0 files changed, 0 insertions, 0 deletions
diff --git a/.appveyor.yml b/.appveyor.yml
new file mode 100644
index 0000000000..05ff204541
--- /dev/null
+++ b/.appveyor.yml
@@ -0,0 +1,134 @@
+---
+version: '{build}'
+init:
+  - git config --global user.name git
+  - git config --global user.email svn-admin@ruby-lang.org
+  - git config --global core.autocrlf false
+  - git config --global core.eol lf
+  - git config --global advice.detachedHead 0
+shallow_clone: true
+clone_depth: 10
+platform:
+  - x64
+skip_commits:
+  message: /\[DOC\]/
+  files:
+    - doc/*
+    - '**/*.md'
+    - '**/*.rdoc'
+    - '**/.document'
+    - '**/*.[1-8]'
+    - '**/*.ronn'
+environment:
+  ruby_version: "24-%Platform%"
+  matrix:
+    # Test only the oldest supported version because AppVeyor is unstable, its concurrency
+    # is limited, and compatibility issues that happen only in newer versions are rare.
+    # You may test some other stuff on GitHub Actions instead.
+    - build: vs
+      vs: 120 # Visual Studio 2013
+      ssl: OpenSSL-v111
+      # The worker image name. This is NOT the Visual Studio version we're using here.
+      APPVEYOR_BUILD_WORKER_IMAGE: Visual Studio 2015
+      GEMS_FOR_TEST: ""
+  RELINE_TEST_ENCODING: "UTF-8"
+cache:
+  - c:\Tools\vcpkg\installed\
+for:
+-
+  matrix:
+    only:
+      - build: vs
+  install:
+    - ver
+    - chcp
+    - SET BITS=%Platform:x86=32%
+    - SET BITS=%BITS:x=%
+    - SET OPENSSL_DIR=C:\%ssl%-Win%BITS%
+    - cd C:\Tools\vcpkg
+    - git pull -q
+    - .\bootstrap-vcpkg.bat
+    - ps: Start-FileDownload 'https://github.com/microsoft/vcpkg-tool/releases/download/2023-08-09/vcpkg.exe' -FileName 'C:\Tools\vcpkg\vcpkg.exe'
+    - cd %APPVEYOR_BUILD_FOLDER%
+    - vcpkg --triplet %Platform%-windows install --x-use-aria2 libffi libyaml readline zlib
+    - CALL SET vcvars=%%^VS%VS%COMNTOOLS^%%..\..\VC\vcvarsall.bat
+    - SET vcvars
+    - '"%vcvars%" %Platform:x64=amd64%'
+    - SET ruby_path=C:\Ruby%ruby_version:-x86=%
+    - SET PATH=\usr\local\bin;%ruby_path%\bin;%PATH%;C:\msys64\mingw64\bin;C:\msys64\usr\bin
+    - ruby --version
+    - 'cl'
+    - echo> Makefile srcdir=.
+    - echo>> Makefile MSC_VER=0
+    - echo>> Makefile RT=none
+    - echo>> Makefile RT_VER=0
+    - echo>> Makefile BUILTIN_ENCOBJS=nul
+    - type win32\Makefile.sub >> Makefile
+    - nmake %mflags% up VCSUP="echo Update OK"
+    - nmake %mflags% extract-extlibs
+    - del Makefile
+    - mkdir \usr\local\bin
+    - mkdir \usr\local\include
+    - mkdir \usr\local\lib
+    - for %%I in (%OPENSSL_DIR%\*.dll) do mklink /h \usr\local\bin\%%~nxI %%I
+    - for %%I in (c:\Tools\vcpkg\installed\%Platform%-windows\bin\*.dll) do (
+        if not %%~nI == readline mklink \usr\local\bin\%%~nxI %%I
+      )
+    - attrib +r /s /d
+    - mkdir %Platform%-mswin_%vs%
+  build_script:
+    - set HAVE_GIT=no
+    - cd %APPVEYOR_BUILD_FOLDER%
+    - cd %Platform%-mswin_%vs%
+    - >-
+      ..\win32\configure.bat
+      --with-opt-dir="/usr/local;c:/Tools/vcpkg/installed/%Platform%-windows"
+      --with-openssl-dir=%OPENSSL_DIR:\=/%
+    - nmake -l
+    - nmake install-nodoc
+    - \usr\bin\ruby -v -e "p :locale => Encoding.find('locale'), :filesystem => Encoding.find('filesystem')"
+    - if not "%GEMS_FOR_TEST%" == "" \usr\bin\gem install --no-document %GEMS_FOR_TEST%
+    - \usr\bin\ruby -ropenssl -e "puts 'Build    ' + OpenSSL::OPENSSL_VERSION, 'Runtime  ' + OpenSSL::OPENSSL_LIBRARY_VERSION"
+  test_script:
+    - set /a JOBS=%NUMBER_OF_PROCESSORS%
+    - nmake -l "TESTOPTS=-v -q" btest
+    - nmake -l "TESTOPTS=-v -q" test-basic
+    - >-
+      nmake -l "TESTOPTS=--timeout-scale=3.0
+      --excludes=../test/excludes/_appveyor -j%JOBS%
+      --exclude win32ole
+      --exclude test_bignum
+      --exclude test_syntax
+      --exclude test_open-uri
+      --exclude test_bundled_ca
+      " test-all
+    # separately execute tests without -j which may crash worker with -j.
+    - >-
+      nmake -l
+      "TESTOPTS=--timeout-scale=3.0 --excludes=../test/excludes/_appveyor"
+      TESTS="
+      ../test/win32ole
+      ../test/ruby/test_bignum.rb
+      ../test/ruby/test_syntax.rb
+      ../test/open-uri/test_open-uri.rb
+      ../test/rubygems/test_bundled_ca.rb
+      " test-all
+    - nmake -l test-spec MSPECOPT=-fs # not using `-j` because sometimes `mspec -j` silently dies on Windows
+notifications:
+  - provider: Webhook
+    method: POST
+    url:
+      secure: CcFlJNDJ/a6to7u3Z4Fnz6dScEPNx7hTha2GkSRlV+1U6dqmxY/7uBcLXYb9gR3jfQk6w+2o/HrjNAyXMNGU/JOka3s2WRI4VKitzM+lQ08owvJIh0R7LxrGH0J2e81U # ruby-lang slack: ruby/simpler-alerts-bot
+    body: >-
+      {{^isPullRequest}}
+        {
+          "ci": "AppVeyor CI",
+          "env": "Visual Studio 2013",
+          "url": "{{buildUrl}}",
+          "commit": "{{commitId}}",
+          "branch": "{{branch}}"
+        }
+      {{/isPullRequest}}
+    on_build_success: false
+    on_build_failure: true
+    on_build_status_changed: false
diff --git a/.dir-locals.el b/.dir-locals.el
new file mode 100644
index 0000000000..8f4b96445c
--- /dev/null
+++ b/.dir-locals.el
@@ -0,0 +1,39 @@
+;; Copyright (c) 2018 Urabe, Shyouhei.  All rights reserved.
+;;
+;; This file is a part of  the programming language Ruby.  Permission is hereby
+;; granted, to either  redistribute and/or modify this file,  provided that the
+;; conditions mentioned  in the  file COPYING  are met.   Consult the  file for
+;; details.
+
+((nil .
+     ((indent-tabs-mode . nil)
+      (require-final-newline . t)
+      (tab-width . 8)
+      (show-trailing-whitespace . t)
+      (whitespace-line-column . 80))) ;; See also [Misc #12277]
+
+ ;; (bat-mode . ((buffer-file-coding-system . utf-8-dos)))
+
+ (ruby-mode . ((ruby-indent-level . 2)))
+
+ (rdoc-mode . ((fill-column . 74)))
+
+ (yaml-mode . ((yaml-indent-offset . 2)))
+
+ (makefile-mode . ((indent-tabs-mode . t)))
+
+ (c-mode . ((c-file-style . "ruby")))
+
+ (c++-mode . ((c-file-style . "ruby")))
+
+ (change-log-mode .
+     ((buffer-file-coding-system . us-ascii)
+      (indent-tabs-mode . t)
+      (change-log-indent-text . 2)
+      (add-log-time-format . (lambda (&optional x y)
+        (let* ((time (or x (current-time)))
+	       (system-time-locale "C")
+	       (diff (+ (cadr time) 32400))
+	       (lo (% diff 65536))
+	       (hi (+ (car time) (/ diff 65536))))
+        (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))))))
diff --git a/.document b/.document
index fb27ba325d..3a6b0c238c 100644
--- a/.document
+++ b/.document
@@ -5,9 +5,31 @@
 
 # Process all the C source files
 *.c
+*.y
 
 # prelude
 prelude.rb
+rbconfig.rb
+
+array.rb
+ast.rb
+dir.rb
+gc.rb
+io.rb
+kernel.rb
+marshal.rb
+mjit.rb
+numeric.rb
+nilclass.rb
+pack.rb
+ractor.rb
+string.rb
+symbol.rb
+timev.rb
+thread_sync.rb
+trace_point.rb
+warning.rb
+yjit.rb
 
 # the lib/ directory (which has its own .document file)
 lib
@@ -16,11 +38,17 @@ lib
 ext
 
 # rdoc files
-ChangeLog
-
-NEWS
+NEWS.md
 
 README.md
 README.ja.md
 
+COPYING
+COPYING.ja
+
+LEGAL
+
+# win32/README.win32 linked from README.md
+win32
+
 doc
diff --git a/.editorconfig b/.editorconfig
index 67abf4b978..4633a7acae 100644
--- a/.editorconfig
+++ b/.editorconfig
@@ -2,15 +2,29 @@ root = true
 
 [*]
 end_of_line = lf
+indent_size = 4
+indent_style = space
 insert_final_newline = true
-trim_trailing_whitespace = true
 tab_width = 8
-indent_style = tab
-indent_size = 4
+trim_trailing_whitespace = true
 
-[**.bat]
+[*.bat]
 end_of_line = crlf
 
-[**.rb]
-indent_style = space
+[*.gemspec]
+indent_size = 2
+
+[*.rb]
+indent_size = 2
+
+[*.yml]
+indent_size = 2
+
+[{*[Mm]akefile*,*.mak,*.mk,depend}]
+indent_style = tab
+
+[enc/*]
+indent_size = 2
+
+[reg*.[ch]]
 indent_size = 2
diff --git a/.gdbinit b/.gdbinit
index 5864bb15ce..34d044caf6 100644
--- a/.gdbinit
+++ b/.gdbinit
@@ -1,3 +1,5 @@
+set startup-with-shell off
+
 define hook-run
   set $color_type = 0
   set $color_highlite = 0
@@ -63,7 +65,15 @@ define rp
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
     printf "%sT_OBJECT%s: ", $color_type, $color_end
-    print (struct RObject *)($arg0)
+    print ((struct RObject *)($arg0))->basic
+    if ($flags & ROBJECT_EMBED)
+      print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (ROBJECT_EMBED_LEN_MAX+0)
+    else
+      print (((struct RObject *)($arg0))->as.heap)
+      if (((struct RObject*)($arg0))->as.heap.numiv) > 0
+        print/x *(((struct RObject*)($arg0))->as.heap.ivptr) @ (((struct RObject*)($arg0))->as.heap.numiv)
+      end
+    end
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
     printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
@@ -89,14 +99,15 @@ define rp
     set $regsrc = ((struct RRegexp*)($arg0))->src
     set $rsflags = ((struct RBasic*)$regsrc)->flags
     printf "%sT_REGEXP%s: ", $color_type, $color_end
+    set $len = ($rsflags & RUBY_FL_USER1) ? \
+            ((struct RString*)$regsrc)->as.heap.len : \
+            (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
     set print address off
-    output (char *)(($rsflags & RUBY_FL_USER1) ? \
+    output *(char *)(($rsflags & RUBY_FL_USER1) ? \
 	    ((struct RString*)$regsrc)->as.heap.ptr : \
-	    ((struct RString*)$regsrc)->as.ary)
+	    ((struct RString*)$regsrc)->as.ary) @ $len
     set print address on
-    printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
-            ((struct RString*)$regsrc)->as.heap.len : \
-            (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+    printf " len:%ld ", $len
     if $flags & RUBY_FL_USER6
       printf "(none) "
     end
@@ -117,7 +128,7 @@ define rp
       if ($len == 0)
 	printf "{(empty)} "
       else
-	output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+	print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
 	printf " "
       end
     else
@@ -125,7 +136,7 @@ define rp
       printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
       if ($flags & RUBY_FL_USER2)
 	printf "(shared) shared="
-	output/x ((struct RArray*)($arg0))->as.heap.aux.shared
+	output/x ((struct RArray*)($arg0))->as.heap.aux.shared_root
 	printf " "
       else
 	printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
@@ -133,7 +144,7 @@ define rp
       if ($len == 0)
 	printf "{(empty)} "
       else
-	output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+	print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
 	printf " "
       end
     end
@@ -145,34 +156,27 @@ define rp
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_HASH
     printf "%sT_HASH%s: ", $color_type, $color_end,
-    if ((struct RHash *)($arg0))->ntbl
-      printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
+    if (((struct RHash *)($arg0))->basic.flags & RHASH_ST_TABLE_FLAG)
+      printf "st len=%ld ", ((struct RHash *)($arg0))->as.st->num_entries
+    else
+      printf "li len=%ld bound=%ld ", \
+        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_SIZE_MASK) >> RHASH_AR_TABLE_SIZE_SHIFT), \
+        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_BOUND_MASK) >> RHASH_AR_TABLE_BOUND_SHIFT)
     end
     print (struct RHash *)($arg0)
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
-    printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, \
-      (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+    set $len = (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
        ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
        ((struct RStruct *)($arg0))->as.heap.len)
+    printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, $len
     print (struct RStruct *)($arg0)
-    x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
-          ((struct RStruct *)($arg0))->as.ary : \
-          ((struct RStruct *)($arg0))->as.heap.ptr)
+    output/x *(($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+              ((struct RStruct *)($arg0))->as.ary : \
+              ((struct RStruct *)($arg0))->as.heap.ptr) @ $len
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
-    printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
-      (($flags & RUBY_FL_USER1) != 0), \
-      (($flags & RUBY_FL_USER2) ? \
-       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
-       ((struct RBignum*)($arg0))->as.heap.len)
-    if $flags & RUBY_FL_USER2
-      printf "(embed) "
-    end
-    print (struct RBignum *)($arg0)
-    x/xw (($flags & RUBY_FL_USER2) ? \
-          ((struct RBignum*)($arg0))->as.ary : \
-          ((struct RBignum*)($arg0))->as.heap.digits)
+    rp_bignum $arg0
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
     printf "%sT_RATIONAL%s: ", $color_type, $color_end
@@ -247,7 +251,7 @@ define rp
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
     printf "%sT_IMEMO%s(", $color_type, $color_end
-    output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&imemo_mask)
+    output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&RUBY_IMEMO_MASK)
     printf "): "
     rp_imemo $arg0
   else
@@ -261,6 +265,10 @@ define rp
     printf "%sT_ZOMBIE%s: ", $color_type, $color_end
     print (struct RData *)($arg0)
   else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MOVED
+    printf "%sT_MOVED%s: ", $color_type, $color_end
+    print *(struct RMoved *)$arg0
+  else
     printf "%sunknown%s: ", $color_type, $color_end
     print (struct RBasic *)($arg0)
   end
@@ -296,6 +304,7 @@ define rp
   end
   end
   end
+  end
 end
 document rp
   Print a Ruby's VALUE.
@@ -327,6 +336,9 @@ define rp_id
   if $id == idLTLT
     printf "(:<<)\n"
   else
+  if $id == idGTGT
+    printf "(:>>)\n"
+  else
   if $id == idLE
     printf "(:<=)\n"
   else
@@ -354,6 +366,18 @@ define rp_id
   if $id == idASET
     printf "(:[]=)\n"
   else
+  if $id == idCOLON2
+    printf "(:'::')\n"
+  else
+  if $id == idANDOP
+    printf "(:&&)\n"
+  else
+  if $id == idOROP
+    printf "(:||)\n"
+  else
+  if $id == idANDDOT
+    printf "(:&.)\n"
+  else
     if $id <= tLAST_OP_ID
       printf "O"
     else
@@ -385,12 +409,13 @@ define rp_id
       end
     end
     printf "(%ld): ", $id
-    set $str = lookup_id_str($id)
-    if $str
-      rp_string $str
-    else
-      echo undef\n
-    end
+    print_id $id
+    echo \n
+  end
+  end
+  end
+  end
+  end
   end
   end
   end
@@ -413,16 +438,35 @@ document rp_id
   Print an ID.
 end
 
-define rp_string
+define output_string
   set $flags = ((struct RBasic*)($arg0))->flags
-  set print address off
-  output (char *)(($flags & RUBY_FL_USER1) ? \
+  set $len = ($flags & RUBY_FL_USER1) ? \
+          ((struct RString*)($arg0))->as.heap.len : \
+          (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+  if $len > 0
+    output *(char *)(($flags & RUBY_FL_USER1) ? \
 	    ((struct RString*)($arg0))->as.heap.ptr : \
-	    ((struct RString*)($arg0))->as.ary)
-  set print address on
-  printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
+	    ((struct RString*)($arg0))->as.ary) @ $len
+  else
+    output ""
+  end
+end
+
+define print_string
+  set $flags = ((struct RBasic*)($arg0))->flags
+  set $len = ($flags & RUBY_FL_USER1) ? \
           ((struct RString*)($arg0))->as.heap.len : \
           (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+  if $len > 0
+    printf "%s", *(char *)(($flags & RUBY_FL_USER1) ? \
+	    ((struct RString*)($arg0))->as.heap.ptr : \
+	    ((struct RString*)($arg0))->as.ary) @ $len
+  end
+end
+
+define rp_string
+  output_string $arg0
+  printf " bytesize:%ld ", $len
   if !($flags & RUBY_FL_USER1)
     printf "(embed) "
   else
@@ -453,22 +497,67 @@ document rp_string
   Print the content of a String.
 end
 
+define rp_bignum
+  set $flags = ((struct RBignum*)($arg0))->basic.flags
+  set $len = (($flags & RUBY_FL_USER2) ? \
+       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+       ((struct RBignum*)($arg0))->as.heap.len)
+  printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
+         (($flags & RUBY_FL_USER1) != 0), $len
+  if $flags & RUBY_FL_USER2
+    printf "(embed) "
+  end
+  print (struct RBignum *)($arg0)
+  set $ptr = (($flags & RUBY_FL_USER2) ? \
+              ((struct RBignum*)($arg0))->as.ary : \
+              ((struct RBignum*)($arg0))->as.heap.digits)
+  set $len = $len-1
+  printf "0x%x", $ptr[$len]
+  while $len > 0
+    set $len = $len-1
+    set $val = $ptr[$len]
+    set $w = sizeof($ptr[0])
+    printf "_"
+    if $w > 8
+      printf "%.32x", $val
+    else
+    if $w > 4
+      printf "%.16x", $val
+    else
+    if $w > 2
+      printf "%.8x", $val
+    else
+    if $w > 1
+      printf "%.4x", $val
+    else
+      printf "%.2x", $val
+    end
+    end
+    end
+    end
+  end
+  printf "\n"
+end
+document rp_bignum
+  Print the content of a Bignum.
+end
+
 define rp_class
   printf "(struct RClass *) %p", (void*)$arg0
-  if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
-    printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
+  if RCLASS_ORIGIN((struct RClass *)($arg0)) != $arg0
+    printf " -> %p", RCLASS_ORIGIN((struct RClass *)($arg0))
   end
   printf "\n"
   rb_classname $arg0
-  print *(struct RClass *)($arg0)
-  print *((struct RClass *)($arg0))->ptr
+  print/x *(struct RClass *)($arg0)
+  print *RCLASS_EXT((struct RClass *)($arg0))
 end
 document rp_class
   Print the content of a Class/Module.
 end
 
 define rp_imemo
-  set $flags = (((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & imemo_mask
+  set $flags = (enum imemo_type)((((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & RUBY_IMEMO_MASK)
   if $flags == imemo_cref
     printf "(rb_cref_t *) %p\n", (void*)$arg0
     print *(rb_cref_t *)$arg0
@@ -489,6 +578,14 @@ define rp_imemo
     printf "(struct MEMO *) %p\n", (void*)$arg0
     print *(struct MEMO *)$arg0
   else
+  if $flags == imemo_ment
+    printf "(rb_method_entry_t *) %p\n", (void*)$arg0
+    print *(rb_method_entry_t *)$arg0
+  else
+  if $flags == imemo_iseq
+    printf "(rb_iseq_t *) %p\n", (void*)$arg0
+    print *(rb_iseq_t *)$arg0
+  else
     printf "(struct RIMemo *) %p\n", (void*)$arg0
     print *(struct RIMemo *)$arg0
   end
@@ -496,6 +593,8 @@ define rp_imemo
   end
   end
   end
+  end
+  end
 end
 document rp_imemo
   Print the content of a memo
@@ -610,12 +709,6 @@ define nd_cval
   rp ($arg0).u3.value
 end
 
-
-define nd_cnt
-  printf "%su3.cnt%s: ", $color_highlite, $color_end
-  p ($arg0).u3.cnt
-end
-
 define nd_tbl
   printf "%su1.tbl%s: ", $color_highlite, $color_end
   p ($arg0).u1.tbl
@@ -654,12 +747,6 @@ define nd_lit
   rp ($arg0).u1.value
 end
 
-
-define nd_frml
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
 define nd_rest
   printf "%su2.argc%s: ", $color_highlite, $color_end
   p ($arg0).u2.argc
@@ -686,12 +773,6 @@ define nd_args
   rp ($arg0).u3.node
 end
 
-
-define nd_noex
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
 define nd_defn
   printf "%su3.node%s: ", $color_highlite, $color_end
   rp ($arg0).u3.node
@@ -709,17 +790,6 @@ define nd_new
 end
 
 
-define nd_cfnc
-  printf "%su1.cfunc%s: ", $color_highlite, $color_end
-  p ($arg0).u1.cfunc
-end
-
-define nd_argc
-  printf "%su2.argc%s: ", $color_highlite, $color_end
-  p ($arg0).u2.argc
-end
-
-
 define nd_cname
   printf "%su1.id%s: ", $color_highlite, $color_end
   p ($arg0).u1.id
@@ -781,7 +851,7 @@ end
 
 define nd_tree
   set $buf = (struct RString *)rb_str_buf_new(0)
-  call dump_node((VALUE)($buf), rb_str_new(0, 0), 0, ($arg0))
+  call dump_node((VALUE)($buf), rb_str_tmp_new(0), 0, ($arg0))
   printf "%s\n", $buf->as.heap.ptr
 end
 
@@ -852,8 +922,7 @@ end
 
 define rb_classname
   # up to 128bit int
-  set $rb_classname_permanent = "0123456789ABCDEF"
-  set $rb_classname = classname($arg0, $rb_classname_permanent)
+  set $rb_classname = rb_mod_name($arg0)
   if $rb_classname != RUBY_Qnil
     rp $rb_classname
   else
@@ -902,7 +971,7 @@ define iseq
 end
 
 define rb_ps
-  rb_ps_vm ruby_current_vm
+  rb_ps_vm ruby_current_vm_ptr
 end
 document rb_ps
 Dump all threads and their callstacks
@@ -910,36 +979,307 @@ end
 
 define rb_ps_vm
   print $ps_vm = (rb_vm_t*)$arg0
-  set $ps_threads = (st_table*)$ps_vm->living_threads
-  if $ps_threads->entries_packed
-    set $ps_threads_i = 0
-    while $ps_threads_i < $ps_threads->num_entries
-      set $ps_threads_key = (st_data_t)$ps_threads->as.packed.entries[$ps_threads_i].key
-      set $ps_threads_val = (st_data_t)$ps_threads->as.packed.entries[$ps_threads_i].val
-      rb_ps_thread $ps_threads_key $ps_threads_val
-      set $ps_threads_i = $ps_threads_i + 1
-    end
-  else
-    set $ps_threads_ptr = (st_table_entry*)$ps_threads->head
-    while $ps_threads_ptr
-      set $ps_threads_key = (st_data_t)$ps_threads_ptr->key
-      set $ps_threads_val = (st_data_t)$ps_threads_ptr->record
-      rb_ps_thread $ps_threads_key $ps_threads_val
-      set $ps_threads_ptr = (st_table_entry*)$ps_threads_ptr->fore
+  set $ps_thread_ln      = $ps_vm->ractor.main_ractor.threads.set.n.next
+  set $ps_thread_ln_last = $ps_vm->ractor.main_ractor.threads.set.n.prev
+  while 1
+    set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
+    set $ps_thread = (VALUE)($ps_thread_th->self)
+    rb_ps_thread $ps_thread
+    if $ps_thread_ln == $ps_thread_ln_last
+      loop_break
     end
+    set $ps_thread_ln = $ps_thread_ln->next
   end
 end
 document rb_ps_vm
 Dump all threads in a (rb_vm_t*) and their callstacks
 end
 
-define rb_ps_thread
-  set $ps_thread = (struct RTypedData*)$arg0
-  set $ps_thread_id = $arg1
-  print $ps_thread_th = (rb_thread_t*)$ps_thread->data
+define print_lineno
+  set $cfp = $arg0
+  set $iseq = $cfp->iseq
+  set $pos = $cfp->pc - $iseq->body->iseq_encoded
+  if $pos != 0
+    set $pos = $pos - 1
+  end
+
+  set $index = 0
+  set $size = $iseq->body->insns_info.size
+  set $table = $iseq->body->insns_info.body
+  set $positions = $iseq->body->insns_info.positions
+  #printf "size: %d\n", $size
+  if $size == 0
+  else
+  if $size == 1
+    printf "%d", $table[0].line_no
+  else
+    if $positions
+      # get_insn_info_linear_search
+      set $index = 1
+      while $index < $size
+        #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $positions[$i], $table[$i].line_no, $pos
+        if $positions[$index] > $pos
+          loop_break
+        end
+        set $index = $index + 1
+        if $positions[$index] == $pos
+          loop_break
+        end
+      end
+    else
+      # get_insn_info_succinct_bitvector
+      set $sd = $iseq->body->insns_info.succ_index_table
+      set $immediate_table_size = sizeof($sd->imm_part) / sizeof(uint64_t) * 9
+      if $pos < $immediate_table_size
+        set $i = $pos / 9
+        set $j = $pos % 9
+        set $index = ((int)($sd->imm_part[$i] >> ($j * 7))) & 0x7f
+      else
+        set $block_index = ($pos - $immediate_table_size) / 512
+        set $block = &$sd->succ_part[$block_index]
+        set $block_bit_index = ($pos - $immediate_table_size) % 512
+        set $small_block_index = $block_bit_index / 64
+        set $small_block_popcount = $small_block_index == 0 ? 0 : (((int)($block->small_block_ranks >> (($small_block_index - 1) * 9))) & 0x1ff)
+        set $x = $block->bits[$small_block_index] << (63 - $block_bit_index % 64)
+        set $x = ($x & 0x5555555555555555) + ($x >> 1 & 0x5555555555555555)
+        set $x = ($x & 0x3333333333333333) + ($x >> 2 & 0x3333333333333333)
+        set $x = ($x & 0x0707070707070707) + ($x >> 4 & 0x0707070707070707)
+        set $x = ($x & 0x001f001f001f001f) + ($x >> 8 & 0x001f001f001f001f)
+        set $x = ($x & 0x0000003f0000003f) + ($x >>16 & 0x0000003f0000003f)
+        set $popcnt = ($x & 0x7f) + ($x >>32 & 0x7f)
+        set $index = $block->rank + $small_block_popcount + $popcnt
+      end
+    end
+    printf "%d", $table[$index-1].line_no
+  end
+  end
+end
+
+define check_method_entry
+  set $imemo = (struct RBasic *)$arg0
+  if $imemo != RUBY_Qfalse
+    set $type = ($imemo->flags >> 12) & 0x07
+    if $type == imemo_ment
+      set $me = (rb_callable_method_entry_t *)$imemo
+    else
+    if $type == imemo_svar
+      set $imemo = ((struct vm_svar *)$imemo)->cref_or_me
+      check_method_entry $imemo
+    end
+    end
+  end
 end
 
-# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
+define print_id
+  set $id = $arg0
+  # rb_id_to_serial
+  if $id > tLAST_OP_ID
+    set $serial = (rb_id_serial_t)($id >> RUBY_ID_SCOPE_SHIFT)
+  else
+    set $serial = (rb_id_serial_t)$id
+  end
+  if $serial && $serial <= ruby_global_symbols.last_id
+    set $idx = $serial / ID_ENTRY_UNIT
+    set $ids = (struct RArray *)ruby_global_symbols.ids
+    set $flags = $ids->basic.flags
+    if ($flags & RUBY_FL_USER1)
+      set $idsptr = $ids->as.ary
+      set $idslen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+    else
+      set $idsptr = $ids->as.heap.ptr
+      set $idslen = $ids->as.heap.len
+    end
+    if $idx < $idslen
+      set $t = 0
+      set $ary = (struct RArray *)$idsptr[$idx]
+      if $ary != RUBY_Qnil
+        set $flags = $ary->basic.flags
+        if ($flags & RUBY_FL_USER1)
+          set $aryptr = $ary->as.ary
+          set $arylen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+        else
+          set $aryptr = $ary->as.heap.ptr
+          set $arylen = $ary->as.heap.len
+        end
+        set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
+        if $result != RUBY_Qnil
+          print_string $result
+        else
+          echo undef
+        end
+      end
+    end
+  end
+end
+
+define print_pathobj
+  set $flags = ((struct RBasic*)($arg0))->flags
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+    print_string $arg0
+  end
+  if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+    if $flags & RUBY_FL_USER1
+      set $str = ((struct RArray*)($arg0))->as.ary[0]
+    else
+      set $str = ((struct RArray*)($arg0))->as.heap.ptr[0]
+    end
+    print_string $str
+  end
+end
+
+define rb_ps_thread
+  set $ps_thread = (struct RTypedData*)$arg0
+  set $ps_thread_th = (rb_thread_t*)$ps_thread->data
+  printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
+    $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
+  set $cfp = $ps_thread_th->ec->cfp
+  set $cfpend = (rb_control_frame_t *)($ps_thread_th->ec->vm_stack + $ps_thread_th->ec->vm_stack_size)-1
+  while $cfp < $cfpend
+    if $cfp->iseq
+      if !((VALUE)$cfp->iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$cfp->iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
+        printf "%d:ifunc ", $cfpend-$cfp
+        set print symbol-filename on
+        output/a $cfp->iseq.body
+        set print symbol-filename off
+        printf "\n"
+      else
+      if $cfp->pc
+        set $location = $cfp->iseq->body->location
+        printf "%d:", $cfpend-$cfp
+        print_pathobj $location.pathobj
+        printf ":"
+        print_lineno $cfp
+        printf ":in `"
+        print_string $location.label
+        printf "'\n"
+      else
+        printf "%d: ???.rb:???:in `???'\n", $cfpend-$cfp
+      end
+      end
+    else
+      # if VM_FRAME_TYPE($cfp->flag) == VM_FRAME_MAGIC_CFUNC
+      set $ep = $cfp->ep
+      if ($ep[0] & 0xffff0001) == 0x55550001
+        #define VM_ENV_FLAG_LOCAL 0x02
+        #define VM_ENV_PREV_EP(ep)   GC_GUARDED_PTR_REF(ep[VM_ENV_DATA_INDEX_SPECVAL])
+        set $me = 0
+        set $env_specval = $ep[-1]
+        set $env_me_cref = $ep[-2]
+        while ($env_specval & 0x02) != 0
+          check_method_entry $env_me_cref
+          if $me != 0
+            loop_break
+          end
+          set $ep = $ep[0]
+          set $env_specval = $ep[-1]
+          set $env_me_cref = $ep[-2]
+        end
+        if $me == 0
+          check_method_entry $env_me_cref
+        end
+        printf "%d:", $cfpend-$cfp
+        set print symbol-filename on
+        output/a $me->def->body.cfunc.func
+        set print symbol-filename off
+        set $mid = $me->def->original_id
+        printf ":in `"
+        print_id $mid
+        printf "'\n"
+      else
+        printf "%d:unknown_frame:???:in `???'\n", $cfpend-$cfp
+      end
+    end
+    set $cfp = $cfp + 1
+  end
+end
+
+define rb_count_objects
+  set $objspace = ruby_current_vm_ptr->objspace
+  set $counts_00 = 0
+  set $counts_01 = 0
+  set $counts_02 = 0
+  set $counts_03 = 0
+  set $counts_04 = 0
+  set $counts_05 = 0
+  set $counts_06 = 0
+  set $counts_07 = 0
+  set $counts_08 = 0
+  set $counts_09 = 0
+  set $counts_0a = 0
+  set $counts_0b = 0
+  set $counts_0c = 0
+  set $counts_0d = 0
+  set $counts_0e = 0
+  set $counts_0f = 0
+  set $counts_10 = 0
+  set $counts_11 = 0
+  set $counts_12 = 0
+  set $counts_13 = 0
+  set $counts_14 = 0
+  set $counts_15 = 0
+  set $counts_16 = 0
+  set $counts_17 = 0
+  set $counts_18 = 0
+  set $counts_19 = 0
+  set $counts_1a = 0
+  set $counts_1b = 0
+  set $counts_1c = 0
+  set $counts_1d = 0
+  set $counts_1e = 0
+  set $counts_1f = 0
+  set $total = 0
+  set $i = 0
+  while $i < $objspace->heap_pages.allocated_pages
+    printf "\rcounting... %d/%d", $i, $objspace->heap_pages.allocated_pages
+    set $page = $objspace->heap_pages.sorted[$i]
+    set $p = $page->start
+    set $pend = $p + $page->total_slots
+    while $p < $pend
+      set $flags = $p->as.basic.flags & 0x1f
+      eval "set $counts_%02x = $counts_%02x + 1", $flags, $flags
+      set $p = $p + 1
+    end
+    set $total = $total + $page->total_slots
+    set $i = $i + 1
+  end
+  printf "\rTOTAL: %d, FREE: %d\n", $total, $counts_00
+  printf "T_OBJECT: %d\n", $counts_01
+  printf "T_CLASS: %d\n", $counts_02
+  printf "T_MODULE: %d\n", $counts_03
+  printf "T_FLOAT: %d\n", $counts_04
+  printf "T_STRING: %d\n", $counts_05
+  printf "T_REGEXP: %d\n", $counts_06
+  printf "T_ARRAY: %d\n", $counts_07
+  printf "T_HASH: %d\n", $counts_08
+  printf "T_STRUCT: %d\n", $counts_09
+  printf "T_BIGNUM: %d\n", $counts_0a
+  printf "T_FILE: %d\n", $counts_0b
+  printf "T_DATA: %d\n", $counts_0c
+  printf "T_MATCH: %d\n", $counts_0d
+  printf "T_COMPLEX: %d\n", $counts_0e
+  printf "T_RATIONAL: %d\n", $counts_0f
+  #printf "UNKNOWN_10: %d\n", $counts_10
+  printf "T_NIL: %d\n", $counts_11
+  printf "T_TRUE: %d\n", $counts_12
+  printf "T_FALSE: %d\n", $counts_13
+  printf "T_SYMBOL: %d\n", $counts_14
+  printf "T_FIXNUM: %d\n", $counts_15
+  printf "T_UNDEF: %d\n", $counts_16
+  #printf "UNKNOWN_17: %d\n", $counts_17
+  #printf "UNKNOWN_18: %d\n", $counts_18
+  #printf "UNKNOWN_19: %d\n", $counts_19
+  printf "T_IMEMO: %d\n", $counts_1a
+  printf "T_NODE: %d\n", $counts_1b
+  printf "T_ICLASS: %d\n", $counts_1c
+  printf "T_ZOMBIE: %d\n", $counts_1d
+  #printf "UNKNOWN_1E: %d\n", $counts_1e
+  printf "T_MASK: %d\n", $counts_1f
+end
+document rb_count_objects
+  Counts all objects grouped by type.
+end
+
+# Details: https://bugs.ruby-lang.org/projects/ruby-master/wiki/MachineInstructionsTraceWithGDB
 define trace_machine_instructions
   set logging on
   set height 0
@@ -955,3 +1295,56 @@ define SDR
   call rb_vmdebug_stack_dump_raw_current()
 end
 
+define rbi
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_LABEL
+    p *(LABEL*)$arg0
+  else
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_INSN
+    p *(INSN*)$arg0
+  else
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_ADJUST
+    p *(ADJUST*)$arg0
+  else
+    print *$arg0
+  end
+  end
+  end
+end
+
+define dump_node
+  set $str = rb_parser_dump_tree($arg0, 0)
+  set $flags = ((struct RBasic*)($str))->flags
+  printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
+                        ((struct RString*)$str)->as.heap.ptr : \
+                        ((struct RString*)$str)->as.ary)
+end
+
+define print_flags
+  printf "RUBY_FL_WB_PROTECTED: %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_WB_PROTECTED ? "1" : "0"
+  printf "RUBY_FL_PROMOTED0   : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED0 ? "1" : "0"
+  printf "RUBY_FL_PROMOTED1   : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED1 ? "1" : "0"
+  printf "RUBY_FL_FINALIZE    : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FINALIZE ? "1" : "0"
+  printf "RUBY_FL_SHAREABLE   : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_SHAREABLE ? "1" : "0"
+  printf "RUBY_FL_EXIVAR      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_EXIVAR ? "1" : "0"
+  printf "RUBY_FL_FREEZE      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FREEZE ? "1" : "0"
+
+  printf "RUBY_FL_USER0       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER0 ? "1" : "0"
+  printf "RUBY_FL_USER1       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER1 ? "1" : "0"
+  printf "RUBY_FL_USER2       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER2 ? "1" : "0"
+  printf "RUBY_FL_USER3       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER3 ? "1" : "0"
+  printf "RUBY_FL_USER4       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER4 ? "1" : "0"
+  printf "RUBY_FL_USER5       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER5 ? "1" : "0"
+  printf "RUBY_FL_USER6       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER6 ? "1" : "0"
+  printf "RUBY_FL_USER7       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER7 ? "1" : "0"
+  printf "RUBY_FL_USER8       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER8 ? "1" : "0"
+  printf "RUBY_FL_USER9       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER9 ? "1" : "0"
+  printf "RUBY_FL_USER10      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER10 ? "1" : "0"
+  printf "RUBY_FL_USER11      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER11 ? "1" : "0"
+  printf "RUBY_FL_USER12      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER12 ? "1" : "0"
+  printf "RUBY_FL_USER13      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER13 ? "1" : "0"
+  printf "RUBY_FL_USER14      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER14 ? "1" : "0"
+  printf "RUBY_FL_USER15      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER15 ? "1" : "0"
+  printf "RUBY_FL_USER16      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER16 ? "1" : "0"
+  printf "RUBY_FL_USER17      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER17 ? "1" : "0"
+  printf "RUBY_FL_USER18      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER18 ? "1" : "0"
+end
diff --git a/.git-blame-ignore-revs b/.git-blame-ignore-revs
new file mode 100644
index 0000000000..6c5eac5a0f
--- /dev/null
+++ b/.git-blame-ignore-revs
@@ -0,0 +1,23 @@
+# This is a file used by GitHub to ignore the following commits on `git blame`.
+#
+# You can also do the same thing in your local repository with:
+# $ git config --local blame.ignoreRevsFile .git-blame-ignore-revs
+
+# Expand tabs
+5b21e94bebed90180d8ff63dad03b8b948361089
+
+# Enable Style/StringLiterals cop for RubyGems/Bundler
+d7ffd3fea402239b16833cc434404a7af82d44f3
+
+# [ruby/digest] Revert tab-expansion in external files
+48b09aae7ec5632209229dcc294dd0d75a93a17f
+8a65cf3b61c60e4cb886f59a73ff6db44364bfa9
+39dc9f9093901d40d2998653948d5da38b18ee2c
+
+# [ruby/io-nonblock] Revert tab expansion
+f28287d34c03f472ffe90ea262bdde9affd4b965
+0d842fecb4f75ab3b1d4097ebdb8e88f51558041
+4ba2c66761d6a293abdfba409241d31063cefd62
+
+# Make benchmark indentation consistent
+fc4acf8cae82e5196186d3278d831f2438479d91
diff --git a/.gitattributes b/.gitattributes
new file mode 100644
index 0000000000..d0c2d266b4
--- /dev/null
+++ b/.gitattributes
@@ -0,0 +1,8 @@
+*.gemspec diff=ruby
+*.rb diff=ruby
+bin svn-properties=svn:ignore=ruby
+bin/* diff=ruby
+tool/update-deps diff=ruby
+tool/make-snapshot diff=ruby
+tool/format-release diff=ruby
+tool/leaked-globals diff=ruby
diff --git a/.github/SECURITY.md b/.github/SECURITY.md
new file mode 100644
index 0000000000..56baa29942
--- /dev/null
+++ b/.github/SECURITY.md
@@ -0,0 +1,9 @@
+# Security Policy
+
+## Supported Versions
+
+See <https://www.ruby-lang.org/en/downloads/branches/>.
+
+## Reporting a Vulnerability
+
+See <https://www.ruby-lang.org/en/security/>.
diff --git a/.github/codeql/codeql-config.yml b/.github/codeql/codeql-config.yml
new file mode 100644
index 0000000000..91f82b842b
--- /dev/null
+++ b/.github/codeql/codeql-config.yml
@@ -0,0 +1,3 @@
+name: "CodeQL config for the Ruby language"
+
+languages: cpp
diff --git a/.github/dependabot.yml b/.github/dependabot.yml
new file mode 100644
index 0000000000..bc63aca35b
--- /dev/null
+++ b/.github/dependabot.yml
@@ -0,0 +1,6 @@
+version: 2
+updates:
+  - package-ecosystem: 'github-actions'
+    directory: '/'
+    schedule:
+      interval: 'monthly'
diff --git a/.github/workflows/baseruby.yml b/.github/workflows/baseruby.yml
new file mode 100644
index 0000000000..ebaafe3bf0
--- /dev/null
+++ b/.github/workflows/baseruby.yml
@@ -0,0 +1,80 @@
+name: BASERUBY Check
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  merge_group:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  baseruby:
+    name: BASERUBY
+    runs-on: ubuntu-22.04
+    if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+    strategy:
+      matrix:
+        ruby:
+          - ruby-2.2
+#         - ruby-2.3
+#         - ruby-2.4
+#         - ruby-2.5
+#         - ruby-2.6
+#         - ruby-2.7
+          - ruby-3.0
+          - ruby-3.1
+
+    steps:
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+      - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+        with:
+          path: .downloaded-cache
+          key: downloaded-cache
+      - uses: ruby/setup-ruby@13e7a03dc3ac6c3798f4570bfead2aed4d96abfb # v1.244.0
+        with:
+          ruby-version: ${{ matrix.ruby }}
+          bundler: none
+      - run: echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+      - run: sudo apt-get install build-essential autoconf bison libyaml-dev
+      - run: ./autogen.sh
+      - run: ./configure --disable-install-doc
+      - run: make common-srcs
+      - run: make incs
+      - run: make all
+      - run: make test
+      - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+        with:
+          payload: |
+            {
+              "ci": "GitHub Actions",
+              "env": "${{ github.workflow }} / BASERUBY @ ${{ matrix.ruby }}",
+              "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+              "commit": "${{ github.sha }}",
+              "branch": "${{ github.ref_name }}"
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() && github.event_name == 'push' }}
diff --git a/.github/workflows/bundled_gems.yml b/.github/workflows/bundled_gems.yml
new file mode 100644
index 0000000000..070c0fa1dd
--- /dev/null
+++ b/.github/workflows/bundled_gems.yml
@@ -0,0 +1,166 @@
+name: bundled_gems
+
+on:
+  push:
+    branches: [ "master" ]
+    paths:
+      - '.github/workflows/bundled_gems.yml'
+      - 'gems/bundled_gems'
+  pull_request:
+    branches: [ "master" ]
+    paths:
+      - '.github/workflows/bundled_gems.yml'
+      - 'gems/bundled_gems'
+  merge_group:
+    branches: [ "master" ]
+    paths:
+      - '.github/workflows/bundled_gems.yml'
+      - 'gems/bundled_gems'
+  schedule:
+    - cron: '45 6 * * *'
+  workflow_dispatch:
+
+permissions:  # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  update:
+    permissions:
+      contents: write  # for Git to git push
+    if: ${{ github.event_name != 'schedule' || github.repository == 'ruby/ruby' }}
+    name: update ${{ github.workflow }}
+    runs-on: ubuntu-latest
+    steps:
+      - name: git config
+        run: |
+          git config --global advice.detachedHead 0
+          git config --global init.defaultBranch garbage
+
+      - name: Set ENV
+        run: |
+          echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+          echo "TODAY=$(date +%F)" >> $GITHUB_ENV
+
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+
+      - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+        with:
+          path: .downloaded-cache
+          key: downloaded-cache-${{ github.sha }}
+          restore-keys: |
+            downloaded-cache
+
+      - name: Download previous gems list
+        run: |
+          data=bundled_gems.json
+          mkdir -p .downloaded-cache
+          ln -s .downloaded-cache/$data .
+          curl -O -R -z ./$data https://stdgems.org/$data
+
+      - name: Update bundled gems list
+        run: |
+          ruby -i~ tool/update-bundled_gems.rb gems/bundled_gems
+
+      - name: Maintain updated gems list in NEWS
+        run: |
+          #!ruby
+          require 'json'
+          news = File.read("NEWS.md")
+          prev = news[/since the \*+(\d+\.\d+\.\d+)\*+/, 1]
+          prevs = [prev, prev.sub(/\.\d+\z/, '')]
+          %W[bundled].each do |type|
+            last = JSON.parse(File.read("#{type}_gems.json"))['gems'].filter_map do |g|
+              v = g['versions'].values_at(*prevs).compact.first
+              g = g['gem']
+              g = 'RubyGems' if g == 'rubygems'
+              [g, v] if v
+            end.to_h
+            changed = File.foreach("gems/#{type}_gems").filter_map do |l|
+              next if l.start_with?("#")
+              g, v = l.split(" ", 3)
+              [g, v] unless last[g] == v
+            end
+            changed, added = changed.partition {|g, _| last[g]}
+            news.sub!(/^\*( +)The following #{type} gems? are updated\.\n+\K(?: \1\*( +).*\n)*/) do
+              mark = "#{$1} *#{$2}"
+              changed.map {|g, v|"#{mark}#{g} #{v}\n"}.join("")
+            end or next
+            news.sub!(/^\*( +)The following default gems are now bundled gems\.\n+\K(?: \1\*( +).*\n)*/) do
+              mark = "#{$1} *#{$2}"
+              added.map {|g, v|"#{mark}#{g} #{v}\n"}.join("")
+            end or next unless added.empty?
+            File.write("NEWS.md", news)
+          end
+        shell: ruby {0}
+
+      - name: Check diffs
+        id: diff
+        run: |
+          git add -- NEWS.md
+          git diff --no-ext-diff --ignore-submodules --quiet -- gems/bundled_gems
+        continue-on-error: true
+
+      - name: Install libraries
+        run: |
+          set -x
+          sudo apt-get update -q || :
+          sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+        if: ${{ steps.diff.outcome == 'failure' }}
+
+      - name: Build
+        run: |
+          ./autogen.sh
+          ./configure -C --disable-install-doc
+          make
+        if: ${{ steps.diff.outcome == 'failure' }}
+
+      - name: Prepare bundled gems
+        run: |
+          make -s prepare-gems
+        if: ${{ steps.diff.outcome == 'failure' }}
+
+      - name: Test bundled gems
+        run: |
+          make -s test-bundled-gems
+          git add -- gems/bundled_gems
+        timeout-minutes: 30
+        env:
+          RUBY_TESTOPTS: "-q --tty=no"
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ""
+        if: ${{ steps.diff.outcome == 'failure' }}
+
+      - name: Show diffs
+        id: show
+        run: |
+          git diff --cached --color --no-ext-diff --ignore-submodules --exit-code --
+        continue-on-error: true
+
+      - name: Commit
+        run: |
+          git pull --ff-only origin ${GITHUB_REF#refs/heads/}
+          message="Update bundled gems list at "
+          if [ ${{ steps.diff.outcome }} = success ]; then
+            git commit --message="${message}${GITHUB_SHA:0:30} [ci skip]"
+          else
+            git commit --message="${message}${TODAY}"
+          fi
+          git push origin ${GITHUB_REF#refs/heads/}
+        env:
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+        if: ${{ github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull') && steps.show.outcome == 'failure' }}
+
+      - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+        with:
+          payload: |
+            {
+              "ci": "GitHub Actions",
+              "env": "${{ github.workflow }} / update",
+              "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+              "commit": "${{ github.sha }}",
+              "branch": "${{ github.ref_name }}"
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() && github.event_name == 'push' }}
diff --git a/.github/workflows/check_dependencies.yml b/.github/workflows/check_dependencies.yml
new file mode 100644
index 0000000000..79b2916feb
--- /dev/null
+++ b/.github/workflows/check_dependencies.yml
@@ -0,0 +1,78 @@
+name: Check Dependencies
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  merge_group:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  update-deps:
+    strategy:
+      matrix:
+        os: [ubuntu-22.04]
+      fail-fast: true
+    runs-on: ${{ matrix.os }}
+    if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+    steps:
+      - name: Install libraries
+        run: |
+          set -x
+          sudo apt-get update -q || :
+          sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+        if: ${{ contains(matrix.os, 'ubuntu') }}
+      - name: Install libraries
+        run: |
+          brew install gmp libffi openssl@1.1 zlib autoconf automake libtool readline
+        if: ${{ contains(matrix.os, 'macos') }}
+      - name: git config
+        run: |
+          git config --global advice.detachedHead 0
+          git config --global init.defaultBranch garbage
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+      - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+        with:
+          path: .downloaded-cache
+          key: downloaded-cache
+      - run: ./autogen.sh
+      - name: Run configure
+        run: ./configure -C --disable-install-doc --disable-rubygems --with-gcc 'optflags=-O0' 'debugflags=-save-temps=obj -g'
+      - run: make all golf
+      - run: ruby tool/update-deps --fix
+      - run: git diff --no-ext-diff --ignore-submodules --exit-code
+      - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+        with:
+          payload: |
+            {
+              "ci": "GitHub Actions",
+              "env": "${{ matrix.os }} / Dependencies need to update",
+              "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+              "commit": "${{ github.sha }}",
+              "branch": "${{ github.ref_name }}"
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() && github.event_name == 'push' }}
diff --git a/.github/workflows/codeql-analysis.yml b/.github/workflows/codeql-analysis.yml
new file mode 100644
index 0000000000..8dba76fbe2
--- /dev/null
+++ b/.github/workflows/codeql-analysis.yml
@@ -0,0 +1,75 @@
+name: "Code scanning - action"
+
+on:
+  # push:
+  #   paths-ignore:
+  #     - 'doc/**'
+  #     - '**/man'
+  #     - '**.md'
+  #     - '**.rdoc'
+  #     - '**/.document'
+  # pull_request:
+  #   paths-ignore:
+  #     - 'doc/**'
+  #     - '**/man'
+  #     - '**.md'
+  #     - '**.rdoc'
+  #     - '**/.document'
+  schedule:
+    - cron: '0 12 * * *'
+  workflow_dispatch:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:  # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  CodeQL-Build:
+
+    # CodeQL runs on ubuntu-latest and windows-latest
+    permissions:
+      actions: read  # for github/codeql-action/init to get workflow details
+      contents: read  # for actions/checkout to fetch code
+      security-events: write  # for github/codeql-action/autobuild to send a status report
+    runs-on: ubuntu-latest
+    # CodeQL fails to run pull requests from dependabot due to missing write access to upload results.
+    if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') && github.event.head_commit.pusher.name != 'dependabot[bot]' }}
+
+    env:
+      enable_install_doc: no
+
+    steps:
+    - name: Install libraries
+      run: |
+        set -x
+        sudo apt-get update -q || :
+        sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+
+    - name: Checkout repository
+      uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+
+    - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+      with:
+        path: .downloaded-cache
+        key: downloaded-cache
+
+    - name: Remove an obsolete rubygems vendored file
+      run: sudo rm /usr/lib/ruby/vendor_ruby/rubygems/defaults/operating_system.rb
+
+    - name: Initialize CodeQL
+      uses: github/codeql-action/init@959cbb7472c4d4ad70cdfe6f4976053fe48ab394 # v2.1.37
+      with:
+        config-file: ./.github/codeql/codeql-config.yml
+        trap-caching: false
+
+    - name: Set ENV
+      run: echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+
+    - name: Autobuild
+      uses: github/codeql-action/autobuild@959cbb7472c4d4ad70cdfe6f4976053fe48ab394 # v2.1.37
+
+    - name: Perform CodeQL Analysis
+      uses: github/codeql-action/analyze@959cbb7472c4d4ad70cdfe6f4976053fe48ab394 # v2.1.37
diff --git a/.github/workflows/compilers.yml b/.github/workflows/compilers.yml
new file mode 100644
index 0000000000..caf12cc0f4
--- /dev/null
+++ b/.github/workflows/compilers.yml
@@ -0,0 +1,281 @@
+name: Compilations
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.rdoc'
+      - '**/.document'
+  merge_group:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.rdoc'
+      - '**/.document'
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+# GitHub actions does not support YAML anchors.  This creative use of
+# environment variables (plus the "echo $GITHUB_ENV" hack) is to reroute that
+# restriction.
+env:
+  default_cc: clang-15
+  append_cc: ''
+
+  # -O1 is faster than -O3 in our tests... Majority of time are consumed trying
+  # to optimize binaries.  Also GitHub Actions run on relatively modern CPUs
+  # compared to, say, GCC 4 or Clang 3.  We don't specify `-march=native`
+  # because compilers tend not understand what the CPU is.
+  optflags: '-O1'
+
+  # -g0 disables backtraces when SEGV.  Do not set that.
+  debugflags: '-ggdb3'
+
+  default_configure: >-
+    --enable-debug-env
+    --disable-install-doc
+    --with-ext=-test-/cxxanyargs,+
+  append_configure: >-
+    --without-valgrind
+    --without-jemalloc
+    --without-gmp
+
+  UPDATE_UNICODE: >-
+    UNICODE_FILES=.
+    UNICODE_PROPERTY_FILES=.
+    UNICODE_AUXILIARY_FILES=.
+    UNICODE_EMOJI_FILES=.
+  CONFIGURE_TTY: never
+  GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+  RUBY_DEBUG: ci rgengc
+  RUBY_TESTOPTS: >-
+    -q
+    --color=always
+    --tty=no
+
+permissions:
+  contents: read
+
+jobs:
+  compile:
+    strategy:
+      fail-fast: false
+      matrix:
+        env:
+          - {}
+        entry:
+          - { name: gcc-12,    env: { default_cc: gcc-12 } }
+          - { name: gcc-11,    env: { default_cc: gcc-11 } }
+          - { name: gcc-10,    env: { default_cc: gcc-10 } }
+          - { name: gcc-9,     env: { default_cc: gcc-9 } }
+          - { name: gcc-8,     env: { default_cc: gcc-8 } }
+          - { name: gcc-7,     env: { default_cc: gcc-7 } }
+          - name: 'gcc-13 LTO'
+            container: gcc-13
+            env:
+              default_cc: 'gcc-13 -flto=auto -ffat-lto-objects -Werror=lto-type-mismatch'
+              optflags: '-O2'
+            shared: disable
+            # check: true
+          - { name: clang-16,  env: { default_cc: clang-16 } }
+          - { name: clang-15,  env: { default_cc: clang-15 } }
+          - { name: clang-14,  env: { default_cc: clang-14 } }
+          - { name: clang-13,  env: { default_cc: clang-13 } }
+          - { name: clang-12,  env: { default_cc: clang-12 } }
+          - { name: clang-11,  env: { default_cc: clang-11 } }
+          - { name: clang-10,  env: { default_cc: clang-10 } }
+          # llvm-objcopy<=9 doesn't have --wildcard. It compiles, but leaves Rust symbols in libyjit.o.
+          - { name: clang-9,   env: { default_cc: clang-9,   append_configure: '--disable-yjit' } }
+          - { name: clang-8,   env: { default_cc: clang-8,   append_configure: '--disable-yjit' } }
+          - { name: clang-7,   env: { default_cc: clang-7,   append_configure: '--disable-yjit' } }
+          - { name: clang-6.0, env: { default_cc: clang-6.0, append_configure: '--disable-yjit' } }
+          - name: 'clang-16 LTO'
+            container: clang-16
+            env:
+              default_cc: 'clang-16 -flto=auto'
+              optflags: '-O2'
+            shared: disable
+            # check: true
+
+#         - { name: aarch64-linux-gnu,     crosshost: aarch64-linux-gnu, container: crossbuild-essential-arm64 }
+#         - { name: arm-linux-gnueabi,     crosshost: arm-linux-gnueabi }
+#         - { name: arm-linux-gnueabihf,   crosshost: arm-linux-gnueabihf }
+#         - { name: i686-w64-mingw32,      crosshost: i686-w64-mingw32 }
+#         - { name: powerpc-linux-gnu,     crosshost: powerpc-linux-gnu }
+#         - { name: powerpc64le-linux-gnu, crosshost: powerpc64le-linux-gnu, container: crossbuild-essential-ppc64el }
+#         - { name: s390x-linux-gnu,       crosshost: s390x-linux-gnu, container: crossbuild-essential-s390x }
+#         - { name: x86_64-w64-mingw32,    crosshost: x86_64-w64-mingw32, container: mingw-w64 }
+
+          # -Wno-strict-prototypes is necessary with current clang-15 since
+          # older autoconf generate functions without prototype and -pedantic
+          # now implies strict-prototypes. Disabling the error but leaving the
+          # warning generates a lot of noise from use of ANYARGS in
+          # rb_define_method() and friends.
+          # See: https://github.com/llvm/llvm-project/commit/11da1b53d8cd3507959022cd790d5a7ad4573d94
+          - { name: c99,   env: { append_cc: '-std=c99   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
+#         - { name: c11,   env: { append_cc: '-std=c11   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
+#         - { name: c17,   env: { append_cc: '-std=c17   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
+          - { name: c2x,   env: { append_cc: '-std=c2x   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
+          - { name: c++98, env: { CXXFLAGS: '-std=c++98 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+#         - { name: c++11, env: { CXXFLAGS: '-std=c++11 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+#         - { name: c++14, env: { CXXFLAGS: '-std=c++14 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+#         - { name: c++17, env: { CXXFLAGS: '-std=c++17 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+          - { name: c++2a, env: { CXXFLAGS: '-std=c++2a -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+
+          - { name: '-O0', env: { optflags: '-O0 -march=x86-64 -mtune=generic' } }
+#         - { name: '-O3', env: { optflags: '-O3 -march=x86-64 -mtune=generic' }, check: true }
+
+          - { name: gmp,                  env: { append_configure: '--with-gmp' } }
+          - { name: jemalloc,             env: { append_configure: '--with-jemalloc' } }
+          - { name: valgrind,             env: { append_configure: '--with-valgrind' } }
+          - { name: 'coroutine=ucontext', env: { append_configure: '--with-coroutine=ucontext' } }
+          - { name: 'coroutine=pthread',  env: { append_configure: '--with-coroutine=pthread' } }
+          - { name: disable-jit-support,  env: { append_configure: '--disable-jit-support' } }
+          - { name: disable-dln,          env: { append_configure: '--disable-dln' } }
+          - { name: enable-mkmf-verbose,  env: { append_configure: '--enable-mkmf-verbose' } }
+          - { name: disable-rubygems,     env: { append_configure: '--disable-rubygems' } }
+          - { name: RUBY_DEVEL,           env: { append_configure: '--enable-devel' } }
+
+          - { name: OPT_THREADED_CODE=1,            env: { cppflags: '-DOPT_THREADED_CODE=1' } }
+          - { name: OPT_THREADED_CODE=2,            env: { cppflags: '-DOPT_THREADED_CODE=2' } }
+          - { name: OPT_THREADED_CODE=3,            env: { cppflags: '-DOPT_THREADED_CODE=3' } }
+
+          - { name: NDEBUG,                         env: { cppflags: '-DNDEBUG' } }
+          - { name: RUBY_DEBUG,                     env: { cppflags: '-DRUBY_DEBUG' } }
+#         - { name: ARRAY_DEBUG,                    env: { cppflags: '-DARRAY_DEBUG' } }
+#         - { name: BIGNUM_DEBUG,                   env: { cppflags: '-DBIGNUM_DEBUG' } }
+#         - { name: CCAN_LIST_DEBUG,                env: { cppflags: '-DCCAN_LIST_DEBUG' } }
+#         - { name: CPDEBUG=-1,                     env: { cppflags: '-DCPDEBUG=-1' } }
+#         - { name: ENC_DEBUG,                      env: { cppflags: '-DENC_DEBUG' } }
+#         - { name: GC_DEBUG,                       env: { cppflags: '-DGC_DEBUG' } }
+#         - { name: HASH_DEBUG,                     env: { cppflags: '-DHASH_DEBUG' } }
+#         - { name: ID_TABLE_DEBUG,                 env: { cppflags: '-DID_TABLE_DEBUG' } }
+#         - { name: RGENGC_DEBUG=-1,                env: { cppflags: '-DRGENGC_DEBUG=-1' } }
+#         - { name: SYMBOL_DEBUG,                   env: { cppflags: '-DSYMBOL_DEBUG' } }
+
+#         - { name: RGENGC_CHECK_MODE,              env: { cppflags: '-DRGENGC_CHECK_MODE' } }
+#         - { name: TRANSIENT_HEAP_CHECK_MODE,      env: { cppflags: '-DTRANSIENT_HEAP_CHECK_MODE' } }
+#         - { name: VM_CHECK_MODE,                  env: { cppflags: '-DVM_CHECK_MODE' } }
+
+          - { name: USE_EMBED_CI=0,                 env: { cppflags: '-DUSE_EMBED_CI=0' } }
+          - name: USE_FLONUM=0,
+            env:
+              cppflags: '-DUSE_FLONUM=0'
+              # yjit requires FLONUM for the pointer tagging scheme
+              append_configure: '--disable-yjit'
+#         - { name: USE_GC_MALLOC_OBJ_INFO_DETAILS, env: { cppflags: '-DUSE_GC_MALLOC_OBJ_INFO_DETAILS' } }
+          - { name: USE_LAZY_LOAD,                  env: { cppflags: '-DUSE_LAZY_LOAD' } }
+#         - { name: USE_RINCGC=0,                   env: { cppflags: '-DUSE_RINCGC=0' } }
+#         - { name: USE_SYMBOL_GC=0,                env: { cppflags: '-DUSE_SYMBOL_GC=0' } }
+#         - { name: USE_THREAD_CACHE=0,             env: { cppflags: '-DUSE_THREAD_CACHE=0' } }
+#         - { name: USE_TRANSIENT_HEAP=0,           env: { cppflags: '-DUSE_TRANSIENT_HEAP=0' } }
+#         - { name: USE_RUBY_DEBUG_LOG=1,           env: { cppflags: '-DUSE_RUBY_DEBUG_LOG=1' } }
+          - { name: USE_RVARGC=0,                   env: { cppflags: '-DUSE_RVARGC=0' } }
+#         - { name: USE_RVARGC=1,                   env: { cppflags: '-DUSE_RVARGC=1' } }
+#         - { name: USE_DEBUG_COUNTER,              env: { cppflags: '-DUSE_DEBUG_COUNTER=1', RUBY_DEBUG_COUNTER_DISABLE: '1' } }
+
+          - { name: DEBUG_FIND_TIME_NUMGUESS,       env: { cppflags: '-DDEBUG_FIND_TIME_NUMGUESS' } }
+          - { name: DEBUG_INTEGER_PACK,             env: { cppflags: '-DDEBUG_INTEGER_PACK' } }
+#         - { name: ENABLE_PATH_CHECK,              env: { cppflags: '-DENABLE_PATH_CHECK' } }
+
+          - { name: GC_DEBUG_STRESS_TO_CLASS,       env: { cppflags: '-DGC_DEBUG_STRESS_TO_CLASS' } }
+#         - { name: GC_ENABLE_LAZY_SWEEP=0,         env: { cppflags: '-DGC_ENABLE_LAZY_SWEEP=0' } }
+#         - { name: GC_PROFILE_DETAIL_MEMOTY,       env: { cppflags: '-DGC_PROFILE_DETAIL_MEMOTY' } }
+#         - { name: GC_PROFILE_MORE_DETAIL,         env: { cppflags: '-DGC_PROFILE_MORE_DETAIL' } }
+
+#         - { name: CALC_EXACT_MALLOC_SIZE,         env: { cppflags: '-DCALC_EXACT_MALLOC_SIZE' } }
+#         - { name: MALLOC_ALLOCATED_SIZE_CHECK,    env: { cppflags: '-DMALLOC_ALLOCATED_SIZE_CHECK' } }
+
+#         - { name: IBF_ISEQ_ENABLE_LOCAL_BUFFER,   env: { cppflags: '-DIBF_ISEQ_ENABLE_LOCAL_BUFFER' } }
+
+#         - { name: RGENGC_ESTIMATE_OLDMALLOC,      env: { cppflags: '-DRGENGC_ESTIMATE_OLDMALLOC' } }
+#         - { name: RGENGC_FORCE_MAJOR_GC,          env: { cppflags: '-DRGENGC_FORCE_MAJOR_GC' } }
+#         - { name: RGENGC_OBJ_INFO,                env: { cppflags: '-DRGENGC_OBJ_INFO' } }
+#         - { name: RGENGC_OLD_NEWOBJ_CHECK,        env: { cppflags: '-DRGENGC_OLD_NEWOBJ_CHECK' } }
+#         - { name: RGENGC_PROFILE,                 env: { cppflags: '-DRGENGC_PROFILE' } }
+
+#         - { name: VM_DEBUG_BP_CHECK,              env: { cppflags: '-DVM_DEBUG_BP_CHECK' } }
+#         - { name: VM_DEBUG_VERIFY_METHOD_CACHE,   env: { cppflags: '-DVM_DEBUG_VERIFY_METHOD_CACHE' } }
+
+          - { name: MJIT_FORCE_ENABLE,              env: { cppflags: '-DMJIT_FORCE_ENABLE' } }
+          - { name: YJIT_FORCE_ENABLE,              env: { cppflags: '-DYJIT_FORCE_ENABLE' } }
+
+    name: ${{ matrix.entry.name }}
+    runs-on: ubuntu-latest
+    container:
+      image: ghcr.io/ruby/ruby-ci-image:${{ matrix.entry.container || matrix.entry.env.default_cc || 'clang-15' }}
+      options: --user root
+    if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+    env: ${{ matrix.entry.env || matrix.env }}
+    steps:
+      - run: id
+        working-directory:
+      - run: mkdir build
+        working-directory:
+      - name: setenv
+        run: |
+          echo "GNUMAKEFLAGS=-sj$((1 + $(nproc --all)))" >> $GITHUB_ENV
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+        with:
+          path: src
+      - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+        with:
+          path: src/.downloaded-cache
+          key: downloaded-cache
+      - run: ./autogen.sh
+        working-directory: src
+      - name: Run configure
+        run: >
+          ../src/configure -C ${default_configure} ${append_configure}
+          --${{
+            matrix.entry.crosshost && 'host' || 'with-gcc'
+          }}=${{
+            matrix.entry.crosshost || '"${default_cc}${append_cc:+ $append_cc}"'
+          }}
+          --${{ matrix.entry.shared || 'enable' }}-shared
+      - run: make extract-extlibs
+      - run: make incs
+      - run: make showflags
+      - run: make
+      - run: make leaked-globals
+      - run: make test
+      - run: make install
+        if: ${{ matrix.entry.check }}
+      - run: make test-tool
+        if: ${{ matrix.entry.check }}
+      - run: make test-all TESTS='-- ruby -ext-'
+        if: ${{ matrix.entry.check }}
+      - run: make test-spec
+        env:
+          CHECK_LEAKS: true
+        if: ${{ matrix.entry.check }}
+      - run: make test-annocheck
+        if: ${{ matrix.entry.check && endsWith(matrix.entry.name, 'annocheck') }}
+
+      - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+        with:
+          payload: |
+            {
+              "ci": "GitHub Actions",
+              "env": "${{ github.workflow }} / ${{ matrix.entry.name }}",
+              "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+              "commit": "${{ github.sha }}",
+              "branch": "${{ github.ref_name }}"
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/macos.yml b/.github/workflows/macos.yml
new file mode 100644
index 0000000000..d8dc58b119
--- /dev/null
+++ b/.github/workflows/macos.yml
@@ -0,0 +1,113 @@
+name: macOS
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  merge_group:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        test_task: ["check"] # "test-bundler-parallel", "test-bundled-gems"
+        os:
+          - macos-13
+          - macos-14
+          - macos-15
+      fail-fast: false
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+    runs-on: ${{ matrix.os }}
+    if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+    steps:
+      - run: mkdir build
+        working-directory:
+      - name: git config
+        run: |
+          git config --global advice.detachedHead 0
+          git config --global init.defaultBranch garbage
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+        with:
+          path: src
+      - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+        with:
+          path: src/.downloaded-cache
+          key: downloaded-cache
+      - name: Install libraries
+        run: |
+          brew install gmp libffi openssl@1.1 zlib autoconf automake libtool readline bison
+        working-directory: src
+      - name: Set ENV
+        run: |
+          echo "MAKEFLAGS=-j$((1 + $(sysctl -n hw.activecpu)))" >> $GITHUB_ENV
+          echo "PATH="/usr/local/opt/bison/bin:/opt/homebrew/opt/bison/bin:$PATH"" >> $GITHUB_ENV
+      - run: ./autogen.sh
+        working-directory: src
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --with-openssl-dir=$(brew --prefix openssl@1.1) --with-readline-dir=$(brew --prefix readline)
+      - run: make incs
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+      - run: make
+      - run: make leaked-globals
+        if: ${{ matrix.test_task == 'check' }}
+      - name: make ${{ matrix.test_task }}
+        run: |
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS=`echo "$TESTS" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|'`}
+        timeout-minutes: 40
+        env:
+          RUBY_TESTOPTS: "-q --tty=no"
+          TESTS: ${{ matrix.test_task == 'check' && matrix.skipped_tests || '' }}
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ""
+          PRECHECK_BUNDLED_GEMS: "no"
+      - name: make skipped tests
+        run: |
+          make -s test-all TESTS=`echo "$TESTS" | sed 's| |$$/ -n/|g;s|^|-n/|;s|$|$$/|'`
+        env:
+          GNUMAKEFLAGS: ""
+          RUBY_TESTOPTS: "-v --tty=no"
+          TESTS: ${{ matrix.skipped_tests }}
+          PRECHECK_BUNDLED_GEMS: "no"
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests != '' }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+      - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+        with:
+          payload: |
+            {
+              "ci": "GitHub Actions",
+              "env": "${{ matrix.os }} / ${{ matrix.test_task }}${{ matrix.configure }}",
+              "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+              "commit": "${{ github.sha }}",
+              "branch": "${{ github.ref_name }}"
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/mingw.yml b/.github/workflows/mingw.yml
new file mode 100644
index 0000000000..0df917d3d8
--- /dev/null
+++ b/.github/workflows/mingw.yml
@@ -0,0 +1,179 @@
+name: MinGW
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  merge_group:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+# Notes:
+# Actions console encoding causes issues, see test-all & test-spec steps
+#
+jobs:
+  make:
+    runs-on: windows-2022
+    name: ${{ github.workflow }} (${{ matrix.msystem }})
+    env:
+      MSYSTEM: ${{ matrix.msystem }}
+      MSYS2_ARCH: x86_64
+      CHOST: "x86_64-w64-mingw32"
+      CFLAGS:   "-march=x86-64 -mtune=generic -O3 -pipe"
+      CXXFLAGS: "-march=x86-64 -mtune=generic -O3 -pipe"
+      CPPFLAGS: "-D_FORTIFY_SOURCE=2 -D__USE_MINGW_ANSI_STDIO=1 -DFD_SETSIZE=2048"
+      LDFLAGS:  "-pipe"
+      UPDATE_UNICODE: "UNICODE_FILES=. UNICODE_PROPERTY_FILES=. UNICODE_AUXILIARY_FILES=. UNICODE_EMOJI_FILES=."
+      GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+    strategy:
+      matrix:
+        include:
+          # To mitigate flakiness of MinGW CI, we test only one runtime that newer MSYS2 uses.
+          - msystem: "UCRT64"
+            base_ruby: head
+            test_task: "check"
+            test-all-opts: "--name=!/TestObjSpace#test_reachable_objects_during_iteration/"
+      fail-fast: false
+    if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+    steps:
+      - run: mkdir build
+        working-directory:
+      - name: git config
+        run: |
+          git config --global core.autocrlf false
+          git config --global core.eol lf
+          git config --global advice.detachedHead 0
+          git config --global init.defaultBranch garbage
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+        with:
+          path: src
+      - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+        with:
+          path: src/.downloaded-cache
+          key: downloaded-cache
+      - name: Set up Ruby & MSYS2
+        uses: ruby/setup-ruby@13e7a03dc3ac6c3798f4570bfead2aed4d96abfb # v1.244.0
+        with:
+          ruby-version: ${{ matrix.base_ruby }}
+      - name: set env
+        run: |
+          echo "GNUMAKEFLAGS=-j$((2 * NUMBER_OF_PROCESSORS))" >> $GITHUB_ENV
+
+      - name: where check
+        run: |
+          # show where
+          mv /c/Windows/System32/libcrypto-1_1-x64.dll /c/Windows/System32/libcrypto-1_1-x64.dll_
+          mv /c/Windows/System32/libssl-1_1-x64.dll    /c/Windows/System32/libssl-1_1-x64.dll_
+          result=true
+          for e in gcc.exe ragel.exe make.exe bison.exe libcrypto-1_1-x64.dll libssl-1_1-x64.dll; do
+            echo '##['group']'$'\033[93m'$e$'\033[m'
+            where $e || result=false
+            echo '##['endgroup']'
+          done
+          $result
+
+      - name: version check
+        run: |
+          # show version
+          result=true
+          for e in gcc ragel make bison "openssl version"; do
+            case "$e" in *" "*) ;; *) e="$e --version";; esac
+            echo '##['group']'$'\033[93m'$e$'\033[m'
+            $e || result=false
+            echo '##['endgroup']'
+          done
+          $result
+
+      - name: autogen
+        run: |
+          ./autogen.sh
+        working-directory: src
+
+      - name: configure
+        run: >
+          ../src/configure --disable-install-doc --prefix=/.
+          --build=$CHOST --host=$CHOST --target=$CHOST
+
+      - name: update
+        run: |
+          make incs
+
+      - name: download gems
+        run: |
+          make update-gems
+
+      - name: make all
+        timeout-minutes: 30
+        run: |
+          make
+
+      - run: make leaked-globals
+
+      - name: make install
+        run: |
+          make DESTDIR=../install install-nodoc
+
+      - name: test
+        timeout-minutes: 5
+        run: |
+          make test
+        if: ${{matrix.test_task == 'check' || matrix.test_task == 'test'}}
+
+      - name: test-all
+        timeout-minutes: 45
+        run: |
+          # Actions uses UTF8, causes test failures, similar to normal OS setup
+          chcp.com 437
+          make ${{ StartsWith(matrix.test_task, 'test/') && matrix.test_task || 'test-all' }}
+        env:
+          RUBY_TESTOPTS: >-
+            --retry --job-status=normal --show-skip --timeout-scale=1.5
+            ${{ matrix.test-all-opts }}
+          BUNDLER_VERSION:
+        if: ${{matrix.test_task == 'check' || matrix.test_task == 'test-all' || StartsWith(matrix.test_task, 'test/')}}
+
+      - name: test-spec
+        timeout-minutes: 10
+        run: |
+          make ${{ StartsWith(matrix.test_task, 'spec/') && matrix.test_task || 'test-spec' }}
+        if: ${{matrix.test_task == 'check' || matrix.test_task == 'test-spec' || StartsWith(matrix.test_task, 'spec/')}}
+
+      - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+        with:
+          payload: |
+            {
+              "ci": "GitHub Actions",
+              "env": "${{ github.workflow }} ${{ matrix.msystem }} / ${{ matrix.test_task }}",
+              "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+              "commit": "${{ github.sha }}",
+              "branch": "${{ github.ref_name }}"
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+  run:
+    working-directory: build
+    shell: sh
diff --git a/.github/workflows/mjit-bindgen.yml b/.github/workflows/mjit-bindgen.yml
new file mode 100644
index 0000000000..26f8a1b2aa
--- /dev/null
+++ b/.github/workflows/mjit-bindgen.yml
@@ -0,0 +1,104 @@
+name: MJIT bindgen
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  merge_group:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - task: mjit-bindgen
+      fail-fast: false
+    runs-on: ubuntu-22.04
+    if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+    steps:
+      - run: mkdir build
+        working-directory:
+      - name: Set ENV
+        run: |
+          echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+      - name: Install libraries
+        run: |
+          set -x
+          sudo apt-get update -q || :
+          sudo apt-get install --no-install-recommends -q -y \
+          build-essential \
+          libssl-dev libyaml-dev libreadline6-dev \
+          zlib1g-dev libncurses5-dev libffi-dev \
+          libclang1-14 \
+          bison autoconf
+          sudo apt-get install -q -y pkg-config || :
+      - name: Set up Ruby
+        uses: ruby/setup-ruby@13e7a03dc3ac6c3798f4570bfead2aed4d96abfb # v1.244.0
+        with:
+          ruby-version: '3.1'
+      - name: git config
+        run: |
+          git config --global advice.detachedHead 0
+          git config --global init.defaultBranch garbage
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+        with:
+          path: src
+      - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+        with:
+          path: src/.downloaded-cache
+          key: downloaded-cache
+      - name: Fixed world writable dirs
+        run: |
+          chmod -v go-w $HOME $HOME/.config
+          sudo chmod -R go-w /usr/share
+          sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+      - run: ./autogen.sh
+        working-directory: src
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install --enable-yjit=dev_nodebug
+      - run: make incs
+      - run: make
+      - run: make install
+      - run: make ${{ matrix.task }}
+      - run: git diff --exit-code
+        working-directory: src
+      - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+        with:
+          payload: |
+            {
+              "ci": "GitHub Actions",
+              "env": "${{ matrix.os }} / ${{ matrix.test_task }}${{ matrix.configure }}",
+              "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+              "commit": "${{ github.sha }}",
+              "branch": "${{ github.ref_name }}"
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/mjit.yml b/.github/workflows/mjit.yml
new file mode 100644
index 0000000000..6f7181489a
--- /dev/null
+++ b/.github/workflows/mjit.yml
@@ -0,0 +1,113 @@
+name: MJIT
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '**.[1-8]'
+      - '**.ronn'
+  merge_group:
+    paths-ignore:
+      - 'doc/**'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '**.[1-8]'
+      - '**.ronn'
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        test_task: [check] # to make job names consistent
+        mjit_opts: [--mjit-wait]
+      fail-fast: false
+    runs-on: ubuntu-latest
+    if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+    env:
+      TESTOPTS: '-q --tty=no'
+      RUN_OPTS: '--disable-gems ${{ matrix.mjit_opts }} --mjit-debug=-ggdb3'
+      GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+    steps:
+      - run: mkdir build
+        working-directory:
+      - name: Install libraries
+        run: |
+          set -x
+          sudo apt-get update -q || :
+          sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+      - name: git config
+        run: |
+          git config --global advice.detachedHead 0
+          git config --global init.defaultBranch garbage
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+        with:
+          path: src
+      - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+        with:
+          path: src/.downloaded-cache
+          key: downloaded-cache
+      - name: Fixed world writable dirs
+        run: |
+          chmod -v go-w $HOME $HOME/.config
+          sudo chmod -R go-w /usr/share
+          sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+      - name: Set ENV
+        run: |
+          echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+      - run: ./autogen.sh
+        working-directory: src
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc cppflags=-DVM_CHECK_MODE
+      - run: make incs
+      - run: make
+      - run: sudo make -s install
+      - name: Run test
+        run: |
+          unset GNUMAKEFLAGS
+          make -s test RUN_OPTS="$RUN_OPTS"
+        timeout-minutes: 60
+      # - name: Run test-all
+      #   run: |
+      #     ulimit -c unlimited
+      #     make -s test-all RUN_OPTS="$RUN_OPTS"
+      #   timeout-minutes: 60
+      - name: Run test-spec
+        run: |
+          unset GNUMAKEFLAGS
+          make -s test-spec RUN_OPTS="$RUN_OPTS"
+        timeout-minutes: 60
+      - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+        with:
+          payload: |
+            {
+              "ci": "GitHub Actions",
+              "env": "${{ github.workflow }} / ${{ matrix.test_task }} ${{ matrix.mjit_opts }}",
+              "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+              "commit": "${{ github.sha }}",
+              "branch": "${{ github.ref_name }}"
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/publish.yml b/.github/workflows/publish.yml
new file mode 100644
index 0000000000..5d4474d978
--- /dev/null
+++ b/.github/workflows/publish.yml
@@ -0,0 +1,18 @@
+name: Start release workflow
+on:
+  push:
+    tags:
+      - '*'
+
+jobs:
+  notify:
+    runs-on: ubuntu-latest
+    steps:
+      - name: Build release package
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/actions/dispatches \
+            -d '{"event_type": "${{ github.ref }}"}'
diff --git a/.github/workflows/scorecards.yml b/.github/workflows/scorecards.yml
new file mode 100644
index 0000000000..c12a95362d
--- /dev/null
+++ b/.github/workflows/scorecards.yml
@@ -0,0 +1,72 @@
+# This workflow uses actions that are not certified by GitHub. They are provided
+# by a third-party and are governed by separate terms of service, privacy
+# policy, and support documentation.
+
+name: Scorecards supply-chain security
+on:
+  # For Branch-Protection check. Only the default branch is supported. See
+  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#branch-protection
+  branch_protection_rule:
+  # To guarantee Maintained check is occasionally updated. See
+  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#maintained
+  schedule:
+    - cron: '22 4 * * 2'
+  push:
+    branches: [ "master" ]
+
+# Declare default permissions as read only.
+permissions: read-all
+
+jobs:
+  analysis:
+    name: Scorecards analysis
+    runs-on: ubuntu-latest
+    permissions:
+      # Needed to upload the results to code-scanning dashboard.
+      security-events: write
+      # Needed to publish results and get a badge (see publish_results below).
+      id-token: write
+      # Uncomment the permissions below if installing in a private repository.
+      # contents: read
+      # actions: read
+
+    steps:
+      - name: "Checkout code"
+        uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+        with:
+          persist-credentials: false
+
+      - name: "Run analysis"
+        uses: ossf/scorecard-action@ea651e62978af7915d09fe2e282747c798bf2dab # v2.4.1
+        with:
+          results_file: results.sarif
+          results_format: sarif
+          # (Optional) Read-only PAT token. Uncomment the `repo_token` line below if:
+          # - you want to enable the Branch-Protection check on a *public* repository, or
+          # - you are installing Scorecards on a *private* repository
+          # To create the PAT, follow the steps in https://github.com/ossf/scorecard-action#authentication-with-pat.
+          repo_token: ${{ secrets.SCORECARD_READ_TOKEN }}
+
+          # Public repositories:
+          #   - Publish results to OpenSSF REST API for easy access by consumers
+          #   - Allows the repository to include the Scorecard badge.
+          #   - See https://github.com/ossf/scorecard-action#publishing-results.
+          # For private repositories:
+          #   - `publish_results` will always be set to `false`, regardless
+          #     of the value entered here.
+          publish_results: true
+
+      # Upload the results as artifacts (optional). Commenting out will disable uploads of run results in SARIF
+      # format to the repository Actions tab.
+      - name: "Upload artifact"
+        uses: actions/upload-artifact@ea165f8d65b6e75b540449e92b4886f43607fa02 # v4.6.2
+        with:
+          name: SARIF file
+          path: results.sarif
+          retention-days: 5
+
+      # Upload the results to GitHub's code scanning dashboard.
+      - name: "Upload to code-scanning"
+        uses: github/codeql-action/upload-sarif@959cbb7472c4d4ad70cdfe6f4976053fe48ab394 # v2.1.27
+        with:
+          sarif_file: results.sarif
diff --git a/.github/workflows/spec_guards.yml b/.github/workflows/spec_guards.yml
new file mode 100644
index 0000000000..4521195a2b
--- /dev/null
+++ b/.github/workflows/spec_guards.yml
@@ -0,0 +1,71 @@
+name: Rubyspec Version Guards Check
+
+on:
+  push:
+    paths:
+      - 'spec/**'
+      - '!spec/*.md'
+  pull_request:
+    paths:
+      - 'spec/**'
+      - '!spec/*.md'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  rubyspec:
+    name: Rubyspec
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.head_commit.message, 'Document')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.title, 'Document')
+      || contains(github.event.pull_request.labels.*.name, 'Document')
+      || (github.event_name == 'push' && github.actor == 'dependabot[bot]')
+      )}}
+
+    strategy:
+      matrix:
+        # Specs from ruby/spec should still run on all supported Ruby versions.
+        # This also ensures the needed ruby_version_is guards are there, see spec/README.md.
+        ruby:
+          - ruby-3.1
+          - ruby-3.2
+
+    steps:
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+
+      - uses: ruby/setup-ruby@13e7a03dc3ac6c3798f4570bfead2aed4d96abfb # v1.244.0
+        with:
+          ruby-version: ${{ matrix.ruby }}
+          bundler: none
+
+      - run: gem install webrick
+
+      - run: ruby ../mspec/bin/mspec
+        working-directory: spec/ruby
+        env:
+          CHECK_LEAKS: true
+      - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+        with:
+          payload: |
+            {
+              "ci": "GitHub Actions",
+              "env": "${{ github.workflow }} / rubyspec @ ${{ matrix.ruby }}",
+              "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+              "commit": "${{ github.sha }}",
+              "branch": "${{ github.ref_name }}"
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/ubuntu.yml b/.github/workflows/ubuntu.yml
new file mode 100644
index 0000000000..4fbca1170e
--- /dev/null
+++ b/.github/workflows/ubuntu.yml
@@ -0,0 +1,146 @@
+name: Ubuntu
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  merge_group:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        # main variables included in the job name
+        test_task: [check]
+        configure: [cppflags=-DRUBY_DEBUG] # default to use more assertions
+        arch: ['']
+        # specify all jobs with `include` to avoid testing duplicated things
+        include:
+          - test_task: check
+          - test_task: check
+            arch: i686
+            configure: '' # test without -DRUBY_DEBUG as well
+          - test_task: check
+            configure: "--enable-shared --enable-load-relative"
+          - test_task: test-all TESTS=--repeat-count=2
+          - test_task: test-bundler-parallel
+          - test_task: test-bundled-gems
+      fail-fast: false
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+      RUBY_DEBUG: ci
+      SETARCH: ${{ matrix.arch && format('setarch {0}', matrix.arch) }}
+    runs-on: ubuntu-22.04
+    if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+    steps:
+      - run: mkdir build
+        working-directory:
+      - name: Set ENV
+        run: |
+          echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+      - name: Install libraries
+        env:
+          arch: ${{matrix.arch}}
+        run: |
+          set -x
+          arch=${arch:+:${arch/i[3-6]86/i386}}
+          ${arch:+sudo dpkg --add-architecture ${arch#:}}
+          sudo apt-get update -q || :
+          sudo apt-get install --no-install-recommends -q -y \
+          ${arch:+cross}build-essential${arch/:/-} \
+          libssl-dev${arch} libyaml-dev${arch} libreadline6-dev${arch} \
+          zlib1g-dev${arch} libncurses5-dev${arch} libffi-dev${arch} \
+          bison autoconf ruby
+          sudo apt-get install -q -y pkg-config${arch} || :
+      - name: git config
+        run: |
+          git config --global advice.detachedHead 0
+          git config --global init.defaultBranch garbage
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+        with:
+          path: src
+      - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+        with:
+          path: src/.downloaded-cache
+          key: downloaded-cache
+      - name: Fixed world writable dirs
+        run: |
+          chmod -v go-w $HOME $HOME/.config
+          sudo chmod -R go-w /usr/share
+          sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+      - run: ./autogen.sh
+        working-directory: src
+      - name: Run configure
+        env:
+          arch: ${{matrix.arch}}
+        run: >-
+          $SETARCH ../src/configure -C --disable-install-doc ${{ matrix.configure }}
+          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
+      - run: $SETARCH make incs
+      - run: $SETARCH make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+      - run: $SETARCH make
+      - run: $SETARCH make leaked-globals
+        if: ${{ matrix.test_task == 'check' }}
+      - name: Create dummy files in build dir
+        run: |
+          $SETARCH ./miniruby -e '(("a".."z").to_a+("A".."Z").to_a+("0".."9").to_a+%w[foo bar test zzz]).each{|basename|File.write("#{basename}.rb", "raise %(do not load #{basename}.rb)")}'
+        if: ${{ matrix.test_task == 'check' }}
+      - name: make ${{ matrix.test_task }}
+        run: |
+          $SETARCH make -s ${{ matrix.test_task }} ${TESTS:+TESTS=`echo "$TESTS" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|'`}
+        timeout-minutes: 40
+        env:
+          RUBY_TESTOPTS: "-q --tty=no"
+          TESTS: ${{ matrix.test_task == 'check' && matrix.skipped_tests || '' }}
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ""
+          PRECHECK_BUNDLED_GEMS: "no"
+      - name: make skipped tests
+        run: |
+          $SETARCH make -s test-all TESTS=`echo "$TESTS" | sed 's| |$$/ -n/|g;s|^|-n/|;s|$|$$/|'`
+        env:
+          GNUMAKEFLAGS: ""
+          RUBY_TESTOPTS: "-v --tty=no"
+          TESTS: ${{ matrix.skipped_tests }}
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests != '' }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+      - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+        with:
+          payload: |
+            {
+              "ci": "GitHub Actions",
+              "env": "${{ github.workflow }} / ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}",
+              "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+              "commit": "${{ github.sha }}",
+              "branch": "${{ github.ref_name }}"
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/wasm.yml b/.github/workflows/wasm.yml
new file mode 100644
index 0000000000..27920b5821
--- /dev/null
+++ b/.github/workflows/wasm.yml
@@ -0,0 +1,146 @@
+name: WebAssembly
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  merge_group:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:  # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        entry:
+#         # wasmtime can't compile non-optimized Asyncified binary due to locals explosion
+#         - { name: O0-debuginfo, optflags: "-O0", debugflags: "-g", wasmoptflags: "-O1" }
+#         - { name: O1,           optflags: "-O1", debugflags: ""  , wasmoptflags: "-O1" }
+          - { name: O2,           optflags: "-O2", debugflags: ""  , wasmoptflags: "-O2" }
+#         - { name: O3,           optflags: "-O3", debugflags: ""  , wasmoptflags: "-O3" }
+#         # -O4 is equivalent to -O3 in clang, but it's different in wasm-opt
+#         - { name: O4,           optflags: "-O3", debugflags: ""  , wasmoptflags: "-O4" }
+#         - { name: Oz,           optflags: "-Oz", debugflags: ""  , wasmoptflags: "-Oz" }
+      fail-fast: false
+    env:
+      RUBY_TESTOPTS: '-q --tty=no'
+      GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+      WASI_SDK_VERSION_MAJOR: 14
+      WASI_SDK_VERSION_MINOR: 0
+      BINARYEN_VERSION: 109
+      WASMTIME_VERSION: v0.33.0
+    runs-on: ubuntu-22.04
+    if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+    steps:
+      - run: mkdir build
+        working-directory:
+      - name: git config
+        run: |
+          git config --global advice.detachedHead 0
+          git config --global init.defaultBranch garbage
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+        with:
+          path: src
+      - name: Install libraries
+        run: |
+          set -ex
+          sudo apt-get update -q || :
+          sudo apt-get install --no-install-recommends -q -y ruby bison make autoconf git wget
+
+          wasi_sdk_deb="wasi-sdk_${WASI_SDK_VERSION_MAJOR}.${WASI_SDK_VERSION_MINOR}_amd64.deb"
+          wget "https://github.com/WebAssembly/wasi-sdk/releases/download/wasi-sdk-${WASI_SDK_VERSION_MAJOR}/${wasi_sdk_deb}"
+          sudo dpkg -i "$wasi_sdk_deb"
+          rm -f "$wasi_sdk_deb"
+
+          mkdir build-sdk
+          pushd build-sdk
+
+          wasmtime_url="https://github.com/bytecodealliance/wasmtime/releases/download/${WASMTIME_VERSION}/wasmtime-${WASMTIME_VERSION}-x86_64-linux.tar.xz"
+          wget -O - "$wasmtime_url" | tar xJf -
+          sudo ln -fs "$PWD/wasmtime-${WASMTIME_VERSION}-x86_64-linux/wasmtime" /usr/local/bin/wasmtime
+
+          binaryen_tarball="binaryen-version_${BINARYEN_VERSION}-x86_64-linux.tar.gz"
+          binaryen_url="https://github.com/WebAssembly/binaryen/releases/download/version_${BINARYEN_VERSION}/${binaryen_tarball}"
+          wget -O - "$binaryen_url" | tar xfz -
+          sudo ln -fs "$PWD/binaryen-version_${BINARYEN_VERSION}/bin/wasm-opt" /usr/local/bin/wasm-opt
+        working-directory: src
+      - name: Set ENV
+        run: |
+          echo "MAKEFLAGS=-j$((1 + $(sysctl -n hw.activecpu)))" >> $GITHUB_ENV
+          echo "WASI_SDK_PATH=/opt/wasi-sdk" >> $GITHUB_ENV
+      - run: ./autogen.sh
+        working-directory: src
+
+      - uses: ruby/setup-ruby@13e7a03dc3ac6c3798f4570bfead2aed4d96abfb # v1.244.0
+        with:
+          ruby-version: '3.0'
+          bundler: none
+
+      - name: Download config.guess with wasi version
+        run: |
+          rm tool/config.guess tool/config.sub
+          ruby tool/downloader.rb -d tool -e gnu config.guess config.sub
+        working-directory: src
+
+      - name: Run configure
+        run: |
+          ../src/configure \
+            --host wasm32-unknown-wasi \
+            --with-static-linked-ext \
+            LDFLAGS=" \
+              -Xlinker --stack-first \
+              -Xlinker -z -Xlinker stack-size=16777216 \
+            " \
+            optflags="${{ matrix.entry.optflags }}" \
+            debugflags="${{ matrix.entry.debugflags }}" \
+            wasmoptflags="${{ matrix.entry.wasmoptflags }} ${{ matrix.entry.debugflags }}"
+
+      # miniruby may not be built when cross-compling
+      - run: make mini ruby
+      - name: Run basictest
+        run: wasmtime run ./../build/miniruby --mapdir /::./ -- basictest/test.rb
+        working-directory: src
+      - name: Run bootstraptest (no thread)
+        run: |
+          NO_THREAD_TESTS="$(grep -L Thread -R ./bootstraptest | awk -F/ '{ print $NF }' | uniq | sed -n 's/test_\(.*\).rb/\1/p' | paste -s -d, -)"
+          ruby ./bootstraptest/runner.rb --ruby="$(which wasmtime) run $PWD/../build/ruby --mapdir /::./ -- " --verbose "--sets=$NO_THREAD_TESTS"
+        working-directory: src
+
+      - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+        with:
+          payload: |
+            {
+              "ci": "GitHub Actions",
+              "env": "${{ github.workflow }} / ${{ matrix.name }}",
+              "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+              "commit": "${{ github.sha }}",
+              "branch": "${{ github.ref_name }}"
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/windows.yml b/.github/workflows/windows.yml
new file mode 100644
index 0000000000..c2bd4881c2
--- /dev/null
+++ b/.github/workflows/windows.yml
@@ -0,0 +1,149 @@
+name: Windows
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  merge_group:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - vs: 2022
+            vcvers: -vcvars_ver=14.2
+      fail-fast: false
+    runs-on: windows-${{ matrix.vs }}
+    if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+    name: VisualStudio ${{ matrix.vs }}
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+      PATCH: C:\msys64\usr\bin\patch.exe
+      OS_VER: windows-${{ matrix.vs }}
+    steps:
+      - run: md build
+        working-directory:
+      - uses: msys2/setup-msys2@61f9e5e925871ba6c9e3e8da24ede83ea27fa91f # v2.27.0
+        id: setup-msys2
+        with:
+          update: true
+          install: bison patch
+      - name: patch path
+        shell: msys2 {0}
+        run: echo PATCH=$(cygpath -wa $(command -v patch)) >> $GITHUB_ENV
+        if: ${{ steps.setup-msys2.outcome == 'success' }}
+      - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+        with:
+          path: C:\vcpkg\installed
+          key: ${{ runner.os }}-vcpkg-installed-windows-${{ matrix.vs }}-${{ github.sha }}
+          restore-keys: |
+            ${{ runner.os }}-vcpkg-installed-windows-${{ matrix.vs }}-
+            ${{ runner.os }}-vcpkg-installed-windows-
+      - name: Install libraries with vcpkg
+        run: |
+          iex "& {$(irm get.scoop.sh)} -RunAsAdmin"
+          Join-Path (Resolve-Path ~).Path "scoop\shims" >> $Env:GITHUB_PATH
+          scoop install cmake@3.31.6
+          vcpkg --triplet x64-windows install libffi libyaml openssl readline zlib
+        shell:
+          pwsh
+      - name: git config
+        run: |
+          git config --global core.autocrlf false
+          git config --global core.eol lf
+          git config --global advice.detachedHead 0
+          git config --global init.defaultBranch garbage
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+        with:
+          path: src
+      - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+        with:
+          path: src/.downloaded-cache
+          key: downloaded-cache
+      - name: setup env
+        # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
+        # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
+        # msys2/setup-msys2 installs MSYS2 to D:/a/_temp/msys64/usr/bin
+        run: |
+          set Path=D:/a/_temp/msys64/usr/bin;%Path%
+          if not "%VCVARS%" == "" goto :vcset
+            set VCVARS="C:\Program Files (x86)\Microsoft Visual Studio\${{ matrix.vs }}\Enterprise\VC\Auxiliary\Build\vcvars64.bat"
+            if not exist %VCVARS% set VCVARS="C:\Program Files\Microsoft Visual Studio\${{ matrix.vs }}\Enterprise\VC\Auxiliary\Build\vcvars64.bat"
+          :vcset
+          set | C:\msys64\usr\bin\sort > old.env
+          call %VCVARS% ${{ matrix.vcvers || ''}}
+          set TMP=%USERPROFILE%\AppData\Local\Temp
+          set TEMP=%USERPROFILE%\AppData\Local\Temp
+          set /a TEST_JOBS=(15 * %NUMBER_OF_PROCESSORS% / 10) > nul
+          set | C:\msys64\usr\bin\sort > new.env
+          C:\msys64\usr\bin\comm -13 old.env new.env >> %GITHUB_ENV%
+          del *.env
+      - name: compiler version
+        run: cl
+      - name: link libraries
+        run: |
+          for %%I in (C:\vcpkg\installed\x64-windows\bin\*.dll) do (
+            if not %%~nI == readline mklink %%~nxI %%I
+          )
+          for %%I in (libcrypto-1_1-x64 libssl-1_1-x64) do (
+            ren c:\Windows\System32\%%I.dll %%I.dll_
+          )
+      - name: Configure
+        run: >-
+          ../src/win32/configure.bat --disable-install-doc
+          --with-opt-dir=C:/vcpkg/installed/x64-windows
+      - run: nmake incs
+      - run: nmake extract-extlibs
+      - run: nmake
+        env:
+          YACC: bison.exe
+      - run: nmake test
+        timeout-minutes: 5
+      - run: nmake test-spec
+        timeout-minutes: 10
+      - run: nmake test-all
+        env:
+          RUBY_TESTOPTS: -j${{env.TEST_JOBS}} --job-status=normal
+        timeout-minutes: 60
+      - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+        with:
+          payload: |
+            {
+              "ci": "GitHub Actions",
+              "env": "VS${{ matrix.vs }} / ${{ matrix.test_task || 'check' }}",
+              "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+              "commit": "${{ github.sha }}",
+              "branch": "${{ github.ref_name }}"
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+  run:
+    working-directory: build
+    shell: cmd
diff --git a/.github/workflows/yjit-ubuntu.yml b/.github/workflows/yjit-ubuntu.yml
new file mode 100644
index 0000000000..0b7b9046e9
--- /dev/null
+++ b/.github/workflows/yjit-ubuntu.yml
@@ -0,0 +1,170 @@
+name: YJIT Ubuntu
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+  merge_group:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  cargo:
+    name: Rust cargo test
+    # GitHub Action's image seems to already contain a Rust 1.58.0.
+    runs-on: ubuntu-22.04
+    steps:
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+      # For now we can't run cargo test --offline because it complains about the
+      # capstone dependency, even though the dependency is optional
+      #- run: cargo test --offline
+      - run: RUST_BACKTRACE=1 cargo test
+        working-directory: yjit
+      # Also compile and test with all features enabled
+      - run: RUST_BACKTRACE=1 cargo test --all-features
+        working-directory: yjit
+      # Check that we can build in release mode too
+      - run: cargo build --release
+        working-directory: yjit
+  make:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - test_task: 'yjit-bindgen'
+            hint: 'To fix: use patch in logs'
+            configure: '--with-gcc=clang-14 --enable-yjit=dev'
+            libclang_path: '/usr/lib/llvm-14/lib/libclang.so.1'
+
+          - test_task: "check"
+            # YJIT should be automatically built in release mode on x86-64 Linux with rustc present
+            #configure: "--enable-yjit RUSTC='rustc +1.58.0'"
+            configure: "RUSTC='rustc +1.58.0'"
+            rust_version: "1.58.0"
+
+          - test_task: "check"
+            configure: "--enable-yjit=dev"
+
+          - test_task: "check"
+            configure: "--enable-yjit=dev"
+            yjit_opts: "--yjit-call-threshold=1 --yjit-verify-ctx"
+
+          - test_task: "test-all TESTS=--repeat-count=2"
+            configure: "--enable-yjit=dev"
+
+          - test_task: "test-bundled-gems"
+            configure: "--enable-yjit=dev"
+
+          - test_task: "yjit-bench"
+            configure: "--enable-yjit=dev"
+            yjit_bench_opts: "--yjit-stats"
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+      RUN_OPTS: ${{ matrix.yjit_opts }}
+      YJIT_BENCH_OPTS: ${{ matrix.yjit_bench_opts }}
+      RUBY_DEBUG: ci
+      BUNDLE_JOBS: 8 # for yjit-bench
+    runs-on: ubuntu-22.04
+    if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+    steps:
+      - run: mkdir build
+        working-directory:
+      - name: Install libraries
+        run: |
+          set -x
+          sudo apt-get update -q || :
+          sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+      - name: Install Rust
+        if: ${{ matrix.rust_version }}
+        run: rustup install ${{ matrix.rust_version }} --profile minimal
+      - name: git config
+        run: |
+          git config --global advice.detachedHead 0
+          git config --global init.defaultBranch garbage
+      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+        with:
+          path: src
+      - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+        with:
+          path: src/.downloaded-cache
+          key: downloaded-cache
+      - name: Fixed world writable dirs
+        run: |
+          chmod -v go-w $HOME $HOME/.config
+          sudo chmod -R go-w /usr/share
+          sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+      - name: Set ENV
+        run: |
+          echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+      - run: ./autogen.sh
+        working-directory: src
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install ${{ matrix.configure }}
+      - run: make incs
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+      - run: make -j
+      - run: make leaked-globals
+        if: ${{ matrix.test_task == 'check' }}
+      - name: Create dummy files in build dir
+        run: |
+          ./miniruby -e '(("a".."z").to_a+("A".."Z").to_a+("0".."9").to_a+%w[foo bar test zzz]).each{|basename|File.write("#{basename}.rb", "raise %(do not load #{basename}.rb)")}'
+        if: ${{ matrix.test_task == 'check' }}
+      - name: Enable YJIT through ENV
+        run: echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
+      # Check that the binary was built with YJIT
+      - name: Check YJIT enabled
+        run: ./miniruby --yjit -v | grep "+YJIT"
+      - name: make ${{ matrix.test_task }}
+        run: make -s -j ${{ matrix.test_task }} RUN_OPTS="$RUN_OPTS" YJIT_BENCH_OPTS="$YJIT_BENCH_OPTS"
+        timeout-minutes: 60
+        env:
+          RUBY_TESTOPTS: "-q --tty=no"
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ""
+          PRECHECK_BUNDLED_GEMS: "no"
+          LIBCLANG_PATH: ${{ matrix.libclang_path }}
+        continue-on-error: ${{ matrix.test_task == 'yjit-bench' }}
+      - name: Show ${{ github.event.pull_request.base.ref }} GitHub URL for yjit-bench comparison
+        run: echo "https://github.com/${BASE_REPO}/commit/${BASE_SHA}"
+        env:
+          BASE_REPO: ${{ github.event.pull_request.base.repo.full_name }}
+          BASE_SHA: ${{ github.event.pull_request.base.sha }}
+        if: ${{ matrix.test_task == 'yjit-bench' && startsWith(github.event_name, 'pull') }}
+      - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+        with:
+          payload: |
+            {
+              "ci": "GitHub Actions",
+              "env": "${{ github.workflow }} / ${{ matrix.test_task }} ${{ matrix.configure }}",
+              "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+              "commit": "${{ github.sha }}",
+              "branch": "${{ github.ref_name }}"
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.gitignore b/.gitignore
index 0656e17945..99d32a1825 100644
--- a/.gitignore
+++ b/.gitignore
@@ -3,34 +3,54 @@
 *-*-*.lib
 *.a
 *.bak
+*.bc
+*.bundle
 *.dSYM
 *.dmyh
 *.dylib
 *.elc
+*.i
+*.ii
 *.inc
 *.log
 *.o
+*.o.tmp
 *.obj
+*.old
 *.orig
+*.pch
 *.pdb
+*.rbinc
 *.rej
+*.s
 *.sav
+*.sl
+*.so
+*.so.*
 *.swp
+*.yarb
 *~
-.*-*
 .*.list
 .*.time
 .DS_Store
+.bundle
 .ccmalloc
 .ext
 .pc
 .ppack
 .svn
+.time
+.ruby-version
 Makefile
-Makefile.old
+cygruby*.def
 extconf.h
 y.output
 y.tab.c
+*.gcda
+*.gcno
+*.gcov
+*.vscode
+lcov*.info
 
