1 files changed, 18 insertions, 0 deletions
diff --git a/spec/ruby/library/digest/sha256/shared/constants.rb b/spec/ruby/library/digest/sha256/shared/constants.rb
new file mode 100644
index 0000000000..afe8f11426
--- /dev/null
+++ b/spec/ruby/library/digest/sha256/shared/constants.rb
@@ -0,0 +1,18 @@
+# encoding: binary
+
+require 'digest/sha2'
+
+module SHA256Constants
+
+  Contents = "Ipsum is simply dummy text of the printing and typesetting industry. \nLorem Ipsum has been the industrys standard dummy text ever since the 1500s, when an unknown printer took a galley of type and scrambled it to make a type specimen book. \nIt has survived not only five centuries, but also the leap into electronic typesetting, remaining essentially unchanged. \nIt was popularised in the 1960s with the release of Letraset sheets containing Lorem Ipsum passages, and more recently with desktop publishing software like Aldus PageMaker including versions of Lorem Ipsum."
+
+  Klass          = ::Digest::SHA256
+  BlockLength    = 64
+  DigestLength   = 32
+  BlankDigest    = "\343\260\304B\230\374\034\024\232\373\364\310\231o\271$'\256A\344d\233\223L\244\225\231\exR\270U"
+  Digest         = "\230b\265\344_\337\357\337\242\004\314\311A\211jb\350\373\254\370\365M\230B\002\372\020j\as\270\376"
+  BlankHexdigest = "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855"
+  Hexdigest      = "9862b5e45fdfefdfa204ccc941896a62e8fbacf8f54d984202fa106a0773b8fe"
+  Base64digest   = "mGK15F/f79+iBMzJQYlqYuj7rPj1TZhCAvoQagdzuP4="
+
+end
diff --git a/.dir-locals.el b/.dir-locals.el
deleted file mode 100644
index 8f4b96445c..0000000000
--- a/.dir-locals.el
+++ /dev/null
@@ -1,39 +0,0 @@
-;; Copyright (c) 2018 Urabe, Shyouhei.  All rights reserved.
-;;
-;; This file is a part of  the programming language Ruby.  Permission is hereby
-;; granted, to either  redistribute and/or modify this file,  provided that the
-;; conditions mentioned  in the  file COPYING  are met.   Consult the  file for
-;; details.
-
-((nil .
-     ((indent-tabs-mode . nil)
-      (require-final-newline . t)
-      (tab-width . 8)
-      (show-trailing-whitespace . t)
-      (whitespace-line-column . 80))) ;; See also [Misc #12277]
-
- ;; (bat-mode . ((buffer-file-coding-system . utf-8-dos)))
-
- (ruby-mode . ((ruby-indent-level . 2)))
-
- (rdoc-mode . ((fill-column . 74)))
-
- (yaml-mode . ((yaml-indent-offset . 2)))
-
- (makefile-mode . ((indent-tabs-mode . t)))
-
- (c-mode . ((c-file-style . "ruby")))
-
- (c++-mode . ((c-file-style . "ruby")))
-
- (change-log-mode .
-     ((buffer-file-coding-system . us-ascii)
-      (indent-tabs-mode . t)
-      (change-log-indent-text . 2)
-      (add-log-time-format . (lambda (&optional x y)
-        (let* ((time (or x (current-time)))
-	       (system-time-locale "C")
-	       (diff (+ (cadr time) 32400))
-	       (lo (% diff 65536))
-	       (hi (+ (car time) (/ diff 65536))))
-        (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))))))
diff --git a/.document b/.document
index b6dfcdeee0..eeb565b08b 100644
--- a/.document
+++ b/.document
@@ -9,31 +9,8 @@
 
 # prelude
 prelude.rb
-rbconfig.rb
 
-array.rb
-ast.rb
-dir.rb
-gc.rb
-hash.rb
-io.rb
-kernel.rb
-marshal.rb
-rjit.rb
-numeric.rb
-nilclass.rb
-pack.rb
-ractor.rb
-string.rb
-symbol.rb
-timev.rb
-thread_sync.rb
-trace_point.rb
-warning.rb
-yjit.rb
-
-# Errno::*
-known_errors.inc
+rbconfig.rb
 
 # the lib/ directory (which has its own .document file)
 lib
@@ -42,14 +19,9 @@ lib
 ext
 
 # rdoc files
-NEWS.md
+NEWS
 
 README.md
 README.ja.md
 
-COPYING
-COPYING.ja
-
-LEGAL
-
 doc
diff --git a/.editorconfig b/.editorconfig
index 4633a7acae..49cc692091 100644
--- a/.editorconfig
+++ b/.editorconfig
@@ -3,7 +3,7 @@ root = true
 [*]
 end_of_line = lf
 indent_size = 4
-indent_style = space
+indent_style = tab
 insert_final_newline = true
 tab_width = 8
 trim_trailing_whitespace = true
@@ -13,18 +13,12 @@ end_of_line = crlf
 
 [*.gemspec]
 indent_size = 2
+indent_style = space
 
 [*.rb]
 indent_size = 2
+indent_style = space
 
 [*.yml]
 indent_size = 2
-
-[{*[Mm]akefile*,*.mak,*.mk,depend}]
-indent_style = tab
-
-[enc/*]
-indent_size = 2
-
-[reg*.[ch]]
-indent_size = 2
+indent_style = space
diff --git a/.gdbinit b/.gdbinit
index b778305c8d..a188ffa172 100644
--- a/.gdbinit
+++ b/.gdbinit
@@ -1,7 +1,21 @@
+define hook-run
+  set $color_type = 0
+  set $color_highlite = 0
+  set $color_end = 0
+end
+
 define ruby_gdb_init
-  init-if-undefined $color_type = "\033[31m"
-  init-if-undefined $color_highlite = "\033[36m"
-  init-if-undefined $color_end = "\033[m"
+  if !$color_type
+    set $color_type = "\033[31m"
+  end
+  if !$color_highlite
+    set $color_highlite = "\033[36m"
+  end
+  if !$color_end
+    set $color_end = "\033[m"
+  end
+  if ruby_dummy_gdb_enums.special_consts
+  end
 end
 
 # set prompt \033[36m(gdb)\033[m\040
@@ -51,7 +65,7 @@ define rp
     printf "%sT_OBJECT%s: ", $color_type, $color_end
     print ((struct RObject *)($arg0))->basic
     if ($flags & ROBJECT_EMBED)
-      print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (rb_shape_get_shape($arg0)->capacity)
+      print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (ROBJECT_EMBED_LEN_MAX+0)
     else
       print (((struct RObject *)($arg0))->as.heap)
       if (((struct RObject*)($arg0))->as.heap.numiv) > 0
@@ -83,11 +97,13 @@ define rp
     set $regsrc = ((struct RRegexp*)($arg0))->src
     set $rsflags = ((struct RBasic*)$regsrc)->flags
     printf "%sT_REGEXP%s: ", $color_type, $color_end
-    set $len = ((struct RString*)($arg0))->len
+    set $len = ($rsflags & RUBY_FL_USER1) ? \
+            ((struct RString*)$regsrc)->as.heap.len : \
+            (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
     set print address off
     output *(char *)(($rsflags & RUBY_FL_USER1) ? \
-            ((struct RString*)$regsrc)->as.heap.ptr : \
-            ((struct RString*)$regsrc)->as.embed.ary) @ $len
+	    ((struct RString*)$regsrc)->as.heap.ptr : \
+	    ((struct RString*)$regsrc)->as.ary) @ $len
     set print address on
     printf " len:%ld ", $len
     if $flags & RUBY_FL_USER6
@@ -108,26 +124,26 @@ define rp
       printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
       printf "(embed) "
       if ($len == 0)
-        printf "{(empty)} "
+	printf "{(empty)} "
       else
-        print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
-        printf " "
+	print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+	printf " "
       end
     else
       set $len = ((struct RArray*)($arg0))->as.heap.len
       printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
       if ($flags & RUBY_FL_USER2)
-        printf "(shared) shared="
-        output/x ((struct RArray*)($arg0))->as.heap.aux.shared_root
-        printf " "
+	printf "(shared) shared="
+	output/x ((struct RArray*)($arg0))->as.heap.aux.shared
+	printf " "
       else
-        printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+	printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
       end
       if ($len == 0)
-        printf "{(empty)} "
+	printf "{(empty)} "
       else
-        print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
-        printf " "
+	print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+	printf " "
       end
     end
     print (struct RArray *)($arg0)
@@ -138,12 +154,8 @@ define rp
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_HASH
     printf "%sT_HASH%s: ", $color_type, $color_end,
-    if (((struct RHash *)($arg0))->basic.flags & RHASH_ST_TABLE_FLAG)
-      printf "st len=%ld ", ((struct RHash *)($arg0))->as.st->num_entries
-    else
-      printf "li len=%ld bound=%ld ", \
-        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_SIZE_MASK) >> RHASH_AR_TABLE_SIZE_SHIFT), \
-        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_BOUND_MASK) >> RHASH_AR_TABLE_BOUND_SHIFT)
+    if ((struct RHash *)($arg0))->ntbl
+      printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
     end
     print (struct RHash *)($arg0)
   else
@@ -247,10 +259,6 @@ define rp
     printf "%sT_ZOMBIE%s: ", $color_type, $color_end
     print (struct RData *)($arg0)
   else
-  if ($flags & RUBY_T_MASK) == RUBY_T_MOVED
-    printf "%sT_MOVED%s: ", $color_type, $color_end
-    print *(struct RMoved *)$arg0
-  else
     printf "%sunknown%s: ", $color_type, $color_end
     print (struct RBasic *)($arg0)
   end
@@ -286,7 +294,6 @@ define rp
   end
   end
   end
-  end
 end
 document rp
   Print a Ruby's VALUE.
@@ -422,11 +429,13 @@ end
 
 define output_string
   set $flags = ((struct RBasic*)($arg0))->flags
-  set $len = ((struct RString*)($arg0))->len
+  set $len = ($flags & RUBY_FL_USER1) ? \
+          ((struct RString*)($arg0))->as.heap.len : \
+          (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
   if $len > 0
     output *(char *)(($flags & RUBY_FL_USER1) ? \
-            ((struct RString*)($arg0))->as.heap.ptr : \
-            ((struct RString*)($arg0))->as.embed.ary) @ $len
+	    ((struct RString*)($arg0))->as.heap.ptr : \
+	    ((struct RString*)($arg0))->as.ary) @ $len
   else
     output ""
   end
@@ -434,11 +443,13 @@ end
 
 define print_string
   set $flags = ((struct RBasic*)($arg0))->flags
-  set $len = ((struct RString*)($arg0))->len
+  set $len = ($flags & RUBY_FL_USER1) ? \
+          ((struct RString*)($arg0))->as.heap.len : \
+          (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
   if $len > 0
     printf "%s", *(char *)(($flags & RUBY_FL_USER1) ? \
-            ((struct RString*)($arg0))->as.heap.ptr : \
-            ((struct RString*)($arg0))->as.embed.ary) @ $len
+	    ((struct RString*)($arg0))->as.heap.ptr : \
+	    ((struct RString*)($arg0))->as.ary) @ $len
   end
 end
 
@@ -522,13 +533,13 @@ end
 
 define rp_class
   printf "(struct RClass *) %p", (void*)$arg0
-  if RCLASS_ORIGIN((struct RClass *)($arg0)) != $arg0
-    printf " -> %p", RCLASS_ORIGIN((struct RClass *)($arg0))
+  if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
+    printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
   end
   printf "\n"
   rb_classname $arg0
   print/x *(struct RClass *)($arg0)
-  print *RCLASS_EXT((struct RClass *)($arg0))
+  print *((struct RClass *)($arg0))->ptr
 end
 document rp_class
   Print the content of a Class/Module.
@@ -667,6 +678,11 @@ define nd_stts
 end
 
 
+define nd_entry
+  printf "%su3.entry%s: ", $color_highlite, $color_end
+  p ($arg0).u3.entry
+end
+
 define nd_vid
   printf "%su1.id%s: ", $color_highlite, $color_end
   p ($arg0).u1.id
@@ -682,6 +698,12 @@ define nd_cval
   rp ($arg0).u3.value
 end
 
+
+define nd_cnt
+  printf "%su3.cnt%s: ", $color_highlite, $color_end
+  p ($arg0).u3.cnt
+end
+
 define nd_tbl
   printf "%su1.tbl%s: ", $color_highlite, $color_end
   p ($arg0).u1.tbl
@@ -720,6 +742,12 @@ define nd_lit
   rp ($arg0).u1.value
 end
 
+
+define nd_frml
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
 define nd_rest
   printf "%su2.argc%s: ", $color_highlite, $color_end
   p ($arg0).u2.argc
@@ -746,6 +774,12 @@ define nd_args
   rp ($arg0).u3.node
 end
 
+
+define nd_noex
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
 define nd_defn
   printf "%su3.node%s: ", $color_highlite, $color_end
   rp ($arg0).u3.node
@@ -763,6 +797,17 @@ define nd_new
 end
 
 
+define nd_cfnc
+  printf "%su1.cfunc%s: ", $color_highlite, $color_end
+  p ($arg0).u1.cfunc
+end
+
+define nd_argc
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+
 define nd_cname
   printf "%su1.id%s: ", $color_highlite, $color_end
   p ($arg0).u1.id
@@ -841,22 +886,22 @@ define rb_numtable_entry
     set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
     while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
       if $rb_numtable_p.k == $rb_numtable_id
-        set $rb_numtable_key = $rb_numtable_p.k
-        set $rb_numtable_rec = $rb_numtable_p.v
-        set $rb_numtable_p = 0
+	set $rb_numtable_key = $rb_numtable_p.k
+	set $rb_numtable_rec = $rb_numtable_p.v
+	set $rb_numtable_p = 0
       else
-        set $rb_numtable_p = $rb_numtable_p + 1
+	set $rb_numtable_p = $rb_numtable_p + 1
       end
     end
   else
     set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
     while $rb_numtable_p
       if $rb_numtable_p->key == $rb_numtable_id
-        set $rb_numtable_key = $rb_numtable_p->key
-        set $rb_numtable_rec = $rb_numtable_p->record
-        set $rb_numtable_p = 0
+	set $rb_numtable_key = $rb_numtable_p->key
+	set $rb_numtable_rec = $rb_numtable_p->record
+	set $rb_numtable_p = 0
       else
-        set $rb_numtable_p = $rb_numtable_p->next
+	set $rb_numtable_p = $rb_numtable_p->next
       end
     end
   end
@@ -934,7 +979,7 @@ define iseq
       set $operand_size = ((INSN*)($arg0))->operand_size
       set $operands = ((INSN*)($arg0))->operands
       while $i < $operand_size
-        rp $operands[$i++]
+	rp $operands[$i++]
       end
     end
   end
@@ -952,8 +997,8 @@ end
 
 define rb_ps_vm
   print $ps_vm = (rb_vm_t*)$arg0
-  set $ps_thread_ln      = $ps_vm->ractor.main_ractor.threads.set.n.next
-  set $ps_thread_ln_last = $ps_vm->ractor.main_ractor.threads.set.n.prev
+  set $ps_thread_ln = $ps_vm->living_threads.n.next
+  set $ps_thread_ln_last = $ps_vm->living_threads.n.prev
   while 1
     set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
     set $ps_thread = (VALUE)($ps_thread_th->self)
@@ -976,55 +1021,24 @@ define print_lineno
     set $pos = $pos - 1
   end
 
-  set $index = 0
-  set $size = $iseq->body->insns_info.size
-  set $table = $iseq->body->insns_info.body
-  set $positions = $iseq->body->insns_info.positions
+  set $i = 0
+  set $size = $iseq->body->insns_info_size
+  set $table = $iseq->body->insns_info
   #printf "size: %d\n", $size
   if $size == 0
   else
-  if $size == 1
-    printf "%d", $table[0].line_no
-  else
-    if $positions
-      # get_insn_info_linear_search
-      set $index = 1
-      while $index < $size
-        #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $positions[$i], $table[$i].line_no, $pos
-        if $positions[$index] > $pos
-          loop_break
-        end
-        set $index = $index + 1
-        if $positions[$index] == $pos
-          loop_break
-        end
+    set $i = 1
+    while $i < $size
+      #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $table[$i].position, $table[$i].line_no, $pos
+      if $table[$i].position > $pos
+        loop_break
       end
-    else
-      # get_insn_info_succinct_bitvector
-      set $sd = $iseq->body->insns_info.succ_index_table
-      set $immediate_table_size = sizeof($sd->imm_part) / sizeof(uint64_t) * 9
-      if $pos < $immediate_table_size
-        set $i = $pos / 9
-        set $j = $pos % 9
-        set $index = ((int)($sd->imm_part[$i] >> ($j * 7))) & 0x7f
-      else
-        set $block_index = ($pos - $immediate_table_size) / 512
-        set $block = &$sd->succ_part[$block_index]
-        set $block_bit_index = ($pos - $immediate_table_size) % 512
-        set $small_block_index = $block_bit_index / 64
-        set $small_block_popcount = $small_block_index == 0 ? 0 : (((int)($block->small_block_ranks >> (($small_block_index - 1) * 9))) & 0x1ff)
-        set $x = $block->bits[$small_block_index] << (63 - $block_bit_index % 64)
-        set $x = ($x & 0x5555555555555555) + ($x >> 1 & 0x5555555555555555)
-        set $x = ($x & 0x3333333333333333) + ($x >> 2 & 0x3333333333333333)
-        set $x = ($x & 0x0707070707070707) + ($x >> 4 & 0x0707070707070707)
-        set $x = ($x & 0x001f001f001f001f) + ($x >> 8 & 0x001f001f001f001f)
-        set $x = ($x & 0x0000003f0000003f) + ($x >>16 & 0x0000003f0000003f)
-        set $popcnt = ($x & 0x7f) + ($x >>32 & 0x7f)
-        set $index = $block->rank + $small_block_popcount + $popcnt
+      set $i = $i + 1
+      if $table[$i].position == $pos
+        loop_break
       end
     end
-    printf "%d", $table[$index-1].line_no
-  end
+    printf "%d", $table[$i-1].line_no
   end
 end
 
@@ -1051,9 +1065,9 @@ define print_id
   else
     set $serial = (rb_id_serial_t)$id
   end
-  if $serial && $serial <= ruby_global_symbols.last_id
+  if $serial && $serial <= global_symbols.last_id
     set $idx = $serial / ID_ENTRY_UNIT
-    set $ids = (struct RArray *)ruby_global_symbols.ids
+    set $ids = (struct RArray *)global_symbols.ids
     set $flags = $ids->basic.flags
     if ($flags & RUBY_FL_USER1)
       set $idsptr = $ids->as.ary
@@ -1075,11 +1089,11 @@ define print_id
           set $arylen = $ary->as.heap.len
         end
         set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
-        if $result != RUBY_Qnil
+	if $result != RUBY_Qnil
           print_string $result
-        else
-          echo undef
-        end
+	else
+	  echo undef
+	end
       end
     end
   end
@@ -1104,7 +1118,7 @@ define rb_ps_thread
   set $ps_thread = (struct RTypedData*)$arg0
   set $ps_thread_th = (rb_thread_t*)$ps_thread->data
   printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
-    $ps_thread, $ps_thread_th, $ps_thread_th->nt
+    $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
   set $cfp = $ps_thread_th->ec->cfp
   set $cfpend = (rb_control_frame_t *)($ps_thread_th->ec->vm_stack + $ps_thread_th->ec->vm_stack_size)-1
   while $cfp < $cfpend
@@ -1252,9 +1266,9 @@ document rb_count_objects
   Counts all objects grouped by type.
 end
 
-# Details: https://github.com/ruby/ruby/wiki/Machine-Instructions-Trace-with-GDB
+# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
 define trace_machine_instructions
-  set logging enabled
+  set logging on
   set height 0
   set width 0
   display/i $pc
@@ -1289,40 +1303,5 @@ define dump_node
   set $flags = ((struct RBasic*)($str))->flags
   printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
                         ((struct RString*)$str)->as.heap.ptr : \
-                        ((struct RString*)$str)->as.embed.ary)
-end
-
-define print_flags
-  printf "RUBY_FL_WB_PROTECTED: %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_WB_PROTECTED ? "1" : "0"
-  printf "RUBY_FL_PROMOTED0   : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED0 ? "1" : "0"
-  printf "RUBY_FL_PROMOTED1   : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED1 ? "1" : "0"
-  printf "RUBY_FL_FINALIZE    : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FINALIZE ? "1" : "0"
-  printf "RUBY_FL_SHAREABLE   : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_SHAREABLE ? "1" : "0"
-  printf "RUBY_FL_EXIVAR      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_EXIVAR ? "1" : "0"
-  printf "RUBY_FL_FREEZE      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FREEZE ? "1" : "0"
-
-  printf "RUBY_FL_USER0       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER0 ? "1" : "0"
-  printf "RUBY_FL_USER1       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER1 ? "1" : "0"
-  printf "RUBY_FL_USER2       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER2 ? "1" : "0"
-  printf "RUBY_FL_USER3       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER3 ? "1" : "0"
-  printf "RUBY_FL_USER4       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER4 ? "1" : "0"
-  printf "RUBY_FL_USER5       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER5 ? "1" : "0"
-  printf "RUBY_FL_USER6       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER6 ? "1" : "0"
-  printf "RUBY_FL_USER7       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER7 ? "1" : "0"
-  printf "RUBY_FL_USER8       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER8 ? "1" : "0"
-  printf "RUBY_FL_USER9       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER9 ? "1" : "0"
-  printf "RUBY_FL_USER10      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER10 ? "1" : "0"
-  printf "RUBY_FL_USER11      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER11 ? "1" : "0"
-  printf "RUBY_FL_USER12      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER12 ? "1" : "0"
-  printf "RUBY_FL_USER13      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER13 ? "1" : "0"
-  printf "RUBY_FL_USER14      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER14 ? "1" : "0"
-  printf "RUBY_FL_USER15      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER15 ? "1" : "0"
-  printf "RUBY_FL_USER16      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER16 ? "1" : "0"
-  printf "RUBY_FL_USER17      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER17 ? "1" : "0"
-  printf "RUBY_FL_USER18      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER18 ? "1" : "0"
-end
-
-source -s misc/gdb.py
-
-# Moved from beginning, since it fails on older gdbs
-set startup-with-shell off
+                        ((struct RString*)$str)->as.ary)
+end
diff --git a/.git-blame-ignore-revs b/.git-blame-ignore-revs
deleted file mode 100644
index de62eb432a..0000000000
--- a/.git-blame-ignore-revs
+++ /dev/null
@@ -1,36 +0,0 @@
-# This is a file used by GitHub to ignore the following commits on `git blame`.
-#
-# You can also do the same thing in your local repository with:
-# $ git config --local blame.ignoreRevsFile .git-blame-ignore-revs
-
-# Expand tabs
-5b21e94bebed90180d8ff63dad03b8b948361089
-c5e9af9c9d890578182a21e7b71b50334cd5579e
-e63a2115f64433b21cb5dd67c5bf8b30f87ef293
-712ac99e4d0384a941c80a9f48f62943ba7d97c0
-d1474affa8e105bece209cc9d594bb0a989859e1
-2da92388b948821269b18d6b178a680f17e41750
-
-# Enable Style/StringLiterals cop for RubyGems/Bundler
-d7ffd3fea402239b16833cc434404a7af82d44f3
-
-# [ruby/digest] Revert tab-expansion in external files
-48b09aae7ec5632209229dcc294dd0d75a93a17f
-8a65cf3b61c60e4cb886f59a73ff6db44364bfa9
-39dc9f9093901d40d2998653948d5da38b18ee2c
-
-# [ruby/io-nonblock] Revert tab expansion
-f28287d34c03f472ffe90ea262bdde9affd4b965
-0d842fecb4f75ab3b1d4097ebdb8e88f51558041
-4ba2c66761d6a293abdfba409241d31063cefd62
-
-# Make benchmark indentation consistent
-fc4acf8cae82e5196186d3278d831f2438479d91
-
-# Make prism_compile.c indentation consistent
-40b2c8e5e7e6e5f83cee9276dc9c1922a69292d6
-d2c5867357ed88eccc28c2b3bd4a46e206e7ff85
-
-# Miss-and-revived commits
-a0f7de814ae5c299d6ce99bed5fb308a05d50ba0
-d4e24021d39e1f80f0055b55d91f8d5f22e15084
diff --git a/.gitattributes b/.gitattributes
index d0c2d266b4..6ca2f89462 100644
--- a/.gitattributes
+++ b/.gitattributes
@@ -4,5 +4,3 @@ bin svn-properties=svn:ignore=ruby
 bin/* diff=ruby
 tool/update-deps diff=ruby
 tool/make-snapshot diff=ruby
-tool/format-release diff=ruby
-tool/leaked-globals diff=ruby
diff --git a/.github/CODEOWNERS b/.github/CODEOWNERS
deleted file mode 100644
index d3650266bb..0000000000
--- a/.github/CODEOWNERS
+++ /dev/null
@@ -1 +0,0 @@
-* @k0kubun
diff --git a/.github/SECURITY.md b/.github/SECURITY.md
deleted file mode 100644
index 56baa29942..0000000000
--- a/.github/SECURITY.md
+++ /dev/null
@@ -1,9 +0,0 @@
-# Security Policy
-
-## Supported Versions
-
-See <https://www.ruby-lang.org/en/downloads/branches/>.
-
-## Reporting a Vulnerability
-
-See <https://www.ruby-lang.org/en/security/>.
diff --git a/.github/actions/compilers/action.yml b/.github/actions/compilers/action.yml
deleted file mode 100644
index ff060ce2e0..0000000000
--- a/.github/actions/compilers/action.yml
+++ /dev/null
@@ -1,125 +0,0 @@
-name: Compiles ruby in a container
-description: >-
-  Makes ruby using a dedicated container
-
-inputs:
-  tag:
-    required: false
-    default: clang-18
-    description: >-
-      container image tag to use in this run.
-
-  with_gcc:
-    required: false
-    description: >-
-      override compiler path & flags.
-
-  CFLAGS:
-    required: false
-    description: >-
-      C compiler flags to override.
-
-  CXXFLAGS:
-    required: false
-    description: >-
-      C++ compiler flags to override.
-
-  optflags:
-    required: false
-    # -O1 is faster than -O3 in our tests... Majority of time are consumed trying
-    # to optimize binaries.  Also GitHub Actions run on relatively modern CPUs
-    # compared to, say, GCC 4 or Clang 3.  We don't specify `-march=native`
-    # because compilers tend not understand what the CPU is.
-    default: '-O1'
-    description: >-
-      Compiler flags for optimisations.
-
-  cppflags:
-    required: false
-    description: >-
-      Additional preprocessor flags.
-
-  append_configure:
-    required: false
-    default: >-
-      --without-valgrind
-      --without-jemalloc
-      --without-gmp
-    description: >-
-      flags to append to configure.
-
-  enable_shared:
-    required: false
-    default: true
-    description: >-
-      Whether to build libruby.so.
-
-  check:
-    required: false
-    default: ''
-    description: >-
-      Whether to run `make check`
-
-  mspecopt:
-    required: false
-    default: ''
-    description: >-
-      Additional options for mspec.
-
-  static_exts:
-    required: false
-    description: >-
-      whitespace separated list of extensions that need be linked statically.
-
-runs:
-  using: composite
-  steps:
-    - shell: bash
-      run: docker pull --quiet 'ghcr.io/ruby/ruby-ci-image:${{ inputs.tag }}'
-
-    - name: Enable Launchable conditionally
-      id: enable-launchable
-      run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
-      shell: bash
-      if: >-
-        ${{
-        github.repository == 'ruby/ruby' ||
-        (github.repository != 'ruby/ruby' && env.LAUNCHABLE_TOKEN)
-        }}
-
-    - name: compile
-      shell: bash
-      run: >-
-        docker run
-        --rm
-        --user=root
-        --volume '${{ github.workspace }}:/github/workspace:ro'
-        --workdir=/github/workspace
-        --entrypoint=/github/workspace/.github/actions/compilers/entrypoint.sh
-        --env CI
-        --env GITHUB_ACTION
-        --env INPUT_WITH_GCC='${{ inputs.with_gcc || inputs.tag }}'
-        --env INPUT_CFLAGS='${{ inputs.CFLAGS }}'
-        --env INPUT_CXXFLAGS='${{ inputs.CXXFLAGS }}'
-        --env INPUT_OPTFLAGS='${{ inputs.OPTFLAGS }}'
-        --env INPUT_CPPFLAGS='${{ inputs.cppflags }}'
-        --env INPUT_APPEND_CONFIGURE='${{ inputs.append_configure }}'
-        --env INPUT_CHECK='${{ inputs.check }}'
-        --env INPUT_MSPECOPT='${{ inputs.mspecopt }}'
-        --env INPUT_ENABLE_SHARED='${{ inputs.enable_shared }}'
-        --env INPUT_STATIC_EXTS='${{ inputs.static_exts }}'
-        --env LAUNCHABLE_ORGANIZATION='${{ github.repository_owner }}'
-        --env LAUNCHABLE_WORKSPACE='${{ github.event.repository.name }}'
-        --env LAUNCHABLE_ENABLED='${{ steps.enable-launchable.outputs.enable-launchable || false }}'
-        --env GITHUB_PR_HEAD_SHA='${{ github.event.pull_request.head.sha || github.sha }}'
-        --env GITHUB_PULL_REQUEST_URL='${{ github.event.pull_request.html_url }}'
-        --env GITHUB_REF='${{ github.ref }}'
-        --env GITHUB_ACTIONS
-        --env GITHUB_RUN_ID
-        --env GITHUB_REPOSITORY
-        --env GITHUB_WORKFLOW
-        --env GITHUB_RUN_NUMBER
-        --env GITHUB_EVENT_NAME
-        --env GITHUB_SHA
-        --env GITHUB_HEAD_REF
-        'ghcr.io/ruby/ruby-ci-image:${{ inputs.tag }}'
diff --git a/.github/actions/compilers/entrypoint.sh b/.github/actions/compilers/entrypoint.sh
deleted file mode 100755
index cc8e6e4b23..0000000000
--- a/.github/actions/compilers/entrypoint.sh
+++ /dev/null
@@ -1,164 +0,0 @@
-#! /bin/bash
-
-# Copyright (c) 2024 Ruby developers.  All rights reserved.
-#
-# This file is  a part of the programming language  Ruby.  Permission is hereby
-# granted, to  either redistribute and/or  modify this file, provided  that the
-# conditions  mentioned in  the file  COPYING are  met.  Consult  the file  for
-# details.
-
-grouped()
-{
-    echo "::group::${@}"
-    "${@}"
-    echo "::endgroup::"
-}
-
-set -e
-set -u
-set -o pipefail
-
-srcdir="/github/workspace/src"
-builddir="$(mktemp -dt)"
-
-export GITHUB_WORKFLOW='Compilations'
-export CONFIGURE_TTY='never'
-export RUBY_DEBUG='ci rgengc'
-export RUBY_TESTOPTS='-q --color=always --tty=no'
-export RUBY_DEBUG_COUNTER_DISABLE='1'
-export GNUMAKEFLAGS="-j$((1 + $(nproc --all)))"
-
-case "x${INPUT_ENABLE_SHARED}" in
-x | xno | xfalse )
-    enable_shared='--disable-shared'
-    ;;
-*)
-    enable_shared='--enable-shared'
-    ;;
-esac
-
-pushd ${builddir}
-
-grouped git config --global --add safe.directory ${srcdir}
-
-grouped ${srcdir}/configure        \
-    -C                             \
-    --with-gcc="${INPUT_WITH_GCC}" \
-    --enable-debug-env             \
-    --disable-install-doc          \
-    --with-ext=-test-/cxxanyargs,+ \
-    ${enable_shared}               \
-    ${INPUT_APPEND_CONFIGURE}      \
-    CFLAGS="${INPUT_CFLAGS}"       \
-    CXXFLAGS="${INPUT_CXXFLAGS}"   \
-    optflags="${INPUT_OPTFLAGS}"   \
-    cppflags="${INPUT_CPPFLAGS}"   \
-    debugflags='-ggdb3' # -g0 disables backtraces when SEGV.  Do not set that.
-
-popd
-
-if [[ -n "${INPUT_STATIC_EXTS}" ]]; then
-    echo "::group::ext/Setup"
-    set -x
-    mkdir ${builddir}/ext
-    (
-        for ext in ${INPUT_STATIC_EXTS}; do
-            echo "${ext}"
-        done
-    ) >> ${builddir}/ext/Setup
-    set +x
-    echo "::endgroup::"
-fi
-
-btests=''
-tests=''
-spec_opts=''
-
-# Launchable
-setup_launchable() {
-    pushd ${srcdir}
-    # Launchable creates .launchable file in the current directory, but cannot a file to ${srcdir} directory.
-    # As a workaround, we set LAUNCHABLE_SESSION_DIR to ${builddir}.
-    export LAUNCHABLE_SESSION_DIR=${builddir}
-    local github_ref="${GITHUB_REF//\//_}"
-    local build_name="${github_ref}"_"${GITHUB_PR_HEAD_SHA}"
-    btest_report_path='launchable_bootstraptest.json'
-    test_report_path='launchable_test_all.json'
-    test_spec_report_path='launchable_test_spec_report'
-    test_all_session_file='launchable_test_all_session.txt'
-    btest_session_file='launchable_btest_session.txt'
-    test_spec_session_file='launchable_test_spec_session.txt'
-    btests+=--launchable-test-reports="${btest_report_path}"
-    echo "::group::Setup Launchable"
-    launchable record build --name "${build_name}" || true
-    launchable record session \
-        --build "${build_name}" \
-        --flavor test_task=test \
-        --flavor workflow=Compilations \
-        --flavor with-gcc="${INPUT_WITH_GCC}" \
-        --flavor CFLAGS="${INPUT_CFLAGS}" \
-        --flavor CXXFLAGS="${INPUT_CXXFLAGS}" \
-        --flavor optflags="${INPUT_OPTFLAGS}" \
-        --flavor cppflags="${INPUT_CPPFLAGS}" \
-        --test-suite btest \
-        > "${builddir}"/${btest_session_file}
-    if [ "$INPUT_CHECK" = "true" ]; then
-        tests+=--launchable-test-reports="${test_report_path}"
-        launchable record session \
-            --build "${build_name}" \
-            --flavor test_task=test-all \
-            --flavor workflow=Compilations \
-            --flavor with-gcc="${INPUT_WITH_GCC}" \
-            --flavor CFLAGS="${INPUT_CFLAGS}" \
-            --flavor CXXFLAGS="${INPUT_CXXFLAGS}" \
-            --flavor optflags="${INPUT_OPTFLAGS}" \
-            --flavor cppflags="${INPUT_CPPFLAGS}" \
-            --test-suite test-all \
-            > "${builddir}"/${test_all_session_file}
-        mkdir "${builddir}"/"${test_spec_report_path}"
-        spec_opts+=--launchable-test-reports="${test_spec_report_path}"
-        launchable record session \
-            --build "${build_name}" \
-            --flavor test_task=test-spec \
-            --flavor workflow=Compilations \
-            --flavor with-gcc="${INPUT_WITH_GCC}" \
-            --flavor CFLAGS="${INPUT_CFLAGS}" \
-            --flavor CXXFLAGS="${INPUT_CXXFLAGS}" \
-            --flavor optflags="${INPUT_OPTFLAGS}" \
-            --flavor cppflags="${INPUT_CPPFLAGS}" \
-            --test-suite test-spec \
-            > "${builddir}"/${test_spec_session_file}
-    fi
-    echo "::endgroup::"
-    trap launchable_record_test EXIT
-}
-launchable_record_test() {
-    pushd "${builddir}"
-    grouped launchable record tests --session "$(cat "${btest_session_file}")" raw "${btest_report_path}" || true
-    if [ "$INPUT_CHECK" = "true" ]; then
-        grouped launchable record tests --session "$(cat "${test_all_session_file}")" raw "${test_report_path}" || true
-        grouped launchable record tests --session "$(cat "${test_spec_session_file}")" raw "${test_spec_report_path}"/* || true
-    fi
-}
-if [ "$LAUNCHABLE_ENABLED" = "true" ]; then
-    setup_launchable
-fi
-
-pushd ${builddir}
-
-grouped make showflags
-grouped make all
-grouped make test BTESTS="${btests}"
-
-[[ -z "${INPUT_CHECK}" ]] && exit 0
-
-if [ "$INPUT_CHECK" = "true" ]; then
-  tests+=" -- ruby -ext-"
-else
-  tests+=" -- $INPUT_CHECK"
-fi
-
-# grouped make install
-grouped make test-tool
-grouped make test-all TESTS="$tests"
-grouped env CHECK_LEAKS=true make test-spec MSPECOPT="$INPUT_MSPECOPT" SPECOPTS="${spec_opts}"
diff --git a/.github/actions/launchable/setup/action.yml b/.github/actions/launchable/setup/action.yml
deleted file mode 100644
index 164eb1db5d..0000000000
--- a/.github/actions/launchable/setup/action.yml
+++ /dev/null
@@ -1,274 +0,0 @@
-name: Set up Launchable
-description: >-
-  Install the required dependencies and execute the necessary Launchable commands for test recording
-
-inputs:
-  os:
-    required: true
-    description: The operating system that CI runs on. This value is used in Launchable flavor.
-
-  test-opts:
-    default: none
-    required: false
-    description: >-
-      Test options that determine how tests are run.
-      This value is used in the Launchable flavor.
-
-  launchable-token:
-    required: false
-    description: >-
-      Launchable token is needed if you want to run Launchable on your forked repository.
-      See https://github.com/ruby/ruby/wiki/CI-Servers#launchable-ci for details.
-
-  builddir:
-    required: false
-    default: ${{ github.workspace }}
-    description: >-
-      Directory to create Launchable report file.
-
-  srcdir:
-    required: false
-    default: ${{ github.workspace }}
-    description: >-
-      Directory to (re-)checkout source codes. Launchable retrieves the commit information
-      from the directory.
-
-  test-task:
-    required: false
-    default: ${{ matrix.test_task }}
-    description: >-
-      Specifies a single test task to be executed.
-      This value is used in the Launchable flavor.
-      Either 'test-task' or 'multi-test-tasks' must be configured.
-
-  test-tasks:
-    required: false
-    default: '[]'
-    description: >-
-      Specifies an array of multiple test tasks to be executed.
-      For example: '["test", "test-all"]'.
-      If you want to run a single test task, use the 'test-task' input instead.
-
-  is-yjit:
-    required: false
-    default: 'false'
-    description: >-
-      Whether this workflow is executed on YJIT.
-
-runs:
-  using: composite
-
-  steps:
-    - name: Enable Launchable conditionally
-      id: enable-launchable
-      run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
-      shell: bash
-      if: >-
-        ${{
-        (github.repository == 'ruby/ruby'
-          || (github.repository != 'ruby/ruby'
-          && env.LAUNCHABLE_TOKEN))
-        && (inputs.test-task == 'check'
-          || inputs.test-task == 'test-all'
-          || inputs.test-task == 'test'
-          || contains(fromJSON(inputs.test-tasks), 'test-all')
-          || contains(fromJSON(inputs.test-tasks), 'test'))
-        }}
-
-    # Launchable CLI requires Python and Java.
-    # https://www.launchableinc.com/docs/resources/cli-reference/
-    - name: Set up Python
-      uses: actions/setup-python@871daa956ca9ea99f3c3e30acb424b7960676734 # v5.0.0
-      with:
-        python-version: "3.x"
-      if: steps.enable-launchable.outputs.enable-launchable
-
-    - name: Set up Java
-      uses: actions/setup-java@7a445ee88d4e23b52c33fdc7601e40278616c7f8 # v4.0.0
-      with:
-        distribution: 'temurin'
-        java-version: '17'
-      if: steps.enable-launchable.outputs.enable-launchable
-
-    - name: Set global vars
-      id: global
-      shell: bash
-      run: |
-        test_all_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test-all' || contains(fromJSON(inputs.test-tasks), 'test-all') }}"
-        btest_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test' || contains(fromJSON(inputs.test-tasks), 'test') }}"
-        test_spec_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test-spec' || contains(fromJSON(inputs.test-tasks), 'test-spec') }}"
-        echo test_all_enabled="${test_all_enabled}" >> $GITHUB_OUTPUT
-        echo btest_enabled="${btest_enabled}" >> $GITHUB_OUTPUT
-        echo test_spec_enabled="${test_spec_enabled}" >> $GITHUB_OUTPUT
-        echo test_all_session_file='launchable_test_all_session.txt' >> $GITHUB_OUTPUT
-        echo btest_session_file='launchable_btest_session.txt' >> $GITHUB_OUTPUT
-        echo test_spec_session_file='launchable_test_spec_session.txt' >> $GITHUB_OUTPUT
-        echo test_all_report_file='launchable_test_all_report.json' >> $GITHUB_OUTPUT
-        echo btest_report_file='launchable_btest_report.json' >> $GITHUB_OUTPUT
-        echo test_spec_report_dir='launchable_test_spec_report' >> $GITHUB_OUTPUT
-      if: steps.enable-launchable.outputs.enable-launchable
-
-    - name: Set environment variables for Launchable
-      shell: bash
-      run: |
-        : # GITHUB_PULL_REQUEST_URL are used for commenting test reports in Launchable Github App.
-        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/link.py#L42
-        echo "GITHUB_PULL_REQUEST_URL=${{ github.event.pull_request.html_url }}" >> $GITHUB_ENV
-        : # The following envs are necessary in Launchable tokenless authentication.
-        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L20
-        echo "LAUNCHABLE_ORGANIZATION=${{ github.repository_owner }}" >> $GITHUB_ENV
-        echo "LAUNCHABLE_WORKSPACE=${{ github.event.repository.name }}" >> $GITHUB_ENV
-        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L71
-        echo "GITHUB_PR_HEAD_SHA=${{ github.event.pull_request.head.sha || github.sha }}" >> $GITHUB_ENV
-        echo "LAUNCHABLE_TOKEN=${{ inputs.launchable-token }}" >> $GITHUB_ENV
-      if: steps.enable-launchable.outputs.enable-launchable
-
-    - name: Set up path
-      shell: bash
-      working-directory: ${{ inputs.srcdir }}
-      # Since updated PATH variable will be available in only subsequent actions, we need to add the path beforehand.
-      # https://docs.github.com/en/actions/using-workflows/workflow-commands-for-github-actions#adding-a-system-path
-      run: echo "$(python -msite --user-base)/bin" >> $GITHUB_PATH
-      if: steps.enable-launchable.outputs.enable-launchable && startsWith(inputs.os, 'macos')
-
-    - name: Set up Launchable
-      shell: bash
-      working-directory: ${{ inputs.srcdir }}
-      run: |
-        set -x
-        pip install --user launchable
-        : # The build name cannot include a slash, so we replace the string here.
-        github_ref="${{ github.ref }}"
-        github_ref="${github_ref//\//_}"
-        : # With the --name option, we need to configure a unique identifier for this build.
-        : # To avoid setting the same build name as the CI which runs on other branches, we use the branch name here.
-        build_name="${github_ref}_${GITHUB_PR_HEAD_SHA}"
-        test_opts="${{ inputs.test-opts }}"
-        test_opts="${test_opts// /}"
-        test_opts="${test_opts//=/:}"
-        test_all_test_suite='test-all'
-        btest_test_suite='btest'
-        test_spec_test_suite='test-spec'
-        if [ "${{ inputs.is-yjit }}" = "true" ]; then
-          test_all_test_suite="yjit-${test_all_test_suite}"
-          btest_test_suite="yjit-${btest_test_suite}"
-          test_spec_test_suite="yjit-${test_spec_test_suite}"
-        fi
-        launchable record build --name "${build_name}"
-        if [ "${test_all_enabled}" = "true" ]; then
-          launchable record session \
-            --build "${build_name}" \
-            --flavor os=${{ inputs.os }} \
-            --flavor test_task=${{ inputs.test-task }} \
-            --flavor test_opts=${test_opts} \
-            --test-suite ${test_all_test_suite} \
-            > "${test_all_session_file}"
-          echo "TESTS=${TESTS} --launchable-test-reports=${test_all_report_file}" >> $GITHUB_ENV
-        fi
-        if [ "${btest_enabled}" = "true" ]; then
-          launchable record session \
-            --build "${build_name}" \
-            --flavor os=${{ inputs.os }} \
-            --flavor test_task=${{ inputs.test-task }} \
-            --flavor test_opts=${test_opts} \
-            --test-suite ${btest_test_suite} \
-            > "${btest_session_file}"
-          echo "BTESTS=${BTESTS} --launchable-test-reports=${btest_report_file}" >> $GITHUB_ENV
-        fi
-        if [ "${test_spec_enabled}" = "true" ]; then
-          launchable record session \
-            --build "${build_name}" \
-            --flavor os=${{ inputs.os }} \
-            --flavor test_task=${{ inputs.test-task }} \
-            --flavor test_opts=${test_opts} \
-            --test-suite ${test_spec_test_suite} \
-            > "${test_spec_session_file}"
-          echo "SPECOPTS=${SPECOPTS} --launchable-test-reports=${test_spec_report_dir}" >> $GITHUB_ENV
-        fi
-      if: steps.enable-launchable.outputs.enable-launchable
-      env:
-        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
-        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
-        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
-        test_all_session_file: ${{ steps.global.outputs.test_all_session_file }}
-        btest_session_file: ${{ steps.global.outputs.btest_session_file }}
-        test_spec_session_file: ${{ steps.global.outputs.test_spec_session_file }}
-        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
-        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
-        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
-
-    - name: Variables to report Launchable
-      id: variables
-      shell: bash
-      working-directory: ${{ inputs.srcdir }}
-      run: |
-        set -x
-        : # report-path from srcdir
-        if [ "${srcdir}" = "${{ github.workspace }}" ]; then
-          dir=
-        else
-          # srcdir must be equal to or under workspace
-          dir=$(echo ${srcdir:+${srcdir}/} | sed 's:[^/][^/]*/:../:g')
-        fi
-        if [ "${test_all_enabled}" = "true" ]; then
-          test_report_path="${dir}${builddir:+${builddir}/}${test_all_report_file}"
-          echo test_report_path="${test_report_path}" >> $GITHUB_OUTPUT
-        fi
-        if [ "${btest_enabled}" = "true" ]; then
-          btest_report_path="${dir}${builddir:+${builddir}/}${btest_report_file}"
-          echo btest_report_path="${btest_report_path}" >> $GITHUB_OUTPUT
-        fi
-        if [ "${test_spec_enabled}" = "true" ]; then
-          test_spec_report_path="${dir}${builddir:+${builddir}/}${test_spec_report_dir}"
-          mkdir "${test_spec_report_path}"
-          echo test_spec_report_path="${test_spec_report_path}" >> $GITHUB_OUTPUT
-        fi
-      if: steps.enable-launchable.outputs.enable-launchable
-      env:
-        srcdir: ${{ inputs.srcdir }}
-        builddir: ${{ inputs.builddir }}
-        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
-        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
-        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
-        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
-        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
-        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
-
-    - name: Record test results in Launchable
-      uses: gacts/run-and-post-run@674528335da98a7afc80915ff2b4b860a0b3553a # v1.4.0
-      with:
-        shell: bash
-        working-directory: ${{ inputs.srcdir }}
-        post: |
-          [[ "${test_all_enabled}" = "true" ]] && \
-            launchable record tests \
-              --session "$(cat "${test_all_session_file}")" \
-              raw "${test_report_path}" || true
-
-          [[ "${btest_enabled}" = "true" ]] && \
-            launchable record tests \
-              --session "$(cat "${btest_session_file}")" \
-              raw "${btest_report_path}" || true
-
-          [[ "${test_spec_enabled}" = "true" ]] && \
-            launchable record tests \
-              --session "$(cat "${test_spec_session_file}")" \
-              raw ${test_spec_report_path}/* || true
-
-          rm -f "${test_all_session_file}"
-          rm -f "${btest_session_file}"
-          rm -f "${test_spec_session_file}"
-          rm -f "${test_report_path}"
-          rm -f "${btest_report_path}"
-          rm -fr "${test_spec_report_path}"
-      if: ${{ always() && steps.enable-launchable.outputs.enable-launchable }}
-      env:
-        test_report_path: ${{ steps.variables.outputs.test_report_path }}
-        btest_report_path: ${{ steps.variables.outputs.btest_report_path }}
-        test_spec_report_path: ${{ steps.variables.outputs.test_spec_report_path }}
-        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
-        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
-        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
-        test_all_session_file: ${{ steps.global.outputs.test_all_session_file }}
-        btest_session_file: ${{ steps.global.outputs.btest_session_file }}
-        test_spec_session_file: ${{ steps.global.outputs.test_spec_session_file }}
diff --git a/.github/actions/setup/directories/action.yml b/.github/actions/setup/directories/action.yml
deleted file mode 100644
index 6cc66407a3..0000000000
--- a/.github/actions/setup/directories/action.yml
+++ /dev/null
@@ -1,178 +0,0 @@
-name: Setup directories etc.
-description: >-
-  Set up the source code and build directories (plus some
-  environmental tweaks)
-
-inputs:
-  srcdir:
-    required: false
-    default: ${{ github.workspace }}
-    description: >-
-      Directory to (re-)checkout source codes.  This will be created
-      if absent.  If there is no `configure` file that is also
-      generated inside.
-
-  builddir:
-    required: false
-    default: ${{ github.workspace }}
-    description: >-
-      Where binaries and other generated contents go.  This will be
-      created if absent.
-
-  makeup:
-    required: false
-    type: boolean
-    # Note that `default: false` evaluates to a string constant
-    # `'false'`, which is a truthy value :sigh:
-    # https://github.com/actions/runner/issues/2238
-    default: ''
-    description: >-
-      If set to true, additionally runs `make up`.
-
-  checkout:
-    required: false
-    type: boolean
-    default: true
-    description: >-
-      If set to '' (false), skip running actions/checkout. This is useful when
-      you don't want to overwrite a GitHub token that is already set up.
-
-  dummy-files:
-    required: false
-    type: boolean
-    default: ''
-    description: >-
-      If set to true, creates dummy files in build dir.
-
-  fetch-depth:
-    required: false
-    default: '1'
-    description: The depth of commit history fetched from the remote repository
-
-  clean:
-    required: false
-    type: boolean
-    default: ''
-    description: >-
-      If set to true, clean build directory.
-
-outputs: {} # nothing?
-
-runs:
-  using: composite
-
-  steps:
-    # Note that `shell: bash` works on both Windows and Linux, but not
-    # `shell: sh`.  This is because GitHub hosted Windows runners have
-    # their bash manually installed.
-    - shell: bash
-      run: |
-        mkdir -p ${{ inputs.srcdir }}
-        mkdir -p ${{ inputs.builddir }}
-
-    # Did you know that actions/checkout works without git(1)?  We are
-    # checking that here.
-    - id: which
-      shell: bash
-      run: |
-        echo "git=`command -v git`" >> "$GITHUB_OUTPUT"
-        echo "sudo=`command -v sudo`" >> "$GITHUB_OUTPUT"
-        echo "autoreconf=`command -v autoreconf`" >> "$GITHUB_OUTPUT"
-
-    - if: steps.which.outputs.git
-      shell: bash
-      run: |
-        git config --global core.autocrlf false
-        git config --global core.eol lf
-        git config --global advice.detachedHead 0
-        git config --global init.defaultBranch garbage
-
-    - if: inputs.checkout
-      uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-      with:
-        path: ${{ inputs.srcdir }}
-        fetch-depth: ${{ inputs.fetch-depth }}
-
-    - uses: actions/cache@1bd1e32a3bdc45362d1e726936510720a7c30a57 # v4.2.0
-      with:
-        path: ${{ inputs.srcdir }}/.downloaded-cache
-        key: downloaded-cache
-
-    - if: steps.which.outputs.autoreconf
-      shell: bash
-      working-directory: ${{ inputs.srcdir }}
-      run: ./autogen.sh --install
-
-    # This is for MinGW.
-    - if: runner.os == 'Windows'
-      shell: bash
-      run: echo "GNUMAKEFLAGS=-j$((2 * NUMBER_OF_PROCESSORS))" >> $GITHUB_ENV
-
-    - if: runner.os == 'Linux'
-      shell: bash
-      run: echo "GNUMAKEFLAGS=-sj$((1 + $(nproc --all)))" >> "$GITHUB_ENV"
-
-    # macOS' GNU make is so old that they doesn't understand `GNUMAKEFLAGS`.
-    - if: runner.os == 'macOS'
-      shell: bash
-      run: echo "MAKEFLAGS=-j$((1 + $(sysctl -n hw.activecpu)))" >> "$GITHUB_ENV"
-
-    - if: inputs.makeup
-      shell: bash
-      working-directory: ${{ inputs.srcdir }}
-      run: |
-        touch config.status .rbconfig.time
-        for mk in Makefile GNUmakefile; do
-          sed -f tool/prereq.status template/$mk.in > $mk
-        done
-        make up
-
-    # Cleanup, runs even on failure
-    - if: always() && inputs.makeup
-      shell: bash
-      working-directory: ${{ inputs.srcdir }}
-      run: |
-        rm -f config.status .rbconfig.time \
-          Makefile GNUmakefile uncommon.mk enc.mk noarch-fake.rb
-
-    - if: steps.which.outputs.sudo
-      shell: bash
-      run: |
-        sudo chmod -R go-w /usr/share
-        chmod -v go-w $HOME $HOME/.config || :
-        SAVE_IFS="$IFS" IFS=:; set $PATH; dirs=() IFS="$SAVE_IFS"
-        for d do [ ! -d "$d" ] || dirs+=("$d"); done
-        sudo chmod -v go-w "${dirs[@]}" || :
-
-    - if: inputs.dummy-files == 'true'
-      shell: bash
-      id: dummy-files
-      working-directory: ${{ inputs.builddir }}
-      run: |
-        : Create dummy files in build dir
-        set {{a..z},{A..Z},{0..9},foo,bar,test,zzz}.rb
-        for file; do \
-          echo > $file "raise 'do not load $file'"; \
-        done
-        # drop {a..z}.rb if case-insensitive filesystem
-        grep -F A.rb a.rb > /dev/null && set "${@:27}"
-        echo clean="cd ${{ inputs.builddir }} && rm $*" >> $GITHUB_OUTPUT
-
-    - if: inputs.clean == 'true'
-      shell: bash
-      id: clean
-      run: |
-        echo distclean='make -C ${{ inputs.builddir }} distclean' >> $GITHUB_OUTPUT
-        echo remained-files='find ${{ inputs.builddir }} -ls' >> $GITHUB_OUTPUT
-        [ "${{ inputs.builddir }}" = "${{ inputs.srcdir }}" ] ||
-        echo final='rmdir ${{ inputs.builddir }}' >> $GITHUB_OUTPUT
-
-    - name: clean
-      uses: gacts/run-and-post-run@4683764dd706df847f57b9bed39d08164bcd2690 # v1.4.1
-      with:
-        working-directory:
-        post: |
-          ${{ steps.dummy-files.outputs.clean }}
-          ${{ steps.clean.outputs.distclean }}
-          ${{ steps.clean.outputs.remained-files }}
-          ${{ steps.clean.outputs.final }}
diff --git a/.github/actions/setup/macos/action.yml b/.github/actions/setup/macos/action.yml
deleted file mode 100644
index 5da7c6d44c..0000000000
--- a/.github/actions/setup/macos/action.yml
+++ /dev/null
@@ -1,29 +0,0 @@
-name: Setup macOS environment
-description: >-
-  Installs necessary packages via Homebrew.
-
-inputs: {} # nothing?
-
-outputs: {} # nothing?
-
-runs:
-  using: composite
-
-  steps:
-    - name: brew
-      shell: bash
-      run: |
-        brew install --quiet jemalloc gmp libffi openssl@3 zlib autoconf automake libtool
-
-    - name: Set ENV
-      shell: bash
-      run: |
-        dir_config() {
-          local args=() lib var="$1"; shift
-          for lib in "$@"; do
-            args+="--with-${lib%@*}-dir=$(brew --prefix $lib)"
-          done
-          echo "$var=${args[*]}" >> $GITHUB_ENV
-        }
-        dir_config ruby_configure_args gmp
-        dir_config CONFIGURE_ARGS openssl@3
diff --git a/.github/actions/setup/ubuntu/action.yml b/.github/actions/setup/ubuntu/action.yml
deleted file mode 100644
index a9e5b41951..0000000000
--- a/.github/actions/setup/ubuntu/action.yml
+++ /dev/null
@@ -1,53 +0,0 @@
-name: Setup ubuntu environment
-description: >-
-  At the beginning there was no way but to copy & paste `apt-get`
-  everywhere.  But now that we have composite actions, it seems better
-  merge them into one.
-
-inputs:
-  arch:
-    required: false
-    default: ''
-    description: >-
-      Architecture.  Because we run this on a GitHub-hosted runner
-      acceptable value for this input is very limited.
-
-outputs:
-  arch:
-    value: ${{ steps.uname.outputs.uname }}
-    description: >-
-      Actual architecture.  This could be different from the one
-      passed to the `inputs.arch`.  For instance giving `i386` to this
-      action yields `i686`.
-
-runs:
-  using: composite
-
-  steps:
-    - name: set SETARCH
-      shell: bash
-      run: echo "SETARCH=${setarch}" >> "$GITHUB_ENV"
-      env:
-        setarch: ${{ inputs.arch && format('setarch {0} --', inputs.arch) }}
-
-    - id: uname
-      name: uname
-      shell: bash
-      run: |
-        echo uname=`${SETARCH} uname -m` >> "$GITHUB_OUTPUT"
-        echo dpkg=`${SETARCH} uname -m | sed s/686/386/` >> "$GITHUB_OUTPUT"
-
-    - name: apt-get
-      shell: bash
-      env:
-        arch: ${{ inputs.arch && format(':{0}', steps.uname.outputs.dpkg) || '' }}
-      run: |
-        set -x
-        ${arch:+sudo dpkg --add-architecture ${arch#:}}
-        sudo apt-get update -qq || :
-        sudo apt-get install --no-install-recommends -qq -y -o=Dpkg::Use-Pty=0 \
-        ${arch:+cross}build-essential${arch/:/-} \
-        libssl-dev${arch} libyaml-dev${arch} libreadline6-dev${arch} \
-        zlib1g-dev${arch} libncurses5-dev${arch} libffi-dev${arch} \
-        autoconf ruby
-        sudo apt-get install -qq -y pkg-config${arch} || :
diff --git a/.github/actions/slack/action.yml b/.github/actions/slack/action.yml
deleted file mode 100644
index 98171efc5e..0000000000
--- a/.github/actions/slack/action.yml
+++ /dev/null
@@ -1,39 +0,0 @@
-name: Post a message to slack
-description: >-
-  We have our ruby/action-slack webhook.  However its arguments are
-  bit verbose to be listed in every workflow files.  Better merge them
-  into one.
-
-inputs:
-  SLACK_WEBHOOK_URL:
-    required: true
-    description: >-
-      The URL to post the payload.  This is an input because it tends
-      to be stored in a secrets vault and a composite action cannot
-      look into one.
-
-  label:
-    required: false
-    description: >-
-      Human-readable description of the run, something like "DEBUG=1".
-      This need not be unique among runs.
-
-outputs: {} # Nothing?
-
-runs:
-  using: composite
-
-  steps:
-    - uses: ruby/action-slack@54175162371f1f7c8eb94d7c8644ee2479fcd375 # v3.2.2
-      with:
-        payload: |
-          {
-            "ci": "GitHub Actions",
-            "env": "${{ github.workflow }}${{ inputs.label && format(' / {0}', inputs.label) }}",
-            "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
-            "commit": "${{ github.sha }}",
-            "branch": "${{ github.ref_name }}"
-          }
-      env:
-        SLACK_WEBHOOK_URL: ${{ inputs.SLACK_WEBHOOK_URL }}
-      if: ${{github.event_name == 'push' && startsWith(github.repository, 'ruby/')}}
diff --git a/.github/auto_request_review.yml b/.github/auto_request_review.yml
deleted file mode 100644
index 8726df577d..0000000000
--- a/.github/auto_request_review.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-files:
-  'yjit*': [team:yjit]
-  'yjit/**/*': [team:yjit]
-  'yjit/src/cruby_bindings.inc.rs': []
-  'doc/yjit/*': [team:yjit]
-  'bootstraptest/test_yjit*': [team:yjit]
-  'test/ruby/test_yjit*': [team:yjit]
-options:
-  ignore_draft: true
-  # This currently doesn't work as intended. We want to skip reviews when only
-  # cruby_bingings.inc.rs is modified, but this skips reviews even when other
-  # yjit files are modified as well. To be enabled after fixing the behavior.
-  #last_files_match_only: true
diff --git a/.github/dependabot.yml b/.github/dependabot.yml
deleted file mode 100644
index 426893be2a..0000000000
--- a/.github/dependabot.yml
+++ /dev/null
@@ -1,18 +0,0 @@
-version: 2
-updates:
-  - package-ecosystem: 'github-actions'
-    directory: '/'
-    schedule:
-      interval: 'daily'
-  - package-ecosystem: 'github-actions'
-    directory: '/.github/actions/slack'
-    schedule:
-      interval: 'daily'
-  - package-ecosystem: 'github-actions'
-    directory: '/.github/actions/setup/directories'
-    schedule:
-      interval: 'daily'
-  - package-ecosystem: 'cargo'
-    directory: '/yjit'
-    schedule:
-      interval: 'daily'
diff --git a/.github/workflows/annocheck.yml b/.github/workflows/annocheck.yml
deleted file mode 100644
index 8cc482c428..0000000000
--- a/.github/workflows/annocheck.yml
+++ /dev/null
@@ -1,112 +0,0 @@
-name: Annocheck
-
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  compile:
-    name: test-annocheck
-
-    runs-on: ubuntu-latest
-
-    container:
-      image: ghcr.io/ruby/ruby-ci-image:gcc-11
-      options: --user root
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    env:
-      CONFIGURE_TTY: never
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      RUBY_DEBUG: ci rgengc
-      RUBY_TESTOPTS: >-
-        -q
-        --color=always
-        --tty=no
-      # FIXME: Drop skipping options
-      # https://bugs.ruby-lang.org/issues/18061
-      # https://sourceware.org/annobin/annobin.html/Test-pie.html
-      TEST_ANNOCHECK_OPTS: '--skip-pie --skip-gaps'
-
-    steps:
-      - run: id
-        working-directory:
-
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-
-      - uses: ruby/setup-ruby@a6e6f86333f0a2523ece813039b8b4be04560854 # v1.190.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-
-      # Minimal flags to pass the check.
-      # -g0 disables backtraces when SEGV.  Do not set that.
-      - name: Run configure
-        run: >
-          ../src/configure -C
-          --enable-debug-env
-          --disable-install-doc
-          --with-ext=-test-/cxxanyargs,+
-          --without-valgrind
-          --without-jemalloc
-          --without-gmp
-          --with-gcc="gcc-11 -fcf-protection -Wa,--generate-missing-build-notes=yes"
-          --enable-shared
-          debugflags=-ggdb3
-          optflags=-O2
-          LDFLAGS=-Wl,-z,now
-
-      - run: make showflags
-
-      - run: make
-
-      - run: make test-annocheck
-
-      - uses: ./.github/actions/slack
-        with:
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/auto_request_review.yml b/.github/workflows/auto_request_review.yml
deleted file mode 100644
index ca27244b46..0000000000
--- a/.github/workflows/auto_request_review.yml
+++ /dev/null
@@ -1,19 +0,0 @@
-name: Auto Request Review
-on:
-  pull_request_target:
-    types: [opened, ready_for_review, reopened]
-
-permissions:
-  contents: read
-
-jobs:
-  auto-request-review:
-    name: Auto Request Review
-    runs-on: ubuntu-latest
-    if: ${{ github.repository == 'ruby/ruby' && github.base_ref == 'master' }}
-    steps:
-      - name: Request review based on files changes and/or groups the author belongs to
-        uses: necojackarc/auto-request-review@e89da1a8cd7c8c16d9de9c6e763290b6b0e3d424 # v0.13.0
-        with:
-          # scope: public_repo
-          token: ${{ secrets.MATZBOT_GITHUB_TOKEN }}
diff --git a/.github/workflows/baseruby.yml b/.github/workflows/baseruby.yml
deleted file mode 100644
index 3dbf135736..0000000000
--- a/.github/workflows/baseruby.yml
+++ /dev/null
@@ -1,77 +0,0 @@
-name: BASERUBY Check
-
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  baseruby:
-    name: BASERUBY
-
-    runs-on: ubuntu-20.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    strategy:
-      matrix:
-        ruby:
-          - ruby-3.0
-          - ruby-3.1
-          - ruby-3.2
-          - ruby-3.3
-
-    steps:
-      - uses: ruby/setup-ruby@a6e6f86333f0a2523ece813039b8b4be04560854 # v1.190.0
-        with:
-          ruby-version: ${{ matrix.ruby }}
-          bundler: none
-
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-
-      - uses: ./.github/actions/setup/ubuntu
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          makeup: true
-
-      - run: ./configure --disable-install-doc
-
-      - run: make all
-
-      - run: make test
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.ruby }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
diff --git a/.github/workflows/bundled_gems.yml b/.github/workflows/bundled_gems.yml
deleted file mode 100644
index da2c7028c2..0000000000
--- a/.github/workflows/bundled_gems.yml
+++ /dev/null
@@ -1,136 +0,0 @@
-name: bundled_gems
-
-on:
-  push:
-    branches: ['master']
-    paths:
-      - '.github/workflows/bundled_gems.yml'
-      - 'gems/bundled_gems'
-  pull_request:
-    branches: ['master']
-    paths:
-      - '.github/workflows/bundled_gems.yml'
-      - 'gems/bundled_gems'
-  merge_group:
-  schedule:
-    - cron: '45 6 * * *'
-  workflow_dispatch:
-
-permissions: # added using https://github.com/step-security/secure-workflows
-  contents: read
-
-jobs:
-  update:
-    permissions:
-      contents: write # for Git to git push
-
-    if: ${{ github.event_name != 'schedule' || github.repository == 'ruby/ruby' }}
-
-    name: update ${{ github.workflow }}
-
-    runs-on: ubuntu-latest
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_GITHUB_TOKEN || secrets.GITHUB_TOKEN }}
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          # Skip overwriting MATZBOT_GITHUB_TOKEN
-          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
-
-      - name: Set ENV
-        run: |
-          echo "TODAY=$(date +%F)" >> $GITHUB_ENV
-
-      - name: Download previous gems list
-        run: |
-          mkdir -p .downloaded-cache
-          for data in bundled_gems.json default_gems.json; do
-            ln -s .downloaded-cache/$data .
-            curl -O -R -z ./$data https://stdgems.org/$data
-          done
-
-      - name: Update bundled gems list
-        id: bundled_gems
-        run: |
-          ruby -i~ tool/update-bundled_gems.rb gems/bundled_gems >> $GITHUB_OUTPUT
-
-      - name: Update spec/bundler/support/builders.rb
-        run: |
-          #!ruby
-          rake_version = File.read("gems/bundled_gems")[/^rake\s+(\S+)/, 1]
-          print ARGF.read.sub(/^ *def rake_version\s*\K".*?"/) {rake_version.dump}
-        shell: ruby -i~ {0} spec/bundler/support/builders.rb
-
-      - name: Maintain updated gems list in NEWS
-        run: |
-          ruby tool/update-NEWS-gemlist.rb bundled
-
-      - name: Check diffs
-        id: diff
-        run: |
-          news= gems=
-          git diff --color --no-ext-diff --ignore-submodules --exit-code -- NEWS.md ||
-          news=true
-          git diff --color --no-ext-diff --ignore-submodules --exit-code -- gems/bundled_gems ||
-          gems=true
-          git add -- NEWS.md gems/bundled_gems
-          git add -- spec/bundler/support/builders.rb
-          echo news=$news >> $GITHUB_OUTPUT
-          echo gems=$gems >> $GITHUB_OUTPUT
-          echo update=${news:-$gems} >> $GITHUB_OUTPUT
-
-      - name: Install libraries
-        uses: ./.github/actions/setup/ubuntu
-        if: ${{ steps.diff.outputs.gems }}
-
-      - name: Build
-        run: |
-          ./autogen.sh
-          ./configure -C --disable-install-doc
-          make
-        if: ${{ steps.diff.outputs.gems }}
-
-      - name: Prepare bundled gems
-        run: |
-          make -s prepare-gems
-        if: ${{ steps.diff.outputs.gems }}
-
-      - name: Test bundled gems
-        run: |
-          make -s test-bundled-gems
-        timeout-minutes: 30
-        env:
-          RUBY_TESTOPTS: '-q --tty=no'
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-        if: ${{ steps.diff.outputs.gems }}
-
-      - name: Commit
-        run: |
-          git pull --ff-only origin ${GITHUB_REF#refs/heads/}
-          message="Update bundled gems list"
-          if [ -z "${gems}" ]; then
-            git commit --message="${message} at ${GITHUB_SHA:0:30} [ci skip]"
-          else
-            git commit --message="${message} as of ${TODAY}"
-          fi
-          git push origin ${GITHUB_REF#refs/heads/}
-        env:
-          TODAY: ${{ steps.bundled_gems.outputs.latest_date || env.TODAY }}
-          EMAIL: svn-admin@ruby-lang.org
-          GIT_AUTHOR_NAME: git
-          GIT_COMMITTER_NAME: git
-          gems: ${{ steps.diff.outputs.gems }}
-        if: >-
-          ${{
-          github.repository == 'ruby/ruby' &&
-          !startsWith(github.event_name, 'pull') &&
-          steps.diff.outputs.update
-          }}
-
-      - uses: ./.github/actions/slack
-        with:
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
diff --git a/.github/workflows/check_dependencies.yml b/.github/workflows/check_dependencies.yml
deleted file mode 100644
index d871ef02c0..0000000000
--- a/.github/workflows/check_dependencies.yml
+++ /dev/null
@@ -1,63 +0,0 @@
-name: Check Dependencies
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  update-deps:
-    name: Dependency checks
-
-    strategy:
-      matrix:
-        os: [ubuntu-latest]
-      fail-fast: true
-
-    runs-on: ${{ matrix.os }}
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-
-      - uses: ./.github/actions/setup/ubuntu
-        if: ${{ contains(matrix.os, 'ubuntu') }}
-
-      - uses: ./.github/actions/setup/macos
-        if: ${{ contains(matrix.os, 'macos') }}
-
-      - uses: ./.github/actions/setup/directories
-
-      - uses: ruby/setup-ruby@a6e6f86333f0a2523ece813039b8b4be04560854 # v1.190.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-
-      - name: Run configure
-        run: ./configure -C --disable-install-doc --disable-rubygems --with-gcc 'optflags=-O0' 'debugflags=-save-temps=obj -g'
-
-      - run: make all golf
-
-      - run: ./goruby -veh
-
-      - run: ruby tool/update-deps --fix
-
-      - run: git diff --no-ext-diff --ignore-submodules --exit-code
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.os }} / Dependencies need to update
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
diff --git a/.github/workflows/check_misc.yml b/.github/workflows/check_misc.yml
deleted file mode 100644
index 42ad551430..0000000000
--- a/.github/workflows/check_misc.yml
+++ /dev/null
@@ -1,81 +0,0 @@
-name: Misc
-on: [push, pull_request, merge_group]
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  checks:
-    name: Miscellaneous checks
-
-    permissions:
-      contents: write # for Git to git push
-
-    runs-on: ubuntu-latest
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_GITHUB_TOKEN || secrets.GITHUB_TOKEN }}
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          makeup: true
-          # Skip overwriting MATZBOT_GITHUB_TOKEN
-          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
-
-      - name: Check if C-sources are US-ASCII
-        run: |
-          grep -r -n --include='*.[chyS]' --include='*.asm' $'[^\t-~]' -- . && exit 1 || :
-
-      - name: Check for trailing spaces
-        run: |
-          git grep -I -n $'[\t ]$' -- '*.rb' '*.[chy]' '*.rs' '*.yml' && exit 1 || :
-          git grep -n $'^[\t ][\t ]*$' -- '*.md' && exit 1 || :
-
-      - name: Check for bash specific substitution in configure.ac
-        run: |
-          git grep -n '\${[A-Za-z_0-9]*/' -- configure.ac && exit 1 || :
-
-      - name: Check for header macros
-        run: |
-          fail=
-          for header in ruby/*.h; do
-            git grep -l -F -e $header -e HAVE_`echo $header | tr a-z./ A-Z__` -- . > /dev/null && continue
-            fail=1
-            echo $header
-          done
-          exit $fail
-        working-directory: include
-
-      - name: Generate docs
-        id: docs
-        run: |
-          ruby -W0 --disable-gems -I./lib tool/rdoc-srcdir -q --op html .
-          echo htmlout=ruby-html-${GITHUB_SHA:0:10} >> $GITHUB_OUTPUT
-        # Generate only when document commit/PR
-        if: >-
-          ${{false
-          || contains(github.event.head_commit.message, '[ruby/rdoc]')
-          || contains(github.event.head_commit.message, '[DOC]')
-          || contains(github.event.head_commit.message, 'Document')
-          || contains(github.event.pull_request.title, '[DOC]')
-          || contains(github.event.pull_request.title, 'Document')
-          || contains(github.event.pull_request.labels.*.name, 'Documentation')
-          }}
-
-      - name: Upload docs
-        uses: actions/upload-artifact@v4
-        with:
-          path: html
-          name: ${{ steps.docs.outputs.htmlout }}
-        if: ${{ steps.docs.outcome == 'success' }}
-
-      - uses: ./.github/actions/slack
-        with:
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
diff --git a/.github/workflows/codeql-analysis.yml b/.github/workflows/codeql-analysis.yml
deleted file mode 100644
index 5310d0875f..0000000000
--- a/.github/workflows/codeql-analysis.yml
+++ /dev/null
@@ -1,121 +0,0 @@
-name: 'CodeQL'
-
-on:
-  push:
-    branches: ['master']
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  schedule:
-    - cron: '0 12 * * *'
-  workflow_dispatch:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions: # added using https://github.com/step-security/secure-workflows
-  contents: read
-
-jobs:
-  analyze:
-    name: Analyze
-    runs-on: ubuntu-latest
-    permissions:
-      actions: read # for github/codeql-action/init to get workflow details
-      contents: read # for actions/checkout to fetch code
-      security-events: write # for github/codeql-action/autobuild to send a status report
-    # CodeQL fails to run pull requests from dependabot due to missing write access to upload results.
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    env:
-      enable_install_doc: no
-
-    strategy:
-      fail-fast: false
-      matrix:
-        include:
-          - language: cpp
-          - language: ruby
-
-    steps:
-      - name: Checkout repository
-        uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-
-      - name: Install libraries
-        if: ${{ contains(matrix.os, 'macos') }}
-        uses: ./.github/actions/setup/macos
-
-      - name: Install libraries
-        if : ${{ matrix.os == 'ubuntu-latest' }}
-        uses: ./.github/actions/setup/ubuntu
-
-      - uses: ./.github/actions/setup/directories
-
-      - name: Remove an obsolete rubygems vendored file
-        if: ${{ matrix.os == 'ubuntu-latest' }}
-        run: sudo rm /usr/lib/ruby/vendor_ruby/rubygems/defaults/operating_system.rb
-
-      - name: Initialize CodeQL
-        uses: github/codeql-action/init@df409f7d9260372bd5f19e5b04e83cb3c43714ae # v3.27.9
-        with:
-          languages: ${{ matrix.language }}
-
-      - name: Autobuild
-        uses: github/codeql-action/autobuild@df409f7d9260372bd5f19e5b04e83cb3c43714ae # v3.27.9
-
-      - name: Perform CodeQL Analysis
-        uses: github/codeql-action/analyze@df409f7d9260372bd5f19e5b04e83cb3c43714ae # v3.27.9
-        with:
-          category: '/language:${{ matrix.language }}'
-          upload: False
-          output: sarif-results
-
-      - name: filter-sarif
-        uses: advanced-security/filter-sarif@f3b8118a9349d88f7b1c0c488476411145b6270d # v1.0.1
-        with:
-          patterns: |
-            +**/*.rb
-            -lib/uri/mailto.rb:rb/overly-large-range
-            -lib/uri/rfc3986_parser.rb:rb/overly-large-range
-            -lib/bundler/vendor/uri/lib/uri/mailto.rb:rb/overly-large-range
-            -lib/bundler/vendor/uri/lib/uri/rfc3986_parser.rb:rb/overly-large-range
-            -test/ruby/test_io.rb:rb/non-constant-kernel-open
-            -test/open-uri/test_open-uri.rb:rb/non-constant-kernel-open
-            -test/open-uri/test_ssl.rb:rb/non-constant-kernel-open
-            -spec/ruby/core/io/binread_spec.rb:rb/non-constant-kernel-open
-            -spec/ruby/core/io/readlines_spec.rb:rb/non-constant-kernel-open
-            -spec/ruby/core/io/foreach_spec.rb:rb/non-constant-kernel-open
-            -spec/ruby/core/io/write_spec.rb:rb/non-constant-kernel-open
-            -spec/ruby/core/io/read_spec.rb:rb/non-constant-kernel-open
-            -spec/ruby/core/kernel/open_spec.rb:rb/non-constant-kernel-open
-          input: sarif-results/${{ matrix.language }}.sarif
-          output: sarif-results/${{ matrix.language }}.sarif
-        if: ${{ matrix.language == 'ruby' }}
-        continue-on-error: true
-
-      - name: Upload SARIF
-        uses: github/codeql-action/upload-sarif@df409f7d9260372bd5f19e5b04e83cb3c43714ae # v3.27.9
-        with:
-          sarif_file: sarif-results/${{ matrix.language }}.sarif
-        continue-on-error: true
diff --git a/.github/workflows/compilers.yml b/.github/workflows/compilers.yml
deleted file mode 100644
index d8fcfc2638..0000000000
--- a/.github/workflows/compilers.yml
+++ /dev/null
@@ -1,320 +0,0 @@
-# Some tests depending on this name 'Compilations' via $GITHUB_WORKFLOW. Make sure to update such tests when renaming this workflow.
-name: Compilations
-
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-# Each job is split so that they roughly take 30min to run through.
-jobs:
-  compile-if:
-    name: 'omnibus compilations, trigger'
-    runs-on: ubuntu-latest
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-    steps:
-      - run: true
-        working-directory:
-
-  compile1:
-    name: 'omnibus compilations, #1'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      # Set fetch-depth: 10 so that Launchable can receive commits information.
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - name: 'clang 18 LTO'
-        uses: './.github/actions/compilers'
-        with:
-          tag: clang-18
-          with_gcc: 'clang-18 -flto=auto'
-          optflags: '-O2'
-          enable_shared: false
-      - { uses: './.github/actions/compilers', name: '-O0', with: { optflags: '-O0 -march=x86-64 -mtune=generic' } }
-      # - { uses: './.github/actions/compilers', name: '-O3', with: { optflags: '-O3 -march=x86-64 -mtune=generic', check: true } }
-
-  compile2:
-    name: 'omnibus compilations, #2'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - name: 'GCC 13 LTO'
-        uses: './.github/actions/compilers'
-        with:
-          tag: gcc-13
-          with_gcc: 'gcc-13 -flto=auto -ffat-lto-objects -Werror=lto-type-mismatch'
-          optflags: '-O2'
-          enable_shared: false
-      - { uses: './.github/actions/compilers', name: 'ext/Setup', with: { static_exts: 'etc json/* */escape' } }
-      - { uses: './.github/actions/compilers', name: 'GCC 14', with: { tag: 'gcc-14' } }
-      - { uses: './.github/actions/compilers', name: 'GCC 13', with: { tag: 'gcc-13' } }
-      - { uses: './.github/actions/compilers', name: 'GCC 12', with: { tag: 'gcc-12' } }
-      - { uses: './.github/actions/compilers', name: 'GCC 11', with: { tag: 'gcc-11' } }
-      - { uses: './.github/actions/compilers', name: 'GCC 10', with: { tag: 'gcc-10' } }
-      - { uses: './.github/actions/compilers', name: 'GCC 9',  with: { tag: 'gcc-9'  } }
-      - { uses: './.github/actions/compilers', name: 'GCC 8',  with: { tag: 'gcc-8'  } }
-      - { uses: './.github/actions/compilers', name: 'GCC 7',  with: { tag: 'gcc-7'  } }
-
-  compile3:
-    name: 'omnibus compilations, #3'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'clang 20', with: { tag: 'clang-20' } }
-      - { uses: './.github/actions/compilers', name: 'clang 19', with: { tag: 'clang-19' } }
-      - { uses: './.github/actions/compilers', name: 'clang 18', with: { tag: 'clang-18' } }
-      - { uses: './.github/actions/compilers', name: 'clang 17', with: { tag: 'clang-17' } }
-      - { uses: './.github/actions/compilers', name: 'clang 16', with: { tag: 'clang-16' } }
-      - { uses: './.github/actions/compilers', name: 'clang 15', with: { tag: 'clang-15' } }
-      - { uses: './.github/actions/compilers', name: 'clang 14', with: { tag: 'clang-14' } }
-
-  compile4:
-    name: 'omnibus compilations, #4'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'clang 13', with: { tag: 'clang-13' } }
-      - { uses: './.github/actions/compilers', name: 'clang 12', with: { tag: 'clang-12' } }
-      - { uses: './.github/actions/compilers', name: 'clang 11', with: { tag: 'clang-11' } }
-      - { uses: './.github/actions/compilers', name: 'clang 10', with: { tag: 'clang-10' } }
-        # llvm-objcopy<=9 doesn't have --wildcard. It compiles, but leaves Rust symbols in libyjit.o.
-      - { uses: './.github/actions/compilers', name: 'clang 9',  with: { tag: 'clang-9',   append_configure: '--disable-yjit' } }
-      - { uses: './.github/actions/compilers', name: 'clang 8',  with: { tag: 'clang-8',   append_configure: '--disable-yjit' } }
-      - { uses: './.github/actions/compilers', name: 'clang 7',  with: { tag: 'clang-7',   append_configure: '--disable-yjit' } }
-      - { uses: './.github/actions/compilers', name: 'clang 6',  with: { tag: 'clang-6.0', append_configure: '--disable-yjit' } }
-
-  compile5:
-    name: 'omnibus compilations, #5'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      # -Wno-strict-prototypes is necessary with current clang-15 since
-      # older autoconf generate functions without prototype and -pedantic
-      # now implies strict-prototypes. Disabling the error but leaving the
-      # warning generates a lot of noise from use of ANYARGS in
-      # rb_define_method() and friends.
-      # See: https://github.com/llvm/llvm-project/commit/11da1b53d8cd3507959022cd790d5a7ad4573d94
-      - { uses: './.github/actions/compilers', name: 'C99',      with: { CFLAGS: '-std=c99 -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
-      - { uses: './.github/actions/compilers', name: 'C11',   with: { CFLAGS:   '-std=c11   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
-      - { uses: './.github/actions/compilers', name: 'C17',   with: { CFLAGS:   '-std=c17   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
-      - { uses: './.github/actions/compilers', name: 'C23',   with: { CFLAGS:   '-std=c2x   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
-      - { uses: './.github/actions/compilers', name: 'C++98', with: { CXXFLAGS: '-std=c++98 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-      - { uses: './.github/actions/compilers', name: 'C++11', with: { CXXFLAGS: '-std=c++11 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-      - { uses: './.github/actions/compilers', name: 'C++14', with: { CXXFLAGS: '-std=c++14 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-      - { uses: './.github/actions/compilers', name: 'C++17', with: { CXXFLAGS: '-std=c++17 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-
-  compile6:
-    name: 'omnibus compilations, #6'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'C++20', with: { CXXFLAGS: '-std=c++20 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-      - { uses: './.github/actions/compilers', name: 'C++23', with: { CXXFLAGS: '-std=c++23 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-      - { uses: './.github/actions/compilers', name: 'C++26', with: { CXXFLAGS: '-std=c++26 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-      - { uses: './.github/actions/compilers', name: 'gmp',                 with: { append_configure: '--with-gmp', check: 'ruby/test_bignum.rb', mspecopt: "/github/workspace/src/spec/ruby/core/integer" } }
-      - { uses: './.github/actions/compilers', name: 'jemalloc',            with: { append_configure: '--with-jemalloc' } }
-      - { uses: './.github/actions/compilers', name: 'valgrind',            with: { append_configure: '--with-valgrind' } }
-      - { uses: './.github/actions/compilers', name: 'coroutine=ucontext',  with: { append_configure: '--with-coroutine=ucontext' } }
-      - { uses: './.github/actions/compilers', name: 'coroutine=pthread',   with: { append_configure: '--with-coroutine=pthread' } }
-
-  compile7:
-    name: 'omnibus compilations, #7'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'disable-jit',         with: { append_configure: '--disable-yjit --disable-rjit' } }
-      - { uses: './.github/actions/compilers', name: 'disable-dln',         with: { append_configure: '--disable-dln' } }
-      - { uses: './.github/actions/compilers', name: 'enable-mkmf-verbose', with: { append_configure: '--enable-mkmf-verbose' } }
-      - { uses: './.github/actions/compilers', name: 'disable-rubygems',    with: { append_configure: '--disable-rubygems' } }
-      - { uses: './.github/actions/compilers', name: 'RUBY_DEVEL',          with: { append_configure: '--enable-devel' } }
-      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=0',            with: { cppflags: '-DOPT_THREADED_CODE=0' } }
-      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=1',            with: { cppflags: '-DOPT_THREADED_CODE=1' } }
-      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=2',            with: { cppflags: '-DOPT_THREADED_CODE=2' } }
-
-  compile8:
-    name: 'omnibus compilations, #8'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'NDEBUG',                         with: { cppflags: '-DNDEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'RUBY_DEBUG',                     with: { cppflags: '-DRUBY_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'ARRAY_DEBUG',                    with: { cppflags: '-DARRAY_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'BIGNUM_DEBUG',                   with: { cppflags: '-DBIGNUM_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'CCAN_LIST_DEBUG',                with: { cppflags: '-DCCAN_LIST_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'CPDEBUG=-1',                     with: { cppflags: '-DCPDEBUG=-1' } }
-      - { uses: './.github/actions/compilers', name: 'ENC_DEBUG',                      with: { cppflags: '-DENC_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'GC_DEBUG',                       with: { cppflags: '-DGC_DEBUG' } }
-
-  compile9:
-    name: 'omnibus compilations, #9'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'HASH_DEBUG',                     with: { cppflags: '-DHASH_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'ID_TABLE_DEBUG',                 with: { cppflags: '-DID_TABLE_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'RGENGC_DEBUG=-1',                with: { cppflags: '-DRGENGC_DEBUG=-1' } }
-      - { uses: './.github/actions/compilers', name: 'SYMBOL_DEBUG',                   with: { cppflags: '-DSYMBOL_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'RGENGC_CHECK_MODE',              with: { cppflags: '-DRGENGC_CHECK_MODE' } }
-      - { uses: './.github/actions/compilers', name: 'VM_CHECK_MODE',                  with: { cppflags: '-DVM_CHECK_MODE' } }
-      - { uses: './.github/actions/compilers', name: 'USE_EMBED_CI=0',                 with: { cppflags: '-DUSE_EMBED_CI=0' } }
-      - { uses: './.github/actions/compilers', name: 'USE_FLONUM=0',                   with: { cppflags: '-DUSE_FLONUM=0', append_configure: '--disable-yjit' } }
-
-  compileX:
-    name: 'omnibus compilations, #10'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'USE_LAZY_LOAD',                  with: { cppflags: '-DUSE_LAZY_LOAD' } }
-      - { uses: './.github/actions/compilers', name: 'USE_SYMBOL_GC=0',                with: { cppflags: '-DUSE_SYMBOL_GC=0' } }
-      - { uses: './.github/actions/compilers', name: 'USE_THREAD_CACHE=0',             with: { cppflags: '-DUSE_THREAD_CACHE=0' } }
-      - { uses: './.github/actions/compilers', name: 'USE_RUBY_DEBUG_LOG=1',           with: { cppflags: '-DUSE_RUBY_DEBUG_LOG=1' } }
-      - { uses: './.github/actions/compilers', name: 'USE_DEBUG_COUNTER',              with: { cppflags: '-DUSE_DEBUG_COUNTER=1' } }
-      - { uses: './.github/actions/compilers', name: 'SHARABLE_MIDDLE_SUBSTRING',      with: { cppflags: '-DSHARABLE_MIDDLE_SUBSTRING=1' } }
-      - { uses: './.github/actions/compilers', name: 'DEBUG_FIND_TIME_NUMGUESS',       with: { cppflags: '-DDEBUG_FIND_TIME_NUMGUESS' } }
-      - { uses: './.github/actions/compilers', name: 'DEBUG_INTEGER_PACK',             with: { cppflags: '-DDEBUG_INTEGER_PACK' } }
-
-  compileB:
-    name: 'omnibus compilations, #11'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'GC_DEBUG_STRESS_TO_CLASS',       with: { cppflags: '-DGC_DEBUG_STRESS_TO_CLASS' } }
-      - { uses: './.github/actions/compilers', name: 'GC_ENABLE_LAZY_SWEEP=0',         with: { cppflags: '-DGC_ENABLE_LAZY_SWEEP=0' } }
-      - { uses: './.github/actions/compilers', name: 'GC_PROFILE_DETAIL_MEMORY',       with: { cppflags: '-DGC_PROFILE_DETAIL_MEMORY' } }
-      - { uses: './.github/actions/compilers', name: 'GC_PROFILE_MORE_DETAIL',         with: { cppflags: '-DGC_PROFILE_MORE_DETAIL' } }
-      - { uses: './.github/actions/compilers', name: 'MALLOC_ALLOCATED_SIZE_CHECK',    with: { cppflags: '-DMALLOC_ALLOCATED_SIZE_CHECK' } }
-      - { uses: './.github/actions/compilers', name: 'RGENGC_ESTIMATE_OLDMALLOC',      with: { cppflags: '-DRGENGC_ESTIMATE_OLDMALLOC' } }
-      - { uses: './.github/actions/compilers', name: 'RGENGC_OBJ_INFO',                with: { cppflags: '-DRGENGC_OBJ_INFO' } }
-      - { uses: './.github/actions/compilers', name: 'RGENGC_PROFILE',                 with: { cppflags: '-DRGENGC_PROFILE' } }
-
-  compileC:
-    name: 'omnibus compilations, #12'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'VM_DEBUG_BP_CHECK',              with: { cppflags: '-DVM_DEBUG_BP_CHECK' } }
-      - { uses: './.github/actions/compilers', name: 'VM_DEBUG_VERIFY_METHOD_CACHE',   with: { cppflags: '-DVM_DEBUG_VERIFY_METHOD_CACHE' } }
-      - { uses: './.github/actions/compilers', name: 'enable-yjit',                    with: { append_configure: '--enable-yjit --disable-rjit' } }
-      - { uses: './.github/actions/compilers', name: 'enable-rjit',                    with: { append_configure: '--enable-rjit --disable-yjit' } }
-      - { uses: './.github/actions/compilers', name: 'YJIT_FORCE_ENABLE',              with: { cppflags: '-DYJIT_FORCE_ENABLE' } }
-      - { uses: './.github/actions/compilers', name: 'RJIT_FORCE_ENABLE',              with: { cppflags: '-DRJIT_FORCE_ENABLE' } }
-      - { uses: './.github/actions/compilers', name: 'UNIVERSAL_PARSER',               with: { cppflags: '-DUNIVERSAL_PARSER' } }
-
-  compilemax:
-    name: 'omnibus compilations, result'
-    runs-on: ubuntu-latest
-    if: ${{ always() }}
-    needs:
-      - 'compile1'
-      - 'compile2'
-      - 'compile3'
-      - 'compile4'
-      - 'compile5'
-      - 'compile6'
-      - 'compile7'
-      - 'compile8'
-      - 'compile9'
-      - 'compileX'
-      - 'compileB'
-      - 'compileC'
-    steps:
-      - uses: ./.github/actions/slack
-        with:
-          label: 'omnibus'
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-      - run: false
-        working-directory:
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/cygwin.yml b/.github/workflows/cygwin.yml
deleted file mode 100644
index 3467fc0b70..0000000000
--- a/.github/workflows/cygwin.yml
+++ /dev/null
@@ -1,61 +0,0 @@
-name: Cygwin
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  make:
-    runs-on: windows-2022
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - run: git config --global core.autocrlf input
-
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-
-      - name: Setup Cygwin
-        uses: cygwin/cygwin-install-action@master
-        with:
-          packages: ruby gcc-core make autoconf libtool libssl-devel libyaml-devel libffi-devel zlib-devel
-
-      - name: configure
-        run: |
-          ./autogen.sh
-          ./configure --disable-install-doc
-        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
-
-      - name: make all
-        timeout-minutes: 30
-        run: make -j2 V=1
-        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
diff --git a/.github/workflows/default_gems.yml b/.github/workflows/default_gems.yml
deleted file mode 100644
index ea2e287066..0000000000
--- a/.github/workflows/default_gems.yml
+++ /dev/null
@@ -1,95 +0,0 @@
-name: Update default gems list
-on: [push, pull_request, merge_group]
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  update_default_gems:
-    name: Update default gems list
-
-    permissions:
-      contents: write # for Git to git push
-
-    runs-on: ubuntu-latest
-
-    if: ${{ github.repository == 'ruby/ruby' }}
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_GITHUB_TOKEN || secrets.GITHUB_TOKEN }}
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          makeup: true
-          # Skip overwriting MATZBOT_GITHUB_TOKEN
-          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
-
-      - id: gems
-        run: true
-        if: ${{ github.ref == 'refs/heads/master' }}
-
-      - name: Download previous gems list
-        run: |
-          data=default_gems.json
-          mkdir -p .downloaded-cache
-          ln -s .downloaded-cache/$data .
-          curl -O -R -z ./$data https://stdgems.org/$data
-        if: ${{ steps.gems.outcome == 'success' }}
-
-      - name: Make default gems list
-        run: |
-          #!ruby
-          require 'rubygems'
-          $:.unshift "lib"
-          rgver = File.foreach("lib/rubygems.rb") do |line|
-            break $1 if /^\s*VERSION\s*=\s*"([^"]+)"/ =~ line
-          end
-          gems = Dir.glob("{ext,lib}/**/*.gemspec").map do |f|
-            spec = Gem::Specification.load(f)
-            "#{spec.name} #{spec.version}"
-          end.sort
-          File.open("gems/default_gems", "w") do |f|
-            f.puts "RubyGems #{rgver}"
-            f.puts gems
-          end
-        shell: ruby --disable=gems {0}
-        if: ${{ steps.gems.outcome == 'success' }}
-
-      - name: Maintain updated gems list in NEWS
-        run: |
-          ruby tool/update-NEWS-gemlist.rb default
-        if: ${{ steps.gems.outcome == 'success' }}
-
-      - name: Check diffs
-        id: diff
-        run: |
-          git diff --color --no-ext-diff --ignore-submodules --exit-code NEWS.md ||
-          echo update=true >> $GITHUB_OUTPUT
-        if: ${{ steps.gems.outcome == 'success' }}
-
-      - name: Commit
-        run: |
-          git pull --ff-only origin ${GITHUB_REF#refs/heads/}
-          git commit --message="Update default gems list at ${GITHUB_SHA:0:30} [ci skip]" NEWS.md
-          git push origin ${GITHUB_REF#refs/heads/}
-        env:
-          EMAIL: svn-admin@ruby-lang.org
-          GIT_AUTHOR_NAME: git
-          GIT_COMMITTER_NAME: git
-        if: >-
-          ${{
-          github.repository == 'ruby/ruby' &&
-          !startsWith(github.event_name, 'pull') &&
-          steps.diff.outputs.update
-          }}
-
-      - uses: ./.github/actions/slack
-        with:
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
diff --git a/.github/workflows/dependabot_automerge.yml b/.github/workflows/dependabot_automerge.yml
deleted file mode 100644
index 69ab5d9131..0000000000
--- a/.github/workflows/dependabot_automerge.yml
+++ /dev/null
@@ -1,30 +0,0 @@
-# from https://github.com/gofiber/swagger/blob/main/.github/workflows/dependabot_automerge.yml
-name: Dependabot auto-merge
-on:
-  pull_request_target:
-
-jobs:
-  automerge:
-    runs-on: ubuntu-latest
-
-    if: ${{ github.event.pull_request.user.login == 'dependabot[bot]' }}
-
-    steps:
-      - name: Dependabot metadata
-        uses: dependabot/fetch-metadata@dbb049abf0d677abbd7f7eee0375145b417fdd34 # v2.2.0
-        id: metadata
-
-      - name: Wait for status checks
-        uses: lewagon/wait-on-check-action@ccfb013c15c8afb7bf2b7c028fb74dc5a068cccc # v1.3.4
-        with:
-          repo-token: ${{ secrets.MATZBOT_GITHUB_TOKEN }}
-          ref: ${{ github.event.pull_request.head.sha || github.sha }}
-          check-regexp: 'make \(check, .*\)'
-          wait-interval: 30
-
-      - name: Auto-merge for Dependabot PRs
-        if: ${{ steps.metadata.outputs.update-type == 'version-update:semver-minor' || steps.metadata.outputs.update-type == 'version-update:semver-patch' }}
-        run: gh pr merge --auto --rebase "$PR_URL"
-        env:
-          PR_URL: ${{ github.event.pull_request.html_url }}
-          GITHUB_TOKEN: ${{ secrets.MATZBOT_GITHUB_TOKEN }}
diff --git a/.github/workflows/macos.yml b/.github/workflows/macos.yml
deleted file mode 100644
index d0cdfc69af..0000000000
--- a/.github/workflows/macos.yml
+++ /dev/null
@@ -1,187 +0,0 @@
-name: macOS
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    # Do not use paths-ignore for required status checks
-    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  make:
-    strategy:
-      matrix:
-        include:
-          - test_task: check
-            os: macos-14
-          - test_task: check
-            os: macos-14
-            configure_args: '--with-gcc=gcc-14'
-          - test_task: check
-            os: macos-14
-            configure_args: '--with-jemalloc --with-opt-dir=$(brew --prefix jemalloc)'
-          - test_task: check
-            os: macos-14
-            configure_args: '--with-gmp'
-          - test_task: test-all
-            test_opts: --repeat-count=2
-            os: macos-14
-          - test_task: test-bundler-parallel
-            os: macos-14
-          - test_task: test-bundled-gems
-            os: macos-14
-          - test_task: check
-            os: macos-15
-          - test_task: check
-            os: macos-13
-      fail-fast: false
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-
-    runs-on: ${{ matrix.os }}
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - name: Install libraries
-        uses: ./.github/actions/setup/macos
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          clean: true
-          dummy-files: ${{ matrix.test_task == 'check' }}
-          # Set fetch-depth: 0 so that Launchable can receive commits information.
-          fetch-depth: 10
-
-      - name: make sure that kern.coredump=1
-        run: |
-          sysctl -n kern.coredump
-          sudo sysctl -w kern.coredump=1
-          sudo chmod -R +rwx /cores/
-
-      - name: Delete unused SDKs
-        # To free up disk space to not run out during the run
-        run: |
-          sudo rm -rf ~/.dotnet
-          sudo rm -rf /Library/Android
-          sudo rm -rf /Library/Developer/CoreSimulator
-        continue-on-error: true
-
-      - name: Run configure
-        run: ../src/configure -C --disable-install-doc ${ruby_configure_args} ${{ matrix.configure_args }}
-
-      - run: make prepare-gems
-        if: ${{ matrix.test_task == 'test-bundled-gems' }}
-
-      - run: make
-
-      - run: make hello
-
-      - name: Set test options for skipped tests
-        run: |
-          set -x
-          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
-          echo "TESTS=${TESTS}" >> $GITHUB_ENV
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: ${{ matrix.os }}
-          test-opts: ${{ matrix.test_opts }}
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-        continue-on-error: true
-
-      - name: Set extra test options
-        run: |
-          echo "TESTS=$TESTS ${{ matrix.test_opts }}" >> $GITHUB_ENV
-          echo "RUBY_TEST_TIMEOUT_SCALE=10" >> $GITHUB_ENV # With --repeat-count=2, flaky test by timeout occurs frequently for some reason
-        if: matrix.test_opts
-
-      - name: make ${{ matrix.test_task }}
-        run: |
-          ulimit -c unlimited
-          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"}
-        timeout-minutes: 60
-        env:
-          RUBY_TESTOPTS: '-q --tty=no'
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-          PRECHECK_BUNDLED_GEMS: 'no'
-
-      - name: make skipped tests
-        run: |
-          make -s test-all TESTS="${TESTS//-n!\//-n/}"
-        env:
-          GNUMAKEFLAGS: ''
-          RUBY_TESTOPTS: '-v --tty=no'
-          PRECHECK_BUNDLED_GEMS: 'no'
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.os }} / ${{ matrix.test_task }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-      - name: Resolve job ID
-        id: job_id
-        uses: actions/github-script@main
-        env:
-          matrix: ${{ toJson(matrix) }}
-        with:
-          script: |
-            const { data: workflow_run } = await github.rest.actions.listJobsForWorkflowRun({
-              owner: context.repo.owner,
-              repo: context.repo.repo,
-              run_id: context.runId
-            });
-            const matrix = JSON.parse(process.env.matrix);
-            const job_name = `${context.job}${matrix ? ` (${Object.values(matrix).join(", ")})` : ""}`;
-            return workflow_run.jobs.find((job) => job.name === job_name).id;
-
-  result:
-    if: ${{ always() }}
-    name: ${{ github.workflow }} result
-    runs-on: macos-latest
-    needs: [make]
-    steps:
-      - run: exit 1
-        working-directory:
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/mingw.yml b/.github/workflows/mingw.yml
deleted file mode 100644
index 898a51b63f..0000000000
--- a/.github/workflows/mingw.yml
+++ /dev/null
@@ -1,170 +0,0 @@
-name: MinGW
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-# Notes:
-# Actions console encoding causes issues, see test-all & test-spec steps
-#
-jobs:
-  make:
-    runs-on: windows-2022
-
-    name: ${{ github.workflow }} (${{ matrix.msystem }})
-
-    env:
-      MSYSTEM: ${{ matrix.msystem }}
-      MSYS2_ARCH: x86_64
-      CHOST: 'x86_64-w64-mingw32'
-      CFLAGS: '-march=x86-64 -mtune=generic -O3 -pipe'
-      CXXFLAGS: '-march=x86-64 -mtune=generic -O3 -pipe'
-      CPPFLAGS: '-D_FORTIFY_SOURCE=2 -D__USE_MINGW_ANSI_STDIO=1 -DFD_SETSIZE=2048'
-      LDFLAGS: '-pipe'
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-
-    strategy:
-      matrix:
-        include:
-          # To mitigate flakiness of MinGW CI, we test only one runtime that newer MSYS2 uses.
-          # Ruby 3.2 is the first Windows Ruby to use OpenSSL 3.x
-          - msystem: 'UCRT64'
-            baseruby: '3.2'
-            test_task: 'check'
-            test-all-opts: '--name=!/TestObjSpace#test_reachable_objects_during_iteration/'
-      fail-fast: false
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - name: Set up Ruby & MSYS2
-        uses: ruby/setup-ruby@a6e6f86333f0a2523ece813039b8b4be04560854 # v1.190.0
-        with:
-          ruby-version: ${{ matrix.baseruby }}
-
-      - name: Misc system & package info
-        working-directory:
-        run: |
-          # show where
-          result=true
-          for e in gcc.exe ragel.exe make.exe libcrypto-3-x64.dll libssl-3-x64.dll; do
-            echo ::group::$'\033[93m'$e$'\033[m'
-            where $e || result=false
-            echo ::endgroup::
-          done
-          # show version
-          for e in gcc ragel make "openssl version"; do
-            case "$e" in *" "*) ;; *) e="$e --version";; esac
-            echo ::group::$'\033[93m'$e$'\033[m'
-            $e || result=false
-            echo ::endgroup::
-          done
-          # show packages
-          echo ::group::$'\033[93m'Packages$'\033[m'
-          pacman -Qs mingw-w64-ucrt-x86_64-* | sed -n "s,local/mingw-w64-ucrt-x86_64-,,p"
-          echo ::endgroup::
-          $result
-
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          # Set fetch-depth: 10 so that Launchable can receive commits information.
-          fetch-depth: 10
-
-      - name: configure
-        run: >
-          ../src/configure --disable-install-doc --prefix=/.
-          --build=$CHOST --host=$CHOST --target=$CHOST
-
-      - name: make all
-        timeout-minutes: 30
-        run: make
-
-      - name: make install
-        run: make DESTDIR=../install install-nodoc
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: windows-2022
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-          test-tasks: '["test", "test-all", "test-spec"]'
-        continue-on-error: true
-
-      - name: test
-        timeout-minutes: 30
-        run: make test
-        shell: cmd
-        env:
-          GNUMAKEFLAGS: ''
-          RUBY_TESTOPTS: '-v --tty=no'
-        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test' }}
-
-      - name: test-all
-        timeout-minutes: 45
-        shell: cmd
-        run: |
-          make ${{ StartsWith(matrix.test_task, 'test/') && matrix.test_task || 'test-all' }}
-        env:
-          RUBY_TESTOPTS: >-
-            --retry --job-status=normal --show-skip --timeout-scale=1.5
-            ${{ matrix.test-all-opts }}
-            ${{ env.TESTS }}
-          BUNDLER_VERSION:
-        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test-all' || StartsWith(matrix.test_task, 'test/') }}
-
-      - name: test-spec
-        timeout-minutes: 10
-        run: |
-          make ${{ StartsWith(matrix.test_task, 'spec/') && matrix.test_task || 'test-spec' }}
-        shell: cmd
-        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test-spec' || StartsWith(matrix.test_task, 'spec/') }}
-
-      - uses: ./src/.github/actions/slack
-        with:
-          label: ${{ matrix.msystem }} / ${{ matrix.test_task }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-defaults:
-  run:
-    working-directory: build
-    shell: sh
diff --git a/.github/workflows/modgc.yml b/.github/workflows/modgc.yml
deleted file mode 100644
index 266f7e0593..0000000000
--- a/.github/workflows/modgc.yml
+++ /dev/null
@@ -1,191 +0,0 @@
-name: ModGC
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    # Do not use paths-ignore for required status checks
-    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  check:
-    strategy:
-      matrix:
-        gc:
-          - name: default
-          - name: mmtk
-            mmtk_plan: MarkSweep
-            mmtk_build: release
-        os: [macos-latest, ubuntu-latest]
-        include:
-          - test_task: check
-      fail-fast: false
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      RUBY_DEBUG: ci
-
-    runs-on: ${{ matrix.os }}
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - name: Install libraries (macOS)
-        uses: ./.github/actions/setup/macos
-        if: ${{ contains(matrix.os, 'macos') }}
-
-      - name: Install libraries (Ubuntu)
-        uses: ./.github/actions/setup/ubuntu
-        if: ${{ contains(matrix.os, 'ubuntu') }}
-
-      - uses: ruby/setup-ruby@a6e6f86333f0a2523ece813039b8b4be04560854 # v1.190.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-        if: ${{ contains(matrix.os, 'ubuntu') }}
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          clean: true
-          dummy-files: false
-          # Set fetch-depth: 10 so that Launchable can receive commits information.
-          fetch-depth: 10
-
-      - name: make sure that kern.coredump=1
-        run: |
-          sysctl -n kern.coredump
-          sudo sysctl -w kern.coredump=1
-          sudo chmod -R +rwx /cores/
-        if: ${{ contains(matrix.os, 'macos') }}
-
-      - name: Delete unused SDKs
-        # To free up disk space to not run out during the run
-        run: |
-          sudo rm -rf ~/.dotnet
-          sudo rm -rf /Library/Android
-          sudo rm -rf /Library/Developer/CoreSimulator
-        continue-on-error: true
-        if: ${{ contains(matrix.os, 'macos') }}
-
-      - name: Setup Ruby GC Directory
-        run: |
-          echo "MODULAR_GC_DIR=$HOME/ruby_gc" >> $GITHUB_ENV
-
-      - name: Run configure
-        env:
-          arch: ${{ matrix.arch }}
-        run: >-
-          $SETARCH ../src/configure -C --disable-install-doc --with-modular-gc=${{ env.MODULAR_GC_DIR }}
-          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
-
-      - uses: actions-rust-lang/setup-rust-toolchain@v1
-      - name: Set MMTk environment variables
-        run: |
-          if [[ ${{ matrix.gc.mmtk_build }} == debug ]]; then
-            echo 'RUST_LOG=' >> $GITHUB_ENV
-            # Debug builds run much slower so we should increase the timeout
-            echo 'RUBY_TEST_TIMEOUT_SCALE=10' >> $GITHUB_ENV
-            # SYNTAX_SUGGEST_TIMEOUT defaults to 1 second
-            echo 'SYNTAX_SUGGEST_TIMEOUT=60' >> $GITHUB_ENV
-          fi
-          echo 'MMTK_PLAN=${{ matrix.gc.mmtk_plan }}' >> $GITHUB_ENV
-          echo 'EXCLUDES=../src/test/.excludes-mmtk' >> $GITHUB_ENV
-          echo 'MSPECOPT=-B../src/spec/mmtk.mspec' >> $GITHUB_ENV
-          echo 'GITHUB_WORKFLOW=ModGC' >> $GITHUB_ENV
-        if: ${{ matrix.gc.name == 'mmtk' }}
-
-      - run: $SETARCH make
-
-      - name: Build Modular  GC
-        run: |
-          echo "RUBY_GC_LIBRARY=${{ matrix.gc.name }}" >> $GITHUB_ENV
-          make install-modular-gc MODULAR_GC=${{ matrix.gc.name }} MMTK_BUILD=${{ matrix.gc.mmtk_build }}
-          make distclean-modular-gc MODULAR_GC=${{ matrix.gc.name }}
-
-      - run: $SETARCH make hello
-
-      - name: Set test options for skipped tests
-        run: |
-          set -x
-          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
-          echo "TESTS=${TESTS}" >> $GITHUB_ENV
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: ${{ matrix.os || 'ubuntu-22.04' }}
-          test-opts: ${{ matrix.configure }}
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-        continue-on-error: true
-
-      - name: make ${{ matrix.test_task }}
-        run: >-
-          $SETARCH make -s ${{ matrix.test_task }}
-          ${TESTS:+TESTS="$TESTS"}
-          ${{ !contains(matrix.test_task, 'bundle') && 'RUBYOPT=-w' || '' }}
-        timeout-minutes: ${{ matrix.gc.timeout || 40 }}
-        env:
-          RUBY_TESTOPTS: '-q --tty=no'
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-          PRECHECK_BUNDLED_GEMS: 'no'
-
-      - name: make skipped tests
-        run: |
-          $SETARCH make -s test-all TESTS="${TESTS//-n!\//-n/}"
-        env:
-          GNUMAKEFLAGS: ''
-          RUBY_TESTOPTS: '-v --tty=no'
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-  result:
-    if: ${{ always() }}
-    name: ${{ github.workflow }} result
-    runs-on: ubuntu-latest
-    needs: [check]
-    steps:
-      - run: exit 1
-        working-directory:
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/parsey.yml b/.github/workflows/parsey.yml
deleted file mode 100644
index 3d5e314eaf..0000000000
--- a/.github/workflows/parsey.yml
+++ /dev/null
@@ -1,95 +0,0 @@
-name: parse.y
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  make:
-    strategy:
-      matrix:
-        include:
-          - test_task: check
-          - test_task: test-bundler-parallel
-          - test_task: test-bundled-gems
-      fail-fast: false
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      RUBY_DEBUG: ci
-      SETARCH: ${{ matrix.arch && format('setarch {0}', matrix.arch) }}
-
-    runs-on: ubuntu-22.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/ubuntu
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          clean: true
-          dummy-files: ${{ matrix.test_task == 'check' }}
-
-      - name: Run configure
-        run: ../src/configure -C --disable-install-doc cppflags=-DRUBY_DEBUG --with-parser=parse.y
-
-      - run: make
-
-      - run: make TESTRUN_SCRIPT='-e "exit !RUBY_DESCRIPTION.include?(%[+PRISM])"' run
-
-      - name: make ${{ matrix.test_task }}
-        run: make -s ${{ matrix.test_task }} RUN_OPTS="$RUN_OPTS" SPECOPTS="$SPECOPTS"
-        env:
-          RUBY_TESTOPTS: ${{ matrix.testopts }}
-          EXCLUDES: '../src/test/.excludes-parsey'
-          RUN_OPTS: ${{ matrix.run_opts || '--parser=parse.y' }}
-          SPECOPTS: ${{ matrix.specopts || '-T --parser=parse.y' }}
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.run_opts }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/pr-playground.yml b/.github/workflows/pr-playground.yml
deleted file mode 100644
index cc06006142..0000000000
--- a/.github/workflows/pr-playground.yml
+++ /dev/null
@@ -1,127 +0,0 @@
-name: Post Playground link to PR
-on:
-  pull_request_target:
-    types: [labeled]
-  workflow_run:
-    workflows: ["WebAssembly"]
-    types: [completed]
-
-jobs:
-  post-summary:
-    name: Post Playground link
-    runs-on: ubuntu-latest
-    permissions:
-      pull-requests: write
-    # Post a comment only if the PR status check is passed and the PR is labeled with `Playground`.
-    # Triggered twice: when the PR is labeled and when PR build is passed.
-    if: >-
-      ${{ false
-      || (true
-        && github.event_name == 'pull_request_target'
-        && contains(github.event.pull_request.labels.*.name, 'Playground'))
-      || (true
-        && github.event_name == 'workflow_run'
-        && github.event.workflow_run.conclusion == 'success'
-        && github.event.workflow_run.event == 'pull_request')
-      }}
-    steps:
-      - uses: actions/github-script@60a0d83039c74a4aee543508d2ffcb1c3799cdea # v7.0.1
-        with:
-          github-token: ${{ secrets.GITHUB_TOKEN }}
-          script: |
-            const fs = require('fs/promises');
-
-            const buildWorkflowPath = '.github/workflows/wasm.yml';
-            const findSuccessfuBuildRun = async (pr) => {
-              const opts = github.rest.actions.listWorkflowRunsForRepo.endpoint.merge({
-                owner: context.repo.owner,
-                repo: context.repo.repo,
-                status: 'success',
-                branch: pr.head.ref,
-              });
-              const runs = await github.paginate(opts);
-              const buildRun = runs.find(run => run.path == buildWorkflowPath);
-              return buildRun;
-            }
-
-            const postComment = async (body, pr) => {
-              const { data: comments } = await github.rest.issues.listComments({
-                owner: context.repo.owner,
-                repo: context.repo.repo,
-                issue_number: pr.number,
-              });
-
-              const commentOpts = { owner: context.repo.owner, repo: context.repo.repo, body: comment };
-
-              const existingComment = comments.find(comment => comment.body.startsWith(magicComment));
-              if (existingComment) {
-                core.info(`Updating existing comment: ${existingComment.html_url}`);
-                await github.rest.issues.updateComment({
-                  ...commentOpts, comment_id: existingComment.id
-                });
-              } else {
-                await github.rest.issues.createComment({
-                  ...commentOpts, issue_number: pr.number
-                });
-              }
-            }
-
-            const derivePRNumber = async () => {
-              if (context.payload.pull_request) {
-                return context.payload.pull_request.number;
-              }
-              // Workaround for https://github.com/orgs/community/discussions/25220
-
-              const { data: { artifacts } } = await github.rest.actions.listWorkflowRunArtifacts({
-                owner: context.repo.owner,
-                repo: context.repo.repo,
-                run_id: context.payload.workflow_run.id,
-              });
-              const artifact = artifacts.find(artifact => artifact.name == 'github-pr-info');
-              if (!artifact) {
-                throw new Error('Cannot find github-pr-info.txt artifact');
-              }
-
-              const { data } = await github.rest.actions.downloadArtifact({
-                owner: context.repo.owner,
-                repo: context.repo.repo,
-                artifact_id: artifact.id,
-                archive_format: 'zip',
-              });
-
-              await fs.writeFile('pr-info.zip', Buffer.from(data));
-              await exec.exec('unzip', ['pr-info.zip']);
-              return await fs.readFile('github-pr-info.txt', 'utf8');
-            }
-
-            const prNumber = await derivePRNumber();
-
-            const { data: pr } = await github.rest.pulls.get({
-              owner: context.repo.owner,
-              repo: context.repo.repo,
-              pull_number: prNumber,
-            });
-
-            core.info(`Checking if the PR ${prNumber} is labeled with Playground...`);
-            if (!pr.labels.some(label => label.name == 'Playground')) {
-              core.info(`The PR is not labeled with Playground.`);
-              return;
-            }
-
-            core.info(`Checking if the build is successful for ${pr.head.ref} in ${pr.head.repo.owner.login}/${pr.head.repo.name}...`);
-            const buildRun = await findSuccessfuBuildRun(pr);
-            if (!buildRun) {
-              core.info(`No successful build run found for ${buildWorkflowPath} on ${pr.head.ref} yet.`);
-              return;
-            }
-            core.info(`Found a successful build run: ${buildRun.html_url}`);
-
-            const runLink = `${process.env.GITHUB_SERVER_URL}/${process.env.GITHUB_REPOSITORY}/actions/runs/${process.env.GITHUB_RUN_ID}`;
-            const magicComment = `<!-- AUTO-GENERATED-COMMENT-PR-PLAYGROUND -->`;
-            const comment = `${magicComment}
-            **Try on Playground**: https://ruby.github.io/play-ruby?run=${buildRun.id}
-            This is an automated comment by [\`pr-playground.yml\`](${runLink}) workflow.
-            `;
-            core.info(`Comment: ${comment}`);
-            await postComment(comment, pr);
-
diff --git a/.github/workflows/publish.yml b/.github/workflows/publish.yml
deleted file mode 100644
index 5d4474d978..0000000000
--- a/.github/workflows/publish.yml
+++ /dev/null
@@ -1,18 +0,0 @@
-name: Start release workflow
-on:
-  push:
-    tags:
-      - '*'
-
-jobs:
-  notify:
-    runs-on: ubuntu-latest
-    steps:
-      - name: Build release package
-        run: |
-          curl -L -X POST \
-            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
-            -H "Accept: application/vnd.github+json" \
-            -H "X-GitHub-Api-Version: 2022-11-28" \
-            https://api.github.com/repos/ruby/actions/dispatches \
-            -d '{"event_type": "${{ github.ref }}"}'
diff --git a/.github/workflows/release.yml b/.github/workflows/release.yml
deleted file mode 100644
index 5534e3defe..0000000000
--- a/.github/workflows/release.yml
+++ /dev/null
@@ -1,108 +0,0 @@
-name: Publish Ruby packages
-
-on:
-  repository_dispatch:
-    types:
-      - release
-  workflow_dispatch:
-    inputs:
-      version:
-        description: 'Version of the Ruby package to release'
-        required: true
-        default: '3.3.4'
-
-jobs:
-  release:
-    runs-on: ubuntu-latest
-    steps:
-      - uses: actions/checkout@v4
-
-      - uses: ruby/setup-ruby@v1
-        with:
-          ruby-version: 3.3.4
-
-      - name: Store Ruby version
-        run: |
-          echo "RUBY_VERSION=${{ github.event.client_payload.version || github.event.inputs.version }}" >> $GITHUB_ENV
-
-      - name: Store ABI version
-        run: echo "ABI_VERSION=$(echo ${{ env.RUBY_VERSION }} | cut -d '.' -f 1-2)" >> $GITHUB_ENV
-
-      - name: Copy draft package `/tmp` to `/pub` directory
-        run: tool/release.sh ${{ env.RUBY_VERSION }}
-        env:
-          AWS_ACCESS_KEY_ID: ${{ secrets.FTP_R_L_O_AWS_ACCESS_KEY_ID }}
-          AWS_SECRET_ACCESS_KEY: ${{ secrets.FTP_R_L_O_AWS_SECRET_ACCESS_KEY }}
-          AWS_DEFAULT_REGION: us-west-2
-
-      - name: Purge URLs of release package
-        run: |
-          curl -X POST \
-            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
-            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${{ env.ABI_VERSION }}/ruby-${{ env.RUBY_VERSION }}.tar.gz
-          curl -X POST \
-            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
-            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${{ env.ABI_VERSION }}/ruby-${{ env.RUBY_VERSION }}.tar.xz
-          curl -X POST \
-            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
-            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${{ env.ABI_VERSION }}/ruby-${{ env.RUBY_VERSION }}.zip
-
-      - name: Create a release on GitHub
-        run: |
-          RELEASE_TAG=$(echo v${{ env.RUBY_VERSION }} | sed 's/\./_/g')
-          echo $RELEASE_TAG
-          PREVIOUS_RELEASE_TAG=$(echo $RELEASE_TAG | awk 'BEGIN {FS="_"; OFS="_"}{ $NF=$NF-1; print }')
-          echo $PREVIOUS_RELEASE_TAG
-          tool/gen-github-release.rb $PREVIOUS_RELEASE_TAG $RELEASE_TAG --no-dry-run
-        env:
-          GITHUB_TOKEN: ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}
-
-      - name: Update versions index
-        run: |
-          curl -L -X POST \
-            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
-            -H "Accept: application/vnd.github+json" \
-            -H "X-GitHub-Api-Version: 2022-11-28" \
-            https://api.github.com/repos/ruby/actions/dispatches \
-            -d '{"event_type": "update_index"}'
-
-      - name: Set latest flag for Ruby 3.3
-        if: contains(${{ env.RUBY_VERSION }}, '3.3.')
-        run: |
-          echo "LATEST=true" >> $GITHUB_ENV
-
-      - name: Build and push Docker images
-        run: |
-          curl -L -X POST \
-            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
-            -H "Accept: application/vnd.github+json" \
-            -H "X-GitHub-Api-Version: 2022-11-28" \
-            https://api.github.com/repos/ruby/docker-images/dispatches \
-            -d '{"event_type": "build", "client_payload": {"ruby_version": "${{ env.RUBY_VERSION }}", "arch": "amd64", "latest": "${{ env.LATEST }}"}}'
-
-      - name: Build snapcraft packages
-        run: |
-          curl -L -X POST \
-            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
-            -H "Accept: application/vnd.github+json" \
-            -H "X-GitHub-Api-Version: 2022-11-28" \
-            https://api.github.com/repos/ruby/snap.ruby/dispatches \
-            -d '{"event_type": "build", "client_payload": {"ruby_version": "${{ env.RUBY_VERSION }}"}}'
-
-      - name: Update ruby-build definition
-        run: |
-          curl -L -X POST \
-            -H "Authorization: Bearer ${{ secrets.RUBY_BUILD_WORKFLOW_TOKEN }}" \
-            -H "Accept: application/vnd.github+json" \
-            -H "X-GitHub-Api-Version: 2022-11-28" \
-            https://api.github.com/repos/rbenv/ruby-build/dispatches \
-            -d '{"event_type": "update-ruby", "client_payload": {"ruby_version": "${{ env.RUBY_VERSION }}", "openssl_version": "3.0.15"}}'
-
-      - name: Update all-ruby definition
-        run: |
-          curl -L -X POST \
-            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
-            -H "Accept: application/vnd.github+json" \
-            -H "X-GitHub-Api-Version: 2022-11-28" \
-            https://api.github.com/repos/ruby/all-ruby/dispatches \
-            -d '{"event_type": "update"}'
diff --git a/.github/workflows/rjit-bindgen.yml b/.github/workflows/rjit-bindgen.yml
deleted file mode 100644
index c2ec4a6a68..0000000000
--- a/.github/workflows/rjit-bindgen.yml
+++ /dev/null
@@ -1,86 +0,0 @@
-name: RJIT bindgen
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  make:
-    strategy:
-      matrix:
-        include:
-          - task: rjit-bindgen
-      fail-fast: false
-
-    runs-on: ubuntu-20.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - name: Set up Ruby
-        uses: ruby/setup-ruby@a6e6f86333f0a2523ece813039b8b4be04560854 # v1.190.0
-        with:
-          ruby-version: '3.1'
-
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/ubuntu
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-
-      - name: Run configure
-        run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install --enable-yjit=dev_nodebug
-
-      - run: make
-
-      - run: make install
-
-      - run: make ${{ matrix.task }}
-
-      - run: git diff --exit-code
-        working-directory: src
-
-      - uses: ./.github/actions/slack
-        with:
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/rjit.yml b/.github/workflows/rjit.yml
deleted file mode 100644
index a2358668f0..0000000000
--- a/.github/workflows/rjit.yml
+++ /dev/null
@@ -1,131 +0,0 @@
-name: RJIT
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '**.[1-8]'
-      - '**.ronn'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '**.[1-8]'
-      - '**.ronn'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  make:
-    strategy:
-      matrix:
-        # main variables included in the job name
-        test_task: [check]
-        run_opts: ['--rjit-call-threshold=1']
-        arch: ['']
-      fail-fast: false
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      RUBY_DEBUG: ci
-      SETARCH: ${{ matrix.arch && format('setarch {0}', matrix.arch) }}
-
-    runs-on: ubuntu-22.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/ubuntu
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          # Set fetch-depth: 10 so that Launchable can receive commits information.
-          fetch-depth: 10
-
-      - name: Run configure
-        env:
-          arch: ${{ matrix.arch }}
-        run: >-
-          $SETARCH ../src/configure -C --disable-install-doc cppflags=-DRUBY_DEBUG
-          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
-
-      - run: $SETARCH make
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: ubuntu-22.04
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-          test-opts: ${{ matrix.run_opts }}
-          test-tasks: '["test", "test-all", "test-spec"]'
-        continue-on-error: true
-
-      - name: make test
-        run: |
-          $SETARCH make -s test RUN_OPTS="$RUN_OPTS"
-        timeout-minutes: 30
-        env:
-          GNUMAKEFLAGS: ''
-          RUBY_TESTOPTS: >-
-            ${{ env.TESTS }}
-            --tty=no
-          RUN_OPTS: ${{ matrix.run_opts }}
-
-      - name: make test-all
-        run: >-
-          $SETARCH make -s test-all
-          RUN_OPTS="$RUN_OPTS"
-          ${TESTS:+TESTS="$TESTS"}
-        timeout-minutes: 60
-        env:
-          GNUMAKEFLAGS: ''
-          RUBY_TESTOPTS: '-q --tty=no'
-          RUN_OPTS: ${{ matrix.run_opts }}
-
-      - name: make test-spec
-        run: |
-          $SETARCH make -s test-spec RUN_OPTS="$RUN_OPTS"
-        timeout-minutes: 10
-        env:
-          GNUMAKEFLAGS: ''
-          RUN_OPTS: ${{ matrix.run_opts }}
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.run_opts }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/scorecards.yml b/.github/workflows/scorecards.yml
deleted file mode 100644
index afc41298ba..0000000000
--- a/.github/workflows/scorecards.yml
+++ /dev/null
@@ -1,72 +0,0 @@
-# This workflow uses actions that are not certified by GitHub. They are provided
-# by a third-party and are governed by separate terms of service, privacy
-# policy, and support documentation.
-
-name: Scorecards supply-chain security
-on:
-  # For Branch-Protection check. Only the default branch is supported. See
-  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#branch-protection
-  branch_protection_rule:
-  # To guarantee Maintained check is occasionally updated. See
-  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#maintained
-  schedule:
-    - cron: '22 4 * * 2'
-  # push:
-  #   branches: [ "master" ]
-
-# Declare default permissions as read only.
-permissions: read-all
-
-jobs:
-  analysis:
-    name: Scorecards analysis
-    runs-on: ubuntu-latest
-    permissions:
-      # Needed to upload the results to code-scanning dashboard.
-      security-events: write
-      # Needed to publish results and get a badge (see publish_results below).
-      id-token: write
-      # Uncomment the permissions below if installing in a private repository.
-      # contents: read
-      # actions: read
-
-    steps:
-      - name: 'Checkout code'
-        uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          persist-credentials: false
-
-      - name: 'Run analysis'
-        uses: ossf/scorecard-action@62b2cac7ed8198b15735ed49ab1e5cf35480ba46 # v2.4.0
-        with:
-          results_file: results.sarif
-          results_format: sarif
-          # (Optional) Read-only PAT token. Uncomment the `repo_token` line below if:
-          # - you want to enable the Branch-Protection check on a *public* repository, or
-          # - you are installing Scorecards on a *private* repository
-          # To create the PAT, follow the steps in https://github.com/ossf/scorecard-action#authentication-with-pat.
-          repo_token: ${{ secrets.SCORECARD_READ_TOKEN }}
-
-          # Public repositories:
-          #   - Publish results to OpenSSF REST API for easy access by consumers
-          #   - Allows the repository to include the Scorecard badge.
-          #   - See https://github.com/ossf/scorecard-action#publishing-results.
-          # For private repositories:
-          #   - `publish_results` will always be set to `false`, regardless
-          #     of the value entered here.
-          publish_results: true
-
-      # Upload the results as artifacts (optional). Commenting out will disable uploads of run results in SARIF
-      # format to the repository Actions tab.
-      # - name: "Upload artifact"
-      #   uses: actions/upload-artifact@0b7f8abb1508181956e8e162db84b466c27e18ce # v3.1.2
-      #   with:
-      #     name: SARIF file
-      #     path: results.sarif
-      #     retention-days: 5
-
-      # Upload the results to GitHub's code scanning dashboard.
-      - name: 'Upload to code-scanning'
-        uses: github/codeql-action/upload-sarif@df409f7d9260372bd5f19e5b04e83cb3c43714ae # v3.27.9
-        with:
-          sarif_file: results.sarif
diff --git a/.github/workflows/spec_guards.yml b/.github/workflows/spec_guards.yml
deleted file mode 100644
index 321099f024..0000000000
--- a/.github/workflows/spec_guards.yml
+++ /dev/null
@@ -1,66 +0,0 @@
-name: Rubyspec Version Guards Check
-
-on:
-  push:
-    paths:
-      - 'spec/**'
-      - '!spec/*.md'
-  pull_request:
-    paths:
-      - 'spec/**'
-      - '!spec/*.md'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  rubyspec:
-    name: Rubyspec
-
-    runs-on: ubuntu-20.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    strategy:
-      matrix:
-        # Specs from ruby/spec should still run on all supported Ruby versions.
-        # This also ensures the needed ruby_version_is guards are there, see spec/README.md.
-        ruby:
-          - ruby-3.0
-          - ruby-3.1
-          - ruby-3.2
-          - ruby-3.3
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-
-      - uses: ruby/setup-ruby@a6e6f86333f0a2523ece813039b8b4be04560854 # v1.190.0
-        with:
-          ruby-version: ${{ matrix.ruby }}
-          bundler: none
-
-      - run: gem install webrick
-
-      - run: ruby ../mspec/bin/mspec
-        working-directory: spec/ruby
-        env:
-          CHECK_LEAKS: true
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.ruby }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
diff --git a/.github/workflows/ubuntu.yml b/.github/workflows/ubuntu.yml
deleted file mode 100644
index 2a77d03878..0000000000
--- a/.github/workflows/ubuntu.yml
+++ /dev/null
@@ -1,156 +0,0 @@
-name: Ubuntu
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    # Do not use paths-ignore for required status checks
-    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  make:
-    strategy:
-      matrix:
-        include:
-          - test_task: check
-            configure: 'cppflags=-DVM_CHECK_MODE'
-          - test_task: check
-            arch: i686
-          - test_task: check
-            configure: '--disable-yjit'
-          - test_task: check
-            configure: '--enable-shared --enable-load-relative'
-          - test_task: test-bundler-parallel
-            timeout: 50
-          - test_task: test-bundled-gems
-          - test_task: check
-            os: ubuntu-20.04
-          - test_task: check
-            os: ubuntu-24.04
-      fail-fast: false
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      RUBY_DEBUG: ci
-
-    runs-on: ${{ matrix.os || 'ubuntu-22.04' }}
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/ubuntu
-        with:
-          arch: ${{ matrix.arch }}
-
-      - uses: ruby/setup-ruby@a6e6f86333f0a2523ece813039b8b4be04560854 # v1.190.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          clean: true
-          dummy-files: ${{ matrix.test_task == 'check' }}
-          # Set fetch-depth: 10 so that Launchable can receive commits information.
-          fetch-depth: 10
-
-      - name: Run configure
-        env:
-          arch: ${{ matrix.arch }}
-          configure: ${{ matrix.configure }}
-        run: >-
-          $SETARCH ../src/configure -C --disable-install-doc ${configure:-cppflags=-DRUBY_DEBUG}
-          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
-
-      - run: $SETARCH make prepare-gems
-        if: ${{ matrix.test_task == 'test-bundled-gems' }}
-
-      - run: $SETARCH make
-
-      - run: $SETARCH make hello
-
-      - name: Set test options for skipped tests
-        run: |
-          set -x
-          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
-          echo "TESTS=${TESTS}" >> $GITHUB_ENV
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: ${{ matrix.os || 'ubuntu-22.04' }}
-          test-opts: ${{ matrix.configure }}
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-        continue-on-error: true
-
-      - name: make ${{ matrix.test_task }}
-        run: >-
-          $SETARCH make -s ${{ matrix.test_task }}
-          ${TESTS:+TESTS="$TESTS"}
-          ${{ !contains(matrix.test_task, 'bundle') && 'RUBYOPT=-w' || '' }}
-        timeout-minutes: ${{ matrix.timeout || 40 }}
-        env:
-          RUBY_TESTOPTS: '-q --tty=no'
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-          PRECHECK_BUNDLED_GEMS: 'no'
-
-      - name: make skipped tests
-        run: |
-          $SETARCH make -s test-all TESTS="${TESTS//-n!\//-n/}"
-        env:
-          GNUMAKEFLAGS: ''
-          RUBY_TESTOPTS: '-v --tty=no'
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-  result:
-    if: ${{ always() }}
-    name: ${{ github.workflow }} result
-    runs-on: ubuntu-latest
-    needs: [make]
-    steps:
-      - run: exit 1
-        working-directory:
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/wasm.yml b/.github/workflows/wasm.yml
deleted file mode 100644
index 7c2a384bae..0000000000
--- a/.github/workflows/wasm.yml
+++ /dev/null
@@ -1,181 +0,0 @@
-name: WebAssembly
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions: # added using https://github.com/step-security/secure-workflows
-  contents: read
-
-jobs:
-  make:
-    strategy:
-      matrix:
-        entry:
-#         # wasmtime can't compile non-optimized Asyncified binary due to locals explosion
-#         - { name: O0-debuginfo, optflags: '-O0', debugflags: '-g', wasmoptflags: '-O1' }
-#         - { name: O1,           optflags: '-O1', debugflags: ''  , wasmoptflags: '-O1' }
-          - { name: O2, optflags: '-O2', debugflags: '', wasmoptflags: '-O2' }
-#         - { name: O3,           optflags: '-O3', debugflags: ''  , wasmoptflags: '-O3' }
-#         # -O4 is equivalent to -O3 in clang, but it's different in wasm-opt
-#         - { name: O4,           optflags: '-O3', debugflags: ''  , wasmoptflags: '-O4' }
-#         - { name: Oz,           optflags: '-Oz', debugflags: ''  , wasmoptflags: '-Oz' }
-      fail-fast: false
-
-    env:
-      RUBY_TESTOPTS: '-q --tty=no'
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      WASI_SDK_VERSION_MAJOR: 20
-      WASI_SDK_VERSION_MINOR: 0
-      BINARYEN_VERSION: 113
-      WASMTIME_VERSION: v15.0.0
-
-    runs-on: ubuntu-20.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-
-      - name: Install libraries
-        run: |
-          set -ex
-          sudo apt-get update -q || :
-          sudo apt-get install --no-install-recommends -q -y ruby make autoconf git wget
-
-          wasi_sdk_deb="wasi-sdk_${WASI_SDK_VERSION_MAJOR}.${WASI_SDK_VERSION_MINOR}_amd64.deb"
-          wget "https://github.com/WebAssembly/wasi-sdk/releases/download/wasi-sdk-${WASI_SDK_VERSION_MAJOR}/${wasi_sdk_deb}"
-          sudo dpkg -i "$wasi_sdk_deb"
-          rm -f "$wasi_sdk_deb"
-
-          mkdir build-sdk
-          pushd build-sdk
-
-          wasmtime_url="https://github.com/bytecodealliance/wasmtime/releases/download/${WASMTIME_VERSION}/wasmtime-${WASMTIME_VERSION}-x86_64-linux.tar.xz"
-          wget -O - "$wasmtime_url" | tar xJf -
-          sudo ln -fs "$PWD/wasmtime-${WASMTIME_VERSION}-x86_64-linux/wasmtime" /usr/local/bin/wasmtime
-
-          binaryen_tarball="binaryen-version_${BINARYEN_VERSION}-x86_64-linux.tar.gz"
-          binaryen_url="https://github.com/WebAssembly/binaryen/releases/download/version_${BINARYEN_VERSION}/${binaryen_tarball}"
-          wget -O - "$binaryen_url" | tar xfz -
-          sudo ln -fs "$PWD/binaryen-version_${BINARYEN_VERSION}/bin/wasm-opt" /usr/local/bin/wasm-opt
-        working-directory: src
-
-      - name: Set ENV
-        run: |
-          echo "WASI_SDK_PATH=/opt/wasi-sdk" >> $GITHUB_ENV
-
-      - uses: ruby/setup-ruby@a6e6f86333f0a2523ece813039b8b4be04560854 # v1.190.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-
-      - name: Build baseruby
-        run: |
-          set -ex
-          mkdir ../baseruby
-          pushd ../baseruby
-          ../src/configure --prefix=$PWD/install
-          make
-          make install
-
-      - name: Download config.guess with wasi version
-        run: |
-          rm tool/config.guess tool/config.sub
-          ruby tool/downloader.rb -d tool -e gnu config.guess config.sub
-        working-directory: src
-
-      - name: Run configure
-        run: |
-          ../src/configure \
-            --host wasm32-unknown-wasi \
-            --with-baseruby=$PWD/../baseruby/install/bin/ruby \
-            --with-static-linked-ext \
-            --with-ext=cgi/escape,continuation,coverage,date,digest/bubblebabble,digest,digest/md5,digest/rmd160,digest/sha1,digest/sha2,etc,fcntl,json,json/generator,json/parser,objspace,pathname,rbconfig/sizeof,ripper,stringio,strscan,monitor \
-            LDFLAGS=" \
-              -Xlinker --stack-first \
-              -Xlinker -z -Xlinker stack-size=16777216 \
-            " \
-            optflags="${{ matrix.entry.optflags }}" \
-            debugflags="${{ matrix.entry.debugflags }}" \
-            wasmoptflags="${{ matrix.entry.wasmoptflags }} ${{ matrix.entry.debugflags }}"
-
-      # miniruby may not be built when cross-compling
-      - run: make mini ruby
-
-      - run: make install DESTDIR=$PWD/../install
-      - run: tar cfz ../install.tar.gz -C ../install .
-
-      - name: Upload artifacts
-        uses: actions/upload-artifact@604373da6381bf24206979c74d06a550515601b9 # v4.4.1
-        with:
-          name: ruby-wasm-install
-          path: ${{ github.workspace }}/install.tar.gz
-      - name: Show Playground URL to try the build
-        run: |
-          echo "Try on Playground: https://ruby.github.io/play-ruby?run=$GITHUB_RUN_ID" >> $GITHUB_STEP_SUMMARY
-
-      - name: Run basictest
-        run: wasmtime run ./../build/miniruby --mapdir /::./ -- basictest/test.rb
-        working-directory: src
-
-      - name: Run bootstraptest (no thread)
-        run: |
-          NO_THREAD_TESTS="$(grep -L Thread -R ./bootstraptest | awk -F/ '{ print $NF }' | uniq | sed -n 's/test_\(.*\).rb/\1/p' | paste -s -d, -)"
-          ruby ./bootstraptest/runner.rb --ruby="$(which wasmtime) run $PWD/../build/ruby --mapdir /::./ -- " --verbose "--sets=$NO_THREAD_TESTS"
-        working-directory: src
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.entry.name }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-      # Workaround for https://github.com/orgs/community/discussions/25220
-      - name: Save Pull Request number
-        if: ${{ github.event_name == 'pull_request' }}
-        run: echo "${{ github.event.pull_request.number }}" >> ${{ github.workspace }}/github-pr-info.txt
-      - uses: actions/upload-artifact@604373da6381bf24206979c74d06a550515601b9 # v4.4.1
-        if: ${{ github.event_name == 'pull_request' }}
-        with:
-          name: github-pr-info
-          path: ${{ github.workspace }}/github-pr-info.txt
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/windows.yml b/.github/workflows/windows.yml
deleted file mode 100644
index 90c8af82d6..0000000000
--- a/.github/workflows/windows.yml
+++ /dev/null
@@ -1,212 +0,0 @@
-name: Windows
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    # Do not use paths-ignore for required status checks
-    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  make:
-    strategy:
-      matrix:
-        include:
-          - vc: 2015
-            vs: 2019
-            vcvars: '10.0.14393.0 -vcvars_ver=14.0' # The oldest Windows 10 SDK w/ VC++ 2015 toolset (v140)
-            test_task: check
-          - vs: 2019
-            test_task: check
-          - vs: 2022
-            test_task: check
-          - vs: 2022
-            test_task: test-bundled-gems
-      fail-fast: false
-
-    runs-on: windows-${{ matrix.vs < 2022 && '2019' || matrix.vs }}
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    name: VisualStudio ${{ matrix.vc || matrix.vs }} (${{ matrix.test_task }})
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      OS_VER: windows-${{ matrix.vs < 2022 && '2019' || matrix.vs }}
-      VCPKG_DEFAULT_TRIPLET: ${{ matrix.target || 'x64' }}-windows
-
-    steps:
-      - run: md build
-        working-directory:
-
-      - name: find tools
-        id: find-tools
-        run: |
-          ::- find needed tools
-          set NEEDS=
-          for %%I in (%NEEDED_TOOLS%) do if "%%~$PATH:I" == "" (
-            call set NEEDS=%%NEEDS%% %%~nI
-          ) else (
-            echo %%I: %%~$PATH:I
-          )
-          echo.needs=%NEEDS%>>%GITHUB_OUTPUT%
-          if "%NEEDS%" == "" (
-            echo [debug] All needed tools found
-          ) else (
-            echo [warning^]Needs%NEEDS%
-          )
-        env:
-          NEEDED_TOOLS: >-
-            patch.exe
-
-      - uses: msys2/setup-msys2@d40200dc2db4c351366b048a9565ad82919e1c24 # v2
-        id: setup-msys2
-        with:
-          update: true
-          install: >-
-            ${{ steps.find-tools.outputs.needs }}
-        if: ${{ steps.find-tools.outputs.needs != '' }}
-
-      - uses: ruby/setup-ruby@a6e6f86333f0a2523ece813039b8b4be04560854 # v1.190.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-          windows-toolchain: none
-
-      - name: Export GitHub Actions cache environment variables
-        uses: actions/github-script@v7
-        with:
-          script: |
-            core.exportVariable('ACTIONS_CACHE_URL', process.env.ACTIONS_CACHE_URL || '');
-            core.exportVariable('ACTIONS_RUNTIME_TOKEN', process.env.ACTIONS_RUNTIME_TOKEN || '');
-
-      - name: Install libraries with scoop
-        run: |
-          iex "& {$(irm get.scoop.sh)} -RunAsAdmin"
-          Join-Path (Resolve-Path ~).Path "scoop\shims" >> $Env:GITHUB_PATH
-        shell: pwsh
-
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-
-      - name: setup env
-        # Available Ruby versions: https://github.com/actions/runner-images/blob/main/images/windows/Windows2019-Readme.md#ruby
-        # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
-        # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
-        run: |
-          ::- Set up VC ${{ matrix.vc || matrix.vs }}
-          set vswhere="%ProgramFiles(x86)%\Microsoft Visual Studio\Installer\vswhere.exe"
-          for /f "delims=;" %%I in ('%vswhere% -latest -property installationPath') do (
-            set VCVARS="%%I\VC\Auxiliary\Build\vcvars64.bat"
-          )
-          set VCVARS
-          set | C:\msys64\usr\bin\sort > old.env
-          call %VCVARS% ${{ matrix.vcvars || '' }}
-          nmake -f nul
-          set TMP=%USERPROFILE%\AppData\Local\Temp
-          set TEMP=%USERPROFILE%\AppData\Local\Temp
-          set MAKEFLAGS=l
-          set /a TEST_JOBS=(15 * %NUMBER_OF_PROCESSORS% / 10) > nul
-          set | C:\msys64\usr\bin\sort > new.env
-          C:\msys64\usr\bin\comm -13 old.env new.env >> %GITHUB_ENV%
-          del *.env
-
-      - name: baseruby version
-        run: ruby -v
-
-      - name: compiler version
-        run: cl
-
-      - name: volume info
-        run: Get-Volume
-        shell: pwsh
-
-      - name: Install libraries with vcpkg
-        run: |
-          vcpkg install
-        working-directory: src
-        env:
-          VCPKG_BINARY_SOURCES: "clear;x-gha,readwrite"
-
-      # TODO: We should use `../src` instead of `D:/a/ruby/ruby/src`
-      - name: Configure
-        run: >-
-          ../src/win32/configure.bat --disable-install-doc
-          --with-opt-dir=D:/a/ruby/ruby/src/vcpkg_installed/%VCPKG_DEFAULT_TRIPLET%
-
-      - run: nmake prepare-vcpkg
-
-      - run: nmake incs
-
-      - run: nmake extract-extlibs
-
-      # On all other platforms, test-spec depending on extract-gems (in common.mk) is enough.
-      # But not for this Visual Studio workflow. So here we extract gems before building.
-      - run: nmake extract-gems
-
-      - run: nmake
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: windows-${{ matrix.vs < 2022 && '2019' || matrix.vs }}
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-          test-task: ${{ matrix.test_task || 'check' }}
-        continue-on-error: true
-        if: ${{ matrix.test_task != 'test-bundled-gems' }}
-
-      - run: nmake ${{ matrix.test_task || 'check' }}
-        env:
-          RUBY_TESTOPTS: -j${{ env.TEST_JOBS || 4 }}
-        timeout-minutes: 70
-
-      - uses: ./.github/actions/slack
-        with:
-          label: VS${{ matrix.vc || matrix.vs }} / ${{ matrix.test_task || 'check' }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-  result:
-    if: ${{ always() }}
-    name: ${{ github.workflow }} result
-    runs-on: windows-latest
-    needs: [make]
-    steps:
-      - run: exit 1
-        working-directory:
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-
-defaults:
-  run:
-    working-directory: build
-    shell: cmd
diff --git a/.github/workflows/yjit-macos.yml b/.github/workflows/yjit-macos.yml
deleted file mode 100644
index b322abbfa1..0000000000
--- a/.github/workflows/yjit-macos.yml
+++ /dev/null
@@ -1,171 +0,0 @@
-name: YJIT macOS Arm64
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    # Do not use paths-ignore for required status checks
-    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  cargo:
-    name: cargo test
-
-    runs-on: macos-14
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-
-      - run: RUST_BACKTRACE=1 cargo test
-        working-directory: yjit
-
-      # Also compile and test with all features enabled
-      - run: RUST_BACKTRACE=1 cargo test --all-features
-        working-directory: yjit
-
-      # Check that we can build in release mode too
-      - run: cargo build --release
-        working-directory: yjit
-
-  make:
-    strategy:
-      matrix:
-        include:
-          - test_task: 'check'
-            configure: '--enable-yjit'
-            yjit_opts: '--yjit'
-          - test_task: 'check'
-            configure: '--enable-yjit=dev'
-            yjit_opts: '--yjit-call-threshold=1 --yjit-verify-ctx --yjit-code-gc'
-            specopts: '-T --yjit-call-threshold=1 -T --yjit-verify-ctx -T --yjit-code-gc'
-      fail-fast: false
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      RUN_OPTS: ${{ matrix.yjit_opts }}
-      SPECOPTS: ${{ matrix.specopts }}
-
-    runs-on: macos-14
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - name: Install libraries
-        uses: ./.github/actions/setup/macos
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          dummy-files: ${{ matrix.test_task == 'check' }}
-          # Set fetch-depth: 10 so that Launchable can receive commits information.
-          fetch-depth: 10
-
-      - name: Run configure
-        run: ../src/configure -C --disable-install-doc ${{ matrix.configure }}
-
-      - run: make prepare-gems
-        if: ${{ matrix.test_task == 'test-bundled-gems' }}
-
-      - run: make
-
-      - name: Enable YJIT through ENV
-        run: echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
-
-      - name: Set test options for skipped tests
-        run: |
-          set -x
-          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
-          echo "TESTS=${TESTS}" >> $GITHUB_ENV
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: macos-14
-          test-opts: ${{ matrix.configure }}
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-          is-yjit: true
-        continue-on-error: true
-
-      - name: make ${{ matrix.test_task }}
-        run: >-
-          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"}
-          RUN_OPTS="$RUN_OPTS"
-          SPECOPTS="$SPECOPTS"
-        timeout-minutes: 60
-        env:
-          RUBY_TESTOPTS: '-q --tty=no'
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-          SYNTAX_SUGGEST_TIMEOUT: '5'
-          PRECHECK_BUNDLED_GEMS: 'no'
-        continue-on-error: ${{ matrix.continue-on-test_task || false }}
-
-      - name: make skipped tests
-        run: |
-          make -s test-all TESTS="${TESTS//-n!\//-n/}"
-        env:
-          GNUMAKEFLAGS: ''
-          RUBY_TESTOPTS: '-v --tty=no'
-          PRECHECK_BUNDLED_GEMS: 'no'
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.test_task }} ${{ matrix.configure }} ${{ matrix.yjit_opts }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-  result:
-    if: ${{ always() }}
-    name: ${{ github.workflow }} result
-    runs-on: macos-14
-    needs: [make]
-    steps:
-      - run: exit 1
-        working-directory:
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/yjit-ubuntu.yml b/.github/workflows/yjit-ubuntu.yml
deleted file mode 100644
index f1c62c6c77..0000000000
--- a/.github/workflows/yjit-ubuntu.yml
+++ /dev/null
@@ -1,222 +0,0 @@
-name: YJIT Ubuntu
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    # Do not use paths-ignore for required status checks
-    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  cargo:
-    name: cargo test
-
-    # GitHub Action's image seems to already contain a Rust 1.58.0.
-    runs-on: ubuntu-20.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-
-      # For now we can't run cargo test --offline because it complains about the
-      # capstone dependency, even though the dependency is optional
-      #- run: cargo test --offline
-
-      - run: RUST_BACKTRACE=1 cargo test
-        working-directory: yjit
-
-      # Also compile and test with all features enabled
-      - run: RUST_BACKTRACE=1 cargo test --all-features
-        working-directory: yjit
-
-      # Check that we can build in release mode too
-      - run: cargo build --release
-        working-directory: yjit
-
-  lint:
-    name: cargo clippy
-
-    # GitHub Action's image seems to already contain a Rust 1.58.0.
-    runs-on: ubuntu-20.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-
-      # Check that we don't have linting errors in release mode, too
-      - run: cargo clippy --all-targets --all-features
-        working-directory: yjit
-
-  make:
-    strategy:
-      fail-fast: false
-      matrix:
-        include:
-          - test_task: 'yjit-bindgen'
-            hint: 'To fix: use patch in logs'
-            configure: '--with-gcc=clang-12 --enable-yjit=dev'
-
-          - test_task: 'check'
-            # YJIT should be automatically built in release mode on x86-64 Linux with rustc present
-            #configure: "--enable-yjit RUSTC='rustc +1.58.0'"
-            configure: "RUSTC='rustc +1.58.0'"
-            rust_version: '1.58.0'
-
-          - test_task: 'check'
-            configure: '--enable-yjit=dev'
-
-          - test_task: 'check'
-            configure: '--enable-yjit=dev'
-            yjit_opts: '--yjit-call-threshold=1 --yjit-verify-ctx --yjit-code-gc'
-            specopts: '-T --yjit-call-threshold=1 -T --yjit-verify-ctx -T --yjit-code-gc'
-
-          - test_task: 'test-bundled-gems'
-            configure: '--enable-yjit=dev'
-
-          - test_task: 'yjit-bench'
-            configure: '--enable-yjit=dev'
-            yjit_bench_opts: '--yjit-stats'
-            continue-on-test_task: true
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      RUN_OPTS: ${{ matrix.yjit_opts }}
-      YJIT_BENCH_OPTS: ${{ matrix.yjit_bench_opts }}
-      SPECOPTS: ${{ matrix.specopts }}
-      RUBY_DEBUG: ci
-      BUNDLE_JOBS: 8 # for yjit-bench
-      RUST_BACKTRACE: 1
-
-    runs-on: ubuntu-20.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@d632683dd7b4114ad314bca15554477dd762a938 # v4.2.0
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/ubuntu
-
-      - uses: ruby/setup-ruby@a6e6f86333f0a2523ece813039b8b4be04560854 # v1.190.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          dummy-files: ${{ matrix.test_task == 'check' }}
-          # Set fetch-depth: 10 so that Launchable can receive commits information.
-          fetch-depth: 10
-
-      - name: Install Rust
-        if: ${{ matrix.rust_version }}
-        run: rustup install ${{ matrix.rust_version }} --profile minimal
-
-      - name: Run configure
-        run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install ${{ matrix.configure }}
-
-      - run: make incs
-
-      - run: make prepare-gems
-        if: ${{ matrix.test_task == 'test-bundled-gems' }}
-
-      - run: make
-
-      - name: Enable YJIT through ENV
-        run: echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
-
-      # Check that the binary was built with YJIT
-      - name: Check YJIT enabled
-        run: ./miniruby --yjit -v | grep "+YJIT"
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: ubuntu-20.04
-          test-opts: ${{ matrix.configure }}
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-          is-yjit: true
-        continue-on-error: true
-
-      - name: make ${{ matrix.test_task }}
-        run: >-
-          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"}
-          RUN_OPTS="$RUN_OPTS" MSPECOPT=--debug SPECOPTS="$SPECOPTS"
-          YJIT_BENCH_OPTS="$YJIT_BENCH_OPTS" YJIT_BINDGEN_DIFF_OPTS="$YJIT_BINDGEN_DIFF_OPTS"
-        timeout-minutes: 90
-        env:
-          RUBY_TESTOPTS: '-q --tty=no'
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-          PRECHECK_BUNDLED_GEMS: 'no'
-          SYNTAX_SUGGEST_TIMEOUT: '5'
-          YJIT_BINDGEN_DIFF_OPTS: '--exit-code'
-        continue-on-error: ${{ matrix.continue-on-test_task || false }}
-
-      - name: Show ${{ github.event.pull_request.base.ref }} GitHub URL for yjit-bench comparison
-        run: echo "https://github.com/${BASE_REPO}/commit/${BASE_SHA}"
-        env:
-          BASE_REPO: ${{ github.event.pull_request.base.repo.full_name }}
-          BASE_SHA: ${{ github.event.pull_request.base.sha }}
-        if: ${{ matrix.test_task == 'yjit-bench' && startsWith(github.event_name, 'pull') }}
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.test_task }} ${{ matrix.configure }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-  result:
-    if: ${{ always() }}
-    name: ${{ github.workflow }} result
-    runs-on: ubuntu-latest
-    needs: [make]
-    steps:
-      - run: exit 1
-        working-directory:
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.gitignore b/.gitignore
index f61ce9f889..efc7fd5864 100644
--- a/.gitignore
+++ b/.gitignore
@@ -4,32 +4,25 @@
 *.a
 *.bak
 *.bc
-*.bundle
 *.dSYM
 *.dmyh
 *.dylib
 *.elc
 *.i
-*.ii
 *.inc
 *.log
 *.o
-*.o.tmp
 *.obj
 *.old
 *.orig
-*.pch
 *.pdb
-*.rbinc
 *.rej
 *.s
 *.sav
-*.sl
-*.so
-*.so.*
 *.swp
 *.yarb
 *~
+.*-*
 .*.list
 .*.time
 .DS_Store
@@ -39,8 +32,6 @@
 .pc
 .ppack
 .svn
-.time
-.ruby-version
 Makefile
 cygruby*.def
 extconf.h
@@ -49,8 +40,6 @@ y.tab.c
 *.gcda
 *.gcno
 *.gcov
-*.vscode
-!misc/.vscode
 lcov*.info
 
