59:53 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/lib/leakchecker.rb: Check environment variables.
-
-Thu Mar 12 05:54:27 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/init.c (rsock_s_accept_nonblock):
-	  support exception: false
-	  [ruby-core:66385] [Feature #10532]
-	* ext/socket/init.c (rsock_init_socket_init): define new symbols
-	* ext/socket/rubysocket.h: adjust prototype
-	* ext/socket/socket.c (sock_accept_nonblock): support exception: false
-	* ext/openssl/ossl_ssl.c (ossl_ssl_accept_nonblock): ditto
-	* ext/socket/socket.c (Init_socket): adjust accept_nonblock definition
-	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
-	* ext/socket/tcpserver.c (rsock_init_tcpserver): ditto
-	* ext/socket/unixserver.c (rsock_init_unixserver): ditto
-	* ext/socket/tcpserver.c (tcp_accept_nonblock): adjust
-	  rsock_s_accept_nonblock call
-	* ext/socket/unixserver.c (unix_accept_nonblock): ditto
-	* ext/openssl/ossl_ssl.c (ossl_start_ssl): support no_exception
-	* ext/openssl/ossl_ssl.c (ossl_ssl_connect): adjust ossl_start_ssl call
-	* ext/openssl/ossl_ssl.c (ossl_ssl_connect_nonblock): ditto
-	* ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto
-	* test/socket/test_nonblock.rb (test_accept_nonblock): test for
-	  "exception :false"
-	* test/socket/test_tcp.rb (test_accept_nonblock): new test
-	* test/socket/test_unix.rb (test_accept_nonblock): ditto
-	* test/openssl/test_pair.rb (test_accept_nonblock_no_exception): ditto
-
-Thu Mar 12 10:53:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h, node.h: move a definition of `struct rb_global_entry'
-	  and related functions from node.h to internal.h.
-
-	* variable.c: remove unused include pragma.
-
-	* common.mk: remove unused dependency.
-
-Thu Mar 12 10:32:39 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* common.mk: remove unused dependency.
-
-Thu Mar 12 08:20:14 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* load.c: removed unused header file "node.h".
-
-	* method.h: ditto.
-
-	* symbol.c: ditto.
-
-Thu Mar 12 08:14:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c: RGENGC_CHECK_MODE should be 0.
-
-Thu Mar 12 07:44:17 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: use T_IMEMO to represent `struct MEMO' value.
-	  memo->v1 and memo->v2 is WB protected values.
-	  So use MEMO_V1/V2_SET() macros to set these values.
-	  memo->u3 is ambiguous (sometimes a VALUE, sometimes an integer
-	  value), so use gc_mark_maybe() in gc.c to mark it.
-
-	  Rename NEW_MEMO() to MEMO_NEW().
-
-	  Move MEMO_FOR and NEW_MEMO_FOR macros from node.h.
-
-	  Export a rb_imemo_new() function for ext/ripper.
-
-	* node.h: remove NODE_MEMO.
-
-	* enum.c: catch up these change.
-
-	* enumerator.c: ditto.
-
-	* load.c: ditto.
-
-	* ext/objspace/objspace.c (count_nodes): ditto.
-
-	* gc.c (gc_mark_children): mark imemo_memo type.
-
-	* parse.y (new_args_gen): use T_IMEMO.
-	  (I'm not sure it is working correctly...)
-
-Wed Mar 11 22:36:34 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* eval.c (frame_called_id): it should use vm_ifunc type.
-
-	* eval.c (frame_func_id): ditto.
-
-Wed Mar 11 22:27:05 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* node.h: remove NODE_IFUNC, NEW_IFUNC.
-
-	* internal.h: use T_IMEMO for IFUNC.
-
-	  rename `struct IFUNC' to `struct vm_ifunc' and move the definition
-	  from vm_insnhelper.h. Add imemo_ifunc.
-
-	* gc.c (gc_mark_children): mark imemo_ifunc type T_IMEMO object.
-
-	* compile.c: catch up these changes.
-
-	* proc.c: ditto.
-
-	* vm_core.h (RUBY_VM_IFUNC_P): ditto.
-
-	* vm_eval.c (rb_iterate): ditto.
-
-	* vm_insnhelper.c: ditto.
-
-	* ext/objspace/objspace.c: ditto.
-
-Wed Mar 11 21:53:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h, eval_intern.h: move CREF accessors.
-
-	  List IMEMO supported types in internal.h.
-
-Wed Mar 11 21:45:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h: use T_IMEMO to create THROW_DATA.
-
-	  Add THROW_DATA_NEW().
-
-	* internal.h: move definition of `struct THROW_DATA'
-	  from vm_insnhelper.h to internal.h.
-
-	  Rename `THROW_DATA' to `vm_throw_data'.
-
-	* eval_intern.h (THROW_DATA_P): move to internal.h.
-	  THROW_DATA is no longer T_NODE, so check T_IMEMO.
-
-	* gc.c (gc_mark_children): mark THROW_DATA.
-
-	* vm.c: catch up these changes.
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-Wed Mar 11 21:21:56 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c: use T_IMEMO to create SVAR.
-
-	* internal.h, vm_insnhelper.h: move definition `struct SVAR'
-	  from vm_insnhelper.h to internal.h. And rename it to struct vm_svar.
-
-	  new imemo_type imemo_svar is added.
-
-	* gc.c (gc_mark_children): mark imemo_svar.
-
-	* node.c (rb_gc_mark_node): remove useless marking.
-
-Wed Mar 11 19:35:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* include/ruby/ruby.h: introduce new type T_IMEMO.
-	  T_IMEMO is Internal Memo type, internal use only.
-	  T_IMEMO has same purpose of NODE_MEMO.
-
-	  To insert T_IMEMO, type numbers are modified a little.
-
-	* internal.h: define struct RIMemo. Each RIMemo objects
-	  has imemo_type. We can observe it by the imemo_type() function.
-
-	* gc.c (rb_imemo_new): added.
-
-	* node.h: remove NODE_CREF and NEW_CREF().
-
-	* node.c (rb_gc_mark_node): ditto.
-
-	* vm.c (vm_cref_new): use rb_imem_new().
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: use RIMemo objects for CREF.
-
-	* ext/objspace/objspace.c: support T_IMEMO.
-
-Wed Mar 11 17:03:20 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c: fix memory leak by prepend method.
-
-	  It is easy to reproduce with such script:
-
-	    module M; def bar; end; end
-	    loop{
-	      Class.new do
-	        def foo; end
-	        prepend M
-	      end
-	    }
-
-	* gc.c (obj_free): free T_ICLASS::m_tbl if it is created by prepend.
-	  To recognize it, check RICLASS_IS_ORIGIN flag.
-
-	* gc.c (gc_mark_children): T_ICLASS objects only need to mark
-	  T_ICLASS::m_tbl if RICLASS_IS_ORIGIN is set.
-
-	* gc.c (obj_memsize_of): count T_ICLASS if RICLASS_IS_ORIGIN is set.
-
-	* internal.h (RCLASS_SET_ORIGIN): add to set RCLASS_SET_ORIGIN.
-
-	  TODO: The word `origin' seems not good name. We need to invent
-	  another good name.
-
-	* class.c: use RCLASS_SET_ORIGIN().
-
-	* class.c (class_alloc): zero clear rb_classext_t.
-
-Wed Mar 11 13:28:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in: check also procstat_getvmmap, which is not
-	  available on FreeBSD 9.  [ruby-core:68468] [Bug #10954]
-
-	* vm_dump.c (procstat_vm): use kinfo_getvmmap instead if
-	  procstat_getvmmap is not available.
-
-Wed Mar 11 09:15:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: define struct MEMO.
-
-	* enum.c: use MEMO.
-
-	* enumerator.c: ditto.
-
-	* load.c: ditto.
-
-	* node.h: return (struct MEMO *) pointer.
-
-Wed Mar 11 06:26:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h (THROW_DATA_STATE): return int, not VALUE.
-
-	* vm_insnhelper.h (THROW_DATA_STATE_SET): accept int value.
-
-Wed Mar 11 05:06:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_eval.c (rb_catch_protect): use THROW_DATA_VAL().
-
-Wed Mar 11 04:56:04 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h: define struct IFUNC.
-
-	* vm_eval.c (rb_iterate): use it.
-
-	* vm_insnhelper.c (vm_yield_with_cfunc): ditto.
-
-Wed Mar 11 03:52:12 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* eval_intern.h (THROW_DATA_P): use RB_TYPE_P() instead of
-	  BUILTIN_TYPE().
-
-	* thread.c (thread_join): use THROW_DATA_P().
-
-Wed Mar 11 03:48:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c: use RUBY_VM_IFUNC_P() to recognize IFUNC or not.
-
-	* vm.c: ditto.
-
-	* vm_dump.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-	* vm_core.h (RUBY_VM_IFUNC_P): use RB_TYPE_P() instead of
-	  BUILTIN_TYPE().
-
-Wed Mar 11 03:21:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h: define struct THROW_DATA to represent
-	  throwing data. Also define accessor functions.
-
-	* eval_intern.h: move related changes into vm_insnhelper.h.
-	  Now these MACROs (functions) are only used in vm*.c.
-
-	  There is only THROW_DATA_P(err) to check this data type or not.
-
-	* vm.c: catch up these changes.
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-Wed Mar 11 00:57:00 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* test/rubygems/test_gem_security_trust_dir.rb: The return value of
-	  File::Stat#mode is OS dependent. In AIX, 0200000 is set.
-
-Tue Mar 10 20:03:41 2015  Tanaka Akira  <akr@fsij.org>
-
-	* lib/webrick/server.rb: Invoke setup_shutdown_pipe in start method
-	  instead of listen method.
-	  [ruby-core:68476] [Bug #10956] Reported by Shintaro Kojima.
-
-Tue Mar 10 17:27:27 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* thread.c (thread_join): Fixnum (except TAG_FATAL) and
-	  NODE should not be reached here.
-
-Mon Mar  9 21:42:10 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (ep_cref): rename to lep_cref() because it should be
-	  local ep.
-
-Mon Mar  9 16:34:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_close): don't raise on double
-	  close for consistent to IO#close.
-
-Mon Mar 09 06:44:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h: define struct SVAR for SVAR.
-	  This data type is also same layout of NODE (NODE_IF).
-
-	* vm_insnhelper.c: catch up this change.
-
-Mon Mar  9 06:43:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (lep_svar_set): add WBs.
-
-Mon Mar  9 06:19:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: define rb_cref_t and change to use it.
-
-	  rb_cref_t is data type of CREF. Now, the body is still NODE.
-	  It is easy to understand what is CREF and what is pure NODE.
-
-Mon Mar  9 06:00:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h (COPY_CREF_OMOD): fix translation miss.
-
-Mon Mar  9 04:47:58 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: define CREF accessor macros.
-	  * CREF_CLASS(cref)
-	  * CREF_NEXT(cref)
-	  * CREF_VISI(cref)
-	  * CREF_VISI_SET(cref, v)
-	  * CREF_REFINEMENTS(cref)
-	  * CREF_PUSHED_BY_EVAL(cref)
-	  * CREF_PUSHED_BY_EVAL_SET(cref)
-	  * CREF_OMOD_SHARED(cref)
-	  * CREF_OMOD_SHARED_SET(cref)
-	  * CREF_OMOD_SHARED_UNSET(cref)
-
-	  This is process to change CREF data type from NODE.
-
-Sun Mar  8 22:50:57 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/zlib/zlib.c (rb_gzfile_close): Don't raise on double
-	  close for consistent to IO#close.
-
-Sun Mar  8 16:57:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): match patterns against legacy short names
-	  too, not only ordinary names.  [ruby-core:67954] [Bug #10819]
-
-	* win32/dir.h (struct direct): add short name members.
-
-	* win32/win32.c (opendir_internal, readdir_internal): ditto.
-
-Sat Mar  7 09:36:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* array.c: document that first element is kept when using
-	  Array#uniq and #uniq! [fix GH-845][ci skip]
-	  Patch by @riffraff
-
-Sat Mar  7 09:28:02 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* thread.c: Mutex#owned? is no longer experimental since 2.1.0
-	  [fix GH-839][ci skip] Patch by @takiy33
-
-Sat Mar  7 09:18:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/merger.rb: Added documentation to version method.
-	  [fix GH-847][ci skip] Patch by @magikid
-
-Fri Mar  6 22:50:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (rb_prepend_module): need a WB for klass -> origin.
-
-Fri Mar  6 20:18:38 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* fix namespace issue on singleton class expressions. [Bug #10943]
-
-	* vm_core.h, method.h: remove rb_iseq_t::cref_stack. CREF is stored
-	  to rb_method_definition_t::body.iseq_body.cref.
-
-	* vm_insnhelper.c: modify SVAR usage.
-	  When calling ISEQ type method, push CREF information onto method
-	  frame, SVAR located place. Before this fix, SVAR is simply nil.
-	  After this patch, CREF (or NULL == Qfalse for not iseq methods)
-	  is stored at the method invocation.
-
-	  When SVAR is required, then put NODE_IF onto SVAR location,
-	  and NDOE_IF::nd_reserved points CREF itself.
-
-	* vm.c (vm_cref_new, vm_cref_dump, vm_cref_new_toplevel): added.
-
-	* vm_insnhelper.c (vm_push_frame): accept CREF.
-
-	* method.h, vm_method.c (rb_add_method_iseq): added. This function
-	  accepts iseq and CREF.
-
-	* class.c (clone_method): use rb_add_method_iseq().
-
-	* gc.c (mark_method_entry): mark method_entry::body.iseq_body.cref.
-
-	* iseq.c: remove CREF related codes.
-
-	* insns.def (getinlinecache/setinlinecache): CREF should be cache key
-	  because a different CREF has a different namespace.
-
-	* node.c (rb_gc_mark_node): mark NODE_IF::nd_reserved for SVAR.
-
-	* proc.c: catch up changes.
-
-	* struct.c: ditto.
-
-	* insns.def: ditto.
-
-	* vm_args.c (raise_argument_error): ditto.
-
-	* vm_eval.c: ditto.
-
-	* test/ruby/test_class.rb: add a test.
-
-Fri Mar  6 18:19:13 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/webrick/test_filehandler.rb: on vboxsf (on VirtualBox
-	  on Windows 7), file name and permissions are strange (can access
-	  by short file name and so on).
-
-	  Simply skip on such tests on such FS. To detect strange FS, this
-	  patch use a part of code `File.executable?(__FILE__)`.
-	  Please correct them if there are better ways.
-
-Fri Mar  6 17:31:29 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/ruby/test_beginendblock.rb: do not change directory.
-
-	  Run system command in the directory mounted by vboxsf on Windows 7
-	  and get warning like that "warning: Insecure world writable dir...".
-
-Fri Mar  6 10:31:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (vm_call_super): search next super class from the
-	  original class, to get rid of infinite recursion with
-	  prepending.  a patch by Seiei Higa <hanachin AT gmail.com> at
-	  [ruby-core:68434].  [ruby-core:68093] [Bug #10847]
-
-Fri Mar  6 08:45:26 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/matrix.rb: Add Vector#round. Patch by Jordan Stephens.
-	  [Fixes GH-802]
-
-Fri Mar  6 07:33:03 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): show node name too.
-
-Fri Mar  6 07:00:44 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: remove struct method_table_wrapper.
-	  struct method_table_wrapper was introduced to avoid duplicate marking
-	  for method tables.
-
-	  For example, `module M1; def foo; end; end` make one method table
-	  (mtbl) contains a method `foo`. M1 (T_MODULE) points mtbl.
-	  Classes C1 and C2 includes M1, then two T_ICLASS objects are created
-	  and they points mtbl too. In this case, three objects (one T_MODULE
-	  and two T_ICLASS objects) points same mtbl. On marking phase, these
-	  three objects mark same mtbl. To avoid such duplication, struct
-	  method_table_wrapper was introduced.
-
-	  However, created two T_ICLASS objects have same or shorter lifetime
-	  than M1 (T_MODULE) object. So that we only need to mark mtbl from M1,
-	  not from T_ICLASS objects. This patch tries marking only from M1.
-	  In other words, original module (M1) has responsibility to mark mtbl.
-	  Because of no duplicate marking, we don't need method_table_wrapper
-	  any more.
-
-	  Note that one `Module#prepend` call creates two T_ICLASS objects.
-	  One for referring to a prepending Module object, same as
-	  `Module#include`. We don't need to care this T_ICLASS.
-	  One for moving original mtbl from a prepending class. We need to
-	  mark such mtbl from this T_ICLASS object. To mark the mtbl,
-	  we need to use `RCLASS_ORIGIN(klass)` on marking from a prepended
-	  class `klass`.
-
-	* class.c: ditto.
-
-	* eval.c (rb_using_refinement): ditto.
-
-	* gc.c: ditto.
-
-	* include/ruby/ruby.h: define m_tbl directly. The definition of
-	  struct RClass should be moved to (srcdir)/internal.h.
-
-	* method.h: remove decl of rb_free_m_tbl_wrapper().
-
-	* object.c: use RCLASS_M_TBL() directly.
-
-Fri Mar  6 02:50:12 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* dir.c (replace_real_basename): need to check the return value of
-	  GLOB_REALLOC().
-
-Fri Mar  6 02:26:03 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* dir.c (replace_real_basename): shouldn't create Ruby object before
-	  the object system is loaded.
-	  [ruby-core:68430] [Bug #10941]
-
-Wed Mar  5 16:58:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* hash.c: [DOC] #delete method actually returns nil, if the key
-	  is not found. [fix GH-844][ci skip] Patch by @ivdma
-
-Wed Mar  5 12:22:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c: refactoring: remove unnecessary variable d0 to unify code
-	  appearance.
-
-Thu Mar  5 11:50:54 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* vm_eval.c (eval_string_with_cref): A binding should keep
-	  refinements activation information and the refinements should be
-	  activated in subsequent eval calls with the binding.
-	  [ruby-core:67945] [Bug #10818]
-
-Thu Mar  5 11:16:55 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* test/ruby/test_refinement.rb: There is no need anymore to suppress
-	  warnings.
-
-Thu Mar  5 08:31:02 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* random.c (random_raw_seed): Avoid calling fill_random_bytes()
-	  if the requested size is 0. AIX returns -1 for 0-byte read from
-	  /dev/urandom, while other UNIX returns 0. With this change,
-	  Random.raw_seed(0) consistently returns "" in any UNIX.
-
-Wed Mar  4 12:43:32 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* test/ruby/test_math.rb (assert_float_and_int): Refactor test cases
-	  by introducing assert_float_and_int. [misc #10810]
-
-Wed Mar  4 11:52:30 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* symbol.c (Init_sym): make dsym_fstrs a hash compared by identity
-	  as the keys are unique fstrings, to get rid of running hash and
-	  compare methods and causing new object allocation during garbage
-	  collection phase.  [ruby-dev:48891] [Bug #10933]
-
-Wed Mar  4 10:16:57 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* enum.c: Fix typo in slice_after's exception message.
-	  [fix GH-842][ci skip] Patch by @jsyeo
-
-Wed Mar  4 10:15:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/syntax/methods.rdoc: add some missing spaces and
-	  fix a grammatical error in method docs.
-	  [fix GH-843][ci skip] Patch by @nikolas
-
-Wed Mar  4 02:13:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (backport_command_string): pick up only
-	  when the revision exists in trunk.
-
-Wed Mar  4 00:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* thread.c (rb_thread_io_blocking_region): assigned variables
-	  inside EXEC_TAG() should be volatile.
-
-	* thread.c (rb_thread_s_handle_interrupt): ditto.
-
-	* thread.c (exec_recursive): ditto.
-
-Wed Mar  4 00:29:18 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: now can specify shorten form of commands.
-
-Tue Mar  3 23:41:42 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (Readline.readline): drop untreated control
-	  characters.
-
-Tue Mar  3 22:25:24 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/lib/envutil.rb (EnvUtil.invoke_ruby): need to rescue because
-	  Signal.signame may raise exception.
-
-Tue Mar  3 16:57:39 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: use 'b' instead of 's' for showing
-	  Backport options for merger.rb.
-
-Tue Mar  3 16:55:23 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: show selected ticket number at prompt.
-
-Tue Mar  3 14:47:30 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c (num2dbl_with_to_f): direct casting from Rational to double.
-	  [Feature #10909]
-
-	* test/ruby/test_math.rb: add tests for the above change.
-
-Tue Mar  3 07:52:20 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* test/ruby/test_symbol.rb: avoid a false positive in AIX.
-
-Tue Mar  3 00:59:39 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* configure.in: set PRELOADENV in Solaris to avoid "wrong ELF class"
-	  error. [Bug #10926] [ruby-dev:48888]
-	* configure.in: set LIBPATHENV for 32-bit compile in Solaris
-	  in addition to 64-bit.
-
-Mon Mar  2 15:36:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in: do not check _setjmp unless _longjmp is available,
-	  so that configure results will not be changed by cache.
-
-Mon Mar  2 14:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (RUBY_REPLACE_TYPE): restore unsigned type from
-	  cached variable only if the target type is not available.
-
-Mon Mar  2 13:04:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* signal.c (sig_signame): return nil if the argument is a valid
-	  signal number.
-
-Mon Mar  2 12:05:04 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/net/ftp/test_ftp.rb (create_ftp_server): set SO_OOBINLINE
-	  for receiving OOB data which is sent with MSG_OOB flag in
-	  portable way. [Bug #10915] [ruby-dev:48885]
-	* test/net/ftp/test_ftp.rb (test_abort, test_status): use gets
-	  for receiving OOB data in portable way.
-
-Mon Mar  2 11:43:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (RUBY_REPLACE_TYPE): restore unsigned type from
-	  cached variable.
-
-Mon Mar  2 06:01:41 2015  Eric Wong  <e@80x24.org>
-
-	* ext/io/wait/wait.c (io_nread): wrap return value with INT2FIX
-	  Thanks to Yura Sokolov <funny.falcon@gmail.com>
-	  [ruby-core:68369] [Bug#10923]
-	* test/io/wait/test_io_wait.rb (test_nread_buffered):
-	  fix broken test
-
-Sun Mar  1 20:21:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (RUBY_REPLACE_TYPE): restore convertible type from
-	  cached variable, so that configured results will be stable.
-
-Sun Mar  1 18:10:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (rb_cv_broken_memmem): check before adding the
-	  result HAVE_MEMMEM macro to confdefs.h, so that configured
-	  results will be stable.
-
-Sun Mar  1 11:17:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (id2ref): prohibit from accessing internal objects.
-	  [ruby-core:68348] [Bug #10918]
-
-Sun Mar  1 09:06:11 2015  Tanaka Akira  <akr@fsij.org>
-
-	* lib/time.rb (strptime): Support %s.%N.
-	  [ruby-core:68301] [Bug #10904] Patch by Sadayuki Furuhashi.
-
-Sat Feb 28 17:18:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* enum.c (enum_each_slice, enum_each_cons): limit elements size by
-	  the enumerator size.  suggested by Hans Mackowiak <hanmac AT
-	  gmx.de> at [ruby-core:68335]
-
-Sat Feb 28 15:44:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_dump.c (rb_vm_bugreport): get rid of making new strings
-	  inside signal context.
-
-	* variable.c (rb_tmp_class_path): defer making temporary class
-	  path string.
-
-	* variable.c (rb_search_class_path): search class path or return
-	  Qnil or Qfalse if unnamed, not creating a temporary path.
-
-Sat Feb 28 15:02:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* variable.c (rb_tmp_class_path): preserve name encoding of an
-	  anonymous instance of module/class subclass.
-
-Sat Feb 28 08:24:30 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* ext/pty/pty.c: AIX supports autopush.
-	  Patch by Perry Smith [ruby-core:58539] [Bug #9144]
-
-Fri Feb 27 22:00:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems: Update to RubyGems 2.4.6 and HEAD(800f2e6).
-	  Fixed #1159, #1171, #1173 on rubygems/rubygems
-	* test/rubygems: ditto.
-
-Fri Feb 27 20:55:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rake: Update to rake (9237e74), typo fix and remove needless
-	  private syntax.
-	* test/rake: ditto.
-
-Fri Feb 27 17:06:44 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: define vm_svar_index.
-
-	* vm_insnhelper.c, vm.c, compile.c: use vm_svar_index names.
-
-	* iseq.h: remove DEFAULT_SPECIAL_VAR_COUNT.
-	  use VM_SVAR_FLIPFLOP_START instead.
-
-Fri Feb 27 13:57:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (setup_narg): wipe away expanded part of buffer to get rid
-	  of revealing uncleaned data.  reported by Dongkwan Kim <dkay AT
-	  kaist.ac.kr>.
-
-Wed Feb 25 22:25:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* spec/default.mspec: use default configuration file name.
-	  https://github.com/ruby/rubyspec/commit/cc69f337b06362e5607ffa3e3ad40ef7494960cf
-
-Wed Feb 25 22:21:56 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* spec/default.mspec: remove specific version number.
-	  https://github.com/ruby/rubyspec/commit/7a909e925c1baa9c700bd44af9241aef6e596714
-
-Wed Feb 25 22:04:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/win32/Win32API.rb (initialize): accept both a string and an array
-	  for the arguments of the imported function.
-	  reported by Aaron Stone [ruby-core:68208] [Bug #10876] [Fixes GH-835]
-
-Wed Feb 25 18:12:11 2015  Eric Wong  <e@80x24.org>
-
-	* signal.c (sighandler): preserve errno
-	  Patch by Steven Stewart-Gallus <sstewartgallus00@mylangara.bc.ca>
-	  [ruby-core:68172] [Bug #10866]
-
-Wed Feb 25 15:59:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (push_pattern, push_glob): make globbed file names same
-	  encoding to the given pattern.
-
-Wed Feb 25 15:27:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* tool/merger.rb: support 2.1+ versioning scheme.
-
-Tue Feb 25 08:49:12 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* lib/cmath.rb (log): raise ArgumentError when more than 2 arguments
-	  are passed. [ruby-core:66143] [Bug #10487]
-
-Tue Feb 25 02:15:17 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* test/ruby/test_math.rb: Use assert_infinity instead of assert_equal(1.0/0, ...).
-
-	* test/ruby/test_math.rb: Add tests for overriding Integer#to_f.
-	  [ruby-core:67919] [Misc #10809]
-
-Tue Feb 24 22:58:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* complex.c (nucomp_mul): calculate as rotation in complex plane
-	  if matrix calculation resulted in NaN.
-
-Tue Feb 24 21:45:39 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* test/ruby/test_math.rb(test_cbrt): Add an assertion for Math.cbrt(1.0/0)
-	  and move #test_cbrt to more proper place.
-
-Tue Feb 24 19:09:25 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (lep_svar_place, lep_svar_get): do not create
-	  additional T_NODE object (svars holder) when only getting
-	  svars.
-
-Tue Feb 24 11:49:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* time.c (time_zone_name): should be US-ASCII only if all 7-bits,
-	  otherwise locale encoding.  [ruby-core:68230] [Bug #10887]
-
-Tue Feb 24 09:47:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (chompped_length): enable smart chomp for all non-dummy
-	  encoding strings, not only default_rs.
-	  [ruby-core:68258] [Bug #10893]
-
-Mon Feb 23 23:19:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/vcs.rb (IO.popen): support :chdir option.
-
-	* tool/vcs.rb (VCS::GIT.get_revisions): use :chdir option instead
-	  of -C option which is not supported by older git.
-	  [ruby-dev:48880] [Bug #10890]
-
-Mon Feb 23 15:26:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_split_m): raise ArgumentError at broken string
-	  not RegexpError, as Regexp is not involved in.
-	  [ruby-core:68229] [Bug #10886]
-
-Mon Feb 23 07:25:29 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* time.c: Zone encoding should be US-ASCII if all 7-bits. Fix r46907.
-
-	* test/ruby/test_time.rb, test/ruby/test_time_tz.rb: Update tests.
-
-Sun Feb 22 18:33:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* common.mk: use ruby organization for rubyspec.
-
-Sun Feb 22 15:56:06 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
-
-	* vm_insnhelper.c (rb_vm_rewrite_cref_stack): copy nd_refinements
-	  of original crefs. It fixes segmentation fault when calling
-	  refined method in duplicate module. [ruby-dev:48878] [Bug #10885]
-
-	* vm_core.h, class.c: change accordingly.
-
-	* test/ruby/test_refinement.rb: add a test for above.
-
-Sun Feb 22 10:43:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_objspace_call_finalizer): control GC execution during
-	  force firnalizations at the end of interpreter process.
-	  [Bug #10768]
-
-	  1) Prohibit incremental GC while running Ruby-level finalizers
-	     to avoid any danger.
-	  2) Prohibit GC while invoking T_DATA/T_FILE data structure
-	     because these operations break object relations consistency.
-
-	  This patch can introduce another memory consuming issue because
-	  Ruby-level finalizers can run after (2), GC is disabled.
-	  However, basically object consistency was broken at (2) as I
-	  described above. So that running Ruby-level finalizers contains
-	  danger originally. Because of this point, I need to suggest to
-	  remove these 3 lines (invoking remaining finalizers). And add a
-	  rule to add that finalizers should not add new finalizers, or
-	  say there is no guarantee to invoke finalizers that added by
-	  another finalizer.
-
-Sun Feb 22 04:07:05 2015  Zachary Scott  <e@zzak.io>
-
-	* ext/openssl/ossl_asn1.c: [DOC] RDoc formatting fixes for
-	  ASN1::ObjectId with patch from @vbatts [Fixes GH-834]
-
-	* ext/openssl/ossl_bn.c: ditto.
-
-Sat Feb 21 19:51:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* re.c (match_aref): RMatch::regexp is Qnil after matching by a
-	  string since r45451.  [ruby-core:68209] [Bug #10877]
-
-Sat Feb 21 16:18:42 2015  Stefan Schuler  <mail@stefanschuessler.de>
-
-	* compar.c (Init_Comparable): [DOC] Replace camelcase variable name.
-	  [Fix GH-833]
-
-Fri Feb 20 17:27:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_identical_p): fix handle leak, ensure to close
-	  the handle of the first argument.
-
-Fri Feb 20 17:19:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (different_device_p): compare by volume serial
-	  numbers, not by path names.  [ruby-core:68162] [Bug #10865]
-
-Thu Feb 19 01:58:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/file.c (rb_file_expand_path_internal): neither the drive
-	  of base directory nor the current drive are involved in the
-	  result if different than the drive of path.
-	  [ruby-core:68130] [Bug #10858]
-
-Wed Feb 18 10:48:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (wrename): return EXDEV if moving a directory to
-	  another drive, since MoveFileExW does not set proper error code.
-	  [ruby-core:68162] [Bug #10865]
-
-Wed Feb 18 03:13:52 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych.rb: bump psych version.
-	* ext/psych/psych.gemspec: ditto
-	* ext/psych/yaml/scanner.c: add latest libyaml change.
-	* test/psych/helper.rb: support newer minitest
-	* test/psych/test_to_yaml_properties.rb: ditto
-
-Tue Feb 17 11:47:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/resolv.rb (Resolv::DNS::Resource#==, #hash): elements
-	  returned by Kernel#instance_variables are Symbols now.
-	  [ruby-core:68128] [Bug #10857]
-
-Tue Feb 17 10:59:10 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/syntax/calling_methods.rdoc: Fix documentation for "calling_methods"
-	  Patch by @sos4nt [fix GH-830][ci skip]
-
-Tue Feb 17 10:53:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/file.c (rb_file_expand_path_internal): do not make invalid
-	  (or ADS) path if the path has a drive letter, the result also
-	  should have be under it.  [ruby-core:68130] [Bug #10858]
-
-Tue Feb 17 10:47:20 2015  Iain Beeston  <iain.beeston@gmail.com>
-
-	* hash.c: Added docs to explain that #include? and #member? do not
-	  check member equality
-	* lib/set.rb: ditto
-
-Mon Feb 16 20:58:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* compile.c (compile_massign): optimization for special case,
-	  assignments by aset or attrset.
-	  http://kokizzu.blogspot.jp/2015/02/c-java-hhvm-ruby-nodejsrhinojscspidermo.html
-	  http://www.atdot.net/~ko1/diary/201502.html#d16
-
-Sun Feb 15 10:41:23 2015  Sho Hashimoto  <sho-h@ruby-lang.org>
-
-	* doc/standard_library.rdoc: [DOC] delete removed libraries.
-	  [misc #10843] [ci skip]
-
-Sat Feb 14 12:20:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* random.c (rand_random_number): add a method to return a random
-	  number like SecureRandom to Random::Formatter.
-
-	* lib/securerandom.rb (random_bytes): move to Random::Formatter,
-	  the base method of the module.
-
-Sat Feb 14 12:01:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* random.c (random_raw_seed): extract platform dependent random
-	  seed initialization function as a new method Random.raw_seed.
-
-	* lib/securerandom.rb (SecureRandom): use Random.raw_seed.
-
-Sat Feb 14 00:49:37 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/coverage/coverage.c: Add Coverage.peek_result.  Allows you to
-	  capture coverage information without stopping the coverage tool.
-	  [ruby-core:67940] [Feature #10816]
-
-	* test/coverage/test_coverage.rb: test for change.
-
-Fri Feb 13 21:52:05 2015  Yusuke Endoh  <mame@tsg.ne.jp>
-
-	* string.c (str_discard): does not free for STR_NOFREE string.
-	  [Bug #10853][ruby-core:68110]
-
-	* bootstraptest/test_string.rb: test for above.
-
-Fri Feb 13 21:16:00 2015  Yusuke Endoh  <mame@tsg.ne.jp>
-
-	* lib/base64.rb: make urlsafe mode user-friendly.
-
-	* lib/base64.rb (Base64.urlsafe_encode64): a new option "padding" to
-	  suppress the padding character ("=").
-
-	* lib/base64.rb (Base64.urlsafe_decode64): now it accepts not only
-	  correctly-padded input but also unpadded input.
-	  [Feature #10740][ruby-core:67570]
-
-	* test/base64/test_base64.rb: Test for above
-
-Fri Feb 13 14:19:06 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json: merge upstream from flori/json
-	  change usage of TypedData. [Feature #10739][ruby-core:67564]
-
-Thu Feb 12 18:34:01 2015  multisnow  <infinity.blick.winkel@gmail.com>
-
-	* ext/openssl/extconf.rb: check RAND_edg to support libressl.
-
-	* ext/openssl/ossl_rand.c (ossl_rand_egd): define only if RAND_edg
-	  is available.  [Fix GH-829]
-
-Thu Feb 12 10:46:14 2015  Eric Hodel  <drbrain@segment7.net>
-
-	* proc.c (proc_call):  Improve Proc#call documentation.  Patch by
-	  Hsing-Hui Hsu.  [fix GH-761]
-
-Thu Feb 12 04:33:02 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* compar.c (cmp_equal): no more error hiding for Comparable#==.
-	  It now behaves as other Comparable methods. See #7688.
-
-	* test/ruby/test_comparable.rb: update related test.
-
-Thu Feb 12 03:28:05 2015  Eric Wong  <e@80x24.org>
-
-	* lib/set.rb (initialize): internal hash defaults to false
-
-	* lib/set.rb (include?): use Hash#[] for optimized dispatch.
-	  Patch by Ismael Abreu <ismaelga@gmail.com>
-	  [ruby-core:67664] [Misc #10754]
-
-Wed Feb 11 11:09:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/digest/digest_conf.rb (digest_conf): check for CommonDigest.
-
-	* ext/digest/*/*cc.h: for Apple CommonCrypto/CommonDigest.h.
-
-	* ext/digest/digest.h (DEFINE_FINISH_FUNC_FROM_FINAL): macro for
-	  finish functions, by inverting arguments order.
-
-	* ext/digest/digest_conf.rb (digest_conf): extract common
-	  configurations.
-
-Wed Feb 11 11:01:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/json/generator/generator.c (generate_json): get rid of
-	  unnecessary recursive calls which can cause infinite recursion.
-	  T_STRING may not have rb_cString.
-
-Wed Feb 11 07:53:35 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* test/win32ole/test_word.rb: use skip method to skip test.
-
-Tue Feb 10 11:38:28 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* vm_insnhelper.c (vm_call_method): stop method search when a method
-	  is not found in a refinement, to support undef in refinements.
-	  [ruby-core:66741] [Bug #10578]
-
-Tue Feb 10 11:19:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (chdir, delete, gettextfile, mdtm, mkdir, nlst,
-	  putbinaryfile, puttextfile, rename, rmdir, size): support
-	  Pathname. Patch by Joe Rafaniello. [fix GH-828]
-
-Mon Feb  9 16:36:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/make-snapshot (package): get rid of loading unbundled and
-	  unexpected libraries.  [ruby-core:67977] [Bug #10822]
-
-Sun Feb  8 20:09:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/net/http/header.rb: pass header names as symbols.
-	  Patch by @DamirSvrtan [fix GH-805]
-	* test/net/http/test_httpheader.rb: added test.
-
-Sun Feb  8 13:04:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/socket/getaddrinfo.c (get_addr): reject too long hostname to
-	  get rid of GHOST vulnerability on very old platforms.
-
-	* ext/socket/raddrinfo.c (make_hostent_internal): ditto, paranoic
-	  check for the canonical name.
-
-Sun Feb  8 12:48:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/win32/lib/win32/registry.rb (Win32::Registry::API): use wide
-	  versions of RegDeleteValue and RegDeleteKey.
-	  [ruby-core:67958] [Bug #10820]
-
-Sat Feb  7 22:13:08 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* test/win32ole/test_win32ole_record.rb: remove test using .NET
-	  Framework 3.5 because it is not included in Windows 8/8.1.
-
-Sat Feb  7 19:25:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (has_magic): always get long path name on Windows even if
-	  no tilde is there.  [ruby-core:68011] [Bug #10819]
-
-	* dir.c (replace_real_basename): FindFirstFile ignore redirection
-	  character, check if exists before call it.  cf. [Bug #8597]
-
-Sat Feb  7 13:30:11 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* test/win32ole/test_win32ole_record.rb
-	  (test_ole_instance_variable_get): correct VT_RECORD type and
-	  instance variables.
-
-Fri Feb  6 17:47:05 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: register nodes when
-	  dumping objects with custom coders. [ruby-core:66215] [Bug #10496]
-
-	* test/psych/test_coder.rb: test for fix
-
-Fri Feb  6 16:58:31 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/to_ruby.rb: fix support for regular
-	  expressions with newlines. tenderlove/psych#222
-
-	* test/psych/test_yaml.rb: test for change.
-
-Fri Feb  6 10:31:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_core.h (rb_call_info_kw_arg_struct): make keywords a symbols
-	  list to get rid of inadvertent creation by variable keyword
-	  arguments.  [ruby-core:68031] [Bug #10831]
-
-Thu Feb  5 22:42:34 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems:  Update to RubyGems HEAD(5c3b6f3).
-	  Fixed #1156, #1142, #1115, #1142, #1139 on rubygems/rubygems
-	* test/rubygems:  ditto.
-
-Thu Feb  5 13:41:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (send_internal), vm_insnhelper.c (vm_call_opt_send):
-	  convert String method name into a Symbol, as method_missing
-	  method expects its first argument to be a Symbol.  [Bug #10828]
-
-	* vm_insnhelper.c (ci_missing_reason): return the reason of method
-	  missing in call info.
-
-	* vm_insnhelper.c (vm_call_opt_send): re-apply r49500 with the
-	  proper missing reason.  [Bug #10828]
-
-Thu Feb  5 10:31:46 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* class.c (rb_obj_singleton_methods): should use RTEST() to convert
-	  VALUE to int.
-
-Thu Feb  5 03:59:33 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* vm_insnhelper.c: Fix symbol leak with +send+ [Bug #10828]
-
-Wed Feb  4 20:26:54 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (Init_win32ole): should not use atexit to
-	  free allocated hash table to avoid error on Cygwin.
-
-Wed Feb  4 15:34:25 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* class.c (method_entry_i, class_instance_method_list,
-	  rb_obj_singleton_methods): should not include methods of
-	  superclasses if recur is false. [ruby-dev:48854] [Bug #10826]
-
-Wed Feb  4 16:32:40 2015  Matt Hoyle  <matt@deployable.co>
-
-	* ext/bigdecimal/bigdecimal.c (VpSetPTR): fix a typo, 'expoennt'
-	  to 'exponent'.  [ruby-core:67980] [Bug #10823] [Fix GH-825]
-
-Wed Feb  4 15:55:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/sdbm/_sdbm.c: include ruby/ruby.h for PRIdPTRDIFF when a
-	  macro `DEBUG` is defined.  based on the patch by Owen Rodley in
-	  [ruby-core:67987]. [Bug #10825]
-
-Wed Feb  4 11:12:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in (probes.stamp): rebuild dtrace dependent objects
-	  only when `dtrace -G` modifies its input files.
-
-Tue Feb  3 19:27:16 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* common.mk (ruby-glommed.o): dependency on $(OBJ) should be written
-	  in common.mk (in which OBJ is defined) because of Makefile include
-	  and parse order. This partly reverts r49419.
-	  [ruby-dev:48849] [Bug #10808]
-
-	* Makefile.in (ruby-glommed.o): ditto.
-
-	* Makefile.in (ruby-glommed.o): remove excess $(DTRACE_OBJ) because
-	  it is included in $(OBJS) since r49451.
-
-	* Makefile.in (probes.o): should depend on $(DTRACE_DEPENDENT_OBJS)
-
-Tue Feb  3 17:15:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (try_cppflags, try_cflags, try_ldflags): get rid of
-	  interference by modifying global variables in have_devel? method.
-	  [ruby-core:67962] [Bug #10821]
-
-Tue Feb  3 15:23:58 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* vm_method.c (remove_method): When remove refined
-	  method, raise a NameError if the method is not
-	  defined in refined class.
-
-	  But if the method is defined in refined class,
-	  it should keep refined method and remove original
-	  method.
-
-	  Patch by Seiei Higa. [ruby-core:67722] [Bug #10765]
-
-Tue Feb  3 14:04:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): obtain real name with FindFirstFile API
-	  instead of matching all entries, on Windows.
-	  [ruby-core:67954] [Bug #10819]
-
-Tue Feb  3 12:26:35 2015  Katsuhiko Nishimra  <ktns.87@gmail.com>
-
-	* lib/mkmf.rb (configuration): set the default cxxflags, which is
-	  referred from the default CXXFLAGS, for extension libraries.
-	  [Fix GH-823]
-
-Tue Feb  3 05:52:00 2015  Aman Gupta <ruby@tmm1.net>
-
-	* gc.c (rb_objspace_free): cause rb_bug if lazy sweep is in progress
-	  during rb_objspace_free. Adds extra protection for r46340.
-	  Patch by Vicent Marti. [Bug #10768] [ruby-core:67734]
-	* gc.c (rb_objspace_call_finalizer): Ensure GC is completed after
-	  finalizers have run. We already call gc_rest() before invoking
-	  finalizers, but finalizer can allocate new objects and start new GC
-	  cycle, so we call gc_rest() again after finalizers are complete.
-
-Mon Feb  2 10:51:34 2015  Ari Pollak  <ajp@aripollak.com>
-
-	* doc/security.rdoc (Symbols): update about Symbol GC.  Symbols
-	  explicitly converted from Strings now can be collected, but
-	  reflection/metaprogramming still can cause memory flooding.
-	  [Fix GH-725]
-
-Sun Feb  1 13:46:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/rbinstall.rb (bin-comm): drop batch file installation.
-	  Windows 95 support has not been supported already.
-	  [Feature #10806]
-
-Sat Jan 31 12:06:23 2015  Scott Francis  <scott.francis@shopify.com>
-
-	* thread_pthread.c (reserve_stack): fix intermittent SIGBUS on
-	  Linux, by reserving the stack virtual address space at process
-	  start up so that it will not clash with the heap space.
-	  [Fix GH-822]
-
-Fri Jan 30 17:28:29 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c (num2dbl_with_to_f): make faster when Bignum passed by
-	  direct conversion using rb_big2dbl().  [Feature #10800]
-
-Thu Jan 29 23:30:00 2015  Kenta Murata  <mrkn@mrkn.jp>
-
-	* ext/bigdecimal/bigdecimal.c (rb_rational_num): add fallback function
-	  for rubies lower than 2.2.0.
-
-	* ext/bigdecimal/bigdecimal.c (rb_rational_den): ditto.
-
-	* ext/bigdecimal/extconf.rb: check the existences of struct RRational,
-	  rb_rational_num, and rb_rational_den.
-
-	* ext/bigdecimal/bigdecimal.bundle: bump version.
-
-Thu Jan 29 20:28:25 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/make-snapshot: removed md5 digest with package information
-
-Thu Jan 29 10:41:52 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c (Get_Double): direct casting from Fixnum to double.
-	  [Feature #10785]
-
-Thu Jan 29 02:34:27 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/to_ruby.rb: fix parsing hashes with
-	  instance variables when it is referenced multiple times.
-	* ext/psych/lib/psych.rb: bump version
-	* ext/psych/psych.gemspec: bump version
-	* test/psych/test_hash.rb: test for fix
-
-Thu Jan 29 02:06:09 2015  Eric Wong  <e@80x24.org>
-
-	* thread.c (struct join_arg): restructure and make smaller
-	  (thread_join_sleep): avoid timeofday() call if forever
-	  (thread_join): pass join_arg.delay directly
-	  (rb_thread_inspect_msg): remove, inline into rb_thread_inspect
-	  (rb_thread_inspect): reduce branching and string creation
-	* thread_pthread.c (native_set_thread_name): create string directly
-	  to avoid reparsing. [Misc #10723]
-
-Wed Jan 28 21:32:24 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* thread.c: Improve documentation for Thread#value
-	  [Bug #10694][ruby-core:67324][ci skip]
-
-Tue Jan 27 16:04:19 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: added `!` command.
-
-Tue Jan 27 15:58:23 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: added history feature for platforms which
-	  lack readline.
-
-Mon Jan 26 22:09:35 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .gitignore: ignored temporary file with git.
-
-Mon Jan 26 18:06:03 2015  Akinori MUSHA  <knu@iDaemons.org>
-
-	* misc/ruby-electric.el: Import version 2.2.2 from
-	  https://github.com/knu/ruby-electric.el.
-
-Mon Jan 26 11:37:49 2015  Dave Stevens  <dave@crowdlab.com>
-
-	* string.c (str_make_independent_expand): terminate String when
-	  moved from heap to embedded.  [Fix GH-821].
-
-Sun Jan 25 12:04:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (flatten): no need to call to_ary method on elements
-	  beyond the given level.  [ruby-core:67637] [Bug #10748]
-
-Sun Jan 25 00:42:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/fiddle/win32/libffi.mk.tmpl: assemble without directory prefix.
-	  workaround of a bug of VC12 ml, by unak at [ruby-core:67792].
-	  [ruby-core:67789] [Bug #10780]
-
-Sat Jan 24 19:56:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dln_find.c (dln_find_1): search regular files only.  based on
-	  the patch by Alex Coomans in [ruby-core:67766].  [Bug #10776]
-
-Fri Jan 23 23:57:05 2015  Misumi Rize  <r@ayase-e.li>
-
-	* vm_insnhelper.c (vm_throw_start): search the target to break
-	  from a block with nested rescue, from the nested blocks.
-	  [ruby-core:67765] [Bug #10775] [Fix GH-820]
-
-Fri Jan 23 20:00:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (w_object, marshal_dump): use identity tables for
-	  arbitrary VALUE keys, because of performance of FLONUM.
-	  [Bug #10761]
-
-	* marshal.c (obj_alloc_by_klass, marshal_load): ditto.
-
-Fri Jan 23 17:12:33 2015  Eric Wong  <e@80x24.org>
-
-	* benchmark/bm_marshal_dump_flo.rb: new benchmark for [Bug #10761]
-
-Thu Jan 22 18:03:19 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (find_svn_log): use double quotes instead
-	  of single quotes because cmd.exe doesn't handle them.
-
-	* tool/redmine-backporter.rb (done): the 2nd element of matched data
-	  is the offset of the end of matched string, not length.
-
-Thu Jan 22 16:45:24 2015  Eric Wong  <e@80x24.org>
-
-	* st.c (st_numhash): mix float value for flonum
-	* hash.c (rb_any_hash): ditto
-	* benchmark/bm_hash_aref_flo.rb: new benchmark
-	* benchmark/bm_hash_ident_flo.rb: ditto
-	  [Bug #10761]
-
-Wed Jan 21 22:33:51 2015  Akinori MUSHA  <knu@iDaemons.org>
-
-	* misc/ruby-electric.el: Import version 2.2.1 from
-	  https://github.com/knu/ruby-electric.el.  Improve compatibility
-	  with and optimize for Emacs 24.4.
-
-Wed Jan 21 09:40:52 2015  Zachary Scott  <e@zzak.io>
-
-	* file.c: Document other cases of missing birthtime on OS with patch
-	  provided by @sho-h similar to GH-817. [ci skip] [DOC]
-
-Wed Jan 21 09:09:19 2015  Tanaka Akira  <akr@fsij.org>
-
-	* NEWS: References to tickets added.
-	  [ruby-core:67701] [Bug #10760] Suggested by Zachary Scott.
-
-Tue Jan 20 22:59:54 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/vcs.rb: fix the exception given remote-url of svn.
-
-Tue Jan 20 12:58:33 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: now can change the page of `ls`.
-
-Tue Jan 20 12:28:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (readline): fallback to normal gets on
-	  Windows because IO.console.getch is not always do as expected.
-
-Tue Jan 20 11:31:07 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: update usage.
-
-Tue Jan 20 11:23:47 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (mygets): to support Backspace
-	  implement gets by itself.
-
-Tue Jan 20 02:54:11 2015  Zachary Scott  <e@zzak.io>
-
-	* file.c: NotImplementedError is raised if birthtime is unavailable.
-	  Patch by @y-yagi san and [Fixes GH-817] [ci skip] [DOC]
-
-	* ext/pathname/pathname.c: ditto.
-
-Mon Jan 19 22:08:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* class.c (include_modules_at): allow prepend each modules upto
-	  once for each classes.  [EXPERIMENTAL]
-
-Sun Jan 18 18:32:20 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* math.c (math_atan2): revive documentation before r49220.
-	  http://d.hatena.ne.jp/nagachika/20150112/ruby_trunk_changes_49213_49226
-
-Sun Jan 18 15:57:32 2015  Seiei Higa  <hanachin@gmail.com>
-
-	* vm_method.c (check_definition): Module#public_method_defined?,
-	  Module#private_method_defined?, Module#protected_method_defined?
-	  should not use refinements. [ruby-core:67656] [Bug #10753]
-
-Sun Jan 18 15:50:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_dump.c (rb_vm_bugreport): check by configured result instead
-	  of system name for old FreeBSD.  based on a patch by Steve Wills
-	  at [ruby-core:67655].  [Bug #10752]
-
-Sun Jan 18 12:56:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in (VPATH, NEWLINE_C), common.mk (common-srcs): make
-	  and use newline.c under enc/trans directory, not toplevel.  no
-	  longer search enc directory implicitly.
-
-	* configure.in, enc/Makefile.in (BUILTIN_ENCS, BUILTIN_TRANSES):
-	  prefix respective directory names to builtin encodings and
-	  transcoder source names.
-
-Sun Jan 18 11:49:46 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (ole_invoke): avoid SEGV when VT_RECORD
-	  variable is passed by reference. [ruby-dev:48803] [Bug #10697]
-
-Sat Jan 17 23:59:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb (visit_String):
-	  anchors like `\Z` are not valid inside character class.  use
-	  negative-lookahead instead.
-	  Fixes: https://github.com/tenderlove/psych/issues/221
-
-Sat Jan 17 23:42:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in: get rid of pattern substitution, which is not
-	  supported by ash, and ash on NetBSD parses whole source first
-	  and fails to start.  [ruby-dev:48823] [Bug #10750]
-
-Fri Jan 16 18:42:58 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: support adding related revisions
-	  to issues.
-
-Fri Jan 16 17:20:33 2015  Koichi Sasada  <ko1@atdot.net>
-
-	vm.c, vm_core.h: constify VM_CF_LEP, VM_CF_PREV_EP, VM_CF_BLOCK_PTR
-	and rb_vm_control_frame_block_ptr.
-
-Fri Jan 16 15:41:21 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych.rb: bump version
-
-	* ext/psych/psych.gemspec: ditto
-
-Fri Jan 16 15:37:49 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: only dump hash
-	  subclasses. Thanks Joe Eli McIlvain <joe.eli.mac@gmail.com>
-
-	* test/psych/test_hash.rb: test for change
-
-Fri Jan 16 15:35:21 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych.rb: bump version
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: fix line width wrapping
-	  for long strings.  Thanks Jakub Jirutka <jakub@jirutka.cz>
-
-	* test/psych/test_string.rb: test for change
-
-Fri Jan 16 11:44:44 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
-
-	* eval_intern.h, vm.c, vm_eval.c, vm_insnhelper.c:
-	  change throw mechanism (not save target ep, but save target cfp).
-	  It fixes `unexpected break' bug that occurs when
-	  TracePoint#binding is called.
-	  [ruby-dev:48797] [Bug #10689]
-
-	* test/ruby/test_settracefunc.rb: add a test.
-
-Thu Jan 15 23:55:15 2015  Tanaka Akira  <akr@fsij.org>
-
-	* io.c (rb_io_close_m): Don't raise when the IO object is closed.
-	  [ruby-core:67444] [Feature #10718]
-
-Thu Jan 15 21:34:57 2015  Seiei Higa  <hanachin@gmail.com>
-
-	* proc.c (rb_obj_singleton_method): Kernel#singleton_method should
-	  not use refinements, as well as Kernel#method.
-	  [ruby-core:67603] [Bug #10744]
-
-Thu Jan 15 10:45:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_select_bang, ary_reject_bang): linear
-	  performance.  [ruby-core:67418] [Feature #10714]
-
-Wed Jan 14 18:06:06 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
-
-	* lib/uri/mailto.rb: raising URI::InvalidComponentError instead
-	  of failing with undefined method `split' for nil:NilClass for
-	  mailto: URIs without opaque part. [Bug #10738]
-	* test/uri/testuri.rb: Test for above
-
-Wed Jan 14 16:45:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/downloader.rb (RubyGems.download): verify downloaded gem
-	  packages.  LowSecurity to allow untrusted certificates now.
-
-Wed Jan 14 15:43:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/readline/readline.c (readline_s_refresh_line): initialize
-	  before rl_refresh_line(), as some function make the internal
-	  state non-clean but rl_refresh_line() does not re-initialize it.
-	  [ruby-core:43957] [Bug #6232]
-
-Tue Jan 13 21:59:24 2015  Michal Papis  <mpapis@gmail.com>
-
-	* tool/rbinstall.rb (gem): fix changing permissions of installed
-	  bundled gems.  [Fix GH-812]
-
-Tue Jan 13 21:57:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk (distclean-local): remove autom4te.cache generated by
-	  autoconf.
-
-	* common.mk (realclean-local): remove id sources and dummy header
-	  for dtrace.  [ruby-core:67562] [Bug #10737]
-
-Tue Jan 13 21:08:22 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json, test/json: merge JSON HEAD(259dee6)
-	  separate implementation of Typed_Data macro.
-	  https://github.com/flori/json/compare/v1.8.1...v1.8.2
-
-Tue Jan 13 14:16:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/net/http/test_http.rb: get rid of accessing DNS actually
-	  for some servers returning wrong results.
-	  [ruby-core:67454] [Bug #10721]
-
-Mon Jan 12 23:21:57 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* gems/bundled_gems: update test-unit to 3.0.9.
-
-Mon Jan 12 18:35:44 2015  Eric Wong  <e@80x24.org>
-
-	* numeric.c (bit_coerce): use original value for error message
-	  [ruby-core:67405] [Bug #10711]
-	* test/ruby/test_numeric.rb (test_coerce): check error message
-
-Mon Jan 12 18:01:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rdoc/text.rb (expand_tabs): get rid of infinite loop with
-	  CR.  should check if substitution occurred too.
-	  [ruby-dev:48813] [Bug #10732]
-
-Mon Jan 12 16:45:46 2015  Seiei Higa  <hanachin@gmail.com>
-
-	* vm_method.c (rb_alias): raise a NameError when creating alias to
-	  a refined method if the original method of the refined method is
-	  not defined.  [ruby-core:67523] [Bug #10731]
-
-Mon Jan 12 13:53:17 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* math.c (math_atan2): improve documentation.
-	  [Feature #10323][ruby-core:65400][ci skip]
-
-Mon Jan 12 13:50:49 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/bigdecimal/bigdecimal.c: fixes documentation like labeled lists,
-	  code examples etc. [ruby-core:66730][Bug #10576][ci skip]
-
-Mon Jan 12 13:36:44 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/optparse.rb: improvements for OptionParser documentation.
-	  [misc #10608][ruby-core:66901][ci skip]
-
-Mon Jan 12 13:33:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* array.c (rb_ary_each): documented return value.
-	  [misc #10469][ruby-core:66063]
-
-Sun Jan 11 15:11:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/webrick/test_utils.rb (test_create_listeners): use
-	  dynamically chosen port number, not hardcoded port number.
-	  [ruby-core:67508]
-
-Sat Jan 10 12:57:12 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/zlib/zlib.c: fix document of method signatures.
-	  [Bug #10668][ruby-core:67186][ci skip]
-
-Sat Jan 10 12:32:44 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* eval_error.c (error_print): pos and len parameters of rb_str_substr()
-	  are counted by characters, not bytes.  use rb_str_subseq() instead.
-	  [Bug #10727] [ruby-core:67473]
-
-Sat Jan 10 10:58:55 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* complex.c: removed commented-out code.
-
-Sat Jan 10 10:57:19 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* rational.c: removed commented-out code.
-	  [Feature #10376][ruby-core:65643]
-
-Sat Jan 10 10:12:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_select_bang): keep the array consistent by
-	  removing unselected values soon.  [ruby-dev:48805] [Bug #10722]
-
-Fri Jan  9 23:20:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems:  Update to RubyGems HEAD(e53c54a).
-	* test/rubygems:  ditto.
-
-Fri Jan  9 11:13:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (assocs, assoc): eliminate splatting empty literal
-	  hashes.  [ruby-core:67446] [Bug #10719]
-
-	* compile.c (compile_array_): support splatted hash in hash type.
-
-Fri Jan  9 10:57:09 2015  Vit Ondruch  <vondruch@redhat.com>
-
-	* configure.in (RUBY_SETJMP_TYPE): Remove superfluous semicolon
-	  which causes a syntax error with autoconf 2.63.
-	  [ruby-core:67429] [Bug #10716]
-
-Fri Jan  9 07:23:32 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: correctly quote non-ascii
-	  letters. Thanks @jirutka for the patch.
-
-	* test/psych/test_string.rb: test for change
-
-Fri Jan  9 07:13:55 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/to_ruby.rb: call `allocate` on hash
-	  subclasses.  Fixes github.com/tenderlove/psych/issues/196
-
-	* test/psych/test_hash.rb: test for change
-
-Fri Jan  9 06:58:43 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/to_ruby.rb: revive hashes with ivars
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: dump hashes with ivars.
-	  Fixes github.com/psych/issues/43
-
-	* test/psych/test_hash.rb: test for change
-
-Thu Jan  8 17:05:00 2015  Seiei Higa  <hanachin@gmail.com>
-
-	* vm_method.c (rb_method_entry): if no super class, no original
-	  method entry.  [ruby-core:67389] [Bug #10707]
-
-Thu Jan  8 16:31:43 2015  Seiei Higa  <hanachin@gmail.com>
-
-	* vm_method.c (rb_export_method): bail out if the original method
-	  is undefined when the method is refined.
-	  [ruby-core:67387] [Bug #10706]
-
-Thu Jan  8 12:53:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): match in case-folding only if the directory
-	  resides on a case-insensitive file system, on OSX.
-	  [ruby-core:67364] [Bug #10700]
-
-Thu Jan  8 11:39:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .travis.yml: Remove redundant configuration option.
-	  [fix GH-809] Patch by @gxworld
-
-Thu Jan  8 07:17:14 2015  Eric Wong  <e@80x24.org>
-
-	* lib/resolv.rb: consider ENETUNREACH as ResolvTimeout
-	  [ruby-core:67411] [Bug #10712]
-
-Thu Jan  8 00:13:52 2015  Tanaka Akira  <akr@fsij.org>
-
-	* lib/open3.rb: Open3 properly passes non-keyword hash args to spawn.
-	  Fixed by Josh Cheek.  [Fix GH-808]
-	  Related to [ruby-core:67347] [Bug #10699]
-
-Wed Jan  7 19:19:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (dir_initialize): workaround of opendir failure at symlink
-	  directories on Windows via CIFS.
-
-Wed Jan  7 18:52:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (need_normalization): not only HFS+, CIFS (SMB) is also
-	  decomposed.  [Bug #10704]
-
-	* dir.c (NORMALIZE_UTF8PATH): Unicode decomposition seems to
-	  perform in an upper layer than file systems on OSX, as all path
-	  names are always decomposed regardless of file system types.
-
-Tue Jan  6 21:41:04 2015  Tanaka Akira  <akr@fsij.org>
-
-	* time.c (timelocalw): Set tm_isdst field -1 if vtm->isdst is
-	  VTM_ISDST_INITVAL.  This bug is introduced at packing struct
-	  vtm (r45155).
-	  [ruby-core:67345] [Bug #10698] Reported by Boris Ruf.
-
-Tue Jan  6 03:10:54 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/fiddle/test_handle.rb: fix syntax.
-
-Tue Jan  6 00:16:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/fiddle/test_handle.rb (test_NEXT): use -test-/dln/empty
-	  which is always a shared object and is not used by others.
-	  [ruby-dev:48629] [Bug #10384]
-
-Mon Jan  5 14:58:01 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* test/ruby/test_io.rb: added timeout for AIX environment.
-	  [ruby-core:62983][Bug #9917]
-
-Sun Jan  4 22:33:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/lib/test/unit.rb (ExcludesOption): add "excludes" support
-	  to test suite, for alternative implementations and platforms.
-	  [Feature #10682]
-
-Sun Jan  4 22:32:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/lib/test/unit.rb (Test::Unit): reorder modules and merge
-	  each modules.
-
-	* test/lib/test/unit.rb (Test::Unit): split the large class into
-	  each modules.
-
-Sun Jan  4 21:32:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (f_label): return tLABEL value as it is.
-	  [ruby-core:67315] [Bug #10693]
-
-Sun Jan  4 14:02:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/lib/test/unit/parallel.rb (run): expand the file name to be
-	  loaded, so that relative paths work in parallel mode.
-
-Sun Jan  4 13:36:56 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
-
-	* test/test_tempfile.rb: use assert_file for more descriptive message.
-	  following r49131.
-
-Sun Jan  4 13:05:09 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
-
-	* string.c: improve docs for String#<=>. [ruby-core:65399][Feature #10322]
-	  Patch by gogo tanaka.
-
-Sun Jan  4 12:42:24 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
-
-	* array.c: improve docs for Array#reject. [ruby-core:65324][misc #10307]
-	  Patched by Nebu Pookins.
-
-Sun Jan  4 12:24:11 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
-
-	* string.c: improve docs for String#strip and variations.
-	  [ruby-core:66081][Bug #10476]
-
-Sun Jan  4 09:21:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/drb/drb.rb: removed unused argument. Patch by @vipulnsward
-	  [fix GH-515]
-
-Sun Jan  4 09:18:31 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/tempfile.rb: provide default basename parameter.
-	  [fix GH-523] Patch by @dissolved
-	* test/test_tempfile.rb: ditto.
-
-Sun Jan  4 00:43:41 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
-
-	* README.ja.md: add guidance of mailing list and bugs.r-l.o.
-
-Sat Jan  3 23:56:28 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
-
-	* hash.c: fix docs for Hash#invert. [ruby-core:66917] [Bug #10612]
-
-Sat Jan  3 19:52:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/intern.h (rb_str_new_literal): define on all
-	  platforms, not only gcc.
-
-Sat Jan  3 18:53:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/fiddle/lib/fiddle/cparser.rb (parse_ctype): limit split word
-	  number as the rest are not used.
-
-Sat Jan  3 18:19:50 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/fiddle/lib/fiddle/cparser.rb: r49110 broke Fiddle::Import with
-	  type_alias.
-	* test/fiddle/test_cparser.rb: added type_alias test for parse_ctype
-	  and parse_struct_signature.
-
-Sat Jan  3 11:50:16 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/openssl/ossl.h: avoid to build failure of Windows environment.
-	* ext/openssl/ossl_ssl_session.c: ditto.
-
-Sat Jan  3 11:27:46 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* array.c: Improve performance of Array#shift. use shared instead of
-	  MEMMOVE if with arguments. Patch by @ksss [fix GH-537]
-	* test/ruby/test_array.rb: ditto.
-	* benchmark/bm_array_shift.rb: Added benchmark of GH-537 issue.
-
-Sat Jan  3 10:38:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/net/http.rb: More descriptive error message when net/http fails
-	  to connect to a server. Patch by @xaviershay [fix GH-700]
-	* test/net/http/test_http.rb: ditto.
-
-Sat Jan  3 10:14:51 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/openssl/ossl.h: Make `SSL_SESSION_cmp` use `CRYPTO_memcmp`
-	  [fix GH-591] Patch by @PiPeep
-	* ext/openssl/ossl_ssl_session.c: ditto.
-
-Sat Jan  3 09:54:32 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/fiddle/lib/fiddle/cparser.rb: Support for Fiddle::CParser
-	  to handle rich signatures including parameter names and function
-	  pointer types. Patch by @theryan [fix GH-590]
-	* test/fiddle/test_cparser.rb: ditto.
-
-Sat Jan  3 09:01:43 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* NEWS: added compatibility entry of r49101.
-
-Fri Jan  2 21:06:59 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/net/http.rb (Net::HTTP#send_request): there is no response body
-	  with HEAD request. Patch by @rodrigosaito [fix GH-520]
-
-Fri Jan  2 21:04:36 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* test/net/http/test_http.rb (_test_send_request__HEAD): Added
-	  failing test for send_request with HEAD method.
-
-Fri Jan  2 18:41:20 2015  Tanaka Akira  <akr@fsij.org>
-
-	* eval.c (ruby_init): Print ruby_setup() error only in debug mode.
-	  Unsuppressable error message is not a good idea.
-	  Note that the message is printed sometimes with following
-	  code (highly timing dependent, though):
-	  pid = spawn("ruby -e ''"); Process.kill(:TERM, pid)
-
-Fri Jan  2 16:18:44 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* test/ruby/test_module.rb: Refactor invalid testcase.
-	  [fix GH-472][ruby-core:59035][Bug #9240]
-
-Fri Jan  2 15:53:00 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/webrick/utils.rb: removed unused argument variable.
-	  [fix GH-356] Patch by @vipulnsward
-	* lib/webrick/server.rb: ditto.
-	* lib/webrick/ssl.rb: ditto.
-	* test/webrick/test_utils.rb: added test for WEBrick::Utils#create_listeners.
-
-Fri Jan  2 15:35:53 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/securerandom.rb: improve syntax and grammar of documentation.
-	  [fix GH-796][ci skip] Patch by @Erol
-
-Fri Jan  2 15:10:01 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* test/openssl/test_ssl_session.rb (OpenSSL#test_ctx_client_session_cb):
-	  fix test failure with OpenSSL disabled SSLv3 protocol.
-	  [ruby-core:63772] [Bug #10046]
-
-Fri Jan  2 09:08:31 2015  Tanaka Akira  <akr@fsij.org>
-
-	* lib/resolv.rb (Resolv::DNS::Label::Str#==): Check class equality.
-	  (Resolv::DNS::Name#initialize): Normalize labels as
-	  Resolv::DNS::Label::Str objects.
-
-Thu Jan  1 21:41:49 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/regexp.rdoc: fix regexp docs for whitespace character.
-	  [ruby-dev:48765] [Bug #10624]
-
-Thu Jan  1 17:50:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/ruby/test_rubyoptions.rb: try locale encoding name.
-	  [ruby-core:67109] [Bug #10643]
-
-Thu Jan  1 11:07:12 2015  Eric Wong  <e@80x24.org>
-
-	* symbol.c (rb_gc_free_dsymbol): delete from global fstr hash
-	* test/ruby/test_symbol.rb (test_symbol_fstr_leak): test for bug
-	  [ruby-core:67268] [Bug #10686]
-
-Thu Jan  1 09:14:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_args.c (keyword_hash_p): fix non-symbol keys hash.
-	  rb_extract_keywords() returns 0 not Qnil when no symbol keys is
-	  included.  [ruby-core:67264] [Bug #10685]
-
-Wed Dec 31 17:48:43 2014  Tanaka Akira  <akr@fsij.org>
-
-	* lib/resolv.rb (Resolv::DNS::Label::Str#initialize): Set encoding
-	  ASCII-8BIT before downcase.  case insensitivity of DNS labels doesn't
-	  apply non-ASCII characters.  [RFC 4343]
-
-Wed Dec 31 16:48:44 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (gettable_gen): disable warnings of possible reference
-	  to a local variable defined in a past scope.
-	  [ruby-core:67162] [Bug #10661]
-
-Wed Dec 31 13:43:48 2014  Tanaka Akira  <akr@fsij.org>
-
-	* lib/resolv.rb (Resolv::DNS::Name#==): Compare an array of Label:Str
-	  objects.  Label#Str#== is case-insensitive.
-
-Tue Dec 30 16:16:12 2014  Ben Miller  <bmiller@rackspace.com>
-
-	* lib/resolv.rb (Resolv::DNS::Name#==): DNS is case-insensitive, so the
-	  comparison should be case-insensitive as well.
-	  [ruby-core:66498] [Bug #10550]
-
-Tue Dec 30 16:03:45 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/resolv.rb (Resolv::DNS::Name): names with different dots
-	  should be different.
-
-Tue Dec 30 13:16:56 2014  Martin Duerst  <bernhard+git@lsmod.de>
-
-	* lib/uri/common.rb: Initialize HTML5ASCIIINCOMPAT to empty Array
-	  to avoid error during bootstrap when encodings are not yet defined.
-	  [Bug #10678]
-
-Tue Dec 30 09:29:26 2014  Bernhard M. Wiedemann  <bernhard+git@lsmod.de>
-
-	* ext/dbm/dbm.c (Init_dbm): [DOC] as UNIX permissions are octal
-	  numbers, needs to be prefixed by 0.  [Fix GH-800]
-
-Tue Dec 30 08:57:39 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/unicode_normalize.rb: typo fix. [ci skip]
-	  [ruby-dev:48794][misc #10675]
-
-Mon Dec 29 19:38:01 2014  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* version.h (RUBY_VERSION): 2.3.0 development has started.
-
-Mon Dec 29 18:58:46 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* re.c (unescape_nonascii): append escape sequence as-is not
-	  unescaped character, to get rid of unexpected meta-character.
-	  [ruby-core:67193] [Bug #10670]
-
-Mon Dec 29 14:27:33 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* doc/syntax/literals.rdoc (Symbols): now Symbols created by
-	  interpolation can be garbage collected.  patch by Yihang Ho in
-	  [ruby-core:67194].  [Bug #10671]
-
-Mon Dec 29 11:18:17 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* thread.c (rb_thread_variable_get): fix dynamic symbol keys.
-	  rb_check_id() returns non-zero only for static symbols, whereas
-	  thread local variable keys can be dynamic symbols.
-	  [ruby-core:67185] [Bug #10667]
-
-Mon Dec 29 10:37:27 2014  Thiago Lewin  <thiago_lewin@yahoo.com.br>
-
-	* io.c (rb_f_select): [DOC] workaround for YARD doc.  [Fix GH-799]
-
-	* process.c (proc_detach): [DOC] fix missing closing parenthesis.
-	  [Fix GH-799]
-
-Mon Dec 29 07:27:23 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json, test/json: merge JSON HEAD(17fe8e7)
-	  https://github.com/flori/json/compare/v1.8.1...17fe8e7
-
-Sun Dec 28 23:49:37 2014  Michal Papis  <mpapis@gmail.com>
-
-	* rbinstall.rb: fix target location for installing bundled gems.
-	  install to the prepared directory instead of default Gem.dir,
-	  not to be affected GEM_HOME environment variable.  [Fix GH-798]
-
-Sun Dec 28 18:19:28 2014  Eric Wong  <e@80x24.org>
-
-	* test/-ext-/iseq_load/test_iseq_load.rb
-	  (test_next_in_block_in_block): test using ISeq#eval
-	  (test_break_ensure): ditto
-	  [ruby-core:66988]
-
-Sun Dec 28 16:25:12 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* cygwin/GNUmakefile.in (EXTOBJS): override to add resource files
-	  always.  [ruby-core:67153] [Bug #10657]
-
-Sun Dec 28 13:54:26 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (f_kwrest, new_args_tail_gen): unnamed rest keyword and
-	  keywords bits arguments should be unique.  since internal IDs
-	  depend on the local variable index in the current scope, new ID
-	  should be made before popping those vtables.
-	  [ruby-core:67157] [Bug #10659]
-
-Sat Dec 27 20:12:55 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/json/generator/generator.c (JSON_Generator_State_type): add
-	  #ifdef for backward compatibility.
-
-	* ext/json/parser/parser.rl (JSON_Parser_type): ditto.
-
-	* ext/json/generator/generator.h (ZALLOC): add fallback definition.
-
-	* ext/json/parser/parser.h (ZALLOC): ditto.
-
-Sat Dec 27 16:54:05 2014  Tanaka Akira  <akr@fsij.org>
-
-	* process.c: Unused code removed.
-	  It seems waitpid() is universally available on POSIX platforms.
-
-Sat Dec 27 15:08:27 2014  Eric Wong  <e@80x24.org>
-
-	* vm_core.h (rb_vm_living_threads_insert): preserve order
-	  [Bug #10660] [ruby-core:67154] [ruby-core:67159]
-
-Sat Dec 27 13:08:20 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/socket/socket.c: improved document for YARD doc.
-	  [fix GH-795][ci skip] Patch by @tlewin
-
-Sat Dec 27 10:11:21 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/tk/lib/tkextlib/tcllib/plotchart.rb: fix to invoke correct function
-	  of tcllib. Patch by @zalt50 [fix GH-787]
-
-Sat Dec 27 10:03:41 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/make-snapshot: show sha1 digest when making packages.
-	  it's request from https://github.com/ruby/www.ruby-lang.org/issues/921
-	  [fix GH-794]
-
-Fri Dec 26 15:32:16 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/tk/tcltklib.c (ip_invoke_core): remove probably duplicate
-	  dead code.
-
-Fri Dec 26 15:28:27 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/tk/tcltklib.c (ip_ruby_cmd_receiver_const_get): simply use
-	  rb_path2class() to get a class/module from its name.
-
-Fri Dec 26 15:20:54 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (w_long): append at once by w_nbyte() instead of
-	  appending byte by byte.
-
-Fri Dec 26 15:13:13 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/json/parser/parser.rl (unescape_unicode): check if valid
-	  before bit-or assignments.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
-
-	* ext/nkf/nkf-utf8/nkf.c (nkf_iconv_t): fix a missing semicolon.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
-
-	* process.c (rb_spawn_process): get rid of usage of uninitialized
-	  variable.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
-
-	* regexec.c (match_at): ditto.
-
-	* ext/win32ole/win32ole.c (ole_wc2mb_alloc, ole_vstr2wc, ole_mb2wc):
-	  ditto.
-
-	* dir.c (ruby_glob0): no need to check never-NULL pointer.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
-
-	* win32/file.c (rb_file_expand_path_internal): ditto.
-
-	* win32/file.c (code_page_i): handle realloc failure.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
-
-	* win32/stub.c (stub_sysinit): ditto.
-
-	* fix printf format conversion specifiers.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
-
-Fri Dec 26 01:41:40 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/rbinstall.rb: skip installing bundle gems if zlib is unavailable.
-	  [Bug #10647] [ruby-dev:48787]
-
-Fri Dec 26 01:24:42 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/downloader.rb: support old versions of ruby.
-
-	* tool/downloader.rb: now can download gems by http if openssl is not
-	  available (this may be danger!)
-
-Fri Dec 26 00:13:48 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_extlibs.rb: check existence of extension libraries
-	  which not depend on outer libraries. (experimental)
-
-Thu Dec 25 21:58:15 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/fiddle/extconf.rb: make PIC objects if it will be linked as
-	  a shared object eventually.  [ruby-core:67128]
-
-Thu Dec 25 19:01:13 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/fiddle/win32/libffi-3.2.1-mswin.patch: support mswin32.
-
-Thu Dec 25 17:30:40 2014  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* gc.c (wmap_final_func): fix memory size shortage when realloc wmap.
-	  Fix SEGV during finalize of WeakRef on Solaris (though the SEGV
-	  could occur on all OS/platforms). [ruby-dev:48779] [Bug #10646]
-
-Thu Dec 25 17:27:06 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (NET_LUID): include winsock2.h instead of windows.h.
-	  patch by Jon Forums in [ruby-core:67125].  [Bug #10640]
-
-Thu Dec 25 16:14:10 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/io/console/console.c (console_dev): send the given arguments
-	  to the opened console.  as a special case, do nothing if :close
-	  is given.
-
-	* test/lib/leakchecker.rb (LeakChecker#check_fd_leak): close if
-	  console.
-
-For the changes before 2.2.0, see doc/ChangeLog-2.2.0
-For the changes before 2.1.0, see doc/ChangeLog-2.1.0
-For the changes before 2.0.0, see doc/ChangeLog-2.0.0
-For the changes before 1.9.3, see doc/ChangeLog-1.9.3
-For the changes before 1.8.0, see doc/ChangeLog-1.8.0
-
-Local variables:
-coding: us-ascii
-add-log-time-format: (lambda ()
-  (let* ((time (current-time))
-	 (system-time-locale "C")
-	 (diff (+ (cadr time) 32400))
-	 (lo (% diff 65536))
-	 (hi (+ (car time) (/ diff 65536))))
-  (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
-indent-tabs-mode: t
-tab-width: 8
-change-log-indent-text: 2
-end:
-vim: tabstop=8 shiftwidth=2
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
index b97a08d928..35a8e75876 100644
--- a/KNOWNBUGS.rb
+++ b/KNOWNBUGS.rb
@@ -1,5 +1,7 @@
 #
-# This test file concludes tests which point out known bugs.
+# IMPORTANT: Always keep the first 7 lines (comments),
+# even if this file is otherwise empty.
+#
+# This test file includes tests which point out known bugs.
 # So all tests will cause failure.
 #
-
diff --git a/LEGAL b/LEGAL
index 24e36e6231..2777aa2c14 100644
--- a/LEGAL
+++ b/LEGAL
@@ -1,116 +1,331 @@
-LEGAL NOTICE INFORMATION
-------------------------
+# -*- rdoc -*-
+
+= LEGAL NOTICE INFORMATION
+--------------------------
 
 All the files in this distribution are covered under either the Ruby's
 license (see the file COPYING) or public-domain except some files
 mentioned below.
 
-ccan/build_assert/build_assert.h
-ccan/check_type/check_type.h
-ccan/container_of/container_of.h
-ccan/str/str.h
+[addr2line.c]
 
-  These files are licensed under the CC0.
+  A part of this file is from FreeBSD.
 
-    http://creativecommons.org/choose/zero/
+  >>>
+    Copyright (c) 1986, 1988, 1991, 1993::
+    The Regents of the University of California.  All rights reserved.
 
-ccan/list/list.h
+    (c) UNIX System Laboratories, Inc.
 
-  This file is licensed under the MIT License.
+    All or some portions of this file are derived from material licensed
+    to the University of California by American Telephone and Telegraph
+    Co. or Unix System Laboratories, Inc. and are reproduced herein with
+    the permission of UNIX System Laboratories, Inc.
 
-    Permission is hereby granted, free of charge, to any person obtaining a copy
-    of this software and associated documentation files (the "Software"), to deal
-    in the Software without restriction, including without limitation the rights
-    to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
-    copies of the Software, and to permit persons to whom the Software is
-    furnished to do so, subject to the following conditions:
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    4. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
 
-    The above copyright notice and this permission notice shall be included in
-    all copies or substantial portions of the Software.
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
 
-    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
-    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
-    THE SOFTWARE.
-
-include/ruby/oniguruma.h:
-regcomp.c:
-regenc.[ch]:
-regerror.c:
-regexec.c:
-regint.h:
-regparse.[ch]:
-enc/ascii.c
-enc/big5.c
-enc/cp949.c
-enc/emacs_mule.c
-enc/encdb.c
-enc/euc_jp.c
-enc/euc_kr.c
-enc/euc_tw.c
-enc/gb18030.c
-enc/gb2312.c
-enc/gbk.c
-enc/iso_8859_1.c
-enc/iso_8859_10.c
-enc/iso_8859_11.c
-enc/iso_8859_13.c
-enc/iso_8859_14.c
-enc/iso_8859_15.c
-enc/iso_8859_16.c
-enc/iso_8859_2.c
-enc/iso_8859_3.c
-enc/iso_8859_4.c
-enc/iso_8859_5.c
-enc/iso_8859_6.c
-enc/iso_8859_7.c
-enc/iso_8859_8.c
-enc/iso_8859_9.c
-enc/koi8_r.c
-enc/koi8_u.c
-enc/shift_jis.c
-enc/unicode.c
-enc/us_ascii.c
-enc/utf_16be.c
-enc/utf_16le.c
-enc/utf_32be.c
-enc/utf_32le.c
-enc/utf_8.c
-enc/windows_1251.c
-
-Oniguruma  ----   (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
-
-http://www.geocities.jp/kosako3/oniguruma/
-http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
-http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
-
-   When this software is partly used or it is distributed with Ruby,
-   this of Ruby follows the license of Ruby.
-
-configure:
+	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
+
+
+[ccan/build_assert/build_assert.h]
+[ccan/check_type/check_type.h]
+[ccan/container_of/container_of.h]
+[ccan/str/str.h]
+
+  These files are licensed under the {CC0}[https://creativecommons.org/choose/zero/].
+
+[ccan/list/list.h]
+
+  This file is licensed under the {MIT License}[rdoc-ref:@MIT+License].
+
+[coroutine]
+
+  Unless otherwise specified, these files are licensed under the
+  {MIT License}[rdoc-ref:@MIT+License].
+
+[include/ruby/onigmo.h]
+[include/ruby/oniguruma.h]
+[regcomp.c]
+[regenc.c]
+[regenc.h]
+[regerror.c]
+[regexec.c]
+[regint.h]
+[regparse.c]
+[regparse.h]
+[enc/ascii.c]
+[enc/big5.c]
+[enc/cp949.c]
+[enc/emacs_mule.c]
+[enc/encdb.c]
+[enc/euc_jp.c]
+[enc/euc_kr.c]
+[enc/euc_tw.c]
+[enc/gb18030.c]
+[enc/gb2312.c]
+[enc/gbk.c]
+[enc/iso_8859_1.c]
+[enc/iso_8859_10.c]
+[enc/iso_8859_11.c]
+[enc/iso_8859_13.c]
+[enc/iso_8859_14.c]
+[enc/iso_8859_15.c]
+[enc/iso_8859_16.c]
+[enc/iso_8859_2.c]
+[enc/iso_8859_3.c]
+[enc/iso_8859_4.c]
+[enc/iso_8859_5.c]
+[enc/iso_8859_6.c]
+[enc/iso_8859_7.c]
+[enc/iso_8859_8.c]
+[enc/iso_8859_9.c]
+[enc/koi8_r.c]
+[enc/koi8_u.c]
+[enc/shift_jis.c]
+[enc/unicode.c]
+[enc/us_ascii.c]
+[enc/utf_16be.c]
+[enc/utf_16le.c]
+[enc/utf_32be.c]
+[enc/utf_32le.c]
+[enc/utf_8.c]
+[enc/windows_1251.c]
+[enc/windows_31j.c]
+
+  Onigmo (Oniguruma-mod) LICENSE
+
+  >>>
+    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    Copyright (c) 2011-2014::  K.Takata  <kentkt AT csc DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+  Oniguruma LICENSE
+
+  >>>
+    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+  * https://github.com/k-takata/Onigmo/
+  * https://github.com/kkos/oniguruma
+  * https://svnweb.freebsd.org/ports/head/devel/oniguruma/
+
+    When this software is partly used or it is distributed with Ruby,
+    this of Ruby follows the license of Ruby.
+
+[enc/windows_1250.c]
+[enc/windows_1252.c]
+
+  >>>
+    Copyright (c) 2006-2007::  Byte      <byte AT mail DOT kna DOT ru>
+                               K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[enc/cesu_8.c]
+[enc/windows_1253.c]
+[enc/windows_1254.c]
+[enc/windows_1257.c]
+
+  >>>
+    Copyright (c) 2002-2007::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[enc/trans/GB/GB12345%UCS.src]
+[enc/trans/GB/UCS%GB12345.src]
+[enc/trans/GB/GB2312%UCS.src]
+[enc/trans/GB/UCS%GB2312.src]
+
+  These files have this explanatory texts.
+
+  >>>
+    This mapping data was created from files provided by Unicode, Inc.
+    (The Unicode Consortium). The files were used to create a product supporting
+    Unicode, as explicitly permitted in the files' copyright notices.
+    Please note that Unicode, Inc. never made any claims as to fitness of these
+    files for any particular purpose, and has ceased to publish the files many
+    years ago.
+
+[enc/trans/JIS/JISX0201-KANA%UCS.src]
+[enc/trans/JIS/JISX0208\@1990%UCS.src]
+[enc/trans/JIS/JISX0212%UCS.src]
+[enc/trans/JIS/UCS%JISX0201-KANA.src]
+[enc/trans/JIS/UCS%JISX0208@1990.src]
+[enc/trans/JIS/UCS%JISX0212.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    © 2015 Unicode®, Inc.
+
+    For terms of use, see http://www.unicode.org/terms_of_use.html
+
+[enc/trans/JIS/JISX0213-1%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-1%UCS@SIP.src]
+[enc/trans/JIS/JISX0213-2%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-2%UCS@SIP.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+    Copyright (C) 2001:: I'O, All Rights Reserved.
+    Copyright (C) 2006:: Project X0213, All Rights Reserved.
+    You can use, modify, distribute this table freely.
+
+[enc/trans/JIS/UCS@BMP%JISX0213-1.src]
+[enc/trans/JIS/UCS@BMP%JISX0213-2.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-1.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-2.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+    Copyright (C) 2001:: I'O, All Rights Reserved.
+    You can use, modify, distribute this table freely.
+
+[enc/trans/ucm/glibc-BIG5-2.3.3.ucm]
+[enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm]
+
+  >>>
+    Copyright (C) 2001-2005:: International Business Machines
+                              Corporation and others.  All Rights Reserved.
+
+[enc/trans/ucm/windows-950-2000.ucm]
+[enc/trans/ucm/windows-950_hkscs-2001.ucm]
+
+  >>>
+    Copyright (C) 2001-2002:: International Business Machines
+                              Corporation and others.  All Rights Reserved.
+
+
+[configure]
 
   This file is free software.
 
-    Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
+  >>>
+    Copyright (C) 1992-1996, 1998-2012:: Free Software Foundation, Inc.
 
     This configure script is free software; the Free Software Foundation
     gives unlimited permission to copy, distribute and modify it.
 
-tool/config.guess:
-tool/config.sub:
+[tool/config.guess]
+[tool/config.sub]
 
   As long as you distribute these files with the file configure, they
   are covered under the Ruby's license.
 
-      Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
-      Free Software Foundation, Inc.
+  >>>
+    Copyright 1992-2018:: Free Software Foundation, Inc.
 
     This file is free software; you can redistribute it and/or modify it
     under the terms of the GNU General Public License as published by
-    the Free Software Foundation; either version 2 of the License, or
+    the Free Software Foundation; either version 3 of the License, or
     (at your option) any later version.
 
     This program is distributed in the hope that it will be useful, but
@@ -119,54 +334,85 @@ tool/config.sub:
     General Public License for more details.
 
     You should have received a copy of the GNU General Public License
-    along with this program; if not, write to the Free Software
-    Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+    along with this program; if not, see <https://www.gnu.org/licenses/>.
 
     As a special exception to the GNU General Public License, if you
     distribute this file as part of a program that contains a
     configuration script generated by Autoconf, you may include it under
-    the same distribution terms that you use for the rest of that program.
-
-parse.c:
-
-  This file is licensed under the GPL, but is incorporated into Ruby and
+    the same distribution terms that you use for the rest of that
+    program.  This Exception is an additional permission under section 7
+    of the GNU General Public License, version 3 ("GPLv3").
+
+[tool/lib/test/*]
+[tool/lib/core_assertions.rb]
+
+  Some of methods on these files are based on MiniTest 4. MiniTest 4 is
+  distributed under the MIT License.
+
+  >>>
+    Copyright (c) Ryan Davis, seattle.rb
+
+    Permission is hereby granted, free of charge, to any person obtaining
+    a copy of this software and associated documentation files (the
+    'Software'), to deal in the Software without restriction, including
+    without limitation the rights to use, copy, modify, merge, publish,
+    distribute, sublicense, and/or sell copies of the Software, and to
+    permit persons to whom the Software is furnished to do so, subject to
+    the following conditions:
+
+    The above copyright notice and this permission notice shall be
+    included in all copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND,
+    EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+    MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
+    IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
+    CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
+    TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
+    SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+[parse.c]
+[parse.h]
+
+  These files are licensed under the GPL, but are incorporated into Ruby and
   redistributed under the terms of the Ruby license, as permitted by the
   exception to the GPL below.
 
-     Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
-     Free Software Foundation, Inc.
+  >>>
+    Copyright (C) 1984, 1989-1990, 2000-2015, 2018:: Free Software Foundation, Inc.
 
-     This program is free software; you can redistribute it and/or modify
-     it under the terms of the GNU General Public License as published by
-     the Free Software Foundation; either version 2, or (at your option)
-     any later version.
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
 
-     This program is distributed in the hope that it will be useful,
-     but WITHOUT ANY WARRANTY; without even the implied warranty of
-     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
-     GNU General Public License for more details.
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
 
-     You should have received a copy of the GNU General Public License
-     along with this program; if not, write to the Free Software
-     Foundation, Inc., 51 Franklin Street, Fifth Floor,
-     Boston, MA 02110-1301, USA.  */
+    You should have received a copy of the GNU General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
 
-  /* As a special exception, you may create a larger work that contains
-     part or all of the Bison parser skeleton and distribute that work
-     under terms of your choice, so long as that work isn't itself a
-     parser generator using the skeleton or a modified version thereof
-     as a parser skeleton.  Alternatively, if you modify or redistribute
-     the parser skeleton itself, you may (at your option) remove this
-     special exception, which will cause the skeleton and the resulting
-     Bison output files to be licensed under the GNU General Public
-     License without this special exception.
+    As a special exception, you may create a larger work that contains
+    part or all of the Bison parser skeleton and distribute that work
+    under terms of your choice, so long as that work isn't itself a
+    parser generator using the skeleton or a modified version thereof
+    as a parser skeleton.  Alternatively, if you modify or redistribute
+    the parser skeleton itself, you may (at your option) remove this
+    special exception, which will cause the skeleton and the resulting
+    Bison output files to be licensed under the GNU General Public
+    License without this special exception.
 
-     This special exception was added by the Free Software Foundation in
-     version 2.2 of Bison.  */
+    This special exception was added by the Free Software Foundation in
+    version 2.2 of Bison.
 
-util.c (partly):
+[missing/dtoa.c]
 
-    Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
+  This file is under these licenses.
+
+  >>>
+    Copyright (c) 1991, 2000, 2001:: by Lucent Technologies.
 
     Permission to use, copy, modify, and distribute this software for any
     purpose without fee is hereby granted, provided that this entire notice
@@ -179,71 +425,74 @@ util.c (partly):
     REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
     OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
 
-win32/win32.[ch]:
+  >>>
+    Copyright (c) 2004-2008:: David Schultz <das@FreeBSD.ORG>
+                              All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[win32/win32.c]
+[include/ruby/win32.h]
 
   You can apply the Artistic License to these files. (or GPL,
   alternatively)
 
-    Copyright (c) 1993, Intergraph Corporation
+  >>>
+    Copyright (c) 1993:: Intergraph Corporation
 
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the perl README file.
 
-util.c (partly):
-
-   Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
-   All rights reserved.
-
-   Redistribution and use in source and binary forms, with or without
-   modification, are permitted provided that the following conditions
-   are met:
-   1. Redistributions of source code must retain the above copyright
-      notice, this list of conditions and the following disclaimer.
-   2. Redistributions in binary form must reproduce the above copyright
-      notice, this list of conditions and the following disclaimer in the
-      documentation and/or other materials provided with the distribution.
-
-   THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-   ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-   IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-   ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-   FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-   DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-   OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-   HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-   LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-   OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-   SUCH DAMAGE.
-
-random.c
+[missing/mt19937.c]
 
   This file is under the new-style BSD license.
 
-    A C-program for MT19937, with initialization improved 2002/2/10.
+  >>>
+    A C-program for MT19937, with initialization improved 2002/2/10.::
     Coded by Takuji Nishimura and Makoto Matsumoto.
+
     This is a faster version by taking Shawn Cokus's optimization,
     Matthe Bellew's simplification, Isaku Wada's real version.
 
     Before using, initialize the state by using init_genrand(seed)
     or init_by_array(init_key, key_length).
 
-    Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
-    All rights reserved.
+    Copyright (C) 1997 - 2002:: Makoto Matsumoto and Takuji Nishimura,
+                                All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
     are met:
 
-      1. Redistributions of source code must retain the above copyright
-	 notice, this list of conditions and the following disclaimer.
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
 
-      2. Redistributions in binary form must reproduce the above copyright
-	 notice, this list of conditions and the following disclaimer in the
-	 documentation and/or other materials provided with the distribution.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
 
-      3. The names of its contributors may not be used to endorse or promote
-	 products derived from this software without specific prior written
-	 permission.
+    3. The names of its contributors may not be used to endorse or promote
+       products derived from this software without specific prior written
+       permission.
 
     THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
     "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
@@ -262,44 +511,15 @@ random.c
     http://www.math.keio.ac.jp/matumoto/emt.html
     email: matumoto@math.keio.ac.jp
 
-vm_dump.c:procstat_vm
-
- * Copyright (c) 2007 Robert N. M. Watson
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions
- * are met:
- * 1. Redistributions of source code must retain the above copyright
- *    notice, this list of conditions and the following disclaimer.
- * 2. Redistributions in binary form must reproduce the above copyright
- *    notice, this list of conditions and the following disclaimer in the
- *    documentation and/or other materials provided with the distribution.
- *
- * THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- * SUCH DAMAGE.
- *
- * $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
-
-vsnprintf.c:
-
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
-
-    Copyright (c) 1990, 1993
-         The Regents of the University of California.  All rights reserved.
+  The Wayback Machine url: http://web.archive.org/web/19990429082237/http://www.math.keio.ac.jp/matumoto/emt.html
 
-    This code is derived from software contributed to Berkeley by
-    Chris Torek.
+[missing/procstat_vm.c]
+
+  This file is under the new-style BSD license.
+
+  >>>
+    Copyright (c) 2007:: Robert N. M. Watson
+                         All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -309,14 +529,11 @@ vsnprintf.c:
     2. Redistributions in binary form must reproduce the above copyright
        notice, this list of conditions and the following disclaimer in the
        documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
 
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
     ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
     IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
     FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
     DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
     OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
@@ -325,146 +542,100 @@ vsnprintf.c:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-    IMPORTANT NOTE:
-    --------------
-    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
-    paragraph 3 above is now null and void.
-
-st.[ch]:
-missing/alloca.c:
-missing/dup2.c:
-missing/erf.c:
-missing/finite.c:
-missing/hypot.c:
-missing/isinf.c:
-missing/isnan.c:
-missing/lgamma_r.c:
-missing/memcmp.c:
-missing/memmove.c:
-missing/strchr.c:
-missing/strstr.c:
-missing/strtol.c:
-missing/tgamma.c:
-ext/digest/sha1/sha1.[ch]:
+    $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
+
+[vsnprintf.c]
+
+  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
+
+  >>>
+    Copyright (c) 1990, 1993::
+    The Regents of the University of California.  All rights reserved.
+
+    This code is derived from software contributed to Berkeley by
+    Chris Torek.
+
+[st.c]
+[strftime.c]
+[include/ruby/st.h]
+[missing/acosh.c]
+[missing/alloca.c]
+[missing/erf.c]
+[missing/hypot.c]
+[missing/lgamma_r.c]
+[missing/memcmp.c]
+[missing/memmove.c]
+[missing/strchr.c]
+[missing/strerror.c]
+[missing/strstr.c]
+[missing/tgamma.c]
+[ext/date/date_strftime.c]
+[ext/digest/sha1/sha1.c]
+[ext/digest/sha1/sha1.h]
 
   These files are all under public domain.
 
-missing/crypt.c:
+[missing/crypt.c]
 
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
+  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
 
-    Copyright (c) 1989, 1993
-    	The Regents of the University of California.  All rights reserved.
+  >>>
+    Copyright (c) 1989, 1993::
+    The Regents of the University of California.  All rights reserved.
 
     This code is derived from software contributed to Berkeley by
     Tom Truscott.
 
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
+[missing/setproctitle.c]
 
-missing/setproctitle.c
+  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
 
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
+  >>>
+    Copyright 2003:: Damien Miller
+    Copyright (c) 1983, 1995-1997:: Eric P. Allman
+    Copyright (c) 1988, 1993::
+    The Regents of the University of California.  All rights reserved.
 
-    Copyright 2003 Damien Miller
-    Copyright (c) 1983, 1995-1997 Eric P. Allman
-    Copyright (c) 1988, 1993
-    	The Regents of the University of California.  All rights reserved.
+[missing/strlcat.c]
+[missing/strlcpy.c]
 
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
+  These files are under an ISC-style license.
 
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
+  >>>
+    Copyright (c) 1998, 2015:: Todd C. Miller <Todd.Miller@courtesan.com>
 
-missing/strlcat.c
-missing/strlcpy.c
+    Permission to use, copy, modify, and distribute this software for any
+    purpose with or without fee is hereby granted, provided that the above
+    copyright notice and this permission notice appear in all copies.
 
-  These files are under the new-style BSD license.
+    THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
+    WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
+    MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
+    ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
+    WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
+    ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
+    OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
 
-   Copyright (c) 1998 Todd C. Miller <Todd.Miller@courtesan.com>
-   All rights reserved.
-
-   Redistribution and use in source and binary forms, with or without
-   modification, are permitted provided that the following conditions
-   are met:
-   1. Redistributions of source code must retain the above copyright
-      notice, this list of conditions and the following disclaimer.
-   2. Redistributions in binary form must reproduce the above copyright
-      notice, this list of conditions and the following disclaimer in the
-      documentation and/or other materials provided with the distribution.
-   3. The name of the author may not be used to endorse or promote products
-      derived from this software without specific prior written permission.
-
-   THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES,
-   INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY
-   AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL
-   THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
-   EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
-   PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
-   OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
-   WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
-   OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
-   ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
-
-missing/langinfo.c
+[missing/langinfo.c]
 
   This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
   Ruby uses a modified version. The file contains the following
   author/copyright notice:
 
-  Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
-  Permission to use, copy, modify, and distribute this software
-  for any purpose and without fee is hereby granted. The author
-  disclaims all warranties with regard to this software.
+  >>>
+    Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11::
+    Permission to use, copy, modify, and distribute this software
+    for any purpose and without fee is hereby granted. The author
+    disclaims all warranties with regard to this software.
 
-ext/digest/md5/md5.[ch]:
+[ext/digest/md5/md5.c]
+[ext/digest/md5/md5.h]
 
   These files are under the following license.  Ruby uses modified
   versions of them.
 
-    Copyright (C) 1999, 2000 Aladdin Enterprises.  All rights reserved.
+  >>>
+    Copyright (C) 1999, 2000:: Aladdin Enterprises.  All rights reserved.
 
     This software is provided 'as-is', without any express or implied
     warranty.  In no event will the authors be held liable for any damages
@@ -485,23 +656,27 @@ ext/digest/md5/md5.[ch]:
     L. Peter Deutsch
     ghost@aladdin.com
 
-ext/digest/rmd160/rmd160.[ch]:
+[ext/digest/rmd160/rmd160.c]
+[ext/digest/rmd160/rmd160.h]
 
   These files have the following copyright information, and by the
   author we are allowed to use it under the new-style BSD license.
 
-    AUTHOR:   Antoon Bosselaers, ESAT-COSIC
+  >>>
+    AUTHOR::  Antoon Bosselaers, ESAT-COSIC
               (Arranged for libc by Todd C. Miller)
-    DATE:     1 March 1996
+    DATE::    1 March 1996
 
-    Copyright (c) Katholieke Universiteit Leuven
+    Copyright (c):: Katholieke Universiteit Leuven
     1996, All Rights Reserved
 
-ext/digest/sha2/sha2.[ch]:
+[ext/digest/sha2/sha2.c]
+[ext/digest/sha2/sha2.h]
 
   These files are under the new-style BSD license.
 
-    Copyright 2000 Aaron D. Gifford.  All rights reserved.
+  >>>
+    Copyright 2000:: Aaron D. Gifford.  All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -527,29 +702,71 @@ ext/digest/sha2/sha2.[ch]:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-ext/nkf/nkf-utf8/config.h:
-ext/nkf/nkf-utf8/nkf.c:
-ext/nkf/nkf-utf8/utf8tbl.c:
+[ext/json/vendor/fpconv.c]
+
+  This file is under the {Boost Software License}[rdoc-ref:@Boost+Software+License+1.0].
+
+[ext/json/vendor/jeaiii-ltoa.h]
+
+  >>>
+    Copyright (c) 2024,2025 Enrico Thierbach - https://github.com/radiospiel
+    Copyright (c) 2022 James Edward Anhalt III - https://github.com/jeaiii/itoa
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[ext/json/vendor/ryu.h]
+  This file is adapted from the Ryu algorithm by Ulf Adams https://github.com/ulfjack/ryu.
+  It is dual-licensed under {Apache License 2.0}[rdoc-ref:@Apache+License+2.0] OR
+  {Boost Software License 1.0}[rdoc-ref:@Boost+Software+License+1.0].
+
+[ext/psych]
+[test/psych]
 
-  These files are under the following license.  So to speak, it is
-  copyrighted semi-public-domain software.
+  The files under these directories are under the following license.
 
-    Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
-       Everyone is permitted to do anything on this program
-       including copying, modifying, improving,
-       as long as you don't try to pretend that you wrote it.
-       i.e., the above copyright notice has to appear in all copies.
-       Binary distribution requires original version messages.
-       You don't have to ask before copying, redistribution or publishing.
-       THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+  >>>
+    Copyright 2009:: Aaron Patterson, et al.
 
-ext/socket/addrinfo.h:
-ext/socket/getaddrinfo.c:
-ext/socket/getnameinfo.c:
+    Permission is hereby granted, free of charge, to any person obtaining a copy of
+    this software and associated documentation files (the 'Software'), to deal in
+    the Software without restriction, including without limitation the rights to
+    use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+    of the Software, and to permit persons to whom the Software is furnished to do
+    so, subject to the following conditions:
+
+    The above copyright notice and this permission notice shall be included in all
+    copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+    SOFTWARE.
+
+[ext/pty/pty.c]
+
+  >>>
+    C) Copyright 1998:: by Akinori Ito.
+
+    This software may be redistributed freely for this purpose, in full
+    or in part, provided that this entire copyright notice is included
+    on any copies of this software and applications and derivations thereof.
+
+    This software is provided on an "as is" basis, without warranty of any
+    kind, either expressed or implied, as to any matter including, but not
+    limited to warranty of fitness of purpose, or merchantability, or
+    results obtained from use of this software.
+
+[ext/socket/addrinfo.h]
+[ext/socket/getaddrinfo.c]
+[ext/socket/getnameinfo.c]
 
   These files are under the new-style BSD license.
 
-    Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
+  >>>
+    Copyright (C) 1995, 1996, 1997, 1998, and 1999:: WIDE Project.
     All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
@@ -576,17 +793,508 @@ ext/socket/getnameinfo.c:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-ext/win32ole/win32ole.c:
+[ext/win32ole/win32ole.c]
 
   You can apply the Artistic License to this file. (or GPL,
   alternatively)
 
-    (c) 1995 Microsoft Corporation. All rights reserved.
+  >>>
+    (c) 1995:: Microsoft Corporation. All rights reserved.
     Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
 
-    Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
+    Other modifications Copyright (c) 1997, 1998:: by Gurusamy Sarathy
     <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
 
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the README file
     of the Perl distribution.
+
+  The Wayback Machine url: http://web.archive.org/web/19970607104352/http://www.activeware.com:80/
+
+[lib/rdoc/generator/template/darkfish/css/fonts.css]
+
+  This file is licensed under the {SIL Open Font License}[http://scripts.sil.org/OFL].
+
+[spec/mspec]
+[spec/ruby]
+
+  The files under these directories are under the following license.
+
+  >>>
+    Copyright (c) 2008:: Engine Yard, Inc. All rights reserved.
+
+    Permission is hereby granted, free of charge, to any person
+    obtaining a copy of this software and associated documentation
+    files (the "Software"), to deal in the Software without
+    restriction, including without limitation the rights to use,
+    copy, modify, merge, publish, distribute, sublicense, and/or sell
+    copies of the Software, and to permit persons to whom the
+    Software is furnished to do so, subject to the following
+    conditions:
+
+    The above copyright notice and this permission notice shall be
+    included in all copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+    EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
+    OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+    NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
+    HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
+    WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
+    FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
+    OTHER DEALINGS IN THE SOFTWARE.
+
+[lib/rubygems.rb]
+[lib/rubygems]
+[test/rubygems]
+
+  RubyGems is under the following license.
+
+  >>>
+    RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
+    Weirich and others.  You can redistribute it and/or modify it under
+    either the terms of the {MIT license}[rdoc-ref:@MIT+License], or the conditions
+    below:
+
+    1. You may make and give away verbatim copies of the source form of the
+       software without restriction, provided that you duplicate all of the
+       original copyright notices and associated disclaimers.
+
+    2. You may modify your copy of the software in any way, provided that
+       you do at least ONE of the following:
+
+       a. place your modifications in the Public Domain or otherwise
+          make them Freely Available, such as by posting said
+          modifications to Usenet or an equivalent medium, or by allowing
+          the author to include your modifications in the software.
+
+       b. use the modified software only within your corporation or
+          organization.
+
+       c. give non-standard executables non-standard names, with
+          instructions on where to get the original software distribution.
+
+       d. make other distribution arrangements with the author.
+
+    3. You may distribute the software in object code or executable
+       form, provided that you do at least ONE of the following:
+
+       a. distribute the executables and library files of the software,
+          together with instructions (in the manual page or equivalent)
+          on where to get the original distribution.
+
+       b. accompany the distribution with the machine-readable source of
+          the software.
+
+       c. give non-standard executables non-standard names, with
+          instructions on where to get the original software distribution.
+
+       d. make other distribution arrangements with the author.
+
+    4. You may modify and include the part of the software into any other
+       software (possibly commercial).
+
+    5. The scripts and library files supplied as input to or produced as
+       output from the software do not automatically fall under the
+       copyright of the software, but belong to whomever generated them,
+       and may be sold commercially, and may be aggregated with this
+       software.
+
+    6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+       IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+       WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+       PURPOSE.
+
+[lib/bundler]
+[lib/bundler.rb]
+[spec/bundler]
+
+  Bundler is under the following license.
+
+  >>>
+    Portions copyright (c) 2010:: Andre Arko
+    Portions copyright (c) 2009:: Engine Yard
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/bundler/vendor/thor]
+
+  Thor is under the following license.
+
+  >>>
+    Copyright (c) 2008 Yehuda Katz, Eric Hodel, et al.
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/rubygems/vendor/molinillo]
+
+  molinillo is under the following license.
+
+  >>>
+    Copyright (c) 2014 Samuel E. Giddins segiddins@segiddins.me
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/bundler/vendor/pub_grub]
+
+  pub_grub is under the following license.
+
+  >>>
+    Copyright (c) 2018 John Hawthorn
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/bundler/vendor/connection_pool]
+
+  connection_pool is under the following license.
+
+  >>>
+    Copyright (c) 2011 Mike Perham
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/bundler/vendor/net-http-persistent]
+
+  net-http-persistent is under the following license.
+
+  >>>
+    Copyright (c) Eric Hodel, Aaron Patterson
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/did_you_mean]
+[lib/did_you_mean.rb]
+[test/did_you_mean]
+
+  did_you_mean is under the following license.
+
+  >>>
+    Copyright (c) 2014-2016 Yuki Nishijima
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/error_highlight]
+[lib/error_highlight.rb]
+[test/error_highlight]
+
+  error_highlight is under the following license.
+
+  >>>
+    Copyright (c) 2021 Yusuke Endoh
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[benchmark/so_ackermann.rb]
+[benchmark/so_array.rb]
+[benchmark/so_binary_trees.rb]
+[benchmark/so_concatenate.rb]
+[benchmark/so_count_words.yml]
+[benchmark/so_exception.rb]
+[benchmark/so_fannkuch.rb]
+[benchmark/so_fasta.rb]
+[benchmark/so_k_nucleotide.yml]
+[benchmark/so_lists.rb]
+[benchmark/so_mandelbrot.rb]
+[benchmark/so_matrix.rb]
+[benchmark/so_meteor_contest.rb]
+[benchmark/so_nbody.rb]
+[benchmark/so_nested_loop.rb]
+[benchmark/so_nsieve.rb]
+[benchmark/so_nsieve_bits.rb]
+[benchmark/so_object.rb]
+[benchmark/so_partial_sums.rb]
+[benchmark/so_pidigits.rb]
+[benchmark/so_random.rb]
+[benchmark/so_reverse_complement.yml]
+[benchmark/so_sieve.rb]
+[benchmark/so_spectralnorm.rb]
+
+  These files are very old copy of then-called "The Great Computer Language
+  Shootout".  LEGAL SITUATION OF THESE FILES ARE UNCLEAR because the original
+  site has been lost.  Upstream diverged to delete several benchmarks listed
+  above.
+
+== MIT License
+>>>
+      Permission is hereby granted, free of charge, to any person obtaining
+      a copy of this software and associated documentation files (the
+      "Software"), to deal in the Software without restriction, including
+      without limitation the rights to use, copy, modify, merge, publish,
+      distribute, sublicense, and/or sell copies of the Software, and to
+      permit persons to whom the Software is furnished to do so, subject to
+      the following conditions:
+
+      The above copyright notice and this permission notice shall be
+      included in all copies or substantial portions of the Software.
+
+      THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+      EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+      MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+      NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
+      LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
+      OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
+      WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+== Old-style BSD license
+>>>
+      Redistribution and use in source and binary forms, with or without
+      modification, are permitted provided that the following conditions
+      are met:
+      1. Redistributions of source code must retain the above copyright
+         notice, this list of conditions and the following disclaimer.
+      2. Redistributions in binary form must reproduce the above copyright
+         notice, this list of conditions and the following disclaimer in the
+         documentation and/or other materials provided with the distribution.
+      3. Neither the name of the University nor the names of its contributors
+         may be used to endorse or promote products derived from this software
+         without specific prior written permission.
+
+      THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+      ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+      IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+      ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+      FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+      DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+      OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+      HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+      LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+      OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+      SUCH DAMAGE.
+
+      IMPORTANT NOTE::
+
+      From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+      paragraph 3 above is now null and void.
+
+== Boost Software License 1.0
+
+>>>
+      Boost Software License - Version 1.0 - August 17th, 2003
+
+      Permission is hereby granted, free of charge, to any person or organization
+      obtaining a copy of the software and accompanying documentation covered by
+      this license (the "Software") to use, reproduce, display, distribute,
+      execute, and transmit the Software, and to prepare derivative works of the
+      Software, and to permit third-parties to whom the Software is furnished to
+      do so, all subject to the following:
+
+      The copyright notices in the Software and this entire statement, including
+      the above license grant, this restriction and the following disclaimer,
+      must be included in all copies of the Software, in whole or in part, and
+      all derivative works of the Software, unless such copies or derivative
+      works are solely in the form of machine-executable object code generated by
+      a source language processor.
+
+      THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+      IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+      FITNESS FOR A PARTICULAR PURPOSE, TITLE AND NON-INFRINGEMENT. IN NO EVENT
+      SHALL THE COPYRIGHT HOLDERS OR ANYONE DISTRIBUTING THE SOFTWARE BE LIABLE
+      FOR ANY DAMAGES OR OTHER LIABILITY, WHETHER IN CONTRACT, TORT OR OTHERWISE,
+      ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
+      DEALINGS IN THE SOFTWARE.
+
+== Apache License 2.0
+
+>>>
+      Apache License
+      Version 2.0, January 2004
+      http://www.apache.org/licenses/
+
+      TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION
+
+      1. Definitions.
+
+         "License" shall mean the terms and conditions for use, reproduction,
+         and distribution as defined by Sections 1 through 9 of this document.
+
+         "Licensor" shall mean the copyright owner or entity authorized by
+         the copyright owner that is granting the License.
+
+         "Legal Entity" shall mean the union of the acting entity and all
+         other entities that control, are controlled by, or are under common
+         control with that entity. For the purposes of this definition,
+         "control" means (i) the power, direct or indirect, to cause the
+         direction or management of such entity, whether by contract or
+         otherwise, or (ii) ownership of fifty percent (50%) or more of the
+         outstanding shares, or (iii) beneficial ownership of such entity.
+
+         "You" (or "Your") shall mean an individual or Legal Entity
+         exercising permissions granted by this License.
+
+         "Source" form shall mean the preferred form for making modifications,
+         including but not limited to software source code, documentation
+         source, and configuration files.
+
+         "Object" form shall mean any form resulting from mechanical
+         transformation or translation of a Source form, including but
+         not limited to compiled object code, generated documentation,
+         and conversions to other media types.
+
+         "Work" shall mean the work of authorship, whether in Source or
+         Object form, made available under the License, as indicated by a
+         copyright notice that is included in or attached to the work
+         (an example is provided in the Appendix below).
+
+         "Derivative Works" shall mean any work, whether in Source or Object
+         form, that is based on (or derived from) the Work and for which the
+         editorial revisions, annotations, elaborations, or other modifications
+         represent, as a whole, an original work of authorship. For the purposes
+         of this License, Derivative Works shall not include works that remain
+         separable from, or merely link (or bind by name) to the interfaces of,
+         the Work and Derivative Works thereof.
+
+         "Contribution" shall mean any work of authorship, including
+         the original version of the Work and any modifications or additions
+         to that Work or Derivative Works thereof, that is intentionally
+         submitted to Licensor for inclusion in the Work by the copyright owner
+         or by an individual or Legal Entity authorized to submit on behalf of
+         the copyright owner. For the purposes of this definition, "submitted"
+         means any form of electronic, verbal, or written communication sent
+         to the Licensor or its representatives, including but not limited to
+         communication on electronic mailing lists, source code control systems,
+         and issue tracking systems that are managed by, or on behalf of, the
+         Licensor for the purpose of discussing and improving the Work, but
+         excluding communication that is conspicuously marked or otherwise
+         designated in writing by the copyright owner as "Not a Contribution."
+
+         "Contributor" shall mean Licensor and any individual or Legal Entity
+         on behalf of whom a Contribution has been received by Licensor and
+         subsequently incorporated within the Work.
+
+      2. Grant of Copyright License. Subject to the terms and conditions of
+         this License, each Contributor hereby grants to You a perpetual,
+         worldwide, non-exclusive, no-charge, royalty-free, irrevocable
+         copyright license to reproduce, prepare Derivative Works of,
+         publicly display, publicly perform, sublicense, and distribute the
+         Work and such Derivative Works in Source or Object form.
+
+      3. Grant of Patent License. Subject to the terms and conditions of
+         this License, each Contributor hereby grants to You a perpetual,
+         worldwide, non-exclusive, no-charge, royalty-free, irrevocable
+         (except as stated in this section) patent license to make, have made,
+         use, offer to sell, sell, import, and otherwise transfer the Work,
+         where such license applies only to those patent claims licensable
+         by such Contributor that are necessarily infringed by their
+         Contribution(s) alone or by combination of their Contribution(s)
+         with the Work to which such Contribution(s) was submitted. If You
+         institute patent litigation against any entity (including a
+         cross-claim or counterclaim in a lawsuit) alleging that the Work
+         or a Contribution incorporated within the Work constitutes direct
+         or contributory patent infringement, then any patent licenses
+         granted to You under this License for that Work shall terminate
+         as of the date such litigation is filed.
+
+      4. Redistribution. You may reproduce and distribute copies of the
+         Work or Derivative Works thereof in any medium, with or without
+         modifications, and in Source or Object form, provided that You
+         meet the following conditions:
+
+         a.  You must give any other recipients of the Work or
+             Derivative Works a copy of this License; and
+
+         b.  You must cause any modified files to carry prominent notices
+             stating that You changed the files; and
+
+         c.  You must retain, in the Source form of any Derivative Works
+             that You distribute, all copyright, patent, trademark, and
+             attribution notices from the Source form of the Work,
+             excluding those notices that do not pertain to any part of
+             the Derivative Works; and
+
+         d.  If the Work includes a "NOTICE" text file as part of its
+             distribution, then any Derivative Works that You distribute must
+             include a readable copy of the attribution notices contained
+             within such NOTICE file, excluding those notices that do not
+             pertain to any part of the Derivative Works, in at least one
+             of the following places: within a NOTICE text file distributed
+             as part of the Derivative Works; within the Source form or
+             documentation, if provided along with the Derivative Works; or,
+             within a display generated by the Derivative Works, if and
+             wherever such third-party notices normally appear. The contents
+             of the NOTICE file are for informational purposes only and
+             do not modify the License. You may add Your own attribution
+             notices within Derivative Works that You distribute, alongside
+             or as an addendum to the NOTICE text from the Work, provided
+             that such additional attribution notices cannot be construed
+             as modifying the License.
+
+         You may add Your own copyright statement to Your modifications and
+         may provide additional or different license terms and conditions
+         for use, reproduction, or distribution of Your modifications, or
+         for any such Derivative Works as a whole, provided Your use,
+         reproduction, and distribution of the Work otherwise complies with
+         the conditions stated in this License.
+
+      5. Submission of Contributions. Unless You explicitly state otherwise,
+         any Contribution intentionally submitted for inclusion in the Work
+         by You to the Licensor shall be under the terms and conditions of
+         this License, without any additional terms or conditions.
+         Notwithstanding the above, nothing herein shall supersede or modify
+         the terms of any separate license agreement you may have executed
+         with Licensor regarding such Contributions.
+
+      6. Trademarks. This License does not grant permission to use the trade
+         names, trademarks, service marks, or product names of the Licensor,
+         except as required for reasonable and customary use in describing the
+         origin of the Work and reproducing the content of the NOTICE file.
+
+      7. Disclaimer of Warranty. Unless required by applicable law or
+         agreed to in writing, Licensor provides the Work (and each
+         Contributor provides its Contributions) on an "AS IS" BASIS,
+         WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or
+         implied, including, without limitation, any warranties or conditions
+         of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A
+         PARTICULAR PURPOSE. You are solely responsible for determining the
+         appropriateness of using or redistributing the Work and assume any
+         risks associated with Your exercise of permissions under this License.
+
+      8. Limitation of Liability. In no event and under no legal theory,
+         whether in tort (including negligence), contract, or otherwise,
+         unless required by applicable law (such as deliberate and grossly
+         negligent acts) or agreed to in writing, shall any Contributor be
+         liable to You for damages, including any direct, indirect, special,
+         incidental, or consequential damages of any character arising as a
+         result of this License or out of the use or inability to use the
+         Work (including but not limited to damages for loss of goodwill,
+         work stoppage, computer failure or malfunction, or any and all
+         other commercial damages or losses), even if such Contributor
+         has been advised of the possibility of such damages.
+
+      9. Accepting Warranty or Additional Liability. While redistributing
+         the Work or Derivative Works thereof, You may choose to offer,
+         and charge a fee for, acceptance of support, warranty, indemnity,
+         or other liability obligations and/or rights consistent with this
+         License. However, in accepting such obligations, You may act only
+         on Your own behalf and on Your sole responsibility, not on behalf
+         of any other Contributor, and only if You agree to indemnify,
+         defend, and hold each Contributor harmless for any liability
+         incurred by, or claims asserted against, such Contributor by reason
+         of your accepting any such warranty or additional liability.
+
+      END OF TERMS AND CONDITIONS
+
+      APPENDIX: How to apply the Apache License to your work.
+
+      >>>
+         To apply the Apache License to your work, attach the following
+         boilerplate notice, with the fields enclosed by brackets "[]"
+         replaced with your own identifying information. (Don't include
+         the brackets!)  The text should be enclosed in the appropriate
+         comment syntax for the file format. We also recommend that a
+         file or class name and description of purpose be included on the
+         same "printed page" as the copyright notice for easier
+         identification within third-party archives.
+
+      Copyright [yyyy] [name of copyright owner]
+
+      Licensed under the Apache License, Version 2.0 (the "License");
+      you may not use this file except in compliance with the License.
+      You may obtain a copy of the License at
+
+          http://www.apache.org/licenses/LICENSE-2.0
+
+      Unless required by applicable law or agreed to in writing, software
+      distributed under the License is distributed on an "AS IS" BASIS,
+      WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+      See the License for the specific language governing permissions and
+      limitations under the License.
diff --git a/Makefile.in b/Makefile.in
deleted file mode 100644
index 1dc591ba20..0000000000
--- a/Makefile.in
+++ /dev/null
@@ -1,508 +0,0 @@
-SHELL = /bin/sh
-NULLCMD = @NULLCMD@
-n=$(NULLCMD)
-ECHO1 = $(V:1=$n)
-RUNCMD = $(SHELL)
-CDPATH = .
-CHDIR = @CHDIR@
-exec = exec
-NULL = /dev/null
-PATH_SEPARATOR = @PATH_SEPARATOR@
-
-#### Start of system configuration section. ####
-
-srcdir = @srcdir@
-top_srcdir = $(srcdir)
-hdrdir = $(srcdir)/include
-PLATFORM_DIR = @PLATFORM_DIR@
-
-CC = @CC@
-CPP = @CPP@
-LD = @LD@
-YACC = bison
-PURIFY =
-AUTOCONF = autoconf
-CONFIGURE = @CONFIGURE@
-@SET_MAKE@
-MKFILES = @MAKEFILES@
-BASERUBY = @BASERUBY@
-HAVE_BASERUBY = @HAVE_BASERUBY@
-TEST_RUNNABLE = @TEST_RUNNABLE@
-CROSS_COMPILING = @CROSS_COMPILING@
-DOXYGEN = @DOXYGEN@
-
-prefix = @prefix@
-exec_prefix = @exec_prefix@
-bindir = @bindir@
-sbindir = @sbindir@
-libdir = @libdir@
-libexecdir = @libexecdir@
-datarootdir = @datarootdir@
-datadir = @datadir@
-arch = @arch@
-sitearch = @sitearch@
-sitedir = @sitedir@
-archlibdir = @archlibdir@
-ruby_version = @ruby_version@
-
-TESTUI = console
-TESTS =
-INSTALLDOC = @INSTALLDOC@
-DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
-
-EXTOUT = @EXTOUT@
-arch_hdrdir = $(EXTOUT)/include/$(arch)
-VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/missing
-
-empty =
-CC_VERSION = @CC_VERSION@
-OUTFLAG = @OUTFLAG@$(empty)
-COUTFLAG = @COUTFLAG@$(empty)
-ARCH_FLAG = @ARCH_FLAG@
-CFLAGS_NO_ARCH = @CFLAGS@
-CFLAGS = $(CFLAGS_NO_ARCH) $(ARCH_FLAG)
-cflags = @cflags@
-optflags = @optflags@
-debugflags = @debugflags@
-warnflags = @warnflags@ @strict_warnflags@
-cppflags = @cppflags@
-INCFLAGS = -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir)
-XCFLAGS = @XCFLAGS@
-CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
-LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLDFLAGS = @EXTLDFLAGS@
-XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
-EXTLIBS =
-LIBS = @LIBS@ $(EXTLIBS)
-MISSING = @LIBOBJS@ @ALLOCA@
-LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(XLDFLAGS) $(ARCH_FLAG)
-SOLIBS = @SOLIBS@
-MAINLIBS = @MAINLIBS@
-ARCHMINIOBJS = @MINIOBJS@
-DLNOBJ = @DLNOBJ@
-ENCOBJS = @ENCOBJS@
-EXTOBJS = @EXTOBJS@
-BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
-BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
-BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
-POSTLINK = @POSTLINK@
-
-RUBY_BASE_NAME=@RUBY_BASE_NAME@
-RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
-RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
-RUBY_SO_NAME=@RUBY_SO_NAME@
-EXEEXT = @EXEEXT@
-LIBEXT = @LIBEXT@
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@\
-	$(MINIRUBYOPT)
-# RUNRUBY_COMMAND:: runruby.rb or baseruby. do not append options directly
-RUNRUBY_COMMAND = @RUNRUBY_COMMAND@
-# RUNRUBY:: run ruby with RUN_OPTS which is passed to ruby
-RUNRUBY = @RUNRUBY@ $(RUN_OPTS)
-# RUNRUBY_DEBUGGER:: debugging option for runruby.rb
-RUNRUBY_DEBUGGER = --debugger='gdb -x run.gdb --quiet --args'
-XRUBY = @XRUBY@
-BTESTRUBY = @BTESTRUBY@\
-	$(MINIRUBYOPT)
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-XRUBY_LIBDIR = @XRUBY_LIBDIR@
-XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
-XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
-BOOTSTRAPRUBY = @BOOTSTRAPRUBY@
-
-#### End of system configuration section. ####
-
-MAJOR=	@MAJOR@
-MINOR=	@MINOR@
-TEENY=	@TEENY@
-
-LIBRUBY_A     = @LIBRUBY_A@
-LIBRUBY_SO    = @LIBRUBY_SO@
-LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
-LIBRUBY	      = @LIBRUBY@
-LIBRUBYARG    = @LIBRUBYARG@
-LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
-LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
-LIBRUBY_RELATIVE = @LIBRUBY_RELATIVE@
-LIBRUBY_A_OBJS = @LIBRUBY_A_OBJS@
-
-DTRACE_REBUILD_OBJS = $(DTRACE_REBUILD:yes=$(DTRACE_DEPENDENT_OBJS))
-
-DTRACE_DEPENDENT_OBJS = array.$(OBJEXT) \
-			eval.$(OBJEXT) \
-			gc.$(OBJEXT) \
-			hash.$(OBJEXT) \
-			load.$(OBJEXT) \
-			object.$(OBJEXT) \
-			parse.$(OBJEXT) \
-			string.$(OBJEXT) \
-			symbol.$(OBJEXT) \
-			vm.$(OBJEXT)
-
-THREAD_MODEL  = @THREAD_MODEL@
-
-PREP          = @PREP@
-ARCHFILE      = @ARCHFILE@
-SETUP         =
-EXTSTATIC     = @EXTSTATIC@
-ENCSTATIC     = @ENCSTATIC@
-SET_LC_MESSAGES = env LC_MESSAGES=C
-
-MAKEDIRS      = @MKDIR_P@
-CP            = cp
-MV            = mv
-RM            = rm -f
-RMDIR         = @RMDIR@
-RMDIRS        = @RMDIRS@
-RMALL         = @RMALL@
-NM            = @NM@
-AR            = @AR@
-ARFLAGS       = rcu
-RANLIB        = @RANLIB@
-AS            = @AS@
-ASFLAGS       = @ASFLAGS@ $(INCFLAGS)
-IFCHANGE      = $(srcdir)/tool/ifchange
-SET_LC_MESSAGES = env LC_MESSAGES=C
-OBJDUMP       = @OBJDUMP@
-OBJCOPY       = @OBJCOPY@
-VCS           = @VCS@
-VCSUP         = @VCSUP@
-DTRACE        = @DTRACE@
-DTRACE_EXT    = @DTRACE_EXT@
-DTRACE_OBJ    = @DTRACE_OBJ@
-DTRACE_REBUILD= @DTRACE_REBUILD@
-DTRACE_GLOMMED_OBJ = $(DTRACE_REBUILD:yes=ruby-glommed.$(OBJEXT))
-
-OBJEXT        = @OBJEXT@
-ASMEXT        = S
-DLEXT         = @DLEXT@
-MANTYPE	      = @MANTYPE@
-SYMBOL_PREFIX = @SYMBOL_PREFIX@
-
-INSTALLED_LIST= .installed.list
-
-NEWLINE_C     = enc/trans/newline.c
-MINIPRELUDE_C = miniprelude.c
-PRELUDE_C     = prelude.c
-RBCONFIG      = .rbconfig.time
-
-SRC_FILE      = $<
-OS_SRC_FILE   = $<
-DEST_FILE     = $@
-OS_DEST_FILE  = $@
-
-MESSAGE_BEGIN = @for line in
-MESSAGE_END = ; do echo "$$line"; done
-ECHO_BEGIN = @sep=''; for word in
-ECHO_END = ; do echo @ECHO_N@ "$$sep'$$word'@ECHO_C@"; sep=' '; done; echo
-
-DESTDIR       = @DESTDIR@
-
-configure_args = @configure_args@
-#### End of variables
-
-.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
-
-all:
-
-# Prevent GNU make v3 from overflowing arg limit on SysV.
-.NOEXPORT:
-
-miniruby$(EXEEXT):
-		@-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
-		$(ECHO) linking $@
-		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
-
-$(PROGRAM):
-		@$(RM) $@
-		$(ECHO) linking $@
-		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(EXTLIBS) $(OUTFLAG)$@
-		$(Q) $(POSTLINK)
-
-# We must `rm' the library each time this rule is invoked because "updating" a
-# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
-# supported.
-$(LIBRUBY_A):
-		@$(RM) $@
-		$(ECHO) linking static-library $@
-		$(Q) $(AR) $(ARFLAGS) $@ $(LIBRUBY_A_OBJS) $(INITOBJS)
-		@-$(RANLIB) $@ 2> /dev/null || true
-		$(ECHO) verifying static-library $@
-		@$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)conftest$(EXEEXT)
-		@$(RM) conftest$(EXEEXT) conftest.c
-
-$(LIBRUBY_SO):
-		@-$(PRE_LIBRUBY_UPDATE)
-		$(ECHO) linking shared-library $@
-		$(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(EXTSOLIBS) $(OUTFLAG)$@
-		-$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)ruby_static_id_*' \
-			-L '$(SYMBOL_PREFIX)*_threadptr_*' $@
-		$(Q) $(POSTLINK)
-		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link rescue nil; \
-						  File.symlink "$(LIBRUBY_SO)", link}' \
-				$(LIBRUBY_ALIASES) || true
-
-ruby_pc = @ruby_pc@
-$(ruby_pc):
-		@./config.status --file=$@:$(srcdir)/template/ruby.pc.in
-
-$(RBCONFIG): $($(CROSS_COMPILING:no=)PREP)
-
-install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
-	$(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
-	$(ECHO) installing cross-compiling stuff
-	$(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
-	$(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
-	$(Q) $(BASERUBY) -p \
-	-e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
-	-e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
-	rbconfig.rb > fake-rbconfig.rb
-	$(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
-	$(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
-	@$(RM) fake.rb fake-rbconfig.rb
-	$(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
-	$(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
-	$(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
-	$(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
-
-Makefile:	$(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
-
-$(MKFILES): config.status $(srcdir)/version.h
-		@[ -f $@ ] && mv $@ $@.old
-		MAKE=$(MAKE) $(SHELL) ./config.status $@
-		@cmp $@ $@.old > /dev/null 2>&1 && echo $@ unchanged && exit 0; \
-		{ \
-		    echo "all:; -@rm -f conftest.mk"; \
-		    echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
-		    echo ".force:"; \
-		} > conftest.mk || exit 1; \
-		$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
-		{ echo "$@ updated, restart."; exit 1; }
-
-uncommon.mk: $(srcdir)/common.mk
-		sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
-
-.PHONY: reconfig
-reconfig-args = $(srcdir)/$(CONFIGURE) $(configure_args)
-config.status-args = ./config.status --recheck
-reconfig-exec-0 = exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3 3>&- 4>&-`
-reconfig-exec-1 = set -x; "$$@"
-
-reconfig config.status:	$(srcdir)/$(CONFIGURE) $(srcdir)/enc/Makefile.in \
-			$(srcdir)/include/ruby/version.h
-	@PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
-	set $(SHELL) $($@-args); $(reconfig-exec-$(V))
-
-$(srcdir)/$(CONFIGURE): $(srcdir)/configure.in
-	$(CHDIR) $(srcdir) && exec $(AUTOCONF) -o $(@F)
-
-incs: id.h
-all-incs: probes.h
-
-# Things which should be considered:
-# * with gperf v.s. without gperf
-# * committers may have various versions of gperf
-# * ./configure v.s. ../ruby/configure
-# * GNU make v.s. HP-UX make	# HP-UX make invokes the action if lex.c and keywords has same mtime.
-# * svn checkout generate a file with mtime as current time
-# * ext4 and XFS has a mtime with fractional part
-lex.c: defs/keywords
-	@\
-	if cmp -s $(srcdir)/defs/lex.c.src $?; then \
-	  [ $(Q) ] && echo copying $@ || set -x; \
-	  $(CP) $(srcdir)/lex.c.blt $@; \
-	else \
-	  [ $(Q) ] && echo generating $@ || set -x; \
-	  gperf -C -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@.tmp && \
-	  $(MV) $@.tmp $@ && \
-	  $(CP) $? $(srcdir)/defs/lex.c.src && \
-	  $(CP) $@ $(srcdir)/lex.c.blt; \
-	fi
-
-NAME2CTYPE_OPTIONS = -7 -c -j1 -i1 -t -C -P -T -H uniname2ctype_hash -Q uniname2ctype_pool -N uniname2ctype_p
-
-enc/unicode/name2ctype.h: enc/unicode/name2ctype.kwd
-	$(MAKEDIRS) $(@D)
-	@set +e; \
-	if cmp -s $(?:.kwd=.src) $?; then \
-	  set -x; \
-	  $(CP) $(?:.kwd=.h.blt) $@; \
-	else \
-	  trap '$(RM) $@-1.h $@-2.h' 0 && \
-	  set -x; \
-	  sed '/^#ifdef USE_UNICODE_PROPERTIES/,/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-1.h && \
-	  sed '/^#ifdef USE_UNICODE_PROPERTIES/d;/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-2.h && \
-	  diff -DUSE_UNICODE_PROPERTIES $@-1.h $@-2.h > $@.tmp || :; \
-	  $(MV) $@.tmp $@ && \
-	  $(CP) $? $(?:.kwd=.src) && \
-	  $(CP) $@ $(?:.kwd=.h.blt); \
-	fi
-
-JIS_PROPS_OPTIONS = -k1,3 -7 -c -j1 -i1 -t -C -P -t --ignore-case -H onig_jis_property_hash -Q onig_jis_property_pool -N onig_jis_property
-
-enc/jis/props.h: enc/jis/props.kwd
-	$(MAKEDIRS) $(@D)
-	@set +e; \
-	if cmp -s $(?:.kwd=.src) $?; then \
-	  set -x; \
-	  $(CP) $(?:.kwd=.h.blt) $@; \
-	else \
-	  set -x; \
-	  gperf $(JIS_PROPS_OPTIONS) $? | \
-	  sed 's/(int)(long)&((\([a-zA-Z_0-9 ]*[a-zA-Z_0-9]\) *\*)0)->\([a-zA-Z0-9_]*\),/(char)offsetof(\1, \2),/g' > $@ && \
-	  $(CP) $? $(?:.kwd=.src) && \
-	  $(CP) $@ $(?:.kwd=.h.blt); \
-	fi
-
-.c.@OBJEXT@:
-	@$(ECHO) compiling $<
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
-
-.s.@OBJEXT@:
-	@$(ECHO) assembling $<
-	$(Q) $(AS) $(ASFLAGS) -o $@ $<
-
-.c.S:
-	@$(ECHO) translating $<
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
-
-.c.i:
-	@$(ECHO) preprocessing $<
-	$(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
-
-.d.h:
-	@$(ECHO) translating probes $<
-	$(Q) $(DTRACE) -o $@.tmp -h -C $(INCFLAGS) -s $<
-	$(Q) sed -e 's/RUBY_/RUBY_DTRACE_/g' -e 's/PROBES_H_TMP/PROBES_H/g' -e 's/(char \*/(const char */g' -e 's/, char \*/, const char */g' $@.tmp > $@
-	$(Q) $(RM) $@.tmp
-
-.dmyh.h:
-	@$(ECHO) copying dummy $(DEST_FILE)
-	$(Q) $(CP) $(OS_SRC_FILE) $(OS_DEST_FILE)
-
-probes.stamp: $(DTRACE_REBUILD_OBJS)
-	$(Q) if test -f $@ -o -f probes.$(OBJEXT); then \
-	  $(RM) $(DTRACE_REBUILD_OBJS) $@; \
-	  $(ECHO0) "rebuilding objects which were modified by \"dtrace -G\""; \
-	  $(MAKE) $(DTRACE_REBUILD_OBJS); \
-	fi
-	$(Q) touch $@
-
-probes.@OBJEXT@: $(srcdir)/probes.d $(DTRACE_REBUILD:yes=probes.stamp)
-	@$(ECHO) processing probes in object files
-	$(Q) $(RM) $@
-	$(Q) $(DTRACE) -G -C $(INCFLAGS) -s $(srcdir)/probes.d -o $@ $(DTRACE_REBUILD_OBJS)
-
-# DTrace static library hacks described here:
-# http://mail.opensolaris.org/pipermail/dtrace-discuss/2005-August/000207.html
-ruby-glommed.$(OBJEXT):
-	@$(ECHO) generating a glommed object with DTrace probes for static library
-	$(Q) $(LD) -r -o $@ $(OBJS)
-
-clean-local::
-	$(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output \
-		enc/encinit.c enc/encinit.$(OBJEXT)
-	-$(Q)$(RM) $(pkgconfig_DATA)
-
-distclean-local::
-	$(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
-	-$(Q)$(RM) run.gdb
-	-$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h verconf.h
-	-$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
-
-clean-ext distclean-ext realclean-ext::
-	@cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
-	test "$$#" = 0 && set .; \
-	set dummy `\
-	    find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$::' | sort; \
-	`; shift; \
-	cd ..; \
-	for dir do \
-	    echo $(@:-ext=)ing "$$dir"; \
-	    (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
-	    case "$@" in \
-	    *distclean-ext*|*realclean-ext*) \
-		$(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
-	    esac; \
-	done
-	-$(Q)$(RM) ext/extinit.$(OBJEXT)
-
-distclean-ext realclean-ext::
-	-$(Q)$(RM) ext/extinit.c
-	-$(Q)$(RMDIR) ext 2> /dev/null || true
-
-clean-extout:
-
-clean-enc distclean-enc realclean-enc:
-	@test -f "$(ENC_MK)" || exit 0; \
-	echo $(@:-enc=ing) encodings; \
-	exec $(MAKE) -f $(ENC_MK) $(MFLAGS) $(@:-enc=)
-
-ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
-	$(ECHO) compiling $@
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
-
-enc/encinit.$(OBJEXT): enc/encinit.c $(SETUP)
-
-up::
-	@$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
-
-after-update:: update-config_files common-srcs
-
-update-mspec:
-	@$(CHDIR) $(srcdir); \
-	if [ -d spec/mspec ]; then \
-	  cd spec/mspec; \
-	  echo updating mspec ...; \
-	  exec git pull; \
-	else \
-	  echo retrieving mspec ...; \
-	  exec git clone $(MSPEC_GIT_URL) spec/mspec; \
-	fi
-
-update-rubyspec: update-mspec
-	@$(CHDIR) $(srcdir); \
-	if [ -d spec/rubyspec ]; then \
-	  cd spec/rubyspec; \
-	  echo updating rubyspec ...; \
-	  exec git pull; \
-	else \
-	  echo retrieving rubyspec ...; \
-	  exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
-	fi
-
-test-rubyspec-precheck:
-	@if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here.  make update-rubyspec first.; exit 1; fi
-
-update-coverage:
-	@$(CHDIR) $(srcdir); \
-	if [ -d coverage/simplecov ]; then \
-	  cd coverage/simplecov; \
-	  echo updating simplecov ...; \
-	  exec git pull; \
-	else \
-	  echo retrieving simplecov ...; \
-	  exec git clone $(SIMPLECOV_GIT_URL) coverage/simplecov; \
-	fi
-
-INSNS	= opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
-	  vmtc.inc vm.inc
-
-$(INSNS): $(srcdir)/insns.def vm_opts.h \
-	  $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
-	  $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
-	$(ECHO) generating $@
-	$(Q) $(BASERUBY) -Ku $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
-
-verconf.h: $(RBCONFIG)
-
-loadpath: verconf.h
-	@$(CPP) $(XCFLAGS) $(CPPFLAGS) $(srcdir)/loadpath.c | \
-	sed -e '1,/^const char ruby_initial_load_paths/d;/;/,$$d' \
-	    -e '/^ /!d;s/ *"\\0"$$//;s/" *"//g'
diff --git a/NEWS b/NEWS
deleted file mode 100644
index da678af22c..0000000000
--- a/NEWS
+++ /dev/null
@@ -1,77 +0,0 @@
-# -*- rdoc -*-
-
-= NEWS for Ruby 2.3.0
-
-This document is a list of user visible feature changes made between
-releases except for bug fixes.
-
-Note that each entry is kept so brief that no reason behind or
-reference information is supplied with.  For a full list of changes
-with all sufficient information, see the ChangeLog file.
-
-== Changes since the 2.2.0 release
-
-=== Language changes
-
-=== Core classes updates (outstanding ones only)
-
-=== Core classes compatibility issues (excluding feature bug fixes)
-
-* Array
-  * Array#select!, Array#keep_if, Array#reject!, and Array#delete_if
-    no longer changes the receiver array instantly every time the
-    block is called.  [Feature #10714]
-
-  * Array#flatten and Array#flatten! no longer try to call #to_ary
-    method on elements beyond the given level.  [Bug #10748]
-
-* Enumerable
-  * Enumerable#chunk and Enumerable#slice_before no longer takes the
-    initial_state argument.  [Feature #10958]
-    Use a local variable instead to maintain a state.
-
-* IO
-  * IO#close doesn't raise when the IO object is closed.  [Feature #10718]
-
-=== Stdlib updates (outstanding ones only)
-
-* Socket
-  * Socket#accept_nonblock and Socket#connect_nonblock supports
-    `exception :false` to return symbols.
-    Ditto for TCPServer#accept_nonblock, UNIXServer#accept_nonblock.
-
-* ObjectSpace (objspace)
-  * ObjectSpace.count_imemo_objects is added.
-
-* OpenSSL
-  * OpenSSL::SSL::SSLSocket#accept_nonblock and
-    OpenSSL::SSL::SSLSocket#connect_nonblock supports `exception: false`.
-
-=== Stdlib compatibility issues (excluding feature bug fixes)
-
-* lib/webrick/utils.rb
- * removed unused argument. https://github.com/ruby/ruby/pull/356
-
-* lib/drb/drb.rb
- * removed unused argument. https://github.com/ruby/ruby/pull/515
-
-* lib/base64.rb
- * Base64.urlsafe_encode64: added a "padding" option to suppress
-   the padding character ("=").
- * Base64.urlsafe_decode64: now it accepts not only correctly-padded
-   input but also unpadded input.
-
-* lib/matrix.rb
- * Add Vector#round. https://github.com/ruby/ruby/pull/802
-
-* ext/coverage/coverage.c
-  * Coverage.peek_result: new method to allow coverage to be captured without
-    stopping the coverage tool.
-
-=== Built-in global variables compatibility issues
-
-=== C API updates
-
-=== Build system updates
-
-=== Implementation changes
diff --git a/NEWS.md b/NEWS.md
new file mode 100644
index 0000000000..2b021e7cdd
--- /dev/null
+++ b/NEWS.md
@@ -0,0 +1,87 @@
+# NEWS for Ruby 4.1.0
+
+This document is a list of user-visible feature changes
+since the **4.0.0** release, except for bug fixes.
+
+Note that each entry is kept to a minimum, see links for details.
+
+## Language changes
+
+## Core classes updates
+
+Note: We're only listing outstanding class updates.
+
+* Method
+
+    * `Method#source_location`, `Proc#source_location`, and
+      `UnboundMethod#source_location` now return extended location
+      information with 5 elements: `[path, start_line, start_column,
+      end_line, end_column]`. The previous 2-element format `[path,
+      line]` can still be obtained by calling `.take(2)` on the result.
+      [[Feature #6012]]
+
+* Set
+
+    * A deprecated behavior, `Set#to_set`, `Range#to_set`, and
+      `Enumerable#to_set` accepting arguments, was removed.  [[Feature #21390]]
+
+## Stdlib updates
+
+### The following bundled gems are added.
+
+
+We only list stdlib changes that are notable feature changes.
+
+Other changes are listed in the following sections. We also listed release
+history from the previous bundled version that is Ruby 3.4.0 if it has GitHub
+releases.
+
+### The following bundled gem is promoted from default gems.
+
+* tsort 0.2.0
+
+### The following default gem is added.
+
+### The following default gems are updated.
+
+* RubyGems 4.1.0.dev
+* bundler 4.1.0.dev
+* prism 1.8.0
+* stringio 3.2.1.dev
+* strscan 3.1.7.dev
+
+### The following bundled gems are updated.
+
+* minitest 6.0.1
+* test-unit 3.7.7
+* rss 0.3.2
+* net-imap 0.6.2
+* rbs 3.10.2
+* typeprof 0.31.1
+* debug 1.11.1
+* mutex_m 0.3.0
+* resolv-replace 0.2.0
+* rdoc 7.1.0
+
+### RubyGems and Bundler
+
+Ruby 4.0 bundled RubyGems and Bundler version 4. see the following links for details.
+
+## Supported platforms
+
+## Compatibility issues
+
+## Stdlib compatibility issues
+
+## C API updates
+
+## Implementation improvements
+
+### Ractor
+
+A lot of work has gone into making Ractors more stable, performant, and usable. These improvements bring Ractor implementation closer to leaving experimental status.
+
+## JIT
+
+[Feature #6012]: https://bugs.ruby-lang.org/issues/6012
+[Feature #21390]: https://bugs.ruby-lang.org/issues/21390
diff --git a/README.ja.md b/README.ja.md
index d54f9404c9..9bbc3a83a5 100644
--- a/README.ja.md
+++ b/README.ja.md
@@ -1,3 +1,11 @@
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![AppVeyor status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
+
+[English](rdoc-ref:README.md)
+
 # Rubyとは
 
 Rubyはシンプルかつ強力なオブジェクト指向スクリプト言語です． Rubyは純粋なオブジェクト指向言語として設計されているので，
@@ -10,83 +18,79 @@ Rubyはテキスト処理関係の能力などに優れ，Perlと同じくらい
 
 *   シンプルな文法
 *   普通のオブジェクト指向機能(クラス，メソッドコールなど)
-*   特殊なオブジェクト指向機能(Mixin, 特異メソッドなど)
+*   特殊なオブジェクト指向機能(Mixin，特異メソッドなど)
 *   演算子オーバーロード
 *   例外処理機能
 *   イテレータとクロージャ
 *   ガーベージコレクタ
 *   ダイナミックローディング (アーキテクチャによる)
-*   移植性が高い．多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく，Windows， Mac OS
-    X，BeOSなどの上でも動く cf.
-    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatformsJa
+*   移植性が高い．多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく，Windows， macOS，
+    Haikuなどの上でも動く cf.
+    https://docs.ruby-lang.org/en/master/maintainers_md.html#label-Platform+Maintainers
 
 
 ## 入手法
 
-### FTPで
-
-以下の場所においてあります．
+サードパーティーツールを使った方法を含むRubyのインストール方法の一覧は
 
-ftp://ftp.ruby-lang.org/pub/ruby/
+https://www.ruby-lang.org/ja/downloads/
 
-### Subversionで
+を参照してください．
 
-開発先端のソースコードは次のコマンドで取得できます．
+### Git
 
-    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+ミラーをGitHubに公開しています． 以下のコマンドでリポジトリを取得できます．
 
-他に開発中のブランチの一覧は次のコマンドで見られます．
+```console
+$ git clone https://github.com/ruby/ruby.git
+```
 
-    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+他のブランチの一覧は次のコマンドで見られます．
 
-### Gitで
+```console
+$ git ls-remote https://github.com/ruby/ruby.git
+```
 
-SubversionのミラーをGitHubに公開しています． 以下のコマンドでリポジトリを取得できます．
-
-    $ git clone git://github.com/ruby/ruby.git
+Rubyリポジトリの本来のmasterは https://git.ruby-lang.org/ruby.git にあります．
+コミッタはこちらを使います．
 
 ## ホームページ
 
 RubyのホームページのURLは
 
-http://www.ruby-lang.org/
+https://www.ruby-lang.org/
 
 です．
 
 ## メーリングリスト
 
-Rubyのメーリングリストがあります．参加希望の方は
-
-mailto:ruby-list-request@ruby-lang.org
+Rubyのメーリングリストがあります．参加希望の方は [ruby-list-request@ml.ruby-lang.org] まで件名に
 
-まで本文に
-
-    subscribe
+    join
 
 と書いて送って下さい．
 
-Ruby開発者向けメーリングリストもあります．こちらではrubyのバグ，将来の仕様拡張など実装上の問題について議論されています． 参加希望の方は
-
-mailto:ruby-dev-request@ruby-lang.org
-
-までruby-listと同様の方法でメールしてください．
+Ruby開発者向けメーリングリストもあります．こちらではrubyのバグ，将来の仕様拡張など実装上の問題について議論されています．
+参加希望の方は [ruby-dev-request@ml.ruby-lang.org] までruby-listと同様の方法でメールしてください．
 
 Ruby拡張モジュールについて話し合うruby-extメーリングリストと数学関係の話題について話し合うruby-mathメーリングリストと
 英語でrubyについて話し合うruby-talkメーリングリストもあります．参加方法はどれも同じです．
 
+[ruby-list-request@ml.ruby-lang.org]: mailto:ruby-list-request@ml.ruby-lang.org?subject=join
+[ruby-dev-request@ml.ruby-lang.org]: mailto:ruby-dev-request@ml.ruby-lang.org?subject=join
+
 ## コンパイル・インストール
 
 以下の手順で行ってください．
 
-1.  もし `configure` ファイルが見つからない，もしくは `configure.in` より古いようなら， `autoconf` を実行して
-    新しく `configure` を生成する
+1.  (Gitリポジトリから取得したソースをビルドする場合) `./autogen.sh` を実行して新しく `configure` を生成する
 
 2.  `configure` を実行して `Makefile` などを生成する
 
     環境によってはデフォルトのCコンパイラ用オプションが付きます． `configure` オプションで `optflags=..`
     `warnflags=..` 等で上書きできます．
 
-3.  (必要ならば)`defines.h` を編集する
+3.  (必要ならば)`include/ruby/defines.h` を編集する
 
     多分，必要無いと思います．
 
@@ -95,7 +99,8 @@ Ruby拡張モジュールについて話し合うruby-extメーリングリス�
     `ext/Setup` に記述したモジュールは静的にリンクされます．
 
     ダイナミックローディングをサポートしていないアーキテクチャでは `Setup` の1行目の「`option nodynamic`」という行のコ
-    メントを外す必要があります．また，このアーキテクチャで拡張モジュールを利用するためには，あらかじめ静的にリンクをしておく必要があります．
+    メントを外す必要があります．
+    また，このアーキテクチャで拡張モジュールを利用するためには，あらかじめ静的にリンクをしておく必要があります．
 
 5.  `make` を実行してコンパイルする
 
@@ -144,28 +149,28 @@ UNIXであれば `configure` がほとんどの差異を吸収してくれるは
 のアーキテクチャが`setjmp()`または`getcontext()`によって全てのレジスタを `jmp_buf` や `ucontext_t`
 に格納することと， `jmp_buf` や `ucontext_t` とスタックが32bitアラインメントされていることを仮定
 しています．特に前者が成立しない場合の対応は非常に困難でしょう． 後者の解決は比較的簡単で， `gc.c` でスタックをマークしている
-部分にアラインメントのバイト数だけずらしてマークするコードを追加するだけで済みます．`defined(_\*mc68000*\_)`で括られてい
+部分にアラインメントのバイト数だけずらしてマークするコードを追加するだけで済みます．`defined(__mc68000__)`で括られてい
 る部分を参考にしてください．
 
 レジスタウィンドウを持つCPUでは，レジスタウィンドウをスタックにフラッシュするアセンブラコードを追加する必要があるかもしれません．
 
 ## 配布条件
 
-`COPYING.ja` ファイルを参照してください．
+[COPYING.ja](https://docs.ruby-lang.org/en/master/COPYING_ja.html) ファイルを参照してください．
 
 ## フィードバック
 
-Rubyに関する質問は Ruby-Talk（英語）や Ruby-List（日本語） (https://www.ruby-lang.org/ja/community/mailing-lists) や，
-stackoverflow (http://ja.stackoverflow.com/) などのWebサイトに投稿してください．
+Rubyに関する質問は [Ruby-Talk]（英語）や [Ruby-List]（日本語）や，
+[stackoverflow] などのWebサイトに投稿してください．
 
-バグ報告は http://bugs.ruby-lang.org で受け付けています．
+バグ報告は https://bugs.ruby-lang.org で受け付けています．
 
+[Ruby-Talk]: https://www.ruby-lang.org/en/community/mailing-lists
+[Ruby-List]: https://www.ruby-lang.org/ja/community/mailing-lists
+[stackoverflow]: https://ja.stackoverflow.com/
 
 ## 著者
 
 Rubyのオリジナル版は，1995年にまつもとゆきひろ氏によって設計・開発されました．
 
 <mailto:matz@ruby-lang.org>
-
----
-created at: Thu Aug  3 11:57:36 JST 1995
diff --git a/README.md b/README.md
index 47b124d591..02435b419e 100644
--- a/README.md
+++ b/README.md
@@ -1,157 +1,96 @@
-# What's Ruby
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
 
-Ruby is the interpreted scripting language for quick and easy object-oriented
-programming.  It has many features to process text files and to do system
-management tasks (as in Perl).  It is simple, straight-forward, and
-extensible.
+[日本語](rdoc-ref:README.ja.md)
 
-## Features of Ruby
+# What is Ruby?
+
+Ruby is an interpreted object-oriented programming language often
+used for web development. It also offers many scripting features
+to process plain text and serialized files, or manage system tasks.
+It is simple, straightforward, and extensible.
 
-*   Simple Syntax
-*   **Normal** Object-Oriented features(ex. class, method calls)
-*   **Advanced** Object-Oriented features(ex. Mix-in, Singleton-method)
-*   Operator Overloading
-*   Exception Handling
-*   Iterators and Closures
-*   Garbage Collection
-*   Dynamic Loading of Object files(on some architecture)
-*   Highly Portable (works on many Unix-like/POSIX compatible platforms as
-    well as Windows, Mac OS X, BeOS etc.) cf.
-    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatforms
+## Features of Ruby
 
+* Simple Syntax
+* **Normal** Object-oriented Features (e.g. class, method calls)
+* **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
+* Operator Overloading
+* Exception Handling
+* Iterators and Closures
+* Garbage Collection
+* Dynamic Loading of Object Files (on some architectures)
+* Highly Portable (works on many Unix-like/POSIX compatible platforms as
+  well as Windows, macOS, etc.) cf.
+    https://docs.ruby-lang.org/en/master/maintainers_md.html#label-Platform+Maintainers
 
 ## How to get Ruby
 
-For a complete list of ways to install Ruby, including using third party tools
+For a complete list of ways to install Ruby, including using third-party tools
 like rvm, see:
 
-http://www.ruby-lang.org/en/downloads/
+https://www.ruby-lang.org/en/downloads/
 
-The Ruby distribution files can be found in the following FTP site:
+You can download release packages and the snapshot of the repository. If you want to
+download whole versions of Ruby, please visit https://www.ruby-lang.org/en/downloads/releases/.
 
-ftp://ftp.ruby-lang.org/pub/ruby/
+### Download with Git
 
-The trunk of the Ruby source tree can be checked out with the following
-command:
+The mirror of the Ruby source tree can be checked out with the following command:
 
-    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+    $ git clone https://github.com/ruby/ruby.git
 
-Or if you are using git then use the following command:
+There are some other branches under development. Try the following command
+to see the list of branches:
 
-    $ git clone git://github.com/ruby/ruby.git
+    $ git ls-remote https://github.com/ruby/ruby.git
 
-There are some other branches under development.  Try the following command
-and see the list of branches:
+You may also want to use https://git.ruby-lang.org/ruby.git (actual master of Ruby source)
+if you are a committer.
 
-    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+## How to build
 
-Or if you are using git then use the following command:
+See [Building Ruby](https://docs.ruby-lang.org/en/master/contributing/building_ruby_md.html)
 
-    $ git ls-remote git://github.com/ruby/ruby.git
+## Ruby home page
 
-## Ruby home-page
+https://www.ruby-lang.org/
 
-The URL of the Ruby home-page is:
+## Documentation
 
-http://www.ruby-lang.org/
+- [English](https://docs.ruby-lang.org/en/master/index.html)
+- [Japanese](https://docs.ruby-lang.org/ja/master/index.html)
 
 ## Mailing list
 
-There is a mailing list to talk about Ruby. To subscribe this list, please
-send the following phrase
-
-    subscribe
-
-in the mail body (not subject) to the address
-<mailto:ruby-talk-request@ruby-lang.org>.
-
-## How to compile and install
-
-This is what you need to do to compile and install Ruby:
-
-1.  If you want to use Microsoft Visual C++ to compile ruby, read
-    win32/README.win32 instead of this document.
-
-2.  If `./configure` does not exist or is older than configure.in, run
-    autoconf to (re)generate configure.
-
-3.  Run `./configure`, which will generate config.h and Makefile.
-
-    Some C compiler flags may be added by default depending on your
-    environment.  Specify `optflags=..` and `warnflags=..` as necessary to
-    override them.
-
-4.  Edit `defines.h` if you need. Usually this step will not be needed.
-
-5.  Remove comment mark(`#`) before the module names from `ext/Setup` (or add
-    module names if not present), if you want to link modules statically.
+There is a mailing list to discuss Ruby. To subscribe to this list, please
+send the following phrase:
 
-    If you don't want to compile non static extension modules (probably on
-    architectures which do not allow dynamic loading), remove comment mark
-    from the line "`#option nodynamic`" in `ext/Setup`.
+    join
 
-    Usually this step will not be needed.
+in the mail subject (not body) to the address [ruby-talk-request@ml.ruby-lang.org].
 
-6.  Run `make`.
-
-7.  Optionally, run '`make check`' to check whether the compiled Ruby
-    interpreter works well. If you see the message "`check succeeded`", your
-    ruby works as it should (hopefully).
-
-8.  Run '`make install`'
-
-    This command will create following directories and install files onto
-    them.
-
-    *   `${DESTDIR}${prefix}/bin`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib`
-    *   `${DESTDIR}${prefix}/lib/ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/share/man/man1`
-    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
-
-
-    If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
-    `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
-
-    **NOTE**: teeny of the API version may be different from one of Ruby's
-    program version
-
-    You may have to be a super user to install ruby.
-
-
-If you fail to compile ruby, please send the detailed error report with the
-error log and machine/OS type, to help others.
-
-Some extension libraries may not get compiled because of lack of necessary
-external libraries and/or headers, then you will need to run '`make distclean-ext`'
-to remove old configuration after installing them in such case.
+[ruby-talk-request@ml.ruby-lang.org]: mailto:ruby-talk-request@ml.ruby-lang.org?subject=join
 
 ## Copying
 
-See the file `COPYING`.
+See the file [COPYING](rdoc-ref:COPYING).
 
 ## Feedback
 
-Questions about the Ruby language can be asked on the Ruby-Talk mailing list
-(http://www.ruby-lang.org/en/community/mailing-lists) or on websites like
-(http://stackoverflow.com).
+Questions about the Ruby language can be asked on the [Ruby-Talk](https://www.ruby-lang.org/en/community/mailing-lists) mailing list
+or on websites like https://stackoverflow.com.
+
+Bugs should be reported at https://bugs.ruby-lang.org. Read ["Reporting Issues"](https://docs.ruby-lang.org/en/master/contributing/reporting_issues_md.html) for more information.
+
+## Contributing
 
-Bug reports should be filed at http://bugs.ruby-lang.org
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing/contributing_md.html), which includes setup and build instructions.
 
 ## The Author
 
-Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in
-1995.
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in 1995.
 