 # /
 /*-fake.rb
@@ -40,13 +60,13 @@ y.tab.c
 /*.pc
 /*.rc
 /*_prelude.c
+/.downloaded-cache
+/.top-enc.mk
+/build*/
 /COPYING.LIB
-/ChangeLog-*
-/ChangeLog.pre-alpha
-/ChangeLog.pre1_1
+/ChangeLog
 /Doxyfile
 /GNUmakefile
-/GNUmakefile.old
 /README.atheos
 /README.fat-patch
 /README.v6
@@ -54,6 +74,7 @@ y.tab.c
 /archive
 /autom4te*.cache
 /automake
+/benchmark/benchmark-driver
 /beos
 /bmlog-*
 /breakpoints.gdb
@@ -64,6 +85,8 @@ y.tab.c
 /config.status.lineno
 /configure
 /coverage/simplecov
+/coverage/simplecov-html
+/coverage/doclie
 /coverage/.last_run.json
 /coverage/.resultset.json*
 /coverage/assets
@@ -75,6 +98,9 @@ y.tab.c
 /goruby
 /id.[ch]
 /largefile.h
+/lcov-c-out
+/lcov-rb-out
+/lcov-out
 /lex.c
 /libruby*.*
 /miniprelude.c
@@ -90,27 +116,42 @@ y.tab.c
 /ppack
 /prelude.c
 /preview
+/probes.dmyh
 /probes.h
 /rbconfig.rb
 /rename2.h
 /repack
 /revision.h
+/revision.tmp
 /riscos
 /rubicon
 /ruby
+/ruby-runner
+/ruby-runner.h
 /ruby-man.rd.gz
+/rubyspec_temp
+/run.gdb
 /sizes.c
+/static-ruby
 /test.rb
+/test-coverage.dat
 /tmp
 /transdb.h
 /uncommon.mk
 /verconf.h
 /verconf.mk
-/version.i
 /web
 /yasmdata.rb
 
+# /bin/
+
+/bin/*.exe
+/bin/*.dll
+/bin/goruby
+/bin/ruby
+
 # /benchmark/
+/benchmark/bm_require.data
 /benchmark/bmx_*.rb
 /benchmark/fasta.output.*
 /benchmark/wc.input
@@ -118,25 +159,37 @@ y.tab.c
 /enc/*.def
 /enc/*.exp
 /enc/*.lib
+/enc/jis/props.h
 /enc/unicode/data
 
+# /coroutine/
+!/coroutine/**/*.s
+
 # /enc/trans/
 /enc/trans/*.c
 /enc/trans/*.def
 /enc/trans/*.exp
 /enc/trans/*.lib
-/enc/trans/.time
+
+# /exe/
+/exe/goruby
+/exe/ruby
 
 # /ext/
 /ext/extinit.c
+/ext/configure-ext.mk
+/ext/*/exts.mk
+
+# /ext/-test-/cxxanyargs
+/ext/-test-/cxxanyargs/failure*.failed
 
 # /ext/-test-/win32/dln/
+/ext/-test-/win32/dln/dlntest.dll
 /ext/-test-/win32/dln/dlntest.exp
 /ext/-test-/win32/dln/dlntest.lib
 
-# /ext/dl/callback/
-/ext/dl/callback/callback-*.c
-/ext/dl/callback/callback.c
+# /ext/-test-/gems
+/ext/-test-/gems
 
 # /ext/etc/
 /ext/etc/constdefs.h
@@ -146,9 +199,11 @@ y.tab.c
 
 # /ext/rbconfig/
 /ext/rbconfig/sizeof/sizes.c
+/ext/rbconfig/sizeof/limits.c
 
 # /ext/ripper/
 /ext/ripper/eventids1.c
+/ext/ripper/.eventids2-check
 /ext/ripper/eventids2table.c
 /ext/ripper/ripper.*
 /ext/ripper/ids1
@@ -159,15 +214,20 @@ y.tab.c
 /ext/socket/constdefs.h
 /ext/socket/constdefs.c
 
-# /ext/tk/
-/ext/tk/config_list
-
 # /gems
 /gems/*.gem
+/gems/src
+/gems/*-*
 
-# /spec/
-/spec/mspec
-/spec/rubyspec
+# /lib/
+/lib/ruby/[1-9]*.*
+/lib/ruby/vendor_ruby
+
+# /misc/
+/misc/**/__pycache__
+
+# /spec/bundler
+/.rspec_status
 
 # /tool/
 /tool/config.guess
@@ -175,4 +235,16 @@ y.tab.c
 
 # /win32/
 /win32/*.ico
-/win32/.time
+
+# MJIT
+/include/ruby-*/*/rb_mjit_min_header-*.h
+/lib/ruby_vm/mjit/instruction.rb
+/mjit_config.h
+/rb_mjit_header.h
+
+# YJIT
+/yjit-bench
+/yjit_exit_locations.dump
+
+# /wasm/
+/wasm/tests/*.wasm
diff --git a/.indent.pro b/.indent.pro
index 6a207a0554..1d61cbcad1 100644
--- a/.indent.pro
+++ b/.indent.pro
@@ -2,12 +2,15 @@
 -nbbb
 -nbc
 -br
+-brs
 -nbs
 -ncdb
--ce
--cli0.5
+-nce
+-cdw
+-cli2
+-cbi2
 -ndj
--ei
+-ncs
 -nfc1
 -i4
 -l120
@@ -16,6 +19,14 @@
 -psl
 -sc
 -sob
+-sbi4
+-nut
+-par
 
 -TID
 -TVALUE
+-Tst_data_t
+-Tst_index_t
+-Tst_table
+-Trb_data_type_t
+-TFILE
diff --git a/.rdoc_options b/.rdoc_options
new file mode 100644
index 0000000000..760507c7a2
--- /dev/null
+++ b/.rdoc_options
@@ -0,0 +1,4 @@
+---
+page_dir: doc
+main_page: README.md
+title: Documentation for Ruby development version
diff --git a/.rspec_parallel b/.rspec_parallel
new file mode 100644
index 0000000000..aaff198a32
--- /dev/null
+++ b/.rspec_parallel
@@ -0,0 +1,2 @@
+--format progress
+--format ParallelTests::RSpec::RuntimeLogger --out tmp/parallel_runtime_rspec.log
diff --git a/.travis.yml b/.travis.yml
deleted file mode 100644
index 992f40fa10..0000000000
--- a/.travis.yml
+++ /dev/null
@@ -1,111 +0,0 @@
-# Copyright (C) 2011 Urabe, Shyouhei.  All rights reserved.
-#
-# This file is  a part of the programming language  Ruby.  Permission is hereby
-# granted,  to either  redistribute  or  modify this  file,  provided that  the
-# conditions  mentioned in  the file  COPYING are  met.  Consult  the  file for
-# details.
-
-# This is  a Travis-CI  build configuration file.   The list  of configurations
-# available is located in
-#
-#     http://about.travis-ci.org/docs/user/build-configuration/
-#
-# and as Ruby itself is a project written in C language,
-#
-#     http://about.travis-ci.org/docs/user/languages/c/
-#
-# is also a good place to look at.
-
-# Language specification.
-language: c
-
-# Compilers.  Several  compilers are  provided in Travis,  so we try  them all.
-# The value set here is visible via $CC environment variable.
-compiler:
-  - gcc
-  - clang
-
-os:
-  - linux
-  - osx
-
-# Dependencies.  Some  header files are missing  in a Travis' worker  VM, so we
-# have  to install  them.  The  "1.9.1" here  is OK.   It is  the  most adopted
-# version string  for Debian/Ubuntu, and  no dependencies have been  changed so
-# far since the 1.9.1 release.
-before_install:
-  - "CONFIG_FLAG="
-  - "if [[ $TRAVIS_OS_NAME = 'linux' ]]; then sudo apt-get -qq update; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'linux' ]]; then sudo apt-get -qq install $CC; fi" # upgrade if any
-  - "if [[ $TRAVIS_OS_NAME = 'linux' ]]; then JOBS='-j'; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then brew install autoconf gdbm openssl; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then CONFIG_FLAG=\"$CONFIG_FLAG --with-gdbm-dir=`brew --prefix gdbm`\"; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then CONFIG_FLAG=\"$CONFIG_FLAG --with-openssl-dir=`brew --prefix openssl`\"; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' && $CC = 'gcc' ]]; then CC='gcc-4.9'; fi"
-install: "if [[ $TRAVIS_OS_NAME = 'linux' ]]; then sudo apt-get -qq build-dep ruby1.9.1 2>/dev/null; fi"
-
-# Script is where the test runs.  Note  we just do "make test", not other tests
-# like  test-all, test-rubyspec.   This is  because  they take  too much  time,
-# enough for Travis to shut down the VM as being stalled.
-before_script:
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then rm -f ~/Library/Logs/DiagnosticReports/ruby_*.crash; fi"
-  - "uname -a"
-  - "uname -r"
-  - "rm -fr .ext autom4te.cache"
-  - "make -f common.mk BASERUBY=ruby MAKEDIRS='mkdir -p' srcdir=. update-config_files"
-  - "autoconf"
-  - "mkdir config_1st config_2nd"
-  - "./configure -C --disable-install-doc --with-gcc=$CC $CONFIG_FLAG"
-  - "cp -pr config.status .ext/include config_1st"
-  - "make reconfig"
-  - "cp -pr config.status .ext/include config_2nd"
-  - "diff -ru config_1st config_2nd"
-  - "make -s $JOBS encs"
-  - "make -s $JOBS exts"
-  - "make update-rubyspec"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then echo 'exclude :test_deadlock_by_signal_at_forking, \"under investigation\"' >> test/excludes/TestProcess.rb; fi"
-script:
-  - "make test"
-  - "make test-all TESTOPTS='-q -j2'"
-  - "make test-rubyspec"
-after_failure:
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then find ~/Library/Logs/DiagnosticReports -type f -name ruby_\\*.crash -ls -execdir cat {} \\; -delete; fi"
-
-# Branch matrix.  Not all branches are Travis-ready so we limit branches here.
-branches:
-  only:
-    - trunk
-    - ruby_2_0_0
-    - ruby_2_1
-    - ruby_2_2
-
-# We want to be notified when something happens.
-notifications:
-  irc:
-    channels:
-      - "irc.freenode.org#ruby-core"
-      - "irc.freenode.org#ruby-ja"
-    on_success: change # [always|never|change] # default: always
-    on_failure: change # [always|never|change] # default: always
-    template:
-      - "%{message} by @%{author}: See %{build_url}"
-
-  # Update ruby-head installed on Travis CI so other projects can test against it.
-  webhooks:
-    urls:
-      - "https://rubies.travis-ci.org/rebuild/ruby-head"
-    on_success: always
-    on_failure: never
-
-  email:
-    - ko1c-failure@atdot.net
-    - shibata.hiroshi@gmail.com
-
-# Local Variables:
-# mode: YAML
-# coding: utf-8-unix
-# indent-tabs-mode: nil
-# tab-width: 4
-# fill-column: 79
-# default-justification: full
-# End:
diff --git a/BSDL b/BSDL
index a009caefea..66d93598aa 100644
--- a/BSDL
+++ b/BSDL
@@ -4,10 +4,10 @@ Redistribution and use in source and binary forms, with or without
 modification, are permitted provided that the following conditions
 are met:
 1. Redistributions of source code must retain the above copyright
-notice, this list of conditions and the following disclaimer.
+   notice, this list of conditions and the following disclaimer.
 2. Redistributions in binary form must reproduce the above copyright
-notice, this list of conditions and the following disclaimer in the
-documentation and/or other materials provided with the distribution.
+   notice, this list of conditions and the following disclaimer in the
+   documentation and/or other materials provided with the distribution.
 
 THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
 ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
index ffdf2dd4b8..13df6087ca 100644
--- a/CONTRIBUTING.md
+++ b/CONTRIBUTING.md
@@ -1,4 +1 @@
-Please see the [official issue tracker] and wiki [HowToContribute].
-
-[official issue tracker]: https://bugs.ruby-lang.org
-[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing_md.html), which includes setup and build instructions.
diff --git a/COPYING b/COPYING
index a1f19ff99d..48e5a96de7 100644
--- a/COPYING
+++ b/COPYING
@@ -2,55 +2,55 @@ Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
 You can redistribute it and/or modify it under either the terms of the
 2-clause BSDL (see the file BSDL), or the conditions below:
 
-  1. You may make and give away verbatim copies of the source form of the
-     software without restriction, provided that you duplicate all of the
-     original copyright notices and associated disclaimers.
+1. You may make and give away verbatim copies of the source form of the
+   software without restriction, provided that you duplicate all of the
+   original copyright notices and associated disclaimers.
 
-  2. You may modify your copy of the software in any way, provided that
-     you do at least ONE of the following:
+2. You may modify your copy of the software in any way, provided that
+   you do at least ONE of the following:
 
-       a) place your modifications in the Public Domain or otherwise
-          make them Freely Available, such as by posting said
-	  modifications to Usenet or an equivalent medium, or by allowing
-	  the author to include your modifications in the software.
+   a. place your modifications in the Public Domain or otherwise
+      make them Freely Available, such as by posting said
+      modifications to Usenet or an equivalent medium, or by allowing
+      the author to include your modifications in the software.
 
-       b) use the modified software only within your corporation or
-          organization.
+   b. use the modified software only within your corporation or
+      organization.
 
-       c) give non-standard binaries non-standard names, with
-          instructions on where to get the original software distribution.
+   c. give non-standard binaries non-standard names, with
+      instructions on where to get the original software distribution.
 
-       d) make other distribution arrangements with the author.
+   d. make other distribution arrangements with the author.
 
-  3. You may distribute the software in object code or binary form,
-     provided that you do at least ONE of the following:
+3. You may distribute the software in object code or binary form,
+   provided that you do at least ONE of the following:
 
-       a) distribute the binaries and library files of the software,
-	  together with instructions (in the manual page or equivalent)
-	  on where to get the original distribution.
+   a. distribute the binaries and library files of the software,
+      together with instructions (in the manual page or equivalent)
+      on where to get the original distribution.
 
-       b) accompany the distribution with the machine-readable source of
-	  the software.
+   b. accompany the distribution with the machine-readable source of
+      the software.
 
-       c) give non-standard binaries non-standard names, with
-          instructions on where to get the original software distribution.
+   c. give non-standard binaries non-standard names, with
+      instructions on where to get the original software distribution.
 
-       d) make other distribution arrangements with the author.
+   d. make other distribution arrangements with the author.
 
-  4. You may modify and include the part of the software into any other
-     software (possibly commercial).  But some files in the distribution
-     are not written by the author, so that they are not under these terms.
+4. You may modify and include the part of the software into any other
+   software (possibly commercial).  But some files in the distribution
+   are not written by the author, so that they are not under these terms.
 
-     For the list of those files and their copying conditions, see the
-     file LEGAL.
+   For the list of those files and their copying conditions, see the
+   file LEGAL.
 
-  5. The scripts and library files supplied as input to or produced as 
-     output from the software do not automatically fall under the
-     copyright of the software, but belong to whomever generated them, 
-     and may be sold commercially, and may be aggregated with this
-     software.
+5. The scripts and library files supplied as input to or produced as
+   output from the software do not automatically fall under the
+   copyright of the software, but belong to whomever generated them,
+   and may be sold commercially, and may be aggregated with this
+   software.
 
-  6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
-     IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
-     WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-     PURPOSE.
+6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+   IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+   WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+   PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
index e50d01c8d1..230376bc60 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -2,50 +2,50 @@
 または以下に示す条件で本プログラムを再配布できます
 2-clause BSDLについてはBSDLファイルを参照して下さい．
 
-  1. 複製は制限なく自由です．
+1. 複製は制限なく自由です．
 
-  2. 以下の条件のいずれかを満たす時に本プログラムのソースを
-     自由に変更できます．
+2. 以下の条件のいずれかを満たす時に本プログラムのソースを
+   自由に変更できます．
 
-     (a) ネットニューズにポストしたり，作者に変更を送付する
-         などの方法で，変更を公開する．
+   a.  ネットニューズにポストしたり，作者に変更を送付する
+       などの方法で，変更を公開する．
 
-     (b) 変更した本プログラムを自分の所属する組織内部だけで
-         使う．
+   b.  変更した本プログラムを自分の所属する組織内部だけで
+       使う．
 
-     (c) 変更点を明示したうえ，ソフトウェアの名前を変更する．
-         そのソフトウェアを配布する時には変更前の本プログラ
-         ムも同時に配布する．または変更前の本プログラムのソー
-         スの入手法を明示する．
+   c.  変更点を明示したうえ，ソフトウェアの名前を変更する．
+       そのソフトウェアを配布する時には変更前の本プログラ
+       ムも同時に配布する．または変更前の本プログラムのソー
+       スの入手法を明示する．
 
-     (d) その他の変更条件を作者と合意する．
+   d.  その他の変更条件を作者と合意する．
 
-  3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
-     ルしたオブジェクトコードや実行形式でも配布できます．
+3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
+   ルしたオブジェクトコードや実行形式でも配布できます．
 
-     (a) バイナリを受け取った人がソースを入手できるように，
-         ソースの入手法を明示する．
+   a.  バイナリを受け取った人がソースを入手できるように，
+       ソースの入手法を明示する．
 
-     (b) 機械可読なソースコードを添付する．
+   b.  機械可読なソースコードを添付する．
 
-     (c) 変更を行ったバイナリは名前を変更したうえ，オリジナ
-         ルのソースコードの入手法を明示する．
+   c.  変更を行ったバイナリは名前を変更したうえ，オリジナ
+       ルのソースコードの入手法を明示する．
 
-     (d) その他の配布条件を作者と合意する．
+   d.  その他の配布条件を作者と合意する．
 
-  4. 他のプログラムへの引用はいかなる目的であれ自由です．た
-     だし，本プログラムに含まれる他の作者によるコードは，そ
-     れぞれの作者の意向による制限が加えられる場合があります．
+4. 他のプログラムへの引用はいかなる目的であれ自由です．た
+   だし，本プログラムに含まれる他の作者によるコードは，そ
+   れぞれの作者の意向による制限が加えられる場合があります．
 
-     それらファイルの一覧とそれぞれの配布条件などに付いては
-     LEGALファイルを参照してください．
+   それらファイルの一覧とそれぞれの配布条件などに付いては
+   LEGALファイルを参照してください．
 
-  5. 本プログラムへの入力となるスクリプトおよび，本プログラ
-     ムからの出力の権利は本プログラムの作者ではなく，それぞ
-     れの入出力を生成した人に属します．また，本プログラムに
-     組み込まれるための拡張ライブラリについても同様です．
+5. 本プログラムへの入力となるスクリプトおよび，本プログラ
+   ムからの出力の権利は本プログラムの作者ではなく，それぞ
+   れの入出力を生成した人に属します．また，本プログラムに
+   組み込まれるための拡張ライブラリについても同様です．
 