 # /
@@ -61,11 +50,7 @@ lcov*.info
 /*.pc
 /*.rc
 /*_prelude.c
-/.downloaded-cache
-/.top-enc.mk
-/build*/
 /COPYING.LIB
-/ChangeLog
 /Doxyfile
 /GNUmakefile
 /README.atheos
@@ -75,7 +60,6 @@ lcov*.info
 /archive
 /autom4te*.cache
 /automake
-/benchmark/benchmark-driver
 /beos
 /bmlog-*
 /breakpoints.gdb
@@ -123,34 +107,23 @@ lcov*.info
 /rename2.h
 /repack
 /revision.h
-/revision.tmp
-/ripper.tmp.y
 /riscos
 /rubicon
 /ruby
 /ruby-runner
 /ruby-runner.h
 /ruby-man.rd.gz
-/rubyspec_temp
 /run.gdb
 /sizes.c
-/static-ruby
 /test.rb
 /test-coverage.dat
 /tmp
-/vcpkg_installed
 /transdb.h
 /uncommon.mk
 /verconf.h
 /verconf.mk
 /web
-
-# /bin/
-
-/bin/*.exe
-/bin/*.dll
-/bin/goruby
-/bin/ruby
+/yasmdata.rb
 
 # /benchmark/
 /benchmark/bm_require.data
@@ -164,36 +137,27 @@ lcov*.info
 /enc/jis/props.h
 /enc/unicode/data
 
-# /coroutine/
-!/coroutine/**/*.s
-!/coroutine/**/*.S
-
 # /enc/trans/
 /enc/trans/*.c
 /enc/trans/*.def
 /enc/trans/*.exp
 /enc/trans/*.lib
+/enc/trans/.time
 
 # /exe/
-/exe/goruby
 /exe/ruby
+/exe/.time
 
 # /ext/
 /ext/extinit.c
 /ext/configure-ext.mk
 /ext/*/exts.mk
 
-# /ext/-test-/cxxanyargs
-/ext/-test-/cxxanyargs/failure*.failed
-
 # /ext/-test-/win32/dln/
 /ext/-test-/win32/dln/dlntest.dll
 /ext/-test-/win32/dln/dlntest.exp
 /ext/-test-/win32/dln/dlntest.lib
 
-# /ext/-test-/gems
-/ext/-test-/gems
-
 # /ext/etc/
 /ext/etc/constdefs.h
 
@@ -206,10 +170,7 @@ lcov*.info
 
 # /ext/ripper/
 /ext/ripper/eventids1.c
-/ext/ripper/eventids1.h
-/ext/ripper/.eventids2-check
 /ext/ripper/eventids2table.c
-/ext/ripper/ripper_init.c
 /ext/ripper/ripper.*
 /ext/ripper/ids1
 /ext/ripper/ids2
@@ -224,16 +185,8 @@ lcov*.info
 /gems/src
 /gems/*-*
 
-# /lib/
-/lib/ruby/[1-9]*.*
-/lib/ruby/vendor_ruby
-
-# /misc/
-/misc/**/__pycache__
-
-# for `make test-bundler`
+# /spec/bundler
 /.rspec_status
-/tool/bundler/*.lock
 
 # /tool/
 /tool/config.guess
@@ -241,42 +194,4 @@ lcov*.info
 
 # /win32/
 /win32/*.ico
-
-# RJIT
-/include/ruby-*/*/rb_rjit_min_header-*.h
-/lib/ruby_vm/rjit/instruction.rb
-/lib/ruby_vm/rjit/instruction.rb
-/rjit_config.h
-/rb_rjit_header.h*
-
-# YJIT
-/yjit-bench
-/yjit_exit_locations.dump
-
-# /wasm/
-/wasm/tests/*.wasm
-
-# prism
-/lib/prism/compiler.rb
-/lib/prism/dispatcher.rb
-/lib/prism/dot_visitor.rb
-/lib/prism/dsl.rb
-/lib/prism/inspect_visitor.rb
-/lib/prism/mutation_compiler.rb
-/lib/prism/node.rb
-/lib/prism/reflection.rb
-/lib/prism/serialize.rb
-/lib/prism/visitor.rb
-/prism/api_node.c
-/prism/ast.h
-/prism/diagnostic.c
-/prism/diagnostic.h
-/prism/node.c
-/prism/prettyprint.c
-/prism/serialize.c
-/prism/token_type.c
-
-# tool/update-NEWS-gemlist.rb
-/bundled_gems.json
-/default_gems.json
-/gems/default_gems
+/win32/.time
diff --git a/.indent.pro b/.indent.pro
index 1d61cbcad1..6a207a0554 100644
--- a/.indent.pro
+++ b/.indent.pro
@@ -2,15 +2,12 @@
 -nbbb
 -nbc
 -br
--brs
 -nbs
 -ncdb
--nce
--cdw
--cli2
--cbi2
+-ce
+-cli0.5
 -ndj
--ncs
+-ei
 -nfc1
 -i4
 -l120
@@ -19,14 +16,6 @@
 -psl
 -sc
 -sob
--sbi4
--nut
--par
 
 -TID
 -TVALUE
--Tst_data_t
--Tst_index_t
--Tst_table
--Trb_data_type_t
--TFILE
diff --git a/.mailmap b/.mailmap
deleted file mode 100644
index 213a0f4916..0000000000
--- a/.mailmap
+++ /dev/null
@@ -1,431 +0,0 @@
-git[bot]                                <svn-admin@ruby-lang.org>
-git[bot]                                <svn-admin@ruby-lang.org> git <svn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-svn[bot]                                <svn-admin@ruby-lang.org> svn <svn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# a_matsuda
-Akira Matsuda                           <ronnie@dio.jp>
-Akira Matsuda                           <ronnie@dio.jp> <a_matsuda@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# aamine
-Minero Aoki                             <aamine@loveruby.net>
-Minero Aoki                             <aamine@loveruby.net> <aamine@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# akira
-akira yamada                            <akira@ruby-lang.org>
-## akira yamada                         <akira@ruby-lang.org> <akira@rice.p.arika.org>
-akira yamada                            <akira@ruby-lang.org> <akira@arika.org>
-akira yamada                            <akira@ruby-lang.org> <akira@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# akiyoshi
-AKIYOSHI, Masamichi                     <masamichi.akiyoshi@hp.com>
-AKIYOSHI, Masamichi                     <masamichi.akiyoshi@hp.com> <akiyoshi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# akr
-Tanaka Akira                            <akr@fsij.org>
-Tanaka Akira                            <akr@fsij.org> <akr@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# arai
-Koji Arai                               <jca02266@nifty.ne.jp>
-Koji Arai                               <jca02266@nifty.ne.jp> <arai@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# arton
-Akio Tajima                             <artonx@yahoo.co.jp>
-Akio Tajima                             <artonx@yahoo.co.jp> <arton@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# aycabta
-aycabta                                 <aycabta@gmail.com>
-aycabta                                 <aycabta@gmail.com> <aycabta@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ayumin
-Ayumu AIZAWA                            <ayumu.aizawa@gmail.com>
-Ayumu AIZAWA                            <ayumu.aizawa@gmail.com> <ayumin@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# azav
-Alexander Zavorine                      <alexandre.zavorine@nokia.com>
-Alexander Zavorine                      <alexandre.zavorine@nokia.com> <azav@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# charliesome
-Charlie Somerville                      <charliesome@ruby-lang.org>
-Charlie Somerville                      <charliesome@ruby-lang.org> <charliesome@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# dave
-Dave Thomas                             <dave@pragprog.com>
-Dave Thomas                             <dave@pragprog.com> <dave@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# davidflanagan
-David Flanagan                          <davidflanagan@ruby-lang.org>
-David Flanagan                          <davidflanagan@ruby-lang.org> <david@think32>
-David Flanagan                          <davidflanagan@ruby-lang.org> <david@davidflanagan.com>
-David Flanagan                          <davidflanagan@ruby-lang.org> <davidflanagan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# dblack
-David A. Black                          <dblack@rubypal.com>
-David A. Black                          <dblack@rubypal.com> <dblack@wobblini.net>
-David A. Black                          <dblack@rubypal.com> <dblack@superlink.net>
-David A. Black                          <dblack@rubypal.com> <dblack@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# drbrain
-Eric Hodel                              <drbrain@segment7.net>
-Eric Hodel                              <drbrain@segment7.net> <drbrain@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# duerst
-Martin Dürst                            <duerst@it.aoyama.ac.jp>
-Martin Dürst                            <duerst@it.aoyama.ac.jp> <duerst@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# eban
-WATANABE Hirofumi                       <eban@ruby-lang.org>
-WATANABE Hirofumi                       <eban@ruby-lang.org> <eban@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# emboss
-Martin Bosslet                          <Martin.Bosslet@gmail.com>
-Martin Bosslet                          <Martin.Bosslet@gmail.com> <Martin.Bosslet@googlemail.com>
-Martin Bosslet                          <Martin.Bosslet@gmail.com> <emboss@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# eregon
-Benoit Daloze                           <eregontp@gmail.com>
-Benoit Daloze                           <eregontp@gmail.com> <eregon@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# evan
-Evan Phoenix                            <evan@ruby-lang.org>
-Evan Phoenix                            <evan@ruby-lang.org> <evan@fallingsnow.net>
-Evan Phoenix                            <evan@ruby-lang.org> <evan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# glass
-Masaki Matsushita                       <glass.saga@gmail.com>
-Masaki Matsushita                       <glass.saga@gmail.com> <glass@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# gogotanaka
-Kazuki Tanaka                           <gogotanaka@ruby-lang.org>
-Kazuki Tanaka                           <gogotanaka@ruby-lang.org> <gogotanaka@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# gotoken
-Kentaro Goto                            <gotoken@gmail.com>
-Kentaro Goto                            <gotoken@gmail.com> <gotoken@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# gotoyuzo
-GOTOU Yuuzou                            <gotoyuzo@notwork.org>
-GOTOU Yuuzou                            <gotoyuzo@notwork.org> <gotoyuzo@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# gsinclair
-Gavin Sinclair                          <gsinclair@soyabean.com.au>
-Gavin Sinclair                          <gsinclair@soyabean.com.au> <gsinclair@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# H_Konishi
-KONISHI Hiromasa                        <konishih@fd6.so-net.ne.jp>
-KONISHI Hiromasa                        <konishih@fd6.so-net.ne.jp> <H_Konishi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# headius
-Charles Oliver Nutter                   <headius@headius.com>
-Charles Oliver Nutter                   <headius@headius.com> <headius@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# hone
-Terence Lee                             <hone@heroku.com>
-Terence Lee                             <hone@heroku.com> <hone@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# hsbt
-Hiroshi SHIBATA                         <hsbt@ruby-lang.org>
-Hiroshi SHIBATA                         <hsbt@ruby-lang.org> <hsbt@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# iwamatsu
-Nobuhiro Iwamatsu                       <iwamatsu@nigauri.org>
-Nobuhiro Iwamatsu                       <iwamatsu@nigauri.org> <iwamatsu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# jeg2
-James Edward Gray II                    <james@graysoftinc.com>
-James Edward Gray II                    <james@graysoftinc.com> <jeg2@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# jim
-Jim Weirich                             <jim@tardis.local>
-Jim Weirich                             <jim@tardis.local> <jim@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# k0kubun
-Takashi Kokubun                         <takashikkbn@gmail.com>
-Takashi Kokubun                         <takashikkbn@gmail.com> <k0kubun@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# kanemoto
-Yutaka Kanemoto                         <kanemoto@ruby-lang.org>
-Yutaka Kanemoto                         <kanemoto@ruby-lang.org> <kanemoto@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# katsu
-UENO Katsuhiro                          <katsu@blue.sky.or.jp>
-UENO Katsuhiro                          <katsu@blue.sky.or.jp> <katsu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# kazu
-Kazuhiro NISHIYAMA                      <zn@mbf.nifty.com>
-Kazuhiro NISHIYAMA                      <zn@mbf.nifty.com> <kazu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# keiju
-Keiju Ishitsuka                         <keiju@ishitsuka.com>
-Keiju Ishitsuka                         <keiju@ishitsuka.com> <keiju@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# knu
-Akinori MUSHA                           <knu@iDaemons.org>
-Akinori MUSHA                           <knu@iDaemons.org> <knu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ko1
-Koichi Sasada                           <ko1@atdot.net>
-Koichi Sasada                           <ko1@atdot.net> <ko1@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# kosaki
-KOSAKI Motohiro                         <kosaki.motohiro@gmail.com>
-KOSAKI Motohiro                         <kosaki.motohiro@gmail.com> <kosaki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# kosako
-K.Kosako                                <sndgk393@ybb.ne.jp>
-K.Kosako                                <sndgk393@ybb.ne.jp> <kosako@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# kou
-Sutou Kouhei                            <kou@clear-code.com>
-Sutou Kouhei                            <kou@clear-code.com> <kou@cozmixng.org>
-Sutou Kouhei                            <kou@clear-code.com> <kou@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# kouji
-Kouji Takao                             <kouji.takao@gmail.com>
-Kouji Takao                             <kouji.takao@gmail.com> <kouji@takao7.net>
-Kouji Takao                             <kouji.takao@gmail.com> <kouji@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ksaito
-Kazuo Saito                             <ksaito@uranus.dti.ne.jp>
-Kazuo Saito                             <ksaito@uranus.dti.ne.jp> <ksaito@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ktsj
-Kazuki Tsujimoto                        <kazuki@callcc.net>
-Kazuki Tsujimoto                        <kazuki@callcc.net> <ktsj@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# luislavena
-Luis Lavena                             <luislavena@gmail.com>
-Luis Lavena                             <luislavena@gmail.com> <luislavena@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# mame
-Yusuke Endoh                            <mame@ruby-lang.org>
-## Yusuke Endoh                         <mame@ruby-lang.org> <mame@tsg.ne.jp>
-Yusuke Endoh                            <mame@ruby-lang.org> <mame@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# marcandre
-Marc-Andre Lafortune                    <github@marc-andre.ca>
-Marc-Andre Lafortune                    <ruby-core@marc-andre.ca>
-Marc-Andre Lafortune                    <ruby-core@marc-andre.ca> <marcandre@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# matz
-Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp>
-Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp> <matz@ruby-lang.org>
-Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp> <matz@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# michal
-Michal Rokos                            <michal@ruby-lang.org>
-Michal Rokos                            <michal@ruby-lang.org> <michal@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# mneumann
-Michael Neumann                         <mneumann@ruby-lang.org>
-Michael Neumann                         <mneumann@ruby-lang.org> <mneumann@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# mrkn
-Kenta Murata                            <mrkn@mrkn.jp>
-Kenta Murata                            <mrkn@mrkn.jp> <muraken@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-Kenta Murata                            <mrkn@mrkn.jp> <3959+mrkn@users.noreply.github.com>
-Kenta Murata                            <mrkn@mrkn.jp> <mrkn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# nagachika
-nagachika                               <nagachika@ruby-lang.org>
-nagachika                               <nagachika@ruby-lang.org> <nagachika@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# nagai
-Hidetoshi NAGAI                         <nagai@ai.kyutech.ac.jp>
-Hidetoshi NAGAI                         <nagai@ai.kyutech.ac.jp> <nagai@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# nahi
-Hiroshi Nakamura                        <nahi@ruby-lang.org>
-Hiroshi Nakamura                        <nahi@ruby-lang.org> <nahi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# nari
-Narihiro Nakamura                       <authornari@gmail.com>
-Narihiro Nakamura                       <authornari@gmail.com> <nari@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# naruse
-NARUSE, Yui                             <naruse@airemix.jp>
-NARUSE, Yui                             <naruse@airemix.jp> <naruse@ruby-lang.org>
-NARUSE, Yui                             <naruse@airemix.jp> <naruse@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ngoto
-Naohisa Goto                            <ngotogenome@gmail.com>
-Naohisa Goto                            <ngotogenome@gmail.com> <ngoto@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# nobu
-Nobuyoshi Nakada                        <nobu@ruby-lang.org>
-Nobuyoshi Nakada                        <nobu@ruby-lang.org> <nobu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# normal
-Eric Wong                               <normal@ruby-lang.org>
-Eric Wong                               <normal@ruby-lang.org> <e@80x24.org>
-Eric Wong                               <normal@ruby-lang.org> <normal@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ntalbott
-Nathaniel Talbott                       <ntalbott@ruby-lang.org>
-Nathaniel Talbott                       <ntalbott@ruby-lang.org> <ntalbott@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ocean
-Hirokazu Yamamoto                       <ocean@m2.ccsnet.ne.jp>
-Hirokazu Yamamoto                       <ocean@m2.ccsnet.ne.jp> <ocean@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# odaira
-Rei Odaira                              <rodaira@us.ibm.com>
-Rei Odaira                              <rodaira@us.ibm.com> <Rei.Odaira@gmail.com>
-Rei Odaira                              <rodaira@us.ibm.com> <odaira@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# okkez
-okkez                                   <okkez000@gmail.com>
-okkez                                   <okkez000@gmail.com> <okkez@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# rhe
-Kazuki Yamaguchi                        <k@rhe.jp>
-Kazuki Yamaguchi                        <k@rhe.jp> <rhe@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ryan
-Ryan Davis                              <ryand-github@zenspider.com>
-Ryan Davis                              <ryand-github@zenspider.com> <ryand-ruby@zenspider.com>
-Ryan Davis                              <ryand-github@zenspider.com> <ryan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# samuel
-Samuel Williams                         <samuel.williams@oriontransfer.co.nz>
-Samuel Williams                         <samuel.williams@oriontransfer.co.nz> <samuel@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# seki
-Masatoshi SEKI                          <m_seki@mva.biglobe.ne.jp>
-Masatoshi SEKI                          <m_seki@mva.biglobe.ne.jp> <seki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ser
-Sean Russell                            <ser@germane-software.com>
-Sean Russell                            <ser@germane-software.com> <ser@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# shigek
-Shigeo Kobayashi                        <shigek@ruby-lang.org>
-Shigeo Kobayashi                        <shigek@ruby-lang.org> <shigek@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# shirosaki
-Hiroshi Shirosaki                       <h.shirosaki@gmail.com>
-Hiroshi Shirosaki                       <h.shirosaki@gmail.com> <shirosaki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# sho-h
-Sho Hashimoto                           <sho-h@ruby-lang.org>
-Sho Hashimoto                           <sho-h@ruby-lang.org> <sho-h@netlab.jp>
-Sho Hashimoto                           <sho-h@ruby-lang.org> <sho.hsmt@gmail.com>
-Sho Hashimoto                           <sho-h@ruby-lang.org> <sho-h@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# shugo
-Shugo Maeda                             <shugo@ruby-lang.org>
-Shugo Maeda                             <shugo@ruby-lang.org> <shugo@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# shyouhei
-卜部昌平                                    <shyouhei@ruby-lang.org>
-卜部昌平                                    <shyouhei@ruby-lang.org> <shyouhei@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# siena
-Siena.                                  <siena@faculty.chiba-u.jp>
-Siena.                                  <siena@faculty.chiba-u.jp> <siena@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# sonots
-sonots                                  <sonots@gmail.com>
-sonots                                  <sonots@gmail.com> <sonots@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# sorah
-Sorah Fukumori                          <her@sorah.jp>
-Sorah Fukumori                          <her@sorah.jp> <sorah@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# stomar
-Marcus Stollsteimer                     <sto.mar@web.de>
-Marcus Stollsteimer                     <sto.mar@web.de> <stomar@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# suke
-Masaki Suketa                           <masaki.suketa@nifty.ne.jp>
-Masaki Suketa                           <masaki.suketa@nifty.ne.jp> <suke@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# tadd
-Tadashi Saito                           <tad.a.digger@gmail.com>
-Tadashi Saito                           <tad.a.digger@gmail.com> <tadd@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# tadf
-Tadayoshi Funaba                        <tadf@dotrb.org>
-Tadayoshi Funaba                        <tadf@dotrb.org> <tadf@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# takano32
-TAKANO Mitsuhiro                        <takano32@gmail.com>
-TAKANO Mitsuhiro                        <takano32@gmail.com> <takano32@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# tarui
-Masaya Tarui                            <tarui@ruby-lang.org>
-Masaya Tarui                            <tarui@ruby-lang.org> <tarui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# technorama
-Technorama Ltd.                         <oss-ruby@technorama.net>
-Technorama Ltd.                         <oss-ruby@technorama.net> <technorama@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# tenderlove
-Aaron Patterson                         <tenderlove@ruby-lang.org>
-Aaron Patterson                         <tenderlove@ruby-lang.org> <tenderlove@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# tmm1
-Aman Gupta                              <ruby@tmm1.net>
-Aman Gupta                              <ruby@tmm1.net> <tmm1@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ts
-Guy Decoux                              <ts@moulon.inra.fr>
-Guy Decoux                              <ts@moulon.inra.fr> <ts@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ttate
-Takaaki Tateishi                        <ttate@ttsky.net>
-## Takaaki Tateishi                     <ttate@ttsky.net> <ttate@kt.jaist.ac.jp>
-Takaaki Tateishi                        <ttate@ttsky.net> <ttate@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# uema2
-Takaaki Uematsu                         <uema2x@jcom.home.ne.jp>
-Takaaki Uematsu                         <uema2x@jcom.home.ne.jp> <uema2@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# usa
-U.Nakamura                              <usa@ruby-lang.org>
-U.Nakamura                              <usa@ruby-lang.org> <usa@garbagecollect.jp>
-U.Nakamura                              <usa@ruby-lang.org> <usa@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# wakou
-Wakou Aoyama                            <wakou@ruby-lang.org>
-Wakou Aoyama                            <wakou@ruby-lang.org> <wakou@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# wanabe
-wanabe                                  <s.wanabe@gmail.com>
-wanabe                                  <s.wanabe@gmail.com> <wanabe@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# watson1978
-Watson                                  <watson1978@gmail.com>
-Watson                                  <watson1978@gmail.com> <watson1978@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# wew
-William Webber                          <william@williamwebber.com>
-William Webber                          <william@williamwebber.com> <wew@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# why
-why the lucky stiff                     <why@ruby-lang.org>
-why the lucky stiff                     <why@ruby-lang.org> <why@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# xibbar
-Takeyuki FUJIOKA                        <xibbar@ruby-lang.org>
-Takeyuki FUJIOKA                        <xibbar@ruby-lang.org> <xibbar@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# yugui
-Yuki Yugui Sonoda                       <yugui@yugui.jp>
-Yuki Yugui Sonoda                       <yugui@yugui.jp> <yugui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# yui-knk
-yui-knk                                 <spiketeika@gmail.com>
-yui-knk                                 <spiketeika@gmail.com> <yui-knk@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# yuki
-Yuki Nishijima                          <yuki24@hey.com>
-Yuki Nishijima                          <yuki24@hey.com> <mail@yukinishijima.net>
-Yuki Nishijima                          <yuki24@hey.com> <yuki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# zsombor
-Dee Zsombor                             <zsombor@ruby-lang.org>
-Dee Zsombor                             <zsombor@ruby-lang.org> <zsombor@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# zzak
-zzak                                    <zzakscott@gmail.com>
-zzak                                    <zzakscott@gmail.com> <zzak@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
diff --git a/.rdoc_options b/.rdoc_options
deleted file mode 100644
index f3d0ebfecd..0000000000
--- a/.rdoc_options
+++ /dev/null
@@ -1,13 +0,0 @@
----
-page_dir: doc
-charset: UTF-8
-encoding: UTF-8
-main_page: index.md
-title: Documentation for Ruby development version
-visibility: :private
-rdoc_include:
-- doc
-
-exclude:
-- lib/irb
-- .gemspec
diff --git a/.rspec_parallel b/.rspec_parallel
deleted file mode 100644
index aaff198a32..0000000000
--- a/.rspec_parallel
+++ /dev/null
@@ -1,2 +0,0 @@
---format progress
---format ParallelTests::RSpec::RuntimeLogger --out tmp/parallel_runtime_rspec.log
diff --git a/.travis.yml b/.travis.yml
index 236b87bced..a9117d190f 100644
--- a/.travis.yml
+++ b/.travis.yml
@@ -1,4 +1,3 @@
-# -*- YAML -*-
 # Copyright (C) 2011 Urabe, Shyouhei.  All rights reserved.
 #
 # This file is  a part of the programming language  Ruby.  Permission is hereby
@@ -6,113 +5,105 @@
 # conditions  mentioned in  the file  COPYING are  met.  Consult  the  file for
 # details.
 
-# When you see Travis CI issues, or you are interested in understanding how to
-# manage, please check the link below.
-# https://github.com/ruby/ruby/wiki/CI-Servers#travis-ci
-
-# We enable Travis on the specific branches or forked repositories here.
-# https://docs.travis-ci.com/user/conditions-v1
-if: >-
-  (fork OR branch = master OR branch =~ /^ruby_\d_\d$/)
-  AND (commit_message !~ /(\[DOC\]|Document)/)
-  AND NOT (type = 'push' AND sender =~ /\[bot\]/)
+# This is  a Travis-CI  build configuration file.   The list  of configurations
+# available is located in
+#
+#     http://about.travis-ci.org/docs/user/build-configuration/
+#
+# and as Ruby itself is a project written in C language,
+#
+#     http://about.travis-ci.org/docs/user/languages/c/
+#
+# is also a good place to look at.
 
 language: c
+dist: trusty
 
-os: linux
-
-dist: jammy
+# temporary workaround for https://github.com/travis-ci/travis-ci/issues/8892
+sudo: required
+group: deprecated-2017Q4
 
-git:
-  quiet: true
+compiler:
+  - gcc
 
-env:
-  global:
-    - NPROC="$(nproc)"
-    - JOBS="-j${NPROC}"
-    # https://github.com/travis-ci/travis-build/blob/e411371dda21430a60f61b8f3f57943d2fe4d344/lib/travis/build/bash/travis_apt_get_options.bash#L7
-    - travis_apt_get_options='--allow-downgrades --allow-remove-essential --allow-change-held-packages'
-    - travis_apt_get_options="-yq --no-install-suggests --no-install-recommends $travis_apt_get_options"
-    # -g0 disables backtraces when SEGV. Do not set that.
-    - debugflags=-ggdb3
-    - RUBY_TESTOPTS="$JOBS -q --tty=no"
+os:
+  - linux
 
-.org.ruby-lang.ci.matrix-definitions:
-  - &gcc-11
-    compiler: gcc-11
-    before_install:
-      - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
-      - >-
-        tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install
-        gcc-11
-        g++-11
-        libffi-dev
-        libncurses-dev
-        libncursesw5-dev
-        libreadline-dev
-        libssl-dev
-        libyaml-dev
-        openssl
-        zlib1g-dev
-      - gcc-11 --version
-  - &arm64-linux
-    name: arm64-linux
-    arch: arm64
-    <<: *gcc-11
-  - &ppc64le-linux
-    name: ppc64le-linux
-    arch: ppc64le
-    <<: *gcc-11
-  - &s390x-linux
-    name: s390x-linux
-    arch: s390x
-    <<: *gcc-11
-    env:
-      # Avoid possible test failures with the zlib applying the following patch
-      # on s390x CPU architecture.
-      # https://github.com/madler/zlib/pull/410
-      - DFLTCC=0
-
-matrix:
-  include:
-    - <<: *arm64-linux
-    - <<: *ppc64le-linux
-    - <<: *s390x-linux
-  allow_failures:
-    # The arm64 is very slow to start the jobs.
-    - name: arm64-linux
-    - name: ppc64le-linux
-    - name: s390x-linux
-  fast_finish: true
+before_install:
+  - "CONFIG_FLAG="
+  - "JOBS=-j`nproc`"
 
 before_script:
-  - lscpu
-  - ./autogen.sh
-  - mkdir build
-  - cd build
-  - ../configure -C --disable-install-doc --prefix=$(pwd)/install
-  - make -s $JOBS
-  - make -s $JOBS install
-  # Useful info to report issues to the Ruby.
-  - $(pwd)/install/bin/ruby -v
-  # Useful info To report issues to the RubyGems.
-  - $(pwd)/install/bin/gem env
+  - "echo JOBS=$JOBS"
+  - "uname -a"
+  - "uname -r"
+  - "rm -fr .ext autom4te.cache"
+  - "echo $TERM"
+  - "> config.status"
+  - "sed -f tool/prereq.status Makefile.in common.mk > Makefile"
+  - "make update-config_files"
+  - "make touch-unicode-files"
+  - "make -s $JOBS srcs UNICODE_FILES=."
+  - "requests=; for req in ${RUBYSPEC_PULL_REQUEST//,/ }; do
+      requests=\"$requests +refs/pull/$req/merge:\";
+    done"
+  - "${requests:+git -C spec/ruby -c user.email=none -c user.name=none pull --no-edit origin $requests}"
+  - "${requests:+git -C spec/ruby log --oneline origin/master..@}"
+  - "rm config.status Makefile rbconfig.rb .rbconfig.time"
+  - "mkdir build config_1st config_2nd"
+  - "chmod -R a-w ."
+  - "chmod u+w build config_1st config_2nd"
+  - "cd build"
+  - "../configure -C --disable-install-doc --with-gcc=$CC $CONFIG_FLAG"
+  - "cp -pr config.cache config.status .ext/include ../config_1st"
+  - "make reconfig"
+  - "cp -pr config.cache config.status .ext/include ../config_2nd"
+  - "(cd .. && exec diff -ru config_1st config_2nd)"
+  - "make -s $JOBS"
 
 script:
-  - make -s test
-  - ../tool/travis_wait.sh make -s test-all RUBYOPT="-w"
-  - ../tool/travis_wait.sh make -s test-spec
+  - "make -s test TESTOPTS=--color=never"
+  - "make -s $JOBS test-all -o exts TESTOPTS='-q --color=never --job-status=normal'"
+  - "make -s $JOBS test-spec MSPECOPT=-j"
+
+# Branch matrix.  Not all branches are Travis-ready so we limit branches here.
+branches:
+  only:
+    - trunk
+    - ruby_2_2
+    - ruby_2_3
+    - ruby_2_4
+    - ruby_2_5
+    - /^feature\//
+    - /^bug\//
 
 # We want to be notified when something happens.
 notifications:
-  webhooks:
-    urls:
-      # ruby-lang slack: ruby/simpler-alerts-bot (travis)
-      - secure: mRsoS/UbqDkKkW5p3AEqM27d4SZnV6Gsylo3bm8T/deltQzTsGzZwrm7OIBXZv0UFZdE68XmPlyHfZFLSP2V9QZ7apXMf9/vw0GtcSe1gchtnjpAPF6lYBn7nMCbVPPx9cS0dwL927fjdRM1vj7IKZ2bk4F0lAJ25R25S6teqdk=
-    on_success: never
+  irc:
+    channels:
+      - "chat.freenode.net#ruby-core"
+      - "chat.freenode.net#ruby-ja"
+    on_success: change # [always|never|change] # default: always
+    on_failure: always # [always|never|change] # default: always
+    template:
+      - "%{message} by @%{author}: See %{build_url}"
+
+  slack:
+    rooms:
+      - secure: i1GLETSKye85ea6dGNA3MxI/5myChmMFiZtBd5C69xK+s1sBFqEgOSbaSf9KHc0CYrHVyNhQMaZRruieV7xS+6Pfs0Zvxf1DO6QQTWC2KhkqwFDLvZncAzjoyASdR90hbr+iRPOngQ+HJuE94zemALAwEqNAinzA74PMiJXktqY= # ruby:<token>#commits
+      - secure: ah7UEHBvncXT7bM5mvYIQAO+tIyV/wl7nXLb7wQD16dO2v8Gragy0mWjB79Q09hrrMGmp6H9bCDpdGS80boIA5EHaHoG4QaP0i9bsSt8U2AMWgZtfyIgQKJ4H2kXkGlrjO+AXTgnIkP7LNjdgAVUUTGQPb26T3QmoN2Splt+fIQ= # ruby:<token>#alerts
+    on_pull_requests: false
+    on_success: change
     on_failure: always
+
   email:
-    recipients:
-      - jun.aruga@gmail.com
-    on_success: never
-    on_failure: always
+    - ko1c-failure@atdot.net
+
+# Local Variables:
+# mode: YAML
+# coding: utf-8-unix
+# indent-tabs-mode: nil
+# tab-width: 4
+# fill-column: 79
+# default-justification: full
+# End:
diff --git a/BSDL b/BSDL
index 66d93598aa..a009caefea 100644
--- a/BSDL
+++ b/BSDL
@@ -4,10 +4,10 @@ Redistribution and use in source and binary forms, with or without
 modification, are permitted provided that the following conditions
 are met:
 1. Redistributions of source code must retain the above copyright
-   notice, this list of conditions and the following disclaimer.
+notice, this list of conditions and the following disclaimer.
 2. Redistributions in binary form must reproduce the above copyright
-   notice, this list of conditions and the following disclaimer in the
-   documentation and/or other materials provided with the distribution.
+notice, this list of conditions and the following disclaimer in the
+documentation and/or other materials provided with the distribution.
 
 THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
 ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
index 13df6087ca..ffdf2dd4b8 100644
--- a/CONTRIBUTING.md
+++ b/CONTRIBUTING.md
@@ -1 +1,4 @@
-See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing_md.html), which includes setup and build instructions.
+Please see the [official issue tracker] and wiki [HowToContribute].
+
+[official issue tracker]: https://bugs.ruby-lang.org
+[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
diff --git a/COPYING b/COPYING
index 48e5a96de7..f06056fb45 100644
--- a/COPYING
+++ b/COPYING
@@ -2,55 +2,55 @@ Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
 You can redistribute it and/or modify it under either the terms of the
 2-clause BSDL (see the file BSDL), or the conditions below:
 
-1. You may make and give away verbatim copies of the source form of the
-   software without restriction, provided that you duplicate all of the
-   original copyright notices and associated disclaimers.
+  1. You may make and give away verbatim copies of the source form of the
+     software without restriction, provided that you duplicate all of the
+     original copyright notices and associated disclaimers.
 
-2. You may modify your copy of the software in any way, provided that
-   you do at least ONE of the following:
+  2. You may modify your copy of the software in any way, provided that
+     you do at least ONE of the following:
 
-   a. place your modifications in the Public Domain or otherwise
-      make them Freely Available, such as by posting said
-      modifications to Usenet or an equivalent medium, or by allowing
-      the author to include your modifications in the software.
+       a) place your modifications in the Public Domain or otherwise
+          make them Freely Available, such as by posting said
+          modifications to Usenet or an equivalent medium, or by allowing
+          the author to include your modifications in the software.
 
-   b. use the modified software only within your corporation or
-      organization.
+       b) use the modified software only within your corporation or
+          organization.
 
-   c. give non-standard binaries non-standard names, with
-      instructions on where to get the original software distribution.
+       c) give non-standard binaries non-standard names, with
+          instructions on where to get the original software distribution.
 
-   d. make other distribution arrangements with the author.
+       d) make other distribution arrangements with the author.
 
-3. You may distribute the software in object code or binary form,
-   provided that you do at least ONE of the following:
+  3. You may distribute the software in object code or binary form,
+     provided that you do at least ONE of the following:
 
-   a. distribute the binaries and library files of the software,
-      together with instructions (in the manual page or equivalent)
-      on where to get the original distribution.
+       a) distribute the binaries and library files of the software,
+          together with instructions (in the manual page or equivalent)
+          on where to get the original distribution.
 
-   b. accompany the distribution with the machine-readable source of
-      the software.
+       b) accompany the distribution with the machine-readable source of
+          the software.
 
-   c. give non-standard binaries non-standard names, with
-      instructions on where to get the original software distribution.
+       c) give non-standard binaries non-standard names, with
+          instructions on where to get the original software distribution.
 
-   d. make other distribution arrangements with the author.
+       d) make other distribution arrangements with the author.
 
-4. You may modify and include the part of the software into any other
-   software (possibly commercial).  But some files in the distribution
-   are not written by the author, so that they are not under these terms.
+  4. You may modify and include the part of the software into any other
+     software (possibly commercial).  But some files in the distribution
+     are not written by the author, so that they are not under these terms.
 
-   For the list of those files and their copying conditions, see the
-   file LEGAL.
+     For the list of those files and their copying conditions, see the
+     file LEGAL.
 
-5. The scripts and library files supplied as input to or produced as
-   output from the software do not automatically fall under the
-   copyright of the software, but belong to whomever generated them,
-   and may be sold commercially, and may be aggregated with this
-   software.
+  5. The scripts and library files supplied as input to or produced as
+     output from the software do not automatically fall under the
+     copyright of the software, but belong to whomever generated them,
+     and may be sold commercially, and may be aggregated with this
+     software.
 
-6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
-   IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
-   WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-   PURPOSE.
+  6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+     IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+     WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+     PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
index 230376bc60..e50d01c8d1 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -2,50 +2,50 @@
 または以下に示す条件で本プログラムを再配布できます
 2-clause BSDLについてはBSDLファイルを参照して下さい．
 
-1. 複製は制限なく自由です．
+  1. 複製は制限なく自由です．
 
-2. 以下の条件のいずれかを満たす時に本プログラムのソースを
-   自由に変更できます．
+  2. 以下の条件のいずれかを満たす時に本プログラムのソースを
+     自由に変更できます．
 
-   a.  ネットニューズにポストしたり，作者に変更を送付する
-       などの方法で，変更を公開する．
+     (a) ネットニューズにポストしたり，作者に変更を送付する
+         などの方法で，変更を公開する．
 
-   b.  変更した本プログラムを自分の所属する組織内部だけで
-       使う．
+     (b) 変更した本プログラムを自分の所属する組織内部だけで
+         使う．
 
-   c.  変更点を明示したうえ，ソフトウェアの名前を変更する．
-       そのソフトウェアを配布する時には変更前の本プログラ
-       ムも同時に配布する．または変更前の本プログラムのソー
-       スの入手法を明示する．
+     (c) 変更点を明示したうえ，ソフトウェアの名前を変更する．
+         そのソフトウェアを配布する時には変更前の本プログラ
+         ムも同時に配布する．または変更前の本プログラムのソー
+         スの入手法を明示する．
 
-   d.  その他の変更条件を作者と合意する．
+     (d) その他の変更条件を作者と合意する．
 
-3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
-   ルしたオブジェクトコードや実行形式でも配布できます．
+  3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
+     ルしたオブジェクトコードや実行形式でも配布できます．
 
-   a.  バイナリを受け取った人がソースを入手できるように，
-       ソースの入手法を明示する．
+     (a) バイナリを受け取った人がソースを入手できるように，
+         ソースの入手法を明示する．
 
-   b.  機械可読なソースコードを添付する．
+     (b) 機械可読なソースコードを添付する．
 
-   c.  変更を行ったバイナリは名前を変更したうえ，オリジナ
-       ルのソースコードの入手法を明示する．
+     (c) 変更を行ったバイナリは名前を変更したうえ，オリジナ
+         ルのソースコードの入手法を明示する．
 
-   d.  その他の配布条件を作者と合意する．
+     (d) その他の配布条件を作者と合意する．
 
-4. 他のプログラムへの引用はいかなる目的であれ自由です．た
-   だし，本プログラムに含まれる他の作者によるコードは，そ
-   れぞれの作者の意向による制限が加えられる場合があります．
+  4. 他のプログラムへの引用はいかなる目的であれ自由です．た
+     だし，本プログラムに含まれる他の作者によるコードは，そ
+     れぞれの作者の意向による制限が加えられる場合があります．
 
-   それらファイルの一覧とそれぞれの配布条件などに付いては
-   LEGALファイルを参照してください．
+     それらファイルの一覧とそれぞれの配布条件などに付いては
+     LEGALファイルを参照してください．
 
-5. 本プログラムへの入力となるスクリプトおよび，本プログラ
-   ムからの出力の権利は本プログラムの作者ではなく，それぞ
-   れの入出力を生成した人に属します．また，本プログラムに
-   組み込まれるための拡張ライブラリについても同様です．
+  5. 本プログラムへの入力となるスクリプトおよび，本プログラ
+     ムからの出力の権利は本プログラムの作者ではなく，それぞ
+     れの入出力を生成した人に属します．また，本プログラムに
+     組み込まれるための拡張ライブラリについても同様です．
 
-6. 本プログラムは無保証です．作者は本プログラムをサポート
-   する意志はありますが，プログラム自身のバグあるいは本プ
-   ログラムの実行などから発生するいかなる損害に対しても責
-   任を持ちません．
+  6. 本プログラムは無保証です．作者は本プログラムをサポート
+     する意志はありますが，プログラム自身のバグあるいは本プ
+     ログラムの実行などから発生するいかなる損害に対しても責
+     任を持ちません．
diff --git a/LEGAL b/LEGAL
index ee01de962b..0479751691 100644
--- a/LEGAL
+++ b/LEGAL
@@ -1,248 +1,159 @@
-# -*- rdoc -*-
-
-= LEGAL NOTICE INFORMATION
---------------------------
+LEGAL NOTICE INFORMATION
+------------------------
 
 All the files in this distribution are covered under either the Ruby's
 license (see the file COPYING) or public-domain except some files
 mentioned below.
 
-[addr2line.c]
-
-  A part of this file is from FreeBSD.
-
-  >>>
-    Copyright (c) 1986, 1988, 1991, 1993::
-    The Regents of the University of California.  All rights reserved.
-
-    (c) UNIX System Laboratories, Inc.
-
-    All or some portions of this file are derived from material licensed
-    to the University of California by American Telephone and Telegraph
-    Co. or Unix System Laboratories, Inc. and are reproduced herein with
-    the permission of UNIX System Laboratories, Inc.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    4. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
-
-
-[ccan/build_assert/build_assert.h]
-[ccan/check_type/check_type.h]
-[ccan/container_of/container_of.h]
-[ccan/str/str.h]
-
-  These files are licensed under the {CC0}[https://creativecommons.org/choose/zero/].
-
-[ccan/list/list.h]
-
-  This file is licensed under the {MIT License}[rdoc-ref:@MIT+License].
-
-[coroutine]
-
-  Unless otherwise specified, these files are licensed under the
-  {MIT License}[rdoc-ref:@MIT+License].
-
-[include/ruby/onigmo.h]
-[include/ruby/oniguruma.h]
-[regcomp.c]
-[regenc.c]
-[regenc.h]
-[regerror.c]
-[regexec.c]
-[regint.h]
-[regparse.c]
-[regparse.h]
-[enc/ascii.c]
-[enc/big5.c]
-[enc/cp949.c]
-[enc/emacs_mule.c]
-[enc/encdb.c]
-[enc/euc_jp.c]
-[enc/euc_kr.c]
-[enc/euc_tw.c]
-[enc/gb18030.c]
-[enc/gb2312.c]
-[enc/gbk.c]
-[enc/iso_8859_1.c]
-[enc/iso_8859_10.c]
-[enc/iso_8859_11.c]
-[enc/iso_8859_13.c]
-[enc/iso_8859_14.c]
-[enc/iso_8859_15.c]
-[enc/iso_8859_16.c]
-[enc/iso_8859_2.c]
-[enc/iso_8859_3.c]
-[enc/iso_8859_4.c]
-[enc/iso_8859_5.c]
-[enc/iso_8859_6.c]
-[enc/iso_8859_7.c]
-[enc/iso_8859_8.c]
-[enc/iso_8859_9.c]
-[enc/koi8_r.c]
-[enc/koi8_u.c]
-[enc/shift_jis.c]
-[enc/unicode.c]
-[enc/us_ascii.c]
-[enc/utf_16be.c]
-[enc/utf_16le.c]
-[enc/utf_32be.c]
-[enc/utf_32le.c]
-[enc/utf_8.c]
-[enc/windows_1251.c]
-[enc/windows_31j.c]
-
-  Onigmo (Oniguruma-mod) LICENSE
-
-  >>>
-    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
-    Copyright (c) 2011-2014::  K.Takata  <kentkt AT csc DOT jp>
-    All rights reserved.
+ccan/build_assert/build_assert.h
+ccan/check_type/check_type.h
+ccan/container_of/container_of.h
+ccan/str/str.h
 
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-
-    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-  Oniguruma LICENSE
-
-  >>>
-    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
-    All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-
-    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-  * https://github.com/k-takata/Onigmo/
-  * https://github.com/kkos/oniguruma
-  * https://svnweb.freebsd.org/ports/head/devel/oniguruma/
-
-    When this software is partly used or it is distributed with Ruby,
-    this of Ruby follows the license of Ruby.
-
-[enc/windows_1250.c]
-[enc/windows_1252.c]
-
-  >>>
-    Copyright (c) 2006-2007::  Byte      <byte AT mail DOT kna DOT ru>
-                               K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
-    All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
+  These files are licensed under the CC0.
 
-    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
+    https://creativecommons.org/choose/zero/
 
-[enc/cesu_8.c]
-[enc/windows_1253.c]
-[enc/windows_1254.c]
-[enc/windows_1257.c]
+ccan/list/list.h
 
-  >>>
-    Copyright (c) 2002-2007::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
-    All rights reserved.
+  This file is licensed under the MIT License.
 
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
+    Permission is hereby granted, free of charge, to any person obtaining a copy
+    of this software and associated documentation files (the "Software"), to deal
+    in the Software without restriction, including without limitation the rights
+    to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+    copies of the Software, and to permit persons to whom the Software is
+    furnished to do so, subject to the following conditions:
 
-    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
+    The above copyright notice and this permission notice shall be included in
+    all copies or substantial portions of the Software.
 
-[enc/trans/GB/GB12345%UCS.src]
-[enc/trans/GB/UCS%GB12345.src]
-[enc/trans/GB/GB2312%UCS.src]
-[enc/trans/GB/UCS%GB2312.src]
+    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
+    THE SOFTWARE.
 
-  These files have this explanatory texts.
+include/ruby/onigmo.h:
+include/ruby/oniguruma.h:
+regcomp.c:
+regenc.[ch]:
+regerror.c:
+regexec.c:
+regint.h:
+regparse.[ch]:
+enc/ascii.c
+enc/big5.c
+enc/cp949.c
+enc/emacs_mule.c
+enc/encdb.c
+enc/euc_jp.c
+enc/euc_kr.c
+enc/euc_tw.c
+enc/gb18030.c
+enc/gb2312.c
+enc/gbk.c
+enc/iso_8859_1.c
+enc/iso_8859_10.c
+enc/iso_8859_11.c
+enc/iso_8859_13.c
+enc/iso_8859_14.c
+enc/iso_8859_15.c
+enc/iso_8859_16.c
+enc/iso_8859_2.c
+enc/iso_8859_3.c
+enc/iso_8859_4.c
+enc/iso_8859_5.c
+enc/iso_8859_6.c
+enc/iso_8859_7.c
+enc/iso_8859_8.c
+enc/iso_8859_9.c
+enc/koi8_r.c
+enc/koi8_u.c
+enc/shift_jis.c
+enc/unicode.c
+enc/us_ascii.c
+enc/utf_16be.c
+enc/utf_16le.c
+enc/utf_32be.c
+enc/utf_32le.c
+enc/utf_8.c
+enc/windows_1251.c
+
+Onigmo (Oniguruma-mod) LICENSE
+------------------------------
+
+/*-
+ * Copyright (c) 2002-2009  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+ * Copyright (c) 2011-2014  K.Takata  <kentkt AT csc DOT jp>
+ * All rights reserved.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ *    notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ *    notice, this list of conditions and the following disclaimer in the
+ *    documentation and/or other materials provided with the distribution.
+ *
+ * THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ * ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ * SUCH DAMAGE.
+ */
+
+
+Oniguruma LICENSE
+-----------------
+
+/*-
+ * Copyright (c) 2002-2009  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+ * All rights reserved.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ *    notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ *    notice, this list of conditions and the following disclaimer in the
+ *    documentation and/or other materials provided with the distribution.
+ *
+ * THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ * ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ * SUCH DAMAGE.
+ */
+
+https://github.com/k-takata/Onigmo/
+https://github.com/kkos/oniguruma
+https://svnweb.freebsd.org/ports/head/devel/oniguruma/
+
+   When this software is partly used or it is distributed with Ruby,
+   this of Ruby follows the license of Ruby.
+
+enc/trans/GB/GB12345%UCS.src:
+enc/trans/GB/UCS%GB12345.src:
+enc/trans/GB/GB2312%UCS.src:
+enc/trans/GB/UCS%GB2312.src:
 
-  >>>
     This mapping data was created from files provided by Unicode, Inc.
     (The Unicode Consortium). The files were used to create a product supporting
     Unicode, as explicitly permitted in the files' copyright notices.
@@ -250,82 +161,56 @@ mentioned below.
     files for any particular purpose, and has ceased to publish the files many
     years ago.
 
-[enc/trans/JIS/JISX0201-KANA%UCS.src]
-[enc/trans/JIS/JISX0208\@1990%UCS.src]
-[enc/trans/JIS/JISX0212%UCS.src]
-[enc/trans/JIS/UCS%JISX0201-KANA.src]
-[enc/trans/JIS/UCS%JISX0208@1990.src]
-[enc/trans/JIS/UCS%JISX0212.src]
+enc/trans/JIS/JISX0201-KANA%UCS.src:
+enc/trans/JIS/JISX0208@1990%UCS.src:
+enc/trans/JIS/JISX0212%UCS.src:
+enc/trans/JIS/UCS%JISX0201-KANA.src:
+enc/trans/JIS/UCS%JISX0208@1990.src:
+enc/trans/JIS/UCS%JISX0212.src:
 
-  These files are copyrighted as the following.
-
-  >>>
     © 2015 Unicode®, Inc.
-
     For terms of use, see http://www.unicode.org/terms_of_use.html
 
-[enc/trans/JIS/JISX0213-1%UCS@BMP.src]
-[enc/trans/JIS/JISX0213-1%UCS@SIP.src]
-[enc/trans/JIS/JISX0213-2%UCS@BMP.src]
-[enc/trans/JIS/JISX0213-2%UCS@SIP.src]
+enc/trans/JIS/JISX0213-1%UCS@BMP.src:
+enc/trans/JIS/JISX0213-1%UCS@SIP.src:
+enc/trans/JIS/JISX0213-2%UCS@BMP.src:
+enc/trans/JIS/JISX0213-2%UCS@SIP.src:
 
-  These files are copyrighted as the following.
+ 	Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
+ 	Copyright (C) 2001 I'O, All Rights Reserved.
+ 	Copyright (C) 2006 Project X0213, All Rights Reserved.
+ 	You can use, modify, distribute this table freely.
 
-  >>>
-    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
-    Copyright (C) 2001:: I'O, All Rights Reserved.
-    Copyright (C) 2006:: Project X0213, All Rights Reserved.
-    You can use, modify, distribute this table freely.
+enc/trans/JIS/UCS@BMP%JISX0213-1.src:
+enc/trans/JIS/UCS@BMP%JISX0213-2.src:
+enc/trans/JIS/UCS@SIP%JISX0213-1.src:
+enc/trans/JIS/UCS@SIP%JISX0213-2.src:
 
-[enc/trans/JIS/UCS@BMP%JISX0213-1.src]
-[enc/trans/JIS/UCS@BMP%JISX0213-2.src]
-[enc/trans/JIS/UCS@SIP%JISX0213-1.src]
-[enc/trans/JIS/UCS@SIP%JISX0213-2.src]
+ 	Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
+ 	Copyright (C) 2001 I'O, All Rights Reserved.
+ 	You can use, modify, distribute this table freely.
 
-  These files are copyrighted as the following.
-
-  >>>
-    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
-    Copyright (C) 2001:: I'O, All Rights Reserved.
-    You can use, modify, distribute this table freely.
-
-[enc/trans/ucm/glibc-BIG5-2.3.3.ucm]
-[enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm]
-
-  >>>
-    Copyright (C) 2001-2005:: International Business Machines
-                              Corporation and others.  All Rights Reserved.
-
-[enc/trans/ucm/windows-950-2000.ucm]
-[enc/trans/ucm/windows-950_hkscs-2001.ucm]
-
-  >>>
-    Copyright (C) 2001-2002:: International Business Machines
-                              Corporation and others.  All Rights Reserved.
-
-
-[configure]
+configure:
 
   This file is free software.
 
-  >>>
-    Copyright (C) 1992-1996, 1998-2012:: Free Software Foundation, Inc.
+    Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
 
     This configure script is free software; the Free Software Foundation
     gives unlimited permission to copy, distribute and modify it.
 
-[tool/config.guess]
-[tool/config.sub]
+tool/config.guess:
+tool/config.sub:
 
   As long as you distribute these files with the file configure, they
   are covered under the Ruby's license.
 
-  >>>
-    Copyright 1992-2018:: Free Software Foundation, Inc.
+      Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
+      Free Software Foundation, Inc.
 
     This file is free software; you can redistribute it and/or modify it
     under the terms of the GNU General Public License as published by
-    the Free Software Foundation; either version 3 of the License, or
+    the Free Software Foundation; either version 2 of the License, or
     (at your option) any later version.
 
     This program is distributed in the hope that it will be useful, but
@@ -334,112 +219,54 @@ mentioned below.
     General Public License for more details.
 
     You should have received a copy of the GNU General Public License
-    along with this program; if not, see <https://www.gnu.org/licenses/>.
+    along with this program; if not, write to the Free Software
+    Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
 
     As a special exception to the GNU General Public License, if you
     distribute this file as part of a program that contains a
     configuration script generated by Autoconf, you may include it under
-    the same distribution terms that you use for the rest of that
-    program.  This Exception is an additional permission under section 7
-    of the GNU General Public License, version 3 ("GPLv3").
-
-[tool/lib/test/*]
-[tool/lib/core_assertions.rb]
-
-  Some of methods on these files are based on MiniTest 4. MiniTest 4 is
-  distributed under the MIT License.
-
-  >>>
-    Copyright (c) Ryan Davis, seattle.rb
+    the same distribution terms that you use for the rest of that program.
 
-    Permission is hereby granted, free of charge, to any person obtaining
-    a copy of this software and associated documentation files (the
-    'Software'), to deal in the Software without restriction, including
-    without limitation the rights to use, copy, modify, merge, publish,
-    distribute, sublicense, and/or sell copies of the Software, and to
-    permit persons to whom the Software is furnished to do so, subject to
-    the following conditions:
+parse.c:
 
-    The above copyright notice and this permission notice shall be
-    included in all copies or substantial portions of the Software.
-
-    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND,
-    EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
-    MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
-    IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
-    CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
-    TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
-    SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
-
-[spec/lib/turbo_tests/*]
-[spec/lib/turbo_tests.rb]
-[spec/lib/utils/*]
-
-  These files are under the MIT License.
-
-  >>>
-    Copyright (c) 2020 Ilya Zub
-
-    Permission is hereby granted, free of charge, to any person obtaining a copy
-    of this software and associated documentation files (the "Software"), to deal
-    in the Software without restriction, including without limitation the rights
-    to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
-    copies of the Software, and to permit persons to whom the Software is
-    furnished to do so, subject to the following conditions:
-
-    The above copyright notice and this permission notice shall be included in
-    all copies or substantial portions of the Software.
-
-    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
-    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
-    THE SOFTWARE.
-
-[parse.c]
-[parse.h]
-
-  These files are licensed under the GPL, but are incorporated into Ruby and
+  This file is licensed under the GPL, but is incorporated into Ruby and
   redistributed under the terms of the Ruby license, as permitted by the
   exception to the GPL below.
 
-  >>>
-    Copyright (C) 1984, 1989-1990, 2000-2015, 2018:: Free Software Foundation, Inc.
+     Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
+     Free Software Foundation, Inc.
 
-    This program is free software: you can redistribute it and/or modify
-    it under the terms of the GNU General Public License as published by
-    the Free Software Foundation, either version 3 of the License, or
-    (at your option) any later version.
-
-    This program is distributed in the hope that it will be useful,
-    but WITHOUT ANY WARRANTY; without even the implied warranty of
-    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
-    GNU General Public License for more details.
+     This program is free software; you can redistribute it and/or modify
+     it under the terms of the GNU General Public License as published by
+     the Free Software Foundation; either version 2, or (at your option)
+     any later version.
 
-    You should have received a copy of the GNU General Public License
-    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+     This program is distributed in the hope that it will be useful,
+     but WITHOUT ANY WARRANTY; without even the implied warranty of
+     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+     GNU General Public License for more details.
 
-    As a special exception, you may create a larger work that contains
-    part or all of the Bison parser skeleton and distribute that work
-    under terms of your choice, so long as that work isn't itself a
-    parser generator using the skeleton or a modified version thereof
-    as a parser skeleton.  Alternatively, if you modify or redistribute
-    the parser skeleton itself, you may (at your option) remove this
-    special exception, which will cause the skeleton and the resulting
-    Bison output files to be licensed under the GNU General Public
-    License without this special exception.
+     You should have received a copy of the GNU General Public License
+     along with this program; if not, write to the Free Software
+     Foundation, Inc., 51 Franklin Street, Fifth Floor,
+     Boston, MA 02110-1301, USA.  */
 
-    This special exception was added by the Free Software Foundation in
-    version 2.2 of Bison.
+  /* As a special exception, you may create a larger work that contains
+     part or all of the Bison parser skeleton and distribute that work
+     under terms of your choice, so long as that work isn't itself a
+     parser generator using the skeleton or a modified version thereof
+     as a parser skeleton.  Alternatively, if you modify or redistribute
+     the parser skeleton itself, you may (at your option) remove this
+     special exception, which will cause the skeleton and the resulting
+     Bison output files to be licensed under the GNU General Public
+     License without this special exception.
 
-[missing/dtoa.c]
+     This special exception was added by the Free Software Foundation in
+     version 2.2 of Bison.  */
 
-  This file is under these licenses.
+util.c (partly):
 
-  >>>
-    Copyright (c) 1991, 2000, 2001:: by Lucent Technologies.
+    Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
 
     Permission to use, copy, modify, and distribute this software for any
     purpose without fee is hereby granted, provided that this entire notice
@@ -452,74 +279,71 @@ mentioned below.
     REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
     OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
 
-  >>>
-    Copyright (c) 2004-2008:: David Schultz <das@FreeBSD.ORG>
-                              All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-
-    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-[win32/win32.c]
-[include/ruby/win32.h]
+win32/win32.[ch]:
 
   You can apply the Artistic License to these files. (or GPL,
   alternatively)
 
-  >>>
-    Copyright (c) 1993:: Intergraph Corporation
+    Copyright (c) 1993, Intergraph Corporation
 
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the perl README file.
 
-[missing/mt19937.c]
+util.c (partly):
+
+   Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
+   All rights reserved.
+
+   Redistribution and use in source and binary forms, with or without
+   modification, are permitted provided that the following conditions
+   are met:
+   1. Redistributions of source code must retain the above copyright
+      notice, this list of conditions and the following disclaimer.
+   2. Redistributions in binary form must reproduce the above copyright
+      notice, this list of conditions and the following disclaimer in the
+      documentation and/or other materials provided with the distribution.
+
+   THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+   ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+   IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+   ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+   FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+   DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+   OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+   HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+   LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+   OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+   SUCH DAMAGE.
+
+random.c
 
   This file is under the new-style BSD license.
 
-  >>>
-    A C-program for MT19937, with initialization improved 2002/2/10.::
+    A C-program for MT19937, with initialization improved 2002/2/10.
     Coded by Takuji Nishimura and Makoto Matsumoto.
-
     This is a faster version by taking Shawn Cokus's optimization,
     Matthe Bellew's simplification, Isaku Wada's real version.
 
     Before using, initialize the state by using init_genrand(seed)
     or init_by_array(init_key, key_length).
 
-    Copyright (C) 1997 - 2002:: Makoto Matsumoto and Takuji Nishimura,
-                                All rights reserved.
+    Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
+    All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
     are met:
 
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
+      1. Redistributions of source code must retain the above copyright
+	 notice, this list of conditions and the following disclaimer.
 
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
+      2. Redistributions in binary form must reproduce the above copyright
+	 notice, this list of conditions and the following disclaimer in the
+	 documentation and/or other materials provided with the distribution.
 
-    3. The names of its contributors may not be used to endorse or promote
-       products derived from this software without specific prior written
-       permission.
+      3. The names of its contributors may not be used to endorse or promote
+	 products derived from this software without specific prior written
+	 permission.
 
     THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
     "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
@@ -540,13 +364,12 @@ mentioned below.
 
   The Wayback Machine url: http://web.archive.org/web/19990429082237/http://www.math.keio.ac.jp/matumoto/emt.html
 
-[missing/procstat_vm.c]
+vm_dump.c:procstat_vm
 
   This file is under the new-style BSD license.
 
-  >>>
-    Copyright (c) 2007:: Robert N. M. Watson
-                         All rights reserved.
+    Copyright (c) 2007 Robert N. M. Watson
+    All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -571,65 +394,146 @@ mentioned below.
 
     $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
 
-[vsnprintf.c]
+vsnprintf.c:
 
-  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
 
-  >>>
-    Copyright (c) 1990, 1993::
-    The Regents of the University of California.  All rights reserved.
+    Copyright (c) 1990, 1993
+         The Regents of the University of California.  All rights reserved.
 
     This code is derived from software contributed to Berkeley by
     Chris Torek.
 
-[st.c]
-[strftime.c]
-[include/ruby/st.h]
-[missing/acosh.c]
-[missing/alloca.c]
-[missing/erf.c]
-[missing/hypot.c]
-[missing/lgamma_r.c]
-[missing/memcmp.c]
-[missing/memmove.c]
-[missing/strchr.c]
-[missing/strerror.c]
-[missing/strstr.c]
-[missing/tgamma.c]
-[ext/date/date_strftime.c]
-[ext/digest/sha1/sha1.c]
-[ext/digest/sha1/sha1.h]
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+    IMPORTANT NOTE:
+    --------------
+    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+    paragraph 3 above is now null and void.
+
+st.c:
+strftime.c:
+include/ruby/st.h:
+missing/acosh.c:
+missing/alloca.c:
+missing/dup2.c:
+missing/erf.c:
+missing/finite.c:
+missing/hypot.c:
+missing/isinf.c:
+missing/isnan.c:
+missing/lgamma_r.c:
+missing/memcmp.c:
+missing/memmove.c:
+missing/strchr.c:
+missing/strerror.c:
+missing/strstr.c:
+missing/tgamma.c:
+ext/date/date_strftime.c:
+ext/digest/sha1/sha1.[ch]:
+ext/sdbm/_sdbm.c:
+ext/sdbm/sdbm.h:
 
   These files are all under public domain.
 
-[missing/crypt.c]
+missing/crypt.c:
 
-  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
 
-  >>>
-    Copyright (c) 1989, 1993::
-    The Regents of the University of California.  All rights reserved.
+    Copyright (c) 1989, 1993
+    	The Regents of the University of California.  All rights reserved.
 
     This code is derived from software contributed to Berkeley by
     Tom Truscott.
 
-[missing/setproctitle.c]
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
 
-  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+missing/setproctitle.c
 
-  >>>
-    Copyright 2003:: Damien Miller
-    Copyright (c) 1983, 1995-1997:: Eric P. Allman
-    Copyright (c) 1988, 1993::
-    The Regents of the University of California.  All rights reserved.
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
 
-[missing/strlcat.c]
-[missing/strlcpy.c]
+    Copyright 2003 Damien Miller
+    Copyright (c) 1983, 1995-1997 Eric P. Allman
+    Copyright (c) 1988, 1993
+    	The Regents of the University of California.  All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+missing/strlcat.c
+missing/strlcpy.c
 
   These files are under an ISC-style license.
 
-  >>>
-    Copyright (c) 1998, 2015:: Todd C. Miller <Todd.Miller@courtesan.com>
+    Copyright (c) 1998, 2015 Todd C. Miller <Todd.Miller@courtesan.com>
 
     Permission to use, copy, modify, and distribute this software for any
     purpose with or without fee is hereby granted, provided that the above
@@ -643,26 +547,23 @@ mentioned below.
     ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
     OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
 
-[missing/langinfo.c]
+missing/langinfo.c
 
   This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
   Ruby uses a modified version. The file contains the following
   author/copyright notice:
 
-  >>>
-    Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11::
-    Permission to use, copy, modify, and distribute this software
-    for any purpose and without fee is hereby granted. The author
-    disclaims all warranties with regard to this software.
+  Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
+  Permission to use, copy, modify, and distribute this software
+  for any purpose and without fee is hereby granted. The author
+  disclaims all warranties with regard to this software.
 
-[ext/digest/md5/md5.c]
-[ext/digest/md5/md5.h]
+ext/digest/md5/md5.[ch]:
 
   These files are under the following license.  Ruby uses modified
   versions of them.
 
-  >>>
-    Copyright (C) 1999, 2000:: Aladdin Enterprises.  All rights reserved.
+    Copyright (C) 1999, 2000 Aladdin Enterprises.  All rights reserved.
 
     This software is provided 'as-is', without any express or implied
     warranty.  In no event will the authors be held liable for any damages
@@ -683,27 +584,23 @@ mentioned below.
     L. Peter Deutsch
     ghost@aladdin.com
 
-[ext/digest/rmd160/rmd160.c]
-[ext/digest/rmd160/rmd160.h]
+ext/digest/rmd160/rmd160.[ch]:
 
   These files have the following copyright information, and by the
   author we are allowed to use it under the new-style BSD license.
 
-  >>>
-    AUTHOR::  Antoon Bosselaers, ESAT-COSIC
+    AUTHOR:   Antoon Bosselaers, ESAT-COSIC
               (Arranged for libc by Todd C. Miller)
-    DATE::    1 March 1996
+    DATE:     1 March 1996
 
-    Copyright (c):: Katholieke Universiteit Leuven
+    Copyright (c) Katholieke Universiteit Leuven
     1996, All Rights Reserved
 
-[ext/digest/sha2/sha2.c]
-[ext/digest/sha2/sha2.h]
+ext/digest/sha2/sha2.[ch]:
 
   These files are under the new-style BSD license.
 
-  >>>
-    Copyright 2000:: Aaron D. Gifford.  All rights reserved.
+    Copyright 2000 Aaron D. Gifford.  All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -729,54 +626,96 @@ mentioned below.
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-[ext/psych]
-[test/psych]
-
-  The files under these directories are under the following license.
-
-  >>>
-    Copyright 2009:: Aaron Patterson, et al.
-
-    Permission is hereby granted, free of charge, to any person obtaining a copy of
-    this software and associated documentation files (the 'Software'), to deal in
-    the Software without restriction, including without limitation the rights to
-    use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
-    of the Software, and to permit persons to whom the Software is furnished to do
-    so, subject to the following conditions:
-
-    The above copyright notice and this permission notice shall be included in all
-    copies or substantial portions of the Software.
-
-    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
-    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
-    SOFTWARE.
-
-[ext/pty/pty.c]
-
-  >>>
-    C) Copyright 1998:: by Akinori Ito.
-
-    This software may be redistributed freely for this purpose, in full
-    or in part, provided that this entire copyright notice is included
-    on any copies of this software and applications and derivations thereof.
-
-    This software is provided on an "as is" basis, without warranty of any
-    kind, either expressed or implied, as to any matter including, but not
-    limited to warranty of fitness of purpose, or merchantability, or
-    results obtained from use of this software.
-
-[ext/socket/addrinfo.h]
-[ext/socket/getaddrinfo.c]
-[ext/socket/getnameinfo.c]
+ext/json/generator/generator.c:
+
+    Copyright 2001-2004 Unicode, Inc.
+
+    Disclaimer
+
+    This source code is provided as is by Unicode, Inc. No claims are
+    made as to fitness for any particular purpose. No warranties of any
+    kind are expressed or implied. The recipient agrees to determine
+    applicability of information provided. If this file has been
+    purchased on magnetic or optical media from Unicode, Inc., the
+    sole remedy for any claim will be exchange of defective media
+    within 90 days of receipt.
+
+    Limitations on Rights to Redistribute This Code
+
+    Unicode, Inc. hereby grants the right to freely use the information
+    supplied in this file in the creation of products supporting the
+    Unicode Standard, and to make copies of this file in any form
+    for internal or external distribution as long as this notice
+    remains attached.
+
+ext/nkf/nkf-utf8/config.h:
+ext/nkf/nkf-utf8/nkf.c:
+ext/nkf/nkf-utf8/utf8tbl.c:
+
+  These files are under the following license.  So to speak, it is
+  copyrighted semi-public-domain software.
+
+    Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
+       Everyone is permitted to do anything on this program
+       including copying, modifying, improving,
+       as long as you don't try to pretend that you wrote it.
+       i.e., the above copyright notice has to appear in all copies.
+       Binary distribution requires original version messages.
+       You don't have to ask before copying, redistribution or publishing.
+       THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+
+ext/psych:
+test/psych:
+
+  Copyright 2009 Aaron Patterson, et al.
+
+  Permission is hereby granted, free of charge, to any person obtaining a copy of
+  this software and associated documentation files (the 'Software'), to deal in
+  the Software without restriction, including without limitation the rights to
+  use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+  of the Software, and to permit persons to whom the Software is furnished to do
+  so, subject to the following conditions:
+
+  The above copyright notice and this permission notice shall be included in all
+  copies or substantial portions of the Software.
+
+  THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+  IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+  FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+  AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+  LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+  OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+  SOFTWARE.
+
+ext/psych/yaml:
+
+  Copyright (c) 2006 Kirill Simonov
+
+  Permission is hereby granted, free of charge, to any person obtaining a copy of
+  this software and associated documentation files (the "Software"), to deal in
+  the Software without restriction, including without limitation the rights to
+  use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+  of the Software, and to permit persons to whom the Software is furnished to do
+  so, subject to the following conditions:
+
+  The above copyright notice and this permission notice shall be included in all
+  copies or substantial portions of the Software.
+
+  THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+  IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+  FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+  AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+  LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+  OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+  SOFTWARE.
+
+ext/socket/addrinfo.h:
+ext/socket/getaddrinfo.c:
+ext/socket/getnameinfo.c:
 
   These files are under the new-style BSD license.
 
-  >>>
-    Copyright (C) 1995, 1996, 1997, 1998, and 1999:: WIDE Project.
+    Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
     All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
@@ -803,16 +742,15 @@ mentioned below.
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-[ext/win32ole/win32ole.c]
+ext/win32ole/win32ole.c:
 
   You can apply the Artistic License to this file. (or GPL,
   alternatively)
 
-  >>>
-    (c) 1995:: Microsoft Corporation. All rights reserved.
+    (c) 1995 Microsoft Corporation. All rights reserved.
     Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
 
-    Other modifications Copyright (c) 1997, 1998:: by Gurusamy Sarathy
+    Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
     <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
 
     You may distribute under the terms of either the GNU General Public
@@ -821,17 +759,16 @@ mentioned below.
 
   The Wayback Machine url: http://web.archive.org/web/19970607104352/http://www.activeware.com:80/
 
-[lib/rdoc/generator/template/darkfish/css/fonts.css]
+lib/rdoc/generator/template/darkfish/css/fonts.css:
 
-  This file is licensed under the {SIL Open Font License}[http://scripts.sil.org/OFL].
+  This file is licensed under the SIL Open Font License.
 
-[spec/mspec]
-[spec/ruby]
+    http://scripts.sil.org/OFL
 
-  The files under these directories are under the following license.
+spec/mspec:
+spec/ruby:
 
-  >>>
-    Copyright (c) 2008:: Engine Yard, Inc. All rights reserved.
+    Copyright (c) 2008 Engine Yard, Inc. All rights reserved.
 
     Permission is hereby granted, free of charge, to any person
     obtaining a copy of this software and associated documentation
@@ -854,224 +791,60 @@ mentioned below.
     FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
     OTHER DEALINGS IN THE SOFTWARE.
 
-[lib/rubygems.rb]
-[lib/rubygems]
-[test/rubygems]
+lib/rubygems.rb:
+lib/rubygems:
+test/rubygems:
 
-  RubyGems is under the following license.
+  RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
+  Weirich and others.  You can redistribute it and/or modify it under
+  either the terms of the MIT license (see the file MIT.txt), or the
+  conditions below:
 
-  >>>
-    RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
-    Weirich and others.  You can redistribute it and/or modify it under
-    either the terms of the {MIT license}[rdoc-ref:@MIT+License], or the conditions
-    below:
+  1. You may make and give away verbatim copies of the source form of the
+     software without restriction, provided that you duplicate all of the
+     original copyright notices and associated disclaimers.
 
-    1. You may make and give away verbatim copies of the source form of the
-       software without restriction, provided that you duplicate all of the
-       original copyright notices and associated disclaimers.
+  2. You may modify your copy of the software in any way, provided that
+     you do at least ONE of the following:
 
-    2. You may modify your copy of the software in any way, provided that
-       you do at least ONE of the following:
+     a. place your modifications in the Public Domain or otherwise
+        make them Freely Available, such as by posting said
+        modifications to Usenet or an equivalent medium, or by allowing
+        the author to include your modifications in the software.
 
-       a. place your modifications in the Public Domain or otherwise
-          make them Freely Available, such as by posting said
-          modifications to Usenet or an equivalent medium, or by allowing
-          the author to include your modifications in the software.
+     b. use the modified software only within your corporation or
+        organization.
 
-       b. use the modified software only within your corporation or
-          organization.
+     c. give non-standard executables non-standard names, with
+        instructions on where to get the original software distribution.
 
-       c. give non-standard executables non-standard names, with
-          instructions on where to get the original software distribution.
+     d. make other distribution arrangements with the author.
 
-       d. make other distribution arrangements with the author.
+  3. You may distribute the software in object code or executable
+     form, provided that you do at least ONE of the following:
 
-    3. You may distribute the software in object code or executable
-       form, provided that you do at least ONE of the following:
+     a. distribute the executables and library files of the software,
+        together with instructions (in the manual page or equivalent)
+        on where to get the original distribution.
 
-       a. distribute the executables and library files of the software,
-          together with instructions (in the manual page or equivalent)
-          on where to get the original distribution.
+     b. accompany the distribution with the machine-readable source of
+        the software.
 
-       b. accompany the distribution with the machine-readable source of
-          the software.
+     c. give non-standard executables non-standard names, with
+        instructions on where to get the original software distribution.
 
-       c. give non-standard executables non-standard names, with
-          instructions on where to get the original software distribution.
+     d . make other distribution arrangements with the author.
 
-       d. make other distribution arrangements with the author.
+  4. You may modify and include the part of the software into any other
+     software (possibly commercial).
 
-    4. You may modify and include the part of the software into any other
-       software (possibly commercial).
+  5. The scripts and library files supplied as input to or produced as
+     output from the software do not automatically fall under the
+     copyright of the software, but belong to whomever generated them,
+     and may be sold commercially, and may be aggregated with this
+     software.
 