-<mailto:matz@ruby-lang.org>
+<matz@ruby-lang.org>
diff --git a/lib/rdoc/generator/template/darkfish/.document b/aclocal.m4
index e69de29bb2..e69de29bb2 100644
--- a/lib/rdoc/generator/template/darkfish/.document
+++ b/aclocal.m4
diff --git a/addr2line.c b/addr2line.c
index c8faf48d62..19a6a425c1 100644
--- a/addr2line.c
+++ b/addr2line.c
@@ -8,14 +8,30 @@
 
 **********************************************************************/
 
-#include "ruby/config.h"
+#if defined(__clang__) && defined(__has_warning)
+#if __has_warning("-Wgnu-empty-initializer")
+#pragma clang diagnostic ignored "-Wgnu-empty-initializer"
+#endif
+#if __has_warning("-Wgcc-compat")
+#pragma clang diagnostic ignored "-Wgcc-compat"
+#endif
+#endif
+
+#include "ruby/internal/config.h"
+#include "ruby/defines.h"
 #include "ruby/missing.h"
 #include "addr2line.h"
 
 #include <stdio.h>
 #include <errno.h>
 
-#ifdef USE_ELF
+#ifdef HAVE_LIBPROC_H
+#include <libproc.h>
+#endif
+
+#include "ruby/internal/stdbool.h"
+
+#if defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H)
 
 #include <fcntl.h>
 #include <limits.h>
@@ -28,19 +44,11 @@
 #include <sys/stat.h>
 #include <unistd.h>
 
-#ifdef __OpenBSD__
-#include <elf_abi.h>
-#else
-#include <elf.h>
-#endif
-
 /* Make alloca work the best possible way.  */
 #ifdef __GNUC__
-# ifndef atarist
-#  ifndef alloca
-#   define alloca __builtin_alloca
-#  endif
-# endif	/* atarist */
+# ifndef alloca
+#  define alloca __builtin_alloca
+# endif
 #else
 # ifdef HAVE_ALLOCA_H
 #  include <alloca.h>
@@ -48,35 +56,44 @@
 #  ifdef _AIX
 #pragma alloca
 #  else
-#   ifndef alloca		/* predefined by HP cc +Olibcalls */
+#   ifndef alloca                /* predefined by HP cc +Olibcalls */
 void *alloca();
 #   endif
 #  endif /* AIX */
-# endif	/* HAVE_ALLOCA_H */
+# endif        /* HAVE_ALLOCA_H */
+# ifndef UNREACHABLE
+#  define UNREACHABLE __builtin_unreachable()
+# endif
+# ifndef UNREACHABLE_RETURN
+#  define UNREACHABLE_RETURN(_) __builtin_unreachable()
+# endif
 #endif /* __GNUC__ */
 
+#ifndef UNREACHABLE
+# define UNREACHABLE abort()
+#endif
+#ifndef UNREACHABLE_RETURN
+# define UNREACHABLE_RETURN(_) return (abort(), (_))
+#endif
+
 #ifdef HAVE_DLADDR
 # include <dlfcn.h>
 #endif
 
-#define DW_LNS_copy                     0x01
-#define DW_LNS_advance_pc               0x02
-#define DW_LNS_advance_line             0x03
-#define DW_LNS_set_file                 0x04
-#define DW_LNS_set_column               0x05
-#define DW_LNS_negate_stmt              0x06
-#define DW_LNS_set_basic_block          0x07
-#define DW_LNS_const_add_pc             0x08
-#define DW_LNS_fixed_advance_pc         0x09
-#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
-#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
-#define DW_LNS_set_isa                  0x0c /* DWARF3 */
+#ifdef HAVE_MACH_O_LOADER_H
+# include <crt_externs.h>
+# include <mach-o/fat.h>
+# include <mach-o/loader.h>
+# include <mach-o/nlist.h>
+# include <mach-o/stab.h>
+#endif
 
-/* Line number extended opcode name. */
-#define DW_LNE_end_sequence             0x01
-#define DW_LNE_set_address              0x02
-#define DW_LNE_define_file              0x03
-#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
+#ifdef USE_ELF
+# ifdef __OpenBSD__
+#  include <elf_abi.h>
+# else
+#  include <elf.h>
+# endif
 
 #ifndef ElfW
 # if SIZEOF_VOIDP == 8
@@ -92,13 +109,44 @@ void *alloca();
 #  define ELF_ST_TYPE ELF32_ST_TYPE
 # endif
 #endif
+#endif
+
+#ifdef SHF_COMPRESSED
+# if defined(ELFCOMPRESS_ZLIB) && defined(HAVE_LIBZ)
+   /* FreeBSD 11.0 lacks ELFCOMPRESS_ZLIB */
+#  include <zlib.h>
+#  define SUPPORT_COMPRESSED_DEBUG_LINE
+# endif
+#else /* compatibility with glibc < 2.22 */
+# define SHF_COMPRESSED 0
+#endif
+
 #ifndef PATH_MAX
 #define PATH_MAX 4096
 #endif
 
-int kprintf(const char *fmt, ...);
+#define DW_LNS_copy                     0x01
+#define DW_LNS_advance_pc               0x02
+#define DW_LNS_advance_line             0x03
+#define DW_LNS_set_file                 0x04
+#define DW_LNS_set_column               0x05
+#define DW_LNS_negate_stmt              0x06
+#define DW_LNS_set_basic_block          0x07
+#define DW_LNS_const_add_pc             0x08
+#define DW_LNS_fixed_advance_pc         0x09
+#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
+#define DW_LNS_set_isa                  0x0c /* DWARF3 */
+
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence             0x01
+#define DW_LNE_set_address              0x02
+#define DW_LNE_define_file              0x03
+#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
 
-typedef struct {
+#define kprintf(...) fprintf(errout, "" __VA_ARGS__)
+
+typedef struct line_info {
     const char *dirname;
     const char *filename;
     const char *path; /* object path */
@@ -107,368 +155,1913 @@ typedef struct {
     uintptr_t base_addr;
     uintptr_t saddr;
     const char *sname; /* function name */
+
+    struct line_info *next;
 } line_info_t;
-typedef struct obj_info obj_info_t;
-struct obj_info {
+
+struct dwarf_section {
+    char *ptr;
+    size_t size;
+    uint64_t flags;
+};
+
+typedef struct obj_info {
     const char *path; /* object path */
-    int fd;
-    void *mapped;
+    char *mapped;
     size_t mapped_size;
+    void *uncompressed;
     uintptr_t base_addr;
-    obj_info_t *next;
+    uintptr_t vmaddr;
+    struct dwarf_section debug_abbrev;
+    struct dwarf_section debug_info;
+    struct dwarf_section debug_line;
+    struct dwarf_section debug_ranges;
+    struct dwarf_section debug_str_offsets;
+    struct dwarf_section debug_addr;
+    struct dwarf_section debug_rnglists;
+    struct dwarf_section debug_str;
+    struct dwarf_section debug_line_str;
+    struct obj_info *next;
+} obj_info_t;
+
+#define DWARF_SECTION_COUNT 9
+
+static struct dwarf_section *
+obj_dwarf_section_at(obj_info_t *obj, int n)
+{
+    struct dwarf_section *ary[] = {
+        &obj->debug_abbrev,
+        &obj->debug_info,
+        &obj->debug_line,
+        &obj->debug_ranges,
+        &obj->debug_str_offsets,
+        &obj->debug_addr,
+        &obj->debug_rnglists,
+        &obj->debug_str,
+        &obj->debug_line_str
+    };
+    if (n < 0 || DWARF_SECTION_COUNT <= n) {
+        UNREACHABLE_RETURN(0);
+    }
+    return ary[n];
+}
+
+struct debug_section_definition {
+    const char *name;
+    struct dwarf_section *dwarf;
 };
 
 /* Avoid consuming stack as this module may be used from signal handler */
-static char binary_filename[PATH_MAX];
+static char binary_filename[PATH_MAX + 1];
 
 static unsigned long
-uleb128(char **p)
+uleb128(const char **p)
 {
     unsigned long r = 0;
     int s = 0;
     for (;;) {
-	unsigned char b = *(unsigned char *)(*p)++;
-	if (b < 0x80) {
-	    r += (unsigned long)b << s;
-	    break;
-	}
-	r += (b & 0x7f) << s;
-	s += 7;
+        unsigned char b = (unsigned char)*(*p)++;
+        if (b < 0x80) {
+            r += (unsigned long)b << s;
+            break;
+        }
+        r += (b & 0x7f) << s;
+        s += 7;
     }
     return r;
 }
 
 static long
-sleb128(char **p)
+sleb128(const char **p)
 {
     long r = 0;
     int s = 0;
     for (;;) {
-	unsigned char b = *(unsigned char *)(*p)++;
-	if (b < 0x80) {
-	    if (b & 0x40) {
-		r -= (0x80 - b) << s;
-	    }
-	    else {
-		r += (b & 0x3f) << s;
-	    }
-	    break;
-	}
-	r += (b & 0x7f) << s;
-	s += 7;
+        unsigned char b = (unsigned char)*(*p)++;
+        if (b < 0x80) {
+            if (b & 0x40) {
+                r -= (0x80 - b) << s;
+            }
+            else {
+                r += (b & 0x3f) << s;
+            }
+            break;
+        }
+        r += (b & 0x7f) << s;
+        s += 7;
     }
     return r;
 }
 
 static const char *
-get_nth_dirname(unsigned long dir, char *p)
+get_nth_dirname(unsigned long dir, const char *p, FILE *errout)
 {
     if (!dir--) {
-	return "";
+        return "";
     }
     while (dir--) {
-	while (*p) p++;
-	p++;
-	if (!*p) {
-	    kprintf("Unexpected directory number %lu in %s\n",
-		    dir, binary_filename);
-	    return "";
-	}
+        while (*p) p++;
+        p++;
+        if (!*p) {
+            kprintf("Unexpected directory number %lu in %s\n",
+                    dir, binary_filename);
+            return "";
+        }
     }
     return p;
 }
 
+static const char *parse_ver5_debug_line_header(
+    const char *p, int idx, uint8_t format,
+    obj_info_t *obj, const char **out_path,
+    uint64_t *out_directory_index, FILE *errout);
+
 static void
-fill_filename(int file, char *include_directories, char *filenames,
-	      line_info_t *line)
+fill_filename(int file, uint8_t format, uint16_t version, const char *include_directories,
+              const char *filenames, line_info_t *line, obj_info_t *obj, FILE *errout)
 {
     int i;
-    char *p = filenames;
-    char *filename;
+    const char *p = filenames;
+    const char *filename;
     unsigned long dir;
-    for (i = 1; i <= file; i++) {
-	filename = p;
-	if (!*p) {
-	    /* Need to output binary file name? */
-	    kprintf("Unexpected file number %d in %s\n",
-		    file, binary_filename);
-	    return;
-	}
-	while (*p) p++;
-	p++;
-	dir = uleb128(&p);
-	/* last modified. */
-	uleb128(&p);
-	/* size of the file. */
-	uleb128(&p);
-
-	if (i == file) {
-	    line->filename = filename;
-	    line->dirname = get_nth_dirname(dir, include_directories);
-	}
+    if (version >= 5) {
+        const char *path;
+        uint64_t directory_index = -1;
+        parse_ver5_debug_line_header(filenames, file, format, obj, &path, &directory_index, errout);
+        line->filename = path;
+        parse_ver5_debug_line_header(include_directories, (int)directory_index, format, obj, &path, NULL, errout);
+        line->dirname = path;
+    }
+    else {
+        for (i = 1; i <= file; i++) {
+            filename = p;
+            if (!*p) {
+#ifndef __APPLE__
+                /* Need to output binary file name? */
+                kprintf("Unexpected file number %d in %s at %tx\n",
+                        file, binary_filename, filenames - obj->mapped);
+#endif
+                return;
+            }
+            while (*p) p++;
+            p++;
+            dir = uleb128(&p);
+            /* last modified. */
+            uleb128(&p);
+            /* size of the file. */
+            uleb128(&p);
+
+            if (i == file) {
+                line->filename = filename;
+                line->dirname = get_nth_dirname(dir, include_directories, errout);
+            }
+        }
     }
 }
 
 static void
 fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
-	  char *include_directories, char *filenames,
-	  obj_info_t *obj, line_info_t *lines, int offset)
+          uint8_t format, uint16_t version, const char *include_directories, const char *filenames,
+          obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
 {
     int i;
-    addr += obj->base_addr;
+    addr += obj->base_addr - obj->vmaddr;
     for (i = offset; i < num_traces; i++) {
-	uintptr_t a = (uintptr_t)traces[i];
-	/* We assume one line code doesn't result >100 bytes of native code.
+        uintptr_t a = (uintptr_t)traces[i];
+        /* We assume one line code doesn't result >100 bytes of native code.
        We may want more reliable way eventually... */
-	if (addr < a && a < addr + 100) {
-	    fill_filename(file, include_directories, filenames, &lines[i]);
-	    lines[i].line = line;
-	}
+        if (addr < a && a < addr + 100) {
+            fill_filename(file, format, version, include_directories, filenames, &lines[i], obj, errout);
+            lines[i].line = line;
+        }
     }
 }
 
-static void
-parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
-		obj_info_t *obj, line_info_t *lines, int offset)
-{
-    char *p, *cu_end, *cu_start, *include_directories, *filenames;
-    unsigned long unit_length;
-    int default_is_stmt, line_base;
-    unsigned int header_length, minimum_instruction_length, line_range,
-		 opcode_base;
-    /* unsigned char *standard_opcode_lengths; */
-
-    /* The registers. */
-    unsigned long addr = 0;
-    unsigned int file = 1;
-    unsigned int line = 1;
-    /* unsigned int column = 0; */
-    int is_stmt;
-    /* int basic_block = 0; */
-    /* int end_sequence = 0; */
-    /* int prologue_end = 0; */
-    /* int epilogue_begin = 0; */
-    /* unsigned int isa = 0; */
-
-    p = *debug_line;
+struct LineNumberProgramHeader {
+    uint64_t unit_length;
+    uint16_t version;
+    uint8_t format; /* 4 or 8 */
+    uint64_t header_length;
+    uint8_t minimum_instruction_length;
+    uint8_t maximum_operations_per_instruction;
+    uint8_t default_is_stmt;
+    int8_t line_base;
+    uint8_t line_range;
+    uint8_t opcode_base;
+    /* uint8_t standard_opcode_lengths[opcode_base-1]; */
+    const char *include_directories;
+    const char *filenames;
+    const char *cu_start;
+    const char *cu_end;
+};
 
-    unit_length = *(unsigned int *)p;
-    p += sizeof(unsigned int);
-    if (unit_length == 0xffffffff) {
-	unit_length = *(unsigned long *)p;
-	p += sizeof(unsigned long);
+static int
+parse_debug_line_header(obj_info_t *obj, const char **pp, struct LineNumberProgramHeader *header, FILE *errout)
+{
+    const char *p = *pp;
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
     }
 
-    cu_end = p + unit_length;
+    header->cu_end = p + header->unit_length;
 
-    /*dwarf_version = *(unsigned short *)p;*/
-    p += 2;
+    header->version = *(uint16_t *)p;
+    p += sizeof(uint16_t);
+    if (header->version > 5) return -1;
 
-    header_length = *(unsigned int *)p;
-    p += sizeof(unsigned int);
+    if (header->version >= 5) {
+        /* address_size = *(uint8_t *)p++; */
+        /* segment_selector_size = *(uint8_t *)p++; */
+        p += 2;
+    }
 
-    cu_start = p + header_length;
+    header->header_length = header->format == 4 ? *(uint32_t *)p : *(uint64_t *)p;
+    p += header->format;
+    header->cu_start = p + header->header_length;
 
-    minimum_instruction_length = *(unsigned char *)p;
-    p++;
+    header->minimum_instruction_length = *(uint8_t *)p++;
 
-    is_stmt = default_is_stmt = *(unsigned char *)p;
-    p++;
+    if (header->version >= 4) {
+        /* maximum_operations_per_instruction = *(uint8_t *)p; */
+        if (*p != 1) return -1; /* For non-VLIW architectures, this field is 1 */
+        p++;
+    }
 
-    line_base = *(signed char *)p;
-    p++;
+    header->default_is_stmt = *(uint8_t *)p++;
+    header->line_base = *(int8_t *)p++;
+    header->line_range = *(uint8_t *)p++;
+    header->opcode_base = *(uint8_t *)p++;
+    /* header->standard_opcode_lengths = (uint8_t *)p - 1; */
+    p += header->opcode_base - 1;
+
+    if (header->version >= 5) {
+        header->include_directories = p;
+        p = parse_ver5_debug_line_header(p, -1, header->format, obj, NULL, NULL, errout);
+        header->filenames = p;
+    }
+    else {
+        header->include_directories = p;
 
-    line_range = *(unsigned char *)p;
-    p++;
+        /* temporary measure for compress-debug-sections */
+        if (p >= header->cu_end) return -1;
 
-    opcode_base = *(unsigned char *)p;
-    p++;
+        /* skip include directories */
+        while (*p) {
+            p = memchr(p, '\0', header->cu_end - p);
+            if (!p) return -1;
+            p++;
+        }
+        p++;
 
-    /* standard_opcode_lengths = (unsigned char *)p - 1; */
-    p += opcode_base - 1;
+        header->filenames = p;
+    }
 
-    include_directories = p;
+    *pp = header->cu_start;
 
-    /* skip include directories */
-    while (*p) {
-	while (*p) p++;
-	p++;
-    }
-    p++;
+    return 0;
+}
 
-    filenames = p;
+static int
+parse_debug_line_cu(int num_traces, void **traces, const char **debug_line,
+                obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
+{
+    const char *p = (const char *)*debug_line;
+    struct LineNumberProgramHeader header;
 
-    p = cu_start;
+    /* The registers. */
+    unsigned long addr = 0;
+    unsigned int file = 1;
+    unsigned int line = 1;
+    /* unsigned int column = 0; */
+    int is_stmt;
+    /* int basic_block = 0; */
+    /* int end_sequence = 0; */
+    /* int prologue_end = 0; */
+    /* int epilogue_begin = 0; */
+    /* unsigned int isa = 0; */
 
-#define FILL_LINE()						    \
-    do {							    \
-	fill_line(num_traces, traces, addr, file, line,		    \
-		  include_directories, filenames,		    \
-		  obj, lines, offset);				    \
-	/*basic_block = prologue_end = epilogue_begin = 0;*/	    \
+    if (parse_debug_line_header(obj, &p, &header, errout))
+        return -1;
+    is_stmt = header.default_is_stmt;
+
+#define FILL_LINE()                                                 \
+    do {                                                            \
+        fill_line(num_traces, traces, addr, file, line,             \
+                  header.format,                                    \
+                  header.version,                                   \
+                  header.include_directories,                       \
+                  header.filenames,                                 \
+                  obj, lines, offset, errout);                      \
+        /*basic_block = prologue_end = epilogue_begin = 0;*/        \
     } while (0)
 
-    while (p < cu_end) {
-	unsigned long a;
-	unsigned char op = *p++;
-	switch (op) {
-	case DW_LNS_copy:
-	    FILL_LINE();
-	    break;
-	case DW_LNS_advance_pc:
-	    a = uleb128(&p);
-	    addr += a;
-	    break;
-	case DW_LNS_advance_line: {
-	    long a = sleb128(&p);
-	    line += a;
-	    break;
-	}
-	case DW_LNS_set_file:
-	    file = (unsigned int)uleb128(&p);
-	    break;
-	case DW_LNS_set_column:
-	    /*column = (unsigned int)*/(void)uleb128(&p);
-	    break;
-	case DW_LNS_negate_stmt:
-	    is_stmt = !is_stmt;
-	    break;
-	case DW_LNS_set_basic_block:
-	    /*basic_block = 1; */
-	    break;
-	case DW_LNS_const_add_pc:
-	    a = ((255 - opcode_base) / line_range) *
-		minimum_instruction_length;
-	    addr += a;
-	    break;
-	case DW_LNS_fixed_advance_pc:
-	    a = *(unsigned char *)p++;
-	    addr += a;
-	    break;
-	case DW_LNS_set_prologue_end:
-	    /* prologue_end = 1; */
-	    break;
-	case DW_LNS_set_epilogue_begin:
-	    /* epilogue_begin = 1; */
-	    break;
-	case DW_LNS_set_isa:
-	    /* isa = (unsigned int)*/(void)uleb128(&p);
-	    break;
-	case 0:
-	    a = *(unsigned char *)p++;
-	    op = *p++;
-	    switch (op) {
-	    case DW_LNE_end_sequence:
-		/* end_sequence = 1; */
-		FILL_LINE();
-		addr = 0;
-		file = 1;
-		line = 1;
-		/* column = 0; */
-		is_stmt = default_is_stmt;
-		/* end_sequence = 0; */
-		/* isa = 0; */
-		break;
-	    case DW_LNE_set_address:
-		addr = *(unsigned long *)p;
-		p += sizeof(unsigned long);
-		break;
-	    case DW_LNE_define_file:
-		kprintf("Unsupported operation in %s\n",
-			binary_filename);
-		break;
-	    case DW_LNE_set_discriminator:
-		/* TODO:currently ignore */
-		uleb128(&p);
-		break;
-	    default:
-		kprintf("Unknown extended opcode: %d in %s\n",
-			op, binary_filename);
-	    }
-	    break;
-	default: {
-	    unsigned long addr_incr;
-	    unsigned long line_incr;
-	    a = op - opcode_base;
-	    addr_incr = (a / line_range) * minimum_instruction_length;
-	    line_incr = line_base + (a % line_range);
-	    addr += (unsigned int)addr_incr;
-	    line += (unsigned int)line_incr;
-	    FILL_LINE();
-	}
-	}
-    }
-    *debug_line = p;
+    while (p < header.cu_end) {
+        unsigned long a;
+        unsigned char op = *p++;
+        switch (op) {
+        case DW_LNS_copy:
+            FILL_LINE();
+            break;
+        case DW_LNS_advance_pc:
+            a = uleb128(&p) * header.minimum_instruction_length;
+            addr += a;
+            break;
+        case DW_LNS_advance_line: {
+            long a = sleb128(&p);
+            line += a;
+            break;
+        }
+        case DW_LNS_set_file:
+            file = (unsigned int)uleb128(&p);
+            break;
+        case DW_LNS_set_column:
+            /*column = (unsigned int)*/(void)uleb128(&p);
+            break;
+        case DW_LNS_negate_stmt:
+            is_stmt = !is_stmt;
+            break;
+        case DW_LNS_set_basic_block:
+            /*basic_block = 1; */
+            break;
+        case DW_LNS_const_add_pc:
+            a = ((255UL - header.opcode_base) / header.line_range) *
+                header.minimum_instruction_length;
+            addr += a;
+            break;
+        case DW_LNS_fixed_advance_pc:
+            a = *(uint16_t *)p;
+            p += sizeof(uint16_t);
+            addr += a;
+            break;
+        case DW_LNS_set_prologue_end:
+            /* prologue_end = 1; */
+            break;
+        case DW_LNS_set_epilogue_begin:
+            /* epilogue_begin = 1; */
+            break;
+        case DW_LNS_set_isa:
+            /* isa = (unsigned int)*/(void)uleb128(&p);
+            break;
+        case 0:
+            a = uleb128(&p);
+            op = *p++;
+            switch (op) {
+            case DW_LNE_end_sequence:
+                /* end_sequence = 1; */
+                FILL_LINE();
+                addr = 0;
+                file = 1;
+                line = 1;
+                /* column = 0; */
+                is_stmt = header.default_is_stmt;
+                /* end_sequence = 0; */
+                /* isa = 0; */
+                break;
+            case DW_LNE_set_address:
+                addr = *(unsigned long *)p;
+                p += sizeof(unsigned long);
+                break;
+            case DW_LNE_define_file:
+                kprintf("Unsupported operation in %s\n",
+                        binary_filename);
+                break;
+            case DW_LNE_set_discriminator:
+                /* TODO:currently ignore */
+                uleb128(&p);
+                break;
+            default:
+                kprintf("Unknown extended opcode: %d in %s\n",
+                        op, binary_filename);
+            }
+            break;
+        default: {
+            uint8_t adjusted_opcode = op - header.opcode_base;
+            uint8_t operation_advance = adjusted_opcode / header.line_range;
+            /* NOTE: this code doesn't support VLIW */
+            addr += operation_advance * header.minimum_instruction_length;
+            line += header.line_base + (adjusted_opcode % header.line_range);
+            FILL_LINE();
+        }
+        }
+    }
+    *debug_line = (char *)p;
+    return 0;
 }
 
-static void
+static int
 parse_debug_line(int num_traces, void **traces,
-		 char *debug_line, unsigned long size,
-		 obj_info_t *obj, line_info_t *lines, int offset)
+                 const char *debug_line, unsigned long size,
+                 obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
 {
-    char *debug_line_end = debug_line + size;
+    const char *debug_line_end = debug_line + size;
     while (debug_line < debug_line_end) {
-	parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset);
+        if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset, errout))
+            return -1;
     }
     if (debug_line != debug_line_end) {
-	kprintf("Unexpected size of .debug_line in %s\n",
-		binary_filename);
+        kprintf("Unexpected size of .debug_line in %s\n",
+                binary_filename);
     }
+    return 0;
 }
 
 /* read file and fill lines */
 static uintptr_t
 fill_lines(int num_traces, void **traces, int check_debuglink,
-	   obj_info_t **objp, line_info_t *lines, int offset);
+           obj_info_t **objp, line_info_t *lines, int offset, FILE *errout);
 
 static void
-append_obj(obj_info_t **objp) {
+append_obj(obj_info_t **objp)
+{
     obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
     if (*objp) (*objp)->next = newobj;
     *objp = newobj;
 }
 
+#ifdef USE_ELF
+/* Ideally we should check 4 paths to follow gnu_debuglink:
+ *
+ *   - /usr/lib/debug/.build-id/ab/cdef1234.debug
+ *   - /usr/bin/ruby.debug
+ *   - /usr/bin/.debug/ruby.debug
+ *   - /usr/lib/debug/usr/bin/ruby.debug.
+ *
+ * but we handle only two cases for now as the two formats are
+ * used by some linux distributions.
+ *
+ * See GDB's info for detail.
+ * https://sourceware.org/gdb/onlinedocs/gdb/Separate-Debug-Files.html
+ */
+
+// check the path pattern of "/usr/lib/debug/usr/bin/ruby.debug"
 static void
-follow_debuglink(char *debuglink, int num_traces, void **traces,
-		 obj_info_t **objp, line_info_t *lines, int offset)
+follow_debuglink(const char *debuglink, int num_traces, void **traces,
+                 obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
 {
-    /* Ideally we should check 4 paths to follow gnu_debuglink,
-       but we handle only one case for now as this format is used
-       by some linux distributions. See GDB's info for detail. */
     static const char global_debug_dir[] = "/usr/lib/debug";
-    char *p, *subdir;
+    const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+    char *p;
     obj_info_t *o1 = *objp, *o2;
+    size_t len;
 
     p = strrchr(binary_filename, '/');
     if (!p) {
-	return;
+        return;
     }
     p[1] = '\0';
 
-    subdir = (char *)alloca(strlen(binary_filename) + 1);
-    strcpy(subdir, binary_filename);
-    strcpy(binary_filename, global_debug_dir);
-    strlcat(binary_filename, subdir, PATH_MAX);
-    strlcat(binary_filename, debuglink, PATH_MAX);
+    len = strlen(binary_filename);
+    if (len >= PATH_MAX - global_debug_dir_len)
+        len = PATH_MAX - global_debug_dir_len - 1;
+    memmove(binary_filename + global_debug_dir_len, binary_filename, len);
+    memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+    len += global_debug_dir_len;
+    strlcpy(binary_filename + len, debuglink, PATH_MAX - len);
+
+    append_obj(objp);
+    o2 = *objp;
+    o2->base_addr = o1->base_addr;
+    o2->path = o1->path;
+    fill_lines(num_traces, traces, 0, objp, lines, offset, errout);
+}
+
+// check the path pattern of "/usr/lib/debug/.build-id/ab/cdef1234.debug"
+static void
+follow_debuglink_build_id(const char *build_id, size_t build_id_size, int num_traces, void **traces,
+                          obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+{
+    static const char global_debug_dir[] = "/usr/lib/debug/.build-id/";
+    static const char debug_suffix[] = ".debug";
+    const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+    char *p;
+    obj_info_t *o1 = *objp, *o2;
+    size_t i;
+
+    if (PATH_MAX < global_debug_dir_len + build_id_size * 2 + sizeof(debug_suffix)) return;
+
+    memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+    p = binary_filename + global_debug_dir_len;
+    for (i = 0; i < build_id_size; i++) {
+        static const char tbl[] = "0123456789abcdef";
+        unsigned char n = build_id[i];
+        *p++ = tbl[n / 16];
+        *p++ = tbl[n % 16];
+        if (i == 0) *p++ = '/';
+    }
+    memcpy(p, debug_suffix, sizeof(debug_suffix));
 
     append_obj(objp);
     o2 = *objp;
     o2->base_addr = o1->base_addr;
     o2->path = o1->path;
-    fill_lines(num_traces, traces, 0, objp, lines, offset);
+    fill_lines(num_traces, traces, 0, objp, lines, offset, errout);
+}
+#endif
+
+enum
+{
+    DW_TAG_compile_unit = 0x11,
+    DW_TAG_inlined_subroutine = 0x1d,
+    DW_TAG_subprogram = 0x2e,
+};
+
+/* Attributes encodings */
+enum
+{
+    DW_AT_sibling = 0x01,
+    DW_AT_location = 0x02,
+    DW_AT_name = 0x03,
+    /* Reserved 0x04 */
+    /* Reserved 0x05 */
+    /* Reserved 0x06 */
+    /* Reserved 0x07 */
+    /* Reserved 0x08 */
+    DW_AT_ordering = 0x09,
+    /* Reserved 0x0a */
+    DW_AT_byte_size = 0x0b,
+    /* Reserved 0x0c */
+    DW_AT_bit_size = 0x0d,
+    /* Reserved 0x0e */
+    /* Reserved 0x0f */
+    DW_AT_stmt_list = 0x10,
+    DW_AT_low_pc = 0x11,
+    DW_AT_high_pc = 0x12,
+    DW_AT_language = 0x13,
+    /* Reserved 0x14 */
+    DW_AT_discr = 0x15,
+    DW_AT_discr_value = 0x16,
+    DW_AT_visibility = 0x17,
+    DW_AT_import = 0x18,
+    DW_AT_string_length = 0x19,
+    DW_AT_common_reference = 0x1a,
+    DW_AT_comp_dir = 0x1b,
+    DW_AT_const_value = 0x1c,
+    DW_AT_containing_type = 0x1d,
+    DW_AT_default_value = 0x1e,
+    /* Reserved 0x1f */
+    DW_AT_inline = 0x20,
+    DW_AT_is_optional = 0x21,
+    DW_AT_lower_bound = 0x22,
+    /* Reserved 0x23 */
+    /* Reserved 0x24 */
+    DW_AT_producer = 0x25,
+    /* Reserved 0x26 */
+    DW_AT_prototyped = 0x27,
+    /* Reserved 0x28 */
+    /* Reserved 0x29 */
+    DW_AT_return_addr = 0x2a,
+    /* Reserved 0x2b */
+    DW_AT_start_scope = 0x2c,
+    /* Reserved 0x2d */
+    DW_AT_bit_stride = 0x2e,
+    DW_AT_upper_bound = 0x2f,
+    /* Reserved 0x30 */
+    DW_AT_abstract_origin = 0x31,
+    DW_AT_accessibility = 0x32,
+    DW_AT_address_class = 0x33,
+    DW_AT_artificial = 0x34,
+    DW_AT_base_types = 0x35,
+    DW_AT_calling_convention = 0x36,
+    DW_AT_count = 0x37,
+    DW_AT_data_member_location = 0x38,
+    DW_AT_decl_column = 0x39,
+    DW_AT_decl_file = 0x3a,
+    DW_AT_decl_line = 0x3b,
+    DW_AT_declaration = 0x3c,
+    DW_AT_discr_list = 0x3d,
+    DW_AT_encoding = 0x3e,
+    DW_AT_external = 0x3f,
+    DW_AT_frame_base = 0x40,
+    DW_AT_friend = 0x41,
+    DW_AT_identifier_case = 0x42,
+    /* Reserved 0x43 */
+    DW_AT_namelist_item = 0x44,
+    DW_AT_priority = 0x45,
+    DW_AT_segment = 0x46,
+    DW_AT_specification = 0x47,
+    DW_AT_static_link = 0x48,
+    DW_AT_type = 0x49,
+    DW_AT_use_location = 0x4a,
+    DW_AT_variable_parameter = 0x4b,
+    DW_AT_virtuality = 0x4c,
+    DW_AT_vtable_elem_location = 0x4d,
+    DW_AT_allocated = 0x4e,
+    DW_AT_associated = 0x4f,
+    DW_AT_data_location = 0x50,
+    DW_AT_byte_stride = 0x51,
+    DW_AT_entry_pc = 0x52,
+    DW_AT_use_UTF8 = 0x53,
+    DW_AT_extension = 0x54,
+    DW_AT_ranges = 0x55,
+    DW_AT_trampoline = 0x56,
+    DW_AT_call_column = 0x57,
+    DW_AT_call_file = 0x58,
+    DW_AT_call_line = 0x59,
+    DW_AT_description = 0x5a,
+    DW_AT_binary_scale = 0x5b,
+    DW_AT_decimal_scale = 0x5c,
+    DW_AT_small = 0x5d,
+    DW_AT_decimal_sign = 0x5e,
+    DW_AT_digit_count = 0x5f,
+    DW_AT_picture_string = 0x60,
+    DW_AT_mutable = 0x61,
+    DW_AT_threads_scaled = 0x62,
+    DW_AT_explicit = 0x63,
+    DW_AT_object_pointer = 0x64,
+    DW_AT_endianity = 0x65,
+    DW_AT_elemental = 0x66,
+    DW_AT_pure = 0x67,
+    DW_AT_recursive = 0x68,
+    DW_AT_signature = 0x69,
+    DW_AT_main_subprogram = 0x6a,
+    DW_AT_data_bit_offset = 0x6b,
+    DW_AT_const_expr = 0x6c,
+    DW_AT_enum_class = 0x6d,
+    DW_AT_linkage_name = 0x6e,
+    DW_AT_string_length_bit_size = 0x6f,
+    DW_AT_string_length_byte_size = 0x70,
+    DW_AT_rank = 0x71,
+    DW_AT_str_offsets_base = 0x72,
+    DW_AT_addr_base = 0x73,
+    DW_AT_rnglists_base = 0x74,
+    /* Reserved 0x75 */
+    DW_AT_dwo_name = 0x76,
+    DW_AT_reference = 0x77,
+    DW_AT_rvalue_reference = 0x78,
+    DW_AT_macros = 0x79,
+    DW_AT_call_all_calls = 0x7a,
+    DW_AT_call_all_source_calls = 0x7b,
+    DW_AT_call_all_tail_calls = 0x7c,
+    DW_AT_call_return_pc = 0x7d,
+    DW_AT_call_value = 0x7e,
+    DW_AT_call_origin = 0x7f,
+    DW_AT_call_parameter = 0x80,
+    DW_AT_call_pc = 0x81,
+    DW_AT_call_tail_call = 0x82,
+    DW_AT_call_target = 0x83,
+    DW_AT_call_target_clobbered = 0x84,
+    DW_AT_call_data_location = 0x85,
+    DW_AT_call_data_value = 0x86,
+    DW_AT_noreturn = 0x87,
+    DW_AT_alignment = 0x88,
+    DW_AT_export_symbols = 0x89,
+    DW_AT_deleted = 0x8a,
+    DW_AT_defaulted = 0x8b,
+    DW_AT_loclists_base = 0x8c,
+    DW_AT_lo_user = 0x2000,
+    DW_AT_hi_user = 0x3fff
+};
+
+/* Attribute form encodings */
+enum
+{
+    DW_FORM_addr = 0x01,
+    /* Reserved 0x02 */
+    DW_FORM_block2 = 0x03,
+    DW_FORM_block4 = 0x04,
+    DW_FORM_data2 = 0x05,
+    DW_FORM_data4 = 0x06,
+    DW_FORM_data8 = 0x07,
+    DW_FORM_string = 0x08,
+    DW_FORM_block = 0x09,
+    DW_FORM_block1 = 0x0a,
+    DW_FORM_data1 = 0x0b,
+    DW_FORM_flag = 0x0c,
+    DW_FORM_sdata = 0x0d,
+    DW_FORM_strp = 0x0e,
+    DW_FORM_udata = 0x0f,
+    DW_FORM_ref_addr = 0x10,
+    DW_FORM_ref1 = 0x11,
+    DW_FORM_ref2 = 0x12,
+    DW_FORM_ref4 = 0x13,
+    DW_FORM_ref8 = 0x14,
+    DW_FORM_ref_udata = 0x15,
+    DW_FORM_indirect = 0x16,
+    DW_FORM_sec_offset = 0x17,
+    DW_FORM_exprloc = 0x18,
+    DW_FORM_flag_present = 0x19,
+    DW_FORM_strx = 0x1a,
+    DW_FORM_addrx = 0x1b,
+    DW_FORM_ref_sup4 = 0x1c,
+    DW_FORM_strp_sup = 0x1d,
+    DW_FORM_data16 = 0x1e,
+    DW_FORM_line_strp = 0x1f,
+    DW_FORM_ref_sig8 = 0x20,
+    DW_FORM_implicit_const = 0x21,
+    DW_FORM_loclistx = 0x22,
+    DW_FORM_rnglistx = 0x23,
+    DW_FORM_ref_sup8 = 0x24,
+    DW_FORM_strx1 = 0x25,
+    DW_FORM_strx2 = 0x26,
+    DW_FORM_strx3 = 0x27,
+    DW_FORM_strx4 = 0x28,
+    DW_FORM_addrx1 = 0x29,
+    DW_FORM_addrx2 = 0x2a,
+    DW_FORM_addrx3 = 0x2b,
+    DW_FORM_addrx4 = 0x2c,
+
+    /* GNU extensions for referring to .gnu_debugaltlink dwz-compressed info */
+    DW_FORM_GNU_ref_alt = 0x1f20,
+    DW_FORM_GNU_strp_alt = 0x1f21
+};
+
+/* Range list entry encodings */
+enum {
+    DW_RLE_end_of_list = 0x00,
+    DW_RLE_base_addressx = 0x01,
+    DW_RLE_startx_endx = 0x02,
+    DW_RLE_startx_length = 0x03,
+    DW_RLE_offset_pair = 0x04,
+    DW_RLE_base_address = 0x05,
+    DW_RLE_start_end = 0x06,
+    DW_RLE_start_length = 0x07
+};
+
+enum {
+    VAL_none = 0,
+    VAL_cstr = 1,
+    VAL_data = 2,
+    VAL_uint = 3,
+    VAL_int = 4,
+    VAL_addr = 5
+};
+
+# define ABBREV_TABLE_SIZE 256
+typedef struct {
+    obj_info_t *obj;
+    const char *file;
+    uint8_t current_version;
+    const char *current_cu;
+    uint64_t current_low_pc;
+    uint64_t current_str_offsets_base;
+    uint64_t current_addr_base;
+    uint64_t current_rnglists_base;
+    const char *debug_line_cu_end;
+    uint8_t debug_line_format;
+    uint16_t debug_line_version;
+    const char *debug_line_files;
+    const char *debug_line_directories;
+    const char *p;
+    const char *cu_end;
+    const char *pend;
+    const char *q0;
+    const char *q;
+    int format; // 4 or 8
+    uint8_t address_size;
+    int level;
+    const char *abbrev_table[ABBREV_TABLE_SIZE];
+} DebugInfoReader;
+
+typedef struct {
+    ptrdiff_t pos;
+    int tag;
+    int has_children;
+} DIE;
+
+typedef struct {
+    union {
+        const char *ptr;
+        uint64_t uint64;
+        int64_t int64;
+        uint64_t addr_idx;
+    } as;
+    uint64_t off;
+    uint64_t at;
+    uint64_t form;
+    size_t size;
+    int type;
+} DebugInfoValue;
+
+#if defined(WORDS_BIGENDIAN)
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(a)<<sz)|(b))
+#else
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(b)<<sz)|(a))
+#endif
+
+static uint16_t
+get_uint16(const uint8_t *p)
+{
+    return (uint16_t)MERGE_2INTS(p[0],p[1],8);
+}
+
+static uint32_t
+get_uint32(const uint8_t *p)
+{
+    return (uint32_t)MERGE_2INTS(get_uint16(p),get_uint16(p+2),16);
+}
+
+static uint64_t
+get_uint64(const uint8_t *p)
+{
+    return MERGE_2INTS(get_uint32(p),get_uint32(p+4),32);
+}
+
+static uint8_t
+read_uint8(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 1);
+    return (uint8_t)*p;
+}
+
+static uint16_t
+read_uint16(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 2);
+    return get_uint16((const uint8_t *)p);
+}
+
+static uint32_t
+read_uint24(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 3);
+    return ((uint8_t)*p << 16) | get_uint16((const uint8_t *)p+1);
+}
+
+static uint32_t
+read_uint32(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 4);
+    return get_uint32((const uint8_t *)p);
+}
+
+static uint64_t
+read_uint64(const char **ptr)
+{
+    const unsigned char *p = (const unsigned char *)*ptr;
+    *ptr = (char *)(p + 8);
+    return get_uint64(p);
+}
+
+static uintptr_t
+read_uintptr(const char **ptr)
+{
+    const unsigned char *p = (const unsigned char *)*ptr;
+    *ptr = (char *)(p + SIZEOF_VOIDP);
+#if SIZEOF_VOIDP == 8
+    return get_uint64(p);
+#else
+    return get_uint32(p);
+#endif
+}
+
+static uint64_t
+read_uint(DebugInfoReader *reader)
+{
+    if (reader->format == 4) {
+        return read_uint32(&reader->p);
+    } else { /* 64 bit */
+        return read_uint64(&reader->p);
+    }
+}
+
+static uint64_t
+read_uleb128(DebugInfoReader *reader)
+{
+    return uleb128(&reader->p);
+}
+
+static int64_t
+read_sleb128(DebugInfoReader *reader)
+{
+    return sleb128(&reader->p);
+}
+
+static void
+debug_info_reader_init(DebugInfoReader *reader, obj_info_t *obj)
+{
+    reader->file = obj->mapped;
+    reader->obj = obj;
+    reader->p = obj->debug_info.ptr;
+    reader->pend = obj->debug_info.ptr + obj->debug_info.size;
+    reader->debug_line_cu_end = obj->debug_line.ptr;
+    reader->current_low_pc = 0;
+    reader->current_str_offsets_base = 0;
+    reader->current_addr_base = 0;
+    reader->current_rnglists_base = 0;
+}
+
+static void
+di_skip_die_attributes(const char **p)
+{
+    for (;;) {
+        uint64_t at = uleb128(p);
+        uint64_t form = uleb128(p);
+        if (!at && !form) break;
+        switch (form) {
+          default:
+            break;
+          case DW_FORM_implicit_const:
+            sleb128(p);
+            break;
+        }
+    }
+}
+
+static void
+di_read_debug_abbrev_cu(DebugInfoReader *reader)
+{
+    uint64_t prev = 0;
+    const char *p = reader->q0;
+    for (;;) {
+        uint64_t abbrev_number = uleb128(&p);
+        if (abbrev_number <= prev) break;
+        if (abbrev_number < ABBREV_TABLE_SIZE) {
+            reader->abbrev_table[abbrev_number] = p;
+        }
+        prev = abbrev_number;
+        uleb128(&p); /* tag */
+        p++; /* has_children */
+        di_skip_die_attributes(&p);
+    }
+}
+
+static int
+di_read_debug_line_cu(DebugInfoReader *reader, FILE *errout)
+{
+    const char *p;
+    struct LineNumberProgramHeader header;
+
+    p = (const char *)reader->debug_line_cu_end;
+    if (parse_debug_line_header(reader->obj, &p, &header, errout))
+        return -1;
+
+    reader->debug_line_cu_end = (char *)header.cu_end;
+    reader->debug_line_format = header.format;
+    reader->debug_line_version = header.version;
+    reader->debug_line_directories = (char *)header.include_directories;
+    reader->debug_line_files = (char *)header.filenames;
+
+    return 0;
+}
+
+static void
+set_addr_idx_value(DebugInfoValue *v, uint64_t n)
+{
+    v->as.addr_idx = n;
+    v->type = VAL_addr;
+}
+
+static void
+set_uint_value(DebugInfoValue *v, uint64_t n)
+{
+    v->as.uint64 = n;
+    v->type = VAL_uint;
+}
+
+static void
+set_int_value(DebugInfoValue *v, int64_t n)
+{
+    v->as.int64 = n;
+    v->type = VAL_int;
+}
+
+static void
+set_cstr_value(DebugInfoValue *v, const char *s)
+{
+    v->as.ptr = s;
+    v->off = 0;
+    v->type = VAL_cstr;
+}
+
+static void
+set_cstrp_value(DebugInfoValue *v, const char *s, uint64_t off)
+{
+    v->as.ptr = s;
+    v->off = off;
+    v->type = VAL_cstr;
+}
+
+static void
+set_data_value(DebugInfoValue *v, const char *s)
+{
+    v->as.ptr = s;
+    v->type = VAL_data;
+}
+
+static const char *
+get_cstr_value(DebugInfoValue *v)
+{
+    if (v->as.ptr) {
+        return v->as.ptr + v->off;
+    } else {
+        return NULL;
+    }
+}
+
+static const char *
+resolve_strx(DebugInfoReader *reader, uint64_t idx)
+{
+    const char *p = reader->obj->debug_str_offsets.ptr + reader->current_str_offsets_base;
+    uint64_t off;
+    if (reader->format == 4) {
+        off = ((uint32_t *)p)[idx];
+    }
+    else {
+        off = ((uint64_t *)p)[idx];
+    }
+    return reader->obj->debug_str.ptr + off;
+}
+
+static bool
+debug_info_reader_read_addr_value_member(DebugInfoReader *reader, DebugInfoValue *v, int size)
+{
+    if (size == 4) {
+        set_uint_value(v, read_uint32(&reader->p));
+    } else if (size == 8) {
+        set_uint_value(v, read_uint64(&reader->p));
+    } else {
+        return false;
+    }
+    return true;
+}
+
+#define debug_info_reader_read_addr_value(reader, v, mem) \
+    if (!debug_info_reader_read_addr_value_member((reader), (v), (reader)->mem)) { \
+        kprintf("unknown " #mem ":%d", (reader)->mem); \
+        return false; \
+    }
+
+
+static bool
+debug_info_reader_read_value(DebugInfoReader *reader, uint64_t form, DebugInfoValue *v, FILE *errout)
+{
+    switch (form) {
+      case DW_FORM_addr:
+        debug_info_reader_read_addr_value(reader, v, address_size);
+        break;
+      case DW_FORM_block2:
+        v->size = read_uint16(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_block4:
+        v->size = read_uint32(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_data2:
+        set_uint_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_data4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_data8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_string:
+        v->size = strlen(reader->p);
+        set_cstr_value(v, reader->p);
+        reader->p += v->size + 1;
+        break;
+      case DW_FORM_block:
+        v->size = uleb128(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_block1:
+        v->size = read_uint8(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_data1:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_flag:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_sdata:
+        set_int_value(v, read_sleb128(reader));
+        break;
+      case DW_FORM_strp:
+        set_cstrp_value(v, reader->obj->debug_str.ptr, read_uint(reader));
+        break;
+      case DW_FORM_udata:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_ref_addr:
+        if (reader->current_version <= 2) {
+            // DWARF Version 2 specifies that references have
+            // the same size as an address on the target system
+            debug_info_reader_read_addr_value(reader, v, address_size);
+        } else {
+            debug_info_reader_read_addr_value(reader, v, format);
+        }
+        break;
+      case DW_FORM_ref1:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_ref2:
+        set_uint_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_ref4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_ref8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_ref_udata:
+        set_uint_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_indirect:
+        /* TODO: read the referred value */
+        set_uint_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_sec_offset:
+        set_uint_value(v, read_uint(reader)); /* offset */
+        /* addrptr: debug_addr */
+        /* lineptr: debug_line */
+        /* loclist: debug_loclists */
+        /* loclistptr: debug_loclists */
+        /* macptr: debug_macro */
+        /* rnglist: debug_rnglists */
+        /* rnglistptr: debug_rnglists */
+        /* stroffsetsptr: debug_str_offsets */
+        break;
+      case DW_FORM_exprloc:
+        v->size = (size_t)read_uleb128(reader);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_flag_present:
+        set_uint_value(v, 1);
+        break;
+      case DW_FORM_strx:
+        set_cstr_value(v, resolve_strx(reader, uleb128(&reader->p)));
+        break;
+      case DW_FORM_addrx:
+        set_addr_idx_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_ref_sup4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_strp_sup:
+        set_uint_value(v, read_uint(reader));
+        /* *p = reader->sup_file + reader->sup_str->sh_offset + ret; */
+        break;
+      case DW_FORM_data16:
+        v->size = 16;
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_line_strp:
+        set_cstrp_value(v, reader->obj->debug_line_str.ptr, read_uint(reader));
+        break;
+      case DW_FORM_ref_sig8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_implicit_const:
+        set_int_value(v, sleb128(&reader->q));
+        break;
+      case DW_FORM_loclistx:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_rnglistx:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_ref_sup8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_strx1:
+        set_cstr_value(v, resolve_strx(reader, read_uint8(&reader->p)));
+        break;
+      case DW_FORM_strx2:
+        set_cstr_value(v, resolve_strx(reader, read_uint16(&reader->p)));
+        break;
+      case DW_FORM_strx3:
+        set_cstr_value(v, resolve_strx(reader, read_uint24(&reader->p)));
+        break;
+      case DW_FORM_strx4:
+        set_cstr_value(v, resolve_strx(reader, read_uint32(&reader->p)));
+        break;
+      case DW_FORM_addrx1:
+        set_addr_idx_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_addrx2:
+        set_addr_idx_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_addrx3:
+        set_addr_idx_value(v, read_uint24(&reader->p));
+        break;
+      case DW_FORM_addrx4:
+        set_addr_idx_value(v, read_uint32(&reader->p));
+        break;
+      /* we have no support for actually reading the real values of these refs out
+       * of the .gnu_debugaltlink dwz-compressed debuginfo at the moment, but "read"
+       * them anyway so that we advance the reader by the right amount. */
+      case DW_FORM_GNU_ref_alt:
+      case DW_FORM_GNU_strp_alt:
+        read_uint(reader);
+        set_uint_value(v, 0);
+        break;
+      case 0:
+        goto fail;
+        break;
+    }
+    return true;
+
+  fail:
+    kprintf("%d: unsupported form: %#"PRIx64"\n", __LINE__, form);
+    return false;
+}
+
+/* find abbrev in current compilation unit */
+static const char *
+di_find_abbrev(DebugInfoReader *reader, uint64_t abbrev_number, FILE *errout)
+{
+    const char *p;
+    if (abbrev_number < ABBREV_TABLE_SIZE) {
+        return reader->abbrev_table[abbrev_number];
+    }
+    p = reader->abbrev_table[ABBREV_TABLE_SIZE-1];
+    /* skip 255th record */
+    uleb128(&p); /* tag */
+    p++; /* has_children */
+    di_skip_die_attributes(&p);
+    for (uint64_t n = uleb128(&p); abbrev_number != n; n = uleb128(&p)) {
+        if (n == 0) {
+            kprintf("%d: Abbrev Number %"PRId64" not found\n",__LINE__, abbrev_number);
+            return NULL;
+        }
+        uleb128(&p); /* tag */
+        p++; /* has_children */
+        di_skip_die_attributes(&p);
+    }
+    return p;
+}
+
+#if 0
+static void
+hexdump0(const unsigned char *p, size_t n, FILE *errout)
+{
+    size_t i;
+    kprintf("     0  1  2  3  4  5  6  7  8  9  A  B  C  D  E  F\n");
+    for (i=0; i < n; i++){
+        switch (i & 15) {
+          case 0:
+            kprintf("%02" PRIdSIZE ": %02X ", i/16, p[i]);
+            break;
+          case 15:
+            kprintf("%02X\n", p[i]);
+            break;
+          default:
+            kprintf("%02X ", p[i]);
+            break;
+        }
+    }
+    if ((i & 15) != 15) {
+        kprintf("\n");
+    }
+}
+#define hexdump(p,n,e) hexdump0((const unsigned char *)p, n, e)
+
+static void
+div_inspect(DebugInfoValue *v, FILE *errout)
+{
+    switch (v->type) {
+      case VAL_uint:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:%"PRIx64"\n",__LINE__,v->type,v->size,v->as.uint64);
+        break;
+      case VAL_int:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:%"PRId64"\n",__LINE__,v->type,v->size,(int64_t)v->as.uint64);
+        break;
+      case VAL_cstr:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:'%s'\n",__LINE__,v->type,v->size,v->as.ptr);
+        break;
+      case VAL_data:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:\n",__LINE__,v->type,v->size);
+        hexdump(v->as.ptr, 16, errout);
+        break;
+    }
+}
+#endif
+
+static DIE *
+di_read_die(DebugInfoReader *reader, DIE *die, FILE *errout)
+{
+    uint64_t abbrev_number = uleb128(&reader->p);
+    if (abbrev_number == 0) {
+        reader->level--;
+        return NULL;
+    }
+
+    if (!(reader->q = di_find_abbrev(reader, abbrev_number, errout))) return NULL;
+
+    die->pos = reader->p - reader->obj->debug_info.ptr - 1;
+    die->tag = (int)uleb128(&reader->q); /* tag */
+    die->has_children = *reader->q++; /* has_children */
+    if (die->has_children) {
+        reader->level++;
+    }
+    return die;
+}
+
+static DebugInfoValue *
+di_read_record(DebugInfoReader *reader, DebugInfoValue *vp, FILE *errout)
+{
+    uint64_t at = uleb128(&reader->q);
+    uint64_t form = uleb128(&reader->q);
+    if (!at || !form) return NULL;
+    vp->at = at;
+    vp->form = form;
+    if (!debug_info_reader_read_value(reader, form, vp, errout)) return NULL;
+    return vp;
+}
+
+static bool
+di_skip_records(DebugInfoReader *reader, FILE *errout)
+{
+    for (;;) {
+        DebugInfoValue v = {{0}};
+        uint64_t at = uleb128(&reader->q);
+        uint64_t form = uleb128(&reader->q);
+        if (!at || !form) return true;
+        if (!debug_info_reader_read_value(reader, form, &v, errout)) return false;
+    }
+}
+
+typedef struct addr_header {
+    const char *ptr;
+    uint64_t unit_length;
+    uint8_t format;
+    uint8_t address_size;
+    /* uint8_t segment_selector_size; */
+} addr_header_t;
+
+static bool
+addr_header_init(obj_info_t *obj, addr_header_t *header, FILE *errout)
+{
+    const char *p = obj->debug_addr.ptr;
+
+    header->ptr = p;
+
+    if (!p) return true;
+
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
+    }
+
+    p += 2; /* version */
+    header->address_size = *p++;
+    if (header->address_size != 4 && header->address_size != 8) {
+        kprintf("unknown address_size:%d", header->address_size);
+        return false;
+    }
+    p++; /* segment_selector_size */
+    return true;
+}
+
+static uint64_t
+read_addr(addr_header_t *header, uint64_t addr_base, uint64_t idx) {
+    if (header->address_size == 4) {
+        return ((uint32_t*)(header->ptr + addr_base))[idx];
+    }
+    else {
+        return ((uint64_t*)(header->ptr + addr_base))[idx];
+    }
+}
+
+typedef struct rnglists_header {
+    uint64_t unit_length;
+    uint8_t format;
+    uint8_t address_size;
+    uint32_t offset_entry_count;
+} rnglists_header_t;
+
+static bool
+rnglists_header_init(obj_info_t *obj, rnglists_header_t *header, FILE *errout)
+{
+    const char *p = obj->debug_rnglists.ptr;
+
+    if (!p) return true;
+
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
+    }
+
+    p += 2; /* version */
+    header->address_size = *p++;
+    if (header->address_size != 4 && header->address_size != 8) {
+        kprintf("unknown address_size:%d", header->address_size);
+        return false;
+    }
+    p++; /* segment_selector_size */
+    header->offset_entry_count = *(uint32_t *)p;
+    return true;
+}
+
+typedef struct {
+    uint64_t low_pc;
+    uint64_t high_pc;
+    uint64_t ranges;
+    bool low_pc_set;
+    bool high_pc_set;
+    bool ranges_set;
+} ranges_t;
+
+static void
+ranges_set(ranges_t *ptr, DebugInfoValue *v, addr_header_t *addr_header, uint64_t addr_base)
+{
+    uint64_t n = 0;
+    if (v->type == VAL_uint) {
+        n = v->as.uint64;
+    }
+    else if (v->type == VAL_addr) {
+        n = read_addr(addr_header, addr_base, v->as.addr_idx);
+    }
+    switch (v->at) {
+      case DW_AT_low_pc:
+        ptr->low_pc = n;
+        ptr->low_pc_set = true;
+        break;
+      case DW_AT_high_pc:
+        if (v->form == DW_FORM_addr) {
+            ptr->high_pc = n;
+        }
+        else {
+            ptr->high_pc = ptr->low_pc + n;
+        }
+        ptr->high_pc_set = true;
+        break;
+      case DW_AT_ranges:
+        ptr->ranges = n;
+        ptr->ranges_set = true;
+        break;
+    }
+}
+
+static uint64_t
+read_dw_form_addr(DebugInfoReader *reader, const char **ptr, FILE *errout)
+{
+    const char *p = *ptr;
+    *ptr = p + reader->address_size;
+    if (reader->address_size == 4) {
+        return read_uint32(&p);
+    } else {
+        return read_uint64(&p);
+    }
+}
+
+static uintptr_t
+ranges_include(DebugInfoReader *reader, ranges_t *ptr, uint64_t addr, rnglists_header_t *rnglists_header, FILE *errout)
+{
+    if (ptr->high_pc_set) {
+        if (ptr->ranges_set || !ptr->low_pc_set) {
+            return UINTPTR_MAX;
+        }
+        if (ptr->low_pc <= addr && addr <= ptr->high_pc) {
+            return (uintptr_t)ptr->low_pc;
+        }
+    }
+    else if (ptr->ranges_set) {
+        /* TODO: support base address selection entry */
+        const char *p;
+        uint64_t base = ptr->low_pc_set ? ptr->low_pc : reader->current_low_pc;
+        bool base_valid = true;
+        if (reader->current_version >= 5) {
+            if (rnglists_header->offset_entry_count == 0) {
+                // DW_FORM_sec_offset
+                p = reader->obj->debug_rnglists.ptr + ptr->ranges + reader->current_rnglists_base;
+            }
+            else {
+                // DW_FORM_rnglistx
+                const char *offset_array = reader->obj->debug_rnglists.ptr + reader->current_rnglists_base;
+                if (rnglists_header->format == 4) {
+                    p = offset_array + ((uint32_t *)offset_array)[ptr->ranges];
+                }
+                else {
+                    p = offset_array + ((uint64_t *)offset_array)[ptr->ranges];
+                }
+            }
+            for (;;) {
+                uint8_t rle = read_uint8(&p);
+                uintptr_t from = 0, to = 0;
+                if (rle == DW_RLE_end_of_list) break;
+                switch (rle) {
+                  case DW_RLE_base_addressx:
+                    uleb128(&p);
+                    base_valid = false; /* not supported yet */
+                    break;
+                  case DW_RLE_startx_endx:
+                    uleb128(&p);
+                    uleb128(&p);
+                    break;
+                  case DW_RLE_startx_length:
+                    uleb128(&p);
+                    uleb128(&p);
+                    break;
+                  case DW_RLE_offset_pair:
+                    if (!base_valid) break;
+                    from = (uintptr_t)base + uleb128(&p);
+                    to = (uintptr_t)base + uleb128(&p);
+                    break;
+                  case DW_RLE_base_address:
+                    base = read_dw_form_addr(reader, &p, errout);
+                    base_valid = true;
+                    break;
+                  case DW_RLE_start_end:
+                    from = (uintptr_t)read_dw_form_addr(reader, &p, errout);
+                    to = (uintptr_t)read_dw_form_addr(reader, &p, errout);
+                    break;
+                  case DW_RLE_start_length:
+                    from = (uintptr_t)read_dw_form_addr(reader, &p, errout);
+                    to = from + uleb128(&p);
+                    break;
+                }
+                if (from <= addr && addr < to) {
+                    return from;
+                }
+            }
+            return 0;
+        }
+        p = reader->obj->debug_ranges.ptr + ptr->ranges;
+        for (;;) {
+            uintptr_t from = read_uintptr(&p);
+            uintptr_t to = read_uintptr(&p);
+            if (!from && !to) break;
+            if (from == UINTPTR_MAX) {
+                /* base address selection entry */
+                base = to;
+            }
+            else if (base + from <= addr && addr < base + to) {
+                return (uintptr_t)base + from;
+            }
+        }
+    }
+    else if (ptr->low_pc_set) {
+        if (ptr->low_pc == addr) {
+            return (uintptr_t)ptr->low_pc;
+        }
+    }
+    return 0;
+}
+
+#if 0
+static void
+ranges_inspect(DebugInfoReader *reader, ranges_t *ptr, FILE *errout)
+{
+    if (ptr->high_pc_set) {
+        if (ptr->ranges_set || !ptr->low_pc_set) {
+            kprintf("low_pc_set:%d high_pc_set:%d ranges_set:%d\n",ptr->low_pc_set,ptr->high_pc_set,ptr->ranges_set);
+            return;
+        }
+        kprintf("low_pc:%"PRIx64" high_pc:%"PRIx64"\n",ptr->low_pc,ptr->high_pc);
+    }
+    else if (ptr->ranges_set) {
+        char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
+        kprintf("low_pc:%"PRIx64" ranges:%"PRIx64" %lx ",ptr->low_pc,ptr->ranges, p-reader->obj->mapped);
+        for (;;) {
+            uintptr_t from = read_uintptr(&p);
+            uintptr_t to = read_uintptr(&p);
+            if (!from && !to) break;
+            kprintf("%"PRIx64"-%"PRIx64" ",ptr->low_pc+from,ptr->low_pc+to);
+        }
+        kprintf("\n");
+    }
+    else if (ptr->low_pc_set) {
+        kprintf("low_pc:%"PRIx64"\n",ptr->low_pc);
+    }
+    else {
+        kprintf("empty\n");
+    }
+}
+#endif
+
+static int
+di_read_cu(DebugInfoReader *reader, FILE *errout)
+{
+    uint64_t unit_length;
+    uint16_t version;
+    uint64_t debug_abbrev_offset;
+    reader->format = 4;
+    reader->current_cu = reader->p;
+    unit_length = read_uint32(&reader->p);
+    if (unit_length == 0xffffffff) {
+        unit_length = read_uint64(&reader->p);
+        reader->format = 8;
+    }
+    reader->cu_end = reader->p + unit_length;
+    version = read_uint16(&reader->p);
+    reader->current_version = version;
+    if (version > 5) {
+        return -1;
+    }
+    else if (version == 5) {
+        /* unit_type = */ read_uint8(&reader->p);
+        reader->address_size = read_uint8(&reader->p);
+        debug_abbrev_offset = read_uint(reader);
+    }
+    else {
+        debug_abbrev_offset = read_uint(reader);
+        reader->address_size = read_uint8(&reader->p);
+    }
+    if (reader->address_size != 4 && reader->address_size != 8) {
+        kprintf("unknown address_size:%d", reader->address_size);
+        return -1;
+    }
+    reader->q0 = reader->obj->debug_abbrev.ptr + debug_abbrev_offset;
+
+    reader->level = 0;
+    di_read_debug_abbrev_cu(reader);
+    if (di_read_debug_line_cu(reader, errout)) return -1;
+
+    do {
+        DIE die;
+
+        if (!di_read_die(reader, &die, errout)) continue;
+
+        if (die.tag != DW_TAG_compile_unit) {
+            if (!di_skip_records(reader, errout)) return -1;
+            break;
+        }
+
+        reader->current_str_offsets_base = 0;
+        reader->current_addr_base = 0;
+        reader->current_rnglists_base = 0;
+
+        DebugInfoValue low_pc = {{0}};
+        /* enumerate abbrev */
+        for (;;) {
+            DebugInfoValue v = {{0}};
+            if (!di_read_record(reader, &v, errout)) break;
+            switch (v.at) {
+              case DW_AT_low_pc:
+                // clang may output DW_AT_addr_base after DW_AT_low_pc.
+                // We need to resolve the DW_FORM_addr* after DW_AT_addr_base is parsed.
+                low_pc = v;
+                break;
+              case DW_AT_str_offsets_base:
+                reader->current_str_offsets_base = v.as.uint64;
+                break;
+              case DW_AT_addr_base:
+                reader->current_addr_base = v.as.uint64;
+                break;
+              case DW_AT_rnglists_base:
+                reader->current_rnglists_base = v.as.uint64;
+                break;
+            }
+        }
+        // Resolve the DW_FORM_addr of DW_AT_low_pc
+        switch (low_pc.type) {
+            case VAL_uint:
+                reader->current_low_pc = low_pc.as.uint64;
+                break;
+            case VAL_addr:
+                {
+                    addr_header_t header = {0};
+                    if (!addr_header_init(reader->obj, &header, errout)) return -1;
+                    reader->current_low_pc = read_addr(&header, reader->current_addr_base, low_pc.as.addr_idx);
+                }
+                break;
+        }
+    } while (0);
+
+    return 0;
+}
+
+static void
+read_abstract_origin(DebugInfoReader *reader, uint64_t form, uint64_t abstract_origin, line_info_t *line, FILE *errout)
+{
+    const char *p = reader->p;
+    const char *q = reader->q;
+    int level = reader->level;
+    DIE die;
+
+    switch (form) {
+      case DW_FORM_ref1:
+      case DW_FORM_ref2:
+      case DW_FORM_ref4:
+      case DW_FORM_ref8:
+      case DW_FORM_ref_udata:
+        reader->p = reader->current_cu + abstract_origin;
+        break;
+      case DW_FORM_ref_addr:
+        goto finish; /* not supported yet */
+      case DW_FORM_ref_sig8:
+        goto finish; /* not supported yet */
+      case DW_FORM_ref_sup4:
+      case DW_FORM_ref_sup8:
+        goto finish; /* not supported yet */
+      default:
+        goto finish;
+    }
+    if (!di_read_die(reader, &die, errout)) goto finish;
+
+    /* enumerate abbrev */
+    for (;;) {
+        DebugInfoValue v = {{0}};
+        if (!di_read_record(reader, &v, errout)) break;
+        switch (v.at) {
+          case DW_AT_name:
+            line->sname = get_cstr_value(&v);
+            break;
+        }
+    }
+
+  finish:
+    reader->p = p;
+    reader->q = q;
+    reader->level = level;
+}
+
+static bool
+debug_info_read(DebugInfoReader *reader, int num_traces, void **traces,
+                line_info_t *lines, int offset, FILE *errout)
+{
+
+    addr_header_t addr_header = {0};
+    if (!addr_header_init(reader->obj, &addr_header, errout)) return false;
+
+    rnglists_header_t rnglists_header = {0};
+    if (!rnglists_header_init(reader->obj, &rnglists_header, errout)) return false;
+
+    while (reader->p < reader->cu_end) {
+        DIE die;
+        ranges_t ranges = {0};
+        line_info_t line = {0};
+
+        if (!di_read_die(reader, &die, errout)) continue;
+        /* kprintf("%d:%tx: <%d>\n",__LINE__,die.pos,reader->level,die.tag); */
+
+        if (die.tag != DW_TAG_subprogram && die.tag != DW_TAG_inlined_subroutine) {
+          skip_die:
+            if (!di_skip_records(reader, errout)) return false;
+            continue;
+        }
+
+        /* enumerate abbrev */
+        for (;;) {
+            DebugInfoValue v = {{0}};
+            /* ptrdiff_t pos = reader->p - reader->p0; */
+            if (!di_read_record(reader, &v, errout)) break;
+            /* kprintf("\n%d:%tx: AT:%lx FORM:%lx\n",__LINE__,pos,v.at,v.form); */
+            /* div_inspect(&v, errout); */
+            switch (v.at) {
+              case DW_AT_name:
+                line.sname = get_cstr_value(&v);
+                break;
+              case DW_AT_call_file:
+                fill_filename((int)v.as.uint64, reader->debug_line_format, reader->debug_line_version, reader->debug_line_directories, reader->debug_line_files, &line, reader->obj, errout);
+                break;
+              case DW_AT_call_line:
+                line.line = (int)v.as.uint64;
+                break;
+              case DW_AT_low_pc:
+              case DW_AT_high_pc:
+              case DW_AT_ranges:
+                ranges_set(&ranges, &v, &addr_header, reader->current_addr_base);
+                break;
+              case DW_AT_declaration:
+                goto skip_die;
+              case DW_AT_inline:
+                /* 1 or 3 */
+                break; /* goto skip_die; */
+              case DW_AT_abstract_origin:
+                read_abstract_origin(reader, v.form, v.as.uint64, &line, errout);
+                break; /* goto skip_die; */
+            }
+        }
+        /* ranges_inspect(reader, &ranges, errout); */
+        /* kprintf("%d:%tx: %x ",__LINE__,diepos,die.tag); */
+        for (int i=offset; i < num_traces; i++) {
+            uintptr_t addr = (uintptr_t)traces[i];
+            uintptr_t offset = addr - reader->obj->base_addr + reader->obj->vmaddr;
+            uintptr_t saddr = ranges_include(reader, &ranges, offset, &rnglists_header, errout);
+            if (saddr == UINTPTR_MAX) return false;
+            if (saddr) {
+                /* kprintf("%d:%tx: %d %lx->%lx %x %s: %s/%s %d %s %s %s\n",__LINE__,die.pos, i,addr,offset, die.tag,line.sname,line.dirname,line.filename,line.line,reader->obj->path,line.sname,lines[i].sname); */
+                if (lines[i].sname) {
+                    line_info_t *lp = malloc(sizeof(line_info_t));
+                    memcpy(lp, &lines[i], sizeof(line_info_t));
+                    lines[i].next = lp;
+                    lp->dirname = line.dirname;
+                    lp->filename = line.filename;
+                    lp->line = line.line;
+                    lp->saddr = 0;
+                }
+                lines[i].path = reader->obj->path;
+                lines[i].base_addr = line.base_addr;
+                lines[i].sname = line.sname;
+                lines[i].saddr = saddr + reader->obj->base_addr - reader->obj->vmaddr;
+            }
+        }
+    }
+    return true;
+}
+
+// This function parses the following attributes of Line Number Program Header in DWARF 5:
+//
+// * directory_entry_format_count
+// * directory_entry_format
+// * directories_count
+// * directories
+//
+// or
+//
+// * file_name_entry_format_count
+// * file_name_entry_format
+// * file_names_count
+// * file_names
+//
+// It records DW_LNCT_path and DW_LNCT_directory_index at the index "idx".
+static const char *
+parse_ver5_debug_line_header(const char *p, int idx, uint8_t format,
+                             obj_info_t *obj, const char **out_path,
+                             uint64_t *out_directory_index, FILE *errout)
+{
+    int i, j;
+    int entry_format_count = *(uint8_t *)p++;
+    const char *entry_format = p;
+
+    /* skip the part of entry_format */
+    for (i = 0; i < entry_format_count * 2; i++) uleb128(&p);
+
+    int entry_count = (int)uleb128(&p);
+
+    DebugInfoReader reader = {0};
+    debug_info_reader_init(&reader, obj);
+    reader.format = format;
+    reader.p = p;
+    for (j = 0; j < entry_count; j++) {
+        const char *format = entry_format;
+        for (i = 0; i < entry_format_count; i++) {
+            DebugInfoValue v = {{0}};
+            unsigned long dw_lnct = uleb128(&format);
+            unsigned long dw_form = uleb128(&format);
+            if (!debug_info_reader_read_value(&reader, dw_form, &v, errout)) return 0;
+            if (dw_lnct == 1 /* DW_LNCT_path */ && v.type == VAL_cstr && out_path)
+                *out_path = v.as.ptr + v.off;
+            if (dw_lnct == 2 /* DW_LNCT_directory_index */ && v.type == VAL_uint && out_directory_index)
+                *out_directory_index = v.as.uint64;
+        }
+        if (j == idx) return 0;
+    }
+
+    return reader.p;
+}
+
+#ifdef USE_ELF
+static unsigned long
+uncompress_debug_section(ElfW(Shdr) *shdr, char *file, char **ptr)
+{
+    *ptr = NULL;
+#ifdef SUPPORT_COMPRESSED_DEBUG_LINE
+    ElfW(Chdr) *chdr = (ElfW(Chdr) *)(file + shdr->sh_offset);
+    unsigned long destsize = chdr->ch_size;
+    int ret = 0;
+
+    if (chdr->ch_type != ELFCOMPRESS_ZLIB) {
+        /* unsupported compression type */
+        return 0;
+    }
+
+    *ptr = malloc(destsize);
+    if (!*ptr) return 0;
+    ret = uncompress((Bytef *)*ptr, &destsize,
+            (const Bytef*)chdr + sizeof(ElfW(Chdr)),
+            shdr->sh_size - sizeof(ElfW(Chdr)));
+    if (ret != Z_OK) goto fail;
+    return destsize;
+
+fail:
+    free(*ptr);
+    *ptr = NULL;
+#endif
+    return 0;
 }
 
 /* read file and fill lines */
 static uintptr_t
 fill_lines(int num_traces, void **traces, int check_debuglink,
-	   obj_info_t **objp, line_info_t *lines, int offset)
+           obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
 {
     int i, j;
     char *shstr;
-    char *section_name;
     ElfW(Ehdr) *ehdr;
     ElfW(Shdr) *shdr, *shstr_shdr;
-    ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
+    ElfW(Shdr) *gnu_debuglink_shdr = NULL;
+    ElfW(Shdr) *note_gnu_build_id = NULL;
     int fd;
     off_t filesize;
     char *file;
@@ -479,43 +2072,41 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
 
     fd = open(binary_filename, O_RDONLY);
     if (fd < 0) {
-	goto fail;
+        goto fail;
     }
     filesize = lseek(fd, 0, SEEK_END);
     if (filesize < 0) {
-	int e = errno;
-	close(fd);
-	kprintf("lseek: %s\n", strerror(e));
-	goto fail;
+        int e = errno;
+        close(fd);
+        kprintf("lseek: %s\n", strerror(e));
+        goto fail;
     }
 #if SIZEOF_OFF_T > SIZEOF_SIZE_T
     if (filesize > (off_t)SIZE_MAX) {
-	close(fd);
-	kprintf("Too large file %s\n", binary_filename);
-	goto fail;
+        close(fd);
+        kprintf("Too large file %s\n", binary_filename);
+        goto fail;
     }
 #endif
     lseek(fd, 0, SEEK_SET);
     /* async-signal unsafe */
     file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
     if (file == MAP_FAILED) {
-	int e = errno;
-	close(fd);
-	kprintf("mmap: %s\n", strerror(e));
-	goto fail;
+        int e = errno;
+        close(fd);
+        kprintf("mmap: %s\n", strerror(e));
+        goto fail;
     }
+    close(fd);
 
     ehdr = (ElfW(Ehdr) *)file;
     if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
-	/*
-	 * Huh? Maybe filename was overridden by setproctitle() and
-	 * it match non-elf file.
-	 */
-	close(fd);
-	goto fail;
+        /*
+         * Huh? Maybe filename was overridden by setproctitle() and
+         * it match non-elf file.
+         */
+        goto fail;
     }
-
-    obj->fd = fd;
     obj->mapped = file;
     obj->mapped_size = (size_t)filesize;
 
@@ -525,152 +2116,506 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
     shstr = file + shstr_shdr->sh_offset;
 
     for (i = 0; i < ehdr->e_shnum; i++) {
-	section_name = shstr + shdr[i].sh_name;
-	switch (shdr[i].sh_type) {
-	  case SHT_STRTAB:
-	    if (!strcmp(section_name, ".strtab")) {
-		strtab_shdr = shdr + i;
-	    }
-	    else if (!strcmp(section_name, ".dynstr")) {
-		dynstr_shdr = shdr + i;
-	    }
-	    break;
-	  case SHT_SYMTAB:
-	    /* if (!strcmp(section_name, ".symtab")) */
-	    symtab_shdr = shdr + i;
-	    break;
-	  case SHT_DYNSYM:
-	    /* if (!strcmp(section_name, ".dynsym")) */
-	    dynsym_shdr = shdr + i;
-	    break;
-	  case SHT_PROGBITS:
-	    if (!strcmp(section_name, ".debug_line")) {
-		debug_line_shdr = shdr + i;
-	    }
-	    else if (!strcmp(section_name, ".gnu_debuglink")) {
-		gnu_debuglink_shdr = shdr + i;
-	    }
-	    break;
-	}
-    }
-
-    if (offset == -1) {
-	/* main executable */
-	offset = 0;
-	if (dynsym_shdr && dynstr_shdr) {
-	    char *strtab = file + dynstr_shdr->sh_offset;
-	    ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
-	    int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
-	    for (j = 0; j < symtab_count; j++) {
-		ElfW(Sym) *sym = &symtab[j];
-		Dl_info info;
-		void *h, *s;
-		if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
-		h = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
-		if (!h) continue;
-		s = dlsym(h, strtab + sym->st_name);
-		if (!s) continue;
-		if (dladdr(s, &info)) {
-		    dladdr_fbase = (uintptr_t)info.dli_fbase;
-		    break;
-		}
-	    }
-	    if (ehdr->e_type == ET_EXEC) {
-		obj->base_addr = 0;
-	    }
-	    else {
-		/* PIE (position-independent executable) */
-		obj->base_addr = dladdr_fbase;
-	    }
-	}
-    }
-
-    if (!symtab_shdr) {
-	symtab_shdr = dynsym_shdr;
-	strtab_shdr = dynstr_shdr;
-    }
-
-    if (symtab_shdr && strtab_shdr) {
-	char *strtab = file + strtab_shdr->sh_offset;
-	ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
-	int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
-	for (j = 0; j < symtab_count; j++) {
-	    ElfW(Sym) *sym = &symtab[j];
-	    uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
-	    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
-	    for (i = offset; i < num_traces; i++) {
-		uintptr_t d = (uintptr_t)traces[i] - saddr;
-		if (lines[i].line > 0 || d <= 0 || d > (uintptr_t)sym->st_size)
-		    continue;
-		/* fill symbol name and addr from .symtab */
-		lines[i].sname = strtab + sym->st_name;
-		lines[i].saddr = saddr;
-		lines[i].path  = obj->path;
-		lines[i].base_addr = obj->base_addr;
-	    }
-	}
-    }
-
-    if (!debug_line_shdr) {
-	/* This file doesn't have .debug_line section,
-	   let's check .gnu_debuglink section instead. */
-	if (gnu_debuglink_shdr && check_debuglink) {
-	    follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
-			     num_traces, traces,
-			     objp, lines, offset);
-	}
-	goto finish;
-    }
-
-    parse_debug_line(num_traces, traces,
-		     file + debug_line_shdr->sh_offset,
-		     debug_line_shdr->sh_size,
-		     obj, lines, offset);
+        char *section_name = shstr + shdr[i].sh_name;
+        switch (shdr[i].sh_type) {
+          case SHT_STRTAB:
+            if (!strcmp(section_name, ".strtab")) {
+                strtab_shdr = shdr + i;
+            }
+            else if (!strcmp(section_name, ".dynstr")) {
+                dynstr_shdr = shdr + i;
+            }
+            break;
+          case SHT_SYMTAB:
+            /* if (!strcmp(section_name, ".symtab")) */
+            symtab_shdr = shdr + i;
+            break;
+          case SHT_DYNSYM:
+            /* if (!strcmp(section_name, ".dynsym")) */
+            dynsym_shdr = shdr + i;
+            break;
+          case SHT_NOTE:
+            if (!strcmp(section_name, ".note.gnu.build-id")) {
+                note_gnu_build_id = shdr + i;
+            }
+            break;
+          case SHT_PROGBITS:
+            if (!strcmp(section_name, ".gnu_debuglink")) {
+                gnu_debuglink_shdr = shdr + i;
+            }
+            else {
+                const char *debug_section_names[] = {
+                    ".debug_abbrev",
+                    ".debug_info",
+                    ".debug_line",
+                    ".debug_ranges",
+                    ".debug_str_offsets",
+                    ".debug_addr",
+                    ".debug_rnglists",
+                    ".debug_str",
+                    ".debug_line_str"
+                };
+
+                for (j=0; j < DWARF_SECTION_COUNT; j++) {
+                    struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+                    if (strcmp(section_name, debug_section_names[j]) != 0)
+                        continue;
+
+                    s->ptr = file + shdr[i].sh_offset;
+                    s->size = shdr[i].sh_size;
+                    s->flags = shdr[i].sh_flags;
+                    if (s->flags & SHF_COMPRESSED) {
+                        s->size = uncompress_debug_section(&shdr[i], file, &s->ptr);
+                        if (!s->size) goto fail;
+                    }
+                    break;
+                }
+            }
+            break;
+        }
+    }
+
+    if (offset == 0) {
+        /* main executable */
+        if (dynsym_shdr && dynstr_shdr) {
+            char *strtab = file + dynstr_shdr->sh_offset;
+            ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
+            int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
+            void *handle = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+            if (handle) {
+                for (j = 0; j < symtab_count; j++) {
+                    ElfW(Sym) *sym = &symtab[j];
+                    Dl_info info;
+                    void *s;
+                    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size == 0) continue;
+                    s = dlsym(handle, strtab + sym->st_name);
+                    if (s && dladdr(s, &info)) {
+                        obj->base_addr = dladdr_fbase;
+                        dladdr_fbase = (uintptr_t)info.dli_fbase;
+                        break;
+                    }
+                }
+                dlclose(handle);
+            }
+            if (ehdr->e_type == ET_EXEC) {
+                obj->base_addr = 0;
+            }
+            else {
+                /* PIE (position-independent executable) */
+                obj->base_addr = dladdr_fbase;
+            }
+        }
+    }
+
+    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+        DebugInfoReader reader;
+        debug_info_reader_init(&reader, obj);
+        i = 0;
+        while (reader.p < reader.pend) {
+            /* kprintf("%d:%tx: CU[%d]\n", __LINE__, reader.p - reader.obj->debug_info.ptr, i++); */
+            if (di_read_cu(&reader, errout)) goto use_symtab;
+            if (!debug_info_read(&reader, num_traces, traces, lines, offset, errout))
+                goto use_symtab;
+        }
+    }
+    else {
+        /* This file doesn't have dwarf, use symtab or dynsym */
+use_symtab:
+        if (!symtab_shdr) {
+            /* This file doesn't have symtab, use dynsym instead */
+            symtab_shdr = dynsym_shdr;
+            strtab_shdr = dynstr_shdr;
+        }
+
+        if (symtab_shdr && strtab_shdr) {
+            char *strtab = file + strtab_shdr->sh_offset;
+            ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+            int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+            for (j = 0; j < symtab_count; j++) {
+                ElfW(Sym) *sym = &symtab[j];
+                uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+                if (ELF_ST_TYPE(sym->st_info) != STT_FUNC) continue;
+                for (i = offset; i < num_traces; i++) {
+                    uintptr_t d = (uintptr_t)traces[i] - saddr;
+                    if (lines[i].line > 0 || d > (uintptr_t)sym->st_size)
+                        continue;
+                    /* fill symbol name and addr from .symtab */
+                    if (!lines[i].sname) lines[i].sname = strtab + sym->st_name;
+                    lines[i].saddr = saddr;
+                    lines[i].path  = obj->path;
+                    lines[i].base_addr = obj->base_addr;
+                }
+            }
+        }
+    }
+
+    if (!obj->debug_line.ptr) {
+        /* This file doesn't have .debug_line section,
+           let's check .gnu_debuglink section instead. */
+        if (gnu_debuglink_shdr && check_debuglink) {
+            follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
+                             num_traces, traces,
+                             objp, lines, offset, errout);
+        }
+        if (note_gnu_build_id && check_debuglink) {
+            ElfW(Nhdr) *nhdr = (ElfW(Nhdr)*) (file + note_gnu_build_id->sh_offset);
+            const char *build_id = (char *)(nhdr + 1) + nhdr->n_namesz;
+            follow_debuglink_build_id(build_id, nhdr->n_descsz,
+                               num_traces, traces,
+                               objp, lines, offset, errout);
+        }
+        goto finish;
+    }
+
+    if (parse_debug_line(num_traces, traces,
+            obj->debug_line.ptr,
+            obj->debug_line.size,
+            obj, lines, offset, errout) == -1)
+        goto fail;
+
 finish:
     return dladdr_fbase;
 fail:
     return (uintptr_t)-1;
 }
+#else /* Mach-O */
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+        obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+{
+# ifdef __LP64__
+#  define LP(x) x##_64
+# else
+#  define LP(x) x
+# endif
+    int fd;
+    off_t filesize;
+    char *file, *p = NULL;
+    obj_info_t *obj = *objp;
+    struct LP(mach_header) *header;
+    uintptr_t dladdr_fbase = 0;
+
+    {
+        char *s = binary_filename;
+        char *base = strrchr(binary_filename, '/')+1;
+        size_t max = PATH_MAX;
+        size_t size = strlen(binary_filename);
+        size_t basesize = size - (base - binary_filename);
+        s += size;
+        max -= size;
+        p = s;
+        size = strlcpy(s, ".dSYM/Contents/Resources/DWARF/", max);
+        if (size == 0) goto fail;
+        s += size;
+        max -= size;
+        if (max <= basesize) goto fail;
+        memcpy(s, base, basesize);
+        s[basesize] = 0;
+
+        fd = open(binary_filename, O_RDONLY);
+        if (fd < 0) {
+            *p = 0; /* binary_filename becomes original file name */
+            fd = open(binary_filename, O_RDONLY);
+            if (fd < 0) {
+                goto fail;
+            }
+        }
+    }
+
+    filesize = lseek(fd, 0, SEEK_END);
+    if (filesize < 0) {
+        int e = errno;
+        close(fd);
+        kprintf("lseek: %s\n", strerror(e));
+        goto fail;
+    }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+    if (filesize > (off_t)SIZE_MAX) {
+        close(fd);
+        kprintf("Too large file %s\n", binary_filename);
+        goto fail;
+    }
+#endif
+    lseek(fd, 0, SEEK_SET);
+    /* async-signal unsafe */
+    file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+    if (file == MAP_FAILED) {
+        int e = errno;
+        close(fd);
+        kprintf("mmap: %s\n", strerror(e));
+        goto fail;
+    }
+    close(fd);
+
+    obj->mapped = file;
+    obj->mapped_size = (size_t)filesize;
+
+    header = (struct LP(mach_header) *)file;
+    if (header->magic == LP(MH_MAGIC)) {
+        /* non universal binary */
+        p = file;
+    }
+    else if (header->magic == FAT_CIGAM) {
+        struct LP(mach_header) *mhp = _NSGetMachExecuteHeader();
+        struct fat_header *fat = (struct fat_header *)file;
+        char *q = file + sizeof(*fat);
+        uint32_t nfat_arch = __builtin_bswap32(fat->nfat_arch);
+        /* kprintf("%d: fat:%s %d\n",__LINE__, binary_filename,nfat_arch); */
+        for (uint32_t i = 0; i < nfat_arch; i++) {
+            struct fat_arch *arch = (struct fat_arch *)q;
+            cpu_type_t cputype = __builtin_bswap32(arch->cputype);
+            cpu_subtype_t cpusubtype = __builtin_bswap32(arch->cpusubtype);
+            uint32_t offset = __builtin_bswap32(arch->offset);
+            /* kprintf("%d: fat %d %x/%x %x/%x\n",__LINE__, i, mhp->cputype,mhp->cpusubtype, cputype,cpusubtype); */
+            if (mhp->cputype == cputype &&
+                    (cpu_subtype_t)(mhp->cpusubtype & ~CPU_SUBTYPE_MASK) == cpusubtype) {
+                p = file + offset;
+                file = p;
+                header = (struct LP(mach_header) *)p;
+                if (header->magic == LP(MH_MAGIC)) {
+                    goto found_mach_header;
+                }
+                break;
+            }
+            q += sizeof(*arch);
+        }
+        kprintf("'%s' is not a Mach-O universal binary file!\n",binary_filename);
+        close(fd);
+        goto fail;
+    }
+    else {
+# ifdef __LP64__
+#   define bitsize "64"
+# else
+#   define bitsize "32"
+# endif
+        kprintf("'%s' is not a " bitsize
+                "-bit Mach-O file!\n",binary_filename);
+# undef bitsize
+        close(fd);
+        goto fail;
+    }
+found_mach_header:
+    p += sizeof(*header);
+
+    for (uint32_t i = 0; i < (uint32_t)header->ncmds; i++) {
+        struct load_command *lcmd = (struct load_command *)p;
+        switch (lcmd->cmd) {
+          case LP(LC_SEGMENT):
+            {
+                static const char *debug_section_names[] = {
+                    "__debug_abbrev",
+                    "__debug_info",
+                    "__debug_line",
+                    "__debug_ranges",
+                    "__debug_str_offsets",
+                    "__debug_addr",
+                    "__debug_rnglists",
+                    "__debug_str",
+                    "__debug_line_str",
+                };
+                struct LP(segment_command) *scmd = (struct LP(segment_command) *)lcmd;
+                if (strcmp(scmd->segname, "__TEXT") == 0) {
+                    obj->vmaddr = scmd->vmaddr;
+                }
+                else if (strcmp(scmd->segname, "__DWARF") == 0) {
+                    p += sizeof(struct LP(segment_command));
+                    for (uint64_t i = 0; i < scmd->nsects; i++) {
+                        struct LP(section) *sect = (struct LP(section) *)p;
+                        p += sizeof(struct LP(section));
+                        for (int j=0; j < DWARF_SECTION_COUNT; j++) {
+                            struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+                            if (strcmp(sect->sectname, debug_section_names[j]) != 0
+#ifdef __APPLE__
+                                    /* macOS clang 16 generates DWARF5, which have Mach-O
+                                     * section names that are limited to 16 characters,
+                                     * which causes sections with long names to be truncated
+                                     * and not match above.
+                                     * See: https://wiki.dwarfstd.org/Best_Practices.md#Mach-2d-O
+                                     */
+                                    && strncmp(sect->sectname, debug_section_names[j], 16) != 0
+#endif
+                                )
+                                continue;
+
+                            s->ptr = file + sect->offset;
+                            s->size = sect->size;
+                            s->flags = sect->flags;
+                            if (s->flags & SHF_COMPRESSED) {
+                                goto fail;
+                            }
+                            break;
+                        }
+                    }
+                }
+            }
+            break;
+
+          case LC_SYMTAB:
+            {
+                struct symtab_command *cmd = (struct symtab_command *)lcmd;
+                struct LP(nlist) *nl = (struct LP(nlist) *)(file + cmd->symoff);
+                char *strtab = file + cmd->stroff, *sname = 0;
+                uint32_t j;
+                uintptr_t saddr = 0;
+                /* kprintf("[%2d]: %x/symtab %p\n", i, cmd->cmd, (void *)p); */
+                for (j = 0; j < cmd->nsyms; j++) {
+                    uintptr_t symsize, d;
+                    struct LP(nlist) *e = &nl[j];
+                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+                    if (e->n_type != N_FUN) continue;
+                    if (e->n_sect) {
+                        saddr = (uintptr_t)e->n_value + obj->base_addr - obj->vmaddr;
+                        sname = strtab + e->n_un.n_strx;
+                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+                        continue;
+                    }
+                    for (int k = offset; k < num_traces; k++) {
+                        d = (uintptr_t)traces[k] - saddr;
+                        symsize = e->n_value;
+                        /* kprintf("%lx %lx %lx\n",saddr,symsize,traces[k]); */
+                        if (lines[k].line > 0 || d > (uintptr_t)symsize)
+                            continue;
+                        /* fill symbol name and addr from .symtab */
+                        if (!lines[k].sname) lines[k].sname = sname;
+                        lines[k].saddr = saddr;
+                        lines[k].path  = obj->path;
+                        lines[k].base_addr = obj->base_addr;
+                    }
+                }
+            }
+        }
+        p += lcmd->cmdsize;
+    }
+
+    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+        DebugInfoReader reader;
+        debug_info_reader_init(&reader, obj);
+        while (reader.p < reader.pend) {
+            if (di_read_cu(&reader, errout)) goto fail;
+            if (!debug_info_read(&reader, num_traces, traces, lines, offset, errout))
+                goto fail;
+        }
+    }
+
+    if (parse_debug_line(num_traces, traces,
+            obj->debug_line.ptr,
+            obj->debug_line.size,
+            obj, lines, offset, errout) == -1)
+        goto fail;
+
+    return dladdr_fbase;
+fail:
+    return (uintptr_t)-1;
+}
+#endif
 
 #define HAVE_MAIN_EXE_PATH
-#if defined(__FreeBSD__)
+#if defined(__FreeBSD__) || defined(__DragonFly__)
 # include <sys/sysctl.h>
 #endif
-/* ssize_t main_exe_path(void)
+/* ssize_t main_exe_path(FILE *errout)
  *
  * store the path of the main executable to `binary_filename`,
  * and returns strlen(binary_filename).
  * it is NUL terminated.
  */
-#if defined(__linux__)
-ssize_t
-main_exe_path(void)
+#if defined(__linux__) || defined(__NetBSD__)
+static ssize_t
+main_exe_path(FILE *errout)
 {
-# define PROC_SELF_EXE "/proc/self/exe"
+# if defined(__linux__)
+#  define PROC_SELF_EXE "/proc/self/exe"
+# elif defined(__NetBSD__)
+#  define PROC_SELF_EXE "/proc/curproc/exe"
+# endif
     ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
+    if (len < 0) return 0;
     binary_filename[len] = 0;
     return len;
 }
-#elif defined(__FreeBSD__)
-ssize_t
-main_exe_path(void)
+#elif defined(__FreeBSD__) || defined(__DragonFly__)
+static ssize_t
+main_exe_path(FILE *errout)
 {
     int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
     size_t len = PATH_MAX;
     int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
     if (err) {
-	kprintf("Can't get the path of ruby");
-	return -1;
+        kprintf("Can't get the path of ruby");
+        return -1;
     }
     len--; /* sysctl sets strlen+1 */
     return len;
 }
+#elif defined(HAVE_LIBPROC_H)
+static ssize_t
+main_exe_path(FILE *errout)
+{
+    int len = proc_pidpath(getpid(), binary_filename, PATH_MAX);
+    if (len == 0) return 0;
+    binary_filename[len] = 0;
+    return len;
+}
 #else
 #undef HAVE_MAIN_EXE_PATH
 #endif
 
+static void
+print_line0(line_info_t *line, void *address, FILE *errout)
+{
+    uintptr_t addr = (uintptr_t)address;
+    uintptr_t d = addr - line->saddr;
+    if (!address) {
+        /* inlined */
+        if (line->dirname && line->dirname[0]) {
+            kprintf("%s(%s) %s/%s:%d\n", line->path, line->sname, line->dirname, line->filename, line->line);
+        }
+        else {
+            kprintf("%s(%s) %s:%d\n", line->path, line->sname, line->filename, line->line);
+        }
+    }
+    else if (!line->path) {
+        kprintf("[0x%"PRIxPTR"]\n", addr);
+    }
+    else if (!line->sname) {
+        kprintf("%s(0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, addr-line->base_addr, addr);
+    }
+    else if (!line->saddr) {
+        kprintf("%s(%s) [0x%"PRIxPTR"]\n", line->path, line->sname, addr);
+    }
+    else if (line->line <= 0) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, line->sname,
+                d, addr);
+    }
+    else if (!line->filename) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] ???:%d\n", line->path, line->sname,
+                d, addr, line->line);
+    }
+    else if (line->dirname && line->dirname[0]) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s/%s:%d\n", line->path, line->sname,
+                d, addr, line->dirname, line->filename, line->line);
+    }
+    else {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s:%d\n", line->path, line->sname,
+                d, addr, line->filename, line->line);
+    }
+}
+
+static void
+print_line(line_info_t *line, void *address, FILE *errout)
+{
+    print_line0(line, address, errout);
+    if (line->next) {
+        print_line(line->next, NULL, errout);
+    }
+}
+
 void
-rb_dump_backtrace_with_lines(int num_traces, void **traces)
+rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout)
 {
     int i;
     /* async-signal unsafe */
@@ -678,531 +2623,99 @@ rb_dump_backtrace_with_lines(int num_traces, void **traces)
     obj_info_t *obj = NULL;
     /* 2 is NULL + main executable */
     void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
+
 #ifdef HAVE_MAIN_EXE_PATH
     char *main_path = NULL; /* used on printing backtrace */
     ssize_t len;
-    if ((len = main_exe_path()) > 0) {
-	main_path = (char *)alloca(len + 1);
-	if (main_path) {
-	    uintptr_t addr;
-	    memcpy(main_path, binary_filename, len+1);
-	    append_obj(&obj);
-	    obj->path = main_path;
-	    addr = fill_lines(num_traces, traces, 1, &obj, lines, -1);
-	    if (addr != (uintptr_t)-1) {
-		dladdr_fbases[0] = (void *)addr;
-	    }
-	}
+    if ((len = main_exe_path(errout)) > 0) {
+        main_path = (char *)alloca(len + 1);
+        if (main_path) {
+            uintptr_t addr;
+            memcpy(main_path, binary_filename, len+1);
+            append_obj(&obj);
+            obj->path = main_path;
+            addr = fill_lines(num_traces, traces, 1, &obj, lines, 0, errout);
+            if (addr != (uintptr_t)-1) {
+                dladdr_fbases[0] = (void *)addr;
+            }
+        }
     }
 #endif
 
     /* fill source lines by reading dwarf */
     for (i = 0; i < num_traces; i++) {
-	Dl_info info;
-	if (lines[i].line) continue;
-	if (dladdr(traces[i], &info)) {
-	    const char *path;
-	    void **p;
-
-	    /* skip symbols which is in already checked objects */
-	    /* if the binary is strip-ed, this may effect */
-	    for (p=dladdr_fbases; *p; p++) {
-		if (*p == info.dli_fbase) {
-		    lines[i].path = info.dli_fname;
-		    lines[i].sname = info.dli_sname;
-		    goto next_line;
-		}
-	    }
-	    *p = info.dli_fbase;
-
-	    append_obj(&obj);
-	    obj->base_addr = (uintptr_t)info.dli_fbase;
-	    path = info.dli_fname;
-	    obj->path = path;
-	    lines[i].path = path;
-	    strcpy(binary_filename, path);
-	    fill_lines(num_traces, traces, 1, &obj, lines, i);
-	}
+        Dl_info info;
+        if (lines[i].line) continue;
+        if (dladdr(traces[i], &info)) {
+            const char *path;
+            void **p;
+
+            /* skip symbols which is in already checked objects */
+            /* if the binary is strip-ed, this may effect */
+            for (p=dladdr_fbases; *p; p++) {
+                if (*p == info.dli_fbase) {
+                    if (info.dli_fname) lines[i].path = info.dli_fname;
+                    if (info.dli_sname) lines[i].sname = info.dli_sname;
+                    goto next_line;
+                }
+            }
+            *p = info.dli_fbase;
+
+            append_obj(&obj);
+            obj->base_addr = (uintptr_t)info.dli_fbase;
+            path = info.dli_fname;
+            obj->path = path;
+            if (path) lines[i].path = path;
+            if (info.dli_sname) {
+                lines[i].sname = info.dli_sname;
+                lines[i].saddr = (uintptr_t)info.dli_saddr;
+            }
+            strlcpy(binary_filename, path, PATH_MAX);
+            if (fill_lines(num_traces, traces, 1, &obj, lines, i, errout) == (uintptr_t)-1)
+                break;
+        }
 next_line:
-	continue;
+        continue;
     }
 
     /* output */
     for (i = 0; i < num_traces; i++) {
-	line_info_t *line = &lines[i];
-	uintptr_t addr = (uintptr_t)traces[i];
-	uintptr_t d = addr - line->saddr;
-	if (!line->path) {
-	    kprintf("[0x%lx]\n", addr);
-	}
-	else if (!line->saddr || !line->sname) {
-	    kprintf("%s [0x%lx]\n", line->path, addr);
-	}
-	else if (line->line <= 0) {
-	    kprintf("%s(%s+0x%lx) [0x%lx]\n", line->path, line->sname,
-		    d, addr);
-	}
-	else if (!line->filename) {
-	    kprintf("%s(%s+0x%lx) [0x%lx] ???:%d\n", line->path, line->sname,
-		    d, addr, line->line);
-	}
-	else if (line->dirname && line->dirname[0]) {
-	    kprintf("%s(%s+0x%lx) [0x%lx] %s/%s:%d\n", line->path, line->sname,
-		    d, addr, line->dirname, line->filename, line->line);
-	}
-	else {
-	    kprintf("%s(%s+0x%lx) [0x%lx] %s:%d\n", line->path, line->sname,
-		    d, addr, line->filename, line->line);
-	}
-	/* FreeBSD's backtrace may show _start and so on */
-	if (line->sname && strcmp("main", line->sname) == 0)
-	    break;
+        print_line(&lines[i], traces[i], errout);
+
+        /* FreeBSD's backtrace may show _start and so on */
+        if (lines[i].sname && strcmp("main", lines[i].sname) == 0)
+            break;
     }
 
     /* free */
     while (obj) {
-	obj_info_t *o = obj;
-	obj = o->next;
-	if (o->fd) {
-	    munmap(o->mapped, o->mapped_size);
-	    close(o->fd);
-	}
-	free(o);
+        obj_info_t *o = obj;
+        for (i=0; i < DWARF_SECTION_COUNT; i++) {
+            struct dwarf_section *s = obj_dwarf_section_at(obj, i);
+            if (s->flags & SHF_COMPRESSED) {
+                free(s->ptr);
+            }
+        }
+        if (obj->mapped_size) {
+            munmap(obj->mapped, obj->mapped_size);
+        }
+        obj = o->next;
+        free(o);
+    }
+    for (i = 0; i < num_traces; i++) {
+        line_info_t *line = lines[i].next;
+        while (line) {
+            line_info_t *l = line;
+            line = line->next;
+            free(l);
+        }
     }
     free(lines);
     free(dladdr_fbases);
 }
 
-/* From FreeBSD's lib/libstand/printf.c */
-/*-
- * Copyright (c) 1986, 1988, 1991, 1993
- *	The Regents of the University of California.  All rights reserved.
- * (c) UNIX System Laboratories, Inc.
- * All or some portions of this file are derived from material licensed
- * to the University of California by American Telephone and Telegraph
- * Co. or Unix System Laboratories, Inc. and are reproduced herein with
- * the permission of UNIX System Laboratories, Inc.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions
- * are met:
- * 1. Redistributions of source code must retain the above copyright
- *    notice, this list of conditions and the following disclaimer.
- * 2. Redistributions in binary form must reproduce the above copyright
- *    notice, this list of conditions and the following disclaimer in the
- *    documentation and/or other materials provided with the distribution.
- * 4. Neither the name of the University nor the names of its contributors
- *    may be used to endorse or promote products derived from this software
- *    without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- * SUCH DAMAGE.
- *
- *	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
- */
-
-#include <stdarg.h>
-#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
-extern int rb_toupper(int c);
-#define    toupper(c)  rb_toupper(c)
-#define    hex2ascii(hex)  (hex2ascii_data[hex])
-char const hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
-static inline int imax(int a, int b) { return (a > b ? a : b); }
-static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
-
-static void putce(int c)
-{
-    char s[1];
-    ssize_t ret;
-
-    s[0] = (char)c;
-    ret = write(2, s, 1);
-    (void)ret;
-}
-
-int
-kprintf(const char *fmt, ...)
-{
-	va_list ap;
-	int retval;
-
-	va_start(ap, fmt);
-	retval = kvprintf(fmt, putce, NULL, 10, ap);
-	va_end(ap);
-	return retval;
-}
+#undef kprintf
 
-/*
- * Put a NUL-terminated ASCII number (base <= 36) in a buffer in reverse
- * order; return an optional length and a pointer to the last character
- * written in the buffer (i.e., the first character of the string).
- * The buffer pointed to by `nbuf' must have length >= MAXNBUF.
- */
-static char *
-ksprintn(char *nbuf, uintmax_t num, int base, int *lenp, int upper)
-{
-	char *p, c;
-
-	p = nbuf;
-	*p = '\0';
-	do {
-		c = hex2ascii(num % base);
-		*++p = upper ? toupper(c) : c;
-	} while (num /= base);
-	if (lenp)
-		*lenp = (int)(p - nbuf);
-	return (p);
-}
-
-/*
- * Scaled down version of printf(3).
- *
- * Two additional formats:
- *
- * The format %b is supported to decode error registers.
- * Its usage is:
- *
- *	printf("reg=%b\n", regval, "<base><arg>*");
- *
- * where <base> is the output base expressed as a control character, e.g.
- * \10 gives octal; \20 gives hex.  Each arg is a sequence of characters,
- * the first of which gives the bit number to be inspected (origin 1), and
- * the next characters (up to a control character, i.e. a character <= 32),
- * give the name of the register.  Thus:
- *
- *	kvprintf("reg=%b\n", 3, "\10\2BITTWO\1BITONE\n");
- *
- * would produce output:
- *
- *	reg=3<BITTWO,BITONE>
- *
- * XXX:  %D  -- Hexdump, takes pointer and separator string:
- *		("%6D", ptr, ":")   -> XX:XX:XX:XX:XX:XX
- *		("%*D", len, ptr, " " -> XX XX XX XX ...
- */
-static int
-kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap)
-{
-#define PCHAR(c) {int cc=(c); if (func) (*func)(cc); else *d++ = cc; retval++; }
-	char nbuf[MAXNBUF];
-	char *d;
-	const char *p, *percent, *q;
-	unsigned char *up;
-	int ch, n;
-	uintmax_t num;
-	int base, lflag, qflag, tmp, width, ladjust, sharpflag, neg, sign, dot;
-	int cflag, hflag, jflag, tflag, zflag;
-	int dwidth, upper;
-	char padc;
-	int stop = 0, retval = 0;
-
-	num = 0;
-	if (!func)
-		d = (char *) arg;
-	else
-		d = NULL;
-
-	if (fmt == NULL)
-		fmt = "(fmt null)\n";
-
-	if (radix < 2 || radix > 36)
-		radix = 10;
-
-	for (;;) {
-		padc = ' ';
-		width = 0;
-		while ((ch = (unsigned char)*fmt++) != '%' || stop) {
-			if (ch == '\0')
-				return (retval);
-			PCHAR(ch);
-		}
-		percent = fmt - 1;
-		qflag = 0; lflag = 0; ladjust = 0; sharpflag = 0; neg = 0;
-		sign = 0; dot = 0; dwidth = 0; upper = 0;
-		cflag = 0; hflag = 0; jflag = 0; tflag = 0; zflag = 0;
-reswitch:	switch (ch = (unsigned char)*fmt++) {
-		case '.':
-			dot = 1;
-			goto reswitch;
-		case '#':
-			sharpflag = 1;
-			goto reswitch;
-		case '+':
-			sign = 1;
-			goto reswitch;
-		case '-':
-			ladjust = 1;
-			goto reswitch;
-		case '%':
-			PCHAR(ch);
-			break;
-		case '*':
-			if (!dot) {
-				width = va_arg(ap, int);
-				if (width < 0) {
-					ladjust = !ladjust;
-					width = -width;
-				}
-			} else {
-				dwidth = va_arg(ap, int);
-			}
-			goto reswitch;
-		case '0':
-			if (!dot) {
-				padc = '0';
-				goto reswitch;
-			}
-		case '1': case '2': case '3': case '4':
-		case '5': case '6': case '7': case '8': case '9':
-				for (n = 0;; ++fmt) {
-					n = n * 10 + ch - '0';
-					ch = *fmt;
-					if (ch < '0' || ch > '9')
-						break;
-				}
-			if (dot)
-				dwidth = n;
-			else
-				width = n;
-			goto reswitch;
-		case 'b':
-			num = (unsigned int)va_arg(ap, int);
-			p = va_arg(ap, char *);
-			for (q = ksprintn(nbuf, num, *p++, NULL, 0); *q;)
-				PCHAR(*q--);
-
-			if (num == 0)
-				break;
-
-			for (tmp = 0; *p;) {
-				n = *p++;
-				if (num & (1 << (n - 1))) {
-					PCHAR(tmp ? ',' : '<');
-					for (; (n = *p) > ' '; ++p)
-						PCHAR(n);
-					tmp = 1;
-				} else
-					for (; *p > ' '; ++p)
-						continue;
-			}
-			if (tmp)
-				PCHAR('>');
-			break;
-		case 'c':
-			PCHAR(va_arg(ap, int));
-			break;
-		case 'D':
-			up = va_arg(ap, unsigned char *);
-			p = va_arg(ap, char *);
-			if (!width)
-				width = 16;
-			while(width--) {
-				PCHAR(hex2ascii(*up >> 4));
-				PCHAR(hex2ascii(*up & 0x0f));
-				up++;
-				if (width)
-					for (q=p;*q;q++)
-						PCHAR(*q);
-			}
-			break;
-		case 'd':
-		case 'i':
-			base = 10;
-			sign = 1;
-			goto handle_sign;
-		case 'h':
-			if (hflag) {
-				hflag = 0;
-				cflag = 1;
-			} else
-				hflag = 1;
-			goto reswitch;
-		case 'j':
-			jflag = 1;
-			goto reswitch;
-		case 'l':
-			if (lflag) {
-				lflag = 0;
-				qflag = 1;
-			} else
-				lflag = 1;
-			goto reswitch;
-		case 'n':
-			if (jflag)
-				*(va_arg(ap, intmax_t *)) = retval;
-			else if (qflag)
-				*(va_arg(ap, int64_t *)) = retval;
-			else if (lflag)
-				*(va_arg(ap, long *)) = retval;
-			else if (zflag)
-				*(va_arg(ap, size_t *)) = retval;
-			else if (hflag)
-				*(va_arg(ap, short *)) = retval;
-			else if (cflag)
-				*(va_arg(ap, char *)) = retval;
-			else
-				*(va_arg(ap, int *)) = retval;
-			break;
-		case 'o':
-			base = 8;
-			goto handle_nosign;
-		case 'p':
-			base = 16;
-			sharpflag = (width == 0);
-			sign = 0;
-			num = (uintptr_t)va_arg(ap, void *);
-			goto number;
-		case 'q':
-			qflag = 1;
-			goto reswitch;
-		case 'r':
-			base = radix;
-			if (sign)
-				goto handle_sign;
-			goto handle_nosign;
-		case 's':
-			p = va_arg(ap, char *);
-			if (p == NULL)
-				p = "(null)";
-			if (!dot)
-				n = (int)strlen (p);
-			else
-				for (n = 0; n < dwidth && p[n]; n++)
-					continue;
-
-			width -= n;
-
-			if (!ladjust && width > 0)
-				while (width--)
-					PCHAR(padc);
-			while (n--)
-				PCHAR(*p++);
-			if (ladjust && width > 0)
-				while (width--)
-					PCHAR(padc);
-			break;
-		case 't':
-			tflag = 1;
-			goto reswitch;
-		case 'u':
-			base = 10;
-			goto handle_nosign;
-		case 'X':
-			upper = 1;
-		case 'x':
-			base = 16;
-			goto handle_nosign;
-		case 'y':
-			base = 16;
-			sign = 1;
-			goto handle_sign;
-		case 'z':
-			zflag = 1;
-			goto reswitch;
-handle_nosign:
-			sign = 0;
-			if (jflag)
-				num = va_arg(ap, uintmax_t);
-			else if (qflag)
-				num = va_arg(ap, uint64_t);
-			else if (tflag)
-				num = va_arg(ap, ptrdiff_t);
-			else if (lflag)
-				num = va_arg(ap, unsigned long);
-			else if (zflag)
-				num = va_arg(ap, size_t);
-			else if (hflag)
-				num = (unsigned short)va_arg(ap, int);
-			else if (cflag)
-				num = (unsigned char)va_arg(ap, int);
-			else
-				num = va_arg(ap, unsigned int);
-			goto number;
-handle_sign:
-			if (jflag)
-				num = va_arg(ap, intmax_t);
-			else if (qflag)
-				num = va_arg(ap, int64_t);
-			else if (tflag)
-				num = va_arg(ap, ptrdiff_t);
-			else if (lflag)
-				num = va_arg(ap, long);
-			else if (zflag)
-				num = va_arg(ap, ssize_t);
-			else if (hflag)
-				num = (short)va_arg(ap, int);
-			else if (cflag)
-				num = (char)va_arg(ap, int);
-			else
-				num = va_arg(ap, int);
-number:
-			if (sign && (intmax_t)num < 0) {
-				neg = 1;
-				num = -(intmax_t)num;
-			}
-			p = ksprintn(nbuf, num, base, &n, upper);
-			tmp = 0;
-			if (sharpflag && num != 0) {
-				if (base == 8)
-					tmp++;
-				else if (base == 16)
-					tmp += 2;
-			}
-			if (neg)
-				tmp++;
-
-			if (!ladjust && padc == '0')
-				dwidth = width - tmp;
-			width -= tmp + imax(dwidth, n);
-			dwidth -= n;
-			if (!ladjust)
-				while (width-- > 0)
-					PCHAR(' ');
-			if (neg)
-				PCHAR('-');
-			if (sharpflag && num != 0) {
-				if (base == 8) {
-					PCHAR('0');
-				} else if (base == 16) {
-					PCHAR('0');
-					PCHAR('x');
-				}
-			}
-			while (dwidth-- > 0)
-				PCHAR('0');
-
-			while (*p)
-				PCHAR(*p--);
-
-			if (ladjust)
-				while (width-- > 0)
-					PCHAR(' ');
-
-			break;
-		default:
-			while (percent < fmt)
-				PCHAR(*percent++);
-			/*
-			 * Since we ignore an formatting argument it is no
-			 * longer safe to obey the remaining formatting
-			 * arguments as the arguments will no longer match
-			 * the format specs.
-			 */
-			stop = 1;
-			break;
-		}
-	}
-#undef PCHAR
-}
 #else /* defined(USE_ELF) */
 #error not supported
 #endif
diff --git a/addr2line.h b/addr2line.h
index d99f010934..ff8e476b92 100644
--- a/addr2line.h
+++ b/addr2line.h
@@ -1,3 +1,5 @@
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
 /**********************************************************************
 
   addr2line.h -
@@ -8,13 +10,12 @@
 
 **********************************************************************/
 
-#ifndef RUBY_ADDR2LINE_H
-#define RUBY_ADDR2LINE_H
+#if (defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H))
 
-#ifdef USE_ELF
+#include <stdio.h>
 
 void
-rb_dump_backtrace_with_lines(int num_traces, void **traces);
+rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout);
 
 #endif /* USE_ELF */
 
diff --git a/array.c b/array.c
index 0988a21888..b471823876 100644
--- a/array.c
+++ b/array.c
@@ -11,66 +11,118 @@
 
 **********************************************************************/
 
+#include "debug_counter.h"
+#include "id.h"
 #include "internal.h"
-#include "ruby/util.h"
-#include "ruby/st.h"
+#include "internal/array.h"
+#include "internal/compar.h"
+#include "internal/enum.h"
+#include "internal/gc.h"
+#include "internal/hash.h"
+#include "internal/numeric.h"
+#include "internal/object.h"
+#include "internal/proc.h"
+#include "internal/rational.h"
+#include "internal/vm.h"
 #include "probes.h"
-#include "id.h"
+#include "ruby/encoding.h"
+#include "ruby/st.h"
+#include "ruby/thread.h"
+#include "ruby/util.h"
+#include "ruby/ractor.h"
+#include "vm_core.h"
+#include "builtin.h"
 
-#ifndef ARRAY_DEBUG
+#if !ARRAY_DEBUG
+# undef NDEBUG
 # define NDEBUG
 #endif
-#include <assert.h>
+#include "ruby_assert.h"
 
 VALUE rb_cArray;
+VALUE rb_cArray_empty_frozen;
+
+/* Flags of RArray
+ *
+ * 0:   RARRAY_SHARED_FLAG (equal to ELTS_SHARED)
+ *          The array is shared. The buffer this array points to is owned by
+ *          another array (the shared root).
+ * 1:   RARRAY_EMBED_FLAG
+ *          The array is embedded (its contents follow the header, rather than
+ *          being on a separately allocated buffer).
+ * 3-9: RARRAY_EMBED_LEN
+ *          The length of the array when RARRAY_EMBED_FLAG is set.
+ * 12:  RARRAY_SHARED_ROOT_FLAG
+ *          The array is a shared root that does reference counting. The buffer
+ *          this array points to is owned by this array but may be pointed to
+ *          by other arrays.
+ *          Note: Frozen arrays may be a shared root without this flag being
+ *                set. Frozen arrays do not have reference counting because
+ *                they cannot be modified. Not updating the reference count
+ *                improves copy-on-write performance. Their reference count is
+ *                assumed to be infinity.
+ * 14:  RARRAY_PTR_IN_USE_FLAG
+ *          The buffer of the array is in use. This is only used during
+ *          debugging.
+ */
 
-static ID id_cmp, id_div, id_power;
+/* for OPTIMIZED_CMP: */
+#define id_cmp idCmp
 
 #define ARY_DEFAULT_SIZE 16
 #define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
+#define SMALL_ARRAY_LEN 16
 
-# define ARY_SHARED_P(ary) \
-    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
-     FL_TEST((ary),ELTS_SHARED)!=0)
-# define ARY_EMBED_P(ary) \
-    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
-     FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
+RBIMPL_ATTR_MAYBE_UNUSED()
+static int
+should_be_T_ARRAY(VALUE ary)
+{
+    return RB_TYPE_P(ary, T_ARRAY);
+}
 
-#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
-#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
-#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
+#define ARY_HEAP_PTR(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
+#define ARY_HEAP_LEN(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_HEAP_CAPA(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RUBY_ASSERT(!ARY_SHARED_ROOT_P(a)), \
+                          RARRAY(a)->as.heap.aux.capa)
+
+#define ARY_EMBED_PTR(a) (RUBY_ASSERT(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
 #define ARY_EMBED_LEN(a) \
-    (assert(ARY_EMBED_P(a)), \
+    (RUBY_ASSERT(ARY_EMBED_P(a)), \
      (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
-	 (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
-#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), RARRAY(a)->as.heap.aux.capa * sizeof(VALUE))
+         (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+#define ARY_HEAP_SIZE(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RUBY_ASSERT(ARY_OWNS_HEAP_P(a)), ARY_CAPA(a) * sizeof(VALUE))
+
+#define ARY_OWNS_HEAP_P(a) (RUBY_ASSERT(should_be_T_ARRAY((VALUE)(a))), \
+                            !FL_TEST_RAW((a), RARRAY_SHARED_FLAG|RARRAY_EMBED_FLAG))
 
-#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
 #define FL_SET_EMBED(a) do { \
-    assert(!ARY_SHARED_P(a)); \
+    RUBY_ASSERT(!ARY_SHARED_P(a)); \
     FL_SET((a), RARRAY_EMBED_FLAG); \
+    ary_verify(a); \
 } while (0)
+
 #define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
 #define FL_SET_SHARED(ary) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    FL_SET((ary), ELTS_SHARED); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), RARRAY_SHARED_FLAG); \
 } while (0)
-#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), RARRAY_SHARED_FLAG)
 
+#define ARY_SET_PTR_FORCE(ary, p) \
+    (RARRAY(ary)->as.heap.ptr = (p))
 #define ARY_SET_PTR(ary, p) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
-    RARRAY(ary)->as.heap.ptr = (p); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    ARY_SET_PTR_FORCE(ary, p); \
 } while (0)
 #define ARY_SET_EMBED_LEN(ary, n) do { \
     long tmp_n = (n); \
-    assert(ARY_EMBED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT(ARY_EMBED_P(ary)); \
     RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
     RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
 } while (0)
 #define ARY_SET_HEAP_LEN(ary, n) do { \
-    assert(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
     RARRAY(ary)->as.heap.len = (n); \
 } while (0)
 #define ARY_SET_LEN(ary, n) do { \
@@ -80,15 +132,15 @@ static ID id_cmp, id_div, id_power;
     else { \
         ARY_SET_HEAP_LEN((ary), (n)); \
     } \
-    assert(RARRAY_LEN(ary) == (n)); \
+    RUBY_ASSERT(RARRAY_LEN(ary) == (n)); \
 } while (0)
 #define ARY_INCREASE_PTR(ary, n) do  { \
-    assert(!ARY_EMBED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
     RARRAY(ary)->as.heap.ptr += (n); \
 } while (0)
 #define ARY_INCREASE_LEN(ary, n) do  { \
-    assert(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
     if (ARY_EMBED_P(ary)) { \
         ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
     } \
@@ -97,45 +149,154 @@ static ID id_cmp, id_div, id_power;
     } \
 } while (0)
 
-#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
-		       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? ary_embed_capa(ary) : \
+                       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : ARY_HEAP_CAPA(ary))
+#define ARY_SET_CAPA_FORCE(ary, n) \
+    RARRAY(ary)->as.heap.aux.capa = (n);
 #define ARY_SET_CAPA(ary, n) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    assert(!ARY_SHARED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
-    RARRAY(ary)->as.heap.aux.capa = (n); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!ARY_SHARED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    ARY_SET_CAPA_FORCE(ary, n); \
 } while (0)
 
-#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
-#define ARY_SET_SHARED(ary, value) do { \
-    const VALUE _ary_ = (ary); \
-    const VALUE _value_ = (value); \
-    assert(!ARY_EMBED_P(_ary_)); \
-    assert(ARY_SHARED_P(_ary_)); \
-    assert(ARY_SHARED_ROOT_P(_value_)); \
-    RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared, _value_); \
-} while (0)
-#define RARRAY_SHARED_ROOT_FLAG FL_USER5
-#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
-#define ARY_SHARED_NUM(ary) \
-    (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SHARED_OCCUPIED(ary) (ARY_SHARED_NUM(ary) == 1)
-#define ARY_SET_SHARED_NUM(ary, value) do { \
-    assert(ARY_SHARED_ROOT_P(ary)); \
+#define ARY_SHARED_ROOT_OCCUPIED(ary) (!OBJ_FROZEN(ary) && ARY_SHARED_ROOT_REFCNT(ary) == 1)
+#define ARY_SET_SHARED_ROOT_REFCNT(ary, value) do { \
+    RUBY_ASSERT(ARY_SHARED_ROOT_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT((value) >= 0); \
     RARRAY(ary)->as.heap.aux.capa = (value); \
 } while (0)
 #define FL_SET_SHARED_ROOT(ary) do { \
-    assert(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
     FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
 } while (0)
 
-#define ARY_SET(a, i, v) RARRAY_ASET((assert(!ARY_SHARED_P(a)), (a)), (i), (v))
+static inline void
+ARY_SET(VALUE a, long i, VALUE v)
+{
+    RUBY_ASSERT(!ARY_SHARED_P(a));
+    RUBY_ASSERT(!OBJ_FROZEN(a));
+
+    RARRAY_ASET(a, i, v);
+}
+#undef RARRAY_ASET
+
+static long
+ary_embed_capa(VALUE ary)
+{
+    size_t size = rb_gc_obj_slot_size(ary) - offsetof(struct RArray, as.ary);
+    RUBY_ASSERT(size % sizeof(VALUE) == 0);
+    return size / sizeof(VALUE);
+}
+
+static size_t
+ary_embed_size(long capa)
+{
+    size_t size = offsetof(struct RArray, as.ary) + (sizeof(VALUE) * capa);
+    if (size < sizeof(struct RArray)) size = sizeof(struct RArray);
+    return size;
+}
+
+static bool
+ary_embeddable_p(long capa)
+{
+    return rb_gc_size_allocatable_p(ary_embed_size(capa));
+}
+
+bool
+rb_ary_embeddable_p(VALUE ary)
+{
+    /* An array cannot be turned embeddable when the array is:
+     *  - Shared root: other objects may point to the buffer of this array
+     *    so we cannot make it embedded.
+     *  - Frozen: this array may also be a shared root without the shared root
+     *    flag.
+     *  - Shared: we don't want to re-embed an array that points to a shared
+     *    root (to save memory).
+     */
+    return !(ARY_SHARED_ROOT_P(ary) || OBJ_FROZEN(ary) || ARY_SHARED_P(ary));
+}
+
+size_t
+rb_ary_size_as_embedded(VALUE ary)
+{
+    size_t real_size;
+
+    if (ARY_EMBED_P(ary)) {
+        real_size = ary_embed_size(ARY_EMBED_LEN(ary));
+    }
+    else if (rb_ary_embeddable_p(ary)) {
+        real_size = ary_embed_size(ARY_HEAP_CAPA(ary));
+    }
+    else {
+        real_size = sizeof(struct RArray);
+    }
+    return real_size;
+}
+
+
+#if ARRAY_DEBUG
+#define ary_verify(ary) ary_verify_(ary, __FILE__, __LINE__)
+
+static VALUE
+ary_verify_(VALUE ary, const char *file, int line)
+{
+    RUBY_ASSERT(RB_TYPE_P(ary, T_ARRAY));
+
+    if (ARY_SHARED_P(ary)) {
+        VALUE root = ARY_SHARED_ROOT(ary);
+        const VALUE *ptr = ARY_HEAP_PTR(ary);
+        const VALUE *root_ptr = RARRAY_CONST_PTR(root);
+        long len = ARY_HEAP_LEN(ary), root_len = RARRAY_LEN(root);
+        RUBY_ASSERT(ARY_SHARED_ROOT_P(root) || OBJ_FROZEN(root));
+        RUBY_ASSERT(root_ptr <= ptr && ptr + len <= root_ptr + root_len);
+        ary_verify(root);
+    }
+    else if (ARY_EMBED_P(ary)) {
+        RUBY_ASSERT(!ARY_SHARED_P(ary));
+        RUBY_ASSERT(RARRAY_LEN(ary) <= ary_embed_capa(ary));
+    }
+    else {
+        const VALUE *ptr = RARRAY_CONST_PTR(ary);
+        long i, len = RARRAY_LEN(ary);
+        volatile VALUE v;
+        if (len > 1) len = 1; /* check only HEAD */
+        for (i=0; i<len; i++) {
+            v = ptr[i]; /* access check */
+        }
+        v = v;
+    }
+
+    return ary;
+}
+#else
+#define ary_verify(ary) ((void)0)
+#endif
+
+VALUE *
+rb_ary_ptr_use_start(VALUE ary)
+{
+#if ARRAY_DEBUG
+    FL_SET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+    return (VALUE *)RARRAY_CONST_PTR(ary);
+}
+
+void
+rb_ary_ptr_use_end(VALUE ary)
+{
+#if ARRAY_DEBUG
+    FL_UNSET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+}
 
 void
-rb_mem_clear(register VALUE *mem, register long size)
+rb_mem_clear(VALUE *mem, long size)
 {
     while (size--) {
-	*mem++ = Qnil;
+        *mem++ = Qnil;
     }
 }
 
@@ -143,7 +304,7 @@ static void
 ary_mem_clear(VALUE ary, long beg, long size)
 {
     RARRAY_PTR_USE(ary, ptr, {
-	rb_mem_clear(ptr + beg, size);
+        rb_mem_clear(ptr + beg, size);
     });
 }
 
@@ -151,7 +312,7 @@ static inline void
 memfill(register VALUE *mem, register long size, register VALUE val)
 {
     while (size--) {
-	*mem++ = val;
+        *mem++ = val;
     }
 }
 
@@ -159,36 +320,30 @@ static void
 ary_memfill(VALUE ary, long beg, long size, VALUE val)
 {
     RARRAY_PTR_USE(ary, ptr, {
-	memfill(ptr + beg, size, val);
-	RB_OBJ_WRITTEN(ary, Qundef, val);
+        memfill(ptr + beg, size, val);
+        RB_OBJ_WRITTEN(ary, Qundef, val);
     });
 }
 
 static void
 ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
 {
-#if 1
-    assert(!ARY_SHARED_P(buff_owner_ary));
+    RUBY_ASSERT(!ARY_SHARED_P(buff_owner_ary));
 
     if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
-	rb_gc_writebarrier_remember(buff_owner_ary);
-	RARRAY_PTR_USE(ary, ptr, {
-	    MEMCPY(ptr+beg, argv, VALUE, argc);
-	});
+        rb_gc_writebarrier_remember(buff_owner_ary);
+        RARRAY_PTR_USE(ary, ptr, {
+            MEMCPY(ptr+beg, argv, VALUE, argc);
+        });
     }
     else {
-	int i;
-	RARRAY_PTR_USE(ary, ptr, {
-	    for (i=0; i<argc; i++) {
-		RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
-	    }
-	});
+        int i;
+        RARRAY_PTR_USE(ary, ptr, {
+            for (i=0; i<argc; i++) {
+                RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+            }
+        });
     }
-#else
-    /* giveup write barrier (traditional way) */
-    RARRAY_PTR(buff_owner_ary);
-    MEMCPY(RARRAY_PTR(ary)+beg, argv, VALUE, argc);
-#endif
 }
 
 static void
@@ -197,49 +352,105 @@ ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
     ary_memcpy0(ary, beg, argc, argv, ary);
 }
 
+static VALUE *
+ary_heap_alloc_buffer(size_t capa)
+{
+    return ALLOC_N(VALUE, capa);
+}
+
+static void
+ary_heap_free_ptr(VALUE ary, const VALUE *ptr, long size)
+{
+    ruby_sized_xfree((void *)ptr, size);
+}
+
+static void
+ary_heap_free(VALUE ary)
+{
+    ary_heap_free_ptr(ary, ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+}
+
+static size_t
+ary_heap_realloc(VALUE ary, size_t new_capa)
+{
+    RUBY_ASSERT(!OBJ_FROZEN(ary));
+    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, new_capa, ARY_HEAP_CAPA(ary));
+    ary_verify(ary);
+
+    return new_capa;
+}
+
+void
+rb_ary_make_embedded(VALUE ary)
+{
+    RUBY_ASSERT(rb_ary_embeddable_p(ary));
+    if (!ARY_EMBED_P(ary)) {
+        const VALUE *buf = ARY_HEAP_PTR(ary);
+        long len = ARY_HEAP_LEN(ary);
+
+        FL_SET_EMBED(ary);
+        ARY_SET_EMBED_LEN(ary, len);
+
+        MEMCPY((void *)ARY_EMBED_PTR(ary), (void *)buf, VALUE, len);
+
+        ary_heap_free_ptr(ary, buf, len * sizeof(VALUE));
+    }
+}
+
 static void
 ary_resize_capa(VALUE ary, long capacity)
 {
-    assert(RARRAY_LEN(ary) <= capacity);
-    assert(!OBJ_FROZEN(ary));
-    assert(!ARY_SHARED_P(ary));
-    if (capacity > RARRAY_EMBED_LEN_MAX) {
+    RUBY_ASSERT(RARRAY_LEN(ary) <= capacity);
+    RUBY_ASSERT(!OBJ_FROZEN(ary));
+    RUBY_ASSERT(!ARY_SHARED_P(ary));
+
+    if (capacity > ary_embed_capa(ary)) {
+        size_t new_capa = capacity;
         if (ARY_EMBED_P(ary)) {
             long len = ARY_EMBED_LEN(ary);
-            VALUE *ptr = ALLOC_N(VALUE, (capacity));
+            VALUE *ptr = ary_heap_alloc_buffer(capacity);
+
             MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
             FL_UNSET_EMBED(ary);
             ARY_SET_PTR(ary, ptr);
             ARY_SET_HEAP_LEN(ary, len);
         }
         else {
-	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity, RARRAY(ary)->as.heap.aux.capa);
+            new_capa = ary_heap_realloc(ary, capacity);
         }
-        ARY_SET_CAPA(ary, (capacity));
+        ARY_SET_CAPA(ary, new_capa);
     }
     else {
         if (!ARY_EMBED_P(ary)) {
-            long len = RARRAY_LEN(ary);
-	    const VALUE *ptr = RARRAY_CONST_PTR(ary);
+            long len = ARY_HEAP_LEN(ary);
+            long old_capa = ARY_HEAP_CAPA(ary);
+            const VALUE *ptr = ARY_HEAP_PTR(ary);
 
-	    if (len > capacity) len = capacity;
+            if (len > capacity) len = capacity;
             MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
+            ary_heap_free_ptr(ary, ptr, old_capa);
+
             FL_SET_EMBED(ary);
             ARY_SET_LEN(ary, len);
-	    ruby_xfree((VALUE *)ptr);
         }
     }
+
+    ary_verify(ary);
 }
 
 static inline void
 ary_shrink_capa(VALUE ary)
 {
     long capacity = ARY_HEAP_LEN(ary);
-    long old_capa = RARRAY(ary)->as.heap.aux.capa;
-    assert(!ARY_SHARED_P(ary));
-    assert(old_capa >= capacity);
-    if (old_capa > capacity)
-	REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity);
+    long old_capa = ARY_HEAP_CAPA(ary);
+    RUBY_ASSERT(!ARY_SHARED_P(ary));
+    RUBY_ASSERT(old_capa >= capacity);
+    if (old_capa > capacity) {
+        size_t new_capa = ary_heap_realloc(ary, capacity);
+        ARY_SET_CAPA(ary, new_capa);
+    }
+
+    ary_verify(ary);
 }
 
 static void
@@ -248,172 +459,207 @@ ary_double_capa(VALUE ary, long min)
     long new_capa = ARY_CAPA(ary) / 2;
 
     if (new_capa < ARY_DEFAULT_SIZE) {
-	new_capa = ARY_DEFAULT_SIZE;
+        new_capa = ARY_DEFAULT_SIZE;
     }
     if (new_capa >= ARY_MAX_SIZE - min) {
-	new_capa = (ARY_MAX_SIZE - min) / 2;
+        new_capa = (ARY_MAX_SIZE - min) / 2;
     }
     new_capa += min;
     ary_resize_capa(ary, new_capa);
+
+    ary_verify(ary);
 }
 
 static void
-rb_ary_decrement_share(VALUE shared)
+rb_ary_decrement_share(VALUE shared_root)
 {
-    if (shared) {
-	long num = ARY_SHARED_NUM(shared) - 1;
-	if (num == 0) {
-	    rb_ary_free(shared);
-	    rb_gc_force_recycle(shared);
-	}
-	else if (num > 0) {
-	    ARY_SET_SHARED_NUM(shared, num);
-	}
+    if (!OBJ_FROZEN(shared_root)) {
+        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num - 1);
     }
 }
 
 static void
 rb_ary_unshare(VALUE ary)
 {
-    VALUE shared = RARRAY(ary)->as.heap.aux.shared;
-    rb_ary_decrement_share(shared);
+    VALUE shared_root = ARY_SHARED_ROOT(ary);
+    rb_ary_decrement_share(shared_root);
     FL_UNSET_SHARED(ary);
 }
 
-static inline void
-rb_ary_unshare_safe(VALUE ary)
+static void
+rb_ary_reset(VALUE ary)
 {
-    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
-	rb_ary_unshare(ary);
+    if (ARY_OWNS_HEAP_P(ary)) {
+        ary_heap_free(ary);
+    }
+    else if (ARY_SHARED_P(ary)) {
+        rb_ary_unshare(ary);
     }
+
+    FL_SET_EMBED(ary);
+    ARY_SET_EMBED_LEN(ary, 0);
 }
 
 static VALUE
-rb_ary_increment_share(VALUE shared)
+rb_ary_increment_share(VALUE shared_root)
 {
-    long num = ARY_SHARED_NUM(shared);
-    if (num >= 0) {
-	ARY_SET_SHARED_NUM(shared, num + 1);
+    if (!OBJ_FROZEN(shared_root)) {
+        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+        RUBY_ASSERT(num >= 0);
+        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num + 1);
     }
-    return shared;
+    return shared_root;
 }
 
 static void
-rb_ary_set_shared(VALUE ary, VALUE shared)
+rb_ary_set_shared(VALUE ary, VALUE shared_root)
 {
-    rb_ary_increment_share(shared);
+    RUBY_ASSERT(!ARY_EMBED_P(ary));
+    RUBY_ASSERT(!OBJ_FROZEN(ary));
+    RUBY_ASSERT(ARY_SHARED_ROOT_P(shared_root) || OBJ_FROZEN(shared_root));
+
+    rb_ary_increment_share(shared_root);
     FL_SET_SHARED(ary);
-    ARY_SET_SHARED(ary, shared);
+    RB_OBJ_WRITE(ary, &RARRAY(ary)->as.heap.aux.shared_root, shared_root);
+
+    RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
 }
 
 static inline void
 rb_ary_modify_check(VALUE ary)
 {
+    RUBY_ASSERT(ruby_thread_has_gvl_p());
+
     rb_check_frozen(ary);
+    ary_verify(ary);
 }
 
 void
-rb_ary_modify(VALUE ary)
+rb_ary_cancel_sharing(VALUE ary)
 {
-    rb_ary_modify_check(ary);
     if (ARY_SHARED_P(ary)) {
-	long shared_len, len = RARRAY_LEN(ary);
-	VALUE shared = ARY_SHARED(ary);
-        if (len <= RARRAY_EMBED_LEN_MAX) {
-	    const VALUE *ptr = ARY_HEAP_PTR(ary);
+        long shared_len, len = RARRAY_LEN(ary);
+        VALUE shared_root = ARY_SHARED_ROOT(ary);
+
+        ary_verify(shared_root);
+
+        if (len <= ary_embed_capa(ary)) {
+            const VALUE *ptr = ARY_HEAP_PTR(ary);
             FL_UNSET_SHARED(ary);
             FL_SET_EMBED(ary);
-	    MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
-            rb_ary_decrement_share(shared);
+            MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+            rb_ary_decrement_share(shared_root);
             ARY_SET_EMBED_LEN(ary, len);
         }
-	else if (ARY_SHARED_OCCUPIED(shared) && len > ((shared_len = RARRAY_LEN(shared))>>1)) {
-	    long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared);
-	    FL_UNSET_SHARED(ary);
-	    ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared));
-	    ARY_SET_CAPA(ary, shared_len);
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+shift, VALUE, len);
-	    });
-	    FL_SET_EMBED(shared);
-	    rb_ary_decrement_share(shared);
-	}
+        else if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && len > ((shared_len = RARRAY_LEN(shared_root))>>1)) {
+            long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared_root);
+            FL_UNSET_SHARED(ary);
+            ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared_root));
+            ARY_SET_CAPA(ary, shared_len);
+            RARRAY_PTR_USE(ary, ptr, {
+                MEMMOVE(ptr, ptr+shift, VALUE, len);
+            });
+            FL_SET_EMBED(shared_root);
+            rb_ary_decrement_share(shared_root);
+        }
         else {
-            VALUE *ptr = ALLOC_N(VALUE, len);
-            MEMCPY(ptr, RARRAY_CONST_PTR(ary), VALUE, len);
+            VALUE *ptr = ary_heap_alloc_buffer(len);
+            MEMCPY(ptr, ARY_HEAP_PTR(ary), VALUE, len);
             rb_ary_unshare(ary);
-            ARY_SET_CAPA(ary, len);
-            ARY_SET_PTR(ary, ptr);
+            ARY_SET_CAPA_FORCE(ary, len);
+            ARY_SET_PTR_FORCE(ary, ptr);
         }
 
-	rb_gc_writebarrier_remember(ary);
+        rb_gc_writebarrier_remember(ary);
     }
+    ary_verify(ary);
+}
+
+void
+rb_ary_modify(VALUE ary)
+{
+    rb_ary_modify_check(ary);
+    rb_ary_cancel_sharing(ary);
 }
 
 static VALUE
 ary_ensure_room_for_push(VALUE ary, long add_len)
 {
-    long new_len = RARRAY_LEN(ary) + add_len;
+    long old_len = RARRAY_LEN(ary);
+    long new_len = old_len + add_len;
     long capa;
 
+    if (old_len > ARY_MAX_SIZE - add_len) {
+        rb_raise(rb_eIndexError, "index %ld too big", new_len);
+    }
     if (ARY_SHARED_P(ary)) {
-	if (new_len > RARRAY_EMBED_LEN_MAX) {
-	    VALUE shared = ARY_SHARED(ary);
-	    if (ARY_SHARED_OCCUPIED(shared)) {
-		if (RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared) + new_len <= RARRAY_LEN(shared)) {
-		    rb_ary_modify_check(ary);
-		    return shared;
-		}
-		else {
-		    /* if array is shared, then it is likely it participate in push/shift pattern */
-		    rb_ary_modify(ary);
-		    capa = ARY_CAPA(ary);
-		    if (new_len > capa - (capa >> 6)) {
-			ary_double_capa(ary, new_len);
-		    }
-		    return ary;
-		}
-	    }
-	}
+        if (new_len > ary_embed_capa(ary)) {
+            VALUE shared_root = ARY_SHARED_ROOT(ary);
+            if (ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+                if (ARY_HEAP_PTR(ary) - RARRAY_CONST_PTR(shared_root) + new_len <= RARRAY_LEN(shared_root)) {
+                    rb_ary_modify_check(ary);
+
+                    ary_verify(ary);
+                    ary_verify(shared_root);
+                    return shared_root;
+                }
+                else {
+                    /* if array is shared, then it is likely it participate in push/shift pattern */
+                    rb_ary_modify(ary);
+                    capa = ARY_CAPA(ary);
+                    if (new_len > capa - (capa >> 6)) {
+                        ary_double_capa(ary, new_len);
+                    }
+                    ary_verify(ary);
+                    return ary;
+                }
+            }
+        }
+        ary_verify(ary);
+        rb_ary_modify(ary);
+    }
+    else {
+        rb_ary_modify_check(ary);
     }
-    rb_ary_modify(ary);
     capa = ARY_CAPA(ary);
     if (new_len > capa) {
-	ary_double_capa(ary, new_len);
+        ary_double_capa(ary, new_len);
     }
 
+    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *      ary.freeze -> ary
+ *    freeze -> self
+ *
+ *  Freezes +self+ (if not already frozen); returns +self+:
  *
- *  Calls Object#freeze on +ary+ to prevent any further
- *  modification. A RuntimeError will be raised if a modification
- *  attempt is made.
+ *    a = []
+ *    a.frozen? # => false
+ *    a.freeze
+ *    a.frozen? # => true
  *
+ *  No further changes may be made to +self+;
+ *  raises FrozenError if a change is attempted.
+ *
+ *  Related: Kernel#frozen?.
  */
 
 VALUE
 rb_ary_freeze(VALUE ary)
 {
-    return rb_obj_freeze(ary);
-}
+    RUBY_ASSERT(RB_TYPE_P(ary, T_ARRAY));
 
-/*
- *  call-seq:
- *     ary.frozen?  -> true or false
- *
- *  Return +true+ if this array is frozen (or temporarily frozen
- *  while being sorted). See also Object#frozen?
- */
+    if (OBJ_FROZEN(ary)) return ary;
 
-static VALUE
-rb_ary_frozen_p(VALUE ary)
-{
-    if (OBJ_FROZEN(ary)) return Qtrue;
-    return Qfalse;
+    if (!ARY_EMBED_P(ary) && !ARY_SHARED_P(ary) && !ARY_SHARED_ROOT_P(ary)) {
+        ary_shrink_capa(ary);
+    }
+
+    return rb_obj_freeze(ary);
 }
 
 /* This can be used to take a snapshot of an array (with
@@ -427,18 +673,22 @@ VALUE
 rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
 {
     if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
-	!ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
-	RARRAY(ary1)->as.heap.aux.shared == RARRAY(ary2)->as.heap.aux.shared &&
-	RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
-	return Qtrue;
+            !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
+            ARY_SHARED_ROOT(ary1) == ARY_SHARED_ROOT(ary2) &&
+            ARY_HEAP_LEN(ary1) == ARY_HEAP_LEN(ary2)) {
+        return Qtrue;
     }
     return Qfalse;
 }
 
 static VALUE
-ary_alloc(VALUE klass)
+ary_alloc_embed(VALUE klass, long capa)
 {
-    NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+    size_t size = ary_embed_size(capa);
+    RUBY_ASSERT(rb_gc_size_allocatable_p(size));
+    NEWOBJ_OF(ary, struct RArray, klass,
+                     T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+                     size, 0);
     /* Created array is:
      *   FL_SET_EMBED((VALUE)ary);
      *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
@@ -447,37 +697,51 @@ ary_alloc(VALUE klass)
 }
 
 static VALUE
-empty_ary_alloc(VALUE klass)
+ary_alloc_heap(VALUE klass)
 {
-    if (RUBY_DTRACE_ARRAY_CREATE_ENABLED()) {
-	RUBY_DTRACE_ARRAY_CREATE(0, rb_sourcefile(), rb_sourceline());
-    }
+    NEWOBJ_OF(ary, struct RArray, klass,
+                     T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+                     sizeof(struct RArray), 0);
+
+    ary->as.heap.len = 0;
+    ary->as.heap.aux.capa = 0;
+    ary->as.heap.ptr = NULL;
+
+    return (VALUE)ary;
+}
 
-    return ary_alloc(klass);
+static VALUE
+empty_ary_alloc(VALUE klass)
+{
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
+    return ary_alloc_embed(klass, 0);
 }
 
 static VALUE
 ary_new(VALUE klass, long capa)
 {
-    VALUE ary,*ptr;
+    RUBY_ASSERT(ruby_thread_has_gvl_p());
+
+    VALUE ary;
 
     if (capa < 0) {
-	rb_raise(rb_eArgError, "negative array size (or size too big)");
+        rb_raise(rb_eArgError, "negative array size (or size too big)");
     }
     if (capa > ARY_MAX_SIZE) {
-	rb_raise(rb_eArgError, "array size too big");
+        rb_raise(rb_eArgError, "array size too big");
     }
 
-    if (RUBY_DTRACE_ARRAY_CREATE_ENABLED()) {
-	RUBY_DTRACE_ARRAY_CREATE(capa, rb_sourcefile(), rb_sourceline());
-    }
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
 
-    ary = ary_alloc(klass);
-    if (capa > RARRAY_EMBED_LEN_MAX) {
-	ptr = ALLOC_N(VALUE, capa);
-        FL_UNSET_EMBED(ary);
-        ARY_SET_PTR(ary, ptr);
+    if (ary_embeddable_p(capa)) {
+        ary = ary_alloc_embed(klass, capa);
+    }
+    else {
+        ary = ary_alloc_heap(klass);
         ARY_SET_CAPA(ary, capa);
+        RUBY_ASSERT(!ARY_EMBED_P(ary));
+
+        ARY_SET_PTR(ary, ary_heap_alloc_buffer(capa));
         ARY_SET_HEAP_LEN(ary, 0);
     }
 
@@ -493,7 +757,7 @@ rb_ary_new_capa(long capa)
 VALUE
 rb_ary_new(void)
 {
-    return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
+    return rb_ary_new_capa(0);
 }
 
 VALUE
@@ -507,7 +771,7 @@ VALUE
 
     va_start(ar, n);
     for (i=0; i<n; i++) {
-	ARY_SET(ary, i, va_arg(ar, VALUE));
+        ARY_SET(ary, i, va_arg(ar, VALUE));
     }
     va_end(ar);
 
@@ -516,29 +780,108 @@ VALUE
 }
 
 VALUE
-rb_ary_new_from_values(long n, const VALUE *elts)
+rb_ary_tmp_new_from_values(VALUE klass, long n, const VALUE *elts)
 {
     VALUE ary;
 
-    ary = rb_ary_new2(n);
+    ary = ary_new(klass, n);
     if (n > 0 && elts) {
-	ary_memcpy(ary, 0, n, elts);
-	ARY_SET_LEN(ary, n);
+        ary_memcpy(ary, 0, n, elts);
+        ARY_SET_LEN(ary, n);
+    }
+
+    return ary;
+}
+
+VALUE
+rb_ary_new_from_values(long n, const VALUE *elts)
+{
+    return rb_ary_tmp_new_from_values(rb_cArray, n, elts);
+}
+
+static VALUE
+ec_ary_alloc_embed(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+    size_t size = ary_embed_size(capa);
+    RUBY_ASSERT(rb_gc_size_allocatable_p(size));
+    NEWOBJ_OF(ary, struct RArray, klass,
+            T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+            size, ec);
+    /* Created array is:
+     *   FL_SET_EMBED((VALUE)ary);
+     *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
+     */
+    return (VALUE)ary;
+}
+
+static VALUE
+ec_ary_alloc_heap(rb_execution_context_t *ec, VALUE klass)
+{
+    NEWOBJ_OF(ary, struct RArray, klass,
+            T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+            sizeof(struct RArray), ec);
+
+    ary->as.heap.len = 0;
+    ary->as.heap.aux.capa = 0;
+    ary->as.heap.ptr = NULL;
+
+    return (VALUE)ary;
+}
+
+static VALUE
+ec_ary_new(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+    VALUE ary;
+
+    if (capa < 0) {
+        rb_raise(rb_eArgError, "negative array size (or size too big)");
+    }
+    if (capa > ARY_MAX_SIZE) {
+        rb_raise(rb_eArgError, "array size too big");
+    }
+
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+    if (ary_embeddable_p(capa)) {
+        ary = ec_ary_alloc_embed(ec, klass, capa);
+    }
+    else {
+        ary = ec_ary_alloc_heap(ec, klass);
+        ARY_SET_CAPA(ary, capa);
+        RUBY_ASSERT(!ARY_EMBED_P(ary));
+
+        ARY_SET_PTR(ary, ary_heap_alloc_buffer(capa));
+        ARY_SET_HEAP_LEN(ary, 0);
     }
 
     return ary;
 }
 
 VALUE
-rb_ary_tmp_new(long capa)
+rb_ec_ary_new_from_values(rb_execution_context_t *ec, long n, const VALUE *elts)
 {
-    return ary_new(0, capa);
+    VALUE ary;
+
+    ary = ec_ary_new(ec, rb_cArray, n);
+    if (n > 0 && elts) {
+        ary_memcpy(ary, 0, n, elts);
+        ARY_SET_LEN(ary, n);
+    }
+
+    return ary;
 }
 
 VALUE
-rb_ary_tmp_new_fill(long capa)
+rb_ary_hidden_new(long capa)
 {
     VALUE ary = ary_new(0, capa);
+    return ary;
+}
+
+VALUE
+rb_ary_hidden_new_fill(long capa)
+{
+    VALUE ary = rb_ary_hidden_new(capa);
     ary_memfill(ary, 0, capa, Qnil);
     ARY_SET_LEN(ary, capa);
     return ary;
@@ -548,59 +891,107 @@ void
 rb_ary_free(VALUE ary)
 {
     if (ARY_OWNS_HEAP_P(ary)) {
-	ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+        if (USE_DEBUG_COUNTER &&
+            !ARY_SHARED_ROOT_P(ary) &&
+            ARY_HEAP_CAPA(ary) > RARRAY_LEN(ary)) {
+            RB_DEBUG_COUNTER_INC(obj_ary_extracapa);
+        }
+
+        RB_DEBUG_COUNTER_INC(obj_ary_ptr);
+        ary_heap_free(ary);
     }
+    else {
+        RB_DEBUG_COUNTER_INC(obj_ary_embed);
+    }
+
+    if (ARY_SHARED_P(ary)) {
+        RB_DEBUG_COUNTER_INC(obj_ary_shared);
+    }
+    if (ARY_SHARED_ROOT_P(ary) && ARY_SHARED_ROOT_OCCUPIED(ary)) {
+        RB_DEBUG_COUNTER_INC(obj_ary_shared_root_occupied);
+    }
+}
+
+static VALUE fake_ary_flags;
+
+static VALUE
+init_fake_ary_flags(void)
+{
+    struct RArray fake_ary = {0};
+    fake_ary.basic.flags = T_ARRAY;
+    VALUE ary = (VALUE)&fake_ary;
+    rb_ary_freeze(ary);
+    return fake_ary.basic.flags;
 }
 
-RUBY_FUNC_EXPORTED size_t
+VALUE
+rb_setup_fake_ary(struct RArray *fake_ary, const VALUE *list, long len)
+{
+    fake_ary->basic.flags = fake_ary_flags;
+    RBASIC_CLEAR_CLASS((VALUE)fake_ary);
+
+    // bypass frozen checks
+    fake_ary->as.heap.ptr = list;
+    fake_ary->as.heap.len = len;
+    fake_ary->as.heap.aux.capa = len;
+    return (VALUE)fake_ary;
+}
+
+size_t
 rb_ary_memsize(VALUE ary)
 {
     if (ARY_OWNS_HEAP_P(ary)) {
-	return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
+        return ARY_CAPA(ary) * sizeof(VALUE);
     }
     else {
-	return 0;
+        return 0;
     }
 }
 
-static inline void
-ary_discard(VALUE ary)
-{
-    rb_ary_free(ary);
-    RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
-    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
-}
-
 static VALUE
 ary_make_shared(VALUE ary)
 {
-    assert(!ARY_EMBED_P(ary));
+    ary_verify(ary);
+
     if (ARY_SHARED_P(ary)) {
-	return ARY_SHARED(ary);
+        return ARY_SHARED_ROOT(ary);
     }
     else if (ARY_SHARED_ROOT_P(ary)) {
-	return ary;
+        return ary;
     }
     else if (OBJ_FROZEN(ary)) {
-	ary_shrink_capa(ary);
-	FL_SET_SHARED_ROOT(ary);
-	ARY_SET_SHARED_NUM(ary, 1);
-	return ary;
+        return ary;
     }
     else {
-	long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
-	NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
-        FL_UNSET_EMBED(shared);
+        long capa = ARY_CAPA(ary);
+        long len = RARRAY_LEN(ary);
 
-	ARY_SET_LEN((VALUE)shared, capa);
-	ARY_SET_PTR((VALUE)shared, RARRAY_CONST_PTR(ary));
-	ary_mem_clear((VALUE)shared, len, capa - len);
-	FL_SET_SHARED_ROOT(shared);
-	ARY_SET_SHARED_NUM((VALUE)shared, 1);
-	FL_SET_SHARED(ary);
-	ARY_SET_SHARED(ary, (VALUE)shared);
-	OBJ_FREEZE(shared);
-	return (VALUE)shared;
+        /* Shared roots cannot be embedded because the reference count
+         * (refcnt) is stored in as.heap.aux.capa. */
+        VALUE shared = ary_alloc_heap(0);
+        FL_SET_SHARED_ROOT(shared);
+
+        if (ARY_EMBED_P(ary)) {
+            VALUE *ptr = ary_heap_alloc_buffer(capa);
+            ARY_SET_PTR(shared, ptr);
+            ary_memcpy(shared, 0, len, RARRAY_CONST_PTR(ary));
+
+            FL_UNSET_EMBED(ary);
+            ARY_SET_HEAP_LEN(ary, len);
+            ARY_SET_PTR(ary, ptr);
+        }
+        else {
+            ARY_SET_PTR(shared, RARRAY_CONST_PTR(ary));
+        }
+
+        ARY_SET_LEN(shared, capa);
+        ary_mem_clear(shared, len, capa - len);
+        rb_ary_set_shared(ary, shared);
+
+        ary_verify(shared);
+        ary_verify(ary);
+
+        return shared;
     }
 }
 
@@ -609,9 +1000,11 @@ ary_make_substitution(VALUE ary)
 {
     long len = RARRAY_LEN(ary);
 
-    if (len <= RARRAY_EMBED_LEN_MAX) {
-	VALUE subst = rb_ary_new2(len);
-	ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
+    if (ary_embeddable_p(len)) {
+        VALUE subst = rb_ary_new_capa(len);
+        RUBY_ASSERT(ARY_EMBED_P(subst));
+
+        ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
         ARY_SET_EMBED_LEN(subst, len);
         return subst;
     }
@@ -626,35 +1019,47 @@ rb_assoc_new(VALUE car, VALUE cdr)
     return rb_ary_new3(2, car, cdr);
 }
 
-static VALUE
-to_ary(VALUE ary)
+VALUE
+rb_to_array_type(VALUE ary)
 {
-    return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
+    return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
 }
+#define to_ary rb_to_array_type
 
 VALUE
 rb_check_array_type(VALUE ary)
 {
-    return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
+    return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
+}
+
+VALUE
+rb_check_to_array(VALUE ary)
+{
+    return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
+}
+
+VALUE
+rb_to_array(VALUE ary)
+{
+    return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
 }
 
 /*
  *  call-seq:
- *     Array.try_convert(obj) -> array or nil
+ *    Array.try_convert(object) -> object, new_array, or nil
  *
- *  Tries to convert +obj+ into an array, using +to_ary+ method.  Returns the
- *  converted array or +nil+ if +obj+ cannot be converted for any reason.
- *  This method can be used to check if an argument is an array.
+ *  Attempts to return an array, based on the given +object+.
  *
- *     Array.try_convert([1])   #=> [1]
- *     Array.try_convert("1")   #=> nil
+ *  If +object+ is an array, returns +object+.
  *
- *     if tmp = Array.try_convert(arg)
- *       # the argument is an array
- *     elsif tmp = String.try_convert(arg)
- *       # the argument is a string
- *     end
+ *  Otherwise if +object+ responds to <tt>:to_ary</tt>.
+ *  calls <tt>object.to_ary</tt>:
+ *  if the return value is an array or +nil+, returns that value;
+ *  if not, raises TypeError.
  *
+ *  Otherwise returns +nil+.
+ *
+ *  Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
  */
 
 static VALUE
@@ -663,60 +1068,79 @@ rb_ary_s_try_convert(VALUE dummy, VALUE ary)
     return rb_check_array_type(ary);
 }
 
+/* :nodoc: */
+static VALUE
+rb_ary_s_new(int argc, VALUE *argv, VALUE klass)
+{
+    VALUE ary;
+
+    if (klass == rb_cArray) {
+        long size = 0;
+        if (argc > 0 && FIXNUM_P(argv[0])) {
+            size = FIX2LONG(argv[0]);
+            if (size < 0) size = 0;
+        }
+
+        ary = ary_new(klass, size);
+
+        rb_obj_call_init_kw(ary, argc, argv, RB_PASS_CALLED_KEYWORDS);
+    }
+    else {
+        ary = rb_class_new_instance_pass_kw(argc, argv, klass);
+    }
+
+    return ary;
+}
+
 /*
  *  call-seq:
- *     Array.new(size=0, default=nil)
- *     Array.new(array)
- *     Array.new(size) {|index| block }
+ *    Array.new -> new_empty_array
+ *    Array.new(array) -> new_array
+ *    Array.new(size, default_value = nil) -> new_array
+ *    Array.new(size = 0) {|index| ... } -> new_array
  *
  *  Returns a new array.
  *
- *  In the first form, if no arguments are sent, the new array will be empty.
- *  When a +size+ and an optional +default+ are sent, an array is created with
- *  +size+ copies of +default+.  Take notice that all elements will reference the
- *  same object +default+.
+ *  With no block and no argument given, returns a new empty array:
  *
- *  The second form creates a copy of the array passed as a parameter (the
- *  array is generated by calling to_ary on the parameter).
+ *    Array.new # => []
  *
- *    first_array = ["Matz", "Guido"]
+ *  With no block and array argument given, returns a new array with the same elements:
  *
- *    second_array = Array.new(first_array) #=> ["Matz", "Guido"]
+ *    Array.new([:foo, 'bar', 2]) # => [:foo, "bar", 2]
  *
- *    first_array.equal? second_array       #=> false
+ *  With no block and integer argument given, returns a new array containing
+ *  that many instances of the given +default_value+:
  *
- *  In the last form, an array of the given size is created.  Each element in
- *  this array is created by passing the element's index to the given block
- *  and storing the return value.
+ *    Array.new(0)    # => []
+ *    Array.new(3)    # => [nil, nil, nil]
+ *    Array.new(2, 3) # => [3, 3]
  *
- *    Array.new(3){ |index| index ** 2 }
- *    # => [0, 1, 4]
+ *  With a block given, returns an array of the given +size+;
+ *  calls the block with each +index+ in the range <tt>(0...size)</tt>;
+ *  the element at that +index+ in the returned array is the blocks return value:
  *
- *  == Common gotchas
+ *    Array.new(3)  {|index| "Element #{index}" } # => ["Element 0", "Element 1", "Element 2"]
  *
- *  When sending the second parameter, the same object will be used as the
- *  value for all the array elements:
+ *  A common pitfall for new Rubyists is providing an expression as +default_value+:
  *
- *     a = Array.new(2, Hash.new)
- *     # => [{}, {}]
+ *    array = Array.new(2, {})
+ *    array # => [{}, {}]
+ *    array[0][:a] = 1
+ *    array # => [{a: 1}, {a: 1}], as array[0] and array[1] are same object
  *
- *     a[0]['cat'] = 'feline'
- *     a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
+ *  If you want the elements of the array to be distinct, you should pass a block:
  *
- *     a[1]['cat'] = 'Felix'
- *     a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
+ *    array = Array.new(2) { {} }
+ *    array # => [{}, {}]
+ *    array[0][:a] = 1
+ *    array # => [{a: 1}, {}], as array[0] and array[1] are different objects
  *
- *  Since all the Array elements store the same hash, changes to one of them
- *  will affect them all.
- *
- *  If multiple copies are what you want, you should use the block
- *  version which uses the result of that block each time an element
- *  of the array needs to be initialized:
- *
- *     a = Array.new(2) { Hash.new }
- *     a[0]['cat'] = 'feline'
- *     a # => [{"cat"=>"feline"}, {}]
+ *  Raises TypeError if the first argument is not either an array
+ *  or an {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]).
+ *  Raises ArgumentError if the first argument is a negative integer.
  *
+ *  Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
  */
 
 static VALUE
@@ -727,61 +1151,60 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
 
     rb_ary_modify(ary);
     if (argc == 0) {
-	if (ARY_OWNS_HEAP_P(ary) && RARRAY_CONST_PTR(ary) != 0) {
-	    ruby_sized_xfree((void *)RARRAY_CONST_PTR(ary), ARY_HEAP_SIZE(ary));
-	}
-        rb_ary_unshare_safe(ary);
-        FL_SET_EMBED(ary);
-	ARY_SET_EMBED_LEN(ary, 0);
-	if (rb_block_given_p()) {
-	    rb_warning("given block not used");
-	}
-	return ary;
+        rb_ary_reset(ary);
+        RUBY_ASSERT(ARY_EMBED_P(ary));
+        RUBY_ASSERT(ARY_EMBED_LEN(ary) == 0);
+        if (rb_block_given_p()) {
+            rb_warning("given block not used");
+        }
+        return ary;
     }
     rb_scan_args(argc, argv, "02", &size, &val);
     if (argc == 1 && !FIXNUM_P(size)) {
-	val = rb_check_array_type(size);
-	if (!NIL_P(val)) {
-	    rb_ary_replace(ary, val);
-	    return ary;
-	}
+        val = rb_check_array_type(size);
+        if (!NIL_P(val)) {
+            rb_ary_replace(ary, val);
+            return ary;
+        }
     }
 
     len = NUM2LONG(size);
     /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
     if (len < 0) {
-	rb_raise(rb_eArgError, "negative array size");
+        rb_raise(rb_eArgError, "negative array size");
     }
     if (len > ARY_MAX_SIZE) {
-	rb_raise(rb_eArgError, "array size too big");
+        rb_raise(rb_eArgError, "array size too big");
     }
     /* recheck after argument conversion */
     rb_ary_modify(ary);
     ary_resize_capa(ary, len);
     if (rb_block_given_p()) {
-	long i;
+        long i;
 
-	if (argc == 2) {
-	    rb_warn("block supersedes default value argument");
-	}
-	for (i=0; i<len; i++) {
-	    rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
-	    ARY_SET_LEN(ary, i + 1);
-	}
+        if (argc == 2) {
+            rb_warn("block supersedes default value argument");
+        }
+        for (i=0; i<len; i++) {
+            rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
+            ARY_SET_LEN(ary, i + 1);
+        }
     }
     else {
-	ary_memfill(ary, 0, len, val);
-	ARY_SET_LEN(ary, len);
+        ary_memfill(ary, 0, len, val);
+        ARY_SET_LEN(ary, len);
     }
     return ary;
 }
 
 /*
- * Returns a new array populated with the given objects.
+ * Returns a new array, populated with the given objects:
+ *
+ *   Array[1, 'a', /^A/]    # => [1, "a", /^A/]
+ *   Array[]                # => []
+ *   Array.[](1, 'a', /^A/) # => [1, "a", /^A/]
  *
- *   Array.[]( 1, 'a', /^A/ ) # => [1, "a", /^A/]
- *   Array[ 1, 'a', /^A/ ]    # => [1, "a", /^A/]
- *   [ 1, 'a', /^A/ ]         # => [1, "a", /^A/]
+ * Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
  */
 
 static VALUE
@@ -802,26 +1225,26 @@ rb_ary_store(VALUE ary, long idx, VALUE val)
     long len = RARRAY_LEN(ary);
 
     if (idx < 0) {
-	idx += len;
-	if (idx < 0) {
-	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-		     idx - len, -len);
-	}
+        idx += len;
+        if (idx < 0) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     idx - len, -len);
+        }
     }
     else if (idx >= ARY_MAX_SIZE) {
-	rb_raise(rb_eIndexError, "index %ld too big", idx);
+        rb_raise(rb_eIndexError, "index %ld too big", idx);
     }
 
     rb_ary_modify(ary);
     if (idx >= ARY_CAPA(ary)) {
-	ary_double_capa(ary, idx);
+        ary_double_capa(ary, idx);
     }
     if (idx > len) {
-	ary_mem_clear(ary, len, idx - len + 1);
+        ary_mem_clear(ary, len, idx - len + 1);
     }
 
     if (idx >= len) {
-	ARY_SET_LEN(ary, idx + 1);
+        ARY_SET_LEN(ary, idx + 1);
     }
     ARY_SET(ary, idx, val);
 }
@@ -829,35 +1252,98 @@ rb_ary_store(VALUE ary, long idx, VALUE val)
 static VALUE
 ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
 {
-    assert(offset >= 0);
-    assert(len >= 0);
-    assert(offset+len <= RARRAY_LEN(ary));
+    RUBY_ASSERT(offset >= 0);
+    RUBY_ASSERT(len >= 0);
+    RUBY_ASSERT(offset+len <= RARRAY_LEN(ary));
 
-    if (len <= RARRAY_EMBED_LEN_MAX) {
-        VALUE result = ary_alloc(klass);
-	ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
+    VALUE result = ary_alloc_heap(klass);
+    size_t embed_capa = ary_embed_capa(result);
+    if ((size_t)len <= embed_capa) {
+        FL_SET_EMBED(result);
+        ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
         ARY_SET_EMBED_LEN(result, len);
-        return result;
     }
     else {
-        VALUE shared, result = ary_alloc(klass);
+        VALUE shared = ary_make_shared(ary);
+
+        /* The ary_make_shared call may allocate, which can trigger a GC
+         * compaction. This can cause the array to be embedded because it has
+         * a length of 0. */
         FL_UNSET_EMBED(result);
 
-        shared = ary_make_shared(ary);
         ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
         ARY_SET_LEN(result, RARRAY_LEN(ary));
         rb_ary_set_shared(result, shared);
 
         ARY_INCREASE_PTR(result, offset);
         ARY_SET_LEN(result, len);
+
+        ary_verify(shared);
+    }
+
+    ary_verify(result);
+    return result;
+}
+
+static VALUE
+ary_make_partial_step(VALUE ary, VALUE klass, long offset, long len, long step)
+{
+    RUBY_ASSERT(offset >= 0);
+    RUBY_ASSERT(len >= 0);
+    RUBY_ASSERT(offset+len <= RARRAY_LEN(ary));
+    RUBY_ASSERT(step != 0);
+
+    const long orig_len = len;
+
+    if (step > 0 && step >= len) {
+        VALUE result = ary_new(klass, 1);
+        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+        const VALUE *values = RARRAY_CONST_PTR(ary);
+
+        RB_OBJ_WRITE(result, ptr, values[offset]);
+        ARY_SET_EMBED_LEN(result, 1);
         return result;
     }
+    else if (step < 0 && step < -len) {
+        step = -len;
+    }
+
+    long ustep = (step < 0) ? -step : step;
+    len = roomof(len, ustep);
+
+    long i;
+    long j = offset + ((step > 0) ? 0 : (orig_len - 1));
+
+    VALUE result = ary_new(klass, len);
+    if (ARY_EMBED_P(result)) {
+        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+        const VALUE *values = RARRAY_CONST_PTR(ary);
+
+        for (i = 0; i < len; ++i) {
+            RB_OBJ_WRITE(result, ptr+i, values[j]);
+            j += step;
+        }
+        ARY_SET_EMBED_LEN(result, len);
+    }
+    else {
+        const VALUE *values = RARRAY_CONST_PTR(ary);
+
+        RARRAY_PTR_USE(result, ptr, {
+            for (i = 0; i < len; ++i) {
+                RB_OBJ_WRITE(result, ptr+i, values[j]);
+                j += step;
+            }
+        });
+        ARY_SET_LEN(result, len);
+    }
+
+    return result;
 }
 
 static VALUE
 ary_make_shared_copy(VALUE ary)
 {
-    return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
 }
 
 enum ary_take_pos_flags
@@ -867,50 +1353,59 @@ enum ary_take_pos_flags
 };
 
 static VALUE
-ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+ary_take_first_or_last_n(VALUE ary, long n, enum ary_take_pos_flags last)
 {
-    VALUE nv;
-    long n;
-    long len;
+    long len = RARRAY_LEN(ary);
     long offset = 0;
 
-    rb_scan_args(argc, argv, "1", &nv);
-    n = NUM2LONG(nv);
-    len = RARRAY_LEN(ary);
     if (n > len) {
-	n = len;
+        n = len;
     }
     else if (n < 0) {
-	rb_raise(rb_eArgError, "negative array size");
+        rb_raise(rb_eArgError, "negative array size");
     }
     if (last) {
-	offset = len - n;
+        offset = len - n;
     }
     return ary_make_partial(ary, rb_cArray, offset, n);
 }
 
+static VALUE
+ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+{
+    argc = rb_check_arity(argc, 0, 1);
+    /* the case optional argument is omitted should be handled in
+     * callers of this function.  if another arity case is added,
+     * this arity check needs to rewrite. */
+    RUBY_ASSERT_ALWAYS(argc == 1);
+    return ary_take_first_or_last_n(ary, NUM2LONG(argv[0]), last);
+}
+
 /*
  *  call-seq:
- *     ary << obj            -> ary
+ *    self << object -> self
+ *
+ *  Appends +object+ as the last element in +self+; returns +self+:
  *
- *  Append---Pushes the given object on to the end of this array. This
- *  expression returns the array itself, so several appends
- *  may be chained together.
+ *    [:foo, 'bar', 2] << :baz # => [:foo, "bar", 2, :baz]
  *
- *     [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
- *             #=>  [ 1, 2, "c", "d", [ 3, 4 ] ]
+ *  Appends +object+ as a single element, even if it is another array:
  *
+ *    [:foo, 'bar', 2] << [3, 4] # => [:foo, "bar", 2, [3, 4]]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 VALUE
 rb_ary_push(VALUE ary, VALUE item)
 {
-    long idx = RARRAY_LEN(ary);
+    long idx = RARRAY_LEN((ary_verify(ary), ary));
     VALUE target_ary = ary_ensure_room_for_push(ary, 1);
     RARRAY_PTR_USE(ary, ptr, {
-	RB_OBJ_WRITE(target_ary, &ptr[idx], item);
+        RB_OBJ_WRITE(target_ary, &ptr[idx], item);
     });
     ARY_SET_LEN(ary, idx + 1);
+    ary_verify(ary);
     return ary;
 }
 
@@ -926,18 +1421,20 @@ rb_ary_cat(VALUE ary, const VALUE *argv, long len)
 
 /*
  *  call-seq:
- *     ary.push(obj, ... )   -> ary
- *
- *  Append --- Pushes the given object(s) on to the end of this array. This
- *  expression returns the array itself, so several appends
- *  may be chained together. See also Array#pop for the opposite
- *  effect.
- *
- *     a = [ "a", "b", "c" ]
- *     a.push("d", "e", "f")
- *             #=> ["a", "b", "c", "d", "e", "f"]
- *     [1, 2, 3,].push(4).push(5)
- *             #=> [1, 2, 3, 4, 5]
+ *    push(*objects) -> self
+ *    append(*objects) -> self
+ *
+ *  Appends each argument in +objects+ to +self+; returns +self+:
+ *
+ *    a = [:foo, 'bar', 2] # => [:foo, "bar", 2]
+ *    a.push(:baz, :bat)   # => [:foo, "bar", 2, :baz, :bat]
+ *
+ *  Appends each argument as a single element, even if it is another array:
+ *
+ *    a = [:foo, 'bar', 2]               # => [:foo, "bar", 2]
+      a.push([:baz, :bat], [:bam, :bad]) # => [:foo, "bar", 2, [:baz, :bat], [:bam, :bad]]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -954,32 +1451,47 @@ rb_ary_pop(VALUE ary)
     n = RARRAY_LEN(ary);
     if (n == 0) return Qnil;
     if (ARY_OWNS_HEAP_P(ary) &&
-	n * 3 < ARY_CAPA(ary) &&
-	ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+        n * 3 < ARY_CAPA(ary) &&
+        ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
     {
-	ary_resize_capa(ary, n * 2);
+        ary_resize_capa(ary, n * 2);
     }
-    --n;
-    ARY_SET_LEN(ary, n);
-    return RARRAY_AREF(ary, n);
+
+    VALUE obj = RARRAY_AREF(ary, n - 1);
+
+    ARY_SET_LEN(ary, n - 1);
+    ary_verify(ary);
+    return obj;
 }
 
 /*
  *  call-seq:
- *     ary.pop    -> obj or nil
- *     ary.pop(n) -> new_ary
+ *    pop -> object or nil
+ *    pop(count) -> new_array
+ *
+ *  Removes and returns trailing elements of +self+.
+ *
+ *  With no argument given, removes and returns the last element, if available;
+ *  otherwise returns +nil+:
  *
- *  Removes the last element from +self+ and returns it, or
- *  +nil+ if the array is empty.
+ *    a = [:foo, 'bar', 2]
+ *    a.pop  # => 2
+ *    a      # => [:foo, "bar"]
+ *    [].pop # => nil
  *
- *  If a number +n+ is given, returns an array of the last +n+ elements
- *  (or less) just like <code>array.slice!(-n, n)</code> does. See also
- *  Array#push for the opposite effect.
+ *  With non-negative integer argument +count+ given,
+ *  returns a new array containing the trailing +count+ elements of +self+, as available:
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.pop     #=> "d"
- *     a.pop(2)  #=> ["b", "c"]
- *     a         #=> ["a"]
+ *    a = [:foo, 'bar', 2]
+ *    a.pop(2) # => ["bar", 2]
+ *    a        # => [:foo]
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.pop(50) # => [:foo, "bar", 2]
+ *    a         # => []
+ *
+ *  Related: Array#push;
+ *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -988,12 +1500,13 @@ rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
     VALUE result;
 
     if (argc == 0) {
-	return rb_ary_pop(ary);
+        return rb_ary_pop(ary);
     }
 
     rb_ary_modify_check(ary);
     result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+    ary_verify(ary);
     return result;
 }
 
@@ -1003,52 +1516,54 @@ rb_ary_shift(VALUE ary)
     VALUE top;
     long len = RARRAY_LEN(ary);
 