-  6. 本プログラムは無保証です．作者は本プログラムをサポート
-     する意志はありますが，プログラム自身のバグあるいは本プ
-     ログラムの実行などから発生するいかなる損害に対しても責
-     任を持ちません．
+6. 本プログラムは無保証です．作者は本プログラムをサポート
+   する意志はありますが，プログラム自身のバグあるいは本プ
+   ログラムの実行などから発生するいかなる損害に対しても責
+   任を持ちません．
diff --git a/ChangeLog b/ChangeLog
deleted file mode 100644
index bda2481738..0000000000
--- a/ChangeLog
+++ /dev/null
@@ -1,6317 +0,0 @@
-Tue Jul 21 19:43:20 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* compile.c: constify the first parameter (iseq).
-	  * iseq_add_mark_object()
-	  * iseq_add_mark_object_compile_time()
-
-	* iseq.c, iseq.h (rb_iseq_add_mark_object): ditto.
-
-Tue Jul 21 16:18:48 2015  Eric Wong  <e@80x24.org>
-
-	* test/socket/test_nonblock.rb: increase buffer sizes
-	  to OpenBSD limits. Thanks to Jeremy Evans <code@jeremyevans.net>
-	  [ruby-core:70058]
-
-Tue Jul 21 16:08:53 2015  Eric Wong  <e@80x24.org>
-
-	* load.c (ruby_dln_librefs): make static
-
-Tue Jul 21 13:36:54 2015  yuuji.yaginuma  <yuuji.yaginuma@gmail.com>
-
-	* lib/optparse.rb (complete): [DOC] fix typo.  [Fix GH-973]
-
-Tue Jul 21 05:20:21 2015  Eric Wong  <e@80x24.org>
-
-	* io.c (nogvl_wait_for_single_fd): new function for Linux
-	  (maygvl_copy_stream_wait_read): Linux-specific version
-	  (nogvl_copy_stream_wait_write): use nogvl_wait_for_single_fd
-	  [ruby-core:70051] [Feature #11377]
-
-Mon Jul 20 15:04:30 2015  Eric Wong  <e@80x24.org>
-
-	* parse.y (parser_initialize): avoid redundant zero-ing
-
-Mon Jul 20 12:12:05 2015  Eric Wong  <e@80x24.org>
-
-	* parse.y (struct parser_params): pack: 88 => 256 bytes on 64-bit
-	  [ruby-core:70034] [Feature #11371]
-
-Sun Jul 19 14:29:18 2015  windwiny  <windwiny.ubt@gmail.com>
-
-	* ext/pty/pty.c: [DOC] fix example typo, an old name at move from
-	  PTY.open.  [Fix GH-972]
-
-Sat Jul 18 21:29:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* thread.c (vm_check_ints_blocking): gather common statements at
-	  the end, and prefer LIKELY for Visual C optimization.
-
-Sat Jul 18 20:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* load.c (rb_load_internal0): do not raise any exceptions but
-	  return the result tag state.
-
-	* load.c (rb_load_protect): reduce nested EXEC_TAGs.
-
-Sat Jul 18 19:52:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (run_finalizer): set and restore safe level here to reduce
-	  nested EXEC_TAGs.
-
-Sat Jul 18 18:45:22 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (ruby_cleanup): error_handle() returns exit status to the
-	  system, not internal error state, do not convert the exit status
-	  again.
-
-Sat Jul 18 10:29:03 2015  Eric Wong  <e@80x24.org>
-
-	* test/ruby/test_process.rb: test thread+sigs work after failed exec
-
-Sat Jul 18 07:20:18 2015  Jeremy Evans  <code@jeremyevans.net>
-
-	* test/socket/test_nonblock: use smaller buffer for sendmsg
-	  [ruby-core:70016] [Bug #11364]
-
-Sat Jul 18 07:04:24 2015  Eric Wong  <e@80x24.org>
-
-	* signal.c (trap_handler): cleanup to use RSTRING_GETMEM + memcmp
-
-Sat Jul 18 02:53:06 2015  Eric Wong  <e@80x24.org>
-
-	* io.c (argf_read_nonblock): support `exception: false'
-	  (io_nonblock_eof): new function
-	  (io_read_nonblock): use io_nonblock_eof
-	  (argf_getpartial): accept kwargs hash for `exception: false'
-	* test/ruby/test_argf.rb (test_read_nonblock): new test
-	* NEWS: add item for ARGF.read_nonblock
-	  [ruby-core:70000] [Feature #11358]
-
-Fri Jul 17 23:51:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (rb_eval_cmd): $SAFE=4 has been deprecated.
-
-Fri Jul 17 22:18:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* compile.c (iseq_compile_each): use enum ruby_tag_type names.
-
-	* vm_core.h (ruby_tag_type): move from eval_intern.h for compiling
-	  break/next/redo/return.
-
-Fri Jul 17 15:39:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/encoding.h (ENC_CODERANGE_CLEAN_P): predicate that
-	  tells if the coderange is clean, that is 7bit or valid, and no
-	  needs to scrub.
-
-	* re.c (rb_reg_expr_str): use ENC_CODERANGE_CLEAN_P.
-
-	* string.c (enc_strlen, rb_enc_cr_str_buf_cat, rb_str_scrub):
-	  ditto.
-
-	* string.c (rb_str_enumerate_chars): ditto, and suppress a warning
-	  by gcc6.
-
-Fri Jul 17 15:36:52 2015  yui-knk  <spiketeika@gmail.com>
-
-	* test/ruby/test_range.rb (test_first_last): Add test for
-	  `Range.new`.  [Fix GH-971]
-
-Fri Jul 17 15:36:40 2015  yui-knk  <spiketeika@gmail.com>
-
-	* test/ruby/test_range.rb (test_first_last): Add assertions to
-	  test of `Range#last` with exclude_end true case.  [Fix GH-970]
-
-Fri Jul 17 09:59:14 2015  Eric Wong  <e@80x24.org>
-
-	* thread.c (rb_thread_alone): simplify
-
-Fri Jul 17 09:58:32 2015  Eric Wong  <e@80x24.org>
-
-	* lib/rinda/tuplespace.rb: remove enumerator require
-	* test/pathname/test_pathname.rb: ditto
-
-Fri Jul 17 05:33:58 2015  Eric Wong  <e@80x24.org>
-
-	* iseq.c (rb_iseq_compile_with_option): reuse result of previous
-	  GET_THREAD() call
-	* thread.c (thread_create_core): ditto
-	  (rb_mutex_trylock): ditto
-	  (rb_mutex_lock): ditto
-	* process.c (rb_waitpid): avoid multiple eval from RUBY_VM_CHECK_INTS
-	* thread.c (rb_thread_check_ints): ditto
-
-Thu Jul 16 19:12:30 2015  Eric Wong  <e@80x24.org>
-
-	* thread.c (mutex_alloc): remove needless volatile
-
-Thu Jul 16 22:05:29 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: constify rb_iseq_t::parent_iseq.
-
-	  rb_iseq_t::local_iseq is not constant data because
-	  local_iseq::flip_cnt can be modified (commented).
-
-	* compile.c: catch up this fix.
-
-	* iseq.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-Thu Jul 16 21:47:47 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* process.c (redirect_dup2): when the new FD of dup2() conflicts
-	  with one of the timer thread FDs, the internal FD is diverted.
-	  [Bug #11336] [ruby-core:69886] [Bug #11350] [ruby-core:69961]
-
-	* process.c (dup2_with_divert): new function for the above purpose.
-
-	* thread_pthread.c (rb_divert_reserved_fd): new function for
-	  diverting reserved FD. If the given FD is the same as one of the
-	  reserved FDs, the reserved FD number is internally changed.
-	  It returns -1 when error. Otherwise, returns 0. It also returns
-	  0 if there is no need to change reserved FD number.
-
-	* thread_win32.c (rb_divert_reserved_fd): always returns 0 because
-	  of no reserved FDs.
-
-	* internal.h (rb_divert_reserved_fd): prototype declaration.
-	  It is Ruby internal use only.
-
-Thu Jul 16 21:47:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c (rb_iseq_disasm): rename rb_iseq_t *iseqdat to iseq
-	  and VALUE *iseq to code.
-
-	* iseq.c (rb_iseq_disasm_insn): ditto.
-
-Thu Jul 16 14:34:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm.c (REWIND_CFP): keep the arguments region inside the valid
-	  value stack.  [ruby-core:69969] [Bug #11352]
-
-Thu Jul 16 11:38:21 2015  Eric Wong  <e@80x24.org>
-
-	* process.c (close_unless_reserved): declare type of `fd' arg
-
-Thu Jul 16 08:47:29 2015  Eric Wong  <e@80x24.org>
-
-	* load.c (rb_construct_expanded_load_path): fstring expanded path
-	  (get_loaded_features_index): fstring feature path
-	  (rb_provide_feature): ditto
-	  [ruby-core:69871] [Feature #11331]
-
-Thu Jul 16 02:56:14 2015  Eric Wong  <e@80x24.org>
-
-	* thread.c (thread_initialize): avoid RSTRING_PTR and NUMT2INT
-
-Thu Jul 16 01:00:46 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/ruby/test_process.rb (test_exec_close_reserved_fd): test for
-	  [Bug #11353]
-
-Thu Jul 16 00:35:42 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* .gitignore: ignore version.i.
-
-Wed Jul 15 23:40:32 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/ruby/test_process.rb (test_deadlock_by_signal_at_forking):
-	  use RUBY (= EnvUtil.rubybin)
-
-Wed Jul 15 23:01:22 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* process.c (redirect_close, parent_redirect_close): should not close
-	  reserved FD. It should be closed in the exec system call due to the
-	  O_CLOEXEC or FD_CLOEXEC flag. [Bug #11353] [ruby-core:69977]
-
-	* process.c (close_unless_reserved): new function to close FD unless
-	  it is reserved for internal communication.
-
-	* thread_pthread.c (rb_reserved_fd_p): should check owner_process pid
-	  to avoid false positive in forked child process.
-
-Wed Jul 15 18:31:18 2015  Eric Wong  <e@80x24.org>
-
-	* proc.c (proc_mark): remove redundant check
-	* vm.c (env_mark): ditto
-
-Wed Jul 15 17:27:40 2015  Eric Wong  <e@80x24.org>
-
-	* iseq.c (iseq_mark): remove check for data pointer
-	* proc.c (binding_mark): ditto
-	* vm.c (rb_thread_mark): ditto
-	* vm_trace.c (tp_mark): ditto
-
-Wed Jul 15 16:55:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* encoding.c (enc_autoload): drop dummy encoding flag from
-	  the loaded encoding index.  this flag is used only in this
-	  source.
-
-Wed Jul 15 14:39:29 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c (vm_make_env_each): add comments about env layout.
-	  Do not use `i' to specify `new_ep'.
-
-	* vm.c (rb_proc_create, rb_vm_make_proc_lambda): envval is not used.
-
-Wed Jul 15 08:59:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.h (RUBY_MARK_UNLESS_NULL): evaluate the argument only once
-	  to get rid of inadvertent side effects.
-
-Wed Jul 15 02:53:11 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h, vm.c: remove rb_proc_t::envval because we can know it via
-	  rb_proc_t::block::ep.
-
-	  rb_vm_proc_envval(const rb_proc_t *proc) returns an Env object which
-	  the Proc object use.
-
-	* proc.c: catch up this fix.
-
-	* vm_dump.c (rb_vmdebug_proc_dump_raw): ditto.
-
-Wed Jul 15 02:27:22 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h, vm.c: remove rb_env_t::prev_envval because we can know it
-	  via env->ep.
-
-	  rb_vm_env_prev_envval(env) returns prev_envval via env->ep.
-
-	* vm_core.h (rb_vm_env_local_variables): change parameter type
-	  from VALUE (T_DATA/env) to `const rb_env_t *' to make same as
-	  rb_vm_env_prev_envval().
-
-	* proc.c: catch up these changes.
-
-	* vm_dump.c: ditto.
-
-	* vm.c: rename macros.
-
-	  * ENV_IN_HEAP_P() to VM_EP_IN_HEAP_P() because it uses ep.
-	  * ENV_VAL() to VM_ENV_EP_ENVVAL() because it is too short.
-
-Wed Jul 15 01:09:09 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c: refactoring Proc/Env related code.
-
-	* vm_core.h: remove blockprocval field from rb_proc_t and rb_binding_t.
-	  Instead of this field, mark given block in Proc at rb_env_t::env.
-
-	* vm.c (vm_make_env_each): make an Env object with this layout.
-	  And also simplify parameters.
-
-	* proc.c: catch up this fix.
-
-	* vm_core.h: remove rb_env_t::local_size because it is not used.
-
-	* vm_dump.c (rb_vmdebug_env_dump_raw): catch up this fix.
-
-	* vm_core.h (rb_vm_make_env_object): remove rb_vm_make_env_object()
-	  because it is only referred from vm.c.
-
-	* vm_eval.c (eval_string_with_cref): catch up this fix.
-
-Wed Jul 15 00:03:36 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* gc.c (__has_feature): move into internal.h.
-
-	* internal.h (__has_feature): ditto.
-
-	* internal.h (__has_extension): new macro.
-
-	* internal.h (STATIC_ASSERT): use _Static_assert with
-	  clang. [ruby-core:69931] [Bug #11343]
-
-Wed Jul 15 00:00:00 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* random.c (fill_random_bytes_syscall): fix compile error with
-	  clang. [ruby-core:69931] [Bug #11343]
-
-Tue Jul 14 11:22:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#register):
-	  notify the handler thread of new timeout registration.
-
-	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#initialize):
-	  make sleep intervals adaptive than fixed period intervals.
-
-	* lib/webrick/server.rb (WEBrick::GenericServer#start): flush
-	  shutdown pipe.
-
-	* lib/webrick/server.rb (WEBrick::GenericServer#stop): request the
-	  server to stop immediately by sending data via shutdown pipe.
-
-Mon Jul 13 23:58:08 2015  Stefano Tortarolo  <stefano.tortarolo@gmail.com>
-
-	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#do_CONNECT):
-	  fix typos in debugger statements.  [Fix GH-967]
-
-Mon Jul 13 19:11:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/timeout.rb (timeout): warn as deprecated for a long time.
-
-Mon Jul 13 01:37:27 2015  Zachary Scott  <zzak@ruby-lang.org>
-
-	* ext/openssl/ossl.c: [DOC] Backport ruby/openssl@dbb3fdb [Bug #11345]
-	  Thanks to Tomoya Chiba for the report and help with patch.
-
-Sun Jul 12 09:20:02 2015  Shota Fukumori  <her@sorah.jp>
-
-	* ext/socket/basicsocket.c: [DOC] typo (Errno::AGAIN -> Errno::EAGAIN)
-
-	* ext/socket/socket.c: ditto
-
-	* ext/socket/tcpserver.c: ditto
-
-	* ext/socket/udpsocket.c: ditto
-
-	* ext/socket/unixserver.c: ditto
-
-	* io.c: ditto
-
-Sun Jul 12 06:42:23 2015  ksss  <co000ri@gmail.com>
-
-	* test/stringio/test_stringio.rb (test_sysread): add a test for
-	  StringIO#sysread.  [Fix GH-966]
-
-Sat Jul 11 21:16:34 2015  ksss  <co000ri@gmail.com>
-
-	* ext/stringio/stringio.c (Init_stringio): [DOC] Fix an example,
-	  StringIO#puts should be set "\n" at last.  [Fix GH-965]
-
-Sat Jul 11 12:45:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/timeout.rb (Timeout#timeout): remove regexp with wrong line
-	  number and fix caller depth.
-
-Fri Jul 10 22:05:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/timeout.rb (ExitException): removed internal exception class
-	  and use Timeout::Error instead, as using throw/catch to isolate
-	  each timeouts now.  [ruby-dev:49179] [Bug #11344]
-
-Fri Jul 10 17:41:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (is_case_sensitive): get attributes by the file descriptor
-	  of open directory, instead of using mount point name.
-
-Fri Jul 10 10:46:02 2015  ksss  <co000ri@gmail.com>
-
-	* ext/stringio/stringio.c (writable): remove unnecessary check for
-	  deprecated safe level 4.  [Fix GH-963]
-
-Thu Jul  9 15:07:12 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (waitpid): return immediately if interrupted.
-	  reported by <takkanm AT gmail.com> [ruby-dev:49176] [Bug #11340]
-
-Thu Jul  9 13:03:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_search_super_method): use CI_SET_FASTPATH().
-
-Thu Jul  9 11:07:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: remove rb_call_info_t::klass because
-	  rb_callable_method_entry_t has information about defined class.
-
-	* vm_insnhelper.c (vm_search_method): don't set ci->klass because
-	  it is removed.
-
-	* vm_insnhelper.c (rb_equal_opt): ditto.
-
-	* vm_insnhelper.c (vm_search_superclass): removed because it is too
-	  simple to write code directly.
-
-	* vm_insnhelper.c (vm_defined): don't use vm_search_superclass().
-	  This fix avoid searching current callable `me' twice.
-
-	* vm_insnhelper.c (vm_search_super_method): ditto.
-
-Thu Jul  9 10:03:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/net/http/responses.rb: Added 308 status to CODE_TO_OBJ list.
-	  [fix GH-961] Patch by @billinghamj
-
-Thu Jul  9 09:34:14 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h (rb_control_frame_t): fix comments (layout index).
-
-Thu Jul  9 09:25:50 2015  Zachary Scott  <e@zzak.io>
-
-	* parse.y: Improve duplicate key warning with patch by @andremedeiros
-	  [Fix GH-938] https://github.com/ruby/ruby/pull/938 [Bug #11327]
-
-Wed Jul  8 07:43:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/csv.rb: typo fix [ci skip][fix GH-958] Patch by @henrik
-
-Wed Jul  8 04:42:27 2015  Eric Wong  <e@80x24.org>
-
-	* iseq.c (iseq_data_to_ary): dump kw_arg as symbol
-	* test/-ext-/iseq_load/test_iseq_load.rb: test kw_arg roundtrip
-	  [ruby-core:69891] [Bug #11338]
-
-Tue Jul  7 18:18:41 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* random.c (fill_random_bytes_syscall): fix compile error.
-
-Tue Jul  7 16:47:30 2015  Eric Wong  <e@80x24.org>
-
-	* compile.c (COMPILE_ERROR): reduce GET_THREAD() calls
-
-Tue Jul  7 16:39:04 2015  Eric Wong  <e@80x24.org>
-
-	* random.c (fill_random_bytes_syscall): return -1 for error
-	* random.c (fill_random_bytes): try urandom on syscall failure
-
-Tue Jul  7 15:02:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_str_normalize_ospath): skip invalid byte sequence not
-	  to loop infinitely.  this case usually does not happen as the
-	  input name should come from real file systems.
-
-Tue Jul  7 14:40:08 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_backtrace.c: remove debug flag introduced accidentally.
-
-Tue Jul  7 12:05:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* cont.c (cont_free): remove mysterious fflush()
-	  introduced at r19890, maybe accidentally.
-
-Tue Jul  7 11:45:14 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c (rb_method_call): because data->me should be non-NULL,
-	  do not check data->me
-
-	* proc.c (method_inspect): ditto.
-
-Tue Jul  7 11:37:25 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: remove rb_iseq_t::orig because rb_iseq_clone()
-	  no longer exists.
-
-	* iseq.c: don't use rb_iseq_t::orig.
-
-Tue Jul 07 11:25:57 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c, internal.h (rb_iseq_clone): removed because we don't need to
-	  clone iseq any more.
-
-	* class.c (clone_method): share iseq between cloned methods. All of
-	  method dependent information are able to refer from method entry.
-
-Tue Jul  7 04:42:25 2015  Eric Wong  <e@80x24.org>
-
-	* string.c (Init_String): use rb_str_freeze for String#freeze
-	  to resize internal buffer
-	  [ruby-core:69870] [Feature #11330]
-
-Tue Jul  7 04:12:32 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c (vm_define_method): remove an unused local variable.
-
-Tue Jul  7 03:57:28 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: remove rb_iseq_t::defined_method_id because it is not
-	  needed.
-
-	* eval.c (frame_func_id): simplify. rb_callable_method_entry_t
-	  has enough information.
-
-	* eval.c (frame_called_id): ditto.
-
-	* iseq.c (prepare_iseq_build): catch up this fix.
-
-	* proc.c (rb_mod_define_method): ditto.
-
-	* vm.c (vm_define_method): ditto.
-
-Tue Jul  7 03:47:26 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: remove a useless declaration.
-
-Tue Jul  7 03:33:20 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: remove rb_iseq_t::klass to reduce dynamic data.
-
-	* internal.h, iseq.c (rb_iseq_klass): remove it because
-	  rb_iseq_t::klass is removed.
-
-	* vm_insnhelper.c (vm_super_outside): do not see cfp->iseq, but
-	  check callable method entry on a frame.
-	  This fix simplify the logic to search super class.
-
-	* test/ruby/test_method.rb: support super() from Proc.
-	  Now, [Bug #4881] and [Bug #3136] was solved.
-
-	* proc.c (rb_mod_define_method): catch up this change.
-
-	* vm.c (vm_define_method): ditto.
-
-	* vm_backtrace.c (rb_profile_frames): now, each `frame' objects
-	  are rb_callable_method_entry_t data or iseq VALUEs.
-
-	  This fix introduce minor compatibility issue that
-	  rb_profile_frame_label() always returns
-	  rb_profile_frame_base_label().
-
-	* test/-ext-/debug/test_profile_frames.rb: catch up this change.
-
-Tue Jul  7 01:52:14 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* cont.c (fiber_init): initialize control frame correctly.
-	  This fix does not affect any ordinal execution, but
-	  affects debug prints.
-
-Mon Jul  6 17:59:05 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_search_super_method): do not skip calling
-	  same methods in super.
-	  [Bug #3351]
-
-	* test/ruby/test_super.rb: fix a test.
-
-Mon Jul  6 17:59:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/tk/tcltklib.c: removed deprecated safe level.
-
-Mon Jul  6 17:16:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h, proc.c (rb_method_entry_location): make it static
-	  and remove prefix `rb_' because it is used only in proc.c.
-
-Mon Jul  6 16:42:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* test/lib/memory_status.rb: removed redundant path.
-
-Mon Jul  6 01:18:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/lib/test/unit/parallel.rb: make @@project_dir one level
-	  upper as this file had moved one level deeper.
-
-Sun Jul  5 23:54:10 2015  mizokami  <suzunatsu@yahoo.com>
-
-	* lib/optparse.rb: [DOC] Fix typo.
-
-Sun Jul  5 18:25:37 2015  Eric Wong  <e@80x24.org>
-
-	* gc.c (gc_profile_record_get): fix spelling error in keys
-
-Sun Jul  5 14:49:01 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
-
-	* README.md: fix a typo pointed out by raoulvdberge.
-	  https://github.com/ruby/ruby/pull/953#commitcomment-11998186
-
-Sun Jul  5 12:56:20 2015  Irvi Firqotul Aini  <viarc7@gmail.com>
-
-	* README.md: Added link HowToReport bugs.
-
-Sun Jul  5 10:51:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_sort_bang): the original array may not be
-	  embedded even if a substitution array is embedded, as it is
-	  embedded when the original array is short enough but not
-	  embedded.  [ruby-dev:49166] [Bug #11332]
-
-Sun Jul  5 09:31:40 2015  Eric Wong  <e@80x24.org>
-
-	* test/ruby/test_process.rb: test for fd=3 usability in child
-
-Sat Jul  4 19:43:31 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* Add test case for empty array and first method with args.
-	  Patch by @yui-knk [fix GH-955]
-
-Sat Jul  4 19:39:08 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* Add test for `Enumerable#sort` with block. Patch by @yui-knk
-	  [fix GH-954]
-
-Sat Jul  4 14:38:43 2015  Eric Wong  <e@80x24.org>
-
-	* enum.c (zip_ary): remove volatile, use RB_GC_GUARD
-	  (zip_i): ditto
-
-Sat Jul  4 10:42:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rubygems/test_case.rb (teardown): do not delete features
-	  loaded from the original load paths, the same libraries should
-	  be loaded again when the same features are required.
-	  [ruby-dev:49031] [Bug #11222]
-
-Sat Jul  4 09:38:52 2015  Eric Wong  <e@80x24.org>
-
-	* vm.c (rb_vm_mark): reduce branches for always-set VM fields
-	  (rb_vm_add_root_module): ditto
-
-Fri Jul 03 20:05:10 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: introduce rb_callable_method_entry_t to remove
-	  rb_control_frame_t::klass.
-	  [Bug #11278], [Bug #11279]
-
-	  rb_method_entry_t data belong to modules/classes.
-	  rb_method_entry_t::owner points defined module or class.
-
-	    module M
-	      def foo; end
-	    end
-
-	  In this case, owner is M.
-
-	  rb_callable_method_entry_t data belong to only classes.
-	  For modules, MRI creates corresponding T_ICLASS internally.
-	  rb_callable_method_entry_t can also belong to T_ICLASS.
-
-	  rb_callable_method_entry_t::defined_class points T_CLASS or
-	  T_ICLASS.
-	  rb_method_entry_t data for classes (not for modules) are also
-	  rb_callable_method_entry_t data because it is completely same data.
-	  In this case, rb_method_entry_t::owner == rb_method_entry_t::defined_class.
-
-	  For example, there are classes C and D, and includes M,
-
-	    class C; include M; end
-	    class D; include M; end
-
-	  then, two T_ICLASS objects for C's super class and D's super class
-	  will be created.
-
-	  When C.new.foo is called, then M#foo is searched and
-	  rb_callable_method_t data is used by VM to invoke M#foo.
-
-	  rb_method_entry_t data is only one for M#foo.
-	  However, rb_callable_method_entry_t data are two (and can be more).
-	  It is proportional to the number of including (and prepending)
-	  classes (the number of T_ICLASS which point to the module).
-
-	  Now, created rb_callable_method_entry_t are collected when
-	  the original module M was modified. We can think it is a cache.
-
-	  We need to select what kind of method entry data is needed.
-	  To operate definition, then you need to use rb_method_entry_t.
-
-	  You can access them by the following functions.
-
-	  * rb_method_entry(VALUE klass, ID id);
-	  * rb_method_entry_with_refinements(VALUE klass, ID id);
-	  * rb_method_entry_without_refinements(VALUE klass, ID id);
-	  * rb_resolve_refined_method(VALUE refinements, const rb_method_entry_t *me);
-
-	  To invoke methods, then you need to use rb_callable_method_entry_t
-	  which you can get by the following APIs corresponding to the
-	  above listed functions.
-
-	  * rb_callable_method_entry(VALUE klass, ID id);
-	  * rb_callable_method_entry_with_refinements(VALUE klass, ID id);
-	  * rb_callable_method_entry_without_refinements(VALUE klass, ID id);
-	  * rb_resolve_refined_method_callable(VALUE refinements, const rb_callable_method_entry_t *me);
-
-	  VM pushes rb_callable_method_entry_t, so that rb_vm_frame_method_entry()
-	  returns rb_callable_method_entry_t.
-	  You can check a super class of current method by
-	  rb_callable_method_entry_t::defined_class.
-
-	* method.h: renamed from rb_method_entry_t::klass to
-	  rb_method_entry_t::owner.
-
-	* internal.h: add rb_classext_struct::callable_m_tbl to cache
-	  rb_callable_method_entry_t data.
-
-	  We need to consider about this field again because it is only
-	  active for T_ICLASS.
-
-	* class.c (method_entry_i): ditto.
-
-	* class.c (rb_define_attr): rb_method_entry() does not takes
-	  defined_class_ptr.
-
-	* gc.c (mark_method_entry): mark RCLASS_CALLABLE_M_TBL() for T_ICLASS.
-
-	* cont.c (fiber_init): rb_control_frame_t::klass is removed.
-
-	* proc.c: fix `struct METHOD' data structure because
-	  rb_callable_method_t has all information.
-
-	* vm_core.h: remove several fields.
-	  * rb_control_frame_t::klass.
-	  * rb_block_t::klass.
-
-	  And catch up changes.
-
-	* eval.c: catch up changes.
-
-	* gc.c: ditto.
-
-	* insns.def: ditto.
-
-	* vm.c: ditto.
-
-	* vm_args.c: ditto.
-
-	* vm_backtrace.c: ditto.
-
-	* vm_dump.c: ditto.
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-	* vm_method.c: ditto.
-
-Fri Jul  3 14:30:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/file.c: some mingw compilers need a tweek for the
-	  declarations of _wfreopen_s.  [Bug #11320]
-
-Fri Jul  3 12:25:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* transcode.c (rb_econv_set_replacement): target encoding name can
-	  be empty now.  [ruby-core:69841] [Bug #11324]
-
-Fri Jul  3 07:21:06 2015  Eric Wong  <e@80x24.org>
-
-	* benchmark/bm_io_nonblock_noex.rb: new benchmark
-	* ext/openssl/ossl_ssl.c (no_exception_p): new function
-	  (ossl_start_ssl): adjust for no_exception_p
-	  (ossl_ssl_connect): adjust ossl_start_ssl call
-	  (ossl_ssl_connect_nonblock): ditto
-	  (ossl_ssl_accept): ditto
-	  (ossl_ssl_accept_nonblock): ditto
-	  (ossl_ssl_read_internal): adjust for no_exception_p
-	  (ossl_ssl_write_internal): ditto
-	  (ossl_ssl_write): adjust ossl_write_internal call
-	  (ossl_ssl_write_nonblock): ditto
-	* ext/stringio/stringio.c (strio_read_nonblock):
-	  delay exception check
-	* io.c (no_exception_p): new function
-	  (io_getpartial): call no_exception_p
-	  (io_readpartial): adjust for io_getpartial
-	  (get_kwargs_exception): remove
-	  (io_read_nonblock): adjust for io_getpartial,
-	  check no_exception_p on EOF
-	  (io_write_nonblock): call no_exception_p
-	  (rb_io_write_nonblock): do not check `exception: false'
-	  (argf_getpartial): adjust for io_getpartial
-	  [ruby-core:69778] [Feature #11318]
-
-Fri Jul  3 07:13:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (replace_real_basename): Win32 API does not set errno, get
-	  the last error by GetLastError() and map to errno.  [Bug #10015]
-
-Thu Jul  2 21:32:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (replace_real_basename): show warnings at errors.
-	  [Bug #10015]
-
-Thu Jul  2 18:39:20 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c: remove `#define RGENGC_OBJ_INFO 1' line introduced to
-	  debug Bug #11244.
-
-Thu Jul  2 18:34:26 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_raw_obj_info): separated from rb_obj_info().
-	  Fill internal object information into passed buffer.
-
-	* gc.h: declare rb_raw_obj_info().
-
-Thu Jul  2 16:15:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (replace_real_basename): update path type by the target
-	  attributes if possible, to improve the performance.  [Bug #10015]
-
-Thu Jul  2 14:45:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* st.c: get rid of VC++'s warnings of C4700 (uninitialized local
-	  variable used).  I think that these are wrong, but should shut them
-	  up.
-
-Thu Jul  2 14:15:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rubygems.rb (Gem.load_path_insert_index): search
-	  @gem_prelude_index first.
-
-	* lib/rubygems/test_case.rb (Gem::TestCase#setup): keep already
-	  expanded paths to preserve instance variables.
-
-Thu Jul  2 14:12:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ruby.c (process_options): also copy initial load path marks at
-	  setting load paths encoding.
-
-Thu Jul  2 12:26:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/rubygems/test_gem_server.rb (process_based_port): use
-	  dynamically chosen port numbers to get rid of conflicts.
-
-Thu Jul  2 11:58:59 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/rubygems/test_gem_specification.rb: skip tests which the
-	  platform does not permit the filename of its test file.
-
-Thu Jul  2 11:36:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/rubygems/test_gem_resolver_git_specification.rb: require
-	  rubygems/installer.rb before Gem::TestCase#setup runs, otherwise
-	  as Gem::TestCase#teardown restores $LOADED_FEATURES to the state
-	  at that time, the requiring the file in GitSpecification#install
-	  method causes a lot of constant redefinitions.
-
-Thu Jul  2 10:43:36 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/rubysocket.h: flags for common socket families
-	  (rsock_getfamily): update signature
-	* include/ruby/io.h: comment socket FMODE flags
-	* ext/socket/init.c (rsock_getfamily): memoize family
-	* ext/socket/basicsocket.c: adjust rsock_getfamily calls
-	* ext/socket/ancdata.c: ditto
-	  [ruby-core:69713] [Feature #11298]
-
-Thu Jul  2 10:30:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/rubygems/resolver.rb: fixed NameError of Gem::Util::NULL_DEVICE.
-
-Thu Jul  2 09:51:44 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/rubygems/resolver.rb: fix error of null device reference with DOSISH
-	  platform.
-
-Thu Jul  2 06:49:44 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/rubygems: Update to RubyGems HEAD(c202db2).
-	  this version contains many enhancements see http://git.io/vtNwF
-	* test/rubygems: ditto.
-
-Wed Jul  1 23:50:34 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* test/net/http/test_httpresponse.rb
-	(HTTPResponseTest#test_read_body_content_encoding_deflate_uppercase):
-	fix a failure without zlib.
-
-Wed Jul  1 10:54:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* Add test for Enumerable#none? [fix GH-950] Patch by @yui-knk
-
-Wed Jul  1 09:30:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* struct.c (struct_set_members): hide internal back_members
-	  object, and members object does not need to be duped as it
-	  should be frozen and hidden.
-
-Wed Jul  1 09:28:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* struct.c (struct_member_pos): revert r51080 to fix other
-	  implicit conversions but cast the return value to fix the
-	  previous implicit conversion.
-
-Wed Jul  1 08:47:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* struct.c (struct_member_pos): avoid implicit conversion loses
-	  integer precision: 'long' to 'int'.
-
-Wed Jul  1 05:57:03 2015  Eric Wong  <e@80x24.org>
-
-	* vm_method.c (rb_add_method_iseq): add RB_GC_GUARD
-	* class.c (clone_method): remove RB_GC_GUARD
-	* struct.c (define_aref_method): ditto
-	  (define_aset_method): ditto
-	* vm.c (vm_define_method):
-	* iseq.c (rb_iseq_clone): add RB_GC_GUARD
-
-Wed Jul  1 05:43:58 2015  Eric Wong  <e@80x24.org>
-
-	* struct.c (AREF_HASH_THRESHOLD): new macro
-	  (id_back_members): new ID
-	  (struct_member_pos_ideal): new function
-	  (struct_member_pos_probe): ditto
-	  (struct_set_members): ditto
-	  (struct_member_pos): ditto
-	  (rb_struct_getmember): use struct_member_pos for O(1) access
-	  (rb_struct_aref_sym): ditto
-	  (rb_struct_aset_sym): ditto
-	  (setup_struct): call struct_set_members
-	  (struct_define_without_accessor): ditto
-	  (Init_Struct): initialize __members_back__
-	  [ruby-core:66851] [ruby-core:69705] [ruby-core:69821]
-
-Tue Jun 30 23:12:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_reopen): FilePathValue() ensures the path
-	  NUL-terminated and frozen, so it is unnecessary to make it shared.
-
-Tue Jun 30 23:11:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (check_dirname): ensure path name NUL-terminated for
-	  SHARABLE_MIDDLE_SUBSTRING.
-
-	* io.c (rb_sysopen): ditto.
-
-Tue Jun 30 18:38:16 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/file.c (rb_freopen): need to terminate by NUL.
-
-Tue Jun 30 17:28:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_reopen): freopen(3) with OS encoding path.
-	  [ruby-core:69780] [Bug #11320]
-
-	* win32/file.c (rb_freopen): wrapper of wchar version freopen(3).
-	  use _wfreopen_s() if available.
-
-Tue Jun 30 08:24:08 2015  Eric Wong  <e@80x24.org>
-
-	* io.c (rb_io_oflags_modestr): handle O_TRUNC correctly
-	* test/ruby/test_io.rb (test_reopen_stdio): new test
-	  Patch-by: cremno phobia <cremno@mail.ru>
-	  [ruby-core:69779] [Bug #11319]
-
-Tue Jun 30 02:47:02 2015  Eric Wong  <e@80x24.org>
-
-	* include/ruby/st.h (struct st_table): hide struct list_head
-	* st.c (struct st_table_entry): adjust struct
-	  (head, tail): remove shortcut macros
-	  (st_head): new wrapper function
-	  (st_init_table_with_size): adjust to new struct and API
-	  (st_clear): ditto
-	  (add_direct): ditto
-	  (unpack_entries): ditto
-	  (rehash): ditto
-	  (st_copy): ditto
-	  (remove_entry): ditto
-	  (st_shift): ditto
-	  (st_foreach_check): ditto
-	  (st_foreach): ditto
-	  (get_keys): ditto
-	  (get_values): ditto
-	  (st_values_check): ditto
-	  (st_reverse_foreach_check): ditto (unused)
-	  (st_reverse_foreach): ditto (unused)
-	  [ruby-core:69726] [Misc #10278]
-
-Mon Jun 29 17:38:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* insns.def (defineclass): do not quote unprintable characters at
-	  raising an exception.
-
-Mon Jun 29 16:01:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* lib/net/http/response.rb (inflater): CONTENT_ENCODING can be upper
-	  case. [ruby-core:69670] [Bug #11285] patched by Andy Chu
-
-Mon Jun 29 14:50:08 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* eval.c (add_activated_refinement): should not include the original
-	  class.
-
-Mon Jun 29 12:09:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* README.md: tweak styles. [fix GH-945][ci skip] Patch by @bryndyment
-
-Mon Jun 29 07:23:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* template/sizes.c.tmpl: extract RUBY_DEFINT to define sizes of
-	  types checked by configure.in, and fix size of intptr_t in
-	  universal binary.
-
-Mon Jun 29 02:10:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* insns.def (defineclass): preserve encoding of name in error
-	  messages for super class mismatch.
-
-	* insns.def (defineclass): preserve encoding of name in error
-	  messages for non-class super.
-
-	* insns.def (defineclass): preserve encoding of name in error
-	  messages when already defined but type mismatch.
-
-Sun Jun 28 12:07:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* class.c (rb_define_class_id_under): raise TypeError exception
-	  same as ruby level class definition when superclass mismatch.
-
-Sun Jun 14 19:02:03 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* lib/net/ftp.rb (makeport): close the TCPServer
-	  when sending the port fails.
-
-	* test/net/ftp/test_ftp.rb: test for above.
-
-Fri Jun 26 12:48:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* transcode.c (load_transcoder_entry): fix transcoder loading race
-	  condition, by waiting in require.  [ruby-dev:49106] [Bug #11277]
-
-Fri Jun 26 07:53:56 2015  Eric Wong  <e@80x24.org>
-
-	* enum.c (enum_minmax): simplify return value creation
-	* test/ruby/test_enum.rb: test behavior on empty
-	* hash.c (rb_hash_fetch_m): remove unnecessary volatile since r41597
-	  (env_reject_bang): trade volatile for GC guard
-	  (env_select): ditto
-	  (env_select_bang): ditto
-	  (env_keep_if): ditto
-	  (rb_env_clear): ditto
-
-Thu Jun 25 21:24:28 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/-ext-/popen_deadlock/test_popen_deadlock.rb: test [Bug #11265]
-
-	* ext/-test-/popen_deadlock/infinite_loop_dlsym.c: new ext to call
-	  dlsym(3) infinitely without GVL, used in the above test.
-
-	* ext/-test-/popen_deadlock/extconf.rb: extconf.rb for the above
-	  ext. Currently, only enabled on Solaris (main target) and Linux
-	  (as a reference platform and for debugging the ext).
-
-Thu Jun 25 19:24:25 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* configure.in: not to use vfork on Solaris to avoid deadlock
-	  occurred in vfork(2) with multi-threading and dynamic linker
-	  on Solaris. [Bug #11265] [ruby-dev:49089]
-
-Thu Jun 25 18:25:41 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/lib/envutil.rb (Test::Unit::Assertions#assert_no_memory_leak):
-	  NO_MEMORY_LEAK_ENVS is moved to Memory::NO_MEMORY_LEAK_ENVS
-	  to reduce child executions during test-all on Solaris.
-
-	* test/lib/memory_status.rb (Memory::NO_MEMORY_LEAK_ENVS): ditto.
-
-Thu Jun 25 17:32:33 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c (rb_method_entry_create): need to call
-	  method_definition_reset() if def is given.
-
-	  Actually, `me' is a new object, so we don't need to call it.
-	  It is just to make sure.
-
-	* vm_method.c (method_definition_reset): remove duplicated insertion.
-
-	* vm_method.c (rb_method_entry_clone): assign dst->def here,
-	  not in method_definition_reset().
-
-Thu Jun 25 16:44:54 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c: make a rb_method_definition_t data (def) *after* making
-	  a rb_method_entry_t data (me).
-
-	  Normally, `me' points `def'. Some Ruby objects pointed from `def'
-	  and objects are marked by `me' (mark_method_entry() in gc.c).
-	  However, `def' is built before making a `me', then nobody can mark
-	  objects pointed from `def' before making (and pointing from) `me'.
-
-	  I hope this patch solve #11244.
-
-	* vm_method.c: remove `rb_' prefix from some static functions.
-
-	* method.h (rb_method_entry_create): constify
-
-	* gc.c (mark_method_entry): add checking `def' and
-	  `def->body.iseq.iseqptr' availability because they can be NULL.
-
-Thu Jun 25 14:14:16 2015  takiy33  <takiy33@gmail.com>
-
-	* test/test_prime.rb (test_eratosthenes_works_fine_after_timeout):
-	  use spaces instead of TABs in ruby codes.  [Fix GH-944]
-
-Thu Jun 25 07:08:35 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info, method_type_name): show method type name in a string
-	  instead of a number.
-
-Thu Jun 25 06:49:25 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): show more details for T_IMEMO/imemo_ment.
-
-Thu Jun 25 06:40:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c (rb_method_definition_reset): need a WB for
-	  VM_METHOD_TYPE_ATTRSET.
-
-Thu Jun 25 03:33:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (RGENGC_OBJ_INFO, obj_info): add a macro to enable/disable
-	  rich obj_info() output.
-
-	  At the default, the value of RGENGC_OBJ_INFO is
-	  (RGENGC_DEBUG | RGENGC_CHECK_MODE).
-
-	* gc.c (RGENGC_OBJ_INFO): force enable it to debug #11244.
-
-	* gc.c (gc_mark_ptr): print more details with obj_info().
-
-	* gc.c (gc_mark_children): remove useless debug prints.
-
-Thu Jun 25 02:40:33 2015  Eric Wong  <e@80x24.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_read_internal):
-	  do not process kwargs in blocking mode
-	* test/openssl/test_ssl.rb: test sysread
-
-Wed Jun 24 16:54:11 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_mark_children): add additional debug code for #11244.
-
-Wed Jun 24 16:05:42 2015  Eric Wong  <e@80x24.org>
-
-	* string.c (rb_str_justify): use RB_GC_GUARD
-
-Wed Jun 24 14:25:17 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_mark_ptr): add a check code for #11244.
-
-	  It should be removed later. But we can remain this check
-	  because it is only a branch.
-
-Wed Jun 24 12:49:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_fstring_cstr): new function to make a fstring from
-	  a string literal.
-
-	* internal.h (rb_fstring_lit): new macro to make a fstring from a
-	  string literal.
-
-	* include/ruby/intern.h (rb_strlen_lit): new macro to get the
-	  length of a string literal, borrowed from mruby/mruby@e4afd53.
-
-Wed Jun 24 12:21:16 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* re.c: Update documentation for Regexp class.
-	  [fix GH-937][ci skip] Patch by @davydovanton
-
-Wed Jun 24 09:23:03 2015  Eric Wong  <e@80x24.org>
-
-	* variable.c (generic_ivar_set): remove FL_ABLE check
-	  (gen_ivar_copy): ditto
-	  [ruby-core:69715]
-
-Wed Jun 24 08:28:15 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_recvmsg_internal): reduce stack use
-	  [ruby-core:69595] [Feature #11263]
-
-Tue Jun 23 14:32:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (name_err_receiver): raise ArgumentError if no receiver
-	  is available on this exception object.  [Feature #10881]
-
-Tue Jun 23 09:48:34 2015  Eric Wong  <e@80x24.org>
-
-	* dir.c (check_dirname): avoid volatile, use return value
-	  (dir_s_chroot, dir_s_mkdir, dir_s_rmdir): adjust callers
-
-Tue Jun 23 06:37:10 2015  Eric Wong  <e@80x24.org>
-
-	* struct.c (struct_ivar_get): cache member definition in a subclass
-	  Thanks to Sokolov Yura aka funny_falcon <funny.falcon@gmail.com>
-	  in https://bugs.ruby-lang.org/issues/10585
-
-Tue Jun 23 04:58:06 2015  Eric Wong  <e@80x24.org>
-
-	* benchmark/bm_vm2_struct_big_href_hi.rb: new benchmark
-	* benchmark/bm_vm2_struct_big_href_lo.rb: ditto
-	* benchmark/bm_vm2_struct_big_hset.rb: ditto
-	* benchmark/bm_vm2_struct_small_href.rb: ditto
-	* benchmark/bm_vm2_struct_small_hset.rb: ditto
-	  Thanks to Sokolov Yura aka funny_falcon <funny.falcon@gmail.com>
-	  in https://bugs.ruby-lang.org/issues/10585
-
-Mon Jun 22 18:08:48 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/lib/test/unit.rb (Test::Unit::Parallel#start_watchdog): removed
-	  because it has been meaningless since r36385. [Bug #11288]
-
-	* test/lib/test/unit.rb (Test::Unit::Parallel#_run_parallel): delete
-	  lines related to the removed start_watchdog method
-
-Sun Jun 21 23:52:46 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* NEWS: mention Array#bsearch_index and Hash#fetch_values.
-
-Sun Jun 21 23:46:27 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* NEWS: add a reference to a ticket.
-
-Sun Jun 21 20:28:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* internal.h (roomof): extract from type_roomof, and move from
-	  bignum.c.
-
-Sun Jun 21 18:32:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ruby_atomic.h (ATOMIC_PTR_CAS): define by generic CAS macro, not
-	  via size_t, to suppress a warning by mingw gcc.
-
-Sun Jun 21 05:31:41 2015  Shota Fukumori  <her@sorah.jp>
-
-	* ext/objspace/objspace_dump.c(dump_object): Return empty JSON object when
-	  passed object is a special const, instead of SEGV.
-	  Based patch by Kohei Suzuki (eagletmt). [ruby-core:69692] [Bug #11291]
-
-	* test/objspace/test_objspace.rb(test_dump_special_consts): Test for above fix.
-
-
-Sat Jun 20 03:56:58 2015  Yusuke Endoh  <mame@ruby-lang.org>
-
-	* enc/make_encmake.rb: the list of encoding extension libraries must
-	  not include encinit.c itself.  It caused "undefined reference to
-	  Init_encinit".
-
-Sat Jun 20 02:03:53 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* process.c (rb_execarg_parent_start1): new macro ALWAYS_NEED_ENVP
-	  to generate envp_str anytime on Solaris 10 (or earlier version
-	  of Solaris) to avoid calling execv() which is async-signal unsafe
-	  on Solaris 10. [Bug #11265] [ruby-dev:49089]
-
-	* process.c (exec_with_sh, proc_exec_cmd): On Solaris 10,
-	  because ALWAYS_NEED_ENVP is 1 and envp_str is always generated,
-	  execv() in exec_with_sh() and proc_exec_cmd() are never called.
-	  To guarantee this, execv() is replaced by a macro to print
-	  out error message on Solaris 10.
-
-	* process.c (proc_exec_sh): Because proc_exec_sh() may be called
-	  by rb_proc_exec() with envp_str = Qfalse, execl() is replaced
-	  by a macro that calls execle() with "extern char **environ"
-	  traditional global variable on Solaris 10.
-	  TODO: This may be unsafe and should be changed in the future.
-	  Although rb_proc_exec() is not used from inside current version
-	  of ruby, it may be called by third-party extensions.
-
-Sat Jun 20 01:10:13 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* NEWS: mention about $SAFE.
-
-Fri Jun 19 14:53:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* proc.c (rb_mod_define_method): now requires a block direct to
-	  this method call.  [ruby-core:69655] [Bug #11283]
-
-Fri Jun 19 13:54:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* proc.c (rb_mod_define_method): get rid of inadvertent ID
-	  creations at error.
-
-Fri Jun 19 07:58:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: if no with-ext option is given, default to
-	  enable everything.  [ruby-dev:49108] [Bug #11280]
-
-Fri Jun 19 06:30:07 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* bootstraptest/test_method.rb: remove a test because $SAFE=2 was
-	  obsolete.
-
-	  Please check btest, too.
-
-Thu Jun 18 23:51:51 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* bin/erb: $SAFE=3 is obsolete.
-
-Thu Jun 18 23:45:11 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* safe.c: removed needless doc related $SAFE=2
-
-Thu Jun 18 23:38:07 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* thread.c (rb_thread_safe_level): fix document.  $SAFE=3 is obsolete.
-	  [ci skip]
-
-Thu Jun 18 23:25:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: configure intersection of with-ext and not
-	  without-ext, as withouts is no longer true by default if
-	  with-ext option is given.  [ruby-dev:49108] [Bug #11280]
-
-Thu Jun 18 23:20:46 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* include/ruby/ruby.h: $SAFE=2 is now obsolete.
-
-	* dir.c, ext/fiddle/handle.c, ext/socket/basicsocket.c, file.c
-	  gc.c, io.c, process.c, safe.c, signal.c, win32/file.c:
-	  removed code for $SAFE=2
-
-	* test/erb/test_erb.rb, test/fiddle/test_handle.rb
-	  test/ruby/test_env.rb: removed tests for $SAFE=2.
-
-Thu Jun 18 22:50:07 2015  Yusuke Endoh  <mame@ruby-lang.org>
-
-	* enc/make_encmake.rb: added --transes and --no-transes options.
-
-Thu Jun 18 18:24:12 2015  Eric Wong  <e@80x24.org>
-
-	* test/socket/test_unix.rb: replace sleep with select
-
-Thu Jun 18 17:59:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c (rb_vm_control_frame_id_and_class): remove useless codes.
-	  `me' knows ID and owner class.
-
-Thu Jun 18 16:58:35 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: constify rb_method_alias_struct::original_me and
-	  rb_method_refined_struct::orig_me.
-
-	* class.c (move_refined_method): use RB_OBJ_WRITE() for
-	  me->def->body.refined.orig_me.
-
-Thu Jun 18 14:35:28 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* ext/objspace/objspace.c (count_imemo_objects): support imemo_ment.
-
-Thu Jun 18 13:32:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (name_err_receiver): add NameError#receiver method.
-	  [Feature #10881]
-
-Thu Jun 18 10:00:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* safe.c: removed needless doc related $SAFE=3
-
-Thu Jun 18 09:59:23 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* safe.c: rename old method name for $SAFE=3
-
-Thu Jun 18 06:02:42 2015  Eric Wong  <e@80x24.org>
-
-	* compile.c (get_exception_sym2type, iseq_build_from_ary_body):
-	  rely on %+PRIsVALUE instead of calling rb_inspect directly
-
-Wed Jun 17 20:59:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk (ENC_MK): needs fake.rb if cross compilation.
-	  [ruby-dev:49098] [Bug #11272]
-
-Wed Jun 17 20:23:29 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/rbconfig/sizeof/extconf.rb: Check __float80.
-
-Wed Jun 17 15:15:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* safe.c (safe_setter): of course, don't have to warn the limitation of
-	  $SAFE=3 after it's removed.
-
-Wed Jun 17 14:29:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* include/ruby/ruby.h: $SAFE=3 is now obsolete.
-
-	* ext/socket/init.c, ext/socket/socket.c, ext/socket/tcpsocket.c
-	  ext/socket/udpsocket.c, gc.c, object.c, re.c, safe.c: removed code
-	  for $SAFE=3
-
-	* bootstraptest/test_method.rb, test/erb/test_erb.rb, test/ruby/test_dir.rb
-	  test/ruby/test_file.rb, test/ruby/test_method.rb, test/ruby/test_regexp.rb
-	  test/ruby/test_thread.rb: remove tests for $SAFE=3
-
-Wed Jun 17 12:13:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ChangeLog: added contributor name.
-
-Wed Jun 17 10:57:28 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/csv.rb: accept to use Range object for row selection.
-	  contributed by Mitsutaka Mimura.
-	  [Feature #11267][ruby-dev:49091]
-
-Wed Jun 17 09:50:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rdoc/servlet.rb (documentation_search, root_search):
-	  requires json for JSON.dump and fix sporadic failures due to
-	  the loading order.
-
-Tue Jun 16 19:19:53 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/rbconfig/sizeof/extconf.rb: Check several types defined in C99
-	  and x86_64 ABI.
-
-	* template/sizes.c.tmpl: Relax a pattern for types.
-
-Tue Jun 16 17:37:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/objspace/test_objspace.rb: relax pattern because uncollectible
-	  flag and marked flag can be false at major GC.
-	  [Bug #10852]
-
-Tue Jun 16 04:50:44 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/basicsocket.c (bsock_recv): document outbuf
-	* ext/socket/unixsocket.c (unix_recvfrom): ditto
-	* ext/socket/init.c (rsock_strbuf, recvfrom_locktmp): new functions
-	  (rsock_s_recvfrom): support destination buffer as 3rd arg
-	  (rsock_s_recvfrom_nonblock): ditto
-	* string.c (rb_str_locktmp_ensure): export for internal ext
-	* test/socket/test_nonblock.rb: test recv_nonblock
-	* test/socket/test_unix.rb: test recv
-	  [ruby-core:69543] [Feature #11242]
-
-Tue Jun 16 04:38:02 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal,
-	  bsock_recvmsg_internal):
-	  support "exception: false" kwarg
-	* ext/socket/init.c (rsock_s_recvfrom_nonblock):
-	  ditto
-	* ext/socket/init.c (rsock_s_recvfrom_nonblock): use rsock_opt_false_p
-	* ext/socket/socket.c (sock_connect_nonblock): ditto
-	* ext/socket/rubysocket.h (rsock_opt_false_p): new function
-	* ext/socket/basicsocket.c (bsock_recv_nonblock): update rdoc
-	* ext/socket/udpsocket.c (udp_recvfrom_nonblock): ditto
-	* test/socket/test_nonblock.rb: new tests
-	  [ruby-core:69542] [Feature #11229]
-
-Mon Jun 15 14:33:02 2015  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/set.rb: Make Set#each and SortedSet#each generate a sized
-	  enumerator. [GH-931] by kachick (Kenichi Kamiya)
-
-	* test/test_set.rb: Import tests from Set into SortedSet. [GH-931]
-	  by kachick (Kenichi Kamiya)
-
-Mon Jun 15 02:26:34 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* lib/net/http.rb (Net::HTTP#connect): use connect_nonblock and
-	  io/wait to eliminate timeout use. fix GH-899
-
-Sat Jun 13 07:21:18 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
-
-	* thread.c (thread_start_func_2): don't interrupt when last thread
-	  exit unless main thread is already exited. Otherwise main thread
-	  could be wrongly interrupted when it uses rb_thread_call_without_gvl().
-	  Patch by Takehiro Kubo. [Bug #11237][ruby-dev:49044][GH-898]
-
-	* test/-ext-/gvl/test_last_thread.rb: new test for the above fix.
-
-	* ext/-test-/gvl/call_without_gvl/call_without_gvl.c: new ext for
-	  the above test.
-	* ext/-test-/gvl/call_without_gvl/extconf.rb: ditto.
-
-Mon Jun 15 00:14:33 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/pathname/lib/pathname.rb (descend): Blockless form supported.
-	  (ascend): Ditto.
-	  [ruby-core:68820] [Feature #11052] Patch by Piotr Szotkowski.
-
-Sun Jun 14 20:09:25 2015  Tanaka Akira  <akr@fsij.org>
-
-	* time.c (time_getlocaltime): [DOC] Add examples of valid utc_offset
-	  formats.
-	  [ruby-core:68306] [Misc #10905] Patch by Charles Korn.
-
-Sun Jun 14 18:49:56 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/socket/raddrinfo.c (parse_numeric_port): Detect
-	  port overflow.
-	  (numeric_getaddrinfo): Use parse_numeric_port.
-	  numeric_getaddrinfo fails if port is too big now.
-	  This makes rb_getaddrinfo invokes the real getaddrinfo()
-	  on such condition.
-	  This change is related to [ruby-core:69355] [Bug #11179].
-
-Sun Jun 14 17:26:03 2015  Tanaka Akira  <akr@fsij.org>
-
-	* enum.c (enum_chunk_while): New method Enumerable#chunk_while.
-	  [ruby-core:67738] [Feature #10769] proposed by Tsuyoshi Sawada.
-
-Sun Jun 14 17:20:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_load_ok): try opening file without gvl not to
-	  lock entire process.  [Bug #11060]
-
-Sun Jun 14 10:43:50 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/runruby.rb: just remove the lines of RUBY_VERSION check and raise
-	  instead of replacing the check to `true`, for getting rid of a
-	  warning `possibly useless use of true in void context`.
-
-Sun Jun 14 10:13:55 2015  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rexml/source.rb (REXML::IOSource#scan): Fix a typo in
-	  document. [fix GH-934]
-	  Patch by Anton Davydov. Thanks!!!
-
-Sun Jun 14 10:09:48 2015  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rexml/attlistdecl.rb (REXML::AttlistDecl): Fix a typo in
-	  document. [fix GH-934]
-	  Patch by Anton Davydov. Thanks!!!
-
-Sun Jun 14 06:24:57 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* test/ruby/test_io.rb: add test for IO.binread fd leak.
-	  See r50881.
-
-Sun Jun 14 05:23:51 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* io.c (rb_io_s_binread): close fd if seek offset is invalid.
-
-Sun Jun 14 04:40:32 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* test/lib/leakchecker.rb (check): refactor.
-
-Sun Jun 14 04:34:14 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* test/lib/leakchecker.rb: Return false for no leaks.
-	  Otherwise the GC could run for nothing.
-
-Sun Jun 14 04:15:40 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* lib/delegate.rb: [DOC] Update SimpleDelegator example. [ci skip]
-
-Sat Jun 13 20:28:14 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* file.c (rb_stat_ino): get inode from the interval of struct st.
-
-	* win32/win32.c (stati64_set_inode): get nFilIndexHigh/Low, and set it
-	  to the interval of struct st as inode.
-
-	* win32/win32.c (stati64_set_inode_handle): call stati64_set_inode.
-
-	* win32/win32.c (rb_w32_fstati64): call stati64_set_inode_handle.
-
-	* win32/win32.c (stati64_handle): call stati64_set_inode.
-
-Sat Jun 13 19:44:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/io/console/depend (.list.chksum): revert a part of r50859, because
-	  it was not mentioned at its commit log and it caused a build error on
-	  Windows ($(MAKE) is already quoted).
-
-Sat Jun 13 17:35:11 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* vm_core.h (rb_thread_t): add th->name.
-
-	* vm.c (th_init): initialize th->name.
-
-	* thread.c (Init_Thread): add Thread.name and name=. [Feature #11251]
-
-	* thread.c (rb_thread_inspect): show thread's name if set.
-
-	* thread.c (rb_thread_getname): defined.
-
-	* thread.c (rb_thread_setname): ditto.
-
-Sat Jun 13 11:39:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/tempfile.rb: Fix typo. [fix GH-933] Patch by @Zorbash
-
-Sat Jun 13 11:38:00 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/openssl/ossl_ocsp.c: fix documentation on ocsp response cert status.
-	  [fix GH-932] Patch by @chrisholmes
-
-Sat Jun 13 11:35:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/bigdecimal/bigdecimal.gemspec: Fix require paths for released gem.
-	  [fix GH-929] Patch by @voxik
-	* ext/io/console/io-console.gemspec: ditto.
-
-Sat Jun 13 00:45:08 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/prime.rb: Return sized enumerators.
-	  Patch by Kenichi Kamiya [GH-931]
-
-Sat Jun 13 00:45:06 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/prime.rb: Fix with_object with no block given
-
-Sat Jun 13 00:44:59 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/prime.rb: Have with_index accept an offset parameter.
-	  Based on patch by T Yamada. [#11007]
-
-Fri Jun 12 22:21:12 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* test/ruby/test_extlibs.rb (TestExtLibs::check_existence): fix
-	  error. [Bug #11255] [ruby-dev:49079]
-
-Fri Jun 12 21:17:46 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* pack.c (pack_{un,}pack): new template character `j` and `J`, pointer
-	  with signed and unsigned integers.
-
-	* NEWS: mention about this feature.
-	  [Feature #11215] [ruby-dev:49015]
-
-Fri Jun 12 21:01:44 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* file.c (File::SHARE_DELETE): new flag to be able to delete opened file
-	  on Windows.
-
-	* include/win32/win32.c (O_SHARE_DELETE): new pseudo file mode flag.
-
-	* win32/win32.c (rb_w32_{w,}open): support above flag.  [EXPERIMENTAL]
-
-	* NEWS: mention about this feature.
-	  [Feature #11218] [ruby-dev:49022]
-
-Fri Jun 12 18:21:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ChangeLog: added missing commit message.
-
-Fri Jun 12 18:20:37 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* sample/exyacc.rb: Fix some typos. [fix GH-927] Patch by @davydovanton
-	* sample/list.rb: ditto.
-	* sample/trick2013/kinaba/remarks.markdown: ditto.
-
-Fri Jun 12 17:34:14 2015  Wojciech Mach  <wojtek@wojtekmach.pl>
-
-	* hash.c (rb_hash_fetch_values): add `Hash#fetch_values`.
-	  [Feature #10017] [Fix GH-776]
-
-Fri Jun 12 16:28:17 2015  Radan Skoric  <radan.skoric@gmail.com>
-
-	* array.c (rb_ary_bsearch_index): Implement Array#bsearch_index
-	  method, which is similar to bsearch and returns the index or
-	  nil.  [Feature #10730]
-
-Thu Jun 11 19:11:22 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/zlib/zlib.c: Fix indentation for rdoc.
-	  [Bug #11221][ruby-core:69465]
-
-Thu Jun 11 16:23:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h (METHOD_ENTRY_BASIC_SET): fix last commit (unbalanced parens).
-
-Thu Jun 11 15:14:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* configure.in: define SET_THREAD_NAME if it has pthread_set_name_np
-	  for FreeBSD, and don't define it if both pthread_setname_np
-	  and pthread_set_name_np don't exist.
-
-	* thread_pthread.c (SET_THREAD_NAME): don't define if they don't exist.
-
-	* thread_pthread.c (native_set_thread_name): run if SET_THREAD_NAME
-	  is defined.
-
-Thu Jun 11 15:53:31 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h (METHOD_ENTRY_BASIC_SET): should clear last bit.
-
-Thu Jun 11 14:34:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/rubygems.rb: bump version to 2.4.7 and 2.4.8. these versions fixed
-	  CVE-2015-3900.
-	* lib/rubygems/remote_fetcher.rb: ditto.
-	* test/rubygems/test_gem_remote_fetcher.rb: added testcase for CVE-2015-3900
-
-Thu Jun 11 14:18:51 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/rubygems.rb: bump version to 2.4.6. It's missing change at r49774.
-
-Thu Jun 11 13:50:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (ary_ensure_room_for_push): check if array size will
-	  exceed maximum size to get rid of buffer overflow.
-	  [ruby-dev:49043] [Bug #11235]
-
-	* array.c (ary_ensure_room_for_unshift, rb_ary_splice): ditto.
-
-Thu Jun 11 13:17:34 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/test_cmath.rb (TestCMath#test_trigonometric_functions): should
-	  not compare float values (in complex values) by `==`.
-
-Thu Jun 11 08:52:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: embed rb_method_entry_t::attr::flags (5 bits) into
-	  rb_method_entry_t::flags to make one word spare space.
-
-	  Add some macros to access these flags.
-
-	* vm_method.c: use these macros.
-
-	* internal.h: define IMEMO_FL_USHIFT and IMEMO_FL_USER[0-4]
-	  for T_IMEMO local flags.
-
-Thu Jun 11 08:27:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c: use VM_ASSERT instead of assert().
-
-	* vm_args.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-	* vm_method.c: ditto.
-
-Thu Jun 11 08:16:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: define VM_ASSERT() for assertion
-	  enabled only when (VM_CHECK_MODE > 0).
-
-	* vm_insnhelper.c: move definition VM_CHECK_MODE
-	  from vm_insnhelper.c to vm_core.h.
-
-	* vm.c: remove <assert.h>
-
-Thu Jun 11 06:46:07 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (check_frame): check type of cref_or_me first.
-
-Thu Jun 11 04:34:39 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* test/test_cmath.rb: Add some assertions.
-
-Thu Jun 11 00:34:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* template/fake.rb.in: expanded macro result may have spaces
-	  between tokens.  [ruby-dev:49047] [Bug #11243]
-
-Wed Jun 10 22:27:32 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* lib/mkmf.rb: revert r50804 because of build failure when specifying
-	  LDFLAGS during configure, observed on Solaris with GCC 4.6.
-	  [Bug #11245]
-
-Wed Jun 10 21:59:51 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* README.ja.md: fix markup miss.
-
-Wed Jun 10 11:06:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* template/fake.rb.in: turn into erb template from autoconf
-	  template to fake more accurately.
-
-	* common.mk (fake.rb): needs preprocessed file now.
-
-	* version.c (Init_version): add dummy expression to
-	  RUBY_ENGINE_VERSION.
-
-Tue Jun  9 12:31:25 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/prime.rb: Simplify and optimize EratosthenesSieve
-
-Tue Jun  9 11:45:00 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/prime.rb: Simplify and optimize EratosthenesSieve
-	  based on patch by Ajay Kumar. [Fixes GH-921]
-
-Mon Jun  8 05:09:58 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): print method id for T_IMEMO/ment.
-
-Sun Jun  7 07:05:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* Move test cases from test/ruby/test_complex.rb to test/test_cmath.rb
-
-Sat Jun  6 18:23:41 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: back to share rb_method_definition_t by
-	  rb_method_entry_t.
-
-	  r50728 changed sharing `def's to isolating `def's
-	  on alias and so on. However, this change conflicts
-	  future improvement plan. So I change back to sharing approach.
-
-	* method.h: move rb_method_definition_t::flags to
-	  rb_method_entry_t::attr::flags.
-
-	  rb_method_entry_t::attr is union with VALUE because this field
-	  should have same size of VALUE. rb_method_entry_t is T_IMEMO).
-
-	  And also add the following access macros to it's fields.
-
-	  * METHOD_ENTRY_VISI(me)
-	  * METHOD_ENTRY_BASIC(me)
-	  * METHOD_ENTRY_SAFE(me)
-
-	* vm_method.c (rb_method_definition_addref): added instead of
-	  rb_method_definition_clone().
-
-	  Do not create new definition, but increment alias_count.
-
-	* class.c (clone_method): catch up this fix.
-
-	* class.c (method_entry_i): ditto.
-
-	* proc.c (mnew_internal): ditto.
-
-	* proc.c (mnew_missing): ditto.
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-	* vm_method.c: ditto.
-
-Sat Jun  6 15:59:38 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c: ins_methods_push() needs rb_method_visibility_t type on
-	  2nd arg.
-
-Sat Jun  6 15:05:47 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (ins_methods_push): Change type and name of parameters
-	  to make more clear.
-
-Sat Jun  6 08:52:13 2015  Eric Wong  <e@80x24.org>
-
-	* test/socket/test_nonblock.rb: try to avoid EMSGSIZE
-	  [ruby-core:69466]
-
-Sat Jun  6 07:58:30 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c: remove struct mark_tbl_arg and pass objspace directly
-	  to avoid indirect access overhead.
-
-Sat Jun  6 07:08:45 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal): drop redundant assignment
-
-Sat Jun  6 01:00:06 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal): all arguments are
-	  parsed even on systems without HAVE_STRUCT_MSGHDR_MSG_CONTROL
-	  to prevent SEGV caused by passing Qnil to RARRAY_LENINT and
-	  to preserve behavior before r50776.
-	  [Bug #11224] [ruby-core:69468] [Bug #11225] [ruby-core:69469]
-
-Fri Jun  5 22:37:42 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (ins_methods_push): change 3rd parameter's type
-	  from long to rb_method_visibility_t.
-
-	* class.c (ins_methods_i): catch up this fix.
-
-	* class.c (method_entry_i): cast to st_data_t instead of `long'.
-
-Fri Jun  5 20:37:10 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: move definition of rb_cref_t to method.h.
-
-	* eval_intern.h: move definition of rb_scope_visibility_t
-	  to method.h.
-
-	* method.h: change rb_cref_t::scope_visi from VALUE to
-	  rb_scope_visibility_t.
-	  [Bug #11219]
-
-	* vm.c (vm_cref_new): accept rb_method_visibility_t directly.
-
-	* vm_insnhelper.c (rb_vm_rewrite_cref): don't use 0,
-	  but METHOD_VISI_UNDEF.
-
-	* vm_method.c (rb_scope_visibility_set): don't need to use cast.
-
-	* vm_method.c (rb_scope_module_func_set): ditto.
-
-Fri Jun  5 17:27:30 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal): avoid msg_control
-	  ptr if msg_controllen is zero to fix portability problems.
-
-Fri Jun  5 09:17:45 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal): fix build error
-	  from r50776
-
-Fri Jun  5 07:05:58 2015  Eric Wong  <e@80x24.org>
-
-	* io.c (sym_wait_readable, sym_wait_writable): declare
-	  (io_getpartial): use sym_wait_readable
-	  (io_write_nonblock): use sym_wait_writable
-	  (Init_IO): initialize sym_wait_*able
-
-Fri Jun  5 06:43:00 2015  Eric Wong  <e@80x24.org>
-
-	* doc/extension.rdoc: note rb_get_kwargs changes keywords_hash
-	  [ruby-core:68507]
-
-Fri Jun  5 05:50:29 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal): use rb_scan_args
-	  [ruby-core:69439] [Feature #11207]
-
-Fri Jun  5 02:20:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/lib/envutil.rb (assert_no_memory_leak): change default value
-	  of limit from 1.5 to 2.0. It is ad-hoc fix to solve test failure
-	  in travis-ci.
-
-Fri Jun  5 01:17:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_defined): no need to use cast.
-
-Fri Jun  5 01:14:02 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_defined): show additional messages on rb_bug().
-
-Fri Jun  5 01:06:02 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c (rb_add_method_iseq): use intermediate struct to
-	  avoid initializing struct with variables.
-	  [Bug #11217]
-
-	* method.h: add a comment about it.
-
-Fri Jun  5 00:55:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: constify rb_method_refined_t::orig_me.
-
-	  Also constify the following functions.
-
-	  * rb_resolve_refined_method()
-	  * rb_method_entry_with_refinements()
-	  * rb_method_entry_without_refinements()
-	  * rb_method_entry_copy()'s parameter.
-
-	* class.c: catch up this fix.
-
-	* vm_insnhelper.c: ditto.
-
-	* vm_method.c: ditto.
-
-Thu Jun  4 12:47:54 SGT 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* array.c: Revert r50763. because "reentered" is not typo.
-
-Thu Jun  4 11:12:29 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/win32ole/win32ole.c: fix a typo. Patch by @davydovanton
-	  [fix GH-923]
-	* include/ruby/st.h: ditto.
-	* include/ruby/util.h: ditto.
-
-Thu Jun  4 10:54:30 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* array.c: fix a typo. Patch by @manish-shrivastava
-	  [fix GH-922]
-
-Thu Jun  4 09:52:02 2015  Eric Wong  <e@80x24.org>
-
-	* ext/openssl/lib/openssl/ssl.rb: use io/nonblock instead of fcntl
-	  [ruby-core:69382] [Feature #11190]
-
-Thu Jun  4 07:22:45 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: introduce rb_method_refined_t for refined method entry.
-
-	* class.c (move_refined_method): catch up this fix.
-
-	* gc.c (mark_method_entry): ditto.
-
-	* vm_eval.c (vm_call0_body): ditto.
-
-	* vm_insnhelper.c (vm_call_method): ditto.
-
-	* vm_method.c: ditto.
-
-Thu Jun  4 07:12:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (dirent_match): match short names only when FNM_SHORTNAME
-	  flag is given, for the backward compatibility, and the new
-	  behavior is often dangerous.  [ruby-core:69435] [Bug #11206]
-
-Thu Jun  4 05:44:01 2015  Eric Wong  <e@80x24.org>
-
-	* variable.c (special_generic_ivar): remove flag
-	  (givar_i, rb_mark_generic_ivar_tbl): remove functions
-	  (rb_free_generic_ivar, rb_ivar_lookup, rb_ivar_delete,
-	   generic_ivar_set, rb_ivar_set, rb_ivar_defined,
-	   rb_copy_generic_ivar, rb_ivar_foreach, rb_ivar_count,
-	   rb_obj_remove_instance_variable):
-	   adjust for lack of ivar support in special constants
-	* test/ruby/test_variable.rb: test ivars for special consts
-	* internal.h: remove rb_mark_generic_ivar_tbl decl
-	* gc.c (gc_mark_roots): remove rb_mark_generic_ivar_tbl call
-	  [ruby-core:69441] [Feature #11208]
-
-Thu Jun  4 05:13:34 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (def_iseq_ptr): `iseqval' is not available any more.
-
-Thu Jun  4 04:50:12 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (method_entry_i): mtbl should not have `me' as NULL.
-
-Thu Jun  4 04:28:45 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (clone_method): do not use me->klass, but use explicitly
-	  passed argument.
-
-Thu Jun  4 04:10:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h (rb_vm_rewrite_cref_stack): rename to rb_vm_rewrite_cref().
-
-	* class.c (clone_method): use renamed name.
-
-	* vm_insnhelper.c (rb_vm_rewrite_cref): do not use `node' in variable
-	  names.
-
-Wed Jun  3 23:03:50 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c: rename `rb_frame_...' to `rb_scope_...'.
-
-	* eval_intern.h: move decl. of rb_scope_visibility_set() to method.h.
-
-	* load.c: catch up this fix.
-
-Wed Jun  3 21:14:20 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/rbconfig/sizeof/extconf.rb: Check C99 standard integer types.
-
-Wed Jun  3 21:00:47 2015  Tanaka Akira  <akr@fsij.org>
-
-	* configure.in: Don't check __int128.
-
-	* ext/rbconfig/sizeof/extconf.rb: Check __int128.
-
-	* ext/rbconfig/sizeof/depend: sizes.c depends on
-	  ext/rbconfig/sizeof/extconf.rb.
-
-	* template/sizes.c.tmpl: Detect check_sizeof.
-
-Wed Jun  3 20:07:07 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (clone_method): remove redundant check for me->def != NULL.
-	  Now, all `me` have `me->def`.
-
-	* proc.c (rb_method_entry_location): ditto.
-
-	* vm.c (rb_vm_check_redefinition_opt_method): ditto.
-
-	* vm.c (add_opt_method): ditto.
-
-	* vm_eval.c (vm_call0_body): ditto.
-
-Wed Jun  3 19:24:12 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: rename enum missing_reason to enum method_missing_reason.
-
-	* vm_core.h: use enum method_missing_reason for
-	  rb_thread_t::method_missing_reason.
-
-	* vm_eval.c: catch up this fix.
-
-	* vm_insnhelper.c: ditto.
-
-Wed Jun  3 16:17:21 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* vm.c: eagerly allocate `loading_table`.  This eliminates the need to
-	  do NULL checks when looking up the `loading_table` hash.
-	  https://github.com/ruby/ruby/pull/918
-
-	* load.c: remove various NULL checks
-
-Wed Jun  3 11:47:15 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: change fields order to gather frequent access fields.
-
-	* vm_insnhelper.c (vm_call_method): add LIKELY().
-
-Wed Jun 03 10:35:45 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: split rb_method_definition_t::flag to several flags.
-
-	  `flag' contains several categories of attributes and it makes us
-	  confusion (at least, I had confused).
-
-	  * rb_method_visibility_t (flags::visi)
-	    * NOEX_UNDEF     -> METHOD_VISI_UNDEF     = 0
-	    * NOEX_PUBLIC    -> METHOD_VISI_PUBLIC    = 1
-	    * NOEX_PRIVATE   -> METHOD_VISI_PRIVATE   = 2
-	    * NOEX_PROTECTED -> METHOD_VISI_PROTECTED = 3
-	  * NOEX_SAFE(flag)  -> safe (flags::safe, 3 bits)
-	  * NOEX_BASIC       -> basic (flags::basic, 1 bit)
-	  * NOEX_MODFUNC     -> rb_scope_visibility_t in CREF
-	  * NOEX_SUPER       -> MISSING_SUPER (enum missing_reason)
-	  * NOEX_VCALL       -> MISSING_VCALL (enum missing_reason)
-	  * NOEX_RESPONDS    -> BOUND_RESPONDS (macro)
-
-	  Now, NOEX_NOREDEF is not supported (I'm not sure it is needed).
-
-	  Background:
-	    I did not know what "NOEX" stands for.
-	    I asked Matz (who made this name) and his answer was "Nothing".
-	    "At first, it meant NO EXport (private), but the original
-	    meaning was gone."
-	    This is why I remove the mysterious word "NOEX" from MRI.
-
-	* vm_core.h: introduce `enum missing_reason' to represent
-	  method_missing (NoMethodError) reason.
-
-	* eval_intern.h: introduce rb_scope_visibility_t to represent
-	  scope visibility.
-	  It has 3 method visibilities (public/private/protected)
-	  and `module_function`.
-
-Wed Jun  3 08:06:30 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* gem/bundled_gems: updated to test-unit 3.1.1 and minitest 5.7.0.
-
-Wed Jun  3 04:48:05 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_defined): check respond_to_missing?
-	  at defined?(func()).
-	  [Bug #11212]
-
-	* test/ruby/test_defined.rb: add a test for this fix.
-
-Wed Jun  3 04:34:39 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_defined): skip respond_to_missing? when
-	  a method is available.
-	  [Bug #11211]
-
-	* test/ruby/test_defined.rb: add a test for this fix.
-
-Wed Jun  3 04:14:13 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* insns.def (defined), vm_insnhelper.c (vm_defined):
-	  move instruction body to the vm_defined() function.
-
-Wed Jun  3 02:29:25 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* test/ruby/test_module.rb: Do not assume class variable order.
-	  Patch by @enebo.
-
-Wed Jun  3 01:10:38 2015  Yusuke Endoh  <mame@tsg.ne.jp>
-
-	* vm_method.c (rb_method_definition_set): remove a double assignment.
-	  Coverity Scan found this bug.
-
-Wed Jun  3 00:04:51 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c (rb_alias): rename parameter names.
-
-Tue Jun  2 23:27:18 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: remove rb_method_iseq_t::iseqval.
-	  While making a r50728, iseqval is needed (to mark correctly),
-	  but now just iseqptr is enough.
-
-	* class.c: catch up this fix.
-
-	* gc.c: ditto.
-
-	* proc.c: ditto.
-
-	* vm_method.c: ditto.
-
-Tue Jun  2 21:29:28 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c (proc_curry): remove a debug line.
-
-Tue Jun  2 12:43:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: make rb_method_entry_t a VALUE.
-	  Motivation and new data structure are described in [Bug #11203].
-
-	  This patch also solve the following issues.
-
-	  * [Bug #11200] Memory leak of method entries
-	  * [Bug #11046] __callee__ returns incorrect method name in orphan
-	                 proc
-
-	* test/ruby/test_method.rb: add a test for [Bug #11046].
-
-	* vm_core.h: remove rb_control_frame_t::me. me is located at value
-	  stack.
-
-	* vm_core.h, gc.c, vm_method.c: remove unlinked_method... codes
-	  because method entries are simple VALUEs.
-
-	* method.h: Now, all method entries has own independent method
-	  definitions. Strictly speaking, this change is not essential,
-	  but for future changes.
-
-	  * rb_method_entry_t::flag is move to rb_method_definition_t::flag.
-	  * rb_method_definition_t::alias_count is now
-	    rb_method_definition_t::alias_count_ptr, a pointer to the counter.
-
-	* vm_core.h, vm_insnhelper.c (rb_vm_frame_method_entry) added to
-	  search the current method entry from value stack.
-
-	* vm_insnhelper.c (VM_CHECK_MODE): introduced to enable/disable
-	  assertions.
-
-Tue Jun  2 10:46:36 2015  Eric Wong  <e@80x24.org>
-
-	* test/socket/test_nonblock.rb: new test for sendmsg_nonblock
-
-Tue Jun  2 09:04:14 2015  Eric Wong  <e@80x24.org>
-
-	* lib/benchmark.rb: just use Process::CLOCK_MONOTONIC
-	  [ruby-core:69390]
-
-Mon Jun  1 22:01:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (pkg_config): split --libs if --libs-only-l option
-	  is not available.  patch in [ruby-core:69428] by Hans Mackowiak.
-	  [ruby-core:69421] [Bug #11201]
-
-Mon Jun  1 21:18:24 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_mark_children): remove a garbage character
-	  introduced at the last commit.
-
-Mon Jun  1 19:24:42 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c (rb_method_entry_make): do not show warning message
-	  when method_entry is an alias.
-
-Mon Jun  1 15:47:16 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: move class related definitions.
-
-Mon Jun  1 15:43:03 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c: remove needless include pragma for method.h.
-
-	* struct.c: ditto.
-
-	* vm_method.c: ditto.
-
-Mon Jun  1 05:42:00 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* eval_intern.h, vm_method.c: move macros to functions.
-	  * SCOPE_TEST(f)  -> rb_frame_visibility_test(flag).
-	  * SCOPE_CHECK(f) -> rb_frame_visibility_check(flag).
-	  * SCOPE_SET(f)   -> rb_frame_visibility_set(flag).
-
-	* load.c (load_ext): use it.
-
-Mon Jun  1 04:47:37 2015  Zachary Scott  <e@zzak.io>
-
-	* ext/date/date_core.c: [DOC] Add comparison of Time and DateTime
-	  Patch provided by @pixeltrix
-
-Mon Jun  1 04:22:09 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h (VM_FRAME_MAGIC_DUMMY): introduce new frame type to
-	  recognize dummy frame.
-
-	* vm.c (th_init): use new frame type.
-
-	* vm_args.c (raise_argument_error): ditto.
-
-Mon Jun  1 04:15:42 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (rb_class_has_methods): added to reduce dependency
-	  to internal class data structure.
-
-	* internal.h: ditto.
-
-	* hash.c (has_extra_methods): use added function.
-
-Mon Jun  1 04:11:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c , gc.h (rb_obj_info): export obj_info(VALUE) for debugging.
-
-Mon Jun  1 03:52:55 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/ruby/test_gc.rb: increase timeout seconds for GC stressful
-	  debugging.
-
-Sun May 31 04:18:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: fix typo of comments.
-
-Sun May 31 03:36:42 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: add VM_METHOD_TYPE_ALIAS rb_method_definition_t::type
-	  to fix [Bug #11173].
-
-	  Now, inter class/method alias creates new method entry
-	  VM_METHOD_TYPE_ALIAS, which has an original method entry.
-
-	* vm_insnhelper.c (find_defined_class_by_owner): added.
-	  Search corresponding defined_class from owner class/module.
-
-	* vm_method.c (rb_method_entry_get_without_cache): return me->klass
-	  directly for defined_class.
-
-	  Now, no need to check me->klass any more.
-
-	* vm_method.c (method_entry_set0): separated from method_entry_set().
-
-	* vm_method.c (rb_alias): make method entry has VM_METHOD_TYPE_ALIAS.
-
-	* vm_method.c (release_method_definition): support VM_METHOD_TYPE_ALIAS.
-
-	* vm_method.c (rb_hash_method_definition): ditto.
-
-	* vm_method.c (rb_method_definition_eq): ditto.
-
-	* vm_method.c (release_method_definition): ditto.
-
-	* vm_insnhelper.c (vm_call_method): ditto.
-
-	* vm_insnhelper.c (vm_method_cfunc_entry): ditto.
-
-	* vm_eval.c (vm_call0_body): ditto.
-
-	* gc.c (mark_method_entry): ditto.
-
-	* proc.c (method_def_iseq): ditto.
-
-	* proc.c (method_cref): ditto.
-
-	* proc.c (rb_method_entry_min_max_arity): ditto.
-
-	* test/ruby/test_alias.rb: add tests.
-
-	* test/ruby/test_module.rb: fix a test to catch up current behavior.
-
-Sun May 31 03:34:25 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c (rb_unlink_method_entry): make it static.
-
-Sun May 31 03:26:58 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h, vm_method.c (rb_free_method_entry): constify a parameter.
-
-	* vm_core.h: remove useless declaration about rb_unlink_method_entry().
-
-Sat May 30 18:05:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/tempfile.rb (Remover#call): fixed wrong condition.  introduced at
-	  r50682.
-
-Sat May 30 16:12:35 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c: use RB_GC_GUARD instead of volatile
-	  [ruby-core:69419] [Feature #11198]
-
-Sat May 30 15:59:10 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/tempfile.rb (Tempfile#initialize): initialize @unlinked to fix
-	  test failures introduced at r50682.  I hope that check the results of
-	  tests before committing, at least the tests about the changed feature.
-
-Sat May 30 11:02:55 2015  Martin Englund <martin@englund.nu>
-
-	* doc/dtrace_probes.rdoc: change lingering dtrace probe documentation
-	  from function- to method-
-
-Sat May 30 10:26:09 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* lib/tempfile.rb: refactoring.
-	  * use warn instead of STDERR.print
-	  * remove @tmpname and use @tmpfile.path
-	  * introduce @unlinked flag
-	  * Remover takes only @tmpfile
-	  * mode will be modified just before file reopen
-
-Sat May 30 09:02:51 2015  Eric Wong  <e@80x24.org>
-
-	* include/ruby/intern.h (rb_generic_ivar_table): deprecate
-	* internal.h (rb_attr_delete): declare
-	* marshal.c (has_ivars): use rb_ivar_foreach
-	  (w_ivar): ditto
-	  (w_object): update for new interface
-	* time.c (time_mload): use rb_attr_delete
-	* variable.c (generic_ivar_delete): implement
-	  (rb_ivar_delete): ditto
-	  (rb_attr_delete): ditto
-	  [ruby-core:69323] [Feature #11170]
-
-Sat May 30 09:14:28 2015  Scott Francis  <scott.francis@shopify.com>
-
-	* cont.c (cont_free): check if ruby_current_thread is still valid.
-	  [Fix GH-914]
-
-Sat May 30 08:36:04 2015  Eric Wong  <e@80x24.org>
-
-	* variable.c (static int special_generic_ivar): move
-	  (rb_generic_ivar_table): rewrite for compatibility
-	  (gen_ivtbl_bytes): new function
-	  (generic_ivar_get): update to use ivar index
-	  (generic_ivar_update): ditto
-	  (generic_ivar_set): ditto
-	  (generic_ivar_defined): ditto
-	  (generic_ivar_remove): ditto
-	  (rb_mark_generic_ivar): ditto
-	  (givar_i): ditto
-	  (rb_free_generic_ivar): ditto
-	  (rb_mark_generic_ivar_tbl): ditto
-	  (rb_generic_ivar_memsize): ditto
-	  (rb_copy_generic_ivar): ditto
-	  (rb_ivar_set): ditto
-	  (rb_ivar_foreach): ditto
-	  (rb_ivar_count): ditto
-	  (givar_mark_i): remove
-	  (gen_ivtbl_mark): new function
-	  (gen_ivar_each): ditto
-	  (iv_index_tbl_extend): update for struct ivar_update
-	  (iv_index_tbl_newsize): ditto
-	  [ruby-core:69323] [Feature #11170]
-
-Sat May 30 08:10:46 2015  Eric Wong  <e@80x24.org>
-
-	* variable.c (iv_index_tbl_make): extract from rb_ivar_set
-	  (iv_index_tbl_extend): ditto
-	  (iv_index_tbl_newsize): ditto
-	  (rb_ivar_set): use extracted functions
-	  [ruby-core:69323] (Part 1)
-
-Fri May 29 17:39:14 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* tool/make_hgraph.rb: added.
-
-Fri May 29 14:39:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* compile.c (iseq_compile_each): out of range NTH_REF is always
-	  nil.
-
-	* parse.y (parse_numvar): check overflow of NTH_REF and range.
-	  [ruby-core:69393] [Bug #11192]
-
-	* util.c (ruby_scan_digits): make public and add length parameter.
-
-Fri May 29 11:18:58 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal,
-	  bsock_recvmsg_internal):
-	  avoid redundant fcntl on Linux
-	  [ruby-core:69154] [Feature #11145]
-	* ext/socket/init.c (rsock_s_recvfrom_nonblock): ditto
-	* ext/socket/rubysocket.h (MSG_DONTWAIT_RELIABLE): new macro
-
-Fri May 29 10:30:34 2015  Eric Wong  <e@80x24.org>
-
-	* lib/net/resolv.rb (request): use monotonic clock
-	* lib/net/http.rb (begin_transport, end_transport): ditto
-	  [ruby-core:69384] [Feature #11124]
-
-Fri May 29 04:37:38 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* ext/objspace/objspace.c: add two methods to debug internals.
-
-	  * ObjectSpace.internal_class_of: return RBASIC_CLASS(obj).
-	  * ObjectSpace.internal_super_of: return RCLASS_SUPER(cls).
-
-	* NEWS: add information about both methods.
-
-	* test/objspace/test_objspace.rb: add tests for both methods.
-
-Thu May 28 06:55:53 2015  Anton Davydov  <antondavydov.o@gmail.com>
-
-	* ext/tk/sample/figmemo_sample.rb (open_file),
-	  ext/tk/sample/tktextio.rb (TkTextIO): fix typo in messages.
-	  [Fix GH-916]
-
-Wed May 27 09:50:51 2015  Eric Wong  <e@80x24.org>
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
-	  ossl_asn1_decode_all): use RB_GC_GUARD instead of volatile
-	  [ruby-core:69371] [Bug #11185]
-
-Wed May 27 09:27:30 2015  Eric Wong  <e@80x24.org>
-
-	* lib/drb/drb.rb (set_sockopt): remove redundant fcntl call
-	* lib/drb/unix.rb (set_sockopt): ditto
-	  [ruby-core:69128] [Feature #11137]
-
-Tue May 26 22:10:43 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* vm_method.c (rb_alias): should resolve refined methods.
-	  [ruby-core:69360] [Bug #11182]
-
-Tue May 26 21:35:13 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* include/ruby/defines.h (RUBY_ATTR_ALLOC_SIZE): fix condition.
-
-Mon May 25 22:35:58 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (rel): after the relations is changed,
-	  @changesets is no longer right.
-
-Mon May 25 11:27:14 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* win32/win32.c (setup_overlapped): seek to the file end only when
-	  writing (mode:a), not reading (mode:a+, read).
-
-Mon May 25 00:27:37 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* numeric.c (Numeric#negative?): [DOC] Fix call-seq.
-	  Patch by @yui-knk. [Fixes GH-908]
-
-Sun May 24 01:35:22 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* debug.c (ruby_debug_print_id): use rb_id2name() for fprintf().
-
-Sat May 23 18:38:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* man/*.1: updated dates in man pages.
-	  [ruby-dev:48988] [Bug #11171]
-
-Sat May 23 03:10:58 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_write_console): should return the count of
-	  actually eaten characters, include escape sequences.
-
-Fri May 22 22:36:14 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/prime.rb: Remove obsolete Prime.new
-	  patch by Ajay Kumar. [Fixes GH-891]
-
-Fri May 22 21:13:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/intern.h (rb_sym_count): move `rb_sym_all_symbols`
-	  to a symbol.c specific section.  a part of patch by Lourens
-	  Naude.
-
-Fri May 22 20:56:33 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* complex.c (f_complex_polar): simple bug reproduced only when y is
-	  a float but x is not a float.
-
-Fri May 22 19:42:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (rb_spawn_process): do not discard global escape
-	  status.  [ruby-core:69304] [Bug #11166]
-
-	* process.c (rb_execarg_spawn): extract the start procedure in a
-	  parent process with ensuring the end procedure.
-
-Fri May 22 16:48:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* NEWS: added news for net-telnet and rake
-
-Thu May 21 20:27:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* configure.in (RUBY_DTRACE_POSTPROCESS): cmp -b is GNU extension.
-	  darwin uses GNU cmp, and FreeBSD and Solaris are not.
-	  Note that accidentally equals to expected result.
-
-Thu May 21 18:00:19 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c: constify.
-
-	* iseq.h: ditto.
-
-	* method.h: ditto.
-
-	* proc.c: ditto.
-
-	* vm_method.c: ditto.
-
-Thu May 21 17:44:53 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c: fix issues caused by binding created from Method#to_proc.
-	  [Bug #11163]
-
-	* vm.c (vm_cref_new_toplevel): export as rb_vm_cref_new_toplevel().
-
-	* test/ruby/test_method.rb: add some assertions.
-
-Thu May 21 17:29:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/matrix.rb: added documentation for Matrix#empty and Matrix#/
-	  [Feature #10070][ruby-dev:48433] Patch by @gogotanaka
-
-Thu May 21 17:02:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c: rename functions.
-	  * method_get_def() -> method_def()
-	  * method_get_iseq() -> method_def_iseq()
-	  * method_get_cref() -> method_cref()
-
-Thu May 21 16:52:44 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c (rb_method_get_iseq): rename to rb_method_iseq.
-
-	* iseq.c: catch up this fix.
-
-	* iseq.h: commit ditto.
-
-Thu May 21 15:41:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/net/telnet.rb: gemify net-telnet.
-	  [Feature #11083]
-	* gems/bundled_gems: added net-telnet to bundled gems.
-
-Thu May 21 15:37:32 2015  Zachary Scott  <e@zzak.io>
-
-	* vm_method.c: Remove private attribute warning [Bug #10967]
-	  Patch by @spastorino [Fixes GH-849]
-	  https://github.com/ruby/ruby/pull/849
-
-	* test/ruby/test_module.rb: Update test for changes
-
-Thu May 21 10:59:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c (method_proc): rename to method_to_proc.
-
-Thu May 21 10:51:54 2015  Jake Worth  <jakeworth82@gmail.com>
-
-	* io.c (rb_f_select): [DOC] Fixes for grammar and style.
-	  [Fix GH-906]
-
-Thu May 21 08:25:19 2015  Eric Wong  <e@80x24.org>
-
-	* variable.c (Init_var_tables): init generic_iv_tbl
-	  (rb_generic_ivar_table, generic_ivar_get, generic_ivar_set,
-	   generic_ivar_defined, generic_ivar_remove,
-	   rb_mark_generic_ivar, givar_i, rb_mark_generic_ivar_tbl,
-	   rb_free_generic_ivar, rb_copy_generic_ivar, rb_ivar_foreach,
-	   rb_ivar_count): remove checks for uninitialize generic_iv_tbl
-	[ruby-core:69155] [Feature #11146]
-
-Thu May 21 04:11:03 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c (exception_type2symbol): show correct bug message.
-
-Wed May 20 23:19:05 2015  Yusuke Endoh  <mame@ruby-lang.org>
-
-	* lib/base64.rb: Fix rdoc-formatting for padding argument.
-	  [fix GH-905][ci skip] Patch by @davydovanton
-
-Wed May 20 13:16:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (DEPRECATED_BY): deprecate warning with preferable
-	  alternative.
-
-	* configure.in (RUBY_FUNC_ATTRIBUTE): allow attribute arguments in
-	  the macro.
-
-Wed May 20 11:23:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* vm_dump.c (rb_print_backtrace): return value of libexec's backtrace
-	  is size_t, so simply cast as int.
-
-Tue May 19 18:54:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* iseq.c (rb_iseq_compile_with_option): check source type, must be
-	  an IO or a String.  [ruby-core:69219] [Bug #11159]
-
-Tue May 19 17:15:03 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/benchmark.rb: Update Benchmark documentation and formatting.
-	  [fix GH-903][ci skip] Patch by @davydovanton
-
-Tue May 19 13:10:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* numeric.c (num_positive_p): should false on Bignum 0.
-	  http://twitter.com/rafaelfranca/status/600509783427391488
-	  [ruby-core:69173] [Feature #11151]
-
-Tue May 19 11:22:28 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* lib/uri/rfc2396_parser.rb (initialize_pattern):
-	  URI::Generic.build should accept port as a string.
-	  pattern[:PORT] is not defined for long.
-	  by Dave Slutzkin <daveslutzkin@fastmail.fm>
-	  https://github.com/ruby/ruby/pull/804 fix GH-804
-
-Tue May 19 11:18:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/ruby.h (rb_data_typed_object_alloc),
-	  (rb_data_object_alloc): add old names for source level backward
-	  compatibilities.
-
-	* gc.c (rb_data_object_alloc, rb_data_typed_object_alloc): add
-	  aliases for binary level backward compatibilities.
-
-Tue May 19 09:54:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/ruby.h (Data_Make_Struct0): needs function pointer
-	  casts to fix function overloading in C++.
-
-Tue May 19 09:43:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/ruby.h (Data_Make_Struct0, TypedData_Make_Struct0):
-	  explicit cast from void* is necessary as implicit cast is
-	  disallowed in C++.
-
-Mon May 18 15:31:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/intern.h (rb_f_notimplement): should not respond to
-	  not-implemented methods.  as the address inside a DLL and the
-	  imported address are different on Windows, use an exported
-	  variable to share the same address.
-
-Mon May 18 13:55:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/monitor.rb (mon_try_enter, mon_enter): should reset @mon_count
-	  just in case the previous owner thread dies without mon_exit.
-	  [fix GH-874] Patch by @chrisberkhout
-
-Sun May 17 17:21:29 2015  Eric Wong  <e@80x24.org>
-
-	* lib/webrick/utils.rb (set_non_blocking): use IO#nonblock=
-	* (set_close_on_exec): use IO#close_on_exec=
-	  [Feature #11136]
-
-Sun May 17 15:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* numeric.c (num_positive_p, num_negative_p): add methods
-	  Numeric#positive? and Numeric#negative?.
-	  [ruby-core:69173] [Feature #11151]
-
-	* numeric.c (flo_positive_p, flo_negative_p): specialized
-	  functions for Float.
-
-	* complex.c (Init_Complex): Complex do not have positive? and
-	  negative? methods
-
-Sun May 17 14:57:42 2015  Eric Wong  <e@80x24.org>
-
-	* lib/webrick/server.rb (accept_client): avoid redundant fcntl call
-	  [Feature #11137]
-
-Sun May 17 12:13:33 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/init.c (cloexec_accept): support nonblock flag and
-	  use SOCK_NONBLOCK if possible
-	* ext/socket/init.c (rsock_s_accept_nonblock):
-	  update cloexec_accept call
-	* ext/socket/init.c (accept_blocking): ditto for blocking
-	* test/socket/test_nonblock.rb: check nonblock? on accepted socket
-	  [Feature #11138]
-
-Sun May 17 03:58:59 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* load.c (loaded_feature_path): stop returning false negatives for
-	  filenames which are trailing substrings of file extensions.  For
-	  example, 'b', which a trailing substring of ".rb" should not return
-	  false. [Bug #11155][ruby-core:69206]
-
-	* test/ruby/test_autoload.rb: test for fix
-
-Sat May 16 21:41:24 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* string.c: added documentation for character sequence \' with String#sub
-	  [Bug #11132][ruby-core:69121][fix GH-900][ci skip] Patch by @shishir127
-
-Sat May 16 21:38:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* enum.c: fix a sample code. Patch by @eagletmt
-	  [fix GH-901][ci skip]
-
-Sat May 16 21:17:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (rb_data_object_wrap, rb_data_typed_object_wrap): rename
-	  alloc as wrap.  these functions do not allocate data pointers
-	  but just wrap the given pointers.
-
-Sat May 16 19:59:24 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_accept): simplified.
-
-Fri May 15 18:28:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_assoc, rb_ary_rassoc): [DOC] the result when key
-	  was found is the existing element, not a new array.  reported by
-	  Giau Nguyen <giaunv AT nustechnology.com>.
-
-Fri May 15 08:24:28 2015  Takeyuki FUJIOKA  <xibbar@ruby-lang.org>
-
-	* lib/cgi/cookie.rb: Implement HttpOnly flag for cookies.
-	  [fix GH-887] Patch by @martinpovolny
-
-Fri May 15 06:54:19 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* variable.c: Change autoload to call `require` through Ruby rather
-	  than directly calling `rb_require_safe`.  This allows things like
-	  RubyGems to intercept file loading done though `autoload`.
-	  [Feature #11140]
-
-	* test/ruby/test_autoload.rb: Test for change.
-
-Wed Apr  8 19:18:02 2015  Shota Fukumori (sora_h)  <her@sorah.jp>
-
-	* enum.c (enum_grep_v, grep_i, grep_iter_i, Init_enum):
-	  Implement Enumerable#grep_v. [Feature #11049]
-
-Thu May 14 15:54:13 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/pathname/lib/pathname.rb: Remove condition of RUBY_VERSION <= 1.9.
-	  [Feature #11082]
-
-Wed May 13 17:10:37 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* enum.c (enum_to_a): revert r50457.
-	  it requires recursion check.
-	  then, it doesn't make performance improvement.
-	  [Bug #11130] [Feature #9118]
-
-Wed May 13 11:13:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (parse_gvar): separate message for gvar without
-	  non-space characters from message for invalid identifiers.
-
-Tue May 12 22:18:27 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* enum.c (enum_to_a): fix incompatibility introduced in r50457.
-	  [Bug #11130]
-
-	* test/ruby/test_enum.rb: test for above.
-
-Tue May 12 17:08:03 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: remove unused declaration.
-
-Mon May 11 10:58:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* gems/bundled_gems: Update minitest-5.6.1 and power_assert-0.2.3.
-
-Mon May 11 00:20:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/ruby.h (Data_Make_Struct, TypedData_Make_Struct):
-	  allocate wrapper data object before allocating DATA_PTR to get
-	  rid of possible memory leak when the former failed.
-
-Sun May 10 21:32:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (gc_mark_children): call dmark function for non-NULL
-	  pointers only, so that DATA_PTR can be NULL safely now.
-
-Sun May 10 16:23:58 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
-
-	* proc.c (proc_binding): fix segmentation fault on marking phase.
-	  envptr of newenvval should not be NULL.
-
-	  You can reproduce by
-	   make test-all TESTS='--gc-stress -n test_to_proc_binding ruby/test_method.rb'
-
-Sun May 10 12:41:18 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* ext/zlib/zlib.c (rb_gzreader_external_encoding):
-	  define GzipReader#external_encoding.
-	  [Bug #10900]
-
-	* test/zlib/test_zlib.rb: test for above.
-
-Sun May 10 11:57:48 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* ext/win32ole/win32ole_variant.c: fix typo "indicies".
-	  the patch is from davydovanton <antondavydov.o at gmail.com>.
-	  [fix GH-892]
-
-	* lib/rubygems/indexer.rb: ditto.
-
-	* test/rubygems/test_gem_indexer.rb: ditto.
-
-Sun May 10 11:44:37 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* string.c (rb_str_crypt): Raise ArgumentError when
-	  string passed to String#crypt contains null.
-	  the patch is from jrusnack <jrusnack at redhat.com>.
-	  [Bug #10988] [fix GH-853]
-
-	* test/ruby/test_string.rb: test for above.
-
-Sun May 10 11:23:03 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* enum.c (enum_to_a): Use size to set array capa when possible.
-	  the patch is from HonoreDB <aweiner at mdsol.com>.
-	  [fix GH-444]
-
-Sat May  9 06:48:36 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_recvmsg_internal): GC guard
-	  [Bug #11123]
-
-Fri May  8 22:57:24 2015  takiy33  <takiy33@gmail.com>
-
-	* test/matrix/test_matrix.rb (test_determinant): refactor test on
-	  Matrix#determinant, by merging with test_det for an alias method
-	  det.  [Fix GH-897]
-
-Fri May  8 15:43:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (body_ext_mpart): should work even if body-fld-dsp
-	  is omitted.  [ruby-core:69093] [Bug #11128]
-
-Fri May  8 15:05:57 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* doc/syntax/control_expressions.rdoc: fix a missing "a"
-	  [fix GH-888][ci skip] Patch by @riffraff
-
-Fri May  8 12:11:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (rb_method_call_status): resolve refined method entry
-	  to check if undefined.  [ruby-core:69064] [Bug #11117]
-
-Thu May  7 22:22:59 2015  Sho Hashimoto  <sho-h@ruby-lang.org>
-
-	* proc.c: [DOC] fix Binding#local_variable_set example. [ci skip]
-
-Thu May  7 11:32:57 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* Makefile.in (rbconfig.rb): add rule to make.
-
-Thu May  7 05:14:39 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/lib/socket.rb (connect_nonblock): use IO#wait_writable
-	* lib/drb/drb.rb (DRB::DRbTCPSocket#alive?): use IO#wait_readable
-	* lib/webrick/httpserver.rb (run): ditto
-	* lib/resolv.rb (request): ditto for single socket case
-	  [ruby-core:68943] [Feature #11081]
-
-Wed May  6 22:49:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (rb_method_call_status): undefined refined method is
-	  not callable unless using.  [ruby-core:69064] [Bug #11117]
-
-Sun May  3 22:40:06 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* ext/-test-/file/fs.c: need to include sys/statvfs.h
-	  to use statvfs().
-
-	* ext/-test-/file/extconf.rb: check the existence of
-	  sys/statvfs.h
-
-Sun May  3 21:59:48 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/yaml.rb: fix typo. [ci skip][fix GH-890]
-	  Patch by @miketheman
-
-Sun May  3 10:02:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* range.c (linear_object_p, range_include): test if covered for
-	  linear objects.  [ruby-core:69052] [Bug #11113]
-
-Fri May  1 13:30:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dln.c (dln_load): check if a different libruby is loaded by the
-	  extension library, and then bail out to get rid of very frequent
-	  reported stale bug reports.
-
-Thu Apr 30 19:51:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* compile.c (iseq_compile_each): revert r46873 and r46875, not to
-	  allow to execute private readers by pretending op assign.
-	  [ruby-core:68984] [Bug #11096]
-
-Thu Apr 30 17:02:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* rational.c: Added documentation for rational literal.
-	  [Bug #11075][fix GH-885][ci skip] Patch by @shishir127
-
-Thu Apr 30 16:39:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/socket/ipsocket.c (init_inetsock_internal): preserve errno
-	  before other library calls and use rb_syserr_fail.
-	  [ruby-core:68531] [Bug #10975]
-
-Thu Apr 30 16:22:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (lambda): push and reset cmdarg_stack in lambda body.
-	  [ruby-core:69017] [Bug #11107]
-
-Sun Apr 26 07:36:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* enc/utf_8.c (code_to_mbclen, code_to_mbc): reject values larger
-	  than UTF-8 max codepoints.  [Feature #11094]
-
-Sat Apr 25 14:26:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (str_buf_cat): expand later so that the buffer can be
-	  larger for further use.  [Bug #11080] [Bug #11095]
-
-Fri Apr 24 23:48:45 2015  Akinori MUSHA  <knu@iDaemons.org>
-
-	* misc/ruby-electric.el: Import version 2.2.3 from
-	  https://github.com/knu/ruby-electric.el.
-
-Fri Apr 24 10:40:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_{getc,putc}): removed.  they are needed for old
-	  ruby (before 1.8), but not now.
-
-Fri Apr 24 08:40:13 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* win32/win32.c: remove bcc related code.
-
-	* include/ruby/win32.h: ditto.
-
-Fri Apr 24 08:21:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* win32/win32.c (rb_acrt_lowio_lock_fh): wrap _pioinfo(i)->lock.
-
-	* win32/win32.c (rb_acrt_lowio_unlock_fh): ditto.
-
-Fri Apr 24 06:47:19 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* win32/win32.c (_filbuf): msvc14 doesn't have it, use _fgetc_nolock.
-
-	* win32/win32.c (_flsbuf): msvc14 doesn't have it, use _fputc_nolock.
-
-	* win32/win32.c (vcruntime_file): define vcruntime_file on msvc14
-	  because it doesn't export FILE's internal structure.
-
-	* win32/win32.c (FILE_COUNT): added to abstract FILE->_cnt.
-
-	* win32/win32.c (FILE_READPTR): added to abstract FILE->_ptr.
-
-	* win32/win32.c (FILE_FILENO): added to abstract FILE->_file.
-
-	* win32/win32.c (init_stdhandle): use FILE_FILENO.
-
-	* win32/win32.c (rb_w32_getc): use FILE_COUNT and FILE_READPTR.
-
-	* win32/win32.c (rb_w32_putc): ditto.
-
-Fri Apr 24 06:37:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* win32/win32.c (dupfd): use _set_osfhnd.
-
-	* win32/win32.c (rb_w32_wopen): use _set_osflags.
-
-Thu Apr 24 05:38:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_mark_roots): fox to work PRINT_ROOT_TICKS.
-
-Fri Apr 24 04:49:05 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* win32/Makefile.sub: MSVC14 have struct timespec.
-
-	* win32/rtname.cmd: support vcruntime140.dll.
-
-	* time.c (localtime_with_gmtoff_zone): MSVC14 doesn't have tzname and
-	  daylight but have _tzname and _daylight.
-
-Thu Apr 23 11:35:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (rb_obj_instance_eval, rb_obj_instance_exec): allow
-	  symbols to just instance_eval/exec, except for definition of
-	  singletons.  [ruby-core:68961] [Bug #11086]
-
-Thu Apr 23 10:01:36 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/delegate.rb: fix a typo.
-	  [fix GH-881][ci skip] Patch by @Zorbash
-
-Wed Apr 22 18:36:50 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (move, uid_move): support the MOVE command defined
-	  in RFC6851.  Patch by ojab ojab.
-	  [ruby-core:68960] [Feature #11077]
-
-Tue Apr 22 12:42:12 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* test/ruby/test_object.rb: add tests for Kernel#String and Kernel#Array.
-	  [fix GH-879][fix GH-880] Patch by @yui-knk
-
-Tue Apr 21 20:46:02 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* test/ruby/test_object.rb: renamed tests to explicitly class name.
-	  [fix GH-877] Patch by @yui-knk
-
-Tue Apr 21 05:31:00 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/lib/socket.rb (connect_internal): avoid common exceptions
-	  from connect_nonblock. [ruby-core:68909]
-
-Mon Apr 20 23:46:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_wreadlink): follow the official format of
-	  REPARSE_DATA_BUFFER structure.
-
-Mon Apr 20 20:23:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* common.mk ($(arch)-fake.rb): revert r50354 because bsdmake seems not
-	  to handle such substitution.
-
-	* tool/expand-config.rb: convert path separators here.
-
-Mon Apr 20 16:52:20 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/fake.rb: don't fake libdir.  use libdirname instead.
-
-Mon Apr 20 16:49:52 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/mkmf.rb (MakeMakefile#configuration): DESTDIR should never affect
-	  top_srcdir and builddir.
-
-Mon Apr 20 16:18:17 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* common.mk ($(arch)-fake.rb): fix the path separator up for Windows.
-
-Mon Apr 20 15:02:47 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_wreadlink): fixed a bug that a junction misses
-	  its drive letter.
-
-Mon Apr 20 12:54:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/openssl/*: use license instead of licence.
-	  [fix GH-876][ci skip] Patch by @davydovanton
-	* lib/net/https.rb: ditto.
-
-Mon Apr 20 12:42:40 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* benchmark/bm_so_meteor_contest.rb: fix a typo.
-	  [fix GH-876][ci skip] Patch by @davydovanton
-	* tool/bisect.sh: ditto.
-	* tool/update-deps: ditto.
-
-Mon Apr 20 11:10:46 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/socket.c (sock_connect_nonblock): do not raise EISCONN
-	  [ruby-core:68926] [Feature #11072]
-	* test/socket/test_nonblock.rb: check non-EISCONN on 2nd connect
-
-Sun Apr 19 12:19:17 2015  Chad Brewbaker  <crb002@gmail.com>
-
-	* ext/{etc,openssl,tk}: Adding parens and comparisons around
-	  assignments to get rid of Wparentheses warnings.  [Fix GH-875]
-
-Sun Apr 19 10:42:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (get_env_cstr): environment variables must be ASCII
-	  compatible, as dummy encodings and wide char encodings are
-	  unsupported now.
-
-Sat Apr 18 15:18:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/json/parser/parser.rl: raise with messages in UTF-8
-	  encoding.  [ruby-core:67386] [Bug #10705]
-
-Fri Apr 17 11:58:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (STR_SET_EMBED): clear NOFREE flag at embedding as
-	  embedded strings no longer refer static strings.
-	  [ruby-core:68436] [Bug #10942]
-
-Thu Apr 16 05:15:50 2015  Eric Wong  <e@80x24.org>
-
-	* NEWS: note IO#wait_readable change in r50263
-
-Thu Apr 16 05:09:36 2015  Eric Wong  <e@80x24.org>
-
-	* lib/net/protocol.rb (rbuf_fill): use IO#wait_*able
-	* lib/net/http/generic_request.rb (wait_for_continue): ditto
-	  [ruby-core:68891] [Feature #11056]
-
-Wed Apr 15 18:43:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_trace.c (rb_tracepoint_new): fix documentation.
-	  Commented by @emilsoman.
-
-Wed Apr 15 17:36:51 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_trace.c (rb_tracepoint_new): Add documentation for
-	  rb_tracepoint_new C level API [ci skip]
-	  Provided by @emilsoman. [fix GH-869]
-
-Wed Apr 15 10:37:40 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* doc/contributors.rdoc: fix a typo. Patch by @davydovanton
-	  [fix GH-872][ci skip]
-	* doc/syntax/methods.rdoc: ditto.
-	* ext/digest/sha2/sha2.c: ditto.
-	* ext/socket/ipsocket.c: ditto.
-	* ext/tk/*: ditto.
-
-Wed Apr 15 07:51:23 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
-
-	* doc/extension.ja.rdoc: Added description of TypedData_XXX.
-	  Deprecated the old DATA_XXX.
-	  Reviewed by ko1 and nobu.
-	  Fixes [ruby-dev:40881] #3064