-    5. The scripts and library files supplied as input to or produced as
-       output from the software do not automatically fall under the
-       copyright of the software, but belong to whomever generated them,
-       and may be sold commercially, and may be aggregated with this
-       software.
-
-    6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
-       IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
-       WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-       PURPOSE.
-
-[lib/bundler]
-[lib/bundler.rb]
-[spec/bundler]
-
-  Bundler is under the following license.
-
-  >>>
-    Portions copyright (c) 2010:: Andre Arko
-    Portions copyright (c) 2009:: Engine Yard
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/bundler/vendor/thor]
-
-  Thor is under the following license.
-
-  >>>
-    Copyright (c) 2008 Yehuda Katz, Eric Hodel, et al.
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/rubygems/vendor/molinillo]
-
-  molinillo is under the following license.
-
-  >>>
-    Copyright (c) 2014 Samuel E. Giddins segiddins@segiddins.me
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/bundler/vendor/pub_grub]
-
-  pub_grub is under the following license.
-
-  >>>
-    Copyright (c) 2018 John Hawthorn
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/bundler/vendor/connection_pool]
-
-  connection_pool is under the following license.
-
-  >>>
-    Copyright (c) 2011 Mike Perham
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/bundler/vendor/net-http-persistent]
-
-  net-http-persistent is under the following license.
-
-  >>>
-    Copyright (c) Eric Hodel, Aaron Patterson
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/did_you_mean]
-[lib/did_you_mean.rb]
-[test/did_you_mean]
-
-  did_you_mean is under the following license.
-
-  >>>
-    Copyright (c) 2014-2016 Yuki Nishijima
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/error_highlight]
-[lib/error_highlight.rb]
-[test/error_highlight]
-
-  error_highlight is under the following license.
-
-  >>>
-    Copyright (c) 2021 Yusuke Endoh
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[benchmark/so_ackermann.rb]
-[benchmark/so_array.rb]
-[benchmark/so_binary_trees.rb]
-[benchmark/so_concatenate.rb]
-[benchmark/so_count_words.yml]
-[benchmark/so_exception.rb]
-[benchmark/so_fannkuch.rb]
-[benchmark/so_fasta.rb]
-[benchmark/so_k_nucleotide.yml]
-[benchmark/so_lists.rb]
-[benchmark/so_mandelbrot.rb]
-[benchmark/so_matrix.rb]
-[benchmark/so_meteor_contest.rb]
-[benchmark/so_nbody.rb]
-[benchmark/so_nested_loop.rb]
-[benchmark/so_nsieve.rb]
-[benchmark/so_nsieve_bits.rb]
-[benchmark/so_object.rb]
-[benchmark/so_partial_sums.rb]
-[benchmark/so_pidigits.rb]
-[benchmark/so_random.rb]
-[benchmark/so_reverse_complement.yml]
-[benchmark/so_sieve.rb]
-[benchmark/so_spectralnorm.rb]
-
-  These files are very old copy of then-called "The Great Computer Language
-  Shootout".  LEGAL SITUATION OF THESE FILES ARE UNCLEAR because the original
-  site has been lost.  Upstream diverged to delete several benchmarks listed
-  above.
-
-== MIT License
->>>
-      Permission is hereby granted, free of charge, to any person obtaining
-      a copy of this software and associated documentation files (the
-      "Software"), to deal in the Software without restriction, including
-      without limitation the rights to use, copy, modify, merge, publish,
-      distribute, sublicense, and/or sell copies of the Software, and to
-      permit persons to whom the Software is furnished to do so, subject to
-      the following conditions:
-
-      The above copyright notice and this permission notice shall be
-      included in all copies or substantial portions of the Software.
-
-      THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
-      EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
-      MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
-      NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
-      LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
-      OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
-      WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
-
-== Old-style BSD license
->>>
-      Redistribution and use in source and binary forms, with or without
-      modification, are permitted provided that the following conditions
-      are met:
-      1. Redistributions of source code must retain the above copyright
-         notice, this list of conditions and the following disclaimer.
-      2. Redistributions in binary form must reproduce the above copyright
-         notice, this list of conditions and the following disclaimer in the
-         documentation and/or other materials provided with the distribution.
-      3. Neither the name of the University nor the names of its contributors
-         may be used to endorse or promote products derived from this software
-         without specific prior written permission.
-
-      THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-      ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-      IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-      ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-      FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-      DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-      OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-      HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-      LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-      OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-      SUCH DAMAGE.
-
-      IMPORTANT NOTE::
-
-      From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
-      paragraph 3 above is now null and void.
+  6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+     IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+     WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+     PURPOSE.
diff --git a/Makefile.in b/Makefile.in
new file mode 100644
index 0000000000..25075f5900
--- /dev/null
+++ b/Makefile.in
@@ -0,0 +1,531 @@
+SHELL = /bin/sh
+NULLCMD = @NULLCMD@
+n=$(NULLCMD)
+ECHO1 = $(V:1=$n)
+RUNCMD = $(SHELL)
+CDPATH = .
+CHDIR = @CHDIR@
+exec = exec
+NULL = /dev/null
+PATH_SEPARATOR = @PATH_SEPARATOR@
+
+#### Start of system configuration section. ####
+
+srcdir = @srcdir@
+top_srcdir = $(srcdir)
+hdrdir = $(srcdir)/include
+PLATFORM_DIR = @PLATFORM_DIR@
+
+CC = @CC@
+CPP = @CPP@
+LD = @LD@
+YACC = bison
+PURIFY =
+AUTOCONF = autoconf
+ACLOCAL = aclocal
+CONFIGURE = @CONFIGURE@
+@SET_MAKE@
+MKFILES = @MAKEFILES@
+BASERUBY = @BASERUBY@
+HAVE_BASERUBY = @HAVE_BASERUBY@
+TEST_RUNNABLE = @TEST_RUNNABLE@
+CROSS_COMPILING = @CROSS_COMPILING@
+DOXYGEN = @DOXYGEN@
+
+prefix = @prefix@
+exec_prefix = @exec_prefix@
+bindir = @bindir@
+sbindir = @sbindir@
+libdir = @libdir@
+libexecdir = @libexecdir@
+datarootdir = @datarootdir@
+datadir = @datadir@
+arch = @arch@
+sitearch = @sitearch@
+sitedir = @sitedir@
+archlibdir = @archlibdir@
+ruby_version = @ruby_version@
+
+TESTUI = console
+TESTS =
+INSTALLDOC = @INSTALLDOC@
+DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
+
+EXTOUT = @EXTOUT@
+arch_hdrdir = $(EXTOUT)/include/$(arch)
+VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/missing
+
+empty =
+CC_VERSION = @CC_VERSION@
+OUTFLAG = @OUTFLAG@$(empty)
+COUTFLAG = @COUTFLAG@$(empty)
+ARCH_FLAG = @ARCH_FLAG@
+CFLAGS_NO_ARCH = @CFLAGS@
+CFLAGS = $(CFLAGS_NO_ARCH) $(ARCH_FLAG)
+cflags = @cflags@
+optflags = @optflags@
+debugflags = @debugflags@
+warnflags = @warnflags@ @strict_warnflags@
+cppflags = @cppflags@
+XCFLAGS = @XCFLAGS@
+CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
+LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
+EXTLDFLAGS = @EXTLDFLAGS@
+XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
+EXTLIBS =
+LIBS = @LIBS@ $(EXTLIBS)
+MISSING = @LIBOBJS@ @ALLOCA@
+ENABLE_SHARED = @ENABLE_SHARED@
+LDSHARED = @LIBRUBY_LDSHARED@
+DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(XLDFLAGS) $(ARCH_FLAG)
+SOLIBS = @SOLIBS@
+ENABLE_DEBUG_ENV = @ENABLE_DEBUG_ENV@
+MAINLIBS = @MAINLIBS@
+ARCHMINIOBJS = @MINIOBJS@
+DLNOBJ = @DLNOBJ@
+ENCOBJS = @ENCOBJS@
+EXTOBJS = @EXTOBJS@
+BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
+BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
+BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
+POSTLINK = @POSTLINK@
+
+RUBY_BASE_NAME=@RUBY_BASE_NAME@
+RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
+RUBY_API_VERSION=@RUBY_API_VERSION@
+RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
+RUBY_SO_NAME=@RUBY_SO_NAME@
+EXEEXT = @EXEEXT@
+LIBEXT = @LIBEXT@
+PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
+RUBY = $(RUBY_INSTALL_NAME)
+MINIRUBY = @MINIRUBY@\
+	$(MINIRUBYOPT)
+# RUNRUBY_COMMAND:: runruby.rb or baseruby. do not append options directly
+RUNRUBY_COMMAND = @RUNRUBY_COMMAND@
+# RUNRUBY:: run ruby with RUN_OPTS which is passed to ruby
+RUNRUBY = @RUNRUBY@ $(RUN_OPTS)
+# RUNRUBY_DEBUGGER:: debugging option for runruby.rb
+RUNRUBY_DEBUGGER = --debugger='gdb -x run.gdb --quiet --args'
+XRUBY = @XRUBY@
+BTESTRUBY = @BTESTRUBY@\
+	$(MINIRUBYOPT)
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+XRUBY_LIBDIR = @XRUBY_LIBDIR@
+XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
+XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
+BOOTSTRAPRUBY = @BOOTSTRAPRUBY@
+
+#### End of system configuration section. ####
+
+MAJOR=	@MAJOR@
+MINOR=	@MINOR@
+TEENY=	@TEENY@
+RUBY_PROGRAM_VERSION = @RUBY_PROGRAM_VERSION@
+
+LIBRUBY_A     = @LIBRUBY_A@
+LIBRUBY_SO    = @LIBRUBY_SO@
+LIBRUBY_SONAME= @LIBRUBY_SONAME@
+LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
+LIBRUBY	      = @LIBRUBY@
+LIBRUBYARG    = @LIBRUBYARG@
+LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
+LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
+LIBRUBY_RELATIVE = @LIBRUBY_RELATIVE@
+LIBRUBY_A_OBJS = @LIBRUBY_A_OBJS@
+
+DTRACE_REBUILD_OBJS = $(DTRACE_REBUILD:yes=$(DTRACE_DEPENDENT_OBJS))
+
+DTRACE_DEPENDENT_OBJS = array.$(OBJEXT) \
+			eval.$(OBJEXT) \
+			gc.$(OBJEXT) \
+			hash.$(OBJEXT) \
+			load.$(OBJEXT) \
+			object.$(OBJEXT) \
+			parse.$(OBJEXT) \
+			string.$(OBJEXT) \
+			symbol.$(OBJEXT) \
+			vm.$(OBJEXT)
+
+THREAD_MODEL  = @THREAD_MODEL@
+
+PREP          = @PREP@
+ARCHFILE      = @ARCHFILE@
+SETUP         =
+EXTSTATIC     = @EXTSTATIC@
+ENCSTATIC     = @ENCSTATIC@
+SET_LC_MESSAGES = env LC_MESSAGES=C
+
+MAKEDIRS      = @MKDIR_P@
+CP            = cp
+MV            = mv
+RM            = rm -f
+RMDIR         = @RMDIR@
+RMDIRS        = @RMDIRS@
+RMALL         = @RMALL@
+NM            = @NM@
+AR            = @AR@
+ARFLAGS       = @ARFLAGS@$(empty)
+RANLIB        = @RANLIB@
+AS            = @AS@
+ASFLAGS       = @ASFLAGS@ $(INCFLAGS)
+IFCHANGE      = $(srcdir)/tool/ifchange
+SET_LC_MESSAGES = env LC_MESSAGES=C
+OBJDUMP       = @OBJDUMP@
+OBJCOPY       = @OBJCOPY@
+HAVE_GIT      = @HAVE_GIT@
+GIT           = @GIT@
+VCS           = @VCS@
+VCSUP         = @VCSUP@
+DTRACE        = @DTRACE@ @DTRACE_OPT@
+DTRACE_EXT    = @DTRACE_EXT@
+DTRACE_OBJ    = @DTRACE_OBJ@
+DTRACE_REBUILD= @DTRACE_REBUILD@
+DTRACE_GLOMMED_OBJ = $(DTRACE_REBUILD:yes=ruby-glommed.$(OBJEXT))
+
+OBJEXT        = @OBJEXT@
+ASMEXT        = S
+SOEXT         = @SOEXT@
+DLEXT         = @DLEXT@
+MANTYPE	      = @MANTYPE@
+SYMBOL_PREFIX = @SYMBOL_PREFIX@
+
+INSTALLED_LIST= .installed.list
+
+NEWLINE_C     = enc/trans/newline.c
+MINIPRELUDE_C = miniprelude.c
+PRELUDE_C     = prelude.c
+RBCONFIG      = .rbconfig.time
+
+MAINSRC = $(MAINOBJ:@OBJEXT@=c)
+
+SRC_FILE      = $<
+OS_SRC_FILE   = $<
+DEST_FILE     = $@
+OS_DEST_FILE  = $@
+
+MESSAGE_BEGIN = @for line in
+MESSAGE_END = ; do echo "$$line"; done
+ECHO_BEGIN = @sep=''; for word in
+ECHO_END = ; do echo @ECHO_N@ "$$sep'$$word'@ECHO_C@"; sep=' '; done; echo
+
+DESTDIR       = @DESTDIR@
+
+configure_args = @configure_args@
+#### End of variables
+
+.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
+
+all:
+
+# Prevent GNU make v3 from overflowing arg limit on SysV.
+.NOEXPORT:
+
+miniruby$(EXEEXT):
+		@-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
+		$(ECHO) linking $@
+		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
+		$(Q) $(POSTLINK)
+
+$(PROGRAM):
+		@$(RM) $@
+		$(ECHO) linking $@
+		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(EXTLIBS) $(OUTFLAG)$@
+		$(Q) $(POSTLINK)
+
+# We must `rm' the library each time this rule is invoked because "updating" a
+# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
+# supported.
+$(LIBRUBY_A):
+		@$(RM) $@
+		$(ECHO) linking static-library $@
+		$(Q) $(AR) $(ARFLAGS) $@ $(LIBRUBY_A_OBJS) $(INITOBJS)
+		@-$(RANLIB) $@ 2> /dev/null || true
+
+verify-static-library: $(LIBRUBY_A)
+		$(ECHO) verifying static-library $@
+		@$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)conftest$(EXEEXT)
+		@$(RMALL) conftest$(EXEEXT) conftest.c conftest.dSYM
+
+$(LIBRUBY_SO):
+		@-$(PRE_LIBRUBY_UPDATE)
+		$(ECHO) linking shared-library $@
+		$(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(EXTSOLIBS) $(OUTFLAG)$@
+		-$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)ruby_static_id_*' \
+			-L '$(SYMBOL_PREFIX)*_threadptr_*' -L '$(SYMBOL_PREFIX)*_ec_*' $@
+		$(Q) $(POSTLINK)
+		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link rescue nil; \
+						  File.symlink "$(LIBRUBY_SO)", link}' \
+				$(LIBRUBY_ALIASES) || true
+
+ruby_pc = @ruby_pc@
+$(ruby_pc):
+		@./config.status --file=$@:$(srcdir)/template/ruby.pc.in
+
+ruby-runner.h: template/ruby-runner.h.in
+		@./config.status --file=$@:$(srcdir)/template/$(@F).in
+
+$(RBCONFIG): $(PREP)
+
+rbconfig.rb: $(RBCONFIG)
+
+install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
+	$(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
+	$(ECHO) installing cross-compiling stuff
+	$(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+	$(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
+	$(Q) $(BASERUBY) -p \
+	-e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
+	-e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
+	rbconfig.rb > fake-rbconfig.rb
+	$(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
+	$(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
+	@$(RM) fake.rb fake-rbconfig.rb
+	$(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+	$(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
+	$(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
+	$(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
+
+Makefile:	$(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
+
+$(MKFILES): config.status $(srcdir)/version.h
+		@[ -f $@ ] && mv $@ $@.old
+		MAKE=$(MAKE) $(SHELL) ./config.status $@
+		@cmp $@ $@.old > /dev/null 2>&1 && echo $@ unchanged && exit 0; \
+		{ \
+		    echo "all:; -@rm -f conftest.mk"; \
+		    echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
+		    echo ".force:"; \
+		} > conftest.mk || exit 1; \
+		$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
+		{ echo "$@ updated, restart."; exit 1; }
+
+uncommon.mk: $(srcdir)/common.mk
+		sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
+
+.PHONY: reconfig
+reconfig-args = $(srcdir)/$(CONFIGURE) $(configure_args)
+config.status-args = ./config.status --recheck
+reconfig-exec-0 = test -t 1 && { CONFIGURE_TTY=yes; export CONFIGURE_TTY; }; exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3 3>&- 4>&-`
+reconfig-exec-1 = set -x; "$$@"
+
+reconfig config.status:	$(srcdir)/$(CONFIGURE) $(srcdir)/enc/Makefile.in \
+			$(srcdir)/include/ruby/version.h
+	@PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
+	set $(SHELL) $($@-args); $(reconfig-exec-$(V))
+
+$(srcdir)/$(CONFIGURE): $(srcdir)/configure.ac $(srcdir)/aclocal.m4
+	$(CHDIR) $(srcdir) && exec $(AUTOCONF) -o $(@F)
+
+$(srcdir)/aclocal.m4:
+	$(CHDIR) $(srcdir) && \
+	type $(ACLOCAL) >/dev/null 2>&1 && exec $(ACLOCAL); \
+	touch $(@F)
+
+prereq: $(srcdir)/$(CONFIGURE)
+
+incs: id.h
+all-incs: probes.h
+
+# Things which should be considered:
+# * with gperf v.s. without gperf
+# * committers may have various versions of gperf
+# * ./configure v.s. ../ruby/configure
+# * GNU make v.s. HP-UX make	# HP-UX make invokes the action if lex.c and keywords has same mtime.
+# * svn checkout generate a file with mtime as current time
+# * ext4 and XFS has a mtime with fractional part
+lex.c: defs/keywords
+	@\
+	if cmp -s $(srcdir)/defs/lex.c.src $?; then \
+	  [ $(Q) ] && echo copying $@ || set -x; \
+	  $(CP) $(srcdir)/lex.c.blt $@; \
+	else \
+	  [ $(Q) ] && echo generating $@ || set -x; \
+	  gperf -C -P -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? \
+	  | sed -f $(srcdir)/tool/gperf.sed \
+	  > $@.tmp && \
+	  $(MV) $@.tmp $@ && \
+	  $(CP) $? $(srcdir)/defs/lex.c.src && \
+	  $(CP) $@ $(srcdir)/lex.c.blt; \
+	fi
+
+JIS_PROPS_OPTIONS = -k1,3 -7 -c -j1 -i1 -t -C -P -t --ignore-case -H onig_jis_property_hash -Q onig_jis_property_pool -N onig_jis_property
+
+$(srcdir)/enc/jis/props.h: enc/jis/props.kwd
+	$(MAKEDIRS) $(@D)
+	@set +e; \
+	if cmp -s $(?:.kwd=.src) $?; then \
+	  set -x; \
+	  $(CP) $(?:.kwd=.h.blt) $@; \
+	else \
+	  set -x; \
+	  gperf $(JIS_PROPS_OPTIONS) $? | \
+	  sed -f $(srcdir)/tool/gperf.sed > $@ && \
+	  $(CP) $? $(?:.kwd=.src) && \
+	  $(CP) $@ $(?:.kwd=.h.blt); \
+	fi
+
+.c.@OBJEXT@:
+	@$(ECHO) compiling $<
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
+
+.s.@OBJEXT@:
+	@$(ECHO) assembling $<
+	$(Q) $(AS) $(ASFLAGS) -o $@ $<
+
+.c.S:
+	@$(ECHO) translating $<
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
+
+.c.i:
+	@$(ECHO) preprocessing $<
+	$(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
+
+.d.h:
+	@$(ECHO) translating probes $<
+	$(Q) $(DTRACE) -o $@.tmp -h -C $(INCFLAGS) -s $<
+	$(Q) sed -e 's/RUBY_/RUBY_DTRACE_/g' -e 's/PROBES_H_TMP/RUBY_PROBES_H/' -e 's/(char \*/(const char */g' -e 's/, char \*/, const char */g' $@.tmp > $@
+	$(Q) $(RM) $@.tmp
+
+.dmyh.h:
+	@$(ECHO) making dummy $(DEST_FILE)
+	$(Q)echo '#include "$(*F).dmyh"' > $@
+
+probes.stamp: $(DTRACE_REBUILD_OBJS)
+	$(Q) if test -f $@ -o -f probes.$(OBJEXT); then \
+	  $(RM) $(DTRACE_REBUILD_OBJS) $@; \
+	  $(ECHO0) "rebuilding objects which were modified by \"dtrace -G\""; \
+	  $(MAKE) $(DTRACE_REBUILD_OBJS); \
+	fi
+	$(Q) touch $@
+
+probes.@OBJEXT@: $(srcdir)/probes.d $(DTRACE_REBUILD:yes=probes.stamp)
+	@$(ECHO) processing probes in object files
+	$(Q) $(RM) $@
+	$(Q) $(DTRACE) -G -C $(INCFLAGS) -s $(srcdir)/probes.d -o $@ $(DTRACE_REBUILD_OBJS)
+
+# DTrace static library hacks described here:
+# http://mail.opensolaris.org/pipermail/dtrace-discuss/2005-August/000207.html
+ruby-glommed.$(OBJEXT):
+	@$(ECHO) generating a glommed object with DTrace probes for static library
+	$(Q) $(LD) -r -o $@ $(OBJS)
+
+clean-local::
+	$(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output \
+		enc/encinit.c enc/encinit.$(OBJEXT)
+	-$(Q)$(RM) $(pkgconfig_DATA)
+	-$(Q)$(RMALL) exe/ ruby-runner.h *.dSYM
+
+distclean-local::
+	$(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
+	-$(Q)$(RM) run.gdb
+	-$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h verconf.h
+	-$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
+
+ext/clean.sub gems/clean.sub:: ext/clean.mk
+ext/distclean.sub gems/distclean.sub:: ext/distclean.mk
+ext/realclean.sub gems/realclean.sub:: ext/realclean.mk
+
+ext/clean.mk ext/distclean.mk ext/realclean.mk::
+	-$(Q) if [ -f $(EXTS_MK) ]; then exec $(MAKE) -f $(EXTS_MK) $(@F:.mk=); fi
+
+ext/clean:: ext/clean.sub
+ext/distclean:: ext/distclean.sub
+ext/realclean:: ext/realclean.sub
+gems/clean:: gems/clean.sub
+gems/distclean:: gems/distclean.sub
+gems/realclean:: gems/realclean.sub
+
+ext/clean.sub ext/distclean.sub ext/realclean.sub \
+gems/clean.sub gems/distclean.sub gems/realclean.sub::
+	$(Q) set dummy `echo "${EXTS}" | tr , ' '`; shift; \
+	test "$$#" = 0 && set .; \
+	set dummy `\
+	    cd $(@D) 2>/dev/null && \
+	    find "$$@" \( -name Makefile -o -name exts.mk \) -print | \
+	    sed -n 's:^\./::;s:^:$(@D)/:;s:/[^/][^/]*$$::p' | sort -u; \
+	`; shift; \
+	for dir do \
+	    $(RM) "$$dir/exts.mk"; \
+	    if [ -f "$$dir/Makefile" ]; then \
+		echo $(@F:.sub=)ing "$$dir"; \
+		(cd "$$dir" && exec $(MAKE) $(mflags) $(@F:.sub=)); \
+	    fi; \
+	done || true
+
+ext/distclean ext/realclean gems/distclean gems/realclean::
+	$(Q) set dummy `echo "${EXTS}" | tr , ' '`; shift; \
+	test "$$#" = 0 && set .; \
+	cd $(@D) 2>/dev/null && \
+	find "$$@" -type d -empty -exec $(RMDIRS) {} + 2> /dev/null || true
+	$(Q) $(RMDIRS) $(@D) 2> /dev/null || true
+
+clean-enc distclean-enc realclean-enc:
+	@test -f "$(ENC_MK)" || exit 0; \
+	echo $(@:-enc=ing) encodings; \
+	exec $(MAKE) $(MAKE_ENC) $(@:-enc=)
+
+ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
+	$(ECHO) compiling $@
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
+
+enc/encinit.$(OBJEXT): enc/encinit.c $(SETUP)
+
+test-bundled-gems-run:
+	$(Q) set -e; while read gem _; do \
+	  echo testing $$gem gem && \
+	  $(XRUBY) -C $(srcdir)/gems/src/$$gem -Ilib ../../../.bundle/bin/rake; \
+	done < $(srcdir)/gems/bundled_gems
+
+update-src::
+	@$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
+
+update-download:: update-config_files
+
+after-update:: prereq
+
+gcov:
+	$(Q) $(BASERUBY) $(srcdir)/tool/run-gcov.rb
+
+lcov:
+	$(Q) $(BASERUBY) $(srcdir)/tool/run-lcov.rb
+
+update-doclie:
+	$(Q) $(srcdir)/tool/git-refresh -C $(srcdir)/coverage $(Q1:0=-q) \
+		--branch $(DOCLIE_GIT_REF) \
+		$(DOCLIE_GIT_URL) doclie $(GIT_OPTS)
+
+update-simplecov-html:
+	$(Q) $(srcdir)/tool/git-refresh -C $(srcdir)/coverage $(Q1:0=-q) \
+		--branch $(SIMPLECOV_HTML_GIT_REF) \
+		$(SIMPLECOV_HTML_GIT_URL) simplecov-html $(GIT_OPTS)
+
+update-simplecov:
+	$(Q) $(srcdir)/tool/git-refresh -C $(srcdir)/coverage $(Q1:0=-q) \
+		--branch $(SIMPLECOV_GIT_REF)  \
+		$(SIMPLECOV_GIT_URL) simplecov $(GIT_OPTS)
+
+update-coverage: update-simplecov update-simplecov-html update-doclie
+
+INSNS	= opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
+	  vmtc.inc vm.inc
+
+$(INSNS): $(srcdir)/insns.def vm_opts.h \
+	  $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
+	  $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
+	$(ECHO) generating $@
+	$(Q) $(BASERUBY) -Ku $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
+
+verconf.h: $(RBCONFIG)
+
+loadpath: verconf.h
+	@$(CPP) $(XCFLAGS) $(CPPFLAGS) $(srcdir)/loadpath.c | \
+	sed -e '1,/^const char ruby_initial_load_paths/d;/;/,$$d' \
+	    -e '/^ /!d;s/ *"\\0"$$//;s/" *"//g'
+
+un-runnable:
+	$(ECHO) cannot make runnable, configure with --enable-load-relative.
+	$(Q) exit 1
diff --git a/NEWS b/NEWS
new file mode 100644
index 0000000000..e1b91f38b7
--- /dev/null
+++ b/NEWS
@@ -0,0 +1,577 @@
+# -*- rdoc -*-
+
+= NEWS for Ruby 2.5.0
+
+This document is a list of user visible feature changes made between
+releases except for bug fixes.
+
+Note that each entry is kept so brief that no reason behind or
+reference information is supplied with.  For a full list of changes
+with all sufficient information, see the ChangeLog file or Redmine
+(e.g. <tt>https://bugs.ruby-lang.org/issues/$FEATURE_OR_BUG_NUMBER</tt>)
+
+== Changes since the 2.4.0 release
+
+=== Language changes
+
+* Top-level constant look-up is removed.  [Feature #11547]
+
+* rescue/else/ensure are allowed inside do/end blocks.  [Feature #12906]
+
+* refinements take place in string interpolations.  [Feature #13812]
+
+=== Core classes updates (outstanding ones only)
+
+* Array
+
+  * New methods:
+
+    * Array#append  [Feature #12746]
+    * Array#prepend  [Feature #12746]
+
+* Data
+
+  * Is deprecated. It was a base class for C extensions, and it's not
+    necessary to expose in Ruby level. [Feature #3072]
+
+* Exception
+
+  * New methods:
+
+    * Exception#full_message to retrieve a String expression of an exception,
+      formatted in the same way in which Ruby prints out an uncaught exception.
+      [Feature #14141] [experimental]
+
+* Dir
+
+  * Dir.glob provides new optional keyword argument, :base.
+    [Feature #13056]
+  * Dir.chdir (without block arg), Dir.open, Dir.new, Dir.mkdir, Dir.rmdir,
+    Dir.empty? releases GVL
+
+  * New methods:
+
+    * Dir.children  [Feature #11302]
+    * Dir.each_child  [Feature #11302]
+
+* Enumerable
+
+  * Enumerable#{any?,all?,none?,one?} accept a pattern argument [Feature #11286]
+
+* File
+
+  * File.open accepts :newline option to imply text mode.  [Bug #13350]
+  * File#path raises an IOError for files opened with
+    File::Constants::TMPFILE option. [Feature #13568]
+  * File.stat, File.exist?, and other rb_stat()-using methods release GVL
+    [Bug #13941]
+  * File.rename releases GVL [Feature #13951]
+  * File::Stat#{atime,mtime,ctime} support fractional second timestamps on
+    Windows 8 and later  [Feature #13726]
+  * File::Stat#ino and File.indentical? support ReFS 128bit ino on Windows 8.1
+    and later  [Feature #13731]
+  * File.readable?, File.readable_real?, File.writable?, File.writable_real?,
+    File.executable?, File.executable_real?, File.mkfifo, File.readlink,
+    File.truncate, File#truncate, File.chmod, File.lchmod, File.chown,
+    File.lchown, File.unlink, File.utime, File.lstat release GVL
+
+  * New method:
+
+    * File.lutime  [Feature #4052]
+
+* Exception
+
+  * Exception#full_message takes :highlight and :order options [Bug #14324]
+
+* Hash
+
+  * New methods:
+
+    * Hash#transform_keys  [Feature #13583]
+    * Hash#transform_keys!  [Feature #13583]
+    * Hash#slice  [Feature #8499]
+
+* IO
+
+  * IO#copy_stream tries copy offload with copy_file_range(2) [Feature #13867]
+
+  * New methods:
+
+    * IO#pread  [Feature #4532]
+    * IO#pwrite  [Feature #4532]
+    * IO#write accepts multiple arguments  [Feature #9323]
+
+* IOError
+
+  * IO#close might raise an error with message "stream closed",
+    but it is refined to "stream closed in another thread". The new message
+    is more clear for user.
+    [Bug #13405]
+
+* Integer
+
+  * Integer#step no longer hides errors from coerce method when
+    given a step value which cannot be compared with #> to 0.
+    [Feature #7688]
+  * Integer#{round,floor,ceil,truncate} always return an Integer.
+    [Bug #13420]
+  * Integer#pow accepts modulo argument for calculating modular
+    exponentiation.  [Feature #12508] [Feature #11003]
+
+  * New methods:
+
+    * Integer#allbits?, Integer#anybits?, Integer#nobits? [Feature #12753]
+    * Integer.sqrt  [Feature #13219]
+
+* Kernel
+
+  * Kernel#yield_self   [Feature #6721]
+  * Kernel#pp  [Feature #14123]
+  * Kernel#warn(..., uplevel:n)  [Feature #12882]
+
+* Method
+
+  * New methods:
+
+    * Method#=== that invokes Method#call, as same as Proc#=== [Feature #14142]
+
+* Module
+
+  * Module#{attr,attr_accessor,attr_reader,attr_writer} become public [Feature #14132]
+  * Module#{define_method,alias_method,undef_method,remove_method} become public [Feature #14133]
+
+* Numeric
+
+  * Numerical comparison operators (<,<=,>=,>) no longer hide exceptions
+    from #coerce method internally. Return nil in #coerce if the coercion is
+    impossible.  [Feature #7688]
+
+* Process
+
+  * Precision of Process.times is improved if getrusage(2) exists. [Feature #11952]
+
+  * New method:
+
+    * Process.last_status as an alias of $? [Feature #14043]
+
+* Range
+  * Range#initialize no longer hides exceptions when comparing begin and
+    end with #<=> and raise a "bad value for range" ArgumentError
+    but instead lets the exception from the #<=> call go through.
+    [Feature #7688]
+
+* Regexp
+
+  * Update to Onigmo 6.1.3-669ac9997619954c298da971fcfacccf36909d05.
+
+    * Support absence operator https://github.com/k-takata/Onigmo/issues/82
+
+  * Support new 5 emoji-related Unicode character properties
+
+* RubyVM::InstructionSequence
+
+  * New method:
+
+    * RubyVM::InstructionSequence#each_child
+    * RubyVM::InstructionSequence#trace_points
+
+* String
+
+  * String#-@ deduplicates unfrozen strings.  Already-frozen
+    strings remain unchanged for compatibility.  [Feature #13077]
+  * -"literal" (String#-@) optimized to return the same object
+    (same as "literal".freeze in Ruby 2.1+) [Feature #13295]
+  * String#{casecmp,casecmp?} return nil for non-string arguments
+    instead of raising a TypeError. [Bug #13312]
+  * String#start_with? accepts a regexp [Feature #13712]
+
+  * New methods:
+
+    * String#delete_prefix, String#delete_prefix! [Feature #12694]
+    * String#delete_suffix, String#delete_suffix! [Feature #13665]
+    * String#each_grapheme_cluster and String#grapheme_clusters to
+      enumerate grapheme clusters [Feature #13780]
+    * String#undump to unescape String#dump'ed string [Feature #12275]
+
+* Struct
+
+  * Struct.new takes `keyword_init: true` option to initialize members
+    with keyword arguments. [Feature #11925]
+
+* Regexp/String: Update Unicode version from 9.0.0 to 10.0.0 [Feature #13685]
+
+* Thread
+
+  * Description set by Thread#name= is now visible on Windows 10.
+
+  * New method:
+    * Thread#fetch  [Feature #13009]
+
+  * The default of Thread.report_on_exception is now true,
+    showing unhandled exceptions terminating threads on $stderr.
+    [Feature #14143]
+
+* Time
+
+  * Time#at receives 3rd argument which specifies the unit of 2nd argument.
+    [Feature #13919]
+
+* KeyError
+
+  * New methods:
+
+    * KeyError#receiver [Feature #12063]
+    * KeyError#key      [Feature #12063]
+
+* FrozenError
+
+  * New exception class. [Feature #13224]
+
+=== Stdlib updates (outstanding ones only)
+
+* BigDecimal
+
+  * Update to BigDecimal 1.3.4
+
+  * The following features are added:
+
+    * BigDecimal::VERSION
+
+  * The following features have been deprecated,
+    and are planned to be removed in the version 1.4.0:
+
+    * BigDecimal.new
+
+    * BigDecimal.ver
+
+  * BigDecimal#clone and #dup now do not make a new instance,
+    but returns the receiver itself.
+
+* Coverage
+
+  * Support branch coverage and method coverage measurement. [Feature #13901]
+    Branch coverage tells you which branches are executed, and which not.
+    Method coverage tells you which methods are invoked, and which not.
+    By running a test suite with this new feature, you can know which branches
+    and methods are executed by a test, and evaluate total coverage of a test
+    suite more strictly.
+
+    You can specify the measuring target by an option to `Coverage.start`:
+
+        Coverage.start(lines: true, branches: true, methods: true)
+
+    After some Ruby files are loaded, you can use `Coverage.result` to get
+    the coverage result:
+
+        Coverage.result
+        #=> { "/path/to/file.rb"=>
+        #     { :lines => [1, 2, 0, nil, ...],
+        #       :branches =>
+        #         { [:if, 0, 2, 1, 6, 4] =>
+        #             { [:then, 1, 3, 2, 3, 8] => 0,
+        #               [:else, 2, 5, 2, 5, 8] => 2
+        #             }
+        #         },
+        #       :methods => {
+        #          [Object, :foo, 1, 0, 7, 3] => 2
+        #       }
+        #     }
+        #   }
+
+    The result type of line coverage is not changed; it is just an array that
+    contains numbers, which means the count that each line was executed,
+    or `nil`s, which means that the line is not relevant.
+
+    The result type of branch coverage is:
+
+        { (jump base) => { (jump target) => (counter) } }
+
+    where jump base and targets have the format
+
+        [type, unique-id, start lineno, start column, end lineno, end column]
+
+    For example, `[:if, 0, 2, 1, 6, 4]` reads an `if` statement that ranges from
+    line 2 and column 1, to line 6 and column 4.  `[:then, 1, 3, 2, 3, 8]` reads
+    a `then` clause that ranges from line 3 and column 2, to line 3 and column 8.
+    Note that lineno starts from 1, and that columnno starts from 0.  So, the
+    above example shows a branch from the `if` to the `then` was never executed,
+    and a branch from the `if` to the `else` was executed twice.
+
+    The result type of method coverage is:
+
+        { (method key) => (counter) }
+
+    where method key has the format
+
+        [class, method-name, start lineno, start column, end lineno, end column]
+
+    For example, `[Object, :foo, 1, 0, 7, 3]` reads `Object#foo` that ranges from
+    line 1 and column 0, to line 7 and column 3.  The above example shows this
+    `Object#foo` was invoked twice.
+
+    Note: To keep compatibility, passing no option to `Coverage.start` will measure
+    only line coverage, and `Coverage.result` will return the old format:
+
+        Coverage.result
+        #=> { "/path/to/file.rb"=> [1, 2, 0, nil, ...] }
+
+* DRb
+
+  * ACL::ACLEntry.new no longer suppresses IPAddr::InvalidPrefixError.
+
+* ERB
+
+  * Add ERB#result_with_hash to render a template with local variables passed
+    with a Hash object. [Feature #8631]
+
+  * Default template file encoding is changed from ASCII-8BIT to UTF-8 in erb
+    command. [Bug #14095]
+
+  * Carriage returns are changed to be trimmed properly if trim_mode is specified
+    and used. Duplicated newlines will be removed on Windows. [Bug #5339] [Bug #11464]
+
+* IPAddr
+
+  * IPAddr no longer accepts invalid address mask. [Bug #13399]
+  * IPAddr#{ipv4_compat,ipv4_compat?} are marked for deprecation. [Bug #13769]
+
+  * New methods:
+
+    * IPAddr#prefix
+    * IPAddr#loopback?
+    * IPAddr#private? [Feature #11666]
+    * IPAddr#link_local? [Feature #10912]
+
+
+* IRB
+
+  * Print backtrace and error message in reverse order [Feature #8661] [experimental]
+  * `binding.irb` automatically requires irb and runs [Bug #13099] [experimental]
+  * `binding.irb` on its start shows source around the line where it was called
+    [Feature #14124]
+
+* Matrix
+
+  * New methods:
+
+    * Matrix.combine and Matrix#combine [Feature #10903]
+    * Matrix#{hadamard_product,entrywise_product}
+
+* Net::HTTP
+
+  * Net::HTTP.new supports no_proxy parameter [Feature #11195]
+  * Net::HTTP#{min_version,max_version}, [Feature #9450]
+  * Add more HTTP status classes
+  * Net::HTTP::STATUS_CODES is added as HTTP Status Code Repository [Misc #12935]
+  * Net::HTTP#{proxy_user,proxy_pass} reflect http_proxy environment variable
+    if the system's environment variable is multiuser safe. [Bug #12921]
+
+* open-uri
+  * URI.open method defined as an alias to open-uri's Kernel.open.
+    open-uri's Kernel.open will be deprecated in future.
+
+* OpenSSL
+
+  * Updated Ruby/OpenSSL from version 2.0 to 2.1. Changes are noted in
+    "Version 2.1.0" section in ext/openssl/History.md.
+
+* Pathname
+
+  * New method:
+
+    * Pathname#glob [Feature #7360]
+
+* Psych
+
+  * Update to Psych 3.0.2.
+
+    * Convert fallback option to a keyword argument
+      https://github.com/ruby/psych/pull/342
+    * Add :symbolize_names option to Psych.load, Psych.safe_load like JSON.parse
+      https://github.com/ruby/psych/pull/333, https://github.com/ruby/psych/pull/337
+    * Add Psych::Handler#event_location
+      https://github.com/ruby/psych/pull/326
+    * Make frozen string literal = true
+      https://github.com/ruby/psych/pull/320
+    * Preserve time zone offset when deserializing times
+      https://github.com/ruby/psych/pull/316
+    * Remove deprecated method aliases for syck gem
+      https://github.com/ruby/psych/pull/312
+
+* RbConfig
+
+  * RbConfig::LIMITS is added to provide the limits of C types.
+    This is available when rbconfig/sizeof is loaded.
+
+* Ripper
+
+  * Ripper::EXPR_BEG and so on for Ripper#state.
+
+  * New method:
+
+    * Ripper#state to tell the state of scanner. [Feature #13686]
+
+* RDoc
+
+  * Update to RDoc 6.0.1.
+
+    * Replace IRB based lexer with Ripper.
+      * https://github.com/ruby/rdoc/pull/512
+      * This much improves the speed of generating documents.
+      * It also facilitates supporting new syntax in the future.
+    * Support many new syntaxes of Ruby from the past few years.
+    * Use "frozen_string_literal: true".
+      Performance survey: https://gist.github.com/aycabta/abdfaa75ea8a6877eeb734e942e73800
+    * Support did_you_mean.
+
+* Rubygems
+
+  * Update to Rubygems 2.7.3.
+    * http://blog.rubygems.org/2017/11/28/2.7.3-released.html
+    * http://blog.rubygems.org/2017/11/08/2.7.2-released.html
+    * http://blog.rubygems.org/2017/11/03/2.7.1-released.html
+    * http://blog.rubygems.org/2017/11/01/2.7.0-released.html
+    * http://blog.rubygems.org/2017/10/09/2.6.14-released.html
+    * http://blog.rubygems.org/2017/08/27/2.6.13-released.html
+
+* SecureRandom
+
+  * New method:
+
+    * SecureRandom.alphanumeric
+
+* Set
+
+  * New methods:
+
+    * Set#to_s as alias to #inspect [Feature #13676]
+    * Set#=== as alias to #include? [Feature #13801]
+    * Set#reset [Feature #6589]
+
+* StringIO
+
+  * StringIO#write accepts multiple arguments
+
+* StringScanner
+
+  * New methods:
+
+    * StringScanner#size, StringScanner#captures, StringScanner#values_at  [Feature #836]
+
+* URI
+
+  * Relative path operations no longer collapse consecutive slashes to a single slash. [Bug #8352]
+
+* WEBrick
+
+  * Add Server Name Indication (SNI) support [Feature #13729]
+  * support Proc objects as body responses [Feature #855]
+  * released as a RubyGem [Feature #13173]
+  * avoid unintended behavior from Kernel#open [Misc #14216]
+
+* Zlib
+
+  * Zlib::GzipWriter#write accepts multiple arguments
+
+=== Compatibility issues (excluding feature bug fixes)
+
+* Socket
+
+  * BasicSocket#read_nonblock and BasicSocket#write_nonblock no
+    longer set the O_NONBLOCK file description flag as side effect
+    (on Linux only) [Feature #13362]
+
+* Random
+
+  * Random.raw_seed renamed to become Random.urandom.  It is now
+    applicable to non-seeding purposes due to [Bug #9569].
+
+* Socket
+
+  * Socket::Ifaddr#vhid is added [Feature #13803]
+
+* ConditionVariable, Queue and SizedQueue reimplemented for speed.
+  They no longer subclass Struct. [Feature #13552]
+
+=== Stdlib compatibility issues (excluding feature bug fixes)
+
+* Gemification
+
+  * Promote following standard libraries to default gems.
+    * cmath
+    * csv
+    * date
+    * dbm
+    * etc
+    * fcntl
+    * fiddle
+    * fileutils
+    * gdbm
+    * ipaddr
+    * scanf
+    * sdbm
+    * stringio
+    * strscan
+    * webrick
+    * zlib
+
+* Logger
+
+  * Logger.new("| command") had been working to open a command
+    unintentionally. It was prohibited, and now Logger#initialize
+    treats a String argument only as a filename, as its specification.
+    [Bug #14212]
+
+* Net::HTTP
+
+  * Net::HTTP#start now passes :ENV to p_addr by default. [Bug #13351]
+    To avoid this, pass nil explicitly.
+
+* mathn.rb
+
+  * Removed from stdlib. [Feature #10169]
+
+* Rubygems
+
+  * Removed "ubygems.rb" file from stdlib. It's needless since Ruby 1.9.
+
+=== C API updates
+
+=== Supported platform changes
+
+* Drop support of NaCl platform
+
+  * https://bugs.chromium.org/p/chromium/issues/detail?id=239656#c160
+
+=== Implementation improvements
+
+* (This might not be a "user visible feature change" but) Hash class's
+  hash function is now SipHash13. [Feature #13017]
+
+* SecureRandom now prefers OS-provided sources than OpenSSL. [Bug #9569]
+
+* Mutex rewritten to be smaller and faster [Feature #13517]
+
+* Performance of block passing using block parameters is improved by
+  lazy Proc allocation [Feature #14045]
+
+* Dynamic instrumentation for TracePoint hooks instead of using "trace"
+  instruction to avoid overhead [Feature #14104]
+
+* ERB now generates code from a template which runs 2 times faster than Ruby 2.4
+
+=== Miscellaneous changes
+
+* Print backtrace and error message in reverse order if STDERR is unchanged and a tty.
+  [Feature #8661] [experimental]
+
+* Print error message in bold/underlined text if STDERR is unchanged and a tty.
+  [Feature #14140] [experimental]
+
+* configure option --with-ext now mandates its arguments.  So for
+  instance if you run ./configure --with-ext=openssl,+ then the
+  openssl library is guaranteed compiled, otherwise the build fails
+  abnormally.
+
+  Note however to always add the ",+" at the end of the argument.
+  Otherwise nothing but openssl are built.  [Feature #13302]
diff --git a/NEWS.md b/NEWS.md
deleted file mode 100644
index 699855566b..0000000000
--- a/NEWS.md
+++ /dev/null
@@ -1,913 +0,0 @@
-# NEWS for Ruby 3.4.0
-
-This document is a list of user-visible feature changes
-since the **3.3.0** release, except for bug fixes.
-
-Note that each entry is kept to a minimum, see links for details.
-
-## Language changes
-
-* `it` is added to reference a block parameter. [[Feature #18980]]
-
-* String literals in files without a `frozen_string_literal` comment now emit a deprecation warning
-  when they are mutated.
-  These warnings can be enabled with `-W:deprecated` or by setting `Warning[:deprecated] = true`.
-  To disable this change, you can run Ruby with the `--disable-frozen-string-literal`
-  command line argument. [[Feature #20205]]
-
-    * `String#+@` now duplicates when mutating the string would emit
-      a deprecation warning, offered as a replacement for the
-      `str.dup if str.frozen?` pattern.
-
-* Keyword splatting `nil` when calling methods is now supported.
-  `**nil` is treated similarly to `**{}`, passing no keywords,
-  and not calling any conversion methods.  [[Bug #20064]]
-
-* Block passing is no longer allowed in index assignment
-  (e.g. `a[0, &b] = 1`).  [[Bug #19918]]
-
-* Keyword arguments are no longer allowed in index assignment
-  (e.g. `a[0, kw: 1] = 2`).  [[Bug #20218]]
-
-* The toplevel name `::Ruby` is reserved now, and the definition will be warned
-  when `Warning[:deprecated]`.  [[Feature #20884]]
-
-## Core classes updates
-
-Note: We're only listing outstanding class updates.
-
-
-* Array
-
-    * `Array#fetch_values` was added. [[Feature #20702]]
-
-* Exception
-
-    * `Exception#set_backtrace` now accepts arrays of `Thread::Backtrace::Location`.
-      `Kernel#raise`, `Thread#raise` and `Fiber#raise` also accept this new format. [[Feature #13557]]
-
-* Fiber::Scheduler
-
-    * An optional `Fiber::Scheduler#blocking_operation_wait` hook allows blocking operations to be moved out of the
-      event loop in order to reduce latency and improve multi-core processor utilization. [[Feature #20876]]
-
-* GC
-
-    * `GC.config` added to allow setting configuration variables on the Garbage
-      Collector. [[Feature #20443]]
-
-    * GC configuration parameter `rgengc_allow_full_mark` introduced.  When `false`
-      GC will only mark young objects. Default is `true`.  [[Feature #20443]]
-
-* Hash
-
-    * `Hash.new` now accepts an optional `capacity:` argument, to preallocate the hash with a given capacity.
-      This can improve performance when building large hashes incrementally by saving on reallocation and
-      rehashing of keys. [[Feature #19236]]
-
-* IO::Buffer
-
-    * `IO::Buffer#copy` can release the GVL, allowing other threads to run while copying data. [[Feature #20902]]
-
-* Integer
-
-    * `Integer#**` used to return `Float::INFINITY` when the return value is large, but now returns an `Integer`.
-      If the return value is extremely large, it raises an exception.
-      [[Feature #20811]]
-
-* MatchData
-
-    * `MatchData#bytebegin` and `MatchData#byteend` have been added. [[Feature #20576]]
-
-* Object
-
-    * `Object#singleton_method` now returns methods in modules prepended to or included in the
-      receiver's singleton class. [[Bug #20620]]
-
-        ```rb
-        o = Object.new
-        o.extend(Module.new{def a = 1})
-        o.singleton_method(:a).call #=> 1
-        ```
-
-* Ractor
-
-    * `require` in Ractor is allowed. The requiring process will be run on
-      the main Ractor.
-      `Ractor._require(feature)` is added to run requiring process on the
-      main Ractor.
-      [[Feature #20627]]
-
-    * `Ractor.main?` is added. [[Feature #20627]]
-
-    * `Ractor.[]` and `Ractor.[]=` are added to access the ractor local storage
-      of the current Ractor. [[Feature #20715]]
-
-    * `Ractor.store_if_absent(key){ init }` is added to initialize ractor local
-      variables in thread-safety. [[Feature #20875]]
-
-* Range
-
-    * `Range#size` now raises `TypeError` if the range is not iterable. [[Misc #18984]]
-    * `Range#step` now consistently has a semantics of iterating by using `+` operator
-      for all types, not only numerics. [[Feature #18368]]
-
-        ```ruby
-        (Time.utc(2022, 2, 24)..).step(24*60*60).take(3)
-        #=> [2022-02-24 00:00:00 UTC, 2022-02-25 00:00:00 UTC, 2022-02-26 00:00:00 UTC]
-        ```
-
-* Rational
-
-    * `Rational#**` used to return `Float::INFINITY` or `Float::NAN`
-      when the numerator of the return value is large, but now returns an `Rational`.
-      If it is extremely large, it raises an exception. [[Feature #20811]]
-
-* RubyVM::AbstractSyntaxTree
-
-    * Add `RubyVM::AbstractSyntaxTree::Node#locations` method which returns location objects
-      associated with the AST node. [[Feature #20624]]
-    * Add `RubyVM::AbstractSyntaxTree::Location` class which holds location information. [[Feature #20624]]
-
-
-* String
-
-    * `String#append_as_bytes` was added to more easily and efficiently work with binary buffers and protocols.
-      It directly concatenate the arguments into the string without any encoding validation or conversion.
-      [[Feature #20594]]
-
-* Symbol
-
-    * The string returned by `Symbol#to_s` now emits a deprecation warning when mutated, and will be
-      frozen in a future version of Ruby.
-      These warnings can be enabled with `-W:deprecated` or by setting `Warning[:deprecated] = true`.
-      [[Feature #20350]]
-
-* Time
-
-    * On Windows, now `Time#zone` encodes the system timezone name in UTF-8
-      instead of the active code page, if it contains non-ASCII characters.
-      [[Bug #20929]]
-
-    * `Time#xmlschema`, and its `Time#iso8601` alias have been moved into the core Time
-      class while previously it was an extension provided by the `time` gem. [[Feature #20707]]
-
-* Warning
-
-    * Add `Warning.categories` method which returns a list of possible warning categories.
-      [[Feature #20293]]
-
-## Stdlib updates
-
-We only list stdlib changes that are notable feature changes.
-
-* RubyGems
-    * Add `--attestation` option to gem push. It enabled to store signature of build artifact to sigstore.dev.
-
-* Bundler
-    * Add a `lockfile_checksums` configuration to include checksums in fresh lockfiles.
-    * Add bundle lock `--add-checksums` to add checksums to an existing lockfile.
-
-* JSON
-
-    * Performance improvements `JSON.parse` about 1.5 times faster than json-2.7.x.
-
-* Tempfile
-
-    * The keyword argument `anonymous: true` is implemented for Tempfile.create.
-      `Tempfile.create(anonymous: true)` removes the created temporary file immediately.
-      So applications don't need to remove the file.
-      [[Feature #20497]]
-
-* win32/sspi.rb
-
-    * This library is now extracted from the Ruby repository to [ruby/net-http-sspi].
-      [[Feature #20775]]
-
-* Socket
-
-    * `Socket::ResolutionError` and `Socket::ResolutionError#error_code` was added.
-      [[Feature #20018]]
-
-* IRB
-
-    * Interactive method completion is now improved with type information by default.
-      [[Feature #20778]]
-
-Other changes are listed in the following sections. we also listed release history from the previous bundled version that is Ruby 3.3.0 if it has GitHub releases.
-
-The following default gem is added.
-
-* win32-registry 0.1.0
-
-The following default gems are updated.
-
-* [RubyGems][RubyGems] 3.6.2
-    * 3.5.3 to [v3.5.4][RubyGems-v3.5.4], [v3.5.5][RubyGems-v3.5.5], [v3.5.6][RubyGems-v3.5.6], [v3.5.7][RubyGems-v3.5.7], [v3.5.8][RubyGems-v3.5.8], [v3.5.9][RubyGems-v3.5.9], [v3.5.10][RubyGems-v3.5.10], [v3.5.11][RubyGems-v3.5.11], [v3.5.12][RubyGems-v3.5.12], [v3.5.13][RubyGems-v3.5.13], [v3.5.14][RubyGems-v3.5.14], [v3.5.15][RubyGems-v3.5.15], [v3.5.16][RubyGems-v3.5.16], [v3.5.17][RubyGems-v3.5.17], [v3.5.18][RubyGems-v3.5.18], [v3.5.19][RubyGems-v3.5.19], [v3.5.20][RubyGems-v3.5.20], [v3.5.21][RubyGems-v3.5.21], [v3.5.22][RubyGems-v3.5.22], [v3.5.23][RubyGems-v3.5.23], [v3.6.0][RubyGems-v3.6.0], [v3.6.1][RubyGems-v3.6.1], [v3.6.2][RubyGems-v3.6.2]
-* [benchmark][benchmark] 0.4.0
-    * 0.3.0 to [v0.4.0][benchmark-v0.4.0]
-* [bundler][bundler] 2.6.2
-    * 2.5.3 to [v2.5.4][bundler-v2.5.4], [v2.5.5][bundler-v2.5.5], [v2.5.6][bundler-v2.5.6], [v2.5.7][bundler-v2.5.7], [v2.5.8][bundler-v2.5.8], [v2.5.9][bundler-v2.5.9], [v2.5.10][bundler-v2.5.10], [v2.5.11][bundler-v2.5.11], [v2.5.12][bundler-v2.5.12], [v2.5.13][bundler-v2.5.13], [v2.5.14][bundler-v2.5.14], [v2.5.15][bundler-v2.5.15], [v2.5.16][bundler-v2.5.16], [v2.5.17][bundler-v2.5.17], [v2.5.18][bundler-v2.5.18], [v2.5.19][bundler-v2.5.19], [v2.5.20][bundler-v2.5.20], [v2.5.21][bundler-v2.5.21], [v2.5.22][bundler-v2.5.22], [v2.5.23][bundler-v2.5.23], [v2.6.0][bundler-v2.6.0], [v2.6.1][bundler-v2.6.1], [v2.6.2][bundler-v2.6.2]
-* [date][date] 3.4.1
-    * 3.3.4 to [v3.4.0][date-v3.4.0], [v3.4.1][date-v3.4.1]
-* [delegate][delegate] 0.4.0
-    * 0.3.1 to [v0.4.0][delegate-v0.4.0]
-* [did_you_mean][did_you_mean] 2.0.0
-    * 1.6.3 to [v2.0.0][did_you_mean-v2.0.0]
-* [digest][digest] 3.2.0
-    * 3.1.1 to [v3.2.0.pre0][digest-v3.2.0.pre0], [v3.2.0][digest-v3.2.0]
-* [erb][erb] 4.0.4
-    * 4.0.3 to [v4.0.4][erb-v4.0.4]
-* [error_highlight][error_highlight] 0.7.0
-    * 0.6.0 to [v0.7.0][error_highlight-v0.7.0]
-* [etc][etc] 1.4.5
-    * 1.4.3 to [v1.4.4][etc-v1.4.4], [v1.4.5][etc-v1.4.5]
-* [fcntl][fcntl] 1.2.0
-    * 1.1.0 to [v1.2.0][fcntl-v1.2.0]
-* [fiddle][fiddle] 1.1.6
-    * 1.1.2 to [v1.1.3][fiddle-v1.1.3], [v1.1.4][fiddle-v1.1.4], [v1.1.5][fiddle-v1.1.5], [v1.1.6][fiddle-v1.1.6]
-* [fileutils][fileutils] 1.7.3
-    * 1.7.2 to [v1.7.3][fileutils-v1.7.3]
-* [io-console][io-console] 0.8.0
-    * 0.7.1 to [v0.7.2][io-console-v0.7.2], [v0.8.0.beta1][io-console-v0.8.0.beta1], [v0.8.0][io-console-v0.8.0]
-* [io-nonblock][io-nonblock] 0.3.1
-    * 0.3.0 to [v0.3.1][io-nonblock-v0.3.1]
-* [ipaddr][ipaddr] 1.2.7
-    * 1.2.6 to [v1.2.7][ipaddr-v1.2.7]
-* [irb][irb] 1.14.3
-    * 1.11.0 to [v1.11.1][irb-v1.11.1], [v1.11.2][irb-v1.11.2], [v1.12.0][irb-v1.12.0], [v1.13.0][irb-v1.13.0], [v1.13.1][irb-v1.13.1], [v1.13.2][irb-v1.13.2], [v1.14.0][irb-v1.14.0], [v1.14.1][irb-v1.14.1], [v1.14.2][irb-v1.14.2], [v1.14.3][irb-v1.14.3]
-* [json][json] 2.9.1
-    * 2.7.1 to [v2.7.2][json-v2.7.2], [v2.7.3.rc1][json-v2.7.3.rc1], [v2.7.3][json-v2.7.3], [v2.7.4][json-v2.7.4], [v2.7.5][json-v2.7.5], [v2.7.6][json-v2.7.6], [v2.8.0][json-v2.8.0], [v2.8.1][json-v2.8.1], [v2.8.2][json-v2.8.2], [v2.9.0][json-v2.9.0], [v2.9.1][json-v2.9.1]
-* [logger][logger] 1.6.4
-    * 1.6.0 to [v1.6.1][logger-v1.6.1], [v1.6.2][logger-v1.6.2], [v1.6.3][logger-v1.6.3], [v1.6.4][logger-v1.6.4]
-* [net-http][net-http] 0.6.0
-    * 0.4.0 to [v0.4.1][net-http-v0.4.1], [v0.5.0][net-http-v0.5.0], [v0.6.0][net-http-v0.6.0]
-* [open-uri][open-uri] 0.5.0
-    * 0.4.1 to [v0.5.0][open-uri-v0.5.0]
-* [optparse][optparse] 0.6.0
-    * 0.4.0 to [v0.5.0][optparse-v0.5.0], [v0.6.0][optparse-v0.6.0]
-* [ostruct][ostruct] 0.6.1
-    * 0.6.0 to [v0.6.1][ostruct-v0.6.1]
-* [pathname][pathname] 0.4.0
-    * 0.3.0 to [v0.4.0][pathname-v0.4.0]
-* [pp][pp] 0.6.2
-    * 0.5.0 to [v0.6.0][pp-v0.6.0], [v0.6.1][pp-v0.6.1], [v0.6.2][pp-v0.6.2]
-* [prism][prism] 1.2.0
-    * 0.19.0 to [v0.20.0][prism-v0.20.0], [v0.21.0][prism-v0.21.0], [v0.22.0][prism-v0.22.0], [v0.23.0][prism-v0.23.0], [v0.24.0][prism-v0.24.0], [v0.25.0][prism-v0.25.0], [v0.26.0][prism-v0.26.0], [v0.27.0][prism-v0.27.0], [v0.28.0][prism-v0.28.0], [v0.29.0][prism-v0.29.0], [v0.30.0][prism-v0.30.0], [v1.0.0][prism-v1.0.0], [v1.1.0][prism-v1.1.0], [v1.2.0][prism-v1.2.0]
-* [pstore][pstore] 0.1.4
-    * 0.1.3 to [v0.1.4][pstore-v0.1.4]
-* [psych][psych] 5.2.2
-    * 5.1.2 to [v5.2.0.beta1][psych-v5.2.0.beta1], [v5.2.0.beta2][psych-v5.2.0.beta2], [v5.2.0.beta3][psych-v5.2.0.beta3], [v5.2.0.beta4][psych-v5.2.0.beta4], [v5.2.0.beta5][psych-v5.2.0.beta5], [v5.2.0.beta6][psych-v5.2.0.beta6], [v5.2.0.beta7][psych-v5.2.0.beta7], [v5.2.0][psych-v5.2.0], [v5.2.1][psych-v5.2.1], [v5.2.2][psych-v5.2.2]
-* [rdoc][rdoc] 6.10.0
-    * 6.6.2 to [v6.7.0][rdoc-v6.7.0], [v6.8.0][rdoc-v6.8.0], [v6.8.1][rdoc-v6.8.1], [v6.9.0][rdoc-v6.9.0], [v6.9.1][rdoc-v6.9.1], [v6.10.0][rdoc-v6.10.0]
-* [reline][reline] 0.6.0
-    * 0.4.1 to [v0.4.2][reline-v0.4.2], [v0.4.3][reline-v0.4.3], [v0.5.0.pre.1][reline-v0.5.0.pre.1], [v0.5.0][reline-v0.5.0], [v0.5.1][reline-v0.5.1], [v0.5.2][reline-v0.5.2], [v0.5.3][reline-v0.5.3], [v0.5.4][reline-v0.5.4], [v0.5.5][reline-v0.5.5], [v0.5.6][reline-v0.5.6], [v0.5.7][reline-v0.5.7], [v0.5.8][reline-v0.5.8], [v0.5.9][reline-v0.5.9], [v0.5.10][reline-v0.5.10], [v0.5.11][reline-v0.5.11], [v0.5.12][reline-v0.5.12], [v0.6.0][reline-v0.6.0]
-* [resolv][resolv] 0.6.0
-    * 0.3.0 to [v0.4.0][resolv-v0.4.0], [v0.5.0][resolv-v0.5.0], [v0.6.0][resolv-v0.6.0]
-* [securerandom][securerandom] 0.4.1
-    * 0.3.1 to [v0.3.2][securerandom-v0.3.2], [v0.4.0][securerandom-v0.4.0], [v0.4.1][securerandom-v0.4.1]
-* [set][set] 1.1.1
-    * 1.1.0 to [v1.1.1][set-v1.1.1]
-* [shellwords][shellwords] 0.2.2
-    * 0.2.0 to [v0.2.1][shellwords-v0.2.1], [v0.2.2][shellwords-v0.2.2]
-* [singleton][singleton] 0.3.0
-    * 0.2.0 to [v0.3.0][singleton-v0.3.0]
-* [stringio][stringio] 3.1.2
-    * 3.1.0 to [v3.1.1][stringio-v3.1.1], [v3.1.2][stringio-v3.1.2]
-* [strscan][strscan] 3.1.2
-    * 3.0.7 to [v3.0.8][strscan-v3.0.8], [v3.0.9][strscan-v3.0.9], [v3.1.0][strscan-v3.1.0], [v3.1.1][strscan-v3.1.1], [v3.1.2][strscan-v3.1.2]
-* [syntax_suggest][syntax_suggest] 2.0.2
-    * 2.0.0 to [v2.0.1][syntax_suggest-v2.0.1], [v2.0.2][syntax_suggest-v2.0.2]
-* [tempfile][tempfile] 0.3.1
-    * 0.2.1 to [v0.3.0][tempfile-v0.3.0], [v0.3.1][tempfile-v0.3.1]
-* [time][time] 0.4.1
-    * 0.3.0 to [v0.4.0][time-v0.4.0], [v0.4.1][time-v0.4.1]
-* [timeout][timeout] 0.4.3
-    * 0.4.1 to [v0.4.2][timeout-v0.4.2], [v0.4.3][timeout-v0.4.3]
-* [tmpdir][tmpdir] 0.3.1
-    * 0.2.0 to [v0.3.0][tmpdir-v0.3.0], [v0.3.1][tmpdir-v0.3.1]
-* [uri][uri] 1.0.2
-    * 0.13.0 to [v0.13.1][uri-v0.13.1], [v1.0.0][uri-v1.0.0], [v1.0.1][uri-v1.0.1], [v1.0.2][uri-v1.0.2]
-* [win32ole][win32ole] 1.9.1
-    * 1.8.10 to [v1.9.0][win32ole-v1.9.0], [v1.9.1][win32ole-v1.9.1]
-* [yaml][yaml] 0.4.0
-    * 0.3.0 to [v0.4.0][yaml-v0.4.0]
-* [zlib][zlib] 3.2.1
-    * 3.1.0 to [v3.1.1][zlib-v3.1.1], [v3.2.0][zlib-v3.2.0], [v3.2.1][zlib-v3.2.1]
-
-The following bundled gem is added.
-
-* [repl_type_completor][repl_type_completor] 0.1.9
-
-The following bundled gems are updated.
-
-* [minitest][minitest] 5.25.4
-    * 5.20.0 to [v5.25.4][minitest-v5.25.4]
-* [power_assert][power_assert] 2.0.5
-    * 2.0.3 to [v2.0.4][power_assert-v2.0.4], [v2.0.5][power_assert-v2.0.5]
-* [rake][rake] 13.2.1
-    * 13.1.0 to [v13.2.0][rake-v13.2.0], [v13.2.1][rake-v13.2.1]
-* [test-unit][test-unit] 3.6.7
-    * 3.6.1 to [3.6.2][test-unit-3.6.2], [3.6.3][test-unit-3.6.3], [3.6.4][test-unit-3.6.4], [3.6.5][test-unit-3.6.5], [3.6.6][test-unit-3.6.6], [3.6.7][test-unit-3.6.7]
-* [rexml][rexml] 3.4.0
-    * 3.2.6 to [v3.2.7][rexml-v3.2.7], [v3.2.8][rexml-v3.2.8], [v3.2.9][rexml-v3.2.9], [v3.3.0][rexml-v3.3.0], [v3.3.1][rexml-v3.3.1], [v3.3.2][rexml-v3.3.2], [v3.3.3][rexml-v3.3.3], [v3.3.4][rexml-v3.3.4], [v3.3.5][rexml-v3.3.5], [v3.3.6][rexml-v3.3.6], [v3.3.7][rexml-v3.3.7], [v3.3.8][rexml-v3.3.8], [v3.3.9][rexml-v3.3.9], [v3.4.0][rexml-v3.4.0]
-* [rss][rss] 0.3.1
-    * 0.3.0 to [0.3.1][rss-0.3.1]
-* [net-ftp][net-ftp] 0.3.8
-    * 0.3.3 to [v0.3.4][net-ftp-v0.3.4], [v0.3.5][net-ftp-v0.3.5], [v0.3.6][net-ftp-v0.3.6], [v0.3.7][net-ftp-v0.3.7], [v0.3.8][net-ftp-v0.3.8]
-* [net-imap][net-imap] 0.5.4
-    * 0.4.9 to [v0.4.9.1][net-imap-v0.4.9.1], [v0.4.10][net-imap-v0.4.10], [v0.4.11][net-imap-v0.4.11], [v0.4.12][net-imap-v0.4.12], [v0.4.13][net-imap-v0.4.13], [v0.4.14][net-imap-v0.4.14], [v0.4.15][net-imap-v0.4.15], [v0.4.16][net-imap-v0.4.16], [v0.4.17][net-imap-v0.4.17], [v0.5.0][net-imap-v0.5.0], [v0.4.18][net-imap-v0.4.18], [v0.5.1][net-imap-v0.5.1], [v0.5.2][net-imap-v0.5.2], [v0.5.3][net-imap-v0.5.3], [v0.5.4][net-imap-v0.5.4]
-* [net-smtp][net-smtp] 0.5.0
-    * 0.4.0 to [v0.4.0.1][net-smtp-v0.4.0.1], [v0.5.0][net-smtp-v0.5.0]
-* [prime][prime] 0.1.3
-    * 0.1.2 to [v0.1.3][prime-v0.1.3]
-* [rbs][rbs] 3.8.0
-    * 3.4.0 to [v3.4.1][rbs-v3.4.1], [v3.4.2][rbs-v3.4.2], [v3.4.3][rbs-v3.4.3], [v3.4.4][rbs-v3.4.4], [v3.5.0.pre.1][rbs-v3.5.0.pre.1], [v3.5.0.pre.2][rbs-v3.5.0.pre.2], [v3.5.0][rbs-v3.5.0], [v3.5.1][rbs-v3.5.1], [v3.5.2][rbs-v3.5.2], [v3.5.3][rbs-v3.5.3], [v3.6.0.dev.1][rbs-v3.6.0.dev.1], [v3.6.0.pre.1][rbs-v3.6.0.pre.1], [v3.6.0.pre.2][rbs-v3.6.0.pre.2], [v3.6.0.pre.3][rbs-v3.6.0.pre.3], [v3.6.0][rbs-v3.6.0], [v3.6.1][rbs-v3.6.1], [v3.7.0.dev.1][rbs-v3.7.0.dev.1], [v3.7.0.pre.1][rbs-v3.7.0.pre.1], [v3.7.0][rbs-v3.7.0], [v3.8.0.pre.1][rbs-v3.8.0.pre.1] [v3.8.0][rbs-v3.8.0]
-* [typeprof][typeprof] 0.30.1
-    * 0.21.9 to [v0.30.1][typeprof-v0.30.1]
-* [debug][debug] 1.10.0
-    * 1.9.1 to [v1.9.2][debug-v1.9.2], [v1.10.0][debug-v1.10.0]
-* [racc][racc] 1.8.1
-    * 1.7.3 to [v1.8.0][racc-v1.8.0], [v1.8.1][racc-v1.8.1]
-
-The following bundled gems are promoted from default gems.
-
-* [mutex_m][mutex_m] 0.3.0
-    * 0.2.0 to [v0.3.0][mutex_m-v0.3.0]
-* [getoptlong][getoptlong] 0.2.1
-* [base64][base64] 0.2.0
-* [bigdecimal][bigdecimal] 3.1.8
-    * 3.1.5 to [v3.1.6][bigdecimal-v3.1.6], [v3.1.7][bigdecimal-v3.1.7], [v3.1.8][bigdecimal-v3.1.8]
-* [observer][observer] 0.1.2
-* [abbrev][abbrev] 0.1.2
-* [resolv-replace][resolv-replace] 0.1.1
-* [rinda][rinda] 0.2.0
-* [drb][drb] 2.2.1
-    * 2.2.0 to [v2.2.1][drb-v2.2.1]
-* [nkf][nkf] 0.2.0
-    * 0.1.3 to [v0.2.0][nkf-v0.2.0]
-* [syslog][syslog] 0.2.0
-    * 0.1.2 to [v0.2.0][syslog-v0.2.0]
-* [csv][csv] 3.3.2
-    * 3.2.8 to [v3.2.9][csv-v3.2.9], [v3.3.0][csv-v3.3.0], [v3.3.1][csv-v3.3.1], [v3.3.2][csv-v3.3.2]
-
-## Supported platforms
-
-## Compatibility issues
-
-* Error messages and backtrace displays have been changed.
-
-    * Use a single quote instead of a backtick as an opening quote. [[Feature #16495]]
-    * Display a class name before a method name (only when the class has a permanent name). [[Feature #19117]]
-    * Extra `rescue`/`ensure` frames are no longer available on the backtrace. [[Feature #20275]]
-    * `Kernel#caller`, `Thread::Backtrace::Location`’s methods, etc. are also changed accordingly.
-
-        Old:
-        ```
-        test.rb:1:in `foo': undefined method `time' for an instance of Integer
-                from test.rb:2:in `<main>'
-        ```
-
-        New:
-        ```
-        test.rb:1:in 'Object#foo': undefined method 'time' for an instance of Integer
-                from test.rb:2:in '<main>'
-        ```
-
-* `Hash#inspect` rendering have been changed. [[Bug #20433]]
-
-    * Symbol keys are displayed using the modern symbol key syntax: `"{user: 1}"`
-    * Other keys now have spaces around `=>`: `'{"user" => 1}'`, while previously they didn't: `'{"user"=>1}'`
-
-* `Kernel#Float()` now accepts a decimal string with decimal part omitted. [[Feature #20705]]
-
-    ```rb
-    Float("1.")    #=> 1.0 (previously, an ArgumentError was raised)
-    Float("1.E-1") #=> 0.1 (previously, an ArgumentError was raised)
-    ```
-
-* `String#to_f` now accepts a decimal string with decimal part omitted. [[Feature #20705]]
-  Note that the result changes when an exponent is specified.
-
-    ```rb
-    "1.".to_f    #=> 1.0
-    "1.E-1".to_f #=> 0.1 (previously, 1.0 was returned)
-    ```
-
-* `Refinement#refined_class` has been removed. [[Feature #19714]]
-
-## Stdlib compatibility issues
-
-* DidYouMean
-
-    * `DidYouMean::SPELL_CHECKERS[]=` and `DidYouMean::SPELL_CHECKERS.merge!` are removed.
-
-* Net::HTTP
-
-    * Removed the following deprecated constants:
-        * `Net::HTTP::ProxyMod`
-        * `Net::NetPrivate::HTTPRequest`
-        * `Net::HTTPInformationCode`
-        * `Net::HTTPSuccessCode`
-        * `Net::HTTPRedirectionCode`
-        * `Net::HTTPRetriableCode`
-        * `Net::HTTPClientErrorCode`
-        * `Net::HTTPFatalErrorCode`
-        * `Net::HTTPServerErrorCode`
-        * `Net::HTTPResponseReceiver`
-        * `Net::HTTPResponceReceiver`
-
-      These constants were deprecated from 2012.
-
-* Timeout
-
-    * Reject negative values for `Timeout.timeout`. [[Bug #20795]]
-
-* URI
-
-    * Switched default parser to RFC 3986 compliant from RFC 2396 compliant.
-      [[Bug #19266]]
-
-## C API updates
-
-* `rb_newobj` and `rb_newobj_of` (and corresponding macros `RB_NEWOBJ`, `RB_NEWOBJ_OF`, `NEWOBJ`, `NEWOBJ_OF`) have been removed. [[Feature #20265]]
-* Removed deprecated function `rb_gc_force_recycle`. [[Feature #18290]]
-
-## Implementation improvements
-
-* The default parser is now Prism.
-  To use the conventional parser, use the command-line argument `--parser=parse.y`.
-  [[Feature #20564]]
-
-* Happy Eyeballs version 2 (RFC8305), an algorithm that ensures faster and more reliable connections
-  by attempting IPv6 and IPv4 concurrently, is used in `Socket.tcp` and `TCPSocket.new`.
-  To disable it globally, set the environment variable `RUBY_TCP_NO_FAST_FALLBACK=1` or
-  call `Socket.tcp_fast_fallback=false`.
-  Or to disable it on a per-method basis, use the keyword argument `fast_fallback: false`.
-  [[Feature #20108]] [[Feature #20782]]
-
-* Alternative garbage collector (GC) implementations can be loaded dynamically
-  through the modular garbage collector feature. To enable this feature,
-  configure Ruby with `--with-modular-gc` at build time. GC libraries can be
-  loaded at runtime using the environment variable `RUBY_GC_LIBRARY`.
-  [[Feature #20351]]
-
-* Ruby's built-in garbage collector has been split into a separate file at
-  `gc/default/default.c` and interacts with Ruby using an API defined in
-  `gc/gc_impl.h`. The built-in garbage collector can now also be built as a
-  library using `make modular-gc MODULAR_GC=default` and enabled using the
-  environment variable `RUBY_GC_LIBRARY=default`. [[Feature #20470]]
-
-* An experimental GC library is provided based on [MMTk](https://www.mmtk.io/).
-  This GC library can be built using `make modular-gc MODULAR_GC=mmtk` and
-  enabled using the environment variable `RUBY_GC_LIBRARY=mmtk`. This requires
-  the Rust toolchain on the build machine. [[Feature #20860]]
-
-### YJIT
-
-#### New features
-
-* Command-line options
-    * `--yjit-mem-size` introduces a unified memory limit (default 128MiB) to track total YJIT memory usage,
-      providing a more intuitive alternative to the old `--yjit-exec-mem-size` option.
-    * `--yjit-trace-exits=COUNTER` allows tracing of counted exits and fallbacks.
-    * `--yjit-perf=codegen` allows profiling of JIT code based on YJIT's codegen functions.
-    * `--yjit-log` enables a compilation log to track what gets compiled.
-* Ruby API
-    * `RubyVM::YJIT.enable(log: true)` also enables a compilation log.
-    * `RubyVM::YJIT.log` provides access to the tail of the compilation log at run-time.
-* YJIT stats
-    * `RubyVM::YJIT.runtime_stats` now always provides additional statistics on
-      invalidation, inlining, and metadata encoding.
-    * `RubyVM::YJIT.runtime_stats[:iseq_calls]` is added to profile non-inlined Ruby method calls.
-    * `RubyVM::YJIT.runtime_stats[:cfunc_calls]` is truncated to the top 20 entries for better performance.
-
-#### New optimizations
-
-* Compressed context reduces memory needed to store YJIT metadata
-* Allocate registers for local variables and Ruby method arguments
-* When YJIT is enabled, use more Core primitives written in Ruby:
-    * `Array#each`, `Array#select`, `Array#map` rewritten in Ruby for better performance [[Feature #20182]].
-* Ability to inline small/trivial methods such as:
-    * Empty methods
-    * Methods returning a constant
-    * Methods returning `self`
-    * Methods directly returning an argument
-* Specialized codegen for many more runtime methods
-* Optimize `String#getbyte`, `String#setbyte` and other string methods
-* Optimize bitwise operations to speed up low-level bit/byte manipulation
-* Support shareable constants in multi-ractor mode
-* Various other incremental optimizations
-
-## Miscellaneous changes
-
-* Passing a block to a method which doesn't use the passed block will show
-  a warning on verbose mode (`-w`).
-  In connection with this, a new `strict_unused_block` warning category was introduced.
-  Turn them on with `-W:strict_unused_block` or `Warning[:strict_unused_block] = true`.
-  [[Feature #15554]]
-
-* Redefining some core methods that are specially optimized by the interpreter
-  and JIT like `String#freeze` or `Integer#+` now emits a performance class
-  warning (`-W:performance` or `Warning[:performance] = true`).
-  [[Feature #20429]]
-
-[Feature #13557]: https://bugs.ruby-lang.org/issues/13557
-[Feature #15554]: https://bugs.ruby-lang.org/issues/15554
-[Feature #16495]: https://bugs.ruby-lang.org/issues/16495
-[Feature #18290]: https://bugs.ruby-lang.org/issues/18290
-[Feature #18368]: https://bugs.ruby-lang.org/issues/18368
-[Feature #18980]: https://bugs.ruby-lang.org/issues/18980
-[Misc #18984]:    https://bugs.ruby-lang.org/issues/18984
-[Feature #19117]: https://bugs.ruby-lang.org/issues/19117
-[Feature #19236]: https://bugs.ruby-lang.org/issues/19236
-[Bug #19266]:     https://bugs.ruby-lang.org/issues/19266
-[Feature #19714]: https://bugs.ruby-lang.org/issues/19714
-[Bug #19918]:     https://bugs.ruby-lang.org/issues/19918
-[Feature #20018]: https://bugs.ruby-lang.org/issues/20018
-[Bug #20064]:     https://bugs.ruby-lang.org/issues/20064
-[Feature #20108]: https://bugs.ruby-lang.org/issues/20108
-[Feature #20182]: https://bugs.ruby-lang.org/issues/20182
-[Feature #20205]: https://bugs.ruby-lang.org/issues/20205
-[Bug #20218]:     https://bugs.ruby-lang.org/issues/20218
-[Feature #20265]: https://bugs.ruby-lang.org/issues/20265
-[Feature #20275]: https://bugs.ruby-lang.org/issues/20275
-[Feature #20293]: https://bugs.ruby-lang.org/issues/20293
-[Feature #20350]: https://bugs.ruby-lang.org/issues/20350
-[Feature #20351]: https://bugs.ruby-lang.org/issues/20351
-[Feature #20429]: https://bugs.ruby-lang.org/issues/20429
-[Bug #20433]:     https://bugs.ruby-lang.org/issues/20433
-[Feature #20443]: https://bugs.ruby-lang.org/issues/20443
-[Feature #20470]: https://bugs.ruby-lang.org/issues/20470
-[Feature #20497]: https://bugs.ruby-lang.org/issues/20497
-[Feature #20564]: https://bugs.ruby-lang.org/issues/20564
-[Feature #20576]: https://bugs.ruby-lang.org/issues/20576
-[Feature #20594]: https://bugs.ruby-lang.org/issues/20594
-[Bug #20620]:     https://bugs.ruby-lang.org/issues/20620
-[Feature #20624]: https://bugs.ruby-lang.org/issues/20624
-[Feature #20627]: https://bugs.ruby-lang.org/issues/20627
-[Feature #20702]: https://bugs.ruby-lang.org/issues/20702
-[Feature #20705]: https://bugs.ruby-lang.org/issues/20705
-[Feature #20707]: https://bugs.ruby-lang.org/issues/20707
-[Feature #20715]: https://bugs.ruby-lang.org/issues/20715
-[Feature #20775]: https://bugs.ruby-lang.org/issues/20775
-[Feature #20778]: https://bugs.ruby-lang.org/issues/20778
-[Feature #20782]: https://bugs.ruby-lang.org/issues/20782
-[Bug #20795]:     https://bugs.ruby-lang.org/issues/20795
-[Feature #20811]: https://bugs.ruby-lang.org/issues/20811
-[Feature #20860]: https://bugs.ruby-lang.org/issues/20860
-[Feature #20875]: https://bugs.ruby-lang.org/issues/20875
-[Feature #20876]: https://bugs.ruby-lang.org/issues/20876
-[Feature #20884]: https://bugs.ruby-lang.org/issues/20884
-[Feature #20902]: https://bugs.ruby-lang.org/issues/20902
-[Bug #20929]:     https://bugs.ruby-lang.org/issues/20929
-[RubyGems-v3.5.4]: https://github.com/rubygems/rubygems/releases/tag/v3.5.4
-[RubyGems-v3.5.5]: https://github.com/rubygems/rubygems/releases/tag/v3.5.5
-[RubyGems-v3.5.6]: https://github.com/rubygems/rubygems/releases/tag/v3.5.6
-[RubyGems-v3.5.7]: https://github.com/rubygems/rubygems/releases/tag/v3.5.7
-[RubyGems-v3.5.8]: https://github.com/rubygems/rubygems/releases/tag/v3.5.8
-[RubyGems-v3.5.9]: https://github.com/rubygems/rubygems/releases/tag/v3.5.9
-[RubyGems-v3.5.10]: https://github.com/rubygems/rubygems/releases/tag/v3.5.10
-[RubyGems-v3.5.11]: https://github.com/rubygems/rubygems/releases/tag/v3.5.11
-[RubyGems-v3.5.12]: https://github.com/rubygems/rubygems/releases/tag/v3.5.12
-[RubyGems-v3.5.13]: https://github.com/rubygems/rubygems/releases/tag/v3.5.13
-[RubyGems-v3.5.14]: https://github.com/rubygems/rubygems/releases/tag/v3.5.14
-[RubyGems-v3.5.15]: https://github.com/rubygems/rubygems/releases/tag/v3.5.15
-[RubyGems-v3.5.16]: https://github.com/rubygems/rubygems/releases/tag/v3.5.16
-[RubyGems-v3.5.17]: https://github.com/rubygems/rubygems/releases/tag/v3.5.17
-[RubyGems-v3.5.18]: https://github.com/rubygems/rubygems/releases/tag/v3.5.18
-[RubyGems-v3.5.19]: https://github.com/rubygems/rubygems/releases/tag/v3.5.19
-[RubyGems-v3.5.20]: https://github.com/rubygems/rubygems/releases/tag/v3.5.20
-[RubyGems-v3.5.21]: https://github.com/rubygems/rubygems/releases/tag/v3.5.21
-[RubyGems-v3.5.22]: https://github.com/rubygems/rubygems/releases/tag/v3.5.22
-[RubyGems-v3.5.23]: https://github.com/rubygems/rubygems/releases/tag/v3.5.23
-[RubyGems-v3.6.0]: https://github.com/rubygems/rubygems/releases/tag/v3.6.0
-[RubyGems-v3.6.1]: https://github.com/rubygems/rubygems/releases/tag/v3.6.1
-[RubyGems-v3.6.2]: https://github.com/rubygems/rubygems/releases/tag/v3.6.2
-[benchmark-v0.4.0]: https://github.com/ruby/benchmark/releases/tag/v0.4.0
-[bundler-v2.5.4]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.4
-[bundler-v2.5.5]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.5
-[bundler-v2.5.6]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.6
-[bundler-v2.5.7]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.7
-[bundler-v2.5.8]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.8
-[bundler-v2.5.9]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.9
-[bundler-v2.5.10]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.10
-[bundler-v2.5.11]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.11
-[bundler-v2.5.12]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.12
-[bundler-v2.5.13]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.13
-[bundler-v2.5.14]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.14
-[bundler-v2.5.15]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.15
-[bundler-v2.5.16]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.16
-[bundler-v2.5.17]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.17
-[bundler-v2.5.18]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.18
-[bundler-v2.5.19]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.19
-[bundler-v2.5.20]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.20
-[bundler-v2.5.21]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.21
-[bundler-v2.5.22]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.22
-[bundler-v2.5.23]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.5.23
-[bundler-v2.6.0]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.6.0
-[bundler-v2.6.1]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.6.1
-[bundler-v2.6.2]: https://github.com/rubygems/rubygems/releases/tag/bundler-v2.6.2
-[date-v3.4.0]: https://github.com/ruby/date/releases/tag/v3.4.0
-[date-v3.4.1]: https://github.com/ruby/date/releases/tag/v3.4.1
-[delegate-v0.4.0]: https://github.com/ruby/delegate/releases/tag/v0.4.0
-[did_you_mean-v2.0.0]: https://github.com/ruby/did_you_mean/releases/tag/v2.0.0
-[digest-v3.2.0.pre0]: https://github.com/ruby/digest/releases/tag/v3.2.0.pre0
-[digest-v3.2.0]: https://github.com/ruby/digest/releases/tag/v3.2.0
-[erb-v4.0.4]: https://github.com/ruby/erb/releases/tag/v4.0.4
-[etc-v1.4.4]: https://github.com/ruby/etc/releases/tag/v1.4.4
-[etc-v1.4.5]: https://github.com/ruby/etc/releases/tag/v1.4.5
-[fcntl-v1.2.0]: https://github.com/ruby/fcntl/releases/tag/v1.2.0
-[fiddle-v1.1.3]: https://github.com/ruby/fiddle/releases/tag/v1.1.3
-[fiddle-v1.1.4]: https://github.com/ruby/fiddle/releases/tag/v1.1.4
-[fiddle-v1.1.5]: https://github.com/ruby/fiddle/releases/tag/v1.1.5
-[fiddle-v1.1.6]: https://github.com/ruby/fiddle/releases/tag/v1.1.6
-[fileutils-v1.7.3]: https://github.com/ruby/fileutils/releases/tag/v1.7.3
-[io-console-v0.7.2]: https://github.com/ruby/io-console/releases/tag/v0.7.2
-[io-console-v0.8.0.beta1]: https://github.com/ruby/io-console/releases/tag/v0.8.0.beta1
-[io-console-v0.8.0]: https://github.com/ruby/io-console/releases/tag/v0.8.0
-[io-nonblock-v0.3.1]: https://github.com/ruby/io-nonblock/releases/tag/v0.3.1
-[ipaddr-v1.2.7]: https://github.com/ruby/ipaddr/releases/tag/v1.2.7
-[irb-v1.11.1]: https://github.com/ruby/irb/releases/tag/v1.11.1
-[irb-v1.11.2]: https://github.com/ruby/irb/releases/tag/v1.11.2
-[irb-v1.12.0]: https://github.com/ruby/irb/releases/tag/v1.12.0
-[irb-v1.13.0]: https://github.com/ruby/irb/releases/tag/v1.13.0
-[irb-v1.13.1]: https://github.com/ruby/irb/releases/tag/v1.13.1
-[irb-v1.13.2]: https://github.com/ruby/irb/releases/tag/v1.13.2
-[irb-v1.14.0]: https://github.com/ruby/irb/releases/tag/v1.14.0
-[irb-v1.14.1]: https://github.com/ruby/irb/releases/tag/v1.14.1
-[irb-v1.14.2]: https://github.com/ruby/irb/releases/tag/v1.14.2
-[irb-v1.14.3]: https://github.com/ruby/irb/releases/tag/v1.14.3
-[json-v2.7.2]: https://github.com/ruby/json/releases/tag/v2.7.2
-[json-v2.7.3.rc1]: https://github.com/ruby/json/releases/tag/v2.7.3.rc1
-[json-v2.7.3]: https://github.com/ruby/json/releases/tag/v2.7.3
-[json-v2.7.4]: https://github.com/ruby/json/releases/tag/v2.7.4
-[json-v2.7.5]: https://github.com/ruby/json/releases/tag/v2.7.5
-[json-v2.7.6]: https://github.com/ruby/json/releases/tag/v2.7.6
-[json-v2.8.0]: https://github.com/ruby/json/releases/tag/v2.8.0
-[json-v2.8.1]: https://github.com/ruby/json/releases/tag/v2.8.1
-[json-v2.8.2]: https://github.com/ruby/json/releases/tag/v2.8.2
-[json-v2.9.0]: https://github.com/ruby/json/releases/tag/v2.9.0
-[json-v2.9.1]: https://github.com/ruby/json/releases/tag/v2.9.1
-[logger-v1.6.1]: https://github.com/ruby/logger/releases/tag/v1.6.1
-[logger-v1.6.2]: https://github.com/ruby/logger/releases/tag/v1.6.2
-[logger-v1.6.3]: https://github.com/ruby/logger/releases/tag/v1.6.3
-[logger-v1.6.4]: https://github.com/ruby/logger/releases/tag/v1.6.4
-[net-http-v0.4.1]: https://github.com/ruby/net-http/releases/tag/v0.4.1
-[net-http-v0.5.0]: https://github.com/ruby/net-http/releases/tag/v0.5.0
-[net-http-v0.6.0]: https://github.com/ruby/net-http/releases/tag/v0.6.0
-[open-uri-v0.5.0]: https://github.com/ruby/open-uri/releases/tag/v0.5.0
-[optparse-v0.5.0]: https://github.com/ruby/optparse/releases/tag/v0.5.0
-[optparse-v0.6.0]: https://github.com/ruby/optparse/releases/tag/v0.6.0
-[ostruct-v0.6.1]: https://github.com/ruby/ostruct/releases/tag/v0.6.1
-[pathname-v0.4.0]: https://github.com/ruby/pathname/releases/tag/v0.4.0
-[pp-v0.6.0]: https://github.com/ruby/pp/releases/tag/v0.6.0
-[pp-v0.6.1]: https://github.com/ruby/pp/releases/tag/v0.6.1
-[pp-v0.6.2]: https://github.com/ruby/pp/releases/tag/v0.6.2
-[prism-v0.20.0]: https://github.com/ruby/prism/releases/tag/v0.20.0
-[prism-v0.21.0]: https://github.com/ruby/prism/releases/tag/v0.21.0
-[prism-v0.22.0]: https://github.com/ruby/prism/releases/tag/v0.22.0
-[prism-v0.23.0]: https://github.com/ruby/prism/releases/tag/v0.23.0
-[prism-v0.24.0]: https://github.com/ruby/prism/releases/tag/v0.24.0
-[prism-v0.25.0]: https://github.com/ruby/prism/releases/tag/v0.25.0
-[prism-v0.26.0]: https://github.com/ruby/prism/releases/tag/v0.26.0
-[prism-v0.27.0]: https://github.com/ruby/prism/releases/tag/v0.27.0
-[prism-v0.28.0]: https://github.com/ruby/prism/releases/tag/v0.28.0
-[prism-v0.29.0]: https://github.com/ruby/prism/releases/tag/v0.29.0
-[prism-v0.30.0]: https://github.com/ruby/prism/releases/tag/v0.30.0
-[prism-v1.0.0]: https://github.com/ruby/prism/releases/tag/v1.0.0
-[prism-v1.1.0]: https://github.com/ruby/prism/releases/tag/v1.1.0
-[prism-v1.2.0]: https://github.com/ruby/prism/releases/tag/v1.2.0
-[pstore-v0.1.4]: https://github.com/ruby/pstore/releases/tag/v0.1.4
-[psych-v5.2.0.beta1]: https://github.com/ruby/psych/releases/tag/v5.2.0.beta1
-[psych-v5.2.0]: https://github.com/ruby/psych/releases/tag/v5.2.0
-[psych-v5.2.0.beta2]: https://github.com/ruby/psych/releases/tag/v5.2.0.beta2
-[psych-v5.2.0.beta3]: https://github.com/ruby/psych/releases/tag/v5.2.0.beta3
-[psych-v5.2.0.beta4]: https://github.com/ruby/psych/releases/tag/v5.2.0.beta4
-[psych-v5.2.0.beta5]: https://github.com/ruby/psych/releases/tag/v5.2.0.beta5
-[psych-v5.2.0.beta6]: https://github.com/ruby/psych/releases/tag/v5.2.0.beta6
-[psych-v5.2.0.beta7]: https://github.com/ruby/psych/releases/tag/v5.2.0.beta7
-[psych-v5.2.1]: https://github.com/ruby/psych/releases/tag/v5.2.1
-[psych-v5.2.2]: https://github.com/ruby/psych/releases/tag/v5.2.2
-[rdoc-v6.7.0]: https://github.com/ruby/rdoc/releases/tag/v6.7.0
-[rdoc-v6.8.0]: https://github.com/ruby/rdoc/releases/tag/v6.8.0
-[rdoc-v6.8.1]: https://github.com/ruby/rdoc/releases/tag/v6.8.1
-[rdoc-v6.9.0]: https://github.com/ruby/rdoc/releases/tag/v6.9.0
-[rdoc-v6.9.1]: https://github.com/ruby/rdoc/releases/tag/v6.9.1
-[rdoc-v6.10.0]: https://github.com/ruby/rdoc/releases/tag/v6.10.0
-[reline-v0.5.0.pre.1]: https://github.com/ruby/reline/releases/tag/v0.5.0.pre.1
-[reline-v0.4.2]: https://github.com/ruby/reline/releases/tag/v0.4.2
-[reline-v0.4.3]: https://github.com/ruby/reline/releases/tag/v0.4.3
-[reline-v0.5.0]: https://github.com/ruby/reline/releases/tag/v0.5.0
-[reline-v0.5.1]: https://github.com/ruby/reline/releases/tag/v0.5.1
-[reline-v0.5.2]: https://github.com/ruby/reline/releases/tag/v0.5.2
-[reline-v0.5.3]: https://github.com/ruby/reline/releases/tag/v0.5.3
-[reline-v0.5.4]: https://github.com/ruby/reline/releases/tag/v0.5.4
-[reline-v0.5.5]: https://github.com/ruby/reline/releases/tag/v0.5.5
-[reline-v0.5.6]: https://github.com/ruby/reline/releases/tag/v0.5.6
-[reline-v0.5.7]: https://github.com/ruby/reline/releases/tag/v0.5.7
-[reline-v0.5.8]: https://github.com/ruby/reline/releases/tag/v0.5.8
-[reline-v0.5.9]: https://github.com/ruby/reline/releases/tag/v0.5.9
-[reline-v0.5.10]: https://github.com/ruby/reline/releases/tag/v0.5.10
-[reline-v0.5.11]: https://github.com/ruby/reline/releases/tag/v0.5.11
-[reline-v0.5.12]: https://github.com/ruby/reline/releases/tag/v0.5.12
-[reline-v0.6.0]: https://github.com/ruby/reline/releases/tag/v0.6.0
-[resolv-v0.4.0]: https://github.com/ruby/resolv/releases/tag/v0.4.0
-[resolv-v0.5.0]: https://github.com/ruby/resolv/releases/tag/v0.5.0
-[resolv-v0.6.0]: https://github.com/ruby/resolv/releases/tag/v0.6.0
-[securerandom-v0.3.2]: https://github.com/ruby/securerandom/releases/tag/v0.3.2
-[securerandom-v0.4.0]: https://github.com/ruby/securerandom/releases/tag/v0.4.0
-[securerandom-v0.4.1]: https://github.com/ruby/securerandom/releases/tag/v0.4.1
-[set-v1.1.1]: https://github.com/ruby/set/releases/tag/v1.1.1
-[shellwords-v0.2.1]: https://github.com/ruby/shellwords/releases/tag/v0.2.1
-[shellwords-v0.2.2]: https://github.com/ruby/shellwords/releases/tag/v0.2.2
-[singleton-v0.3.0]: https://github.com/ruby/singleton/releases/tag/v0.3.0
-[stringio-v3.1.1]: https://github.com/ruby/stringio/releases/tag/v3.1.1
-[stringio-v3.1.2]: https://github.com/ruby/stringio/releases/tag/v3.1.2
-[strscan-v3.0.8]: https://github.com/ruby/strscan/releases/tag/v3.0.8
-[strscan-v3.0.9]: https://github.com/ruby/strscan/releases/tag/v3.0.9
-[strscan-v3.1.0]: https://github.com/ruby/strscan/releases/tag/v3.1.0
-[strscan-v3.1.1]: https://github.com/ruby/strscan/releases/tag/v3.1.1
-[strscan-v3.1.2]: https://github.com/ruby/strscan/releases/tag/v3.1.2
-[syntax_suggest-v2.0.1]: https://github.com/ruby/syntax_suggest/releases/tag/v2.0.1
-[syntax_suggest-v2.0.2]: https://github.com/ruby/syntax_suggest/releases/tag/v2.0.2
-[tempfile-v0.3.0]: https://github.com/ruby/tempfile/releases/tag/v0.3.0
-[tempfile-v0.3.1]: https://github.com/ruby/tempfile/releases/tag/v0.3.1
-[time-v0.4.0]: https://github.com/ruby/time/releases/tag/v0.4.0
-[time-v0.4.1]: https://github.com/ruby/time/releases/tag/v0.4.1
-[timeout-v0.4.2]: https://github.com/ruby/timeout/releases/tag/v0.4.2
-[timeout-v0.4.3]: https://github.com/ruby/timeout/releases/tag/v0.4.3
-[tmpdir-v0.3.0]: https://github.com/ruby/tmpdir/releases/tag/v0.3.0
-[tmpdir-v0.3.1]: https://github.com/ruby/tmpdir/releases/tag/v0.3.1
-[uri-v0.13.1]: https://github.com/ruby/uri/releases/tag/v0.13.1
-[uri-v1.0.0]: https://github.com/ruby/uri/releases/tag/v1.0.0
-[uri-v1.0.1]: https://github.com/ruby/uri/releases/tag/v1.0.1
-[uri-v1.0.2]: https://github.com/ruby/uri/releases/tag/v1.0.2
-[win32ole-v1.9.0]: https://github.com/ruby/win32ole/releases/tag/v1.9.0
-[win32ole-v1.9.1]: https://github.com/ruby/win32ole/releases/tag/v1.9.1
-[yaml-v0.4.0]: https://github.com/ruby/yaml/releases/tag/v0.4.0
-[zlib-v3.1.1]: https://github.com/ruby/zlib/releases/tag/v3.1.1
-[zlib-v3.2.0]: https://github.com/ruby/zlib/releases/tag/v3.2.0
-[zlib-v3.2.1]: https://github.com/ruby/zlib/releases/tag/v3.2.1
-[minitest-v5.25.4]: https://github.com/seattlerb/minitest/releases/tag/v5.25.4
-[power_assert-v2.0.4]:  https://github.com/ruby/power_assert/releases/tag/v2.0.4
-[power_assert-v2.0.5]:  https://github.com/ruby/power_assert/releases/tag/v2.0.5
-[rake-v13.2.0]: https://github.com/ruby/rake/releases/tag/v13.2.0
-[rake-v13.2.1]: https://github.com/ruby/rake/releases/tag/v13.2.1
-[test-unit-3.6.2]: https://github.com/test-unit/test-unit/releases/tag/3.6.2
-[test-unit-3.6.3]: https://github.com/test-unit/test-unit/releases/tag/3.6.3
-[test-unit-3.6.4]: https://github.com/test-unit/test-unit/releases/tag/3.6.4
-[test-unit-3.6.5]: https://github.com/test-unit/test-unit/releases/tag/3.6.5
-[test-unit-3.6.6]: https://github.com/test-unit/test-unit/releases/tag/3.6.6
-[test-unit-3.6.7]: https://github.com/test-unit/test-unit/releases/tag/3.6.7
-[rexml-v3.2.7]: https://github.com/ruby/rexml/releases/tag/v3.2.7
-[rexml-v3.2.8]: https://github.com/ruby/rexml/releases/tag/v3.2.8
-[rexml-v3.2.9]: https://github.com/ruby/rexml/releases/tag/v3.2.9
-[rexml-v3.3.0]: https://github.com/ruby/rexml/releases/tag/v3.3.0
-[rexml-v3.3.1]: https://github.com/ruby/rexml/releases/tag/v3.3.1
-[rexml-v3.3.2]: https://github.com/ruby/rexml/releases/tag/v3.3.2
-[rexml-v3.3.3]: https://github.com/ruby/rexml/releases/tag/v3.3.3
-[rexml-v3.3.4]: https://github.com/ruby/rexml/releases/tag/v3.3.4
-[rexml-v3.3.5]: https://github.com/ruby/rexml/releases/tag/v3.3.5
-[rexml-v3.3.6]: https://github.com/ruby/rexml/releases/tag/v3.3.6
-[rexml-v3.3.7]: https://github.com/ruby/rexml/releases/tag/v3.3.7
-[rexml-v3.3.8]: https://github.com/ruby/rexml/releases/tag/v3.3.8
-[rexml-v3.3.9]: https://github.com/ruby/rexml/releases/tag/v3.3.9
-[rexml-v3.4.0]: https://github.com/ruby/rexml/releases/tag/v3.4.0
-[rss-0.3.1]: https://github.com/ruby/rss/releases/tag/0.3.1
-[net-ftp-v0.3.4]: https://github.com/ruby/net-ftp/releases/tag/v0.3.4
-[net-ftp-v0.3.5]: https://github.com/ruby/net-ftp/releases/tag/v0.3.5
-[net-ftp-v0.3.6]: https://github.com/ruby/net-ftp/releases/tag/v0.3.6
-[net-ftp-v0.3.7]: https://github.com/ruby/net-ftp/releases/tag/v0.3.7
-[net-ftp-v0.3.8]: https://github.com/ruby/net-ftp/releases/tag/v0.3.8
-[net-imap-v0.4.9.1]: https://github.com/ruby/net-imap/releases/tag/v0.4.9.1
-[net-imap-v0.4.10]: https://github.com/ruby/net-imap/releases/tag/v0.4.10
-[net-imap-v0.4.11]: https://github.com/ruby/net-imap/releases/tag/v0.4.11
-[net-imap-v0.4.12]: https://github.com/ruby/net-imap/releases/tag/v0.4.12
-[net-imap-v0.4.13]: https://github.com/ruby/net-imap/releases/tag/v0.4.13
-[net-imap-v0.4.14]: https://github.com/ruby/net-imap/releases/tag/v0.4.14
-[net-imap-v0.4.15]: https://github.com/ruby/net-imap/releases/tag/v0.4.15
-[net-imap-v0.4.16]: https://github.com/ruby/net-imap/releases/tag/v0.4.16
-[net-imap-v0.4.17]: https://github.com/ruby/net-imap/releases/tag/v0.4.17
-[net-imap-v0.5.0]: https://github.com/ruby/net-imap/releases/tag/v0.5.0
-[net-imap-v0.4.18]: https://github.com/ruby/net-imap/releases/tag/v0.4.18
-[net-imap-v0.5.1]: https://github.com/ruby/net-imap/releases/tag/v0.5.1
-[net-imap-v0.5.2]: https://github.com/ruby/net-imap/releases/tag/v0.5.2
-[net-imap-v0.5.3]: https://github.com/ruby/net-imap/releases/tag/v0.5.3
-[net-imap-v0.5.4]: https://github.com/ruby/net-imap/releases/tag/v0.5.4
-[net-smtp-v0.4.0.1]: https://github.com/ruby/net-smtp/releases/tag/v0.4.0.1
-[net-smtp-v0.5.0]: https://github.com/ruby/net-smtp/releases/tag/v0.5.0
-[prime-v0.1.3]: https://github.com/ruby/prime/releases/tag/v0.1.3
-[rbs-v3.4.1]: https://github.com/ruby/rbs/releases/tag/v3.4.1
-[rbs-v3.4.2]: https://github.com/ruby/rbs/releases/tag/v3.4.2
-[rbs-v3.4.3]: https://github.com/ruby/rbs/releases/tag/v3.4.3
-[rbs-v3.4.4]: https://github.com/ruby/rbs/releases/tag/v3.4.4
-[rbs-v3.5.0.pre.1]: https://github.com/ruby/rbs/releases/tag/v3.5.0.pre.1
-[rbs-v3.5.0.pre.2]: https://github.com/ruby/rbs/releases/tag/v3.5.0.pre.2
-[rbs-v3.5.0]: https://github.com/ruby/rbs/releases/tag/v3.5.0
-[rbs-v3.5.1]: https://github.com/ruby/rbs/releases/tag/v3.5.1
-[rbs-v3.5.2]: https://github.com/ruby/rbs/releases/tag/v3.5.2
-[rbs-v3.5.3]: https://github.com/ruby/rbs/releases/tag/v3.5.3
-[rbs-v3.6.0.dev.1]: https://github.com/ruby/rbs/releases/tag/v3.6.0.dev.1
-[rbs-v3.6.0.pre.1]: https://github.com/ruby/rbs/releases/tag/v3.6.0.pre.1
-[rbs-v3.6.0.pre.2]: https://github.com/ruby/rbs/releases/tag/v3.6.0.pre.2
-[rbs-v3.6.0.pre.3]: https://github.com/ruby/rbs/releases/tag/v3.6.0.pre.3
-[rbs-v3.6.0]: https://github.com/ruby/rbs/releases/tag/v3.6.0
-[rbs-v3.6.1]: https://github.com/ruby/rbs/releases/tag/v3.6.1
-[rbs-v3.7.0.dev.1]: https://github.com/ruby/rbs/releases/tag/v3.7.0.dev.1
-[rbs-v3.7.0.pre.1]: https://github.com/ruby/rbs/releases/tag/v3.7.0.pre.1
-[rbs-v3.7.0]: https://github.com/ruby/rbs/releases/tag/v3.7.0
-[rbs-v3.8.0.pre.1]: https://github.com/ruby/rbs/releases/tag/v3.8.0.pre.1
-[rbs-v3.8.0]: https://github.com/ruby/rbs/releases/tag/v3.8.0
-[debug-v1.9.2]: https://github.com/ruby/debug/releases/tag/v1.9.2
-[debug-v1.10.0]: https://github.com/ruby/debug/releases/tag/v1.10.0
-[racc-v1.8.0]: https://github.com/ruby/racc/releases/tag/v1.8.0
-[racc-v1.8.1]: https://github.com/ruby/racc/releases/tag/v1.8.1
-[mutex_m-v0.3.0]: https://github.com/ruby/mutex_m/releases/tag/v0.3.0
-[bigdecimal-v3.1.6]: https://github.com/ruby/bigdecimal/releases/tag/v3.1.6
-[bigdecimal-v3.1.7]: https://github.com/ruby/bigdecimal/releases/tag/v3.1.7
-[bigdecimal-v3.1.8]: https://github.com/ruby/bigdecimal/releases/tag/v3.1.8
-[drb-v2.2.1]: https://github.com/ruby/drb/releases/tag/v2.2.1
-[nkf-v0.2.0]: https://github.com/ruby/nkf/releases/tag/v0.2.0
-[syslog-v0.2.0]: https://github.com/ruby/syslog/releases/tag/v0.2.0
-[csv-v3.2.9]: https://github.com/ruby/csv/releases/tag/v3.2.9
-[csv-v3.3.0]: https://github.com/ruby/csv/releases/tag/v3.3.0
-[csv-v3.3.1]: https://github.com/ruby/csv/releases/tag/v3.3.1
-[csv-v3.3.2]: https://github.com/ruby/csv/releases/tag/v3.3.2
-[ruby/net-http-sspi]: https://github.com/ruby/net-http-sspi
-[typeprof-v0.30.1]: https://github.com/ruby/typeprof/releases/tag/v0.30.1
-
-[RubyGems]: https://github.com/rubygems/rubygems
-[benchmark]: https://github.com/ruby/benchmark
-[bundler]: https://github.com/rubygems/rubygems
-[date]: https://github.com/ruby/date
-[delegate]: https://github.com/ruby/delegate
-[did_you_mean]: https://github.com/ruby/did_you_mean
-[digest]: https://github.com/ruby/digest
-[erb]: https://github.com/ruby/erb
-[error_highlight]: https://github.com/ruby/error_highlight
-[etc]: https://github.com/ruby/etc
-[fcntl]: https://github.com/ruby/fcntl
-[fiddle]: https://github.com/ruby/fiddle
-[fileutils]: https://github.com/ruby/fileutils
-[io-console]: https://github.com/ruby/io-console
-[io-nonblock]: https://github.com/ruby/io-nonblock
-[ipaddr]: https://github.com/ruby/ipaddr
-[irb]: https://github.com/ruby/irb
-[json]: https://github.com/ruby/json
-[logger]: https://github.com/ruby/logger
-[net-http]: https://github.com/ruby/net-http
-[open-uri]: https://github.com/ruby/open-uri
-[optparse]: https://github.com/ruby/optparse
-[ostruct]: https://github.com/ruby/ostruct
-[pathname]: https://github.com/ruby/pathname
-[pp]: https://github.com/ruby/pp
-[prism]: https://github.com/ruby/prism
-[pstore]: https://github.com/ruby/pstore
-[psych]: https://github.com/ruby/psych
-[rdoc]: https://github.com/ruby/rdoc
-[reline]: https://github.com/ruby/reline
-[resolv]: https://github.com/ruby/resolv
-[securerandom]: https://github.com/ruby/securerandom
-[set]: https://github.com/ruby/set
-[shellwords]: https://github.com/ruby/shellwords
-[singleton]: https://github.com/ruby/singleton
-[stringio]: https://github.com/ruby/stringio
-[strscan]: https://github.com/ruby/strscan
-[syntax_suggest]: https://github.com/ruby/syntax_suggest
-[tempfile]: https://github.com/ruby/tempfile
-[time]: https://github.com/ruby/time
-[timeout]: https://github.com/ruby/timeout
-[tmpdir]: https://github.com/ruby/tmpdir
-[uri]: https://github.com/ruby/uri
-[win32ole]: https://github.com/ruby/win32ole
-[yaml]: https://github.com/ruby/yaml
-[zlib]: https://github.com/ruby/zlib
-
-[repl_type_completor]: https://github.com/ruby/repl_type_completor
-[minitest]: https://github.com/seattlerb/minitest
-[power_assert]: https://github.com/ruby/power_assert
-[rake]: https://github.com/ruby/rake
-[test-unit]: https://github.com/test-unit/test-unit
-[rexml]: https://github.com/ruby/rexml
-[rss]: https://github.com/ruby/rss
-[net-ftp]: https://github.com/ruby/net-ftp
-[net-imap]: https://github.com/ruby/net-imap
-[net-smtp]: https://github.com/ruby/net-smtp
-[prime]: https://github.com/ruby/prime
-[rbs]: https://github.com/ruby/rbs
-[typeprof]: https://github.com/ruby/typeprof
-[debug]: https://github.com/ruby/debug
-[racc]: https://github.com/ruby/racc
-[mutex_m]: https://github.com/ruby/mutex_m
-[getoptlong]: https://github.com/ruby/getoptlong
-[base64]: https://github.com/ruby/base64
-[bigdecimal]: https://github.com/ruby/bigdecimal
-[observer]: https://github.com/ruby/observer
-[abbrev]: https://github.com/ruby/abbrev
-[resolv-replace]: https://github.com/ruby/resolv-replace
-[rinda]: https://github.com/ruby/rinda
-[drb]: https://github.com/ruby/drb
-[nkf]: https://github.com/ruby/nkf
-[syslog]: https://github.com/ruby/syslog
-[csv]: https://github.com/ruby/csv
diff --git a/README.ja.md b/README.ja.md
index adacd57a4f..2902216f99 100644
--- a/README.ja.md
+++ b/README.ja.md
@@ -1,10 +1,3 @@
-[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
-[![Actions Status: RJIT](https://github.com/ruby/ruby/workflows/RJIT/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"RJIT")
-[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
-[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
-[![AppVeyor status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
-[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
-
 # Rubyとは
 
 Rubyはシンプルかつ強力なオブジェクト指向スクリプト言語です． Rubyは純粋なオブジェクト指向言語として設計されているので，
@@ -17,41 +10,40 @@ Rubyはテキスト処理関係の能力などに優れ，Perlと同じくらい
 
 *   シンプルな文法
 *   普通のオブジェクト指向機能(クラス，メソッドコールなど)
-*   特殊なオブジェクト指向機能(Mixin，特異メソッドなど)
+*   特殊なオブジェクト指向機能(Mixin, 特異メソッドなど)
 *   演算子オーバーロード
 *   例外処理機能
 *   イテレータとクロージャ
 *   ガーベージコレクタ
 *   ダイナミックローディング (アーキテクチャによる)
-*   移植性が高い．多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく，Windows， macOS，
-    Haikuなどの上でも動く cf.
-    https://docs.ruby-lang.org/en/master/maintainers_md.html#label-Platform+Maintainers
+*   移植性が高い．多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく，Windows， Mac OS
+    X，Haikuなどの上でも動く cf.
+    https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatformsJa
 
 
 ## 入手法
 
-サードパーティーツールを使った方法を含むRubyのインストール方法の一覧は
+### FTPで
+
+以下の場所においてあります．
+
+ftp://ftp.ruby-lang.org/pub/ruby/
 
-https://www.ruby-lang.org/ja/downloads/
+### Subversionで
 
-を参照してください．
+開発先端のソースコードは次のコマンドで取得できます．
 
-### Git
+    $ svn co https://svn.ruby-lang.org/repos/ruby/trunk/ ruby
 
-ミラーをGitHubに公開しています． 以下のコマンドでリポジトリを取得できます．
+他に開発中のブランチの一覧は次のコマンドで見られます．
 
-```console
-$ git clone https://github.com/ruby/ruby.git
-```
+    $ svn ls https://svn.ruby-lang.org/repos/ruby/branches/
 
-他のブランチの一覧は次のコマンドで見られます．
+### Gitで
 
-```console
-$ git ls-remote https://github.com/ruby/ruby.git
-```
+SubversionのミラーをGitHubに公開しています． 以下のコマンドでリポジトリを取得できます．
 
-Rubyリポジトリの本来のmasterは https://git.ruby-lang.org/ruby.git にあります．
-コミッタはこちらを使います．
+    $ git clone git://github.com/ruby/ruby.git
 
 ## ホームページ
 
@@ -63,33 +55,38 @@ https://www.ruby-lang.org/
 
 ## メーリングリスト
 
-Rubyのメーリングリストがあります．参加希望の方は [ruby-list-request@ml.ruby-lang.org] まで件名に
+Rubyのメーリングリストがあります．参加希望の方は
+
+mailto:ruby-list-request@ruby-lang.org
+
+まで本文に
 
-    join
+    subscribe
 
 と書いて送って下さい．
 
-Ruby開発者向けメーリングリストもあります．こちらではrubyのバグ，将来の仕様拡張など実装上の問題について議論されています．
-参加希望の方は [ruby-dev-request@ml.ruby-lang.org] までruby-listと同様の方法でメールしてください．
+Ruby開発者向けメーリングリストもあります．こちらではrubyのバグ，将来の仕様拡張など実装上の問題について議論されています． 参加希望の方は
+
+mailto:ruby-dev-request@ruby-lang.org
+
+までruby-listと同様の方法でメールしてください．
 
 Ruby拡張モジュールについて話し合うruby-extメーリングリストと数学関係の話題について話し合うruby-mathメーリングリストと
 英語でrubyについて話し合うruby-talkメーリングリストもあります．参加方法はどれも同じです．
 
-[ruby-list-request@ml.ruby-lang.org]: mailto:ruby-list-request@ml.ruby-lang.org?subject=join
-[ruby-dev-request@ml.ruby-lang.org]: mailto:ruby-dev-request@ml.ruby-lang.org?subject=join
-
 ## コンパイル・インストール
 
 以下の手順で行ってください．
 
-1.  (Gitリポジトリから取得したソースをビルドする場合) `./autogen.sh` を実行して新しく `configure` を生成する
+1.  もし `configure` ファイルが見つからない，もしくは `configure.ac` より古いようなら， `autoconf` を実行して
+    新しく `configure` を生成する
 
 2.  `configure` を実行して `Makefile` などを生成する
 
     環境によってはデフォルトのCコンパイラ用オプションが付きます． `configure` オプションで `optflags=..`
     `warnflags=..` 等で上書きできます．
 
-3.  (必要ならば)`include/ruby/defines.h` を編集する
+3.  (必要ならば)`defines.h` を編集する
 
     多分，必要無いと思います．
 
@@ -98,8 +95,7 @@ Ruby拡張モジュールについて話し合うruby-extメーリングリス�
     `ext/Setup` に記述したモジュールは静的にリンクされます．
 
     ダイナミックローディングをサポートしていないアーキテクチャでは `Setup` の1行目の「`option nodynamic`」という行のコ
-    メントを外す必要があります．
-    また，このアーキテクチャで拡張モジュールを利用するためには，あらかじめ静的にリンクをしておく必要があります．
+    メントを外す必要があります．また，このアーキテクチャで拡張モジュールを利用するためには，あらかじめ静的にリンクをしておく必要があります．
 
 5.  `make` を実行してコンパイルする
 
@@ -155,21 +151,21 @@ UNIXであれば `configure` がほとんどの差異を吸収してくれるは
 
 ## 配布条件
 
-[COPYING.ja](https://docs.ruby-lang.org/en/master/COPYING_ja.html) ファイルを参照してください．
+[COPYING.ja](COPYING.ja) ファイルを参照してください．
 
 ## フィードバック
 
-Rubyに関する質問は [Ruby-Talk]（英語）や [Ruby-List]（日本語）や，
-[stackoverflow] などのWebサイトに投稿してください．
+Rubyに関する質問は Ruby-Talk（英語）や Ruby-List（日本語） (https://www.ruby-lang.org/ja/community/mailing-lists) や，
+stackoverflow (https://ja.stackoverflow.com/) などのWebサイトに投稿してください．
 
 バグ報告は https://bugs.ruby-lang.org で受け付けています．
 
-[Ruby-Talk]: https://www.ruby-lang.org/en/community/mailing-lists
-[Ruby-List]: https://www.ruby-lang.org/ja/community/mailing-lists
-[stackoverflow]: https://ja.stackoverflow.com/
 
 ## 著者
 
 Rubyのオリジナル版は，1995年にまつもとゆきひろ氏によって設計・開発されました．
 
 <mailto:matz@ruby-lang.org>
+
+---
+created at: Thu Aug  3 11:57:36 JST 1995
diff --git a/README.md b/README.md
index eb24a73ee3..7a24329fe8 100644
--- a/README.md
+++ b/README.md
@@ -1,29 +1,27 @@
-[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
-[![Actions Status: RJIT](https://github.com/ruby/ruby/workflows/RJIT/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"RJIT")
-[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
-[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
-[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
+[![Build Status](https://travis-ci.org/ruby/ruby.svg)](https://travis-ci.org/ruby/ruby)
+[![Build status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/trunk?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/trunk)
 
-# What is Ruby?
+# What's Ruby
 
-Ruby is an interpreted object-oriented programming language often
-used for web development. It also offers many scripting features
-to process plain text and serialized files, or manage system tasks.
-It is simple, straightforward, and extensible.
+Ruby is the interpreted scripting language for quick and easy object-oriented
+programming. It has many features to process text files and to do system
+management tasks (as in Perl). It is simple, straight-forward, and
+extensible.
 
 ## Features of Ruby
 
-* Simple Syntax
-* **Normal** Object-oriented Features (e.g. class, method calls)
-* **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
-* Operator Overloading
-* Exception Handling
-* Iterators and Closures
-* Garbage Collection
-* Dynamic Loading of Object Files (on some architectures)
-* Highly Portable (works on many Unix-like/POSIX compatible platforms as
-  well as Windows, macOS, etc.) cf.
-    https://docs.ruby-lang.org/en/master/maintainers_md.html#label-Platform+Maintainers
+*   Simple Syntax
+*   **Normal** Object-oriented Features (e.g. class, method calls)
+*   **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
+*   Operator Overloading
+*   Exception Handling
+*   Iterators and Closures
+*   Garbage Collection
+*   Dynamic Loading of Object Files (on some architectures)
+*   Highly Portable (works on many Unix-like/POSIX compatible platforms as
+    well as Windows, macOS, Haiku, etc.) cf.
+    https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatforms
+
 
 ## How to get Ruby
 
@@ -32,64 +30,146 @@ like rvm, see:
 
 https://www.ruby-lang.org/en/downloads/
 
-You can download release packages and the snapshot of the repository. If you want to
-download whole versions of Ruby, please visit https://www.ruby-lang.org/en/downloads/releases/.
+The Ruby distribution files can be found on the following FTP site:
+
+ftp://ftp.ruby-lang.org/pub/ruby/
+
+The trunk of the Ruby source tree can be checked out with the following
+command:
 
-### Download with Git
+    $ svn co https://svn.ruby-lang.org/repos/ruby/trunk/ ruby
 
-The mirror of the Ruby source tree can be checked out with the following command:
+Or if you are using git then use the following command:
 
     $ git clone https://github.com/ruby/ruby.git
 
 There are some other branches under development. Try the following command
 to see the list of branches:
 
-    $ git ls-remote https://github.com/ruby/ruby.git
+    $ svn ls https://svn.ruby-lang.org/repos/ruby/branches/
 
-You may also want to use https://git.ruby-lang.org/ruby.git (actual master of Ruby source)
-if you are a committer.
+Or if you are using git then use the following command:
 
-## How to build
-
-See [Building Ruby](https://docs.ruby-lang.org/en/master/contributing/building_ruby_md.html)
+    $ git ls-remote git://github.com/ruby/ruby.git
 
 ## Ruby home page
 
-https://www.ruby-lang.org/
+The URL of the Ruby home page is:
 
-## Documentation
-
-- [English](https://docs.ruby-lang.org/en/master/index.html)
-- [Japanese](https://docs.ruby-lang.org/ja/master/index.html)
+https://www.ruby-lang.org/
 
 ## Mailing list
 
-There is a mailing list to discuss Ruby. To subscribe to this list, please
+There is a mailing list to talk about Ruby. To subscribe to this list, please
 send the following phrase:
 
-    join
+    subscribe
+
+in the mail body (not subject) to the address
+<mailto:ruby-talk-request@ruby-lang.org>.
+
+## How to compile and install
+
+This is what you need to do to compile and install Ruby:
+
+1.  If you want to use Microsoft Visual C++ to compile Ruby, read
+    [win32/README.win32](win32/README.win32) instead of this document.
+
+2.  If `./configure` does not exist or is older than `configure.ac`, run
+    `autoconf` to (re)generate configure.
+
+3.  Run `./configure`, which will generate `config.h` and `Makefile`.
+
+    Some C compiler flags may be added by default depending on your
+    environment. Specify `optflags=..` and `warnflags=..` as necessary to
+    override them.
+
+4.  Edit `defines.h` if you need. Usually this step will not be needed.
+
+5.  Remove comment mark(`#`) before the module names from `ext/Setup` (or add
+    module names if not present), if you want to link modules statically.
+
+    If you don't want to compile non static extension modules (probably on
+    architectures which do not allow dynamic loading), remove comment mark
+    from the line "`#option nodynamic`" in `ext/Setup`.
 
-in the mail subject (not body) to the address [ruby-talk-request@ml.ruby-lang.org].
+    Usually this step will not be needed.
 
-[ruby-talk-request@ml.ruby-lang.org]: mailto:ruby-talk-request@ml.ruby-lang.org?subject=join
+6.  Run `make`.
+
+    * On Mac, set RUBY\_CODESIGN environment variable with a signing identity.
+      It uses the identity to sign `ruby` binary. See also codesign(1).
+
+7.  Optionally, run '`make check`' to check whether the compiled Ruby
+    interpreter works well. If you see the message "`check succeeded`", your
+    Ruby works as it should (hopefully).
+
+8.  Optionally, run `make update-gems` and `make extract-gems`.
+
+    If you want to install bundled gems, run `make update-gems` and
+    `make extract-gems` before running `make install`.
+
+9.  Run '`make install`'.
+
+    This command will create the following directories and install files into
+    them.
+
+    *   `${DESTDIR}${prefix}/bin`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib`
+    *   `${DESTDIR}${prefix}/lib/ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/share/man/man1`
+    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
+
+
+    If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
+    `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
+
+    **NOTE**: teeny of the API version may be different from one of Ruby's
+    program version
+
+    You may have to be a super user to install Ruby.
+
+
+If you fail to compile Ruby, please send the detailed error report with the
+error log and machine/OS type, to help others.
+
+Some extension libraries may not get compiled because of lack of necessary
+external libraries and/or headers, then you will need to run '`make distclean-ext`'
+to remove old configuration after installing them in such case.
 
 ## Copying
 
-See the file [COPYING](rdoc-ref:COPYING).
+See the file [COPYING](COPYING).
 
 ## Feedback
 
-Questions about the Ruby language can be asked on the [Ruby-Talk](https://www.ruby-lang.org/en/community/mailing-lists) mailing list
-or on websites like https://stackoverflow.com.
+Questions about the Ruby language can be asked on the Ruby-Talk mailing list
+(https://www.ruby-lang.org/en/community/mailing-lists) or on websites like
+(https://stackoverflow.com).
 
-Bugs should be reported at https://bugs.ruby-lang.org. Read ["Reporting Issues"](https://docs.ruby-lang.org/en/master/contributing/reporting_issues_md.html) for more information.
+Bug reports should be filed at https://bugs.ruby-lang.org. Read [HowToReport] for more information.
+
+[HowToReport]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToReport
 
 ## Contributing
 
-See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing_md.html), which includes setup and build instructions.
+See the file [CONTRIBUTING.md](CONTRIBUTING.md)
+
 
 ## The Author
 
-Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in 1995.
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in
+1995.
 
-<matz@ruby-lang.org>
+<mailto:matz@ruby-lang.org>
diff --git a/acinclude.m4 b/acinclude.m4
new file mode 100644
index 0000000000..99b24e6d93
--- /dev/null
+++ b/acinclude.m4
@@ -0,0 +1,46 @@
+# -*- autoconf -*-
+
+AC_DEFUN([_COLORIZE_RESULT_PREPARE], [
+    msg_checking= msg_result_yes= msg_result_no= msg_result_other= msg_reset=
+    AS_IF([test "x${CONFIGURE_TTY}" = xyes -o -t 1], [
+	msg_begin="`tput smso 2>/dev/null`"
+	AS_CASE(["$msg_begin"], ['@<:@'*m],
+	    [msg_begin="`echo "$msg_begin" | sed ['s/[0-9]*m$//']`"
+	    msg_checking="${msg_begin}33m"
+	    AS_IF([test ${TEST_COLORS:+set}], [
+		msg_result_yes=[`expr ":$TEST_COLORS:" : ".*:pass=\([^:]*\):"`]
+		msg_result_no=[`expr ":$TEST_COLORS:" : ".*:fail=\([^:]*\):"`]
+		msg_result_other=[`expr ":$TEST_COLORS:" : ".*:skip=\([^:]*\):"`]
+	    ])
+	    msg_result_yes="${msg_begin}${msg_result_yes:-32;1}m"
+	    msg_result_no="${msg_begin}${msg_result_no:-31;1}m"
+	    msg_result_other="${msg_begin}${msg_result_other:-33;1}m"
+	    msg_reset="${msg_begin}m"
+	    ])
+	AS_UNSET(msg_begin)
+	])
+    AS_REQUIRE_SHELL_FN([colorize_result],
+	[AS_FUNCTION_DESCRIBE([colorize_result], [MSG], [Colorize result])],
+        [AS_CASE(["$[]1"],
+            [yes], [AS_ECHO(["${msg_result_yes}$[]1${msg_reset}]")],
+            [no], [AS_ECHO(["${msg_result_no}$[]1${msg_reset}]")],
+            [AS_ECHO(["${msg_result_other}$[]1${msg_reset}]")])])
+])
+
+AC_DEFUN([COLORIZE_RESULT], [AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
+    AS_LITERAL_IF([$1],
+	[m4_case([$1],
+		[yes], [AS_ECHO(["${msg_result_yes}$1${msg_reset}"])],
+		[no], [AS_ECHO(["${msg_result_no}$1${msg_reset}"])],
+		[AS_ECHO(["${msg_result_other}$1${msg_reset}"])])],
+	[colorize_result "$1"]) dnl
+])
+
+AC_DEFUN([AC_CHECKING],[dnl
+AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
+AS_MESSAGE([checking ${msg_checking}$1${msg_reset}...])])
+
+AC_DEFUN([AC_MSG_RESULT], [dnl
+{ _AS_ECHO_LOG([result: $1])
+COLORIZE_RESULT([$1]); dnl
+}])
diff --git a/aclocal.m4 b/aclocal.m4
index e69de29bb2..18ba297b05 100644
--- a/aclocal.m4
+++ b/aclocal.m4
@@ -0,0 +1,15 @@
+# generated automatically by aclocal 1.15.1 -*- Autoconf -*-
+
+# Copyright (C) 1996-2017 Free Software Foundation, Inc.
+
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+m4_ifndef([AC_CONFIG_MACRO_DIRS], [m4_defun([_AM_CONFIG_MACRO_DIRS], [])m4_defun([AC_CONFIG_MACRO_DIRS], [_AM_CONFIG_MACRO_DIRS($@)])])
+m4_include([acinclude.m4])
diff --git a/addr2line.c b/addr2line.c
index b783e8e470..09fcc3c225 100644
--- a/addr2line.c
+++ b/addr2line.c
@@ -8,30 +8,20 @@
 
 **********************************************************************/
 
-#if defined(__clang__) && defined(__has_warning)
-#if __has_warning("-Wgnu-empty-initializer")
-#pragma clang diagnostic ignored "-Wgnu-empty-initializer"
-#endif
-#if __has_warning("-Wgcc-compat")
-#pragma clang diagnostic ignored "-Wgcc-compat"
-#endif
-#endif
-
-#include "ruby/internal/config.h"
-#include "ruby/defines.h"
+#include "ruby/config.h"
 #include "ruby/missing.h"
 #include "addr2line.h"
 
 #include <stdio.h>
 #include <errno.h>
 
-#ifdef HAVE_LIBPROC_H
-#include <libproc.h>
+#ifdef HAVE_STDBOOL_H
+#include <stdbool.h>
+#else
+#include "missing/stdbool.h"
 #endif
 
-#include "ruby/internal/stdbool.h"
-
-#if defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H)
+#ifdef USE_ELF
 
 #include <fcntl.h>
 #include <limits.h>
@@ -44,6 +34,12 @@
 #include <sys/stat.h>
 #include <unistd.h>
 
+#ifdef __OpenBSD__
+#include <elf_abi.h>
+#else
+#include <elf.h>
+#endif
+
 /* Make alloca work the best possible way.  */
 #ifdef __GNUC__
 # ifndef alloca
@@ -56,44 +52,35 @@
 #  ifdef _AIX
 #pragma alloca
 #  else
-#   ifndef alloca                /* predefined by HP cc +Olibcalls */
+#   ifndef alloca		/* predefined by HP cc +Olibcalls */
 void *alloca();
 #   endif
 #  endif /* AIX */
-# endif        /* HAVE_ALLOCA_H */
-# ifndef UNREACHABLE
-#  define UNREACHABLE __builtin_unreachable()
-# endif
-# ifndef UNREACHABLE_RETURN
-#  define UNREACHABLE_RETURN(_) __builtin_unreachable()
-# endif
+# endif	/* HAVE_ALLOCA_H */
 #endif /* __GNUC__ */
 
-#ifndef UNREACHABLE
-# define UNREACHABLE abort()
-#endif
-#ifndef UNREACHABLE_RETURN
-# define UNREACHABLE_RETURN(_) return (abort(), (_))
-#endif
-
 #ifdef HAVE_DLADDR
 # include <dlfcn.h>
 #endif
 
-#ifdef HAVE_MACH_O_LOADER_H
-# include <crt_externs.h>
-# include <mach-o/fat.h>
-# include <mach-o/loader.h>
-# include <mach-o/nlist.h>
-# include <mach-o/stab.h>
-#endif
+#define DW_LNS_copy                     0x01
+#define DW_LNS_advance_pc               0x02
+#define DW_LNS_advance_line             0x03
+#define DW_LNS_set_file                 0x04
+#define DW_LNS_set_column               0x05
+#define DW_LNS_negate_stmt              0x06
+#define DW_LNS_set_basic_block          0x07
+#define DW_LNS_const_add_pc             0x08
+#define DW_LNS_fixed_advance_pc         0x09
+#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
+#define DW_LNS_set_isa                  0x0c /* DWARF3 */
 
-#ifdef USE_ELF
-# ifdef __OpenBSD__
-#  include <elf_abi.h>
-# else
-#  include <elf.h>
-# endif
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence             0x01
+#define DW_LNE_set_address              0x02
+#define DW_LNE_define_file              0x03
+#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
 
 #ifndef ElfW
 # if SIZEOF_VOIDP == 8
@@ -109,44 +96,17 @@ void *alloca();
 #  define ELF_ST_TYPE ELF32_ST_TYPE
 # endif
 #endif
-#endif
-
-#ifdef SHF_COMPRESSED
-# if defined(ELFCOMPRESS_ZLIB) && defined(HAVE_LIBZ)
-   /* FreeBSD 11.0 lacks ELFCOMPRESS_ZLIB */
-#  include <zlib.h>
-#  define SUPPORT_COMPRESSED_DEBUG_LINE
-# endif
-#else /* compatibility with glibc < 2.22 */
-# define SHF_COMPRESSED 0
-#endif
-
 #ifndef PATH_MAX
 #define PATH_MAX 4096
 #endif
 
-#define DW_LNS_copy                     0x01
-#define DW_LNS_advance_pc               0x02
-#define DW_LNS_advance_line             0x03
-#define DW_LNS_set_file                 0x04
-#define DW_LNS_set_column               0x05
-#define DW_LNS_negate_stmt              0x06
-#define DW_LNS_set_basic_block          0x07
-#define DW_LNS_const_add_pc             0x08
-#define DW_LNS_fixed_advance_pc         0x09
-#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
-#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
-#define DW_LNS_set_isa                  0x0c /* DWARF3 */
-
-/* Line number extended opcode name. */
-#define DW_LNE_end_sequence             0x01
-#define DW_LNE_set_address              0x02
-#define DW_LNE_define_file              0x03
-#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
+#ifndef SHF_COMPRESSED /* compatibility with glibc < 2.22 */
+#define SHF_COMPRESSED 0
+#endif
 
-#define kprintf(...) fprintf(errout, "" __VA_ARGS__)
+int kprintf(const char *fmt, ...);
 
-typedef struct line_info {
+typedef struct {
     const char *dirname;
     const char *filename;
     const char *path; /* object path */
@@ -155,416 +115,318 @@ typedef struct line_info {
     uintptr_t base_addr;
     uintptr_t saddr;
     const char *sname; /* function name */
-
-    struct line_info *next;
 } line_info_t;
-
-struct dwarf_section {
-    char *ptr;
-    size_t size;
-    uint64_t flags;
-};
-
-typedef struct obj_info {
+typedef struct obj_info obj_info_t;
+struct obj_info {
     const char *path; /* object path */
-    char *mapped;
+    int fd;
+    void *mapped;
     size_t mapped_size;
-    void *uncompressed;
     uintptr_t base_addr;
-    uintptr_t vmaddr;
-    struct dwarf_section debug_abbrev;
-    struct dwarf_section debug_info;
-    struct dwarf_section debug_line;
-    struct dwarf_section debug_ranges;
-    struct dwarf_section debug_str_offsets;
-    struct dwarf_section debug_addr;
-    struct dwarf_section debug_rnglists;
-    struct dwarf_section debug_str;
-    struct dwarf_section debug_line_str;
-    struct obj_info *next;
-} obj_info_t;
-
-#define DWARF_SECTION_COUNT 9
-
-static struct dwarf_section *
-obj_dwarf_section_at(obj_info_t *obj, int n)
-{
-    struct dwarf_section *ary[] = {
-        &obj->debug_abbrev,
-        &obj->debug_info,
-        &obj->debug_line,
-        &obj->debug_ranges,
-        &obj->debug_str_offsets,
-        &obj->debug_addr,
-        &obj->debug_rnglists,
-        &obj->debug_str,
-        &obj->debug_line_str
-    };
-    if (n < 0 || DWARF_SECTION_COUNT <= n) {
-        UNREACHABLE_RETURN(0);
-    }
-    return ary[n];
-}
-
-struct debug_section_definition {
-    const char *name;
-    struct dwarf_section *dwarf;
+    obj_info_t *next;
 };
 
 /* Avoid consuming stack as this module may be used from signal handler */
-static char binary_filename[PATH_MAX + 1];
+static char binary_filename[PATH_MAX];
 
 static unsigned long
-uleb128(const char **p)
+uleb128(char **p)
 {
     unsigned long r = 0;
     int s = 0;
     for (;;) {
-        unsigned char b = (unsigned char)*(*p)++;
-        if (b < 0x80) {
-            r += (unsigned long)b << s;
-            break;
-        }
-        r += (b & 0x7f) << s;
-        s += 7;
+	unsigned char b = *(unsigned char *)(*p)++;
+	if (b < 0x80) {
+	    r += (unsigned long)b << s;
+	    break;
+	}
+	r += (b & 0x7f) << s;
+	s += 7;
     }
     return r;
 }
 
 static long
-sleb128(const char **p)
+sleb128(char **p)
 {
     long r = 0;
     int s = 0;
     for (;;) {
-        unsigned char b = (unsigned char)*(*p)++;
-        if (b < 0x80) {
-            if (b & 0x40) {
-                r -= (0x80 - b) << s;
-            }
-            else {
-                r += (b & 0x3f) << s;
-            }
-            break;
-        }
-        r += (b & 0x7f) << s;
-        s += 7;
+	unsigned char b = *(unsigned char *)(*p)++;
+	if (b < 0x80) {
+	    if (b & 0x40) {
+		r -= (0x80 - b) << s;
+	    }
+	    else {
+		r += (b & 0x3f) << s;
+	    }
+	    break;
+	}
+	r += (b & 0x7f) << s;
+	s += 7;
     }
     return r;
 }
 
 static const char *
-get_nth_dirname(unsigned long dir, const char *p, FILE *errout)
+get_nth_dirname(unsigned long dir, char *p)
 {
     if (!dir--) {
-        return "";
+	return "";
     }
     while (dir--) {
-        while (*p) p++;
-        p++;
-        if (!*p) {
-            kprintf("Unexpected directory number %lu in %s\n",
-                    dir, binary_filename);
-            return "";
-        }
+	while (*p) p++;
+	p++;
+	if (!*p) {
+	    kprintf("Unexpected directory number %lu in %s\n",
+		    dir, binary_filename);
+	    return "";
+	}
     }
     return p;
 }
 
-static const char *parse_ver5_debug_line_header(
-    const char *p, int idx, uint8_t format,
-    obj_info_t *obj, const char **out_path,
-    uint64_t *out_directory_index, FILE *errout);
-
 static void
-fill_filename(int file, uint8_t format, uint16_t version, const char *include_directories,
-              const char *filenames, line_info_t *line, obj_info_t *obj, FILE *errout)
+fill_filename(int file, char *include_directories, char *filenames,
+	      line_info_t *line)
 {
     int i;
-    const char *p = filenames;
-    const char *filename;
+    char *p = filenames;
+    char *filename;
     unsigned long dir;
-    if (version >= 5) {
-        const char *path;
-        uint64_t directory_index = -1;
-        parse_ver5_debug_line_header(filenames, file, format, obj, &path, &directory_index, errout);
-        line->filename = path;
-        parse_ver5_debug_line_header(include_directories, (int)directory_index, format, obj, &path, NULL, errout);
-        line->dirname = path;
-    }
-    else {
-        for (i = 1; i <= file; i++) {
-            filename = p;
-            if (!*p) {
-                /* Need to output binary file name? */
-                kprintf("Unexpected file number %d in %s at %tx\n",
-                        file, binary_filename, filenames - obj->mapped);
-                return;
-            }
-            while (*p) p++;
-            p++;
-            dir = uleb128(&p);
-            /* last modified. */
-            uleb128(&p);
-            /* size of the file. */
-            uleb128(&p);
-
-            if (i == file) {
-                line->filename = filename;
-                line->dirname = get_nth_dirname(dir, include_directories, errout);
-            }
-        }
+    for (i = 1; i <= file; i++) {
+	filename = p;
+	if (!*p) {
+	    /* Need to output binary file name? */
+	    kprintf("Unexpected file number %d in %s\n",
+		    file, binary_filename);
+	    return;
+	}
+	while (*p) p++;
+	p++;
+	dir = uleb128(&p);
+	/* last modified. */
+	uleb128(&p);
+	/* size of the file. */
+	uleb128(&p);
+
+	if (i == file) {
+	    line->filename = filename;
+	    line->dirname = get_nth_dirname(dir, include_directories);
+	}
     }
 }
 
 static void
 fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
-          uint8_t format, uint16_t version, const char *include_directories, const char *filenames,
-          obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
+	  char *include_directories, char *filenames,
+	  obj_info_t *obj, line_info_t *lines, int offset)
 {
     int i;
-    addr += obj->base_addr - obj->vmaddr;
+    addr += obj->base_addr;
     for (i = offset; i < num_traces; i++) {
-        uintptr_t a = (uintptr_t)traces[i];
-        /* We assume one line code doesn't result >100 bytes of native code.
+	uintptr_t a = (uintptr_t)traces[i];
+	/* We assume one line code doesn't result >100 bytes of native code.
        We may want more reliable way eventually... */
-        if (addr < a && a < addr + 100) {
-            fill_filename(file, format, version, include_directories, filenames, &lines[i], obj, errout);
-            lines[i].line = line;
-        }
+	if (addr < a && a < addr + 100) {
+	    fill_filename(file, include_directories, filenames, &lines[i]);
+	    lines[i].line = line;
+	}
     }
 }
 
-struct LineNumberProgramHeader {
-    uint64_t unit_length;
-    uint16_t version;
-    uint8_t format; /* 4 or 8 */
-    uint64_t header_length;
-    uint8_t minimum_instruction_length;
-    uint8_t maximum_operations_per_instruction;
-    uint8_t default_is_stmt;
-    int8_t line_base;
-    uint8_t line_range;
-    uint8_t opcode_base;
-    /* uint8_t standard_opcode_lengths[opcode_base-1]; */
-    const char *include_directories;
-    const char *filenames;
-    const char *cu_start;
-    const char *cu_end;
-};
-
 static int
-parse_debug_line_header(obj_info_t *obj, const char **pp, struct LineNumberProgramHeader *header, FILE *errout)
+parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
+		obj_info_t *obj, line_info_t *lines, int offset)
 {
-    const char *p = *pp;
-    header->unit_length = *(uint32_t *)p;
-    p += sizeof(uint32_t);
-
-    header->format = 4;
-    if (header->unit_length == 0xffffffff) {
-        header->unit_length = *(uint64_t *)p;
-        p += sizeof(uint64_t);
-        header->format = 8;
-    }
+    char *p, *cu_end, *cu_start, *include_directories, *filenames;
+    unsigned long unit_length;
+    int default_is_stmt, line_base;
+    unsigned int header_length, minimum_instruction_length, line_range,
+		 opcode_base;
+    /* unsigned char *standard_opcode_lengths; */
 
-    header->cu_end = p + header->unit_length;
+    /* The registers. */
+    unsigned long addr = 0;
+    unsigned int file = 1;
+    unsigned int line = 1;
+    /* unsigned int column = 0; */
+    int is_stmt;
+    /* int basic_block = 0; */
+    /* int end_sequence = 0; */
+    /* int prologue_end = 0; */
+    /* int epilogue_begin = 0; */
+    /* unsigned int isa = 0; */
 
-    header->version = *(uint16_t *)p;
-    p += sizeof(uint16_t);
-    if (header->version > 5) return -1;
+    p = *debug_line;
 
-    if (header->version >= 5) {
-        /* address_size = *(uint8_t *)p++; */
-        /* segment_selector_size = *(uint8_t *)p++; */
-        p += 2;
+    unit_length = *(unsigned int *)p;
+    p += sizeof(unsigned int);
+    if (unit_length == 0xffffffff) {
+	unit_length = *(unsigned long *)p;
+	p += sizeof(unsigned long);
     }
 
-    header->header_length = header->format == 4 ? *(uint32_t *)p : *(uint64_t *)p;
-    p += header->format;
-    header->cu_start = p + header->header_length;
+    cu_end = p + unit_length;
 
-    header->minimum_instruction_length = *(uint8_t *)p++;
+    /*dwarf_version = *(unsigned short *)p;*/
+    p += 2;
 
-    if (header->version >= 4) {
-        /* maximum_operations_per_instruction = *(uint8_t *)p; */
-        if (*p != 1) return -1; /* For non-VLIW architectures, this field is 1 */
-        p++;
-    }
+    header_length = *(unsigned int *)p;
+    p += sizeof(unsigned int);
 
-    header->default_is_stmt = *(uint8_t *)p++;
-    header->line_base = *(int8_t *)p++;
-    header->line_range = *(uint8_t *)p++;
-    header->opcode_base = *(uint8_t *)p++;
-    /* header->standard_opcode_lengths = (uint8_t *)p - 1; */
-    p += header->opcode_base - 1;
-
-    if (header->version >= 5) {
-        header->include_directories = p;
-        p = parse_ver5_debug_line_header(p, -1, header->format, obj, NULL, NULL, errout);
-        header->filenames = p;
-    }
-    else {
-        header->include_directories = p;
+    cu_start = p + header_length;
 
-        /* temporary measure for compress-debug-sections */
-        if (p >= header->cu_end) return -1;
+    minimum_instruction_length = *(unsigned char *)p;
+    p++;
 
-        /* skip include directories */
-        while (*p) {
-            p = memchr(p, '\0', header->cu_end - p);
-            if (!p) return -1;
-            p++;
-        }
-        p++;
+    is_stmt = default_is_stmt = *(unsigned char *)p;
+    p++;
 
-        header->filenames = p;
-    }
+    line_base = *(signed char *)p;
+    p++;
 
-    *pp = header->cu_start;
+    line_range = *(unsigned char *)p;
+    p++;
 
-    return 0;
-}
+    opcode_base = *(unsigned char *)p;
+    p++;
 
-static int
-parse_debug_line_cu(int num_traces, void **traces, const char **debug_line,
-                obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
-{
-    const char *p = (const char *)*debug_line;
-    struct LineNumberProgramHeader header;
+    /* standard_opcode_lengths = (unsigned char *)p - 1; */
+    p += opcode_base - 1;
 
-    /* The registers. */
-    unsigned long addr = 0;
-    unsigned int file = 1;
-    unsigned int line = 1;
-    /* unsigned int column = 0; */
-    int is_stmt;
-    /* int basic_block = 0; */
-    /* int end_sequence = 0; */
-    /* int prologue_end = 0; */
-    /* int epilogue_begin = 0; */
-    /* unsigned int isa = 0; */
+    include_directories = p;
 
-    if (parse_debug_line_header(obj, &p, &header, errout))
-        return -1;
-    is_stmt = header.default_is_stmt;
-
-#define FILL_LINE()                                                 \
-    do {                                                            \
-        fill_line(num_traces, traces, addr, file, line,             \
-                  header.format,                                    \
-                  header.version,                                   \
-                  header.include_directories,                       \
-                  header.filenames,                                 \
-                  obj, lines, offset, errout);                      \
-        /*basic_block = prologue_end = epilogue_begin = 0;*/        \
-    } while (0)
+    /* temporary measure for compress-debug-sections */
+    if (p >= cu_end) return -1;
 
-    while (p < header.cu_end) {
-        unsigned long a;
-        unsigned char op = *p++;
-        switch (op) {
-        case DW_LNS_copy:
-            FILL_LINE();
-            break;
-        case DW_LNS_advance_pc:
-            a = uleb128(&p) * header.minimum_instruction_length;
-            addr += a;
-            break;
-        case DW_LNS_advance_line: {
-            long a = sleb128(&p);
-            line += a;
-            break;
-        }
-        case DW_LNS_set_file:
-            file = (unsigned int)uleb128(&p);
-            break;
-        case DW_LNS_set_column:
-            /*column = (unsigned int)*/(void)uleb128(&p);
-            break;
-        case DW_LNS_negate_stmt:
-            is_stmt = !is_stmt;
-            break;
-        case DW_LNS_set_basic_block:
-            /*basic_block = 1; */
-            break;
-        case DW_LNS_const_add_pc:
-            a = ((255UL - header.opcode_base) / header.line_range) *
-                header.minimum_instruction_length;
-            addr += a;
-            break;
-        case DW_LNS_fixed_advance_pc:
-            a = *(uint16_t *)p;
-            p += sizeof(uint16_t);
-            addr += a;
-            break;
-        case DW_LNS_set_prologue_end:
-            /* prologue_end = 1; */
-            break;
-        case DW_LNS_set_epilogue_begin:
-            /* epilogue_begin = 1; */
-            break;
-        case DW_LNS_set_isa:
-            /* isa = (unsigned int)*/(void)uleb128(&p);
-            break;
-        case 0:
-            a = uleb128(&p);
-            op = *p++;
-            switch (op) {
-            case DW_LNE_end_sequence:
-                /* end_sequence = 1; */
-                FILL_LINE();
-                addr = 0;
-                file = 1;
-                line = 1;
-                /* column = 0; */
-                is_stmt = header.default_is_stmt;
-                /* end_sequence = 0; */
-                /* isa = 0; */
-                break;
-            case DW_LNE_set_address:
-                addr = *(unsigned long *)p;
-                p += sizeof(unsigned long);
-                break;
-            case DW_LNE_define_file:
-                kprintf("Unsupported operation in %s\n",
-                        binary_filename);
-                break;
-            case DW_LNE_set_discriminator:
-                /* TODO:currently ignore */
-                uleb128(&p);
-                break;
-            default:
-                kprintf("Unknown extended opcode: %d in %s\n",
-                        op, binary_filename);
-            }
-            break;
-        default: {
-            uint8_t adjusted_opcode = op - header.opcode_base;
-            uint8_t operation_advance = adjusted_opcode / header.line_range;
-            /* NOTE: this code doesn't support VLIW */
-            addr += operation_advance * header.minimum_instruction_length;
-            line += header.line_base + (adjusted_opcode % header.line_range);
-            FILL_LINE();
-        }
-        }
+    /* skip include directories */
+    while (*p) {
+	p = memchr(p, '\0', cu_end - p);
+	if (!p) return -1;
+	p++;
     }
-    *debug_line = (char *)p;
+    p++;
+
+    filenames = p;
+
+    p = cu_start;
+
+#define FILL_LINE()						    \
+    do {							    \
+	fill_line(num_traces, traces, addr, file, line,		    \
+		  include_directories, filenames,		    \
+		  obj, lines, offset);				    \
+	/*basic_block = prologue_end = epilogue_begin = 0;*/	    \
+    } while (0)
+
+    while (p < cu_end) {
+	unsigned long a;
+	unsigned char op = *p++;
+	switch (op) {
+	case DW_LNS_copy:
+	    FILL_LINE();
+	    break;
+	case DW_LNS_advance_pc:
+	    a = uleb128(&p);
+	    addr += a;
+	    break;
+	case DW_LNS_advance_line: {
+	    long a = sleb128(&p);
+	    line += a;
+	    break;
+	}
+	case DW_LNS_set_file:
+	    file = (unsigned int)uleb128(&p);
+	    break;
+	case DW_LNS_set_column:
+	    /*column = (unsigned int)*/(void)uleb128(&p);
+	    break;
+	case DW_LNS_negate_stmt:
+	    is_stmt = !is_stmt;
+	    break;
+	case DW_LNS_set_basic_block:
+	    /*basic_block = 1; */
+	    break;
+	case DW_LNS_const_add_pc:
+	    a = ((255 - opcode_base) / line_range) *
+		minimum_instruction_length;
+	    addr += a;
+	    break;
+	case DW_LNS_fixed_advance_pc:
+	    a = *(unsigned char *)p++;
+	    addr += a;
+	    break;
+	case DW_LNS_set_prologue_end:
+	    /* prologue_end = 1; */
+	    break;
+	case DW_LNS_set_epilogue_begin:
+	    /* epilogue_begin = 1; */
+	    break;
+	case DW_LNS_set_isa:
+	    /* isa = (unsigned int)*/(void)uleb128(&p);
+	    break;
+	case 0:
+	    a = *(unsigned char *)p++;
+	    op = *p++;
+	    switch (op) {
+	    case DW_LNE_end_sequence:
+		/* end_sequence = 1; */
+		FILL_LINE();
+		addr = 0;
+		file = 1;
+		line = 1;
+		/* column = 0; */
+		is_stmt = default_is_stmt;
+		/* end_sequence = 0; */
+		/* isa = 0; */
+		break;
+	    case DW_LNE_set_address:
+		addr = *(unsigned long *)p;
+		p += sizeof(unsigned long);
+		break;
+	    case DW_LNE_define_file:
+		kprintf("Unsupported operation in %s\n",
+			binary_filename);
+		break;
+	    case DW_LNE_set_discriminator:
+		/* TODO:currently ignore */
+		uleb128(&p);
+		break;
+	    default:
+		kprintf("Unknown extended opcode: %d in %s\n",
+			op, binary_filename);
+	    }
+	    break;
+	default: {
+	    unsigned long addr_incr;
+	    unsigned long line_incr;
+	    a = op - opcode_base;
+	    addr_incr = (a / line_range) * minimum_instruction_length;
+	    line_incr = line_base + (a % line_range);
+	    addr += (unsigned int)addr_incr;
+	    line += (unsigned int)line_incr;
+	    FILL_LINE();
+	}
+	}
+    }
+    *debug_line = p;
     return 0;
 }
 
 static int
 parse_debug_line(int num_traces, void **traces,
-                 const char *debug_line, unsigned long size,
-                 obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
+		 char *debug_line, unsigned long size,
+		 obj_info_t *obj, line_info_t *lines, int offset)
 {
-    const char *debug_line_end = debug_line + size;
+    char *debug_line_end = debug_line + size;
     while (debug_line < debug_line_end) {
-        if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset, errout))
-            return -1;
+	if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset))
+	    return -1;
     }
     if (debug_line != debug_line_end) {
-        kprintf("Unexpected size of .debug_line in %s\n",
-                binary_filename);
+	kprintf("Unexpected size of .debug_line in %s\n",
+		binary_filename);
     }
     return 0;
 }
@@ -572,7 +434,7 @@ parse_debug_line(int num_traces, void **traces,
 /* read file and fill lines */
 static uintptr_t
 fill_lines(int num_traces, void **traces, int check_debuglink,
-           obj_info_t **objp, line_info_t *lines, int offset, FILE *errout);
+	   obj_info_t **objp, line_info_t *lines, int offset);
 
 static void
 append_obj(obj_info_t **objp)
@@ -582,26 +444,13 @@ append_obj(obj_info_t **objp)
     *objp = newobj;
 }
 
-#ifdef USE_ELF
-/* Ideally we should check 4 paths to follow gnu_debuglink:
- *
- *   - /usr/lib/debug/.build-id/ab/cdef1234.debug
- *   - /usr/bin/ruby.debug
- *   - /usr/bin/.debug/ruby.debug
- *   - /usr/lib/debug/usr/bin/ruby.debug.
- *
- * but we handle only two cases for now as the two formats are
- * used by some linux distributions.
- *
- * See GDB's info for detail.
- * https://sourceware.org/gdb/onlinedocs/gdb/Separate-Debug-Files.html
- */
-
-// check the path pattern of "/usr/lib/debug/usr/bin/ruby.debug"
 static void
 follow_debuglink(const char *debuglink, int num_traces, void **traces,
-                 obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+		 obj_info_t **objp, line_info_t *lines, int offset)
 {
+    /* Ideally we should check 4 paths to follow gnu_debuglink,
+       but we handle only one case for now as this format is used
+       by some linux distributions. See GDB's info for detail. */
     static const char global_debug_dir[] = "/usr/lib/debug";
     const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
     char *p;
@@ -610,13 +459,13 @@ follow_debuglink(const char *debuglink, int num_traces, void **traces,
 
     p = strrchr(binary_filename, '/');
     if (!p) {
-        return;
+	return;
     }
     p[1] = '\0';
 
     len = strlen(binary_filename);
     if (len >= PATH_MAX - global_debug_dir_len)
-        len = PATH_MAX - global_debug_dir_len - 1;
+	len = PATH_MAX - global_debug_dir_len - 1;
     memmove(binary_filename + global_debug_dir_len, binary_filename, len);
     memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
     len += global_debug_dir_len;
@@ -626,1439 +475,20 @@ follow_debuglink(const char *debuglink, int num_traces, void **traces,
     o2 = *objp;
     o2->base_addr = o1->base_addr;
     o2->path = o1->path;
-    fill_lines(num_traces, traces, 0, objp, lines, offset, errout);
-}
-
-// check the path pattern of "/usr/lib/debug/.build-id/ab/cdef1234.debug"
-static void
-follow_debuglink_build_id(const char *build_id, size_t build_id_size, int num_traces, void **traces,
-                          obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
-{
-    static const char global_debug_dir[] = "/usr/lib/debug/.build-id/";
-    const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
-    char *p;
-    obj_info_t *o1 = *objp, *o2;
-    size_t i;
-
-    if (PATH_MAX < global_debug_dir_len + 1 + build_id_size * 2 + 6) return;
-
-    memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
-    p = binary_filename + global_debug_dir_len;
-    for (i = 0; i < build_id_size; i++) {
-        static const char tbl[] = "0123456789abcdef";
-        unsigned char n = build_id[i];
-        *p++ = tbl[n / 16];
-        *p++ = tbl[n % 16];
-        if (i == 0) *p++ = '/';
-    }
-    strcpy(p, ".debug");
-
-    append_obj(objp);
-    o2 = *objp;
-    o2->base_addr = o1->base_addr;
-    o2->path = o1->path;
-    fill_lines(num_traces, traces, 0, objp, lines, offset, errout);
-}
-#endif
-
-enum
-{
-    DW_TAG_compile_unit = 0x11,
-    DW_TAG_inlined_subroutine = 0x1d,
-    DW_TAG_subprogram = 0x2e,
-};
-
-/* Attributes encodings */
-enum
-{
-    DW_AT_sibling = 0x01,
-    DW_AT_location = 0x02,
-    DW_AT_name = 0x03,
-    /* Reserved 0x04 */
-    /* Reserved 0x05 */
-    /* Reserved 0x06 */
-    /* Reserved 0x07 */
-    /* Reserved 0x08 */
-    DW_AT_ordering = 0x09,
-    /* Reserved 0x0a */
-    DW_AT_byte_size = 0x0b,
-    /* Reserved 0x0c */
-    DW_AT_bit_size = 0x0d,
-    /* Reserved 0x0e */
-    /* Reserved 0x0f */
-    DW_AT_stmt_list = 0x10,
-    DW_AT_low_pc = 0x11,
-    DW_AT_high_pc = 0x12,
-    DW_AT_language = 0x13,
-    /* Reserved 0x14 */
-    DW_AT_discr = 0x15,
-    DW_AT_discr_value = 0x16,
-    DW_AT_visibility = 0x17,
-    DW_AT_import = 0x18,
-    DW_AT_string_length = 0x19,
-    DW_AT_common_reference = 0x1a,
-    DW_AT_comp_dir = 0x1b,
-    DW_AT_const_value = 0x1c,
-    DW_AT_containing_type = 0x1d,
-    DW_AT_default_value = 0x1e,
-    /* Reserved 0x1f */
-    DW_AT_inline = 0x20,
-    DW_AT_is_optional = 0x21,
-    DW_AT_lower_bound = 0x22,
-    /* Reserved 0x23 */
-    /* Reserved 0x24 */
-    DW_AT_producer = 0x25,
-    /* Reserved 0x26 */
-    DW_AT_prototyped = 0x27,
-    /* Reserved 0x28 */
-    /* Reserved 0x29 */
-    DW_AT_return_addr = 0x2a,
-    /* Reserved 0x2b */
-    DW_AT_start_scope = 0x2c,
-    /* Reserved 0x2d */
-    DW_AT_bit_stride = 0x2e,
-    DW_AT_upper_bound = 0x2f,
-    /* Reserved 0x30 */
-    DW_AT_abstract_origin = 0x31,
-    DW_AT_accessibility = 0x32,
-    DW_AT_address_class = 0x33,
-    DW_AT_artificial = 0x34,
-    DW_AT_base_types = 0x35,
-    DW_AT_calling_convention = 0x36,
-    DW_AT_count = 0x37,
-    DW_AT_data_member_location = 0x38,
-    DW_AT_decl_column = 0x39,
-    DW_AT_decl_file = 0x3a,
-    DW_AT_decl_line = 0x3b,
-    DW_AT_declaration = 0x3c,
-    DW_AT_discr_list = 0x3d,
-    DW_AT_encoding = 0x3e,
-    DW_AT_external = 0x3f,
-    DW_AT_frame_base = 0x40,
-    DW_AT_friend = 0x41,
-    DW_AT_identifier_case = 0x42,
-    /* Reserved 0x43 */
-    DW_AT_namelist_item = 0x44,
-    DW_AT_priority = 0x45,
-    DW_AT_segment = 0x46,
-    DW_AT_specification = 0x47,
-    DW_AT_static_link = 0x48,
-    DW_AT_type = 0x49,
-    DW_AT_use_location = 0x4a,
-    DW_AT_variable_parameter = 0x4b,
-    DW_AT_virtuality = 0x4c,
-    DW_AT_vtable_elem_location = 0x4d,
-    DW_AT_allocated = 0x4e,
-    DW_AT_associated = 0x4f,
-    DW_AT_data_location = 0x50,
-    DW_AT_byte_stride = 0x51,
-    DW_AT_entry_pc = 0x52,
-    DW_AT_use_UTF8 = 0x53,
-    DW_AT_extension = 0x54,
-    DW_AT_ranges = 0x55,
-    DW_AT_trampoline = 0x56,
-    DW_AT_call_column = 0x57,
-    DW_AT_call_file = 0x58,
-    DW_AT_call_line = 0x59,
-    DW_AT_description = 0x5a,
-    DW_AT_binary_scale = 0x5b,
-    DW_AT_decimal_scale = 0x5c,
-    DW_AT_small = 0x5d,
-    DW_AT_decimal_sign = 0x5e,
-    DW_AT_digit_count = 0x5f,
-    DW_AT_picture_string = 0x60,
-    DW_AT_mutable = 0x61,
-    DW_AT_threads_scaled = 0x62,
-    DW_AT_explicit = 0x63,
-    DW_AT_object_pointer = 0x64,
-    DW_AT_endianity = 0x65,
-    DW_AT_elemental = 0x66,
-    DW_AT_pure = 0x67,
-    DW_AT_recursive = 0x68,
-    DW_AT_signature = 0x69,
-    DW_AT_main_subprogram = 0x6a,
-    DW_AT_data_bit_offset = 0x6b,
-    DW_AT_const_expr = 0x6c,
-    DW_AT_enum_class = 0x6d,
-    DW_AT_linkage_name = 0x6e,
-    DW_AT_string_length_bit_size = 0x6f,
-    DW_AT_string_length_byte_size = 0x70,
-    DW_AT_rank = 0x71,
-    DW_AT_str_offsets_base = 0x72,
-    DW_AT_addr_base = 0x73,
-    DW_AT_rnglists_base = 0x74,
-    /* Reserved 0x75 */
-    DW_AT_dwo_name = 0x76,
-    DW_AT_reference = 0x77,
-    DW_AT_rvalue_reference = 0x78,
-    DW_AT_macros = 0x79,
-    DW_AT_call_all_calls = 0x7a,
-    DW_AT_call_all_source_calls = 0x7b,
-    DW_AT_call_all_tail_calls = 0x7c,
-    DW_AT_call_return_pc = 0x7d,
-    DW_AT_call_value = 0x7e,
-    DW_AT_call_origin = 0x7f,
-    DW_AT_call_parameter = 0x80,
-    DW_AT_call_pc = 0x81,
-    DW_AT_call_tail_call = 0x82,
-    DW_AT_call_target = 0x83,
-    DW_AT_call_target_clobbered = 0x84,
-    DW_AT_call_data_location = 0x85,
-    DW_AT_call_data_value = 0x86,
-    DW_AT_noreturn = 0x87,
-    DW_AT_alignment = 0x88,
-    DW_AT_export_symbols = 0x89,
-    DW_AT_deleted = 0x8a,
-    DW_AT_defaulted = 0x8b,
-    DW_AT_loclists_base = 0x8c,
-    DW_AT_lo_user = 0x2000,
-    DW_AT_hi_user = 0x3fff
-};
-
-/* Attribute form encodings */
-enum
-{
-    DW_FORM_addr = 0x01,
-    /* Reserved 0x02 */
-    DW_FORM_block2 = 0x03,
-    DW_FORM_block4 = 0x04,
-    DW_FORM_data2 = 0x05,
-    DW_FORM_data4 = 0x06,
-    DW_FORM_data8 = 0x07,
-    DW_FORM_string = 0x08,
-    DW_FORM_block = 0x09,
-    DW_FORM_block1 = 0x0a,
-    DW_FORM_data1 = 0x0b,
-    DW_FORM_flag = 0x0c,
-    DW_FORM_sdata = 0x0d,
-    DW_FORM_strp = 0x0e,
-    DW_FORM_udata = 0x0f,
-    DW_FORM_ref_addr = 0x10,
-    DW_FORM_ref1 = 0x11,
-    DW_FORM_ref2 = 0x12,
-    DW_FORM_ref4 = 0x13,
-    DW_FORM_ref8 = 0x14,
-    DW_FORM_ref_udata = 0x15,
-    DW_FORM_indirect = 0x16,
-    DW_FORM_sec_offset = 0x17,
-    DW_FORM_exprloc = 0x18,
-    DW_FORM_flag_present = 0x19,
-    DW_FORM_strx = 0x1a,
-    DW_FORM_addrx = 0x1b,
-    DW_FORM_ref_sup4 = 0x1c,
-    DW_FORM_strp_sup = 0x1d,
-    DW_FORM_data16 = 0x1e,
-    DW_FORM_line_strp = 0x1f,
-    DW_FORM_ref_sig8 = 0x20,
-    DW_FORM_implicit_const = 0x21,
-    DW_FORM_loclistx = 0x22,
-    DW_FORM_rnglistx = 0x23,
-    DW_FORM_ref_sup8 = 0x24,
-    DW_FORM_strx1 = 0x25,
-    DW_FORM_strx2 = 0x26,
-    DW_FORM_strx3 = 0x27,
-    DW_FORM_strx4 = 0x28,
-    DW_FORM_addrx1 = 0x29,
-    DW_FORM_addrx2 = 0x2a,
-    DW_FORM_addrx3 = 0x2b,
-    DW_FORM_addrx4 = 0x2c,
-
-    /* GNU extensions for referring to .gnu_debugaltlink dwz-compressed info */
-    DW_FORM_GNU_ref_alt = 0x1f20,
-    DW_FORM_GNU_strp_alt = 0x1f21
-};
-
-/* Range list entry encodings */
-enum {
-    DW_RLE_end_of_list = 0x00,
-    DW_RLE_base_addressx = 0x01,
-    DW_RLE_startx_endx = 0x02,
-    DW_RLE_startx_length = 0x03,
-    DW_RLE_offset_pair = 0x04,
-    DW_RLE_base_address = 0x05,
-    DW_RLE_start_end = 0x06,
-    DW_RLE_start_length = 0x07
-};
-
-enum {
-    VAL_none = 0,
-    VAL_cstr = 1,
-    VAL_data = 2,
-    VAL_uint = 3,
-    VAL_int = 4,
-    VAL_addr = 5
-};
-
-# define ABBREV_TABLE_SIZE 256
-typedef struct {
-    obj_info_t *obj;
-    const char *file;
-    uint8_t current_version;
-    const char *current_cu;
-    uint64_t current_low_pc;
-    uint64_t current_str_offsets_base;
-    uint64_t current_addr_base;
-    uint64_t current_rnglists_base;
-    const char *debug_line_cu_end;
-    uint8_t debug_line_format;
-    uint16_t debug_line_version;
-    const char *debug_line_files;
-    const char *debug_line_directories;
-    const char *p;
-    const char *cu_end;
-    const char *pend;
-    const char *q0;
-    const char *q;
-    int format; // 4 or 8
-    uint8_t address_size;
-    int level;
-    const char *abbrev_table[ABBREV_TABLE_SIZE];
-} DebugInfoReader;
-
-typedef struct {
-    ptrdiff_t pos;
-    int tag;
-    int has_children;
-} DIE;
-
-typedef struct {
-    union {
-        const char *ptr;
-        uint64_t uint64;
-        int64_t int64;
-        uint64_t addr_idx;
-    } as;
-    uint64_t off;
-    uint64_t at;
-    uint64_t form;
-    size_t size;
-    int type;
-} DebugInfoValue;
-
-#if defined(WORDS_BIGENDIAN)
-#define MERGE_2INTS(a,b,sz) (((uint64_t)(a)<<sz)|(b))
-#else
-#define MERGE_2INTS(a,b,sz) (((uint64_t)(b)<<sz)|(a))
-#endif
-
-static uint16_t
-get_uint16(const uint8_t *p)
-{
-    return (uint16_t)MERGE_2INTS(p[0],p[1],8);
-}
-
-static uint32_t
-get_uint32(const uint8_t *p)
-{
-    return (uint32_t)MERGE_2INTS(get_uint16(p),get_uint16(p+2),16);
-}
-
-static uint64_t
-get_uint64(const uint8_t *p)
-{
-    return MERGE_2INTS(get_uint32(p),get_uint32(p+4),32);
-}
-
-static uint8_t
-read_uint8(const char **ptr)
-{
-    const char *p = *ptr;
-    *ptr = (p + 1);
-    return (uint8_t)*p;
-}
-
-static uint16_t
-read_uint16(const char **ptr)
-{
-    const char *p = *ptr;
-    *ptr = (p + 2);
-    return get_uint16((const uint8_t *)p);
-}
-
-static uint32_t
-read_uint24(const char **ptr)
-{
-    const char *p = *ptr;
-    *ptr = (p + 3);
-    return ((uint8_t)*p << 16) | get_uint16((const uint8_t *)p+1);
-}
-
-static uint32_t
-read_uint32(const char **ptr)
-{
-    const char *p = *ptr;
-    *ptr = (p + 4);
-    return get_uint32((const uint8_t *)p);
-}
-
-static uint64_t
-read_uint64(const char **ptr)
-{
-    const unsigned char *p = (const unsigned char *)*ptr;
-    *ptr = (char *)(p + 8);
-    return get_uint64(p);
-}
-
-static uintptr_t
-read_uintptr(const char **ptr)
-{
-    const unsigned char *p = (const unsigned char *)*ptr;
-    *ptr = (char *)(p + SIZEOF_VOIDP);
-#if SIZEOF_VOIDP == 8
-    return get_uint64(p);
-#else
-    return get_uint32(p);
-#endif
-}
-
-static uint64_t
-read_uint(DebugInfoReader *reader)
-{
-    if (reader->format == 4) {
-        return read_uint32(&reader->p);
-    } else { /* 64 bit */
-        return read_uint64(&reader->p);
-    }
-}
-
-static uint64_t
-read_uleb128(DebugInfoReader *reader)
-{
-    return uleb128(&reader->p);
-}
-
-static int64_t
-read_sleb128(DebugInfoReader *reader)
-{
-    return sleb128(&reader->p);
-}
-
-static void
-debug_info_reader_init(DebugInfoReader *reader, obj_info_t *obj)
-{
-    reader->file = obj->mapped;
-    reader->obj = obj;
-    reader->p = obj->debug_info.ptr;
-    reader->pend = obj->debug_info.ptr + obj->debug_info.size;
-    reader->debug_line_cu_end = obj->debug_line.ptr;
-    reader->current_low_pc = 0;
-    reader->current_str_offsets_base = 0;
-    reader->current_addr_base = 0;
-    reader->current_rnglists_base = 0;
-}
-
-static void
-di_skip_die_attributes(const char **p)
-{
-    for (;;) {
-        uint64_t at = uleb128(p);
-        uint64_t form = uleb128(p);
-        if (!at && !form) break;
-        switch (form) {
-          default:
-            break;
-          case DW_FORM_implicit_const:
-            sleb128(p);
-            break;
-        }
-    }
-}
-
-static void
-di_read_debug_abbrev_cu(DebugInfoReader *reader)
-{
-    uint64_t prev = 0;
-    const char *p = reader->q0;
-    for (;;) {
-        uint64_t abbrev_number = uleb128(&p);
-        if (abbrev_number <= prev) break;
-        if (abbrev_number < ABBREV_TABLE_SIZE) {
-            reader->abbrev_table[abbrev_number] = p;
-        }
-        prev = abbrev_number;
-        uleb128(&p); /* tag */
-        p++; /* has_children */
-        di_skip_die_attributes(&p);
-    }
-}
-
-static int
-di_read_debug_line_cu(DebugInfoReader *reader, FILE *errout)
-{
-    const char *p;
-    struct LineNumberProgramHeader header;
-
-    p = (const char *)reader->debug_line_cu_end;
-    if (parse_debug_line_header(reader->obj, &p, &header, errout))
-        return -1;
-
-    reader->debug_line_cu_end = (char *)header.cu_end;
-    reader->debug_line_format = header.format;
-    reader->debug_line_version = header.version;
-    reader->debug_line_directories = (char *)header.include_directories;
-    reader->debug_line_files = (char *)header.filenames;
-
-    return 0;
-}
-
-static void
-set_addr_idx_value(DebugInfoValue *v, uint64_t n)
-{
-    v->as.addr_idx = n;
-    v->type = VAL_addr;
-}
-
-static void
-set_uint_value(DebugInfoValue *v, uint64_t n)
-{
-    v->as.uint64 = n;
-    v->type = VAL_uint;
-}
-
-static void
-set_int_value(DebugInfoValue *v, int64_t n)
-{
-    v->as.int64 = n;
-    v->type = VAL_int;
-}
-
-static void
-set_cstr_value(DebugInfoValue *v, const char *s)
-{
-    v->as.ptr = s;
-    v->off = 0;
-    v->type = VAL_cstr;
-}
-
-static void
-set_cstrp_value(DebugInfoValue *v, const char *s, uint64_t off)
-{
-    v->as.ptr = s;
-    v->off = off;
-    v->type = VAL_cstr;
-}
-
-static void
-set_data_value(DebugInfoValue *v, const char *s)
-{
-    v->as.ptr = s;
-    v->type = VAL_data;
-}
-
-static const char *
-get_cstr_value(DebugInfoValue *v)
-{
-    if (v->as.ptr) {
-        return v->as.ptr + v->off;
-    } else {
-        return NULL;
-    }
-}
-
-static const char *
-resolve_strx(DebugInfoReader *reader, uint64_t idx)
-{
-    const char *p = reader->obj->debug_str_offsets.ptr + reader->current_str_offsets_base;
-    uint64_t off;
-    if (reader->format == 4) {
-        off = ((uint32_t *)p)[idx];
-    }
-    else {
-        off = ((uint64_t *)p)[idx];
-    }
-    return reader->obj->debug_str.ptr + off;
-}
-
-static bool
-debug_info_reader_read_addr_value_member(DebugInfoReader *reader, DebugInfoValue *v, int size)
-{
-    if (size == 4) {
-        set_uint_value(v, read_uint32(&reader->p));
-    } else if (size == 8) {
-        set_uint_value(v, read_uint64(&reader->p));
-    } else {
-        return false;
-    }
-    return true;
-}
-
-#define debug_info_reader_read_addr_value(reader, v, mem) \
-    if (!debug_info_reader_read_addr_value_member((reader), (v), (reader)->mem)) { \
-        kprintf("unknown " #mem ":%d", (reader)->mem); \
-        return false; \
-    }
-
-
-static bool
-debug_info_reader_read_value(DebugInfoReader *reader, uint64_t form, DebugInfoValue *v, FILE *errout)
-{
-    switch (form) {
-      case DW_FORM_addr:
-        debug_info_reader_read_addr_value(reader, v, address_size);
-        break;
-      case DW_FORM_block2:
-        v->size = read_uint16(&reader->p);
-        set_data_value(v, reader->p);
-        reader->p += v->size;
-        break;
-      case DW_FORM_block4:
-        v->size = read_uint32(&reader->p);
-        set_data_value(v, reader->p);
-        reader->p += v->size;
-        break;
-      case DW_FORM_data2:
-        set_uint_value(v, read_uint16(&reader->p));
-        break;
-      case DW_FORM_data4:
-        set_uint_value(v, read_uint32(&reader->p));
-        break;
-      case DW_FORM_data8:
-        set_uint_value(v, read_uint64(&reader->p));
-        break;
-      case DW_FORM_string:
-        v->size = strlen(reader->p);
-        set_cstr_value(v, reader->p);
-        reader->p += v->size + 1;
-        break;
-      case DW_FORM_block:
-        v->size = uleb128(&reader->p);
-        set_data_value(v, reader->p);
-        reader->p += v->size;
-        break;
-      case DW_FORM_block1:
-        v->size = read_uint8(&reader->p);
-        set_data_value(v, reader->p);
-        reader->p += v->size;
-        break;
-      case DW_FORM_data1:
-        set_uint_value(v, read_uint8(&reader->p));
-        break;
-      case DW_FORM_flag:
-        set_uint_value(v, read_uint8(&reader->p));
-        break;
-      case DW_FORM_sdata:
-        set_int_value(v, read_sleb128(reader));
-        break;
-      case DW_FORM_strp:
-        set_cstrp_value(v, reader->obj->debug_str.ptr, read_uint(reader));
-        break;
-      case DW_FORM_udata:
-        set_uint_value(v, read_uleb128(reader));
-        break;
-      case DW_FORM_ref_addr:
-        if (reader->current_version <= 2) {
-            // DWARF Version 2 specifies that references have
-            // the same size as an address on the target system
-            debug_info_reader_read_addr_value(reader, v, address_size);
-        } else {
-            debug_info_reader_read_addr_value(reader, v, format);
-        }
-        break;
-      case DW_FORM_ref1:
-        set_uint_value(v, read_uint8(&reader->p));
-        break;
-      case DW_FORM_ref2:
-        set_uint_value(v, read_uint16(&reader->p));
-        break;
-      case DW_FORM_ref4:
-        set_uint_value(v, read_uint32(&reader->p));
-        break;
-      case DW_FORM_ref8:
-        set_uint_value(v, read_uint64(&reader->p));
-        break;
-      case DW_FORM_ref_udata:
-        set_uint_value(v, uleb128(&reader->p));
-        break;
-      case DW_FORM_indirect:
-        /* TODO: read the referred value */
-        set_uint_value(v, uleb128(&reader->p));
-        break;
-      case DW_FORM_sec_offset:
-        set_uint_value(v, read_uint(reader)); /* offset */
-        /* addrptr: debug_addr */
-        /* lineptr: debug_line */
-        /* loclist: debug_loclists */
-        /* loclistptr: debug_loclists */
-        /* macptr: debug_macro */
-        /* rnglist: debug_rnglists */
-        /* rnglistptr: debug_rnglists */
-        /* stroffsetsptr: debug_str_offsets */
-        break;
-      case DW_FORM_exprloc:
-        v->size = (size_t)read_uleb128(reader);
-        set_data_value(v, reader->p);
-        reader->p += v->size;
-        break;
-      case DW_FORM_flag_present:
-        set_uint_value(v, 1);
-        break;
-      case DW_FORM_strx:
-        set_cstr_value(v, resolve_strx(reader, uleb128(&reader->p)));
-        break;
-      case DW_FORM_addrx:
-        set_addr_idx_value(v, uleb128(&reader->p));
-        break;
-      case DW_FORM_ref_sup4:
-        set_uint_value(v, read_uint32(&reader->p));
-        break;
-      case DW_FORM_strp_sup:
-        set_uint_value(v, read_uint(reader));
-        /* *p = reader->sup_file + reader->sup_str->sh_offset + ret; */
-        break;
-      case DW_FORM_data16:
-        v->size = 16;
-        set_data_value(v, reader->p);
-        reader->p += v->size;
-        break;
-      case DW_FORM_line_strp:
-        set_cstrp_value(v, reader->obj->debug_line_str.ptr, read_uint(reader));
-        break;
-      case DW_FORM_ref_sig8:
-        set_uint_value(v, read_uint64(&reader->p));
-        break;
-      case DW_FORM_implicit_const:
-        set_int_value(v, sleb128(&reader->q));
-        break;
-      case DW_FORM_loclistx:
-        set_uint_value(v, read_uleb128(reader));
-        break;
-      case DW_FORM_rnglistx:
-        set_uint_value(v, read_uleb128(reader));
-        break;
-      case DW_FORM_ref_sup8:
-        set_uint_value(v, read_uint64(&reader->p));
-        break;
-      case DW_FORM_strx1:
-        set_cstr_value(v, resolve_strx(reader, read_uint8(&reader->p)));
-        break;
-      case DW_FORM_strx2:
-        set_cstr_value(v, resolve_strx(reader, read_uint16(&reader->p)));
-        break;
-      case DW_FORM_strx3:
-        set_cstr_value(v, resolve_strx(reader, read_uint24(&reader->p)));
-        break;
-      case DW_FORM_strx4:
-        set_cstr_value(v, resolve_strx(reader, read_uint32(&reader->p)));
-        break;
-      case DW_FORM_addrx1:
-        set_addr_idx_value(v, read_uint8(&reader->p));
-        break;
-      case DW_FORM_addrx2:
-        set_addr_idx_value(v, read_uint16(&reader->p));
-        break;
-      case DW_FORM_addrx3:
-        set_addr_idx_value(v, read_uint24(&reader->p));
-        break;
-      case DW_FORM_addrx4:
-        set_addr_idx_value(v, read_uint32(&reader->p));
-        break;
-      /* we have no support for actually reading the real values of these refs out
-       * of the .gnu_debugaltlink dwz-compressed debuginfo at the moment, but "read"
-       * them anyway so that we advance the reader by the right amount. */
-      case DW_FORM_GNU_ref_alt:
-      case DW_FORM_GNU_strp_alt:
-        read_uint(reader);
-        set_uint_value(v, 0);
-        break;
-      case 0:
-        goto fail;
-        break;
-    }
-    return true;
-
-  fail:
-    kprintf("%d: unsupported form: %#"PRIx64"\n", __LINE__, form);
-    return false;
-}
-
-/* find abbrev in current compilation unit */
-static const char *
-di_find_abbrev(DebugInfoReader *reader, uint64_t abbrev_number, FILE *errout)
-{
-    const char *p;
-    if (abbrev_number < ABBREV_TABLE_SIZE) {
-        return reader->abbrev_table[abbrev_number];
-    }
-    p = reader->abbrev_table[ABBREV_TABLE_SIZE-1];
-    /* skip 255th record */
-    uleb128(&p); /* tag */
-    p++; /* has_children */
-    di_skip_die_attributes(&p);
-    for (uint64_t n = uleb128(&p); abbrev_number != n; n = uleb128(&p)) {
-        if (n == 0) {
-            kprintf("%d: Abbrev Number %"PRId64" not found\n",__LINE__, abbrev_number);
-            return NULL;
-        }
-        uleb128(&p); /* tag */
-        p++; /* has_children */
-        di_skip_die_attributes(&p);
-    }
-    return p;
-}
-
-#if 0
-static void
-hexdump0(const unsigned char *p, size_t n, FILE *errout)
-{
-    size_t i;
-    kprintf("     0  1  2  3  4  5  6  7  8  9  A  B  C  D  E  F\n");
-    for (i=0; i < n; i++){
-        switch (i & 15) {
-          case 0:
-            kprintf("%02" PRIdSIZE ": %02X ", i/16, p[i]);
-            break;
-          case 15:
-            kprintf("%02X\n", p[i]);
-            break;
-          default:
-            kprintf("%02X ", p[i]);
-            break;
-        }
-    }
-    if ((i & 15) != 15) {
-        kprintf("\n");
-    }
-}
-#define hexdump(p,n,e) hexdump0((const unsigned char *)p, n, e)
-
-static void
-div_inspect(DebugInfoValue *v, FILE *errout)
-{
-    switch (v->type) {
-      case VAL_uint:
-        kprintf("%d: type:%d size:%" PRIxSIZE " v:%"PRIx64"\n",__LINE__,v->type,v->size,v->as.uint64);
-        break;
-      case VAL_int:
-        kprintf("%d: type:%d size:%" PRIxSIZE " v:%"PRId64"\n",__LINE__,v->type,v->size,(int64_t)v->as.uint64);
-        break;
-      case VAL_cstr:
-        kprintf("%d: type:%d size:%" PRIxSIZE " v:'%s'\n",__LINE__,v->type,v->size,v->as.ptr);
-        break;
-      case VAL_data:
-        kprintf("%d: type:%d size:%" PRIxSIZE " v:\n",__LINE__,v->type,v->size);
-        hexdump(v->as.ptr, 16, errout);
-        break;
-    }
-}
-#endif
-
-static DIE *
-di_read_die(DebugInfoReader *reader, DIE *die, FILE *errout)
-{
-    uint64_t abbrev_number = uleb128(&reader->p);
-    if (abbrev_number == 0) {
-        reader->level--;
-        return NULL;
-    }
-
-    if (!(reader->q = di_find_abbrev(reader, abbrev_number, errout))) return NULL;
-
-    die->pos = reader->p - reader->obj->debug_info.ptr - 1;
-    die->tag = (int)uleb128(&reader->q); /* tag */
-    die->has_children = *reader->q++; /* has_children */
-    if (die->has_children) {
-        reader->level++;
-    }
-    return die;
-}
-
-static DebugInfoValue *
-di_read_record(DebugInfoReader *reader, DebugInfoValue *vp, FILE *errout)
-{
-    uint64_t at = uleb128(&reader->q);
-    uint64_t form = uleb128(&reader->q);
-    if (!at || !form) return NULL;
-    vp->at = at;
-    vp->form = form;
-    if (!debug_info_reader_read_value(reader, form, vp, errout)) return NULL;
-    return vp;
-}
-
-static bool
-di_skip_records(DebugInfoReader *reader, FILE *errout)
-{
-    for (;;) {
-        DebugInfoValue v = {{0}};
-        uint64_t at = uleb128(&reader->q);
-        uint64_t form = uleb128(&reader->q);
-        if (!at || !form) return true;
-        if (!debug_info_reader_read_value(reader, form, &v, errout)) return false;
-    }
-}
-
-typedef struct addr_header {
-    const char *ptr;
-    uint64_t unit_length;
-    uint8_t format;
-    uint8_t address_size;
-    /* uint8_t segment_selector_size; */
-} addr_header_t;
-
-static bool
-addr_header_init(obj_info_t *obj, addr_header_t *header, FILE *errout)
-{
-    const char *p = obj->debug_addr.ptr;
-
-    header->ptr = p;
-
-    if (!p) return true;
-
-    header->unit_length = *(uint32_t *)p;
-    p += sizeof(uint32_t);
-
-    header->format = 4;
-    if (header->unit_length == 0xffffffff) {
-        header->unit_length = *(uint64_t *)p;
-        p += sizeof(uint64_t);
-        header->format = 8;
-    }
-
-    p += 2; /* version */
-    header->address_size = *p++;
-    if (header->address_size != 4 && header->address_size != 8) {
-        kprintf("unknown address_size:%d", header->address_size);
-        return false;
-    }
-    p++; /* segment_selector_size */
-    return true;
-}
-
-static uint64_t
-read_addr(addr_header_t *header, uint64_t addr_base, uint64_t idx) {
-    if (header->address_size == 4) {
-        return ((uint32_t*)(header->ptr + addr_base))[idx];
-    }
-    else {
-        return ((uint64_t*)(header->ptr + addr_base))[idx];
-    }
-}
-
-typedef struct rnglists_header {
-    uint64_t unit_length;
-    uint8_t format;
-    uint8_t address_size;
-    uint32_t offset_entry_count;
-} rnglists_header_t;
-
-static bool
-rnglists_header_init(obj_info_t *obj, rnglists_header_t *header, FILE *errout)
-{
-    const char *p = obj->debug_rnglists.ptr;
-
-    if (!p) return true;
-
-    header->unit_length = *(uint32_t *)p;
-    p += sizeof(uint32_t);
-
-    header->format = 4;
-    if (header->unit_length == 0xffffffff) {
-        header->unit_length = *(uint64_t *)p;
-        p += sizeof(uint64_t);
-        header->format = 8;
-    }
-
-    p += 2; /* version */
-    header->address_size = *p++;
-    if (header->address_size != 4 && header->address_size != 8) {
-        kprintf("unknown address_size:%d", header->address_size);
-        return false;
-    }
-    p++; /* segment_selector_size */
-    header->offset_entry_count = *(uint32_t *)p;
-    return true;
-}
-
-typedef struct {
-    uint64_t low_pc;
-    uint64_t high_pc;
-    uint64_t ranges;
-    bool low_pc_set;
-    bool high_pc_set;
-    bool ranges_set;
-} ranges_t;
-
-static void
-ranges_set(ranges_t *ptr, DebugInfoValue *v, addr_header_t *addr_header, uint64_t addr_base)
-{
-    uint64_t n = 0;
-    if (v->type == VAL_uint) {
-        n = v->as.uint64;
-    }
-    else if (v->type == VAL_addr) {
-        n = read_addr(addr_header, addr_base, v->as.addr_idx);
-    }
-    switch (v->at) {
-      case DW_AT_low_pc:
-        ptr->low_pc = n;
-        ptr->low_pc_set = true;
-        break;
-      case DW_AT_high_pc:
-        if (v->form == DW_FORM_addr) {
-            ptr->high_pc = n;
-        }
-        else {
-            ptr->high_pc = ptr->low_pc + n;
-        }
-        ptr->high_pc_set = true;
-        break;
-      case DW_AT_ranges:
-        ptr->ranges = n;
-        ptr->ranges_set = true;
-        break;
-    }
-}
-
-static uint64_t
-read_dw_form_addr(DebugInfoReader *reader, const char **ptr, FILE *errout)
-{
-    const char *p = *ptr;
-    *ptr = p + reader->address_size;
-    if (reader->address_size == 4) {
-        return read_uint32(&p);
-    } else {
-        return read_uint64(&p);
-    }
-}
-
-static uintptr_t
-ranges_include(DebugInfoReader *reader, ranges_t *ptr, uint64_t addr, rnglists_header_t *rnglists_header, FILE *errout)
-{
-    if (ptr->high_pc_set) {
-        if (ptr->ranges_set || !ptr->low_pc_set) {
-            return UINTPTR_MAX;
-        }
-        if (ptr->low_pc <= addr && addr <= ptr->high_pc) {
-            return (uintptr_t)ptr->low_pc;
-        }
-    }
-    else if (ptr->ranges_set) {
-        /* TODO: support base address selection entry */
-        const char *p;
-        uint64_t base = ptr->low_pc_set ? ptr->low_pc : reader->current_low_pc;
-        bool base_valid = true;
-        if (reader->current_version >= 5) {
-            if (rnglists_header->offset_entry_count == 0) {
-                // DW_FORM_sec_offset
-                p = reader->obj->debug_rnglists.ptr + ptr->ranges + reader->current_rnglists_base;
-            }
-            else {
-                // DW_FORM_rnglistx
-                const char *offset_array = reader->obj->debug_rnglists.ptr + reader->current_rnglists_base;
-                if (rnglists_header->format == 4) {
-                    p = offset_array + ((uint32_t *)offset_array)[ptr->ranges];
-                }
-                else {
-                    p = offset_array + ((uint64_t *)offset_array)[ptr->ranges];
-                }
-            }
-            for (;;) {
-                uint8_t rle = read_uint8(&p);
-                uintptr_t from = 0, to = 0;
-                if (rle == DW_RLE_end_of_list) break;
-                switch (rle) {
-                  case DW_RLE_base_addressx:
-                    uleb128(&p);
-                    base_valid = false; /* not supported yet */
-                    break;
-                  case DW_RLE_startx_endx:
-                    uleb128(&p);
-                    uleb128(&p);
-                    break;
-                  case DW_RLE_startx_length:
-                    uleb128(&p);
-                    uleb128(&p);
-                    break;
-                  case DW_RLE_offset_pair:
-                    if (!base_valid) break;
-                    from = (uintptr_t)base + uleb128(&p);
-                    to = (uintptr_t)base + uleb128(&p);
-                    break;
-                  case DW_RLE_base_address:
-                    base = read_dw_form_addr(reader, &p, errout);
-                    base_valid = true;
-                    break;
-                  case DW_RLE_start_end:
-                    from = (uintptr_t)read_dw_form_addr(reader, &p, errout);
-                    to = (uintptr_t)read_dw_form_addr(reader, &p, errout);
-                    break;
-                  case DW_RLE_start_length:
-                    from = (uintptr_t)read_dw_form_addr(reader, &p, errout);
-                    to = from + uleb128(&p);
-                    break;
-                }
-                if (from <= addr && addr < to) {
-                    return from;
-                }
-            }
-            return 0;
-        }
-        p = reader->obj->debug_ranges.ptr + ptr->ranges;
-        for (;;) {
-            uintptr_t from = read_uintptr(&p);
-            uintptr_t to = read_uintptr(&p);
-            if (!from && !to) break;
-            if (from == UINTPTR_MAX) {
-                /* base address selection entry */
-                base = to;
-            }
-            else if (base + from <= addr && addr < base + to) {
-                return (uintptr_t)base + from;
-            }
-        }
-    }
-    else if (ptr->low_pc_set) {
-        if (ptr->low_pc == addr) {
-            return (uintptr_t)ptr->low_pc;
-        }
-    }
-    return 0;
-}
-
-#if 0
-static void
-ranges_inspect(DebugInfoReader *reader, ranges_t *ptr, FILE *errout)
-{
-    if (ptr->high_pc_set) {
-        if (ptr->ranges_set || !ptr->low_pc_set) {
-            kprintf("low_pc_set:%d high_pc_set:%d ranges_set:%d\n",ptr->low_pc_set,ptr->high_pc_set,ptr->ranges_set);
-            return;
-        }
-        kprintf("low_pc:%"PRIx64" high_pc:%"PRIx64"\n",ptr->low_pc,ptr->high_pc);
-    }
-    else if (ptr->ranges_set) {
-        char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
-        kprintf("low_pc:%"PRIx64" ranges:%"PRIx64" %lx ",ptr->low_pc,ptr->ranges, p-reader->obj->mapped);
-        for (;;) {
-            uintptr_t from = read_uintptr(&p);
-            uintptr_t to = read_uintptr(&p);
-            if (!from && !to) break;
-            kprintf("%"PRIx64"-%"PRIx64" ",ptr->low_pc+from,ptr->low_pc+to);
-        }
-        kprintf("\n");
-    }
-    else if (ptr->low_pc_set) {
-        kprintf("low_pc:%"PRIx64"\n",ptr->low_pc);
-    }
-    else {
-        kprintf("empty\n");
-    }
-}
-#endif
-
-static int
-di_read_cu(DebugInfoReader *reader, FILE *errout)
-{
-    uint64_t unit_length;
-    uint16_t version;
-    uint64_t debug_abbrev_offset;
-    reader->format = 4;
-    reader->current_cu = reader->p;
-    unit_length = read_uint32(&reader->p);
-    if (unit_length == 0xffffffff) {
-        unit_length = read_uint64(&reader->p);
-        reader->format = 8;
-    }
-    reader->cu_end = reader->p + unit_length;
-    version = read_uint16(&reader->p);
-    reader->current_version = version;
-    if (version > 5) {
-        return -1;
-    }
-    else if (version == 5) {
-        /* unit_type = */ read_uint8(&reader->p);
-        reader->address_size = read_uint8(&reader->p);
-        debug_abbrev_offset = read_uint(reader);
-    }
-    else {
-        debug_abbrev_offset = read_uint(reader);
-        reader->address_size = read_uint8(&reader->p);
-    }
-    if (reader->address_size != 4 && reader->address_size != 8) {
-        kprintf("unknown address_size:%d", reader->address_size);
-        return -1;
-    }
-    reader->q0 = reader->obj->debug_abbrev.ptr + debug_abbrev_offset;
-
-    reader->level = 0;
-    di_read_debug_abbrev_cu(reader);
-    if (di_read_debug_line_cu(reader, errout)) return -1;
-
-    do {
-        DIE die;
-
-        if (!di_read_die(reader, &die, errout)) continue;
-
-        if (die.tag != DW_TAG_compile_unit) {
-            if (!di_skip_records(reader, errout)) return -1;
-            break;
-        }
-
-        reader->current_str_offsets_base = 0;
-        reader->current_addr_base = 0;
-        reader->current_rnglists_base = 0;
-
-        DebugInfoValue low_pc = {{0}};
-        /* enumerate abbrev */
-        for (;;) {
-            DebugInfoValue v = {{0}};
-            if (!di_read_record(reader, &v, errout)) break;
-            switch (v.at) {
-              case DW_AT_low_pc:
-                // clang may output DW_AT_addr_base after DW_AT_low_pc.
-                // We need to resolve the DW_FORM_addr* after DW_AT_addr_base is parsed.
-                low_pc = v;
-                break;
-              case DW_AT_str_offsets_base:
-                reader->current_str_offsets_base = v.as.uint64;
-                break;
-              case DW_AT_addr_base:
-                reader->current_addr_base = v.as.uint64;
-                break;
-              case DW_AT_rnglists_base:
-                reader->current_rnglists_base = v.as.uint64;
-                break;
-            }
-        }
-        // Resolve the DW_FORM_addr of DW_AT_low_pc
-        switch (low_pc.type) {
-            case VAL_uint:
-                reader->current_low_pc = low_pc.as.uint64;
-                break;
-            case VAL_addr:
-                {
-                    addr_header_t header = {0};
-                    if (!addr_header_init(reader->obj, &header, errout)) return -1;
-                    reader->current_low_pc = read_addr(&header, reader->current_addr_base, low_pc.as.addr_idx);
-                }
-                break;
-        }
-    } while (0);
-
-    return 0;
-}
-
-static void
-read_abstract_origin(DebugInfoReader *reader, uint64_t form, uint64_t abstract_origin, line_info_t *line, FILE *errout)
-{
-    const char *p = reader->p;
-    const char *q = reader->q;
-    int level = reader->level;
-    DIE die;
-
-    switch (form) {
-      case DW_FORM_ref1:
-      case DW_FORM_ref2:
-      case DW_FORM_ref4:
-      case DW_FORM_ref8:
-      case DW_FORM_ref_udata:
-        reader->p = reader->current_cu + abstract_origin;
-        break;
-      case DW_FORM_ref_addr:
-        goto finish; /* not supported yet */
-      case DW_FORM_ref_sig8:
-        goto finish; /* not supported yet */
-      case DW_FORM_ref_sup4:
-      case DW_FORM_ref_sup8:
-        goto finish; /* not supported yet */
-      default:
-        goto finish;
-    }
-    if (!di_read_die(reader, &die, errout)) goto finish;
-
-    /* enumerate abbrev */
-    for (;;) {
-        DebugInfoValue v = {{0}};
-        if (!di_read_record(reader, &v, errout)) break;
-        switch (v.at) {
-          case DW_AT_name:
-            line->sname = get_cstr_value(&v);
-            break;
-        }
-    }
-
-  finish:
-    reader->p = p;
-    reader->q = q;
-    reader->level = level;
-}
-
-static bool
-debug_info_read(DebugInfoReader *reader, int num_traces, void **traces,
-                line_info_t *lines, int offset, FILE *errout)
-{
-
-    addr_header_t addr_header = {0};
-    if (!addr_header_init(reader->obj, &addr_header, errout)) return false;
-
-    rnglists_header_t rnglists_header = {0};
-    if (!rnglists_header_init(reader->obj, &rnglists_header, errout)) return false;
-
-    while (reader->p < reader->cu_end) {
-        DIE die;
-        ranges_t ranges = {0};
-        line_info_t line = {0};
-
-        if (!di_read_die(reader, &die, errout)) continue;
-        /* kprintf("%d:%tx: <%d>\n",__LINE__,die.pos,reader->level,die.tag); */
-
-        if (die.tag != DW_TAG_subprogram && die.tag != DW_TAG_inlined_subroutine) {
-          skip_die:
-            if (!di_skip_records(reader, errout)) return false;
-            continue;
-        }
-
-        /* enumerate abbrev */
-        for (;;) {
-            DebugInfoValue v = {{0}};
-            /* ptrdiff_t pos = reader->p - reader->p0; */
-            if (!di_read_record(reader, &v, errout)) break;
-            /* kprintf("\n%d:%tx: AT:%lx FORM:%lx\n",__LINE__,pos,v.at,v.form); */
-            /* div_inspect(&v, errout); */
-            switch (v.at) {
-              case DW_AT_name:
-                line.sname = get_cstr_value(&v);
-                break;
-              case DW_AT_call_file:
-                fill_filename((int)v.as.uint64, reader->debug_line_format, reader->debug_line_version, reader->debug_line_directories, reader->debug_line_files, &line, reader->obj, errout);
-                break;
-              case DW_AT_call_line:
-                line.line = (int)v.as.uint64;
-                break;
-              case DW_AT_low_pc:
-              case DW_AT_high_pc:
-              case DW_AT_ranges:
-                ranges_set(&ranges, &v, &addr_header, reader->current_addr_base);
-                break;
-              case DW_AT_declaration:
-                goto skip_die;
-              case DW_AT_inline:
-                /* 1 or 3 */
-                break; /* goto skip_die; */
-              case DW_AT_abstract_origin:
-                read_abstract_origin(reader, v.form, v.as.uint64, &line, errout);
-                break; /* goto skip_die; */
-            }
-        }
-        /* ranges_inspect(reader, &ranges, errout); */
-        /* kprintf("%d:%tx: %x ",__LINE__,diepos,die.tag); */
-        for (int i=offset; i < num_traces; i++) {
-            uintptr_t addr = (uintptr_t)traces[i];
-            uintptr_t offset = addr - reader->obj->base_addr + reader->obj->vmaddr;
-            uintptr_t saddr = ranges_include(reader, &ranges, offset, &rnglists_header, errout);
-            if (saddr == UINTPTR_MAX) return false;
-            if (saddr) {
-                /* kprintf("%d:%tx: %d %lx->%lx %x %s: %s/%s %d %s %s %s\n",__LINE__,die.pos, i,addr,offset, die.tag,line.sname,line.dirname,line.filename,line.line,reader->obj->path,line.sname,lines[i].sname); */
-                if (lines[i].sname) {
-                    line_info_t *lp = malloc(sizeof(line_info_t));
-                    memcpy(lp, &lines[i], sizeof(line_info_t));
-                    lines[i].next = lp;
-                    lp->dirname = line.dirname;
-                    lp->filename = line.filename;
-                    lp->line = line.line;
-                    lp->saddr = 0;
-                }
-                lines[i].path = reader->obj->path;
-                lines[i].base_addr = line.base_addr;
-                lines[i].sname = line.sname;
-                lines[i].saddr = saddr + reader->obj->base_addr - reader->obj->vmaddr;
-            }
-        }
-    }
-    return true;
-}
-
-// This function parses the following attributes of Line Number Program Header in DWARF 5:
-//
-// * directory_entry_format_count
-// * directory_entry_format
-// * directories_count
-// * directories
-//
-// or
-//
-// * file_name_entry_format_count
-// * file_name_entry_format
-// * file_names_count
-// * file_names
-//
-// It records DW_LNCT_path and DW_LNCT_directory_index at the index "idx".
-static const char *
-parse_ver5_debug_line_header(const char *p, int idx, uint8_t format,
-                             obj_info_t *obj, const char **out_path,
-                             uint64_t *out_directory_index, FILE *errout)
-{
-    int i, j;
-    int entry_format_count = *(uint8_t *)p++;
-    const char *entry_format = p;
-
-    /* skip the part of entry_format */
-    for (i = 0; i < entry_format_count * 2; i++) uleb128(&p);
-
-    int entry_count = (int)uleb128(&p);
-
-    DebugInfoReader reader = {0};
-    debug_info_reader_init(&reader, obj);
-    reader.format = format;
-    reader.p = p;
-    for (j = 0; j < entry_count; j++) {
-        const char *format = entry_format;
-        for (i = 0; i < entry_format_count; i++) {
-            DebugInfoValue v = {{0}};
-            unsigned long dw_lnct = uleb128(&format);
-            unsigned long dw_form = uleb128(&format);
-            if (!debug_info_reader_read_value(&reader, dw_form, &v, errout)) return 0;
-            if (dw_lnct == 1 /* DW_LNCT_path */ && v.type == VAL_cstr && out_path)
-                *out_path = v.as.ptr + v.off;
-            if (dw_lnct == 2 /* DW_LNCT_directory_index */ && v.type == VAL_uint && out_directory_index)
-                *out_directory_index = v.as.uint64;
-        }
-        if (j == idx) return 0;
-    }
-
-    return reader.p;
-}
-
-#ifdef USE_ELF
-static unsigned long
-uncompress_debug_section(ElfW(Shdr) *shdr, char *file, char **ptr)
-{
-    *ptr = NULL;
-#ifdef SUPPORT_COMPRESSED_DEBUG_LINE
-    ElfW(Chdr) *chdr = (ElfW(Chdr) *)(file + shdr->sh_offset);
-    unsigned long destsize = chdr->ch_size;
-    int ret = 0;
-
-    if (chdr->ch_type != ELFCOMPRESS_ZLIB) {
-        /* unsupported compression type */
-        return 0;
-    }
-
-    *ptr = malloc(destsize);
-    if (!*ptr) return 0;
-    ret = uncompress((Bytef *)*ptr, &destsize,
-            (const Bytef*)chdr + sizeof(ElfW(Chdr)),
-            shdr->sh_size - sizeof(ElfW(Chdr)));
-    if (ret != Z_OK) goto fail;
-    return destsize;
-
-fail:
-    free(*ptr);
-    *ptr = NULL;
-#endif
-    return 0;
+    fill_lines(num_traces, traces, 0, objp, lines, offset);
 }
 