-    rb_ary_modify_check(ary);
-    if (len == 0) return Qnil;
+    if (len == 0) {
+        rb_ary_modify_check(ary);
+        return Qnil;
+    }
+
     top = RARRAY_AREF(ary, 0);
-    if (!ARY_SHARED_P(ary)) {
-	if (len < ARY_DEFAULT_SIZE) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+1, VALUE, len-1);
-	    }); /* WB: no new reference */
-            ARY_INCREASE_LEN(ary, -1);
-	    return top;
-	}
-        assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
-
-	ARY_SET(ary, 0, Qnil);
-	ary_make_shared(ary);
-    }
-    else if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
-	RARRAY_PTR_USE(ary, ptr, ptr[0] = Qnil);
-    }
-    ARY_INCREASE_PTR(ary, 1);		/* shift ptr */
-    ARY_INCREASE_LEN(ary, -1);
+
+    rb_ary_behead(ary, 1);
 
     return top;
 }
 
 /*
  *  call-seq:
- *     ary.shift    -> obj or nil
- *     ary.shift(n) -> new_ary
+ *    shift -> object or nil
+ *    shift(count) -> new_array or nil
+ *
+ *  Removes and returns leading elements from +self+.
+ *
+ *  With no argument, removes and returns one element, if available,
+ *  or +nil+ otherwise:
+ *
+ *    a = [0, 1, 2, 3]
+ *    a.shift  # => 0
+ *    a        # => [1, 2, 3]
+ *    [].shift # => nil
  *
- *  Removes the first element of +self+ and returns it (shifting all
- *  other elements down by one). Returns +nil+ if the array
- *  is empty.
+ *  With non-negative numeric argument +count+ given,
+ *  removes and returns the first +count+ elements:
  *
- *  If a number +n+ is given, returns an array of the first +n+ elements
- *  (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
- *  containing only the remainder elements, not including what was shifted to
- *  +new_ary+. See also Array#unshift for the opposite effect.
+ *    a = [0, 1, 2, 3]
+ *    a.shift(2)   # => [0, 1]
+ *    a            # => [2, 3]
+ *    a.shift(1.1) # => [2]
+ *    a            # => [3]
+ *    a.shift(0)   # => []
+ *    a            # => [3]
  *
- *     args = [ "-m", "-q", "filename" ]
- *     args.shift     #=> "-m"
- *     args           #=> ["-q", "filename"]
+ *  If +count+ is large,
+ *  removes and returns all elements:
  *
- *     args = [ "-m", "-q", "filename" ]
- *     args.shift(2)  #=> ["-m", "-q"]
- *     args           #=> ["filename"]
+ *    a = [0, 1, 2, 3]
+ *    a.shift(50) # => [0, 1, 2, 3]
+ *    a           # => []
+ *
+ *  If +self+ is empty, returns a new empty array.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -1058,111 +1573,158 @@ rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
     long n;
 
     if (argc == 0) {
-	return rb_ary_shift(ary);
+        return rb_ary_shift(ary);
     }
 
     rb_ary_modify_check(ary);
     result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
     n = RARRAY_LEN(result);
-    if (ARY_SHARED_P(ary)) {
-	if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
-	  setup_occupied_shared:
-	    ary_mem_clear(ary, 0, n);
-	}
-        ARY_INCREASE_PTR(ary, n);
+    rb_ary_behead(ary,n);
+
+    return result;
+}
+
+VALUE
+rb_ary_behead(VALUE ary, long n)
+{
+    if (n <= 0) {
+        return ary;
     }
-    else {
-	if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
-	    }); /* WB: no new reference */
-	}
-	else {
-	    ary_make_shared(ary);
-	    goto setup_occupied_shared;
-	}
+
+    rb_ary_modify_check(ary);
+
+    if (!ARY_SHARED_P(ary)) {
+        if (ARY_EMBED_P(ary) || RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+            RARRAY_PTR_USE(ary, ptr, {
+                MEMMOVE(ptr, ptr + n, VALUE, RARRAY_LEN(ary) - n);
+            }); /* WB: no new reference */
+            ARY_INCREASE_LEN(ary, -n);
+            ary_verify(ary);
+            return ary;
+        }
+
+        ary_mem_clear(ary, 0, n);
+        ary_make_shared(ary);
+    }
+    else if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
+        ary_mem_clear(ary, 0, n);
     }
+
+    ARY_INCREASE_PTR(ary, n);
     ARY_INCREASE_LEN(ary, -n);
+    ary_verify(ary);
 
-    return result;
+    return ary;
 }
 
 static VALUE
-ary_ensure_room_for_unshift(VALUE ary, int argc)
+make_room_for_unshift(VALUE ary, const VALUE *head, VALUE *sharedp, int argc, long capa, long len)
+{
+    if (head - sharedp < argc) {
+        long room = capa - len - argc;
+
+        room -= room >> 4;
+        MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+        head = sharedp + argc + room;
+    }
+    ARY_SET_PTR(ary, head - argc);
+    RUBY_ASSERT(ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary)));
+
+    ary_verify(ary);
+    return ARY_SHARED_ROOT(ary);
+}
+
+static VALUE
+ary_modify_for_unshift(VALUE ary, int argc)
 {
     long len = RARRAY_LEN(ary);
     long new_len = len + argc;
     long capa;
     const VALUE *head, *sharedp;
 
-    if (ARY_SHARED_P(ary)) {
-	VALUE shared = ARY_SHARED(ary);
-	capa = RARRAY_LEN(shared);
-	if (ARY_SHARED_OCCUPIED(shared) && capa > new_len) {
-	    head = RARRAY_CONST_PTR(ary);
-	    sharedp = RARRAY_CONST_PTR(shared);
-	    goto makeroom_if_need;
-	}
-    }
-
     rb_ary_modify(ary);
     capa = ARY_CAPA(ary);
     if (capa - (capa >> 6) <= new_len) {
-	ary_double_capa(ary, new_len);
+        ary_double_capa(ary, new_len);
     }
 
     /* use shared array for big "queues" */
-    if (new_len > ARY_DEFAULT_SIZE * 4) {
-	/* make a room for unshifted items */
-	capa = ARY_CAPA(ary);
-	ary_make_shared(ary);
-
-	head = sharedp = RARRAY_CONST_PTR(ary);
-	goto makeroom;
-      makeroom_if_need:
-	if (head - sharedp < argc) {
-	    long room;
-	  makeroom:
-	    room = capa - new_len;
-	    room -= room >> 4;
-	    MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
-	    head = sharedp + argc + room;
-	}
-	ARY_SET_PTR(ary, head - argc);
-	assert(ARY_SHARED_OCCUPIED(ARY_SHARED(ary)));
-	return ARY_SHARED(ary);
+    if (new_len > ARY_DEFAULT_SIZE * 4 && !ARY_EMBED_P(ary)) {
+        ary_verify(ary);
+
+        /* make a room for unshifted items */
+        capa = ARY_CAPA(ary);
+        ary_make_shared(ary);
+
+        head = sharedp = RARRAY_CONST_PTR(ary);
+        return make_room_for_unshift(ary, head, (void *)sharedp, argc, capa, len);
     }
     else {
-	/* sliding items */
-	RARRAY_PTR_USE(ary, ptr, {
-	    MEMMOVE(ptr + argc, ptr, VALUE, len);
-	});
+        /* sliding items */
+        RARRAY_PTR_USE(ary, ptr, {
+            MEMMOVE(ptr + argc, ptr, VALUE, len);
+        });
 
-	return ary;
+        ary_verify(ary);
+        return ary;
+    }
+}
+
+static VALUE
+ary_ensure_room_for_unshift(VALUE ary, int argc)
+{
+    long len = RARRAY_LEN(ary);
+    long new_len = len + argc;
+
+    if (len > ARY_MAX_SIZE - argc) {
+        rb_raise(rb_eIndexError, "index %ld too big", new_len);
+    }
+    else if (! ARY_SHARED_P(ary)) {
+        return ary_modify_for_unshift(ary, argc);
+    }
+    else {
+        VALUE shared_root = ARY_SHARED_ROOT(ary);
+        long capa = RARRAY_LEN(shared_root);
+
+        if (! ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+            return ary_modify_for_unshift(ary, argc);
+        }
+        else if (new_len > capa) {
+            return ary_modify_for_unshift(ary, argc);
+        }
+        else {
+            const VALUE * head = RARRAY_CONST_PTR(ary);
+            void *sharedp = (void *)RARRAY_CONST_PTR(shared_root);
+
+            rb_ary_modify_check(ary);
+            return make_room_for_unshift(ary, head, sharedp, argc, capa, len);
+        }
     }
 }
 
 /*
  *  call-seq:
- *     ary.unshift(obj, ...)  -> ary
+ *    unshift(*objects) -> self
+ *    prepend(*objects) -> self
+ *
+ *  Prepends the given +objects+ to +self+:
  *
- *  Prepends objects to the front of +self+, moving other elements upwards.
- *  See also Array#shift for the opposite effect.
+ *    a = [:foo, 'bar', 2]
+ *    a.unshift(:bam, :bat) # => [:bam, :bat, :foo, "bar", 2]
  *
- *     a = [ "b", "c", "d" ]
- *     a.unshift("a")   #=> ["a", "b", "c", "d"]
- *     a.unshift(1, 2)  #=> [ 1, 2, "a", "b", "c", "d"]
+ *  Related: Array#shift;
+ *  see also {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
-static VALUE
+VALUE
 rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
 {
     long len = RARRAY_LEN(ary);
     VALUE target_ary;
 
     if (argc == 0) {
-	rb_ary_modify_check(ary);
-	return ary;
+        rb_ary_modify_check(ary);
+        return ary;
     }
 
     target_ary = ary_ensure_room_for_unshift(ary, argc);
@@ -1174,7 +1736,7 @@ rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
 VALUE
 rb_ary_unshift(VALUE ary, VALUE item)
 {
-    return rb_ary_unshift_m(1,&item,ary);
+    return rb_ary_unshift_m(1, &item, ary);
 }
 
 /* faster version - use this if you don't need to treat negative offset */
@@ -1184,7 +1746,7 @@ rb_ary_elt(VALUE ary, long offset)
     long len = RARRAY_LEN(ary);
     if (len == 0) return Qnil;
     if (offset < 0 || len <= offset) {
-	return Qnil;
+        return Qnil;
     }
     return RARRAY_AREF(ary, offset);
 }
@@ -1192,14 +1754,11 @@ rb_ary_elt(VALUE ary, long offset)
 VALUE
 rb_ary_entry(VALUE ary, long offset)
 {
-    if (offset < 0) {
-	offset += RARRAY_LEN(ary);
-    }
-    return rb_ary_elt(ary, offset);
+    return rb_ary_entry_internal(ary, offset);
 }
 
 VALUE
-rb_ary_subseq(VALUE ary, long beg, long len)
+rb_ary_subseq_step(VALUE ary, long beg, long len, long step)
 {
     VALUE klass;
     long alen = RARRAY_LEN(ary);
@@ -1208,179 +1767,293 @@ rb_ary_subseq(VALUE ary, long beg, long len)
     if (beg < 0 || len < 0) return Qnil;
 
     if (alen < len || alen < beg + len) {
-	len = alen - beg;
+        len = alen - beg;
     }
-    klass = rb_obj_class(ary);
+    klass = rb_cArray;
     if (len == 0) return ary_new(klass, 0);
+    if (step == 0)
+        rb_raise(rb_eArgError, "slice step cannot be zero");
+    if (step == 1)
+        return ary_make_partial(ary, klass, beg, len);
+    else
+        return ary_make_partial_step(ary, klass, beg, len, step);
+}
 
-    return ary_make_partial(ary, klass, beg, len);
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
+{
+    return rb_ary_subseq_step(ary, beg, len, 1);
 }
 
+static VALUE rb_ary_aref2(VALUE ary, VALUE b, VALUE e);
+
 /*
  *  call-seq:
- *     ary[index]                -> obj     or nil
- *     ary[start, length]        -> new_ary or nil
- *     ary[range]                -> new_ary or nil
- *     ary.slice(index)          -> obj     or nil
- *     ary.slice(start, length)  -> new_ary or nil
- *     ary.slice(range)          -> new_ary or nil
- *
- *  Element Reference --- Returns the element at +index+, or returns a
- *  subarray starting at the +start+ index and continuing for +length+
- *  elements, or returns a subarray specified by +range+ of indices.
- *
- *  Negative indices count backward from the end of the array (-1 is the last
- *  element).  For +start+ and +range+ cases the starting index is just before
- *  an element.  Additionally, an empty array is returned when the starting
- *  index for an element range is at the end of the array.
- *
- *  Returns +nil+ if the index (or starting index) are out of range.
- *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a[2] +  a[0] + a[1]    #=> "cab"
- *     a[6]                   #=> nil
- *     a[1, 2]                #=> [ "b", "c" ]
- *     a[1..3]                #=> [ "b", "c", "d" ]
- *     a[4..7]                #=> [ "e" ]
- *     a[6..10]               #=> nil
- *     a[-3, 3]               #=> [ "c", "d", "e" ]
- *     # special cases
- *     a[5]                   #=> nil
- *     a[6, 1]                #=> nil
- *     a[5, 1]                #=> []
- *     a[5..10]               #=> []
+ *    self[offset] -> object or nil
+ *    self[offset, size] -> object or nil
+ *    self[range] -> object or nil
+ *    self[aseq] -> object or nil
+ *
+ *  Returns elements from +self+; does not modify +self+.
+ *
+ *  In brief:
+ *
+ *    a = [:foo, 'bar', 2]
+ *
+ *    # Single argument offset: returns one element.
+ *    a[0]     # => :foo          # Zero-based index.
+ *    a[-1]    # => 2             # Negative index counts backwards from end.
+ *
+ *    # Arguments offset and size: returns an array.
+ *    a[1, 2]  # => ["bar", 2]
+ *    a[-2, 2] # => ["bar", 2]    # Negative offset counts backwards from end.
+ *
+ *    # Single argument range: returns an array.
+ *    a[0..1]  # => [:foo, "bar"]
+ *    a[0..-2] # => [:foo, "bar"] # Negative range-begin counts backwards from end.
+ *    a[-2..2] # => ["bar", 2]    # Negative range-end counts backwards from end.
+ *
+ *  When a single integer argument +offset+ is given, returns the element at offset +offset+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0] # => :foo
+ *    a[2] # => 2
+ *    a # => [:foo, "bar", 2]
+ *
+ *  If +offset+ is negative, counts backwards from the end of +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1] # => 2
+ *    a[-2] # => "bar"
+ *
+ *  If +index+ is out of range, returns +nil+.
+ *
+ *  When two Integer arguments +offset+ and +size+ are given,
+ *  returns a new array of size +size+ containing successive elements beginning at offset +offset+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 2] # => [:foo, "bar"]
+ *    a[1, 2] # => ["bar", 2]
+ *
+ *  If <tt>offset + size</tt> is greater than <tt>self.size</tt>,
+ *  returns all elements from offset +offset+ to the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 4] # => [:foo, "bar", 2]
+ *    a[1, 3] # => ["bar", 2]
+ *    a[2, 2] # => [2]
+ *
+ *  If <tt>offset == self.size</tt> and <tt>size >= 0</tt>,
+ *  returns a new empty array.
+ *
+ *  If +size+ is negative, returns +nil+.
  *
+ *  When a single Range argument +range+ is given,
+ *  treats <tt>range.min</tt> as +offset+ above
+ *  and <tt>range.size</tt> as +size+ above:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..1] # => [:foo, "bar"]
+ *    a[1..2] # => ["bar", 2]
+ *
+ *  Special case: If <tt>range.start == a.size</tt>, returns a new empty array.
+ *
+ *  If <tt>range.end</tt> is negative, calculates the end index from the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..-1] # => [:foo, "bar", 2]
+ *    a[0..-2] # => [:foo, "bar"]
+ *    a[0..-3] # => [:foo]
+ *
+ *  If <tt>range.start</tt> is negative, calculates the start index from the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1..2] # => [2]
+ *    a[-2..2] # => ["bar", 2]
+ *    a[-3..2] # => [:foo, "bar", 2]
+ *
+ *  If <tt>range.start</tt> is larger than the array size, returns +nil+.
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[4..1] # => nil
+ *    a[4..0] # => nil
+ *    a[4..-1] # => nil
+ *
+ *  When a single Enumerator::ArithmeticSequence argument +aseq+ is given,
+ *  returns an array of elements corresponding to the indexes produced by
+ *  the sequence.
+ *
+ *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ *    a[(1..).step(2)] # => ["data1", "data2", "data3"]
+ *
+ *  Unlike slicing with range, if the start or the end of the arithmetic sequence
+ *  is larger than array size, throws RangeError.
+ *
+ *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ *    a[(1..11).step(2)]
+ *    # RangeError (((1..11).step(2)) out of range)
+ *    a[(7..).step(2)]
+ *    # RangeError (((7..).step(2)) out of range)
+ *
+ *  If given a single argument, and its type is not one of the listed, tries to
+ *  convert it to Integer, and raises if it is impossible:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    # Raises TypeError (no implicit conversion of Symbol into Integer):
+ *    a[:foo]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
 rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
 {
-    VALUE arg;
-    long beg, len;
-
+    rb_check_arity(argc, 1, 2);
     if (argc == 2) {
-	beg = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
-	if (beg < 0) {
-	    beg += RARRAY_LEN(ary);
-	}
-	return rb_ary_subseq(ary, beg, len);
+        return rb_ary_aref2(ary, argv[0], argv[1]);
     }
-    if (argc != 1) {
-	rb_scan_args(argc, argv, "11", NULL, NULL);
+    return rb_ary_aref1(ary, argv[0]);
+}
+
+static VALUE
+rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
+{
+    long beg = NUM2LONG(b);
+    long len = NUM2LONG(e);
+    if (beg < 0) {
+        beg += RARRAY_LEN(ary);
     }
-    arg = argv[0];
+    return rb_ary_subseq(ary, beg, len);
+}
+
+VALUE
+rb_ary_aref1(VALUE ary, VALUE arg)
+{
+    long beg, len, step;
+
     /* special case - speeding up */
     if (FIXNUM_P(arg)) {
-	return rb_ary_entry(ary, FIX2LONG(arg));
+        return rb_ary_entry(ary, FIX2LONG(arg));
     }
-    /* check if idx is Range */
-    switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
+    /* check if idx is Range or ArithmeticSequence */
+    switch (rb_arithmetic_sequence_beg_len_step(arg, &beg, &len, &step, RARRAY_LEN(ary), 0)) {
       case Qfalse:
-	break;
+        break;
       case Qnil:
-	return Qnil;
+        return Qnil;
       default:
-	return rb_ary_subseq(ary, beg, len);
+        return rb_ary_subseq_step(ary, beg, len, step);
     }
+
     return rb_ary_entry(ary, NUM2LONG(arg));
 }
 
 /*
  *  call-seq:
- *     ary.at(index)   ->   obj  or nil
+ *    at(index) -> object or nil
+ *
+ *  Returns the element of +self+ specified by the given +index+
+ *  or +nil+ if there is no such element;
+ *  +index+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *
+ *  For non-negative +index+, returns the element of +self+ at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.at(0)   # => :foo
+ *    a.at(2)   # => 2
+ *    a.at(2.0) # => 2
  *
- *  Returns the element at +index+. A negative index counts from the end of
- *  +self+. Returns +nil+ if the index is out of range. See also
- *  Array#[].
+ *  For negative +index+, counts backwards from the end of +self+:
  *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.at(0)     #=> "a"
- *     a.at(-1)    #=> "e"
+ *    a.at(-2) # => "bar"
+ *
+ *  Related: Array#[];
+ *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
-static VALUE
+VALUE
 rb_ary_at(VALUE ary, VALUE pos)
 {
     return rb_ary_entry(ary, NUM2LONG(pos));
 }
 
-/*
- *  call-seq:
- *     ary.first     ->   obj or nil
- *     ary.first(n)  ->   new_ary
- *
- *  Returns the first element, or the first +n+ elements, of the array.
- *  If the array is empty, the first form returns +nil+, and the
- *  second form returns an empty array. See also Array#last for
- *  the opposite effect.
- *
- *     a = [ "q", "r", "s", "t" ]
- *     a.first     #=> "q"
- *     a.first(2)  #=> ["q", "r"]
- */
-
+#if 0
 static VALUE
 rb_ary_first(int argc, VALUE *argv, VALUE ary)
 {
     if (argc == 0) {
-	if (RARRAY_LEN(ary) == 0) return Qnil;
-	return RARRAY_AREF(ary, 0);
+        if (RARRAY_LEN(ary) == 0) return Qnil;
+        return RARRAY_AREF(ary, 0);
     }
     else {
-	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
     }
 }
+#endif
 
-/*
- *  call-seq:
- *     ary.last     ->  obj or nil
- *     ary.last(n)  ->  new_ary
- *
- *  Returns the last element(s) of +self+. If the array is empty,
- *  the first form returns +nil+.
- *
- *  See also Array#first for the opposite effect.
- *
- *     a = [ "w", "x", "y", "z" ]
- *     a.last     #=> "z"
- *     a.last(2)  #=> ["y", "z"]
- */
+static VALUE
+ary_first(VALUE self)
+{
+    return (RARRAY_LEN(self) == 0) ? Qnil : RARRAY_AREF(self, 0);
+}
+
+static VALUE
+ary_last(VALUE self)
+{
+    long len = RARRAY_LEN(self);
+    return (len == 0) ? Qnil : RARRAY_AREF(self, len-1);
+}
 
 VALUE
-rb_ary_last(int argc, const VALUE *argv, VALUE ary)
+rb_ary_last(int argc, const VALUE *argv, VALUE ary) // used by parse.y
 {
     if (argc == 0) {
-	long len = RARRAY_LEN(ary);
-	if (len == 0) return Qnil;
-	return RARRAY_AREF(ary, len-1);
+        return ary_last(ary);
     }
     else {
-	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     }
 }
 
 /*
  *  call-seq:
- *     ary.fetch(index)                    -> obj
- *     ary.fetch(index, default)           -> obj
- *     ary.fetch(index) { |index| block }  -> obj
- *
- *  Tries to return the element at position +index+, but throws an IndexError
- *  exception if the referenced +index+ lies outside of the array bounds.  This
- *  error can be prevented by supplying a second argument, which will act as a
- *  +default+ value.
- *
- *  Alternatively, if a block is given it will only be executed when an
- *  invalid +index+ is referenced.  Negative values of +index+ count from the
- *  end of the array.
- *
- *     a = [ 11, 22, 33, 44 ]
- *     a.fetch(1)               #=> 22
- *     a.fetch(-1)              #=> 44
- *     a.fetch(4, 'cat')        #=> "cat"
- *     a.fetch(100) { |i| puts "#{i} is out of bounds" }
- *                              #=> "100 is out of bounds"
+ *    fetch(index) -> element
+ *    fetch(index, default_value) -> element or default_value
+ *    fetch(index) {|index| ... } -> element or block_return_value
+ *
+ *  Returns the element of +self+ at offset +index+ if +index+ is in range; +index+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *
+ *  With the single argument +index+ and no block,
+ *  returns the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1)   # => "bar"
+ *    a.fetch(1.1) # => "bar"
+ *
+ *  If +index+ is negative, counts from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(-1) # => 2
+ *    a.fetch(-2) # => "bar"
+ *
+ *  With arguments +index+ and +default_value+ (which may be any object) and no block,
+ *  returns +default_value+ if +index+ is out-of-range:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1, nil)  # => "bar"
+ *    a.fetch(3, :foo) # => :foo
+ *
+ *  With argument +index+ and a block,
+ *  returns the element at offset +index+ if index is in range
+ *  (and the block is not called); otherwise calls the block with index and returns its return value:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1) {|index| raise 'Cannot happen' } # => "bar"
+ *    a.fetch(50) {|index| "Value for #{index}" } # => "Value for 50"
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -1393,149 +2066,232 @@ rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
     rb_scan_args(argc, argv, "11", &pos, &ifnone);
     block_given = rb_block_given_p();
     if (block_given && argc == 2) {
-	rb_warn("block supersedes default value argument");
+        rb_warn("block supersedes default value argument");
     }
     idx = NUM2LONG(pos);
 
     if (idx < 0) {
-	idx +=  RARRAY_LEN(ary);
+        idx +=  RARRAY_LEN(ary);
     }
     if (idx < 0 || RARRAY_LEN(ary) <= idx) {
-	if (block_given) return rb_yield(pos);
-	if (argc == 1) {
-	    rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
-			idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
-	}
-	return ifnone;
+        if (block_given) return rb_yield(pos);
+        if (argc == 1) {
+            rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+                        idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+        }
+        return ifnone;
     }
     return RARRAY_AREF(ary, idx);
 }
 
 /*
+ * call-seq:
+ *   find(if_none_proc = nil) {|element| ... } -> object or nil
+ *   find(if_none_proc = nil) -> enumerator
+ *
+ * Returns the first element for which the block returns a truthy value.
+ *
+ * With a block given, calls the block with successive elements of the array;
+ * returns the first element for which the block returns a truthy value:
+ *
+ *   [1, 3, 5].find {|element| element > 2}                # => 3
+ *
+ * If no such element is found, calls +if_none_proc+ and returns its return value.
+ *
+ *   [1, 3, 5].find(proc {-1}) {|element| element > 12} # => -1
+ *
+ * With no block given, returns an Enumerator.
+ *
+ */
+
+static VALUE
+rb_ary_find(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE if_none;
+    long idx;
+
+    RETURN_ENUMERATOR(ary, argc, argv);
+    if_none = rb_check_arity(argc, 0, 1) ? argv[0] : Qnil;
+
+    for (idx = 0; idx < RARRAY_LEN(ary); idx++) {
+        VALUE elem = RARRAY_AREF(ary, idx);
+        if (RTEST(rb_yield(elem))) {
+            return elem;
+        }
+    }
+
+    if (!NIL_P(if_none)) {
+        return rb_funcallv(if_none, idCall, 0, 0);
+    }
+    return Qnil;
+}
+
+/*
+ * call-seq:
+ *   rfind(if_none_proc = nil) {|element| ... } -> object or nil
+ *   rfind(if_none_proc = nil) -> enumerator
+ *
+ * Returns the last element for which the block returns a truthy value.
+ *
+ * With a block given, calls the block with successive elements of the array in
+ * reverse order; returns the first element for which the block returns a truthy
+ * value:
+ *
+ *   [1, 2, 3, 4, 5, 6].rfind {|element| element < 5}       # => 4
+ *
+ * If no such element is found, calls +if_none_proc+ and returns its return value.
+ *
+ *   [1, 2, 3, 4].rfind(proc {0}) {|element| element < -2}  # => 0
+ *
+ * With no block given, returns an Enumerator.
+ *
+ */
+
+static VALUE
+rb_ary_rfind(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE if_none;
+    long len, idx;
+
+    RETURN_ENUMERATOR(ary, argc, argv);
+    if_none = rb_check_arity(argc, 0, 1) ? argv[0] : Qnil;
+
+    idx = RARRAY_LEN(ary);
+    while (idx--) {
+        VALUE elem = RARRAY_AREF(ary, idx);
+        if (RTEST(rb_yield(elem))) {
+            return elem;
+        }
+
+        len = RARRAY_LEN(ary);
+        idx = (idx >= len) ? len : idx;
+    }
+
+    if (!NIL_P(if_none)) {
+        return rb_funcallv(if_none, idCall, 0, 0);
+    }
+    return Qnil;
+}
+
+/*
  *  call-seq:
- *     ary.find_index(obj)             ->  int or nil
- *     ary.find_index { |item| block } ->  int or nil
- *     ary.find_index                  ->  Enumerator
- *     ary.index(obj)             ->  int or nil
- *     ary.index { |item| block } ->  int or nil
- *     ary.index                  ->  Enumerator
+ *    find_index(object) -> integer or nil
+ *    find_index {|element| ... } -> integer or nil
+ *    find_index -> new_enumerator
+ *    index(object) -> integer or nil
+ *    index {|element| ... } -> integer or nil
+ *    index -> new_enumerator
+ *
+ *  Returns the zero-based integer index of a specified element, or +nil+.
+ *
+ *  With only argument +object+ given,
+ *  returns the index of the first element +element+
+ *  for which <tt>object == element</tt>:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.index('bar') # => 1
  *
- *  Returns the _index_ of the first object in +ary+ such that the object is
- *  <code>==</code> to +obj+.
+ *  Returns +nil+ if no such element found.
  *
- *  If a block is given instead of an argument, returns the _index_ of the
- *  first object for which the block returns +true+.  Returns +nil+ if no
- *  match is found.
+ *  With only a block given,
+ *  calls the block with each successive element;
+ *  returns the index of the first element for which the block returns a truthy value:
  *
- *  See also Array#rindex.
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.index {|element| element == 'bar' } # => 1
  *
- *  An Enumerator is returned if neither a block nor argument is given.
+ *  Returns +nil+ if the block never returns a truthy value.
  *
- *     a = [ "a", "b", "c" ]
- *     a.index("b")              #=> 1
- *     a.index("z")              #=> nil
- *     a.index { |x| x == "b" }  #=> 1
+ *  With neither an argument nor a block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
 rb_ary_index(int argc, VALUE *argv, VALUE ary)
 {
-    const VALUE *ptr;
     VALUE val;
-    long i, len;
+    long i;
 
     if (argc == 0) {
-	RETURN_ENUMERATOR(ary, 0, 0);
-	for (i=0; i<RARRAY_LEN(ary); i++) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-		return LONG2NUM(i);
-	    }
-	}
-	return Qnil;
+        RETURN_ENUMERATOR(ary, 0, 0);
+        for (i=0; i<RARRAY_LEN(ary); i++) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+                return LONG2NUM(i);
+            }
+        }
+        return Qnil;
     }
     rb_check_arity(argc, 0, 1);
     val = argv[0];
     if (rb_block_given_p())
-	rb_warn("given block not used");
-    len = RARRAY_LEN(ary);
-    ptr = RARRAY_CONST_PTR(ary);
-    for (i=0; i<len; i++) {
-	VALUE e = ptr[i];
-	switch (rb_equal_opt(e, val)) {
-	  case Qundef:
-	    if (!rb_equal(e, val)) break;
-	  case Qtrue:
-	    return LONG2NUM(i);
-	  case Qfalse:
-	    continue;
-	}
-	len = RARRAY_LEN(ary);
-	ptr = RARRAY_CONST_PTR(ary);
+        rb_warn("given block not used");
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        VALUE e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, val)) {
+            return LONG2NUM(i);
+        }
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *     ary.rindex(obj)             ->  int or nil
- *     ary.rindex { |item| block } ->  int or nil
- *     ary.rindex                  ->  Enumerator
+ *    rindex(object) -> integer or nil
+ *    rindex {|element| ... } -> integer or nil
+ *    rindex -> new_enumerator
+ *
+ *  Returns the index of the last element for which <tt>object == element</tt>.
+ *
+ *  With argument +object+ given, returns the index of the last such element found:
  *
- *  Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.rindex('bar') # => 3
  *
- *  If a block is given instead of an argument, returns the _index_ of the
- *  first object for which the block returns +true+, starting from the last
- *  object.
+ *  Returns +nil+ if no such object found.
  *
- *  Returns +nil+ if no match is found.
+ *  With a block given, calls the block with each successive element;
+ *  returns the index of the last element for which the block returns a truthy value:
  *
- *  See also Array#index.
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.rindex {|element| element == 'bar' } # => 3
  *
- *  If neither block nor argument is given, an Enumerator is returned instead.
+ *  Returns +nil+ if the block never returns a truthy value.
  *
- *     a = [ "a", "b", "b", "b", "c" ]
- *     a.rindex("b")             #=> 3
- *     a.rindex("z")             #=> nil
- *     a.rindex { |x| x == "b" } #=> 3
+ *  When neither an argument nor a block is given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
 rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
 {
-    const VALUE *ptr;
     VALUE val;
     long i = RARRAY_LEN(ary), len;
 
     if (argc == 0) {
-	RETURN_ENUMERATOR(ary, 0, 0);
-	while (i--) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
-		return LONG2NUM(i);
-	    if (i > (len = RARRAY_LEN(ary))) {
-		i = len;
-	    }
-	}
-	return Qnil;
+        RETURN_ENUMERATOR(ary, 0, 0);
+        while (i--) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
+                return LONG2NUM(i);
+            if (i > (len = RARRAY_LEN(ary))) {
+                i = len;
+            }
+        }
+        return Qnil;
     }
     rb_check_arity(argc, 0, 1);
     val = argv[0];
     if (rb_block_given_p())
-	rb_warn("given block not used");
-    ptr = RARRAY_CONST_PTR(ary);
+        rb_warn("given block not used");
     while (i--) {
-	VALUE e = ptr[i];
-	switch (rb_equal_opt(e, val)) {
-	  case Qundef:
-	    if (!rb_equal(e, val)) break;
-	  case Qtrue:
-	    return LONG2NUM(i);
-	  case Qfalse:
-	    continue;
-	}
-	if (i > (len = RARRAY_LEN(ary))) {
-	    i = len;
-	}
-	ptr = RARRAY_CONST_PTR(ary);
+        VALUE e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, val)) {
+            return LONG2NUM(i);
+        }
+        if (i > RARRAY_LEN(ary)) {
+            break;
+        }
     }
     return Qnil;
 }
@@ -1550,65 +2306,78 @@ rb_ary_to_ary(VALUE obj)
 }
 
 static void
-rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
+rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
 {
-    long rlen;
     long olen;
+    long rofs;
 
     if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
     olen = RARRAY_LEN(ary);
     if (beg < 0) {
-	beg += olen;
-	if (beg < 0) {
-	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-		     beg - olen, -olen);
-	}
+        beg += olen;
+        if (beg < 0) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     beg - olen, -olen);
+        }
     }
     if (olen < len || olen < beg + len) {
-	len = olen - beg;
+        len = olen - beg;
     }
 
-    if (rpl == Qundef) {
-	rlen = 0;
-    }
-    else {
-	rpl = rb_ary_to_ary(rpl);
-	rlen = RARRAY_LEN(rpl);
-	olen = RARRAY_LEN(ary);	/* ary may be resized in rpl.to_ary too */
+    {
+        const VALUE *optr = RARRAY_CONST_PTR(ary);
+        rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
     }
+
     if (beg >= olen) {
-	VALUE target_ary;
-	if (beg > ARY_MAX_SIZE - rlen) {
-	    rb_raise(rb_eIndexError, "index %ld too big", beg);
-	}
-	target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
-	len = beg + rlen;
-	ary_mem_clear(ary, olen, beg - olen);
-	if (rlen > 0) {
-	    ary_memcpy0(ary, beg, rlen, RARRAY_CONST_PTR(rpl), target_ary);
-	}
-	ARY_SET_LEN(ary, len);
+        VALUE target_ary;
+        if (beg > ARY_MAX_SIZE - rlen) {
+            rb_raise(rb_eIndexError, "index %ld too big", beg);
+        }
+        target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+        len = beg + rlen;
+        ary_mem_clear(ary, olen, beg - olen);
+        if (rlen > 0) {
+            if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
+            ary_memcpy0(ary, beg, rlen, rptr, target_ary);
+        }
+        ARY_SET_LEN(ary, len);
     }
     else {
-	long alen;
-
-	rb_ary_modify(ary);
-	alen = olen + rlen - len;
-	if (alen >= ARY_CAPA(ary)) {
-	    ary_double_capa(ary, alen);
-	}
-
-	if (len != rlen) {
-	    RARRAY_PTR_USE(ary, ptr,
-			   MEMMOVE(ptr + beg + rlen, ptr + beg + len,
-				   VALUE, olen - (beg + len)));
-	    ARY_SET_LEN(ary, alen);
-	}
-	if (rlen > 0) {
-	    MEMMOVE(RARRAY_PTR(ary) + beg, RARRAY_CONST_PTR(rpl), VALUE, rlen);
-	}
+        long alen;
+
+        if (olen - len > ARY_MAX_SIZE - rlen) {
+            rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
+        }
+        rb_ary_modify(ary);
+        alen = olen + rlen - len;
+        if (alen >= ARY_CAPA(ary)) {
+            ary_double_capa(ary, alen);
+        }
+
+        if (len != rlen) {
+            RARRAY_PTR_USE(ary, ptr,
+                                     MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+                                             VALUE, olen - (beg + len)));
+            ARY_SET_LEN(ary, alen);
+        }
+        if (rlen > 0) {
+            if (rofs == -1) {
+                rb_gc_writebarrier_remember(ary);
+            }
+            else {
+                /* In this case, we're copying from a region in this array, so
+                 * we don't need to fire the write barrier. */
+                rptr = RARRAY_CONST_PTR(ary) + rofs;
+            }
+
+            /* do not use RARRAY_PTR() because it can causes GC.
+             * ary can contain T_NONE object because it is not cleared.
+             */
+            RARRAY_PTR_USE(ary, ptr,
+                                     MEMMOVE(ptr + beg, rptr, VALUE, rlen));
+        }
     }
-    RB_GC_GUARD(rpl);
 }
 
 void
@@ -1618,22 +2387,14 @@ rb_ary_set_len(VALUE ary, long len)
 
     rb_ary_modify_check(ary);
     if (ARY_SHARED_P(ary)) {
-	rb_raise(rb_eRuntimeError, "can't set length of shared ");
+        rb_raise(rb_eRuntimeError, "can't set length of shared ");
     }
     if (len > (capa = (long)ARY_CAPA(ary))) {
-	rb_bug("probable buffer overflow: %ld for %ld", len, capa);
+        rb_bug("probable buffer overflow: %ld for %ld", len, capa);
     }
     ARY_SET_LEN(ary, len);
 }
 
-/*!
- * expands or shrinks \a ary to \a len elements.
- * expanded region will be filled with Qnil.
- * \param ary  an array
- * \param len  new size
- * \return     \a ary
- * \post       the size of \a ary is \a len.
- */
 VALUE
 rb_ary_resize(VALUE ary, long len)
 {
@@ -1643,68 +2404,199 @@ rb_ary_resize(VALUE ary, long len)
     olen = RARRAY_LEN(ary);
     if (len == olen) return ary;
     if (len > ARY_MAX_SIZE) {
-	rb_raise(rb_eIndexError, "index %ld too big", len);
+        rb_raise(rb_eIndexError, "index %ld too big", len);
     }
     if (len > olen) {
-	if (len >= ARY_CAPA(ary)) {
-	    ary_double_capa(ary, len);
-	}
-	ary_mem_clear(ary, olen, len - olen);
-	ARY_SET_LEN(ary, len);
+        if (len > ARY_CAPA(ary)) {
+            ary_double_capa(ary, len);
+        }
+        ary_mem_clear(ary, olen, len - olen);
+        ARY_SET_LEN(ary, len);
     }
     else if (ARY_EMBED_P(ary)) {
         ARY_SET_EMBED_LEN(ary, len);
     }
-    else if (len <= RARRAY_EMBED_LEN_MAX) {
-	VALUE tmp[RARRAY_EMBED_LEN_MAX];
-	MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
-	ary_discard(ary);
-	MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
+    else if (len <= ary_embed_capa(ary)) {
+        const VALUE *ptr = ARY_HEAP_PTR(ary);
+        long ptr_capa = ARY_HEAP_SIZE(ary);
+        bool is_malloc_ptr = !ARY_SHARED_P(ary);
+
+        FL_SET_EMBED(ary);
+
+        MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len); /* WB: no new reference */
         ARY_SET_EMBED_LEN(ary, len);
+
+        if (is_malloc_ptr) ruby_sized_xfree((void *)ptr, ptr_capa);
     }
     else {
-	if (olen > len + ARY_DEFAULT_SIZE) {
-	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len, RARRAY(ary)->as.heap.aux.capa);
-	    ARY_SET_CAPA(ary, len);
-	}
-	ARY_SET_HEAP_LEN(ary, len);
+        if (olen > len + ARY_DEFAULT_SIZE) {
+            size_t new_capa = ary_heap_realloc(ary, len);
+            ARY_SET_CAPA(ary, new_capa);
+        }
+        ARY_SET_HEAP_LEN(ary, len);
     }
+    ary_verify(ary);
     return ary;
 }
 
+static VALUE
+ary_aset_by_rb_ary_store(VALUE ary, long key, VALUE val)
+{
+    rb_ary_store(ary, key, val);
+    return val;
+}
+
+static VALUE
+ary_aset_by_rb_ary_splice(VALUE ary, long beg, long len, VALUE val)
+{
+    VALUE rpl = rb_ary_to_ary(val);
+    rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR(rpl), RARRAY_LEN(rpl));
+    RB_GC_GUARD(rpl);
+    return val;
+}
+
 /*
  *  call-seq:
- *     ary[index]         = obj                      ->  obj
- *     ary[start, length] = obj or other_ary or nil  ->  obj or other_ary or nil
- *     ary[range]         = obj or other_ary or nil  ->  obj or other_ary or nil
- *
- *  Element Assignment --- Sets the element at +index+, or replaces a subarray
- *  from the +start+ index for +length+ elements, or replaces a subarray
- *  specified by the +range+ of indices.
- *
- *  If indices are greater than the current capacity of the array, the array
- *  grows automatically.  Elements are inserted into the array at +start+ if
- *  +length+ is zero.
- *
- *  Negative indices will count backward from the end of the array.  For
- *  +start+ and +range+ cases the starting index is just before an element.
- *
- *  An IndexError is raised if a negative index points past the beginning of
- *  the array.
- *
- *  See also Array#push, and Array#unshift.
- *
- *     a = Array.new
- *     a[4] = "4";                 #=> [nil, nil, nil, nil, "4"]
- *     a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
- *     a[1..2] = [ 1, 2 ]          #=> ["a", 1, 2, nil, "4"]
- *     a[0, 2] = "?"               #=> ["?", 2, nil, "4"]
- *     a[0..2] = "A"               #=> ["A", "4"]
- *     a[-1]   = "Z"               #=> ["A", "Z"]
- *     a[1..-1] = nil              #=> ["A", nil]
- *     a[1..-1] = []               #=> ["A"]
- *     a[0, 0] = [ 1, 2 ]          #=> [1, 2, "A"]
- *     a[3, 0] = "B"               #=> [1, 2, "A", "B"]
+ *    self[index] = object -> object
+ *    self[start, length] = object -> object
+ *    self[range] = object -> object
+ *
+ *  Assigns elements in +self+, based on the given +object+; returns +object+.
+ *
+ *  In brief:
+ *
+ *      a_orig = [:foo, 'bar', 2]
+ *
+ *      # With argument index.
+ *      a = a_orig.dup
+ *      a[0] = 'foo' # => "foo"
+ *      a # => ["foo", "bar", 2]
+ *      a = a_orig.dup
+ *      a[7] = 'foo' # => "foo"
+ *      a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
+ *
+ *      # With arguments start and length.
+ *      a = a_orig.dup
+ *      a[0, 2] = 'foo' # => "foo"
+ *      a # => ["foo", 2]
+ *      a = a_orig.dup
+ *      a[6, 50] = 'foo' # => "foo"
+ *      a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *      # With argument range.
+ *      a = a_orig.dup
+ *      a[0..1] = 'foo' # => "foo"
+ *      a # => ["foo", 2]
+ *      a = a_orig.dup
+ *      a[6..50] = 'foo' # => "foo"
+ *      a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  When Integer argument +index+ is given, assigns +object+ to an element in +self+.
+ *
+ *  If +index+ is non-negative, assigns +object+ the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0] = 'foo' # => "foo"
+ *    a # => ["foo", "bar", 2]
+ *
+ *  If +index+ is greater than <tt>self.length</tt>, extends the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[7] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
+ *
+ *  If +index+ is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1] = 'two' # => "two"
+ *    a # => [:foo, "bar", "two"]
+ *
+ *  When Integer arguments +start+ and +length+ are given and +object+ is not an array,
+ *  removes <tt>length - 1</tt> elements beginning at offset +start+,
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 2] = 'foo' # => "foo"
+ *    a # => ["foo", 2]
+ *
+ *  If +start+ is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-2, 2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  If +start+ is non-negative and outside the array (<tt> >= self.size</tt>),
+ *  extends the array with +nil+, assigns +object+ at offset +start+,
+ *  and ignores +length+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[6, 50] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  If +length+ is zero, shifts elements at and following offset +start+
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1, 0] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *
+ *  If +length+ is too large for the existing array, does not extend the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1, 5] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  When Range argument +range+ is given and +object+ is not an array,
+ *  removes <tt>length - 1</tt> elements beginning at offset +start+,
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..1] = 'foo' # => "foo"
+ *    a # => ["foo", 2]
+ *
+ *  if <tt>range.begin</tt> is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-2..2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  If the array length is less than <tt>range.begin</tt>,
+ *  extends the array with +nil+, assigns +object+ at offset <tt>range.begin</tt>,
+ *  and ignores +length+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[6..50] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  If <tt>range.end</tt> is zero, shifts elements at and following offset +start+
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..0] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *
+ *  If <tt>range.end</tt> is negative, assigns +object+ at offset +start+,
+ *  retains <tt>range.end.abs -1</tt> elements past that, and removes those beyond:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-1] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", 2]
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-3] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *    a = [:foo, 'bar', 2]
+ *
+ *  If <tt>range.end</tt> is too large for the existing array,
+ *  replaces array elements, but does not extend the array with +nil+ values:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..5] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -1712,45 +2604,60 @@ rb_ary_aset(int argc, VALUE *argv, VALUE ary)
 {
     long offset, beg, len;
 
+    rb_check_arity(argc, 2, 3);
+    rb_ary_modify_check(ary);
     if (argc == 3) {
-	rb_ary_modify_check(ary);
-	beg = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
-	rb_ary_splice(ary, beg, len, argv[2]);
-	return argv[2];
+        beg = NUM2LONG(argv[0]);
+        len = NUM2LONG(argv[1]);
+        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[2]);
     }
-    rb_check_arity(argc, 2, 2);
-    rb_ary_modify_check(ary);
     if (FIXNUM_P(argv[0])) {
-	offset = FIX2LONG(argv[0]);
-	goto fixnum;
+        offset = FIX2LONG(argv[0]);
+        return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
     }
     if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
-	/* check if idx is Range */
-	rb_ary_splice(ary, beg, len, argv[1]);
-	return argv[1];
+        /* check if idx is Range */
+        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[1]);
     }
 
     offset = NUM2LONG(argv[0]);
-fixnum:
-    rb_ary_store(ary, offset, argv[1]);
-    return argv[1];
+    return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
 }
 
 /*
  *  call-seq:
- *     ary.insert(index, obj...)  -> ary
+ *    insert(index, *objects) -> self
+ *
+ *  Inserts the given +objects+ as elements of +self+;
+ *  returns +self+.
+ *
+ *  When +index+ is non-negative, inserts +objects+
+ *  _before_ the element at offset +index+:
  *
- *  Inserts the given values before the element with the given +index+.
+ *    a = ['a', 'b', 'c']     # => ["a", "b", "c"]
+ *    a.insert(1, :x, :y, :z) # => ["a", :x, :y, :z, "b", "c"]
  *
- *  Negative indices count backwards from the end of the array, where +-1+ is
- *  the last element. If a negative index is used, the given values will be
- *  inserted after that element, so using an index of +-1+ will insert the
- *  values at the end of the array.
+ *  Extends the array if +index+ is beyond the array (<tt>index >= self.size</tt>):
  *
- *     a = %w{ a b c d }
- *     a.insert(2, 99)         #=> ["a", "b", 99, "c", "d"]
- *     a.insert(-2, 1, 2, 3)   #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
+ *    a = ['a', 'b', 'c']     # => ["a", "b", "c"]
+ *    a.insert(5, :x, :y, :z) # => ["a", "b", "c", nil, nil, :x, :y, :z]
+ *
+ *  When +index+ is negative, inserts +objects+
+ *  _after_ the element at offset <tt>index + self.size</tt>:
+ *
+ *    a = ['a', 'b', 'c']      # => ["a", "b", "c"]
+ *    a.insert(-2, :x, :y, :z) # => ["a", "b", :x, :y, :z, "c"]
+ *
+ *  With no +objects+ given, does nothing:
+ *
+ *    a = ['a', 'b', 'c'] # => ["a", "b", "c"]
+ *    a.insert(1)         # => ["a", "b", "c"]
+ *    a.insert(50)        # => ["a", "b", "c"]
+ *    a.insert(-50)       # => ["a", "b", "c"]
+ *
+ *  Raises IndexError if +objects+ are given and +index+ is negative and out of range.
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -1760,15 +2667,20 @@ rb_ary_insert(int argc, VALUE *argv, VALUE ary)
 
     rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
     rb_ary_modify_check(ary);
-    if (argc == 1) return ary;
     pos = NUM2LONG(argv[0]);
+    if (argc == 1) return ary;
     if (pos == -1) {
-	pos = RARRAY_LEN(ary);
+        pos = RARRAY_LEN(ary);
     }
-    if (pos < 0) {
-	pos++;
+    else if (pos < 0) {
+        long minpos = -RARRAY_LEN(ary) - 1;
+        if (pos < minpos) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     pos, minpos);
+        }
+        pos++;
     }
-    rb_ary_splice(ary, pos, 0, rb_ary_new4(argc - 1, argv + 1));
+    rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
     return ary;
 }
 
@@ -1781,53 +2693,97 @@ ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
     return rb_ary_length(ary);
 }
 
+// Primitive to avoid a race condition in Array#each.
+// Return `true` and write `value` and `index` if the element exists.
+static VALUE
+ary_fetch_next(VALUE self, VALUE *index, VALUE *value)
+{
+    long i = NUM2LONG(*index);
+    if (i >= RARRAY_LEN(self)) {
+        return Qfalse;
+    }
+    *value = RARRAY_AREF(self, i);
+    *index = LONG2NUM(i + 1);
+    return Qtrue;
+}
+
 /*
  *  call-seq:
- *     ary.each { |item| block }  -> ary
- *     ary.each                   -> Enumerator
+ *    each {|element| ... } -> self
+ *    each -> new_enumerator
+ *
+ *  With a block given, iterates over the elements of +self+,
+ *  passing each element to the block;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each {|element|  puts "#{element.class} #{element}" }
+ *
+ *  Output:
+ *
+ *    Symbol foo
+ *    String bar
+ *    Integer 2
+ *
+ *  Allows the array to be modified during iteration:
  *
- *  Calls the given block once for each element in +self+, passing that element
- *  as a parameter.  Returns the array itself.
+ *    a = [:foo, 'bar', 2]
+ *    a.each {|element| puts element; a.clear if element.to_s.start_with?('b') }
  *
- *  If no block is given, an Enumerator is returned.
+ *  Output:
  *
- *     a = [ "a", "b", "c" ]
- *     a.each {|x| print x, " -- " }
+ *    foo
+ *    bar
  *
- *  produces:
+ *  With no block given, returns a new Enumerator.
  *
- *     a -- b -- c --
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 VALUE
-rb_ary_each(VALUE array)
+rb_ary_each(VALUE ary)
 {
     long i;
-    volatile VALUE ary = array;
-
+    ary_verify(ary);
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	rb_yield(RARRAY_AREF(ary, i));
+        rb_yield(RARRAY_AREF(ary, i));
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.each_index { |index| block }  -> ary
- *     ary.each_index                    -> Enumerator
+ *    each_index {|index| ... } -> self
+ *    each_index -> new_enumerator
+ *
+ *  With a block given, iterates over the elements of +self+,
+ *  passing each <i>array index</i> to the block;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each_index {|index|  puts "#{index} #{a[index]}" }
+ *
+ *  Output:
  *
- *  Same as Array#each, but passes the +index+ of the element instead of the
- *  element itself.
+ *    0 foo
+ *    1 bar
+ *    2 2
  *
- *  An Enumerator is returned if no block is given.
+ *  Allows the array to be modified during iteration:
  *
- *     a = [ "a", "b", "c" ]
- *     a.each_index {|x| print x, " -- " }
+ *    a = [:foo, 'bar', 2]
+ *    a.each_index {|index| puts index; a.clear if index > 0 }
+ *    a # => []
  *
- *  produces:
+ *  Output:
  *
- *     0 -- 1 -- 2 --
+ *    0
+ *    1
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
@@ -1837,24 +2793,33 @@ rb_ary_each_index(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	rb_yield(LONG2NUM(i));
+        rb_yield(LONG2NUM(i));
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.reverse_each { |item| block }  -> ary
- *     ary.reverse_each                   -> Enumerator
+ *    reverse_each {|element| ... } -> self
+ *    reverse_each -> Enumerator
+ *
+ *  When a block given, iterates backwards over the elements of +self+,
+ *  passing, in reverse order, each element to the block;
+ *  returns +self+:
+ *
+ *    a = []
+ *    [0, 1, 2].reverse_each {|element| a.push(element) }
+ *    a # => [2, 1, 0]
  *
- *  Same as Array#each, but traverses +self+ in reverse order.
+ *  Allows the array to be modified during iteration:
  *
- *     a = [ "a", "b", "c" ]
- *     a.reverse_each {|x| print x, " " }
+ *    a = ['a', 'b', 'c']
+ *    a.reverse_each {|element| a.clear if element.start_with?('b') }
+ *    a # => []
  *
- *  produces:
+ *  When no block given, returns a new Enumerator.
  *
- *     c b a
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
@@ -1865,24 +2830,27 @@ rb_ary_reverse_each(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     len = RARRAY_LEN(ary);
     while (len--) {
-	long nlen;
-	rb_yield(RARRAY_AREF(ary, len));
-	nlen = RARRAY_LEN(ary);
-	if (nlen < len) {
-	    len = nlen;
-	}
+        long nlen;
+        rb_yield(RARRAY_AREF(ary, len));
+        nlen = RARRAY_LEN(ary);
+        if (nlen < len) {
+            len = nlen;
+        }
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.length -> int
+ *    length -> integer
+ *    size -> integer
+ *
+ *  Returns the count of elements in +self+:
  *
- *  Returns the number of elements in +self+. May be zero.
+ *    [0, 1, 2].length # => 3
+ *    [].length        # => 0
  *
- *     [ 1, 2, 3, 4, 5 ].length   #=> 5
- *     [].length                  #=> 0
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
@@ -1894,19 +2862,18 @@ rb_ary_length(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.empty?   -> true or false
+ *    empty?  -> true or false
  *
- *  Returns +true+ if +self+ contains no elements.
+ *  Returns +true+ if the count of elements in +self+ is zero,
+ *  +false+ otherwise.
  *
- *     [].empty?   #=> true
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
 rb_ary_empty_p(VALUE ary)
 {
-    if (RARRAY_LEN(ary) == 0)
-	return Qtrue;
-    return Qfalse;
+    return RBOOL(RARRAY_LEN(ary) == 0);
 }
 
 VALUE
@@ -1916,13 +2883,16 @@ rb_ary_dup(VALUE ary)
     VALUE dup = rb_ary_new2(len);
     ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
     ARY_SET_LEN(dup, len);
+
+    ary_verify(ary);
+    ary_verify(dup);
     return dup;
 }
 
 VALUE
 rb_ary_resurrect(VALUE ary)
 {
-    return rb_ary_new4(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
+    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
 }
 
 extern VALUE rb_output_fs;
@@ -1939,15 +2909,15 @@ recursive_join(VALUE obj, VALUE argp, int recur)
     int *first = (int *)arg[3];
 
     if (recur) {
-	rb_raise(rb_eArgError, "recursive array join");
+        rb_raise(rb_eArgError, "recursive array join");
     }
     else {
-	ary_join_1(obj, ary, sep, 0, result, first);
+        ary_join_1(obj, ary, sep, 0, result, first);
     }
     return Qnil;
 }
 
-static void
+static long
 ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
 {
     long i;
@@ -1955,11 +2925,40 @@ ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
 
     if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
     for (i=0; i<max; i++) {
-	val = RARRAY_AREF(ary, i);
-	if (i > 0 && !NIL_P(sep))
-	    rb_str_buf_append(result, sep);
-	rb_str_buf_append(result, val);
-	if (OBJ_TAINTED(val)) OBJ_TAINT(result);
+        val = RARRAY_AREF(ary, i);
+        if (!RB_TYPE_P(val, T_STRING)) break;
+        if (i > 0 && !NIL_P(sep))
+            rb_str_buf_append(result, sep);
+        rb_str_buf_append(result, val);
+    }
+    return i;
+}
+
+static void
+ary_join_1_str(VALUE dst, VALUE src, int *first)
+{
+    rb_str_buf_append(dst, src);
+    if (*first) {
+        rb_enc_copy(dst, src);
+        *first = FALSE;
+    }
+}
+
+static void
+ary_join_1_ary(VALUE obj, VALUE ary, VALUE sep, VALUE result, VALUE val, int *first)
+{
+    if (val == ary) {
+        rb_raise(rb_eArgError, "recursive array join");
+    }
+    else {
+        VALUE args[4];
+
+        *first = FALSE;
+        args[0] = val;
+        args[1] = sep;
+        args[2] = result;
+        args[3] = (VALUE)first;
+        rb_exec_recursive(recursive_join, obj, (VALUE)args);
     }
 }
 
@@ -1969,50 +2968,25 @@ ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
     VALUE val, tmp;
 
     for (; i<RARRAY_LEN(ary); i++) {
-	if (i > 0 && !NIL_P(sep))
-	    rb_str_buf_append(result, sep);
-
-	val = RARRAY_AREF(ary, i);
-	if (RB_TYPE_P(val, T_STRING)) {
-	  str_join:
-	    rb_str_buf_append(result, val);
-	    *first = FALSE;
-	}
-	else if (RB_TYPE_P(val, T_ARRAY)) {
-	    obj = val;
-	  ary_join:
-	    if (val == ary) {
-		rb_raise(rb_eArgError, "recursive array join");
-	    }
-	    else {
-		VALUE args[4];
-
-		args[0] = val;
-		args[1] = sep;
-		args[2] = result;
-		args[3] = (VALUE)first;
-		rb_exec_recursive(recursive_join, obj, (VALUE)args);
-	    }
-	}
-	else {
-	    tmp = rb_check_string_type(val);
-	    if (!NIL_P(tmp)) {
-		val = tmp;
-		goto str_join;
-	    }
-	    tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
-	    if (!NIL_P(tmp)) {
-		obj = val;
-		val = tmp;
-		goto ary_join;
-	    }
-	    val = rb_obj_as_string(val);
-	    if (*first) {
-		rb_enc_copy(result, val);
-		*first = FALSE;
-	    }
-	    goto str_join;
-	}
+        if (i > 0 && !NIL_P(sep))
+            rb_str_buf_append(result, sep);
+
+        val = RARRAY_AREF(ary, i);
+        if (RB_TYPE_P(val, T_STRING)) {
+            ary_join_1_str(result, val, first);
+        }
+        else if (RB_TYPE_P(val, T_ARRAY)) {
+            ary_join_1_ary(val, ary, sep, result, val, first);
+        }
+        else if (!NIL_P(tmp = rb_check_string_type(val))) {
+            ary_join_1_str(result, tmp, first);
+        }
+        else if (!NIL_P(tmp = rb_check_array_type(val))) {
+            ary_join_1_ary(val, ary, sep, result, tmp, first);
+        }
+        else {
+            ary_join_1_str(result, rb_obj_as_string(val), first);
+        }
     }
 }
 
@@ -2020,36 +2994,41 @@ VALUE
 rb_ary_join(VALUE ary, VALUE sep)
 {
     long len = 1, i;
-    int taint = FALSE;
     VALUE val, tmp, result;
 
     if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
-    if (OBJ_TAINTED(ary)) taint = TRUE;
 
     if (!NIL_P(sep)) {
-	StringValue(sep);
-	len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+        StringValue(sep);
+        len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+    }
+    long len_memo = RARRAY_LEN(ary);
+    for (i=0; i < len_memo; i++) {
+        val = RARRAY_AREF(ary, i);
+        if (RB_UNLIKELY(!RB_TYPE_P(val, T_STRING))) {
+            tmp = rb_check_string_type(val);
+            if (NIL_P(tmp) || tmp != val) {
+                int first;
+                long n = RARRAY_LEN(ary);
+                if (i > n) i = n;
+                result = rb_str_buf_new(len + (n-i)*10);
+                rb_enc_associate(result, rb_usascii_encoding());
+                i = ary_join_0(ary, sep, i, result);
+                first = i == 0;
+                ary_join_1(ary, ary, sep, i, result, &first);
+                return result;
+            }
+            len += RSTRING_LEN(tmp);
+            len_memo = RARRAY_LEN(ary);
+        }
+        else {
+            len += RSTRING_LEN(val);
+        }
     }
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	val = RARRAY_AREF(ary, i);
-	tmp = rb_check_string_type(val);
 
-	if (NIL_P(tmp) || tmp != val) {
-	    int first;
-	    result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
-	    rb_enc_associate(result, rb_usascii_encoding());
-	    if (taint) OBJ_TAINT(result);
-	    ary_join_0(ary, sep, i, result);
-	    first = i == 0;
-	    ary_join_1(ary, ary, sep, i, result, &first);
-	    return result;
-	}
-
-	len += RSTRING_LEN(tmp);
-    }
+    result = rb_str_new(0, len);
+    rb_str_set_len(result, 0);
 
-    result = rb_str_buf_new(len);
-    if (taint) OBJ_TAINT(result);
     ary_join_0(ary, sep, RARRAY_LEN(ary), result);
 
     return result;
@@ -2057,24 +3036,44 @@ rb_ary_join(VALUE ary, VALUE sep)
 
 /*
  *  call-seq:
- *     ary.join(separator=$,)    -> str
+ *    join(separator = $,) -> new_string
+ *
+ *  Returns the new string formed by joining the converted elements of +self+;
+ *  for each element +element+:
+ *
+ *  - Converts recursively using <tt>element.join(separator)</tt>
+ *    if +element+ is a <tt>kind_of?(Array)</tt>.
+ *  - Otherwise, converts using <tt>element.to_s</tt>.
+ *
+ *  With no argument given, joins using the output field separator, <tt>$,</tt>:
  *
- *  Returns a string created by converting each element of the array to
- *  a string, separated by the given +separator+.
- *  If the +separator+ is +nil+, it uses current $,.
- *  If both the +separator+ and $, are nil, it uses empty string.
+ *    a = [:foo, 'bar', 2]
+ *    $, # => nil
+ *    a.join # => "foobar2"
  *
- *     [ "a", "b", "c" ].join        #=> "abc"
- *     [ "a", "b", "c" ].join("-")   #=> "a-b-c"
+ *  With string argument +separator+ given, joins using that separator:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.join("\n") # => "foo\nbar\n2"
+ *
+ *  Joins recursively for nested arrays:
+ *
+ *   a = [:foo, [:bar, [:baz, :bat]]]
+ *   a.join # => "foobarbazbat"
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
-
 static VALUE
 rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE sep;
 
-    rb_scan_args(argc, argv, "01", &sep);
-    if (NIL_P(sep)) sep = rb_output_fs;
+    if (rb_check_arity(argc, 0, 1) == 0 || NIL_P(sep = argv[0])) {
+        sep = rb_output_fs;
+        if (!NIL_P(sep)) {
+            rb_category_warn(RB_WARN_CATEGORY_DEPRECATED, "$, is set to non-nil value");
+        }
+    }
 
     return rb_ary_join(ary, sep);
 }
@@ -2082,32 +3081,33 @@ rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 static VALUE
 inspect_ary(VALUE ary, VALUE dummy, int recur)
 {
-    int tainted = OBJ_TAINTED(ary);
     long i;
     VALUE s, str;
 
     if (recur) return rb_usascii_str_new_cstr("[...]");
     str = rb_str_buf_new2("[");
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	s = rb_inspect(RARRAY_AREF(ary, i));
-	if (OBJ_TAINTED(s)) tainted = TRUE;
-	if (i > 0) rb_str_buf_cat2(str, ", ");
-	else rb_enc_copy(str, s);
-	rb_str_buf_append(str, s);
+        s = rb_inspect(RARRAY_AREF(ary, i));
+        if (i > 0) rb_str_buf_cat2(str, ", ");
+        else rb_enc_copy(str, s);
+        rb_str_buf_append(str, s);
     }
     rb_str_buf_cat2(str, "]");
-    if (tainted) OBJ_TAINT(str);
     return str;
 }
 
 /*
  *  call-seq:
- *     ary.inspect  -> string
- *     ary.to_s     -> string
+ *    inspect -> new_string
+ *    to_s -> new_string
  *
- *  Creates a string representation of +self+.
+ *  Returns the new string formed by calling method <tt>#inspect</tt>
+ *  on each array element:
  *
- *     [ "a", "b", "c" ].to_s     #=> "[\"a\", \"b\", \"c\"]"
+ *    a = [:foo, 'bar', 2]
+ *    a.inspect # => "[:foo, \"bar\", 2]"
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
@@ -2125,58 +3125,84 @@ rb_ary_to_s(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.to_a     -> ary
+ *    to_a -> self or new_array
  *
- *  Returns +self+.
+ *  When +self+ is an instance of \Array, returns +self+.
+ *
+ *  Otherwise, returns a new array containing the elements of +self+:
+ *
+ *    class MyArray < Array; end
+ *    my_a = MyArray.new(['foo', 'bar', 'two'])
+ *    a = my_a.to_a
+ *    a # => ["foo", "bar", "two"]
+ *    a.class # => Array # Not MyArray.
  *
- *  If called on a subclass of Array, converts the receiver to an Array object.
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
 rb_ary_to_a(VALUE ary)
 {
     if (rb_obj_class(ary) != rb_cArray) {
-	VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
-	rb_ary_replace(dup, ary);
-	return dup;
+        VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+        rb_ary_replace(dup, ary);
+        return dup;
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.to_h     -> hash
+ *    to_h -> new_hash
+ *    to_h {|element| ... } -> new_hash
+ *
+ *  Returns a new hash formed from +self+.
+ *
+ *  With no block given, each element of +self+ must be a 2-element sub-array;
+ *  forms each sub-array into a key-value pair in the new hash:
+ *
+ *    a = [['foo', 'zero'], ['bar', 'one'], ['baz', 'two']]
+ *    a.to_h # => {"foo"=>"zero", "bar"=>"one", "baz"=>"two"}
+ *    [].to_h # => {}
  *
- *  Returns the result of interpreting <i>ary</i> as an array of
- *  <tt>[key, value]</tt> pairs.
+ *  With a block given, the block must return a 2-element array;
+ *  calls the block with each element of +self+;
+ *  forms each returned array into a key-value pair in the returned hash:
  *
- *     [[:foo, :bar], [1, 2]].to_h
- *       # => {:foo => :bar, 1 => 2}
+ *    a = ['foo', :bar, 1, [2, 3], {baz: 4}]
+ *    a.to_h {|element| [element, element.class] }
+ *    # => {"foo"=>String, :bar=>Symbol, 1=>Integer, [2, 3]=>Array, {:baz=>4}=>Hash}
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
 rb_ary_to_h(VALUE ary)
 {
     long i;
-    VALUE hash = rb_hash_new();
+    VALUE hash = rb_hash_new_with_size(RARRAY_LEN(ary));
+    int block_given = rb_block_given_p();
+
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	VALUE key_value_pair = rb_check_array_type(rb_ary_elt(ary, i));
-	if (NIL_P(key_value_pair)) {
-	    rb_raise(rb_eTypeError, "wrong element type %s at %ld (expected array)",
-		rb_builtin_class_name(rb_ary_elt(ary, i)), i);
-	}
-	if (RARRAY_LEN(key_value_pair) != 2) {
-	    rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
-		i, RARRAY_LEN(key_value_pair));
-	}
-	rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
+        const VALUE e = rb_ary_elt(ary, i);
+        const VALUE elt = block_given ? rb_yield_force_blockarg(e) : e;
+        const VALUE key_value_pair = rb_check_array_type(elt);
+        if (NIL_P(key_value_pair)) {
+            rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
+                     rb_obj_class(elt), i);
+        }
+        if (RARRAY_LEN(key_value_pair) != 2) {
+            rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
+                i, RARRAY_LEN(key_value_pair));
+        }
+        rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
     }
     return hash;
 }
 
 /*
  *  call-seq:
- *     ary.to_ary -> ary
+ *    to_ary -> self
  *
  *  Returns +self+.
  */
@@ -2191,9 +3217,9 @@ static void
 ary_reverse(VALUE *p1, VALUE *p2)
 {
     while (p1 < p2) {
-	VALUE tmp = *p1;
-	*p1++ = *p2;
-	*p2-- = tmp;
+        VALUE tmp = *p1;
+        *p1++ = *p2;
+        *p2-- = tmp;
     }
 }
 
@@ -2205,23 +3231,26 @@ rb_ary_reverse(VALUE ary)
 
     rb_ary_modify(ary);
     if (len > 1) {
-	RARRAY_PTR_USE(ary, p1, {
-	    p2 = p1 + len - 1;	/* points last item */
-	    ary_reverse(p1, p2);
-	}); /* WB: no new reference */
+        RARRAY_PTR_USE(ary, p1, {
+            p2 = p1 + len - 1;	/* points last item */
+            ary_reverse(p1, p2);
+        }); /* WB: no new reference */
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.reverse!   -> ary
+ *    reverse! -> self
  *
- *  Reverses +self+ in place.
+ *  Reverses the order of the elements of +self+;
+ *  returns +self+:
  *
- *     a = [ "a", "b", "c" ]
- *     a.reverse!       #=> ["c", "b", "a"]
- *     a                #=> ["c", "b", "a"]
+ *    a = [0, 1, 2]
+ *    a.reverse! # => [2, 1, 0]
+ *    a          # => [2, 1, 0]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -2232,12 +3261,13 @@ rb_ary_reverse_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.reverse    -> new_ary
+ *    reverse -> new_array
+ *
+ *  Returns a new array containing the elements of +self+ in reverse order:
  *
- *  Returns a new array containing +self+'s elements in reverse order.
+ *    [0, 1, 2].reverse # => [2, 1, 0]
  *
- *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
- *     [ 1 ].reverse               #=> [1]
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 static VALUE
@@ -2247,9 +3277,9 @@ rb_ary_reverse_m(VALUE ary)
     VALUE dup = rb_ary_new2(len);
 
     if (len > 0) {
-	const VALUE *p1 = RARRAY_CONST_PTR(ary);
-	VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
-	do *p2-- = *p1++; while (--len > 0);
+        const VALUE *p1 = RARRAY_CONST_PTR(ary);
+        VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
+        do *p2-- = *p1++; while (--len > 0);
     }
     ARY_SET_LEN(dup, RARRAY_LEN(ary));
     return dup;
@@ -2261,73 +3291,113 @@ rotate_count(long cnt, long len)
     return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
 }
 
+static void
+ary_rotate_ptr(VALUE *ptr, long len, long cnt)
+{
+    if (cnt == 1) {
+        VALUE tmp = *ptr;
+        memmove(ptr, ptr + 1, sizeof(VALUE)*(len - 1));
+        *(ptr + len - 1) = tmp;
+    }
+    else if (cnt == len - 1) {
+        VALUE tmp = *(ptr + len - 1);
+        memmove(ptr + 1, ptr, sizeof(VALUE)*(len - 1));
+        *ptr = tmp;
+    }
+    else {
+        --len;
+        if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+        if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+        if (len > 0) ary_reverse(ptr, ptr + len);
+    }
+}
+
 VALUE
 rb_ary_rotate(VALUE ary, long cnt)
 {
     rb_ary_modify(ary);
 
     if (cnt != 0) {
-	VALUE *ptr = RARRAY_PTR(ary);
-	long len = RARRAY_LEN(ary);
-
-	if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
-	    --len;
-	    if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
-	    if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
-	    if (len > 0) ary_reverse(ptr, ptr + len);
-	    return ary;
-	}
+        long len = RARRAY_LEN(ary);
+        if (len > 1 && (cnt = rotate_count(cnt, len)) > 0) {
+            RARRAY_PTR_USE(ary, ptr, ary_rotate_ptr(ptr, len, cnt));
+            return ary;
+        }
     }
-
     return Qnil;
 }
 
 /*
  *  call-seq:
- *     ary.rotate!(count=1)   -> ary
+ *    rotate!(count = 1) -> self
  *
- *  Rotates +self+ in place so that the element at +count+ comes first, and
- *  returns +self+.
+ *  Rotates +self+ in place by moving elements from one end to the other; returns +self+.
+ *
+ *  With non-negative numeric +count+,
+ *  rotates +count+ elements from the beginning to the end:
+ *
+ *    [0, 1, 2, 3].rotate!(2)   # => [2, 3, 0, 1]
+      [0, 1, 2, 3].rotate!(2.1) # => [2, 3, 0, 1]
+ *
+ *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate!(21) # => [1, 2, 3, 0]
  *
- *  If +count+ is negative then it rotates in the opposite direction, starting
- *  from the end of the array where +-1+ is the last element.
+ *  If +count+ is zero, rotates no elements:
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.rotate!        #=> ["b", "c", "d", "a"]
- *     a                #=> ["b", "c", "d", "a"]
- *     a.rotate!(2)     #=> ["d", "a", "b", "c"]
- *     a.rotate!(-3)    #=> ["a", "b", "c", "d"]
+ *    [0, 1, 2, 3].rotate!(0) # => [0, 1, 2, 3]
+ *
+ *  With a negative numeric +count+, rotates in the opposite direction,
+ *  from end to beginning:
+ *
+ *    [0, 1, 2, 3].rotate!(-1) # => [3, 0, 1, 2]
+ *
+ *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate!(-21) # => [3, 0, 1, 2]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
 rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
 {
-    long n = 1;
-
-    switch (argc) {
-      case 1: n = NUM2LONG(argv[0]);
-      case 0: break;
-      default: rb_scan_args(argc, argv, "01", NULL);
-    }
+    long n = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
     rb_ary_rotate(ary, n);
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.rotate(count=1)    -> new_ary
+ *    rotate(count = 1) -> new_array
+ *
+ *  Returns a new array formed from +self+ with elements
+ *  rotated from one end to the other.
+ *
+ *  With non-negative numeric +count+,
+ *  rotates elements from the beginning to the end:
+ *
+ *    [0, 1, 2, 3].rotate(2)   # => [2, 3, 0, 1]
+ *    [0, 1, 2, 3].rotate(2.1) # => [2, 3, 0, 1]
+ *
+ *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate(22) # => [2, 3, 0, 1]
+ *
+ *  With a +count+ of zero, rotates no elements:
+ *
+ *    [0, 1, 2, 3].rotate(0) # => [0, 1, 2, 3]
  *
- *  Returns a new array by rotating +self+ so that the element at +count+ is
- *  the first element of the new array.
+ *  With negative numeric +count+, rotates in the opposite direction,
+ *  from the end to the beginning:
  *
- *  If +count+ is negative then it rotates in the opposite direction, starting
- *  from the end of +self+ where +-1+ is the last element.
+ *    [0, 1, 2, 3].rotate(-1) # => [3, 0, 1, 2]
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.rotate         #=> ["b", "c", "d", "a"]
- *     a                #=> ["a", "b", "c", "d"]
- *     a.rotate(2)      #=> ["c", "d", "a", "b"]
- *     a.rotate(-3)     #=> ["b", "c", "d", "a"]
+ *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate(-21) # => [3, 0, 1, 2]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -2335,22 +3405,17 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE rotated;
     const VALUE *ptr;
-    long len, cnt = 1;
-
-    switch (argc) {
-      case 1: cnt = NUM2LONG(argv[0]);
-      case 0: break;
-      default: rb_scan_args(argc, argv, "01", NULL);
-    }
+    long len;
+    long cnt = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
 
     len = RARRAY_LEN(ary);
     rotated = rb_ary_new2(len);
     if (len > 0) {
-	cnt = rotate_count(cnt, len);
-	ptr = RARRAY_CONST_PTR(ary);
-	len -= cnt;
-	ary_memcpy(rotated, 0, len, ptr + cnt);
-	ary_memcpy(rotated, len, cnt, ptr);
+        cnt = rotate_count(cnt, len);
+        ptr = RARRAY_CONST_PTR(ary);
+        len -= cnt;
+        ary_memcpy(rotated, 0, len, ptr + cnt);
+        ary_memcpy(rotated, len, cnt, ptr);
     }
     ARY_SET_LEN(rotated, RARRAY_LEN(ary));
     return rotated;
@@ -2358,46 +3423,41 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
 
 struct ary_sort_data {
     VALUE ary;
-    int opt_methods;
-    int opt_inited;
+    VALUE receiver;
 };
 
-enum {
-    sort_opt_Fixnum,
-    sort_opt_String,
-    sort_optimizable_count
-};
-
-#define STRING_P(s) (RB_TYPE_P((s), T_STRING) && CLASS_OF(s) == rb_cString)
-
-#define SORT_OPTIMIZABLE_BIT(type) (1U << TOKEN_PASTE(sort_opt_,type))
-#define SORT_OPTIMIZABLE(data, type) \
-    (((data)->opt_inited & SORT_OPTIMIZABLE_BIT(type)) ? \
-     ((data)->opt_methods & SORT_OPTIMIZABLE_BIT(type)) : \
-     (((data)->opt_inited |= SORT_OPTIMIZABLE_BIT(type)), \
-      rb_method_basic_definition_p(TOKEN_PASTE(rb_c,type), id_cmp) && \
-      ((data)->opt_methods |= SORT_OPTIMIZABLE_BIT(type))))
-
 static VALUE
 sort_reentered(VALUE ary)
 {
     if (RBASIC(ary)->klass) {
-	rb_raise(rb_eRuntimeError, "sort reentered");
+        rb_raise(rb_eRuntimeError, "sort reentered");
     }
     return Qnil;
 }
 
+static void
+sort_returned(struct ary_sort_data *data)
+{
+    if (rb_obj_frozen_p(data->receiver)) {
+        rb_raise(rb_eFrozenError, "array frozen during sort");
+    }
+    sort_reentered(data->ary);
+}
+
 static int
 sort_1(const void *ap, const void *bp, void *dummy)
 {
     struct ary_sort_data *data = dummy;
     VALUE retval = sort_reentered(data->ary);
     VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+    VALUE args[2];
     int n;
 
-    retval = rb_yield_values(2, a, b);
+    args[0] = a;
+    args[1] = b;
+    retval = rb_yield_values2(2, args);
     n = rb_cmpint(retval, a, b);
-    sort_reentered(data->ary);
+    sort_returned(data);
     return n;
 }
 
@@ -2409,68 +3469,61 @@ sort_2(const void *ap, const void *bp, void *dummy)
     VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
     int n;
 
-    if (FIXNUM_P(a) && FIXNUM_P(b) && SORT_OPTIMIZABLE(data, Fixnum)) {
-	if ((long)a > (long)b) return 1;
-	if ((long)a < (long)b) return -1;
-	return 0;
+    if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(INTEGER)) {
+        if ((long)a > (long)b) return 1;
+        if ((long)a < (long)b) return -1;
+        return 0;
     }
-    if (STRING_P(a) && STRING_P(b) && SORT_OPTIMIZABLE(data, String)) {
-	return rb_str_cmp(a, b);
+    if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(STRING)) {
+        return rb_str_cmp(a, b);
+    }
+    if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(FLOAT)) {
+        return rb_float_cmp(a, b);
     }
 
     retval = rb_funcallv(a, id_cmp, 1, &b);
     n = rb_cmpint(retval, a, b);
-    sort_reentered(data->ary);
+    sort_returned(data);
 
     return n;
 }
 
 /*
  *  call-seq:
- *     ary.sort!                   -> ary
- *     ary.sort! { |a, b| block }  -> ary
- *
- *  Sorts +self+ in place.
+ *    sort! -> self
+ *    sort! {|a, b| ... } -> self
  *
- *  Comparisons for the sort will be done using the <code><=></code> operator
- *  or using an optional code block.
+ *  Like Array#sort, but returns +self+ with its elements sorted in place.
  *
- *  The block must implement a comparison between +a+ and +b+, and return
- *  +-1+, when +a+ follows +b+, +0+ when +a+ and +b+ are equivalent, or ++1+
- *  if +b+ follows +a+.
- *
- *  See also Enumerable#sort_by.
- *
- *     a = [ "d", "a", "e", "c", "b" ]
- *     a.sort!                    #=> ["a", "b", "c", "d", "e"]
- *     a.sort! { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 VALUE
 rb_ary_sort_bang(VALUE ary)
 {
     rb_ary_modify(ary);
-    assert(!ARY_SHARED_P(ary));
+    RUBY_ASSERT(!ARY_SHARED_P(ary));
     if (RARRAY_LEN(ary) > 1) {
-	VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
-	struct ary_sort_data data;
-	long len = RARRAY_LEN(ary);
-
-	RBASIC_CLEAR_CLASS(tmp);
-	data.ary = tmp;
-	data.opt_methods = 0;
-	data.opt_inited = 0;
-	RARRAY_PTR_USE(tmp, ptr, {
-	    ruby_qsort(ptr, len, sizeof(VALUE),
-		       rb_block_given_p()?sort_1:sort_2, &data);
-	}); /* WB: no new reference */
-	rb_ary_modify(ary);
+        VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+        struct ary_sort_data data;
+        long len = RARRAY_LEN(ary);
+        RBASIC_CLEAR_CLASS(tmp);
+        data.ary = tmp;
+        data.receiver = ary;
+        RARRAY_PTR_USE(tmp, ptr, {
+            ruby_qsort(ptr, len, sizeof(VALUE),
+                       rb_block_given_p()?sort_1:sort_2, &data);
+        }); /* WB: no new reference */
+        rb_ary_modify(ary);
         if (ARY_EMBED_P(tmp)) {
             if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
                 rb_ary_unshare(ary);
+                FL_SET_EMBED(ary);
             }
-            FL_SET_EMBED(ary);
-	    ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
+            if (ARY_EMBED_LEN(tmp) > ARY_CAPA(ary)) {
+                ary_resize_capa(ary, ARY_EMBED_LEN(tmp));
+            }
+            ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
             ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
         }
         else {
@@ -2479,7 +3532,7 @@ rb_ary_sort_bang(VALUE ary)
                 ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
             }
             else {
-                assert(!ARY_SHARED_P(tmp));
+                RUBY_ASSERT(!ARY_SHARED_P(tmp));
                 if (ARY_EMBED_P(ary)) {
                     FL_UNSET_EMBED(ary);
                 }
@@ -2488,44 +3541,56 @@ rb_ary_sort_bang(VALUE ary)
                     rb_ary_unshare(ary);
                 }
                 else {
-		    ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+                    ary_heap_free(ary);
                 }
-                ARY_SET_PTR(ary, RARRAY_CONST_PTR(tmp));
+                ARY_SET_PTR(ary, ARY_HEAP_PTR(tmp));
                 ARY_SET_HEAP_LEN(ary, len);
-                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+                ARY_SET_CAPA(ary, ARY_HEAP_LEN(tmp));
             }
             /* tmp was lost ownership for the ptr */
-            FL_UNSET(tmp, FL_FREEZE);
             FL_SET_EMBED(tmp);
             ARY_SET_EMBED_LEN(tmp, 0);
-            FL_SET(tmp, FL_FREEZE);
-	}
+            OBJ_FREEZE(tmp);
+        }
         /* tmp will be GC'ed. */
         RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
     }
+    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.sort                   -> new_ary
- *     ary.sort { |a, b| block }  -> new_ary
+ *    sort -> new_array
+ *    sort {|a, b| ... } -> new_array
+ *
+ *  Returns a new array containing the elements of +self+, sorted.
+ *
+ *  With no block given, compares elements using operator <tt>#<=></tt>
+ *  (see Object#<=>):
  *
- *  Returns a new array created by sorting +self+.
+ *    [0, 2, 3, 1].sort # => [0, 1, 2, 3]
  *
- *  Comparisons for the sort will be done using the <code><=></code> operator
- *  or using an optional code block.
+ *  With a block given, calls the block with each combination of pairs of elements from +self+;
+ *  for each pair +a+ and +b+, the block should return a numeric:
  *
- *  The block must implement a comparison between +a+ and +b+, and return
- *  +-1+, when +a+ follows +b+, +0+ when +a+ and +b+ are equivalent, or ++1+
- *  if +b+ follows +a+.
+ *  - Negative when +b+ is to follow +a+.
+ *  - Zero when +a+ and +b+ are equivalent.
+ *  - Positive when +a+ is to follow +b+.
  *
+ *  Example:
  *
- *  See also Enumerable#sort_by.
+ *    a = [3, 2, 0, 1]
+ *    a.sort {|a, b| a <=> b } # => [0, 1, 2, 3]
+ *    a.sort {|a, b| b <=> a } # => [3, 2, 1, 0]
  *
- *     a = [ "d", "a", "e", "c", "b" ]
- *     a.sort                    #=> ["a", "b", "c", "d", "e"]
- *     a.sort { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
+ *  When the block returns zero, the order for +a+ and +b+ is indeterminate,
+ *  and may be unstable.
+ *
+ *  See an example in Numeric#nonzero? for the idiom to sort more
+ *  complex structure.
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
@@ -2536,103 +3601,90 @@ rb_ary_sort(VALUE ary)
     return ary;
 }
 
+static VALUE rb_ary_bsearch_index(VALUE ary);
+
 /*
  *  call-seq:
- *     ary.bsearch {|x| block }  -> elem
- *
- *  By using binary search, finds a value from this array which meets
- *  the given condition in O(log n) where n is the size of the array.
- *
- *  You can use this method in two use cases: a find-minimum mode and
- *  a find-any mode.  In either case, the elements of the array must be
- *  monotone (or sorted) with respect to the block.
- *
- *  In find-minimum mode (this is a good choice for typical use case),
- *  the block must return true or false, and there must be an index i
- *  (0 <= i <= ary.size) so that:
- *
- *  - the block returns false for any element whose index is less than
- *    i, and
- *  - the block returns true for any element whose index is greater
- *    than or equal to i.
- *
- *  This method returns the i-th element.  If i is equal to ary.size,
- *  it returns nil.
- *
- *     ary = [0, 4, 7, 10, 12]
- *     ary.bsearch {|x| x >=   4 } #=> 4
- *     ary.bsearch {|x| x >=   6 } #=> 7
- *     ary.bsearch {|x| x >=  -1 } #=> 0
- *     ary.bsearch {|x| x >= 100 } #=> nil
- *
- *  In find-any mode (this behaves like libc's bsearch(3)), the block
- *  must return a number, and there must be two indices i and j
- *  (0 <= i <= j <= ary.size) so that:
- *
- *  - the block returns a positive number for ary[k] if 0 <= k < i,
- *  - the block returns zero for ary[k] if i <= k < j, and
- *  - the block returns a negative number for ary[k] if
- *    j <= k < ary.size.
- *
- *  Under this condition, this method returns any element whose index
- *  is within i...j.  If i is equal to j (i.e., there is no element
- *  that satisfies the block), this method returns nil.
- *
- *     ary = [0, 4, 7, 10, 12]
- *     # try to find v such that 4 <= v < 8
- *     ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
- *     # try to find v such that 8 <= v < 10
- *     ary.bsearch {|x| 4 - x / 2 } #=> nil
- *
- *  You must not mix the two modes at a time; the block must always
- *  return either true/false, or always return a number.  It is
- *  undefined which value is actually picked up at each iteration.
+ *    bsearch {|element| ... } -> found_element or nil
+ *    bsearch -> new_enumerator
+ *
+ *  Returns the element from +self+ found by a binary search,
+ *  or +nil+ if the search found no suitable element.
+ *
+ *  See {Binary Searching}[rdoc-ref:language/bsearch.rdoc].
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
 rb_ary_bsearch(VALUE ary)
 {
+    VALUE index_result = rb_ary_bsearch_index(ary);
+
+    if (FIXNUM_P(index_result)) {
+        return rb_ary_entry(ary, FIX2LONG(index_result));
+    }
+    return index_result;
+}
+
+/*
+ *  call-seq:
+ *    bsearch_index {|element| ... } -> integer or nil
+ *    bsearch_index -> new_enumerator
+ *
+ *  Returns the integer index of the element from +self+ found by a binary search,
+ *  or +nil+ if the search found no suitable element.
+ *
+ *  See {Binary Searching}[rdoc-ref:language/bsearch.rdoc].
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_bsearch_index(VALUE ary)
+{
     long low = 0, high = RARRAY_LEN(ary), mid;
-    int smaller = 0;
-    VALUE v, val, satisfied = Qnil;
+    int smaller = 0, satisfied = 0;
+    VALUE v, val;
 
     RETURN_ENUMERATOR(ary, 0, 0);
     while (low < high) {
-	mid = low + ((high - low) / 2);
-	val = rb_ary_entry(ary, mid);
-	v = rb_yield(val);
-	if (FIXNUM_P(v)) {
-	    if (v == INT2FIX(0)) return val;
-	    smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
-	}
-	else if (v == Qtrue) {
-	    satisfied = val;
-	    smaller = 1;
-	}
-	else if (v == Qfalse || v == Qnil) {
-	    smaller = 0;
-	}
-	else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
-	    const VALUE zero = INT2FIX(0);
-	    switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
-	      case 0: return val;
-	      case 1: smaller = 1; break;
-	      case -1: smaller = 0;
-	    }
-	}
-	else {
-	    rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
-		     " (must be numeric, true, false or nil)",
-		     rb_obj_class(v));
-	}
-	if (smaller) {
-	    high = mid;
-	}
-	else {
-	    low = mid + 1;
-	}
-    }
-    return satisfied;
+        mid = low + ((high - low) / 2);
+        val = rb_ary_entry(ary, mid);
+        v = rb_yield(val);
+        if (FIXNUM_P(v)) {
+            if (v == INT2FIX(0)) return INT2FIX(mid);
+            smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
+        }
+        else if (v == Qtrue) {
+            satisfied = 1;
+            smaller = 1;
+        }
+        else if (!RTEST(v)) {
+            smaller = 0;
+        }
+        else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
+            const VALUE zero = INT2FIX(0);
+            switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
+              case 0: return INT2FIX(mid);
+              case 1: smaller = 0; break;
+              case -1: smaller = 1;
+            }
+        }
+        else {
+            rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
+                     " (must be numeric, true, false or nil)",
+                     rb_obj_class(v));
+        }
+        if (smaller) {
+            high = mid;
+        }
+        else {
+            low = mid + 1;
+        }
+    }
+    if (!satisfied) return Qnil;
+    return INT2FIX(low);
 }
 
 
@@ -2644,14 +3696,24 @@ sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
 
 /*
  *  call-seq:
- *     ary.sort_by! { |obj| block }    -> ary
- *     ary.sort_by!                    -> Enumerator
+ *    sort_by! {|element| ... } -> self
+ *    sort_by! -> new_enumerator
+ *
+ *  With a block given, sorts the elements of +self+ in place;
+ *  returns self.
+ *
+ *  Calls the block with each successive element;
+ *  sorts elements based on the values returned from the block:
+ *
+ *    a = ['aaaa', 'bbb', 'cc', 'd']
+ *    a.sort_by! {|element| element.size }
+ *    a # => ["d", "cc", "bbb", "aaaa"]
  *
- *  Sorts +self+ in place using a set of keys generated by mapping the
- *  values in +self+ through the given block.
+ *  For duplicate values returned by the block, the ordering is indeterminate, and may be unstable.
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
  *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -2661,31 +3723,32 @@ rb_ary_sort_by_bang(VALUE ary)
 
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     rb_ary_modify(ary);
-    sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
-    rb_ary_replace(ary, sorted);
+    if (RARRAY_LEN(ary) > 1) {
+        sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
+        rb_ary_replace(ary, sorted);
+    }
     return ary;
 }
 
 
 /*
  *  call-seq:
- *     ary.collect { |item| block }  -> new_ary
- *     ary.map     { |item| block }  -> new_ary
- *     ary.collect                   -> Enumerator
- *     ary.map                       -> Enumerator
- *
- *  Invokes the given block once for each element of +self+.
+ *    collect {|element| ... } -> new_array
+ *    collect -> new_enumerator
+ *    map {|element| ... } -> new_array
+ *    map -> new_enumerator
  *
- *  Creates a new array containing the values returned by the block.
+ *  With a block given, calls the block with each element of +self+;
+ *  returns a new array whose elements are the return values from the block:
  *
- *  See also Enumerable#collect.
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a.map {|element| element.class }
+ *    a1 # => [Symbol, String, Integer]
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.collect { |x| x + "!" }        #=> ["a!", "b!", "c!", "d!"]
- *     a.map.with_index{ |x, i| x * i } #=> ["", "b", "cc", "ddd"]
- *     a                                #=> ["a", "b", "c", "d"]
+ *  Related: #collect!;
+ *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
@@ -2697,7 +3760,7 @@ rb_ary_collect(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     collect = rb_ary_new2(RARRAY_LEN(ary));
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
+        rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
     }
     return collect;
 }
@@ -2705,23 +3768,22 @@ rb_ary_collect(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.collect! {|item| block }   -> ary
- *     ary.map!     {|item| block }   -> ary
- *     ary.collect!                   -> Enumerator
- *     ary.map!                       -> Enumerator
+ *    collect! {|element| ... } -> self
+ *    collect! -> new_enumerator
+ *    map! {|element| ... } -> self
+ *    map! -> new_enumerator
  *
- *  Invokes the given block once for each element of +self+, replacing the
- *  element with the value returned by the block.
+ *  With a block given, calls the block with each element of +self+
+ *  and replaces the element with the block's return value;
+ *  returns +self+:
  *
- *  See also Enumerable#collect.
+ *    a = [:foo, 'bar', 2]
+ *    a.map! { |element| element.class } # => [Symbol, String, Integer]
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.map! {|x| x + "!" }
- *     a #=>  [ "a!", "b!", "c!", "d!" ]
- *     a.collect!.with_index {|x, i| x[0...i] }
- *     a #=>  ["", "b", "c!", "d!"]
+ *  Related: #collect;
+ *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
@@ -2732,7 +3794,7 @@ rb_ary_collect_bang(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     rb_ary_modify(ary);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
+        rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
     }
     return ary;
 }
@@ -2744,66 +3806,190 @@ rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func
     long beg, len, i, j;
 
     for (i=0; i<argc; i++) {
-	if (FIXNUM_P(argv[i])) {
-	    rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
-	    continue;
-	}
-	/* check if idx is Range */
-	if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
-	    long end = olen < beg+len ? olen : beg+len;
-	    for (j = beg; j < end; j++) {
-		rb_ary_push(result, (*func)(obj, j));
-	    }
-	    if (beg + len > j)
-		rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
-	    continue;
-	}
-	rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
+        if (FIXNUM_P(argv[i])) {
+            rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
+            continue;
+        }
+        /* check if idx is Range */
+        if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
+            long end = olen < beg+len ? olen : beg+len;
+            for (j = beg; j < end; j++) {
+                rb_ary_push(result, (*func)(obj, j));
+            }
+            if (beg + len > j)
+                rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
+            continue;
+        }
+        rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
     }
     return result;
 }
 
+static VALUE
+append_values_at_single(VALUE result, VALUE ary, long olen, VALUE idx)
+{
+    long beg, len;
+    if (FIXNUM_P(idx)) {
+        beg = FIX2LONG(idx);
+    }
+    /* check if idx is Range */
+    else if (rb_range_beg_len(idx, &beg, &len, olen, 1)) {
+        if (len > 0) {
+            const VALUE *const src = RARRAY_CONST_PTR(ary);
+            const long end = beg + len;
+            const long prevlen = RARRAY_LEN(result);
+            if (beg < olen) {
+                rb_ary_cat(result, src + beg, end > olen ? olen-beg : len);
+            }
+            if (end > olen) {
+                rb_ary_store(result, prevlen + len - 1, Qnil);
+            }
+        }
+        return result;
+    }
+    else {
+        beg = NUM2LONG(idx);
+    }
+    return rb_ary_push(result, rb_ary_entry(ary, beg));
+}
+
 /*
  *  call-seq:
- *     ary.values_at(selector, ...)  -> new_ary
+ *    values_at(*specifiers) -> new_array
+ *
+ *  Returns elements from +self+ in a new array; does not modify +self+.
+ *
+ *  The objects included in the returned array are the elements of +self+
+ *  selected by the given +specifiers+,
+ *  each of which must be a numeric index or a Range.
+ *
+ *  In brief:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *
+ *    # Index specifiers.
+ *    a.values_at(2, 0, 2, 0)     # => ["c", "a", "c", "a"] # May repeat.
+ *    a.values_at(-4, -3, -2, -1) # => ["a", "b", "c", "d"] # Counts backwards if negative.
+ *    a.values_at(-50, 50)        # => [nil, nil]           # Outside of self.
+ *
+ *    # Range specifiers.
+ *    a.values_at(1..3)       # => ["b", "c", "d"] # From range.begin to range.end.
+ *    a.values_at(1...3)      # => ["b", "c"]      # End excluded.
+ *    a.values_at(3..1)       # => []              # No such elements.
+ *
+ *    a.values_at(-3..3)  # => ["b", "c", "d"]     # Negative range.begin counts backwards.
+ *    a.values_at(-50..3)                          # Raises RangeError.
+ *
+ *    a.values_at(1..-2)  # => ["b", "c"]          # Negative range.end counts backwards.
+ *    a.values_at(1..-50) # => []                  # No such elements.
+ *
+ *    # Mixture of specifiers.
+ *    a.values_at(2..3, 3, 0..1, 0) # => ["c", "d", "d", "a", "b", "a"]
+ *
+ *  With no +specifiers+ given, returns a new empty array:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.values_at # => []
+ *
+ *  For each numeric specifier +index+, includes an element:
+ *
+ *  - For each non-negative numeric specifier +index+ that is in-range (less than <tt>self.size</tt>),
+ *    includes the element at offset +index+:
+ *
+ *      a.values_at(0, 2)     # => ["a", "c"]
+ *      a.values_at(0.1, 2.9) # => ["a", "c"]
+ *
+ *  - For each negative numeric +index+ that is in-range (greater than or equal to <tt>- self.size</tt>),
+ *    counts backwards from the end of +self+:
+ *
+ *      a.values_at(-1, -4) # => ["d", "a"]
+ *
+ *  The given indexes may be in any order, and may repeat:
+ *
+ *    a.values_at(2, 0, 1, 0, 2) # => ["c", "a", "b", "a", "c"]
+ *
+ *  For each +index+ that is out-of-range, includes +nil+:
+ *
+ *    a.values_at(4, -5) # => [nil, nil]
+ *
+ *  For each Range specifier +range+, includes elements
+ *  according to <tt>range.begin</tt> and <tt>range.end</tt>:
+ *
+ *  - If both <tt>range.begin</tt> and <tt>range.end</tt>
+ *    are non-negative and in-range (less than <tt>self.size</tt>),
+ *    includes elements from index <tt>range.begin</tt>
+ *    through <tt>range.end - 1</tt> (if <tt>range.exclude_end?</tt>),
+ *    or through <tt>range.end</tt> (otherwise):
+ *
+ *      a.values_at(1..2)  # => ["b", "c"]
+ *      a.values_at(1...2) # => ["b"]
+ *
+ *  - If <tt>range.begin</tt> is negative and in-range (greater than or equal to <tt>- self.size</tt>),
+ *    counts backwards from the end of +self+:
+ *
+ *      a.values_at(-2..3) # => ["c", "d"]
+ *
+ *  - If <tt>range.begin</tt> is negative and out-of-range, raises an exception:
  *
- *  Returns an array containing the elements in +self+ corresponding to the
- *  given +selector+(s).
+ *      a.values_at(-5..3) # Raises RangeError.
  *
- *  The selectors may be either integer indices or ranges.
+ *  - If <tt>range.end</tt> is positive and out-of-range,
+ *    extends the returned array with +nil+ elements:
  *
- *  See also Array#select.
+ *      a.values_at(1..5) # => ["b", "c", "d", nil, nil]
  *
- *     a = %w{ a b c d e f }
- *     a.values_at(1, 3, 5)          # => ["b", "d", "f"]
- *     a.values_at(1, 3, 5, 7)       # => ["b", "d", "f", nil]
- *     a.values_at(-1, -2, -2, -7)   # => ["f", "e", "e", nil]
- *     a.values_at(4..6, 3...6)      # => ["e", "f", nil, "d", "e", "f"]
+ *  - If <tt>range.end</tt> is negative and in-range,
+ *    counts backwards from the end of +self+:
+ *
+ *      a.values_at(1..-2) # => ["b", "c"]
+ *
+ *  - If <tt>range.end</tt> is negative and out-of-range,
+ *    returns an empty array:
+ *
+ *      a.values_at(1..-5) # => []
+ *
+ *  The given ranges may be in any order and may repeat:
+ *
+ *    a.values_at(2..3, 0..1, 2..3) # => ["c", "d", "a", "b", "c", "d"]
+ *
+ *  The given specifiers may be any mixture of indexes and ranges:
+ *
+ *    a.values_at(3, 1..2, 0, 2..3) # => ["d", "b", "c", "a", "c", "d"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
 rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
 {
-    return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
+    long i, olen = RARRAY_LEN(ary);
+    VALUE result = rb_ary_new_capa(argc);
+    for (i = 0; i < argc; ++i) {
+        append_values_at_single(result, ary, olen, argv[i]);
+    }
+    RB_GC_GUARD(ary);
+    return result;
 }
 
 
 /*
  *  call-seq:
- *     ary.select { |item| block } -> new_ary
- *     ary.select                  -> Enumerator
+ *    select {|element| ... } -> new_array
+ *    select -> new_enumerator
+ *    filter {|element| ... } -> new_array
+ *    filter -> new_enumerator
  *
- *  Returns a new array containing all elements of +ary+
- *  for which the given +block+ returns a true value.
+ *  With a block given, calls the block with each element of +self+;
+ *  returns a new array containing those elements of +self+
+ *  for which the block returns a truthy value:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.select {|element| element.to_s.start_with?('b') }
+ *    # => ["bar", :bam]
  *
- *     [1,2,3,4,5].select { |num|  num.even?  }   #=> [2, 4]
+ *  With no block given, returns a new Enumerator.
  *
- *     a = %w{ a b c d e f }
- *     a.select { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
- *
- *  See also Enumerable#select.
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -2815,9 +4001,9 @@ rb_ary_select(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     result = rb_ary_new2(RARRAY_LEN(ary));
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-	    rb_ary_push(result, rb_ary_elt(ary, i));
-	}
+        if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+            rb_ary_push(result, rb_ary_elt(ary, i));
+        }
     }
     return result;
 }
@@ -2835,12 +4021,12 @@ select_bang_i(VALUE a)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-	VALUE v = RARRAY_AREF(ary, i1);
-	if (!RTEST(rb_yield(v))) continue;
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, v);
-	}
-	arg->len[1] = ++i2;
+        VALUE v = RARRAY_AREF(ary, i1);
+        if (!RTEST(rb_yield(v))) continue;
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, v);
+        }
+        arg->len[1] = ++i2;
     }
     return (i1 == i2) ? Qnil : ary;
 }
@@ -2853,33 +4039,40 @@ select_bang_ensure(VALUE a)
     long len = RARRAY_LEN(ary);
     long i1 = arg->len[0], i2 = arg->len[1];
 
-    if (i2 < i1) {
-	if (i1 < len) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		    MEMMOVE(ptr + i2, ptr + i1, VALUE, len - i1);
-		});
-	}
-	ARY_SET_LEN(ary, len - i1 + i2);
+    if (i2 < len && i2 < i1) {
+        long tail = 0;
+        rb_ary_modify(ary);
+        if (i1 < len) {
+            tail = len - i1;
+            RARRAY_PTR_USE(ary, ptr, {
+                    MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
+                });
+        }
+        ARY_SET_LEN(ary, i2 + tail);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.select!  {|item| block } -> ary or nil
- *     ary.select!                  -> Enumerator
+ *    select! {|element| ... } -> self or nil
+ *    select! -> new_enumerator
+ *    filter! {|element| ... } -> self or nil
+ *    filter! -> new_enumerator
  *
- *  Invokes the given block passing in successive elements from +self+,
- *  deleting elements for which the block returns a +false+ value.
+ *  With a block given, calls the block with each element of +self+;
+ *  removes from +self+ those elements for which the block returns +false+ or +nil+.
  *
- *  The array may not be changed instantly every time the block is called.
+ *  Returns +self+ if any elements were removed:
  *
- *  If changes were made, it will return +self+, otherwise it returns +nil+.
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.select! {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
  *
- *  See also Array#keep_if
+ *  Returns +nil+ if no elements were removed.
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
  *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -2897,18 +4090,18 @@ rb_ary_select_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.keep_if { |item| block } -> ary
- *     ary.keep_if                  -> Enumerator
+ *    keep_if {|element| ... } -> self
+ *    keep_if -> new_enumerator
  *
- *  Deletes every element of +self+ for which the given block evaluates to
- *  +false+.
+ *  With a block given, calls the block with each element of +self+;
+ *  removes the element from +self+ if the block does not return a truthy value:
  *
- *  See also Array#select!
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.keep_if {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
  *
- *     a = %w{ a b c d e f }
- *     a.keep_if { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -2924,32 +4117,49 @@ ary_resize_smaller(VALUE ary, long len)
 {
     rb_ary_modify(ary);
     if (RARRAY_LEN(ary) > len) {
-	ARY_SET_LEN(ary, len);
-	if (len * 2 < ARY_CAPA(ary) &&
-	    ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
-	    ary_resize_capa(ary, len * 2);
-	}
+        ARY_SET_LEN(ary, len);
+        if (len * 2 < ARY_CAPA(ary) &&
+            ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+            ary_resize_capa(ary, len * 2);
+        }
     }
 }
 
 /*
  *  call-seq:
- *     ary.delete(obj)            -> item or nil
- *     ary.delete(obj) { block }  -> item or result of block
+ *    delete(object) -> last_removed_object
+ *    delete(object) {|element| ... } -> last_removed_object or block_return
  *
- *  Deletes all items from +self+ that are equal to +obj+.
+ *  Removes zero or more elements from +self+.
  *
- *  Returns the last deleted item, or +nil+ if no matching item is found.
+ *  With no block given,
+ *  removes from +self+ each element +ele+ such that <tt>ele == object</tt>;
+ *  returns the last removed element:
  *
- *  If the optional code block is given, the result of the block is returned if
- *  the item is not found.  (To remove +nil+ elements and get an informative
- *  return value, use Array#compact!)
+ *    a = [0, 1, 2, 2.0]
+ *    a.delete(2) # => 2.0
+ *    a           # => [0, 1]
  *
- *     a = [ "a", "b", "b", "b", "c" ]
- *     a.delete("b")                   #=> "b"
- *     a                               #=> ["a", "c"]
- *     a.delete("z")                   #=> nil
- *     a.delete("z") { "not found" }   #=> "not found"
+ *  Returns +nil+ if no elements removed:
+ *
+ *    a.delete(2) # => nil
+ *
+ *  With a block given,
+ *  removes from +self+ each element +ele+ such that <tt>ele == object</tt>.
+ *
+ *  If any such elements are found, ignores the block
+ *  and returns the last removed element:
+ *
+ *    a = [0, 1, 2, 2.0]
+ *    a.delete(2) {|element| fail 'Cannot happen' } # => 2.0
+ *    a                                             # => [0, 1]
+ *
+ *  If no such element is found, returns the block's return value:
+ *
+ *    a.delete(2) {|element| "Element #{element} not found." }
+ *    # => "Element 2 not found."
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 VALUE
@@ -2959,26 +4169,27 @@ rb_ary_delete(VALUE ary, VALUE item)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-	VALUE e = RARRAY_AREF(ary, i1);
+        VALUE e = RARRAY_AREF(ary, i1);
 
-	if (rb_equal(e, item)) {
-	    v = e;
-	    continue;
-	}
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, e);
-	}
-	i2++;
+        if (rb_equal(e, item)) {
+            v = e;
+            continue;
+        }
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, e);
+        }
+        i2++;
     }
     if (RARRAY_LEN(ary) == i2) {
-	if (rb_block_given_p()) {
-	    return rb_yield(item);
-	}
-	return Qnil;
+        if (rb_block_given_p()) {
+            return rb_yield(item);
+        }
+        return Qnil;
     }
 
     ary_resize_smaller(ary, i2);
 
+    ary_verify(ary);
     return v;
 }
 
@@ -2988,18 +4199,18 @@ rb_ary_delete_same(VALUE ary, VALUE item)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-	VALUE e = RARRAY_AREF(ary, i1);
+        VALUE e = RARRAY_AREF(ary, i1);
 
-	if (e == item) {
-	    continue;
-	}
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, e);
-	}
-	i2++;
+        if (e == item) {
+            continue;
+        }
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, e);
+        }
+        i2++;
     }
     if (RARRAY_LEN(ary) == i2) {
-	return;
+        return;
     }
 
     ary_resize_smaller(ary, i2);
@@ -3013,33 +4224,46 @@ rb_ary_delete_at(VALUE ary, long pos)
 
     if (pos >= len) return Qnil;
     if (pos < 0) {
-	pos += len;
-	if (pos < 0) return Qnil;
+        pos += len;
+        if (pos < 0) return Qnil;
     }
 
     rb_ary_modify(ary);
     del = RARRAY_AREF(ary, pos);
     RARRAY_PTR_USE(ary, ptr, {
-	MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+        MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
     });
     ARY_INCREASE_LEN(ary, -1);
-
+    ary_verify(ary);
     return del;
 }
 
 /*
  *  call-seq:
- *     ary.delete_at(index)  -> obj or nil
+ *    delete_at(index) -> removed_object or nil
  *
- *  Deletes the element at the specified +index+, returning that element, or
- *  +nil+ if the +index+ is out of range.
+ *  Removes the element of +self+ at the given +index+, which must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
  *
- *  See also Array#slice!
+ *  When +index+ is non-negative, deletes the element at offset +index+:
  *
- *     a = ["ant", "bat", "cat", "dog"]
- *     a.delete_at(2)    #=> "cat"
- *     a                 #=> ["ant", "bat", "dog"]
- *     a.delete_at(99)   #=> nil
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(1) # => "bar"
+ *    a # => [:foo, 2]
+ *
+ *  When +index+ is negative, counts backward from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(-2) # => "bar"
+ *    a # => [:foo, 2]
+ *
+ *  When +index+ is out of range, returns +nil+.
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(3)  # => nil
+ *    a.delete_at(-4) # => nil
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -3048,73 +4272,156 @@ rb_ary_delete_at_m(VALUE ary, VALUE pos)
     return rb_ary_delete_at(ary, NUM2LONG(pos));
 }
 
+static VALUE
+ary_slice_bang_by_rb_ary_splice(VALUE ary, long pos, long len)
+{
+    const long orig_len = RARRAY_LEN(ary);
+
+    if (len < 0) {
+        return Qnil;
+    }
+    else if (pos < -orig_len) {
+        return Qnil;
+    }
+    else if (pos < 0) {
+        pos += orig_len;
+    }
+    else if (orig_len < pos) {
+        return Qnil;
+    }
+    if (orig_len < pos + len) {
+        len = orig_len - pos;
+    }
+    if (len == 0) {
+        return rb_ary_new2(0);
+    }
+    else {
+        VALUE arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
+        rb_ary_splice(ary, pos, len, 0, 0);
+        return arg2;
+    }
+}
+
 /*
  *  call-seq:
- *     ary.slice!(index)         -> obj or nil
- *     ary.slice!(start, length) -> new_ary or nil
- *     ary.slice!(range)         -> new_ary or nil
- *
- *  Deletes the element(s) given by an +index+ (optionally up to +length+
- *  elements) or by a +range+.
- *
- *  Returns the deleted object (or objects), or +nil+ if the +index+ is out of
- *  range.
- *
- *     a = [ "a", "b", "c" ]
- *     a.slice!(1)     #=> "b"
- *     a               #=> ["a", "c"]
- *     a.slice!(-1)    #=> "c"
- *     a               #=> ["a"]
- *     a.slice!(100)   #=> nil
- *     a               #=> ["a"]
+ *    slice!(index) -> object or nil
+ *    slice!(start, length) -> new_array or nil
+ *    slice!(range) -> new_array or nil
+ *
+ *  Removes and returns elements from +self+.
+ *
+ *  With numeric argument +index+ given,
+ *  removes and returns the element at offset +index+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(2)   # => "c"
+ *    a             # => ["a", "b", "d"]
+ *    a.slice!(2.1) # => "d"
+ *    a             # => ["a", "b"]
+ *
+ *  If +index+ is negative, counts backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(-2) # => "c"
+ *    a            # => ["a", "b", "d"]
+ *
+ *  If +index+ is out of range, returns +nil+.
+ *
+ *  With numeric arguments +start+ and +length+ given,
+ *  removes +length+ elements from +self+ beginning at zero-based offset +start+;
+ *  returns the removed objects in a new array:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(1, 2)     # => ["b", "c"]
+ *    a                  # => ["a", "d"]
+ *    a.slice!(0.1, 1.1) # => ["a"]
+ *    a                  # => ["d"]
+ *
+ *  If +start+ is negative, counts backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(-2, 1) # => ["c"]
+ *    a               # => ["a", "b", "d"]
+ *
+ *  If +start+ is out-of-range, returns +nil+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(5, 1)  # => nil
+ *    a.slice!(-5, 1) # => nil
+ *
+ *  If <tt>start + length</tt> exceeds the array size,
+ *  removes and returns all elements from offset +start+ to the end:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(2, 50) # => ["c", "d"]
+ *    a               # => ["a", "b"]
+ *
+ *  If <tt>start == a.size</tt> and +length+ is non-negative,
+ *  returns a new empty array.
+ *
+ *  If +length+ is negative, returns +nil+.
+ *
+ *  With Range argument +range+ given,
+ *  treats <tt>range.min</tt> as +start+ (as above)
+ *  and <tt>range.size</tt> as +length+ (as above):
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(1..2) # => ["b", "c"]
+ *    a              # => ["a", "d"]
+ *
+ *  If <tt>range.start == a.size</tt>, returns a new empty array:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(4..5) # => []
+ *
+ *  If <tt>range.start</tt> is larger than the array size, returns +nil+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+      a.slice!(5..6) # => nil
+ *
+ *  If <tt>range.start</tt> is negative,
+ *  calculates the start index by counting backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(-2..2) # => ["c"]
+ *
+ *  If <tt>range.end</tt> is negative,
+ *  calculates the end index by counting backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(0..-2) # => ["a", "b", "c"]
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
 rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE arg1, arg2;
-    long pos, len, orig_len;
+    VALUE arg1;
+    long pos, len;
 
     rb_ary_modify_check(ary);
+    rb_check_arity(argc, 1, 2);
+    arg1 = argv[0];
+
     if (argc == 2) {
-	pos = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
-      delete_pos_len:
-	if (len < 0) return Qnil;
-	orig_len = RARRAY_LEN(ary);
-	if (pos < 0) {
-	    pos += orig_len;
-	    if (pos < 0) return Qnil;
-	}
-	else if (orig_len < pos) return Qnil;
-	if (orig_len < pos + len) {
-	    len = orig_len - pos;
-	}
-	if (len == 0) return rb_ary_new2(0);
-	arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
-	RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
-	rb_ary_splice(ary, pos, len, Qundef);
-	return arg2;
-    }
-
-    if (argc != 1) {
-	/* error report */
-	rb_scan_args(argc, argv, "11", NULL, NULL);
+        pos = NUM2LONG(argv[0]);
+        len = NUM2LONG(argv[1]);
+        return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
     }
-    arg1 = argv[0];
 
     if (!FIXNUM_P(arg1)) {
-	switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
-	  case Qtrue:
-	    /* valid range */
-	    goto delete_pos_len;
-	  case Qnil:
-	    /* invalid range */
-	    return Qnil;
-	  default:
-	    /* not a range */
-	    break;
-	}
+        switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+          case Qtrue:
+            /* valid range */
+            return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
+          case Qnil:
+            /* invalid range */
+            return Qnil;
+          default:
+            /* not a range */
+            break;
+        }
     }
 
     return rb_ary_delete_at(ary, NUM2LONG(arg1));
@@ -3126,10 +4433,11 @@ ary_reject(VALUE orig, VALUE result)
     long i;
 
     for (i = 0; i < RARRAY_LEN(orig); i++) {
-	VALUE v = RARRAY_AREF(orig, i);
-	if (!RTEST(rb_yield(v))) {
-	    rb_ary_push(result, v);
-	}
+        VALUE v = RARRAY_AREF(orig, i);
+
+        if (!RTEST(rb_yield(v))) {
+            rb_ary_push(result, v);
+        }
     }
     return result;
 }
@@ -3142,12 +4450,12 @@ reject_bang_i(VALUE a)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-	VALUE v = RARRAY_AREF(ary, i1);
-	if (RTEST(rb_yield(v))) continue;
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, v);
-	}
-	arg->len[1] = ++i2;
+        VALUE v = RARRAY_AREF(ary, i1);
+        if (RTEST(rb_yield(v))) continue;
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, v);
+        }
+        arg->len[1] = ++i2;
     }
     return (i1 == i2) ? Qnil : ary;
 }
@@ -3156,7 +4464,6 @@ static VALUE
 ary_reject_bang(VALUE ary)
 {
     struct select_bang_arg args;
-
     rb_ary_modify_check(ary);
     args.ary = ary;
     args.len[0] = args.len[1] = 0;
@@ -3165,37 +4472,47 @@ ary_reject_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.reject! { |item| block }  -> ary or nil
- *     ary.reject!                   -> Enumerator
+ *    reject! {|element| ... } -> self or nil
+ *    reject! -> new_enumerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  removes each element for which the block returns a truthy value.
  *
- *  Equivalent to Array#delete_if, deleting elements from +self+ for which the
- *  block evaluates to +true+, but returns +nil+ if no changes were made.
+ *  Returns +self+ if any elements removed:
  *
- *  The array may not be changed instantly every time the block is called.
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a.reject! {|element| element.to_s.start_with?('b') } # => [:foo, 2]
  *
- *  See also Enumerable#reject and Array#delete_if.
+ *  Returns +nil+ if no elements removed.
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
 rb_ary_reject_bang(VALUE ary)
 {
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
     return ary_reject_bang(ary);
 }
 
 /*
  *  call-seq:
- *     ary.reject  {|item| block }  -> new_ary
- *     ary.reject                   -> Enumerator
+ *    reject {|element| ... } -> new_array
+ *    reject -> new_enumerator
  *
- *  Returns a new array containing the items in +self+ for which the given
- *  block is not +true+. The ordering of non-rejected elements is maintained.
+ *  With a block given, returns a new array whose elements are all those from +self+
+ *  for which the block returns +false+ or +nil+:
  *
- *  See also Array#delete_if
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a1 = a.reject {|element| element.to_s.start_with?('b') }
+ *    a1 # => [:foo, 2]
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -3211,25 +4528,25 @@ rb_ary_reject(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.delete_if { |item| block }  -> ary
- *     ary.delete_if                   -> Enumerator
- *
- *  Deletes every element of +self+ for which block evaluates to +true+.
+ *    delete_if {|element| ... } -> self
+ *    delete_if -> new_numerator
  *
- *  The array is changed instantly every time the block is called, not after
- *  the iteration is over.
+ *  With a block given, calls the block with each element of +self+;
+ *  removes the element if the block returns a truthy value;
+ *  returns +self+:
  *
- *  See also Array#reject!
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a.delete_if {|element| element.to_s.start_with?('b') } # => [:foo, 2]
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
  *
- *     scores = [ 97, 42, 75 ]
- *     scores.delete_if {|score| score < 80 }   #=> [97]
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
 rb_ary_delete_if(VALUE ary)
 {
+    ary_verify(ary);
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     ary_reject_bang(ary);
     return ary;
@@ -3239,9 +4556,9 @@ static VALUE
 take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
 {
     VALUE *args = (VALUE *)cbarg;
-    if (args[1]-- == 0) rb_iter_break();
     if (argc > 1) val = rb_ary_new4(argc, argv);
     rb_ary_push(args[0], val);
+    if (--args[1] == 0) rb_iter_break();
     return Qnil;
 }
 
@@ -3251,38 +4568,108 @@ take_items(VALUE obj, long n)
     VALUE result = rb_check_array_type(obj);
     VALUE args[2];
 
+    if (n == 0) return result;
     if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
     result = rb_ary_new2(n);
     args[0] = result; args[1] = (VALUE)n;
-    if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
-	rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
-		 rb_obj_class(obj));
+    if (UNDEF_P(rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args)))
+        rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
+                 rb_obj_class(obj));
     return result;
 }
 
 
 /*
  *  call-seq:
- *     ary.zip(arg, ...)                  -> new_ary
- *     ary.zip(arg, ...) { |arr| block }  -> nil
- *
- *  Converts any arguments to arrays, then merges elements of +self+ with
- *  corresponding elements from each argument.
- *
- *  This generates a sequence of <code>ary.size</code> _n_-element arrays,
- *  where _n_ is one more than the count of arguments.
- *
- *  If the size of any argument is less than the size of the initial array,
- *  +nil+ values are supplied.
- *
- *  If a block is given, it is invoked for each output +array+, otherwise an
- *  array of arrays is returned.
- *
- *     a = [ 4, 5, 6 ]
- *     b = [ 7, 8, 9 ]
- *     [1, 2, 3].zip(a, b)   #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
- *     [1, 2].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8]]
- *     a.zip([1, 2], [8])    #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
+ *    zip(*other_arrays) -> new_array
+ *    zip(*other_arrays) {|sub_array| ... } -> nil
+ *
+ *  With no block given, combines +self+ with the collection of +other_arrays+;
+ *  returns a new array of sub-arrays:
+ *
+ *    [0, 1].zip(['zero', 'one'], [:zero, :one])
+ *    # => [[0, "zero", :zero], [1, "one", :one]]
+ *
+ *  Returned:
+ *
+ *  - The outer array is of size <tt>self.size</tt>.
+ *  - Each sub-array is of size <tt>other_arrays.size + 1</tt>.
+ *  - The _nth_ sub-array contains (in order):
+ *
+ *    - The _nth_ element of +self+.
+ *    - The _nth_ element of each of the other arrays, as available.
+ *
+ *  Example:
+ *
+ *    a = [0, 1]
+ *    zipped = a.zip(['zero', 'one'], [:zero, :one])
+ *    # => [[0, "zero", :zero], [1, "one", :one]]
+ *    zipped.size       # => 2 # Same size as a.
+ *    zipped.first.size # => 3 # Size of other arrays plus 1.
+ *
+ *  When the other arrays are all the same size as +self+,
+ *  the returned sub-arrays are a rearrangement containing exactly elements of all the arrays
+ *  (including +self+), with no omissions or additions:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3]
+ *    c = [:c0, :c1, :c2, :c3]
+ *    d = a.zip(b, c)
+ *    pp d
+ *    # =>
+ *    [[:a0, :b0, :c0],
+ *     [:a1, :b1, :c1],
+ *     [:a2, :b2, :c2],
+ *     [:a3, :b3, :c3]]
+ *
+ *  When one of the other arrays is smaller than +self+,
+ *  pads the corresponding sub-array with +nil+ elements:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2]
+ *    c = [:c0, :c1]
+ *    d = a.zip(b, c)
+ *    pp d
+ *    # =>
+ *    [[:a0, :b0, :c0],
+ *     [:a1, :b1, :c1],
+ *     [:a2, :b2, nil],
+ *     [:a3, nil, nil]]
+ *
+ *  When one of the other arrays is larger than +self+,
+ *  _ignores_ its trailing elements:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3, :b4]
+ *    c = [:c0, :c1, :c2, :c3, :c4, :c5]
+ *    d = a.zip(b, c)
+ *    pp d
+ *    # =>
+ *    [[:a0, :b0, :c0],
+ *     [:a1, :b1, :c1],
+ *     [:a2, :b2, :c2],
+ *     [:a3, :b3, :c3]]
+ *
+ *  With a block given, calls the block with each of the other arrays;
+ *  returns +nil+:
+ *
+ *    d = []
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3]
+ *    c = [:c0, :c1, :c2, :c3]
+ *    a.zip(b, c) {|sub_array| d.push(sub_array.reverse) } # => nil
+ *    pp d
+ *    # =>
+ *    [[:c0, :b0, :a0],
+ *     [:c1, :b1, :a1],
+ *     [:c2, :b2, :a2],
+ *     [:c3, :b3, :a3]]
+ *
+ *  For an *object* in *other_arrays* that is not actually an array,
+ *  forms the "other array" as <tt>object.to_ary</tt>, if defined,
+ *  or as <tt>object.each.to_a</tt> otherwise.
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
@@ -3293,51 +4680,51 @@ rb_ary_zip(int argc, VALUE *argv, VALUE ary)
     VALUE result = Qnil;
 
     for (i=0; i<argc; i++) {
-	argv[i] = take_items(argv[i], len);
+        argv[i] = take_items(argv[i], len);
     }
 
     if (rb_block_given_p()) {
-	int arity = rb_block_arity();
-
-	if (arity > 1) {
-	    VALUE work, *tmp;
-
-	    tmp = ALLOCV_N(VALUE, work, argc+1);
-
-	    for (i=0; i<RARRAY_LEN(ary); i++) {
-		tmp[0] = RARRAY_AREF(ary, i);
-		for (j=0; j<argc; j++) {
-		    tmp[j+1] = rb_ary_elt(argv[j], i);
-		}
-		rb_yield_values2(argc+1, tmp);
-	    }
-
-	    if (work) ALLOCV_END(work);
-	}
-	else {
-	    for (i=0; i<RARRAY_LEN(ary); i++) {
-		VALUE tmp = rb_ary_new2(argc+1);
-
-		rb_ary_push(tmp, RARRAY_AREF(ary, i));
-		for (j=0; j<argc; j++) {
-		    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-		}
-		rb_yield(tmp);
-	    }
-	}
+        int arity = rb_block_arity();
+
+        if (arity > 1) {
+            VALUE work, *tmp;
+
+            tmp = ALLOCV_N(VALUE, work, argc+1);
+
+            for (i=0; i<RARRAY_LEN(ary); i++) {
+                tmp[0] = RARRAY_AREF(ary, i);
+                for (j=0; j<argc; j++) {
+                    tmp[j+1] = rb_ary_elt(argv[j], i);
+                }
+                rb_yield_values2(argc+1, tmp);
+            }
+
+            if (work) ALLOCV_END(work);
+        }
+        else {
+            for (i=0; i<RARRAY_LEN(ary); i++) {
+                VALUE tmp = rb_ary_new2(argc+1);
+
+                rb_ary_push(tmp, RARRAY_AREF(ary, i));
+                for (j=0; j<argc; j++) {
+                    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+                }
+                rb_yield(tmp);
+            }
+        }
     }
     else {
-	result = rb_ary_new_capa(len);
+        result = rb_ary_new_capa(len);
 
-	for (i=0; i<len; i++) {
-	    VALUE tmp = rb_ary_new_capa(argc+1);
+        for (i=0; i<len; i++) {
+            VALUE tmp = rb_ary_new_capa(argc+1);
 
-	    rb_ary_push(tmp, RARRAY_AREF(ary, i));
-	    for (j=0; j<argc; j++) {
-		rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-	    }
-	    rb_ary_push(result, tmp);
-	}
+            rb_ary_push(tmp, RARRAY_AREF(ary, i));
+            for (j=0; j<argc; j++) {
+                rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+            }
+            rb_ary_push(result, tmp);
+        }
     }
 
     return result;
@@ -3345,15 +4732,17 @@ rb_ary_zip(int argc, VALUE *argv, VALUE ary)
 
 /*
  *  call-seq:
- *     ary.transpose -> new_ary
+ *    transpose -> new_array
+ *
+ *  Returns a new array that is +self+
+ *  as a {transposed matrix}[https://en.wikipedia.org/wiki/Transpose]:
  *
- *  Assumes that +self+ is an array of arrays and transposes the rows and
- *  columns.
+ *    a = [[:a0, :a1], [:b0, :b1], [:c0, :c1]]
+ *    a.transpose # => [[:a0, :b0, :c0], [:a1, :b1, :c1]]
  *
- *     a = [[1,2], [3,4], [5,6]]
- *     a.transpose   #=> [[1, 3, 5], [2, 4, 6]]
+ *  The elements of +self+ must all be the same size.
  *
- *  If the length of the subarrays don't match, an IndexError is raised.
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
@@ -3365,36 +4754,38 @@ rb_ary_transpose(VALUE ary)
     alen = RARRAY_LEN(ary);
     if (alen == 0) return rb_ary_dup(ary);
     for (i=0; i<alen; i++) {
-	tmp = to_ary(rb_ary_elt(ary, i));
-	if (elen < 0) {		/* first element */
-	    elen = RARRAY_LEN(tmp);
-	    result = rb_ary_new2(elen);
-	    for (j=0; j<elen; j++) {
-		rb_ary_store(result, j, rb_ary_new2(alen));
-	    }
-	}
-	else if (elen != RARRAY_LEN(tmp)) {
-	    rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
-		     RARRAY_LEN(tmp), elen);
-	}
-	for (j=0; j<elen; j++) {
-	    rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
-	}
+        tmp = to_ary(rb_ary_elt(ary, i));
+        if (elen < 0) {		/* first element */
+            elen = RARRAY_LEN(tmp);
+            result = rb_ary_new2(elen);
+            for (j=0; j<elen; j++) {
+                rb_ary_store(result, j, rb_ary_new2(alen));
+            }
+        }
+        else if (elen != RARRAY_LEN(tmp)) {
+            rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+                     RARRAY_LEN(tmp), elen);
+        }
+        for (j=0; j<elen; j++) {
+            rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
+        }
     }
     return result;
 }
 
 /*
  *  call-seq:
- *     ary.replace(other_ary)  -> ary
- *     ary.initialize_copy(other_ary)	-> ary
+ *    initialize_copy(other_array) -> self
+ *    replace(other_array) -> self
+ *
+ *  Replaces the elements of +self+ with the elements of +other_array+, which must be an
+ *  {array-convertible object}[rdoc-ref:implicit_conversion.rdoc@Array-Convertible+Objects];
+ *  returns +self+:
  *
- *  Replaces the contents of +self+ with the contents of +other_ary+,
- *  truncating or expanding if necessary.
+ *    a = ['a', 'b', 'c']   # => ["a", "b", "c"]
+ *    a.replace(['d', 'e']) # => ["d", "e"]
  *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.replace([ "x", "y", "z" ])   #=> ["x", "y", "z"]
- *     a                              #=> ["x", "y", "z"]
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 VALUE
@@ -3404,183 +4795,330 @@ rb_ary_replace(VALUE copy, VALUE orig)
     orig = to_ary(orig);
     if (copy == orig) return copy;
 
-    if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
-        VALUE shared = 0;
+    rb_ary_reset(copy);
 
-        if (ARY_OWNS_HEAP_P(copy)) {
-	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
-	}
-        else if (ARY_SHARED_P(copy)) {
-            shared = ARY_SHARED(copy);
-            FL_UNSET_SHARED(copy);
-        }
-        FL_SET_EMBED(copy);
-	ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
-        if (shared) {
-            rb_ary_decrement_share(shared);
-        }
-        ARY_SET_LEN(copy, RARRAY_LEN(orig));
+    /* orig has enough space to embed the contents of orig. */
+    if (RARRAY_LEN(orig) <= ary_embed_capa(copy)) {
+        RUBY_ASSERT(ARY_EMBED_P(copy));
+        ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
+        ARY_SET_EMBED_LEN(copy, RARRAY_LEN(orig));
+    }
+    /* orig is embedded but copy does not have enough space to embed the
+     * contents of orig. */
+    else if (ARY_EMBED_P(orig)) {
+        long len = ARY_EMBED_LEN(orig);
+        VALUE *ptr = ary_heap_alloc_buffer(len);
+
+        FL_UNSET_EMBED(copy);
+        ARY_SET_PTR(copy, ptr);
+        ARY_SET_LEN(copy, len);
+        ARY_SET_CAPA(copy, len);
+
+        // No allocation and exception expected that could leave `copy` in a
+        // bad state from the edits above.
+        ary_memcpy(copy, 0, len, RARRAY_CONST_PTR(orig));
     }
+    /* Otherwise, orig is on heap and copy does not have enough space to embed
+     * the contents of orig. */
     else {
-        VALUE shared = ary_make_shared(orig);
-        if (ARY_OWNS_HEAP_P(copy)) {
-	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
-        }
-        else {
-            rb_ary_unshare_safe(copy);
-        }
+        VALUE shared_root = ary_make_shared(orig);
         FL_UNSET_EMBED(copy);
-        ARY_SET_PTR(copy, RARRAY_CONST_PTR(orig));
-        ARY_SET_LEN(copy, RARRAY_LEN(orig));
-        rb_ary_set_shared(copy, shared);
+        ARY_SET_PTR(copy, ARY_HEAP_PTR(orig));
+        ARY_SET_LEN(copy, ARY_HEAP_LEN(orig));
+        rb_ary_set_shared(copy, shared_root);
+
+        RUBY_ASSERT(RB_OBJ_SHAREABLE_P(copy) ? RB_OBJ_SHAREABLE_P(shared_root) : 1);
     }
+    ary_verify(copy);
     return copy;
 }
 
 /*
  *  call-seq:
- *     ary.clear    -> ary
+ *    clear -> self
  *
- *  Removes all elements from +self+.
+ *  Removes all elements from +self+; returns +self+:
  *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.clear    #=> [ ]
+ *    a = [:foo, 'bar', 2]
+ *    a.clear # => []
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 VALUE
 rb_ary_clear(VALUE ary)
 {
     rb_ary_modify_check(ary);
-    ARY_SET_LEN(ary, 0);
     if (ARY_SHARED_P(ary)) {
-	if (!ARY_EMBED_P(ary)) {
-	    rb_ary_unshare(ary);
-	    FL_SET_EMBED(ary);
-	}
+        rb_ary_unshare(ary);
+        FL_SET_EMBED(ary);
+        ARY_SET_EMBED_LEN(ary, 0);
     }
-    else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
-	ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+    else {
+        ARY_SET_LEN(ary, 0);
+        if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+            ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+        }
     }
+    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.fill(obj)                                 -> ary
- *     ary.fill(obj, start [, length])               -> ary
- *     ary.fill(obj, range )                         -> ary
- *     ary.fill { |index| block }                    -> ary
- *     ary.fill(start [, length] ) { |index| block } -> ary
- *     ary.fill(range) { |index| block }             -> ary
+ *    fill(object, start = nil, count = nil) -> self
+ *    fill(object, range) -> self
+ *    fill(start = nil, count = nil) {|element| ... } -> self
+ *    fill(range) {|element| ... } -> self
+ *
+ *  Replaces selected elements in +self+;
+ *  may add elements to +self+;
+ *  always returns +self+ (never a new array).
+ *
+ *  In brief:
+ *
+ *    # Non-negative start.
+ *    ['a', 'b', 'c', 'd'].fill('-', 1, 2)          # => ["a", "-", "-", "d"]
+ *    ['a', 'b', 'c', 'd'].fill(1, 2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *    # Extends with specified values if necessary.
+ *    ['a', 'b', 'c', 'd'].fill('-', 3, 2)          # => ["a", "b", "c", "-", "-"]
+ *    ['a', 'b', 'c', 'd'].fill(3, 2) {|e| e.to_s } # => ["a", "b", "c", "3", "4"]
+ *
+ *    # Fills with nils if necessary.
+ *    ['a', 'b', 'c', 'd'].fill('-', 6, 2)          # => ["a", "b", "c", "d", nil, nil, "-", "-"]
+ *    ['a', 'b', 'c', 'd'].fill(6, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, nil, "6", "7"]
+ *
+ *    # For negative start, counts backwards from the end.
+ *    ['a', 'b', 'c', 'd'].fill('-', -3, 3)          # => ["a", "-", "-", "-"]
+ *    ['a', 'b', 'c', 'd'].fill(-3, 3) {|e| e.to_s } # => ["a", "1", "2", "3"]
+ *
+ *    # Range.
+ *    ['a', 'b', 'c', 'd'].fill('-', 1..2)          # => ["a", "-", "-", "d"]
+ *    ['a', 'b', 'c', 'd'].fill(1..2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *  When arguments +start+ and +count+ are given,
+ *  they select the elements of +self+ to be replaced;
+ *  each must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
+ *  (or +nil+):
+ *
+ *  - +start+ specifies the zero-based offset of the first element to be replaced;
+ *    +nil+ means zero.
+ *  - +count+ is the number of consecutive elements to be replaced;
+ *    +nil+ means "all the rest."
+ *
+ *  With argument +object+ given,
+ *  that one object is used for all replacements:
+ *
+ *    o = Object.new           # => #<Object:0x0000014e7bff7600>
+ *    a = ['a', 'b', 'c', 'd'] # => ["a", "b", "c", "d"]
+ *    a.fill(o, 1, 2)
+ *    # => ["a", #<Object:0x0000014e7bff7600>, #<Object:0x0000014e7bff7600>, "d"]
+ *
+ *  With a block given, the block is called once for each element to be replaced;
+ *  the value passed to the block is the _index_ of the element to be replaced
+ *  (not the element itself);
+ *  the block's return value replaces the element:
+ *
+ *    a = ['a', 'b', 'c', 'd']               # => ["a", "b", "c", "d"]
+ *    a.fill(1, 2) {|element| element.to_s } # => ["a", "1", "2", "d"]
+ *
+ *  For arguments +start+ and +count+:
+ *
+ *  - If +start+ is non-negative,
+ *    replaces +count+ elements beginning at offset +start+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 0, 2) # => ["-", "-", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 1, 2) # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 2, 2) # => ["a", "b", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(0, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1, 2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(2, 2) {|e| e.to_s } # => ["a", "b", "2", "3"]
+ *
+ *    Extends +self+ if necessary:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 3, 2) # => ["a", "b", "c", "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 4, 2) # => ["a", "b", "c", "d", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(3, 2) {|e| e.to_s } # => ["a", "b", "c", "3", "4"]
+ *      ['a', 'b', 'c', 'd'].fill(4, 2) {|e| e.to_s } # => ["a", "b", "c", "d", "4", "5"]
+ *
+ *    Fills with +nil+ if necessary:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 5, 2) # => ["a", "b", "c", "d", nil, "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 6, 2) # => ["a", "b", "c", "d", nil, nil, "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(5, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, "5", "6"]
+ *      ['a', 'b', 'c', 'd'].fill(6, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, nil, "6", "7"]
+ *
+ *    Does nothing if +count+ is non-positive:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 2, 0)    # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 2, -100) # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 6, -100) # => ["a", "b", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(2, 0) {|e| fail 'Cannot happen' }    # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(2, -100) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(6, -100) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ *  - If +start+ is negative, counts backwards from the end of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -4, 3) # => ["-", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -3, 3) # => ["a", "-", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-4, 3) {|e| e.to_s } # => ["0", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-3, 3) {|e| e.to_s } # => ["a", "1", "2", "3"]
+ *
+ *    Extends +self+ if necessary:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -2, 3) # => ["a", "b", "-", "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -1, 3) # => ["a", "b", "c", "-", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-2, 3) {|e| e.to_s } # => ["a", "b", "2", "3", "4"]
+ *      ['a', 'b', 'c', 'd'].fill(-1, 3) {|e| e.to_s } # => ["a", "b", "c", "3", "4", "5"]
+ *
+ *    Starts at the beginning of +self+ if +start+ is negative and out-of-range:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -5, 2) # => ["-", "-", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -6, 2) # => ["-", "-", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-5, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-6, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
+ *
+ *    Does nothing if +count+ is non-positive:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -2, 0)  # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -2, -1) # => ["a", "b", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-2, 0) {|e| fail 'Cannot happen' }  # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-2, -1) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ *  When argument +range+ is given,
+ *  it must be a Range object whose members are numeric;
+ *  its +begin+ and +end+ values determine the elements of +self+
+ *  to be replaced:
+ *
+ *  - If both +begin+ and +end+ are positive, they specify the first and last elements
+ *    to be replaced:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 1..2)          # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1..2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *    If +end+ is smaller than +begin+, replaces no elements:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 2..1)          # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(2..1) {|e| e.to_s } # => ["a", "b", "c", "d"]
  *
- *  The first three forms set the selected elements of +self+ (which
- *  may be the entire array) to +obj+.
+ *  - If either is negative (or both are negative), counts backwards from the end of +self+:
  *
- *  A +start+ of +nil+ is equivalent to zero.
+ *      ['a', 'b', 'c', 'd'].fill('-', -3..2)  # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 1..-2)  # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -3..-2) # => ["a", "-", "-", "d"]
  *
- *  A +length+ of +nil+ is equivalent to the length of the array.
+ *      ['a', 'b', 'c', 'd'].fill(-3..2) {|e| e.to_s }  # => ["a", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1..-2) {|e| e.to_s }  # => ["a", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-3..-2) {|e| e.to_s } # => ["a", "1", "2", "d"]
  *
- *  The last three forms fill the array with the value of the given block,
- *  which is passed the absolute index of each element to be filled.
+ *  - If the +end+ value is excluded (see Range#exclude_end?), omits the last replacement:
  *
- *  Negative values of +start+ count from the end of the array, where +-1+ is
- *  the last element.
+ *      ['a', 'b', 'c', 'd'].fill('-', 1...2)  # => ["a", "-", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 1...-2) # => ["a", "-", "c", "d"]
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.fill("x")              #=> ["x", "x", "x", "x"]
- *     a.fill("z", 2, 2)        #=> ["x", "x", "z", "z"]
- *     a.fill("y", 0..1)        #=> ["y", "y", "z", "z"]
- *     a.fill { |i| i*i }       #=> [0, 1, 4, 9]
- *     a.fill(-2) { |i| i*i*i } #=> [0, 1, 8, 27]
+ *      ['a', 'b', 'c', 'd'].fill(1...2) {|e| e.to_s }  # => ["a", "1", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1...-2) {|e| e.to_s } # => ["a", "1", "c", "d"]
+ *
+ *  - If the range is endless (see {Endless Ranges}[rdoc-ref:Range@Endless+Ranges]),
+ *    replaces elements to the end of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 1..)          # => ["a", "-", "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill(1..) {|e| e.to_s } # => ["a", "1", "2", "3"]
+ *
+ *  - If the range is beginless (see {Beginless Ranges}[rdoc-ref:Range@Beginless+Ranges]),
+ *    replaces elements from the beginning of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', ..2)          # => ["-", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(..2) {|e| e.to_s } # => ["0", "1", "2", "d"]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
 rb_ary_fill(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE item, arg1, arg2;
+    VALUE item = Qundef, arg1, arg2;
     long beg = 0, end = 0, len = 0;
-    int block_p = FALSE;
 
     if (rb_block_given_p()) {
-	block_p = TRUE;
-	rb_scan_args(argc, argv, "02", &arg1, &arg2);
-	argc += 1;		/* hackish */
+        rb_scan_args(argc, argv, "02", &arg1, &arg2);
+        argc += 1;		/* hackish */
     }
     else {
-	rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+        rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
     }
     switch (argc) {
       case 1:
-	beg = 0;
-	len = RARRAY_LEN(ary);
-	break;
+        beg = 0;
+        len = RARRAY_LEN(ary);
+        break;
       case 2:
-	if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
-	    break;
-	}
-	/* fall through */
+        if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+            break;
+        }
+        /* fall through */
       case 3:
-	beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
-	if (beg < 0) {
-	    beg = RARRAY_LEN(ary) + beg;
-	    if (beg < 0) beg = 0;
-	}
-	len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
-	break;
+        beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
+        if (beg < 0) {
+            beg = RARRAY_LEN(ary) + beg;
+            if (beg < 0) beg = 0;
+        }
+        len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+        break;
     }
     rb_ary_modify(ary);
     if (len < 0) {
         return ary;
     }
     if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
-	rb_raise(rb_eArgError, "argument too big");
+        rb_raise(rb_eArgError, "argument too big");
     }
     end = beg + len;
     if (RARRAY_LEN(ary) < end) {
-	if (end >= ARY_CAPA(ary)) {
-	    ary_resize_capa(ary, end);
-	}
-	ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
-	ARY_SET_LEN(ary, end);
+        if (end >= ARY_CAPA(ary)) {
+            ary_resize_capa(ary, end);
+        }
+        ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+        ARY_SET_LEN(ary, end);
     }
 
-    if (block_p) {
-	VALUE v;
-	long i;
+    if (UNDEF_P(item)) {
+        VALUE v;
+        long i;
 
-	for (i=beg; i<end; i++) {
-	    v = rb_yield(LONG2NUM(i));
-	    if (i>=RARRAY_LEN(ary)) break;
-	    ARY_SET(ary, i, v);
-	}
+        for (i=beg; i<end; i++) {
+            v = rb_yield(LONG2NUM(i));
+            if (i>=RARRAY_LEN(ary)) break;
+            ARY_SET(ary, i, v);
+        }
     }
     else {
-	ary_memfill(ary, beg, len, item);
+        ary_memfill(ary, beg, len, item);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary + other_ary   -> new_ary
- *
- *  Concatenation --- Returns a new array built by concatenating the
- *  two arrays together to produce a third array.
+ *    self + other_array -> new_array
  *
- *     [ 1, 2, 3 ] + [ 4, 5 ]    #=> [ 1, 2, 3, 4, 5 ]
- *     a = [ "a", "b", "c" ]
- *     c = a + [ "d", "e", "f" ]
- *     c                         #=> [ "a", "b", "c", "d", "e", "f" ]
- *     a                         #=> [ "a", "b", "c" ]
+ *  Returns a new array containing all elements of +self+
+ *  followed by all elements of +other_array+:
  *
- *  Note that
- *     x += y
- *  is the same as
- *     x = x + y
- *  This means that it produces a new array. As a consequence,
- *  repeated use of <code>+=</code> on arrays can be quite inefficient.
+ *    a = [0, 1] + [2, 3]
+ *    a # => [0, 1, 2, 3]
  *
- *  See also Array#concat.
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 VALUE
@@ -3601,46 +5139,72 @@ rb_ary_plus(VALUE x, VALUE y)
     return z;
 }
 
+static VALUE
+ary_append(VALUE x, VALUE y)
+{
+    long n = RARRAY_LEN(y);
+    if (n > 0) {
+        rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR(y), n);
+    }
+    RB_GC_GUARD(y);
+    return x;
+}
+
 /*
  *  call-seq:
- *     ary.concat(other_ary)   -> ary
+ *    concat(*other_arrays) -> self
  *
- *  Appends the elements of +other_ary+ to +self+.
+ *  Adds to +self+ all elements from each array in +other_arrays+; returns +self+:
  *
- *     [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
- *     a = [ 1, 2, 3 ]
- *     a.concat( [ 4, 5 ] )
- *     a                                 #=> [ 1, 2, 3, 4, 5 ]
+ *    a = [0, 1]
+ *    a.concat(['two', 'three'], [:four, :five], a)
+ *    # => [0, 1, "two", "three", :four, :five, 0, 1]
  *
- *  See also Array#+.
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
-VALUE
-rb_ary_concat(VALUE x, VALUE y)
+static VALUE
+rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
 {
-    rb_ary_modify_check(x);
-    y = to_ary(y);
-    if (RARRAY_LEN(y) > 0) {
-	rb_ary_splice(x, RARRAY_LEN(x), 0, y);
+    rb_ary_modify_check(ary);
+
+    if (argc == 1) {
+        rb_ary_concat(ary, argv[0]);
     }
-    return x;
+    else if (argc > 1) {
+        int i;
+        VALUE args = rb_ary_hidden_new(argc);
+        for (i = 0; i < argc; i++) {
+            rb_ary_concat(args, argv[i]);
+        }
+        ary_append(ary, args);
+    }
+
+    ary_verify(ary);
+    return ary;
 }
 
+VALUE
+rb_ary_concat(VALUE x, VALUE y)
+{
+    return ary_append(x, to_ary(y));
+}
 
 /*
  *  call-seq:
- *     ary * int     -> new_ary
- *     ary * str     -> new_string
+ *    self * n -> new_array
+ *    self * string_separator -> new_string
  *
- *  Repetition --- With a String argument, equivalent to
- *  <code>ary.join(str)</code>.
+ *  When non-negative integer argument +n+ is given,
+ *  returns a new array built by concatenating +n+ copies of +self+:
  *
- *  Otherwise, returns a new array built by concatenating the +int+ copies of
- *  +self+.
+ *    a = ['x', 'y']
+ *    a * 3 # => ["x", "y", "x", "y", "x", "y"]
  *
+ *  When string argument +string_separator+ is given,
+ *  equivalent to <tt>self.join(string_separator)</tt>:
  *
- *     [ 1, 2, 3 ] * 3    #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
- *     [ 1, 2, 3 ] * ","  #=> "1,2,3"
+ *    [0, [0, 1], {foo: 0}] * ', ' # => "0, 0, 1, {foo: 0}"
  *
  */
 
@@ -3653,61 +5217,55 @@ rb_ary_times(VALUE ary, VALUE times)
 
     tmp = rb_check_string_type(times);
     if (!NIL_P(tmp)) {
-	return rb_ary_join(ary, tmp);
+        return rb_ary_join(ary, tmp);
     }
 
     len = NUM2LONG(times);
     if (len == 0) {
-	ary2 = ary_new(rb_obj_class(ary), 0);
-	goto out;
+        ary2 = ary_new(rb_cArray, 0);
+        goto out;
     }
     if (len < 0) {
-	rb_raise(rb_eArgError, "negative argument");
+        rb_raise(rb_eArgError, "negative argument");
     }
     if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
-	rb_raise(rb_eArgError, "argument too big");
+        rb_raise(rb_eArgError, "argument too big");
     }
     len *= RARRAY_LEN(ary);
 
-    ary2 = ary_new(rb_obj_class(ary), len);
+    ary2 = ary_new(rb_cArray, len);
     ARY_SET_LEN(ary2, len);
 
     ptr = RARRAY_CONST_PTR(ary);
     t = RARRAY_LEN(ary);
     if (0 < t) {
-	ary_memcpy(ary2, 0, t, ptr);
-	while (t <= len/2) {
-	    ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
+        ary_memcpy(ary2, 0, t, ptr);
+        while (t <= len/2) {
+            ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
             t *= 2;
         }
         if (t < len) {
-	    ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
+            ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
         }
     }
   out:
-    OBJ_INFECT(ary2, ary);
-
     return ary2;
 }
 
 /*
  *  call-seq:
- *     ary.assoc(obj)   -> new_ary  or  nil
+ *    assoc(object) -> found_array or nil
  *
- *  Searches through an array whose elements are also arrays comparing +obj+
- *  with the first element of each contained array using <code>obj.==</code>.
+ *  Returns the first element +ele+ in +self+ such that +ele+ is an array
+ *  and <tt>ele[0] == object</tt>:
  *
- *  Returns the first contained array that matches (that is, the first
- *  associated array), or +nil+ if no match is found.
+ *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ *    a.assoc(4) # => [4, 5, 6]
  *
- *  See also Array#rassoc
+ *  Returns +nil+ if no such element is found.
  *
- *     s1 = [ "colors", "red", "blue", "green" ]
- *     s2 = [ "letters", "a", "b", "c" ]
- *     s3 = "foo"
- *     a  = [ s1, s2, s3 ]
- *     a.assoc("letters")  #=> [ "letters", "a", "b", "c" ]
- *     a.assoc("foo")      #=> nil
+ *  Related: Array#rassoc;
+ *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
@@ -3717,30 +5275,29 @@ rb_ary_assoc(VALUE ary, VALUE key)
     VALUE v;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	v = rb_check_array_type(RARRAY_AREF(ary, i));
-	if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
-	    rb_equal(RARRAY_AREF(v, 0), key))
-	    return v;
+        v = rb_check_array_type(RARRAY_AREF(ary, i));
+        if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+            rb_equal(RARRAY_AREF(v, 0), key))
+            return v;
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *     ary.rassoc(obj) -> new_ary or nil
- *
- *  Searches through the array whose elements are also arrays.
+ *    rassoc(object) -> found_array or nil
  *
- *  Compares +obj+ with the second element of each contained array using
- *  <code>obj.==</code>.
+ *  Returns the first element +ele+ in +self+ such that +ele+ is an array
+ *  and <tt>ele[1] == object</tt>:
  *
- *  Returns the first contained array that matches +obj+.
+ *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ *    a.rassoc(4) # => [2, 4]
+ *    a.rassoc(5) # => [4, 5, 6]
  *
- *  See also Array#assoc.
+ *  Returns +nil+ if no such element is found.
  *
- *     a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
- *     a.rassoc("two")    #=> [2, "two"]
- *     a.rassoc("four")   #=> nil
+ *  Related: Array#assoc;
+ *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
@@ -3750,11 +5307,11 @@ rb_ary_rassoc(VALUE ary, VALUE value)
     VALUE v;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	v = RARRAY_AREF(ary, i);
-	if (RB_TYPE_P(v, T_ARRAY) &&
-	    RARRAY_LEN(v) > 1 &&
-	    rb_equal(RARRAY_AREF(v, 1), value))
-	    return v;
+        v = rb_check_array_type(RARRAY_AREF(ary, i));
+        if (RB_TYPE_P(v, T_ARRAY) &&
+            RARRAY_LEN(v) > 1 &&
+            rb_equal(RARRAY_AREF(v, 1), value))
+            return v;
     }
     return Qnil;
 }
@@ -3767,43 +5324,54 @@ recursive_equal(VALUE ary1, VALUE ary2, int recur)
 
     if (recur) return Qtrue; /* Subtle! */
 
+    /* rb_equal() can evacuate ptrs */
     p1 = RARRAY_CONST_PTR(ary1);
     p2 = RARRAY_CONST_PTR(ary2);
     len1 = RARRAY_LEN(ary1);
 
     for (i = 0; i < len1; i++) {
-	if (*p1 != *p2) {
-	    if (rb_equal(*p1, *p2)) {
-		len1 = RARRAY_LEN(ary1);
-		if (len1 != RARRAY_LEN(ary2))
-		    return Qfalse;
-		if (len1 < i)
-		    return Qtrue;
-		p1 = RARRAY_CONST_PTR(ary1) + i;
-		p2 = RARRAY_CONST_PTR(ary2) + i;
-	    }
-	    else {
-		return Qfalse;
-	    }
-	}
-	p1++;
-	p2++;
+        if (*p1 != *p2) {
+            if (rb_equal(*p1, *p2)) {
+                len1 = RARRAY_LEN(ary1);
+                if (len1 != RARRAY_LEN(ary2))
+                    return Qfalse;
+                if (len1 < i)
+                    return Qtrue;
+                p1 = RARRAY_CONST_PTR(ary1) + i;
+                p2 = RARRAY_CONST_PTR(ary2) + i;
+            }
+            else {
+                return Qfalse;
+            }
+        }
+        p1++;
+        p2++;
     }
     return Qtrue;
 }
 
 /*
  *  call-seq:
- *     ary == other_ary   ->   bool
+ *    self == other_array -> true or false
  *
- *  Equality --- Two arrays are equal if they contain the same number of
- *  elements and if each element is equal to (according to Object#==) the
- *  corresponding element in +other_ary+.
+ *  Returns whether both:
  *
- *     [ "a", "c" ]    == [ "a", "c", 7 ]     #=> false
- *     [ "a", "c", 7 ] == [ "a", "c", 7 ]     #=> true
- *     [ "a", "c", 7 ] == [ "a", "d", "f" ]   #=> false
+ *  - +self+ and +other_array+ are the same size.
+ *  - Their corresponding elements are the same;
+ *    that is, for each index +i+ in <tt>(0...self.size)</tt>,
+ *    <tt>self[i] == other_array[i]</tt>.
  *
+ *  Examples:
+ *
+ *    [:foo, 'bar', 2] == [:foo, 'bar', 2]   # => true
+ *    [:foo, 'bar', 2] == [:foo, 'bar', 2.0] # => true
+ *    [:foo, 'bar', 2] == [:foo, 'bar']      # => false # Different sizes.
+ *    [:foo, 'bar', 2] == [:foo, 'bar', 3]   # => false # Different elements.
+ *
+ *  This method is different from method Array#eql?,
+ *  which compares elements using <tt>Object#eql?</tt>.
+ *
+ *  Related: see {Methods for Comparing}[rdoc-ref:Array@Methods+for+Comparing].
  */
 
 static VALUE
@@ -3811,10 +5379,10 @@ rb_ary_equal(VALUE ary1, VALUE ary2)
 {
     if (ary1 == ary2) return Qtrue;
     if (!RB_TYPE_P(ary2, T_ARRAY)) {
-	if (!rb_respond_to(ary2, idTo_ary)) {
-	    return Qfalse;
-	}
-	return rb_equal(ary2, ary1);
+        if (!rb_respond_to(ary2, idTo_ary)) {
+            return Qfalse;
+        }
+        return rb_equal(ary2, ary1);
     }
     if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
     if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
@@ -3828,18 +5396,29 @@ recursive_eql(VALUE ary1, VALUE ary2, int recur)
 
     if (recur) return Qtrue; /* Subtle! */
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
-	    return Qfalse;
+        if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+            return Qfalse;
     }
     return Qtrue;
 }
 
 /*
  *  call-seq:
- *     ary.eql?(other)  -> true or false
+ *    eql?(other_array) -> true or false
+ *
+ *  Returns +true+ if +self+ and +other_array+ are the same size,
+ *  and if, for each index +i+ in +self+, <tt>self[i].eql?(other_array[i])</tt>:
+ *
+ *    a0 = [:foo, 'bar', 2]
+ *    a1 = [:foo, 'bar', 2]
+ *    a1.eql?(a0) # => true
+ *
+ *  Otherwise, returns +false+.
  *
- *  Returns +true+ if +self+ and +other+ are the same object,
- *  or are both arrays with the same content (according to Object#eql?).
+ *  This method is different from method Array#==,
+ *  which compares using method <tt>Object#==</tt>.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
@@ -3852,45 +5431,67 @@ rb_ary_eql(VALUE ary1, VALUE ary2)
     return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
 }
 
+static VALUE
+ary_hash_values(long len, const VALUE *elements, const VALUE ary)
+{
+    long i;
+    st_index_t h;
+    VALUE n;
+
+    h = rb_hash_start(len);
+    h = rb_hash_uint(h, (st_index_t)rb_ary_hash_values);
+    for (i=0; i<len; i++) {
+        n = rb_hash(elements[i]);
+        h = rb_hash_uint(h, NUM2LONG(n));
+        if (ary) {
+            len = RARRAY_LEN(ary);
+            elements = RARRAY_CONST_PTR(ary);
+        }
+    }
+    h = rb_hash_end(h);
+    return ST2FIX(h);
+}
+
+VALUE
+rb_ary_hash_values(long len, const VALUE *elements)
+{
+    return ary_hash_values(len, elements, 0);
+}
+
 /*
  *  call-seq:
- *     ary.hash   -> fixnum
+ *    hash -> integer
+ *
+ *  Returns the integer hash value for +self+.
  *
- *  Compute a hash-code for this array.
+ *  Two arrays with the same content will have the same hash value
+ *  (and will compare using eql?):
  *
- *  Two arrays with the same content will have the same hash code (and will
- *  compare using #eql?).
+ *    ['a', 'b'].hash == ['a', 'b'].hash # => true
+ *    ['a', 'b'].hash == ['a', 'c'].hash # => false
+ *    ['a', 'b'].hash == ['a'].hash      # => false
  *
- *  See also Object#hash.
  */
 
 static VALUE
 rb_ary_hash(VALUE ary)
 {
-    long i;
-    st_index_t h;
-    VALUE n;
-
-    h = rb_hash_start(RARRAY_LEN(ary));
-    h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	n = rb_hash(RARRAY_AREF(ary, i));
-	h = rb_hash_uint(h, NUM2LONG(n));
-    }
-    h = rb_hash_end(h);
-    return LONG2FIX(h);
+    RBIMPL_ASSERT_OR_ASSUME(ary);
+    return ary_hash_values(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary), ary);
 }
 
 /*
  *  call-seq:
- *     ary.include?(object)   -> true or false
+ *    include?(object) -> true or false
+ *
+ *  Returns whether for some element +element+ in +self+,
+ *  <tt>object == element</tt>:
  *
- *  Returns +true+ if the given +object+ is present in +self+ (that is, if any
- *  element <code>==</code> +object+), otherwise returns +false+.
+ *    [0, 1, 2].include?(2)   # => true
+ *    [0, 1, 2].include?(2.0) # => true
+ *    [0, 1, 2].include?(2.1) # => false
  *
- *     a = [ "a", "b", "c" ]
- *     a.include?("b")   #=> true
- *     a.include?("z")   #=> false
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 VALUE
@@ -3900,18 +5501,28 @@ rb_ary_includes(VALUE ary, VALUE item)
     VALUE e;
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	e = RARRAY_AREF(ary, i);
-	switch (rb_equal_opt(e, item)) {
-	  case Qundef:
-	    if (rb_equal(e, item)) return Qtrue;
-	    break;
-	  case Qtrue:
-	    return Qtrue;
-	}
+        e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, item)) {
+            return Qtrue;
+        }
     }
     return Qfalse;
 }
 
+static VALUE
+rb_ary_includes_by_eql(VALUE ary, VALUE item)
+{
+    long i;
+    VALUE e;
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (rb_eql(item, e)) {
+            return Qtrue;
+        }
+    }
+    return Qfalse;
+}
 
 static VALUE
 recursive_cmp(VALUE ary1, VALUE ary2, int recur)
@@ -3921,46 +5532,54 @@ recursive_cmp(VALUE ary1, VALUE ary2, int recur)
     if (recur) return Qundef;	/* Subtle! */
     len = RARRAY_LEN(ary1);
     if (len > RARRAY_LEN(ary2)) {
-	len = RARRAY_LEN(ary2);
+        len = RARRAY_LEN(ary2);
     }
     for (i=0; i<len; i++) {
-	VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
-	VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
-	if (v != INT2FIX(0)) {
-	    return v;
-	}
+        VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
+        VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
+        if (v != INT2FIX(0)) {
+            return v;
+        }
     }
     return Qundef;
 }
 
 /*
  *  call-seq:
- *     ary <=> other_ary   ->  -1, 0, +1 or nil
+ *    self <=> other_array -> -1, 0, or 1
+ *
+ *  Returns -1, 0, or 1 as +self+ is determined
+ *  to be less than, equal to, or greater than +other_array+.
+ *
+ *  Iterates over each index +i+ in <tt>(0...self.size)</tt>:
+ *
+ *  - Computes <tt>result[i]</tt> as <tt>self[i] <=> other_array[i]</tt>.
+ *  - Immediately returns 1 if <tt>result[i]</tt> is 1:
+ *
+ *      [0, 1, 2] <=> [0, 0, 2] # => 1
+ *
+ *  - Immediately returns -1 if <tt>result[i]</tt> is -1:
  *
- *  Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
- *  array is less than, equal to, or greater than +other_ary+.
+ *      [0, 1, 2] <=> [0, 2, 2] # => -1
  *
- *  Each object in each array is compared (using the <=> operator).
+ *  - Continues if <tt>result[i]</tt> is 0.
  *
- *  Arrays are compared in an "element-wise" manner; the first element of +ary+
- *  is compared with the first one of +other_ary+ using the <=> operator, then
- *  each of the second elements, etc...
- *  As soon as the result of any such comparison is non zero (i.e. the two
- *  corresponding elements are not equal), that result is returned for the
- *  whole array comparison.
+ *  When every +result+ is 0,
+ *  returns <tt>self.size <=> other_array.size</tt>
+ *  (see Integer#<=>):
  *
- *  If all the elements are equal, then the result is based on a comparison of
- *  the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
- *  and only if, they have the same length and the value of each element is
- *  equal to the value of the corresponding element in the other array.
+ *    [0, 1, 2] <=> [0, 1]        # => 1
+ *    [0, 1, 2] <=> [0, 1, 2]     # => 0
+ *    [0, 1, 2] <=> [0, 1, 2, 3]  # => -1
  *
- *  +nil+ is returned if the +other_ary+ is not an array or if the comparison
- *  of two elements returned +nil+.
+ *  Note that when +other_array+ is larger than +self+,
+ *  its trailing elements do not affect the result:
  *
- *     [ "a", "a", "c" ]    <=> [ "a", "b", "c" ]   #=> -1
- *     [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ]            #=> +1
- *     [ 1, 2 ]             <=> [ 1, :two ]         #=> nil
+ *    [0, 1, 2] <=> [0, 1, 2, -3] # => -1
+ *    [0, 1, 2] <=> [0, 1, 2, 0]  # => -1
+ *    [0, 1, 2] <=> [0, 1, 2, 3]  # => -1
  *
+ *  Related: see {Methods for Comparing}[rdoc-ref:Array@Methods+for+Comparing].
  */
 
 VALUE
@@ -3973,7 +5592,7 @@ rb_ary_cmp(VALUE ary1, VALUE ary2)
     if (NIL_P(ary2)) return Qnil;
     if (ary1 == ary2) return INT2FIX(0);
     v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
-    if (v != Qundef) return v;
+    if (!UNDEF_P(v)) return v;
     len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
     if (len == 0) return INT2FIX(0);
     if (len > 0) return INT2FIX(1);
@@ -3986,18 +5605,17 @@ ary_add_hash(VALUE hash, VALUE ary)
     long i;
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	VALUE elt = RARRAY_AREF(ary, i);
-	if (rb_hash_lookup2(hash, elt, Qundef) == Qundef) {
-	    rb_hash_aset(hash, elt, elt);
-	}
+        VALUE elt = RARRAY_AREF(ary, i);
+        rb_hash_add_new_element(hash, elt, elt);
     }
     return hash;
 }
 
 static inline VALUE
-ary_tmp_hash_new(void)
+ary_tmp_hash_new(VALUE ary)
 {
-    VALUE hash = rb_hash_new();
+    long size = RARRAY_LEN(ary);
+    VALUE hash = rb_hash_new_with_size(size);
 
     RBASIC_CLEAR_CLASS(hash);
     return hash;
@@ -4006,7 +5624,7 @@ ary_tmp_hash_new(void)
 static VALUE
 ary_make_hash(VALUE ary)
 {
-    VALUE hash = ary_tmp_hash_new();
+    VALUE hash = ary_tmp_hash_new(ary);
     return ary_add_hash(hash, ary);
 }
 
@@ -4016,10 +5634,8 @@ ary_add_hash_by(VALUE hash, VALUE ary)
     long i;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
-	if (rb_hash_lookup2(hash, k, Qundef) == Qundef) {
-	    rb_hash_aset(hash, k, v);
-	}
+        VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+        rb_hash_add_new_element(hash, k, v);
     }
     return hash;
 }
@@ -4027,70 +5643,134 @@ ary_add_hash_by(VALUE hash, VALUE ary)
 static VALUE
 ary_make_hash_by(VALUE ary)
 {
-    VALUE hash = ary_tmp_hash_new();
+    VALUE hash = ary_tmp_hash_new(ary);
     return ary_add_hash_by(hash, ary);
 }
 
-static inline void
-ary_recycle_hash(VALUE hash)
-{
-    if (RHASH(hash)->ntbl) {
-	st_table *tbl = RHASH(hash)->ntbl;
-	RHASH(hash)->ntbl = 0;
-	st_free_table(tbl);
-    }
-    RB_GC_GUARD(hash);
-}
-
 /*
  *  call-seq:
- *     ary - other_ary    -> new_ary
- *
- *  Array Difference
+ *    self - other_array -> new_array
  *
- *  Returns a new array that is a copy of the original array, removing any
- *  items that also appear in +other_ary+. The order is preserved from the
- *  original array.
+ *  Returns a new array containing only those elements of +self+
+ *  that are not found in +other_array+;
+ *  the order from +self+ is preserved:
  *
- *  It compares elements using their #hash and #eql? methods for efficiency.
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1] - [1]             # => [0, 2, 3]
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1] - [3, 2, 0, :foo] # => [1, 1, 1, 1, 1, 1]
+ *    [0, 1, 2] - [:foo]                            # => [0, 1, 2]
  *
- *     [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ]  #=>  [ 3, 3, 5 ]
+ *  Element are compared using method <tt>#eql?</tt>
+ *  (as defined in each element of +self+).
  *
- *  If you need set-like behavior, see the library class Set.
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
-static VALUE
+VALUE
 rb_ary_diff(VALUE ary1, VALUE ary2)
 {
     VALUE ary3;
     VALUE hash;
     long i;
 
-    hash = ary_make_hash(to_ary(ary2));
+    ary2 = to_ary(ary2);
+    if (RARRAY_LEN(ary2) == 0) { return ary_make_shared_copy(ary1); }
     ary3 = rb_ary_new();
 
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN || RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            VALUE elt = rb_ary_elt(ary1, i);
+            if (rb_ary_includes_by_eql(ary2, elt)) continue;
+            rb_ary_push(ary3, elt);
+        }
+        return ary3;
+    }
+
+    hash = ary_make_hash(ary2);
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-	if (st_lookup(rb_hash_tbl_raw(hash), RARRAY_AREF(ary1, i), 0)) continue;
-	rb_ary_push(ary3, rb_ary_elt(ary1, i));
+        if (rb_hash_stlike_lookup(hash, RARRAY_AREF(ary1, i), NULL)) continue;
+        rb_ary_push(ary3, rb_ary_elt(ary1, i));
     }
-    ary_recycle_hash(hash);
+
     return ary3;
 }
 