-
-	* doc/extension.rdoc: ditto.
-
-Wed Apr 15 07:34:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* thread_pthread.c (reserve_stack): keep sp safe zone to get rid
-	  of crash by -fstack-check.  [ruby-core:68740] [Bug #11030]
-
-Tue Apr 14 16:03:49 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/merger.rb (versionup): should also increment revision when
-	  changing teeny.
-
-Tue Apr 14 11:24:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/-test-/printf/printf.c (uint_to_str): renamed to get rid of
-	  conflict on cygwin.  [ruby-core:68877] [Bug #11065]
-
-Tue Apr 14 08:59:04 2015  Zachary Scott  <e@zzak.io>
-
-	* gc.c: [DOC] Improve documentation for ObjectSpace.count_objects
-	  with regards to `:TOTAL` key, with patch by @schneems [Fixes GH-871]
-	  https://github.com/ruby/ruby/pull/871 [Bug #11067]
-
-Mon Apr 13 22:44:07 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/lib/envutil.rb (File.mkfifo): Defined using mkfifo command.
-
-	* test/ruby/test_io.rb: Use File.mkfifo.
-
-	* test/ruby/test_file_exhaustive.rb: Ditto.
-
-	* test/ruby/test_process.rb: Ditto.
-
-Mon Apr 13 21:20:20 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb: stricter hostname verification
-	  following RFC 6125. with the patch provided by Tony Arcieri and
-	  Hiroshi Nakamura [ruby-core:61545] [Bug #9644]
-	* test/openssl/test_ssl.rb: add tests for above.
-
-Sun Apr 12 18:40:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json/json.gemspec: bump version to 1.8.2.
-	* ext/json/lib/json/version.rb: ditto.
-
-Sun Apr 12 18:12:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json/json.gemspec, lib/rdoc/rdoc.gemspec: added gemspec directly.
-	* defs/default_gems, tool/rbinstall.rb: removed default_gems definition.
-	  it make simple installation for default gems.
-
-Sun Apr 12 17:35:17 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json/*, test/json/*: Reverted r50231.  Because it's not
-	  working with cross-compile environment.
-
-Sun Apr 12 15:34:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (arg): fix segfault by null caused by syntax error.
-	  [ruby-core:68851] [Bug #10957]
-
-Sun Apr 12 15:11:16 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems/test_case.rb: use explicitly exception class and reverted
-	  to require JSON library for rubygems tests with Ruby 2.2.0 or earlier.
-
-Sun Apr 12 15:10:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/io/wait/wait.c (io_wait_readable): simply returns that IO is
-	  readable without blocking, but no longer returns EOF.
-
-	* ext/io/wait/wait.c (io_ready_p, io_wait_readable): try polling
-	  first and check FIONREAD optionally to see if EOF.
-	  [ruby-core:36805] [Feature #4849]
-
-Sun Apr 12 14:53:23 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems/test_case.rb: fixed json load error for rubygems tests.
-
-Sun Apr 12 14:13:28 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* gc.c: Document require name for ObjectSpace methods.
-	  [ci skip][fix GH-860] Patch by @schneems
-
-Sun Apr 12 13:54:05 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_io.rb: New test that open(fifo) doesn't block other
-	  threads.
-
-Sun Apr 12 13:52:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/coverage/coverage.c: Remove extension from require argument.
-	  [ci skip][fix GH-870] Patch by @yui-knk
-
-Sun Apr 12 10:29:14 2015  Eric Wong  <e@80x24.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_connect_nonblock):
-	  support `exception: false'
-	* (get_no_exception): move function location
-	* ext/socket/socket.c (sock_connect_nonblock):
-	  support `exception: false'
-	* test/openssl/test_pair.rb (test_connect_accept_nonblock_no_exception):
-	  test `exception: false' on connect,
-	  rename from `test_accept_nonblock_no_exception'
-	* test/socket/test_nonblock.rb (test_connect_nonblock_no_exception):
-	  new test
-
-Sun Apr 12 09:57:16 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test a block device on GNU/Linux.
-
-Sun Apr 12 09:24:03 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test a file not owned.
-
-Sun Apr 12 09:05:44 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/fiddle/depend: Fix "Wrong mix of special targets" error with
-	  OpenBSD make.
-
-Sun Apr 12 09:04:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_file_exhaustive.rb: Windows doesn't support Unix file
-	  modes.
-
-Sun Apr 12 08:56:44 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/-test-/file/fs.c: OpenBSD needs sys/param.h before sys/mount.h.
-
-Sun Apr 12 08:52:01 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test suid, sgid and sticky file.
-
-Sat Apr 11 23:48:30 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* template/fake.rb.in: Don't assign baseruby, Because it's affect to
-	  Makefile of native gem like json on bundled gems.
-
-Sat Apr 11 23:33:22 2015  Tanaka Akira  <akr@fsij.org>
-
-	* file.c (rb_f_test): Consider nsec for "=", "<" and ">" for "test"
-	  method.
-
-Sat Apr 11 23:26:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/rbinstall.rb: support destdir for native extension gem.
-
-Sat Apr 11 21:02:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_file_exhaustive.rb
-	  (TestFileExhaustive#test_stat_socket_p): r50226 accidentally missed
-	  the guard for non-unix environments.
-
-Sat Apr 11 20:14:21 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json/*, test/json/*, defs/default_gems: Gemify JSON library.
-	  [fix GH-867][Feature #11057]
-	* test/ruby/test_extlibs.rb: removed json gem from existence extensions.
-	* gems/bundled_gems: added json gem into bundled gem.
-	* lib/rdoc/rubygems_hook.rb: ignored no json environment.
-	* lib/rubygems/test_case.rb, test/rubygems/*: ditto.
-	* lib/rdoc/test_case.rb, test/rdoc/*: ditto.
-
-Sat Apr 11 15:56:58 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Create sample files lazily.
-
-Sat Apr 11 14:03:47 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test character device using
-	  /dev/null.
-
-Sat Apr 11 10:59:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (append_cppflags, append_cflags, append_ldflags):
-	  utility methods to append compiler options.
-
-Sat Apr 11 08:22:24 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rdoc/text.rb: removed duplicated code.
-
-Sat Apr 11 04:46:42 2015  Eric Wong  <e@80x24.org>
-
-	* lib/net/protocol.rb (rbuf_fill): avoid exception with read_nonblock
-	  [ruby-core:68787] [Feature #11044]
-
-Fri Apr 10 23:57:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (need_normalization): use getattrlist() if fgetattrlist()
-	  is unavailable, on OSX 10.5.  [ruby-core:68829] [Bug #11054]
-
-Fri Apr 10 22:29:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (try_compile): pass the given werror flag to try_do
-	  to check if stderr is empty.
-
-	* lib/mkmf.rb (try_cflags, try_ldflags): default werror to true.
-
-	* win32/Makefile.sub (WERRORFLAG): remove useless option.  VC does
-	  not make warnings of unknown command option an error.
-
-Fri Apr 10 19:34:24 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test socket.
-
-Fri Apr 10 19:38:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/objspace/test_objspace.rb: remove debug prints.
-
-Fri Apr 10 19:35:51 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* ext/objspace/objspace.c: add ObjectSpace.count_imemo_objects method
-	  to count imemo objects for each type.
-
-	* test/objspace/test_objspace.rb: add a test.
-
-	* NEWS: describe about this addition.
-
-Fri Apr 10 19:34:24 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test anonymous pipe.
-
-Fri Apr 10 19:31:56 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test named pipe.
-
-Fri Apr 10 19:10:34 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* ext/objspace/objspace.c (setup_hash): unify common routine.
-
-Fri Apr 10 18:29:49 2015  Tanaka Akira  <akr@fsij.org>
-
-	* process.c (rb_execarg_parent_start1): Handle EINTR.
-
-Fri Apr 10 17:27:58 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c (vm_exec): check other events when RETURN is thrown.
-	  [Bug #10724]
-
-	* test/ruby/test_settracefunc.rb: add a test.
-
-Fri Apr 10 11:44:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/date/extconf.rb: check warnings.
-
-	* lib/mkmf.rb (try_cflags): pass options to try_compile.
-
-	* win32/Makefile.sub (WERRORFLAG): make unknown command line
-	  options an error.
-
-Fri Apr 10 08:00:17 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_process.rb: unfortunately, windows is not POSIX...
-	  cygwin has mkfifo command, but it does not affect system-wide.
-
-Fri Apr 10 02:18:53 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_process.rb: Use mkfifo command instead of mknod
-	  command to create a named pipe.  mkfifo command is defined by POSIX.
-
-Fri Apr 10 01:29:05 2015  Tanaka Akira  <akr@fsij.org>
-
-	* process.c: Release GVL when opening a file in spawn() to avoid whole
-	  process blocking when opening a named pipe.
-	  (open_func): New function.
-	  (rb_execarg_parent_start1): Extracted from rb_execarg_parent_start and
-	  use rb_thread_call_without_gvl2 to release GVL when opening a file.
-	  (rb_execarg_parent_start): Invoke rb_execarg_parent_start1 via
-	  rb_protect and invoke rb_execarg_parent_end when error.
-
-Thu Apr  9 22:19:19 2015  Tanaka Akira  <akr@fsij.org>
-
-	* process.c (redirect_open): Removed.
-
-Thu Apr  9 21:38:20 2015  Tanaka Akira  <akr@fsij.org>
-
-	* internal.h (rb_execarg_parent_end): Declared.
-
-	* process.c: "spawn" opens files in the parent process.
-	  (check_exec_redirect): Add an placeholder for fd in parameters
-	  for fd_open.
-	  (check_exec_fds_1): Delete fd_open condition.
-	  (check_exec_fds): Don't call check_exec_fds_1 with fd_open.
-	  (rb_execarg_parent_start): Open files specified as "spawn" options
-	  and add "dup2" options.
-	  (rb_execarg_parent_end): New function to close opened fds.
-	  (run_exec_open): Removed.
-	  (rb_execarg_run_options): Don't call run_exec_open.
-	  (rb_spawn_internal): Call rb_execarg_parent_end.
-
-	* io.c (pipe_open): Call rb_execarg_parent_end.
-
-	* ext/pty/pty.c (establishShell): Call rb_execarg_parent_end.
-
-Thu Apr  9 20:52:31 2015  Tanaka Akira  <akr@fsij.org>
-
-	* internal.h (rb_execarg_parent_start): Renamed from rb_execarg_fixup.
-
-	* process.c: Follows the above change.
-
-	* io.c: Ditto.
-
-	* ext/pty/pty.c: Ditto.
-
-Thu Apr  9 20:35:12 2015  Tanaka Akira  <akr@fsij.org>
-
-	* process.c (fd_clear_cloexec): Extracted from run_exec_dup2.
-
-Thu Apr  9 09:26:47 2015  Eric Wong  <e@80x24.org>
-
-	* ccan/list/list.h: sync with ccan upstream
-	  [ccan commit c2fbfe5282ba264f3485586e7efa8a5967f2d386]
-
-Thu Apr  9 08:24:03 2015  Masahiro Tomita  <tommy@tmtm.org>
-
-	* ext/socket/raddrinfo.c (addrinfo_mload): fix memory leak of
-	  addrinfo.  [ruby-dev:48923] [Bug #11051]
-
-Wed Apr  8 17:45:02 2015  Shannon Skipper  <shannonskipper@gmail.com>
-
-	* version.c (Init_version): the version of the engine or
-	  interpreter.  [Fix GH-858]
-
-Wed Apr  8 16:15:30 2015  Kenta Murata  <mrkn@cookpad.com>
-
-	* bigdecimal: conform to ruby's license.  [ruby-core:68466] [Bug #10952]
-
-Wed Apr  8 14:57:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_wreadlink): should treat junctions like as
-	  symlinks.
-
-Wed Apr  8 14:03:47 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/ruby/test_symbol.rb: fix syntax error.
-
-Wed Apr  8 13:01:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (rb_any_hash): Symbols are compared by the identities
-	  always.  [ruby-core:68767] [Bug #11035]
-
-Tue Apr  7 10:22:51 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* internal.h: fix typo. Patch by @sferik [fix GH-865]
-
-Mon Apr  6 22:52:35 2015  Tanaka Akira  <akr@fsij.org>
-
-	* enum.c: Enumerable#chunk and Enumerable#slice_before no longer takes
-	  the initial_state argument.  [Feature #10958]
-
-Mon Apr  6 16:09:58 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_args.c: protect value stack from calling other methods
-	  during complex parameter setting process (splat, kw, and so on).
-	  [Bug #11027]
-
-	* vm_core.h: remove rb_thread_t::mark_stack_len.
-	  With this modification, we don't need to use th->mark_stack_len.
-
-	* test/ruby/test_keyword.rb: add a test.
-
-	* cont.c (cont_capture): catch up this fix.
-
-	* vm.c (rb_thread_mark): ditto.
-
-Mon Apr  6 11:26:42 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* tool/downloader.rb (http_options): prevent content auto decoding
-	  because this is a downloader.
-
-Sun Apr  5 09:55:18 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* doc/contributing.rdoc: update Maintainers list.
-
-Sun Apr  5 09:11:00 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/rbinstall.rb: fix bin script permission of bundled gems.
-
-Sun Apr  5 08:46:08 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/rbinstall.rb: support --program-suffix option.
-
-Sat Apr  4 21:31:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rake/*: Gemify rake [fix GH-862][Feature #11025]
-	* test/rake/*: ditto.
-	* tool/rbinstall.rb: ditto.
-
-Sat Apr  4 11:30:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_setbyte): check the argument first not to
-	  discard shared string and code range unnecessarily until
-	  actually changing the contents.  pointed out by headius.
-
-Sat Apr  4 08:16:43 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* lib/net/http.rb (edit_path): use path which is absolute ftp url
-	  on using ftp_proxy.
-
-Fri Apr  3 11:43:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (vm_call0_cfunc): update invoker arguments.
-
-	* vm_insnhelper.c (vm_call_cfunc_latter): ditto.
-
-	* vm_insnhelper.c (rb_vm_call_cfunc_push_frame): ditto, and prefix
-	  with rb_.
-
-Thu Apr  2 16:26:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk, tool/mkconfig.rb: check the running ruby version in
-	  rbconfig.rb with the program version, as RUBY_VERSION has never
-	  been affected by --with-ruby-version option.
-	  [ruby-core:68639] [Bug #11002]
-
-	* configure.in (LIBRUBY_DLDFLAGS): compatibility_version must be
-	  valid version numbers, not an arbitrary string.
-
-Wed Apr  1 11:09:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (push_glob): remove indirect links of arguments for
-	  trampoline.
-
-Wed Apr  1 09:59:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/fileutils.rb (FileUtils#mv): show the exact target path in
-	  the error message instead of the destination parent directory
-	  name.  patched by Joao Britto <jabcalves AT gmail.com> at
-	  [ruby-core:68706].  [Bug #11021]
-
-Tue Mar 31 15:25:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/ChangeLog-0.06_to_0.52: added archived Changelog.
-	  [ruby-list:50105]
-	* doc/ChangeLog-0.50_to_0.60: ditto.
-	* doc/ChangeLog-0.60_to_1.1: ditto.
-
-Mon Mar 30 22:02:55 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* README.EXT.ja: add redirect [ruby-core:68631]
-
-Mon Mar 30 14:42:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (fileattr_to_unixmode, winnt_lstat): deal with
-	  symbolic link than directory, and set executable bits.
-
-Mon Mar 30 11:27:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (copy_stream_body): use the arguments without conversion if
-	  having read, readpartial, and write methods, than conversion by
-	  to_path method.  [ruby-core:68676] [Bug #11015]
-
-Sun Mar 29 21:08:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* gc.c (objspace_allrefs_destruct_i): fix a typo.
-	  [Bug #11013]
-
-Sun Mar 29 11:51:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* proc.c (proc_binding): replicate env from method object, and
-	  allocate the local variable area for the iseq local table.
-	  [ruby-core:68673] [Bug #11012]
-
-Sat Mar 28 09:19:41 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/date/extconf.rb: try_cflags("-std=iso9899:1999") [Bug #10906]
-	  ruby itself (including numeric.c) is built with strict compile
-	  options including -std=iso9899:1999, but ext/date is not.
-	  By the way -std=iso9899:1999 is not only a warning option but also
-	  changes behavior like MACRO definitions for example INFINITY.
-	  gcc on Solaris affect this.
-
-Fri Mar 27 16:34:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk: revert using BOOTSTRAPRUBY for enc.mk, as
-	  enc/depend uses CONFIG.  [ruby-core:68647] [Bug #11004]
-
-Thu Mar 26 10:05:13 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* test/test_observer.rb: add tests for Observable module.
-	  [fix GH-859] Patch by @brightbits
-
-Thu Mar 26 06:35:10 2015  Eric Wong  <e@80x24.org>
-
-	* README.EXT: add redirect [ruby-core:68631]
-
-Wed Mar 25 16:46:49 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/socket/extconf.rb: Solaris 11 has struct tcp_info.tcpi_ca_state,
-	  but it is a dummy.
-
-	* ext/socket/option.c: Solaris 11 doesn't have u_intN_t.
-
-	* ext/socket/option.c: Solaris 11 needs inspect_tcpi_msec.
-
-	* ext/socket/raddrinfo.c: Solaris 11 has AF_PACKET but doesn't have
-	  related macros.
-
-Wed Mar 25 17:03:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/-test-/file/fs.c (get_fsname): try magic number only if
-	  f_type is included.  [ruby-dev:48913] [Bug #11000]
-
-Wed Mar 25 11:20:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* benchmark/bm_hash_aref_flo.rb: make more realistic data.
-	  [ruby-core:68632] [[Bug #10999]
-
-Wed Mar 25 10:39:06 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .document: removed needless entries.
-
-Wed Mar 25 08:07:28 2015  Eric Wong  <e@80x24.org>
-
-	* doc/extension.rdoc: fix spelling of filename
-	* doc/extension.ja.rdoc: ditto.
-
-Tue Mar 25 06:55:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* complex.c (k_inexact_p, k_exact_zero_p): use k_exact_zero_p macro
-	  to remove k_inexact_p macro.
-
-	* complex.c (k_exact_one_p): remove unused macro k_exact_one_p.
-
-Tue Mar 24 22:23:33 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/extention.rdoc: move from toplevel document and added extname.
-	* doc/extention.ja.rdoc: ditto.
-
-Tue Mar 24 22:06:58 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/standard_library.rdoc: strip.
-
-Tue Mar 24 22:06:27 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/standard_library.rdoc: move Thread to Extensions.
-
-Tue Mar 24 21:59:10 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/contributing.rdoc: update Maintainers list.
-
-Tue Mar 24 19:10:24 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_writebarrier_generational): fix messages for rb_bug().
-	  Remove `rb_' prefix.
-
-	* gc.c (gc_writebarrier_incremental): ditto.
-
-Tue Mar 24 17:34:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* README.ja.md: should be chunibyo.
-
-Tue Mar 24 17:30:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/-test-/file/fs.c (get_fsname): return filesystem name by
-	  statfs/statvfs.  [ruby-core:68624] [Bug #10998]
-
-Tue Mar 24 16:46:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: now doesn't required spaces just after
-	  `!`.
-
-Mon Mar 23 23:18:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (dir_close): don't raise on double close for consistent to
-	  IO#close.  [Feature #10950]
-
-Mon Mar 23 21:22:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/file.c (rb_readlink): move from file.c for better buffer
-	  allocation and the result encoding.
-
-	* win32/win32.c (wreadlink, rb_w32_ureadlink): implement readlink().
-
-Mon Mar 23 14:40:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (winnt_stat): stat with following symbolic links.
-
-	* win32/win32.c (winnt_lstat): rename old winnt_stat, which does
-	  not follow symbolic links.
-
-Mon Mar 23 01:44:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (r_symreal): register symbol names as strings first so
-	  that r_symlink always returns valid names.
-	  [ruby-core:68587] [Bug #10991]
-
-	* marshal.c (r_ivar, r_object0): now need to intern symbol names.
-
-	* marshal.c (r_object0): compare with symbol names.
-
-Sun Mar 22 22:07:40 2015  Kouhei Sutou  <kou@cozmixng.org>
-
-	* doc/etc.rd.ja: Fix wrong coding for Emacs.
-
-Sun Mar 22 09:53:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/make-snapshot (package): add default CONFIGURE name to
-	  follow r50039.
-
-	* tool/make-snapshot (package): substitute configuration variables
-	  in Makefile.in instead of passing by the command line, and make
-	  temporary Makefile instead of a pipe.
-
-Sun Mar 22 08:09:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk (ext/ripper/ripper.c, ext/rbconfig/sizeof/sizes.c):
-	  strip autogenerated dependencies which have invalid syntax in
-	  other than nmake.
-
-Sat Mar 21 15:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/io/console/console.c (console_set_winsize): use handle for
-	  writing.  GetConsoleScreenBufferInfo seems failing on a handle
-	  for reading.
-
-	* io.c: [DOC] update the example of IO#winsize to use $stdout
-	  instead of $stdin, which does not work on Windows.  a patch by
-	  Jan Lelis <mail AT janlelis.de> at [ruby-core:68574].
-	  [Bug #10986]
-
-Fri Mar 20 18:41:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* proc.c (respond_to_missing_p): check if the receiver responds to
-	  the given method by respond_to_missing?.
-
-	* proc.c (mnew_missing): create Method object for method_missing.
-	  [ruby-core:68564] [Bug #10985]
-
-Fri Mar 20 17:43:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .travis.yml: enabled email notification.
-
-Fri Mar 20 17:39:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .travis.yml: removed Ruby 1.9.3 build on Travis CI
-
-Fri Mar 20 12:38:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): obj_info() can receive internal objects.
-
-	* gc.c (check_rvalue_consistency): obj_info() returns const char *.
-
-Fri Mar 20 12:14:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): show class name and T_DATA type_name.
-
-Thu Mar 19 22:12:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_copy_wb_protected_attribute): `dest' can be WB unprotected.
-
-Thu Mar 19 21:25:25 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_copy_wb_protected_attribute): demote `dest' object.
-
-Thu Mar 19 16:18:00 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c, internal.h: export rb_gc_verify_internal_consistency().
-
-Thu Mar 19 16:15:24 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): show allocation site if GC_DEBUG is not 0.
-
-Thu Mar 19 16:12:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (newobj_of): fix RGENGC_OLD_NEWOBJ_CHECK logics.
-	  * skip on incremental marking because not sure what happen :p
-	  * rb_gc_writebarrier_remember() is enough to mark children.
-
-Thu Mar 19 16:08:42 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_copy_wb_protected_attribute): need demote for old objects.
-
-Thu Mar 19 10:31:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* random.c (fill_random_bytes): release the handle in the static
-	  variable, not a local variable.
-
-Thu Mar 19 06:30:35 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* object.c (rb_obj_clone): do not touch age (FL_PROMOTED[01]) because
-	  rb_obj_alloc() can return old object in debug.
-
-Thu Mar 19 06:29:28 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/objspace/test_objspace.rb: flag name was changed
-	  (long_lived -> uncollectible).
-
-Thu Mar 19 05:30:13 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c (iseq_mark): skip some marking if iseq->orig is available.
-
-	* iseq.c (rb_iseq_clone): need WB for iseq1->klass = iseq0->klass
-	  (done in MEMCPY).
-
-Thu Mar 19 04:55:53 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h (IMEMO_DEBUG): added.
-
-	* internal.h: remove unused FL_IMEMO_MARK_V[0-3].
-
-	* gc.c (rb_imemo_new_debug): added.
-
-	* gc.c (obj_info): show imemo type name.
-
-Thu Mar 19 04:52:26 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (RGENGC_OLD_NEWOBJ_CHECK): add check mechanism.
-
-	  If RGENGC_OLD_NEWOBJ_CHECK > 0, then create old objects
-	  (not new objects) periodically.
-
-	  Create one old objects per RGENGC_OLD_NEWOBJ_CHECK objects are
-	  created.
-
-Thu Mar 19 04:46:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* enum.c (enum_sort_by): add WBs.
-
-Thu Mar 19 03:37:52 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (check_rvalue_consistency): refactoring.
-	  * not inline on RGENGC_CHECK_MODE > 0.
-	  * check SPECIAL_CONST_P(obj) first.
-	  * add a check that remembered_bit is only TRUE when old (age == 3).
-
-	* gc.c (RVALUE_DEMOTE): should clear RVALUE_REMEMBERED bit.
-
-	  remembered_bit should be TRUE only for old (age == 3) objects.
-
-	  Actually there are no effect because demoted objects will be
-	  uncollectible WB unprotected objects (marked at the beginning of
-	  every minor GC).
-
-Thu Mar 19 02:52:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c: rename terminologies.
-	  * long_lived -> uncollectible:
-	    because this bitmap does not mean "long lived objects in past",
-	    but means "prohibit collection these objects until next major GC".
-
-	    Uncollectible objects consist of two types objects, one is old
-	    objects (WB protected objects which age == 3) and another is
-	    uncollectible WB unprotected objects which are referred from old
-	    objects
-
-	  * remembered_wb_unprotected_objects ->
-	    uncollectible_wb_unprotected_objects:
-	    because uncollectible objects does not mean remembered objects.
-
-Wed Mar 18 17:21:12 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_writebarrier_generational): add an alternative write
-	  barrier (WB) implementation.
-	  When finding reference from [Old obj] to [New obj] by WB, current
-	  implementation marks [Old obj] as remembered old objects and marks
-	  children of [Old obj] at the beginning of marking.
-
-	  Added (but disabled) code changes current behaviour. This fix promote
-	  [New obj] to old and marks as a remembered old object. We can assume
-	  "new objects referred from old objects are maybe long-lived old
-	  objects".
-
-	  Disadvantage of added algorithm is we may promote unwilling
-	  short-lived objects. For example, consider many new objects push and
-	  pop to an old stack object. All of new objects (short-lived objects)
-	  promote to old objects unexpectedly.
-
-	  To compare these behaviour, I add this new code (but disabled it).
-
-Wed Mar 18 17:14:39 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (RVALUE_PROMOTE_RAW): rename to RVALUE_OLD_LONG_LIVED_SET()
-	  to make clear.
-
-Wed Mar 18 17:10:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (check_rvalue_consistency): do not need to check is_sweeping().
-
-Wed Mar 18 14:13:22 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* benchmark/bm_vm1_gc_wb_ary.rb: run GC to finish "marking" phase.
-
-	* benchmark/bm_vm1_gc_wb_obj.rb: ditto.
-
-	* benchmark/bm_vm1_gc_wb_ary_promoted.rb: add parameter
-	  full_mark: false to invoke only minor GC.
-
-	* benchmark/bm_vm1_gc_wb_obj_promoted.rb: ditto.
-
-Wed Mar 18 12:07:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* string.c: add a comment about RSTRING_FSTR.
-
-Wed Mar 18 12:01:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (rb_any_hash): use same hash values with Float#hash so
-	  that -0.0 and +0.0 will be identical.
-	  [ruby-core:68541] [Bug #10979]
-
-Wed Mar 18 05:34:32 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* string.c: introduce STR_FAKESTR to show string is FAKESTR or not.
-
-	* string.c (STR_SET_SHARED): ignore FAKESTR because only Ruby objects
-	  can use write barrier.
-
-Tue Mar 17 18:59:16 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* include/ruby/ruby.h: use rb_gc_writebrrier() simply.
-	  For incremental GC, we need to get a pointer to the objspace.
-	  We can share this pointer for the following WB process.
-	  And considering icache hit ratio, process in the GC.
-
-	* gc.c (rb_gc_writebarrier): added.
-
-	* gc.c (gc_writebarrier_generational, gc_writebarrier_incremental):
-	  make them NOINLINE because inlining them into rb_gc_writebarrier()
-	  makes a prologue code of rb_gc_writebarrier() longer (storing callee
-	  save registers).
-
-	  This patch improve the performance of WB on micro-benchmarks.
-
-	  name                   ruby 2.1   trunk   modified
-	  vm1_gc_wb_ary*            0.511   0.632      0.532
-	  vm1_gc_wb_ary_promoted*   0.578   0.701      0.674
-	  vm1_gc_wb_obj*            0.419   0.575      0.492
-	  vm1_gc_wb_obj_promoted*   0.537   0.664      0.618
-	                                                 (sec)
-
-Tue Mar 17 18:51:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* benchmark/bm_vm1_gc_wb_ary(_promoted).rb: separate fastpath and
-	  slowpath for WB.
-
-	  Before this change bm_vm1_gc_wb_ary.rb tried to check the performance
-	  for WB slowpath (making a reference from oldobj to newobj). However,
-	  from Ruby 2.2, 3 GCs are needed to promote new objects because
-	  only 3 age objects are promoted objects.
-
-	  To compare fastpath and slowpath, introduce new "promoted" version
-	  benchmark.
-
-	  bm_vm1_gc_wb_ary.rb is for fastpath and
-	  bm_vm1_gc_wb_ary_promoted.rb is for slowpath.
-
-	* benchmark/bm_vm1_gc_wb_obj(_promoted).rb: ditto.
-
-Tue Mar 17 17:23:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): distinguish not-yet-stated and DT_UNKNOWN
-	  by readdir, and traverse recursively for the former.  Linux
-	  readdir returns DT_UNKNOWN on some filesystems, e.g., smbfs,
-	  iso9660.
-
-Mon Mar 16 17:43:21 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/webrick/server.rb: Fix regression bug in WEBrick's
-	  :DoNotReverseLookup config option implementation.
-	  [fix GH-731] Patch by @vais
-	* test/webrick/test_do_not_reverse_lookup.rb: ditto.
-
-Sat Mar 14 20:05:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c (math_gamma): optimization for passed small integer.
-
-Sat Mar 14 18:07:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* enum.c: [DOC] Fixes Enumerable#member? documentation
-	  [fix GH-756][ci skip] Patch by @shamanime
-
-Sat Mar 14 12:23:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): use d_type to reduce lstat system calls.
-
-	* win32/dir.h (struct direct): add d_type instead of d_isdir and
-	  d_isrep.  SYMLINKD is unreliable, since the target can be
-	  replaced after a link was created.
-
-	* win32/win32.c (readdir_internal): set d_type.
-
-Sat Mar 14 02:14:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (primary): empty parentheses at cmdarg can be null.
-	  [ruby-core:68477] [Bug #10957]
-
-Fri Mar 13 15:04:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_close): don't raise on double
-	  close for consistent to IO#close.
-
-Fri Mar 13 15:03:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_close_read, rb_io_close_write): don't raise after
-	  close same as IO#close.
-
-Fri Mar 13 12:29:07 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/readline/test_readline.rb: Restore environment variables:
-	  COLUMNS LINES
-
-Fri Mar 13 11:37:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/fiddle/extconf.rb: needs --enable-shared when linked to
-	  libruby or fiddle.so.  since --with-static-linked-ext does no
-	  longer link extensions to ruby program with --enable-shared, the
-	  only combination needs --enable-static is --disable-shared and
-	  --with-static-linked-ext.  [ruby-dev:48901] [Bug #10960]
-
-Fri Mar 13 07:02:20 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/init.c (rsock_s_accept_nonblock): use rb_hash_lookup2
-	* ext/openssl/ossl_ssl.c (get_no_exception): new function
-	  (ossl_ssl_accept_nonblock): use get_no_exception
-	  (ossl_ssl_read_internal): ditto
-	  (ossl_ssl_write_nonblock): ditto
-	  [ruby-core:68511]
-
-Fri Mar 13 07:01:38 2015  Eric Wong  <e@80x24.org>
-
-	* ext/openssl/ossl_ssl.c: predefine wait_*able symbols
-
-Thu Mar 12 22:59:53 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/lib/leakchecker.rb: Check environment variables.
-
-Thu Mar 12 05:54:27 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/init.c (rsock_s_accept_nonblock):
-	  support exception: false
-	  [ruby-core:66385] [Feature #10532]
-	* ext/socket/init.c (rsock_init_socket_init): define new symbols
-	* ext/socket/rubysocket.h: adjust prototype
-	* ext/socket/socket.c (sock_accept_nonblock): support exception: false
-	* ext/openssl/ossl_ssl.c (ossl_ssl_accept_nonblock): ditto
-	* ext/socket/socket.c (Init_socket): adjust accept_nonblock definition
-	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
-	* ext/socket/tcpserver.c (rsock_init_tcpserver): ditto
-	* ext/socket/unixserver.c (rsock_init_unixserver): ditto
-	* ext/socket/tcpserver.c (tcp_accept_nonblock): adjust
-	  rsock_s_accept_nonblock call
-	* ext/socket/unixserver.c (unix_accept_nonblock): ditto
-	* ext/openssl/ossl_ssl.c (ossl_start_ssl): support no_exception
-	* ext/openssl/ossl_ssl.c (ossl_ssl_connect): adjust ossl_start_ssl call
-	* ext/openssl/ossl_ssl.c (ossl_ssl_connect_nonblock): ditto
-	* ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto
-	* test/socket/test_nonblock.rb (test_accept_nonblock): test for
-	  "exception :false"
-	* test/socket/test_tcp.rb (test_accept_nonblock): new test
-	* test/socket/test_unix.rb (test_accept_nonblock): ditto
-	* test/openssl/test_pair.rb (test_accept_nonblock_no_exception): ditto
-
-Thu Mar 12 10:53:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h, node.h: move a definition of `struct rb_global_entry'
-	  and related functions from node.h to internal.h.
-
-	* variable.c: remove unused include pragma.
-
-	* common.mk: remove unused dependency.
-
-Thu Mar 12 10:32:39 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* common.mk: remove unused dependency.
-
-Thu Mar 12 08:20:14 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* load.c: removed unused header file "node.h".
-
-	* method.h: ditto.
-
-	* symbol.c: ditto.
-
-Thu Mar 12 08:14:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c: RGENGC_CHECK_MODE should be 0.
-
-Thu Mar 12 07:44:17 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: use T_IMEMO to represent `struct MEMO' value.
-	  memo->v1 and memo->v2 is WB protected values.
-	  So use MEMO_V1/V2_SET() macros to set these values.
-	  memo->u3 is ambiguous (sometimes a VALUE, sometimes an integer
-	  value), so use gc_mark_maybe() in gc.c to mark it.
-
-	  Rename NEW_MEMO() to MEMO_NEW().
-
-	  Move MEMO_FOR and NEW_MEMO_FOR macros from node.h.
-
-	  Export a rb_imemo_new() function for ext/ripper.
-
-	* node.h: remove NODE_MEMO.
-
-	* enum.c: catch up these change.
-
-	* enumerator.c: ditto.
-
-	* load.c: ditto.
-
-	* ext/objspace/objspace.c (count_nodes): ditto.
-
-	* gc.c (gc_mark_children): mark imemo_memo type.
-
-	* parse.y (new_args_gen): use T_IMEMO.
-	  (I'm not sure it is working correctly...)
-
-Wed Mar 11 22:36:34 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* eval.c (frame_called_id): it should use vm_ifunc type.
-
-	* eval.c (frame_func_id): ditto.
-
-Wed Mar 11 22:27:05 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* node.h: remove NODE_IFUNC, NEW_IFUNC.
-
-	* internal.h: use T_IMEMO for IFUNC.
-
-	  rename `struct IFUNC' to `struct vm_ifunc' and move the definition
-	  from vm_insnhelper.h. Add imemo_ifunc.
-
-	* gc.c (gc_mark_children): mark imemo_ifunc type T_IMEMO object.
-
-	* compile.c: catch up these changes.
-
-	* proc.c: ditto.
-
-	* vm_core.h (RUBY_VM_IFUNC_P): ditto.
-
-	* vm_eval.c (rb_iterate): ditto.
-
-	* vm_insnhelper.c: ditto.
-
-	* ext/objspace/objspace.c: ditto.
-
-Wed Mar 11 21:53:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h, eval_intern.h: move CREF accessors.
-
-	  List IMEMO supported types in internal.h.
-
-Wed Mar 11 21:45:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h: use T_IMEMO to create THROW_DATA.
-
-	  Add THROW_DATA_NEW().
-
-	* internal.h: move definition of `struct THROW_DATA'
-	  from vm_insnhelper.h to internal.h.
-
-	  Rename `THROW_DATA' to `vm_throw_data'.
-
-	* eval_intern.h (THROW_DATA_P): move to internal.h.
-	  THROW_DATA is no longer T_NODE, so check T_IMEMO.
-
-	* gc.c (gc_mark_children): mark THROW_DATA.
-
-	* vm.c: catch up these changes.
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-Wed Mar 11 21:21:56 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c: use T_IMEMO to create SVAR.
-
-	* internal.h, vm_insnhelper.h: move definition `struct SVAR'
-	  from vm_insnhelper.h to internal.h. And rename it to struct vm_svar.
-
-	  new imemo_type imemo_svar is added.
-
-	* gc.c (gc_mark_children): mark imemo_svar.
-
-	* node.c (rb_gc_mark_node): remove useless marking.
-
-Wed Mar 11 19:35:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* include/ruby/ruby.h: introduce new type T_IMEMO.
-	  T_IMEMO is Internal Memo type, internal use only.
-	  T_IMEMO has same purpose of NODE_MEMO.
-
-	  To insert T_IMEMO, type numbers are modified a little.
-
-	* internal.h: define struct RIMemo. Each RIMemo objects
-	  has imemo_type. We can observe it by the imemo_type() function.
-
-	* gc.c (rb_imemo_new): added.
-
-	* node.h: remove NODE_CREF and NEW_CREF().
-
-	* node.c (rb_gc_mark_node): ditto.
-
-	* vm.c (vm_cref_new): use rb_imem_new().
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: use RIMemo objects for CREF.
-
-	* ext/objspace/objspace.c: support T_IMEMO.
-
-Wed Mar 11 17:03:20 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c: fix memory leak by prepend method.
-
-	  It is easy to reproduce with such script:
-
-	    module M; def bar; end; end
-	    loop{
-	      Class.new do
-	        def foo; end
-	        prepend M
-	      end
-	    }
-
-	* gc.c (obj_free): free T_ICLASS::m_tbl if it is created by prepend.
-	  To recognize it, check RICLASS_IS_ORIGIN flag.
-
-	* gc.c (gc_mark_children): T_ICLASS objects only need to mark
-	  T_ICLASS::m_tbl if RICLASS_IS_ORIGIN is set.
-
-	* gc.c (obj_memsize_of): count T_ICLASS if RICLASS_IS_ORIGIN is set.
-
-	* internal.h (RCLASS_SET_ORIGIN): add to set RCLASS_SET_ORIGIN.
-
-	  TODO: The word `origin' seems not good name. We need to invent
-	  another good name.
-
-	* class.c: use RCLASS_SET_ORIGIN().
-
-	* class.c (class_alloc): zero clear rb_classext_t.
-
-Wed Mar 11 13:28:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in: check also procstat_getvmmap, which is not
-	  available on FreeBSD 9.  [ruby-core:68468] [Bug #10954]
-
-	* vm_dump.c (procstat_vm): use kinfo_getvmmap instead if
-	  procstat_getvmmap is not available.
-
-Wed Mar 11 09:15:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: define struct MEMO.
-
-	* enum.c: use MEMO.
-
-	* enumerator.c: ditto.
-
-	* load.c: ditto.
-
-	* node.h: return (struct MEMO *) pointer.
-
-Wed Mar 11 06:26:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h (THROW_DATA_STATE): return int, not VALUE.
-
-	* vm_insnhelper.h (THROW_DATA_STATE_SET): accept int value.
-
-Wed Mar 11 05:06:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_eval.c (rb_catch_protect): use THROW_DATA_VAL().
-
-Wed Mar 11 04:56:04 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h: define struct IFUNC.
-
-	* vm_eval.c (rb_iterate): use it.
-
-	* vm_insnhelper.c (vm_yield_with_cfunc): ditto.
-
-Wed Mar 11 03:52:12 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* eval_intern.h (THROW_DATA_P): use RB_TYPE_P() instead of
-	  BUILTIN_TYPE().
-
-	* thread.c (thread_join): use THROW_DATA_P().
-
-Wed Mar 11 03:48:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c: use RUBY_VM_IFUNC_P() to recognize IFUNC or not.
-
-	* vm.c: ditto.
-
-	* vm_dump.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-	* vm_core.h (RUBY_VM_IFUNC_P): use RB_TYPE_P() instead of
-	  BUILTIN_TYPE().
-
-Wed Mar 11 03:21:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h: define struct THROW_DATA to represent
-	  throwing data. Also define accessor functions.
-
-	* eval_intern.h: move related changes into vm_insnhelper.h.
-	  Now these MACROs (functions) are only used in vm*.c.
-
-	  There is only THROW_DATA_P(err) to check this data type or not.
-
-	* vm.c: catch up these changes.
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-Wed Mar 11 00:57:00 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* test/rubygems/test_gem_security_trust_dir.rb: The return value of
-	  File::Stat#mode is OS dependent. In AIX, 0200000 is set.
-
-Tue Mar 10 20:03:41 2015  Tanaka Akira  <akr@fsij.org>
-
-	* lib/webrick/server.rb: Invoke setup_shutdown_pipe in start method
-	  instead of listen method.
-	  [ruby-core:68476] [Bug #10956] Reported by Shintaro Kojima.
-
-Tue Mar 10 17:27:27 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* thread.c (thread_join): Fixnum (except TAG_FATAL) and
-	  NODE should not be reached here.
-
-Mon Mar  9 21:42:10 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (ep_cref): rename to lep_cref() because it should be
-	  local ep.
-
-Mon Mar  9 16:34:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_close): don't raise on double
-	  close for consistent to IO#close.
-
-Mon Mar 09 06:44:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h: define struct SVAR for SVAR.
-	  This data type is also same layout of NODE (NODE_IF).
-
-	* vm_insnhelper.c: catch up this change.
-
-Mon Mar  9 06:43:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (lep_svar_set): add WBs.
-
-Mon Mar  9 06:19:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: define rb_cref_t and change to use it.
-
-	  rb_cref_t is data type of CREF. Now, the body is still NODE.
-	  It is easy to understand what is CREF and what is pure NODE.
-
-Mon Mar  9 06:00:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h (COPY_CREF_OMOD): fix translation miss.
-
-Mon Mar  9 04:47:58 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: define CREF accessor macros.
-	  * CREF_CLASS(cref)
-	  * CREF_NEXT(cref)
-	  * CREF_VISI(cref)
-	  * CREF_VISI_SET(cref, v)
-	  * CREF_REFINEMENTS(cref)
-	  * CREF_PUSHED_BY_EVAL(cref)
-	  * CREF_PUSHED_BY_EVAL_SET(cref)
-	  * CREF_OMOD_SHARED(cref)
-	  * CREF_OMOD_SHARED_SET(cref)
-	  * CREF_OMOD_SHARED_UNSET(cref)
-
-	  This is process to change CREF data type from NODE.
-
-Sun Mar  8 22:50:57 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/zlib/zlib.c (rb_gzfile_close): Don't raise on double
-	  close for consistent to IO#close.
-
-Sun Mar  8 16:57:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): match patterns against legacy short names
-	  too, not only ordinary names.  [ruby-core:67954] [Bug #10819]
-
-	* win32/dir.h (struct direct): add short name members.
-
-	* win32/win32.c (opendir_internal, readdir_internal): ditto.
-
-Sat Mar  7 09:36:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* array.c: document that first element is kept when using
-	  Array#uniq and #uniq! [fix GH-845][ci skip]
-	  Patch by @riffraff
-
-Sat Mar  7 09:28:02 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* thread.c: Mutex#owned? is no longer experimental since 2.1.0
-	  [fix GH-839][ci skip] Patch by @takiy33
-
-Sat Mar  7 09:18:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/merger.rb: Added documentation to version method.
-	  [fix GH-847][ci skip] Patch by @magikid
-
-Fri Mar  6 22:50:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (rb_prepend_module): need a WB for klass -> origin.
-
-Fri Mar  6 20:18:38 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* fix namespace issue on singleton class expressions. [Bug #10943]
-
-	* vm_core.h, method.h: remove rb_iseq_t::cref_stack. CREF is stored
-	  to rb_method_definition_t::body.iseq_body.cref.
-
-	* vm_insnhelper.c: modify SVAR usage.
-	  When calling ISEQ type method, push CREF information onto method
-	  frame, SVAR located place. Before this fix, SVAR is simply nil.
-	  After this patch, CREF (or NULL == Qfalse for not iseq methods)
-	  is stored at the method invocation.
-
-	  When SVAR is required, then put NODE_IF onto SVAR location,
-	  and NDOE_IF::nd_reserved points CREF itself.
-
-	* vm.c (vm_cref_new, vm_cref_dump, vm_cref_new_toplevel): added.
-
-	* vm_insnhelper.c (vm_push_frame): accept CREF.
-
-	* method.h, vm_method.c (rb_add_method_iseq): added. This function
-	  accepts iseq and CREF.
-
-	* class.c (clone_method): use rb_add_method_iseq().
-
-	* gc.c (mark_method_entry): mark method_entry::body.iseq_body.cref.
-
-	* iseq.c: remove CREF related codes.
-
-	* insns.def (getinlinecache/setinlinecache): CREF should be cache key
-	  because a different CREF has a different namespace.
-
-	* node.c (rb_gc_mark_node): mark NODE_IF::nd_reserved for SVAR.
-
-	* proc.c: catch up changes.
-
-	* struct.c: ditto.
-
-	* insns.def: ditto.
-
-	* vm_args.c (raise_argument_error): ditto.
-
-	* vm_eval.c: ditto.
-
-	* test/ruby/test_class.rb: add a test.
-
-Fri Mar  6 18:19:13 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/webrick/test_filehandler.rb: on vboxsf (on VirtualBox
-	  on Windows 7), file name and permissions are strange (can access
-	  by short file name and so on).
-
-	  Simply skip on such tests on such FS. To detect strange FS, this
-	  patch use a part of code `File.executable?(__FILE__)`.
-	  Please correct them if there are better ways.
-
-Fri Mar  6 17:31:29 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/ruby/test_beginendblock.rb: do not change directory.
-
-	  Run system command in the directory mounted by vboxsf on Windows 7
-	  and get warning like that "warning: Insecure world writable dir...".
-
-Fri Mar  6 10:31:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (vm_call_super): search next super class from the
-	  original class, to get rid of infinite recursion with
-	  prepending.  a patch by Seiei Higa <hanachin AT gmail.com> at
-	  [ruby-core:68434].  [ruby-core:68093] [Bug #10847]
-
-Fri Mar  6 08:45:26 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/matrix.rb: Add Vector#round. Patch by Jordan Stephens.
-	  [Fixes GH-802]
-
-Fri Mar  6 07:33:03 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): show node name too.
-
-Fri Mar  6 07:00:44 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: remove struct method_table_wrapper.
-	  struct method_table_wrapper was introduced to avoid duplicate marking
-	  for method tables.
-
-	  For example, `module M1; def foo; end; end` make one method table
-	  (mtbl) contains a method `foo`. M1 (T_MODULE) points mtbl.
-	  Classes C1 and C2 includes M1, then two T_ICLASS objects are created
-	  and they points mtbl too. In this case, three objects (one T_MODULE
-	  and two T_ICLASS objects) points same mtbl. On marking phase, these
-	  three objects mark same mtbl. To avoid such duplication, struct
-	  method_table_wrapper was introduced.
-
-	  However, created two T_ICLASS objects have same or shorter lifetime
-	  than M1 (T_MODULE) object. So that we only need to mark mtbl from M1,
-	  not from T_ICLASS objects. This patch tries marking only from M1.
-	  In other words, original module (M1) has responsibility to mark mtbl.
-	  Because of no duplicate marking, we don't need method_table_wrapper
-	  any more.
-
-	  Note that one `Module#prepend` call creates two T_ICLASS objects.
-	  One for referring to a prepending Module object, same as
-	  `Module#include`. We don't need to care this T_ICLASS.
-	  One for moving original mtbl from a prepending class. We need to
-	  mark such mtbl from this T_ICLASS object. To mark the mtbl,
-	  we need to use `RCLASS_ORIGIN(klass)` on marking from a prepended
-	  class `klass`.
-
-	* class.c: ditto.
-
-	* eval.c (rb_using_refinement): ditto.
-
-	* gc.c: ditto.
-
-	* include/ruby/ruby.h: define m_tbl directly. The definition of
-	  struct RClass should be moved to (srcdir)/internal.h.
-
-	* method.h: remove decl of rb_free_m_tbl_wrapper().
-
-	* object.c: use RCLASS_M_TBL() directly.
-
-Fri Mar  6 02:50:12 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* dir.c (replace_real_basename): need to check the return value of
-	  GLOB_REALLOC().
-
-Fri Mar  6 02:26:03 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* dir.c (replace_real_basename): shouldn't create Ruby object before
-	  the object system is loaded.
-	  [ruby-core:68430] [Bug #10941]
-
-Wed Mar  5 16:58:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* hash.c: [DOC] #delete method actually returns nil, if the key
-	  is not found. [fix GH-844][ci skip] Patch by @ivdma
-
-Wed Mar  5 12:22:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c: refactoring: remove unnecessary variable d0 to unify code
-	  appearance.
-
-Thu Mar  5 11:50:54 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* vm_eval.c (eval_string_with_cref): A binding should keep
-	  refinements activation information and the refinements should be
-	  activated in subsequent eval calls with the binding.
-	  [ruby-core:67945] [Bug #10818]
-
-Thu Mar  5 11:16:55 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* test/ruby/test_refinement.rb: There is no need anymore to suppress
-	  warnings.
-
-Thu Mar  5 08:31:02 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* random.c (random_raw_seed): Avoid calling fill_random_bytes()
-	  if the requested size is 0. AIX returns -1 for 0-byte read from
-	  /dev/urandom, while other UNIX returns 0. With this change,
-	  Random.raw_seed(0) consistently returns "" in any UNIX.
-
-Wed Mar  4 12:43:32 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* test/ruby/test_math.rb (assert_float_and_int): Refactor test cases
-	  by introducing assert_float_and_int. [misc #10810]
-
-Wed Mar  4 11:52:30 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* symbol.c (Init_sym): make dsym_fstrs a hash compared by identity
-	  as the keys are unique fstrings, to get rid of running hash and
-	  compare methods and causing new object allocation during garbage
-	  collection phase.  [ruby-dev:48891] [Bug #10933]
-
-Wed Mar  4 10:16:57 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* enum.c: Fix typo in slice_after's exception message.
-	  [fix GH-842][ci skip] Patch by @jsyeo
-
-Wed Mar  4 10:15:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/syntax/methods.rdoc: add some missing spaces and
-	  fix a grammatical error in method docs.
-	  [fix GH-843][ci skip] Patch by @nikolas
-
-Wed Mar  4 02:13:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (backport_command_string): pick up only
-	  when the revision exists in trunk.
-
-Wed Mar  4 00:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* thread.c (rb_thread_io_blocking_region): assigned variables
-	  inside EXEC_TAG() should be volatile.
-
-	* thread.c (rb_thread_s_handle_interrupt): ditto.
-
-	* thread.c (exec_recursive): ditto.
-
-Wed Mar  4 00:29:18 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: now can specify shorten form of commands.
-
-Tue Mar  3 23:41:42 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (Readline.readline): drop untreated control
-	  characters.
-
-Tue Mar  3 22:25:24 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/lib/envutil.rb (EnvUtil.invoke_ruby): need to rescue because
-	  Signal.signame may raise exception.
-
-Tue Mar  3 16:57:39 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: use 'b' instead of 's' for showing
-	  Backport options for merger.rb.
-
-Tue Mar  3 16:55:23 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: show selected ticket number at prompt.
-
-Tue Mar  3 14:47:30 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c (num2dbl_with_to_f): direct casting from Rational to double.
-	  [Feature #10909]
-
-	* test/ruby/test_math.rb: add tests for the above change.
-
-Tue Mar  3 07:52:20 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* test/ruby/test_symbol.rb: avoid a false positive in AIX.
-
-Tue Mar  3 00:59:39 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* configure.in: set PRELOADENV in Solaris to avoid "wrong ELF class"
-	  error. [Bug #10926] [ruby-dev:48888]
-	* configure.in: set LIBPATHENV for 32-bit compile in Solaris
-	  in addition to 64-bit.
-
-Mon Mar  2 15:36:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in: do not check _setjmp unless _longjmp is available,
-	  so that configure results will not be changed by cache.
-
-Mon Mar  2 14:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (RUBY_REPLACE_TYPE): restore unsigned type from
-	  cached variable only if the target type is not available.
-
-Mon Mar  2 13:04:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* signal.c (sig_signame): return nil if the argument is a valid
-	  signal number.
-
-Mon Mar  2 12:05:04 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/net/ftp/test_ftp.rb (create_ftp_server): set SO_OOBINLINE
-	  for receiving OOB data which is sent with MSG_OOB flag in
-	  portable way. [Bug #10915] [ruby-dev:48885]
-	* test/net/ftp/test_ftp.rb (test_abort, test_status): use gets
-	  for receiving OOB data in portable way.
-
-Mon Mar  2 11:43:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (RUBY_REPLACE_TYPE): restore unsigned type from
-	  cached variable.
-
-Mon Mar  2 06:01:41 2015  Eric Wong  <e@80x24.org>
-
-	* ext/io/wait/wait.c (io_nread): wrap return value with INT2FIX
-	  Thanks to Yura Sokolov <funny.falcon@gmail.com>
-	  [ruby-core:68369] [Bug#10923]
-	* test/io/wait/test_io_wait.rb (test_nread_buffered):
-	  fix broken test
-
-Sun Mar  1 20:21:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (RUBY_REPLACE_TYPE): restore convertible type from
-	  cached variable, so that configured results will be stable.
-
-Sun Mar  1 18:10:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (rb_cv_broken_memmem): check before adding the
-	  result HAVE_MEMMEM macro to confdefs.h, so that configured
-	  results will be stable.
-
-Sun Mar  1 11:17:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (id2ref): prohibit from accessing internal objects.
-	  [ruby-core:68348] [Bug #10918]
-
-Sun Mar  1 09:06:11 2015  Tanaka Akira  <akr@fsij.org>
-
-	* lib/time.rb (strptime): Support %s.%N.
-	  [ruby-core:68301] [Bug #10904] Patch by Sadayuki Furuhashi.
-
-Sat Feb 28 17:18:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* enum.c (enum_each_slice, enum_each_cons): limit elements size by
-	  the enumerator size.  suggested by Hans Mackowiak <hanmac AT
-	  gmx.de> at [ruby-core:68335]
-
-Sat Feb 28 15:44:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_dump.c (rb_vm_bugreport): get rid of making new strings
-	  inside signal context.
-
-	* variable.c (rb_tmp_class_path): defer making temporary class
-	  path string.
-
-	* variable.c (rb_search_class_path): search class path or return
-	  Qnil or Qfalse if unnamed, not creating a temporary path.
-
-Sat Feb 28 15:02:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* variable.c (rb_tmp_class_path): preserve name encoding of an
-	  anonymous instance of module/class subclass.
-
-Sat Feb 28 08:24:30 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* ext/pty/pty.c: AIX supports autopush.
-	  Patch by Perry Smith [ruby-core:58539] [Bug #9144]
-
-Fri Feb 27 22:00:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems: Update to RubyGems 2.4.6 and HEAD(800f2e6).
-	  Fixed #1159, #1171, #1173 on rubygems/rubygems
-	* test/rubygems: ditto.
-
-Fri Feb 27 20:55:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rake: Update to rake (9237e74), typo fix and remove needless
-	  private syntax.
-	* test/rake: ditto.
-
-Fri Feb 27 17:06:44 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: define vm_svar_index.
-
-	* vm_insnhelper.c, vm.c, compile.c: use vm_svar_index names.
-
-	* iseq.h: remove DEFAULT_SPECIAL_VAR_COUNT.
-	  use VM_SVAR_FLIPFLOP_START instead.
-
-Fri Feb 27 13:57:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (setup_narg): wipe away expanded part of buffer to get rid
-	  of revealing uncleaned data.  reported by Dongkwan Kim <dkay AT
-	  kaist.ac.kr>.
-
-Wed Feb 25 22:25:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* spec/default.mspec: use default configuration file name.
-	  https://github.com/ruby/rubyspec/commit/cc69f337b06362e5607ffa3e3ad40ef7494960cf
-
-Wed Feb 25 22:21:56 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* spec/default.mspec: remove specific version number.
-	  https://github.com/ruby/rubyspec/commit/7a909e925c1baa9c700bd44af9241aef6e596714
-
-Wed Feb 25 22:04:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/win32/Win32API.rb (initialize): accept both a string and an array
-	  for the arguments of the imported function.
-	  reported by Aaron Stone [ruby-core:68208] [Bug #10876] [Fixes GH-835]
-
-Wed Feb 25 18:12:11 2015  Eric Wong  <e@80x24.org>
-
-	* signal.c (sighandler): preserve errno
-	  Patch by Steven Stewart-Gallus <sstewartgallus00@mylangara.bc.ca>
-	  [ruby-core:68172] [Bug #10866]
-
-Wed Feb 25 15:59:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (push_pattern, push_glob): make globbed file names same
-	  encoding to the given pattern.
-
-Wed Feb 25 15:27:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* tool/merger.rb: support 2.1+ versioning scheme.
-
-Tue Feb 25 08:49:12 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* lib/cmath.rb (log): raise ArgumentError when more than 2 arguments
-	  are passed. [ruby-core:66143] [Bug #10487]
-
-Tue Feb 25 02:15:17 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* test/ruby/test_math.rb: Use assert_infinity instead of assert_equal(1.0/0, ...).
-
-	* test/ruby/test_math.rb: Add tests for overriding Integer#to_f.
-	  [ruby-core:67919] [Misc #10809]
-
-Tue Feb 24 22:58:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* complex.c (nucomp_mul): calculate as rotation in complex plane
-	  if matrix calculation resulted in NaN.
-
-Tue Feb 24 21:45:39 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* test/ruby/test_math.rb(test_cbrt): Add an assertion for Math.cbrt(1.0/0)
-	  and move #test_cbrt to more proper place.
-
-Tue Feb 24 19:09:25 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (lep_svar_place, lep_svar_get): do not create
-	  additional T_NODE object (svars holder) when only getting
-	  svars.
-
-Tue Feb 24 11:49:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* time.c (time_zone_name): should be US-ASCII only if all 7-bits,
-	  otherwise locale encoding.  [ruby-core:68230] [Bug #10887]
-
-Tue Feb 24 09:47:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (chompped_length): enable smart chomp for all non-dummy
-	  encoding strings, not only default_rs.
-	  [ruby-core:68258] [Bug #10893]
-
-Mon Feb 23 23:19:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/vcs.rb (IO.popen): support :chdir option.
-
-	* tool/vcs.rb (VCS::GIT.get_revisions): use :chdir option instead
-	  of -C option which is not supported by older git.
-	  [ruby-dev:48880] [Bug #10890]
-
-Mon Feb 23 15:26:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_split_m): raise ArgumentError at broken string
-	  not RegexpError, as Regexp is not involved in.
-	  [ruby-core:68229] [Bug #10886]
-
-Mon Feb 23 07:25:29 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* time.c: Zone encoding should be US-ASCII if all 7-bits. Fix r46907.
-
-	* test/ruby/test_time.rb, test/ruby/test_time_tz.rb: Update tests.
-
-Sun Feb 22 18:33:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* common.mk: use ruby organization for rubyspec.
-
-Sun Feb 22 15:56:06 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
-
-	* vm_insnhelper.c (rb_vm_rewrite_cref_stack): copy nd_refinements
-	  of original crefs. It fixes segmentation fault when calling
-	  refined method in duplicate module. [ruby-dev:48878] [Bug #10885]
-
-	* vm_core.h, class.c: change accordingly.
-
-	* test/ruby/test_refinement.rb: add a test for above.
-
-Sun Feb 22 10:43:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_objspace_call_finalizer): control GC execution during
-	  force firnalizations at the end of interpreter process.
-	  [Bug #10768]
-
-	  1) Prohibit incremental GC while running Ruby-level finalizers
-	     to avoid any danger.
-	  2) Prohibit GC while invoking T_DATA/T_FILE data structure
-	     because these operations break object relations consistency.
-
-	  This patch can introduce another memory consuming issue because
-	  Ruby-level finalizers can run after (2), GC is disabled.
-	  However, basically object consistency was broken at (2) as I
-	  described above. So that running Ruby-level finalizers contains
-	  danger originally. Because of this point, I need to suggest to
-	  remove these 3 lines (invoking remaining finalizers). And add a
-	  rule to add that finalizers should not add new finalizers, or
-	  say there is no guarantee to invoke finalizers that added by
-	  another finalizer.
-
-Sun Feb 22 04:07:05 2015  Zachary Scott  <e@zzak.io>
-
-	* ext/openssl/ossl_asn1.c: [DOC] RDoc formatting fixes for
-	  ASN1::ObjectId with patch from @vbatts [Fixes GH-834]
-
-	* ext/openssl/ossl_bn.c: ditto.
-
-Sat Feb 21 19:51:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* re.c (match_aref): RMatch::regexp is Qnil after matching by a
-	  string since r45451.  [ruby-core:68209] [Bug #10877]
-
-Sat Feb 21 16:18:42 2015  Stefan Schuler  <mail@stefanschuessler.de>
-
-	* compar.c (Init_Comparable): [DOC] Replace camelcase variable name.
-	  [Fix GH-833]
-
-Fri Feb 20 17:27:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_identical_p): fix handle leak, ensure to close
-	  the handle of the first argument.
-
-Fri Feb 20 17:19:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (different_device_p): compare by volume serial
-	  numbers, not by path names.  [ruby-core:68162] [Bug #10865]
-
-Thu Feb 19 01:58:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/file.c (rb_file_expand_path_internal): neither the drive
-	  of base directory nor the current drive are involved in the
-	  result if different than the drive of path.
-	  [ruby-core:68130] [Bug #10858]
-
-Wed Feb 18 10:48:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (wrename): return EXDEV if moving a directory to
-	  another drive, since MoveFileExW does not set proper error code.
-	  [ruby-core:68162] [Bug #10865]
-
-Wed Feb 18 03:13:52 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych.rb: bump psych version.
-	* ext/psych/psych.gemspec: ditto
-	* ext/psych/yaml/scanner.c: add latest libyaml change.
-	* test/psych/helper.rb: support newer minitest
-	* test/psych/test_to_yaml_properties.rb: ditto
-
-Tue Feb 17 11:47:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/resolv.rb (Resolv::DNS::Resource#==, #hash): elements
-	  returned by Kernel#instance_variables are Symbols now.
-	  [ruby-core:68128] [Bug #10857]
-
-Tue Feb 17 10:59:10 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/syntax/calling_methods.rdoc: Fix documentation for "calling_methods"
-	  Patch by @sos4nt [fix GH-830][ci skip]
-
-Tue Feb 17 10:53:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/file.c (rb_file_expand_path_internal): do not make invalid
-	  (or ADS) path if the path has a drive letter, the result also
-	  should have be under it.  [ruby-core:68130] [Bug #10858]
-
-Tue Feb 17 10:47:20 2015  Iain Beeston  <iain.beeston@gmail.com>
-
-	* hash.c: Added docs to explain that #include? and #member? do not
-	  check member equality
-	* lib/set.rb: ditto
-
-Mon Feb 16 20:58:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* compile.c (compile_massign): optimization for special case,
-	  assignments by aset or attrset.
-	  http://kokizzu.blogspot.jp/2015/02/c-java-hhvm-ruby-nodejsrhinojscspidermo.html
-	  http://www.atdot.net/~ko1/diary/201502.html#d16
-
-Sun Feb 15 10:41:23 2015  Sho Hashimoto  <sho-h@ruby-lang.org>
-
-	* doc/standard_library.rdoc: [DOC] delete removed libraries.
-	  [misc #10843] [ci skip]
-
-Sat Feb 14 12:20:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* random.c (rand_random_number): add a method to return a random
-	  number like SecureRandom to Random::Formatter.
-
-	* lib/securerandom.rb (random_bytes): move to Random::Formatter,
-	  the base method of the module.
-
-Sat Feb 14 12:01:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* random.c (random_raw_seed): extract platform dependent random
-	  seed initialization function as a new method Random.raw_seed.
-
-	* lib/securerandom.rb (SecureRandom): use Random.raw_seed.
-
-Sat Feb 14 00:49:37 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/coverage/coverage.c: Add Coverage.peek_result.  Allows you to
-	  capture coverage information without stopping the coverage tool.
-	  [ruby-core:67940] [Feature #10816]
-
-	* test/coverage/test_coverage.rb: test for change.
-
-Fri Feb 13 21:52:05 2015  Yusuke Endoh  <mame@tsg.ne.jp>
-
-	* string.c (str_discard): does not free for STR_NOFREE string.
-	  [Bug #10853][ruby-core:68110]
-
-	* bootstraptest/test_string.rb: test for above.
-
-Fri Feb 13 21:16:00 2015  Yusuke Endoh  <mame@tsg.ne.jp>
-
-	* lib/base64.rb: make urlsafe mode user-friendly.
-
-	* lib/base64.rb (Base64.urlsafe_encode64): a new option "padding" to
-	  suppress the padding character ("=").
-
-	* lib/base64.rb (Base64.urlsafe_decode64): now it accepts not only
-	  correctly-padded input but also unpadded input.
-	  [Feature #10740][ruby-core:67570]
-
-	* test/base64/test_base64.rb: Test for above
-
-Fri Feb 13 14:19:06 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json: merge upstream from flori/json
-	  change usage of TypedData. [Feature #10739][ruby-core:67564]
-
-Thu Feb 12 18:34:01 2015  multisnow  <infinity.blick.winkel@gmail.com>
-
-	* ext/openssl/extconf.rb: check RAND_edg to support libressl.
-
-	* ext/openssl/ossl_rand.c (ossl_rand_egd): define only if RAND_edg
-	  is available.  [Fix GH-829]
-
-Thu Feb 12 10:46:14 2015  Eric Hodel  <drbrain@segment7.net>
-
-	* proc.c (proc_call):  Improve Proc#call documentation.  Patch by
-	  Hsing-Hui Hsu.  [fix GH-761]
-
-Thu Feb 12 04:33:02 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* compar.c (cmp_equal): no more error hiding for Comparable#==.
-	  It now behaves as other Comparable methods. See #7688.
-
-	* test/ruby/test_comparable.rb: update related test.
-
-Thu Feb 12 03:28:05 2015  Eric Wong  <e@80x24.org>
-
-	* lib/set.rb (initialize): internal hash defaults to false
-
-	* lib/set.rb (include?): use Hash#[] for optimized dispatch.
-	  Patch by Ismael Abreu <ismaelga@gmail.com>
-	  [ruby-core:67664] [Misc #10754]
-
-Wed Feb 11 11:09:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/digest/digest_conf.rb (digest_conf): check for CommonDigest.
-
-	* ext/digest/*/*cc.h: for Apple CommonCrypto/CommonDigest.h.
-
-	* ext/digest/digest.h (DEFINE_FINISH_FUNC_FROM_FINAL): macro for
-	  finish functions, by inverting arguments order.
-
-	* ext/digest/digest_conf.rb (digest_conf): extract common
-	  configurations.
-
-Wed Feb 11 11:01:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/json/generator/generator.c (generate_json): get rid of
-	  unnecessary recursive calls which can cause infinite recursion.
-	  T_STRING may not have rb_cString.
-
-Wed Feb 11 07:53:35 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* test/win32ole/test_word.rb: use skip method to skip test.
-
-Tue Feb 10 11:38:28 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* vm_insnhelper.c (vm_call_method): stop method search when a method
-	  is not found in a refinement, to support undef in refinements.
-	  [ruby-core:66741] [Bug #10578]
-
-Tue Feb 10 11:19:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (chdir, delete, gettextfile, mdtm, mkdir, nlst,
-	  putbinaryfile, puttextfile, rename, rmdir, size): support
-	  Pathname. Patch by Joe Rafaniello. [fix GH-828]
-
-Mon Feb  9 16:36:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/make-snapshot (package): get rid of loading unbundled and
-	  unexpected libraries.  [ruby-core:67977] [Bug #10822]
-
-Sun Feb  8 20:09:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/net/http/header.rb: pass header names as symbols.
-	  Patch by @DamirSvrtan [fix GH-805]
-	* test/net/http/test_httpheader.rb: added test.
-
-Sun Feb  8 13:04:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/socket/getaddrinfo.c (get_addr): reject too long hostname to
-	  get rid of GHOST vulnerability on very old platforms.
-
-	* ext/socket/raddrinfo.c (make_hostent_internal): ditto, paranoic
-	  check for the canonical name.
-
-Sun Feb  8 12:48:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/win32/lib/win32/registry.rb (Win32::Registry::API): use wide
-	  versions of RegDeleteValue and RegDeleteKey.
-	  [ruby-core:67958] [Bug #10820]
-
-Sat Feb  7 22:13:08 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* test/win32ole/test_win32ole_record.rb: remove test using .NET
-	  Framework 3.5 because it is not included in Windows 8/8.1.
-
-Sat Feb  7 19:25:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (has_magic): always get long path name on Windows even if
-	  no tilde is there.  [ruby-core:68011] [Bug #10819]
-
-	* dir.c (replace_real_basename): FindFirstFile ignore redirection
-	  character, check if exists before call it.  cf. [Bug #8597]
-
-Sat Feb  7 13:30:11 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* test/win32ole/test_win32ole_record.rb
-	  (test_ole_instance_variable_get): correct VT_RECORD type and
-	  instance variables.
-
-Fri Feb  6 17:47:05 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: register nodes when
-	  dumping objects with custom coders. [ruby-core:66215] [Bug #10496]
-
-	* test/psych/test_coder.rb: test for fix
-
-Fri Feb  6 16:58:31 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/to_ruby.rb: fix support for regular
-	  expressions with newlines. tenderlove/psych#222
-
-	* test/psych/test_yaml.rb: test for change.
-
-Fri Feb  6 10:31:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_core.h (rb_call_info_kw_arg_struct): make keywords a symbols
-	  list to get rid of inadvertent creation by variable keyword
-	  arguments.  [ruby-core:68031] [Bug #10831]
-
-Thu Feb  5 22:42:34 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems:  Update to RubyGems HEAD(5c3b6f3).
-	  Fixed #1156, #1142, #1115, #1142, #1139 on rubygems/rubygems
-	* test/rubygems:  ditto.
-
-Thu Feb  5 13:41:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (send_internal), vm_insnhelper.c (vm_call_opt_send):
-	  convert String method name into a Symbol, as method_missing
-	  method expects its first argument to be a Symbol.  [Bug #10828]
-
-	* vm_insnhelper.c (ci_missing_reason): return the reason of method
-	  missing in call info.
-
-	* vm_insnhelper.c (vm_call_opt_send): re-apply r49500 with the
-	  proper missing reason.  [Bug #10828]
-
-Thu Feb  5 10:31:46 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* class.c (rb_obj_singleton_methods): should use RTEST() to convert
-	  VALUE to int.
-
-Thu Feb  5 03:59:33 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* vm_insnhelper.c: Fix symbol leak with +send+ [Bug #10828]
-
-Wed Feb  4 20:26:54 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (Init_win32ole): should not use atexit to
-	  free allocated hash table to avoid error on Cygwin.
-
-Wed Feb  4 15:34:25 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* class.c (method_entry_i, class_instance_method_list,
-	  rb_obj_singleton_methods): should not include methods of
-	  superclasses if recur is false. [ruby-dev:48854] [Bug #10826]
-
-Wed Feb  4 16:32:40 2015  Matt Hoyle  <matt@deployable.co>
-
-	* ext/bigdecimal/bigdecimal.c (VpSetPTR): fix a typo, 'expoennt'
-	  to 'exponent'.  [ruby-core:67980] [Bug #10823] [Fix GH-825]
-
-Wed Feb  4 15:55:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/sdbm/_sdbm.c: include ruby/ruby.h for PRIdPTRDIFF when a
-	  macro `DEBUG` is defined.  based on the patch by Owen Rodley in
-	  [ruby-core:67987]. [Bug #10825]
-
-Wed Feb  4 11:12:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in (probes.stamp): rebuild dtrace dependent objects
-	  only when `dtrace -G` modifies its input files.
-
-Tue Feb  3 19:27:16 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* common.mk (ruby-glommed.o): dependency on $(OBJ) should be written
-	  in common.mk (in which OBJ is defined) because of Makefile include
-	  and parse order. This partly reverts r49419.
-	  [ruby-dev:48849] [Bug #10808]
-
-	* Makefile.in (ruby-glommed.o): ditto.
-
-	* Makefile.in (ruby-glommed.o): remove excess $(DTRACE_OBJ) because
-	  it is included in $(OBJS) since r49451.
-
-	* Makefile.in (probes.o): should depend on $(DTRACE_DEPENDENT_OBJS)
-
-Tue Feb  3 17:15:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (try_cppflags, try_cflags, try_ldflags): get rid of
-	  interference by modifying global variables in have_devel? method.
-	  [ruby-core:67962] [Bug #10821]
-
-Tue Feb  3 15:23:58 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* vm_method.c (remove_method): When remove refined
-	  method, raise a NameError if the method is not
-	  defined in refined class.
-
-	  But if the method is defined in refined class,
-	  it should keep refined method and remove original
-	  method.
-
-	  Patch by Seiei Higa. [ruby-core:67722] [Bug #10765]
-
-Tue Feb  3 14:04:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): obtain real name with FindFirstFile API
-	  instead of matching all entries, on Windows.
-	  [ruby-core:67954] [Bug #10819]
-
-Tue Feb  3 12:26:35 2015  Katsuhiko Nishimra  <ktns.87@gmail.com>
-
-	* lib/mkmf.rb (configuration): set the default cxxflags, which is
-	  referred from the default CXXFLAGS, for extension libraries.
-	  [Fix GH-823]
-
-Tue Feb  3 05:52:00 2015  Aman Gupta <ruby@tmm1.net>
-
-	* gc.c (rb_objspace_free): cause rb_bug if lazy sweep is in progress
-	  during rb_objspace_free. Adds extra protection for r46340.
-	  Patch by Vicent Marti. [Bug #10768] [ruby-core:67734]
-	* gc.c (rb_objspace_call_finalizer): Ensure GC is completed after
-	  finalizers have run. We already call gc_rest() before invoking
-	  finalizers, but finalizer can allocate new objects and start new GC
-	  cycle, so we call gc_rest() again after finalizers are complete.
-
-Mon Feb  2 10:51:34 2015  Ari Pollak  <ajp@aripollak.com>
-
-	* doc/security.rdoc (Symbols): update about Symbol GC.  Symbols
-	  explicitly converted from Strings now can be collected, but
-	  reflection/metaprogramming still can cause memory flooding.
-	  [Fix GH-725]
-
-Sun Feb  1 13:46:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/rbinstall.rb (bin-comm): drop batch file installation.
-	  Windows 95 support has not been supported already.
-	  [Feature #10806]
-
-Sat Jan 31 12:06:23 2015  Scott Francis  <scott.francis@shopify.com>
-
-	* thread_pthread.c (reserve_stack): fix intermittent SIGBUS on
-	  Linux, by reserving the stack virtual address space at process
-	  start up so that it will not clash with the heap space.
-	  [Fix GH-822]
-
-Fri Jan 30 17:28:29 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c (num2dbl_with_to_f): make faster when Bignum passed by
-	  direct conversion using rb_big2dbl().  [Feature #10800]
-
-Thu Jan 29 23:30:00 2015  Kenta Murata  <mrkn@mrkn.jp>
-
-	* ext/bigdecimal/bigdecimal.c (rb_rational_num): add fallback function
-	  for rubies lower than 2.2.0.
-
-	* ext/bigdecimal/bigdecimal.c (rb_rational_den): ditto.
-
-	* ext/bigdecimal/extconf.rb: check the existences of struct RRational,
-	  rb_rational_num, and rb_rational_den.
-
-	* ext/bigdecimal/bigdecimal.bundle: bump version.
-
-Thu Jan 29 20:28:25 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/make-snapshot: removed md5 digest with package information
-
-Thu Jan 29 10:41:52 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c (Get_Double): direct casting from Fixnum to double.
-	  [Feature #10785]
-
-Thu Jan 29 02:34:27 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/to_ruby.rb: fix parsing hashes with
-	  instance variables when it is referenced multiple times.
-	* ext/psych/lib/psych.rb: bump version
-	* ext/psych/psych.gemspec: bump version
-	* test/psych/test_hash.rb: test for fix
-
-Thu Jan 29 02:06:09 2015  Eric Wong  <e@80x24.org>
-
-	* thread.c (struct join_arg): restructure and make smaller
-	  (thread_join_sleep): avoid timeofday() call if forever
-	  (thread_join): pass join_arg.delay directly
-	  (rb_thread_inspect_msg): remove, inline into rb_thread_inspect
-	  (rb_thread_inspect): reduce branching and string creation
-	* thread_pthread.c (native_set_thread_name): create string directly
-	  to avoid reparsing. [Misc #10723]
-
-Wed Jan 28 21:32:24 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* thread.c: Improve documentation for Thread#value
-	  [Bug #10694][ruby-core:67324][ci skip]
-
-Tue Jan 27 16:04:19 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: added `!` command.
-
-Tue Jan 27 15:58:23 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: added history feature for platforms which
-	  lack readline.
-
-Mon Jan 26 22:09:35 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .gitignore: ignored temporary file with git.
-
-Mon Jan 26 18:06:03 2015  Akinori MUSHA  <knu@iDaemons.org>
-
-	* misc/ruby-electric.el: Import version 2.2.2 from
-	  https://github.com/knu/ruby-electric.el.
-
-Mon Jan 26 11:37:49 2015  Dave Stevens  <dave@crowdlab.com>
-
-	* string.c (str_make_independent_expand): terminate String when
-	  moved from heap to embedded.  [Fix GH-821].
-
-Sun Jan 25 12:04:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (flatten): no need to call to_ary method on elements
-	  beyond the given level.  [ruby-core:67637] [Bug #10748]
-
-Sun Jan 25 00:42:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/fiddle/win32/libffi.mk.tmpl: assemble without directory prefix.
-	  workaround of a bug of VC12 ml, by unak at [ruby-core:67792].
-	  [ruby-core:67789] [Bug #10780]
-
-Sat Jan 24 19:56:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dln_find.c (dln_find_1): search regular files only.  based on
-	  the patch by Alex Coomans in [ruby-core:67766].  [Bug #10776]
-
-Fri Jan 23 23:57:05 2015  Misumi Rize  <r@ayase-e.li>
-
-	* vm_insnhelper.c (vm_throw_start): search the target to break
-	  from a block with nested rescue, from the nested blocks.
-	  [ruby-core:67765] [Bug #10775] [Fix GH-820]
-
-Fri Jan 23 20:00:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (w_object, marshal_dump): use identity tables for
-	  arbitrary VALUE keys, because of performance of FLONUM.
-	  [Bug #10761]
-
-	* marshal.c (obj_alloc_by_klass, marshal_load): ditto.
-
-Fri Jan 23 17:12:33 2015  Eric Wong  <e@80x24.org>
-
-	* benchmark/bm_marshal_dump_flo.rb: new benchmark for [Bug #10761]
-
-Thu Jan 22 18:03:19 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (find_svn_log): use double quotes instead
-	  of single quotes because cmd.exe doesn't handle them.
-
-	* tool/redmine-backporter.rb (done): the 2nd element of matched data
-	  is the offset of the end of matched string, not length.
-
-Thu Jan 22 16:45:24 2015  Eric Wong  <e@80x24.org>
-
-	* st.c (st_numhash): mix float value for flonum
-	* hash.c (rb_any_hash): ditto
-	* benchmark/bm_hash_aref_flo.rb: new benchmark
-	* benchmark/bm_hash_ident_flo.rb: ditto
-	  [Bug #10761]
-
-Wed Jan 21 22:33:51 2015  Akinori MUSHA  <knu@iDaemons.org>
-
-	* misc/ruby-electric.el: Import version 2.2.1 from
-	  https://github.com/knu/ruby-electric.el.  Improve compatibility
-	  with and optimize for Emacs 24.4.
-
-Wed Jan 21 09:40:52 2015  Zachary Scott  <e@zzak.io>
-
-	* file.c: Document other cases of missing birthtime on OS with patch
-	  provided by @sho-h similar to GH-817. [ci skip] [DOC]
-
-Wed Jan 21 09:09:19 2015  Tanaka Akira  <akr@fsij.org>
-
-	* NEWS: References to tickets added.
-	  [ruby-core:67701] [Bug #10760] Suggested by Zachary Scott.
-
-Tue Jan 20 22:59:54 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/vcs.rb: fix the exception given remote-url of svn.
-
-Tue Jan 20 12:58:33 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: now can change the page of `ls`.
-
-Tue Jan 20 12:28:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (readline): fallback to normal gets on
-	  Windows because IO.console.getch is not always do as expected.
-
-Tue Jan 20 11:31:07 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: update usage.
-
-Tue Jan 20 11:23:47 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (mygets): to support Backspace
-	  implement gets by itself.
-
-Tue Jan 20 02:54:11 2015  Zachary Scott  <e@zzak.io>
-
-	* file.c: NotImplementedError is raised if birthtime is unavailable.
-	  Patch by @y-yagi san and [Fixes GH-817] [ci skip] [DOC]
-
-	* ext/pathname/pathname.c: ditto.
-
-Mon Jan 19 22:08:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* class.c (include_modules_at): allow prepend each modules upto
-	  once for each classes.  [EXPERIMENTAL]
-
-Sun Jan 18 18:32:20 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* math.c (math_atan2): revive documentation before r49220.
-	  http://d.hatena.ne.jp/nagachika/20150112/ruby_trunk_changes_49213_49226
-
-Sun Jan 18 15:57:32 2015  Seiei Higa  <hanachin@gmail.com>
-
-	* vm_method.c (check_definition): Module#public_method_defined?,
-	  Module#private_method_defined?, Module#protected_method_defined?
-	  should not use refinements. [ruby-core:67656] [Bug #10753]
-
-Sun Jan 18 15:50:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_dump.c (rb_vm_bugreport): check by configured result instead
-	  of system name for old FreeBSD.  based on a patch by Steve Wills
-	  at [ruby-core:67655].  [Bug #10752]
-
-Sun Jan 18 12:56:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in (VPATH, NEWLINE_C), common.mk (common-srcs): make
-	  and use newline.c under enc/trans directory, not toplevel.  no
-	  longer search enc directory implicitly.
-
-	* configure.in, enc/Makefile.in (BUILTIN_ENCS, BUILTIN_TRANSES):
-	  prefix respective directory names to builtin encodings and
-	  transcoder source names.
-
-Sun Jan 18 11:49:46 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (ole_invoke): avoid SEGV when VT_RECORD
-	  variable is passed by reference. [ruby-dev:48803] [Bug #10697]
-
-Sat Jan 17 23:59:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb (visit_String):
-	  anchors like `\Z` are not valid inside character class.  use
-	  negative-lookahead instead.
-	  Fixes: https://github.com/tenderlove/psych/issues/221
-
-Sat Jan 17 23:42:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in: get rid of pattern substitution, which is not
-	  supported by ash, and ash on NetBSD parses whole source first
-	  and fails to start.  [ruby-dev:48823] [Bug #10750]
-
-Fri Jan 16 18:42:58 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: support adding related revisions
-	  to issues.
-
-Fri Jan 16 17:20:33 2015  Koichi Sasada  <ko1@atdot.net>
-
-	vm.c, vm_core.h: constify VM_CF_LEP, VM_CF_PREV_EP, VM_CF_BLOCK_PTR
-	and rb_vm_control_frame_block_ptr.
-
-Fri Jan 16 15:41:21 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych.rb: bump version
-
-	* ext/psych/psych.gemspec: ditto
-
-Fri Jan 16 15:37:49 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: only dump hash
-	  subclasses. Thanks Joe Eli McIlvain <joe.eli.mac@gmail.com>
-
-	* test/psych/test_hash.rb: test for change
-
-Fri Jan 16 15:35:21 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych.rb: bump version
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: fix line width wrapping
-	  for long strings.  Thanks Jakub Jirutka <jakub@jirutka.cz>
-
-	* test/psych/test_string.rb: test for change
-
-Fri Jan 16 11:44:44 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
-
-	* eval_intern.h, vm.c, vm_eval.c, vm_insnhelper.c:
-	  change throw mechanism (not save target ep, but save target cfp).
-	  It fixes `unexpected break' bug that occurs when
-	  TracePoint#binding is called.
-	  [ruby-dev:48797] [Bug #10689]
-
-	* test/ruby/test_settracefunc.rb: add a test.
-
-Thu Jan 15 23:55:15 2015  Tanaka Akira  <akr@fsij.org>
-
-	* io.c (rb_io_close_m): Don't raise when the IO object is closed.
-	  [ruby-core:67444] [Feature #10718]
-
-Thu Jan 15 21:34:57 2015  Seiei Higa  <hanachin@gmail.com>
-
-	* proc.c (rb_obj_singleton_method): Kernel#singleton_method should
-	  not use refinements, as well as Kernel#method.
-	  [ruby-core:67603] [Bug #10744]
-
-Thu Jan 15 10:45:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_select_bang, ary_reject_bang): linear
-	  performance.  [ruby-core:67418] [Feature #10714]
-
-Wed Jan 14 18:06:06 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
-
-	* lib/uri/mailto.rb: raising URI::InvalidComponentError instead
-	  of failing with undefined method `split' for nil:NilClass for
-	  mailto: URIs without opaque part. [Bug #10738]
-	* test/uri/testuri.rb: Test for above
-
-Wed Jan 14 16:45:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/downloader.rb (RubyGems.download): verify downloaded gem
-	  packages.  LowSecurity to allow untrusted certificates now.
-
-Wed Jan 14 15:43:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/readline/readline.c (readline_s_refresh_line): initialize
-	  before rl_refresh_line(), as some function make the internal
-	  state non-clean but rl_refresh_line() does not re-initialize it.
-	  [ruby-core:43957] [Bug #6232]
-
-Tue Jan 13 21:59:24 2015  Michal Papis  <mpapis@gmail.com>
-
-	* tool/rbinstall.rb (gem): fix changing permissions of installed
-	  bundled gems.  [Fix GH-812]
-
-Tue Jan 13 21:57:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk (distclean-local): remove autom4te.cache generated by
-	  autoconf.
-
-	* common.mk (realclean-local): remove id sources and dummy header
-	  for dtrace.  [ruby-core:67562] [Bug #10737]
-
-Tue Jan 13 21:08:22 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json, test/json: merge JSON HEAD(259dee6)
-	  separate implementation of Typed_Data macro.
-	  https://github.com/flori/json/compare/v1.8.1...v1.8.2
-
-Tue Jan 13 14:16:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/net/http/test_http.rb: get rid of accessing DNS actually
-	  for some servers returning wrong results.
-	  [ruby-core:67454] [Bug #10721]
-
-Mon Jan 12 23:21:57 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* gems/bundled_gems: update test-unit to 3.0.9.
-
-Mon Jan 12 18:35:44 2015  Eric Wong  <e@80x24.org>
-
-	* numeric.c (bit_coerce): use original value for error message
-	  [ruby-core:67405] [Bug #10711]
-	* test/ruby/test_numeric.rb (test_coerce): check error message
-
-Mon Jan 12 18:01:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rdoc/text.rb (expand_tabs): get rid of infinite loop with
-	  CR.  should check if substitution occurred too.
-	  [ruby-dev:48813] [Bug #10732]
-
-Mon Jan 12 16:45:46 2015  Seiei Higa  <hanachin@gmail.com>
-
-	* vm_method.c (rb_alias): raise a NameError when creating alias to
-	  a refined method if the original method of the refined method is
-	  not defined.  [ruby-core:67523] [Bug #10731]
-
-Mon Jan 12 13:53:17 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* math.c (math_atan2): improve documentation.
-	  [Feature #10323][ruby-core:65400][ci skip]
-
-Mon Jan 12 13:50:49 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/bigdecimal/bigdecimal.c: fixes documentation like labeled lists,
-	  code examples etc. [ruby-core:66730][Bug #10576][ci skip]
-
-Mon Jan 12 13:36:44 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/optparse.rb: improvements for OptionParser documentation.
-	  [misc #10608][ruby-core:66901][ci skip]
-
-Mon Jan 12 13:33:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* array.c (rb_ary_each): documented return value.
-	  [misc #10469][ruby-core:66063]
-
-Sun Jan 11 15:11:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/webrick/test_utils.rb (test_create_listeners): use
-	  dynamically chosen port number, not hardcoded port number.
-	  [ruby-core:67508]
-
-Sat Jan 10 12:57:12 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/zlib/zlib.c: fix document of method signatures.
-	  [Bug #10668][ruby-core:67186][ci skip]
-
-Sat Jan 10 12:32:44 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* eval_error.c (error_print): pos and len parameters of rb_str_substr()
-	  are counted by characters, not bytes.  use rb_str_subseq() instead.
-	  [Bug #10727] [ruby-core:67473]
-
-Sat Jan 10 10:58:55 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* complex.c: removed commented-out code.
-
-Sat Jan 10 10:57:19 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* rational.c: removed commented-out code.
-	  [Feature #10376][ruby-core:65643]
-
-Sat Jan 10 10:12:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_select_bang): keep the array consistent by
-	  removing unselected values soon.  [ruby-dev:48805] [Bug #10722]
-
-Fri Jan  9 23:20:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems:  Update to RubyGems HEAD(e53c54a).
-	* test/rubygems:  ditto.
-
-Fri Jan  9 11:13:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (assocs, assoc): eliminate splatting empty literal
-	  hashes.  [ruby-core:67446] [Bug #10719]
-
-	* compile.c (compile_array_): support splatted hash in hash type.
-
-Fri Jan  9 10:57:09 2015  Vit Ondruch  <vondruch@redhat.com>
-
-	* configure.in (RUBY_SETJMP_TYPE): Remove superfluous semicolon
-	  which causes a syntax error with autoconf 2.63.
-	  [ruby-core:67429] [Bug #10716]
-
-Fri Jan  9 07:23:32 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: correctly quote non-ascii
-	  letters. Thanks @jirutka for the patch.
-
-	* test/psych/test_string.rb: test for change
-
-Fri Jan  9 07:13:55 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/to_ruby.rb: call `allocate` on hash
-	  subclasses.  Fixes github.com/tenderlove/psych/issues/196
-
-	* test/psych/test_hash.rb: test for change
-
-Fri Jan  9 06:58:43 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/to_ruby.rb: revive hashes with ivars
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: dump hashes with ivars.
-	  Fixes github.com/psych/issues/43
-
-	* test/psych/test_hash.rb: test for change
-
-Thu Jan  8 17:05:00 2015  Seiei Higa  <hanachin@gmail.com>
-
-	* vm_method.c (rb_method_entry): if no super class, no original
-	  method entry.  [ruby-core:67389] [Bug #10707]
-
-Thu Jan  8 16:31:43 2015  Seiei Higa  <hanachin@gmail.com>
-
-	* vm_method.c (rb_export_method): bail out if the original method
-	  is undefined when the method is refined.
-	  [ruby-core:67387] [Bug #10706]
-
-Thu Jan  8 12:53:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): match in case-folding only if the directory
-	  resides on a case-insensitive file system, on OSX.
-	  [ruby-core:67364] [Bug #10700]
-
-Thu Jan  8 11:39:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .travis.yml: Remove redundant configuration option.
-	  [fix GH-809] Patch by @gxworld
-
-Thu Jan  8 07:17:14 2015  Eric Wong  <e@80x24.org>
-
-	* lib/resolv.rb: consider ENETUNREACH as ResolvTimeout
-	  [ruby-core:67411] [Bug #10712]
-
-Thu Jan  8 00:13:52 2015  Tanaka Akira  <akr@fsij.org>
-
-	* lib/open3.rb: Open3 properly passes non-keyword hash args to spawn.
-	  Fixed by Josh Cheek.  [Fix GH-808]
-	  Related to [ruby-core:67347] [Bug #10699]
-
-Wed Jan  7 19:19:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (dir_initialize): workaround of opendir failure at symlink
-	  directories on Windows via CIFS.
-
-Wed Jan  7 18:52:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (need_normalization): not only HFS+, CIFS (SMB) is also
-	  decomposed.  [Bug #10704]
-
-	* dir.c (NORMALIZE_UTF8PATH): Unicode decomposition seems to
-	  perform in an upper layer than file systems on OSX, as all path
-	  names are always decomposed regardless of file system types.
-
-Tue Jan  6 21:41:04 2015  Tanaka Akira  <akr@fsij.org>
-
-	* time.c (timelocalw): Set tm_isdst field -1 if vtm->isdst is
-	  VTM_ISDST_INITVAL.  This bug is introduced at packing struct
-	  vtm (r45155).
-	  [ruby-core:67345] [Bug #10698] Reported by Boris Ruf.
-
-Tue Jan  6 03:10:54 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/fiddle/test_handle.rb: fix syntax.
-
-Tue Jan  6 00:16:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/fiddle/test_handle.rb (test_NEXT): use -test-/dln/empty
-	  which is always a shared object and is not used by others.
-	  [ruby-dev:48629] [Bug #10384]
-
-Mon Jan  5 14:58:01 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* test/ruby/test_io.rb: added timeout for AIX environment.
-	  [ruby-core:62983][Bug #9917]
-
-Sun Jan  4 22:33:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/lib/test/unit.rb (ExcludesOption): add "excludes" support
-	  to test suite, for alternative implementations and platforms.
-	  [Feature #10682]
-
-Sun Jan  4 22:32:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/lib/test/unit.rb (Test::Unit): reorder modules and merge
-	  each modules.
-
-	* test/lib/test/unit.rb (Test::Unit): split the large class into
-	  each modules.
-
-Sun Jan  4 21:32:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (f_label): return tLABEL value as it is.
-	  [ruby-core:67315] [Bug #10693]
-
-Sun Jan  4 14:02:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/lib/test/unit/parallel.rb (run): expand the file name to be
-	  loaded, so that relative paths work in parallel mode.
-
-Sun Jan  4 13:36:56 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
-
-	* test/test_tempfile.rb: use assert_file for more descriptive message.
-	  following r49131.
-
-Sun Jan  4 13:05:09 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
-
-	* string.c: improve docs for String#<=>. [ruby-core:65399][Feature #10322]
-	  Patch by gogo tanaka.
-
-Sun Jan  4 12:42:24 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
-
-	* array.c: improve docs for Array#reject. [ruby-core:65324][misc #10307]
-	  Patched by Nebu Pookins.
-
-Sun Jan  4 12:24:11 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
-
-	* string.c: improve docs for String#strip and variations.
-	  [ruby-core:66081][Bug #10476]
-
-Sun Jan  4 09:21:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/drb/drb.rb: removed unused argument. Patch by @vipulnsward
-	  [fix GH-515]
-
-Sun Jan  4 09:18:31 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/tempfile.rb: provide default basename parameter.
-	  [fix GH-523] Patch by @dissolved
-	* test/test_tempfile.rb: ditto.
-
-Sun Jan  4 00:43:41 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
-
-	* README.ja.md: add guidance of mailing list and bugs.r-l.o.
-
-Sat Jan  3 23:56:28 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
-
-	* hash.c: fix docs for Hash#invert. [ruby-core:66917] [Bug #10612]
-
-Sat Jan  3 19:52:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/intern.h (rb_str_new_literal): define on all
-	  platforms, not only gcc.
-
-Sat Jan  3 18:53:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/fiddle/lib/fiddle/cparser.rb (parse_ctype): limit split word
-	  number as the rest are not used.
-
-Sat Jan  3 18:19:50 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/fiddle/lib/fiddle/cparser.rb: r49110 broke Fiddle::Import with
-	  type_alias.
-	* test/fiddle/test_cparser.rb: added type_alias test for parse_ctype
-	  and parse_struct_signature.
-
-Sat Jan  3 11:50:16 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/openssl/ossl.h: avoid to build failure of Windows environment.
-	* ext/openssl/ossl_ssl_session.c: ditto.
-
-Sat Jan  3 11:27:46 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* array.c: Improve performance of Array#shift. use shared instead of
-	  MEMMOVE if with arguments. Patch by @ksss [fix GH-537]
-	* test/ruby/test_array.rb: ditto.
-	* benchmark/bm_array_shift.rb: Added benchmark of GH-537 issue.
-
-Sat Jan  3 10:38:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/net/http.rb: More descriptive error message when net/http fails
-	  to connect to a server. Patch by @xaviershay [fix GH-700]
-	* test/net/http/test_http.rb: ditto.
-
-Sat Jan  3 10:14:51 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/openssl/ossl.h: Make `SSL_SESSION_cmp` use `CRYPTO_memcmp`
-	  [fix GH-591] Patch by @PiPeep
-	* ext/openssl/ossl_ssl_session.c: ditto.
-
-Sat Jan  3 09:54:32 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/fiddle/lib/fiddle/cparser.rb: Support for Fiddle::CParser
-	  to handle rich signatures including parameter names and function
-	  pointer types. Patch by @theryan [fix GH-590]
-	* test/fiddle/test_cparser.rb: ditto.
-
-Sat Jan  3 09:01:43 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* NEWS: added compatibility entry of r49101.
-
-Fri Jan  2 21:06:59 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/net/http.rb (Net::HTTP#send_request): there is no response body
-	  with HEAD request. Patch by @rodrigosaito [fix GH-520]
-
-Fri Jan  2 21:04:36 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* test/net/http/test_http.rb (_test_send_request__HEAD): Added
-	  failing test for send_request with HEAD method.
-
-Fri Jan  2 18:41:20 2015  Tanaka Akira  <akr@fsij.org>
-
-	* eval.c (ruby_init): Print ruby_setup() error only in debug mode.
-	  Unsuppressable error message is not a good idea.
-	  Note that the message is printed sometimes with following
-	  code (highly timing dependent, though):
-	  pid = spawn("ruby -e ''"); Process.kill(:TERM, pid)
-
-Fri Jan  2 16:18:44 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* test/ruby/test_module.rb: Refactor invalid testcase.
-	  [fix GH-472][ruby-core:59035][Bug #9240]
-
-Fri Jan  2 15:53:00 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/webrick/utils.rb: removed unused argument variable.
-	  [fix GH-356] Patch by @vipulnsward
-	* lib/webrick/server.rb: ditto.
-	* lib/webrick/ssl.rb: ditto.
-	* test/webrick/test_utils.rb: added test for WEBrick::Utils#create_listeners.
-
-Fri Jan  2 15:35:53 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/securerandom.rb: improve syntax and grammar of documentation.
-	  [fix GH-796][ci skip] Patch by @Erol
-
-Fri Jan  2 15:10:01 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* test/openssl/test_ssl_session.rb (OpenSSL#test_ctx_client_session_cb):
-	  fix test failure with OpenSSL disabled SSLv3 protocol.
-	  [ruby-core:63772] [Bug #10046]
-
-Fri Jan  2 09:08:31 2015  Tanaka Akira  <akr@fsij.org>
-
-	* lib/resolv.rb (Resolv::DNS::Label::Str#==): Check class equality.
-	  (Resolv::DNS::Name#initialize): Normalize labels as
-	  Resolv::DNS::Label::Str objects.
-
-Thu Jan  1 21:41:49 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/regexp.rdoc: fix regexp docs for whitespace character.
-	  [ruby-dev:48765] [Bug #10624]
-
-Thu Jan  1 17:50:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/ruby/test_rubyoptions.rb: try locale encoding name.
-	  [ruby-core:67109] [Bug #10643]
-
-Thu Jan  1 11:07:12 2015  Eric Wong  <e@80x24.org>
-
-	* symbol.c (rb_gc_free_dsymbol): delete from global fstr hash
-	* test/ruby/test_symbol.rb (test_symbol_fstr_leak): test for bug
-	  [ruby-core:67268] [Bug #10686]
-
-Thu Jan  1 09:14:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_args.c (keyword_hash_p): fix non-symbol keys hash.
-	  rb_extract_keywords() returns 0 not Qnil when no symbol keys is
-	  included.  [ruby-core:67264] [Bug #10685]
-
-Wed Dec 31 17:48:43 2014  Tanaka Akira  <akr@fsij.org>
-
-	* lib/resolv.rb (Resolv::DNS::Label::Str#initialize): Set encoding
-	  ASCII-8BIT before downcase.  case insensitivity of DNS labels doesn't
-	  apply non-ASCII characters.  [RFC 4343]
-
-Wed Dec 31 16:48:44 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (gettable_gen): disable warnings of possible reference
-	  to a local variable defined in a past scope.
-	  [ruby-core:67162] [Bug #10661]
-
-Wed Dec 31 13:43:48 2014  Tanaka Akira  <akr@fsij.org>
-
-	* lib/resolv.rb (Resolv::DNS::Name#==): Compare an array of Label:Str
-	  objects.  Label#Str#== is case-insensitive.
-
-Tue Dec 30 16:16:12 2014  Ben Miller  <bmiller@rackspace.com>
-
-	* lib/resolv.rb (Resolv::DNS::Name#==): DNS is case-insensitive, so the
-	  comparison should be case-insensitive as well.
-	  [ruby-core:66498] [Bug #10550]
-
-Tue Dec 30 16:03:45 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/resolv.rb (Resolv::DNS::Name): names with different dots
-	  should be different.
-
-Tue Dec 30 13:16:56 2014  Martin Duerst  <bernhard+git@lsmod.de>
-
-	* lib/uri/common.rb: Initialize HTML5ASCIIINCOMPAT to empty Array
-	  to avoid error during bootstrap when encodings are not yet defined.
-	  [Bug #10678]
-
-Tue Dec 30 09:29:26 2014  Bernhard M. Wiedemann  <bernhard+git@lsmod.de>
-
-	* ext/dbm/dbm.c (Init_dbm): [DOC] as UNIX permissions are octal
-	  numbers, needs to be prefixed by 0.  [Fix GH-800]
-
-Tue Dec 30 08:57:39 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/unicode_normalize.rb: typo fix. [ci skip]
-	  [ruby-dev:48794][misc #10675]
-
-Mon Dec 29 19:38:01 2014  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* version.h (RUBY_VERSION): 2.3.0 development has started.
-
-Mon Dec 29 18:58:46 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* re.c (unescape_nonascii): append escape sequence as-is not
-	  unescaped character, to get rid of unexpected meta-character.
-	  [ruby-core:67193] [Bug #10670]
-
-Mon Dec 29 14:27:33 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* doc/syntax/literals.rdoc (Symbols): now Symbols created by
-	  interpolation can be garbage collected.  patch by Yihang Ho in
-	  [ruby-core:67194].  [Bug #10671]
-
-Mon Dec 29 11:18:17 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* thread.c (rb_thread_variable_get): fix dynamic symbol keys.
-	  rb_check_id() returns non-zero only for static symbols, whereas
-	  thread local variable keys can be dynamic symbols.
-	  [ruby-core:67185] [Bug #10667]
-
-Mon Dec 29 10:37:27 2014  Thiago Lewin  <thiago_lewin@yahoo.com.br>
-
-	* io.c (rb_f_select): [DOC] workaround for YARD doc.  [Fix GH-799]
-
-	* process.c (proc_detach): [DOC] fix missing closing parenthesis.
-	  [Fix GH-799]
-
-Mon Dec 29 07:27:23 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json, test/json: merge JSON HEAD(17fe8e7)
-	  https://github.com/flori/json/compare/v1.8.1...17fe8e7
-
-Sun Dec 28 23:49:37 2014  Michal Papis  <mpapis@gmail.com>
-
-	* rbinstall.rb: fix target location for installing bundled gems.
-	  install to the prepared directory instead of default Gem.dir,
-	  not to be affected GEM_HOME environment variable.  [Fix GH-798]
-
-Sun Dec 28 18:19:28 2014  Eric Wong  <e@80x24.org>
-
-	* test/-ext-/iseq_load/test_iseq_load.rb
-	  (test_next_in_block_in_block): test using ISeq#eval
-	  (test_break_ensure): ditto
-	  [ruby-core:66988]
-
-Sun Dec 28 16:25:12 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* cygwin/GNUmakefile.in (EXTOBJS): override to add resource files
-	  always.  [ruby-core:67153] [Bug #10657]
-
-Sun Dec 28 13:54:26 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (f_kwrest, new_args_tail_gen): unnamed rest keyword and
-	  keywords bits arguments should be unique.  since internal IDs
-	  depend on the local variable index in the current scope, new ID
-	  should be made before popping those vtables.
-	  [ruby-core:67157] [Bug #10659]
-
-Sat Dec 27 20:12:55 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/json/generator/generator.c (JSON_Generator_State_type): add
-	  #ifdef for backward compatibility.
-
-	* ext/json/parser/parser.rl (JSON_Parser_type): ditto.
-
-	* ext/json/generator/generator.h (ZALLOC): add fallback definition.
-
-	* ext/json/parser/parser.h (ZALLOC): ditto.
-
-Sat Dec 27 16:54:05 2014  Tanaka Akira  <akr@fsij.org>
-
-	* process.c: Unused code removed.
-	  It seems waitpid() is universally available on POSIX platforms.
-
-Sat Dec 27 15:08:27 2014  Eric Wong  <e@80x24.org>
-
-	* vm_core.h (rb_vm_living_threads_insert): preserve order
-	  [Bug #10660] [ruby-core:67154] [ruby-core:67159]
-
-Sat Dec 27 13:08:20 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/socket/socket.c: improved document for YARD doc.
-	  [fix GH-795][ci skip] Patch by @tlewin
-
-Sat Dec 27 10:11:21 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/tk/lib/tkextlib/tcllib/plotchart.rb: fix to invoke correct function
-	  of tcllib. Patch by @zalt50 [fix GH-787]
-
-Sat Dec 27 10:03:41 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/make-snapshot: show sha1 digest when making packages.
-	  it's request from https://github.com/ruby/www.ruby-lang.org/issues/921
-	  [fix GH-794]
-
-Fri Dec 26 15:32:16 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/tk/tcltklib.c (ip_invoke_core): remove probably duplicate
-	  dead code.
-
-Fri Dec 26 15:28:27 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/tk/tcltklib.c (ip_ruby_cmd_receiver_const_get): simply use
-	  rb_path2class() to get a class/module from its name.
-
-Fri Dec 26 15:20:54 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (w_long): append at once by w_nbyte() instead of
-	  appending byte by byte.
-
-Fri Dec 26 15:13:13 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/json/parser/parser.rl (unescape_unicode): check if valid
-	  before bit-or assignments.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
-
-	* ext/nkf/nkf-utf8/nkf.c (nkf_iconv_t): fix a missing semicolon.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
-
-	* process.c (rb_spawn_process): get rid of usage of uninitialized
-	  variable.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
-
-	* regexec.c (match_at): ditto.
-
-	* ext/win32ole/win32ole.c (ole_wc2mb_alloc, ole_vstr2wc, ole_mb2wc):
-	  ditto.
-
-	* dir.c (ruby_glob0): no need to check never-NULL pointer.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
-
-	* win32/file.c (rb_file_expand_path_internal): ditto.
-
-	* win32/file.c (code_page_i): handle realloc failure.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
-
-	* win32/stub.c (stub_sysinit): ditto.
-
-	* fix printf format conversion specifiers.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
-
-Fri Dec 26 01:41:40 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/rbinstall.rb: skip installing bundle gems if zlib is unavailable.
-	  [Bug #10647] [ruby-dev:48787]
-
-Fri Dec 26 01:24:42 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/downloader.rb: support old versions of ruby.
-
-	* tool/downloader.rb: now can download gems by http if openssl is not
-	  available (this may be danger!)
-
-Fri Dec 26 00:13:48 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_extlibs.rb: check existence of extension libraries
-	  which not depend on outer libraries. (experimental)
-
-Thu Dec 25 21:58:15 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/fiddle/extconf.rb: make PIC objects if it will be linked as
-	  a shared object eventually.  [ruby-core:67128]
-
-Thu Dec 25 19:01:13 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/fiddle/win32/libffi-3.2.1-mswin.patch: support mswin32.
-
-Thu Dec 25 17:30:40 2014  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* gc.c (wmap_final_func): fix memory size shortage when realloc wmap.
-	  Fix SEGV during finalize of WeakRef on Solaris (though the SEGV
-	  could occur on all OS/platforms). [ruby-dev:48779] [Bug #10646]
-
-Thu Dec 25 17:27:06 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (NET_LUID): include winsock2.h instead of windows.h.
-	  patch by Jon Forums in [ruby-core:67125].  [Bug #10640]
-
-Thu Dec 25 16:14:10 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/io/console/console.c (console_dev): send the given arguments
-	  to the opened console.  as a special case, do nothing if :close
-	  is given.
-
-	* test/lib/leakchecker.rb (LeakChecker#check_fd_leak): close if
-	  console.
-
-For the changes before 2.2.0, see doc/ChangeLog-2.2.0
-For the changes before 2.1.0, see doc/ChangeLog-2.1.0
-For the changes before 2.0.0, see doc/ChangeLog-2.0.0
-For the changes before 1.9.3, see doc/ChangeLog-1.9.3
-For the changes before 1.8.0, see doc/ChangeLog-1.8.0
-
-Local variables:
-coding: us-ascii
-add-log-time-format: (lambda ()
-  (let* ((time (current-time))
-	 (system-time-locale "C")
-	 (diff (+ (cadr time) 32400))
-	 (lo (% diff 65536))
-	 (hi (+ (car time) (/ diff 65536))))
-  (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
-indent-tabs-mode: t
-tab-width: 8
-change-log-indent-text: 2
-end:
-vim: tabstop=8 shiftwidth=2
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
index b97a08d928..35a8e75876 100644
--- a/KNOWNBUGS.rb
+++ b/KNOWNBUGS.rb
@@ -1,5 +1,7 @@
 #
-# This test file concludes tests which point out known bugs.
+# IMPORTANT: Always keep the first 7 lines (comments),
+# even if this file is otherwise empty.
+#
+# This test file includes tests which point out known bugs.
 # So all tests will cause failure.
 #
-
diff --git a/LEGAL b/LEGAL
index 24e36e6231..0423d57ac9 100644
--- a/LEGAL
+++ b/LEGAL
@@ -1,116 +1,331 @@
-LEGAL NOTICE INFORMATION
-------------------------
+# -*- rdoc -*-
+
+= LEGAL NOTICE INFORMATION
+--------------------------
 