 /* read file and fill lines */
 static uintptr_t
 fill_lines(int num_traces, void **traces, int check_debuglink,
-           obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+	   obj_info_t **objp, line_info_t *lines, int offset)
 {
     int i, j;
     char *shstr;
+    char *section_name;
     ElfW(Ehdr) *ehdr;
     ElfW(Shdr) *shdr, *shstr_shdr;
-    ElfW(Shdr) *gnu_debuglink_shdr = NULL;
-    ElfW(Shdr) *note_gnu_build_id = NULL;
+    ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
     int fd;
     off_t filesize;
     char *file;
@@ -2066,44 +496,47 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
     ElfW(Shdr) *dynsym_shdr = NULL, *dynstr_shdr = NULL;
     obj_info_t *obj = *objp;
     uintptr_t dladdr_fbase = 0;
+    bool compressed_p = false;
 
     fd = open(binary_filename, O_RDONLY);
     if (fd < 0) {
-        goto fail;
+	goto fail;
     }
     filesize = lseek(fd, 0, SEEK_END);
     if (filesize < 0) {
-        int e = errno;
-        close(fd);
-        kprintf("lseek: %s\n", strerror(e));
-        goto fail;
+	int e = errno;
+	close(fd);
+	kprintf("lseek: %s\n", strerror(e));
+	goto fail;
     }
 #if SIZEOF_OFF_T > SIZEOF_SIZE_T
     if (filesize > (off_t)SIZE_MAX) {
-        close(fd);
-        kprintf("Too large file %s\n", binary_filename);
-        goto fail;
+	close(fd);
+	kprintf("Too large file %s\n", binary_filename);
+	goto fail;
     }
 #endif
     lseek(fd, 0, SEEK_SET);
     /* async-signal unsafe */
     file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
     if (file == MAP_FAILED) {
-        int e = errno;
-        close(fd);
-        kprintf("mmap: %s\n", strerror(e));
-        goto fail;
+	int e = errno;
+	close(fd);
+	kprintf("mmap: %s\n", strerror(e));
+	goto fail;
     }
-    close(fd);
 
     ehdr = (ElfW(Ehdr) *)file;
     if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
-        /*
-         * Huh? Maybe filename was overridden by setproctitle() and
-         * it match non-elf file.
-         */
-        goto fail;
+	/*
+	 * Huh? Maybe filename was overridden by setproctitle() and
+	 * it match non-elf file.
+	 */
+	close(fd);
+	goto fail;
     }
+
+    obj->fd = fd;
     obj->mapped = file;
     obj->mapped_size = (size_t)filesize;
 
@@ -2113,507 +546,157 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
     shstr = file + shstr_shdr->sh_offset;
 
     for (i = 0; i < ehdr->e_shnum; i++) {
-        char *section_name = shstr + shdr[i].sh_name;
-        switch (shdr[i].sh_type) {
-          case SHT_STRTAB:
-            if (!strcmp(section_name, ".strtab")) {
-                strtab_shdr = shdr + i;
-            }
-            else if (!strcmp(section_name, ".dynstr")) {
-                dynstr_shdr = shdr + i;
-            }
-            break;
-          case SHT_SYMTAB:
-            /* if (!strcmp(section_name, ".symtab")) */
-            symtab_shdr = shdr + i;
-            break;
-          case SHT_DYNSYM:
-            /* if (!strcmp(section_name, ".dynsym")) */
-            dynsym_shdr = shdr + i;
-            break;
-          case SHT_NOTE:
-            if (!strcmp(section_name, ".note.gnu.build-id")) {
-                note_gnu_build_id = shdr + i;
-            }
-            break;
-          case SHT_PROGBITS:
-            if (!strcmp(section_name, ".gnu_debuglink")) {
-                gnu_debuglink_shdr = shdr + i;
-            }
-            else {
-                const char *debug_section_names[] = {
-                    ".debug_abbrev",
-                    ".debug_info",
-                    ".debug_line",
-                    ".debug_ranges",
-                    ".debug_str_offsets",
-                    ".debug_addr",
-                    ".debug_rnglists",
-                    ".debug_str",
-                    ".debug_line_str"
-                };
-
-                for (j=0; j < DWARF_SECTION_COUNT; j++) {
-                    struct dwarf_section *s = obj_dwarf_section_at(obj, j);
-
-                    if (strcmp(section_name, debug_section_names[j]) != 0)
-                        continue;
-
-                    s->ptr = file + shdr[i].sh_offset;
-                    s->size = shdr[i].sh_size;
-                    s->flags = shdr[i].sh_flags;
-                    if (s->flags & SHF_COMPRESSED) {
-                        s->size = uncompress_debug_section(&shdr[i], file, &s->ptr);
-                        if (!s->size) goto fail;
-                    }
-                    break;
-                }
-            }
-            break;
-        }
+	section_name = shstr + shdr[i].sh_name;
+	switch (shdr[i].sh_type) {
+	  case SHT_STRTAB:
+	    if (!strcmp(section_name, ".strtab")) {
+		strtab_shdr = shdr + i;
+	    }
+	    else if (!strcmp(section_name, ".dynstr")) {
+		dynstr_shdr = shdr + i;
+	    }
+	    break;
+	  case SHT_SYMTAB:
+	    /* if (!strcmp(section_name, ".symtab")) */
+	    symtab_shdr = shdr + i;
+	    break;
+	  case SHT_DYNSYM:
+	    /* if (!strcmp(section_name, ".dynsym")) */
+	    dynsym_shdr = shdr + i;
+	    break;
+	  case SHT_PROGBITS:
+	    if (!strcmp(section_name, ".debug_line")) {
+		if (shdr[i].sh_flags & SHF_COMPRESSED) {
+		    compressed_p = true;
+		}
+		debug_line_shdr = shdr + i;
+	    }
+	    else if (!strcmp(section_name, ".gnu_debuglink")) {
+		gnu_debuglink_shdr = shdr + i;
+	    }
+	    break;
+	}
     }
 
     if (offset == -1) {
-        /* main executable */
-        offset = 0;
-        if (dynsym_shdr && dynstr_shdr) {
-            char *strtab = file + dynstr_shdr->sh_offset;
-            ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
-            int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
-            void *handle = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
-            if (handle) {
-                for (j = 0; j < symtab_count; j++) {
-                    ElfW(Sym) *sym = &symtab[j];
-                    Dl_info info;
-                    void *s;
-                    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size == 0) continue;
-                    s = dlsym(handle, strtab + sym->st_name);
-                    if (s && dladdr(s, &info)) {
-                        obj->base_addr = dladdr_fbase;
-                        dladdr_fbase = (uintptr_t)info.dli_fbase;
-                        break;
-                    }
-                }
-                dlclose(handle);
-            }
-            if (ehdr->e_type == ET_EXEC) {
-                obj->base_addr = 0;
-            }
-            else {
-                /* PIE (position-independent executable) */
-                obj->base_addr = dladdr_fbase;
-            }
-        }
-    }
-
-    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
-        DebugInfoReader reader;
-        debug_info_reader_init(&reader, obj);
-        i = 0;
-        while (reader.p < reader.pend) {
-            /* kprintf("%d:%tx: CU[%d]\n", __LINE__, reader.p - reader.obj->debug_info.ptr, i++); */
-            if (di_read_cu(&reader, errout)) goto use_symtab;
-            if (!debug_info_read(&reader, num_traces, traces, lines, offset, errout))
-                goto use_symtab;
-        }
-    }
-    else {
-        /* This file doesn't have dwarf, use symtab or dynsym */
-use_symtab:
-        if (!symtab_shdr) {
-            /* This file doesn't have symtab, use dynsym instead */
-            symtab_shdr = dynsym_shdr;
-            strtab_shdr = dynstr_shdr;
-        }
-
-        if (symtab_shdr && strtab_shdr) {
-            char *strtab = file + strtab_shdr->sh_offset;
-            ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
-            int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
-            for (j = 0; j < symtab_count; j++) {
-                ElfW(Sym) *sym = &symtab[j];
-                uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
-                if (ELF_ST_TYPE(sym->st_info) != STT_FUNC) continue;
-                for (i = offset; i < num_traces; i++) {
-                    uintptr_t d = (uintptr_t)traces[i] - saddr;
-                    if (lines[i].line > 0 || d > (uintptr_t)sym->st_size)
-                        continue;
-                    /* fill symbol name and addr from .symtab */
-                    if (!lines[i].sname) lines[i].sname = strtab + sym->st_name;
-                    lines[i].saddr = saddr;
-                    lines[i].path  = obj->path;
-                    lines[i].base_addr = obj->base_addr;
-                }
-            }
-        }
-    }
-
-    if (!obj->debug_line.ptr) {
-        /* This file doesn't have .debug_line section,
-           let's check .gnu_debuglink section instead. */
-        if (gnu_debuglink_shdr && check_debuglink) {
-            follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
-                             num_traces, traces,
-                             objp, lines, offset, errout);
-        }
-        if (note_gnu_build_id && check_debuglink) {
-            ElfW(Nhdr) *nhdr = (ElfW(Nhdr)*) (file + note_gnu_build_id->sh_offset);
-            const char *build_id = (char *)(nhdr + 1) + nhdr->n_namesz;
-            follow_debuglink_build_id(build_id, nhdr->n_descsz,
-                               num_traces, traces,
-                               objp, lines, offset, errout);
-        }
-        goto finish;
-    }
-
-    if (parse_debug_line(num_traces, traces,
-            obj->debug_line.ptr,
-            obj->debug_line.size,
-            obj, lines, offset, errout) == -1)
-        goto fail;
-
+	/* main executable */
+	offset = 0;
+	if (dynsym_shdr && dynstr_shdr) {
+	    char *strtab = file + dynstr_shdr->sh_offset;
+	    ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
+	    int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
+	    for (j = 0; j < symtab_count; j++) {
+		ElfW(Sym) *sym = &symtab[j];
+		Dl_info info;
+		void *h, *s;
+		if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
+		h = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+		if (!h) continue;
+		s = dlsym(h, strtab + sym->st_name);
+		if (!s) continue;
+		if (dladdr(s, &info)) {
+		    dladdr_fbase = (uintptr_t)info.dli_fbase;
+		    break;
+		}
+	    }
+	    if (ehdr->e_type == ET_EXEC) {
+		obj->base_addr = 0;
+	    }
+	    else {
+		/* PIE (position-independent executable) */
+		obj->base_addr = dladdr_fbase;
+	    }
+	}
+    }
+
+    if (!symtab_shdr) {
+	symtab_shdr = dynsym_shdr;
+	strtab_shdr = dynstr_shdr;
+    }
+
+    if (symtab_shdr && strtab_shdr) {
+	char *strtab = file + strtab_shdr->sh_offset;
+	ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+	int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+	for (j = 0; j < symtab_count; j++) {
+	    ElfW(Sym) *sym = &symtab[j];
+	    uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+	    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
+	    for (i = offset; i < num_traces; i++) {
+		uintptr_t d = (uintptr_t)traces[i] - saddr;
+		if (lines[i].line > 0 || d <= 0 || d > (uintptr_t)sym->st_size)
+		    continue;
+		/* fill symbol name and addr from .symtab */
+		lines[i].sname = strtab + sym->st_name;
+		lines[i].saddr = saddr;
+		lines[i].path  = obj->path;
+		lines[i].base_addr = obj->base_addr;
+	    }
+	}
+    }
+
+    if (!debug_line_shdr) {
+	/* This file doesn't have .debug_line section,
+	   let's check .gnu_debuglink section instead. */
+	if (gnu_debuglink_shdr && check_debuglink) {
+	    follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
+			     num_traces, traces,
+			     objp, lines, offset);
+	}
+	goto finish;
+    }
+
+    if (!compressed_p &&
+	    parse_debug_line(num_traces, traces,
+			 file + debug_line_shdr->sh_offset,
+			 debug_line_shdr->sh_size,
+			 obj, lines, offset))
+	goto fail;
 finish:
     return dladdr_fbase;
 fail:
     return (uintptr_t)-1;
 }
-#else /* Mach-O */
-/* read file and fill lines */
-static uintptr_t
-fill_lines(int num_traces, void **traces, int check_debuglink,
-        obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
-{
-# ifdef __LP64__
-#  define LP(x) x##_64
-# else
-#  define LP(x) x
-# endif
-    int fd;
-    off_t filesize;
-    char *file, *p = NULL;
-    obj_info_t *obj = *objp;
-    struct LP(mach_header) *header;
-    uintptr_t dladdr_fbase = 0;
-
-    {
-        char *s = binary_filename;
-        char *base = strrchr(binary_filename, '/')+1;
-        size_t max = PATH_MAX;
-        size_t size = strlen(binary_filename);
-        size_t basesize = size - (base - binary_filename);
-        s += size;
-        max -= size;
-        p = s;
-        size = strlcpy(s, ".dSYM/Contents/Resources/DWARF/", max);
-        if (size == 0) goto fail;
-        s += size;
-        max -= size;
-        if (max <= basesize) goto fail;
-        memcpy(s, base, basesize);
-        s[basesize] = 0;
-
-        fd = open(binary_filename, O_RDONLY);
-        if (fd < 0) {
-            *p = 0; /* binary_filename becomes original file name */
-            fd = open(binary_filename, O_RDONLY);
-            if (fd < 0) {
-                goto fail;
-            }
-        }
-    }
-
-    filesize = lseek(fd, 0, SEEK_END);
-    if (filesize < 0) {
-        int e = errno;
-        close(fd);
-        kprintf("lseek: %s\n", strerror(e));
-        goto fail;
-    }
-#if SIZEOF_OFF_T > SIZEOF_SIZE_T
-    if (filesize > (off_t)SIZE_MAX) {
-        close(fd);
-        kprintf("Too large file %s\n", binary_filename);
-        goto fail;
-    }
-#endif
-    lseek(fd, 0, SEEK_SET);
-    /* async-signal unsafe */
-    file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
-    if (file == MAP_FAILED) {
-        int e = errno;
-        close(fd);
-        kprintf("mmap: %s\n", strerror(e));
-        goto fail;
-    }
-    close(fd);
-
-    obj->mapped = file;
-    obj->mapped_size = (size_t)filesize;
-
-    header = (struct LP(mach_header) *)file;
-    if (header->magic == LP(MH_MAGIC)) {
-        /* non universal binary */
-        p = file;
-    }
-    else if (header->magic == FAT_CIGAM) {
-        struct LP(mach_header) *mhp = _NSGetMachExecuteHeader();
-        struct fat_header *fat = (struct fat_header *)file;
-        char *q = file + sizeof(*fat);
-        uint32_t nfat_arch = __builtin_bswap32(fat->nfat_arch);
-        /* kprintf("%d: fat:%s %d\n",__LINE__, binary_filename,nfat_arch); */
-        for (uint32_t i = 0; i < nfat_arch; i++) {
-            struct fat_arch *arch = (struct fat_arch *)q;
-            cpu_type_t cputype = __builtin_bswap32(arch->cputype);
-            cpu_subtype_t cpusubtype = __builtin_bswap32(arch->cpusubtype);
-            uint32_t offset = __builtin_bswap32(arch->offset);
-            /* kprintf("%d: fat %d %x/%x %x/%x\n",__LINE__, i, mhp->cputype,mhp->cpusubtype, cputype,cpusubtype); */
-            if (mhp->cputype == cputype &&
-                    (cpu_subtype_t)(mhp->cpusubtype & ~CPU_SUBTYPE_MASK) == cpusubtype) {
-                p = file + offset;
-                file = p;
-                header = (struct LP(mach_header) *)p;
-                if (header->magic == LP(MH_MAGIC)) {
-                    goto found_mach_header;
-                }
-                break;
-            }
-            q += sizeof(*arch);
-        }
-        kprintf("'%s' is not a Mach-O universal binary file!\n",binary_filename);
-        close(fd);
-        goto fail;
-    }
-    else {
-# ifdef __LP64__
-#   define bitsize "64"
-# else
-#   define bitsize "32"
-# endif
-        kprintf("'%s' is not a " bitsize
-                "-bit Mach-O file!\n",binary_filename);
-# undef bitsize
-        close(fd);
-        goto fail;
-    }
-found_mach_header:
-    p += sizeof(*header);
-
-    for (uint32_t i = 0; i < (uint32_t)header->ncmds; i++) {
-        struct load_command *lcmd = (struct load_command *)p;
-        switch (lcmd->cmd) {
-          case LP(LC_SEGMENT):
-            {
-                static const char *debug_section_names[] = {
-                    "__debug_abbrev",
-                    "__debug_info",
-                    "__debug_line",
-                    "__debug_ranges",
-                    "__debug_str_offsets",
-                    "__debug_addr",
-                    "__debug_rnglists",
-                    "__debug_str",
-                    "__debug_line_str",
-                };
-                struct LP(segment_command) *scmd = (struct LP(segment_command) *)lcmd;
-                if (strcmp(scmd->segname, "__TEXT") == 0) {
-                    obj->vmaddr = scmd->vmaddr;
-                }
-                else if (strcmp(scmd->segname, "__DWARF") == 0) {
-                    p += sizeof(struct LP(segment_command));
-                    for (uint64_t i = 0; i < scmd->nsects; i++) {
-                        struct LP(section) *sect = (struct LP(section) *)p;
-                        p += sizeof(struct LP(section));
-                        for (int j=0; j < DWARF_SECTION_COUNT; j++) {
-                            struct dwarf_section *s = obj_dwarf_section_at(obj, j);
-
-                            if (strcmp(sect->sectname, debug_section_names[j]) != 0
-#ifdef __APPLE__
-                                    /* macOS clang 16 generates DWARF5, which have Mach-O
-                                     * section names that are limited to 16 characters,
-                                     * which causes sections with long names to be truncated
-                                     * and not match above.
-                                     * See: https://wiki.dwarfstd.org/Best_Practices.md#Mach-2d-O
-                                     */
-                                    && strncmp(sect->sectname, debug_section_names[j], 16) != 0
-#endif
-                                )
-                                continue;
-
-                            s->ptr = file + sect->offset;
-                            s->size = sect->size;
-                            s->flags = sect->flags;
-                            if (s->flags & SHF_COMPRESSED) {
-                                goto fail;
-                            }
-                            break;
-                        }
-                    }
-                }
-            }
-            break;
-
-          case LC_SYMTAB:
-            {
-                struct symtab_command *cmd = (struct symtab_command *)lcmd;
-                struct LP(nlist) *nl = (struct LP(nlist) *)(file + cmd->symoff);
-                char *strtab = file + cmd->stroff, *sname = 0;
-                uint32_t j;
-                uintptr_t saddr = 0;
-                /* kprintf("[%2d]: %x/symtab %p\n", i, cmd->cmd, (void *)p); */
-                for (j = 0; j < cmd->nsyms; j++) {
-                    uintptr_t symsize, d;
-                    struct LP(nlist) *e = &nl[j];
-                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
-                    if (e->n_type != N_FUN) continue;
-                    if (e->n_sect) {
-                        saddr = (uintptr_t)e->n_value + obj->base_addr - obj->vmaddr;
-                        sname = strtab + e->n_un.n_strx;
-                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
-                        continue;
-                    }
-                    for (int k = offset; k < num_traces; k++) {
-                        d = (uintptr_t)traces[k] - saddr;
-                        symsize = e->n_value;
-                        /* kprintf("%lx %lx %lx\n",saddr,symsize,traces[k]); */
-                        if (lines[k].line > 0 || d > (uintptr_t)symsize)
-                            continue;
-                        /* fill symbol name and addr from .symtab */
-                        if (!lines[k].sname) lines[k].sname = sname;
-                        lines[k].saddr = saddr;
-                        lines[k].path  = obj->path;
-                        lines[k].base_addr = obj->base_addr;
-                    }
-                }
-            }
-        }
-        p += lcmd->cmdsize;
-    }
-
-    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
-        DebugInfoReader reader;
-        debug_info_reader_init(&reader, obj);
-        while (reader.p < reader.pend) {
-            if (di_read_cu(&reader, errout)) goto fail;
-            if (!debug_info_read(&reader, num_traces, traces, lines, offset, errout))
-                goto fail;
-        }
-    }
-
-    if (parse_debug_line(num_traces, traces,
-            obj->debug_line.ptr,
-            obj->debug_line.size,
-            obj, lines, offset, errout) == -1)
-        goto fail;
-
-    return dladdr_fbase;
-fail:
-    return (uintptr_t)-1;
-}
-#endif
 
 #define HAVE_MAIN_EXE_PATH
-#if defined(__FreeBSD__) || defined(__DragonFly__)
+#if defined(__FreeBSD__)
 # include <sys/sysctl.h>
 #endif
-/* ssize_t main_exe_path(FILE *errout)
+/* ssize_t main_exe_path(void)
  *
  * store the path of the main executable to `binary_filename`,
  * and returns strlen(binary_filename).
  * it is NUL terminated.
  */
-#if defined(__linux__) || defined(__NetBSD__)
+#if defined(__linux__)
 static ssize_t
-main_exe_path(FILE *errout)
+main_exe_path(void)
 {
-# if defined(__linux__)
-#  define PROC_SELF_EXE "/proc/self/exe"
-# elif defined(__NetBSD__)
-#  define PROC_SELF_EXE "/proc/curproc/exe"
-# endif
+# define PROC_SELF_EXE "/proc/self/exe"
     ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
-    if (len < 0) return 0;
     binary_filename[len] = 0;
     return len;
 }
-#elif defined(__FreeBSD__) || defined(__DragonFly__)
+#elif defined(__FreeBSD__)
 static ssize_t
-main_exe_path(FILE *errout)
+main_exe_path(void)
 {
     int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
     size_t len = PATH_MAX;
     int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
     if (err) {
-        kprintf("Can't get the path of ruby");
-        return -1;
+	kprintf("Can't get the path of ruby");
+	return -1;
     }
     len--; /* sysctl sets strlen+1 */
     return len;
 }
-#elif defined(HAVE_LIBPROC_H)
-static ssize_t
-main_exe_path(FILE *errout)
-{
-    int len = proc_pidpath(getpid(), binary_filename, PATH_MAX);
-    if (len == 0) return 0;
-    binary_filename[len] = 0;
-    return len;
-}
 #else
 #undef HAVE_MAIN_EXE_PATH
 #endif
 
-static void
-print_line0(line_info_t *line, void *address, FILE *errout)
-{
-    uintptr_t addr = (uintptr_t)address;
-    uintptr_t d = addr - line->saddr;
-    if (!address) {
-        /* inlined */
-        if (line->dirname && line->dirname[0]) {
-            kprintf("%s(%s) %s/%s:%d\n", line->path, line->sname, line->dirname, line->filename, line->line);
-        }
-        else {
-            kprintf("%s(%s) %s:%d\n", line->path, line->sname, line->filename, line->line);
-        }
-    }
-    else if (!line->path) {
-        kprintf("[0x%"PRIxPTR"]\n", addr);
-    }
-    else if (!line->sname) {
-        kprintf("%s(0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, addr-line->base_addr, addr);
-    }
-    else if (!line->saddr) {
-        kprintf("%s(%s) [0x%"PRIxPTR"]\n", line->path, line->sname, addr);
-    }
-    else if (line->line <= 0) {
-        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, line->sname,
-                d, addr);
-    }
-    else if (!line->filename) {
-        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] ???:%d\n", line->path, line->sname,
-                d, addr, line->line);
-    }
-    else if (line->dirname && line->dirname[0]) {
-        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s/%s:%d\n", line->path, line->sname,
-                d, addr, line->dirname, line->filename, line->line);
-    }
-    else {
-        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s:%d\n", line->path, line->sname,
-                d, addr, line->filename, line->line);
-    }
-}
-
-static void
-print_line(line_info_t *line, void *address, FILE *errout)
-{
-    print_line0(line, address, errout);
-    if (line->next) {
-        print_line(line->next, NULL, errout);
-    }
-}
-
 void
-rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout)
+rb_dump_backtrace_with_lines(int num_traces, void **traces)
 {
     int i;
     /* async-signal unsafe */
@@ -2621,99 +704,531 @@ rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout)
     obj_info_t *obj = NULL;
     /* 2 is NULL + main executable */
     void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
-
 #ifdef HAVE_MAIN_EXE_PATH
     char *main_path = NULL; /* used on printing backtrace */
     ssize_t len;
-    if ((len = main_exe_path(errout)) > 0) {
-        main_path = (char *)alloca(len + 1);
-        if (main_path) {
-            uintptr_t addr;
-            memcpy(main_path, binary_filename, len+1);
-            append_obj(&obj);
-            obj->path = main_path;
-            addr = fill_lines(num_traces, traces, 1, &obj, lines, 0, errout);
-            if (addr != (uintptr_t)-1) {
-                dladdr_fbases[0] = (void *)addr;
-            }
-        }
+    if ((len = main_exe_path()) > 0) {
+	main_path = (char *)alloca(len + 1);
+	if (main_path) {
+	    uintptr_t addr;
+	    memcpy(main_path, binary_filename, len+1);
+	    append_obj(&obj);
+	    obj->path = main_path;
+	    addr = fill_lines(num_traces, traces, 1, &obj, lines, -1);
+	    if (addr != (uintptr_t)-1) {
+		dladdr_fbases[0] = (void *)addr;
+	    }
+	}
     }
 #endif
 
     /* fill source lines by reading dwarf */
     for (i = 0; i < num_traces; i++) {
-        Dl_info info;
-        if (lines[i].line) continue;
-        if (dladdr(traces[i], &info)) {
-            const char *path;
-            void **p;
-
-            /* skip symbols which is in already checked objects */
-            /* if the binary is strip-ed, this may effect */
-            for (p=dladdr_fbases; *p; p++) {
-                if (*p == info.dli_fbase) {
-                    if (info.dli_fname) lines[i].path = info.dli_fname;
-                    if (info.dli_sname) lines[i].sname = info.dli_sname;
-                    goto next_line;
-                }
-            }
-            *p = info.dli_fbase;
-
-            append_obj(&obj);
-            obj->base_addr = (uintptr_t)info.dli_fbase;
-            path = info.dli_fname;
-            obj->path = path;
-            if (path) lines[i].path = path;
-            if (info.dli_sname) {
-                lines[i].sname = info.dli_sname;
-                lines[i].saddr = (uintptr_t)info.dli_saddr;
-            }
-            strlcpy(binary_filename, path, PATH_MAX);
-            if (fill_lines(num_traces, traces, 1, &obj, lines, i, errout) == (uintptr_t)-1)
-                break;
-        }
+	Dl_info info;
+	if (lines[i].line) continue;
+	if (dladdr(traces[i], &info)) {
+	    const char *path;
+	    void **p;
+
+	    /* skip symbols which is in already checked objects */
+	    /* if the binary is strip-ed, this may effect */
+	    for (p=dladdr_fbases; *p; p++) {
+		if (*p == info.dli_fbase) {
+		    lines[i].path = info.dli_fname;
+		    lines[i].sname = info.dli_sname;
+		    goto next_line;
+		}
+	    }
+	    *p = info.dli_fbase;
+
+	    append_obj(&obj);
+	    obj->base_addr = (uintptr_t)info.dli_fbase;
+	    path = info.dli_fname;
+	    obj->path = path;
+	    lines[i].path = path;
+	    strlcpy(binary_filename, path, PATH_MAX);
+	    if (fill_lines(num_traces, traces, 1, &obj, lines, i) == (uintptr_t)-1)
+		break;
+	}
 next_line:
-        continue;
+	continue;
     }
 
     /* output */
     for (i = 0; i < num_traces; i++) {
-        print_line(&lines[i], traces[i], errout);
-
-        /* FreeBSD's backtrace may show _start and so on */
-        if (lines[i].sname && strcmp("main", lines[i].sname) == 0)
-            break;
+	line_info_t *line = &lines[i];
+	uintptr_t addr = (uintptr_t)traces[i];
+	uintptr_t d = addr - line->saddr;
+	if (!line->path) {
+	    kprintf("[0x%lx]\n", addr);
+	}
+	else if (!line->saddr || !line->sname) {
+	    kprintf("%s(0x%lx) [0x%lx]\n", line->path, addr-line->base_addr, addr);
+	}
+	else if (line->line <= 0) {
+	    kprintf("%s(%s+0x%lx) [0x%lx]\n", line->path, line->sname,
+		    d, addr);
+	}
+	else if (!line->filename) {
+	    kprintf("%s(%s+0x%lx) [0x%lx] ???:%d\n", line->path, line->sname,
+		    d, addr, line->line);
+	}
+	else if (line->dirname && line->dirname[0]) {
+	    kprintf("%s(%s+0x%lx) [0x%lx] %s/%s:%d\n", line->path, line->sname,
+		    d, addr, line->dirname, line->filename, line->line);
+	}
+	else {
+	    kprintf("%s(%s+0x%lx) [0x%lx] %s:%d\n", line->path, line->sname,
+		    d, addr, line->filename, line->line);
+	}
+	/* FreeBSD's backtrace may show _start and so on */
+	if (line->sname && strcmp("main", line->sname) == 0)
+	    break;
     }
 
     /* free */
     while (obj) {
-        obj_info_t *o = obj;
-        for (i=0; i < DWARF_SECTION_COUNT; i++) {
-            struct dwarf_section *s = obj_dwarf_section_at(obj, i);
-            if (s->flags & SHF_COMPRESSED) {
-                free(s->ptr);
-            }
-        }
-        if (obj->mapped_size) {
-            munmap(obj->mapped, obj->mapped_size);
-        }
-        obj = o->next;
-        free(o);
-    }
-    for (i = 0; i < num_traces; i++) {
-        line_info_t *line = lines[i].next;
-        while (line) {
-            line_info_t *l = line;
-            line = line->next;
-            free(l);
-        }
+	obj_info_t *o = obj;
+	obj = o->next;
+	if (o->fd) {
+	    munmap(o->mapped, o->mapped_size);
+	    close(o->fd);
+	}
+	free(o);
     }
     free(lines);
     free(dladdr_fbases);
 }
 
-#undef kprintf
+/* From FreeBSD's lib/libstand/printf.c */
+/*-
+ * Copyright (c) 1986, 1988, 1991, 1993
+ *	The Regents of the University of California.  All rights reserved.
+ * (c) UNIX System Laboratories, Inc.
+ * All or some portions of this file are derived from material licensed
+ * to the University of California by American Telephone and Telegraph
+ * Co. or Unix System Laboratories, Inc. and are reproduced herein with
+ * the permission of UNIX System Laboratories, Inc.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ *    notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ *    notice, this list of conditions and the following disclaimer in the
+ *    documentation and/or other materials provided with the distribution.
+ * 4. Neither the name of the University nor the names of its contributors
+ *    may be used to endorse or promote products derived from this software
+ *    without specific prior written permission.
+ *
+ * THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ * ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ * SUCH DAMAGE.
+ *
+ *	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
+ */
+
+#include <stdarg.h>
+#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
+static inline int toupper(int c) { return ('A' <= c && c <= 'Z') ? (c&0x5f) : c; }
+#define    hex2ascii(hex)  (hex2ascii_data[hex])
+char const hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
+static inline int imax(int a, int b) { return (a > b ? a : b); }
+static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
+
+static void putce(int c)
+{
+    char s[1];
+    ssize_t ret;
+
+    s[0] = (char)c;
+    ret = write(2, s, 1);
+    (void)ret;
+}
+
+int
+kprintf(const char *fmt, ...)
+{
+	va_list ap;
+	int retval;
+
+	va_start(ap, fmt);
+	retval = kvprintf(fmt, putce, NULL, 10, ap);
+	va_end(ap);
+	return retval;
+}
 
+/*
+ * Put a NUL-terminated ASCII number (base <= 36) in a buffer in reverse
+ * order; return an optional length and a pointer to the last character
+ * written in the buffer (i.e., the first character of the string).
+ * The buffer pointed to by `nbuf' must have length >= MAXNBUF.
+ */
+static char *
+ksprintn(char *nbuf, uintmax_t num, int base, int *lenp, int upper)
+{
+	char *p, c;
+
+	p = nbuf;
+	*p = '\0';
+	do {
+		c = hex2ascii(num % base);
+		*++p = upper ? toupper(c) : c;
+	} while (num /= base);
+	if (lenp)
+		*lenp = (int)(p - nbuf);
+	return (p);
+}
+
+/*
+ * Scaled down version of printf(3).
+ *
+ * Two additional formats:
+ *
+ * The format %b is supported to decode error registers.
+ * Its usage is:
+ *
+ *	printf("reg=%b\n", regval, "<base><arg>*");
+ *
+ * where <base> is the output base expressed as a control character, e.g.
+ * \10 gives octal; \20 gives hex.  Each arg is a sequence of characters,
+ * the first of which gives the bit number to be inspected (origin 1), and
+ * the next characters (up to a control character, i.e. a character <= 32),
+ * give the name of the register.  Thus:
+ *
+ *	kvprintf("reg=%b\n", 3, "\10\2BITTWO\1BITONE\n");
+ *
+ * would produce output:
+ *
+ *	reg=3<BITTWO,BITONE>
+ *
+ * XXX:  %D  -- Hexdump, takes pointer and separator string:
+ *		("%6D", ptr, ":")   -> XX:XX:XX:XX:XX:XX
+ *		("%*D", len, ptr, " " -> XX XX XX XX ...
+ */
+static int
+kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap)
+{
+#define PCHAR(c) {int cc=(c); if (func) (*func)(cc); else *d++ = cc; retval++; }
+	char nbuf[MAXNBUF];
+	char *d;
+	const char *p, *percent, *q;
+	unsigned char *up;
+	int ch, n;
+	uintmax_t num;
+	int base, lflag, qflag, tmp, width, ladjust, sharpflag, neg, sign, dot;
+	int cflag, hflag, jflag, tflag, zflag;
+	int dwidth, upper;
+	char padc;
+	int stop = 0, retval = 0;
+
+	num = 0;
+	if (!func)
+		d = (char *) arg;
+	else
+		d = NULL;
+
+	if (fmt == NULL)
+		fmt = "(fmt null)\n";
+
+	if (radix < 2 || radix > 36)
+		radix = 10;
+
+	for (;;) {
+		padc = ' ';
+		width = 0;
+		while ((ch = (unsigned char)*fmt++) != '%' || stop) {
+			if (ch == '\0')
+				return (retval);
+			PCHAR(ch);
+		}
+		percent = fmt - 1;
+		qflag = 0; lflag = 0; ladjust = 0; sharpflag = 0; neg = 0;
+		sign = 0; dot = 0; dwidth = 0; upper = 0;
+		cflag = 0; hflag = 0; jflag = 0; tflag = 0; zflag = 0;
+reswitch:	switch (ch = (unsigned char)*fmt++) {
+		case '.':
+			dot = 1;
+			goto reswitch;
+		case '#':
+			sharpflag = 1;
+			goto reswitch;
+		case '+':
+			sign = 1;
+			goto reswitch;
+		case '-':
+			ladjust = 1;
+			goto reswitch;
+		case '%':
+			PCHAR(ch);
+			break;
+		case '*':
+			if (!dot) {
+				width = va_arg(ap, int);
+				if (width < 0) {
+					ladjust = !ladjust;
+					width = -width;
+				}
+			} else {
+				dwidth = va_arg(ap, int);
+			}
+			goto reswitch;
+		case '0':
+			if (!dot) {
+				padc = '0';
+				goto reswitch;
+			}
+		case '1': case '2': case '3': case '4':
+		case '5': case '6': case '7': case '8': case '9':
+				for (n = 0;; ++fmt) {
+					n = n * 10 + ch - '0';
+					ch = *fmt;
+					if (ch < '0' || ch > '9')
+						break;
+				}
+			if (dot)
+				dwidth = n;
+			else
+				width = n;
+			goto reswitch;
+		case 'b':
+			num = (unsigned int)va_arg(ap, int);
+			p = va_arg(ap, char *);
+			for (q = ksprintn(nbuf, num, *p++, NULL, 0); *q;)
+				PCHAR(*q--);
+
+			if (num == 0)
+				break;
+
+			for (tmp = 0; *p;) {
+				n = *p++;
+				if (num & (1 << (n - 1))) {
+					PCHAR(tmp ? ',' : '<');
+					for (; (n = *p) > ' '; ++p)
+						PCHAR(n);
+					tmp = 1;
+				} else
+					for (; *p > ' '; ++p)
+						continue;
+			}
+			if (tmp)
+				PCHAR('>');
+			break;
+		case 'c':
+			PCHAR(va_arg(ap, int));
+			break;
+		case 'D':
+			up = va_arg(ap, unsigned char *);
+			p = va_arg(ap, char *);
+			if (!width)
+				width = 16;
+			while(width--) {
+				PCHAR(hex2ascii(*up >> 4));
+				PCHAR(hex2ascii(*up & 0x0f));
+				up++;
+				if (width)
+					for (q=p;*q;q++)
+						PCHAR(*q);
+			}
+			break;
+		case 'd':
+		case 'i':
+			base = 10;
+			sign = 1;
+			goto handle_sign;
+		case 'h':
+			if (hflag) {
+				hflag = 0;
+				cflag = 1;
+			} else
+				hflag = 1;
+			goto reswitch;
+		case 'j':
+			jflag = 1;
+			goto reswitch;
+		case 'l':
+			if (lflag) {
+				lflag = 0;
+				qflag = 1;
+			} else
+				lflag = 1;
+			goto reswitch;
+		case 'n':
+			if (jflag)
+				*(va_arg(ap, intmax_t *)) = retval;
+			else if (qflag)
+				*(va_arg(ap, int64_t *)) = retval;
+			else if (lflag)
+				*(va_arg(ap, long *)) = retval;
+			else if (zflag)
+				*(va_arg(ap, size_t *)) = retval;
+			else if (hflag)
+				*(va_arg(ap, short *)) = retval;
+			else if (cflag)
+				*(va_arg(ap, char *)) = retval;
+			else
+				*(va_arg(ap, int *)) = retval;
+			break;
+		case 'o':
+			base = 8;
+			goto handle_nosign;
+		case 'p':
+			base = 16;
+			sharpflag = (width == 0);
+			sign = 0;
+			num = (uintptr_t)va_arg(ap, void *);
+			goto number;
+		case 'q':
+			qflag = 1;
+			goto reswitch;
+		case 'r':
+			base = radix;
+			if (sign)
+				goto handle_sign;
+			goto handle_nosign;
+		case 's':
+			p = va_arg(ap, char *);
+			if (p == NULL)
+				p = "(null)";
+			if (!dot)
+				n = (int)strlen (p);
+			else
+				for (n = 0; n < dwidth && p[n]; n++)
+					continue;
+
+			width -= n;
+
+			if (!ladjust && width > 0)
+				while (width--)
+					PCHAR(padc);
+			while (n--)
+				PCHAR(*p++);
+			if (ladjust && width > 0)
+				while (width--)
+					PCHAR(padc);
+			break;
+		case 't':
+			tflag = 1;
+			goto reswitch;
+		case 'u':
+			base = 10;
+			goto handle_nosign;
+		case 'X':
+			upper = 1;
+		case 'x':
+			base = 16;
+			goto handle_nosign;
+		case 'y':
+			base = 16;
+			sign = 1;
+			goto handle_sign;
+		case 'z':
+			zflag = 1;
+			goto reswitch;
+handle_nosign:
+			sign = 0;
+			if (jflag)
+				num = va_arg(ap, uintmax_t);
+			else if (qflag)
+				num = va_arg(ap, uint64_t);
+			else if (tflag)
+				num = va_arg(ap, ptrdiff_t);
+			else if (lflag)
+				num = va_arg(ap, unsigned long);
+			else if (zflag)
+				num = va_arg(ap, size_t);
+			else if (hflag)
+				num = (unsigned short)va_arg(ap, int);
+			else if (cflag)
+				num = (unsigned char)va_arg(ap, int);
+			else
+				num = va_arg(ap, unsigned int);
+			goto number;
+handle_sign:
+			if (jflag)
+				num = va_arg(ap, intmax_t);
+			else if (qflag)
+				num = va_arg(ap, int64_t);
+			else if (tflag)
+				num = va_arg(ap, ptrdiff_t);
+			else if (lflag)
+				num = va_arg(ap, long);
+			else if (zflag)
+				num = va_arg(ap, ssize_t);
+			else if (hflag)
+				num = (short)va_arg(ap, int);
+			else if (cflag)
+				num = (char)va_arg(ap, int);
+			else
+				num = va_arg(ap, int);
+number:
+			if (sign && (intmax_t)num < 0) {
+				neg = 1;
+				num = -(intmax_t)num;
+			}
+			p = ksprintn(nbuf, num, base, &n, upper);
+			tmp = 0;
+			if (sharpflag && num != 0) {
+				if (base == 8)
+					tmp++;
+				else if (base == 16)
+					tmp += 2;
+			}
+			if (neg)
+				tmp++;
+
+			if (!ladjust && padc == '0')
+				dwidth = width - tmp;
+			width -= tmp + imax(dwidth, n);
+			dwidth -= n;
+			if (!ladjust)
+				while (width-- > 0)
+					PCHAR(' ');
+			if (neg)
+				PCHAR('-');
+			if (sharpflag && num != 0) {
+				if (base == 8) {
+					PCHAR('0');
+				} else if (base == 16) {
+					PCHAR('0');
+					PCHAR('x');
+				}
+			}
+			while (dwidth-- > 0)
+				PCHAR('0');
+
+			while (*p)
+				PCHAR(*p--);
+
+			if (ladjust)
+				while (width-- > 0)
+					PCHAR(' ');
+
+			break;
+		default:
+			while (percent < fmt)
+				PCHAR(*percent++);
+			/*
+			 * Since we ignore an formatting argument it is no
+			 * longer safe to obey the remaining formatting
+			 * arguments as the arguments will no longer match
+			 * the format specs.
+			 */
+			stop = 1;
+			break;
+		}
+	}
+#undef PCHAR
+}
 #else /* defined(USE_ELF) */
 #error not supported
 #endif
diff --git a/addr2line.h b/addr2line.h
index ff8e476b92..d99f010934 100644
--- a/addr2line.h
+++ b/addr2line.h
@@ -1,5 +1,3 @@
-#ifndef RUBY_ADDR2LINE_H
-#define RUBY_ADDR2LINE_H
 /**********************************************************************
 
   addr2line.h -
@@ -10,12 +8,13 @@
 
 **********************************************************************/
 
-#if (defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H))
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
 
-#include <stdio.h>
+#ifdef USE_ELF
 
 void
-rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout);
+rb_dump_backtrace_with_lines(int num_traces, void **traces);
 
 #endif /* USE_ELF */
 
diff --git a/appveyor.yml b/appveyor.yml
new file mode 100644
index 0000000000..22c7bdce6a
--- /dev/null
+++ b/appveyor.yml
@@ -0,0 +1,55 @@
+---
+shallow_clone: true
+platform:
+  - x64
+environment:
+  ruby_version: "24-%Platform%"
+  zlib_version: "1.2.11"
+  matrix:
+    - vs: "120"
+install:
+  - chcp
+  - SET BITS=%Platform:x86=32%
+  - SET BITS=%BITS:x=%
+  - SET OPENSSL_DIR=c:\OpenSSL-Win%BITS%
+  - CALL SET vcvars=%%^VS%VS%COMNTOOLS^%%..\..\VC\vcvarsall.bat
+  - SET vcvars
+  - '"%vcvars%" %Platform:x64=amd64%'
+  - SET ruby_path=C:\Ruby%ruby_version:-x86=%
+  - SET PATH=\usr\local\bin;%ruby_path%\bin;%PATH%;C:\msys64\mingw64\bin;C:\msys64\usr\bin
+  - ruby --version
+  - 'cl'
+  - SET
+  - echo> Makefile srcdir=.
+  - echo>> Makefile MSC_VER=0
+  - echo>> Makefile RT=none
+  - echo>> Makefile RT_VER=0
+  - echo>> Makefile BUILTIN_ENCOBJS=nul
+  - type win32\Makefile.sub >> Makefile
+  - nmake %mflags% touch-unicode-files
+  - nmake %mflags% up incs UNICODE_FILES=.
+  - del Makefile
+  - mkdir \usr\local\bin
+  - mkdir \usr\local\include
+  - mkdir \usr\local\lib
+  - appveyor DownloadFile https://zlib.net/zlib%zlib_version:.=%.zip
+  - 7z x -o%APPVEYOR_BUILD_FOLDER%\ext\zlib zlib%zlib_version:.=%.zip
+  - for %%I in (%OPENSSL_DIR%\*.dll) do mklink /h \usr\local\bin\%%~nxI %%I
+  - mkdir %Platform%-mswin_%vs%
+  - ps: Get-ChildItem "win32" -Recurse | foreach {$_.Attributes = 'Readonly'}
+  - ps: Get-Item $env:Platform"-mswin_"$env:vs | foreach {$_.Attributes = 'Normal'}
+build_script:
+  - cd %APPVEYOR_BUILD_FOLDER%
+  - cd %Platform%-mswin_%vs%
+  - ..\win32\configure.bat --without-ext=+,dbm,gdbm,readline --with-opt-dir=/usr/local --with-openssl-dir=%OPENSSL_DIR:\=/%
+  - nmake -l
+  - nmake install-nodoc
+  - \usr\bin\ruby -v -e "p :locale => Encoding.find('locale'), :filesystem => Encoding.find('filesystem')"
+test_script:
+  - set /a JOBS=%NUMBER_OF_PROCESSORS%
+  - nmake -l "TESTOPTS=-v -q" btest
+  - nmake -l "TESTOPTS=-v -q" test-basic
+  - nmake -l "TESTOPTS=-q -j%JOBS%" test-all
+  - nmake -l test-spec
+matrix:
+  fast_finish: true
diff --git a/array.c b/array.c
index 5a4daf3e73..1600e484fe 100644
--- a/array.c
+++ b/array.c
@@ -11,58 +11,19 @@
 
 **********************************************************************/
 
-#include "debug_counter.h"
-#include "id.h"
 #include "internal.h"
-#include "internal/array.h"
-#include "internal/compar.h"
-#include "internal/enum.h"
-#include "internal/gc.h"
-#include "internal/hash.h"
-#include "internal/numeric.h"
-#include "internal/object.h"
-#include "internal/proc.h"
-#include "internal/rational.h"
-#include "internal/vm.h"
-#include "probes.h"
-#include "ruby/encoding.h"
-#include "ruby/st.h"
 #include "ruby/util.h"
-#include "vm_core.h"
-#include "builtin.h"
+#include "ruby/st.h"
+#include "probes.h"
+#include "id.h"
+#include "debug_counter.h"
 
-#if !ARRAY_DEBUG
-# undef NDEBUG
+#ifndef ARRAY_DEBUG
 # define NDEBUG
 #endif
 #include "ruby_assert.h"
 
 VALUE rb_cArray;
-VALUE rb_cArray_empty_frozen;
-
-/* Flags of RArray
- *
- * 0:   RARRAY_SHARED_FLAG (equal to ELTS_SHARED)
- *          The array is shared. The buffer this array points to is owned by
- *          another array (the shared root).
- * 1:   RARRAY_EMBED_FLAG
- *          The array is embedded (its contents follow the header, rather than
- *          being on a separately allocated buffer).
- * 3-9: RARRAY_EMBED_LEN
- *          The length of the array when RARRAY_EMBED_FLAG is set.
- * 12:  RARRAY_SHARED_ROOT_FLAG
- *          The array is a shared root that does reference counting. The buffer
- *          this array points to is owned by this array but may be pointed to
- *          by other arrays.
- *          Note: Frozen arrays may be a shared root without this flag being
- *                set. Frozen arrays do not have reference counting because
- *                they cannot be modified. Not updating the reference count
- *                improves copy-on-write performance. Their reference count is
- *                assumed to be infinity.
- * 14:  RARRAY_PTR_IN_USE_FLAG
- *          The buffer of the array is in use. This is only used during
- *          debugging.
- */
 
 /* for OPTIMIZED_CMP: */
 #define id_cmp idCmp
@@ -71,54 +32,48 @@ VALUE rb_cArray_empty_frozen;
 #define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
 #define SMALL_ARRAY_LEN 16
 
-RBIMPL_ATTR_MAYBE_UNUSED()
-static int
-should_be_T_ARRAY(VALUE ary)
-{
-    return RB_TYPE_P(ary, T_ARRAY);
-}
-
-#define ARY_HEAP_PTR(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
-#define ARY_HEAP_LEN(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
-#define ARY_HEAP_CAPA(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RUBY_ASSERT(!ARY_SHARED_ROOT_P(a)), \
-                          RARRAY(a)->as.heap.aux.capa)
+# define ARY_SHARED_P(ary) \
+    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+     FL_TEST((ary),ELTS_SHARED)!=0)
+# define ARY_EMBED_P(ary) \
+    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+     FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
 
-#define ARY_EMBED_PTR(a) (RUBY_ASSERT(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
+#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
+#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
 #define ARY_EMBED_LEN(a) \
-    (RUBY_ASSERT(ARY_EMBED_P(a)), \
+    (assert(ARY_EMBED_P(a)), \
      (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
-         (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
-#define ARY_HEAP_SIZE(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RUBY_ASSERT(ARY_OWNS_HEAP_P(a)), ARY_CAPA(a) * sizeof(VALUE))
-
-#define ARY_OWNS_HEAP_P(a) (RUBY_ASSERT(should_be_T_ARRAY((VALUE)(a))), \
-                            !FL_TEST_RAW((a), RARRAY_SHARED_FLAG|RARRAY_EMBED_FLAG))
+	 (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), RARRAY(a)->as.heap.aux.capa * sizeof(VALUE))
 
+#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
 #define FL_SET_EMBED(a) do { \
-    RUBY_ASSERT(!ARY_SHARED_P(a)); \
+    assert(!ARY_SHARED_P(a)); \
     FL_SET((a), RARRAY_EMBED_FLAG); \
-    ary_verify(a); \
 } while (0)
-
 #define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
 #define FL_SET_SHARED(ary) do { \
-    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
-    FL_SET((ary), RARRAY_SHARED_FLAG); \
+    assert(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), ELTS_SHARED); \
 } while (0)
-#define FL_UNSET_SHARED(ary) FL_UNSET((ary), RARRAY_SHARED_FLAG)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
 
 #define ARY_SET_PTR(ary, p) do { \
-    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
-    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
     RARRAY(ary)->as.heap.ptr = (p); \
 } while (0)
 #define ARY_SET_EMBED_LEN(ary, n) do { \
     long tmp_n = (n); \
-    RUBY_ASSERT(ARY_EMBED_P(ary)); \
+    assert(ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
     RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
     RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
 } while (0)
 #define ARY_SET_HEAP_LEN(ary, n) do { \
-    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    assert(!ARY_EMBED_P(ary)); \
     RARRAY(ary)->as.heap.len = (n); \
 } while (0)
 #define ARY_SET_LEN(ary, n) do { \
@@ -128,15 +83,15 @@ should_be_T_ARRAY(VALUE ary)
     else { \
         ARY_SET_HEAP_LEN((ary), (n)); \
     } \
-    RUBY_ASSERT(RARRAY_LEN(ary) == (n)); \
+    assert(RARRAY_LEN(ary) == (n)); \
 } while (0)
 #define ARY_INCREASE_PTR(ary, n) do  { \
-    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
-    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
     RARRAY(ary)->as.heap.ptr += (n); \
 } while (0)
 #define ARY_INCREASE_LEN(ary, n) do  { \
-    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
     if (ARY_EMBED_P(ary)) { \
         ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
     } \
@@ -145,150 +100,45 @@ should_be_T_ARRAY(VALUE ary)
     } \
 } while (0)
 
-#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? ary_embed_capa(ary) : \
-                       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : ARY_HEAP_CAPA(ary))
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
+		       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
 #define ARY_SET_CAPA(ary, n) do { \
-    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
-    RUBY_ASSERT(!ARY_SHARED_P(ary)); \
-    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!ARY_SHARED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
     RARRAY(ary)->as.heap.aux.capa = (n); \
 } while (0)
 
-#define ARY_SHARED_ROOT_OCCUPIED(ary) (!OBJ_FROZEN(ary) && ARY_SHARED_ROOT_REFCNT(ary) == 1)
-#define ARY_SET_SHARED_ROOT_REFCNT(ary, value) do { \
-    RUBY_ASSERT(ARY_SHARED_ROOT_P(ary)); \
-    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
-    RUBY_ASSERT((value) >= 0); \
+#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
+#define ARY_SET_SHARED(ary, value) do { \
+    const VALUE _ary_ = (ary); \
+    const VALUE _value_ = (value); \
+    assert(!ARY_EMBED_P(_ary_)); \
+    assert(ARY_SHARED_P(_ary_)); \
+    assert(ARY_SHARED_ROOT_P(_value_)); \
+    RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared, _value_); \
+} while (0)
+#define RARRAY_SHARED_ROOT_FLAG FL_USER5
+#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
+#define ARY_SHARED_NUM(ary) \
+    (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SHARED_OCCUPIED(ary) (ARY_SHARED_NUM(ary) == 1)
+#define ARY_SET_SHARED_NUM(ary, value) do { \
+    assert(ARY_SHARED_ROOT_P(ary)); \
     RARRAY(ary)->as.heap.aux.capa = (value); \
 } while (0)
 #define FL_SET_SHARED_ROOT(ary) do { \
-    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
-    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    assert(!ARY_EMBED_P(ary)); \
     FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
 } while (0)
 
-static inline void
-ARY_SET(VALUE a, long i, VALUE v)
-{
-    RUBY_ASSERT(!ARY_SHARED_P(a));
-    RUBY_ASSERT(!OBJ_FROZEN(a));
-
-    RARRAY_ASET(a, i, v);
-}
-#undef RARRAY_ASET
-
-static long
-ary_embed_capa(VALUE ary)
-{
-    size_t size = rb_gc_obj_slot_size(ary) - offsetof(struct RArray, as.ary);
-    RUBY_ASSERT(size % sizeof(VALUE) == 0);
-    return size / sizeof(VALUE);
-}
-
-static size_t
-ary_embed_size(long capa)
-{
-    return offsetof(struct RArray, as.ary) + (sizeof(VALUE) * capa);
-}
-
-static bool
-ary_embeddable_p(long capa)
-{
-    return rb_gc_size_allocatable_p(ary_embed_size(capa));
-}
-
-bool
-rb_ary_embeddable_p(VALUE ary)
-{
-    /* An array cannot be turned embeddable when the array is:
-     *  - Shared root: other objects may point to the buffer of this array
-     *    so we cannot make it embedded.
-     *  - Frozen: this array may also be a shared root without the shared root
-     *    flag.
-     *  - Shared: we don't want to re-embed an array that points to a shared
-     *    root (to save memory).
-     */
-    return !(ARY_SHARED_ROOT_P(ary) || OBJ_FROZEN(ary) || ARY_SHARED_P(ary));
-}
-
-size_t
-rb_ary_size_as_embedded(VALUE ary)
-{
-    size_t real_size;
-
-    if (ARY_EMBED_P(ary)) {
-        real_size = ary_embed_size(ARY_EMBED_LEN(ary));
-    }
-    else if (rb_ary_embeddable_p(ary)) {
-        real_size = ary_embed_size(ARY_HEAP_CAPA(ary));
-    }
-    else {
-        real_size = sizeof(struct RArray);
-    }
-    return real_size;
-}
-
-
-#if ARRAY_DEBUG
-#define ary_verify(ary) ary_verify_(ary, __FILE__, __LINE__)
-
-static VALUE
-ary_verify_(VALUE ary, const char *file, int line)
-{
-    RUBY_ASSERT(RB_TYPE_P(ary, T_ARRAY));
-
-    if (ARY_SHARED_P(ary)) {
-        VALUE root = ARY_SHARED_ROOT(ary);
-        const VALUE *ptr = ARY_HEAP_PTR(ary);
-        const VALUE *root_ptr = RARRAY_CONST_PTR(root);
-        long len = ARY_HEAP_LEN(ary), root_len = RARRAY_LEN(root);
-        RUBY_ASSERT(ARY_SHARED_ROOT_P(root) || OBJ_FROZEN(root));
-        RUBY_ASSERT(root_ptr <= ptr && ptr + len <= root_ptr + root_len);
-        ary_verify(root);
-    }
-    else if (ARY_EMBED_P(ary)) {
-        RUBY_ASSERT(!ARY_SHARED_P(ary));
-        RUBY_ASSERT(RARRAY_LEN(ary) <= ary_embed_capa(ary));
-    }
-    else {
-        const VALUE *ptr = RARRAY_CONST_PTR(ary);
-        long i, len = RARRAY_LEN(ary);
-        volatile VALUE v;
-        if (len > 1) len = 1; /* check only HEAD */
-        for (i=0; i<len; i++) {
-            v = ptr[i]; /* access check */
-        }
-        v = v;
-    }
-
-    return ary;
-}
-#else
-#define ary_verify(ary) ((void)0)
-#endif
-
-VALUE *
-rb_ary_ptr_use_start(VALUE ary)
-{
-#if ARRAY_DEBUG
-    FL_SET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
-#endif
-    return (VALUE *)RARRAY_CONST_PTR(ary);
-}
-
-void
-rb_ary_ptr_use_end(VALUE ary)
-{
-#if ARRAY_DEBUG
-    FL_UNSET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
-#endif
-}
+#define ARY_SET(a, i, v) RARRAY_ASET((assert(!ARY_SHARED_P(a)), (a)), (i), (v))
 
 void
-rb_mem_clear(VALUE *mem, long size)
+rb_mem_clear(register VALUE *mem, register long size)
 {
     while (size--) {
-        *mem++ = Qnil;
+	*mem++ = Qnil;
     }
 }
 
@@ -296,7 +146,7 @@ static void
 ary_mem_clear(VALUE ary, long beg, long size)
 {
     RARRAY_PTR_USE(ary, ptr, {
-        rb_mem_clear(ptr + beg, size);
+	rb_mem_clear(ptr + beg, size);
     });
 }
 
@@ -304,7 +154,7 @@ static inline void
 memfill(register VALUE *mem, register long size, register VALUE val)
 {
     while (size--) {
-        *mem++ = val;
+	*mem++ = val;
     }
 }
 
@@ -312,30 +162,36 @@ static void
 ary_memfill(VALUE ary, long beg, long size, VALUE val)
 {
     RARRAY_PTR_USE(ary, ptr, {
-        memfill(ptr + beg, size, val);
-        RB_OBJ_WRITTEN(ary, Qundef, val);
+	memfill(ptr + beg, size, val);
+	RB_OBJ_WRITTEN(ary, Qundef, val);
     });
 }
 
 static void
 ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
 {
-    RUBY_ASSERT(!ARY_SHARED_P(buff_owner_ary));
+#if 1
+    assert(!ARY_SHARED_P(buff_owner_ary));
 
     if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
-        rb_gc_writebarrier_remember(buff_owner_ary);
-        RARRAY_PTR_USE(ary, ptr, {
-            MEMCPY(ptr+beg, argv, VALUE, argc);
-        });
+	rb_gc_writebarrier_remember(buff_owner_ary);
+	RARRAY_PTR_USE(ary, ptr, {
+	    MEMCPY(ptr+beg, argv, VALUE, argc);
+	});
     }
     else {
-        int i;
-        RARRAY_PTR_USE(ary, ptr, {
-            for (i=0; i<argc; i++) {
-                RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
-            }
-        });
+	int i;
+	RARRAY_PTR_USE(ary, ptr, {
+	    for (i=0; i<argc; i++) {
+		RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+	    }
+	});
     }
+#else
+    /* giveup write barrier (traditional way) */
+    RARRAY_PTR(buff_owner_ary);
+    MEMCPY(RARRAY_PTR(ary)+beg, argv, VALUE, argc);
+#endif
 }
 
 static void
@@ -344,105 +200,49 @@ ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
     ary_memcpy0(ary, beg, argc, argv, ary);
 }
 
-static VALUE *
-ary_heap_alloc_buffer(size_t capa)
-{
-    return ALLOC_N(VALUE, capa);
-}
-
-static void
-ary_heap_free_ptr(VALUE ary, const VALUE *ptr, long size)
-{
-    ruby_sized_xfree((void *)ptr, size);
-}
-
-static void
-ary_heap_free(VALUE ary)
-{
-    ary_heap_free_ptr(ary, ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
-}
-
-static size_t
-ary_heap_realloc(VALUE ary, size_t new_capa)
-{
-    RUBY_ASSERT(!OBJ_FROZEN(ary));
-    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, new_capa, ARY_HEAP_CAPA(ary));
-    ary_verify(ary);
-
-    return new_capa;
-}
-
-void
-rb_ary_make_embedded(VALUE ary)
-{
-    RUBY_ASSERT(rb_ary_embeddable_p(ary));
-    if (!ARY_EMBED_P(ary)) {
-        const VALUE *buf = ARY_HEAP_PTR(ary);
-        long len = ARY_HEAP_LEN(ary);
-
-        FL_SET_EMBED(ary);
-        ARY_SET_EMBED_LEN(ary, len);
-
-        MEMCPY((void *)ARY_EMBED_PTR(ary), (void *)buf, VALUE, len);
-
-        ary_heap_free_ptr(ary, buf, len * sizeof(VALUE));
-    }
-}
-
 static void
 ary_resize_capa(VALUE ary, long capacity)
 {
-    RUBY_ASSERT(RARRAY_LEN(ary) <= capacity);
-    RUBY_ASSERT(!OBJ_FROZEN(ary));
-    RUBY_ASSERT(!ARY_SHARED_P(ary));
-
-    if (capacity > ary_embed_capa(ary)) {
-        size_t new_capa = capacity;
+    assert(RARRAY_LEN(ary) <= capacity);
+    assert(!OBJ_FROZEN(ary));
+    assert(!ARY_SHARED_P(ary));
+    if (capacity > RARRAY_EMBED_LEN_MAX) {
         if (ARY_EMBED_P(ary)) {
             long len = ARY_EMBED_LEN(ary);
-            VALUE *ptr = ary_heap_alloc_buffer(capacity);
-
+            VALUE *ptr = ALLOC_N(VALUE, (capacity));
             MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
             FL_UNSET_EMBED(ary);
             ARY_SET_PTR(ary, ptr);
             ARY_SET_HEAP_LEN(ary, len);
         }
         else {
-            new_capa = ary_heap_realloc(ary, capacity);
+	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity, RARRAY(ary)->as.heap.aux.capa);
         }
-        ARY_SET_CAPA(ary, new_capa);
+        ARY_SET_CAPA(ary, (capacity));
     }
     else {
         if (!ARY_EMBED_P(ary)) {
-            long len = ARY_HEAP_LEN(ary);
-            long old_capa = ARY_HEAP_CAPA(ary);
-            const VALUE *ptr = ARY_HEAP_PTR(ary);
+            long len = RARRAY_LEN(ary);
+	    const VALUE *ptr = RARRAY_CONST_PTR(ary);
 
-            if (len > capacity) len = capacity;
+	    if (len > capacity) len = capacity;
             MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
-            ary_heap_free_ptr(ary, ptr, old_capa);
-
             FL_SET_EMBED(ary);
             ARY_SET_LEN(ary, len);
+	    ruby_xfree((VALUE *)ptr);
         }
     }
-
-    ary_verify(ary);
 }
 
 static inline void
 ary_shrink_capa(VALUE ary)
 {
     long capacity = ARY_HEAP_LEN(ary);
-    long old_capa = ARY_HEAP_CAPA(ary);
-    RUBY_ASSERT(!ARY_SHARED_P(ary));
-    RUBY_ASSERT(old_capa >= capacity);
-    if (old_capa > capacity) {
-        size_t new_capa = ary_heap_realloc(ary, capacity);
-        ARY_SET_CAPA(ary, new_capa);
-    }
-
-    ary_verify(ary);
+    long old_capa = RARRAY(ary)->as.heap.aux.capa;
+    assert(!ARY_SHARED_P(ary));
+    assert(old_capa >= capacity);
+    if (old_capa > capacity)
+	REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity);
 }
 
 static void
@@ -451,126 +251,106 @@ ary_double_capa(VALUE ary, long min)
     long new_capa = ARY_CAPA(ary) / 2;
 
     if (new_capa < ARY_DEFAULT_SIZE) {
-        new_capa = ARY_DEFAULT_SIZE;
+	new_capa = ARY_DEFAULT_SIZE;
     }
     if (new_capa >= ARY_MAX_SIZE - min) {
-        new_capa = (ARY_MAX_SIZE - min) / 2;
+	new_capa = (ARY_MAX_SIZE - min) / 2;
     }
     new_capa += min;
     ary_resize_capa(ary, new_capa);
-
-    ary_verify(ary);
 }
 
 static void
-rb_ary_decrement_share(VALUE shared_root)
+rb_ary_decrement_share(VALUE shared)
 {
-    if (!OBJ_FROZEN(shared_root)) {
-        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
-        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num - 1);
+    if (shared) {
+	long num = ARY_SHARED_NUM(shared) - 1;
+	if (num == 0) {
+	    rb_ary_free(shared);
+	    rb_gc_force_recycle(shared);
+	}
+	else if (num > 0) {
+	    ARY_SET_SHARED_NUM(shared, num);
+	}
     }
 }
 
 static void
 rb_ary_unshare(VALUE ary)
 {
-    VALUE shared_root = ARY_SHARED_ROOT(ary);
-    rb_ary_decrement_share(shared_root);
+    VALUE shared = RARRAY(ary)->as.heap.aux.shared;
+    rb_ary_decrement_share(shared);
     FL_UNSET_SHARED(ary);
 }
 
-static void
-rb_ary_reset(VALUE ary)
+static inline void
+rb_ary_unshare_safe(VALUE ary)
 {
-    if (ARY_OWNS_HEAP_P(ary)) {
-        ary_heap_free(ary);
+    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+	rb_ary_unshare(ary);
     }
-    else if (ARY_SHARED_P(ary)) {
-        rb_ary_unshare(ary);
-    }
-
-    FL_SET_EMBED(ary);
-    ARY_SET_EMBED_LEN(ary, 0);
 }
 
 static VALUE
-rb_ary_increment_share(VALUE shared_root)
+rb_ary_increment_share(VALUE shared)
 {
-    if (!OBJ_FROZEN(shared_root)) {
-        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
-        RUBY_ASSERT(num >= 0);
-        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num + 1);
+    long num = ARY_SHARED_NUM(shared);
+    if (num >= 0) {
+	ARY_SET_SHARED_NUM(shared, num + 1);
     }
-    return shared_root;
+    return shared;
 }
 
 static void
-rb_ary_set_shared(VALUE ary, VALUE shared_root)
+rb_ary_set_shared(VALUE ary, VALUE shared)
 {
-    RUBY_ASSERT(!ARY_EMBED_P(ary));
-    RUBY_ASSERT(!OBJ_FROZEN(ary));
-    RUBY_ASSERT(ARY_SHARED_ROOT_P(shared_root) || OBJ_FROZEN(shared_root));
-
-    rb_ary_increment_share(shared_root);
+    rb_ary_increment_share(shared);
     FL_SET_SHARED(ary);
-    RB_OBJ_WRITE(ary, &RARRAY(ary)->as.heap.aux.shared_root, shared_root);
-
-    RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+    ARY_SET_SHARED(ary, shared);
 }
 
 static inline void
 rb_ary_modify_check(VALUE ary)
 {
     rb_check_frozen(ary);
-    ary_verify(ary);
 }
 
 void
-rb_ary_cancel_sharing(VALUE ary)
+rb_ary_modify(VALUE ary)
 {
+    rb_ary_modify_check(ary);
     if (ARY_SHARED_P(ary)) {
-        long shared_len, len = RARRAY_LEN(ary);
-        VALUE shared_root = ARY_SHARED_ROOT(ary);
-
-        ary_verify(shared_root);
-
-        if (len <= ary_embed_capa(ary)) {
-            const VALUE *ptr = ARY_HEAP_PTR(ary);
+	long shared_len, len = RARRAY_LEN(ary);
+	VALUE shared = ARY_SHARED(ary);
+        if (len <= RARRAY_EMBED_LEN_MAX) {
+	    const VALUE *ptr = ARY_HEAP_PTR(ary);
             FL_UNSET_SHARED(ary);
             FL_SET_EMBED(ary);
-            MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
-            rb_ary_decrement_share(shared_root);
+	    MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+            rb_ary_decrement_share(shared);
             ARY_SET_EMBED_LEN(ary, len);
         }
-        else if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && len > ((shared_len = RARRAY_LEN(shared_root))>>1)) {
-            long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared_root);
-            FL_UNSET_SHARED(ary);
-            ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared_root));
-            ARY_SET_CAPA(ary, shared_len);
-            RARRAY_PTR_USE(ary, ptr, {
-                MEMMOVE(ptr, ptr+shift, VALUE, len);
-            });
-            FL_SET_EMBED(shared_root);
-            rb_ary_decrement_share(shared_root);
-        }
+	else if (ARY_SHARED_OCCUPIED(shared) && len > ((shared_len = RARRAY_LEN(shared))>>1)) {
+	    long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared);
+	    FL_UNSET_SHARED(ary);
+	    ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared));
+	    ARY_SET_CAPA(ary, shared_len);
+	    RARRAY_PTR_USE(ary, ptr, {
+		MEMMOVE(ptr, ptr+shift, VALUE, len);
+	    });
+	    FL_SET_EMBED(shared);
+	    rb_ary_decrement_share(shared);
+	}
         else {
-            VALUE *ptr = ary_heap_alloc_buffer(len);
-            MEMCPY(ptr, ARY_HEAP_PTR(ary), VALUE, len);
+            VALUE *ptr = ALLOC_N(VALUE, len);
+            MEMCPY(ptr, RARRAY_CONST_PTR(ary), VALUE, len);
             rb_ary_unshare(ary);
             ARY_SET_CAPA(ary, len);
             ARY_SET_PTR(ary, ptr);
         }
 
-        rb_gc_writebarrier_remember(ary);
+	rb_gc_writebarrier_remember(ary);
     }
-    ary_verify(ary);
-}
-
-void
-rb_ary_modify(VALUE ary)
-{
-    rb_ary_modify_check(ary);
-    rb_ary_cancel_sharing(ary);
 }
 
 static VALUE
@@ -581,75 +361,69 @@ ary_ensure_room_for_push(VALUE ary, long add_len)
     long capa;
 
     if (old_len > ARY_MAX_SIZE - add_len) {
-        rb_raise(rb_eIndexError, "index %ld too big", new_len);
+	rb_raise(rb_eIndexError, "index %ld too big", new_len);
     }
     if (ARY_SHARED_P(ary)) {
-        if (new_len > ary_embed_capa(ary)) {
-            VALUE shared_root = ARY_SHARED_ROOT(ary);
-            if (ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
-                if (ARY_HEAP_PTR(ary) - RARRAY_CONST_PTR(shared_root) + new_len <= RARRAY_LEN(shared_root)) {
-                    rb_ary_modify_check(ary);
-
-                    ary_verify(ary);
-                    ary_verify(shared_root);
-                    return shared_root;
-                }
-                else {
-                    /* if array is shared, then it is likely it participate in push/shift pattern */
-                    rb_ary_modify(ary);
-                    capa = ARY_CAPA(ary);
-                    if (new_len > capa - (capa >> 6)) {
-                        ary_double_capa(ary, new_len);
-                    }
-                    ary_verify(ary);
-                    return ary;
-                }
-            }
-        }
-        ary_verify(ary);
-        rb_ary_modify(ary);
+	if (new_len > RARRAY_EMBED_LEN_MAX) {
+	    VALUE shared = ARY_SHARED(ary);
+	    if (ARY_SHARED_OCCUPIED(shared)) {
+		if (RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared) + new_len <= RARRAY_LEN(shared)) {
+		    rb_ary_modify_check(ary);
+		    return shared;
+		}
+		else {
+		    /* if array is shared, then it is likely it participate in push/shift pattern */
+		    rb_ary_modify(ary);
+		    capa = ARY_CAPA(ary);
+		    if (new_len > capa - (capa >> 6)) {
+			ary_double_capa(ary, new_len);
+		    }
+		    return ary;
+		}
+	    }
+	}
+	rb_ary_modify(ary);
     }
     else {
-        rb_ary_modify_check(ary);
+	rb_ary_modify_check(ary);
     }
     capa = ARY_CAPA(ary);
     if (new_len > capa) {
-        ary_double_capa(ary, new_len);
+	ary_double_capa(ary, new_len);
     }
 
-    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *    freeze -> self
- *
- *  Freezes +self+ (if not already frozen); returns +self+:
+ *      ary.freeze -> ary
  *
- *    a = []
- *    a.frozen? # => false
- *    a.freeze
- *    a.frozen? # => true
+ *  Calls Object#freeze on +ary+ to prevent any further
+ *  modification. A RuntimeError will be raised if a modification
+ *  attempt is made.
  *
- *  No further changes may be made to +self+;
- *  raises FrozenError if a change is attempted.
- *
- *  Related: Kernel#frozen?.
  */
 
 VALUE
 rb_ary_freeze(VALUE ary)
 {
-    RUBY_ASSERT(RB_TYPE_P(ary, T_ARRAY));
-
-    if (OBJ_FROZEN(ary)) return ary;
+    return rb_obj_freeze(ary);
+}
 
-    if (!ARY_EMBED_P(ary) && !ARY_SHARED_P(ary) && !ARY_SHARED_ROOT_P(ary)) {
-        ary_shrink_capa(ary);
-    }
+/*
+ *  call-seq:
+ *     ary.frozen?  -> true or false
+ *
+ *  Return +true+ if this array is frozen (or temporarily frozen
+ *  while being sorted). See also Object#frozen?
+ */
 
-    return rb_obj_freeze(ary);
+static VALUE
+rb_ary_frozen_p(VALUE ary)
+{
+    if (OBJ_FROZEN(ary)) return Qtrue;
+    return Qfalse;
 }
 
 /* This can be used to take a snapshot of an array (with
@@ -663,22 +437,18 @@ VALUE
 rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
 {
     if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
-            !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
-            ARY_SHARED_ROOT(ary1) == ARY_SHARED_ROOT(ary2) &&
-            ARY_HEAP_LEN(ary1) == ARY_HEAP_LEN(ary2)) {
-        return Qtrue;
+	!ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
+	RARRAY(ary1)->as.heap.aux.shared == RARRAY(ary2)->as.heap.aux.shared &&
+	RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
+	return Qtrue;
     }
     return Qfalse;
 }
 
 static VALUE
-ary_alloc_embed(VALUE klass, long capa)
+ary_alloc(VALUE klass)
 {
-    size_t size = ary_embed_size(capa);
-    RUBY_ASSERT(rb_gc_size_allocatable_p(size));
-    NEWOBJ_OF(ary, struct RArray, klass,
-                     T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
-                     size, 0);
+    NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
     /* Created array is:
      *   FL_SET_EMBED((VALUE)ary);
      *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
@@ -687,44 +457,32 @@ ary_alloc_embed(VALUE klass, long capa)
 }
 
 static VALUE
-ary_alloc_heap(VALUE klass)
-{
-    NEWOBJ_OF(ary, struct RArray, klass,
-                     T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
-                     sizeof(struct RArray), 0);
-    return (VALUE)ary;
-}
-
-static VALUE
 empty_ary_alloc(VALUE klass)
 {
     RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
-    return ary_alloc_embed(klass, 0);
+    return ary_alloc(klass);
 }
 
 static VALUE
 ary_new(VALUE klass, long capa)
 {
-    VALUE ary;
+    VALUE ary,*ptr;
 
     if (capa < 0) {
-        rb_raise(rb_eArgError, "negative array size (or size too big)");
+	rb_raise(rb_eArgError, "negative array size (or size too big)");
     }
     if (capa > ARY_MAX_SIZE) {
-        rb_raise(rb_eArgError, "array size too big");
+	rb_raise(rb_eArgError, "array size too big");
     }
 
     RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
 
-    if (ary_embeddable_p(capa)) {
-        ary = ary_alloc_embed(klass, capa);
-    }
-    else {
-        ary = ary_alloc_heap(klass);
+    ary = ary_alloc(klass);
+    if (capa > RARRAY_EMBED_LEN_MAX) {
+	ptr = ALLOC_N(VALUE, capa);
+        FL_UNSET_EMBED(ary);
+        ARY_SET_PTR(ary, ptr);
         ARY_SET_CAPA(ary, capa);
-        RUBY_ASSERT(!ARY_EMBED_P(ary));
-
-        ARY_SET_PTR(ary, ary_heap_alloc_buffer(capa));
         ARY_SET_HEAP_LEN(ary, 0);
     }
 
@@ -740,7 +498,7 @@ rb_ary_new_capa(long capa)
 VALUE
 rb_ary_new(void)
 {
-    return rb_ary_new_capa(0);
+    return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
 }
 
 VALUE
@@ -754,7 +512,7 @@ VALUE
 
     va_start(ar, n);
     for (i=0; i<n; i++) {
-        ARY_SET(ary, i, va_arg(ar, VALUE));
+	ARY_SET(ary, i, va_arg(ar, VALUE));
     }
     va_end(ar);
 
@@ -769,8 +527,8 @@ rb_ary_tmp_new_from_values(VALUE klass, long n, const VALUE *elts)
 
     ary = ary_new(klass, n);
     if (n > 0 && elts) {
-        ary_memcpy(ary, 0, n, elts);
-        ARY_SET_LEN(ary, n);
+	ary_memcpy(ary, 0, n, elts);
+	ARY_SET_LEN(ary, n);
     }
 
     return ary;
@@ -782,84 +540,16 @@ rb_ary_new_from_values(long n, const VALUE *elts)
     return rb_ary_tmp_new_from_values(rb_cArray, n, elts);
 }
 
-static VALUE
-ec_ary_alloc_embed(rb_execution_context_t *ec, VALUE klass, long capa)
-{
-    size_t size = ary_embed_size(capa);
-    RUBY_ASSERT(rb_gc_size_allocatable_p(size));
-    NEWOBJ_OF(ary, struct RArray, klass,
-            T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
-            size, ec);
-    /* Created array is:
-     *   FL_SET_EMBED((VALUE)ary);
-     *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
-     */
-    return (VALUE)ary;
-}
-
-static VALUE
-ec_ary_alloc_heap(rb_execution_context_t *ec, VALUE klass)
-{
-    NEWOBJ_OF(ary, struct RArray, klass,
-            T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
-            sizeof(struct RArray), ec);
-    return (VALUE)ary;
-}
-
-static VALUE
-ec_ary_new(rb_execution_context_t *ec, VALUE klass, long capa)
-{
-    VALUE ary;
-
-    if (capa < 0) {
-        rb_raise(rb_eArgError, "negative array size (or size too big)");
-    }
-    if (capa > ARY_MAX_SIZE) {
-        rb_raise(rb_eArgError, "array size too big");
-    }
-
-    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
-
-    if (ary_embeddable_p(capa)) {
-        ary = ec_ary_alloc_embed(ec, klass, capa);
-    }
-    else {
-        ary = ec_ary_alloc_heap(ec, klass);
-        ARY_SET_CAPA(ary, capa);
-        RUBY_ASSERT(!ARY_EMBED_P(ary));
-
-        ARY_SET_PTR(ary, ary_heap_alloc_buffer(capa));
-        ARY_SET_HEAP_LEN(ary, 0);
-    }
-
-    return ary;
-}
-
 VALUE
-rb_ec_ary_new_from_values(rb_execution_context_t *ec, long n, const VALUE *elts)
+rb_ary_tmp_new(long capa)
 {
-    VALUE ary;
-
-    ary = ec_ary_new(ec, rb_cArray, n);
-    if (n > 0 && elts) {
-        ary_memcpy(ary, 0, n, elts);
-        ARY_SET_LEN(ary, n);
-    }
-
-    return ary;
+    return ary_new(0, capa);
 }
 
 VALUE
-rb_ary_hidden_new(long capa)
+rb_ary_tmp_new_fill(long capa)
 {
     VALUE ary = ary_new(0, capa);
-    return ary;
-}
-
-VALUE
-rb_ary_hidden_new_fill(long capa)
-{
-    VALUE ary = rb_ary_hidden_new(capa);
     ary_memfill(ary, 0, capa, Qnil);
     ARY_SET_LEN(ary, capa);
     return ary;
@@ -869,107 +559,63 @@ void
 rb_ary_free(VALUE ary)
 {
     if (ARY_OWNS_HEAP_P(ary)) {
-        if (USE_DEBUG_COUNTER &&
-            !ARY_SHARED_ROOT_P(ary) &&
-            ARY_HEAP_CAPA(ary) > RARRAY_LEN(ary)) {
-            RB_DEBUG_COUNTER_INC(obj_ary_extracapa);
-        }
-
-        RB_DEBUG_COUNTER_INC(obj_ary_ptr);
-        ary_heap_free(ary);
+	RB_DEBUG_COUNTER_INC(obj_ary_ptr);
+	ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
     }
     else {
-        RB_DEBUG_COUNTER_INC(obj_ary_embed);
-    }
-
-    if (ARY_SHARED_P(ary)) {
-        RB_DEBUG_COUNTER_INC(obj_ary_shared);
-    }
-    if (ARY_SHARED_ROOT_P(ary) && ARY_SHARED_ROOT_OCCUPIED(ary)) {
-        RB_DEBUG_COUNTER_INC(obj_ary_shared_root_occupied);
+	RB_DEBUG_COUNTER_INC(obj_ary_embed);
     }
 }
 
-static VALUE fake_ary_flags;
-
-static VALUE
-init_fake_ary_flags(void)
-{
-    struct RArray fake_ary = {0};
-    fake_ary.basic.flags = T_ARRAY;
-    VALUE ary = (VALUE)&fake_ary;
-    rb_ary_freeze(ary);
-    return fake_ary.basic.flags;
-}
-
-VALUE
-rb_setup_fake_ary(struct RArray *fake_ary, const VALUE *list, long len)
-{
-    fake_ary->basic.flags = fake_ary_flags;
-    RBASIC_CLEAR_CLASS((VALUE)fake_ary);
-
-    // bypass frozen checks
-    fake_ary->as.heap.ptr = list;
-    fake_ary->as.heap.len = len;
-    fake_ary->as.heap.aux.capa = len;
-    return (VALUE)fake_ary;
-}
-
-size_t
+RUBY_FUNC_EXPORTED size_t
 rb_ary_memsize(VALUE ary)
 {
     if (ARY_OWNS_HEAP_P(ary)) {
-        return ARY_CAPA(ary) * sizeof(VALUE);
+	return ARY_CAPA(ary) * sizeof(VALUE);
     }
     else {
-        return 0;
+	return 0;
     }
 }
 
+static inline void
+ary_discard(VALUE ary)
+{
+    rb_ary_free(ary);
+    RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
+    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
+}
+
 static VALUE
 ary_make_shared(VALUE ary)
 {
-    ary_verify(ary);
-
+    assert(!ARY_EMBED_P(ary));
     if (ARY_SHARED_P(ary)) {
-        return ARY_SHARED_ROOT(ary);
+	return ARY_SHARED(ary);
     }
     else if (ARY_SHARED_ROOT_P(ary)) {
-        return ary;
+	return ary;
     }
     else if (OBJ_FROZEN(ary)) {
-        return ary;
+	ary_shrink_capa(ary);
+	FL_SET_SHARED_ROOT(ary);
+	ARY_SET_SHARED_NUM(ary, 1);
+	return ary;
     }
     else {
-        long capa = ARY_CAPA(ary);
-        long len = RARRAY_LEN(ary);
-
-        /* Shared roots cannot be embedded because the reference count
-         * (refcnt) is stored in as.heap.aux.capa. */
-        VALUE shared = ary_alloc_heap(0);
-        FL_SET_SHARED_ROOT(shared);
-
-        if (ARY_EMBED_P(ary)) {
-            VALUE *ptr = ary_heap_alloc_buffer(capa);
-            ARY_SET_PTR(shared, ptr);
-            ary_memcpy(shared, 0, len, RARRAY_CONST_PTR(ary));
-
-            FL_UNSET_EMBED(ary);
-            ARY_SET_HEAP_LEN(ary, len);
-            ARY_SET_PTR(ary, ptr);
-        }
-        else {
-            ARY_SET_PTR(shared, RARRAY_CONST_PTR(ary));
-        }
+	long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
+	NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+        FL_UNSET_EMBED(shared);
 
-        ARY_SET_LEN(shared, capa);
-        ary_mem_clear(shared, len, capa - len);
-        rb_ary_set_shared(ary, shared);
-
-        ary_verify(shared);
-        ary_verify(ary);
-
-        return shared;
+	ARY_SET_LEN((VALUE)shared, capa);
+	ARY_SET_PTR((VALUE)shared, RARRAY_CONST_PTR(ary));
+	ary_mem_clear((VALUE)shared, len, capa - len);
+	FL_SET_SHARED_ROOT(shared);
+	ARY_SET_SHARED_NUM((VALUE)shared, 1);
+	FL_SET_SHARED(ary);
+	ARY_SET_SHARED(ary, (VALUE)shared);
+	OBJ_FREEZE(shared);
+	return (VALUE)shared;
     }
 }
 
@@ -978,11 +624,9 @@ ary_make_substitution(VALUE ary)
 {
     long len = RARRAY_LEN(ary);
 
-    if (ary_embeddable_p(len)) {
-        VALUE subst = rb_ary_new_capa(len);
-        RUBY_ASSERT(ARY_EMBED_P(subst));
-
-        ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
+    if (len <= RARRAY_EMBED_LEN_MAX) {
+	VALUE subst = rb_ary_new2(len);
+	ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
         ARY_SET_EMBED_LEN(subst, len);
         return subst;
     }
@@ -1010,34 +654,23 @@ rb_check_array_type(VALUE ary)
     return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
 }
 
-VALUE
-rb_check_to_array(VALUE ary)
-{
-    return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
-}
-
-VALUE
-rb_to_array(VALUE ary)
-{
-    return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
-}
-
 /*
  *  call-seq:
- *    Array.try_convert(object) -> object, new_array, or nil
- *
- *  Attempts to return an array, based on the given +object+.
+ *     Array.try_convert(obj) -> array or nil
  *
- *  If +object+ is an array, returns +object+.
+ *  Tries to convert +obj+ into an array, using +to_ary+ method.  Returns the
+ *  converted array or +nil+ if +obj+ cannot be converted for any reason.
+ *  This method can be used to check if an argument is an array.
  *
- *  Otherwise if +object+ responds to <tt>:to_ary</tt>.
- *  calls <tt>object.to_ary</tt>:
- *  if the return value is an array or +nil+, returns that value;
- *  if not, raises TypeError.
+ *     Array.try_convert([1])   #=> [1]
+ *     Array.try_convert("1")   #=> nil
  *
- *  Otherwise returns +nil+.
+ *     if tmp = Array.try_convert(arg)
+ *       # the argument is an array
+ *     elsif tmp = String.try_convert(arg)
+ *       # the argument is a string
+ *     end
  *
- *  Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
  */
 
 static VALUE
@@ -1046,79 +679,60 @@ rb_ary_s_try_convert(VALUE dummy, VALUE ary)
     return rb_check_array_type(ary);
 }
 
-/* :nodoc: */
-static VALUE
-rb_ary_s_new(int argc, VALUE *argv, VALUE klass)
-{
-    VALUE ary;
-
-    if (klass == rb_cArray) {
-        long size = 0;
-        if (argc > 0 && FIXNUM_P(argv[0])) {
-            size = FIX2LONG(argv[0]);
-            if (size < 0) size = 0;
-        }
-
-        ary = ary_new(klass, size);
-
-        rb_obj_call_init_kw(ary, argc, argv, RB_PASS_CALLED_KEYWORDS);
-    }
-    else {
-        ary = rb_class_new_instance_pass_kw(argc, argv, klass);
-    }
-
-    return ary;
-}
-
 /*
  *  call-seq:
- *    Array.new -> new_empty_array
- *    Array.new(array) -> new_array
- *    Array.new(size, default_value = nil) -> new_array
- *    Array.new(size = 0) {|index| ... } -> new_array
+ *     Array.new(size=0, default=nil)
+ *     Array.new(array)
+ *     Array.new(size) {|index| block }
  *
  *  Returns a new array.
  *
- *  With no block and no argument given, returns a new empty array:
+ *  In the first form, if no arguments are sent, the new array will be empty.
+ *  When a +size+ and an optional +default+ are sent, an array is created with
+ *  +size+ copies of +default+.  Take notice that all elements will reference the
+ *  same object +default+.
+ *
+ *  The second form creates a copy of the array passed as a parameter (the
+ *  array is generated by calling to_ary on the parameter).
  *
- *    Array.new # => []
+ *    first_array = ["Matz", "Guido"]
  *
- *  With no block and array argument given, returns a new array with the same elements:
+ *    second_array = Array.new(first_array) #=> ["Matz", "Guido"]
  *
- *    Array.new([:foo, 'bar', 2]) # => [:foo, "bar", 2]
+ *    first_array.equal? second_array       #=> false
  *
- *  With no block and integer argument given, returns a new array containing
- *  that many instances of the given +default_value+:
+ *  In the last form, an array of the given size is created.  Each element in
+ *  this array is created by passing the element's index to the given block
+ *  and storing the return value.
  *
- *    Array.new(0)    # => []
- *    Array.new(3)    # => [nil, nil, nil]
- *    Array.new(2, 3) # => [3, 3]
+ *    Array.new(3){ |index| index ** 2 }
+ *    # => [0, 1, 4]
  *
- *  With a block given, returns an array of the given +size+;
- *  calls the block with each +index+ in the range <tt>(0...size)</tt>;
- *  the element at that +index+ in the returned array is the blocks return value:
+ *  == Common gotchas
  *
- *    Array.new(3)  {|index| "Element #{index}" } # => ["Element 0", "Element 1", "Element 2"]
+ *  When sending the second parameter, the same object will be used as the
+ *  value for all the array elements:
  *
- *  A common pitfall for new Rubyists is providing an expression as +default_value+:
+ *     a = Array.new(2, Hash.new)
+ *     # => [{}, {}]
  *
- *    array = Array.new(2, {})
- *    array # => [{}, {}]
- *    array[0][:a] = 1
- *    array # => [{a: 1}, {a: 1}], as array[0] and array[1] are same object
+ *     a[0]['cat'] = 'feline'
+ *     a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
  *
- *  If you want the elements of the array to be distinct, you should pass a block:
+ *     a[1]['cat'] = 'Felix'
+ *     a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
  *
- *    array = Array.new(2) { {} }
- *    array # => [{}, {}]
- *    array[0][:a] = 1
- *    array # => [{a: 1}, {}], as array[0] and array[1] are different objects
+ *  Since all the Array elements store the same hash, changes to one of them
+ *  will affect them all.
  *
- *  Raises TypeError if the first argument is not either an array
- *  or an {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]).
- *  Raises ArgumentError if the first argument is a negative integer.
+ *  If multiple copies are what you want, you should use the block
+ *  version which uses the result of that block each time an element
+ *  of the array needs to be initialized:
+ *
+ *     a = Array.new(2) { Hash.new }
+ *     a[0]['cat'] = 'feline'
+ *     a # => [{"cat"=>"feline"}, {}]
  *
- *  Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
  */
 
 static VALUE
@@ -1129,60 +743,61 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
 
     rb_ary_modify(ary);
     if (argc == 0) {
-        rb_ary_reset(ary);
-        RUBY_ASSERT(ARY_EMBED_P(ary));
-        RUBY_ASSERT(ARY_EMBED_LEN(ary) == 0);
-        if (rb_block_given_p()) {
-            rb_warning("given block not used");
-        }
-        return ary;
+	if (ARY_OWNS_HEAP_P(ary) && RARRAY_CONST_PTR(ary) != 0) {
+	    ruby_sized_xfree((void *)RARRAY_CONST_PTR(ary), ARY_HEAP_SIZE(ary));
+	}
+        rb_ary_unshare_safe(ary);
+        FL_SET_EMBED(ary);
+	ARY_SET_EMBED_LEN(ary, 0);
+	if (rb_block_given_p()) {
+	    rb_warning("given block not used");
+	}
+	return ary;
     }
     rb_scan_args(argc, argv, "02", &size, &val);
     if (argc == 1 && !FIXNUM_P(size)) {
-        val = rb_check_array_type(size);
-        if (!NIL_P(val)) {
-            rb_ary_replace(ary, val);
-            return ary;
-        }
+	val = rb_check_array_type(size);
+	if (!NIL_P(val)) {
+	    rb_ary_replace(ary, val);
+	    return ary;
+	}
     }
 
     len = NUM2LONG(size);
     /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
     if (len < 0) {
-        rb_raise(rb_eArgError, "negative array size");
+	rb_raise(rb_eArgError, "negative array size");
     }
     if (len > ARY_MAX_SIZE) {
-        rb_raise(rb_eArgError, "array size too big");
+	rb_raise(rb_eArgError, "array size too big");
     }
     /* recheck after argument conversion */
     rb_ary_modify(ary);
     ary_resize_capa(ary, len);
     if (rb_block_given_p()) {
-        long i;
+	long i;
 
-        if (argc == 2) {
-            rb_warn("block supersedes default value argument");
-        }
-        for (i=0; i<len; i++) {
-            rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
-            ARY_SET_LEN(ary, i + 1);
-        }
+	if (argc == 2) {
+	    rb_warn("block supersedes default value argument");
+	}
+	for (i=0; i<len; i++) {
+	    rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
+	    ARY_SET_LEN(ary, i + 1);
+	}
     }
     else {
-        ary_memfill(ary, 0, len, val);
-        ARY_SET_LEN(ary, len);
+	ary_memfill(ary, 0, len, val);
+	ARY_SET_LEN(ary, len);
     }
     return ary;
 }
 
 /*
- * Returns a new array, populated with the given objects:
- *
- *   Array[1, 'a', /^A/]    # => [1, "a", /^A/]
- *   Array[]                # => []
- *   Array.[](1, 'a', /^A/) # => [1, "a", /^A/]
+ * Returns a new array populated with the given objects.
  *
- * Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
+ *   Array.[]( 1, 'a', /^A/ ) # => [1, "a", /^A/]
+ *   Array[ 1, 'a', /^A/ ]    # => [1, "a", /^A/]
+ *   [ 1, 'a', /^A/ ]         # => [1, "a", /^A/]
  */
 
 static VALUE
@@ -1203,26 +818,26 @@ rb_ary_store(VALUE ary, long idx, VALUE val)
     long len = RARRAY_LEN(ary);
 
     if (idx < 0) {
-        idx += len;
-        if (idx < 0) {
-            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-                     idx - len, -len);
-        }
+	idx += len;
+	if (idx < 0) {
+	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+		     idx - len, -len);
+	}
     }
     else if (idx >= ARY_MAX_SIZE) {
-        rb_raise(rb_eIndexError, "index %ld too big", idx);
+	rb_raise(rb_eIndexError, "index %ld too big", idx);
     }
 
     rb_ary_modify(ary);
     if (idx >= ARY_CAPA(ary)) {
-        ary_double_capa(ary, idx);
+	ary_double_capa(ary, idx);
     }
     if (idx > len) {
-        ary_mem_clear(ary, len, idx - len + 1);
+	ary_mem_clear(ary, len, idx - len + 1);
     }
 
     if (idx >= len) {
-        ARY_SET_LEN(ary, idx + 1);
+	ARY_SET_LEN(ary, idx + 1);
     }
     ARY_SET(ary, idx, val);
 }
@@ -1230,98 +845,35 @@ rb_ary_store(VALUE ary, long idx, VALUE val)
 static VALUE
 ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
 {
-    RUBY_ASSERT(offset >= 0);
-    RUBY_ASSERT(len >= 0);
-    RUBY_ASSERT(offset+len <= RARRAY_LEN(ary));
+    assert(offset >= 0);
+    assert(len >= 0);
+    assert(offset+len <= RARRAY_LEN(ary));
 
-    VALUE result = ary_alloc_heap(klass);
-    size_t embed_capa = ary_embed_capa(result);
-    if ((size_t)len <= embed_capa) {
-        FL_SET_EMBED(result);
-        ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
+    if (len <= RARRAY_EMBED_LEN_MAX) {
+        VALUE result = ary_alloc(klass);
+	ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
         ARY_SET_EMBED_LEN(result, len);
+        return result;
     }
     else {
-        VALUE shared = ary_make_shared(ary);
-
-        /* The ary_make_shared call may allocate, which can trigger a GC
-         * compaction. This can cause the array to be embedded because it has
-         * a length of 0. */
+        VALUE shared, result = ary_alloc(klass);
         FL_UNSET_EMBED(result);
 
+        shared = ary_make_shared(ary);
         ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
         ARY_SET_LEN(result, RARRAY_LEN(ary));
         rb_ary_set_shared(result, shared);
 
         ARY_INCREASE_PTR(result, offset);
         ARY_SET_LEN(result, len);
-
-        ary_verify(shared);
-    }
-
-    ary_verify(result);
-    return result;
-}
-
-static VALUE
-ary_make_partial_step(VALUE ary, VALUE klass, long offset, long len, long step)
-{
-    RUBY_ASSERT(offset >= 0);
-    RUBY_ASSERT(len >= 0);
-    RUBY_ASSERT(offset+len <= RARRAY_LEN(ary));
-    RUBY_ASSERT(step != 0);
-
-    const long orig_len = len;
-
-    if (step > 0 && step >= len) {
-        VALUE result = ary_new(klass, 1);
-        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
-        const VALUE *values = RARRAY_CONST_PTR(ary);
-
-        RB_OBJ_WRITE(result, ptr, values[offset]);
-        ARY_SET_EMBED_LEN(result, 1);
         return result;
     }
-    else if (step < 0 && step < -len) {
-        step = -len;
-    }
-
-    long ustep = (step < 0) ? -step : step;
-    len = roomof(len, ustep);
-
-    long i;
-    long j = offset + ((step > 0) ? 0 : (orig_len - 1));
-
-    VALUE result = ary_new(klass, len);
-    if (ARY_EMBED_P(result)) {
-        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
-        const VALUE *values = RARRAY_CONST_PTR(ary);
-
-        for (i = 0; i < len; ++i) {
-            RB_OBJ_WRITE(result, ptr+i, values[j]);
-            j += step;
-        }
-        ARY_SET_EMBED_LEN(result, len);
-    }
-    else {
-        const VALUE *values = RARRAY_CONST_PTR(ary);
-
-        RARRAY_PTR_USE(result, ptr, {
-            for (i = 0; i < len; ++i) {
-                RB_OBJ_WRITE(result, ptr+i, values[j]);
-                j += step;
-            }
-        });
-        ARY_SET_LEN(result, len);
-    }
-
-    return result;
 }
 
 static VALUE
 ary_make_shared_copy(VALUE ary)
 {
-    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
+    return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
 }
 
 enum ary_take_pos_flags
@@ -1331,59 +883,53 @@ enum ary_take_pos_flags
 };
 
 static VALUE
-ary_take_first_or_last_n(VALUE ary, long n, enum ary_take_pos_flags last)
+ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
 {
-    long len = RARRAY_LEN(ary);
+    VALUE nv;
+    long n;
+    long len;
     long offset = 0;
 
+    rb_scan_args(argc, argv, "1", &nv);
+    n = NUM2LONG(nv);
+    len = RARRAY_LEN(ary);
     if (n > len) {
-        n = len;
+	n = len;
     }
     else if (n < 0) {
-        rb_raise(rb_eArgError, "negative array size");
+	rb_raise(rb_eArgError, "negative array size");
     }
     if (last) {
-        offset = len - n;
+	offset = len - n;
     }
     return ary_make_partial(ary, rb_cArray, offset, n);
 }
 
-static VALUE
-ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
-{
-    argc = rb_check_arity(argc, 0, 1);
-    /* the case optional argument is omitted should be handled in
-     * callers of this function.  if another arity case is added,
-     * this arity check needs to rewrite. */
-    RUBY_ASSERT_ALWAYS(argc == 1);
-    return ary_take_first_or_last_n(ary, NUM2LONG(argv[0]), last);
-}
-
 /*
  *  call-seq:
- *    self << object -> self
- *
- *  Appends +object+ as the last element in +self+; returns +self+:
+ *     ary << obj            -> ary
  *
- *    [:foo, 'bar', 2] << :baz # => [:foo, "bar", 2, :baz]
+ *  Append---Pushes the given object on to the end of this array. This
+ *  expression returns the array itself, so several appends
+ *  may be chained together.
  *
- *  Appends +object+ as a single element, even if it is another array:
+ *     a = [ 1, 2 ]
+ *     a << "c" << "d" << [ 3, 4 ]
+ *             #=>  [ 1, 2, "c", "d", [ 3, 4 ] ]
+ *     a
+ *             #=>  [ 1, 2, "c", "d", [ 3, 4 ] ]
  *
- *    [:foo, 'bar', 2] << [3, 4] # => [:foo, "bar", 2, [3, 4]]
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 VALUE
 rb_ary_push(VALUE ary, VALUE item)
 {
-    long idx = RARRAY_LEN((ary_verify(ary), ary));
+    long idx = RARRAY_LEN(ary);
     VALUE target_ary = ary_ensure_room_for_push(ary, 1);
     RARRAY_PTR_USE(ary, ptr, {
-        RB_OBJ_WRITE(target_ary, &ptr[idx], item);
+	RB_OBJ_WRITE(target_ary, &ptr[idx], item);
     });
     ARY_SET_LEN(ary, idx + 1);
-    ary_verify(ary);
     return ary;
 }
 
@@ -1399,20 +945,18 @@ rb_ary_cat(VALUE ary, const VALUE *argv, long len)
 
 /*
  *  call-seq:
- *    push(*objects) -> self
- *    append(*objects) -> self
- *
- *  Appends each argument in +objects+ to +self+; returns +self+:
- *
- *    a = [:foo, 'bar', 2] # => [:foo, "bar", 2]
- *    a.push(:baz, :bat)   # => [:foo, "bar", 2, :baz, :bat]
- *
- *  Appends each argument as a single element, even if it is another array:
- *
- *    a = [:foo, 'bar', 2]               # => [:foo, "bar", 2]
-      a.push([:baz, :bat], [:bam, :bad]) # => [:foo, "bar", 2, [:baz, :bat], [:bam, :bad]]
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     ary.push(obj, ... )   -> ary
+ *
+ *  Append --- Pushes the given object(s) on to the end of this array. This
+ *  expression returns the array itself, so several appends
+ *  may be chained together. See also Array#pop for the opposite
+ *  effect.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.push("d", "e", "f")
+ *             #=> ["a", "b", "c", "d", "e", "f"]
+ *     [1, 2, 3].push(4).push(5)
+ *             #=> [1, 2, 3, 4, 5]
  */
 
 static VALUE
@@ -1429,45 +973,32 @@ rb_ary_pop(VALUE ary)
     n = RARRAY_LEN(ary);
     if (n == 0) return Qnil;
     if (ARY_OWNS_HEAP_P(ary) &&
-        n * 3 < ARY_CAPA(ary) &&
-        ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+	n * 3 < ARY_CAPA(ary) &&
+	ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
     {
-        ary_resize_capa(ary, n * 2);
+	ary_resize_capa(ary, n * 2);
     }
     --n;
     ARY_SET_LEN(ary, n);
-    ary_verify(ary);
     return RARRAY_AREF(ary, n);
 }
 
 /*
  *  call-seq:
- *    pop -> object or nil
- *    pop(count) -> new_array
- *
- *  Removes and returns trailing elements of +self+.
- *
- *  With no argument given, removes and returns the last element, if available;
- *  otherwise returns +nil+:
+ *     ary.pop    -> obj or nil
+ *     ary.pop(n) -> new_ary
  *
- *    a = [:foo, 'bar', 2]
- *    a.pop  # => 2
- *    a      # => [:foo, "bar"]
- *    [].pop # => nil
+ *  Removes the last element from +self+ and returns it, or
+ *  +nil+ if the array is empty.
  *
- *  With non-negative integer argument +count+ given,
- *  returns a new array containing the trailing +count+ elements of +self+, as available:
+ *  If a number +n+ is given, returns an array of the last +n+ elements
+ *  (or less) just like <code>array.slice!(-n, n)</code> does. See also
+ *  Array#push for the opposite effect.
  *
- *    a = [:foo, 'bar', 2]
- *    a.pop(2) # => ["bar", 2]
- *    a        # => [:foo]
- *
- *    a = [:foo, 'bar', 2]
- *    a.pop(50) # => [:foo, "bar", 2]
- *    a         # => []
- *
- *  Related: Array#push;
- *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.pop     #=> "d"
+ *     a.pop(2)  #=> ["b", "c"]
+ *     a         #=> ["a"]
  */
 
 static VALUE
@@ -1476,13 +1007,12 @@ rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
     VALUE result;
 
     if (argc == 0) {
-        return rb_ary_pop(ary);
+	return rb_ary_pop(ary);
     }
 
     rb_ary_modify_check(ary);
     result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
-    ary_verify(ary);
     return result;
 }
 
@@ -1492,54 +1022,52 @@ rb_ary_shift(VALUE ary)
     VALUE top;
     long len = RARRAY_LEN(ary);
 
-    if (len == 0) {
-        rb_ary_modify_check(ary);
-        return Qnil;
-    }
-
+    rb_ary_modify_check(ary);
+    if (len == 0) return Qnil;
     top = RARRAY_AREF(ary, 0);
-
-    rb_ary_behead(ary, 1);
+    if (!ARY_SHARED_P(ary)) {
+	if (len < ARY_DEFAULT_SIZE) {
+	    RARRAY_PTR_USE(ary, ptr, {
+		MEMMOVE(ptr, ptr+1, VALUE, len-1);
+	    }); /* WB: no new reference */
+            ARY_INCREASE_LEN(ary, -1);
+	    return top;
+	}
+        assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
+
+	ARY_SET(ary, 0, Qnil);
+	ary_make_shared(ary);
+    }
+    else if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
+	RARRAY_PTR_USE(ary, ptr, ptr[0] = Qnil);
+    }
+    ARY_INCREASE_PTR(ary, 1);		/* shift ptr */
+    ARY_INCREASE_LEN(ary, -1);
 
     return top;
 }
 
 /*
  *  call-seq:
- *    shift -> object or nil
- *    shift(count) -> new_array or nil
- *
- *  Removes and returns leading elements from +self+.
- *
- *  With no argument, removes and returns one element, if available,
- *  or +nil+ otherwise:
- *
- *    a = [0, 1, 2, 3]
- *    a.shift  # => 0
- *    a        # => [1, 2, 3]
- *    [].shift # => nil
- *
- *  With non-negative numeric argument +count+ given,
- *  removes and returns the first +count+ elements:
- *
- *    a = [0, 1, 2, 3]
- *    a.shift(2)   # => [0, 1]
- *    a            # => [2, 3]
- *    a.shift(1.1) # => [2]
- *    a            # => [3]
- *    a.shift(0)   # => []
- *    a            # => [3]
+ *     ary.shift    -> obj or nil
+ *     ary.shift(n) -> new_ary
  *
- *  If +count+ is large,
- *  removes and returns all elements:
+ *  Removes the first element of +self+ and returns it (shifting all
+ *  other elements down by one). Returns +nil+ if the array
+ *  is empty.
  *
- *    a = [0, 1, 2, 3]
- *    a.shift(50) # => [0, 1, 2, 3]
- *    a           # => []
+ *  If a number +n+ is given, returns an array of the first +n+ elements
+ *  (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
+ *  containing only the remainder elements, not including what was shifted to
+ *  +new_ary+. See also Array#unshift for the opposite effect.
  *
- *  If +self+ is empty, returns a new empty array.
+ *     args = [ "-m", "-q", "filename" ]
+ *     args.shift     #=> "-m"
+ *     args           #=> ["-q", "filename"]
  *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     args = [ "-m", "-q", "filename" ]
+ *     args.shift(2)  #=> ["-m", "-q"]
+ *     args           #=> ["filename"]
  */
 
 static VALUE
@@ -1549,158 +1077,116 @@ rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
     long n;
 
     if (argc == 0) {
-        return rb_ary_shift(ary);
+	return rb_ary_shift(ary);
     }
 
     rb_ary_modify_check(ary);
     result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
     n = RARRAY_LEN(result);
-    rb_ary_behead(ary,n);
-
-    return result;
-}
-
-VALUE
-rb_ary_behead(VALUE ary, long n)
-{
-    if (n <= 0) {
-        return ary;
-    }
-
-    rb_ary_modify_check(ary);
-
-    if (!ARY_SHARED_P(ary)) {
-        if (ARY_EMBED_P(ary) || RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
-            RARRAY_PTR_USE(ary, ptr, {
-                MEMMOVE(ptr, ptr + n, VALUE, RARRAY_LEN(ary) - n);
-            }); /* WB: no new reference */
-            ARY_INCREASE_LEN(ary, -n);
-            ary_verify(ary);
-            return ary;
-        }
-
-        ary_mem_clear(ary, 0, n);
-        ary_make_shared(ary);
+    if (ARY_SHARED_P(ary)) {
+	if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
+	  setup_occupied_shared:
+	    ary_mem_clear(ary, 0, n);
+	}
+        ARY_INCREASE_PTR(ary, n);
     }
-    else if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
-        ary_mem_clear(ary, 0, n);
+    else {
+	if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+	    RARRAY_PTR_USE(ary, ptr, {
+		MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
+	    }); /* WB: no new reference */
+	}
+	else {
+	    ary_make_shared(ary);
+	    goto setup_occupied_shared;
+	}
     }
-
-    ARY_INCREASE_PTR(ary, n);
     ARY_INCREASE_LEN(ary, -n);
-    ary_verify(ary);
-
-    return ary;
-}
-
-static VALUE
-make_room_for_unshift(VALUE ary, const VALUE *head, VALUE *sharedp, int argc, long capa, long len)
-{
-    if (head - sharedp < argc) {
-        long room = capa - len - argc;
 
-        room -= room >> 4;
-        MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
-        head = sharedp + argc + room;
-    }
-    ARY_SET_PTR(ary, head - argc);
-    RUBY_ASSERT(ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary)));
-
-    ary_verify(ary);
-    return ARY_SHARED_ROOT(ary);
+    return result;
 }
 
 static VALUE
-ary_modify_for_unshift(VALUE ary, int argc)
+ary_ensure_room_for_unshift(VALUE ary, int argc)
 {
     long len = RARRAY_LEN(ary);
     long new_len = len + argc;
     long capa;
     const VALUE *head, *sharedp;
 
-    rb_ary_modify(ary);
-    capa = ARY_CAPA(ary);
-    if (capa - (capa >> 6) <= new_len) {
-        ary_double_capa(ary, new_len);
+    if (len > ARY_MAX_SIZE - argc) {
+	rb_raise(rb_eIndexError, "index %ld too big", new_len);
     }
 
-    /* use shared array for big "queues" */
-    if (new_len > ARY_DEFAULT_SIZE * 4 && !ARY_EMBED_P(ary)) {
-        ary_verify(ary);
-
-        /* make a room for unshifted items */
-        capa = ARY_CAPA(ary);
-        ary_make_shared(ary);
+    rb_ary_modify(ary);
 
-        head = sharedp = RARRAY_CONST_PTR(ary);
-        return make_room_for_unshift(ary, head, (void *)sharedp, argc, capa, len);
+    if (ARY_SHARED_P(ary)) {
+	VALUE shared = ARY_SHARED(ary);
+	capa = RARRAY_LEN(shared);
+	if (ARY_SHARED_OCCUPIED(shared) && capa > new_len) {
+	    head = RARRAY_CONST_PTR(ary);
+	    sharedp = RARRAY_CONST_PTR(shared);
+	    goto makeroom_if_need;
+	}
     }
-    else {
-        /* sliding items */
-        RARRAY_PTR_USE(ary, ptr, {
-            MEMMOVE(ptr + argc, ptr, VALUE, len);
-        });
 
-        ary_verify(ary);
-        return ary;
+    capa = ARY_CAPA(ary);
+    if (capa - (capa >> 6) <= new_len) {
+	ary_double_capa(ary, new_len);
     }
-}
-
-static VALUE
-ary_ensure_room_for_unshift(VALUE ary, int argc)
-{
-    long len = RARRAY_LEN(ary);
-    long new_len = len + argc;
 
-    if (len > ARY_MAX_SIZE - argc) {
-        rb_raise(rb_eIndexError, "index %ld too big", new_len);
-    }
-    else if (! ARY_SHARED_P(ary)) {
-        return ary_modify_for_unshift(ary, argc);
+    /* use shared array for big "queues" */
+    if (new_len > ARY_DEFAULT_SIZE * 4) {
+	/* make a room for unshifted items */
+	capa = ARY_CAPA(ary);
+	ary_make_shared(ary);
+
+	head = sharedp = RARRAY_CONST_PTR(ary);
+	goto makeroom;
+      makeroom_if_need:
+	if (head - sharedp < argc) {
+	    long room;
+	  makeroom:
+	    room = capa - new_len;
+	    room -= room >> 4;
+	    MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+	    head = sharedp + argc + room;
+	}
+	ARY_SET_PTR(ary, head - argc);
+	assert(ARY_SHARED_OCCUPIED(ARY_SHARED(ary)));
+	return ARY_SHARED(ary);
     }
     else {
-        VALUE shared_root = ARY_SHARED_ROOT(ary);
-        long capa = RARRAY_LEN(shared_root);
+	/* sliding items */
+	RARRAY_PTR_USE(ary, ptr, {
+	    MEMMOVE(ptr + argc, ptr, VALUE, len);
+	});
 
-        if (! ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
-            return ary_modify_for_unshift(ary, argc);
-        }
-        else if (new_len > capa) {
-            return ary_modify_for_unshift(ary, argc);
-        }
-        else {
-            const VALUE * head = RARRAY_CONST_PTR(ary);
-            void *sharedp = (void *)RARRAY_CONST_PTR(shared_root);
-
-            rb_ary_modify_check(ary);
-            return make_room_for_unshift(ary, head, sharedp, argc, capa, len);
-        }
+	return ary;
     }
 }
 
 /*
  *  call-seq:
- *    unshift(*objects) -> self
- *    prepend(*objects) -> self
- *
- *  Prepends the given +objects+ to +self+:
+ *     ary.unshift(obj, ...)  -> ary
  *
- *    a = [:foo, 'bar', 2]
- *    a.unshift(:bam, :bat) # => [:bam, :bat, :foo, "bar", 2]
+ *  Prepends objects to the front of +self+, moving other elements upwards.
+ *  See also Array#shift for the opposite effect.
  *
- *  Related: Array#shift;
- *  see also {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ "b", "c", "d" ]
+ *     a.unshift("a")   #=> ["a", "b", "c", "d"]
+ *     a.unshift(1, 2)  #=> [ 1, 2, "a", "b", "c", "d"]
  */
 
-VALUE
+static VALUE
 rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
 {
     long len = RARRAY_LEN(ary);
     VALUE target_ary;
 
     if (argc == 0) {
-        rb_ary_modify_check(ary);
-        return ary;
+	rb_ary_modify_check(ary);
+	return ary;
     }
 
     target_ary = ary_ensure_room_for_unshift(ary, argc);
@@ -1712,7 +1198,7 @@ rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
 VALUE
 rb_ary_unshift(VALUE ary, VALUE item)
 {
-    return rb_ary_unshift_m(1, &item, ary);
+    return rb_ary_unshift_m(1,&item,ary);
 }
 
 /* faster version - use this if you don't need to treat negative offset */
@@ -1722,7 +1208,7 @@ rb_ary_elt(VALUE ary, long offset)
     long len = RARRAY_LEN(ary);
     if (len == 0) return Qnil;
     if (offset < 0 || len <= offset) {
-        return Qnil;
+	return Qnil;
     }
     return RARRAY_AREF(ary, offset);
 }
@@ -1730,11 +1216,21 @@ rb_ary_elt(VALUE ary, long offset)
 VALUE
 rb_ary_entry(VALUE ary, long offset)
 {
-    return rb_ary_entry_internal(ary, offset);
+    long len = RARRAY_LEN(ary);
+    const VALUE *ptr = RARRAY_CONST_PTR(ary);
+    if (len == 0) return Qnil;
+    if (offset < 0) {
+        offset += len;
+        if (offset < 0) return Qnil;
+    }
+    else if (len <= offset) {
+        return Qnil;
+    }
+    return ptr[offset];
 }
 
 VALUE
-rb_ary_subseq_step(VALUE ary, long beg, long len, long step)
+rb_ary_subseq(VALUE ary, long beg, long len)
 {
     VALUE klass;
     long alen = RARRAY_LEN(ary);
@@ -1743,146 +1239,48 @@ rb_ary_subseq_step(VALUE ary, long beg, long len, long step)
     if (beg < 0 || len < 0) return Qnil;
 
     if (alen < len || alen < beg + len) {
-        len = alen - beg;
+	len = alen - beg;
     }
-    klass = rb_cArray;
+    klass = rb_obj_class(ary);
     if (len == 0) return ary_new(klass, 0);
-    if (step == 0)
-        rb_raise(rb_eArgError, "slice step cannot be zero");
-    if (step == 1)
-        return ary_make_partial(ary, klass, beg, len);
-    else
-        return ary_make_partial_step(ary, klass, beg, len, step);
-}
 
-VALUE
-rb_ary_subseq(VALUE ary, long beg, long len)
-{
-    return rb_ary_subseq_step(ary, beg, len, 1);
+    return ary_make_partial(ary, klass, beg, len);
 }
 
-static VALUE rb_ary_aref2(VALUE ary, VALUE b, VALUE e);
-
 /*
  *  call-seq:
- *    self[index] -> object or nil
- *    self[start, length] -> object or nil
- *    self[range] -> object or nil
- *    self[aseq] -> object or nil
- *    slice(index) -> object or nil
- *    slice(start, length) -> object or nil
- *    slice(range) -> object or nil
- *    slice(aseq) -> object or nil
- *
- *  Returns elements from +self+; does not modify +self+.
- *
- *  In brief:
- *
- *    a = [:foo, 'bar', 2]
+ *     ary[index]                -> obj     or nil
+ *     ary[start, length]        -> new_ary or nil
+ *     ary[range]                -> new_ary or nil
+ *     ary.slice(index)          -> obj     or nil
+ *     ary.slice(start, length)  -> new_ary or nil
+ *     ary.slice(range)          -> new_ary or nil
+ *
+ *  Element Reference --- Returns the element at +index+, or returns a
+ *  subarray starting at the +start+ index and continuing for +length+
+ *  elements, or returns a subarray specified by +range+ of indices.
+ *
+ *  Negative indices count backward from the end of the array (-1 is the last
+ *  element).  For +start+ and +range+ cases the starting index is just before
+ *  an element.  Additionally, an empty array is returned when the starting
+ *  index for an element range is at the end of the array.
+ *
+ *  Returns +nil+ if the index (or starting index) are out of range.
+ *
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a[2] +  a[0] + a[1]    #=> "cab"
+ *     a[6]                   #=> nil
+ *     a[1, 2]                #=> [ "b", "c" ]
+ *     a[1..3]                #=> [ "b", "c", "d" ]
+ *     a[4..7]                #=> [ "e" ]
+ *     a[6..10]               #=> nil
+ *     a[-3, 3]               #=> [ "c", "d", "e" ]
+ *     # special cases
+ *     a[5]                   #=> nil
+ *     a[6, 1]                #=> nil
+ *     a[5, 1]                #=> []
+ *     a[5..10]               #=> []
  *
- *    # Single argument index: returns one element.
- *    a[0]     # => :foo          # Zero-based index.
- *    a[-1]    # => 2             # Negative index counts backwards from end.
- *
- *    # Arguments start and length: returns an array.
- *    a[1, 2]  # => ["bar", 2]
- *    a[-2, 2] # => ["bar", 2]    # Negative start counts backwards from end.
- *
- *    # Single argument range: returns an array.
- *    a[0..1]  # => [:foo, "bar"]
- *    a[0..-2] # => [:foo, "bar"] # Negative range-begin counts backwards from end.
- *    a[-2..2] # => ["bar", 2]    # Negative range-end counts backwards from end.
- *
- *  When a single integer argument +index+ is given, returns the element at offset +index+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0] # => :foo
- *    a[2] # => 2
- *    a # => [:foo, "bar", 2]
- *
- *  If +index+ is negative, counts backwards from the end of +self+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[-1] # => 2
- *    a[-2] # => "bar"
- *
- *  If +index+ is out of range, returns +nil+.
- *
- *  When two Integer arguments +start+ and +length+ are given,
- *  returns a new +Array+ of size +length+ containing successive elements beginning at offset +start+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0, 2] # => [:foo, "bar"]
- *    a[1, 2] # => ["bar", 2]
- *
- *  If <tt>start + length</tt> is greater than <tt>self.length</tt>,
- *  returns all elements from offset +start+ to the end:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0, 4] # => [:foo, "bar", 2]
- *    a[1, 3] # => ["bar", 2]
- *    a[2, 2] # => [2]
- *
- *  If <tt>start == self.size</tt> and <tt>length >= 0</tt>,
- *  returns a new empty +Array+.
- *
- *  If +length+ is negative, returns +nil+.
- *
- *  When a single Range argument +range+ is given,
- *  treats <tt>range.min</tt> as +start+ above
- *  and <tt>range.size</tt> as +length+ above:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0..1] # => [:foo, "bar"]
- *    a[1..2] # => ["bar", 2]
- *
- *  Special case: If <tt>range.start == a.size</tt>, returns a new empty +Array+.
- *
- *  If <tt>range.end</tt> is negative, calculates the end index from the end:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0..-1] # => [:foo, "bar", 2]
- *    a[0..-2] # => [:foo, "bar"]
- *    a[0..-3] # => [:foo]
- *
- *  If <tt>range.start</tt> is negative, calculates the start index from the end:
- *
- *    a = [:foo, 'bar', 2]
- *    a[-1..2] # => [2]
- *    a[-2..2] # => ["bar", 2]
- *    a[-3..2] # => [:foo, "bar", 2]
- *
- *  If <tt>range.start</tt> is larger than the array size, returns +nil+.
- *
- *    a = [:foo, 'bar', 2]
- *    a[4..1] # => nil
- *    a[4..0] # => nil
- *    a[4..-1] # => nil
- *
- *  When a single Enumerator::ArithmeticSequence argument +aseq+ is given,
- *  returns an +Array+ of elements corresponding to the indexes produced by
- *  the sequence.
- *
- *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
- *    a[(1..).step(2)] # => ["data1", "data2", "data3"]
- *
- *  Unlike slicing with range, if the start or the end of the arithmetic sequence
- *  is larger than array size, throws RangeError.
- *
- *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
- *    a[(1..11).step(2)]
- *    # RangeError (((1..11).step(2)) out of range)
- *    a[(7..).step(2)]
- *    # RangeError (((7..).step(2)) out of range)
- *
- *  If given a single argument, and its type is not one of the listed, tries to
- *  convert it to Integer, and raises if it is impossible:
- *
- *    a = [:foo, 'bar', 2]
- *    # Raises TypeError (no implicit conversion of Symbol into Integer):
- *    a[:foo]
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
@@ -1890,18 +1288,18 @@ rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
 {
     rb_check_arity(argc, 1, 2);
     if (argc == 2) {
-        return rb_ary_aref2(ary, argv[0], argv[1]);
+	return rb_ary_aref2(ary, argv[0], argv[1]);
     }
     return rb_ary_aref1(ary, argv[0]);
 }
 
-static VALUE
+VALUE
 rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
 {
     long beg = NUM2LONG(b);
     long len = NUM2LONG(e);
     if (beg < 0) {
-        beg += RARRAY_LEN(ary);
+	beg += RARRAY_LEN(ary);
     }
     return rb_ary_subseq(ary, beg, len);
 }
@@ -1909,47 +1307,35 @@ rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
 VALUE
 rb_ary_aref1(VALUE ary, VALUE arg)
 {
-    long beg, len, step;
+    long beg, len;
 
     /* special case - speeding up */
     if (FIXNUM_P(arg)) {
-        return rb_ary_entry(ary, FIX2LONG(arg));
+	return rb_ary_entry(ary, FIX2LONG(arg));
     }
-    /* check if idx is Range or ArithmeticSequence */
-    switch (rb_arithmetic_sequence_beg_len_step(arg, &beg, &len, &step, RARRAY_LEN(ary), 0)) {
+    /* check if idx is Range */
+    switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
       case Qfalse:
-        break;
+	break;
       case Qnil:
-        return Qnil;
+	return Qnil;
       default:
-        return rb_ary_subseq_step(ary, beg, len, step);
+	return rb_ary_subseq(ary, beg, len);
     }
-
     return rb_ary_entry(ary, NUM2LONG(arg));
 }
 
 /*
  *  call-seq:
- *    at(index) -> object or nil
- *
- *  Returns the element of +self+ specified by the given +index+
- *  or +nil+ if there is no such element;
- *  +index+ must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
- *
- *  For non-negative +index+, returns the element of +self+ at offset +index+:
- *
- *    a = [:foo, 'bar', 2]
- *    a.at(0)   # => :foo
- *    a.at(2)   # => 2
- *    a.at(2.0) # => 2
- *
- *  For negative +index+, counts backwards from the end of +self+:
+ *     ary.at(index)   ->   obj  or nil
  *
- *    a.at(-2) # => "bar"
+ *  Returns the element at +index+. A negative index counts from the end of
+ *  +self+. Returns +nil+ if the index is out of range. See also
+ *  Array#[].
  *
- *  Related: Array#[];
- *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a.at(0)     #=> "a"
+ *     a.at(-1)    #=> "e"
  */
 
 VALUE
@@ -1958,82 +1344,83 @@ rb_ary_at(VALUE ary, VALUE pos)
     return rb_ary_entry(ary, NUM2LONG(pos));
 }
 
-#if 0
+/*
+ *  call-seq:
+ *     ary.first     ->   obj or nil
+ *     ary.first(n)  ->   new_ary
+ *
+ *  Returns the first element, or the first +n+ elements, of the array.
+ *  If the array is empty, the first form returns +nil+, and the
+ *  second form returns an empty array. See also Array#last for
+ *  the opposite effect.
+ *
+ *     a = [ "q", "r", "s", "t" ]
+ *     a.first     #=> "q"
+ *     a.first(2)  #=> ["q", "r"]
+ */
+
 static VALUE
 rb_ary_first(int argc, VALUE *argv, VALUE ary)
 {
     if (argc == 0) {
-        if (RARRAY_LEN(ary) == 0) return Qnil;
-        return RARRAY_AREF(ary, 0);
+	if (RARRAY_LEN(ary) == 0) return Qnil;
+	return RARRAY_AREF(ary, 0);
     }
     else {
-        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
     }
 }
-#endif
-
-static VALUE
-ary_first(VALUE self)
-{
-    return (RARRAY_LEN(self) == 0) ? Qnil : RARRAY_AREF(self, 0);
-}
 
-static VALUE
-ary_last(VALUE self)
-{
-    long len = RARRAY_LEN(self);
-    return (len == 0) ? Qnil : RARRAY_AREF(self, len-1);
-}
+/*
+ *  call-seq:
+ *     ary.last     ->  obj or nil
+ *     ary.last(n)  ->  new_ary
+ *
+ *  Returns the last element(s) of +self+. If the array is empty,
+ *  the first form returns +nil+.
+ *
+ *  See also Array#first for the opposite effect.
+ *
+ *     a = [ "w", "x", "y", "z" ]
+ *     a.last     #=> "z"
+ *     a.last(2)  #=> ["y", "z"]
+ */
 
 VALUE
-rb_ary_last(int argc, const VALUE *argv, VALUE ary) // used by parse.y
+rb_ary_last(int argc, const VALUE *argv, VALUE ary)
 {
     if (argc == 0) {
-        return ary_last(ary);
+	long len = RARRAY_LEN(ary);
+	if (len == 0) return Qnil;
+	return RARRAY_AREF(ary, len-1);
     }
     else {
-        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     }
 }
 
 /*
  *  call-seq:
- *    fetch(index) -> element
- *    fetch(index, default_value) -> element or default_value
- *    fetch(index) {|index| ... } -> element or block_return_value
- *
- *  Returns the element of +self+ at offset +index+ if +index+ is in range; +index+ must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
- *
- *  With the single argument +index+ and no block,
- *  returns the element at offset +index+:
- *
- *    a = [:foo, 'bar', 2]
- *    a.fetch(1)   # => "bar"
- *    a.fetch(1.1) # => "bar"
- *
- *  If +index+ is negative, counts from the end of the array:
- *
- *    a = [:foo, 'bar', 2]
- *    a.fetch(-1) # => 2
- *    a.fetch(-2) # => "bar"
- *
- *  With arguments +index+ and +default_value+ (which may be any object) and no block,
- *  returns +default_value+ if +index+ is out-of-range:
- *
- *    a = [:foo, 'bar', 2]
- *    a.fetch(1, nil)  # => "bar"
- *    a.fetch(3, :foo) # => :foo
- *
- *  With argument +index+ and a block,
- *  returns the element at offset +index+ if index is in range
- *  (and the block is not called); otherwise calls the block with index and returns its return value:
- *
- *    a = [:foo, 'bar', 2]
- *    a.fetch(1) {|index| raise 'Cannot happen' } # => "bar"
- *    a.fetch(50) {|index| "Value for #{index}" } # => "Value for 50"
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     ary.fetch(index)                    -> obj
+ *     ary.fetch(index, default)           -> obj
+ *     ary.fetch(index) { |index| block }  -> obj
+ *
+ *  Tries to return the element at position +index+, but throws an IndexError
+ *  exception if the referenced +index+ lies outside of the array bounds.  This
+ *  error can be prevented by supplying a second argument, which will act as a
+ *  +default+ value.
+ *
+ *  Alternatively, if a block is given it will only be executed when an
+ *  invalid +index+ is referenced.
+ *
+ *  Negative values of +index+ count from the end of the array.
+ *
+ *     a = [ 11, 22, 33, 44 ]
+ *     a.fetch(1)               #=> 22
+ *     a.fetch(-1)              #=> 44
+ *     a.fetch(4, 'cat')        #=> "cat"
+ *     a.fetch(100) { |i| puts "#{i} is out of bounds" }
+ *                              #=> "100 is out of bounds"
  */
 
 static VALUE
@@ -2046,56 +1433,48 @@ rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
     rb_scan_args(argc, argv, "11", &pos, &ifnone);
     block_given = rb_block_given_p();
     if (block_given && argc == 2) {
-        rb_warn("block supersedes default value argument");
+	rb_warn("block supersedes default value argument");
     }
     idx = NUM2LONG(pos);
 
     if (idx < 0) {
-        idx +=  RARRAY_LEN(ary);
+	idx +=  RARRAY_LEN(ary);
     }
     if (idx < 0 || RARRAY_LEN(ary) <= idx) {
-        if (block_given) return rb_yield(pos);
-        if (argc == 1) {
-            rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
-                        idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
-        }
-        return ifnone;
+	if (block_given) return rb_yield(pos);
+	if (argc == 1) {
+	    rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+			idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+	}
+	return ifnone;
     }
     return RARRAY_AREF(ary, idx);
 }
 