 /*
  *  call-seq:
- *     ary & other_ary      -> new_ary
+ *    difference(*other_arrays = []) -> new_array
  *
- *  Set Intersection --- Returns a new array containing elements common to the
- *  two arrays, excluding any duplicates. The order is preserved from the
- *  original array.
+ *  Returns a new array containing only those elements from +self+
+ *  that are not found in any of the given +other_arrays+;
+ *  items are compared using <tt>eql?</tt>;  order from +self+ is preserved:
  *
- *  It compares elements using their #hash and #eql? methods for efficiency.
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1].difference([1]) # => [0, 2, 3]
+ *    [0, 1, 2, 3].difference([3, 0], [1, 3])     # => [2]
+ *    [0, 1, 2].difference([4])                   # => [0, 1, 2]
+ *    [0, 1, 2].difference                        # => [0, 1, 2]
  *
- *     [ 1, 1, 3, 5 ] & [ 1, 2, 3 ]                 #=> [ 1, 3 ]
- *     [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ]   #=> [ 'a', 'b' ]
+ *  Returns a copy of +self+ if no arguments are given.
  *
- *  See also Array#uniq.
+ *  Related: Array#-;
+ *  see also {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_difference_multi(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE ary_diff;
+    long i, length;
+    volatile VALUE t0;
+    bool *is_hash = ALLOCV_N(bool, t0, argc);
+    ary_diff = rb_ary_new();
+    length = RARRAY_LEN(ary);
+
+    for (i = 0; i < argc; i++) {
+        argv[i] = to_ary(argv[i]);
+        is_hash[i] = (length > SMALL_ARRAY_LEN && RARRAY_LEN(argv[i]) > SMALL_ARRAY_LEN);
+        if (is_hash[i]) argv[i] = ary_make_hash(argv[i]);
+    }
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        int j;
+        VALUE elt = rb_ary_elt(ary, i);
+        for (j = 0; j < argc; j++) {
+            if (is_hash[j]) {
+                if (rb_hash_stlike_lookup(argv[j], elt, NULL))
+                    break;
+            }
+            else {
+                if (rb_ary_includes_by_eql(argv[j], elt)) break;
+            }
+        }
+        if (j == argc) rb_ary_push(ary_diff, elt);
+    }
+
+    ALLOCV_END(t0);
+
+    return ary_diff;
+}
+
+
+/*
+ *  call-seq:
+ *    self & other_array -> new_array
+ *
+ *  Returns a new array containing the _intersection_ of +self+ and +other_array+;
+ *  that is, containing those elements found in both +self+ and +other_array+:
+ *
+ *    [0, 1, 2, 3] & [1, 2] # => [1, 2]
+ *
+ *  Omits duplicates:
+ *
+ *    [0, 1, 1, 0] & [0, 1] # => [0, 1]
+ *
+ *  Preserves order from +self+:
+ *
+ *    [0, 1, 2] & [3, 2, 1, 0] # => [0, 1, 2]
+ *
+ *  Identifies common elements using method <tt>#eql?</tt>
+ *  (as defined in each element of +self+).
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 
@@ -4098,28 +5778,70 @@ static VALUE
 rb_ary_and(VALUE ary1, VALUE ary2)
 {
     VALUE hash, ary3, v;
-    st_table *table;
     st_data_t vv;
     long i;
 
     ary2 = to_ary(ary2);
     ary3 = rb_ary_new();
-    if (RARRAY_LEN(ary2) == 0) return ary3;
+    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return ary3;
+
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            v = RARRAY_AREF(ary1, i);
+            if (!rb_ary_includes_by_eql(ary2, v)) continue;
+            if (rb_ary_includes_by_eql(ary3, v)) continue;
+            rb_ary_push(ary3, v);
+        }
+        return ary3;
+    }
+
     hash = ary_make_hash(ary2);
-    table = rb_hash_tbl_raw(hash);
 
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-	v = RARRAY_AREF(ary1, i);
-	vv = (st_data_t)v;
-	if (st_delete(table, &vv, 0)) {
-	    rb_ary_push(ary3, v);
-	}
+        v = RARRAY_AREF(ary1, i);
+        vv = (st_data_t)v;
+        if (rb_hash_stlike_delete(hash, &vv, 0)) {
+            rb_ary_push(ary3, v);
+        }
     }
-    ary_recycle_hash(hash);
 
     return ary3;
 }
 
+/*
+ *  call-seq:
+ *    intersection(*other_arrays) -> new_array
+ *
+ *  Returns a new array containing each element in +self+ that is +#eql?+
+ *  to at least one element in each of the given +other_arrays+;
+ *  duplicates are omitted:
+ *
+ *    [0, 0, 1, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
+ *
+ *  Each element must correctly implement method <tt>#hash</tt>.
+ *
+ *  Order from +self+ is preserved:
+ *
+ *    [0, 1, 2].intersection([2, 1, 0]) # => [0, 1, 2]
+ *
+ *  Returns a copy of +self+ if no arguments are given.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_intersection_multi(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result = rb_ary_dup(ary);
+    int i;
+
+    for (i = 0; i < argc; i++) {
+        result = rb_ary_and(result, argv[i]);
+    }
+
+    return result;
+}
+
 static int
 ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
 {
@@ -4128,75 +5850,588 @@ ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
     return ST_CONTINUE;
 }
 
+static void
+rb_ary_union(VALUE ary_union, VALUE ary)
+{
+    long i;
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        VALUE elt = rb_ary_elt(ary, i);
+        if (rb_ary_includes_by_eql(ary_union, elt)) continue;
+        rb_ary_push(ary_union, elt);
+    }
+}
+
+static void
+rb_ary_union_hash(VALUE hash, VALUE ary2)
+{
+    long i;
+    for (i = 0; i < RARRAY_LEN(ary2); i++) {
+        VALUE elt = RARRAY_AREF(ary2, i);
+        if (!rb_hash_stlike_update(hash, (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+            RB_OBJ_WRITTEN(hash, Qundef, elt);
+        }
+    }
+}
+
 /*
  *  call-seq:
- *     ary | other_ary     -> new_ary
- *
- *  Set Union --- Returns a new array by joining +ary+ with +other_ary+,
- *  excluding any duplicates and preserving the order from the original array.
+ *    self | other_array -> new_array
  *
- *  It compares elements using their #hash and #eql? methods for efficiency.
+ *  Returns the union of +self+ and +other_array+;
+ *  duplicates are removed; order is preserved;
+ *  items are compared using <tt>eql?</tt>:
  *
- *     [ "a", "b", "c" ] | [ "c", "d", "a" ]    #=> [ "a", "b", "c", "d" ]
+ *    [0, 1] | [2, 3] # => [0, 1, 2, 3]
+ *    [0, 1, 1] | [2, 2, 3] # => [0, 1, 2, 3]
+ *    [0, 1, 2] | [3, 2, 1, 0] # => [0, 1, 2, 3]
  *
- *  See also Array#uniq.
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 static VALUE
 rb_ary_or(VALUE ary1, VALUE ary2)
 {
-    VALUE hash, ary3;
-    long i;
+    VALUE hash;
 
     ary2 = to_ary(ary2);
+    if (RARRAY_LEN(ary1) + RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        VALUE ary3 = rb_ary_new();
+        rb_ary_union(ary3, ary1);
+        rb_ary_union(ary3, ary2);
+        return ary3;
+    }
+
     hash = ary_make_hash(ary1);
+    rb_ary_union_hash(hash, ary2);
+
+    return rb_hash_values(hash);
+}
+
+/*
+ *  call-seq:
+ *    union(*other_arrays) -> new_array
+ *
+ *  Returns a new array that is the union of the elements of +self+
+ *  and all given arrays +other_arrays+;
+ *  items are compared using <tt>eql?</tt>:
+ *
+ *    [0, 1, 2, 3].union([4, 5], [6, 7]) # => [0, 1, 2, 3, 4, 5, 6, 7]
+ *
+ *  Removes duplicates (preserving the first found):
+ *
+ *    [0, 1, 1].union([2, 1], [3, 1]) # => [0, 1, 2, 3]
+ *
+ *  Preserves order (preserving the position of the first found):
+ *
+ *    [3, 2, 1, 0].union([5, 3], [4, 2]) # => [3, 2, 1, 0, 5, 4]
+ *
+ *  With no arguments given, returns a copy of +self+.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_union_multi(int argc, VALUE *argv, VALUE ary)
+{
+    int i;
+    long sum;
+    VALUE hash;
 
-    for (i=0; i<RARRAY_LEN(ary2); i++) {
-	VALUE elt = RARRAY_AREF(ary2, i);
-	if (!st_update(RHASH_TBL_RAW(hash), (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
-	    RB_OBJ_WRITTEN(hash, Qundef, elt);
-	}
+    sum = RARRAY_LEN(ary);
+    for (i = 0; i < argc; i++) {
+        argv[i] = to_ary(argv[i]);
+        sum += RARRAY_LEN(argv[i]);
     }
-    ary3 = rb_hash_values(hash);
-    ary_recycle_hash(hash);
-    return ary3;
+
+    if (sum <= SMALL_ARRAY_LEN) {
+        VALUE ary_union = rb_ary_new();
+
+        rb_ary_union(ary_union, ary);
+        for (i = 0; i < argc; i++) rb_ary_union(ary_union, argv[i]);
+
+        return ary_union;
+    }
+
+    hash = ary_make_hash(ary);
+    for (i = 0; i < argc; i++) rb_ary_union_hash(hash, argv[i]);
+
+    return rb_hash_values(hash);
 }
 
-static int
-push_value(st_data_t key, st_data_t val, st_data_t ary)
+/*
+ *  call-seq:
+ *    intersect?(other_array) -> true or false
+ *
+ *  Returns whether +other_array+ has at least one element that is +#eql?+ to some element of +self+:
+ *
+ *    [1, 2, 3].intersect?([3, 4, 5]) # => true
+ *    [1, 2, 3].intersect?([4, 5, 6]) # => false
+ *
+ *  Each element must correctly implement method <tt>#hash</tt>.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_intersect_p(VALUE ary1, VALUE ary2)
 {
-    rb_ary_push((VALUE)ary, (VALUE)val);
-    return ST_CONTINUE;
+    VALUE hash, v, result, shorter, longer;
+    st_data_t vv;
+    long i;
+
+    ary2 = to_ary(ary2);
+    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return Qfalse;
+
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            v = RARRAY_AREF(ary1, i);
+            if (rb_ary_includes_by_eql(ary2, v)) return Qtrue;
+        }
+        return Qfalse;
+    }
+
+    shorter = ary1;
+    longer = ary2;
+    if (RARRAY_LEN(ary1) > RARRAY_LEN(ary2)) {
+        longer = ary1;
+        shorter = ary2;
+    }
+
+    hash = ary_make_hash(shorter);
+    result = Qfalse;
+
+    for (i=0; i<RARRAY_LEN(longer); i++) {
+        v = RARRAY_AREF(longer, i);
+        vv = (st_data_t)v;
+        if (rb_hash_stlike_lookup(hash, vv, 0)) {
+            result = Qtrue;
+            break;
+        }
+    }
+
+    return result;
+}
+
+static VALUE
+ary_max_generic(VALUE ary, long i, VALUE vmax)
+{
+    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+    VALUE v;
+    for (; i < RARRAY_LEN(ary); ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (rb_cmpint(rb_funcallv(vmax, id_cmp, 1, &v), vmax, v) < 0) {
+            vmax = v;
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_fixnum(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(FIXNUM_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (FIXNUM_P(v)) {
+            if ((long)vmax < (long)v) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_float(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (RB_FLOAT_TYPE_P(v)) {
+            if (rb_float_cmp(vmax, v) < 0) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_string(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(STRING_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (STRING_P(v)) {
+            if (rb_str_cmp(vmax, v) < 0) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
 }
 
 /*
  *  call-seq:
- *     ary.uniq!                -> ary or nil
- *     ary.uniq! { |item| ... } -> ary or nil
+ *    max -> element
+ *    max(count) -> new_array
+ *    max {|a, b| ... } -> element
+ *    max(count) {|a, b| ... } -> new_array
+ *
+ *  Returns one of the following:
+ *
+ *  - The maximum-valued element from +self+.
+ *  - A new array of maximum-valued elements from +self+.
+ *
+ *  Does not modify +self+.
  *
- *  Removes duplicate elements from +self+.
+ *  With no block given, each element in +self+ must respond to method <tt>#<=></tt>
+ *  with a numeric.
  *
- *  If a block is given, it will use the return value of the block for
- *  comparison.
+ *  With no argument and no block, returns the element in +self+
+ *  having the maximum value per method <tt>#<=></tt>:
  *
- *  It compares values using their #hash and #eql? methods for efficiency.
+ *    [1, 0, 3, 2].max # => 3
  *
- *  +self+ is traversed in order, and the first occurrence is kept.
+ *  With non-negative numeric argument +count+ and no block,
+ *  returns a new array with at most +count+ elements,
+ *  in descending order, per method <tt>#<=></tt>:
  *
- *  Returns +nil+ if no changes are made (that is, no duplicates are found).
+ *    [1, 0, 3, 2].max(3)   # => [3, 2, 1]
+ *    [1, 0, 3, 2].max(3.0) # => [3, 2, 1]
+ *    [1, 0, 3, 2].max(9)   # => [3, 2, 1, 0]
+ *    [1, 0, 3, 2].max(0)   # => []
  *
- *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq!   # => ["a", "b", "c"]
+ *  With a block given, the block must return a numeric.
  *
- *     b = [ "a", "b", "c" ]
- *     b.uniq!   # => nil
+ *  With a block and no argument, calls the block <tt>self.size - 1</tt> times to compare elements;
+ *  returns the element having the maximum value per the block:
  *
- *     c = [["student","sam"], ["student","george"], ["teacher","matz"]]
- *     c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *    ['0', '', '000', '00'].max {|a, b| a.size <=> b.size }
+ *    # => "000"
  *
+ *  With non-negative numeric argument +count+ and a block,
+ *  returns a new array with at most +count+ elements,
+ *  in descending order, per the block:
+ *
+ *    ['0', '', '000', '00'].max(2) {|a, b| a.size <=> b.size }
+ *    # => ["000", "00"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
+static VALUE
+rb_ary_max(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result = Qundef, v;
+    VALUE num;
+    long i;
+
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+       return rb_nmin_run(ary, num, 0, 1, 1);
+
+    const long n = RARRAY_LEN(ary);
+    if (rb_block_given_p()) {
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+           v = RARRAY_AREF(ary, i);
+           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
+               result = v;
+           }
+        }
+    }
+    else if (n > 0) {
+        result = RARRAY_AREF(ary, 0);
+        if (n > 1) {
+            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+                return ary_max_opt_fixnum(ary, 1, result);
+            }
+            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+                return ary_max_opt_string(ary, 1, result);
+            }
+            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+                return ary_max_opt_float(ary, 1, result);
+            }
+            else {
+                return ary_max_generic(ary, 1, result);
+            }
+        }
+    }
+    if (UNDEF_P(result)) return Qnil;
+    return result;
+}
+
+static VALUE
+ary_min_generic(VALUE ary, long i, VALUE vmin)
+{
+    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+    VALUE v;
+    for (; i < RARRAY_LEN(ary); ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (rb_cmpint(rb_funcallv(vmin, id_cmp, 1, &v), vmin, v) > 0) {
+            vmin = v;
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_fixnum(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(FIXNUM_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (FIXNUM_P(a)) {
+            if ((long)vmin > (long)a) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_float(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (RB_FLOAT_TYPE_P(a)) {
+            if (rb_float_cmp(vmin, a) > 0) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
 
 static VALUE
+ary_min_opt_string(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(STRING_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (STRING_P(a)) {
+            if (rb_str_cmp(vmin, a) > 0) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
+/*
+ *  call-seq:
+ *    min -> element
+ *    min(count) -> new_array
+ *    min {|a, b| ... } -> element
+ *    min(count) {|a, b| ... } -> new_array
+ *
+ *  Returns one of the following:
+ *
+ *  - The minimum-valued element from +self+.
+ *  - A new array of minimum-valued elements from +self+.
+ *
+ *  Does not modify +self+.
+ *
+ *  With no block given, each element in +self+ must respond to method <tt>#<=></tt>
+ *  with a numeric.
+ *
+ *  With no argument and no block, returns the element in +self+
+ *  having the minimum value per method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].min # => 0
+ *
+ *  With non-negative numeric argument +count+ and no block,
+ *  returns a new array with at most +count+ elements,
+ *  in ascending order, per method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].min(3)   # => [0, 1, 2]
+ *    [1, 0, 3, 2].min(3.0) # => [0, 1, 2]
+ *    [1, 0, 3, 2].min(9)   # => [0, 1, 2, 3]
+ *    [1, 0, 3, 2].min(0)   # => []
+ *
+ *  With a block given, the block must return a numeric.
+ *
+ *  With a block and no argument, calls the block <tt>self.size - 1</tt> times to compare elements;
+ *  returns the element having the minimum value per the block:
+ *
+ *    ['0', '', '000', '00'].min {|a, b| a.size <=> b.size }
+ *    # => ""
+ *
+ *  With non-negative numeric argument +count+ and a block,
+ *  returns a new array with at most +count+ elements,
+ *  in ascending order, per the block:
+ *
+ *    ['0', '', '000', '00'].min(2) {|a, b| a.size <=> b.size }
+ *    # => ["", "0"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+static VALUE
+rb_ary_min(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result = Qundef, v;
+    VALUE num;
+    long i;
+
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+       return rb_nmin_run(ary, num, 0, 0, 1);
+
+    const long n = RARRAY_LEN(ary);
+    if (rb_block_given_p()) {
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+           v = RARRAY_AREF(ary, i);
+           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
+               result = v;
+           }
+        }
+    }
+    else if (n > 0) {
+        result = RARRAY_AREF(ary, 0);
+        if (n > 1) {
+            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+                return ary_min_opt_fixnum(ary, 1, result);
+            }
+            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+                return ary_min_opt_string(ary, 1, result);
+            }
+            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+                return ary_min_opt_float(ary, 1, result);
+            }
+            else {
+                return ary_min_generic(ary, 1, result);
+            }
+        }
+    }
+    if (UNDEF_P(result)) return Qnil;
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    minmax -> array
+ *    minmax {|a, b| ... } -> array
+ *
+ *  Returns a 2-element array containing the minimum-valued and maximum-valued
+ *  elements from +self+;
+ *  does not modify +self+.
+ *
+ *  With no block given, the minimum and maximum values are determined using method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].minmax # => [0, 3]
+ *
+ *  With a block given, the block must return a numeric;
+ *  the block is called <tt>self.size - 1</tt> times to compare elements;
+ *  returns the elements having the minimum and maximum values per the block:
+ *
+ *    ['0', '', '000', '00'].minmax {|a, b| a.size <=> b.size }
+ *    # => ["", "000"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+static VALUE
+rb_ary_minmax(VALUE ary)
+{
+    if (rb_block_given_p()) {
+        return rb_call_super(0, NULL);
+    }
+    return rb_assoc_new(rb_ary_min(0, 0, ary), rb_ary_max(0, 0, ary));
+}
+
+static int
+push_value(st_data_t key, st_data_t val, st_data_t ary)
+{
+    rb_ary_push((VALUE)ary, (VALUE)val);
+    return ST_CONTINUE;
+}
+
+/*
+ *  call-seq:
+ *    uniq! -> self or nil
+ *    uniq! {|element| ... } -> self or nil
+ *
+ *  Removes duplicate elements from +self+, the first occurrence always being retained;
+ *  returns +self+ if any elements removed, +nil+ otherwise.
+ *
+ *  With no block given, identifies and removes elements using method <tt>eql?</tt>
+ *  to compare elements:
+ *
+ *    a = [0, 0, 1, 1, 2, 2]
+ *    a.uniq! # => [0, 1, 2]
+ *    a.uniq! # => nil
+ *
+ *  With a block given, calls the block for each element;
+ *  identifies and omits "duplicate" elements using method <tt>eql?</tt>
+ *  to compare <i>block return values</i>;
+ *  that is, an element is a duplicate if its block return value
+ *  is the same as that of a previous element:
+ *
+ *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ *    a.uniq! {|element| element.size } # => ["a", "aa", "aaa"]
+ *    a.uniq! {|element| element.size } # => nil
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+static VALUE
 rb_ary_uniq_bang(VALUE ary)
 {
     VALUE hash;
@@ -4206,46 +6441,50 @@ rb_ary_uniq_bang(VALUE ary)
     if (RARRAY_LEN(ary) <= 1)
         return Qnil;
     if (rb_block_given_p())
-	hash = ary_make_hash_by(ary);
+        hash = ary_make_hash_by(ary);
     else
-	hash = ary_make_hash(ary);
+        hash = ary_make_hash(ary);
 
     hash_size = RHASH_SIZE(hash);
     if (RARRAY_LEN(ary) == hash_size) {
-	return Qnil;
+        return Qnil;
     }
     rb_ary_modify_check(ary);
     ARY_SET_LEN(ary, 0);
-    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
-	rb_ary_unshare(ary);
-	FL_SET_EMBED(ary);
+    if (ARY_SHARED_P(ary)) {
+        rb_ary_unshare(ary);
+        FL_SET_EMBED(ary);
     }
     ary_resize_capa(ary, hash_size);
-    st_foreach(rb_hash_tbl_raw(hash), push_value, ary);
-    ary_recycle_hash(hash);
+    rb_hash_foreach(hash, push_value, ary);
 
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.uniq                -> new_ary
- *     ary.uniq { |item| ... } -> new_ary
+ *    uniq -> new_array
+ *    uniq {|element| ... } -> new_array
  *
- *  Returns a new array by removing duplicate values in +self+.
+ *  Returns a new array containing those elements from +self+ that are not duplicates,
+ *  the first occurrence always being retained.
  *
- *  If a block is given, it will use the return value of the block for comparison.
+ *  With no block given, identifies and omits duplicate elements using method <tt>eql?</tt>
+ *  to compare elements:
  *
- *  It compares values using their #hash and #eql? methods for efficiency.
+ *    a = [0, 0, 1, 1, 2, 2]
+ *    a.uniq # => [0, 1, 2]
  *
- *  +self+ is traversed in order, and the first occurrence is kept.
+ *  With a block given, calls the block for each element;
+ *  identifies and omits "duplicate" elements using method <tt>eql?</tt>
+ *  to compare <i>block return values</i>;
+ *  that is, an element is a duplicate if its block return value
+ *  is the same as that of a previous element:
  *
- *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq   # => ["a", "b", "c"]
- *
- *     b = [["student","sam"], ["student","george"], ["teacher","matz"]]
- *     b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ *    a.uniq {|element| element.size } # => ["a", "aa", "aaa"]
  *
+ *  Related: {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -4253,32 +6492,36 @@ rb_ary_uniq(VALUE ary)
 {
     VALUE hash, uniq;
 
-    if (RARRAY_LEN(ary) <= 1)
-        return rb_ary_dup(ary);
-    if (rb_block_given_p()) {
-	hash = ary_make_hash_by(ary);
-	uniq = rb_hash_values(hash);
+    if (RARRAY_LEN(ary) <= 1) {
+        hash = 0;
+        uniq = rb_ary_dup(ary);
+    }
+    else if (rb_block_given_p()) {
+        hash = ary_make_hash_by(ary);
+        uniq = rb_hash_values(hash);
     }
     else {
-	hash = ary_make_hash(ary);
-	uniq = rb_hash_values(hash);
+        hash = ary_make_hash(ary);
+        uniq = rb_hash_values(hash);
     }
-    RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
-    ary_recycle_hash(hash);
 
     return uniq;
 }
 
 /*
  *  call-seq:
- *     ary.compact!    -> ary  or  nil
+ *    compact! -> self or nil
  *
- *  Removes +nil+ elements from the array.
+ *  Removes all +nil+ elements from +self+;
+ *  Returns +self+ if any elements are removed, +nil+ otherwise:
  *
- *  Returns +nil+ if no changes were made, otherwise returns the array.
+ *    a = [nil, 0, nil, false, nil, '', nil, [], nil, {}]
+ *    a.compact! # => [0, false, "", [], {}]
+ *    a          # => [0, false, "", [], {}]
+ *    a.compact! # => nil
  *
- *     [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
- *     [ "a", "b", "c" ].compact!           #=> nil
+ *  Related: Array#compact;
+ *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -4292,12 +6535,12 @@ rb_ary_compact_bang(VALUE ary)
     end = p + RARRAY_LEN(ary);
 
     while (t < end) {
-	if (NIL_P(*t)) t++;
-	else *p++ = *t++;
+        if (NIL_P(*t)) t++;
+        else *p++ = *t++;
     }
     n = p - RARRAY_CONST_PTR(ary);
     if (RARRAY_LEN(ary) == n) {
-	return Qnil;
+        return Qnil;
     }
     ary_resize_smaller(ary, n);
 
@@ -4306,12 +6549,16 @@ rb_ary_compact_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.compact     -> new_ary
+ *    compact -> new_array
+ *
+ *  Returns a new array containing only the non-+nil+ elements from +self+;
+ *  element order is preserved:
  *
- *  Returns a copy of +self+ with all +nil+ elements removed.
+ *    a = [nil, 0, nil, false, nil, '', nil, [], nil, {}]
+ *    a.compact # => [0, false, "", [], {}]
  *
- *     [ "a", nil, "b", nil, "c", nil ].compact
- *                       #=> [ "a", "b", "c" ]
+ *  Related: Array#compact!;
+ *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -4324,23 +6571,29 @@ rb_ary_compact(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.count                   -> int
- *     ary.count(obj)              -> int
- *     ary.count { |item| block }  -> int
+ *    count -> integer
+ *    count(object) -> integer
+ *    count {|element| ... } -> integer
+ *
+ *  Returns a count of specified elements.
+ *
+ *  With no argument and no block, returns the count of all elements:
+ *
+ *    [0, :one, 'two', 3, 3.0].count # => 5
  *
- *  Returns the number of elements.
+ *  With argument +object+ given, returns the count of elements <tt>==</tt> to +object+:
  *
- *  If an argument is given, counts the number of elements which equal +obj+
- *  using <code>==</code>.
+ *    [0, :one, 'two', 3, 3.0].count(3) # => 2
  *
- *  If a block is given, counts the number of elements for which the block
- *  returns a true value.
+ *  With no argument and a block given, calls the block with each element;
+ *  returns the count of elements for which the block returns a truthy value:
  *
- *     ary = [1, 2, 4, 2]
- *     ary.count                  #=> 4
- *     ary.count(2)               #=> 2
- *     ary.count { |x| x%2 == 0 } #=> 3
+ *    [0, 1, 2, 3].count {|element| element > 1 } # => 2
  *
+ *  With argument +object+ and a block given, issues a warning, ignores the block,
+ *  and returns the count of elements <tt>==</tt> to +object+.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
@@ -4348,108 +6601,149 @@ rb_ary_count(int argc, VALUE *argv, VALUE ary)
 {
     long i, n = 0;
 
-    if (argc == 0) {
-	VALUE v;
+    if (rb_check_arity(argc, 0, 1) == 0) {
+        VALUE v;
 
-	if (!rb_block_given_p())
-	    return LONG2NUM(RARRAY_LEN(ary));
+        if (!rb_block_given_p())
+            return LONG2NUM(RARRAY_LEN(ary));
 
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    v = RARRAY_AREF(ary, i);
-	    if (RTEST(rb_yield(v))) n++;
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            v = RARRAY_AREF(ary, i);
+            if (RTEST(rb_yield(v))) n++;
+        }
     }
     else {
-	VALUE obj;
+        VALUE obj = argv[0];
 
-	rb_scan_args(argc, argv, "1", &obj);
-	if (rb_block_given_p()) {
-	    rb_warn("given block not used");
-	}
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
-	}
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
+        }
     }
 
     return LONG2NUM(n);
 }
 
 static VALUE
-flatten(VALUE ary, int level, int *modified)
+flatten(VALUE ary, int level)
 {
-    long i = 0;
-    VALUE stack, result, tmp, elt;
-    st_table *memo;
-    st_data_t id;
+    long i;
+    VALUE stack, result, tmp = 0, elt;
+    VALUE memo = Qfalse;
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        elt = RARRAY_AREF(ary, i);
+        tmp = rb_check_array_type(elt);
+        if (!NIL_P(tmp)) {
+            break;
+        }
+    }
+    if (i == RARRAY_LEN(ary)) {
+        return ary;
+    }
 
-    stack = ary_new(0, ARY_DEFAULT_SIZE);
     result = ary_new(0, RARRAY_LEN(ary));
-    memo = st_init_numtable();
-    st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
-    *modified = 0;
+    ary_memcpy(result, 0, i, RARRAY_CONST_PTR(ary));
+    ARY_SET_LEN(result, i);
+
+    stack = ary_new(0, ARY_DEFAULT_SIZE);
+    rb_ary_push(stack, ary);
+    rb_ary_push(stack, LONG2NUM(i + 1));
+
+    if (level < 0) {
+        memo = rb_obj_hide(rb_ident_hash_new());
+        rb_hash_aset(memo, ary, Qtrue);
+        rb_hash_aset(memo, tmp, Qtrue);
+    }
+
+    ary = tmp;
+    i = 0;
 
     while (1) {
-	while (i < RARRAY_LEN(ary)) {
-	    elt = RARRAY_AREF(ary, i++);
-	    if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
-		rb_ary_push(result, elt);
-		continue;
-	    }
-	    tmp = rb_check_array_type(elt);
-	    if (RBASIC(result)->klass) {
-		rb_raise(rb_eRuntimeError, "flatten reentered");
-	    }
-	    if (NIL_P(tmp)) {
-		rb_ary_push(result, elt);
-	    }
-	    else {
-		*modified = 1;
-		id = (st_data_t)tmp;
-		if (st_lookup(memo, id, 0)) {
-		    st_free_table(memo);
-		    rb_raise(rb_eArgError, "tried to flatten recursive array");
-		}
-		st_insert(memo, id, (st_data_t)Qtrue);
-		rb_ary_push(stack, ary);
-		rb_ary_push(stack, LONG2NUM(i));
-		ary = tmp;
-		i = 0;
-	    }
-	}
-	if (RARRAY_LEN(stack) == 0) {
-	    break;
-	}
-	id = (st_data_t)ary;
-	st_delete(memo, &id, 0);
-	tmp = rb_ary_pop(stack);
-	i = NUM2LONG(tmp);
-	ary = rb_ary_pop(stack);
-    }
-
-    st_free_table(memo);
-
-    RBASIC_SET_CLASS(result, rb_class_of(ary));
+        while (i < RARRAY_LEN(ary)) {
+            elt = RARRAY_AREF(ary, i++);
+            if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
+                rb_ary_push(result, elt);
+                continue;
+            }
+            tmp = rb_check_array_type(elt);
+            if (RBASIC(result)->klass) {
+                if (RTEST(memo)) {
+                    rb_hash_clear(memo);
+                }
+                rb_raise(rb_eRuntimeError, "flatten reentered");
+            }
+            if (NIL_P(tmp)) {
+                rb_ary_push(result, elt);
+            }
+            else {
+                if (memo) {
+                    if (rb_hash_aref(memo, tmp) == Qtrue) {
+                        rb_hash_clear(memo);
+                        rb_raise(rb_eArgError, "tried to flatten recursive array");
+                    }
+                    rb_hash_aset(memo, tmp, Qtrue);
+                }
+                rb_ary_push(stack, ary);
+                rb_ary_push(stack, LONG2NUM(i));
+                ary = tmp;
+                i = 0;
+            }
+        }
+        if (RARRAY_LEN(stack) == 0) {
+            break;
+        }
+        if (memo) {
+            rb_hash_delete(memo, ary);
+        }
+        tmp = rb_ary_pop(stack);
+        i = NUM2LONG(tmp);
+        ary = rb_ary_pop(stack);
+    }
+
+    if (memo) {
+        rb_hash_clear(memo);
+    }
+
+    RBASIC_SET_CLASS(result, rb_cArray);
     return result;
 }
 
 /*
  *  call-seq:
- *     ary.flatten!        -> ary or nil
- *     ary.flatten!(level) -> ary or nil
+ *    flatten!(depth = nil) -> self or nil
+ *
+ *  Returns +self+ as a recursively flattening of +self+ to +depth+ levels of recursion;
+ *  +depth+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects],
+ *  or +nil+.
+ *  At each level of recursion:
+ *
+ *  - Each element that is an array is "flattened"
+ *    (that is, replaced by its individual array elements).
+ *  - Each element that is not an array is unchanged
+ *    (even if the element is an object that has instance method +flatten+).
+ *
+ *  Returns +nil+ if no elements were flattened.
+ *
+ *  With non-negative integer argument +depth+, flattens recursively through +depth+ levels:
  *
- *  Flattens +self+ in place.
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5, {foo: 0}, Set.new([6, 7]) ]
+ *    a                   # => [0, [1, [2, 3], 4], 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(1)   # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(1.1) # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(2)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(3)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
  *
- *  Returns +nil+ if no modifications were made (i.e., the array contains no
- *  subarrays.)
+ *  With +nil+ or negative argument +depth+, flattens all levels:
  *
- *  The optional +level+ argument determines the level of recursion to flatten.
+ *    a.dup.flatten!     # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(-1) # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
  *
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten!   #=> [1, 2, 3, 4, 5]
- *     a.flatten!   #=> nil
- *     a            #=> [1, 2, 3, 4, 5]
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten!(1) #=> [1, 2, 3, [4, 5]]
+ *  Related: Array#flatten;
+ *  see also {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -4458,17 +6752,16 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
     int mod = 0, level = -1;
     VALUE result, lv;
 
-    rb_scan_args(argc, argv, "01", &lv);
+    lv = (rb_check_arity(argc, 0, 1) ? argv[0] : Qnil);
     rb_ary_modify_check(ary);
     if (!NIL_P(lv)) level = NUM2INT(lv);
     if (level == 0) return Qnil;
 
-    result = flatten(ary, level, &mod);
-    if (mod == 0) {
-	ary_discard(result);
-	return Qnil;
+    result = flatten(ary, level);
+    if (result == ary) {
+        return Qnil;
     }
-    if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
+    if (!(mod = ARY_EMBED_P(result))) rb_ary_freeze(result);
     rb_ary_replace(ary, result);
     if (mod) ARY_SET_EMBED_LEN(result, 0);
 
@@ -4477,246 +6770,221 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
 
 /*
  *  call-seq:
- *     ary.flatten -> new_ary
- *     ary.flatten(level) -> new_ary
+ *    flatten(depth = nil) -> new_array
+ *
+ *  Returns a new array that is a recursive flattening of +self+
+ *  to +depth+ levels of recursion;
+ *  +depth+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
+ *  or +nil+.
+ *  At each level of recursion:
+ *
+ *  - Each element that is an array is "flattened"
+ *    (that is, replaced by its individual array elements).
+ *  - Each element that is not an array is unchanged
+ *    (even if the element is an object that has instance method +flatten+).
+ *
+ *  With non-negative integer argument +depth+, flattens recursively through +depth+ levels:
  *
- *  Returns a new array that is a one-dimensional flattening of +self+
- *  (recursively).
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5, {foo: 0}, Set.new([6, 7]) ]
+ *    a              # => [0, [1, [2, 3], 4], 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.flatten(0)   # => [0, [1, [2, 3], 4], 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.flatten(1  ) # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.flatten(1.1) # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.flatten(2)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.flatten(3)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
  *
- *  That is, for every element that is an array, extract its elements into
- *  the new array.
+ *  With +nil+ or negative +depth+, flattens all levels.
  *
- *  The optional +level+ argument determines the level of recursion to
- *  flatten.
+ *    a.flatten     # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.flatten(-1) # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
  *
- *     s = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     t = [ 4, 5, 6, [7, 8] ]   #=> [4, 5, 6, [7, 8]]
- *     a = [ s, t, 9, 10 ]       #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten(1)              #=> [1, 2, 3, [4, 5]]
+ *  Related: Array#flatten!;
+ *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
 rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
 {
-    int mod = 0, level = -1;
-    VALUE result, lv;
+    int level = -1;
+    VALUE result;
 
-    rb_scan_args(argc, argv, "01", &lv);
-    if (!NIL_P(lv)) level = NUM2INT(lv);
-    if (level == 0) return ary_make_shared_copy(ary);
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0])) {
+        level = NUM2INT(argv[0]);
+        if (level == 0) return ary_make_shared_copy(ary);
+    }
 
-    result = flatten(ary, level, &mod);
-    OBJ_INFECT(result, ary);
+    result = flatten(ary, level);
+    if (result == ary) {
+        result = ary_make_shared_copy(ary);
+    }
 
     return result;
 }
 
-#define OPTHASH_GIVEN_P(opts) \
-    (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
-static ID id_random;
-
 #define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
 
-/*
- *  call-seq:
- *     ary.shuffle!              -> ary
- *     ary.shuffle!(random: rng) -> ary
- *
- *  Shuffles elements in +self+ in place.
- *
- *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     a.shuffle!                #=> [2, 3, 1]
- *     a                         #=> [2, 3, 1]
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a.shuffle!(random: Random.new(1))  #=> [1, 3, 2]
- */
-
 static VALUE
-rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_shuffle_bang(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
 {
-    VALUE opts, randgen = rb_cRandom;
     long i, len;
 
-    if (OPTHASH_GIVEN_P(opts)) {
-	VALUE rnd;
-	ID keyword_ids[1];
-
-	keyword_ids[0] = id_random;
-	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
-	if (rnd != Qundef) {
-	    randgen = rnd;
-	}
-    }
-    rb_check_arity(argc, 0, 0);
     rb_ary_modify(ary);
     i = len = RARRAY_LEN(ary);
     RARRAY_PTR_USE(ary, ptr, {
-	while (i) {
-	    long j = RAND_UPTO(i);
-	    VALUE tmp;
-	    if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
-		rb_raise(rb_eRuntimeError, "modified during shuffle");
-	    }
-	    tmp = ptr[--i];
-	    ptr[i] = ptr[j];
-	    ptr[j] = tmp;
-	}
+        while (i > 1) {
+            long j = RAND_UPTO(i);
+            VALUE tmp;
+            if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
+                rb_raise(rb_eRuntimeError, "modified during shuffle");
+            }
+            tmp = ptr[--i];
+            ptr[i] = ptr[j];
+            ptr[j] = tmp;
+        }
     }); /* WB: no new reference */
     return ary;
 }
 
-
-/*
- *  call-seq:
- *     ary.shuffle              -> new_ary
- *     ary.shuffle(random: rng) -> new_ary
- *
- *  Returns a new array with elements of +self+ shuffled.
- *
- *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     a.shuffle                 #=> [2, 3, 1]
- *     a                         #=> [1, 2, 3]
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a.shuffle(random: Random.new(1))  #=> [1, 3, 2]
- */
-
 static VALUE
-rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
+rb_ary_shuffle(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
 {
     ary = rb_ary_dup(ary);
-    rb_ary_shuffle_bang(argc, argv, ary);
+    rb_ary_shuffle_bang(ec, ary, randgen);
     return ary;
 }
 
-
-/*
- *  call-seq:
- *     ary.sample                  -> obj
- *     ary.sample(random: rng)     -> obj
- *     ary.sample(n)               -> new_ary
- *     ary.sample(n, random: rng)  -> new_ary
- *
- *  Choose a random element or +n+ random elements from the array.
- *
- *  The elements are chosen by using random and unique indices into the array
- *  in order to ensure that an element doesn't repeat itself unless the array
- *  already contained duplicate elements.
- *
- *  If the array is empty the first form returns +nil+ and the second form
- *  returns an empty array.
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
- *     a.sample         #=> 7
- *     a.sample(4)      #=> [6, 4, 2, 5]
- */
-
+static const rb_data_type_t ary_sample_memo_type = {
+    .wrap_struct_name = "ary_sample_memo",
+    .function = {
+        .dfree = (RUBY_DATA_FUNC)st_free_table,
+    },
+    .flags = RUBY_TYPED_WB_PROTECTED | RUBY_TYPED_FREE_IMMEDIATELY
+};
 
 static VALUE
-rb_ary_sample(int argc, VALUE *argv, VALUE ary)
+ary_sample(rb_execution_context_t *ec, VALUE ary, VALUE randgen, VALUE nv, VALUE to_array)
 {
-    VALUE nv, result;
-    VALUE opts, randgen = rb_cRandom;
+    VALUE result;
     long n, len, i, j, k, idx[10];
     long rnds[numberof(idx)];
+    long memo_threshold;
 
-    if (OPTHASH_GIVEN_P(opts)) {
-	VALUE rnd;
-	ID keyword_ids[1];
-
-	keyword_ids[0] = id_random;
-	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
-	if (rnd != Qundef) {
-	    randgen = rnd;
-	}
-    }
     len = RARRAY_LEN(ary);
-    if (argc == 0) {
-	if (len < 2)
-	    i = 0;
-	else
-	    i = RAND_UPTO(len);
+    if (!to_array) {
+        if (len < 2)
+            i = 0;
+        else
+            i = RAND_UPTO(len);
 
-	return rb_ary_elt(ary, i);
+        return rb_ary_elt(ary, i);
     }
-    rb_scan_args(argc, argv, "1", &nv);
     n = NUM2LONG(nv);
     if (n < 0) rb_raise(rb_eArgError, "negative sample number");
     if (n > len) n = len;
     if (n <= numberof(idx)) {
-	for (i = 0; i < n; ++i) {
-	    rnds[i] = RAND_UPTO(len - i);
-	}
+        for (i = 0; i < n; ++i) {
+            rnds[i] = RAND_UPTO(len - i);
+        }
     }
     k = len;
     len = RARRAY_LEN(ary);
     if (len < k && n <= numberof(idx)) {
-	for (i = 0; i < n; ++i) {
-	    if (rnds[i] >= len) return rb_ary_new_capa(0);
-	}
+        for (i = 0; i < n; ++i) {
+            if (rnds[i] >= len) return rb_ary_new_capa(0);
+        }
     }
     if (n > len) n = len;
     switch (n) {
       case 0:
-	return rb_ary_new_capa(0);
+        return rb_ary_new_capa(0);
       case 1:
-	i = rnds[0];
-	return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
+        i = rnds[0];
+        return rb_ary_new_from_args(1, RARRAY_AREF(ary, i));
       case 2:
-	i = rnds[0];
-	j = rnds[1];
-	if (j >= i) j++;
-	return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
+        i = rnds[0];
+        j = rnds[1];
+        if (j >= i) j++;
+        return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
       case 3:
-	i = rnds[0];
-	j = rnds[1];
-	k = rnds[2];
-	{
-	    long l = j, g = i;
-	    if (j >= i) l = i, g = ++j;
-	    if (k >= l && (++k >= g)) ++k;
-	}
-	return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
+        i = rnds[0];
+        j = rnds[1];
+        k = rnds[2];
+        {
+            long l = j, g = i;
+            if (j >= i) l = i, g = ++j;
+            if (k >= l && (++k >= g)) ++k;
+        }
+        return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
     }
+    memo_threshold =
+        len < 2560 ? len / 128 :
+        len < 5120 ? len / 64 :
+        len < 10240 ? len / 32 :
+        len / 16;
     if (n <= numberof(idx)) {
-	long sorted[numberof(idx)];
-	sorted[0] = idx[0] = rnds[0];
-	for (i=1; i<n; i++) {
-	    k = rnds[i];
-	    for (j = 0; j < i; ++j) {
-		if (k < sorted[j]) break;
-		++k;
-	    }
-	    memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
-	    sorted[j] = idx[i] = k;
-	}
-	result = rb_ary_new_capa(n);
-	RARRAY_PTR_USE(result, ptr_result, {
-	    for (i=0; i<n; i++) {
-		ptr_result[i] = RARRAY_AREF(ary, idx[i]);
-	    }
-	});
+        long sorted[numberof(idx)];
+        sorted[0] = idx[0] = rnds[0];
+        for (i=1; i<n; i++) {
+            k = rnds[i];
+            for (j = 0; j < i; ++j) {
+                if (k < sorted[j]) break;
+                ++k;
+            }
+            memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+            sorted[j] = idx[i] = k;
+        }
+        result = rb_ary_new_capa(n);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                ptr_result[i] = RARRAY_AREF(ary, idx[i]);
+            }
+        });
+    }
+    else if (n <= memo_threshold / 2) {
+        long max_idx = 0;
+        VALUE vmemo = TypedData_Wrap_Struct(0, &ary_sample_memo_type, 0);
+        st_table *memo = st_init_numtable_with_size(n);
+        RTYPEDDATA_DATA(vmemo) = memo;
+        result = rb_ary_new_capa(n);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                long r = RAND_UPTO(len-i) + i;
+                ptr_result[i] = r;
+                if (r > max_idx) max_idx = r;
+            }
+            len = RARRAY_LEN(ary);
+            if (len <= max_idx) n = 0;
+            else if (n > len) n = len;
+            RARRAY_PTR_USE(ary, ptr_ary, {
+                for (i=0; i<n; i++) {
+                    long j2 = j = ptr_result[i];
+                    long i2 = i;
+                    st_data_t value;
+                    if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
+                    if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
+                    st_insert(memo, (st_data_t)j, (st_data_t)i2);
+                    ptr_result[i] = ptr_ary[j2];
+                }
+            });
+        });
+        RTYPEDDATA_DATA(vmemo) = 0;
+        st_free_table(memo);
+        RB_GC_GUARD(vmemo);
     }
     else {
-	result = rb_ary_dup(ary);
-	RBASIC_CLEAR_CLASS(result);
-	RB_GC_GUARD(ary);
-	RARRAY_PTR_USE(result, ptr_result, {
-	    for (i=0; i<n; i++) {
-		j = RAND_UPTO(len-i) + i;
-		nv = ptr_result[j];
-		ptr_result[j] = ptr_result[i];
-		ptr_result[i] = nv;
-	    }
-	});
-	RBASIC_SET_CLASS_RAW(result, rb_cArray);
+        result = rb_ary_dup(ary);
+        RBASIC_CLEAR_CLASS(result);
+        RB_GC_GUARD(ary);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                j = RAND_UPTO(len-i) + i;
+                nv = ptr_result[j];
+                ptr_result[j] = ptr_result[i];
+                ptr_result[i] = nv;
+            }
+        });
+        RBASIC_SET_CLASS_RAW(result, rb_cArray);
     }
     ARY_SET_LEN(result, n);
 
@@ -4724,55 +6992,79 @@ rb_ary_sample(int argc, VALUE *argv, VALUE ary)
 }
 
 static VALUE
+ary_sized_alloc(rb_execution_context_t *ec, VALUE self)
+{
+    return rb_ary_new2(RARRAY_LEN(self));
+}
+
+static VALUE
+ary_sample0(rb_execution_context_t *ec, VALUE ary)
+{
+    return ary_sample(ec, ary, rb_cRandom, Qfalse, Qfalse);
+}
+
+static VALUE
 rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
 {
     long mul;
     VALUE n = Qnil;
     if (args && (RARRAY_LEN(args) > 0)) {
-	n = RARRAY_AREF(args, 0);
+        n = RARRAY_AREF(args, 0);
     }
     if (RARRAY_LEN(self) == 0) return INT2FIX(0);
-    if (n == Qnil) return DBL2NUM(INFINITY);
+    if (NIL_P(n)) return DBL2NUM(HUGE_VAL);
     mul = NUM2LONG(n);
     if (mul <= 0) return INT2FIX(0);
     n = LONG2FIX(mul);
-    return rb_funcallv(rb_ary_length(self), '*', 1, &n);
+    return rb_fix_mul_fix(rb_ary_length(self), n);
 }
 
 /*
  *  call-seq:
- *     ary.cycle(n=nil) { |obj| block }  -> nil
- *     ary.cycle(n=nil)                  -> Enumerator
+ *    cycle(count = nil) {|element| ... } -> nil
+ *    cycle(count = nil) -> new_enumerator
+ *
+ *  With a block given, may call the block, depending on the value of argument +count+;
+ *  +count+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects],
+ *  or +nil+.
  *
- *  Calls the given block for each element +n+ times or forever if +nil+ is
- *  given.
+ *  When +count+ is positive,
+ *  calls the block with each element, then does so repeatedly,
+ *  until it has done so +count+ times; returns +nil+:
  *
- *  Does nothing if a non-positive number is given or the array is empty.
+ *    output = []
+ *    [0, 1].cycle(2) {|element| output.push(element) } # => nil
+ *    output # => [0, 1, 0, 1]
  *
- *  Returns +nil+ if the loop has finished without getting interrupted.
+ *  When +count+ is zero or negative, does not call the block:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    [0, 1].cycle(0) {|element| fail 'Cannot happen' }  # => nil
+ *    [0, 1].cycle(-1) {|element| fail 'Cannot happen' } # => nil
  *
- *     a = ["a", "b", "c"]
- *     a.cycle { |x| puts x }     # print, a, b, c, a, b, c,.. forever.
- *     a.cycle(2) { |x| puts x }  # print, a, b, c, a, b, c.
+ *  When +count+ is +nil+, cycles forever:
  *
+ *    # Prints 0 and 1 forever.
+ *    [0, 1].cycle {|element| puts element }
+ *    [0, 1].cycle(nil) {|element| puts element }
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
-
 static VALUE
 rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
 {
     long n, i;
-    VALUE nv = Qnil;
 
-    rb_scan_args(argc, argv, "01", &nv);
+    rb_check_arity(argc, 0, 1);
 
     RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
-    if (NIL_P(nv)) {
+    if (argc == 0 || NIL_P(argv[0])) {
         n = -1;
     }
     else {
-        n = NUM2LONG(nv);
+        n = NUM2LONG(argv[0]);
         if (n <= 0) return Qnil;
     }
 
@@ -4784,11 +7076,6 @@ rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
     return Qnil;
 }
 
-#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
-#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC_SET_CLASS_RAW(s, rb_cString))
-#define tmpary(n) rb_ary_tmp_new(n)
-#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
-
 /*
  * Build a ruby array of the corresponding values and yield it to the
  * associated block.
@@ -4798,11 +7085,9 @@ static int
 yield_indexed_values(const VALUE values, const long r, const long *const p)
 {
     const VALUE result = rb_ary_new2(r);
-    VALUE *const result_array = RARRAY_PTR(result);
-    const VALUE *const values_array = RARRAY_CONST_PTR(values);
     long i;
 
-    for (i = 0; i < r; i++) result_array[i] = values_array[p[i]];
+    for (i = 0; i < r; i++) ARY_SET(result, i, RARRAY_AREF(values, p[i]));
     ARY_SET_LEN(result, r);
     rb_yield(result);
     return !RBASIC(values)->klass;
@@ -4811,8 +7096,8 @@ yield_indexed_values(const VALUE values, const long r, const long *const p)
 /*
  * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
  *
- * When we have a complete permutation of array indexes, copy the values
- * at those indexes into a new array and yield that array.
+ * When we have a complete permutation of array indices, copy the values
+ * at those indices into a new array and yield that array.
  *
  * n: the size of the set
  * r: the number of elements in each permutation
@@ -4826,46 +7111,52 @@ permute0(const long n, const long r, long *const p, char *const used, const VALU
     long i = 0, index = 0;
 
     for (;;) {
-	const char *const unused = memchr(&used[i], 0, n-i);
-	if (!unused) {
-	    if (!index) break;
-	    i = p[--index];                /* pop index */
-	    used[i++] = 0;                 /* index unused */
-	}
-	else {
-	    i = unused - used;
-	    p[index] = i;
-	    used[i] = 1;                   /* mark index used */
-	    ++index;
-	    if (index < r-1) {             /* if not done yet */
-		p[index] = i = 0;
-		continue;
-	    }
-	    for (i = 0; i < n; ++i) {
-		if (used[i]) continue;
-		p[index] = i;
-		if (!yield_indexed_values(values, r, p)) {
-		    rb_raise(rb_eRuntimeError, "permute reentered");
-		}
-	    }
-	    i = p[--index];                /* pop index */
-	    used[i] = 0;                   /* index unused */
-	    p[index] = ++i;
-	}
+        const char *const unused = memchr(&used[i], 0, n-i);
+        if (!unused) {
+            if (!index) break;
+            i = p[--index];                /* pop index */
+            used[i++] = 0;                 /* index unused */
+        }
+        else {
+            i = unused - used;
+            p[index] = i;
+            used[i] = 1;                   /* mark index used */
+            ++index;
+            if (index < r-1) {             /* if not done yet */
+                p[index] = i = 0;
+                continue;
+            }
+            for (i = 0; i < n; ++i) {
+                if (used[i]) continue;
+                p[index] = i;
+                if (!yield_indexed_values(values, r, p)) {
+                    rb_raise(rb_eRuntimeError, "permute reentered");
+                }
+            }
+            i = p[--index];                /* pop index */
+            used[i] = 0;                   /* index unused */
+            p[index] = ++i;
+        }
     }
 }
 
 /*
  * Returns the product of from, from-1, ..., from - how_many + 1.
- * http://en.wikipedia.org/wiki/Pochhammer_symbol
+ * https://en.wikipedia.org/wiki/Pochhammer_symbol
  */
 static VALUE
 descending_factorial(long from, long how_many)
 {
-    VALUE cnt = LONG2FIX(how_many >= 0);
-    while (how_many-- > 0) {
-	VALUE v = LONG2FIX(from--);
-	cnt = rb_funcallv(cnt, '*', 1, &v);
+    VALUE cnt;
+    if (how_many > 0) {
+        cnt = LONG2FIX(from);
+        while (--how_many > 0) {
+            long v = --from;
+            cnt = rb_int_mul(cnt, LONG2FIX(v));
+        }
+    }
+    else {
+        cnt = LONG2FIX(how_many == 0);
     }
     return cnt;
 }
@@ -4873,16 +7164,23 @@ descending_factorial(long from, long how_many)
 static VALUE
 binomial_coefficient(long comb, long size)
 {
-    VALUE r, v;
+    VALUE r;
+    long i;
     if (comb > size-comb) {
-	comb = size-comb;
+        comb = size-comb;
     }
     if (comb < 0) {
-	return LONG2FIX(0);
+        return LONG2FIX(0);
     }
-    r = descending_factorial(size, comb);
-    v = descending_factorial(comb, comb);
-    return rb_funcallv(r, id_div, 1, &v);
+    else if (comb == 0) {
+        return LONG2FIX(1);
+    }
+    r = LONG2FIX(size);
+    for (i = 1; i < comb; ++i) {
+        r = rb_int_mul(r, LONG2FIX(size - i));
+        r = rb_int_idiv(r, LONG2FIX(i + 1));
+    }
+    return r;
 }
 
 static VALUE
@@ -4896,66 +7194,80 @@ rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
 
 /*
  *  call-seq:
- *     ary.permutation { |p| block }          -> ary
- *     ary.permutation                        -> Enumerator
- *     ary.permutation(n) { |p| block }       -> ary
- *     ary.permutation(n)                     -> Enumerator
+ *    permutation(count = self.size) {|permutation| ... } -> self
+ *    permutation(count = self.size) -> new_enumerator
+ *
+ *  Iterates over permutations of the elements of +self+;
+ *  the order of permutations is indeterminate.
+ *
+ *  With a block and an in-range positive integer argument +count+ (<tt>0 < count <= self.size</tt>) given,
+ *  calls the block with each permutation of +self+ of size +count+;
+ *  returns +self+:
+ *
+ *    a = [0, 1, 2]
+ *    perms = []
+ *    a.permutation(1) {|perm| perms.push(perm) }
+ *    perms # => [[0], [1], [2]]
+ *
+ *    perms = []
+ *    a.permutation(2) {|perm| perms.push(perm) }
+ *    perms # => [[0, 1], [0, 2], [1, 0], [1, 2], [2, 0], [2, 1]]
+ *
+ *    perms = []
+ *    a.permutation(3) {|perm| perms.push(perm) }
+ *    perms # => [[0, 1, 2], [0, 2, 1], [1, 0, 2], [1, 2, 0], [2, 0, 1], [2, 1, 0]]
  *
- * When invoked with a block, yield all permutations of length +n+ of the
- * elements of the array, then return the array itself.
+ *  When +count+ is zero, calls the block once with a new empty array:
  *
- * If +n+ is not specified, yield all permutations of all elements.
+ *    perms = []
+ *    a.permutation(0) {|perm| perms.push(perm) }
+ *    perms # => [[]]
  *
- * The implementation makes no guarantees about the order in which the
- * permutations are yielded.
+ *  When +count+ is out of range (negative or larger than <tt>self.size</tt>),
+ *  does not call the block:
  *
- * If no block is given, an Enumerator is returned instead.
+ *    a.permutation(-1) {|permutation| fail 'Cannot happen' }
+ *    a.permutation(4) {|permutation| fail 'Cannot happen' }
  *
- * Examples:
+ *  With no block given, returns a new Enumerator.
  *
- *   a = [1, 2, 3]
- *   a.permutation.to_a    #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- *   a.permutation(1).to_a #=> [[1],[2],[3]]
- *   a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
- *   a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- *   a.permutation(0).to_a #=> [[]] # one permutation of length 0
- *   a.permutation(4).to_a #=> []   # no permutations of length 4
+ *  Related: {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
 rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE num;
     long r, n, i;
 
     n = RARRAY_LEN(ary);                  /* Array length */
     RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size);   /* Return enumerator if no block */
-    rb_scan_args(argc, argv, "01", &num);
-    r = NIL_P(num) ? n : NUM2LONG(num);   /* Permutation size from argument */
+    r = n;
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0]))
+        r = NUM2LONG(argv[0]);            /* Permutation size from argument */
 
     if (r < 0 || n < r) {
-	/* no permutations: yield nothing */
+        /* no permutations: yield nothing */
     }
     else if (r == 0) { /* exactly one permutation: the zero-length array */
-	rb_yield(rb_ary_new2(0));
+        rb_yield(rb_ary_new2(0));
     }
     else if (r == 1) { /* this is a special, easy case */
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
     }
     else {             /* this is the general case */
-	volatile VALUE t0;
-	long *p = (long*)ALLOCV(t0, r*sizeof(long)+n*sizeof(char));
-	char *used = (char*)(p + r);
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
+        char *used = (char*)(p + r);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
 
-	MEMZERO(used, char, n); /* initialize array */
+        MEMZERO(used, char, n); /* initialize array */
 
-	permute0(n, r, p, used, ary0); /* compute and yield permutations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+        permute0(n, r, p, used, ary0); /* compute and yield permutations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -4968,16 +7280,16 @@ combinate0(const long len, const long n, long *const stack, const VALUE values)
     MEMZERO(stack+1, long, n);
     stack[0] = -1;
     for (;;) {
-	for (lev++; lev < n; lev++) {
-	    stack[lev+1] = stack[lev]+1;
-	}
-	if (!yield_indexed_values(values, n, stack+1)) {
-	    rb_raise(rb_eRuntimeError, "combination reentered");
-	}
-	do {
-	    if (lev == 0) return;
-	    stack[lev--]++;
-	} while (stack[lev+1]+n == len+lev+1);
+        for (lev++; lev < n; lev++) {
+            stack[lev+1] = stack[lev]+1;
+        }
+        if (!yield_indexed_values(values, n, stack+1)) {
+            rb_raise(rb_eRuntimeError, "combination reentered");
+        }
+        do {
+            if (lev == 0) return;
+            stack[lev--]++;
+        } while (stack[lev+1]+n == len+lev+1);
     }
 }
 
@@ -4992,27 +7304,46 @@ rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
 
 /*
  *  call-seq:
- *     ary.combination(n) { |c| block }    -> ary
- *     ary.combination(n)                  -> Enumerator
+ *    combination(count) {|element| ... } -> self
+ *    combination(count) -> new_enumerator
+ *
+ *  When a block and a positive
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
+ *  argument +count+ (<tt>0 < count <= self.size</tt>)
+ *  are given, calls the block with each combination of +self+ of size +count+;
+ *  returns +self+:
+ *
+ *    a = %w[a b c]                                   # => ["a", "b", "c"]
+ *    a.combination(2) {|combination| p combination } # => ["a", "b", "c"]
+ *
+ *  Output:
  *
- * When invoked with a block, yields all combinations of length +n+ of elements
- * from the array and then returns the array itself.
+ *    ["a", "b"]
+ *    ["a", "c"]
+ *    ["b", "c"]
  *
- * The implementation makes no guarantees about the order in which the
- * combinations are yielded.
+ *  The order of the yielded combinations is not guaranteed.
  *
- * If no block is given, an Enumerator is returned instead.
+ *  When +count+ is zero, calls the block once with a new empty array:
  *
- * Examples:
+ *    a.combination(0) {|combination| p combination }
+ *    [].combination(0) {|combination| p combination }
  *
- *     a = [1, 2, 3, 4]
- *     a.combination(1).to_a  #=> [[1],[2],[3],[4]]
- *     a.combination(2).to_a  #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
- *     a.combination(3).to_a  #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
- *     a.combination(4).to_a  #=> [[1,2,3,4]]
- *     a.combination(0).to_a  #=> [[]] # one combination of length 0
- *     a.combination(5).to_a  #=> []   # no combinations of length 5
+ *  Output:
  *
+ *    []
+ *    []
+ *
+ *  When +count+ is negative or larger than +self.size+ and +self+ is non-empty,
+ *  does not call the block:
+ *
+ *    a.combination(-1) {|combination| fail 'Cannot happen' } # => ["a", "b", "c"]
+ *    a.combination(4)  {|combination| fail 'Cannot happen' } # => ["a", "b", "c"]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: Array#permutation;
+ *  see also {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
@@ -5024,25 +7355,25 @@ rb_ary_combination(VALUE ary, VALUE num)
     RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
     len = RARRAY_LEN(ary);
     if (n < 0 || len < n) {
-	/* yield nothing */
+        /* yield nothing */
     }
     else if (n == 0) {
-	rb_yield(rb_ary_new2(0));
+        rb_yield(rb_ary_new2(0));
     }
     else if (n == 1) {
-	for (i = 0; i < len; i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
     }
     else {
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	volatile VALUE t0;
-	long *stack = ALLOCV_N(long, t0, n+1);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        volatile VALUE t0;
+        long *stack = ALLOCV_N(long, t0, n+1);
 
-	RBASIC_CLEAR_CLASS(ary0);
-	combinate0(len, n, stack, ary0);
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+        RBASIC_CLEAR_CLASS(ary0);
+        combinate0(len, n, stack, ary0);
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -5051,8 +7382,8 @@ rb_ary_combination(VALUE ary, VALUE num)
  * Compute repeated permutations of +r+ elements of the set
  * <code>[0..n-1]</code>.
  *
- * When we have a complete repeated permutation of array indexes, copy the
- * values at those indexes into a new array and yield that array.
+ * When we have a complete repeated permutation of array indices, copy the
+ * values at those indices into a new array and yield that array.
  *
  * n: the size of the set
  * r: the number of elements in each permutation
@@ -5066,19 +7397,19 @@ rpermute0(const long n, const long r, long *const p, const VALUE values)
 
     p[index] = i;
     for (;;) {
-	if (++index < r-1) {
-	    p[index] = i = 0;
-	    continue;
-	}
-	for (i = 0; i < n; ++i) {
-	    p[index] = i;
-	    if (!yield_indexed_values(values, r, p)) {
-		rb_raise(rb_eRuntimeError, "repeated permute reentered");
-	    }
-	}
-	do {
-	    if (index <= 0) return;
-	} while ((i = ++p[--index]) >= n);
+        if (++index < r-1) {
+            p[index] = i = 0;
+            continue;
+        }
+        for (i = 0; i < n; ++i) {
+            p[index] = i;
+            if (!yield_indexed_values(values, r, p)) {
+                rb_raise(rb_eRuntimeError, "repeated permute reentered");
+            }
+        }
+        do {
+            if (index <= 0) return;
+        } while ((i = ++p[--index]) >= n);
     }
 }
 
@@ -5087,39 +7418,54 @@ rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
 {
     long n = RARRAY_LEN(ary);
     long k = NUM2LONG(RARRAY_AREF(args, 0));
-    VALUE v;
 
     if (k < 0) {
-	return LONG2FIX(0);
+        return LONG2FIX(0);
     }
-
-    v = LONG2NUM(k);
-    return rb_funcallv(LONG2NUM(n), id_power, 1, &v);
+    if (n <= 0) {
+        return LONG2FIX(!k);
+    }
+    return rb_int_positive_pow(n, (unsigned long)k);
 }
 
 /*
  *  call-seq:
- *     ary.repeated_permutation(n) { |p| block } -> ary
- *     ary.repeated_permutation(n)               -> Enumerator
+ *    repeated_permutation(size) {|permutation| ... } -> self
+ *    repeated_permutation(size) -> new_enumerator
+ *
+ *  With a block given, calls the block with each repeated permutation of length +size+
+ *  of the elements of +self+;
+ *  each permutation is an array;
+ *  returns +self+. The order of the permutations is indeterminate.
+ *
+ *  If a positive integer argument +size+ is given,
+ *  calls the block with each +size+-tuple repeated permutation of the elements of +self+.
+ *  The number of permutations is <tt>self.size**size</tt>.
+ *
+ *  Examples:
+ *
+ *  - +size+ is 1:
  *
- * When invoked with a block, yield all repeated permutations of length +n+ of
- * the elements of the array, then return the array itself.
+ *      p = []
+ *      [0, 1, 2].repeated_permutation(1) {|permutation| p.push(permutation) }
+ *      p # => [[0], [1], [2]]
  *
- * The implementation makes no guarantees about the order in which the repeated
- * permutations are yielded.
+ *  - +size+ is 2:
  *
- * If no block is given, an Enumerator is returned instead.
+ *      p = []
+ *      [0, 1, 2].repeated_permutation(2) {|permutation| p.push(permutation) }
+ *      p # => [[0, 0], [0, 1], [0, 2], [1, 0], [1, 1], [1, 2], [2, 0], [2, 1], [2, 2]]
  *
- * Examples:
+ *  If +size+ is zero, calls the block once with an empty array.
  *
- *     a = [1, 2]
- *     a.repeated_permutation(1).to_a  #=> [[1], [2]]
- *     a.repeated_permutation(2).to_a  #=> [[1,1],[1,2],[2,1],[2,2]]
- *     a.repeated_permutation(3).to_a  #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
- *                                     #    [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
- *     a.repeated_permutation(0).to_a  #=> [[]] # one permutation of length 0
+ *  If +size+ is negative, does not call the block:
+ *
+ *    [0, 1, 2].repeated_permutation(-1) {|permutation| fail 'Cannot happen' }
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
-
 static VALUE
 rb_ary_repeated_permutation(VALUE ary, VALUE num)
 {
@@ -5130,25 +7476,25 @@ rb_ary_repeated_permutation(VALUE ary, VALUE num)
     r = NUM2LONG(num);                    /* Permutation size from argument */
 
     if (r < 0) {
-	/* no permutations: yield nothing */
+        /* no permutations: yield nothing */
     }
     else if (r == 0) { /* exactly one permutation: the zero-length array */
-	rb_yield(rb_ary_new2(0));
+        rb_yield(rb_ary_new2(0));
     }
     else if (r == 1) { /* this is a special, easy case */
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
     }
     else {             /* this is the general case */
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, r * sizeof(long));
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, r);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
 
-	rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+        rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -5160,19 +7506,19 @@ rcombinate0(const long n, const long r, long *const p, const long rest, const VA
 
     p[index] = i;
     for (;;) {
-	if (++index < r-1) {
-	    p[index] = i;
-	    continue;
-	}
-	for (; i < n; ++i) {
-	    p[index] = i;
-	    if (!yield_indexed_values(values, r, p)) {
-		rb_raise(rb_eRuntimeError, "repeated combination reentered");
-	    }
-	}
-	do {
-	    if (index <= 0) return;
-	} while ((i = ++p[--index]) >= n);
+        if (++index < r-1) {
+            p[index] = i;
+            continue;
+        }
+        for (; i < n; ++i) {
+            p[index] = i;
+            if (!yield_indexed_values(values, r, p)) {
+                rb_raise(rb_eRuntimeError, "repeated combination reentered");
+            }
+        }
+        do {
+            if (index <= 0) return;
+        } while ((i = ++p[--index]) >= n);
     }
 }
 
@@ -5182,36 +7528,48 @@ rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
     long n = RARRAY_LEN(ary);
     long k = NUM2LONG(RARRAY_AREF(args, 0));
     if (k == 0) {
-	return LONG2FIX(1);
+        return LONG2FIX(1);
     }
     return binomial_coefficient(k, n + k - 1);
 }
 
 /*
  *  call-seq:
- *     ary.repeated_combination(n) { |c| block } -> ary
- *     ary.repeated_combination(n)               -> Enumerator
+ *    repeated_combination(size) {|combination| ... } -> self
+ *    repeated_combination(size) -> new_enumerator
+ *
+ *  With a block given, calls the block with each repeated combination of length +size+
+ *  of the elements of +self+;
+ *  each combination is an array;
+ *  returns +self+. The order of the combinations is indeterminate.
+ *
+ *  If a positive integer argument +size+ is given,
+ *  calls the block with each +size+-tuple repeated combination of the elements of +self+.
+ *  The number of combinations is <tt>(size+1)(size+2)/2</tt>.
+ *
+ *  Examples:
+ *
+ *  - +size+ is 1:
+ *
+ *      c = []
+ *      [0, 1, 2].repeated_combination(1) {|combination| c.push(combination) }
+ *      c # => [[0], [1], [2]]
+ *
+ *  - +size+ is 2:
  *
- * When invoked with a block, yields all repeated combinations of length +n+ of
- * elements from the array and then returns the array itself.
+ *      c = []
+ *      [0, 1, 2].repeated_combination(2) {|combination| c.push(combination) }
+ *      c # => [[0, 0], [0, 1], [0, 2], [1, 1], [1, 2], [2, 2]]
  *
- * The implementation makes no guarantees about the order in which the repeated
- * combinations are yielded.
+ *  If +size+ is zero, calls the block once with an empty array.
  *
- * If no block is given, an Enumerator is returned instead.
+ *  If +size+ is negative, does not call the block:
  *
- * Examples:
+ *    [0, 1, 2].repeated_combination(-1) {|combination| fail 'Cannot happen' }
  *
- *   a = [1, 2, 3]
- *   a.repeated_combination(1).to_a  #=> [[1], [2], [3]]
- *   a.repeated_combination(2).to_a  #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
- *   a.repeated_combination(3).to_a  #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
- *                                   #    [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
- *   a.repeated_combination(4).to_a  #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
- *                                   #    [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
- *                                   #    [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
- *   a.repeated_combination(0).to_a  #=> [[]] # one combination of length 0
+ *  With no block given, returns a new Enumerator.
  *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 static VALUE
@@ -5223,67 +7581,98 @@ rb_ary_repeated_combination(VALUE ary, VALUE num)
     RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size);   /* Return enumerator if no block */
     len = RARRAY_LEN(ary);
     if (n < 0) {
-	/* yield nothing */
+        /* yield nothing */
     }
     else if (n == 0) {
-	rb_yield(rb_ary_new2(0));
+        rb_yield(rb_ary_new2(0));
     }
     else if (n == 1) {
-	for (i = 0; i < len; i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
     }
     else if (len == 0) {
-	/* yield nothing */
+        /* yield nothing */
     }
     else {
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, n);
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, n);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
 
-	rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+        rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.product(other_ary, ...)                -> new_ary
- *     ary.product(other_ary, ...) { |p| block }  -> ary
+ *    product(*other_arrays) -> new_array
+ *    product(*other_arrays) {|combination| ... } -> self
+ *
+ *  Computes all combinations of elements from all the arrays,
+ *  including both +self+ and +other_arrays+:
+ *
+ *  - The number of combinations is the product of the sizes of all the arrays,
+ *    including both +self+ and +other_arrays+.
+ *  - The order of the returned combinations is indeterminate.
+ *
+ *  With no block given, returns the combinations as an array of arrays:
+ *
+ *    p = [0, 1].product([2, 3])
+ *    # => [[0, 2], [0, 3], [1, 2], [1, 3]]
+ *    p.size # => 4
+ *    p = [0, 1].product([2, 3], [4, 5])
+ *    # => [[0, 2, 4], [0, 2, 5], [0, 3, 4], [0, 3, 5], [1, 2, 4], [1, 2, 5], [1, 3, 4], [1, 3,...
+ *    p.size # => 8
+ *
+ *  If +self+ or any argument is empty, returns an empty array:
+ *
+ *    [].product([2, 3], [4, 5]) # => []
+ *    [0, 1].product([2, 3], []) # => []
+ *
+ *  If no argument is given, returns an array of 1-element arrays,
+ *  each containing an element of +self+:
  *
- *  Returns an array of all combinations of elements from all arrays.
+ *    a.product # => [[0], [1], [2]]
  *
- *  The length of the returned array is the product of the length of +self+ and
- *  the argument arrays.
+ *  With a block given, calls the block with each combination; returns +self+:
  *
- *  If given a block, #product will yield all combinations and return +self+
- *  instead.
+ *    p = []
+ *    [0, 1].product([2, 3]) {|combination| p.push(combination) }
+ *    p # => [[0, 2], [0, 3], [1, 2], [1, 3]]
  *
- *     [1,2,3].product([4,5])     #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
- *     [1,2].product([1,2])       #=> [[1,1],[1,2],[2,1],[2,2]]
- *     [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
- *                                #     [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
- *     [1,2].product()            #=> [[1],[2]]
- *     [1,2].product([])          #=> []
+ *  If +self+ or any argument is empty, does not call the block:
+ *
+ *    [].product([2, 3], [4, 5]) {|combination| fail 'Cannot happen' }
+ *    # => []
+ *    [0, 1].product([2, 3], []) {|combination| fail 'Cannot happen' }
+ *    # => [0, 1]
+ *
+ *  If no argument is given, calls the block with each element of +self+ as a 1-element array:
+ *
+ *    p = []
+ *    [0, 1].product {|combination| p.push(combination) }
+ *    p # => [[0], [1]]
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 static VALUE
 rb_ary_product(int argc, VALUE *argv, VALUE ary)
 {
     int n = argc+1;    /* How many arrays we're operating on */
-    volatile VALUE t0 = tmpary(n);
-    volatile VALUE t1 = tmpbuf(n, sizeof(int));
+    volatile VALUE t0 = rb_ary_hidden_new(n);
+    volatile VALUE t1 = Qundef;
     VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
-    int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
+    int *counters = ALLOCV_N(int, t1, n); /* The current position in each one */
     VALUE result = Qnil;      /* The array we'll be returning, when no block given */
     long i,j;
     long resultlen = 1;
 
     RBASIC_CLEAR_CLASS(t0);
-    RBASIC_CLEAR_CLASS(t1);
 
     /* initialize the arrays of arrays */
     ARY_SET_LEN(t0, n);
@@ -5296,82 +7685,85 @@ rb_ary_product(int argc, VALUE *argv, VALUE ary)
 
     /* Otherwise, allocate and fill in an array of results */
     if (rb_block_given_p()) {
-	/* Make defensive copies of arrays; exit if any is empty */
-	for (i = 0; i < n; i++) {
-	    if (RARRAY_LEN(arrays[i]) == 0) goto done;
-	    arrays[i] = ary_make_shared_copy(arrays[i]);
-	}
+        /* Make defensive copies of arrays; exit if any is empty */
+        for (i = 0; i < n; i++) {
+            if (RARRAY_LEN(arrays[i]) == 0) goto done;
+            arrays[i] = ary_make_shared_copy(arrays[i]);
+        }
     }
     else {
-	/* Compute the length of the result array; return [] if any is empty */
-	for (i = 0; i < n; i++) {
-	    long k = RARRAY_LEN(arrays[i]);
-	    if (k == 0) {
-		result = rb_ary_new2(0);
-		goto done;
-	    }
+        /* Compute the length of the result array; return [] if any is empty */
+        for (i = 0; i < n; i++) {
+            long k = RARRAY_LEN(arrays[i]);
+            if (k == 0) {
+                result = rb_ary_new2(0);
+                goto done;
+            }
             if (MUL_OVERFLOW_LONG_P(resultlen, k))
-		rb_raise(rb_eRangeError, "too big to product");
-	    resultlen *= k;
-	}
-	result = rb_ary_new2(resultlen);
+                rb_raise(rb_eRangeError, "too big to product");
+            resultlen *= k;
+        }
+        result = rb_ary_new2(resultlen);
     }
     for (;;) {
-	int m;
-	/* fill in one subarray */
-	VALUE subarray = rb_ary_new2(n);
-	for (j = 0; j < n; j++) {
-	    rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
-	}
-
-	/* put it on the result array */
-	if (NIL_P(result)) {
-	    FL_SET(t0, FL_USER5);
-	    rb_yield(subarray);
-	    if (! FL_TEST(t0, FL_USER5)) {
-		rb_raise(rb_eRuntimeError, "product reentered");
-	    }
-	    else {
-		FL_UNSET(t0, FL_USER5);
-	    }
-	}
-	else {
-	    rb_ary_push(result, subarray);
-	}
-
-	/*
-	 * Increment the last counter.  If it overflows, reset to 0
-	 * and increment the one before it.
-	 */
-	m = n-1;
-	counters[m]++;
-	while (counters[m] == RARRAY_LEN(arrays[m])) {
-	    counters[m] = 0;
-	    /* If the first counter overflows, we are done */
-	    if (--m < 0) goto done;
-	    counters[m]++;
-	}
+        int m;
+        /* fill in one subarray */
+        VALUE subarray = rb_ary_new2(n);
+        for (j = 0; j < n; j++) {
+            rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+        }
+
+        /* put it on the result array */
+        if (NIL_P(result)) {
+            FL_SET(t0, RARRAY_SHARED_ROOT_FLAG);
+            rb_yield(subarray);
+            if (!FL_TEST(t0, RARRAY_SHARED_ROOT_FLAG)) {
+                rb_raise(rb_eRuntimeError, "product reentered");
+            }
+            else {
+                FL_UNSET(t0, RARRAY_SHARED_ROOT_FLAG);
+            }
+        }
+        else {
+            rb_ary_push(result, subarray);
+        }
+
+        /*
+         * Increment the last counter.  If it overflows, reset to 0
+         * and increment the one before it.
+         */
+        m = n-1;
+        counters[m]++;
+        while (counters[m] == RARRAY_LEN(arrays[m])) {
+            counters[m] = 0;
+            /* If the first counter overflows, we are done */
+            if (--m < 0) goto done;
+            counters[m]++;
+        }
     }
+
 done:
-    tmpary_discard(t0);
-    tmpbuf_discard(t1);
+    ALLOCV_END(t1);
 
     return NIL_P(result) ? ary : result;
 }
 
 /*
  *  call-seq:
- *     ary.take(n)               -> new_ary
+ *    take(count) -> new_array
  *
- *  Returns first +n+ elements from the array.
+ *  Returns a new array containing the first +count+ element of +self+
+ *  (as available);
+ *  +count+ must be a non-negative numeric;
+ *  does not modify +self+:
  *
- *  If a negative number is given, raises an ArgumentError.
- *
- *  See also Array#drop
- *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.take(3)             #=> [1, 2, 3]
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.take(2)   # => ["a", "b"]
+ *    a.take(2.1) # => ["a", "b"]
+ *    a.take(50)  # => ["a", "b", "c", "d"]
+ *    a.take(0)   # => []
  *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -5379,26 +7771,30 @@ rb_ary_take(VALUE obj, VALUE n)
 {
     long len = NUM2LONG(n);
     if (len < 0) {
-	rb_raise(rb_eArgError, "attempt to take negative size");
+        rb_raise(rb_eArgError, "attempt to take negative size");
     }
     return rb_ary_subseq(obj, 0, len);
 }
 
 /*
  *  call-seq:
- *     ary.take_while { |arr| block }  -> new_ary
- *     ary.take_while                  -> Enumerator
+ *    take_while {|element| ... } -> new_array
+ *    take_while -> new_enumerator
  *
- *  Passes elements to the block until the block returns +nil+ or +false+, then
- *  stops iterating and returns an array of all prior elements.
+ *  With a block given, calls the block with each successive element of +self+;
+ *  stops iterating if the block returns +false+ or +nil+;
+ *  returns a new array containing those elements for which the block returned a truthy value:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.take_while {|element| element < 3 } # => [0, 1, 2]
+ *    a.take_while {|element| true }        # => [0, 1, 2, 3, 4, 5]
+ *    a.take_while {|element| false }       # => []
  *
- *  See also Array#drop_while
+ *  With no block given, returns a new Enumerator.
  *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.take_while { |i| i < 3 }  #=> [1, 2]
+ *  Does not modify +self+.
  *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -5408,25 +7804,28 @@ rb_ary_take_while(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
     }
     return rb_ary_take(ary, LONG2FIX(i));
 }
 
 /*
  *  call-seq:
- *     ary.drop(n)               -> new_ary
- *
- *  Drops first +n+ elements from +ary+ and returns the rest of the elements in
- *  an array.
+ *    drop(count) -> new_array
  *
- *  If a negative number is given, raises an ArgumentError.
+ *  Returns a new array containing all but the first +count+ element of +self+,
+ *  where +count+ is a non-negative integer;
+ *  does not modify +self+.
  *
- *  See also Array#take
+ *  Examples:
  *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.drop(3)             #=> [4, 5, 0]
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.drop(0) # => [0, 1, 2, 3, 4, 5]
+ *    a.drop(1) # => [1, 2, 3, 4, 5]
+ *    a.drop(2) # => [2, 3, 4, 5]
+ *    a.drop(9) # => []
  *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -5435,30 +7834,30 @@ rb_ary_drop(VALUE ary, VALUE n)
     VALUE result;
     long pos = NUM2LONG(n);
     if (pos < 0) {
-	rb_raise(rb_eArgError, "attempt to drop negative size");
+        rb_raise(rb_eArgError, "attempt to drop negative size");
     }
 
     result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
-    if (result == Qnil) result = rb_ary_new();
+    if (NIL_P(result)) result = rb_ary_new();
     return result;
 }
 
 /*
  *  call-seq:
- *     ary.drop_while { |arr| block }   -> new_ary
- *     ary.drop_while                  -> Enumerator
+ *    drop_while {|element| ... } -> new_array
+ *    drop_while -> new_enumerator
  *
- *  Drops elements up to, but not including, the first element for which the
- *  block returns +nil+ or +false+ and returns an array containing the
- *  remaining elements.
+ *  With a block given, calls the block with each successive element of +self+;
+ *  stops if the block returns +false+ or +nil+;
+ *  returns a new array _omitting_ those elements for which the block returned a truthy value;
+ *  does not modify +self+:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.drop_while {|element| element < 3 } # => [3, 4, 5]
  *
- *  See also Array#take_while
- *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.drop_while {|i| i < 3 }   #=> [3, 4, 5, 0]
+ *  With no block given, returns a new Enumerator.
  *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -5468,85 +7867,638 @@ rb_ary_drop_while(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
     }
     return rb_ary_drop(ary, LONG2FIX(i));
 }
 
 /*
  *  call-seq:
- *     ary.any? [{ |obj| block }]   -> true or false
+ *    any? -> true or false
+ *    any?(object) -> true or false
+ *    any? {|element| ... } -> true or false
+ *
+ *  Returns whether for any element of +self+, a given criterion is satisfied.
+ *
+ *  With no block and no argument, returns whether any element of +self+ is truthy:
+ *
+ *    [nil, false, []].any? # => true  # Array object is truthy.
+ *    [nil, false, {}].any? # => true  # Hash object is truthy.
+ *    [nil, false, ''].any? # => true  # String object is truthy.
+ *    [nil, false].any?     # => false # Nil and false are not truthy.
+ *
+ *  With argument +object+ given,
+ *  returns whether <tt>object === ele</tt> for any element +ele+ in +self+:
+ *
+ *    [nil, false, 0].any?(0)          # => true
+ *    [nil, false, 1].any?(0)          # => false
+ *    [nil, false, 'food'].any?(/foo/) # => true
+ *    [nil, false, 'food'].any?(/bar/) # => false
+ *
+ *  With a block given,
+ *  calls the block with each element in +self+;
+ *  returns whether the block returns any truthy value:
+ *
+ *    [0, 1, 2].any? {|ele| ele < 1 } # => true
+ *    [0, 1, 2].any? {|ele| ele < 0 } # => false
  *
- *  See also Enumerable#any?
+ *  With both a block and argument +object+ given,
+ *  ignores the block and uses +object+ as above.
+ *
+ *  <b>Special case</b>: returns +false+ if +self+ is empty
+ *  (regardless of any given argument or block).
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
-rb_ary_any_p(VALUE ary)
+rb_ary_any_p(int argc, VALUE *argv, VALUE ary)
 {
     long i, len = RARRAY_LEN(ary);
-    const VALUE *ptr = RARRAY_CONST_PTR(ary);
 
+    rb_check_arity(argc, 0, 1);
     if (!len) return Qfalse;
-    if (!rb_block_given_p()) {
-	for (i = 0; i < len; ++i) if (RTEST(ptr[i])) return Qtrue;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qtrue;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) return Qtrue;
+        }
     }
     else {
-	for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
-	}
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
+        }
     }
     return Qfalse;
 }
 
 /*
- *  Arrays are ordered, integer-indexed collections of any object.
+ *  call-seq:
+ *    all? -> true or false
+ *    all?(object) -> true or false
+ *    all? {|element| ... } -> true or false
+ *
+ *  Returns whether for every element of +self+,
+ *  a given criterion is satisfied.
+ *
+ *  With no block and no argument,
+ *  returns whether every element of +self+ is truthy:
+ *
+ *    [[], {}, '', 0, 0.0, Object.new].all? # => true  # All truthy objects.
+ *    [[], {}, '', 0, 0.0, nil].all?        # => false # nil is not truthy.
+ *    [[], {}, '', 0, 0.0, false].all?      # => false # false is not truthy.
+ *
+ *  With argument +object+ given, returns whether <tt>object === ele</tt>
+ *  for every element +ele+ in +self+:
+ *
+ *    [0, 0, 0].all?(0)                    # => true
+ *    [0, 1, 2].all?(1)                    # => false
+ *    ['food', 'fool', 'foot'].all?(/foo/) # => true
+ *    ['food', 'drink'].all?(/foo/)        # => false
+ *
+ *  With a block given, calls the block with each element in +self+;
+ *  returns whether the block returns only truthy values:
+ *
+ *    [0, 1, 2].all? { |ele| ele < 3 } # => true
+ *    [0, 1, 2].all? { |ele| ele < 2 } # => false
+ *
+ *  With both a block and argument +object+ given,
+ *  ignores the block and uses +object+ as above.
+ *
+ *  <b>Special case</b>: returns +true+ if +self+ is empty
+ *  (regardless of any given argument or block).
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_all_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qtrue;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (!RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (!RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    return Qtrue;
+}
+
+/*
+ *  call-seq:
+ *    none? -> true or false
+ *    none?(object) -> true or false
+ *    none? {|element| ... } -> true or false
+ *
+ *  Returns +true+ if no element of +self+ meets a given criterion, +false+ otherwise.
+ *
+ *  With no block given and no argument, returns +true+ if +self+ has no truthy elements,
+ *  +false+ otherwise:
+ *
+ *    [nil, false].none?    # => true
+ *    [nil, 0, false].none? # => false
+ *    [].none?              # => true
+ *
+ *  With argument +object+ given, returns +false+ if for any element +element+,
+ *  <tt>object === element</tt>; +true+ otherwise:
+ *
+ *    ['food', 'drink'].none?(/bar/) # => true
+ *    ['food', 'drink'].none?(/foo/) # => false
+ *    [].none?(/foo/)                # => true
+ *    [0, 1, 2].none?(3)             # => true
+ *    [0, 1, 2].none?(1)             # => false
+ *
+ *  With a block given, calls the block with each element in +self+;
+ *  returns +true+ if the block returns no truthy value, +false+ otherwise:
+ *
+ *    [0, 1, 2].none? {|element| element > 3 } # => true
+ *    [0, 1, 2].none? {|element| element > 1 } # => false
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_none_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qtrue;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    return Qtrue;
+}
+
+/*
+ *  call-seq:
+ *    one? -> true or false
+ *    one? {|element| ... } -> true or false
+ *    one?(object) -> true or false
+ *
+ *  Returns +true+ if exactly one element of +self+ meets a given criterion.
+ *
+ *  With no block given and no argument, returns +true+ if +self+ has exactly one truthy element,
+ *  +false+ otherwise:
+ *
+ *    [nil, 0].one? # => true
+ *    [0, 0].one? # => false
+ *    [nil, nil].one? # => false
+ *    [].one? # => false
+ *
+ *  With a block given, calls the block with each element in +self+;
+ *  returns +true+ if the block a truthy value for exactly one element, +false+ otherwise:
+ *
+ *    [0, 1, 2].one? {|element| element > 0 } # => false
+ *    [0, 1, 2].one? {|element| element > 1 } # => true
+ *    [0, 1, 2].one? {|element| element > 2 } # => false
+ *
+ *  With argument +object+ given, returns +true+ if for exactly one element +element+, <tt>object === element</tt>;
+ *  +false+ otherwise:
+ *
+ *    [0, 1, 2].one?(0) # => true
+ *    [0, 0, 1].one?(0) # => false
+ *    [1, 1, 2].one?(0) # => false
+ *    ['food', 'drink'].one?(/bar/) # => false
+ *    ['food', 'drink'].one?(/foo/) # => true
+ *    [].one?(/foo/) # => false
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_one_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+    VALUE result = Qfalse;
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qfalse;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    dig(index, *identifiers) -> object
+ *
+ *  Finds and returns the object in nested object
+ *  specified by +index+ and +identifiers+;
+ *  the nested objects may be instances of various classes.
+ *  See {Dig Methods}[rdoc-ref:dig_methods.rdoc].
+ *
+ *  Examples:
+ *
+ *    a = [:foo, [:bar, :baz, [:bat, :bam]]]
+ *    a.dig(1) # => [:bar, :baz, [:bat, :bam]]
+ *    a.dig(1, 2) # => [:bat, :bam]
+ *    a.dig(1, 2, 0) # => :bat
+ *    a.dig(1, 2, 3) # => nil
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_dig(int argc, VALUE *argv, VALUE self)
+{
+    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+    self = rb_ary_at(self, *argv);
+    if (!--argc) return self;
+    ++argv;
+    return rb_obj_dig(argc, argv, self, Qnil);
+}
+
+static inline VALUE
+finish_exact_sum(long n, VALUE r, VALUE v, int z)
+{
+    if (n != 0)
+        v = rb_fix_plus(LONG2FIX(n), v);
+    if (!UNDEF_P(r)) {
+        v = rb_rational_plus(r, v);
+    }
+    else if (!n && z) {
+        v = rb_fix_plus(LONG2FIX(0), v);
+    }
+    return v;
+}
+
+/*
+ * call-seq:
+ *   sum(init = 0) -> object
+ *   sum(init = 0) {|element| ... } -> object
+ *
+ *  With no block given, returns the sum of +init+ and all elements of +self+;
+ *  for array +array+ and value +init+, equivalent to:
+ *
+ *    sum = init
+ *    array.each {|element| sum += element }
+ *    sum
+ *
+ *  For example, <tt>[e0, e1, e2].sum</tt> returns <tt>init + e0 + e1 + e2</tt>.
+ *
+ *  Examples:
+ *
+ *    [0, 1, 2, 3].sum                 # => 6
+ *    [0, 1, 2, 3].sum(100)            # => 106
+ *    ['abc', 'def', 'ghi'].sum('jkl') # => "jklabcdefghi"
+ *    [[:foo, :bar], ['foo', 'bar']].sum([2, 3])
+ *    # => [2, 3, :foo, :bar, "foo", "bar"]
+ *
+ *  The +init+ value and elements need not be numeric, but must all be <tt>+</tt>-compatible:
+ *
+ *    # Raises TypeError: Array can't be coerced into Integer.
+ *    [[:foo, :bar], ['foo', 'bar']].sum(2)
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  the block's return value (instead of the element itself) is used as the addend:
+ *
+ *    ['zero', 1, :two].sum('Coerced and concatenated: ') {|element| element.to_s }
+ *    # => "Coerced and concatenated: zero1two"
+ *
+ *  Notes:
+ *
+ *  - Array#join and Array#flatten may be faster than Array#sum
+ *    for an array of strings or an array of arrays.
+ *  - Array#sum method may not respect method redefinition of "+" methods such as Integer#+.
+ *
+ */
+
+static VALUE
+rb_ary_sum(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE e, v, r;
+    long i, n;
+    int block_given;
+
+    v = (rb_check_arity(argc, 0, 1) ? argv[0] : LONG2FIX(0));
+
+    block_given = rb_block_given_p();
+
+    if (RARRAY_LEN(ary) == 0)
+        return v;
+
+    n = 0;
+    r = Qundef;
+
+    if (!FIXNUM_P(v) && !RB_BIGNUM_TYPE_P(v) && !RB_TYPE_P(v, T_RATIONAL)) {
+        i = 0;
+        goto init_is_a_value;
+    }
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (block_given)
+            e = rb_yield(e);
+        if (FIXNUM_P(e)) {
+            n += FIX2LONG(e); /* should not overflow long type */
+            if (!FIXABLE(n)) {
+                v = rb_big_plus(LONG2NUM(n), v);
+                n = 0;
+            }
+        }
+        else if (RB_BIGNUM_TYPE_P(e))
+            v = rb_big_plus(e, v);
+        else if (RB_TYPE_P(e, T_RATIONAL)) {
+            if (UNDEF_P(r))
+                r = e;
+            else
+                r = rb_rational_plus(r, e);
+        }
+        else
+            goto not_exact;
+    }
+    v = finish_exact_sum(n, r, v, argc!=0);
+    return v;
+
+  not_exact:
+    v = finish_exact_sum(n, r, v, i!=0);
+
+    if (RB_FLOAT_TYPE_P(e)) {
+        /*
+         * Kahan-Babuska balancing compensated summation algorithm
+         * See https://link.springer.com/article/10.1007/s00607-005-0139-x
+         */
+        double f, c;
+        double x, t;
+
+        f = NUM2DBL(v);
+        c = 0.0;
+        goto has_float_value;
+        for (; i < RARRAY_LEN(ary); i++) {
+            e = RARRAY_AREF(ary, i);
+            if (block_given)
+                e = rb_yield(e);
+            if (RB_FLOAT_TYPE_P(e))
+              has_float_value:
+                x = RFLOAT_VALUE(e);
+            else if (FIXNUM_P(e))
+                x = FIX2LONG(e);
+            else if (RB_BIGNUM_TYPE_P(e))
+                x = rb_big2dbl(e);
+            else if (RB_TYPE_P(e, T_RATIONAL))
+                x = rb_num2dbl(e);
+            else
+                goto not_float;
+
+            if (isnan(f)) continue;
+            if (isnan(x)) {
+                f = x;
+                continue;
+            }
+            if (isinf(x)) {
+                if (isinf(f) && signbit(x) != signbit(f))
+                    f = NAN;
+                else
+                    f = x;
+                continue;
+            }
+            if (isinf(f)) continue;
+
+            t = f + x;
+            if (fabs(f) >= fabs(x))
+                c += ((f - t) + x);
+            else
+                c += ((x - t) + f);
+            f = t;
+        }
+        f += c;
+        return DBL2NUM(f);
+
+      not_float:
+        v = DBL2NUM(f);
+    }
+
+    goto has_some_value;
+    init_is_a_value:
+    for (; i < RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (block_given)
+            e = rb_yield(e);
+      has_some_value:
+        v = rb_funcall(v, idPLUS, 1, e);
+    }
+    return v;
+}
+
+/* :nodoc: */
+static VALUE
+rb_ary_deconstruct(VALUE ary)
+{
+    return ary;
+}
+
+/*
+ *  An \Array object is an ordered, integer-indexed collection of objects,
+ *  called _elements_;
+ *  the object represents
+ *  an {array data structure}[https://en.wikipedia.org/wiki/Array_(data_structure)].
  *
- *  Array indexing starts at 0, as in C or Java.  A negative index is assumed
- *  to be relative to the end of the array---that is, an index of -1 indicates
- *  the last element of the array, -2 is the next to last element in the
- *  array, and so on.
+ *  An element may be any object (even another array);
+ *  elements may be any mixture of objects of different types.
+ *
+ *  Important data structures that use arrays include:
+ *
+ *  - {Coordinate vector}[https://en.wikipedia.org/wiki/Coordinate_vector].
+ *  - {Matrix}[https://en.wikipedia.org/wiki/Matrix_(mathematics)].
+ *  - {Heap}[https://en.wikipedia.org/wiki/Heap_(data_structure)].
+ *  - {Hash table}[https://en.wikipedia.org/wiki/Hash_table].
+ *  - {Deque (double-ended queue)}[https://en.wikipedia.org/wiki/Double-ended_queue].
+ *  - {Queue}[https://en.wikipedia.org/wiki/Queue_(abstract_data_type)].
+ *  - {Stack}[https://en.wikipedia.org/wiki/Stack_(abstract_data_type)].
+ *
+ *  There are also array-like data structures:
+ *
+ *  - {Associative array}[https://en.wikipedia.org/wiki/Associative_array] (see Hash).
+ *  - {Directory}[https://en.wikipedia.org/wiki/Directory_(computing)] (see Dir).
+ *  - {Environment}[https://en.wikipedia.org/wiki/Environment_variable] (see ENV).
+ *  - {Set}[https://en.wikipedia.org/wiki/Set_(abstract_data_type)] (see Set).
+ *  - {String}[https://en.wikipedia.org/wiki/String_(computer_science)] (see String).
+ *
+ *  == \Array Indexes
+ *
+ *  \Array indexing starts at 0, as in C or Java.
+ *
+ *  A non-negative index is an offset from the first element:
+ *
+ *  - Index 0 indicates the first element.
+ *  - Index 1 indicates the second element.
+ *  - ...
+ *
+ *  A negative index is an offset, backwards, from the end of the array:
+ *
+ *  - Index -1 indicates the last element.
+ *  - Index -2 indicates the next-to-last element.
+ *  - ...
+ *
+ *
+ *  === In-Range and Out-of-Range Indexes
+ *
+ *  A non-negative index is <i>in range</i> if and only if it is smaller than
+ *  the size of the array.  For a 3-element array:
+ *
+ *  - Indexes 0 through 2 are in range.
+ *  - Index 3 is out of range.
+ *
+ *  A negative index is <i>in range</i> if and only if its absolute value is
+ *  not larger than the size of the array.  For a 3-element array:
+ *
+ *  - Indexes -1 through -3 are in range.
+ *  - Index -4 is out of range.
+ *
+ *  === Effective Index
+ *
+ *  Although the effective index into an array is always an integer,
+ *  some methods (both within class \Array and elsewhere)
+ *  accept one or more non-integer arguments that are
+ *  {integer-convertible objects}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
  *
  *  == Creating Arrays
  *
- *  A new array can be created by using the literal constructor
- *  <code>[]</code>.  Arrays can contain different types of objects.  For
- *  example, the array below contains an Integer, a String and a Float:
+ *  You can create an \Array object explicitly with:
+ *
+ *  - An {array literal}[rdoc-ref:syntax/literals.rdoc@Array+Literals]:
+ *
+ *      [1, 'one', :one, [2, 'two', :two]]
+ *
+ *  - A {%w or %W string-array Literal}[rdoc-ref:syntax/literals.rdoc@25w+and+-25W-3A+String-Array+Literals]:
+ *
+ *      %w[foo bar baz] # => ["foo", "bar", "baz"]
+ *      %w[1 % *]       # => ["1", "%", "*"]
  *
- *     ary = [1, "two", 3.0] #=> [1, "two", 3.0]
+ *  - A {%i or %I symbol-array Literal}[rdoc-ref:syntax/literals.rdoc@25i+and+-25I-3A+Symbol-Array+Literals]:
  *
- *  An array can also be created by explicitly calling Array.new with zero, one
- *  (the initial size of the Array) or two arguments (the initial size and a
- *  default object).
+ *      %i[foo bar baz] # => [:foo, :bar, :baz]
+ *      %i[1 % *]       # => [:"1", :%, :*]
  *
- *     ary = Array.new    #=> []
- *     Array.new(3)       #=> [nil, nil, nil]
- *     Array.new(3, true) #=> [true, true, true]
+ *  - Method Kernel#Array:
  *
- *  Note that the second argument populates the array with references to the
- *  same object.  Therefore, it is only recommended in cases when you need to
- *  instantiate arrays with natively immutable objects such as Symbols,
- *  numbers, true or false.
+ *      Array(["a", "b"])             # => ["a", "b"]
+ *      Array(1..5)                   # => [1, 2, 3, 4, 5]
+ *      Array(key: :value)            # => [[:key, :value]]
+ *      Array(nil)                    # => []
+ *      Array(1)                      # => [1]
+ *      Array({:a => "a", :b => "b"}) # => [[:a, "a"], [:b, "b"]]
  *
- *  To create an array with separate objects a block can be passed instead.
- *  This method is safe to use with mutable objects such as hashes, strings or
- *  other arrays:
+ *  - Method Array.new:
  *
- *     Array.new(4) { Hash.new } #=> [{}, {}, {}, {}]
+ *      Array.new               # => []
+ *      Array.new(3)            # => [nil, nil, nil]
+ *      Array.new(4) {Hash.new} # => [{}, {}, {}, {}]
+ *      Array.new(3, true)      # => [true, true, true]
  *
- *  This is also a quick way to build up multi-dimensional arrays:
+ *    Note that the last example above populates the array
+ *    with references to the same object.
+ *    This is recommended only in cases where that object is a natively immutable object
+ *    such as a symbol, a numeric, +nil+, +true+, or +false+.
  *
- *     empty_table = Array.new(3) { Array.new(3) }
- *     #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *    Another way to create an array with various objects, using a block;
+ *    this usage is safe for mutable objects such as hashes, strings or
+ *    other arrays:
  *
- *  An array can also be created by using the Array() method, provided by
- *  Kernel, which tries to call #to_ary, then #to_a on its argument.
+ *      Array.new(4) {|i| i.to_s } # => ["0", "1", "2", "3"]
  *
- *	Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
+ *    Here is a way to create a multi-dimensional array:
+ *
+ *      Array.new(3) {Array.new(3)}
+ *      # => [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *
+ *  A number of Ruby methods, both in the core and in the standard library,
+ *  provide instance method +to_a+, which converts an object to an array.
+ *
+ *  - ARGF#to_a
+ *  - Array#to_a
+ *  - Enumerable#to_a
+ *  - Hash#to_a
+ *  - MatchData#to_a
+ *  - NilClass#to_a
+ *  - OptionParser#to_a
+ *  - Range#to_a
+ *  - Set#to_a
+ *  - Struct#to_a
+ *  - Time#to_a
+ *  - Benchmark::Tms#to_a
+ *  - CSV::Table#to_a
+ *  - Enumerator::Lazy#to_a
+ *  - Gem::List#to_a
+ *  - Gem::NameTuple#to_a
+ *  - Gem::Platform#to_a
+ *  - Gem::RequestSet::Lockfile::Tokenizer#to_a
+ *  - Gem::SourceList#to_a
+ *  - OpenSSL::X509::Extension#to_a
+ *  - OpenSSL::X509::Name#to_a
+ *  - Racc::ISet#to_a
+ *  - Rinda::RingFinger#to_a
+ *  - Ripper::Lexer::Elem#to_a
+ *  - RubyVM::InstructionSequence#to_a
+ *  - YAML::DBM#to_a
  *
  *  == Example Usage
  *
- *  In addition to the methods it mixes in through the Enumerable module, the
- *  Array class has proprietary methods for accessing, searching and otherwise
+ *  In addition to the methods it mixes in through the Enumerable module,
+ *  class \Array has proprietary methods for accessing, searching and otherwise
  *  manipulating arrays.
  *
  *  Some of the more common ones are illustrated below.
@@ -5594,9 +8546,9 @@ rb_ary_any_p(VALUE ary)
  *
  *     arr.drop(3) #=> [4, 5, 6]
  *
- *  == Obtaining Information about an Array
+ *  == Obtaining Information about an \Array
  *
- *  Arrays keep track of their own length at all times.  To query an array
+ *  An array keeps track of its own length at all times.  To query an array
  *  about the number of elements it contains, use #length, #count or #size.
  *
  *    browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
@@ -5611,7 +8563,7 @@ rb_ary_any_p(VALUE ary)
  *
  *    browsers.include?('Konqueror') #=> false
  *
- *  == Adding Items to Arrays
+ *  == Adding Items to an \Array
  *
  *  Items can be added to the end of an array by using either #push or #<<
  *
@@ -5632,7 +8584,7 @@ rb_ary_any_p(VALUE ary)
  *     arr.insert(3, 'orange', 'pear', 'grapefruit')
  *     #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
  *
- *  == Removing Items from an Array
+ *  == Removing Items from an \Array
  *
  *  The method #pop removes the last element in an array and returns it:
  *
@@ -5672,17 +8624,17 @@ rb_ary_any_p(VALUE ary)
  *     arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
  *     arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
  *
- *  == Iterating over Arrays
+ *  == Iterating over an \Array
  *
- *  Like all classes that include the Enumerable module, Array has an each
+ *  Like all classes that include the Enumerable module, class \Array has an each
  *  method, which defines what elements should be iterated over and how.  In
- *  case of Array's #each, all elements in the Array instance are yielded to
+ *  case of Array#each, all elements in +self+ are yielded to
  *  the supplied block in sequence.
  *
  *  Note that this operation leaves the array unchanged.
  *
  *     arr = [1, 2, 3, 4, 5]
- *     arr.each { |a| print a -= 10, " " }
+ *     arr.each {|a| print a -= 10, " "}
  *     # prints: -9 -8 -7 -6 -5
  *     #=> [1, 2, 3, 4, 5]
  *
@@ -5691,18 +8643,19 @@ rb_ary_any_p(VALUE ary)
  *
  *     words = %w[first second third fourth fifth sixth]
  *     str = ""
- *     words.reverse_each { |word| str += "#{word} " }
+ *     words.reverse_each {|word| str += "#{word} "}
  *     p str #=> "sixth fifth fourth third second first "
  *
  *  The #map method can be used to create a new array based on the original
  *  array, but with the values modified by the supplied block:
  *
- *     arr.map { |a| 2*a }   #=> [2, 4, 6, 8, 10]
+ *     arr.map {|a| 2*a}     #=> [2, 4, 6, 8, 10]
  *     arr                   #=> [1, 2, 3, 4, 5]
- *     arr.map! { |a| a**2 } #=> [1, 4, 9, 16, 25]
+ *     arr.map! {|a| a**2}   #=> [1, 4, 9, 16, 25]
  *     arr                   #=> [1, 4, 9, 16, 25]
  *
- *  == Selecting Items from an Array
+ *
+ *  == Selecting Items from an \Array
  *
  *  Elements can be selected from an array according to criteria defined in a
  *  block.  The selection can happen in a destructive or a non-destructive
@@ -5713,9 +8666,9 @@ rb_ary_any_p(VALUE ary)
  *  === Non-destructive Selection
  *
  *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.select { |a| a > 3 }     #=> [4, 5, 6]
- *     arr.reject { |a| a < 3 }     #=> [3, 4, 5, 6]
- *     arr.drop_while { |a| a < 4 } #=> [4, 5, 6]
+ *     arr.select {|a| a > 3}       #=> [4, 5, 6]
+ *     arr.reject {|a| a < 3}       #=> [3, 4, 5, 6]
+ *     arr.drop_while {|a| a < 4}   #=> [4, 5, 6]
  *     arr                          #=> [1, 2, 3, 4, 5, 6]
  *
  *  === Destructive Selection
@@ -5726,25 +8679,190 @@ rb_ary_any_p(VALUE ary)
  *  Similar to #select vs. #reject, #delete_if and #keep_if have the exact
  *  opposite result when supplied with the same block:
  *
- *     arr.delete_if { |a| a < 4 } #=> [4, 5, 6]
+ *     arr.delete_if {|a| a < 4}   #=> [4, 5, 6]
  *     arr                         #=> [4, 5, 6]
  *
  *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.keep_if { |a| a < 4 } #=> [1, 2, 3]
+ *     arr.keep_if {|a| a < 4}   #=> [1, 2, 3]
  *     arr                       #=> [1, 2, 3]
  *
+ *  == What's Here
+ *
+ *  First, what's elsewhere. Class \Array:
+ *
+ *  - Inherits from {class Object}[rdoc-ref:Object@What-27s+Here].
+ *  - Includes {module Enumerable}[rdoc-ref:Enumerable@What-27s+Here],
+ *    which provides dozens of additional methods.
+ *
+ *  Here, class \Array provides methods that are useful for:
+ *
+ *  - {Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array]
+ *  - {Querying}[rdoc-ref:Array@Methods+for+Querying]
+ *  - {Comparing}[rdoc-ref:Array@Methods+for+Comparing]
+ *  - {Fetching}[rdoc-ref:Array@Methods+for+Fetching]
+ *  - {Assigning}[rdoc-ref:Array@Methods+for+Assigning]
+ *  - {Deleting}[rdoc-ref:Array@Methods+for+Deleting]
+ *  - {Combining}[rdoc-ref:Array@Methods+for+Combining]
+ *  - {Iterating}[rdoc-ref:Array@Methods+for+Iterating]
+ *  - {Converting}[rdoc-ref:Array@Methods+for+Converting]
+ *  - {And more....}[rdoc-ref:Array@Other+Methods]
+ *
+ *  === Methods for Creating an \Array
+ *
+ *  - ::[]: Returns a new array populated with given objects.
+ *  - ::new: Returns a new array.
+ *  - ::try_convert: Returns a new array created from a given object.
+ *
+ *  See also {Creating Arrays}[rdoc-ref:Array@Creating+Arrays].
+ *
+ *  === Methods for Querying
+ *
+ *  - #all?: Returns whether all elements meet a given criterion.
+ *  - #any?: Returns whether any element meets a given criterion.
+ *  - #count: Returns the count of elements that meet a given criterion.
+ *  - #empty?: Returns whether there are no elements.
+ *  - #find_index (aliased as #index): Returns the index of the first element that meets a given criterion.
+ *  - #hash: Returns the integer hash code.
+ *  - #include?: Returns whether any element <tt>==</tt> a given object.
+ *  - #length (aliased as #size): Returns the count of elements.
+ *  - #none?: Returns whether no element <tt>==</tt> a given object.
+ *  - #one?: Returns whether exactly one element <tt>==</tt> a given object.
+ *  - #rindex: Returns the index of the last element that meets a given criterion.
+ *
+ *  === Methods for Comparing
+ *
+ *  - #<=>: Returns -1, 0, or 1, as +self+ is less than, equal to, or greater than a given object.
+ *  - #==: Returns whether each element in +self+ is <tt>==</tt> to the corresponding element in a given object.
+ *  - #eql?: Returns whether each element in +self+ is <tt>eql?</tt> to the corresponding element in a given object.
+
+ *  === Methods for Fetching
+ *
+ *  These methods do not modify +self+.
+ *
+ *  - #[] (aliased as #slice): Returns consecutive elements as determined by a given argument.
+ *  - #assoc: Returns the first element that is an array whose first element <tt>==</tt> a given object.
+ *  - #at: Returns the element at a given offset.
+ *  - #bsearch: Returns an element selected via a binary search as determined by a given block.
+ *  - #bsearch_index: Returns the index of an element selected via a binary search as determined by a given block.
+ *  - #compact: Returns an array containing all non-+nil+ elements.
+ *  - #dig: Returns the object in nested objects that is specified by a given index and additional arguments.
+ *  - #drop: Returns trailing elements as determined by a given index.
+ *  - #drop_while: Returns trailing elements as determined by a given block.
+ *  - #fetch: Returns the element at a given offset.
+ *  - #fetch_values: Returns elements at given offsets.
+ *  - #first: Returns one or more leading elements.
+ *  - #last: Returns one or more trailing elements.
+ *  - #max: Returns one or more maximum-valued elements, as determined by <tt>#<=></tt> or a given block.
+ *  - #min: Returns one or more minimum-valued elements, as determined by <tt>#<=></tt> or a given block.
+ *  - #minmax: Returns the minimum-valued and maximum-valued elements, as determined by <tt>#<=></tt> or a given block.
+ *  - #rassoc: Returns the first element that is an array whose second element <tt>==</tt> a given object.
+ *  - #reject: Returns an array containing elements not rejected by a given block.
+ *  - #reverse: Returns all elements in reverse order.
+ *  - #rotate: Returns all elements with some rotated from one end to the other.
+ *  - #sample: Returns one or more random elements.
+ *  - #select (aliased as #filter): Returns an array containing elements selected by a given block.
+ *  - #shuffle: Returns elements in a random order.
+ *  - #sort: Returns all elements in an order determined by <tt>#<=></tt> or a given block.
+ *  - #take: Returns leading elements as determined by a given index.
+ *  - #take_while: Returns leading elements as determined by a given block.
+ *  - #uniq: Returns an array containing non-duplicate elements.
+ *  - #values_at: Returns the elements at given offsets.
+ *
+ *  === Methods for Assigning
+ *
+ *  These methods add, replace, or reorder elements in +self+.
+ *
+ *  - #<<: Appends an element.
+ *  - #[]=: Assigns specified elements with a given object.
+ *  - #concat: Appends all elements from given arrays.
+ *  - #fill: Replaces specified elements with specified objects.
+ *  - #flatten!: Replaces each nested array in +self+ with the elements from that array.
+ *  - #initialize_copy (aliased as #replace): Replaces the content of +self+ with the content of a given array.
+ *  - #insert: Inserts given objects at a given offset; does not replace elements.
+ *  - #push (aliased as #append): Appends elements.
+ *  - #reverse!: Replaces +self+ with its elements reversed.
+ *  - #rotate!: Replaces +self+ with its elements rotated.
+ *  - #shuffle!: Replaces +self+ with its elements in random order.
+ *  - #sort!: Replaces +self+ with its elements sorted, as determined by <tt>#<=></tt> or a given block.
+ *  - #sort_by!: Replaces +self+ with its elements sorted, as determined by a given block.
+ *  - #unshift (aliased as #prepend): Prepends leading elements.
+ *
+ *  === Methods for Deleting
+ *
+ *  Each of these methods removes elements from +self+:
+ *
+ *  - #clear: Removes all elements.
+ *  - #compact!: Removes all +nil+ elements.
+ *  - #delete: Removes elements equal to a given object.
+ *  - #delete_at: Removes the element at a given offset.
+ *  - #delete_if: Removes elements specified by a given block.
+ *  - #keep_if: Removes elements not specified by a given block.
+ *  - #pop: Removes and returns the last element.
+ *  - #reject!: Removes elements specified by a given block.
+ *  - #select! (aliased as #filter!): Removes elements not specified by a given block.
+ *  - #shift:  Removes and returns the first element.
+ *  - #slice!: Removes and returns a sequence of elements.
+ *  - #uniq!: Removes duplicates.
+ *
+ *  === Methods for Combining
+ *
+ *  - #&: Returns an array containing elements found both in +self+ and a given array.
+ *  - #+: Returns an array containing all elements of +self+ followed by all elements of a given array.
+ *  - #-: Returns an array containing all elements of +self+ that are not found in a given array.
+ *  - #|: Returns an array containing all element of +self+ and all elements of a given array, duplicates removed.
+ *  - #difference: Returns an array containing all elements of +self+ that are not found in any of the given arrays..
+ *  - #intersection: Returns an array containing elements found both in +self+ and in each given array.
+ *  - #product: Returns or yields all combinations of elements from +self+ and given arrays.
+ *  - #reverse: Returns an array containing all elements of +self+ in reverse order.
+ *  - #union: Returns an array containing all elements of +self+ and all elements of given arrays, duplicates removed.
+ *
+ *  === Methods for Iterating
+ *
+ *  - #combination: Calls a given block with combinations of elements of +self+; a combination does not use the same element more than once.
+ *  - #cycle: Calls a given block with each element, then does so again, for a specified number of times, or forever.
+ *  - #each: Passes each element to a given block.
+ *  - #each_index: Passes each element index to a given block.
+ *  - #permutation: Calls a given block with permutations of elements of +self+; a permutation does not use the same element more than once.
+ *  - #repeated_combination: Calls a given block with combinations of elements of +self+; a combination may use the same element more than once.
+ *  - #repeated_permutation: Calls a given block with permutations of elements of +self+; a permutation may use the same element more than once.
+ *  - #reverse_each:  Passes each element, in reverse order, to a given block.
+ *
+ *  === Methods for Converting
+ *
+ *  - #collect (aliased as #map): Returns an array containing the block return-value for each element.
+ *  - #collect! (aliased as #map!): Replaces each element with a block return-value.
+ *  - #flatten: Returns an array that is a recursive flattening of +self+.
+ *  - #inspect (aliased as #to_s): Returns a new String containing the elements.
+ *  - #join: Returns a new String containing the elements joined by the field separator.
+ *  - #to_a: Returns +self+ or a new array containing all elements.
+ *  - #to_ary: Returns +self+.
+ *  - #to_h: Returns a new hash formed from the elements.
+ *  - #transpose: Transposes +self+, which must be an array of arrays.
+ *  - #zip: Returns a new array of arrays containing +self+ and given arrays.
+ *
+ *  === Other Methods
+ *
+ *  - #*: Returns one of the following:
+ *
+ *    - With integer argument +n+, a new array that is the concatenation
+ *      of +n+ copies of +self+.
+ *    - With string argument +field_separator+, a new string that is equivalent to
+ *      <tt>join(field_separator)</tt>.
+ *
+ *  - #pack: Packs the elements into a binary sequence.
+ *  - #sum: Returns a sum of elements according to either <tt>+</tt> or a given block.
  */
 
 void
 Init_Array(void)
 {
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
+    fake_ary_flags = init_fake_ary_flags();
 
     rb_cArray  = rb_define_class("Array", rb_cObject);
     rb_include_module(rb_cArray, rb_mEnumerable);
 
     rb_define_alloc_func(rb_cArray, empty_ary_alloc);
+    rb_define_singleton_method(rb_cArray, "new", rb_ary_s_new, -1);
     rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
     rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
     rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
@@ -5755,7 +8873,6 @@ Init_Array(void)
     rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
     rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
     rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
-    rb_define_method(rb_cArray, "frozen?",  rb_ary_frozen_p, 0);
 
     rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
     rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
@@ -5765,21 +8882,28 @@ Init_Array(void)
     rb_define_method(rb_cArray, "[]=", rb_ary_aset, -1);
     rb_define_method(rb_cArray, "at", rb_ary_at, 1);
     rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
-    rb_define_method(rb_cArray, "first", rb_ary_first, -1);
-    rb_define_method(rb_cArray, "last", rb_ary_last, -1);
-    rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
+    rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
+    rb_define_method(rb_cArray, "union", rb_ary_union_multi, -1);
+    rb_define_method(rb_cArray, "difference", rb_ary_difference_multi, -1);
+    rb_define_method(rb_cArray, "intersection", rb_ary_intersection_multi, -1);
+    rb_define_method(rb_cArray, "intersect?", rb_ary_intersect_p, 1);
     rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
     rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
+    rb_define_alias(rb_cArray,  "append", "push");
     rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
     rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
     rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
+    rb_define_alias(rb_cArray,  "prepend", "unshift");
     rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
     rb_define_method(rb_cArray, "each", rb_ary_each, 0);
     rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
     rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
     rb_define_method(rb_cArray, "length", rb_ary_length, 0);
-    rb_define_alias(rb_cArray,  "size", "length");
+    rb_define_method(rb_cArray, "size", rb_ary_length, 0);
     rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
+    rb_define_method(rb_cArray, "find", rb_ary_find, -1);
+    rb_define_method(rb_cArray, "detect", rb_ary_find, -1);
+    rb_define_method(rb_cArray, "rfind", rb_ary_rfind, -1);
     rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
     rb_define_method(rb_cArray, "index", rb_ary_index, -1);
     rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
@@ -5797,6 +8921,8 @@ Init_Array(void)
     rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
     rb_define_method(rb_cArray, "select", rb_ary_select, 0);
     rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+    rb_define_method(rb_cArray, "filter", rb_ary_select, 0);
+    rb_define_method(rb_cArray, "filter!", rb_ary_select_bang, 0);
     rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
     rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
     rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
@@ -5825,6 +8951,10 @@ Init_Array(void)
     rb_define_method(rb_cArray, "&", rb_ary_and, 1);
     rb_define_method(rb_cArray, "|", rb_ary_or, 1);
 
+    rb_define_method(rb_cArray, "max", rb_ary_max, -1);
+    rb_define_method(rb_cArray, "min", rb_ary_min, -1);
+    rb_define_method(rb_cArray, "minmax", rb_ary_minmax, 0);
+
     rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
     rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
     rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
@@ -5832,9 +8962,6 @@ Init_Array(void)
     rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
     rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
     rb_define_method(rb_cArray, "count", rb_ary_count, -1);
-    rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
-    rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
-    rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
     rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
     rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
     rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
@@ -5847,10 +8974,19 @@ Init_Array(void)
     rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
     rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
     rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
-    rb_define_method(rb_cArray, "any?", rb_ary_any_p, 0);
+    rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
+    rb_define_method(rb_cArray, "any?", rb_ary_any_p, -1);
+    rb_define_method(rb_cArray, "all?", rb_ary_all_p, -1);
+    rb_define_method(rb_cArray, "none?", rb_ary_none_p, -1);
+    rb_define_method(rb_cArray, "one?", rb_ary_one_p, -1);
+    rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
+    rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
+    rb_define_method(rb_cArray, "freeze", rb_ary_freeze, 0);
+
+    rb_define_method(rb_cArray, "deconstruct", rb_ary_deconstruct, 0);
 