 All the files in this distribution are covered under either the Ruby's
 license (see the file COPYING) or public-domain except some files
 mentioned below.
 
-ccan/build_assert/build_assert.h
-ccan/check_type/check_type.h
-ccan/container_of/container_of.h
-ccan/str/str.h
+[addr2line.c]
 
-  These files are licensed under the CC0.
+  A part of this file is from FreeBSD.
 
-    http://creativecommons.org/choose/zero/
+  >>>
+    Copyright (c) 1986, 1988, 1991, 1993::
+    The Regents of the University of California.  All rights reserved.
 
-ccan/list/list.h
+    (c) UNIX System Laboratories, Inc.
 
-  This file is licensed under the MIT License.
+    All or some portions of this file are derived from material licensed
+    to the University of California by American Telephone and Telegraph
+    Co. or Unix System Laboratories, Inc. and are reproduced herein with
+    the permission of UNIX System Laboratories, Inc.
 
-    Permission is hereby granted, free of charge, to any person obtaining a copy
-    of this software and associated documentation files (the "Software"), to deal
-    in the Software without restriction, including without limitation the rights
-    to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
-    copies of the Software, and to permit persons to whom the Software is
-    furnished to do so, subject to the following conditions:
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    4. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
 
-    The above copyright notice and this permission notice shall be included in
-    all copies or substantial portions of the Software.
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
 
-    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
-    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
-    THE SOFTWARE.
-
-include/ruby/oniguruma.h:
-regcomp.c:
-regenc.[ch]:
-regerror.c:
-regexec.c:
-regint.h:
-regparse.[ch]:
-enc/ascii.c
-enc/big5.c
-enc/cp949.c
-enc/emacs_mule.c
-enc/encdb.c
-enc/euc_jp.c
-enc/euc_kr.c
-enc/euc_tw.c
-enc/gb18030.c
-enc/gb2312.c
-enc/gbk.c
-enc/iso_8859_1.c
-enc/iso_8859_10.c
-enc/iso_8859_11.c
-enc/iso_8859_13.c
-enc/iso_8859_14.c
-enc/iso_8859_15.c
-enc/iso_8859_16.c
-enc/iso_8859_2.c
-enc/iso_8859_3.c
-enc/iso_8859_4.c
-enc/iso_8859_5.c
-enc/iso_8859_6.c
-enc/iso_8859_7.c
-enc/iso_8859_8.c
-enc/iso_8859_9.c
-enc/koi8_r.c
-enc/koi8_u.c
-enc/shift_jis.c
-enc/unicode.c
-enc/us_ascii.c
-enc/utf_16be.c
-enc/utf_16le.c
-enc/utf_32be.c
-enc/utf_32le.c
-enc/utf_8.c
-enc/windows_1251.c
-
-Oniguruma  ----   (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
-
-http://www.geocities.jp/kosako3/oniguruma/
-http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
-http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
-
-   When this software is partly used or it is distributed with Ruby,
-   this of Ruby follows the license of Ruby.
-
-configure:
+	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
+
+
+[ccan/build_assert/build_assert.h]
+[ccan/check_type/check_type.h]
+[ccan/container_of/container_of.h]
+[ccan/str/str.h]
+
+  These files are licensed under the {CC0}[https://creativecommons.org/choose/zero/].
+
+[ccan/list/list.h]
+
+  This file is licensed under the {MIT License}[rdoc-label:label-MIT+License].
+
+[coroutine]
+
+  Unless otherwise specified, these files are licensed under the
+  {MIT License}[rdoc-label:label-MIT+License].
+
+[include/ruby/onigmo.h]
+[include/ruby/oniguruma.h]
+[regcomp.c]
+[regenc.c]
+[regenc.h]
+[regerror.c]
+[regexec.c]
+[regint.h]
+[regparse.c]
+[regparse.h]
+[enc/ascii.c]
+[enc/big5.c]
+[enc/cp949.c]
+[enc/emacs_mule.c]
+[enc/encdb.c]
+[enc/euc_jp.c]
+[enc/euc_kr.c]
+[enc/euc_tw.c]
+[enc/gb18030.c]
+[enc/gb2312.c]
+[enc/gbk.c]
+[enc/iso_8859_1.c]
+[enc/iso_8859_10.c]
+[enc/iso_8859_11.c]
+[enc/iso_8859_13.c]
+[enc/iso_8859_14.c]
+[enc/iso_8859_15.c]
+[enc/iso_8859_16.c]
+[enc/iso_8859_2.c]
+[enc/iso_8859_3.c]
+[enc/iso_8859_4.c]
+[enc/iso_8859_5.c]
+[enc/iso_8859_6.c]
+[enc/iso_8859_7.c]
+[enc/iso_8859_8.c]
+[enc/iso_8859_9.c]
+[enc/koi8_r.c]
+[enc/koi8_u.c]
+[enc/shift_jis.c]
+[enc/unicode.c]
+[enc/us_ascii.c]
+[enc/utf_16be.c]
+[enc/utf_16le.c]
+[enc/utf_32be.c]
+[enc/utf_32le.c]
+[enc/utf_8.c]
+[enc/windows_1251.c]
+[enc/windows_31j.c]
+
+  Onigmo (Oniguruma-mod) LICENSE
+
+  >>>
+    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    Copyright (c) 2011-2014::  K.Takata  <kentkt AT csc DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+  Oniguruma LICENSE
+
+  >>>
+    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+  * https://github.com/k-takata/Onigmo/
+  * https://github.com/kkos/oniguruma
+  * https://svnweb.freebsd.org/ports/head/devel/oniguruma/
+
+    When this software is partly used or it is distributed with Ruby,
+    this of Ruby follows the license of Ruby.
+
+[enc/windows_1250.c]
+[enc/windows_1252.c]
+
+  >>>
+    Copyright (c) 2006-2007::  Byte      <byte AT mail DOT kna DOT ru>
+                               K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[enc/cesu_8.c]
+[enc/windows_1253.c]
+[enc/windows_1254.c]
+[enc/windows_1257.c]
+
+  >>>
+    Copyright (c) 2002-2007::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[enc/trans/GB/GB12345%UCS.src]
+[enc/trans/GB/UCS%GB12345.src]
+[enc/trans/GB/GB2312%UCS.src]
+[enc/trans/GB/UCS%GB2312.src]
+
+  These files have this explanatory texts.
+
+  >>>
+    This mapping data was created from files provided by Unicode, Inc.
+    (The Unicode Consortium). The files were used to create a product supporting
+    Unicode, as explicitly permitted in the files' copyright notices.
+    Please note that Unicode, Inc. never made any claims as to fitness of these
+    files for any particular purpose, and has ceased to publish the files many
+    years ago.
+
+[enc/trans/JIS/JISX0201-KANA%UCS.src]
+[enc/trans/JIS/JISX0208\@1990%UCS.src]
+[enc/trans/JIS/JISX0212%UCS.src]
+[enc/trans/JIS/UCS%JISX0201-KANA.src]
+[enc/trans/JIS/UCS%JISX0208@1990.src]
+[enc/trans/JIS/UCS%JISX0212.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    © 2015 Unicode®, Inc.
+
+    For terms of use, see http://www.unicode.org/terms_of_use.html
+
+[enc/trans/JIS/JISX0213-1%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-1%UCS@SIP.src]
+[enc/trans/JIS/JISX0213-2%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-2%UCS@SIP.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+    Copyright (C) 2001:: I'O, All Rights Reserved.
+    Copyright (C) 2006:: Project X0213, All Rights Reserved.
+    You can use, modify, distribute this table freely.
+
+[enc/trans/JIS/UCS@BMP%JISX0213-1.src]
+[enc/trans/JIS/UCS@BMP%JISX0213-2.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-1.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-2.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+    Copyright (C) 2001:: I'O, All Rights Reserved.
+    You can use, modify, distribute this table freely.
+
+[enc/trans/ucm/glibc-BIG5-2.3.3.ucm]
+[enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm]
+
+  >>>
+    Copyright (C) 2001-2005:: International Business Machines
+                              Corporation and others.  All Rights Reserved.
+
+[enc/trans/ucm/windows-950-2000.ucm]
+[enc/trans/ucm/windows-950_hkscs-2001.ucm]
+
+  >>>
+    Copyright (C) 2001-2002:: International Business Machines
+                              Corporation and others.  All Rights Reserved.
+
+
+[configure]
 
   This file is free software.
 
-    Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
+  >>>
+    Copyright (C) 1992-1996, 1998-2012:: Free Software Foundation, Inc.
 
     This configure script is free software; the Free Software Foundation
     gives unlimited permission to copy, distribute and modify it.
 
-tool/config.guess:
-tool/config.sub:
+[tool/config.guess]
+[tool/config.sub]
 
   As long as you distribute these files with the file configure, they
   are covered under the Ruby's license.
 
-      Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
-      Free Software Foundation, Inc.
+  >>>
+    Copyright 1992-2018:: Free Software Foundation, Inc.
 
     This file is free software; you can redistribute it and/or modify it
     under the terms of the GNU General Public License as published by
-    the Free Software Foundation; either version 2 of the License, or
+    the Free Software Foundation; either version 3 of the License, or
     (at your option) any later version.
 
     This program is distributed in the hope that it will be useful, but
@@ -119,54 +334,85 @@ tool/config.sub:
     General Public License for more details.
 
     You should have received a copy of the GNU General Public License
-    along with this program; if not, write to the Free Software
-    Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+    along with this program; if not, see <https://www.gnu.org/licenses/>.
 
     As a special exception to the GNU General Public License, if you
     distribute this file as part of a program that contains a
     configuration script generated by Autoconf, you may include it under
-    the same distribution terms that you use for the rest of that program.
-
-parse.c:
-
-  This file is licensed under the GPL, but is incorporated into Ruby and
+    the same distribution terms that you use for the rest of that
+    program.  This Exception is an additional permission under section 7
+    of the GNU General Public License, version 3 ("GPLv3").
+
+[tool/lib/test/*]
+[tool/lib/core_assertions.rb]
+
+  Some of methods on these files are based on MiniTest 4. MiniTest 4 is
+  distributed under the MIT License.
+
+  >>>
+    Copyright (c) Ryan Davis, seattle.rb
+
+    Permission is hereby granted, free of charge, to any person obtaining
+    a copy of this software and associated documentation files (the
+    'Software'), to deal in the Software without restriction, including
+    without limitation the rights to use, copy, modify, merge, publish,
+    distribute, sublicense, and/or sell copies of the Software, and to
+    permit persons to whom the Software is furnished to do so, subject to
+    the following conditions:
+
+    The above copyright notice and this permission notice shall be
+    included in all copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND,
+    EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+    MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
+    IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
+    CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
+    TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
+    SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+[parse.c]
+[parse.h]
+
+  These files are licensed under the GPL, but are incorporated into Ruby and
   redistributed under the terms of the Ruby license, as permitted by the
   exception to the GPL below.
 
-     Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
-     Free Software Foundation, Inc.
+  >>>
+    Copyright (C) 1984, 1989-1990, 2000-2015, 2018:: Free Software Foundation, Inc.
 
-     This program is free software; you can redistribute it and/or modify
-     it under the terms of the GNU General Public License as published by
-     the Free Software Foundation; either version 2, or (at your option)
-     any later version.
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
 
-     This program is distributed in the hope that it will be useful,
-     but WITHOUT ANY WARRANTY; without even the implied warranty of
-     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
-     GNU General Public License for more details.
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
 
-     You should have received a copy of the GNU General Public License
-     along with this program; if not, write to the Free Software
-     Foundation, Inc., 51 Franklin Street, Fifth Floor,
-     Boston, MA 02110-1301, USA.  */
+    As a special exception, you may create a larger work that contains
+    part or all of the Bison parser skeleton and distribute that work
+    under terms of your choice, so long as that work isn't itself a
+    parser generator using the skeleton or a modified version thereof
+    as a parser skeleton.  Alternatively, if you modify or redistribute
+    the parser skeleton itself, you may (at your option) remove this
+    special exception, which will cause the skeleton and the resulting
+    Bison output files to be licensed under the GNU General Public
+    License without this special exception.
 
-  /* As a special exception, you may create a larger work that contains
-     part or all of the Bison parser skeleton and distribute that work
-     under terms of your choice, so long as that work isn't itself a
-     parser generator using the skeleton or a modified version thereof
-     as a parser skeleton.  Alternatively, if you modify or redistribute
-     the parser skeleton itself, you may (at your option) remove this
-     special exception, which will cause the skeleton and the resulting
-     Bison output files to be licensed under the GNU General Public
-     License without this special exception.
+    This special exception was added by the Free Software Foundation in
+    version 2.2 of Bison.
 
-     This special exception was added by the Free Software Foundation in
-     version 2.2 of Bison.  */
+[missing/dtoa.c]
 
-util.c (partly):
+  This file is under these licenses.
 
-    Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
+  >>>
+    Copyright (c) 1991, 2000, 2001:: by Lucent Technologies.
 
     Permission to use, copy, modify, and distribute this software for any
     purpose without fee is hereby granted, provided that this entire notice
@@ -179,71 +425,74 @@ util.c (partly):
     REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
     OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
 
-win32/win32.[ch]:
+  >>>
+    Copyright (c) 2004-2008:: David Schultz <das@FreeBSD.ORG>
+                              All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[win32/win32.c]
+[include/ruby/win32.h]
 
   You can apply the Artistic License to these files. (or GPL,
   alternatively)
 
-    Copyright (c) 1993, Intergraph Corporation
+  >>>
+    Copyright (c) 1993:: Intergraph Corporation
 
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the perl README file.
 
-util.c (partly):
-
-   Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
-   All rights reserved.
-
-   Redistribution and use in source and binary forms, with or without
-   modification, are permitted provided that the following conditions
-   are met:
-   1. Redistributions of source code must retain the above copyright
-      notice, this list of conditions and the following disclaimer.
-   2. Redistributions in binary form must reproduce the above copyright
-      notice, this list of conditions and the following disclaimer in the
-      documentation and/or other materials provided with the distribution.
-
-   THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-   ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-   IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-   ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-   FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-   DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-   OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-   HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-   LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-   OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-   SUCH DAMAGE.
-
-random.c
+[missing/mt19937.c]
 
   This file is under the new-style BSD license.
 
-    A C-program for MT19937, with initialization improved 2002/2/10.
+  >>>
+    A C-program for MT19937, with initialization improved 2002/2/10.::
     Coded by Takuji Nishimura and Makoto Matsumoto.
+
     This is a faster version by taking Shawn Cokus's optimization,
     Matthe Bellew's simplification, Isaku Wada's real version.
 
     Before using, initialize the state by using init_genrand(seed)
     or init_by_array(init_key, key_length).
 
-    Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
-    All rights reserved.
+    Copyright (C) 1997 - 2002:: Makoto Matsumoto and Takuji Nishimura,
+                                All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
     are met:
 
-      1. Redistributions of source code must retain the above copyright
-	 notice, this list of conditions and the following disclaimer.
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
 
-      2. Redistributions in binary form must reproduce the above copyright
-	 notice, this list of conditions and the following disclaimer in the
-	 documentation and/or other materials provided with the distribution.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
 
-      3. The names of its contributors may not be used to endorse or promote
-	 products derived from this software without specific prior written
-	 permission.
+    3. The names of its contributors may not be used to endorse or promote
+       products derived from this software without specific prior written
+       permission.
 
     THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
     "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
@@ -262,44 +511,15 @@ random.c
     http://www.math.keio.ac.jp/matumoto/emt.html
     email: matumoto@math.keio.ac.jp
 
-vm_dump.c:procstat_vm
-
- * Copyright (c) 2007 Robert N. M. Watson
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions
- * are met:
- * 1. Redistributions of source code must retain the above copyright
- *    notice, this list of conditions and the following disclaimer.
- * 2. Redistributions in binary form must reproduce the above copyright
- *    notice, this list of conditions and the following disclaimer in the
- *    documentation and/or other materials provided with the distribution.
- *
- * THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- * SUCH DAMAGE.
- *
- * $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
-
-vsnprintf.c:
-
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
-
-    Copyright (c) 1990, 1993
-         The Regents of the University of California.  All rights reserved.
+  The Wayback Machine url: http://web.archive.org/web/19990429082237/http://www.math.keio.ac.jp/matumoto/emt.html
 
-    This code is derived from software contributed to Berkeley by
-    Chris Torek.
+[missing/procstat_vm.c]
+
+  This file is under the new-style BSD license.
+
+  >>>
+    Copyright (c) 2007:: Robert N. M. Watson
+                         All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -309,14 +529,11 @@ vsnprintf.c:
     2. Redistributions in binary form must reproduce the above copyright
        notice, this list of conditions and the following disclaimer in the
        documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
 
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
     ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
     IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
     FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
     DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
     OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
@@ -325,146 +542,100 @@ vsnprintf.c:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-    IMPORTANT NOTE:
-    --------------
-    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
-    paragraph 3 above is now null and void.
-
-st.[ch]:
-missing/alloca.c:
-missing/dup2.c:
-missing/erf.c:
-missing/finite.c:
-missing/hypot.c:
-missing/isinf.c:
-missing/isnan.c:
-missing/lgamma_r.c:
-missing/memcmp.c:
-missing/memmove.c:
-missing/strchr.c:
-missing/strstr.c:
-missing/strtol.c:
-missing/tgamma.c:
-ext/digest/sha1/sha1.[ch]:
+    $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
+
+[vsnprintf.c]
+
+  This file is under the {old-style BSD license}[rdoc-label:label-Old-style+BSD+license].
+
+  >>>
+    Copyright (c) 1990, 1993::
+    The Regents of the University of California.  All rights reserved.
+
+    This code is derived from software contributed to Berkeley by
+    Chris Torek.
+
+[st.c]
+[strftime.c]
+[include/ruby/st.h]
+[missing/acosh.c]
+[missing/alloca.c]
+[missing/erf.c]
+[missing/hypot.c]
+[missing/lgamma_r.c]
+[missing/memcmp.c]
+[missing/memmove.c]
+[missing/strchr.c]
+[missing/strerror.c]
+[missing/strstr.c]
+[missing/tgamma.c]
+[ext/date/date_strftime.c]
+[ext/digest/sha1/sha1.c]
+[ext/digest/sha1/sha1.h]
 
   These files are all under public domain.
 
-missing/crypt.c:
+[missing/crypt.c]
 
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
+  This file is under the {old-style BSD license}[rdoc-label:label-Old-style+BSD+license].
 
-    Copyright (c) 1989, 1993
-    	The Regents of the University of California.  All rights reserved.
+  >>>
+    Copyright (c) 1989, 1993::
+    The Regents of the University of California.  All rights reserved.
 
     This code is derived from software contributed to Berkeley by
     Tom Truscott.
 
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
+[missing/setproctitle.c]
 
-missing/setproctitle.c
+  This file is under the {old-style BSD license}[rdoc-label:label-Old-style+BSD+license].
 
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
+  >>>
+    Copyright 2003:: Damien Miller
+    Copyright (c) 1983, 1995-1997:: Eric P. Allman
+    Copyright (c) 1988, 1993::
+    The Regents of the University of California.  All rights reserved.
 
-    Copyright 2003 Damien Miller
-    Copyright (c) 1983, 1995-1997 Eric P. Allman
-    Copyright (c) 1988, 1993
-    	The Regents of the University of California.  All rights reserved.
+[missing/strlcat.c]
+[missing/strlcpy.c]
 
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
+  These files are under an ISC-style license.
 
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
+  >>>
+    Copyright (c) 1998, 2015:: Todd C. Miller <Todd.Miller@courtesan.com>
 
-missing/strlcat.c
-missing/strlcpy.c
+    Permission to use, copy, modify, and distribute this software for any
+    purpose with or without fee is hereby granted, provided that the above
+    copyright notice and this permission notice appear in all copies.
 
-  These files are under the new-style BSD license.
+    THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
+    WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
+    MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
+    ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
+    WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
+    ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
+    OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
 
-   Copyright (c) 1998 Todd C. Miller <Todd.Miller@courtesan.com>
-   All rights reserved.
-
-   Redistribution and use in source and binary forms, with or without
-   modification, are permitted provided that the following conditions
-   are met:
-   1. Redistributions of source code must retain the above copyright
-      notice, this list of conditions and the following disclaimer.
-   2. Redistributions in binary form must reproduce the above copyright
-      notice, this list of conditions and the following disclaimer in the
-      documentation and/or other materials provided with the distribution.
-   3. The name of the author may not be used to endorse or promote products
-      derived from this software without specific prior written permission.
-
-   THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES,
-   INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY
-   AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL
-   THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
-   EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
-   PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
-   OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
-   WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
-   OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
-   ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
-
-missing/langinfo.c
+[missing/langinfo.c]
 
   This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
   Ruby uses a modified version. The file contains the following
   author/copyright notice:
 
-  Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
-  Permission to use, copy, modify, and distribute this software
-  for any purpose and without fee is hereby granted. The author
-  disclaims all warranties with regard to this software.
+  >>>
+    Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11::
+    Permission to use, copy, modify, and distribute this software
+    for any purpose and without fee is hereby granted. The author
+    disclaims all warranties with regard to this software.
 
-ext/digest/md5/md5.[ch]:
+[ext/digest/md5/md5.c]
+[ext/digest/md5/md5.h]
 
   These files are under the following license.  Ruby uses modified
   versions of them.
 
-    Copyright (C) 1999, 2000 Aladdin Enterprises.  All rights reserved.
+  >>>
+    Copyright (C) 1999, 2000:: Aladdin Enterprises.  All rights reserved.
 
     This software is provided 'as-is', without any express or implied
     warranty.  In no event will the authors be held liable for any damages
@@ -485,23 +656,27 @@ ext/digest/md5/md5.[ch]:
     L. Peter Deutsch
     ghost@aladdin.com
 
-ext/digest/rmd160/rmd160.[ch]:
+[ext/digest/rmd160/rmd160.c]
+[ext/digest/rmd160/rmd160.h]
 
   These files have the following copyright information, and by the
   author we are allowed to use it under the new-style BSD license.
 
-    AUTHOR:   Antoon Bosselaers, ESAT-COSIC
+  >>>
+    AUTHOR::  Antoon Bosselaers, ESAT-COSIC
               (Arranged for libc by Todd C. Miller)
-    DATE:     1 March 1996
+    DATE::    1 March 1996
 
-    Copyright (c) Katholieke Universiteit Leuven
+    Copyright (c):: Katholieke Universiteit Leuven
     1996, All Rights Reserved
 
-ext/digest/sha2/sha2.[ch]:
+[ext/digest/sha2/sha2.c]
+[ext/digest/sha2/sha2.h]
 
   These files are under the new-style BSD license.
 
-    Copyright 2000 Aaron D. Gifford.  All rights reserved.
+  >>>
+    Copyright 2000:: Aaron D. Gifford.  All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -527,29 +702,123 @@ ext/digest/sha2/sha2.[ch]:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-ext/nkf/nkf-utf8/config.h:
-ext/nkf/nkf-utf8/nkf.c:
-ext/nkf/nkf-utf8/utf8tbl.c:
+[ext/json/generator/generator.c]
+
+  The file contains the following copyright notice.
+
+  >>>
+    Copyright 2001-2004:: Unicode, Inc.
+
+    Disclaimer::
+
+      This source code is provided as is by Unicode, Inc. No claims are
+      made as to fitness for any particular purpose. No warranties of any
+      kind are expressed or implied. The recipient agrees to determine
+      applicability of information provided. If this file has been
+      purchased on magnetic or optical media from Unicode, Inc., the
+      sole remedy for any claim will be exchange of defective media
+      within 90 days of receipt.
+
+    Limitations on Rights to Redistribute This Code::
+
+      Unicode, Inc. hereby grants the right to freely use the information
+      supplied in this file in the creation of products supporting the
+      Unicode Standard, and to make copies of this file in any form
+      for internal or external distribution as long as this notice
+      remains attached.
+
+[ext/nkf/nkf-utf8/config.h]
+[ext/nkf/nkf-utf8/nkf.c]
+[ext/nkf/nkf-utf8/utf8tbl.c]
 
   These files are under the following license.  So to speak, it is
   copyrighted semi-public-domain software.
 
-    Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
-       Everyone is permitted to do anything on this program
-       including copying, modifying, improving,
-       as long as you don't try to pretend that you wrote it.
-       i.e., the above copyright notice has to appear in all copies.
-       Binary distribution requires original version messages.
-       You don't have to ask before copying, redistribution or publishing.
-       THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+  >>>
+    Copyright (C) 1987:: Fujitsu LTD. (Itaru ICHIKAWA)
+
+    Everyone is permitted to do anything on this program
+    including copying, modifying, improving,
+    as long as you don't try to pretend that you wrote it.
+    i.e., the above copyright notice has to appear in all copies.
+    Binary distribution requires original version messages.
+    You don't have to ask before copying, redistribution or publishing.
+    THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+
+[ext/psych]
+[test/psych]
+
+  The files under these directories are under the following license, except for
+  ext/psych/yaml.
+
+  >>>
+    Copyright 2009:: Aaron Patterson, et al.
+
+    Permission is hereby granted, free of charge, to any person obtaining a copy of
+    this software and associated documentation files (the 'Software'), to deal in
+    the Software without restriction, including without limitation the rights to
+    use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+    of the Software, and to permit persons to whom the Software is furnished to do
+    so, subject to the following conditions:
+
+    The above copyright notice and this permission notice shall be included in all
+    copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+    SOFTWARE.
+
+[ext/psych/yaml]
+
+  The files under this directory are under the following license.
+
+  >>>
+    Copyright (c) 2006:: Kirill Simonov
+
+    Permission is hereby granted, free of charge, to any person obtaining a copy of
+    this software and associated documentation files (the "Software"), to deal in
+    the Software without restriction, including without limitation the rights to
+    use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+    of the Software, and to permit persons to whom the Software is furnished to do
+    so, subject to the following conditions:
+
+    The above copyright notice and this permission notice shall be included in all
+    copies or substantial portions of the Software.
 
-ext/socket/addrinfo.h:
-ext/socket/getaddrinfo.c:
-ext/socket/getnameinfo.c:
+    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+    SOFTWARE.
+
+[ext/pty/pty.c]
+
+  >>>
+    C) Copyright 1998:: by Akinori Ito.
+
+    This software may be redistributed freely for this purpose, in full
+    or in part, provided that this entire copyright notice is included
+    on any copies of this software and applications and derivations thereof.
+
+    This software is provided on an "as is" basis, without warranty of any
+    kind, either expressed or implied, as to any matter including, but not
+    limited to warranty of fitness of purpose, or merchantability, or
+    results obtained from use of this software.
+
+[ext/socket/addrinfo.h]
+[ext/socket/getaddrinfo.c]
+[ext/socket/getnameinfo.c]
 
   These files are under the new-style BSD license.
 
-    Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
+  >>>
+    Copyright (C) 1995, 1996, 1997, 1998, and 1999:: WIDE Project.
     All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
@@ -576,17 +845,275 @@ ext/socket/getnameinfo.c:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-ext/win32ole/win32ole.c:
+[ext/win32ole/win32ole.c]
 
   You can apply the Artistic License to this file. (or GPL,
   alternatively)
 
-    (c) 1995 Microsoft Corporation. All rights reserved.
+  >>>
+    (c) 1995:: Microsoft Corporation. All rights reserved.
     Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
 
-    Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
+    Other modifications Copyright (c) 1997, 1998:: by Gurusamy Sarathy
     <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
 