 /*
  *  call-seq:
- *    find_index(object) -> integer or nil
- *    find_index {|element| ... } -> integer or nil
- *    find_index -> new_enumerator
- *    index(object) -> integer or nil
- *    index {|element| ... } -> integer or nil
- *    index -> new_enumerator
- *
- *  Returns the zero-based integer index of a specified element, or +nil+.
+ *     ary.find_index(obj)             ->  int or nil
+ *     ary.find_index { |item| block } ->  int or nil
+ *     ary.find_index                  ->  Enumerator
+ *     ary.index(obj)             ->  int or nil
+ *     ary.index { |item| block } ->  int or nil
+ *     ary.index                  ->  Enumerator
  *
- *  With only argument +object+ given,
- *  returns the index of the first element +element+
- *  for which <tt>object == element</tt>:
+ *  Returns the _index_ of the first object in +ary+ such that the object is
+ *  <code>==</code> to +obj+.
  *
- *    a = [:foo, 'bar', 2, 'bar']
- *    a.index('bar') # => 1
+ *  If a block is given instead of an argument, returns the _index_ of the
+ *  first object for which the block returns +true+.  Returns +nil+ if no
+ *  match is found.
  *
- *  Returns +nil+ if no such element found.
+ *  See also Array#rindex.
  *
- *  With only a block given,
- *  calls the block with each successive element;
- *  returns the index of the first element for which the block returns a truthy value:
+ *  An Enumerator is returned if neither a block nor argument is given.
  *
- *    a = [:foo, 'bar', 2, 'bar']
- *    a.index {|element| element == 'bar' } # => 1
- *
- *  Returns +nil+ if the block never returns a truthy value.
- *
- *  With neither an argument nor a block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *     a = [ "a", "b", "c" ]
+ *     a.index("b")              #=> 1
+ *     a.index("z")              #=> nil
+ *     a.index { |x| x == "b" }  #=> 1
  */
 
 static VALUE
@@ -2105,53 +1484,49 @@ rb_ary_index(int argc, VALUE *argv, VALUE ary)
     long i;
 
     if (argc == 0) {
-        RETURN_ENUMERATOR(ary, 0, 0);
-        for (i=0; i<RARRAY_LEN(ary); i++) {
-            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-                return LONG2NUM(i);
-            }
-        }
-        return Qnil;
+	RETURN_ENUMERATOR(ary, 0, 0);
+	for (i=0; i<RARRAY_LEN(ary); i++) {
+	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+		return LONG2NUM(i);
+	    }
+	}
+	return Qnil;
     }
     rb_check_arity(argc, 0, 1);
     val = argv[0];
     if (rb_block_given_p())
-        rb_warn("given block not used");
+	rb_warn("given block not used");
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        VALUE e = RARRAY_AREF(ary, i);
-        if (rb_equal(e, val)) {
-            return LONG2NUM(i);
-        }
+	VALUE e = RARRAY_AREF(ary, i);
+	if (rb_equal(e, val)) {
+	    return LONG2NUM(i);
+	}
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *    rindex(object) -> integer or nil
- *    rindex {|element| ... } -> integer or nil
- *    rindex -> new_enumerator
- *
- *  Returns the index of the last element for which <tt>object == element</tt>.
- *
- *  With argument +object+ given, returns the index of the last such element found:
+ *     ary.rindex(obj)             ->  int or nil
+ *     ary.rindex { |item| block } ->  int or nil
+ *     ary.rindex                  ->  Enumerator
  *
- *    a = [:foo, 'bar', 2, 'bar']
- *    a.rindex('bar') # => 3
+ *  Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
  *
- *  Returns +nil+ if no such object found.
+ *  If a block is given instead of an argument, returns the _index_ of the
+ *  first object for which the block returns +true+, starting from the last
+ *  object.
  *
- *  With a block given, calls the block with each successive element;
- *  returns the index of the last element for which the block returns a truthy value:
+ *  Returns +nil+ if no match is found.
  *
- *    a = [:foo, 'bar', 2, 'bar']
- *    a.rindex {|element| element == 'bar' } # => 3
+ *  See also Array#index.
  *
- *  Returns +nil+ if the block never returns a truthy value.
+ *  If neither block nor argument is given, an Enumerator is returned instead.
  *
- *  When neither an argument nor a block is given, returns a new Enumerator.
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *     a = [ "a", "b", "b", "b", "c" ]
+ *     a.rindex("b")             #=> 3
+ *     a.rindex("z")             #=> nil
+ *     a.rindex { |x| x == "b" } #=> 3
  */
 
 static VALUE
@@ -2161,28 +1536,25 @@ rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
     long i = RARRAY_LEN(ary), len;
 
     if (argc == 0) {
-        RETURN_ENUMERATOR(ary, 0, 0);
-        while (i--) {
-            if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
-                return LONG2NUM(i);
-            if (i > (len = RARRAY_LEN(ary))) {
-                i = len;
-            }
-        }
-        return Qnil;
+	RETURN_ENUMERATOR(ary, 0, 0);
+	while (i--) {
+	    if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
+		return LONG2NUM(i);
+	    if (i > (len = RARRAY_LEN(ary))) {
+		i = len;
+	    }
+	}
+	return Qnil;
     }
     rb_check_arity(argc, 0, 1);
     val = argv[0];
     if (rb_block_given_p())
-        rb_warn("given block not used");
+	rb_warn("given block not used");
     while (i--) {
-        VALUE e = RARRAY_AREF(ary, i);
-        if (rb_equal(e, val)) {
-            return LONG2NUM(i);
-        }
-        if (i > RARRAY_LEN(ary)) {
-            break;
-        }
+	VALUE e = RARRAY_AREF(ary, i);
+	if (rb_equal(e, val)) {
+	    return LONG2NUM(i);
+	}
     }
     return Qnil;
 }
@@ -2205,69 +1577,57 @@ rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
     if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
     olen = RARRAY_LEN(ary);
     if (beg < 0) {
-        beg += olen;
-        if (beg < 0) {
-            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-                     beg - olen, -olen);
-        }
+	beg += olen;
+	if (beg < 0) {
+	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+		     beg - olen, -olen);
+	}
     }
     if (olen < len || olen < beg + len) {
-        len = olen - beg;
+	len = olen - beg;
     }
 
     {
-        const VALUE *optr = RARRAY_CONST_PTR(ary);
-        rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
+	const VALUE *optr = RARRAY_CONST_PTR(ary);
+	rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
     }
 
     if (beg >= olen) {
-        VALUE target_ary;
-        if (beg > ARY_MAX_SIZE - rlen) {
-            rb_raise(rb_eIndexError, "index %ld too big", beg);
-        }
-        target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
-        len = beg + rlen;
-        ary_mem_clear(ary, olen, beg - olen);
-        if (rlen > 0) {
-            if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
-            ary_memcpy0(ary, beg, rlen, rptr, target_ary);
-        }
-        ARY_SET_LEN(ary, len);
+	VALUE target_ary;
+	if (beg > ARY_MAX_SIZE - rlen) {
+	    rb_raise(rb_eIndexError, "index %ld too big", beg);
+	}
+	target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+	len = beg + rlen;
+	ary_mem_clear(ary, olen, beg - olen);
+	if (rlen > 0) {
+	    if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
+	    ary_memcpy0(ary, beg, rlen, rptr, target_ary);
+	}
+	ARY_SET_LEN(ary, len);
     }
     else {
-        long alen;
-
-        if (olen - len > ARY_MAX_SIZE - rlen) {
-            rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
-        }
-        rb_ary_modify(ary);
-        alen = olen + rlen - len;
-        if (alen >= ARY_CAPA(ary)) {
-            ary_double_capa(ary, alen);
-        }
-
-        if (len != rlen) {
-            RARRAY_PTR_USE(ary, ptr,
-                                     MEMMOVE(ptr + beg + rlen, ptr + beg + len,
-                                             VALUE, olen - (beg + len)));
-            ARY_SET_LEN(ary, alen);
-        }
-        if (rlen > 0) {
-            if (rofs == -1) {
-                rb_gc_writebarrier_remember(ary);
-            }
-            else {
-                /* In this case, we're copying from a region in this array, so
-                 * we don't need to fire the write barrier. */
-                rptr = RARRAY_CONST_PTR(ary) + rofs;
-            }
-
-            /* do not use RARRAY_PTR() because it can causes GC.
-             * ary can contain T_NONE object because it is not cleared.
-             */
-            RARRAY_PTR_USE(ary, ptr,
-                                     MEMMOVE(ptr + beg, rptr, VALUE, rlen));
-        }
+	long alen;
+
+	if (olen - len > ARY_MAX_SIZE - rlen) {
+	    rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
+	}
+	rb_ary_modify(ary);
+	alen = olen + rlen - len;
+	if (alen >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, alen);
+	}
+
+	if (len != rlen) {
+	    RARRAY_PTR_USE(ary, ptr,
+			   MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+				   VALUE, olen - (beg + len)));
+	    ARY_SET_LEN(ary, alen);
+	}
+	if (rlen > 0) {
+	    if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
+	    MEMMOVE(RARRAY_PTR(ary) + beg, rptr, VALUE, rlen);
+	}
     }
 }
 
@@ -2278,14 +1638,22 @@ rb_ary_set_len(VALUE ary, long len)
 
     rb_ary_modify_check(ary);
     if (ARY_SHARED_P(ary)) {
-        rb_raise(rb_eRuntimeError, "can't set length of shared ");
+	rb_raise(rb_eRuntimeError, "can't set length of shared ");
     }
     if (len > (capa = (long)ARY_CAPA(ary))) {
-        rb_bug("probable buffer overflow: %ld for %ld", len, capa);
+	rb_bug("probable buffer overflow: %ld for %ld", len, capa);
     }
     ARY_SET_LEN(ary, len);
 }
 
+/*!
+ * expands or shrinks \a ary to \a len elements.
+ * expanded region will be filled with Qnil.
+ * \param ary  an array
+ * \param len  new size
+ * \return     \a ary
+ * \post       the size of \a ary is \a len.
+ */
 VALUE
 rb_ary_resize(VALUE ary, long len)
 {
@@ -2295,260 +1663,117 @@ rb_ary_resize(VALUE ary, long len)
     olen = RARRAY_LEN(ary);
     if (len == olen) return ary;
     if (len > ARY_MAX_SIZE) {
-        rb_raise(rb_eIndexError, "index %ld too big", len);
+	rb_raise(rb_eIndexError, "index %ld too big", len);
     }
     if (len > olen) {
-        if (len > ARY_CAPA(ary)) {
-            ary_double_capa(ary, len);
-        }
-        ary_mem_clear(ary, olen, len - olen);
-        ARY_SET_LEN(ary, len);
+	if (len >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, len);
+	}
+	ary_mem_clear(ary, olen, len - olen);
+	ARY_SET_LEN(ary, len);
     }
     else if (ARY_EMBED_P(ary)) {
         ARY_SET_EMBED_LEN(ary, len);
     }
-    else if (len <= ary_embed_capa(ary)) {
-        const VALUE *ptr = ARY_HEAP_PTR(ary);
-        long ptr_capa = ARY_HEAP_SIZE(ary);
-        bool is_malloc_ptr = !ARY_SHARED_P(ary);
-
-        FL_SET_EMBED(ary);
-
-        MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len); /* WB: no new reference */
+    else if (len <= RARRAY_EMBED_LEN_MAX) {
+	VALUE tmp[RARRAY_EMBED_LEN_MAX];
+	MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
+	ary_discard(ary);
+	MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
         ARY_SET_EMBED_LEN(ary, len);
-
-        if (is_malloc_ptr) ruby_sized_xfree((void *)ptr, ptr_capa);
     }
     else {
-        if (olen > len + ARY_DEFAULT_SIZE) {
-            size_t new_capa = ary_heap_realloc(ary, len);
-            ARY_SET_CAPA(ary, new_capa);
-        }
-        ARY_SET_HEAP_LEN(ary, len);
+	if (olen > len + ARY_DEFAULT_SIZE) {
+	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len, RARRAY(ary)->as.heap.aux.capa);
+	    ARY_SET_CAPA(ary, len);
+	}
+	ARY_SET_HEAP_LEN(ary, len);
     }
-    ary_verify(ary);
     return ary;
 }
 
-static VALUE
-ary_aset_by_rb_ary_store(VALUE ary, long key, VALUE val)
-{
-    rb_ary_store(ary, key, val);
-    return val;
-}
-
-static VALUE
-ary_aset_by_rb_ary_splice(VALUE ary, long beg, long len, VALUE val)
-{
-    VALUE rpl = rb_ary_to_ary(val);
-    rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR(rpl), RARRAY_LEN(rpl));
-    RB_GC_GUARD(rpl);
-    return val;
-}
-
 /*
  *  call-seq:
- *    self[index] = object -> object
- *    self[start, length] = object -> object
- *    self[range] = object -> object
- *
- *  Assigns elements in +self+, based on the given +object+; returns +object+.
- *
- *  In brief:
- *
- *      a_orig = [:foo, 'bar', 2]
- *
- *      # With argument index.
- *      a = a_orig.dup
- *      a[0] = 'foo' # => "foo"
- *      a # => ["foo", "bar", 2]
- *      a = a_orig.dup
- *      a[7] = 'foo' # => "foo"
- *      a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
- *
- *      # With arguments start and length.
- *      a = a_orig.dup
- *      a[0, 2] = 'foo' # => "foo"
- *      a # => ["foo", 2]
- *      a = a_orig.dup
- *      a[6, 50] = 'foo' # => "foo"
- *      a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
- *
- *      # With argument range.
- *      a = a_orig.dup
- *      a[0..1] = 'foo' # => "foo"
- *      a # => ["foo", 2]
- *      a = a_orig.dup
- *      a[6..50] = 'foo' # => "foo"
- *      a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
- *
- *  When Integer argument +index+ is given, assigns +object+ to an element in +self+.
- *
- *  If +index+ is non-negative, assigns +object+ the element at offset +index+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0] = 'foo' # => "foo"
- *    a # => ["foo", "bar", 2]
- *
- *  If +index+ is greater than <tt>self.length</tt>, extends the array:
- *
- *    a = [:foo, 'bar', 2]
- *    a[7] = 'foo' # => "foo"
- *    a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
- *
- *  If +index+ is negative, counts backwards from the end of the array:
- *
- *    a = [:foo, 'bar', 2]
- *    a[-1] = 'two' # => "two"
- *    a # => [:foo, "bar", "two"]
- *
- *  When Integer arguments +start+ and +length+ are given and +object+ is not an +Array+,
- *  removes <tt>length - 1</tt> elements beginning at offset +start+,
- *  and assigns +object+ at offset +start+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0, 2] = 'foo' # => "foo"
- *    a # => ["foo", 2]
- *
- *  If +start+ is negative, counts backwards from the end of the array:
- *
- *    a = [:foo, 'bar', 2]
- *    a[-2, 2] = 'foo' # => "foo"
- *    a # => [:foo, "foo"]
- *
- *  If +start+ is non-negative and outside the array (<tt> >= self.size</tt>),
- *  extends the array with +nil+, assigns +object+ at offset +start+,
- *  and ignores +length+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[6, 50] = 'foo' # => "foo"
- *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
- *
- *  If +length+ is zero, shifts elements at and following offset +start+
- *  and assigns +object+ at offset +start+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[1, 0] = 'foo' # => "foo"
- *    a # => [:foo, "foo", "bar", 2]
- *
- *  If +length+ is too large for the existing array, does not extend the array:
- *
- *    a = [:foo, 'bar', 2]
- *    a[1, 5] = 'foo' # => "foo"
- *    a # => [:foo, "foo"]
- *
- *  When Range argument +range+ is given and +object+ is not an +Array+,
- *  removes <tt>length - 1</tt> elements beginning at offset +start+,
- *  and assigns +object+ at offset +start+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0..1] = 'foo' # => "foo"
- *    a # => ["foo", 2]
- *
- *  if <tt>range.begin</tt> is negative, counts backwards from the end of the array:
- *
- *    a = [:foo, 'bar', 2]
- *    a[-2..2] = 'foo' # => "foo"
- *    a # => [:foo, "foo"]
- *
- *  If the array length is less than <tt>range.begin</tt>,
- *  extends the array with +nil+, assigns +object+ at offset <tt>range.begin</tt>,
- *  and ignores +length+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[6..50] = 'foo' # => "foo"
- *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
- *
- *  If <tt>range.end</tt> is zero, shifts elements at and following offset +start+
- *  and assigns +object+ at offset +start+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[1..0] = 'foo' # => "foo"
- *    a # => [:foo, "foo", "bar", 2]
- *
- *  If <tt>range.end</tt> is negative, assigns +object+ at offset +start+,
- *  retains <tt>range.end.abs -1</tt> elements past that, and removes those beyond:
- *
- *    a = [:foo, 'bar', 2]
- *    a[1..-1] = 'foo' # => "foo"
- *    a # => [:foo, "foo"]
- *    a = [:foo, 'bar', 2]
- *    a[1..-2] = 'foo' # => "foo"
- *    a # => [:foo, "foo", 2]
- *    a = [:foo, 'bar', 2]
- *    a[1..-3] = 'foo' # => "foo"
- *    a # => [:foo, "foo", "bar", 2]
- *    a = [:foo, 'bar', 2]
- *
- *  If <tt>range.end</tt> is too large for the existing array,
- *  replaces array elements, but does not extend the array with +nil+ values:
- *
- *    a = [:foo, 'bar', 2]
- *    a[1..5] = 'foo' # => "foo"
- *    a # => [:foo, "foo"]
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     ary[index]         = obj                      ->  obj
+ *     ary[start, length] = obj or other_ary or nil  ->  obj or other_ary or nil
+ *     ary[range]         = obj or other_ary or nil  ->  obj or other_ary or nil
+ *
+ *  Element Assignment --- Sets the element at +index+, or replaces a subarray
+ *  from the +start+ index for +length+ elements, or replaces a subarray
+ *  specified by the +range+ of indices.
+ *
+ *  If indices are greater than the current capacity of the array, the array
+ *  grows automatically.  Elements are inserted into the array at +start+ if
+ *  +length+ is zero.
+ *
+ *  Negative indices will count backward from the end of the array.  For
+ *  +start+ and +range+ cases the starting index is just before an element.
+ *
+ *  An IndexError is raised if a negative index points past the beginning of
+ *  the array.
+ *
+ *  See also Array#push, and Array#unshift.
+ *
+ *     a = Array.new
+ *     a[4] = "4";                 #=> [nil, nil, nil, nil, "4"]
+ *     a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
+ *     a[1..2] = [ 1, 2 ]          #=> ["a", 1, 2, nil, "4"]
+ *     a[0, 2] = "?"               #=> ["?", 2, nil, "4"]
+ *     a[0..2] = "A"               #=> ["A", "4"]
+ *     a[-1]   = "Z"               #=> ["A", "Z"]
+ *     a[1..-1] = nil              #=> ["A", nil]
+ *     a[1..-1] = []               #=> ["A"]
+ *     a[0, 0] = [ 1, 2 ]          #=> [1, 2, "A"]
+ *     a[3, 0] = "B"               #=> [1, 2, "A", "B"]
  */
 
 static VALUE
 rb_ary_aset(int argc, VALUE *argv, VALUE ary)
 {
     long offset, beg, len;
+    VALUE rpl;
 
-    rb_check_arity(argc, 2, 3);
-    rb_ary_modify_check(ary);
     if (argc == 3) {
-        beg = NUM2LONG(argv[0]);
-        len = NUM2LONG(argv[1]);
-        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[2]);
+	rb_ary_modify_check(ary);
+	beg = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
+	goto range;
     }
+    rb_check_arity(argc, 2, 2);
+    rb_ary_modify_check(ary);
     if (FIXNUM_P(argv[0])) {
-        offset = FIX2LONG(argv[0]);
-        return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
+	offset = FIX2LONG(argv[0]);
+	goto fixnum;
     }
     if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
-        /* check if idx is Range */
-        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[1]);
+	/* check if idx is Range */
+      range:
+	rpl = rb_ary_to_ary(argv[argc-1]);
+	rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR(rpl), RARRAY_LEN(rpl));
+	RB_GC_GUARD(rpl);
+	return argv[argc-1];
     }
 
     offset = NUM2LONG(argv[0]);
-    return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
+fixnum:
+    rb_ary_store(ary, offset, argv[1]);
+    return argv[1];
 }
 
 /*
  *  call-seq:
- *    insert(index, *objects) -> self
+ *     ary.insert(index, obj...)  -> ary
  *
- *  Inserts the given +objects+ as elements of +self+;
- *  returns +self+.
- *
- *  When +index+ is non-negative, inserts +objects+
- *  _before_ the element at offset +index+:
- *
- *    a = ['a', 'b', 'c']     # => ["a", "b", "c"]
- *    a.insert(1, :x, :y, :z) # => ["a", :x, :y, :z, "b", "c"]
- *
- *  Extends the array if +index+ is beyond the array (<tt>index >= self.size</tt>):
- *
- *    a = ['a', 'b', 'c']     # => ["a", "b", "c"]
- *    a.insert(5, :x, :y, :z) # => ["a", "b", "c", nil, nil, :x, :y, :z]
- *
- *  When +index+ is negative, inserts +objects+
- *  _after_ the element at offset <tt>index + self.size</tt>:
- *
- *    a = ['a', 'b', 'c']      # => ["a", "b", "c"]
- *    a.insert(-2, :x, :y, :z) # => ["a", "b", :x, :y, :z, "c"]
+ *  Inserts the given values before the element with the given +index+.
  *
- *  With no +objects+ given, does nothing:
+ *  Negative indices count backwards from the end of the array, where +-1+ is
+ *  the last element. If a negative index is used, the given values will be
+ *  inserted after that element, so using an index of +-1+ will insert the
+ *  values at the end of the array.
  *
- *    a = ['a', 'b', 'c'] # => ["a", "b", "c"]
- *    a.insert(1)         # => ["a", "b", "c"]
- *    a.insert(50)        # => ["a", "b", "c"]
- *    a.insert(-50)       # => ["a", "b", "c"]
- *
- *  Raises IndexError if +objects+ are given and +index+ is negative and out of range.
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = %w{ a b c d }
+ *     a.insert(2, 99)         #=> ["a", "b", 99, "c", "d"]
+ *     a.insert(-2, 1, 2, 3)   #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
  */
 
 static VALUE
@@ -2561,15 +1786,15 @@ rb_ary_insert(int argc, VALUE *argv, VALUE ary)
     pos = NUM2LONG(argv[0]);
     if (argc == 1) return ary;
     if (pos == -1) {
-        pos = RARRAY_LEN(ary);
+	pos = RARRAY_LEN(ary);
     }
     else if (pos < 0) {
-        long minpos = -RARRAY_LEN(ary) - 1;
-        if (pos < minpos) {
-            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-                     pos, minpos);
-        }
-        pos++;
+	long minpos = -RARRAY_LEN(ary) - 1;
+	if (pos < minpos) {
+	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+		     pos, minpos);
+	}
+	pos++;
     }
     rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
     return ary;
@@ -2584,97 +1809,52 @@ ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
     return rb_ary_length(ary);
 }
 
-// Primitive to avoid a race condition in Array#each.
-// Return `true` and write `value` and `index` if the element exists.
-static VALUE
-ary_fetch_next(VALUE self, VALUE *index, VALUE *value)
-{
-    long i = NUM2LONG(*index);
-    if (i >= RARRAY_LEN(self)) {
-        return Qfalse;
-    }
-    *value = RARRAY_AREF(self, i);
-    *index = LONG2NUM(i + 1);
-    return Qtrue;
-}
-
 /*
  *  call-seq:
- *    each {|element| ... } -> self
- *    each -> new_enumerator
- *
- *  With a block given, iterates over the elements of +self+,
- *  passing each element to the block;
- *  returns +self+:
- *
- *    a = [:foo, 'bar', 2]
- *    a.each {|element|  puts "#{element.class} #{element}" }
- *
- *  Output:
+ *     ary.each { |item| block }  -> ary
+ *     ary.each                   -> Enumerator
  *
- *    Symbol foo
- *    String bar
- *    Integer 2
+ *  Calls the given block once for each element in +self+, passing that element
+ *  as a parameter.  Returns the array itself.
  *
- *  Allows the array to be modified during iteration:
+ *  If no block is given, an Enumerator is returned.
  *
- *    a = [:foo, 'bar', 2]
- *    a.each {|element| puts element; a.clear if element.to_s.start_with?('b') }
+ *     a = [ "a", "b", "c" ]
+ *     a.each {|x| print x, " -- " }
  *
- *  Output:
+ *  produces:
  *
- *    foo
- *    bar
- *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ *     a -- b -- c --
  */
 
 VALUE
 rb_ary_each(VALUE ary)
 {
     long i;
-    ary_verify(ary);
+
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        rb_yield(RARRAY_AREF(ary, i));
+	rb_yield(RARRAY_AREF(ary, i));
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    each_index {|index| ... } -> self
- *    each_index -> new_enumerator
- *
- *  With a block given, iterates over the elements of +self+,
- *  passing each <i>array index</i> to the block;
- *  returns +self+:
- *
- *    a = [:foo, 'bar', 2]
- *    a.each_index {|index|  puts "#{index} #{a[index]}" }
- *
- *  Output:
+ *     ary.each_index { |index| block }  -> ary
+ *     ary.each_index                    -> Enumerator
  *
- *    0 foo
- *    1 bar
- *    2 2
+ *  Same as Array#each, but passes the +index+ of the element instead of the
+ *  element itself.
  *
- *  Allows the array to be modified during iteration:
+ *  An Enumerator is returned if no block is given.
  *
- *    a = [:foo, 'bar', 2]
- *    a.each_index {|index| puts index; a.clear if index > 0 }
- *    a # => []
+ *     a = [ "a", "b", "c" ]
+ *     a.each_index {|x| print x, " -- " }
  *
- *  Output:
+ *  produces:
  *
- *    0
- *    1
- *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ *     0 -- 1 -- 2 --
  */
 
 static VALUE
@@ -2684,33 +1864,24 @@ rb_ary_each_index(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        rb_yield(LONG2NUM(i));
+	rb_yield(LONG2NUM(i));
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    reverse_each {|element| ... } -> self
- *    reverse_each -> Enumerator
- *
- *  When a block given, iterates backwards over the elements of +self+,
- *  passing, in reverse order, each element to the block;
- *  returns +self+:
- *
- *    a = []
- *    [0, 1, 2].reverse_each {|element| a.push(element) }
- *    a # => [2, 1, 0]
+ *     ary.reverse_each { |item| block }  -> ary
+ *     ary.reverse_each                   -> Enumerator
  *
- *  Allows the array to be modified during iteration:
+ *  Same as Array#each, but traverses +self+ in reverse order.
  *
- *    a = ['a', 'b', 'c']
- *    a.reverse_each {|element| a.clear if element.start_with?('b') }
- *    a # => []
+ *     a = [ "a", "b", "c" ]
+ *     a.reverse_each {|x| print x, " " }
  *
- *  When no block given, returns a new Enumerator.
+ *  produces:
  *
- *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ *     c b a
  */
 
 static VALUE
@@ -2721,27 +1892,24 @@ rb_ary_reverse_each(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     len = RARRAY_LEN(ary);
     while (len--) {
-        long nlen;
-        rb_yield(RARRAY_AREF(ary, len));
-        nlen = RARRAY_LEN(ary);
-        if (nlen < len) {
-            len = nlen;
-        }
+	long nlen;
+	rb_yield(RARRAY_AREF(ary, len));
+	nlen = RARRAY_LEN(ary);
+	if (nlen < len) {
+	    len = nlen;
+	}
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    length -> integer
- *    size -> integer
- *
- *  Returns the count of elements in +self+:
+ *     ary.length -> int
  *
- *    [0, 1, 2].length # => 3
- *    [].length        # => 0
+ *  Returns the number of elements in +self+. May be zero.
  *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *     [ 1, 2, 3, 4, 5 ].length   #=> 5
+ *     [].length                  #=> 0
  */
 
 static VALUE
@@ -2753,18 +1921,19 @@ rb_ary_length(VALUE ary)
 
 /*
  *  call-seq:
- *    array.empty?  -> true or false
+ *     ary.empty?   -> true or false
  *
- *  Returns +true+ if the count of elements in +self+ is zero,
- *  +false+ otherwise.
+ *  Returns +true+ if +self+ contains no elements.
  *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *     [].empty?   #=> true
  */
 
 static VALUE
 rb_ary_empty_p(VALUE ary)
 {
-    return RBOOL(RARRAY_LEN(ary) == 0);
+    if (RARRAY_LEN(ary) == 0)
+	return Qtrue;
+    return Qfalse;
 }
 
 VALUE
@@ -2774,16 +1943,13 @@ rb_ary_dup(VALUE ary)
     VALUE dup = rb_ary_new2(len);
     ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
     ARY_SET_LEN(dup, len);
-
-    ary_verify(ary);
-    ary_verify(dup);
     return dup;
 }
 
 VALUE
 rb_ary_resurrect(VALUE ary)
 {
-    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
+    return rb_ary_new4(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
 }
 
 extern VALUE rb_output_fs;
@@ -2800,15 +1966,15 @@ recursive_join(VALUE obj, VALUE argp, int recur)
     int *first = (int *)arg[3];
 
     if (recur) {
-        rb_raise(rb_eArgError, "recursive array join");
+	rb_raise(rb_eArgError, "recursive array join");
     }
     else {
-        ary_join_1(obj, ary, sep, 0, result, first);
+	ary_join_1(obj, ary, sep, 0, result, first);
     }
     return Qnil;
 }
 
-static long
+static void
 ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
 {
     long i;
@@ -2816,40 +1982,11 @@ ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
 
     if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
     for (i=0; i<max; i++) {
-        val = RARRAY_AREF(ary, i);
-        if (!RB_TYPE_P(val, T_STRING)) break;
-        if (i > 0 && !NIL_P(sep))
-            rb_str_buf_append(result, sep);
-        rb_str_buf_append(result, val);
-    }
-    return i;
-}
-
-static void
-ary_join_1_str(VALUE dst, VALUE src, int *first)
-{
-    rb_str_buf_append(dst, src);
-    if (*first) {
-        rb_enc_copy(dst, src);
-        *first = FALSE;
-    }
-}
-
-static void
-ary_join_1_ary(VALUE obj, VALUE ary, VALUE sep, VALUE result, VALUE val, int *first)
-{
-    if (val == ary) {
-        rb_raise(rb_eArgError, "recursive array join");
-    }
-    else {
-        VALUE args[4];
-
-        *first = FALSE;
-        args[0] = val;
-        args[1] = sep;
-        args[2] = result;
-        args[3] = (VALUE)first;
-        rb_exec_recursive(recursive_join, obj, (VALUE)args);
+	val = RARRAY_AREF(ary, i);
+	if (i > 0 && !NIL_P(sep))
+	    rb_str_buf_append(result, sep);
+	rb_str_buf_append(result, val);
+	if (OBJ_TAINTED(val)) OBJ_TAINT(result);
     }
 }
 
@@ -2859,25 +1996,50 @@ ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
     VALUE val, tmp;
 
     for (; i<RARRAY_LEN(ary); i++) {
-        if (i > 0 && !NIL_P(sep))
-            rb_str_buf_append(result, sep);
-
-        val = RARRAY_AREF(ary, i);
-        if (RB_TYPE_P(val, T_STRING)) {
-            ary_join_1_str(result, val, first);
-        }
-        else if (RB_TYPE_P(val, T_ARRAY)) {
-            ary_join_1_ary(val, ary, sep, result, val, first);
-        }
-        else if (!NIL_P(tmp = rb_check_string_type(val))) {
-            ary_join_1_str(result, tmp, first);
-        }
-        else if (!NIL_P(tmp = rb_check_array_type(val))) {
-            ary_join_1_ary(val, ary, sep, result, tmp, first);
-        }
-        else {
-            ary_join_1_str(result, rb_obj_as_string(val), first);
-        }
+	if (i > 0 && !NIL_P(sep))
+	    rb_str_buf_append(result, sep);
+
+	val = RARRAY_AREF(ary, i);
+	if (RB_TYPE_P(val, T_STRING)) {
+	  str_join:
+	    rb_str_buf_append(result, val);
+	    if (*first) {
+		rb_enc_copy(result, val);
+		*first = FALSE;
+	    }
+	}
+	else if (RB_TYPE_P(val, T_ARRAY)) {
+	    obj = val;
+	  ary_join:
+	    if (val == ary) {
+		rb_raise(rb_eArgError, "recursive array join");
+	    }
+	    else {
+		VALUE args[4];
+
+		*first = FALSE;
+		args[0] = val;
+		args[1] = sep;
+		args[2] = result;
+		args[3] = (VALUE)first;
+		rb_exec_recursive(recursive_join, obj, (VALUE)args);
+	    }
+	}
+	else {
+	    tmp = rb_check_string_type(val);
+	    if (!NIL_P(tmp)) {
+		val = tmp;
+		goto str_join;
+	    }
+	    tmp = rb_check_array_type(val);
+	    if (!NIL_P(tmp)) {
+		obj = val;
+		val = tmp;
+		goto ary_join;
+	    }
+	    val = rb_obj_as_string(val);
+	    goto str_join;
+	}
     }
 }
 
@@ -2885,36 +2047,36 @@ VALUE
 rb_ary_join(VALUE ary, VALUE sep)
 {
     long len = 1, i;
+    int taint = FALSE;
     VALUE val, tmp, result;
 
     if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
+    if (OBJ_TAINTED(ary)) taint = TRUE;
 
     if (!NIL_P(sep)) {
-        StringValue(sep);
-        len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+	StringValue(sep);
+	len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
     }
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        val = RARRAY_AREF(ary, i);
-        tmp = rb_check_string_type(val);
-
-        if (NIL_P(tmp) || tmp != val) {
-            int first;
-            long n = RARRAY_LEN(ary);
-            if (i > n) i = n;
-            result = rb_str_buf_new(len + (n-i)*10);
-            rb_enc_associate(result, rb_usascii_encoding());
-            i = ary_join_0(ary, sep, i, result);
-            first = i == 0;
-            ary_join_1(ary, ary, sep, i, result, &first);
-            return result;
-        }
+	val = RARRAY_AREF(ary, i);
+	tmp = rb_check_string_type(val);
 
-        len += RSTRING_LEN(tmp);
-    }
+	if (NIL_P(tmp) || tmp != val) {
+	    int first;
+	    result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
+	    rb_enc_associate(result, rb_usascii_encoding());
+	    if (taint) OBJ_TAINT(result);
+	    ary_join_0(ary, sep, i, result);
+	    first = i == 0;
+	    ary_join_1(ary, ary, sep, i, result, &first);
+	    return result;
+	}
 
-    result = rb_str_new(0, len);
-    rb_str_set_len(result, 0);
+	len += RSTRING_LEN(tmp);
+    }
 
+    result = rb_str_buf_new(len);
+    if (taint) OBJ_TAINT(result);
     ary_join_0(ary, sep, RARRAY_LEN(ary), result);
 
     return result;
@@ -2922,44 +2084,29 @@ rb_ary_join(VALUE ary, VALUE sep)
 
 /*
  *  call-seq:
- *    array.join(separator = $,) -> new_string
- *
- *  Returns the new string formed by joining the converted elements of +self+;
- *  for each element +element+:
- *
- *  - Converts recursively using <tt>element.join(separator)</tt>
- *    if +element+ is a <tt>kind_of?(Array)</tt>.
- *  - Otherwise, converts using <tt>element.to_s</tt>.
- *
- *  With no argument given, joins using the output field separator, <tt>$,</tt>:
- *
- *    a = [:foo, 'bar', 2]
- *    $, # => nil
- *    a.join # => "foobar2"
- *
- *  With string argument +separator+ given, joins using that separator:
+ *     ary.join(separator=$,)    -> str
  *
- *    a = [:foo, 'bar', 2]
- *    a.join("\n") # => "foo\nbar\n2"
+ *  Returns a string created by converting each element of the array to
+ *  a string, separated by the given +separator+.
+ *  If the +separator+ is +nil+, it uses current <code>$,</code>.
+ *  If both the +separator+ and <code>$,</code> are +nil+,
+ *  it uses an empty string.
  *
- *  Joins recursively for nested arrays:
+ *     [ "a", "b", "c" ].join        #=> "abc"
+ *     [ "a", "b", "c" ].join("-")   #=> "a-b-c"
  *
- *   a = [:foo, [:bar, [:baz, :bat]]]
- *   a.join # => "foobarbazbat"
+ *  For nested arrays, join is applied recursively:
  *
- *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     [ "a", [1, 2, [:x, :y]], "b" ].join("-")   #=> "a-1-2-x-y-b"
  */
+
 static VALUE
 rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE sep;
 
-    if (rb_check_arity(argc, 0, 1) == 0 || NIL_P(sep = argv[0])) {
-        sep = rb_output_fs;
-        if (!NIL_P(sep)) {
-            rb_category_warn(RB_WARN_CATEGORY_DEPRECATED, "$, is set to non-nil value");
-        }
-    }
+    rb_scan_args(argc, argv, "01", &sep);
+    if (NIL_P(sep)) sep = rb_output_fs;
 
     return rb_ary_join(ary, sep);
 }
@@ -2967,33 +2114,32 @@ rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 static VALUE
 inspect_ary(VALUE ary, VALUE dummy, int recur)
 {
+    int tainted = OBJ_TAINTED(ary);
     long i;
     VALUE s, str;
 
     if (recur) return rb_usascii_str_new_cstr("[...]");
     str = rb_str_buf_new2("[");
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        s = rb_inspect(RARRAY_AREF(ary, i));
-        if (i > 0) rb_str_buf_cat2(str, ", ");
-        else rb_enc_copy(str, s);
-        rb_str_buf_append(str, s);
+	s = rb_inspect(RARRAY_AREF(ary, i));
+	if (OBJ_TAINTED(s)) tainted = TRUE;
+	if (i > 0) rb_str_buf_cat2(str, ", ");
+	else rb_enc_copy(str, s);
+	rb_str_buf_append(str, s);
     }
     rb_str_buf_cat2(str, "]");
+    if (tainted) OBJ_TAINT(str);
     return str;
 }
 
 /*
  *  call-seq:
- *    inspect -> new_string
- *    to_s -> new_string
- *
- *  Returns the new string formed by calling method <tt>#inspect</tt>
- *  on each array element:
+ *     ary.inspect  -> string
+ *     ary.to_s     -> string
  *
- *    a = [:foo, 'bar', 2]
- *    a.inspect # => "[:foo, \"bar\", 2]"
+ *  Creates a string representation of +self+.
  *
- *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     [ "a", "b", "c" ].to_s     #=> "[\"a\", \"b\", \"c\"]"
  */
 
 static VALUE
@@ -3011,55 +2157,33 @@ rb_ary_to_s(VALUE ary)
 
 /*
  *  call-seq:
- *    to_a -> self or new_array
+ *     ary.to_a     -> ary
  *
- *  When +self+ is an instance of +Array+, returns +self+.
- *
- *  Otherwise, returns a new array containing the elements of +self+:
- *
- *    class MyArray < Array; end
- *    my_a = MyArray.new(['foo', 'bar', 'two'])
- *    a = my_a.to_a
- *    a # => ["foo", "bar", "two"]
- *    a.class # => Array # Not MyArray.
+ *  Returns +self+.
  *
- *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *  If called on a subclass of Array, converts the receiver to an Array object.
  */
 
 static VALUE
 rb_ary_to_a(VALUE ary)
 {
     if (rb_obj_class(ary) != rb_cArray) {
-        VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
-        rb_ary_replace(dup, ary);
-        return dup;
+	VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+	rb_ary_replace(dup, ary);
+	return dup;
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    to_h -> new_hash
- *    to_h {|element| ... } -> new_hash
+ *     ary.to_h     -> hash
  *
- *  Returns a new hash formed from +self+.
+ *  Returns the result of interpreting <i>ary</i> as an array of
+ *  <tt>[key, value]</tt> pairs.
  *
- *  With no block given, each element of +self+ must be a 2-element sub-array;
- *  forms each sub-array into a key-value pair in the new hash:
- *
- *    a = [['foo', 'zero'], ['bar', 'one'], ['baz', 'two']]
- *    a.to_h # => {"foo"=>"zero", "bar"=>"one", "baz"=>"two"}
- *    [].to_h # => {}
- *
- *  With a block given, the block must return a 2-element array;
- *  calls the block with each element of +self+;
- *  forms each returned array into a key-value pair in the returned hash:
- *
- *    a = ['foo', :bar, 1, [2, 3], {baz: 4}]
- *    a.to_h {|element| [element, element.class] }
- *    # => {"foo"=>String, :bar=>Symbol, 1=>Integer, [2, 3]=>Array, {:baz=>4}=>Hash}
- *
- *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     [[:foo, :bar], [1, 2]].to_h
+ *       # => {:foo => :bar, 1 => 2}
  */
 
 static VALUE
@@ -3067,28 +2191,25 @@ rb_ary_to_h(VALUE ary)
 {
     long i;
     VALUE hash = rb_hash_new_with_size(RARRAY_LEN(ary));
-    int block_given = rb_block_given_p();
-
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        const VALUE e = rb_ary_elt(ary, i);
-        const VALUE elt = block_given ? rb_yield_force_blockarg(e) : e;
-        const VALUE key_value_pair = rb_check_array_type(elt);
-        if (NIL_P(key_value_pair)) {
-            rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
-                     rb_obj_class(elt), i);
-        }
-        if (RARRAY_LEN(key_value_pair) != 2) {
-            rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
-                i, RARRAY_LEN(key_value_pair));
-        }
-        rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
+	const VALUE elt = rb_ary_elt(ary, i);
+	const VALUE key_value_pair = rb_check_array_type(elt);
+	if (NIL_P(key_value_pair)) {
+	    rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
+		     rb_obj_class(elt), i);
+	}
+	if (RARRAY_LEN(key_value_pair) != 2) {
+	    rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
+		i, RARRAY_LEN(key_value_pair));
+	}
+	rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
     }
     return hash;
 }
 
 /*
  *  call-seq:
- *    array.to_ary -> self
+ *     ary.to_ary -> ary
  *
  *  Returns +self+.
  */
@@ -3103,9 +2224,9 @@ static void
 ary_reverse(VALUE *p1, VALUE *p2)
 {
     while (p1 < p2) {
-        VALUE tmp = *p1;
-        *p1++ = *p2;
-        *p2-- = tmp;
+	VALUE tmp = *p1;
+	*p1++ = *p2;
+	*p2-- = tmp;
     }
 }
 
@@ -3117,26 +2238,23 @@ rb_ary_reverse(VALUE ary)
 
     rb_ary_modify(ary);
     if (len > 1) {
-        RARRAY_PTR_USE(ary, p1, {
-            p2 = p1 + len - 1;	/* points last item */
-            ary_reverse(p1, p2);
-        }); /* WB: no new reference */
+	RARRAY_PTR_USE(ary, p1, {
+	    p2 = p1 + len - 1;	/* points last item */
+	    ary_reverse(p1, p2);
+	}); /* WB: no new reference */
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    reverse! -> self
- *
- *  Reverses the order of the elements of +self+;
- *  returns +self+:
+ *     ary.reverse!   -> ary
  *
- *    a = [0, 1, 2]
- *    a.reverse! # => [2, 1, 0]
- *    a          # => [2, 1, 0]
+ *  Reverses +self+ in place.
  *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ "a", "b", "c" ]
+ *     a.reverse!       #=> ["c", "b", "a"]
+ *     a                #=> ["c", "b", "a"]
  */
 
 static VALUE
@@ -3147,13 +2265,12 @@ rb_ary_reverse_bang(VALUE ary)
 
 /*
  *  call-seq:
- *    reverse -> new_array
+ *     ary.reverse    -> new_ary
  *
- *  Returns a new array containing the elements of +self+ in reverse order:
+ *  Returns a new array containing +self+'s elements in reverse order.
  *
- *    [0, 1, 2].reverse # => [2, 1, 0]
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
+ *     [ 1 ].reverse               #=> [1]
  */
 
 static VALUE
@@ -3163,9 +2280,9 @@ rb_ary_reverse_m(VALUE ary)
     VALUE dup = rb_ary_new2(len);
 
     if (len > 0) {
-        const VALUE *p1 = RARRAY_CONST_PTR(ary);
-        VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
-        do *p2-- = *p1++; while (--len > 0);
+	const VALUE *p1 = RARRAY_CONST_PTR(ary);
+	VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
+	do *p2-- = *p1++; while (--len > 0);
     }
     ARY_SET_LEN(dup, RARRAY_LEN(ary));
     return dup;
@@ -3177,113 +2294,73 @@ rotate_count(long cnt, long len)
     return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
 }
 
-static void
-ary_rotate_ptr(VALUE *ptr, long len, long cnt)
-{
-    if (cnt == 1) {
-        VALUE tmp = *ptr;
-        memmove(ptr, ptr + 1, sizeof(VALUE)*(len - 1));
-        *(ptr + len - 1) = tmp;
-    }
-    else if (cnt == len - 1) {
-        VALUE tmp = *(ptr + len - 1);
-        memmove(ptr + 1, ptr, sizeof(VALUE)*(len - 1));
-        *ptr = tmp;
-    }
-    else {
-        --len;
-        if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
-        if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
-        if (len > 0) ary_reverse(ptr, ptr + len);
-    }
-}
-
 VALUE
 rb_ary_rotate(VALUE ary, long cnt)
 {
     rb_ary_modify(ary);
 
     if (cnt != 0) {
-        long len = RARRAY_LEN(ary);
-        if (len > 1 && (cnt = rotate_count(cnt, len)) > 0) {
-            RARRAY_PTR_USE(ary, ptr, ary_rotate_ptr(ptr, len, cnt));
-            return ary;
-        }
+	VALUE *ptr = RARRAY_PTR(ary);
+	long len = RARRAY_LEN(ary);
+
+	if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
+	    --len;
+	    if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+	    if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+	    if (len > 0) ary_reverse(ptr, ptr + len);
+	    return ary;
+	}
     }
+
     return Qnil;
 }
 
 /*
  *  call-seq:
- *    rotate!(count = 1) -> self
- *
- *  Rotates +self+ in place by moving elements from one end to the other; returns +self+.
- *
- *  With non-negative numeric +count+,
- *  rotates +count+ elements from the beginning to the end:
- *
- *    [0, 1, 2, 3].rotate!(2)   # => [2, 3, 0, 1]
-      [0, 1, 2, 3].rotate!(2.1) # => [2, 3, 0, 1]
- *
- *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
- *
- *    [0, 1, 2, 3].rotate!(21) # => [1, 2, 3, 0]
+ *     ary.rotate!(count=1)   -> ary
  *
- *  If +count+ is zero, rotates no elements:
- *
- *    [0, 1, 2, 3].rotate!(0) # => [0, 1, 2, 3]
- *
- *  With a negative numeric +count+, rotates in the opposite direction,
- *  from end to beginning:
- *
- *    [0, 1, 2, 3].rotate!(-1) # => [3, 0, 1, 2]
- *
- *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *  Rotates +self+ in place so that the element at +count+ comes first, and
+ *  returns +self+.
  *
- *    [0, 1, 2, 3].rotate!(-21) # => [3, 0, 1, 2]
+ *  If +count+ is negative then it rotates in the opposite direction, starting
+ *  from the end of the array where +-1+ is the last element.
  *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.rotate!        #=> ["b", "c", "d", "a"]
+ *     a                #=> ["b", "c", "d", "a"]
+ *     a.rotate!(2)     #=> ["d", "a", "b", "c"]
+ *     a.rotate!(-3)    #=> ["a", "b", "c", "d"]
  */
 
 static VALUE
 rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
 {
-    long n = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
+    long n = 1;
+
+    switch (argc) {
+      case 1: n = NUM2LONG(argv[0]);
+      case 0: break;
+      default: rb_scan_args(argc, argv, "01", NULL);
+    }
     rb_ary_rotate(ary, n);
     return ary;
 }
 
 /*
  *  call-seq:
- *    rotate(count = 1) -> new_array
- *
- *  Returns a new array formed from +self+ with elements
- *  rotated from one end to the other.
- *
- *  With non-negative numeric +count+,
- *  rotates elements from the beginning to the end:
- *
- *    [0, 1, 2, 3].rotate(2)   # => [2, 3, 0, 1]
- *    [0, 1, 2, 3].rotate(2.1) # => [2, 3, 0, 1]
- *
- *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
- *
- *    [0, 1, 2, 3].rotate(22) # => [2, 3, 0, 1]
+ *     ary.rotate(count=1)    -> new_ary
  *
- *  With a +count+ of zero, rotates no elements:
+ *  Returns a new array by rotating +self+ so that the element at +count+ is
+ *  the first element of the new array.
  *
- *    [0, 1, 2, 3].rotate(0) # => [0, 1, 2, 3]
+ *  If +count+ is negative then it rotates in the opposite direction, starting
+ *  from the end of +self+ where +-1+ is the last element.
  *
- *  With negative numeric +count+, rotates in the opposite direction,
- *  from the end to the beginning:
- *
- *    [0, 1, 2, 3].rotate(-1) # => [3, 0, 1, 2]
- *
- *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
- *
- *    [0, 1, 2, 3].rotate(-21) # => [3, 0, 1, 2]
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.rotate         #=> ["b", "c", "d", "a"]
+ *     a                #=> ["a", "b", "c", "d"]
+ *     a.rotate(2)      #=> ["c", "d", "a", "b"]
+ *     a.rotate(-3)     #=> ["b", "c", "d", "a"]
  */
 
 static VALUE
@@ -3291,17 +2368,22 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE rotated;
     const VALUE *ptr;
-    long len;
-    long cnt = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
+    long len, cnt = 1;
+
+    switch (argc) {
+      case 1: cnt = NUM2LONG(argv[0]);
+      case 0: break;
+      default: rb_scan_args(argc, argv, "01", NULL);
+    }
 
     len = RARRAY_LEN(ary);
     rotated = rb_ary_new2(len);
     if (len > 0) {
-        cnt = rotate_count(cnt, len);
-        ptr = RARRAY_CONST_PTR(ary);
-        len -= cnt;
-        ary_memcpy(rotated, 0, len, ptr + cnt);
-        ary_memcpy(rotated, len, cnt, ptr);
+	cnt = rotate_count(cnt, len);
+	ptr = RARRAY_CONST_PTR(ary);
+	len -= cnt;
+	ary_memcpy(rotated, 0, len, ptr + cnt);
+	ary_memcpy(rotated, len, cnt, ptr);
     }
     ARY_SET_LEN(rotated, RARRAY_LEN(ary));
     return rotated;
@@ -3309,27 +2391,18 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
 
 struct ary_sort_data {
     VALUE ary;
-    VALUE receiver;
+    struct cmp_opt_data cmp_opt;
 };
 
 static VALUE
 sort_reentered(VALUE ary)
 {
     if (RBASIC(ary)->klass) {
-        rb_raise(rb_eRuntimeError, "sort reentered");
+	rb_raise(rb_eRuntimeError, "sort reentered");
     }
     return Qnil;
 }
 
-static void
-sort_returned(struct ary_sort_data *data)
-{
-    if (rb_obj_frozen_p(data->receiver)) {
-        rb_raise(rb_eFrozenError, "array frozen during sort");
-    }
-    sort_reentered(data->ary);
-}
-
 static int
 sort_1(const void *ap, const void *bp, void *dummy)
 {
@@ -3343,7 +2416,7 @@ sort_1(const void *ap, const void *bp, void *dummy)
     args[1] = b;
     retval = rb_yield_values2(2, args);
     n = rb_cmpint(retval, a, b);
-    sort_returned(data);
+    sort_reentered(data->ary);
     return n;
 }
 
@@ -3355,61 +2428,74 @@ sort_2(const void *ap, const void *bp, void *dummy)
     VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
     int n;
 
-    if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(INTEGER)) {
-        if ((long)a > (long)b) return 1;
-        if ((long)a < (long)b) return -1;
-        return 0;
+    if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, Fixnum)) {
+	if ((long)a > (long)b) return 1;
+	if ((long)a < (long)b) return -1;
+	return 0;
     }
-    if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(STRING)) {
-        return rb_str_cmp(a, b);
+    if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, String)) {
+	return rb_str_cmp(a, b);
     }
-    if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(FLOAT)) {
-        return rb_float_cmp(a, b);
+    if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(data->cmp_opt, Float)) {
+	return rb_float_cmp(a, b);
     }
 
     retval = rb_funcallv(a, id_cmp, 1, &b);
     n = rb_cmpint(retval, a, b);
-    sort_returned(data);
+    sort_reentered(data->ary);
 
     return n;
 }
 
 /*
  *  call-seq:
- *    sort! -> self
- *    sort! {|a, b| ... } -> self
+ *     ary.sort!                   -> ary
+ *     ary.sort! { |a, b| block }  -> ary
+ *
+ *  Sorts +self+ in place.
+ *
+ *  Comparisons for the sort will be done using the <code><=></code> operator
+ *  or using an optional code block.
  *
- *  Like Array#sort, but returns +self+ with its elements sorted in place.
+ *  The block must implement a comparison between +a+ and +b+ and return
+ *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
+ *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
  *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *  The result is not guaranteed to be stable.  When the comparison of two
+ *  elements returns +0+, the order of the elements is unpredictable.
+ *
+ *     ary = [ "d", "a", "e", "c", "b" ]
+ *     ary.sort!                     #=> ["a", "b", "c", "d", "e"]
+ *     ary.sort! { |a, b| b <=> a }  #=> ["e", "d", "c", "b", "a"]
+ *
+ *  See also Enumerable#sort_by.
  */
 
 VALUE
 rb_ary_sort_bang(VALUE ary)
 {
     rb_ary_modify(ary);
-    RUBY_ASSERT(!ARY_SHARED_P(ary));
+    assert(!ARY_SHARED_P(ary));
     if (RARRAY_LEN(ary) > 1) {
-        VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
-        struct ary_sort_data data;
-        long len = RARRAY_LEN(ary);
-        RBASIC_CLEAR_CLASS(tmp);
-        data.ary = tmp;
-        data.receiver = ary;
-        RARRAY_PTR_USE(tmp, ptr, {
-            ruby_qsort(ptr, len, sizeof(VALUE),
-                       rb_block_given_p()?sort_1:sort_2, &data);
-        }); /* WB: no new reference */
-        rb_ary_modify(ary);
+	VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+	struct ary_sort_data data;
+	long len = RARRAY_LEN(ary);
+
+	RBASIC_CLEAR_CLASS(tmp);
+	data.ary = tmp;
+	data.cmp_opt.opt_methods = 0;
+	data.cmp_opt.opt_inited = 0;
+	RARRAY_PTR_USE(tmp, ptr, {
+	    ruby_qsort(ptr, len, sizeof(VALUE),
+		       rb_block_given_p()?sort_1:sort_2, &data);
+	}); /* WB: no new reference */
+	rb_ary_modify(ary);
         if (ARY_EMBED_P(tmp)) {
             if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
                 rb_ary_unshare(ary);
-                FL_SET_EMBED(ary);
+		FL_SET_EMBED(ary);
             }
-            if (ARY_EMBED_LEN(tmp) > ARY_CAPA(ary)) {
-                ary_resize_capa(ary, ARY_EMBED_LEN(tmp));
-            }
-            ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
+	    ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
             ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
         }
         else {
@@ -3418,7 +2504,7 @@ rb_ary_sort_bang(VALUE ary)
                 ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
             }
             else {
-                RUBY_ASSERT(!ARY_SHARED_P(tmp));
+                assert(!ARY_SHARED_P(tmp));
                 if (ARY_EMBED_P(ary)) {
                     FL_UNSET_EMBED(ary);
                 }
@@ -3427,54 +2513,46 @@ rb_ary_sort_bang(VALUE ary)
                     rb_ary_unshare(ary);
                 }
                 else {
-                    ary_heap_free(ary);
+		    ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
                 }
-                ARY_SET_PTR(ary, ARY_HEAP_PTR(tmp));
+                ARY_SET_PTR(ary, RARRAY_CONST_PTR(tmp));
                 ARY_SET_HEAP_LEN(ary, len);
-                ARY_SET_CAPA(ary, ARY_HEAP_LEN(tmp));
+                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
             }
             /* tmp was lost ownership for the ptr */
             FL_UNSET(tmp, FL_FREEZE);
             FL_SET_EMBED(tmp);
             ARY_SET_EMBED_LEN(tmp, 0);
             FL_SET(tmp, FL_FREEZE);
-        }
+	}
         /* tmp will be GC'ed. */
         RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
     }
-    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *    sort -> new_array
- *    sort {|a, b| ... } -> new_array
- *
- *  Returns a new array containing the elements of +self+, sorted.
- *
- *  With no block given, compares elements using operator <tt>#<=></tt>
- *  (see Object#<=>):
+ *     ary.sort                   -> new_ary
+ *     ary.sort { |a, b| block }  -> new_ary
  *
- *    [0, 2, 3, 1].sort # => [0, 1, 2, 3]
+ *  Returns a new array created by sorting +self+.
  *
- *  With a block given, calls the block with each combination of pairs of elements from +self+;
- *  for each pair +a+ and +b+, the block should return a numeric:
+ *  Comparisons for the sort will be done using the <code><=></code> operator
+ *  or using an optional code block.
  *
- *  - Negative when +b+ is to follow +a+.
- *  - Zero when +a+ and +b+ are equivalent.
- *  - Positive when +a+ is to follow +b+.
+ *  The block must implement a comparison between +a+ and +b+ and return
+ *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
+ *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
  *
- *  Example:
+ *  The result is not guaranteed to be stable.  When the comparison of two
+ *  elements returns +0+, the order of the elements is unpredictable.
  *
- *    a = [3, 2, 0, 1]
- *    a.sort {|a, b| a <=> b } # => [0, 1, 2, 3]
- *    a.sort {|a, b| b <=> a } # => [3, 2, 1, 0]
+ *     ary = [ "d", "a", "e", "c", "b" ]
+ *     ary.sort                     #=> ["a", "b", "c", "d", "e"]
+ *     ary.sort { |a, b| b <=> a }  #=> ["e", "d", "c", "b", "a"]
  *
- *  When the block returns zero, the order for +a+ and +b+ is indeterminate,
- *  and may be unstable.
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *  See also Enumerable#sort_by.
  */
 
 VALUE
@@ -3489,15 +2567,55 @@ static VALUE rb_ary_bsearch_index(VALUE ary);
 
 /*
  *  call-seq:
- *    bsearch {|element| ... } -> found_element or nil
- *    bsearch -> new_enumerator
- *
- *  Returns the element from +self+ found by a binary search,
- *  or +nil+ if the search found no suitable element.
- *
- *  See {Binary Searching}[rdoc-ref:bsearch.rdoc].
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     ary.bsearch {|x| block }  -> elem
+ *
+ *  By using binary search, finds a value from this array which meets
+ *  the given condition in O(log n) where n is the size of the array.
+ *
+ *  You can use this method in two modes: a find-minimum mode and
+ *  a find-any mode.  In either case, the elements of the array must be
+ *  monotone (or sorted) with respect to the block.
+ *
+ *  In find-minimum mode (this is a good choice for typical use cases),
+ *  the block must always return true or false, and there must be an index i
+ *  (0 <= i <= ary.size) so that:
+ *
+ *  - the block returns false for any element whose index is less than
+ *    i, and
+ *  - the block returns true for any element whose index is greater
+ *    than or equal to i.
+ *
+ *  This method returns the i-th element.  If i is equal to ary.size,
+ *  it returns nil.
+ *
+ *     ary = [0, 4, 7, 10, 12]
+ *     ary.bsearch {|x| x >=   4 } #=> 4
+ *     ary.bsearch {|x| x >=   6 } #=> 7
+ *     ary.bsearch {|x| x >=  -1 } #=> 0
+ *     ary.bsearch {|x| x >= 100 } #=> nil
+ *
+ *  In find-any mode (this behaves like libc's bsearch(3)), the block
+ *  must always return a number, and there must be two indices i and j
+ *  (0 <= i <= j <= ary.size) so that:
+ *
+ *  - the block returns a positive number for ary[k] if 0 <= k < i,
+ *  - the block returns zero for ary[k] if i <= k < j, and
+ *  - the block returns a negative number for ary[k] if
+ *    j <= k < ary.size.
+ *
+ *  Under this condition, this method returns any element whose index
+ *  is within i...j.  If i is equal to j (i.e., there is no element
+ *  that satisfies the block), this method returns nil.
+ *
+ *     ary = [0, 4, 7, 10, 12]
+ *     # try to find v such that 4 <= v < 8
+ *     ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
+ *     # try to find v such that 8 <= v < 10
+ *     ary.bsearch {|x| 4 - x / 2 } #=> nil
+ *
+ *  You must not mix the two modes at a time; the block must always
+ *  return either true/false, or always return a number.  It is
+ *  undefined which value is actually picked up at each iteration.
  */
 
 static VALUE
@@ -3506,22 +2624,22 @@ rb_ary_bsearch(VALUE ary)
     VALUE index_result = rb_ary_bsearch_index(ary);
 
     if (FIXNUM_P(index_result)) {
-        return rb_ary_entry(ary, FIX2LONG(index_result));
+	return rb_ary_entry(ary, FIX2LONG(index_result));
     }
     return index_result;
 }
 
 /*
  *  call-seq:
- *    bsearch_index {|element| ... } -> integer or nil
- *    bsearch_index -> new_enumerator
- *
- *  Returns the integer index of the element from +self+ found by a binary search,
- *  or +nil+ if the search found no suitable element.
+ *     ary.bsearch_index {|x| block }  -> int or nil
  *
- *  See {Binary Searching}[rdoc-ref:bsearch.rdoc].
+ *  By using binary search, finds an index of a value from this array which
+ *  meets the given condition in O(log n) where n is the size of the array.
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *  It supports two modes, depending on the nature of the block. They are
+ *  exactly the same as in the case of the #bsearch method, with the only difference
+ *  being that this method returns the index of the element instead of the
+ *  element itself. For more details consult the documentation for #bsearch.
  */
 
 static VALUE
@@ -3533,39 +2651,39 @@ rb_ary_bsearch_index(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     while (low < high) {
-        mid = low + ((high - low) / 2);
-        val = rb_ary_entry(ary, mid);
-        v = rb_yield(val);
-        if (FIXNUM_P(v)) {
-            if (v == INT2FIX(0)) return INT2FIX(mid);
-            smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
-        }
-        else if (v == Qtrue) {
-            satisfied = 1;
-            smaller = 1;
-        }
-        else if (!RTEST(v)) {
-            smaller = 0;
-        }
-        else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
-            const VALUE zero = INT2FIX(0);
-            switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
-              case 0: return INT2FIX(mid);
-              case 1: smaller = 0; break;
-              case -1: smaller = 1;
-            }
-        }
-        else {
-            rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
-                     " (must be numeric, true, false or nil)",
-                     rb_obj_class(v));
-        }
-        if (smaller) {
-            high = mid;
-        }
-        else {
-            low = mid + 1;
-        }
+	mid = low + ((high - low) / 2);
+	val = rb_ary_entry(ary, mid);
+	v = rb_yield(val);
+	if (FIXNUM_P(v)) {
+	    if (v == INT2FIX(0)) return INT2FIX(mid);
+	    smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
+	}
+	else if (v == Qtrue) {
+	    satisfied = 1;
+	    smaller = 1;
+	}
+	else if (v == Qfalse || v == Qnil) {
+	    smaller = 0;
+	}
+	else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
+	    const VALUE zero = INT2FIX(0);
+	    switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
+	      case 0: return INT2FIX(mid);
+	      case 1: smaller = 1; break;
+	      case -1: smaller = 0;
+	    }
+	}
+	else {
+	    rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
+		     " (must be numeric, true, false or nil)",
+		     rb_obj_class(v));
+	}
+	if (smaller) {
+	    high = mid;
+	}
+	else {
+	    low = mid + 1;
+	}
     }
     if (!satisfied) return Qnil;
     return INT2FIX(low);
@@ -3580,24 +2698,18 @@ sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
 
 /*
  *  call-seq:
- *    sort_by! {|element| ... } -> self
- *    sort_by! -> new_enumerator
+ *     ary.sort_by! { |obj| block }    -> ary
+ *     ary.sort_by!                    -> Enumerator
  *
- *  With a block given, sorts the elements of +self+ in place;
- *  returns self.
+ *  Sorts +self+ in place using a set of keys generated by mapping the
+ *  values in +self+ through the given block.
  *
- *  Calls the block with each successive element;
- *  sorts elements based on the values returned from the block:
+ *  The result is not guaranteed to be stable.  When two keys are equal,
+ *  the order of the corresponding elements is unpredictable.
  *
- *    a = ['aaaa', 'bbb', 'cc', 'd']
- *    a.sort_by! {|element| element.size }
- *    a # => ["d", "cc", "bbb", "aaaa"]
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  For duplicate values returned by the block, the ordering is indeterminate, and may be unstable.
- *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *  See also Enumerable#sort_by.
  */
 
 static VALUE
@@ -3615,22 +2727,23 @@ rb_ary_sort_by_bang(VALUE ary)
 
 /*
  *  call-seq:
- *    collect {|element| ... } -> new_array
- *    collect -> new_enumerator
- *    map {|element| ... } -> new_array
- *    map -> new_enumerator
+ *     ary.collect { |item| block }  -> new_ary
+ *     ary.map     { |item| block }  -> new_ary
+ *     ary.collect                   -> Enumerator
+ *     ary.map                       -> Enumerator
+ *
+ *  Invokes the given block once for each element of +self+.
  *
- *  With a block given, calls the block with each element of +self+;
- *  returns a new array whose elements are the return values from the block:
+ *  Creates a new array containing the values returned by the block.
  *
- *    a = [:foo, 'bar', 2]
- *    a1 = a.map {|element| element.class }
- *    a1 # => [Symbol, String, Integer]
+ *  See also Enumerable#collect.
  *
- *  With no block given, returns a new Enumerator.
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  Related: #collect!;
- *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.collect { |x| x + "!" }         #=> ["a!", "b!", "c!", "d!"]
+ *     a.map.with_index { |x, i| x * i } #=> ["", "b", "cc", "ddd"]
+ *     a                                 #=> ["a", "b", "c", "d"]
  */
 
 static VALUE
@@ -3642,7 +2755,7 @@ rb_ary_collect(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     collect = rb_ary_new2(RARRAY_LEN(ary));
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-        rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
+	rb_ary_push(collect, rb_yield_force_blockarg(RARRAY_AREF(ary, i)));
     }
     return collect;
 }
@@ -3650,22 +2763,23 @@ rb_ary_collect(VALUE ary)
 
 /*
  *  call-seq:
- *    collect! {|element| ... } -> new_array
- *    collect! -> new_enumerator
- *    map! {|element| ... } -> new_array
- *    map! -> new_enumerator
+ *     ary.collect! {|item| block }   -> ary
+ *     ary.map!     {|item| block }   -> ary
+ *     ary.collect!                   -> Enumerator
+ *     ary.map!                       -> Enumerator
  *
- *  With a block given, calls the block with each element of +self+
- *  and replaces the element with the block's return value;
- *  returns +self+:
+ *  Invokes the given block once for each element of +self+, replacing the
+ *  element with the value returned by the block.
  *
- *    a = [:foo, 'bar', 2]
- *    a.map! { |element| element.class } # => [Symbol, String, Integer]
+ *  See also Enumerable#collect.
  *
- *  With no block given, returns a new Enumerator.
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  Related: #collect;
- *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.map! {|x| x + "!" }
+ *     a #=>  [ "a!", "b!", "c!", "d!" ]
+ *     a.collect!.with_index {|x, i| x[0...i] }
+ *     a #=>  ["", "b", "c!", "d!"]
  */
 
 static VALUE
@@ -3676,7 +2790,7 @@ rb_ary_collect_bang(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     rb_ary_modify(ary);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-        rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
+	rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
     }
     return ary;
 }
@@ -3688,190 +2802,66 @@ rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func
     long beg, len, i, j;
 
     for (i=0; i<argc; i++) {
-        if (FIXNUM_P(argv[i])) {
-            rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
-            continue;
-        }
-        /* check if idx is Range */
-        if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
-            long end = olen < beg+len ? olen : beg+len;
-            for (j = beg; j < end; j++) {
-                rb_ary_push(result, (*func)(obj, j));
-            }
-            if (beg + len > j)
-                rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
-            continue;
-        }
-        rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
+	if (FIXNUM_P(argv[i])) {
+	    rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
+	    continue;
+	}
+	/* check if idx is Range */
+	if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
+	    long end = olen < beg+len ? olen : beg+len;
+	    for (j = beg; j < end; j++) {
+		rb_ary_push(result, (*func)(obj, j));
+	    }
+	    if (beg + len > j)
+		rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
+	    continue;
+	}
+	rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
     }
     return result;
 }
 
-static VALUE
-append_values_at_single(VALUE result, VALUE ary, long olen, VALUE idx)
-{
-    long beg, len;
-    if (FIXNUM_P(idx)) {
-        beg = FIX2LONG(idx);
-    }
-    /* check if idx is Range */
-    else if (rb_range_beg_len(idx, &beg, &len, olen, 1)) {
-        if (len > 0) {
-            const VALUE *const src = RARRAY_CONST_PTR(ary);
-            const long end = beg + len;
-            const long prevlen = RARRAY_LEN(result);
-            if (beg < olen) {
-                rb_ary_cat(result, src + beg, end > olen ? olen-beg : len);
-            }
-            if (end > olen) {
-                rb_ary_store(result, prevlen + len - 1, Qnil);
-            }
-        }
-        return result;
-    }
-    else {
-        beg = NUM2LONG(idx);
-    }
-    return rb_ary_push(result, rb_ary_entry(ary, beg));
-}
-
 /*
  *  call-seq:
- *    values_at(*specifiers) -> new_array
- *
- *  Returns elements from +self+ in a new array; does not modify +self+.
- *
- *  The objects included in the returned array are the elements of +self+
- *  selected by the given +specifiers+,
- *  each of which must be a numeric index or a Range.
- *
- *  In brief:
- *
- *    a = ['a', 'b', 'c', 'd']
- *
- *    # Index specifiers.
- *    a.values_at(2, 0, 2, 0)     # => ["c", "a", "c", "a"] # May repeat.
- *    a.values_at(-4, -3, -2, -1) # => ["a", "b", "c", "d"] # Counts backwards if negative.
- *    a.values_at(-50, 50)        # => [nil, nil]           # Outside of self.
- *
- *    # Range specifiers.
- *    a.values_at(1..3)       # => ["b", "c", "d"] # From range.begin to range.end.
- *    a.values_at(1...3)      # => ["b", "c"]      # End excluded.
- *    a.values_at(3..1)       # => []              # No such elements.
- *
- *    a.values_at(-3..3)  # => ["b", "c", "d"]     # Negative range.begin counts backwards.
- *    a.values_at(-50..3)                          # Raises RangeError.
- *
- *    a.values_at(1..-2)  # => ["b", "c"]          # Negative range.end counts backwards.
- *    a.values_at(1..-50) # => []                  # No such elements.
- *
- *    # Mixture of specifiers.
- *    a.values_at(2..3, 3, 0..1, 0) # => ["c", "d", "d", "a", "b", "a"]
- *
- *  With no +specifiers+ given, returns a new empty array:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.values_at # => []
- *
- *  For each numeric specifier +index+, includes an element:
- *
- *  - For each non-negative numeric specifier +index+ that is in-range (less than <tt>self.size</tt>),
- *    includes the element at offset +index+:
- *
- *      a.values_at(0, 2)     # => ["a", "c"]
- *      a.values_at(0.1, 2.9) # => ["a", "c"]
- *
- *  - For each negative numeric +index+ that is in-range (greater than or equal to <tt>- self.size</tt>),
- *    counts backwards from the end of +self+:
- *
- *      a.values_at(-1, -4) # => ["d", "a"]
- *
- *  The given indexes may be in any order, and may repeat:
- *
- *    a.values_at(2, 0, 1, 0, 2) # => ["c", "a", "b", "a", "c"]
- *
- *  For each +index+ that is out-of-range, includes +nil+:
- *
- *    a.values_at(4, -5) # => [nil, nil]
- *
- *  For each Range specifier +range+, includes elements
- *  according to <tt>range.begin</tt> and <tt>range.end</tt>:
- *
- *  - If both <tt>range.begin</tt> and <tt>range.end</tt>
- *    are non-negative and in-range (less than <tt>self.size</tt>),
- *    includes elements from index <tt>range.begin</tt>
- *    through <tt>range.end - 1</tt> (if <tt>range.exclude_end?</tt>),
- *    or through <tt>range.end</tt> (otherwise):
- *
- *      a.values_at(1..2)  # => ["b", "c"]
- *      a.values_at(1...2) # => ["b"]
- *
- *  - If <tt>range.begin</tt> is negative and in-range (greater than or equal to <tt>- self.size</tt>),
- *    counts backwards from the end of +self+:
- *
- *      a.values_at(-2..3) # => ["c", "d"]
- *
- *  - If <tt>range.begin</tt> is negative and out-of-range, raises an exception:
- *
- *      a.values_at(-5..3) # Raises RangeError.
- *
- *  - If <tt>range.end</tt> is positive and out-of-range,
- *    extends the returned array with +nil+ elements:
- *
- *      a.values_at(1..5) # => ["b", "c", "d", nil, nil]
- *
- *  - If <tt>range.end</tt> is negative and in-range,
- *    counts backwards from the end of +self+:
- *
- *      a.values_at(1..-2) # => ["b", "c"]
- *
- *  - If <tt>range.end</tt> is negative and out-of-range,
- *    returns an empty array:
- *
- *      a.values_at(1..-5) # => []
- *
- *  The given ranges may be in any order and may repeat:
+ *     ary.values_at(selector, ...)  -> new_ary
  *
- *    a.values_at(2..3, 0..1, 2..3) # => ["c", "d", "a", "b", "c", "d"]
+ *  Returns an array containing the elements in +self+ corresponding to the
+ *  given +selector+(s).
  *
- *  The given specifiers may be any mixture of indexes and ranges:
+ *  The selectors may be either integer indices or ranges.
  *
- *    a.values_at(3, 1..2, 0, 2..3) # => ["d", "b", "c", "a", "c", "d"]
+ *  See also Array#select.
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     a = %w{ a b c d e f }
+ *     a.values_at(1, 3, 5)          # => ["b", "d", "f"]
+ *     a.values_at(1, 3, 5, 7)       # => ["b", "d", "f", nil]
+ *     a.values_at(-1, -2, -2, -7)   # => ["f", "e", "e", nil]
+ *     a.values_at(4..6, 3...6)      # => ["e", "f", nil, "d", "e", "f"]
  */
 
 static VALUE
 rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
 {
-    long i, olen = RARRAY_LEN(ary);
-    VALUE result = rb_ary_new_capa(argc);
-    for (i = 0; i < argc; ++i) {
-        append_values_at_single(result, ary, olen, argv[i]);
-    }
-    RB_GC_GUARD(ary);
-    return result;
+    return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
 }
 
 
 /*
  *  call-seq:
- *    select {|element| ... } -> new_array
- *    select -> new_enumerator
- *    filter {|element| ... } -> new_array
- *    filter -> new_enumerator
+ *     ary.select { |item| block } -> new_ary
+ *     ary.select                  -> Enumerator
  *
- *  With a block given, calls the block with each element of +self+;
- *  returns a new array containing those elements of +self+
- *  for which the block returns a truthy value:
+ *  Returns a new array containing all elements of +ary+
+ *  for which the given +block+ returns a true value.
  *
- *    a = [:foo, 'bar', 2, :bam]
- *    a.select {|element| element.to_s.start_with?('b') }
- *    # => ["bar", :bam]
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  With no block given, returns a new Enumerator.
+ *     [1,2,3,4,5].select { |num|  num.even?  }   #=> [2, 4]
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     a = %w{ a b c d e f }
+ *     a.select { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
+ *
+ *  See also Enumerable#select.
  */
 
 static VALUE
@@ -3883,9 +2873,9 @@ rb_ary_select(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     result = rb_ary_new2(RARRAY_LEN(ary));
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-        if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-            rb_ary_push(result, rb_ary_elt(ary, i));
-        }
+	if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+	    rb_ary_push(result, rb_ary_elt(ary, i));
+	}
     }
     return result;
 }
@@ -3903,12 +2893,12 @@ select_bang_i(VALUE a)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-        VALUE v = RARRAY_AREF(ary, i1);
-        if (!RTEST(rb_yield(v))) continue;
-        if (i1 != i2) {
-            rb_ary_store(ary, i2, v);
-        }
-        arg->len[1] = ++i2;
+	VALUE v = RARRAY_AREF(ary, i1);
+	if (!RTEST(rb_yield(v))) continue;
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, v);
+	}
+	arg->len[1] = ++i2;
     }
     return (i1 == i2) ? Qnil : ary;
 }
@@ -3922,39 +2912,34 @@ select_bang_ensure(VALUE a)
     long i1 = arg->len[0], i2 = arg->len[1];
 
     if (i2 < len && i2 < i1) {
-        long tail = 0;
-        rb_ary_modify(ary);
-        if (i1 < len) {
-            tail = len - i1;
-            RARRAY_PTR_USE(ary, ptr, {
-                    MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
-                });
-        }
-        ARY_SET_LEN(ary, i2 + tail);
+	long tail = 0;
+	if (i1 < len) {
+	    tail = len - i1;
+	    RARRAY_PTR_USE(ary, ptr, {
+		    MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
+		});
+	}
+	ARY_SET_LEN(ary, i2 + tail);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    select! {|element| ... } -> self or nil
- *    select! -> new_enumerator
- *    filter! {|element| ... } -> self or nil
- *    filter! -> new_enumerator
+ *     ary.select!  {|item| block } -> ary or nil
+ *     ary.select!                  -> Enumerator
  *
- *  With a block given, calls the block with each element of +self+;
- *  removes from +self+ those elements for which the block returns +false+ or +nil+.
+ *  Invokes the given block passing in successive elements from +self+,
+ *  deleting elements for which the block returns a +false+ value.
  *
- *  Returns +self+ if any elements were removed:
+ *  The array may not be changed instantly every time the block is called.
  *
- *    a = [:foo, 'bar', 2, :bam]
- *    a.select! {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
+ *  If changes were made, it will return +self+, otherwise it returns +nil+.
  *
- *  Returns +nil+ if no elements were removed.
+ *  See also Array#keep_if
  *
- *  With no block given, returns a new Enumerator.
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -3972,18 +2957,18 @@ rb_ary_select_bang(VALUE ary)
 
 /*
  *  call-seq:
- *    keep_if {|element| ... } -> self
- *    keep_if -> new_enumerator
+ *     ary.keep_if { |item| block } -> ary
+ *     ary.keep_if                  -> Enumerator
  *
- *  With a block given, calls the block with each element of +self+;
- *  removes the element from +self+ if the block does not return a truthy value:
+ *  Deletes every element of +self+ for which the given block evaluates to
+ *  +false+.
  *
- *    a = [:foo, 'bar', 2, :bam]
- *    a.keep_if {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
+ *  See also Array#select!
  *
- *  With no block given, returns a new Enumerator.
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     a = %w{ a b c d e f }
+ *     a.keep_if { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
  */
 
 static VALUE
@@ -3999,49 +2984,32 @@ ary_resize_smaller(VALUE ary, long len)
 {
     rb_ary_modify(ary);
     if (RARRAY_LEN(ary) > len) {
-        ARY_SET_LEN(ary, len);
-        if (len * 2 < ARY_CAPA(ary) &&
-            ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
-            ary_resize_capa(ary, len * 2);
-        }
+	ARY_SET_LEN(ary, len);
+	if (len * 2 < ARY_CAPA(ary) &&
+	    ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+	    ary_resize_capa(ary, len * 2);
+	}
     }
 }
 
 /*
  *  call-seq:
- *    delete(object) -> last_removed_object
- *    delete(object) {|element| ... } -> last_removed_object or block_return
- *
- *  Removes zero or more elements from +self+.
- *
- *  With no block given,
- *  removes from +self+ each element +ele+ such that <tt>ele == object</tt>;
- *  returns the last removed element:
- *
- *    a = [0, 1, 2, 2.0]
- *    a.delete(2) # => 2.0
- *    a           # => [0, 1]
- *
- *  Returns +nil+ if no elements removed:
- *
- *    a.delete(2) # => nil
- *
- *  With a block given,
- *  removes from +self+ each element +ele+ such that <tt>ele == object</tt>.
+ *     ary.delete(obj)            -> item or nil
+ *     ary.delete(obj) { block }  -> item or result of block
  *
- *  If any such elements are found, ignores the block
- *  and returns the last removed element:
+ *  Deletes all items from +self+ that are equal to +obj+.
  *
- *    a = [0, 1, 2, 2.0]
- *    a.delete(2) {|element| fail 'Cannot happen' } # => 2.0
- *    a                                             # => [0, 1]
+ *  Returns the last deleted item, or +nil+ if no matching item is found.
  *
- *  If no such element is found, returns the block's return value:
+ *  If the optional code block is given, the result of the block is returned if
+ *  the item is not found.  (To remove +nil+ elements and get an informative
+ *  return value, use Array#compact!)
  *
- *    a.delete(2) {|element| "Element #{element} not found." }
- *    # => "Element 2 not found."
- *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     a = [ "a", "b", "b", "b", "c" ]
+ *     a.delete("b")                   #=> "b"
+ *     a                               #=> ["a", "c"]
+ *     a.delete("z")                   #=> nil
+ *     a.delete("z") { "not found" }   #=> "not found"
  */
 
 VALUE
@@ -4051,27 +3019,26 @@ rb_ary_delete(VALUE ary, VALUE item)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-        VALUE e = RARRAY_AREF(ary, i1);
+	VALUE e = RARRAY_AREF(ary, i1);
 
-        if (rb_equal(e, item)) {
-            v = e;
-            continue;
-        }
-        if (i1 != i2) {
-            rb_ary_store(ary, i2, e);
-        }
-        i2++;
+	if (rb_equal(e, item)) {
+	    v = e;
+	    continue;
+	}
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, e);
+	}
+	i2++;
     }
     if (RARRAY_LEN(ary) == i2) {
-        if (rb_block_given_p()) {
-            return rb_yield(item);
-        }
-        return Qnil;
+	if (rb_block_given_p()) {
+	    return rb_yield(item);
+	}
+	return Qnil;
     }
 
     ary_resize_smaller(ary, i2);
 
-    ary_verify(ary);
     return v;
 }
 
@@ -4081,18 +3048,18 @@ rb_ary_delete_same(VALUE ary, VALUE item)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-        VALUE e = RARRAY_AREF(ary, i1);
+	VALUE e = RARRAY_AREF(ary, i1);
 
-        if (e == item) {
-            continue;
-        }
-        if (i1 != i2) {
-            rb_ary_store(ary, i2, e);
-        }
-        i2++;
+	if (e == item) {
+	    continue;
+	}
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, e);
+	}
+	i2++;
     }
     if (RARRAY_LEN(ary) == i2) {
-        return;
+	return;
     }
 
     ary_resize_smaller(ary, i2);
@@ -4106,46 +3073,33 @@ rb_ary_delete_at(VALUE ary, long pos)
 
     if (pos >= len) return Qnil;
     if (pos < 0) {
-        pos += len;
-        if (pos < 0) return Qnil;
+	pos += len;
+	if (pos < 0) return Qnil;
     }
 
     rb_ary_modify(ary);
     del = RARRAY_AREF(ary, pos);
     RARRAY_PTR_USE(ary, ptr, {
-        MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+	MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
     });
     ARY_INCREASE_LEN(ary, -1);
-    ary_verify(ary);
+
     return del;
 }
 
 /*
  *  call-seq:
- *    delete_at(index) -> removed_object or nil
- *
- *  Removes the element of +self+ at the given +index+, which must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
- *
- *  When +index+ is non-negative, deletes the element at offset +index+:
- *
- *    a = [:foo, 'bar', 2]
- *    a.delete_at(1) # => "bar"
- *    a # => [:foo, 2]
- *
- *  When +index+ is negative, counts backward from the end of the array:
+ *     ary.delete_at(index)  -> obj or nil
  *
- *    a = [:foo, 'bar', 2]
- *    a.delete_at(-2) # => "bar"
- *    a # => [:foo, 2]
+ *  Deletes the element at the specified +index+, returning that element, or
+ *  +nil+ if the +index+ is out of range.
  *
- *  When +index+ is out of range, returns +nil+.
+ *  See also Array#slice!
  *
- *    a = [:foo, 'bar', 2]
- *    a.delete_at(3)  # => nil
- *    a.delete_at(-4) # => nil
- *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     a = ["ant", "bat", "cat", "dog"]
+ *     a.delete_at(2)    #=> "cat"
+ *     a                 #=> ["ant", "bat", "dog"]
+ *     a.delete_at(99)   #=> nil
  */
 
 static VALUE
@@ -4154,156 +3108,73 @@ rb_ary_delete_at_m(VALUE ary, VALUE pos)
     return rb_ary_delete_at(ary, NUM2LONG(pos));
 }
 
-static VALUE
-ary_slice_bang_by_rb_ary_splice(VALUE ary, long pos, long len)
-{
-    const long orig_len = RARRAY_LEN(ary);
-
-    if (len < 0) {
-        return Qnil;
-    }
-    else if (pos < -orig_len) {
-        return Qnil;
-    }
-    else if (pos < 0) {
-        pos += orig_len;
-    }
-    else if (orig_len < pos) {
-        return Qnil;
-    }
-    if (orig_len < pos + len) {
-        len = orig_len - pos;
-    }
-    if (len == 0) {
-        return rb_ary_new2(0);
-    }
-    else {
-        VALUE arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
-        rb_ary_splice(ary, pos, len, 0, 0);
-        return arg2;
-    }
-}
-
 /*
  *  call-seq:
- *    slice!(index) -> object or nil
- *    slice!(start, length) -> new_array or nil
- *    slice!(range) -> new_array or nil
- *
- *  Removes and returns elements from +self+.
- *
- *  With numeric argument +index+ given,
- *  removes and returns the element at offset +index+:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(2)   # => "c"
- *    a             # => ["a", "b", "d"]
- *    a.slice!(2.1) # => "d"
- *    a             # => ["a", "b"]
- *
- *  If +index+ is negative, counts backwards from the end of +self+:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(-2) # => "c"
- *    a            # => ["a", "b", "d"]
- *
- *  If +index+ is out of range, returns +nil+.
- *
- *  With numeric arguments +start+ and +length+ given,
- *  removes +length+ elements from +self+ beginning at zero-based offset +start+;
- *  returns the removed objects in a new array:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(1, 2)     # => ["b", "c"]
- *    a                  # => ["a", "d"]
- *    a.slice!(0.1, 1.1) # => ["a"]
- *    a                  # => ["d"]
- *
- *  If +start+ is negative, counts backwards from the end of +self+:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(-2, 1) # => ["c"]
- *    a               # => ["a", "b", "d"]
- *
- *  If +start+ is out-of-range, returns +nil+:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(5, 1)  # => nil
- *    a.slice!(-5, 1) # => nil
- *
- *  If <tt>start + length</tt> exceeds the array size,
- *  removes and returns all elements from offset +start+ to the end:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(2, 50) # => ["c", "d"]
- *    a               # => ["a", "b"]
- *
- *  If <tt>start == a.size</tt> and +length+ is non-negative,
- *  returns a new empty array.
- *
- *  If +length+ is negative, returns +nil+.
- *
- *  With Range argument +range+ given,
- *  treats <tt>range.min</tt> as +start+ (as above)
- *  and <tt>range.size</tt> as +length+ (as above):
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(1..2) # => ["b", "c"]
- *    a              # => ["a", "d"]
- *
- *  If <tt>range.start == a.size</tt>, returns a new empty array:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(4..5) # => []
- *
- *  If <tt>range.start</tt> is larger than the array size, returns +nil+:
- *
- *    a = ['a', 'b', 'c', 'd']
-      a.slice!(5..6) # => nil
- *
- *  If <tt>range.start</tt> is negative,
- *  calculates the start index by counting backwards from the end of +self+:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(-2..2) # => ["c"]
- *
- *  If <tt>range.end</tt> is negative,
- *  calculates the end index by counting backwards from the end of +self+:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(0..-2) # => ["a", "b", "c"]
- *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     ary.slice!(index)         -> obj or nil
+ *     ary.slice!(start, length) -> new_ary or nil
+ *     ary.slice!(range)         -> new_ary or nil
+ *
+ *  Deletes the element(s) given by an +index+ (optionally up to +length+
+ *  elements) or by a +range+.
+ *
+ *  Returns the deleted object (or objects), or +nil+ if the +index+ is out of
+ *  range.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.slice!(1)     #=> "b"
+ *     a               #=> ["a", "c"]
+ *     a.slice!(-1)    #=> "c"
+ *     a               #=> ["a"]
+ *     a.slice!(100)   #=> nil
+ *     a               #=> ["a"]
  */
 
 static VALUE
 rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE arg1;
-    long pos, len;
+    VALUE arg1, arg2;
+    long pos, len, orig_len;
 
     rb_ary_modify_check(ary);
-    rb_check_arity(argc, 1, 2);
-    arg1 = argv[0];
-
     if (argc == 2) {
-        pos = NUM2LONG(argv[0]);
-        len = NUM2LONG(argv[1]);
-        return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
+	pos = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
+      delete_pos_len:
+	if (len < 0) return Qnil;
+	orig_len = RARRAY_LEN(ary);
+	if (pos < 0) {
+	    pos += orig_len;
+	    if (pos < 0) return Qnil;
+	}
+	else if (orig_len < pos) return Qnil;
+	if (orig_len < pos + len) {
+	    len = orig_len - pos;
+	}
+	if (len == 0) return rb_ary_new2(0);
+	arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
+	RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
+	rb_ary_splice(ary, pos, len, 0, 0);
+	return arg2;
+    }
+
+    if (argc != 1) {
+	/* error report */
+	rb_scan_args(argc, argv, "11", NULL, NULL);
     }
+    arg1 = argv[0];
 
     if (!FIXNUM_P(arg1)) {
-        switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
-          case Qtrue:
-            /* valid range */
-            return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
-          case Qnil:
-            /* invalid range */
-            return Qnil;
-          default:
-            /* not a range */
-            break;
-        }
+	switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+	  case Qtrue:
+	    /* valid range */
+	    goto delete_pos_len;
+	  case Qnil:
+	    /* invalid range */
+	    return Qnil;
+	  default:
+	    /* not a range */
+	    break;
+	}
     }
 
     return rb_ary_delete_at(ary, NUM2LONG(arg1));
@@ -4315,11 +3186,10 @@ ary_reject(VALUE orig, VALUE result)
     long i;
 
     for (i = 0; i < RARRAY_LEN(orig); i++) {
-        VALUE v = RARRAY_AREF(orig, i);
-
-        if (!RTEST(rb_yield(v))) {
-            rb_ary_push(result, v);
-        }
+	VALUE v = RARRAY_AREF(orig, i);
+	if (!RTEST(rb_yield(v))) {
+	    rb_ary_push(result, v);
+	}
     }
     return result;
 }
@@ -4332,12 +3202,12 @@ reject_bang_i(VALUE a)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-        VALUE v = RARRAY_AREF(ary, i1);
-        if (RTEST(rb_yield(v))) continue;
-        if (i1 != i2) {
-            rb_ary_store(ary, i2, v);
-        }
-        arg->len[1] = ++i2;
+	VALUE v = RARRAY_AREF(ary, i1);
+	if (RTEST(rb_yield(v))) continue;
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, v);
+	}
+	arg->len[1] = ++i2;
     }
     return (i1 == i2) ? Qnil : ary;
 }
@@ -4346,6 +3216,7 @@ static VALUE
 ary_reject_bang(VALUE ary)
 {
     struct select_bang_arg args;
+
     rb_ary_modify_check(ary);
     args.ary = ary;
     args.len[0] = args.len[1] = 0;
@@ -4354,22 +3225,17 @@ ary_reject_bang(VALUE ary)
 
 /*
  *  call-seq:
- *    reject! {|element| ... } -> self or nil
- *    reject! -> new_enumerator
- *
- *  With a block given, calls the block with each element of +self+;
- *  removes each element for which the block returns a truthy value.
- *
- *  Returns +self+ if any elements removed:
+ *     ary.reject! { |item| block }  -> ary or nil
+ *     ary.reject!                   -> Enumerator
  *
- *    a = [:foo, 'bar', 2, 'bat']
- *    a.reject! {|element| element.to_s.start_with?('b') } # => [:foo, 2]
+ *  Deletes every element of +self+ for which the block evaluates to +true+,
+ *  if no changes were made returns +nil+.
  *
- *  Returns +nil+ if no elements removed.
+ *  The array may not be changed instantly every time the block is called.
  *
- *  With no block given, returns a new Enumerator.
+ *  See also Enumerable#reject and Array#delete_if.
  *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *  If no block is given, an Enumerator is returned instead.
  */
 
 static VALUE
@@ -4382,19 +3248,15 @@ rb_ary_reject_bang(VALUE ary)
 
 /*
  *  call-seq:
- *    reject {|element| ... } -> new_array
- *    reject -> new_enumerator
+ *     ary.reject  {|item| block }  -> new_ary
+ *     ary.reject                   -> Enumerator
  *
- *  With a block given, returns a new array whose elements are all those from +self+
- *  for which the block returns +false+ or +nil+:
+ *  Returns a new array containing the items in +self+ for which the given
+ *  block is not +true+. The ordering of non-rejected elements is maintained.
  *
- *    a = [:foo, 'bar', 2, 'bat']
- *    a1 = a.reject {|element| element.to_s.start_with?('b') }
- *    a1 # => [:foo, 2]
+ *  See also Array#delete_if
  *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *  If no block is given, an Enumerator is returned instead.
  */
 
 static VALUE
@@ -4410,25 +3272,25 @@ rb_ary_reject(VALUE ary)
 
 /*
  *  call-seq:
- *    delete_if {|element| ... } -> self
- *    delete_if -> new_numerator
+ *     ary.delete_if { |item| block }  -> ary
+ *     ary.delete_if                   -> Enumerator
+ *
+ *  Deletes every element of +self+ for which block evaluates to +true+.
  *
- *  With a block given, calls the block with each element of +self+;
- *  removes the element if the block returns a truthy value;
- *  returns +self+:
+ *  The array is changed instantly every time the block is called, not after
+ *  the iteration is over.
  *
- *    a = [:foo, 'bar', 2, 'bat']
- *    a.delete_if {|element| element.to_s.start_with?('b') } # => [:foo, 2]
+ *  See also Array#reject!
  *
- *  With no block given, returns a new Enumerator.
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     scores = [ 97, 42, 75 ]
+ *     scores.delete_if {|score| score < 80 }   #=> [97]
  */
 
 static VALUE
 rb_ary_delete_if(VALUE ary)
 {
-    ary_verify(ary);
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     ary_reject_bang(ary);
     return ary;
@@ -4438,9 +3300,9 @@ static VALUE
 take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
 {
     VALUE *args = (VALUE *)cbarg;
+    if (args[1]-- == 0) rb_iter_break();
     if (argc > 1) val = rb_ary_new4(argc, argv);
     rb_ary_push(args[0], val);
-    if (--args[1] == 0) rb_iter_break();
     return Qnil;
 }
 
@@ -4450,108 +3312,38 @@ take_items(VALUE obj, long n)
     VALUE result = rb_check_array_type(obj);
     VALUE args[2];
 
-    if (n == 0) return result;
     if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
     result = rb_ary_new2(n);
     args[0] = result; args[1] = (VALUE)n;
-    if (UNDEF_P(rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args)))
-        rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
-                 rb_obj_class(obj));
+    if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
+	rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
+		 rb_obj_class(obj));
     return result;
 }
 
 
 /*
  *  call-seq:
- *    zip(*other_arrays) -> new_array
- *    zip(*other_arrays) {|sub_array| ... } -> nil
- *
- *  With no block given, combines +self+ with the collection of +other_arrays+;
- *  returns a new array of sub-arrays:
- *
- *    [0, 1].zip(['zero', 'one'], [:zero, :one])
- *    # => [[0, "zero", :zero], [1, "one", :one]]
- *
- *  Returned:
- *
- *  - The outer array is of size <tt>self.size</tt>.
- *  - Each sub-array is of size <tt>other_arrays.size + 1</tt>.
- *  - The _nth_ sub-array contains (in order):
- *
- *    - The _nth_ element of +self+.
- *    - The _nth_ element of each of the other arrays, as available.
- *
- *  Example:
- *
- *    a = [0, 1]
- *    zipped = a.zip(['zero', 'one'], [:zero, :one])
- *    # => [[0, "zero", :zero], [1, "one", :one]]
- *    zipped.size       # => 2 # Same size as a.
- *    zipped.first.size # => 3 # Size of other arrays plus 1.
- *
- *  When the other arrays are all the same size as +self+,
- *  the returned sub-arrays are a rearrangement containing exactly elements of all the arrays
- *  (including +self+), with no omissions or additions:
- *
- *    a = [:a0, :a1, :a2, :a3]
- *    b = [:b0, :b1, :b2, :b3]
- *    c = [:c0, :c1, :c2, :c3]
- *    d = a.zip(b, c)
- *    pp d
- *    # =>
- *    [[:a0, :b0, :c0],
- *     [:a1, :b1, :c1],
- *     [:a2, :b2, :c2],
- *     [:a3, :b3, :c3]]
- *
- *  When one of the other arrays is smaller than +self+,
- *  pads the corresponding sub-array with +nil+ elements:
- *
- *    a = [:a0, :a1, :a2, :a3]
- *    b = [:b0, :b1, :b2]
- *    c = [:c0, :c1]
- *    d = a.zip(b, c)
- *    pp d
- *    # =>
- *    [[:a0, :b0, :c0],
- *     [:a1, :b1, :c1],
- *     [:a2, :b2, nil],
- *     [:a3, nil, nil]]
- *
- *  When one of the other arrays is larger than +self+,
- *  _ignores_ its trailing elements:
- *
- *    a = [:a0, :a1, :a2, :a3]
- *    b = [:b0, :b1, :b2, :b3, :b4]
- *    c = [:c0, :c1, :c2, :c3, :c4, :c5]
- *    d = a.zip(b, c)
- *    pp d
- *    # =>
- *    [[:a0, :b0, :c0],
- *     [:a1, :b1, :c1],
- *     [:a2, :b2, :c2],
- *     [:a3, :b3, :c3]]
- *
- *  With a block given, calls the block with each of the other arrays;
- *  returns +nil+:
- *
- *    d = []
- *    a = [:a0, :a1, :a2, :a3]
- *    b = [:b0, :b1, :b2, :b3]
- *    c = [:c0, :c1, :c2, :c3]
- *    a.zip(b, c) {|sub_array| d.push(sub_array.reverse) } # => nil
- *    pp d
- *    # =>
- *    [[:c0, :b0, :a0],
- *     [:c1, :b1, :a1],
- *     [:c2, :b2, :a2],
- *     [:c3, :b3, :a3]]
- *
- *  For an *object* in *other_arrays* that is not actually an array,
- *  forms the the "other array" as <tt>object.to_ary</tt>, if defined,
- *  or as <tt>object.each.to_a</tt> otherwise.
- *
- *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     ary.zip(arg, ...)                  -> new_ary
+ *     ary.zip(arg, ...) { |arr| block }  -> nil
+ *
+ *  Converts any arguments to arrays, then merges elements of +self+ with
+ *  corresponding elements from each argument.
+ *
+ *  This generates a sequence of <code>ary.size</code> _n_-element arrays,
+ *  where _n_ is one more than the count of arguments.
+ *
+ *  If the size of any argument is less than the size of the initial array,
+ *  +nil+ values are supplied.
+ *
+ *  If a block is given, it is invoked for each output +array+, otherwise an
+ *  array of arrays is returned.
+ *
+ *     a = [ 4, 5, 6 ]
+ *     b = [ 7, 8, 9 ]
+ *     [1, 2, 3].zip(a, b)   #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
+ *     [1, 2].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8]]
+ *     a.zip([1, 2], [8])    #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
  */
 
 static VALUE
@@ -4562,51 +3354,51 @@ rb_ary_zip(int argc, VALUE *argv, VALUE ary)
     VALUE result = Qnil;
 
     for (i=0; i<argc; i++) {
-        argv[i] = take_items(argv[i], len);
+	argv[i] = take_items(argv[i], len);
     }
 
     if (rb_block_given_p()) {
-        int arity = rb_block_arity();
-
-        if (arity > 1) {
-            VALUE work, *tmp;
-
-            tmp = ALLOCV_N(VALUE, work, argc+1);
-
-            for (i=0; i<RARRAY_LEN(ary); i++) {
-                tmp[0] = RARRAY_AREF(ary, i);
-                for (j=0; j<argc; j++) {
-                    tmp[j+1] = rb_ary_elt(argv[j], i);
-                }
-                rb_yield_values2(argc+1, tmp);
-            }
-
-            if (work) ALLOCV_END(work);
-        }
-        else {
-            for (i=0; i<RARRAY_LEN(ary); i++) {
-                VALUE tmp = rb_ary_new2(argc+1);
-
-                rb_ary_push(tmp, RARRAY_AREF(ary, i));
-                for (j=0; j<argc; j++) {
-                    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-                }
-                rb_yield(tmp);
-            }
-        }
+	int arity = rb_block_arity();
+
+	if (arity > 1) {
+	    VALUE work, *tmp;
+
+	    tmp = ALLOCV_N(VALUE, work, argc+1);
+
+	    for (i=0; i<RARRAY_LEN(ary); i++) {
+		tmp[0] = RARRAY_AREF(ary, i);
+		for (j=0; j<argc; j++) {
+		    tmp[j+1] = rb_ary_elt(argv[j], i);
+		}
+		rb_yield_values2(argc+1, tmp);
+	    }
+
+	    if (work) ALLOCV_END(work);
+	}
+	else {
+	    for (i=0; i<RARRAY_LEN(ary); i++) {
+		VALUE tmp = rb_ary_new2(argc+1);
+
+		rb_ary_push(tmp, RARRAY_AREF(ary, i));
+		for (j=0; j<argc; j++) {
+		    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+		}
+		rb_yield(tmp);
+	    }
+	}
     }
     else {
-        result = rb_ary_new_capa(len);
+	result = rb_ary_new_capa(len);
 
-        for (i=0; i<len; i++) {
-            VALUE tmp = rb_ary_new_capa(argc+1);
+	for (i=0; i<len; i++) {
+	    VALUE tmp = rb_ary_new_capa(argc+1);
 
-            rb_ary_push(tmp, RARRAY_AREF(ary, i));
-            for (j=0; j<argc; j++) {
-                rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-            }
-            rb_ary_push(result, tmp);
-        }
+	    rb_ary_push(tmp, RARRAY_AREF(ary, i));
+	    for (j=0; j<argc; j++) {
+		rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+	    }
+	    rb_ary_push(result, tmp);
+	}
     }
 
     return result;
@@ -4614,17 +3406,15 @@ rb_ary_zip(int argc, VALUE *argv, VALUE ary)
 
 /*
  *  call-seq:
- *    transpose -> new_array
- *
- *  Returns a new array that is +self+
- *  as a {transposed matrix}[https://en.wikipedia.org/wiki/Transpose]:
+ *     ary.transpose -> new_ary
  *
- *    a = [[:a0, :a1], [:b0, :b1], [:c0, :c1]]
- *    a.transpose # => [[:a0, :b0, :c0], [:a1, :b1, :c1]]
+ *  Assumes that +self+ is an array of arrays and transposes the rows and
+ *  columns.
  *
- *  The elements of +self+ must all be the same size.
+ *     a = [[1,2], [3,4], [5,6]]
+ *     a.transpose   #=> [[1, 3, 5], [2, 4, 6]]
  *
- *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *  If the length of the subarrays don't match, an IndexError is raised.
  */
 
 static VALUE
@@ -4636,38 +3426,36 @@ rb_ary_transpose(VALUE ary)
     alen = RARRAY_LEN(ary);
     if (alen == 0) return rb_ary_dup(ary);
     for (i=0; i<alen; i++) {
-        tmp = to_ary(rb_ary_elt(ary, i));
-        if (elen < 0) {		/* first element */
-            elen = RARRAY_LEN(tmp);
-            result = rb_ary_new2(elen);
-            for (j=0; j<elen; j++) {
-                rb_ary_store(result, j, rb_ary_new2(alen));
-            }
-        }
-        else if (elen != RARRAY_LEN(tmp)) {
-            rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
-                     RARRAY_LEN(tmp), elen);
-        }
-        for (j=0; j<elen; j++) {
-            rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
-        }
+	tmp = to_ary(rb_ary_elt(ary, i));
+	if (elen < 0) {		/* first element */
+	    elen = RARRAY_LEN(tmp);
+	    result = rb_ary_new2(elen);
+	    for (j=0; j<elen; j++) {
+		rb_ary_store(result, j, rb_ary_new2(alen));
+	    }
+	}
+	else if (elen != RARRAY_LEN(tmp)) {
+	    rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+		     RARRAY_LEN(tmp), elen);
+	}
+	for (j=0; j<elen; j++) {
+	    rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
+	}
     }
     return result;
 }
 
 /*
  *  call-seq:
- *    initialize_copy(other_array) -> self
- *    replace(other_array) -> self
- *
- *  Replaces the elements of +self+ with the elements of +other_array+, which must be an
- *  {array-convertible object}[rdoc-ref:implicit_conversion.rdoc@Array-Convertible+Objects];
- *  returns +self+:
+ *     ary.replace(other_ary)  -> ary
+ *     ary.initialize_copy(other_ary)	-> ary
  *
- *    a = ['a', 'b', 'c']   # => ["a", "b", "c"]
- *    a.replace(['d', 'e']) # => ["d", "e"]
+ *  Replaces the contents of +self+ with the contents of +other_ary+,
+ *  truncating or expanding if necessary.
  *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a.replace([ "x", "y", "z" ])   #=> ["x", "y", "z"]
+ *     a                              #=> ["x", "y", "z"]
  */
 
 VALUE
@@ -4677,251 +3465,94 @@ rb_ary_replace(VALUE copy, VALUE orig)
     orig = to_ary(orig);
     if (copy == orig) return copy;
 
-    rb_ary_reset(copy);
-
-    /* orig has enough space to embed the contents of orig. */
-    if (RARRAY_LEN(orig) <= ary_embed_capa(copy)) {
-        RUBY_ASSERT(ARY_EMBED_P(copy));
-        ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
-        ARY_SET_EMBED_LEN(copy, RARRAY_LEN(orig));
-    }
-    /* orig is embedded but copy does not have enough space to embed the
-     * contents of orig. */
-    else if (ARY_EMBED_P(orig)) {
-        long len = ARY_EMBED_LEN(orig);
-        VALUE *ptr = ary_heap_alloc_buffer(len);
-
-        FL_UNSET_EMBED(copy);
-        ARY_SET_PTR(copy, ptr);
-        ARY_SET_LEN(copy, len);
-        ARY_SET_CAPA(copy, len);
+    if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
+        VALUE shared = 0;
 
-        // No allocation and exception expected that could leave `copy` in a
-        // bad state from the edits above.
-        ary_memcpy(copy, 0, len, RARRAY_CONST_PTR(orig));
+        if (ARY_OWNS_HEAP_P(copy)) {
+	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
+	}
+        else if (ARY_SHARED_P(copy)) {
+            shared = ARY_SHARED(copy);
+            FL_UNSET_SHARED(copy);
+        }
+        FL_SET_EMBED(copy);
+	ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
+        if (shared) {
+            rb_ary_decrement_share(shared);
+        }
+        ARY_SET_LEN(copy, RARRAY_LEN(orig));
     }
-    /* Otherwise, orig is on heap and copy does not have enough space to embed
-     * the contents of orig. */
     else {
-        VALUE shared_root = ary_make_shared(orig);
+        VALUE shared = ary_make_shared(orig);
+        if (ARY_OWNS_HEAP_P(copy)) {
+	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
+        }
+        else {
+            rb_ary_unshare_safe(copy);
+        }
         FL_UNSET_EMBED(copy);
-        ARY_SET_PTR(copy, ARY_HEAP_PTR(orig));
-        ARY_SET_LEN(copy, ARY_HEAP_LEN(orig));
-        rb_ary_set_shared(copy, shared_root);
+        ARY_SET_PTR(copy, RARRAY_CONST_PTR(orig));
+        ARY_SET_LEN(copy, RARRAY_LEN(orig));
+        rb_ary_set_shared(copy, shared);
     }
-    ary_verify(copy);
     return copy;
 }
 
 /*
  *  call-seq:
- *    clear -> self
- *
- *  Removes all elements from +self+; returns +self+:
+ *     ary.clear    -> ary
  *
- *    a = [:foo, 'bar', 2]
- *    a.clear # => []
+ *  Removes all elements from +self+.
  *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a.clear    #=> [ ]
  */
 
 VALUE
 rb_ary_clear(VALUE ary)
 {
     rb_ary_modify_check(ary);
+    ARY_SET_LEN(ary, 0);
     if (ARY_SHARED_P(ary)) {
-        rb_ary_unshare(ary);
-        FL_SET_EMBED(ary);
-        ARY_SET_EMBED_LEN(ary, 0);
+	if (!ARY_EMBED_P(ary)) {
+	    rb_ary_unshare(ary);
+	    FL_SET_EMBED(ary);
+	}
     }
-    else {
-        ARY_SET_LEN(ary, 0);
-        if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
-            ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
-        }
+    else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+	ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
     }
-    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *    fill(object, start = nil, count = nil) -> new_array
- *    fill(object, range) -> new_array
- *    fill(start = nil, count = nil) {|element| ... } -> new_array
- *    fill(range) {|element| ... } -> new_array
- *
- *  Replaces selected elements in +self+;
- *  may add elements to +self+;
- *  always returns +self+ (never a new array).
- *
- *  In brief:
- *
- *    # Non-negative start.
- *    ['a', 'b', 'c', 'd'].fill('-', 1, 2)          # => ["a", "-", "-", "d"]
- *    ['a', 'b', 'c', 'd'].fill(1, 2) {|e| e.to_s } # => ["a", "1", "2", "d"]
- *
- *    # Extends with specified values if necessary.
- *    ['a', 'b', 'c', 'd'].fill('-', 3, 2)          # => ["a", "b", "c", "-", "-"]
- *    ['a', 'b', 'c', 'd'].fill(3, 2) {|e| e.to_s } # => ["a", "b", "c", "3", "4"]
- *
- *    # Fills with nils if necessary.
- *    ['a', 'b', 'c', 'd'].fill('-', 6, 2)          # => ["a", "b", "c", "d", nil, nil, "-", "-"]
- *    ['a', 'b', 'c', 'd'].fill(6, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, nil, "6", "7"]
- *
- *    # For negative start, counts backwards from the end.
- *    ['a', 'b', 'c', 'd'].fill('-', -3, 3)          # => ["a", "-", "-", "-"]
- *    ['a', 'b', 'c', 'd'].fill(-3, 3) {|e| e.to_s } # => ["a", "1", "2", "3"]
- *
- *    # Range.
- *    ['a', 'b', 'c', 'd'].fill('-', 1..2)          # => ["a", "-", "-", "d"]
- *    ['a', 'b', 'c', 'd'].fill(1..2) {|e| e.to_s } # => ["a", "1", "2", "d"]
- *
- *  When arguments +start+ and +count+ are given,
- *  they select the elements of +self+ to be replaced;
- *  each must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
- *  (or +nil+):
- *
- *  - +start+ specifies the zero-based offset of the first element to be replaced;
- *    +nil+ means zero.
- *  - +count+ is the number of consecutive elements to be replaced;
- *    +nil+ means "all the rest."
- *
- *  With argument +object+ given,
- *  that one object is used for all replacements:
- *
- *    o = Object.new           # => #<Object:0x0000014e7bff7600>
- *    a = ['a', 'b', 'c', 'd'] # => ["a", "b", "c", "d"]
- *    a.fill(o, 1, 2)
- *    # => ["a", #<Object:0x0000014e7bff7600>, #<Object:0x0000014e7bff7600>, "d"]
- *
- *  With a block given, the block is called once for each element to be replaced;
- *  the value passed to the block is the _index_ of the element to be replaced
- *  (not the element itself);
- *  the block's return value replaces the element:
- *
- *    a = ['a', 'b', 'c', 'd']               # => ["a", "b", "c", "d"]
- *    a.fill(1, 2) {|element| element.to_s } # => ["a", "1", "2", "d"]
- *
- *  For arguments +start+ and +count+:
- *
- *  - If +start+ is non-negative,
- *    replaces +count+ elements beginning at offset +start+:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 0, 2) # => ["-", "-", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', 1, 2) # => ["a", "-", "-", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', 2, 2) # => ["a", "b", "-", "-"]
- *
- *      ['a', 'b', 'c', 'd'].fill(0, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(1, 2) {|e| e.to_s } # => ["a", "1", "2", "d"]
- *      ['a', 'b', 'c', 'd'].fill(2, 2) {|e| e.to_s } # => ["a", "b", "2", "3"]
- *
- *    Extends +self+ if necessary:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 3, 2) # => ["a", "b", "c", "-", "-"]
- *      ['a', 'b', 'c', 'd'].fill('-', 4, 2) # => ["a", "b", "c", "d", "-", "-"]
- *
- *      ['a', 'b', 'c', 'd'].fill(3, 2) {|e| e.to_s } # => ["a", "b", "c", "3", "4"]
- *      ['a', 'b', 'c', 'd'].fill(4, 2) {|e| e.to_s } # => ["a", "b", "c", "d", "4", "5"]
- *
- *    Fills with +nil+ if necessary:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 5, 2) # => ["a", "b", "c", "d", nil, "-", "-"]
- *      ['a', 'b', 'c', 'd'].fill('-', 6, 2) # => ["a", "b", "c", "d", nil, nil, "-", "-"]
- *
- *      ['a', 'b', 'c', 'd'].fill(5, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, "5", "6"]
- *      ['a', 'b', 'c', 'd'].fill(6, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, nil, "6", "7"]
- *
- *    Does nothing if +count+ is non-positive:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 2, 0)    # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', 2, -100) # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', 6, -100) # => ["a", "b", "c", "d"]
- *
- *      ['a', 'b', 'c', 'd'].fill(2, 0) {|e| fail 'Cannot happen' }    # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(2, -100) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(6, -100) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
- *
- *  - If +start+ is negative, counts backwards from the end of +self+:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', -4, 3) # => ["-", "-", "-", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', -3, 3) # => ["a", "-", "-", "-"]
+ *     ary.fill(obj)                                 -> ary
+ *     ary.fill(obj, start [, length])               -> ary
+ *     ary.fill(obj, range )                         -> ary
+ *     ary.fill { |index| block }                    -> ary
+ *     ary.fill(start [, length] ) { |index| block } -> ary
+ *     ary.fill(range) { |index| block }             -> ary
  *
- *      ['a', 'b', 'c', 'd'].fill(-4, 3) {|e| e.to_s } # => ["0", "1", "2", "d"]
- *      ['a', 'b', 'c', 'd'].fill(-3, 3) {|e| e.to_s } # => ["a", "1", "2", "3"]
+ *  The first three forms set the selected elements of +self+ (which
+ *  may be the entire array) to +obj+.
  *
- *    Extends +self+ if necessary:
+ *  A +start+ of +nil+ is equivalent to zero.
  *
- *      ['a', 'b', 'c', 'd'].fill('-', -2, 3) # => ["a", "b", "-", "-", "-"]
- *      ['a', 'b', 'c', 'd'].fill('-', -1, 3) # => ["a", "b", "c", "-", "-", "-"]
+ *  A +length+ of +nil+ is equivalent to the length of the array.
  *
- *      ['a', 'b', 'c', 'd'].fill(-2, 3) {|e| e.to_s } # => ["a", "b", "2", "3", "4"]
- *      ['a', 'b', 'c', 'd'].fill(-1, 3) {|e| e.to_s } # => ["a", "b", "c", "3", "4", "5"]
+ *  The last three forms fill the array with the value of the given block,
+ *  which is passed the absolute index of each element to be filled.
  *
- *    Starts at the beginning of +self+ if +start+ is negative and out-of-range:
+ *  Negative values of +start+ count from the end of the array, where +-1+ is
+ *  the last element.
  *
- *      ['a', 'b', 'c', 'd'].fill('-', -5, 2) # => ["-", "-", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', -6, 2) # => ["-", "-", "c", "d"]
- *
- *      ['a', 'b', 'c', 'd'].fill(-5, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(-6, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
- *
- *    Does nothing if +count+ is non-positive:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', -2, 0)  # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', -2, -1) # => ["a", "b", "c", "d"]
- *
- *      ['a', 'b', 'c', 'd'].fill(-2, 0) {|e| fail 'Cannot happen' }  # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(-2, -1) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
- *
- *  When argument +range+ is given,
- *  it must be a Range object whose members are numeric;
- *  its +begin+ and +end+ values determine the elements of +self+
- *  to be replaced:
- *
- *  - If both +begin+ and +end+ are positive, they specify the first and last elements
- *    to be replaced:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 1..2)          # => ["a", "-", "-", "d"]
- *      ['a', 'b', 'c', 'd'].fill(1..2) {|e| e.to_s } # => ["a", "1", "2", "d"]
- *
- *    If +end+ is smaller than +begin+, replaces no elements:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 2..1)          # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(2..1) {|e| e.to_s } # => ["a", "b", "c", "d"]
- *
- *  - If either is negative (or both are negative), counts backwards from the end of +self+:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', -3..2)  # => ["a", "-", "-", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', 1..-2)  # => ["a", "-", "-", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', -3..-2) # => ["a", "-", "-", "d"]
- *
- *      ['a', 'b', 'c', 'd'].fill(-3..2) {|e| e.to_s }  # => ["a", "1", "2", "d"]
- *      ['a', 'b', 'c', 'd'].fill(1..-2) {|e| e.to_s }  # => ["a", "1", "2", "d"]
- *      ['a', 'b', 'c', 'd'].fill(-3..-2) {|e| e.to_s } # => ["a", "1", "2", "d"]
- *
- *  - If the +end+ value is excluded (see Range#exclude_end?), omits the last replacement:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 1...2)  # => ["a", "-", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', 1...-2) # => ["a", "-", "c", "d"]
- *
- *      ['a', 'b', 'c', 'd'].fill(1...2) {|e| e.to_s }  # => ["a", "1", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(1...-2) {|e| e.to_s } # => ["a", "1", "c", "d"]
- *
- *  - If the range is endless (see {Endless Ranges}[rdoc-ref:Range@Endless+Ranges]),
- *    replaces elements to the end of +self+:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 1..)          # => ["a", "-", "-", "-"]
- *      ['a', 'b', 'c', 'd'].fill(1..) {|e| e.to_s } # => ["a", "1", "2", "3"]
- *
- *  - If the range is beginless (see {Beginless Ranges}[rdoc-ref:Range@Beginless+Ranges]),
- *    replaces elements from the beginning of +self+:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', ..2)          # => ["-", "-", "-", "d"]
- *      ['a', 'b', 'c', 'd'].fill(..2) {|e| e.to_s } # => ["0", "1", "2", "d"]
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.fill("x")              #=> ["x", "x", "x", "x"]
+ *     a.fill("z", 2, 2)        #=> ["x", "x", "z", "z"]
+ *     a.fill("y", 0..1)        #=> ["y", "y", "z", "z"]
+ *     a.fill { |i| i*i }       #=> [0, 1, 4, 9]
+ *     a.fill(-2) { |i| i*i*i } #=> [0, 1, 8, 27]
  */
 
 static VALUE
@@ -4931,74 +3562,84 @@ rb_ary_fill(int argc, VALUE *argv, VALUE ary)
     long beg = 0, end = 0, len = 0;
 
     if (rb_block_given_p()) {
-        rb_scan_args(argc, argv, "02", &arg1, &arg2);
-        argc += 1;		/* hackish */
+	rb_scan_args(argc, argv, "02", &arg1, &arg2);
+	argc += 1;		/* hackish */
     }
     else {
-        rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+	rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
     }
     switch (argc) {
       case 1:
-        beg = 0;
-        len = RARRAY_LEN(ary);
-        break;
+	beg = 0;
+	len = RARRAY_LEN(ary);
+	break;
       case 2:
-        if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
-            break;
-        }
-        /* fall through */
+	if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+	    break;
+	}
+	/* fall through */
       case 3:
-        beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
-        if (beg < 0) {
-            beg = RARRAY_LEN(ary) + beg;
-            if (beg < 0) beg = 0;
-        }
-        len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
-        break;
+	beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
+	if (beg < 0) {
+	    beg = RARRAY_LEN(ary) + beg;
+	    if (beg < 0) beg = 0;
+	}
+	len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+	break;
     }
     rb_ary_modify(ary);
     if (len < 0) {
         return ary;
     }
     if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
-        rb_raise(rb_eArgError, "argument too big");
+	rb_raise(rb_eArgError, "argument too big");
     }
     end = beg + len;
     if (RARRAY_LEN(ary) < end) {
-        if (end >= ARY_CAPA(ary)) {
-            ary_resize_capa(ary, end);
-        }
-        ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
-        ARY_SET_LEN(ary, end);
+	if (end >= ARY_CAPA(ary)) {
+	    ary_resize_capa(ary, end);
+	}
+	ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+	ARY_SET_LEN(ary, end);
     }
 
-    if (UNDEF_P(item)) {
-        VALUE v;
-        long i;
+    if (item == Qundef) {
+	VALUE v;
+	long i;
 
-        for (i=beg; i<end; i++) {
-            v = rb_yield(LONG2NUM(i));
-            if (i>=RARRAY_LEN(ary)) break;
-            ARY_SET(ary, i, v);
-        }
+	for (i=beg; i<end; i++) {
+	    v = rb_yield(LONG2NUM(i));
+	    if (i>=RARRAY_LEN(ary)) break;
+	    ARY_SET(ary, i, v);
+	}
     }
     else {
-        ary_memfill(ary, beg, len, item);
+	ary_memfill(ary, beg, len, item);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    self + other_array -> new_array
+ *     ary + other_ary   -> new_ary
+ *
+ *  Concatenation --- Returns a new array built by concatenating the
+ *  two arrays together to produce a third array.
  *
- *  Returns a new array containing all elements of +self+
- *  followed by all elements of +other_array+:
+ *     [ 1, 2, 3 ] + [ 4, 5 ]    #=> [ 1, 2, 3, 4, 5 ]
+ *     a = [ "a", "b", "c" ]
+ *     c = a + [ "d", "e", "f" ]
+ *     c                         #=> [ "a", "b", "c", "d", "e", "f" ]
+ *     a                         #=> [ "a", "b", "c" ]
  *
- *    a = [0, 1] + [2, 3]
- *    a # => [0, 1, 2, 3]
+ *  Note that
+ *     x += y
+ *  is the same as
+ *     x = x + y
+ *  This means that it produces a new array. As a consequence,
+ *  repeated use of <code>+=</code> on arrays can be quite inefficient.
  *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *  See also Array#concat.
  */
 
 VALUE
@@ -5024,23 +3665,29 @@ ary_append(VALUE x, VALUE y)
 {
     long n = RARRAY_LEN(y);
     if (n > 0) {
-        rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR(y), n);
+	rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR(y), n);
     }
-    RB_GC_GUARD(y);
     return x;
 }
 
 /*
  *  call-seq:
- *    concat(*other_arrays) -> self
+ *     ary.concat(other_ary1, other_ary2,...)   -> ary
+ *
+ *  Appends the elements of +other_ary+s to +self+.
  *
- *  Adds to +self+ all elements from each array in +other_arrays+; returns +self+:
+ *     [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
+ *     [ "a" ].concat( ["b"], ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
+ *     [ "a" ].concat #=> [ "a" ]
  *
- *    a = [0, 1]
- *    a.concat(['two', 'three'], [:four, :five], a)
- *    # => [0, 1, "two", "three", :four, :five, 0, 1]
+ *     a = [ 1, 2, 3 ]
+ *     a.concat( [ 4, 5 ] )
+ *     a                                 #=> [ 1, 2, 3, 4, 5 ]
  *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ 1, 2 ]
+ *     a.concat(a, a)                    #=> [1, 2, 1, 2, 1, 2]
+ *
+ *  See also Array#+.
  */
 
 static VALUE
@@ -5049,18 +3696,17 @@ rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
     rb_ary_modify_check(ary);
 
     if (argc == 1) {
-        rb_ary_concat(ary, argv[0]);
+	rb_ary_concat(ary, argv[0]);
     }
     else if (argc > 1) {
-        int i;
-        VALUE args = rb_ary_hidden_new(argc);
-        for (i = 0; i < argc; i++) {
-            rb_ary_concat(args, argv[i]);
-        }
-        ary_append(ary, args);
+	int i;
+	VALUE args = rb_ary_tmp_new(argc);
+	for (i = 0; i < argc; i++) {
+	    rb_ary_concat(args, argv[i]);
+	}
+	ary_append(ary, args);
     }
 
-    ary_verify(ary);
     return ary;
 }
 
@@ -5072,19 +3718,18 @@ rb_ary_concat(VALUE x, VALUE y)
 
 /*
  *  call-seq:
- *    self * n -> new_array
- *    self * string_separator -> new_string
+ *     ary * int     -> new_ary
+ *     ary * str     -> new_string
  *
- *  When non-negative integer argument +n+ is given,
- *  returns a new array built by concatenating +n+ copies of +self+:
+ *  Repetition --- With a String argument, equivalent to
+ *  <code>ary.join(str)</code>.
  *
- *    a = ['x', 'y']
- *    a * 3 # => ["x", "y", "x", "y", "x", "y"]
+ *  Otherwise, returns a new array built by concatenating the +int+ copies of
+ *  +self+.
  *
- *  When string argument +string_separator+ is given,
- *  equivalent to <tt>self.join(string_separator)</tt>:
  *
- *    [0, [0, 1], {foo: 0}] * ', ' # => "0, 0, 1, {foo: 0}"
+ *     [ 1, 2, 3 ] * 3    #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
+ *     [ 1, 2, 3 ] * ","  #=> "1,2,3"
  *
  */
 
@@ -5097,55 +3742,61 @@ rb_ary_times(VALUE ary, VALUE times)
 
     tmp = rb_check_string_type(times);
     if (!NIL_P(tmp)) {
-        return rb_ary_join(ary, tmp);
+	return rb_ary_join(ary, tmp);
     }
 
     len = NUM2LONG(times);
     if (len == 0) {
-        ary2 = ary_new(rb_cArray, 0);
-        goto out;
+	ary2 = ary_new(rb_obj_class(ary), 0);
+	goto out;
     }
     if (len < 0) {
-        rb_raise(rb_eArgError, "negative argument");
+	rb_raise(rb_eArgError, "negative argument");
     }
     if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
-        rb_raise(rb_eArgError, "argument too big");
+	rb_raise(rb_eArgError, "argument too big");
     }
     len *= RARRAY_LEN(ary);
 
-    ary2 = ary_new(rb_cArray, len);
+    ary2 = ary_new(rb_obj_class(ary), len);
     ARY_SET_LEN(ary2, len);
 
     ptr = RARRAY_CONST_PTR(ary);
     t = RARRAY_LEN(ary);
     if (0 < t) {
-        ary_memcpy(ary2, 0, t, ptr);
-        while (t <= len/2) {
-            ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
+	ary_memcpy(ary2, 0, t, ptr);
+	while (t <= len/2) {
+	    ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
             t *= 2;
         }
         if (t < len) {
-            ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
+	    ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
         }
     }
   out:
+    OBJ_INFECT(ary2, ary);
+
     return ary2;
 }
 
 /*
  *  call-seq:
- *    assoc(object) -> found_array or nil
+ *     ary.assoc(obj)   -> element_ary  or  nil
  *
- *  Returns the first element +ele+ in +self+ such that +ele+ is an array
- *  and <tt>ele[0] == object</tt>:
+ *  Searches through an array whose elements are also arrays comparing +obj+
+ *  with the first element of each contained array using <code>obj.==</code>.
  *
- *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
- *    a.assoc(4) # => [4, 5, 6]
+ *  Returns the first contained array that matches (that is, the first
+ *  associated array), or +nil+ if no match is found.
  *
- *  Returns +nil+ if no such element is found.
+ *  See also Array#rassoc
  *
- *  Related: Array#rassoc;
- *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     s1 = [ "colors", "red", "blue", "green" ]
+ *     s2 = [ "letters", "a", "b", "c" ]
+ *     s3 = "foo"
+ *     a  = [ s1, s2, s3 ]
+ *     a.assoc("letters")  #=> [ "letters", "a", "b", "c" ]
+ *     a.assoc("foo")      #=> nil
  */
 
 VALUE
@@ -5155,29 +3806,30 @@ rb_ary_assoc(VALUE ary, VALUE key)
     VALUE v;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-        v = rb_check_array_type(RARRAY_AREF(ary, i));
-        if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
-            rb_equal(RARRAY_AREF(v, 0), key))
-            return v;
+	v = rb_check_array_type(RARRAY_AREF(ary, i));
+	if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+	    rb_equal(RARRAY_AREF(v, 0), key))
+	    return v;
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *    rassoc(object) -> found_array or nil
+ *     ary.rassoc(obj) -> element_ary or nil
+ *
+ *  Searches through the array whose elements are also arrays.
  *
- *  Returns the first element +ele+ in +self+ such that +ele+ is an array
- *  and <tt>ele[1] == object</tt>:
+ *  Compares +obj+ with the second element of each contained array using
+ *  <code>obj.==</code>.
  *
- *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
- *    a.rassoc(4) # => [2, 4]
- *    a.rassoc(5) # => [4, 5, 6]
+ *  Returns the first contained array that matches +obj+.
  *
- *  Returns +nil+ if no such element is found.
+ *  See also Array#assoc.
  *
- *  Related: Array#assoc;
- *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
+ *     a.rassoc("two")    #=> [2, "two"]
+ *     a.rassoc("four")   #=> nil
  */
 
 VALUE
@@ -5187,11 +3839,11 @@ rb_ary_rassoc(VALUE ary, VALUE value)
     VALUE v;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-        v = rb_check_array_type(RARRAY_AREF(ary, i));
-        if (RB_TYPE_P(v, T_ARRAY) &&
-            RARRAY_LEN(v) > 1 &&
-            rb_equal(RARRAY_AREF(v, 1), value))
-            return v;
+	v = RARRAY_AREF(ary, i);
+	if (RB_TYPE_P(v, T_ARRAY) &&
+	    RARRAY_LEN(v) > 1 &&
+	    rb_equal(RARRAY_AREF(v, 1), value))
+	    return v;
     }
     return Qnil;
 }
@@ -5204,54 +3856,43 @@ recursive_equal(VALUE ary1, VALUE ary2, int recur)
 
     if (recur) return Qtrue; /* Subtle! */
 
-    /* rb_equal() can evacuate ptrs */
     p1 = RARRAY_CONST_PTR(ary1);
     p2 = RARRAY_CONST_PTR(ary2);
     len1 = RARRAY_LEN(ary1);
 
     for (i = 0; i < len1; i++) {
-        if (*p1 != *p2) {
-            if (rb_equal(*p1, *p2)) {
-                len1 = RARRAY_LEN(ary1);
-                if (len1 != RARRAY_LEN(ary2))
-                    return Qfalse;
-                if (len1 < i)
-                    return Qtrue;
-                p1 = RARRAY_CONST_PTR(ary1) + i;
-                p2 = RARRAY_CONST_PTR(ary2) + i;
-            }
-            else {
-                return Qfalse;
-            }
-        }
-        p1++;
-        p2++;
+	if (*p1 != *p2) {
+	    if (rb_equal(*p1, *p2)) {
+		len1 = RARRAY_LEN(ary1);
+		if (len1 != RARRAY_LEN(ary2))
+		    return Qfalse;
+		if (len1 < i)
+		    return Qtrue;
+		p1 = RARRAY_CONST_PTR(ary1) + i;
+		p2 = RARRAY_CONST_PTR(ary2) + i;
+	    }
+	    else {
+		return Qfalse;
+	    }
+	}
+	p1++;
+	p2++;
     }
     return Qtrue;
 }
 
 /*
  *  call-seq:
- *    self == other_array -> true or false
- *
- *  Returns whether both:
- *
- *  - +self+ and +other_array+ are the same size.
- *  - Their corresponding elements are the same;
- *    that is, for each index +i+ in <tt>(0...self.size)</tt>,
- *    <tt>self[i] == other_array[i]</tt>.
+ *     ary == other_ary   ->   bool
  *
- *  Examples:
+ *  Equality --- Two arrays are equal if they contain the same number of
+ *  elements and if each element is equal to (according to Object#==) the
+ *  corresponding element in +other_ary+.
  *
- *    [:foo, 'bar', 2] == [:foo, 'bar', 2]   # => true
- *    [:foo, 'bar', 2] == [:foo, 'bar', 2.0] # => true
- *    [:foo, 'bar', 2] == [:foo, 'bar']      # => false # Different sizes.
- *    [:foo, 'bar', 2] == [:foo, 'bar', 3]   # => false # Different elements.
+ *     [ "a", "c" ]    == [ "a", "c", 7 ]     #=> false
+ *     [ "a", "c", 7 ] == [ "a", "c", 7 ]     #=> true
+ *     [ "a", "c", 7 ] == [ "a", "d", "f" ]   #=> false
  *
- *  This method is different from method Array#eql?,
- *  which compares elements using <tt>Object#eql?</tt>.
- *
- *  Related: see {Methods for Comparing}[rdoc-ref:Array@Methods+for+Comparing].
  */
 
 static VALUE
@@ -5259,10 +3900,10 @@ rb_ary_equal(VALUE ary1, VALUE ary2)
 {
     if (ary1 == ary2) return Qtrue;
     if (!RB_TYPE_P(ary2, T_ARRAY)) {
-        if (!rb_respond_to(ary2, idTo_ary)) {
-            return Qfalse;
-        }
-        return rb_equal(ary2, ary1);
+	if (!rb_respond_to(ary2, idTo_ary)) {
+	    return Qfalse;
+	}
+	return rb_equal(ary2, ary1);
     }
     if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
     if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
@@ -5276,29 +3917,18 @@ recursive_eql(VALUE ary1, VALUE ary2, int recur)
 
     if (recur) return Qtrue; /* Subtle! */
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-        if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
-            return Qfalse;
+	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+	    return Qfalse;
     }
     return Qtrue;
 }
 
 /*
  *  call-seq:
- *    eql?(other_array) -> true or false
- *
- *  Returns +true+ if +self+ and +other_array+ are the same size,
- *  and if, for each index +i+ in +self+, <tt>self[i].eql?(other_array[i])</tt>:
+ *     ary.eql?(other)  -> true or false
  *
- *    a0 = [:foo, 'bar', 2]
- *    a1 = [:foo, 'bar', 2]
- *    a1.eql?(a0) # => true
- *
- *  Otherwise, returns +false+.
- *
- *  This method is different from method Array#==,
- *  which compares using method <tt>Object#==</tt>.
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *  Returns +true+ if +self+ and +other+ are the same object,
+ *  or are both arrays with the same content (according to Object#eql?).
  */
 
 static VALUE
@@ -5311,56 +3941,45 @@ rb_ary_eql(VALUE ary1, VALUE ary2)
     return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
 }
 
-VALUE
-rb_ary_hash_values(long len, const VALUE *elements)
-{
-    long i;
-    st_index_t h;
-    VALUE n;
-
-    h = rb_hash_start(len);
-    h = rb_hash_uint(h, (st_index_t)rb_ary_hash_values);
-    for (i=0; i<len; i++) {
-        n = rb_hash(elements[i]);
-        h = rb_hash_uint(h, NUM2LONG(n));
-    }
-    h = rb_hash_end(h);
-    return ST2FIX(h);
-}
-
 /*
  *  call-seq:
- *    hash -> integer
- *
- *  Returns the integer hash value for +self+.
+ *     ary.hash   -> integer
  *
- *  Two arrays with the same content will have the same hash value
- *  (and will compare using eql?):
+ *  Compute a hash-code for this array.
  *
- *    ['a', 'b'].hash == ['a', 'b'].hash # => true
- *    ['a', 'b'].hash == ['a', 'c'].hash # => false
- *    ['a', 'b'].hash == ['a'].hash      # => false
+ *  Two arrays with the same content will have the same hash code (and will
+ *  compare using #eql?).
  *
+ *  See also Object#hash.
  */
 
 static VALUE
 rb_ary_hash(VALUE ary)
 {
-    return rb_ary_hash_values(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
+    long i;
+    st_index_t h;
+    VALUE n;
+
+    h = rb_hash_start(RARRAY_LEN(ary));
+    h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	n = rb_hash(RARRAY_AREF(ary, i));
+	h = rb_hash_uint(h, NUM2LONG(n));
+    }
+    h = rb_hash_end(h);
+    return ST2FIX(h);
 }
 
 /*
  *  call-seq:
- *    include?(object) -> true or false
- *
- *  Returns whether for some element +element+ in +self+,
- *  <tt>object == element</tt>:
+ *     ary.include?(object)   -> true or false
  *
- *    [0, 1, 2].include?(2)   # => true
- *    [0, 1, 2].include?(2.0) # => true
- *    [0, 1, 2].include?(2.1) # => false
+ *  Returns +true+ if the given +object+ is present in +self+ (that is, if any
+ *  element <code>==</code> +object+), otherwise returns +false+.
  *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *     a = [ "a", "b", "c" ]
+ *     a.include?("b")   #=> true
+ *     a.include?("z")   #=> false
  */
 
 VALUE
@@ -5370,10 +3989,10 @@ rb_ary_includes(VALUE ary, VALUE item)
     VALUE e;
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        e = RARRAY_AREF(ary, i);
-        if (rb_equal(e, item)) {
-            return Qtrue;
-        }
+	e = RARRAY_AREF(ary, i);
+	if (rb_equal(e, item)) {
+	    return Qtrue;
+	}
     }
     return Qfalse;
 }
@@ -5385,10 +4004,10 @@ rb_ary_includes_by_eql(VALUE ary, VALUE item)
     VALUE e;
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        e = RARRAY_AREF(ary, i);
-        if (rb_eql(item, e)) {
-            return Qtrue;
-        }
+	e = RARRAY_AREF(ary, i);
+	if (rb_eql(item, e)) {
+	    return Qtrue;
+	}
     }
     return Qfalse;
 }
@@ -5401,54 +4020,46 @@ recursive_cmp(VALUE ary1, VALUE ary2, int recur)
     if (recur) return Qundef;	/* Subtle! */
     len = RARRAY_LEN(ary1);
     if (len > RARRAY_LEN(ary2)) {
-        len = RARRAY_LEN(ary2);
+	len = RARRAY_LEN(ary2);
     }
     for (i=0; i<len; i++) {
-        VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
-        VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
-        if (v != INT2FIX(0)) {
-            return v;
-        }
+	VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
+	VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
+	if (v != INT2FIX(0)) {
+	    return v;
+	}
     }
     return Qundef;
 }
 
 /*
  *  call-seq:
- *    self <=> other_array -> -1, 0, or 1
- *
- *  Returns -1, 0, or 1 as +self+ is determined
- *  to be less than, equal to, or greater than +other_array+.
+ *     ary <=> other_ary   ->  -1, 0, +1 or nil
  *
- *  Iterates over each index +i+ in <tt>(0...self.size)</tt>:
+ *  Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
+ *  array is less than, equal to, or greater than +other_ary+.
  *
- *  - Computes <tt>result[i]</tt> as <tt>self[i] <=> other_array[i]</tt>.
- *  - Immediately returns 1 if <tt>result[i]</tt> is 1:
+ *  Each object in each array is compared (using the <=> operator).
  *
- *      [0, 1, 2] <=> [0, 0, 2] # => 1
+ *  Arrays are compared in an "element-wise" manner; the first element of +ary+
+ *  is compared with the first one of +other_ary+ using the <=> operator, then
+ *  each of the second elements, etc...
+ *  As soon as the result of any such comparison is non zero (i.e. the two
+ *  corresponding elements are not equal), that result is returned for the
+ *  whole array comparison.
  *
- *  - Immediately returns -1 if <tt>result[i]</tt> is -1:
+ *  If all the elements are equal, then the result is based on a comparison of
+ *  the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
+ *  and only if, they have the same length and the value of each element is
+ *  equal to the value of the corresponding element in the other array.
  *
- *      [0, 1, 2] <=> [0, 2, 2] # => -1
+ *  +nil+ is returned if the +other_ary+ is not an array or if the comparison
+ *  of two elements returned +nil+.
  *
- *  - Continues if <tt>result[i]</tt> is 0.
+ *     [ "a", "a", "c" ]    <=> [ "a", "b", "c" ]   #=> -1
+ *     [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ]            #=> +1
+ *     [ 1, 2 ]             <=> [ 1, :two ]         #=> nil
  *
- *  When every +result+ is 0,
- *  returns <tt>self.size <=> other_array.size</tt>
- *  (see Integer#<=>):
- *
- *    [0, 1, 2] <=> [0, 1]        # => 1
- *    [0, 1, 2] <=> [0, 1, 2]     # => 0
- *    [0, 1, 2] <=> [0, 1, 2, 3]  # => -1
- *
- *  Note that when +other_array+ is larger than +self+,
- *  its trailing elements do not affect the result:
- *
- *    [0, 1, 2] <=> [0, 1, 2, -3] # => -1
- *    [0, 1, 2] <=> [0, 1, 2, 0]  # => -1
- *    [0, 1, 2] <=> [0, 1, 2, 3]  # => -1
- *
- *  Related: see {Methods for Comparing}[rdoc-ref:Array@Methods+for+Comparing].
  */
 