-    id_cmp = rb_intern("<=>");
-    id_random = rb_intern("random");
-    id_div = rb_intern("div");
-    id_power = rb_intern("**");
+    rb_cArray_empty_frozen = RB_OBJ_SET_SHAREABLE(rb_ary_freeze(rb_ary_new()));
+    rb_vm_register_global_object(rb_cArray_empty_frozen);
 }
+
+#include "array.rbinc"
diff --git a/array.rb b/array.rb
new file mode 100644
index 0000000000..81beff0b1c
--- /dev/null
+++ b/array.rb
@@ -0,0 +1,287 @@
+class Array
+  # call-seq:
+  #   shuffle!(random: Random) -> self
+  #
+  # Shuffles all elements in +self+ into a random order,
+  # as selected by the object given by the keyword argument +random+.
+  # Returns +self+:
+  #
+  #   a =             [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
+  #   a.shuffle! # => [5, 3, 8, 7, 6, 1, 9, 4, 2, 0]
+  #   a.shuffle! # => [9, 4, 0, 6, 2, 8, 1, 5, 3, 7]
+  #
+  # Duplicate elements are included:
+  #
+  #   a =             [0, 1, 0, 1, 0, 1, 0, 1, 0, 1]
+  #   a.shuffle! # => [1, 0, 0, 1, 1, 0, 1, 0, 0, 1]
+  #   a.shuffle! # => [0, 1, 0, 1, 1, 0, 1, 0, 1, 0]
+  #
+  # The object given with the keyword argument +random+ is used as the random number generator.
+  #
+  # Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+  def shuffle!(random: Random)
+    Primitive.rb_ary_shuffle_bang(random)
+  end
+
+  # call-seq:
+  #   shuffle(random: Random) -> new_array
+  #
+  # Returns a new array containing all elements from +self+ in a random order,
+  # as selected by the object given by the keyword argument +random+:
+  #
+  #   a =            [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
+  #   a.shuffle # => [0, 8, 1, 9, 6, 3, 4, 7, 2, 5]
+  #   a.shuffle # => [8, 9, 0, 5, 1, 2, 6, 4, 7, 3]
+  #
+  # Duplicate elements are included:
+  #
+  #   a =            [0, 1, 0, 1, 0, 1, 0, 1, 0, 1]
+  #   a.shuffle # => [1, 0, 1, 1, 0, 0, 1, 0, 0, 1]
+  #   a.shuffle # => [1, 1, 0, 0, 0, 1, 1, 0, 0, 1]
+  #
+  # The object given with the keyword argument +random+ is used as the random number generator.
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def shuffle(random: Random)
+    Primitive.rb_ary_shuffle(random)
+  end
+
+  # call-seq:
+  #   sample(random: Random) -> object
+  #   sample(count, random: Random) -> new_ary
+  #
+  # Returns random elements from +self+,
+  # as selected by the object given by the keyword argument +random+.
+  #
+  # With no argument +count+ given, returns one random element from +self+:
+  #
+  #   a = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
+  #   a.sample # => 3
+  #   a.sample # => 8
+  #
+  # Returns +nil+ if +self+ is empty:
+  #
+  #   [].sample # => nil
+  #
+  # With a non-negative numeric argument +count+ given,
+  # returns a new array containing +count+ random elements from +self+:
+  #
+  #   a.sample(3) # => [8, 9, 2]
+  #   a.sample(6) # => [9, 6, 0, 3, 1, 4]
+  #
+  # The order of the result array is unrelated to the order of +self+.
+  #
+  # Returns a new empty array if +self+ is empty:
+  #
+  #   [].sample(4) # => []
+  #
+  # May return duplicates in +self+:
+  #
+  #   a = [1, 1, 1, 2, 2, 3]
+  #   a.sample(a.size) # => [1, 1, 3, 2, 1, 2]
+  #
+  # Returns no more than <tt>a.size</tt> elements
+  # (because no new duplicates are introduced):
+  #
+  #   a.sample(50) # => [6, 4, 1, 8, 5, 9, 0, 2, 3, 7]
+  #
+  # The object given with the keyword argument +random+ is used as the random number generator:
+  #
+  #   a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+  #   a.sample(random: Random.new(1))     # => 6
+  #   a.sample(4, random: Random.new(1))  # => [6, 10, 9, 2]
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def sample(n = (ary = false), random: Random)
+    if Primitive.mandatory_only?
+      # Primitive.cexpr! %{ rb_ary_sample(self, rb_cRandom, Qfalse, Qfalse) }
+      Primitive.ary_sample0
+    else
+      # Primitive.cexpr! %{ rb_ary_sample(self, random, n, ary) }
+      Primitive.ary_sample(random, n, ary)
+    end
+  end
+
+  # call-seq:
+  #   first -> object or nil
+  #   first(count) -> new_array
+  #
+  # Returns elements from +self+, or +nil+; does not modify +self+.
+  #
+  # With no argument given, returns the first element (if available):
+  #
+  #   a = [:foo, 'bar', 2]
+  #   a.first # => :foo
+  #   a # => [:foo, "bar", 2]
+  #
+  # If +self+ is empty, returns +nil+.
+  #
+  #   [].first # => nil
+  #
+  # With a non-negative integer argument +count+ given,
+  # returns the first +count+ elements (as available) in a new array:
+  #
+  #   a.first(0)  # => []
+  #   a.first(2)  # => [:foo, "bar"]
+  #   a.first(50) # => [:foo, "bar", 2]
+  #
+  # Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+  def first n = unspecified = true
+    if Primitive.mandatory_only?
+      Primitive.attr! :leaf
+      Primitive.cexpr! %q{ ary_first(self) }
+    else
+      if unspecified
+        Primitive.cexpr! %q{ ary_first(self) }
+      else
+        Primitive.cexpr! %q{  ary_take_first_or_last_n(self, NUM2LONG(n), ARY_TAKE_FIRST) }
+      end
+    end
+  end
+
+  # call-seq:
+  #  last  -> last_object or nil
+  #  last(count) -> new_array
+  #
+  # Returns elements from +self+, or +nil+; +self+ is not modified.
+  #
+  # With no argument given, returns the last element, or +nil+ if +self+ is empty:
+  #
+  #   a = [:foo, 'bar', 2]
+  #   a.last # => 2
+  #   a # => [:foo, "bar", 2]
+  #   [].last # => nil
+  #
+  #
+  # With non-negative integer argument +count+ given,
+  # returns a new array containing the trailing +count+ elements of +self+, as available:
+  #
+  #   a = [:foo, 'bar', 2]
+  #   a.last(2)  # => ["bar", 2]
+  #   a.last(50) # => [:foo, "bar", 2]
+  #   a.last(0)  # => []
+  #   [].last(3) # => []
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def last n = unspecified = true
+    if Primitive.mandatory_only?
+      Primitive.attr! :leaf
+      Primitive.cexpr! %q{ ary_last(self) }
+    else
+      if unspecified
+        Primitive.cexpr! %q{ ary_last(self) }
+      else
+        Primitive.cexpr! %q{ ary_take_first_or_last_n(self, NUM2LONG(n), ARY_TAKE_LAST) }
+      end
+    end
+  end
+
+  # call-seq:
+  #   fetch_values(*indexes) -> new_array
+  #   fetch_values(*indexes) { |index| ... } -> new_array
+  #
+  # With no block given, returns a new array containing the elements of +self+
+  # at the offsets specified by +indexes+. Each of the +indexes+ must be an
+  # {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]:
+  #
+  #    a = [:foo, :bar, :baz]
+  #    a.fetch_values(2, 0)   # => [:baz, :foo]
+  #    a.fetch_values(2.1, 0) # => [:baz, :foo]
+  #    a.fetch_values         # => []
+  #
+  # For a negative index, counts backwards from the end of the array:
+  #
+  #    a.fetch_values(-2, -1) # [:bar, :baz]
+  #
+  # When no block is given, raises an exception if any index is out of range.
+  #
+  # With a block given, for each index:
+  #
+  # - If the index is in range, uses an element of +self+ (as above).
+  # - Otherwise, calls the block with the index and uses the block's return value.
+  #
+  # Example:
+  #
+  #   a = [:foo, :bar, :baz]
+  #   a.fetch_values(1, 0, 42, 777) { |index| index.to_s }
+  #   # => [:bar, :foo, "42", "777"]
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def fetch_values(*indexes, &block)
+    indexes.map! { |i| fetch(i, &block) }
+    indexes
+  end
+
+  with_jit do
+    if Primitive.rb_builtin_basic_definition_p(:each)
+      undef :each
+
+      def each # :nodoc:
+        Primitive.attr! :inline_block, :c_trace
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+        _i = 0
+        value = nil
+        while Primitive.cexpr!(%q{ ary_fetch_next(self, LOCAL_PTR(_i), LOCAL_PTR(value)) })
+          yield value
+        end
+        self
+      end
+    end
+
+    if Primitive.rb_builtin_basic_definition_p(:map)
+      undef :map
+
+      def map # :nodoc:
+        Primitive.attr! :inline_block, :c_trace
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+
+        _i = 0
+        value = nil
+        result = Primitive.ary_sized_alloc
+        while Primitive.cexpr!(%q{ ary_fetch_next(self, LOCAL_PTR(_i), LOCAL_PTR(value)) })
+          value = yield(value)
+          Primitive.cexpr!(%q{ rb_ary_push(result, value) })
+        end
+        result
+      end
+
+      if Primitive.rb_builtin_basic_definition_p(:collect)
+        undef :collect
+        alias collect map
+      end
+    end
+
+    if Primitive.rb_builtin_basic_definition_p(:select)
+      undef :select
+
+      def select # :nodoc:
+        Primitive.attr! :inline_block, :c_trace
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+
+        _i = 0
+        value = nil
+        result = Primitive.ary_sized_alloc
+        while Primitive.cexpr!(%q{ ary_fetch_next(self, LOCAL_PTR(_i), LOCAL_PTR(value)) })
+          if yield value
+            Primitive.cexpr!(%q{ rb_ary_push(result, value) })
+          end
+        end
+        result
+      end
+
+      if Primitive.rb_builtin_basic_definition_p(:filter)
+        undef :filter
+        alias filter select
+      end
+    end
+  end
+end
diff --git a/ast.c b/ast.c
new file mode 100644
index 0000000000..5357aa38a5
--- /dev/null
+++ b/ast.c
@@ -0,0 +1,1165 @@
+/* indent-tabs-mode: nil */
+#include "internal.h"
+#include "internal/ruby_parser.h"
+#include "internal/symbol.h"
+#include "internal/warnings.h"
+#include "iseq.h"
+#include "node.h"
+#include "ruby.h"
+#include "ruby/encoding.h"
+#include "ruby/util.h"
+#include "vm_core.h"
+
+#include "builtin.h"
+
+static VALUE rb_mAST;
+static VALUE rb_cNode;
+static VALUE rb_cLocation;
+
+struct ASTNodeData {
+    VALUE ast_value;
+    const NODE *node;
+};
+
+static void
+node_gc_mark(void *ptr)
+{
+    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+    rb_gc_mark(data->ast_value);
+}
+
+static size_t
+node_memsize(const void *ptr)
+{
+    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+    size_t size = sizeof(struct ASTNodeData);
+    if (data->ast_value) {
+        rb_ast_t *ast = rb_ruby_ast_data_get(data->ast_value);
+        size += rb_ast_memsize(ast);
+    }
+
+    return size;
+}
+
+static const rb_data_type_t rb_node_type = {
+    "AST/node",
+    {node_gc_mark, RUBY_TYPED_DEFAULT_FREE, node_memsize,},
+    0, 0,
+    RUBY_TYPED_FREE_IMMEDIATELY,
+};
+
+struct ASTLocationData {
+    int first_lineno;
+    int first_column;
+    int last_lineno;
+    int last_column;
+};
+
+static void
+location_gc_mark(void *ptr)
+{
+}
+
+static size_t
+location_memsize(const void *ptr)
+{
+    return sizeof(struct ASTLocationData);
+}
+
+static const rb_data_type_t rb_location_type = {
+    "AST/location",
+    {location_gc_mark, RUBY_TYPED_DEFAULT_FREE, location_memsize,},
+    0, 0,
+    RUBY_TYPED_FREE_IMMEDIATELY,
+};
+
+
+static VALUE rb_ast_node_alloc(VALUE klass);
+
+static void
+setup_node(VALUE obj, VALUE ast_value, const NODE *node)
+{
+    struct ASTNodeData *data;
+
+    TypedData_Get_Struct(obj, struct ASTNodeData, &rb_node_type, data);
+    data->ast_value = ast_value;
+    data->node = node;
+}
+
+static VALUE
+ast_new_internal(VALUE ast_value, const NODE *node)
+{
+    VALUE obj;
+
+    obj = rb_ast_node_alloc(rb_cNode);
+    setup_node(obj, ast_value, node);
+
+    return obj;
+}
+
+static VALUE rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+static VALUE rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+
+static VALUE
+ast_parse_new(void)
+{
+    return rb_parser_set_context(rb_parser_new(), NULL, 0);
+}
+
+static VALUE
+ast_parse_done(VALUE ast_value)
+{
+    rb_ast_t *ast = rb_ruby_ast_data_get(ast_value);
+
+    if (!ast->body.root) {
+        rb_ast_dispose(ast);
+        rb_exc_raise(GET_EC()->errinfo);
+    }
+
+    return ast_new_internal(ast_value, (NODE *)ast->body.root);
+}
+
+static VALUE
+setup_vparser(VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE vparser = ast_parse_new();
+    if (RTEST(keep_script_lines)) rb_parser_set_script_lines(vparser);
+    if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
+    if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
+    return vparser;
+}
+
+static VALUE
+ast_s_parse(rb_execution_context_t *ec, VALUE module, VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    return rb_ast_parse_str(str, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE ast_value = Qnil;
+    StringValue(str);
+    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
+    ast_value = rb_parser_compile_string_path(vparser, Qnil, str, 1);
+    return ast_parse_done(ast_value);
+}
+
+static VALUE
+ast_s_parse_file(rb_execution_context_t *ec, VALUE module, VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    return rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE f;
+    VALUE ast_value = Qnil;
+    rb_encoding *enc = rb_utf8_encoding();
+
+    f = rb_file_open_str(path, "r");
+    rb_funcall(f, rb_intern("set_encoding"), 2, rb_enc_from_encoding(enc), rb_str_new_cstr("-"));
+    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
+    ast_value = rb_parser_compile_file_path(vparser, Qnil, f, 1);
+    rb_io_close(f);
+    return ast_parse_done(ast_value);
+}
+
+static VALUE
+rb_ast_parse_array(VALUE array, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE ast_value = Qnil;
+
+    array = rb_check_array_type(array);
+    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
+    ast_value = rb_parser_compile_array(vparser, Qnil, array, 1);
+    return ast_parse_done(ast_value);
+}
+
+static VALUE node_children(VALUE, const NODE*);
+
+static VALUE
+node_find(VALUE self, const int node_id)
+{
+    VALUE ary;
+    long i;
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    if (nd_node_id(data->node) == node_id) return self;
+
+    ary = node_children(data->ast_value, data->node);
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        VALUE child = RARRAY_AREF(ary, i);
+
+        if (CLASS_OF(child) == rb_cNode) {
+            VALUE result = node_find(child, node_id);
+            if (RTEST(result)) return result;
+        }
+    }
+
+    return Qnil;
+}
+
+extern VALUE rb_e_script;
+
+static VALUE
+node_id_for_backtrace_location(rb_execution_context_t *ec, VALUE module, VALUE location)
+{
+    int node_id;
+
+    if (!rb_frame_info_p(location)) {
+        rb_raise(rb_eTypeError, "Thread::Backtrace::Location object expected");
+    }
+
+    node_id = rb_get_node_id_from_frame_info(location);
+    if (node_id == -1) {
+        return Qnil;
+    }
+
+    return INT2NUM(node_id);
+}
+
+static VALUE
+ast_s_of(rb_execution_context_t *ec, VALUE module, VALUE body, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE node, lines = Qnil;
+    const rb_iseq_t *iseq;
+    int node_id;
+
+    if (rb_frame_info_p(body)) {
+        iseq = rb_get_iseq_from_frame_info(body);
+        node_id = rb_get_node_id_from_frame_info(body);
+    }
+    else {
+        iseq = NULL;
+
+        if (rb_obj_is_proc(body)) {
+            iseq = vm_proc_iseq(body);
+
+            if (!rb_obj_is_iseq((VALUE)iseq)) return Qnil;
+        }
+        else {
+            iseq = rb_method_iseq(body);
+        }
+        if (iseq) {
+            node_id = ISEQ_BODY(iseq)->location.node_id;
+        }
+    }
+
+    if (!iseq) {
+        return Qnil;
+    }
+
+    if (ISEQ_BODY(iseq)->prism) {
+        rb_raise(rb_eRuntimeError, "cannot get AST for ISEQ compiled by prism");
+    }
+
+    lines = ISEQ_BODY(iseq)->variable.script_lines;
+
+    VALUE path = rb_iseq_path(iseq);
+    int e_option = RSTRING_LEN(path) == 2 && memcmp(RSTRING_PTR(path), "-e", 2) == 0;
+
+    if (NIL_P(lines) && rb_iseq_from_eval_p(iseq) && !e_option) {
+        rb_raise(rb_eArgError, "cannot get AST for method defined in eval");
+    }
+
+    if (!NIL_P(lines)) {
+        node = rb_ast_parse_array(lines, keep_script_lines, error_tolerant, keep_tokens);
+    }
+    else if (e_option) {
+        node = rb_ast_parse_str(rb_e_script, keep_script_lines, error_tolerant, keep_tokens);
+    }
+    else {
+        node = rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+    }
+
+    return node_find(node, node_id);
+}
+
+static VALUE
+rb_ast_node_alloc(VALUE klass)
+{
+    struct ASTNodeData *data;
+    VALUE obj = TypedData_Make_Struct(klass, struct ASTNodeData, &rb_node_type, data);
+
+    return obj;
+}
+
+static const char*
+node_type_to_str(const NODE *node)
+{
+    return (ruby_node_name(nd_type(node)) + rb_strlen_lit("NODE_"));
+}
+
+static VALUE
+ast_node_type(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return rb_sym_intern_ascii_cstr(node_type_to_str(data->node));
+}
+
+static VALUE
+ast_node_node_id(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2FIX(nd_node_id(data->node));
+}
+
+#define NEW_CHILD(ast_value, node) (node ? ast_new_internal(ast_value, node) : Qnil)
+
+static VALUE
+rb_ary_new_from_node_args(VALUE ast_value, long n, ...)
+{
+    va_list ar;
+    VALUE ary;
+    long i;
+
+    ary = rb_ary_new2(n);
+
+    va_start(ar, n);
+    for (i=0; i<n; i++) {
+        NODE *node;
+        node = va_arg(ar, NODE *);
+        rb_ary_push(ary, NEW_CHILD(ast_value, node));
+    }
+    va_end(ar);
+    return ary;
+}
+
+static VALUE
+dump_block(VALUE ast_value, const struct RNode_BLOCK *node)
+{
+    VALUE ary = rb_ary_new();
+    do {
+        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
+    } while (node->nd_next &&
+        nd_type_p(node->nd_next, NODE_BLOCK) &&
+        (node = RNODE_BLOCK(node->nd_next), 1));
+    if (node->nd_next) {
+        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_next));
+    }
+
+    return ary;
+}
+
+static VALUE
+dump_array(VALUE ast_value, const struct RNode_LIST *node)
+{
+    VALUE ary = rb_ary_new();
+    rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
+
+    while (node->nd_next && nd_type_p(node->nd_next, NODE_LIST)) {
+        node = RNODE_LIST(node->nd_next);
+        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
+    }
+    rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_next));
+
+    return ary;
+}
+
+static VALUE
+dump_parser_array(VALUE ast_value, rb_parser_ary_t *p_ary)
+{
+    VALUE ary;
+
+    if (p_ary->data_type != PARSER_ARY_DATA_NODE) {
+        rb_bug("unexpected rb_parser_ary_data_type: %d", p_ary->data_type);
+    }
+
+    ary = rb_ary_new();
+
+    for (long i = 0; i < p_ary->len; i++) {
+        rb_ary_push(ary, NEW_CHILD(ast_value, p_ary->data[i]));
+    }
+
+    return ary;
+}
+
+static VALUE
+var_name(ID id)
+{
+    if (!id) return Qnil;
+    if (!rb_id2str(id)) return Qnil;
+    return ID2SYM(id);
+}
+
+static VALUE
+no_name_rest(void)
+{
+    ID rest;
+    CONST_ID(rest, "NODE_SPECIAL_NO_NAME_REST");
+    return ID2SYM(rest);
+}
+
+static VALUE
+rest_arg(VALUE ast_value, const NODE *rest_arg)
+{
+    return NODE_NAMED_REST_P(rest_arg) ? NEW_CHILD(ast_value, rest_arg) : no_name_rest();
+}
+
+static VALUE
+node_children(VALUE ast_value, const NODE *node)
+{
+    char name[sizeof("$") + DECIMAL_SIZE_OF(long)];
+
+    enum node_type type = nd_type(node);
+    switch (type) {
+      case NODE_BLOCK:
+        return dump_block(ast_value, RNODE_BLOCK(node));
+      case NODE_IF:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_IF(node)->nd_cond, RNODE_IF(node)->nd_body, RNODE_IF(node)->nd_else);
+      case NODE_UNLESS:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_UNLESS(node)->nd_cond, RNODE_UNLESS(node)->nd_body, RNODE_UNLESS(node)->nd_else);
+      case NODE_CASE:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE(node)->nd_head, RNODE_CASE(node)->nd_body);
+      case NODE_CASE2:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE2(node)->nd_head, RNODE_CASE2(node)->nd_body);
+      case NODE_CASE3:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE3(node)->nd_head, RNODE_CASE3(node)->nd_body);
+      case NODE_WHEN:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_WHEN(node)->nd_head, RNODE_WHEN(node)->nd_body, RNODE_WHEN(node)->nd_next);
+      case NODE_IN:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_IN(node)->nd_head, RNODE_IN(node)->nd_body, RNODE_IN(node)->nd_next);
+      case NODE_WHILE:
+      case NODE_UNTIL:
+        return rb_ary_push(rb_ary_new_from_node_args(ast_value, 2, RNODE_WHILE(node)->nd_cond, RNODE_WHILE(node)->nd_body),
+                           RBOOL(RNODE_WHILE(node)->nd_state));
+      case NODE_ITER:
+      case NODE_FOR:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ITER(node)->nd_iter, RNODE_ITER(node)->nd_body);
+      case NODE_FOR_MASGN:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_FOR_MASGN(node)->nd_var);
+      case NODE_BREAK:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_BREAK(node)->nd_stts);
+      case NODE_NEXT:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_NEXT(node)->nd_stts);
+      case NODE_RETURN:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_RETURN(node)->nd_stts);
+      case NODE_REDO:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_RETRY:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_BEGIN:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_BEGIN(node)->nd_body);
+      case NODE_RESCUE:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_RESCUE(node)->nd_head, RNODE_RESCUE(node)->nd_resq, RNODE_RESCUE(node)->nd_else);
+      case NODE_RESBODY:
+        return rb_ary_new_from_node_args(ast_value, 4, RNODE_RESBODY(node)->nd_args, RNODE_RESBODY(node)->nd_exc_var, RNODE_RESBODY(node)->nd_body, RNODE_RESBODY(node)->nd_next);
+      case NODE_ENSURE:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ENSURE(node)->nd_head, RNODE_ENSURE(node)->nd_ensr);
+      case NODE_AND:
+      case NODE_OR:
+        {
+            VALUE ary = rb_ary_new();
+
+            while (1) {
+                rb_ary_push(ary, NEW_CHILD(ast_value, RNODE_AND(node)->nd_1st));
+                if (!RNODE_AND(node)->nd_2nd || !nd_type_p(RNODE_AND(node)->nd_2nd, type))
+                    break;
+                node = RNODE_AND(node)->nd_2nd;
+            }
+            rb_ary_push(ary, NEW_CHILD(ast_value, RNODE_AND(node)->nd_2nd));
+            return ary;
+        }
+      case NODE_MASGN:
+        if (NODE_NAMED_REST_P(RNODE_MASGN(node)->nd_args)) {
+            return rb_ary_new_from_node_args(ast_value, 3, RNODE_MASGN(node)->nd_value, RNODE_MASGN(node)->nd_head, RNODE_MASGN(node)->nd_args);
+        }
+        else {
+            return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_MASGN(node)->nd_value),
+                                        NEW_CHILD(ast_value, RNODE_MASGN(node)->nd_head),
+                                        no_name_rest());
+        }
+      case NODE_LASGN:
+        if (NODE_REQUIRED_KEYWORD_P(RNODE_LASGN(node)->nd_value)) {
+            return rb_ary_new_from_args(2, var_name(RNODE_LASGN(node)->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
+        }
+        return rb_ary_new_from_args(2, var_name(RNODE_LASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_LASGN(node)->nd_value));
+      case NODE_DASGN:
+        if (NODE_REQUIRED_KEYWORD_P(RNODE_DASGN(node)->nd_value)) {
+            return rb_ary_new_from_args(2, var_name(RNODE_DASGN(node)->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
+        }
+        return rb_ary_new_from_args(2, var_name(RNODE_DASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_DASGN(node)->nd_value));
+      case NODE_IASGN:
+        return rb_ary_new_from_args(2, var_name(RNODE_IASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_IASGN(node)->nd_value));
+      case NODE_CVASGN:
+        return rb_ary_new_from_args(2, var_name(RNODE_CVASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_CVASGN(node)->nd_value));
+      case NODE_GASGN:
+        return rb_ary_new_from_args(2, var_name(RNODE_GASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_GASGN(node)->nd_value));
+      case NODE_CDECL:
+        if (RNODE_CDECL(node)->nd_vid) {
+            return rb_ary_new_from_args(2, ID2SYM(RNODE_CDECL(node)->nd_vid), NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_value));
+        }
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_else), ID2SYM(RNODE_COLON2(RNODE_CDECL(node)->nd_else)->nd_mid), NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_value));
+      case NODE_OP_ASGN1:
+        return rb_ary_new_from_args(4, NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_recv),
+                                    ID2SYM(RNODE_OP_ASGN1(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_index),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_rvalue));
+      case NODE_OP_ASGN2:
+        return rb_ary_new_from_args(5, NEW_CHILD(ast_value, RNODE_OP_ASGN2(node)->nd_recv),
+                                    RBOOL(RNODE_OP_ASGN2(node)->nd_aid),
+                                    ID2SYM(RNODE_OP_ASGN2(node)->nd_vid),
+                                    ID2SYM(RNODE_OP_ASGN2(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN2(node)->nd_value));
+      case NODE_OP_ASGN_AND:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_ASGN_AND(node)->nd_head), ID2SYM(idANDOP),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN_AND(node)->nd_value));
+      case NODE_OP_ASGN_OR:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_ASGN_OR(node)->nd_head), ID2SYM(idOROP),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN_OR(node)->nd_value));
+      case NODE_OP_CDECL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_CDECL(node)->nd_head),
+                                    ID2SYM(RNODE_OP_CDECL(node)->nd_aid),
+                                    NEW_CHILD(ast_value, RNODE_OP_CDECL(node)->nd_value));
+      case NODE_CALL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_CALL(node)->nd_recv),
+                                    ID2SYM(RNODE_CALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_CALL(node)->nd_args));
+      case NODE_OPCALL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OPCALL(node)->nd_recv),
+                                    ID2SYM(RNODE_OPCALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_OPCALL(node)->nd_args));
+      case NODE_QCALL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_QCALL(node)->nd_recv),
+                                    ID2SYM(RNODE_QCALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_QCALL(node)->nd_args));
+      case NODE_FCALL:
+        return rb_ary_new_from_args(2, ID2SYM(RNODE_FCALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_FCALL(node)->nd_args));
+      case NODE_VCALL:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_VCALL(node)->nd_mid));
+      case NODE_SUPER:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_SUPER(node)->nd_args);
+      case NODE_ZSUPER:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_LIST:
+        return dump_array(ast_value, RNODE_LIST(node));
+      case NODE_ZLIST:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_HASH:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_HASH(node)->nd_head);
+      case NODE_YIELD:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_YIELD(node)->nd_head);
+      case NODE_LVAR:
+        return rb_ary_new_from_args(1, var_name(RNODE_LVAR(node)->nd_vid));
+      case NODE_DVAR:
+        return rb_ary_new_from_args(1, var_name(RNODE_DVAR(node)->nd_vid));
+      case NODE_IVAR:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_IVAR(node)->nd_vid));
+      case NODE_CONST:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_CONST(node)->nd_vid));
+      case NODE_CVAR:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_CVAR(node)->nd_vid));
+      case NODE_GVAR:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_GVAR(node)->nd_vid));
+      case NODE_NTH_REF:
+        snprintf(name, sizeof(name), "$%ld", RNODE_NTH_REF(node)->nd_nth);
+        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+      case NODE_BACK_REF:
+        name[0] = '$';
+        name[1] = (char)RNODE_BACK_REF(node)->nd_nth;
+        name[2] = '\0';
+        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+      case NODE_MATCH:
+        return rb_ary_new_from_args(1, rb_node_regx_string_val(node));
+      case NODE_MATCH2:
+        if (RNODE_MATCH2(node)->nd_args) {
+            return rb_ary_new_from_node_args(ast_value, 3, RNODE_MATCH2(node)->nd_recv, RNODE_MATCH2(node)->nd_value, RNODE_MATCH2(node)->nd_args);
+        }
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MATCH2(node)->nd_recv, RNODE_MATCH2(node)->nd_value);
+      case NODE_MATCH3:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MATCH3(node)->nd_recv, RNODE_MATCH3(node)->nd_value);
+      case NODE_STR:
+      case NODE_XSTR:
+        return rb_ary_new_from_args(1, rb_node_str_string_val(node));
+      case NODE_INTEGER:
+        return rb_ary_new_from_args(1, rb_node_integer_literal_val(node));
+      case NODE_FLOAT:
+        return rb_ary_new_from_args(1, rb_node_float_literal_val(node));
+      case NODE_RATIONAL:
+        return rb_ary_new_from_args(1, rb_node_rational_literal_val(node));
+      case NODE_IMAGINARY:
+        return rb_ary_new_from_args(1, rb_node_imaginary_literal_val(node));
+      case NODE_REGX:
+        return rb_ary_new_from_args(1, rb_node_regx_string_val(node));
+      case NODE_ONCE:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_ONCE(node)->nd_body);
+      case NODE_DSTR:
+      case NODE_DXSTR:
+      case NODE_DREGX:
+      case NODE_DSYM:
+        {
+            struct RNode_LIST *n = RNODE_DSTR(node)->nd_next;
+            VALUE head = Qnil, next = Qnil;
+            if (n) {
+                head = NEW_CHILD(ast_value, n->nd_head);
+                next = NEW_CHILD(ast_value, n->nd_next);
+            }
+            return rb_ary_new_from_args(3, rb_node_dstr_string_val(node), head, next);
+        }
+      case NODE_SYM:
+        return rb_ary_new_from_args(1, rb_node_sym_string_val(node));
+      case NODE_EVSTR:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_EVSTR(node)->nd_body);
+      case NODE_ARGSCAT:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ARGSCAT(node)->nd_head, RNODE_ARGSCAT(node)->nd_body);
+      case NODE_ARGSPUSH:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ARGSPUSH(node)->nd_head, RNODE_ARGSPUSH(node)->nd_body);
+      case NODE_SPLAT:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_SPLAT(node)->nd_head);
+      case NODE_BLOCK_PASS:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_BLOCK_PASS(node)->nd_head, RNODE_BLOCK_PASS(node)->nd_body);
+      case NODE_DEFN:
+        return rb_ary_new_from_args(2, ID2SYM(RNODE_DEFN(node)->nd_mid), NEW_CHILD(ast_value, RNODE_DEFN(node)->nd_defn));
+      case NODE_DEFS:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_DEFS(node)->nd_recv), ID2SYM(RNODE_DEFS(node)->nd_mid), NEW_CHILD(ast_value, RNODE_DEFS(node)->nd_defn));
+      case NODE_ALIAS:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ALIAS(node)->nd_1st, RNODE_ALIAS(node)->nd_2nd);
+      case NODE_VALIAS:
+        return rb_ary_new_from_args(2, ID2SYM(RNODE_VALIAS(node)->nd_alias), ID2SYM(RNODE_VALIAS(node)->nd_orig));
+      case NODE_UNDEF:
+        return rb_ary_new_from_args(1, dump_parser_array(ast_value, RNODE_UNDEF(node)->nd_undefs));
+      case NODE_CLASS:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_CLASS(node)->nd_cpath, RNODE_CLASS(node)->nd_super, RNODE_CLASS(node)->nd_body);
+      case NODE_MODULE:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MODULE(node)->nd_cpath, RNODE_MODULE(node)->nd_body);
+      case NODE_SCLASS:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_SCLASS(node)->nd_recv, RNODE_SCLASS(node)->nd_body);
+      case NODE_COLON2:
+        return rb_ary_new_from_args(2, NEW_CHILD(ast_value, RNODE_COLON2(node)->nd_head), ID2SYM(RNODE_COLON2(node)->nd_mid));
+      case NODE_COLON3:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_COLON3(node)->nd_mid));
+      case NODE_DOT2:
+      case NODE_DOT3:
+      case NODE_FLIP2:
+      case NODE_FLIP3:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_DOT2(node)->nd_beg, RNODE_DOT2(node)->nd_end);
+      case NODE_SELF:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_NIL:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_TRUE:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_FALSE:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_ERRINFO:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_DEFINED:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_DEFINED(node)->nd_head);
+      case NODE_POSTEXE:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_POSTEXE(node)->nd_body);
+      case NODE_ATTRASGN:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_ATTRASGN(node)->nd_recv), ID2SYM(RNODE_ATTRASGN(node)->nd_mid), NEW_CHILD(ast_value, RNODE_ATTRASGN(node)->nd_args));
+      case NODE_LAMBDA:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_LAMBDA(node)->nd_body);
+      case NODE_OPT_ARG:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_OPT_ARG(node)->nd_body, RNODE_OPT_ARG(node)->nd_next);
+      case NODE_KW_ARG:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_KW_ARG(node)->nd_body, RNODE_KW_ARG(node)->nd_next);
+      case NODE_POSTARG:
+        if (NODE_NAMED_REST_P(RNODE_POSTARG(node)->nd_1st)) {
+            return rb_ary_new_from_node_args(ast_value, 2, RNODE_POSTARG(node)->nd_1st, RNODE_POSTARG(node)->nd_2nd);
+        }
+        return rb_ary_new_from_args(2, no_name_rest(),
+                                    NEW_CHILD(ast_value, RNODE_POSTARG(node)->nd_2nd));
+      case NODE_ARGS:
+        {
+            struct rb_args_info *ainfo = &RNODE_ARGS(node)->nd_ainfo;
+            return rb_ary_new_from_args(10,
+                                        INT2NUM(ainfo->pre_args_num),
+                                        NEW_CHILD(ast_value, ainfo->pre_init),
+                                        NEW_CHILD(ast_value, (NODE *)ainfo->opt_args),
+                                        var_name(ainfo->first_post_arg),
+                                        INT2NUM(ainfo->post_args_num),
+                                        NEW_CHILD(ast_value, ainfo->post_init),
+                                        (ainfo->rest_arg == NODE_SPECIAL_EXCESSIVE_COMMA
+                                            ? ID2SYM(rb_intern("NODE_SPECIAL_EXCESSIVE_COMMA"))
+                                            : var_name(ainfo->rest_arg)),
+                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast_value, (NODE *)ainfo->kw_args)),
+                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast_value, ainfo->kw_rest_arg)),
+                                        var_name(ainfo->block_arg));
+        }
+      case NODE_SCOPE:
+        {
+            rb_ast_id_table_t *tbl = RNODE_SCOPE(node)->nd_tbl;
+            int i, size = tbl ? tbl->size : 0;
+            VALUE locals = rb_ary_new_capa(size);
+            for (i = 0; i < size; i++) {
+                rb_ary_push(locals, var_name(tbl->ids[i]));
+            }
+            return rb_ary_new_from_args(3, locals, NEW_CHILD(ast_value, (NODE *)RNODE_SCOPE(node)->nd_args), NEW_CHILD(ast_value, RNODE_SCOPE(node)->nd_body));
+        }
+      case NODE_ARYPTN:
+        {
+            VALUE rest = rest_arg(ast_value, RNODE_ARYPTN(node)->rest_arg);
+            return rb_ary_new_from_args(4,
+                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->nd_pconst),
+                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->pre_args),
+                                        rest,
+                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->post_args));
+        }
+      case NODE_FNDPTN:
+        {
+            VALUE pre_rest = rest_arg(ast_value, RNODE_FNDPTN(node)->pre_rest_arg);
+            VALUE post_rest = rest_arg(ast_value, RNODE_FNDPTN(node)->post_rest_arg);
+            return rb_ary_new_from_args(4,
+                                        NEW_CHILD(ast_value, RNODE_FNDPTN(node)->nd_pconst),
+                                        pre_rest,
+                                        NEW_CHILD(ast_value, RNODE_FNDPTN(node)->args),
+                                        post_rest);
+        }
+      case NODE_HSHPTN:
+        {
+            VALUE kwrest = RNODE_HSHPTN(node)->nd_pkwrestarg == NODE_SPECIAL_NO_REST_KEYWORD ? ID2SYM(rb_intern("NODE_SPECIAL_NO_REST_KEYWORD")) :
+                                                                                 NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pkwrestarg);
+
+            return rb_ary_new_from_args(3,
+                                        NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pconst),
+                                        NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pkwargs),
+                                        kwrest);
+        }
+      case NODE_LINE:
+        return rb_ary_new_from_args(1, rb_node_line_lineno_val(node));
+      case NODE_FILE:
+        return rb_ary_new_from_args(1, rb_node_file_path_val(node));
+      case NODE_ENCODING:
+        return rb_ary_new_from_args(1, rb_node_encoding_val(node));
+      case NODE_ERROR:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_ARGS_AUX:
+      case NODE_LAST:
+        break;
+    }
+
+    rb_bug("node_children: unknown node: %s", ruby_node_name(type));
+}
+
+static VALUE
+ast_node_children(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return node_children(data->ast_value, data->node);
+}
+
+static int
+null_loc_p(rb_code_location_t *loc)
+{
+    return (loc->beg_pos.lineno == 0 && loc->beg_pos.column == -1 && loc->end_pos.lineno == 0 && loc->end_pos.column == -1);
+}
+
+static VALUE
+location_new(rb_code_location_t *loc)
+{
+    VALUE obj;
+    struct ASTLocationData *data;
+
+    if (null_loc_p(loc)) return Qnil;
+
+    obj = TypedData_Make_Struct(rb_cLocation, struct ASTLocationData, &rb_location_type, data);
+    data->first_lineno = loc->beg_pos.lineno;
+    data->first_column = loc->beg_pos.column;
+    data->last_lineno = loc->end_pos.lineno;
+    data->last_column = loc->end_pos.column;
+
+    return obj;
+}
+
+static VALUE
+node_locations(VALUE ast_value, const NODE *node)
+{
+    enum node_type type = nd_type(node);
+    switch (type) {
+      case NODE_ALIAS:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_ALIAS(node)->keyword_loc));
+      case NODE_AND:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_AND(node)->operator_loc));
+      case NODE_BLOCK_PASS:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_BLOCK_PASS(node)->operator_loc));
+      case NODE_BREAK:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_BREAK(node)->keyword_loc));
+      case NODE_CASE:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CASE(node)->case_keyword_loc),
+                                    location_new(&RNODE_CASE(node)->end_keyword_loc));
+      case NODE_CASE2:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CASE2(node)->case_keyword_loc),
+                                    location_new(&RNODE_CASE2(node)->end_keyword_loc));
+      case NODE_CASE3:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CASE3(node)->case_keyword_loc),
+                                    location_new(&RNODE_CASE3(node)->end_keyword_loc));
+      case NODE_CLASS:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CLASS(node)->class_keyword_loc),
+                                    location_new(&RNODE_CLASS(node)->inheritance_operator_loc),
+                                    location_new(&RNODE_CLASS(node)->end_keyword_loc));
+      case NODE_COLON2:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_COLON2(node)->delimiter_loc),
+                                    location_new(&RNODE_COLON2(node)->name_loc));
+      case NODE_COLON3:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_COLON3(node)->delimiter_loc),
+                                    location_new(&RNODE_COLON3(node)->name_loc));
+      case NODE_DEFINED:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_DEFINED(node)->keyword_loc));
+      case NODE_DOT2:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_DOT2(node)->operator_loc));
+      case NODE_DOT3:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_DOT3(node)->operator_loc));
+      case NODE_EVSTR:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_EVSTR(node)->opening_loc),
+                                    location_new(&RNODE_EVSTR(node)->closing_loc));
+      case NODE_FLIP2:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_FLIP2(node)->operator_loc));
+      case NODE_FLIP3:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_FLIP3(node)->operator_loc));
+      case NODE_FOR:
+        return rb_ary_new_from_args(5,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_FOR(node)->for_keyword_loc),
+                                    location_new(&RNODE_FOR(node)->in_keyword_loc),
+                                    location_new(&RNODE_FOR(node)->do_keyword_loc),
+                                    location_new(&RNODE_FOR(node)->end_keyword_loc));
+      case NODE_LAMBDA:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_LAMBDA(node)->operator_loc),
+                                    location_new(&RNODE_LAMBDA(node)->opening_loc),
+                                    location_new(&RNODE_LAMBDA(node)->closing_loc));
+      case NODE_IF:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_IF(node)->if_keyword_loc),
+                                    location_new(&RNODE_IF(node)->then_keyword_loc),
+                                    location_new(&RNODE_IF(node)->end_keyword_loc));
+      case NODE_IN:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_IN(node)->in_keyword_loc),
+                                    location_new(&RNODE_IN(node)->then_keyword_loc),
+                                    location_new(&RNODE_IN(node)->operator_loc));
+      case NODE_MODULE:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_MODULE(node)->module_keyword_loc),
+                                    location_new(&RNODE_MODULE(node)->end_keyword_loc));
+      case NODE_NEXT:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_NEXT(node)->keyword_loc));
+      case NODE_OR:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_OR(node)->operator_loc));
+      case NODE_OP_ASGN1:
+        return rb_ary_new_from_args(5,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_OP_ASGN1(node)->call_operator_loc),
+                                    location_new(&RNODE_OP_ASGN1(node)->opening_loc),
+                                    location_new(&RNODE_OP_ASGN1(node)->closing_loc),
+                                    location_new(&RNODE_OP_ASGN1(node)->binary_operator_loc));
+      case NODE_OP_ASGN2:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_OP_ASGN2(node)->call_operator_loc),
+                                    location_new(&RNODE_OP_ASGN2(node)->message_loc),
+                                    location_new(&RNODE_OP_ASGN2(node)->binary_operator_loc));
+      case NODE_POSTEXE:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_POSTEXE(node)->keyword_loc),
+                                    location_new(&RNODE_POSTEXE(node)->opening_loc),
+                                    location_new(&RNODE_POSTEXE(node)->closing_loc));
+      case NODE_REDO:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_REDO(node)->keyword_loc));
+      case NODE_REGX:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_REGX(node)->opening_loc),
+                                    location_new(&RNODE_REGX(node)->content_loc),
+                                    location_new(&RNODE_REGX(node)->closing_loc));
+      case NODE_RETURN:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_RETURN(node)->keyword_loc));
+
+      case NODE_SCLASS:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_SCLASS(node)->class_keyword_loc),
+                                    location_new(&RNODE_SCLASS(node)->operator_loc),
+                                    location_new(&RNODE_SCLASS(node)->end_keyword_loc));
+
+      case NODE_SPLAT:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_SPLAT(node)->operator_loc));
+      case NODE_SUPER:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_SUPER(node)->keyword_loc),
+                                    location_new(&RNODE_SUPER(node)->lparen_loc),
+                                    location_new(&RNODE_SUPER(node)->rparen_loc));
+      case NODE_UNDEF:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_UNDEF(node)->keyword_loc));
+      case NODE_UNLESS:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_UNLESS(node)->keyword_loc),
+                                    location_new(&RNODE_UNLESS(node)->then_keyword_loc),
+                                    location_new(&RNODE_UNLESS(node)->end_keyword_loc));
+      case NODE_VALIAS:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_VALIAS(node)->keyword_loc));
+      case NODE_WHEN:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_WHEN(node)->keyword_loc),
+                                    location_new(&RNODE_WHEN(node)->then_keyword_loc));
+      case NODE_WHILE:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_WHILE(node)->keyword_loc),
+                                    location_new(&RNODE_WHILE(node)->closing_loc));
+      case NODE_UNTIL:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_UNTIL(node)->keyword_loc),
+                                    location_new(&RNODE_UNTIL(node)->closing_loc));
+      case NODE_YIELD:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_YIELD(node)->keyword_loc),
+                                    location_new(&RNODE_YIELD(node)->lparen_loc),
+                                    location_new(&RNODE_YIELD(node)->rparen_loc));
+      case NODE_ARGS_AUX:
+      case NODE_LAST:
+        break;
+      default:
+        return rb_ary_new_from_args(1, location_new(nd_code_loc(node)));
+    }
+
+    rb_bug("node_locations: unknown node: %s", ruby_node_name(type));
+}
+
+static VALUE
+ast_node_locations(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return node_locations(data->ast_value, data->node);
+}
+
+static VALUE
+ast_node_first_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_first_lineno(data->node));
+}
+
+static VALUE
+ast_node_first_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_first_column(data->node));
+}
+
+static VALUE
+ast_node_last_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_last_lineno(data->node));
+}
+
+static VALUE
+ast_node_last_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_last_column(data->node));
+}
+
+static VALUE
+ast_node_all_tokens(rb_execution_context_t *ec, VALUE self)
+{
+    long i;
+    struct ASTNodeData *data;
+    rb_ast_t *ast;
+    rb_parser_ary_t *parser_tokens;
+    rb_parser_ast_token_t *parser_token;
+    VALUE str, loc, token, all_tokens;
+
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+    ast = rb_ruby_ast_data_get(data->ast_value);
+
+    parser_tokens = ast->node_buffer->tokens;
+    if (parser_tokens == NULL) {
+        return Qnil;
+    }
+
+    all_tokens = rb_ary_new2(parser_tokens->len);
+    for (i = 0; i < parser_tokens->len; i++) {
+        parser_token = parser_tokens->data[i];
+        str = rb_str_new(parser_token->str->ptr, parser_token->str->len);
+        loc = rb_ary_new_from_args(4,
+            INT2FIX(parser_token->loc.beg_pos.lineno),
+            INT2FIX(parser_token->loc.beg_pos.column),
+            INT2FIX(parser_token->loc.end_pos.lineno),
+            INT2FIX(parser_token->loc.end_pos.column)
+        );
+        token = rb_ary_new_from_args(4, INT2FIX(parser_token->id), ID2SYM(rb_intern(parser_token->type_name)), str, loc);
+        rb_ary_push(all_tokens, token);
+    }
+    rb_ary_freeze(all_tokens);
+
+    return all_tokens;
+}
+
+static VALUE
+ast_node_inspect(rb_execution_context_t *ec, VALUE self)
+{
+    VALUE str;
+    VALUE cname;
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    cname = rb_class_path(rb_obj_class(self));
+    str = rb_str_new2("#<");
+
+    rb_str_append(str, cname);
+    rb_str_catf(str, ":%s@%d:%d-%d:%d>",
+                node_type_to_str(data->node),
+                nd_first_lineno(data->node), nd_first_column(data->node),
+                nd_last_lineno(data->node), nd_last_column(data->node));
+
+    return str;
+}
+
+static VALUE
+ast_node_script_lines(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    rb_ast_t *ast;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+    ast = rb_ruby_ast_data_get(data->ast_value);
+    rb_parser_ary_t *ret = ast->body.script_lines;
+    return rb_parser_build_script_lines_from(ret);
+}
+
+static VALUE
+ast_location_first_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->first_lineno);
+}
+
+static VALUE
+ast_location_first_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->first_column);
+}
+
+static VALUE
+ast_location_last_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->last_lineno);
+}
+
+static VALUE
+ast_location_last_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->last_column);
+}
+
+static VALUE
+ast_location_inspect(rb_execution_context_t *ec, VALUE self)
+{
+    VALUE str;
+    VALUE cname;
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    cname = rb_class_path(rb_obj_class(self));
+    str = rb_str_new2("#<");
+
+    rb_str_append(str, cname);
+    rb_str_catf(str, ":@%d:%d-%d:%d>",
+                data->first_lineno, data->first_column,
+                data->last_lineno, data->last_column);
+
+    return str;
+}
+
+#include "ast.rbinc"
+
+void
+Init_ast(void)
+{
+    rb_mAST = rb_define_module_under(rb_cRubyVM, "AbstractSyntaxTree");
+    rb_cNode = rb_define_class_under(rb_mAST, "Node", rb_cObject);
+    rb_cLocation = rb_define_class_under(rb_mAST, "Location", rb_cObject);
+    rb_undef_alloc_func(rb_cNode);
+    rb_undef_alloc_func(rb_cLocation);
+}
diff --git a/ast.rb b/ast.rb
new file mode 100644
index 0000000000..6380621780
--- /dev/null
+++ b/ast.rb
@@ -0,0 +1,332 @@
+# for ast.c
+
+# AbstractSyntaxTree provides methods to parse Ruby code into
+# abstract syntax trees. The nodes in the tree
+# are instances of RubyVM::AbstractSyntaxTree::Node.
+#
+# This module is MRI specific as it exposes implementation details
+# of the MRI abstract syntax tree.
+#
+# This module is experimental and its API is not stable, therefore it might
+# change without notice. As examples, the order of children nodes is not
+# guaranteed, the number of children nodes might change, there is no way to
+# access children nodes by name, etc.
+#
+# If you are looking for a stable API or an API working under multiple Ruby
+# implementations, consider using the _prism_ gem, which is the official
+# Ruby API to parse Ruby code.
+#
+module RubyVM::AbstractSyntaxTree
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.parse(string, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #  Parses the given _string_ into an abstract syntax tree,
+  #  returning the root node of that tree.
+  #
+  #    RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+  #    # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-1:9>
+  #
+  #  If <tt>keep_script_lines: true</tt> option is provided, the text of the parsed
+  #  source is associated with nodes and is available via Node#script_lines.
+  #
+  #  If <tt>keep_tokens: true</tt> option is provided, Node#tokens are populated.
+  #
+  #  SyntaxError is raised if the given _string_ is invalid syntax. To overwrite this
+  #  behavior, <tt>error_tolerant: true</tt> can be provided. In this case, the parser
+  #  will produce a tree where expressions with syntax errors would be represented by
+  #  Node with <tt>type=:ERROR</tt>.
+  #
+  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2")
+  #     # <internal:ast>:33:in `parse': syntax error, unexpected ';', expecting ')' (SyntaxError)
+  #     # x = 1; p(x; y=2
+  #     #           ^
+  #
+  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2", error_tolerant: true)
+  #     # (SCOPE@1:0-1:15
+  #     #  tbl: [:x, :y]
+  #     #  args: nil
+  #     #  body: (BLOCK@1:0-1:15 (LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)) (ERROR@1:7-1:11) (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))))
+  #     root.children.last.children
+  #     # [(LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)),
+  #     #  (ERROR@1:7-1:11),
+  #     #  (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))]
+  #
+  #  Note that parsing continues even after the errored expression.
+  #
+  def self.parse string, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_parse string, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.parse_file(pathname, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #   Reads the file from _pathname_, then parses it like ::parse,
+  #   returning the root node of the abstract syntax tree.
+  #
+  #   SyntaxError is raised if _pathname_'s contents are not
+  #   valid Ruby syntax.
+  #
+  #     RubyVM::AbstractSyntaxTree.parse_file("my-app/app.rb")
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-31:3>
+  #
+  #   See ::parse for explanation of keyword argument meaning and usage.
+  def self.parse_file pathname, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_parse_file pathname, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.of(proc, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false)   -> RubyVM::AbstractSyntaxTree::Node
+  #     RubyVM::AbstractSyntaxTree.of(method, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #   Returns AST nodes of the given _proc_ or _method_.
+  #
+  #     RubyVM::AbstractSyntaxTree.of(proc {1 + 2})
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:35-1:42>
+  #
+  #     def hello
+  #       puts "hello, world"
+  #     end
+  #
+  #     RubyVM::AbstractSyntaxTree.of(method(:hello))
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-3:3>
+  #
+  #   See ::parse for explanation of keyword argument meaning and usage.
+  def self.of body, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_of body, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(backtrace_location)   -> integer
+  #
+  #   Returns the node id for the given backtrace location.
+  #
+  #     begin
+  #       raise
+  #     rescue =>  e
+  #       loc = e.backtrace_locations.first
+  #       RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(loc)
+  #     end # => 0
+  def self.node_id_for_backtrace_location backtrace_location
+    Primitive.node_id_for_backtrace_location backtrace_location
+  end
+
+  # RubyVM::AbstractSyntaxTree::Node instances are created by parse methods in
+  # RubyVM::AbstractSyntaxTree.
+  #
+  # This class is MRI specific.
+  #
+  class Node
+
+    #  call-seq:
+    #     node.type -> symbol
+    #
+    #  Returns the type of this node as a symbol.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+    #    root.type # => :SCOPE
+    #    lasgn = root.children[2]
+    #    lasgn.type # => :LASGN
+    #    call = lasgn.children[1]
+    #    call.type # => :OPCALL
+    def type
+      Primitive.ast_node_type
+    end
+
+    #  call-seq:
+    #     node.first_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text began.
+    def first_lineno
+      Primitive.ast_node_first_lineno
+    end
+
+    #  call-seq:
+    #     node.first_column -> integer
+    #
+    #  The column number in the source code where this AST's text began.
+    def first_column
+      Primitive.ast_node_first_column
+    end
+
+    #  call-seq:
+    #     node.last_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text ended.
+    def last_lineno
+      Primitive.ast_node_last_lineno
+    end
+
+    #  call-seq:
+    #     node.last_column -> integer
+    #
+    #  The column number in the source code where this AST's text ended.
+    def last_column
+      Primitive.ast_node_last_column
+    end
+
+    #  call-seq:
+    #     node.tokens -> array
+    #
+    #  Returns tokens corresponding to the location of the node.
+    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+    #    root.tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    #    root.tokens.map{_1[2]}.join # => "x = 1 + 2"
+    #
+    #  Token is an array of:
+    #
+    #  - id
+    #  - token type
+    #  - source code text
+    #  - location [ first_lineno, first_column, last_lineno, last_column ]
+    def tokens
+      return nil unless all_tokens
+
+      all_tokens.each_with_object([]) do |token, a|
+        loc = token.last
+        if ([first_lineno, first_column] <=> [loc[0], loc[1]]) <= 0 &&
+           ([last_lineno, last_column]   <=> [loc[2], loc[3]]) >= 0
+           a << token
+        end
+      end
+    end
+
+    #  call-seq:
+    #     node.all_tokens -> array
+    #
+    #  Returns all tokens for the input script regardless the receiver node.
+    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+    #    root.all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    #    root.children[-1].all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    def all_tokens
+      Primitive.ast_node_all_tokens
+    end
+
+    #  call-seq:
+    #     node.children -> array
+    #
+    #  Returns AST nodes under this one.  Each kind of node
+    #  has different children, depending on what kind of node it is.
+    #
+    #  The returned array may contain other nodes or <code>nil</code>.
+    def children
+      Primitive.ast_node_children
+    end
+
+    #  call-seq:
+    #     node.inspect -> string
+    #
+    #  Returns debugging information about this node as a string.
+    def inspect
+      Primitive.ast_node_inspect
+    end
+
+    #  call-seq:
+    #     node.node_id -> integer
+    #
+    #  Returns an internal node_id number.
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    def node_id
+      Primitive.ast_node_node_id
+    end
+
+    #  call-seq:
+    #     node.script_lines -> array
+    #
+    #  Returns the original source code as an array of lines.
+    #
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    def script_lines
+      Primitive.ast_node_script_lines
+    end
+
+    #  call-seq:
+    #     node.source -> string
+    #
+    #  Returns the code fragment that corresponds to this AST.
+    #
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    #
+    #  Also note that this API may return an incomplete code fragment
+    #  that does not parse; for example, a here document following
+    #  an expression may be dropped.
+    def source
+      lines = script_lines
+      if lines
+        lines = lines[first_lineno - 1 .. last_lineno - 1]
+        lines[-1] = lines[-1].byteslice(0...last_column)
+        lines[0] = lines[0].byteslice(first_column..-1)
+        lines.join
+      else
+        nil
+      end
+    end
+
+    #  call-seq:
+    #     node.locations -> array
+    #
+    #  Returns location objects associated with the AST node.
+    #  The returned array contains RubyVM::AbstractSyntaxTree::Location.
+    def locations
+      Primitive.ast_node_locations
+    end
+  end
+
+  # RubyVM::AbstractSyntaxTree::Location instances are created by
+  # RubyVM::AbstractSyntaxTree::Node#locations.
+  #
+  # This class is MRI specific.
+  #
+  class Location
+
+    #  call-seq:
+    #     location.first_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text began.
+    def first_lineno
+      Primitive.ast_location_first_lineno
+    end
+
+    #  call-seq:
+    #     location.first_column -> integer
+    #
+    #  The column number in the source code where this AST's text began.
+    def first_column
+      Primitive.ast_location_first_column
+    end
+
+    #  call-seq:
+    #     location.last_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text ended.
+    def last_lineno
+      Primitive.ast_location_last_lineno
+    end
+
+    #  call-seq:
+    #     location.last_column -> integer
+    #
+    #  The column number in the source code where this AST's text ended.
+    def last_column
+      Primitive.ast_location_last_column
+    end
+
+    #  call-seq:
+    #     location.inspect -> string
+    #
+    #  Returns debugging information about this location as a string.
+    def inspect
+      Primitive.ast_location_inspect
+    end
+  end
+end
diff --git a/autogen.sh b/autogen.sh
new file mode 100755
index 0000000000..6cbc5dddab
--- /dev/null
+++ b/autogen.sh
@@ -0,0 +1,22 @@
+#!/bin/sh
+
+# Clear PWD to force commands to recompute working directory
+PWD=
+
+# Figure out the source directory for this script
+# configure.ac should be in the same place
+case "$0" in
+    */* )  srcdir=`dirname "$0"` ;; # Called with path
+    *   )  srcdir="";; # Otherwise
+esac
+
+# If install-only is explicitly requested, disable symlink flags
+case " $* " in
+    *" -i "* | *" --install"* ) symlink_flags="" ;;
+    *                         ) symlink_flags="--install --symlink" ;;
+esac
+
+exec ${AUTORECONF:-autoreconf} \
+     $symlink_flags \
+     "$@" \
+     $srcdir
diff --git a/basictest/runner.rb b/basictest/runner.rb
new file mode 100755
index 0000000000..0f398e7acc
--- /dev/null
+++ b/basictest/runner.rb
@@ -0,0 +1,33 @@
+#! ./miniruby
+
+exit if defined?(CROSS_COMPILING) and CROSS_COMPILING
+ruby = ENV["RUBY"]
+unless ruby
+  load './rbconfig.rb'
+  ruby = "./#{RbConfig::CONFIG['ruby_install_name']}#{RbConfig::CONFIG['EXEEXT']}"
+end
+unless File.exist? ruby
+  print "#{ruby} is not found.\n"
+  print "Try `make' first, then `make test', please.\n"
+  exit false
+end
+ARGV[0] and opt = ARGV[0][/\A--run-opt=(.*)/, 1] and ARGV.shift
+
+$stderr.reopen($stdout)
+error = ''
+
+srcdir = File.expand_path('..', File.dirname(__FILE__))
+if env = ENV["RUBYOPT"]
+  ENV["RUBYOPT"] = env + " -W1"
+end
+`#{ruby} #{opt} -W1 #{srcdir}/basictest/test.rb #{ARGV.join(' ')}`.each_line do |line|
+  if line =~ /^end of test/
+    print "\ntest succeeded\n"
+    exit true
+  end
+  error << line if %r:^(basictest/test.rb|not): =~ line
+end
+puts
+print error
+print "test failed\n"
+exit false
diff --git a/basictest/test.rb b/basictest/test.rb
new file mode 100755
index 0000000000..711e4f4ab3
--- /dev/null
+++ b/basictest/test.rb
@@ -0,0 +1,2367 @@
+#! /usr/bin/env ruby
+# -*- coding: us-ascii -*-
+
+$testnum=0
+$ntest=0
+$failed = 0
+class Progress
+  def initialize
+    @color = nil
+    @tty = nil
+    @quiet = nil
+    @verbose = nil
+    ARGV.each do |arg|
+      case arg
+      when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
+        warn "unknown --color argument: #$3" if $3
+        @color = $1 ? nil : !$2
+      when /\A--tty(=(?:yes|(no)|(.*)))?\z/
+        warn "unknown --tty argument: #$3" if $3
+        @tty = !$1 || !$2
+        true
+      when /\A-(q|-quiet)\z/
+        @quiet = true
+      when /\A-(v|-verbose)\z/
+        @verbose = true
+      end
+    end
+    @tty = STDERR.tty? && !STDOUT.tty? && /dumb/ !~ ENV["TERM"] if @tty.nil?
+    @eol = @tty && !@verbose ? "\r\e[K\r" : "\n"
+    case @color
+    when nil
+      @color = @tty
+    end
+    if @color
+      # dircolors-like style
+      colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
+      begin
+        File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
+          colors[n] ||= c
+        end
+      rescue
+      end
+      @passed = "\e[;#{colors["pass"] || "32"}m"
+      @failed = "\e[;#{colors["fail"] || "31"}m"
+      @reset = "\e[m"
+    else
+      @passed = @failed = @reset = ""
+    end
+    extend(Rotator) if @tty
+  end
+
+  def passed_string
+    "."
+  end
+  def failed_string
+    "#{@failed}F#{@reset}"
+  end
+  def init_string
+  end
+  def finish_string
+    if @quiet
+      @eol
+    else
+      "#{@passed}#{@ok ? 'OK' : ''} #{$testnum}#{@reset}#{@eol}"
+    end
+  end
+  def pass
+    STDERR.print passed_string
+  end
+  def fail
+    @ok = false
+    STDERR.print failed_string
+  end
+  def init
+    @ok = true
+    STDERR.print init_string
+  end
+  def finish
+    STDERR.print finish_string
+  end
+
+  module Rotator
+    ROTATOR = %w[- \\ | /]
+    BS = "\b" * ROTATOR[0].size
+    def passed_string
+      "#{BS}#{ROTATOR[(@count += 1) % ROTATOR.size]}"
+    end
+    def failed_string
+      "#{BS}#{super}#{ROTATOR[@count % ROTATOR.size]}"
+    end
+    def init_string
+      @count = 0
+      " "
+    end
+    def finish_string
+      s = "#{BS}#{' ' * BS.size}#{BS}#{super}"
+      s.gsub!(/\n/, "\r\e[2K\r") if @quiet
+      s
+    end
+  end
+end
+PROGRESS = Progress.new
+
+def test_check(what)
+  unless $ntest.zero?
+    PROGRESS.finish
+  end
+  STDERR.print "#{$0}:#{what} "
+  PROGRESS.init
+  $what = what
+  $testnum = 0
+end
+
+def test_ok(cond,n=1)
+  $testnum+=1
+  $ntest+=1
+  where = (st = caller(n)) ? st[0] : "caller error! (n=#{n}, trace=#{caller(0).join(', ')}"
+  if cond
+    PROGRESS.pass
+    printf "ok %d (%s)\n", $testnum, where
+  else
+    PROGRESS.fail
+    printf "not ok %s %d -- %s\n", $what, $testnum, where
+    $failed+=1
+  end
+  STDOUT.flush
+  STDERR.flush
+end
+
+# make sure conditional operators work
+
+test_check "assignment"
+
+a=[]; a[0] ||= "bar";
+test_ok(a[0] == "bar")
+h={}; h["foo"] ||= "bar";
+test_ok(h["foo"] == "bar")
+
+aa = 5
+aa ||= 25
+test_ok(aa == 5)
+bb ||= 25
+test_ok(bb == 25)
+cc &&=33
+test_ok(cc == nil)
+cc = 5
+cc &&=44
+test_ok(cc == 44)
+
+a = nil; test_ok(a == nil)
+a = 1; test_ok(a == 1)
+a = []; test_ok(a == [])
+a = [1]; test_ok(a == [1])
+a = [nil]; test_ok(a == [nil])
+a = [[]]; test_ok(a == [[]])
+a = [1,2]; test_ok(a == [1,2])
+a = [*[]]; test_ok(a == [])
+a = [*[1]]; test_ok(a == [1])
+a = [*[1,2]]; test_ok(a == [1,2])
+
+a = *[]; test_ok(a == [])
+a = *[1]; test_ok(a == [1])
+a = *[nil]; test_ok(a == [nil])
+a = *[[]]; test_ok(a == [[]])
+a = *[1,2]; test_ok(a == [1,2])
+a = *[*[]]; test_ok(a == [])
+a = *[*[1]]; test_ok(a == [1])
+a = *[*[1,2]]; test_ok(a == [1,2])
+
+a, = nil; test_ok(a == nil)
+a, = 1; test_ok(a == 1)
+a, = []; test_ok(a == nil)
+a, = [1]; test_ok(a == 1)
+a, = [nil]; test_ok(a == nil)
+a, = [[]]; test_ok(a == [])
+a, = 1,2; test_ok(a == 1)
+a, = [1,2]; test_ok(a == 1)
+a, = [*[]]; test_ok(a == nil)
+a, = [*[1]]; test_ok(a == 1)
+a, = *[1,2]; test_ok(a == 1)
+a, = [*[1,2]]; test_ok(a == 1)
+
+a, = *[]; test_ok(a == nil)
+a, = *[1]; test_ok(a == 1)
+a, = *[nil]; test_ok(a == nil)
+a, = *[[]]; test_ok(a == [])
+a, = *[1,2]; test_ok(a == 1)
+a, = *[*[]]; test_ok(a == nil)
+a, = *[*[1]]; test_ok(a == 1)
+a, = *[*[1,2]]; test_ok(a == 1)
+
+*a = nil; test_ok(a == [nil])
+*a = 1; test_ok(a == [1])
+*a = []; test_ok(a == [])
+*a = [1]; test_ok(a == [1])
+*a = [nil]; test_ok(a == [nil])
+*a = [[]]; test_ok(a == [[]])
+*a = [1,2]; test_ok(a == [1,2])
+*a = [*[]]; test_ok(a == [])
+*a = [*[1]]; test_ok(a == [1])
+*a = [*[1,2]]; test_ok(a == [1,2])
+
+*a = *[]; test_ok(a == [])
+*a = *[1]; test_ok(a == [1])
+*a = *[nil]; test_ok(a == [nil])
+*a = *[[]]; test_ok(a == [[]])
+*a = *[1,2]; test_ok(a == [1,2])
+*a = *[*[]]; test_ok(a == [])
+*a = *[*[1]]; test_ok(a == [1])
+*a = *[*[1,2]]; test_ok(a == [1,2])
+
+a,b,*c = nil; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = 1; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = []; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = [1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = [*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = *[]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = *[1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = *[*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+def f; yield nil; end; f {|a| test_ok(a == nil)}
+def f; yield 1; end; f {|a| test_ok(a == 1)}
+def f; yield []; end; f {|a| test_ok(a == [])}
+def f; yield [1]; end; f {|a| test_ok(a == [1])}
+def f; yield [nil]; end; f {|a| test_ok(a == [nil])}
+def f; yield [[]]; end; f {|a| test_ok(a == [[]])}
+def f; yield [*[]]; end; f {|a| test_ok(a == [])}
+def f; yield [*[1]]; end; f {|a| test_ok(a == [1])}
+def f; yield [*[1,2]]; end; f {|a| test_ok(a == [1,2])}
+def f; yield *[]; end; f {|a| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a| test_ok(a == [])}
+def f; yield *[*[]]; end; f {|a| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a| test_ok(a == 1)}
+
+def f; yield; end; f {|a,| test_ok(a == nil)}
+def f; yield nil; end; f {|a,| test_ok(a == nil)}
+def f; yield 1; end; f {|a,| test_ok(a == 1)}
+def f; yield []; end; f {|a,| test_ok(a == nil)}
+def f; yield [1]; end; f {|a,| test_ok(a == 1)}
+def f; yield [nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield [[]]; end; f {|a,| test_ok(a == [])}
+def f; yield [*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield [*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield [*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield *[]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield; end; f {|*a| test_ok(a == [])}
+def f; yield nil; end; f {|*a| test_ok(a == [nil])}
+def f; yield 1; end; f {|*a| test_ok(a == [1])}
+def f; yield []; end; f {|*a| test_ok(a == [[]])}
+def f; yield [1]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [nil]; end; f {|*a| test_ok(a == [[nil]])}
+def f; yield [[]]; end; f {|*a| test_ok(a == [[[]]])}
+def f; yield [1,2]; end; f {|*a| test_ok(a == [[1,2]])}
+def f; yield [*[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield [*[1]]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [*[1,2]]; end; f {|*a| test_ok(a == [[1,2]])}
+
+def f; yield *[]; end; f {|*a| test_ok(a == [])}
+def f; yield *[1]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[nil]; end; f {|*a| test_ok(a == [nil])}
+def f; yield *[[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield *[*[]]; end; f {|*a| test_ok(a == [])}
+def f; yield *[*[1]]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[*[1,2]]; end; f {|*a| test_ok(a == [1,2])}
+
+def f; yield; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield nil; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield 1; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield []; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [[]]; end; f {|a,b,*c| test_ok([a,b,c] == [[],nil,[]])}
+def f; yield [*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def f; yield *[]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def r; return; end; a = r(); test_ok(a == nil)
+def r; return nil; end; a = r(); test_ok(a == nil)
+def r; return 1; end; a = r(); test_ok(a == 1)
+def r; return []; end; a = r(); test_ok(a == [])
+def r; return [1]; end; a = r(); test_ok(a == [1])
+def r; return [nil]; end; a = r(); test_ok(a == [nil])
+def r; return [[]]; end; a = r(); test_ok(a == [[]])
+def r; return [*[]]; end; a = r(); test_ok(a == [])
+def r; return [*[1]]; end; a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; a = r(); test_ok(a == [])
+def r; return *[1]; end; a = r(); test_ok(a == [1])
+def r; return *[nil]; end; a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; a = r(); test_ok(a == [[]])
+def r; return *[*[]]; end; a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; a = *r(); test_ok(a == [[]])
+def r; return *[*[1,2]]; end; a = *r(); test_ok(a == [1,2])
+
+def r; return; end; *a = r(); test_ok(a == [nil])
+def r; return nil; end; *a = r(); test_ok(a == [nil])
+def r; return 1; end; *a = r(); test_ok(a == [1])
+def r; return []; end; *a = r(); test_ok(a == [])
+def r; return [1]; end; *a = r(); test_ok(a == [1])
+def r; return [nil]; end; *a = r(); test_ok(a == [nil])
+def r; return [[]]; end; *a = r(); test_ok(a == [[]])
+def r; return [1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return [*[]]; end; *a = r(); test_ok(a == [])
+def r; return [*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; *a = r(); test_ok(a == [])
+def r; return *[1]; end; *a = r(); test_ok(a == [1])
+def r; return *[nil]; end; *a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; *a = r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return *[*[]]; end; *a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; *a = *r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = *r(); test_ok(a == [1,2])
+def r; return *[*[1,2]]; end; *a = *r(); test_ok(a == [1,2])
+
+def r; return; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return nil; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return 1; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return []; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return [1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return [*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+def r; return *[]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return *[1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return *[*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+f = lambda {|r,| test_ok([] == r)}
+f.call([], *[])
+
+f = lambda {|r,*l| test_ok([] == r); test_ok([1] == l)}
+f.call([], *[1])
+
+f = lambda{|x| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|x,| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|*x| x}
+test_ok(f.call(42) == [42])
+test_ok(f.call([42]) == [[42]])
+test_ok(f.call([[42]]) == [[[42]]])
+test_ok(f.call([42,55]) == [[42,55]])
+test_ok(f.call(42,55) == [42,55])
+
+f = lambda { |a, b=42, *c| [a,b,c] }
+test_ok(f.call(1      ) == [1,42,[  ]] )
+test_ok(f.call(1,43   ) == [1,43,[  ]] )
+test_ok(f.call(1,43,44) == [1,43,[44]] )
+
+f = lambda { |a, b=(a|16), *c, &block| [a,b,c,block&&block[]] }
+test_ok(f.call(8      )     == [8,24,[  ],nil] )
+test_ok(f.call(8,43   )     == [8,43,[  ],nil] )
+test_ok(f.call(8,43,44)     == [8,43,[44],nil] )
+test_ok(f.call(8      ){45} == [8,24,[  ],45 ] )
+test_ok(f.call(8,43   ){45} == [8,43,[  ],45 ] )
+test_ok(f.call(8,43,44){45} == [8,43,[44],45 ] )
+
+f = lambda { |a, b=42, *c, d| [a,b,c,d] }
+test_ok(f.call(1      ,99) == [1,42,[  ],99] )
+test_ok(f.call(1,43   ,99) == [1,43,[  ],99] )
+test_ok(f.call(1,43,44,99) == [1,43,[44],99] )
+
+f = lambda { |a, b=(a|16), &block| [a,b,block&&block[]] }
+test_ok(f.call(8   )     == [8,24,nil] )
+test_ok(f.call(8,43)     == [8,43,nil] )
+test_ok(f.call(8,43)     == [8,43,nil] )
+test_ok(f.call(8   ){45} == [8,24,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+
+f = lambda { |a, b=42, d| [a,b,d] }
+test_ok(f.call(1   ,99) == [1,42,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+
+f = lambda { |b=42, *c, &block| [b,c,block&&block[]] }
+test_ok(f.call(     )     == [42,[  ],nil] )
+test_ok(f.call(43   )     == [43,[  ],nil] )
+test_ok(f.call(43,44)     == [43,[44],nil] )
+test_ok(f.call(     ){45} == [42,[  ],45 ] )
+test_ok(f.call(43   ){45} == [43,[  ],45 ] )
+test_ok(f.call(43,44){45} == [43,[44],45 ] )
+
+f = lambda { |b=42, *c, d| [b,c,d] }
+test_ok(f.call(      99) == [42,[  ],99] )
+test_ok(f.call(43   ,99) == [43,[  ],99] )
+test_ok(f.call(43,44,99) == [43,[44],99] )
+
+f = lambda { |b=42, &block| [b,block&&block[]] }
+test_ok(f.call(  )     == [42,nil] )
+test_ok(f.call(43)     == [43,nil] )
+test_ok(f.call(43)     == [43,nil] )
+test_ok(f.call(  ){45} == [42,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+
+f = lambda { |b=42, d| [b,d] }
+test_ok(f.call(   99) == [42,99] )
+test_ok(f.call(43,99) == [43,99] )
+test_ok(f.call(43,99) == [43,99] )
+
+
+a,=*[1]
+test_ok(a == 1)
+a,=*[[1]]
+test_ok(a == [1])
+a,=*[[[1]]]
+test_ok(a == [[1]])
+
+x, (y, z) = 1, 2, 3
+test_ok([1,2,nil] == [x,y,z])
+x, (y, z) = 1, [2,3]
+test_ok([1,2,3] == [x,y,z])
+x, (y, z) = 1, [2]
+test_ok([1,2,nil] == [x,y,z])
+
+a = loop do break; end; test_ok(a == nil)
+a = loop do break nil; end; test_ok(a == nil)
+a = loop do break 1; end; test_ok(a == 1)
+a = loop do break []; end; test_ok(a == [])
+a = loop do break [1]; end; test_ok(a == [1])
+a = loop do break [nil]; end; test_ok(a == [nil])
+a = loop do break [[]]; end; test_ok(a == [[]])
+a = loop do break [*[]]; end; test_ok(a == [])
+a = loop do break [*[1]]; end; test_ok(a == [1])
+a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+a = loop do break *[]; end; test_ok(a == [])
+a = loop do break *[1]; end; test_ok(a == [1])
+a = loop do break *[nil]; end; test_ok(a == [nil])
+a = loop do break *[[]]; end; test_ok(a == [[]])
+a = loop do break *[*[]]; end; test_ok(a == [])
+a = loop do break *[*[1]]; end; test_ok(a == [1])
+a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break; end; test_ok(a == [nil])
+*a = loop do break nil; end; test_ok(a == [nil])
+*a = loop do break 1; end; test_ok(a == [1])
+*a = loop do break []; end; test_ok(a == [])
+*a = loop do break [1]; end; test_ok(a == [1])
+*a = loop do break [nil]; end; test_ok(a == [nil])
+*a = loop do break [[]]; end; test_ok(a == [[]])
+*a = loop do break [1,2]; end; test_ok(a == [1,2])
+*a = loop do break [*[]]; end; test_ok(a == [])
+*a = loop do break [*[1]]; end; test_ok(a == [1])
+*a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break *[]; end; test_ok(a == [])
+*a = loop do break *[1]; end; test_ok(a == [1])
+*a = loop do break *[nil]; end; test_ok(a == [nil])
+*a = loop do break *[[]]; end; test_ok(a == [[]])
+*a = loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = loop do break *[*[]]; end; test_ok(a == [])
+*a = loop do break *[*[1]]; end; test_ok(a == [1])
+*a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = *loop do break *[[]]; end; test_ok(a == [[]])
+*a = *loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = *loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+a,b,*c = loop do break; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break nil; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break 1; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break []; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break [1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break [*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = loop do break *[]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break *[1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break *[*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+def r(val); a = yield(); test_ok(a == val, 2); end
+r(nil){next}
+r(nil){next nil}
+r(1){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+r([]){next *[]}
+r([1]){next *[1]}
+r([nil]){next *[nil]}
+r([[]]){next *[[]]}
+r([]){next *[*[]]}
+r([1]){next *[*[1]]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); *a = yield(); test_ok(a == val, 2); end
+r([nil]){next}
+r([nil]){next nil}
+r([1]){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([1,2]){next [1,2]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+def r(val); *a = *yield(); test_ok(a == val, 2); end
+r([[]]){next *[[]]}
+r([1,2]){next *[1,2]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); a,b,*c = yield(); test_ok([a,b,c] == val, 2); end
+r([nil,nil,[]]){next}
+r([nil,nil,[]]){next nil}
+r([1,nil,[]]){next 1}
+r([nil,nil,[]]){next []}
+r([1,nil,[]]){next [1]}
+r([nil,nil,[]]){next [nil]}
+r([[],nil,[]]){next [[]]}
+r([1,2,[]]){next [1,2]}
+r([nil,nil,[]]){next [*[]]}
+r([1,nil,[]]){next [*[1]]}
+r([1,2,[]]){next [*[1,2]]}
+
+def r(val); a,b,*c = *yield(); test_ok([a,b,c] == val, 2); end
+r([[],nil,[]]){next *[[]]}
+r([1,2,[]]){next *[1,2]}
+r([1,2,[]]){next *[*[1,2]]}
+
+test_check "condition"
+
+$x = '0';
+
+$x == $x && test_ok(true)
+$x != $x && test_ok(false)
+$x == $x || test_ok(false)
+$x != $x || test_ok(true)
+
+# first test to see if we can run the tests.
+
+test_check "if/unless";
+
+$x = 'test';
+test_ok(if $x == $x then true else false end)
+$bad = false
+unless $x == $x
+  $bad = true
+end
+test_ok(!$bad)
+test_ok(unless $x != $x then true else false end)
+
+test_check "case"
+
+case 5
+when 1, 2, 3, 4, 6, 7, 8
+  test_ok(false)
+when 5
+  test_ok(true)
+end
+
+case 5
+when 5
+  test_ok(true)
+when 1..10
+  test_ok(false)
+end
+
+case 5
+when 1..10
+  test_ok(true)
+else
+  test_ok(false)
+end
+
+case 5
+when 5
+  test_ok(true)
+else
+  test_ok(false)
+end
+
+case "foobar"
+when /^f.*r$/
+  test_ok(true)
+else
+  test_ok(false)
+end
+
+test_check "while/until";
+
+while_tmp = "while_tmp.#{$$}"
+tmp = open(while_tmp, "w")
+tmp.print "tvi925\n";
+tmp.print "tvi920\n";
+tmp.print "vt100\n";
+tmp.print "Amiga\n";
+tmp.print "paper\n";
+tmp.close
+
+# test break
+
+tmp = open(while_tmp, "r")
+test_ok(tmp.kind_of?(File))
+
+while line = tmp.gets()
+  break if /vt100/ =~ line
+end
+
+test_ok(!tmp.eof? && /vt100/ =~ line)
+tmp.close
+
+# test next
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+  next if /vt100/ =~ line
+  $bad = 1 if /vt100/ =~ line
+end
+test_ok(!(!tmp.eof? || /vt100/ =~ line || $bad))
+tmp.close
+
+# test redo
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+  lastline = line
+  line = line.gsub(/vt100/, 'VT100')
+  if lastline != line
+    line.gsub!('VT100', 'Vt100')
+    redo
+  end
+  $bad = 1 if /vt100/ =~ line
+  $bad = 1 if /VT100/ =~ line
+end
+test_ok(tmp.eof? && !$bad)
+tmp.close
+
+sum=0
+for i in 1..10
+  sum += i
+  i -= 1
+  if i > 0
+    redo
+  end
+end
+test_ok(sum == 220)
+
+# test interval
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+  break if 3
+  case line
+  when /vt100/, /Amiga/, /paper/
+    $bad = true
+  end
+end
+test_ok(!$bad)
+tmp.close
+
+File.unlink while_tmp or `/bin/rm -f "#{while_tmp}"`
+test_ok(!File.exist?(while_tmp))
+
+i = 0
+until i>4
+  i+=1
+end
+test_ok(i>4)
+
+
+# exception handling
+test_check "exception";
+
+begin
+  raise "this must be handled"
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+$bad = true
+begin
+  raise "this must be handled no.2"
+rescue
+  if $bad
+    $bad = false
+    retry
+    test_ok(false)
+  end
+end
+test_ok(true)
+
+# exception in rescue clause
+$string = "this must be handled no.3"
+begin
+  begin
+    raise "exception in rescue clause"
+  rescue
+    raise $string
+  end
+  test_ok(false)
+rescue => e
+  test_ok($! == e)
+  test_ok(e.message == $string)
+  test_ok(e != $string)
+end
+
+# exception in ensure clause
+begin
+  begin
+    raise "this must be handled no.4"
+  ensure
+    raise "exception in ensure clause"
+  end
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+$bad = true
+begin
+  begin
+    raise "this must be handled no.5"
+  ensure
+    $bad = false
+  end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+begin
+  begin
+    raise "this must be handled no.6"
+  ensure
+    $bad = false
+  end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+while true
+  begin
+    break
+  ensure
+    $bad = false
+  end
+end
+test_ok(!$bad)
+
+test_ok(catch(:foo) {
+     loop do
+       loop do
+	 throw :foo, true
+	 break
+       end
+       break
+       test_ok(false)			# should not reach here
+     end
+     false
+   })
+
+test_check "array"
+test_ok([1, 2] + [3, 4] == [1, 2, 3, 4])
+test_ok([1, 2] * 2 == [1, 2, 1, 2])
+test_ok([1, 2] * ":" == "1:2")
+
+test_ok([1, 2].hash == [1, 2].hash)
+
+test_ok([1,2,3] & [2,3,4] == [2,3])
+test_ok([1,2,3] | [2,3,4] == [1,2,3,4])
+test_ok([1,2,3] - [2,3] == [1])
+
+$x = [0, 1, 2, 3, 4, 5]
+test_ok($x[2] == 2)
+test_ok($x[1..3] == [1, 2, 3])
+test_ok($x[1,3] == [1, 2, 3])
+
+$x[0, 2] = 10
+test_ok($x[0] == 10 && $x[1] == 2)
+
+$x[0, 0] = -1
+test_ok($x[0] == -1 && $x[1] == 10)
+
+$x[-1, 1] = 20
+test_ok($x[-1] == 20 && $x.pop == 20)
+
+# array and/or
+test_ok(([1,2,3]&[2,4,6]) == [2])
+test_ok(([1,2,3]|[2,4,6]) == [1,2,3,4,6])
+
+# compact
+$x = [nil, 1, nil, nil, 5, nil, nil]
+$x.compact!
+test_ok($x == [1, 5])
+
+# uniq
+$x = [1, 1, 4, 2, 5, 4, 5, 1, 2]
+$x.uniq!
+test_ok($x == [1, 4, 2, 5])
+
+# empty?
+test_ok(!$x.empty?)
+$x = []
+test_ok($x.empty?)
+
+# sort
+$x = ["it", "came", "to", "pass", "that", "..."]
+$x = $x.sort.join(" ")
+test_ok($x == "... came it pass that to")
+$x = [2,5,3,1,7]
+$x.sort!{|a,b| a<=>b}		# sort with condition
+test_ok($x == [1,2,3,5,7])
+$x.sort!{|a,b| b-a}		# reverse sort
+test_ok($x == [7,5,3,2,1])
+
+# split test
+$x = +"The Book of Mormon"
+test_ok($x.split(//).reverse!.join == $x.reverse)
+test_ok($x.reverse == $x.reverse!)
+test_ok("1 byte string".split(//).reverse.join(":") == "g:n:i:r:t:s: :e:t:y:b: :1")
+$x = "a b c  d"
+test_ok($x.split == ['a', 'b', 'c', 'd'])
+test_ok($x.split(' ') == ['a', 'b', 'c', 'd'])
+test_ok(defined? "a".chomp)
+test_ok("abc".scan(/./) == ["a", "b", "c"])
+test_ok("1a2b3c".scan(/(\d.)/) == [["1a"], ["2b"], ["3c"]])
+# non-greedy match
+test_ok("a=12;b=22".scan(/(.*?)=(\d*);?/) == [["a", "12"], ["b", "22"]])
+
+$x = [1]
+test_ok(($x * 5).join(":") == '1:1:1:1:1')
+test_ok(($x * 1).join(":") == '1')
+test_ok(($x * 0).join(":") == '')
+
+*$x = *(1..7).to_a
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+$x = [1,2,3]
+$x[1,0] = $x
+test_ok($x == [1,1,2,3,2,3])
+
+$x = [1,2,3]
+$x[-1,0] = $x
+test_ok($x == [1,2,1,2,3,3])
+
+$x = [1,2,3]
+$x.concat($x)
+test_ok($x == [1,2,3,1,2,3])
+
+test_check "hash"
+$x = {1=>2, 2=>4, 3=>6}
+
+test_ok($x[1] == 2)
+
+test_ok(begin
+     for k,v in $x
+       raise if k*2 != v
+     end
+     true
+   rescue
+     false
+   end)
+
+test_ok($x.length == 3)
+test_ok($x.has_key?(1))
+test_ok($x.has_value?(4))
+test_ok($x.values_at(2,3) == [4,6])
+test_ok($x == {1=>2, 2=>4, 3=>6})
+
+$z = $x.keys.sort.join(":")
+test_ok($z == "1:2:3")
+
+$z = $x.values.sort.join(":")
+test_ok($z == "2:4:6")
+test_ok($x == $x)
+
+$x.shift
+test_ok($x.length == 2)
+
+$z = [1,2]
+$x[$z] = 256
+test_ok($x[$z] == 256)
+
+$x = Hash.new(0)
+$x[1] = 1
+test_ok($x[1] == 1)
+test_ok($x[2] == 0)
+
+$x = Hash.new([])
+test_ok($x[22] == [])
+test_ok($x[22].equal?($x[22]))
+
+$x = Hash.new{[]}
+test_ok($x[22] == [])
+test_ok(!$x[22].equal?($x[22]))
+
+$x = Hash.new{|h,k| $z = k; h[k] = k*2}
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+$x.default = 5
+test_ok($x[23] == 5)
+
+$x = Hash.new
+def $x.default(k)
+  $z = k
+  self[k] = k*2
+end
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+
+test_check "iterator"
+
+# yield at top level
+test_ok(!defined?(yield))
+
+$x = [1, 2, 3, 4]
+$y = []
+
+# iterator over array
+for i in $x
+  $y.push i
+end
+test_ok($x == $y)
+
+# nested iterator
+def tt
+  1.upto(10) {|i|
+    yield i
+  }
+end
+
+i=0
+tt{|i| break if i == 5}
+test_ok(i == 0)
+
+def tt2(dummy)
+  yield 1
+end
+
+def tt3(&block)
+  tt2(raise(ArgumentError,""),&block)
+end
+
+$x = false
+begin
+  tt3{}
+rescue ArgumentError
+  $x = true
+rescue Exception
+end
+test_ok($x)
+
+def tt4 &block
+  tt2(raise(ArgumentError,""),&block)
+end
+$x = false
+begin
+  tt4{}
+rescue ArgumentError
+  $x = true
+rescue Exception
+end
+test_ok($x)
+
+# iterator break/redo/next/retry
+done = true
+loop{
+  break
+  done = false			# should not reach here
+}
+test_ok(done)
+
+done = false
+$bad = false
+loop {
+  break if done
+  done = true
+  next
+  $bad = true			# should not reach here
+}
+test_ok(!$bad)
+
+done = false
+$bad = false
+loop {
+  break if done
+  done = true
+  redo
+  $bad = true			# should not reach here
+}
+test_ok(!$bad)
+
+$x = []
+for i in 1 .. 7
+  $x.push i
+end
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+# append method to built-in class
+class Array
+  def iter_test1
+    collect{|e| [e, yield(e)]}.sort{|a,b|a[1]<=>b[1]}
+  end
+  def iter_test2
+    a = collect{|e| [e, yield(e)]}
+    a.sort{|a,b|a[1]<=>b[1]}
+  end
+end
+$x = [[1,2],[3,4],[5,6]]
+test_ok($x.iter_test1{|x|x} == $x.iter_test2{|x|x})
+
+class IterTest
+  def initialize(e); @body = e; end
+
+  def each0(&block); @body.each(&block); end
+  def each1(&block); @body.each {|*x| block.call(*x) } end
+  def each2(&block); @body.each {|*x| block.call(x) } end
+  def each3(&block); @body.each {|x| block.call(*x) } end
+  def each4(&block); @body.each {|x| block.call(x) } end
+  def each5; @body.each {|*x| yield(*x) } end
+  def each6; @body.each {|*x| yield(x) } end
+  def each7; @body.each {|x| yield(*x) } end
+  def each8; @body.each {|x| yield(x) } end
+
+  def f(a)
+    a
+  end
+end
+test_ok(IterTest.new(nil).method(:f).to_proc.call([1]) == [1])
+m = /\w+/.match("abc")
+test_ok(IterTest.new(nil).method(:f).to_proc.call([m]) == [m])
+
+IterTest.new([0]).each0 {|x| test_ok(x == 0)}
+IterTest.new([1]).each1 {|x| test_ok(x == 1)}
+IterTest.new([2]).each2 {|x| test_ok(x == [2])}
+#IterTest.new([3]).each3 {|x| test_ok(x == 3)}
+IterTest.new([4]).each4 {|x| test_ok(x == 4)}
+IterTest.new([5]).each5 {|x| test_ok(x == 5)}
+IterTest.new([6]).each6 {|x| test_ok(x == [6])}
+#IterTest.new([7]).each7 {|x| test_ok(x == 7)}
+IterTest.new([8]).each8 {|x| test_ok(x == 8)}
+
+IterTest.new([[0]]).each0 {|x| test_ok(x == [0])}
+IterTest.new([[1]]).each1 {|x| test_ok(x == [1])}
+IterTest.new([[2]]).each2 {|x| test_ok(x == [[2]])}
+IterTest.new([[3]]).each3 {|x| test_ok(x == 3)}
+IterTest.new([[4]]).each4 {|x| test_ok(x == [4])}
+IterTest.new([[5]]).each5 {|x| test_ok(x == [5])}
+IterTest.new([[6]]).each6 {|x| test_ok(x == [[6]])}
+IterTest.new([[7]]).each7 {|x| test_ok(x == 7)}
+IterTest.new([[8]]).each8 {|x| test_ok(x == [8])}
+
+IterTest.new([[0,0]]).each0 {|*x| test_ok(x == [[0,0]])}
+IterTest.new([[8,8]]).each8 {|*x| test_ok(x == [[8,8]])}
+
+def m0(v)
+  v
+end
+
+def m1
+  m0(block_given?)
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+def m
+  m0(block_given?,&Proc.new{})
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+class C
+  include Enumerable
+  def initialize
+    @a = [1,2,3]
+  end
+  def each(&block)
+    @a.each(&block)
+  end
+end
+
+test_ok(C.new.collect{|n| n} == [1,2,3])
+
+test_ok(Proc == lambda{}.class)
+test_ok(Proc == Proc.new{}.class)
+lambda{|a|test_ok(a==1)}.call(1)
+def block_test(klass, &block)
+  test_ok(klass === block)
+end
+
+block_test(NilClass)
+block_test(Proc){}
+
+def call_argument_test(state, proc, *args)
+  x = state
+  begin
+    proc.call(*args)
+  rescue ArgumentError
+    x = !x
+  end
+  test_ok(x,2)
+end
+
+call_argument_test(true, lambda{||})
+call_argument_test(false, lambda{||}, 1)
+call_argument_test(true, lambda{|a,|}, 1)
+call_argument_test(false, lambda{|a,|})
+call_argument_test(false, lambda{|a,|}, 1,2)
+
+call_argument_test(true, Proc.new{||})
+call_argument_test(true, Proc.new{||}, 1)
+call_argument_test(true, Proc.new{|a,|}, 1)
+call_argument_test(true, Proc.new{|a,|})
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+def block_get(&block)
+  block
+end
+
+test_ok(Proc == block_get{}.class)
+call_argument_test(true, block_get{||})
+call_argument_test(true, block_get{||}, 1)
+call_argument_test(true, block_get{|a,|}, 1)
+call_argument_test(true, block_get{|a,|})
+call_argument_test(true, block_get{|a,|}, 1,2)
+
+call_argument_test(true, block_get(&lambda{||}))
+call_argument_test(false, block_get(&lambda{||}),1)
+call_argument_test(true, block_get(&lambda{|a,|}),1)
+call_argument_test(false, block_get(&lambda{|a,|}),1,2)
+
+blk = block_get{11}
+test_ok(blk.class == Proc)
+test_ok(blk.to_proc.class == Proc)
+test_ok(blk.clone.call == 11)
+test_ok(block_get(&blk).class == Proc)
+
+lmd = lambda{44}
+test_ok(lmd.class == Proc)
+test_ok(lmd.to_proc.class == Proc)
+test_ok(lmd.clone.call == 44)
+test_ok(block_get(&lmd).class == Proc)
+
+test_ok(Proc.new{|a,| a}.yield(1,2,3) == 1)
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+test_ok(Proc.new{|&b| b.call(10)}.call {|x| x} == 10)
+test_ok(Proc.new{|a,&b| b.call(a)}.call(12) {|x| x} == 12)
+
+def test_return1
+  Proc.new {
+    return 55
+  }.yield + 5
+end
+test_ok(test_return1() == 55)
+def test_return2
+  lambda {
+    return 55
+  }.call + 5
+end
+test_ok(test_return2() == 60)
+
+def proc_call(&b)
+  b.call
+end
+def proc_yield()
+  yield
+end
+def proc_return1
+  lambda{return 42}.call+1
+end
+test_ok(proc_return1() == 43)
+def proc_return2
+  ->{return 42}.call+1
+end
+test_ok(proc_return2() == 43)
+def proc_return3
+  proc_call{return 42}+1
+end
+test_ok(proc_return3() == 42)
+def proc_return4
+  proc_yield{return 42}+1
+end
+test_ok(proc_return4() == 42)
+
+def ljump_test(state, proc, *args)
+  x = state
+  begin
+    proc.call(*args)
+  rescue LocalJumpError
+    x = !x
+  end
+  test_ok(x,2)
+end
+
+ljump_test(false, block_get{break})
+ljump_test(true, lambda{break})
+
+def exit_value_test(&block)
+  block.call
+rescue LocalJumpError
+  $!.exit_value
+end
+
+test_ok(45 == exit_value_test{break 45})
+
+test_ok(55 == begin
+              block_get{break 55}.call
+            rescue LocalJumpError
+              $!.exit_value
+            end)
+
+def block_call(&block)
+  block.call
+end
+
+def test_b1
+  block_call{break 11}
+end
+test_ok(test_b1() == 11)
+
+def ljump_rescue(r)
+  begin
+    yield
+  rescue LocalJumpError => e
+    r if /from proc-closure/ =~ e.message
+  end
+end
+
+def test_b2
+  ljump_rescue(22) do
+    block_get{break 21}.call
+  end
+end
+test_ok(test_b2() == 22)
+
+def test_b3
+  ljump_rescue(33) do
+    Proc.new{break 31}.yield
+  end
+end
+test_ok(test_b3() == 33)
+
+def test_b4
+  lambda{break 44}.call
+end
+test_ok(test_b4() == 44)
+
+def test_b5
+  ljump_rescue(55) do
+    b = block_get{break 54}
+    block_call(&b)
+  end
+end
+test_ok(test_b5() == 55)
+
+def test_b6
+  b = lambda{break 67}
+  block_call(&b)
+  66
+end
+test_ok(test_b6() == 66)
+
+def util_r7
+  block_get{break 78}
+end
+
+def test_b7
+  b = util_r7()
+  ljump_rescue(77) do
+    block_call(&b)
+  end
+end
+test_ok(test_b7() == 77)
+
+def util_b8(&block)
+  block_call(&block)
+end
+
+def test_b8
+  util_b8{break 88}
+end
+test_ok(test_b8() == 88)
+
+def util_b9(&block)
+  lambda{block.call; 98}.call
+end
+
+def test_b9
+  util_b9{break 99}
+end
+test_ok(test_b9() == 99)
+
+def util_b10
+  util_b9{break 100}
+end
+
+def test_b10
+  util_b10()
+end
+test_ok(test_b10() == 100)
+
+def test_b11
+  ljump_rescue(111) do
+    loop do
+      Proc.new{break 110}.yield
+      break 112
+    end
+  end
+end
+test_ok(test_b11() == 111)
+
+def test_b12
+  loop do
+    break lambda{break 122}.call
+    break 121
+  end
+end
+test_ok(test_b12() == 122)
+
+def test_b13
+  ljump_rescue(133) do
+    while true
+      Proc.new{break 130}.yield
+      break 131
+    end
+  end
+end
+test_ok(test_b13() == 133)
+
+def test_b14
+  while true
+    break lambda{break 144}.call
+    break 143
+  end
+end
+test_ok(test_b14() == 144)
+
+def test_b15
+  [0].each {|c| yield 1 }
+  156
+end
+test_ok(test_b15{|e| break 155 } == 155)
+
+def marity_test(m)
+  method = method(m)
+  test_ok(method.arity == method.to_proc.arity, 2)
+end
+marity_test(:test_ok)
+marity_test(:marity_test)
+marity_test(:p)
+
+class ITER_TEST1
+   def a
+     block_given?
+   end
+end
+
+class ITER_TEST2 < ITER_TEST1
+   def a
+     test_ok(super)
+     super
+   end
+end
+test_ok(ITER_TEST2.new.a {})
+
+class ITER_TEST3
+  def foo x
+    return yield if block_given?
+    x
+  end
+end
+
+class ITER_TEST4 < ITER_TEST3
+  def foo x
+    test_ok(super == yield)
+    test_ok(super(x, &nil) == x)
+  end
+end
+
+ITER_TEST4.new.foo(44){55}
+
+class ITER_TEST5
+   def tt(aa)
+     aa
+   end
+
+   def uu(a)
+      class << self
+         define_method(:tt) do |sym|
+            super(sym)
+         end
+      end
+   end
+
+   def xx(*x)
+     x.size
+   end
+end
+
+a = ITER_TEST5.new
+a.uu(12)
+test_ok(a.tt(1) == 1)
+
+class ITER_TEST6 < ITER_TEST5
+   def xx(*a)
+      a << 12
+      super
+   end
+end
+
+test_ok(ITER_TEST6.new.xx([24]) == 2)
+
+test_check "float"
+test_ok(2.6.floor == 2)
+test_ok((-2.6).floor == -3)
+test_ok(2.6.ceil == 3)
+test_ok((-2.6).ceil == -2)
+test_ok(2.6.truncate == 2)
+test_ok((-2.6).truncate == -2)
+test_ok(2.6.round == 3)
+test_ok((-2.4).truncate == -2)
+test_ok((13.4 % 1 - 0.4).abs < 0.0001)
+nan = 0.0/0
+def nan_test(x,y)
+  test_ok(x != y)
+  test_ok((x < y) == false)
+  test_ok((x > y) == false)
+  test_ok((x <= y) == false)
+  test_ok((x >= y) == false)
+end
+nan_test(nan, nan)
+nan_test(nan, 0)
+nan_test(nan, 1)
+nan_test(nan, -1)
+nan_test(nan, 1000)
+nan_test(nan, -1000)
+nan_test(nan, 1_000_000_000_000)
+nan_test(nan, -1_000_000_000_000)
+nan_test(nan, 100.0);
+nan_test(nan, -100.0);
+nan_test(nan, 0.001);
+nan_test(nan, -0.001);
+nan_test(nan, 1.0/0);
+nan_test(nan, -1.0/0);
+
+#s = "3.7517675036461267e+17"
+#test_ok(s == sprintf("%.16e", s.to_f))
+f = 3.7517675036461267e+17
+test_ok(f == sprintf("%.16e", f).to_f)
+
+
+test_check "bignum"
+def fact(n)
+  return 1 if n == 0
+  f = 1
+  while n>0
+    f *= n
+    n -= 1
+  end
+  return f
+end
+$x = fact(40)
+test_ok($x == $x)
+test_ok($x == fact(40))
+test_ok($x < $x+2)
+test_ok($x > $x-2)
+test_ok($x == 815915283247897734345611269596115894272000000000)
+test_ok($x != 815915283247897734345611269596115894272000000001)
+test_ok($x+1 == 815915283247897734345611269596115894272000000001)
+test_ok($x/fact(20) == 335367096786357081410764800000)
+$x = -$x
+test_ok($x == -815915283247897734345611269596115894272000000000)
+test_ok(2-(2**32) == -(2**32-2))
+test_ok(2**32 - 5 == (2**32-3)-2)
+
+$good = true;
+for i in 1000..1014
+  $good = false if ((1 << i) != (2**i))
+end
+test_ok($good)
+
+$good = true;
+n1= 1 << 1000
+for i in 1000..1014
+  $good = false if ((1 << i) != n1)
+  n1 *= 2
+end
+test_ok($good)
+
+$good = true;
+n2=n1
+for i in 1..10
+  n1 = n1 / 2
+  n2 = n2 >> 1
+  $good = false if (n1 != n2)
+end
+test_ok($good)
+
+$good = true;
+for i in 4000..4096
+  n1 = 1 << i;
+  if (n1**2-1) / (n1+1) != (n1-1)
+    $good = false
+  end
+end
+test_ok($good)
+
+b = 10**80
+a = b * 9 + 7
+test_ok(7 == a.modulo(b))
+test_ok(-b + 7 == a.modulo(-b))
+test_ok(b + -7 == (-a).modulo(b))
+test_ok(-7 == (-a).modulo(-b))
+test_ok(7 == a.remainder(b))
+test_ok(7 == a.remainder(-b))
+test_ok(-7 == (-a).remainder(b))
+test_ok(-7 == (-a).remainder(-b))
+
+test_ok(10**40+10**20 == 10000000000000000000100000000000000000000)
+test_ok(10**40/10**20 == 100000000000000000000)
+
+a = 677330545177305025495135714080
+b = 14269972710765292560
+test_ok(a % b == 0)
+test_ok(-a % b == 0)
+
+def shift_test(a)
+  b = a / (2 ** 32)
+  c = a >> 32
+  test_ok(b == c)
+
+  b = a * (2 ** 32)
+  c = a << 32
+  test_ok(b == c)
+end
+
+shift_test(-4518325415524767873)
+shift_test(-0xfffffffffffffffff)
+
+test_check "string & char"
+
+test_ok("abcd" == "abcd")
+test_ok("abcd" =~ /abcd/)
+test_ok("abcd" === "abcd")
+# compile time string concatenation
+test_ok("ab" "cd" == "abcd")
+test_ok("#{22}aa" "cd#{44}" == "22aacd44")
+test_ok("#{22}aa" "cd#{44}" "55" "#{66}" == "22aacd445566")
+test_ok("abc" !~ /^$/)
+test_ok("abc\n" !~ /^$/)
+test_ok("abc" !~ /^d*$/)
+test_ok(("abc" =~ /d*$/) == 3)
+test_ok("" =~ /^$/)
+test_ok("\n" =~ /^$/)
+test_ok("a\n\n" =~ /^$/)
+test_ok("abcabc" =~ /.*a/ && $& == "abca")
+test_ok("abcabc" =~ /.*c/ && $& == "abcabc")
+test_ok("abcabc" =~ /.*?a/ && $& == "a")
+test_ok("abcabc" =~ /.*?c/ && $& == "abc")
+test_ok(/(.|\n)*?\n(b|\n)/ =~ "a\nb\n\n" && $& == "a\nb")
+
+test_ok(/^(ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(ab+)+/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+/ =~ "ababb" && $& == "ababb")
+
+test_ok(/(\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+test_ok(/(?:\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+
+$x = +<<END;
+ABCD
+ABCD
+END
+$x.gsub!(/((.|\n)*?)B((.|\n)*?)D/, '\1\3')
+test_ok($x == "AC\nAC\n")
+
+test_ok("foobar" =~ /foo(?=(bar)|(baz))/)
+test_ok("foobaz" =~ /foo(?=(bar)|(baz))/)
+
+$foo = "abc"
+test_ok("#$foo = abc" == "abc = abc")
+test_ok("#{$foo} = abc" == "abc = abc")
+
+foo = "abc"
+test_ok("#{foo} = abc" == "abc = abc")
+
+test_ok('-' * 5 == '-----')
+test_ok('-' * 1 == '-')
+test_ok('-' * 0 == '')
+
+foo = '-'
+test_ok(foo * 5 == '-----')
+test_ok(foo * 1 == '-')
+test_ok(foo * 0 == '')
+
+$x = "a.gif"
+test_ok($x.sub(/.*\.([^\.]+)$/, '\1') == "gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'b.\1') == "b.gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, '\2') == "")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'a\2b') == "ab")
+test_ok($x.sub(/.*\.([^\.]+)$/, '<\&>') == "<a.gif>")
+
+# character constants(assumes ASCII)
+test_ok("a"[0] == ?a)
+test_ok(?a == ?a)
+test_ok(?\C-a == "\1")
+test_ok(?\M-a == "\341")
+test_ok(?\M-\C-a == "\201")
+test_ok("a".dup.upcase![0] == ?A)
+test_ok("A".dup.downcase![0] == ?a)
+test_ok("abc".dup.tr!("a-z", "A-Z") == "ABC")
+test_ok("aabbcccc".dup.tr_s!("a-z", "A-Z") == "ABC")
+test_ok("abcc".dup.squeeze!("a-z") == "abc")
+test_ok("abcd".dup.delete!("bc") == "ad")
+
+$x = "abcdef"
+$y = [ ?a, ?b, ?c, ?d, ?e, ?f ]
+$bad = false
+$x.each_byte {|i|
+  if i.chr != $y.shift
+    $bad = true
+    break
+  end
+}
+test_ok(!$bad)
+
+s = +"a string"
+s[0..s.size]="another string"
+test_ok(s == "another string")
+
+s = <<EOS
+#{
+[1,2,3].join(",")
+}
+EOS
+test_ok(s == "1,2,3\n")
+test_ok("Just".to_i(36) == 926381)
+test_ok("-another".to_i(36) == -23200231779)
+test_ok(1299022.to_s(36) == "ruby")
+test_ok(-1045307475.to_s(36) == "-hacker")
+test_ok("Just_another_Ruby_hacker".to_i(36) == 265419172580680477752431643787347)
+test_ok(-265419172580680477752431643787347.to_s(36) == "-justanotherrubyhacker")
+
+a = []
+(0..255).each {|n|
+  ch = [n].pack("C")
+  a.push ch if /a#{Regexp.quote ch}b/x =~ "ab"
+}
+test_ok(a.size == 0)
+
+test_check "assignment"
+a = nil
+test_ok(defined?(a))
+test_ok(a == nil)
+
+# multiple assignment
+a, b = 1, 2
+test_ok(a == 1 && b == 2)
+
+a, b = b, a
+test_ok(a == 2 && b == 1)
+
+a, = 1,2
+test_ok(a == 1)
+
+a, *b = 1, 2, 3
+test_ok(a == 1 && b == [2, 3])
+
+a, (b, c), d = 1, [2, 3], 4
+test_ok(a == 1 && b == 2 && c == 3 && d == 4)
+
+*a = 1, 2, 3
+test_ok(a == [1, 2, 3])
+
+*a = 4
+test_ok(a == [4])
+
+*a = nil
+test_ok(a == [nil])
+
+test_check "call"
+def aaa(a, b=100, *rest)
+  res = [a, b]
+  res += rest if rest
+  return res
+end
+
+# not enough argument
+begin
+  aaa()				# need at least 1 arg
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+begin
+  aaa				# no arg given (exception raised)
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+test_ok(aaa(1) == [1, 100])
+test_ok(aaa(1, 2) == [1, 2])
+test_ok(aaa(1, 2, 3, 4) == [1, 2, 3, 4])
+test_ok(aaa(1, *[2, 3, 4]) == [1, 2, 3, 4])
+
+test_check "proc"
+$proc = Proc.new{|i| i}
+test_ok($proc.call(2) == 2)
+test_ok($proc.call(3) == 3)
+
+$proc = Proc.new{|i| i*2}
+test_ok($proc.call(2) == 4)
+test_ok($proc.call(3) == 6)
+
+Proc.new{
+  iii=5				# nested local variable
+  $proc = Proc.new{|i|
+    iii = i
+  }
+  $proc2 = Proc.new {
+    $x = iii			# nested variables shared by procs
+  }
+  # scope of nested variables
+  test_ok(defined?(iii))
+}.call
+test_ok(!defined?(iii))		# out of scope
+
+loop{iii=5; test_ok(eval("defined? iii")); break}
+loop {
+  iii = 10
+  def dyna_var_check
+    loop {
+      test_ok(!defined?(iii))
+      break
+    }
+  end
+  dyna_var_check
+  break
+}
+$x=0
+$proc.call(5)
+$proc2.call
+test_ok($x == 5)
+
+if defined? Process.kill
+  test_check "signal"
+
+  $x = 0
+  trap "SIGINT", Proc.new{|sig| $x = 2}
+  Process.kill "SIGINT", $$
+  100.times {
+    sleep 0.1
+    break if $x != 0
+  }
+  test_ok($x == 2)
+
+  trap "SIGINT", Proc.new{raise "Interrupt"}
+
+  x = false
+  begin
+    Process.kill "SIGINT", $$
+    sleep 0.1
+  rescue
+    x = $!
+  end
+  test_ok(x && /Interrupt/ =~ x.message)
+end
+
+test_check "eval"
+test_ok(eval("") == nil)
+$bad=false
+eval 'while false; $bad = true; print "foo\n" end'
+test_ok(!$bad)
+
+test_ok(eval('Object'))
+test_ok(eval('true'))
+test_ok(!eval('nil'))
+test_ok(!eval('false'))
+
+$foo = 'test_ok(true)'
+begin
+  eval $foo
+rescue
+  test_ok(false)
+end
+
+test_ok(eval("$foo") == 'test_ok(true)')
+test_ok(eval("true") == true)
+i = 5
+test_ok(eval("i == 5"))
+test_ok(eval("i") == 5)
+test_ok(eval("defined? i"))
+
+# eval with binding
+def test_ev
+  local1 = "local1"
+  lambda {
+    local2 = "local2"
+    return binding
+  }.call
+end
+
+$x = test_ev
+test_ok(eval("local1", $x) == "local1") # normal local var
+test_ok(eval("local2", $x) == "local2") # nested local var
+$bad = true
+begin
+  p eval("local1")
+rescue NameError		# must raise error
+  $bad = false
+end
+test_ok(!$bad)
+
+module EvTest
+  EVTEST1 = 25
+  evtest2 = 125
+  $x = binding
+end
+test_ok(eval("EVTEST1", $x) == 25)	# constant in module
+test_ok(eval("evtest2", $x) == 125)	# local var in module
+$bad = true
+begin
+  eval("EVTEST1")
+rescue NameError		# must raise error
+  $bad = false
+end
+test_ok(!$bad)
+
+x = binding #! YARV Limitation: Proc.new{}
+eval "i4 = 1", x
+test_ok(eval("i4", x) == 1)
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "i4 = 22", x
+test_ok(eval("i4", x) == 22)
+$x = []
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+
+x = binding
+eval "i = 1", x
+test_ok(eval("i", x) == 1)
+x = Proc.new{binding}.call
+eval "i = 22", x
+test_ok(eval("i", x) == 22)
+$x = []
+x = Proc.new{binding}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+x = Proc.new{binding}.call
+eval "for i6 in 1..1; j6=i6; end", x
+test_ok(eval("defined? i6", x))
+test_ok(eval("defined? j6", x))
+
+Proc.new {
+  p = binding
+  eval "foo11 = 1", p
+  foo22 = 5
+  Proc.new{foo11=22}.call
+  Proc.new{foo22=55}.call
+  test_ok(eval("foo11", p) == eval("foo11"))
+  test_ok(eval("foo11") == 1)
+  test_ok(eval("foo22", p) == eval("foo22"))
+  test_ok(eval("foo22") == 55)
+}.call if false #! YARV Limitation
+
+#! YARV Limitation: p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+p1 = Proc.new{i7 = 0; binding}.call
+#! YARV Limitation: test_ok(p1.call == 0)
+eval "i7=5", p1
+#! YARV Limitation: test_ok(p1.call == 5)
+test_ok(!defined?(i7))
+
+if false #! YARV Limitation
+p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+i7 = nil
+test_ok(p1.call == 0)
+eval "i7=1", p1
+test_ok(p1.call == 1)
+eval "i7=5", p1
+test_ok(p1.call == 5)
+test_ok(i7 == nil)
+end
+
+# WASI doesn't support spawning a new process for now.
+unless /wasi/ =~ RUBY_PLATFORM
+test_check "system"
+test_ok(`echo foobar` == "foobar\n")
+test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
+
+script_tmp = "script_tmp.#{$$}"
+tmp = open(script_tmp, "w")
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby -s #{script_tmp} -zzz` == 'true')
+test_ok(`./miniruby -s #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby #{script_tmp} -zzz=678` == '678')
+
+tmp = open(script_tmp, "w")
+tmp.print "this is a leading junk\n";
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.print "__END__\n";
+tmp.print "this is a trailing junk\n";
+tmp.close
+
+test_ok(`./miniruby -x #{script_tmp}` == '')
+test_ok(`./miniruby -x #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+for i in 1..5
+  tmp.print i, "\n"
+end
+tmp.close
+
+`./miniruby -i.bak -pe '$_.sub!(/^[0-9]+$/){$&.to_i * 5}' #{script_tmp}`
+done = true
+tmp = open(script_tmp, "r")
+while tmp.gets
+  if $_.to_i % 5 != 0
+    done = false
+    break
+  end
+end
+tmp.close
+test_ok(done)
+
+File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
+File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
+end # not /wasi/ =~ RUBY_PLATFORM
+
+test_check "const"
+TEST1 = 1
+TEST2 = 2
+
+module Const
+  TEST3 = 3
+  TEST4 = 4
+end
+
+module Const2
+  TEST3 = 6
+  TEST4 = 8
+end
+
+include Const
+
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,3,4])
+
+include Const2
+STDERR.print "intentionally redefines TEST3, TEST4\n" if $VERBOSE
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,6,8])
+
+
+test_ok((String <=> Object) == -1)
+test_ok((Object <=> String) == 1)
+test_ok((Array <=> String) == nil)
+
+test_check "clone"
+foo = Object.new
+def foo.test
+  "test"
+end
+bar = foo.clone
+def bar.test2
+  "test2"
+end
+
+test_ok(bar.test2 == "test2")
+test_ok(bar.test == "test")
+test_ok(foo.test == "test")
+
+begin
+  foo.test2
+  test_ok false
+rescue NoMethodError
+  test_ok true
+end
+
+module M001; end
+module M002; end
+module M003; include M002; end
+module M002; include M001; end
+module M003; include M002; end
+
+test_ok(M003.ancestors == [M003, M002, M001])
+
+test_check "marshal"
+$x = [1,2,3,[4,5,"foo"],{1=>"bar"},2.5,fact(30)]
+$y = Marshal.dump($x)
+test_ok($x == Marshal.load($y))
+
+StrClone=String.clone;
+test_ok(Marshal.load(Marshal.dump(StrClone.new("abc"))).class == StrClone)
+
+[[1,2,3,4], [81, 2, 118, 3146]].each { |w,x,y,z|
+  a = (x.to_f + y.to_f / z.to_f) * Math.exp(w.to_f / (x.to_f + y.to_f / z.to_f))
+  ma = Marshal.dump(a)
+  b = Marshal.load(ma)
+  test_ok(a == b)
+}
+
+test_check "pack"
+
+$format = "c2x5CCxsdils_l_a6";
+# Need the expression in here to force ary[5] to be numeric.  This avoids
+# test2 failing because ary2 goes str->numeric->str and ary does not.
+ary = [1,-100,127,128,32767,987.654321098 / 100.0,12345,123456,-32767,-123456,"abcdef"]
+$x = ary.pack($format)
+ary2 = $x.unpack($format)
+
+test_ok(ary.length == ary2.length)
+test_ok(ary.join(':') == ary2.join(':'))
+test_ok($x =~ /def/)
+
+$x = [-1073741825]
+test_ok($x.pack("q").unpack("q") == $x)
+
+test_check "math"
+test_ok(Math.sqrt(4) == 2)
+
+include Math
+test_ok(sqrt(4) == 2)
+
+test_check "struct"
+struct_test = Struct.new("Test", :foo, :bar)
+test_ok(struct_test == Struct::Test)
+
+test = struct_test.new(1, 2)
+test_ok(test.foo == 1 && test.bar == 2)
+test_ok(test[0] == 1 && test[1] == 2)
+
+a, b = test.to_a
+test_ok(a == 1 && b == 2)
+
+test[0] = 22
+test_ok(test.foo == 22)
+
+test.bar = 47
+test_ok(test.bar == 47)
+
+test_check "variable"
+test_ok($$.instance_of?(Integer))
+
+# read-only variable
+begin
+  $$ = 5
+  test_ok false
+rescue NameError
+  test_ok true
+end
+
+foobar = "foobar"
+$_ = foobar
+test_ok($_ == foobar)
+
+class Gods
+  @@rule = "Uranus"
+  def ruler0
+    @@rule
+  end
+
+  def self.ruler1		# <= per method definition style
+    @@rule
+  end
+  class << self			# <= multiple method definition style
+    def ruler2
+      @@rule
+    end
+  end
+end
+
+module Olympians
+  @@rule ="Zeus"
+  def ruler3
+    @@rule
+  end
+end
+
+class Titans < Gods
+  @@rule = "Cronus"		# modifies @@rule in Gods
+  include Olympians
+  def ruler4
+    @@rule
+  end
+end
+
+test_ok(Gods.new.ruler0 == "Cronus")
+test_ok(Gods.ruler1 == "Cronus")
+test_ok(Gods.ruler2 == "Cronus")
+test_ok(Titans.ruler1 == "Cronus")
+test_ok(Titans.ruler2 == "Cronus")
+atlas = Titans.new
+test_ok(atlas.ruler0 == "Cronus")
+test_ok(atlas.ruler3 == "Zeus")
+begin
+  atlas.ruler4
+rescue RuntimeError => e
+  test_ok(e.message.include?("class variable @@rule of Olympians is overtaken by Gods"))
+else
+  test_ok(false)
+end
+test_ok(atlas.ruler3 == "Zeus")
+
+test_check "trace"
+$x = 1234
+$y = 0
+trace_var :$x, Proc.new{$y = $x}
+$x = 40414
+test_ok($y == $x)
+
+untrace_var :$x
+$x = 19660208
+test_ok($y != $x)
+
+trace_var :$x, Proc.new{$x *= 2}
+$x = 5
+test_ok($x == 10)
+
+untrace_var :$x
+
+test_check "defined?"
+
+test_ok(defined?($x))		# global variable
+test_ok(defined?($x) == 'global-variable')# returns description
+
+foo=5
+test_ok(defined?(foo))		# local variable
+
+test_ok(defined?(Array))	# constant
+test_ok(defined?(Object.new))	# method
+test_ok(!defined?(Object.print))# private method
+test_ok(defined?(1 == 2))	# operator expression
+
+class Foo
+  def foo
+    p :foo
+  end
+  protected :foo
+  def bar(f)
+    test_ok(defined?(self.foo))
+    test_ok(defined?(f.foo))
+  end
+end
+f = Foo.new
+test_ok(defined?(f.foo) == nil)
+f.bar(f)
+
+def defined_test
+  return !defined?(yield)
+end
+
+test_ok(defined_test)		# not iterator
+test_ok(!defined_test{})	# called as iterator
+
+test_check "alias"
+class Alias0
+  def foo; "foo" end
+end
+class Alias1 < Alias0
+  alias bar foo
+  def foo; "foo+" + super end
+end
+class Alias2 < Alias1
+  alias baz foo
+  undef foo
+end
+
+x = Alias2.new
+test_ok(x.bar == "foo")
+test_ok(x.baz == "foo+foo")
+
+# test_check for cache
+test_ok(x.baz == "foo+foo")
+
+class Alias3 < Alias2
+  def foo
+    defined? super
+  end
+  def bar
+    defined? super
+  end
+  def quux
+    defined? super
+  end
+end
+x = Alias3.new
+test_ok(!x.foo)
+test_ok(x.bar)
+test_ok(!x.quux)
+
+test_check "path"
+test_ok(File.basename("a") == "a")
+test_ok(File.basename("a/b") == "b")
+test_ok(File.basename("a/b/") == "b")
+test_ok(File.basename("/") == "/")
+test_ok(File.basename("//") == "/")
+test_ok(File.basename("///") == "/")
+test_ok(File.basename("a/b////") == "b")
+test_ok(File.basename("a.rb", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".*") == "a")
+test_ok(File.basename("a.rb///", ".c") == "a.rb")
+test_ok(File.dirname("a") == ".")
+test_ok(File.dirname("/") == "/")
+test_ok(File.dirname("/a") == "/")
+test_ok(File.dirname("a/b") == "a")
+test_ok(File.dirname("a/b/c") == "a/b")
+test_ok(File.dirname("/a/b/c") == "/a/b")
+test_ok(File.dirname("/a/b/") == "/a")
+test_ok(File.dirname("/a/b///") == "/a")
+case Dir.pwd
+when %r'\A\w:'
+  test_ok(/\A\w:\/\z/ =~ File.expand_path(".", "/"))
+  test_ok(/\A\w:\/a\z/ =~ File.expand_path("a", "/"))
+  dosish = true
+when %r'\A//'
+  test_ok(%r'\A//[^/]+/[^/]+\z' =~ File.expand_path(".", "/"))
+  test_ok(%r'\A//[^/]+/[^/]+/a\z' =~ File.expand_path(".", "/"))
+  dosish = true
+else
+  test_ok(File.expand_path(".", "/") == "/")
+  test_ok(File.expand_path("sub", "/") == "/sub")
+end
+if dosish
+  test_ok(File.expand_path("/", "//machine/share/sub") == "//machine/share")
+  test_ok(File.expand_path("/dir", "//machine/share/sub") == "//machine/share/dir")
+  test_ok(File.expand_path("/", "z:/sub") == "z:/")
+  test_ok(File.expand_path("/dir", "z:/sub") == "z:/dir")
+end
+test_ok(File.expand_path(".", "//") == "//")
+test_ok(File.expand_path("sub", "//") == "//sub")
+
+# test_check "Proc#binding"
+ObjectSpace.each_object(Proc){|o|
+  begin
+    b = o.binding
+    eval 'self', b
+  rescue ArgumentError
+  end
+}
+
+test_check "gc"
+begin
+  1.upto(10000) {
+    tmp = [0,1,2,3,4,5,6,7,8,9]
+  }
+  tmp = nil
+  test_ok true
+rescue
+  test_ok false
+end
+class S
+  def initialize(a)
+    @a = a
+  end
+end
+l=nil
+100000.times {
+  l = S.new(l)
+}
+GC.start
+test_ok true   # reach here or dumps core
+l = []
+100000.times {
+  l.push([l])
+}
+GC.start
+test_ok true   # reach here or dumps core
+
+ObjectSpace.each_object{|o|
+  o.class.name
+}
+
+test_ok true   # reach here or dumps core
+
+PROGRESS.finish
+if $failed > 0
+  printf "not ok/test: %d failed %d\n", $ntest, $failed
+else
+  printf "end of test(test: %d)\n", $ntest
+end
diff --git a/benchmark/README.md b/benchmark/README.md
new file mode 100644
index 0000000000..9f9192685e
--- /dev/null
+++ b/benchmark/README.md
@@ -0,0 +1,75 @@
+# ruby/benchmark
+
+This directory has benchmark definitions to be run with
+[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
+
+## Normal usage
+
+Execute `gem install benchmark_driver` and run a command like:
+
+```bash
+# Run a benchmark script with the ruby in the $PATH
+benchmark-driver benchmark/app_fib.rb
+
+# Run benchmark scripts with multiple Ruby executables or options
+benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
+
+# Or compare Ruby versions managed by rbenv
+benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
+
+# You can collect many metrics in many ways
+benchmark-driver benchmark/*.rb --runner memory --output markdown
+
+# Some are defined with YAML for complex setup or accurate measurement
+benchmark-driver benchmark/*.yml
+```
+
+See also:
+
+```console
+benchmark-driver --help
+Usage: benchmark-driver [options] RUBY|YAML...
+    -r, --runner TYPE                Specify runner type: ips, time, memory, once, block (default: ips)
+    -o, --output TYPE                Specify output type: compare, simple, markdown, record, all (default: compare)
+    -e, --executables EXECS          Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
+        --rbenv VERSIONS             Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
+        --repeat-count NUM           Try benchmark NUM times and use the fastest result or the worst memory usage
+        --repeat-result TYPE         Yield "best", "average" or "worst" result with --repeat-count (default: best)
+        --alternate                  Alternate executables instead of running the same executable in a row with --repeat-count
+        --bundler                    Install and use gems specified in Gemfile
+        --filter REGEXP              Filter out benchmarks with given regexp
+        --run-duration SECONDS       Warmup estimates loop_count to run for this duration (default: 3)
+        --timeout SECONDS            Timeout ruby command execution with timeout(1)
+    -v, --verbose                    Verbose mode. Multiple -v options increase visibility (max: 2)
+```
+
+## make benchmark
+
+Using `make benchmark`, `make update-benchmark-driver` automatically downloads
+the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
+benchmark\_driver.
+
+```bash
+# Run all benchmarks with the ruby in the $PATH and the built ruby
+make benchmark
+
+# Or compare with specific ruby binary
+make benchmark COMPARE_RUBY="/path/to/ruby --jit"
+
+# Run vm benchmarks
+make benchmark ITEM=vm
+
+# Run some limited benchmarks in ITEM-matched files
+make benchmark ITEM=vm OPTS=--filter=block
+
+# You can specify the benchmark by an exact filename instead of using the default argument:
+# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
+make benchmark ARGS=benchmark/erb_render.yml
+
+# You can specify any option via $OPTS
+make benchmark OPTS="--help"
+
+# With `make benchmark`, some special runner plugins are available:
+#   -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
+make benchmark ITEM=vm_bigarray OPTS="-r peak"
+```
diff --git a/benchmark/bm_app_answer.rb b/benchmark/app_answer.rb
index 3cd8a8fd37..3cd8a8fd37 100644
--- a/benchmark/bm_app_answer.rb
+++ b/benchmark/app_answer.rb
diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb
new file mode 100644
index 0000000000..c1546e08ab
--- /dev/null
+++ b/benchmark/app_aobench.rb
@@ -0,0 +1,297 @@
+# coding: US-ASCII
+
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+#      https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+srand(0)
+
+class Vec
+  def initialize(x, y, z)
+    @x = x
+    @y = y
+    @z = z
+  end
+
+  attr_accessor :x, :y, :z
+
+  def vadd(b)
+    Vec.new(@x + b.x, @y + b.y, @z + b.z)
+  end
+
+  def vsub(b)
+    Vec.new(@x - b.x, @y - b.y, @z - b.z)
+  end
+
+  def vcross(b)
+    Vec.new(@y * b.z - @z * b.y,
+            @z * b.x - @x * b.z,
+            @x * b.y - @y * b.x)
+  end
+
+  def vdot(b)
+    @x * b.x + @y * b.y + @z * b.z
+  end
+
+  def vlength
+    Math.sqrt(@x * @x + @y * @y + @z * @z)
+  end
+
+  def vnormalize
+    len = vlength
+    v = Vec.new(@x, @y, @z)
+    if len > 1.0e-17 then
+      v.x = v.x / len
+      v.y = v.y / len
+      v.z = v.z / len
+    end
+    v
+  end
+end
+
+
+class Sphere
+  def initialize(center, radius)
+    @center = center
+    @radius = radius
+  end
+
+  attr_reader :center, :radius
+
+  def intersect(ray, isect)
+    rs = ray.org.vsub(@center)
+    b = rs.vdot(ray.dir)
+    c = rs.vdot(rs) - (@radius * @radius)
+    d = b * b - c
+    if d > 0.0 then
+      t = - b - Math.sqrt(d)
+
+      if t > 0.0 and t < isect.t then
+        isect.t = t
+        isect.hit = true
+        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+                          ray.org.y + ray.dir.y * t,
+                          ray.org.z + ray.dir.z * t)
+        n = isect.pl.vsub(@center)
+        isect.n = n.vnormalize
+      else
+        0.0
+      end
+    end
+    nil
+  end
+end
+
+class Plane
+  def initialize(p, n)
+    @p = p
+    @n = n
+  end
+
+  def intersect(ray, isect)
+    d = -@p.vdot(@n)
+    v = ray.dir.vdot(@n)
+    v0 = v
+    if v < 0.0 then
+      v0 = -v
+    end
+    if v0 < 1.0e-17 then
+      return
+    end
+
+    t = -(ray.org.vdot(@n) + d) / v
+
+    if t > 0.0 and t < isect.t then
+      isect.hit = true
+      isect.t = t
+      isect.n = @n
+      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+                        ray.org.y + t * ray.dir.y,
+                        ray.org.z + t * ray.dir.z)
+    end
+    nil
+  end
+end
+
+class Ray
+  def initialize(org, dir)
+    @org = org
+    @dir = dir
+  end
+
+  attr_accessor :org, :dir
+end
+
+class Isect
+  def initialize
+    @t = 10000000.0
+    @hit = false
+    @pl = Vec.new(0.0, 0.0, 0.0)
+    @n = Vec.new(0.0, 0.0, 0.0)
+  end
+
+  attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+  i = f * 255.5
+  if i > 255.0 then
+    i = 255.0
+  end
+  if i < 0.0 then
+    i = 0.0
+  end
+  i.to_i
+end
+
+def orthoBasis(basis, n)
+  basis[2] = Vec.new(n.x, n.y, n.z)
+  basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+  if n.x < 0.6 and n.x > -0.6 then
+    basis[1].x = 1.0
+  elsif n.y < 0.6 and n.y > -0.6 then
+    basis[1].y = 1.0
+  elsif n.z < 0.6 and n.z > -0.6 then
+    basis[1].z = 1.0
+  else
+    basis[1].x = 1.0
+  end
+
+  basis[0] = basis[1].vcross(basis[2])
+  basis[0] = basis[0].vnormalize
+
+  basis[1] = basis[2].vcross(basis[0])
+  basis[1] = basis[1].vnormalize
+end
+
+class Scene
+  def initialize
+    @spheres = Array.new
+    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+  end
+
+  def ambient_occlusion(isect)
+    basis = Array.new
+    orthoBasis(basis, isect.n)
+
+    ntheta    = NAO_SAMPLES
+    nphi      = NAO_SAMPLES
+    eps       = 0.0001
+    occlusion = 0.0
+
+    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+                isect.pl.y + eps * isect.n.y,
+                isect.pl.z + eps * isect.n.z)
+    nphi.times do |j|
+      ntheta.times do |i|
+        r = rand
+        phi = 2.0 * 3.14159265 * rand
+        x = Math.cos(phi) * Math.sqrt(1.0 - r)
+        y = Math.sin(phi) * Math.sqrt(1.0 - r)
+        z = Math.sqrt(r)
+
+        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+        raydir = Vec.new(rx, ry, rz)
+        ray = Ray.new(p0, raydir)
+
+        occisect = Isect.new
+        @spheres[0].intersect(ray, occisect)
+        @spheres[1].intersect(ray, occisect)
+        @spheres[2].intersect(ray, occisect)
+        @plane.intersect(ray, occisect)
+        if occisect.hit then
+          occlusion = occlusion + 1.0
+        else
+          0.0
+        end
+      end
+    end
+
+    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+    Vec.new(occlusion, occlusion, occlusion)
+  end
+
+  def render(w, h, nsubsamples)
+    cnt = 0
+    nsf = nsubsamples.to_f
+    h.times do |y|
+      w.times do |x|
+        rad = Vec.new(0.0, 0.0, 0.0)
+
+        # Subsampling
+        nsubsamples.times do |v|
+          nsubsamples.times do |u|
+
+            cnt = cnt + 1
+            wf = w.to_f
+            hf = h.to_f
+            xf = x.to_f
+            yf = y.to_f
+            uf = u.to_f
+            vf = v.to_f
+
+            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+            eye = Vec.new(px, py, -1.0).vnormalize
+
+            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+            isect = Isect.new
+            @spheres[0].intersect(ray, isect)
+            @spheres[1].intersect(ray, isect)
+            @spheres[2].intersect(ray, isect)
+            @plane.intersect(ray, isect)
+            if isect.hit then
+              col = ambient_occlusion(isect)
+              rad.x = rad.x + col.x
+              rad.y = rad.y + col.y
+              rad.z = rad.z + col.z
+            end
+          end
+        end
+
+        r = rad.x / (nsf * nsf)
+        g = rad.y / (nsf * nsf)
+        b = rad.z / (nsf * nsf)
+        printf("%c", clamp(r))
+        printf("%c", clamp(g))
+        printf("%c", clamp(b))
+      end
+      nil
+    end
+
+    nil
+  end
+end
+
+alias printf_orig printf
+def printf *args
+  # $fp.printf(*args)
+end
+
+# File.open("ao.ppm", "w") do |fp|
+  # $fp = fp
+  printf("P6\n")
+  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  printf("255\n")
+  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
new file mode 100644
index 0000000000..31e29b7644
--- /dev/null
+++ b/benchmark/app_erb.yml
@@ -0,0 +1,23 @@
+#
+# Create many HTML strings with ERB.
+#
+prelude: |
+  require 'erb'
+
+  data = <<erb
+  <html>
+    <head> <%= title %> </head>
+    <body>
+      <h1> <%= title %> </h1>
+      <p>
+        <%= content %>
+      </p>
+    </body>
+  </html>
+  erb
+
+  title = "hello world!"
+  content = "hello world!\n" * 10
+benchmark:
+  app_erb: ERB.new(data).result(binding)
+loop_count: 15000
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/app_factorial.rb
index 45f471dfdb..45f471dfdb 100644
--- a/benchmark/bm_app_factorial.rb
+++ b/benchmark/app_factorial.rb
diff --git a/benchmark/app_fib.rb b/benchmark/app_fib.rb
new file mode 100644
index 0000000000..e61bc8aa32
--- /dev/null
+++ b/benchmark/app_fib.rb
@@ -0,0 +1,10 @@
+def fib(n)
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
+
diff --git a/benchmark/bm_app_lc_fizzbuzz.rb b/benchmark/app_lc_fizzbuzz.rb
index f09574bbeb..f09574bbeb 100644
--- a/benchmark/bm_app_lc_fizzbuzz.rb
+++ b/benchmark/app_lc_fizzbuzz.rb
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/app_mandelbrot.rb
index 801b75e8e2..801b75e8e2 100644
--- a/benchmark/bm_app_mandelbrot.rb
+++ b/benchmark/app_mandelbrot.rb
diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb
new file mode 100644
index 0000000000..47be7b203f
--- /dev/null
+++ b/benchmark/app_pentomino.rb
@@ -0,0 +1,130 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+  nb.each{|x|
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      [-ROW, -1, 1, ROW].each{|d|
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      }
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  }
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  (0...ROW*COL).each{|i|
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  }
+end
+
+def pboard
+  return # skip print
+  print "No. #$no\n"
+  (0...COL).each{|i|
+    print "|"
+    (0...ROW-NP).each{|j|
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    }
+    print "\n"
+  }
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      x.each{|s|
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      }
+      if f == 0 then
+        x.each{|s|
+          $b[pos+s] = i
+        }
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        x.each{|s|
+          $b[pos+s] = -1
+        }
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/app_raise.rb
index 5db8f95d50..5db8f95d50 100644
--- a/benchmark/bm_app_raise.rb
+++ b/benchmark/app_raise.rb
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/app_strconcat.rb
index 7eed7c1aed..7eed7c1aed 100644
--- a/benchmark/bm_app_strconcat.rb
+++ b/benchmark/app_strconcat.rb
diff --git a/benchmark/bm_app_tak.rb b/benchmark/app_tak.rb
index efe5380f4e..efe5380f4e 100644
--- a/benchmark/bm_app_tak.rb
+++ b/benchmark/app_tak.rb
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/app_tarai.rb
index 4c146f5ccf..4c146f5ccf 100644
--- a/benchmark/bm_app_tarai.rb
+++ b/benchmark/app_tarai.rb
diff --git a/benchmark/bm_app_uri.rb b/benchmark/app_uri.rb
index 586edfd5dc..586edfd5dc 100644
--- a/benchmark/bm_app_uri.rb
+++ b/benchmark/app_uri.rb
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
new file mode 100644
index 0000000000..88ef544ba0
--- /dev/null
+++ b/benchmark/array_flatten.yml
@@ -0,0 +1,19 @@
+prelude: |
+  small_flat_ary = 5.times.to_a
+  large_flat_ary = 100.times.to_a
+  small_pairs_ary = [[1, 2]] * 5
+  large_pairs_ary = [[1, 2]] * 100
+  mostly_flat_ary = 100.times.to_a.push([101, 102])
+
+benchmark:
+  small_flat_ary.flatten: small_flat_ary.flatten
+  small_flat_ary.flatten!: small_flat_ary.flatten!
+  large_flat_ary.flatten: large_flat_ary.flatten
+  large_flat_ary.flatten!: large_flat_ary.flatten!
+  small_pairs_ary.flatten: small_pairs_ary.flatten
+  small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
+  large_pairs_ary.flatten: large_pairs_ary.flatten
+  large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
+  mostly_flat_ary.flatten: mostly_flat_ary.flatten
+  mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
+loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
new file mode 100644
index 0000000000..26705323fd
--- /dev/null
+++ b/benchmark/array_intersection.yml
@@ -0,0 +1,14 @@
+prelude: |
+  small1 = [1, 2, 3]
+  small2 = [1, 2, 3, 4, 5]
+  small3 = [2, 3, 4, 5]
+  small4 = [2]
+  big1 = [1, 2, 3, 4] * 64
+  big2 = [1, 2, 3] * 64
+  big3 = [1, 2] * 64
+
+benchmark:
+  small-&: small1 & small2 & small3 & small4
+  small-intersection: small1.intersection(small2, small3, small4)
+  big-&: big1 & big2 & big3
+  big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_large_literal.yml b/benchmark/array_large_literal.yml
new file mode 100644
index 0000000000..423d68391f
--- /dev/null
+++ b/benchmark/array_large_literal.yml
@@ -0,0 +1,19 @@
+prelude: |
+  def def_array(size)
+    Object.class_eval(<<-END)
+      def array_#{size}
+        x = 1
+        [#{(['x'] * size).join(',')}]
+      end
+    END
+  end
+  def_array(100)
+  def_array(1000)
+  def_array(10000)
+  def_array(100000)
+benchmark:
+  array_100: array_100
+  array_1000: array_1000
+  array_10000: array_10000
+  array_100000: array_100000
+
diff --git a/benchmark/array_max_float.yml b/benchmark/array_max_float.yml
new file mode 100644
index 0000000000..ace1ae2e14
--- /dev/null
+++ b/benchmark/array_max_float.yml
@@ -0,0 +1,30 @@
+prelude: |
+  ary2 = 2.times.map(&:to_f).shuffle
+  ary10 = 10.times.map(&:to_f).shuffle
+  ary100 = 100.times.map(&:to_f).shuffle
+  ary500 = 500.times.map(&:to_f).shuffle
+  ary1000 = 1000.times.map(&:to_f).shuffle
+  ary2000 = 2500.times.map(&:to_f).shuffle
+  ary3000 = 2500.times.map(&:to_f).shuffle
+  ary5000 = 5000.times.map(&:to_f).shuffle
+  ary10000 = 10000.times.map(&:to_f).shuffle
+  ary20000 = 20000.times.map(&:to_f).shuffle
+  ary50000 = 50000.times.map(&:to_f).shuffle
+  ary100000 = 100000.times.map(&:to_f).shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_max_int.yml b/benchmark/array_max_int.yml
new file mode 100644
index 0000000000..acd83684d0
--- /dev/null
+++ b/benchmark/array_max_int.yml
@@ -0,0 +1,31 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary500 = 500.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary2000 = 2500.times.to_a.shuffle
+  ary3000 = 2500.times.to_a.shuffle
+  ary5000 = 5000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+  ary20000 = 20000.times.to_a.shuffle
+  ary50000 = 50000.times.to_a.shuffle
+  ary100000 = 100000.times.to_a.shuffle
+  ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+  ary1000000.max: ary1000000.max
+
+loop_count: 10000
diff --git a/benchmark/array_max_str.yml b/benchmark/array_max_str.yml
new file mode 100644
index 0000000000..2aeed010f2
--- /dev/null
+++ b/benchmark/array_max_str.yml
@@ -0,0 +1,30 @@
+prelude: |
+  ary2 = 2.times.map(&:to_s).shuffle
+  ary10 = 10.times.map(&:to_s).shuffle
+  ary100 = 100.times.map(&:to_s).shuffle
+  ary500 = 500.times.map(&:to_s).shuffle
+  ary1000 = 1000.times.map(&:to_s).shuffle
+  ary2000 = 2500.times.map(&:to_s).shuffle
+  ary3000 = 2500.times.map(&:to_s).shuffle
+  ary5000 = 5000.times.map(&:to_s).shuffle
+  ary10000 = 10000.times.map(&:to_s).shuffle
+  ary20000 = 20000.times.map(&:to_s).shuffle
+  ary50000 = 50000.times.map(&:to_s).shuffle
+  ary100000 = 100000.times.map(&:to_s).shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_min.yml b/benchmark/array_min.yml
new file mode 100644
index 0000000000..53e5072b14
--- /dev/null
+++ b/benchmark/array_min.yml
@@ -0,0 +1,31 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary500 = 500.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary2000 = 2500.times.to_a.shuffle
+  ary3000 = 2500.times.to_a.shuffle
+  ary5000 = 5000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+  ary20000 = 20000.times.to_a.shuffle
+  ary50000 = 50000.times.to_a.shuffle
+  ary100000 = 100000.times.to_a.shuffle
+  ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+  ary2.min: ary2.min
+  ary10.min: ary10.min
+  ary100.min: ary100.min
+  ary500.min: ary500.min
+  ary1000.min: ary1000.min
+  ary2000.min: ary2000.min
+  ary3000.min: ary3000.min
+  ary5000.min: ary5000.min
+  ary10000.min: ary10000.min
+  ary20000.min: ary20000.min
+  ary50000.min: ary50000.min
+  ary100000.min: ary100000.min
+  ary1000000.min: ary1000000.min
+
+loop_count: 10000
diff --git a/benchmark/array_sample.yml b/benchmark/array_sample.yml
new file mode 100644
index 0000000000..1cd2b34794
--- /dev/null
+++ b/benchmark/array_sample.yml
@@ -0,0 +1,4 @@
+prelude: ary = (1..10_000).to_a
+benchmark:
+  - ary.sample
+  - ary.sample(2)
diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb
new file mode 100644
index 0000000000..5f41ecc32b
--- /dev/null
+++ b/benchmark/array_sample_100k_10.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10}
diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb
new file mode 100644
index 0000000000..18b1715319
--- /dev/null
+++ b/benchmark/array_sample_100k_11.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 11}
diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb
new file mode 100644
index 0000000000..22863afe89
--- /dev/null
+++ b/benchmark/array_sample_100k__100.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 100}
diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb
new file mode 100644
index 0000000000..4cd79e6c67
--- /dev/null
+++ b/benchmark/array_sample_100k__1k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 1000}
diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb
new file mode 100644
index 0000000000..b3d264249e
--- /dev/null
+++ b/benchmark/array_sample_100k__6k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 6000}
diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb
new file mode 100644
index 0000000000..5dd55ec058
--- /dev/null
+++ b/benchmark/array_sample_100k___10k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10_000}
diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb
new file mode 100644
index 0000000000..1506732c3c
--- /dev/null
+++ b/benchmark/array_sample_100k___50k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 50_000}
diff --git a/benchmark/bm_array_shift.rb b/benchmark/array_shift.rb
index 798bb9e3f4..798bb9e3f4 100644
--- a/benchmark/bm_array_shift.rb
+++ b/benchmark/array_shift.rb
diff --git a/benchmark/array_small_and.rb b/benchmark/array_small_and.rb
new file mode 100644
index 0000000000..e53a6edae6
--- /dev/null
+++ b/benchmark/array_small_and.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+  (MIN_SIZE..MAX_SIZE).map do |size2|
+    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+  end
+end
+
+ITERATIONS.times do
+  ARRAYS.each do |group|
+    group.each do |arr1, arr2|
+      arr1 & arr2
+    end
+  end
+end
diff --git a/benchmark/array_small_diff.rb b/benchmark/array_small_diff.rb
new file mode 100644
index 0000000000..9661ee48db
--- /dev/null
+++ b/benchmark/array_small_diff.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+  (MIN_SIZE..MAX_SIZE).map do |size2|
+    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+  end
+end
+
+ITERATIONS.times do
+  ARRAYS.each do |group|
+    group.each do |arr1, arr2|
+      arr1 - arr2
+    end
+  end
+end
diff --git a/benchmark/array_small_or.rb b/benchmark/array_small_or.rb
new file mode 100644
index 0000000000..c58b5fd1ff
--- /dev/null
+++ b/benchmark/array_small_or.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+  (MIN_SIZE..MAX_SIZE).map do |size2|
+    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+  end
+end
+
+ITERATIONS.times do
+  ARRAYS.each do |group|
+    group.each do |arr1, arr2|
+      arr1 | arr2
+    end
+  end
+end
diff --git a/benchmark/array_sort_block.rb b/benchmark/array_sort_block.rb
new file mode 100644
index 0000000000..3579786056
--- /dev/null
+++ b/benchmark/array_sort_block.rb
@@ -0,0 +1,2 @@
+ary = Array.new(1000) { rand(1000) }
+10000.times { ary.sort { |a, b| a <=> b } }
diff --git a/benchmark/array_sort_float.rb b/benchmark/array_sort_float.rb
new file mode 100644
index 0000000000..9a6e2f8bd2
--- /dev/null
+++ b/benchmark/array_sort_float.rb
@@ -0,0 +1,2 @@
+arr = Array.new(1000) { rand }
+10000.times { arr.sort }
diff --git a/benchmark/array_sort_int.yml b/benchmark/array_sort_int.yml
new file mode 100644
index 0000000000..7b9027ebf7
--- /dev/null
+++ b/benchmark/array_sort_int.yml
@@ -0,0 +1,15 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+
+benchmark:
+  ary2.sort: ary2.sort
+  ary10.sort: ary10.sort
+  ary100.sort: ary100.sort
+  ary1000.sort: ary1000.sort
+  ary10000.sort: ary10000.sort
+
+loop_count: 10000
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
new file mode 100644
index 0000000000..6cb394cb9f
--- /dev/null
+++ b/benchmark/array_values_at_int.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
new file mode 100644
index 0000000000..5b53806d1c
--- /dev/null
+++ b/benchmark/array_values_at_range.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/attr_accessor.yml b/benchmark/attr_accessor.yml
new file mode 100644
index 0000000000..82134cdf9b
--- /dev/null
+++ b/benchmark/attr_accessor.yml
@@ -0,0 +1,29 @@
+prelude: |
+  class C
+    attr_accessor :x
+    def initialize
+      @x = nil
+    end
+    class_eval <<-END
+      def ar
+        #{'x;'*256}
+      end
+      def aw
+        #{'self.x = nil;'*256}
+      end
+      def arm
+        m = method(:x)
+        #{'m.call;'*256}
+      end
+      def awm
+        m = method(:x=)
+        #{'m.call(nil);'*256}
+      end
+    END
+  end
+  obj = C.new
+benchmark:
+  attr_reader: "obj.ar"
+  attr_writer: "obj.aw"
+  attr_reader_method: "obj.arm"
+  attr_writer_method: "obj.awm"
diff --git a/benchmark/bighash.rb b/benchmark/bighash.rb
new file mode 100644
index 0000000000..e2ad5a5c94
--- /dev/null
+++ b/benchmark/bighash.rb
@@ -0,0 +1 @@
+h = {}; 5000000.times {|n| h[n] = n }
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
deleted file mode 100644
index ffab116fcd..0000000000
--- a/benchmark/bm_app_aobench.rb
+++ /dev/null
@@ -1,291 +0,0 @@
-# AO render benchmark
-# Original program (C) Syoyo Fujita in Javascript (and other languages)
-#      https://code.google.com/p/aobench/
-# Ruby(yarv2llvm) version by Hideki Miura
-#
-
-IMAGE_WIDTH = 256
-IMAGE_HEIGHT = 256
-NSUBSAMPLES = 2
-NAO_SAMPLES = 8
-
-class Vec
-  def initialize(x, y, z)
-    @x = x
-    @y = y
-    @z = z
-  end
-
-  attr_accessor :x, :y, :z
-
-  def vadd(b)
-    Vec.new(@x + b.x, @y + b.y, @z + b.z)
-  end
-
-  def vsub(b)
-    Vec.new(@x - b.x, @y - b.y, @z - b.z)
-  end
-
-  def vcross(b)
-    Vec.new(@y * b.z - @z * b.y,
-            @z * b.x - @x * b.z,
-            @x * b.y - @y * b.x)
-  end
-
-  def vdot(b)
-    @x * b.x + @y * b.y + @z * b.z
-  end
-
-  def vlength
-    Math.sqrt(@x * @x + @y * @y + @z * @z)
-  end
-
-  def vnormalize
-    len = vlength
-    v = Vec.new(@x, @y, @z)
-    if len > 1.0e-17 then
-      v.x = v.x / len
-      v.y = v.y / len
-      v.z = v.z / len
-    end
-    v
-  end
-end
-
-
-class Sphere
-  def initialize(center, radius)
-    @center = center
-    @radius = radius
-  end
-
-  attr_reader :center, :radius
-
-  def intersect(ray, isect)
-    rs = ray.org.vsub(@center)
-    b = rs.vdot(ray.dir)
-    c = rs.vdot(rs) - (@radius * @radius)
-    d = b * b - c
-    if d > 0.0 then
-      t = - b - Math.sqrt(d)
-
-      if t > 0.0 and t < isect.t then
-        isect.t = t
-        isect.hit = true
-        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
-                          ray.org.y + ray.dir.y * t,
-                          ray.org.z + ray.dir.z * t)
-        n = isect.pl.vsub(@center)
-        isect.n = n.vnormalize
-      else
-        0.0
-      end
-    end
-    nil
-  end
-end
-
-class Plane
-  def initialize(p, n)
-    @p = p
-    @n = n
-  end
-
-  def intersect(ray, isect)
-    d = -@p.vdot(@n)
-    v = ray.dir.vdot(@n)
-    v0 = v
-    if v < 0.0 then
-      v0 = -v
-    end
-    if v0 < 1.0e-17 then
-      return
-    end
-
-    t = -(ray.org.vdot(@n) + d) / v
-
-    if t > 0.0 and t < isect.t then
-      isect.hit = true
-      isect.t = t
-      isect.n = @n
-      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
-                        ray.org.y + t * ray.dir.y,
-                        ray.org.z + t * ray.dir.z)
-    end
-    nil
-  end
-end
-
-class Ray
-  def initialize(org, dir)
-    @org = org
-    @dir = dir
-  end
-
-  attr_accessor :org, :dir
-end
-
-class Isect
-  def initialize
-    @t = 10000000.0
-    @hit = false
-    @pl = Vec.new(0.0, 0.0, 0.0)
-    @n = Vec.new(0.0, 0.0, 0.0)
-  end
-
-  attr_accessor :t, :hit, :pl, :n
-end
-
-def clamp(f)
-  i = f * 255.5
-  if i > 255.0 then
-    i = 255.0
-  end
-  if i < 0.0 then
-    i = 0.0
-  end
-  i.to_i
-end
-
-def otherBasis(basis, n)
-  basis[2] = Vec.new(n.x, n.y, n.z)
-  basis[1] = Vec.new(0.0, 0.0, 0.0)
-
-  if n.x < 0.6 and n.x > -0.6 then
-    basis[1].x = 1.0
-  elsif n.y < 0.6 and n.y > -0.6 then
-    basis[1].y = 1.0
-  elsif n.z < 0.6 and n.z > -0.6 then
-    basis[1].z = 1.0
-  else
-    basis[1].x = 1.0
-  end
-
-  basis[0] = basis[1].vcross(basis[2])
-  basis[0] = basis[0].vnormalize
-
-  basis[1] = basis[2].vcross(basis[0])
-  basis[1] = basis[1].vnormalize
-end
-
-class Scene
-  def initialize
-    @spheres = Array.new
-    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
-    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
-    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
-    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
-  end
-
-  def ambient_occlusion(isect)
-    basis = Array.new
-    otherBasis(basis, isect.n)
-
-    ntheta    = NAO_SAMPLES
-    nphi      = NAO_SAMPLES
-    eps       = 0.0001
-    occlusion = 0.0
-
-    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
-                isect.pl.y + eps * isect.n.y,
-                isect.pl.z + eps * isect.n.z)
-    nphi.times do |j|
-      ntheta.times do |i|
-        r = rand
-        phi = 2.0 * 3.14159265 * rand
-        x = Math.cos(phi) * Math.sqrt(1.0 - r)
-        y = Math.sin(phi) * Math.sqrt(1.0 - r)
-        z = Math.sqrt(r)
-
-        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
-        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
-        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
-
-        raydir = Vec.new(rx, ry, rz)
-        ray = Ray.new(p0, raydir)
-
-        occisect = Isect.new
-        @spheres[0].intersect(ray, occisect)
-        @spheres[1].intersect(ray, occisect)
-        @spheres[2].intersect(ray, occisect)
-        @plane.intersect(ray, occisect)
-        if occisect.hit then
-          occlusion = occlusion + 1.0
-        else
-          0.0
-        end
-      end
-    end
-
-    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
-
-    Vec.new(occlusion, occlusion, occlusion)
-  end
-
-  def render(w, h, nsubsamples)
-    cnt = 0
-    nsf = nsubsamples.to_f
-    h.times do |y|
-      w.times do |x|
-        rad = Vec.new(0.0, 0.0, 0.0)
-
-        # Subsmpling
-        nsubsamples.times do |v|
-          nsubsamples.times do |u|
-
-            cnt = cnt + 1
-            wf = w.to_f
-            hf = h.to_f
-            xf = x.to_f
-            yf = y.to_f
-            uf = u.to_f
-            vf = v.to_f
-
-            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
-            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
-
-            eye = Vec.new(px, py, -1.0).vnormalize
-
-            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
-
-            isect = Isect.new
-            @spheres[0].intersect(ray, isect)
-            @spheres[1].intersect(ray, isect)
-            @spheres[2].intersect(ray, isect)
-            @plane.intersect(ray, isect)
-            if isect.hit then
-              col = ambient_occlusion(isect)
-              rad.x = rad.x + col.x
-              rad.y = rad.y + col.y
-              rad.z = rad.z + col.z
-            end
-          end
-        end
-
-        r = rad.x / (nsf * nsf)
-        g = rad.y / (nsf * nsf)
-        b = rad.z / (nsf * nsf)
-        printf("%c", clamp(r))
-        printf("%c", clamp(g))
-        printf("%c", clamp(b))
-      end
-      nil
-    end
-
-    nil
-  end
-end
-
-alias printf_orig printf
-def printf *args
-end
-
-# File.open("ao.ppm", "w") do |fp|
-  printf("P6\n")
-  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
-  printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
-  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
-# end
-
-undef printf
-alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
deleted file mode 100644
index 77c66a7949..0000000000
--- a/benchmark/bm_app_erb.rb
+++ /dev/null
@@ -1,26 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-
-require 'erb'
-
-data = DATA.read
-max = 15_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-max.times{
-  ERB.new(data).result(binding)
-}
-
-__END__
-
-<html>
-  <head> <%= title %> </head>
-  <body>
-    <h1> <%= title %> </h1>
-    <p>
-      <%= content %>
-    </p>
-  </body>
-</html>
diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb
deleted file mode 100644
index 34a7b2e725..0000000000
--- a/benchmark/bm_app_fib.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def fib n
-  if n < 3
-    1
-  else
-    fib(n-1) + fib(n-2)
-  end
-end
-
-fib(34)
-
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
deleted file mode 100644
index 59c63f358e..0000000000
--- a/benchmark/bm_app_pentomino.rb
+++ /dev/null
@@ -1,259 +0,0 @@
-#!/usr/local/bin/ruby
-# This program is contributed by Shin Nishiyama
-
-
-# modified by K.Sasada
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n, a, nb)
-  nb.each{|x|
-    a[n] = x
-    if n == NP-1
-      $p << [a.sort]
-    else
-      nbc=nb.dup
-      [-ROW, -1, 1, ROW].each{|d|
-        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
-          nbc << x+d
-        end
-      }
-      nbc.delete x
-      piece(n+1,a[0..n],nbc)
-    end
-  }
-end
-
-def kikaku(a)
-  a.collect {|x| x - a[0]}
-end
-def ud(a)
-  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
-  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
-  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
-  piece(0,[],[0])
-  $p.each do |a|
-    a0 = a[0]
-    a[1] = ud(a0)
-    a[2] = rl(a0)
-    a[3] = ud(rl(a0))
-    a[4] = xy(a0)
-    a[5] = ud(xy(a0))
-    a[6] = rl(xy(a0))
-    a[7] = ud(rl(xy(a0)))
-    a.sort!
-    a.uniq!
-  end
-  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
-  (0...ROW*COL).each{|i|
-    if i % ROW >= ROW-NP
-      $b[i] = -2
-    else
-      $b[i] = -1
-    end
-    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
-  }
-end
-
-def pboard
-  return # skip print
-  print "No. #$no\n"
-  (0...COL).each{|i|
-    print "|"
-    (0...ROW-NP).each{|j|
-      x = $b[i*ROW+j]
-      if x < 0
-        print "..|"
-      else
-        printf "%2d|",x+1
-      end
-    }
-    print "\n"
-  }
-  print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
-  if a.length == $p.length then
-    $no += 1
-    pboard
-    return
-  end
-  while $b[pos] != -1
-    pos += 1
-  end
-  ($pnum - a).each do |i|
-    $p[i].each do |x|
-      f = 0
-      x.each{|s|
-        if $b[pos+s] != -1
-          f=1
-          break
-        end
-      }
-      if f == 0 then
-        x.each{|s|
-          $b[pos+s] = i
-        }
-        a << i
-        setpiece(a.dup, pos)
-        a.pop
-        x.each{|s|
-          $b[pos+s] = -1
-        }
-      end
-    end
-  end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
-
-
-__END__
-
-# original
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n,a,nb)
-  for x in nb
-    a[n] = x
-    if n == NP-1
-      $p << [a.sort]
-    else
-      nbc=nb.dup
-      for d in [-ROW, -1, 1, ROW]
-        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
-          nbc << x+d
-        end
-      end
-      nbc.delete x
-      piece(n+1,a[0..n],nbc)
-    end
-  end
-end
-
-def kikaku(a)
-  a.collect {|x| x - a[0]}
-end
-def ud(a)
-  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
-  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
-  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
-  piece(0,[],[0])
-  $p.each do |a|
-    a0 = a[0]
-    a[1] = ud(a0)
-    a[2] = rl(a0)
-    a[3] = ud(rl(a0))
-    a[4] = xy(a0)
-    a[5] = ud(xy(a0))
-    a[6] = rl(xy(a0))
-    a[7] = ud(rl(xy(a0)))
-    a.sort!
-    a.uniq!
-  end
-  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
-  for i in 0...ROW*COL
-    if i % ROW >= ROW-NP
-      $b[i] = -2
-    else
-      $b[i] = -1
-    end
-    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
-  end
-end
-
-def pboard
-  print "No. #$no\n"
-  for i in 0...COL
-    print "|"
-    for j in 0...ROW-NP
-      x = $b[i*ROW+j]
-      if x < 0
-        print "..|"
-      else
-        printf "%2d|",x+1
-      end
-    end
-    print "\n"
-  end
-  print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
-  if a.length == $p.length then
-    $no += 1
-    pboard
-    return
-  end
-  while $b[pos] != -1
-    pos += 1
-  end
-  ($pnum - a).each do |i|
-    $p[i].each do |x|
-      f = 0
-      for s in x do
-        if $b[pos+s] != -1
-          f=1
-          break
-        end
-      end
-      if f == 0 then
-        for s in x do
-          $b[pos+s] = i
-        end
-        a << i
-        setpiece(a.dup, pos)
-        a.pop
-        for s in x do
-          $b[pos+s] = -1
-        end
-      end
-    end
-  end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
deleted file mode 100644
index d3375c744c..0000000000
--- a/benchmark/bm_loop_generator.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-max = 600000
-
-if defined? Fiber
-  gen = (1..max).each
-  loop do
-    gen.next
-  end
-else
-  require 'generator'
-  gen = Generator.new((0..max))
-  while gen.next?
-    gen.next
-  end
-end
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
deleted file mode 100644
index 7db5be9050..0000000000
--- a/benchmark/bm_so_ackermann.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-def ack(m, n)
-    if m == 0 then
-        n + 1
-    elsif n == 0 then
-        ack(m - 1, 1)
-    else
-        ack(m - 1, ack(m, n - 1))
-    end
-end
-
-NUM = 9
-ack(3, NUM)
-
-
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
deleted file mode 100644
index 2b8fce8f99..0000000000
--- a/benchmark/bm_so_array.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan and Mark Hubbart
-
-n = 9000 # Integer(ARGV.shift || 1)
-
-x = Array.new(n)
-y = Array.new(n, 0)
-
-n.times{|bi|
-  x[bi] = bi + 1
-}
-
-(0 .. 999).each do |e|
-  (n-1).step(0,-1) do |bi|
-    y[bi] += x.at(bi)
-  end
-end
-# puts "#{y.first} #{y.last}"
-
-
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
deleted file mode 100644
index 873214de7c..0000000000
--- a/benchmark/bm_so_concatenate.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
-
-STUFF = "hello\n"
-i = 0
-while i<10
-  i += 1
-  hello = ''
-  4_000_000.times do |e|
-    hello << STUFF
-  end
-end
-# puts hello.length
-
-
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
deleted file mode 100644
index 65f6337a4a..0000000000
--- a/benchmark/bm_so_count_words.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan
-
-input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
-
-nl = nw = nc = 0
-while true
-  tmp = input.read(4096) or break
-  data = tmp << (input.gets || "")
-  nc += data.length
-  nl += data.count("\n")
-  ((data.strip! || data).tr!("\n", " ") || data).squeeze!
-  nw += data.count(" ") + 1
-end
-# STDERR.puts "#{nl} #{nw} #{nc}"
-
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
deleted file mode 100644
index deb003a594..0000000000
--- a/benchmark/bm_so_exception.rb
+++ /dev/null
@@ -1,61 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-$HI = 0
-$LO = 0
-NUM = 250000 # Integer(ARGV[0] || 1)
-
-
-class Lo_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-class Hi_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-def some_function(num)
-  begin
-    hi_function(num)
-  rescue
-    print "We shouldn't get here, exception is: #{$!.type}\n"
-  end
-end
-
-def hi_function(num)
-  begin
-    lo_function(num)
-  rescue Hi_Exception
-    $HI = $HI + 1
-  end
-end
-
-def lo_function(num)
-  begin
-    blowup(num)
-  rescue Lo_Exception
-    $LO = $LO + 1
-  end
-end
-
-def blowup(num)
-  if num % 2 == 0
-    raise Lo_Exception.new(num)
-  else
-    raise Hi_Exception.new(num)
-  end
-end
-
-
-i = 1
-max = NUM+1
-while i < max
-  i += 1
-  some_function(i+1)
-end
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
deleted file mode 100644
index 3f759ba7ae..0000000000
--- a/benchmark/bm_so_fasta.rb
+++ /dev/null
@@ -1,81 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-$last = 42.0
-def gen_random (max,im=139968,ia=3877,ic=29573)
-    (max * ($last = ($last * ia + ic) % im)) / im
-end
-
-alu =
-   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
-   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
-   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
-   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
-   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
-   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
-   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-iub = [
-    ["a", 0.27],
-    ["c", 0.12],
-    ["g", 0.12],
-    ["t", 0.27],
-
-    ["B", 0.02],
-    ["D", 0.02],
-    ["H", 0.02],
-    ["K", 0.02],
-    ["M", 0.02],
-    ["N", 0.02],
-    ["R", 0.02],
-    ["S", 0.02],
-    ["V", 0.02],
-    ["W", 0.02],
-    ["Y", 0.02],
-]
-homosapiens = [
-    ["a", 0.3029549426680],
-    ["c", 0.1979883004921],
-    ["g", 0.1975473066391],
-    ["t", 0.3015094502008],
-]
-
-def make_repeat_fasta(id, desc, src, n)
-    puts ">#{id} #{desc}"
-    v = nil
-    width = 60
-    l = src.length
-    s = src * ((n / l) + 1)
-    s.slice!(n, l)
-    puts(s.scan(/.{1,#{width}}/).join("\n"))
-end
-
-def make_random_fasta(id, desc, table, n)
-    puts ">#{id} #{desc}"
-    rand, v = nil,nil
-    width = 60
-    chunk = 1 * width
-    prob = 0.0
-    table.each{|v| v[1]= (prob += v[1])}
-    for i in 1..(n/width)
-        puts((1..width).collect{
-            rand = gen_random(1.0)
-            table.find{|v| v[1]>rand}[0]
-        }.join)
-    end
-    if n%width != 0
-        puts((1..(n%width)).collect{
-            rand = gen_random(1.0)
-            table.find{|v| v[1]>rand}[0]
-        }.join)
-    end
-end
-
-
-n = (ARGV[0] or 250_000).to_i
-
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
deleted file mode 100644
index dadab3e79c..0000000000
--- a/benchmark/bm_so_k_nucleotide.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
-    n, table = seq.length - length + 1, Hash.new(0)
-    f, i = nil, nil
-    (0 ... length).each do |f|
-        (f ... n).step(length) do |i|
-            table[seq[i,length]] += 1
-        end
-    end
-    [n,table]
-
-end
-
-def sort_by_freq( seq,length )
-    n,table = frecuency( seq,length )
-    a, b, v = nil, nil, nil
-    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
-        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
-    end
-    puts
-end
-
-def find_seq( seq,s )
-    n,table = frecuency( seq,s.length )
-    puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
-    seq << line.chomp
-    line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
deleted file mode 100644
index e2c5c8e559..0000000000
--- a/benchmark/bm_so_matrix.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-n = 60 #Integer(ARGV.shift || 1)
-
-size = 40
-
-def mkmatrix(rows, cols)
-    count = 1
-    mx = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            row[j] = count
-            count += 1
-        end
-        mx[bi] = row
-    end
-    mx
-end
-
-def mmult(rows, cols, m1, m2)
-    m3 = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            val = 0
-            (0 .. (cols - 1)).each do |k|
-                val += m1.at(bi).at(k) * m2.at(k).at(j)
-            end
-            row[j] = val
-        end
-        m3[bi] = row
-    end
-    m3
-end
-
-m1 = mkmatrix(size, size)
-m2 = mkmatrix(size, size)
-mm = Array.new
-n.times do
-    mm = mmult(size, size, m1, m2)
-end
-# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
-
-
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
deleted file mode 100644
index b8e93bd150..0000000000
--- a/benchmark/bm_so_meteor_contest.rb
+++ /dev/null
@@ -1,564 +0,0 @@
-#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-#   http://shootout.alioth.debian.org
-#   contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM:  the main body is at the bottom.
-#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-#   2) see how I represent a board as a bitmask by reading the blank_board comments
-#   3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
-  # an array (by location) containing a bit mask for how the piece maps at the given location.
-  # if the rotation is invalid at that location the mask will contain false
-  attr_reader :start_masks
-
-  # maps a direction to a relative location.  these differ depending on whether it is an even or
-  # odd row being mapped from
-  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
-  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
-  def initialize( directions )
-    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
-    @even_mask = mask_for_offsets( @even_offsets)
-    @odd_mask = mask_for_offsets( @odd_offsets)
-
-    @start_masks = Array.new(60)
-
-    # create the rotational masks by placing the base mask at the location and seeing if
-    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
-    # is true the piece cannot be placed
-    0.upto(59) do | offset |
-      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
-      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
-        imask = compute_required( mask, offset)
-        @start_masks[offset] = [ mask, imask, imask | mask ]
-      else
-        @start_masks[offset] = false
-      end
-    end
-  end
-
-  def compute_required( mask, offset )
-    board = blank_board
-    0.upto(offset) { | i | board |= 1 << i }
-    board |= mask
-    return 0 if (!prunable(board | mask, offset))
-    board = flood_fill(board,58)
-    count = 0
-    imask = 0
-    0.upto(59) do | i |
-      if (board[i] == 0) then
-        imask |= (1 << i)
-        count += 1
-      end
-    end
-    (count > 0 && count < 5) ? imask : 0
-  end
-
-  def flood_fill( board, location)
-    return board if (board[location] == 1)
-    board |= 1 << location
-    row, col = location.divmod(6)
-    board = flood_fill( board, location - 1) if (col > 0)
-    board = flood_fill( board, location + 1) if (col < 4)
-    if (row % 2 == 0) then
-      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
-    else
-      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
-    end
-    board
-  end
-
-  # given a location, produces a list of relative locations covered by the piece at this rotation
-  def offsets( location)
-    if is_even( location) then
-      @even_offsets.collect { | value | value + location }
-    else
-      @odd_offsets.collect { | value | value + location }
-    end
-  end
-
-  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
-  # this is hard to explain. imagine we have this partial board:
-  #   0 0 0 0 0 x        [positions 0-5]
-  #    0 0 1 1 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 1 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # The top-left of the piece is at position 8, the
-  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
-  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
-  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
-  #   0 0 0 1 1 x        [positions 0-5]
-  #    0 0 1 0 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 0 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
-  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
-  # this function would return
-  def normalize_offsets( values)
-    min = values.min
-    even_min = is_even(min)
-    other_min = even_min ? min + 6 : min + 7
-    other_values = values.collect do | value |
-      if is_even(value) then
-        value + 6 - other_min
-      else
-        value + 7 - other_min
-      end
-    end
-    values.collect! { | value | value - min }
-
-    if even_min then
-      [values, other_values]
-    else
-      [other_values, values]
-    end
-  end
-
-  # produce a bitmask representation of an array of offset locations
-  def mask_for_offsets( offsets )
-    mask = 0
-    offsets.each { | value | mask = mask + ( 1 << value ) }
-    mask
-  end
-
-  # finds a "safe" position that a position as described by a list of directions can be placed
-  # without falling off any edge of the board.  the values returned a location to place the first piece
-  # at so it will fit after making the described moves
-  def start_adjust( directions )
-    south = east = 0;
-    directions.each do | direction |
-      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
-      south += 1 if ( direction == :nw || direction == :ne )
-    end
-    south * 6 + east
-  end
-
-  # given a set of directions places the piece (as defined by a set of directions) on the board at
-  # a location that will not take it off the edge
-  def get_values ( directions )
-    start = start_adjust(directions)
-    values = [ start ]
-    directions.each do | direction |
-      if (start % 12 >= 6) then
-        start += @@rotation_odd_adder[direction]
-      else
-        start += @@rotation_even_adder[direction]
-      end
-      values += [ start ]
-    end
-
-    # some moves take you back to an existing location, we'll strip duplicates
-    values.uniq
-  end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-#   rotations -- all the rotations of the piece
-#   type -- a numeic "name" of the piece
-#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
-#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
-  attr_reader :rotations, :type, :masks
-  attr_accessor :placed
-
-  # transform hashes that change one direction into another when you either flip or rotate a set of directions
-  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
-  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
-  def initialize( directions, type )
-    @type = type
-    @rotations = Array.new();
-    @map = {}
-
-    generate_rotations( directions )
-    directions.collect! { | value | @@flip_converter[value] }
-    generate_rotations( directions )
-
-    # creates the masks AND a map that returns [location, rotation] for any given mask
-    # this is used when a board is found and we want to draw it, otherwise the map is unused
-    @masks = Array.new();
-    0.upto(59) do | i |
-      even = true
-      @masks[i] = @rotations.collect do | rotation |
-        mask = rotation.start_masks[i]
-        @map[mask[0]] = [ i, rotation ] if (mask)
-        mask || nil
-      end
-      @masks[i].compact!
-    end
-  end
-
-  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
-  def generate_rotations( directions )
-    6.times do
-      rotations.push( Rotation.new(directions))
-      directions.collect! { | value | @@rotate_converter[value] }
-    end
-  end
-
-  # given a board string, adds this piece to the board at whatever location/rotation
-  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
-  def fill_string( board_string)
-    location, rotation = @map[@placed]
-    rotation.offsets(location).each do | offset |
-      row, col = offset.divmod(6)
-      board_string[ row*5 + col, 1 ] = @type.to_s
-    end
-  end
-end
-
-# a blank bit board having this form:
-#
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
-  0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
-  0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
-  (location % 12) < 6
-end
-
-# support function that create three utility maps:
-#  $converter -- for each row an array that maps a five bit row (via array mapping)
-#                to the a a five bit representation of the bits below it
-#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-#                   a region array has three values the first is a mask of bits in the region,
-#                   the second is the count of those bits and the third is identical to the first
-#                   examples:
-#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-#                           0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
-  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
-  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
-  all_odds = Array.new(0b100000)
-  all_evens = Array.new(0b100000)
-  bit_counts = Array.new(0b100000)
-  new_regions = Array.new(0b100000)
-  0.upto(0b11111) do | i |
-    bit_count = odd = even = 0
-    0.upto(4) do | bit |
-      if (i[bit] == 1) then
-        bit_count += 1
-        odd |= odd_map[bit]
-        even |= even_map[bit]
-      end
-    end
-    all_odds[i] = odd
-    all_evens[i] = even
-    bit_counts[i] = bit_count
-    new_regions[i] = create_regions( i)
-  end
-
-  $converter = []
-  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
-  $bit_counts = bit_counts
-  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five.  The following board is an example of a prunable board:
-#    0 0 1 0 0
-#     0 1 0 0 0
-#    1 1 0 0 0
-#     0 1 0 0 0
-#    0 0 0 0 0
-#       ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
-#   location -- starting location, everything above and to the left is already full
-#   slotting -- set to true only when testing initial pieces, when filling normally
-#               additional assumptions are possible
-#
-# Algorithm:
-#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
-#    maintainng counts of active open areas (kept in the collector array) each collector contains
-#    three values at the start of an iteration:
-#          0: mask of bits that would be adjacent to the collector in this row
-#          1: the number of bits collected so far
-#          2: a scratch space starting as zero, but used during the computation to represent
-#             the empty bits in the new row that are adjacent (position 0)
-#  The exact procedure is described in-code
-def prunable( board, location, slotting = false)
-  collectors = []
-  # loop across the rows
-  (location / 6).to_i.upto(9) do | row_on |
-    # obtain a set of regions representing the bits of the current row.
-    regions = $regions[(board >> (row_on * 6)) & 0b11111]
-    converter = $converter[row_on]
-
-    # track the number of collectors at the start of the cycle so that
-    # we don't compute against newly created collectors, only existing collectors
-    initial_collector_count = collectors.length
-
-    # loop against the regions.  For each region of the row
-    # we will see if it connects to one or more existing collectors.
-    # if it connects to 1 collector, the bits from the region are added to the
-    # bits of the collector and the mask is placed in collector[2]
-    # If the region overlaps more than one collector then all the collectors
-    # it overlaps with are merged into the first one (the others are set to nil in the array)
-    # if NO collectors are found then the region is copied as a new collector
-    regions.each do | region |
-      collector_found = nil
-      region_mask = region[2]
-      initial_collector_count.times do | collector_num |
-        collector = collectors[collector_num]
-        if (collector) then
-          collector_mask = collector[0]
-          if (collector_mask & region_mask != 0) then
-            if (collector_found) then
-              collector_found[0] |= collector_mask
-              collector_found[1] += collector[1]
-              collector_found[2] |= collector[2]
-              collectors[collector_num] = nil
-            else
-              collector_found = collector
-              collector[1] += region[1]
-              collector[2] |= region_mask
-            end
-          end
-        end
-      end
-      if (collector_found == nil) then
-        collectors.push(Array.new(region))
-      end
-    end
-
-    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
-    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
-    # the board is prunable.  if it is a multiple of five it is removed.
-    # Collector that are still active have a new adjacent value [0] set based n the matched bits
-    # and have [2] cleared out for the next cycle.
-    collectors.length.times do | collector_num |
-      collector = collectors[collector_num]
-      if (collector) then
-        if (collector[2] == 0) then
-          return true if (collector[1] % 5 != 0)
-          collectors[collector_num] = nil
-        else
-          # if a collector matches all bits in the row then we can return unprunable early for the
-          # following reasons:
-          #    1) there can be no more unavailable bits bince we fill from the top left downward
-          #    2) all previous regions have been closed or joined so only this region can fail
-          #    3) this region must be good since there can never be only 1 region that is nuot
-          #       a multiple of five
-          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
-          # in pieces to see what configurations work for them (the only other time this algorithm is used).
-          return false if (collector[2] == 0b11111 && !slotting)
-          collector[0] = converter[collector[2]]
-          collector[2] = 0
-        end
-      end
-    end
-
-    # get rid of all the empty converters for the next round
-    collectors.compact!
-  end
-  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
-  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask.  see prunable for what a "region" is
-def create_regions( value )
-  regions = []
-  cur_region = 0
-  5.times do | bit |
-    if (value[bit] == 0) then
-      cur_region |= 1 << bit
-    else
-      if (cur_region != 0 ) then
-        regions.push( cur_region)
-        cur_region = 0;
-      end
-    end
-  end
-  regions.push(cur_region) if (cur_region != 0)
-  regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
-  find_top( 1)
-  find_top( 0)
-  print_results
-end
-
-# show the board
-def print_results
-  print "#{@boards_found} solutions found\n\n"
-  print_full_board( @min_board)
-  print "\n"
-  print_full_board( @max_board)
-  print "\n"
-end
-
-# finds solutions.  This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece.  It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
-#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
-#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
-#   diminsh over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
-#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-#   maximum number
-def find_top( rotation_skip)
-  board = blank_board
-  (@pieces.length-1).times do
-    piece = @pieces.shift
-    piece.masks[0].each do | mask, imask, cmask |
-      if ((rotation_skip += 1) % 2 == 0) then
-        piece.placed = mask
-        find( 1, 1, board | mask)
-      end
-    end
-    @pieces.push(piece)
-  end
-  piece = @pieces.shift
-  @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found.  depth is acheived via recursion.  the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-#  start_location -- where to start looking for place for the next piece at
-#  placed -- number of pieces placed
-#  board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
-  # find the next location to place a piece by looking for an empty bit
-  while board[start_location] == 1
-    start_location += 1
-  end
-
-  @pieces.length.times do
-    piece = @pieces.shift
-    piece.masks[start_location].each do | mask, imask, cmask |
-      if ( board & cmask == imask) then
-        piece.placed = mask
-        if (placed == 9) then
-          add_board
-        else
-          find( start_location + 1, placed + 1, board | mask)
-        end
-      end
-    end
-    @pieces.push(piece)
-  end
-end
-
-# print the board
-def print_full_board( board_string)
-  10.times do | row |
-    print " " if (row % 2 == 1)
-    5.times do | col |
-      print "#{board_string[row*5 + col,1]} "
-    end
-    print "\n"
-  end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
-  board_string = "99999999999999999999999999999999999999999999999999"
-  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
-  save( board_string)
-  save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
-  if (@all_boards[board_string] == nil) then
-    @min_board = board_string if (board_string < @min_board)
-    @max_board = board_string if (board_string > @max_board)
-    @all_boards.store(board_string,true)
-    @boards_found += 1
-
-    # the exit motif is a time saver.  Ideally the function should return, but those tests
-    # take noticeable time (performance).
-    if (@boards_found == @stop_count) then
-      print_results
-      exit(0)
-    end
-  end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
-  Piece.new( [ :nw, :ne, :east, :east ], 2),
-  Piece.new( [ :ne, :se, :east, :ne ], 7),
-  Piece.new( [ :ne, :east, :ne, :nw ], 1),
-  Piece.new( [ :east, :sw, :sw, :se ], 6),
-  Piece.new( [ :east, :ne, :se, :ne ], 5),
-  Piece.new( [ :east, :east, :east, :se ], 0),
-  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
-  Piece.new( [ :se, :se, :se, :west ], 9),
-  Piece.new( [ :se, :se, :east, :se ], 8),
-  Piece.new( [ :east, :east, :sw, :se ], 3)
-  ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
-
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
deleted file mode 100644
index d6c5bb9e61..0000000000
--- a/benchmark/bm_so_nbody.rb
+++ /dev/null
@@ -1,148 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
- attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
- def initialize(x, y, z, vx, vy, vz, mass)
-  @x, @y, @z = x, y, z
-  @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
-  @mass = mass * SOLAR_MASS
- end
-
- def move_from_i(bodies, nbodies, dt, i)
-  while i < nbodies
-   b2 = bodies[i]
-   dx = @x - b2.x
-   dy = @y - b2.y
-   dz = @z - b2.z
-
-   distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-   mag = dt / (distance * distance * distance)
-   b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
-   @vx -= dx * b2_mass_mag
-   @vy -= dy * b2_mass_mag
-   @vz -= dz * b2_mass_mag
-   b2.vx += dx * b_mass_mag
-   b2.vy += dy * b_mass_mag
-   b2.vz += dz * b_mass_mag
-   i += 1
-  end
-
-  @x += dt * @vx
-  @y += dt * @vy
-  @z += dt * @vz
- end
-end
-
-def energy(bodies)
-  e = 0.0
-  nbodies = bodies.size
-
-  for i in 0 ... nbodies
-    b = bodies[i]
-    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
-    for j in (i + 1) ... nbodies
-      b2 = bodies[j]
-      dx = b.x - b2.x
-      dy = b.y - b2.y
-      dz = b.z - b2.z
-      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-      e -= (b.mass * b2.mass) / distance
-    end
-  end
-  e
-end
-
-def offset_momentum(bodies)
-  px, py, pz = 0.0, 0.0, 0.0
-
-  for b in bodies
-    m = b.mass
-    px += b.vx * m
-    py += b.vy * m
-    pz += b.vz * m
-  end
-
-  b = bodies[0]
-  b.vx = - px / SOLAR_MASS
-  b.vy = - py / SOLAR_MASS
-  b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
-  # sun
-  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
-  # jupiter
-  Planet.new(
-    4.84143144246472090e+00,
-    -1.16032004402742839e+00,
-    -1.03622044471123109e-01,
-    1.66007664274403694e-03,
-    7.69901118419740425e-03,
-    -6.90460016972063023e-05,
-    9.54791938424326609e-04),
-
-  # saturn
-  Planet.new(
-    8.34336671824457987e+00,
-    4.12479856412430479e+00,
-    -4.03523417114321381e-01,
-    -2.76742510726862411e-03,
-    4.99852801234917238e-03,
-    2.30417297573763929e-05,
-    2.85885980666130812e-04),
-
-  # uranus
-  Planet.new(
-    1.28943695621391310e+01,
-    -1.51111514016986312e+01,
-    -2.23307578892655734e-01,
-    2.96460137564761618e-03,
-    2.37847173959480950e-03,
-    -2.96589568540237556e-05,
-    4.36624404335156298e-05),
-
-  # neptune
-  Planet.new(
-    1.53796971148509165e+01,
-    -2.59193146099879641e+01,
-    1.79258772950371181e-01,
-    2.68067772490389322e-03,
-    1.62824170038242295e-03,
-    -9.51592254519715870e-05,
-    5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
-  i = 0
-  while i < nbodies
-    b = BODIES[i]
-    b.move_from_i(BODIES, nbodies, dt, i + 1)
-    i += 1
-  end
-end
-
-puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
deleted file mode 100644
index a0513f8c47..0000000000
--- a/benchmark/bm_so_nested_loop.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# from Avi Bryant
-
-n = 16 # Integer(ARGV.shift || 1)
-x = 0
-n.times do
-    n.times do
-        n.times do
-            n.times do
-                n.times do
-                    n.times do
-                        x += 1
-                    end
-                end
-            end
-        end
-    end
-end
-# puts x
-
-
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
deleted file mode 100644
index e8607c7199..0000000000
--- a/benchmark/bm_so_object.rb
+++ /dev/null
@@ -1,56 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Aristarkh Zagorodnikov
-
-class Toggle
-    def initialize(start_state)
-        @bool = start_state
-    end
-
-    def value
-        @bool
-    end
-
-    def activate
-        @bool = !@bool
-        self
-    end
-end
-
-class NthToggle < Toggle
-    def initialize(start_state, max_counter)
-        super start_state
-        @count_max = max_counter
-        @counter = 0
-    end
-
-    def activate
-        @counter += 1
-        if @counter >= @count_max
-            @bool = !@bool
-            @counter = 0
-        end
-        self
-    end
-end
-
-n = 1500000 # (ARGV.shift || 1).to_i
-
-toggle = Toggle.new 1
-5.times do
-    toggle.activate.value ? 'true' : 'false'
-end
-n.times do
-    toggle = Toggle.new 1
-end
-
-ntoggle = NthToggle.new 1, 3
-8.times do
-    ntoggle.activate.value ? 'true' : 'false'
-end
-n.times do
-    ntoggle = NthToggle.new 1, 3
-end
-
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
deleted file mode 100644
index c7d6fbfb4d..0000000000
--- a/benchmark/bm_so_pidigits.rb
+++ /dev/null
@@ -1,92 +0,0 @@
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Gabriele Renzi
-
-class PiDigitSpigot
-
-    def initialize()
-        @z = Transformation.new 1,0,0,1
-        @x = Transformation.new 0,0,0,0
-        @inverse = Transformation.new 0,0,0,0
-    end
-
-    def next!
-        @y = @z.extract(3)
-        if safe? @y
-            @z = produce(@y)
-            @y
-        else
-            @z = consume @x.next!()
-            next!()
-        end
-    end
-
-    def safe?(digit)
-        digit == @z.extract(4)
-    end
-
-    def produce(i)
-        @inverse.qrst(10,-10*i,0,1).compose(@z)
-    end
-
-    def consume(a)
-        @z.compose(a)
-    end
-end
-
-
-class Transformation
-    attr_reader :q, :r, :s, :t
-    def initialize (q, r, s, t)
-        @q,@r,@s,@t,@k = q,r,s,t,0
-    end
-
-    def next!()
-        @q = @k = @k + 1
-        @r = 4 * @k + 2
-        @s = 0
-        @t = 2 * @k + 1
-        self
-    end
-
-    def extract(j)
-        (@q * j + @r) / (@s * j + @t)
-    end
-
-    def compose(a)
-        self.class.new( @q * a.q,
-                        @q * a.r + r * a.t,
-                        @s * a.q + t * a.s,
-                        @s * a.r + t * a.t
-                    )
-    end
-
-    def qrst *args
-        initialize *args
-        self
-    end
-
-
-end
-
-
-WIDTH = 10
-n = 2_500 # Integer(ARGV[0])
-j = 0
-
-digits = PiDigitSpigot.new
-
-while n > 0
-    if n >= WIDTH
-        WIDTH.times {print digits.next!}
-        j += WIDTH
-    else
-        n.times {print digits.next!}
-        (WIDTH-n).times {print " "}
-        j += n
-    end
-    puts "\t:"+j.to_s
-    n -= WIDTH
-end
-
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
deleted file mode 100644
index 82ea666994..0000000000
--- a/benchmark/bm_so_reverse_complement.rb
+++ /dev/null
@@ -1,30 +0,0 @@
-#!/usr/bin/ruby
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# Contributed by Peter Bjarke Olsen
-# Modified by Doug King
-
-seq=Array.new
-
-def revcomp(seq)
-  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
-  stringlen=seq.length
-  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-while input.gets
-  if $_ =~ />/
-    if seq.length != 0
-      revcomp(seq.join)
-      seq=Array.new
-    end
-    puts $_
-  else
-    $_.sub(/\n/,'')
-    seq.push $_
-  end
-end
-revcomp(seq.join)
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
deleted file mode 100644
index 16906f3605..0000000000
--- a/benchmark/bm_vm1_attr_ivar.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
-  attr_reader :a, :b
-  def initialize
-    @a = nil
-    @b = nil
-  end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = obj.a
-  k = obj.b
-end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
deleted file mode 100644
index 7e7a6b48c0..0000000000
--- a/benchmark/bm_vm1_attr_ivar_set.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
-  attr_accessor :a, :b
-  def initialize
-    @a = nil
-    @b = nil
-  end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  obj.a = 1
-  obj.b = 2
-end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
deleted file mode 100644
index a9f56b15ea..0000000000
--- a/benchmark/bm_vm1_block.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
-  yield
-end
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  m{
-  }
-end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
deleted file mode 100644
index ac59ebccf1..0000000000
--- a/benchmark/bm_vm1_const.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-Const = 1
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = Const
-  k = Const
-end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
deleted file mode 100644
index a1596145f2..0000000000
--- a/benchmark/bm_vm1_ensure.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-i = 0
-while i<30_000_000 # benchmark loop 1
-  i += 1
-  begin
-    begin
-    ensure
-    end
-  ensure
-  end
-end
-
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
deleted file mode 100644
index d4581439ff..0000000000
--- a/benchmark/bm_vm1_float_simple.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0.0; f = 0.0
-while i<30_000_000
-  i += 1
-  f += 0.1; f -= 0.1
-  f += 0.1; f -= 0.1
-  f += 0.1; f -= 0.1
-end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
deleted file mode 100644
index e78bca5668..0000000000
--- a/benchmark/bm_vm1_gc_short_lived.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
deleted file mode 100644
index b66052dee0..0000000000
--- a/benchmark/bm_vm1_gc_short_with_complex_long.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-def nested_hash h, n
-  if n == 0
-    ''
-  else
-    10.times{
-      h[Object.new] = nested_hash(h, n-1)
-    }
-  end
-end
-
-long_lived = Hash.new
-nested_hash long_lived, 6
-
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
-
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
deleted file mode 100644
index 298dbc845b..0000000000
--- a/benchmark/bm_vm1_gc_short_with_long.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-long_lived = Array.new(1_000_000){|i| "#{i}"}
-GC.start
-GC.start
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
deleted file mode 100644
index 6b15c1b7bf..0000000000
--- a/benchmark/bm_vm1_gc_short_with_symbol.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# make many symbols
-50_000.times{|i| sym = "sym#{i}".to_sym}
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
deleted file mode 100644
index 881528845b..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-short_lived_ary = []
-
-if RUBY_VERSION >= "2.2.0"
-  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  short_lived_ary[0] = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary_promoted.rb b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
deleted file mode 100644
index 3c8279c956..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary_promoted.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-long_lived = []
-
-if RUBY_VERSION > "2.2.0"
-  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
-  GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  long_lived[0] = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
deleted file mode 100644
index a4067af36b..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-class C
-  attr_accessor :foo
-end
-short_lived_obj = C.new
-
-if RUBY_VERSION >= "2.2.0"
-  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  short_lived_obj.foo = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj_promoted.rb b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
deleted file mode 100644
index eee07a0248..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj_promoted.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-class C
-  attr_accessor :foo
-end
-long_lived = C.new
-
-if RUBY_VERSION >= "2.2.0"
-  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
-  GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  long_lived.foo = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
deleted file mode 100644
index 68a73cf92f..0000000000
--- a/benchmark/bm_vm1_ivar.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-@a = 1
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = @a
-  k = @a
-end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
deleted file mode 100644
index bd81b06c34..0000000000
--- a/benchmark/bm_vm1_ivar_set.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  @a = 1
-  @b = 2
-end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
deleted file mode 100644
index 353de3ab0e..0000000000
--- a/benchmark/bm_vm1_length.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-a = 'abc'
-b = [1, 2, 3]
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a.length
-  b.length
-end
-
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
deleted file mode 100644
index 36f2068811..0000000000
--- a/benchmark/bm_vm1_lvar_init.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def m v
-  unless v
-    # unreachable code
-    v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
-    v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
-    v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
-    v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
-    v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
-  end
-end
-
-i = 0
-
-while i<30_000_000 # while loop 1
-  i += 1
-  m i
-end
-
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
deleted file mode 100644
index 222e864134..0000000000
--- a/benchmark/bm_vm1_lvar_set.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
-end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
deleted file mode 100644
index bbb4ae07a4..0000000000
--- a/benchmark/bm_vm1_neq.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-obj1 = Object.new
-obj2 = Object.new
-
-while i<30_000_000 # while loop 1
-  i += 1
-  obj1 != obj2
-end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
deleted file mode 100644
index b09ecdcc21..0000000000
--- a/benchmark/bm_vm1_not.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-obj = Object.new
-
-while i<30_000_000 # while loop 1
-  i += 1
-  !obj
-end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
deleted file mode 100644
index b0d3e2bdfa..0000000000
--- a/benchmark/bm_vm1_rescue.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  begin
-  rescue
-  end
-end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
deleted file mode 100644
index 63f9f21675..0000000000
--- a/benchmark/bm_vm1_simplereturn.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  return 1
-end
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  m
-end
-
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
deleted file mode 100644
index 918f8b2112..0000000000
--- a/benchmark/bm_vm1_swap.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-a = 1
-b = 2
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a, b = b, a
-end
-
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
deleted file mode 100644
index 775597cea6..0000000000
--- a/benchmark/bm_vm1_yield.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
-  i = 0
-  while i<30_000_000 # while loop 1
-    i += 1
-    yield
-  end
-end
-
-m{}
-
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
deleted file mode 100644
index df9037c83c..0000000000
--- a/benchmark/bm_vm2_array.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  a = [1,2,3,4,5,6,7,8,9,10]
-end
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
deleted file mode 100644
index b02509d6a2..0000000000
--- a/benchmark/bm_vm2_bigarray.rb
+++ /dev/null
@@ -1,106 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  a = [
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-  ]
-end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
deleted file mode 100644
index 5e3f437bb8..0000000000
--- a/benchmark/bm_vm2_bighash.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<60_000 # benchmark loop 2
-  i += 1
-  a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
-end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
deleted file mode 100644
index adc6e4df0a..0000000000
--- a/benchmark/bm_vm2_case.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-i = 0
-while i<6_000_000 # while loop 2
-  case :foo
-  when :bar
-    raise
-  when :baz
-    raise
-  when :boo
-    raise
-  when :foo
-    i += 1
-  end
-end
-
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
deleted file mode 100644
index 053ed6c912..0000000000
--- a/benchmark/bm_vm2_defined_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-class Object
-  define_method(:m){}
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/bm_vm2_dstr.rb
deleted file mode 100644
index 58c0f7bbc3..0000000000
--- a/benchmark/bm_vm2_dstr.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-x = y = 'z'
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  str = "foo#{x}bar#{y}baz"
-end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
deleted file mode 100644
index 307cfc28ef..0000000000
--- a/benchmark/bm_vm2_eval.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  eval("1")
-end
-
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
deleted file mode 100644
index a8ccff7138..0000000000
--- a/benchmark/bm_vm2_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb
deleted file mode 100644
index 2badc73101..0000000000
--- a/benchmark/bm_vm2_method_missing.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
-  def method_missing mid
-  end
-end
-
-obj = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
-end
diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb
deleted file mode 100644
index b4efb4f520..0000000000
--- a/benchmark/bm_vm2_method_with_block.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
-end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
deleted file mode 100644
index 7362f738c5..0000000000
--- a/benchmark/bm_vm2_mutex.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-require 'thread'
-
-m = Mutex.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m.synchronize{}
-end
diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/bm_vm2_newlambda.rb
deleted file mode 100644
index 6422c9b0d0..0000000000
--- a/benchmark/bm_vm2_newlambda.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  lambda {}
-end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
deleted file mode 100644
index c82c0e4bce..0000000000
--- a/benchmark/bm_vm2_poly_method.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
-  def m
-    1
-  end
-end
-class C2
-  def m
-    2
-  end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  o = (i % 2 == 0) ? o1 : o2
-  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
deleted file mode 100644
index aa5fd1dd38..0000000000
--- a/benchmark/bm_vm2_poly_method_ov.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
-  def m
-    1
-  end
-end
-class C2
-  def m
-    2
-  end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  o = (i % 2 == 0) ? o1 : o2
-#  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
deleted file mode 100644
index 65e5217371..0000000000
--- a/benchmark/bm_vm2_proc.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-def m &b
-  b
-end
-
-pr = m{
-  a = 1
-}
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  pr.call
-end
-
diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb
deleted file mode 100644
index aa5387987f..0000000000
--- a/benchmark/bm_vm2_raise1.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
-  if n > 0
-    rec n-1
-  else
-    raise
-  end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-
-  begin
-    rec 1
-  rescue
-    # ignore
-  end
-end
diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb
deleted file mode 100644
index 1f61c63157..0000000000
--- a/benchmark/bm_vm2_raise2.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
-  if n > 0
-    rec n-1
-  else
-    raise
-  end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-
-  begin
-    rec 10
-  rescue
-    # ignore
-  end
-end
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
deleted file mode 100644
index 55f9e957a3..0000000000
--- a/benchmark/bm_vm2_regexp.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-str = 'xxxhogexxx'
-while i<6_000_000 # benchmark loop 2
-  /hoge/ =~ str
-  i += 1
-end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
deleted file mode 100644
index 6a3ab6fdab..0000000000
--- a/benchmark/bm_vm2_send.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
-  def m
-  end
-end
-
-o = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  o.__send__ :m
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_hi.rb b/benchmark/bm_vm2_struct_big_aref_hi.rb
deleted file mode 100644
index 22cb26b0a5..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.z # x[25]
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_lo.rb b/benchmark/bm_vm2_struct_big_aref_lo.rb
deleted file mode 100644
index 5e61a7087e..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.k # x[10]
-end
diff --git a/benchmark/bm_vm2_struct_big_aset.rb b/benchmark/bm_vm2_struct_big_aset.rb
deleted file mode 100644
index 5a1c3d16f3..0000000000
--- a/benchmark/bm_vm2_struct_big_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.k = i # x[10] = i
-end
diff --git a/benchmark/bm_vm2_struct_small_aref.rb b/benchmark/bm_vm2_struct_small_aref.rb
deleted file mode 100644
index 8eaa555b41..0000000000
--- a/benchmark/bm_vm2_struct_small_aref.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.a
-end
diff --git a/benchmark/bm_vm2_struct_small_aset.rb b/benchmark/bm_vm2_struct_small_aset.rb
deleted file mode 100644
index ecd0f95669..0000000000
--- a/benchmark/bm_vm2_struct_small_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.a = i
-end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
deleted file mode 100644
index afd8579e7b..0000000000
--- a/benchmark/bm_vm2_super.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-
-class C
-  def m
-    1
-  end
-end
-
-class CC < C
-  def m
-    super()
-  end
-end
-
-obj = CC.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  obj.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
deleted file mode 100644
index 1774625942..0000000000
--- a/benchmark/bm_vm2_unif1.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-def m a, b
-end
-
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m 100, 200
-end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
deleted file mode 100644
index 2a43e62217..0000000000
--- a/benchmark/bm_vm2_zsuper.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-i = 0
-
-class C
-  def m a
-    1
-  end
-end
-
-class CC < C
-  def m a
-    super
-  end
-end
-
-obj = CC.new
-
-while i<6_000_000 # benchmark loop 2
-  obj.m 10
-  i += 1
-end
diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/bm_vm3_gc.rb
deleted file mode 100755
index 7db9829d44..0000000000
--- a/benchmark/bm_vm3_gc.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-#! /usr/bin/ruby
-5000.times do
-  100.times do
-    {"xxxx"=>"yyyy"}
-  end
-  GC.start
-end
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
deleted file mode 100644
index c993accdda..0000000000
--- a/benchmark/bm_vm_thread_alive_check1.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-5_000.times{
-  t = Thread.new{}
-  while t.alive?
-    Thread.pass
-  end
-}
diff --git a/benchmark/bm_vm_thread_mutex1.rb b/benchmark/bm_vm_thread_mutex1.rb
deleted file mode 100644
index 5c9f85dfb7..0000000000
--- a/benchmark/bm_vm_thread_mutex1.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# one thread, one mutex (no contention)
-
-require 'thread'
-m = Mutex.new
-r = 0
-max = 2000
-lmax = max * max
-(1..1).map{
-  Thread.new{
-    i = 0
-    while i<lmax
-      i += 1
-      m.synchronize{
-        r += 1
-      }
-    end
-  }
-}.each{|e|
-  e.join
-}
-raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex2.rb b/benchmark/bm_vm_thread_mutex2.rb
deleted file mode 100644
index 10de59054f..0000000000
--- a/benchmark/bm_vm_thread_mutex2.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# two threads, one mutex
-
-require 'thread'
-m = Mutex.new
-r = 0
-max = 2000
-lmax = (max * max)/2
-(1..2).map{
-  Thread.new{
-    i = 0
-    while i<lmax
-      i += 1
-      m.synchronize{
-        r += 1
-      }
-    end
-  }
-}.each{|e|
-  e.join
-}
-raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex3.rb b/benchmark/bm_vm_thread_mutex3.rb
deleted file mode 100644
index 7f9a44b39d..0000000000
--- a/benchmark/bm_vm_thread_mutex3.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-# 1000 threads, one mutex
-
-require 'thread'
-m = Mutex.new
-r = 0
-max = 2000
-(1..max).map{
-  Thread.new{
-    i = 0
-    while i<max
-      i += 1
-      m.synchronize{
-        r += 1
-      }
-    end
-  }
-}.each{|e|
-  e.join
-}
-raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/bm_vm_thread_pass.rb
deleted file mode 100644
index b5b3c0bc85..0000000000
--- a/benchmark/bm_vm_thread_pass.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# Plenty Thtread.pass
-# A performance may depend on GVL implementation.
-
-tmax = (ARGV.shift || 2).to_i
-lmax = 200_000 / tmax
-
-(1..tmax).map{
-  Thread.new{
-    lmax.times{
-      Thread.pass
-    }
-  }
-}.each{|t| t.join}
-
-
diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb
deleted file mode 100644
index 27157d1a6f..0000000000
--- a/benchmark/bm_vm_thread_pass_flood.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-1000.times{
-  Thread.new{loop{Thread.pass}}
-}
-
-i = 0
-while i<10000
-  i += 1
-end
diff --git a/benchmark/bm_vm_thread_pipe.rb b/benchmark/bm_vm_thread_pipe.rb
deleted file mode 100644
index 272d231eba..0000000000
--- a/benchmark/bm_vm_thread_pipe.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-# Mesure small and plenty pipe read/write.
-# A performance may depend on GVL implementation.
-
-lmax = 100_000
-r, w = IO.pipe
-[Thread.new{
-  lmax.times{
-    w.write('a')
-  }
-  p "w:exit"
-}, Thread.new{
-  lmax.times{
-    r.read(1)
-  }
-  p "r:exit"
-}].each{|t| t.join}
-
diff --git a/benchmark/bm_vm_thread_queue.rb b/benchmark/bm_vm_thread_queue.rb
deleted file mode 100644
index 37381ae62b..0000000000
--- a/benchmark/bm_vm_thread_queue.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-require 'thread'
-
-n = 1_000_000
-q = Queue.new
-consumer = Thread.new{
-  while q.pop
-    # consuming
-  end
-}
-
-producer = Thread.new{
-  n.times{
-    q.push true
-  }
-  q.push nil
-}
-
-consumer.join
diff --git a/benchmark/buffer_each.yml b/benchmark/buffer_each.yml
new file mode 100644
index 0000000000..417941104e
--- /dev/null
+++ b/benchmark/buffer_each.yml
@@ -0,0 +1,27 @@
+prelude: |
+  # frozen_string_literal: true
+  Warning[:experimental] = false
+  string = "The quick brown fox jumped over the lazy dog."
+  array = string.bytes
+  buffer = IO::Buffer.for(string)
+benchmark:
+  string.each_byte: |
+    upcased = String.new
+    string.each_byte do |byte|
+      upcased << (byte ^ 32)
+    end
+  array.each: |
+    upcased = String.new
+    array.each do |byte|
+      upcased << (byte ^ 32)
+    end
+  buffer.each: |
+    upcased = String.new
+    buffer.each(:U8) do |offset, byte|
+      upcased << (byte ^ 32)
+    end
+  buffer.each_byte: |
+    upcased = String.new
+    buffer.each_byte do |byte|
+      upcased << (byte ^ 32)
+    end
diff --git a/benchmark/buffer_get.yml b/benchmark/buffer_get.yml
new file mode 100644
index 0000000000..9e1f99d64e
--- /dev/null
+++ b/benchmark/buffer_get.yml
@@ -0,0 +1,25 @@
+prelude: |
+  # frozen_string_literal: true
+  Warning[:experimental] = false
+  string = "The quick brown fox jumped over the lazy dog."
+  buffer = IO::Buffer.for(string)
+  format = [:U32, :U32, :U32, :U32]
+benchmark:
+  string.unpack1: |
+    [
+      string.unpack1("N"),
+      string.unpack1("N", offset: 4),
+      string.unpack1("N", offset: 8),
+      string.unpack1("N", offset: 12),
+    ]
+  buffer.get_value: |
+    [
+      buffer.get_value(:U32, 0),
+      buffer.get_value(:U32, 4),
+      buffer.get_value(:U32, 8),
+      buffer.get_value(:U32, 12),
+    ]
+  buffer.get_values: |
+    buffer.get_values(format, 0)
+  string.unpack: |
+    string.unpack("NNNN")
diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml
new file mode 100644
index 0000000000..655be9d7d8
--- /dev/null
+++ b/benchmark/cgi_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'cgi/escape'
+benchmark:
+  - script: CGI.escapeHTML("")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("abcde")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("abcd<")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("'&\"<>")
+    loop_count: 5000000
+  - prelude: long_no_escape = "abcde" * 300
+    script: CGI.escapeHTML(long_no_escape)
+    loop_count: 1000000
+  - prelude: long_all_escape = "'&\"<>" * 10
+    script: CGI.escapeHTML(long_all_escape)
+    loop_count: 1000000
+  - prelude: | # http://example.com/
+      example_html = <<~HTML
+        <body>
+        <div>
+            <h1>Example Domain</h1>
+            <p>This domain is established to be used for illustrative examples in documents. You may use this
+            domain in examples without prior coordination or asking for permission.</p>
+            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+        </div>
+        </body>
+      HTML
+    script: CGI.escapeHTML(example_html)
+    loop_count: 1000000
diff --git a/benchmark/class_superclass.yml b/benchmark/class_superclass.yml
new file mode 100644
index 0000000000..847ff811f1
--- /dev/null
+++ b/benchmark/class_superclass.yml
@@ -0,0 +1,23 @@
+prelude: |
+  class SimpleClass; end
+  class OneModuleClass
+    1.times { include Module.new }
+  end
+  class MediumClass
+    10.times { include Module.new }
+  end
+  class LargeClass
+    100.times { include Module.new }
+  end
+benchmark:
+  object_class_superclass: |
+    Object.superclass
+  simple_class_superclass: |
+    SimpleClass.superclass
+  one_module_class: |
+    OneModuleClass.superclass
+  medium_class_superclass: |
+    MediumClass.superclass
+  large_class_superclass: |
+    LargeClass.superclass
+loop_count: 20000000
diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml
new file mode 100644
index 0000000000..d0150c5e5b
--- /dev/null
+++ b/benchmark/complex_float_add.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_add: c = a + b
+loop_count: 1000000
diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml
new file mode 100644
index 0000000000..b9f5e1d51c
--- /dev/null
+++ b/benchmark/complex_float_div.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_div: c = a / b
+loop_count: 1000000
diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml
new file mode 100644
index 0000000000..59b096a6dc
--- /dev/null
+++ b/benchmark/complex_float_mul.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_mul: c = a * b
+loop_count: 1000000
diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml
new file mode 100644
index 0000000000..6fcde3125b
--- /dev/null
+++ b/benchmark/complex_float_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_new: c = Complex(a, b)
+loop_count: 1000000
diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml
new file mode 100644
index 0000000000..c40a31ab55
--- /dev/null
+++ b/benchmark/complex_float_power.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_power: c = a ** b
+loop_count: 1000000
diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml
new file mode 100644
index 0000000000..3fafe7cdbe
--- /dev/null
+++ b/benchmark/complex_float_sub.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_sub: c = a - b
+loop_count: 1000000
diff --git a/benchmark/constant_invalidation.rb b/benchmark/constant_invalidation.rb
new file mode 100644
index 0000000000..a95ec6f37e
--- /dev/null
+++ b/benchmark/constant_invalidation.rb
@@ -0,0 +1,22 @@
+$VERBOSE = nil
+
+CONSTANT1 = 1
+CONSTANT2 = 1
+CONSTANT3 = 1
+CONSTANT4 = 1
+CONSTANT5 = 1
+
+def constants
+  [CONSTANT1, CONSTANT2, CONSTANT3, CONSTANT4, CONSTANT5]
+end
+
+500_000.times do
+  constants
+
+  # With previous behavior, this would cause all of the constant caches
+  # associated with the constant lookups listed above to invalidate, meaning
+  # they would all have to be fetched again. With current behavior, it only
+  # invalidates when a name matches, so the following constant set shouldn't
+  # impact the constant lookups listed above.
+  INVALIDATE = true
+end
diff --git a/benchmark/dir_empty_p.rb b/benchmark/dir_empty_p.rb
new file mode 100644
index 0000000000..8329c757cf
--- /dev/null
+++ b/benchmark/dir_empty_p.rb
@@ -0,0 +1,5 @@
+require 'tmpdir'
+max = 100_000
+Dir.mktmpdir('bm_dir_empty_p') do |dir|
+  max.times { Dir.empty?(dir) }
+end
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
deleted file mode 100644
index defe3c30be..0000000000
--- a/benchmark/driver.rb
+++ /dev/null
@@ -1,400 +0,0 @@
-#
-# Ruby Benchmark driver
-#
-
-first = true
-
-begin
-  require 'optparse'
-rescue LoadError
-  if first
-    first = false
-    $:.unshift File.join(File.dirname(__FILE__), '../lib')
-    retry
-  else
-    raise
-  end
-end
-
-require 'benchmark'
-require 'pp'
-
-class BenchmarkDriver
-  def self.benchmark(opt)
-    driver = self.new(opt[:execs], opt[:dir], opt)
-    begin
-      driver.run
-    ensure
-      driver.show_results
-    end
-  end
-
-  def self.load(input, type, opt)
-    attrs = [:executables, :results]
-    case type
-    when 'yaml'
-      require 'yaml'
-      h = YAML.load(input)
-    when 'json'
-      require 'json'
-      h = JSON.load(input)
-    else
-      h = eval(input.read)
-    end
-    obj = allocate
-    obj.instance_variable_set("@execs", h[:executables] || h["executables"])
-    obj.instance_variable_set("@results", h[:results] || h["results"])
-    obj.instance_variable_set("@opt", opt)
-    obj
-  end
-
-  def output *args
-    puts(*args)
-    @output and @output.puts(*args)
-  end
-
-  def message *args
-    output(*args) if @verbose
-  end
-
-  def message_print *args
-    if @verbose
-      print(*args)
-      STDOUT.flush
-      @output and @output.print(*args)
-    end
-  end
-
-  def progress_message *args
-    unless STDOUT.tty?
-      STDERR.print(*args)
-      STDERR.flush
-    end
-  end
-
-  def initialize execs, dir, opt = {}
-    @execs = execs.map{|e|
-      e.strip!
-      next if e.empty?
-
-      if /(.+)::(.+)/ =~ e
-        # ex) ruby-a::/path/to/ruby-a
-        label = $1.strip
-        path = $2
-        version = `#{path} -v`.chomp
-      else
-        path = e
-        version = label = `#{path} -v`.chomp
-      end
-      [path, label, version]
-    }.compact
-
-    @dir = dir
-    @repeat = opt[:repeat] || 1
-    @repeat = 1 if @repeat < 1
-    @pattern = opt[:pattern] || nil
-    @exclude = opt[:exclude] || nil
-    @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
-    @output = opt[:output] ? open(opt[:output], 'w') : nil
-    @loop_wl1 = @loop_wl2 = nil
-    @ruby_arg = opt[:ruby_arg] || nil
-    @opt = opt
-
-    # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
-    @results = []
-
-    if @verbose
-      @start_time = Time.now
-      message @start_time
-      @execs.each_with_index{|(path, label, version), i|
-        message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\""
-      }
-    end
-  end
-
-  def adjusted_results name, results
-    s = nil
-    results.each_with_index{|e, i|
-      r = e.min
-      case name
-      when /^vm1_/
-        if @loop_wl1
-          r -= @loop_wl1[i]
-          r = 0 if r < 0
-          s = '*'
-        end
-      when /^vm2_/
-        if @loop_wl2
-          r -= @loop_wl2[i]
-          r = 0 if r < 0
-          s = '*'
-        end
-      end
-      yield r
-    }
-    s
-  end
-
-  def show_results
-    case @opt[:format]
-    when :tsv
-      strformat = "\t%1$s"
-      numformat = "\t%1$*2$.3f"
-      minwidth = 0
-      name_width = 0
-    when :markdown
-      markdown = true
-      strformat = "|%1$-*2$s"
-      numformat = "|%1$*2$.3f"
-    when :plain
-      strformat = " %1$-*2$s"
-      numformat = " %1$*2$.3f"
-    end
-
-    name_width ||= @results.map {|v,*| v.size}.max
-    minwidth ||= 7
-    width = @execs.map{|(_, v)| [v.size, minwidth].max}
-
-    output
-
-    if @verbose
-      message '-----------------------------------------------------------'
-      message 'raw data:'
-      message
-      message PP.pp(@results, "", 79)
-      message
-      message "Elapsed time: #{Time.now - @start_time} (sec)"
-    end
-
-    if rawdata_output = @opt[:rawdata_output]
-      h = {}
-      h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo')
-      h[:executables] = @execs
-      h[:results] = @results
-      if (type = File.extname(rawdata_output)).empty?
-        type = rawdata_output
-        rawdata_output = @output.path.sub(/\.[^.\/]+\z/, '') << '.' << rawdata_output
-      end
-      case type
-      when 'yaml'
-        require 'yaml'
-        h = YAML.dump(h)
-      when 'json'
-        require 'json'
-        h = JSON.pretty_generate(h)
-      else
-        require 'pp'
-        h = h.pretty_inspect
-      end
-      open(rawdata_output, 'w') {|f| f.puts h}
-    end
-
-    output '-----------------------------------------------------------'
-    output 'benchmark results:'
-
-    if @verbose and @repeat > 1
-      output "minimum results in each #{@repeat} measurements."
-    end
-
-    output "Execution time (sec)"
-    output if markdown
-    output ["name".ljust(name_width), @execs.map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
-    output ["-"*name_width, width.map{|n|":".rjust(n, "-")}].join("|") if markdown
-    @results.each{|v, result|
-      rets = []
-      s = adjusted_results(v, result){|r|
-        rets << sprintf(numformat, r, width[rets.size])
-      }
-      v += s if s
-      output [v.ljust(name_width), rets].join("")
-    }
-
-    if @execs.size > 1
-      output
-      output "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)"
-      output if markdown
-      output ["name".ljust(name_width), @execs[1..-1].map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
-      output ["-"*name_width, width[1..-1].map{|n|":".rjust(n, "-")}].join("|") if markdown
-      @results.each{|v, result|
-        rets = []
-        first_value = nil
-        s = adjusted_results(v, result){|r|
-          if first_value
-            if r == 0
-              rets << "Error"
-            else
-              rets << sprintf(numformat, first_value/r, width[rets.size+1])
-            end
-          else
-            first_value = r
-          end
-        }
-        v += s if s
-        output [v.ljust(name_width), rets].join("")
-      }
-    end
-
-    if @opt[:output]
-      output
-      output "Log file: #{@opt[:output]}"
-    end
-  end
-
-  def files
-    flag = {}
-    @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
-      next if @pattern && /#{@pattern}/ !~ File.basename(file)
-      next if @exclude && /#{@exclude}/ =~ File.basename(file)
-      case file
-      when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
-        flag[$1] = true
-      end
-      file
-    }.compact
-
-    if flag['vm1'] && !flag['whileloop']
-      @files << File.join(@dir, 'bm_loop_whileloop.rb')
-    elsif flag['vm2'] && !flag['whileloop2']
-      @files << File.join(@dir, 'bm_loop_whileloop2.rb')
-    end
-
-    @files.sort!
-    progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
-    @files
-  end
-
-  def run
-    files.each_with_index{|file, i|
-      @i = i
-      r = measure_file(file)
-
-      if /bm_loop_whileloop.rb/ =~ file
-        @loop_wl1 = r[1].map{|e| e.min}
-      elsif /bm_loop_whileloop2.rb/ =~ file
-        @loop_wl2 = r[1].map{|e| e.min}
-      end
-    }
-  end
-
-  def measure_file file
-    name = File.basename(file, '.rb').sub(/^bm_/, '')
-    prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
-    load prepare_file if FileTest.exist?(prepare_file)
-
-    if @verbose
-      output
-      output '-----------------------------------------------------------'
-      output name
-      output
-      output File.read(file)
-      output
-    end
-
-    result = [name]
-    result << @execs.map{|(e, v)|
-      (0...@repeat).map{
-        message_print "#{v}\t"
-        progress_message '.'
-
-        m = measure(e, file)
-        message "#{m}"
-        m
-      }
-    }
-    @results << result
-    result
-  end
-
-  unless defined?(File::NULL)
-    if File.exist?('/dev/null')
-      File::NULL = '/dev/null'
-    end
-  end
-
-  def measure executable, file
-    cmd = "#{executable} #{@ruby_arg} #{file}"
-
-    m = Benchmark.measure{
-      system(cmd, out: File::NULL)
-    }
-
-    if $? != 0
-      output "\`#{cmd}\' exited with abnormal status (#{$?})"
-      0
-    else
-      m.real
-    end
-  end
-end
-
-if __FILE__ == $0
-  opt = {
-    :execs => [],
-    :dir => File.dirname(__FILE__),
-    :repeat => 1,
-    :output => nil,
-    :raw_output => nil,
-    :format => :tsv,
-  }
-  formats = {
-    :tsv => ".tsv",
-    :markdown => ".md",
-    :plain => ".txt",
-  }
-
-  parser = OptionParser.new{|o|
-    o.on('-e', '--executables [EXECS]',
-      "Specify benchmark one or more targets (e1::path1; e2::path2; e3::path3;...)"){|e|
-       e.split(/;/).each{|path|
-         opt[:execs] << path
-       }
-    }
-    o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
-      opt[:dir] = d
-    }
-    o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
-      opt[:pattern] = p
-    }
-    o.on('-x', '--exclude [PATTERN]', "Benchmark exclude pattern"){|e|
-      opt[:exclude] = e
-    }
-    o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
-      opt[:repeat] = n.to_i
-    }
-    o.on('-o', '--output-file [FILE]', "Output file"){|f|
-      opt[:output] = f
-    }
-    o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a|
-      opt[:ruby_arg] = a
-    }
-    o.on('--rawdata-output [FILE]', 'output rawdata'){|r|
-      opt[:rawdata_output] = r
-    }
-    o.on('--load-rawdata=FILE', 'input rawdata'){|r|
-      opt[:rawdata_input] = r
-    }
-    o.on('-f', "--format=FORMAT", "output format (#{formats.keys.join(",")})", formats.keys){|r|
-      opt[:format] = r
-    }
-    o.on('-v', '--verbose'){|v|
-      opt[:verbose] = v
-    }
-    o.on('-q', '--quiet', "Run without notify information except result table."){|q|
-      opt[:quiet] = q
-      opt[:verbose] = false
-    }
-  }
-
-  parser.parse!(ARGV)
-  opt[:output] ||= "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}#{formats[opt[:format]]}"
-
-  if input = opt[:rawdata_input]
-    b = open(input) {|f|
-      BenchmarkDriver.load(f, File.extname(input)[1..-1], opt)
-    }
-    b.show_results
-  else
-    BenchmarkDriver.benchmark(opt)
-  end
-end
-
diff --git a/benchmark/enum_lazy_flat_map.yml b/benchmark/enum_lazy_flat_map.yml
new file mode 100644
index 0000000000..0ee390a441
--- /dev/null
+++ b/benchmark/enum_lazy_flat_map.yml
@@ -0,0 +1,16 @@
+prelude: |
+  num = (1..).lazy.take(100)
+  ary2 = [[1,2]].cycle.lazy.take(10)
+  ary10 = [[*1..10]].cycle.lazy.take(10)
+  ary20 = [[*1..20]].cycle.lazy.take(10)
+  ary50 = [[*1..50]].cycle.lazy.take(10)
+  ary100 = [[*1..100]].cycle.lazy.take(10)
+
+benchmark:
+  num3: num.flat_map {|x| x}.take(3).to_a
+  num10: num.flat_map {|x| x}.take(3).to_a
+  ary2:  ary2.flat_map {|x| x}.take(3).to_a
+  ary10: ary10.flat_map {|x| x}.take(3).to_a
+  ary20: ary20.flat_map {|x| x}.take(3).to_a
+  ary50: ary50.flat_map {|x| x}.take(3).to_a
+  ary100: ary100.flat_map {|x| x}.take(3).to_a
diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb
new file mode 100644
index 0000000000..8832392e65
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_100.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb
new file mode 100644
index 0000000000..329509fa8f
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_20.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb
new file mode 100644
index 0000000000..02ea4d4e71
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_50.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb
new file mode 100644
index 0000000000..2e6434d9c4
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_100.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb
new file mode 100644
index 0000000000..75e6398fee
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_20.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb
new file mode 100644
index 0000000000..59a39b78ff
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_50.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_zip.yml b/benchmark/enum_lazy_zip.yml
new file mode 100644
index 0000000000..4566ff0261
--- /dev/null
+++ b/benchmark/enum_lazy_zip.yml
@@ -0,0 +1,22 @@
+prelude: |
+  a = (1..3).lazy
+  b = a.map {|x| x}
+
+benchmark:
+  first_ary: a.zip(["a", "b", "c"]).first
+  first_nonary: a.zip("a".."c").first
+  first_noarg: a.zip.first
+
+  take3_ary: a.zip(["a", "b", "c"]).take(3).force
+  take3_nonary: a.zip("a".."c").take(3).force
+  take3_noarg: a.zip.take(3).force
+
+  chain-first_ary: b.zip(["a", "b", "c"]).first
+  chain-first_nonary: b.zip("a".."c").first
+  chain-first_noarg: b.zip.first
+
+  chain-take3_ary: b.zip(["a", "b", "c"]).take(3).force
+  chain-take3_nonary: b.zip("a".."c").take(3).force
+  chain-take3_noarg: b.zip.take(3).force
+
+  block: a.zip("a".."c") {|x, y| [x, y]}
diff --git a/benchmark/enum_minmax.yml b/benchmark/enum_minmax.yml
new file mode 100644
index 0000000000..9d01731abb
--- /dev/null
+++ b/benchmark/enum_minmax.yml
@@ -0,0 +1,25 @@
+prelude: |
+  set2 = 2.times.to_a.shuffle.to_set
+  set10 = 10.times.to_a.shuffle.to_set
+  set100 = 100.times.to_a.shuffle.to_set
+  set1000 = 1000.times.to_a.shuffle.to_set
+  set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+  set2.min: set2.min
+  set10.min: set10.min
+  set100.min: set100.min
+  set1000.min: set1000.min
+  set10000.min: set10000.min
+  set2.max: set2.max
+  set10.max: set10.max
+  set100.max: set100.max
+  set1000.max: set1000.max
+  set10000.max: set10000.max
+  set2.minmax: set2.minmax
+  set10.minmax: set10.minmax
+  set100.minmax: set100.minmax
+  set1000.minmax: set1000.minmax
+  set10000.minmax: set10000.minmax
+
+loop_count: 10000
diff --git a/benchmark/enum_sort.yml b/benchmark/enum_sort.yml
new file mode 100644
index 0000000000..6f26e748c6
--- /dev/null
+++ b/benchmark/enum_sort.yml
@@ -0,0 +1,15 @@
+prelude: |
+  set2 = 2.times.to_a.shuffle.to_set
+  set10 = 10.times.to_a.shuffle.to_set
+  set100 = 100.times.to_a.shuffle.to_set
+  set1000 = 1000.times.to_a.shuffle.to_set
+  set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+  set2.sort_by: set2.sort_by { 0 }
+  set10.sort_by: set10.sort_by { 0 }
+  set100.sort_by: set100.sort_by { 0 }
+  set1000.sort_by: set1000.sort_by { 0 }
+  set10000.sort_by: set10000.sort_by { 0 }
+
+loop_count: 10000
diff --git a/benchmark/enum_sort_by.yml b/benchmark/enum_sort_by.yml
new file mode 100644
index 0000000000..d386353888
--- /dev/null
+++ b/benchmark/enum_sort_by.yml
@@ -0,0 +1,53 @@
+prelude: |
+  array_length = 2
+  fixnum_array2 = array_length.times.to_a.map {rand(10000)}
+  float_array2 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array2 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array2 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array2 =array_length.times.to_a.map {0}
+
+  array_length = 10
+  fixnum_array10 = array_length.times.to_a.map {rand(10000)}
+  float_array10 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array10 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array10 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array10 =array_length.times.to_a.map {0}
+
+  array_length = 1000
+  fixnum_array1000 = array_length.times.to_a.map {rand(10000)}
+  float_array1000 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array1000 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array1000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array1000 =array_length.times.to_a.map {0}
+
+  array_length = 100000
+  fixnum_array100000 = array_length.times.to_a.map {rand(10000)}
+  float_array100000 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array100000 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array100000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array100000 =array_length.times.to_a.map {0}
+
+benchmark:
+  fixnum_array2.sort_by: fixnum_array2.sort_by {|a| a}
+  float_array2.sort_by:  float_array2.sort_by {|a| a}
+  string_length2.sort_by: string_array2.sort_by {|a| a.length}
+  mix_array2.sort_by:  mix_array2.sort_by {|a| a}
+  all_zero2.sort_by: all_zero_array2.sort_by{|a| a}
+
+  fixnum_array10.sort_by: fixnum_array10.sort_by {|a| a}
+  float_array10.sort_by:  float_array10.sort_by {|a| a}
+  string_length10.sort_by: string_array10.sort_by {|a| a.length}
+  mix_array10.sort_by:  mix_array10.sort_by {|a| a}
+  all_zero10.sort_by: all_zero_array10.sort_by{|a| a}
+
+  fixnum_array1000.sort_by: fixnum_array1000.sort_by {|a| a}
+  float_array1000.sort_by:  float_array1000.sort_by {|a| a}
+  string_length1000.sort_by: string_array1000.sort_by {|a| a.length}
+  mix_array1000.sort_by:  mix_array1000.sort_by {|a| a}
+  all_zero1000.sort_by: all_zero_array1000.sort_by{|a| a}
+
+  fixnum_array100000.sort_by: fixnum_array100000.sort_by {|a| a}
+  float_array100000.sort_by:  float_array100000.sort_by {|a| a}
+  string_length100000.sort_by: string_array100000.sort_by {|a| a.length}
+  mix_array100000.sort_by:  mix_array100000.sort_by {|a| a}
+  all_zero100000.sort_by: all_zero_array100000.sort_by{|a| a}
diff --git a/benchmark/enum_tally.yml b/benchmark/enum_tally.yml
new file mode 100644
index 0000000000..edd2e040a0
--- /dev/null
+++ b/benchmark/enum_tally.yml
@@ -0,0 +1,4 @@
+prelude: |
+  list = ("aaa".."zzz").to_a*10
+benchmark:
+  tally: list.tally
diff --git a/benchmark/erb_escape_html.yml b/benchmark/erb_escape_html.yml
new file mode 100644
index 0000000000..ca28d756e7
--- /dev/null
+++ b/benchmark/erb_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'erb'
+benchmark:
+  - script: ERB::Util.html_escape("")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("abcde")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("abcd<")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("'&\"<>")
+    loop_count: 5000000
+  - prelude: long_no_escape = "abcde" * 300
+    script: ERB::Util.html_escape(long_no_escape)
+    loop_count: 1000000
+  - prelude: long_all_escape = "'&\"<>" * 10
+    script: ERB::Util.html_escape(long_all_escape)
+    loop_count: 1000000
+  - prelude: | # http://example.com/
+      example_html = <<~HTML
+        <body>
+        <div>
+            <h1>Example Domain</h1>
+            <p>This domain is established to be used for illustrative examples in documents. You may use this
+            domain in examples without prior coordination or asking for permission.</p>
+            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+        </div>
+        </body>
+      HTML
+    script: ERB::Util.html_escape(example_html)
+    loop_count: 1000000
diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml
new file mode 100644
index 0000000000..15f6c3880b
--- /dev/null
+++ b/benchmark/erb_render.yml
@@ -0,0 +1,24 @@
+prelude: |
+  require 'erb'
+
+  data = <<erb
+  <html>
+    <head> <%= title %> </head>
+    <body>
+      <h1> <%= title %> </h1>
+      <p>
+        <%= content %>
+      </p>
+    </body>
+  </html>
+  erb
+
+  title = "hello world!"
+  content = "hello world!\n" * 10
+
+  src = "def self.render(title, content); #{ERB.new(data).src}; end"
+  mod = Module.new
+  mod.instance_eval(src, "(ERB)")
+benchmark:
+  erb_render: mod.render(title, content)
+loop_count: 1500000
diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml
new file mode 100644
index 0000000000..a36c759f8e
--- /dev/null
+++ b/benchmark/fiber_chain.yml
@@ -0,0 +1,36 @@
+prelude: |
+  def make_link(previous)
+    Fiber.new do
+      while message = previous.resume
+        Fiber.yield(message)
+      end
+    end
+  end
+
+  def make_chain(length = 1000, &block)
+    chain = Fiber.new(&block)
+
+    (length - 1).times do
+      chain = make_link(chain)
+    end
+
+    return chain
+  end
+
+  message = "Hello World!"
+
+  chain = make_chain do
+    while true
+      Fiber.yield(message)
+    end
+  end
+benchmark:
+  make_chain: |
+    make_chain(100) do
+      while true
+        Fiber.yield(message)
+      end
+    end
+  resume_chain: |
+    chain.resume
+loop_count: 5000
diff --git a/benchmark/fiber_locals.yml b/benchmark/fiber_locals.yml
new file mode 100644
index 0000000000..8588686477
--- /dev/null
+++ b/benchmark/fiber_locals.yml
@@ -0,0 +1,8 @@
+prelude: |
+  th = Thread.current
+  th[:key] = :val
+benchmark:
+  key?: th.key?(:key)
+  []: th[:key]
+  keys: th.keys
+loop_count: 1_000_000
diff --git a/benchmark/file_chmod.rb b/benchmark/file_chmod.rb
new file mode 100644
index 0000000000..1cd4760c9d
--- /dev/null
+++ b/benchmark/file_chmod.rb
@@ -0,0 +1,9 @@
+# chmod file
+require 'tempfile'
+max = 200_000
+tmp = Tempfile.new('chmod')
+path = tmp.path
+max.times do
+  File.chmod(0777, path)
+end
+tmp.close!
diff --git a/benchmark/file_join.yml b/benchmark/file_join.yml
new file mode 100644
index 0000000000..845257cf1e
--- /dev/null
+++ b/benchmark/file_join.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  two_strings: File.join(__FILE__, "path")
+  many_strings: File.join(__FILE__, "path", "a", "b", "c", "d")
+  array: File.join([__FILE__, "path", "a", "b", "c", "d"])
+  mixed: File.join(__FILE__, "path", "a", "b", ["c", "d"])
diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb
new file mode 100644
index 0000000000..bbb44aebac
--- /dev/null
+++ b/benchmark/file_rename.rb
@@ -0,0 +1,11 @@
+# rename file
+require 'tempfile'
+
+max = 100_000
+tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
+a, b = tmp.map { |x| x.path }
+tmp.each { |t| t.close } # Windows can't rename files without closing them
+max.times do
+  File.rename(a, b)
+  File.rename(b, a)
+end
diff --git a/benchmark/float_methods.yml b/benchmark/float_methods.yml
new file mode 100644
index 0000000000..56ea41effc
--- /dev/null
+++ b/benchmark/float_methods.yml
@@ -0,0 +1,14 @@
+prelude: |
+  flo = 4.2
+benchmark:
+  to_f: |
+    flo.to_f
+  abs: |
+    flo.abs
+  magnitude: |
+    flo.magnitude
+  -@: |
+    -flo
+  zero?: |
+    flo.zero?
+loop_count: 20000000
diff --git a/benchmark/float_neg_posi.yml b/benchmark/float_neg_posi.yml
new file mode 100644
index 0000000000..172db1bf6d
--- /dev/null
+++ b/benchmark/float_neg_posi.yml
@@ -0,0 +1,8 @@
+prelude: |
+  flo = 4.2
+benchmark:
+  negative?: |
+    flo.negative?
+  positive?: |
+    flo.positive?
+loop_count: 20000000
diff --git a/benchmark/float_to_s.yml b/benchmark/float_to_s.yml
new file mode 100644
index 0000000000..0abae5cdb8
--- /dev/null
+++ b/benchmark/float_to_s.yml
@@ -0,0 +1,7 @@
+prelude: |
+  floats = [*0.0.step(1.0, 0.0001)]
+
+benchmark:
+  to_s: floats.each {|f| f.to_s}
+
+loop_count: 1000
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
index 2eed7abc83..275f58b924 100644
--- a/benchmark/gc/aobench.rb
+++ b/benchmark/gc/aobench.rb
@@ -1 +1 @@
-require_relative '../bm_app_aobench.rb'
+require_relative '../app_aobench'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
index af8ea722aa..83347cdd20 100644
--- a/benchmark/gc/binary_trees.rb
+++ b/benchmark/gc/binary_trees.rb
@@ -1 +1 @@
-require_relative '../bm_so_binary_trees.rb'
+require_relative '../so_binary_trees'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
index 09a404466a..23d0b91c6c 100644
--- a/benchmark/gc/gcbench.rb
+++ b/benchmark/gc/gcbench.rb
@@ -3,11 +3,12 @@ require 'pp'
 require 'optparse'
 