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the README file
     of the Perl distribution.
+
+  The Wayback Machine url: http://web.archive.org/web/19970607104352/http://www.activeware.com:80/
+
+[lib/rdoc/generator/template/darkfish/css/fonts.css]
+
+  This file is licensed under the {SIL Open Font License}[http://scripts.sil.org/OFL].
+
+[spec/mspec]
+[spec/ruby]
+
+  The files under these directories are under the following license.
+
+  >>>
+    Copyright (c) 2008:: Engine Yard, Inc. All rights reserved.
+
+    Permission is hereby granted, free of charge, to any person
+    obtaining a copy of this software and associated documentation
+    files (the "Software"), to deal in the Software without
+    restriction, including without limitation the rights to use,
+    copy, modify, merge, publish, distribute, sublicense, and/or sell
+    copies of the Software, and to permit persons to whom the
+    Software is furnished to do so, subject to the following
+    conditions:
+
+    The above copyright notice and this permission notice shall be
+    included in all copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+    EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
+    OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+    NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
+    HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
+    WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
+    FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
+    OTHER DEALINGS IN THE SOFTWARE.
+
+[lib/rubygems.rb]
+[lib/rubygems]
+[test/rubygems]
+
+  RubyGems is under the following license.
+
+  >>>
+    RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
+    Weirich and others.  You can redistribute it and/or modify it under
+    either the terms of the {MIT license}[rdoc-label:label-MIT+License], or the conditions
+    below:
+
+    1. You may make and give away verbatim copies of the source form of the
+       software without restriction, provided that you duplicate all of the
+       original copyright notices and associated disclaimers.
+
+    2. You may modify your copy of the software in any way, provided that
+       you do at least ONE of the following:
+
+       a. place your modifications in the Public Domain or otherwise
+          make them Freely Available, such as by posting said
+          modifications to Usenet or an equivalent medium, or by allowing
+          the author to include your modifications in the software.
+
+       b. use the modified software only within your corporation or
+          organization.
+
+       c. give non-standard executables non-standard names, with
+          instructions on where to get the original software distribution.
+
+       d. make other distribution arrangements with the author.
+
+    3. You may distribute the software in object code or executable
+       form, provided that you do at least ONE of the following:
+
+       a. distribute the executables and library files of the software,
+          together with instructions (in the manual page or equivalent)
+          on where to get the original distribution.
+
+       b. accompany the distribution with the machine-readable source of
+          the software.
+
+       c. give non-standard executables non-standard names, with
+          instructions on where to get the original software distribution.
+
+       d. make other distribution arrangements with the author.
+
+    4. You may modify and include the part of the software into any other
+       software (possibly commercial).
+
+    5. The scripts and library files supplied as input to or produced as
+       output from the software do not automatically fall under the
+       copyright of the software, but belong to whomever generated them,
+       and may be sold commercially, and may be aggregated with this
+       software.
+
+    6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+       IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+       WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+       PURPOSE.
+
+[lib/bundler]
+[lib/bundler.rb]
+[spec/bundler]
+
+  Bundler is under the following license.
+
+  >>>
+    Portions copyright (c) 2010:: Andre Arko
+    Portions copyright (c) 2009:: Engine Yard
+
+    {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/bundler/vendor/thor]
+
+  Thor is under the following license.
+
+  >>>
+    Copyright (c) 2008 Yehuda Katz, Eric Hodel, et al.
+
+    {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/rubygems/resolver/molinillo]
+
+  molinillo is under the following license.
+
+  >>>
+    Copyright (c) 2014 Samuel E. Giddins segiddins@segiddins.me
+
+    {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/bundler/vendor/pub_grub]
+
+  pub_grub is under the following license.
+
+  >>>
+    Copyright (c) 2018 John Hawthorn
+
+    {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/bundler/vendor/connection_pool]
+
+  connection_pool is under the following license.
+
+  >>>
+    Copyright (c) 2011 Mike Perham
+
+    {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/bundler/vendor/net-http-persistent]
+
+  net-http-persistent is under the following license.
+
+  >>>
+    Copyright (c) Eric Hodel, Aaron Patterson
+
+    {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/did_you_mean]
+[lib/did_you_mean.rb]
+[test/did_you_mean]
+
+  did_you_mean is under the following license.
+
+  >>>
+    Copyright (c) 2014-2016 Yuki Nishijima
+
+    {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/error_highlight]
+[lib/error_highlight.rb]
+[test/error_highlight]
+
+  error_highlight is under the following license.
+
+  >>>
+    Copyright (c) 2021 Yusuke Endoh
+
+    {MIT License}[rdoc-label:label-MIT+License]
+
+[benchmark/so_ackermann.rb]
+[benchmark/so_array.rb]
+[benchmark/so_binary_trees.rb]
+[benchmark/so_concatenate.rb]
+[benchmark/so_count_words.yml]
+[benchmark/so_exception.rb]
+[benchmark/so_fannkuch.rb]
+[benchmark/so_fasta.rb]
+[benchmark/so_k_nucleotide.yml]
+[benchmark/so_lists.rb]
+[benchmark/so_mandelbrot.rb]
+[benchmark/so_matrix.rb]
+[benchmark/so_meteor_contest.rb]
+[benchmark/so_nbody.rb]
+[benchmark/so_nested_loop.rb]
+[benchmark/so_nsieve.rb]
+[benchmark/so_nsieve_bits.rb]
+[benchmark/so_object.rb]
+[benchmark/so_partial_sums.rb]
+[benchmark/so_pidigits.rb]
+[benchmark/so_random.rb]
+[benchmark/so_reverse_complement.yml]
+[benchmark/so_sieve.rb]
+[benchmark/so_spectralnorm.rb]
+
+  These files are very old copy of then-called "The Great Computer Language
+  Shootout".  LEGAL SITUATION OF THESE FILES ARE UNCLEAR because the original
+  site has been lost.  Upstream diverged to delete several benchmarks listed
+  above.
+
+== MIT License
+>>>
+      Permission is hereby granted, free of charge, to any person obtaining
+      a copy of this software and associated documentation files (the
+      "Software"), to deal in the Software without restriction, including
+      without limitation the rights to use, copy, modify, merge, publish,
+      distribute, sublicense, and/or sell copies of the Software, and to
+      permit persons to whom the Software is furnished to do so, subject to
+      the following conditions:
+
+      The above copyright notice and this permission notice shall be
+      included in all copies or substantial portions of the Software.
+
+      THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+      EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+      MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+      NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
+      LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
+      OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
+      WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+== Old-style BSD license
+>>>
+      Redistribution and use in source and binary forms, with or without
+      modification, are permitted provided that the following conditions
+      are met:
+      1. Redistributions of source code must retain the above copyright
+         notice, this list of conditions and the following disclaimer.
+      2. Redistributions in binary form must reproduce the above copyright
+         notice, this list of conditions and the following disclaimer in the
+         documentation and/or other materials provided with the distribution.
+      3. Neither the name of the University nor the names of its contributors
+         may be used to endorse or promote products derived from this software
+         without specific prior written permission.
+
+      THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+      ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+      IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+      ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+      FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+      DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+      OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+      HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+      LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+      OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+      SUCH DAMAGE.
+
+      IMPORTANT NOTE::
+
+      From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+      paragraph 3 above is now null and void.
diff --git a/Makefile.in b/Makefile.in
deleted file mode 100644
index 23e193c407..0000000000
--- a/Makefile.in
+++ /dev/null
@@ -1,510 +0,0 @@
-SHELL = /bin/sh
-NULLCMD = @NULLCMD@
-n=$(NULLCMD)
-ECHO1 = $(V:1=$n)
-RUNCMD = $(SHELL)
-CDPATH = .
-CHDIR = @CHDIR@
-exec = exec
-NULL = /dev/null
-PATH_SEPARATOR = @PATH_SEPARATOR@
-
-#### Start of system configuration section. ####
-
-srcdir = @srcdir@
-top_srcdir = $(srcdir)
-hdrdir = $(srcdir)/include
-PLATFORM_DIR = @PLATFORM_DIR@
-
-CC = @CC@
-CPP = @CPP@
-LD = @LD@
-YACC = bison
-PURIFY =
-AUTOCONF = autoconf
-CONFIGURE = @CONFIGURE@
-@SET_MAKE@
-MKFILES = @MAKEFILES@
-BASERUBY = @BASERUBY@
-HAVE_BASERUBY = @HAVE_BASERUBY@
-TEST_RUNNABLE = @TEST_RUNNABLE@
-CROSS_COMPILING = @CROSS_COMPILING@
-DOXYGEN = @DOXYGEN@
-
-prefix = @prefix@
-exec_prefix = @exec_prefix@
-bindir = @bindir@
-sbindir = @sbindir@
-libdir = @libdir@
-libexecdir = @libexecdir@
-datarootdir = @datarootdir@
-datadir = @datadir@
-arch = @arch@
-sitearch = @sitearch@
-sitedir = @sitedir@
-archlibdir = @archlibdir@
-ruby_version = @ruby_version@
-
-TESTUI = console
-TESTS =
-INSTALLDOC = @INSTALLDOC@
-DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
-
-EXTOUT = @EXTOUT@
-arch_hdrdir = $(EXTOUT)/include/$(arch)
-VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/missing
-
-empty =
-CC_VERSION = @CC_VERSION@
-OUTFLAG = @OUTFLAG@$(empty)
-COUTFLAG = @COUTFLAG@$(empty)
-ARCH_FLAG = @ARCH_FLAG@
-CFLAGS_NO_ARCH = @CFLAGS@
-CFLAGS = $(CFLAGS_NO_ARCH) $(ARCH_FLAG)
-cflags = @cflags@
-optflags = @optflags@
-debugflags = @debugflags@
-warnflags = @warnflags@ @strict_warnflags@
-cppflags = @cppflags@
-INCFLAGS = -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir)
-XCFLAGS = @XCFLAGS@
-CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
-LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLDFLAGS = @EXTLDFLAGS@
-XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
-EXTLIBS =
-LIBS = @LIBS@ $(EXTLIBS)
-MISSING = @LIBOBJS@ @ALLOCA@
-LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(XLDFLAGS) $(ARCH_FLAG)
-SOLIBS = @SOLIBS@
-MAINLIBS = @MAINLIBS@
-ARCHMINIOBJS = @MINIOBJS@
-DLNOBJ = @DLNOBJ@
-ENCOBJS = @ENCOBJS@
-EXTOBJS = @EXTOBJS@
-BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
-BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
-BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
-POSTLINK = @POSTLINK@
-
-RUBY_BASE_NAME=@RUBY_BASE_NAME@
-RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
-RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
-RUBY_SO_NAME=@RUBY_SO_NAME@
-EXEEXT = @EXEEXT@
-LIBEXT = @LIBEXT@
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@\
-	$(MINIRUBYOPT)
-# RUNRUBY_COMMAND:: runruby.rb or baseruby. do not append options directly
-RUNRUBY_COMMAND = @RUNRUBY_COMMAND@
-# RUNRUBY:: run ruby with RUN_OPTS which is passed to ruby
-RUNRUBY = @RUNRUBY@ $(RUN_OPTS)
-# RUNRUBY_DEBUGGER:: debugging option for runruby.rb
-RUNRUBY_DEBUGGER = --debugger='gdb -x run.gdb --quiet --args'
-XRUBY = @XRUBY@
-BTESTRUBY = @BTESTRUBY@\
-	$(MINIRUBYOPT)
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-XRUBY_LIBDIR = @XRUBY_LIBDIR@
-XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
-XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
-BOOTSTRAPRUBY = @BOOTSTRAPRUBY@
-
-#### End of system configuration section. ####
-
-MAJOR=	@MAJOR@
-MINOR=	@MINOR@
-TEENY=	@TEENY@
-
-LIBRUBY_A     = @LIBRUBY_A@
-LIBRUBY_SO    = @LIBRUBY_SO@
-LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
-LIBRUBY	      = @LIBRUBY@
-LIBRUBYARG    = @LIBRUBYARG@
-LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
-LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
-LIBRUBY_RELATIVE = @LIBRUBY_RELATIVE@
-LIBRUBY_A_OBJS = @LIBRUBY_A_OBJS@
-
-DTRACE_REBUILD_OBJS = $(DTRACE_REBUILD:yes=$(DTRACE_DEPENDENT_OBJS))
-
-DTRACE_DEPENDENT_OBJS = array.$(OBJEXT) \
-			eval.$(OBJEXT) \
-			gc.$(OBJEXT) \
-			hash.$(OBJEXT) \
-			load.$(OBJEXT) \
-			object.$(OBJEXT) \
-			parse.$(OBJEXT) \
-			string.$(OBJEXT) \
-			symbol.$(OBJEXT) \
-			vm.$(OBJEXT)
-
-THREAD_MODEL  = @THREAD_MODEL@
-
-PREP          = @PREP@
-ARCHFILE      = @ARCHFILE@
-SETUP         =
-EXTSTATIC     = @EXTSTATIC@
-ENCSTATIC     = @ENCSTATIC@
-SET_LC_MESSAGES = env LC_MESSAGES=C
-
-MAKEDIRS      = @MKDIR_P@
-CP            = cp
-MV            = mv
-RM            = rm -f
-RMDIR         = @RMDIR@
-RMDIRS        = @RMDIRS@
-RMALL         = @RMALL@
-NM            = @NM@
-AR            = @AR@
-ARFLAGS       = rcu
-RANLIB        = @RANLIB@
-AS            = @AS@
-ASFLAGS       = @ASFLAGS@ $(INCFLAGS)
-IFCHANGE      = $(srcdir)/tool/ifchange
-SET_LC_MESSAGES = env LC_MESSAGES=C
-OBJDUMP       = @OBJDUMP@
-OBJCOPY       = @OBJCOPY@
-VCS           = @VCS@
-VCSUP         = @VCSUP@
-DTRACE        = @DTRACE@
-DTRACE_EXT    = @DTRACE_EXT@
-DTRACE_OBJ    = @DTRACE_OBJ@
-DTRACE_REBUILD= @DTRACE_REBUILD@
-DTRACE_GLOMMED_OBJ = $(DTRACE_REBUILD:yes=ruby-glommed.$(OBJEXT))
-
-OBJEXT        = @OBJEXT@
-ASMEXT        = S
-DLEXT         = @DLEXT@
-MANTYPE	      = @MANTYPE@
-SYMBOL_PREFIX = @SYMBOL_PREFIX@
-
-INSTALLED_LIST= .installed.list
-
-NEWLINE_C     = enc/trans/newline.c
-MINIPRELUDE_C = miniprelude.c
-PRELUDE_C     = prelude.c
-RBCONFIG      = .rbconfig.time
-
-SRC_FILE      = $<
-OS_SRC_FILE   = $<
-DEST_FILE     = $@
-OS_DEST_FILE  = $@
-
-MESSAGE_BEGIN = @for line in
-MESSAGE_END = ; do echo "$$line"; done
-ECHO_BEGIN = @sep=''; for word in
-ECHO_END = ; do echo @ECHO_N@ "$$sep'$$word'@ECHO_C@"; sep=' '; done; echo
-
-DESTDIR       = @DESTDIR@
-
-configure_args = @configure_args@
-#### End of variables
-
-.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
-
-all:
-
-# Prevent GNU make v3 from overflowing arg limit on SysV.
-.NOEXPORT:
-
-miniruby$(EXEEXT):
-		@-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
-		$(ECHO) linking $@
-		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
-
-$(PROGRAM):
-		@$(RM) $@
-		$(ECHO) linking $@
-		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(EXTLIBS) $(OUTFLAG)$@
-		$(Q) $(POSTLINK)
-
-# We must `rm' the library each time this rule is invoked because "updating" a
-# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
-# supported.
-$(LIBRUBY_A):
-		@$(RM) $@
-		$(ECHO) linking static-library $@
-		$(Q) $(AR) $(ARFLAGS) $@ $(LIBRUBY_A_OBJS) $(INITOBJS)
-		@-$(RANLIB) $@ 2> /dev/null || true
-		$(ECHO) verifying static-library $@
-		@$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)conftest$(EXEEXT)
-		@$(RM) conftest$(EXEEXT) conftest.c
-
-$(LIBRUBY_SO):
-		@-$(PRE_LIBRUBY_UPDATE)
-		$(ECHO) linking shared-library $@
-		$(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(EXTSOLIBS) $(OUTFLAG)$@
-		-$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)ruby_static_id_*' \
-			-L '$(SYMBOL_PREFIX)*_threadptr_*' $@
-		$(Q) $(POSTLINK)
-		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link rescue nil; \
-						  File.symlink "$(LIBRUBY_SO)", link}' \
-				$(LIBRUBY_ALIASES) || true
-
-ruby_pc = @ruby_pc@
-$(ruby_pc):
-		@./config.status --file=$@:$(srcdir)/template/ruby.pc.in
-
-$(RBCONFIG): $($(CROSS_COMPILING:no=)PREP)
-
-rbconfig.rb: $(RBCONFIG)
-
-install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
-	$(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
-	$(ECHO) installing cross-compiling stuff
-	$(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
-	$(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
-	$(Q) $(BASERUBY) -p \
-	-e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
-	-e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
-	rbconfig.rb > fake-rbconfig.rb
-	$(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
-	$(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
-	@$(RM) fake.rb fake-rbconfig.rb
-	$(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
-	$(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
-	$(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
-	$(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
-
-Makefile:	$(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
-
-$(MKFILES): config.status $(srcdir)/version.h
-		@[ -f $@ ] && mv $@ $@.old
-		MAKE=$(MAKE) $(SHELL) ./config.status $@
-		@cmp $@ $@.old > /dev/null 2>&1 && echo $@ unchanged && exit 0; \
-		{ \
-		    echo "all:; -@rm -f conftest.mk"; \
-		    echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
-		    echo ".force:"; \
-		} > conftest.mk || exit 1; \
-		$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
-		{ echo "$@ updated, restart."; exit 1; }
-
-uncommon.mk: $(srcdir)/common.mk
-		sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
-
-.PHONY: reconfig
-reconfig-args = $(srcdir)/$(CONFIGURE) $(configure_args)
-config.status-args = ./config.status --recheck
-reconfig-exec-0 = exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3 3>&- 4>&-`
-reconfig-exec-1 = set -x; "$$@"
-
-reconfig config.status:	$(srcdir)/$(CONFIGURE) $(srcdir)/enc/Makefile.in \
-			$(srcdir)/include/ruby/version.h
-	@PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
-	set $(SHELL) $($@-args); $(reconfig-exec-$(V))
-
-$(srcdir)/$(CONFIGURE): $(srcdir)/configure.in
-	$(CHDIR) $(srcdir) && exec $(AUTOCONF) -o $(@F)
-
-incs: id.h
-all-incs: probes.h
-
-# Things which should be considered:
-# * with gperf v.s. without gperf
-# * committers may have various versions of gperf
-# * ./configure v.s. ../ruby/configure
-# * GNU make v.s. HP-UX make	# HP-UX make invokes the action if lex.c and keywords has same mtime.
-# * svn checkout generate a file with mtime as current time
-# * ext4 and XFS has a mtime with fractional part
-lex.c: defs/keywords
-	@\
-	if cmp -s $(srcdir)/defs/lex.c.src $?; then \
-	  [ $(Q) ] && echo copying $@ || set -x; \
-	  $(CP) $(srcdir)/lex.c.blt $@; \
-	else \
-	  [ $(Q) ] && echo generating $@ || set -x; \
-	  gperf -C -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@.tmp && \
-	  $(MV) $@.tmp $@ && \
-	  $(CP) $? $(srcdir)/defs/lex.c.src && \
-	  $(CP) $@ $(srcdir)/lex.c.blt; \
-	fi
-
-NAME2CTYPE_OPTIONS = -7 -c -j1 -i1 -t -C -P -T -H uniname2ctype_hash -Q uniname2ctype_pool -N uniname2ctype_p
-
-enc/unicode/name2ctype.h: enc/unicode/name2ctype.kwd
-	$(MAKEDIRS) $(@D)
-	@set +e; \
-	if cmp -s $(?:.kwd=.src) $?; then \
-	  set -x; \
-	  $(CP) $(?:.kwd=.h.blt) $@; \
-	else \
-	  trap '$(RM) $@-1.h $@-2.h' 0 && \
-	  set -x; \
-	  sed '/^#ifdef USE_UNICODE_PROPERTIES/,/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-1.h && \
-	  sed '/^#ifdef USE_UNICODE_PROPERTIES/d;/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-2.h && \
-	  diff -DUSE_UNICODE_PROPERTIES $@-1.h $@-2.h > $@.tmp || :; \
-	  $(MV) $@.tmp $@ && \
-	  $(CP) $? $(?:.kwd=.src) && \
-	  $(CP) $@ $(?:.kwd=.h.blt); \
-	fi
-
-JIS_PROPS_OPTIONS = -k1,3 -7 -c -j1 -i1 -t -C -P -t --ignore-case -H onig_jis_property_hash -Q onig_jis_property_pool -N onig_jis_property
-
-enc/jis/props.h: enc/jis/props.kwd
-	$(MAKEDIRS) $(@D)
-	@set +e; \
-	if cmp -s $(?:.kwd=.src) $?; then \
-	  set -x; \
-	  $(CP) $(?:.kwd=.h.blt) $@; \
-	else \
-	  set -x; \
-	  gperf $(JIS_PROPS_OPTIONS) $? | \
-	  sed 's/(int)(long)&((\([a-zA-Z_0-9 ]*[a-zA-Z_0-9]\) *\*)0)->\([a-zA-Z0-9_]*\),/(char)offsetof(\1, \2),/g' > $@ && \
-	  $(CP) $? $(?:.kwd=.src) && \
-	  $(CP) $@ $(?:.kwd=.h.blt); \
-	fi
-
-.c.@OBJEXT@:
-	@$(ECHO) compiling $<
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
-
-.s.@OBJEXT@:
-	@$(ECHO) assembling $<
-	$(Q) $(AS) $(ASFLAGS) -o $@ $<
-
-.c.S:
-	@$(ECHO) translating $<
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
-
-.c.i:
-	@$(ECHO) preprocessing $<
-	$(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
-
-.d.h:
-	@$(ECHO) translating probes $<
-	$(Q) $(DTRACE) -o $@.tmp -h -C $(INCFLAGS) -s $<
-	$(Q) sed -e 's/RUBY_/RUBY_DTRACE_/g' -e 's/PROBES_H_TMP/PROBES_H/g' -e 's/(char \*/(const char */g' -e 's/, char \*/, const char */g' $@.tmp > $@
-	$(Q) $(RM) $@.tmp
-
-.dmyh.h:
-	@$(ECHO) copying dummy $(DEST_FILE)
-	$(Q) $(CP) $(OS_SRC_FILE) $(OS_DEST_FILE)
-
-probes.stamp: $(DTRACE_REBUILD_OBJS)
-	$(Q) if test -f $@ -o -f probes.$(OBJEXT); then \
-	  $(RM) $(DTRACE_REBUILD_OBJS) $@; \
-	  $(ECHO0) "rebuilding objects which were modified by \"dtrace -G\""; \
-	  $(MAKE) $(DTRACE_REBUILD_OBJS); \
-	fi
-	$(Q) touch $@
-
-probes.@OBJEXT@: $(srcdir)/probes.d $(DTRACE_REBUILD:yes=probes.stamp)
-	@$(ECHO) processing probes in object files
-	$(Q) $(RM) $@
-	$(Q) $(DTRACE) -G -C $(INCFLAGS) -s $(srcdir)/probes.d -o $@ $(DTRACE_REBUILD_OBJS)
-
-# DTrace static library hacks described here:
-# http://mail.opensolaris.org/pipermail/dtrace-discuss/2005-August/000207.html
-ruby-glommed.$(OBJEXT):
-	@$(ECHO) generating a glommed object with DTrace probes for static library
-	$(Q) $(LD) -r -o $@ $(OBJS)
-
-clean-local::
-	$(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output \
-		enc/encinit.c enc/encinit.$(OBJEXT)
-	-$(Q)$(RM) $(pkgconfig_DATA)
-
-distclean-local::
-	$(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
-	-$(Q)$(RM) run.gdb
-	-$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h verconf.h
-	-$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
-
-clean-ext distclean-ext realclean-ext::
-	@cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
-	test "$$#" = 0 && set .; \
-	set dummy `\
-	    find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$::' | sort; \
-	`; shift; \
-	cd ..; \
-	for dir do \
-	    echo $(@:-ext=)ing "$$dir"; \
-	    (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
-	    case "$@" in \
-	    *distclean-ext*|*realclean-ext*) \
-		$(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
-	    esac; \
-	done
-	-$(Q)$(RM) ext/extinit.$(OBJEXT)
-
-distclean-ext realclean-ext::
-	-$(Q)$(RM) ext/extinit.c
-	-$(Q)$(RMDIR) ext 2> /dev/null || true
-
-clean-extout:
-
-clean-enc distclean-enc realclean-enc:
-	@test -f "$(ENC_MK)" || exit 0; \
-	echo $(@:-enc=ing) encodings; \
-	exec $(MAKE) -f $(ENC_MK) $(MFLAGS) $(@:-enc=)
-
-ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
-	$(ECHO) compiling $@
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
-
-enc/encinit.$(OBJEXT): enc/encinit.c $(SETUP)
-
-up::
-	@$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
-
-after-update:: update-config_files common-srcs
-
-update-mspec:
-	@$(CHDIR) $(srcdir); \
-	if [ -d spec/mspec ]; then \
-	  cd spec/mspec; \
-	  echo updating mspec ...; \
-	  exec git pull; \
-	else \
-	  echo retrieving mspec ...; \
-	  exec git clone $(MSPEC_GIT_URL) spec/mspec; \
-	fi
-
-update-rubyspec: update-mspec
-	@$(CHDIR) $(srcdir); \
-	if [ -d spec/rubyspec ]; then \
-	  cd spec/rubyspec; \
-	  echo updating rubyspec ...; \
-	  exec git pull; \
-	else \
-	  echo retrieving rubyspec ...; \
-	  exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
-	fi
-
-test-rubyspec-precheck:
-	@if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here.  make update-rubyspec first.; exit 1; fi
-
-update-coverage:
-	@$(CHDIR) $(srcdir); \
-	if [ -d coverage/simplecov ]; then \
-	  cd coverage/simplecov; \
-	  echo updating simplecov ...; \
-	  exec git pull; \
-	else \
-	  echo retrieving simplecov ...; \
-	  exec git clone $(SIMPLECOV_GIT_URL) coverage/simplecov; \
-	fi
-
-INSNS	= opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
-	  vmtc.inc vm.inc
-
-$(INSNS): $(srcdir)/insns.def vm_opts.h \
-	  $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
-	  $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
-	$(ECHO) generating $@
-	$(Q) $(BASERUBY) -Ku $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
-
-verconf.h: $(RBCONFIG)
-
-loadpath: verconf.h
-	@$(CPP) $(XCFLAGS) $(CPPFLAGS) $(srcdir)/loadpath.c | \
-	sed -e '1,/^const char ruby_initial_load_paths/d;/;/,$$d' \
-	    -e '/^ /!d;s/ *"\\0"$$//;s/" *"//g'
diff --git a/NEWS b/NEWS
deleted file mode 100644
index 62ddaece45..0000000000
--- a/NEWS
+++ /dev/null
@@ -1,160 +0,0 @@
-# -*- rdoc -*-
-
-= NEWS for Ruby 2.3.0
-
-This document is a list of user visible feature changes made between
-releases except for bug fixes.
-
-Note that each entry is kept so brief that no reason behind or
-reference information is supplied with.  For a full list of changes
-with all sufficient information, see the ChangeLog file.
-
-== Changes since the 2.2.0 release
-
-=== Language changes
-
-=== Core classes updates (outstanding ones only)
-
-* Array
-
-  * Array#bsearch_index [Feature #10730]
-
-* Enumerable
-
-  * Enumerable#grep_v is added as inverse version of Enumerable#grep.
-    [Feature #11049]
-  * Enumerable#chunk_while [Feature #10769]
-
-* Hash
-
-  * Hash#fetch_values [Feature #10017]
-
-* Numeric
-
-  * Numeric#positive? and Numeric#negative? are added, which return
-    true when the receiver is positive and negative respectively.
-    [Feature #11151]
-
-* ARGF
-
-  * ARGF.read_nonblock supports `exception: false' like IO#read_nonblock.
-    [Feature #11358]
-
-* IO
-
-  * new mode flag File::SHARE_DELETE is available.
-    this flag means to permit deleting opened file on Windows, but currently
-    this affect only files opened as binary.  [Feature #11218]
-
-* Thread
-  * Thread#name, Thread#name= are added to handle thread names [Feature #11251]
-
-* NameError
-  * NameError#receiver is added to take the receiver object. [Feature #10881]
-
-=== Core classes compatibility issues (excluding feature bug fixes)
-
-* Array
-  * Array#select!, Array#keep_if, Array#reject!, and Array#delete_if
-    no longer changes the receiver array instantly every time the
-    block is called.  [Feature #10714]
-
-  * Array#flatten and Array#flatten! no longer try to call #to_ary
-    method on elements beyond the given level.  [Bug #10748]
-
-* Enumerable
-  * Enumerable#chunk and Enumerable#slice_before no longer takes the
-    initial_state argument.  [Feature #10958]
-    Use a local variable instead to maintain a state.
-
-* File::Stat
-  * On Windows File::Stat#ino always returned 0, but now returns
-    BY_HANDLE_FILE_INFORMATION.nFileIndexHigh/Low.
-
-* IO
-  * IO#close doesn't raise when the IO object is closed.  [Feature #10718]
-
-* Module
-  * Module#define_method and Object.define_singleton_method now
-    require method body, Proc, Method, or a block, and raise
-    ArgumentError if no block is given directly.  [Bug #11283]
-
-* pack/unpack (Array/String)
-  * j and J directives for pointer width integer type.  [Feature #11215]
-
-
-=== Stdlib updates (outstanding ones only)
-
-* Socket
-  * Socket#connect_nonblock, Socket#accept_nonblock,
-    TCPServer#accept_nonblock, UNIXServer#accept_nonblock,
-    BasicSocket#recv_nonblock, BasicSocket#recvmsg_nonblock,
-    BasicSocket#sendmsg_nonblock all support `exception :false` to return
-    :wait_readable or :wait_writable symbols instead of raising
-    IO::WaitReadable or IO::WaitWritable exceptions
-  * BasicSocket#recv and BasicSocket#recv_nonblock allow an output
-    String buffer argument like IO#read and IO#read_nonblock to reduce
-    GC overhead
-
-* ObjectSpace (objspace)
-  * ObjectSpace.count_imemo_objects is added.
-  * ObjectSpace.internal_class_of is added.
-  * ObjectSpace.internal_super_of is added.
-
-* OpenSSL
-  * OpenSSL::SSL::SSLSocket#accept_nonblock and
-    OpenSSL::SSL::SSLSocket#connect_nonblock supports `exception: false`.
-
-* Pathname
-  * Pathname#descend and Pathname#ascend supported blockless form.
-    [Feature #11052]
-
-* io/wait
-  * IO#wait_readable no longer checks FIONREAD, it may be used for
-    non-bytestream IO such as listen sockets.
-
-* timeout
-  * Object#timeout is now warned as deprecated when called.
-
-=== Stdlib compatibility issues (excluding feature bug fixes)
-
-* lib/webrick/utils.rb
- * removed unused argument. https://github.com/ruby/ruby/pull/356
-
-* lib/drb/drb.rb
- * removed unused argument. https://github.com/ruby/ruby/pull/515
-
-* lib/base64.rb
- * Base64.urlsafe_encode64: added a "padding" option to suppress
-   the padding character ("=").
- * Base64.urlsafe_decode64: now it accepts not only correctly-padded
-   input but also unpadded input.
-
-* lib/matrix.rb
- * Add Vector#round. https://github.com/ruby/ruby/pull/802
-
-* ext/coverage/coverage.c
-  * Coverage.peek_result: new method to allow coverage to be captured without
-    stopping the coverage tool.
-
-* Net::Telnet
-  * Net::Telnet is extracted to net-telnet gem. It's unmaintain code.
-
-* Rake
-  * Rake is removed from stdlib.
-
-=== Built-in global variables compatibility issues
-
-* $SAFE
-  * $SAFE=2 and $SAFE=3 are obsolete.  If $SAFE is set to 2 or larger,
-    an ArgumentError is raised.  [Feature #5455]
-
-=== C API updates
-
-* rb_define_class_id_under() now raises a TypeError exception when the
-  class is already defined but its superclass does not match the given
-  superclass, as well as definitions in ruby level.
-
-=== Build system updates
-
-=== Implementation changes
diff --git a/NEWS.md b/NEWS.md
new file mode 100644
index 0000000000..f6c3c6fc97
--- /dev/null
+++ b/NEWS.md
@@ -0,0 +1,820 @@
+# NEWS for Ruby 3.2.0
+
+This document is a list of user-visible feature changes
+since the **3.1.0** release, except for bug fixes.
+
+Note that each entry is kept to a minimum, see links for details.
+
+## Language changes
+
+* Anonymous rest and keyword rest arguments can now be passed as
+  arguments, instead of just used in method parameters.
+  [[Feature #18351]]
+
+    ```ruby
+    def foo(*)
+      bar(*)
+    end
+    def baz(**)
+      quux(**)
+    end
+    ```
+
+* A proc that accepts a single positional argument and keywords will
+  no longer autosplat. [[Bug #18633]]
+
+    ```ruby
+    proc{|a, **k| a}.call([1, 2])
+    # Ruby 3.1 and before
+    # => 1
+    # Ruby 3.2 and after
+    # => [1, 2]
+    ```
+
+* Constant assignment evaluation order for constants set on explicit
+  objects has been made consistent with single attribute assignment
+  evaluation order. With this code:
+
+    ```ruby
+    foo::BAR = baz
+    ```
+
+    `foo` is now called before `baz`. Similarly, for multiple assignments
+    to constants,  left-to-right evaluation order is used. With this
+    code:
+
+    ```ruby
+    foo1::BAR1, foo2::BAR2 = baz1, baz2
+    ```
+
+    The following evaluation order is now used:
+
+    1. `foo1`
+    2. `foo2`
+    3. `baz1`
+    4. `baz2`
+
+    [[Bug #15928]]
+
+* "Find pattern" is no longer experimental.
+  [[Feature #18585]]
+
+* Methods taking a rest parameter (like `*args`) and wishing to delegate keyword
+  arguments through `foo(*args)` must now be marked with `ruby2_keywords`
+  (if not already the case). In other words, all methods wishing to delegate
+  keyword arguments through `*args` must now be marked with `ruby2_keywords`,
+  with no exception. This will make it easier to transition to other ways of
+  delegation once a library can require Ruby 3+. Previously, the `ruby2_keywords`
+  flag was kept if the receiving method took `*args`, but this was a bug and an
+  inconsistency. A good technique to find the potentially-missing `ruby2_keywords`
+  is to run the test suite, for where it fails find the last method which must
+  receive keyword arguments, use `puts nil, caller, nil` there, and check each
+  method/block on the call chain which must delegate keywords is correctly marked
+  as `ruby2_keywords`. [[Bug #18625]] [[Bug #16466]]
+
+    ```ruby
+    def target(**kw)
+    end
+
+    # Accidentally worked without ruby2_keywords in Ruby 2.7-3.1, ruby2_keywords
+    # needed in 3.2+. Just like (*args, **kwargs) or (...) would be needed on
+    # both #foo and #bar when migrating away from ruby2_keywords.
+    ruby2_keywords def bar(*args)
+      target(*args)
+    end
+
+    ruby2_keywords def foo(*args)
+      bar(*args)
+    end
+
+    foo(k: 1)
+    ```
+
+## Core classes updates
+
+Note: We're only listing outstanding class updates.
+
+* Fiber
+
+    * Introduce Fiber.[] and Fiber.[]= for inheritable fiber storage.
+      Introduce Fiber#storage and Fiber#storage= (experimental) for
+      getting and resetting the current storage.  Introduce
+      `Fiber.new(storage:)` for setting the storage when creating a
+      fiber. [[Feature #19078]]
+
+        Existing Thread and Fiber local variables can be tricky to use.
+        Thread-local variables are shared between all fibers, making it
+        hard to isolate, while Fiber-local variables can be hard to
+        share.  It is often desirable to define unit of execution
+        ("execution context") such that some state is shared between all
+        fibers and threads created in that context.  This is what Fiber
+        storage provides.
+
+        ```ruby
+        def log(message)
+          puts "#{Fiber[:request_id]}: #{message}"
+        end
+
+        def handle_requests
+          while request = read_request
+            Fiber.schedule do
+              Fiber[:request_id] = SecureRandom.uuid
+
+              request.messages.each do |message|
+                Fiber.schedule do
+                  log("Handling #{message}") # Log includes inherited request_id.
+                end
+              end
+            end
+          end
+        end
+        ```
+
+        You should generally consider Fiber storage for any state which
+        you want to be shared implicitly between all fibers and threads
+        created in a given context, e.g. a connection pool, a request
+        id, a logger level, environment variables, configuration, etc.
+
+* Fiber::Scheduler
+
+    * Introduce `Fiber::Scheduler#io_select` for non-blocking IO.select.
+      [[Feature #19060]]
+
+* IO
+
+    * Introduce IO#timeout= and IO#timeout which can cause
+      IO::TimeoutError to be raised if a blocking operation exceeds the
+      specified timeout. [[Feature #18630]]
+
+        ```ruby
+        STDIN.timeout = 1
+        STDIN.read # => Blocking operation timed out! (IO::TimeoutError)
+        ```
+
+    * Introduce `IO.new(..., path:)` and promote `File#path` to `IO#path`.
+      [[Feature #19036]]
+
+* Class
+
+    * Class#attached_object, which returns the object for which
+      the receiver is the singleton class. Raises TypeError if the
+      receiver is not a singleton class.
+      [[Feature #12084]]
+
+        ```ruby
+        class Foo; end
+
+        Foo.singleton_class.attached_object        #=> Foo
+        Foo.new.singleton_class.attached_object    #=> #<Foo:0x000000010491a370>
+        Foo.attached_object                        #=> TypeError: `Foo' is not a singleton class
+        nil.singleton_class.attached_object        #=> TypeError: `NilClass' is not a singleton class
+        ```
+
+* Data
+
+    * New core class to represent simple immutable value object. The class is
+      similar to Struct and partially shares an implementation, but has more
+      lean and strict API. [[Feature #16122]]
+
+        ```ruby
+        Measure = Data.define(:amount, :unit)
+        distance = Measure.new(100, 'km')            #=> #<data Measure amount=100, unit="km">
+        weight = Measure.new(amount: 50, unit: 'kg') #=> #<data Measure amount=50, unit="kg">
+        weight.with(amount: 40)                      #=> #<data Measure amount=40, unit="kg">
+        weight.amount                                #=> 50
+        weight.amount = 40                           #=> NoMethodError: undefined method `amount='
+        ```
+
+* Encoding
+
+    * Encoding#replicate has been deprecated and will be removed in 3.3. [[Feature #18949]]
+    * The dummy `Encoding::UTF_16` and `Encoding::UTF_32` encodings no longer
+      try to dynamically guess the endian based on a byte order mark.
+      Use `Encoding::UTF_16BE`/`UTF_16LE` and `Encoding::UTF_32BE`/`UTF_32LE` instead.
+      This change speeds up getting the encoding of a String. [[Feature #18949]]
+    * Limit maximum encoding set size by 256.
+      If exceeding maximum size, `EncodingError` will be raised. [[Feature #18949]]
+
+* Enumerator
+
+    * Enumerator.product has been added.  Enumerator::Product is the implementation. [[Feature #18685]]
+
+* Exception
+
+    * Exception#detailed_message has been added.
+      The default error printer calls this method on the Exception object
+      instead of #message. [[Feature #18564]]
+
+* Hash
+
+    * Hash#shift now always returns nil if the hash is
+      empty, instead of returning the default value or
+      calling the default proc. [[Bug #16908]]
+
+* Integer
+
+    * Integer#ceildiv has been added. [[Feature #18809]]
+
+* Kernel
+
+    * Kernel#binding raises RuntimeError if called from a non-Ruby frame
+      (such as a method defined in C). [[Bug #18487]]
+
+* MatchData
+
+    * MatchData#byteoffset has been added. [[Feature #13110]]
+    * MatchData#deconstruct has been added. [[Feature #18821]]
+    * MatchData#deconstruct_keys has been added. [[Feature #18821]]
+
+* Module
+
+    * Module.used_refinements has been added. [[Feature #14332]]
+    * Module#refinements has been added. [[Feature #12737]]
+    * Module#const_added has been added. [[Feature #17881]]
+    * Module#undefined_instance_methods has been added. [[Feature #12655]]
+
+* Proc
+
+    * Proc#dup returns an instance of subclass. [[Bug #17545]]
+    * Proc#parameters now accepts lambda keyword. [[Feature #15357]]
+
+* Process
+    * Added `RLIMIT_NPTS` constant to FreeBSD platform
+
+* Regexp
+
+    * The cache-based optimization is introduced.
+      Many (but not all) Regexp matching is now in linear time, which
+      will prevent regular expression denial of service (ReDoS)
+      vulnerability. [[Feature #19104]]
+
+    * Regexp.linear_time? is introduced. [[Feature #19194]]
+
+    * Regexp.new now supports passing the regexp flags not only as an Integer,
+      but also as a String.  Unknown flags raise ArgumentError.
+      Otherwise, anything other than `true`, `false`, `nil` or Integer will be warned.
+      [[Feature #18788]]
+
+    * Regexp.timeout= has been added. Also, Regexp.new new supports timeout keyword.
+      See [[Feature #17837]]
+
+* Refinement
+
+    * Refinement#refined_class has been added. [[Feature #12737]]
+
+* RubyVM::AbstractSyntaxTree
+
+    * Add `error_tolerant` option for `parse`, `parse_file` and `of`. [[Feature #19013]]
+      With this option
+
+        1. SyntaxError is suppressed
+        2. AST is returned for invalid input
+        3. `end` is complemented when a parser reaches to the end of input but `end` is insufficient
+        4. `end` is treated as keyword based on indent
+
+        ```ruby
+        # Without error_tolerant option
+        root = RubyVM::AbstractSyntaxTree.parse(<<~RUBY)
+        def m
+          a = 10
+          if
+        end
+        RUBY
+        # => <internal:ast>:33:in `parse': syntax error, unexpected `end' (SyntaxError)
+
+        # With error_tolerant option
+        root = RubyVM::AbstractSyntaxTree.parse(<<~RUBY, error_tolerant: true)
+        def m
+          a = 10
+          if
+        end
+        RUBY
+        p root # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-4:3>
+
+        # `end` is treated as keyword based on indent
+        root = RubyVM::AbstractSyntaxTree.parse(<<~RUBY, error_tolerant: true)
+        module Z
+          class Foo
+            foo.
+          end
+
+          def bar
+          end
+        end
+        RUBY
+        p root.children[-1].children[-1].children[-1].children[-2..-1]
+        # => [#<RubyVM::AbstractSyntaxTree::Node:CLASS@2:2-4:5>, #<RubyVM::AbstractSyntaxTree::Node:DEFN@6:2-7:5>]
+        ```
+
+    * Add `keep_tokens` option for `parse`, `parse_file` and `of`. Add `#tokens` and `#all_tokens`
+      for RubyVM::AbstractSyntaxTree::Node [[Feature #19070]]
+
+        ```ruby
+        root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+        root.tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+        root.tokens.map{_1[2]}.join # => "x = 1 + 2"
+        ```
+
+* Set
+
+    * Set is now available as a built-in class without the need for `require "set"`. [[Feature #16989]]
+      It is currently autoloaded via the Set constant or a call to Enumerable#to_set.
+
+* String
+
+    * String#byteindex and String#byterindex have been added. [[Feature #13110]]
+    * Update Unicode to Version 15.0.0 and Emoji Version 15.0. [[Feature #18639]]
+      (also applies to Regexp)
+    * String#bytesplice has been added.  [[Feature #18598]]
+    * String#dedup has been added as an alias to String#-@.  [[Feature #18595]]
+
+* Struct
+
+    * A Struct class can also be initialized with keyword arguments
+      without `keyword_init: true` on Struct.new [[Feature #16806]]
+
+        ```ruby
+        Post = Struct.new(:id, :name)
+        Post.new(1, "hello") #=> #<struct Post id=1, name="hello">
+        # From Ruby 3.2, the following code also works without keyword_init: true.
+        Post.new(id: 1, name: "hello") #=> #<struct Post id=1, name="hello">
+        ```
+
+* Thread
+
+    * Thread.each_caller_location is added. [[Feature #16663]]
+
+* Thread::Queue
+
+    * Thread::Queue#pop(timeout: sec) is added. [[Feature #18774]]
+
+* Thread::SizedQueue
+
+    * Thread::SizedQueue#pop(timeout: sec) is added. [[Feature #18774]]
+    * Thread::SizedQueue#push(timeout: sec) is added. [[Feature #18944]]
+
+* Time
+
+    * Time#deconstruct_keys is added, allowing to use Time instances
+      in pattern-matching expressions [[Feature #19071]]
+
+    * Time.new now can parse a string like generated by Time#inspect
+      and return a Time instance based on the given argument.
+      [[Feature #18033]]
+
+* SyntaxError
+    * SyntaxError#path has been added.  [[Feature #19138]]
+
+* TracePoint
+
+    * TracePoint#binding now returns `nil` for `c_call`/`c_return` TracePoints.
+      [[Bug #18487]]
+    * TracePoint#enable `target_thread` keyword argument now defaults to the
+      current thread if a block is given and `target` and `target_line` keyword
+      arguments are not passed. [[Bug #16889]]
+
+* UnboundMethod
+
+    * `UnboundMethod#==` returns `true` if the actual method is same. For example,
+      `String.instance_method(:object_id) == Array.instance_method(:object_id)`
+      returns `true`. [[Feature #18798]]
+
+    * `UnboundMethod#inspect` does not show the receiver of `instance_method`.
+      For example `String.instance_method(:object_id).inspect` returns
+      `"#<UnboundMethod: Kernel#object_id()>"`
+      (was `"#<UnboundMethod: String(Kernel)#object_id()>"`).
+
+* GC
+
+    * Expose `need_major_gc` via `GC.latest_gc_info`. [GH-6791]
+
+* ObjectSpace
+
+    * `ObjectSpace.dump_all` dump shapes as well. [GH-6868]
+
+## Stdlib updates
+
+* Bundler
+
+    * Bundler now uses [PubGrub] resolver instead of [Molinillo] for performance improvement.
+    * Add --ext=rust support to bundle gem for creating simple gems with Rust extensions.
+      [[GH-rubygems-6149]]
+    * Make cloning git repos faster [[GH-rubygems-4475]]
+
+* RubyGems
+
+    * Add mswin support for cargo builder. [[GH-rubygems-6167]]
+
+* CGI
+
+    * `CGI.escapeURIComponent` and `CGI.unescapeURIComponent` are added.
+      [[Feature #18822]]
+
+* Coverage
+
+    * `Coverage.setup` now accepts `eval: true`. By this, `eval` and related methods are
+      able to generate code coverage. [[Feature #19008]]
+
+    * `Coverage.supported?(mode)` enables detection of what coverage modes are
+      supported. [[Feature #19026]]
+
+* Date
+
+    * Added `Date#deconstruct_keys` and `DateTime#deconstruct_keys` same as [[Feature #19071]]
+
+* ERB
+
+    * `ERB::Util.html_escape` is made faster than `CGI.escapeHTML`.
+        * It no longer allocates a String object when no character needs to be escaped.
+        * It skips calling `#to_s` method when an argument is already a String.
+        * `ERB::Escape.html_escape` is added as an alias to `ERB::Util.html_escape`,
+          which has not been monkey-patched by Rails.
+    * `ERB::Util.url_encode` is made faster using `CGI.escapeURIComponent`.
+    * `-S` option is removed from `erb` command.
+
+* FileUtils
+
+    * Add FileUtils.ln_sr method and `relative:` option to FileUtils.ln_s.
+      [[Feature #18925]]
+
+* IRB
+
+    * debug.gem integration commands have been added: `debug`, `break`, `catch`,
+      `next`, `delete`, `step`, `continue`, `finish`, `backtrace`, `info`
+        * They work even if you don't have `gem "debug"` in your Gemfile.
+        * See also: [What's new in Ruby 3.2's IRB?](https://st0012.dev/whats-new-in-ruby-3-2-irb)
+    * More Pry-like commands and features have been added.
+        * `edit` and `show_cmds` (like Pry's `help`) are added.
+        * `ls` takes `-g` or `-G` option to filter out outputs.
+        * `show_source` is aliased from `$` and accepts unquoted inputs.
+        * `whereami` is aliased from `@`.
+
+* Net::Protocol
+
+    * Improve `Net::BufferedIO` performance. [[GH-net-protocol-14]]
+
+* Pathname
+
+    * Added `Pathname#lutime`. [[GH-pathname-20]]
+
+* Socket
+
+    * Added the following constants for supported platforms.
+        * `SO_INCOMING_CPU`
+        * `SO_INCOMING_NAPI_ID`
+        * `SO_RTABLE`
+        * `SO_SETFIB`
+        * `SO_USER_COOKIE`
+        * `TCP_KEEPALIVE`
+        * `TCP_CONNECTION_INFO`
+
+* SyntaxSuggest
+
+    * The feature of `syntax_suggest` formerly `dead_end` is integrated in Ruby.
+      [[Feature #18159]]
+
+* UNIXSocket
+
+    * Add support for UNIXSocket on Windows. Emulate anonymous sockets. Add
+      support for File.socket? and File::Stat#socket? where possible.
+      [[Feature #19135]]
+
+*   The following default gems are updated.
+
+    * RubyGems 3.4.1
+    * abbrev 0.1.1
+    * benchmark 0.2.1
+    * bigdecimal 3.1.3
+    * bundler 2.4.1
+    * cgi 0.3.6
+    * csv 3.2.6
+    * date 3.3.3
+    * delegate 0.3.0
+    * did_you_mean 1.6.3
+    * digest 3.1.1
+    * drb 2.1.1
+    * english 0.7.2
+    * erb 4.0.2
+    * error_highlight 0.5.1
+    * etc 1.4.2
+    * fcntl 1.0.2
+    * fiddle 1.1.1
+    * fileutils 1.7.0
+    * forwardable 1.3.3
+    * getoptlong 0.2.0
+    * io-console 0.6.0
+    * io-nonblock 0.2.0
+    * io-wait 0.3.0
+    * ipaddr 1.2.5
+    * irb 1.6.2
+    * json 2.6.3
+    * logger 1.5.3
+    * mutex_m 0.1.2
+    * net-http 0.4.0
+    * net-protocol 0.2.1
+    * nkf 0.1.2
+    * open-uri 0.3.0
+    * open3 0.1.2
+    * openssl 3.1.0
+    * optparse 0.3.1
+    * ostruct 0.5.5
+    * pathname 0.2.1
+    * pp 0.4.0
+    * pstore 0.1.2
+    * psych 5.0.1
+    * racc 1.6.2
+    * rdoc 6.5.0
+    * readline-ext 0.1.5
+    * reline 0.3.2
+    * resolv 0.2.2
+    * resolv-replace 0.1.1
+    * securerandom 0.2.2
+    * set 1.0.3
+    * stringio 3.0.4
+    * strscan 3.0.5
+    * syntax_suggest 1.0.2
+    * syslog 0.1.1
+    * tempfile 0.1.3
+    * time 0.2.1
+    * timeout 0.3.1
+    * tmpdir 0.1.3
+    * tsort 0.1.1
+    * un 0.2.1
+    * uri 0.12.0
+    * weakref 0.1.2
+    * win32ole 1.8.9
+    * yaml 0.2.1
+    * zlib 3.0.0
+
+*   The following bundled gems are updated.
+
+    * minitest 5.16.3
+    * power_assert 2.0.3
+    * test-unit 3.5.7
+    * net-ftp 0.2.0
+    * net-imap 0.3.4
+    * net-pop 0.1.2
+    * net-smtp 0.3.3
+    * rbs 2.8.2
+    * typeprof 0.21.3
+    * debug 1.7.1
+
+See GitHub releases like [GitHub Releases of Logger](https://github.com/ruby/logger/releases) or changelog for details of the default gems or bundled gems.
+
+## Supported platforms
+
+* WebAssembly/WASI is added. See [wasm/README.md] and [ruby.wasm] for more details. [[Feature #18462]]
+
+## Compatibility issues
+
+* `String#to_c` currently treat a sequence of underscores as an end of Complex
+  string. [[Bug #19087]]
+
+* Now `ENV.clone` raises `TypeError` as well as `ENV.dup` [[Bug #17767]]
+
+### Removed constants
+
+The following deprecated constants are removed.
+
+* `Fixnum` and `Bignum` [[Feature #12005]]
+* `Random::DEFAULT` [[Feature #17351]]
+* `Struct::Group`
+* `Struct::Passwd`
+
+### Removed methods
+
+The following deprecated methods are removed.
+
+* `Dir.exists?` [[Feature #17391]]
+* `File.exists?` [[Feature #17391]]
+* `Kernel#=~` [[Feature #15231]]
+* `Kernel#taint`, `Kernel#untaint`, `Kernel#tainted?`
+  [[Feature #16131]]
+* `Kernel#trust`, `Kernel#untrust`, `Kernel#untrusted?`
+  [[Feature #16131]]
+* `Method#public?`, `Method#private?`, `Method#protected?`,
+  `UnboundMethod#public?`, `UnboundMethod#private?`, `UnboundMethod#protected?`
+  [[Bug #18729]] [[Bug #18751]] [[Bug #18435]]
+
+### Source code incompatibility of extension libraries
+
+* Extension libraries provide PRNG, subclasses of Random, need updates.
+  See [PRNG update] below for more information. [[Bug #19100]]
+
+### Error printer
+
+* Ruby no longer escapes control characters and backslashes in an
+  error message. [[Feature #18367]]
+
+### Constant lookup when defining a class/module
+
+* When defining a class/module directly under the Object class by class/module
+  statement, if there is already a class/module defined by `Module#include`
+  with the same name, the statement was handled as "open class" in Ruby 3.1 or before.
+  Since Ruby 3.2, a new class is defined instead. [[Feature #18832]]
+
+## Stdlib compatibility issues
+
+* Psych no longer bundles libyaml sources.
+  And also Fiddle no longer bundles libffi sources.
+  Users need to install the libyaml/libffi library themselves via the package
+  manager like apt, yum, brew, etc.
+
+    Psych and fiddle supported the static build with specific version of libyaml
+    and libffi sources. You can build psych with libyaml-0.2.5 like this.
+
+    ```bash
+    $ ./configure --with-libyaml-source-dir=/path/to/libyaml-0.2.5
+    ```
+
+    And you can build fiddle with libffi-3.4.4 like this.
+
+    ```bash
+    $ ./configure --with-libffi-source-dir=/path/to/libffi-3.4.4
+    ```
+
+    [[Feature #18571]]
+
+* Check cookie name/path/domain characters in `CGI::Cookie`. [[CVE-2021-33621]]
+
+* `URI.parse` return empty string in host instead of nil. [[sec-156615]]
+
+## C API updates
+
+### Updated C APIs
+
+The following APIs are updated.
+
+* PRNG update
+
+    `rb_random_interface_t` in ruby/random.h updated and versioned.
+    Extension libraries which use this interface and built for older
+    versions need to rebuild with adding `init_int32` function.
+
+### Added C APIs
+
+* `VALUE rb_hash_new_capa(long capa)` was added to created hashes with the desired capacity.
+* `rb_internal_thread_add_event_hook` and `rb_internal_thread_add_event_hook` were added to instrument threads scheduling.
+  The following events are available:
+    * `RUBY_INTERNAL_THREAD_EVENT_STARTED`
+    * `RUBY_INTERNAL_THREAD_EVENT_READY`
+    * `RUBY_INTERNAL_THREAD_EVENT_RESUMED`
+    * `RUBY_INTERNAL_THREAD_EVENT_SUSPENDED`
+    * `RUBY_INTERNAL_THREAD_EVENT_EXITED`
+* `rb_debug_inspector_current_depth` and `rb_debug_inspector_frame_depth` are added for debuggers.
+
+### Removed C APIs
+
+The following deprecated APIs are removed.
+
+* `rb_cData` variable.
+* "taintedness" and "trustedness" functions. [[Feature #16131]]
+
+## Implementation improvements
+
+* Fixed several race conditions in Kernel#autoload. [[Bug #18782]]
+* Cache invalidation for expressions referencing constants is now
+  more fine-grained. `RubyVM.stat(:global_constant_state)` was
+  removed because it was closely tied to the previous caching scheme
+  where setting any constant invalidates all caches in the system.
+  New keys, `:constant_cache_invalidations` and `:constant_cache_misses`,
+  were introduced to help with use cases for `:global_constant_state`.
+  [[Feature #18589]]
+* The cache-based optimization for Regexp matching is introduced.
+  [[Feature #19104]]
+* [Variable Width Allocation](https://shopify.engineering/ruby-variable-width-allocation)
+  is now enabled by default. [[Feature #18239]]
+* Added a new instance variable caching mechanism, called object shapes, which
+  improves inline cache hits for most objects and allows us to generate very
+  efficient JIT code. Objects whose instance variables are defined in a
+  consistent order will see the most performance benefits.
+  [[Feature #18776]]
+* Speed up marking instruction sequences by using a bitmap to find "markable"
+  objects.  This change results in faster major collections.
+  [[Feature #18875]]
+
+## JIT
+
+### YJIT
+
+* YJIT is no longer experimental
+    * Has been tested on production workloads for over a year and proven to be quite stable.
+* YJIT now supports both x86-64 and arm64/aarch64 CPUs on Linux, MacOS, BSD and other UNIX platforms.
+    * This release brings support for Mac M1/M2, AWS Graviton and Raspberry Pi 4.
+* Building YJIT now requires Rust 1.58.0+. [[Feature #18481]]
+    * In order to ensure that CRuby is built with YJIT, please install `rustc` >= 1.58.0
+      before running `./configure`
+    * Please reach out to the YJIT team should you run into any issues.
+* Physical memory for JIT code is lazily allocated. Unlike Ruby 3.1,
+  the RSS of a Ruby process is minimized because virtual memory pages
+  allocated by `--yjit-exec-mem-size` will not be mapped to physical
+  memory pages until actually utilized by JIT code.
+* Introduce Code GC that frees all code pages when the memory consumption
+  by JIT code reaches `--yjit-exec-mem-size`.
+    * `RubyVM::YJIT.runtime_stats` returns Code GC metrics in addition to
+      existing `inline_code_size` and `outlined_code_size` keys:
+      `code_gc_count`, `live_page_count`, `freed_page_count`, and `freed_code_size`.
+* Most of the statistics produced by `RubyVM::YJIT.runtime_stats` are now available in release builds.
+    * Simply run ruby with `--yjit-stats` to compute and dump stats (incurs some run-time overhead).
+* YJIT is now optimized to take advantage of object shapes. [[Feature #18776]]
+* Take advantage of finer-grained constant invalidation to invalidate less code when defining new constants. [[Feature #18589]]
+* The default `--yjit-exec-mem-size` is changed to 64 (MiB).
+* The default `--yjit-call-threshold` is changed to 30.
+
+### MJIT
+
+* The MJIT compiler is re-implemented in Ruby as `ruby_vm/mjit/compiler`.
+* MJIT compiler is executed under a forked Ruby process instead of
+  doing it in a native thread called MJIT worker. [[Feature #18968]]
+    * As a result, Microsoft Visual Studio (MSWIN) is no longer supported.
+* MinGW is no longer supported. [[Feature #18824]]
+* Rename `--mjit-min-calls` to `--mjit-call-threshold`.
+* Change default `--mjit-max-cache` back from 10000 to 100.
+
+[Feature #12005]:     https://bugs.ruby-lang.org/issues/12005
+[Feature #12084]:     https://bugs.ruby-lang.org/issues/12084
+[Feature #12655]:     https://bugs.ruby-lang.org/issues/12655
+[Feature #12737]:     https://bugs.ruby-lang.org/issues/12737
+[Feature #13110]:     https://bugs.ruby-lang.org/issues/13110
+[Feature #14332]:     https://bugs.ruby-lang.org/issues/14332
+[Feature #15231]:     https://bugs.ruby-lang.org/issues/15231
+[Feature #15357]:     https://bugs.ruby-lang.org/issues/15357
+[Bug #15928]:         https://bugs.ruby-lang.org/issues/15928
+[Feature #16122]:     https://bugs.ruby-lang.org/issues/16122
+[Feature #16131]:     https://bugs.ruby-lang.org/issues/16131
+[Bug #16466]:         https://bugs.ruby-lang.org/issues/16466
+[Feature #16663]:     https://bugs.ruby-lang.org/issues/16663
+[Feature #16806]:     https://bugs.ruby-lang.org/issues/16806
+[Bug #16889]:         https://bugs.ruby-lang.org/issues/16889
+[Bug #16908]:         https://bugs.ruby-lang.org/issues/16908
+[Feature #16989]:     https://bugs.ruby-lang.org/issues/16989
+[Feature #17351]:     https://bugs.ruby-lang.org/issues/17351
+[Feature #17391]:     https://bugs.ruby-lang.org/issues/17391
+[Bug #17545]:         https://bugs.ruby-lang.org/issues/17545
+[Bug #17767]:         https://bugs.ruby-lang.org/issues/17767
+[Feature #17837]:     https://bugs.ruby-lang.org/issues/17837
+[Feature #17881]:     https://bugs.ruby-lang.org/issues/17881
+[Feature #18033]:     https://bugs.ruby-lang.org/issues/18033
+[Feature #18159]:     https://bugs.ruby-lang.org/issues/18159
+[Feature #18239]:     https://bugs.ruby-lang.org/issues/18239#note-17
+[Feature #18351]:     https://bugs.ruby-lang.org/issues/18351
+[Feature #18367]:     https://bugs.ruby-lang.org/issues/18367
+[Bug #18435]:         https://bugs.ruby-lang.org/issues/18435
+[Feature #18462]:     https://bugs.ruby-lang.org/issues/18462
+[Feature #18481]:     https://bugs.ruby-lang.org/issues/18481
+[Bug #18487]:         https://bugs.ruby-lang.org/issues/18487
+[Feature #18564]:     https://bugs.ruby-lang.org/issues/18564
+[Feature #18571]:     https://bugs.ruby-lang.org/issues/18571
+[Feature #18585]:     https://bugs.ruby-lang.org/issues/18585
+[Feature #18589]:     https://bugs.ruby-lang.org/issues/18589
+[Feature #18595]:     https://bugs.ruby-lang.org/issues/18595
+[Feature #18598]:     https://bugs.ruby-lang.org/issues/18598
+[Bug #18625]:         https://bugs.ruby-lang.org/issues/18625
+[Feature #18630]:     https://bugs.ruby-lang.org/issues/18630
+[Bug #18633]:         https://bugs.ruby-lang.org/issues/18633
+[Feature #18639]:     https://bugs.ruby-lang.org/issues/18639
+[Feature #18685]:     https://bugs.ruby-lang.org/issues/18685
+[Bug #18729]:         https://bugs.ruby-lang.org/issues/18729
+[Bug #18751]:         https://bugs.ruby-lang.org/issues/18751
+[Feature #18774]:     https://bugs.ruby-lang.org/issues/18774
+[Feature #18776]:     https://bugs.ruby-lang.org/issues/18776
+[Bug #18782]:         https://bugs.ruby-lang.org/issues/18782
+[Feature #18788]:     https://bugs.ruby-lang.org/issues/18788
+[Feature #18798]:     https://bugs.ruby-lang.org/issues/18798
+[Feature #18809]:     https://bugs.ruby-lang.org/issues/18809
+[Feature #18821]:     https://bugs.ruby-lang.org/issues/18821
+[Feature #18822]:     https://bugs.ruby-lang.org/issues/18822
+[Feature #18824]:     https://bugs.ruby-lang.org/issues/18824
+[Feature #18832]:     https://bugs.ruby-lang.org/issues/18832
+[Feature #18875]:     https://bugs.ruby-lang.org/issues/18875
+[Feature #18925]:     https://bugs.ruby-lang.org/issues/18925
+[Feature #18944]:     https://bugs.ruby-lang.org/issues/18944
+[Feature #18949]:     https://bugs.ruby-lang.org/issues/18949
+[Feature #18968]:     https://bugs.ruby-lang.org/issues/18968
+[Feature #19008]:     https://bugs.ruby-lang.org/issues/19008
+[Feature #19013]:     https://bugs.ruby-lang.org/issues/19013
+[Feature #19026]:     https://bugs.ruby-lang.org/issues/19026
+[Feature #19036]:     https://bugs.ruby-lang.org/issues/19036
+[Feature #19060]:     https://bugs.ruby-lang.org/issues/19060
+[Feature #19070]:     https://bugs.ruby-lang.org/issues/19070
+[Feature #19071]:     https://bugs.ruby-lang.org/issues/19071
+[Feature #19078]:     https://bugs.ruby-lang.org/issues/19078
+[Bug #19087]:         https://bugs.ruby-lang.org/issues/19087
+[Bug #19100]:         https://bugs.ruby-lang.org/issues/19100
+[Feature #19104]:     https://bugs.ruby-lang.org/issues/19104
+[Feature #19135]:     https://bugs.ruby-lang.org/issues/19135
+[Feature #19138]:     https://bugs.ruby-lang.org/issues/19138
+[Feature #19194]:     https://bugs.ruby-lang.org/issues/19194
+[Molinillo]:          https://github.com/CocoaPods/Molinillo
+[PubGrub]:            https://github.com/jhawthorn/pub_grub
+[GH-net-protocol-14]: https://github.com/ruby/net-protocol/pull/14
+[GH-pathname-20]:     https://github.com/ruby/pathname/pull/20
+[GH-6791]:            https://github.com/ruby/ruby/pull/6791
+[GH-6868]:            https://github.com/ruby/ruby/pull/6868
+[GH-rubygems-4475]:   https://github.com/rubygems/rubygems/pull/4475
+[GH-rubygems-6149]:   https://github.com/rubygems/rubygems/pull/6149
+[GH-rubygems-6167]:   https://github.com/rubygems/rubygems/pull/6167
+[sec-156615]:         https://hackerone.com/reports/156615
+[CVE-2021-33621]:     https://www.ruby-lang.org/en/news/2022/11/22/http-response-splitting-in-cgi-cve-2021-33621/
+[wasm/README.md]:     https://github.com/ruby/ruby/blob/master/wasm/README.md
+[ruby.wasm]:          https://github.com/ruby/ruby.wasm
diff --git a/README.ja.md b/README.ja.md
index eee54a9171..93c0131690 100644
--- a/README.ja.md
+++ b/README.ja.md
@@ -1,3 +1,10 @@
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: MJIT](https://github.com/ruby/ruby/workflows/MJIT/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MJIT")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![AppVeyor status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
+
 # Rubyとは
 
 Rubyはシンプルかつ強力なオブジェクト指向スクリプト言語です． Rubyは純粋なオブジェクト指向言語として設計されているので，
@@ -10,83 +17,86 @@ Rubyはテキスト処理関係の能力などに優れ，Perlと同じくらい
 
 *   シンプルな文法
 *   普通のオブジェクト指向機能(クラス，メソッドコールなど)
-*   特殊なオブジェクト指向機能(Mixin, 特異メソッドなど)
+*   特殊なオブジェクト指向機能(Mixin，特異メソッドなど)
 *   演算子オーバーロード
 *   例外処理機能
 *   イテレータとクロージャ
 *   ガーベージコレクタ
 *   ダイナミックローディング (アーキテクチャによる)
-*   移植性が高い．多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく，Windows， Mac OS
-    X，BeOSなどの上でも動く cf.
-    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatformsJa
+*   移植性が高い．多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく，Windows， macOS，
+    Haikuなどの上でも動く cf.
+    https://github.com/ruby/ruby/blob/master/doc/contributing.rdoc#platform-maintainers
 
 
 ## 入手法
 
-### FTPで
+サードパーティーツールを使った方法を含むRubyのインストール方法の一覧は
+
+https://www.ruby-lang.org/ja/downloads/
+
+を参照してください．
 
-以下の場所においてあります．
+### Git
 
-ftp://ftp.ruby-lang.org/pub/ruby/
+ミラーをGitHubに公開しています． 以下のコマンドでリポジトリを取得できます．
 
-### Subversionで
+    $ git clone https://github.com/ruby/ruby.git
 
-開発先端のソースコードは次のコマンドで取得できます．
+他のブランチの一覧は次のコマンドで見られます．
 
-    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+    $ git ls-remote https://github.com/ruby/ruby.git
 
-他に開発中のブランチの一覧は次のコマンドで見られます．
+Rubyリポジトリの本来のmasterは https://git.ruby-lang.org/ruby.git にあります．
+コミッタはこちらを使います．
 
-    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+### Subversion
 
-### Gitで
+古いRubyのバージョンのソースコードは次のコマンドでも取得できます．
 
-SubversionのミラーをGitHubに公開しています． 以下のコマンドでリポジトリを取得できます．
+    $ svn co https://svn.ruby-lang.org/repos/ruby/branches/ruby_2_6/ ruby
+
+他のブランチの一覧は次のコマンドで見られます．
+
+    $ svn ls https://svn.ruby-lang.org/repos/ruby/branches/
 
-    $ git clone git://github.com/ruby/ruby.git
 
 ## ホームページ
 
 RubyのホームページのURLは
 
-http://www.ruby-lang.org/
+https://www.ruby-lang.org/
 
 です．
 
 ## メーリングリスト
 
-Rubyのメーリングリストがあります．参加希望の方は
-
-mailto:ruby-list-request@ruby-lang.org
-
-まで本文に
+Rubyのメーリングリストがあります．参加希望の方は [ruby-list-request@ruby-lang.org] まで本文に
 
     subscribe
 
 と書いて送って下さい．
 
-Ruby開発者向けメーリングリストもあります．こちらではrubyのバグ，将来の仕様拡張など実装上の問題について議論されています． 参加希望の方は
-
-mailto:ruby-dev-request@ruby-lang.org
-
-までruby-listと同様の方法でメールしてください．
+Ruby開発者向けメーリングリストもあります．こちらではrubyのバグ，将来の仕様拡張など実装上の問題について議論されています．
+参加希望の方は [ruby-dev-request@ruby-lang.org] までruby-listと同様の方法でメールしてください．
 
 Ruby拡張モジュールについて話し合うruby-extメーリングリストと数学関係の話題について話し合うruby-mathメーリングリストと
 英語でrubyについて話し合うruby-talkメーリングリストもあります．参加方法はどれも同じです．
 
+[ruby-list-request@ruby-lang.org]: mailto:ruby-list-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe
+[ruby-dev-request@ruby-lang.org]: mailto:ruby-dev-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe
+
 ## コンパイル・インストール
 
 以下の手順で行ってください．
 
-1.  もし `configure` ファイルが見つからない，もしくは `configure.in` より古いようなら， `autoconf` を実行して
-    新しく `configure` を生成する
+1.  (Gitリポジトリから取得したソースをビルドする場合) `./autogen.sh` を実行して新しく `configure` を生成する
 
 2.  `configure` を実行して `Makefile` などを生成する
 
     環境によってはデフォルトのCコンパイラ用オプションが付きます． `configure` オプションで `optflags=..`
     `warnflags=..` 等で上書きできます．
 
-3.  (必要ならば)`defines.h` を編集する
+3.  (必要ならば)`include/ruby/defines.h` を編集する
 
     多分，必要無いと思います．
 
@@ -95,7 +105,8 @@ Ruby拡張モジュールについて話し合うruby-extメーリングリス�
     `ext/Setup` に記述したモジュールは静的にリンクされます．
 
     ダイナミックローディングをサポートしていないアーキテクチャでは `Setup` の1行目の「`option nodynamic`」という行のコ
-    メントを外す必要があります．また，このアーキテクチャで拡張モジュールを利用するためには，あらかじめ静的にリンクをしておく必要があります．
+    メントを外す必要があります．
+    また，このアーキテクチャで拡張モジュールを利用するためには，あらかじめ静的にリンクをしておく必要があります．
 
 5.  `make` を実行してコンパイルする
 
@@ -151,21 +162,21 @@ UNIXであれば `configure` がほとんどの差異を吸収してくれるは
 
 ## 配布条件
 
-`COPYING.ja` ファイルを参照してください．
+[COPYING.ja](COPYING.ja) ファイルを参照してください．
 
 ## フィードバック
 
-Rubyに関する質問は Ruby-Talk（英語）や Ruby-List（日本語） (https://www.ruby-lang.org/ja/community/mailing-lists) や，
-stackoverflow (http://ja.stackoverflow.com/) などのWebサイトに投稿してください．
+Rubyに関する質問は [Ruby-Talk]（英語）や [Ruby-List]（日本語）や，
+[stackoverflow] などのWebサイトに投稿してください．
 
-バグ報告は http://bugs.ruby-lang.org で受け付けています．
+バグ報告は https://bugs.ruby-lang.org で受け付けています．
 
+[Ruby-Talk]: https://www.ruby-lang.org/en/community/mailing-lists
+[Ruby-List]: https://www.ruby-lang.org/ja/community/mailing-lists
+[stackoverflow]: https://ja.stackoverflow.com/
 
 ## 著者
 
 Rubyのオリジナル版は，1995年にまつもとゆきひろ氏によって設計・開発されました．
 
 <mailto:matz@ruby-lang.org>
-
----
-created at: Thu Aug  3 11:57:36 JST 1995
diff --git a/README.md b/README.md
index 9ea9ceb8f0..c445448c71 100644
--- a/README.md
+++ b/README.md
@@ -1,164 +1,91 @@
-# What's Ruby
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: MJIT](https://github.com/ruby/ruby/workflows/MJIT/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MJIT")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![AppVeyor status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
 
-Ruby is the interpreted scripting language for quick and easy object-oriented
-programming.  It has many features to process text files and to do system
-management tasks (as in Perl).  It is simple, straight-forward, and
-extensible.
+# What is Ruby?
 
-## Features of Ruby
+Ruby is an interpreted object-oriented programming language often
+used for web development. It also offers many scripting features
+to process plain text and serialized files, or manage system tasks.
+It is simple, straightforward, and extensible.
 
-*   Simple Syntax
-*   **Normal** Object-oriented Features (e.g. class, method calls)
-*   **Advanced** Object-oriented Features (e.g. Mix-in, Singleton-method)
-*   Operator Overloading
-*   Exception Handling
-*   Iterators and Closures
-*   Garbage Collection
-*   Dynamic Loading of Object Files (on some architectures)
-*   Highly Portable (works on many Unix-like/POSIX compatible platforms as
-    well as Windows, Mac OS X, BeOS, etc.) cf.
-    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatforms
+## Features of Ruby
 
+* Simple Syntax
+* **Normal** Object-oriented Features (e.g. class, method calls)
+* **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
+* Operator Overloading
+* Exception Handling
+* Iterators and Closures
+* Garbage Collection
+* Dynamic Loading of Object Files (on some architectures)
+* Highly Portable (works on many Unix-like/POSIX compatible platforms as
+  well as Windows, macOS, etc.) cf.
+  https://github.com/ruby/ruby/blob/master/doc/maintainers.rdoc#label-Platform+Maintainers
 
-## How to get Ruby
+## How to get Ruby with Git
 
 For a complete list of ways to install Ruby, including using third-party tools
 like rvm, see:
 
-http://www.ruby-lang.org/en/downloads/
-
-The Ruby distribution files can be found on the following FTP site:
-
-ftp://ftp.ruby-lang.org/pub/ruby/
+https://www.ruby-lang.org/en/downloads/
 
-The trunk of the Ruby source tree can be checked out with the following
-command:
+The mirror of the Ruby source tree can be checked out with the following command:
 
-    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+    $ git clone https://github.com/ruby/ruby.git
 
-Or if you are using git then use the following command:
-
-    $ git clone git://github.com/ruby/ruby.git
-
-There are some other branches under development.  Try the following command
+There are some other branches under development. Try the following command
 to see the list of branches:
 
-    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+    $ git ls-remote https://github.com/ruby/ruby.git
 
-Or if you are using git then use the following command:
+You may also want to use https://git.ruby-lang.org/ruby.git (actual master of Ruby source)
+if you are a committer.
 
-    $ git ls-remote git://github.com/ruby/ruby.git
+## How to build
+
+see [Building Ruby](doc/contributing/building_ruby.md)
 
 ## Ruby home page
 
-The URL of the Ruby home page is:
+https://www.ruby-lang.org/
+
+## Documentation
 
-http://www.ruby-lang.org/
+- [English](https://docs.ruby-lang.org/en/master/index.html)
+- [Japanese](https://docs.ruby-lang.org/ja/master/index.html)
 
 ## Mailing list
 
-There is a mailing list to talk about Ruby. To subscribe this list, please
+There is a mailing list to discuss Ruby. To subscribe to this list, please
 send the following phrase:
 
     subscribe
 
-in the mail body (not subject) to the address
-<mailto:ruby-talk-request@ruby-lang.org>.
-
-## How to compile and install
-
-This is what you need to do to compile and install Ruby:
-
-1.  If you want to use Microsoft Visual C++ to compile ruby, read
-    win32/README.win32 instead of this document.
-
-2.  If `./configure` does not exist or is older than configure.in, run
-    autoconf to (re)generate configure.
-
-3.  Run `./configure`, which will generate config.h and Makefile.
-
-    Some C compiler flags may be added by default depending on your
-    environment.  Specify `optflags=..` and `warnflags=..` as necessary to
-    override them.
-
-4.  Edit `defines.h` if you need. Usually this step will not be needed.
-
-5.  Remove comment mark(`#`) before the module names from `ext/Setup` (or add
-    module names if not present), if you want to link modules statically.
+in the mail body (not subject) to the address [ruby-talk-request@ruby-lang.org].
 
-    If you don't want to compile non static extension modules (probably on
-    architectures which do not allow dynamic loading), remove comment mark
-    from the line "`#option nodynamic`" in `ext/Setup`.
-
-    Usually this step will not be needed.
-
-6.  Run `make`.
-
-7.  Optionally, run '`make check`' to check whether the compiled Ruby
-    interpreter works well. If you see the message "`check succeeded`", your
-    ruby works as it should (hopefully).
-
-8.  Run '`make install`'
-
-    This command will create following directories and install files onto
-    them.
-
-    *   `${DESTDIR}${prefix}/bin`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib`
-    *   `${DESTDIR}${prefix}/lib/ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/share/man/man1`
-    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
-
-
-    If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
-    `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
-
-    **NOTE**: teeny of the API version may be different from one of Ruby's
-    program version
-
-    You may have to be a super user to install ruby.
-
-
-If you fail to compile ruby, please send the detailed error report with the
-error log and machine/OS type, to help others.
-
-Some extension libraries may not get compiled because of lack of necessary
-external libraries and/or headers, then you will need to run '`make distclean-ext`'
-to remove old configuration after installing them in such case.
+[ruby-talk-request@ruby-lang.org]: mailto:ruby-talk-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe
 
 ## Copying
 
-See the file `COPYING`.
+See the file [COPYING](rdoc-ref:COPYING).
 
 ## Feedback
 
-Questions about the Ruby language can be asked on the Ruby-Talk mailing list
-(http://www.ruby-lang.org/en/community/mailing-lists) or on websites like
-(http://stackoverflow.com).
-
-Bug reports should be filed at http://bugs.ruby-lang.org. Read [HowToReport] for more information.
-
-[HowToReport]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToReport
+Questions about the Ruby language can be asked on the [Ruby-Talk](https://www.ruby-lang.org/en/community/mailing-lists) mailing list
+or on websites like https://stackoverflow.com.
 
-##Contributing
+Bugs should be reported at https://bugs.ruby-lang.org. Read ["Reporting Issues"](https://docs.ruby-lang.org/en/master/contributing/reporting_issues_md.html) for more information.
 
-See the file `CONTRIBUTING.md`
+## Contributing
 
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing_md.html), which includes setup and build instructions.
 
 ## The Author
 
-Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in
-1995.
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in 1995.
 
-<mailto:matz@ruby-lang.org>
+<matz@ruby-lang.org>
diff --git a/aclocal.m4 b/aclocal.m4
new file mode 100644
index 0000000000..e69de29bb2
--- /dev/null
+++ b/aclocal.m4
diff --git a/addr2line.c b/addr2line.c
index c8faf48d62..e5f25293e2 100644
--- a/addr2line.c
+++ b/addr2line.c
@@ -8,14 +8,26 @@
 
 **********************************************************************/
 
-#include "ruby/config.h"
+#if defined(__clang__)
+#pragma clang diagnostic ignored "-Wgnu-empty-initializer"
+#pragma clang diagnostic ignored "-Wgcc-compat"
+#endif
+
+#include "ruby/internal/config.h"
+#include "ruby/defines.h"
 #include "ruby/missing.h"
 #include "addr2line.h"
 
 #include <stdio.h>
 #include <errno.h>
 
-#ifdef USE_ELF
+#ifdef HAVE_LIBPROC_H
+#include <libproc.h>
+#endif
+
+#include "ruby/internal/stdbool.h"
+
+#if defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H)
 
 #include <fcntl.h>
 #include <limits.h>
@@ -28,19 +40,11 @@
 #include <sys/stat.h>
 #include <unistd.h>
 
-#ifdef __OpenBSD__
-#include <elf_abi.h>
-#else
-#include <elf.h>
-#endif
-
 /* Make alloca work the best possible way.  */
 #ifdef __GNUC__
-# ifndef atarist
-#  ifndef alloca
-#   define alloca __builtin_alloca
-#  endif
-# endif	/* atarist */
+# ifndef alloca
+#  define alloca __builtin_alloca
+# endif
 #else
 # ifdef HAVE_ALLOCA_H
 #  include <alloca.h>
@@ -59,24 +63,20 @@ void *alloca();
 # include <dlfcn.h>
 #endif
 
-#define DW_LNS_copy                     0x01
-#define DW_LNS_advance_pc               0x02
-#define DW_LNS_advance_line             0x03
-#define DW_LNS_set_file                 0x04
-#define DW_LNS_set_column               0x05
-#define DW_LNS_negate_stmt              0x06
-#define DW_LNS_set_basic_block          0x07
-#define DW_LNS_const_add_pc             0x08
-#define DW_LNS_fixed_advance_pc         0x09
-#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
-#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
-#define DW_LNS_set_isa                  0x0c /* DWARF3 */
+#ifdef HAVE_MACH_O_LOADER_H
+# include <crt_externs.h>
+# include <mach-o/fat.h>
+# include <mach-o/loader.h>
+# include <mach-o/nlist.h>
+# include <mach-o/stab.h>
+#endif
 
-/* Line number extended opcode name. */
-#define DW_LNE_end_sequence             0x01
-#define DW_LNE_set_address              0x02
-#define DW_LNE_define_file              0x03
-#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
+#ifdef USE_ELF
+# ifdef __OpenBSD__
+#  include <elf_abi.h>
+# else
+#  include <elf.h>
+# endif
 
 #ifndef ElfW
 # if SIZEOF_VOIDP == 8
@@ -92,13 +92,44 @@ void *alloca();
 #  define ELF_ST_TYPE ELF32_ST_TYPE
 # endif
 #endif
+#endif
+
+#ifdef SHF_COMPRESSED
+# if defined(ELFCOMPRESS_ZLIB) && defined(HAVE_LIBZ)
+   /* FreeBSD 11.0 lacks ELFCOMPRESS_ZLIB */
+#  include <zlib.h>
+#  define SUPPORT_COMPRESSED_DEBUG_LINE
+# endif
+#else /* compatibility with glibc < 2.22 */
+# define SHF_COMPRESSED 0
+#endif
+
 #ifndef PATH_MAX
 #define PATH_MAX 4096
 #endif
 
-int kprintf(const char *fmt, ...);
+#define DW_LNS_copy                     0x01
+#define DW_LNS_advance_pc               0x02
+#define DW_LNS_advance_line             0x03
+#define DW_LNS_set_file                 0x04
+#define DW_LNS_set_column               0x05
+#define DW_LNS_negate_stmt              0x06
+#define DW_LNS_set_basic_block          0x07
+#define DW_LNS_const_add_pc             0x08
+#define DW_LNS_fixed_advance_pc         0x09
+#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
+#define DW_LNS_set_isa                  0x0c /* DWARF3 */
+
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence             0x01
+#define DW_LNE_set_address              0x02
+#define DW_LNE_define_file              0x03
+#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
 
-typedef struct {
+PRINTF_ARGS(static int kprintf(const char *fmt, ...), 1, 2);
+
+typedef struct line_info {
     const char *dirname;
     const char *filename;
     const char *path; /* object path */
@@ -107,27 +138,72 @@ typedef struct {
     uintptr_t base_addr;
     uintptr_t saddr;
     const char *sname; /* function name */
+
+    struct line_info *next;
 } line_info_t;
-typedef struct obj_info obj_info_t;
-struct obj_info {
+
+struct dwarf_section {
+    char *ptr;
+    size_t size;
+    uint64_t flags;
+};
+
+typedef struct obj_info {
     const char *path; /* object path */
-    int fd;
-    void *mapped;
+    char *mapped;
     size_t mapped_size;
+    void *uncompressed;
     uintptr_t base_addr;
-    obj_info_t *next;
+    uintptr_t vmaddr;
+    struct dwarf_section debug_abbrev;
+    struct dwarf_section debug_info;
+    struct dwarf_section debug_line;
+    struct dwarf_section debug_ranges;
+    struct dwarf_section debug_str_offsets;
+    struct dwarf_section debug_addr;
+    struct dwarf_section debug_rnglists;
+    struct dwarf_section debug_str;
+    struct dwarf_section debug_line_str;
+    struct obj_info *next;
+} obj_info_t;
+
+#define DWARF_SECTION_COUNT 9
+
+static struct dwarf_section *
+obj_dwarf_section_at(obj_info_t *obj, int n)
+{
+    struct dwarf_section *ary[] = {
+        &obj->debug_abbrev,
+        &obj->debug_info,
+        &obj->debug_line,
+        &obj->debug_ranges,
+        &obj->debug_str_offsets,
+        &obj->debug_addr,
+        &obj->debug_rnglists,
+        &obj->debug_str,
+        &obj->debug_line_str
+    };
+    if (n < 0 || DWARF_SECTION_COUNT <= n) {
+        abort();
+    }
+    return ary[n];
+}
+
+struct debug_section_definition {
+    const char *name;
+    struct dwarf_section *dwarf;
 };
 
 /* Avoid consuming stack as this module may be used from signal handler */
-static char binary_filename[PATH_MAX];
+static char binary_filename[PATH_MAX + 1];
 
 static unsigned long
-uleb128(char **p)
+uleb128(const char **p)
 {
     unsigned long r = 0;
     int s = 0;
     for (;;) {
-	unsigned char b = *(unsigned char *)(*p)++;
+	unsigned char b = (unsigned char)*(*p)++;
 	if (b < 0x80) {
 	    r += (unsigned long)b << s;
 	    break;
@@ -139,12 +215,12 @@ uleb128(char **p)
 }
 
 static long
-sleb128(char **p)
+sleb128(const char **p)
 {
     long r = 0;
     int s = 0;
     for (;;) {
-	unsigned char b = *(unsigned char *)(*p)++;
+	unsigned char b = (unsigned char)*(*p)++;
 	if (b < 0x80) {
 	    if (b & 0x40) {
 		r -= (0x80 - b) << s;
@@ -161,7 +237,7 @@ sleb128(char **p)
 }
 
 static const char *
-get_nth_dirname(unsigned long dir, char *p)
+get_nth_dirname(unsigned long dir, const char *p)
 {
     if (!dir--) {
 	return "";
@@ -178,137 +254,191 @@ get_nth_dirname(unsigned long dir, char *p)
     return p;
 }
 
+static const char *parse_ver5_debug_line_header(const char *p, int idx, uint8_t format, obj_info_t *obj, const char **out_path, uint64_t *out_directory_index);
+
 static void
-fill_filename(int file, char *include_directories, char *filenames,
-	      line_info_t *line)
+fill_filename(int file, uint8_t format, uint16_t version, const char *include_directories, const char *filenames, line_info_t *line, obj_info_t *obj)
 {
     int i;
-    char *p = filenames;
-    char *filename;
+    const char *p = filenames;
+    const char *filename;
     unsigned long dir;
-    for (i = 1; i <= file; i++) {
-	filename = p;
-	if (!*p) {
-	    /* Need to output binary file name? */
-	    kprintf("Unexpected file number %d in %s\n",
-		    file, binary_filename);
-	    return;
-	}
-	while (*p) p++;
-	p++;
-	dir = uleb128(&p);
-	/* last modified. */
-	uleb128(&p);
-	/* size of the file. */
-	uleb128(&p);
-
-	if (i == file) {
-	    line->filename = filename;
-	    line->dirname = get_nth_dirname(dir, include_directories);
-	}
+    if (version >= 5) {
+        const char *path;
+        uint64_t directory_index = -1;
+        parse_ver5_debug_line_header(filenames, file, format, obj, &path, &directory_index);
+        line->filename = path;
+        parse_ver5_debug_line_header(include_directories, (int)directory_index, format, obj, &path, NULL);
+        line->dirname = path;
+    }
+    else {
+        for (i = 1; i <= file; i++) {
+            filename = p;
+            if (!*p) {
+                /* Need to output binary file name? */
+                kprintf("Unexpected file number %d in %s at %tx\n",
+                        file, binary_filename, filenames - obj->mapped);
+                return;
+            }
+            while (*p) p++;
+            p++;
+            dir = uleb128(&p);
+            /* last modified. */
+            uleb128(&p);
+            /* size of the file. */
+            uleb128(&p);
+
+            if (i == file) {
+                line->filename = filename;
+                line->dirname = get_nth_dirname(dir, include_directories);
+            }
+        }
     }
 }
 
 static void
 fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
-	  char *include_directories, char *filenames,
+	  uint8_t format, uint16_t version, const char *include_directories, const char *filenames,
 	  obj_info_t *obj, line_info_t *lines, int offset)
 {
     int i;
-    addr += obj->base_addr;
+    addr += obj->base_addr - obj->vmaddr;
     for (i = offset; i < num_traces; i++) {
 	uintptr_t a = (uintptr_t)traces[i];
 	/* We assume one line code doesn't result >100 bytes of native code.
        We may want more reliable way eventually... */
 	if (addr < a && a < addr + 100) {
-	    fill_filename(file, include_directories, filenames, &lines[i]);
+	    fill_filename(file, format, version, include_directories, filenames, &lines[i], obj);
 	    lines[i].line = line;
 	}
     }
 }
 
-static void
-parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
-		obj_info_t *obj, line_info_t *lines, int offset)
+struct LineNumberProgramHeader {
+    uint64_t unit_length;
+    uint16_t version;
+    uint8_t format; /* 4 or 8 */
+    uint64_t header_length;
+    uint8_t minimum_instruction_length;
+    uint8_t maximum_operations_per_instruction;
+    uint8_t default_is_stmt;
+    int8_t line_base;
+    uint8_t line_range;
+    uint8_t opcode_base;
+    /* uint8_t standard_opcode_lengths[opcode_base-1]; */
+    const char *include_directories;
+    const char *filenames;
+    const char *cu_start;
+    const char *cu_end;
+};
+
+static int
+parse_debug_line_header(obj_info_t *obj, const char **pp, struct LineNumberProgramHeader *header)
 {
-    char *p, *cu_end, *cu_start, *include_directories, *filenames;
-    unsigned long unit_length;
-    int default_is_stmt, line_base;
-    unsigned int header_length, minimum_instruction_length, line_range,
-		 opcode_base;
-    /* unsigned char *standard_opcode_lengths; */
+    const char *p = *pp;
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+	header->unit_length = *(uint64_t *)p;
+	p += sizeof(uint64_t);
+        header->format = 8;
+    }
 
-    /* The registers. */
-    unsigned long addr = 0;
-    unsigned int file = 1;
-    unsigned int line = 1;
-    /* unsigned int column = 0; */
-    int is_stmt;
-    /* int basic_block = 0; */
-    /* int end_sequence = 0; */
-    /* int prologue_end = 0; */
-    /* int epilogue_begin = 0; */
-    /* unsigned int isa = 0; */
+    header->cu_end = p + header->unit_length;
 
-    p = *debug_line;
+    header->version = *(uint16_t *)p;
+    p += sizeof(uint16_t);
+    if (header->version > 5) return -1;
 
-    unit_length = *(unsigned int *)p;
-    p += sizeof(unsigned int);
-    if (unit_length == 0xffffffff) {
-	unit_length = *(unsigned long *)p;
-	p += sizeof(unsigned long);
+    if (header->version >= 5) {
+        /* address_size = *(uint8_t *)p++; */
+        /* segment_selector_size = *(uint8_t *)p++; */
+        p += 2;
     }
 
-    cu_end = p + unit_length;
-
-    /*dwarf_version = *(unsigned short *)p;*/
-    p += 2;
+    header->header_length = header->format == 4 ? *(uint32_t *)p : *(uint64_t *)p;
+    p += header->format;
+    header->cu_start = p + header->header_length;
 
-    header_length = *(unsigned int *)p;
-    p += sizeof(unsigned int);
+    header->minimum_instruction_length = *(uint8_t *)p++;
 
-    cu_start = p + header_length;
-
-    minimum_instruction_length = *(unsigned char *)p;
-    p++;
+    if (header->version >= 4) {
+        /* maximum_operations_per_instruction = *(uint8_t *)p; */
+        if (*p != 1) return -1; /* For non-VLIW architectures, this field is 1 */
+        p++;
+    }
 
-    is_stmt = default_is_stmt = *(unsigned char *)p;
-    p++;
+    header->default_is_stmt = *(uint8_t *)p++;
+    header->line_base = *(int8_t *)p++;
+    header->line_range = *(uint8_t *)p++;
+    header->opcode_base = *(uint8_t *)p++;
+    /* header->standard_opcode_lengths = (uint8_t *)p - 1; */
+    p += header->opcode_base - 1;
+
+    if (header->version >= 5) {
+        header->include_directories = p;
+        p = parse_ver5_debug_line_header(p, -1, header->format, obj, NULL, NULL);
+        header->filenames = p;
+    }
+    else {
+        header->include_directories = p;
 
-    line_base = *(signed char *)p;
-    p++;
+        /* temporary measure for compress-debug-sections */
+        if (p >= header->cu_end) return -1;
 
-    line_range = *(unsigned char *)p;
-    p++;
+        /* skip include directories */
+        while (*p) {
+            p = memchr(p, '\0', header->cu_end - p);
+            if (!p) return -1;
+            p++;
+        }
+        p++;
 
-    opcode_base = *(unsigned char *)p;
-    p++;
+        header->filenames = p;
+    }
 
-    /* standard_opcode_lengths = (unsigned char *)p - 1; */
-    p += opcode_base - 1;
+    *pp = header->cu_start;
 
-    include_directories = p;
+    return 0;
+}
 
-    /* skip include directories */
-    while (*p) {
-	while (*p) p++;
-	p++;
-    }
-    p++;
+static int
+parse_debug_line_cu(int num_traces, void **traces, const char **debug_line,
+		obj_info_t *obj, line_info_t *lines, int offset)
+{
+    const char *p = (const char *)*debug_line;
+    struct LineNumberProgramHeader header;
 
-    filenames = p;
+    /* The registers. */
+    unsigned long addr = 0;
+    unsigned int file = 1;
+    unsigned int line = 1;
+    /* unsigned int column = 0; */
+    int is_stmt;
+    /* int basic_block = 0; */
+    /* int end_sequence = 0; */
+    /* int prologue_end = 0; */
+    /* int epilogue_begin = 0; */
+    /* unsigned int isa = 0; */
 
-    p = cu_start;
+    if (parse_debug_line_header(obj, &p, &header))
+        return -1;
+    is_stmt = header.default_is_stmt;
 
 #define FILL_LINE()						    \
     do {							    \
 	fill_line(num_traces, traces, addr, file, line,		    \
-		  include_directories, filenames,		    \
+                  header.format,                                    \
+                  header.version,                                   \
+                  header.include_directories,                       \
+                  header.filenames,                                 \
 		  obj, lines, offset);				    \
 	/*basic_block = prologue_end = epilogue_begin = 0;*/	    \
     } while (0)
 
-    while (p < cu_end) {
+    while (p < header.cu_end) {
 	unsigned long a;
 	unsigned char op = *p++;
 	switch (op) {
@@ -316,7 +446,7 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
 	    FILL_LINE();
 	    break;
 	case DW_LNS_advance_pc:
-	    a = uleb128(&p);
+	    a = uleb128(&p) * header.minimum_instruction_length;
 	    addr += a;
 	    break;
 	case DW_LNS_advance_line: {
@@ -337,12 +467,13 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
 	    /*basic_block = 1; */
 	    break;
 	case DW_LNS_const_add_pc:
-	    a = ((255 - opcode_base) / line_range) *
-		minimum_instruction_length;
+	    a = ((255UL - header.opcode_base) / header.line_range) *
+		header.minimum_instruction_length;
 	    addr += a;
 	    break;
 	case DW_LNS_fixed_advance_pc:
-	    a = *(unsigned char *)p++;
+	    a = *(uint16_t *)p;
+	    p += sizeof(uint16_t);
 	    addr += a;
 	    break;
 	case DW_LNS_set_prologue_end:
@@ -355,7 +486,7 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
 	    /* isa = (unsigned int)*/(void)uleb128(&p);
 	    break;
 	case 0:
-	    a = *(unsigned char *)p++;
+	    a = uleb128(&p);
 	    op = *p++;
 	    switch (op) {
 	    case DW_LNE_end_sequence:
@@ -365,7 +496,7 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
 		file = 1;
 		line = 1;
 		/* column = 0; */
-		is_stmt = default_is_stmt;
+		is_stmt = header.default_is_stmt;
 		/* end_sequence = 0; */
 		/* isa = 0; */
 		break;
@@ -387,33 +518,34 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
 	    }
 	    break;
 	default: {
-	    unsigned long addr_incr;
-	    unsigned long line_incr;
-	    a = op - opcode_base;
-	    addr_incr = (a / line_range) * minimum_instruction_length;
-	    line_incr = line_base + (a % line_range);
-	    addr += (unsigned int)addr_incr;
-	    line += (unsigned int)line_incr;
+            uint8_t adjusted_opcode = op - header.opcode_base;
+            uint8_t operation_advance = adjusted_opcode / header.line_range;
+            /* NOTE: this code doesn't support VLIW */
+            addr += operation_advance * header.minimum_instruction_length;
+            line += header.line_base + (adjusted_opcode % header.line_range);
 	    FILL_LINE();
 	}
 	}
     }
-    *debug_line = p;
+    *debug_line = (char *)p;
+    return 0;
 }
 
-static void
+static int
 parse_debug_line(int num_traces, void **traces,
-		 char *debug_line, unsigned long size,
+		 const char *debug_line, unsigned long size,
 		 obj_info_t *obj, line_info_t *lines, int offset)
 {
-    char *debug_line_end = debug_line + size;
+    const char *debug_line_end = debug_line + size;
     while (debug_line < debug_line_end) {
-	parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset);
+	if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset))
+	    return -1;
     }
     if (debug_line != debug_line_end) {
 	kprintf("Unexpected size of .debug_line in %s\n",
 		binary_filename);
     }
+    return 0;
 }
 
 /* read file and fill lines */
@@ -422,22 +554,38 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
 	   obj_info_t **objp, line_info_t *lines, int offset);
 
 static void
-append_obj(obj_info_t **objp) {
+append_obj(obj_info_t **objp)
+{
     obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
     if (*objp) (*objp)->next = newobj;
     *objp = newobj;
 }
 
+#ifdef USE_ELF
+/* Ideally we should check 4 paths to follow gnu_debuglink:
+ *
+ *   - /usr/lib/debug/.build-id/ab/cdef1234.debug
+ *   - /usr/bin/ruby.debug
+ *   - /usr/bin/.debug/ruby.debug
+ *   - /usr/lib/debug/usr/bin/ruby.debug.
+ *
+ * but we handle only two cases for now as the two formats are
+ * used by some linux distributions.
+ *
+ * See GDB's info for detail.
+ * https://sourceware.org/gdb/onlinedocs/gdb/Separate-Debug-Files.html
+ */
+
+// check the path pattern of "/usr/lib/debug/usr/bin/ruby.debug"
 static void
-follow_debuglink(char *debuglink, int num_traces, void **traces,
+follow_debuglink(const char *debuglink, int num_traces, void **traces,
 		 obj_info_t **objp, line_info_t *lines, int offset)
 {
-    /* Ideally we should check 4 paths to follow gnu_debuglink,
-       but we handle only one case for now as this format is used
-       by some linux distributions. See GDB's info for detail. */
     static const char global_debug_dir[] = "/usr/lib/debug";
-    char *p, *subdir;
+    const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+    char *p;
     obj_info_t *o1 = *objp, *o2;
+    size_t len;
 
     p = strrchr(binary_filename, '/');
     if (!p) {
@@ -445,11 +593,44 @@ follow_debuglink(char *debuglink, int num_traces, void **traces,
     }
     p[1] = '\0';
 