 VALUE
@@ -5461,7 +4072,7 @@ rb_ary_cmp(VALUE ary1, VALUE ary2)
     if (NIL_P(ary2)) return Qnil;
     if (ary1 == ary2) return INT2FIX(0);
     v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
-    if (!UNDEF_P(v)) return v;
+    if (v != Qundef) return v;
     len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
     if (len == 0) return INT2FIX(0);
     if (len > 0) return INT2FIX(1);
@@ -5474,8 +4085,8 @@ ary_add_hash(VALUE hash, VALUE ary)
     long i;
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        VALUE elt = RARRAY_AREF(ary, i);
-        rb_hash_add_new_element(hash, elt, elt);
+	VALUE elt = RARRAY_AREF(ary, i);
+	rb_hash_add_new_element(hash, elt, elt);
     }
     return hash;
 }
@@ -5503,8 +4114,8 @@ ary_add_hash_by(VALUE hash, VALUE ary)
     long i;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-        VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
-        rb_hash_add_new_element(hash, k, v);
+	VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+	rb_hash_add_new_element(hash, k, v);
     }
     return hash;
 }
@@ -5516,25 +4127,35 @@ ary_make_hash_by(VALUE ary)
     return ary_add_hash_by(hash, ary);
 }
 
+static inline void
+ary_recycle_hash(VALUE hash)
+{
+    assert(RBASIC_CLASS(hash) == 0);
+    if (RHASH(hash)->ntbl) {
+	st_table *tbl = RHASH(hash)->ntbl;
+	st_free_table(tbl);
+    }
+    rb_gc_force_recycle(hash);
+}
+
 /*
  *  call-seq:
- *    self - other_array -> new_array
+ *     ary - other_ary    -> new_ary
+ *
+ *  Array Difference
  *
- *  Returns a new array containing only those elements of +self+
- *  that are not found in +other_array+;
- *  the order from +self+ is preserved:
+ *  Returns a new array that is a copy of the original array, removing any
+ *  items that also appear in +other_ary+. The order is preserved from the
+ *  original array.
  *
- *    [0, 1, 1, 2, 1, 1, 3, 1, 1] - [1]             # => [0, 2, 3]
- *    [0, 1, 1, 2, 1, 1, 3, 1, 1] - [3, 2, 0, :foo] # => [1, 1, 1, 1, 1, 1]
- *    [0, 1, 2] - [:foo]                            # => [0, 1, 2]
+ *  It compares elements using their #hash and #eql? methods for efficiency.
  *
- *  Element are compared using method <tt>#eql?</tt>
- *  (as defined in each element of +self+).
+ *     [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ]  #=>  [ 3, 3, 5 ]
  *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *  If you need set-like behavior, see the library class Set.
  */
 
-VALUE
+static VALUE
 rb_ary_diff(VALUE ary1, VALUE ary2)
 {
     VALUE ary3;
@@ -5542,104 +4163,39 @@ rb_ary_diff(VALUE ary1, VALUE ary2)
     long i;
 
     ary2 = to_ary(ary2);
-    if (RARRAY_LEN(ary2) == 0) { return ary_make_shared_copy(ary1); }
     ary3 = rb_ary_new();
 
     if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN || RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
-        for (i=0; i<RARRAY_LEN(ary1); i++) {
-            VALUE elt = rb_ary_elt(ary1, i);
-            if (rb_ary_includes_by_eql(ary2, elt)) continue;
-            rb_ary_push(ary3, elt);
-        }
-        return ary3;
+	for (i=0; i<RARRAY_LEN(ary1); i++) {
+	    VALUE elt = rb_ary_elt(ary1, i);
+	    if (rb_ary_includes_by_eql(ary2, elt)) continue;
+	    rb_ary_push(ary3, elt);
+	}
+	return ary3;
     }
 
     hash = ary_make_hash(ary2);
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-        if (rb_hash_stlike_lookup(hash, RARRAY_AREF(ary1, i), NULL)) continue;
-        rb_ary_push(ary3, rb_ary_elt(ary1, i));
+	if (st_lookup(rb_hash_tbl_raw(hash), RARRAY_AREF(ary1, i), 0)) continue;
+	rb_ary_push(ary3, rb_ary_elt(ary1, i));
     }
-
+    ary_recycle_hash(hash);
     return ary3;
 }
 
 /*
  *  call-seq:
- *    difference(*other_arrays = []) -> new_array
+ *     ary & other_ary      -> new_ary
  *
- *  Returns a new array containing only those elements from +self+
- *  that are not found in any of the given +other_arrays+;
- *  items are compared using <tt>eql?</tt>;  order from +self+ is preserved:
+ *  Set Intersection --- Returns a new array containing unique elements common to the
+ *  two arrays. The order is preserved from the original array.
  *
- *    [0, 1, 1, 2, 1, 1, 3, 1, 1].difference([1]) # => [0, 2, 3]
- *    [0, 1, 2, 3].difference([3, 0], [1, 3])     # => [2]
- *    [0, 1, 2].difference([4])                   # => [0, 1, 2]
- *    [0, 1, 2].difference                        # => [0, 1, 2]
+ *  It compares elements using their #hash and #eql? methods for efficiency.
  *
- *  Returns a copy of +self+ if no arguments are given.
+ *     [ 1, 1, 3, 5 ] & [ 3, 2, 1 ]                 #=> [ 1, 3 ]
+ *     [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ]   #=> [ 'a', 'b' ]
  *
- *  Related: Array#-;
- *  see also {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
- */
-
-static VALUE
-rb_ary_difference_multi(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE ary_diff;
-    long i, length;
-    volatile VALUE t0;
-    bool *is_hash = ALLOCV_N(bool, t0, argc);
-    ary_diff = rb_ary_new();
-    length = RARRAY_LEN(ary);
-
-    for (i = 0; i < argc; i++) {
-        argv[i] = to_ary(argv[i]);
-        is_hash[i] = (length > SMALL_ARRAY_LEN && RARRAY_LEN(argv[i]) > SMALL_ARRAY_LEN);
-        if (is_hash[i]) argv[i] = ary_make_hash(argv[i]);
-    }
-
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-        int j;
-        VALUE elt = rb_ary_elt(ary, i);
-        for (j = 0; j < argc; j++) {
-            if (is_hash[j]) {
-                if (rb_hash_stlike_lookup(argv[j], RARRAY_AREF(ary, i), NULL))
-                    break;
-            }
-            else {
-                if (rb_ary_includes_by_eql(argv[j], elt)) break;
-            }
-        }
-        if (j == argc) rb_ary_push(ary_diff, elt);
-    }
-
-    ALLOCV_END(t0);
-
-    return ary_diff;
-}
-
-
-/*
- *  call-seq:
- *    self & other_array -> new_array
- *
- *  Returns a new array containing the _intersection_ of +self+ and +other_array+;
- *  that is, containing those elements found in both +self+ and +other_array+:
- *
- *    [0, 1, 2, 3] & [1, 2] # => [1, 2]
- *
- *  Omits duplicates:
- *
- *    [0, 1, 1, 0] & [0, 1] # => [0, 1]
- *
- *  Preserves order from +self+:
- *
- *    [0, 1, 2] & [3, 2, 1, 0] # => [0, 1, 2]
- *
- *  Identifies common elements using method <tt>#eql?</tt>
- *  (as defined in each element of +self+).
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *  See also Array#uniq.
  */
 
 
@@ -5647,70 +4203,39 @@ static VALUE
 rb_ary_and(VALUE ary1, VALUE ary2)
 {
     VALUE hash, ary3, v;
+    st_table *table;
     st_data_t vv;
     long i;
 
     ary2 = to_ary(ary2);
     ary3 = rb_ary_new();
-    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return ary3;
+    if (RARRAY_LEN(ary2) == 0) return ary3;
 
     if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
-        for (i=0; i<RARRAY_LEN(ary1); i++) {
-            v = RARRAY_AREF(ary1, i);
-            if (!rb_ary_includes_by_eql(ary2, v)) continue;
-            if (rb_ary_includes_by_eql(ary3, v)) continue;
-            rb_ary_push(ary3, v);
-        }
-        return ary3;
+	for (i=0; i<RARRAY_LEN(ary1); i++) {
+	    v = RARRAY_AREF(ary1, i);
+	    if (!rb_ary_includes_by_eql(ary2, v)) continue;
+	    if (rb_ary_includes_by_eql(ary3, v)) continue;
+	    rb_ary_push(ary3, v);
+	}
+	return ary3;
     }
 
     hash = ary_make_hash(ary2);
+    table = rb_hash_tbl_raw(hash);
 
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-        v = RARRAY_AREF(ary1, i);
-        vv = (st_data_t)v;
-        if (rb_hash_stlike_delete(hash, &vv, 0)) {
-            rb_ary_push(ary3, v);
-        }
+	v = RARRAY_AREF(ary1, i);
+	vv = (st_data_t)v;
+	if (st_delete(table, &vv, 0)) {
+	    rb_ary_push(ary3, v);
+	}
     }
+    ary_recycle_hash(hash);
 
     return ary3;
 }
 
-/*
- *  call-seq:
- *    intersection(*other_arrays) -> new_array
- *
- *  Returns a new array containing each element in +self+ that is +#eql?+
- *  to at least one element in each of the given +other_arrays+;
- *  duplicates are omitted:
- *
- *    [0, 0, 1, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
- *
- *  Each element must correctly implement method <tt>#hash</tt>.
- *
- *  Order from +self+ is preserved:
- *
- *    [0, 1, 2].intersection([2, 1, 0]) # => [0, 1, 2]
- *
- *  Returns a copy of +self+ if no arguments are given.
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
- */
-
-static VALUE
-rb_ary_intersection_multi(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE result = rb_ary_dup(ary);
-    int i;
-
-    for (i = 0; i < argc; i++) {
-        result = rb_ary_and(result, argv[i]);
-    }
-
-    return result;
-}
-
 static int
 ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
 {
@@ -5719,553 +4244,165 @@ ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
     return ST_CONTINUE;
 }
 
-static void
-rb_ary_union(VALUE ary_union, VALUE ary)
-{
-    long i;
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-        VALUE elt = rb_ary_elt(ary, i);
-        if (rb_ary_includes_by_eql(ary_union, elt)) continue;
-        rb_ary_push(ary_union, elt);
-    }
-}
-
-static void
-rb_ary_union_hash(VALUE hash, VALUE ary2)
-{
-    long i;
-    for (i = 0; i < RARRAY_LEN(ary2); i++) {
-        VALUE elt = RARRAY_AREF(ary2, i);
-        if (!rb_hash_stlike_update(hash, (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
-            RB_OBJ_WRITTEN(hash, Qundef, elt);
-        }
-    }
-}
-
 /*
  *  call-seq:
- *    self | other_array -> new_array
+ *     ary | other_ary     -> new_ary
+ *
+ *  Set Union --- Returns a new array by joining +ary+ with +other_ary+,
+ *  excluding any duplicates and preserving the order from the given arrays.
  *
- *  Returns the union of +self+ and +other_array+;
- *  duplicates are removed; order is preserved;
- *  items are compared using <tt>eql?</tt>:
+ *  It compares elements using their #hash and #eql? methods for efficiency.
  *
- *    [0, 1] | [2, 3] # => [0, 1, 2, 3]
- *    [0, 1, 1] | [2, 2, 3] # => [0, 1, 2, 3]
- *    [0, 1, 2] | [3, 2, 1, 0] # => [0, 1, 2, 3]
+ *     [ "a", "b", "c" ] | [ "c", "d", "a" ]    #=> [ "a", "b", "c", "d" ]
+ *     [ "c", "d", "a" ] | [ "a", "b", "c" ]    #=> [ "c", "d", "a", "b" ]
  *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *  See also Array#uniq.
  */
 
 static VALUE
 rb_ary_or(VALUE ary1, VALUE ary2)
 {
-    VALUE hash;
+    VALUE hash, ary3;
+    long i;
 
     ary2 = to_ary(ary2);
     if (RARRAY_LEN(ary1) + RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
-        VALUE ary3 = rb_ary_new();
-        rb_ary_union(ary3, ary1);
-        rb_ary_union(ary3, ary2);
-        return ary3;
+	ary3 = rb_ary_new();
+	for (i=0; i<RARRAY_LEN(ary1); i++) {
+	    VALUE elt = rb_ary_elt(ary1, i);
+	    if (rb_ary_includes_by_eql(ary3, elt)) continue;
+	    rb_ary_push(ary3, elt);
+	}
+	for (i=0; i<RARRAY_LEN(ary2); i++) {
+	    VALUE elt = rb_ary_elt(ary2, i);
+	    if (rb_ary_includes_by_eql(ary3, elt)) continue;
+	    rb_ary_push(ary3, elt);
+	}
+	return ary3;
     }
 
     hash = ary_make_hash(ary1);
-    rb_ary_union_hash(hash, ary2);
-
-    return rb_hash_values(hash);
-}
-
-/*
- *  call-seq:
- *    union(*other_arrays) -> new_array
- *
- *  Returns a new array that is the union of the elements of +self+
- *  and all given arrays +other_arrays+;
- *  items are compared using <tt>eql?</tt>:
- *
- *    [0, 1, 2, 3].union([4, 5], [6, 7]) # => [0, 1, 2, 3, 4, 5, 6, 7]
- *
- *  Removes duplicates (preserving the first found):
- *
- *    [0, 1, 1].union([2, 1], [3, 1]) # => [0, 1, 2, 3]
- *
- *  Preserves order (preserving the position of the first found):
- *
- *    [3, 2, 1, 0].union([5, 3], [4, 2]) # => [3, 2, 1, 0, 5, 4]
- *
- *  With no arguments given, returns a copy of +self+.
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
- */
-
-static VALUE
-rb_ary_union_multi(int argc, VALUE *argv, VALUE ary)
-{
-    int i;
-    long sum;
-    VALUE hash;
-
-    sum = RARRAY_LEN(ary);
-    for (i = 0; i < argc; i++) {
-        argv[i] = to_ary(argv[i]);
-        sum += RARRAY_LEN(argv[i]);
-    }
-
-    if (sum <= SMALL_ARRAY_LEN) {
-        VALUE ary_union = rb_ary_new();
-
-        rb_ary_union(ary_union, ary);
-        for (i = 0; i < argc; i++) rb_ary_union(ary_union, argv[i]);
-
-        return ary_union;
-    }
-
-    hash = ary_make_hash(ary);
-    for (i = 0; i < argc; i++) rb_ary_union_hash(hash, argv[i]);
-
-    return rb_hash_values(hash);
-}
-
-/*
- *  call-seq:
- *    intersect?(other_array) -> true or false
- *
- *  Returns whether +other_array+ has at least one element that is +#eql?+ to some element of +self+:
- *
- *    [1, 2, 3].intersect?([3, 4, 5]) # => true
- *    [1, 2, 3].intersect?([4, 5, 6]) # => false
- *
- *  Each element must correctly implement method <tt>#hash</tt>.
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
- */
-
-static VALUE
-rb_ary_intersect_p(VALUE ary1, VALUE ary2)
-{
-    VALUE hash, v, result, shorter, longer;
-    st_data_t vv;
-    long i;
-
-    ary2 = to_ary(ary2);
-    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return Qfalse;
-
-    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
-        for (i=0; i<RARRAY_LEN(ary1); i++) {
-            v = RARRAY_AREF(ary1, i);
-            if (rb_ary_includes_by_eql(ary2, v)) return Qtrue;
-        }
-        return Qfalse;
-    }
-
-    shorter = ary1;
-    longer = ary2;
-    if (RARRAY_LEN(ary1) > RARRAY_LEN(ary2)) {
-        longer = ary1;
-        shorter = ary2;
-    }
-
-    hash = ary_make_hash(shorter);
-    result = Qfalse;
-
-    for (i=0; i<RARRAY_LEN(longer); i++) {
-        v = RARRAY_AREF(longer, i);
-        vv = (st_data_t)v;
-        if (rb_hash_stlike_lookup(hash, vv, 0)) {
-            result = Qtrue;
-            break;
-        }
-    }
-
-    return result;
-}
-
-static VALUE
-ary_max_generic(VALUE ary, long i, VALUE vmax)
-{
-    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
-
-    VALUE v;
-    for (; i < RARRAY_LEN(ary); ++i) {
-        v = RARRAY_AREF(ary, i);
-
-        if (rb_cmpint(rb_funcallv(vmax, id_cmp, 1, &v), vmax, v) < 0) {
-            vmax = v;
-        }
-    }
-
-    return vmax;
-}
-
-static VALUE
-ary_max_opt_fixnum(VALUE ary, long i, VALUE vmax)
-{
-    const long n = RARRAY_LEN(ary);
-    RUBY_ASSERT(i > 0 && i < n);
-    RUBY_ASSERT(FIXNUM_P(vmax));
-
-    VALUE v;
-    for (; i < n; ++i) {
-        v = RARRAY_AREF(ary, i);
-
-        if (FIXNUM_P(v)) {
-            if ((long)vmax < (long)v) {
-                vmax = v;
-            }
-        }
-        else {
-            return ary_max_generic(ary, i, vmax);
-        }
-    }
-
-    return vmax;
-}
-
-static VALUE
-ary_max_opt_float(VALUE ary, long i, VALUE vmax)
-{
-    const long n = RARRAY_LEN(ary);
-    RUBY_ASSERT(i > 0 && i < n);
-    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmax));
-
-    VALUE v;
-    for (; i < n; ++i) {
-        v = RARRAY_AREF(ary, i);
-
-        if (RB_FLOAT_TYPE_P(v)) {
-            if (rb_float_cmp(vmax, v) < 0) {
-                vmax = v;
-            }
-        }
-        else {
-            return ary_max_generic(ary, i, vmax);
-        }
-    }
-
-    return vmax;
-}
-
-static VALUE
-ary_max_opt_string(VALUE ary, long i, VALUE vmax)
-{
-    const long n = RARRAY_LEN(ary);
-    RUBY_ASSERT(i > 0 && i < n);
-    RUBY_ASSERT(STRING_P(vmax));
-
-    VALUE v;
-    for (; i < n; ++i) {
-        v = RARRAY_AREF(ary, i);
-
-        if (STRING_P(v)) {
-            if (rb_str_cmp(vmax, v) < 0) {
-                vmax = v;
-            }
-        }
-        else {
-            return ary_max_generic(ary, i, vmax);
-        }
-    }
-
-    return vmax;
+    for (i=0; i<RARRAY_LEN(ary2); i++) {
+	VALUE elt = RARRAY_AREF(ary2, i);
+	if (!st_update(RHASH_TBL_RAW(hash), (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+	    RB_OBJ_WRITTEN(hash, Qundef, elt);
+	}
+    }
+    ary3 = rb_hash_values(hash);
+    ary_recycle_hash(hash);
+    return ary3;
 }
 
 /*
  *  call-seq:
- *    max -> element
- *    max(count) -> new_array
- *    max {|a, b| ... } -> element
- *    max(count) {|a, b| ... } -> new_array
- *
- *  Returns one of the following:
- *
- *  - The maximum-valued element from +self+.
- *  - A new array of maximum-valued elements from +self+.
- *
- *  Does not modify +self+.
- *
- *  With no block given, each element in +self+ must respond to method <tt>#<=></tt>
- *  with a numeric.
- *
- *  With no argument and no block, returns the element in +self+
- *  having the maximum value per method <tt>#<=></tt>:
- *
- *    [1, 0, 3, 2].max # => 3
+ *     ary.max                     -> obj
+ *     ary.max { |a, b| block }    -> obj
+ *     ary.max(n)                  -> array
+ *     ary.max(n) { |a, b| block } -> array
  *
- *  With non-negative numeric argument +count+ and no block,
- *  returns a new array with at most +count+ elements,
- *  in descending order, per method <tt>#<=></tt>:
+ *  Returns the object in _ary_ with the maximum value. The
+ *  first form assumes all objects implement <code>Comparable</code>;
+ *  the second uses the block to return <em>a <=> b</em>.
  *
- *    [1, 0, 3, 2].max(3)   # => [3, 2, 1]
- *    [1, 0, 3, 2].max(3.0) # => [3, 2, 1]
- *    [1, 0, 3, 2].max(9)   # => [3, 2, 1, 0]
- *    [1, 0, 3, 2].max(0)   # => []
+ *     ary = %w(albatross dog horse)
+ *     ary.max                                   #=> "horse"
+ *     ary.max { |a, b| a.length <=> b.length }  #=> "albatross"
  *
- *  With a block given, the block must return a numeric.
+ *  If the +n+ argument is given, maximum +n+ elements are returned
+ *  as an array.
  *
- *  With a block and no argument, calls the block <tt>self.size - 1</tt> times to compare elements;
- *  returns the element having the maximum value per the block:
- *
- *    ['0', '', '000', '00'].max {|a, b| a.size <=> b.size }
- *    # => "000"
- *
- *  With non-negative numeric argument +count+ and a block,
- *  returns a new array with at most +count+ elements,
- *  in descending order, per the block:
- *
- *    ['0', '', '000', '00'].max(2) {|a, b| a.size <=> b.size }
- *    # => ["000", "00"]
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     ary = %w[albatross dog horse]
+ *     ary.max(2)                                  #=> ["horse", "dog"]
+ *     ary.max(2) {|a, b| a.length <=> b.length }  #=> ["albatross", "horse"]
  */
 static VALUE
 rb_ary_max(int argc, VALUE *argv, VALUE ary)
 {
+    struct cmp_opt_data cmp_opt = { 0, 0 };
     VALUE result = Qundef, v;
     VALUE num;
     long i;
 
-    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+    rb_scan_args(argc, argv, "01", &num);
+
+    if (!NIL_P(num))
        return rb_nmin_run(ary, num, 0, 1, 1);
 
-    const long n = RARRAY_LEN(ary);
     if (rb_block_given_p()) {
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-           v = RARRAY_AREF(ary, i);
-           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
-               result = v;
-           }
-        }
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	   v = RARRAY_AREF(ary, i);
+	   if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
+	       result = v;
+	   }
+	}
     }
-    else if (n > 0) {
-        result = RARRAY_AREF(ary, 0);
-        if (n > 1) {
-            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
-                return ary_max_opt_fixnum(ary, 1, result);
-            }
-            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
-                return ary_max_opt_string(ary, 1, result);
-            }
-            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
-                return ary_max_opt_float(ary, 1, result);
-            }
-            else {
-                return ary_max_generic(ary, 1, result);
-            }
-        }
-    }
-    if (UNDEF_P(result)) return Qnil;
+    else {
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	   v = RARRAY_AREF(ary, i);
+	   if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) > 0) {
+	       result = v;
+	   }
+	}
+    }
+    if (result == Qundef) return Qnil;
     return result;
 }
 
-static VALUE
-ary_min_generic(VALUE ary, long i, VALUE vmin)
-{
-    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
-
-    VALUE v;
-    for (; i < RARRAY_LEN(ary); ++i) {
-        v = RARRAY_AREF(ary, i);
-
-        if (rb_cmpint(rb_funcallv(vmin, id_cmp, 1, &v), vmin, v) > 0) {
-            vmin = v;
-        }
-    }
-
-    return vmin;
-}
-
-static VALUE
-ary_min_opt_fixnum(VALUE ary, long i, VALUE vmin)
-{
-    const long n = RARRAY_LEN(ary);
-    RUBY_ASSERT(i > 0 && i < n);
-    RUBY_ASSERT(FIXNUM_P(vmin));
-
-    VALUE a;
-    for (; i < n; ++i) {
-        a = RARRAY_AREF(ary, i);
-
-        if (FIXNUM_P(a)) {
-            if ((long)vmin > (long)a) {
-                vmin = a;
-            }
-        }
-        else {
-            return ary_min_generic(ary, i, vmin);
-        }
-    }
-
-    return vmin;
-}
-
-static VALUE
-ary_min_opt_float(VALUE ary, long i, VALUE vmin)
-{
-    const long n = RARRAY_LEN(ary);
-    RUBY_ASSERT(i > 0 && i < n);
-    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmin));
-
-    VALUE a;
-    for (; i < n; ++i) {
-        a = RARRAY_AREF(ary, i);
-
-        if (RB_FLOAT_TYPE_P(a)) {
-            if (rb_float_cmp(vmin, a) > 0) {
-                vmin = a;
-            }
-        }
-        else {
-            return ary_min_generic(ary, i, vmin);
-        }
-    }
-
-    return vmin;
-}
-
-static VALUE
-ary_min_opt_string(VALUE ary, long i, VALUE vmin)
-{
-    const long n = RARRAY_LEN(ary);
-    RUBY_ASSERT(i > 0 && i < n);
-    RUBY_ASSERT(STRING_P(vmin));
-
-    VALUE a;
-    for (; i < n; ++i) {
-        a = RARRAY_AREF(ary, i);
-
-        if (STRING_P(a)) {
-            if (rb_str_cmp(vmin, a) > 0) {
-                vmin = a;
-            }
-        }
-        else {
-            return ary_min_generic(ary, i, vmin);
-        }
-    }
-
-    return vmin;
-}
-
 /*
  *  call-seq:
- *    min -> element
- *    min(count) -> new_array
- *    min {|a, b| ... } -> element
- *    min(count) {|a, b| ... } -> new_array
- *
- *  Returns one of the following:
- *
- *  - The minimum-valued element from +self+.
- *  - A new array of minimum-valued elements from +self+.
- *
- *  Does not modify +self+.
- *
- *  With no block given, each element in +self+ must respond to method <tt>#<=></tt>
- *  with a numeric.
- *
- *  With no argument and no block, returns the element in +self+
- *  having the minimum value per method <tt>#<=></tt>:
- *
- *    [1, 0, 3, 2].min # => 0
- *
- *  With non-negative numeric argument +count+ and no block,
- *  returns a new array with at most +count+ elements,
- *  in ascending order, per method <tt>#<=></tt>:
- *
- *    [1, 0, 3, 2].min(3)   # => [0, 1, 2]
- *    [1, 0, 3, 2].min(3.0) # => [0, 1, 2]
- *    [1, 0, 3, 2].min(9)   # => [0, 1, 2, 3]
- *    [1, 0, 3, 2].min(0)   # => []
- *
- *  With a block given, the block must return a numeric.
+ *     ary.min                     -> obj
+ *     ary.min {| a,b | block }    -> obj
+ *     ary.min(n)                  -> array
+ *     ary.min(n) {| a,b | block } -> array
  *
- *  With a block and no argument, calls the block <tt>self.size - 1</tt> times to compare elements;
- *  returns the element having the minimum value per the block:
+ *  Returns the object in _ary_ with the minimum value. The
+ *  first form assumes all objects implement <code>Comparable</code>;
+ *  the second uses the block to return <em>a <=> b</em>.
  *
- *    ['0', '', '000', '00'].min {|a, b| a.size <=> b.size }
- *    # => ""
+ *     ary = %w(albatross dog horse)
+ *     ary.min                                   #=> "albatross"
+ *     ary.min { |a, b| a.length <=> b.length }  #=> "dog"
  *
- *  With non-negative numeric argument +count+ and a block,
- *  returns a new array with at most +count+ elements,
- *  in ascending order, per the block:
+ *  If the +n+ argument is given, minimum +n+ elements are returned
+ *  as an array.
  *
- *    ['0', '', '000', '00'].min(2) {|a, b| a.size <=> b.size }
- *    # => ["", "0"]
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     ary = %w[albatross dog horse]
+ *     ary.min(2)                                  #=> ["albatross", "dog"]
+ *     ary.min(2) {|a, b| a.length <=> b.length }  #=> ["dog", "horse"]
  */
 static VALUE
 rb_ary_min(int argc, VALUE *argv, VALUE ary)
 {
+    struct cmp_opt_data cmp_opt = { 0, 0 };
     VALUE result = Qundef, v;
     VALUE num;
     long i;
 
-    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+    rb_scan_args(argc, argv, "01", &num);
+
+    if (!NIL_P(num))
        return rb_nmin_run(ary, num, 0, 0, 1);
 
-    const long n = RARRAY_LEN(ary);
     if (rb_block_given_p()) {
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-           v = RARRAY_AREF(ary, i);
-           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
-               result = v;
-           }
-        }
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	   v = RARRAY_AREF(ary, i);
+	   if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
+	       result = v;
+	   }
+	}
     }
-    else if (n > 0) {
-        result = RARRAY_AREF(ary, 0);
-        if (n > 1) {
-            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
-                return ary_min_opt_fixnum(ary, 1, result);
-            }
-            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
-                return ary_min_opt_string(ary, 1, result);
-            }
-            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
-                return ary_min_opt_float(ary, 1, result);
-            }
-            else {
-                return ary_min_generic(ary, 1, result);
-            }
-        }
-    }
-    if (UNDEF_P(result)) return Qnil;
+    else {
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	   v = RARRAY_AREF(ary, i);
+	   if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) < 0) {
+	       result = v;
+	   }
+	}
+    }
+    if (result == Qundef) return Qnil;
     return result;
 }
 
-/*
- *  call-seq:
- *    minmax -> array
- *    minmax {|a, b| ... } -> array
- *
- *  Returns a 2-element array containing the minimum-valued and maximum-valued
- *  elements from +self+;
- *  does not modify +self+.
- *
- *  With no block given, the minimum and maximum values are determined using method <tt>#<=></tt>:
- *
- *    [1, 0, 3, 2].minmax # => [0, 3]
- *
- *  With a block given, the block must return a numeric;
- *  the block is called <tt>self.size - 1</tt> times to compare elements;
- *  returns the elements having the minimum and maximum values per the block:
- *
- *    ['0', '', '000', '00'].minmax {|a, b| a.size <=> b.size }
- *    # => ["", "000"]
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
- */
-static VALUE
-rb_ary_minmax(VALUE ary)
-{
-    if (rb_block_given_p()) {
-        return rb_call_super(0, NULL);
-    }
-    return rb_assoc_new(rb_ary_min(0, 0, ary), rb_ary_max(0, 0, ary));
-}
-
 static int
 push_value(st_data_t key, st_data_t val, st_data_t ary)
 {
@@ -6275,31 +4412,31 @@ push_value(st_data_t key, st_data_t val, st_data_t ary)
 
 /*
  *  call-seq:
- *    uniq! -> self or nil
- *    uniq! {|element| ... } -> self or nil
+ *     ary.uniq!                -> ary or nil
+ *     ary.uniq! { |item| ... } -> ary or nil
+ *
+ *  Removes duplicate elements from +self+.
+ *
+ *  If a block is given, it will use the return value of the block for
+ *  comparison.
+ *
+ *  It compares values using their #hash and #eql? methods for efficiency.
  *
- *  Removes duplicate elements from +self+, the first occurrence always being retained;
- *  returns +self+ if any elements removed, +nil+ otherwise.
+ *  +self+ is traversed in order, and the first occurrence is kept.
  *
- *  With no block given, identifies and removes elements using method <tt>eql?</tt>
- *  to compare elements:
+ *  Returns +nil+ if no changes are made (that is, no duplicates are found).
  *
- *    a = [0, 0, 1, 1, 2, 2]
- *    a.uniq! # => [0, 1, 2]
- *    a.uniq! # => nil
+ *     a = [ "a", "a", "b", "b", "c" ]
+ *     a.uniq!   # => ["a", "b", "c"]
  *
- *  With a block given, calls the block for each element;
- *  identifies and omits "duplicate" elements using method <tt>eql?</tt>
- *  to compare <i>block return values</i>;
- *  that is, an element is a duplicate if its block return value
- *  is the same as that of a previous element:
+ *     b = [ "a", "b", "c" ]
+ *     b.uniq!   # => nil
  *
- *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
- *    a.uniq! {|element| element.size } # => ["a", "aa", "aaa"]
- *    a.uniq! {|element| element.size } # => nil
+ *     c = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ *     c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
  *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
+
 static VALUE
 rb_ary_uniq_bang(VALUE ary)
 {
@@ -6310,50 +4447,46 @@ rb_ary_uniq_bang(VALUE ary)
     if (RARRAY_LEN(ary) <= 1)
         return Qnil;
     if (rb_block_given_p())
-        hash = ary_make_hash_by(ary);
+	hash = ary_make_hash_by(ary);
     else
-        hash = ary_make_hash(ary);
+	hash = ary_make_hash(ary);
 
     hash_size = RHASH_SIZE(hash);
     if (RARRAY_LEN(ary) == hash_size) {
-        return Qnil;
+	return Qnil;
     }
     rb_ary_modify_check(ary);
     ARY_SET_LEN(ary, 0);
-    if (ARY_SHARED_P(ary)) {
-        rb_ary_unshare(ary);
-        FL_SET_EMBED(ary);
+    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+	rb_ary_unshare(ary);
+	FL_SET_EMBED(ary);
     }
     ary_resize_capa(ary, hash_size);
-    rb_hash_foreach(hash, push_value, ary);
+    st_foreach(rb_hash_tbl_raw(hash), push_value, ary);
+    ary_recycle_hash(hash);
 
     return ary;
 }
 
 /*
  *  call-seq:
- *    uniq -> new_array
- *    uniq {|element| ... } -> new_array
+ *     ary.uniq                -> new_ary
+ *     ary.uniq { |item| ... } -> new_ary
+ *
+ *  Returns a new array by removing duplicate values in +self+.
  *
- *  Returns a new array containing those elements from +self+ that are not duplicates,
- *  the first occurrence always being retained.
+ *  If a block is given, it will use the return value of the block for comparison.
  *
- *  With no block given, identifies and omits duplicate elements using method <tt>eql?</tt>
- *  to compare elements:
+ *  It compares values using their #hash and #eql? methods for efficiency.
  *
- *    a = [0, 0, 1, 1, 2, 2]
- *    a.uniq # => [0, 1, 2]
+ *  +self+ is traversed in order, and the first occurrence is kept.
  *
- *  With a block given, calls the block for each element;
- *  identifies and omits "duplicate" elements using method <tt>eql?</tt>
- *  to compare <i>block return values</i>;
- *  that is, an element is a duplicate if its block return value
- *  is the same as that of a previous element:
+ *     a = [ "a", "a", "b", "b", "c" ]
+ *     a.uniq   # => ["a", "b", "c"]
  *
- *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
- *    a.uniq {|element| element.size } # => ["a", "aa", "aaa"]
+ *     b = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ *     b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
  *
- *  Related: {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -6361,36 +4494,32 @@ rb_ary_uniq(VALUE ary)
 {
     VALUE hash, uniq;
 
-    if (RARRAY_LEN(ary) <= 1) {
-        hash = 0;
-        uniq = rb_ary_dup(ary);
-    }
-    else if (rb_block_given_p()) {
-        hash = ary_make_hash_by(ary);
-        uniq = rb_hash_values(hash);
+    if (RARRAY_LEN(ary) <= 1)
+        return rb_ary_dup(ary);
+    if (rb_block_given_p()) {
+	hash = ary_make_hash_by(ary);
+	uniq = rb_hash_values(hash);
     }
     else {
-        hash = ary_make_hash(ary);
-        uniq = rb_hash_values(hash);
+	hash = ary_make_hash(ary);
+	uniq = rb_hash_values(hash);
     }
+    RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
+    ary_recycle_hash(hash);
 
     return uniq;
 }
 
 /*
  *  call-seq:
- *    compact! -> self or nil
+ *     ary.compact!    -> ary  or  nil
  *
- *  Removes all +nil+ elements from +self+;
- *  Returns +self+ if any elements are removed, +nil+ otherwise:
+ *  Removes +nil+ elements from the array.
  *
- *    a = [nil, 0, nil, false, nil, '', nil, [], nil, {}]
- *    a.compact! # => [0, false, "", [], {}]
- *    a          # => [0, false, "", [], {}]
- *    a.compact! # => nil
+ *  Returns +nil+ if no changes were made, otherwise returns the array.
  *
- *  Related: Array#compact;
- *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
+ *     [ "a", "b", "c" ].compact!           #=> nil
  */
 
 static VALUE
@@ -6404,12 +4533,12 @@ rb_ary_compact_bang(VALUE ary)
     end = p + RARRAY_LEN(ary);
 
     while (t < end) {
-        if (NIL_P(*t)) t++;
-        else *p++ = *t++;
+	if (NIL_P(*t)) t++;
+	else *p++ = *t++;
     }
     n = p - RARRAY_CONST_PTR(ary);
     if (RARRAY_LEN(ary) == n) {
-        return Qnil;
+	return Qnil;
     }
     ary_resize_smaller(ary, n);
 
@@ -6418,16 +4547,12 @@ rb_ary_compact_bang(VALUE ary)
 
 /*
  *  call-seq:
- *    compact -> new_array
+ *     ary.compact     -> new_ary
  *
- *  Returns a new array containing only the non-+nil+ elements from +self+;
- *  element order is preserved:
+ *  Returns a copy of +self+ with all +nil+ elements removed.
  *
- *    a = [nil, 0, nil, false, nil, '', nil, [], nil, {}]
- *    a.compact # => [0, false, "", [], {}]
- *
- *  Related: Array#compact!;
- *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     [ "a", nil, "b", nil, "c", nil ].compact
+ *                       #=> [ "a", "b", "c" ]
  */
 
 static VALUE
@@ -6440,29 +4565,23 @@ rb_ary_compact(VALUE ary)
 
 /*
  *  call-seq:
- *    count -> integer
- *    count(object) -> integer
- *    count {|element| ... } -> integer
- *
- *  Returns a count of specified elements.
- *
- *  With no argument and no block, returns the count of all elements:
- *
- *    [0, :one, 'two', 3, 3.0].count # => 5
+ *     ary.count                   -> int
+ *     ary.count(obj)              -> int
+ *     ary.count { |item| block }  -> int
  *
- *  With argument +object+ given, returns the count of elements <tt>==</tt> to +object+:
+ *  Returns the number of elements.
  *
- *    [0, :one, 'two', 3, 3.0].count(3) # => 2
+ *  If an argument is given, counts the number of elements which equal +obj+
+ *  using <code>==</code>.
  *
- *  With no argument and a block given, calls the block with each element;
- *  returns the count of elements for which the block returns a truthy value:
+ *  If a block is given, counts the number of elements for which the block
+ *  returns a true value.
  *
- *    [0, 1, 2, 3].count {|element| element > 1 } # => 2
+ *     ary = [1, 2, 4, 2]
+ *     ary.count                  #=> 4
+ *     ary.count(2)               #=> 2
+ *     ary.count { |x| x%2 == 0 } #=> 3
  *
- *  With argument +object+ and a block given, issues a warning, ignores the block,
- *  and returns the count of elements <tt>==</tt> to +object+.
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
@@ -6470,149 +4589,108 @@ rb_ary_count(int argc, VALUE *argv, VALUE ary)
 {
     long i, n = 0;
 
-    if (rb_check_arity(argc, 0, 1) == 0) {
-        VALUE v;
+    if (argc == 0) {
+	VALUE v;
 
-        if (!rb_block_given_p())
-            return LONG2NUM(RARRAY_LEN(ary));
+	if (!rb_block_given_p())
+	    return LONG2NUM(RARRAY_LEN(ary));
 
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-            v = RARRAY_AREF(ary, i);
-            if (RTEST(rb_yield(v))) n++;
-        }
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    v = RARRAY_AREF(ary, i);
+	    if (RTEST(rb_yield(v))) n++;
+	}
     }
     else {
-        VALUE obj = argv[0];
+	VALUE obj;
 
-        if (rb_block_given_p()) {
-            rb_warn("given block not used");
-        }
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-            if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
-        }
+	rb_scan_args(argc, argv, "1", &obj);
+	if (rb_block_given_p()) {
+	    rb_warn("given block not used");
+	}
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
+	}
     }
 
     return LONG2NUM(n);
 }
 
 static VALUE
-flatten(VALUE ary, int level)
+flatten(VALUE ary, int level, int *modified)
 {
-    long i;
-    VALUE stack, result, tmp = 0, elt;
-    VALUE memo = Qfalse;
-
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-        elt = RARRAY_AREF(ary, i);
-        tmp = rb_check_array_type(elt);
-        if (!NIL_P(tmp)) {
-            break;
-        }
-    }
-    if (i == RARRAY_LEN(ary)) {
-        return ary;
-    }
-
-    result = ary_new(0, RARRAY_LEN(ary));
-    ary_memcpy(result, 0, i, RARRAY_CONST_PTR(ary));
-    ARY_SET_LEN(result, i);
+    long i = 0;
+    VALUE stack, result, tmp, elt;
+    st_table *memo;
+    st_data_t id;
 
     stack = ary_new(0, ARY_DEFAULT_SIZE);
-    rb_ary_push(stack, ary);
-    rb_ary_push(stack, LONG2NUM(i + 1));
-
-    if (level < 0) {
-        memo = rb_obj_hide(rb_ident_hash_new());
-        rb_hash_aset(memo, ary, Qtrue);
-        rb_hash_aset(memo, tmp, Qtrue);
-    }
-
-    ary = tmp;
-    i = 0;
+    result = ary_new(0, RARRAY_LEN(ary));
+    memo = st_init_numtable();
+    st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
+    *modified = 0;
 
     while (1) {
-        while (i < RARRAY_LEN(ary)) {
-            elt = RARRAY_AREF(ary, i++);
-            if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
-                rb_ary_push(result, elt);
-                continue;
-            }
-            tmp = rb_check_array_type(elt);
-            if (RBASIC(result)->klass) {
-                if (RTEST(memo)) {
-                    rb_hash_clear(memo);
-                }
-                rb_raise(rb_eRuntimeError, "flatten reentered");
-            }
-            if (NIL_P(tmp)) {
-                rb_ary_push(result, elt);
-            }
-            else {
-                if (memo) {
-                    if (rb_hash_aref(memo, tmp) == Qtrue) {
-                        rb_hash_clear(memo);
-                        rb_raise(rb_eArgError, "tried to flatten recursive array");
-                    }
-                    rb_hash_aset(memo, tmp, Qtrue);
-                }
-                rb_ary_push(stack, ary);
-                rb_ary_push(stack, LONG2NUM(i));
-                ary = tmp;
-                i = 0;
-            }
-        }
-        if (RARRAY_LEN(stack) == 0) {
-            break;
-        }
-        if (memo) {
-            rb_hash_delete(memo, ary);
-        }
-        tmp = rb_ary_pop(stack);
-        i = NUM2LONG(tmp);
-        ary = rb_ary_pop(stack);
-    }
-
-    if (memo) {
-        rb_hash_clear(memo);
-    }
-
-    RBASIC_SET_CLASS(result, rb_cArray);
+	while (i < RARRAY_LEN(ary)) {
+	    elt = RARRAY_AREF(ary, i++);
+	    if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
+		rb_ary_push(result, elt);
+		continue;
+	    }
+	    tmp = rb_check_array_type(elt);
+	    if (RBASIC(result)->klass) {
+		rb_raise(rb_eRuntimeError, "flatten reentered");
+	    }
+	    if (NIL_P(tmp)) {
+		rb_ary_push(result, elt);
+	    }
+	    else {
+		*modified = 1;
+		id = (st_data_t)tmp;
+		if (st_lookup(memo, id, 0)) {
+		    st_free_table(memo);
+		    rb_raise(rb_eArgError, "tried to flatten recursive array");
+		}
+		st_insert(memo, id, (st_data_t)Qtrue);
+		rb_ary_push(stack, ary);
+		rb_ary_push(stack, LONG2NUM(i));
+		ary = tmp;
+		i = 0;
+	    }
+	}
+	if (RARRAY_LEN(stack) == 0) {
+	    break;
+	}
+	id = (st_data_t)ary;
+	st_delete(memo, &id, 0);
+	tmp = rb_ary_pop(stack);
+	i = NUM2LONG(tmp);
+	ary = rb_ary_pop(stack);
+    }
+
+    st_free_table(memo);
+
+    RBASIC_SET_CLASS(result, rb_obj_class(ary));
     return result;
 }
 
 /*
  *  call-seq:
- *    flatten!(depth = nil) -> self or nil
- *
- *  Returns +self+ as a recursively flattening of +self+ to +depth+ levels of recursion;
- *  +depth+ must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects],
- *  or +nil+.
- *  At each level of recursion:
+ *     ary.flatten!        -> ary or nil
+ *     ary.flatten!(level) -> ary or nil
  *
- *  - Each element that is an array is "flattened"
- *    (that is, replaced by its individual array elements).
- *  - Each element that is not an array is unchanged
- *    (even if the element is an object that has instance method +flatten+).
+ *  Flattens +self+ in place.
  *
- *  Returns +nil+ if no elements were flattened.
+ *  Returns +nil+ if no modifications were made (i.e., the array contains no
+ *  subarrays.)
  *
- *  With non-negative integer argument +depth+, flattens recursively through +depth+ levels:
+ *  The optional +level+ argument determines the level of recursion to flatten.
  *
- *    a = [ 0, [ 1, [2, 3], 4 ], 5, {foo: 0}, Set.new([6, 7]) ]
- *    a                   # => [0, [1, [2, 3], 4], 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.dup.flatten!(1)   # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.dup.flatten!(1.1) # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.dup.flatten!(2)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.dup.flatten!(3)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *
- *  With +nil+ or negative argument +depth+, flattens all levels:
- *
- *    a.dup.flatten!     # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.dup.flatten!(-1) # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *
- *  Related: Array#flatten;
- *  see also {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten!   #=> [1, 2, 3, 4, 5]
+ *     a.flatten!   #=> nil
+ *     a            #=> [1, 2, 3, 4, 5]
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten!(1) #=> [1, 2, 3, [4, 5]]
  */
 
 static VALUE
@@ -6621,16 +4699,17 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
     int mod = 0, level = -1;
     VALUE result, lv;
 
-    lv = (rb_check_arity(argc, 0, 1) ? argv[0] : Qnil);
+    rb_scan_args(argc, argv, "01", &lv);
     rb_ary_modify_check(ary);
     if (!NIL_P(lv)) level = NUM2INT(lv);
     if (level == 0) return Qnil;
 
-    result = flatten(ary, level);
-    if (result == ary) {
-        return Qnil;
+    result = flatten(ary, level, &mod);
+    if (mod == 0) {
+	ary_discard(result);
+	return Qnil;
     }
-    if (!(mod = ARY_EMBED_P(result))) rb_ary_freeze(result);
+    if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
     rb_ary_replace(ary, result);
     if (mod) ARY_SET_EMBED_LEN(result, 0);
 
@@ -6639,221 +4718,284 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
 
 /*
  *  call-seq:
- *    flatten(depth = nil) -> new_array
- *
- *  Returns a new array that is a recursive flattening of +self+
- *  to +depth+ levels of recursion;
- *  +depth+ must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
- *  or +nil+.
- *  At each level of recursion:
- *
- *  - Each element that is an array is "flattened"
- *    (that is, replaced by its individual array elements).
- *  - Each element that is not an array is unchanged
- *    (even if the element is an object that has instance method +flatten+).
- *
- *  With non-negative integer argument +depth+, flattens recursively through +depth+ levels:
+ *     ary.flatten -> new_ary
+ *     ary.flatten(level) -> new_ary
  *
- *    a = [ 0, [ 1, [2, 3], 4 ], 5, {foo: 0}, Set.new([6, 7]) ]
- *    a              # => [0, [1, [2, 3], 4], 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.flatten(0)   # => [0, [1, [2, 3], 4], 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.flatten(1  ) # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.flatten(1.1) # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.flatten(2)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.flatten(3)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *  Returns a new array that is a one-dimensional flattening of +self+
+ *  (recursively).
  *
- *  With +nil+ or negative +depth+, flattens all levels.
+ *  That is, for every element that is an array, extract its elements into
+ *  the new array.
  *
- *    a.flatten     # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.flatten(-1) # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *  The optional +level+ argument determines the level of recursion to
+ *  flatten.
  *
- *  Related: Array#flatten!;
- *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     s = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     t = [ 4, 5, 6, [7, 8] ]   #=> [4, 5, 6, [7, 8]]
+ *     a = [ s, t, 9, 10 ]       #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
+ *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten(1)              #=> [1, 2, 3, [4, 5]]
  */
 
 static VALUE
 rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
 {
-    int level = -1;
-    VALUE result;
+    int mod = 0, level = -1;
+    VALUE result, lv;
 
-    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0])) {
-        level = NUM2INT(argv[0]);
-        if (level == 0) return ary_make_shared_copy(ary);
-    }
+    rb_scan_args(argc, argv, "01", &lv);
+    if (!NIL_P(lv)) level = NUM2INT(lv);
+    if (level == 0) return ary_make_shared_copy(ary);
 
-    result = flatten(ary, level);
-    if (result == ary) {
-        result = ary_make_shared_copy(ary);
-    }
+    result = flatten(ary, level, &mod);
+    OBJ_INFECT(result, ary);
 
     return result;
 }
 
+#define OPTHASH_GIVEN_P(opts) \
+    (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
+static ID id_random;
+
 #define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
 
+/*
+ *  call-seq:
+ *     ary.shuffle!              -> ary
+ *     ary.shuffle!(random: rng) -> ary
+ *
+ *  Shuffles elements in +self+ in place.
+ *
+ *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     a.shuffle!                #=> [2, 3, 1]
+ *     a                         #=> [2, 3, 1]
+ *
+ *  The optional +rng+ argument will be used as the random number generator.
+ *
+ *     a.shuffle!(random: Random.new(1))  #=> [1, 3, 2]
+ */
+
 static VALUE
-rb_ary_shuffle_bang(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
+rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
 {
+    VALUE opts, randgen = rb_cRandom;
     long i, len;
 
+    if (OPTHASH_GIVEN_P(opts)) {
+	VALUE rnd;
+	ID keyword_ids[1];
+
+	keyword_ids[0] = id_random;
+	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
+	if (rnd != Qundef) {
+	    randgen = rnd;
+	}
+    }
+    rb_check_arity(argc, 0, 0);
     rb_ary_modify(ary);
     i = len = RARRAY_LEN(ary);
     RARRAY_PTR_USE(ary, ptr, {
-        while (i) {
-            long j = RAND_UPTO(i);
-            VALUE tmp;
-            if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
-                rb_raise(rb_eRuntimeError, "modified during shuffle");
-            }
-            tmp = ptr[--i];
-            ptr[i] = ptr[j];
-            ptr[j] = tmp;
-        }
+	while (i) {
+	    long j = RAND_UPTO(i);
+	    VALUE tmp;
+	    if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
+		rb_raise(rb_eRuntimeError, "modified during shuffle");
+	    }
+	    tmp = ptr[--i];
+	    ptr[i] = ptr[j];
+	    ptr[j] = tmp;
+	}
     }); /* WB: no new reference */
     return ary;
 }
 
+
+/*
+ *  call-seq:
+ *     ary.shuffle              -> new_ary
+ *     ary.shuffle(random: rng) -> new_ary
+ *
+ *  Returns a new array with elements of +self+ shuffled.
+ *
+ *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     a.shuffle                 #=> [2, 3, 1]
+ *     a                         #=> [1, 2, 3]
+ *
+ *  The optional +rng+ argument will be used as the random number generator.
+ *
+ *     a.shuffle(random: Random.new(1))  #=> [1, 3, 2]
+ */
+
 static VALUE
-rb_ary_shuffle(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
+rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
 {
     ary = rb_ary_dup(ary);
-    rb_ary_shuffle_bang(ec, ary, randgen);
+    rb_ary_shuffle_bang(argc, argv, ary);
     return ary;
 }
 
-static const rb_data_type_t ary_sample_memo_type = {
-    .wrap_struct_name = "ary_sample_memo",
-    .function = {
-        .dfree = (RUBY_DATA_FUNC)st_free_table,
-    },
-    .flags = RUBY_TYPED_WB_PROTECTED | RUBY_TYPED_FREE_IMMEDIATELY
-};
+
+/*
+ *  call-seq:
+ *     ary.sample                  -> obj
+ *     ary.sample(random: rng)     -> obj
+ *     ary.sample(n)               -> new_ary
+ *     ary.sample(n, random: rng)  -> new_ary
+ *
+ *  Choose a random element or +n+ random elements from the array.
+ *
+ *  The elements are chosen by using random and unique indices into the array
+ *  in order to ensure that an element doesn't repeat itself unless the array
+ *  already contained duplicate elements.
+ *
+ *  If the array is empty the first form returns +nil+ and the second form
+ *  returns an empty array.
+ *
+ *  The optional +rng+ argument will be used as the random number generator.
+ *
+ *     a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
+ *     a.sample         #=> 7
+ *     a.sample(4)      #=> [6, 4, 2, 5]
+ */
+
 
 static VALUE
-ary_sample(rb_execution_context_t *ec, VALUE ary, VALUE randgen, VALUE nv, VALUE to_array)
+rb_ary_sample(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE result;
+    VALUE nv, result;
+    VALUE opts, randgen = rb_cRandom;
     long n, len, i, j, k, idx[10];
     long rnds[numberof(idx)];
     long memo_threshold;
 
+    if (OPTHASH_GIVEN_P(opts)) {
+	VALUE rnd;
+	ID keyword_ids[1];
+
+	keyword_ids[0] = id_random;
+	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
+	if (rnd != Qundef) {
+	    randgen = rnd;
+	}
+    }
     len = RARRAY_LEN(ary);
-    if (!to_array) {
-        if (len < 2)
-            i = 0;
-        else
-            i = RAND_UPTO(len);
+    if (argc == 0) {
+	if (len < 2)
+	    i = 0;
+	else
+	    i = RAND_UPTO(len);
 
-        return rb_ary_elt(ary, i);
+	return rb_ary_elt(ary, i);
     }
+    rb_scan_args(argc, argv, "1", &nv);
     n = NUM2LONG(nv);
     if (n < 0) rb_raise(rb_eArgError, "negative sample number");
     if (n > len) n = len;
     if (n <= numberof(idx)) {
-        for (i = 0; i < n; ++i) {
-            rnds[i] = RAND_UPTO(len - i);
-        }
+	for (i = 0; i < n; ++i) {
+	    rnds[i] = RAND_UPTO(len - i);
+	}
     }
     k = len;
     len = RARRAY_LEN(ary);
     if (len < k && n <= numberof(idx)) {
-        for (i = 0; i < n; ++i) {
-            if (rnds[i] >= len) return rb_ary_new_capa(0);
-        }
+	for (i = 0; i < n; ++i) {
+	    if (rnds[i] >= len) return rb_ary_new_capa(0);
+	}
     }
     if (n > len) n = len;
     switch (n) {
       case 0:
-        return rb_ary_new_capa(0);
+	return rb_ary_new_capa(0);
       case 1:
-        i = rnds[0];
-        return rb_ary_new_from_args(1, RARRAY_AREF(ary, i));
+	i = rnds[0];
+	return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
       case 2:
-        i = rnds[0];
-        j = rnds[1];
-        if (j >= i) j++;
-        return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
+	i = rnds[0];
+	j = rnds[1];
+	if (j >= i) j++;
+	return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
       case 3:
-        i = rnds[0];
-        j = rnds[1];
-        k = rnds[2];
-        {
-            long l = j, g = i;
-            if (j >= i) l = i, g = ++j;
-            if (k >= l && (++k >= g)) ++k;
-        }
-        return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
+	i = rnds[0];
+	j = rnds[1];
+	k = rnds[2];
+	{
+	    long l = j, g = i;
+	    if (j >= i) l = i, g = ++j;
+	    if (k >= l && (++k >= g)) ++k;
+	}
+	return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
     }
     memo_threshold =
-        len < 2560 ? len / 128 :
-        len < 5120 ? len / 64 :
-        len < 10240 ? len / 32 :
-        len / 16;
+	len < 2560 ? len / 128 :
+	len < 5120 ? len / 64 :
+	len < 10240 ? len / 32 :
+	len / 16;
     if (n <= numberof(idx)) {
-        long sorted[numberof(idx)];
-        sorted[0] = idx[0] = rnds[0];
-        for (i=1; i<n; i++) {
-            k = rnds[i];
-            for (j = 0; j < i; ++j) {
-                if (k < sorted[j]) break;
-                ++k;
-            }
-            memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
-            sorted[j] = idx[i] = k;
-        }
-        result = rb_ary_new_capa(n);
-        RARRAY_PTR_USE(result, ptr_result, {
-            for (i=0; i<n; i++) {
-                ptr_result[i] = RARRAY_AREF(ary, idx[i]);
-            }
-        });
+	long sorted[numberof(idx)];
+	sorted[0] = idx[0] = rnds[0];
+	for (i=1; i<n; i++) {
+	    k = rnds[i];
+	    for (j = 0; j < i; ++j) {
+		if (k < sorted[j]) break;
+		++k;
+	    }
+	    memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+	    sorted[j] = idx[i] = k;
+	}
+	result = rb_ary_new_capa(n);
+	RARRAY_PTR_USE(result, ptr_result, {
+	    for (i=0; i<n; i++) {
+		ptr_result[i] = RARRAY_AREF(ary, idx[i]);
+	    }
+	});
     }
     else if (n <= memo_threshold / 2) {
-        long max_idx = 0;
-        VALUE vmemo = TypedData_Wrap_Struct(0, &ary_sample_memo_type, 0);
-        st_table *memo = st_init_numtable_with_size(n);
-        RTYPEDDATA_DATA(vmemo) = memo;
-        result = rb_ary_new_capa(n);
-        RARRAY_PTR_USE(result, ptr_result, {
-            for (i=0; i<n; i++) {
-                long r = RAND_UPTO(len-i) + i;
-                ptr_result[i] = r;
-                if (r > max_idx) max_idx = r;
-            }
-            len = RARRAY_LEN(ary);
-            if (len <= max_idx) n = 0;
-            else if (n > len) n = len;
-            RARRAY_PTR_USE(ary, ptr_ary, {
-                for (i=0; i<n; i++) {
-                    long j2 = j = ptr_result[i];
-                    long i2 = i;
-                    st_data_t value;
-                    if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
-                    if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
-                    st_insert(memo, (st_data_t)j, (st_data_t)i2);
-                    ptr_result[i] = ptr_ary[j2];
-                }
-            });
-        });
-        RTYPEDDATA_DATA(vmemo) = 0;
-        st_free_table(memo);
-        RB_GC_GUARD(vmemo);
+	long max_idx = 0;
+#undef RUBY_UNTYPED_DATA_WARNING
+#define RUBY_UNTYPED_DATA_WARNING 0
+	VALUE vmemo = Data_Wrap_Struct(0, 0, st_free_table, 0);
+	st_table *memo = st_init_numtable_with_size(n);
+	DATA_PTR(vmemo) = memo;
+	result = rb_ary_new_capa(n);
+	RARRAY_PTR_USE(result, ptr_result, {
+	    for (i=0; i<n; i++) {
+		long r = RAND_UPTO(len-i) + i;
+		ptr_result[i] = r;
+		if (r > max_idx) max_idx = r;
+	    }
+	    len = RARRAY_LEN(ary);
+	    if (len <= max_idx) n = 0;
+	    else if (n > len) n = len;
+	    RARRAY_PTR_USE(ary, ptr_ary, {
+		for (i=0; i<n; i++) {
+		    long j2 = j = ptr_result[i];
+		    long i2 = i;
+		    st_data_t value;
+		    if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
+		    if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
+		    st_insert(memo, (st_data_t)j, (st_data_t)i2);
+		    ptr_result[i] = ptr_ary[j2];
+		}
+	    });
+	});
+	DATA_PTR(vmemo) = 0;
+	st_free_table(memo);
     }
     else {
-        result = rb_ary_dup(ary);
-        RBASIC_CLEAR_CLASS(result);
-        RB_GC_GUARD(ary);
-        RARRAY_PTR_USE(result, ptr_result, {
-            for (i=0; i<n; i++) {
-                j = RAND_UPTO(len-i) + i;
-                nv = ptr_result[j];
-                ptr_result[j] = ptr_result[i];
-                ptr_result[i] = nv;
-            }
-        });
-        RBASIC_SET_CLASS_RAW(result, rb_cArray);
+	result = rb_ary_dup(ary);
+	RBASIC_CLEAR_CLASS(result);
+	RB_GC_GUARD(ary);
+	RARRAY_PTR_USE(result, ptr_result, {
+	    for (i=0; i<n; i++) {
+		j = RAND_UPTO(len-i) + i;
+		nv = ptr_result[j];
+		ptr_result[j] = ptr_result[i];
+		ptr_result[i] = nv;
+	    }
+	});
+	RBASIC_SET_CLASS_RAW(result, rb_cArray);
     }
     ARY_SET_LEN(result, n);
 
@@ -6861,27 +5003,15 @@ ary_sample(rb_execution_context_t *ec, VALUE ary, VALUE randgen, VALUE nv, VALUE
 }
 
 static VALUE
-ary_sized_alloc(rb_execution_context_t *ec, VALUE self)
-{
-    return rb_ary_new2(RARRAY_LEN(self));
-}
-
-static VALUE
-ary_sample0(rb_execution_context_t *ec, VALUE ary)
-{
-    return ary_sample(ec, ary, rb_cRandom, Qfalse, Qfalse);
-}
-
-static VALUE
 rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
 {
     long mul;
     VALUE n = Qnil;
     if (args && (RARRAY_LEN(args) > 0)) {
-        n = RARRAY_AREF(args, 0);
+	n = RARRAY_AREF(args, 0);
     }
     if (RARRAY_LEN(self) == 0) return INT2FIX(0);
-    if (NIL_P(n)) return DBL2NUM(HUGE_VAL);
+    if (n == Qnil) return DBL2NUM(INFINITY);
     mul = NUM2LONG(n);
     if (mul <= 0) return INT2FIX(0);
     n = LONG2FIX(mul);
@@ -6890,50 +5020,38 @@ rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
 
 /*
  *  call-seq:
- *    cycle(count = nil) {|element| ... } -> nil
- *    cycle(count = nil) -> new_enumerator
- *
- *  With a block given, may call the block, depending on the value of argument +count+;
- *  +count+ must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects],
- *  or +nil+.
- *
- *  When +count+ is positive,
- *  calls the block with each element, then does so repeatedly,
- *  until it has done so +count+ times; returns +nil+:
+ *     ary.cycle(n=nil) { |obj| block }  -> nil
+ *     ary.cycle(n=nil)                  -> Enumerator
  *
- *    output = []
- *    [0, 1].cycle(2) {|element| output.push(element) } # => nil
- *    output # => [0, 1, 0, 1]
+ *  Calls the given block for each element +n+ times or forever if +nil+ is
+ *  given.
  *
- *  When +count+ is zero or negative, does not call the block:
+ *  Does nothing if a non-positive number is given or the array is empty.
  *
- *    [0, 1].cycle(0) {|element| fail 'Cannot happen' }  # => nil
- *    [0, 1].cycle(-1) {|element| fail 'Cannot happen' } # => nil
+ *  Returns +nil+ if the loop has finished without getting interrupted.
  *
- *  When +count+ is +nil+, cycles forever:
+ *  If no block is given, an Enumerator is returned instead.
  *
- *    # Prints 0 and 1 forever.
- *    [0, 1].cycle {|element| puts element }
- *    [0, 1].cycle(nil) {|element| puts element }
+ *     a = ["a", "b", "c"]
+ *     a.cycle { |x| puts x }     # print, a, b, c, a, b, c,.. forever.
+ *     a.cycle(2) { |x| puts x }  # print, a, b, c, a, b, c.
  *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
+
 static VALUE
 rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
 {
     long n, i;
+    VALUE nv = Qnil;
 
-    rb_check_arity(argc, 0, 1);
+    rb_scan_args(argc, argv, "01", &nv);
 
     RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
-    if (argc == 0 || NIL_P(argv[0])) {
+    if (NIL_P(nv)) {
         n = -1;
     }
     else {
-        n = NUM2LONG(argv[0]);
+        n = NUM2LONG(nv);
         if (n <= 0) return Qnil;
     }
 
@@ -6945,6 +5063,11 @@ rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
     return Qnil;
 }
 
+#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
+#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC_SET_CLASS_RAW(s, rb_cString))
+#define tmpary(n) rb_ary_tmp_new(n)
+#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
+
 /*
  * Build a ruby array of the corresponding values and yield it to the
  * associated block.
@@ -6954,9 +5077,11 @@ static int
 yield_indexed_values(const VALUE values, const long r, const long *const p)
 {
     const VALUE result = rb_ary_new2(r);
+    VALUE *const result_array = RARRAY_PTR(result);
+    const VALUE *const values_array = RARRAY_CONST_PTR(values);
     long i;
 
-    for (i = 0; i < r; i++) ARY_SET(result, i, RARRAY_AREF(values, p[i]));
+    for (i = 0; i < r; i++) result_array[i] = values_array[p[i]];
     ARY_SET_LEN(result, r);
     rb_yield(result);
     return !RBASIC(values)->klass;
@@ -6980,52 +5105,52 @@ permute0(const long n, const long r, long *const p, char *const used, const VALU
     long i = 0, index = 0;
 
     for (;;) {
-        const char *const unused = memchr(&used[i], 0, n-i);
-        if (!unused) {
-            if (!index) break;
-            i = p[--index];                /* pop index */
-            used[i++] = 0;                 /* index unused */
-        }
-        else {
-            i = unused - used;
-            p[index] = i;
-            used[i] = 1;                   /* mark index used */
-            ++index;
-            if (index < r-1) {             /* if not done yet */
-                p[index] = i = 0;
-                continue;
-            }
-            for (i = 0; i < n; ++i) {
-                if (used[i]) continue;
-                p[index] = i;
-                if (!yield_indexed_values(values, r, p)) {
-                    rb_raise(rb_eRuntimeError, "permute reentered");
-                }
-            }
-            i = p[--index];                /* pop index */
-            used[i] = 0;                   /* index unused */
-            p[index] = ++i;
-        }
+	const char *const unused = memchr(&used[i], 0, n-i);
+	if (!unused) {
+	    if (!index) break;
+	    i = p[--index];                /* pop index */
+	    used[i++] = 0;                 /* index unused */
+	}
+	else {
+	    i = unused - used;
+	    p[index] = i;
+	    used[i] = 1;                   /* mark index used */
+	    ++index;
+	    if (index < r-1) {             /* if not done yet */
+		p[index] = i = 0;
+		continue;
+	    }
+	    for (i = 0; i < n; ++i) {
+		if (used[i]) continue;
+		p[index] = i;
+		if (!yield_indexed_values(values, r, p)) {
+		    rb_raise(rb_eRuntimeError, "permute reentered");
+		}
+	    }
+	    i = p[--index];                /* pop index */
+	    used[i] = 0;                   /* index unused */
+	    p[index] = ++i;
+	}
     }
 }
 
 /*
  * Returns the product of from, from-1, ..., from - how_many + 1.
- * https://en.wikipedia.org/wiki/Pochhammer_symbol
+ * http://en.wikipedia.org/wiki/Pochhammer_symbol
  */
 static VALUE
 descending_factorial(long from, long how_many)
 {
     VALUE cnt;
     if (how_many > 0) {
-        cnt = LONG2FIX(from);
-        while (--how_many > 0) {
-            long v = --from;
-            cnt = rb_int_mul(cnt, LONG2FIX(v));
-        }
+	cnt = LONG2FIX(from);
+	while (--how_many > 0) {
+	    long v = --from;
+	    cnt = rb_int_mul(cnt, LONG2FIX(v));
+	}
     }
     else {
-        cnt = LONG2FIX(how_many == 0);
+	cnt = LONG2FIX(how_many == 0);
     }
     return cnt;
 }
@@ -7036,18 +5161,18 @@ binomial_coefficient(long comb, long size)
     VALUE r;
     long i;
     if (comb > size-comb) {
-        comb = size-comb;
+	comb = size-comb;
     }
     if (comb < 0) {
-        return LONG2FIX(0);
+	return LONG2FIX(0);
     }
     else if (comb == 0) {
-        return LONG2FIX(1);
+	return LONG2FIX(1);
     }
     r = LONG2FIX(size);
     for (i = 1; i < comb; ++i) {
-        r = rb_int_mul(r, LONG2FIX(size - i));
-        r = rb_int_idiv(r, LONG2FIX(i + 1));
+	r = rb_int_mul(r, LONG2FIX(size - i));
+	r = rb_int_idiv(r, LONG2FIX(i + 1));
     }
     return r;
 }
@@ -7063,80 +5188,66 @@ rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
 
 /*
  *  call-seq:
- *    permutation(count = self.size) {|permutation| ... } -> self
- *    permutation(count = self.size) -> new_enumerator
- *
- *  Iterates over permutations of the elements of +self+;
- *  the order of permutations is indeterminate.
+ *     ary.permutation { |p| block }          -> ary
+ *     ary.permutation                        -> Enumerator
+ *     ary.permutation(n) { |p| block }       -> ary
+ *     ary.permutation(n)                     -> Enumerator
  *
- *  With a block and an in-range positive integer argument +count+ (<tt>0 < count <= self.size</tt>) given,
- *  calls the block with each permutation of +self+ of size +count+;
- *  returns +self+:
+ * When invoked with a block, yield all permutations of length +n+ of the
+ * elements of the array, then return the array itself.
  *
- *    a = [0, 1, 2]
- *    perms = []
- *    a.permutation(1) {|perm| perms.push(perm) }
- *    perms # => [[0], [1], [2]]
+ * If +n+ is not specified, yield all permutations of all elements.
  *
- *    perms = []
- *    a.permutation(2) {|perm| perms.push(perm) }
- *    perms # => [[0, 1], [0, 2], [1, 0], [1, 2], [2, 0], [2, 1]]
+ * The implementation makes no guarantees about the order in which the
+ * permutations are yielded.
  *
- *    perms = []
- *    a.permutation(3) {|perm| perms.push(perm) }
- *    perms # => [[0, 1, 2], [0, 2, 1], [1, 0, 2], [1, 2, 0], [2, 0, 1], [2, 1, 0]]
+ * If no block is given, an Enumerator is returned instead.
  *
- *  When +count+ is zero, calls the block once with a new empty array:
+ * Examples:
  *
- *    perms = []
- *    a.permutation(0) {|perm| perms.push(perm) }
- *    perms # => [[]]
- *
- *  When +count+ is out of range (negative or larger than <tt>self.size</tt>),
- *  does not call the block:
- *
- *    a.permutation(-1) {|permutation| fail 'Cannot happen' }
- *    a.permutation(4) {|permutation| fail 'Cannot happen' }
- *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ *   a = [1, 2, 3]
+ *   a.permutation.to_a    #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ *   a.permutation(1).to_a #=> [[1],[2],[3]]
+ *   a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
+ *   a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ *   a.permutation(0).to_a #=> [[]] # one permutation of length 0
+ *   a.permutation(4).to_a #=> []   # no permutations of length 4
  */
 
 static VALUE
 rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
 {
+    VALUE num;
     long r, n, i;
 
     n = RARRAY_LEN(ary);                  /* Array length */
     RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size);   /* Return enumerator if no block */
-    r = n;
-    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0]))
-        r = NUM2LONG(argv[0]);            /* Permutation size from argument */
+    rb_scan_args(argc, argv, "01", &num);
+    r = NIL_P(num) ? n : NUM2LONG(num);   /* Permutation size from argument */
 
     if (r < 0 || n < r) {
-        /* no permutations: yield nothing */
+	/* no permutations: yield nothing */
     }
     else if (r == 0) { /* exactly one permutation: the zero-length array */
-        rb_yield(rb_ary_new2(0));
+	rb_yield(rb_ary_new2(0));
     }
     else if (r == 1) { /* this is a special, easy case */
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-        }
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
     }
     else {             /* this is the general case */
-        volatile VALUE t0;
-        long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
-        char *used = (char*)(p + r);
-        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-        RBASIC_CLEAR_CLASS(ary0);
+	volatile VALUE t0;
+	long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
+	char *used = (char*)(p + r);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC_CLEAR_CLASS(ary0);
 
-        MEMZERO(used, char, n); /* initialize array */
+	MEMZERO(used, char, n); /* initialize array */
 
-        permute0(n, r, p, used, ary0); /* compute and yield permutations */
-        ALLOCV_END(t0);
-        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+	permute0(n, r, p, used, ary0); /* compute and yield permutations */
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -7149,16 +5260,16 @@ combinate0(const long len, const long n, long *const stack, const VALUE values)
     MEMZERO(stack+1, long, n);
     stack[0] = -1;
     for (;;) {
-        for (lev++; lev < n; lev++) {
-            stack[lev+1] = stack[lev]+1;
-        }
-        if (!yield_indexed_values(values, n, stack+1)) {
-            rb_raise(rb_eRuntimeError, "combination reentered");
-        }
-        do {
-            if (lev == 0) return;
-            stack[lev--]++;
-        } while (stack[lev+1]+n == len+lev+1);
+	for (lev++; lev < n; lev++) {
+	    stack[lev+1] = stack[lev]+1;
+	}
+	if (!yield_indexed_values(values, n, stack+1)) {
+	    rb_raise(rb_eRuntimeError, "combination reentered");
+	}
+	do {
+	    if (lev == 0) return;
+	    stack[lev--]++;
+	} while (stack[lev+1]+n == len+lev+1);
     }
 }
 
@@ -7173,46 +5284,27 @@ rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
 
 /*
  *  call-seq:
- *    combination(count) {|element| ... } -> self
- *    combination(count) -> new_enumerator
- *
- *  When a block and a positive
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
- *  argument +count+ (<tt>0 < count <= self.size</tt>)
- *  are given, calls the block with each combination of +self+ of size +count+;
- *  returns +self+:
- *
- *    a = %w[a b c]                                   # => ["a", "b", "c"]
- *    a.combination(2) {|combination| p combination } # => ["a", "b", "c"]
- *
- *  Output:
- *
- *    ["a", "b"]
- *    ["a", "c"]
- *    ["b", "c"]
+ *     ary.combination(n) { |c| block }    -> ary
+ *     ary.combination(n)                  -> Enumerator
  *
- *  The order of the yielded combinations is not guaranteed.
+ * When invoked with a block, yields all combinations of length +n+ of elements
+ * from the array and then returns the array itself.
  *
- *  When +count+ is zero, calls the block once with a new empty array:
+ * The implementation makes no guarantees about the order in which the
+ * combinations are yielded.
  *
- *    a.combination(0) {|combination| p combination }
- *    [].combination(0) {|combination| p combination }
+ * If no block is given, an Enumerator is returned instead.
  *
- *  Output:
+ * Examples:
  *
- *    []
- *    []
+ *     a = [1, 2, 3, 4]
+ *     a.combination(1).to_a  #=> [[1],[2],[3],[4]]
+ *     a.combination(2).to_a  #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
+ *     a.combination(3).to_a  #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
+ *     a.combination(4).to_a  #=> [[1,2,3,4]]
+ *     a.combination(0).to_a  #=> [[]] # one combination of length 0
+ *     a.combination(5).to_a  #=> []   # no combinations of length 5
  *
- *  When +count+ is negative or larger than +self.size+ and +self+ is non-empty,
- *  does not call the block:
- *
- *    a.combination(-1) {|combination| fail 'Cannot happen' } # => ["a", "b", "c"]
- *    a.combination(4)  {|combination| fail 'Cannot happen' } # => ["a", "b", "c"]
- *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: Array#permutation;
- *  see also {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
@@ -7224,25 +5316,25 @@ rb_ary_combination(VALUE ary, VALUE num)
     RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
     len = RARRAY_LEN(ary);
     if (n < 0 || len < n) {
-        /* yield nothing */
+	/* yield nothing */
     }
     else if (n == 0) {
-        rb_yield(rb_ary_new2(0));
+	rb_yield(rb_ary_new2(0));
     }
     else if (n == 1) {
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-        }
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
     }
     else {
-        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-        volatile VALUE t0;
-        long *stack = ALLOCV_N(long, t0, n+1);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	volatile VALUE t0;
+	long *stack = ALLOCV_N(long, t0, n+1);
 
-        RBASIC_CLEAR_CLASS(ary0);
-        combinate0(len, n, stack, ary0);
-        ALLOCV_END(t0);
-        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+	RBASIC_CLEAR_CLASS(ary0);
+	combinate0(len, n, stack, ary0);
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -7266,19 +5358,19 @@ rpermute0(const long n, const long r, long *const p, const VALUE values)
 
     p[index] = i;
     for (;;) {
-        if (++index < r-1) {
-            p[index] = i = 0;
-            continue;
-        }
-        for (i = 0; i < n; ++i) {
-            p[index] = i;
-            if (!yield_indexed_values(values, r, p)) {
-                rb_raise(rb_eRuntimeError, "repeated permute reentered");
-            }
-        }
-        do {
-            if (index <= 0) return;
-        } while ((i = ++p[--index]) >= n);
+	if (++index < r-1) {
+	    p[index] = i = 0;
+	    continue;
+	}
+	for (i = 0; i < n; ++i) {
+	    p[index] = i;
+	    if (!yield_indexed_values(values, r, p)) {
+		rb_raise(rb_eRuntimeError, "repeated permute reentered");
+	    }
+	}
+	do {
+	    if (index <= 0) return;
+	} while ((i = ++p[--index]) >= n);
     }
 }
 
@@ -7289,52 +5381,37 @@ rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
     long k = NUM2LONG(RARRAY_AREF(args, 0));
 
     if (k < 0) {
-        return LONG2FIX(0);
+	return LONG2FIX(0);
     }
     if (n <= 0) {
-        return LONG2FIX(!k);
+	return LONG2FIX(!k);
     }
     return rb_int_positive_pow(n, (unsigned long)k);
 }
 
 /*
  *  call-seq:
- *    repeated_permutation(size) {|permutation| ... } -> self
- *    repeated_permutation(size) -> new_enumerator
- *
- *  With a block given, calls the block with each repeated permutation of length +size+
- *  of the elements of +self+;
- *  each permutation is an array;
- *  returns +self+. The order of the permutations is indeterminate.
- *
- *  If a positive integer argument +size+ is given,
- *  calls the block with each +size+-tuple repeated permutation of the elements of +self+.
- *  The number of permutations is <tt>self.size**size</tt>.
- *
- *  Examples:
- *
- *  - +size+ is 1:
- *
- *      p = []
- *      [0, 1, 2].repeated_permutation(1) {|permutation| p.push(permutation) }
- *      p # => [[0], [1], [2]]
- *
- *  - +size+ is 2:
+ *     ary.repeated_permutation(n) { |p| block } -> ary
+ *     ary.repeated_permutation(n)               -> Enumerator
  *
- *      p = []
- *      [0, 1, 2].repeated_permutation(2) {|permutation| p.push(permutation) }
- *      p # => [[0, 0], [0, 1], [0, 2], [1, 0], [1, 1], [1, 2], [2, 0], [2, 1], [2, 2]]
+ * When invoked with a block, yield all repeated permutations of length +n+ of
+ * the elements of the array, then return the array itself.
  *
- *  If +size+ is zero, calls the block once with an empty array.
+ * The implementation makes no guarantees about the order in which the repeated
+ * permutations are yielded.
  *
- *  If +size+ is negative, does not call the block:
+ * If no block is given, an Enumerator is returned instead.
  *
- *    [0, 1, 2].repeated_permutation(-1) {|permutation| fail 'Cannot happen' }
+ * Examples:
  *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *     a = [1, 2]
+ *     a.repeated_permutation(1).to_a  #=> [[1], [2]]
+ *     a.repeated_permutation(2).to_a  #=> [[1,1],[1,2],[2,1],[2,2]]
+ *     a.repeated_permutation(3).to_a  #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
+ *                                     #    [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
+ *     a.repeated_permutation(0).to_a  #=> [[]] # one permutation of length 0
  */
+
 static VALUE
 rb_ary_repeated_permutation(VALUE ary, VALUE num)
 {
@@ -7345,25 +5422,25 @@ rb_ary_repeated_permutation(VALUE ary, VALUE num)
     r = NUM2LONG(num);                    /* Permutation size from argument */
 
     if (r < 0) {
-        /* no permutations: yield nothing */
+	/* no permutations: yield nothing */
     }
     else if (r == 0) { /* exactly one permutation: the zero-length array */
-        rb_yield(rb_ary_new2(0));
+	rb_yield(rb_ary_new2(0));
     }
     else if (r == 1) { /* this is a special, easy case */
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-        }
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
     }
     else {             /* this is the general case */
-        volatile VALUE t0;
-        long *p = ALLOCV_N(long, t0, r);
-        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-        RBASIC_CLEAR_CLASS(ary0);
+	volatile VALUE t0;
+	long *p = ALLOCV_N(long, t0, r);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC_CLEAR_CLASS(ary0);
 
-        rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
-        ALLOCV_END(t0);
-        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+	rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -7375,19 +5452,19 @@ rcombinate0(const long n, const long r, long *const p, const long rest, const VA
 
     p[index] = i;
     for (;;) {
-        if (++index < r-1) {
-            p[index] = i;
-            continue;
-        }
-        for (; i < n; ++i) {
-            p[index] = i;
-            if (!yield_indexed_values(values, r, p)) {
-                rb_raise(rb_eRuntimeError, "repeated combination reentered");
-            }
-        }
-        do {
-            if (index <= 0) return;
-        } while ((i = ++p[--index]) >= n);
+	if (++index < r-1) {
+	    p[index] = i;
+	    continue;
+	}
+	for (; i < n; ++i) {
+	    p[index] = i;
+	    if (!yield_indexed_values(values, r, p)) {
+		rb_raise(rb_eRuntimeError, "repeated combination reentered");
+	    }
+	}
+	do {
+	    if (index <= 0) return;
+	} while ((i = ++p[--index]) >= n);
     }
 }
 
@@ -7397,48 +5474,36 @@ rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
     long n = RARRAY_LEN(ary);
     long k = NUM2LONG(RARRAY_AREF(args, 0));
     if (k == 0) {
-        return LONG2FIX(1);
+	return LONG2FIX(1);
     }
     return binomial_coefficient(k, n + k - 1);
 }
 
 /*
  *  call-seq:
- *    repeated_combination(size) {|combination| ... } -> self
- *    repeated_combination(size) -> new_enumerator
+ *     ary.repeated_combination(n) { |c| block } -> ary
+ *     ary.repeated_combination(n)               -> Enumerator
  *
- *  With a block given, calls the block with each repeated combination of length +size+
- *  of the elements of +self+;
- *  each combination is an array;
- *  returns +self+. The order of the combinations is indeterminate.
+ * When invoked with a block, yields all repeated combinations of length +n+ of
+ * elements from the array and then returns the array itself.
  *
- *  If a positive integer argument +size+ is given,
- *  calls the block with each +size+-tuple repeated combination of the elements of +self+.
- *  The number of combinations is <tt>(size+1)(size+2)/2</tt>.
+ * The implementation makes no guarantees about the order in which the repeated
+ * combinations are yielded.
  *
- *  Examples:
+ * If no block is given, an Enumerator is returned instead.
  *
- *  - +size+ is 1:
+ * Examples:
  *
- *      c = []
- *      [0, 1, 2].repeated_combination(1) {|combination| c.push(combination) }
- *      c # => [[0], [1], [2]]
+ *   a = [1, 2, 3]
+ *   a.repeated_combination(1).to_a  #=> [[1], [2], [3]]
+ *   a.repeated_combination(2).to_a  #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
+ *   a.repeated_combination(3).to_a  #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
+ *                                   #    [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
+ *   a.repeated_combination(4).to_a  #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
+ *                                   #    [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
+ *                                   #    [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
+ *   a.repeated_combination(0).to_a  #=> [[]] # one combination of length 0
  *
- *  - +size+ is 2:
- *
- *      c = []
- *      [0, 1, 2].repeated_combination(2) {|combination| c.push(combination) }
- *      c # => [[0, 0], [0, 1], [0, 2], [1, 1], [1, 2], [2, 2]]
- *
- *  If +size+ is zero, calls the block once with an empty array.
- *
- *  If +size+ is negative, does not call the block:
- *
- *    [0, 1, 2].repeated_combination(-1) {|combination| fail 'Cannot happen' }
- *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 static VALUE
@@ -7450,98 +5515,67 @@ rb_ary_repeated_combination(VALUE ary, VALUE num)
     RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size);   /* Return enumerator if no block */
     len = RARRAY_LEN(ary);
     if (n < 0) {
-        /* yield nothing */
+	/* yield nothing */
     }
     else if (n == 0) {
-        rb_yield(rb_ary_new2(0));
+	rb_yield(rb_ary_new2(0));
     }
     else if (n == 1) {
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-        }
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
     }
     else if (len == 0) {
-        /* yield nothing */
+	/* yield nothing */
     }
     else {
-        volatile VALUE t0;
-        long *p = ALLOCV_N(long, t0, n);
-        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-        RBASIC_CLEAR_CLASS(ary0);
+	volatile VALUE t0;
+	long *p = ALLOCV_N(long, t0, n);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC_CLEAR_CLASS(ary0);
 
-        rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
-        ALLOCV_END(t0);
-        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+	rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    product(*other_arrays) -> new_array
- *    product(*other_arrays) {|combination| ... } -> self
- *
- *  Computes all combinations of elements from all the arrays,
- *  including both +self+ and +other_arrays+:
- *
- *  - The number of combinations is the product of the sizes of all the arrays,
- *    including both +self+ and +other_arrays+.
- *  - The order of the returned combinations is indeterminate.
- *
- *  With no block given, returns the combinations as an array of arrays:
- *
- *    p = [0, 1].product([2, 3])
- *    # => [[0, 2], [0, 3], [1, 2], [1, 3]]
- *    p.size # => 4
- *    p = [0, 1].product([2, 3], [4, 5])
- *    # => [[0, 2, 4], [0, 2, 5], [0, 3, 4], [0, 3, 5], [1, 2, 4], [1, 2, 5], [1, 3, 4], [1, 3,...
- *    p.size # => 8
- *
- *  If +self+ or any argument is empty, returns an empty array:
- *
- *    [].product([2, 3], [4, 5]) # => []
- *    [0, 1].product([2, 3], []) # => []
+ *     ary.product(other_ary, ...)                -> new_ary
+ *     ary.product(other_ary, ...) { |p| block }  -> ary
  *
- *  If no argument is given, returns an array of 1-element arrays,
- *  each containing an element of +self+:
+ *  Returns an array of all combinations of elements from all arrays.
  *
- *    a.product # => [[0], [1], [2]]
+ *  The length of the returned array is the product of the length of +self+ and
+ *  the argument arrays.
  *
- *  With a block given, calls the block with each combination; returns +self+:
+ *  If given a block, #product will yield all combinations and return +self+
+ *  instead.
  *
- *    p = []
- *    [0, 1].product([2, 3]) {|combination| p.push(combination) }
- *    p # => [[0, 2], [0, 3], [1, 2], [1, 3]]
- *
- *  If +self+ or any argument is empty, does not call the block:
- *
- *    [].product([2, 3], [4, 5]) {|combination| fail 'Cannot happen' }
- *    # => []
- *    [0, 1].product([2, 3], []) {|combination| fail 'Cannot happen' }
- *    # => [0, 1]
- *
- *  If no argument is given, calls the block with each element of +self+ as a 1-element array:
- *
- *    p = []
- *    [0, 1].product {|combination| p.push(combination) }
- *    p # => [[0], [1]]
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *     [1,2,3].product([4,5])     #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
+ *     [1,2].product([1,2])       #=> [[1,1],[1,2],[2,1],[2,2]]
+ *     [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
+ *                                #     [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
+ *     [1,2].product()            #=> [[1],[2]]
+ *     [1,2].product([])          #=> []
  */
 
 static VALUE
 rb_ary_product(int argc, VALUE *argv, VALUE ary)
 {
     int n = argc+1;    /* How many arrays we're operating on */
-    volatile VALUE t0 = rb_ary_hidden_new(n);
-    volatile VALUE t1 = Qundef;
+    volatile VALUE t0 = tmpary(n);
+    volatile VALUE t1 = tmpbuf(n, sizeof(int));
     VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
-    int *counters = ALLOCV_N(int, t1, n); /* The current position in each one */
+    int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
     VALUE result = Qnil;      /* The array we'll be returning, when no block given */
     long i,j;
     long resultlen = 1;
 
     RBASIC_CLEAR_CLASS(t0);
+    RBASIC_CLEAR_CLASS(t1);
 
     /* initialize the arrays of arrays */
     ARY_SET_LEN(t0, n);
@@ -7554,85 +5588,82 @@ rb_ary_product(int argc, VALUE *argv, VALUE ary)
 
     /* Otherwise, allocate and fill in an array of results */
     if (rb_block_given_p()) {
-        /* Make defensive copies of arrays; exit if any is empty */
-        for (i = 0; i < n; i++) {
-            if (RARRAY_LEN(arrays[i]) == 0) goto done;
-            arrays[i] = ary_make_shared_copy(arrays[i]);
-        }
+	/* Make defensive copies of arrays; exit if any is empty */
+	for (i = 0; i < n; i++) {
+	    if (RARRAY_LEN(arrays[i]) == 0) goto done;
+	    arrays[i] = ary_make_shared_copy(arrays[i]);
+	}
     }
     else {
-        /* Compute the length of the result array; return [] if any is empty */
-        for (i = 0; i < n; i++) {
-            long k = RARRAY_LEN(arrays[i]);
-            if (k == 0) {
-                result = rb_ary_new2(0);
-                goto done;
-            }
+	/* Compute the length of the result array; return [] if any is empty */
+	for (i = 0; i < n; i++) {
+	    long k = RARRAY_LEN(arrays[i]);
+	    if (k == 0) {
+		result = rb_ary_new2(0);
+		goto done;
+	    }
             if (MUL_OVERFLOW_LONG_P(resultlen, k))
-                rb_raise(rb_eRangeError, "too big to product");
-            resultlen *= k;
-        }
-        result = rb_ary_new2(resultlen);
+		rb_raise(rb_eRangeError, "too big to product");
+	    resultlen *= k;
+	}
+	result = rb_ary_new2(resultlen);
     }
     for (;;) {
-        int m;
-        /* fill in one subarray */
-        VALUE subarray = rb_ary_new2(n);
-        for (j = 0; j < n; j++) {
-            rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
-        }
-
-        /* put it on the result array */
-        if (NIL_P(result)) {
-            FL_SET(t0, RARRAY_SHARED_ROOT_FLAG);
-            rb_yield(subarray);
-            if (!FL_TEST(t0, RARRAY_SHARED_ROOT_FLAG)) {
-                rb_raise(rb_eRuntimeError, "product reentered");
-            }
-            else {
-                FL_UNSET(t0, RARRAY_SHARED_ROOT_FLAG);
-            }
-        }
-        else {
-            rb_ary_push(result, subarray);
-        }
-
-        /*
-         * Increment the last counter.  If it overflows, reset to 0
-         * and increment the one before it.
-         */
-        m = n-1;
-        counters[m]++;
-        while (counters[m] == RARRAY_LEN(arrays[m])) {
-            counters[m] = 0;
-            /* If the first counter overflows, we are done */
-            if (--m < 0) goto done;
-            counters[m]++;
-        }
+	int m;
+	/* fill in one subarray */
+	VALUE subarray = rb_ary_new2(n);
+	for (j = 0; j < n; j++) {
+	    rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+	}
+
+	/* put it on the result array */
+	if (NIL_P(result)) {
+	    FL_SET(t0, FL_USER5);
+	    rb_yield(subarray);
+	    if (! FL_TEST(t0, FL_USER5)) {
+		rb_raise(rb_eRuntimeError, "product reentered");
+	    }
+	    else {
+		FL_UNSET(t0, FL_USER5);
+	    }
+	}
+	else {
+	    rb_ary_push(result, subarray);
+	}
+
+	/*
+	 * Increment the last counter.  If it overflows, reset to 0
+	 * and increment the one before it.
+	 */
+	m = n-1;
+	counters[m]++;
+	while (counters[m] == RARRAY_LEN(arrays[m])) {
+	    counters[m] = 0;
+	    /* If the first counter overflows, we are done */
+	    if (--m < 0) goto done;
+	    counters[m]++;
+	}
     }
-
 done:
-    ALLOCV_END(t1);
+    tmpary_discard(t0);
+    tmpbuf_discard(t1);
 
     return NIL_P(result) ? ary : result;
 }
 
 /*
  *  call-seq:
- *    take(count) -> new_array
+ *     ary.take(n)               -> new_ary
+ *
+ *  Returns first +n+ elements from the array.
  *
- *  Returns a new array containing the first +count+ element of +self+
- *  (as available);
- *  +count+ must be a non-negative numeric;
- *  does not modify +self+:
+ *  If a negative number is given, raises an ArgumentError.
  *
- *    a = ['a', 'b', 'c', 'd']
- *    a.take(2)   # => ["a", "b"]
- *    a.take(2.1) # => ["a", "b"]
- *    a.take(50)  # => ["a", "b", "c", "d"]
- *    a.take(0)   # => []
+ *  See also Array#drop
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.take(3)             #=> [1, 2, 3]
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -7640,30 +5671,26 @@ rb_ary_take(VALUE obj, VALUE n)
 {
     long len = NUM2LONG(n);
     if (len < 0) {
-        rb_raise(rb_eArgError, "attempt to take negative size");
+	rb_raise(rb_eArgError, "attempt to take negative size");
     }
     return rb_ary_subseq(obj, 0, len);
 }
 
 /*
  *  call-seq:
- *    take_while {|element| ... } -> new_array
- *    take_while -> new_enumerator
+ *     ary.take_while { |obj| block }  -> new_ary
+ *     ary.take_while                  -> Enumerator
  *
- *  With a block given, calls the block with each successive element of +self+;
- *  stops iterating if the block returns +false+ or +nil+;
- *  returns a new array containing those elements for which the block returned a truthy value:
+ *  Passes elements to the block until the block returns +nil+ or +false+, then
+ *  stops iterating and returns an array of all prior elements.
  *
- *    a = [0, 1, 2, 3, 4, 5]
- *    a.take_while {|element| element < 3 } # => [0, 1, 2]
- *    a.take_while {|element| true }        # => [0, 1, 2, 3, 4, 5]
- *    a.take_while {|element| false }       # => []
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  With no block given, returns a new Enumerator.
+ *  See also Array#drop_while
  *
- *  Does not modify +self+.
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.take_while { |i| i < 3 }  #=> [1, 2]
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -7673,28 +5700,25 @@ rb_ary_take_while(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
     }
     return rb_ary_take(ary, LONG2FIX(i));
 }
 
 /*
  *  call-seq:
- *    drop(count) -> new_array
+ *     ary.drop(n)               -> new_ary
+ *
+ *  Drops first +n+ elements from +ary+ and returns the rest of the elements in
+ *  an array.
  *
- *  Returns a new array containing all but the first +count+ element of +self+,
- *  where +count+ is a non-negative integer;
- *  does not modify +self+.
+ *  If a negative number is given, raises an ArgumentError.
  *
- *  Examples:
+ *  See also Array#take
  *
- *    a = [0, 1, 2, 3, 4, 5]
- *    a.drop(0) # => [0, 1, 2, 3, 4, 5]
- *    a.drop(1) # => [1, 2, 3, 4, 5]
- *    a.drop(2) # => [2, 3, 4, 5]
- *    a.drop(9) # => []
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.drop(3)             #=> [4, 5, 0]
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -7703,30 +5727,30 @@ rb_ary_drop(VALUE ary, VALUE n)
     VALUE result;
     long pos = NUM2LONG(n);
     if (pos < 0) {
-        rb_raise(rb_eArgError, "attempt to drop negative size");
+	rb_raise(rb_eArgError, "attempt to drop negative size");
     }
 
     result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
-    if (NIL_P(result)) result = rb_ary_new();
+    if (result == Qnil) result = rb_ary_new();
     return result;
 }
 
 /*
  *  call-seq:
- *    drop_while {|element| ... } -> new_array
- *    drop_while -> new_enumerator
+ *     ary.drop_while { |obj| block }   -> new_ary
+ *     ary.drop_while                  -> Enumerator
+ *
+ *  Drops elements up to, but not including, the first element for which the
+ *  block returns +nil+ or +false+ and returns an array containing the
+ *  remaining elements.
  *
- *  With a block given, calls the block with each successive element of +self+;
- *  stops if the block returns +false+ or +nil+;
- *  returns a new array _omitting_ those elements for which the block returned a truthy value;
- *  does not modify +self+:
+ *  If no block is given, an Enumerator is returned instead.
  *
- *    a = [0, 1, 2, 3, 4, 5]
- *    a.drop_while {|element| element < 3 } # => [3, 4, 5]
+ *  See also Array#take_while
  *
- *  With no block given, returns a new Enumerator.
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.drop_while {|i| i < 3 }   #=> [3, 4, 5, 0]
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -7736,301 +5760,59 @@ rb_ary_drop_while(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
     }
     return rb_ary_drop(ary, LONG2FIX(i));
 }
 
 /*
  *  call-seq:
- *    any? -> true or false
- *    any?(object) -> true or false
- *    any? {|element| ... } -> true or false
+ *     ary.any? [{ |obj| block }]   -> true or false
  *
- *  Returns whether for any element of +self+, a given criterion is satisfied.
- *
- *  With no block and no argument, returns whether any element of +self+ is truthy:
- *
- *    [nil, false, []].any? # => true  # Array object is truthy.
- *    [nil, false, {}].any? # => true  # Hash object is truthy.
- *    [nil, false, ''].any? # => true  # String object is truthy.
- *    [nil, false].any?     # => false # Nil and false are not truthy.
- *
- *  With argument +object+ given,
- *  returns whether <tt>object === ele</tt> for any element +ele+ in +self+:
- *
- *    [nil, false, 0].any?(0)          # => true
- *    [nil, false, 1].any?(0)          # => false
- *    [nil, false, 'food'].any?(/foo/) # => true
- *    [nil, false, 'food'].any?(/bar/) # => false
- *
- *  With a block given,
- *  calls the block with each element in +self+;
- *  returns whether the block returns any truthy value:
- *
- *    [0, 1, 2].any? {|ele| ele < 1 } # => true
- *    [0, 1, 2].any? {|ele| ele < 0 } # => false
- *
- *  With both a block and argument +object+ given,
- *  ignores the block and uses +object+ as above.
- *
- *  <b>Special case</b>: returns +false+ if +self+ is empty
- *  (regardless of any given argument or block).
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *  See also Enumerable#any?
  */
 
 static VALUE
 rb_ary_any_p(int argc, VALUE *argv, VALUE ary)
 {
     long i, len = RARRAY_LEN(ary);
+    const VALUE *ptr = RARRAY_CONST_PTR(ary);
 
     rb_check_arity(argc, 0, 1);
     if (!len) return Qfalse;
     if (argc) {
-        if (rb_block_given_p()) {
-            rb_warn("given block not used");
-        }
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qtrue;
-        }
+	for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	    if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qtrue;
+	}
     }
     else if (!rb_block_given_p()) {
-        for (i = 0; i < len; ++i) {
-            if (RTEST(RARRAY_AREF(ary, i))) return Qtrue;
-        }
+	for (i = 0; i < len; ++i) if (RTEST(ptr[i])) return Qtrue;
     }
     else {
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
-        }
+	for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
+	}
     }
     return Qfalse;
 }
 
 /*
- *  call-seq:
- *    all? -> true or false
- *    all?(object) -> true or false
- *    all? {|element| ... } -> true or false
- *
- *  Returns whether for every element of +self+,
- *  a given criterion is satisfied.
- *
- *  With no block and no argument,
- *  returns whether every element of +self+ is truthy:
- *
- *    [[], {}, '', 0, 0.0, Object.new].all? # => true  # All truthy objects.
- *    [[], {}, '', 0, 0.0, nil].all?        # => false # nil is not truthy.
- *    [[], {}, '', 0, 0.0, false].all?      # => false # false is not truthy.
- *
- *  With argument +object+ given, returns whether <tt>object === ele</tt>
- *  for every element +ele+ in +self+:
- *
- *    [0, 0, 0].all?(0)                    # => true
- *    [0, 1, 2].all?(1)                    # => false
- *    ['food', 'fool', 'foot'].all?(/foo/) # => true
- *    ['food', 'drink'].all?(/foo/)        # => false
- *
- *  With a block given, calls the block with each element in +self+;
- *  returns whether the block returns only truthy values:
- *
- *    [0, 1, 2].all? { |ele| ele < 3 } # => true
- *    [0, 1, 2].all? { |ele| ele < 2 } # => false
- *
- *  With both a block and argument +object+ given,
- *  ignores the block and uses +object+ as above.
- *
- *  <b>Special case</b>: returns +true+ if +self+ is empty
- *  (regardless of any given argument or block).
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
- */
-
-static VALUE
-rb_ary_all_p(int argc, VALUE *argv, VALUE ary)
-{
-    long i, len = RARRAY_LEN(ary);
-
-    rb_check_arity(argc, 0, 1);
-    if (!len) return Qtrue;
-    if (argc) {
-        if (rb_block_given_p()) {
-            rb_warn("given block not used");
-        }
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (!RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
-        }
-    }
-    else if (!rb_block_given_p()) {
-        for (i = 0; i < len; ++i) {
-            if (!RTEST(RARRAY_AREF(ary, i))) return Qfalse;
-        }
-    }
-    else {
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
-        }
-    }
-    return Qtrue;
-}
-
-/*
- *  call-seq:
- *    none? -> true or false
- *    none?(object) -> true or false
- *    none? {|element| ... } -> true or false
- *
- *  Returns +true+ if no element of +self+ meets a given criterion, +false+ otherwise.
- *
- *  With no block given and no argument, returns +true+ if +self+ has no truthy elements,
- *  +false+ otherwise:
- *
- *    [nil, false].none?    # => true
- *    [nil, 0, false].none? # => false
- *    [].none?              # => true
- *
- *  With argument +object+ given, returns +false+ if for any element +element+,
- *  <tt>object === element</tt>; +true+ otherwise:
- *
- *    ['food', 'drink'].none?(/bar/) # => true
- *    ['food', 'drink'].none?(/foo/) # => false
- *    [].none?(/foo/)                # => true
- *    [0, 1, 2].none?(3)             # => true
- *    [0, 1, 2].none?(1)             # => false
- *
- *  With a block given, calls the block with each element in +self+;
- *  returns +true+ if the block returns no truthy value, +false+ otherwise:
- *
- *    [0, 1, 2].none? {|element| element > 3 } # => true
- *    [0, 1, 2].none? {|element| element > 1 } # => false
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
- */
-
-static VALUE
-rb_ary_none_p(int argc, VALUE *argv, VALUE ary)
-{
-    long i, len = RARRAY_LEN(ary);
-
-    rb_check_arity(argc, 0, 1);
-    if (!len) return Qtrue;
-    if (argc) {
-        if (rb_block_given_p()) {
-            rb_warn("given block not used");
-        }
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
-        }
-    }
-    else if (!rb_block_given_p()) {
-        for (i = 0; i < len; ++i) {
-            if (RTEST(RARRAY_AREF(ary, i))) return Qfalse;
-        }
-    }
-    else {
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
-        }
-    }
-    return Qtrue;
-}
-
-/*
- *  call-seq:
- *    one? -> true or false
- *    one? {|element| ... } -> true or false
- *    one?(object) -> true or false
- *
- *  Returns +true+ if exactly one element of +self+ meets a given criterion.
- *
- *  With no block given and no argument, returns +true+ if +self+ has exactly one truthy element,
- *  +false+ otherwise:
- *
- *    [nil, 0].one? # => true
- *    [0, 0].one? # => false
- *    [nil, nil].one? # => false
- *    [].one? # => false
- *
- *  With a block given, calls the block with each element in +self+;
- *  returns +true+ if the block a truthy value for exactly one element, +false+ otherwise:
- *
- *    [0, 1, 2].one? {|element| element > 0 } # => false
- *    [0, 1, 2].one? {|element| element > 1 } # => true
- *    [0, 1, 2].one? {|element| element > 2 } # => false
- *
- *  With argument +object+ given, returns +true+ if for exactly one element +element+, <tt>object === element</tt>;
- *  +false+ otherwise:
- *
- *    [0, 1, 2].one?(0) # => true
- *    [0, 0, 1].one?(0) # => false
- *    [1, 1, 2].one?(0) # => false
- *    ['food', 'drink'].one?(/bar/) # => false
- *    ['food', 'drink'].one?(/foo/) # => true
- *    [].one?(/foo/) # => false
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
- */
-
-static VALUE
-rb_ary_one_p(int argc, VALUE *argv, VALUE ary)
-{
-    long i, len = RARRAY_LEN(ary);
-    VALUE result = Qfalse;
-
-    rb_check_arity(argc, 0, 1);
-    if (!len) return Qfalse;
-    if (argc) {
-        if (rb_block_given_p()) {
-            rb_warn("given block not used");
-        }
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) {
-                if (result) return Qfalse;
-                result = Qtrue;
-            }
-        }
-    }
-    else if (!rb_block_given_p()) {
-        for (i = 0; i < len; ++i) {
-            if (RTEST(RARRAY_AREF(ary, i))) {
-                if (result) return Qfalse;
-                result = Qtrue;
-            }
-        }
-    }
-    else {
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-                if (result) return Qfalse;
-                result = Qtrue;
-            }
-        }
-    }
-    return result;
-}
-
-/*
- *  call-seq:
- *    array.dig(index, *identifiers) -> object
- *
- *  Finds and returns the object in nested object
- *  specified by +index+ and +identifiers+;
- *  the nested objects may be instances of various classes.
- *  See {Dig Methods}[rdoc-ref:dig_methods.rdoc].
+ * call-seq:
+ *   ary.dig(idx, ...)                 -> object
  *
- *  Examples:
+ * Extracts the nested value specified by the sequence of <i>idx</i>
+ * objects by calling +dig+ at each step, returning +nil+ if any
+ * intermediate step is +nil+.
  *
- *    a = [:foo, [:bar, :baz, [:bat, :bam]]]
- *    a.dig(1) # => [:bar, :baz, [:bat, :bam]]
- *    a.dig(1, 2) # => [:bat, :bam]
- *    a.dig(1, 2, 0) # => :bat
- *    a.dig(1, 2, 3) # => nil
+ *   a = [[1, [2, 3]]]
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *   a.dig(0, 1, 1)                    #=> 3
+ *   a.dig(1, 2, 3)                    #=> nil
+ *   a.dig(0, 0, 0)                    #=> TypeError: Integer does not have #dig method
+ *   [42, {foo: :bar}].dig(1, :foo)    #=> :bar
  */
 
-static VALUE
+VALUE
 rb_ary_dig(int argc, VALUE *argv, VALUE self)
 {
     rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
@@ -8045,8 +5827,14 @@ finish_exact_sum(long n, VALUE r, VALUE v, int z)
 {
     if (n != 0)
         v = rb_fix_plus(LONG2FIX(n), v);
-    if (!UNDEF_P(r)) {
-        v = rb_rational_plus(r, v);
+    if (r != Qundef) {
+	/* r can be an Integer when mathn is loaded */
+	if (FIXNUM_P(r))
+	    v = rb_fix_plus(r, v);
+	else if (RB_TYPE_P(r, T_BIGNUM))
+	    v = rb_big_plus(r, v);
+	else
+	    v = rb_rational_plus(r, v);
     }
     else if (!n && z) {
         v = rb_fix_plus(LONG2FIX(0), v);
@@ -8056,42 +5844,43 @@ finish_exact_sum(long n, VALUE r, VALUE v, int z)
 
 /*
  * call-seq:
- *   sum(init = 0) -> object
- *   sum(init = 0) {|element| ... } -> object
+ *   ary.sum(init=0)                    -> number
+ *   ary.sum(init=0) {|e| expr }        -> number
  *
- *  With no block given, returns the sum of +init+ and all elements of +self+;
- *  for array +array+ and value +init+, equivalent to:
+ * Returns the sum of elements.
+ * For example, [e1, e2, e3].sum returns init + e1 + e2 + e3.
  *
- *    sum = init
- *    array.each {|element| sum += element }
- *    sum
+ * If a block is given, the block is applied to each element
+ * before addition.
  *
- *  For example, <tt>[e0, e1, e2].sum</tt> returns <tt>init + e0 + e1 + e2</tt>.
+ * If <i>ary</i> is empty, it returns <i>init</i>.
  *
- *  Examples:
+ *   [].sum                             #=> 0
+ *   [].sum(0.0)                        #=> 0.0
+ *   [1, 2, 3].sum                      #=> 6
+ *   [3, 5.5].sum                       #=> 8.5
+ *   [2.5, 3.0].sum(0.0) {|e| e * e }   #=> 15.25
+ *   [Object.new].sum                   #=> TypeError
  *
- *    [0, 1, 2, 3].sum                 # => 6
- *    [0, 1, 2, 3].sum(100)            # => 106
- *    ['abc', 'def', 'ghi'].sum('jkl') # => "jklabcdefghi"
- *    [[:foo, :bar], ['foo', 'bar']].sum([2, 3])
- *    # => [2, 3, :foo, :bar, "foo", "bar"]
+ * The (arithmetic) mean value of an array can be obtained as follows.
  *
- *  The +init+ value and elements need not be numeric, but must all be <tt>+</tt>-compatible:
+ *   mean = ary.sum(0.0) / ary.length
  *
- *    # Raises TypeError: Array can't be coerced into Integer.
- *    [[:foo, :bar], ['foo', 'bar']].sum(2)
+ * This method can be used for non-numeric objects by
+ * explicit <i>init</i> argument.
  *
- *  With a block given, calls the block with each element of +self+;
- *  the block's return value (instead of the element itself) is used as the addend:
+ *   ["a", "b", "c"].sum("")            #=> "abc"
+ *   [[1], [[2]], [3]].sum([])          #=> [1, [2], 3]
  *
- *    ['zero', 1, :two].sum('Coerced and concatenated: ') {|element| element.to_s }
- *    # => "Coerced and concatenated: zero1two"
+ * However, Array#join and Array#flatten is faster than Array#sum for
+ * array of strings and array of arrays.
  *
- *  Notes:
+ *   ["a", "b", "c"].join               #=> "abc"
+ *   [[1], [[2]], [3]].flatten(1)       #=> [1, [2], 3]
  *
- *  - Array#join and Array#flatten may be faster than Array#sum
- *    for an array of strings or an array of arrays.
- *  - Array#sum method may not respect method redefinition of "+" methods such as Integer#+.
+ *
+ * Array#sum method may not respect method redefinition of "+" methods
+ * such as Integer#+.
  *
  */
 
@@ -8102,7 +5891,8 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
     long i, n;
     int block_given;
 
-    v = (rb_check_arity(argc, 0, 1) ? argv[0] : LONG2FIX(0));
+    if (rb_scan_args(argc, argv, "01", &v) == 0)
+        v = LONG2FIX(0);
 
     block_given = rb_block_given_p();
 
@@ -8111,12 +5901,6 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
 
     n = 0;
     r = Qundef;
-
-    if (!FIXNUM_P(v) && !RB_BIGNUM_TYPE_P(v) && !RB_TYPE_P(v, T_RATIONAL)) {
-        i = 0;
-        goto init_is_a_value;
-    }
-
     for (i = 0; i < RARRAY_LEN(ary); i++) {
         e = RARRAY_AREF(ary, i);
         if (block_given)
@@ -8128,10 +5912,10 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
                 n = 0;
             }
         }
-        else if (RB_BIGNUM_TYPE_P(e))
+        else if (RB_TYPE_P(e, T_BIGNUM))
             v = rb_big_plus(e, v);
         else if (RB_TYPE_P(e, T_RATIONAL)) {
-            if (UNDEF_P(r))
+            if (r == Qundef)
                 r = e;
             else
                 r = rb_rational_plus(r, e);
@@ -8148,15 +5932,15 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
     if (RB_FLOAT_TYPE_P(e)) {
         /*
          * Kahan-Babuska balancing compensated summation algorithm
-         * See https://link.springer.com/article/10.1007/s00607-005-0139-x
+         * See http://link.springer.com/article/10.1007/s00607-005-0139-x
          */
         double f, c;
-        double x, t;
 
         f = NUM2DBL(v);
         c = 0.0;
         goto has_float_value;
         for (; i < RARRAY_LEN(ary); i++) {
+            double x, t;
             e = RARRAY_AREF(ary, i);
             if (block_given)
                 e = rb_yield(e);
@@ -8165,7 +5949,7 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
                 x = RFLOAT_VALUE(e);
             else if (FIXNUM_P(e))
                 x = FIX2LONG(e);
-            else if (RB_BIGNUM_TYPE_P(e))
+            else if (RB_TYPE_P(e, T_BIGNUM))
                 x = rb_big2dbl(e);
             else if (RB_TYPE_P(e, T_RATIONAL))
                 x = rb_num2dbl(e);
@@ -8201,7 +5985,6 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
     }
 
     goto has_some_value;
-    init_is_a_value:
     for (; i < RARRAY_LEN(ary); i++) {
         e = RARRAY_AREF(ary, i);
         if (block_given)
@@ -8212,162 +5995,56 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
     return v;
 }
 
-/* :nodoc: */
-static VALUE
-rb_ary_deconstruct(VALUE ary)
-{
-    return ary;
-}
-
 /*
- *  An \Array object is an ordered, integer-indexed collection of objects,
- *  called _elements_;
- *  the object represents
- *  an {array data structure}[https://en.wikipedia.org/wiki/Array_(data_structure)].
- *
- *  An element may be any object (even another array);
- *  elements may be any mixture of objects of different types.
- *
- *  Important data structures that use arrays include:
- *
- *  - {Coordinate vector}[https://en.wikipedia.org/wiki/Coordinate_vector].
- *  - {Matrix}[https://en.wikipedia.org/wiki/Matrix_(mathematics)].
- *  - {Heap}[https://en.wikipedia.org/wiki/Heap_(data_structure)].
- *  - {Hash table}[https://en.wikipedia.org/wiki/Hash_table].
- *  - {Deque (double-ended queue)}[https://en.wikipedia.org/wiki/Double-ended_queue].
- *  - {Queue}[https://en.wikipedia.org/wiki/Queue_(abstract_data_type)].
- *  - {Stack}[https://en.wikipedia.org/wiki/Stack_(abstract_data_type)].
+ *  Arrays are ordered, integer-indexed collections of any object.
  *
- *  There are also array-like data structures:
- *
- *  - {Associative array}[https://en.wikipedia.org/wiki/Associative_array] (see Hash).
- *  - {Directory}[https://en.wikipedia.org/wiki/Directory_(computing)] (see Dir).
- *  - {Environment}[https://en.wikipedia.org/wiki/Environment_variable] (see ENV).
- *  - {Set}[https://en.wikipedia.org/wiki/Set_(abstract_data_type)] (see Set).
- *  - {String}[https://en.wikipedia.org/wiki/String_(computer_science)] (see String).
- *
- *  == \Array Indexes
- *
- *  \Array indexing starts at 0, as in C or Java.
- *
- *  A non-negative index is an offset from the first element:
- *
- *  - Index 0 indicates the first element.
- *  - Index 1 indicates the second element.
- *  - ...
- *
- *  A negative index is an offset, backwards, from the end of the array:
- *
- *  - Index -1 indicates the last element.
- *  - Index -2 indicates the next-to-last element.
- *  - ...
- *
- *
- *  === In-Range and Out-of-Range Indexes
- *
- *  A non-negative index is <i>in range</i> if and only if it is smaller than
- *  the size of the array.  For a 3-element array:
- *
- *  - Indexes 0 through 2 are in range.
- *  - Index 3 is out of range.
- *
- *  A negative index is <i>in range</i> if and only if its absolute value is
- *  not larger than the size of the array.  For a 3-element array:
- *
- *  - Indexes -1 through -3 are in range.
- *  - Index -4 is out of range.
- *
- *  === Effective Index
- *
- *  Although the effective index into an array is always an integer,
- *  some methods (both within class \Array and elsewhere)
- *  accept one or more non-integer arguments that are
- *  {integer-convertible objects}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *  Array indexing starts at 0, as in C or Java.  A negative index is assumed
+ *  to be relative to the end of the array---that is, an index of -1 indicates
+ *  the last element of the array, -2 is the next to last element in the
+ *  array, and so on.
  *
  *  == Creating Arrays
  *
- *  You can create an \Array object explicitly with:
- *
- *  - An {array literal}[rdoc-ref:syntax/literals.rdoc@Array+Literals]:
- *
- *      [1, 'one', :one, [2, 'two', :two]]
- *
- *  - A {%w or %W string-array Literal}[rdoc-ref:syntax/literals.rdoc@25w+and+-25W-3A+String-Array+Literals]:
- *
- *      %w[foo bar baz] # => ["foo", "bar", "baz"]
- *      %w[1 % *]       # => ["1", "%", "*"]
+ *  A new array can be created by using the literal constructor
+ *  <code>[]</code>.  Arrays can contain different types of objects.  For
+ *  example, the array below contains an Integer, a String and a Float:
  *
- *  - A {%i or %I symbol-array Literal}[rdoc-ref:syntax/literals.rdoc@25i+and+-25I-3A+Symbol-Array+Literals]:
+ *     ary = [1, "two", 3.0] #=> [1, "two", 3.0]
  *
- *      %i[foo bar baz] # => [:foo, :bar, :baz]
- *      %i[1 % *]       # => [:"1", :%, :*]
+ *  An array can also be created by explicitly calling Array.new with zero, one
+ *  (the initial size of the Array) or two arguments (the initial size and a
+ *  default object).
  *
- *  - \Method Kernel#Array:
+ *     ary = Array.new    #=> []
+ *     Array.new(3)       #=> [nil, nil, nil]
+ *     Array.new(3, true) #=> [true, true, true]
  *
- *      Array(["a", "b"])             # => ["a", "b"]
- *      Array(1..5)                   # => [1, 2, 3, 4, 5]
- *      Array(key: :value)            # => [[:key, :value]]
- *      Array(nil)                    # => []
- *      Array(1)                      # => [1]
- *      Array({:a => "a", :b => "b"}) # => [[:a, "a"], [:b, "b"]]
+ *  Note that the second argument populates the array with references to the
+ *  same object.  Therefore, it is only recommended in cases when you need to
+ *  instantiate arrays with natively immutable objects such as Symbols,
+ *  numbers, true or false.
  *
- *  - \Method Array.new:
+ *  To create an array with separate objects a block can be passed instead.
+ *  This method is safe to use with mutable objects such as hashes, strings or
+ *  other arrays:
  *
- *      Array.new               # => []
- *      Array.new(3)            # => [nil, nil, nil]
- *      Array.new(4) {Hash.new} # => [{}, {}, {}, {}]
- *      Array.new(3, true)      # => [true, true, true]
+ *     Array.new(4) { Hash.new }  #=> [{}, {}, {}, {}]
+ *     Array.new(4) {|i| i.to_s } #=> ["0", "1", "2", "3"]
  *
- *    Note that the last example above populates the array
- *    with references to the same object.
- *    This is recommended only in cases where that object is a natively immutable object
- *    such as a symbol, a numeric, +nil+, +true+, or +false+.
+ *  This is also a quick way to build up multi-dimensional arrays:
  *
- *    Another way to create an array with various objects, using a block;
- *    this usage is safe for mutable objects such as hashes, strings or
- *    other arrays:
+ *     empty_table = Array.new(3) { Array.new(3) }
+ *     #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
  *
- *      Array.new(4) {|i| i.to_s } # => ["0", "1", "2", "3"]
+ *  An array can also be created by using the Array() method, provided by
+ *  Kernel, which tries to call #to_ary, then #to_a on its argument.
  *
- *    Here is a way to create a multi-dimensional array:
- *
- *      Array.new(3) {Array.new(3)}
- *      # => [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
- *
- *  A number of Ruby methods, both in the core and in the standard library,
- *  provide instance method +to_a+, which converts an object to an array.
- *
- *  - ARGF#to_a
- *  - Array#to_a
- *  - Enumerable#to_a
- *  - Hash#to_a
- *  - MatchData#to_a
- *  - NilClass#to_a
- *  - OptionParser#to_a
- *  - Range#to_a
- *  - Set#to_a
- *  - Struct#to_a
- *  - Time#to_a
- *  - Benchmark::Tms#to_a
- *  - CSV::Table#to_a
- *  - Enumerator::Lazy#to_a
- *  - Gem::List#to_a
- *  - Gem::NameTuple#to_a
- *  - Gem::Platform#to_a
- *  - Gem::RequestSet::Lockfile::Tokenizer#to_a
- *  - Gem::SourceList#to_a
- *  - OpenSSL::X509::Extension#to_a
- *  - OpenSSL::X509::Name#to_a
- *  - Racc::ISet#to_a
- *  - Rinda::RingFinger#to_a
- *  - Ripper::Lexer::Elem#to_a
- *  - RubyVM::InstructionSequence#to_a
- *  - YAML::DBM#to_a
+ *	Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
  *
  *  == Example Usage
  *
  *  In addition to the methods it mixes in through the Enumerable module, the
- *  +Array+ class has proprietary methods for accessing, searching and otherwise
+ *  Array class has proprietary methods for accessing, searching and otherwise
  *  manipulating arrays.
  *
  *  Some of the more common ones are illustrated below.
@@ -8415,7 +6092,7 @@ rb_ary_deconstruct(VALUE ary)
  *
  *     arr.drop(3) #=> [4, 5, 6]
  *
- *  == Obtaining Information about an +Array+
+ *  == Obtaining Information about an Array
  *
  *  Arrays keep track of their own length at all times.  To query an array
  *  about the number of elements it contains, use #length, #count or #size.
@@ -8453,7 +6130,7 @@ rb_ary_deconstruct(VALUE ary)
  *     arr.insert(3, 'orange', 'pear', 'grapefruit')
  *     #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
  *
- *  == Removing Items from an +Array+
+ *  == Removing Items from an Array
  *
  *  The method #pop removes the last element in an array and returns it:
  *
@@ -8495,15 +6172,15 @@ rb_ary_deconstruct(VALUE ary)
  *
  *  == Iterating over Arrays
  *
- *  Like all classes that include the Enumerable module, +Array+ has an each
+ *  Like all classes that include the Enumerable module, Array has an each
  *  method, which defines what elements should be iterated over and how.  In
- *  case of Array's #each, all elements in the +Array+ instance are yielded to
+ *  case of Array's #each, all elements in the Array instance are yielded to
  *  the supplied block in sequence.
  *
  *  Note that this operation leaves the array unchanged.
  *
  *     arr = [1, 2, 3, 4, 5]
- *     arr.each {|a| print a -= 10, " "}
+ *     arr.each { |a| print a -= 10, " " }
  *     # prints: -9 -8 -7 -6 -5
  *     #=> [1, 2, 3, 4, 5]
  *
@@ -8512,19 +6189,18 @@ rb_ary_deconstruct(VALUE ary)
  *
  *     words = %w[first second third fourth fifth sixth]
  *     str = ""
- *     words.reverse_each {|word| str += "#{word} "}
+ *     words.reverse_each { |word| str += "#{word} " }
  *     p str #=> "sixth fifth fourth third second first "
  *
  *  The #map method can be used to create a new array based on the original
  *  array, but with the values modified by the supplied block:
  *
- *     arr.map {|a| 2*a}     #=> [2, 4, 6, 8, 10]
+ *     arr.map { |a| 2*a }   #=> [2, 4, 6, 8, 10]
  *     arr                   #=> [1, 2, 3, 4, 5]
- *     arr.map! {|a| a**2}   #=> [1, 4, 9, 16, 25]
+ *     arr.map! { |a| a**2 } #=> [1, 4, 9, 16, 25]
  *     arr                   #=> [1, 4, 9, 16, 25]
  *
- *
- *  == Selecting Items from an +Array+
+ *  == Selecting Items from an Array
  *
  *  Elements can be selected from an array according to criteria defined in a
  *  block.  The selection can happen in a destructive or a non-destructive
@@ -8535,9 +6211,9 @@ rb_ary_deconstruct(VALUE ary)
  *  === Non-destructive Selection
  *
  *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.select {|a| a > 3}       #=> [4, 5, 6]
- *     arr.reject {|a| a < 3}       #=> [3, 4, 5, 6]
- *     arr.drop_while {|a| a < 4}   #=> [4, 5, 6]
+ *     arr.select { |a| a > 3 }     #=> [4, 5, 6]
+ *     arr.reject { |a| a < 3 }     #=> [3, 4, 5, 6]
+ *     arr.drop_while { |a| a < 4 } #=> [4, 5, 6]
  *     arr                          #=> [1, 2, 3, 4, 5, 6]
  *
  *  === Destructive Selection
@@ -8548,190 +6224,25 @@ rb_ary_deconstruct(VALUE ary)
  *  Similar to #select vs. #reject, #delete_if and #keep_if have the exact
  *  opposite result when supplied with the same block:
  *
- *     arr.delete_if {|a| a < 4}   #=> [4, 5, 6]
+ *     arr.delete_if { |a| a < 4 } #=> [4, 5, 6]
  *     arr                         #=> [4, 5, 6]
  *
  *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.keep_if {|a| a < 4}   #=> [1, 2, 3]
+ *     arr.keep_if { |a| a < 4 } #=> [1, 2, 3]
  *     arr                       #=> [1, 2, 3]
  *
- *  == What's Here
- *
- *  First, what's elsewhere. \Class +Array+:
- *
- *  - Inherits from {class Object}[rdoc-ref:Object@What-27s+Here].
- *  - Includes {module Enumerable}[rdoc-ref:Enumerable@What-27s+Here],
- *    which provides dozens of additional methods.
- *
- *  Here, class +Array+ provides methods that are useful for:
- *
- *  - {Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array]
- *  - {Querying}[rdoc-ref:Array@Methods+for+Querying]
- *  - {Comparing}[rdoc-ref:Array@Methods+for+Comparing]
- *  - {Fetching}[rdoc-ref:Array@Methods+for+Fetching]
- *  - {Assigning}[rdoc-ref:Array@Methods+for+Assigning]
- *  - {Deleting}[rdoc-ref:Array@Methods+for+Deleting]
- *  - {Combining}[rdoc-ref:Array@Methods+for+Combining]
- *  - {Iterating}[rdoc-ref:Array@Methods+for+Iterating]
- *  - {Converting}[rdoc-ref:Array@Methods+for+Converting]
- *  - {And more....}[rdoc-ref:Array@Other+Methods]
- *
- *  === Methods for Creating an +Array+
- *
- *  - ::[]: Returns a new array populated with given objects.
- *  - ::new: Returns a new array.
- *  - ::try_convert: Returns a new array created from a given object.
- *
- *  See also {Creating Arrays}[rdoc-ref:Array@Creating+Arrays].
- *
- *  === Methods for Querying
- *
- *  - #all?: Returns whether all elements meet a given criterion.
- *  - #any?: Returns whether any element meets a given criterion.
- *  - #count: Returns the count of elements that meet a given criterion.
- *  - #empty?: Returns whether there are no elements.
- *  - #find_index (aliased as #index): Returns the index of the first element that meets a given criterion.
- *  - #hash: Returns the integer hash code.
- *  - #include?: Returns whether any element <tt>==</tt> a given object.
- *  - #length (aliased as #size): Returns the count of elements.
- *  - #none?: Returns whether no element <tt>==</tt> a given object.
- *  - #one?: Returns whether exactly one element <tt>==</tt> a given object.
- *  - #rindex: Returns the index of the last element that meets a given criterion.
- *
- *  === Methods for Comparing
- *
- *  - #<=>: Returns -1, 0, or 1, as +self+ is less than, equal to, or greater than a given object.
- *  - #==: Returns whether each element in +self+ is <tt>==</tt> to the corresponding element in a given object.
- *  - #eql?: Returns whether each element in +self+ is <tt>eql?</tt> to the corresponding element in a given object.
-
- *  === Methods for Fetching
- *
- *  These methods do not modify +self+.
- *
- *  - #[] (aliased as #slice): Returns consecutive elements as determined by a given argument.
- *  - #assoc: Returns the first element that is an array whose first element <tt>==</tt> a given object.
- *  - #at: Returns the element at a given offset.
- *  - #bsearch: Returns an element selected via a binary search as determined by a given block.
- *  - #bsearch_index: Returns the index of an element selected via a binary search as determined by a given block.
- *  - #compact: Returns an array containing all non-+nil+ elements.
- *  - #dig: Returns the object in nested objects that is specified by a given index and additional arguments.
- *  - #drop: Returns trailing elements as determined by a given index.
- *  - #drop_while: Returns trailing elements as determined by a given block.
- *  - #fetch: Returns the element at a given offset.
- *  - #fetch_values: Returns elements at given offsets.
- *  - #first: Returns one or more leading elements.
- *  - #last: Returns one or more trailing elements.
- *  - #max: Returns one or more maximum-valued elements, as determined by <tt>#<=></tt> or a given block.
- *  - #min: Returns one or more minimum-valued elements, as determined by <tt>#<=></tt> or a given block.
- *  - #minmax: Returns the minimum-valued and maximum-valued elements, as determined by <tt>#<=></tt> or a given block.
- *  - #rassoc: Returns the first element that is an array whose second element <tt>==</tt> a given object.
- *  - #reject: Returns an array containing elements not rejected by a given block.
- *  - #reverse: Returns all elements in reverse order.
- *  - #rotate: Returns all elements with some rotated from one end to the other.
- *  - #sample: Returns one or more random elements.
- *  - #select (aliased as #filter): Returns an array containing elements selected by a given block.
- *  - #shuffle: Returns elements in a random order.
- *  - #sort: Returns all elements in an order determined by <tt>#<=></tt> or a given block.
- *  - #take: Returns leading elements as determined by a given index.
- *  - #take_while: Returns leading elements as determined by a given block.
- *  - #uniq: Returns an array containing non-duplicate elements.
- *  - #values_at: Returns the elements at given offsets.
- *
- *  === Methods for Assigning
- *
- *  These methods add, replace, or reorder elements in +self+.
- *
- *  - #<<: Appends an element.
- *  - #[]=: Assigns specified elements with a given object.
- *  - #concat: Appends all elements from given arrays.
- *  - #fill: Replaces specified elements with specified objects.
- *  - #flatten!: Replaces each nested array in +self+ with the elements from that array.
- *  - #initialize_copy (aliased as #replace): Replaces the content of +self+ with the content of a given array.
- *  - #insert: Inserts given objects at a given offset; does not replace elements.
- *  - #push (aliased as #append): Appends elements.
- *  - #reverse!: Replaces +self+ with its elements reversed.
- *  - #rotate!: Replaces +self+ with its elements rotated.
- *  - #shuffle!: Replaces +self+ with its elements in random order.
- *  - #sort!: Replaces +self+ with its elements sorted, as determined by <tt>#<=></tt> or a given block.
- *  - #sort_by!: Replaces +self+ with its elements sorted, as determined by a given block.
- *  - #unshift (aliased as #prepend): Prepends leading elements.
- *
- *  === Methods for Deleting
- *
- *  Each of these methods removes elements from +self+:
- *
- *  - #clear: Removes all elements.
- *  - #compact!: Removes all +nil+ elements.
- *  - #delete: Removes elements equal to a given object.
- *  - #delete_at: Removes the element at a given offset.
- *  - #delete_if: Removes elements specified by a given block.
- *  - #keep_if: Removes elements not specified by a given block.
- *  - #pop: Removes and returns the last element.
- *  - #reject!: Removes elements specified by a given block.
- *  - #select! (aliased as #filter!): Removes elements not specified by a given block.
- *  - #shift:  Removes and returns the first element.
- *  - #slice!: Removes and returns a sequence of elements.
- *  - #uniq!: Removes duplicates.
- *
- *  === Methods for Combining
- *
- *  - #&: Returns an array containing elements found both in +self+ and a given array.
- *  - #+: Returns an array containing all elements of +self+ followed by all elements of a given array.
- *  - #-: Returns an array containing all elements of +self+ that are not found in a given array.
- *  - #|: Returns an array containing all element of +self+ and all elements of a given array, duplicates removed.
- *  - #difference: Returns an array containing all elements of +self+ that are not found in any of the given arrays..
- *  - #intersection: Returns an array containing elements found both in +self+ and in each given array.
- *  - #product: Returns or yields all combinations of elements from +self+ and given arrays.
- *  - #reverse: Returns an array containing all elements of +self+ in reverse order.
- *  - #union: Returns an array containing all elements of +self+ and all elements of given arrays, duplicates removed.
- *
- *  === Methods for Iterating
- *
- *  - #combination: Calls a given block with combinations of elements of +self+; a combination does not use the same element more than once.
- *  - #cycle: Calls a given block with each element, then does so again, for a specified number of times, or forever.
- *  - #each: Passes each element to a given block.
- *  - #each_index: Passes each element index to a given block.
- *  - #permutation: Calls a given block with permutations of elements of +self+; a permutation does not use the same element more than once.
- *  - #repeated_combination: Calls a given block with combinations of elements of +self+; a combination may use the same element more than once.
- *  - #repeated_permutation: Calls a given block with permutations of elements of +self+; a permutation may use the same element more than once.
- *  - #reverse_each:  Passes each element, in reverse order, to a given block.
- *
- *  === Methods for Converting
- *
- *  - #collect (aliased as #map): Returns an array containing the block return-value for each element.
- *  - #collect! (aliased as #map!): Replaces each element with a block return-value.
- *  - #flatten: Returns an array that is a recursive flattening of +self+.
- *  - #inspect (aliased as #to_s): Returns a new String containing the elements.
- *  - #join: Returns a newsString containing the elements joined by the field separator.
- *  - #to_a: Returns +self+ or a new array containing all elements.
- *  - #to_ary: Returns +self+.
- *  - #to_h: Returns a new hash formed from the elements.
- *  - #transpose: Transposes +self+, which must be an array of arrays.
- *  - #zip: Returns a new array of arrays containing +self+ and given arrays.
- *
- *  === Other Methods
- *
- *  - #*: Returns one of the following:
- *
- *    - With integer argument +n+, a new array that is the concatenation
- *      of +n+ copies of +self+.
- *    - With string argument +field_separator+, a new string that is equivalent to
- *      <tt>join(field_separator)</tt>.
- *
- *  - #pack: Packs the elements into a binary sequence.
- *  - #sum: Returns a sum of elements according to either <tt>+</tt> or a given block.
  */
 
 void
 Init_Array(void)
 {
-    fake_ary_flags = init_fake_ary_flags();
+#undef rb_intern
+#define rb_intern(str) rb_intern_const(str)
 
     rb_cArray  = rb_define_class("Array", rb_cObject);
     rb_include_module(rb_cArray, rb_mEnumerable);
 
     rb_define_alloc_func(rb_cArray, empty_ary_alloc);
-    rb_define_singleton_method(rb_cArray, "new", rb_ary_s_new, -1);
     rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
     rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
     rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
@@ -8742,6 +6253,7 @@ Init_Array(void)
     rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
     rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
     rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
+    rb_define_method(rb_cArray, "frozen?",  rb_ary_frozen_p, 0);
 
     rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
     rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
@@ -8751,11 +6263,9 @@ Init_Array(void)
     rb_define_method(rb_cArray, "[]=", rb_ary_aset, -1);
     rb_define_method(rb_cArray, "at", rb_ary_at, 1);
     rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
+    rb_define_method(rb_cArray, "first", rb_ary_first, -1);
+    rb_define_method(rb_cArray, "last", rb_ary_last, -1);
     rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
-    rb_define_method(rb_cArray, "union", rb_ary_union_multi, -1);
-    rb_define_method(rb_cArray, "difference", rb_ary_difference_multi, -1);
-    rb_define_method(rb_cArray, "intersection", rb_ary_intersection_multi, -1);
-    rb_define_method(rb_cArray, "intersect?", rb_ary_intersect_p, 1);
     rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
     rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
     rb_define_alias(rb_cArray,  "append", "push");
@@ -8768,7 +6278,7 @@ Init_Array(void)
     rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
     rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
     rb_define_method(rb_cArray, "length", rb_ary_length, 0);
-    rb_define_method(rb_cArray, "size", rb_ary_length, 0);
+    rb_define_alias(rb_cArray,  "size", "length");
     rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
     rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
     rb_define_method(rb_cArray, "index", rb_ary_index, -1);
@@ -8787,8 +6297,6 @@ Init_Array(void)
     rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
     rb_define_method(rb_cArray, "select", rb_ary_select, 0);
     rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
-    rb_define_method(rb_cArray, "filter", rb_ary_select, 0);
-    rb_define_method(rb_cArray, "filter!", rb_ary_select_bang, 0);
     rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
     rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
     rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
@@ -8819,7 +6327,6 @@ Init_Array(void)
 
     rb_define_method(rb_cArray, "max", rb_ary_max, -1);
     rb_define_method(rb_cArray, "min", rb_ary_min, -1);
-    rb_define_method(rb_cArray, "minmax", rb_ary_minmax, 0);
 
     rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
     rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
@@ -8828,6 +6335,9 @@ Init_Array(void)
     rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
     rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
     rb_define_method(rb_cArray, "count", rb_ary_count, -1);
+    rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
+    rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
+    rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
     rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
     rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
     rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
@@ -8842,17 +6352,8 @@ Init_Array(void)
     rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
     rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
     rb_define_method(rb_cArray, "any?", rb_ary_any_p, -1);
-    rb_define_method(rb_cArray, "all?", rb_ary_all_p, -1);
-    rb_define_method(rb_cArray, "none?", rb_ary_none_p, -1);
-    rb_define_method(rb_cArray, "one?", rb_ary_one_p, -1);
     rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
     rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
-    rb_define_method(rb_cArray, "freeze", rb_ary_freeze, 0);
-
-    rb_define_method(rb_cArray, "deconstruct", rb_ary_deconstruct, 0);
 