 $list = true
-$gcprof = true
+$gcprof = false
 
 opt = OptionParser.new
 opt.on('-q'){$list = false}
 opt.on('-d'){$gcprof = false}
+opt.on('-p'){$gcprof = true}
 opt.parse!(ARGV)
 
 script = File.join(File.dirname(__FILE__), ARGV.shift)
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
index 94ba74be89..8ebdff7d1d 100644
--- a/benchmark/gc/pentomino.rb
+++ b/benchmark/gc/pentomino.rb
@@ -1 +1 @@
-require_relative '../bm_app_pentomino.rb'
+require_relative '../app_pentomino'
diff --git a/benchmark/hash_aref_array.rb b/benchmark/hash_aref_array.rb
new file mode 100644
index 0000000000..ac7a683d95
--- /dev/null
+++ b/benchmark/hash_aref_array.rb
@@ -0,0 +1,5 @@
+h = {}
+arrays = (0..99).each_slice(10).to_a
+#STDERR.puts arrays.inspect
+arrays.each { |s| h[s] = s }
+200_000.times { arrays.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym.rb b/benchmark/hash_aref_dsym.rb
new file mode 100644
index 0000000000..af4f8c36d4
--- /dev/null
+++ b/benchmark/hash_aref_dsym.rb
@@ -0,0 +1,4 @@
+h = {}
+syms = ('a'..'z').map { |s| s.to_sym }
+syms.each { |s| h[s] = 1 }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym_long.rb b/benchmark/hash_aref_dsym_long.rb
new file mode 100644
index 0000000000..9d7759379e
--- /dev/null
+++ b/benchmark/hash_aref_dsym_long.rb
@@ -0,0 +1,21 @@
+# [ruby-core:70129] [Bug #11396]
+collection_size = 200000
+sample_size = 10000
+
+values = (1..collection_size).to_a.map do |x|
+  "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
+end
+
+symbol_hash = {}
+
+values.each do |x|
+  symbol_hash[x.to_sym] = 1
+end
+
+# use the same samples each time to minimize deviations
+rng = Random.new(0)
+symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
+
+3000.times do
+  symbol_sample_array.each { |x| symbol_hash[x] }
+end
diff --git a/benchmark/hash_aref_fix.rb b/benchmark/hash_aref_fix.rb
new file mode 100644
index 0000000000..1346890582
--- /dev/null
+++ b/benchmark/hash_aref_fix.rb
@@ -0,0 +1,4 @@
+h = {}
+nums = (1..26).to_a
+nums.each { |i| h[i] = i }
+200_000.times { nums.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_flo.rb b/benchmark/hash_aref_flo.rb
index 2217274c82..2217274c82 100644
--- a/benchmark/bm_hash_aref_flo.rb
+++ b/benchmark/hash_aref_flo.rb
diff --git a/benchmark/bm_hash_aref_miss.rb b/benchmark/hash_aref_miss.rb
index b0913dd4bb..b0913dd4bb 100644
--- a/benchmark/bm_hash_aref_miss.rb
+++ b/benchmark/hash_aref_miss.rb
diff --git a/benchmark/bm_hash_aref_str.rb b/benchmark/hash_aref_str.rb
index 19439b061b..19439b061b 100644
--- a/benchmark/bm_hash_aref_str.rb
+++ b/benchmark/hash_aref_str.rb
diff --git a/benchmark/hash_aref_str_lit.yml b/benchmark/hash_aref_str_lit.yml
new file mode 100644
index 0000000000..ed8142bcf1
--- /dev/null
+++ b/benchmark/hash_aref_str_lit.yml
@@ -0,0 +1,20 @@
+prelude: |
+  # frozen_string_literal: true
+  hash = 10.times.to_h do |i|
+    [i, i]
+  end
+  dyn_sym = "dynamic_symbol".to_sym
+  binary = RubyVM::InstructionSequence.compile("# frozen_string_literal: true\n'iseq_load'").to_binary
+  iseq_literal_string = RubyVM::InstructionSequence.load_from_binary(binary).eval
+
+  hash[:some_symbol] = 1
+  hash[dyn_sym] = 2
+  hash["small"] = 3
+  hash["frozen_string_literal"] = 4
+  hash[iseq_literal_string] = 5
+benchmark:
+  symbol: hash[:some_symbol]
+  dyn_symbol: hash[dyn_sym]
+  small_lit: hash["small"]
+  frozen_lit: hash["frozen_string_literal"]
+  iseq_lit: hash[iseq_literal_string]
diff --git a/benchmark/bm_hash_aref_sym.rb b/benchmark/hash_aref_sym.rb
index f75d163fe6..f75d163fe6 100644
--- a/benchmark/bm_hash_aref_sym.rb
+++ b/benchmark/hash_aref_sym.rb
diff --git a/benchmark/bm_hash_aref_sym_long.rb b/benchmark/hash_aref_sym_long.rb
index 9dab8df7be..9dab8df7be 100644
--- a/benchmark/bm_hash_aref_sym_long.rb
+++ b/benchmark/hash_aref_sym_long.rb
diff --git a/benchmark/hash_defaults.yml b/benchmark/hash_defaults.yml
new file mode 100644
index 0000000000..833f10e1c7
--- /dev/null
+++ b/benchmark/hash_defaults.yml
@@ -0,0 +1,6 @@
+prelude: |
+  h = Hash.new { :foo }
+benchmark:
+  default_aref: h[1]
+  default_method: h.default(1)
+loop_count: 1000000
diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml
new file mode 100644
index 0000000000..65f521ec94
--- /dev/null
+++ b/benchmark/hash_dup.yml
@@ -0,0 +1,8 @@
+prelude: |
+  small_hash = { a: 1 }
+  larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h
+
+benchmark:
+  dup_small: small_hash.dup
+  dup_larger: larger_hash.dup
+loop_count: 10000
diff --git a/benchmark/hash_first.yml b/benchmark/hash_first.yml
new file mode 100644
index 0000000000..c26df1a7ed
--- /dev/null
+++ b/benchmark/hash_first.yml
@@ -0,0 +1,11 @@
+prelude: |
+  hash1 = 1_000_000.times.to_h { [rand, true]}
+  hash2 = hash1.dup
+  hash2.keys[1..100_000].each { hash2.delete _1 }
+  hash2.delete hash2.first[0]
+
+benchmark:
+  hash1: hash1.first
+  hash2: hash2.first
+
+loop_count: 100_000
diff --git a/benchmark/bm_hash_flatten.rb b/benchmark/hash_flatten.rb
index e944aae9f2..e944aae9f2 100644
--- a/benchmark/bm_hash_flatten.rb
+++ b/benchmark/hash_flatten.rb
diff --git a/benchmark/bm_hash_ident_flo.rb b/benchmark/hash_ident_flo.rb
index 0c7edfed3e..0c7edfed3e 100644
--- a/benchmark/bm_hash_ident_flo.rb
+++ b/benchmark/hash_ident_flo.rb
diff --git a/benchmark/bm_hash_ident_num.rb b/benchmark/hash_ident_num.rb
index b226736c6f..b226736c6f 100644
--- a/benchmark/bm_hash_ident_num.rb
+++ b/benchmark/hash_ident_num.rb
diff --git a/benchmark/bm_hash_ident_obj.rb b/benchmark/hash_ident_obj.rb
index 4b3b58edec..4b3b58edec 100644
--- a/benchmark/bm_hash_ident_obj.rb
+++ b/benchmark/hash_ident_obj.rb
diff --git a/benchmark/bm_hash_ident_str.rb b/benchmark/hash_ident_str.rb
index 8582b38e31..8582b38e31 100644
--- a/benchmark/bm_hash_ident_str.rb
+++ b/benchmark/hash_ident_str.rb
diff --git a/benchmark/bm_hash_ident_sym.rb b/benchmark/hash_ident_sym.rb
index 4c81e3d28e..4c81e3d28e 100644
--- a/benchmark/bm_hash_ident_sym.rb
+++ b/benchmark/hash_ident_sym.rb
diff --git a/benchmark/hash_key.yml b/benchmark/hash_key.yml
new file mode 100644
index 0000000000..cab4cf9ca4
--- /dev/null
+++ b/benchmark/hash_key.yml
@@ -0,0 +1,5 @@
+prelude: |
+  obj = Object.new
+  hash = { obj => true }
+benchmark: hash.key?(obj)
+loop_count: 30000000
diff --git a/benchmark/bm_hash_keys.rb b/benchmark/hash_keys.rb
index 6863cd01f9..6863cd01f9 100644
--- a/benchmark/bm_hash_keys.rb
+++ b/benchmark/hash_keys.rb
diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb
new file mode 100644
index 0000000000..c188529260
--- /dev/null
+++ b/benchmark/hash_literal_small2.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz" }  }
diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb
new file mode 100644
index 0000000000..739f71b5b0
--- /dev/null
+++ b/benchmark/hash_literal_small4.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } }
diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb
new file mode 100644
index 0000000000..53d80af535
--- /dev/null
+++ b/benchmark/hash_literal_small8.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } }
diff --git a/benchmark/hash_long.rb b/benchmark/hash_long.rb
new file mode 100644
index 0000000000..03d9109602
--- /dev/null
+++ b/benchmark/hash_long.rb
@@ -0,0 +1,4 @@
+k1 = "Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong";
+k2 = "Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping";
+h = {k1 => 0, k2 => 0};
+3000000.times{|i| k = i % 2 ? k2 : k1; h [k] = h[k] + 1}
diff --git a/benchmark/hash_new.yml b/benchmark/hash_new.yml
new file mode 100644
index 0000000000..9d8e34187f
--- /dev/null
+++ b/benchmark/hash_new.yml
@@ -0,0 +1,16 @@
+prelude: |
+  has_hash_with_capa = Hash.instance_method(:initialize).parameters.include?([:key, :capacity])
+  strings_1k = 1_000.times.map { |i| -i.to_s.freeze }
+  strings_100k = 100_000.times.map { |i| -i.to_s.freeze }
+benchmark:
+  new: Hash.new
+  new_with_capa_1k: |
+    h = has_hash_with_capa ? Hash.new(capacity: strings_1k.size) : {}
+    strings_1k.each do |x|
+      h[x] = true
+    end
+  new_with_capa_100k: |
+    h = has_hash_with_capa ? Hash.new(capacity: strings_100k.size) : {}
+    strings_100k.each do |x|
+      h[x] = true
+    end
diff --git a/benchmark/bm_hash_shift.rb b/benchmark/hash_shift.rb
index a645671a5b..a645671a5b 100644
--- a/benchmark/bm_hash_shift.rb
+++ b/benchmark/hash_shift.rb
diff --git a/benchmark/hash_shift_u16.rb b/benchmark/hash_shift_u16.rb
new file mode 100644
index 0000000000..ec800d0342
--- /dev/null
+++ b/benchmark/hash_shift_u16.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(16384..65536).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_shift_u24.rb b/benchmark/hash_shift_u24.rb
new file mode 100644
index 0000000000..de4e0fa696
--- /dev/null
+++ b/benchmark/hash_shift_u24.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xff4000..0xffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_shift_u32.rb b/benchmark/hash_shift_u32.rb
new file mode 100644
index 0000000000..656aa55583
--- /dev/null
+++ b/benchmark/hash_shift_u32.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xffff4000..0xffffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_small2.rb b/benchmark/hash_small2.rb
new file mode 100644
index 0000000000..45485d9c71
--- /dev/null
+++ b/benchmark/hash_small2.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 2.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small4.rb b/benchmark/hash_small4.rb
new file mode 100644
index 0000000000..acd4084334
--- /dev/null
+++ b/benchmark/hash_small4.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 4.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small8.rb b/benchmark/hash_small8.rb
new file mode 100644
index 0000000000..9cffcc91b6
--- /dev/null
+++ b/benchmark/hash_small8.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 8.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_to_proc.rb b/benchmark/hash_to_proc.rb
new file mode 100644
index 0000000000..2b675bf509
--- /dev/null
+++ b/benchmark/hash_to_proc.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do |i|
+  [i].map(&h)
+end
diff --git a/benchmark/bm_hash_values.rb b/benchmark/hash_values.rb
index 069441302f..069441302f 100644
--- a/benchmark/bm_hash_values.rb
+++ b/benchmark/hash_values.rb
diff --git a/benchmark/int_quo.rb b/benchmark/int_quo.rb
new file mode 100644
index 0000000000..e22a3f8c30
--- /dev/null
+++ b/benchmark/int_quo.rb
@@ -0,0 +1 @@
+5000000.times { 42.quo(3) }
diff --git a/benchmark/io_close.yml b/benchmark/io_close.yml
new file mode 100644
index 0000000000..a552872884
--- /dev/null
+++ b/benchmark/io_close.yml
@@ -0,0 +1,13 @@
+prelude: |
+  ios = 1000.times.map do
+    100.times.map{IO.pipe}
+  end
+benchmark:
+  # Close IO
+  io_close: |
+    # Process each batch of ios per iteration of the benchmark.
+    ios.pop.each do |r, w|
+      r.close
+      w.close
+    end
+loop_count: 100
diff --git a/benchmark/io_close_contended.yml b/benchmark/io_close_contended.yml
new file mode 100644
index 0000000000..1d9e4e0d0f
--- /dev/null
+++ b/benchmark/io_close_contended.yml
@@ -0,0 +1,21 @@
+prelude: |
+  ios = 100.times.map do
+    10.times.map do
+      pipe = IO.pipe.tap do |r, w|
+        Thread.new do
+          r.read
+        rescue IOError
+          # Ignore
+        end
+      end
+    end
+  end
+benchmark:
+  # Close IO
+  io_close_contended: |
+    # Process each batch of ios per iteration of the benchmark.
+    ios.pop.each do |r, w|
+      r.close
+      w.close
+    end
+loop_count: 10
diff --git a/benchmark/io_copy_stream_write.rb b/benchmark/io_copy_stream_write.rb
new file mode 100644
index 0000000000..3fd87250a4
--- /dev/null
+++ b/benchmark/io_copy_stream_write.rb
@@ -0,0 +1,24 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+
+class Zero
+  def initialize
+    @n = 100000
+    @in = File.open('/dev/zero', 'rb')
+  end
+
+  def read(len, buf)
+    return if (@n -= 1) == 0
+    @in.read(len, buf)
+  end
+end
+
+begin
+  src = Zero.new
+  dst = File.open(IO::NULL, 'wb')
+  n = IO.copy_stream(src, dst)
+rescue Errno::ENOENT
+  # not *nix
+end if IO.respond_to?(:copy_stream) && IO.const_defined?(:NULL)
diff --git a/benchmark/io_copy_stream_write_socket.rb b/benchmark/io_copy_stream_write_socket.rb
new file mode 100644
index 0000000000..11f369bd0d
--- /dev/null
+++ b/benchmark/io_copy_stream_write_socket.rb
@@ -0,0 +1,35 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+class Zero
+  def initialize
+    @n = 100000
+    @in = File.open('/dev/zero', 'rb')
+  end
+
+  def read(len, buf)
+    return if (@n -= 1) == 0
+    @in.read(len, buf)
+  end
+end
+
+begin
+  require 'socket'
+  src = Zero.new
+  rd, wr = UNIXSocket.pair
+  pid = fork do
+    wr.close
+    buf = String.new
+    while rd.read(16384, buf)
+    end
+  end
+  rd.close
+  IO.copy_stream(src, wr)
+rescue Errno::ENOENT, NotImplementedError, NameError
+  # not *nix: missing /dev/zero, fork, or UNIXSocket
+rescue LoadError # no socket?
+ensure
+  wr.close if wr
+  Process.waitpid(pid) if pid
+end if IO.respond_to?(:copy_stream)
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/io_file_create.rb
index 2f205c1333..2f205c1333 100644
--- a/benchmark/bm_io_file_create.rb
+++ b/benchmark/io_file_create.rb
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/io_file_read.rb
index b9e796ed30..b9e796ed30 100644
--- a/benchmark/bm_io_file_read.rb
+++ b/benchmark/io_file_read.rb
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/io_file_write.rb
index aa1be0e5fe..aa1be0e5fe 100644
--- a/benchmark/bm_io_file_write.rb
+++ b/benchmark/io_file_write.rb
diff --git a/benchmark/io_nonblock_noex.rb b/benchmark/io_nonblock_noex.rb
new file mode 100644
index 0000000000..da9357fdc6
--- /dev/null
+++ b/benchmark/io_nonblock_noex.rb
@@ -0,0 +1,22 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+noex = { exception: false }
+begin
+  r, w = IO.pipe
+  while i < nr
+    i += 1
+    w.write_nonblock(msg, noex)
+    r.read_nonblock(1, buf, noex)
+  end
+rescue ArgumentError # old Rubies
+  while i < nr
+    i += 1
+    w.write_nonblock(msg)
+    r.read_nonblock(1, buf)
+  end
+ensure
+  r.close
+  w.close
+end
diff --git a/benchmark/io_nonblock_noex2.rb b/benchmark/io_nonblock_noex2.rb
new file mode 100644
index 0000000000..56819d049b
--- /dev/null
+++ b/benchmark/io_nonblock_noex2.rb
@@ -0,0 +1,21 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+begin
+  r, w = IO.pipe
+  while i < nr
+    i += 1
+    w.write_nonblock(msg, exception: false)
+    r.read_nonblock(1, buf, exception: false)
+  end
+rescue ArgumentError # old Rubies
+  while i < nr
+    i += 1
+    w.write_nonblock(msg)
+    r.read_nonblock(1, buf)
+  end
+ensure
+  r.close
+  w.close
+end
diff --git a/benchmark/io_pipe_rw.rb b/benchmark/io_pipe_rw.rb
new file mode 100644
index 0000000000..6862a8ae61
--- /dev/null
+++ b/benchmark/io_pipe_rw.rb
@@ -0,0 +1,13 @@
+# Measure uncontended GVL performance via read/write with 1:1 threading
+# If we switch to M:N threading, this will benchmark something else...
+r, w = IO.pipe
+src = '0'.freeze
+dst = String.new
+i = 0
+while i < 1_000_000
+  i += 1
+  w.write(src)
+  r.read(1, dst)
+end
+w.close
+r.close
diff --git a/benchmark/bm_io_select.rb b/benchmark/io_select.rb
index 19248daeb1..19248daeb1 100644
--- a/benchmark/bm_io_select.rb
+++ b/benchmark/io_select.rb
diff --git a/benchmark/bm_io_select2.rb b/benchmark/io_select2.rb
index 10e37d71b2..10e37d71b2 100644
--- a/benchmark/bm_io_select2.rb
+++ b/benchmark/io_select2.rb
diff --git a/benchmark/bm_io_select3.rb b/benchmark/io_select3.rb
index 7d0ba1f092..7d0ba1f092 100644
--- a/benchmark/bm_io_select3.rb
+++ b/benchmark/io_select3.rb
diff --git a/benchmark/io_write.rb b/benchmark/io_write.rb
new file mode 100644
index 0000000000..cdb409948b
--- /dev/null
+++ b/benchmark/io_write.rb
@@ -0,0 +1,22 @@
+#!/usr/bin/env ruby
+
+require 'benchmark'
+
+i, o = IO.pipe
+o.sync = true
+
+DOT = ".".freeze
+
+chunks = 100_000.times.collect{DOT}
+
+thread = Thread.new do
+  while i.read(1024)
+  end
+end
+
+100.times do
+  o.write(*chunks)
+end
+
+o.close
+thread.join
diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml
new file mode 100644
index 0000000000..ebdc8d7e8b
--- /dev/null
+++ b/benchmark/irb_color.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'irb/color'
+  code = <<~'CODE'
+    def self.foo # bar
+      :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}"
+    end
+  CODE
+benchmark:
+  irb_color_complete: |
+    IRB::Color.colorize_code(code, complete: true)
+  irb_color_incomplete: |
+    IRB::Color.colorize_code(code, complete: false)
+loop_count: 2000000
diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml
new file mode 100644
index 0000000000..28933f8b38
--- /dev/null
+++ b/benchmark/irb_exec.yml
@@ -0,0 +1,10 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'rbconfig'
+  irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f']
+benchmark:
+  irb_exec: |
+    IO.popen(irb_f, 'w') do |io|
+      io.write('exit')
+    end
+loop_count: 30
diff --git a/benchmark/iseq_load_from_binary.yml b/benchmark/iseq_load_from_binary.yml
new file mode 100644
index 0000000000..7e9d73bdd4
--- /dev/null
+++ b/benchmark/iseq_load_from_binary.yml
@@ -0,0 +1,25 @@
+prelude: |
+  symbol = RubyVM::InstructionSequence.compile(":foo; :bar; :baz; :egg; :spam").to_binary
+
+  define_method = RubyVM::InstructionSequence.compile(%{
+    def foo; end
+    def bar; end
+    def baz; end
+    def egg; end
+    def spam; end
+  }).to_binary
+
+  all = RubyVM::InstructionSequence.compile(%{
+    module Foo; def foo; :foo; end; end
+    module Bar; def bar; :bar; end; end
+    module Baz; def baz; :baz; end; end
+    class Egg; def egg; :egg; end; end
+    class Spaml; def spam; :spam; end; end
+  }).to_binary
+
+benchmark:
+  symbol: RubyVM::InstructionSequence.load_from_binary(symbol)
+  define_method: RubyVM::InstructionSequence.load_from_binary(define_method)
+  all: RubyVM::InstructionSequence.load_from_binary(all)
+
+loop_count: 100_000
diff --git a/benchmark/ivar_extend.yml b/benchmark/ivar_extend.yml
new file mode 100644
index 0000000000..eb9ee923f5
--- /dev/null
+++ b/benchmark/ivar_extend.yml
@@ -0,0 +1,23 @@
+prelude: |
+  class Embedded
+    def initialize
+      @a = 1
+      @b = 1
+      @c = 1
+    end
+  end
+
+  class Extended
+    def initialize
+      @a = 1
+      @b = 1
+      @c = 1
+      @d = 1
+      @e = 1
+      @f = 1
+    end
+  end
+benchmark:
+  embedded: Embedded.new
+  extended: Extended.new
+loop_count: 20_000_000
diff --git a/benchmark/kernel_clone.yml b/benchmark/kernel_clone.yml
new file mode 100644
index 0000000000..069b23abcd
--- /dev/null
+++ b/benchmark/kernel_clone.yml
@@ -0,0 +1,6 @@
+prelude: "object = Object.new"
+benchmark:
+  clone: "object.clone"
+  clone_true: "object.clone(freeze: true)"
+  clone_false: "object.clone(freeze: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_float.yml b/benchmark/kernel_float.yml
new file mode 100644
index 0000000000..215f6750fc
--- /dev/null
+++ b/benchmark/kernel_float.yml
@@ -0,0 +1,5 @@
+benchmark:
+  float: "Float(42)"
+  float_true: "Float(42, exception: true)"
+  float_false: "Float(42, exception: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_tap.yml b/benchmark/kernel_tap.yml
new file mode 100644
index 0000000000..4dcbb31b4d
--- /dev/null
+++ b/benchmark/kernel_tap.yml
@@ -0,0 +1,6 @@
+prelude: |
+  obj = Object.new
+  x = nil
+benchmark:
+  kernel_tap: obj.tap { |o| x = o }
+loop_count: 20000000
diff --git a/benchmark/kernel_then.yml b/benchmark/kernel_then.yml
new file mode 100644
index 0000000000..85f7341e33
--- /dev/null
+++ b/benchmark/kernel_then.yml
@@ -0,0 +1,6 @@
+benchmark:
+  kernel_then: 1.then { |i| i + 1 }
+  kernel_then_enum: 1.then
+  kernel_yield_self: 1.yield_self { |i| i + 1 }
+  kernel_yield_self_enum: 1.yield_self
+loop_count: 20000000
diff --git a/benchmark/keyword_arguments.yml b/benchmark/keyword_arguments.yml
new file mode 100644
index 0000000000..fce6bce0b8
--- /dev/null
+++ b/benchmark/keyword_arguments.yml
@@ -0,0 +1,13 @@
+prelude: |
+  h = {a: 1}
+  def kw(a: 1) a end
+  def kws(**kw) kw end
+benchmark:
+  kw_to_kw: "kw(a: 1)"
+  kw_splat_to_kw: "kw(**h)"
+  kw_to_kw_splat: "kws(a: 1)"
+  kw_splat_to_kw_splat: "kws(**h)"
+  kw_and_splat_to_kw: "kw(a: 1, **h)"
+  kw_splats_to_kw: "kw(**h, **h)"
+  kw_and_splat_to_kw_splat: "kws(a: 1, **h)"
+  kw_splats_to_kw_splat: "kws(**h, **h)"
diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb
new file mode 100644
index 0000000000..d22236e9fb
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/output/driver.rb
@@ -0,0 +1,36 @@
+require 'benchmark_driver/output/simple'
+
+# This replicates the legacy benchmark/driver.rb behavior.
+class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple
+  def initialize(*)
+    super
+    @stdout = $stdout
+    @strio  = StringIO.new
+    $stdout = IOMultiplexer.new(@stdout, @strio)
+  end
+
+  def with_benchmark(*)
+    super
+  ensure
+    logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log"
+    puts "\nLog file: #{logfile}"
+
+    $stdout = @stdout
+    File.write(logfile, @strio.tap(&:rewind).read)
+  end
+
+  class IOMultiplexer
+    def initialize(io1, io2)
+      @io1 = io1
+      @io2 = io2
+    end
+
+    [:write, :sync, :sync=, :puts, :print, :flush].each do |method|
+      define_method(method) do |*args|
+        @io1.send(method, *args)
+        @io2.send(method, *args)
+      end
+    end
+  end
+  private_constant :IOMultiplexer
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb
new file mode 100644
index 0000000000..3c3453e527
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cstime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :cstime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb
new file mode 100644
index 0000000000..e139962ef2
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cutime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :cutime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb
new file mode 100644
index 0000000000..d04f2e51ff
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/peak.rb
@@ -0,0 +1,151 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Peak
+  METRIC = BenchmarkDriver::Metric.new(
+    name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger',
+  )
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  # @param [BenchmarkDriver::Config::RunnerConfig] config
+  # @param [BenchmarkDriver::Output] output
+  # @param [BenchmarkDriver::Context] contexts
+  def initialize(config:, output:, contexts:)
+    @config = config
+    @output = output
+    @contexts = contexts
+  end
+
+  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+  # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
+  def run(jobs)
+    if jobs.any? { |job| job.loop_count.nil? }
+      jobs = jobs.map do |job|
+        job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1))
+      end
+    end
+
+    @output.with_benchmark do
+      jobs.each do |job|
+        @output.with_job(name: job.name) do
+          job.runnable_contexts(@contexts).each do |context|
+            value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+              run_benchmark(job, context: context)
+            end
+            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+              @output.report(values: { metric => value }, loop_count: job.loop_count)
+            end
+          end
+        end
+      end
+    end
+  end
+
+  private
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__)
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      with_script(benchmark.render) do |path|
+        output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read)
+        if $?.success?
+          Integer(f.read)
+        else
+          $stdout.print(output)
+          BenchmarkDriver::Result::ERROR
+        end
+      end
+    end
+  end
+
+  # Overridden by BenchmarkDriver::Runner::Size
+  def target
+    'peak'
+  end
+
+  # Overridden by BenchmarkDriver::Runner::Size
+  def metric
+    METRIC
+  end
+
+  def with_script(script)
+    if @config.verbose >= 2
+      sep = '-' * 30
+      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+    end
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      f.puts script
+      f.close
+      return yield(f.path)
+    end
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    def render
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      <<-RUBY
+#{prelude}
+#{while_loop(script, loop_count)}
+#{teardown}
+
+result_file, target, memory_status = ARGV
+require_relative memory_status
+
+ms = Memory::Status.new
+case target.to_sym
+when :peak
+  key = ms.respond_to?(:hwm) ? :hwm : :peak
+when :size
+  key = ms.respond_to?(:rss) ? :rss : :size
+else
+  raise('unexpected target: ' + target)
+end
+
+File.write(result_file, ms[key])
+      RUBY
+    end
+
+    private
+
+    def while_loop(content, times)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      end
+
+      if times > 1
+        <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+  #{content}
+  __bmdv_i += 1
+end
+        RUBY
+      else
+        content
+      end
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/ractor.rb b/benchmark/lib/benchmark_driver/runner/ractor.rb
new file mode 100644
index 0000000000..fd9c2dd4db
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/ractor.rb
@@ -0,0 +1,122 @@
+require 'erb'
+
+# A runner to measure performance *inside* Ractor
+class BenchmarkDriver::Runner::Ractor < BenchmarkDriver::Runner::Ips
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob) do
+    attr_accessor :ractor
+  end
+
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
+    def parse(ractor: 1, **kwargs)
+      super(**kwargs).each do |job|
+        job.ractor = ractor
+      end
+    end
+  })
+
+  private
+
+  unless private_instance_methods.include?(:run_benchmark)
+    raise "#run_benchmark is no longer defined in BenchmarkDriver::Runner::Ips"
+  end
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    results = job.ractor.times.map do
+      Tempfile.open('benchmark_driver_result')
+    end
+    duration = with_script(benchmark.render(results: results.map(&:path))) do |path|
+      success = execute(*context.executable.command, path, exception: false)
+      if success && ((value = results.map { |f| Float(f.read) }.max) > 0)
+        value
+      else
+        BenchmarkDriver::Result::ERROR
+      end
+    end
+    results.each(&:close)
+
+    value_duration(
+      loop_count: job.loop_count,
+      duration: duration,
+    )
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    # @param [String] result - A file to write result
+    def render(results:)
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      ERB.new(<<-RUBY).result_with_hash(results: results)
+Warning[:experimental] = false
+# shareable-constant-value: experimental_everything
+#{prelude}
+
+if #{loop_count} == 1
+  __bmdv_loop_before = 0
+  __bmdv_loop_after = 0
+else
+  __bmdv_loop_before = Time.new
+  #{while_loop('', loop_count, id: 0)}
+  __bmdv_loop_after = Time.new
+end
+
+__bmdv_ractors = []
+<% results.size.times do %>
+__bmdv_ractors << Ractor.new(__bmdv_loop_after - __bmdv_loop_before) { |__bmdv_loop_time|
+  __bmdv_time = Time
+  __bmdv_script_before = __bmdv_time.new
+  #{while_loop(script, loop_count, id: 1)}
+  __bmdv_script_after = __bmdv_time.new
+
+  (__bmdv_script_after - __bmdv_script_before) - __bmdv_loop_time
+}
+<% end %>
+
+# Wait for all Ractors before executing code to write results
+__bmdv_ractors.map!(&:value)
+
+<% results.each do |result| %>
+File.write(<%= result.dump %>, __bmdv_ractors.shift)
+<% end %>
+
+#{teardown}
+      RUBY
+    end
+
+    private
+
+    # id is to prevent:
+    # can not isolate a Proc because it accesses outer variables (__bmdv_i)
+    def while_loop(content, times, id:)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      elsif times == 1
+        return content
+      end
+
+      # TODO: execute in batch
+      <<-RUBY
+__bmdv_i#{id} = 0
+while __bmdv_i#{id} < #{times}
+  #{content}
+  __bmdv_i#{id} += 1
+end
+      RUBY
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb
new file mode 100644
index 0000000000..1b31f901c7
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/size.rb
@@ -0,0 +1,25 @@
+require 'benchmark_driver/runner/peak'
+
+# Actually the same as BenchmarkDriver::Runner::Memory
+class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak
+  METRIC = BenchmarkDriver::Metric.new(
+    name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger',
+  )
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Peak#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Peak#target
+  def target
+    'size'
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb
new file mode 100644
index 0000000000..4577fb0bf8
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/stime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :stime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb
new file mode 100644
index 0000000000..64dc14f84e
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/total.rb
@@ -0,0 +1,137 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  # @param [BenchmarkDriver::Config::RunnerConfig] config
+  # @param [BenchmarkDriver::Output] output
+  # @param [BenchmarkDriver::Context] contexts
+  def initialize(config:, output:, contexts:)
+    @config = config
+    @output = output
+    @contexts = contexts
+  end
+
+  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+  # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs
+  def run(jobs)
+    if jobs.any? { |job| job.loop_count.nil? }
+      raise 'missing loop_count is not supported in Ruby repository'
+    end
+
+    @output.with_benchmark do
+      jobs.each do |job|
+        @output.with_job(name: job.name) do
+          job.runnable_contexts(@contexts).each do |context|
+            duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+              run_benchmark(job, context: context)
+            end
+            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+              @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count)
+            end
+          end
+        end
+      end
+    end
+  end
+
+  private
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      with_script(benchmark.render(result: f.path, target: target)) do |path|
+        IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2
+        if $?.success?
+          Float(f.read)
+        else
+          BenchmarkDriver::Result::ERROR
+        end
+      end
+    end
+  end
+
+  # This method is overridden by some subclasses
+  def metric
+    METRIC
+  end
+
+  # This method is overridden by some subclasses
+  def target
+    :total
+  end
+
+  def with_script(script)
+    if @config.verbose >= 2
+      sep = '-' * 30
+      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+    end
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      f.puts script
+      f.close
+      return yield(f.path)
+    end
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    # @param [String] result - A file to write result
+    def render(result:, target:)
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      <<-RUBY
+#{prelude}
+
+require 'benchmark'
+__bmdv_result = Benchmark.measure {
+  #{while_loop(script, loop_count)}
+}
+
+#{teardown}
+
+File.write(#{result.dump}, __bmdv_result.#{target})
+      RUBY
+    end
+
+    private
+
+    def while_loop(content, times)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      elsif times == 1
+        return content
+      end
+
+      # TODO: execute in batch
+      <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+  #{content}
+  __bmdv_i += 1
+end
+      RUBY
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb
new file mode 100644
index 0000000000..b61d83a188
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/utime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :utime
+  end
+end
diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb
new file mode 100644
index 0000000000..31b770c484
--- /dev/null
+++ b/benchmark/lib/load.rb
@@ -0,0 +1,18 @@
+# How to use this file:
+#   1. write a `$(srcdir)/test.rb` like:
+=begin
+require_relative 'benchmark/lib/load'
+
+Benchmark.driver(repeat_count: 5){|x|
+  x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby'
+  x.executable name: 'modif-miniruby', command: %w'./miniruby'
+
+  x.report %q{
+    h = {a: 1, b: 2, c: 3, d: 4}
+  }
+}
+=end
+#
+#  2. `make run`
+$:.unshift(File.join(__dir__, '../benchmark-driver/lib'))
+require 'benchmark_driver'
diff --git a/benchmark/loop_each.yml b/benchmark/loop_each.yml
new file mode 100644
index 0000000000..1c757185a8
--- /dev/null
+++ b/benchmark/loop_each.yml
@@ -0,0 +1,4 @@
+prelude: |
+  arr = [nil] * 30_000_000
+benchmark:
+  loop_each: arr.each{|e|}
diff --git a/benchmark/bm_loop_for.rb b/benchmark/loop_for.rb
index 0fc4cc1511..0fc4cc1511 100644
--- a/benchmark/bm_loop_for.rb
+++ b/benchmark/loop_for.rb
diff --git a/benchmark/loop_generator.rb b/benchmark/loop_generator.rb
new file mode 100644
index 0000000000..6a3194b670
--- /dev/null
+++ b/benchmark/loop_generator.rb
@@ -0,0 +1,14 @@
+max = 6000000
+
+if defined? Fiber
+  gen = (1..max).each
+  loop do
+    gen.next
+  end
+else
+  require 'generator'
+  gen = Generator.new((0..max))
+  while gen.next?
+    gen.next
+  end
+end
diff --git a/benchmark/bm_loop_times.rb b/benchmark/loop_times.rb
index 521f72ad1a..521f72ad1a 100644
--- a/benchmark/bm_loop_times.rb
+++ b/benchmark/loop_times.rb
diff --git a/benchmark/loop_times_megamorphic.yml b/benchmark/loop_times_megamorphic.yml
new file mode 100644
index 0000000000..f9343ba897
--- /dev/null
+++ b/benchmark/loop_times_megamorphic.yml
@@ -0,0 +1,7 @@
+prelude: |
+  eval(<<~EOS)
+    def loop_times_megamorphic
+      #{"1.times {|i|};" * 1000}
+    end
+  EOS
+benchmark: loop_times_megamorphic
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/loop_whileloop.rb
index 0072822c06..0072822c06 100644
--- a/benchmark/bm_loop_whileloop.rb
+++ b/benchmark/loop_whileloop.rb
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/loop_whileloop2.rb
index 47d02dffc4..47d02dffc4 100644
--- a/benchmark/bm_loop_whileloop2.rb
+++ b/benchmark/loop_whileloop2.rb
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
deleted file mode 100644
index b6d787ae27..0000000000
--- a/benchmark/make_fasta_output.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-# prepare 'fasta.output'
-
-def prepare_fasta_output n
-  filebase = File.join(File.dirname($0), 'fasta.output')
-  script = File.join(File.dirname($0), 'bm_so_fasta.rb')
-  file = "#{filebase}.#{n}"
-
-  unless FileTest.exist?(file)
-    STDERR.puts "preparing #{file}"
-
-    open(file, 'w'){|f|
-      ARGV[0] = n
-      $stdout = f
-      load script
-      $stdout = STDOUT
-    }
-  end
-end
-
diff --git a/benchmark/bm_marshal_dump_flo.rb b/benchmark/marshal_dump_flo.rb
index 9b8d0c6afb..9b8d0c6afb 100644
--- a/benchmark/bm_marshal_dump_flo.rb
+++ b/benchmark/marshal_dump_flo.rb
diff --git a/benchmark/marshal_dump_load_geniv.rb b/benchmark/marshal_dump_load_geniv.rb
new file mode 100644
index 0000000000..8252ad90fa
--- /dev/null
+++ b/benchmark/marshal_dump_load_geniv.rb
@@ -0,0 +1,10 @@
+a = ''
+a.instance_eval do
+  @a = :a
+  @b = :b
+  @c = :c
+end
+100000.times do
+  a = Marshal.load(Marshal.dump(a))
+end
+#p(a.instance_eval { @a == :a && @b == :b && @c == :c })
diff --git a/benchmark/marshal_dump_load_integer.yml b/benchmark/marshal_dump_load_integer.yml
new file mode 100644
index 0000000000..78ebf823d2
--- /dev/null
+++ b/benchmark/marshal_dump_load_integer.yml
@@ -0,0 +1,22 @@
+prelude: |
+  smallint_array = 1000.times.map { |x| x }
+  bigint32_array = 1000.times.map { |x| x + 2**32 }
+  bigint64_array = 1000.times.map { |x| x + 2**64 }
+
+  smallint_dump = Marshal.dump(smallint_array)
+  bigint32_dump = Marshal.dump(bigint32_array)
+  bigint64_dump = Marshal.dump(bigint64_array)
+benchmark:
+  marshal_dump_integer_small: |
+    Marshal.dump(smallint_array)
+  marshal_dump_integer_over_32_bit: |
+    Marshal.dump(bigint32_array)
+  marshal_dump_integer_over_64_bit: |
+    Marshal.dump(bigint64_array)
+  marshal_load_integer_small: |
+    Marshal.load(smallint_dump)
+  marshal_load_integer_over_32_bit: |
+    Marshal.load(bigint32_dump)
+  marshal_load_integer_over_64_bit: |
+    Marshal.load(bigint64_dump)
+loop_count: 4000
diff --git a/benchmark/marshal_dump_load_time.rb b/benchmark/marshal_dump_load_time.rb
new file mode 100644
index 0000000000..e29743b791
--- /dev/null
+++ b/benchmark/marshal_dump_load_time.rb
@@ -0,0 +1 @@
+100000.times { Marshal.load(Marshal.dump(Time.now)) }
diff --git a/benchmark/masgn.yml b/benchmark/masgn.yml
new file mode 100644
index 0000000000..31cb8ee4a3
--- /dev/null
+++ b/benchmark/masgn.yml
@@ -0,0 +1,53 @@
+prelude: |
+  a = [nil] * 3
+  b = Class.new{attr_writer :a, :b, :c}.new
+  c = d = e = f = g = h = i = nil
+benchmark:
+  array2_2: "c = (a[0], a[1] = 1, 2)"
+  array2_3: "c = (a[0], a[1] = 1, 2, 3)"
+  array3_2: "c = (a[0], a[1], a[2] = 1, 2)"
+  array3_3: "c = (a[0], a[1], a[2] = 1, 2, 3)"
+  attr2_2: "c = (b.a, b.b = 1, 2)"
+  attr2_3: "c = (b.a, b.b = 1, 2, 3)"
+  attr3_2: "c = (b.a, b.b, b.c = 1, 2)"
+  attr3_3: "c = (b.a, b.b, b.c = 1, 2, 3)"
+  lvar2_2: "c = (d, e = 1, 2)"
+  lvar2_3: "c = (d, e = 1, 2, 3)"
+  lvar3_2: "c = (d, e, f = 1, 2)"
+  lvar3_3: "c = (d, e, f = 1, 2, 3)"
+  array2_2p: "(a[0], a[1] = 1, 2; nil)"
+  array2_3p: "(a[0], a[1] = 1, 2, 3; nil)"
+  array3_2p: "(a[0], a[1], a[2] = 1, 2; nil)"
+  array3_3p: "(a[0], a[1], a[2] = 1, 2, 3; nil)"
+  attr2_2p: "(b.a, b.b = 1, 2; nil)"
+  attr2_3p: "(b.a, b.b = 1, 2, 3; nil)"
+  attr3_2p: "(b.a, b.b, b.c = 1, 2; nil)"
+  attr3_3p: "(b.a, b.b, b.c = 1, 2, 3; nil)"
+  lvar2_2p: "(d, e = 1, 2; nil)"
+  lvar2_3p: "(d, e = 1, 2, 3; nil)"
+  lvar3_2p: "(d, e, f = 1, 2; nil)"
+  lvar3_3p: "(d, e, f = 1, 2, 3; nil)"
+  array2_2lv: "c = (a[0], a[1] = g, h)"
+  array2_ilv: "c = (a[0], a[1] = g, h, i)"
+  arrayi_2lv: "c = (a[0], a[1], a[2] = g, h)"
+  arrayi_ilv: "c = (a[0], a[1], a[2] = g, h, i)"
+  attr2_2lv: "c = (b.a, b.b = g, h)"
+  attr2_ilv: "c = (b.a, b.b = g, h, i)"
+  attri_2lv: "c = (b.a, b.b, b.c = g, h)"
+  attri_ilv: "c = (b.a, b.b, b.c = g, h, i)"
+  lvar2_2lv: "c = (d, e = g, h)"
+  lvar2_ilv: "c = (d, e = g, h, i)"
+  lvari_2lv: "c = (d, e, f = g, h)"
+  lvari_ilv: "c = (d, e, f = g, h, i)"
+  array2_2plv: "(a[0], a[1] = g, h; nil)"
+  array2_iplv: "(a[0], a[1] = g, h, i; nil)"
+  arrayi_2plv: "(a[0], a[1], a[2] = g, h; nil)"
+  arrayi_iplv: "(a[0], a[1], a[2] = g, h, i; nil)"
+  attr2_2plv: "(b.a, b.b = g, h; nil)"
+  attr2_iplv: "(b.a, b.b = g, h, i; nil)"
+  attri_2plv: "(b.a, b.b, b.c = g, h; nil)"
+  attri_iplv: "(b.a, b.b, b.c = g, h, i; nil)"
+  lvar2_2plv: "(d, e = g, h; nil)"
+  lvar2_iplv: "(d, e = g, h, i; nil)"
+  lvari_2plv: "(d, e, f = g, h; nil)"
+  lvari_iplv: "(d, e, f = g, h, i; nil)"
diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb
new file mode 100644
index 0000000000..ffda109912
--- /dev/null
+++ b/benchmark/match_gt4.rb
@@ -0,0 +1 @@
+1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") }
diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb
new file mode 100644
index 0000000000..3b743d484a
--- /dev/null
+++ b/benchmark/match_small.rb
@@ -0,0 +1 @@
+1000000.times { 'haystack'.match(/hay/) }
diff --git a/benchmark/method_bind_call.yml b/benchmark/method_bind_call.yml
new file mode 100644
index 0000000000..9e0e046ed4
--- /dev/null
+++ b/benchmark/method_bind_call.yml
@@ -0,0 +1,16 @@
+prelude: |
+  named_module = Kernel
+
+  module FakeName
+    def self.name
+      "NotMyame".freeze
+    end
+  end
+
+  MOD_NAME = Module.instance_method(:name)
+
+benchmark:
+  fastpath: MOD_NAME.bind_call(Kernel)
+  slowpath: MOD_NAME.bind_call(FakeName)
+
+loop_count: 100_000
diff --git a/benchmark/module_eqq.yml b/benchmark/module_eqq.yml
new file mode 100644
index 0000000000..2f9c490d92
--- /dev/null
+++ b/benchmark/module_eqq.yml
@@ -0,0 +1,32 @@
+prelude: |
+  module SomeModule; end
+  class SimpleClass; end
+  class MediumClass
+    10.times { include Module.new }
+  end
+  class LargeClass
+    100.times { include Module.new }
+  end
+  class HugeClass
+    300.times { include Module.new }
+  end
+  SimpleObj = SimpleClass.new
+  MediumObj = MediumClass.new
+  LargeObj = LargeClass.new
+  HugeObj = HugeClass.new
+benchmark:
+  simple_class_eqq_simple_obj: |
+    SimpleClass === SimpleObj
+  medium_class_eqq_simple_obj: |
+    MediumClass === SimpleObj
+  simple_class_eqq_medium_obj: |
+    SimpleClass === MediumObj
+  simple_class_eqq_large_obj: |
+    SimpleClass === LargeObj
+  simple_class_eqq_huge_obj: |
+    SimpleClass === HugeObj
+  simple_class_eqq_module: |
+    SimpleClass === HugeObj
+  module_eqq_module: |
+    SomeModule === HugeObj
+loop_count: 10000000
diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml
new file mode 100644
index 0000000000..79ba4f2177
--- /dev/null
+++ b/benchmark/nil_p.yml
@@ -0,0 +1,9 @@
+prelude: |
+  class Niller; def nil?; true; end; end
+  xnil, notnil = nil, Object.new
+  niller = Niller.new
+benchmark:
+  - xnil.nil?
+  - notnil.nil?
+  - niller.nil?
+loop_count: 10000000
diff --git a/benchmark/nilclass.yml b/benchmark/nilclass.yml
new file mode 100644
index 0000000000..66234c4cdf
--- /dev/null
+++ b/benchmark/nilclass.yml
@@ -0,0 +1,16 @@
+prelude: |
+  def a = nil
+benchmark:
+  rationalize:
+    nil.rationalize
+  to_c: |
+    nil.to_c
+  to_i: |
+    nil.to_i
+  to_f: |
+    nil.to_f
+  to_r: |
+    nil.to_r
+  splat: |
+    a(*nil)
+loop_count: 100000
diff --git a/benchmark/num_zero_p.yml b/benchmark/num_zero_p.yml
new file mode 100644
index 0000000000..2195963433
--- /dev/null
+++ b/benchmark/num_zero_p.yml
@@ -0,0 +1,8 @@
+benchmark:
+  - 0.zero?
+  - 1.zero?
+  - 0r.zero?
+  - 1r.zero?
+  - 0i.zero?
+  - 1i.zero?
+loop_count: 50000000
diff --git a/benchmark/numeric_methods.yml b/benchmark/numeric_methods.yml
new file mode 100644
index 0000000000..1384902935
--- /dev/null
+++ b/benchmark/numeric_methods.yml
@@ -0,0 +1,29 @@
+prelude: |
+  int = 42
+  flo = 4.2
+benchmark:
+  real?: |
+    int.real?
+  integer?: |
+    flo.integer?
+  finite?: |
+    int.finite?
+  infinite?: |
+    int.infinite?
+  integer_real: |
+    int.real
+  float_real: |
+    flo.real
+  integr_imag: |
+    int.imag
+  float_imag: |
+    flo.imag
+  integer_conj: |
+    int.conj
+  float_conj: |
+    flo.conj
+  integer_numerator: |
+    int.numerator
+  integer_denominator: |
+    int.denominator
+loop_count: 20000000
diff --git a/benchmark/object_allocate.yml b/benchmark/object_allocate.yml
new file mode 100644
index 0000000000..c6269923f0
--- /dev/null
+++ b/benchmark/object_allocate.yml
@@ -0,0 +1,49 @@
+prelude: |
+  class Eight
+    8.times { include(Module.new) }
+  end
+  class ThirtyTwo
+    32.times { include(Module.new) }
+  end
+  class SixtyFour
+    64.times { include(Module.new) }
+  end
+  class OneTwentyEight
+    128.times { include(Module.new) }
+  end
+  class OnePositional
+    def initialize a; end
+  end
+  class TwoPositional
+    def initialize a, b; end
+  end
+  class ThreePositional
+    def initialize a, b, c; end
+  end
+  class FourPositional
+    def initialize a, b, c, d; end
+  end
+  class KWArg
+    def initialize a:, b:, c:, d:
+    end
+  end
+  class Mixed
+    def initialize a, b, c:, d:
+    end
+  end
+  # Disable GC to see raw throughput:
+  GC.disable
+benchmark:
+  allocate_8_deep: Eight.new
+  allocate_32_deep: ThirtyTwo.new
+  allocate_64_deep: SixtyFour.new
+  allocate_128_deep: OneTwentyEight.new
+  allocate_1_positional_params: OnePositional.new(1)
+  allocate_2_positional_params: TwoPositional.new(1, 2)
+  allocate_3_positional_params: ThreePositional.new(1, 2, 3)
+  allocate_4_positional_params: FourPositional.new(1, 2, 3, 4)
+  allocate_kwarg_params: "KWArg.new(a: 1, b: 2, c: 3, d: 4)"
+  allocate_mixed_params: "Mixed.new(1, 2, c: 3, d: 4)"
+  allocate_no_params: "Object.new"
+  allocate_allocate: "Object.allocate"
+loop_count: 100000
diff --git a/benchmark/object_class.yml b/benchmark/object_class.yml
new file mode 100644
index 0000000000..1e5409d1e2
--- /dev/null
+++ b/benchmark/object_class.yml
@@ -0,0 +1,40 @@
+prelude: |
+  def get_class(obj)
+    i = 10_000
+    while i > 0
+      i -= 1
+      # 100 times per loop
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+    end
+  end
+
+  class Obj
+  end
+  obj = Obj.new
+
+  singleton = Obj.new
+  def singleton.bar
+  end
+
+  extended = Obj.new
+  2.times do
+    extended.extend Module.new
+  end
+
+  immediate = 1.4
+benchmark:
+  obj: get_class(obj)
+  extended: get_class(extended)
+  singleton: get_class(singleton)
+  immediate: get_class(immediate)
+loop_count: 1000
diff --git a/benchmark/object_id.yml b/benchmark/object_id.yml
new file mode 100644
index 0000000000..2bd52b923f
--- /dev/null
+++ b/benchmark/object_id.yml
@@ -0,0 +1,4 @@
+benchmark:
+  baseline: "Object.new"
+  object_id: "Object.new.object_id"
+# loop_count: 100000
diff --git a/benchmark/objspace_dump_all.yml b/benchmark/objspace_dump_all.yml
new file mode 100644
index 0000000000..ebab562d2e
--- /dev/null
+++ b/benchmark/objspace_dump_all.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'objspace'
+  require 'tempfile'
+  $objs = 1_000.times.map { Object.new }
+  $strings = 1_000.times.map { |i| "string #{i}" }
+  $file = Tempfile.new('heap')
+  $dev_null = File.open(File::NULL, 'w+')
+
+benchmark:
+  dump_all_string: "ObjectSpace.dump_all(output: :string)"
+  dump_all_file: "ObjectSpace.dump_all(output: $file)"
+  dump_all_dev_null: "ObjectSpace.dump_all(output: $dev_null)"
+loop_count: 1
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
index 01593965d9..1ce9f76275 100644
--- a/benchmark/other-lang/fact.py
+++ b/benchmark/other-lang/fact.py
@@ -3,7 +3,7 @@
 
 def factL(n):
 	r = 1
-	for x in range(2, n):
+	for x in range(2, n+1):
 		r *= x
 	return r
 
diff --git a/benchmark/pm_array.yml b/benchmark/pm_array.yml
new file mode 100644
index 0000000000..babb65a289
--- /dev/null
+++ b/benchmark/pm_array.yml
@@ -0,0 +1,19 @@
+prelude: |
+  def call(*val)
+    case val
+      in [String => body]
+        [200, {}, [body]]
+      in [Integer => status]
+        [status, {}, [""]]
+      in [Integer, String] => response
+        [response[0], {}, [response[1]]]
+      in [Integer, Hash, String] => response
+        [response[0], response[1], [response[2]]]
+    end
+  end
+
+benchmark:
+  first_match: call("ok")
+  second_match: call(401)
+  third_match: call(200, "ok")
+  fourth_match: call(201, {}, "created")
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
deleted file mode 100644
index ee2138cdb2..0000000000
--- a/benchmark/prepare_so_count_words.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# prepare 'wc.input'
-
-def prepare_wc_input
-  wcinput = File.join(File.dirname($0), 'wc.input')
-  wcbase  = File.join(File.dirname($0), 'wc.input.base')
-  unless FileTest.exist?(wcinput)
-    data = File.read(wcbase)
-    13.times{
-      data << data
-    }
-    open(wcinput, 'w'){|f| f.write data}
-  end
-end
-
-prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
deleted file mode 100644
index d83aeb7a7e..0000000000
--- a/benchmark/prepare_so_k_nucleotide.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
deleted file mode 100644
index da3ec2df14..0000000000
--- a/benchmark/prepare_so_reverse_complement.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(2_500_000)
diff --git a/benchmark/ractor_const.yml b/benchmark/ractor_const.yml
new file mode 100644
index 0000000000..d7ab74bdca
--- /dev/null
+++ b/benchmark/ractor_const.yml
@@ -0,0 +1,4 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+  ractor_const: Object
+ractor: 1
diff --git a/benchmark/ractor_float_to_s.yml b/benchmark/ractor_float_to_s.yml
new file mode 100644
index 0000000000..8f492be668
--- /dev/null
+++ b/benchmark/ractor_float_to_s.yml
@@ -0,0 +1,8 @@
+type: lib/benchmark_driver/runner/ractor
+prelude: |
+  FLOATS = [*0.0.step(1.0, 0.001)]
+benchmark:
+  ractor_float_to_s: |
+    FLOATS.each {|f| f.to_s}
+loop_count: 100
+ractor: 2
diff --git a/benchmark/ractor_string_fstring.yml b/benchmark/ractor_string_fstring.yml
new file mode 100644
index 0000000000..14b92d8fd8
--- /dev/null
+++ b/benchmark/ractor_string_fstring.yml
@@ -0,0 +1,18 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+  ractor_fstring_random: |
+    i = 0
+    str = "same".dup
+    while i < 2000000
+      -(i.to_s.freeze)
+      i += 1
+    end
+  ractor_fstring_same: |
+    i = 0
+    str = "same".dup
+    while i < 2000000
+      -str
+      i += 1
+    end
+loop_count: 1
+ractor: 4
diff --git a/benchmark/range_bsearch_bignum.yml b/benchmark/range_bsearch_bignum.yml
new file mode 100644
index 0000000000..5730c93fcf
--- /dev/null
+++ b/benchmark/range_bsearch_bignum.yml
@@ -0,0 +1,10 @@
+prelude: |
+  first = 2**100
+  last = 2**1000
+  mid = (first + last) / 2
+  r = first..last
+
+benchmark:
+  first: r.bsearch { |x| x >= first }
+  mid: r.bsearch { |x| x >= mid }
+  last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_bsearch_endpointless.yml b/benchmark/range_bsearch_endpointless.yml
new file mode 100644
index 0000000000..8d7bedb662
--- /dev/null
+++ b/benchmark/range_bsearch_endpointless.yml
@@ -0,0 +1,21 @@
+prelude: |
+  re = (1..)
+  rb = (..0)
+
+benchmark:
+  'endless 10**0': re.bsearch { |x| x >= 1 }
+  'endless 10**1': re.bsearch { |x| x >= 10 }
+  'endless 10**2': re.bsearch { |x| x >= 100 }
+  'endless 10**3': re.bsearch { |x| x >= 1000 }
+  'endless 10**4': re.bsearch { |x| x >= 10000 }
+  'endless 10**5': re.bsearch { |x| x >= 100000 }
+  'endless 10**10': re.bsearch { |x| x >= 10000000000 }
+  'endless 10**100': re.bsearch { |x| x >= 10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
+  'beginless -10**0': rb.bsearch { |x| x >= -1 }
+  'beginless -10**1': rb.bsearch { |x| x >= -10 }
+  'beginless -10**2': rb.bsearch { |x| x >= -100 }
+  'beginless -10**3': rb.bsearch { |x| x >= -1000 }
+  'beginless -10**4': rb.bsearch { |x| x >= -10000 }
+  'beginless -10**5': rb.bsearch { |x| x >= -100000 }
+  'beginless -10**10': rb.bsearch { |x| x >= -10000000000 }
+  'beginless -10**100': rb.bsearch { |x| x >= -10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
diff --git a/benchmark/range_bsearch_fixnum.yml b/benchmark/range_bsearch_fixnum.yml
new file mode 100644
index 0000000000..59416531b9
--- /dev/null
+++ b/benchmark/range_bsearch_fixnum.yml
@@ -0,0 +1,10 @@
+prelude: |
+  first = 1
+  last = 10000
+  mid = (first + last) / 2
+  r = first..last
+
+benchmark:
+  first: r.bsearch { |x| x >= first }
+  mid: r.bsearch { |x| x >= mid }
+  last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_count.yml b/benchmark/range_count.yml
new file mode 100644
index 0000000000..58f53a0236
--- /dev/null
+++ b/benchmark/range_count.yml
@@ -0,0 +1,11 @@
+prelude: |
+  r_1 = 1..1
+  r_1k = 1..1000
+  r_1m = 1..1000000
+  r_str = 'a'..'z'
+
+benchmark:
+  'int 1': r_1.count
+  'int 1K': r_1k.count
+  'int 1M': r_1m.count
+  string: r_str.count
diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml
new file mode 100644
index 0000000000..a6674f82ee
--- /dev/null
+++ b/benchmark/range_last.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - (1..1_000_000).last(100)
+  - (1..1_000_000).last(1000)
+  - (1..1_000_000).last(10000)
diff --git a/benchmark/range_min.yml b/benchmark/range_min.yml
new file mode 100644
index 0000000000..9e60dd7308
--- /dev/null
+++ b/benchmark/range_min.yml
@@ -0,0 +1,2 @@
+benchmark:
+  - (1..10).min
diff --git a/benchmark/range_overlap.yml b/benchmark/range_overlap.yml
new file mode 100644
index 0000000000..700a00053c
--- /dev/null
+++ b/benchmark/range_overlap.yml
@@ -0,0 +1,19 @@
+prelude: |
+  class Range
+    unless method_defined?(:overlap?)
+      def overlap?(other)
+        other.begin == self.begin || cover?(other.begin) || other.cover?(self.begin)
+      end
+    end
+  end
+
+benchmark:
+  - (2..3).overlap?(1..1)
+  - (2..3).overlap?(2..4)
+  - (2..3).overlap?(4..5)
+  - (2..3).overlap?(2..1)
+  - (2..3).overlap?(0..1)
+  - (2..3).overlap?(...1)
+  - (2...3).overlap?(..2)
+  - (2...3).overlap?(3...)
+  - (2..3).overlap?('a'..'d')
diff --git a/benchmark/range_reverse_each.yml b/benchmark/range_reverse_each.yml
new file mode 100644
index 0000000000..a32efeccc6
--- /dev/null
+++ b/benchmark/range_reverse_each.yml
@@ -0,0 +1,16 @@
+prelude: |
+  rf_1 = 0..1
+  rf_1k = 0..1000
+  rf_1m = 0..1000000
+  big = 2**1000
+  rb_1 = big..big+1
+  rb_1k = big..big+1000
+  rb_1m = big..big+1000000
+
+benchmark:
+  "Fixnum 1": rf_1.reverse_each { _1 }
+  "Fixnum 1K": rf_1k.reverse_each { _1 }
+  "Fixnum 1M": rf_1m.reverse_each { _1 }
+  "Bignum 1": rb_1.reverse_each { _1 }
+  "Bignum 1K": rb_1k.reverse_each { _1 }
+  "Bignum 1M": rb_1m.reverse_each { _1 }
diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml
new file mode 100644
index 0000000000..6b6a4836b0
--- /dev/null
+++ b/benchmark/realpath.yml
@@ -0,0 +1,33 @@
+prelude: |
+  f = File
+  pwd = Dir.pwd
+  Dir.mkdir('b') unless f.directory?('b')
+  f.write('b/a', '') unless f.file?('b/a')
+
+  relative = 'b/a'
+  absolute = File.join(pwd, relative)
+  dir = 'b'
+  file = 'a'
+
+  relative_dir = 'b/c'
+  absolute_dir = File.join(pwd, relative_dir)
+  file_dir = 'c'
+teardown: |
+  require 'fileutils'
+  FileUtils.rm_rf('b')
+benchmark:
+  relative_nil: "f.realpath(relative, nil)"
+  absolute_nil: "f.realpath(absolute, nil)"
+  relative_relative: "f.realpath(file, dir)"
+  absolute_relative: "f.realpath(absolute, dir)"
+  relative_absolute: "f.realpath(relative, pwd)"
+  relative_nil_dir: "f.realdirpath(relative_dir, nil)"
+  absolute_nil_dir: "f.realdirpath(absolute_dir, nil)"
+  relative_relative_dir: "f.realdirpath(file_dir, dir)"
+  absolute_relative_dir: "f.realdirpath(absolute_dir, dir)"
+  relative_absolute_dir: "f.realdirpath(relative_dir, pwd)"
+  relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil"
+  absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil"
+  relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil"
+  absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil"
+  relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil"
diff --git a/benchmark/regexp_dup.yml b/benchmark/regexp_dup.yml
new file mode 100644
index 0000000000..52f89991cd
--- /dev/null
+++ b/benchmark/regexp_dup.yml
@@ -0,0 +1,6 @@
+prelude: |
+  str = "a" * 1000
+  re = Regexp.new(str)
+
+benchmark:
+  dup: re.dup
diff --git a/benchmark/regexp_new.yml b/benchmark/regexp_new.yml
new file mode 100644
index 0000000000..bc9ab3ca21
--- /dev/null
+++ b/benchmark/regexp_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+  str = "a" * 1000
+  re = Regexp.new(str)
+
+benchmark:
+  string: Regexp.new(str)
+  regexp: Regexp.new(re)
diff --git a/benchmark/report.rb b/benchmark/report.rb
deleted file mode 100644
index d2dc56b1e1..0000000000
--- a/benchmark/report.rb
+++ /dev/null
@@ -1,79 +0,0 @@
-#
-# YARV benchmark driver
-#
-
-require 'yarvutil'
-require 'benchmark'
-require 'rbconfig'
-
-def exec_command type, file, w
-  <<-EOP
-  $DRIVER_PATH = '#{File.dirname($0)}'
-  $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
-  require 'benchmark'
-  require 'yarvutil'
-#  print '#{type}'
-  begin
-    puts Benchmark.measure{
-      #{w}('#{file}')
-    }.utime
-  rescue Exception => exec_command_error_variable
-    puts "\t" + exec_command_error_variable.message
-  end
-  EOP
-end
-
-def benchmark cmd
-  rubybin = ENV['RUBY'] || RbConfig.ruby
-
-  IO.popen(rubybin, 'r+'){|io|
-    io.write cmd
-    io.close_write
-    return io.gets
-  }
-end
-
-def ruby_exec file
-  prog = exec_command 'ruby', file, 'load'
-  benchmark prog
-end
-
-def yarv_exec file
-  prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
-  benchmark prog
-end
-
-$wr = $wy = nil
-
-def measure bench
-  file = File.dirname($0) + "/bm_#{bench}.rb"
-  r = ruby_exec(file).to_f
-  y = yarv_exec(file).to_f
-  puts "#{bench}\t#{r}\t#{y}"
-end
-
-def measure2
-  r = ruby_exec.to_f
-  y = yarv_exec.to_f
-  puts r/y
-end
-
-if $0 == __FILE__
-  %w{
-    whileloop
-    whileloop2
-    times
-    const
-    method
-    poly_method
-    block
-    rescue
-    rescue2
-  }.each{|bench|
-    measure bench
-  }
-end
-
-
-
-
diff --git a/benchmark/require.yml b/benchmark/require.yml
new file mode 100644
index 0000000000..09f218cf08
--- /dev/null
+++ b/benchmark/require.yml
@@ -0,0 +1,32 @@
+prelude: |
+  require "fileutils"
+
+  def prepare
+    num_files = 10000
+
+    basename = File.dirname($0)
+    data_dir = File.join(basename, "bm_require.data")
+
+    # skip if all of files exists
+    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+      return
+    end
+
+    FileUtils.mkdir_p(data_dir)
+
+    1.upto(num_files) do |i|
+      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+    end
+  end
+
+  prepare
+benchmark:
+  require: |
+    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+    1.upto(10000) do |i|
+      require "c#{i}"
+    end
+
+    $:.pop
+loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
new file mode 100644
index 0000000000..0c63257106
--- /dev/null
+++ b/benchmark/require_thread.yml
@@ -0,0 +1,40 @@
+prelude: |
+  require "fileutils"
+
+  def prepare
+    num_files = 10000
+
+    basename = File.dirname($0)
+    data_dir = File.join(basename, "bm_require.data")
+
+    # skip if all of files exists
+    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+      return
+    end
+
+    FileUtils.mkdir_p(data_dir)
+
+    1.upto(num_files) do |i|
+      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+    end
+  end
+
+  prepare
+benchmark:
+  require_thread: |
+    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+    i=0
+    t = Thread.new do
+      while true
+        i = i+1 # dummy loop
+      end
+    end
+
+    1.upto(100) do |i|
+      require "c#{i}"
+    end
+
+    $:.pop
+    t.kill
+loop_count: 1
diff --git a/benchmark/run.rb b/benchmark/run.rb
deleted file mode 100644
index 0cd2363849..0000000000
--- a/benchmark/run.rb
+++ /dev/null
@@ -1,127 +0,0 @@
-#
-# Ruby benchmark driver
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$matzrubyonly = false
-$rubyonly = false
-
-$results  = []
-
-# prepare 'wc.input'
-def prepare_wc_input
-  wcinput = File.join(File.dirname($0), 'wc.input')
-  wcbase  = File.join(File.dirname($0), 'wc.input.base')
-  unless FileTest.exist?(wcinput)
-    data = File.read(wcbase)
-    13.times{
-      data << data
-    }
-    open(wcinput, 'w'){|f| f.write data}
-  end
-end
-
-prepare_wc_input
-
-def bm file
-  prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
-  return if prog.empty?
-
-  /[a-z]+_(.+)\.rb/ =~ file
-  bm_name = $1
-  puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
-  puts "#{bm_name}: "
-
-
-puts <<EOS unless $matzrubyonly || $rubyonly
-#{prog}
---
-EOS
-  begin
-    result = [bm_name]
-    result << matzruby_exec(file) unless $rubyonly
-    result << ruby_exec(file) unless $matzrubyonly
-    $results << result
-
-  rescue Exception => e
-    puts
-    puts "** benchmark failure: #{e}"
-    puts e.backtrace
-  end
-end
-
-def benchmark file, bin
-  m = Benchmark.measure{
-    `#{bin} #{$opts} #{file}`
-  }
-  sec = '%.3f' % m.real
-  puts " #{sec}"
-  sec
-end
-
-def ruby_exec file
-  print 'ruby'
-  benchmark file, $ruby_program
-end
-
-def matzruby_exec file
-  print 'matz'
-  rubylib = ENV['RUBYLIB']
-  ENV['RUBYLIB'] = ''
-  r = benchmark file, $matzruby_program
-  ENV['RUBYLIB'] = rubylib
-  r
-end
-
-if $0 == __FILE__
-  ARGV.each{|arg|
-    case arg
-    when /\A--ruby=(.+)/
-      $ruby_program = $1
-    when /\A--matzruby=(.+)/
-      $matzruby_program = $1
-    when /\A--opts=(.+)/
-      $opts = $1
-    when /\A(-r|--only-ruby)\z/
-      $rubyonly = true
-    when /\A(-m|--only-matzruby)\z/
-      $matzrubyonly = true
-    end
-  }
-  ARGV.delete_if{|arg|
-    /\A-/ =~ arg
-  }
-
-  puts "MatzRuby:"
-  system("#{$matzruby_program} -v")
-  puts "Ruby:"
-  system("#{$ruby_program} -v")
-  puts
-
-  if ARGV.empty?
-    Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
-      bm file
-    }
-  else
-    ARGV.each{|file|
-      Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
-        # file = "#{File.dirname(__FILE__)}/#{file}.rb"
-        bm ef
-      }
-    }
-  end
-
-  puts
-  puts "-- benchmark summary ---------------------------"
-  $results.each{|res|
-    print res.shift, "\t"
-    (res||[]).each{|result|
-      /([\d\.]+)/ =~ result
-      print $1 + "\t" if $1
-    }
-    puts
-  }
-end
-
diff --git a/benchmark/runc.rb b/benchmark/runc.rb
deleted file mode 100644
index 97c5cef045..0000000000
--- a/benchmark/runc.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-#
-#
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$rubybin = ENV['RUBY'] || RbConfig.ruby
-
-def runfile file
-  puts file
-  file = File.join(File.dirname($0), 'contrib', file)
-  Benchmark.bm{|x|
-    x.report('ruby'){
-      system("#{$rubybin} #{file}")
-    }
-    x.report('yarv'){
-      system("#{$rubybin} -rite -I.. #{file}")
-    }
-  }
-end
-
-ARGV.each{|file|
-  runfile file
-}
-
-
diff --git a/benchmark/scan.yaml b/benchmark/scan.yaml
new file mode 100644
index 0000000000..62ad1d6862
--- /dev/null
+++ b/benchmark/scan.yaml
@@ -0,0 +1,16 @@
+prelude: |
+  $LOAD_PATH.unshift(File.expand_path("lib"))
+  require "strscan"
+  str = "test string"
+  scanner = StringScanner.new(str)
+  str = "test"
+  reg = /test/
+benchmark:
+  check(reg): |
+    scanner.check(reg)
+  check(str): |
+    scanner.check(str)
+  match?(reg): |
+    scanner.match?(reg)
+  match?(str): |
+    scanner.match?(str)
diff --git a/benchmark/search.yaml b/benchmark/search.yaml
new file mode 100644
index 0000000000..42a50c90e6
--- /dev/null
+++ b/benchmark/search.yaml
@@ -0,0 +1,16 @@
+prelude: |
+  $LOAD_PATH.unshift(File.expand_path("lib"))
+  require "strscan"
+  str = "test string"
+  scanner = StringScanner.new(str)
+  str = "string"
+  reg = /string/
+benchmark:
+  check_until(reg): |
+    scanner.check_until(reg)
+  check_until(str): |
+    scanner.check_until(str)
+  exist?(reg): |
+    scanner.exist?(reg)
+  exist?(str): |
+    scanner.exist?(str)
diff --git a/benchmark/bm_securerandom.rb b/benchmark/securerandom.rb
index a082ea6d5b..a082ea6d5b 100644
--- a/benchmark/bm_securerandom.rb
+++ b/benchmark/securerandom.rb
diff --git a/benchmark/set.yml b/benchmark/set.yml
new file mode 100644
index 0000000000..061509cb1f
--- /dev/null
+++ b/benchmark/set.yml
@@ -0,0 +1,261 @@
+prelude: |
+  # First 1000 digits of pi
+  pi = <<~END.gsub(/\D/, '')
+    31415926535897932384626433832795028841971693993751058209749445923078164062862089
+    98628034825342117067982148086513282306647093844609550582231725359408128481117450
+    28410270193852110555964462294895493038196442881097566593344612847564823378678316
+    52712019091456485669234603486104543266482133936072602491412737245870066063155881
+    74881520920962829254091715364367892590360011330530548820466521384146951941511609
+    43305727036575959195309218611738193261179310511854807446237996274956735188575272
+    48912279381830119491298336733624406566430860213949463952247371907021798609437027
+    70539217176293176752384674818467669405132000568127145263560827785771342757789609
+    17363717872146844090122495343014654958537105079227968925892354201995611212902196
+    08640344181598136297747713099605187072113499999983729780499510597317328160963185
+    95024459455346908302642522308253344685035261931188171010003137838752886587533208
+    38142061717766914730359825349042875546873115956286388235378759375195778185778053
+    21712268066130019278766111959092164201989380952572010654505906988788448549
+  END
+  array1 = 10.times.flat_map do |i|
+    pi[i...].chars.each_slice(10).map(&:join)
+  end
+  array2 = array1.map(&:reverse)
+  array1.map!(&:to_i)
+  array2.map!(&:to_i)
+  a1 = array1[...10]
+  a2 = array1[...100]
+  a3 = array1
+  oa1 = array2[...10]
+  oa2 = array2[...100]
+  oa3 = array2
+  s0 = Set.new
+  s0 = Set.new
+  s1 = Set.new(a1)
+  s2 = Set.new(a2)
+  s3 = Set.new(a3)
+  o0 = Set.new
+  o1 = Set.new(array2[...10])
+  o2 = Set.new(array2[...100])
+  o3 = Set.new(array2)
+  d0 = s0.dup
+  d1 = s1.dup
+  d2 = s2.dup
+  d3 = s3.dup
+  ss1 = s1 - a1[-1..-1]
+  ss2 = s2 - a2[-1..-1]
+  ss3 = s3 - a3[-1..-1]
+  os1 = o1 - oa1[-1..-1]
+  os2 = o2 - oa2[-1..-1]
+  os3 = o3 - oa3[-1..-1]
+  member = a1.first
+  cbi = s0.dup.compare_by_identity
+  ns = Set[s3, o3, d3]
+  set_subclass = Class.new(Set)
+
+benchmark:
+  new_0: Set.new
+  new_10: Set.new(a1)
+  new_100: Set.new(a2)
+  new_1000: Set.new(a3)
+  aref_0: Set[]
+  aref_10: Set[*a1]
+  aref_100: Set[*a2]
+  aref_1000: Set[*a3]
+  amp_0: s0 & o0
+  amp_10: s1 & o1
+  amp_100: s2 & o2
+  amp_1000: s3 & o3
+  amp_same_0: s0 & d0
+  amp_same_10: s1 & d1
+  amp_same_100: s2 & d2
+  amp_same_1000: s3 & d3
+  minus_0: s0 - o0
+  minus_10: s1 - o1
+  minus_100: s2 - o2
+  minus_1000: s3 - o3
+  minus_same_0: s0 - d0
+  minus_same_10: s1 - d1
+  minus_same_100: s2 - d2
+  minus_same_1000: s3 - d3
+  spaceship_0: s0 <=> o0
+  spaceship_diff_10: s1 <=> o1
+  spaceship_diff_100: s2 <=> o2
+  spaceship_diff_1000: s2 <=> o3
+  spaceship_sub_10: s1 <=> ss1
+  spaceship_sub_100: s2 <=> ss2
+  spaceship_sub_1000: s2 <=> ss3
+  spaceship_sup_10: ss1 <=> s1
+  spaceship_sup_100: ss2 <=> s2
+  spaceship_sup_1000: ss2 <=> s3
+  eq_0: s0 == o0
+  eq_10: s1 == o1
+  eq_100: s2 == o2
+  eq_1000: s3 == o3
+  eq_same_0: s0 == d0
+  eq_same_10: s1 == d1
+  eq_same_100: s2 == d2
+  eq_same_1000: s3 == d3
+  xor_0: s0 ^ o0
+  xor_10: s1 ^ o1
+  xor_100: s2 ^ o2
+  xor_1000: s3 ^ o3
+  xor_same_0: s0 ^ d0
+  xor_same_10: s1 ^ d1
+  xor_same_100: s2 ^ d2
+  xor_same_1000: s3 ^ d3
+  pipe_0: s0 | o0
+  pipe_10: s1 | o1
+  pipe_100: s2 | o2
+  pipe_1000: s3 | o3
+  pipe_same_0: s0 | d0
+  pipe_same_10: s1 | d1
+  pipe_same_100: s2 | d2
+  pipe_same_1000: s3 | d3
+  add: a3.each { s0.add(it) }
+  add_exist: a3.each { s3.add(it) }
+  addq: a3.each { s0.add?(it) }
+  addq_exist: a3.each { s3.add?(it) }
+  classify_0: s0.classify { it }
+  classify_10: s1.classify { it & 2 }
+  classify_100: s2.classify { it & 8 }
+  classify_1000: s3.classify { it & 32 }
+  clear: s0.clear
+  collect_0: s0.collect! { it }
+  collect_10: s1.collect! { it }
+  collect_100: s2.collect! { it }
+  collect_1000: s3.collect! { it }
+  compare_by_identity_0: s0.dup.compare_by_identity
+  compare_by_identity_10: s1.dup.compare_by_identity
+  compare_by_identity_100: s2.dup.compare_by_identity
+  compare_by_identity_1000: s3.dup.compare_by_identity
+  compare_by_identityq_false: s0.compare_by_identity?
+  compare_by_identityq_true: cbi.compare_by_identity?
+  clone_0: s0.clone
+  clone_10: s1.clone
+  clone_100: s2.clone
+  clone_1000: s3.clone
+  delete: a3.each { s3.delete(it) }
+  delete_not_exist: a3.each { o3.delete(it) }
+  deleteq: a3.each { s3.delete?(it) }
+  deleteq_not_exist: a3.each { o3.delete?(it) }
+  delete_if_0: s0.delete_if { it }
+  delete_if_10: s1.delete_if { it & 2 == 0 }
+  delete_if_100: s2.delete_if { it & 2 == 0 }
+  delete_if_1000: s3.delete_if { it & 2 == 0 }
+  disjoint_0: s0.disjoint? o0
+  disjoint_10: s1.disjoint? o1
+  disjoint_100: s2.disjoint? o2
+  disjoint_1000: s3.disjoint? o3
+  disjoint_same_0: s0.disjoint? d0
+  disjoint_same_10: s1.disjoint? d1
+  disjoint_same_100: s2.disjoint? d2
+  disjoint_same_1000: s3.disjoint? d3
+  divide_1arity_0: s0.divide { true }
+  divide_1arity_10: s1.divide { it & 2 }
+  divide_1arity_100: s2.divide { it & 8 }
+  divide_1arity_1000: s3.divide { it & 32 }
+  divide_2arity_0: s0.divide { true }
+  divide_2arity_10: s1.divide { (_1 & 2) == (_2 & 2) }
+  divide_2arity_100: s2.divide { (_1 & 8) == (_2 & 8) }
+  divide_2arity_1000: s3.divide { (_1 & 32) == (_2 & 32) }
+  dup_0: s0.dup
+  dup_10: s1.dup
+  dup_100: s2.dup
+  dup_1000: s3.dup
+  each_0: s0.each { it }
+  each_10: s1.each { it }
+  each_100: s2.each { it }
+  each_1000: s3.each { it }
+  empty_true: s0.empty?
+  empty_false: s3.empty?
+  flatten: ns.flatten
+  flattenb: ns.flatten!
+  include_true_0: s0.include? member
+  include_true_10: s1.include? member
+  include_true_100: s2.include? member
+  include_true_1000: s3.include? member
+  include_false_0: s0.include?(-1)
+  include_false_10: s1.include?(-1)
+  include_false_100: s2.include?(-1)
+  include_false_1000: s3.include?(-1)
+  intersect_0: s0.intersect? o0
+  intersect_10: s1.intersect? o1
+  intersect_100: s2.intersect? o2
+  intersect_1000: s3.intersect? o3
+  intersect_same_0: s0.intersect? d0
+  intersect_same_10: s1.intersect? d1
+  intersect_same_100: s2.intersect? d2
+  intersect_same_1000: s3.intersect? d3
+  join_0: s0.join
+  join_10: s1.join
+  join_100: s2.join
+  join_1000: s3.join
+  join_arg_0: s0.join ""
+  join_arg_10: s1.join ""
+  join_arg_100: s2.join ""
+  join_arg_1000: s3.join ""
+  keep_if_0: s0.keep_if { it }
+  keep_if_10: s1.keep_if { it & 2 == 0 }
+  keep_if_100: s2.keep_if { it & 2 == 0 }
+  keep_if_1000: s3.keep_if { it & 2 == 0 }
+  merge_set: s0.dup.merge(s3, o3)
+  merge_enum: s0.dup.merge(array1, array2)
+  proper_subset_0: s0.proper_subset? s0
+  proper_subset_10: s1.proper_subset? ss1
+  proper_subset_100: s2.proper_subset? ss2
+  proper_subset_1000: s3.proper_subset? ss3
+  proper_subset_false_10: s1.proper_subset? os1
+  proper_subset_false_100: s2.proper_subset? os2
+  proper_subset_false_1000: s3.proper_subset? os3
+  proper_superset_0: s0.proper_superset? s0
+  proper_superset_10: ss1.proper_superset? s1
+  proper_superset_100: ss2.proper_superset? s2
+  proper_superset_1000: ss3.proper_superset? s3
+  proper_superset_false_10: os1.proper_superset? s1
+  proper_superset_false_100: os2.proper_superset? s2
+  proper_superset_false_1000: os3.proper_superset? s3
+  reject_0: s0.reject! { it }
+  reject_10: s1.reject! { it & 2 == 0 }
+  reject_100: s2.reject! { it & 2 == 0 }
+  reject_1000: s3.reject! { it & 2 == 0 }
+  replace_0: s = Set.new; array1.each { s.replace(s0) }
+  replace_10: s = Set.new; array1.each { s.replace(s1) }
+  replace_100: s = Set.new; array1.each { s.replace(s2) }
+  replace_1000: s = Set.new; array1.each { s.replace(s3) }
+  reset_0: s0.reset
+  reset_10: s1.reset
+  reset_100: s2.reset
+  reset_1000: s3.reset
+  select_0: s0.select! { it }
+  select_10: s1.select! { it & 2 == 0 }
+  select_100: s2.select! { it & 2 == 0 }
+  select_1000: s3.select! { it & 2 == 0 }
+  size_0: s0.size
+  size_10: s1.size
+  size_100: s2.size
+  size_1000: s3.size
+  subtract_set: s3.dup.subtract(os3)
+  subtract_enum: s3.dup.subtract(oa3)
+  subtract_same_set: s3.dup.subtract(s3)
+  subtract_same_enum: s3.dup.subtract(a3)
+  subset_0: s0.subset? s0
+  subset_10: s1.subset? ss1
+  subset_100: s2.subset? ss2
+  subset_1000: s3.subset? ss3
+  subset_false_10: s1.subset? os1
+  subset_false_100: s2.subset? os2
+  subset_false_1000: s3.subset? os3
+  superset_0: s0.superset? s0
+  superset_10: ss1.superset? s1
+  superset_100: ss2.superset? s2
+  superset_1000: ss3.superset? s3
+  superset_false_10: os1.superset? s1
+  superset_false_100: os2.superset? s2
+  superset_false_1000: os3.superset? s3
+  to_a_0: s0.to_a
+  to_a_10: s1.to_a
+  to_a_100: s2.to_a
+  to_a_1000: s3.to_a
+  to_set_0: s0.to_set
+  to_set_10: s1.to_set
+  to_set_100: s2.to_set
+  to_set_1000: s3.to_set
diff --git a/benchmark/so_ackermann.rb b/benchmark/so_ackermann.rb
new file mode 100644
index 0000000000..4effa1ecaf
--- /dev/null
+++ b/benchmark/so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/so_array.rb b/benchmark/so_array.rb
new file mode 100644
index 0000000000..767e03db5f
--- /dev/null
+++ b/benchmark/so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+  x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+  (n-1).step(0,-1) do |bi|
+    y[bi] += x.at(bi)
+  end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/so_binary_trees.rb
index b1693e4109..b1693e4109 100644
--- a/benchmark/bm_so_binary_trees.rb
+++ b/benchmark/so_binary_trees.rb
diff --git a/benchmark/so_concatenate.rb b/benchmark/so_concatenate.rb
new file mode 100644
index 0000000000..4468e20ac8
--- /dev/null
+++ b/benchmark/so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+  i += 1
+  hello = ''
+  4_000_000.times do |e|
+    hello << STUFF
+  end
+end
+# puts hello.length
+
+
diff --git a/benchmark/so_count_words.yml b/benchmark/so_count_words.yml
new file mode 100644
index 0000000000..f7322a8541
--- /dev/null
+++ b/benchmark/so_count_words.yml
@@ -0,0 +1,66 @@
+prelude: |
+  #!/usr/bin/ruby
+
+  wc_input_base = <<EOS
+  Subject:      Re: Who was Izchak Miller?
+  From:         "Jane D. Anonymous" <nobody@yale.edu>
+  Date:         1996/04/28
+  Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
+  References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+  To:           75176.2330@compuserve.com
+  Content-Type: text/plain; charset=us-ascii
+  Organization: Yale University
+  X-Url:        news:4lk6vl$gde@ns.oar.net
+  Mime-Version: 1.0
+  Newsgroups:   rec.games.roguelike.nethack
+  X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
+
+  Hello there,  Izchak Miller was my  father.  When I was  younger I spent
+  many  a night,  hunched over  the keyboard  with a  cup of  tea, playing
+  nethack with him and my brother.  my dad was a philosopher with a strong
+  weakness for fantasy/sci fi.  I remember when he started to get involved
+  with the  Nethack team- my  brother's Dungeons and Dragons  monster book
+  found a regular place beside my dad's  desk. it's nice to see him living
+  on in the game he loved so much :-).
+                                                                    Tamar Miller
+
+  The following is a really long word of 5000 characters:
+
+  wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
+  EOS
+
+  # prepare 'wc.input'
+
+  def prepare_wc_input(wcbase)
+    wcinput = File.join(File.dirname($0), 'wc.input')
+    unless FileTest.exist?(wcinput)
+      data = wcbase.dup
+      13.times{
+        data << data
+      }
+      File.write(wcinput, data)
+    end
+    at_exit {File.unlink(wcinput) rescue nil}
+  end
+
+  prepare_wc_input(wc_input_base)
+
+benchmark:
+  so_count_words: |
+    # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+    # http://www.bagley.org/~doug/shootout/
+    # with help from Paul Brannan
+
+    nl = nw = nc = 0
+    File.open(File.join(File.dirname($0), 'wc.input'), 'rb') do |input|
+      while tmp = input.read(4096)
+        data = tmp << (input.gets || "")
+        nc += data.length
+        nl += data.count("\n")
+        ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+        nw += data.count(" ") + 1
+      end
+    end
+    # STDERR.puts "#{nl} #{nw} #{nc}"
+
+loop_count: 1
diff --git a/benchmark/so_exception.rb b/benchmark/so_exception.rb
new file mode 100644
index 0000000000..eb205b4df1
--- /dev/null
+++ b/benchmark/so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+class Hi_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+def some_function(num)
+  begin
+    hi_function(num)
+  rescue
+    print "We shouldn't get here, exception is: #{$!.type}\n"
+  end
+end
+
+def hi_function(num)
+  begin
+    lo_function(num)
+  rescue Hi_Exception
+    $HI = $HI + 1
+  end
+end
+
+def lo_function(num)
+  begin
+    blowup(num)
+  rescue Lo_Exception
+    $LO = $LO + 1
+  end
+end
+
+def blowup(num)
+  if num % 2 == 0
+    raise Lo_Exception.new(num)
+  else
+    raise Hi_Exception.new(num)
+  end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+  i += 1
+  some_function(i+1)
+end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/so_fannkuch.rb
index bac5ecd44c..bac5ecd44c 100644
--- a/benchmark/bm_so_fannkuch.rb
+++ b/benchmark/so_fannkuch.rb
diff --git a/benchmark/so_fasta.rb b/benchmark/so_fasta.rb
new file mode 100644
index 0000000000..dcc6b39507
--- /dev/null
+++ b/benchmark/so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random(max, im=139968, ia=3877, ic=29573)
+    (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+    ["a", 0.27],
+    ["c", 0.12],
+    ["g", 0.12],
+    ["t", 0.27],
+
+    ["B", 0.02],
+    ["D", 0.02],
+    ["H", 0.02],
+    ["K", 0.02],
+    ["M", 0.02],
+    ["N", 0.02],
+    ["R", 0.02],
+    ["S", 0.02],
+    ["V", 0.02],
+    ["W", 0.02],
+    ["Y", 0.02],
+]
+homosapiens = [
+    ["a", 0.3029549426680],
+    ["c", 0.1979883004921],
+    ["g", 0.1975473066391],
+    ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+    puts ">#{id} #{desc}"
+    v = nil
+    width = 60
+    l = src.length
+    s = src * ((n / l) + 1)
+    s.slice!(n, l)
+    puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+    puts ">#{id} #{desc}"
+    rand, v = nil,nil
+    width = 60
+    chunk = 1 * width
+    prob = 0.0
+    table.each{|v| v[1]= (prob += v[1])}
+    for i in 1..(n/width)
+        puts((1..width).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+    if n%width != 0
+        puts((1..(n%width)).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
new file mode 100644
index 0000000000..d7df086c39
--- /dev/null
+++ b/benchmark/so_k_nucleotide.yml
@@ -0,0 +1,155 @@
+prelude: |
+  bm_so_fasta = <<'EOS'
+  # The Computer Language Shootout
+  # http://shootout.alioth.debian.org/
+  # Contributed by Sokolov Yura
+
+  $last = 42.0
+  def gen_random(max, im=139968, ia=3877, ic=29573)
+      (max * ($last = ($last * ia + ic) % im)) / im
+  end
+
+  alu =
+     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+  iub = [
+      ["a", 0.27],
+      ["c", 0.12],
+      ["g", 0.12],
+      ["t", 0.27],
+
+      ["B", 0.02],
+      ["D", 0.02],
+      ["H", 0.02],
+      ["K", 0.02],
+      ["M", 0.02],
+      ["N", 0.02],
+      ["R", 0.02],
+      ["S", 0.02],
+      ["V", 0.02],
+      ["W", 0.02],
+      ["Y", 0.02],
+  ]
+  homosapiens = [
+      ["a", 0.3029549426680],
+      ["c", 0.1979883004921],
+      ["g", 0.1975473066391],
+      ["t", 0.3015094502008],
+  ]
+
+  def make_repeat_fasta(id, desc, src, n)
+      puts ">#{id} #{desc}"
+      v = nil
+      width = 60
+      l = src.length
+      s = src * ((n / l) + 1)
+      s.slice!(n, l)
+      puts(s.scan(/.{1,#{width}}/).join("\n"))
+  end
+
+  def make_random_fasta(id, desc, table, n)
+      puts ">#{id} #{desc}"
+      rand, v = nil,nil
+      width = 60
+      chunk = 1 * width
+      prob = 0.0
+      table.each{|v| v[1]= (prob += v[1])}
+      for i in 1..(n/width)
+          puts((1..width).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+      if n%width != 0
+          puts((1..(n%width)).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+  end
+
+
+  n = (ARGV[0] or 250_000).to_i
+
+  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+  EOS
+benchmark:
+  - name: so_k_nucleotide
+    prelude: |
+      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+      File.write(script, bm_so_fasta)
+
+      def prepare_fasta_output n
+        filebase = File.join(File.dirname($0), 'fasta.output')
+        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+        file = "#{filebase}.#{n}"
+
+        unless FileTest.exist?(file)
+          STDERR.puts "preparing #{file}"
+
+          open(file, 'w'){|f|
+            ARGV[0] = n
+            $stdout = f
+            load script
+            $stdout = STDOUT
+          }
+        end
+      end
+      prepare_fasta_output(100_000)
+    script: |
+      # The Computer Language Shootout
+      # http://shootout.alioth.debian.org
+      #
+      # contributed by jose fco. gonzalez
+      # modified by Sokolov Yura
+
+      seq = String.new
+
+      def frecuency( seq,length )
+          n, table = seq.length - length + 1, Hash.new(0)
+          f, i = nil, nil
+          (0 ... length).each do |f|
+              (f ... n).step(length) do |i|
+                  table[seq[i,length]] += 1
+              end
+          end
+          [n,table]
+
+      end
+
+      def sort_by_freq( seq,length )
+          n,table = frecuency( seq,length )
+          a, b, v = nil, nil, nil
+          table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+              puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+          end
+          puts
+      end
+
+      def find_seq( seq,s )
+          n,table = frecuency( seq,s.length )
+          puts "#{table[s].to_s}\t#{s.upcase}"
+      end
+
+      input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+      line = input.gets while line !~ /^>THREE/
+      line = input.gets
+
+      while (line !~ /^>/) & line do
+          seq << line.chomp
+          line = input.gets
+      end
+
+      [1,2].each {|i| sort_by_freq( seq,i ) }
+
+      %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+    loop_count: 1
diff --git a/benchmark/bm_so_lists.rb b/benchmark/so_lists.rb
index e8f4a2a5f7..e8f4a2a5f7 100644
--- a/benchmark/bm_so_lists.rb
+++ b/benchmark/so_lists.rb
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/so_mandelbrot.rb
index 76331c64b8..76331c64b8 100644
--- a/benchmark/bm_so_mandelbrot.rb
+++ b/benchmark/so_mandelbrot.rb
diff --git a/benchmark/so_matrix.rb b/benchmark/so_matrix.rb
new file mode 100644
index 0000000000..2d1e72bda9
--- /dev/null
+++ b/benchmark/so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+    count = 1
+    mx = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            row[j] = count
+            count += 1
+        end
+        mx[bi] = row
+    end
+    mx
+end
+
+def mmult(rows, cols, m1, m2)
+    m3 = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            val = 0
+            (0 .. (cols - 1)).each do |k|
+                val += m1.at(bi).at(k) * m2.at(k).at(j)
+            end
+            row[j] = val
+        end
+        m3[bi] = row
+    end
+    m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+    mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/so_meteor_contest.rb b/benchmark/so_meteor_contest.rb
new file mode 100644
index 0000000000..d8c8e3ab9c
--- /dev/null
+++ b/benchmark/so_meteor_contest.rb
@@ -0,0 +1,563 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+#   http://shootout.alioth.debian.org
+#   contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM:  the main body is at the bottom.
+#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+#   2) see how I represent a board as a bitmask by reading the blank_board comments
+#   3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+  # an array (by location) containing a bit mask for how the piece maps at the given location.
+  # if the rotation is invalid at that location the mask will contain false
+  attr_reader :start_masks
+
+  # maps a direction to a relative location.  these differ depending on whether it is an even or
+  # odd row being mapped from
+  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+  def initialize( directions )
+    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+    @even_mask = mask_for_offsets( @even_offsets)
+    @odd_mask = mask_for_offsets( @odd_offsets)
+
+    @start_masks = Array.new(60)
+
+    # create the rotational masks by placing the base mask at the location and seeing if
+    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
+    # is true the piece cannot be placed
+    0.upto(59) do | offset |
+      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+        imask = compute_required( mask, offset)
+        @start_masks[offset] = [ mask, imask, imask | mask ]
+      else
+        @start_masks[offset] = false
+      end
+    end
+  end
+
+  def compute_required( mask, offset )
+    board = blank_board
+    0.upto(offset) { | i | board |= 1 << i }
+    board |= mask
+    return 0 if (!prunable(board | mask, offset))
+    board = flood_fill(board,58)
+    count = 0
+    imask = 0
+    0.upto(59) do | i |
+      if (board[i] == 0) then
+        imask |= (1 << i)
+        count += 1
+      end
+    end
+    (count > 0 && count < 5) ? imask : 0
+  end
+
+  def flood_fill( board, location)
+    return board if (board[location] == 1)
+    board |= 1 << location
+    row, col = location.divmod(6)
+    board = flood_fill( board, location - 1) if (col > 0)
+    board = flood_fill( board, location + 1) if (col < 4)
+    if (row % 2 == 0) then
+      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+    else
+      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+    end
+    board
+  end
+
+  # given a location, produces a list of relative locations covered by the piece at this rotation
+  def offsets( location)
+    if is_even( location) then
+      @even_offsets.collect { | value | value + location }
+    else
+      @odd_offsets.collect { | value | value + location }
+    end
+  end
+
+  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+  # this is hard to explain. imagine we have this partial board:
+  #   0 0 0 0 0 x        [positions 0-5]
+  #    0 0 1 1 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 1 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # The top-left of the piece is at position 8, the
+  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
+  #   0 0 0 1 1 x        [positions 0-5]
+  #    0 0 1 0 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 0 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+  # this function would return
+  def normalize_offsets( values)
+    min = values.min
+    even_min = is_even(min)
+    other_min = even_min ? min + 6 : min + 7
+    other_values = values.collect do | value |
+      if is_even(value) then
+        value + 6 - other_min
+      else
+        value + 7 - other_min
+      end
+    end
+    values.collect! { | value | value - min }
+
+    if even_min then
+      [values, other_values]
+    else
+      [other_values, values]
+    end
+  end
+
+  # produce a bitmask representation of an array of offset locations
+  def mask_for_offsets( offsets )
+    mask = 0
+    offsets.each { | value | mask = mask + ( 1 << value ) }
+    mask
+  end
+
+  # finds a "safe" position that a position as described by a list of directions can be placed
+  # without falling off any edge of the board.  the values returned a location to place the first piece
+  # at so it will fit after making the described moves
+  def start_adjust( directions )
+    south = east = 0;
+    directions.each do | direction |
+      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+      south += 1 if ( direction == :nw || direction == :ne )
+    end
+    south * 6 + east
+  end
+
+  # given a set of directions places the piece (as defined by a set of directions) on the board at
+  # a location that will not take it off the edge
+  def get_values( directions )
+    start = start_adjust(directions)
+    values = [ start ]
+    directions.each do | direction |
+      if (start % 12 >= 6) then
+        start += @@rotation_odd_adder[direction]
+      else
+        start += @@rotation_even_adder[direction]
+      end
+      values += [ start ]
+    end
+
+    # some moves take you back to an existing location, we'll strip duplicates
+    values.uniq
+  end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+#   rotations -- all the rotations of the piece
+#   type -- a numeic "name" of the piece
+#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
+#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+  attr_reader :rotations, :type, :masks
+  attr_accessor :placed
+
+  # transform hashes that change one direction into another when you either flip or rotate a set of directions
+  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+  def initialize( directions, type )
+    @type = type
+    @rotations = Array.new();
+    @map = {}
+
+    generate_rotations( directions )
+    directions.collect! { | value | @@flip_converter[value] }
+    generate_rotations( directions )
+
+    # creates the masks AND a map that returns [location, rotation] for any given mask
+    # this is used when a board is found and we want to draw it, otherwise the map is unused
+    @masks = Array.new();
+    0.upto(59) do | i |
+      even = true
+      @masks[i] = @rotations.collect do | rotation |
+        mask = rotation.start_masks[i]
+        @map[mask[0]] = [ i, rotation ] if (mask)
+        mask || nil
+      end
+      @masks[i].compact!
+    end
+  end
+
+  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+  def generate_rotations( directions )
+    6.times do
+      rotations.push( Rotation.new(directions))
+      directions.collect! { | value | @@rotate_converter[value] }
+    end
+  end
+
+  # given a board string, adds this piece to the board at whatever location/rotation
+  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+  def fill_string( board_string)
+    location, rotation = @map[@placed]
+    rotation.offsets(location).each do | offset |
+      row, col = offset.divmod(6)
+      board_string[ row*5 + col, 1 ] = @type.to_s
+    end
+  end
+end
+
+# a blank bit board having this form:
+#
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+  0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+  0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+  (location % 12) < 6
+end
+
+# support function that create three utility maps:
+#  $converter -- for each row an array that maps a five bit row (via array mapping)
+#                to the a five bit representation of the bits below it
+#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+#                   a region array has three values the first is a mask of bits in the region,
+#                   the second is the count of those bits and the third is identical to the first
+#                   examples:
+#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+#                           0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+  all_odds = Array.new(0b100000)
+  all_evens = Array.new(0b100000)
+  bit_counts = Array.new(0b100000)
+  new_regions = Array.new(0b100000)
+  0.upto(0b11111) do | i |
+    bit_count = odd = even = 0
+    0.upto(4) do | bit |
+      if (i[bit] == 1) then
+        bit_count += 1
+        odd |= odd_map[bit]
+        even |= even_map[bit]
+      end
+    end
+    all_odds[i] = odd
+    all_evens[i] = even
+    bit_counts[i] = bit_count
+    new_regions[i] = create_regions( i)
+  end
+
+  $converter = []
+  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+  $bit_counts = bit_counts
+  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five.  The following board is an example of a prunable board:
+#    0 0 1 0 0
+#     0 1 0 0 0
+#    1 1 0 0 0
+#     0 1 0 0 0
+#    0 0 0 0 0
+#       ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
+#   location -- starting location, everything above and to the left is already full
+#   slotting -- set to true only when testing initial pieces, when filling normally
+#               additional assumptions are possible
+#
+# Algorithm:
+#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
+#    maintainng counts of active open areas (kept in the collector array) each collector contains
+#    three values at the start of an iteration:
+#          0: mask of bits that would be adjacent to the collector in this row
+#          1: the number of bits collected so far
+#          2: a scratch space starting as zero, but used during the computation to represent
+#             the empty bits in the new row that are adjacent (position 0)
+#  The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+  collectors = []
+  # loop across the rows
+  (location / 6).to_i.upto(9) do | row_on |
+    # obtain a set of regions representing the bits of the current row.
+    regions = $regions[(board >> (row_on * 6)) & 0b11111]
+    converter = $converter[row_on]
+
+    # track the number of collectors at the start of the cycle so that
+    # we don't compute against newly created collectors, only existing collectors
+    initial_collector_count = collectors.length
+
+    # loop against the regions.  For each region of the row
+    # we will see if it connects to one or more existing collectors.
+    # if it connects to 1 collector, the bits from the region are added to the
+    # bits of the collector and the mask is placed in collector[2]
+    # If the region overlaps more than one collector then all the collectors
+    # it overlaps with are merged into the first one (the others are set to nil in the array)
+    # if NO collectors are found then the region is copied as a new collector
+    regions.each do | region |
+      collector_found = nil
+      region_mask = region[2]
+      initial_collector_count.times do | collector_num |
+        collector = collectors[collector_num]
+        if (collector) then
+          collector_mask = collector[0]
+          if (collector_mask & region_mask != 0) then
+            if (collector_found) then
+              collector_found[0] |= collector_mask
+              collector_found[1] += collector[1]
+              collector_found[2] |= collector[2]
+              collectors[collector_num] = nil
+            else
+              collector_found = collector
+              collector[1] += region[1]
+              collector[2] |= region_mask
+            end
+          end
+        end
+      end
+      if (collector_found == nil) then
+        collectors.push(Array.new(region))
+      end
+    end
+
+    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
+    # the board is prunable.  if it is a multiple of five it is removed.
+    # Collector that are still active have a new adjacent value [0] set based n the matched bits
+    # and have [2] cleared out for the next cycle.
+    collectors.length.times do | collector_num |
+      collector = collectors[collector_num]
+      if (collector) then
+        if (collector[2] == 0) then
+          return true if (collector[1] % 5 != 0)
+          collectors[collector_num] = nil
+        else
+          # if a collector matches all bits in the row then we can return unprunable early for the
+          # following reasons:
+          #    1) there can be no more unavailable bits bince we fill from the top left downward
+          #    2) all previous regions have been closed or joined so only this region can fail
+          #    3) this region must be good since there can never be only 1 region that is nuot
+          #       a multiple of five
+          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+          # in pieces to see what configurations work for them (the only other time this algorithm is used).
+          return false if (collector[2] == 0b11111 && !slotting)
+          collector[0] = converter[collector[2]]
+          collector[2] = 0
+        end
+      end
+    end
+
+    # get rid of all the empty converters for the next round
+    collectors.compact!
+  end
+  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask.  see prunable for what a "region" is
+def create_regions( value )
+  regions = []
+  cur_region = 0
+  5.times do | bit |
+    if (value[bit] == 0) then
+      cur_region |= 1 << bit
+    else
+      if (cur_region != 0 ) then
+        regions.push( cur_region)
+        cur_region = 0;
+      end
+    end
+  end
+  regions.push(cur_region) if (cur_region != 0)
+  regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+  find_top( 1)
+  find_top( 0)
+  print_results
+end
+
+# show the board
+def print_results
+  print "#{@boards_found} solutions found\n\n"
+  print_full_board( @min_board)
+  print "\n"
+  print_full_board( @max_board)
+  print "\n"
+end
+
+# finds solutions.  This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece.  It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
+#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
+#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
+#   diminish over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
+#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+#   maximum number
+def find_top( rotation_skip)
+  board = blank_board
+  (@pieces.length-1).times do
+    piece = @pieces.shift
+    piece.masks[0].each do | mask, imask, cmask |
+      if ((rotation_skip += 1) % 2 == 0) then
+        piece.placed = mask
+        find( 1, 1, board | mask)
+      end
+    end
+    @pieces.push(piece)
+  end
+  piece = @pieces.shift
+  @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+#  start_location -- where to start looking for place for the next piece at
+#  placed -- number of pieces placed
+#  board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+  # find the next location to place a piece by looking for an empty bit
+  while board[start_location] == 1
+    start_location += 1
+  end
+
+  @pieces.length.times do
+    piece = @pieces.shift
+    piece.masks[start_location].each do | mask, imask, cmask |
+      if ( board & cmask == imask) then
+        piece.placed = mask
+        if (placed == 9) then
+          add_board
+        else
+          find( start_location + 1, placed + 1, board | mask)
+        end
+      end
+    end
+    @pieces.push(piece)
+  end
+end
+
+# print the board
+def print_full_board( board_string)
+  10.times do | row |
+    print " " if (row % 2 == 1)
+    5.times do | col |
+      print "#{board_string[row*5 + col,1]} "
+    end
+    print "\n"
+  end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+  board_string = "99999999999999999999999999999999999999999999999999"
+  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
+  save( board_string)
+  save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+  if (@all_boards[board_string] == nil) then
+    @min_board = board_string if (board_string < @min_board)
+    @max_board = board_string if (board_string > @max_board)
+    @all_boards.store(board_string,true)
+    @boards_found += 1
+
+    # the exit motif is a time saver.  Ideally the function should return, but those tests
+    # take noticeable time (performance).
+    if (@boards_found == @stop_count) then
+      print_results
+      exit(0)
+    end
+  end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+  Piece.new( [ :nw, :ne, :east, :east ], 2),
+  Piece.new( [ :ne, :se, :east, :ne ], 7),
+  Piece.new( [ :ne, :east, :ne, :nw ], 1),
+  Piece.new( [ :east, :sw, :sw, :se ], 6),
+  Piece.new( [ :east, :ne, :se, :ne ], 5),
+  Piece.new( [ :east, :east, :east, :se ], 0),
+  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+  Piece.new( [ :se, :se, :se, :west ], 9),
+  Piece.new( [ :se, :se, :east, :se ], 8),
+  Piece.new( [ :east, :east, :sw, :se ], 3)
+  ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
diff --git a/benchmark/so_nbody.rb b/benchmark/so_nbody.rb
new file mode 100644
index 0000000000..9884fc4edc
--- /dev/null
+++ b/benchmark/so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+  attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+  def initialize(x, y, z, vx, vy, vz, mass)
+    @x, @y, @z = x, y, z
+    @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+    @mass = mass * SOLAR_MASS
+  end
+
+  def move_from_i(bodies, nbodies, dt, i)
+    while i < nbodies
+      b2 = bodies[i]
+      dx = @x - b2.x
+      dy = @y - b2.y
+      dz = @z - b2.z
+
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      mag = dt / (distance * distance * distance)
+      b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+      @vx -= dx * b2_mass_mag
+      @vy -= dy * b2_mass_mag
+      @vz -= dz * b2_mass_mag
+      b2.vx += dx * b_mass_mag
+      b2.vy += dy * b_mass_mag
+      b2.vz += dz * b_mass_mag
+      i += 1
+    end
+
+    @x += dt * @vx
+    @y += dt * @vy
+    @z += dt * @vz
+  end
+end
+
+def energy(bodies)
+  e = 0.0
+  nbodies = bodies.size
+
+  for i in 0 ... nbodies
+    b = bodies[i]
+    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+    for j in (i + 1) ... nbodies
+      b2 = bodies[j]
+      dx = b.x - b2.x
+      dy = b.y - b2.y
+      dz = b.z - b2.z
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      e -= (b.mass * b2.mass) / distance
+    end
+  end
+  e
+end
+
+def offset_momentum(bodies)
+  px, py, pz = 0.0, 0.0, 0.0
+
+  for b in bodies
+    m = b.mass
+    px += b.vx * m
+    py += b.vy * m
+    pz += b.vz * m
+  end
+
+  b = bodies[0]
+  b.vx = - px / SOLAR_MASS
+  b.vy = - py / SOLAR_MASS
+  b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+  # sun
+  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+  # jupiter
+  Planet.new(
+    4.84143144246472090e+00,
+    -1.16032004402742839e+00,
+    -1.03622044471123109e-01,
+    1.66007664274403694e-03,
+    7.69901118419740425e-03,
+    -6.90460016972063023e-05,
+    9.54791938424326609e-04),
+
+  # saturn
+  Planet.new(
+    8.34336671824457987e+00,
+    4.12479856412430479e+00,
+    -4.03523417114321381e-01,
+    -2.76742510726862411e-03,
+    4.99852801234917238e-03,
+    2.30417297573763929e-05,
+    2.85885980666130812e-04),
+
+  # uranus
+  Planet.new(
+    1.28943695621391310e+01,
+    -1.51111514016986312e+01,
+    -2.23307578892655734e-01,
+    2.96460137564761618e-03,
+    2.37847173959480950e-03,
+    -2.96589568540237556e-05,
+    4.36624404335156298e-05),
+
+  # neptune
+  Planet.new(
+    1.53796971148509165e+01,
+    -2.59193146099879641e+01,
+    1.79258772950371181e-01,
+    2.68067772490389322e-03,
+    1.62824170038242295e-03,
+    -9.51592254519715870e-05,
+    5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+  i = 0
+  while i < nbodies
+    b = BODIES[i]
+    b.move_from_i(BODIES, nbodies, dt, i + 1)
+    i += 1
+  end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/so_nested_loop.rb b/benchmark/so_nested_loop.rb
new file mode 100644
index 0000000000..766fcf7b84
--- /dev/null
+++ b/benchmark/so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+    n.times do
+        n.times do
+            n.times do
+                n.times do
+                    n.times do
+                        x += 1
+                    end
+                end
+            end
+        end
+    end
+end
+# puts x
+
+
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/so_nsieve.rb
index a65cc78233..a65cc78233 100644
--- a/benchmark/bm_so_nsieve.rb
+++ b/benchmark/so_nsieve.rb
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/so_nsieve_bits.rb
index 6f958ee44e..6f958ee44e 100644
--- a/benchmark/bm_so_nsieve_bits.rb
+++ b/benchmark/so_nsieve_bits.rb
diff --git a/benchmark/so_object.rb b/benchmark/so_object.rb
new file mode 100644
index 0000000000..131f44624c
--- /dev/null
+++ b/benchmark/so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+    def initialize(start_state)
+        @bool = start_state
+    end
+
+    def value
+        @bool
+    end
+
+    def activate
+        @bool = !@bool
+        self
+    end
+end
+
+class NthToggle < Toggle
+    def initialize(start_state, max_counter)
+        super start_state
+        @count_max = max_counter
+        @counter = 0
+    end
+
+    def activate
+        @counter += 1
+        if @counter >= @count_max
+            @bool = !@bool
+            @counter = 0
+        end
+        self
+    end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+    toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+    ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/so_partial_sums.rb
index 630b45cb8d..630b45cb8d 100644
--- a/benchmark/bm_so_partial_sums.rb
+++ b/benchmark/so_partial_sums.rb
diff --git a/benchmark/so_pidigits.rb b/benchmark/so_pidigits.rb
new file mode 100644
index 0000000000..9a537b2d1c
--- /dev/null
+++ b/benchmark/so_pidigits.rb
@@ -0,0 +1,92 @@
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+    def initialize()
+        @z = Transformation.new 1,0,0,1
+        @x = Transformation.new 0,0,0,0
+        @inverse = Transformation.new 0,0,0,0
+    end
+
+    def next!
+        @y = @z.extract(3)
+        if safe? @y
+            @z = produce(@y)
+            @y
+        else
+            @z = consume @x.next!()
+            next!()
+        end
+    end
+
+    def safe?(digit)
+        digit == @z.extract(4)
+    end
+
+    def produce(i)
+        @inverse.qrst(10,-10*i,0,1).compose(@z)
+    end
+
+    def consume(a)
+        @z.compose(a)
+    end
+end
+
+
+class Transformation
+    attr_reader :q, :r, :s, :t
+    def initialize(q, r, s, t)
+        @q,@r,@s,@t,@k = q,r,s,t,0
+    end
+
+    def next!()
+        @q = @k = @k + 1
+        @r = 4 * @k + 2
+        @s = 0
+        @t = 2 * @k + 1
+        self
+    end
+
+    def extract(j)
+        (@q * j + @r) / (@s * j + @t)
+    end
+
+    def compose(a)
+        self.class.new( @q * a.q,
+                        @q * a.r + r * a.t,
+                        @s * a.q + t * a.s,
+                        @s * a.r + t * a.t
+                    )
+    end
+
+    def qrst *args
+        initialize *args
+        self
+    end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+    if n >= WIDTH
+        WIDTH.times {print digits.next!}
+        j += WIDTH
+    else
+        n.times {print digits.next!}
+        (WIDTH-n).times {print " "}
+        j += n
+    end
+    puts "\t:"+j.to_s
+    n -= WIDTH
+end
+
diff --git a/benchmark/bm_so_random.rb b/benchmark/so_random.rb
index a66b9e8e63..a66b9e8e63 100644
--- a/benchmark/bm_so_random.rb
+++ b/benchmark/so_random.rb
diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml
new file mode 100644
index 0000000000..de05eedfc4
--- /dev/null
+++ b/benchmark/so_reverse_complement.yml
@@ -0,0 +1,137 @@
+prelude: |
+  bm_so_fasta = <<'EOS'
+  # The Computer Language Shootout
+  # http://shootout.alioth.debian.org/
+  # Contributed by Sokolov Yura
+
+  $last = 42.0
+  def gen_random(max, im=139968, ia=3877, ic=29573)
+      (max * ($last = ($last * ia + ic) % im)) / im
+  end
+
+  alu =
+     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+  iub = [
+      ["a", 0.27],
+      ["c", 0.12],
+      ["g", 0.12],
+      ["t", 0.27],
+
+      ["B", 0.02],
+      ["D", 0.02],
+      ["H", 0.02],
+      ["K", 0.02],
+      ["M", 0.02],
+      ["N", 0.02],
+      ["R", 0.02],
+      ["S", 0.02],
+      ["V", 0.02],
+      ["W", 0.02],
+      ["Y", 0.02],
+  ]
+  homosapiens = [
+      ["a", 0.3029549426680],
+      ["c", 0.1979883004921],
+      ["g", 0.1975473066391],
+      ["t", 0.3015094502008],
+  ]
+
+  def make_repeat_fasta(id, desc, src, n)
+      puts ">#{id} #{desc}"
+      v = nil
+      width = 60
+      l = src.length
+      s = src * ((n / l) + 1)
+      s.slice!(n, l)
+      puts(s.scan(/.{1,#{width}}/).join("\n"))
+  end
+
+  def make_random_fasta(id, desc, table, n)
+      puts ">#{id} #{desc}"
+      rand, v = nil,nil
+      width = 60
+      chunk = 1 * width
+      prob = 0.0
+      table.each{|v| v[1]= (prob += v[1])}
+      for i in 1..(n/width)
+          puts((1..width).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+      if n%width != 0
+          puts((1..(n%width)).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+  end
+
+
+  n = (ARGV[0] or 250_000).to_i
+
+  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+  EOS
+benchmark:
+  - name: so_reverse_complement
+    prelude: |
+      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+      File.write(script, bm_so_fasta)
+
+      def prepare_fasta_output n
+        filebase = File.join(File.dirname($0), 'fasta.output')
+        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+        file = "#{filebase}.#{n}"
+
+        unless FileTest.exist?(file)
+          STDERR.puts "preparing #{file}"
+
+          open(file, 'w'){|f|
+            ARGV[0] = n
+            $stdout = f
+            load script
+            $stdout = STDOUT
+          }
+        end
+      end
+      prepare_fasta_output(2_500_000)
+    script: |
+      # The Great Computer Language Shootout
+      # http://shootout.alioth.debian.org/
+      #
+      # Contributed by Peter Bjarke Olsen
+      # Modified by Doug King
+
+      seq=Array.new
+
+      def revcomp(seq)
+        seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+        stringlen=seq.length
+        0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+      end
+
+      input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+      while input.gets
+        if $_ =~ />/
+          if seq.length != 0
+            revcomp(seq.join)
+            seq=Array.new
+          end
+          puts $_
+        else
+          $_.sub(/\n/,'')
+          seq.push $_
+        end
+      end
+      revcomp(seq.join)
+    loop_count: 1
diff --git a/benchmark/bm_so_sieve.rb b/benchmark/so_sieve.rb
index 43dc302648..43dc302648 100644
--- a/benchmark/bm_so_sieve.rb
+++ b/benchmark/so_sieve.rb
diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/so_spectralnorm.rb
index 6b97206689..6b97206689 100644
--- a/benchmark/bm_so_spectralnorm.rb
+++ b/benchmark/so_spectralnorm.rb
diff --git a/benchmark/string_capitalize.yml b/benchmark/string_capitalize.yml
new file mode 100644
index 0000000000..7d23fd3d35
--- /dev/null
+++ b/benchmark/string_capitalize.yml
@@ -0,0 +1,10 @@
+prelude: |
+  str1 = [*"a".."m",*"N".."Z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+benchmark:
+  capitalize-1: str1.capitalize
+  capitalize-10: str10.capitalize
+  capitalize-100: str100.capitalize
+  capitalize-1000: str1000.capitalize
diff --git a/benchmark/string_casecmp.yml b/benchmark/string_casecmp.yml
new file mode 100644
index 0000000000..88a3555c8a
--- /dev/null
+++ b/benchmark/string_casecmp.yml
@@ -0,0 +1,28 @@
+prelude: |
+  lstr1 = [*"a".."z",*"0".."9"].join("")
+  lstr10 = lstr1 * 10
+  lstr100 = lstr10 * 10
+  lstr1000 = lstr100 * 10
+  lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  lnonascii10 = lnonascii1 * 10
+  lnonascii100 = lnonascii10 * 10
+  lnonascii1000 = lnonascii100 * 10
+  ustr1 = [*"A".."Z",*"0".."9"].join("")
+  ustr10 = ustr1 * 10
+  ustr100 = ustr10 * 10
+  ustr1000 = ustr100 * 10
+  unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  unonascii10 = unonascii1 * 10
+  unonascii100 = unonascii10 * 10
+  unonascii1000 = unonascii100 * 10
+benchmark:
+  casecmp-1: lstr1.casecmp(ustr1)
+  casecmp-10: lstr10.casecmp(ustr10)
+  casecmp-100: lstr100.casecmp(ustr100)
+  casecmp-1000: lstr1000.casecmp(ustr1000)
+  casecmp-1000vs10: lstr1000.casecmp(ustr10)
+  casecmp-nonascii1: lnonascii1.casecmp(unonascii1)
+  casecmp-nonascii10: lnonascii10.casecmp(unonascii10)
+  casecmp-nonascii100: lnonascii100.casecmp(unonascii100)
+  casecmp-nonascii1000: lnonascii1000.casecmp(unonascii1000)
+  casecmp-nonascii1000vs10: lnonascii1000.casecmp(unonascii10)
diff --git a/benchmark/string_casecmp_p.yml b/benchmark/string_casecmp_p.yml
new file mode 100644
index 0000000000..a790ce7d55
--- /dev/null
+++ b/benchmark/string_casecmp_p.yml
@@ -0,0 +1,26 @@
+prelude: |
+  lstr1 = [*"a".."z",*"0".."9"].join("")
+  lstr10 = lstr1 * 10
+  lstr100 = lstr10 * 10
+  lstr1000 = lstr100 * 10
+  lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  lnonascii10 = lnonascii1 * 10
+  lnonascii100 = lnonascii10 * 10
+  lnonascii1000 = lnonascii100 * 10
+  ustr1 = [*"A".."Z",*"0".."9"].join("")
+  ustr10 = ustr1 * 10
+  ustr100 = ustr10 * 10
+  ustr1000 = ustr100 * 10
+  unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  unonascii10 = unonascii1 * 10
+  unonascii100 = unonascii10 * 10
+  unonascii1000 = unonascii100 * 10
+benchmark:
+  casecmp_p-1: lstr1.casecmp?(ustr1)
+  casecmp_p-10: lstr10.casecmp?(ustr10)
+  casecmp_p-100: lstr100.casecmp?(ustr100)
+  casecmp_p-1000: lstr1000.casecmp?(ustr1000)
+  casecmp_p-nonascii1: lnonascii1.casecmp?(unonascii1)
+  casecmp_p-nonascii10: lnonascii10.casecmp?(unonascii10)
+  casecmp_p-nonascii100: lnonascii100.casecmp?(unonascii100)
+  casecmp_p-nonascii1000: lnonascii1000.casecmp?(unonascii1000)
diff --git a/benchmark/string_concat.yml b/benchmark/string_concat.yml
new file mode 100644
index 0000000000..f11f95ee9a
--- /dev/null
+++ b/benchmark/string_concat.yml
@@ -0,0 +1,51 @@
+prelude: |
+  CHUNK = "a" * 64
+  UCHUNK = "é" * 32
+  SHORT = "a" * (GC::INTERNAL_CONSTANTS[:BASE_SLOT_SIZE] / 2)
+  LONG = "a" * (GC::INTERNAL_CONSTANTS[:BASE_SLOT_SIZE] * 2)
+  GC.disable # GC causes a lot of variance
+benchmark:
+  binary_concat_7bit: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::BINARY)
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+  utf8_concat_7bit: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+  utf8_concat_UTF8: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+  interpolation: |
+    buffer = "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}"
+  interpolation_same_heap: |
+    buffer = "#{SHORT}#{SHORT}"
+  interpolation_switching_heaps: |
+    buffer = "#{SHORT}#{LONG}"
diff --git a/benchmark/string_downcase.yml b/benchmark/string_downcase.yml
new file mode 100644
index 0000000000..1fea6afbec
--- /dev/null
+++ b/benchmark/string_downcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"A".."Z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  downcase-1: str1.upcase
+  downcase-10: str10.upcase
+  downcase-100: str100.upcase
+  downcase-1000: str1000.upcase
+  downcase-nonascii1: nonascii1.downcase
+  downcase-nonascii10: nonascii10.downcase
+  downcase-nonascii100: nonascii100.downcase
+  downcase-nonascii1000: nonascii1000.downcase
diff --git a/benchmark/string_dup.yml b/benchmark/string_dup.yml
new file mode 100644
index 0000000000..90793f9f2a
--- /dev/null
+++ b/benchmark/string_dup.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  uplus: |
+    +"A"
+  dup: |
+    "A".dup
diff --git a/benchmark/string_fstring.yml b/benchmark/string_fstring.yml
new file mode 100644
index 0000000000..cafef1f3fe
--- /dev/null
+++ b/benchmark/string_fstring.yml
@@ -0,0 +1,16 @@
+benchmark:
+  fstring_random: |
+    i = 0
+    str = "same".dup
+    while i < 5_000_000
+      -(i.to_s.freeze)
+      i += 1
+    end
+  fstring_same: |
+    i = 0
+    str = "same".dup
+    while i < 10_000_000
+      -str
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/string_gsub.yml b/benchmark/string_gsub.yml
new file mode 100644
index 0000000000..0f964337dd
--- /dev/null
+++ b/benchmark/string_gsub.yml
@@ -0,0 +1,43 @@
+prelude: |
+  # frozen_string_literal: true
+  STR = ((("a" * 31) + "<") * 1000).freeze
+  STR_UNICODE = ((("a" * 30) + "\u2028") * 1000).freeze
+  ESCAPED_CHARS_BINARY = {
+    "\u2028".b => '\u2028'.b,
+    "\u2029".b => '\u2029'.b,
+    ">".b => '\u003e'.b.freeze,
+    "<".b => '\u003c'.b.freeze,
+    "&".b => '\u0026'.b.freeze,
+  }
+  BINARY_PATTERN = Regexp.union(ESCAPED_CHARS_BINARY.keys)
+
+  ESCAPED_CHARS = {
+    "\u2028" => '\u2028',
+    "\u2029" => '\u2029',
+    ">" => '\u003e',
+    "<" => '\u003c',
+    "&" => '\u0026',
+  }
+  ESCAPE_PATTERN = Regexp.union(ESCAPED_CHARS.keys)
+
+
+benchmark:
+  escape: |
+    str = STR.dup
+    str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)
+    str
+
+  escape_bin: |
+    str = STR.b
+    str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)
+    str.force_encoding(Encoding::UTF_8)
+
+  escape_utf8: |
+    str = STR_UNICODE.dup
+    str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)
+    str
+
+  escape_utf8_bin: |
+    str = STR_UNICODE.b
+    str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)
+    str.force_encoding(Encoding::UTF_8)
diff --git a/benchmark/string_index.rb b/benchmark/string_index.rb
new file mode 100644
index 0000000000..7783111082
--- /dev/null
+++ b/benchmark/string_index.rb
@@ -0,0 +1,3 @@
+str1 = "あ" * 1024 + "い" # not single byte optimizable
+str2 = "い"
+100_000.times { str1.index(str2) }
diff --git a/benchmark/string_rpartition.yml b/benchmark/string_rpartition.yml
new file mode 100644
index 0000000000..37e9d1b071
--- /dev/null
+++ b/benchmark/string_rpartition.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"a".."z",*"0".."9"].join("")
+  str10 = str1 * 10 + ":"
+  str100 = str1 * 100 + ":"
+  str1000 = str1 * 1000 + ":"
+  nonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10 + ":"
+  nonascii100 = nonascii1 * 100 + ":"
+  nonascii1000 = nonascii1 * 1000 + ":"
+benchmark:
+  rpartition-1: str1.rpartition(":")
+  rpartition-10: str10.rpartition(":")
+  rpartition-100: str100.rpartition(":")
+  rpartition-1000: str1000.rpartition(":")
+  rpartition-nonascii1: nonascii1.rpartition(":")
+  rpartition-nonascii10: nonascii10.rpartition(":")
+  rpartition-nonascii100: nonascii100.rpartition(":")
+  rpartition-nonascii1000: nonascii1000.rpartition(":")
diff --git a/benchmark/string_scan_re.rb b/benchmark/string_scan_re.rb
new file mode 100644
index 0000000000..b0d60201a9
--- /dev/null
+++ b/benchmark/string_scan_re.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan(/abc/) }
diff --git a/benchmark/string_scan_str.rb b/benchmark/string_scan_str.rb
new file mode 100644
index 0000000000..42440bd948
--- /dev/null
+++ b/benchmark/string_scan_str.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan('abc') }
diff --git a/benchmark/string_slice.yml b/benchmark/string_slice.yml
new file mode 100644
index 0000000000..fc2393c5d1
--- /dev/null
+++ b/benchmark/string_slice.yml
@@ -0,0 +1,11 @@
+prelude: |
+  long_string = "x"*1000+"-hår"
+benchmark:
+  regexp-short: |
+    "x-hår".slice!(/-(.)(.)(.)/, 3)
+  regexp-long: |
+    long_string.dup.slice!(/-(.)(.)(.)/, 3)
+  string-short: |
+    "x-hår".slice!("r")
+  string-long: |
+    long_string.dup.slice!("r")
diff --git a/benchmark/string_split.yml b/benchmark/string_split.yml
new file mode 100644
index 0000000000..cc2c7d7855
--- /dev/null
+++ b/benchmark/string_split.yml
@@ -0,0 +1,22 @@
+prelude: |
+  str1 = [*0..5].join(" ") + " "
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+benchmark:
+  to_chars-1: str1.split('')
+  to_chars-10: str10.split('')
+  to_chars-100: str100.split('')
+  to_chars-1000: str1000.split('')
+  to_words-1: str1.split(' ')
+  to_words-10: str10.split(' ')
+  to_words-100: str100.split(' ')
+  to_words-1000: str1000.split(' ')
+  re_chars-1: str1.split(//)
+  re_chars-10: str10.split(//)
+  re_chars-100: str100.split(//)
+  re_chars-1000: str1000.split(//)
+  re_space-1: str1.split(/ /)
+  re_space-10: str10.split(/ /)
+  re_space-100: str100.split(/ /)
+  re_space-1000: str1000.split(/ /)
diff --git a/benchmark/string_swapcase.yml b/benchmark/string_swapcase.yml
new file mode 100644
index 0000000000..eeb5928907
--- /dev/null
+++ b/benchmark/string_swapcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"A".."M",*"n".."z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{c0}".."\u{cf}",*"\u{f0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  swapcase-1: str1.swapcase
+  swapcase-10: str10.swapcase
+  swapcase-100: str100.swapcase
+  swapcase-1000: str1000.swapcase
+  swapcase-nonascii1: nonascii1.swapcase
+  swapcase-nonascii10: nonascii10.swapcase
+  swapcase-nonascii100: nonascii100.swapcase
+  swapcase-nonascii1000: nonascii1000.swapcase
diff --git a/benchmark/string_upcase.yml b/benchmark/string_upcase.yml
new file mode 100644
index 0000000000..dab84bbde2
--- /dev/null
+++ b/benchmark/string_upcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"a".."z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  upcase-1: str1.upcase
+  upcase-10: str10.upcase
+  upcase-100: str100.upcase
+  upcase-1000: str1000.upcase
+  upcase-nonascii1: nonascii1.upcase
+  upcase-nonascii10: nonascii10.upcase
+  upcase-nonascii100: nonascii100.upcase
+  upcase-nonascii1000: nonascii1000.upcase
diff --git a/benchmark/struct_accessor.yml b/benchmark/struct_accessor.yml
new file mode 100644
index 0000000000..d95240e2dd
--- /dev/null
+++ b/benchmark/struct_accessor.yml
@@ -0,0 +1,37 @@
+prelude: |
+  C = Struct.new(:x) do
+    def initialize(...)
+      super
+      @ivar = 42
+    end
+
+    attr_accessor :ivar
+
+    class_eval <<-END
+      def r
+        #{'x;'*256}
+      end
+      def w
+        #{'self.x = nil;'*256}
+      end
+      def rm
+        m = method(:x)
+        #{'m.call;'*256}
+      end
+      def wm
+        m = method(:x=)
+        #{'m.call(nil);'*256}
+      end
+      def r_ivar
+        #{'ivar;'*256}
+      end
+    END
+  end
+  C.new(nil) # ensure common shape is known
+  obj = C.new(nil)
+benchmark:
+  member_reader: "obj.r"
+  member_writer: "obj.w"
+  member_reader_method: "obj.rm"
+  member_writer_method: "obj.wm"
+  ivar_reader: "obj.r_ivar"
diff --git a/benchmark/time_at.yml b/benchmark/time_at.yml
new file mode 100644
index 0000000000..3247efbe77
--- /dev/null
+++ b/benchmark/time_at.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  - 'Time.at(0)'
+  - 'Time.at(0, 500)'
+  - 'Time.at(0, in: "+09:00")'
+  - 'Time.at(0, 500, in: "+09:00")'
diff --git a/benchmark/time_new.yml b/benchmark/time_new.yml
new file mode 100644
index 0000000000..5947dd3a41
--- /dev/null
+++ b/benchmark/time_new.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - 'Time.new(2021)'
+  - 'Time.new(2021, 8, 22)'
+  - 'Time.new(2021, 8, 22, in: "+09:00")'
diff --git a/benchmark/time_now.yml b/benchmark/time_now.yml
new file mode 100644
index 0000000000..9336877cd4
--- /dev/null
+++ b/benchmark/time_now.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - 'Time.now'
+  - 'Time.now(in: "+09:00")'
+  - 'Time.now.year'
diff --git a/benchmark/time_parse.yml b/benchmark/time_parse.yml
new file mode 100644
index 0000000000..6060b58bc6
--- /dev/null
+++ b/benchmark/time_parse.yml
@@ -0,0 +1,10 @@
+prelude: |
+  require 'time'
+  inspect = "2021-08-23 09:57:02 +0900"
+  iso8601 = "2021-08-23T09:57:02+09:00"
+benchmark:
+  - Time.iso8601(iso8601)
+  - Time.parse(iso8601)
+  - Time.parse(inspect)
+  - Time.new(iso8601) rescue Time.iso8601(iso8601)
+  - Time.new(inspect) rescue Time.parse(inspect)
diff --git a/benchmark/time_strftime.yml b/benchmark/time_strftime.yml
new file mode 100644
index 0000000000..28f62aec87
--- /dev/null
+++ b/benchmark/time_strftime.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+  time = Time.now
+benchmark:
+  - time.strftime("%FT%T")     # 19B
+  - time.strftime("%FT%T.%3N") # 23B
+  - time.strftime("%FT%T.%6N") # 26B
diff --git a/benchmark/time_strptime.yml b/benchmark/time_strptime.yml
new file mode 100644
index 0000000000..8d89ebb7a7
--- /dev/null
+++ b/benchmark/time_strptime.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'time'
+benchmark:
+  - Time.strptime("28/Aug/2005:06:54:20 +0000", "%d/%b/%Y:%T %z")
+  - Time.strptime("1", "%s")
+  - Time.strptime("0 +0100", "%s %z")
+  - Time.strptime("0 UTC", "%s %z")
+  - Time.strptime("1.5", "%s.%N")
+  - Time.strptime("1.000000000001", "%s.%N")
+  - Time.strptime("20010203 -0200", "%Y%m%d %z")
+  - Time.strptime("20010203 UTC", "%Y%m%d %z")
+  - Time.strptime("2018-365", "%Y-%j")
+  - Time.strptime("2018-091", "%Y-%j")
diff --git a/benchmark/time_subsec.rb b/benchmark/time_subsec.rb
new file mode 100644
index 0000000000..505021c701
--- /dev/null
+++ b/benchmark/time_subsec.rb
@@ -0,0 +1,2 @@
+t = Time.now
+4000000.times { t.subsec }
diff --git a/benchmark/time_xmlschema.yml b/benchmark/time_xmlschema.yml
new file mode 100644
index 0000000000..654e5cfcbc
--- /dev/null
+++ b/benchmark/time_xmlschema.yml
@@ -0,0 +1,27 @@
+prelude: |
+  # frozen_string_literal
+  unless Time.method_defined?(:xmlschema)
+    class Time
+      def xmlschema(fraction_digits=0)
+        fraction_digits = fraction_digits.to_i
+        s = strftime("%FT%T")
+        if fraction_digits > 0
+          s << strftime(".%#{fraction_digits}N")
+        end
+        s << (utc? ? 'Z' : strftime("%:z"))
+      end
+    end
+  end
+  time = Time.now
+  utc_time = Time.now.utc
+  fraction_sec = Time.at(123456789.quo(9999999999)).getlocal("+09:00")
+  future_time = Time.utc(10000)
+benchmark:
+  - time.xmlschema
+  - utc_time.xmlschema
+  - time.xmlschema(6)
+  - utc_time.xmlschema(6)
+  - time.xmlschema(9)
+  - utc_time.xmlschema(9)
+  - fraction_sec.xmlschema(10)
+  - future_time.xmlschema
diff --git a/benchmark/vm_array.yml b/benchmark/vm_array.yml
new file mode 100644
index 0000000000..2a177237ef
--- /dev/null
+++ b/benchmark/vm_array.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_array: |
+    a = [1,2,3,4,5,6,7,8,9,10]
+loop_count: 6000000
diff --git a/benchmark/vm_attr_ivar.yml b/benchmark/vm_attr_ivar.yml
new file mode 100644
index 0000000000..75b803478e
--- /dev/null
+++ b/benchmark/vm_attr_ivar.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    attr_reader :a, :b
+    def initialize
+      @a = nil
+      @b = nil
+    end
+  end
+  obj = C.new
+benchmark:
+  vm_attr_ivar: |
+    j = obj.a
+    k = obj.b
+loop_count: 30000000
diff --git a/benchmark/vm_attr_ivar_set.yml b/benchmark/vm_attr_ivar_set.yml
new file mode 100644
index 0000000000..a0d379b18a
--- /dev/null
+++ b/benchmark/vm_attr_ivar_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    attr_accessor :a, :b
+    def initialize
+      @a = nil
+      @b = nil
+    end
+  end
+  obj = C.new
+benchmark:
+  vm_attr_ivar_set: |
+    obj.a = 1
+    obj.b = 2
+loop_count: 30000000
diff --git a/benchmark/bm_vm3_backtrace.rb b/benchmark/vm_backtrace.rb
index 0fbf73e1ca..0fbf73e1ca 100644
--- a/benchmark/bm_vm3_backtrace.rb
+++ b/benchmark/vm_backtrace.rb
diff --git a/benchmark/vm_bigarray.yml b/benchmark/vm_bigarray.yml
new file mode 100644
index 0000000000..8b2d3f3443
--- /dev/null
+++ b/benchmark/vm_bigarray.yml
@@ -0,0 +1,105 @@
+benchmark:
+  vm_bigarray: |
+    a = [
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+    ]
+loop_count: 6000000
diff --git a/benchmark/vm_bighash.yml b/benchmark/vm_bighash.yml
new file mode 100644
index 0000000000..4dacfde793
--- /dev/null
+++ b/benchmark/vm_bighash.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_bighash: |
+    a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+loop_count: 60000
diff --git a/benchmark/vm_block.yml b/benchmark/vm_block.yml
new file mode 100644
index 0000000000..68b3e40bf5
--- /dev/null
+++ b/benchmark/vm_block.yml
@@ -0,0 +1,9 @@
+prelude: |
+  def m
+    yield
+  end
+benchmark:
+  vm_block: |
+    m{
+    }
+loop_count: 30000000
diff --git a/benchmark/vm_block_handler.yml b/benchmark/vm_block_handler.yml
new file mode 100644
index 0000000000..461d7953ad
--- /dev/null
+++ b/benchmark/vm_block_handler.yml
@@ -0,0 +1,27 @@
+# :FIXME: is there a way to benchmark block_handler_type_ifunc?
+
+prelude: |
+  p = proc{_1}
+  o = Object.new
+  def o.each
+    i = 0
+    while i < 3_000_000 do
+      yield i
+      i += 1
+    end
+  end
+
+benchmark:
+  - name: block_handler_type_iseq
+    script: |
+      o.each{_1}
+
+  - name: block_handler_type_symbol
+    script: |
+      o.each(&:itself)
+
+  - name: block_handler_type_proc
+    script: |
+      o.each(&p)
+
+loop_count: 1
diff --git a/benchmark/vm_blockparam.yml b/benchmark/vm_blockparam.yml
new file mode 100644
index 0000000000..5e5a0170a2
--- /dev/null
+++ b/benchmark/vm_blockparam.yml
@@ -0,0 +1,7 @@
+prelude: |
+  def m &b
+  end
+benchmark:
+  vm_blockparam: |
+    m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_call.yml b/benchmark/vm_blockparam_call.yml
new file mode 100644
index 0000000000..a7d8d366ea
--- /dev/null
+++ b/benchmark/vm_blockparam_call.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def m &b
+    b.call
+  end
+benchmark:
+  vm_blockparam_call: |
+    m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_pass.yml b/benchmark/vm_blockparam_pass.yml
new file mode 100644
index 0000000000..841f5e7a63
--- /dev/null
+++ b/benchmark/vm_blockparam_pass.yml
@@ -0,0 +1,12 @@
+prelude: |
+  def bp_yield
+    yield
+  end
+
+  def bp_pass &b
+    bp_yield &b
+  end
+benchmark:
+  vm_blockparam_pass: |
+    bp_pass{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_yield.yml b/benchmark/vm_blockparam_yield.yml
new file mode 100644
index 0000000000..8ea9b46ed2
--- /dev/null
+++ b/benchmark/vm_blockparam_yield.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def bp_yield &b
+    yield
+  end
+benchmark:
+  vm_blockparam_yield: |
+    bp_yield{}
+loop_count: 30000000
diff --git a/benchmark/vm_call_bmethod.yml b/benchmark/vm_call_bmethod.yml
new file mode 100644
index 0000000000..40136e5aa4
--- /dev/null
+++ b/benchmark/vm_call_bmethod.yml
@@ -0,0 +1,37 @@
+prelude: |
+  define_method(:a0){}
+  define_method(:a1){|a| a}
+  define_method(:s){|*a| a}
+  define_method(:b){|kw: 1| kw}
+
+  t0 = 0.times.to_a
+  t1 = 1.times.to_a
+  t10 = 10.times.to_a
+  t100 = 100.times.to_a
+  kw = {kw: 2}
+benchmark:
+  bmethod_simple_0: |
+    a0
+  bmethod_simple_1: |
+    a1(1)
+  bmethod_simple_0_splat: |
+    a0(*t0)
+  bmethod_simple_1_splat: |
+    a1(*t1)
+  bmethod_no_splat: |
+    s
+  bmethod_0_splat: |
+    s(*t0)
+  bmethod_1_splat: |
+    s(*t1)
+  bmethod_10_splat: |
+    s(*t10)
+  bmethod_100_splat: |
+    s(*t100)
+  bmethod_kw: |
+    b(kw: 1)
+  bmethod_no_kw: |
+    b
+  bmethod_kw_splat: |
+    b(**kw)
+loop_count: 6000000
diff --git a/benchmark/vm_call_kw_and_kw_splat.yml b/benchmark/vm_call_kw_and_kw_splat.yml
new file mode 100644
index 0000000000..aa6e549e0c
--- /dev/null
+++ b/benchmark/vm_call_kw_and_kw_splat.yml
@@ -0,0 +1,25 @@
+prelude: |
+  h1, h10, h100, h1000 = [1, 10, 100, 1000].map do |n|
+    h = {kw: 1}
+    n.times{|i| h[i.to_s.to_sym] = i}
+    h
+  end
+  eh = {}
+  def kw(kw: nil, **kws) end
+benchmark:
+  1: |
+    kw(**h1)
+  1_mutable: |
+    kw(**eh, **h1)
+  10: |
+    kw(**h10)
+  10_mutable: |
+    kw(**eh, **h10)
+  100: |
+    kw(**h100)
+  100_mutable: |
+    kw(**eh, **h100)
+  1000: |
+    kw(**h1000)
+  1000_mutable: |
+    kw(**eh, **h1000)
diff --git a/benchmark/vm_call_method_missing.yml b/benchmark/vm_call_method_missing.yml
new file mode 100644
index 0000000000..f890796f11
--- /dev/null
+++ b/benchmark/vm_call_method_missing.yml
@@ -0,0 +1,62 @@
+prelude: |
+  class A0
+    def method_missing(m); m end
+  end
+  class A1
+    def method_missing(m, a) a; end
+  end
+  class S
+    def method_missing(m, *a) a; end
+  end
+  class B
+    def method_missing(m, kw: 1) kw end
+  end
+  class SB
+    def method_missing(m, *a, kw: 1) kw end
+  end
+
+  t0 = 0.times.to_a
+  t1 = 1.times.to_a
+  t10 = 10.times.to_a
+  t200 = 200.times.to_a
+  kw = {kw: 2}
+
+  a0 = A0.new
+  a1 = A1.new
+  s = S.new
+  b = B.new
+  sb = SB.new
+benchmark:
+  method_missing_simple_0: |
+    a0.()
+  method_missing_simple_1: |
+    a1.x(1)
+  method_missing_simple_0_splat: |
+    a0.(*t0)
+  method_missing_simple_1_splat: |
+    a1.(*t1)
+  method_missing_no_splat: |
+    s.()
+  method_missing_0_splat: |
+    s.(*t0)
+  method_missing_1_splat: |
+    s.(*t1)
+  method_missing_10_splat: |
+    s.(*t10)
+  method_missing_200_splat: |
+    s.(*t200)
+  method_missing_kw: |
+    b.(kw: 1)
+  method_missing_no_kw: |
+    b.()
+  method_missing_kw_splat: |
+    b.(**kw)
+  method_missing_0_splat_kw: |
+    sb.(*t0, **kw)
+  method_missing_1_splat_kw: |
+    sb.(*t1, **kw)
+  method_missing_10_splat_kw: |
+    sb.(*t10, **kw)
+  method_missing_200_splat_kw: |
+    sb.(*t200, **kw)
+loop_count: 1000000
diff --git a/benchmark/vm_call_send_iseq.yml b/benchmark/vm_call_send_iseq.yml
new file mode 100644
index 0000000000..60ff23c475
--- /dev/null
+++ b/benchmark/vm_call_send_iseq.yml
@@ -0,0 +1,77 @@
+prelude: |
+  def a0; end
+  def a1(a) a; end
+  def s(*a) a; end
+  def b(kw: 1) kw end
+  def sb(*a, kw: 1) kw end
+
+  t0 = 0.times.to_a
+  t1 = 1.times.to_a
+  t10 = 10.times.to_a
+  t200 = 200.times.to_a
+
+  a0_t0 = [:a0, *t0]
+  a1_t1 = [:a1, *t1]
+  s_t0 = [:s, *t0]
+  s_t1 = [:s, *t1]
+  s_t10 = [:s, *t10]
+  s_t200 = [:s, *t200]
+  sb_t0 = [:sb, *t0]
+  sb_t1 = [:sb, *t1]
+  sb_t10 = [:sb, *t10]
+  sb_t200 = [:sb, *t200]
+  kw = {kw: 2}
+benchmark:
+  send_simple_0: |
+    send(:a0)
+  send_simple_1: |
+    send(:a1, 1)
+  send_simple_0_splat: |
+    send(:a0, *t0)
+  send_simple_1_splat: |
+    send(:a1, *t1)
+  send_simple_0_splat_comb: |
+    send(*a0_t0)
+  send_simple_1_splat_comb: |
+    send(*a1_t1)
+  send_no_splat: |
+    send(:s)
+  send_0_splat: |
+    send(:s, *t0)
+  send_1_splat: |
+    send(:s, *t1)
+  send_10_splat: |
+    send(:s, *t10)
+  send_200_splat: |
+    send(:s, *t200)
+  send_0_splat_comb: |
+    send(*s_t0)
+  send_1_splat_comb: |
+    send(*s_t1)
+  send_10_splat_comb: |
+    send(*s_t10)
+  send_200_splat_comb: |
+    send(*s_t200)
+  send_kw: |
+    send(:b, kw: 1)
+  send_no_kw: |
+    send(:b)
+  send_kw_splat: |
+    send(:b, **kw)
+  send_0_splat_kw: |
+    send(:sb, *t0, **kw)
+  send_1_splat_kw: |
+    send(:sb, *t1, **kw)
+  send_10_splat_kw: |
+    send(:sb, *t10, **kw)
+  send_200_splat_kw: |
+    send(:sb, *t200, **kw)
+  send_0_splat_comb_kw: |
+    send(*sb_t0, **kw)
+  send_1_splat_comb_kw: |
+    send(*sb_t1, **kw)
+  send_10_splat_comb_kw: |
+    send(*sb_t10, **kw)
+  send_200_splat_comb_kw: |
+    send(*sb_t200, **kw)
+loop_count: 3000000
diff --git a/benchmark/vm_call_symproc.yml b/benchmark/vm_call_symproc.yml
new file mode 100644
index 0000000000..16e0ac579e
--- /dev/null
+++ b/benchmark/vm_call_symproc.yml
@@ -0,0 +1,83 @@
+prelude: |
+  def self.a0; end
+  def self.a1(a) a; end
+  def self.s(*a) a; end
+  def self.b(kw: 1) kw end
+  def self.sb(*a, kw: 1) kw end
+
+  t0 = 0.times.to_a
+  t1 = 1.times.to_a
+  t10 = 10.times.to_a
+  t200 = 200.times.to_a
+
+  a0_t0 = [self, *t0]
+  a1_t1 = [self, *t1]
+  s_t0 = [self, *t0]
+  s_t1 = [self, *t1]
+  s_t10 = [self, *t10]
+  s_t200 = [self, *t200]
+  sb_t0 = [self, *t0]
+  sb_t1 = [self, *t1]
+  sb_t10 = [self, *t10]
+  sb_t200 = [self, *t200]
+  kw = {kw: 2}
+
+  a0 = :a0.to_proc
+  a1 = :a1.to_proc
+  s = :s.to_proc
+  b = :b.to_proc
+  sb = :sb.to_proc
+benchmark:
+  symproc_simple_0: |
+    a0.(self)
+  symproc_simple_1: |
+    a1.(self, 1)
+  symproc_simple_0_splat: |
+    a0.(self, *t0)
+  symproc_simple_1_splat: |
+    a1.(self, *t1)
+  symproc_simple_0_splat_comb: |
+    a0.(*a0_t0)
+  symproc_simple_1_splat_comb: |
+    a1.(*a1_t1)
+  symproc_no_splat: |
+    s.(self)
+  symproc_0_splat: |
+    s.(self, *t0)
+  symproc_1_splat: |
+    s.(self, *t1)
+  symproc_10_splat: |
+    s.(self, *t10)
+  symproc_200_splat: |
+    s.(self, *t200)
+  symproc_0_splat_comb: |
+    s.(*s_t0)
+  symproc_1_splat_comb: |
+    s.(*s_t1)
+  symproc_10_splat_comb: |
+    s.(*s_t10)
+  symproc_200_splat_comb: |
+    s.(*s_t200)
+  symproc_kw: |
+    b.(self, kw: 1)
+  symproc_no_kw: |
+    b.(self)
+  symproc_kw_splat: |
+    b.(self, **kw)
+  symproc_0_splat_kw: |
+    sb.(self, *t0, **kw)
+  symproc_1_splat_kw: |
+    sb.(self, *t1, **kw)
+  symproc_10_splat_kw: |
+    sb.(self, *t10, **kw)
+  symproc_200_splat_kw: |
+    sb.(self, *t200, **kw)
+  symproc_0_splat_comb_kw: |
+    sb.(*sb_t0, **kw)
+  symproc_1_splat_comb_kw: |
+    sb.(*sb_t1, **kw)
+  symproc_10_splat_comb_kw: |
+    sb.(*sb_t10, **kw)
+  symproc_200_splat_comb_kw: |
+    sb.(*sb_t200, **kw)
+loop_count: 1000000
diff --git a/benchmark/vm_case.yml b/benchmark/vm_case.yml
new file mode 100644
index 0000000000..b26a491a15
--- /dev/null
+++ b/benchmark/vm_case.yml
@@ -0,0 +1,13 @@
+benchmark:
+  vm_case: |
+    case :foo
+    when :bar
+      raise
+    when :baz
+      raise
+    when :boo
+      raise
+    when :foo
+      # noop
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_case_classes.yml b/benchmark/vm_case_classes.yml
new file mode 100644
index 0000000000..cacc4f0464
--- /dev/null
+++ b/benchmark/vm_case_classes.yml
@@ -0,0 +1,9 @@
+benchmark:
+  vm_case_classes: |
+    case :foo
+    when Hash
+      raise
+    when Array
+      raise
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_case_lit.yml b/benchmark/vm_case_lit.yml
new file mode 100644
index 0000000000..9f91801544
--- /dev/null
+++ b/benchmark/vm_case_lit.yml
@@ -0,0 +1,23 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_case_lit: |
+    i = 0
+    @ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
+    def foo(i)
+      @ret[i % @ret.size]
+    end
+
+    while i<6_000_000
+      case foo(i)
+      when "foo" then :foo
+      when true then true
+      when false then false
+      when :sym then :sym
+      when 6 then :fix
+      when nil then nil
+      when 0.1 then :float
+      when 0xffffffffffffffff then :big
+      end
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/bm_vm3_clearmethodcache.rb b/benchmark/vm_clearmethodcache.rb
index 9661323cd2..9661323cd2 100644
--- a/benchmark/bm_vm3_clearmethodcache.rb
+++ b/benchmark/vm_clearmethodcache.rb
diff --git a/benchmark/vm_const.yml b/benchmark/vm_const.yml
new file mode 100644
index 0000000000..8939ca0cd3
--- /dev/null
+++ b/benchmark/vm_const.yml
@@ -0,0 +1,13 @@
+prelude: |
+  Const = 1
+  A = B = C = D = E = F = G = H = I = J = K = L = M = N = O = P = Q = R = S = T = U = V = W = X = Y = Z = 1
+  def foo
+    A; B; C; D; E; F; G; H; I; J; K; L; M; N; O; P; Q; R; S; T; U; V; W; X; Y; Z
+  end
+benchmark:
+  vm_const: |
+    j = Const
+    k = Const
+  vm_const_many: |
+    foo
+loop_count: 30000000
diff --git a/benchmark/vm_cvar.yml b/benchmark/vm_cvar.yml
new file mode 100644
index 0000000000..1d0e161829
--- /dev/null
+++ b/benchmark/vm_cvar.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class A
+    @@foo = 1
+
+    def self.foo
+      @@foo
+    end
+
+    ("A".."Z").each do |module_name|
+      eval <<-EOM
+        module #{module_name}
+        end
+
+        include #{module_name}
+      EOM
+    end
+  end
+benchmark:
+  vm_cvar: A.foo
+loop_count: 600000
diff --git a/benchmark/vm_defined_method.yml b/benchmark/vm_defined_method.yml
new file mode 100644
index 0000000000..347e0cfd33
--- /dev/null
+++ b/benchmark/vm_defined_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+  class Object
+    define_method(:m){}
+  end
+benchmark:
+  vm_defined_method: |
+    m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_dstr.yml b/benchmark/vm_dstr.yml
new file mode 100644
index 0000000000..30c7a3193c
--- /dev/null
+++ b/benchmark/vm_dstr.yml
@@ -0,0 +1,6 @@
+prelude: |
+  x = y = 'z'
+benchmark:
+  vm_dstr: |
+    str = "foo#{x}bar#{y}baz"
+loop_count: 6000000
diff --git a/benchmark/vm_dstr_ary.rb b/benchmark/vm_dstr_ary.rb
new file mode 100644
index 0000000000..1d3aa3b97b
--- /dev/null
+++ b/benchmark/vm_dstr_ary.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = []
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_bool.rb b/benchmark/vm_dstr_bool.rb
new file mode 100644
index 0000000000..631ca54755
--- /dev/null
+++ b/benchmark/vm_dstr_bool.rb
@@ -0,0 +1,7 @@
+i = 0
+x = true
+y = false
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_class_module.rb b/benchmark/vm_dstr_class_module.rb
new file mode 100644
index 0000000000..becf0861c7
--- /dev/null
+++ b/benchmark/vm_dstr_class_module.rb
@@ -0,0 +1,10 @@
+i = 0
+class A; end unless defined?(A)
+module B; end unless defined?(B)
+x = A
+y = B
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
+
diff --git a/benchmark/vm_dstr_digit.rb b/benchmark/vm_dstr_digit.rb
new file mode 100644
index 0000000000..caaa395192
--- /dev/null
+++ b/benchmark/vm_dstr_digit.rb
@@ -0,0 +1,7 @@
+i = 0
+x = 0
+y = 9
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_int.rb b/benchmark/vm_dstr_int.rb
new file mode 100644
index 0000000000..ed380d7595
--- /dev/null
+++ b/benchmark/vm_dstr_int.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{i}bar#{i}baz"
+end
diff --git a/benchmark/vm_dstr_nil.rb b/benchmark/vm_dstr_nil.rb
new file mode 100644
index 0000000000..ec4f5d6c67
--- /dev/null
+++ b/benchmark/vm_dstr_nil.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = nil
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj.rb b/benchmark/vm_dstr_obj.rb
new file mode 100644
index 0000000000..fb78637ead
--- /dev/null
+++ b/benchmark/vm_dstr_obj.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = Object.new
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj_def.rb b/benchmark/vm_dstr_obj_def.rb
new file mode 100644
index 0000000000..99ff7b98fb
--- /dev/null
+++ b/benchmark/vm_dstr_obj_def.rb
@@ -0,0 +1,8 @@
+i = 0
+o = Object.new
+def o.to_s; -""; end
+x = y = o
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_str.rb b/benchmark/vm_dstr_str.rb
new file mode 100644
index 0000000000..45fc107892
--- /dev/null
+++ b/benchmark/vm_dstr_str.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = ""
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_sym.rb b/benchmark/vm_dstr_sym.rb
new file mode 100644
index 0000000000..484b8f8150
--- /dev/null
+++ b/benchmark/vm_dstr_sym.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = :z
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_ensure.yml b/benchmark/vm_ensure.yml
new file mode 100644
index 0000000000..4ea62f30de
--- /dev/null
+++ b/benchmark/vm_ensure.yml
@@ -0,0 +1,14 @@
+# Not utilizing loop_count since using it for this is too unstable for now
+benchmark:
+  vm_ensure: |
+    i = 0
+    while i<30_000_000
+      i += 1
+      begin
+        begin
+        ensure
+        end
+      ensure
+      end
+    end
+loop_count: 1
diff --git a/benchmark/vm_eval.yml b/benchmark/vm_eval.yml
new file mode 100644
index 0000000000..7ba1a8d1de
--- /dev/null
+++ b/benchmark/vm_eval.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_eval: |
+    eval("1")
+loop_count: 6000000
diff --git a/benchmark/vm_fiber_allocate.yml b/benchmark/vm_fiber_allocate.yml
new file mode 100644
index 0000000000..b5a54e1ddf
--- /dev/null
+++ b/benchmark/vm_fiber_allocate.yml
@@ -0,0 +1,8 @@
+prelude: |
+  # Disable GC to see raw throughput:
+  GC.disable
+benchmark:
+  vm_fiber_allocate: |
+    fiber = Fiber.new{Fiber.yield}
+    fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_count.yml b/benchmark/vm_fiber_count.yml
new file mode 100644
index 0000000000..b83d3152d4
--- /dev/null
+++ b/benchmark/vm_fiber_count.yml
@@ -0,0 +1,10 @@
+# On Linux, you will need to increase the maximum number of memory maps:
+# sudo sysctl -w vm.max_map_count=200000
+prelude: |
+  fibers = []
+benchmark:
+  vm_fiber_count: |
+    fiber = Fiber.new{Fiber.yield}
+    fibers << fiber
+    fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_reuse.yml b/benchmark/vm_fiber_reuse.yml
new file mode 100644
index 0000000000..4ca41085b1
--- /dev/null
+++ b/benchmark/vm_fiber_reuse.yml
@@ -0,0 +1,14 @@
+prelude: |
+  GC.disable
+  fibers = []
+benchmark:
+  vm_fiber_reuse: |
+    1024.times do
+      fiber = Fiber.new{Fiber.yield}
+      fibers << fiber
+      fiber.resume
+    end
+
+    fibers.clear
+    GC.start
+loop_count: 200
diff --git a/benchmark/vm_fiber_reuse_gc.yml b/benchmark/vm_fiber_reuse_gc.yml
new file mode 100644
index 0000000000..892622f121
--- /dev/null
+++ b/benchmark/vm_fiber_reuse_gc.yml
@@ -0,0 +1,12 @@
+# https://bugs.ruby-lang.org/issues/16009
+prelude: |
+  fibers = []
+benchmark:
+  vm_fiber_reuse_gc: |
+    2000.times do
+      fiber = Fiber.new{Fiber.yield}
+      fibers << fiber
+      fiber.resume
+    end
+    fibers.clear
+loop_count: 100
diff --git a/benchmark/vm_fiber_switch.yml b/benchmark/vm_fiber_switch.yml
new file mode 100644
index 0000000000..3de36b66eb
--- /dev/null
+++ b/benchmark/vm_fiber_switch.yml
@@ -0,0 +1,9 @@
+prelude: |
+  # based on benchmark for [ruby-core:65518] [Feature #10341] by Knut Franke
+  fib = Fiber.new do
+    loop { Fiber.yield }
+  end
+benchmark:
+  vm_fiber_switch: |
+    fib.resume
+loop_count: 20000000
diff --git a/benchmark/vm_float_simple.yml b/benchmark/vm_float_simple.yml
new file mode 100644
index 0000000000..92f5fd52ab
--- /dev/null
+++ b/benchmark/vm_float_simple.yml
@@ -0,0 +1,8 @@
+prelude: |
+  f = 0.0
+benchmark:
+  vm_float_simple: |
+    f += 0.1; f -= 0.1
+    f += 0.1; f -= 0.1
+    f += 0.1; f -= 0.1
+loop_count: 30000000
diff --git a/benchmark/vm_freezeobj.yml b/benchmark/vm_freezeobj.yml
new file mode 100644
index 0000000000..69a795a354
--- /dev/null
+++ b/benchmark/vm_freezeobj.yml
@@ -0,0 +1,6 @@
+prelude: |
+ objs = 100000.times.map { Object.new }
+benchmark:
+  vm_freeze_obj: |
+    objs.map(&:freeze)
+loop_count: 600
diff --git a/benchmark/vm_freezestring.yml b/benchmark/vm_freezestring.yml
new file mode 100644
index 0000000000..facc9aa043
--- /dev/null
+++ b/benchmark/vm_freezestring.yml
@@ -0,0 +1,10 @@
+prelude: |
+  class String
+    def freeze
+      -self
+    end
+  end
+benchmark:
+  vm_freezestring: |
+    "tXnL1BP5T1WPXMjuFNLQtallEtRcay1t2lHtJSrlVsDgvunlbtfpr/DGdH0NGYE9".freeze
+loop_count: 6000000
diff --git a/benchmark/vm_gc.rb b/benchmark/vm_gc.rb
new file mode 100644
index 0000000000..e668026915
--- /dev/null
+++ b/benchmark/vm_gc.rb
@@ -0,0 +1,6 @@
+5000.times do
+  100.times do
+    {"xxxx"=>"yyyy"}
+  end
+  GC.start
+end
diff --git a/benchmark/vm_gc_old_full.rb b/benchmark/vm_gc_old_full.rb
new file mode 100644
index 0000000000..cfdfc8c5a5
--- /dev/null
+++ b/benchmark/vm_gc_old_full.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+100.times do
+  GC.start
+end
diff --git a/benchmark/vm_gc_old_immediate.rb b/benchmark/vm_gc_old_immediate.rb
new file mode 100644
index 0000000000..ad22feb655
--- /dev/null
+++ b/benchmark/vm_gc_old_immediate.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+30_000.times do
+  GC.start(full_mark: false, immediate_sweep: true)
+end
diff --git a/benchmark/vm_gc_old_lazy.rb b/benchmark/vm_gc_old_lazy.rb
new file mode 100644
index 0000000000..b74d44baf1
--- /dev/null
+++ b/benchmark/vm_gc_old_lazy.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+30_000.times do
+  GC.start(full_mark: false, immediate_sweep: false)
+end
diff --git a/benchmark/vm_gc_short_lived.yml b/benchmark/vm_gc_short_lived.yml
new file mode 100644
index 0000000000..29c803fee3
--- /dev/null
+++ b/benchmark/vm_gc_short_lived.yml
@@ -0,0 +1,9 @@
+benchmark:
+  vm_gc_short_lived: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_complex_long.yml b/benchmark/vm_gc_short_with_complex_long.yml
new file mode 100644
index 0000000000..4b6c3ed7b9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_complex_long.yml
@@ -0,0 +1,25 @@
+prelude: |
+  def nested_hash h, n
+    if n == 0
+      ''
+    else
+      10.times{
+        h[Object.new] = nested_hash(h, n-1)
+      }
+    end
+  end
+
+  long_lived = Hash.new
+  nested_hash long_lived, 6
+
+  GC.start
+  GC.start
+benchmark:
+  vm_gc_short_with_complex_long: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_long.yml b/benchmark/vm_gc_short_with_long.yml
new file mode 100644
index 0000000000..03ba0f95a9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_long.yml
@@ -0,0 +1,13 @@
+prelude: |
+  long_lived = Array.new(1_000_000){|i| "#{i}"}
+  GC.start
+  GC.start
+benchmark:
+  vm_gc_short_with_long: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_symbol.yml b/benchmark/vm_gc_short_with_symbol.yml
new file mode 100644
index 0000000000..129b8bf4ed
--- /dev/null
+++ b/benchmark/vm_gc_short_with_symbol.yml
@@ -0,0 +1,13 @@
+prelude: |
+  50_000.times{|i| sym = "sym#{i}".to_sym}
+  GC.start
+  GC.start
+benchmark:
+  vm_gc_short_with_symbol: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary.yml b/benchmark/vm_gc_wb_ary.yml
new file mode 100644
index 0000000000..e3293e72d0
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary.yml
@@ -0,0 +1,12 @@
+prelude: |
+  short_lived_ary = []
+
+  if RUBY_VERSION >= "2.2.0"
+    GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+  end
+
+  short_lived = ''
+benchmark:
+  vm_gc_wb_ary: |
+    short_lived_ary[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary_promoted.yml b/benchmark/vm_gc_wb_ary_promoted.yml
new file mode 100644
index 0000000000..003995945b
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary_promoted.yml
@@ -0,0 +1,15 @@
+prelude: |
+  long_lived = []
+
+  if RUBY_VERSION > "2.2.0"
+    3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+  elsif
+    GC.start
+  end
+
+  short_lived = ''
+
+benchmark:
+  vm_gc_wb_ary_promoted: |
+    long_lived[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj.yml b/benchmark/vm_gc_wb_obj.yml
new file mode 100644
index 0000000000..a2a2ce2d18
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj.yml
@@ -0,0 +1,15 @@
+prelude: |
+  class C
+    attr_accessor :foo
+  end
+  short_lived_obj = C.new
+
+  if RUBY_VERSION >= "2.2.0"
+    GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+  end
+
+  short_lived = ''
+benchmark:
+  vm_gc_wb_obj: |
+    short_lived_obj.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj_promoted.yml b/benchmark/vm_gc_wb_obj_promoted.yml
new file mode 100644
index 0000000000..00a454ba72
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj_promoted.yml
@@ -0,0 +1,17 @@
+prelude: |
+  class C
+    attr_accessor :foo
+  end
+  long_lived = C.new
+
+  if RUBY_VERSION >= "2.2.0"
+    3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+  elsif
+    GC.start
+  end
+
+  short_lived = ''
+benchmark:
+  vm_gc_wb_obj_promoted: |
+    long_lived.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_iclass_super.yml b/benchmark/vm_iclass_super.yml
new file mode 100644
index 0000000000..21bb7db247
--- /dev/null
+++ b/benchmark/vm_iclass_super.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class C
+    def m
+      1
+    end
+
+    ("A".."M").each do |module_name|
+      eval <<-EOM
+          module #{module_name}
+            def m; super; end
+          end
+          prepend #{module_name}
+      EOM
+    end
+  end
+
+  obj = C.new
+benchmark:
+  vm_iclass_super: obj.m
+loop_count: 6000000
diff --git a/benchmark/vm_ivar.yml b/benchmark/vm_ivar.yml
new file mode 100644
index 0000000000..119531d5ef
--- /dev/null
+++ b/benchmark/vm_ivar.yml
@@ -0,0 +1,6 @@
+prelude: "@a = 1\n"
+benchmark:
+  vm_ivar: |
+    j = @a
+    k = @a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_embedded_obj_init.yml b/benchmark/vm_ivar_embedded_obj_init.yml
new file mode 100644
index 0000000000..74fe20a630
--- /dev/null
+++ b/benchmark/vm_ivar_embedded_obj_init.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_embedded_obj_init: |
+    c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_extended_obj_init.yml b/benchmark/vm_ivar_extended_obj_init.yml
new file mode 100644
index 0000000000..f054bab282
--- /dev/null
+++ b/benchmark/vm_ivar_extended_obj_init.yml
@@ -0,0 +1,16 @@
+prelude: |
+  class C
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+      @d = nil
+      @e = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_extended_obj_init: |
+    c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_generic_get.yml b/benchmark/vm_ivar_generic_get.yml
new file mode 100644
index 0000000000..dae2d37671
--- /dev/null
+++ b/benchmark/vm_ivar_generic_get.yml
@@ -0,0 +1,17 @@
+prelude: |
+  class C < Array
+    attr_reader :a, :b, :c
+    def initialize
+      @a = nil
+      @b = nil
+      @c = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_generic_get: |
+    c.a
+    c.b
+    c.c
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_generic_set.yml b/benchmark/vm_ivar_generic_set.yml
new file mode 100644
index 0000000000..102a6577fb
--- /dev/null
+++ b/benchmark/vm_ivar_generic_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C < Array
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_generic_set: |
+    c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_get.yml b/benchmark/vm_ivar_get.yml
new file mode 100644
index 0000000000..1e0dad665f
--- /dev/null
+++ b/benchmark/vm_ivar_get.yml
@@ -0,0 +1,100 @@
+prelude: |
+  class Example
+    def initialize
+      @levar = 1
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+    end
+
+    def get_value_loop
+      sum = 0
+
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        i += 1
+      end
+
+      return sum
+    end
+
+    @levar = 1
+    @v0 = 1
+    @v1 = 2
+    @v3 = 3
+
+    def self.get_value_loop
+      sum = 0
+
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        i += 1
+      end
+
+      return sum
+    end
+  end
+
+  class GenExample < Time
+    def initialize
+      @levar = 1
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+    end
+
+    def get_value_loop
+      sum = 0
+
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        i += 1
+      end
+
+      return sum
+    end
+  end
+
+  obj = Example.new
+  gen = GenExample.new
+benchmark:
+  vm_ivar_get_on_obj: |
+    obj.get_value_loop
+  vm_ivar_get_on_class: |
+    Example.get_value_loop
+  vm_ivar_get_on_generic: |
+    gen.get_value_loop
+loop_count: 100
diff --git a/benchmark/vm_ivar_get_unintialized.yml b/benchmark/vm_ivar_get_unintialized.yml
new file mode 100644
index 0000000000..a1ccfb06ce
--- /dev/null
+++ b/benchmark/vm_ivar_get_unintialized.yml
@@ -0,0 +1,12 @@
+prelude: |
+  class Example
+    def read
+      @uninitialized
+    end
+  end
+
+  obj = Example.new
+benchmark:
+  vm_ivar_get_uninitialized: |
+    obj.read
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_ic_miss.yml b/benchmark/vm_ivar_ic_miss.yml
new file mode 100644
index 0000000000..944fb1a9e6
--- /dev/null
+++ b/benchmark/vm_ivar_ic_miss.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class Foo
+    def initialize diverge
+      if diverge
+        @a = 1
+      end
+
+      @a0 = @a1 = @a2 = @a3 = @a4 = @a5 = @a6 = @a7 = @a8 = @a9 = @a10 = @a11 = @a12 = @a13 = @a14 = @a15 = @a16 = @a17 = @a18 = @a19 = @a20 = @a21 = @a22 = @a23 = @a24 = @a25 = @a26 = @a27 = @a28 = @a29 = @a30 = @a31 = @a32 = @a33 = @a34 = @a35 = @a36 = @a37 = @a38 = @a39 = @a40 = @a41 = @a42 = @a43 = @a44 = @a45 = @a46 = @a47 = @a48 = @a49 = @a50 = @a51 = @a52 = @a53 = @a54 = @a55 = @a56 = @a57 = @a58 = @a59 = @a60 = @a61 = @a62 = @a63 = @a64 = @a65 = @a66 = @a67 = @a68 = @a69 = @a70 = @a71 = @a72 = @a73 = @a74 = @b = 1
+    end
+
+    def b; @b; end
+  end
+
+  a = Foo.new false
+  b = Foo.new true
+benchmark:
+  vm_ivar_ic_miss: |
+    a.b
+    b.b
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_lazy_set.yml b/benchmark/vm_ivar_lazy_set.yml
new file mode 100644
index 0000000000..7372ffcfbc
--- /dev/null
+++ b/benchmark/vm_ivar_lazy_set.yml
@@ -0,0 +1,12 @@
+prelude: |
+  class Example
+    def lazy_set
+      @uninitialized ||= 123
+    end
+  end
+
+  objs = 10000000.times.map { Example.new }
+benchmark:
+  vm_ivar_lazy_set: |
+    objs.each(&:lazy_set)
+loop_count: 1
diff --git a/benchmark/vm_ivar_memoize.yml b/benchmark/vm_ivar_memoize.yml
new file mode 100644
index 0000000000..90f6b07f05
--- /dev/null
+++ b/benchmark/vm_ivar_memoize.yml
@@ -0,0 +1,85 @@
+prelude: |
+  IVARS = 60
+  class Record
+    def initialize(offset = false)
+      @offset = 1 if offset
+      @first = 0
+      IVARS.times do |i|
+        instance_variable_set("@ivar_#{i}", i)
+      end
+    end
+
+    def first
+      @first
+    end
+
+    def lazy_set
+      @lazy_set ||= 123
+    end
+
+    def undef
+      @undef
+    end
+  end
+
+  Record.new # Need one alloc to right size
+
+  BASE = Record.new
+  LAZY = Record.new
+  LAZY.lazy_set
+
+  class Miss < Record
+    @first = 0
+    IVARS.times do |i|
+      instance_variable_set("@i_#{i}", i)
+    end
+  end
+
+  Miss.new # Need one alloc to right size
+  MISS = Miss.new
+
+  DIVERGENT = Record.new(true)
+
+benchmark:
+  vm_ivar_stable_shape: |
+    BASE.first
+    BASE.first
+    BASE.first
+    BASE.first
+    BASE.first
+    BASE.first
+  vm_ivar_memoize_unstable_shape: |
+    BASE.first
+    LAZY.first
+    BASE.first
+    LAZY.first
+    BASE.first
+    LAZY.first
+  vm_ivar_memoize_unstable_shape_miss: |
+    BASE.first
+    MISS.first
+    BASE.first
+    MISS.first
+    BASE.first
+    MISS.first
+  vm_ivar_unstable_undef: |
+    BASE.undef
+    LAZY.undef
+    BASE.undef
+    LAZY.undef
+    BASE.undef
+    LAZY.undef
+  vm_ivar_divergent_shape: |
+    BASE.first
+    DIVERGENT.first
+    BASE.first
+    DIVERGENT.first
+    BASE.first
+    DIVERGENT.first
+  vm_ivar_divergent_shape_imbalanced: |
+    BASE.first
+    DIVERGENT.first
+    DIVERGENT.first
+    DIVERGENT.first
+    DIVERGENT.first
+    DIVERGENT.first
diff --git a/benchmark/vm_ivar_of_class.yml b/benchmark/vm_ivar_of_class.yml
new file mode 100644
index 0000000000..172e28b2fd
--- /dev/null
+++ b/benchmark/vm_ivar_of_class.yml
@@ -0,0 +1,12 @@
+prelude: |
+  class C
+    @a = 1
+    def self.a
+      _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+      _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+    end
+  end
+benchmark:
+  vm_ivar_of_class: |
+    a = C.a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_of_class_set.yml b/benchmark/vm_ivar_of_class_set.yml
new file mode 100644
index 0000000000..2ea5199423
--- /dev/null
+++ b/benchmark/vm_ivar_of_class_set.yml
@@ -0,0 +1,11 @@
+prelude: |
+  class C
+    @a = 1
+    def self.a o
+      @a = o; @a = o; @a = o; @a = o; @a = o; @a = o;
+    end
+  end
+benchmark:
+  vm_ivar_of_class_set: |
+    a = C.a(nil)
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set.yml b/benchmark/vm_ivar_set.yml
new file mode 100644
index 0000000000..8bbb60043b
--- /dev/null
+++ b/benchmark/vm_ivar_set.yml
@@ -0,0 +1,5 @@
+benchmark:
+  vm_ivar_set: |
+    @a = 1
+    @b = 2
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set_on_instance.yml b/benchmark/vm_ivar_set_on_instance.yml
new file mode 100644
index 0000000000..6ce53a86ec
--- /dev/null
+++ b/benchmark/vm_ivar_set_on_instance.yml
@@ -0,0 +1,94 @@
+prelude: |
+  class TheClass
+    def initialize
+      @levar = 1
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+    end
+
+    def set_value_loop
+      # 100k
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        i += 1
+      end
+    end
+  end
+
+  class Generic < Time
+    def initialize
+      @levar = 1
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+    end
+
+    def set_value_loop
+      # 100k
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        i += 1
+      end
+    end
+  end
+
+  obj = TheClass.new
+  gen_obj = Generic.new
+
+  class SomeClass
+    @levar = 1
+    @v0 = 1
+    @v1 = 2
+    @v3 = 3
+
+    def self.set_value_loop
+      # 100k
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        i += 1
+      end
+    end
+  end
+
+benchmark:
+  vm_ivar_set_on_instance: |
+    obj.set_value_loop
+  vm_ivar_set_on_generic: |
+    gen_obj.set_value_loop
+  vm_ivar_set_on_class: |
+    SomeClass.set_value_loop
+loop_count: 100
diff --git a/benchmark/vm_ivar_set_subclass.yml b/benchmark/vm_ivar_set_subclass.yml
new file mode 100644
index 0000000000..bc8bf5bf6b
--- /dev/null
+++ b/benchmark/vm_ivar_set_subclass.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class A
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+      @d = nil
+      @e = nil
+    end
+  end
+  class B < A; end
+  class C < A; end
+
+  b = B.new
+  c = C.new
+benchmark:
+  vm_ivar_init_subclass: |
+    b.set_ivars
+    c.set_ivars
+loop_count: 3000000
diff --git a/benchmark/vm_length.yml b/benchmark/vm_length.yml
new file mode 100644
index 0000000000..5fd94e7d86
--- /dev/null
+++ b/benchmark/vm_length.yml
@@ -0,0 +1,8 @@
+prelude: |
+  a = 'abc'
+  b = [1, 2, 3]
+benchmark:
+  vm_length: |
+    a.length
+    b.length
+loop_count: 30000000
diff --git a/benchmark/vm_lvar_cond_set.yml b/benchmark/vm_lvar_cond_set.yml
new file mode 100644
index 0000000000..1845f9d12e
--- /dev/null
+++ b/benchmark/vm_lvar_cond_set.yml
@@ -0,0 +1,8 @@
+benchmark:
+  vm_lvar_cond_set: |
+    a ||= 1
+    b ||= 1
+    c ||= 1
+    d ||= 1
+    nil
+loop_count: 30000000
diff --git a/benchmark/vm_lvar_init.yml b/benchmark/vm_lvar_init.yml
new file mode 100644
index 0000000000..70a9b1c0ca
--- /dev/null
+++ b/benchmark/vm_lvar_init.yml
@@ -0,0 +1,21 @@
+# while loop cost is not removed because `i` is used in the script
+benchmark:
+  vm_lvar_init: |
+    def m v
+      unless v
+        # unreachable code
+        v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
+        v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
+        v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
+        v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
+        v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
+      end
+    end
+
+    i = 0
+
+    while i<30_000_000
+      i += 1
+      m i
+    end
+loop_count: 1
diff --git a/benchmark/vm_lvar_set.yml b/benchmark/vm_lvar_set.yml
new file mode 100644
index 0000000000..f29f763d81
--- /dev/null
+++ b/benchmark/vm_lvar_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_lvar_set: |
+    a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
+loop_count: 30000000
diff --git a/benchmark/vm_method.yml b/benchmark/vm_method.yml
new file mode 100644
index 0000000000..d45e4ec572
--- /dev/null
+++ b/benchmark/vm_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def m
+    nil
+  end
+benchmark:
+  vm_method: |
+    m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_missing.yml b/benchmark/vm_method_missing.yml
new file mode 100644
index 0000000000..3da456c0bb
--- /dev/null
+++ b/benchmark/vm_method_missing.yml
@@ -0,0 +1,11 @@
+prelude: |
+  class C
+    def method_missing mid
+    end
+  end
+
+  obj = C.new
+benchmark:
+  vm_method_missing: |
+    obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_splat_calls.yml b/benchmark/vm_method_splat_calls.yml
new file mode 100644
index 0000000000..f2f366e99c
--- /dev/null
+++ b/benchmark/vm_method_splat_calls.yml
@@ -0,0 +1,13 @@
+prelude: |
+  def f(x=0, y: 0) end
+  a = [1]
+  ea = []
+  kw = {y: 1}
+  b = lambda{}
+benchmark:
+  arg_splat: "f(1, *ea)"
+  arg_splat_block: "f(1, *ea, &b)"
+  splat_kw_splat: "f(*a, **kw)"
+  splat_kw_splat_block: "f(*a, **kw, &b)"
+  splat_kw: "f(*a, y: 1)"
+  splat_kw_block: "f(*a, y: 1, &b)"
diff --git a/benchmark/vm_method_splat_calls2.yml b/benchmark/vm_method_splat_calls2.yml
new file mode 100644
index 0000000000..d33dcd7e8b
--- /dev/null
+++ b/benchmark/vm_method_splat_calls2.yml
@@ -0,0 +1,27 @@
+prelude: |
+  def named_arg_splat(*a) end
+  def named_arg_kw_splat(*a, **kw) end
+  def anon_arg_splat(*) end
+  def anon_kw_splat(**) end
+  def anon_arg_kw_splat(*, **) end
+  def anon_fw_to_named(*, **) named_arg_kw_splat(*, **) end
+  def fw_to_named(...) named_arg_kw_splat(...) end
+  def fw_to_anon_to_named(...) anon_fw_to_named(...) end
+  def fw_no_kw(...) named_arg_splat(...) end
+  a = [1]
+  kw = {y: 1}
+benchmark:
+  named_multi_arg_splat: "named_arg_splat(*a, *a)"
+  named_post_splat: "named_arg_splat(*a, a)"
+  anon_arg_splat: "anon_arg_splat(*a)"
+  anon_arg_kw_splat: "anon_arg_kw_splat(*a, **kw)"
+  anon_multi_arg_splat: "anon_arg_splat(*a, *a)"
+  anon_post_splat: "anon_arg_splat(*a, a)"
+  anon_kw_splat: "anon_kw_splat(**kw)"
+  anon_fw_to_named_splat: "anon_fw_to_named(*a, **kw)"
+  anon_fw_to_named_no_splat: "anon_fw_to_named(1, y: 1)"
+  fw_to_named_splat: "fw_to_named(*a, **kw)"
+  fw_to_named_no_splat: "fw_to_named(1, y: 1)"
+  fw_to_anon_to_named_splat: "fw_to_anon_to_named(*a, **kw)"
+  fw_to_anon_to_named_no_splat: "fw_to_anon_to_named(1, y: 1)"
+  fw_no_kw: "fw_no_kw(1, 2)"
diff --git a/benchmark/vm_method_with_block.yml b/benchmark/vm_method_with_block.yml
new file mode 100644
index 0000000000..281a481394
--- /dev/null
+++ b/benchmark/vm_method_with_block.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def m
+    nil
+  end
+benchmark:
+  vm_method_with_block: |
+    m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
+loop_count: 6000000
diff --git a/benchmark/vm_module_ann_const_set.yml b/benchmark/vm_module_ann_const_set.yml
new file mode 100644
index 0000000000..243229ba4a
--- /dev/null
+++ b/benchmark/vm_module_ann_const_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_module_ann_const_set: |
+    Module.new.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_module_const_set.yml b/benchmark/vm_module_const_set.yml
new file mode 100644
index 0000000000..e5a24181a9
--- /dev/null
+++ b/benchmark/vm_module_const_set.yml
@@ -0,0 +1,8 @@
+prelude: |
+  module M
+  end
+  $VERBOSE = nil
+benchmark:
+  vm_module_const_set: |
+    M.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_mutex.yml b/benchmark/vm_mutex.yml
new file mode 100644
index 0000000000..abcf1e28ce
--- /dev/null
+++ b/benchmark/vm_mutex.yml
@@ -0,0 +1,8 @@
+prelude: |
+  require 'thread'
+
+  m = Thread::Mutex.new
+benchmark:
+  vm_mutex: |
+    m.synchronize{}
+loop_count: 6000000
diff --git a/benchmark/vm_neq.yml b/benchmark/vm_neq.yml
new file mode 100644
index 0000000000..fb04d15ae8
--- /dev/null
+++ b/benchmark/vm_neq.yml
@@ -0,0 +1,7 @@
+prelude: |
+  obj1 = Object.new
+  obj2 = Object.new
+benchmark:
+  vm_neq: |
+    obj1 != obj2
+loop_count: 30000000
diff --git a/benchmark/vm_newlambda.yml b/benchmark/vm_newlambda.yml
new file mode 100644
index 0000000000..0b9787d91a
--- /dev/null
+++ b/benchmark/vm_newlambda.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_newlambda: |
+    lambda {}
+loop_count: 6000000
diff --git a/benchmark/vm_not.yml b/benchmark/vm_not.yml
new file mode 100644
index 0000000000..c68dde3c50
--- /dev/null
+++ b/benchmark/vm_not.yml
@@ -0,0 +1,6 @@
+prelude: |
+  obj = Object.new
+benchmark:
+  vm_not: |
+    !obj
+loop_count: 30000000
diff --git a/benchmark/vm_poly_method.yml b/benchmark/vm_poly_method.yml
new file mode 100644
index 0000000000..dd2f4e71de
--- /dev/null
+++ b/benchmark/vm_poly_method.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_poly_method: |
+    class C1
+      def m
+        1
+      end
+    end
+    class C2
+      def m
+        2
+      end
+    end
+
+    o1 = C1.new
+    o2 = C2.new
+
+    i = 0
+    while i<6_000_000
+      o = (i % 2 == 0) ? o1 : o2
+      o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/vm_poly_method_ov.yml b/benchmark/vm_poly_method_ov.yml
new file mode 100644
index 0000000000..bca1b62729
--- /dev/null
+++ b/benchmark/vm_poly_method_ov.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_poly_method_ov: |
+    class C1
+      def m
+        1
+      end
+    end
+    class C2
+      def m
+        2
+      end
+    end
+
+    o1 = C1.new
+    o2 = C2.new
+
+    i = 0
+    while i<6_000_000
+      o = (i % 2 == 0) ? o1 : o2
+    #  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/vm_poly_same_method.yml b/benchmark/vm_poly_same_method.yml
new file mode 100644
index 0000000000..6c5404ac84
--- /dev/null
+++ b/benchmark/vm_poly_same_method.yml
@@ -0,0 +1,25 @@
+prelude: |
+  module AR; end
+  class AR::Base
+    def create_or_update
+      nil
+    end
+    def save
+      create_or_update
+    end
+  end
+  class Foo < AR::Base; end
+  class Bar < AR::Base; end
+  o1 = Foo.new
+  o2 = Bar.new
+benchmark:
+  vm_poly_same_method: |
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+loop_count: 6000000
diff --git a/benchmark/vm_poly_singleton.yml b/benchmark/vm_poly_singleton.yml
new file mode 100644
index 0000000000..c7923160fb
--- /dev/null
+++ b/benchmark/vm_poly_singleton.yml
@@ -0,0 +1,18 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_poly_singleton: |
+    class C1
+      def m; 1; end
+    end
+
+    o1 = C1.new
+    o2 = C1.new
+    o2.singleton_class
+
+    i = 0
+    while i<6_000_000 # benchmark loop 2
+      o = (i % 2 == 0) ? o1 : o2
+      o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/vm_proc.yml b/benchmark/vm_proc.yml
new file mode 100644
index 0000000000..2f8de6c272
--- /dev/null
+++ b/benchmark/vm_proc.yml
@@ -0,0 +1,12 @@
+prelude: |
+  def m &b
+    b
+  end
+
+  pr = m{
+    a = 1
+  }
+benchmark:
+  vm_proc: |
+    pr.call
+loop_count: 6000000
diff --git a/benchmark/vm_raise1.yml b/benchmark/vm_raise1.yml
new file mode 100644
index 0000000000..247d9f70ee
--- /dev/null
+++ b/benchmark/vm_raise1.yml
@@ -0,0 +1,16 @@
+prelude: |
+  def rec n
+    if n > 0
+      rec n-1
+    else
+      raise
+    end
+  end
+benchmark:
+  vm_raise1: |
+    begin
+      rec 1
+    rescue
+      # ignore
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_raise2.yml b/benchmark/vm_raise2.yml
new file mode 100644
index 0000000000..f0fa047b3c
--- /dev/null
+++ b/benchmark/vm_raise2.yml
@@ -0,0 +1,16 @@
+prelude: |
+  def rec n
+    if n > 0
+      rec n-1
+    else
+      raise
+    end
+  end
+benchmark:
+  vm_raise2: |
+    begin
+      rec 10
+    rescue
+      # ignore
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_regexp.yml b/benchmark/vm_regexp.yml
new file mode 100644
index 0000000000..2aa3d94dbd
--- /dev/null
+++ b/benchmark/vm_regexp.yml
@@ -0,0 +1,8 @@
+prelude: |
+  str = 'xxxhogexxx'
+benchmark:
+  vm_regexp: |
+    /hoge/ =~ str
+  vm_regexp_invert: |
+    str =~ /hoge/
+loop_count: 6000000
diff --git a/benchmark/vm_rescue.yml b/benchmark/vm_rescue.yml
new file mode 100644
index 0000000000..b4a0af521f
--- /dev/null
+++ b/benchmark/vm_rescue.yml
@@ -0,0 +1,6 @@
+benchmark:
+  vm_rescue: |
+    begin
+    rescue
+    end
+loop_count: 30000000
diff --git a/benchmark/vm_send.yml b/benchmark/vm_send.yml
new file mode 100644
index 0000000000..f31bc7ac89
--- /dev/null
+++ b/benchmark/vm_send.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    def m
+    end
+  end
+
+  o = C.new
+  m = :m
+benchmark:
+  vm_send: |
+    o.__send__ :m
+  vm_send_var: |
+    o.__send__ m
+loop_count: 6000000
diff --git a/benchmark/vm_send_cfunc.yml b/benchmark/vm_send_cfunc.yml
new file mode 100644
index 0000000000..6f12b65176
--- /dev/null
+++ b/benchmark/vm_send_cfunc.yml
@@ -0,0 +1,14 @@
+prelude: |
+  ary = []
+  kw = {a: 1}
+  empty_kw = {}
+  kw_ary = [Hash.ruby2_keywords_hash(a: 1)]
+  empty_kw_ary = [Hash.ruby2_keywords_hash({})]
+benchmark:
+  vm_send_cfunc: itself
+  vm_send_cfunc_splat: itself(*ary)
+  vm_send_cfunc_splat_kw_hash: equal?(*kw_ary)
+  vm_send_cfunc_splat_empty_kw_hash: itself(*empty_kw_ary)
+  vm_send_cfunc_splat_kw: equal?(*ary, **kw)
+  vm_send_cfunc_splat_empty_kw: itself(*ary, **empty_kw)
+loop_count: 20000000
diff --git a/benchmark/vm_simplereturn.yml b/benchmark/vm_simplereturn.yml
new file mode 100644
index 0000000000..c9829cff0b
--- /dev/null
+++ b/benchmark/vm_simplereturn.yml
@@ -0,0 +1,7 @@
+prelude: |
+  def m
+    return 1
+  end
+benchmark:
+  vm_simplereturn: m
+loop_count: 30000000
diff --git a/benchmark/vm_string_literal.yml b/benchmark/vm_string_literal.yml
new file mode 100644
index 0000000000..64439c7980
--- /dev/null
+++ b/benchmark/vm_string_literal.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_string_literal: |
+    x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aref_hi.yml b/benchmark/vm_struct_big_aref_hi.yml
new file mode 100644
index 0000000000..4cf78970cb
--- /dev/null
+++ b/benchmark/vm_struct_big_aref_hi.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_aref_hi: |
+    x.z # x[25]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aref_lo.yml b/benchmark/vm_struct_big_aref_lo.yml
new file mode 100644
index 0000000000..c91af27fa5
--- /dev/null
+++ b/benchmark/vm_struct_big_aref_lo.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_aref_lo: |
+    x.k # x[10]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aset.yml b/benchmark/vm_struct_big_aset.yml
new file mode 100644
index 0000000000..69550d14ea
--- /dev/null
+++ b/benchmark/vm_struct_big_aset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_struct_big_aset: |
+    s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+    x = s.new
+    i = 0
+    while i<6_000_000
+      i += 1
+      x.k = i # x[10] = i
+    end
+loop_count: 1
diff --git a/benchmark/vm_struct_big_href_hi.yml b/benchmark/vm_struct_big_href_hi.yml
new file mode 100644
index 0000000000..09b764dd13
--- /dev/null
+++ b/benchmark/vm_struct_big_href_hi.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_href_hi: |
+    x[:z]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_href_lo.yml b/benchmark/vm_struct_big_href_lo.yml
new file mode 100644
index 0000000000..d2f00b220f
--- /dev/null
+++ b/benchmark/vm_struct_big_href_lo.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_href_lo: |
+    x[:k]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_hset.yml b/benchmark/vm_struct_big_hset.yml
new file mode 100644
index 0000000000..fc45cbee9c
--- /dev/null
+++ b/benchmark/vm_struct_big_hset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_struct_big_hset: |
+    s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+    x = s.new
+    i = 0
+    while i<6_000_000
+      i += 1
+      x[:k] = i
+    end
+loop_count: 1
diff --git a/benchmark/vm_struct_small_aref.yml b/benchmark/vm_struct_small_aref.yml
new file mode 100644
index 0000000000..5a83251d1e
--- /dev/null
+++ b/benchmark/vm_struct_small_aref.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(:a, :b, :c)
+  x = s.new
+benchmark:
+  vm_struct_small_aref: |
+    x.a
+loop_count: 6000000
diff --git a/benchmark/vm_struct_small_aset.yml b/benchmark/vm_struct_small_aset.yml
new file mode 100644
index 0000000000..74f435f126
--- /dev/null
+++ b/benchmark/vm_struct_small_aset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_struct_small_aset: |
+    s = Struct.new(:a, :b, :c)
+    x = s.new
+    i = 0
+    while i<6_000_000
+      i += 1
+      x.a = i
+    end
+loop_count: 1
diff --git a/benchmark/vm_struct_small_href.yml b/benchmark/vm_struct_small_href.yml
new file mode 100644
index 0000000000..6b7d7f39e7
--- /dev/null
+++ b/benchmark/vm_struct_small_href.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(:a, :b, :c)
+  x = s.new
+benchmark:
+  vm_struct_small_href: |
+    x[:a]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_small_hset.yml b/benchmark/vm_struct_small_hset.yml
new file mode 100644
index 0000000000..5d43b150de
--- /dev/null
+++ b/benchmark/vm_struct_small_hset.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(:a, :b, :c)
+  x = s.new
+benchmark:
+  vm_struct_small_hset: |
+    x[:a] = 1
+loop_count: 6000000
diff --git a/benchmark/vm_super.yml b/benchmark/vm_super.yml
new file mode 100644
index 0000000000..0d1e965c6e
--- /dev/null
+++ b/benchmark/vm_super.yml
@@ -0,0 +1,17 @@
+prelude: |
+  class C
+    def m
+      1
+    end
+  end
+
+  class CC < C
+    def m
+      super()
+    end
+  end
+
+  obj = CC.new
+benchmark:
+  vm_super: obj.m
+loop_count: 6000000
diff --git a/benchmark/vm_super_splat_calls.yml b/benchmark/vm_super_splat_calls.yml
new file mode 100644
index 0000000000..795e44e4da
--- /dev/null
+++ b/benchmark/vm_super_splat_calls.yml
@@ -0,0 +1,25 @@
+prelude: |
+  @a = [1].freeze
+  @ea = [].freeze
+  @kw = {y: 1}.freeze
+  @b = lambda{}
+  extend(Module.new{def arg_splat(x=0, y: 0) end})
+  extend(Module.new{def arg_splat_block(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_splat(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_splat_block(x=0, y: 0) end})
+  extend(Module.new{def splat_kw(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_block(x=0, y: 0) end})
+
+  extend(Module.new{def arg_splat; super(1, *@ea) end})
+  extend(Module.new{def arg_splat_block; super(1, *@ea, &@b) end})
+  extend(Module.new{def splat_kw_splat; super(*@a, **@kw) end})
+  extend(Module.new{def splat_kw_splat_block; super(*@a, **@kw, &@b) end})
+  extend(Module.new{def splat_kw; super(*@a, y: 1) end})
+  extend(Module.new{def splat_kw_block; super(*@a, y: 1, &@b) end})
+benchmark:
+  arg_splat: "arg_splat"
+  arg_splat_block: "arg_splat_block"
+  splat_kw_splat: "splat_kw_splat"
+  splat_kw_splat_block: "splat_kw_splat_block"
+  splat_kw: "splat_kw"
+  splat_kw_block: "splat_kw_block"
diff --git a/benchmark/vm_swap.yml b/benchmark/vm_swap.yml
new file mode 100644
index 0000000000..e824a65e0a
--- /dev/null
+++ b/benchmark/vm_swap.yml
@@ -0,0 +1,7 @@
+prelude: |
+  a = 1
+  b = 2
+benchmark:
+  vm_swap: |
+    a, b = b, a
+loop_count: 30000000
diff --git a/benchmark/vm_symbol_block_pass.rb b/benchmark/vm_symbol_block_pass.rb
new file mode 100644
index 0000000000..1d433353e1
--- /dev/null
+++ b/benchmark/vm_symbol_block_pass.rb
@@ -0,0 +1,13 @@
+class C
+  1000.times {|i|
+    eval("def i#{i};end")
+  }
+end
+
+c = C.new
+m = C.instance_methods(false)
+5_000.times do
+  m.each do |n|
+    c.tap(&n)
+  end
+end
diff --git a/benchmark/vm_thread_alive_check.yml b/benchmark/vm_thread_alive_check.yml
new file mode 100644
index 0000000000..d21737d3e8
--- /dev/null
+++ b/benchmark/vm_thread_alive_check.yml
@@ -0,0 +1,8 @@
+benchmark:
+  vm_thread_alive_check: |
+    t = Thread.new{}
+    while t.alive?
+      Thread.pass
+    end
+loop_count: 50_000
+
diff --git a/benchmark/bm_vm_thread_close.rb b/benchmark/vm_thread_close.rb
index 3e9a265ce8..3e9a265ce8 100644
--- a/benchmark/bm_vm_thread_close.rb
+++ b/benchmark/vm_thread_close.rb
diff --git a/benchmark/vm_thread_condvar1.rb b/benchmark/vm_thread_condvar1.rb
new file mode 100644
index 0000000000..feed27c3ad
--- /dev/null
+++ b/benchmark/vm_thread_condvar1.rb
@@ -0,0 +1,28 @@
+# two threads, two mutex, two condvar ping-pong
+require 'thread'
+m1 = Thread::Mutex.new
+m2 = Thread::Mutex.new
+cv1 = Thread::ConditionVariable.new
+cv2 = Thread::ConditionVariable.new
+max = 100000
+i = 0
+wait = nil
+m2.synchronize do
+  wait = Thread.new do
+    m1.synchronize do
+      m2.synchronize { cv2.signal }
+      while (i += 1) < max
+        cv1.wait(m1)
+        cv2.signal
+      end
+    end
+  end
+  cv2.wait(m2)
+end
+m1.synchronize do
+  while i < max
+    cv1.signal
+    cv2.wait(m1)
+  end
+end
+wait.join
diff --git a/benchmark/vm_thread_condvar2.rb b/benchmark/vm_thread_condvar2.rb
new file mode 100644
index 0000000000..6590c4134b
--- /dev/null
+++ b/benchmark/vm_thread_condvar2.rb
@@ -0,0 +1,35 @@
+# many threads, one mutex, many condvars
+require 'thread'
+m = Thread::Mutex.new
+cv1 = Thread::ConditionVariable.new
+cv2 = Thread::ConditionVariable.new
+max = 1000
+n = 100
+waiting = 0
+scvs = []
+waiters = n.times.map do |i|
+  start_cv = Thread::ConditionVariable.new
+  scvs << start_cv
+  start_mtx = Thread::Mutex.new
+  start_mtx.synchronize do
+    th = Thread.new(start_mtx, start_cv) do |sm, scv|
+      m.synchronize do
+        sm.synchronize { scv.signal }
+        max.times do
+          cv2.signal if (waiting += 1) == n
+          cv1.wait(m)
+        end
+      end
+    end
+    start_cv.wait(start_mtx)
+    th
+  end
+end
+m.synchronize do
+  max.times do
+    cv2.wait(m) until waiting == n
+    waiting = 0
+    cv1.broadcast
+  end
+end
+waiters.each(&:join)
diff --git a/benchmark/bm_vm_thread_create_join.rb b/benchmark/vm_thread_create_join.rb
index 393cd45df9..393cd45df9 100644
--- a/benchmark/bm_vm_thread_create_join.rb
+++ b/benchmark/vm_thread_create_join.rb
diff --git a/benchmark/vm_thread_mutex1.rb b/benchmark/vm_thread_mutex1.rb
new file mode 100644
index 0000000000..66e42c85e1
--- /dev/null
+++ b/benchmark/vm_thread_mutex1.rb
@@ -0,0 +1,21 @@
+# one thread, one mutex (no contention)
+
+require 'thread'
+m = Thread::Mutex.new
+r = 0
+max = 2000
+lmax = max * max
+(1..1).map{
+  Thread.new{
+    i = 0
+    while i<lmax
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/vm_thread_mutex2.rb b/benchmark/vm_thread_mutex2.rb
new file mode 100644
index 0000000000..6e6c804c31
--- /dev/null
+++ b/benchmark/vm_thread_mutex2.rb
@@ -0,0 +1,21 @@
+# two threads, one mutex
+
+require 'thread'
+m = Thread::Mutex.new
+r = 0
+max = 2000
+lmax = (max * max)/2
+(1..2).map{
+  Thread.new{
+    i = 0
+    while i<lmax
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/vm_thread_mutex3.rb b/benchmark/vm_thread_mutex3.rb
new file mode 100644
index 0000000000..c750dc542a
--- /dev/null
+++ b/benchmark/vm_thread_mutex3.rb
@@ -0,0 +1,20 @@
+# 1000 threads, one mutex
+
+require 'thread'
+m = Thread::Mutex.new
+r = 0
+max = 2000
+(1..max).map{
+  Thread.new{
+    i = 0
+    while i<max
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/vm_thread_pass.rb b/benchmark/vm_thread_pass.rb
new file mode 100644
index 0000000000..438bd08d45
--- /dev/null
+++ b/benchmark/vm_thread_pass.rb
@@ -0,0 +1,15 @@
+# Plenty Thread.pass
+# A performance may depend on GVL implementation.
+
+tmax = (ARGV.shift || 8).to_i
+lmax = 400_000 / tmax
+
+(1..tmax).map{
+  Thread.new{
+    lmax.times{
+      Thread.pass
+    }
+  }
+}.each{|t| t.join}
+
+
diff --git a/benchmark/vm_thread_pass_flood.rb b/benchmark/vm_thread_pass_flood.rb
new file mode 100644
index 0000000000..65df8e6154
--- /dev/null
+++ b/benchmark/vm_thread_pass_flood.rb
@@ -0,0 +1,10 @@
+# n.b. this is a good test for GVL when pinned to a single CPU
+
+5_000.times{
+  Thread.new{loop{Thread.pass}}
+}
+
+i = 0
+while i<10_000
+  i += 1
+end
diff --git a/benchmark/vm_thread_pipe.rb b/benchmark/vm_thread_pipe.rb
new file mode 100644
index 0000000000..112a621905
--- /dev/null
+++ b/benchmark/vm_thread_pipe.rb
@@ -0,0 +1,17 @@
+# Measure small and plenty pipe read/write.
+# A performance may depend on GVL implementation.
+
+lmax = 100_000
+r, w = IO.pipe
+[Thread.new{
+  lmax.times{
+    w.write('a')
+  }
+  p "w:exit"
+}, Thread.new{
+  lmax.times{
+    r.read(1)
+  }
+  p "r:exit"
+}].each{|t| t.join}
+
diff --git a/benchmark/vm_thread_queue.rb b/benchmark/vm_thread_queue.rb
new file mode 100644
index 0000000000..1dd3696a3c
--- /dev/null
+++ b/benchmark/vm_thread_queue.rb
@@ -0,0 +1,18 @@
+require 'thread'
+
+n = 10_000_000
+q = Thread::Queue.new
+consumer = Thread.new{
+  while q.pop
+    # consuming
+  end
+}
+
+producer = Thread.new{
+  n.times{
+    q.push true
+  }
+  q.push nil
+}
+
+consumer.join
diff --git a/benchmark/vm_thread_sized_queue.rb b/benchmark/vm_thread_sized_queue.rb
new file mode 100644
index 0000000000..7b9af5482b
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue.rb
@@ -0,0 +1,20 @@
+require 'thread'
+# on producer, one consumer
+
+n = 1_000_000
+q = Thread::SizedQueue.new(100)
+consumer = Thread.new{
+  while q.pop
+    # consuming
+  end
+}
+
+producer = Thread.new{
+  while n > 0
+    q.push true
+    n -= 1
+  end
+  q.push nil
+}
+
+consumer.join
diff --git a/benchmark/vm_thread_sized_queue2.rb b/benchmark/vm_thread_sized_queue2.rb
new file mode 100644
index 0000000000..de9f55e978
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue2.rb
@@ -0,0 +1,23 @@
+require 'thread'
+# one producer, many consumers
+n = 1_000_000
+m = 10
+q = Thread::SizedQueue.new(100)
+consumers = m.times.map do
+  Thread.new do
+    while q.pop
+      # consuming
+    end
+  end
+end
+
+producer = Thread.new do
+  while n > 0
+    q.push true
+    n -= 1
+  end
+  m.times { q.push nil }
+end
+
+producer.join
+consumers.each(&:join)
diff --git a/benchmark/vm_thread_sized_queue3.rb b/benchmark/vm_thread_sized_queue3.rb
new file mode 100644
index 0000000000..ce5f1796d8
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue3.rb
@@ -0,0 +1,22 @@
+require 'thread'
+# many producers, one consumer
+n = 1_000_000
+m = 10
+q = Thread::SizedQueue.new(100)
+consumer = Thread.new do
+  while q.pop
+    # consuming
+  end
+end
+
+producers = m.times.map do
+  Thread.new do
+    while n > 0
+      q.push true
+      n -= 1
+    end
+  end
+end
+producers.each(&:join)
+q.push nil
+consumer.join
diff --git a/benchmark/vm_thread_sized_queue4.rb b/benchmark/vm_thread_sized_queue4.rb
new file mode 100644
index 0000000000..a9b7d80ec0
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue4.rb
@@ -0,0 +1,26 @@
+require 'thread'
+# many producers, many consumers
+nr = 1_000_000
+n = 10
+m = 10
+q = Thread::SizedQueue.new(100)
+consumers = n.times.map do
+  Thread.new do
+    while q.pop
+      # consuming
+    end
+  end
+end
+
+producers = m.times.map do
+  Thread.new do
+    while nr > 0
+      q.push true
+      nr -= 1
+    end
+  end
+end
+
+producers.each(&:join)
+n.times { q.push nil }
+consumers.each(&:join)
diff --git a/benchmark/vm_thread_sleep.yml b/benchmark/vm_thread_sleep.yml
new file mode 100644
index 0000000000..96901d8466
--- /dev/null
+++ b/benchmark/vm_thread_sleep.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_thread_sleep: |
+    Thread.new { sleep }
+loop_count: 10_000
diff --git a/benchmark/vm_unif1.yml b/benchmark/vm_unif1.yml
new file mode 100644
index 0000000000..04187bb0e2
--- /dev/null
+++ b/benchmark/vm_unif1.yml
@@ -0,0 +1,7 @@
+prelude: |
+  def m a, b
+  end
+benchmark:
+  vm_unif1: |
+    m 100, 200
+loop_count: 6000000
diff --git a/benchmark/vm_yield.yml b/benchmark/vm_yield.yml
new file mode 100644
index 0000000000..230be3d84f
--- /dev/null
+++ b/benchmark/vm_yield.yml
@@ -0,0 +1,13 @@
+# while loop cost is not removed due to benchmark_driver.gem's limitation
+benchmark:
+  vm_yield: |
+    def m
+      i = 0
+      while i<30_000_000
+        i += 1
+        yield
+      end
+    end
+
+    m{}
+loop_count: 1
diff --git a/benchmark/vm_zsuper.yml b/benchmark/vm_zsuper.yml
new file mode 100644
index 0000000000..bfb5837578
--- /dev/null
+++ b/benchmark/vm_zsuper.yml
@@ -0,0 +1,18 @@
+prelude: |
+  class C
+    def m a
+      1
+    end
+  end
+
+  class CC < C
+    def m a
+      super
+    end
+  end
+
+  obj = CC.new
+benchmark:
+  vm_zsuper: |
+    obj.m 10
+loop_count: 6000000
diff --git a/benchmark/vm_zsuper_splat_calls.yml b/benchmark/vm_zsuper_splat_calls.yml
new file mode 100644
index 0000000000..82dc22349d
--- /dev/null
+++ b/benchmark/vm_zsuper_splat_calls.yml
@@ -0,0 +1,28 @@
+prelude: |
+  a = [1].freeze
+  ea = [].freeze
+  kw = {y: 1}.freeze
+  b = lambda{}
+  extend(Module.new{def arg_splat(x=0, y: 0) end})
+  extend(Module.new{def arg_splat_block(x=0, y: 0) end})
+  extend(Module.new{def arg_splat_post(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_splat(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_splat_block(x=0, y: 0) end})
+  extend(Module.new{def splat_kw(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_block(x=0, y: 0) end})
+
+  extend(Module.new{def arg_splat(x, *a) super end})
+  extend(Module.new{def arg_splat_block(x, *a, &b) super end})
+  extend(Module.new{def arg_splat_post(*a, x) super end})
+  extend(Module.new{def splat_kw_splat(*a, **kw) super end})
+  extend(Module.new{def splat_kw_splat_block(*a, **kw, &b) super end})
+  extend(Module.new{def splat_kw(*a, y: 1) super end})
+  extend(Module.new{def splat_kw_block(*a, y: 1, &b) super end})
+benchmark:
+  arg_splat: "arg_splat(1, *ea)"
+  arg_splat_block: "arg_splat_block(1, *ea, &b)"
+  arg_splat_post: "arg_splat_post(1, *ea, &b)"
+  splat_kw_splat: "splat_kw_splat(*a, **kw)"
+  splat_kw_splat_block: "splat_kw_splat_block(*a, **kw, &b)"
+  splat_kw: "splat_kw(*a, y: 1)"
+  splat_kw_block: "splat_kw_block(*a, y: 1, &b)"
diff --git a/benchmark/wc.input.base b/benchmark/wc.input.base
deleted file mode 100644
index 41143fbac0..0000000000
--- a/benchmark/wc.input.base
+++ /dev/null
@@ -1,25 +0,0 @@
-Subject:      Re: Who was Izchak Miller?
-From:         "Jane D. Anonymous" <nobody@yale.edu>
-Date:         1996/04/28
-Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
-References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
-To:           75176.2330@compuserve.com
-Content-Type: text/plain; charset=us-ascii
-Organization: Yale University
-X-Url:        news:4lk6vl$gde@ns.oar.net
-Mime-Version: 1.0
-Newsgroups:   rec.games.roguelike.nethack
-X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
-
-Hello there, Izchak Miller was my father.  When I was younger I spent 
-many a night, hunched over the keyboard with a cup of tea, playing 
-nethack with him and my brother.  my dad was a philosopher with a strong 
-weakness for fantasy/sci fi.  I remember when he started to get involved 
-with the Nethack team- my brother's Dungeons and Dragons monster book 
-found a regular place beside my dad's desk. it's nice to see him living 
-on in the game he loved so much :-).  
-                                                                  Tamar Miller
-
-The following is a really long word of 5000 characters:
-
-wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
diff --git a/bignum.c b/bignum.c
index dfbe2ecec9..ee2fa1ed30 100644
--- a/bignum.c
+++ b/bignum.c
@@ -9,29 +9,59 @@
 