-    subdir = (char *)alloca(strlen(binary_filename) + 1);
-    strcpy(subdir, binary_filename);
-    strcpy(binary_filename, global_debug_dir);
-    strlcat(binary_filename, subdir, PATH_MAX);
-    strlcat(binary_filename, debuglink, PATH_MAX);
+    len = strlen(binary_filename);
+    if (len >= PATH_MAX - global_debug_dir_len)
+	len = PATH_MAX - global_debug_dir_len - 1;
+    memmove(binary_filename + global_debug_dir_len, binary_filename, len);
+    memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+    len += global_debug_dir_len;
+    strlcpy(binary_filename + len, debuglink, PATH_MAX - len);
+
+    append_obj(objp);
+    o2 = *objp;
+    o2->base_addr = o1->base_addr;
+    o2->path = o1->path;
+    fill_lines(num_traces, traces, 0, objp, lines, offset);
+}
+
+// check the path pattern of "/usr/lib/debug/.build-id/ab/cdef1234.debug"
+static void
+follow_debuglink_build_id(const char *build_id, size_t build_id_size, int num_traces, void **traces,
+                          obj_info_t **objp, line_info_t *lines, int offset)
+{
+    static const char global_debug_dir[] = "/usr/lib/debug/.build-id/";
+    const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+    char *p;
+    obj_info_t *o1 = *objp, *o2;
+    size_t i;
+
+    if (PATH_MAX < global_debug_dir_len + 1 + build_id_size * 2 + 6) return;
+
+    memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+    p = binary_filename + global_debug_dir_len;
+    for (i = 0; i < build_id_size; i++) {
+        static const char tbl[] = "0123456789abcdef";
+        unsigned char n = build_id[i];
+        *p++ = tbl[n / 16];
+        *p++ = tbl[n % 16];
+        if (i == 0) *p++ = '/';
+    }
+    strcpy(p, ".debug");
 
     append_obj(objp);
     o2 = *objp;
@@ -457,6 +638,1367 @@ follow_debuglink(char *debuglink, int num_traces, void **traces,
     o2->path = o1->path;
     fill_lines(num_traces, traces, 0, objp, lines, offset);
 }
+#endif
+
+enum
+{
+    DW_TAG_compile_unit = 0x11,
+    DW_TAG_inlined_subroutine = 0x1d,
+    DW_TAG_subprogram = 0x2e,
+};
+
+/* Attributes encodings */
+enum
+{
+    DW_AT_sibling = 0x01,
+    DW_AT_location = 0x02,
+    DW_AT_name = 0x03,
+    /* Reserved 0x04 */
+    /* Reserved 0x05 */
+    /* Reserved 0x06 */
+    /* Reserved 0x07 */
+    /* Reserved 0x08 */
+    DW_AT_ordering = 0x09,
+    /* Reserved 0x0a */
+    DW_AT_byte_size = 0x0b,
+    /* Reserved 0x0c */
+    DW_AT_bit_size = 0x0d,
+    /* Reserved 0x0e */
+    /* Reserved 0x0f */
+    DW_AT_stmt_list = 0x10,
+    DW_AT_low_pc = 0x11,
+    DW_AT_high_pc = 0x12,
+    DW_AT_language = 0x13,
+    /* Reserved 0x14 */
+    DW_AT_discr = 0x15,
+    DW_AT_discr_value = 0x16,
+    DW_AT_visibility = 0x17,
+    DW_AT_import = 0x18,
+    DW_AT_string_length = 0x19,
+    DW_AT_common_reference = 0x1a,
+    DW_AT_comp_dir = 0x1b,
+    DW_AT_const_value = 0x1c,
+    DW_AT_containing_type = 0x1d,
+    DW_AT_default_value = 0x1e,
+    /* Reserved 0x1f */
+    DW_AT_inline = 0x20,
+    DW_AT_is_optional = 0x21,
+    DW_AT_lower_bound = 0x22,
+    /* Reserved 0x23 */
+    /* Reserved 0x24 */
+    DW_AT_producer = 0x25,
+    /* Reserved 0x26 */
+    DW_AT_prototyped = 0x27,
+    /* Reserved 0x28 */
+    /* Reserved 0x29 */
+    DW_AT_return_addr = 0x2a,
+    /* Reserved 0x2b */
+    DW_AT_start_scope = 0x2c,
+    /* Reserved 0x2d */
+    DW_AT_bit_stride = 0x2e,
+    DW_AT_upper_bound = 0x2f,
+    /* Reserved 0x30 */
+    DW_AT_abstract_origin = 0x31,
+    DW_AT_accessibility = 0x32,
+    DW_AT_address_class = 0x33,
+    DW_AT_artificial = 0x34,
+    DW_AT_base_types = 0x35,
+    DW_AT_calling_convention = 0x36,
+    DW_AT_count = 0x37,
+    DW_AT_data_member_location = 0x38,
+    DW_AT_decl_column = 0x39,
+    DW_AT_decl_file = 0x3a,
+    DW_AT_decl_line = 0x3b,
+    DW_AT_declaration = 0x3c,
+    DW_AT_discr_list = 0x3d,
+    DW_AT_encoding = 0x3e,
+    DW_AT_external = 0x3f,
+    DW_AT_frame_base = 0x40,
+    DW_AT_friend = 0x41,
+    DW_AT_identifier_case = 0x42,
+    /* Reserved 0x43 */
+    DW_AT_namelist_item = 0x44,
+    DW_AT_priority = 0x45,
+    DW_AT_segment = 0x46,
+    DW_AT_specification = 0x47,
+    DW_AT_static_link = 0x48,
+    DW_AT_type = 0x49,
+    DW_AT_use_location = 0x4a,
+    DW_AT_variable_parameter = 0x4b,
+    DW_AT_virtuality = 0x4c,
+    DW_AT_vtable_elem_location = 0x4d,
+    DW_AT_allocated = 0x4e,
+    DW_AT_associated = 0x4f,
+    DW_AT_data_location = 0x50,
+    DW_AT_byte_stride = 0x51,
+    DW_AT_entry_pc = 0x52,
+    DW_AT_use_UTF8 = 0x53,
+    DW_AT_extension = 0x54,
+    DW_AT_ranges = 0x55,
+    DW_AT_trampoline = 0x56,
+    DW_AT_call_column = 0x57,
+    DW_AT_call_file = 0x58,
+    DW_AT_call_line = 0x59,
+    DW_AT_description = 0x5a,
+    DW_AT_binary_scale = 0x5b,
+    DW_AT_decimal_scale = 0x5c,
+    DW_AT_small = 0x5d,
+    DW_AT_decimal_sign = 0x5e,
+    DW_AT_digit_count = 0x5f,
+    DW_AT_picture_string = 0x60,
+    DW_AT_mutable = 0x61,
+    DW_AT_threads_scaled = 0x62,
+    DW_AT_explicit = 0x63,
+    DW_AT_object_pointer = 0x64,
+    DW_AT_endianity = 0x65,
+    DW_AT_elemental = 0x66,
+    DW_AT_pure = 0x67,
+    DW_AT_recursive = 0x68,
+    DW_AT_signature = 0x69,
+    DW_AT_main_subprogram = 0x6a,
+    DW_AT_data_bit_offset = 0x6b,
+    DW_AT_const_expr = 0x6c,
+    DW_AT_enum_class = 0x6d,
+    DW_AT_linkage_name = 0x6e,
+    DW_AT_string_length_bit_size = 0x6f,
+    DW_AT_string_length_byte_size = 0x70,
+    DW_AT_rank = 0x71,
+    DW_AT_str_offsets_base = 0x72,
+    DW_AT_addr_base = 0x73,
+    DW_AT_rnglists_base = 0x74,
+    /* Reserved 0x75 */
+    DW_AT_dwo_name = 0x76,
+    DW_AT_reference = 0x77,
+    DW_AT_rvalue_reference = 0x78,
+    DW_AT_macros = 0x79,
+    DW_AT_call_all_calls = 0x7a,
+    DW_AT_call_all_source_calls = 0x7b,
+    DW_AT_call_all_tail_calls = 0x7c,
+    DW_AT_call_return_pc = 0x7d,
+    DW_AT_call_value = 0x7e,
+    DW_AT_call_origin = 0x7f,
+    DW_AT_call_parameter = 0x80,
+    DW_AT_call_pc = 0x81,
+    DW_AT_call_tail_call = 0x82,
+    DW_AT_call_target = 0x83,
+    DW_AT_call_target_clobbered = 0x84,
+    DW_AT_call_data_location = 0x85,
+    DW_AT_call_data_value = 0x86,
+    DW_AT_noreturn = 0x87,
+    DW_AT_alignment = 0x88,
+    DW_AT_export_symbols = 0x89,
+    DW_AT_deleted = 0x8a,
+    DW_AT_defaulted = 0x8b,
+    DW_AT_loclists_base = 0x8c,
+    DW_AT_lo_user = 0x2000,
+    DW_AT_hi_user = 0x3fff
+};
+
+/* Attribute form encodings */
+enum
+{
+    DW_FORM_addr = 0x01,
+    /* Reserved 0x02 */
+    DW_FORM_block2 = 0x03,
+    DW_FORM_block4 = 0x04,
+    DW_FORM_data2 = 0x05,
+    DW_FORM_data4 = 0x06,
+    DW_FORM_data8 = 0x07,
+    DW_FORM_string = 0x08,
+    DW_FORM_block = 0x09,
+    DW_FORM_block1 = 0x0a,
+    DW_FORM_data1 = 0x0b,
+    DW_FORM_flag = 0x0c,
+    DW_FORM_sdata = 0x0d,
+    DW_FORM_strp = 0x0e,
+    DW_FORM_udata = 0x0f,
+    DW_FORM_ref_addr = 0x10,
+    DW_FORM_ref1 = 0x11,
+    DW_FORM_ref2 = 0x12,
+    DW_FORM_ref4 = 0x13,
+    DW_FORM_ref8 = 0x14,
+    DW_FORM_ref_udata = 0x15,
+    DW_FORM_indirect = 0x16,
+    DW_FORM_sec_offset = 0x17,
+    DW_FORM_exprloc = 0x18,
+    DW_FORM_flag_present = 0x19,
+    DW_FORM_strx = 0x1a,
+    DW_FORM_addrx = 0x1b,
+    DW_FORM_ref_sup4 = 0x1c,
+    DW_FORM_strp_sup = 0x1d,
+    DW_FORM_data16 = 0x1e,
+    DW_FORM_line_strp = 0x1f,
+    DW_FORM_ref_sig8 = 0x20,
+    DW_FORM_implicit_const = 0x21,
+    DW_FORM_loclistx = 0x22,
+    DW_FORM_rnglistx = 0x23,
+    DW_FORM_ref_sup8 = 0x24,
+    DW_FORM_strx1 = 0x25,
+    DW_FORM_strx2 = 0x26,
+    DW_FORM_strx3 = 0x27,
+    DW_FORM_strx4 = 0x28,
+    DW_FORM_addrx1 = 0x29,
+    DW_FORM_addrx2 = 0x2a,
+    DW_FORM_addrx3 = 0x2b,
+    DW_FORM_addrx4 = 0x2c
+};
+
+/* Range list entry encodings */
+enum {
+    DW_RLE_end_of_list = 0x00,
+    DW_RLE_base_addressx = 0x01,
+    DW_RLE_startx_endx = 0x02,
+    DW_RLE_startx_length = 0x03,
+    DW_RLE_offset_pair = 0x04,
+    DW_RLE_base_address = 0x05,
+    DW_RLE_start_end = 0x06,
+    DW_RLE_start_length = 0x07
+};
+
+enum {
+    VAL_none = 0,
+    VAL_cstr = 1,
+    VAL_data = 2,
+    VAL_uint = 3,
+    VAL_int = 4,
+    VAL_addr = 5
+};
+
+# define ABBREV_TABLE_SIZE 256
+typedef struct {
+    obj_info_t *obj;
+    const char *file;
+    uint8_t current_version;
+    const char *current_cu;
+    uint64_t current_low_pc;
+    uint64_t current_str_offsets_base;
+    uint64_t current_addr_base;
+    uint64_t current_rnglists_base;
+    const char *debug_line_cu_end;
+    uint8_t debug_line_format;
+    uint16_t debug_line_version;
+    const char *debug_line_files;
+    const char *debug_line_directories;
+    const char *p;
+    const char *cu_end;
+    const char *pend;
+    const char *q0;
+    const char *q;
+    int format; // 4 or 8
+    uint8_t address_size;
+    int level;
+    const char *abbrev_table[ABBREV_TABLE_SIZE];
+} DebugInfoReader;
+
+typedef struct {
+    ptrdiff_t pos;
+    int tag;
+    int has_children;
+} DIE;
+
+typedef struct {
+    union {
+        const char *ptr;
+        uint64_t uint64;
+        int64_t int64;
+        uint64_t addr_idx;
+    } as;
+    uint64_t off;
+    uint64_t at;
+    uint64_t form;
+    size_t size;
+    int type;
+} DebugInfoValue;
+
+#if defined(WORDS_BIGENDIAN)
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(a)<<sz)|(b))
+#else
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(b)<<sz)|(a))
+#endif
+
+static uint16_t
+get_uint16(const uint8_t *p)
+{
+    return (uint16_t)MERGE_2INTS(p[0],p[1],8);
+}
+
+static uint32_t
+get_uint32(const uint8_t *p)
+{
+    return (uint32_t)MERGE_2INTS(get_uint16(p),get_uint16(p+2),16);
+}
+
+static uint64_t
+get_uint64(const uint8_t *p)
+{
+    return MERGE_2INTS(get_uint32(p),get_uint32(p+4),32);
+}
+
+static uint8_t
+read_uint8(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 1);
+    return (uint8_t)*p;
+}
+
+static uint16_t
+read_uint16(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 2);
+    return get_uint16((const uint8_t *)p);
+}
+
+static uint32_t
+read_uint24(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 3);
+    return ((uint8_t)*p << 16) | get_uint16((const uint8_t *)p+1);
+}
+
+static uint32_t
+read_uint32(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 4);
+    return get_uint32((const uint8_t *)p);
+}
+
+static uint64_t
+read_uint64(const char **ptr)
+{
+    const unsigned char *p = (const unsigned char *)*ptr;
+    *ptr = (char *)(p + 8);
+    return get_uint64(p);
+}
+
+static uintptr_t
+read_uintptr(const char **ptr)
+{
+    const unsigned char *p = (const unsigned char *)*ptr;
+    *ptr = (char *)(p + SIZEOF_VOIDP);
+#if SIZEOF_VOIDP == 8
+    return get_uint64(p);
+#else
+    return get_uint32(p);
+#endif
+}
+
+static uint64_t
+read_uint(DebugInfoReader *reader)
+{
+    if (reader->format == 4) {
+        return read_uint32(&reader->p);
+    } else { /* 64 bit */
+        return read_uint64(&reader->p);
+    }
+}
+
+static uint64_t
+read_uleb128(DebugInfoReader *reader)
+{
+    return uleb128(&reader->p);
+}
+
+static int64_t
+read_sleb128(DebugInfoReader *reader)
+{
+    return sleb128(&reader->p);
+}
+
+static void
+debug_info_reader_init(DebugInfoReader *reader, obj_info_t *obj)
+{
+    reader->file = obj->mapped;
+    reader->obj = obj;
+    reader->p = obj->debug_info.ptr;
+    reader->pend = obj->debug_info.ptr + obj->debug_info.size;
+    reader->debug_line_cu_end = obj->debug_line.ptr;
+    reader->current_low_pc = 0;
+    reader->current_str_offsets_base = 0;
+    reader->current_addr_base = 0;
+    reader->current_rnglists_base = 0;
+}
+
+static void
+di_skip_die_attributes(const char **p)
+{
+    for (;;) {
+        uint64_t at = uleb128(p);
+        uint64_t form = uleb128(p);
+        if (!at && !form) break;
+        switch (form) {
+          default:
+            break;
+          case DW_FORM_implicit_const:
+            sleb128(p);
+            break;
+        }
+    }
+}
+
+static void
+di_read_debug_abbrev_cu(DebugInfoReader *reader)
+{
+    uint64_t prev = 0;
+    const char *p = reader->q0;
+    for (;;) {
+        uint64_t abbrev_number = uleb128(&p);
+        if (abbrev_number <= prev) break;
+        if (abbrev_number < ABBREV_TABLE_SIZE) {
+            reader->abbrev_table[abbrev_number] = p;
+        }
+        prev = abbrev_number;
+        uleb128(&p); /* tag */
+        p++; /* has_children */
+        di_skip_die_attributes(&p);
+    }
+}
+
+static int
+di_read_debug_line_cu(DebugInfoReader *reader)
+{
+    const char *p;
+    struct LineNumberProgramHeader header;
+
+    p = (const char *)reader->debug_line_cu_end;
+    if (parse_debug_line_header(reader->obj, &p, &header))
+        return -1;
+
+    reader->debug_line_cu_end = (char *)header.cu_end;
+    reader->debug_line_format = header.format;
+    reader->debug_line_version = header.version;
+    reader->debug_line_directories = (char *)header.include_directories;
+    reader->debug_line_files = (char *)header.filenames;
+
+    return 0;
+}
+
+static void
+set_addr_idx_value(DebugInfoValue *v, uint64_t n)
+{
+    v->as.addr_idx = n;
+    v->type = VAL_addr;
+}
+
+static void
+set_uint_value(DebugInfoValue *v, uint64_t n)
+{
+    v->as.uint64 = n;
+    v->type = VAL_uint;
+}
+
+static void
+set_int_value(DebugInfoValue *v, int64_t n)
+{
+    v->as.int64 = n;
+    v->type = VAL_int;
+}
+
+static void
+set_cstr_value(DebugInfoValue *v, const char *s)
+{
+    v->as.ptr = s;
+    v->off = 0;
+    v->type = VAL_cstr;
+}
+
+static void
+set_cstrp_value(DebugInfoValue *v, const char *s, uint64_t off)
+{
+    v->as.ptr = s;
+    v->off = off;
+    v->type = VAL_cstr;
+}
+
+static void
+set_data_value(DebugInfoValue *v, const char *s)
+{
+    v->as.ptr = s;
+    v->type = VAL_data;
+}
+
+static const char *
+get_cstr_value(DebugInfoValue *v)
+{
+    if (v->as.ptr) {
+        return v->as.ptr + v->off;
+    } else {
+        return NULL;
+    }
+}
+
+static const char *
+resolve_strx(DebugInfoReader *reader, uint64_t idx)
+{
+    const char *p = reader->obj->debug_str_offsets.ptr + reader->current_str_offsets_base;
+    uint64_t off;
+    if (reader->format == 4) {
+        off = ((uint32_t *)p)[idx];
+    }
+    else {
+        off = ((uint64_t *)p)[idx];
+    }
+    return reader->obj->debug_str.ptr + off;
+}
+
+static void
+debug_info_reader_read_addr_value(DebugInfoReader *reader, DebugInfoValue *v)
+{
+    if (reader->address_size == 4) {
+        set_uint_value(v, read_uint32(&reader->p));
+    } else if (reader->address_size == 8) {
+        set_uint_value(v, read_uint64(&reader->p));
+    } else {
+        fprintf(stderr,"unknown address_size:%d", reader->address_size);
+        abort();
+    }
+}
+
+static void
+debug_info_reader_read_value(DebugInfoReader *reader, uint64_t form, DebugInfoValue *v)
+{
+    switch (form) {
+      case DW_FORM_addr:
+        debug_info_reader_read_addr_value(reader, v);
+        break;
+      case DW_FORM_block2:
+        v->size = read_uint16(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_block4:
+        v->size = read_uint32(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_data2:
+        set_uint_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_data4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_data8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_string:
+        v->size = strlen(reader->p);
+        set_cstr_value(v, reader->p);
+        reader->p += v->size + 1;
+        break;
+      case DW_FORM_block:
+        v->size = uleb128(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_block1:
+        v->size = read_uint8(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_data1:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_flag:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_sdata:
+        set_int_value(v, read_sleb128(reader));
+        break;
+      case DW_FORM_strp:
+        set_cstrp_value(v, reader->obj->debug_str.ptr, read_uint(reader));
+        break;
+      case DW_FORM_udata:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_ref_addr:
+        if (reader->current_version <= 2) {
+            // DWARF Version 2 specifies that references have
+            // the same size as an address on the target system
+            debug_info_reader_read_addr_value(reader, v);
+        } else {
+            if (reader->format == 4) {
+                set_uint_value(v, read_uint32(&reader->p));
+            } else if (reader->format == 8) {
+                set_uint_value(v, read_uint64(&reader->p));
+            } else {
+                fprintf(stderr,"unknown format:%d", reader->format);
+                abort();
+            }
+        }
+        break;
+      case DW_FORM_ref1:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_ref2:
+        set_uint_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_ref4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_ref8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_ref_udata:
+        set_uint_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_indirect:
+        /* TODO: read the referred value */
+        set_uint_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_sec_offset:
+        set_uint_value(v, read_uint(reader)); /* offset */
+        /* addrptr: debug_addr */
+        /* lineptr: debug_line */
+        /* loclist: debug_loclists */
+        /* loclistptr: debug_loclists */
+        /* macptr: debug_macro */
+        /* rnglist: debug_rnglists */
+        /* rnglistptr: debug_rnglists */
+        /* stroffsetsptr: debug_str_offsets */
+        break;
+      case DW_FORM_exprloc:
+        v->size = (size_t)read_uleb128(reader);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_flag_present:
+        set_uint_value(v, 1);
+        break;
+      case DW_FORM_strx:
+        set_cstr_value(v, resolve_strx(reader, uleb128(&reader->p)));
+        break;
+      case DW_FORM_addrx:
+        set_addr_idx_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_ref_sup4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_strp_sup:
+        set_uint_value(v, read_uint(reader));
+        /* *p = reader->sup_file + reader->sup_str->sh_offset + ret; */
+        break;
+      case DW_FORM_data16:
+        v->size = 16;
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_line_strp:
+        set_cstrp_value(v, reader->obj->debug_line_str.ptr, read_uint(reader));
+        break;
+      case DW_FORM_ref_sig8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_implicit_const:
+        set_int_value(v, sleb128(&reader->q));
+        break;
+      case DW_FORM_loclistx:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_rnglistx:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_ref_sup8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_strx1:
+        set_cstr_value(v, resolve_strx(reader, read_uint8(&reader->p)));
+        break;
+      case DW_FORM_strx2:
+        set_cstr_value(v, resolve_strx(reader, read_uint16(&reader->p)));
+        break;
+      case DW_FORM_strx3:
+        set_cstr_value(v, resolve_strx(reader, read_uint24(&reader->p)));
+        break;
+      case DW_FORM_strx4:
+        set_cstr_value(v, resolve_strx(reader, read_uint32(&reader->p)));
+        break;
+      case DW_FORM_addrx1:
+        set_addr_idx_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_addrx2:
+        set_addr_idx_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_addrx3:
+        set_addr_idx_value(v, read_uint24(&reader->p));
+        break;
+      case DW_FORM_addrx4:
+        set_addr_idx_value(v, read_uint32(&reader->p));
+        break;
+      case 0:
+        goto fail;
+        break;
+    }
+    return;
+
+  fail:
+    fprintf(stderr, "%d: unsupported form: %#"PRIx64"\n", __LINE__, form);
+    exit(1);
+}
+
+/* find abbrev in current compilation unit */
+static const char *
+di_find_abbrev(DebugInfoReader *reader, uint64_t abbrev_number)
+{
+    const char *p;
+    if (abbrev_number < ABBREV_TABLE_SIZE) {
+        return reader->abbrev_table[abbrev_number];
+    }
+    p = reader->abbrev_table[ABBREV_TABLE_SIZE-1];
+    /* skip 255th record */
+    uleb128(&p); /* tag */
+    p++; /* has_children */
+    di_skip_die_attributes(&p);
+    for (uint64_t n = uleb128(&p); abbrev_number != n; n = uleb128(&p)) {
+        if (n == 0) {
+            fprintf(stderr,"%d: Abbrev Number %"PRId64" not found\n",__LINE__, abbrev_number);
+            exit(1);
+        }
+        uleb128(&p); /* tag */
+        p++; /* has_children */
+        di_skip_die_attributes(&p);
+    }
+    return p;
+}
+
+#if 0
+static void
+hexdump0(const unsigned char *p, size_t n)
+{
+    size_t i;
+    fprintf(stderr, "     0  1  2  3  4  5  6  7  8  9  A  B  C  D  E  F\n");
+    for (i=0; i < n; i++){
+        switch (i & 15) {
+          case 0:
+            fprintf(stderr, "%02" PRIdSIZE ": %02X ", i/16, p[i]);
+            break;
+          case 15:
+            fprintf(stderr, "%02X\n", p[i]);
+            break;
+          default:
+            fprintf(stderr, "%02X ", p[i]);
+            break;
+        }
+    }
+    if ((i & 15) != 15) {
+        fprintf(stderr, "\n");
+    }
+}
+#define hexdump(p,n) hexdump0((const unsigned char *)p, n)
+
+static void
+div_inspect(DebugInfoValue *v)
+{
+    switch (v->type) {
+      case VAL_uint:
+        fprintf(stderr,"%d: type:%d size:%" PRIxSIZE " v:%"PRIx64"\n",__LINE__,v->type,v->size,v->as.uint64);
+        break;
+      case VAL_int:
+        fprintf(stderr,"%d: type:%d size:%" PRIxSIZE " v:%"PRId64"\n",__LINE__,v->type,v->size,(int64_t)v->as.uint64);
+        break;
+      case VAL_cstr:
+        fprintf(stderr,"%d: type:%d size:%" PRIxSIZE " v:'%s'\n",__LINE__,v->type,v->size,v->as.ptr);
+        break;
+      case VAL_data:
+        fprintf(stderr,"%d: type:%d size:%" PRIxSIZE " v:\n",__LINE__,v->type,v->size);
+        hexdump(v->as.ptr, 16);
+        break;
+    }
+}
+#endif
+
+static DIE *
+di_read_die(DebugInfoReader *reader, DIE *die)
+{
+    uint64_t abbrev_number = uleb128(&reader->p);
+    if (abbrev_number == 0) {
+        reader->level--;
+        return NULL;
+    }
+
+    reader->q = di_find_abbrev(reader, abbrev_number);
+
+    die->pos = reader->p - reader->obj->debug_info.ptr - 1;
+    die->tag = (int)uleb128(&reader->q); /* tag */
+    die->has_children = *reader->q++; /* has_children */
+    if (die->has_children) {
+        reader->level++;
+    }
+    return die;
+}
+
+static DebugInfoValue *
+di_read_record(DebugInfoReader *reader, DebugInfoValue *vp)
+{
+    uint64_t at = uleb128(&reader->q);
+    uint64_t form = uleb128(&reader->q);
+    if (!at || !form) return NULL;
+    vp->at = at;
+    vp->form = form;
+    debug_info_reader_read_value(reader, form, vp);
+    return vp;
+}
+
+static void
+di_skip_records(DebugInfoReader *reader)
+{
+    for (;;) {
+        DebugInfoValue v = {{}};
+        uint64_t at = uleb128(&reader->q);
+        uint64_t form = uleb128(&reader->q);
+        if (!at || !form) return;
+        debug_info_reader_read_value(reader, form, &v);
+    }
+}
+
+typedef struct addr_header {
+    const char *ptr;
+    uint64_t unit_length;
+    uint8_t format;
+    uint8_t address_size;
+    /* uint8_t segment_selector_size; */
+} addr_header_t;
+
+static void
+addr_header_init(obj_info_t *obj, addr_header_t *header) {
+    const char *p = obj->debug_addr.ptr;
+
+    header->ptr = p;
+
+    if (!p) return;
+
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
+    }
+
+    p += 2; /* version */
+    header->address_size = *p++;
+    p++; /* segment_selector_size */
+}
+
+static uint64_t
+read_addr(addr_header_t *header, uint64_t addr_base, uint64_t idx) {
+    if (header->address_size == 4) {
+        return ((uint32_t*)(header->ptr + addr_base))[idx];
+    }
+    else {
+        return ((uint64_t*)(header->ptr + addr_base))[idx];
+    }
+}
+
+typedef struct rnglists_header {
+    uint64_t unit_length;
+    uint8_t format;
+    uint8_t address_size;
+    uint32_t offset_entry_count;
+} rnglists_header_t;
+
+static void
+rnglists_header_init(obj_info_t *obj, rnglists_header_t *header) {
+    const char *p = obj->debug_rnglists.ptr;
+
+    if (!p) return;
+
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
+    }
+
+    p += 2; /* version */
+    header->address_size = *p++;
+    p++; /* segment_selector_size */
+    header->offset_entry_count = *(uint32_t *)p;
+}
+
+typedef struct {
+    uint64_t low_pc;
+    uint64_t high_pc;
+    uint64_t ranges;
+    bool low_pc_set;
+    bool high_pc_set;
+    bool ranges_set;
+} ranges_t;
+
+static void
+ranges_set(ranges_t *ptr, DebugInfoValue *v, addr_header_t *addr_header, uint64_t addr_base)
+{
+    uint64_t n = 0;
+    if (v->type == VAL_uint) {
+        n = v->as.uint64;
+    }
+    else if (v->type == VAL_addr) {
+        n = read_addr(addr_header, addr_base, v->as.addr_idx);
+    }
+    switch (v->at) {
+      case DW_AT_low_pc:
+        ptr->low_pc = n;
+        ptr->low_pc_set = true;
+        break;
+      case DW_AT_high_pc:
+        if (v->form == DW_FORM_addr) {
+            ptr->high_pc = n;
+        }
+        else {
+            ptr->high_pc = ptr->low_pc + n;
+        }
+        ptr->high_pc_set = true;
+        break;
+      case DW_AT_ranges:
+        ptr->ranges = n;
+        ptr->ranges_set = true;
+        break;
+    }
+}
+
+static uint64_t
+read_dw_form_addr(DebugInfoReader *reader, const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = p + reader->address_size;
+    if (reader->address_size == 4) {
+        return read_uint32(&p);
+    } else if (reader->address_size == 8) {
+        return read_uint64(&p);
+    } else {
+        fprintf(stderr,"unknown address_size:%d", reader->address_size);
+        abort();
+    }
+}
+
+static uintptr_t
+ranges_include(DebugInfoReader *reader, ranges_t *ptr, uint64_t addr, rnglists_header_t *rnglists_header)
+{
+    if (ptr->high_pc_set) {
+        if (ptr->ranges_set || !ptr->low_pc_set) {
+            exit(1);
+        }
+        if (ptr->low_pc <= addr && addr <= ptr->high_pc) {
+            return (uintptr_t)ptr->low_pc;
+        }
+    }
+    else if (ptr->ranges_set) {
+        /* TODO: support base address selection entry */
+        const char *p;
+        uint64_t base = ptr->low_pc_set ? ptr->low_pc : reader->current_low_pc;
+        bool base_valid = true;
+        if (reader->current_version >= 5) {
+            if (rnglists_header->offset_entry_count == 0) {
+                // DW_FORM_sec_offset
+                p = reader->obj->debug_rnglists.ptr + ptr->ranges + reader->current_rnglists_base;
+            }
+            else {
+                // DW_FORM_rnglistx
+                const char *offset_array = reader->obj->debug_rnglists.ptr + reader->current_rnglists_base;
+                if (rnglists_header->format == 4) {
+                    p = offset_array + ((uint32_t *)offset_array)[ptr->ranges];
+                }
+                else {
+                    p = offset_array + ((uint64_t *)offset_array)[ptr->ranges];
+                }
+            }
+            for (;;) {
+                uint8_t rle = read_uint8(&p);
+                uintptr_t from = 0, to = 0;
+                if (rle == DW_RLE_end_of_list) break;
+                switch (rle) {
+                  case DW_RLE_base_addressx:
+                    uleb128(&p);
+                    base_valid = false; /* not supported yet */
+                    break;
+                  case DW_RLE_startx_endx:
+                    uleb128(&p);
+                    uleb128(&p);
+                    break;
+                  case DW_RLE_startx_length:
+                    uleb128(&p);
+                    uleb128(&p);
+                    break;
+                  case DW_RLE_offset_pair:
+                    if (!base_valid) break;
+                    from = (uintptr_t)base + uleb128(&p);
+                    to = (uintptr_t)base + uleb128(&p);
+                    break;
+                  case DW_RLE_base_address:
+                    base = read_dw_form_addr(reader, &p);
+                    base_valid = true;
+                    break;
+                  case DW_RLE_start_end:
+                    from = (uintptr_t)read_dw_form_addr(reader, &p);
+                    to = (uintptr_t)read_dw_form_addr(reader, &p);
+                    break;
+                  case DW_RLE_start_length:
+                    from = (uintptr_t)read_dw_form_addr(reader, &p);
+                    to = from + uleb128(&p);
+                    break;
+                }
+                if (from <= addr && addr < to) {
+                    return from;
+                }
+            }
+            return false;
+        }
+        p = reader->obj->debug_ranges.ptr + ptr->ranges;
+        for (;;) {
+            uintptr_t from = read_uintptr(&p);
+            uintptr_t to = read_uintptr(&p);
+            if (!from && !to) break;
+            if (from == UINTPTR_MAX) {
+                /* base address selection entry */
+                base = to;
+            }
+            else if (base + from <= addr && addr < base + to) {
+                return (uintptr_t)base + from;
+            }
+        }
+    }
+    else if (ptr->low_pc_set) {
+        if (ptr->low_pc == addr) {
+            return (uintptr_t)ptr->low_pc;
+        }
+    }
+    return false;
+}
+
+#if 0
+static void
+ranges_inspect(DebugInfoReader *reader, ranges_t *ptr)
+{
+    if (ptr->high_pc_set) {
+        if (ptr->ranges_set || !ptr->low_pc_set) {
+            fprintf(stderr,"low_pc_set:%d high_pc_set:%d ranges_set:%d\n",ptr->low_pc_set,ptr->high_pc_set,ptr->ranges_set);
+            exit(1);
+        }
+        fprintf(stderr,"low_pc:%"PRIx64" high_pc:%"PRIx64"\n",ptr->low_pc,ptr->high_pc);
+    }
+    else if (ptr->ranges_set) {
+        char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
+        fprintf(stderr,"low_pc:%"PRIx64" ranges:%"PRIx64" %lx ",ptr->low_pc,ptr->ranges, p-reader->obj->mapped);
+        for (;;) {
+            uintptr_t from = read_uintptr(&p);
+            uintptr_t to = read_uintptr(&p);
+            if (!from && !to) break;
+            fprintf(stderr,"%"PRIx64"-%"PRIx64" ",ptr->low_pc+from,ptr->low_pc+to);
+        }
+        fprintf(stderr,"\n");
+    }
+    else if (ptr->low_pc_set) {
+        fprintf(stderr,"low_pc:%"PRIx64"\n",ptr->low_pc);
+    }
+    else {
+        fprintf(stderr,"empty\n");
+    }
+}
+#endif
+
+static int
+di_read_cu(DebugInfoReader *reader)
+{
+    uint64_t unit_length;
+    uint16_t version;
+    uint64_t debug_abbrev_offset;
+    reader->format = 4;
+    reader->current_cu = reader->p;
+    unit_length = read_uint32(&reader->p);
+    if (unit_length == 0xffffffff) {
+        unit_length = read_uint64(&reader->p);
+        reader->format = 8;
+    }
+    reader->cu_end = reader->p + unit_length;
+    version = read_uint16(&reader->p);
+    reader->current_version = version;
+    if (version > 5) {
+        return -1;
+    }
+    else if (version == 5) {
+        /* unit_type = */ read_uint8(&reader->p);
+        reader->address_size = read_uint8(&reader->p);
+        debug_abbrev_offset = read_uint(reader);
+    }
+    else {
+        debug_abbrev_offset = read_uint(reader);
+        reader->address_size = read_uint8(&reader->p);
+    }
+    reader->q0 = reader->obj->debug_abbrev.ptr + debug_abbrev_offset;
+
+    reader->level = 0;
+    di_read_debug_abbrev_cu(reader);
+    if (di_read_debug_line_cu(reader)) return -1;
+
+#if defined(__GNUC__) && !defined(__clang__) && !defined(__INTEL_COMPILER_BUILD_DATE)
+    /* Though DWARF specifies "the applicable base address defaults to the base
+       address of the compilation unit", but GCC seems to use zero as default */
+#else
+    do {
+        DIE die;
+
+        if (!di_read_die(reader, &die)) continue;
+
+        if (die.tag != DW_TAG_compile_unit) {
+            di_skip_records(reader);
+            break;
+        }
+
+        reader->current_str_offsets_base = 0;
+        reader->current_addr_base = 0;
+        reader->current_rnglists_base = 0;
+
+        DebugInfoValue low_pc = {{}};
+        /* enumerate abbrev */
+        for (;;) {
+            DebugInfoValue v = {{}};
+            if (!di_read_record(reader, &v)) break;
+            switch (v.at) {
+              case DW_AT_low_pc:
+                // clang may output DW_AT_addr_base after DW_AT_low_pc.
+                // We need to resolve the DW_FORM_addr* after DW_AT_addr_base is parsed.
+                low_pc = v;
+                break;
+              case DW_AT_str_offsets_base:
+                reader->current_str_offsets_base = v.as.uint64;
+                break;
+              case DW_AT_addr_base:
+                reader->current_addr_base = v.as.uint64;
+                break;
+              case DW_AT_rnglists_base:
+                reader->current_rnglists_base = v.as.uint64;
+                break;
+            }
+        }
+        // Resolve the DW_FORM_addr of DW_AT_low_pc
+        switch (low_pc.type) {
+            case VAL_uint:
+                reader->current_low_pc = low_pc.as.uint64;
+                break;
+            case VAL_addr:
+                {
+                    addr_header_t header;
+                    addr_header_init(reader->obj, &header);
+                    reader->current_low_pc = read_addr(&header, reader->current_addr_base, low_pc.as.addr_idx);
+                }
+                break;
+        }
+    } while (0);
+#endif
+    return 0;
+}
+
+static void
+read_abstract_origin(DebugInfoReader *reader, uint64_t form, uint64_t abstract_origin, line_info_t *line)
+{
+    const char *p = reader->p;
+    const char *q = reader->q;
+    int level = reader->level;
+    DIE die;
+
+    switch (form) {
+      case DW_FORM_ref1:
+      case DW_FORM_ref2:
+      case DW_FORM_ref4:
+      case DW_FORM_ref8:
+      case DW_FORM_ref_udata:
+        reader->p = reader->current_cu + abstract_origin;
+        break;
+      case DW_FORM_ref_addr:
+        goto finish; /* not supported yet */
+      case DW_FORM_ref_sig8:
+        goto finish; /* not supported yet */
+      case DW_FORM_ref_sup4:
+      case DW_FORM_ref_sup8:
+        goto finish; /* not supported yet */
+      default:
+        goto finish;
+    }
+    if (!di_read_die(reader, &die)) goto finish;
+
+    /* enumerate abbrev */
+    for (;;) {
+        DebugInfoValue v = {{}};
+        if (!di_read_record(reader, &v)) break;
+        switch (v.at) {
+          case DW_AT_name:
+            line->sname = get_cstr_value(&v);
+            break;
+        }
+    }
+
+  finish:
+    reader->p = p;
+    reader->q = q;
+    reader->level = level;
+}
+
+static void
+debug_info_read(DebugInfoReader *reader, int num_traces, void **traces,
+         line_info_t *lines, int offset) {
+
+    addr_header_t addr_header = {};
+    addr_header_init(reader->obj, &addr_header);
+
+    rnglists_header_t rnglists_header = {};
+    rnglists_header_init(reader->obj, &rnglists_header);
+
+    while (reader->p < reader->cu_end) {
+        DIE die;
+        ranges_t ranges = {};
+        line_info_t line = {};
+
+        if (!di_read_die(reader, &die)) continue;
+        /* fprintf(stderr,"%d:%tx: <%d>\n",__LINE__,die.pos,reader->level,die.tag); */
+
+        if (die.tag != DW_TAG_subprogram && die.tag != DW_TAG_inlined_subroutine) {
+          skip_die:
+            di_skip_records(reader);
+            continue;
+        }
+
+        /* enumerate abbrev */
+        for (;;) {
+            DebugInfoValue v = {{}};
+            /* ptrdiff_t pos = reader->p - reader->p0; */
+            if (!di_read_record(reader, &v)) break;
+            /* fprintf(stderr,"\n%d:%tx: AT:%lx FORM:%lx\n",__LINE__,pos,v.at,v.form); */
+            /* div_inspect(&v); */
+            switch (v.at) {
+              case DW_AT_name:
+                line.sname = get_cstr_value(&v);
+                break;
+              case DW_AT_call_file:
+                fill_filename((int)v.as.uint64, reader->debug_line_format, reader->debug_line_version, reader->debug_line_directories, reader->debug_line_files, &line, reader->obj);
+                break;
+              case DW_AT_call_line:
+                line.line = (int)v.as.uint64;
+                break;
+              case DW_AT_low_pc:
+              case DW_AT_high_pc:
+              case DW_AT_ranges:
+                ranges_set(&ranges, &v, &addr_header, reader->current_addr_base);
+                break;
+              case DW_AT_declaration:
+                goto skip_die;
+              case DW_AT_inline:
+                /* 1 or 3 */
+                break; /* goto skip_die; */
+              case DW_AT_abstract_origin:
+                read_abstract_origin(reader, v.form, v.as.uint64, &line);
+                break; /* goto skip_die; */
+            }
+        }
+        /* ranges_inspect(reader, &ranges); */
+        /* fprintf(stderr,"%d:%tx: %x ",__LINE__,diepos,die.tag); */
+        for (int i=offset; i < num_traces; i++) {
+            uintptr_t addr = (uintptr_t)traces[i];
+            uintptr_t offset = addr - reader->obj->base_addr + reader->obj->vmaddr;
+            uintptr_t saddr = ranges_include(reader, &ranges, offset, &rnglists_header);
+            if (saddr) {
+                /* fprintf(stdout, "%d:%tx: %d %lx->%lx %x %s: %s/%s %d %s %s %s\n",__LINE__,die.pos, i,addr,offset, die.tag,line.sname,line.dirname,line.filename,line.line,reader->obj->path,line.sname,lines[i].sname); */
+                if (lines[i].sname) {
+                    line_info_t *lp = malloc(sizeof(line_info_t));
+                    memcpy(lp, &lines[i], sizeof(line_info_t));
+                    lines[i].next = lp;
+                    lp->dirname = line.dirname;
+                    lp->filename = line.filename;
+                    lp->line = line.line;
+                    lp->saddr = 0;
+                }
+                lines[i].path = reader->obj->path;
+                lines[i].base_addr = line.base_addr;
+                lines[i].sname = line.sname;
+                lines[i].saddr = saddr + reader->obj->base_addr - reader->obj->vmaddr;
+            }
+        }
+    }
+}
+
+// This function parses the following attributes of Line Number Program Header in DWARF 5:
+//
+// * directory_entry_format_count
+// * directory_entry_format
+// * directories_count
+// * directories
+//
+// or
+//
+// * file_name_entry_format_count
+// * file_name_entry_format
+// * file_names_count
+// * file_names
+//
+// It records DW_LNCT_path and DW_LNCT_directory_index at the index "idx".
+static const char *
+parse_ver5_debug_line_header(const char *p, int idx, uint8_t format, obj_info_t *obj, const char **out_path, uint64_t *out_directory_index) {
+    int i, j;
+    int entry_format_count = *(uint8_t *)p++;
+    const char *entry_format = p;
+
+    /* skip the part of entry_format */
+    for (i = 0; i < entry_format_count * 2; i++) uleb128(&p);
+
+    int entry_count = (int)uleb128(&p);
+
+    DebugInfoReader reader;
+    debug_info_reader_init(&reader, obj);
+    reader.format = format;
+    reader.p = p;
+    for (j = 0; j < entry_count; j++) {
+        const char *format = entry_format;
+        for (i = 0; i < entry_format_count; i++) {
+            DebugInfoValue v = {{}};
+            unsigned long dw_lnct = uleb128(&format);
+            unsigned long dw_form = uleb128(&format);
+            debug_info_reader_read_value(&reader, dw_form, &v);
+            if (dw_lnct == 1 /* DW_LNCT_path */ && v.type == VAL_cstr && out_path)
+                *out_path = v.as.ptr + v.off;
+            if (dw_lnct == 2 /* DW_LNCT_directory_index */ && v.type == VAL_uint && out_directory_index)
+                *out_directory_index = v.as.uint64;
+        }
+        if (j == idx) return 0;
+    }
+
+    return reader.p;
+}
+
+#ifdef USE_ELF
+static unsigned long
+uncompress_debug_section(ElfW(Shdr) *shdr, char *file, char **ptr)
+{
+    *ptr = NULL;
+#ifdef SUPPORT_COMPRESSED_DEBUG_LINE
+    ElfW(Chdr) *chdr = (ElfW(Chdr) *)(file + shdr->sh_offset);
+    unsigned long destsize = chdr->ch_size;
+    int ret = 0;
+
+    if (chdr->ch_type != ELFCOMPRESS_ZLIB) {
+	/* unsupported compression type */
+	return 0;
+    }
+
+    *ptr = malloc(destsize);
+    if (!*ptr) return 0;
+    ret = uncompress((Bytef *)*ptr, &destsize,
+	    (const Bytef*)chdr + sizeof(ElfW(Chdr)),
+            shdr->sh_size - sizeof(ElfW(Chdr)));
+    if (ret != Z_OK) goto fail;
+    return destsize;
+
+fail:
+    free(*ptr);
+    *ptr = NULL;
+#endif
+    return 0;
+}
 
 /* read file and fill lines */
 static uintptr_t
@@ -465,10 +2007,10 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
 {
     int i, j;
     char *shstr;
-    char *section_name;
     ElfW(Ehdr) *ehdr;
     ElfW(Shdr) *shdr, *shstr_shdr;
-    ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
+    ElfW(Shdr) *gnu_debuglink_shdr = NULL;
+    ElfW(Shdr) *note_gnu_build_id = NULL;
     int fd;
     off_t filesize;
     char *file;
@@ -504,6 +2046,7 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
 	kprintf("mmap: %s\n", strerror(e));
 	goto fail;
     }
+    close(fd);
 
     ehdr = (ElfW(Ehdr) *)file;
     if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
@@ -511,11 +2054,8 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
 	 * Huh? Maybe filename was overridden by setproctitle() and
 	 * it match non-elf file.
 	 */
-	close(fd);
 	goto fail;
     }
-
-    obj->fd = fd;
     obj->mapped = file;
     obj->mapped_size = (size_t)filesize;
 
@@ -525,7 +2065,7 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
     shstr = file + shstr_shdr->sh_offset;
 
     for (i = 0; i < ehdr->e_shnum; i++) {
-	section_name = shstr + shdr[i].sh_name;
+        char *section_name = shstr + shdr[i].sh_name;
 	switch (shdr[i].sh_type) {
 	  case SHT_STRTAB:
 	    if (!strcmp(section_name, ".strtab")) {
@@ -543,13 +2083,44 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
 	    /* if (!strcmp(section_name, ".dynsym")) */
 	    dynsym_shdr = shdr + i;
 	    break;
+          case SHT_NOTE:
+            if (!strcmp(section_name, ".note.gnu.build-id")) {
+                note_gnu_build_id = shdr + i;
+            }
+            break;
 	  case SHT_PROGBITS:
-	    if (!strcmp(section_name, ".debug_line")) {
-		debug_line_shdr = shdr + i;
-	    }
-	    else if (!strcmp(section_name, ".gnu_debuglink")) {
+	    if (!strcmp(section_name, ".gnu_debuglink")) {
 		gnu_debuglink_shdr = shdr + i;
 	    }
+            else {
+                const char *debug_section_names[] = {
+                    ".debug_abbrev",
+                    ".debug_info",
+                    ".debug_line",
+                    ".debug_ranges",
+                    ".debug_str_offsets",
+                    ".debug_addr",
+                    ".debug_rnglists",
+                    ".debug_str",
+                    ".debug_line_str"
+                };
+
+                for (j=0; j < DWARF_SECTION_COUNT; j++) {
+                    struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+                    if (strcmp(section_name, debug_section_names[j]) != 0)
+                        continue;
+
+                    s->ptr = file + shdr[i].sh_offset;
+                    s->size = shdr[i].sh_size;
+                    s->flags = shdr[i].sh_flags;
+                    if (s->flags & SHF_COMPRESSED) {
+                        s->size = uncompress_debug_section(&shdr[i], file, &s->ptr);
+                        if (!s->size) goto fail;
+                    }
+                    break;
+                }
+            }
 	    break;
 	}
     }
@@ -561,20 +2132,22 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
 	    char *strtab = file + dynstr_shdr->sh_offset;
 	    ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
 	    int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
-	    for (j = 0; j < symtab_count; j++) {
-		ElfW(Sym) *sym = &symtab[j];
-		Dl_info info;
-		void *h, *s;
-		if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
-		h = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
-		if (!h) continue;
-		s = dlsym(h, strtab + sym->st_name);
-		if (!s) continue;
-		if (dladdr(s, &info)) {
-		    dladdr_fbase = (uintptr_t)info.dli_fbase;
-		    break;
-		}
-	    }
+            void *handle = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+            if (handle) {
+                for (j = 0; j < symtab_count; j++) {
+                    ElfW(Sym) *sym = &symtab[j];
+                    Dl_info info;
+                    void *s;
+                    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size == 0) continue;
+                    s = dlsym(handle, strtab + sym->st_name);
+                    if (s && dladdr(s, &info)) {
+                        obj->base_addr = dladdr_fbase;
+                        dladdr_fbase = (uintptr_t)info.dli_fbase;
+                        break;
+                    }
+                }
+                dlclose(handle);
+            }
 	    if (ehdr->e_type == ET_EXEC) {
 		obj->base_addr = 0;
 	    }
@@ -585,33 +2158,48 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
 	}
     }
 
-    if (!symtab_shdr) {
-	symtab_shdr = dynsym_shdr;
-	strtab_shdr = dynstr_shdr;
-    }
-
-    if (symtab_shdr && strtab_shdr) {
-	char *strtab = file + strtab_shdr->sh_offset;
-	ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
-	int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
-	for (j = 0; j < symtab_count; j++) {
-	    ElfW(Sym) *sym = &symtab[j];
-	    uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
-	    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
-	    for (i = offset; i < num_traces; i++) {
-		uintptr_t d = (uintptr_t)traces[i] - saddr;
-		if (lines[i].line > 0 || d <= 0 || d > (uintptr_t)sym->st_size)
-		    continue;
-		/* fill symbol name and addr from .symtab */
-		lines[i].sname = strtab + sym->st_name;
-		lines[i].saddr = saddr;
-		lines[i].path  = obj->path;
-		lines[i].base_addr = obj->base_addr;
-	    }
-	}
+    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+        DebugInfoReader reader;
+        debug_info_reader_init(&reader, obj);
+        i = 0;
+        while (reader.p < reader.pend) {
+            /* fprintf(stderr, "%d:%tx: CU[%d]\n", __LINE__, reader.p - reader.obj->debug_info.ptr, i++); */
+            if (di_read_cu(&reader)) goto use_symtab;
+            debug_info_read(&reader, num_traces, traces, lines, offset);
+        }
+    }
+    else {
+        /* This file doesn't have dwarf, use symtab or dynsym */
+use_symtab:
+        if (!symtab_shdr) {
+            /* This file doesn't have symtab, use dynsym instead */
+            symtab_shdr = dynsym_shdr;
+            strtab_shdr = dynstr_shdr;
+        }
+
+        if (symtab_shdr && strtab_shdr) {
+            char *strtab = file + strtab_shdr->sh_offset;
+            ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+            int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+            for (j = 0; j < symtab_count; j++) {
+                ElfW(Sym) *sym = &symtab[j];
+                uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+                if (ELF_ST_TYPE(sym->st_info) != STT_FUNC) continue;
+                for (i = offset; i < num_traces; i++) {
+                    uintptr_t d = (uintptr_t)traces[i] - saddr;
+                    if (lines[i].line > 0 || d > (uintptr_t)sym->st_size)
+                        continue;
+                    /* fill symbol name and addr from .symtab */
+                    if (!lines[i].sname) lines[i].sname = strtab + sym->st_name;
+                    lines[i].saddr = saddr;
+                    lines[i].path  = obj->path;
+                    lines[i].base_addr = obj->base_addr;
+                }
+            }
+        }
     }
 
-    if (!debug_line_shdr) {
+    if (!obj->debug_line.ptr) {
 	/* This file doesn't have .debug_line section,
 	   let's check .gnu_debuglink section instead. */
 	if (gnu_debuglink_shdr && check_debuglink) {
@@ -619,21 +2207,251 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
 			     num_traces, traces,
 			     objp, lines, offset);
 	}
+        if (note_gnu_build_id && check_debuglink) {
+            ElfW(Nhdr) *nhdr = (ElfW(Nhdr)*) (file + note_gnu_build_id->sh_offset);
+            const char *build_id = (char *)(nhdr + 1) + nhdr->n_namesz;
+            follow_debuglink_build_id(build_id, nhdr->n_descsz,
+			       num_traces, traces,
+			       objp, lines, offset);
+        }
 	goto finish;
     }
 
-    parse_debug_line(num_traces, traces,
-		     file + debug_line_shdr->sh_offset,
-		     debug_line_shdr->sh_size,
-		     obj, lines, offset);
+    if (parse_debug_line(num_traces, traces,
+            obj->debug_line.ptr,
+            obj->debug_line.size,
+            obj, lines, offset) == -1)
+        goto fail;
+
 finish:
     return dladdr_fbase;
 fail:
     return (uintptr_t)-1;
 }
+#else /* Mach-O */
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+        obj_info_t **objp, line_info_t *lines, int offset)
+{
+# ifdef __LP64__
+#  define LP(x) x##_64
+# else
+#  define LP(x) x
+# endif
+    int fd;
+    off_t filesize;
+    char *file, *p = NULL;
+    obj_info_t *obj = *objp;
+    struct LP(mach_header) *header;
+    uintptr_t dladdr_fbase = 0;
+
+    {
+        char *s = binary_filename;
+        char *base = strrchr(binary_filename, '/')+1;
+        size_t max = PATH_MAX;
+        size_t size = strlen(binary_filename);
+        size_t basesize = size - (base - binary_filename);
+        s += size;
+        max -= size;
+        p = s;
+        size = strlcpy(s, ".dSYM/Contents/Resources/DWARF/", max);
+        if (size == 0) goto fail;
+        s += size;
+        max -= size;
+        if (max <= basesize) goto fail;
+        memcpy(s, base, basesize);
+        s[basesize] = 0;
+
+        fd = open(binary_filename, O_RDONLY);
+        if (fd < 0) {
+            *p = 0; /* binary_filename becomes original file name */
+            fd = open(binary_filename, O_RDONLY);
+            if (fd < 0) {
+                goto fail;
+            }
+        }
+    }
+
+    filesize = lseek(fd, 0, SEEK_END);
+    if (filesize < 0) {
+        int e = errno;
+        close(fd);
+        kprintf("lseek: %s\n", strerror(e));
+        goto fail;
+    }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+    if (filesize > (off_t)SIZE_MAX) {
+        close(fd);
+        kprintf("Too large file %s\n", binary_filename);
+        goto fail;
+    }
+#endif
+    lseek(fd, 0, SEEK_SET);
+    /* async-signal unsafe */
+    file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+    if (file == MAP_FAILED) {
+        int e = errno;
+        close(fd);
+        kprintf("mmap: %s\n", strerror(e));
+        goto fail;
+    }
+    close(fd);
+
+    obj->mapped = file;
+    obj->mapped_size = (size_t)filesize;
+
+    header = (struct LP(mach_header) *)file;
+    if (header->magic == LP(MH_MAGIC)) {
+        /* non universal binary */
+        p = file;
+    }
+    else if (header->magic == FAT_CIGAM) {
+        struct LP(mach_header) *mhp = _NSGetMachExecuteHeader();
+        struct fat_header *fat = (struct fat_header *)file;
+        char *q = file + sizeof(*fat);
+        uint32_t nfat_arch = __builtin_bswap32(fat->nfat_arch);
+        /* fprintf(stderr,"%d: fat:%s %d\n",__LINE__, binary_filename,nfat_arch); */
+        for (uint32_t i = 0; i < nfat_arch; i++) {
+            struct fat_arch *arch = (struct fat_arch *)q;
+            cpu_type_t cputype = __builtin_bswap32(arch->cputype);
+            cpu_subtype_t cpusubtype = __builtin_bswap32(arch->cpusubtype);
+            uint32_t offset = __builtin_bswap32(arch->offset);
+            /* fprintf(stderr,"%d: fat %d %x/%x %x/%x\n",__LINE__, i, mhp->cputype,mhp->cpusubtype, cputype,cpusubtype); */
+            if (mhp->cputype == cputype &&
+                    (cpu_subtype_t)(mhp->cpusubtype & ~CPU_SUBTYPE_MASK) == cpusubtype) {
+                p = file + offset;
+                file = p;
+                header = (struct LP(mach_header) *)p;
+                if (header->magic == LP(MH_MAGIC)) {
+                    goto found_mach_header;
+                }
+                break;
+            }
+            q += sizeof(*arch);
+        }
+        kprintf("'%s' is not a Mach-O universal binary file!\n",binary_filename);
+        close(fd);
+        goto fail;
+    }
+    else {
+        kprintf("'%s' is not a "
+# ifdef __LP64__
+                "64"
+# else
+                "32"
+# endif
+                "-bit Mach-O file!\n",binary_filename);
+        close(fd);
+        goto fail;
+    }
+found_mach_header:
+    p += sizeof(*header);
+
+    for (uint32_t i = 0; i < (uint32_t)header->ncmds; i++) {
+        struct load_command *lcmd = (struct load_command *)p;
+        switch (lcmd->cmd) {
+          case LP(LC_SEGMENT):
+            {
+                static const char *debug_section_names[] = {
+                    "__debug_abbrev",
+                    "__debug_info",
+                    "__debug_line",
+                    "__debug_ranges",
+                    "__debug_str_offsets",
+                    "__debug_addr",
+                    "__debug_rnglists",
+                    "__debug_str",
+                    "__debug_line_str",
+                };
+                struct LP(segment_command) *scmd = (struct LP(segment_command) *)lcmd;
+                if (strcmp(scmd->segname, "__TEXT") == 0) {
+                    obj->vmaddr = scmd->vmaddr;
+                }
+                else if (strcmp(scmd->segname, "__DWARF") == 0) {
+                    p += sizeof(struct LP(segment_command));
+                    for (uint64_t i = 0; i < scmd->nsects; i++) {
+                        struct LP(section) *sect = (struct LP(section) *)p;
+                        p += sizeof(struct LP(section));
+                        for (int j=0; j < DWARF_SECTION_COUNT; j++) {
+                            struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+                            if (strcmp(sect->sectname, debug_section_names[j]) != 0)
+                                continue;
+
+                            s->ptr = file + sect->offset;
+                            s->size = sect->size;
+                            s->flags = sect->flags;
+                            if (s->flags & SHF_COMPRESSED) {
+                                goto fail;
+                            }
+                            break;
+                        }
+                    }
+                }
+            }
+            break;
+
+          case LC_SYMTAB:
+            {
+                struct symtab_command *cmd = (struct symtab_command *)lcmd;
+                struct LP(nlist) *nl = (struct LP(nlist) *)(file + cmd->symoff);
+                char *strtab = file + cmd->stroff, *sname = 0;
+                uint32_t j;
+                uintptr_t saddr = 0;
+                /* kprintf("[%2d]: %x/symtab %p\n", i, cmd->cmd, (void *)p); */
+                for (j = 0; j < cmd->nsyms; j++) {
+                    uintptr_t symsize, d;
+                    struct LP(nlist) *e = &nl[j];
+                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+                    if (e->n_type != N_FUN) continue;
+                    if (e->n_sect) {
+                        saddr = (uintptr_t)e->n_value + obj->base_addr - obj->vmaddr;
+                        sname = strtab + e->n_un.n_strx;
+                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+                        continue;
+                    }
+                    for (int k = offset; k < num_traces; k++) {
+                        d = (uintptr_t)traces[k] - saddr;
+                        symsize = e->n_value;
+                        /* kprintf("%lx %lx %lx\n",saddr,symsize,traces[k]); */
+                        if (lines[k].line > 0 || d > (uintptr_t)symsize)
+                            continue;
+                        /* fill symbol name and addr from .symtab */
+                        if (!lines[k].sname) lines[k].sname = sname;
+                        lines[k].saddr = saddr;
+                        lines[k].path  = obj->path;
+                        lines[k].base_addr = obj->base_addr;
+                    }
+                }
+            }
+        }
+        p += lcmd->cmdsize;
+    }
+
+    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+        DebugInfoReader reader;
+        debug_info_reader_init(&reader, obj);
+        while (reader.p < reader.pend) {
+            if (di_read_cu(&reader)) goto fail;
+            debug_info_read(&reader, num_traces, traces, lines, offset);
+        }
+    }
+
+    if (parse_debug_line(num_traces, traces,
+            obj->debug_line.ptr,
+            obj->debug_line.size,
+            obj, lines, offset) == -1)
+        goto fail;
+
+    return dladdr_fbase;
+fail:
+    return (uintptr_t)-1;
+}
+#endif
 
 #define HAVE_MAIN_EXE_PATH
-#if defined(__FreeBSD__)
+#if defined(__FreeBSD__) || defined(__DragonFly__)
 # include <sys/sysctl.h>
 #endif
 /* ssize_t main_exe_path(void)
@@ -642,17 +2460,22 @@ fail:
  * and returns strlen(binary_filename).
  * it is NUL terminated.
  */
-#if defined(__linux__)
-ssize_t
+#if defined(__linux__) || defined(__NetBSD__)
+static ssize_t
 main_exe_path(void)
 {
-# define PROC_SELF_EXE "/proc/self/exe"
+# if defined(__linux__)
+#  define PROC_SELF_EXE "/proc/self/exe"
+# elif defined(__NetBSD__)
+#  define PROC_SELF_EXE "/proc/curproc/exe"
+# endif
     ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
+    if (len < 0) return 0;
     binary_filename[len] = 0;
     return len;
 }
-#elif defined(__FreeBSD__)
-ssize_t
+#elif defined(__FreeBSD__) || defined(__DragonFly__)
+static ssize_t
 main_exe_path(void)
 {
     int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
@@ -665,10 +2488,69 @@ main_exe_path(void)
     len--; /* sysctl sets strlen+1 */
     return len;
 }
+#elif defined(HAVE_LIBPROC_H)
+static ssize_t
+main_exe_path(void)
+{
+    int len = proc_pidpath(getpid(), binary_filename, PATH_MAX);
+    if (len == 0) return 0;
+    binary_filename[len] = 0;
+    return len;
+}
 #else
 #undef HAVE_MAIN_EXE_PATH
 #endif
 
+static void
+print_line0(line_info_t *line, void *address)
+{
+    uintptr_t addr = (uintptr_t)address;
+    uintptr_t d = addr - line->saddr;
+    if (!address) {
+        /* inlined */
+        if (line->dirname && line->dirname[0]) {
+            kprintf("%s(%s) %s/%s:%d\n", line->path, line->sname, line->dirname, line->filename, line->line);
+        }
+        else {
+            kprintf("%s(%s) %s:%d\n", line->path, line->sname, line->filename, line->line);
+        }
+    }
+    else if (!line->path) {
+        kprintf("[0x%"PRIxPTR"]\n", addr);
+    }
+    else if (!line->sname) {
+        kprintf("%s(0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, addr-line->base_addr, addr);
+    }
+    else if (!line->saddr) {
+        kprintf("%s(%s) [0x%"PRIxPTR"]\n", line->path, line->sname, addr);
+    }
+    else if (line->line <= 0) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, line->sname,
+                d, addr);
+    }
+    else if (!line->filename) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] ???:%d\n", line->path, line->sname,
+                d, addr, line->line);
+    }
+    else if (line->dirname && line->dirname[0]) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s/%s:%d\n", line->path, line->sname,
+                d, addr, line->dirname, line->filename, line->line);
+    }
+    else {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s:%d\n", line->path, line->sname,
+                d, addr, line->filename, line->line);
+    }
+}
+
+static void
+print_line(line_info_t *line, void *address)
+{
+    print_line0(line, address);
+    if (line->next) {
+        print_line(line->next, NULL);
+    }
+}
+
 void
 rb_dump_backtrace_with_lines(int num_traces, void **traces)
 {
@@ -678,6 +2560,7 @@ rb_dump_backtrace_with_lines(int num_traces, void **traces)
     obj_info_t *obj = NULL;
     /* 2 is NULL + main executable */
     void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
+
 #ifdef HAVE_MAIN_EXE_PATH
     char *main_path = NULL; /* used on printing backtrace */
     ssize_t len;
@@ -708,8 +2591,8 @@ rb_dump_backtrace_with_lines(int num_traces, void **traces)
 	    /* if the binary is strip-ed, this may effect */
 	    for (p=dladdr_fbases; *p; p++) {
 		if (*p == info.dli_fbase) {
-		    lines[i].path = info.dli_fname;
-		    lines[i].sname = info.dli_sname;
+		    if (info.dli_fname) lines[i].path = info.dli_fname;
+		    if (info.dli_sname) lines[i].sname = info.dli_sname;
 		    goto next_line;
 		}
 	    }
@@ -719,9 +2602,14 @@ rb_dump_backtrace_with_lines(int num_traces, void **traces)
 	    obj->base_addr = (uintptr_t)info.dli_fbase;
 	    path = info.dli_fname;
 	    obj->path = path;
-	    lines[i].path = path;
-	    strcpy(binary_filename, path);
-	    fill_lines(num_traces, traces, 1, &obj, lines, i);
+	    if (path) lines[i].path = path;
+            if (info.dli_sname) {
+                lines[i].sname = info.dli_sname;
+                lines[i].saddr = (uintptr_t)info.dli_saddr;
+            }
+	    strlcpy(binary_filename, path, PATH_MAX);
+	    if (fill_lines(num_traces, traces, 1, &obj, lines, i) == (uintptr_t)-1)
+		break;
 	}
 next_line:
 	continue;
@@ -729,46 +2617,36 @@ next_line:
 
     /* output */
     for (i = 0; i < num_traces; i++) {
-	line_info_t *line = &lines[i];
-	uintptr_t addr = (uintptr_t)traces[i];
-	uintptr_t d = addr - line->saddr;
-	if (!line->path) {
-	    kprintf("[0x%lx]\n", addr);
-	}
-	else if (!line->saddr || !line->sname) {
-	    kprintf("%s [0x%lx]\n", line->path, addr);
-	}
-	else if (line->line <= 0) {
-	    kprintf("%s(%s+0x%lx) [0x%lx]\n", line->path, line->sname,
-		    d, addr);
-	}
-	else if (!line->filename) {
-	    kprintf("%s(%s+0x%lx) [0x%lx] ???:%d\n", line->path, line->sname,
-		    d, addr, line->line);
-	}
-	else if (line->dirname && line->dirname[0]) {
-	    kprintf("%s(%s+0x%lx) [0x%lx] %s/%s:%d\n", line->path, line->sname,
-		    d, addr, line->dirname, line->filename, line->line);
-	}
-	else {
-	    kprintf("%s(%s+0x%lx) [0x%lx] %s:%d\n", line->path, line->sname,
-		    d, addr, line->filename, line->line);
-	}
+        print_line(&lines[i], traces[i]);
+
 	/* FreeBSD's backtrace may show _start and so on */
-	if (line->sname && strcmp("main", line->sname) == 0)
+	if (lines[i].sname && strcmp("main", lines[i].sname) == 0)
 	    break;
     }
 
     /* free */
     while (obj) {
 	obj_info_t *o = obj;
-	obj = o->next;
-	if (o->fd) {
-	    munmap(o->mapped, o->mapped_size);
-	    close(o->fd);
+        for (i=0; i < DWARF_SECTION_COUNT; i++) {
+            struct dwarf_section *s = obj_dwarf_section_at(obj, i);
+            if (s->flags & SHF_COMPRESSED) {
+                free(s->ptr);
+            }
+        }
+	if (obj->mapped_size) {
+	    munmap(obj->mapped, obj->mapped_size);
 	}
+	obj = o->next;
 	free(o);
     }
+    for (i = 0; i < num_traces; i++) {
+        line_info_t *line = lines[i].next;
+        while (line) {
+            line_info_t *l = line;
+            line = line->next;
+            free(l);
+        }
+    }
     free(lines);
     free(dladdr_fbases);
 }
@@ -812,10 +2690,9 @@ next_line:
 
 #include <stdarg.h>
 #define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
-extern int rb_toupper(int c);
-#define    toupper(c)  rb_toupper(c)
+static inline int toupper(int c) { return ('A' <= c && c <= 'Z') ? (c&0x5f) : c; }
 #define    hex2ascii(hex)  (hex2ascii_data[hex])
-char const hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
+static const char hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
 static inline int imax(int a, int b) { return (a > b ? a : b); }
 static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
 
@@ -829,7 +2706,7 @@ static void putce(int c)
     (void)ret;
 }
 
-int
+static int
 kprintf(const char *fmt, ...)
 {
 	va_list ap;
diff --git a/addr2line.h b/addr2line.h
index d99f010934..f09b665800 100644
--- a/addr2line.h
+++ b/addr2line.h
@@ -1,3 +1,5 @@
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
 /**********************************************************************
 
   addr2line.h -
@@ -8,10 +10,7 @@
 
 **********************************************************************/
 
-#ifndef RUBY_ADDR2LINE_H
-#define RUBY_ADDR2LINE_H
-
-#ifdef USE_ELF
+#if (defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H))
 
 void
 rb_dump_backtrace_with_lines(int num_traces, void **traces);
diff --git a/array.c b/array.c
index 27b6325aa2..b76e9a64a3 100644
--- a/array.c
+++ b/array.c
@@ -11,51 +11,107 @@
 
 **********************************************************************/
 
+#include "debug_counter.h"
+#include "id.h"
 #include "internal.h"
-#include "ruby/util.h"
-#include "ruby/st.h"
+#include "internal/array.h"
+#include "internal/compar.h"
+#include "internal/enum.h"
+#include "internal/gc.h"
+#include "internal/hash.h"
+#include "internal/numeric.h"
+#include "internal/object.h"
+#include "internal/proc.h"
+#include "internal/rational.h"
+#include "internal/vm.h"
 #include "probes.h"
-#include "id.h"
+#include "ruby/encoding.h"
+#include "ruby/st.h"
+#include "ruby/util.h"
+#include "transient_heap.h"
+#include "builtin.h"
 
-#ifndef ARRAY_DEBUG
+#if !ARRAY_DEBUG
+# undef NDEBUG
 # define NDEBUG
 #endif
-#include <assert.h>
+#include "ruby_assert.h"
 
 VALUE rb_cArray;
 
-static ID id_cmp, id_div, id_power;
+/* Flags of RArray
+ *
+ * 1:   RARRAY_EMBED_FLAG
+ *          The array is embedded (its contents follow the header, rather than
+ *          being on a separately allocated buffer).
+ * 2:   RARRAY_SHARED_FLAG (equal to ELTS_SHARED)
+ *          The array is shared. The buffer this array points to is owned by
+ *          another array (the shared root).
+ * if USE_RVARGC
+ * 3-9: RARRAY_EMBED_LEN
+ *          The length of the array when RARRAY_EMBED_FLAG is set.
+ * else
+ * 3-4: RARRAY_EMBED_LEN
+ *          The length of the array when RARRAY_EMBED_FLAG is set.
+ * endif
+ * 12:  RARRAY_SHARED_ROOT_FLAG
+ *          The array is a shared root that does reference counting. The buffer
+ *          this array points to is owned by this array but may be pointed to
+ *          by other arrays.
+ *          Note: Frozen arrays may be a shared root without this flag being
+ *                set. Frozen arrays do not have reference counting because
+ *                they cannot be modified. Not updating the reference count
+ *                improves copy-on-write performance. Their reference count is
+ *                assumed to be infinity.
+ * 13:  RARRAY_TRANSIENT_FLAG
+ *          The buffer of the array is allocated on the transient heap.
+ * 14:  RARRAY_PTR_IN_USE_FLAG
+ *          The buffer of the array is in use. This is only used during
+ *          debugging.
+ */
+
+/* for OPTIMIZED_CMP: */
+#define id_cmp idCmp
 
 #define ARY_DEFAULT_SIZE 16
 #define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
+#define SMALL_ARRAY_LEN 16
 
-# define ARY_SHARED_P(ary) \
-    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
-     FL_TEST((ary),ELTS_SHARED)!=0)
-# define ARY_EMBED_P(ary) \
-    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
-     FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
+RBIMPL_ATTR_MAYBE_UNUSED()
+static int
+should_be_T_ARRAY(VALUE ary)
+{
+    return RB_TYPE_P(ary, T_ARRAY);
+}
 
 #define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
 #define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_HEAP_CAPA(a) (assert(!ARY_EMBED_P(a)), assert(!ARY_SHARED_ROOT_P(a)), \
+                          RARRAY(a)->as.heap.aux.capa)
+
 #define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
 #define ARY_EMBED_LEN(a) \
     (assert(ARY_EMBED_P(a)), \
      (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
-	 (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
-#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), RARRAY(a)->as.heap.aux.capa * sizeof(VALUE))
+         (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), ARY_CAPA(a) * sizeof(VALUE))
+
+#define ARY_OWNS_HEAP_P(a) (assert(should_be_T_ARRAY((VALUE)(a))), \
+                            !FL_TEST_RAW((a), RARRAY_SHARED_FLAG|RARRAY_EMBED_FLAG))
 
-#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
 #define FL_SET_EMBED(a) do { \
     assert(!ARY_SHARED_P(a)); \
     FL_SET((a), RARRAY_EMBED_FLAG); \
+    RARY_TRANSIENT_UNSET(a); \
+    ary_verify(a); \
 } while (0)
+
 #define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
 #define FL_SET_SHARED(ary) do { \
     assert(!ARY_EMBED_P(ary)); \
-    FL_SET((ary), ELTS_SHARED); \
+    FL_SET((ary), RARRAY_SHARED_FLAG); \
 } while (0)
-#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), RARRAY_SHARED_FLAG)
 
 #define ARY_SET_PTR(ary, p) do { \
     assert(!ARY_EMBED_P(ary)); \
@@ -65,7 +121,6 @@ static ID id_cmp, id_div, id_power;
 #define ARY_SET_EMBED_LEN(ary, n) do { \
     long tmp_n = (n); \
     assert(ARY_EMBED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
     RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
     RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
 } while (0)
@@ -97,8 +152,8 @@ static ID id_cmp, id_div, id_power;
     } \
 } while (0)
 
-#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
-		       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? ary_embed_capa(ary) : \
+                       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : ARY_HEAP_CAPA(ary))
 #define ARY_SET_CAPA(ary, n) do { \
     assert(!ARY_EMBED_P(ary)); \
     assert(!ARY_SHARED_P(ary)); \
@@ -106,44 +161,185 @@ static ID id_cmp, id_div, id_power;
     RARRAY(ary)->as.heap.aux.capa = (n); \
 } while (0)
 
-#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
 #define ARY_SET_SHARED(ary, value) do { \
     const VALUE _ary_ = (ary); \
     const VALUE _value_ = (value); \
     assert(!ARY_EMBED_P(_ary_)); \
     assert(ARY_SHARED_P(_ary_)); \
-    assert(ARY_SHARED_ROOT_P(_value_)); \
-    RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared, _value_); \
+    assert(!OBJ_FROZEN(_ary_)); \
+    assert(ARY_SHARED_ROOT_P(_value_) || OBJ_FROZEN(_value_)); \
+    RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared_root, _value_); \
 } while (0)
-#define RARRAY_SHARED_ROOT_FLAG FL_USER5
-#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
-#define ARY_SHARED_NUM(ary) \
-    (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SHARED_OCCUPIED(ary) (ARY_SHARED_NUM(ary) == 1)
-#define ARY_SET_SHARED_NUM(ary, value) do { \
+
+#define ARY_SHARED_ROOT_OCCUPIED(ary) (!OBJ_FROZEN(ary) && ARY_SHARED_ROOT_REFCNT(ary) == 1)
+#define ARY_SET_SHARED_ROOT_REFCNT(ary, value) do { \
     assert(ARY_SHARED_ROOT_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    assert((value) >= 0); \
     RARRAY(ary)->as.heap.aux.capa = (value); \
 } while (0)
 #define FL_SET_SHARED_ROOT(ary) do { \
+    assert(!OBJ_FROZEN(ary)); \
     assert(!ARY_EMBED_P(ary)); \
+    assert(!RARRAY_TRANSIENT_P(ary)); \
     FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
 } while (0)
 
-#define ARY_SET(a, i, v) RARRAY_ASET((assert(!ARY_SHARED_P(a)), (a)), (i), (v))
+static inline void
+ARY_SET(VALUE a, long i, VALUE v)
+{
+    assert(!ARY_SHARED_P(a));
+    assert(!OBJ_FROZEN(a));
+
+    RARRAY_ASET(a, i, v);
+}
+#undef RARRAY_ASET
+
+static long
+ary_embed_capa(VALUE ary)
+{
+#if USE_RVARGC
+    size_t size = rb_gc_obj_slot_size(ary) - offsetof(struct RArray, as.ary);
+    assert(size % sizeof(VALUE) == 0);
+    return size / sizeof(VALUE);
+#else
+    return RARRAY_EMBED_LEN_MAX;
+#endif
+}
+
+static size_t
+ary_embed_size(long capa)
+{
+    return offsetof(struct RArray, as.ary) + (sizeof(VALUE) * capa);
+}
+
+static bool
+ary_embeddable_p(long capa)
+{
+#if USE_RVARGC
+    return rb_gc_size_allocatable_p(ary_embed_size(capa));
+#else
+    return capa <= RARRAY_EMBED_LEN_MAX;
+#endif
+}
+
+bool
+rb_ary_embeddable_p(VALUE ary)
+{
+    /* An array cannot be turned embeddable when the array is:
+     *  - Shared root: other objects may point to the buffer of this array
+     *    so we cannot make it embedded.
+     *  - Frozen: this array may also be a shared root without the shared root
+     *    flag.
+     *  - Shared: we don't want to re-embed an array that points to a shared
+     *    root (to save memory).
+     */
+    return !(ARY_SHARED_ROOT_P(ary) || OBJ_FROZEN(ary) || ARY_SHARED_P(ary));
+}
+
+size_t
+rb_ary_size_as_embedded(VALUE ary)
+{
+    size_t real_size;
+
+    if (ARY_EMBED_P(ary)) {
+        real_size = ary_embed_size(ARY_EMBED_LEN(ary));
+    }
+    else if (rb_ary_embeddable_p(ary)) {
+        real_size = ary_embed_size(ARY_HEAP_CAPA(ary));
+    }
+    else {
+        real_size = sizeof(struct RArray);
+    }
+    return real_size;
+}
+
+
+#if ARRAY_DEBUG
+#define ary_verify(ary) ary_verify_(ary, __FILE__, __LINE__)
+
+static VALUE
+ary_verify_(VALUE ary, const char *file, int line)
+{
+    assert(RB_TYPE_P(ary, T_ARRAY));
+
+    if (ARY_SHARED_P(ary)) {
+        VALUE root = ARY_SHARED_ROOT(ary);
+        const VALUE *ptr = ARY_HEAP_PTR(ary);
+        const VALUE *root_ptr = RARRAY_CONST_PTR_TRANSIENT(root);
+        long len = ARY_HEAP_LEN(ary), root_len = RARRAY_LEN(root);
+        assert(ARY_SHARED_ROOT_P(root) || OBJ_FROZEN(root));
+        assert(root_ptr <= ptr && ptr + len <= root_ptr + root_len);
+        ary_verify(root);
+    }
+    else if (ARY_EMBED_P(ary)) {
+        assert(!RARRAY_TRANSIENT_P(ary));
+        assert(!ARY_SHARED_P(ary));
+        assert(RARRAY_LEN(ary) <= ary_embed_capa(ary));
+    }
+    else {
+#if 1
+        const VALUE *ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
+        long i, len = RARRAY_LEN(ary);
+        volatile VALUE v;
+        if (len > 1) len = 1; /* check only HEAD */
+        for (i=0; i<len; i++) {
+            v = ptr[i]; /* access check */
+        }
+        v = v;
+#endif
+    }
+
+#if USE_TRANSIENT_HEAP
+    if (RARRAY_TRANSIENT_P(ary)) {
+        assert(rb_transient_heap_managed_ptr_p(RARRAY_CONST_PTR_TRANSIENT(ary)));
+    }
+#endif
+
+    rb_transient_heap_verify();
+
+    return ary;
+}
+
+void
+rb_ary_verify(VALUE ary)
+{
+    ary_verify(ary);
+}
+#else
+#define ary_verify(ary) ((void)0)
+#endif
+
+VALUE *
+rb_ary_ptr_use_start(VALUE ary)
+{
+#if ARRAY_DEBUG
+    FL_SET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+    return (VALUE *)RARRAY_CONST_PTR_TRANSIENT(ary);
+}
 
 void
-rb_mem_clear(register VALUE *mem, register long size)
+rb_ary_ptr_use_end(VALUE ary)
+{
+#if ARRAY_DEBUG
+    FL_UNSET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+}
+
+void
+rb_mem_clear(VALUE *mem, long size)
 {
     while (size--) {
-	*mem++ = Qnil;
+        *mem++ = Qnil;
     }
 }
 
 static void
 ary_mem_clear(VALUE ary, long beg, long size)
 {
-    RARRAY_PTR_USE(ary, ptr, {
-	rb_mem_clear(ptr + beg, size);
+    RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+        rb_mem_clear(ptr + beg, size);
     });
 }
 
@@ -151,44 +347,38 @@ static inline void
 memfill(register VALUE *mem, register long size, register VALUE val)
 {
     while (size--) {
-	*mem++ = val;
+        *mem++ = val;
     }
 }
 
 static void
 ary_memfill(VALUE ary, long beg, long size, VALUE val)
 {
-    RARRAY_PTR_USE(ary, ptr, {
-	memfill(ptr + beg, size, val);
-	RB_OBJ_WRITTEN(ary, Qundef, val);
+    RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+        memfill(ptr + beg, size, val);
+        RB_OBJ_WRITTEN(ary, Qundef, val);
     });
 }
 
 static void
 ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
 {
-#if 1
     assert(!ARY_SHARED_P(buff_owner_ary));
 
     if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
-	rb_gc_writebarrier_remember(buff_owner_ary);
-	RARRAY_PTR_USE(ary, ptr, {
-	    MEMCPY(ptr+beg, argv, VALUE, argc);
-	});
+        rb_gc_writebarrier_remember(buff_owner_ary);
+        RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+            MEMCPY(ptr+beg, argv, VALUE, argc);
+        });
     }
     else {
-	int i;
-	RARRAY_PTR_USE(ary, ptr, {
-	    for (i=0; i<argc; i++) {
-		RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
-	    }
-	});
+        int i;
+        RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+            for (i=0; i<argc; i++) {
+                RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+            }
+        });
     }
-#else
-    /* giveup write barrier (traditional way) */
-    RARRAY_PTR(buff_owner_ary);
-    MEMCPY(RARRAY_PTR(ary)+beg, argv, VALUE, argc);
-#endif
 }
 
 static void
@@ -197,49 +387,198 @@ ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
     ary_memcpy0(ary, beg, argc, argv, ary);
 }
 
+static VALUE *
+ary_heap_alloc(VALUE ary, size_t capa)
+{
+    VALUE *ptr = rb_transient_heap_alloc(ary, sizeof(VALUE) * capa);
+
+    if (ptr != NULL) {
+        RARY_TRANSIENT_SET(ary);
+    }
+    else {
+        RARY_TRANSIENT_UNSET(ary);
+        ptr = ALLOC_N(VALUE, capa);
+    }
+
+    return ptr;
+}
+
+static void
+ary_heap_free_ptr(VALUE ary, const VALUE *ptr, long size)
+{
+    if (RARRAY_TRANSIENT_P(ary)) {
+        /* ignore it */
+    }
+    else {
+        ruby_sized_xfree((void *)ptr, size);
+    }
+}
+
+static void
+ary_heap_free(VALUE ary)
+{
+    if (RARRAY_TRANSIENT_P(ary)) {
+        RARY_TRANSIENT_UNSET(ary);
+    }
+    else {
+        ary_heap_free_ptr(ary, ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+    }
+}
+
+static size_t
+ary_heap_realloc(VALUE ary, size_t new_capa)
+{
+    size_t alloc_capa = new_capa;
+    size_t old_capa = ARY_HEAP_CAPA(ary);
+
+    if (RARRAY_TRANSIENT_P(ary)) {
+        if (new_capa <= old_capa) {
+            /* do nothing */
+            alloc_capa = old_capa;
+        }
+        else {
+            VALUE *new_ptr = rb_transient_heap_alloc(ary, sizeof(VALUE) * new_capa);
+
+            if (new_ptr == NULL) {
+                new_ptr = ALLOC_N(VALUE, new_capa);
+                RARY_TRANSIENT_UNSET(ary);
+            }
+
+            MEMCPY(new_ptr, ARY_HEAP_PTR(ary), VALUE, old_capa);
+            ARY_SET_PTR(ary, new_ptr);
+        }
+    }
+    else {
+        SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, new_capa, old_capa);
+    }
+    ary_verify(ary);
+
+    return alloc_capa;
+}
+
+#if USE_TRANSIENT_HEAP
+static inline void
+rb_ary_transient_heap_evacuate_(VALUE ary, int transient, int promote)
+{
+    if (transient) {
+        assert(!ARY_SHARED_ROOT_P(ary));
+
+        VALUE *new_ptr;
+        const VALUE *old_ptr = ARY_HEAP_PTR(ary);
+        long capa = ARY_HEAP_CAPA(ary);
+
+        assert(ARY_OWNS_HEAP_P(ary));
+        assert(RARRAY_TRANSIENT_P(ary));
+        assert(!ARY_PTR_USING_P(ary));
+
+        if (promote) {
+            new_ptr = ALLOC_N(VALUE, capa);
+            RARY_TRANSIENT_UNSET(ary);
+        }
+        else {
+            new_ptr = ary_heap_alloc(ary, capa);
+        }
+
+        MEMCPY(new_ptr, old_ptr, VALUE, capa);
+        /* do not use ARY_SET_PTR() because they assert !frozen */
+        RARRAY(ary)->as.heap.ptr = new_ptr;
+    }
+
+    ary_verify(ary);
+}
+
+void
+rb_ary_transient_heap_evacuate(VALUE ary, int promote)
+{
+    rb_ary_transient_heap_evacuate_(ary, RARRAY_TRANSIENT_P(ary), promote);
+}
+
+void
+rb_ary_detransient(VALUE ary)
+{
+    assert(RARRAY_TRANSIENT_P(ary));
+    rb_ary_transient_heap_evacuate_(ary, TRUE, TRUE);
+}
+#else
+void
+rb_ary_detransient(VALUE ary)
+{
+    /* do nothing */
+}
+#endif
+
+void
+rb_ary_make_embedded(VALUE ary)
+{
+    assert(rb_ary_embeddable_p(ary));
+    if (!ARY_EMBED_P(ary)) {
+        const VALUE *buf = ARY_HEAP_PTR(ary);
+        long len = ARY_HEAP_LEN(ary);
+        bool was_transient = RARRAY_TRANSIENT_P(ary);
+
+        // FL_SET_EMBED also unsets the transient flag
+        FL_SET_EMBED(ary);
+        ARY_SET_EMBED_LEN(ary, len);
+
+        MEMCPY((void *)ARY_EMBED_PTR(ary), (void *)buf, VALUE, len);
+
+        if (!was_transient) {
+            ary_heap_free_ptr(ary, buf, len * sizeof(VALUE));
+        }
+    }
+}
+
 static void
 ary_resize_capa(VALUE ary, long capacity)
 {
     assert(RARRAY_LEN(ary) <= capacity);
     assert(!OBJ_FROZEN(ary));
     assert(!ARY_SHARED_P(ary));
-    if (capacity > RARRAY_EMBED_LEN_MAX) {
+
+    if (capacity > ary_embed_capa(ary)) {
+        size_t new_capa = capacity;
         if (ARY_EMBED_P(ary)) {
             long len = ARY_EMBED_LEN(ary);
-            VALUE *ptr = ALLOC_N(VALUE, (capacity));
+            VALUE *ptr = ary_heap_alloc(ary, capacity);
+
             MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
             FL_UNSET_EMBED(ary);
             ARY_SET_PTR(ary, ptr);
             ARY_SET_HEAP_LEN(ary, len);
         }
         else {
-	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity, RARRAY(ary)->as.heap.aux.capa);
+            new_capa = ary_heap_realloc(ary, capacity);
         }
-        ARY_SET_CAPA(ary, (capacity));
+        ARY_SET_CAPA(ary, new_capa);
     }
     else {
         if (!ARY_EMBED_P(ary)) {
-            long len = RARRAY_LEN(ary);
-	    const VALUE *ptr = RARRAY_CONST_PTR(ary);
+            long len = ARY_HEAP_LEN(ary);
+            long old_capa = ARY_HEAP_CAPA(ary);
+            const VALUE *ptr = ARY_HEAP_PTR(ary);
 
-	    if (len > capacity) len = capacity;
+            if (len > capacity) len = capacity;
             MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
+            ary_heap_free_ptr(ary, ptr, old_capa);
+
             FL_SET_EMBED(ary);
             ARY_SET_LEN(ary, len);
-	    ruby_xfree((VALUE *)ptr);
         }
     }
+
+    ary_verify(ary);
 }
 
 static inline void
 ary_shrink_capa(VALUE ary)
 {
     long capacity = ARY_HEAP_LEN(ary);
-    long old_capa = RARRAY(ary)->as.heap.aux.capa;
+    long old_capa = ARY_HEAP_CAPA(ary);
     assert(!ARY_SHARED_P(ary));
     assert(old_capa >= capacity);
-    if (old_capa > capacity)
-	REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity);
+    if (old_capa > capacity) ary_heap_realloc(ary, capacity);
+
+    ary_verify(ary);
 }
 
 static void
@@ -248,106 +587,121 @@ ary_double_capa(VALUE ary, long min)
     long new_capa = ARY_CAPA(ary) / 2;
 
     if (new_capa < ARY_DEFAULT_SIZE) {
-	new_capa = ARY_DEFAULT_SIZE;
+        new_capa = ARY_DEFAULT_SIZE;
     }
     if (new_capa >= ARY_MAX_SIZE - min) {
-	new_capa = (ARY_MAX_SIZE - min) / 2;
+        new_capa = (ARY_MAX_SIZE - min) / 2;
     }
     new_capa += min;
     ary_resize_capa(ary, new_capa);
+
+    ary_verify(ary);
 }
 
 static void
-rb_ary_decrement_share(VALUE shared)
+rb_ary_decrement_share(VALUE shared_root)
 {
-    if (shared) {
-	long num = ARY_SHARED_NUM(shared) - 1;
-	if (num == 0) {
-	    rb_ary_free(shared);
-	    rb_gc_force_recycle(shared);
-	}
-	else if (num > 0) {
-	    ARY_SET_SHARED_NUM(shared, num);
-	}
+    if (!OBJ_FROZEN(shared_root)) {
+        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num - 1);
     }
 }
 
 static void
 rb_ary_unshare(VALUE ary)
 {
-    VALUE shared = RARRAY(ary)->as.heap.aux.shared;
-    rb_ary_decrement_share(shared);
+    VALUE shared_root = ARY_SHARED_ROOT(ary);
+    rb_ary_decrement_share(shared_root);
     FL_UNSET_SHARED(ary);
 }
 