-    rb_cArray_empty_frozen = rb_ary_freeze(rb_ary_new());
-    rb_vm_register_global_object(rb_cArray_empty_frozen);
+    id_random = rb_intern("random");
 }
-
-#include "array.rbinc"
diff --git a/array.rb b/array.rb
deleted file mode 100644
index 2eaec6de20..0000000000
--- a/array.rb
+++ /dev/null
@@ -1,284 +0,0 @@
-class Array
-  # call-seq:
-  #   shuffle!(random: Random) -> self
-  #
-  # Shuffles all elements in +self+ into a random order,
-  # as selected by the object given by the keyword argument +random+.
-  # Returns +self+:
-  #
-  #   a =             [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
-  #   a.shuffle! # => [5, 3, 8, 7, 6, 1, 9, 4, 2, 0]
-  #   a.shuffle! # => [9, 4, 0, 6, 2, 8, 1, 5, 3, 7]
-  #
-  # Duplicate elements are included:
-  #
-  #   a =             [0, 1, 0, 1, 0, 1, 0, 1, 0, 1]
-  #   a.shuffle! # => [1, 0, 0, 1, 1, 0, 1, 0, 0, 1]
-  #   a.shuffle! # => [0, 1, 0, 1, 1, 0, 1, 0, 1, 0]
-  #
-  # The object given with the keyword argument +random+ is used as the random number generator.
-  #
-  # Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
-  def shuffle!(random: Random)
-    Primitive.rb_ary_shuffle_bang(random)
-  end
-
-  # call-seq:
-  #   shuffle(random: Random) -> new_array
-  #
-  # Returns a new array containing all elements from +self+ in a random order,
-  # as selected by the object given by the keyword argument +random+:
-  #
-  #   a =            [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
-  #   a.shuffle # => [0, 8, 1, 9, 6, 3, 4, 7, 2, 5]
-  #   a.shuffle # => [8, 9, 0, 5, 1, 2, 6, 4, 7, 3]
-  #
-  # Duplicate elements are included:
-  #
-  #   a =            [0, 1, 0, 1, 0, 1, 0, 1, 0, 1]
-  #   a.shuffle # => [1, 0, 1, 1, 0, 0, 1, 0, 0, 1]
-  #   a.shuffle # => [1, 1, 0, 0, 0, 1, 1, 0, 0, 1]
-  #
-  # The object given with the keyword argument +random+ is used as the random number generator.
-  #
-  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
-  def shuffle(random: Random)
-    Primitive.rb_ary_shuffle(random)
-  end
-
-  # call-seq:
-  #   sample(random: Random) -> object
-  #   sample(count, random: Random) -> new_ary
-  #
-  # Returns random elements from +self+,
-  # as selected by the object given by the keyword argument +random+.
-  #
-  # With no argument +count+ given, returns one random element from +self+:
-  #
-  #   a = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
-  #   a.sample # => 3
-  #   a.sample # => 8
-  #
-  # Returns +nil+ if +self+ is empty:
-  #
-  #   [].sample # => nil
-  #
-  # With a non-negative numeric argument +count+ given,
-  # returns a new array containing +count+ random elements from +self+:
-  #
-  #   a.sample(3) # => [8, 9, 2]
-  #   a.sample(6) # => [9, 6, 0, 3, 1, 4]
-  #
-  # The order of the result array is unrelated to the order of +self+.
-  #
-  # Returns a new empty +Array+ if +self+ is empty:
-  #
-  #   [].sample(4) # => []
-  #
-  # May return duplicates in +self+:
-  #
-  #   a = [1, 1, 1, 2, 2, 3]
-  #   a.sample(a.size) # => [1, 1, 3, 2, 1, 2]
-  #
-  # Returns no more than <tt>a.size</tt> elements
-  # (because no new duplicates are introduced):
-  #
-  #   a.sample(50) # => [6, 4, 1, 8, 5, 9, 0, 2, 3, 7]
-  #
-  # The object given with the keyword argument +random+ is used as the random number generator:
-  #
-  #   a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
-  #   a.sample(random: Random.new(1))     # => 6
-  #   a.sample(4, random: Random.new(1))  # => [6, 10, 9, 2]
-  #
-  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
-  def sample(n = (ary = false), random: Random)
-    if Primitive.mandatory_only?
-      # Primitive.cexpr! %{ rb_ary_sample(self, rb_cRandom, Qfalse, Qfalse) }
-      Primitive.ary_sample0
-    else
-      # Primitive.cexpr! %{ rb_ary_sample(self, random, n, ary) }
-      Primitive.ary_sample(random, n, ary)
-    end
-  end
-
-  # call-seq:
-  #   first -> object or nil
-  #   first(count) -> new_array
-  #
-  # Returns elements from +self+, or +nil+; does not modify +self+.
-  #
-  # With no argument given, returns the first element (if available):
-  #
-  #   a = [:foo, 'bar', 2]
-  #   a.first # => :foo
-  #   a # => [:foo, "bar", 2]
-  #
-  # If +self+ is empty, returns +nil+.
-  #
-  #   [].first # => nil
-  #
-  # With a non-negative integer argument +count+ given,
-  # returns the first +count+ elements (as available) in a new array:
-  #
-  #   a.first(0)  # => []
-  #   a.first(2)  # => [:foo, "bar"]
-  #   a.first(50) # => [:foo, "bar", 2]
-  #
-  # Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
-  def first n = unspecified = true
-    if Primitive.mandatory_only?
-      Primitive.attr! :leaf
-      Primitive.cexpr! %q{ ary_first(self) }
-    else
-      if unspecified
-        Primitive.cexpr! %q{ ary_first(self) }
-      else
-        Primitive.cexpr! %q{  ary_take_first_or_last_n(self, NUM2LONG(n), ARY_TAKE_FIRST) }
-      end
-    end
-  end
-
-  # call-seq:
-  #  last  -> last_object or nil
-  #  last(count) -> new_array
-  #
-  # Returns elements from +self+, or +nil+; +self+ is not modified.
-  #
-  # With no argument given, returns the last element, or +nil+ if +self+ is empty:
-  #
-  #   a = [:foo, 'bar', 2]
-  #   a.last # => 2
-  #   a # => [:foo, "bar", 2]
-  #   [].last # => nil
-  #
-  #
-  # With non-negative integer argument +count+ given,
-  # returns a new array containing the trailing +count+ elements of +self+, as available:
-  #
-  #   a = [:foo, 'bar', 2]
-  #   a.last(2)  # => ["bar", 2]
-  #   a.last(50) # => [:foo, "bar", 2]
-  #   a.last(0)  # => []
-  #   [].last(3) # => []
-  #
-  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
-  def last n = unspecified = true
-    if Primitive.mandatory_only?
-      Primitive.attr! :leaf
-      Primitive.cexpr! %q{ ary_last(self) }
-    else
-      if unspecified
-        Primitive.cexpr! %q{ ary_last(self) }
-      else
-        Primitive.cexpr! %q{ ary_take_first_or_last_n(self, NUM2LONG(n), ARY_TAKE_LAST) }
-      end
-    end
-  end
-
-  # call-seq:
-  #   fetch_values(*indexes) -> new_array
-  #   fetch_values(*indexes) { |index| ... } -> new_array
-  #
-  # With no block given, returns a new array containing the elements of +self+
-  # at the offsets specified by +indexes+. Each of the +indexes+ must be an
-  # {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]:
-  #
-  #    a = [:foo, :bar, :baz]
-  #    a.fetch_values(2, 0)   # => [:baz, :foo]
-  #    a.fetch_values(2.1, 0) # => [:baz, :foo]
-  #    a.fetch_values         # => []
-  #
-  # For a negative index, counts backwards from the end of the array:
-  #
-  #    a.fetch_values(-2, -1) # [:bar, :baz]
-  #
-  # When no block is given, raises an exception if any index is out of range.
-  #
-  # With a block given, for each index:
-  #
-  # - If the index is in range, uses an element of +self+ (as above).
-  # - Otherwise, calls the block with the index and uses the block's return value.
-  #
-  # Example:
-  #
-  #   a = [:foo, :bar, :baz]
-  #   a.fetch_values(1, 0, 42, 777) { |index| index.to_s }
-  #   # => [:bar, :foo, "42", "777"]
-  #
-  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
-  def fetch_values(*indexes, &block)
-    indexes.map! { |i| fetch(i, &block) }
-    indexes
-  end
-
-  with_yjit do
-    if Primitive.rb_builtin_basic_definition_p(:each)
-      undef :each
-
-      def each # :nodoc:
-        Primitive.attr! :inline_block, :c_trace
-
-        unless defined?(yield)
-          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
-        end
-        _i = 0
-        value = nil
-        while Primitive.cexpr!(%q{ ary_fetch_next(self, LOCAL_PTR(_i), LOCAL_PTR(value)) })
-          yield value
-        end
-        self
-      end
-    end
-
-    if Primitive.rb_builtin_basic_definition_p(:map)
-      undef :map
-
-      def map # :nodoc:
-        Primitive.attr! :inline_block, :c_trace
-
-        unless defined?(yield)
-          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
-        end
-
-        _i = 0
-        value = nil
-        result = Primitive.ary_sized_alloc
-        while Primitive.cexpr!(%q{ ary_fetch_next(self, LOCAL_PTR(_i), LOCAL_PTR(value)) })
-          result << yield(value)
-        end
-        result
-      end
-
-      if Primitive.rb_builtin_basic_definition_p(:collect)
-        undef :collect
-        alias collect map
-      end
-    end
-
-    if Primitive.rb_builtin_basic_definition_p(:select)
-      undef :select
-
-      def select # :nodoc:
-        Primitive.attr! :inline_block, :c_trace
-
-        unless defined?(yield)
-          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
-        end
-
-        _i = 0
-        value = nil
-        result = Primitive.ary_sized_alloc
-        while Primitive.cexpr!(%q{ ary_fetch_next(self, LOCAL_PTR(_i), LOCAL_PTR(value)) })
-          result << value if yield value
-        end
-        result
-      end
-
-      if Primitive.rb_builtin_basic_definition_p(:filter)
-        undef :filter
-        alias filter select
-      end
-    end
-  end
-end
diff --git a/ast.c b/ast.c
deleted file mode 100644
index a0c1801de1..0000000000
--- a/ast.c
+++ /dev/null
@@ -1,1059 +0,0 @@
-/* indent-tabs-mode: nil */
-#include "internal.h"
-#include "internal/ruby_parser.h"
-#include "internal/symbol.h"
-#include "internal/warnings.h"
-#include "iseq.h"
-#include "node.h"
-#include "ruby.h"
-#include "ruby/encoding.h"
-#include "ruby/util.h"
-#include "vm_core.h"
-
-#include "builtin.h"
-
-static VALUE rb_mAST;
-static VALUE rb_cNode;
-static VALUE rb_cLocation;
-
-struct ASTNodeData {
-    VALUE ast_value;
-    const NODE *node;
-};
-
-static void
-node_gc_mark(void *ptr)
-{
-    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
-    rb_gc_mark(data->ast_value);
-}
-
-static size_t
-node_memsize(const void *ptr)
-{
-    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
-    rb_ast_t *ast = rb_ruby_ast_data_get(data->ast_value);
-
-    return sizeof(struct ASTNodeData) + rb_ast_memsize(ast);
-}
-
-static const rb_data_type_t rb_node_type = {
-    "AST/node",
-    {node_gc_mark, RUBY_TYPED_DEFAULT_FREE, node_memsize,},
-    0, 0,
-    RUBY_TYPED_FREE_IMMEDIATELY,
-};
-
-struct ASTLocationData {
-    int first_lineno;
-    int first_column;
-    int last_lineno;
-    int last_column;
-};
-
-static void
-location_gc_mark(void *ptr)
-{
-}
-
-static size_t
-location_memsize(const void *ptr)
-{
-    return sizeof(struct ASTLocationData);
-}
-
-static const rb_data_type_t rb_location_type = {
-    "AST/location",
-    {location_gc_mark, RUBY_TYPED_DEFAULT_FREE, location_memsize,},
-    0, 0,
-    RUBY_TYPED_FREE_IMMEDIATELY,
-};
-
-
-static VALUE rb_ast_node_alloc(VALUE klass);
-
-static void
-setup_node(VALUE obj, VALUE ast_value, const NODE *node)
-{
-    struct ASTNodeData *data;
-
-    TypedData_Get_Struct(obj, struct ASTNodeData, &rb_node_type, data);
-    data->ast_value = ast_value;
-    data->node = node;
-}
-
-static VALUE
-ast_new_internal(VALUE ast_value, const NODE *node)
-{
-    VALUE obj;
-
-    obj = rb_ast_node_alloc(rb_cNode);
-    setup_node(obj, ast_value, node);
-
-    return obj;
-}
-
-static VALUE rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
-static VALUE rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
-
-static VALUE
-ast_parse_new(void)
-{
-    return rb_parser_set_context(rb_parser_new(), NULL, 0);
-}
-
-static VALUE
-ast_parse_done(VALUE ast_value)
-{
-    rb_ast_t *ast = rb_ruby_ast_data_get(ast_value);
-
-    if (!ast->body.root) {
-        rb_ast_dispose(ast);
-        rb_exc_raise(GET_EC()->errinfo);
-    }
-
-    return ast_new_internal(ast_value, (NODE *)ast->body.root);
-}
-
-static VALUE
-ast_s_parse(rb_execution_context_t *ec, VALUE module, VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
-{
-    return rb_ast_parse_str(str, keep_script_lines, error_tolerant, keep_tokens);
-}
-
-static VALUE
-rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
-{
-    VALUE ast_value;
-
-    StringValue(str);
-    VALUE vparser = ast_parse_new();
-    if (RTEST(keep_script_lines)) rb_parser_set_script_lines(vparser);
-    if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
-    if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
-    ast_value = rb_parser_compile_string_path(vparser, Qnil, str, 1);
-    return ast_parse_done(ast_value);
-}
-
-static VALUE
-ast_s_parse_file(rb_execution_context_t *ec, VALUE module, VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
-{
-    return rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
-}
-
-static VALUE
-rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
-{
-    VALUE f;
-    VALUE ast_value = Qnil;
-    rb_encoding *enc = rb_utf8_encoding();
-
-    f = rb_file_open_str(path, "r");
-    rb_funcall(f, rb_intern("set_encoding"), 2, rb_enc_from_encoding(enc), rb_str_new_cstr("-"));
-    VALUE vparser = ast_parse_new();
-    if (RTEST(keep_script_lines)) rb_parser_set_script_lines(vparser);
-    if (RTEST(error_tolerant))  rb_parser_error_tolerant(vparser);
-    if (RTEST(keep_tokens))  rb_parser_keep_tokens(vparser);
-    ast_value = rb_parser_compile_file_path(vparser, Qnil, f, 1);
-    rb_io_close(f);
-    return ast_parse_done(ast_value);
-}
-
-static VALUE
-rb_ast_parse_array(VALUE array, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
-{
-    VALUE ast_value = Qnil;
-
-    array = rb_check_array_type(array);
-    VALUE vparser = ast_parse_new();
-    if (RTEST(keep_script_lines)) rb_parser_set_script_lines(vparser);
-    if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
-    if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
-    ast_value = rb_parser_compile_array(vparser, Qnil, array, 1);
-    return ast_parse_done(ast_value);
-}
-
-static VALUE node_children(VALUE, const NODE*);
-
-static VALUE
-node_find(VALUE self, const int node_id)
-{
-    VALUE ary;
-    long i;
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    if (nd_node_id(data->node) == node_id) return self;
-
-    ary = node_children(data->ast_value, data->node);
-
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-        VALUE child = RARRAY_AREF(ary, i);
-
-        if (CLASS_OF(child) == rb_cNode) {
-            VALUE result = node_find(child, node_id);
-            if (RTEST(result)) return result;
-        }
-    }
-
-    return Qnil;
-}
-
-extern VALUE rb_e_script;
-
-static VALUE
-node_id_for_backtrace_location(rb_execution_context_t *ec, VALUE module, VALUE location)
-{
-    int node_id;
-
-    if (!rb_frame_info_p(location)) {
-        rb_raise(rb_eTypeError, "Thread::Backtrace::Location object expected");
-    }
-
-    node_id = rb_get_node_id_from_frame_info(location);
-    if (node_id == -1) {
-        return Qnil;
-    }
-
-    return INT2NUM(node_id);
-}
-
-static VALUE
-ast_s_of(rb_execution_context_t *ec, VALUE module, VALUE body, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
-{
-    VALUE node, lines = Qnil;
-    const rb_iseq_t *iseq;
-    int node_id;
-
-    if (rb_frame_info_p(body)) {
-        iseq = rb_get_iseq_from_frame_info(body);
-        node_id = rb_get_node_id_from_frame_info(body);
-    }
-    else {
-        iseq = NULL;
-
-        if (rb_obj_is_proc(body)) {
-            iseq = vm_proc_iseq(body);
-
-            if (!rb_obj_is_iseq((VALUE)iseq)) return Qnil;
-        }
-        else {
-            iseq = rb_method_iseq(body);
-        }
-        if (iseq) {
-            node_id = ISEQ_BODY(iseq)->location.node_id;
-        }
-    }
-
-    if (!iseq) {
-        return Qnil;
-    }
-
-    if (ISEQ_BODY(iseq)->prism) {
-        rb_raise(rb_eRuntimeError, "cannot get AST for ISEQ compiled by prism");
-    }
-
-    lines = ISEQ_BODY(iseq)->variable.script_lines;
-
-    VALUE path = rb_iseq_path(iseq);
-    int e_option = RSTRING_LEN(path) == 2 && memcmp(RSTRING_PTR(path), "-e", 2) == 0;
-
-    if (NIL_P(lines) && rb_iseq_from_eval_p(iseq) && !e_option) {
-        rb_raise(rb_eArgError, "cannot get AST for method defined in eval");
-    }
-
-    if (!NIL_P(lines)) {
-        node = rb_ast_parse_array(lines, keep_script_lines, error_tolerant, keep_tokens);
-    }
-    else if (e_option) {
-        node = rb_ast_parse_str(rb_e_script, keep_script_lines, error_tolerant, keep_tokens);
-    }
-    else {
-        node = rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
-    }
-
-    return node_find(node, node_id);
-}
-
-static VALUE
-rb_ast_node_alloc(VALUE klass)
-{
-    struct ASTNodeData *data;
-    VALUE obj = TypedData_Make_Struct(klass, struct ASTNodeData, &rb_node_type, data);
-
-    return obj;
-}
-
-static const char*
-node_type_to_str(const NODE *node)
-{
-    return (ruby_node_name(nd_type(node)) + rb_strlen_lit("NODE_"));
-}
-
-static VALUE
-ast_node_type(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return rb_sym_intern_ascii_cstr(node_type_to_str(data->node));
-}
-
-static VALUE
-ast_node_node_id(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return INT2FIX(nd_node_id(data->node));
-}
-
-#define NEW_CHILD(ast_value, node) (node ? ast_new_internal(ast_value, node) : Qnil)
-
-static VALUE
-rb_ary_new_from_node_args(VALUE ast_value, long n, ...)
-{
-    va_list ar;
-    VALUE ary;
-    long i;
-
-    ary = rb_ary_new2(n);
-
-    va_start(ar, n);
-    for (i=0; i<n; i++) {
-        NODE *node;
-        node = va_arg(ar, NODE *);
-        rb_ary_push(ary, NEW_CHILD(ast_value, node));
-    }
-    va_end(ar);
-    return ary;
-}
-
-static VALUE
-dump_block(VALUE ast_value, const struct RNode_BLOCK *node)
-{
-    VALUE ary = rb_ary_new();
-    do {
-        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
-    } while (node->nd_next &&
-        nd_type_p(node->nd_next, NODE_BLOCK) &&
-        (node = RNODE_BLOCK(node->nd_next), 1));
-    if (node->nd_next) {
-        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_next));
-    }
-
-    return ary;
-}
-
-static VALUE
-dump_array(VALUE ast_value, const struct RNode_LIST *node)
-{
-    VALUE ary = rb_ary_new();
-    rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
-
-    while (node->nd_next && nd_type_p(node->nd_next, NODE_LIST)) {
-        node = RNODE_LIST(node->nd_next);
-        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
-    }
-    rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_next));
-
-    return ary;
-}
-
-static VALUE
-dump_parser_array(VALUE ast_value, rb_parser_ary_t *p_ary)
-{
-    VALUE ary;
-
-    if (p_ary->data_type != PARSER_ARY_DATA_NODE) {
-        rb_bug("unexpected rb_parser_ary_data_type: %d", p_ary->data_type);
-    }
-
-    ary = rb_ary_new();
-
-    for (long i = 0; i < p_ary->len; i++) {
-        rb_ary_push(ary, NEW_CHILD(ast_value, p_ary->data[i]));
-    }
-
-    return ary;
-}
-
-static VALUE
-var_name(ID id)
-{
-    if (!id) return Qnil;
-    if (!rb_id2str(id)) return Qnil;
-    return ID2SYM(id);
-}
-
-static VALUE
-no_name_rest(void)
-{
-    ID rest;
-    CONST_ID(rest, "NODE_SPECIAL_NO_NAME_REST");
-    return ID2SYM(rest);
-}
-
-static VALUE
-rest_arg(VALUE ast_value, const NODE *rest_arg)
-{
-    return NODE_NAMED_REST_P(rest_arg) ? NEW_CHILD(ast_value, rest_arg) : no_name_rest();
-}
-
-static VALUE
-node_children(VALUE ast_value, const NODE *node)
-{
-    char name[sizeof("$") + DECIMAL_SIZE_OF(long)];
-
-    enum node_type type = nd_type(node);
-    switch (type) {
-      case NODE_BLOCK:
-        return dump_block(ast_value, RNODE_BLOCK(node));
-      case NODE_IF:
-        return rb_ary_new_from_node_args(ast_value, 3, RNODE_IF(node)->nd_cond, RNODE_IF(node)->nd_body, RNODE_IF(node)->nd_else);
-      case NODE_UNLESS:
-        return rb_ary_new_from_node_args(ast_value, 3, RNODE_UNLESS(node)->nd_cond, RNODE_UNLESS(node)->nd_body, RNODE_UNLESS(node)->nd_else);
-      case NODE_CASE:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE(node)->nd_head, RNODE_CASE(node)->nd_body);
-      case NODE_CASE2:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE2(node)->nd_head, RNODE_CASE2(node)->nd_body);
-      case NODE_CASE3:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE3(node)->nd_head, RNODE_CASE3(node)->nd_body);
-      case NODE_WHEN:
-        return rb_ary_new_from_node_args(ast_value, 3, RNODE_WHEN(node)->nd_head, RNODE_WHEN(node)->nd_body, RNODE_WHEN(node)->nd_next);
-      case NODE_IN:
-        return rb_ary_new_from_node_args(ast_value, 3, RNODE_IN(node)->nd_head, RNODE_IN(node)->nd_body, RNODE_IN(node)->nd_next);
-      case NODE_WHILE:
-      case NODE_UNTIL:
-        return rb_ary_push(rb_ary_new_from_node_args(ast_value, 2, RNODE_WHILE(node)->nd_cond, RNODE_WHILE(node)->nd_body),
-                           RBOOL(RNODE_WHILE(node)->nd_state));
-      case NODE_ITER:
-      case NODE_FOR:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ITER(node)->nd_iter, RNODE_ITER(node)->nd_body);
-      case NODE_FOR_MASGN:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_FOR_MASGN(node)->nd_var);
-      case NODE_BREAK:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_BREAK(node)->nd_stts);
-      case NODE_NEXT:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_NEXT(node)->nd_stts);
-      case NODE_RETURN:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_RETURN(node)->nd_stts);
-      case NODE_REDO:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_RETRY:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_BEGIN:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_BEGIN(node)->nd_body);
-      case NODE_RESCUE:
-        return rb_ary_new_from_node_args(ast_value, 3, RNODE_RESCUE(node)->nd_head, RNODE_RESCUE(node)->nd_resq, RNODE_RESCUE(node)->nd_else);
-      case NODE_RESBODY:
-        return rb_ary_new_from_node_args(ast_value, 4, RNODE_RESBODY(node)->nd_args, RNODE_RESBODY(node)->nd_exc_var, RNODE_RESBODY(node)->nd_body, RNODE_RESBODY(node)->nd_next);
-      case NODE_ENSURE:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ENSURE(node)->nd_head, RNODE_ENSURE(node)->nd_ensr);
-      case NODE_AND:
-      case NODE_OR:
-        {
-            VALUE ary = rb_ary_new();
-
-            while (1) {
-                rb_ary_push(ary, NEW_CHILD(ast_value, RNODE_AND(node)->nd_1st));
-                if (!RNODE_AND(node)->nd_2nd || !nd_type_p(RNODE_AND(node)->nd_2nd, type))
-                    break;
-                node = RNODE_AND(node)->nd_2nd;
-            }
-            rb_ary_push(ary, NEW_CHILD(ast_value, RNODE_AND(node)->nd_2nd));
-            return ary;
-        }
-      case NODE_MASGN:
-        if (NODE_NAMED_REST_P(RNODE_MASGN(node)->nd_args)) {
-            return rb_ary_new_from_node_args(ast_value, 3, RNODE_MASGN(node)->nd_value, RNODE_MASGN(node)->nd_head, RNODE_MASGN(node)->nd_args);
-        }
-        else {
-            return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_MASGN(node)->nd_value),
-                                        NEW_CHILD(ast_value, RNODE_MASGN(node)->nd_head),
-                                        no_name_rest());
-        }
-      case NODE_LASGN:
-        if (NODE_REQUIRED_KEYWORD_P(RNODE_LASGN(node)->nd_value)) {
-            return rb_ary_new_from_args(2, var_name(RNODE_LASGN(node)->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
-        }
-        return rb_ary_new_from_args(2, var_name(RNODE_LASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_LASGN(node)->nd_value));
-      case NODE_DASGN:
-        if (NODE_REQUIRED_KEYWORD_P(RNODE_DASGN(node)->nd_value)) {
-            return rb_ary_new_from_args(2, var_name(RNODE_DASGN(node)->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
-        }
-        return rb_ary_new_from_args(2, var_name(RNODE_DASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_DASGN(node)->nd_value));
-      case NODE_IASGN:
-        return rb_ary_new_from_args(2, var_name(RNODE_IASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_IASGN(node)->nd_value));
-      case NODE_CVASGN:
-        return rb_ary_new_from_args(2, var_name(RNODE_CVASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_CVASGN(node)->nd_value));
-      case NODE_GASGN:
-        return rb_ary_new_from_args(2, var_name(RNODE_GASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_GASGN(node)->nd_value));
-      case NODE_CDECL:
-        if (RNODE_CDECL(node)->nd_vid) {
-            return rb_ary_new_from_args(2, ID2SYM(RNODE_CDECL(node)->nd_vid), NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_value));
-        }
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_else), ID2SYM(RNODE_COLON2(RNODE_CDECL(node)->nd_else)->nd_mid), NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_value));
-      case NODE_OP_ASGN1:
-        return rb_ary_new_from_args(4, NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_recv),
-                                    ID2SYM(RNODE_OP_ASGN1(node)->nd_mid),
-                                    NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_index),
-                                    NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_rvalue));
-      case NODE_OP_ASGN2:
-        return rb_ary_new_from_args(5, NEW_CHILD(ast_value, RNODE_OP_ASGN2(node)->nd_recv),
-                                    RBOOL(RNODE_OP_ASGN2(node)->nd_aid),
-                                    ID2SYM(RNODE_OP_ASGN2(node)->nd_vid),
-                                    ID2SYM(RNODE_OP_ASGN2(node)->nd_mid),
-                                    NEW_CHILD(ast_value, RNODE_OP_ASGN2(node)->nd_value));
-      case NODE_OP_ASGN_AND:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_ASGN_AND(node)->nd_head), ID2SYM(idANDOP),
-                                    NEW_CHILD(ast_value, RNODE_OP_ASGN_AND(node)->nd_value));
-      case NODE_OP_ASGN_OR:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_ASGN_OR(node)->nd_head), ID2SYM(idOROP),
-                                    NEW_CHILD(ast_value, RNODE_OP_ASGN_OR(node)->nd_value));
-      case NODE_OP_CDECL:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_CDECL(node)->nd_head),
-                                    ID2SYM(RNODE_OP_CDECL(node)->nd_aid),
-                                    NEW_CHILD(ast_value, RNODE_OP_CDECL(node)->nd_value));
-      case NODE_CALL:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_CALL(node)->nd_recv),
-                                    ID2SYM(RNODE_CALL(node)->nd_mid),
-                                    NEW_CHILD(ast_value, RNODE_CALL(node)->nd_args));
-      case NODE_OPCALL:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OPCALL(node)->nd_recv),
-                                    ID2SYM(RNODE_OPCALL(node)->nd_mid),
-                                    NEW_CHILD(ast_value, RNODE_OPCALL(node)->nd_args));
-      case NODE_QCALL:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_QCALL(node)->nd_recv),
-                                    ID2SYM(RNODE_QCALL(node)->nd_mid),
-                                    NEW_CHILD(ast_value, RNODE_QCALL(node)->nd_args));
-      case NODE_FCALL:
-        return rb_ary_new_from_args(2, ID2SYM(RNODE_FCALL(node)->nd_mid),
-                                    NEW_CHILD(ast_value, RNODE_FCALL(node)->nd_args));
-      case NODE_VCALL:
-        return rb_ary_new_from_args(1, ID2SYM(RNODE_VCALL(node)->nd_mid));
-      case NODE_SUPER:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_SUPER(node)->nd_args);
-      case NODE_ZSUPER:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_LIST:
-        return dump_array(ast_value, RNODE_LIST(node));
-      case NODE_ZLIST:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_HASH:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_HASH(node)->nd_head);
-      case NODE_YIELD:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_YIELD(node)->nd_head);
-      case NODE_LVAR:
-        return rb_ary_new_from_args(1, var_name(RNODE_LVAR(node)->nd_vid));
-      case NODE_DVAR:
-        return rb_ary_new_from_args(1, var_name(RNODE_DVAR(node)->nd_vid));
-      case NODE_IVAR:
-        return rb_ary_new_from_args(1, ID2SYM(RNODE_IVAR(node)->nd_vid));
-      case NODE_CONST:
-        return rb_ary_new_from_args(1, ID2SYM(RNODE_CONST(node)->nd_vid));
-      case NODE_CVAR:
-        return rb_ary_new_from_args(1, ID2SYM(RNODE_CVAR(node)->nd_vid));
-      case NODE_GVAR:
-        return rb_ary_new_from_args(1, ID2SYM(RNODE_GVAR(node)->nd_vid));
-      case NODE_NTH_REF:
-        snprintf(name, sizeof(name), "$%ld", RNODE_NTH_REF(node)->nd_nth);
-        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
-      case NODE_BACK_REF:
-        name[0] = '$';
-        name[1] = (char)RNODE_BACK_REF(node)->nd_nth;
-        name[2] = '\0';
-        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
-      case NODE_MATCH:
-        return rb_ary_new_from_args(1, rb_node_regx_string_val(node));
-      case NODE_MATCH2:
-        if (RNODE_MATCH2(node)->nd_args) {
-            return rb_ary_new_from_node_args(ast_value, 3, RNODE_MATCH2(node)->nd_recv, RNODE_MATCH2(node)->nd_value, RNODE_MATCH2(node)->nd_args);
-        }
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MATCH2(node)->nd_recv, RNODE_MATCH2(node)->nd_value);
-      case NODE_MATCH3:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MATCH3(node)->nd_recv, RNODE_MATCH3(node)->nd_value);
-      case NODE_STR:
-      case NODE_XSTR:
-        return rb_ary_new_from_args(1, rb_node_str_string_val(node));
-      case NODE_INTEGER:
-        return rb_ary_new_from_args(1, rb_node_integer_literal_val(node));
-      case NODE_FLOAT:
-        return rb_ary_new_from_args(1, rb_node_float_literal_val(node));
-      case NODE_RATIONAL:
-        return rb_ary_new_from_args(1, rb_node_rational_literal_val(node));
-      case NODE_IMAGINARY:
-        return rb_ary_new_from_args(1, rb_node_imaginary_literal_val(node));
-      case NODE_REGX:
-        return rb_ary_new_from_args(1, rb_node_regx_string_val(node));
-      case NODE_ONCE:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_ONCE(node)->nd_body);
-      case NODE_DSTR:
-      case NODE_DXSTR:
-      case NODE_DREGX:
-      case NODE_DSYM:
-        {
-            struct RNode_LIST *n = RNODE_DSTR(node)->nd_next;
-            VALUE head = Qnil, next = Qnil;
-            if (n) {
-                head = NEW_CHILD(ast_value, n->nd_head);
-                next = NEW_CHILD(ast_value, n->nd_next);
-            }
-            return rb_ary_new_from_args(3, rb_node_dstr_string_val(node), head, next);
-        }
-      case NODE_SYM:
-        return rb_ary_new_from_args(1, rb_node_sym_string_val(node));
-      case NODE_EVSTR:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_EVSTR(node)->nd_body);
-      case NODE_ARGSCAT:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ARGSCAT(node)->nd_head, RNODE_ARGSCAT(node)->nd_body);
-      case NODE_ARGSPUSH:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ARGSPUSH(node)->nd_head, RNODE_ARGSPUSH(node)->nd_body);
-      case NODE_SPLAT:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_SPLAT(node)->nd_head);
-      case NODE_BLOCK_PASS:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_BLOCK_PASS(node)->nd_head, RNODE_BLOCK_PASS(node)->nd_body);
-      case NODE_DEFN:
-        return rb_ary_new_from_args(2, ID2SYM(RNODE_DEFN(node)->nd_mid), NEW_CHILD(ast_value, RNODE_DEFN(node)->nd_defn));
-      case NODE_DEFS:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_DEFS(node)->nd_recv), ID2SYM(RNODE_DEFS(node)->nd_mid), NEW_CHILD(ast_value, RNODE_DEFS(node)->nd_defn));
-      case NODE_ALIAS:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ALIAS(node)->nd_1st, RNODE_ALIAS(node)->nd_2nd);
-      case NODE_VALIAS:
-        return rb_ary_new_from_args(2, ID2SYM(RNODE_VALIAS(node)->nd_alias), ID2SYM(RNODE_VALIAS(node)->nd_orig));
-      case NODE_UNDEF:
-        return rb_ary_new_from_args(1, dump_parser_array(ast_value, RNODE_UNDEF(node)->nd_undefs));
-      case NODE_CLASS:
-        return rb_ary_new_from_node_args(ast_value, 3, RNODE_CLASS(node)->nd_cpath, RNODE_CLASS(node)->nd_super, RNODE_CLASS(node)->nd_body);
-      case NODE_MODULE:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MODULE(node)->nd_cpath, RNODE_MODULE(node)->nd_body);
-      case NODE_SCLASS:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_SCLASS(node)->nd_recv, RNODE_SCLASS(node)->nd_body);
-      case NODE_COLON2:
-        return rb_ary_new_from_args(2, NEW_CHILD(ast_value, RNODE_COLON2(node)->nd_head), ID2SYM(RNODE_COLON2(node)->nd_mid));
-      case NODE_COLON3:
-        return rb_ary_new_from_args(1, ID2SYM(RNODE_COLON3(node)->nd_mid));
-      case NODE_DOT2:
-      case NODE_DOT3:
-      case NODE_FLIP2:
-      case NODE_FLIP3:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_DOT2(node)->nd_beg, RNODE_DOT2(node)->nd_end);
-      case NODE_SELF:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_NIL:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_TRUE:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_FALSE:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_ERRINFO:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_DEFINED:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_DEFINED(node)->nd_head);
-      case NODE_POSTEXE:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_POSTEXE(node)->nd_body);
-      case NODE_ATTRASGN:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_ATTRASGN(node)->nd_recv), ID2SYM(RNODE_ATTRASGN(node)->nd_mid), NEW_CHILD(ast_value, RNODE_ATTRASGN(node)->nd_args));
-      case NODE_LAMBDA:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_LAMBDA(node)->nd_body);
-      case NODE_OPT_ARG:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_OPT_ARG(node)->nd_body, RNODE_OPT_ARG(node)->nd_next);
-      case NODE_KW_ARG:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_KW_ARG(node)->nd_body, RNODE_KW_ARG(node)->nd_next);
-      case NODE_POSTARG:
-        if (NODE_NAMED_REST_P(RNODE_POSTARG(node)->nd_1st)) {
-            return rb_ary_new_from_node_args(ast_value, 2, RNODE_POSTARG(node)->nd_1st, RNODE_POSTARG(node)->nd_2nd);
-        }
-        return rb_ary_new_from_args(2, no_name_rest(),
-                                    NEW_CHILD(ast_value, RNODE_POSTARG(node)->nd_2nd));
-      case NODE_ARGS:
-        {
-            struct rb_args_info *ainfo = &RNODE_ARGS(node)->nd_ainfo;
-            return rb_ary_new_from_args(10,
-                                        INT2NUM(ainfo->pre_args_num),
-                                        NEW_CHILD(ast_value, ainfo->pre_init),
-                                        NEW_CHILD(ast_value, (NODE *)ainfo->opt_args),
-                                        var_name(ainfo->first_post_arg),
-                                        INT2NUM(ainfo->post_args_num),
-                                        NEW_CHILD(ast_value, ainfo->post_init),
-                                        (ainfo->rest_arg == NODE_SPECIAL_EXCESSIVE_COMMA
-                                            ? ID2SYM(rb_intern("NODE_SPECIAL_EXCESSIVE_COMMA"))
-                                            : var_name(ainfo->rest_arg)),
-                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast_value, (NODE *)ainfo->kw_args)),
-                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast_value, ainfo->kw_rest_arg)),
-                                        var_name(ainfo->block_arg));
-        }
-      case NODE_SCOPE:
-        {
-            rb_ast_id_table_t *tbl = RNODE_SCOPE(node)->nd_tbl;
-            int i, size = tbl ? tbl->size : 0;
-            VALUE locals = rb_ary_new_capa(size);
-            for (i = 0; i < size; i++) {
-                rb_ary_push(locals, var_name(tbl->ids[i]));
-            }
-            return rb_ary_new_from_args(3, locals, NEW_CHILD(ast_value, (NODE *)RNODE_SCOPE(node)->nd_args), NEW_CHILD(ast_value, RNODE_SCOPE(node)->nd_body));
-        }
-      case NODE_ARYPTN:
-        {
-            VALUE rest = rest_arg(ast_value, RNODE_ARYPTN(node)->rest_arg);
-            return rb_ary_new_from_args(4,
-                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->nd_pconst),
-                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->pre_args),
-                                        rest,
-                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->post_args));
-        }
-      case NODE_FNDPTN:
-        {
-            VALUE pre_rest = rest_arg(ast_value, RNODE_FNDPTN(node)->pre_rest_arg);
-            VALUE post_rest = rest_arg(ast_value, RNODE_FNDPTN(node)->post_rest_arg);
-            return rb_ary_new_from_args(4,
-                                        NEW_CHILD(ast_value, RNODE_FNDPTN(node)->nd_pconst),
-                                        pre_rest,
-                                        NEW_CHILD(ast_value, RNODE_FNDPTN(node)->args),
-                                        post_rest);
-        }
-      case NODE_HSHPTN:
-        {
-            VALUE kwrest = RNODE_HSHPTN(node)->nd_pkwrestarg == NODE_SPECIAL_NO_REST_KEYWORD ? ID2SYM(rb_intern("NODE_SPECIAL_NO_REST_KEYWORD")) :
-                                                                                 NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pkwrestarg);
-
-            return rb_ary_new_from_args(3,
-                                        NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pconst),
-                                        NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pkwargs),
-                                        kwrest);
-        }
-      case NODE_LINE:
-        return rb_ary_new_from_args(1, rb_node_line_lineno_val(node));
-      case NODE_FILE:
-        return rb_ary_new_from_args(1, rb_node_file_path_val(node));
-      case NODE_ENCODING:
-        return rb_ary_new_from_args(1, rb_node_encoding_val(node));
-      case NODE_ERROR:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_ARGS_AUX:
-      case NODE_LAST:
-        break;
-    }
-
-    rb_bug("node_children: unknown node: %s", ruby_node_name(type));
-}
-
-static VALUE
-ast_node_children(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return node_children(data->ast_value, data->node);
-}
-
-static int
-null_loc_p(rb_code_location_t *loc)
-{
-    return (loc->beg_pos.lineno == 0 && loc->beg_pos.column == -1 && loc->end_pos.lineno == 0 && loc->end_pos.column == -1);
-}
-
-static VALUE
-location_new(rb_code_location_t *loc)
-{
-    VALUE obj;
-    struct ASTLocationData *data;
-
-    if (null_loc_p(loc)) return Qnil;
-
-    obj = TypedData_Make_Struct(rb_cLocation, struct ASTLocationData, &rb_location_type, data);
-    data->first_lineno = loc->beg_pos.lineno;
-    data->first_column = loc->beg_pos.column;
-    data->last_lineno = loc->end_pos.lineno;
-    data->last_column = loc->end_pos.column;
-
-    return obj;
-}
-
-static VALUE
-node_locations(VALUE ast_value, const NODE *node)
-{
-    enum node_type type = nd_type(node);
-    switch (type) {
-      case NODE_ALIAS:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_ALIAS(node)->keyword_loc));
-      case NODE_AND:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_AND(node)->operator_loc));
-      case NODE_BLOCK_PASS:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_BLOCK_PASS(node)->operator_loc));
-
-      case NODE_BREAK:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_BREAK(node)->keyword_loc));
-      case NODE_CASE:
-        return rb_ary_new_from_args(3,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_CASE(node)->case_keyword_loc),
-                                    location_new(&RNODE_CASE(node)->end_keyword_loc));
-      case NODE_CASE2:
-        return rb_ary_new_from_args(3,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_CASE2(node)->case_keyword_loc),
-                                    location_new(&RNODE_CASE2(node)->end_keyword_loc));
-      case NODE_CASE3:
-        return rb_ary_new_from_args(3,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_CASE3(node)->case_keyword_loc),
-                                    location_new(&RNODE_CASE3(node)->end_keyword_loc));
-      case NODE_NEXT:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_NEXT(node)->keyword_loc));
-      case NODE_OR:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_OR(node)->operator_loc));
-      case NODE_OP_ASGN1:
-        return rb_ary_new_from_args(5,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_OP_ASGN1(node)->call_operator_loc),
-                                    location_new(&RNODE_OP_ASGN1(node)->opening_loc),
-                                    location_new(&RNODE_OP_ASGN1(node)->closing_loc),
-                                    location_new(&RNODE_OP_ASGN1(node)->binary_operator_loc));
-      case NODE_OP_ASGN2:
-        return rb_ary_new_from_args(4,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_OP_ASGN2(node)->call_operator_loc),
-                                    location_new(&RNODE_OP_ASGN2(node)->message_loc),
-                                    location_new(&RNODE_OP_ASGN2(node)->binary_operator_loc));
-      case NODE_REDO:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_REDO(node)->keyword_loc));
-      case NODE_RETURN:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_RETURN(node)->keyword_loc));
-      case NODE_SPLAT:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_SPLAT(node)->operator_loc));
-      case NODE_UNDEF:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_UNDEF(node)->keyword_loc));
-      case NODE_UNLESS:
-        return rb_ary_new_from_args(4,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_UNLESS(node)->keyword_loc),
-                                    location_new(&RNODE_UNLESS(node)->then_keyword_loc),
-                                    location_new(&RNODE_UNLESS(node)->end_keyword_loc));
-      case NODE_VALIAS:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_VALIAS(node)->keyword_loc));
-      case NODE_WHEN:
-        return rb_ary_new_from_args(3,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_WHEN(node)->keyword_loc),
-                                    location_new(&RNODE_WHEN(node)->then_keyword_loc));
-      case NODE_WHILE:
-        return rb_ary_new_from_args(3,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_WHILE(node)->keyword_loc),
-                                    location_new(&RNODE_WHILE(node)->closing_loc));
-      case NODE_UNTIL:
-        return rb_ary_new_from_args(3,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_UNTIL(node)->keyword_loc),
-                                    location_new(&RNODE_UNTIL(node)->closing_loc));
-      case NODE_ARGS_AUX:
-      case NODE_LAST:
-        break;
-      default:
-        return rb_ary_new_from_args(1, location_new(nd_code_loc(node)));
-    }
-
-    rb_bug("node_locations: unknown node: %s", ruby_node_name(type));
-}
-
-static VALUE
-ast_node_locations(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return node_locations(data->ast_value, data->node);
-}
-
-static VALUE
-ast_node_first_lineno(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return INT2NUM(nd_first_lineno(data->node));
-}
-
-static VALUE
-ast_node_first_column(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return INT2NUM(nd_first_column(data->node));
-}
-
-static VALUE
-ast_node_last_lineno(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return INT2NUM(nd_last_lineno(data->node));
-}
-
-static VALUE
-ast_node_last_column(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return INT2NUM(nd_last_column(data->node));
-}
-
-static VALUE
-ast_node_all_tokens(rb_execution_context_t *ec, VALUE self)
-{
-    long i;
-    struct ASTNodeData *data;
-    rb_ast_t *ast;
-    rb_parser_ary_t *parser_tokens;
-    rb_parser_ast_token_t *parser_token;
-    VALUE str, loc, token, all_tokens;
-
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-    ast = rb_ruby_ast_data_get(data->ast_value);
-
-    parser_tokens = ast->node_buffer->tokens;
-    if (parser_tokens == NULL) {
-        return Qnil;
-    }
-
-    all_tokens = rb_ary_new2(parser_tokens->len);
-    for (i = 0; i < parser_tokens->len; i++) {
-        parser_token = parser_tokens->data[i];
-        str = rb_str_new(parser_token->str->ptr, parser_token->str->len);
-        loc = rb_ary_new_from_args(4,
-            INT2FIX(parser_token->loc.beg_pos.lineno),
-            INT2FIX(parser_token->loc.beg_pos.column),
-            INT2FIX(parser_token->loc.end_pos.lineno),
-            INT2FIX(parser_token->loc.end_pos.column)
-        );
-        token = rb_ary_new_from_args(4, INT2FIX(parser_token->id), ID2SYM(rb_intern(parser_token->type_name)), str, loc);
-        rb_ary_push(all_tokens, token);
-    }
-    rb_ary_freeze(all_tokens);
-
-    return all_tokens;
-}
-
-static VALUE
-ast_node_inspect(rb_execution_context_t *ec, VALUE self)
-{
-    VALUE str;
-    VALUE cname;
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    cname = rb_class_path(rb_obj_class(self));
-    str = rb_str_new2("#<");
-
-    rb_str_append(str, cname);
-    rb_str_catf(str, ":%s@%d:%d-%d:%d>",
-                node_type_to_str(data->node),
-                nd_first_lineno(data->node), nd_first_column(data->node),
-                nd_last_lineno(data->node), nd_last_column(data->node));
-
-    return str;
-}
-
-static VALUE
-ast_node_script_lines(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    rb_ast_t *ast;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-    ast = rb_ruby_ast_data_get(data->ast_value);
-    rb_parser_ary_t *ret = ast->body.script_lines;
-    return rb_parser_build_script_lines_from(ret);
-}
-
-static VALUE
-ast_location_first_lineno(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTLocationData *data;
-    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
-
-    return INT2NUM(data->first_lineno);
-}
-
-static VALUE
-ast_location_first_column(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTLocationData *data;
-    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
-
-    return INT2NUM(data->first_column);
-}
-
-static VALUE
-ast_location_last_lineno(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTLocationData *data;
-    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
-
-    return INT2NUM(data->last_lineno);
-}
-
-static VALUE
-ast_location_last_column(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTLocationData *data;
-    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
-
-    return INT2NUM(data->last_column);
-}
-
-static VALUE
-ast_location_inspect(rb_execution_context_t *ec, VALUE self)
-{
-    VALUE str;
-    VALUE cname;
-    struct ASTLocationData *data;
-    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
-
-    cname = rb_class_path(rb_obj_class(self));
-    str = rb_str_new2("#<");
-
-    rb_str_append(str, cname);
-    rb_str_catf(str, ":@%d:%d-%d:%d>",
-                data->first_lineno, data->first_column,
-                data->last_lineno, data->last_column);
-
-    return str;
-}
-
-#include "ast.rbinc"
-
-void
-Init_ast(void)
-{
-    rb_mAST = rb_define_module_under(rb_cRubyVM, "AbstractSyntaxTree");
-    rb_cNode = rb_define_class_under(rb_mAST, "Node", rb_cObject);
-    rb_cLocation = rb_define_class_under(rb_mAST, "Location", rb_cObject);
-    rb_undef_alloc_func(rb_cNode);
-    rb_undef_alloc_func(rb_cLocation);
-}
diff --git a/ast.rb b/ast.rb
deleted file mode 100644
index 6380621780..0000000000
--- a/ast.rb
+++ /dev/null
@@ -1,332 +0,0 @@
-# for ast.c
-
-# AbstractSyntaxTree provides methods to parse Ruby code into
-# abstract syntax trees. The nodes in the tree
-# are instances of RubyVM::AbstractSyntaxTree::Node.
-#
-# This module is MRI specific as it exposes implementation details
-# of the MRI abstract syntax tree.
-#
-# This module is experimental and its API is not stable, therefore it might
-# change without notice. As examples, the order of children nodes is not
-# guaranteed, the number of children nodes might change, there is no way to
-# access children nodes by name, etc.
-#
-# If you are looking for a stable API or an API working under multiple Ruby
-# implementations, consider using the _prism_ gem, which is the official
-# Ruby API to parse Ruby code.
-#
-module RubyVM::AbstractSyntaxTree
-
-  #  call-seq:
-  #     RubyVM::AbstractSyntaxTree.parse(string, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
-  #
-  #  Parses the given _string_ into an abstract syntax tree,
-  #  returning the root node of that tree.
-  #
-  #    RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
-  #    # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-1:9>
-  #
-  #  If <tt>keep_script_lines: true</tt> option is provided, the text of the parsed
-  #  source is associated with nodes and is available via Node#script_lines.
-  #
-  #  If <tt>keep_tokens: true</tt> option is provided, Node#tokens are populated.
-  #
-  #  SyntaxError is raised if the given _string_ is invalid syntax. To overwrite this
-  #  behavior, <tt>error_tolerant: true</tt> can be provided. In this case, the parser
-  #  will produce a tree where expressions with syntax errors would be represented by
-  #  Node with <tt>type=:ERROR</tt>.
-  #
-  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2")
-  #     # <internal:ast>:33:in `parse': syntax error, unexpected ';', expecting ')' (SyntaxError)
-  #     # x = 1; p(x; y=2
-  #     #           ^
-  #
-  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2", error_tolerant: true)
-  #     # (SCOPE@1:0-1:15
-  #     #  tbl: [:x, :y]
-  #     #  args: nil
-  #     #  body: (BLOCK@1:0-1:15 (LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)) (ERROR@1:7-1:11) (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))))
-  #     root.children.last.children
-  #     # [(LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)),
-  #     #  (ERROR@1:7-1:11),
-  #     #  (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))]
-  #
-  #  Note that parsing continues even after the errored expression.
-  #
-  def self.parse string, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
-    Primitive.ast_s_parse string, keep_script_lines, error_tolerant, keep_tokens
-  end
-
-  #  call-seq:
-  #     RubyVM::AbstractSyntaxTree.parse_file(pathname, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
-  #
-  #   Reads the file from _pathname_, then parses it like ::parse,
-  #   returning the root node of the abstract syntax tree.
-  #
-  #   SyntaxError is raised if _pathname_'s contents are not
-  #   valid Ruby syntax.
-  #
-  #     RubyVM::AbstractSyntaxTree.parse_file("my-app/app.rb")
-  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-31:3>
-  #
-  #   See ::parse for explanation of keyword argument meaning and usage.
-  def self.parse_file pathname, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
-    Primitive.ast_s_parse_file pathname, keep_script_lines, error_tolerant, keep_tokens
-  end
-
-  #  call-seq:
-  #     RubyVM::AbstractSyntaxTree.of(proc, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false)   -> RubyVM::AbstractSyntaxTree::Node
-  #     RubyVM::AbstractSyntaxTree.of(method, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
-  #
-  #   Returns AST nodes of the given _proc_ or _method_.
-  #
-  #     RubyVM::AbstractSyntaxTree.of(proc {1 + 2})
-  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:35-1:42>
-  #
-  #     def hello
-  #       puts "hello, world"
-  #     end
-  #
-  #     RubyVM::AbstractSyntaxTree.of(method(:hello))
-  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-3:3>
-  #
-  #   See ::parse for explanation of keyword argument meaning and usage.
-  def self.of body, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
-    Primitive.ast_s_of body, keep_script_lines, error_tolerant, keep_tokens
-  end
-
-  #  call-seq:
-  #     RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(backtrace_location)   -> integer
-  #
-  #   Returns the node id for the given backtrace location.
-  #
-  #     begin
-  #       raise
-  #     rescue =>  e
-  #       loc = e.backtrace_locations.first
-  #       RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(loc)
-  #     end # => 0
-  def self.node_id_for_backtrace_location backtrace_location
-    Primitive.node_id_for_backtrace_location backtrace_location
-  end
-
-  # RubyVM::AbstractSyntaxTree::Node instances are created by parse methods in
-  # RubyVM::AbstractSyntaxTree.
-  #
-  # This class is MRI specific.
-  #
-  class Node
-
-    #  call-seq:
-    #     node.type -> symbol
-    #
-    #  Returns the type of this node as a symbol.
-    #
-    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
-    #    root.type # => :SCOPE
-    #    lasgn = root.children[2]
-    #    lasgn.type # => :LASGN
-    #    call = lasgn.children[1]
-    #    call.type # => :OPCALL
-    def type
-      Primitive.ast_node_type
-    end
-
-    #  call-seq:
-    #     node.first_lineno -> integer
-    #
-    #  The line number in the source code where this AST's text began.
-    def first_lineno
-      Primitive.ast_node_first_lineno
-    end
-
-    #  call-seq:
-    #     node.first_column -> integer
-    #
-    #  The column number in the source code where this AST's text began.
-    def first_column
-      Primitive.ast_node_first_column
-    end
-
-    #  call-seq:
-    #     node.last_lineno -> integer
-    #
-    #  The line number in the source code where this AST's text ended.
-    def last_lineno
-      Primitive.ast_node_last_lineno
-    end
-
-    #  call-seq:
-    #     node.last_column -> integer
-    #
-    #  The column number in the source code where this AST's text ended.
-    def last_column
-      Primitive.ast_node_last_column
-    end
-
-    #  call-seq:
-    #     node.tokens -> array
-    #
-    #  Returns tokens corresponding to the location of the node.
-    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
-    #
-    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
-    #    root.tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
-    #    root.tokens.map{_1[2]}.join # => "x = 1 + 2"
-    #
-    #  Token is an array of:
-    #
-    #  - id
-    #  - token type
-    #  - source code text
-    #  - location [ first_lineno, first_column, last_lineno, last_column ]
-    def tokens
-      return nil unless all_tokens
-
-      all_tokens.each_with_object([]) do |token, a|
-        loc = token.last
-        if ([first_lineno, first_column] <=> [loc[0], loc[1]]) <= 0 &&
-           ([last_lineno, last_column]   <=> [loc[2], loc[3]]) >= 0
-           a << token
-        end
-      end
-    end
-
-    #  call-seq:
-    #     node.all_tokens -> array
-    #
-    #  Returns all tokens for the input script regardless the receiver node.
-    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
-    #
-    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
-    #    root.all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
-    #    root.children[-1].all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
-    def all_tokens
-      Primitive.ast_node_all_tokens
-    end
-
-    #  call-seq:
-    #     node.children -> array
-    #
-    #  Returns AST nodes under this one.  Each kind of node
-    #  has different children, depending on what kind of node it is.
-    #
-    #  The returned array may contain other nodes or <code>nil</code>.
-    def children
-      Primitive.ast_node_children
-    end
-
-    #  call-seq:
-    #     node.inspect -> string
-    #
-    #  Returns debugging information about this node as a string.
-    def inspect
-      Primitive.ast_node_inspect
-    end
-
-    #  call-seq:
-    #     node.node_id -> integer
-    #
-    #  Returns an internal node_id number.
-    #  Note that this is an API for ruby internal use, debugging,
-    #  and research. Do not use this for any other purpose.
-    #  The compatibility is not guaranteed.
-    def node_id
-      Primitive.ast_node_node_id
-    end
-
-    #  call-seq:
-    #     node.script_lines -> array
-    #
-    #  Returns the original source code as an array of lines.
-    #
-    #  Note that this is an API for ruby internal use, debugging,
-    #  and research. Do not use this for any other purpose.
-    #  The compatibility is not guaranteed.
-    def script_lines
-      Primitive.ast_node_script_lines
-    end
-
-    #  call-seq:
-    #     node.source -> string
-    #
-    #  Returns the code fragment that corresponds to this AST.
-    #
-    #  Note that this is an API for ruby internal use, debugging,
-    #  and research. Do not use this for any other purpose.
-    #  The compatibility is not guaranteed.
-    #
-    #  Also note that this API may return an incomplete code fragment
-    #  that does not parse; for example, a here document following
-    #  an expression may be dropped.
-    def source
-      lines = script_lines
-      if lines
-        lines = lines[first_lineno - 1 .. last_lineno - 1]
-        lines[-1] = lines[-1].byteslice(0...last_column)
-        lines[0] = lines[0].byteslice(first_column..-1)
-        lines.join
-      else
-        nil
-      end
-    end
-
-    #  call-seq:
-    #     node.locations -> array
-    #
-    #  Returns location objects associated with the AST node.
-    #  The returned array contains RubyVM::AbstractSyntaxTree::Location.
-    def locations
-      Primitive.ast_node_locations
-    end
-  end
-
-  # RubyVM::AbstractSyntaxTree::Location instances are created by
-  # RubyVM::AbstractSyntaxTree::Node#locations.
-  #
-  # This class is MRI specific.
-  #
-  class Location
-
-    #  call-seq:
-    #     location.first_lineno -> integer
-    #
-    #  The line number in the source code where this AST's text began.
-    def first_lineno
-      Primitive.ast_location_first_lineno
-    end
-
-    #  call-seq:
-    #     location.first_column -> integer
-    #
-    #  The column number in the source code where this AST's text began.
-    def first_column
-      Primitive.ast_location_first_column
-    end
-
-    #  call-seq:
-    #     location.last_lineno -> integer
-    #
-    #  The line number in the source code where this AST's text ended.
-    def last_lineno
-      Primitive.ast_location_last_lineno
-    end
-
-    #  call-seq:
-    #     location.last_column -> integer
-    #
-    #  The column number in the source code where this AST's text ended.
-    def last_column
-      Primitive.ast_location_last_column
-    end
-
-    #  call-seq:
-    #     location.inspect -> string
-    #
-    #  Returns debugging information about this location as a string.
-    def inspect
-      Primitive.ast_location_inspect
-    end
-  end
-end
diff --git a/autogen.sh b/autogen.sh
deleted file mode 100755
index f8cdf3c0c1..0000000000
--- a/autogen.sh
+++ /dev/null
@@ -1,17 +0,0 @@
-#!/bin/sh
-
-PWD=
-case "$0" in
-*/*) srcdir=`dirname $0`;;
-*) srcdir="";;
-esac
-
-symlink='--install --symlink'
-case " $* " in
-    *" -i "*|*" --install "*)
-        # reset to copy missing standard auxiliary files, instead of symlinks
-        symlink=
-        ;;
-esac
-
-exec ${AUTORECONF:-autoreconf} ${symlink} "$@" ${srcdir:+"$srcdir"}
diff --git a/basictest/test.rb b/basictest/test.rb
index 711e4f4ab3..25d52ca1ef 100755
--- a/basictest/test.rb
+++ b/basictest/test.rb
@@ -35,7 +35,7 @@ class Progress
       # dircolors-like style
       colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
       begin
-        File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
+        File.read(File.join(__dir__, "../test/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
           colors[n] ||= c
         end
       rescue
@@ -879,7 +879,7 @@ $x.sort!{|a,b| b-a}		# reverse sort
 test_ok($x == [7,5,3,2,1])
 
 # split test
-$x = +"The Book of Mormon"
+$x = "The Book of Mormon"
 test_ok($x.split(//).reverse!.join == $x.reverse)
 test_ok($x.reverse == $x.reverse!)
 test_ok("1 byte string".split(//).reverse.join(":") == "g:n:i:r:t:s: :e:t:y:b: :1")
@@ -984,6 +984,13 @@ test_ok($z == 0)
 
 test_check "iterator"
 
+test_ok(!iterator?)
+
+def ttt
+  test_ok(iterator?)
+end
+ttt{}
+
 # yield at top level
 test_ok(!defined?(yield))
 
@@ -1425,6 +1432,9 @@ marity_test(:test_ok)
 marity_test(:marity_test)
 marity_test(:p)
 
+lambda(&method(:test_ok)).call(true)
+lambda(&block_get{|a,n| test_ok(a,n)}).call(true, 2)
+
 class ITER_TEST1
    def a
      block_given?
@@ -1643,7 +1653,7 @@ test_ok(/^(?:ab+)+/ =~ "ababb" && $& == "ababb")
 test_ok(/(\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
 test_ok(/(?:\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
 
-$x = +<<END;
+$x = <<END;
 ABCD
 ABCD
 END
@@ -1682,12 +1692,12 @@ test_ok(?a == ?a)
 test_ok(?\C-a == "\1")
 test_ok(?\M-a == "\341")
 test_ok(?\M-\C-a == "\201")
-test_ok("a".dup.upcase![0] == ?A)
-test_ok("A".dup.downcase![0] == ?a)
-test_ok("abc".dup.tr!("a-z", "A-Z") == "ABC")
-test_ok("aabbcccc".dup.tr_s!("a-z", "A-Z") == "ABC")
-test_ok("abcc".dup.squeeze!("a-z") == "abc")
-test_ok("abcd".dup.delete!("bc") == "ad")
+test_ok("a".upcase![0] == ?A)
+test_ok("A".downcase![0] == ?a)
+test_ok("abc".tr!("a-z", "A-Z") == "ABC")
+test_ok("aabbcccc".tr_s!("a-z", "A-Z") == "ABC")
+test_ok("abcc".squeeze!("a-z") == "abc")
+test_ok("abcd".delete!("bc") == "ad")
 
 $x = "abcdef"
 $y = [ ?a, ?b, ?c, ?d, ?e, ?f ]
@@ -1700,7 +1710,7 @@ $x.each_byte {|i|
 }
 test_ok(!$bad)
 
-s = +"a string"
+s = "a string"
 s[0..s.size]="another string"
 test_ok(s == "another string")
 
@@ -1729,7 +1739,7 @@ a = nil
 test_ok(defined?(a))
 test_ok(a == nil)
 
-# multiple assignment
+# multiple asignment
 a, b = 1, 2
 test_ok(a == 1 && b == 2)
 
@@ -1960,8 +1970,6 @@ test_ok(p1.call == 5)
 test_ok(i7 == nil)
 end
 
-# WASI doesn't support spawning a new process for now.
-unless /wasi/ =~ RUBY_PLATFORM
 test_check "system"
 test_ok(`echo foobar` == "foobar\n")
 test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
@@ -2012,7 +2020,6 @@ test_ok(done)
 
 File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
 File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
-end # not /wasi/ =~ RUBY_PLATFORM
 
 test_check "const"
 TEST1 = 1
@@ -2140,7 +2147,7 @@ $_ = foobar
 test_ok($_ == foobar)
 
 class Gods
-  @@rule = "Uranus"
+  @@rule = "Uranus"		# private to Gods
   def ruler0
     @@rule
   end
@@ -2163,7 +2170,7 @@ module Olympians
 end
 
 class Titans < Gods
-  @@rule = "Cronus"		# modifies @@rule in Gods
+  @@rule = "Cronus"		# do not affect @@rule in Gods
   include Olympians
   def ruler4
     @@rule
@@ -2178,14 +2185,7 @@ test_ok(Titans.ruler2 == "Cronus")
 atlas = Titans.new
 test_ok(atlas.ruler0 == "Cronus")
 test_ok(atlas.ruler3 == "Zeus")
-begin
-  atlas.ruler4
-rescue RuntimeError => e
-  test_ok(e.message.include?("class variable @@rule of Olympians is overtaken by Gods"))
-else
-  test_ok(false)
-end
-test_ok(atlas.ruler3 == "Zeus")
+test_ok(atlas.ruler4 == "Cronus")
 
 test_check "trace"
 $x = 1234
diff --git a/benchmark/README.md b/benchmark/README.md
deleted file mode 100644
index c5c29d0daf..0000000000
--- a/benchmark/README.md
+++ /dev/null
@@ -1,75 +0,0 @@
-# ruby/benchmark
-
-This directory has benchmark definitions to be run with
-[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
-
-## Normal usage
-
-Execute `gem install benchmark_driver` and run a command like:
-
-```bash
-# Run a benchmark script with the ruby in the $PATH
-benchmark-driver benchmark/app_fib.rb
-
-# Run benchmark scripts with multiple Ruby executables or options
-benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
-
-# Or compare Ruby versions managed by rbenv
-benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
-
-# You can collect many metrics in many ways
-benchmark-driver benchmark/*.rb --runner memory --output markdown
-
-# Some are defined with YAML for complex setup or accurate measurement
-benchmark-driver benchmark/*.yml
-```
-
-See also:
-
-```console
-benchmark-driver --help
-Usage: benchmark-driver [options] RUBY|YAML...
-    -r, --runner TYPE                Specify runner type: ips, time, memory, once, block (default: ips)
-    -o, --output TYPE                Specify output type: compare, simple, markdown, record, all (default: compare)
-    -e, --executables EXECS          Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
-        --rbenv VERSIONS             Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
-        --repeat-count NUM           Try benchmark NUM times and use the fastest result or the worst memory usage
-        --repeat-result TYPE         Yield "best", "average" or "worst" result with --repeat-count (default: best)
-        --alternate                  Alternate executables instead of running the same executable in a row with --repeat-count
-        --bundler                    Install and use gems specified in Gemfile
-        --filter REGEXP              Filter out benchmarks with given regexp
-        --run-duration SECONDS       Warmup estimates loop_count to run for this duration (default: 3)
-        --timeout SECONDS            Timeout ruby command execution with timeout(1)
-    -v, --verbose                    Verbose mode. Multiple -v options increase visilibity (max: 2)
-```
-
-## make benchmark
-
-Using `make benchmark`, `make update-benchmark-driver` automatically downloads
-the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
-benchmark\_driver.
-
-```bash
-# Run all benchmarks with the ruby in the $PATH and the built ruby
-make benchmark
-
-# Or compare with specific ruby binary
-make benchmark COMPARE_RUBY="/path/to/ruby --jit"
-
-# Run vm benchmarks
-make benchmark ITEM=vm
-
-# Run some limited benchmarks in ITEM-matched files
-make benchmark ITEM=vm OPTS=--filter=block
-
-# You can specify the benchmark by an exact filename instead of using the default argument:
-# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
-make benchmark ARGS=benchmark/erb_render.yml
-
-# You can specify any option via $OPTS
-make benchmark OPTS="--help"
-
-# With `make benchmark`, some special runner plugins are available:
-#   -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
-make benchmark ITEM=vm_bigarray OPTS="-r peak"
-```
diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb
deleted file mode 100644
index c1546e08ab..0000000000
--- a/benchmark/app_aobench.rb
+++ /dev/null
@@ -1,297 +0,0 @@
-# coding: US-ASCII
-
-# AO render benchmark
-# Original program (C) Syoyo Fujita in Javascript (and other languages)
-#      https://code.google.com/p/aobench/
-# Ruby(yarv2llvm) version by Hideki Miura
-#
-
-IMAGE_WIDTH = 256
-IMAGE_HEIGHT = 256
-NSUBSAMPLES = 2
-NAO_SAMPLES = 8
-
-srand(0)
-
-class Vec
-  def initialize(x, y, z)
-    @x = x
-    @y = y
-    @z = z
-  end
-
-  attr_accessor :x, :y, :z
-
-  def vadd(b)
-    Vec.new(@x + b.x, @y + b.y, @z + b.z)
-  end
-
-  def vsub(b)
-    Vec.new(@x - b.x, @y - b.y, @z - b.z)
-  end
-
-  def vcross(b)
-    Vec.new(@y * b.z - @z * b.y,
-            @z * b.x - @x * b.z,
-            @x * b.y - @y * b.x)
-  end
-
-  def vdot(b)
-    @x * b.x + @y * b.y + @z * b.z
-  end
-
-  def vlength
-    Math.sqrt(@x * @x + @y * @y + @z * @z)
-  end
-
-  def vnormalize
-    len = vlength
-    v = Vec.new(@x, @y, @z)
-    if len > 1.0e-17 then
-      v.x = v.x / len
-      v.y = v.y / len
-      v.z = v.z / len
-    end
-    v
-  end
-end
-
-
-class Sphere
-  def initialize(center, radius)
-    @center = center
-    @radius = radius
-  end
-
-  attr_reader :center, :radius
-
-  def intersect(ray, isect)
-    rs = ray.org.vsub(@center)
-    b = rs.vdot(ray.dir)
-    c = rs.vdot(rs) - (@radius * @radius)
-    d = b * b - c
-    if d > 0.0 then
-      t = - b - Math.sqrt(d)
-
-      if t > 0.0 and t < isect.t then
-        isect.t = t
-        isect.hit = true
-        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
-                          ray.org.y + ray.dir.y * t,
-                          ray.org.z + ray.dir.z * t)
-        n = isect.pl.vsub(@center)
-        isect.n = n.vnormalize
-      else
-        0.0
-      end
-    end
-    nil
-  end
-end
-
-class Plane
-  def initialize(p, n)
-    @p = p
-    @n = n
-  end
-
-  def intersect(ray, isect)
-    d = -@p.vdot(@n)
-    v = ray.dir.vdot(@n)
-    v0 = v
-    if v < 0.0 then
-      v0 = -v
-    end
-    if v0 < 1.0e-17 then
-      return
-    end
-
-    t = -(ray.org.vdot(@n) + d) / v
-
-    if t > 0.0 and t < isect.t then
-      isect.hit = true
-      isect.t = t
-      isect.n = @n
-      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
-                        ray.org.y + t * ray.dir.y,
-                        ray.org.z + t * ray.dir.z)
-    end
-    nil
-  end
-end
-
-class Ray
-  def initialize(org, dir)
-    @org = org
-    @dir = dir
-  end
-
-  attr_accessor :org, :dir
-end
-
-class Isect
-  def initialize
-    @t = 10000000.0
-    @hit = false
-    @pl = Vec.new(0.0, 0.0, 0.0)
-    @n = Vec.new(0.0, 0.0, 0.0)
-  end
-
-  attr_accessor :t, :hit, :pl, :n
-end
-
-def clamp(f)
-  i = f * 255.5
-  if i > 255.0 then
-    i = 255.0
-  end
-  if i < 0.0 then
-    i = 0.0
-  end
-  i.to_i
-end
-
-def orthoBasis(basis, n)
-  basis[2] = Vec.new(n.x, n.y, n.z)
-  basis[1] = Vec.new(0.0, 0.0, 0.0)
-
-  if n.x < 0.6 and n.x > -0.6 then
-    basis[1].x = 1.0
-  elsif n.y < 0.6 and n.y > -0.6 then
-    basis[1].y = 1.0
-  elsif n.z < 0.6 and n.z > -0.6 then
-    basis[1].z = 1.0
-  else
-    basis[1].x = 1.0
-  end
-
-  basis[0] = basis[1].vcross(basis[2])
-  basis[0] = basis[0].vnormalize
-
-  basis[1] = basis[2].vcross(basis[0])
-  basis[1] = basis[1].vnormalize
-end
-
-class Scene
-  def initialize
-    @spheres = Array.new
-    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
-    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
-    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
-    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
-  end
-
-  def ambient_occlusion(isect)
-    basis = Array.new
-    orthoBasis(basis, isect.n)
-
-    ntheta    = NAO_SAMPLES
-    nphi      = NAO_SAMPLES
-    eps       = 0.0001
-    occlusion = 0.0
-
-    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
-                isect.pl.y + eps * isect.n.y,
-                isect.pl.z + eps * isect.n.z)
-    nphi.times do |j|
-      ntheta.times do |i|
-        r = rand
-        phi = 2.0 * 3.14159265 * rand
-        x = Math.cos(phi) * Math.sqrt(1.0 - r)
-        y = Math.sin(phi) * Math.sqrt(1.0 - r)
-        z = Math.sqrt(r)
-
-        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
-        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
-        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
-
-        raydir = Vec.new(rx, ry, rz)
-        ray = Ray.new(p0, raydir)
-
-        occisect = Isect.new
-        @spheres[0].intersect(ray, occisect)
-        @spheres[1].intersect(ray, occisect)
-        @spheres[2].intersect(ray, occisect)
-        @plane.intersect(ray, occisect)
-        if occisect.hit then
-          occlusion = occlusion + 1.0
-        else
-          0.0
-        end
-      end
-    end
-
-    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
-
-    Vec.new(occlusion, occlusion, occlusion)
-  end
-
-  def render(w, h, nsubsamples)
-    cnt = 0
-    nsf = nsubsamples.to_f
-    h.times do |y|
-      w.times do |x|
-        rad = Vec.new(0.0, 0.0, 0.0)
-
-        # Subsampling
-        nsubsamples.times do |v|
-          nsubsamples.times do |u|
-
-            cnt = cnt + 1
-            wf = w.to_f
-            hf = h.to_f
-            xf = x.to_f
-            yf = y.to_f
-            uf = u.to_f
-            vf = v.to_f
-
-            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
-            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
-
-            eye = Vec.new(px, py, -1.0).vnormalize
-
-            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
-
-            isect = Isect.new
-            @spheres[0].intersect(ray, isect)
-            @spheres[1].intersect(ray, isect)
-            @spheres[2].intersect(ray, isect)
-            @plane.intersect(ray, isect)
-            if isect.hit then
-              col = ambient_occlusion(isect)
-              rad.x = rad.x + col.x
-              rad.y = rad.y + col.y
-              rad.z = rad.z + col.z
-            end
-          end
-        end
-
-        r = rad.x / (nsf * nsf)
-        g = rad.y / (nsf * nsf)
-        b = rad.z / (nsf * nsf)
-        printf("%c", clamp(r))
-        printf("%c", clamp(g))
-        printf("%c", clamp(b))
-      end
-      nil
-    end
-
-    nil
-  end
-end
-
-alias printf_orig printf
-def printf *args
-  # $fp.printf(*args)
-end
-
-# File.open("ao.ppm", "w") do |fp|
-  # $fp = fp
-  printf("P6\n")
-  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
-  printf("255\n")
-  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
-# end
-
-undef printf
-alias printf printf_orig
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
deleted file mode 100644
index 31e29b7644..0000000000
--- a/benchmark/app_erb.yml
+++ /dev/null
@@ -1,23 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-prelude: |
-  require 'erb'
-
-  data = <<erb
-  <html>
-    <head> <%= title %> </head>
-    <body>
-      <h1> <%= title %> </h1>
-      <p>
-        <%= content %>
-      </p>
-    </body>
-  </html>
-  erb
-
-  title = "hello world!"
-  content = "hello world!\n" * 10
-benchmark:
-  app_erb: ERB.new(data).result(binding)
-loop_count: 15000
diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb
deleted file mode 100644
index 47be7b203f..0000000000
--- a/benchmark/app_pentomino.rb
+++ /dev/null
@@ -1,130 +0,0 @@
-#!/usr/local/bin/ruby
-# This program is contributed by Shin Nishiyama
-
-
-# modified by K.Sasada
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n, a, nb)
-  nb.each{|x|
-    a[n] = x
-    if n == NP-1
-      $p << [a.sort]
-    else
-      nbc=nb.dup
-      [-ROW, -1, 1, ROW].each{|d|
-        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
-          nbc << x+d
-        end
-      }
-      nbc.delete x
-      piece(n+1,a[0..n],nbc)
-    end
-  }
-end
-
-def kikaku(a)
-  a.collect {|x| x - a[0]}
-end
-def ud(a)
-  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
-  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
-  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
-  piece(0,[],[0])
-  $p.each do |a|
-    a0 = a[0]
-    a[1] = ud(a0)
-    a[2] = rl(a0)
-    a[3] = ud(rl(a0))
-    a[4] = xy(a0)
-    a[5] = ud(xy(a0))
-    a[6] = rl(xy(a0))
-    a[7] = ud(rl(xy(a0)))
-    a.sort!
-    a.uniq!
-  end
-  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
-  (0...ROW*COL).each{|i|
-    if i % ROW >= ROW-NP
-      $b[i] = -2
-    else
-      $b[i] = -1
-    end
-    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
-  }
-end
-
-def pboard
-  return # skip print
-  print "No. #$no\n"
-  (0...COL).each{|i|
-    print "|"
-    (0...ROW-NP).each{|j|
-      x = $b[i*ROW+j]
-      if x < 0
-        print "..|"
-      else
-        printf "%2d|",x+1
-      end
-    }
-    print "\n"
-  }
-  print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
-  if a.length == $p.length then
-    $no += 1
-    pboard
-    return
-  end
-  while $b[pos] != -1
-    pos += 1
-  end
-  ($pnum - a).each do |i|
-    $p[i].each do |x|
-      f = 0
-      x.each{|s|
-        if $b[pos+s] != -1
-          f=1
-          break
-        end
-      }
-      if f == 0 then
-        x.each{|s|
-          $b[pos+s] = i
-        }
-        a << i
-        setpiece(a.dup, pos)
-        a.pop
-        x.each{|s|
-          $b[pos+s] = -1
-        }
-      end
-    end
-  end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
deleted file mode 100644
index 88ef544ba0..0000000000
--- a/benchmark/array_flatten.yml
+++ /dev/null
@@ -1,19 +0,0 @@
-prelude: |
-  small_flat_ary = 5.times.to_a
-  large_flat_ary = 100.times.to_a
-  small_pairs_ary = [[1, 2]] * 5
-  large_pairs_ary = [[1, 2]] * 100
-  mostly_flat_ary = 100.times.to_a.push([101, 102])
-
-benchmark:
-  small_flat_ary.flatten: small_flat_ary.flatten
-  small_flat_ary.flatten!: small_flat_ary.flatten!
-  large_flat_ary.flatten: large_flat_ary.flatten
-  large_flat_ary.flatten!: large_flat_ary.flatten!
-  small_pairs_ary.flatten: small_pairs_ary.flatten
-  small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
-  large_pairs_ary.flatten: large_pairs_ary.flatten
-  large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
-  mostly_flat_ary.flatten: mostly_flat_ary.flatten
-  mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
-loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
deleted file mode 100644
index 26705323fd..0000000000
--- a/benchmark/array_intersection.yml
+++ /dev/null
@@ -1,14 +0,0 @@
-prelude: |
-  small1 = [1, 2, 3]
-  small2 = [1, 2, 3, 4, 5]
-  small3 = [2, 3, 4, 5]
-  small4 = [2]
-  big1 = [1, 2, 3, 4] * 64
-  big2 = [1, 2, 3] * 64
-  big3 = [1, 2] * 64
-
-benchmark:
-  small-&: small1 & small2 & small3 & small4
-  small-intersection: small1.intersection(small2, small3, small4)
-  big-&: big1 & big2 & big3
-  big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_large_literal.yml b/benchmark/array_large_literal.yml
deleted file mode 100644
index 423d68391f..0000000000
--- a/benchmark/array_large_literal.yml
+++ /dev/null
@@ -1,19 +0,0 @@
-prelude: |
-  def def_array(size)
-    Object.class_eval(<<-END)
-      def array_#{size}
-        x = 1
-        [#{(['x'] * size).join(',')}]
-      end
-    END
-  end
-  def_array(100)
-  def_array(1000)
-  def_array(10000)
-  def_array(100000)
-benchmark:
-  array_100: array_100
-  array_1000: array_1000
-  array_10000: array_10000
-  array_100000: array_100000
-
diff --git a/benchmark/array_max_float.yml b/benchmark/array_max_float.yml
deleted file mode 100644
index ace1ae2e14..0000000000
--- a/benchmark/array_max_float.yml
+++ /dev/null
@@ -1,30 +0,0 @@
-prelude: |
-  ary2 = 2.times.map(&:to_f).shuffle
-  ary10 = 10.times.map(&:to_f).shuffle
-  ary100 = 100.times.map(&:to_f).shuffle
-  ary500 = 500.times.map(&:to_f).shuffle
-  ary1000 = 1000.times.map(&:to_f).shuffle
-  ary2000 = 2500.times.map(&:to_f).shuffle
-  ary3000 = 2500.times.map(&:to_f).shuffle
-  ary5000 = 5000.times.map(&:to_f).shuffle
-  ary10000 = 10000.times.map(&:to_f).shuffle
-  ary20000 = 20000.times.map(&:to_f).shuffle
-  ary50000 = 50000.times.map(&:to_f).shuffle
-  ary100000 = 100000.times.map(&:to_f).shuffle
-
-benchmark:
-  ary2.max: ary2.max
-  ary10.max: ary10.max
-  ary100.max: ary100.max
-  ary500.max: ary500.max
-  ary1000.max: ary1000.max
-  ary2000.max: ary2000.max
-  ary3000.max: ary3000.max
-  ary5000.max: ary5000.max
-  ary10000.max: ary10000.max
-  ary20000.max: ary20000.max
-  ary50000.max: ary50000.max
-  ary100000.max: ary100000.max
-
-loop_count: 10000
-
diff --git a/benchmark/array_max_int.yml b/benchmark/array_max_int.yml
deleted file mode 100644
index acd83684d0..0000000000
--- a/benchmark/array_max_int.yml
+++ /dev/null
@@ -1,31 +0,0 @@
-prelude: |
-  ary2 = 2.times.to_a.shuffle
-  ary10 = 10.times.to_a.shuffle
-  ary100 = 100.times.to_a.shuffle
-  ary500 = 500.times.to_a.shuffle
-  ary1000 = 1000.times.to_a.shuffle
-  ary2000 = 2500.times.to_a.shuffle
-  ary3000 = 2500.times.to_a.shuffle
-  ary5000 = 5000.times.to_a.shuffle
-  ary10000 = 10000.times.to_a.shuffle
-  ary20000 = 20000.times.to_a.shuffle
-  ary50000 = 50000.times.to_a.shuffle
-  ary100000 = 100000.times.to_a.shuffle
-  ary1000000 = 1000000.times.to_a.shuffle
-
-benchmark:
-  ary2.max: ary2.max
-  ary10.max: ary10.max
-  ary100.max: ary100.max
-  ary500.max: ary500.max
-  ary1000.max: ary1000.max
-  ary2000.max: ary2000.max
-  ary3000.max: ary3000.max
-  ary5000.max: ary5000.max
-  ary10000.max: ary10000.max
-  ary20000.max: ary20000.max
-  ary50000.max: ary50000.max
-  ary100000.max: ary100000.max
-  ary1000000.max: ary1000000.max
-
-loop_count: 10000
diff --git a/benchmark/array_max_str.yml b/benchmark/array_max_str.yml
deleted file mode 100644
index 2aeed010f2..0000000000
--- a/benchmark/array_max_str.yml
+++ /dev/null
@@ -1,30 +0,0 @@
-prelude: |
-  ary2 = 2.times.map(&:to_s).shuffle
-  ary10 = 10.times.map(&:to_s).shuffle
-  ary100 = 100.times.map(&:to_s).shuffle
-  ary500 = 500.times.map(&:to_s).shuffle
-  ary1000 = 1000.times.map(&:to_s).shuffle
-  ary2000 = 2500.times.map(&:to_s).shuffle
-  ary3000 = 2500.times.map(&:to_s).shuffle
-  ary5000 = 5000.times.map(&:to_s).shuffle
-  ary10000 = 10000.times.map(&:to_s).shuffle
-  ary20000 = 20000.times.map(&:to_s).shuffle
-  ary50000 = 50000.times.map(&:to_s).shuffle
-  ary100000 = 100000.times.map(&:to_s).shuffle
-
-benchmark:
-  ary2.max: ary2.max
-  ary10.max: ary10.max
-  ary100.max: ary100.max
-  ary500.max: ary500.max
-  ary1000.max: ary1000.max
-  ary2000.max: ary2000.max
-  ary3000.max: ary3000.max
-  ary5000.max: ary5000.max
-  ary10000.max: ary10000.max
-  ary20000.max: ary20000.max
-  ary50000.max: ary50000.max
-  ary100000.max: ary100000.max
-
-loop_count: 10000
-
diff --git a/benchmark/array_min.yml b/benchmark/array_min.yml
deleted file mode 100644
index 53e5072b14..0000000000
--- a/benchmark/array_min.yml
+++ /dev/null
@@ -1,31 +0,0 @@
-prelude: |
-  ary2 = 2.times.to_a.shuffle
-  ary10 = 10.times.to_a.shuffle
-  ary100 = 100.times.to_a.shuffle
-  ary500 = 500.times.to_a.shuffle
-  ary1000 = 1000.times.to_a.shuffle
-  ary2000 = 2500.times.to_a.shuffle
-  ary3000 = 2500.times.to_a.shuffle
-  ary5000 = 5000.times.to_a.shuffle
-  ary10000 = 10000.times.to_a.shuffle
-  ary20000 = 20000.times.to_a.shuffle
-  ary50000 = 50000.times.to_a.shuffle
-  ary100000 = 100000.times.to_a.shuffle
-  ary1000000 = 1000000.times.to_a.shuffle
-
-benchmark:
-  ary2.min: ary2.min
-  ary10.min: ary10.min
-  ary100.min: ary100.min
-  ary500.min: ary500.min
-  ary1000.min: ary1000.min
-  ary2000.min: ary2000.min
-  ary3000.min: ary3000.min
-  ary5000.min: ary5000.min
-  ary10000.min: ary10000.min
-  ary20000.min: ary20000.min
-  ary50000.min: ary50000.min
-  ary100000.min: ary100000.min
-  ary1000000.min: ary1000000.min
-
-loop_count: 10000
diff --git a/benchmark/array_sample.yml b/benchmark/array_sample.yml
deleted file mode 100644
index 1cd2b34794..0000000000
--- a/benchmark/array_sample.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-prelude: ary = (1..10_000).to_a
-benchmark:
-  - ary.sample
-  - ary.sample(2)
diff --git a/benchmark/array_sort_int.yml b/benchmark/array_sort_int.yml
deleted file mode 100644
index 7b9027ebf7..0000000000
--- a/benchmark/array_sort_int.yml
+++ /dev/null
@@ -1,15 +0,0 @@
-prelude: |
-  ary2 = 2.times.to_a.shuffle
-  ary10 = 10.times.to_a.shuffle
-  ary100 = 100.times.to_a.shuffle
-  ary1000 = 1000.times.to_a.shuffle
-  ary10000 = 10000.times.to_a.shuffle
-
-benchmark:
-  ary2.sort: ary2.sort
-  ary10.sort: ary10.sort
-  ary100.sort: ary100.sort
-  ary1000.sort: ary1000.sort
-  ary10000.sort: ary10000.sort
-
-loop_count: 10000
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
deleted file mode 100644
index 6cb394cb9f..0000000000
--- a/benchmark/array_values_at_int.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-ary = Array.new(10000) {|i| i}
-100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
deleted file mode 100644
index 5b53806d1c..0000000000
--- a/benchmark/array_values_at_range.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-ary = Array.new(10000) {|i| i}
-100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/attr_accessor.yml b/benchmark/attr_accessor.yml
deleted file mode 100644
index 82134cdf9b..0000000000
--- a/benchmark/attr_accessor.yml
+++ /dev/null
@@ -1,29 +0,0 @@
-prelude: |
-  class C
-    attr_accessor :x
-    def initialize
-      @x = nil
-    end
-    class_eval <<-END
-      def ar
-        #{'x;'*256}
-      end
-      def aw
-        #{'self.x = nil;'*256}
-      end
-      def arm
-        m = method(:x)
-        #{'m.call;'*256}
-      end
-      def awm
-        m = method(:x=)
-        #{'m.call(nil);'*256}
-      end
-    END
-  end
-  obj = C.new
-benchmark:
-  attr_reader: "obj.ar"
-  attr_writer: "obj.aw"
-  attr_reader_method: "obj.arm"
-  attr_writer_method: "obj.awm"
diff --git a/benchmark/app_answer.rb b/benchmark/bm_app_answer.rb
index 3cd8a8fd37..3cd8a8fd37 100644
--- a/benchmark/app_answer.rb
+++ b/benchmark/bm_app_answer.rb
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
new file mode 100644
index 0000000000..2bd6acfaf8
--- /dev/null
+++ b/benchmark/bm_app_aobench.rb
@@ -0,0 +1,291 @@
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+#      https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+class Vec
+  def initialize(x, y, z)
+    @x = x
+    @y = y
+    @z = z
+  end
+
+  attr_accessor :x, :y, :z
+
+  def vadd(b)
+    Vec.new(@x + b.x, @y + b.y, @z + b.z)
+  end
+
+  def vsub(b)
+    Vec.new(@x - b.x, @y - b.y, @z - b.z)
+  end
+
+  def vcross(b)
+    Vec.new(@y * b.z - @z * b.y,
+            @z * b.x - @x * b.z,
+            @x * b.y - @y * b.x)
+  end
+
+  def vdot(b)
+    @x * b.x + @y * b.y + @z * b.z
+  end
+
+  def vlength
+    Math.sqrt(@x * @x + @y * @y + @z * @z)
+  end
+
+  def vnormalize
+    len = vlength
+    v = Vec.new(@x, @y, @z)
+    if len > 1.0e-17 then
+      v.x = v.x / len
+      v.y = v.y / len
+      v.z = v.z / len
+    end
+    v
+  end
+end
+
+
+class Sphere
+  def initialize(center, radius)
+    @center = center
+    @radius = radius
+  end
+
+  attr_reader :center, :radius
+
+  def intersect(ray, isect)
+    rs = ray.org.vsub(@center)
+    b = rs.vdot(ray.dir)
+    c = rs.vdot(rs) - (@radius * @radius)
+    d = b * b - c
+    if d > 0.0 then
+      t = - b - Math.sqrt(d)
+
+      if t > 0.0 and t < isect.t then
+        isect.t = t
+        isect.hit = true
+        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+                          ray.org.y + ray.dir.y * t,
+                          ray.org.z + ray.dir.z * t)
+        n = isect.pl.vsub(@center)
+        isect.n = n.vnormalize
+      else
+        0.0
+      end
+    end
+    nil
+  end
+end
+
+class Plane
+  def initialize(p, n)
+    @p = p
+    @n = n
+  end
+
+  def intersect(ray, isect)
+    d = -@p.vdot(@n)
+    v = ray.dir.vdot(@n)
+    v0 = v
+    if v < 0.0 then
+      v0 = -v
+    end
+    if v0 < 1.0e-17 then
+      return
+    end
+
+    t = -(ray.org.vdot(@n) + d) / v
+
+    if t > 0.0 and t < isect.t then
+      isect.hit = true
+      isect.t = t
+      isect.n = @n
+      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+                        ray.org.y + t * ray.dir.y,
+                        ray.org.z + t * ray.dir.z)
+    end
+    nil
+  end
+end
+
+class Ray
+  def initialize(org, dir)
+    @org = org
+    @dir = dir
+  end
+
+  attr_accessor :org, :dir
+end
+
+class Isect
+  def initialize
+    @t = 10000000.0
+    @hit = false
+    @pl = Vec.new(0.0, 0.0, 0.0)
+    @n = Vec.new(0.0, 0.0, 0.0)
+  end
+
+  attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+  i = f * 255.5
+  if i > 255.0 then
+    i = 255.0
+  end
+  if i < 0.0 then
+    i = 0.0
+  end
+  i.to_i
+end
+
+def otherBasis(basis, n)
+  basis[2] = Vec.new(n.x, n.y, n.z)
+  basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+  if n.x < 0.6 and n.x > -0.6 then
+    basis[1].x = 1.0
+  elsif n.y < 0.6 and n.y > -0.6 then
+    basis[1].y = 1.0
+  elsif n.z < 0.6 and n.z > -0.6 then
+    basis[1].z = 1.0
+  else
+    basis[1].x = 1.0
+  end
+
+  basis[0] = basis[1].vcross(basis[2])
+  basis[0] = basis[0].vnormalize
+
+  basis[1] = basis[2].vcross(basis[0])
+  basis[1] = basis[1].vnormalize
+end
+
+class Scene
+  def initialize
+    @spheres = Array.new
+    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+  end
+
+  def ambient_occlusion(isect)
+    basis = Array.new
+    otherBasis(basis, isect.n)
+
+    ntheta    = NAO_SAMPLES
+    nphi      = NAO_SAMPLES
+    eps       = 0.0001
+    occlusion = 0.0
+
+    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+                isect.pl.y + eps * isect.n.y,
+                isect.pl.z + eps * isect.n.z)
+    nphi.times do |j|
+      ntheta.times do |i|
+        r = rand
+        phi = 2.0 * 3.14159265 * rand
+        x = Math.cos(phi) * Math.sqrt(1.0 - r)
+        y = Math.sin(phi) * Math.sqrt(1.0 - r)
+        z = Math.sqrt(r)
+
+        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+        raydir = Vec.new(rx, ry, rz)
+        ray = Ray.new(p0, raydir)
+
+        occisect = Isect.new
+        @spheres[0].intersect(ray, occisect)
+        @spheres[1].intersect(ray, occisect)
+        @spheres[2].intersect(ray, occisect)
+        @plane.intersect(ray, occisect)
+        if occisect.hit then
+          occlusion = occlusion + 1.0
+        else
+          0.0
+        end
+      end
+    end
+
+    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+    Vec.new(occlusion, occlusion, occlusion)
+  end
+
+  def render(w, h, nsubsamples)
+    cnt = 0
+    nsf = nsubsamples.to_f
+    h.times do |y|
+      w.times do |x|
+        rad = Vec.new(0.0, 0.0, 0.0)
+
+        # Subsampling
+        nsubsamples.times do |v|
+          nsubsamples.times do |u|
+
+            cnt = cnt + 1
+            wf = w.to_f
+            hf = h.to_f
+            xf = x.to_f
+            yf = y.to_f
+            uf = u.to_f
+            vf = v.to_f
+
+            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+            eye = Vec.new(px, py, -1.0).vnormalize
+
+            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+            isect = Isect.new
+            @spheres[0].intersect(ray, isect)
+            @spheres[1].intersect(ray, isect)
+            @spheres[2].intersect(ray, isect)
+            @plane.intersect(ray, isect)
+            if isect.hit then
+              col = ambient_occlusion(isect)
+              rad.x = rad.x + col.x
+              rad.y = rad.y + col.y
+              rad.z = rad.z + col.z
+            end
+          end
+        end
+
+        r = rad.x / (nsf * nsf)
+        g = rad.y / (nsf * nsf)
+        b = rad.z / (nsf * nsf)
+        printf("%c", clamp(r))
+        printf("%c", clamp(g))
+        printf("%c", clamp(b))
+      end
+      nil
+    end
+
+    nil
+  end
+end
+
+alias printf_orig printf
+def printf *args
+end
+
+# File.open("ao.ppm", "w") do |fp|
+  printf("P6\n")
+  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
new file mode 100644
index 0000000000..77c66a7949
--- /dev/null
+++ b/benchmark/bm_app_erb.rb
@@ -0,0 +1,26 @@
+#
+# Create many HTML strings with ERB.
+#
+
+require 'erb'
+
+data = DATA.read
+max = 15_000
+title = "hello world!"
+content = "hello world!\n" * 10
+
+max.times{
+  ERB.new(data).result(binding)
+}
+
+__END__
+
+<html>
+  <head> <%= title %> </head>
+  <body>
+    <h1> <%= title %> </h1>
+    <p>
+      <%= content %>
+    </p>
+  </body>
+</html>
diff --git a/benchmark/app_factorial.rb b/benchmark/bm_app_factorial.rb
index 45f471dfdb..45f471dfdb 100644
--- a/benchmark/app_factorial.rb
+++ b/benchmark/bm_app_factorial.rb
diff --git a/benchmark/app_fib.rb b/benchmark/bm_app_fib.rb
index 34a7b2e725..34a7b2e725 100644
--- a/benchmark/app_fib.rb
+++ b/benchmark/bm_app_fib.rb
diff --git a/benchmark/app_lc_fizzbuzz.rb b/benchmark/bm_app_lc_fizzbuzz.rb
index f09574bbeb..f09574bbeb 100644
--- a/benchmark/app_lc_fizzbuzz.rb
+++ b/benchmark/bm_app_lc_fizzbuzz.rb
diff --git a/benchmark/app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
index 801b75e8e2..801b75e8e2 100644
--- a/benchmark/app_mandelbrot.rb
+++ b/benchmark/bm_app_mandelbrot.rb
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
new file mode 100644
index 0000000000..59c63f358e
--- /dev/null
+++ b/benchmark/bm_app_pentomino.rb
@@ -0,0 +1,259 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+  nb.each{|x|
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      [-ROW, -1, 1, ROW].each{|d|
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      }
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  }
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  (0...ROW*COL).each{|i|
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  }
+end
+
+def pboard
+  return # skip print
+  print "No. #$no\n"
+  (0...COL).each{|i|
+    print "|"
+    (0...ROW-NP).each{|j|
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    }
+    print "\n"
+  }
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      x.each{|s|
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      }
+      if f == 0 then
+        x.each{|s|
+          $b[pos+s] = i
+        }
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        x.each{|s|
+          $b[pos+s] = -1
+        }
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
+
+
+__END__
+
+# original
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n,a,nb)
+  for x in nb
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      for d in [-ROW, -1, 1, ROW]
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      end
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  end
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  for i in 0...ROW*COL
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  end
+end
+
+def pboard
+  print "No. #$no\n"
+  for i in 0...COL
+    print "|"
+    for j in 0...ROW-NP
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    end
+    print "\n"
+  end
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      for s in x do
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      end
+      if f == 0 then
+        for s in x do
+          $b[pos+s] = i
+        end
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        for s in x do
+          $b[pos+s] = -1
+        end
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/app_raise.rb b/benchmark/bm_app_raise.rb
index 5db8f95d50..5db8f95d50 100644
--- a/benchmark/app_raise.rb
+++ b/benchmark/bm_app_raise.rb
diff --git a/benchmark/app_strconcat.rb b/benchmark/bm_app_strconcat.rb
index 7eed7c1aed..7eed7c1aed 100644
--- a/benchmark/app_strconcat.rb
+++ b/benchmark/bm_app_strconcat.rb
diff --git a/benchmark/app_tak.rb b/benchmark/bm_app_tak.rb
index efe5380f4e..efe5380f4e 100644
--- a/benchmark/app_tak.rb
+++ b/benchmark/bm_app_tak.rb
diff --git a/benchmark/app_tarai.rb b/benchmark/bm_app_tarai.rb
index 4c146f5ccf..4c146f5ccf 100644
--- a/benchmark/app_tarai.rb
+++ b/benchmark/bm_app_tarai.rb
diff --git a/benchmark/app_uri.rb b/benchmark/bm_app_uri.rb
index 586edfd5dc..586edfd5dc 100644
--- a/benchmark/app_uri.rb
+++ b/benchmark/bm_app_uri.rb
diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/bm_array_sample_100k_10.rb
index 5f41ecc32b..5f41ecc32b 100644
--- a/benchmark/array_sample_100k_10.rb
+++ b/benchmark/bm_array_sample_100k_10.rb
diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/bm_array_sample_100k_11.rb
index 18b1715319..18b1715319 100644
--- a/benchmark/array_sample_100k_11.rb
+++ b/benchmark/bm_array_sample_100k_11.rb
diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/bm_array_sample_100k__100.rb
index 22863afe89..22863afe89 100644
--- a/benchmark/array_sample_100k__100.rb
+++ b/benchmark/bm_array_sample_100k__100.rb
diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/bm_array_sample_100k__1k.rb
index 4cd79e6c67..4cd79e6c67 100644
--- a/benchmark/array_sample_100k__1k.rb
+++ b/benchmark/bm_array_sample_100k__1k.rb
diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/bm_array_sample_100k__6k.rb
index b3d264249e..b3d264249e 100644
--- a/benchmark/array_sample_100k__6k.rb
+++ b/benchmark/bm_array_sample_100k__6k.rb
diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/bm_array_sample_100k___10k.rb
index 5dd55ec058..5dd55ec058 100644
--- a/benchmark/array_sample_100k___10k.rb
+++ b/benchmark/bm_array_sample_100k___10k.rb
diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/bm_array_sample_100k___50k.rb
index 1506732c3c..1506732c3c 100644
--- a/benchmark/array_sample_100k___50k.rb
+++ b/benchmark/bm_array_sample_100k___50k.rb
diff --git a/benchmark/array_shift.rb b/benchmark/bm_array_shift.rb
index 798bb9e3f4..798bb9e3f4 100644
--- a/benchmark/array_shift.rb
+++ b/benchmark/bm_array_shift.rb
diff --git a/benchmark/array_small_and.rb b/benchmark/bm_array_small_and.rb
index e53a6edae6..e53a6edae6 100644
--- a/benchmark/array_small_and.rb
+++ b/benchmark/bm_array_small_and.rb
diff --git a/benchmark/array_small_diff.rb b/benchmark/bm_array_small_diff.rb
index 9661ee48db..9661ee48db 100644
--- a/benchmark/array_small_diff.rb
+++ b/benchmark/bm_array_small_diff.rb
diff --git a/benchmark/array_small_or.rb b/benchmark/bm_array_small_or.rb
index c58b5fd1ff..c58b5fd1ff 100644
--- a/benchmark/array_small_or.rb
+++ b/benchmark/bm_array_small_or.rb
diff --git a/benchmark/array_sort_block.rb b/benchmark/bm_array_sort_block.rb
index 3579786056..3579786056 100644
--- a/benchmark/array_sort_block.rb
+++ b/benchmark/bm_array_sort_block.rb
diff --git a/benchmark/array_sort_float.rb b/benchmark/bm_array_sort_float.rb
index 9a6e2f8bd2..9a6e2f8bd2 100644
--- a/benchmark/array_sort_float.rb
+++ b/benchmark/bm_array_sort_float.rb
diff --git a/benchmark/bighash.rb b/benchmark/bm_bighash.rb
index e2ad5a5c94..e2ad5a5c94 100644
--- a/benchmark/bighash.rb
+++ b/benchmark/bm_bighash.rb
diff --git a/benchmark/dir_empty_p.rb b/benchmark/bm_dir_empty_p.rb
index 8329c757cf..8329c757cf 100644
--- a/benchmark/dir_empty_p.rb
+++ b/benchmark/bm_dir_empty_p.rb
diff --git a/benchmark/bm_erb_render.rb b/benchmark/bm_erb_render.rb
new file mode 100644
index 0000000000..d2929b0553
--- /dev/null
+++ b/benchmark/bm_erb_render.rb
@@ -0,0 +1,26 @@
+require 'erb'
+
+data = DATA.read
+max = 1_500_000
+title = "hello world!"
+content = "hello world!\n" * 10
+
+src = "def self.render(title, content); #{ERB.new(data).src}; end"
+mod = Module.new
+mod.instance_eval(src, "(ERB)")
+
+max.times do
+  mod.render(title, content)
+end
+
+__END__
+
+<html>
+  <head> <%= title %> </head>
+  <body>
+    <h1> <%= title %> </h1>
+    <p>
+      <%= content %>
+    </p>
+  </body>
+</html>
diff --git a/benchmark/file_chmod.rb b/benchmark/bm_file_chmod.rb
index 1cd4760c9d..1cd4760c9d 100644
--- a/benchmark/file_chmod.rb
+++ b/benchmark/bm_file_chmod.rb
diff --git a/benchmark/bm_file_rename.rb b/benchmark/bm_file_rename.rb
new file mode 100644
index 0000000000..3bf6a5ef35
--- /dev/null
+++ b/benchmark/bm_file_rename.rb
@@ -0,0 +1,11 @@
+# rename file
+require 'tempfile'
+
+max = 100_000
+tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
+a, b = tmp.map { |x| x.path }
+max.times do
+  File.rename(a, b)
+  File.rename(b, a)
+end
+tmp.each { |t| t.close! }
diff --git a/benchmark/hash_aref_dsym.rb b/benchmark/bm_hash_aref_dsym.rb
index af4f8c36d4..af4f8c36d4 100644
--- a/benchmark/hash_aref_dsym.rb
+++ b/benchmark/bm_hash_aref_dsym.rb
diff --git a/benchmark/hash_aref_dsym_long.rb b/benchmark/bm_hash_aref_dsym_long.rb
index 9d7759379e..9d7759379e 100644
--- a/benchmark/hash_aref_dsym_long.rb
+++ b/benchmark/bm_hash_aref_dsym_long.rb
diff --git a/benchmark/hash_aref_fix.rb b/benchmark/bm_hash_aref_fix.rb
index 1346890582..1346890582 100644
--- a/benchmark/hash_aref_fix.rb
+++ b/benchmark/bm_hash_aref_fix.rb
diff --git a/benchmark/hash_aref_flo.rb b/benchmark/bm_hash_aref_flo.rb
index 2217274c82..2217274c82 100644
--- a/benchmark/hash_aref_flo.rb
+++ b/benchmark/bm_hash_aref_flo.rb
diff --git a/benchmark/hash_aref_miss.rb b/benchmark/bm_hash_aref_miss.rb
index b0913dd4bb..b0913dd4bb 100644
--- a/benchmark/hash_aref_miss.rb
+++ b/benchmark/bm_hash_aref_miss.rb
diff --git a/benchmark/hash_aref_str.rb b/benchmark/bm_hash_aref_str.rb
index 19439b061b..19439b061b 100644
--- a/benchmark/hash_aref_str.rb
+++ b/benchmark/bm_hash_aref_str.rb
diff --git a/benchmark/hash_aref_sym.rb b/benchmark/bm_hash_aref_sym.rb
index f75d163fe6..f75d163fe6 100644
--- a/benchmark/hash_aref_sym.rb
+++ b/benchmark/bm_hash_aref_sym.rb
diff --git a/benchmark/hash_aref_sym_long.rb b/benchmark/bm_hash_aref_sym_long.rb
index 9dab8df7be..9dab8df7be 100644
--- a/benchmark/hash_aref_sym_long.rb
+++ b/benchmark/bm_hash_aref_sym_long.rb
diff --git a/benchmark/hash_flatten.rb b/benchmark/bm_hash_flatten.rb
index e944aae9f2..e944aae9f2 100644
--- a/benchmark/hash_flatten.rb
+++ b/benchmark/bm_hash_flatten.rb
diff --git a/benchmark/hash_ident_flo.rb b/benchmark/bm_hash_ident_flo.rb
index 0c7edfed3e..0c7edfed3e 100644
--- a/benchmark/hash_ident_flo.rb
+++ b/benchmark/bm_hash_ident_flo.rb
diff --git a/benchmark/hash_ident_num.rb b/benchmark/bm_hash_ident_num.rb
index b226736c6f..b226736c6f 100644
--- a/benchmark/hash_ident_num.rb
+++ b/benchmark/bm_hash_ident_num.rb
diff --git a/benchmark/hash_ident_obj.rb b/benchmark/bm_hash_ident_obj.rb
index 4b3b58edec..4b3b58edec 100644
--- a/benchmark/hash_ident_obj.rb
+++ b/benchmark/bm_hash_ident_obj.rb
diff --git a/benchmark/hash_ident_str.rb b/benchmark/bm_hash_ident_str.rb
index 8582b38e31..8582b38e31 100644
--- a/benchmark/hash_ident_str.rb
+++ b/benchmark/bm_hash_ident_str.rb
diff --git a/benchmark/hash_ident_sym.rb b/benchmark/bm_hash_ident_sym.rb
index 4c81e3d28e..4c81e3d28e 100644
--- a/benchmark/hash_ident_sym.rb
+++ b/benchmark/bm_hash_ident_sym.rb
diff --git a/benchmark/hash_keys.rb b/benchmark/bm_hash_keys.rb
index 6863cd01f9..6863cd01f9 100644
--- a/benchmark/hash_keys.rb
+++ b/benchmark/bm_hash_keys.rb
diff --git a/benchmark/hash_long.rb b/benchmark/bm_hash_long.rb
index 03d9109602..03d9109602 100644
--- a/benchmark/hash_long.rb
+++ b/benchmark/bm_hash_long.rb
diff --git a/benchmark/hash_shift.rb b/benchmark/bm_hash_shift.rb
index a645671a5b..a645671a5b 100644
--- a/benchmark/hash_shift.rb
+++ b/benchmark/bm_hash_shift.rb
diff --git a/benchmark/hash_shift_u16.rb b/benchmark/bm_hash_shift_u16.rb
index ec800d0342..ec800d0342 100644
--- a/benchmark/hash_shift_u16.rb
+++ b/benchmark/bm_hash_shift_u16.rb
diff --git a/benchmark/hash_shift_u24.rb b/benchmark/bm_hash_shift_u24.rb
index de4e0fa696..de4e0fa696 100644
--- a/benchmark/hash_shift_u24.rb
+++ b/benchmark/bm_hash_shift_u24.rb
diff --git a/benchmark/hash_shift_u32.rb b/benchmark/bm_hash_shift_u32.rb
index 656aa55583..656aa55583 100644
--- a/benchmark/hash_shift_u32.rb
+++ b/benchmark/bm_hash_shift_u32.rb
diff --git a/benchmark/hash_small2.rb b/benchmark/bm_hash_small2.rb
index 45485d9c71..45485d9c71 100644
--- a/benchmark/hash_small2.rb
+++ b/benchmark/bm_hash_small2.rb
diff --git a/benchmark/hash_small4.rb b/benchmark/bm_hash_small4.rb
index acd4084334..acd4084334 100644
--- a/benchmark/hash_small4.rb
+++ b/benchmark/bm_hash_small4.rb
diff --git a/benchmark/hash_small8.rb b/benchmark/bm_hash_small8.rb
index 9cffcc91b6..9cffcc91b6 100644
--- a/benchmark/hash_small8.rb
+++ b/benchmark/bm_hash_small8.rb
diff --git a/benchmark/hash_to_proc.rb b/benchmark/bm_hash_to_proc.rb
index 2b675bf509..2b675bf509 100644
--- a/benchmark/hash_to_proc.rb
+++ b/benchmark/bm_hash_to_proc.rb
diff --git a/benchmark/hash_values.rb b/benchmark/bm_hash_values.rb
index 069441302f..069441302f 100644
--- a/benchmark/hash_values.rb
+++ b/benchmark/bm_hash_values.rb
diff --git a/benchmark/int_quo.rb b/benchmark/bm_int_quo.rb
index e22a3f8c30..e22a3f8c30 100644
--- a/benchmark/int_quo.rb
+++ b/benchmark/bm_int_quo.rb
diff --git a/benchmark/io_copy_stream_write.rb b/benchmark/bm_io_copy_stream_write.rb
index 3fd87250a4..3fd87250a4 100644
--- a/benchmark/io_copy_stream_write.rb
+++ b/benchmark/bm_io_copy_stream_write.rb
diff --git a/benchmark/io_copy_stream_write_socket.rb b/benchmark/bm_io_copy_stream_write_socket.rb
index 11f369bd0d..11f369bd0d 100644
--- a/benchmark/io_copy_stream_write_socket.rb
+++ b/benchmark/bm_io_copy_stream_write_socket.rb
diff --git a/benchmark/io_file_create.rb b/benchmark/bm_io_file_create.rb
index 2f205c1333..2f205c1333 100644
--- a/benchmark/io_file_create.rb
+++ b/benchmark/bm_io_file_create.rb
diff --git a/benchmark/io_file_read.rb b/benchmark/bm_io_file_read.rb
index b9e796ed30..b9e796ed30 100644
--- a/benchmark/io_file_read.rb
+++ b/benchmark/bm_io_file_read.rb
diff --git a/benchmark/io_file_write.rb b/benchmark/bm_io_file_write.rb
index aa1be0e5fe..aa1be0e5fe 100644
--- a/benchmark/io_file_write.rb
+++ b/benchmark/bm_io_file_write.rb
diff --git a/benchmark/io_nonblock_noex.rb b/benchmark/bm_io_nonblock_noex.rb
index da9357fdc6..da9357fdc6 100644
--- a/benchmark/io_nonblock_noex.rb
+++ b/benchmark/bm_io_nonblock_noex.rb
diff --git a/benchmark/io_nonblock_noex2.rb b/benchmark/bm_io_nonblock_noex2.rb
index 56819d049b..56819d049b 100644
--- a/benchmark/io_nonblock_noex2.rb
+++ b/benchmark/bm_io_nonblock_noex2.rb
diff --git a/benchmark/io_pipe_rw.rb b/benchmark/bm_io_pipe_rw.rb
index 6862a8ae61..6862a8ae61 100644
--- a/benchmark/io_pipe_rw.rb
+++ b/benchmark/bm_io_pipe_rw.rb
diff --git a/benchmark/io_select.rb b/benchmark/bm_io_select.rb
index 19248daeb1..19248daeb1 100644
--- a/benchmark/io_select.rb
+++ b/benchmark/bm_io_select.rb
diff --git a/benchmark/io_select2.rb b/benchmark/bm_io_select2.rb
index 10e37d71b2..10e37d71b2 100644
--- a/benchmark/io_select2.rb
+++ b/benchmark/bm_io_select2.rb
diff --git a/benchmark/io_select3.rb b/benchmark/bm_io_select3.rb
index 7d0ba1f092..7d0ba1f092 100644
--- a/benchmark/io_select3.rb
+++ b/benchmark/bm_io_select3.rb
diff --git a/benchmark/loop_for.rb b/benchmark/bm_loop_for.rb
index 0fc4cc1511..0fc4cc1511 100644
--- a/benchmark/loop_for.rb
+++ b/benchmark/bm_loop_for.rb
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
new file mode 100644
index 0000000000..d3375c744c
--- /dev/null
+++ b/benchmark/bm_loop_generator.rb
@@ -0,0 +1,14 @@
+max = 600000
+
+if defined? Fiber
+  gen = (1..max).each
+  loop do
+    gen.next
+  end
+else
+  require 'generator'
+  gen = Generator.new((0..max))
+  while gen.next?
+    gen.next
+  end
+end
diff --git a/benchmark/loop_times.rb b/benchmark/bm_loop_times.rb
index 521f72ad1a..521f72ad1a 100644
--- a/benchmark/loop_times.rb
+++ b/benchmark/bm_loop_times.rb
diff --git a/benchmark/loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
index 0072822c06..0072822c06 100644
--- a/benchmark/loop_whileloop.rb
+++ b/benchmark/bm_loop_whileloop.rb
diff --git a/benchmark/loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
index 47d02dffc4..47d02dffc4 100644
--- a/benchmark/loop_whileloop2.rb
+++ b/benchmark/bm_loop_whileloop2.rb
diff --git a/benchmark/marshal_dump_flo.rb b/benchmark/bm_marshal_dump_flo.rb
index 9b8d0c6afb..9b8d0c6afb 100644
--- a/benchmark/marshal_dump_flo.rb
+++ b/benchmark/bm_marshal_dump_flo.rb
diff --git a/benchmark/marshal_dump_load_geniv.rb b/benchmark/bm_marshal_dump_load_geniv.rb
index 8252ad90fa..8252ad90fa 100644
--- a/benchmark/marshal_dump_load_geniv.rb
+++ b/benchmark/bm_marshal_dump_load_geniv.rb
diff --git a/benchmark/marshal_dump_load_time.rb b/benchmark/bm_marshal_dump_load_time.rb
index e29743b791..e29743b791 100644
--- a/benchmark/marshal_dump_load_time.rb
+++ b/benchmark/bm_marshal_dump_load_time.rb
diff --git a/benchmark/bm_require.rb b/benchmark/bm_require.rb
new file mode 100644
index 0000000000..b8abc88f41
--- /dev/null
+++ b/benchmark/bm_require.rb
@@ -0,0 +1,7 @@
+$:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+1.upto(10000) do |i|
+  require "c#{i}"
+end
+
+$:.pop
diff --git a/benchmark/bm_require_thread.rb b/benchmark/bm_require_thread.rb
new file mode 100644
index 0000000000..e54db6c6e5
--- /dev/null
+++ b/benchmark/bm_require_thread.rb
@@ -0,0 +1,15 @@
+$:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+i=0
+t = Thread.new do
+  while true
+    i = i+1 # dummy loop
+  end
+end
+
+1.upto(100) do |i|
+  require "c#{i}"
+end
+
+$:.pop
+t.kill
diff --git a/benchmark/securerandom.rb b/benchmark/bm_securerandom.rb
index a082ea6d5b..a082ea6d5b 100644
--- a/benchmark/securerandom.rb
+++ b/benchmark/bm_securerandom.rb
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
new file mode 100644
index 0000000000..7db5be9050
--- /dev/null
+++ b/benchmark/bm_so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
new file mode 100644
index 0000000000..2b8fce8f99
--- /dev/null
+++ b/benchmark/bm_so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+  x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+  (n-1).step(0,-1) do |bi|
+    y[bi] += x.at(bi)
+  end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
index b1693e4109..b1693e4109 100644
--- a/benchmark/so_binary_trees.rb
+++ b/benchmark/bm_so_binary_trees.rb
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
new file mode 100644
index 0000000000..873214de7c
--- /dev/null
+++ b/benchmark/bm_so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+  i += 1
+  hello = ''
+  4_000_000.times do |e|
+    hello << STUFF
+  end
+end
+# puts hello.length
+
+
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
new file mode 100644
index 0000000000..65f6337a4a
--- /dev/null
+++ b/benchmark/bm_so_count_words.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan
+
+input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+nl = nw = nc = 0
+while true
+  tmp = input.read(4096) or break
+  data = tmp << (input.gets || "")
+  nc += data.length
+  nl += data.count("\n")
+  ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+  nw += data.count(" ") + 1
+end
+# STDERR.puts "#{nl} #{nw} #{nc}"
+
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
new file mode 100644
index 0000000000..deb003a594
--- /dev/null
+++ b/benchmark/bm_so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+class Hi_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+def some_function(num)
+  begin
+    hi_function(num)
+  rescue
+    print "We shouldn't get here, exception is: #{$!.type}\n"
+  end
+end
+
+def hi_function(num)
+  begin
+    lo_function(num)
+  rescue Hi_Exception
+    $HI = $HI + 1
+  end
+end
+
+def lo_function(num)
+  begin
+    blowup(num)
+  rescue Lo_Exception
+    $LO = $LO + 1
+  end
+end
+
+def blowup(num)
+  if num % 2 == 0
+    raise Lo_Exception.new(num)
+  else
+    raise Hi_Exception.new(num)
+  end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+  i += 1
+  some_function(i+1)
+end
diff --git a/benchmark/so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
index bac5ecd44c..bac5ecd44c 100644
--- a/benchmark/so_fannkuch.rb
+++ b/benchmark/bm_so_fannkuch.rb
diff --git a/benchmark/so_fasta.rb b/benchmark/bm_so_fasta.rb
index dcc6b39507..dcc6b39507 100644
--- a/benchmark/so_fasta.rb
+++ b/benchmark/bm_so_fasta.rb
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
new file mode 100644
index 0000000000..dadab3e79c
--- /dev/null
+++ b/benchmark/bm_so_k_nucleotide.rb
@@ -0,0 +1,48 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# contributed by jose fco. gonzalez
+# modified by Sokolov Yura
+
+seq = String.new
+
+def frecuency( seq,length )
+    n, table = seq.length - length + 1, Hash.new(0)
+    f, i = nil, nil
+    (0 ... length).each do |f|
+        (f ... n).step(length) do |i|
+            table[seq[i,length]] += 1
+        end
+    end
+    [n,table]
+
+end
+
+def sort_by_freq( seq,length )
+    n,table = frecuency( seq,length )
+    a, b, v = nil, nil, nil
+    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+    end
+    puts
+end
+
+def find_seq( seq,s )
+    n,table = frecuency( seq,s.length )
+    puts "#{table[s].to_s}\t#{s.upcase}"
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+line = input.gets while line !~ /^>THREE/
+line = input.gets
+
+while (line !~ /^>/) & line do
+    seq << line.chomp
+    line = input.gets
+end
+
+[1,2].each {|i| sort_by_freq( seq,i ) }
+
+%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+
diff --git a/benchmark/so_lists.rb b/benchmark/bm_so_lists.rb
index e8f4a2a5f7..e8f4a2a5f7 100644
--- a/benchmark/so_lists.rb
+++ b/benchmark/bm_so_lists.rb
diff --git a/benchmark/so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb
index 76331c64b8..76331c64b8 100644
--- a/benchmark/so_mandelbrot.rb
+++ b/benchmark/bm_so_mandelbrot.rb
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
new file mode 100644
index 0000000000..e2c5c8e559
--- /dev/null
+++ b/benchmark/bm_so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+    count = 1
+    mx = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            row[j] = count
+            count += 1
+        end
+        mx[bi] = row
+    end
+    mx
+end
+
+def mmult(rows, cols, m1, m2)
+    m3 = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            val = 0
+            (0 .. (cols - 1)).each do |k|
+                val += m1.at(bi).at(k) * m2.at(k).at(j)
+            end
+            row[j] = val
+        end
+        m3[bi] = row
+    end
+    m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+    mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
new file mode 100755
index 0000000000..8c136baa6c
--- /dev/null
+++ b/benchmark/bm_so_meteor_contest.rb
@@ -0,0 +1,563 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+#   http://shootout.alioth.debian.org
+#   contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM:  the main body is at the bottom.
+#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+#   2) see how I represent a board as a bitmask by reading the blank_board comments
+#   3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+  # an array (by location) containing a bit mask for how the piece maps at the given location.
+  # if the rotation is invalid at that location the mask will contain false
+  attr_reader :start_masks
+
+  # maps a direction to a relative location.  these differ depending on whether it is an even or
+  # odd row being mapped from
+  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+  def initialize( directions )
+    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+    @even_mask = mask_for_offsets( @even_offsets)
+    @odd_mask = mask_for_offsets( @odd_offsets)
+
+    @start_masks = Array.new(60)
+
+    # create the rotational masks by placing the base mask at the location and seeing if
+    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
+    # is true the piece cannot be placed
+    0.upto(59) do | offset |
+      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+        imask = compute_required( mask, offset)
+        @start_masks[offset] = [ mask, imask, imask | mask ]
+      else
+        @start_masks[offset] = false
+      end
+    end
+  end
+
+  def compute_required( mask, offset )
+    board = blank_board
+    0.upto(offset) { | i | board |= 1 << i }
+    board |= mask
+    return 0 if (!prunable(board | mask, offset))
+    board = flood_fill(board,58)
+    count = 0
+    imask = 0
+    0.upto(59) do | i |
+      if (board[i] == 0) then
+        imask |= (1 << i)
+        count += 1
+      end
+    end
+    (count > 0 && count < 5) ? imask : 0
+  end
+
+  def flood_fill( board, location)
+    return board if (board[location] == 1)
+    board |= 1 << location
+    row, col = location.divmod(6)
+    board = flood_fill( board, location - 1) if (col > 0)
+    board = flood_fill( board, location + 1) if (col < 4)
+    if (row % 2 == 0) then
+      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+    else
+      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+    end
+    board
+  end
+
+  # given a location, produces a list of relative locations covered by the piece at this rotation
+  def offsets( location)
+    if is_even( location) then
+      @even_offsets.collect { | value | value + location }
+    else
+      @odd_offsets.collect { | value | value + location }
+    end
+  end
+
+  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+  # this is hard to explain. imagine we have this partial board:
+  #   0 0 0 0 0 x        [positions 0-5]
+  #    0 0 1 1 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 1 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # The top-left of the piece is at position 8, the
+  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
+  #   0 0 0 1 1 x        [positions 0-5]
+  #    0 0 1 0 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 0 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+  # this function would return
+  def normalize_offsets( values)
+    min = values.min
+    even_min = is_even(min)
+    other_min = even_min ? min + 6 : min + 7
+    other_values = values.collect do | value |
+      if is_even(value) then
+        value + 6 - other_min
+      else
+        value + 7 - other_min
+      end
+    end
+    values.collect! { | value | value - min }
+
+    if even_min then
+      [values, other_values]
+    else
+      [other_values, values]
+    end
+  end
+
+  # produce a bitmask representation of an array of offset locations
+  def mask_for_offsets( offsets )
+    mask = 0
+    offsets.each { | value | mask = mask + ( 1 << value ) }
+    mask
+  end
+
+  # finds a "safe" position that a position as described by a list of directions can be placed
+  # without falling off any edge of the board.  the values returned a location to place the first piece
+  # at so it will fit after making the described moves
+  def start_adjust( directions )
+    south = east = 0;
+    directions.each do | direction |
+      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+      south += 1 if ( direction == :nw || direction == :ne )
+    end
+    south * 6 + east
+  end
+
+  # given a set of directions places the piece (as defined by a set of directions) on the board at
+  # a location that will not take it off the edge
+  def get_values( directions )
+    start = start_adjust(directions)
+    values = [ start ]
+    directions.each do | direction |
+      if (start % 12 >= 6) then
+        start += @@rotation_odd_adder[direction]
+      else
+        start += @@rotation_even_adder[direction]
+      end
+      values += [ start ]
+    end
+
+    # some moves take you back to an existing location, we'll strip duplicates
+    values.uniq
+  end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+#   rotations -- all the rotations of the piece
+#   type -- a numeic "name" of the piece
+#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
+#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+  attr_reader :rotations, :type, :masks
+  attr_accessor :placed
+
+  # transform hashes that change one direction into another when you either flip or rotate a set of directions
+  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+  def initialize( directions, type )
+    @type = type
+    @rotations = Array.new();
+    @map = {}
+
+    generate_rotations( directions )
+    directions.collect! { | value | @@flip_converter[value] }
+    generate_rotations( directions )
+
+    # creates the masks AND a map that returns [location, rotation] for any given mask
+    # this is used when a board is found and we want to draw it, otherwise the map is unused
+    @masks = Array.new();
+    0.upto(59) do | i |
+      even = true
+      @masks[i] = @rotations.collect do | rotation |
+        mask = rotation.start_masks[i]
+        @map[mask[0]] = [ i, rotation ] if (mask)
+        mask || nil
+      end
+      @masks[i].compact!
+    end
+  end
+
+  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+  def generate_rotations( directions )
+    6.times do
+      rotations.push( Rotation.new(directions))
+      directions.collect! { | value | @@rotate_converter[value] }
+    end
+  end
+
+  # given a board string, adds this piece to the board at whatever location/rotation
+  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+  def fill_string( board_string)
+    location, rotation = @map[@placed]
+    rotation.offsets(location).each do | offset |
+      row, col = offset.divmod(6)
+      board_string[ row*5 + col, 1 ] = @type.to_s
+    end
+  end
+end
+
+# a blank bit board having this form:
+#
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+  0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+  0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+  (location % 12) < 6
+end
+
+# support function that create three utility maps:
+#  $converter -- for each row an array that maps a five bit row (via array mapping)
+#                to the a five bit representation of the bits below it
+#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+#                   a region array has three values the first is a mask of bits in the region,
+#                   the second is the count of those bits and the third is identical to the first
+#                   examples:
+#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+#                           0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+  all_odds = Array.new(0b100000)
+  all_evens = Array.new(0b100000)
+  bit_counts = Array.new(0b100000)
+  new_regions = Array.new(0b100000)
+  0.upto(0b11111) do | i |
+    bit_count = odd = even = 0
+    0.upto(4) do | bit |
+      if (i[bit] == 1) then
+        bit_count += 1
+        odd |= odd_map[bit]
+        even |= even_map[bit]
+      end
+    end
+    all_odds[i] = odd
+    all_evens[i] = even
+    bit_counts[i] = bit_count
+    new_regions[i] = create_regions( i)
+  end
+
+  $converter = []
+  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+  $bit_counts = bit_counts
+  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five.  The following board is an example of a prunable board:
+#    0 0 1 0 0
+#     0 1 0 0 0
+#    1 1 0 0 0
+#     0 1 0 0 0
+#    0 0 0 0 0
+#       ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
+#   location -- starting location, everything above and to the left is already full
+#   slotting -- set to true only when testing initial pieces, when filling normally
+#               additional assumptions are possible
+#
+# Algorithm:
+#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
+#    maintainng counts of active open areas (kept in the collector array) each collector contains
+#    three values at the start of an iteration:
+#          0: mask of bits that would be adjacent to the collector in this row
+#          1: the number of bits collected so far
+#          2: a scratch space starting as zero, but used during the computation to represent
+#             the empty bits in the new row that are adjacent (position 0)
+#  The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+  collectors = []
+  # loop across the rows
+  (location / 6).to_i.upto(9) do | row_on |
+    # obtain a set of regions representing the bits of the current row.
+    regions = $regions[(board >> (row_on * 6)) & 0b11111]
+    converter = $converter[row_on]
+
+    # track the number of collectors at the start of the cycle so that
+    # we don't compute against newly created collectors, only existing collectors
+    initial_collector_count = collectors.length
+
+    # loop against the regions.  For each region of the row
+    # we will see if it connects to one or more existing collectors.
+    # if it connects to 1 collector, the bits from the region are added to the
+    # bits of the collector and the mask is placed in collector[2]
+    # If the region overlaps more than one collector then all the collectors
+    # it overlaps with are merged into the first one (the others are set to nil in the array)
+    # if NO collectors are found then the region is copied as a new collector
+    regions.each do | region |
+      collector_found = nil
+      region_mask = region[2]
+      initial_collector_count.times do | collector_num |
+        collector = collectors[collector_num]
+        if (collector) then
+          collector_mask = collector[0]
+          if (collector_mask & region_mask != 0) then
+            if (collector_found) then
+              collector_found[0] |= collector_mask
+              collector_found[1] += collector[1]
+              collector_found[2] |= collector[2]
+              collectors[collector_num] = nil
+            else
+              collector_found = collector
+              collector[1] += region[1]
+              collector[2] |= region_mask
+            end
+          end
+        end
+      end
+      if (collector_found == nil) then
+        collectors.push(Array.new(region))
+      end
+    end
+
+    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
+    # the board is prunable.  if it is a multiple of five it is removed.
+    # Collector that are still active have a new adjacent value [0] set based n the matched bits
+    # and have [2] cleared out for the next cycle.
+    collectors.length.times do | collector_num |
+      collector = collectors[collector_num]
+      if (collector) then
+        if (collector[2] == 0) then
+          return true if (collector[1] % 5 != 0)
+          collectors[collector_num] = nil
+        else
+          # if a collector matches all bits in the row then we can return unprunable early for the
+          # following reasons:
+          #    1) there can be no more unavailable bits bince we fill from the top left downward
+          #    2) all previous regions have been closed or joined so only this region can fail
+          #    3) this region must be good since there can never be only 1 region that is nuot
+          #       a multiple of five
+          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+          # in pieces to see what configurations work for them (the only other time this algorithm is used).
+          return false if (collector[2] == 0b11111 && !slotting)
+          collector[0] = converter[collector[2]]
+          collector[2] = 0
+        end
+      end
+    end
+
+    # get rid of all the empty converters for the next round
+    collectors.compact!
+  end
+  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask.  see prunable for what a "region" is
+def create_regions( value )
+  regions = []
+  cur_region = 0
+  5.times do | bit |
+    if (value[bit] == 0) then
+      cur_region |= 1 << bit
+    else
+      if (cur_region != 0 ) then
+        regions.push( cur_region)
+        cur_region = 0;
+      end
+    end
+  end
+  regions.push(cur_region) if (cur_region != 0)
+  regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+  find_top( 1)
+  find_top( 0)
+  print_results
+end
+
+# show the board
+def print_results
+  print "#{@boards_found} solutions found\n\n"
+  print_full_board( @min_board)
+  print "\n"
+  print_full_board( @max_board)
+  print "\n"
+end
+
+# finds solutions.  This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece.  It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
+#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
+#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
+#   diminsh over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
+#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+#   maximum number
+def find_top( rotation_skip)
+  board = blank_board
+  (@pieces.length-1).times do
+    piece = @pieces.shift
+    piece.masks[0].each do | mask, imask, cmask |
+      if ((rotation_skip += 1) % 2 == 0) then
+        piece.placed = mask
+        find( 1, 1, board | mask)
+      end
+    end
+    @pieces.push(piece)
+  end
+  piece = @pieces.shift
+  @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+#  start_location -- where to start looking for place for the next piece at
+#  placed -- number of pieces placed
+#  board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+  # find the next location to place a piece by looking for an empty bit
+  while board[start_location] == 1
+    start_location += 1
+  end
+
+  @pieces.length.times do
+    piece = @pieces.shift
+    piece.masks[start_location].each do | mask, imask, cmask |
+      if ( board & cmask == imask) then
+        piece.placed = mask
+        if (placed == 9) then
+          add_board
+        else
+          find( start_location + 1, placed + 1, board | mask)
+        end
+      end
+    end
+    @pieces.push(piece)
+  end
+end
+
+# print the board
+def print_full_board( board_string)
+  10.times do | row |
+    print " " if (row % 2 == 1)
+    5.times do | col |
+      print "#{board_string[row*5 + col,1]} "
+    end
+    print "\n"
+  end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+  board_string = "99999999999999999999999999999999999999999999999999"
+  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
+  save( board_string)
+  save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+  if (@all_boards[board_string] == nil) then
+    @min_board = board_string if (board_string < @min_board)
+    @max_board = board_string if (board_string > @max_board)
+    @all_boards.store(board_string,true)
+    @boards_found += 1
+
+    # the exit motif is a time saver.  Ideally the function should return, but those tests
+    # take noticeable time (performance).
+    if (@boards_found == @stop_count) then
+      print_results
+      exit(0)
+    end
+  end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+  Piece.new( [ :nw, :ne, :east, :east ], 2),
+  Piece.new( [ :ne, :se, :east, :ne ], 7),
+  Piece.new( [ :ne, :east, :ne, :nw ], 1),
+  Piece.new( [ :east, :sw, :sw, :se ], 6),
+  Piece.new( [ :east, :ne, :se, :ne ], 5),
+  Piece.new( [ :east, :east, :east, :se ], 0),
+  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+  Piece.new( [ :se, :se, :se, :west ], 9),
+  Piece.new( [ :se, :se, :east, :se ], 8),
+  Piece.new( [ :east, :east, :sw, :se ], 3)
+  ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
new file mode 100644
index 0000000000..d6c5bb9e61
--- /dev/null
+++ b/benchmark/bm_so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+ def initialize(x, y, z, vx, vy, vz, mass)
+  @x, @y, @z = x, y, z
+  @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+  @mass = mass * SOLAR_MASS
+ end
+
+ def move_from_i(bodies, nbodies, dt, i)
+  while i < nbodies
+   b2 = bodies[i]
+   dx = @x - b2.x
+   dy = @y - b2.y
+   dz = @z - b2.z
+
+   distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+   mag = dt / (distance * distance * distance)
+   b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+   @vx -= dx * b2_mass_mag
+   @vy -= dy * b2_mass_mag
+   @vz -= dz * b2_mass_mag
+   b2.vx += dx * b_mass_mag
+   b2.vy += dy * b_mass_mag
+   b2.vz += dz * b_mass_mag
+   i += 1
+  end
+
+  @x += dt * @vx
+  @y += dt * @vy
+  @z += dt * @vz
+ end
+end
+
+def energy(bodies)
+  e = 0.0
+  nbodies = bodies.size
+
+  for i in 0 ... nbodies
+    b = bodies[i]
+    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+    for j in (i + 1) ... nbodies
+      b2 = bodies[j]
+      dx = b.x - b2.x
+      dy = b.y - b2.y
+      dz = b.z - b2.z
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      e -= (b.mass * b2.mass) / distance
+    end
+  end
+  e
+end
+
+def offset_momentum(bodies)
+  px, py, pz = 0.0, 0.0, 0.0
+
+  for b in bodies
+    m = b.mass
+    px += b.vx * m
+    py += b.vy * m
+    pz += b.vz * m
+  end
+
+  b = bodies[0]
+  b.vx = - px / SOLAR_MASS
+  b.vy = - py / SOLAR_MASS
+  b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+  # sun
+  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+  # jupiter
+  Planet.new(
+    4.84143144246472090e+00,
+    -1.16032004402742839e+00,
+    -1.03622044471123109e-01,
+    1.66007664274403694e-03,
+    7.69901118419740425e-03,
+    -6.90460016972063023e-05,
+    9.54791938424326609e-04),
+
+  # saturn
+  Planet.new(
+    8.34336671824457987e+00,
+    4.12479856412430479e+00,
+    -4.03523417114321381e-01,
+    -2.76742510726862411e-03,
+    4.99852801234917238e-03,
+    2.30417297573763929e-05,
+    2.85885980666130812e-04),
+
+  # uranus
+  Planet.new(
+    1.28943695621391310e+01,
+    -1.51111514016986312e+01,
+    -2.23307578892655734e-01,
+    2.96460137564761618e-03,
+    2.37847173959480950e-03,
+    -2.96589568540237556e-05,
+    4.36624404335156298e-05),
+
+  # neptune
+  Planet.new(
+    1.53796971148509165e+01,
+    -2.59193146099879641e+01,
+    1.79258772950371181e-01,
+    2.68067772490389322e-03,
+    1.62824170038242295e-03,
+    -9.51592254519715870e-05,
+    5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+  i = 0
+  while i < nbodies
+    b = BODIES[i]
+    b.move_from_i(BODIES, nbodies, dt, i + 1)
+    i += 1
+  end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
new file mode 100644
index 0000000000..a0513f8c47
--- /dev/null
+++ b/benchmark/bm_so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+    n.times do
+        n.times do
+            n.times do
+                n.times do
+                    n.times do
+                        x += 1
+                    end
+                end
+            end
+        end
+    end
+end
+# puts x
+
+
diff --git a/benchmark/so_nsieve.rb b/benchmark/bm_so_nsieve.rb
index a65cc78233..a65cc78233 100644
--- a/benchmark/so_nsieve.rb
+++ b/benchmark/bm_so_nsieve.rb
diff --git a/benchmark/so_nsieve_bits.rb b/benchmark/bm_so_nsieve_bits.rb
index 6f958ee44e..6f958ee44e 100644
--- a/benchmark/so_nsieve_bits.rb
+++ b/benchmark/bm_so_nsieve_bits.rb
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
new file mode 100644
index 0000000000..e8607c7199
--- /dev/null
+++ b/benchmark/bm_so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+    def initialize(start_state)
+        @bool = start_state
+    end
+
+    def value
+        @bool
+    end
+
+    def activate
+        @bool = !@bool
+        self
+    end
+end
+
+class NthToggle < Toggle
+    def initialize(start_state, max_counter)
+        super start_state
+        @count_max = max_counter
+        @counter = 0
+    end
+
+    def activate
+        @counter += 1
+        if @counter >= @count_max
+            @bool = !@bool
+            @counter = 0
+        end
+        self
+    end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+    toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+    ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/so_partial_sums.rb b/benchmark/bm_so_partial_sums.rb
index 630b45cb8d..630b45cb8d 100644
--- a/benchmark/so_partial_sums.rb
+++ b/benchmark/bm_so_partial_sums.rb
diff --git a/benchmark/so_pidigits.rb b/benchmark/bm_so_pidigits.rb
index 9a537b2d1c..9a537b2d1c 100644
--- a/benchmark/so_pidigits.rb
+++ b/benchmark/bm_so_pidigits.rb
diff --git a/benchmark/so_random.rb b/benchmark/bm_so_random.rb
index a66b9e8e63..a66b9e8e63 100644
--- a/benchmark/so_random.rb
+++ b/benchmark/bm_so_random.rb
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
new file mode 100644
index 0000000000..82ea666994
--- /dev/null
+++ b/benchmark/bm_so_reverse_complement.rb
@@ -0,0 +1,30 @@
+#!/usr/bin/ruby
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# Contributed by Peter Bjarke Olsen
+# Modified by Doug King
+
+seq=Array.new
+
+def revcomp(seq)
+  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+  stringlen=seq.length
+  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+while input.gets
+  if $_ =~ />/
+    if seq.length != 0
+      revcomp(seq.join)
+      seq=Array.new
+    end
+    puts $_
+  else
+    $_.sub(/\n/,'')
+    seq.push $_
+  end
+end
+revcomp(seq.join)
diff --git a/benchmark/so_sieve.rb b/benchmark/bm_so_sieve.rb
index 43dc302648..43dc302648 100644
--- a/benchmark/so_sieve.rb
+++ b/benchmark/bm_so_sieve.rb
diff --git a/benchmark/so_spectralnorm.rb b/benchmark/bm_so_spectralnorm.rb
index 6b97206689..6b97206689 100644
--- a/benchmark/so_spectralnorm.rb
+++ b/benchmark/bm_so_spectralnorm.rb
diff --git a/benchmark/string_index.rb b/benchmark/bm_string_index.rb
index 7783111082..7783111082 100644
--- a/benchmark/string_index.rb
+++ b/benchmark/bm_string_index.rb
diff --git a/benchmark/string_scan_re.rb b/benchmark/bm_string_scan_re.rb
index b0d60201a9..b0d60201a9 100644
--- a/benchmark/string_scan_re.rb
+++ b/benchmark/bm_string_scan_re.rb
diff --git a/benchmark/string_scan_str.rb b/benchmark/bm_string_scan_str.rb
index 42440bd948..42440bd948 100644
--- a/benchmark/string_scan_str.rb
+++ b/benchmark/bm_string_scan_str.rb
diff --git a/benchmark/time_subsec.rb b/benchmark/bm_time_subsec.rb
index 505021c701..505021c701 100644
--- a/benchmark/time_subsec.rb
+++ b/benchmark/bm_time_subsec.rb
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
new file mode 100644
index 0000000000..16906f3605
--- /dev/null
+++ b/benchmark/bm_vm1_attr_ivar.rb
@@ -0,0 +1,14 @@
+class C
+  attr_reader :a, :b
+  def initialize
+    @a = nil
+    @b = nil
+  end
+end
+obj = C.new
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = obj.a
+  k = obj.b
+end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
new file mode 100644
index 0000000000..7e7a6b48c0
--- /dev/null
+++ b/benchmark/bm_vm1_attr_ivar_set.rb
@@ -0,0 +1,14 @@
+class C
+  attr_accessor :a, :b
+  def initialize
+    @a = nil
+    @b = nil
+  end
+end
+obj = C.new
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  obj.a = 1
+  obj.b = 2
+end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
new file mode 100644
index 0000000000..a9f56b15ea
--- /dev/null
+++ b/benchmark/bm_vm1_block.rb
@@ -0,0 +1,10 @@
+def m
+  yield
+end
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  m{
+  }
+end
diff --git a/benchmark/bm_vm1_blockparam.rb b/benchmark/bm_vm1_blockparam.rb
new file mode 100755
index 0000000000..11680a2e61
--- /dev/null
+++ b/benchmark/bm_vm1_blockparam.rb
@@ -0,0 +1,9 @@
+def m &b
+end
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  m{}
+end
+
diff --git a/benchmark/bm_vm1_blockparam_call.rb b/benchmark/bm_vm1_blockparam_call.rb
new file mode 100755
index 0000000000..f6102a2b5a
--- /dev/null
+++ b/benchmark/bm_vm1_blockparam_call.rb
@@ -0,0 +1,9 @@
+def m &b
+  b.call
+end
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  m{}
+end
diff --git a/benchmark/bm_vm1_blockparam_pass.rb b/benchmark/bm_vm1_blockparam_pass.rb
new file mode 100755
index 0000000000..10029a257a
--- /dev/null
+++ b/benchmark/bm_vm1_blockparam_pass.rb
@@ -0,0 +1,13 @@
+def bp_yield
+  yield
+end
+
+def bp_pass &b
+  bp_yield &b
+end
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  bp_pass{}
+end
diff --git a/benchmark/bm_vm1_blockparam_yield.rb b/benchmark/bm_vm1_blockparam_yield.rb
new file mode 100755
index 0000000000..6dc01ced7c
--- /dev/null
+++ b/benchmark/bm_vm1_blockparam_yield.rb
@@ -0,0 +1,9 @@
+def bp_yield &b
+  yield
+end
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  bp_yield{}
+end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
new file mode 100644
index 0000000000..ac59ebccf1
--- /dev/null
+++ b/benchmark/bm_vm1_const.rb
@@ -0,0 +1,8 @@
+Const = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = Const
+  k = Const
+end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
new file mode 100644
index 0000000000..a1596145f2
--- /dev/null
+++ b/benchmark/bm_vm1_ensure.rb
@@ -0,0 +1,11 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+  i += 1
+  begin
+    begin
+    ensure
+    end
+  ensure
+  end
+end
+
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
new file mode 100644
index 0000000000..d4581439ff
--- /dev/null
+++ b/benchmark/bm_vm1_float_simple.rb
@@ -0,0 +1,7 @@
+i = 0.0; f = 0.0
+while i<30_000_000
+  i += 1
+  f += 0.1; f -= 0.1
+  f += 0.1; f -= 0.1
+  f += 0.1; f -= 0.1
+end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
new file mode 100644
index 0000000000..e78bca5668
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_lived.rb
@@ -0,0 +1,10 @@
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
new file mode 100644
index 0000000000..b66052dee0
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_complex_long.rb
@@ -0,0 +1,27 @@
+def nested_hash h, n
+  if n == 0
+    ''
+  else
+    10.times{
+      h[Object.new] = nested_hash(h, n-1)
+    }
+  end
+end
+
+long_lived = Hash.new
+nested_hash long_lived, 6
+
+GC.start
+GC.start
+
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
+
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
new file mode 100644
index 0000000000..298dbc845b
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_long.rb
@@ -0,0 +1,13 @@
+long_lived = Array.new(1_000_000){|i| "#{i}"}
+GC.start
+GC.start
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
new file mode 100644
index 0000000000..6b15c1b7bf
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_symbol.rb
@@ -0,0 +1,15 @@
+# make many symbols
+50_000.times{|i| sym = "sym#{i}".to_sym}
+GC.start
+GC.start
+
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
new file mode 100644
index 0000000000..1b030386cf
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_ary.rb
@@ -0,0 +1,12 @@
+short_lived_ary = []
+
+if RUBY_VERSION >= "2.2.0"
+  GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  short_lived_ary[0] = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_ary_promoted.rb b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
new file mode 100644
index 0000000000..ebc369a60f
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
@@ -0,0 +1,14 @@
+long_lived = []
+
+if RUBY_VERSION > "2.2.0"
+  3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+elsif
+  GC.start
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  long_lived[0] = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
new file mode 100644
index 0000000000..96f4261915
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_obj.rb
@@ -0,0 +1,15 @@
+class C
+  attr_accessor :foo
+end
+short_lived_obj = C.new
+
+if RUBY_VERSION >= "2.2.0"
+  GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  short_lived_obj.foo = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_obj_promoted.rb b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
new file mode 100644
index 0000000000..674c413992
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
@@ -0,0 +1,17 @@
+class C
+  attr_accessor :foo
+end
+long_lived = C.new
+
+if RUBY_VERSION >= "2.2.0"
+  3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+elsif
+  GC.start
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  long_lived.foo = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
new file mode 100644
index 0000000000..68a73cf92f
--- /dev/null
+++ b/benchmark/bm_vm1_ivar.rb
@@ -0,0 +1,8 @@
+@a = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = @a
+  k = @a
+end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
new file mode 100644
index 0000000000..bd81b06c34
--- /dev/null
+++ b/benchmark/bm_vm1_ivar_set.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  @a = 1
+  @b = 2
+end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
new file mode 100644
index 0000000000..353de3ab0e
--- /dev/null
+++ b/benchmark/bm_vm1_length.rb
@@ -0,0 +1,9 @@
+a = 'abc'
+b = [1, 2, 3]
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a.length
+  b.length
+end
+
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
new file mode 100644
index 0000000000..36f2068811
--- /dev/null
+++ b/benchmark/bm_vm1_lvar_init.rb
@@ -0,0 +1,18 @@
+def m v
+  unless v
+    # unreachable code
+    v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
+    v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
+    v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
+    v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
+    v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
+  end
+end
+
+i = 0
+
+while i<30_000_000 # while loop 1
+  i += 1
+  m i
+end
+
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
new file mode 100644
index 0000000000..222e864134
--- /dev/null
+++ b/benchmark/bm_vm1_lvar_set.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
+end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
new file mode 100644
index 0000000000..bbb4ae07a4
--- /dev/null
+++ b/benchmark/bm_vm1_neq.rb
@@ -0,0 +1,8 @@
+i = 0
+obj1 = Object.new
+obj2 = Object.new
+
+while i<30_000_000 # while loop 1
+  i += 1
+  obj1 != obj2
+end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
new file mode 100644
index 0000000000..b09ecdcc21
--- /dev/null
+++ b/benchmark/bm_vm1_not.rb
@@ -0,0 +1,7 @@
+i = 0
+obj = Object.new
+
+while i<30_000_000 # while loop 1
+  i += 1
+  !obj
+end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
new file mode 100644
index 0000000000..b0d3e2bdfa
--- /dev/null
+++ b/benchmark/bm_vm1_rescue.rb
@@ -0,0 +1,7 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  begin
+  rescue
+  end
+end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
new file mode 100644
index 0000000000..63f9f21675
--- /dev/null
+++ b/benchmark/bm_vm1_simplereturn.rb
@@ -0,0 +1,9 @@
+def m
+  return 1
+end
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  m
+end
+
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
new file mode 100644
index 0000000000..918f8b2112
--- /dev/null
+++ b/benchmark/bm_vm1_swap.rb
@@ -0,0 +1,8 @@
+a = 1
+b = 2
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a, b = b, a
+end
+
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
new file mode 100644
index 0000000000..775597cea6
--- /dev/null
+++ b/benchmark/bm_vm1_yield.rb
@@ -0,0 +1,10 @@
+def m
+  i = 0
+  while i<30_000_000 # while loop 1
+    i += 1
+    yield
+  end
+end
+
+m{}
+
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
new file mode 100644
index 0000000000..df9037c83c
--- /dev/null
+++ b/benchmark/bm_vm2_array.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  a = [1,2,3,4,5,6,7,8,9,10]
+end
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
new file mode 100644
index 0000000000..b02509d6a2
--- /dev/null
+++ b/benchmark/bm_vm2_bigarray.rb
@@ -0,0 +1,106 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  a = [
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+  ]
+end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
new file mode 100644
index 0000000000..5e3f437bb8
--- /dev/null
+++ b/benchmark/bm_vm2_bighash.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<60_000 # benchmark loop 2
+  i += 1
+  a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
new file mode 100644
index 0000000000..adc6e4df0a
--- /dev/null
+++ b/benchmark/bm_vm2_case.rb
@@ -0,0 +1,14 @@
+i = 0
+while i<6_000_000 # while loop 2
+  case :foo
+  when :bar
+    raise
+  when :baz
+    raise
+  when :boo
+    raise
+  when :foo
+    i += 1
+  end
+end
+
diff --git a/benchmark/bm_vm2_case_lit.rb b/benchmark/bm_vm2_case_lit.rb
new file mode 100644
index 0000000000..c62b294e0e
--- /dev/null
+++ b/benchmark/bm_vm2_case_lit.rb
@@ -0,0 +1,19 @@
+i = 0
+@ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
+def foo(i)
+  @ret[i % @ret.size]
+end
+
+while i<6_000_000 # while loop 2
+  case foo(i)
+  when "foo" then :foo
+  when true then true
+  when false then false
+  when :sym then :sym
+  when 6 then :fix
+  when nil then nil
+  when 0.1 then :float
+  when 0xffffffffffffffff then :big
+  end
+  i += 1
+end
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
new file mode 100644
index 0000000000..053ed6c912
--- /dev/null
+++ b/benchmark/bm_vm2_defined_method.rb
@@ -0,0 +1,9 @@
+class Object
+  define_method(:m){}
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/bm_vm2_dstr.rb
new file mode 100644
index 0000000000..58c0f7bbc3
--- /dev/null
+++ b/benchmark/bm_vm2_dstr.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = 'z'
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
new file mode 100644
index 0000000000..307cfc28ef
--- /dev/null
+++ b/benchmark/bm_vm2_eval.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  eval("1")
+end
+
diff --git a/benchmark/bm_vm2_fiber_switch.rb b/benchmark/bm_vm2_fiber_switch.rb
new file mode 100644
index 0000000000..c6f615d71d
--- /dev/null
+++ b/benchmark/bm_vm2_fiber_switch.rb
@@ -0,0 +1,9 @@
+# based on benchmark for [ruby-core:65518] [Feature #10341] by Knut Franke
+fib = Fiber.new do
+  loop { Fiber.yield }
+end
+i = 0
+while i< 6_000_000 # benchmark loop 2
+  i += 1
+  fib.resume
+end
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
new file mode 100644
index 0000000000..a8ccff7138
--- /dev/null
+++ b/benchmark/bm_vm2_method.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb
new file mode 100644
index 0000000000..2badc73101
--- /dev/null
+++ b/benchmark/bm_vm2_method_missing.rb
@@ -0,0 +1,12 @@
+class C
+  def method_missing mid
+  end
+end
+
+obj = C.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
+end
diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb
new file mode 100644
index 0000000000..b4efb4f520
--- /dev/null
+++ b/benchmark/bm_vm2_method_with_block.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
+end
diff --git a/benchmark/bm_vm2_module_ann_const_set.rb b/benchmark/bm_vm2_module_ann_const_set.rb
new file mode 100644
index 0000000000..12ccfd2ff3
--- /dev/null
+++ b/benchmark/bm_vm2_module_ann_const_set.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  Module.new.const_set(:X, Module.new)
+end
diff --git a/benchmark/bm_vm2_module_const_set.rb b/benchmark/bm_vm2_module_const_set.rb
new file mode 100644
index 0000000000..f4d4c1b2e7
--- /dev/null
+++ b/benchmark/bm_vm2_module_const_set.rb
@@ -0,0 +1,8 @@
+i = 0
+module M
+end
+$VERBOSE = nil
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  M.const_set(:X, Module.new)
+end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
new file mode 100644
index 0000000000..5d16480c6b
--- /dev/null
+++ b/benchmark/bm_vm2_mutex.rb
@@ -0,0 +1,9 @@
+require 'thread'
+
+m = Thread::Mutex.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m.synchronize{}
+end
diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/bm_vm2_newlambda.rb
new file mode 100644
index 0000000000..6422c9b0d0
--- /dev/null
+++ b/benchmark/bm_vm2_newlambda.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  lambda {}
+end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
new file mode 100644
index 0000000000..c82c0e4bce
--- /dev/null
+++ b/benchmark/bm_vm2_poly_method.rb
@@ -0,0 +1,20 @@
+class C1
+  def m
+    1
+  end
+end
+class C2
+  def m
+    2
+  end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  o = (i % 2 == 0) ? o1 : o2
+  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+  i += 1
+end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
new file mode 100644
index 0000000000..aa5fd1dd38
--- /dev/null
+++ b/benchmark/bm_vm2_poly_method_ov.rb
@@ -0,0 +1,20 @@
+class C1
+  def m
+    1
+  end
+end
+class C2
+  def m
+    2
+  end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  o = (i % 2 == 0) ? o1 : o2
+#  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+  i += 1
+end
diff --git a/benchmark/bm_vm2_poly_singleton.rb b/benchmark/bm_vm2_poly_singleton.rb
new file mode 100644
index 0000000000..0dba4320c4
--- /dev/null
+++ b/benchmark/bm_vm2_poly_singleton.rb
@@ -0,0 +1,14 @@
+class C1
+  def m; 1; end
+end
+
+o1 = C1.new
+o2 = C1.new
+o2.singleton_class
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  o = (i % 2 == 0) ? o1 : o2
+  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+  i += 1
+end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
new file mode 100644
index 0000000000..65e5217371
--- /dev/null
+++ b/benchmark/bm_vm2_proc.rb
@@ -0,0 +1,14 @@
+def m &b
+  b
+end
+
+pr = m{
+  a = 1
+}
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  pr.call
+end
+
diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb
new file mode 100644
index 0000000000..aa5387987f
--- /dev/null
+++ b/benchmark/bm_vm2_raise1.rb
@@ -0,0 +1,18 @@
+def rec n
+  if n > 0
+    rec n-1
+  else
+    raise
+  end
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+
+  begin
+    rec 1
+  rescue
+    # ignore
+  end
+end
diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb
new file mode 100644
index 0000000000..1f61c63157
--- /dev/null
+++ b/benchmark/bm_vm2_raise2.rb
@@ -0,0 +1,18 @@
+def rec n
+  if n > 0
+    rec n-1
+  else
+    raise
+  end
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+
+  begin
+    rec 10
+  rescue
+    # ignore
+  end
+end
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
new file mode 100644
index 0000000000..55f9e957a3
--- /dev/null
+++ b/benchmark/bm_vm2_regexp.rb
@@ -0,0 +1,6 @@
+i = 0
+str = 'xxxhogexxx'
+while i<6_000_000 # benchmark loop 2
+  /hoge/ =~ str
+  i += 1
+end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
new file mode 100644
index 0000000000..6a3ab6fdab
--- /dev/null
+++ b/benchmark/bm_vm2_send.rb
@@ -0,0 +1,12 @@
+class C
+  def m
+  end
+end
+
+o = C.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  o.__send__ :m
+end
diff --git a/benchmark/bm_vm2_string_literal.rb b/benchmark/bm_vm2_string_literal.rb
new file mode 100644
index 0000000000..1d73036849
--- /dev/null
+++ b/benchmark/bm_vm2_string_literal.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
+end
diff --git a/benchmark/bm_vm2_struct_big_aref_hi.rb b/benchmark/bm_vm2_struct_big_aref_hi.rb
new file mode 100644
index 0000000000..22cb26b0a5
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_aref_hi.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.z # x[25]
+end
diff --git a/benchmark/bm_vm2_struct_big_aref_lo.rb b/benchmark/bm_vm2_struct_big_aref_lo.rb
new file mode 100644
index 0000000000..5e61a7087e
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_aref_lo.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.k # x[10]
+end
diff --git a/benchmark/bm_vm2_struct_big_aset.rb b/benchmark/bm_vm2_struct_big_aset.rb
new file mode 100644
index 0000000000..5a1c3d16f3
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_aset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.k = i # x[10] = i
+end
diff --git a/benchmark/bm_vm2_struct_big_href_hi.rb b/benchmark/bm_vm2_struct_big_href_hi.rb
new file mode 100644
index 0000000000..fff940a80a
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_href_hi.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:z]
+end
diff --git a/benchmark/bm_vm2_struct_big_href_lo.rb b/benchmark/bm_vm2_struct_big_href_lo.rb
new file mode 100644
index 0000000000..5e4085d59d
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_href_lo.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:k]
+end
diff --git a/benchmark/bm_vm2_struct_big_hset.rb b/benchmark/bm_vm2_struct_big_hset.rb
new file mode 100644
index 0000000000..9c0cee4141
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_hset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:k] = i
+end
diff --git a/benchmark/bm_vm2_struct_small_aref.rb b/benchmark/bm_vm2_struct_small_aref.rb
new file mode 100644
index 0000000000..8eaa555b41
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_aref.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.a
+end
diff --git a/benchmark/bm_vm2_struct_small_aset.rb b/benchmark/bm_vm2_struct_small_aset.rb
new file mode 100644
index 0000000000..ecd0f95669
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_aset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.a = i
+end
diff --git a/benchmark/bm_vm2_struct_small_href.rb b/benchmark/bm_vm2_struct_small_href.rb
new file mode 100644
index 0000000000..2c88fee6bf
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_href.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:a]
+end
diff --git a/benchmark/bm_vm2_struct_small_hset.rb b/benchmark/bm_vm2_struct_small_hset.rb
new file mode 100644
index 0000000000..33c36d20f1
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_hset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:a] = 1
+end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
new file mode 100644
index 0000000000..afd8579e7b
--- /dev/null
+++ b/benchmark/bm_vm2_super.rb
@@ -0,0 +1,20 @@
+
+class C
+  def m
+    1
+  end
+end
+
+class CC < C
+  def m
+    super()
+  end
+end
+
+obj = CC.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  obj.m
+  i += 1
+end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
new file mode 100644
index 0000000000..1774625942
--- /dev/null
+++ b/benchmark/bm_vm2_unif1.rb
@@ -0,0 +1,8 @@
+i = 0
+def m a, b
+end
+
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m 100, 200
+end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
new file mode 100644
index 0000000000..2a43e62217
--- /dev/null
+++ b/benchmark/bm_vm2_zsuper.rb
@@ -0,0 +1,20 @@
+i = 0
+
+class C
+  def m a
+    1
+  end
+end
+
+class CC < C
+  def m a
+    super
+  end
+end
+
+obj = CC.new
+
+while i<6_000_000 # benchmark loop 2
+  obj.m 10
+  i += 1
+end
diff --git a/benchmark/vm_backtrace.rb b/benchmark/bm_vm3_backtrace.rb
index 0fbf73e1ca..0fbf73e1ca 100644
--- a/benchmark/vm_backtrace.rb
+++ b/benchmark/bm_vm3_backtrace.rb
diff --git a/benchmark/vm_clearmethodcache.rb b/benchmark/bm_vm3_clearmethodcache.rb
index 9661323cd2..9661323cd2 100644
--- a/benchmark/vm_clearmethodcache.rb
+++ b/benchmark/bm_vm3_clearmethodcache.rb
diff --git a/benchmark/vm_gc.rb b/benchmark/bm_vm3_gc.rb
index e668026915..e668026915 100644
--- a/benchmark/vm_gc.rb
+++ b/benchmark/bm_vm3_gc.rb
diff --git a/benchmark/vm_gc_old_full.rb b/benchmark/bm_vm3_gc_old_full.rb
index cfdfc8c5a5..cfdfc8c5a5 100644
--- a/benchmark/vm_gc_old_full.rb
+++ b/benchmark/bm_vm3_gc_old_full.rb
diff --git a/benchmark/vm_gc_old_immediate.rb b/benchmark/bm_vm3_gc_old_immediate.rb
index ad22feb655..ad22feb655 100644
--- a/benchmark/vm_gc_old_immediate.rb
+++ b/benchmark/bm_vm3_gc_old_immediate.rb
diff --git a/benchmark/vm_gc_old_lazy.rb b/benchmark/bm_vm3_gc_old_lazy.rb
index b74d44baf1..b74d44baf1 100644
--- a/benchmark/vm_gc_old_lazy.rb
+++ b/benchmark/bm_vm3_gc_old_lazy.rb
diff --git a/benchmark/vm_symbol_block_pass.rb b/benchmark/bm_vm_symbol_block_pass.rb
index 1d433353e1..1d433353e1 100644
--- a/benchmark/vm_symbol_block_pass.rb
+++ b/benchmark/bm_vm_symbol_block_pass.rb
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
new file mode 100644
index 0000000000..c993accdda
--- /dev/null
+++ b/benchmark/bm_vm_thread_alive_check1.rb
@@ -0,0 +1,6 @@
+5_000.times{
+  t = Thread.new{}
+  while t.alive?
+    Thread.pass
+  end
+}
diff --git a/benchmark/vm_thread_close.rb b/benchmark/bm_vm_thread_close.rb
index 3e9a265ce8..3e9a265ce8 100644
--- a/benchmark/vm_thread_close.rb
+++ b/benchmark/bm_vm_thread_close.rb
diff --git a/benchmark/bm_vm_thread_condvar1.rb b/benchmark/bm_vm_thread_condvar1.rb
new file mode 100644
index 0000000000..cf5706b23e
--- /dev/null
+++ b/benchmark/bm_vm_thread_condvar1.rb
@@ -0,0 +1,28 @@
+# two threads, two mutex, two condvar ping-pong
+require 'thread'
+m1 = Mutex.new
+m2 = Mutex.new
+cv1 = ConditionVariable.new
+cv2 = ConditionVariable.new
+max = 100000
+i = 0
+wait = nil
+m2.synchronize do
+  wait = Thread.new do
+    m1.synchronize do
+      m2.synchronize { cv2.signal }
+      while (i += 1) < max
+        cv1.wait(m1)
+        cv2.signal
+      end
+    end
+  end
+  cv2.wait(m2)
+end
+m1.synchronize do
+  while i < max
+    cv1.signal
+    cv2.wait(m1)
+  end
+end
+wait.join
diff --git a/benchmark/bm_vm_thread_condvar2.rb b/benchmark/bm_vm_thread_condvar2.rb
new file mode 100644
index 0000000000..7c8dc19481
--- /dev/null
+++ b/benchmark/bm_vm_thread_condvar2.rb
@@ -0,0 +1,35 @@
+# many threads, one mutex, many condvars
+require 'thread'
+m = Mutex.new
+cv1 = ConditionVariable.new
+cv2 = ConditionVariable.new
+max = 1000
+n = 100
+waiting = 0
+scvs = []
+waiters = n.times.map do |i|
+  start_cv = ConditionVariable.new
+  scvs << start_cv
+  start_mtx = Mutex.new
+  start_mtx.synchronize do
+    th = Thread.new(start_mtx, start_cv) do |sm, scv|
+      m.synchronize do
+        sm.synchronize { scv.signal }
+        max.times do
+          cv2.signal if (waiting += 1) == n
+          cv1.wait(m)
+        end
+      end
+    end
+    start_cv.wait(start_mtx)
+    th
+  end
+end
+m.synchronize do
+  max.times do
+    cv2.wait(m) until waiting == n
+    waiting = 0
+    cv1.broadcast
+  end
+end
+waiters.each(&:join)
diff --git a/benchmark/vm_thread_create_join.rb b/benchmark/bm_vm_thread_create_join.rb
index 393cd45df9..393cd45df9 100644
--- a/benchmark/vm_thread_create_join.rb
+++ b/benchmark/bm_vm_thread_create_join.rb
diff --git a/benchmark/vm_thread_mutex1.rb b/benchmark/bm_vm_thread_mutex1.rb
index 66e42c85e1..66e42c85e1 100644
--- a/benchmark/vm_thread_mutex1.rb
+++ b/benchmark/bm_vm_thread_mutex1.rb
diff --git a/benchmark/vm_thread_mutex2.rb b/benchmark/bm_vm_thread_mutex2.rb
index 6e6c804c31..6e6c804c31 100644
--- a/benchmark/vm_thread_mutex2.rb
+++ b/benchmark/bm_vm_thread_mutex2.rb
diff --git a/benchmark/vm_thread_mutex3.rb b/benchmark/bm_vm_thread_mutex3.rb
index c750dc542a..c750dc542a 100644
--- a/benchmark/vm_thread_mutex3.rb
+++ b/benchmark/bm_vm_thread_mutex3.rb
diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/bm_vm_thread_pass.rb
new file mode 100644
index 0000000000..b5b3c0bc85
--- /dev/null
+++ b/benchmark/bm_vm_thread_pass.rb
@@ -0,0 +1,15 @@
+# Plenty Thtread.pass
+# A performance may depend on GVL implementation.
+
+tmax = (ARGV.shift || 2).to_i
+lmax = 200_000 / tmax
+
+(1..tmax).map{
+  Thread.new{
+    lmax.times{
+      Thread.pass
+    }
+  }
+}.each{|t| t.join}
+
+
diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb
new file mode 100644
index 0000000000..a660aafc18
--- /dev/null
+++ b/benchmark/bm_vm_thread_pass_flood.rb
@@ -0,0 +1,10 @@
+# n.b. this is a good test for GVL when pinned to a single CPU
+
+1000.times{
+  Thread.new{loop{Thread.pass}}
+}
+
+i = 0
+while i<10000
+  i += 1
+end
diff --git a/benchmark/vm_thread_pipe.rb b/benchmark/bm_vm_thread_pipe.rb
index 112a621905..112a621905 100644
--- a/benchmark/vm_thread_pipe.rb
+++ b/benchmark/bm_vm_thread_pipe.rb
diff --git a/benchmark/bm_vm_thread_queue.rb b/benchmark/bm_vm_thread_queue.rb
new file mode 100644
index 0000000000..274ceda366
--- /dev/null
+++ b/benchmark/bm_vm_thread_queue.rb
@@ -0,0 +1,18 @@
+require 'thread'
+
+n = 1_000_000
+q = Thread::Queue.new
+consumer = Thread.new{
+  while q.pop
+    # consuming
+  end
+}
+
+producer = Thread.new{
+  n.times{
+    q.push true
+  }
+  q.push nil
+}
+
+consumer.join
diff --git a/benchmark/vm_thread_sized_queue.rb b/benchmark/bm_vm_thread_sized_queue.rb
index 7b9af5482b..7b9af5482b 100644
--- a/benchmark/vm_thread_sized_queue.rb
+++ b/benchmark/bm_vm_thread_sized_queue.rb
diff --git a/benchmark/vm_thread_sized_queue2.rb b/benchmark/bm_vm_thread_sized_queue2.rb
index de9f55e978..de9f55e978 100644
--- a/benchmark/vm_thread_sized_queue2.rb
+++ b/benchmark/bm_vm_thread_sized_queue2.rb
diff --git a/benchmark/vm_thread_sized_queue3.rb b/benchmark/bm_vm_thread_sized_queue3.rb
index ce5f1796d8..ce5f1796d8 100644
--- a/benchmark/vm_thread_sized_queue3.rb
+++ b/benchmark/bm_vm_thread_sized_queue3.rb
diff --git a/benchmark/vm_thread_sized_queue4.rb b/benchmark/bm_vm_thread_sized_queue4.rb
index a9b7d80ec0..a9b7d80ec0 100644
--- a/benchmark/vm_thread_sized_queue4.rb
+++ b/benchmark/bm_vm_thread_sized_queue4.rb
diff --git a/benchmark/buffer_each.yml b/benchmark/buffer_each.yml
deleted file mode 100644
index 417941104e..0000000000
--- a/benchmark/buffer_each.yml
+++ /dev/null
@@ -1,27 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-  Warning[:experimental] = false
-  string = "The quick brown fox jumped over the lazy dog."
-  array = string.bytes
-  buffer = IO::Buffer.for(string)
-benchmark:
-  string.each_byte: |
-    upcased = String.new
-    string.each_byte do |byte|
-      upcased << (byte ^ 32)
-    end
-  array.each: |
-    upcased = String.new
-    array.each do |byte|
-      upcased << (byte ^ 32)
-    end
-  buffer.each: |
-    upcased = String.new
-    buffer.each(:U8) do |offset, byte|
-      upcased << (byte ^ 32)
-    end
-  buffer.each_byte: |
-    upcased = String.new
-    buffer.each_byte do |byte|
-      upcased << (byte ^ 32)
-    end
diff --git a/benchmark/buffer_get.yml b/benchmark/buffer_get.yml
deleted file mode 100644
index 9e1f99d64e..0000000000
--- a/benchmark/buffer_get.yml
+++ /dev/null
@@ -1,25 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-  Warning[:experimental] = false
-  string = "The quick brown fox jumped over the lazy dog."
-  buffer = IO::Buffer.for(string)
-  format = [:U32, :U32, :U32, :U32]
-benchmark:
-  string.unpack1: |
-    [
-      string.unpack1("N"),
-      string.unpack1("N", offset: 4),
-      string.unpack1("N", offset: 8),
-      string.unpack1("N", offset: 12),
-    ]
-  buffer.get_value: |
-    [
-      buffer.get_value(:U32, 0),
-      buffer.get_value(:U32, 4),
-      buffer.get_value(:U32, 8),
-      buffer.get_value(:U32, 12),
-    ]
-  buffer.get_values: |
-    buffer.get_values(format, 0)
-  string.unpack: |
-    string.unpack("NNNN")
diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml
deleted file mode 100644
index 655be9d7d8..0000000000
--- a/benchmark/cgi_escape_html.yml
+++ /dev/null
@@ -1,31 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-  require 'cgi/escape'
-benchmark:
-  - script: CGI.escapeHTML("")
-    loop_count: 20000000
-  - script: CGI.escapeHTML("abcde")
-    loop_count: 20000000
-  - script: CGI.escapeHTML("abcd<")
-    loop_count: 20000000
-  - script: CGI.escapeHTML("'&\"<>")
-    loop_count: 5000000
-  - prelude: long_no_escape = "abcde" * 300
-    script: CGI.escapeHTML(long_no_escape)
-    loop_count: 1000000
-  - prelude: long_all_escape = "'&\"<>" * 10
-    script: CGI.escapeHTML(long_all_escape)
-    loop_count: 1000000
-  - prelude: | # http://example.com/
-      example_html = <<~HTML
-        <body>
-        <div>
-            <h1>Example Domain</h1>
-            <p>This domain is established to be used for illustrative examples in documents. You may use this
-            domain in examples without prior coordination or asking for permission.</p>
-            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
-        </div>
-        </body>
-      HTML
-    script: CGI.escapeHTML(example_html)
-    loop_count: 1000000
diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml
deleted file mode 100644
index d0150c5e5b..0000000000
--- a/benchmark/complex_float_add.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  max, min = 1000.0, -1000.0
-  a = Complex(rand(max)+min, rand(max)+min)
-  b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
-  complex_float_add: c = a + b
-loop_count: 1000000
diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml
deleted file mode 100644
index b9f5e1d51c..0000000000
--- a/benchmark/complex_float_div.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  max, min = 1000.0, -1000.0
-  a = Complex(rand(max)+min, rand(max)+min)
-  b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
-  complex_float_div: c = a / b
-loop_count: 1000000
diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml
deleted file mode 100644
index 59b096a6dc..0000000000
--- a/benchmark/complex_float_mul.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  max, min = 1000.0, -1000.0
-  a = Complex(rand(max)+min, rand(max)+min)
-  b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
-  complex_float_mul: c = a * b
-loop_count: 1000000
diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml
deleted file mode 100644
index 6fcde3125b..0000000000
--- a/benchmark/complex_float_new.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  max, min = 1000.0, -1000.0
-  a = Complex(rand(max)+min, rand(max)+min)
-  b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
-  complex_float_new: c = Complex(a, b)
-loop_count: 1000000
diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml
deleted file mode 100644
index c40a31ab55..0000000000
--- a/benchmark/complex_float_power.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  max, min = 1000.0, -1000.0
-  a = Complex(rand(max)+min, rand(max)+min)
-  b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
-  complex_float_power: c = a ** b
-loop_count: 1000000
diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml
deleted file mode 100644
index 3fafe7cdbe..0000000000
--- a/benchmark/complex_float_sub.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  max, min = 1000.0, -1000.0
-  a = Complex(rand(max)+min, rand(max)+min)
-  b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
-  complex_float_sub: c = a - b
-loop_count: 1000000
diff --git a/benchmark/constant_invalidation.rb b/benchmark/constant_invalidation.rb
deleted file mode 100644
index a95ec6f37e..0000000000
--- a/benchmark/constant_invalidation.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-$VERBOSE = nil
-
-CONSTANT1 = 1
-CONSTANT2 = 1
-CONSTANT3 = 1
-CONSTANT4 = 1
-CONSTANT5 = 1
-
-def constants
-  [CONSTANT1, CONSTANT2, CONSTANT3, CONSTANT4, CONSTANT5]
-end
-
-500_000.times do
-  constants
-
-  # With previous behavior, this would cause all of the constant caches
-  # associated with the constant lookups listed above to invalidate, meaning
-  # they would all have to be fetched again. With current behavior, it only
-  # invalidates when a name matches, so the following constant set shouldn't
-  # impact the constant lookups listed above.
-  INVALIDATE = true
-end
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
new file mode 100755
index 0000000000..469fc99f40
--- /dev/null
+++ b/benchmark/driver.rb
@@ -0,0 +1,441 @@
+#!/usr/bin/env ruby
+#
+# Ruby Benchmark driver
+#
+
+first = true
+
+begin
+  require 'optparse'
+rescue LoadError
+  if first
+    first = false
+    $:.unshift File.join(File.dirname(__FILE__), '../lib')
+    retry
+  else
+    raise
+  end
+end
+
+require 'benchmark'
+require 'pp'
+require 'tempfile'
+
+class BenchmarkDriver
+  def self.benchmark(opt)
+    driver = self.new(opt[:execs], opt[:dir], opt)
+    begin
+      driver.run
+    ensure
+      driver.show_results
+    end
+  end
+
+  def self.load(input, type, opt)
+    case type
+    when 'yaml'
+      require 'yaml'
+      h = YAML.load(input)
+    when 'json'
+      require 'json'
+      h = JSON.load(input)
+    else
+      h = eval(input.read)
+    end
+    results = h[:results] || h["results"]
+    obj = allocate
+    obj.instance_variable_set("@execs", h[:executables] || h["executables"])
+    obj.instance_variable_set("@results", results)
+    obj.instance_variable_set("@opt", opt)
+    [1, 2].each do |i|
+      loop = results.assoc((n = "loop_whileloop#{i}").intern) || results.assoc(n)
+      obj.instance_variable_set("@loop_wl#{i}", loop ? loop[1].map {|t,*|t} : nil)
+    end
+    obj.instance_variable_set("@measure_target", opt[:measure_target] || opt["measure_target"])
+    obj
+  end
+
+  def output *args
+    puts(*args)
+    @output and @output.puts(*args)
+  end
+
+  def message *args
+    output(*args) if @verbose
+  end
+
+  def message_print *args
+    if @verbose
+      print(*args)
+      STDOUT.flush
+      @output and @output.print(*args)
+    end
+  end
+
+  def progress_message *args
+    unless STDOUT.tty?
+      STDERR.print(*args)
+      STDERR.flush
+    end
+  end
+
+  def initialize execs, dir, opt = {}
+    @execs = execs.map{|e|
+      e.strip!
+      next if e.empty?
+
+      if /(.+)::(.+)/ =~ e
+        # ex) ruby-a::/path/to/ruby-a
+        label = $1.strip
+        path = $2
+        version = `#{path} -v`.chomp
+      else
+        path = e
+        version = label = `#{path} -v`.chomp
+      end
+      [path, label, version]
+    }.compact
+
+    @dir = dir
+    @repeat = opt[:repeat] || 1
+    @repeat = 1 if @repeat < 1
+    @pattern = opt[:pattern] || nil
+    @exclude = opt[:exclude] || nil
+    @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
+    @output = opt[:output] ? open(opt[:output], 'w') : nil
+    @loop_wl1 = @loop_wl2 = nil
+    @ruby_arg = opt[:ruby_arg] || nil
+    @measure_target = opt[:measure_target]
+    @opt = opt
+
+    # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
+    @results = []
+
+    if @verbose
+      @start_time = Time.now
+      message @start_time
+      @execs.each_with_index{|(path, label, version), i|
+        message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\""
+      }
+      message "measure target: #{@measure_target}"
+    end
+  end
+
+  def adjusted_results name, results
+    s = nil
+    results.each_with_index{|e, i|
+      r = e.min
+      case name
+      when /^vm1_/
+        if @loop_wl1
+          r -= @loop_wl1[i]
+          r = 0 if r < 0
+          s = '*'
+        end
+      when /^vm2_/
+        if @loop_wl2
+          r -= @loop_wl2[i]
+          r = 0 if r < 0
+          s = '*'
+        end
+      end
+      yield r
+    }
+    s
+  end
+
+  def show_results
+    case @opt[:format]
+    when :tsv
+      strformat = "\t%1$s"
+      numformat = "\t%1$*2$.3f"
+      minwidth = 0
+      name_width = 0
+    when :markdown
+      markdown = true
+      strformat = "|%1$-*2$s"
+      numformat = "|%1$*2$.3f"
+    when :plain
+      strformat = " %1$-*2$s"
+      numformat = " %1$*2$.3f"
+    end
+
+    name_width ||= @results.map {|v, result|
+      v.size + (case v; when /^vm1_/; @loop_wl1; when /^vm2_/; @loop_wl2; end ? 1 : 0)
+    }.max
+    minwidth ||= 7
+    width = @execs.map{|(_, v)| [v.size, minwidth].max}
+
+    output
+
+    if @verbose
+      message '-----------------------------------------------------------'
+      message 'raw data:'
+      message
+      message PP.pp(@results, "", 79)
+      message
+      message "Elapsed time: #{Time.now - @start_time} (sec)"
+    end
+
+    if rawdata_output = @opt[:rawdata_output]
+      h = {}
+      h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo')
+      h[:executables] = @execs
+      h[:results] = @results
+      if (type = File.extname(rawdata_output)).empty?
+        type = rawdata_output
+        rawdata_output = @output.path.sub(/\.[^.\/]+\z/, '') << '.' << rawdata_output
+      end
+      case type
+      when 'yaml'
+        require 'yaml'
+        h = YAML.dump(h)
+      when 'json'
+        require 'json'
+        h = JSON.pretty_generate(h)
+      else
+        require 'pp'
+        h = h.pretty_inspect
+      end
+      open(rawdata_output, 'w') {|f| f.puts h}
+    end
+
+    output '-----------------------------------------------------------'
+    output 'benchmark results:'
+
+    if @verbose and @repeat > 1
+      output "minimum results in each #{@repeat} measurements."
+    end
+
+    output({
+      real: "Execution time (sec)",
+      peak: "Memory usage (peak) (B)",
+      size: "Memory usage (last size) (B)",
+    }[@measure_target])
+    output if markdown
+    output ["name".ljust(name_width), @execs.map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
+    output ["-"*name_width, width.map{|n|":".rjust(n, "-")}].join("|") if markdown
+    @results.each{|v, result|
+      rets = []
+      s = adjusted_results(v, result){|r|
+        rets << sprintf(numformat, r, width[rets.size])
+      }
+      v += s if s
+      output [v.ljust(name_width), rets].join("")
+    }
+
+    if @execs.size > 1
+      output
+      output({
+        real: "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)",
+        peak: "Memory consuming ratio (peak) with the result of `#{@execs[0][1]}' (greater is better)",
+        size: "Memory consuming ratio (size) with the result of `#{@execs[0][1]}' (greater is better)",
+      }[@measure_target])
+      output if markdown
+      output ["name".ljust(name_width), @execs[1..-1].map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
+      output ["-"*name_width, width[1..-1].map{|n|":".rjust(n, "-")}].join("|") if markdown
+      @results.each{|v, result|
+        rets = []
+        first_value = nil
+        s = adjusted_results(v, result){|r|
+          if first_value
+            if r == 0
+              rets << "Error"
+            else
+              rets << sprintf(numformat, first_value/Float(r), width[rets.size+1])
+            end
+          else
+            first_value = r
+          end
+        }
+        v += s if s
+        output [v.ljust(name_width), rets].join("")
+      }
+    end
+
+    if @opt[:output]
+      output
+      output "Log file: #{@opt[:output]}"
+    end
+  end
+
+  def files
+    flag = {}
+    @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
+      next if @pattern && /#{@pattern}/ !~ File.basename(file)
+      next if @exclude && /#{@exclude}/ =~ File.basename(file)
+      case file
+      when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
+        flag[$1] = true
+      end
+      file
+    }.compact
+
+    if flag['vm1'] && !flag['whileloop']
+      @files << File.join(@dir, 'bm_loop_whileloop.rb')
+    elsif flag['vm2'] && !flag['whileloop2']
+      @files << File.join(@dir, 'bm_loop_whileloop2.rb')
+    end
+
+    @files.sort!
+    progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
+    @files
+  end
+
+  def run
+    files.each_with_index{|file, i|
+      @i = i
+      r = measure_file(file)
+
+      if /bm_loop_whileloop.rb/ =~ file
+        @loop_wl1 = r[1].map{|e| e.min}
+      elsif /bm_loop_whileloop2.rb/ =~ file
+        @loop_wl2 = r[1].map{|e| e.min}
+      end
+    }
+  end
+
+  def measure_file file
+    name = File.basename(file, '.rb').sub(/^bm_/, '')
+    prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
+    load prepare_file if FileTest.exist?(prepare_file)
+
+    if @verbose
+      output
+      output '-----------------------------------------------------------'
+      output name
+      output
+      output File.read(file)
+      output
+    end
+
+    result = [name]
+    result << @execs.map{|(e, v)|
+      (0...@repeat).map{
+        message_print "#{v}\t"
+        progress_message '.'
+
+        m = measure(e, file)
+        message "#{m}"
+        m
+      }
+    }
+    @results << result
+    result
+  end
+
+  unless defined?(File::NULL)
+    if File.exist?('/dev/null')
+      File::NULL = '/dev/null'
+    end
+  end
+
+  def measure executable, file
+    case @measure_target
+    when :real
+      cmd = "#{executable} #{@ruby_arg} #{file}"
+      m = Benchmark.measure{
+        system(cmd, out: File::NULL)
+      }
+      result = m.real
+    when :peak, :size
+      tmp = Tempfile.new("benchmark-memory-wrapper-data")
+      wrapper = "#{File.join(__dir__, 'memory_wrapper.rb')} #{tmp.path} #{@measure_target}"
+      cmd = "#{executable} #{@ruby_arg} #{wrapper} #{file}"
+      system(cmd, out: File::NULL)
+      result = tmp.read.to_i
+      tmp.close
+    else
+      raise "unknown measure target"
+    end
+
+    if $? != 0
+      raise $?.inspect if $? && $?.signaled?
+      output "\`#{cmd}\' exited with abnormal status (#{$?})"
+      0
+    else
+      result
+    end
+  end
+end
+
+if __FILE__ == $0
+  opt = {
+    :execs => [],
+    :dir => File.dirname(__FILE__),
+    :repeat => 1,
+    :measure_target => :real,
+    :output => nil,
+    :raw_output => nil,
+    :format => :tsv,
+  }
+  formats = {
+    :tsv => ".tsv",
+    :markdown => ".md",
+    :plain => ".txt",
+  }
+
+  parser = OptionParser.new{|o|
+    o.on('-e', '--executables [EXECS]',
+      "Specify benchmark one or more targets (e1::path1; e2::path2; e3::path3;...)"){|e|
+       e.split(/;/).each{|path|
+         opt[:execs] << path
+       }
+    }
+    o.on('--rbenv [VERSIONS]', 'Specify benchmark targets with rbenv version (vX.X.X;vX.X.X;...)'){|v|
+      v.split(/;/).each{|version|
+        opt[:execs] << "#{version}::#{`RBENV_VERSION='#{version}' rbenv which ruby`.rstrip}"
+      }
+    }
+    o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
+      opt[:dir] = d
+    }
+    o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
+      opt[:pattern] = p
+    }
+    o.on('-x', '--exclude [PATTERN]', "Benchmark exclude pattern"){|e|
+      opt[:exclude] = e
+    }
+    o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
+      opt[:repeat] = n.to_i
+    }
+    o.on('-o', '--output-file [FILE]', "Output file"){|f|
+      opt[:output] = f
+    }
+    o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a|
+      opt[:ruby_arg] = a
+    }
+    o.on('--measure-target [TARGET]', 'real (execution time), peak, size (memory)'){|mt|
+      opt[:measure_target] = mt.to_sym
+    }
+    o.on('--rawdata-output [FILE]', 'output rawdata'){|r|
+      opt[:rawdata_output] = r
+    }
+    o.on('--load-rawdata=FILE', 'input rawdata'){|r|
+      opt[:rawdata_input] = r
+    }
+    o.on('-f', "--format=FORMAT", "output format (#{formats.keys.join(",")})", formats.keys){|r|
+      opt[:format] = r
+    }
+    o.on('-v', '--verbose'){|v|
+      opt[:verbose] = v
+    }
+    o.on('-q', '--quiet', "Run without notify information except result table."){|q|
+      opt[:quiet] = q
+      opt[:verbose] = false
+    }
+  }
+
+  parser.parse!(ARGV)
+
+  if input = opt[:rawdata_input]
+    b = open(input) {|f|
+      BenchmarkDriver.load(f, File.extname(input)[1..-1], opt)
+    }
+    b.show_results
+  else
+    opt[:output] ||= "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}#{formats[opt[:format]]}"
+    BenchmarkDriver.benchmark(opt)
+  end
+end
+
diff --git a/benchmark/enum_lazy_flat_map.yml b/benchmark/enum_lazy_flat_map.yml
deleted file mode 100644
index 0ee390a441..0000000000
--- a/benchmark/enum_lazy_flat_map.yml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
-  num = (1..).lazy.take(100)
-  ary2 = [[1,2]].cycle.lazy.take(10)
-  ary10 = [[*1..10]].cycle.lazy.take(10)
-  ary20 = [[*1..20]].cycle.lazy.take(10)
-  ary50 = [[*1..50]].cycle.lazy.take(10)
-  ary100 = [[*1..100]].cycle.lazy.take(10)
-
-benchmark:
-  num3: num.flat_map {|x| x}.take(3).to_a
-  num10: num.flat_map {|x| x}.take(3).to_a
-  ary2:  ary2.flat_map {|x| x}.take(3).to_a
-  ary10: ary10.flat_map {|x| x}.take(3).to_a
-  ary20: ary20.flat_map {|x| x}.take(3).to_a
-  ary50: ary50.flat_map {|x| x}.take(3).to_a
-  ary100: ary100.flat_map {|x| x}.take(3).to_a
diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb
deleted file mode 100644
index 8832392e65..0000000000
--- a/benchmark/enum_lazy_grep_v_100.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-grep_data = (1..10).to_a * 1000
-N = 100
-enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0})
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb
deleted file mode 100644
index 329509fa8f..0000000000
--- a/benchmark/enum_lazy_grep_v_20.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-grep_data = (1..10).to_a * 1000
-N = 100
-enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2})
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb
deleted file mode 100644
index 02ea4d4e71..0000000000
--- a/benchmark/enum_lazy_grep_v_50.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-grep_data = (1..10).to_a * 1000
-N = 100
-enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5})
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb
deleted file mode 100644
index 2e6434d9c4..0000000000
--- a/benchmark/enum_lazy_uniq_100.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-uniq_data = (1..10_000).to_a
-N = 100
-enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000}
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb
deleted file mode 100644
index 75e6398fee..0000000000
--- a/benchmark/enum_lazy_uniq_20.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-uniq_data = (1..10_000).to_a
-N = 100
-enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000}
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb
deleted file mode 100644
index 59a39b78ff..0000000000
--- a/benchmark/enum_lazy_uniq_50.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-uniq_data = (1..10_000).to_a
-N = 100
-enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000}
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_zip.yml b/benchmark/enum_lazy_zip.yml
deleted file mode 100644
index 4566ff0261..0000000000
--- a/benchmark/enum_lazy_zip.yml
+++ /dev/null
@@ -1,22 +0,0 @@
-prelude: |
-  a = (1..3).lazy
-  b = a.map {|x| x}
-
-benchmark:
-  first_ary: a.zip(["a", "b", "c"]).first
-  first_nonary: a.zip("a".."c").first
-  first_noarg: a.zip.first
-
-  take3_ary: a.zip(["a", "b", "c"]).take(3).force
-  take3_nonary: a.zip("a".."c").take(3).force
-  take3_noarg: a.zip.take(3).force
-
-  chain-first_ary: b.zip(["a", "b", "c"]).first
-  chain-first_nonary: b.zip("a".."c").first
-  chain-first_noarg: b.zip.first
-
-  chain-take3_ary: b.zip(["a", "b", "c"]).take(3).force
-  chain-take3_nonary: b.zip("a".."c").take(3).force
-  chain-take3_noarg: b.zip.take(3).force
-
-  block: a.zip("a".."c") {|x, y| [x, y]}
diff --git a/benchmark/enum_minmax.yml b/benchmark/enum_minmax.yml
deleted file mode 100644
index 9d01731abb..0000000000
--- a/benchmark/enum_minmax.yml
+++ /dev/null
@@ -1,25 +0,0 @@
-prelude: |
-  set2 = 2.times.to_a.shuffle.to_set
-  set10 = 10.times.to_a.shuffle.to_set
-  set100 = 100.times.to_a.shuffle.to_set
-  set1000 = 1000.times.to_a.shuffle.to_set
-  set10000 = 10000.times.to_a.shuffle.to_set
-
-benchmark:
-  set2.min: set2.min
-  set10.min: set10.min
-  set100.min: set100.min
-  set1000.min: set1000.min
-  set10000.min: set10000.min
-  set2.max: set2.max
-  set10.max: set10.max
-  set100.max: set100.max
-  set1000.max: set1000.max
-  set10000.max: set10000.max
-  set2.minmax: set2.minmax
-  set10.minmax: set10.minmax
-  set100.minmax: set100.minmax
-  set1000.minmax: set1000.minmax
-  set10000.minmax: set10000.minmax
-
-loop_count: 10000
diff --git a/benchmark/enum_sort.yml b/benchmark/enum_sort.yml
deleted file mode 100644
index 6f26e748c6..0000000000
--- a/benchmark/enum_sort.yml
+++ /dev/null
@@ -1,15 +0,0 @@
-prelude: |
-  set2 = 2.times.to_a.shuffle.to_set
-  set10 = 10.times.to_a.shuffle.to_set
-  set100 = 100.times.to_a.shuffle.to_set
-  set1000 = 1000.times.to_a.shuffle.to_set
-  set10000 = 10000.times.to_a.shuffle.to_set
-
-benchmark:
-  set2.sort_by: set2.sort_by { 0 }
-  set10.sort_by: set10.sort_by { 0 }
-  set100.sort_by: set100.sort_by { 0 }
-  set1000.sort_by: set1000.sort_by { 0 }
-  set10000.sort_by: set10000.sort_by { 0 }
-
-loop_count: 10000
diff --git a/benchmark/enum_sort_by.yml b/benchmark/enum_sort_by.yml
deleted file mode 100644
index d386353888..0000000000
--- a/benchmark/enum_sort_by.yml
+++ /dev/null
@@ -1,53 +0,0 @@
-prelude: |
-  array_length = 2
-  fixnum_array2 = array_length.times.to_a.map {rand(10000)}
-  float_array2 = array_length.times.to_a.map {rand(10000.0).to_f}
-  string_array2 = array_length.times.to_a.map {"r" * rand(1..10000)}
-  mix_array2 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
-  all_zero_array2 =array_length.times.to_a.map {0}
-
-  array_length = 10
-  fixnum_array10 = array_length.times.to_a.map {rand(10000)}
-  float_array10 = array_length.times.to_a.map {rand(10000.0).to_f}
-  string_array10 = array_length.times.to_a.map {"r" * rand(1..10000)}
-  mix_array10 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
-  all_zero_array10 =array_length.times.to_a.map {0}
-
-  array_length = 1000
-  fixnum_array1000 = array_length.times.to_a.map {rand(10000)}
-  float_array1000 = array_length.times.to_a.map {rand(10000.0).to_f}
-  string_array1000 = array_length.times.to_a.map {"r" * rand(1..10000)}
-  mix_array1000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
-  all_zero_array1000 =array_length.times.to_a.map {0}
-
-  array_length = 100000
-  fixnum_array100000 = array_length.times.to_a.map {rand(10000)}
-  float_array100000 = array_length.times.to_a.map {rand(10000.0).to_f}
-  string_array100000 = array_length.times.to_a.map {"r" * rand(1..10000)}
-  mix_array100000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
-  all_zero_array100000 =array_length.times.to_a.map {0}
-
-benchmark:
-  fixnum_array2.sort_by: fixnum_array2.sort_by {|a| a}
-  float_array2.sort_by:  float_array2.sort_by {|a| a}
-  string_length2.sort_by: string_array2.sort_by {|a| a.length}
-  mix_array2.sort_by:  mix_array2.sort_by {|a| a}
-  all_zero2.sort_by: all_zero_array2.sort_by{|a| a}
-
-  fixnum_array10.sort_by: fixnum_array10.sort_by {|a| a}
-  float_array10.sort_by:  float_array10.sort_by {|a| a}
-  string_length10.sort_by: string_array10.sort_by {|a| a.length}
-  mix_array10.sort_by:  mix_array10.sort_by {|a| a}
-  all_zero10.sort_by: all_zero_array10.sort_by{|a| a}
-
-  fixnum_array1000.sort_by: fixnum_array1000.sort_by {|a| a}
-  float_array1000.sort_by:  float_array1000.sort_by {|a| a}
-  string_length1000.sort_by: string_array1000.sort_by {|a| a.length}
-  mix_array1000.sort_by:  mix_array1000.sort_by {|a| a}
-  all_zero1000.sort_by: all_zero_array1000.sort_by{|a| a}
-
-  fixnum_array100000.sort_by: fixnum_array100000.sort_by {|a| a}
-  float_array100000.sort_by:  float_array100000.sort_by {|a| a}
-  string_length100000.sort_by: string_array100000.sort_by {|a| a.length}
-  mix_array100000.sort_by:  mix_array100000.sort_by {|a| a}
-  all_zero100000.sort_by: all_zero_array100000.sort_by{|a| a}
diff --git a/benchmark/enum_tally.yml b/benchmark/enum_tally.yml
deleted file mode 100644
index edd2e040a0..0000000000
--- a/benchmark/enum_tally.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-prelude: |
-  list = ("aaa".."zzz").to_a*10
-benchmark:
-  tally: list.tally
diff --git a/benchmark/erb_escape_html.yml b/benchmark/erb_escape_html.yml
deleted file mode 100644
index ca28d756e7..0000000000
--- a/benchmark/erb_escape_html.yml
+++ /dev/null
@@ -1,31 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-  require 'erb'
-benchmark:
-  - script: ERB::Util.html_escape("")
-    loop_count: 20000000
-  - script: ERB::Util.html_escape("abcde")
-    loop_count: 20000000
-  - script: ERB::Util.html_escape("abcd<")
-    loop_count: 20000000
-  - script: ERB::Util.html_escape("'&\"<>")
-    loop_count: 5000000
-  - prelude: long_no_escape = "abcde" * 300
-    script: ERB::Util.html_escape(long_no_escape)
-    loop_count: 1000000
-  - prelude: long_all_escape = "'&\"<>" * 10
-    script: ERB::Util.html_escape(long_all_escape)
-    loop_count: 1000000
-  - prelude: | # http://example.com/
-      example_html = <<~HTML
-        <body>
-        <div>
-            <h1>Example Domain</h1>
-            <p>This domain is established to be used for illustrative examples in documents. You may use this
-            domain in examples without prior coordination or asking for permission.</p>
-            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
-        </div>
-        </body>
-      HTML
-    script: ERB::Util.html_escape(example_html)
-    loop_count: 1000000
diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml
deleted file mode 100644
index 15f6c3880b..0000000000
--- a/benchmark/erb_render.yml
+++ /dev/null
@@ -1,24 +0,0 @@
-prelude: |
-  require 'erb'
-
-  data = <<erb
-  <html>
-    <head> <%= title %> </head>
-    <body>
-      <h1> <%= title %> </h1>
-      <p>
-        <%= content %>
-      </p>
-    </body>
-  </html>
-  erb
-
-  title = "hello world!"
-  content = "hello world!\n" * 10
-
-  src = "def self.render(title, content); #{ERB.new(data).src}; end"
-  mod = Module.new
-  mod.instance_eval(src, "(ERB)")
-benchmark:
-  erb_render: mod.render(title, content)
-loop_count: 1500000
diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml
deleted file mode 100644
index a36c759f8e..0000000000
--- a/benchmark/fiber_chain.yml
+++ /dev/null
@@ -1,36 +0,0 @@
-prelude: |
-  def make_link(previous)
-    Fiber.new do
-      while message = previous.resume
-        Fiber.yield(message)
-      end
-    end
-  end
-
-  def make_chain(length = 1000, &block)
-    chain = Fiber.new(&block)
-
-    (length - 1).times do
-      chain = make_link(chain)
-    end
-
-    return chain
-  end
-
-  message = "Hello World!"
-
-  chain = make_chain do
-    while true
-      Fiber.yield(message)
-    end
-  end
-benchmark:
-  make_chain: |
-    make_chain(100) do
-      while true
-        Fiber.yield(message)
-      end
-    end
-  resume_chain: |
-    chain.resume
-loop_count: 5000
diff --git a/benchmark/fiber_locals.yml b/benchmark/fiber_locals.yml
deleted file mode 100644
index 8588686477..0000000000
--- a/benchmark/fiber_locals.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
-  th = Thread.current
-  th[:key] = :val
-benchmark:
-  key?: th.key?(:key)
-  []: th[:key]
-  keys: th.keys
-loop_count: 1_000_000
diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb
deleted file mode 100644
index bbb44aebac..0000000000
--- a/benchmark/file_rename.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-# rename file
-require 'tempfile'
-
-max = 100_000
-tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
-a, b = tmp.map { |x| x.path }
-tmp.each { |t| t.close } # Windows can't rename files without closing them
-max.times do
-  File.rename(a, b)
-  File.rename(b, a)
-end
diff --git a/benchmark/float_methods.yml b/benchmark/float_methods.yml
deleted file mode 100644
index 56ea41effc..0000000000
--- a/benchmark/float_methods.yml
+++ /dev/null
@@ -1,14 +0,0 @@
-prelude: |
-  flo = 4.2
-benchmark:
-  to_f: |
-    flo.to_f
-  abs: |
-    flo.abs
-  magnitude: |
-    flo.magnitude
-  -@: |
-    -flo
-  zero?: |
-    flo.zero?
-loop_count: 20000000
diff --git a/benchmark/float_neg_posi.yml b/benchmark/float_neg_posi.yml
deleted file mode 100644
index 172db1bf6d..0000000000
--- a/benchmark/float_neg_posi.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
-  flo = 4.2
-benchmark:
-  negative?: |
-    flo.negative?
-  positive?: |
-    flo.positive?
-loop_count: 20000000
diff --git a/benchmark/float_to_s.yml b/benchmark/float_to_s.yml
deleted file mode 100644
index 0abae5cdb8..0000000000
--- a/benchmark/float_to_s.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  floats = [*0.0.step(1.0, 0.0001)]
-
-benchmark:
-  to_s: floats.each {|f| f.to_s}
-
-loop_count: 1000
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
index 275f58b924..2eed7abc83 100644
--- a/benchmark/gc/aobench.rb
+++ b/benchmark/gc/aobench.rb
@@ -1 +1 @@
-require_relative '../app_aobench'
+require_relative '../bm_app_aobench.rb'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
index 83347cdd20..af8ea722aa 100644
--- a/benchmark/gc/binary_trees.rb
+++ b/benchmark/gc/binary_trees.rb
@@ -1 +1 @@
-require_relative '../so_binary_trees'
+require_relative '../bm_so_binary_trees.rb'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
index 23d0b91c6c..09a404466a 100644
--- a/benchmark/gc/gcbench.rb
+++ b/benchmark/gc/gcbench.rb
@@ -3,12 +3,11 @@ require 'pp'
 require 'optparse'
 