 **********************************************************************/
 
-#include "internal.h"
-#include "ruby/thread.h"
-#include "ruby/util.h"
+#include "ruby/internal/config.h"
+
+#include <ctype.h>
+#include <float.h>
+#include <math.h>
 
 #ifdef HAVE_STRINGS_H
-#include <strings.h>
+# include <strings.h>
 #endif
-#include <math.h>
-#include <float.h>
-#include <ctype.h>
+
 #ifdef HAVE_IEEEFP_H
-#include <ieeefp.h>
+# include <ieeefp.h>
 #endif
-#include <assert.h>
 
+#if !defined(USE_GMP)
 #if defined(HAVE_LIBGMP) && defined(HAVE_GMP_H)
-#define USE_GMP
-#include <gmp.h>
+# define USE_GMP 1
+#else
+# define USE_GMP 0
+#endif
+#endif
+
+#include "id.h"
+#include "internal.h"
+#include "internal/bignum.h"
+#include "internal/complex.h"
+#include "internal/gc.h"
+#include "internal/numeric.h"
+#include "internal/object.h"
+#include "internal/sanitizers.h"
+#include "internal/variable.h"
+#include "internal/warnings.h"
+#include "ruby/thread.h"
+#include "ruby/util.h"
+#include "ruby_assert.h"
+
+#if USE_GMP
+RBIMPL_WARNING_PUSH()
+# ifdef _MSC_VER
+RBIMPL_WARNING_IGNORED(4146) /* for mpn_neg() */
+# endif
+# include <gmp.h>
+RBIMPL_WARNING_POP()
 #endif
 
-#define RB_BIGNUM_TYPE_P(x) RB_TYPE_P((x), T_BIGNUM)
+static const bool debug_integer_pack = (
+#ifdef DEBUG_INTEGER_PACK
+    DEBUG_INTEGER_PACK+0
+#else
+    RUBY_DEBUG
+#endif
+    ) != 0;
 
-VALUE rb_cBignum;
 const char ruby_digitmap[] = "0123456789abcdefghijklmnopqrstuvwxyz";
 
 #ifndef SIZEOF_BDIGIT_DBL
@@ -49,7 +79,6 @@ STATIC_ASSERT(sizeof_bdigit_and_dbl, SIZEOF_BDIGIT*2 <= SIZEOF_BDIGIT_DBL);
 STATIC_ASSERT(bdigit_signedness, 0 < (BDIGIT)-1);
 STATIC_ASSERT(bdigit_dbl_signedness, 0 < (BDIGIT_DBL)-1);
 STATIC_ASSERT(bdigit_dbl_signed_signedness, 0 > (BDIGIT_DBL_SIGNED)-1);
-STATIC_ASSERT(rbignum_embed_len_max, BIGNUM_EMBED_LEN_MAX <= (BIGNUM_EMBED_LEN_MASK >> BIGNUM_EMBED_LEN_SHIFT));
 
 #if SIZEOF_BDIGIT < SIZEOF_LONG
 STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_LONG % SIZEOF_BDIGIT == 0);
@@ -62,8 +91,7 @@ STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
 #else
 #   define HOST_BIGENDIAN_P 0
 #endif
-#define ALIGNOF(type) ((int)offsetof(struct { char f1; type f2; }, f2))
-/* (!LSHIFTABLE(d, n) ? 0 : (n)) is same as n but suppress a warning, C4293, by Visual Studio.  */
+/* (!LSHIFTABLE(d, n) ? 0 : (n)) is the same as n but suppress a warning, C4293, by Visual Studio.  */
 #define LSHIFTABLE(d, n) ((n) < sizeof(d) * CHAR_BIT)
 #define LSHIFTX(d, n) (!LSHIFTABLE(d, n) ? 0 : ((d) << (!LSHIFTABLE(d, n) ? 0 : (n))))
 #define CLEAR_LOWBITS(d, numbits) ((d) & LSHIFTX(~((d)*0), (numbits)))
@@ -90,15 +118,14 @@ STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
 #endif
 
 #define BIGZEROP(x) (BIGNUM_LEN(x) == 0 || \
-		     (BDIGITS(x)[0] == 0 && \
-		      (BIGNUM_LEN(x) == 1 || bigzero_p(x))))
+                     (BDIGITS(x)[0] == 0 && \
+                      (BIGNUM_LEN(x) == 1 || bigzero_p(x))))
 #define BIGSIZE(x) (BIGNUM_LEN(x) == 0 ? (size_t)0 : \
     BDIGITS(x)[BIGNUM_LEN(x)-1] ? \
         (size_t)(BIGNUM_LEN(x)*SIZEOF_BDIGIT - nlz(BDIGITS(x)[BIGNUM_LEN(x)-1])/CHAR_BIT) : \
     rb_absint_size(x, NULL))
 
 #define BIGDIVREM_EXTRA_WORDS 1
-#define roomof(n, m) ((long)(((n)+(m)-1) / (m)))
 #define bdigit_roomof(n) roomof(n, SIZEOF_BDIGIT)
 #define BARY_ARGS(ary) ary, numberof(ary)
 
@@ -111,7 +138,7 @@ STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
 #define BIGNUM_SET_NEGATIVE_SIGN(b) BIGNUM_SET_SIGN(b, 0)
 #define BIGNUM_SET_POSITIVE_SIGN(b) BIGNUM_SET_SIGN(b, 1)
 
-#define bignew(len,sign) bignew_1(rb_cBignum,(len),(sign))
+#define bignew(len,sign) bignew_1(rb_cInteger,(len),(sign))
 
 #define BDIGITS_ZERO(ptr, n) do { \
   BDIGIT *bdigitz_zero_ptr = (ptr); \
@@ -137,21 +164,22 @@ STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
 #define GMP_DIV_DIGITS 20
 #define GMP_BIG2STR_DIGITS 20
 #define GMP_STR2BIG_DIGITS 20
+#if USE_GMP
+# define NAIVE_MUL_DIGITS GMP_MUL_DIGITS
+#else
+# define NAIVE_MUL_DIGITS KARATSUBA_MUL_DIGITS
+#endif
 
 typedef void (mulfunc_t)(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn);
 
 static mulfunc_t bary_mul_toom3_start;
 static mulfunc_t bary_mul_karatsuba_start;
 static BDIGIT bigdivrem_single(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT y);
-static void bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn);
 
-static VALUE bigmul0(VALUE x, VALUE y);
-static void bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn);
 static VALUE bignew_1(VALUE klass, size_t len, int sign);
 static inline VALUE bigtrunc(VALUE x);
 
 static VALUE bigsq(VALUE x);
-static void bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp);
 static inline VALUE power_cache_get_power(int base, int power_level, size_t *numdigits_ret);
 
 #if SIZEOF_BDIGIT <= SIZEOF_INT
@@ -173,7 +201,7 @@ static int nlz(BDIGIT x) { return nlz_int128((uint128_t)x) - (SIZEOF_INT128_T-SI
 #define U128(a,b,c,d) (((uint128_t)U64(a,b) << 64) | U64(c,d))
 #endif
 
-/* The following scirpt, maxpow.rb, generates the tables follows.
+/* The following script, maxpow.rb, generates the tables follows.
 
 def big(n, bits)
   ns = []
@@ -326,7 +354,7 @@ maxpow_in_bdigit_dbl(int base, int *exp_ret)
     BDIGIT_DBL maxpow;
     int exponent;
 
-    assert(2 <= base && base <= 36);
+    RUBY_ASSERT(2 <= base && base <= 36);
 
     {
 #if SIZEOF_BDIGIT_DBL == 2
@@ -358,7 +386,7 @@ maxpow_in_bdigit_dbl(int base, int *exp_ret)
 static inline BDIGIT_DBL
 bary2bdigitdbl(const BDIGIT *ds, size_t n)
 {
-    assert(n <= 2);
+    RUBY_ASSERT(n <= 2);
 
     if (n == 2)
         return ds[0] | BIGUP(ds[1]);
@@ -370,7 +398,7 @@ bary2bdigitdbl(const BDIGIT *ds, size_t n)
 static inline void
 bdigitdbl2bary(BDIGIT *ds, size_t n, BDIGIT_DBL num)
 {
-    assert(n == 2);
+    RUBY_ASSERT(n == 2);
 
     ds[0] = BIGLO(num);
     ds[1] = (BDIGIT)BIGDN(num);
@@ -379,6 +407,7 @@ bdigitdbl2bary(BDIGIT *ds, size_t n, BDIGIT_DBL num)
 static int
 bary_cmp(const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
+    size_t i;
     BARY_TRUNC(xds, xn);
     BARY_TRUNC(yds, yn);
 
@@ -387,11 +416,12 @@ bary_cmp(const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
     if (xn > yn)
         return 1;
 
-    while (xn-- && xds[xn] == yds[xn])
-        ;
-    if (xn == (size_t)-1)
+    for (i = 0; i < xn; i++)
+        if (xds[xn - i - 1] != yds[yn - i - 1])
+            break;
+    if (i == xn)
         return 0;
-    return xds[xn] < yds[xn] ? -1 : 1;
+    return xds[xn - i - 1] < yds[yn - i - 1] ? -1 : 1;
 }
 
 static BDIGIT
@@ -399,12 +429,12 @@ bary_small_lshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift)
 {
     size_t i;
     BDIGIT_DBL num = 0;
-    assert(0 <= shift && shift < BITSPERDIG);
+    RUBY_ASSERT(0 <= shift && shift < BITSPERDIG);
 
     for (i=0; i<n; i++) {
-	num = num | (BDIGIT_DBL)*xds++ << shift;
-	*zds++ = BIGLO(num);
-	num = BIGDN(num);
+        num = num | (BDIGIT_DBL)*xds++ << shift;
+        *zds++ = BIGLO(num);
+        num = BIGDN(num);
     }
     return BIGLO(num);
 }
@@ -412,27 +442,27 @@ bary_small_lshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift)
 static void
 bary_small_rshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift, BDIGIT higher_bdigit)
 {
+    size_t i;
     BDIGIT_DBL num = 0;
-    BDIGIT x;
 
-    assert(0 <= shift && shift < BITSPERDIG);
+    RUBY_ASSERT(0 <= shift && shift < BITSPERDIG);
 
     num = BIGUP(higher_bdigit);
-    while (n--) {
-	num = (num | xds[n]) >> shift;
-        x = xds[n];
-	zds[n] = BIGLO(num);
-	num = BIGUP(x);
+    for (i = 0; i < n; i++) {
+        BDIGIT x = xds[n - i - 1];
+        num = (num | x) >> shift;
+        zds[n - i - 1] = BIGLO(num);
+        num = BIGUP(x);
     }
 }
 
 static int
-bary_zero_p(BDIGIT *xds, size_t xn)
+bary_zero_p(const BDIGIT *xds, size_t xn)
 {
     if (xn == 0)
         return 1;
     do {
-	if (xds[--xn]) return 0;
+        if (xds[--xn]) return 0;
     } while (xn);
     return 1;
 }
@@ -440,15 +470,15 @@ bary_zero_p(BDIGIT *xds, size_t xn)
 static void
 bary_neg(BDIGIT *ds, size_t n)
 {
-    while (n--)
-        ds[n] = BIGLO(~ds[n]);
+    size_t i;
+    for (i = 0; i < n; i++)
+        ds[n - i - 1] = BIGLO(~ds[n - i - 1]);
 }
 
 static int
 bary_2comp(BDIGIT *ds, size_t n)
 {
     size_t i;
-    i = 0;
     for (i = 0; i < n; i++) {
         if (ds[i] != 0) {
             goto non_zero;
@@ -611,8 +641,12 @@ static int
 bytes_2comp(unsigned char *buf, size_t len)
 {
     size_t i;
-    for (i = 0; i < len; i++)
-        buf[i] = ~buf[i];
+    for (i = 0; i < len; i++) {
+        signed char c = buf[i];
+        signed int d = ~c;
+        unsigned int e = d & 0xFF;
+        buf[i] = e;
+    }
     for (i = 0; i < len; i++) {
         buf[i]++;
         if (buf[i] != 0)
@@ -662,7 +696,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                     return ((1 < de - dp || CLEAR_LOWBITS(d, 8) != 0) ? 2 : 1) * sign;
                 }
 #if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
-                if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
+                if (wordsize == 2 && (uintptr_t)words % RUBY_ALIGNOF(uint16_t) == 0) {
                     uint16_t u = (uint16_t)(d = dp[0]);
                     if (need_swap) u = swap16(u);
                     *((uint16_t *)words) = u;
@@ -670,7 +704,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                 }
 #endif
 #if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
-                if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
+                if (wordsize == 4 && (uintptr_t)words % RUBY_ALIGNOF(uint32_t) == 0) {
                     uint32_t u = (uint32_t)(d = dp[0]);
                     if (need_swap) u = swap32(u);
                     *((uint32_t *)words) = u;
@@ -678,7 +712,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                 }
 #endif
 #if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
-                if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
+                if (wordsize == 8 && (uintptr_t)words % RUBY_ALIGNOF(uint64_t) == 0) {
                     uint64_t u = (uint64_t)(d = dp[0]);
                     if (need_swap) u = swap64(u);
                     *((uint64_t *)words) = u;
@@ -693,7 +727,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                     return (1 < de - dp || FILL_LOWBITS(d, 8) != -1) ? -2 : -1;
                 }
 #if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
-                if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
+                if (wordsize == 2 && (uintptr_t)words % RUBY_ALIGNOF(uint16_t) == 0) {
                     uint16_t u = (uint16_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
                     if (need_swap) u = swap16(u);
                     *((uint16_t *)words) = u;
@@ -702,7 +736,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                 }
 #endif
 #if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
-                if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
+                if (wordsize == 4 && (uintptr_t)words % RUBY_ALIGNOF(uint32_t) == 0) {
                     uint32_t u = (uint32_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
                     if (need_swap) u = swap32(u);
                     *((uint32_t *)words) = u;
@@ -711,7 +745,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                 }
 #endif
 #if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
-                if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
+                if (wordsize == 8 && (uintptr_t)words % RUBY_ALIGNOF(uint64_t) == 0) {
                     uint64_t u = (uint64_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
                     if (need_swap) u = swap64(u);
                     *((uint64_t *)words) = u;
@@ -754,7 +788,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
         }
 #endif
         if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
-            wordsize % SIZEOF_BDIGIT == 0 && (uintptr_t)words % ALIGNOF(BDIGIT) == 0) {
+            wordsize % SIZEOF_BDIGIT == 0 && (uintptr_t)words % RUBY_ALIGNOF(BDIGIT) == 0) {
             size_t bdigits_per_word = wordsize / SIZEOF_BDIGIT;
             size_t src_num_bdigits = de - dp;
             size_t dst_num_bdigits = numwords * bdigits_per_word;
@@ -897,8 +931,6 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
     }
 
     if ((flags & INTEGER_PACK_2COMP) && (sign < 0 && numwords != 0)) {
-        unsigned char *buf;
-
         int word_num_partialbits;
         size_t word_num_fullbytes;
 
@@ -958,7 +990,7 @@ integer_unpack_num_bdigits_small(size_t numwords, size_t wordsize, size_t nails,
 {
     /* nlp_bits stands for number of leading padding bits */
     size_t num_bits = (wordsize * CHAR_BIT - nails) * numwords;
-    size_t num_bdigits = (num_bits + BITSPERDIG - 1) / BITSPERDIG;
+    size_t num_bdigits = roomof(num_bits, BITSPERDIG);
     *nlp_bits_ret = (int)(num_bdigits * BITSPERDIG - num_bits);
     return num_bdigits;
 }
@@ -968,7 +1000,7 @@ integer_unpack_num_bdigits_generic(size_t numwords, size_t wordsize, size_t nail
 {
     /* BITSPERDIG = SIZEOF_BDIGIT * CHAR_BIT */
     /* num_bits = (wordsize * CHAR_BIT - nails) * numwords */
-    /* num_bdigits = (num_bits + BITSPERDIG - 1) / BITSPERDIG */
+    /* num_bdigits = roomof(num_bits, BITSPERDIG) */
 
     /* num_bits = CHAR_BIT * (wordsize * numwords) - nails * numwords = CHAR_BIT * num_bytes1 - nails * numwords */
     size_t num_bytes1 = wordsize * numwords;
@@ -1030,14 +1062,13 @@ integer_unpack_num_bdigits(size_t numwords, size_t wordsize, size_t nails, int *
 
     if (numwords <= (SIZE_MAX - (BITSPERDIG-1)) / CHAR_BIT / wordsize) {
         num_bdigits = integer_unpack_num_bdigits_small(numwords, wordsize, nails, nlp_bits_ret);
-#ifdef DEBUG_INTEGER_PACK
-        {
+        if (debug_integer_pack) {
             int nlp_bits1;
             size_t num_bdigits1 = integer_unpack_num_bdigits_generic(numwords, wordsize, nails, &nlp_bits1);
-            assert(num_bdigits == num_bdigits1);
-            assert(*nlp_bits_ret == nlp_bits1);
+            RUBY_ASSERT(num_bdigits == num_bdigits1);
+            RUBY_ASSERT(*nlp_bits_ret == nlp_bits1);
+            (void)num_bdigits1;
         }
-#endif
     }
     else {
         num_bdigits = integer_unpack_num_bdigits_generic(numwords, wordsize, nails, nlp_bits_ret);
@@ -1076,6 +1107,13 @@ integer_unpack_single_bdigit(BDIGIT u, size_t size, int flags, BDIGIT *dp)
     return sign;
 }
 
+#ifdef HAVE_BUILTIN___BUILTIN_ASSUME_ALIGNED
+#define reinterpret_cast(type, value) (type) \
+    __builtin_assume_aligned((value), sizeof(*(type)NULL));
+#else
+#define reinterpret_cast(type, value) (type)value
+#endif
+
 static int
 bary_unpack_internal(BDIGIT *bdigits, size_t num_bdigits, const void *words, size_t numwords, size_t wordsize, size_t nails, int flags, int nlp_bits)
 {
@@ -1096,23 +1134,24 @@ bary_unpack_internal(BDIGIT *bdigits, size_t num_bdigits, const void *words, siz
                 return integer_unpack_single_bdigit(*(uint8_t *)buf, sizeof(uint8_t), flags, dp);
             }
 #if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
-            if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
-                uint16_t u = *(uint16_t *)buf;
+            if (wordsize == 2 && (uintptr_t)words % RUBY_ALIGNOF(uint16_t) == 0) {
+                uint16_t u = *reinterpret_cast(const uint16_t *, buf);
                 return integer_unpack_single_bdigit(need_swap ? swap16(u) : u, sizeof(uint16_t), flags, dp);
             }
 #endif
 #if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
-            if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
-                uint32_t u = *(uint32_t *)buf;
+            if (wordsize == 4 && (uintptr_t)words % RUBY_ALIGNOF(uint32_t) == 0) {
+                uint32_t u = *reinterpret_cast(const uint32_t *, buf);
                 return integer_unpack_single_bdigit(need_swap ? swap32(u) : u, sizeof(uint32_t), flags, dp);
             }
 #endif
 #if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
-            if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
-                uint64_t u = *(uint64_t *)buf;
+            if (wordsize == 8 && (uintptr_t)words % RUBY_ALIGNOF(uint64_t) == 0) {
+                uint64_t u = *reinterpret_cast(const uint64_t *, buf);
                 return integer_unpack_single_bdigit(need_swap ? swap64(u) : u, sizeof(uint64_t), flags, dp);
             }
 #endif
+#undef reinterpret_cast
         }
 #if !defined(WORDS_BIGENDIAN)
         if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
@@ -1237,7 +1276,7 @@ bary_unpack_internal(BDIGIT *bdigits, size_t num_bdigits, const void *words, siz
         }
         if (dd)
             *dp++ = (BDIGIT)dd;
-        assert(dp <= de);
+        RUBY_ASSERT(dp <= de);
         while (dp < de)
             *dp++ = 0;
 #undef PUSH_BITS
@@ -1296,7 +1335,7 @@ bary_unpack(BDIGIT *bdigits, size_t num_bdigits, const void *words, size_t numwo
 
     num_bdigits0 = integer_unpack_num_bdigits(numwords, wordsize, nails, &nlp_bits);
 
-    assert(num_bdigits0 <= num_bdigits);
+    RUBY_ASSERT(num_bdigits0 <= num_bdigits);
 
     sign = bary_unpack_internal(bdigits, num_bdigits0, words, numwords, wordsize, nails, flags, nlp_bits);
 
@@ -1315,16 +1354,16 @@ bary_subb(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     size_t i;
     size_t sn;
 
-    assert(xn <= zn);
-    assert(yn <= zn);
+    RUBY_ASSERT(xn <= zn);
+    RUBY_ASSERT(yn <= zn);
 
     sn = xn < yn ? xn : yn;
 
     num = borrow ? -1 : 0;
     for (i = 0; i < sn; i++) {
-	num += (BDIGIT_DBL_SIGNED)xds[i] - yds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        num += (BDIGIT_DBL_SIGNED)xds[i] - yds[i];
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     if (yn <= xn) {
         for (; i < xn; i++) {
@@ -1343,7 +1382,7 @@ bary_subb(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     }
     if (num == 0) goto num_is_zero;
     for (; i < zn; i++) {
-	zds[i] = BDIGMAX;
+        zds[i] = BDIGMAX;
     }
     return 1;
 
@@ -1351,10 +1390,10 @@ bary_subb(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     if (xds == zds && xn == zn)
         return 0;
     for (; i < xn; i++) {
-	zds[i] = xds[i];
+        zds[i] = xds[i];
     }
     for (; i < zn; i++) {
-	zds[i] = 0;
+        zds[i] = 0;
     }
     return 0;
 }
@@ -1377,31 +1416,31 @@ bary_addc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     BDIGIT_DBL num;
     size_t i;
 
-    assert(xn <= zn);
-    assert(yn <= zn);
+    RUBY_ASSERT(xn <= zn);
+    RUBY_ASSERT(yn <= zn);
 
     if (xn > yn) {
-	const BDIGIT *tds;
-	tds = xds; xds = yds; yds = tds;
-	i = xn; xn = yn; yn = i;
+        const BDIGIT *tds;
+        tds = xds; xds = yds; yds = tds;
+        i = xn; xn = yn; yn = i;
     }
 
     num = carry ? 1 : 0;
     for (i = 0; i < xn; i++) {
-	num += (BDIGIT_DBL)xds[i] + yds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        num += (BDIGIT_DBL)xds[i] + yds[i];
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     for (; i < yn; i++) {
         if (num == 0) goto num_is_zero;
-	num += yds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        num += yds[i];
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     for (; i < zn; i++) {
         if (num == 0) goto num_is_zero;
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     return num != 0;
 
@@ -1409,10 +1448,10 @@ bary_addc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     if (yds == zds && yn == zn)
         return 0;
     for (; i < yn; i++) {
-	zds[i] = yds[i];
+        zds[i] = yds[i];
     }
     for (; i < zn; i++) {
-	zds[i] = 0;
+        zds[i] = 0;
     }
     return 0;
 }
@@ -1428,7 +1467,9 @@ bary_add_one(BDIGIT *ds, size_t n)
 {
     size_t i;
     for (i = 0; i < n; i++) {
-	ds[i] = BIGLO(ds[i]+1);
+        BDIGIT_DBL n = ds[i];
+        n += 1;
+        ds[i] = BIGLO(n);
         if (ds[i] != 0)
             return 0;
     }
@@ -1440,7 +1481,7 @@ bary_mul_single(BDIGIT *zds, size_t zn, BDIGIT x, BDIGIT y)
 {
     BDIGIT_DBL n;
 
-    assert(2 <= zn);
+    RUBY_ASSERT(2 <= zn);
 
     n = (BDIGIT_DBL)x * y;
     bdigitdbl2bary(zds, 2, n);
@@ -1454,7 +1495,7 @@ bary_muladd_1xN(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
     BDIGIT_DBL dd;
     size_t j;
 
-    assert(zn > yn);
+    RUBY_ASSERT(zn > yn);
 
     if (x == 0)
         return 0;
@@ -1489,22 +1530,23 @@ bigdivrem_mulsub(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
     BDIGIT_DBL t2;
     BDIGIT_DBL_SIGNED num;
 
-    assert(zn == yn + 1);
+    RUBY_ASSERT(zn == yn + 1);
 
     num = 0;
     t2 = 0;
     i = 0;
 
     do {
-        BDIGIT_DBL ee;
+        BDIGIT_DBL_SIGNED ee;
         t2 += (BDIGIT_DBL)yds[i] * x;
         ee = num - BIGLO(t2);
-        num = (BDIGIT_DBL)zds[i] + ee;
+        num = (BDIGIT_DBL_SIGNED)zds[i] + ee;
         if (ee) zds[i] = BIGLO(num);
         num = BIGDN(num);
         t2 = BIGDN(t2);
     } while (++i < yn);
-    num += zds[i] - t2; /* borrow from high digit; don't update */
+    num -= (BDIGIT_DBL_SIGNED)t2;
+    num += (BDIGIT_DBL_SIGNED)zds[yn]; /* borrow from high digit; don't update */
     return num;
 }
 
@@ -1513,7 +1555,7 @@ bary_mulsub_1xN(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
 {
     BDIGIT_DBL_SIGNED num;
 
-    assert(zn == yn + 1);
+    RUBY_ASSERT(zn == yn + 1);
 
     num = bigdivrem_mulsub(zds, zn, x, yds, yn);
     zds[yn] = BIGLO(num);
@@ -1527,7 +1569,7 @@ bary_mul_normal(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIG
 {
     size_t i;
 
-    assert(xn + yn <= zn);
+    RUBY_ASSERT(xn + yn <= zn);
 
     BDIGITS_ZERO(zds, zn);
     for (i = 0; i < xn; i++) {
@@ -1548,7 +1590,7 @@ rb_big_mul_normal(VALUE x, VALUE y)
 
 /* efficient squaring (2 times faster than normal multiplication)
  * ref: Handbook of Applied Cryptography, Algorithm 14.16
- *      http://www.cacr.math.uwaterloo.ca/hac/about/chap14.pdf
+ *      https://www.cacr.math.uwaterloo.ca/hac/about/chap14.pdf
  */
 static void
 bary_sq_fast(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn)
@@ -1558,7 +1600,7 @@ bary_sq_fast(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn)
     BDIGIT vl;
     int vh;
 
-    assert(xn * 2 <= zn);
+    RUBY_ASSERT(xn * 2 <= zn);
 
     BDIGITS_ZERO(zds, zn);
 
@@ -1566,30 +1608,30 @@ bary_sq_fast(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn)
         return;
 
     for (i = 0; i < xn-1; i++) {
-	v = (BDIGIT_DBL)xds[i];
-	if (!v)
+        v = (BDIGIT_DBL)xds[i];
+        if (!v)
             continue;
-	c = (BDIGIT_DBL)zds[i + i] + v * v;
-	zds[i + i] = BIGLO(c);
-	c = BIGDN(c);
-	v *= 2;
+        c = (BDIGIT_DBL)zds[i + i] + v * v;
+        zds[i + i] = BIGLO(c);
+        c = BIGDN(c);
+        v *= 2;
         vl = BIGLO(v);
         vh = (int)BIGDN(v);
-	for (j = i + 1; j < xn; j++) {
-	    w = (BDIGIT_DBL)xds[j];
-	    c += (BDIGIT_DBL)zds[i + j] + vl * w;
-	    zds[i + j] = BIGLO(c);
-	    c = BIGDN(c);
-	    if (vh)
+        for (j = i + 1; j < xn; j++) {
+            w = (BDIGIT_DBL)xds[j];
+            c += (BDIGIT_DBL)zds[i + j] + vl * w;
+            zds[i + j] = BIGLO(c);
+            c = BIGDN(c);
+            if (vh)
                 c += w;
-	}
-	if (c) {
-	    c += (BDIGIT_DBL)zds[i + xn];
-	    zds[i + xn] = BIGLO(c);
-	    c = BIGDN(c);
+        }
+        if (c) {
+            c += (BDIGIT_DBL)zds[i + xn];
+            zds[i + xn] = BIGLO(c);
+            c = BIGDN(c);
             if (c)
                 zds[i + xn + 1] += (BDIGIT)c;
-	}
+        }
     }
 
     /* i == xn-1 */
@@ -1614,28 +1656,48 @@ rb_big_sq_fast(VALUE x)
     return z;
 }
 
+static inline size_t
+max_size(size_t a, size_t b)
+{
+    return (a > b ? a : b);
+}
+
 /* balancing multiplication by slicing larger argument */
 static void
-bary_mul_balance_with_mulfunc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn, mulfunc_t *mulfunc)
+bary_mul_balance_with_mulfunc(BDIGIT *const zds, const size_t zn,
+                              const BDIGIT *const xds, const size_t xn,
+                              const BDIGIT *const yds, const size_t yn,
+                              BDIGIT *wds, size_t wn, mulfunc_t *const mulfunc)
 {
     VALUE work = 0;
-    size_t yn0 = yn;
-    size_t r, n;
+    size_t n;
 
-    assert(xn + yn <= zn);
-    assert(xn <= yn);
-    assert(!KARATSUBA_BALANCED(xn, yn) || !TOOM3_BALANCED(xn, yn));
+    RUBY_ASSERT(xn + yn <= zn);
+    RUBY_ASSERT(xn <= yn);
+    RUBY_ASSERT(!KARATSUBA_BALANCED(xn, yn) || !TOOM3_BALANCED(xn, yn));
 
     BDIGITS_ZERO(zds, xn);
 
+    if (wn < xn) {
+        /* The condition when a new buffer is needed:
+         * 1. (2(xn+r) > zn-(yn-r)) => (2xn+r > zn-yn), at the last
+         *    iteration (or r == 0)
+         * 2. (2(xn+xn) > zn-(yn-r-xn)) => (3xn-r > zn-yn), at the
+         *    previous iteration.
+         */
+        const size_t r = yn % xn;
+        if (2*xn + yn + max_size(xn-r, r) > zn) {
+            wn = xn;
+            wds = ALLOCV_N(BDIGIT, work, wn);
+        }
+    }
+
     n = 0;
-    while (yn > 0) {
-        BDIGIT *tds;
-        size_t tn;
-	r = xn > yn ? yn : xn;
-        tn = xn + r;
+    while (yn > n) {
+        const size_t r = (xn > (yn - n) ? (yn - n) : xn);
+        const size_t tn = (xn + r);
         if (2 * (xn + r) <= zn - n) {
-            tds = zds + n + xn + r;
+            BDIGIT *const tds = zds + n + xn + r;
             mulfunc(tds, tn, xds, xn, yds + n, r, wds, wn);
             BDIGITS_ZERO(zds + n + xn, r);
             bary_add(zds + n, tn,
@@ -1643,21 +1705,25 @@ bary_mul_balance_with_mulfunc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t
                      tds, tn);
         }
         else {
+            BDIGIT *const tds = zds + n;
             if (wn < xn) {
+                /* xn is invariant, only once here */
+#if 0
                 wn = xn;
                 wds = ALLOCV_N(BDIGIT, work, wn);
+#else
+                rb_bug("wds is not enough: %" PRIdSIZE " for %" PRIdSIZE, wn, xn);
+#endif
             }
-            tds = zds + n;
             MEMCPY(wds, zds + n, BDIGIT, xn);
             mulfunc(tds, tn, xds, xn, yds + n, r, wds+xn, wn-xn);
             bary_add(zds + n, tn,
                      zds + n, tn,
                      wds, xn);
         }
-	yn -= r;
-	n += r;
+        n += r;
     }
-    BDIGITS_ZERO(zds+xn+yn0, zn - (xn+yn0));
+    BDIGITS_ZERO(zds+xn+yn, zn - (xn+yn));
 
     if (work)
         ALLOCV_END(work);
@@ -1690,9 +1756,9 @@ bary_mul_karatsuba(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const B
     const BDIGIT *xds0, *xds1, *yds0, *yds1;
     BDIGIT *zds0, *zds1, *zds2, *zds3;
 
-    assert(xn + yn <= zn);
-    assert(xn <= yn);
-    assert(yn < 2 * xn);
+    RUBY_ASSERT(xn + yn <= zn);
+    RUBY_ASSERT(xn <= yn);
+    RUBY_ASSERT(yn < 2 * xn);
 
     sq = xds == yds && xn == yn;
 
@@ -1707,7 +1773,7 @@ bary_mul_karatsuba(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const B
 
     n = yn / 2;
 
-    assert(n < xn);
+    RUBY_ASSERT(n < xn);
 
     if (wn < n) {
         /* This function itself needs only n BDIGITs for work area.
@@ -1828,7 +1894,7 @@ bary_mul_karatsuba(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const B
         for (x = 0, i = xn-1; 0 <= i; i--) { x <<= SIZEOF_BDIGIT*CHAR_BIT; x |= xds[i]; }
         for (y = 0, i = yn-1; 0 <= i; i--) { y <<= SIZEOF_BDIGIT*CHAR_BIT; y |= yds[i]; }
         for (z = 0, i = zn-1; 0 <= i; i--) { z <<= SIZEOF_BDIGIT*CHAR_BIT; z |= zds[i]; }
-        assert(z == x * y);
+        RUBY_ASSERT(z == x * y);
     }
     */
 
@@ -1896,11 +1962,11 @@ bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGI
 
     int sq = xds == yds && xn == yn;
 
-    assert(xn <= yn);  /* assume y >= x */
-    assert(xn + yn <= zn);
+    RUBY_ASSERT(xn <= yn);  /* assume y >= x */
+    RUBY_ASSERT(xn + yn <= zn);
 
     n = (yn + 2) / 3;
-    assert(2*n < xn);
+    RUBY_ASSERT(2*n < xn);
 
     wnc = 0;
 
@@ -1974,7 +2040,7 @@ bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGI
     }
 
     /*
-     * ref. http://en.wikipedia.org/wiki/Toom%E2%80%93Cook_multiplication
+     * ref. https://en.wikipedia.org/wiki/Toom%E2%80%93Cook_multiplication
      *
      * x(b) = x0 * b^0 + x1 * b^1 + x2 * b^2
      * y(b) = y0 * b^0 + y1 * b^1 + y2 * b^2
@@ -2047,21 +2113,21 @@ bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGI
         v3n = u3n; v3ds = u3ds; v3p = u3p;
     }
     else {
-	/* v1 <- y0 + y2 */
+        /* v1 <- y0 + y2 */
         bary_add(v1ds, v1n, y0ds, y0n, y2ds, y2n);
         v1p = 1;
 
-	/* y(-1) : v2 <- v1 - y1 = y0 - y1 + y2 */
+        /* y(-1) : v2 <- v1 - y1 = y0 - y1 + y2 */
         v2p = 1;
         if (bary_sub(v2ds, v2n, v1ds, v1n, y1ds, y1n)) {
             bary_2comp(v2ds, v2n);
             v2p = 0;
         }
 
-	/* y(1) : v1 <- v1 + y1 = y0 + y1 + y2 */
+        /* y(1) : v1 <- v1 + y1 = y0 + y1 + y2 */
         bary_add(v1ds, v1n, v1ds, v1n, y1ds, y1n);
 
-	/* y(-2) : v3 <- 2 * (v2 + y2) - y0 = y0 - 2 * (y1 - 2 * y2) */
+        /* y(-2) : v3 <- 2 * (v2 + y2) - y0 = y0 - 2 * (y1 - 2 * y2) */
         v3p = 1;
         if (v2p) {
             bary_add(v3ds, v3n, v2ds, v2n, y2ds, y2n);
@@ -2087,19 +2153,19 @@ bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGI
     /* z(1) : t1 <- u1 * v1 */
     bary_mul_toom3_start(t1ds, t1n, u1ds, u1n, v1ds, v1n, wds, wn);
     t1p = u1p == v1p;
-    assert(t1ds[t1n-1] == 0);
+    RUBY_ASSERT(t1ds[t1n-1] == 0);
     t1n--;
 
     /* z(-1) : t2 <- u2 * v2 */
     bary_mul_toom3_start(t2ds, t2n, u2ds, u2n, v2ds, v2n, wds, wn);
     t2p = u2p == v2p;
-    assert(t2ds[t2n-1] == 0);
+    RUBY_ASSERT(t2ds[t2n-1] == 0);
     t2n--;
 
     /* z(-2) : t3 <- u3 * v3 */
     bary_mul_toom3_start(t3ds, t3n, u3ds, u3n, v3ds, v3n, wds, wn);
     t3p = u3p == v3p;
-    assert(t3ds[t3n-1] == 0);
+    RUBY_ASSERT(t3ds[t3n-1] == 0);
     t3n--;
 
     /* z(inf) : t4 <- x2 * y2 */
@@ -2254,28 +2320,41 @@ rb_big_mul_toom3(VALUE x, VALUE y)
     return z;
 }
 
-#ifdef USE_GMP
+#if USE_GMP
+static inline void
+bdigits_to_mpz(mpz_t mp, const BDIGIT *digits, size_t len)
+{
+    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+    mpz_import(mp, len, -1, sizeof(BDIGIT), 0, nails, digits);
+}
+
+static inline void
+bdigits_from_mpz(mpz_t mp, BDIGIT *digits, size_t *len)
+{
+    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+    mpz_export(digits, len, -1, sizeof(BDIGIT), 0, nails, mp);
+}
+
 static void
 bary_mul_gmp(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
     mpz_t x, y, z;
     size_t count;
 
-    assert(xn + yn <= zn);
+    RUBY_ASSERT(xn + yn <= zn);
 
     mpz_init(x);
     mpz_init(y);
     mpz_init(z);
-    mpz_import(x, xn, -1, sizeof(BDIGIT), 0, nails, xds);
+    bdigits_to_mpz(x, xds, xn);
     if (xds == yds && xn == yn) {
         mpz_mul(z, x, x);
     }
     else {
-        mpz_import(y, yn, -1, sizeof(BDIGIT), 0, nails, yds);
+        bdigits_to_mpz(y, yds, yn);
         mpz_mul(z, x, y);
     }
-    mpz_export(zds, &count, -1, sizeof(BDIGIT), 0, nails, z);
+    bdigits_from_mpz(z, zds, &count);
     BDIGITS_ZERO(zds+count, zn-count);
     mpz_clear(x);
     mpz_clear(y);
@@ -2297,7 +2376,7 @@ rb_big_mul_gmp(VALUE x, VALUE y)
 static void
 bary_short_mul(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-    assert(xn + yn <= zn);
+    RUBY_ASSERT(xn + yn <= zn);
 
     if (xn == 1 && yn == 1) {
         bary_mul_single(zds, zn, xds[0], yds[0]);
@@ -2314,9 +2393,9 @@ bary_sparse_p(const BDIGIT *ds, size_t n)
 {
     long c = 0;
 
-    if (          ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
-    if (c <= 1 && ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
-    if (c <= 1 && ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
+    if (          ds[2 * n / 5]) c++;
+    if (c <= 1 && ds[    n / 2]) c++;
+    if (c <= 1 && ds[3 * n / 5]) c++;
 
     return (c <= 1) ? 1 : 0;
 }
@@ -2333,7 +2412,7 @@ bary_mul_precheck(BDIGIT **zdsp, size_t *znp, const BDIGIT **xdsp, size_t *xnp,
     const BDIGIT *yds = *ydsp;
     size_t yn = *ynp;
 
-    assert(xn + yn <= zn);
+    RUBY_ASSERT(xn + yn <= zn);
 
     nlsz = 0;
 
@@ -2379,10 +2458,10 @@ bary_mul_precheck(BDIGIT **zdsp, size_t *znp, const BDIGIT **xdsp, size_t *xnp,
     if (xn > yn) {
         const BDIGIT *tds;
         size_t tn;
-	tds = xds; xds = yds; yds = tds;
-	tn = xn; xn = yn; yn = tn;
+        tds = xds; xds = yds; yds = tds;
+        tn = xn; xn = yn; yn = tn;
     }
-    assert(xn <= yn);
+    RUBY_ASSERT(xn <= yn);
 
     if (xn <= 1) {
         if (xn == 0) {
@@ -2424,12 +2503,7 @@ bary_mul_karatsuba_branch(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn,
 {
     /* normal multiplication when x is small */
     if (xn < KARATSUBA_MUL_DIGITS) {
-      normal:
-        if (xds == yds && xn == yn)
-            bary_sq_fast(zds, zn, xds, xn);
-        else
-            bary_short_mul(zds, zn, xds, xn, yds, yn);
-        return;
+        goto normal;
     }
 
     /* normal multiplication when x or y is a sparse bignum */
@@ -2447,6 +2521,15 @@ bary_mul_karatsuba_branch(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn,
 
     /* multiplication by karatsuba method */
     bary_mul_karatsuba(zds, zn, xds, xn, yds, yn, wds, wn);
+    return;
+
+  normal:
+    if (xds == yds && xn == yn) {
+        bary_sq_fast(zds, zn, xds, xn);
+    }
+    else {
+        bary_short_mul(zds, zn, xds, xn, yds, yn);
+    }
 }
 
 static void
@@ -2486,13 +2569,8 @@ bary_mul_toom3_start(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const
 static void
 bary_mul(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-#ifdef USE_GMP
-    const size_t naive_threshold = GMP_MUL_DIGITS;
-#else
-    const size_t naive_threshold = KARATSUBA_MUL_DIGITS;
-#endif
     if (xn <= yn) {
-        if (xn < naive_threshold) {
+        if (xn < NAIVE_MUL_DIGITS) {
             if (xds == yds && xn == yn)
                 bary_sq_fast(zds, zn, xds, xn);
             else
@@ -2501,13 +2579,13 @@ bary_mul(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds
         }
     }
     else {
-        if (yn < naive_threshold) {
+        if (yn < NAIVE_MUL_DIGITS) {
             bary_short_mul(zds, zn, yds, yn, xds, xn);
             return;
         }
     }
 
-#ifdef USE_GMP
+#if USE_GMP
     bary_mul_gmp(zds, zn, xds, xn, yds, yn);
 #else
     bary_mul_toom3_start(zds, zn, xds, xn, yds, yn, NULL, 0);
@@ -2531,30 +2609,31 @@ bigdivrem1(void *ptr)
     BDIGIT q;
 
     do {
-	if (bds->stop) {
-	    bds->zn = zn;
-	    return 0;
+        if (bds->stop) {
+            bds->zn = zn;
+            return 0;
         }
-	if (zds[zn-1] == yds[yn-1]) q = BDIGMAX;
-	else q = (BDIGIT)((BIGUP(zds[zn-1]) + zds[zn-2])/yds[yn-1]);
-	if (q) {
+        if (zds[zn-1] == yds[yn-1]) q = BDIGMAX;
+        else q = (BDIGIT)((BIGUP(zds[zn-1]) + zds[zn-2])/yds[yn-1]);
+        if (q) {
             num = bigdivrem_mulsub(zds+zn-(yn+1), yn+1,
                                    q,
                                    yds, yn);
-	    while (num) { /* "add back" required */
-		q--;
+            while (num) { /* "add back" required */
+                q--;
                 num = bary_add(zds+zn-(yn+1), yn,
                                zds+zn-(yn+1), yn,
                                yds, yn);
                 num--;
-	    }
-	}
+            }
+        }
         zn--;
-	zds[zn] = q;
+        zds[zn] = q;
     } while (zn > yn);
     return 0;
 }
 
+/* async-signal-safe */
 static void
 rb_big_stop(void *ptr)
 {
@@ -2565,8 +2644,8 @@ rb_big_stop(void *ptr)
 static BDIGIT
 bigdivrem_single1(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT x_higher_bdigit, BDIGIT y)
 {
-    assert(0 < xn);
-    assert(x_higher_bdigit < y);
+    RUBY_ASSERT(0 < xn);
+    RUBY_ASSERT(x_higher_bdigit < y);
     if (POW2_P(y)) {
         BDIGIT r;
         r = xds[0] & (y-1);
@@ -2577,10 +2656,9 @@ bigdivrem_single1(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT x_higher_bdi
         size_t i;
         BDIGIT_DBL t2;
         t2 = x_higher_bdigit;
-        i = xn;
-        while (i--) {
-            t2 = BIGUP(t2) + xds[i];
-            qds[i] = (BDIGIT)(t2 / y);
+        for (i = 0; i < xn; i++) {
+            t2 = BIGUP(t2) + xds[xn - i - 1];
+            qds[xn - i - 1] = (BDIGIT)(t2 / y);
             t2 %= y;
         }
         return (BDIGIT)t2;
@@ -2599,9 +2677,9 @@ bigdivrem_restoring(BDIGIT *zds, size_t zn, BDIGIT *yds, size_t yn)
     struct big_div_struct bds;
     size_t ynzero;
 
-    assert(yn < zn);
-    assert(BDIGIT_MSB(yds[yn-1]));
-    assert(zds[zn-1] < yds[yn-1]);
+    RUBY_ASSERT(yn < zn);
+    RUBY_ASSERT(BDIGIT_MSB(yds[yn-1]));
+    RUBY_ASSERT(zds[zn-1] < yds[yn-1]);
 
     for (ynzero = 0; !yds[ynzero]; ynzero++);
 
@@ -2619,16 +2697,16 @@ bigdivrem_restoring(BDIGIT *zds, size_t zn, BDIGIT *yds, size_t yn)
     bds.zn = zn - ynzero;
     if (bds.zn > 10000 || bds.yn > 10000) {
       retry:
-	bds.stop = Qfalse;
-	rb_thread_call_without_gvl(bigdivrem1, &bds, rb_big_stop, &bds);
+        bds.stop = Qfalse;
+        rb_nogvl(bigdivrem1, &bds, rb_big_stop, &bds, RB_NOGVL_UBF_ASYNC_SAFE | RB_NOGVL_OFFLOAD_SAFE);
 
-	if (bds.stop == Qtrue) {
-	    /* execute trap handler, but exception was not raised. */
-	    goto retry;
-	}
+        if (bds.stop == Qtrue) {
+            /* execute trap handler, but exception was not raised. */
+            goto retry;
+        }
     }
     else {
-	bigdivrem1(&bds);
+        bigdivrem1(&bds);
     }
 }
 
@@ -2640,9 +2718,9 @@ bary_divmod_normal(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT
     size_t zn;
     VALUE tmpyz = 0;
 
-    assert(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
-    assert(qds ? (xn - yn + 1) <= qn : 1);
-    assert(rds ? yn <= rn : 1);
+    RUBY_ASSERT(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
+    RUBY_ASSERT(qds ? (xn - yn + 1) <= qn : 1);
+    RUBY_ASSERT(rds ? yn <= rn : 1);
 
     zn = xn + BIGDIVREM_EXTRA_WORDS;
 
@@ -2727,26 +2805,25 @@ rb_big_divrem_normal(VALUE x, VALUE y)
     return rb_assoc_new(q, r);
 }
 
-#ifdef USE_GMP
+#if USE_GMP
 static void
 bary_divmod_gmp(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
     mpz_t x, y, q, r;
     size_t count;
 
-    assert(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
-    assert(qds ? (xn - yn + 1) <= qn : 1);
-    assert(rds ? yn <= rn : 1);
-    assert(qds || rds);
+    RUBY_ASSERT(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
+    RUBY_ASSERT(qds ? (xn - yn + 1) <= qn : 1);
+    RUBY_ASSERT(rds ? yn <= rn : 1);
+    RUBY_ASSERT(qds || rds);
 
     mpz_init(x);
     mpz_init(y);
     if (qds) mpz_init(q);
     if (rds) mpz_init(r);
 
-    mpz_import(x, xn, -1, sizeof(BDIGIT), 0, nails, xds);
-    mpz_import(y, yn, -1, sizeof(BDIGIT), 0, nails, yds);
+    bdigits_to_mpz(x, xds, xn);
+    bdigits_to_mpz(y, yds, yn);
 
     if (!rds) {
         mpz_fdiv_q(q, x, y);
@@ -2762,13 +2839,13 @@ bary_divmod_gmp(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xd
     mpz_clear(y);
 
     if (qds) {
-        mpz_export(qds, &count, -1, sizeof(BDIGIT), 0, nails, q);
+        bdigits_from_mpz(q, qds, &count);
         BDIGITS_ZERO(qds+count, qn-count);
         mpz_clear(q);
     }
 
     if (rds) {
-        mpz_export(rds, &count, -1, sizeof(BDIGIT), 0, nails, r);
+        bdigits_from_mpz(r, rds, &count);
         BDIGITS_ZERO(rds+count, rn-count);
         mpz_clear(r);
     }
@@ -2812,7 +2889,7 @@ rb_big_divrem_gmp(VALUE x, VALUE y)
 static void
 bary_divmod_branch(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-#ifdef USE_GMP
+#if USE_GMP
     if (GMP_DIV_DIGITS < xn) {
         bary_divmod_gmp(qds, qn, rds, rn, xds, xn, yds, yn);
         return;
@@ -2824,8 +2901,8 @@ bary_divmod_branch(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT
 static void
 bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-    assert(xn <= qn);
-    assert(yn <= rn);
+    RUBY_ASSERT(xn <= qn);
+    RUBY_ASSERT(yn <= rn);
 
     BARY_TRUNC(yds, yn);
     if (yn == 0)
@@ -2867,29 +2944,8 @@ bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, s
 }
 
 
-#define BIGNUM_DEBUG 0
-#if BIGNUM_DEBUG
-#define ON_DEBUG(x) do { x; } while (0)
-static void
-dump_bignum(VALUE x)
-{
-    long i;
-    printf("%c0x0", BIGNUM_SIGN(x) ? '+' : '-');
-    for (i = BIGNUM_LEN(x); i--; ) {
-        printf("_%0*"PRIxBDIGIT, SIZEOF_BDIGIT*2, BDIGITS(x)[i]);
-    }
-    printf(", len=%"PRIuSIZE, BIGNUM_LEN(x));
-    puts("");
-}
-
-static VALUE
-rb_big_dump(VALUE x)
-{
-    dump_bignum(x);
-    return x;
-}
-#else
-#define ON_DEBUG(x)
+#ifndef BIGNUM_DEBUG
+# define BIGNUM_DEBUG (0+RUBY_DEBUG)
 #endif
 
 static int
@@ -2908,7 +2964,7 @@ int
 rb_cmpint(VALUE val, VALUE a, VALUE b)
 {
     if (NIL_P(val)) {
-	rb_cmperr(a, b);
+        rb_cmperr(a, b);
     }
     if (FIXNUM_P(val)) {
         long l = FIX2LONG(val);
@@ -2917,9 +2973,9 @@ rb_cmpint(VALUE val, VALUE a, VALUE b)
         return 0;
     }
     if (RB_BIGNUM_TYPE_P(val)) {
-	if (BIGZEROP(val)) return 0;
-	if (BIGNUM_SIGN(val)) return 1;
-	return -1;
+        if (BIGZEROP(val)) return 0;
+        if (BIGNUM_SIGN(val)) return 1;
+        return -1;
     }
     if (RTEST(rb_funcall(val, '>', 1, INT2FIX(0)))) return 1;
     if (RTEST(rb_funcall(val, '<', 1, INT2FIX(0)))) return -1;
@@ -2927,44 +2983,75 @@ rb_cmpint(VALUE val, VALUE a, VALUE b)
 }
 
 #define BIGNUM_SET_LEN(b,l) \
-    ((RBASIC(b)->flags & BIGNUM_EMBED_FLAG) ? \
+    (BIGNUM_EMBED_P(b) ? \
      (void)(RBASIC(b)->flags = \
-	    (RBASIC(b)->flags & ~BIGNUM_EMBED_LEN_MASK) | \
-	    ((l) << BIGNUM_EMBED_LEN_SHIFT)) : \
+            (RBASIC(b)->flags & ~BIGNUM_EMBED_LEN_MASK) | \
+            ((l) << BIGNUM_EMBED_LEN_SHIFT)) : \
      (void)(RBIGNUM(b)->as.heap.len = (l)))
 
+static size_t
+big_embed_capa(VALUE big)
+{
+    size_t size = rb_gc_obj_slot_size(big) - offsetof(struct RBignum, as.ary);
+    RUBY_ASSERT(size % sizeof(BDIGIT) == 0);
+    size_t capa = size / sizeof(BDIGIT);
+    RUBY_ASSERT(capa <= BIGNUM_EMBED_LEN_MAX);
+    return capa;
+}
+
+static size_t
+big_embed_size(size_t capa)
+{
+    size_t size = offsetof(struct RBignum, as.ary) + (sizeof(BDIGIT) * capa);
+    if (size < sizeof(struct RBignum)) {
+        size = sizeof(struct RBignum);
+    }
+    return size;
+}
+
+static bool
+big_embeddable_p(size_t capa)
+{
+    if (capa > BIGNUM_EMBED_LEN_MAX) {
+        return false;
+    }
+    return rb_gc_size_allocatable_p(big_embed_size(capa));
+}
+
 static void
 rb_big_realloc(VALUE big, size_t len)
 {
     BDIGIT *ds;
-    if (RBASIC(big)->flags & BIGNUM_EMBED_FLAG) {
-	if (BIGNUM_EMBED_LEN_MAX < len) {
-	    ds = ALLOC_N(BDIGIT, len);
-	    MEMCPY(ds, RBIGNUM(big)->as.ary, BDIGIT, BIGNUM_EMBED_LEN_MAX);
-	    RBIGNUM(big)->as.heap.len = BIGNUM_LEN(big);
-	    RBIGNUM(big)->as.heap.digits = ds;
-	    RBASIC(big)->flags &= ~BIGNUM_EMBED_FLAG;
-	}
+    size_t embed_capa = big_embed_capa(big);
+
+    if (BIGNUM_EMBED_P(big)) {
+        if (embed_capa < len) {
+            ds = ALLOC_N(BDIGIT, len);
+            MEMCPY(ds, RBIGNUM(big)->as.ary, BDIGIT, embed_capa);
+            RBIGNUM(big)->as.heap.len = BIGNUM_LEN(big);
+            RBIGNUM(big)->as.heap.digits = ds;
+            FL_UNSET_RAW(big, BIGNUM_EMBED_FLAG);
+        }
     }
     else {
-	if (len <= BIGNUM_EMBED_LEN_MAX) {
-	    ds = RBIGNUM(big)->as.heap.digits;
-	    RBASIC(big)->flags |= BIGNUM_EMBED_FLAG;
-	    BIGNUM_SET_LEN(big, len);
-            (void)VALGRIND_MAKE_MEM_UNDEFINED((void*)RBIGNUM(big)->as.ary, sizeof(RBIGNUM(big)->as.ary));
-	    if (ds) {
-		MEMCPY(RBIGNUM(big)->as.ary, ds, BDIGIT, len);
-		xfree(ds);
-	    }
-	}
-	else {
-	    if (BIGNUM_LEN(big) == 0) {
-		RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
-	    }
-	    else {
-		REALLOC_N(RBIGNUM(big)->as.heap.digits, BDIGIT, len);
-	    }
-	}
+        if (len <= embed_capa) {
+            ds = RBIGNUM(big)->as.heap.digits;
+            FL_SET_RAW(big, BIGNUM_EMBED_FLAG);
+            BIGNUM_SET_LEN(big, len);
+            (void)VALGRIND_MAKE_MEM_UNDEFINED((void*)RBIGNUM(big)->as.ary, embed_capa * sizeof(BDIGIT));
+            if (ds) {
+                MEMCPY(RBIGNUM(big)->as.ary, ds, BDIGIT, len);
+                xfree(ds);
+            }
+        }
+        else {
+            if (BIGNUM_LEN(big) == 0) {
+                RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
+            }
+            else if (BIGNUM_LEN(big) < len) {
+                REALLOC_N(RBIGNUM(big)->as.heap.digits, BDIGIT, len);
+            }
+        }
     }
 }
 
@@ -2978,25 +3065,37 @@ rb_big_resize(VALUE big, size_t len)
 static VALUE
 bignew_1(VALUE klass, size_t len, int sign)
 {
-    NEWOBJ_OF(big, struct RBignum, klass, T_BIGNUM | (RGENGC_WB_PROTECTED_BIGNUM ? FL_WB_PROTECTED : 0));
-    BIGNUM_SET_SIGN(big, sign?1:0);
-    if (len <= BIGNUM_EMBED_LEN_MAX) {
-	RBASIC(big)->flags |= BIGNUM_EMBED_FLAG;
-	BIGNUM_SET_LEN(big, len);
-        (void)VALGRIND_MAKE_MEM_UNDEFINED((void*)RBIGNUM(big)->as.ary, sizeof(RBIGNUM(big)->as.ary));
+    VALUE bigv;
+
+    if (big_embeddable_p(len)) {
+        size_t size = big_embed_size(len);
+        RUBY_ASSERT(rb_gc_size_allocatable_p(size));
+        NEWOBJ_OF(big, struct RBignum, klass,
+                T_BIGNUM | BIGNUM_EMBED_FLAG | (RGENGC_WB_PROTECTED_BIGNUM ? FL_WB_PROTECTED : 0),
+                size, 0);
+        bigv = (VALUE)big;
+        BIGNUM_SET_SIGN(bigv, sign);
+        BIGNUM_SET_LEN(bigv, len);
+        (void)VALGRIND_MAKE_MEM_UNDEFINED((void*)big->as.ary, len * sizeof(BDIGIT));
     }
     else {
-	RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
-	RBIGNUM(big)->as.heap.len = len;
+        NEWOBJ_OF(big, struct RBignum, klass,
+                T_BIGNUM | (RGENGC_WB_PROTECTED_BIGNUM ? FL_WB_PROTECTED : 0), sizeof(struct RBignum), 0);
+        bigv = (VALUE)big;
+        BIGNUM_SET_SIGN(bigv, sign);
+        big->as.heap.digits = ALLOC_N(BDIGIT, len);
+        big->as.heap.len = len;
     }
-    OBJ_FREEZE(big);
-    return (VALUE)big;
+    OBJ_FREEZE(bigv);
+    return bigv;
 }
 
 VALUE
 rb_big_new(size_t len, int sign)
 {
-    return bignew(len, sign != 0);
+    VALUE obj = bignew(len, sign != 0);
+    memset(BIGNUM_DIGITS(obj), 0, len * sizeof(BDIGIT));
+    return obj;
 }
 
 VALUE
@@ -3049,7 +3148,7 @@ abs2twocomp(VALUE *xp, long *n_ret)
         MEMCPY(BDIGITS(z), ds, BDIGIT, n);
         bary_2comp(BDIGITS(z), n);
         hibits = BDIGMAX;
-	*xp = z;
+        *xp = z;
     }
     *n_ret = n;
     return hibits;
@@ -3073,7 +3172,7 @@ bigtrunc(VALUE x)
     if (len == 0) return x;
     while (--len && !ds[len]);
     if (BIGNUM_LEN(x) > len+1) {
-	rb_big_resize(x, len+1);
+        rb_big_resize(x, len+1);
     }
     return x;
 }
@@ -3126,7 +3225,7 @@ static VALUE
 bignorm(VALUE x)
 {
     if (RB_BIGNUM_TYPE_P(x)) {
-	x = bigfixize(x);
+        x = bigfixize(x);
     }
     return x;
 }
@@ -3138,7 +3237,7 @@ rb_big_norm(VALUE x)
 }
 
 VALUE
-rb_uint2big(VALUE n)
+rb_uint2big(uintptr_t n)
 {
     long i;
     VALUE big = bignew(bdigit_roomof(SIZEOF_VALUE), 1);
@@ -3148,8 +3247,8 @@ rb_uint2big(VALUE n)
     digits[0] = n;
 #else
     for (i = 0; i < bdigit_roomof(SIZEOF_VALUE); i++) {
-	digits[i] = BIGLO(n);
-	n = BIGDN(n);
+        digits[i] = BIGLO(n);
+        n = BIGDN(n);
     }
 #endif
 
@@ -3160,7 +3259,7 @@ rb_uint2big(VALUE n)
 }
 
 VALUE
-rb_int2big(SIGNED_VALUE n)
+rb_int2big(intptr_t n)
 {
     long neg = 0;
     VALUE u;
@@ -3168,27 +3267,27 @@ rb_int2big(SIGNED_VALUE n)
 
     if (n < 0) {
         u = 1 + (VALUE)(-(n + 1)); /* u = -n avoiding overflow */
-	neg = 1;
+        neg = 1;
     }
     else {
         u = n;
     }
     big = rb_uint2big(u);
     if (neg) {
-	BIGNUM_SET_SIGN(big, 0);
+        BIGNUM_SET_NEGATIVE_SIGN(big);
     }
     return big;
 }
 
 VALUE
-rb_uint2inum(VALUE n)
+rb_uint2inum(uintptr_t n)
 {
     if (POSFIXABLE(n)) return LONG2FIX(n);
     return rb_uint2big(n);
 }
 
 VALUE
-rb_int2inum(SIGNED_VALUE n)
+rb_int2inum(intptr_t n)
 {
     if (FIXABLE(n)) return LONG2FIX(n);
     return rb_int2big(n);
@@ -3334,7 +3433,7 @@ absint_numwords_generic(size_t numbytes, int nlz_bits_in_msbyte, size_t word_num
 
     if (sign == 2) {
 #if defined __GNUC__ && (__GNUC__ == 4 && __GNUC_MINOR__ == 4)
-	*nlz_bits_ret = 0;
+        *nlz_bits_ret = 0;
 #endif
         return (size_t)-1;
     }
@@ -3367,7 +3466,7 @@ rb_absint_numwords(VALUE val, size_t word_numbits, size_t *nlz_bits_ret)
     size_t numbytes;
     int nlz_bits_in_msbyte;
     size_t numwords;
-    size_t nlz_bits;
+    size_t nlz_bits = 0;
 
     if (word_numbits == 0)
         return (size_t)-1;
@@ -3376,14 +3475,13 @@ rb_absint_numwords(VALUE val, size_t word_numbits, size_t *nlz_bits_ret)
 
     if (numbytes <= SIZE_MAX / CHAR_BIT) {
         numwords = absint_numwords_small(numbytes, nlz_bits_in_msbyte, word_numbits, &nlz_bits);
-#ifdef DEBUG_INTEGER_PACK
-        {
+        if (debug_integer_pack) {
             size_t numwords0, nlz_bits0;
             numwords0 = absint_numwords_generic(numbytes, nlz_bits_in_msbyte, word_numbits, &nlz_bits0);
-            assert(numwords0 == numwords);
-            assert(nlz_bits0 == nlz_bits);
+            RUBY_ASSERT(numwords0 == numwords);
+            RUBY_ASSERT(nlz_bits0 == nlz_bits);
+            (void)numwords0;
         }
-#endif
     }
     else {
         numwords = absint_numwords_generic(numbytes, nlz_bits_in_msbyte, word_numbits, &nlz_bits);
@@ -3569,7 +3667,7 @@ rb_integer_pack(VALUE val, void *words, size_t numwords, size_t wordsize, size_t
 }
 
 /*
- * Import an integer into a buffer.
+ * Import an integer from a buffer.
  *
  * [words] buffer to import.
  * [numwords] the size of given buffer as number of words.
@@ -3653,7 +3751,7 @@ rb_integer_unpack(const void *words, size_t numwords, size_t wordsize, size_t na
         }
         else if (num_bdigits == numberof(fixbuf)) {
             val = bignew((long)num_bdigits+1, 0);
-	    MEMCPY(BDIGITS(val), fixbuf, BDIGIT, num_bdigits);
+            MEMCPY(BDIGITS(val), fixbuf, BDIGIT, num_bdigits);
             BDIGITS(val)[num_bdigits++] = 1;
         }
         else {
@@ -3665,11 +3763,11 @@ rb_integer_unpack(const void *words, size_t numwords, size_t wordsize, size_t na
         BDIGIT_DBL u = fixbuf[0] + BIGUP(fixbuf[1]);
         if (u == 0)
             return LONG2FIX(0);
-	if (0 < sign && POSFIXABLE(u))
-            return LONG2FIX(u);
-	if (sign < 0 && BDIGIT_MSB(fixbuf[1]) == 0 &&
+        if (0 < sign && POSFIXABLE(u))
+            return LONG2FIX((long)u);
+        if (sign < 0 && BDIGIT_MSB(fixbuf[1]) == 0 &&
                 NEGFIXABLE(-(BDIGIT_DBL_SIGNED)u))
-            return LONG2FIX(-(BDIGIT_DBL_SIGNED)u);
+            return LONG2FIX((long)-(BDIGIT_DBL_SIGNED)u);
         val = bignew((long)num_bdigits, 0 <= sign);
         MEMCPY(BDIGITS(val), fixbuf, BDIGIT, num_bdigits);
     }
@@ -3686,46 +3784,78 @@ rb_integer_unpack(const void *words, size_t numwords, size_t wordsize, size_t na
 
 #define conv_digit(c) (ruby_digit36_to_number_table[(unsigned char)(c)])
 
-static void
-str2big_scan_digits(const char *s, const char *str, int base, int badcheck, size_t *num_digits_p, size_t *len_p)
+NORETURN(static inline void invalid_radix(int base));
+NORETURN(static inline void invalid_integer(VALUE s));
+
+static inline int
+valid_radix_p(int base)
+{
+    return (1 < base && base <= 36);
+}
+
+static inline void
+invalid_radix(int base)
+{
+    rb_raise(rb_eArgError, "invalid radix %d", base);
+}
+
+static inline void
+invalid_integer(VALUE s)
+{
+    rb_raise(rb_eArgError, "invalid value for Integer(): %+"PRIsVALUE, s);
+}
+
+static int
+str2big_scan_digits(const char *s, const char *str, int base, int badcheck, size_t *num_digits_p, ssize_t *len_p)
 {
     char nondigit = 0;
     size_t num_digits = 0;
     const char *digits_start = str;
     const char *digits_end = str;
+    ssize_t len = *len_p;
 
     int c;
 
-    if (badcheck && *str == '_') goto bad;
+    if (!len) {
+        *num_digits_p = 0;
+        *len_p = 0;
+        return TRUE;
+    }
+
+    if (badcheck && *str == '_') return FALSE;
 
     while ((c = *str++) != 0) {
-	if (c == '_') {
-	    if (nondigit) {
-		if (badcheck) goto bad;
-		break;
-	    }
-	    nondigit = (char) c;
-	    continue;
-	}
-	else if ((c = conv_digit(c)) < 0) {
-	    break;
-	}
-	if (c >= base) break;
-	nondigit = 0;
-        num_digits++;
-        digits_end = str;
-    }
-    if (badcheck) {
-	str--;
-	if (s+1 < str && str[-1] == '_') goto bad;
-	while (*str && ISSPACE(*str)) str++;
-	if (*str) {
-	  bad:
-	    rb_invalid_str(s, "Integer()");
-	}
+        if (c == '_') {
+            if (nondigit) {
+                if (badcheck) return FALSE;
+                break;
+            }
+            nondigit = (char) c;
+        }
+        else if ((c = conv_digit(c)) < 0 || c >= base) {
+            break;
+        }
+        else {
+            nondigit = 0;
+            num_digits++;
+            digits_end = str;
+        }
+        if (len > 0 && !--len) break;
+    }
+    if (badcheck && nondigit) return FALSE;
+    if (badcheck && len) {
+        str--;
+        while (*str && ISSPACE(*str)) {
+            str++;
+            if (len > 0 && !--len) break;
+        }
+        if (len && *str) {
+            return FALSE;
+        }
     }
     *num_digits_p = num_digits;
     *len_p = digits_end - digits_start;
+    return TRUE;
 }
 
 static VALUE
@@ -3764,7 +3894,7 @@ str2big_poweroftwo(
     if (numbits) {
         *dp++ = BIGLO(dd);
     }
-    assert((size_t)(dp - BDIGITS(z)) == num_bdigits);
+    RUBY_ASSERT((size_t)(dp - BDIGITS(z)) == num_bdigits);
 
     return z;
 }
@@ -3807,7 +3937,7 @@ str2big_normal(
             }
             break;
         }
-        assert(blen <= num_bdigits);
+        RUBY_ASSERT(blen <= num_bdigits);
     }
 
     return z;
@@ -3865,7 +3995,7 @@ str2big_karatsuba(
             current_base = 1;
         }
     }
-    assert(i == num_bdigits);
+    RUBY_ASSERT(i == num_bdigits);
     for (unit = 2; unit < num_bdigits; unit *= 2) {
         for (i = 0; i < num_bdigits; i += unit*2) {
             if (2*unit <= num_bdigits - i) {
@@ -3896,7 +4026,7 @@ str2big_karatsuba(
     return z;
 }
 
-#ifdef USE_GMP
+#if USE_GMP
 static VALUE
 str2big_gmp(
     int sign,
@@ -3906,7 +4036,6 @@ str2big_gmp(
     size_t num_bdigits,
     int base)
 {
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
     char *buf, *p;
     const char *q;
     VALUE tmps;
@@ -3929,7 +4058,7 @@ str2big_gmp(
     zn = num_bdigits;
     z = bignew(zn, sign);
     zds = BDIGITS(z);
-    mpz_export(BDIGITS(z), &count, -1, sizeof(BDIGIT), 0, nails, mz);
+    bdigits_from_mpz(mz, BDIGITS(z), &count);
     BDIGITS_ZERO(zds+count, zn-count);
     mpz_clear(mz);
 
@@ -3940,155 +4069,228 @@ str2big_gmp(
 }
 #endif
 
+static VALUE rb_cstr_parse_inum(const char *str, ssize_t len, char **endp, int base);
+
+/*
+ * Parse +str+ as Ruby Integer, i.e., underscores, 0d and 0b prefixes.
+ *
+ * str:      pointer to the string to be parsed.
+ *	     should be NUL-terminated.
+ * base:     base of conversion, must be 2..36, or -36..0.
+ *           if +base+ > 0, the conversion is done according to the +base+
+ *           and unmatched prefix is parsed as a part of the result if
+ *           present.
+ *           if +base+ <= 0, the conversion is done according to the
+ *           prefix if present, in base <code>-base</code> if +base+ < -1,
+ *           or in base 10.
+ * badcheck: if non-zero, +ArgumentError+ is raised when +str+ is not
+ *           valid as an Integer.  if zero, Fixnum 0 is returned in
+ *           that case.
+ */
 VALUE
 rb_cstr_to_inum(const char *str, int base, int badcheck)
 {
-    const char *s = str;
+    char *end;
+    VALUE ret = rb_cstr_parse_inum(str, -1, (badcheck ? NULL : &end), base);
+    if (NIL_P(ret)) {
+        if (badcheck) rb_invalid_str(str, "Integer()");
+        ret = INT2FIX(0);
+    }
+    return ret;
+}
+
+/*
+ * Parse +str+ as Ruby Integer, i.e., underscores, 0d and 0b prefixes.
+ *
+ * str:  pointer to the string to be parsed.
+ *       should be NUL-terminated if +len+ is negative.
+ * len:  length of +str+ if >= 0.  if +len+ is negative, +str+ should
+ *       be NUL-terminated.
+ * endp: if non-NULL, the address after parsed part is stored.  if
+ *       NULL, Qnil is returned when +str+ is not valid as an Integer.
+ * ndigits: if non-NULL, the number of parsed digits is stored.
+ * base: see +rb_cstr_to_inum+
+ * flags: bitwise OR of below flags:
+ *       RB_INT_PARSE_SIGN: allow preceding spaces and +/- sign
+ *       RB_INT_PARSE_UNDERSCORE: allow an underscore between digits
+ *       RB_INT_PARSE_PREFIX: allow preceding prefix
+ */
+
+VALUE
+rb_int_parse_cstr(const char *str, ssize_t len, char **endp, size_t *ndigits,
+                  int base, int flags)
+{
+    const char *const s = str;
     char sign = 1;
     int c;
-    VALUE z;
+    VALUE z = Qnil;
 
-    int bits_per_digit;
+    unsigned long val;
+    int ov;
 
     const char *digits_start, *digits_end;
-    size_t num_digits;
+    size_t num_digits = 0;
     size_t num_bdigits;
-    size_t len;
+    const ssize_t len0 = len;
+    const int badcheck = !endp;
+
+#define ADV(n) do {\
+        if (len > 0 && len <= (n)) goto bad; \
+        str += (n); \
+        len -= (n); \
+    } while (0)
+#define ASSERT_LEN() do {\
+        RUBY_ASSERT(len != 0); \
+        if (len0 >= 0) RUBY_ASSERT(s + len0 == str + len); \
+    } while (0)
 
     if (!str) {
-	if (badcheck) {
-          bad:
-            rb_invalid_str(s, "Integer()");
-        }
-	return INT2FIX(0);
+        goto bad;
     }
-    while (ISSPACE(*str)) str++;
+    if (len && (flags & RB_INT_PARSE_SIGN)) {
+        while (ISSPACE(*str)) ADV(1);
 
-    if (str[0] == '+') {
-	str++;
-    }
-    else if (str[0] == '-') {
-	str++;
-	sign = 0;
-    }
-    if (str[0] == '+' || str[0] == '-') {
-	if (badcheck) goto bad;
-	return INT2FIX(0);
+        if (str[0] == '+') {
+            ADV(1);
+        }
+        else if (str[0] == '-') {
+            ADV(1);
+            sign = 0;
+        }
+        ASSERT_LEN();
     }
     if (base <= 0) {
-	if (str[0] == '0') {
-	    switch (str[1]) {
-	      case 'x': case 'X':
-		base = 16;
-                str += 2;
-		break;
-	      case 'b': case 'B':
-		base = 2;
-                str += 2;
-		break;
-	      case 'o': case 'O':
-		base = 8;
-                str += 2;
-		break;
-	      case 'd': case 'D':
-		base = 10;
-                str += 2;
-		break;
-	      default:
-		base = 8;
-	    }
-	}
-	else if (base < -1) {
-	    base = -base;
-	}
-	else {
-	    base = 10;
-	}
+        if (str[0] == '0' && len > 1) {
+            switch (str[1]) {
+              case 'x': case 'X':
+                base = 16;
+                ADV(2);
+                break;
+              case 'b': case 'B':
+                base = 2;
+                ADV(2);
+                break;
+              case 'o': case 'O':
+                base = 8;
+                ADV(2);
+                break;
+              case 'd': case 'D':
+                base = 10;
+                ADV(2);
+                break;
+              default:
+                base = 8;
+            }
+        }
+        else if (base < -1) {
+            base = -base;
+        }
+        else {
+            base = 10;
+        }
+    }
+    else if (len == 1 || !(flags & RB_INT_PARSE_PREFIX)) {
+        /* no prefix */
     }
     else if (base == 2) {
-	if (str[0] == '0' && (str[1] == 'b'||str[1] == 'B')) {
-	    str += 2;
-	}
+        if (str[0] == '0' && (str[1] == 'b'||str[1] == 'B')) {
+            ADV(2);
+        }
     }
     else if (base == 8) {
-	if (str[0] == '0' && (str[1] == 'o'||str[1] == 'O')) {
-	    str += 2;
-	}
+        if (str[0] == '0' && (str[1] == 'o'||str[1] == 'O')) {
+            ADV(2);
+        }
     }
     else if (base == 10) {
-	if (str[0] == '0' && (str[1] == 'd'||str[1] == 'D')) {
-	    str += 2;
-	}
+        if (str[0] == '0' && (str[1] == 'd'||str[1] == 'D')) {
+            ADV(2);
+        }
     }
     else if (base == 16) {
-	if (str[0] == '0' && (str[1] == 'x'||str[1] == 'X')) {
-	    str += 2;
-	}
-    }
-    if (base < 2 || 36 < base) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
-    }
-    if (*str == '0') {		/* squeeze preceding 0s */
-	int us = 0;
-	while ((c = *++str) == '0' || c == '_') {
-	    if (c == '_') {
-		if (++us >= 2)
-		    break;
-	    }
-	    else {
-		us = 0;
-	    }
-	}
-	if (!(c = *str) || ISSPACE(c)) --str;
+        if (str[0] == '0' && (str[1] == 'x'||str[1] == 'X')) {
+            ADV(2);
+        }
+    }
+    if (!valid_radix_p(base)) {
+        invalid_radix(base);
+    }
+    if (!len) goto bad;
+    num_digits = str - s;
+    if (*str == '0' && len != 1) { /* squeeze preceding 0s */
+        int us = 0;
+        const char *end = len < 0 ? NULL : str + len;
+        ++num_digits;
+        while ((c = *++str) == '0' ||
+               ((flags & RB_INT_PARSE_UNDERSCORE) && c == '_')) {
+            if (c == '_') {
+                if (++us >= 2)
+                    break;
+            }
+            else {
+                ++num_digits;
+                us = 0;
+            }
+            if (str == end) break;
+        }
+        if (!c || ISSPACE(c)) --str;
+        if (end) len = end - str;
     }
     c = *str;
     c = conv_digit(c);
     if (c < 0 || c >= base) {
-	if (badcheck) goto bad;
-	return INT2FIX(0);
-    }
-
-    bits_per_digit = bit_length(base-1);
-    if (bits_per_digit * strlen(str) <= sizeof(long) * CHAR_BIT) {
-        char *end;
-	unsigned long val = STRTOUL(str, &end, base);
-
-	if (str < end && *end == '_') goto bigparse;
-	if (badcheck) {
-	    if (end == str) goto bad; /* no number */
-	    while (*end && ISSPACE(*end)) end++;
-	    if (*end) goto bad;	      /* trailing garbage */
-	}
-
-	if (POSFIXABLE(val)) {
-	    if (sign) return LONG2FIX(val);
-	    else {
-		long result = -(long)val;
-		return LONG2FIX(result);
-	    }
-	}
-	else {
-	    VALUE big = rb_uint2big(val);
-	    BIGNUM_SET_SIGN(big, sign);
-	    return bignorm(big);
-	}
+        if (!badcheck && num_digits) z = INT2FIX(0);
+        goto bad;
+    }
+
+    if (ndigits) *ndigits = num_digits;
+    val = ruby_scan_digits(str, len, base, &num_digits, &ov);
+    if (!ov) {
+        const char *end = &str[num_digits];
+        if (num_digits > 0 && *end == '_' && (flags & RB_INT_PARSE_UNDERSCORE))
+            goto bigparse;
+        if (endp) *endp = (char *)end;
+        if (ndigits) *ndigits += num_digits;
+        if (badcheck) {
+            if (num_digits == 0) return Qnil; /* no number */
+            while (len < 0 ? *end : end < str + len) {
+                if (!ISSPACE(*end)) return Qnil; /* trailing garbage */
+                end++;
+            }
+        }
+
+        if (POSFIXABLE(val)) {
+            if (sign) return LONG2FIX(val);
+            else {
+                long result = -(long)val;
+                return LONG2FIX(result);
+            }
+        }
+        else {
+            VALUE big = rb_uint2big(val);
+            BIGNUM_SET_SIGN(big, sign);
+            return bignorm(big);
+        }
     }
 
   bigparse:
     digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    if (!str2big_scan_digits(s, str, base, badcheck, &num_digits, &len))
+        goto bad;
+    if (endp) *endp = (char *)(str + len);
+    if (ndigits) *ndigits += num_digits;
     digits_end = digits_start + len;
 
     if (POW2_P(base)) {
         z = str2big_poweroftwo(sign, digits_start, digits_end, num_digits,
-                bits_per_digit);
+                               bit_length(base-1));
     }
     else {
         int digits_per_bdigits_dbl;
         maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
         num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
 
-#ifdef USE_GMP
+#if USE_GMP
         if (GMP_STR2BIG_DIGITS < num_bdigits) {
             z = str2big_gmp(sign, digits_start, digits_end, num_digits,
                     num_bdigits, base);
@@ -4106,63 +4308,74 @@ rb_cstr_to_inum(const char *str, int base, int badcheck)
     }
 
     return bignorm(z);
+
+  bad:
+    if (endp) *endp = (char *)str;
+    if (ndigits) *ndigits = num_digits;
+    return z;
+}
+
+static VALUE
+rb_cstr_parse_inum(const char *str, ssize_t len, char **endp, int base)
+{
+    return rb_int_parse_cstr(str, len, endp, NULL, base,
+                             RB_INT_PARSE_DEFAULT);
 }
 
 VALUE
-rb_str_to_inum(VALUE str, int base, int badcheck)
+rb_str_convert_to_inum(VALUE str, int base, int badcheck, int raise_exception)
 {
-    char *s;
-    long len;
-    VALUE v = 0;
     VALUE ret;
+    const char *s;
+    long len;
+    char *end;
 
     StringValue(str);
     rb_must_asciicompat(str);
-    if (badcheck) {
-	s = StringValueCStr(str);
-    }
-    else {
-	s = RSTRING_PTR(str);
-    }
-    if (s) {
-	len = RSTRING_LEN(str);
-	if (s[len]) {		/* no sentinel somehow */
-	    char *p = ALLOCV(v, len+1);
-
-	    MEMCPY(p, s, char, len);
-	    p[len] = '\0';
-	    s = p;
-	}
+    RSTRING_GETMEM(str, s, len);
+    ret = rb_cstr_parse_inum(s, len, (badcheck ? NULL : &end), base);
+    if (NIL_P(ret)) {
+        if (badcheck) {
+            if (!raise_exception) return Qnil;
+            invalid_integer(str);
+        }
+        ret = INT2FIX(0);
     }
-    ret = rb_cstr_to_inum(s, base, badcheck);
-    if (v)
-	ALLOCV_END(v);
     return ret;
 }
 
 VALUE
+rb_str_to_inum(VALUE str, int base, int badcheck)
+{
+    return rb_str_convert_to_inum(str, base, badcheck, TRUE);
+}
+
+VALUE
 rb_str2big_poweroftwo(VALUE arg, int base, int badcheck)
 {
     int positive_p = 1;
     const char *s, *str;
     const char *digits_start, *digits_end;
     size_t num_digits;
-    size_t len;
+    ssize_t len;
     VALUE z;
 
-    if (base < 2 || 36 < base || !POW2_P(base)) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
+    if (!valid_radix_p(base) || !POW2_P(base)) {
+        invalid_radix(base);
     }
 
     rb_must_asciicompat(arg);
     s = str = StringValueCStr(arg);
+    len = RSTRING_LEN(arg);
     if (*str == '-') {
+        len--;
         str++;
         positive_p = 0;
     }
 
     digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    if (!str2big_scan_digits(s, str, base, badcheck, &num_digits, &len))
+        invalid_integer(arg);
     digits_end = digits_start + len;
 
     z = str2big_poweroftwo(positive_p, digits_start, digits_end, num_digits,
@@ -4180,25 +4393,28 @@ rb_str2big_normal(VALUE arg, int base, int badcheck)
     const char *s, *str;
     const char *digits_start, *digits_end;
     size_t num_digits;
-    size_t len;
+    ssize_t len;
     VALUE z;
 
     int digits_per_bdigits_dbl;
     size_t num_bdigits;
 
-    if (base < 2 || 36 < base) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
+    if (!valid_radix_p(base)) {
+        invalid_radix(base);
     }
 
     rb_must_asciicompat(arg);
-    s = str = StringValueCStr(arg);
-    if (*str == '-') {
+    s = str = StringValuePtr(arg);
+    len = RSTRING_LEN(arg);
+    if (len > 0 && *str == '-') {
+        len--;
         str++;
         positive_p = 0;
     }
 
     digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    if (!str2big_scan_digits(s, str, base, badcheck, &num_digits, &len))
+        invalid_integer(arg);
     digits_end = digits_start + len;
 
     maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
@@ -4219,25 +4435,28 @@ rb_str2big_karatsuba(VALUE arg, int base, int badcheck)
     const char *s, *str;
     const char *digits_start, *digits_end;
     size_t num_digits;
-    size_t len;
+    ssize_t len;
     VALUE z;
 
     int digits_per_bdigits_dbl;
     size_t num_bdigits;
 
-    if (base < 2 || 36 < base) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
+    if (!valid_radix_p(base)) {
+        invalid_radix(base);
     }
 
     rb_must_asciicompat(arg);
-    s = str = StringValueCStr(arg);
-    if (*str == '-') {
+    s = str = StringValuePtr(arg);
+    len = RSTRING_LEN(arg);
+    if (len > 0 && *str == '-') {
+        len--;
         str++;
         positive_p = 0;
     }
 
     digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    if (!str2big_scan_digits(s, str, base, badcheck, &num_digits, &len))
+        invalid_integer(arg);
     digits_end = digits_start + len;
 
     maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
@@ -4251,7 +4470,7 @@ rb_str2big_karatsuba(VALUE arg, int base, int badcheck)
     return bignorm(z);
 }
 
-#ifdef USE_GMP
+#if USE_GMP
 VALUE
 rb_str2big_gmp(VALUE arg, int base, int badcheck)
 {
@@ -4259,25 +4478,28 @@ rb_str2big_gmp(VALUE arg, int base, int badcheck)
     const char *s, *str;
     const char *digits_start, *digits_end;
     size_t num_digits;
-    size_t len;
+    ssize_t len;
     VALUE z;
 
     int digits_per_bdigits_dbl;
     size_t num_bdigits;
 
-    if (base < 2 || 36 < base) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
+    if (!valid_radix_p(base)) {
+        invalid_radix(base);
     }
 
     rb_must_asciicompat(arg);
-    s = str = StringValueCStr(arg);
-    if (*str == '-') {
+    s = str = StringValuePtr(arg);
+    len = RSTRING_LEN(arg);
+    if (len > 0 && *str == '-') {
+        len--;
         str++;
         positive_p = 0;
     }
 
     digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    if (!str2big_scan_digits(s, str, base, badcheck, &num_digits, &len))
+        invalid_integer(arg);
     digits_end = digits_start + len;
 
     maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
@@ -4293,7 +4515,7 @@ rb_str2big_gmp(VALUE arg, int base, int badcheck)
 
 #if HAVE_LONG_LONG
 
-static VALUE
+VALUE
 rb_ull2big(unsigned LONG_LONG n)
 {
     long i;
@@ -4304,8 +4526,8 @@ rb_ull2big(unsigned LONG_LONG n)
     digits[0] = n;
 #else
     for (i = 0; i < bdigit_roomof(SIZEOF_LONG_LONG); i++) {
-	digits[i] = BIGLO(n);
-	n = BIGDN(n);
+        digits[i] = BIGLO(n);
+        n = BIGDN(n);
     }
 #endif
 
@@ -4315,7 +4537,7 @@ rb_ull2big(unsigned LONG_LONG n)
     return big;
 }
 
-static VALUE
+VALUE
 rb_ll2big(LONG_LONG n)
 {
     long neg = 0;
@@ -4324,14 +4546,14 @@ rb_ll2big(LONG_LONG n)
 
     if (n < 0) {
         u = 1 + (unsigned LONG_LONG)(-(n + 1)); /* u = -n avoiding overflow */
-	neg = 1;
+        neg = 1;
     }
     else {
         u = n;
     }
     big = rb_ull2big(u);
     if (neg) {
-	BIGNUM_SET_SIGN(big, 0);
+        BIGNUM_SET_NEGATIVE_SIGN(big);
     }
     return big;
 }
@@ -4339,19 +4561,59 @@ rb_ll2big(LONG_LONG n)
 VALUE
 rb_ull2inum(unsigned LONG_LONG n)
 {
-    if (POSFIXABLE(n)) return LONG2FIX(n);
+    if (POSFIXABLE(n)) return LONG2FIX((long)n);
     return rb_ull2big(n);
 }
 
 VALUE
 rb_ll2inum(LONG_LONG n)
 {
-    if (FIXABLE(n)) return LONG2FIX(n);
+    if (FIXABLE(n)) return LONG2FIX((long)n);
     return rb_ll2big(n);
 }
 
 #endif  /* HAVE_LONG_LONG */
 
+#ifdef HAVE_INT128_T
+VALUE
+rb_uint128t2big(uint128_t n)
+{
+    long i;
+    VALUE big = bignew(bdigit_roomof(SIZEOF_INT128_T), 1);
+    BDIGIT *digits = BDIGITS(big);
+
+    for (i = 0; i < bdigit_roomof(SIZEOF_INT128_T); i++) {
+        digits[i] = BIGLO(RSHIFT(n ,BITSPERDIG*i));
+    }
+
+    i = bdigit_roomof(SIZEOF_INT128_T);
+    while (i-- && !digits[i]) ;
+    BIGNUM_SET_LEN(big, i+1);
+    return big;
+}
+
+VALUE
+rb_int128t2big(int128_t n)
+{
+    int neg = 0;
+    uint128_t u;
+    VALUE big;
+
+    if (n < 0) {
+        u = 1 + (uint128_t)(-(n + 1)); /* u = -n avoiding overflow */
+        neg = 1;
+    }
+    else {
+        u = n;
+    }
+    big = rb_uint128t2big(u);
+    if (neg) {
+        BIGNUM_SET_NEGATIVE_SIGN(big);
+    }
+    return big;
+}
+#endif
+
 VALUE
 rb_cstr2inum(const char *str, int base)
 {
@@ -4375,11 +4637,14 @@ big_shift3(VALUE x, int lshift_p, size_t shift_numdigits, int shift_numbits)
 
     if (lshift_p) {
         if (LONG_MAX < shift_numdigits) {
-            rb_raise(rb_eArgError, "too big number");
+          too_big:
+            rb_raise(rb_eRangeError, "shift width too big");
         }
         s1 = shift_numdigits;
         s2 = shift_numbits;
+        if ((size_t)s1 != shift_numdigits) goto too_big;
         xn = BIGNUM_LEN(x);
+        if (LONG_MAX/SIZEOF_BDIGIT <= xn+s1) goto too_big;
         z = bignew(xn+s1+1, BIGNUM_SIGN(x));
         zds = BDIGITS(z);
         BDIGITS_ZERO(zds, s1);
@@ -4421,8 +4686,8 @@ big_shift2(VALUE x, int lshift_p, VALUE y)
     size_t shift_numdigits;
     int shift_numbits;
 
-    assert(POW2_P(CHAR_BIT));
-    assert(POW2_P(BITSPERDIG));
+    RUBY_ASSERT(POW2_P(CHAR_BIT));
+    RUBY_ASSERT(POW2_P(BITSPERDIG));
 
     if (BIGZEROP(x))
         return INT2FIX(0);
@@ -4470,12 +4735,6 @@ static size_t base36_numdigits_cache[35][MAX_BASE36_POWER_TABLE_ENTRIES];
 static void
 power_cache_init(void)
 {
-    int i, j;
-    for (i = 0; i < 35; ++i) {
-	for (j = 0; j < MAX_BASE36_POWER_TABLE_ENTRIES; ++j) {
-	    base36_power_cache[i][j] = Qnil;
-	}
-    }
 }
 
 static inline VALUE
@@ -4498,8 +4757,8 @@ power_cache_get_power(int base, int power_level, size_t *numdigits_ret)
     if (MAX_BASE36_POWER_TABLE_ENTRIES <= power_level)
         rb_bug("too big power number requested: maxpow_in_bdigit_dbl(%d)**(2**%d)", base, power_level);
 
-    if (NIL_P(base36_power_cache[base - 2][power_level])) {
-        VALUE power;
+    VALUE power = base36_power_cache[base - 2][power_level];
+    if (!power) {
         size_t numdigits;
         if (power_level == 0) {
             int numdigits0;
@@ -4515,11 +4774,11 @@ power_cache_get_power(int base, int power_level, size_t *numdigits_ret)
         rb_obj_hide(power);
         base36_power_cache[base - 2][power_level] = power;
         base36_numdigits_cache[base - 2][power_level] = numdigits;
-	rb_gc_register_mark_object(power);
+        rb_vm_register_global_object(power);
     }
     if (numdigits_ret)
         *numdigits_ret = base36_numdigits_cache[base - 2][power_level];
-    return base36_power_cache[base - 2][power_level];
+    return power;
 }
 
 struct big2str_struct {
@@ -4551,7 +4810,7 @@ big2str_2bdigits(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t tail
     int beginning = !b2s->ptr;
     size_t len = 0;
 
-    assert(xn <= 2);
+    RUBY_ASSERT(xn <= 2);
     num = bary2bdigitdbl(xds, xn);
 
     if (beginning) {
@@ -4560,19 +4819,21 @@ big2str_2bdigits(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t tail
         p = buf;
         j = sizeof(buf);
         do {
-            p[--j] = ruby_digitmap[num % b2s->base];
+            BDIGIT_DBL idx = num % b2s->base;
             num /= b2s->base;
+            p[--j] = ruby_digitmap[idx];
         } while (num);
         len = sizeof(buf) - j;
         big2str_alloc(b2s, len + taillen);
-	MEMCPY(b2s->ptr, buf + j, char, len);
+        MEMCPY(b2s->ptr, buf + j, char, len);
     }
     else {
         p = b2s->ptr;
         j = b2s->hbase2_numdigits;
         do {
-            p[--j] = ruby_digitmap[num % b2s->base];
+            BDIGIT_DBL idx = num % b2s->base;
             num /= b2s->base;
+            p[--j] = ruby_digitmap[idx];
         } while (j);
         len = b2s->hbase2_numdigits;
     }
@@ -4581,7 +4842,7 @@ big2str_2bdigits(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t tail
 
 static void
 big2str_karatsuba(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t wn,
-		  int power_level, size_t taillen)
+                  int power_level, size_t taillen)
 {
     VALUE b;
     size_t half_numdigits, lower_numdigits;
@@ -4611,17 +4872,17 @@ big2str_karatsuba(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t wn,
      */
 
     if (xn == 0 || bary_zero_p(xds, xn)) {
-	if (b2s->ptr) {
+        if (b2s->ptr) {
             /* When x is zero, power_cache_get_power(base, power_level) should be cached already. */
             power_cache_get_power(b2s->base, power_level, &len);
-	    memset(b2s->ptr, '0', len);
+            memset(b2s->ptr, '0', len);
             b2s->ptr += len;
-	}
+        }
         return;
     }
 
     if (power_level == 0) {
-	big2str_2bdigits(b2s, xds, xn, taillen);
+        big2str_2bdigits(b2s, xds, xn, taillen);
         return;
     }
 
@@ -4649,7 +4910,7 @@ big2str_karatsuba(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t wn,
             memset(b2s->ptr, '0', len);
             b2s->ptr += len;
         }
-	big2str_2bdigits(b2s, xds, xn, taillen);
+        big2str_2bdigits(b2s, xds, xn, taillen);
     }
     else {
         BDIGIT *qds, *rds;
@@ -4677,7 +4938,7 @@ big2str_karatsuba(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t wn,
             /* bigdivrem_restoring will modify y.
              * So use temporary buffer.  */
             tds = xds + qn;
-            assert(qn + bn <= xn + wn);
+            RUBY_ASSERT(qn + bn <= xn + wn);
             bary_small_lshift(tds, bds, bn, shift);
             xds[xn] = bary_small_lshift(xds, xds, xn, shift);
         }
@@ -4695,7 +4956,7 @@ big2str_karatsuba(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t wn,
         }
 
         BARY_TRUNC(qds, qn);
-        assert(qn <= bn);
+        RUBY_ASSERT(qn <= bn);
         big2str_karatsuba(b2s, qds, qn, xn+wn - (rn+qn), lower_power_level, lower_numdigits+taillen);
         BARY_TRUNC(rds, rn);
         big2str_karatsuba(b2s, rds, rn, xn+wn - rn, lower_power_level, taillen);
@@ -4753,14 +5014,14 @@ big2str_generic(VALUE x, int base)
     BARY_TRUNC(xds, xn);
 
     if (xn == 0) {
-	return rb_usascii_str_new2("0");
+        return rb_usascii_str_new2("0");
     }
 
-    if (base < 2 || 36 < base)
-	rb_raise(rb_eArgError, "invalid radix %d", base);
+    if (!valid_radix_p(base))
+        invalid_radix(base);
 
     if (xn >= LONG_MAX/BITSPERDIG) {
-        rb_raise(rb_eRangeError, "bignum too big to convert into `string'");
+        rb_raise(rb_eRangeError, "bignum too big to convert into 'string'");
     }
 
     power_level = 0;
@@ -4770,7 +5031,7 @@ big2str_generic(VALUE x, int base)
         power_level++;
         power = power_cache_get_power(base, power_level, NULL);
     }
-    assert(power_level != MAX_BASE36_POWER_TABLE_ENTRIES);
+    RUBY_ASSERT(power_level != MAX_BASE36_POWER_TABLE_ENTRIES);
 
     if ((size_t)BIGNUM_LEN(power) <= xn) {
         /*
@@ -4794,7 +5055,7 @@ big2str_generic(VALUE x, int base)
     b2s_data.ptr = NULL;
 
     if (power_level == 0) {
-	big2str_2bdigits(&b2s_data, xds, xn, 0);
+        big2str_2bdigits(&b2s_data, xds, xn, 0);
     }
     else {
         VALUE tmpw = 0;
@@ -4803,7 +5064,7 @@ big2str_generic(VALUE x, int base)
         wn = power_level * BIGDIVREM_EXTRA_WORDS + BIGNUM_LEN(power);
         wds = ALLOCV_N(BDIGIT, tmpw, xn + wn);
         MEMCPY(wds, xds, BDIGIT, xn);
-	big2str_karatsuba(&b2s_data, wds, xn, wn, power_level, 0);
+        big2str_karatsuba(&b2s_data, wds, xn, wn, power_level, 0);
         if (tmpw)
             ALLOCV_END(tmpw);
     }
@@ -4822,11 +5083,10 @@ rb_big2str_generic(VALUE x, int base)
     return big2str_generic(x, base);
 }
 
-#ifdef USE_GMP
-VALUE
+#if USE_GMP
+static VALUE
 big2str_gmp(VALUE x, int base)
 {
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
     mpz_t mx;
     size_t size;
     VALUE str;
@@ -4834,7 +5094,7 @@ big2str_gmp(VALUE x, int base)
     size_t xn = BIGNUM_LEN(x);
 
     mpz_init(mx);
-    mpz_import(mx, xn, -1, sizeof(BDIGIT), 0, nails, xds);
+    bdigits_to_mpz(mx, xds, xn);
 
     size = mpz_sizeinbase(mx, base);
 
@@ -4870,7 +5130,7 @@ rb_big2str1(VALUE x, int base)
     size_t xn;
 
     if (FIXNUM_P(x)) {
-	return rb_fix2str(x, base);
+        return rb_fix2str(x, base);
     }
 
     bigtrunc(x);
@@ -4879,14 +5139,14 @@ rb_big2str1(VALUE x, int base)
     BARY_TRUNC(xds, xn);
 
     if (xn == 0) {
-	return rb_usascii_str_new2("0");
+        return rb_usascii_str_new2("0");
     }
 
-    if (base < 2 || 36 < base)
-	rb_raise(rb_eArgError, "invalid radix %d", base);
+    if (!valid_radix_p(base))
+        invalid_radix(base);
 
     if (xn >= LONG_MAX/BITSPERDIG) {
-        rb_raise(rb_eRangeError, "bignum too big to convert into `string'");
+        rb_raise(rb_eRangeError, "bignum too big to convert into 'string'");
     }
 
     if (POW2_P(base)) {
@@ -4894,7 +5154,7 @@ rb_big2str1(VALUE x, int base)
         return big2str_base_poweroftwo(x, base);
     }
 
-#ifdef USE_GMP
+#if USE_GMP
     if (GMP_BIG2STR_DIGITS < xn) {
         return big2str_gmp(x, base);
     }
@@ -4909,38 +5169,12 @@ rb_big2str(VALUE x, int base)
     return rb_big2str1(x, base);
 }
 
-/*
- *  call-seq:
- *     big.to_s(base=10)   ->  string
- *
- *  Returns a string containing the representation of <i>big</i> radix
- *  <i>base</i> (2 through 36).
- *
- *     12345654321.to_s         #=> "12345654321"
- *     12345654321.to_s(2)      #=> "1011011111110110111011110000110001"
- *     12345654321.to_s(8)      #=> "133766736061"
- *     12345654321.to_s(16)     #=> "2dfdbbc31"
- *     78546939656932.to_s(36)  #=> "rubyrules"
- */
-
-static VALUE
-rb_big_to_s(int argc, VALUE *argv, VALUE x)
-{
-    int base;
-
-    if (argc == 0) base = 10;
-    else {
-	VALUE b;
-
-	rb_scan_args(argc, argv, "01", &b);
-	base = NUM2INT(b);
-    }
-    return rb_big2str(x, base);
-}
-
 static unsigned long
 big2ulong(VALUE x, const char *type)
 {
+#if SIZEOF_LONG > SIZEOF_BDIGIT
+    size_t i;
+#endif
     size_t len = BIGNUM_LEN(x);
     unsigned long num;
     BDIGIT *ds;
@@ -4948,16 +5182,16 @@ big2ulong(VALUE x, const char *type)
     if (len == 0)
         return 0;
     if (BIGSIZE(x) > sizeof(long)) {
-        rb_raise(rb_eRangeError, "bignum too big to convert into `%s'", type);
+        rb_raise(rb_eRangeError, "bignum too big to convert into '%s'", type);
     }
     ds = BDIGITS(x);
 #if SIZEOF_LONG <= SIZEOF_BDIGIT
     num = (unsigned long)ds[0];
 #else
     num = 0;
-    while (len--) {
-	num <<= BITSPERDIG;
-	num += (unsigned long)ds[len]; /* overflow is already checked */
+    for (i = 0; i < len; i++) {
+        num <<= BITSPERDIG;
+        num += (unsigned long)ds[len - i - 1]; /* overflow is already checked */
     }
 #endif
     return num;
@@ -4972,10 +5206,8 @@ rb_big2ulong(VALUE x)
         return num;
     }
     else {
-        if (num <= LONG_MAX)
-            return -(long)num;
-        if (num == 1+(unsigned long)(-(LONG_MIN+1)))
-            return LONG_MIN;
+        if (num <= 1+(unsigned long)(-(LONG_MIN+1)))
+            return -(long)(num-1)-1;
     }
     rb_raise(rb_eRangeError, "bignum out of range of unsigned long");
 }
@@ -4990,12 +5222,10 @@ rb_big2long(VALUE x)
             return num;
     }
     else {
-        if (num <= LONG_MAX)
-            return -(long)num;
-        if (num == 1+(unsigned long)(-(LONG_MIN+1)))
-            return LONG_MIN;
+        if (num <= 1+(unsigned long)(-(LONG_MIN+1)))
+            return -(long)(num-1)-1;
     }
-    rb_raise(rb_eRangeError, "bignum too big to convert into `long'");
+    rb_raise(rb_eRangeError, "bignum too big to convert into 'long'");
 }
 
 #if HAVE_LONG_LONG
@@ -5003,6 +5233,9 @@ rb_big2long(VALUE x)
 static unsigned LONG_LONG
 big2ull(VALUE x, const char *type)
 {
+#if SIZEOF_LONG_LONG > SIZEOF_BDIGIT
+    size_t i;
+#endif
     size_t len = BIGNUM_LEN(x);
     unsigned LONG_LONG num;
     BDIGIT *ds = BDIGITS(x);
@@ -5010,14 +5243,14 @@ big2ull(VALUE x, const char *type)
     if (len == 0)
         return 0;
     if (BIGSIZE(x) > SIZEOF_LONG_LONG)
-	rb_raise(rb_eRangeError, "bignum too big to convert into `%s'", type);
+        rb_raise(rb_eRangeError, "bignum too big to convert into '%s'", type);
 #if SIZEOF_LONG_LONG <= SIZEOF_BDIGIT
     num = (unsigned LONG_LONG)ds[0];
 #else
     num = 0;
-    while (len--) {
-	num = BIGUP(num);
-	num += ds[len];
+    for (i = 0; i < len; i++) {
+        num = BIGUP(num);
+        num += ds[len - i - 1];
     }
 #endif
     return num;
@@ -5032,10 +5265,8 @@ rb_big2ull(VALUE x)
         return num;
     }
     else {
-        if (num <= LLONG_MAX)
-            return -(LONG_LONG)num;
-        if (num == 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
-            return LLONG_MIN;
+        if (num <= 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
+            return -(LONG_LONG)(num-1)-1;
     }
     rb_raise(rb_eRangeError, "bignum out of range of unsigned long long");
 }
@@ -5050,12 +5281,10 @@ rb_big2ll(VALUE x)
             return num;
     }
     else {
-        if (num <= LLONG_MAX)
-            return -(LONG_LONG)num;
-        if (num == 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
-            return LLONG_MIN;
+        if (num <= 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
+            return -(LONG_LONG)(num-1)-1;
     }
-    rb_raise(rb_eRangeError, "bignum too big to convert into `long long'");
+    rb_raise(rb_eRangeError, "bignum too big to convert into 'long long'");
 }
 