 $list = true
-$gcprof = false
+$gcprof = true
 
 opt = OptionParser.new
 opt.on('-q'){$list = false}
 opt.on('-d'){$gcprof = false}
-opt.on('-p'){$gcprof = true}
 opt.parse!(ARGV)
 
 script = File.join(File.dirname(__FILE__), ARGV.shift)
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
index 8ebdff7d1d..94ba74be89 100644
--- a/benchmark/gc/pentomino.rb
+++ b/benchmark/gc/pentomino.rb
@@ -1 +1 @@
-require_relative '../app_pentomino'
+require_relative '../bm_app_pentomino.rb'
diff --git a/benchmark/hash_aref_array.rb b/benchmark/hash_aref_array.rb
deleted file mode 100644
index ac7a683d95..0000000000
--- a/benchmark/hash_aref_array.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-h = {}
-arrays = (0..99).each_slice(10).to_a
-#STDERR.puts arrays.inspect
-arrays.each { |s| h[s] = s }
-200_000.times { arrays.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_str_lit.yml b/benchmark/hash_aref_str_lit.yml
deleted file mode 100644
index ed8142bcf1..0000000000
--- a/benchmark/hash_aref_str_lit.yml
+++ /dev/null
@@ -1,20 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-  hash = 10.times.to_h do |i|
-    [i, i]
-  end
-  dyn_sym = "dynamic_symbol".to_sym
-  binary = RubyVM::InstructionSequence.compile("# frozen_string_literal: true\n'iseq_load'").to_binary
-  iseq_literal_string = RubyVM::InstructionSequence.load_from_binary(binary).eval
-
-  hash[:some_symbol] = 1
-  hash[dyn_sym] = 2
-  hash["small"] = 3
-  hash["frozen_string_literal"] = 4
-  hash[iseq_literal_string] = 5
-benchmark:
-  symbol: hash[:some_symbol]
-  dyn_symbol: hash[dyn_sym]
-  small_lit: hash["small"]
-  frozen_lit: hash["frozen_string_literal"]
-  iseq_lit: hash[iseq_literal_string]
diff --git a/benchmark/hash_defaults.yml b/benchmark/hash_defaults.yml
deleted file mode 100644
index 833f10e1c7..0000000000
--- a/benchmark/hash_defaults.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-prelude: |
-  h = Hash.new { :foo }
-benchmark:
-  default_aref: h[1]
-  default_method: h.default(1)
-loop_count: 1000000
diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml
deleted file mode 100644
index 65f521ec94..0000000000
--- a/benchmark/hash_dup.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
-  small_hash = { a: 1 }
-  larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h
-
-benchmark:
-  dup_small: small_hash.dup
-  dup_larger: larger_hash.dup
-loop_count: 10000
diff --git a/benchmark/hash_first.yml b/benchmark/hash_first.yml
deleted file mode 100644
index c26df1a7ed..0000000000
--- a/benchmark/hash_first.yml
+++ /dev/null
@@ -1,11 +0,0 @@
-prelude: |
-  hash1 = 1_000_000.times.to_h { [rand, true]}
-  hash2 = hash1.dup
-  hash2.keys[1..100_000].each { hash2.delete _1 }
-  hash2.delete hash2.first[0]
-
-benchmark:
-  hash1: hash1.first
-  hash2: hash2.first
-
-loop_count: 100_000
diff --git a/benchmark/hash_key.yml b/benchmark/hash_key.yml
deleted file mode 100644
index cab4cf9ca4..0000000000
--- a/benchmark/hash_key.yml
+++ /dev/null
@@ -1,5 +0,0 @@
-prelude: |
-  obj = Object.new
-  hash = { obj => true }
-benchmark: hash.key?(obj)
-loop_count: 30000000
diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb
deleted file mode 100644
index c188529260..0000000000
--- a/benchmark/hash_literal_small2.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-# frozen_string_literal: true
-
-1_000_000.times.map { { "foo" => "bar", "bar" => "baz" }  }
diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb
deleted file mode 100644
index 739f71b5b0..0000000000
--- a/benchmark/hash_literal_small4.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-# frozen_string_literal: true
-
-1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } }
diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb
deleted file mode 100644
index 53d80af535..0000000000
--- a/benchmark/hash_literal_small8.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-# frozen_string_literal: true
-
-1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } }
diff --git a/benchmark/hash_new.yml b/benchmark/hash_new.yml
deleted file mode 100644
index 9d8e34187f..0000000000
--- a/benchmark/hash_new.yml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
-  has_hash_with_capa = Hash.instance_method(:initialize).parameters.include?([:key, :capacity])
-  strings_1k = 1_000.times.map { |i| -i.to_s.freeze }
-  strings_100k = 100_000.times.map { |i| -i.to_s.freeze }
-benchmark:
-  new: Hash.new
-  new_with_capa_1k: |
-    h = has_hash_with_capa ? Hash.new(capacity: strings_1k.size) : {}
-    strings_1k.each do |x|
-      h[x] = true
-    end
-  new_with_capa_100k: |
-    h = has_hash_with_capa ? Hash.new(capacity: strings_100k.size) : {}
-    strings_100k.each do |x|
-      h[x] = true
-    end
diff --git a/benchmark/io_write.rb b/benchmark/io_write.rb
deleted file mode 100644
index cdb409948b..0000000000
--- a/benchmark/io_write.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-#!/usr/bin/env ruby
-
-require 'benchmark'
-
-i, o = IO.pipe
-o.sync = true
-
-DOT = ".".freeze
-
-chunks = 100_000.times.collect{DOT}
-
-thread = Thread.new do
-  while i.read(1024)
-  end
-end
-
-100.times do
-  o.write(*chunks)
-end
-
-o.close
-thread.join
diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml
deleted file mode 100644
index ebdc8d7e8b..0000000000
--- a/benchmark/irb_color.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-prelude: |
-  require 'irb/color'
-  code = <<~'CODE'
-    def self.foo # bar
-      :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}"
-    end
-  CODE
-benchmark:
-  irb_color_complete: |
-    IRB::Color.colorize_code(code, complete: true)
-  irb_color_incomplete: |
-    IRB::Color.colorize_code(code, complete: false)
-loop_count: 2000000
diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml
deleted file mode 100644
index 28933f8b38..0000000000
--- a/benchmark/irb_exec.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-  require 'rbconfig'
-  irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f']
-benchmark:
-  irb_exec: |
-    IO.popen(irb_f, 'w') do |io|
-      io.write('exit')
-    end
-loop_count: 30
diff --git a/benchmark/iseq_load_from_binary.yml b/benchmark/iseq_load_from_binary.yml
deleted file mode 100644
index 7e9d73bdd4..0000000000
--- a/benchmark/iseq_load_from_binary.yml
+++ /dev/null
@@ -1,25 +0,0 @@
-prelude: |
-  symbol = RubyVM::InstructionSequence.compile(":foo; :bar; :baz; :egg; :spam").to_binary
-
-  define_method = RubyVM::InstructionSequence.compile(%{
-    def foo; end
-    def bar; end
-    def baz; end
-    def egg; end
-    def spam; end
-  }).to_binary
-
-  all = RubyVM::InstructionSequence.compile(%{
-    module Foo; def foo; :foo; end; end
-    module Bar; def bar; :bar; end; end
-    module Baz; def baz; :baz; end; end
-    class Egg; def egg; :egg; end; end
-    class Spaml; def spam; :spam; end; end
-  }).to_binary
-
-benchmark:
-  symbol: RubyVM::InstructionSequence.load_from_binary(symbol)
-  define_method: RubyVM::InstructionSequence.load_from_binary(define_method)
-  all: RubyVM::InstructionSequence.load_from_binary(all)
-
-loop_count: 100_000
diff --git a/benchmark/ivar_extend.yml b/benchmark/ivar_extend.yml
deleted file mode 100644
index eb9ee923f5..0000000000
--- a/benchmark/ivar_extend.yml
+++ /dev/null
@@ -1,23 +0,0 @@
-prelude: |
-  class Embedded
-    def initialize
-      @a = 1
-      @b = 1
-      @c = 1
-    end
-  end
-
-  class Extended
-    def initialize
-      @a = 1
-      @b = 1
-      @c = 1
-      @d = 1
-      @e = 1
-      @f = 1
-    end
-  end
-benchmark:
-  embedded: Embedded.new
-  extended: Extended.new
-loop_count: 20_000_000
diff --git a/benchmark/kernel_clone.yml b/benchmark/kernel_clone.yml
deleted file mode 100644
index 069b23abcd..0000000000
--- a/benchmark/kernel_clone.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-prelude: "object = Object.new"
-benchmark:
-  clone: "object.clone"
-  clone_true: "object.clone(freeze: true)"
-  clone_false: "object.clone(freeze: false)"
-loop_count: 10000
diff --git a/benchmark/kernel_float.yml b/benchmark/kernel_float.yml
deleted file mode 100644
index 215f6750fc..0000000000
--- a/benchmark/kernel_float.yml
+++ /dev/null
@@ -1,5 +0,0 @@
-benchmark:
-  float: "Float(42)"
-  float_true: "Float(42, exception: true)"
-  float_false: "Float(42, exception: false)"
-loop_count: 10000
diff --git a/benchmark/kernel_tap.yml b/benchmark/kernel_tap.yml
deleted file mode 100644
index 4dcbb31b4d..0000000000
--- a/benchmark/kernel_tap.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-prelude: |
-  obj = Object.new
-  x = nil
-benchmark:
-  kernel_tap: obj.tap { |o| x = o }
-loop_count: 20000000
diff --git a/benchmark/kernel_then.yml b/benchmark/kernel_then.yml
deleted file mode 100644
index 85f7341e33..0000000000
--- a/benchmark/kernel_then.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-benchmark:
-  kernel_then: 1.then { |i| i + 1 }
-  kernel_then_enum: 1.then
-  kernel_yield_self: 1.yield_self { |i| i + 1 }
-  kernel_yield_self_enum: 1.yield_self
-loop_count: 20000000
diff --git a/benchmark/keyword_arguments.yml b/benchmark/keyword_arguments.yml
deleted file mode 100644
index fce6bce0b8..0000000000
--- a/benchmark/keyword_arguments.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-prelude: |
-  h = {a: 1}
-  def kw(a: 1) a end
-  def kws(**kw) kw end
-benchmark:
-  kw_to_kw: "kw(a: 1)"
-  kw_splat_to_kw: "kw(**h)"
-  kw_to_kw_splat: "kws(a: 1)"
-  kw_splat_to_kw_splat: "kws(**h)"
-  kw_and_splat_to_kw: "kw(a: 1, **h)"
-  kw_splats_to_kw: "kw(**h, **h)"
-  kw_and_splat_to_kw_splat: "kws(a: 1, **h)"
-  kw_splats_to_kw_splat: "kws(**h, **h)"
diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb
deleted file mode 100644
index d22236e9fb..0000000000
--- a/benchmark/lib/benchmark_driver/output/driver.rb
+++ /dev/null
@@ -1,36 +0,0 @@
-require 'benchmark_driver/output/simple'
-
-# This replicates the legacy benchmark/driver.rb behavior.
-class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple
-  def initialize(*)
-    super
-    @stdout = $stdout
-    @strio  = StringIO.new
-    $stdout = IOMultiplexer.new(@stdout, @strio)
-  end
-
-  def with_benchmark(*)
-    super
-  ensure
-    logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log"
-    puts "\nLog file: #{logfile}"
-
-    $stdout = @stdout
-    File.write(logfile, @strio.tap(&:rewind).read)
-  end
-
-  class IOMultiplexer
-    def initialize(io1, io2)
-      @io1 = io1
-      @io2 = io2
-    end
-
-    [:write, :sync, :sync=, :puts, :print, :flush].each do |method|
-      define_method(method) do |*args|
-        @io1.send(method, *args)
-        @io2.send(method, *args)
-      end
-    end
-  end
-  private_constant :IOMultiplexer
-end
diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb
deleted file mode 100644
index 3c3453e527..0000000000
--- a/benchmark/lib/benchmark_driver/runner/cstime.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-require 'benchmark_driver/runner/total'
-
-class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total
-  METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false)
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  private
-
-  # Overriding BenchmarkDriver::Runner::Total#metric
-  def metric
-    METRIC
-  end
-
-  # Overriding BenchmarkDriver::Runner::Total#target
-  def target
-    :cstime
-  end
-end
diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb
deleted file mode 100644
index e139962ef2..0000000000
--- a/benchmark/lib/benchmark_driver/runner/cutime.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-require 'benchmark_driver/runner/total'
-
-class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total
-  METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false)
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  private
-
-  # Overriding BenchmarkDriver::Runner::Total#metric
-  def metric
-    METRIC
-  end
-
-  # Overriding BenchmarkDriver::Runner::Total#target
-  def target
-    :cutime
-  end
-end
diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb
deleted file mode 100644
index d04f2e51ff..0000000000
--- a/benchmark/lib/benchmark_driver/runner/peak.rb
+++ /dev/null
@@ -1,151 +0,0 @@
-require 'benchmark_driver/struct'
-require 'benchmark_driver/metric'
-require 'benchmark_driver/default_job'
-require 'benchmark_driver/default_job_parser'
-require 'tempfile'
-
-class BenchmarkDriver::Runner::Peak
-  METRIC = BenchmarkDriver::Metric.new(
-    name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger',
-  )
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  # @param [BenchmarkDriver::Config::RunnerConfig] config
-  # @param [BenchmarkDriver::Output] output
-  # @param [BenchmarkDriver::Context] contexts
-  def initialize(config:, output:, contexts:)
-    @config = config
-    @output = output
-    @contexts = contexts
-  end
-
-  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
-  # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
-  def run(jobs)
-    if jobs.any? { |job| job.loop_count.nil? }
-      jobs = jobs.map do |job|
-        job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1))
-      end
-    end
-
-    @output.with_benchmark do
-      jobs.each do |job|
-        @output.with_job(name: job.name) do
-          job.runnable_contexts(@contexts).each do |context|
-            value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
-              run_benchmark(job, context: context)
-            end
-            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
-              @output.report(values: { metric => value }, loop_count: job.loop_count)
-            end
-          end
-        end
-      end
-    end
-  end
-
-  private
-
-  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
-  # @param [BenchmarkDriver::Context] context
-  # @return [BenchmarkDriver::Metrics]
-  def run_benchmark(job, context:)
-    benchmark = BenchmarkScript.new(
-      preludes:   [context.prelude, job.prelude],
-      script:     job.script,
-      teardown:   job.teardown,
-      loop_count: job.loop_count,
-    )
-
-    memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__)
-    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
-      with_script(benchmark.render) do |path|
-        output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read)
-        if $?.success?
-          Integer(f.read)
-        else
-          $stdout.print(output)
-          BenchmarkDriver::Result::ERROR
-        end
-      end
-    end
-  end
-
-  # Overridden by BenchmarkDriver::Runner::Size
-  def target
-    'peak'
-  end
-
-  # Overridden by BenchmarkDriver::Runner::Size
-  def metric
-    METRIC
-  end
-
-  def with_script(script)
-    if @config.verbose >= 2
-      sep = '-' * 30
-      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
-    end
-
-    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
-      f.puts script
-      f.close
-      return yield(f.path)
-    end
-  end
-
-  # @param [String] prelude
-  # @param [String] script
-  # @param [String] teardown
-  # @param [Integer] loop_count
-  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
-    def render
-      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
-      <<-RUBY
-#{prelude}
-#{while_loop(script, loop_count)}
-#{teardown}
-
-result_file, target, memory_status = ARGV
-require_relative memory_status
-
-ms = Memory::Status.new
-case target.to_sym
-when :peak
-  key = ms.respond_to?(:hwm) ? :hwm : :peak
-when :size
-  key = ms.respond_to?(:rss) ? :rss : :size
-else
-  raise('unexpected target: ' + target)
-end
-
-File.write(result_file, ms[key])
-      RUBY
-    end
-
-    private
-
-    def while_loop(content, times)
-      if !times.is_a?(Integer) || times <= 0
-        raise ArgumentError.new("Unexpected times: #{times.inspect}")
-      end
-
-      if times > 1
-        <<-RUBY
-__bmdv_i = 0
-while __bmdv_i < #{times}
-  #{content}
-  __bmdv_i += 1
-end
-        RUBY
-      else
-        content
-      end
-    end
-  end
-  private_constant :BenchmarkScript
-end
diff --git a/benchmark/lib/benchmark_driver/runner/ractor.rb b/benchmark/lib/benchmark_driver/runner/ractor.rb
deleted file mode 100644
index c730b8e4a5..0000000000
--- a/benchmark/lib/benchmark_driver/runner/ractor.rb
+++ /dev/null
@@ -1,122 +0,0 @@
-require 'erb'
-
-# A runner to measure performance *inside* Ractor
-class BenchmarkDriver::Runner::Ractor < BenchmarkDriver::Runner::Ips
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob) do
-    attr_accessor :ractor
-  end
-
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
-    def parse(ractor: 1, **kwargs)
-      super(**kwargs).each do |job|
-        job.ractor = ractor
-      end
-    end
-  })
-
-  private
-
-  unless private_instance_methods.include?(:run_benchmark)
-    raise "#run_benchmark is no longer defined in BenchmarkDriver::Runner::Ips"
-  end
-
-  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
-  # @param [BenchmarkDriver::Context] context
-  # @return [BenchmarkDriver::Metrics]
-  def run_benchmark(job, context:)
-    benchmark = BenchmarkScript.new(
-      preludes:   [context.prelude, job.prelude],
-      script:     job.script,
-      teardown:   job.teardown,
-      loop_count: job.loop_count,
-    )
-
-    results = job.ractor.times.map do
-      Tempfile.open('benchmark_driver_result')
-    end
-    duration = with_script(benchmark.render(results: results.map(&:path))) do |path|
-      success = execute(*context.executable.command, path, exception: false)
-      if success && ((value = results.map { |f| Float(f.read) }.max) > 0)
-        value
-      else
-        BenchmarkDriver::Result::ERROR
-      end
-    end
-    results.each(&:close)
-
-    value_duration(
-      loop_count: job.loop_count,
-      duration: duration,
-    )
-  end
-
-  # @param [String] prelude
-  # @param [String] script
-  # @param [String] teardown
-  # @param [Integer] loop_count
-  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
-    # @param [String] result - A file to write result
-    def render(results:)
-      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
-      ERB.new(<<-RUBY).result_with_hash(results: results)
-Warning[:experimental] = false
-# shareable-constant-value: experimental_everything
-#{prelude}
-
-if #{loop_count} == 1
-  __bmdv_loop_before = 0
-  __bmdv_loop_after = 0
-else
-  __bmdv_loop_before = Time.new
-  #{while_loop('', loop_count, id: 0)}
-  __bmdv_loop_after = Time.new
-end
-
-__bmdv_ractors = []
-<% results.size.times do %>
-__bmdv_ractors << Ractor.new(__bmdv_loop_after - __bmdv_loop_before) { |__bmdv_loop_time|
-  __bmdv_time = Time
-  __bmdv_script_before = __bmdv_time.new
-  #{while_loop(script, loop_count, id: 1)}
-  __bmdv_script_after = __bmdv_time.new
-
-  (__bmdv_script_after - __bmdv_script_before) - __bmdv_loop_time
-}
-<% end %>
-
-# Wait for all Ractors before executing code to write results
-__bmdv_ractors.map!(&:take)
-
-<% results.each do |result| %>
-File.write(<%= result.dump %>, __bmdv_ractors.shift)
-<% end %>
-
-#{teardown}
-      RUBY
-    end
-
-    private
-
-    # id is to prevent:
-    # can not isolate a Proc because it accesses outer variables (__bmdv_i)
-    def while_loop(content, times, id:)
-      if !times.is_a?(Integer) || times <= 0
-        raise ArgumentError.new("Unexpected times: #{times.inspect}")
-      elsif times == 1
-        return content
-      end
-
-      # TODO: execute in batch
-      <<-RUBY
-__bmdv_i#{id} = 0
-while __bmdv_i#{id} < #{times}
-  #{content}
-  __bmdv_i#{id} += 1
-end
-      RUBY
-    end
-  end
-  private_constant :BenchmarkScript
-end
diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb
deleted file mode 100644
index 1b31f901c7..0000000000
--- a/benchmark/lib/benchmark_driver/runner/size.rb
+++ /dev/null
@@ -1,25 +0,0 @@
-require 'benchmark_driver/runner/peak'
-
-# Actually the same as BenchmarkDriver::Runner::Memory
-class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak
-  METRIC = BenchmarkDriver::Metric.new(
-    name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger',
-  )
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  private
-
-  # Overriding BenchmarkDriver::Runner::Peak#metric
-  def metric
-    METRIC
-  end
-
-  # Overriding BenchmarkDriver::Runner::Peak#target
-  def target
-    'size'
-  end
-end
diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb
deleted file mode 100644
index 4577fb0bf8..0000000000
--- a/benchmark/lib/benchmark_driver/runner/stime.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-require 'benchmark_driver/runner/total'
-
-class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total
-  METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false)
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  private
-
-  # Overriding BenchmarkDriver::Runner::Total#metric
-  def metric
-    METRIC
-  end
-
-  # Overriding BenchmarkDriver::Runner::Total#target
-  def target
-    :stime
-  end
-end
diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb
deleted file mode 100644
index 64dc14f84e..0000000000
--- a/benchmark/lib/benchmark_driver/runner/total.rb
+++ /dev/null
@@ -1,137 +0,0 @@
-require 'benchmark_driver/struct'
-require 'benchmark_driver/metric'
-require 'benchmark_driver/default_job'
-require 'benchmark_driver/default_job_parser'
-require 'tempfile'
-
-class BenchmarkDriver::Runner::Total
-  METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false)
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  # @param [BenchmarkDriver::Config::RunnerConfig] config
-  # @param [BenchmarkDriver::Output] output
-  # @param [BenchmarkDriver::Context] contexts
-  def initialize(config:, output:, contexts:)
-    @config = config
-    @output = output
-    @contexts = contexts
-  end
-
-  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
-  # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs
-  def run(jobs)
-    if jobs.any? { |job| job.loop_count.nil? }
-      raise 'missing loop_count is not supported in Ruby repository'
-    end
-
-    @output.with_benchmark do
-      jobs.each do |job|
-        @output.with_job(name: job.name) do
-          job.runnable_contexts(@contexts).each do |context|
-            duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
-              run_benchmark(job, context: context)
-            end
-            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
-              @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count)
-            end
-          end
-        end
-      end
-    end
-  end
-
-  private
-
-  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
-  # @param [BenchmarkDriver::Context] context
-  # @return [BenchmarkDriver::Metrics]
-  def run_benchmark(job, context:)
-    benchmark = BenchmarkScript.new(
-      preludes:   [context.prelude, job.prelude],
-      script:     job.script,
-      teardown:   job.teardown,
-      loop_count: job.loop_count,
-    )
-
-    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
-      with_script(benchmark.render(result: f.path, target: target)) do |path|
-        IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2
-        if $?.success?
-          Float(f.read)
-        else
-          BenchmarkDriver::Result::ERROR
-        end
-      end
-    end
-  end
-
-  # This method is overridden by some subclasses
-  def metric
-    METRIC
-  end
-
-  # This method is overridden by some subclasses
-  def target
-    :total
-  end
-
-  def with_script(script)
-    if @config.verbose >= 2
-      sep = '-' * 30
-      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
-    end
-
-    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
-      f.puts script
-      f.close
-      return yield(f.path)
-    end
-  end
-
-  # @param [String] prelude
-  # @param [String] script
-  # @param [String] teardown
-  # @param [Integer] loop_count
-  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
-    # @param [String] result - A file to write result
-    def render(result:, target:)
-      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
-      <<-RUBY
-#{prelude}
-
-require 'benchmark'
-__bmdv_result = Benchmark.measure {
-  #{while_loop(script, loop_count)}
-}
-
-#{teardown}
-
-File.write(#{result.dump}, __bmdv_result.#{target})
-      RUBY
-    end
-
-    private
-
-    def while_loop(content, times)
-      if !times.is_a?(Integer) || times <= 0
-        raise ArgumentError.new("Unexpected times: #{times.inspect}")
-      elsif times == 1
-        return content
-      end
-
-      # TODO: execute in batch
-      <<-RUBY
-__bmdv_i = 0
-while __bmdv_i < #{times}
-  #{content}
-  __bmdv_i += 1
-end
-      RUBY
-    end
-  end
-  private_constant :BenchmarkScript
-end
diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb
deleted file mode 100644
index b61d83a188..0000000000
--- a/benchmark/lib/benchmark_driver/runner/utime.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-require 'benchmark_driver/runner/total'
-
-class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total
-  METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false)
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  private
-
-  # Overriding BenchmarkDriver::Runner::Total#metric
-  def metric
-    METRIC
-  end
-
-  # Overriding BenchmarkDriver::Runner::Total#target
-  def target
-    :utime
-  end
-end
diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb
deleted file mode 100644
index 31b770c484..0000000000
--- a/benchmark/lib/load.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-# How to use this file:
-#   1. write a `$(srcdir)/test.rb` like:
-=begin
-require_relative 'benchmark/lib/load'
-
-Benchmark.driver(repeat_count: 5){|x|
-  x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby'
-  x.executable name: 'modif-miniruby', command: %w'./miniruby'
-
-  x.report %q{
-    h = {a: 1, b: 2, c: 3, d: 4}
-  }
-}
-=end
-#
-#  2. `make run`
-$:.unshift(File.join(__dir__, '../benchmark-driver/lib'))
-require 'benchmark_driver'
diff --git a/benchmark/loop_each.yml b/benchmark/loop_each.yml
deleted file mode 100644
index 1c757185a8..0000000000
--- a/benchmark/loop_each.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-prelude: |
-  arr = [nil] * 30_000_000
-benchmark:
-  loop_each: arr.each{|e|}
diff --git a/benchmark/loop_generator.rb b/benchmark/loop_generator.rb
deleted file mode 100644
index 6a3194b670..0000000000
--- a/benchmark/loop_generator.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-max = 6000000
-
-if defined? Fiber
-  gen = (1..max).each
-  loop do
-    gen.next
-  end
-else
-  require 'generator'
-  gen = Generator.new((0..max))
-  while gen.next?
-    gen.next
-  end
-end
diff --git a/benchmark/loop_times_megamorphic.yml b/benchmark/loop_times_megamorphic.yml
deleted file mode 100644
index f9343ba897..0000000000
--- a/benchmark/loop_times_megamorphic.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  eval(<<~EOS)
-    def loop_times_megamorphic
-      #{"1.times {|i|};" * 1000}
-    end
-  EOS
-benchmark: loop_times_megamorphic
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
new file mode 100644
index 0000000000..b6d787ae27
--- /dev/null
+++ b/benchmark/make_fasta_output.rb
@@ -0,0 +1,19 @@
+# prepare 'fasta.output'
+
+def prepare_fasta_output n
+  filebase = File.join(File.dirname($0), 'fasta.output')
+  script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+  file = "#{filebase}.#{n}"
+
+  unless FileTest.exist?(file)
+    STDERR.puts "preparing #{file}"
+
+    open(file, 'w'){|f|
+      ARGV[0] = n
+      $stdout = f
+      load script
+      $stdout = STDOUT
+    }
+  end
+end
+
diff --git a/benchmark/marshal_dump_load_integer.yml b/benchmark/marshal_dump_load_integer.yml
deleted file mode 100644
index 78ebf823d2..0000000000
--- a/benchmark/marshal_dump_load_integer.yml
+++ /dev/null
@@ -1,22 +0,0 @@
-prelude: |
-  smallint_array = 1000.times.map { |x| x }
-  bigint32_array = 1000.times.map { |x| x + 2**32 }
-  bigint64_array = 1000.times.map { |x| x + 2**64 }
-
-  smallint_dump = Marshal.dump(smallint_array)
-  bigint32_dump = Marshal.dump(bigint32_array)
-  bigint64_dump = Marshal.dump(bigint64_array)
-benchmark:
-  marshal_dump_integer_small: |
-    Marshal.dump(smallint_array)
-  marshal_dump_integer_over_32_bit: |
-    Marshal.dump(bigint32_array)
-  marshal_dump_integer_over_64_bit: |
-    Marshal.dump(bigint64_array)
-  marshal_load_integer_small: |
-    Marshal.load(smallint_dump)
-  marshal_load_integer_over_32_bit: |
-    Marshal.load(bigint32_dump)
-  marshal_load_integer_over_64_bit: |
-    Marshal.load(bigint64_dump)
-loop_count: 4000
diff --git a/benchmark/masgn.yml b/benchmark/masgn.yml
deleted file mode 100644
index 31cb8ee4a3..0000000000
--- a/benchmark/masgn.yml
+++ /dev/null
@@ -1,53 +0,0 @@
-prelude: |
-  a = [nil] * 3
-  b = Class.new{attr_writer :a, :b, :c}.new
-  c = d = e = f = g = h = i = nil
-benchmark:
-  array2_2: "c = (a[0], a[1] = 1, 2)"
-  array2_3: "c = (a[0], a[1] = 1, 2, 3)"
-  array3_2: "c = (a[0], a[1], a[2] = 1, 2)"
-  array3_3: "c = (a[0], a[1], a[2] = 1, 2, 3)"
-  attr2_2: "c = (b.a, b.b = 1, 2)"
-  attr2_3: "c = (b.a, b.b = 1, 2, 3)"
-  attr3_2: "c = (b.a, b.b, b.c = 1, 2)"
-  attr3_3: "c = (b.a, b.b, b.c = 1, 2, 3)"
-  lvar2_2: "c = (d, e = 1, 2)"
-  lvar2_3: "c = (d, e = 1, 2, 3)"
-  lvar3_2: "c = (d, e, f = 1, 2)"
-  lvar3_3: "c = (d, e, f = 1, 2, 3)"
-  array2_2p: "(a[0], a[1] = 1, 2; nil)"
-  array2_3p: "(a[0], a[1] = 1, 2, 3; nil)"
-  array3_2p: "(a[0], a[1], a[2] = 1, 2; nil)"
-  array3_3p: "(a[0], a[1], a[2] = 1, 2, 3; nil)"
-  attr2_2p: "(b.a, b.b = 1, 2; nil)"
-  attr2_3p: "(b.a, b.b = 1, 2, 3; nil)"
-  attr3_2p: "(b.a, b.b, b.c = 1, 2; nil)"
-  attr3_3p: "(b.a, b.b, b.c = 1, 2, 3; nil)"
-  lvar2_2p: "(d, e = 1, 2; nil)"
-  lvar2_3p: "(d, e = 1, 2, 3; nil)"
-  lvar3_2p: "(d, e, f = 1, 2; nil)"
-  lvar3_3p: "(d, e, f = 1, 2, 3; nil)"
-  array2_2lv: "c = (a[0], a[1] = g, h)"
-  array2_ilv: "c = (a[0], a[1] = g, h, i)"
-  arrayi_2lv: "c = (a[0], a[1], a[2] = g, h)"
-  arrayi_ilv: "c = (a[0], a[1], a[2] = g, h, i)"
-  attr2_2lv: "c = (b.a, b.b = g, h)"
-  attr2_ilv: "c = (b.a, b.b = g, h, i)"
-  attri_2lv: "c = (b.a, b.b, b.c = g, h)"
-  attri_ilv: "c = (b.a, b.b, b.c = g, h, i)"
-  lvar2_2lv: "c = (d, e = g, h)"
-  lvar2_ilv: "c = (d, e = g, h, i)"
-  lvari_2lv: "c = (d, e, f = g, h)"
-  lvari_ilv: "c = (d, e, f = g, h, i)"
-  array2_2plv: "(a[0], a[1] = g, h; nil)"
-  array2_iplv: "(a[0], a[1] = g, h, i; nil)"
-  arrayi_2plv: "(a[0], a[1], a[2] = g, h; nil)"
-  arrayi_iplv: "(a[0], a[1], a[2] = g, h, i; nil)"
-  attr2_2plv: "(b.a, b.b = g, h; nil)"
-  attr2_iplv: "(b.a, b.b = g, h, i; nil)"
-  attri_2plv: "(b.a, b.b, b.c = g, h; nil)"
-  attri_iplv: "(b.a, b.b, b.c = g, h, i; nil)"
-  lvar2_2plv: "(d, e = g, h; nil)"
-  lvar2_iplv: "(d, e = g, h, i; nil)"
-  lvari_2plv: "(d, e, f = g, h; nil)"
-  lvari_iplv: "(d, e, f = g, h, i; nil)"
diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb
deleted file mode 100644
index ffda109912..0000000000
--- a/benchmark/match_gt4.rb
+++ /dev/null
@@ -1 +0,0 @@
-1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") }
diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb
deleted file mode 100644
index 3b743d484a..0000000000
--- a/benchmark/match_small.rb
+++ /dev/null
@@ -1 +0,0 @@
-1000000.times { 'haystack'.match(/hay/) }
diff --git a/benchmark/memory_wrapper.rb b/benchmark/memory_wrapper.rb
new file mode 100644
index 0000000000..3f4451a037
--- /dev/null
+++ b/benchmark/memory_wrapper.rb
@@ -0,0 +1,16 @@
+
+write_file, target, script_file = ARGV
+
+load(script_file)
+require_relative '../test/lib/memory_status'
+open(write_file, 'wb'){|f|
+  ms = Memory::Status.new
+  case target.to_sym
+  when :peak
+    key = ms.respond_to?(:hwm) ? :hwm : :peak
+  when :size
+    key = ms.respond_to?(:rss) ? :rss : :size
+  end
+
+  f.puts ms[key]
+}
diff --git a/benchmark/method_bind_call.yml b/benchmark/method_bind_call.yml
deleted file mode 100644
index 9e0e046ed4..0000000000
--- a/benchmark/method_bind_call.yml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
-  named_module = Kernel
-
-  module FakeName
-    def self.name
-      "NotMyame".freeze
-    end
-  end
-
-  MOD_NAME = Module.instance_method(:name)
-
-benchmark:
-  fastpath: MOD_NAME.bind_call(Kernel)
-  slowpath: MOD_NAME.bind_call(FakeName)
-
-loop_count: 100_000
diff --git a/benchmark/module_eqq.yml b/benchmark/module_eqq.yml
deleted file mode 100644
index a561fb86dc..0000000000
--- a/benchmark/module_eqq.yml
+++ /dev/null
@@ -1,27 +0,0 @@
-prelude: |
-  class SimpleClass; end
-  class MediumClass
-    10.times { include Module.new }
-  end
-  class LargeClass
-    100.times { include Module.new }
-  end
-  class HugeClass
-    300.times { include Module.new }
-  end
-  SimpleObj = SimpleClass.new
-  MediumObj = MediumClass.new
-  LargeObj = LargeClass.new
-  HugeObj = HugeClass.new
-benchmark:
-  simple_class_eqq_simple_obj: |
-    SimpleClass === SimpleObj
-  medium_class_eqq_simple_obj: |
-    MediumClass === SimpleObj
-  simple_class_eqq_medium_obj: |
-    SimpleClass === MediumObj
-  simple_class_eqq_large_obj: |
-    SimpleClass === LargeObj
-  simple_class_eqq_huge_obj: |
-    SimpleClass === HugeObj
-loop_count: 20000000
diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml
deleted file mode 100644
index 79ba4f2177..0000000000
--- a/benchmark/nil_p.yml
+++ /dev/null
@@ -1,9 +0,0 @@
-prelude: |
-  class Niller; def nil?; true; end; end
-  xnil, notnil = nil, Object.new
-  niller = Niller.new
-benchmark:
-  - xnil.nil?
-  - notnil.nil?
-  - niller.nil?
-loop_count: 10000000
diff --git a/benchmark/nilclass.yml b/benchmark/nilclass.yml
deleted file mode 100644
index fba67a5f6a..0000000000
--- a/benchmark/nilclass.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-benchmark:
-  to_i: |
-    nil.to_i
-  to_f: |
-    nil.to_f
-loop_count: 100000
diff --git a/benchmark/num_zero_p.yml b/benchmark/num_zero_p.yml
deleted file mode 100644
index 2195963433..0000000000
--- a/benchmark/num_zero_p.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-benchmark:
-  - 0.zero?
-  - 1.zero?
-  - 0r.zero?
-  - 1r.zero?
-  - 0i.zero?
-  - 1i.zero?
-loop_count: 50000000
diff --git a/benchmark/numeric_methods.yml b/benchmark/numeric_methods.yml
deleted file mode 100644
index 1384902935..0000000000
--- a/benchmark/numeric_methods.yml
+++ /dev/null
@@ -1,29 +0,0 @@
-prelude: |
-  int = 42
-  flo = 4.2
-benchmark:
-  real?: |
-    int.real?
-  integer?: |
-    flo.integer?
-  finite?: |
-    int.finite?
-  infinite?: |
-    int.infinite?
-  integer_real: |
-    int.real
-  float_real: |
-    flo.real
-  integr_imag: |
-    int.imag
-  float_imag: |
-    flo.imag
-  integer_conj: |
-    int.conj
-  float_conj: |
-    flo.conj
-  integer_numerator: |
-    int.numerator
-  integer_denominator: |
-    int.denominator
-loop_count: 20000000
diff --git a/benchmark/object_allocate.yml b/benchmark/object_allocate.yml
deleted file mode 100644
index bdbd4536db..0000000000
--- a/benchmark/object_allocate.yml
+++ /dev/null
@@ -1,48 +0,0 @@
-prelude: |
-  class Eight
-    8.times { include(Module.new) }
-  end
-  class ThirtyTwo
-    32.times { include(Module.new) }
-  end
-  class SixtyFour
-    64.times { include(Module.new) }
-  end
-  class OneTwentyEight
-    128.times { include(Module.new) }
-  end
-  class OnePositional
-    def initialize a; end
-  end
-  class TwoPositional
-    def initialize a, b; end
-  end
-  class ThreePositional
-    def initialize a, b, c; end
-  end
-  class FourPositional
-    def initialize a, b, c, d; end
-  end
-  class KWArg
-    def initialize a:, b:, c:, d:
-    end
-  end
-  class Mixed
-    def initialize a, b, c:, d:
-    end
-  end
-  # Disable GC to see raw throughput:
-  GC.disable
-benchmark:
-  allocate_8_deep: Eight.new
-  allocate_32_deep: ThirtyTwo.new
-  allocate_64_deep: SixtyFour.new
-  allocate_128_deep: OneTwentyEight.new
-  allocate_1_positional_params: OnePositional.new(1)
-  allocate_2_positional_params: TwoPositional.new(1, 2)
-  allocate_3_positional_params: ThreePositional.new(1, 2, 3)
-  allocate_4_positional_params: FourPositional.new(1, 2, 3, 4)
-  allocate_kwarg_params: "KWArg.new(a: 1, b: 2, c: 3, d: 4)"
-  allocate_mixed_params: "Mixed.new(1, 2, c: 3, d: 4)"
-  allocate_no_params: "Object.new"
-loop_count: 100000
diff --git a/benchmark/objspace_dump_all.yml b/benchmark/objspace_dump_all.yml
deleted file mode 100644
index ebab562d2e..0000000000
--- a/benchmark/objspace_dump_all.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-prelude: |
-  require 'objspace'
-  require 'tempfile'
-  $objs = 1_000.times.map { Object.new }
-  $strings = 1_000.times.map { |i| "string #{i}" }
-  $file = Tempfile.new('heap')
-  $dev_null = File.open(File::NULL, 'w+')
-
-benchmark:
-  dump_all_string: "ObjectSpace.dump_all(output: :string)"
-  dump_all_file: "ObjectSpace.dump_all(output: $file)"
-  dump_all_dev_null: "ObjectSpace.dump_all(output: $dev_null)"
-loop_count: 1
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
index 1ce9f76275..01593965d9 100644
--- a/benchmark/other-lang/fact.py
+++ b/benchmark/other-lang/fact.py
@@ -3,7 +3,7 @@
 
 def factL(n):
 	r = 1
-	for x in range(2, n+1):
+	for x in range(2, n):
 		r *= x
 	return r
 
diff --git a/benchmark/pm_array.yml b/benchmark/pm_array.yml
deleted file mode 100644
index babb65a289..0000000000
--- a/benchmark/pm_array.yml
+++ /dev/null
@@ -1,19 +0,0 @@
-prelude: |
-  def call(*val)
-    case val
-      in [String => body]
-        [200, {}, [body]]
-      in [Integer => status]
-        [status, {}, [""]]
-      in [Integer, String] => response
-        [response[0], {}, [response[1]]]
-      in [Integer, Hash, String] => response
-        [response[0], response[1], [response[2]]]
-    end
-  end
-
-benchmark:
-  first_match: call("ok")
-  second_match: call(401)
-  third_match: call(200, "ok")
-  fourth_match: call(201, {}, "created")
diff --git a/benchmark/prepare_require.rb b/benchmark/prepare_require.rb
new file mode 100644
index 0000000000..c4786f04ad
--- /dev/null
+++ b/benchmark/prepare_require.rb
@@ -0,0 +1,25 @@
+require "fileutils"
+
+def prepare
+  num_files = 10000
+
+  basename = File.dirname($0)
+  data_dir = File.join(basename, "bm_require.data")
+
+  # skip if all of files exists
+  if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+    return
+  end
+
+  FileUtils.mkdir_p(data_dir)
+
+  1.upto(num_files) do |i|
+    f = File.open("#{data_dir}/c#{i}.rb", "w")
+    f.puts <<-END
+      class C#{i}
+      end
+    END
+  end
+end
+
+prepare
diff --git a/benchmark/prepare_require_thread.rb b/benchmark/prepare_require_thread.rb
new file mode 100644
index 0000000000..339ecb8b39
--- /dev/null
+++ b/benchmark/prepare_require_thread.rb
@@ -0,0 +1,2 @@
+load File.join(File.dirname(__FILE__), "prepare_require.rb")
+
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
new file mode 100644
index 0000000000..ee2138cdb2
--- /dev/null
+++ b/benchmark/prepare_so_count_words.rb
@@ -0,0 +1,15 @@
+# prepare 'wc.input'
+
+def prepare_wc_input
+  wcinput = File.join(File.dirname($0), 'wc.input')
+  wcbase  = File.join(File.dirname($0), 'wc.input.base')
+  unless FileTest.exist?(wcinput)
+    data = File.read(wcbase)
+    13.times{
+      data << data
+    }
+    open(wcinput, 'w'){|f| f.write data}
+  end
+end
+
+prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
new file mode 100644
index 0000000000..d83aeb7a7e
--- /dev/null
+++ b/benchmark/prepare_so_k_nucleotide.rb
@@ -0,0 +1,2 @@
+require_relative 'make_fasta_output'
+prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
new file mode 100644
index 0000000000..da3ec2df14
--- /dev/null
+++ b/benchmark/prepare_so_reverse_complement.rb
@@ -0,0 +1,2 @@
+require_relative 'make_fasta_output'
+prepare_fasta_output(2_500_000)
diff --git a/benchmark/ractor_const.yml b/benchmark/ractor_const.yml
deleted file mode 100644
index d7ab74bdca..0000000000
--- a/benchmark/ractor_const.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-type: lib/benchmark_driver/runner/ractor
-benchmark:
-  ractor_const: Object
-ractor: 1
diff --git a/benchmark/ractor_float_to_s.yml b/benchmark/ractor_float_to_s.yml
deleted file mode 100644
index 8f492be668..0000000000
--- a/benchmark/ractor_float_to_s.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-type: lib/benchmark_driver/runner/ractor
-prelude: |
-  FLOATS = [*0.0.step(1.0, 0.001)]
-benchmark:
-  ractor_float_to_s: |
-    FLOATS.each {|f| f.to_s}
-loop_count: 100
-ractor: 2
diff --git a/benchmark/range_bsearch_bignum.yml b/benchmark/range_bsearch_bignum.yml
deleted file mode 100644
index 5730c93fcf..0000000000
--- a/benchmark/range_bsearch_bignum.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
-  first = 2**100
-  last = 2**1000
-  mid = (first + last) / 2
-  r = first..last
-
-benchmark:
-  first: r.bsearch { |x| x >= first }
-  mid: r.bsearch { |x| x >= mid }
-  last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_bsearch_endpointless.yml b/benchmark/range_bsearch_endpointless.yml
deleted file mode 100644
index 8d7bedb662..0000000000
--- a/benchmark/range_bsearch_endpointless.yml
+++ /dev/null
@@ -1,21 +0,0 @@
-prelude: |
-  re = (1..)
-  rb = (..0)
-
-benchmark:
-  'endless 10**0': re.bsearch { |x| x >= 1 }
-  'endless 10**1': re.bsearch { |x| x >= 10 }
-  'endless 10**2': re.bsearch { |x| x >= 100 }
-  'endless 10**3': re.bsearch { |x| x >= 1000 }
-  'endless 10**4': re.bsearch { |x| x >= 10000 }
-  'endless 10**5': re.bsearch { |x| x >= 100000 }
-  'endless 10**10': re.bsearch { |x| x >= 10000000000 }
-  'endless 10**100': re.bsearch { |x| x >= 10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
-  'beginless -10**0': rb.bsearch { |x| x >= -1 }
-  'beginless -10**1': rb.bsearch { |x| x >= -10 }
-  'beginless -10**2': rb.bsearch { |x| x >= -100 }
-  'beginless -10**3': rb.bsearch { |x| x >= -1000 }
-  'beginless -10**4': rb.bsearch { |x| x >= -10000 }
-  'beginless -10**5': rb.bsearch { |x| x >= -100000 }
-  'beginless -10**10': rb.bsearch { |x| x >= -10000000000 }
-  'beginless -10**100': rb.bsearch { |x| x >= -10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
diff --git a/benchmark/range_bsearch_fixnum.yml b/benchmark/range_bsearch_fixnum.yml
deleted file mode 100644
index 59416531b9..0000000000
--- a/benchmark/range_bsearch_fixnum.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
-  first = 1
-  last = 10000
-  mid = (first + last) / 2
-  r = first..last
-
-benchmark:
-  first: r.bsearch { |x| x >= first }
-  mid: r.bsearch { |x| x >= mid }
-  last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_count.yml b/benchmark/range_count.yml
deleted file mode 100644
index 58f53a0236..0000000000
--- a/benchmark/range_count.yml
+++ /dev/null
@@ -1,11 +0,0 @@
-prelude: |
-  r_1 = 1..1
-  r_1k = 1..1000
-  r_1m = 1..1000000
-  r_str = 'a'..'z'
-
-benchmark:
-  'int 1': r_1.count
-  'int 1K': r_1k.count
-  'int 1M': r_1m.count
-  string: r_str.count
diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml
deleted file mode 100644
index a6674f82ee..0000000000
--- a/benchmark/range_last.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-benchmark:
-  - (1..1_000_000).last(100)
-  - (1..1_000_000).last(1000)
-  - (1..1_000_000).last(10000)
diff --git a/benchmark/range_min.yml b/benchmark/range_min.yml
deleted file mode 100644
index 9e60dd7308..0000000000
--- a/benchmark/range_min.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-benchmark:
-  - (1..10).min
diff --git a/benchmark/range_overlap.yml b/benchmark/range_overlap.yml
deleted file mode 100644
index 700a00053c..0000000000
--- a/benchmark/range_overlap.yml
+++ /dev/null
@@ -1,19 +0,0 @@
-prelude: |
-  class Range
-    unless method_defined?(:overlap?)
-      def overlap?(other)
-        other.begin == self.begin || cover?(other.begin) || other.cover?(self.begin)
-      end
-    end
-  end
-
-benchmark:
-  - (2..3).overlap?(1..1)
-  - (2..3).overlap?(2..4)
-  - (2..3).overlap?(4..5)
-  - (2..3).overlap?(2..1)
-  - (2..3).overlap?(0..1)
-  - (2..3).overlap?(...1)
-  - (2...3).overlap?(..2)
-  - (2...3).overlap?(3...)
-  - (2..3).overlap?('a'..'d')
diff --git a/benchmark/range_reverse_each.yml b/benchmark/range_reverse_each.yml
deleted file mode 100644
index a32efeccc6..0000000000
--- a/benchmark/range_reverse_each.yml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
-  rf_1 = 0..1
-  rf_1k = 0..1000
-  rf_1m = 0..1000000
-  big = 2**1000
-  rb_1 = big..big+1
-  rb_1k = big..big+1000
-  rb_1m = big..big+1000000
-
-benchmark:
-  "Fixnum 1": rf_1.reverse_each { _1 }
-  "Fixnum 1K": rf_1k.reverse_each { _1 }
-  "Fixnum 1M": rf_1m.reverse_each { _1 }
-  "Bignum 1": rb_1.reverse_each { _1 }
-  "Bignum 1K": rb_1k.reverse_each { _1 }
-  "Bignum 1M": rb_1m.reverse_each { _1 }
diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml
deleted file mode 100644
index 6b6a4836b0..0000000000
--- a/benchmark/realpath.yml
+++ /dev/null
@@ -1,33 +0,0 @@
-prelude: |
-  f = File
-  pwd = Dir.pwd
-  Dir.mkdir('b') unless f.directory?('b')
-  f.write('b/a', '') unless f.file?('b/a')
-
-  relative = 'b/a'
-  absolute = File.join(pwd, relative)
-  dir = 'b'
-  file = 'a'
-
-  relative_dir = 'b/c'
-  absolute_dir = File.join(pwd, relative_dir)
-  file_dir = 'c'
-teardown: |
-  require 'fileutils'
-  FileUtils.rm_rf('b')
-benchmark:
-  relative_nil: "f.realpath(relative, nil)"
-  absolute_nil: "f.realpath(absolute, nil)"
-  relative_relative: "f.realpath(file, dir)"
-  absolute_relative: "f.realpath(absolute, dir)"
-  relative_absolute: "f.realpath(relative, pwd)"
-  relative_nil_dir: "f.realdirpath(relative_dir, nil)"
-  absolute_nil_dir: "f.realdirpath(absolute_dir, nil)"
-  relative_relative_dir: "f.realdirpath(file_dir, dir)"
-  absolute_relative_dir: "f.realdirpath(absolute_dir, dir)"
-  relative_absolute_dir: "f.realdirpath(relative_dir, pwd)"
-  relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil"
-  absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil"
-  relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil"
-  absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil"
-  relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil"
diff --git a/benchmark/regexp_dup.yml b/benchmark/regexp_dup.yml
deleted file mode 100644
index 52f89991cd..0000000000
--- a/benchmark/regexp_dup.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-prelude: |
-  str = "a" * 1000
-  re = Regexp.new(str)
-
-benchmark:
-  dup: re.dup
diff --git a/benchmark/regexp_new.yml b/benchmark/regexp_new.yml
deleted file mode 100644
index bc9ab3ca21..0000000000
--- a/benchmark/regexp_new.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  str = "a" * 1000
-  re = Regexp.new(str)
-
-benchmark:
-  string: Regexp.new(str)
-  regexp: Regexp.new(re)
diff --git a/benchmark/report.rb b/benchmark/report.rb
new file mode 100644
index 0000000000..d2dc56b1e1
--- /dev/null
+++ b/benchmark/report.rb
@@ -0,0 +1,79 @@
+#
+# YARV benchmark driver
+#
+
+require 'yarvutil'
+require 'benchmark'
+require 'rbconfig'
+
+def exec_command type, file, w
+  <<-EOP
+  $DRIVER_PATH = '#{File.dirname($0)}'
+  $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
+  require 'benchmark'
+  require 'yarvutil'
+#  print '#{type}'
+  begin
+    puts Benchmark.measure{
+      #{w}('#{file}')
+    }.utime
+  rescue Exception => exec_command_error_variable
+    puts "\t" + exec_command_error_variable.message
+  end
+  EOP
+end
+
+def benchmark cmd
+  rubybin = ENV['RUBY'] || RbConfig.ruby
+
+  IO.popen(rubybin, 'r+'){|io|
+    io.write cmd
+    io.close_write
+    return io.gets
+  }
+end
+
+def ruby_exec file
+  prog = exec_command 'ruby', file, 'load'
+  benchmark prog
+end
+
+def yarv_exec file
+  prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
+  benchmark prog
+end
+
+$wr = $wy = nil
+
+def measure bench
+  file = File.dirname($0) + "/bm_#{bench}.rb"
+  r = ruby_exec(file).to_f
+  y = yarv_exec(file).to_f
+  puts "#{bench}\t#{r}\t#{y}"
+end
+
+def measure2
+  r = ruby_exec.to_f
+  y = yarv_exec.to_f
+  puts r/y
+end
+
+if $0 == __FILE__
+  %w{
+    whileloop
+    whileloop2
+    times
+    const
+    method
+    poly_method
+    block
+    rescue
+    rescue2
+  }.each{|bench|
+    measure bench
+  }
+end
+
+
+
+
diff --git a/benchmark/require.yml b/benchmark/require.yml
deleted file mode 100644
index 09f218cf08..0000000000
--- a/benchmark/require.yml
+++ /dev/null
@@ -1,32 +0,0 @@
-prelude: |
-  require "fileutils"
-
-  def prepare
-    num_files = 10000
-
-    basename = File.dirname($0)
-    data_dir = File.join(basename, "bm_require.data")
-
-    # skip if all of files exists
-    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
-      return
-    end
-
-    FileUtils.mkdir_p(data_dir)
-
-    1.upto(num_files) do |i|
-      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
-    end
-  end
-
-  prepare
-benchmark:
-  require: |
-    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-    1.upto(10000) do |i|
-      require "c#{i}"
-    end
-
-    $:.pop
-loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
deleted file mode 100644
index 0c63257106..0000000000
--- a/benchmark/require_thread.yml
+++ /dev/null
@@ -1,40 +0,0 @@
-prelude: |
-  require "fileutils"
-
-  def prepare
-    num_files = 10000
-
-    basename = File.dirname($0)
-    data_dir = File.join(basename, "bm_require.data")
-
-    # skip if all of files exists
-    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
-      return
-    end
-
-    FileUtils.mkdir_p(data_dir)
-
-    1.upto(num_files) do |i|
-      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
-    end
-  end
-
-  prepare
-benchmark:
-  require_thread: |
-    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-    i=0
-    t = Thread.new do
-      while true
-        i = i+1 # dummy loop
-      end
-    end
-
-    1.upto(100) do |i|
-      require "c#{i}"
-    end
-
-    $:.pop
-    t.kill
-loop_count: 1
diff --git a/benchmark/run.rb b/benchmark/run.rb
new file mode 100644
index 0000000000..0cd2363849
--- /dev/null
+++ b/benchmark/run.rb
@@ -0,0 +1,127 @@
+#
+# Ruby benchmark driver
+#
+
+require 'benchmark'
+require 'rbconfig'
+
+$matzrubyonly = false
+$rubyonly = false
+
+$results  = []
+
+# prepare 'wc.input'
+def prepare_wc_input
+  wcinput = File.join(File.dirname($0), 'wc.input')
+  wcbase  = File.join(File.dirname($0), 'wc.input.base')
+  unless FileTest.exist?(wcinput)
+    data = File.read(wcbase)
+    13.times{
+      data << data
+    }
+    open(wcinput, 'w'){|f| f.write data}
+  end
+end
+
+prepare_wc_input
+
+def bm file
+  prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
+  return if prog.empty?
+
+  /[a-z]+_(.+)\.rb/ =~ file
+  bm_name = $1
+  puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
+  puts "#{bm_name}: "
+
+
+puts <<EOS unless $matzrubyonly || $rubyonly
+#{prog}
+--
+EOS
+  begin
+    result = [bm_name]
+    result << matzruby_exec(file) unless $rubyonly
+    result << ruby_exec(file) unless $matzrubyonly
+    $results << result
+
+  rescue Exception => e
+    puts
+    puts "** benchmark failure: #{e}"
+    puts e.backtrace
+  end
+end
+
+def benchmark file, bin
+  m = Benchmark.measure{
+    `#{bin} #{$opts} #{file}`
+  }
+  sec = '%.3f' % m.real
+  puts " #{sec}"
+  sec
+end
+
+def ruby_exec file
+  print 'ruby'
+  benchmark file, $ruby_program
+end
+
+def matzruby_exec file
+  print 'matz'
+  rubylib = ENV['RUBYLIB']
+  ENV['RUBYLIB'] = ''
+  r = benchmark file, $matzruby_program
+  ENV['RUBYLIB'] = rubylib
+  r
+end
+
+if $0 == __FILE__
+  ARGV.each{|arg|
+    case arg
+    when /\A--ruby=(.+)/
+      $ruby_program = $1
+    when /\A--matzruby=(.+)/
+      $matzruby_program = $1
+    when /\A--opts=(.+)/
+      $opts = $1
+    when /\A(-r|--only-ruby)\z/
+      $rubyonly = true
+    when /\A(-m|--only-matzruby)\z/
+      $matzrubyonly = true
+    end
+  }
+  ARGV.delete_if{|arg|
+    /\A-/ =~ arg
+  }
+
+  puts "MatzRuby:"
+  system("#{$matzruby_program} -v")
+  puts "Ruby:"
+  system("#{$ruby_program} -v")
+  puts
+
+  if ARGV.empty?
+    Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
+      bm file
+    }
+  else
+    ARGV.each{|file|
+      Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
+        # file = "#{File.dirname(__FILE__)}/#{file}.rb"
+        bm ef
+      }
+    }
+  end
+
+  puts
+  puts "-- benchmark summary ---------------------------"
+  $results.each{|res|
+    print res.shift, "\t"
+    (res||[]).each{|result|
+      /([\d\.]+)/ =~ result
+      print $1 + "\t" if $1
+    }
+    puts
+  }
+end
+
diff --git a/benchmark/runc.rb b/benchmark/runc.rb
new file mode 100644
index 0000000000..97c5cef045
--- /dev/null
+++ b/benchmark/runc.rb
@@ -0,0 +1,27 @@
+#
+#
+#
+
+require 'benchmark'
+require 'rbconfig'
+
+$rubybin = ENV['RUBY'] || RbConfig.ruby
+
+def runfile file
+  puts file
+  file = File.join(File.dirname($0), 'contrib', file)
+  Benchmark.bm{|x|
+    x.report('ruby'){
+      system("#{$rubybin} #{file}")
+    }
+    x.report('yarv'){
+      system("#{$rubybin} -rite -I.. #{file}")
+    }
+  }
+end
+
+ARGV.each{|file|
+  runfile file
+}
+
+
diff --git a/benchmark/scan.yaml b/benchmark/scan.yaml
deleted file mode 100644
index 62ad1d6862..0000000000
--- a/benchmark/scan.yaml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
-  $LOAD_PATH.unshift(File.expand_path("lib"))
-  require "strscan"
-  str = "test string"
-  scanner = StringScanner.new(str)
-  str = "test"
-  reg = /test/
-benchmark:
-  check(reg): |
-    scanner.check(reg)
-  check(str): |
-    scanner.check(str)
-  match?(reg): |
-    scanner.match?(reg)
-  match?(str): |
-    scanner.match?(str)
diff --git a/benchmark/search.yaml b/benchmark/search.yaml
deleted file mode 100644
index 42a50c90e6..0000000000
--- a/benchmark/search.yaml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
-  $LOAD_PATH.unshift(File.expand_path("lib"))
-  require "strscan"
-  str = "test string"
-  scanner = StringScanner.new(str)
-  str = "string"
-  reg = /string/
-benchmark:
-  check_until(reg): |
-    scanner.check_until(reg)
-  check_until(str): |
-    scanner.check_until(str)
-  exist?(reg): |
-    scanner.exist?(reg)
-  exist?(str): |
-    scanner.exist?(str)
diff --git a/benchmark/so_ackermann.rb b/benchmark/so_ackermann.rb
deleted file mode 100644
index 4effa1ecaf..0000000000
--- a/benchmark/so_ackermann.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-def ack(m, n)
-    if m == 0 then
-        n + 1
-    elsif n == 0 then
-        ack(m - 1, 1)
-    else
-        ack(m - 1, ack(m, n - 1))
-    end
-end
-
-NUM = 9
-ack(3, NUM)
-
-
diff --git a/benchmark/so_array.rb b/benchmark/so_array.rb
deleted file mode 100644
index 767e03db5f..0000000000
--- a/benchmark/so_array.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan and Mark Hubbart
-
-n = 9000 # Integer(ARGV.shift || 1)
-
-x = Array.new(n)
-y = Array.new(n, 0)
-
-n.times{|bi|
-  x[bi] = bi + 1
-}
-
-(0 .. 999).each do |e|
-  (n-1).step(0,-1) do |bi|
-    y[bi] += x.at(bi)
-  end
-end
-# puts "#{y.first} #{y.last}"
-
-
diff --git a/benchmark/so_concatenate.rb b/benchmark/so_concatenate.rb
deleted file mode 100644
index 4468e20ac8..0000000000
--- a/benchmark/so_concatenate.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
-
-STUFF = "hello\n"
-i = 0
-while i<10
-  i += 1
-  hello = ''
-  4_000_000.times do |e|
-    hello << STUFF
-  end
-end
-# puts hello.length
-
-
diff --git a/benchmark/so_count_words.yml b/benchmark/so_count_words.yml
deleted file mode 100644
index f7322a8541..0000000000
--- a/benchmark/so_count_words.yml
+++ /dev/null
@@ -1,66 +0,0 @@
-prelude: |
-  #!/usr/bin/ruby
-
-  wc_input_base = <<EOS
-  Subject:      Re: Who was Izchak Miller?
-  From:         "Jane D. Anonymous" <nobody@yale.edu>
-  Date:         1996/04/28
-  Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
-  References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
-  To:           75176.2330@compuserve.com
-  Content-Type: text/plain; charset=us-ascii
-  Organization: Yale University
-  X-Url:        news:4lk6vl$gde@ns.oar.net
-  Mime-Version: 1.0
-  Newsgroups:   rec.games.roguelike.nethack
-  X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
-
-  Hello there,  Izchak Miller was my  father.  When I was  younger I spent
-  many  a night,  hunched over  the keyboard  with a  cup of  tea, playing
-  nethack with him and my brother.  my dad was a philosopher with a strong
-  weakness for fantasy/sci fi.  I remember when he started to get involved
-  with the  Nethack team- my  brother's Dungeons and Dragons  monster book
-  found a regular place beside my dad's  desk. it's nice to see him living
-  on in the game he loved so much :-).
-                                                                    Tamar Miller
-
-  The following is a really long word of 5000 characters:
-
-  wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
-  EOS
-
-  # prepare 'wc.input'
-
-  def prepare_wc_input(wcbase)
-    wcinput = File.join(File.dirname($0), 'wc.input')
-    unless FileTest.exist?(wcinput)
-      data = wcbase.dup
-      13.times{
-        data << data
-      }
-      File.write(wcinput, data)
-    end
-    at_exit {File.unlink(wcinput) rescue nil}
-  end
-
-  prepare_wc_input(wc_input_base)
-
-benchmark:
-  so_count_words: |
-    # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-    # http://www.bagley.org/~doug/shootout/
-    # with help from Paul Brannan
-
-    nl = nw = nc = 0
-    File.open(File.join(File.dirname($0), 'wc.input'), 'rb') do |input|
-      while tmp = input.read(4096)
-        data = tmp << (input.gets || "")
-        nc += data.length
-        nl += data.count("\n")
-        ((data.strip! || data).tr!("\n", " ") || data).squeeze!
-        nw += data.count(" ") + 1
-      end
-    end
-    # STDERR.puts "#{nl} #{nw} #{nc}"
-
-loop_count: 1
diff --git a/benchmark/so_exception.rb b/benchmark/so_exception.rb
deleted file mode 100644
index eb205b4df1..0000000000
--- a/benchmark/so_exception.rb
+++ /dev/null
@@ -1,61 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-$HI = 0
-$LO = 0
-NUM = 250000 # Integer(ARGV[0] || 1)
-
-
-class Lo_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-class Hi_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-def some_function(num)
-  begin
-    hi_function(num)
-  rescue
-    print "We shouldn't get here, exception is: #{$!.type}\n"
-  end
-end
-
-def hi_function(num)
-  begin
-    lo_function(num)
-  rescue Hi_Exception
-    $HI = $HI + 1
-  end
-end
-
-def lo_function(num)
-  begin
-    blowup(num)
-  rescue Lo_Exception
-    $LO = $LO + 1
-  end
-end
-
-def blowup(num)
-  if num % 2 == 0
-    raise Lo_Exception.new(num)
-  else
-    raise Hi_Exception.new(num)
-  end
-end
-
-
-i = 1
-max = NUM+1
-while i < max
-  i += 1
-  some_function(i+1)
-end
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
deleted file mode 100644
index d7df086c39..0000000000
--- a/benchmark/so_k_nucleotide.yml
+++ /dev/null
@@ -1,155 +0,0 @@
-prelude: |
-  bm_so_fasta = <<'EOS'
-  # The Computer Language Shootout
-  # http://shootout.alioth.debian.org/
-  # Contributed by Sokolov Yura
-
-  $last = 42.0
-  def gen_random(max, im=139968, ia=3877, ic=29573)
-      (max * ($last = ($last * ia + ic) % im)) / im
-  end
-
-  alu =
-     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
-     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
-     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
-     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
-     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
-     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
-     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-  iub = [
-      ["a", 0.27],
-      ["c", 0.12],
-      ["g", 0.12],
-      ["t", 0.27],
-
-      ["B", 0.02],
-      ["D", 0.02],
-      ["H", 0.02],
-      ["K", 0.02],
-      ["M", 0.02],
-      ["N", 0.02],
-      ["R", 0.02],
-      ["S", 0.02],
-      ["V", 0.02],
-      ["W", 0.02],
-      ["Y", 0.02],
-  ]
-  homosapiens = [
-      ["a", 0.3029549426680],
-      ["c", 0.1979883004921],
-      ["g", 0.1975473066391],
-      ["t", 0.3015094502008],
-  ]
-
-  def make_repeat_fasta(id, desc, src, n)
-      puts ">#{id} #{desc}"
-      v = nil
-      width = 60
-      l = src.length
-      s = src * ((n / l) + 1)
-      s.slice!(n, l)
-      puts(s.scan(/.{1,#{width}}/).join("\n"))
-  end
-
-  def make_random_fasta(id, desc, table, n)
-      puts ">#{id} #{desc}"
-      rand, v = nil,nil
-      width = 60
-      chunk = 1 * width
-      prob = 0.0
-      table.each{|v| v[1]= (prob += v[1])}
-      for i in 1..(n/width)
-          puts((1..width).collect{
-              rand = gen_random(1.0)
-              table.find{|v| v[1]>rand}[0]
-          }.join)
-      end
-      if n%width != 0
-          puts((1..(n%width)).collect{
-              rand = gen_random(1.0)
-              table.find{|v| v[1]>rand}[0]
-          }.join)
-      end
-  end
-
-
-  n = (ARGV[0] or 250_000).to_i
-
-  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-  EOS
-benchmark:
-  - name: so_k_nucleotide
-    prelude: |
-      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
-      File.write(script, bm_so_fasta)
-
-      def prepare_fasta_output n
-        filebase = File.join(File.dirname($0), 'fasta.output')
-        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
-        file = "#{filebase}.#{n}"
-
-        unless FileTest.exist?(file)
-          STDERR.puts "preparing #{file}"
-
-          open(file, 'w'){|f|
-            ARGV[0] = n
-            $stdout = f
-            load script
-            $stdout = STDOUT
-          }
-        end
-      end
-      prepare_fasta_output(100_000)
-    script: |
-      # The Computer Language Shootout
-      # http://shootout.alioth.debian.org
-      #
-      # contributed by jose fco. gonzalez
-      # modified by Sokolov Yura
-
-      seq = String.new
-
-      def frecuency( seq,length )
-          n, table = seq.length - length + 1, Hash.new(0)
-          f, i = nil, nil
-          (0 ... length).each do |f|
-              (f ... n).step(length) do |i|
-                  table[seq[i,length]] += 1
-              end
-          end
-          [n,table]
-
-      end
-
-      def sort_by_freq( seq,length )
-          n,table = frecuency( seq,length )
-          a, b, v = nil, nil, nil
-          table.sort{|a,b| b[1] <=> a[1]}.each do |v|
-              puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
-          end
-          puts
-      end
-
-      def find_seq( seq,s )
-          n,table = frecuency( seq,s.length )
-          puts "#{table[s].to_s}\t#{s.upcase}"
-      end
-
-      input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-      line = input.gets while line !~ /^>THREE/
-      line = input.gets
-
-      while (line !~ /^>/) & line do
-          seq << line.chomp
-          line = input.gets
-      end
-
-      [1,2].each {|i| sort_by_freq( seq,i ) }
-
-      %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-    loop_count: 1
diff --git a/benchmark/so_matrix.rb b/benchmark/so_matrix.rb
deleted file mode 100644
index 2d1e72bda9..0000000000
--- a/benchmark/so_matrix.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-n = 60 #Integer(ARGV.shift || 1)
-
-size = 40
-
-def mkmatrix(rows, cols)
-    count = 1
-    mx = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            row[j] = count
-            count += 1
-        end
-        mx[bi] = row
-    end
-    mx
-end
-
-def mmult(rows, cols, m1, m2)
-    m3 = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            val = 0
-            (0 .. (cols - 1)).each do |k|
-                val += m1.at(bi).at(k) * m2.at(k).at(j)
-            end
-            row[j] = val
-        end
-        m3[bi] = row
-    end
-    m3
-end
-
-m1 = mkmatrix(size, size)
-m2 = mkmatrix(size, size)
-mm = Array.new
-n.times do
-    mm = mmult(size, size, m1, m2)
-end
-# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
-
-
diff --git a/benchmark/so_meteor_contest.rb b/benchmark/so_meteor_contest.rb
deleted file mode 100644
index d8c8e3ab9c..0000000000
--- a/benchmark/so_meteor_contest.rb
+++ /dev/null
@@ -1,563 +0,0 @@
-#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-#   http://shootout.alioth.debian.org
-#   contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM:  the main body is at the bottom.
-#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-#   2) see how I represent a board as a bitmask by reading the blank_board comments
-#   3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
-  # an array (by location) containing a bit mask for how the piece maps at the given location.
-  # if the rotation is invalid at that location the mask will contain false
-  attr_reader :start_masks
-
-  # maps a direction to a relative location.  these differ depending on whether it is an even or
-  # odd row being mapped from
-  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
-  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
-  def initialize( directions )
-    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
-    @even_mask = mask_for_offsets( @even_offsets)
-    @odd_mask = mask_for_offsets( @odd_offsets)
-
-    @start_masks = Array.new(60)
-
-    # create the rotational masks by placing the base mask at the location and seeing if
-    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
-    # is true the piece cannot be placed
-    0.upto(59) do | offset |
-      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
-      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
-        imask = compute_required( mask, offset)
-        @start_masks[offset] = [ mask, imask, imask | mask ]
-      else
-        @start_masks[offset] = false
-      end
-    end
-  end
-
-  def compute_required( mask, offset )
-    board = blank_board
-    0.upto(offset) { | i | board |= 1 << i }
-    board |= mask
-    return 0 if (!prunable(board | mask, offset))
-    board = flood_fill(board,58)
-    count = 0
-    imask = 0
-    0.upto(59) do | i |
-      if (board[i] == 0) then
-        imask |= (1 << i)
-        count += 1
-      end
-    end
-    (count > 0 && count < 5) ? imask : 0
-  end
-
-  def flood_fill( board, location)
-    return board if (board[location] == 1)
-    board |= 1 << location
-    row, col = location.divmod(6)
-    board = flood_fill( board, location - 1) if (col > 0)
-    board = flood_fill( board, location + 1) if (col < 4)
-    if (row % 2 == 0) then
-      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
-    else
-      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
-    end
-    board
-  end
-
-  # given a location, produces a list of relative locations covered by the piece at this rotation
-  def offsets( location)
-    if is_even( location) then
-      @even_offsets.collect { | value | value + location }
-    else
-      @odd_offsets.collect { | value | value + location }
-    end
-  end
-
-  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
-  # this is hard to explain. imagine we have this partial board:
-  #   0 0 0 0 0 x        [positions 0-5]
-  #    0 0 1 1 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 1 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # The top-left of the piece is at position 8, the
-  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
-  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
-  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
-  #   0 0 0 1 1 x        [positions 0-5]
-  #    0 0 1 0 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 0 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
-  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
-  # this function would return
-  def normalize_offsets( values)
-    min = values.min
-    even_min = is_even(min)
-    other_min = even_min ? min + 6 : min + 7
-    other_values = values.collect do | value |
-      if is_even(value) then
-        value + 6 - other_min
-      else
-        value + 7 - other_min
-      end
-    end
-    values.collect! { | value | value - min }
-
-    if even_min then
-      [values, other_values]
-    else
-      [other_values, values]
-    end
-  end
-
-  # produce a bitmask representation of an array of offset locations
-  def mask_for_offsets( offsets )
-    mask = 0
-    offsets.each { | value | mask = mask + ( 1 << value ) }
-    mask
-  end
-
-  # finds a "safe" position that a position as described by a list of directions can be placed
-  # without falling off any edge of the board.  the values returned a location to place the first piece
-  # at so it will fit after making the described moves
-  def start_adjust( directions )
-    south = east = 0;
-    directions.each do | direction |
-      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
-      south += 1 if ( direction == :nw || direction == :ne )
-    end
-    south * 6 + east
-  end
-
-  # given a set of directions places the piece (as defined by a set of directions) on the board at
-  # a location that will not take it off the edge
-  def get_values( directions )
-    start = start_adjust(directions)
-    values = [ start ]
-    directions.each do | direction |
-      if (start % 12 >= 6) then
-        start += @@rotation_odd_adder[direction]
-      else
-        start += @@rotation_even_adder[direction]
-      end
-      values += [ start ]
-    end
-
-    # some moves take you back to an existing location, we'll strip duplicates
-    values.uniq
-  end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-#   rotations -- all the rotations of the piece
-#   type -- a numeic "name" of the piece
-#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
-#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
-  attr_reader :rotations, :type, :masks
-  attr_accessor :placed
-
-  # transform hashes that change one direction into another when you either flip or rotate a set of directions
-  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
-  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
-  def initialize( directions, type )
-    @type = type
-    @rotations = Array.new();
-    @map = {}
-
-    generate_rotations( directions )
-    directions.collect! { | value | @@flip_converter[value] }
-    generate_rotations( directions )
-
-    # creates the masks AND a map that returns [location, rotation] for any given mask
-    # this is used when a board is found and we want to draw it, otherwise the map is unused
-    @masks = Array.new();
-    0.upto(59) do | i |
-      even = true
-      @masks[i] = @rotations.collect do | rotation |
-        mask = rotation.start_masks[i]
-        @map[mask[0]] = [ i, rotation ] if (mask)
-        mask || nil
-      end
-      @masks[i].compact!
-    end
-  end
-
-  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
-  def generate_rotations( directions )
-    6.times do
-      rotations.push( Rotation.new(directions))
-      directions.collect! { | value | @@rotate_converter[value] }
-    end
-  end
-
-  # given a board string, adds this piece to the board at whatever location/rotation
-  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
-  def fill_string( board_string)
-    location, rotation = @map[@placed]
-    rotation.offsets(location).each do | offset |
-      row, col = offset.divmod(6)
-      board_string[ row*5 + col, 1 ] = @type.to_s
-    end
-  end
-end
-
-# a blank bit board having this form:
-#
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
-  0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
-  0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
-  (location % 12) < 6
-end
-
-# support function that create three utility maps:
-#  $converter -- for each row an array that maps a five bit row (via array mapping)
-#                to the a five bit representation of the bits below it
-#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-#                   a region array has three values the first is a mask of bits in the region,
-#                   the second is the count of those bits and the third is identical to the first
-#                   examples:
-#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-#                           0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
-  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
-  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
-  all_odds = Array.new(0b100000)
-  all_evens = Array.new(0b100000)
-  bit_counts = Array.new(0b100000)
-  new_regions = Array.new(0b100000)
-  0.upto(0b11111) do | i |
-    bit_count = odd = even = 0
-    0.upto(4) do | bit |
-      if (i[bit] == 1) then
-        bit_count += 1
-        odd |= odd_map[bit]
-        even |= even_map[bit]
-      end
-    end
-    all_odds[i] = odd
-    all_evens[i] = even
-    bit_counts[i] = bit_count
-    new_regions[i] = create_regions( i)
-  end
-
-  $converter = []
-  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
-  $bit_counts = bit_counts
-  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five.  The following board is an example of a prunable board:
-#    0 0 1 0 0
-#     0 1 0 0 0
-#    1 1 0 0 0
-#     0 1 0 0 0
-#    0 0 0 0 0
-#       ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
-#   location -- starting location, everything above and to the left is already full
-#   slotting -- set to true only when testing initial pieces, when filling normally
-#               additional assumptions are possible
-#
-# Algorithm:
-#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
-#    maintainng counts of active open areas (kept in the collector array) each collector contains
-#    three values at the start of an iteration:
-#          0: mask of bits that would be adjacent to the collector in this row
-#          1: the number of bits collected so far
-#          2: a scratch space starting as zero, but used during the computation to represent
-#             the empty bits in the new row that are adjacent (position 0)
-#  The exact procedure is described in-code
-def prunable( board, location, slotting = false)
-  collectors = []
-  # loop across the rows
-  (location / 6).to_i.upto(9) do | row_on |
-    # obtain a set of regions representing the bits of the current row.
-    regions = $regions[(board >> (row_on * 6)) & 0b11111]
-    converter = $converter[row_on]
-
-    # track the number of collectors at the start of the cycle so that
-    # we don't compute against newly created collectors, only existing collectors
-    initial_collector_count = collectors.length
-
-    # loop against the regions.  For each region of the row
-    # we will see if it connects to one or more existing collectors.
-    # if it connects to 1 collector, the bits from the region are added to the
-    # bits of the collector and the mask is placed in collector[2]
-    # If the region overlaps more than one collector then all the collectors
-    # it overlaps with are merged into the first one (the others are set to nil in the array)
-    # if NO collectors are found then the region is copied as a new collector
-    regions.each do | region |
-      collector_found = nil
-      region_mask = region[2]
-      initial_collector_count.times do | collector_num |
-        collector = collectors[collector_num]
-        if (collector) then
-          collector_mask = collector[0]
-          if (collector_mask & region_mask != 0) then
-            if (collector_found) then
-              collector_found[0] |= collector_mask
-              collector_found[1] += collector[1]
-              collector_found[2] |= collector[2]
-              collectors[collector_num] = nil
-            else
-              collector_found = collector
-              collector[1] += region[1]
-              collector[2] |= region_mask
-            end
-          end
-        end
-      end
-      if (collector_found == nil) then
-        collectors.push(Array.new(region))
-      end
-    end
-
-    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
-    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
-    # the board is prunable.  if it is a multiple of five it is removed.
-    # Collector that are still active have a new adjacent value [0] set based n the matched bits
-    # and have [2] cleared out for the next cycle.
-    collectors.length.times do | collector_num |
-      collector = collectors[collector_num]
-      if (collector) then
-        if (collector[2] == 0) then
-          return true if (collector[1] % 5 != 0)
-          collectors[collector_num] = nil
-        else
-          # if a collector matches all bits in the row then we can return unprunable early for the
-          # following reasons:
-          #    1) there can be no more unavailable bits bince we fill from the top left downward
-          #    2) all previous regions have been closed or joined so only this region can fail
-          #    3) this region must be good since there can never be only 1 region that is nuot
-          #       a multiple of five
-          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
-          # in pieces to see what configurations work for them (the only other time this algorithm is used).
-          return false if (collector[2] == 0b11111 && !slotting)
-          collector[0] = converter[collector[2]]
-          collector[2] = 0
-        end
-      end
-    end
-
-    # get rid of all the empty converters for the next round
-    collectors.compact!
-  end
-  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
-  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask.  see prunable for what a "region" is
-def create_regions( value )
-  regions = []
-  cur_region = 0
-  5.times do | bit |
-    if (value[bit] == 0) then
-      cur_region |= 1 << bit
-    else
-      if (cur_region != 0 ) then
-        regions.push( cur_region)
-        cur_region = 0;
-      end
-    end
-  end
-  regions.push(cur_region) if (cur_region != 0)
-  regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
-  find_top( 1)
-  find_top( 0)
-  print_results
-end
-
-# show the board
-def print_results
-  print "#{@boards_found} solutions found\n\n"
-  print_full_board( @min_board)
-  print "\n"
-  print_full_board( @max_board)
-  print "\n"
-end
-
-# finds solutions.  This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece.  It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
-#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
-#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
-#   diminish over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
-#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-#   maximum number
-def find_top( rotation_skip)
-  board = blank_board
-  (@pieces.length-1).times do
-    piece = @pieces.shift
-    piece.masks[0].each do | mask, imask, cmask |
-      if ((rotation_skip += 1) % 2 == 0) then
-        piece.placed = mask
-        find( 1, 1, board | mask)
-      end
-    end
-    @pieces.push(piece)
-  end
-  piece = @pieces.shift
-  @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-#  start_location -- where to start looking for place for the next piece at
-#  placed -- number of pieces placed
-#  board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
-  # find the next location to place a piece by looking for an empty bit
-  while board[start_location] == 1
-    start_location += 1
-  end
-
-  @pieces.length.times do
-    piece = @pieces.shift
-    piece.masks[start_location].each do | mask, imask, cmask |
-      if ( board & cmask == imask) then
-        piece.placed = mask
-        if (placed == 9) then
-          add_board
-        else
-          find( start_location + 1, placed + 1, board | mask)
-        end
-      end
-    end
-    @pieces.push(piece)
-  end
-end
-
-# print the board
-def print_full_board( board_string)
-  10.times do | row |
-    print " " if (row % 2 == 1)
-    5.times do | col |
-      print "#{board_string[row*5 + col,1]} "
-    end
-    print "\n"
-  end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
-  board_string = "99999999999999999999999999999999999999999999999999"
-  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
-  save( board_string)
-  save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
-  if (@all_boards[board_string] == nil) then
-    @min_board = board_string if (board_string < @min_board)
-    @max_board = board_string if (board_string > @max_board)
-    @all_boards.store(board_string,true)
-    @boards_found += 1
-
-    # the exit motif is a time saver.  Ideally the function should return, but those tests
-    # take noticeable time (performance).
-    if (@boards_found == @stop_count) then
-      print_results
-      exit(0)
-    end
-  end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
-  Piece.new( [ :nw, :ne, :east, :east ], 2),
-  Piece.new( [ :ne, :se, :east, :ne ], 7),
-  Piece.new( [ :ne, :east, :ne, :nw ], 1),
-  Piece.new( [ :east, :sw, :sw, :se ], 6),
-  Piece.new( [ :east, :ne, :se, :ne ], 5),
-  Piece.new( [ :east, :east, :east, :se ], 0),
-  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
-  Piece.new( [ :se, :se, :se, :west ], 9),
-  Piece.new( [ :se, :se, :east, :se ], 8),
-  Piece.new( [ :east, :east, :sw, :se ], 3)
-  ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
diff --git a/benchmark/so_nbody.rb b/benchmark/so_nbody.rb
deleted file mode 100644
index 9884fc4edc..0000000000
--- a/benchmark/so_nbody.rb
+++ /dev/null
@@ -1,148 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
-  attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
-  def initialize(x, y, z, vx, vy, vz, mass)
-    @x, @y, @z = x, y, z
-    @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
-    @mass = mass * SOLAR_MASS
-  end
-
-  def move_from_i(bodies, nbodies, dt, i)
-    while i < nbodies
-      b2 = bodies[i]
-      dx = @x - b2.x
-      dy = @y - b2.y
-      dz = @z - b2.z
-
-      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-      mag = dt / (distance * distance * distance)
-      b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
-      @vx -= dx * b2_mass_mag
-      @vy -= dy * b2_mass_mag
-      @vz -= dz * b2_mass_mag
-      b2.vx += dx * b_mass_mag
-      b2.vy += dy * b_mass_mag
-      b2.vz += dz * b_mass_mag
-      i += 1
-    end
-
-    @x += dt * @vx
-    @y += dt * @vy
-    @z += dt * @vz
-  end
-end
-
-def energy(bodies)
-  e = 0.0
-  nbodies = bodies.size
-
-  for i in 0 ... nbodies
-    b = bodies[i]
-    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
-    for j in (i + 1) ... nbodies
-      b2 = bodies[j]
-      dx = b.x - b2.x
-      dy = b.y - b2.y
-      dz = b.z - b2.z
-      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-      e -= (b.mass * b2.mass) / distance
-    end
-  end
-  e
-end
-
-def offset_momentum(bodies)
-  px, py, pz = 0.0, 0.0, 0.0
-
-  for b in bodies
-    m = b.mass
-    px += b.vx * m
-    py += b.vy * m
-    pz += b.vz * m
-  end
-
-  b = bodies[0]
-  b.vx = - px / SOLAR_MASS
-  b.vy = - py / SOLAR_MASS
-  b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
-  # sun
-  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
-  # jupiter
-  Planet.new(
-    4.84143144246472090e+00,
-    -1.16032004402742839e+00,
-    -1.03622044471123109e-01,
-    1.66007664274403694e-03,
-    7.69901118419740425e-03,
-    -6.90460016972063023e-05,
-    9.54791938424326609e-04),
-
-  # saturn
-  Planet.new(
-    8.34336671824457987e+00,
-    4.12479856412430479e+00,
-    -4.03523417114321381e-01,
-    -2.76742510726862411e-03,
-    4.99852801234917238e-03,
-    2.30417297573763929e-05,
-    2.85885980666130812e-04),
-
-  # uranus
-  Planet.new(
-    1.28943695621391310e+01,
-    -1.51111514016986312e+01,
-    -2.23307578892655734e-01,
-    2.96460137564761618e-03,
-    2.37847173959480950e-03,
-    -2.96589568540237556e-05,
-    4.36624404335156298e-05),
-
-  # neptune
-  Planet.new(
-    1.53796971148509165e+01,
-    -2.59193146099879641e+01,
-    1.79258772950371181e-01,
-    2.68067772490389322e-03,
-    1.62824170038242295e-03,
-    -9.51592254519715870e-05,
-    5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
-  i = 0
-  while i < nbodies
-    b = BODIES[i]
-    b.move_from_i(BODIES, nbodies, dt, i + 1)
-    i += 1
-  end
-end
-
-puts "%.9f" % energy(BODIES)
diff --git a/benchmark/so_nested_loop.rb b/benchmark/so_nested_loop.rb
deleted file mode 100644
index 766fcf7b84..0000000000
--- a/benchmark/so_nested_loop.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# from Avi Bryant
-
-n = 16 # Integer(ARGV.shift || 1)
-x = 0
-n.times do
-    n.times do
-        n.times do
-            n.times do
-                n.times do
-                    n.times do
-                        x += 1
-                    end
-                end
-            end
-        end
-    end
-end
-# puts x
-
-
diff --git a/benchmark/so_object.rb b/benchmark/so_object.rb
deleted file mode 100644