 #endif  /* HAVE_LONG_LONG */
@@ -5070,23 +5299,23 @@ dbl2big(double d)
     double u = (d < 0)?-d:d;
 
     if (isinf(d)) {
-	rb_raise(rb_eFloatDomainError, d < 0 ? "-Infinity" : "Infinity");
+        rb_raise(rb_eFloatDomainError, d < 0 ? "-Infinity" : "Infinity");
     }
     if (isnan(d)) {
-	rb_raise(rb_eFloatDomainError, "NaN");
+        rb_raise(rb_eFloatDomainError, "NaN");
     }
 
     while (1.0 <= u) {
-	u /= (double)(BIGRAD);
-	i++;
+        u /= (double)(BIGRAD);
+        i++;
     }
     z = bignew(i, d>=0);
     digits = BDIGITS(z);
     while (i--) {
-	u *= BIGRAD;
-	c = (BDIGIT)u;
-	u -= c;
-	digits[i] = c;
+        u *= BIGRAD;
+        c = (BDIGIT)u;
+        u -= c;
+        digits[i] = c;
     }
 
     return z;
@@ -5106,45 +5335,50 @@ big2dbl(VALUE x)
     BDIGIT *ds = BDIGITS(x), dl;
 
     if (i) {
-	bits = i * BITSPERDIG - nlz(ds[i-1]);
-	if (bits > DBL_MANT_DIG+DBL_MAX_EXP) {
-	    d = HUGE_VAL;
-	}
-	else {
-	    if (bits > DBL_MANT_DIG+1)
-		lo = (bits -= DBL_MANT_DIG+1) / BITSPERDIG;
-	    else
-		bits = 0;
-	    while (--i > lo) {
-		d = ds[i] + BIGRAD*d;
-	    }
-	    dl = ds[i];
-	    if (bits && (dl & ((BDIGIT)1 << (bits %= BITSPERDIG)))) {
-		int carry = (dl & ~(BDIGMAX << bits)) != 0;
-		if (!carry) {
-		    while (i-- > 0) {
-			carry = ds[i] != 0;
-			if (carry) break;
-		    }
-		}
-		if (carry) {
-		    dl &= BDIGMAX << bits;
-		    dl = BIGLO(dl + ((BDIGIT)1 << bits));
-		    if (!dl) d += 1;
-		}
-	    }
-	    d = dl + BIGRAD*d;
-	    if (lo) {
-		if (lo > INT_MAX / BITSPERDIG)
-		    d = HUGE_VAL;
-		else if (lo < INT_MIN / BITSPERDIG)
-		    d = 0.0;
-		else
-		    d = ldexp(d, (int)(lo * BITSPERDIG));
-	    }
-	}
-    }
-    if (!BIGNUM_SIGN(x)) d = -d;
+        bits = i * BITSPERDIG - nlz(ds[i-1]);
+        if (bits > DBL_MANT_DIG+DBL_MAX_EXP) {
+            d = HUGE_VAL;
+        }
+        else {
+            if (bits > DBL_MANT_DIG+1)
+                lo = (bits -= DBL_MANT_DIG+1) / BITSPERDIG;
+            else
+                bits = 0;
+            while (--i > lo) {
+                d = ds[i] + BIGRAD*d;
+            }
+            dl = ds[i];
+            if (bits && (dl & ((BDIGIT)1 << (bits %= BITSPERDIG)))) {
+                int carry = (dl & ~(BDIGMAX << bits)) != 0;
+                if (!carry) {
+                    while (i-- > 0) {
+                        carry = ds[i] != 0;
+                        if (carry) break;
+                    }
+                }
+                if (carry) {
+                    BDIGIT mask = BDIGMAX;
+                    BDIGIT bit = 1;
+                    mask <<= bits;
+                    bit <<= bits;
+                    dl &= mask;
+                    dl += bit;
+                    dl = BIGLO(dl);
+                    if (!dl) d += 1;
+                }
+            }
+            d = dl + BIGRAD*d;
+            if (lo) {
+                if (lo > INT_MAX / BITSPERDIG)
+                    d = HUGE_VAL;
+                else if (lo < INT_MIN / BITSPERDIG)
+                    d = 0.0;
+                else
+                    d = ldexp(d, (int)(lo * BITSPERDIG));
+            }
+        }
+    }
+    if (BIGNUM_NEGATIVE_P(x)) d = -d;
     return d;
 }
 
@@ -5154,30 +5388,15 @@ rb_big2dbl(VALUE x)
     double d = big2dbl(x);
 
     if (isinf(d)) {
-	rb_warning("Bignum out of Float range");
-	if (d < 0.0)
-	    d = -HUGE_VAL;
-	else
-	    d = HUGE_VAL;
+        rb_warning("Integer out of Float range");
+        if (d < 0.0)
+            d = -HUGE_VAL;
+        else
+            d = HUGE_VAL;
     }
     return d;
 }
 
-/*
- *  call-seq:
- *     big.to_f -> float
- *
- *  Converts <i>big</i> to a <code>Float</code>. If <i>big</i> doesn't
- *  fit in a <code>Float</code>, the result is infinity.
- *
- */
-
-static VALUE
-rb_big_to_f(VALUE x)
-{
-    return DBL2NUM(rb_big2dbl(x));
-}
-
 VALUE
 rb_integer_float_cmp(VALUE x, VALUE y)
 {
@@ -5228,13 +5447,22 @@ rb_integer_float_cmp(VALUE x, VALUE y)
     return INT2FIX(-1);
 }
 
+#if SIZEOF_LONG * CHAR_BIT >= DBL_MANT_DIG /* assume FLT_RADIX == 2 */
+COMPILER_WARNING_PUSH
+#if __has_warning("-Wimplicit-int-float-conversion")
+COMPILER_WARNING_IGNORED(-Wimplicit-int-float-conversion)
+#endif
+static const double LONG_MAX_as_double = LONG_MAX;
+COMPILER_WARNING_POP
+#endif
+
 VALUE
 rb_integer_float_eq(VALUE x, VALUE y)
 {
     double yd = RFLOAT_VALUE(y);
     double yi, yf;
 
-    if (isnan(yd) || isinf(yd))
+    if (!isfinite(yd))
         return Qfalse;
     yf = modf(yd, &yi);
     if (yf != 0)
@@ -5242,70 +5470,47 @@ rb_integer_float_eq(VALUE x, VALUE y)
     if (FIXNUM_P(x)) {
 #if SIZEOF_LONG * CHAR_BIT < DBL_MANT_DIG /* assume FLT_RADIX == 2 */
         double xd = (double)FIX2LONG(x);
-        if (xd != yd)
-            return Qfalse;
-        return Qtrue;
+        return RBOOL(xd == yd);
 #else
         long xn, yn;
-        if (yi < LONG_MIN || LONG_MAX < yi)
+        if (yi < LONG_MIN || LONG_MAX_as_double <= yi)
             return Qfalse;
         xn = FIX2LONG(x);
         yn = (long)yi;
-        if (xn != yn)
-            return Qfalse;
-        return Qtrue;
+        return RBOOL(xn == yn);
 #endif
     }
     y = rb_dbl2big(yi);
     return rb_big_eq(x, y);
 }
 
-/*
- *  call-seq:
- *     big <=> numeric   -> -1, 0, +1 or nil
- *
- *  Comparison---Returns -1, 0, or +1 depending on whether +big+ is
- *  less than, equal to, or greater than +numeric+. This is the
- *  basis for the tests in Comparable.
- *
- *  +nil+ is returned if the two values are incomparable.
- *
- */
 
 VALUE
 rb_big_cmp(VALUE x, VALUE y)
 {
-    int cmp;
-
     if (FIXNUM_P(y)) {
-        x = bignorm(x);
+        x = bigfixize(x);
         if (FIXNUM_P(x)) {
-            if (FIX2LONG(x) > FIX2LONG(y)) return INT2FIX(1);
-            if (FIX2LONG(x) < FIX2LONG(y)) return INT2FIX(-1);
-            return INT2FIX(0);
-        }
-        else {
-            if (BIGNUM_NEGATIVE_P(x)) return INT2FIX(-1);
-            return INT2FIX(1);
+            /* SIGNED_VALUE and Fixnum have same sign-bits, same
+             * order */
+            SIGNED_VALUE sx = (SIGNED_VALUE)x, sy = (SIGNED_VALUE)y;
+            if (sx < sy) return INT2FIX(-1);
+            return INT2FIX(sx > sy);
         }
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
+        if (BIGNUM_SIGN(x) == BIGNUM_SIGN(y)) {
+            int cmp = bary_cmp(BDIGITS(x), BIGNUM_LEN(x), BDIGITS(y), BIGNUM_LEN(y));
+            return INT2FIX(BIGNUM_SIGN(x) ? cmp : -cmp);
+        }
     }
     else if (RB_FLOAT_TYPE_P(y)) {
         return rb_integer_float_cmp(x, y);
     }
     else {
-	return rb_num_coerce_cmp(x, y, rb_intern("<=>"));
+        return rb_num_coerce_cmp(x, y, idCmp);
     }
-
-    if (BIGNUM_SIGN(x) > BIGNUM_SIGN(y)) return INT2FIX(1);
-    if (BIGNUM_SIGN(x) < BIGNUM_SIGN(y)) return INT2FIX(-1);
-
-    cmp = bary_cmp(BDIGITS(x), BIGNUM_LEN(x), BDIGITS(y), BIGNUM_LEN(y));
-    if (BIGNUM_SIGN(x))
-        return INT2FIX(cmp);
-    else
-        return INT2FIX(-cmp);
+    return INT2FIX(BIGNUM_SIGN(x) ? 1 : -1);
 }
 
 enum big_op_t {
@@ -5321,87 +5526,55 @@ big_op(VALUE x, VALUE y, enum big_op_t op)
     VALUE rel;
     int n;
 
-    if (FIXNUM_P(y) || RB_BIGNUM_TYPE_P(y)) {
-	rel = rb_big_cmp(x, y);
+    if (RB_INTEGER_TYPE_P(y)) {
+        rel = rb_big_cmp(x, y);
     }
     else if (RB_FLOAT_TYPE_P(y)) {
         rel = rb_integer_float_cmp(x, y);
     }
     else {
-	ID id = 0;
-	switch (op) {
-	  case big_op_gt: id = '>'; break;
-	  case big_op_ge: id = rb_intern(">="); break;
-	  case big_op_lt: id = '<'; break;
-	  case big_op_le: id = rb_intern("<="); break;
-	}
-	return rb_num_coerce_relop(x, y, id);
+        ID id = 0;
+        switch (op) {
+          case big_op_gt: id = '>'; break;
+          case big_op_ge: id = idGE; break;
+          case big_op_lt: id = '<'; break;
+          case big_op_le: id = idLE; break;
+        }
+        return rb_num_coerce_relop(x, y, id);
     }
 
     if (NIL_P(rel)) return Qfalse;
     n = FIX2INT(rel);
 
     switch (op) {
-	case big_op_gt: return n >  0 ? Qtrue : Qfalse;
-	case big_op_ge: return n >= 0 ? Qtrue : Qfalse;
-	case big_op_lt: return n <  0 ? Qtrue : Qfalse;
-	case big_op_le: return n <= 0 ? Qtrue : Qfalse;
+      case big_op_gt: return RBOOL(n >  0);
+      case big_op_ge: return RBOOL(n >= 0);
+      case big_op_lt: return RBOOL(n <  0);
+      case big_op_le: return RBOOL(n <= 0);
     }
     return Qundef;
 }
 
-/*
- * call-seq:
- *   big > real  ->  true or false
- *
- * Returns <code>true</code> if the value of <code>big</code> is
- * greater than that of <code>real</code>.
- */
-
-static VALUE
-big_gt(VALUE x, VALUE y)
+VALUE
+rb_big_gt(VALUE x, VALUE y)
 {
     return big_op(x, y, big_op_gt);
 }
 
-/*
- * call-seq:
- *   big >= real  ->  true or false
- *
- * Returns <code>true</code> if the value of <code>big</code> is
- * greater than or equal to that of <code>real</code>.
- */
-
-static VALUE
-big_ge(VALUE x, VALUE y)
+VALUE
+rb_big_ge(VALUE x, VALUE y)
 {
     return big_op(x, y, big_op_ge);
 }
 
-/*
- * call-seq:
- *   big < real  ->  true or false
- *
- * Returns <code>true</code> if the value of <code>big</code> is
- * less than that of <code>real</code>.
- */
-
-static VALUE
-big_lt(VALUE x, VALUE y)
+VALUE
+rb_big_lt(VALUE x, VALUE y)
 {
     return big_op(x, y, big_op_lt);
 }
 
-/*
- * call-seq:
- *   big <= real  ->  true or false
- *
- * Returns <code>true</code> if the value of <code>big</code> is
- * less than or equal to that of <code>real</code>.
- */
-
-static VALUE
-big_le(VALUE x, VALUE y)
+VALUE
+rb_big_le(VALUE x, VALUE y)
 {
     return big_op(x, y, big_op_le);
 }
@@ -5411,8 +5584,8 @@ big_le(VALUE x, VALUE y)
  *     big == obj  -> true or false
  *
  *  Returns <code>true</code> only if <i>obj</i> has the same value
- *  as <i>big</i>. Contrast this with <code>Bignum#eql?</code>, which
- *  requires <i>obj</i> to be a <code>Bignum</code>.
+ *  as <i>big</i>. Contrast this with Integer#eql?, which requires
+ *  <i>obj</i> to be an Integer.
  *
  *     68719476736 == 68719476736.0   #=> true
  */
@@ -5421,8 +5594,7 @@ VALUE
 rb_big_eq(VALUE x, VALUE y)
 {
     if (FIXNUM_P(y)) {
-	if (bignorm(x) == y) return Qtrue;
-	y = rb_int2big(FIX2LONG(y));
+        return RBOOL(bignorm(x) == y);
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
     }
@@ -5430,66 +5602,34 @@ rb_big_eq(VALUE x, VALUE y)
         return rb_integer_float_eq(x, y);
     }
     else {
-	return rb_equal(y, x);
+        return rb_equal(y, x);
     }
     if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y)) return Qfalse;
     if (BIGNUM_LEN(x) != BIGNUM_LEN(y)) return Qfalse;
-    if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) != 0) return Qfalse;
-    return Qtrue;
+    return RBOOL(MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) == 0);
 }
 
-/*
- *  call-seq:
- *     big.eql?(obj)   -> true or false
- *
- *  Returns <code>true</code> only if <i>obj</i> is a
- *  <code>Bignum</code> with the same value as <i>big</i>. Contrast this
- *  with <code>Bignum#==</code>, which performs type conversions.
- *
- *     68719476736.eql?(68719476736.0)   #=> false
- */
-
 VALUE
 rb_big_eql(VALUE x, VALUE y)
 {
     if (!RB_BIGNUM_TYPE_P(y)) return Qfalse;
     if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y)) return Qfalse;
     if (BIGNUM_LEN(x) != BIGNUM_LEN(y)) return Qfalse;
-    if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) != 0) return Qfalse;
-    return Qtrue;
+    return RBOOL(MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) == 0);
 }
 
-/*
- * call-seq:
- *    -big   ->  integer
- *
- * Unary minus (returns an integer whose value is 0-big)
- */
-
 VALUE
 rb_big_uminus(VALUE x)
 {
     VALUE z = rb_big_clone(x);
 
-    BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
+    BIGNUM_NEGATE(z);
 
     return bignorm(z);
 }
 
-/*
- * call-seq:
- *     ~big  ->  integer
- *
- * Inverts the bits in big. As Bignums are conceptually infinite
- * length, the result acts as if it had an infinite number of one
- * bits to the left. In hex representations, this is displayed
- * as two periods to the left of the digits.
- *
- *   sprintf("%X", ~0x1122334455)    #=> "..FEEDDCCBBAA"
- */
-
-static VALUE
-rb_big_neg(VALUE x)
+VALUE
+rb_big_comp(VALUE x)
 {
     VALUE z = rb_big_clone(x);
     BDIGIT *ds = BDIGITS(z);
@@ -5566,13 +5706,13 @@ bigsub_int(VALUE x, long y0)
     zds = BDIGITS(z);
 
 #if SIZEOF_BDIGIT >= SIZEOF_LONG
-    assert(xn == zn);
+    RUBY_ASSERT(xn == zn);
     num = (BDIGIT_DBL_SIGNED)xds[0] - y;
     if (xn == 1 && num < 0) {
-	BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
-	zds[0] = (BDIGIT)-num;
-	RB_GC_GUARD(x);
-	return bignorm(z);
+        BIGNUM_NEGATE(z);
+        zds[0] = (BDIGIT)-num;
+        RB_GC_GUARD(x);
+        return bignorm(z);
     }
     zds[0] = BIGLO(num);
     num = BIGDN(num);
@@ -5584,10 +5724,10 @@ bigsub_int(VALUE x, long y0)
     num = 0;
     for (i=0; i < xn; i++) {
         if (y == 0) goto y_is_zero_x;
-	num += (BDIGIT_DBL_SIGNED)xds[i] - BIGLO(y);
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
-	y = BIGDN(y);
+        num += (BDIGIT_DBL_SIGNED)xds[i] - BIGLO(y);
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
+        y = BIGDN(y);
     }
     for (; i < zn; i++) {
         if (y == 0) goto y_is_zero_z;
@@ -5602,9 +5742,9 @@ bigsub_int(VALUE x, long y0)
     for (; i < xn; i++) {
       y_is_zero_x:
         if (num == 0) goto num_is_zero_x;
-	num += xds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        num += xds[i];
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
 #if SIZEOF_BDIGIT < SIZEOF_LONG
     for (; i < zn; i++) {
@@ -5618,7 +5758,7 @@ bigsub_int(VALUE x, long y0)
 
     for (; i < xn; i++) {
       num_is_zero_x:
-	zds[i] = xds[i];
+        zds[i] = xds[i];
     }
 #if SIZEOF_BDIGIT < SIZEOF_LONG
     for (; i < zn; i++) {
@@ -5629,10 +5769,10 @@ bigsub_int(VALUE x, long y0)
     goto finish;
 
   finish:
-    assert(num == 0 || num == -1);
+    RUBY_ASSERT(num == 0 || num == -1);
     if (num < 0) {
         get2comp(z);
-	BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
+        BIGNUM_NEGATE(z);
     }
     RB_GC_GUARD(x);
     return bignorm(z);
@@ -5675,17 +5815,17 @@ bigadd_int(VALUE x, long y)
     num = 0;
     for (i=0; i < xn; i++) {
         if (y == 0) goto y_is_zero_x;
-	num += (BDIGIT_DBL)xds[i] + BIGLO(y);
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
-	y = BIGDN(y);
+        num += (BDIGIT_DBL)xds[i] + BIGLO(y);
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
+        y = BIGDN(y);
     }
     for (; i < zn; i++) {
         if (y == 0) goto y_is_zero_z;
-	num += BIGLO(y);
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
-	y = BIGDN(y);
+        num += BIGLO(y);
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
+        y = BIGDN(y);
     }
     goto finish;
 
@@ -5694,25 +5834,25 @@ bigadd_int(VALUE x, long y)
     for (;i < xn; i++) {
       y_is_zero_x:
         if (num == 0) goto num_is_zero_x;
-	num += (BDIGIT_DBL)xds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        num += (BDIGIT_DBL)xds[i];
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     for (; i < zn; i++) {
       y_is_zero_z:
         if (num == 0) goto num_is_zero_z;
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     goto finish;
 
     for (;i < xn; i++) {
       num_is_zero_x:
-	zds[i] = xds[i];
+        zds[i] = xds[i];
     }
     for (; i < zn; i++) {
       num_is_zero_z:
-	zds[i] = 0;
+        zds[i] = 0;
     }
     goto finish;
 
@@ -5729,15 +5869,15 @@ bigadd(VALUE x, VALUE y, int sign)
 
     sign = (sign == BIGNUM_SIGN(y));
     if (BIGNUM_SIGN(x) != sign) {
-	if (sign) return bigsub(y, x);
-	return bigsub(x, y);
+        if (sign) return bigsub(y, x);
+        return bigsub(x, y);
     }
 
     if (BIGNUM_LEN(x) > BIGNUM_LEN(y)) {
-	len = BIGNUM_LEN(x) + 1;
+        len = BIGNUM_LEN(x) + 1;
     }
     else {
-	len = BIGNUM_LEN(y) + 1;
+        len = BIGNUM_LEN(y) + 1;
     }
     z = bignew(len, sign);
 
@@ -5748,75 +5888,61 @@ bigadd(VALUE x, VALUE y, int sign)
     return z;
 }
 
-/*
- *  call-seq:
- *     big + other  -> Numeric
- *
- *  Adds big and other, returning the result.
- */
-
 VALUE
 rb_big_plus(VALUE x, VALUE y)
 {
     long n;
 
     if (FIXNUM_P(y)) {
-	n = FIX2LONG(y);
-	if ((n > 0) != BIGNUM_SIGN(x)) {
-	    if (n < 0) {
-		n = -n;
-	    }
-	    return bigsub_int(x, n);
-	}
-	if (n < 0) {
-	    n = -n;
-	}
-	return bigadd_int(x, n);
+        n = FIX2LONG(y);
+        if ((n > 0) != BIGNUM_SIGN(x)) {
+            if (n < 0) {
+                n = -n;
+            }
+            return bigsub_int(x, n);
+        }
+        if (n < 0) {
+            n = -n;
+        }
+        return bigadd_int(x, n);
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
-	return bignorm(bigadd(x, y, 1));
+        return bignorm(bigadd(x, y, 1));
     }
     else if (RB_FLOAT_TYPE_P(y)) {
-	return DBL2NUM(rb_big2dbl(x) + RFLOAT_VALUE(y));
+        return DBL2NUM(rb_big2dbl(x) + RFLOAT_VALUE(y));
     }
     else {
-	return rb_num_coerce_bin(x, y, '+');
+        return rb_num_coerce_bin(x, y, '+');
     }
 }
 
-/*
- *  call-seq:
- *     big - other  -> Numeric
- *
- *  Subtracts other from big, returning the result.
- */
-
 VALUE
 rb_big_minus(VALUE x, VALUE y)
 {
     long n;
 
     if (FIXNUM_P(y)) {
-	n = FIX2LONG(y);
-	if ((n > 0) != BIGNUM_SIGN(x)) {
-	    if (n < 0) {
-		n = -n;
-	    }
-	    return bigadd_int(x, n);
-	}
-	if (n < 0) {
-	    n = -n;
-	}
-	return bigsub_int(x, n);
+        n = FIX2LONG(y);
+        if ((n > 0) != BIGNUM_SIGN(x)) {
+            if (n < 0) {
+                n = -n;
+            }
+            return bigadd_int(x, n);
+        }
+        if (n < 0) {
+            n = -n;
+        }
+        return bigsub_int(x, n);
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
-	return bignorm(bigadd(x, y, 0));
+        return bignorm(bigadd(x, y, 0));
     }
     else if (RB_FLOAT_TYPE_P(y)) {
-	return DBL2NUM(rb_big2dbl(x) - RFLOAT_VALUE(y));
+        return DBL2NUM(rb_big2dbl(x) - RFLOAT_VALUE(y));
     }
     else {
-	return rb_num_coerce_bin(x, y, '-');
+        return rb_num_coerce_bin(x, y, '-');
     }
 }
 
@@ -5828,6 +5954,8 @@ bigsq(VALUE x)
     BDIGIT *xds, *zds;
 
     xn = BIGNUM_LEN(x);
+    if (MUL_OVERFLOW_LONG_P(2, xn))
+        rb_raise(rb_eArgError, "square overflow");
     zn = 2 * xn;
 
     z = bignew(zn, 1);
@@ -5835,17 +5963,10 @@ bigsq(VALUE x)
     xds = BDIGITS(x);
     zds = BDIGITS(z);
 
-#ifdef USE_GMP
-    if (xn < GMP_MUL_DIGITS)
-        bary_sq_fast(zds, zn, xds, xn);
-    else
-        bary_mul(zds, zn, xds, xn, xds, xn);
-#else
-    if (xn < KARATSUBA_MUL_DIGITS)
+    if (xn < NAIVE_MUL_DIGITS)
         bary_sq_fast(zds, zn, xds, xn);
     else
         bary_mul(zds, zn, xds, xn, xds, xn);
-#endif
 
     RB_GC_GUARD(x);
     return z;
@@ -5863,6 +5984,8 @@ bigmul0(VALUE x, VALUE y)
 
     xn = BIGNUM_LEN(x);
     yn = BIGNUM_LEN(y);
+    if (ADD_OVERFLOW_LONG_P(xn, yn))
+        rb_raise(rb_eArgError, "multiplication overflow");
     zn = xn + yn;
 
     z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
@@ -5878,26 +6001,19 @@ bigmul0(VALUE x, VALUE y)
     return z;
 }
 
-/*
- *  call-seq:
- *     big * other  -> Numeric
- *
- *  Multiplies big and other, returning the result.
- */
-
 VALUE
 rb_big_mul(VALUE x, VALUE y)
 {
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+        y = rb_int2big(FIX2LONG(y));
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
     }
     else if (RB_FLOAT_TYPE_P(y)) {
-	return DBL2NUM(rb_big2dbl(x) * RFLOAT_VALUE(y));
+        return DBL2NUM(rb_big2dbl(x) * RFLOAT_VALUE(y));
     }
     else {
-	return rb_num_coerce_bin(x, y, '*');
+        return rb_num_coerce_bin(x, y, '*');
     }
 
     return bignorm(bigmul0(x, y));
@@ -5924,21 +6040,21 @@ bigdivrem(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp)
     BARY_TRUNC(xds, xn);
 
     if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1])) {
-	if (divp) *divp = rb_int2big(0);
-	if (modp) *modp = x;
-	return Qnil;
+        if (divp) *divp = rb_int2big(0);
+        if (modp) *modp = x;
+        return Qnil;
     }
     if (yn == 1) {
-	dd = yds[0];
-	z = bignew(xn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
-	zds = BDIGITS(z);
+        dd = yds[0];
+        z = bignew(xn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+        zds = BDIGITS(z);
         dd = bigdivrem_single(zds, xds, xn, dd);
-	if (modp) {
-	    *modp = rb_uint2big((VALUE)dd);
-	    BIGNUM_SET_SIGN(*modp, BIGNUM_SIGN(x));
-	}
-	if (divp) *divp = z;
-	return Qnil;
+        if (modp) {
+            *modp = rb_uint2big((uintptr_t)dd);
+            BIGNUM_SET_SIGN(*modp, BIGNUM_SIGN(x));
+        }
+        if (divp) *divp = z;
+        return Qnil;
     }
     if (xn == 2 && yn == 2) {
         BDIGIT_DBL x0 = bary2bdigitdbl(xds, 2);
@@ -6003,11 +6119,11 @@ bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp)
 
     bigdivrem(x, y, divp, &mod);
     if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y) && !BIGZEROP(mod)) {
-	if (divp) *divp = bigadd(*divp, rb_int2big(1), 0);
-	if (modp) *modp = bigadd(mod, y, 1);
+        if (divp) *divp = bigadd(*divp, rb_int2big(1), 0);
+        if (modp) *modp = bigadd(mod, y, 1);
     }
     else if (modp) {
-	*modp = mod;
+        *modp = mod;
     }
 }
 
@@ -6018,123 +6134,85 @@ rb_big_divide(VALUE x, VALUE y, ID op)
     VALUE z;
 
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+        y = rb_int2big(FIX2LONG(y));
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
     }
     else if (RB_FLOAT_TYPE_P(y)) {
-	if (op == '/') {
-	    return DBL2NUM(rb_big2dbl(x) / RFLOAT_VALUE(y));
-	}
-	else {
-	    double dy = RFLOAT_VALUE(y);
-	    if (dy == 0.0) rb_num_zerodiv();
-	    return rb_dbl2big(rb_big2dbl(x) / dy);
-	}
+        if (op == '/') {
+            double dx = rb_big2dbl(x);
+            return rb_flo_div_flo(DBL2NUM(dx), y);
+        }
+        else {
+            VALUE v;
+            double dy = RFLOAT_VALUE(y);
+            if (dy == 0.0) rb_num_zerodiv();
+            v = rb_big_divide(x, y, '/');
+            return rb_dbl2big(RFLOAT_VALUE(v));
+        }
     }
     else {
-	return rb_num_coerce_bin(x, y, op);
+        return rb_num_coerce_bin(x, y, op);
     }
     bigdivmod(x, y, &z, 0);
 
     return bignorm(z);
 }
 
-/*
- *  call-seq:
- *     big / other     -> Numeric
- *
- * Performs division: the class of the resulting object depends on
- * the class of <code>numeric</code> and on the magnitude of the
- * result.
- */
-
 VALUE
 rb_big_div(VALUE x, VALUE y)
 {
     return rb_big_divide(x, y, '/');
 }
 
-/*
- *  call-seq:
- *     big.div(other)  -> integer
- *
- * Performs integer division: returns integer value.
- */
-
 VALUE
 rb_big_idiv(VALUE x, VALUE y)
 {
-    return rb_big_divide(x, y, rb_intern("div"));
+    return rb_big_divide(x, y, idDiv);
 }
 
-/*
- *  call-seq:
- *     big % other         -> Numeric
- *     big.modulo(other)   -> Numeric
- *
- *  Returns big modulo other. See Numeric.divmod for more
- *  information.
- */
-
 VALUE
 rb_big_modulo(VALUE x, VALUE y)
 {
     VALUE z;
 
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+        y = rb_int2big(FIX2LONG(y));
     }
     else if (!RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bin(x, y, '%');
+        return rb_num_coerce_bin(x, y, '%');
     }
     bigdivmod(x, y, 0, &z);
 
     return bignorm(z);
 }
 
-/*
- *  call-seq:
- *     big.remainder(numeric)    -> number
- *
- *  Returns the remainder after dividing <i>big</i> by <i>numeric</i>.
- *
- *     -1234567890987654321.remainder(13731)      #=> -6966
- *     -1234567890987654321.remainder(13731.24)   #=> -9906.22531493148
- */
-static VALUE
+VALUE
 rb_big_remainder(VALUE x, VALUE y)
 {
     VALUE z;
 
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+        y = rb_int2big(FIX2LONG(y));
     }
     else if (!RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bin(x, y, rb_intern("remainder"));
+        return rb_num_coerce_bin(x, y, rb_intern("remainder"));
     }
     bigdivrem(x, y, 0, &z);
 
     return bignorm(z);
 }
 
-/*
- *  call-seq:
- *     big.divmod(numeric)   -> array
- *
- *  See <code>Numeric#divmod</code>.
- *
- */
 VALUE
 rb_big_divmod(VALUE x, VALUE y)
 {
     VALUE div, mod;
 
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+        y = rb_int2big(FIX2LONG(y));
     }
     else if (!RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bin(x, y, rb_intern("divmod"));
+        return rb_num_coerce_bin(x, y, idDivmod);
     }
     bigdivmod(x, y, &div, &mod);
 
@@ -6145,16 +6223,17 @@ static VALUE
 big_shift(VALUE x, long n)
 {
     if (n < 0)
-	return big_lshift(x, 1+(unsigned long)(-(n+1)));
+        return big_lshift(x, 1+(unsigned long)(-(n+1)));
     else if (n > 0)
-	return big_rshift(x, (unsigned long)n);
+        return big_rshift(x, (unsigned long)n);
     return x;
 }
 
-static VALUE
+enum {DBL_BIGDIG = ((DBL_MANT_DIG + BITSPERDIG) / BITSPERDIG)};
+
+static double
 big_fdiv(VALUE x, VALUE y, long ey)
 {
-#define DBL_BIGDIG ((DBL_MANT_DIG + BITSPERDIG) / BITSPERDIG)
     VALUE z;
     long l, ex;
 
@@ -6162,21 +6241,23 @@ big_fdiv(VALUE x, VALUE y, long ey)
     l = BIGNUM_LEN(x);
     ex = l * BITSPERDIG - nlz(BDIGITS(x)[l-1]);
     ex -= 2 * DBL_BIGDIG * BITSPERDIG;
+    if (ex > BITSPERDIG) ex -= BITSPERDIG;
+    else if (ex > 0) ex = 0;
     if (ex) x = big_shift(x, ex);
 
     bigdivrem(x, y, &z, 0);
     l = ex - ey;
 #if SIZEOF_LONG > SIZEOF_INT
     {
-	/* Visual C++ can't be here */
-	if (l > INT_MAX) return DBL2NUM(INFINITY);
-	if (l < INT_MIN) return DBL2NUM(0.0);
+        /* Visual C++ can't be here */
+        if (l > INT_MAX) return HUGE_VAL;
+        if (l < INT_MIN) return 0.0;
     }
 #endif
-    return DBL2NUM(ldexp(big2dbl(z), (int)l));
+    return ldexp(big2dbl(z), (int)l);
 }
 
-static VALUE
+static double
 big_fdiv_int(VALUE x, VALUE y)
 {
     long l, ey;
@@ -6188,7 +6269,7 @@ big_fdiv_int(VALUE x, VALUE y)
     return big_fdiv(x, y, ey);
 }
 
-static VALUE
+static double
 big_fdiv_float(VALUE x, VALUE y)
 {
     int i;
@@ -6196,60 +6277,40 @@ big_fdiv_float(VALUE x, VALUE y)
     return big_fdiv(x, y, i - DBL_MANT_DIG);
 }
 
-/*
- *  call-seq:
-  *     big.fdiv(numeric) -> float
- *
- *  Returns the floating point result of dividing <i>big</i> by
- *  <i>numeric</i>.
- *
- *     -1234567890987654321.fdiv(13731)      #=> -89910996357705.5
- *     -1234567890987654321.fdiv(13731.24)   #=> -89909424858035.7
- *
- */
-
-
-VALUE
-rb_big_fdiv(VALUE x, VALUE y)
+double
+rb_big_fdiv_double(VALUE x, VALUE y)
 {
     double dx, dy;
+    VALUE v;
 
     dx = big2dbl(x);
     if (FIXNUM_P(y)) {
-	dy = (double)FIX2LONG(y);
-	if (isinf(dx))
-	    return big_fdiv_int(x, rb_int2big(FIX2LONG(y)));
+        dy = (double)FIX2LONG(y);
+        if (isinf(dx))
+            return big_fdiv_int(x, rb_int2big(FIX2LONG(y)));
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
-	dy = rb_big2dbl(y);
-	if (isinf(dx) || isinf(dy))
-	    return big_fdiv_int(x, y);
+        return big_fdiv_int(x, y);
     }
     else if (RB_FLOAT_TYPE_P(y)) {
-	dy = RFLOAT_VALUE(y);
-	if (isnan(dy))
-	    return y;
-	if (isinf(dx))
-	    return big_fdiv_float(x, y);
+        dy = RFLOAT_VALUE(y);
+        if (isnan(dy))
+            return dy;
+        if (isinf(dx))
+            return big_fdiv_float(x, y);
     }
     else {
-	return rb_num_coerce_bin(x, y, rb_intern("fdiv"));
+        return NUM2DBL(rb_num_coerce_bin(x, y, idFdiv));
     }
-    return DBL2NUM(dx / dy);
+    v = rb_flo_div_flo(DBL2NUM(dx), DBL2NUM(dy));
+    return NUM2DBL(v);
 }
 
-/*
- *  call-seq:
- *     big ** exponent   -> numeric
- *
- *  Raises _big_ to the _exponent_ power (which may be an integer, float,
- *  or anything that will coerce to a number). The result may be
- *  a Fixnum, Bignum, or Float
- *
- *    123456789 ** 2      #=> 15241578750190521
- *    123456789 ** 1.2    #=> 5126464716.09932
- *    123456789 ** -2     #=> 6.5610001194102e-17
- */
+VALUE
+rb_big_fdiv(VALUE x, VALUE y)
+{
+    return DBL2NUM(rb_big_fdiv_double(x, y));
+}
 
 VALUE
 rb_big_pow(VALUE x, VALUE y)
@@ -6259,48 +6320,58 @@ rb_big_pow(VALUE x, VALUE y)
 
   again:
     if (y == INT2FIX(0)) return INT2FIX(1);
+    if (y == INT2FIX(1)) return x;
     if (RB_FLOAT_TYPE_P(y)) {
-	d = RFLOAT_VALUE(y);
-	if ((!BIGNUM_SIGN(x) && !BIGZEROP(x)) && d != round(d))
-	    return rb_funcall(rb_complex_raw1(x), rb_intern("**"), 1, y);
+        d = RFLOAT_VALUE(y);
+        if ((BIGNUM_NEGATIVE_P(x) && !BIGZEROP(x))) {
+            return rb_dbl_complex_new_polar_pi(pow(-rb_big2dbl(x), d), d);
+        }
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
-	y = bignorm(y);
-	if (FIXNUM_P(y))
-	    goto again;
-	rb_warn("in a**b, b may be too big");
-	d = rb_big2dbl(y);
+        y = bignorm(y);
+        if (FIXNUM_P(y))
+            goto again;
+        rb_raise(rb_eArgError, "exponent is too large");
     }
     else if (FIXNUM_P(y)) {
-	yy = FIX2LONG(y);
+        yy = FIX2LONG(y);
 
-	if (yy < 0)
-	    return rb_funcall(rb_rational_raw1(x), rb_intern("**"), 1, y);
-	else {
-	    VALUE z = 0;
-	    SIGNED_VALUE mask;
+        if (yy < 0) {
+            x = rb_big_pow(x, LONG2NUM(-yy));
+            if (RB_INTEGER_TYPE_P(x))
+                return rb_rational_raw(INT2FIX(1), x);
+            else
+                return DBL2NUM(1.0 / NUM2DBL(x));
+        }
+        else {
+            VALUE z = 0;
+            SIGNED_VALUE mask;
             const size_t xbits = rb_absint_numwords(x, 1, NULL);
-	    const size_t BIGLEN_LIMIT = 32*1024*1024;
+#if SIZEOF_SIZE_T == 4
+            const size_t BIGLEN_LIMIT = 1ULL << 31; // 2 GB
+#else // SIZEOF_SIZE_T == 8
+            const size_t BIGLEN_LIMIT = 1ULL << 34; // 16 GB
+#endif
 
-	    if (xbits == (size_t)-1 ||
+            if (xbits == (size_t)-1 ||
                 (xbits > BIGLEN_LIMIT) ||
+                MUL_OVERFLOW_LONG_P(yy, xbits) ||
                 (xbits * yy > BIGLEN_LIMIT)) {
-		rb_warn("in a**b, b may be too big");
-		d = (double)yy;
-	    }
-	    else {
-		for (mask = FIXNUM_MAX + 1; mask; mask >>= 1) {
-		    if (z) z = bigsq(z);
-		    if (yy & mask) {
-			z = z ? bigtrunc(bigmul0(z, x)) : x;
-		    }
-		}
-		return bignorm(z);
-	    }
-	}
+                rb_raise(rb_eArgError, "exponent is too large");
+            }
+            else {
+                for (mask = FIXNUM_MAX + 1; mask; mask >>= 1) {
+                    if (z) z = bigsq(z);
+                    if (yy & mask) {
+                        z = z ? bigtrunc(bigmul0(z, x)) : x;
+                    }
+                }
+                return bignorm(z);
+            }
+        }
     }
     else {
-	return rb_num_coerce_bin(x, y, rb_intern("**"));
+        return rb_num_coerce_bin(x, y, idPow);
     }
     return DBL2NUM(pow(rb_big2dbl(x), d));
 }
@@ -6315,13 +6386,13 @@ bigand_int(VALUE x, long xn, BDIGIT hibitsx, long y)
     BDIGIT hibitsy;
 
     if (y == 0) return INT2FIX(0);
-    if (xn == 0) return hibitsx ? LONG2NUM(y) : 0;
+    if (xn == 0) return hibitsx ? LONG2NUM(y) : INT2FIX(0);
     hibitsy = 0 <= y ? 0 : BDIGMAX;
     xds = BDIGITS(x);
 #if SIZEOF_BDIGIT >= SIZEOF_LONG
     if (!hibitsy) {
-	y &= xds[0];
-	return LONG2NUM(y);
+        y &= xds[0];
+        return LONG2NUM(y);
     }
 #endif
 
@@ -6350,23 +6421,16 @@ bigand_int(VALUE x, long xn, BDIGIT hibitsx, long y)
     }
 #endif
     for (;i < xn; i++) {
-	zds[i] = xds[i] & hibitsy;
+        zds[i] = xds[i] & hibitsy;
     }
     for (;i < zn; i++) {
-	zds[i] = hibitsx & hibitsy;
+        zds[i] = hibitsx & hibitsy;
     }
     twocomp2abs_bang(z, hibitsx && hibitsy);
     RB_GC_GUARD(x);
     return bignorm(z);
 }
 
-/*
- * call-seq:
- *     big & numeric   ->  integer
- *
- * Performs bitwise +and+ between _big_ and _numeric_.
- */
-
 VALUE
 rb_big_and(VALUE x, VALUE y)
 {
@@ -6379,13 +6443,13 @@ rb_big_and(VALUE x, VALUE y)
     BDIGIT tmph;
     long tmpn;
 
-    if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bit(x, y, '&');
+    if (!RB_INTEGER_TYPE_P(y)) {
+        return rb_num_coerce_bit(x, y, '&');
     }
 
     hibitsx = abs2twocomp(&x, &xn);
     if (FIXNUM_P(y)) {
-	return bigand_int(x, xn, hibitsx, FIX2LONG(y));
+        return bigand_int(x, xn, hibitsx, FIX2LONG(y));
     }
     hibitsy = abs2twocomp(&y, &yn);
     if (xn > yn) {
@@ -6407,10 +6471,10 @@ rb_big_and(VALUE x, VALUE y)
     zds = BDIGITS(z);
 
     for (i=0; i<n1; i++) {
-	zds[i] = ds1[i] & ds2[i];
+        zds[i] = ds1[i] & ds2[i];
     }
     for (; i<n2; i++) {
-	zds[i] = hibits1 & ds2[i];
+        zds[i] = hibits1 & ds2[i];
     }
     twocomp2abs_bang(z, hibits1 && hibits2);
     RB_GC_GUARD(x);
@@ -6486,13 +6550,6 @@ bigor_int(VALUE x, long xn, BDIGIT hibitsx, long y)
     return bignorm(z);
 }
 
-/*
- * call-seq:
- *     big | numeric   ->  integer
- *
- * Performs bitwise +or+ between _big_ and _numeric_.
- */
-
 VALUE
 rb_big_or(VALUE x, VALUE y)
 {
@@ -6505,13 +6562,13 @@ rb_big_or(VALUE x, VALUE y)
     BDIGIT tmph;
     long tmpn;
 
-    if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bit(x, y, '|');
+    if (!RB_INTEGER_TYPE_P(y)) {
+        return rb_num_coerce_bit(x, y, '|');
     }
 
     hibitsx = abs2twocomp(&x, &xn);
     if (FIXNUM_P(y)) {
-	return bigor_int(x, xn, hibitsx, FIX2LONG(y));
+        return bigor_int(x, xn, hibitsx, FIX2LONG(y));
     }
     hibitsy = abs2twocomp(&y, &yn);
     if (xn > yn) {
@@ -6533,10 +6590,10 @@ rb_big_or(VALUE x, VALUE y)
     zds = BDIGITS(z);
 
     for (i=0; i<n1; i++) {
-	zds[i] = ds1[i] | ds2[i];
+        zds[i] = ds1[i] | ds2[i];
     }
     for (; i<n2; i++) {
-	zds[i] = hibits1 | ds2[i];
+        zds[i] = hibits1 | ds2[i];
     }
     twocomp2abs_bang(z, hibits1 || hibits2);
     RB_GC_GUARD(x);
@@ -6586,12 +6643,6 @@ bigxor_int(VALUE x, long xn, BDIGIT hibitsx, long y)
     RB_GC_GUARD(x);
     return bignorm(z);
 }
-/*
- * call-seq:
- *     big ^ numeric   ->  integer
- *
- * Performs bitwise +exclusive or+ between _big_ and _numeric_.
- */
 
 VALUE
 rb_big_xor(VALUE x, VALUE y)
@@ -6605,13 +6656,13 @@ rb_big_xor(VALUE x, VALUE y)
     BDIGIT tmph;
     long tmpn;
 
-    if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bit(x, y, '^');
+    if (!RB_INTEGER_TYPE_P(y)) {
+        return rb_num_coerce_bit(x, y, '^');
     }
 
     hibitsx = abs2twocomp(&x, &xn);
     if (FIXNUM_P(y)) {
-	return bigxor_int(x, xn, hibitsx, FIX2LONG(y));
+        return bigxor_int(x, xn, hibitsx, FIX2LONG(y));
     }
     hibitsy = abs2twocomp(&y, &yn);
     if (xn > yn) {
@@ -6630,10 +6681,10 @@ rb_big_xor(VALUE x, VALUE y)
     zds = BDIGITS(z);
 
     for (i=0; i<n1; i++) {
-	zds[i] = ds1[i] ^ ds2[i];
+        zds[i] = ds1[i] ^ ds2[i];
     }
     for (; i<n2; i++) {
-	zds[i] = hibitsx ^ ds2[i];
+        zds[i] = hibitsx ^ ds2[i];
     }
     twocomp2abs_bang(z, (hibits1 ^ hibits2) != 0);
     RB_GC_GUARD(x);
@@ -6641,13 +6692,6 @@ rb_big_xor(VALUE x, VALUE y)
     return bignorm(z);
 }
 
-/*
- * call-seq:
- *     big << numeric   ->  integer
- *
- * Shifts big left _numeric_ positions (right if _numeric_ is negative).
- */
-
 VALUE
 rb_big_lshift(VALUE x, VALUE y)
 {
@@ -6656,36 +6700,28 @@ rb_big_lshift(VALUE x, VALUE y)
     int shift_numbits;
 
     for (;;) {
-	if (FIXNUM_P(y)) {
-	    long l = FIX2LONG(y);
+        if (FIXNUM_P(y)) {
+            long l = FIX2LONG(y);
             unsigned long shift;
-	    if (0 <= l) {
-		lshift_p = 1;
+            if (0 <= l) {
+                lshift_p = 1;
                 shift = l;
             }
             else {
-		lshift_p = 0;
-		shift = 1+(unsigned long)(-(l+1));
-	    }
+                lshift_p = 0;
+                shift = 1+(unsigned long)(-(l+1));
+            }
             shift_numbits = (int)(shift & (BITSPERDIG-1));
             shift_numdigits = shift >> bit_length(BITSPERDIG-1);
             return bignorm(big_shift3(x, lshift_p, shift_numdigits, shift_numbits));
-	}
-	else if (RB_BIGNUM_TYPE_P(y)) {
+        }
+        else if (RB_BIGNUM_TYPE_P(y)) {
             return bignorm(big_shift2(x, 1, y));
-	}
-	y = rb_to_int(y);
+        }
+        y = rb_to_int(y);
     }
 }
 
-
-/*
- * call-seq:
- *     big >> numeric   ->  integer
- *
- * Shifts big right _numeric_ positions (left if _numeric_ is negative).
- */
-
 VALUE
 rb_big_rshift(VALUE x, VALUE y)
 {
@@ -6694,8 +6730,8 @@ rb_big_rshift(VALUE x, VALUE y)
     int shift_numbits;
 
     for (;;) {
-	if (FIXNUM_P(y)) {
-	    long l = FIX2LONG(y);
+        if (FIXNUM_P(y)) {
+            long l = FIX2LONG(y);
             unsigned long shift;
             if (0 <= l) {
                 lshift_p = 0;
@@ -6703,39 +6739,20 @@ rb_big_rshift(VALUE x, VALUE y)
             }
             else {
                 lshift_p = 1;
-		shift = 1+(unsigned long)(-(l+1));
-	    }
+                shift = 1+(unsigned long)(-(l+1));
+            }
             shift_numbits = (int)(shift & (BITSPERDIG-1));
             shift_numdigits = shift >> bit_length(BITSPERDIG-1);
             return bignorm(big_shift3(x, lshift_p, shift_numdigits, shift_numbits));
-	}
-	else if (RB_BIGNUM_TYPE_P(y)) {
+        }
+        else if (RB_BIGNUM_TYPE_P(y)) {
             return bignorm(big_shift2(x, 0, y));
-	}
-	y = rb_to_int(y);
+        }
+        y = rb_to_int(y);
     }
 }
 
-/*
- *  call-seq:
- *     big[n] -> 0, 1
- *
- *  Bit Reference---Returns the <em>n</em>th bit in the (assumed) binary
- *  representation of <i>big</i>, where <i>big</i>[0] is the least
- *  significant bit.
- *
- *     a = 9**15
- *     50.downto(0) do |n|
- *       print a[n]
- *     end
- *
- *  <em>produces:</em>
- *
- *     000101110110100000111000011110010100111100010111001
- *
- */
-
-static VALUE
+VALUE
 rb_big_aref(VALUE x, VALUE y)
 {
     BDIGIT *xds;
@@ -6745,29 +6762,29 @@ rb_big_aref(VALUE x, VALUE y)
     BDIGIT bit;
 
     if (RB_BIGNUM_TYPE_P(y)) {
-	if (!BIGNUM_SIGN(y))
-	    return INT2FIX(0);
-	bigtrunc(y);
-	if (BIGSIZE(y) > sizeof(size_t)) {
-	  out_of_range:
-	    return BIGNUM_SIGN(x) ? INT2FIX(0) : INT2FIX(1);
-	}
+        if (BIGNUM_NEGATIVE_P(y))
+            return INT2FIX(0);
+        bigtrunc(y);
+        if (BIGSIZE(y) > sizeof(size_t)) {
+            return BIGNUM_SIGN(x) ? INT2FIX(0) : INT2FIX(1);
+        }
 #if SIZEOF_SIZE_T <= SIZEOF_LONG
-	shift = big2ulong(y, "long");
+        shift = big2ulong(y, "long");
 #else
-	shift = big2ull(y, "long long");
+        shift = big2ull(y, "long long");
 #endif
     }
     else {
-	l = NUM2LONG(y);
-	if (l < 0) return INT2FIX(0);
-	shift = (size_t)l;
+        l = NUM2LONG(y);
+        if (l < 0) return INT2FIX(0);
+        shift = (size_t)l;
     }
     s1 = shift/BITSPERDIG;
     s2 = shift%BITSPERDIG;
     bit = (BDIGIT)1 << s2;
 
-    if (s1 >= BIGNUM_LEN(x)) goto out_of_range;
+    if (s1 >= BIGNUM_LEN(x))
+        return BIGNUM_SIGN(x) ? INT2FIX(0) : INT2FIX(1);
 
     xds = BDIGITS(x);
     if (BIGNUM_POSITIVE_P(x))
@@ -6780,128 +6797,139 @@ rb_big_aref(VALUE x, VALUE y)
     return (xds[s1] & bit) ? INT2FIX(1) : INT2FIX(0);
 }
 
-/*
- * call-seq:
- *   big.hash   -> fixnum
- *
- * Compute a hash based on the value of _big_.
- *
- * See also Object#hash.
- */
+VALUE
+rb_big_aref2(VALUE x, VALUE beg, VALUE len)
+{
+    BDIGIT *xds, *vds;
+    VALUE v;
+    size_t copy_begin, xn, shift;
+    ssize_t begin, length, end;
+    bool negative_add_one;
+
+    beg = rb_to_int(beg);
+    len = rb_to_int(len);
+    length = NUM2SSIZET(len);
+    begin = NUM2SSIZET(beg);
+    end = NUM2SSIZET(rb_int_plus(beg, len));
+    shift = begin < 0 ? -begin : 0;
+    xn = BIGNUM_LEN(x);
+    xds = BDIGITS(x);
 
-static VALUE
+    if (length < 0) return rb_big_rshift(x, beg);
+    if (length == 0 || end <= 0) return INT2FIX(0);
+    if (begin < 0) begin = 0;
+
+    if ((size_t)(end - 1) / BITSPERDIG >= xn) {
+        /* end > xn * BITSPERDIG */
+        end = xn * BITSPERDIG;
+    }
+
+    if ((size_t)begin / BITSPERDIG < xn) {
+        /* begin < xn * BITSPERDIG */
+        size_t shift_bits, copy_end;
+        copy_begin = begin / BITSPERDIG;
+        shift_bits = begin % BITSPERDIG;
+        copy_end = (end - 1) / BITSPERDIG + 1;
+        v = bignew(copy_end - copy_begin, 1);
+        vds = BDIGITS(v);
+        MEMCPY(vds, xds + copy_begin, BDIGIT, copy_end - copy_begin);
+        negative_add_one = (vds[0] & ((1 << shift_bits) - 1)) == 0;
+        v = bignorm(v);
+        if (shift_bits) v = rb_int_rshift(v, SIZET2NUM(shift_bits));
+    }
+    else {
+        /* Out of range */
+        v = INT2FIX(0);
+        negative_add_one = false;
+        copy_begin = begin = end = 0;
+    }
+
+    if (BIGNUM_NEGATIVE_P(x)) {
+        size_t mask_size = length - shift;
+        VALUE mask = rb_int_minus(rb_int_lshift(INT2FIX(1), SIZET2NUM(mask_size)), INT2FIX(1));
+        v = rb_int_xor(v, mask);
+        for (size_t i = 0; negative_add_one && i < copy_begin; i++) {
+            if (xds[i]) negative_add_one = false;
+        }
+        if (negative_add_one) v = rb_int_plus(v, INT2FIX(1));
+        v = rb_int_and(v, mask);
+    }
+    else {
+        size_t mask_size = (size_t)end - begin;
+        VALUE mask = rb_int_minus(rb_int_lshift(INT2FIX(1), SIZET2NUM(mask_size)), INT2FIX(1));
+        v = rb_int_and(v, mask);
+    }
+    RB_GC_GUARD(x);
+    if (shift) v = rb_int_lshift(v, SSIZET2NUM(shift));
+    return v;
+}
+
+VALUE
 rb_big_hash(VALUE x)
 {
     st_index_t hash;
 
     hash = rb_memhash(BDIGITS(x), sizeof(BDIGIT)*BIGNUM_LEN(x)) ^ BIGNUM_SIGN(x);
-    return INT2FIX(hash);
+    return ST2FIX(hash);
 }
 
 /*
  * call-seq:
- *   big.coerce(numeric)  ->  array
+ *   int.coerce(numeric)  ->  array
  *
- * Returns an array with both a +numeric+ and a +big+ represented as Bignum
- * objects.
+ * Returns an array with both a +numeric+ and a +int+ represented as
+ * Integer objects or Float objects.
  *
- * This is achieved by converting +numeric+ to a Bignum.
+ * This is achieved by converting +numeric+ to an Integer or a Float.
  *
- * A TypeError is raised if the +numeric+ is not a Fixnum or Bignum type.
+ * A TypeError is raised if the +numeric+ is not an Integer or a Float
+ * type.
  *
  *     (0x3FFFFFFFFFFFFFFF+1).coerce(42)   #=> [42, 4611686018427387904]
  */
 
 static VALUE
-rb_big_coerce(VALUE x, VALUE y)
+rb_int_coerce(VALUE x, VALUE y)
 {
-    if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+    if (RB_INTEGER_TYPE_P(y)) {
+        return rb_assoc_new(y, x);
     }
-    else if (!RB_BIGNUM_TYPE_P(y)) {
-	rb_raise(rb_eTypeError, "can't coerce %s to Bignum",
-		 rb_obj_classname(y));
+    else {
+        x = rb_Float(x);
+        y = rb_Float(y);
+        return rb_assoc_new(y, x);
     }
-    return rb_assoc_new(y, x);
 }
 
-/*
- *  call-seq:
- *     big.abs -> aBignum
- *     big.magnitude -> aBignum
- *
- *  Returns the absolute value of <i>big</i>.
- *
- *     -1234567890987654321.abs   #=> 1234567890987654321
- */
-
-static VALUE
+VALUE
 rb_big_abs(VALUE x)
 {
-    if (!BIGNUM_SIGN(x)) {
-	x = rb_big_clone(x);
-	BIGNUM_SET_SIGN(x, 1);
+    if (BIGNUM_NEGATIVE_P(x)) {
+        x = rb_big_clone(x);
+        BIGNUM_SET_POSITIVE_SIGN(x);
     }
     return x;
 }
 
-/*
- *  call-seq:
- *     big.size -> integer
- *
- *  Returns the number of bytes in the machine representation of
- *  <i>big</i>.
- *
- *     (256**10 - 1).size   #=> 12
- *     (256**20 - 1).size   #=> 20
- *     (256**40 - 1).size   #=> 40
- */
+int
+rb_big_sign(VALUE x)
+{
+    return BIGNUM_SIGN(x);
+}
 
-static VALUE
+size_t
 rb_big_size(VALUE big)
 {
-    return SIZET2NUM(BIGSIZE(big));
+    return BIGSIZE(big);
 }
 
-/*
- *  call-seq:
- *     int.bit_length -> integer
- *
- *  Returns the number of bits of the value of <i>int</i>.
- *
- *  "the number of bits" means that
- *  the bit position of the highest bit which is different to the sign bit.
- *  (The bit position of the bit 2**n is n+1.)
- *  If there is no such bit (zero or minus one), zero is returned.
- *
- *  I.e. This method returns ceil(log2(int < 0 ? -int : int+1)).
- *
- *     (-2**10000-1).bit_length  #=> 10001
- *     (-2**10000).bit_length    #=> 10000
- *     (-2**10000+1).bit_length  #=> 10000
- *
- *     (-2**1000-1).bit_length   #=> 1001
- *     (-2**1000).bit_length     #=> 1000
- *     (-2**1000+1).bit_length   #=> 1000
- *
- *     (2**1000-1).bit_length    #=> 1000
- *     (2**1000).bit_length      #=> 1001
- *     (2**1000+1).bit_length    #=> 1001
- *
- *     (2**10000-1).bit_length   #=> 10000
- *     (2**10000).bit_length     #=> 10001
- *     (2**10000+1).bit_length   #=> 10001
- *
- *  This method can be used to detect overflow in Array#pack as follows.
- *
- *     if n.bit_length < 32
- *       [n].pack("l") # no overflow
- *     else
- *       raise "overflow"
- *     end
- */
+VALUE
+rb_big_size_m(VALUE big)
+{
+    return SIZET2NUM(rb_big_size(big));
+}
 
-static VALUE
+VALUE
 rb_big_bit_length(VALUE big)
 {
     int nlz_bits;
@@ -6942,36 +6970,275 @@ rb_big_bit_length(VALUE big)
             INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER);
 }
 
+VALUE
+rb_big_odd_p(VALUE num)
+{
+    return RBOOL(BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1);
+}
+
+VALUE
+rb_big_even_p(VALUE num)
+{
+    if (BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1) {
+        return Qfalse;
+    }
+    return Qtrue;
+}
+
+unsigned long rb_ulong_isqrt(unsigned long);
+#if SIZEOF_BDIGIT*2 > SIZEOF_LONG
+BDIGIT rb_bdigit_dbl_isqrt(BDIGIT_DBL);
+# ifdef ULL_TO_DOUBLE
+#   define BDIGIT_DBL_TO_DOUBLE(n) ULL_TO_DOUBLE(n)
+# endif
+#else
+# define rb_bdigit_dbl_isqrt(x) (BDIGIT)rb_ulong_isqrt(x)
+#endif
+#ifndef BDIGIT_DBL_TO_DOUBLE
+# define BDIGIT_DBL_TO_DOUBLE(n) (double)(n)
+#endif
+
+VALUE
+rb_big_isqrt(VALUE n)
+{
+    BDIGIT *nds = BDIGITS(n);
+    size_t len = BIGNUM_LEN(n);
+
+    if (len <= 2) {
+        BDIGIT sq = rb_bdigit_dbl_isqrt(bary2bdigitdbl(nds, len));
+#if SIZEOF_BDIGIT > SIZEOF_LONG
+        return ULL2NUM(sq);
+#else
+        return ULONG2NUM(sq);
+#endif
+    }
+    else {
+        size_t shift = FIX2LONG(rb_big_bit_length(n)) / 4;
+        VALUE n2 = rb_int_rshift(n, SIZET2NUM(2 * shift));
+        VALUE x = FIXNUM_P(n2) ? LONG2FIX(rb_ulong_isqrt(FIX2ULONG(n2))) : rb_big_isqrt(n2);
+        /* x = (x+n/x)/2 */
+        x = rb_int_plus(rb_int_lshift(x, SIZET2NUM(shift - 1)), rb_int_idiv(rb_int_rshift(n, SIZET2NUM(shift + 1)), x));
+        VALUE xx = rb_int_mul(x, x);
+        while (rb_int_gt(xx, n)) {
+            xx = rb_int_minus(xx, rb_int_minus(rb_int_plus(x, x), INT2FIX(1)));
+            x = rb_int_minus(x, INT2FIX(1));
+        }
+        return x;
+    }
+}
+
+#if USE_GMP
+static void
+bary_powm_gmp(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, const BDIGIT *mds, size_t mn)
+{
+    mpz_t z, x, y, m;
+    size_t count;
+    mpz_init(x);
+    mpz_init(y);
+    mpz_init(m);
+    mpz_init(z);
+    bdigits_to_mpz(x, xds, xn);
+    bdigits_to_mpz(y, yds, yn);
+    bdigits_to_mpz(m, mds, mn);
+    mpz_powm(z, x, y, m);
+    bdigits_from_mpz(z, zds, &count);
+    BDIGITS_ZERO(zds+count, zn-count);
+    mpz_clear(x);
+    mpz_clear(y);
+    mpz_clear(m);
+    mpz_clear(z);
+}
+#endif
+
+static VALUE
+int_pow_tmp3(VALUE x, VALUE y, VALUE m, int nega_flg)
+{
+#if USE_GMP
+    VALUE z;
+    size_t xn, yn, mn, zn;
+
+    if (FIXNUM_P(x)) {
+       x = rb_int2big(FIX2LONG(x));
+    }
+    if (FIXNUM_P(y)) {
+       y = rb_int2big(FIX2LONG(y));
+    }
+    RUBY_ASSERT(RB_BIGNUM_TYPE_P(m));
+    xn = BIGNUM_LEN(x);
+    yn = BIGNUM_LEN(y);
+    mn = BIGNUM_LEN(m);
+    zn = mn;
+    z = bignew(zn, 1);
+    bary_powm_gmp(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn, BDIGITS(m), mn);
+    if (nega_flg && BIGNUM_POSITIVE_P(z) && !BIGZEROP(z)) {
+        z = rb_big_minus(z, m);
+    }
+    RB_GC_GUARD(x);
+    RB_GC_GUARD(y);
+    RB_GC_GUARD(m);
+    return rb_big_norm(z);
+#else
+    VALUE tmp = LONG2FIX(1L);
+    long yy;
+
+    for (/*NOP*/; ! FIXNUM_P(y); y = rb_big_rshift(y, LONG2FIX(1L))) {
+        if (RTEST(rb_int_odd_p(y))) {
+            tmp = rb_int_mul(tmp, x);
+            tmp = rb_int_modulo(tmp, m);
+        }
+        x = rb_int_mul(x, x);
+        x = rb_int_modulo(x, m);
+    }
+    for (yy = FIX2LONG(y); yy; yy >>= 1L) {
+        if (yy & 1L) {
+            tmp = rb_int_mul(tmp, x);
+            tmp = rb_int_modulo(tmp, m);
+        }
+        x = rb_int_mul(x, x);
+        x = rb_int_modulo(x, m);
+    }
+
+    if (nega_flg && rb_int_positive_p(tmp) && !rb_int_zero_p(tmp)) {
+        tmp = rb_int_minus(tmp, m);
+    }
+    return tmp;
+#endif
+}
+
 /*
- *  call-seq:
- *     big.odd? -> true or false
- *
- *  Returns <code>true</code> if <i>big</i> is an odd number.
+ * Integer#pow
  */
 
 static VALUE
-rb_big_odd_p(VALUE num)
+int_pow_tmp1(VALUE x, VALUE y, long mm, int nega_flg)
 {
-    if (BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1) {
-	return Qtrue;
+    long xx = FIX2LONG(x);
+    long tmp = 1L;
+    long yy;
+
+    for (/*NOP*/; ! FIXNUM_P(y); y = rb_big_rshift(y, LONG2FIX(1L))) {
+        if (RTEST(rb_int_odd_p(y))) {
+            tmp = (tmp * xx) % mm;
+        }
+        xx = (xx * xx) % mm;
+    }
+    for (yy = FIX2LONG(y); yy; yy >>= 1L) {
+        if (yy & 1L) {
+            tmp = (tmp * xx) % mm;
+        }
+        xx = (xx * xx) % mm;
+    }
+
+    if (nega_flg && tmp) {
+        tmp -= mm;
+    }
+    return LONG2FIX(tmp);
+}
+
+static VALUE
+int_pow_tmp2(VALUE x, VALUE y, long mm, int nega_flg)
+{
+    long tmp = 1L;
+    long yy;
+#ifdef DLONG
+    const DLONG m = mm;
+    long tmp2 = tmp;
+    long xx = FIX2LONG(x);
+# define MUL_MODULO(a, b, c) (long)(((DLONG)(a) * (DLONG)(b)) % (c))
+#else
+    const VALUE m = LONG2FIX(mm);
+    VALUE tmp2 = LONG2FIX(tmp);
+    VALUE xx = x;
+# define MUL_MODULO(a, b, c) rb_int_modulo(rb_fix_mul_fix((a), (b)), (c))
+#endif
+
+    for (/*NOP*/; ! FIXNUM_P(y); y = rb_big_rshift(y, LONG2FIX(1L))) {
+        if (RTEST(rb_int_odd_p(y))) {
+            tmp2 = MUL_MODULO(tmp2, xx, m);
+        }
+        xx = MUL_MODULO(xx, xx, m);
+    }
+    for (yy = FIX2LONG(y); yy; yy >>= 1L) {
+        if (yy & 1L) {
+            tmp2 = MUL_MODULO(tmp2, xx, m);
+        }
+        xx = MUL_MODULO(xx, xx, m);
+    }
+
+#ifdef DLONG
+    tmp = tmp2;
+#else
+    tmp = FIX2LONG(tmp2);
+#endif
+    if (nega_flg && tmp) {
+        tmp -= mm;
     }
-    return Qfalse;
+    return LONG2FIX(tmp);
 }
 
 /*
- *  call-seq:
- *     big.even? -> true or false
+ * Document-method: Integer#pow
+ * call-seq:
+ *    integer.pow(numeric)           ->  numeric
+ *    integer.pow(integer, integer)  ->  integer
  *
- *  Returns <code>true</code> if <i>big</i> is an even number.
+ * Returns (modular) exponentiation as:
+ *
+ *   a.pow(b)     #=> same as a**b
+ *   a.pow(b, m)  #=> same as (a**b) % m, but avoids huge temporary values
  */
-
-static VALUE
-rb_big_even_p(VALUE num)
+VALUE
+rb_int_powm(int const argc, VALUE * const argv, VALUE const num)
 {
-    if (BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1) {
-	return Qfalse;
+    rb_check_arity(argc, 1, 2);
+
+    if (argc == 1) {
+        return rb_int_pow(num, argv[0]);
     }
-    return Qtrue;
+    else {
+        VALUE const a = num;
+        VALUE const b = argv[0];
+        VALUE m = argv[1];
+        int nega_flg = 0;
+        if ( ! RB_INTEGER_TYPE_P(b)) {
+            rb_raise(rb_eTypeError, "Integer#pow() 2nd argument not allowed unless a 1st argument is integer");
+        }
+        if (rb_int_negative_p(b)) {
+            rb_raise(rb_eRangeError, "Integer#pow() 1st argument cannot be negative when 2nd argument specified");
+        }
+        if (!RB_INTEGER_TYPE_P(m)) {
+            rb_raise(rb_eTypeError, "Integer#pow() 2nd argument not allowed unless all arguments are integers");
+        }
+
+        if (rb_int_zero_p(a) && !rb_int_zero_p(b)) {
+            /* shortcut; 0**x => 0 except for x == 0 */
+            return INT2FIX(0);
+        }
+
+        if (rb_int_negative_p(m)) {
+            m = rb_int_uminus(m);
+            nega_flg = 1;
+        }
+
+        if (FIXNUM_P(m)) {
+            long const half_val = (long)HALF_LONG_MSB;
+            long const mm = FIX2LONG(m);
+            if (!mm) rb_num_zerodiv();
+            if (mm == 1) return INT2FIX(0);
+            if (mm <= half_val) {
+                return int_pow_tmp1(rb_int_modulo(a, m), b, mm, nega_flg);
+            }
+            else {
+                return int_pow_tmp2(rb_int_modulo(a, m), b, mm, nega_flg);
+            }
+        }
+        else {
+            if (rb_bigzero_p(m)) rb_num_zerodiv();
+            if (bignorm(m) == INT2FIX(1)) return INT2FIX(0);
+            return int_pow_tmp3(rb_int_modulo(a, m), b, m, nega_flg);
+        }
+    }
+    UNREACHABLE_RETURN(Qnil);
 }
 
 /*
@@ -6995,51 +7262,11 @@ rb_big_even_p(VALUE num)
 void
 Init_Bignum(void)
 {
-    rb_cBignum = rb_define_class("Bignum", rb_cInteger);
-
-    rb_define_method(rb_cBignum, "to_s", rb_big_to_s, -1);
-    rb_define_alias(rb_cBignum, "inspect", "to_s");
-    rb_define_method(rb_cBignum, "coerce", rb_big_coerce, 1);
-    rb_define_method(rb_cBignum, "-@", rb_big_uminus, 0);
-    rb_define_method(rb_cBignum, "+", rb_big_plus, 1);
-    rb_define_method(rb_cBignum, "-", rb_big_minus, 1);
-    rb_define_method(rb_cBignum, "*", rb_big_mul, 1);
-    rb_define_method(rb_cBignum, "/", rb_big_div, 1);
-    rb_define_method(rb_cBignum, "%", rb_big_modulo, 1);
-    rb_define_method(rb_cBignum, "div", rb_big_idiv, 1);
-    rb_define_method(rb_cBignum, "divmod", rb_big_divmod, 1);
-    rb_define_method(rb_cBignum, "modulo", rb_big_modulo, 1);
-    rb_define_method(rb_cBignum, "remainder", rb_big_remainder, 1);
-    rb_define_method(rb_cBignum, "fdiv", rb_big_fdiv, 1);
-    rb_define_method(rb_cBignum, "**", rb_big_pow, 1);
-    rb_define_method(rb_cBignum, "&", rb_big_and, 1);
-    rb_define_method(rb_cBignum, "|", rb_big_or, 1);
-    rb_define_method(rb_cBignum, "^", rb_big_xor, 1);
-    rb_define_method(rb_cBignum, "~", rb_big_neg, 0);
-    rb_define_method(rb_cBignum, "<<", rb_big_lshift, 1);
-    rb_define_method(rb_cBignum, ">>", rb_big_rshift, 1);
-    rb_define_method(rb_cBignum, "[]", rb_big_aref, 1);
-
-    rb_define_method(rb_cBignum, "<=>", rb_big_cmp, 1);
-    rb_define_method(rb_cBignum, "==", rb_big_eq, 1);
-    rb_define_method(rb_cBignum, ">", big_gt, 1);
-    rb_define_method(rb_cBignum, ">=", big_ge, 1);
-    rb_define_method(rb_cBignum, "<", big_lt, 1);
-    rb_define_method(rb_cBignum, "<=", big_le, 1);
-    rb_define_method(rb_cBignum, "===", rb_big_eq, 1);
-    rb_define_method(rb_cBignum, "eql?", rb_big_eql, 1);
-    rb_define_method(rb_cBignum, "hash", rb_big_hash, 0);
-    rb_define_method(rb_cBignum, "to_f", rb_big_to_f, 0);
-    rb_define_method(rb_cBignum, "abs", rb_big_abs, 0);
-    rb_define_method(rb_cBignum, "magnitude", rb_big_abs, 0);
-    rb_define_method(rb_cBignum, "size", rb_big_size, 0);
-    rb_define_method(rb_cBignum, "bit_length", rb_big_bit_length, 0);
-    rb_define_method(rb_cBignum, "odd?", rb_big_odd_p, 0);
-    rb_define_method(rb_cBignum, "even?", rb_big_even_p, 0);
-
-#ifdef USE_GMP
+    rb_define_method(rb_cInteger, "coerce", rb_int_coerce, 1);
+
+#if USE_GMP
     /* The version of loaded GMP. */
-    rb_define_const(rb_cBignum, "GMP_VERSION", rb_sprintf("GMP %s", gmp_version));
+    rb_define_const(rb_cInteger, "GMP_VERSION", rb_sprintf("GMP %s", gmp_version));
 #endif
 
     power_cache_init();
diff --git a/bin/erb b/bin/erb
deleted file mode 100755
index 1ba49c9dc1..0000000000
--- a/bin/erb
+++ /dev/null
@@ -1,171 +0,0 @@
-#!/usr/bin/env ruby
-# Tiny eRuby --- ERB2
-# Copyright (c) 1999-2000,2002 Masatoshi SEKI
-# You can redistribute it and/or modify it under the same terms as Ruby.
-
-require 'erb'
-
-class ERB
-  module Main
-    def ARGV.switch
-      return nil if self.empty?
-      arg = self.shift
-      return nil if arg == '--'
-      case arg
-      when /\A-(.)(.*)/
-        if $1 == '-'
-          arg, @maybe_arg = arg.split(/=/, 2)
-          return arg
-        end
-        raise 'unknown switch "-"' if $2[0] == ?- and $1 != 'T'
-        if $2.size > 0
-          self.unshift "-#{$2}"
-          @maybe_arg = $2
-        else
-          @maybe_arg = nil
-        end
-        "-#{$1}"
-      when /\A(\w+)=/
-        arg
-      else
-        self.unshift arg
-        nil
-      end
-    end
-
-    def ARGV.req_arg
-      (@maybe_arg || self.shift || raise('missing argument')).tap {
-        @maybe_arg = nil
-      }
-    end
-
-    def trim_mode_opt(trim_mode, disable_percent)
-      return trim_mode if disable_percent
-      case trim_mode
-      when 0
-        return '%'
-      when 1
-        return '%>'
-      when 2
-        return '%<>'
-      when '-'
-        return '%-'
-      end
-    end
-    module_function :trim_mode_opt
-
-    def run(factory=ERB)
-      trim_mode = 0
-      disable_percent = false
-      variables = {}
-      begin
-        while switch = ARGV.switch
-          case switch
-          when '-x'                        # ruby source
-            output = true
-          when '-n'                        # line number
-            number = true
-          when '-v'                        # verbose
-            $VERBOSE = true
-          when '--version'                 # version
-            STDERR.puts factory.version
-            exit
-          when '-d', '--debug'             # debug
-            $DEBUG = true
-          when '-r'                        # require
-            require ARGV.req_arg
-          when '-S'                        # security level
-            arg = ARGV.req_arg
-            raise "invalid safe_level #{arg.dump}" unless arg =~ /\A[0-3]\z/
-            safe_level = arg.to_i
-          when '-T'                        # trim mode
-            arg = ARGV.req_arg
-            if arg == '-'
-              trim_mode = arg
-              next
-            end
-            raise "invalid trim mode #{arg.dump}" unless arg =~ /\A[0-2]\z/
-            trim_mode = arg.to_i
-          when '-E', '--encoding'
-            arg = ARGV.req_arg
-            set_encoding(*arg.split(/:/, 2))
-          when '-U'
-            set_encoding(Encoding::UTF_8, Encoding::UTF_8)
-          when '-P'
-            disable_percent = true
-          when '--help'
-            raise "print this help"
-          when /\A-/
-            raise "unknown switch #{switch.dump}"
-          else
-            var, val = *switch.split('=', 2)
-            (variables ||= {})[var] = val
-          end
-        end
-      rescue                               # usage
-        STDERR.puts $!.to_s
-        STDERR.puts File.basename($0) +
-          " [switches] [var=value...] [inputfile]"
-        STDERR.puts <<EOU
-  -x               print ruby script
-  -n               print ruby script with line number
-  -v               enable verbose mode
-  -d               set $DEBUG to true
-  -r library       load a library
-  -S safe_level    set $SAFE (0..3)
-  -E ex[:in]       set default external/internal encodings
-  -U               set default encoding to UTF-8.
-  -T trim_mode     specify trim_mode (0..2, -)
-  -P               ignore lines which start with "%"
-  var=value        set variable
-EOU
-        exit 1
-      end
-
-      $<.set_encoding(Encoding::ASCII_8BIT, nil)
-      src = $<.read
-      filename = $FILENAME
-      exit 2 unless src
-      trim = trim_mode_opt(trim_mode, disable_percent)
-      erb = factory.new(src.untaint, safe_level, trim)
-      erb.filename = filename
-      if output
-        if number
-          erb.src.each_line.with_index do |line, l|
-            puts "%3d %s"%[l+1, line]
-          end
-        else
-          puts erb.src
-        end
-      else
-        bind = TOPLEVEL_BINDING.taint
-        if variables
-          enc = erb.encoding
-          for var, val in variables do
-            val = val.encode(enc) if val
-            bind.local_variable_set(var, val)
-          end
-        end
-        erb.run(bind)
-      end
-    end
-    module_function :run
-
-    def set_encoding(extern, intern = nil)
-      verbose, $VERBOSE = $VERBOSE, nil
-      Encoding.default_external = extern unless extern.nil? || extern == ""
-      Encoding.default_internal = intern unless intern.nil? || intern == ""
-      [$stdin, $stdout, $stderr].each do |io|
-        io.set_encoding(extern, intern)
-      end
-    ensure
-      $VERBOSE = verbose
-    end
-    module_function :set_encoding
-    class << self; private :set_encoding; end
-  end
-end
-
-if __FILE__ == $0
-  ERB::Main.run
-end
diff --git a/bin/gem b/bin/gem
index a4ec754abb..3ac1d9e623 100755
--- a/bin/gem
+++ b/bin/gem
@@ -1,25 +1,12 @@
 #!/usr/bin/env ruby
+# frozen_string_literal: true
+
 #--
 # Copyright 2006 by Chad Fowler, Rich Kilmer, Jim Weirich and others.
 # All rights reserved.
 # See LICENSE.txt for permissions.
 #++
 
-require 'rubygems'
-require 'rubygems/gem_runner'
-require 'rubygems/exceptions'
-
-required_version = Gem::Requirement.new ">= 1.8.7"
-
-unless required_version.satisfied_by? Gem.ruby_version then
-  abort "Expected Ruby Version #{required_version}, is #{Gem.ruby_version}"
-end
-
-args = ARGV.clone
-
-begin
-  Gem::GemRunner.new.run args
-rescue Gem::SystemExitException => e
-  exit e.exit_code
-end
+require "rubygems/gem_runner"
 
+Gem::GemRunner.new.run ARGV.clone
diff --git a/bin/irb b/bin/irb
deleted file mode 100755
index c64ee85fbd..0000000000
--- a/bin/irb
+++ /dev/null
@@ -1,11 +0,0 @@
-#!/usr/bin/env ruby
-#
-#   irb.rb - interactive ruby
-#   	$Release Version: 0.9.6 $
-#   	$Revision$
-#   	by Keiju ISHITSUKA(keiju@ruby-lang.org)
-#
-
-require "irb"
-
-IRB.start(__FILE__)
diff --git a/bin/rdoc b/bin/rdoc
deleted file mode 100755
index aaa23292df..0000000000
--- a/bin/rdoc
+++ /dev/null
@@ -1,44 +0,0 @@
-#!/usr/bin/env ruby
-#
-#  RDoc: Documentation tool for source code
-#        (see lib/rdoc/rdoc.rb for more information)
-#
-#  Copyright (c) 2003 Dave Thomas
-#  Released under the same terms as Ruby
-
-begin
-  gem 'rdoc'
-rescue NameError => e # --disable-gems
-  raise unless e.name == :gem
-rescue Gem::LoadError
-end
-
-require 'rdoc/rdoc'
-
-begin
-  r = RDoc::RDoc.new
-  r.document ARGV
-rescue Errno::ENOSPC
-  $stderr.puts 'Ran out of space creating documentation'
-  $stderr.puts
-  $stderr.puts 'Please free up some space and try again'
-rescue SystemExit
-  raise
-rescue Exception => e
-  if $DEBUG_RDOC then
-    $stderr.puts e.message
-    $stderr.puts "#{e.backtrace.join "\n\t"}"
-    $stderr.puts
-  elsif Interrupt === e then
-    $stderr.puts
-    $stderr.puts 'Interrupted'
-  else
-    $stderr.puts "uh-oh! RDoc had a problem:"
-    $stderr.puts e.message
-    $stderr.puts
-    $stderr.puts "run with --debug for full backtrace"
-  end
-
-  exit 1
-end
-
diff --git a/bin/ri b/bin/ri
deleted file mode 100755
index 7fbed0c099..0000000000
--- a/bin/ri
+++ /dev/null
@@ -1,12 +0,0 @@
-#!/usr/bin/env ruby
-
-begin
-  gem 'rdoc'
-rescue NameError => e # --disable-gems
-  raise unless e.name == :gem
-rescue Gem::LoadError
-end
-
-require 'rdoc/ri/driver'
-
-RDoc::RI::Driver.run ARGV
diff --git a/bootstraptest/pending.rb b/bootstraptest/pending.rb
index 744c0adac1..2c4b85a419 100644
--- a/bootstraptest/pending.rb
+++ b/bootstraptest/pending.rb
@@ -1,19 +1,3 @@
-assert_equal 'A', %q{
-  class A
-    @@a = 'A'
-    def a=(x)
-      @@a = x
-    end
-    def a
-      @@a
-    end
-  end
-
-  B = A.dup
-  B.new.a = 'B'
-  A.new.a
-}, '[ruby-core:17019]'
-
 assert_equal 'ok', %q{
   def m
     lambda{
@@ -31,9 +15,7 @@ assert_equal 'ok', %q{
   end
 }
 
-assert_normal_exit %q{
-  r = Range.allocate
-  def r.<=>(o) true end
-  r.instance_eval { initialize r, r }
-  r.inspect
+# This randomly fails on mswin.
+assert_equal %q{[]}, %q{
+  Thread.new{sleep}.backtrace
 }
diff --git a/bootstraptest/runner.rb b/bootstraptest/runner.rb
index d58b824386..04de0c93b9 100755
--- a/bootstraptest/runner.rb
+++ b/bootstraptest/runner.rb
@@ -1,4 +1,4 @@
-"exec" "${RUBY-ruby}" "-x" "$0" "$@" || true # -*- mode: ruby; coding: utf-8 -*-
+"exec" "${RUBY-ruby}" "-x" "$0" "$@" || true # -*- Ruby -*-
 #!./ruby
 # $Id$
 
@@ -7,6 +7,8 @@
 # Never use test/unit in this file.
 # Never use Ruby extensions in this file.
 
+$start_time = Time.now
+
 begin
   require 'fileutils'
   require 'tmpdir'
@@ -14,6 +16,7 @@ rescue LoadError
   $:.unshift File.join(File.dirname(__FILE__), '../lib')
   retry
 end
+require_relative '../tool/lib/test/jobserver'
 
 if !Dir.respond_to?(:mktmpdir)
   # copied from lib/tmpdir.rb
@@ -57,23 +60,99 @@ if !Dir.respond_to?(:mktmpdir)
   end
 end
 
+# Configuration
+bt = Struct.new(:ruby,
+                :verbose,
+                :color,
+                :tty,
+                :quiet,
+                :wn,
+                :progress,
+                :progress_bs,
+                :passed,
+                :failed,
+                :reset,
+                :columns,
+                :window_width,
+                :width,
+                :indent,
+                :platform,
+                :timeout,
+                :timeout_scale,
+                :launchable_test_reports
+                )
+BT = Class.new(bt) do
+  def indent=(n)
+    super
+    if (self.columns ||= 0) < n
+      $stderr.print(' ' * (n - self.columns))
+    end
+    self.columns = indent
+  end
+
+  def putc(c)
+    unless self.quiet
+      if self.window_width == nil
+        unless w = ENV["COLUMNS"] and (w = w.to_i) > 0
+          w = 80
+        end
+        w -= 1
+        self.window_width = w
+      end
+      if self.window_width and self.columns >= self.window_width
+        $stderr.print "\n", " " * (self.indent ||= 0)
+        self.columns = indent
+      end
+      $stderr.print c
+      $stderr.flush
+      self.columns += 1
+    end
+  end
+
+  def wn=(wn)
+    unless wn == 1
+      wn = Test::JobServer.max_jobs(wn > 0 ? wn : 1024, ENV.delete("MAKEFLAGS")) || wn
+      if wn <= 0
+        require 'etc'
+        wn = [Etc.nprocessors / 2, 1].max
+      end
+    end
+    super wn
+  end
+
+  def apply_timeout_scale(timeout)
+    timeout&.*(timeout_scale)
+  end
+end.new
+
+BT_STATE = Struct.new(:count, :error).new
+
 def main
-  @ruby = File.expand_path('miniruby')
-  @verbose = false
+  BT.ruby = File.expand_path('miniruby')
+  BT.verbose = false
+  $VERBOSE = false
   $stress = false
-  @color = nil
-  @tty = nil
-  @quiet = false
+  BT.color = nil
+  BT.tty = nil
+  BT.quiet = false
+  BT.timeout = 180
+  BT.timeout_scale = 1
+  if (ts = (ENV["RUBY_TEST_TIMEOUT_SCALE"] || ENV["RUBY_TEST_SUBPROCESS_TIMEOUT_SCALE"]).to_i) > 1
+    BT.timeout_scale *= ts
+  end
+
+  # BT.wn = 1
   dir = nil
   quiet = false
   tests = nil
   ARGV.delete_if {|arg|
     case arg
     when /\A--ruby=(.*)/
-      @ruby = $1
-      @ruby.gsub!(/^([^ ]*)/){File.expand_path($1)}
-      @ruby.gsub!(/(\s+-I\s*)((?!(?:\.\/)*-(?:\s|\z))\S+)/){$1+File.expand_path($2)}
-      @ruby.gsub!(/(\s+-r\s*)(\.\.?\/\S+)/){$1+File.expand_path($2)}
+      ruby = $1
+      ruby.gsub!(/^([^ ]*)/){File.expand_path($1)}
+      ruby.gsub!(/(\s+-I\s*)((?!(?:\.\/)*-(?:\s|\z))\S+)/){$1+File.expand_path($2)}
+      ruby.gsub!(/(\s+-r\s*)(\.\.?\/\S+)/){$1+File.expand_path($2)}
+      BT.ruby = ruby
       true
     when /\A--sets=(.*)/
       tests = Dir.glob("#{File.dirname($0)}/test_{#{$1}}*.rb").sort
@@ -86,18 +165,27 @@ def main
       $stress = true
     when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
       warn "unknown --color argument: #$3" if $3
-      @color = $1 ? nil : !$2
+      BT.color = color = $1 ? nil : !$2
       true
     when /\A--tty(=(?:yes|(no)|(.*)))?\z/
       warn "unknown --tty argument: #$3" if $3
-      @tty = !$1 || !$2
+      BT.tty = !$1 || !$2
       true
-    when /\A(-q|--q(uiet))\z/
+    when /\A(-q|--q(uiet)?)\z/
       quiet = true
-      @quiet = true
+      BT.quiet = true
+      true
+    when /\A-j(\d+)?/
+      BT.wn = $1.to_i
+      true
+    when /\A--timeout=(\d+(?:_\d+)*(?:\.\d+(?:_\d+)*)?)(?::(\d+(?:_\d+)*(?:\.\d+(?:_\d+)*)?))?/
+      BT.timeout = $1.to_f
+      BT.timeout_scale = $2.to_f if defined?($2)
+      true
+    when /\A(-v|--v(erbose)?)\z/
+      BT.verbose = true
+      BT.quiet = false
       true
-    when /\A(-v|--v(erbose))\z/
-      @verbose = true
     when /\A(-h|--h(elp)?)\z/
       puts(<<-End)
 Usage: #{File.basename($0, '.*')} --ruby=PATH [--sets=NAME,NAME,...]
@@ -106,6 +194,7 @@ Usage: #{File.basename($0, '.*')} --ruby=PATH [--sets=NAME,NAME,...]
                                     default: /tmp/bootstraptestXXXXX.tmpwd
         --color[=WHEN]              Colorize the output.  WHEN defaults to 'always'
                                     or can be 'never' or 'auto'.
+        --timeout=TIMEOUT           Default timeout in seconds.
     -s, --stress                    stress test.
     -v, --verbose                   Output test name before exec.
     -q, --quiet                     Don\'t print header message.
@@ -114,218 +203,514 @@ End
       exit true
     when /\A-j/
       true
+    when /--launchable-test-reports=(.*)/
+      if File.exist?($1)
+        # To protect files from overwritten, do nothing when the file exists.
+        return true
+      end
+
+      begin
+        require_relative '../tool/lib/launchable'
+      rescue LoadError
+        # The following error sometimes happens, so we're going to skip writing Launchable report files in this case.
+        #
+        # ```
+        # /tmp/tmp.bISss9CtXZ/.ext/common/json/ext.rb:15:in 'Kernel#require':
+        #   /tmp/tmp.bISss9CtXZ/.ext/x86_64-linux/json/ext/parser.so:
+        #     undefined symbol: ruby_abi_version - ruby_abi_version (LoadError)
+        # ```
+        #
+        return true
+      end
+      BT.launchable_test_reports = writer = Launchable::JsonStreamWriter.new($1)
+      writer.write_array('testCases')
+      at_exit {
+        writer.close
+      }
+      true
     else
       false
     end
   }
   if tests and not ARGV.empty?
-    $stderr.puts "--tests and arguments are exclusive"
-    exit false
+    abort "--sets and arguments are exclusive"
   end
   tests ||= ARGV
   tests = Dir.glob("#{File.dirname($0)}/test_*.rb").sort if tests.empty?
-  pathes = tests.map {|path| File.expand_path(path) }
+  paths = tests.map {|path| File.expand_path(path) }
 
-  @progress = %w[- \\ | /]
-  @progress_bs = "\b" * @progress[0].size
-  @tty = $stderr.tty? if @tty.nil?
-  case @color
+  BT.progress = %w[- \\ | /]
+  BT.progress_bs = "\b" * BT.progress[0].size
+  BT.tty = $stderr.tty? if BT.tty.nil?
+  BT.wn ||= /-j(\d+)?/ =~ (ENV["MAKEFLAGS"] || ENV["MFLAGS"]) ? $1.to_i : 1
+
+  case BT.color
   when nil
-    @color = @tty && /dumb/ !~ ENV["TERM"]
+    BT.color = BT.tty && /dumb/ !~ ENV["TERM"]
   end
-  @tty &&= !@verbose
-  if @color
+  BT.tty &&= !BT.verbose
+  if BT.color
     # dircolors-like style
-    colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:]*)/)] : {}
-    @passed = "\e[#{colors["pass"] || "32"}m"
-    @failed = "\e[#{colors["fail"] || "31"}m"
-    @reset = "\e[m"
+    colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
+    begin
+      File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
+        colors[n] ||= c
+      end
+    rescue
+    end
+    BT.passed = "\e[;#{colors["pass"] || "32"}m"
+    BT.failed = "\e[;#{colors["fail"] || "31"}m"
+    BT.reset = "\e[m"
   else
-    @passed = @failed = @reset = ""
+    BT.passed = BT.failed = BT.reset = ""
   end
+  target_version = `#{BT.ruby} -v`.chomp
+  BT.platform = target_version[/\[(.*)\]\z/, 1]
   unless quiet
-    puts Time.now
+    puts $start_time
     if defined?(RUBY_DESCRIPTION)
       puts "Driver is #{RUBY_DESCRIPTION}"
     elsif defined?(RUBY_PATCHLEVEL)
-      puts "Driver is ruby #{RUBY_VERSION} (#{RUBY_RELEASE_DATE}#{RUBY_PLATFORM}) [#{RUBY_PLATFORM}]"
+      puts "Driver is ruby #{RUBY_VERSION} (#{RUBY_RELEASE_DATE}#{RUBY_PATCHLEVEL}) [#{RUBY_PLATFORM}]"
     else
       puts "Driver is ruby #{RUBY_VERSION} (#{RUBY_RELEASE_DATE}) [#{RUBY_PLATFORM}]"
     end
-    puts "Target is #{`#{@ruby} -v`.chomp}"
+    puts "Target is #{target_version}"
     puts
     $stdout.flush
   end
 
-  in_temporary_working_directory(dir) {
-    exec_test pathes
-  }
+  in_temporary_working_directory(dir) do
+    exec_test paths
+  end
 end
 
 def erase(e = true)
-  if e and @columns > 0 and !@verbose
-    "\r#{" "*@columns}\r"
+  if e and BT.columns > 0 and BT.tty and !BT.verbose
+    "\e[1K\r"
   else
     ""
   end
 end
 
-def exec_test(pathes)
-  @count = 0
-  @error = 0
-  @errbuf = []
-  @location = nil
-  @columns = 0
-  @width = pathes.map {|path| File.basename(path).size}.max + 2
-  pathes.each do |path|
-    @basename = File.basename(path)
-    $stderr.printf("%s%-*s ", erase(@quiet), @width, @basename)
-    $stderr.flush
-    @columns = @width + 1
-    $stderr.puts if @verbose
-    count = @count
-    error = @error
+def load_test paths
+  paths.each do |path|
     load File.expand_path(path)
-    if @tty
-      if @error == error
-        msg = "PASS #{@count-count}"
-        @columns += msg.size - 1
-        $stderr.print "#{@progress_bs}#{@passed}#{msg}#{@reset}"
-      else
-        msg = "FAIL #{@error-error}/#{@count-count}"
-        $stderr.print "#{@progress_bs}#{@failed}#{msg}#{@reset}"
-        @columns = 0
+  end
+end
+
+def concurrent_exec_test
+  aq = Queue.new
+  rq = Queue.new
+
+  ts = BT.wn.times.map do
+    Thread.new do
+      while as = aq.pop
+        as.call
+        rq << as
       end
+    ensure
+      rq << nil
     end
-    $stderr.puts unless @quiet and @tty and @error == error
   end
-  $stderr.print(erase) if @quiet
-  if @error == 0
-    if @count == 0
-      $stderr.puts "No tests, no problem"
-    else
-      $stderr.puts "#{@passed}PASS#{@reset} all #{@count} tests"
+
+  Assertion.all.to_a.shuffle.each do |path, assertions|
+    assertions.each do |as|
+      aq << as
     end
-    exit true
-  else
-    @errbuf.each do |msg|
-      $stderr.puts msg
+  end
+
+  BT.indent = 1
+  aq.close
+  i = 1
+  term_wn = 0
+  begin
+    while BT.wn != term_wn
+      if r = rq.pop
+        BT_STATE.count += 1
+        case
+        when BT.quiet
+        when BT.tty
+          $stderr.print "#{BT.progress_bs}#{BT.progress[(i+=1) % BT.progress.size]}"
+        else
+          BT.putc '.'
+        end
+      else
+        term_wn += 1
+      end
     end
-    $stderr.puts "#{@failed}FAIL#{@reset} #{@error}/#{@count} tests failed"
-    exit false
+  ensure
+    ts.each(&:kill)
+    ts.each(&:join)
   end
 end
 
-def show_progress(message = '')
-  if @verbose
-    $stderr.print "\##{@count} #{@location} "
-  elsif @tty
-    $stderr.print "#{@progress_bs}#{@progress[@count % @progress.size]}"
-  end
-  t = Time.now if @verbose
-  faildesc, errout = with_stderr {yield}
-  t = Time.now - t if @verbose
-  if !faildesc
-    if @tty
-      $stderr.print "#{@progress_bs}#{@progress[@count % @progress.size]}"
-    elsif @verbose
-      $stderr.printf(". %.3f\n", t)
-    else
-      $stderr.print '.'
+##
+# Module for writing a test file for uploading test results into Launchable.
+# In bootstraptest, we aggregate the test results based on file level.
+module Launchable
+  @@last_test_name = nil
+  @@failure_log = ''
+  @@duration = 0
+
+  def show_progress(message = '')
+    faildesc, t = super
+
+    if writer = BT.launchable_test_reports
+      if faildesc
+        @@failure_log += faildesc
+      end
+      repo_path = File.expand_path("#{__dir__}/../")
+      relative_path = File.join(__dir__, self.path).delete_prefix("#{repo_path}/")
+      if @@last_test_name != nil && @@last_test_name != relative_path
+        # The test path is a URL-encoded representation.
+        # https://github.com/launchableinc/cli/blob/v1.81.0/launchable/testpath.py#L18
+        test_path = "#{encode_test_path_component("file")}=#{encode_test_path_component(@@last_test_name)}"
+        if @@failure_log.size > 0
+          status = 'TEST_FAILED'
+        else
+          status = 'TEST_PASSED'
+        end
+        writer.write_object(
+          {
+            testPath: test_path,
+            status: status,
+            duration: t,
+            createdAt: Time.now.to_s,
+            stderr: @@failure_log,
+            stdout: nil,
+            data: {
+              lineNumber: self.lineno
+            }
+          }
+        )
+        @@duration = 0
+        @@failure_log = ''
+      end
+      @@last_test_name = relative_path
+      @@duration += t
     end
+  end
+
+  private
+  def encode_test_path_component component
+    component.to_s.gsub('%', '%25').gsub('=', '%3D').gsub('#', '%23').gsub('&', '%26')
+  end
+end
+
+def exec_test(paths)
+  # setup
+  load_test paths
+  BT_STATE.count = 0
+  BT_STATE.error = 0
+  BT.columns = 0
+  BT.width = paths.map {|path| File.basename(path).size}.max + 2
+
+  # execute tests
+  if BT.wn > 1
+    concurrent_exec_test
   else
-    $stderr.print "#{@failed}F"
-    $stderr.printf(" %.3f", t) if @verbose
-    $stderr.print "#{@reset}"
-    $stderr.puts if @verbose
-    error faildesc, message
-    unless errout.empty?
-      $stderr.print "#{@failed}stderr output is not empty#{@reset}\n", adjust_indent(errout)
+    prev_basename = nil
+    Assertion.all.each do |basename, assertions|
+      if !BT.quiet && basename != prev_basename
+        prev_basename = basename
+        $stderr.printf("%s%-*s ", erase(BT.quiet), BT.width, basename)
+        $stderr.flush
+      end
+      BT.columns = BT.width + 1
+      $stderr.puts if BT.verbose
+      count = BT_STATE.count
+      error = BT_STATE.error
+
+      assertions.each do |assertion|
+        BT_STATE.count += 1
+        assertion.call
+      end
+
+      if BT.tty
+        if BT_STATE.error == error
+          msg = "PASS #{BT_STATE.count-count}"
+          BT.columns += msg.size - 1
+          $stderr.print "#{BT.progress_bs}#{BT.passed}#{msg}#{BT.reset}" unless BT.quiet
+        else
+          msg = "FAIL #{BT_STATE.error-error}/#{BT_STATE.count-count}"
+          $stderr.print "#{BT.progress_bs}#{BT.failed}#{msg}#{BT.reset}"
+          BT.columns = 0
+        end
+      end
+      $stderr.puts if !BT.quiet and (BT.tty or BT_STATE.error == error)
     end
-    if @tty and !@verbose
-      $stderr.printf("%-*s%s", @width, @basename, @progress[@count % @progress.size])
+  end
+
+  # show results
+  unless BT.quiet
+    $stderr.puts(erase)
+
+    sec = Time.now - $start_time
+    $stderr.puts "Finished in #{'%.2f' % sec} sec\n\n" if Assertion.count > 0
+  end
+
+  Assertion.errbuf.each do |msg|
+    $stderr.puts msg
+  end
+
+  out = BT.quiet ? $stdout : $stderr
+
+  if BT_STATE.error == 0
+    if Assertion.count == 0
+      out.puts "No tests, no problem" unless BT.quiet
+    else
+      out.puts "#{BT.passed}PASS#{BT.reset} all #{Assertion.count} tests"
     end
+    true
+  else
+    $stderr.puts "#{BT.failed}FAIL#{BT.reset} #{BT_STATE.error}/#{BT_STATE.count} tests failed"
+    false
   end
-rescue Interrupt
-  raise Interrupt
-rescue Exception => err
-  $stderr.print 'E'
-  $stderr.puts if @verbose
-  error err.message, message
 end
 
-# NativeClient is special.  The binary is cross-compiled.  But runs on the build environment.
-# So RUBY_PLATFORM in this process is not useful to detect it.
-def nacl?
-  @ruby and File.basename(@ruby.split(/\s/).first)['sel_ldr']
+def target_platform
+  BT.platform or RUBY_PLATFORM
 end
 
-def assert_check(testsrc, message = '', opt = '')
-  show_progress(message) {
-    result = get_result_string(testsrc, opt)
-    check_coredump
-    yield(result)
-  }
-end
+class Assertion < Struct.new(:src, :path, :lineno, :proc)
+  prepend Launchable
+  @count = 0
+  @all = Hash.new{|h, k| h[k] = []}
+  @errbuf = []
+
+  class << self
+    attr_reader :count, :errbuf
 
-def assert_equal(expected, testsrc, message = '')
-  newtest
-  assert_check(testsrc, message) {|result|
-    if expected == result
-      nil
+    def all
+      @all
+    end
+
+    def add as
+      @all[as.path] << as
+      as.id = (@count += 1)
+    end
+  end
+
+  attr_accessor :id
+  attr_reader :err, :category
+
+  def initialize(*args)
+    super
+    self.class.add self
+    @category = self.path[/\Atest_(.+)\.rb\z/, 1]
+  end
+
+  def call
+    self.proc.call self
+  end
+
+  def assert_check(message = '', opt = '', **argh)
+    show_progress(message) {
+      result = get_result_string(opt, **argh)
+      yield(result)
+    }
+  end
+
+  def with_stderr
+    out = err = nil
+    r, w = IO.pipe
+    @err = w
+    err_reader = Thread.new{ r.read }
+
+    begin
+      out = yield
+    ensure
+      w.close
+      err = err_reader.value
+      r.close rescue nil
+    end
+
+    return out, err
+  end
+
+  def show_error(msg, additional_message)
+    msg = "#{BT.failed}\##{self.id} #{self.path}:#{self.lineno}#{BT.reset}: #{msg}  #{additional_message}"
+    if BT.tty
+      $stderr.puts "#{erase}#{msg}"
     else
-      desc = "#{result.inspect} (expected #{expected.inspect})"
-      pretty(testsrc, desc, result)
+      Assertion.errbuf << msg
+    end
+    BT_STATE.error += 1
+  end
+
+
+  def show_progress(message = '')
+    if BT.quiet || BT.wn > 1
+      # do nothing
+    elsif BT.verbose
+      $stderr.print "\##{@id} #{self.path}:#{self.lineno} "
+    elsif BT.tty
+      $stderr.print "#{BT.progress_bs}#{BT.progress[BT_STATE.count % BT.progress.size]}"
     end
-  }
-end
 
-def assert_match(expected_pattern, testsrc, message = '')
-  newtest
-  assert_check(testsrc, message) {|result|
-    if expected_pattern =~ result
-      nil
+    t = Time.now if BT.verbose || BT.launchable_test_reports
+    faildesc, errout = with_stderr {yield}
+    t = Time.now - t if BT.verbose || BT.launchable_test_reports
+
+    if !faildesc
+      # success
+      if BT.quiet || BT.wn > 1
+        # do nothing
+      elsif BT.tty
+        $stderr.print "#{BT.progress_bs}#{BT.progress[BT_STATE.count % BT.progress.size]}"
+      elsif BT.verbose
+        $stderr.printf(". %.3f\n", t)
+      else
+        BT.putc '.'
+      end
     else
-      desc = "#{expected_pattern.inspect} expected to be =~\n#{result.inspect}"
-      pretty(testsrc, desc, result)
+      $stderr.print "#{BT.failed}F"
+      $stderr.printf(" %.3f", t) if BT.verbose
+      $stderr.print BT.reset
+      $stderr.puts if BT.verbose
+      show_error faildesc, message
+      unless errout.empty?
+        $stderr.print "#{BT.failed}stderr output is not empty#{BT.reset}\n", adjust_indent(errout)
+      end
+
+      if BT.tty and !BT.verbose and BT.wn == 1
+        $stderr.printf("%-*s%s", BT.width, path, BT.progress[BT_STATE.count % BT.progress.size])
+      end
     end
-  }
-end
 
-def assert_not_match(unexpected_pattern, testsrc, message = '')
-  newtest
-  assert_check(testsrc, message) {|result|
-    if unexpected_pattern !~ result
-      nil
+    [faildesc, t]
+  rescue Interrupt
+    $stderr.puts "\##{@id} #{path}:#{lineno}"
+    raise
+  rescue Exception => err
+    $stderr.print 'E'
+    $stderr.puts if BT.verbose
+    show_error err.message, message
+  ensure
+    begin
+      check_coredump
+    rescue CoreDumpError => err
+      $stderr.print 'E'
+      $stderr.puts if BT.verbose
+      show_error err.message, message
+      cleanup_coredump
+    end
+  end
+
+  class Timeout < StandardError; end
+
+  def get_result_string(opt = '', timeout: BT.timeout, **argh)
+    if BT.ruby
+      timeout = BT.apply_timeout_scale(timeout)
+      filename = make_srcfile(**argh)
+      begin
+        kw = self.err ? {err: self.err} : {}
+        out = IO.popen("#{BT.ruby} -W0 #{opt} #{filename}", **kw)
+        pid = out.pid
+        th = Thread.new {out.read.tap {Process.waitpid(pid); out.close}}
+        if th.join(timeout)
+          th.value
+        else
+          Timeout.new("timed out after #{timeout} seconds")
+        end
+      ensure
+        raise Interrupt if $? and $?.signaled? && $?.termsig == Signal.list["INT"]
+
+        begin
+          Process.kill :KILL, pid
+        rescue Errno::ESRCH
+          # OK
+        end
+      end
     else
-      desc = "#{unexpected_pattern.inspect} expected to be !~\n#{result.inspect}"
-      pretty(testsrc, desc, result)
+      eval(src).to_s
     end
-  }
+  end
+
+  def make_srcfile(frozen_string_literal: nil)
+    filename = "bootstraptest.#{self.path}_#{self.lineno}_#{self.id}.rb"
+    File.open(filename, 'w') {|f|
+      f.puts "#frozen_string_literal:#{frozen_string_literal}" unless frozen_string_literal.nil?
+      if $stress
+        f.puts "GC.stress = true" if $stress
+      else
+        f.puts ""
+      end
+      f.puts "class BT_Skip < Exception; end; def skip(msg) = raise(BT_Skip, msg.to_s)"
+      f.puts "print(begin; #{self.src}; rescue BT_Skip; $!.message; end)"
+    }
+    filename
+  end
+end
+
+def add_assertion src, pr
+  loc = caller_locations(2, 1).first
+  lineno = loc.lineno
+  path = File.basename(loc.path)
+
+  Assertion.new(src, path, lineno, pr)
+end
+
+def assert_equal(expected, testsrc, message = '', opt = '', **kwargs)
+  add_assertion testsrc, -> as do
+    as.assert_check(message, opt, **kwargs) {|result|
+      if expected == result
+        nil
+      else
+        desc = "#{result.inspect} (expected #{expected.inspect})"
+        pretty(testsrc, desc, result)
+      end
+    }
+  end
+end
+
+def assert_match(expected_pattern, testsrc, message = '', **argh)
+  add_assertion testsrc, -> as do
+    as.assert_check(message, **argh) {|result|
+      if expected_pattern =~ result
+        nil
+      else
+        desc = "#{expected_pattern.inspect} expected to be =~\n#{result.inspect}"
+        pretty(testsrc, desc, result)
+      end
+    }
+  end
+end
+
+def assert_not_match(unexpected_pattern, testsrc, message = '')
+  add_assertion testsrc, -> as do
+    as.assert_check(message) {|result|
+      if unexpected_pattern !~ result
+        nil
+      else
+        desc = "#{unexpected_pattern.inspect} expected to be !~\n#{result.inspect}"
+        pretty(testsrc, desc, result)
+      end
+    }
+  end
 end
 
 def assert_valid_syntax(testsrc, message = '')
-  newtest
-  assert_check(testsrc, message, '-c') {|result|
-    result if /Syntax OK/ !~ result
-  }
+  add_assertion testsrc, -> as do
+    as.assert_check(message, '-c') {|result|
+      result if /Syntax OK/ !~ result
+    }
+  end
 end
 
-def assert_normal_exit(testsrc, *rest)
-  newtest
-  opt = {}
-  opt = rest.pop if Hash === rest.last
-  message, ignore_signals = rest
-  message ||= ''
-  timeout = opt[:timeout]
-  show_progress(message) {
-    faildesc = nil
-    filename = make_srcfile(testsrc)
-    old_stderr = $stderr.dup
-    timeout_signaled = false
-    begin
-      $stderr.reopen("assert_normal_exit.log", "w")
-      io = IO.popen("#{@ruby} -W0 #{filename}")
+def assert_normal_exit(testsrc, *rest, timeout: BT.timeout, **opt)
+  add_assertion testsrc, -> as do
+    timeout = BT.apply_timeout_scale(timeout)
+    message, ignore_signals = rest
+    message ||= ''
+    as.show_progress(message) {
+      faildesc = nil
+      filename = as.make_srcfile
+      timeout_signaled = false
+      logfile = "assert_normal_exit.#{as.path}.#{as.lineno}.log"
+
+      io = IO.popen("#{BT.ruby} -W0 #{filename}", err: logfile)
       pid = io.pid
       th = Thread.new {
         io.read
@@ -337,68 +722,93 @@ def assert_normal_exit(testsrc, *rest)
         timeout_signaled = true
       end
       status = th.value
-    ensure
-      $stderr.reopen(old_stderr)
-      old_stderr.close
-    end
-    if status && status.signaled?
-      signo = status.termsig
-      signame = Signal.list.invert[signo]
-      unless ignore_signals and ignore_signals.include?(signame)
-        sigdesc = "signal #{signo}"
-        if signame
-          sigdesc = "SIG#{signame} (#{sigdesc})"
-        end
-        if timeout_signaled
-          sigdesc << " (timeout)"
-        end
-        faildesc = pretty(testsrc, "killed by #{sigdesc}", nil)
-        stderr_log = File.read("assert_normal_exit.log")
-        if !stderr_log.empty?
-          faildesc << "\n" if /\n\z/ !~ faildesc
-          stderr_log << "\n" if /\n\z/ !~ stderr_log
-          stderr_log.gsub!(/^.*\n/) { '| ' + $& }
-          faildesc << stderr_log
+
+      if status && status.signaled?
+        signo = status.termsig
+        signame = Signal.list.invert[signo]
+        unless ignore_signals and ignore_signals.include?(signame)
+          sigdesc = "signal #{signo}"
+          if signame
+            sigdesc = "SIG#{signame} (#{sigdesc})"
+          end
+          if timeout_signaled
+            sigdesc << " (timeout)"
+          end
+          faildesc = pretty(testsrc, "killed by #{sigdesc}", nil)
+          stderr_log = File.read(logfile)
+          if !stderr_log.empty?
+            faildesc << "\n" if /\n\z/ !~ faildesc
+            stderr_log << "\n" if /\n\z/ !~ stderr_log
+            stderr_log.gsub!(/^.*\n/) { '| ' + $& }
+            faildesc << stderr_log
+          end
         end
       end
-    end
-    faildesc
-  }
+      faildesc
+    }
+  end
 end
 
 def assert_finish(timeout_seconds, testsrc, message = '')
-  newtest
-  show_progress(message) {
-    faildesc = nil
-    filename = make_srcfile(testsrc)
-    io = IO.popen("#{@ruby} -W0 #{filename}")
-    pid = io.pid
-    waited = false
-    tlimit = Time.now + timeout_seconds
-    while Time.now < tlimit
-      if Process.waitpid pid, Process::WNOHANG
-        waited = true
-        break
+  add_assertion testsrc, -> as do
+    timeout_seconds = BT.apply_timeout_scale(timeout_seconds)
+
+    as.show_progress(message) {
+      faildesc = nil
+      filename = as.make_srcfile
+      io = IO.popen("#{BT.ruby} -W0 #{filename}", err: as.err)
+      pid = io.pid
+      waited = false
+      tlimit = Time.now + timeout_seconds
+      diff = timeout_seconds
+      while diff > 0
+        if Process.waitpid pid, Process::WNOHANG
+          waited = true
+          break
+        end
+        if io.respond_to?(:read_nonblock)
+          if IO.select([io], nil, nil, diff)
+            begin
+              io.read_nonblock(1024)
+            rescue Errno::EAGAIN, IO::WaitReadable, EOFError
+              break
+            end while true
+          end
+        else
+          sleep 0.1
+        end
+        diff = tlimit - Time.now
       end
-      sleep 0.1
-    end
-    if !waited
-      Process.kill(:KILL, pid)
-      Process.waitpid pid
-      faildesc = pretty(testsrc, "not finished in #{timeout_seconds} seconds", nil)
-    end
-    io.close
-    faildesc
-  }
+      if !waited
+        Process.kill(:KILL, pid)
+        Process.waitpid pid
+        faildesc = pretty(testsrc, "not finished in #{timeout_seconds} seconds", nil)
+      end
+      io.close
+      faildesc
+    }
+  end
 end
 
 def flunk(message = '')
-  newtest
-  show_progress('') { message }
+  add_assertion '', -> as do
+    as.show_progress('') { message }
+  end
+end
+
+def show_limit(testsrc, opt = '', **argh)
+  return if BT.quiet
+
+  add_assertion testsrc, -> as do
+    result = as.get_result_string(opt, **argh)
+    Assertion.errbuf << result
+  end
 end
 
 def pretty(src, desc, result)
-  src = src.sub(/\A.*\n/, '')
+  src = src.sub(/\A\s*\n/, '')
+  lines = src.lines
+  src = lines[0..20].join + "(...snip)\n" if lines.size > 20
   (/\n/ =~ src ? "\n#{adjust_indent(src)}" : src) + "  #=> #{desc}"
 end
 
@@ -412,66 +822,6 @@ def untabify(str)
   str.gsub(/^\t+/) {' ' * (8 * $&.size) }
 end
 
-def make_srcfile(src)
-  filename = 'bootstraptest.tmp.rb'
-  File.open(filename, 'w') {|f|
-    f.puts "GC.stress = true" if $stress
-    f.puts "print(begin; #{src}; end)"
-  }
-  filename
-end
-
-def get_result_string(src, opt = '')
-  if @ruby
-    filename = make_srcfile(src)
-    begin
-      `#{@ruby} -W0 #{opt} #{filename}`
-    ensure
-      raise Interrupt if $? and $?.signaled? && $?.termsig == Signal.list["INT"]
-      raise CoreDumpError, "core dumped" if $? and $?.coredump?
-    end
-  else
-    eval(src).to_s
-  end
-end
-
-def with_stderr
-  out = err = nil
-  begin
-    r, w = IO.pipe
-    stderr = $stderr.dup
-    $stderr.reopen(w)
-    w.close
-    reader = Thread.start {r.read}
-    begin
-      out = yield
-    ensure
-      $stderr.reopen(stderr)
-      err = reader.value
-    end
-  ensure
-    w.close rescue nil
-    r.close rescue nil
-  end
-  return out, err
-end
-
-def newtest
-  @location = File.basename(caller(2).first)
-  @count += 1
-  cleanup_coredump
-end
-
-def error(msg, additional_message)
-  msg = "#{@failed}\##{@count} #{@location}#{@reset}: #{msg}  #{additional_message}"
-  if @tty
-    $stderr.puts "#{erase}#{msg}"
-  else
-    @errbuf.push msg
-  end
-  @error += 1
-end
-
 def in_temporary_working_directory(dir)
   if dir
     Dir.mkdir dir
@@ -488,18 +838,40 @@ def in_temporary_working_directory(dir)
 end
 
 def cleanup_coredump
-  FileUtils.rm_f 'core'
+  if File.file?('core')
+    require 'time'
+    Dir.glob('/tmp/bootstraptest-core.*').each do |f|
+      if Time.now - File.mtime(f) > 7 * 24 * 60 * 60 # 7 days
+        warn "Deleting an old core file: #{f}"
+        FileUtils.rm(f)
+      end
+    end
+    core_path = "/tmp/bootstraptest-core.#{Time.now.utc.iso8601}"
+    warn "A core file is found. Saving it at: #{core_path.dump}"
+    FileUtils.mv('core', core_path)
+    cmd = ['gdb', BT.ruby, '-c', core_path, '-ex', 'bt', '-batch']
+    p cmd # debugging why it's not working
+    system(*cmd)
+  end
   FileUtils.rm_f Dir.glob('core.*')
-  FileUtils.rm_f @ruby+'.stackdump' if @ruby
+  FileUtils.rm_f BT.ruby+'.stackdump' if BT.ruby
 end
 
 class CoreDumpError < StandardError; end
 
 def check_coredump
   if File.file?('core') or not Dir.glob('core.*').empty? or
-      (@ruby and File.exist?(@ruby+'.stackdump'))
+      (BT.ruby and File.exist?(BT.ruby+'.stackdump'))
     raise CoreDumpError, "core dumped"
   end
 end
 
-main
+def yjit_enabled?
+  ENV.key?('RUBY_YJIT_ENABLE') || ENV.fetch('RUN_OPTS', '').include?('yjit') || BT.ruby.include?('yjit')
+end
+
+def zjit_enabled?
+  ENV.key?('RUBY_ZJIT_ENABLE') || ENV.fetch('RUN_OPTS', '').include?('zjit') || BT.ruby.include?('zjit')
+end
+
+exit main
diff --git a/bootstraptest/test_attr.rb b/bootstraptest/test_attr.rb
index 721a847145..3cb9d3eb39 100644
--- a/bootstraptest/test_attr.rb
+++ b/bootstraptest/test_attr.rb
@@ -34,3 +34,19 @@ assert_equal %{ok}, %{
     print "ok"
   end
 }, '[ruby-core:15120]'
+
+assert_equal %{ok}, %{
+  class Big
+    attr_reader :foo
+    def initialize
+      @foo = "ok"
+    end
+  end
+
+  obj = Big.new
+  100.times do |i|
+    obj.instance_variable_set(:"@ivar_\#{i}", i)
+  end
+
+  Big.new.foo
+}
diff --git a/bootstraptest/test_autoload.rb b/bootstraptest/test_autoload.rb
index a9f8e6dacd..de66f1f3ee 100644
--- a/bootstraptest/test_autoload.rb
+++ b/bootstraptest/test_autoload.rb
@@ -1,7 +1,7 @@
 assert_equal 'ok', %q{
-  File.unlink('zzz.rb') if File.file?('zzz.rb')
+  File.unlink('zzz1.rb') if File.file?('zzz1.rb')
   instance_eval do
-    autoload :ZZZ, './zzz.rb'
+    autoload :ZZZ, './zzz1.rb'
     begin
       ZZZ
     rescue LoadError
@@ -11,9 +11,9 @@ assert_equal 'ok', %q{
 }, '[ruby-dev:43816]'
 
 assert_equal 'ok', %q{
-  open('zzz.rb', 'w') {|f| f.puts '' }
+  File.write('zzz2.rb', '')
   instance_eval do
-    autoload :ZZZ, './zzz.rb'
+    autoload :ZZZ, './zzz2.rb'
     begin
       ZZZ
     rescue NameError
@@ -23,29 +23,29 @@ assert_equal 'ok', %q{
 }, '[ruby-dev:43816]'
 
 assert_equal 'ok', %q{
-  open('zzz.rb', 'w') {|f| f.puts 'class ZZZ; def self.ok;:ok;end;end'}
+  File.write('zzz3.rb', "class ZZZ; def self.ok;:ok;end;end\n")
   instance_eval do
-    autoload :ZZZ, './zzz.rb'
+    autoload :ZZZ, './zzz3.rb'
     ZZZ.ok
   end
 }, '[ruby-dev:43816]'
 
 assert_equal 'ok', %q{
-  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
-  autoload :ZZZ, "./zzz.rb"
+  File.write("zzz4.rb", "class ZZZ; def self.ok;:ok;end;end\n")
+  autoload :ZZZ, "./zzz4.rb"
   ZZZ.ok
 }
 
 assert_equal 'ok', %q{
-  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
-  autoload :ZZZ, "./zzz.rb"
-  require "./zzz.rb"
+  File.write("zzz5.rb", "class ZZZ; def self.ok;:ok;end;end\n")
+  autoload :ZZZ, "./zzz5.rb"
+  require "./zzz5.rb"
   ZZZ.ok
 }
 
 assert_equal 'okok', %q{
-  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
-  autoload :ZZZ, "./zzz.rb"
+  File.write("zzz6.rb", "class ZZZ; def self.ok;:ok;end;end\n")
+  autoload :ZZZ, "./zzz6.rb"
   t1 = Thread.new {ZZZ.ok}
   t2 = Thread.new {ZZZ.ok}
   [t1.value, t2.value].join
@@ -60,9 +60,9 @@ assert_finish 5, %q{
 }, '[ruby-core:21696]'
 
 assert_equal 'A::C', %q{
-  open("zzz.rb", "w") {}
+  File.write("zzz7.rb", "")
   class A
-    autoload :C, "./zzz"
+    autoload :C, "./zzz7"
     class C
     end
     C
diff --git a/bootstraptest/test_constant_cache.rb b/bootstraptest/test_constant_cache.rb
new file mode 100644
index 0000000000..1fa83256ed
--- /dev/null
+++ b/bootstraptest/test_constant_cache.rb
@@ -0,0 +1,187 @@
+# Constant lookup is cached.
+assert_equal '1', %q{
+  CONST = 1
+
+  def const
+    CONST
+  end
+
+  const
+  const
+}
+
+# Invalidate when a constant is set.
+assert_equal '2', %q{
+  CONST = 1
+
+  def const
+    CONST
+  end
+
+  const
+
+  CONST = 2
+
+  const
+}
+
+# Invalidate when a constant of the same name is set.
+assert_equal '1', %q{
+  CONST = 1
+
+  def const
+    CONST
+  end
+
+  const
+
+  class Container
+    CONST = 2
+  end
+
+  const
+}
+
+# Invalidate when a constant is removed.
+assert_equal 'missing', %q{
+  class Container
+    CONST = 1
+
+    def const
+      CONST
+    end
+
+    def self.const_missing(name)
+      'missing'
+    end
+
+    new.const
+    remove_const :CONST
+  end
+
+  Container.new.const
+}
+
+# Invalidate when a constant's visibility changes.
+assert_equal 'missing', %q{
+  class Container
+    CONST = 1
+
+    def self.const_missing(name)
+      'missing'
+    end
+  end
+
+  def const
+    Container::CONST
+  end
+
+  const
+
+  Container.private_constant :CONST
+
+  const
+}
+
+# Invalidate when a constant's visibility changes even if the call to the
+# visibility change method fails.
+assert_equal 'missing', %q{
+  class Container
+    CONST1 = 1
+
+    def self.const_missing(name)
+      'missing'
+    end
+  end
+
+  def const1
+    Container::CONST1
+  end
+
+  const1
+
+  begin
+    Container.private_constant :CONST1, :CONST2
+  rescue NameError
+  end
+
+  const1
+}
+
+# Invalidate when a module is included.
+assert_equal 'INCLUDE', %q{
+  module Include
+    CONST = :INCLUDE
+  end
+
+  class Parent
+    CONST = :PARENT
+  end
+
+  class Child < Parent
+    def const
+      CONST
+    end
+
+    new.const
+
+    include Include
+  end
+
+  Child.new.const
+}
+
+# Invalidate when const_missing is hit.
+assert_equal '2', %q{
+  module Container
+    Foo = 1
+    Bar = 2
+
+    class << self
+      attr_accessor :count
+
+      def const_missing(name)
+        @count += 1
+        @count == 1 ? Foo : Bar
+      end
+    end
+
+    @count = 0
+  end
+
+  def const
+    Container::Baz
+  end
+
+  const
+  const
+}
+
+# Invalidate when the iseq gets cleaned up.
+assert_equal '2', %q{
+  CONSTANT = 1
+
+  iseq = RubyVM::InstructionSequence.compile(<<~RUBY)
+    CONSTANT
+  RUBY
+
+  iseq.eval
+  iseq = nil
+
+  GC.start
+  CONSTANT = 2
+}
+
+# Invalidate when the iseq gets cleaned up even if it was never in the cache.
+assert_equal '2', %q{
+  CONSTANT = 1
+
+  iseq = RubyVM::InstructionSequence.compile(<<~RUBY)
+    CONSTANT
+  RUBY
+
+  iseq = nil
+
+  GC.start
+  CONSTANT = 2
+}
diff --git a/bootstraptest/test_env.rb b/bootstraptest/test_env.rb
new file mode 100644
index 0000000000..7d1b45b75e
--- /dev/null
+++ b/bootstraptest/test_env.rb
@@ -0,0 +1,12 @@
+assert_equal "true", %q{
+  ENV["ENVTEST"] = "\u{e9 3042 d76c}"
+  env = ENV["ENVTEST"]
+  env.valid_encoding?
+}
+
+# different encoding is used for PATH
+assert_equal "true", %q{
+  ENV["PATH"] = "\u{e9 3042 d76c}"
+  env = ENV["PATH"]
+  env.valid_encoding?
+}
diff --git a/bootstraptest/test_eval.rb b/bootstraptest/test_eval.rb
index bf7478006d..20bd9615f4 100644
--- a/bootstraptest/test_eval.rb
+++ b/bootstraptest/test_eval.rb
@@ -109,13 +109,40 @@ assert_equal %q{foo}, %q{
   }
 }
 assert_equal %q{1}, %q{
-  class Fixnum
+  class Integer
     Const = 1
   end
   1.instance_eval %{
     Const
   }
 }
+assert_equal %q{1}, %q{
+  class TrueClass
+    Const = 1
+  end
+  true.instance_eval %{
+    Const
+  }
+}
+assert_equal %q{[:Const]}, %q{
+  mod = Module.new
+  mod.instance_eval %{
+    Const = 1
+  }
+  raise if defined?(Module::Const)
+  mod.singleton_class.constants
+}
+assert_equal %q{can't define singleton}, %q{
+  begin
+    123.instance_eval %{
+      Const = 1
+    }
+    "bad"
+  rescue TypeError => e
+    raise "bad" if defined?(Integer::Const)
+    e.message
+  end
+}
 assert_equal %q{top}, %q{
   Const = :top
   class C
@@ -190,7 +217,8 @@ assert_equal %q{[10, main]}, %q{
 }
 
 %w[break next redo].each do |keyword|
-  assert_match %r"Can't escape from eval with #{keyword}\z", %{
+  assert_match %r"Invalid #{keyword}\b", %{
+    $stderr = STDOUT
     begin
       eval "0 rescue #{keyword}"
     rescue SyntaxError => e
@@ -199,8 +227,18 @@ assert_equal %q{[10, main]}, %q{
   }, '[ruby-dev:31372]'
 end
 
+assert_normal_exit %{
+  $stderr = STDOUT
+  5000.times do
+    begin
+      eval "0 rescue break"
+    rescue SyntaxError
+    end
+  end
+}
+
 assert_normal_exit %q{
-  STDERR.reopen(STDOUT)
+  $stderr = STDOUT
   class Foo
      def self.add_method
        class_eval("def some-bad-name; puts 'hello' unless @some_variable.some_function(''); end")
@@ -249,7 +287,9 @@ assert_equal 'ok', %q{
 
 assert_equal 'ok', %q{
   begin
-    12.instance_eval { @@a }
+    class A
+      12.instance_eval { @@a }
+    end
   rescue NameError
     :ok
   end
@@ -257,7 +297,9 @@ assert_equal 'ok', %q{
 
 assert_equal 'ok', %q{
   begin
-    12.instance_exec { @@a }
+    class A
+      12.instance_exec { @@a }
+    end
   rescue NameError
     :ok
   end
@@ -322,3 +364,34 @@ assert_normal_exit %q{
   end
 }, 'check escaping the internal value th->base_block'
 
+assert_equal "false", <<~RUBY, "literal strings are mutable", "--disable-frozen-string-literal"
+  eval("'test'").frozen?
+RUBY
+
+assert_equal "false", <<~RUBY, "literal strings are mutable", "--disable-frozen-string-literal", frozen_string_literal: true
+  eval("'test'").frozen?
+RUBY
+
+assert_equal "true", <<~RUBY, "literal strings are frozen", "--enable-frozen-string-literal"
+  eval("'test'").frozen?
+RUBY
+
+assert_equal "true", <<~RUBY, "literal strings are frozen", "--enable-frozen-string-literal", frozen_string_literal: false
+  eval("'test'").frozen?
+RUBY
+
+assert_equal "false", <<~RUBY, "__FILE__ is mutable", "--disable-frozen-string-literal"
+  eval("__FILE__").frozen?
+RUBY
+
+assert_equal "false", <<~RUBY, "__FILE__ is mutable", "--disable-frozen-string-literal", frozen_string_literal: true
+  eval("__FILE__").frozen?
+RUBY
+
+assert_equal "true", <<~RUBY, "__FILE__ is frozen", "--enable-frozen-string-literal"
+  eval("__FILE__").frozen?
+RUBY
+
+assert_equal "true", <<~RUBY, "__FILE__ is frozen", "--enable-frozen-string-literal", frozen_string_literal: false
+  eval("__FILE__").frozen?
+RUBY
diff --git a/bootstraptest/test_exception.rb b/bootstraptest/test_exception.rb
index 35c8d25e37..decfdc08a3 100644
--- a/bootstraptest/test_exception.rb
+++ b/bootstraptest/test_exception.rb
@@ -370,7 +370,7 @@ assert_equal %q{}, %q{
 }
 
 ##
-assert_match /undefined method `foo\'/, %q{#`
+assert_match /undefined method 'foo\'/, %q{#`
   STDERR.reopen(STDOUT)
   class C
     def inspect
@@ -402,7 +402,7 @@ assert_equal 'nil', %q{
   exc.inspect
 }, '[ruby-dev:32608]'
 
-assert_equal 'exception class/object expected', %q{
+assert_equal 'divided by 0', %q{
   class ZeroDivisionError
     def self.new(message)
       42
diff --git a/bootstraptest/test_fiber.rb b/bootstraptest/test_fiber.rb
new file mode 100644
index 0000000000..ae809a5936
--- /dev/null
+++ b/bootstraptest/test_fiber.rb
@@ -0,0 +1,44 @@
+show_limit %q{
+  fibers = []
+  begin
+    fiber = Fiber.new{Fiber.yield}
+    fiber.resume
+    fibers << fiber
+
+    raise Exception, "skipping" if fibers.count >= 10_000
+  rescue Exception => error
+    puts "Fiber count: #{fibers.count} (#{error})"
+    break
+  end while true
+}
+
+assert_equal %q{ok}, %q{
+  Fiber.new{
+  }.resume
+  :ok
+}
+
+assert_equal %q{ok}, %q{
+  100.times.collect{Fiber.new{}}
+  :ok
+}
+
+assert_equal %q{ok}, %q{
+  fibers = 1000.times.collect{Fiber.new{Fiber.yield}}
+  fibers.each(&:resume)
+  fibers.each(&:resume)
+  :ok
+}
+
+assert_normal_exit %q{
+  at_exit { Fiber.new{}.resume }
+}
+
+assert_normal_exit %q{
+  Fiber.new(&Object.method(:class_eval)).resume("foo")
+}, '[ruby-dev:34128]'
+
+# [Bug #21400]
+assert_normal_exit %q{
+  Thread.new { Fiber.current.kill }.join
+}
diff --git a/bootstraptest/test_finalizer.rb b/bootstraptest/test_finalizer.rb
index 22a16b1220..ccfa0b55d6 100644
--- a/bootstraptest/test_finalizer.rb
+++ b/bootstraptest/test_finalizer.rb
@@ -6,3 +6,11 @@ ObjectSpace.define_finalizer(b1,proc{b1.inspect})
 ObjectSpace.define_finalizer(a2,proc{a1.inspect})
 ObjectSpace.define_finalizer(a1,proc{})
 }, '[ruby-dev:35778]'
+
+assert_equal 'true', %q{
+  obj = Object.new
+  id = obj.object_id
+
+  ObjectSpace.define_finalizer(obj, proc { |i| print(id == i) })
+  nil
+}
diff --git a/bootstraptest/test_flow.rb b/bootstraptest/test_flow.rb
index 0390062a24..15528a4213 100644
--- a/bootstraptest/test_flow.rb
+++ b/bootstraptest/test_flow.rb
@@ -363,7 +363,7 @@ assert_equal %q{[1, 2, 3, 5, 2, 3, 5, 7, 8]}, %q{$a = []; begin;  ; $a << 1
 ; $a << 8
 ; rescue Exception; $a << 99; end; $a}
 assert_equal %q{[1, 2, 6, 3, 5, 7, 8]}, %q{$a = []; begin;  ; $a << 1
-  o = "test"; $a << 2
+  o = "test".dup; $a << 2
   def o.test(a); $a << 3
     return a; $a << 4
   ensure; $a << 5
@@ -534,11 +534,11 @@ assert_equal %Q{ENSURE\n}, %q{
  ['[ruby-core:39125]', %q{
   class Bug5234
     include Enumerable
-    def each
+    def each(&block)
       begin
         yield :foo
       ensure
-        proc
+        proc(&block)
       end
     end
   end
@@ -547,11 +547,11 @@ assert_equal %Q{ENSURE\n}, %q{
  ['[ruby-dev:45656]', %q{
   class Bug6460
     include Enumerable
-    def each
+    def each(&block)
       begin
         yield :foo
       ensure
-        1.times { Proc.new }
+        1.times { Proc.new(&block) }
       end
     end
   end
@@ -589,3 +589,13 @@ assert_equal "foo", %q{
   end
   Bug6460.new.m1
 }, '[ruby-dev:46372]'
+
+assert_equal "foo", %q{
+  obj = "foo"
+  if obj || any1
+    any2 = any2
+  else
+    raise obj.inspect
+  end
+  obj
+}, '[ruby-core:87830]'
diff --git a/bootstraptest/test_fork.rb b/bootstraptest/test_fork.rb
index 5de6ee1b12..860ef285d0 100644
--- a/bootstraptest/test_fork.rb
+++ b/bootstraptest/test_fork.rb
@@ -21,10 +21,12 @@ assert_finish 10, %q{
   end
 }, '[ruby-core:22158]'
 
-assert_normal_exit(<<'End', '[ruby-dev:37934]')
+# temporarily stop this test to enable explicit failure when
+# timer thread couldn't be created (r61706 and r61717).
+assert_normal_exit(<<'End', '[ruby-dev:37934]') if false
   main = Thread.current
   Thread.new { sleep 0.01 until main.stop?; Thread.kill main }
-  Process.setrlimit(:NPROC, 1)
+  Process.setrlimit(:NPROC, 1) if defined?(Process::RLIMIT_NPROC)
   fork {}
 End
 
@@ -73,3 +75,30 @@ assert_equal '[1, 2]', %q{
   end
 }, '[ruby-dev:44005] [Ruby 1.9 - Bug #4950]'
 
+assert_equal 'ok', %q{
+  def now = Process.clock_gettime(Process::CLOCK_MONOTONIC)
+
+  Thread.new do
+    loop { sleep 0.0001 }
+  end
+
+  10.times do
+    pid = fork{ exit!(0) }
+    deadline = now + 10
+    while true
+      _, status = Process.waitpid2(pid, Process::WNOHANG)
+      break if status
+      if now > deadline
+        Process.kill(:KILL, pid)
+        raise "failed"
+      end
+      sleep 0.001
+    end
+    unless status.success?
+      raise "child exited with status #{status}"
+    end
+  rescue NotImplementedError
+  end
+  :ok
+}, '[Bug #20670]'
+
diff --git a/bootstraptest/test_insns.rb b/bootstraptest/test_insns.rb
new file mode 100644
index 0000000000..9e2c4a52a7
--- /dev/null
+++ b/bootstraptest/test_insns.rb
@@ -0,0 +1,492 @@
+# C0 coverage of each instructions
+
+# :NOTE: This is for development purpose; never consider this file as
+# ISeq compilation specification.
+
+begin
+  # This library brings some additional coverage.
+  # Not mandatory.
+  require 'rbconfig/sizeof'
+rescue LoadError
+  # OK, just skip
+else
+  if defined? RbConfig::LIMITS
+    $FIXNUM_MAX = RbConfig::LIMITS["FIXNUM_MAX"]
+    $FIXNUM_MIN = RbConfig::LIMITS["FIXNUM_MIN"]
+  end
+end
+
+fsl   = { frozen_string_literal: true } # used later
+tests = [
+  # insn ,   expression to generate such insn
+  [ 'nop',   %q{ raise rescue true }, ],
+
+  [ 'setlocal *, 0', %q{ x = true }, ],
+  [ 'setlocal *, 1', %q{ x = nil; -> { x = true }.call }, ],
+  [ 'setlocal',      %q{ x = nil; -> { -> { x = true }.() }.() }, ],
+  [ 'getlocal *, 0', %q{ x = true; x }, ],
+  [ 'getlocal *, 1', %q{ x = true; -> { x }.call }, ],
+  [ 'getlocal',      %q{ x = true; -> { -> { x }.() }.() }, ],
+
+  [ 'setblockparam', <<-'},', ], # {
+    def m&b
+      b = # here
+        proc { true }
+    end
+    m { false }.call
+  },
+  [ 'getblockparam', <<-'},', ], # {
+    def m&b
+      b # here
+    end
+    m { true }.call
+  },
+  [ 'getblockparamproxy', <<-'},', ], # {
+    def m&b
+      b # here
+        .call
+    end
+    m { true }
+  },
+
+  [ 'setspecial', %q{ true if true..true }, ],
+  [ 'getspecial', %q{ $&.nil? }, ],
+  [ 'getspecial', %q{ $`.nil? }, ],
+  [ 'getspecial', %q{ $'.nil? }, ],
+  [ 'getspecial', %q{ $+.nil? }, ],
+  [ 'getspecial', %q{ $1.nil? }, ],
+  [ 'getspecial', %q{ $128.nil? }, ],
+
+  [ 'getglobal', %q{ String === $0 }, ],
+  [ 'getglobal', %q{ $_.nil? }, ],
+  [ 'setglobal', %q{ $0 = "true" }, ],
+
+  [ 'setinstancevariable', %q{ @x = true }, ],
+  [ 'getinstancevariable', %q{ @x = true; @x }, ],
+
+  [ 'setclassvariable', %q{ class A; @@x = true; end }, ],
+  [ 'getclassvariable', %q{ class A; @@x = true; @@x end }, ],
+
+  [ 'setconstant', %q{ X = true }, ],
+  [ 'setconstant', %q{ Object::X = true }, ],
+  [ 'getconstant', %q{ X = true; X }, ],
+  [ 'getconstant', %q{ X = true; Object::X }, ],
+
+  [ 'getinlinecache / setinlinecache', %q{ def x; X; end; X = true; x; x; x }, ],
+
+  [ 'putnil',               %q{ $~ == nil }, ],
+  [ 'putself',              %q{ $~ != self }, ],
+  [ 'putobject INT2FIX(0)', %q{ $~ != 0 }, ],
+  [ 'putobject INT2FIX(1)', %q{ $~ != 1 }, ],
+  [ 'putobject',            %q{ $~ != -1 }, ],
+  [ 'putobject',            %q{ $~ != /x/ }, ],
+  [ 'putobject',            %q{ $~ != :x }, ],
+  [ 'putobject',            %q{ $~ != (1..2) }, ],
+  [ 'putobject',            %q{ $~ != true }, ],
+  [ 'putobject',            %q{ /(?<x>x)/ =~ "x"; x == "x" }, ],
+
+  [ 'putspecialobject',         %q{ {//=>true}[//] }, ],
+  [ 'putstring',                %q{ "true" }, ],
+  [ 'tostring / concatstrings', %q{ "#{true}" }, ],
+  [ 'toregexp',                 %q{ /#{true}/ =~ "true" && $~ }, ],
+  [ 'intern',                   %q{ :"#{true}" }, ],
+
+  [ 'newarray',    %q{ ["true"][0] }, ],
+  [ 'pushtoarraykwsplat', %q{ [**{x:'true'}][0][:x] }, ],
+  [ 'duparray',    %q{ [ true ][0] }, ],
+  [ 'expandarray', %q{ y = [ true, false, nil ]; x, = y; x }, ],
+  [ 'expandarray', %q{ y = [ true, false, nil ]; x, *z = y; x }, ],
+  [ 'expandarray', %q{ y = [ true, false, nil ]; x, *z, w = y; x }, ],
+  [ 'splatarray',  %q{ x, = *(y = true), false; x }, ],
+  [ 'concatarray', %q{ ["t", "r", *x = "u", "e"].join }, ],
+  [ 'concatarray', <<-'},', ],  # {
+    class X; def to_a; ['u']; end; end
+    ['t', 'r', *X.new, 'e'].join
+  },
+  [ 'concatarray', <<-'},', ],  # {
+    r = false
+    t = [true, nil]
+    q, w, e = r, *t             # here
+    w
+  },
+
+  [ 'newhash',  %q{ x = {}; x[x] = true }, ],
+  [ 'newhash',  %q{ x = true; { x => x }[x] }, ],
+  [ 'newhashfromarray', %q{ { a: true }[:a] }, ],
+  [ 'newrange', %q{ x = 1; [*(0..x)][0] == 0 }, ],
+  [ 'newrange', %q{ x = 1; [*(0...x)][0] == 0 }, ],
+
+  [ 'pop',     %q{ def x; true; end; x }, ],
+  [ 'dup',     %q{ x = y = true; x }, ],
+  [ 'dupn',    %q{ Object::X ||= true }, ],
+  [ 'reverse', %q{ q, (w, e), r = 1, [2, 3], 4; e == 3 }, ],
+  [ 'swap',    %q{ !!defined?([[]]) }, ],
+  [ 'swap',    <<-'},', ],      # {
+    x = [[false, true]]
+    for i, j in x               # here
+      ;
+    end
+    j
+  },
+
+  [ 'topn',        %q{ x, y = [], 0; x[*y], = [true, false]; x[0] }, ],
+  [ 'setn',        %q{ x, y = [], 0; x[*y]  =  true        ; x[0] }, ],
+  [ 'adjuststack', %q{ x = [true]; x[0] ||= nil; x[0] }, ],
+
+  [ 'defined',      %q{ !defined?(x) }, ],
+  [ 'checkkeyword', %q{ def x x:rand;x end; x x: true }, ],
+  [ 'checktype',    %q{ x = true; "#{x}" }, ],
+  [ 'checkmatch',   <<-'},', ], # {
+    x = y = true
+    case x
+    when false
+      y = false
+    when true                   # here
+      y = nil
+    end
+    y == nil
+  },
+  [ 'checkmatch',   <<-'},', ], # {
+    x, y = true, [false]
+    case x
+    when *y                     # here
+      z = false
+    else
+      z = true
+    end
+    z
+  },
+  [ 'checkmatch',   <<-'},', ], # {
+    x = false
+    begin
+      raise
+    rescue                      # here
+      x = true
+    end
+    x
+  },
+
+  [ 'defineclass', %q{                 module X;    true end }, ],
+  [ 'defineclass', %q{ X = Module.new; module X;    true end }, ],
+  [ 'defineclass', %q{                 class X;     true end }, ],
+  [ 'defineclass', %q{ X = Class.new;  class X;     true end }, ],
+  [ 'defineclass', %q{ X = Class.new;  class Y < X; true end }, ],
+  [ 'defineclass', %q{ X = Class.new;  class << X;  true end }, ],
+  [ 'defineclass', <<-'},', ], # {
+    X = Class.new
+    Y = Class.new(X)
+    class Y < X
+      true
+    end
+  },
+
+  [ 'opt_send_without_block', %q{ true.to_s }, ],
+  [ 'send',                   %q{ true.tap {|i| i.to_s } }, ],
+  [ 'leave',                  %q{ def x; true; end; x }, ],
+  [ 'invokesuper',            <<-'},', ], # {
+    class X < String
+      def empty?
+        super                   # here
+      end
+    end
+   X.new.empty?
+  },
+  [ 'invokeblock',            <<-'},', ], # {
+    def x
+      return yield self         # here
+    end
+    x do
+      true
+    end
+  },
+
+  [ 'opt_str_freeze', %q{ 'true'.freeze }, ],
+  [ 'opt_nil_p',      %q{ nil.nil? }, ],
+  [ 'opt_nil_p',      %q{ !Object.nil? }, ],
+  [ 'opt_nil_p',      %q{ Class.new{def nil?; true end}.new.nil? }, ],
+  [ 'opt_str_uminus', %q{ -'true' }, ],
+  [ 'opt_str_freeze', <<-'},', ], # {
+    class String
+      def freeze
+        true
+      end
+    end
+    'true'.freeze
+  },
+
+  [ 'opt_duparray_send', %q{ x = :a; [:a, :b].include?(x) }, ],
+  [ 'opt_duparray_send', <<-'},', ], # {
+    class Array
+      def include?(i)
+        i == 1
+      end
+    end
+    x = 1
+    [:a, :b].include?(x)
+  },
+
+  [ 'opt_newarray_send', %q{ ![ ].hash.nil? }, ],
+
+  [ 'opt_newarray_send', %q{ v=2; [1, Object.new, 2].include?(v) }, ],
+
+  [ 'opt_newarray_send', %q{ [ ].max.nil? }, ],
+  [ 'opt_newarray_send', %q{ [1, x = 2, 3].max == 3 }, ],
+  [ 'opt_newarray_send', <<-'},', ], # {
+    class Array
+      def max
+        true
+      end
+    end
+    [1, x = 2, 3].max
+  },
+  [ 'opt_newarray_send', %q{ [ ].min.nil? }, ],
+  [ 'opt_newarray_send', %q{ [3, x = 2, 1].min == 1 }, ],
+  [ 'opt_newarray_send', <<-'},', ], # {
+    class Array
+      def min
+        true
+      end
+    end
+    [3, x = 2, 1].min
+  },
+  [ 'opt_newarray_send', %q{ v = 1.23; [v, v*2].pack("E*").unpack("E*") == [v, v*2] }, ],
+  [ 'opt_newarray_send', %q{ v = 4.56; b = +"x"; [v, v*2].pack("E*", buffer: b); b[1..].unpack("E*") == [v, v*2] }, ],
+  [ 'opt_newarray_send', <<-'},', ], # {
+    v = 7.89;
+    b = +"x";
+    class Array
+      alias _pack pack
+      def pack(s, buffer: nil, prefix: "y")
+        buffer ||= +"b"
+        buffer << prefix
+        _pack(s, buffer: buffer)
+      end
+    end
+    tests = []
+
+    ret = [v].pack("E*", prefix: "z")
+    tests << (ret[0..1] == "bz")
+    tests << (ret[2..].unpack("E*") == [v])
+
+    ret = [v].pack("E*")
+    tests << (ret[0..1] == "by")
+    tests << (ret[2..].unpack("E*") == [v])
+
+    [v, v*2, v*3].pack("E*", buffer: b)
+    tests << (b[0..1] == "xy")
+    tests << (b[2..].unpack("E*") == [v, v*2, v*3])
+
+    class Array
+      def pack(_fmt, buffer:) = buffer
+    end
+
+    b = nil
+    tests << [v].pack("E*", buffer: b).nil?
+
+    class Array
+      def pack(_fmt, **kw) = kw.empty?
+    end
+
+    tests << [v].pack("E*") == true
+
+    tests.all? or puts tests
+  },
+
+  [ 'throw',        %q{ false.tap { break true } }, ],
+  [ 'branchif',     %q{ x = nil;  x ||= true }, ],
+  [ 'branchif',     %q{ x = true; x ||= nil; x }, ],
+  [ 'branchunless', %q{ x = 1;    x &&= true }, ],
+  [ 'branchunless', %q{ x = nil;  x &&= true; x.nil? }, ],
+  [ 'branchnil',    %q{ x = true; x&.to_s }, ],
+  [ 'branchnil',    %q{ x = nil;  (x&.to_s).nil? }, ],
+  [ 'jump',         <<-'},', ], # {
+    y = 1
+    x = if y == 0 then nil elsif y == 1 then true else nil end
+    x
+  },
+  [ 'jump',         <<-'},', ], # {
+    # ultra complicated situation: this ||= assignment only generates
+    # 15 instructions, not including the class definition.
+    class X; attr_accessor :x; end
+    x = X.new
+    x&.x ||= true               # here
+  },
+
+  [ 'once', %q{ /#{true}/o =~ "true" && $~ }, ],
+  [ 'once', <<-'},', ],         # {
+    def once expr
+      return /#{expr}/o         # here
+    end
+    x = once(true); x = once(false); x = once(nil);
+    x =~ "true" && $~
+  },
+  [ 'once', <<-'},', ],         # {
+    # recursive once
+    def once n
+      return %r/#{
+        if n == 0
+          true
+        else
+          once(n-1)             # here
+        end
+      }/ox
+    end
+    x = once(128); x = once(7); x = once(16);
+    x =~ "true" && $~
+  },
+  [ 'once', <<-'},', ],         # {
+    # inter-thread lockup situation
+    def once n
+      return Thread.start n do |m|
+        Thread.pass
+        next %r/#{
+          sleep m               # here
+          true
+        }/ox
+      end
+    end
+    x = once(1); y = once(0.1); z = y.value
+    z =~ "true" && $~
+  },
+
+  [ 'opt_case_dispatch', %q{ case   0 when 1.1 then false else true end }, ],
+  [ 'opt_case_dispatch', %q{ case 1.0 when 1.1 then false else true end }, ],
+
+  [ 'opt_plus',    %q{ 1 + 1 == 2 }, ],
+  if defined? $FIXNUM_MAX then
+    [ 'opt_plus',  %Q{ #{ $FIXNUM_MAX } + 1 == #{ $FIXNUM_MAX + 1 } }, ]
+  end,
+  [ 'opt_plus',    %q{ 1.0 + 1.0 == 2.0 }, ],
+  [ 'opt_plus',    %q{ x = +0.0.next_float; x + x >= x }, ],
+  [ 'opt_plus',    %q{ 't' + 'rue' }, ],
+  [ 'opt_plus',    %q{ ( ['t'] + ['r', ['u', ['e'], ], ] ).join }, ],
+  [ 'opt_plus',    %q{ Time.at(1) + 1 == Time.at(2) }, ],
+  [ 'opt_minus',   %q{ 1 - 1 == 0 }, ],
+  if defined? $FIXNUM_MIN then
+    [ 'opt_minus', %Q{ #{ $FIXNUM_MIN } - 1 == #{ $FIXNUM_MIN - 1 } }, ]
+  end,
+  [ 'opt_minus',   %q{ 1.0 - 1.0 == 0.0 }, ],
+  [ 'opt_minus',   %q{ x = -0.0.prev_float; x - x == 0.0 }, ],
+  [ 'opt_minus',   %q{ ( [false, true] - [false] )[0] }, ],
+  [ 'opt_mult',    %q{ 1 * 1 == 1 }, ],
+  [ 'opt_mult',    %q{ 1.0 * 1.0 == 1.0 }, ],
+  [ 'opt_mult',    %q{ x = +0.0.next_float; x * x <= x }, ],
+  [ 'opt_mult',    %q{ ( "ruet" * 3 )[7,4] }, ],
+  [ 'opt_div',     %q{ 1 / 1 == 1 }, ],
+  [ 'opt_div',     %q{ 1.0 / 1.0 == 1.0 }, ],
+  [ 'opt_div',     %q{ x = +0.0.next_float; x / x >= x }, ],
+  [ 'opt_div',     %q{ x = 1/2r; x / x == 1 }, ],
+  [ 'opt_mod',     %q{ 1 % 1 == 0 }, ],
+  [ 'opt_mod',     %q{ 1.0 % 1.0 == 0.0 }, ],
+  [ 'opt_mod',     %q{ x = +0.0.next_float; x % x == 0.0 }, ],
+  [ 'opt_mod',     %q{ '%s' % [ true ] }, ],
+
+  [ 'opt_eq', %q{ 1 == 1 }, ],
+  [ 'opt_eq', <<-'},', ],       # {
+    class X; def == other; true; end; end
+    X.new == true
+  },
+  [ 'opt_neq', %q{ 1 != 0 }, ],
+  [ 'opt_neq', <<-'},', ],       # {
+    class X; def != other; true; end; end
+    X.new != true
+  },
+
+  [ 'opt_lt', %q{            -1   <  0 }, ],
+  [ 'opt_lt', %q{            -1.0 <  0.0 }, ],
+  [ 'opt_lt', %q{ -0.0.prev_float <  0.0 }, ],
+  [ 'opt_lt', %q{              ?a <  ?z }, ],
+  [ 'opt_le', %q{            -1   <= 0 }, ],
+  [ 'opt_le', %q{            -1.0 <= 0.0 }, ],
+  [ 'opt_le', %q{ -0.0.prev_float <= 0.0 }, ],
+  [ 'opt_le', %q{              ?a <= ?z }, ],
+  [ 'opt_gt', %q{             1   >  0 }, ],
+  [ 'opt_gt', %q{             1.0 >  0.0 }, ],
+  [ 'opt_gt', %q{ +0.0.next_float >  0.0 }, ],
+  [ 'opt_gt', %q{              ?z >  ?a }, ],
+  [ 'opt_ge', %q{             1   >= 0 }, ],
+  [ 'opt_ge', %q{             1.0 >= 0.0 }, ],
+  [ 'opt_ge', %q{ +0.0.next_float >= 0.0 }, ],
+  [ 'opt_ge', %q{              ?z >= ?a }, ],
+
+  [ 'opt_ltlt', %q{  +'' << 'true' }, ],
+  [ 'opt_ltlt', %q{ ([] << 'true').join }, ],
+  [ 'opt_ltlt', %q{ (1 << 31) == 2147483648 }, ],
+
+  [ 'opt_aref', %q{ ['true'][0] }, ],
+  [ 'opt_aref', %q{ { 0 => 'true'}[0] }, ],
+  [ 'opt_aref', %q{ 'true'[0] == ?t }, ],
+  [ 'opt_aset', %q{ [][0] = true }, ],
+  [ 'opt_aset', %q{ {}[0] = true }, ],
+  [ 'opt_aset', %q{ x = +'frue'; x[0] = 't'; x }, ],
+  [ 'opt_aset', <<-'},', ], # {
+    # opt_aref / opt_aset mixup situation
+    class X; def x; {}; end; end
+    x = X.new
+    x&.x[true] ||= true         # here
+  },
+
+  [ 'opt_length',  %q{   'true'       .length == 4 }, ],
+  [ 'opt_length',  %q{   :true        .length == 4 }, ],
+  [ 'opt_length',  %q{ [ 'true' ]     .length == 1 }, ],
+  [ 'opt_length',  %q{ { 'true' => 1 }.length == 1 }, ],
+  [ 'opt_size',    %q{   'true'       .size   == 4 }, ],
+  [ 'opt_size',    %q{               1.size   >= 4 }, ],
+  [ 'opt_size',    %q{ [ 'true' ]     .size   == 1 }, ],
+  [ 'opt_size',    %q{ { 'true' => 1 }.size   == 1 }, ],
+  [ 'opt_empty_p', %q{ ''.empty? }, ],
+  [ 'opt_empty_p', %q{ [].empty? }, ],
+  [ 'opt_empty_p', %q{ {}.empty? }, ],
+  [ 'opt_empty_p', %q{ Thread::Queue.new.empty? }, ],
+
+  [ 'opt_succ',  %q{ 1.succ == 2 }, ],
+  if defined? $FIXNUM_MAX then
+    [ 'opt_succ',%Q{ #{ $FIXNUM_MAX }.succ == #{ $FIXNUM_MAX + 1 } }, ]
+  end,
+  [ 'opt_succ',  %q{ '1'.succ == '2' }, ],
+
+  [ 'opt_not',  %q{ ! false }, ],
+  [ 'opt_neq', <<-'},', ],       # {
+    class X; def !; true; end; end
+    ! X.new
+  },
+
+  [ 'opt_regexpmatch2',  %q{ /true/ =~ 'true' && $~ }, ],
+  [ 'opt_regexpmatch2', <<-'},', ],       # {
+    class Regexp; def =~ other; true; end; end
+    /true/ =~ 'true'
+  },
+  [ 'opt_regexpmatch2',  %q{ 'true' =~ /true/ && $~ }, ],
+  [ 'opt_regexpmatch2', <<-'},', ],       # {
+    class String; def =~ other; true; end; end
+    'true' =~ /true/
+  },
+]
+
+# normal path
+tests.compact.each do |(insn, expr, *a)|
+  if a.last.is_a?(Hash)
+    a = a.dup
+    kw = a.pop
+    assert_equal 'true', expr, insn, *a, **kw
+  else
+    assert_equal 'true', expr, insn, *a
+  end
+end
+
+# with trace
+tests.compact.each {|(insn, expr, *a)|
+  progn = "set_trace_func(proc{})\n" + expr
+  if a.last.is_a?(Hash)
+    a = a.dup
+    kw = a.pop
+    assert_equal 'true', progn, 'trace_' + insn, *a, **kw
+  else
+    assert_equal 'true', progn, 'trace_' + insn, *a
+  end
+}
+
+assert_normal_exit("#{<<-"begin;"}\n#{<<-'end;'}")
+begin;
+  RubyVM::InstructionSequence.compile("", debug_level: 5)
+end;
diff --git a/bootstraptest/test_io.rb b/bootstraptest/test_io.rb
index 1d2b19368a..4081769a8c 100644
--- a/bootstraptest/test_io.rb
+++ b/bootstraptest/test_io.rb
@@ -1,3 +1,4 @@
+/freebsd/ =~ RUBY_PLATFORM or
 assert_finish 5, %q{
   r, w = IO.pipe
   t1 = Thread.new { r.sysread(1) }
@@ -30,7 +31,8 @@ assert_finish 10, %q{
   end
 }, '[ruby-dev:32566]'
 
-assert_finish 1, %q{
+/freebsd/ =~ RUBY_PLATFORM or
+assert_finish 5, %q{
   r, w = IO.pipe
   Thread.new {
     w << "ab"
@@ -52,7 +54,7 @@ assert_equal 'ok', %q{
   STDIN.reopen(rw)
   STDIN.reopen(save)
   rw.close
-  File.unlink(tmpname) unless RUBY_PLATFORM['nacl']
+  File.unlink(tmpname)
   :ok
 }
 
@@ -69,7 +71,7 @@ assert_equal 'ok', %q{
   STDIN.print "a"
   STDIN.reopen(save)
   rw.close
-  File.unlink(tmpname) unless RUBY_PLATFORM['nacl']
+  File.unlink(tmpname)
   :ok
 }
 
@@ -83,12 +85,13 @@ assert_normal_exit %q{
   ARGF.set_encoding "foo"
 }
 
+/(freebsd|mswin)/ =~ RUBY_PLATFORM or
 10.times do
   assert_normal_exit %q{
     at_exit { p :foo }
 
     megacontent = "abc" * 12345678
-    #File.open("megasrc", "w") {|f| f << megacontent }
+    #File.write("megasrc", megacontent)
 
     t0 = Thread.main
     Thread.new { sleep 0.001 until t0.stop?; Process.kill(:INT, $$) }
diff --git a/bootstraptest/test_jump.rb b/bootstraptest/test_jump.rb
index 595aaa7c4b..8751343b1f 100644
--- a/bootstraptest/test_jump.rb
+++ b/bootstraptest/test_jump.rb
@@ -146,15 +146,16 @@ assert_equal %q{131}, %q{
     end
   }
 }
-assert_equal %q{ok}, %q{
+assert_match %r{Invalid retry}, %q{
+$stderr = STDOUT
 begin
   eval %q{
     1.times{
       retry
     }
   }
-rescue SyntaxError
-  :ok
+rescue SyntaxError => e
+  e.message
 end
 }
 assert_equal %q{3}, %q{
@@ -291,18 +292,23 @@ assert_equal "true", %q{
       end
     end
   end
-  s = "foo"
+  s = +"foo"
   s.return_eigenclass == class << s; self; end
 }, '[ruby-core:21379]'
 
-assert_equal "true", %q{
-  class Object
-    def yield_eigenclass
-      class << self
-        yield self
+assert_match %r{Invalid yield}, %q{
+$stderr = STDOUT
+begin
+  eval %q{
+    class Object
+      def yield_eigenclass
+        class << self
+          yield self
+        end
       end
     end
-  end
-  s = "foo"
-  s.yield_eigenclass {|c| c == class << s; self; end }
-}, '[ruby-dev:40975]'
+  }
+rescue SyntaxError => e
+  e.message
+end
+}
diff --git a/bootstraptest/test_literal.rb b/bootstraptest/test_literal.rb
index aa65bddae1..39e6527027 100644
--- a/bootstraptest/test_literal.rb
+++ b/bootstraptest/test_literal.rb
@@ -15,17 +15,17 @@ assert_equal 'sym',             ':sym'
 assert_equal ':sym',            ':sym.inspect'
 assert_equal 'Symbol',          ':sym.class'
 assert_equal '1234',            '1234'
-assert_equal 'Fixnum',          '1234.class'
+assert_equal 'Integer',         '1234.class'
 assert_equal '1234',            '1_2_3_4'
-assert_equal 'Fixnum',          '1_2_3_4.class'
+assert_equal 'Integer',         '1_2_3_4.class'
 assert_equal '18',              '0x12'
-assert_equal 'Fixnum',          '0x12.class'
+assert_equal 'Integer',         '0x12.class'
 assert_equal '15',              '0o17'
-assert_equal 'Fixnum',          '0o17.class'
+assert_equal 'Integer',         '0o17.class'
 assert_equal '5',               '0b101'
-assert_equal 'Fixnum',          '0b101.class'
+assert_equal 'Integer',         '0b101.class'
 assert_equal '123456789012345678901234567890', '123456789012345678901234567890'
-assert_equal 'Bignum',          '123456789012345678901234567890.class'
+assert_equal 'Integer',         '123456789012345678901234567890.class'
 assert_equal '2.0',             '2.0'
 assert_equal 'Float',           '1.3.class'
 
@@ -65,10 +65,12 @@ assert_equal ':a3c',            ':"a#{1+2}c".inspect'
 assert_equal 'Symbol',          ':"a#{1+2}c".class'
 
 # xstring
-unless nacl?
+# WASI doesn't support spawning a new process for now.
+if /wasi/ !~ target_platform
   assert_equal "foo\n",           %q(`echo foo`)
   assert_equal "foo\n",           %q(s = "foo"; `echo #{s}`)
 end
+assert_equal "ECHO FOO",        %q(def `(s) s.upcase; end; `echo foo`)
 
 # regexp
 assert_equal '',                '//.source'
@@ -99,7 +101,7 @@ assert_equal '[3]',             '[3].inspect'
 assert_equal '3',               'a = [3]; a[0]'
 assert_equal 'Array',           '[1,2].class'
 assert_equal '2',               '[1,2].size'
-assert_equal '[1, 2]',           '[1,2].inspect'
+assert_equal '[1, 2]',          '[1,2].inspect'
 assert_equal 'Array',           '[1,2,3,4,5].class'
 assert_equal '5',               '[1,2,3,4,5].size'
 assert_equal '[1, 2, 3, 4, 5]', '[1,2,3,4,5].inspect'
@@ -115,16 +117,16 @@ assert_equal '1',               'a = [obj = Object.new]; a.size'
 assert_equal 'true',            'a = [obj = Object.new]; a[0] == obj'
 assert_equal '5',               'a = [1,2,3]; a[1] = 5; a[1]'
 assert_equal 'bar',             '[*:foo];:bar'
-assert_equal '[1, 2]',          'def nil.to_a; [2]; end; [1, *nil]'
-assert_equal '[1, 2]',          'def nil.to_a; [1, 2]; end; [*nil]'
-assert_equal '[0, 1, {2=>3}]',  '[0, *[1], 2=>3]', "[ruby-dev:31592]"
+assert_equal '[]',              'def nil.to_a; [1, 2]; end; [*nil]'
+assert_equal '[1]',             'def nil.to_a; [2]; end; [1, *nil]'
+assert_equal '[0, 1, {2 => 3}]', '[0, *[1], 2=>3]', "[ruby-dev:31592]"
 
 
 # hash
 assert_equal 'Hash',            '{}.class'
 assert_equal '{}',              '{}.inspect'
 assert_equal 'Hash',            '{1=>2}.class'
-assert_equal '{1=>2}',          '{1=>2}.inspect'
+assert_equal '{1 => 2}',        '{1=>2}.inspect'
 assert_equal '2',               'h = {1 => 2}; h[1]'
 assert_equal '0',               'h = {1 => 2}; h.delete(1); h.size'
 assert_equal '',                'h = {1 => 2}; h.delete(1); h[1]'
@@ -169,7 +171,7 @@ assert_equal 'a',               'r = ("a".."c"); r.begin'
 assert_equal 'c',               'r = ("a".."c"); r.end'
 
 assert_equal 'String',          '__FILE__.class'
-assert_equal 'Fixnum',          '__LINE__.class'
+assert_equal 'Integer',         '__LINE__.class'
 
 ###
 
@@ -225,6 +227,24 @@ assert_equal 'ok', %q{ #  long hash literal (optimized)
   :ok
 }
 
+assert_equal 'ok', %q{ #  Bug #15536
+  eval <<-END
+    {
+      **{
+        a0: nil, a1: nil, a2: nil, a3: nil, a4: nil, a5: nil, a6: nil, a7: nil, a8: nil,
+      },
+      a0: nil, a1: nil, a2: nil, a3: nil, a4: nil, a5: nil, a6: nil, a7: nil, a8: nil,
+      **{
+        c: nil
+      },
+      b0: nil, b1: nil, b2: nil, b3: nil, b4: nil, b5: nil, b6: nil, b7: nil, b8: nil,
+      b9: nil, b10: nil, b11: nil, b12: nil, b13: nil, b14: nil, b15: nil, b16: nil,
+      b17: nil, b18: nil, b19: nil, b20: nil, b21: nil,
+    }
+  END
+  :ok
+}
+
 assert_equal 'ok', %q{
   [print(:ok), exit] # void literal with side-effect
   :dummy
diff --git a/bootstraptest/test_literal_suffix.rb b/bootstraptest/test_literal_suffix.rb
index 4316c9e040..7a4d67d0fa 100644
--- a/bootstraptest/test_literal_suffix.rb
+++ b/bootstraptest/test_literal_suffix.rb
@@ -46,9 +46,9 @@ assert_equal '1',               '1rescue nil'
 assert_equal '10000000000000000001/10000000000000000000',
              '1.0000000000000000001r'
 
-assert_equal 'syntax error, unexpected tIDENTIFIER, expecting end-of-input',
-             %q{begin eval('1ir', nil, '', 0); rescue SyntaxError => e; e.message[/\A:(?:\d+:)? (.*)/, 1] end}
-assert_equal 'syntax error, unexpected tIDENTIFIER, expecting end-of-input',
-             %q{begin eval('1.2ir', nil, '', 0); rescue SyntaxError => e; e.message[/\A:(?:\d+:)? (.*)/, 1] end}
-assert_equal 'syntax error, unexpected tIDENTIFIER, expecting end-of-input',
-             %q{begin eval('1e1r', nil, '', 0); rescue SyntaxError => e; e.message[/\A:(?:\d+:)? (.*)/, 1] end}
+assert_equal 'unexpected local variable or method, expecting end-of-input',
+             %q{begin eval('1ir', nil, '', 0); rescue SyntaxError => e; e.message[/(?:\^~*|\A:(?:\d+:)? syntax error,) (.*)/, 1]; end}
+assert_equal 'unexpected local variable or method, expecting end-of-input',
+             %q{begin eval('1.2ir', nil, '', 0); rescue SyntaxError => e; e.message[/(?:\^~*|\A:(?:\d+:)? syntax error,) (.*)/, 1]; end}
+assert_equal 'unexpected local variable or method, expecting end-of-input',
+             %q{begin eval('1e1r', nil, '', 0); rescue SyntaxError => e; e.message[/(?:\^~*|\A:(?:\d+:)? syntax error,) (.*)/, 1]; end}
diff --git a/bootstraptest/test_load.rb b/bootstraptest/test_load.rb
index e63c93a8f4..fa8d31c098 100644
--- a/bootstraptest/test_load.rb
+++ b/bootstraptest/test_load.rb
@@ -1,9 +1,9 @@
 assert_equal 'ok', %q{
-  open("require-lock-test.rb", "w") {|f|
-    f.puts "sleep 0.1"
-    f.puts "module M"
-    f.puts "end"
-  }
+  File.write("require-lock-test.rb", <<-END)
+    sleep 0.1
+    module M
+    end
+  END
   $:.unshift Dir.pwd
   vs = (1..2).map {|i|
     Thread.start {
@@ -16,7 +16,7 @@ assert_equal 'ok', %q{
 
 assert_equal 'ok', %q{
   %w[a a/foo b].each {|d| Dir.mkdir(d)}
-  open("b/foo", "w") {|f| f.puts "$ok = :ok"}
+  File.write("b/foo", "$ok = :ok\n")
   $:.replace(%w[a b])
   begin
     load "foo"
diff --git a/bootstraptest/test_method.rb b/bootstraptest/test_method.rb
index 0a7cb0a577..78aab73485 100644
--- a/bootstraptest/test_method.rb
+++ b/bootstraptest/test_method.rb