-static inline void
-rb_ary_unshare_safe(VALUE ary)
+static void
+rb_ary_reset(VALUE ary)
 {
-    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
-	rb_ary_unshare(ary);
+    if (ARY_OWNS_HEAP_P(ary)) {
+        ary_heap_free(ary);
     }
+    else if (ARY_SHARED_P(ary)) {
+        rb_ary_unshare(ary);
+    }
+
+    FL_SET_EMBED(ary);
+    ARY_SET_EMBED_LEN(ary, 0);
 }
 
 static VALUE
-rb_ary_increment_share(VALUE shared)
+rb_ary_increment_share(VALUE shared_root)
 {
-    long num = ARY_SHARED_NUM(shared);
-    if (num >= 0) {
-	ARY_SET_SHARED_NUM(shared, num + 1);
+    if (!OBJ_FROZEN(shared_root)) {
+        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+        assert(num >= 0);
+        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num + 1);
     }
-    return shared;
+    return shared_root;
 }
 
 static void
-rb_ary_set_shared(VALUE ary, VALUE shared)
+rb_ary_set_shared(VALUE ary, VALUE shared_root)
 {
-    rb_ary_increment_share(shared);
+    rb_ary_increment_share(shared_root);
     FL_SET_SHARED(ary);
-    ARY_SET_SHARED(ary, shared);
+    RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+    ARY_SET_SHARED(ary, shared_root);
 }
 
 static inline void
 rb_ary_modify_check(VALUE ary)
 {
     rb_check_frozen(ary);
+    ary_verify(ary);
 }
 
 void
-rb_ary_modify(VALUE ary)
+rb_ary_cancel_sharing(VALUE ary)
 {
-    rb_ary_modify_check(ary);
     if (ARY_SHARED_P(ary)) {
-	long shared_len, len = RARRAY_LEN(ary);
-	VALUE shared = ARY_SHARED(ary);
-        if (len <= RARRAY_EMBED_LEN_MAX) {
-	    const VALUE *ptr = ARY_HEAP_PTR(ary);
+        long shared_len, len = RARRAY_LEN(ary);
+        VALUE shared_root = ARY_SHARED_ROOT(ary);
+
+        ary_verify(shared_root);
+
+        if (len <= ary_embed_capa(ary)) {
+            const VALUE *ptr = ARY_HEAP_PTR(ary);
             FL_UNSET_SHARED(ary);
             FL_SET_EMBED(ary);
-	    MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
-            rb_ary_decrement_share(shared);
+            MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+            rb_ary_decrement_share(shared_root);
             ARY_SET_EMBED_LEN(ary, len);
         }
-	else if (ARY_SHARED_OCCUPIED(shared) && len > ((shared_len = RARRAY_LEN(shared))>>1)) {
-	    long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared);
-	    FL_UNSET_SHARED(ary);
-	    ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared));
-	    ARY_SET_CAPA(ary, shared_len);
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+shift, VALUE, len);
-	    });
-	    FL_SET_EMBED(shared);
-	    rb_ary_decrement_share(shared);
-	}
+        else if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && len > ((shared_len = RARRAY_LEN(shared_root))>>1)) {
+            long shift = RARRAY_CONST_PTR_TRANSIENT(ary) - RARRAY_CONST_PTR_TRANSIENT(shared_root);
+            FL_UNSET_SHARED(ary);
+            ARY_SET_PTR(ary, RARRAY_CONST_PTR_TRANSIENT(shared_root));
+            ARY_SET_CAPA(ary, shared_len);
+            RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+                MEMMOVE(ptr, ptr+shift, VALUE, len);
+            });
+            FL_SET_EMBED(shared_root);
+            rb_ary_decrement_share(shared_root);
+        }
         else {
-            VALUE *ptr = ALLOC_N(VALUE, len);
-            MEMCPY(ptr, RARRAY_CONST_PTR(ary), VALUE, len);
+            VALUE *ptr = ary_heap_alloc(ary, len);
+            MEMCPY(ptr, ARY_HEAP_PTR(ary), VALUE, len);
             rb_ary_unshare(ary);
             ARY_SET_CAPA(ary, len);
             ARY_SET_PTR(ary, ptr);
         }
 
-	rb_gc_writebarrier_remember(ary);
+        rb_gc_writebarrier_remember(ary);
     }
+    ary_verify(ary);
+}
+
+void
+rb_ary_modify(VALUE ary)
+{
+    rb_ary_modify_check(ary);
+    rb_ary_cancel_sharing(ary);
 }
 
 static VALUE
@@ -358,45 +712,58 @@ ary_ensure_room_for_push(VALUE ary, long add_len)
     long capa;
 
     if (old_len > ARY_MAX_SIZE - add_len) {
-	rb_raise(rb_eIndexError, "index %ld too big", new_len);
+        rb_raise(rb_eIndexError, "index %ld too big", new_len);
     }
     if (ARY_SHARED_P(ary)) {
-	if (new_len > RARRAY_EMBED_LEN_MAX) {
-	    VALUE shared = ARY_SHARED(ary);
-	    if (ARY_SHARED_OCCUPIED(shared)) {
-		if (RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared) + new_len <= RARRAY_LEN(shared)) {
-		    rb_ary_modify_check(ary);
-		    return shared;
-		}
-		else {
-		    /* if array is shared, then it is likely it participate in push/shift pattern */
-		    rb_ary_modify(ary);
-		    capa = ARY_CAPA(ary);
-		    if (new_len > capa - (capa >> 6)) {
-			ary_double_capa(ary, new_len);
-		    }
-		    return ary;
-		}
-	    }
-	}
+        if (new_len > ary_embed_capa(ary)) {
+            VALUE shared_root = ARY_SHARED_ROOT(ary);
+            if (ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+                if (ARY_HEAP_PTR(ary) - RARRAY_CONST_PTR_TRANSIENT(shared_root) + new_len <= RARRAY_LEN(shared_root)) {
+                    rb_ary_modify_check(ary);
+
+                    ary_verify(ary);
+                    ary_verify(shared_root);
+                    return shared_root;
+                }
+                else {
+                    /* if array is shared, then it is likely it participate in push/shift pattern */
+                    rb_ary_modify(ary);
+                    capa = ARY_CAPA(ary);
+                    if (new_len > capa - (capa >> 6)) {
+                        ary_double_capa(ary, new_len);
+                    }
+                    ary_verify(ary);
+                    return ary;
+                }
+            }
+        }
+        ary_verify(ary);
+        rb_ary_modify(ary);
+    }
+    else {
+        rb_ary_modify_check(ary);
     }
-    rb_ary_modify(ary);
     capa = ARY_CAPA(ary);
     if (new_len > capa) {
-	ary_double_capa(ary, new_len);
+        ary_double_capa(ary, new_len);
     }
 
+    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *      ary.freeze -> ary
+ *    array.freeze -> self
+ *
+ *  Freezes +self+; returns +self+:
  *
- *  Calls Object#freeze on +ary+ to prevent any further
- *  modification. A RuntimeError will be raised if a modification
- *  attempt is made.
+ *    a = []
+ *    a.frozen? # => false
+ *    a.freeze
+ *    a.frozen? # => true
  *
+ *  An attempt to modify a frozen \Array raises FrozenError.
  */
 
 VALUE
@@ -405,21 +772,6 @@ rb_ary_freeze(VALUE ary)
     return rb_obj_freeze(ary);
 }
 
-/*
- *  call-seq:
- *     ary.frozen?  -> true or false
- *
- *  Return +true+ if this array is frozen (or temporarily frozen
- *  while being sorted). See also Object#frozen?
- */
-
-static VALUE
-rb_ary_frozen_p(VALUE ary)
-{
-    if (OBJ_FROZEN(ary)) return Qtrue;
-    return Qfalse;
-}
-
 /* This can be used to take a snapshot of an array (with
    e.g. rb_ary_replace) and check later whether the array has been
    modified from the snapshot.  The snapshot is cheap, though if
@@ -431,18 +783,25 @@ VALUE
 rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
 {
     if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
-	!ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
-	RARRAY(ary1)->as.heap.aux.shared == RARRAY(ary2)->as.heap.aux.shared &&
-	RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
-	return Qtrue;
+            !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
+            ARY_SHARED_ROOT(ary1) == ARY_SHARED_ROOT(ary2) &&
+            ARY_HEAP_LEN(ary1) == ARY_HEAP_LEN(ary2)) {
+        return Qtrue;
     }
     return Qfalse;
 }
 
 static VALUE
-ary_alloc(VALUE klass)
+ary_alloc_embed(VALUE klass, long capa)
 {
-    NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+    size_t size = ary_embed_size(capa);
+    assert(rb_gc_size_allocatable_p(size));
+#if !USE_RVARGC
+    assert(size <= sizeof(struct RArray));
+#endif
+    RVARGC_NEWOBJ_OF(ary, struct RArray, klass,
+                     T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+                     size);
     /* Created array is:
      *   FL_SET_EMBED((VALUE)ary);
      *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
@@ -451,13 +810,19 @@ ary_alloc(VALUE klass)
 }
 
 static VALUE
-empty_ary_alloc(VALUE klass)
+ary_alloc_heap(VALUE klass)
 {
-    if (RUBY_DTRACE_ARRAY_CREATE_ENABLED()) {
-	RUBY_DTRACE_ARRAY_CREATE(0, rb_sourcefile(), rb_sourceline());
-    }
+    RVARGC_NEWOBJ_OF(ary, struct RArray, klass,
+                     T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+                     sizeof(struct RArray));
+    return (VALUE)ary;
+}
 
-    return ary_alloc(klass);
+static VALUE
+empty_ary_alloc(VALUE klass)
+{
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
+    return ary_alloc_embed(klass, 0);
 }
 
 static VALUE
@@ -466,22 +831,24 @@ ary_new(VALUE klass, long capa)
     VALUE ary,*ptr;
 
     if (capa < 0) {
-	rb_raise(rb_eArgError, "negative array size (or size too big)");
+        rb_raise(rb_eArgError, "negative array size (or size too big)");
     }
     if (capa > ARY_MAX_SIZE) {
-	rb_raise(rb_eArgError, "array size too big");
+        rb_raise(rb_eArgError, "array size too big");
     }
 
-    if (RUBY_DTRACE_ARRAY_CREATE_ENABLED()) {
-	RUBY_DTRACE_ARRAY_CREATE(capa, rb_sourcefile(), rb_sourceline());
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+    if (ary_embeddable_p(capa)) {
+        ary = ary_alloc_embed(klass, capa);
     }
+    else {
+        ary = ary_alloc_heap(klass);
+        ARY_SET_CAPA(ary, capa);
+        assert(!ARY_EMBED_P(ary));
 
-    ary = ary_alloc(klass);
-    if (capa > RARRAY_EMBED_LEN_MAX) {
-	ptr = ALLOC_N(VALUE, capa);
-        FL_UNSET_EMBED(ary);
+        ptr = ary_heap_alloc(ary, capa);
         ARY_SET_PTR(ary, ptr);
-        ARY_SET_CAPA(ary, capa);
         ARY_SET_HEAP_LEN(ary, 0);
     }
 
@@ -497,7 +864,7 @@ rb_ary_new_capa(long capa)
 VALUE
 rb_ary_new(void)
 {
-    return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
+    return rb_ary_new_capa(0);
 }
 
 VALUE
@@ -511,7 +878,7 @@ VALUE
 
     va_start(ar, n);
     for (i=0; i<n; i++) {
-	ARY_SET(ary, i, va_arg(ar, VALUE));
+        ARY_SET(ary, i, va_arg(ar, VALUE));
     }
     va_end(ar);
 
@@ -519,30 +886,109 @@ VALUE
     return ary;
 }
 
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_tmp_new_from_values(VALUE klass, long n, const VALUE *elts)
+{
+    VALUE ary;
+
+    ary = ary_new(klass, n);
+    if (n > 0 && elts) {
+        ary_memcpy(ary, 0, n, elts);
+        ARY_SET_LEN(ary, n);
+    }
+
+    return ary;
+}
+
 VALUE
 rb_ary_new_from_values(long n, const VALUE *elts)
 {
+    return rb_ary_tmp_new_from_values(rb_cArray, n, elts);
+}
+
+static VALUE
+ec_ary_alloc_embed(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+    size_t size = ary_embed_size(capa);
+    assert(rb_gc_size_allocatable_p(size));
+#if !USE_RVARGC
+    assert(size <= sizeof(struct RArray));
+#endif
+    RB_RVARGC_EC_NEWOBJ_OF(ec, ary, struct RArray, klass,
+                           T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+                           size);
+    /* Created array is:
+     *   FL_SET_EMBED((VALUE)ary);
+     *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
+     */
+    return (VALUE)ary;
+}
+
+static VALUE
+ec_ary_alloc_heap(rb_execution_context_t *ec, VALUE klass)
+{
+    RB_RVARGC_EC_NEWOBJ_OF(ec, ary, struct RArray, klass,
+                           T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+                           sizeof(struct RArray));
+    return (VALUE)ary;
+}
+
+static VALUE
+ec_ary_new(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+    VALUE ary,*ptr;
+
+    if (capa < 0) {
+        rb_raise(rb_eArgError, "negative array size (or size too big)");
+    }
+    if (capa > ARY_MAX_SIZE) {
+        rb_raise(rb_eArgError, "array size too big");
+    }
+
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+    if (ary_embeddable_p(capa)) {
+        ary = ec_ary_alloc_embed(ec, klass, capa);
+    }
+    else {
+        ary = ec_ary_alloc_heap(ec, klass);
+        ARY_SET_CAPA(ary, capa);
+        assert(!ARY_EMBED_P(ary));
+
+        ptr = ary_heap_alloc(ary, capa);
+        ARY_SET_PTR(ary, ptr);
+        ARY_SET_HEAP_LEN(ary, 0);
+    }
+
+    return ary;
+}
+
+VALUE
+rb_ec_ary_new_from_values(rb_execution_context_t *ec, long n, const VALUE *elts)
+{
     VALUE ary;
 
-    ary = rb_ary_new2(n);
+    ary = ec_ary_new(ec, rb_cArray, n);
     if (n > 0 && elts) {
-	ary_memcpy(ary, 0, n, elts);
-	ARY_SET_LEN(ary, n);
+        ary_memcpy(ary, 0, n, elts);
+        ARY_SET_LEN(ary, n);
     }
 
     return ary;
 }
 
 VALUE
-rb_ary_tmp_new(long capa)
+rb_ary_hidden_new(long capa)
 {
-    return ary_new(0, capa);
+    VALUE ary = ary_new(0, capa);
+    rb_ary_transient_heap_evacuate(ary, TRUE);
+    return ary;
 }
 
 VALUE
-rb_ary_tmp_new_fill(long capa)
+rb_ary_hidden_new_fill(long capa)
 {
-    VALUE ary = ary_new(0, capa);
+    VALUE ary = rb_ary_hidden_new(capa);
     ary_memfill(ary, 0, capa, Qnil);
     ARY_SET_LEN(ary, capa);
     return ary;
@@ -552,7 +998,29 @@ void
 rb_ary_free(VALUE ary)
 {
     if (ARY_OWNS_HEAP_P(ary)) {
-	ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+        if (USE_DEBUG_COUNTER &&
+            !ARY_SHARED_ROOT_P(ary) &&
+            ARY_HEAP_CAPA(ary) > RARRAY_LEN(ary)) {
+            RB_DEBUG_COUNTER_INC(obj_ary_extracapa);
+        }
+
+        if (RARRAY_TRANSIENT_P(ary)) {
+            RB_DEBUG_COUNTER_INC(obj_ary_transient);
+        }
+        else {
+            RB_DEBUG_COUNTER_INC(obj_ary_ptr);
+            ary_heap_free(ary);
+        }
+    }
+    else {
+        RB_DEBUG_COUNTER_INC(obj_ary_embed);
+    }
+
+    if (ARY_SHARED_P(ary)) {
+        RB_DEBUG_COUNTER_INC(obj_ary_shared);
+    }
+    if (ARY_SHARED_ROOT_P(ary) && ARY_SHARED_ROOT_OCCUPIED(ary)) {
+        RB_DEBUG_COUNTER_INC(obj_ary_shared_root_occupied);
     }
 }
 
@@ -560,51 +1028,69 @@ RUBY_FUNC_EXPORTED size_t
 rb_ary_memsize(VALUE ary)
 {
     if (ARY_OWNS_HEAP_P(ary)) {
-	return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
+        return ARY_CAPA(ary) * sizeof(VALUE);
     }
     else {
-	return 0;
+        return 0;
     }
 }
 
-static inline void
-ary_discard(VALUE ary)
-{
-    rb_ary_free(ary);
-    RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
-    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
-}
-
 static VALUE
 ary_make_shared(VALUE ary)
 {
-    assert(!ARY_EMBED_P(ary));
+    assert(USE_RVARGC || !ARY_EMBED_P(ary));
+    ary_verify(ary);
+
     if (ARY_SHARED_P(ary)) {
-	return ARY_SHARED(ary);
+        return ARY_SHARED_ROOT(ary);
     }
     else if (ARY_SHARED_ROOT_P(ary)) {
-	return ary;
+        return ary;
     }
     else if (OBJ_FROZEN(ary)) {
-	ary_shrink_capa(ary);
-	FL_SET_SHARED_ROOT(ary);
-	ARY_SET_SHARED_NUM(ary, 1);
-	return ary;
+        if (!ARY_EMBED_P(ary)) {
+            rb_ary_transient_heap_evacuate(ary, TRUE);
+            ary_shrink_capa(ary);
+        }
+        return ary;
     }
     else {
-	long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
-	NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
-        FL_UNSET_EMBED(shared);
+        rb_ary_transient_heap_evacuate(ary, TRUE);
+
+        long capa = ARY_CAPA(ary);
+        long len = RARRAY_LEN(ary);
+
+        /* Shared roots cannot be embedded because the reference count
+         * (refcnt) is stored in as.heap.aux.capa. */
+        VALUE shared = ary_alloc_heap(0);
+        FL_SET_SHARED_ROOT(shared);
+
+        if (ARY_EMBED_P(ary)) {
+            /* Cannot use ary_heap_alloc because we don't want to allocate
+             * on the transient heap. */
+            VALUE *ptr = ALLOC_N(VALUE, capa);
+            ARY_SET_PTR(shared, ptr);
+            ary_memcpy(shared, 0, len, RARRAY_PTR(ary));
 
-	ARY_SET_LEN((VALUE)shared, capa);
-	ARY_SET_PTR((VALUE)shared, RARRAY_CONST_PTR(ary));
-	ary_mem_clear((VALUE)shared, len, capa - len);
-	FL_SET_SHARED_ROOT(shared);
-	ARY_SET_SHARED_NUM((VALUE)shared, 1);
-	FL_SET_SHARED(ary);
-	ARY_SET_SHARED(ary, (VALUE)shared);
-	OBJ_FREEZE(shared);
-	return (VALUE)shared;
+            FL_UNSET_EMBED(ary);
+            ARY_SET_HEAP_LEN(ary, len);
+            ARY_SET_PTR(ary, ptr);
+        }
+        else {
+            ARY_SET_PTR(shared, RARRAY_PTR(ary));
+        }
+
+        ARY_SET_LEN(shared, capa);
+        ary_mem_clear(shared, len, capa - len);
+        ARY_SET_SHARED_ROOT_REFCNT(shared, 1);
+        FL_SET_SHARED(ary);
+        RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+        ARY_SET_SHARED(ary, shared);
+
+        ary_verify(shared);
+        ary_verify(ary);
+
+        return shared;
     }
 }
 
@@ -613,9 +1099,11 @@ ary_make_substitution(VALUE ary)
 {
     long len = RARRAY_LEN(ary);
 
-    if (len <= RARRAY_EMBED_LEN_MAX) {
-	VALUE subst = rb_ary_new2(len);
-	ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
+    if (ary_embeddable_p(len)) {
+        VALUE subst = rb_ary_new_capa(len);
+        assert(ARY_EMBED_P(subst));
+
+        ary_memcpy(subst, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary));
         ARY_SET_EMBED_LEN(subst, len);
         return subst;
     }
@@ -630,35 +1118,43 @@ rb_assoc_new(VALUE car, VALUE cdr)
     return rb_ary_new3(2, car, cdr);
 }
 
-static VALUE
-to_ary(VALUE ary)
+VALUE
+rb_to_array_type(VALUE ary)
 {
-    return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
+    return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
 }
+#define to_ary rb_to_array_type
 
 VALUE
 rb_check_array_type(VALUE ary)
 {
-    return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
+    return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_check_to_array(VALUE ary)
+{
+    return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
+}
+
+VALUE
+rb_to_array(VALUE ary)
+{
+    return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
 }
 
 /*
  *  call-seq:
- *     Array.try_convert(obj) -> array or nil
+ *    Array.try_convert(object) -> object, new_array, or nil
  *
- *  Tries to convert +obj+ into an array, using +to_ary+ method.  Returns the
- *  converted array or +nil+ if +obj+ cannot be converted for any reason.
- *  This method can be used to check if an argument is an array.
+ *  If +object+ is an \Array object, returns +object+.
  *
- *     Array.try_convert([1])   #=> [1]
- *     Array.try_convert("1")   #=> nil
+ *  Otherwise if +object+ responds to <tt>:to_ary</tt>,
+ *  calls <tt>object.to_ary</tt> and returns the result.
  *
- *     if tmp = Array.try_convert(arg)
- *       # the argument is an array
- *     elsif tmp = String.try_convert(arg)
- *       # the argument is a string
- *     end
+ *  Returns +nil+ if +object+ does not respond to <tt>:to_ary</tt>
  *
+ *  Raises an exception unless <tt>object.to_ary</tt> returns an \Array object.
  */
 
 static VALUE
@@ -667,60 +1163,76 @@ rb_ary_s_try_convert(VALUE dummy, VALUE ary)
     return rb_check_array_type(ary);
 }
 
+/* :nodoc: */
+static VALUE
+rb_ary_s_new(int argc, VALUE *argv, VALUE klass)
+{
+    VALUE ary;
+
+    if (klass == rb_cArray) {
+        long size = 0;
+        if (argc > 0 && FIXNUM_P(argv[0])) {
+            size = FIX2LONG(argv[0]);
+            if (size < 0) size = 0;
+        }
+
+        ary = ary_new(klass, size);
+
+        rb_obj_call_init_kw(ary, argc, argv, RB_PASS_CALLED_KEYWORDS);
+    }
+    else {
+        ary = rb_class_new_instance_pass_kw(argc, argv, klass);
+    }
+
+    return ary;
+}
+
 /*
  *  call-seq:
- *     Array.new(size=0, default=nil)
- *     Array.new(array)
- *     Array.new(size) {|index| block }
- *
- *  Returns a new array.
- *
- *  In the first form, if no arguments are sent, the new array will be empty.
- *  When a +size+ and an optional +default+ are sent, an array is created with
- *  +size+ copies of +default+.  Take notice that all elements will reference the
- *  same object +default+.
+ *    Array.new -> new_empty_array
+ *    Array.new(array) -> new_array
+ *    Array.new(size) -> new_array
+ *    Array.new(size, default_value) -> new_array
+ *    Array.new(size) {|index| ... } -> new_array
  *
- *  The second form creates a copy of the array passed as a parameter (the
- *  array is generated by calling to_ary on the parameter).
+ *  Returns a new \Array.
  *
- *    first_array = ["Matz", "Guido"]
+ *  With no block and no arguments, returns a new empty \Array object.
  *
- *    second_array = Array.new(first_array) #=> ["Matz", "Guido"]
+ *  With no block and a single \Array argument +array+,
+ *  returns a new \Array formed from +array+:
  *
- *    first_array.equal? second_array       #=> false
+ *    a = Array.new([:foo, 'bar', 2])
+ *    a.class # => Array
+ *    a # => [:foo, "bar", 2]
  *
- *  In the last form, an array of the given size is created.  Each element in
- *  this array is created by passing the element's index to the given block
- *  and storing the return value.
+ *  With no block and a single \Integer argument +size+,
+ *  returns a new \Array of the given size
+ *  whose elements are all +nil+:
  *
- *    Array.new(3){ |index| index ** 2 }
- *    # => [0, 1, 4]
+ *    a = Array.new(3)
+ *    a # => [nil, nil, nil]
  *
- *  == Common gotchas
+ *  With no block and arguments +size+ and +default_value+,
+ *  returns an \Array of the given size;
+ *  each element is that same +default_value+:
  *
- *  When sending the second parameter, the same object will be used as the
- *  value for all the array elements:
+ *    a = Array.new(3, 'x')
+ *    a # => ['x', 'x', 'x']
  *
- *     a = Array.new(2, Hash.new)
- *     # => [{}, {}]
+ *  With a block and argument +size+,
+ *  returns an \Array of the given size;
+ *  the block is called with each successive integer +index+;
+ *  the element for that +index+ is the return value from the block:
  *
- *     a[0]['cat'] = 'feline'
- *     a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
+ *    a = Array.new(3) {|index| "Element #{index}" }
+ *    a # => ["Element 0", "Element 1", "Element 2"]
  *
- *     a[1]['cat'] = 'Felix'
- *     a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
- *
- *  Since all the Array elements store the same hash, changes to one of them
- *  will affect them all.
- *
- *  If multiple copies are what you want, you should use the block
- *  version which uses the result of that block each time an element
- *  of the array needs to be initialized:
- *
- *     a = Array.new(2) { Hash.new }
- *     a[0]['cat'] = 'feline'
- *     a # => [{"cat"=>"feline"}, {}]
+ *  Raises ArgumentError if +size+ is negative.
  *
+ *  With a block and no argument,
+ *  or a single argument +0+,
+ *  ignores the block and returns a new empty \Array.
  */
 
 static VALUE
@@ -731,51 +1243,48 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
 
     rb_ary_modify(ary);
     if (argc == 0) {
-	if (ARY_OWNS_HEAP_P(ary) && RARRAY_CONST_PTR(ary) != 0) {
-	    ruby_sized_xfree((void *)RARRAY_CONST_PTR(ary), ARY_HEAP_SIZE(ary));
-	}
-        rb_ary_unshare_safe(ary);
-        FL_SET_EMBED(ary);
-	ARY_SET_EMBED_LEN(ary, 0);
-	if (rb_block_given_p()) {
-	    rb_warning("given block not used");
-	}
-	return ary;
+        rb_ary_reset(ary);
+        assert(ARY_EMBED_P(ary));
+        assert(ARY_EMBED_LEN(ary) == 0);
+        if (rb_block_given_p()) {
+            rb_warning("given block not used");
+        }
+        return ary;
     }
     rb_scan_args(argc, argv, "02", &size, &val);
     if (argc == 1 && !FIXNUM_P(size)) {
-	val = rb_check_array_type(size);
-	if (!NIL_P(val)) {
-	    rb_ary_replace(ary, val);
-	    return ary;
-	}
+        val = rb_check_array_type(size);
+        if (!NIL_P(val)) {
+            rb_ary_replace(ary, val);
+            return ary;
+        }
     }
 
     len = NUM2LONG(size);
     /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
     if (len < 0) {
-	rb_raise(rb_eArgError, "negative array size");
+        rb_raise(rb_eArgError, "negative array size");
     }
     if (len > ARY_MAX_SIZE) {
-	rb_raise(rb_eArgError, "array size too big");
+        rb_raise(rb_eArgError, "array size too big");
     }
     /* recheck after argument conversion */
     rb_ary_modify(ary);
     ary_resize_capa(ary, len);
     if (rb_block_given_p()) {
-	long i;
+        long i;
 
-	if (argc == 2) {
-	    rb_warn("block supersedes default value argument");
-	}
-	for (i=0; i<len; i++) {
-	    rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
-	    ARY_SET_LEN(ary, i + 1);
-	}
+        if (argc == 2) {
+            rb_warn("block supersedes default value argument");
+        }
+        for (i=0; i<len; i++) {
+            rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
+            ARY_SET_LEN(ary, i + 1);
+        }
     }
     else {
-	ary_memfill(ary, 0, len, val);
-	ARY_SET_LEN(ary, len);
+        ary_memfill(ary, 0, len, val);
+        ARY_SET_LEN(ary, len);
     }
     return ary;
 }
@@ -783,7 +1292,7 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
 /*
  * Returns a new array populated with the given objects.
  *
- *   Array.[]( 1, 'a', /^A/ ) # => [1, "a", /^A/]
+ *   Array.[]( 1, 'a', /^A/)  # => [1, "a", /^A/]
  *   Array[ 1, 'a', /^A/ ]    # => [1, "a", /^A/]
  *   [ 1, 'a', /^A/ ]         # => [1, "a", /^A/]
  */
@@ -806,26 +1315,26 @@ rb_ary_store(VALUE ary, long idx, VALUE val)
     long len = RARRAY_LEN(ary);
 
     if (idx < 0) {
-	idx += len;
-	if (idx < 0) {
-	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-		     idx - len, -len);
-	}
+        idx += len;
+        if (idx < 0) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     idx - len, -len);
+        }
     }
     else if (idx >= ARY_MAX_SIZE) {
-	rb_raise(rb_eIndexError, "index %ld too big", idx);
+        rb_raise(rb_eIndexError, "index %ld too big", idx);
     }
 
     rb_ary_modify(ary);
     if (idx >= ARY_CAPA(ary)) {
-	ary_double_capa(ary, idx);
+        ary_double_capa(ary, idx);
     }
     if (idx > len) {
-	ary_mem_clear(ary, len, idx - len + 1);
+        ary_mem_clear(ary, len, idx - len + 1);
     }
 
     if (idx >= len) {
-	ARY_SET_LEN(ary, idx + 1);
+        ARY_SET_LEN(ary, idx + 1);
     }
     ARY_SET(ary, idx, val);
 }
@@ -837,31 +1346,87 @@ ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
     assert(len >= 0);
     assert(offset+len <= RARRAY_LEN(ary));
 
-    if (len <= RARRAY_EMBED_LEN_MAX) {
-        VALUE result = ary_alloc(klass);
-	ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
+    const size_t rarray_embed_capa_max = (sizeof(struct RArray) - offsetof(struct RArray, as.ary)) / sizeof(VALUE);
+
+    if ((size_t)len <= rarray_embed_capa_max && ary_embeddable_p(len)) {
+        VALUE result = ary_alloc_embed(klass, len);
+        ary_memcpy(result, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary) + offset);
         ARY_SET_EMBED_LEN(result, len);
         return result;
     }
     else {
-        VALUE shared, result = ary_alloc(klass);
-        FL_UNSET_EMBED(result);
+        VALUE shared = ary_make_shared(ary);
 
-        shared = ary_make_shared(ary);
-        ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
+        VALUE result = ary_alloc_heap(klass);
+        assert(!ARY_EMBED_P(result));
+
+        ARY_SET_PTR(result, RARRAY_CONST_PTR_TRANSIENT(ary));
         ARY_SET_LEN(result, RARRAY_LEN(ary));
         rb_ary_set_shared(result, shared);
 
         ARY_INCREASE_PTR(result, offset);
         ARY_SET_LEN(result, len);
+
+        ary_verify(shared);
+        ary_verify(result);
+        return result;
+    }
+}
+
+static VALUE
+ary_make_partial_step(VALUE ary, VALUE klass, long offset, long len, long step)
+{
+    assert(offset >= 0);
+    assert(len >= 0);
+    assert(offset+len <= RARRAY_LEN(ary));
+    assert(step != 0);
+
+    const VALUE *values = RARRAY_CONST_PTR_TRANSIENT(ary);
+    const long orig_len = len;
+
+    if (step > 0 && step >= len) {
+        VALUE result = ary_new(klass, 1);
+        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+        RB_OBJ_WRITE(result, ptr, values[offset]);
+        ARY_SET_EMBED_LEN(result, 1);
         return result;
     }
+    else if (step < 0 && step < -len) {
+        step = -len;
+    }
+
+    long ustep = (step < 0) ? -step : step;
+    len = roomof(len, ustep);
+
+    long i;
+    long j = offset + ((step > 0) ? 0 : (orig_len - 1));
+
+    VALUE result = ary_new(klass, len);
+    if (ARY_EMBED_P(result)) {
+        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+        for (i = 0; i < len; ++i) {
+            RB_OBJ_WRITE(result, ptr+i, values[j]);
+            j += step;
+        }
+        ARY_SET_EMBED_LEN(result, len);
+    }
+    else {
+        RARRAY_PTR_USE_TRANSIENT(result, ptr, {
+            for (i = 0; i < len; ++i) {
+                RB_OBJ_WRITE(result, ptr+i, values[j]);
+                j += step;
+            }
+        });
+        ARY_SET_LEN(result, len);
+    }
+
+    return result;
 }
 
 static VALUE
 ary_make_shared_copy(VALUE ary)
 {
-    return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
 }
 
 enum ary_take_pos_flags
@@ -873,48 +1438,57 @@ enum ary_take_pos_flags
 static VALUE
 ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
 {
-    VALUE nv;
     long n;
     long len;
     long offset = 0;
 
-    rb_scan_args(argc, argv, "1", &nv);
-    n = NUM2LONG(nv);
+    argc = rb_check_arity(argc, 0, 1);
+    /* the case optional argument is omitted should be handled in
+     * callers of this function.  if another arity case is added,
+     * this arity check needs to rewrite. */
+    RUBY_ASSERT_ALWAYS(argc == 1);
+
+    n = NUM2LONG(argv[0]);
     len = RARRAY_LEN(ary);
     if (n > len) {
-	n = len;
+        n = len;
     }
     else if (n < 0) {
-	rb_raise(rb_eArgError, "negative array size");
+        rb_raise(rb_eArgError, "negative array size");
     }
     if (last) {
-	offset = len - n;
+        offset = len - n;
     }
     return ary_make_partial(ary, rb_cArray, offset, n);
 }
 
 /*
  *  call-seq:
- *     ary << obj            -> ary
+ *    array << object -> self
  *
- *  Append---Pushes the given object on to the end of this array. This
- *  expression returns the array itself, so several appends
- *  may be chained together.
+ *  Appends +object+ to +self+; returns +self+:
  *
- *     [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
- *             #=>  [ 1, 2, "c", "d", [ 3, 4 ] ]
+ *    a = [:foo, 'bar', 2]
+ *    a << :baz # => [:foo, "bar", 2, :baz]
+ *
+ *  Appends +object+ as one element, even if it is another \Array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a << [3, 4]
+ *    a1 # => [:foo, "bar", 2, [3, 4]]
  *
  */
 
 VALUE
 rb_ary_push(VALUE ary, VALUE item)
 {
-    long idx = RARRAY_LEN(ary);
+    long idx = RARRAY_LEN((ary_verify(ary), ary));
     VALUE target_ary = ary_ensure_room_for_push(ary, 1);
-    RARRAY_PTR_USE(ary, ptr, {
-	RB_OBJ_WRITE(target_ary, &ptr[idx], item);
+    RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+        RB_OBJ_WRITE(target_ary, &ptr[idx], item);
     });
     ARY_SET_LEN(ary, idx + 1);
+    ary_verify(ary);
     return ary;
 }
 
@@ -930,18 +1504,24 @@ rb_ary_cat(VALUE ary, const VALUE *argv, long len)
 
 /*
  *  call-seq:
- *     ary.push(obj, ... )   -> ary
- *
- *  Append --- Pushes the given object(s) on to the end of this array. This
- *  expression returns the array itself, so several appends
- *  may be chained together. See also Array#pop for the opposite
- *  effect.
- *
- *     a = [ "a", "b", "c" ]
- *     a.push("d", "e", "f")
- *             #=> ["a", "b", "c", "d", "e", "f"]
- *     [1, 2, 3,].push(4).push(5)
- *             #=> [1, 2, 3, 4, 5]
+ *    array.push(*objects) -> self
+ *
+ *  Appends trailing elements.
+ *
+ *  Appends each argument in +objects+ to +self+;  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.push(:baz, :bat) # => [:foo, "bar", 2, :baz, :bat]
+ *
+ *  Appends each argument as one element, even if it is another \Array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a.push([:baz, :bat], [:bam, :bad])
+ *    a1 # => [:foo, "bar", 2, [:baz, :bat], [:bam, :bad]]
+ *
+ *  Array#append is an alias for Array#push.
+ *
+ *  Related: #pop, #shift, #unshift.
  */
 
 static VALUE
@@ -958,32 +1538,46 @@ rb_ary_pop(VALUE ary)
     n = RARRAY_LEN(ary);
     if (n == 0) return Qnil;
     if (ARY_OWNS_HEAP_P(ary) &&
-	n * 3 < ARY_CAPA(ary) &&
-	ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+        n * 3 < ARY_CAPA(ary) &&
+        ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
     {
-	ary_resize_capa(ary, n * 2);
+        ary_resize_capa(ary, n * 2);
     }
     --n;
     ARY_SET_LEN(ary, n);
+    ary_verify(ary);
     return RARRAY_AREF(ary, n);
 }
 
 /*
  *  call-seq:
- *     ary.pop    -> obj or nil
- *     ary.pop(n) -> new_ary
+ *    array.pop -> object or nil
+ *    array.pop(n) -> new_array
  *
- *  Removes the last element from +self+ and returns it, or
- *  +nil+ if the array is empty.
+ *  Removes and returns trailing elements.
  *
- *  If a number +n+ is given, returns an array of the last +n+ elements
- *  (or less) just like <code>array.slice!(-n, n)</code> does. See also
- *  Array#push for the opposite effect.
+ *  When no argument is given and +self+ is not empty,
+ *  removes and returns the last element:
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.pop     #=> "d"
- *     a.pop(2)  #=> ["b", "c"]
- *     a         #=> ["a"]
+ *    a = [:foo, 'bar', 2]
+ *    a.pop # => 2
+ *    a # => [:foo, "bar"]
+ *
+ *  Returns +nil+ if the array is empty.
+ *
+ *  When a non-negative \Integer argument +n+ is given and is in range,
+ *
+ *  removes and returns the last +n+ elements in a new \Array:
+ *    a = [:foo, 'bar', 2]
+ *    a.pop(2) # => ["bar", 2]
+ *
+ *  If +n+ is positive and out of range,
+ *  removes and returns all elements:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.pop(50) # => [:foo, "bar", 2]
+ *
+ *  Related: #push, #shift, #unshift.
  */
 
 static VALUE
@@ -992,12 +1586,13 @@ rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
     VALUE result;
 
     if (argc == 0) {
-	return rb_ary_pop(ary);
+        return rb_ary_pop(ary);
     }
 
     rb_ary_modify_check(ary);
     result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+    ary_verify(ary);
     return result;
 }
 
@@ -1007,52 +1602,49 @@ rb_ary_shift(VALUE ary)
     VALUE top;
     long len = RARRAY_LEN(ary);
 
-    rb_ary_modify_check(ary);
-    if (len == 0) return Qnil;
+    if (len == 0) {
+        rb_ary_modify_check(ary);
+        return Qnil;
+    }
+
     top = RARRAY_AREF(ary, 0);
-    if (!ARY_SHARED_P(ary)) {
-	if (len < ARY_DEFAULT_SIZE) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+1, VALUE, len-1);
-	    }); /* WB: no new reference */
-            ARY_INCREASE_LEN(ary, -1);
-	    return top;
-	}
-        assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
-
-	ARY_SET(ary, 0, Qnil);
-	ary_make_shared(ary);
-    }
-    else if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
-	RARRAY_PTR_USE(ary, ptr, ptr[0] = Qnil);
-    }
-    ARY_INCREASE_PTR(ary, 1);		/* shift ptr */
-    ARY_INCREASE_LEN(ary, -1);
+
+    rb_ary_behead(ary, 1);
 
     return top;
 }
 
 /*
  *  call-seq:
- *     ary.shift    -> obj or nil
- *     ary.shift(n) -> new_ary
+ *     array.shift -> object or nil
+ *     array.shift(n) -> new_array
+ *
+ *  Removes and returns leading elements.
+ *
+ *  When no argument is given, removes and returns the first element:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.shift # => :foo
+ *    a # => ['bar', 2]
+ *
+ *  Returns +nil+ if +self+ is empty.
+ *
+ *  When positive \Integer argument +n+ is given, removes the first +n+ elements;
+ *  returns those elements in a new \Array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.shift(2) # => [:foo, 'bar']
+ *    a # => [2]
  *
- *  Removes the first element of +self+ and returns it (shifting all
- *  other elements down by one). Returns +nil+ if the array
- *  is empty.
+ *  If +n+ is as large as or larger than <tt>self.length</tt>,
+ *  removes all elements; returns those elements in a new \Array:
  *
- *  If a number +n+ is given, returns an array of the first +n+ elements
- *  (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
- *  containing only the remainder elements, not including what was shifted to
- *  +new_ary+. See also Array#unshift for the opposite effect.
+ *    a = [:foo, 'bar', 2]
+ *    a.shift(3) # => [:foo, 'bar', 2]
  *
- *     args = [ "-m", "-q", "filename" ]
- *     args.shift     #=> "-m"
- *     args           #=> ["-q", "filename"]
+ *  If +n+ is zero, returns a new empty \Array; +self+ is unmodified.
  *
- *     args = [ "-m", "-q", "filename" ]
- *     args.shift(2)  #=> ["-m", "-q"]
- *     args           #=> ["filename"]
+ *  Related: #push, #pop, #unshift.
  */
 
 static VALUE
@@ -1062,104 +1654,147 @@ rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
     long n;
 
     if (argc == 0) {
-	return rb_ary_shift(ary);
+        return rb_ary_shift(ary);
     }
 
     rb_ary_modify_check(ary);
     result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
     n = RARRAY_LEN(result);
-    if (ARY_SHARED_P(ary)) {
-	if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
-	  setup_occupied_shared:
-	    ary_mem_clear(ary, 0, n);
-	}
-        ARY_INCREASE_PTR(ary, n);
+    rb_ary_behead(ary,n);
+
+    return result;
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_behead(VALUE ary, long n)
+{
+    if (n <= 0) {
+        return ary;
     }
-    else {
-	if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
-	    }); /* WB: no new reference */
-	}
-	else {
-	    ary_make_shared(ary);
-	    goto setup_occupied_shared;
-	}
+
+    rb_ary_modify_check(ary);
+
+    if (!ARY_SHARED_P(ary)) {
+        if (ARY_EMBED_P(ary) || RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+            RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+                MEMMOVE(ptr, ptr + n, VALUE, RARRAY_LEN(ary) - n);
+            }); /* WB: no new reference */
+            ARY_INCREASE_LEN(ary, -n);
+            ary_verify(ary);
+            return ary;
+        }
+
+        ary_mem_clear(ary, 0, n);
+        ary_make_shared(ary);
     }
+    else if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
+        ary_mem_clear(ary, 0, n);
+    }
+
+    ARY_INCREASE_PTR(ary, n);
     ARY_INCREASE_LEN(ary, -n);
+    ary_verify(ary);
 
-    return result;
+    return ary;
 }
 
 static VALUE
-ary_ensure_room_for_unshift(VALUE ary, int argc)
+make_room_for_unshift(VALUE ary, const VALUE *head, VALUE *sharedp, int argc, long capa, long len)
+{
+    if (head - sharedp < argc) {
+        long room = capa - len - argc;
+
+        room -= room >> 4;
+        MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+        head = sharedp + argc + room;
+    }
+    ARY_SET_PTR(ary, head - argc);
+    assert(ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary)));
+
+    ary_verify(ary);
+    return ARY_SHARED_ROOT(ary);
+}
+
+static VALUE
+ary_modify_for_unshift(VALUE ary, int argc)
 {
     long len = RARRAY_LEN(ary);
     long new_len = len + argc;
     long capa;
     const VALUE *head, *sharedp;
 
-    if (len > ARY_MAX_SIZE - argc) {
-	rb_raise(rb_eIndexError, "index %ld too big", new_len);
-    }
-
-    if (ARY_SHARED_P(ary)) {
-	VALUE shared = ARY_SHARED(ary);
-	capa = RARRAY_LEN(shared);
-	if (ARY_SHARED_OCCUPIED(shared) && capa > new_len) {
-	    head = RARRAY_CONST_PTR(ary);
-	    sharedp = RARRAY_CONST_PTR(shared);
-	    goto makeroom_if_need;
-	}
-    }
-
     rb_ary_modify(ary);
     capa = ARY_CAPA(ary);
     if (capa - (capa >> 6) <= new_len) {
-	ary_double_capa(ary, new_len);
+        ary_double_capa(ary, new_len);
     }
 
     /* use shared array for big "queues" */
-    if (new_len > ARY_DEFAULT_SIZE * 4) {
-	/* make a room for unshifted items */
-	capa = ARY_CAPA(ary);
-	ary_make_shared(ary);
-
-	head = sharedp = RARRAY_CONST_PTR(ary);
-	goto makeroom;
-      makeroom_if_need:
-	if (head - sharedp < argc) {
-	    long room;
-	  makeroom:
-	    room = capa - new_len;
-	    room -= room >> 4;
-	    MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
-	    head = sharedp + argc + room;
-	}
-	ARY_SET_PTR(ary, head - argc);
-	assert(ARY_SHARED_OCCUPIED(ARY_SHARED(ary)));
-	return ARY_SHARED(ary);
+    if (new_len > ARY_DEFAULT_SIZE * 4 && !ARY_EMBED_P(ary)) {
+        ary_verify(ary);
+
+        /* make a room for unshifted items */
+        capa = ARY_CAPA(ary);
+        ary_make_shared(ary);
+
+        head = sharedp = RARRAY_CONST_PTR_TRANSIENT(ary);
+        return make_room_for_unshift(ary, head, (void *)sharedp, argc, capa, len);
+    }
+    else {
+        /* sliding items */
+        RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+            MEMMOVE(ptr + argc, ptr, VALUE, len);
+        });
+
+        ary_verify(ary);
+        return ary;
+    }
+}
+
+static VALUE
+ary_ensure_room_for_unshift(VALUE ary, int argc)
+{
+    long len = RARRAY_LEN(ary);
+    long new_len = len + argc;
+
+    if (len > ARY_MAX_SIZE - argc) {
+        rb_raise(rb_eIndexError, "index %ld too big", new_len);
+    }
+    else if (! ARY_SHARED_P(ary)) {
+        return ary_modify_for_unshift(ary, argc);
     }
     else {
-	/* sliding items */
-	RARRAY_PTR_USE(ary, ptr, {
-	    MEMMOVE(ptr + argc, ptr, VALUE, len);
-	});
+        VALUE shared_root = ARY_SHARED_ROOT(ary);
+        long capa = RARRAY_LEN(shared_root);
 
-	return ary;
+        if (! ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+            return ary_modify_for_unshift(ary, argc);
+        }
+        else if (new_len > capa) {
+            return ary_modify_for_unshift(ary, argc);
+        }
+        else {
+            const VALUE * head = RARRAY_CONST_PTR_TRANSIENT(ary);
+            void *sharedp = (void *)RARRAY_CONST_PTR_TRANSIENT(shared_root);
+
+            rb_ary_modify_check(ary);
+            return make_room_for_unshift(ary, head, sharedp, argc, capa, len);
+        }
     }
 }
 
 /*
  *  call-seq:
- *     ary.unshift(obj, ...)  -> ary
+ *    array.unshift(*objects) -> self
+ *
+ *  Prepends the given +objects+ to +self+:
  *
- *  Prepends objects to the front of +self+, moving other elements upwards.
- *  See also Array#shift for the opposite effect.
+ *    a = [:foo, 'bar', 2]
+ *    a.unshift(:bam, :bat) # => [:bam, :bat, :foo, "bar", 2]
  *
- *     a = [ "b", "c", "d" ]
- *     a.unshift("a")   #=> ["a", "b", "c", "d"]
- *     a.unshift(1, 2)  #=> [ 1, 2, "a", "b", "c", "d"]
+ *  Array#prepend is an alias for Array#unshift.
+ *
+ *  Related: #push, #pop, #shift.
  */
 
 static VALUE
@@ -1169,8 +1804,8 @@ rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
     VALUE target_ary;
 
     if (argc == 0) {
-	rb_ary_modify_check(ary);
-	return ary;
+        rb_ary_modify_check(ary);
+        return ary;
     }
 
     target_ary = ary_ensure_room_for_unshift(ary, argc);
@@ -1192,7 +1827,7 @@ rb_ary_elt(VALUE ary, long offset)
     long len = RARRAY_LEN(ary);
     if (len == 0) return Qnil;
     if (offset < 0 || len <= offset) {
-	return Qnil;
+        return Qnil;
     }
     return RARRAY_AREF(ary, offset);
 }
@@ -1200,14 +1835,11 @@ rb_ary_elt(VALUE ary, long offset)
 VALUE
 rb_ary_entry(VALUE ary, long offset)
 {
-    if (offset < 0) {
-	offset += RARRAY_LEN(ary);
-    }
-    return rb_ary_elt(ary, offset);
+    return rb_ary_entry_internal(ary, offset);
 }
 
 VALUE
-rb_ary_subseq(VALUE ary, long beg, long len)
+rb_ary_subseq_step(VALUE ary, long beg, long len, long step)
 {
     VALUE klass;
     long alen = RARRAY_LEN(ary);
@@ -1216,98 +1848,186 @@ rb_ary_subseq(VALUE ary, long beg, long len)
     if (beg < 0 || len < 0) return Qnil;
 
     if (alen < len || alen < beg + len) {
-	len = alen - beg;
+        len = alen - beg;
     }
-    klass = rb_obj_class(ary);
+    klass = rb_cArray;
     if (len == 0) return ary_new(klass, 0);
+    if (step == 0)
+        rb_raise(rb_eArgError, "slice step cannot be zero");
+    if (step == 1)
+        return ary_make_partial(ary, klass, beg, len);
+    else
+        return ary_make_partial_step(ary, klass, beg, len, step);
+}
 
-    return ary_make_partial(ary, klass, beg, len);
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
+{
+    return rb_ary_subseq_step(ary, beg, len, 1);
 }
 
+static VALUE rb_ary_aref2(VALUE ary, VALUE b, VALUE e);
+
 /*
  *  call-seq:
- *     ary[index]                -> obj     or nil
- *     ary[start, length]        -> new_ary or nil
- *     ary[range]                -> new_ary or nil
- *     ary.slice(index)          -> obj     or nil
- *     ary.slice(start, length)  -> new_ary or nil
- *     ary.slice(range)          -> new_ary or nil
- *
- *  Element Reference --- Returns the element at +index+, or returns a
- *  subarray starting at the +start+ index and continuing for +length+
- *  elements, or returns a subarray specified by +range+ of indices.
- *
- *  Negative indices count backward from the end of the array (-1 is the last
- *  element).  For +start+ and +range+ cases the starting index is just before
- *  an element.  Additionally, an empty array is returned when the starting
- *  index for an element range is at the end of the array.
- *
- *  Returns +nil+ if the index (or starting index) are out of range.
- *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a[2] +  a[0] + a[1]    #=> "cab"
- *     a[6]                   #=> nil
- *     a[1, 2]                #=> [ "b", "c" ]
- *     a[1..3]                #=> [ "b", "c", "d" ]
- *     a[4..7]                #=> [ "e" ]
- *     a[6..10]               #=> nil
- *     a[-3, 3]               #=> [ "c", "d", "e" ]
- *     # special cases
- *     a[5]                   #=> nil
- *     a[6, 1]                #=> nil
- *     a[5, 1]                #=> []
- *     a[5..10]               #=> []
+ *    array[index] -> object or nil
+ *    array[start, length] -> object or nil
+ *    array[range] -> object or nil
+ *    array[aseq] -> object or nil
+ *    array.slice(index) -> object or nil
+ *    array.slice(start, length) -> object or nil
+ *    array.slice(range) -> object or nil
+ *    array.slice(aseq) -> object or nil
+ *
+ *  Returns elements from +self+; does not modify +self+.
+ *
+ *  When a single \Integer argument +index+ is given, returns the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0] # => :foo
+ *    a[2] # => 2
+ *    a # => [:foo, "bar", 2]
+ *
+ *  If +index+ is negative, counts relative to the end of +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1] # => 2
+ *    a[-2] # => "bar"
+ *
+ *  If +index+ is out of range, returns +nil+.
+ *
+ *  When two \Integer arguments +start+ and +length+ are given,
+ *  returns a new \Array of size +length+ containing successive elements beginning at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 2] # => [:foo, "bar"]
+ *    a[1, 2] # => ["bar", 2]
+ *
+ *  If <tt>start + length</tt> is greater than <tt>self.length</tt>,
+ *  returns all elements from offset +start+ to the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 4] # => [:foo, "bar", 2]
+ *    a[1, 3] # => ["bar", 2]
+ *    a[2, 2] # => [2]
+ *
+ *  If <tt>start == self.size</tt> and <tt>length >= 0</tt>,
+ *  returns a new empty \Array.
+ *
+ *  If +length+ is negative, returns +nil+.
  *
+ *  When a single \Range argument +range+ is given,
+ *  treats <tt>range.min</tt> as +start+ above
+ *  and <tt>range.size</tt> as +length+ above:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..1] # => [:foo, "bar"]
+ *    a[1..2] # => ["bar", 2]
+ *
+ *  Special case: If <tt>range.start == a.size</tt>, returns a new empty \Array.
+ *
+ *  If <tt>range.end</tt> is negative, calculates the end index from the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..-1] # => [:foo, "bar", 2]
+ *    a[0..-2] # => [:foo, "bar"]
+ *    a[0..-3] # => [:foo]
+ *
+ *  If <tt>range.start</tt> is negative, calculates the start index from the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1..2] # => [2]
+ *    a[-2..2] # => ["bar", 2]
+ *    a[-3..2] # => [:foo, "bar", 2]
+ *
+ *  If <tt>range.start</tt> is larger than the array size, returns +nil+.
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[4..1] # => nil
+ *    a[4..0] # => nil
+ *    a[4..-1] # => nil
+ *
+ *  When a single Enumerator::ArithmeticSequence argument +aseq+ is given,
+ *  returns an \Array of elements corresponding to the indexes produced by
+ *  the sequence.
+ *
+ *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ *    a[(1..).step(2)] # => ["data1", "data2", "data3"]
+ *
+ *  Unlike slicing with range, if the start or the end of the arithmetic sequence
+ *  is larger than array size, throws RangeError.
+ *
+ *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ *    a[(1..11).step(2)]
+ *    # RangeError (((1..11).step(2)) out of range)
+ *    a[(7..).step(2)]
+ *    # RangeError (((7..).step(2)) out of range)
+ *
+ *  If given a single argument, and its type is not one of the listed, tries to
+ *  convert it to Integer, and raises if it is impossible:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    # Raises TypeError (no implicit conversion of Symbol into Integer):
+ *    a[:foo]
+ *
+ *  Array#slice is an alias for Array#[].
  */
 
 VALUE
 rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
 {
-    VALUE arg;
-    long beg, len;
-
+    rb_check_arity(argc, 1, 2);
     if (argc == 2) {
-	beg = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
-	if (beg < 0) {
-	    beg += RARRAY_LEN(ary);
-	}
-	return rb_ary_subseq(ary, beg, len);
+        return rb_ary_aref2(ary, argv[0], argv[1]);
     }
-    if (argc != 1) {
-	rb_scan_args(argc, argv, "11", NULL, NULL);
+    return rb_ary_aref1(ary, argv[0]);
+}
+
+static VALUE
+rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
+{
+    long beg = NUM2LONG(b);
+    long len = NUM2LONG(e);
+    if (beg < 0) {
+        beg += RARRAY_LEN(ary);
     }
-    arg = argv[0];
+    return rb_ary_subseq(ary, beg, len);
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_aref1(VALUE ary, VALUE arg)
+{
+    long beg, len, step;
+
     /* special case - speeding up */
     if (FIXNUM_P(arg)) {
-	return rb_ary_entry(ary, FIX2LONG(arg));
+        return rb_ary_entry(ary, FIX2LONG(arg));
     }
-    /* check if idx is Range */
-    switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
+    /* check if idx is Range or ArithmeticSequence */
+    switch (rb_arithmetic_sequence_beg_len_step(arg, &beg, &len, &step, RARRAY_LEN(ary), 0)) {
       case Qfalse:
-	break;
+        break;
       case Qnil:
-	return Qnil;
+        return Qnil;
       default:
-	return rb_ary_subseq(ary, beg, len);
+        return rb_ary_subseq_step(ary, beg, len, step);
     }
+
     return rb_ary_entry(ary, NUM2LONG(arg));
 }
 
 /*
  *  call-seq:
- *     ary.at(index)   ->   obj  or nil
+ *    array.at(index) -> object
  *
- *  Returns the element at +index+. A negative index counts from the end of
- *  +self+. Returns +nil+ if the index is out of range. See also
- *  Array#[].
+ *  Returns the element at \Integer offset +index+; does not modify +self+.
+ *    a = [:foo, 'bar', 2]
+ *    a.at(0) # => :foo
+ *    a.at(2) # => 2
  *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.at(0)     #=> "a"
- *     a.at(-1)    #=> "e"
  */
 
-static VALUE
+VALUE
 rb_ary_at(VALUE ary, VALUE pos)
 {
     return rb_ary_entry(ary, NUM2LONG(pos));
@@ -1315,80 +2035,131 @@ rb_ary_at(VALUE ary, VALUE pos)
 
 /*
  *  call-seq:
- *     ary.first     ->   obj or nil
- *     ary.first(n)  ->   new_ary
+ *    array.first -> object or nil
+ *    array.first(n) -> new_array
+ *
+ *  Returns elements from +self+; does not modify +self+.
+ *
+ *  When no argument is given, returns the first element:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.first # => :foo
+ *    a # => [:foo, "bar", 2]
+ *
+ *  If +self+ is empty, returns +nil+.
  *
- *  Returns the first element, or the first +n+ elements, of the array.
- *  If the array is empty, the first form returns +nil+, and the
- *  second form returns an empty array. See also Array#last for
- *  the opposite effect.
+ *  When non-negative \Integer argument +n+ is given,
+ *  returns the first +n+ elements in a new \Array:
  *
- *     a = [ "q", "r", "s", "t" ]
- *     a.first     #=> "q"
- *     a.first(2)  #=> ["q", "r"]
+ *    a = [:foo, 'bar', 2]
+ *    a.first(2) # => [:foo, "bar"]
+ *
+ *  If <tt>n >= array.size</tt>, returns all elements:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.first(50) # => [:foo, "bar", 2]
+ *
+ *  If <tt>n == 0</tt> returns an new empty \Array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.first(0) # []
+ *
+ *  Related: #last.
  */
-
 static VALUE
 rb_ary_first(int argc, VALUE *argv, VALUE ary)
 {
     if (argc == 0) {
-	if (RARRAY_LEN(ary) == 0) return Qnil;
-	return RARRAY_AREF(ary, 0);
+        if (RARRAY_LEN(ary) == 0) return Qnil;
+        return RARRAY_AREF(ary, 0);
     }
     else {
-	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
     }
 }
 
 /*
  *  call-seq:
- *     ary.last     ->  obj or nil
- *     ary.last(n)  ->  new_ary
+ *    array.last  -> object or nil
+ *    array.last(n) -> new_array
+ *
+ *  Returns elements from +self+; +self+ is not modified.
  *
- *  Returns the last element(s) of +self+. If the array is empty,
- *  the first form returns +nil+.
+ *  When no argument is given, returns the last element:
  *
- *  See also Array#first for the opposite effect.
+ *    a = [:foo, 'bar', 2]
+ *    a.last # => 2
+ *    a # => [:foo, "bar", 2]
  *
- *     a = [ "w", "x", "y", "z" ]
- *     a.last     #=> "z"
- *     a.last(2)  #=> ["y", "z"]
+ *  If +self+ is empty, returns +nil+.
+ *
+ *  When non-negative \Integer argument +n+ is given,
+ *  returns the last +n+ elements in a new \Array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.last(2) # => ["bar", 2]
+ *
+ *  If <tt>n >= array.size</tt>, returns all elements:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.last(50) # => [:foo, "bar", 2]
+ *
+ *  If <tt>n == 0</tt>, returns an new empty \Array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.last(0) # []
+ *
+ *  Related: #first.
  */
 
 VALUE
 rb_ary_last(int argc, const VALUE *argv, VALUE ary)
 {
     if (argc == 0) {
-	long len = RARRAY_LEN(ary);
-	if (len == 0) return Qnil;
-	return RARRAY_AREF(ary, len-1);
+        long len = RARRAY_LEN(ary);
+        if (len == 0) return Qnil;
+        return RARRAY_AREF(ary, len-1);
     }
     else {
-	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     }
 }
 
 /*
  *  call-seq:
- *     ary.fetch(index)                    -> obj
- *     ary.fetch(index, default)           -> obj
- *     ary.fetch(index) { |index| block }  -> obj
- *
- *  Tries to return the element at position +index+, but throws an IndexError
- *  exception if the referenced +index+ lies outside of the array bounds.  This
- *  error can be prevented by supplying a second argument, which will act as a
- *  +default+ value.
- *
- *  Alternatively, if a block is given it will only be executed when an
- *  invalid +index+ is referenced.  Negative values of +index+ count from the
- *  end of the array.
- *
- *     a = [ 11, 22, 33, 44 ]
- *     a.fetch(1)               #=> 22
- *     a.fetch(-1)              #=> 44
- *     a.fetch(4, 'cat')        #=> "cat"
- *     a.fetch(100) { |i| puts "#{i} is out of bounds" }
- *                              #=> "100 is out of bounds"
+ *    array.fetch(index) -> element
+ *    array.fetch(index, default_value) -> element
+ *    array.fetch(index) {|index| ... } -> element
+ *
+ *  Returns the element at offset  +index+.
+ *
+ *  With the single \Integer argument +index+,
+ *  returns the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1) # => "bar"
+ *
+ *  If +index+ is negative, counts from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(-1) # => 2
+ *    a.fetch(-2) # => "bar"
+ *
+ *  With arguments +index+ and +default_value+,
+ *  returns the element at offset +index+ if index is in range,
+ *  otherwise returns +default_value+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1, nil) # => "bar"
+ *
+ *  With argument +index+ and a block,
+ *  returns the element at offset +index+ if index is in range
+ *  (and the block is not called); otherwise calls the block with index and returns its return value:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1) {|index| raise 'Cannot happen' } # => "bar"
+ *    a.fetch(50) {|index| "Value for #{index}" } # => "Value for 50"
+ *
  */
 
 static VALUE
@@ -1401,149 +2172,152 @@ rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
     rb_scan_args(argc, argv, "11", &pos, &ifnone);
     block_given = rb_block_given_p();
     if (block_given && argc == 2) {
-	rb_warn("block supersedes default value argument");
+        rb_warn("block supersedes default value argument");
     }
     idx = NUM2LONG(pos);
 
     if (idx < 0) {
-	idx +=  RARRAY_LEN(ary);
+        idx +=  RARRAY_LEN(ary);
     }
     if (idx < 0 || RARRAY_LEN(ary) <= idx) {
-	if (block_given) return rb_yield(pos);
-	if (argc == 1) {
-	    rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
-			idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
-	}
-	return ifnone;
+        if (block_given) return rb_yield(pos);
+        if (argc == 1) {
+            rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+                        idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+        }
+        return ifnone;
     }
     return RARRAY_AREF(ary, idx);
 }
 
 /*
  *  call-seq:
- *     ary.find_index(obj)             ->  int or nil
- *     ary.find_index { |item| block } ->  int or nil
- *     ary.find_index                  ->  Enumerator
- *     ary.index(obj)             ->  int or nil
- *     ary.index { |item| block } ->  int or nil
- *     ary.index                  ->  Enumerator
+ *    array.index(object) -> integer or nil
+ *    array.index {|element| ... } -> integer or nil
+ *    array.index -> new_enumerator
+ *
+ *  Returns the index of a specified element.
+ *
+ *  When argument +object+ is given but no block,
+ *  returns the index of the first element +element+
+ *  for which <tt>object == element</tt>:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.index('bar') # => 1
  *
- *  Returns the _index_ of the first object in +ary+ such that the object is
- *  <code>==</code> to +obj+.
+ *  Returns +nil+ if no such element found.
  *
- *  If a block is given instead of an argument, returns the _index_ of the
- *  first object for which the block returns +true+.  Returns +nil+ if no
- *  match is found.
+ *  When both argument +object+ and a block are given,
+ *  calls the block with each successive element;
+ *  returns the index of the first element for which the block returns a truthy value:
  *
- *  See also Array#rindex.
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.index {|element| element == 'bar' } # => 1
  *
- *  An Enumerator is returned if neither a block nor argument is given.
+ *  Returns +nil+ if the block never returns a truthy value.
  *
- *     a = [ "a", "b", "c" ]
- *     a.index("b")              #=> 1
- *     a.index("z")              #=> nil
- *     a.index { |x| x == "b" }  #=> 1
+ *  When neither an argument nor a block is given, returns a new Enumerator:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    e = a.index
+ *    e # => #<Enumerator: [:foo, "bar", 2]:index>
+ *    e.each {|element| element == 'bar' } # => 1
+ *
+ *  Array#find_index is an alias for Array#index.
+ *
+ *  Related: #rindex.
  */
 
 static VALUE
 rb_ary_index(int argc, VALUE *argv, VALUE ary)
 {
-    const VALUE *ptr;
     VALUE val;
-    long i, len;
+    long i;
 
     if (argc == 0) {
-	RETURN_ENUMERATOR(ary, 0, 0);
-	for (i=0; i<RARRAY_LEN(ary); i++) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-		return LONG2NUM(i);
-	    }
-	}
-	return Qnil;
+        RETURN_ENUMERATOR(ary, 0, 0);
+        for (i=0; i<RARRAY_LEN(ary); i++) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+                return LONG2NUM(i);
+            }
+        }
+        return Qnil;
     }
     rb_check_arity(argc, 0, 1);
     val = argv[0];
     if (rb_block_given_p())
-	rb_warn("given block not used");
-    len = RARRAY_LEN(ary);
-    ptr = RARRAY_CONST_PTR(ary);
-    for (i=0; i<len; i++) {
-	VALUE e = ptr[i];
-	switch (rb_equal_opt(e, val)) {
-	  case Qundef:
-	    if (!rb_equal(e, val)) break;
-	  case Qtrue:
-	    return LONG2NUM(i);
-	  case Qfalse:
-	    continue;
-	}
-	len = RARRAY_LEN(ary);
-	ptr = RARRAY_CONST_PTR(ary);
+        rb_warn("given block not used");
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        VALUE e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, val)) {
+            return LONG2NUM(i);
+        }
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *     ary.rindex(obj)             ->  int or nil
- *     ary.rindex { |item| block } ->  int or nil
- *     ary.rindex                  ->  Enumerator
+ *    array.rindex(object) -> integer or nil
+ *    array.rindex {|element| ... } -> integer or nil
+ *    array.rindex -> new_enumerator
  *
- *  Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
+ *  Returns the index of the last element for which <tt>object == element</tt>.
  *
- *  If a block is given instead of an argument, returns the _index_ of the
- *  first object for which the block returns +true+, starting from the last
- *  object.
+ *  When argument +object+ is given but no block, returns the index of the last such element found:
  *
- *  Returns +nil+ if no match is found.
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.rindex('bar') # => 3
  *
- *  See also Array#index.
+ *  Returns +nil+ if no such object found.
  *
- *  If neither block nor argument is given, an Enumerator is returned instead.
+ *  When a block is given but no argument, calls the block with each successive element;
+ *  returns the index of the last element for which the block returns a truthy value:
  *
- *     a = [ "a", "b", "b", "b", "c" ]
- *     a.rindex("b")             #=> 3
- *     a.rindex("z")             #=> nil
- *     a.rindex { |x| x == "b" } #=> 3
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.rindex {|element| element == 'bar' } # => 3
+ *
+ *  Returns +nil+ if the block never returns a truthy value.
+ *
+ *  When neither an argument nor a block is given, returns a new \Enumerator:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    e = a.rindex
+ *    e # => #<Enumerator: [:foo, "bar", 2, "bar"]:rindex>
+ *    e.each {|element| element == 'bar' } # => 3
+ *
+ *  Related: #index.
  */
 
 static VALUE
 rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
 {
-    const VALUE *ptr;
     VALUE val;
     long i = RARRAY_LEN(ary), len;
 
     if (argc == 0) {
-	RETURN_ENUMERATOR(ary, 0, 0);
-	while (i--) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
-		return LONG2NUM(i);
-	    if (i > (len = RARRAY_LEN(ary))) {
-		i = len;
-	    }
-	}
-	return Qnil;
+        RETURN_ENUMERATOR(ary, 0, 0);
+        while (i--) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
+                return LONG2NUM(i);
+            if (i > (len = RARRAY_LEN(ary))) {
+                i = len;
+            }
+        }
+        return Qnil;
     }
     rb_check_arity(argc, 0, 1);
     val = argv[0];
     if (rb_block_given_p())
-	rb_warn("given block not used");
-    ptr = RARRAY_CONST_PTR(ary);
+        rb_warn("given block not used");
     while (i--) {
-	VALUE e = ptr[i];
-	switch (rb_equal_opt(e, val)) {
-	  case Qundef:
-	    if (!rb_equal(e, val)) break;
-	  case Qtrue:
-	    return LONG2NUM(i);
-	  case Qfalse:
-	    continue;
-	}
-	if (i > (len = RARRAY_LEN(ary))) {
-	    i = len;
-	}
-	ptr = RARRAY_CONST_PTR(ary);
+        VALUE e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, val)) {
+            return LONG2NUM(i);
+        }
+        if (i > RARRAY_LEN(ary)) {
+            break;
+        }
     }
     return Qnil;
 }
@@ -1558,68 +2332,73 @@ rb_ary_to_ary(VALUE obj)
 }
 
 static void
-rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
+rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
 {
-    long rlen;
     long olen;
+    long rofs;
 
     if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
     olen = RARRAY_LEN(ary);
     if (beg < 0) {
-	beg += olen;
-	if (beg < 0) {
-	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-		     beg - olen, -olen);
-	}
+        beg += olen;
+        if (beg < 0) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     beg - olen, -olen);
+        }
     }
     if (olen < len || olen < beg + len) {
-	len = olen - beg;
+        len = olen - beg;
     }
 
-    if (rpl == Qundef) {
-	rlen = 0;
-    }
-    else {
-	rpl = rb_ary_to_ary(rpl);
-	rlen = RARRAY_LEN(rpl);
-	olen = RARRAY_LEN(ary);	/* ary may be resized in rpl.to_ary too */
+    {
+        const VALUE *optr = RARRAY_CONST_PTR_TRANSIENT(ary);
+        rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
     }
+
     if (beg >= olen) {
-	VALUE target_ary;
-	if (beg > ARY_MAX_SIZE - rlen) {
-	    rb_raise(rb_eIndexError, "index %ld too big", beg);
-	}
-	target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
-	len = beg + rlen;
-	ary_mem_clear(ary, olen, beg - olen);
-	if (rlen > 0) {
-	    ary_memcpy0(ary, beg, rlen, RARRAY_CONST_PTR(rpl), target_ary);
-	}
-	ARY_SET_LEN(ary, len);
+        VALUE target_ary;
+        if (beg > ARY_MAX_SIZE - rlen) {
+            rb_raise(rb_eIndexError, "index %ld too big", beg);
+        }
+        target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+        len = beg + rlen;
+        ary_mem_clear(ary, olen, beg - olen);
+        if (rlen > 0) {
+            if (rofs != -1) rptr = RARRAY_CONST_PTR_TRANSIENT(ary) + rofs;
+            ary_memcpy0(ary, beg, rlen, rptr, target_ary);
+        }
+        ARY_SET_LEN(ary, len);
     }
     else {
-	long alen;
-
-	if (olen - len > ARY_MAX_SIZE - rlen) {
-	    rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
-	}
-	rb_ary_modify(ary);
-	alen = olen + rlen - len;
-	if (alen >= ARY_CAPA(ary)) {
-	    ary_double_capa(ary, alen);
-	}
-
-	if (len != rlen) {
-	    RARRAY_PTR_USE(ary, ptr,
-			   MEMMOVE(ptr + beg + rlen, ptr + beg + len,
-				   VALUE, olen - (beg + len)));
-	    ARY_SET_LEN(ary, alen);
-	}
-	if (rlen > 0) {
-	    MEMMOVE(RARRAY_PTR(ary) + beg, RARRAY_CONST_PTR(rpl), VALUE, rlen);
-	}
+        long alen;
+
+        if (olen - len > ARY_MAX_SIZE - rlen) {
+            rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
+        }
+        rb_ary_modify(ary);
+        alen = olen + rlen - len;
+        if (alen >= ARY_CAPA(ary)) {
+            ary_double_capa(ary, alen);
+        }
+
+        if (len != rlen) {
+            RARRAY_PTR_USE_TRANSIENT(ary, ptr,
+                                     MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+                                             VALUE, olen - (beg + len)));
+            ARY_SET_LEN(ary, alen);
+        }
+        if (rlen > 0) {
+            if (rofs != -1) rptr = RARRAY_CONST_PTR_TRANSIENT(ary) + rofs;
+            /* give up wb-protected ary */
+            RB_OBJ_WB_UNPROTECT_FOR(ARRAY, ary);
+
+            /* do not use RARRAY_PTR() because it can causes GC.
+             * ary can contain T_NONE object because it is not cleared.
+             */
+            RARRAY_PTR_USE_TRANSIENT(ary, ptr,
+                                     MEMMOVE(ptr + beg, rptr, VALUE, rlen));
+        }
     }
-    RB_GC_GUARD(rpl);
 }
 
 void
@@ -1629,22 +2408,14 @@ rb_ary_set_len(VALUE ary, long len)
 
     rb_ary_modify_check(ary);
     if (ARY_SHARED_P(ary)) {
-	rb_raise(rb_eRuntimeError, "can't set length of shared ");
+        rb_raise(rb_eRuntimeError, "can't set length of shared ");
     }
     if (len > (capa = (long)ARY_CAPA(ary))) {
-	rb_bug("probable buffer overflow: %ld for %ld", len, capa);
+        rb_bug("probable buffer overflow: %ld for %ld", len, capa);
     }
     ARY_SET_LEN(ary, len);
 }
 
-/*!
- * expands or shrinks \a ary to \a len elements.
- * expanded region will be filled with Qnil.
- * \param ary  an array
- * \param len  new size
- * \return     \a ary
- * \post       the size of \a ary is \a len.
- */
 VALUE
 rb_ary_resize(VALUE ary, long len)
 {
@@ -1654,68 +2425,170 @@ rb_ary_resize(VALUE ary, long len)
     olen = RARRAY_LEN(ary);
     if (len == olen) return ary;
     if (len > ARY_MAX_SIZE) {
-	rb_raise(rb_eIndexError, "index %ld too big", len);
+        rb_raise(rb_eIndexError, "index %ld too big", len);
     }
     if (len > olen) {
-	if (len >= ARY_CAPA(ary)) {
-	    ary_double_capa(ary, len);
-	}
-	ary_mem_clear(ary, olen, len - olen);
-	ARY_SET_LEN(ary, len);
+        if (len >= ARY_CAPA(ary)) {
+            ary_double_capa(ary, len);
+        }
+        ary_mem_clear(ary, olen, len - olen);
+        ARY_SET_LEN(ary, len);
     }
     else if (ARY_EMBED_P(ary)) {
         ARY_SET_EMBED_LEN(ary, len);
     }
-    else if (len <= RARRAY_EMBED_LEN_MAX) {
-	VALUE tmp[RARRAY_EMBED_LEN_MAX];
-	MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
-	ary_discard(ary);
-	MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
+    else if (len <= ary_embed_capa(ary)) {
+        const VALUE *ptr = ARY_HEAP_PTR(ary);
+        long ptr_capa = ARY_HEAP_SIZE(ary);
+        bool is_malloc_ptr = !ARY_SHARED_P(ary) && !RARRAY_TRANSIENT_P(ary);
+
+        FL_UNSET(ary, RARRAY_TRANSIENT_FLAG);
+        FL_SET_EMBED(ary);
+
+        MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len); /* WB: no new reference */
         ARY_SET_EMBED_LEN(ary, len);
+
+        if (is_malloc_ptr) ruby_sized_xfree((void *)ptr, ptr_capa);
     }
     else {
-	if (olen > len + ARY_DEFAULT_SIZE) {
-	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len, RARRAY(ary)->as.heap.aux.capa);
-	    ARY_SET_CAPA(ary, len);
-	}
-	ARY_SET_HEAP_LEN(ary, len);
+        if (olen > len + ARY_DEFAULT_SIZE) {
+            size_t new_capa = ary_heap_realloc(ary, len);
+            ARY_SET_CAPA(ary, new_capa);
+        }
+        ARY_SET_HEAP_LEN(ary, len);
     }
+    ary_verify(ary);
     return ary;
 }
 
+static VALUE
+ary_aset_by_rb_ary_store(VALUE ary, long key, VALUE val)
+{
+    rb_ary_store(ary, key, val);
+    return val;
+}
+
+static VALUE
+ary_aset_by_rb_ary_splice(VALUE ary, long beg, long len, VALUE val)
+{
+    VALUE rpl = rb_ary_to_ary(val);
+    rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR_TRANSIENT(rpl), RARRAY_LEN(rpl));
+    RB_GC_GUARD(rpl);
+    return val;
+}
+
 /*
  *  call-seq:
- *     ary[index]         = obj                      ->  obj
- *     ary[start, length] = obj or other_ary or nil  ->  obj or other_ary or nil
- *     ary[range]         = obj or other_ary or nil  ->  obj or other_ary or nil
- *
- *  Element Assignment --- Sets the element at +index+, or replaces a subarray
- *  from the +start+ index for +length+ elements, or replaces a subarray
- *  specified by the +range+ of indices.
- *
- *  If indices are greater than the current capacity of the array, the array
- *  grows automatically.  Elements are inserted into the array at +start+ if
- *  +length+ is zero.
- *
- *  Negative indices will count backward from the end of the array.  For
- *  +start+ and +range+ cases the starting index is just before an element.
- *
- *  An IndexError is raised if a negative index points past the beginning of
- *  the array.
- *
- *  See also Array#push, and Array#unshift.
- *
- *     a = Array.new
- *     a[4] = "4";                 #=> [nil, nil, nil, nil, "4"]
- *     a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
- *     a[1..2] = [ 1, 2 ]          #=> ["a", 1, 2, nil, "4"]
- *     a[0, 2] = "?"               #=> ["?", 2, nil, "4"]
- *     a[0..2] = "A"               #=> ["A", "4"]
- *     a[-1]   = "Z"               #=> ["A", "Z"]
- *     a[1..-1] = nil              #=> ["A", nil]
- *     a[1..-1] = []               #=> ["A"]
- *     a[0, 0] = [ 1, 2 ]          #=> [1, 2, "A"]
- *     a[3, 0] = "B"               #=> [1, 2, "A", "B"]
+ *    array[index] = object -> object
+ *    array[start, length] = object -> object
+ *    array[range] = object -> object
+ *
+ *  Assigns elements in +self+; returns the given +object+.
+ *
+ *  When \Integer argument +index+ is given, assigns +object+ to an element in +self+.
+ *
+ *  If +index+ is non-negative, assigns +object+ the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0] = 'foo' # => "foo"
+ *    a # => ["foo", "bar", 2]
+ *
+ *  If +index+ is greater than <tt>self.length</tt>, extends the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[7] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
+ *
+ *  If +index+ is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1] = 'two' # => "two"
+ *    a # => [:foo, "bar", "two"]
+ *
+ *  When \Integer arguments +start+ and +length+ are given and +object+ is not an \Array,
+ *  removes <tt>length - 1</tt> elements beginning at offset +start+,
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 2] = 'foo' # => "foo"
+ *    a # => ["foo", 2]
+ *
+ *  If +start+ is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-2, 2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  If +start+ is non-negative and outside the array (<tt> >= self.size</tt>),
+ *  extends the array with +nil+, assigns +object+ at offset +start+,
+ *  and ignores +length+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[6, 50] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  If +length+ is zero, shifts elements at and following offset +start+
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1, 0] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *
+ *  If +length+ is too large for the existing array, does not extend the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1, 5] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  When \Range argument +range+ is given and +object+ is an \Array,
+ *  removes <tt>length - 1</tt> elements beginning at offset +start+,
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..1] = 'foo' # => "foo"
+ *    a # => ["foo", 2]
+ *
+ *  if <tt>range.begin</tt> is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-2..2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  If the array length is less than <tt>range.begin</tt>,
+ *  assigns +object+ at offset <tt>range.begin</tt>, and ignores +length+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[6..50] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  If <tt>range.end</tt> is zero, shifts elements at and following offset +start+
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..0] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *
+ *  If <tt>range.end</tt> is negative, assigns +object+ at offset +start+,
+ *  retains <tt>range.end.abs -1</tt> elements past that, and removes those beyond:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-1] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", 2]
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-3] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *    a = [:foo, 'bar', 2]
+ *
+ *  If <tt>range.end</tt> is too large for the existing array,
+ *  replaces array elements, but does not extend the array with +nil+ values:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..5] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
  */
 
 static VALUE
@@ -1723,45 +2596,60 @@ rb_ary_aset(int argc, VALUE *argv, VALUE ary)
 {
     long offset, beg, len;
 
+    rb_check_arity(argc, 2, 3);
+    rb_ary_modify_check(ary);
     if (argc == 3) {
-	rb_ary_modify_check(ary);
-	beg = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
-	rb_ary_splice(ary, beg, len, argv[2]);
-	return argv[2];
+        beg = NUM2LONG(argv[0]);
+        len = NUM2LONG(argv[1]);
+        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[2]);
     }
-    rb_check_arity(argc, 2, 2);
-    rb_ary_modify_check(ary);
     if (FIXNUM_P(argv[0])) {
-	offset = FIX2LONG(argv[0]);
-	goto fixnum;
+        offset = FIX2LONG(argv[0]);
+        return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
     }
     if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
-	/* check if idx is Range */
-	rb_ary_splice(ary, beg, len, argv[1]);
-	return argv[1];
+        /* check if idx is Range */
+        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[1]);
     }
 
     offset = NUM2LONG(argv[0]);
-fixnum:
-    rb_ary_store(ary, offset, argv[1]);
-    return argv[1];
+    return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
 }
 
 /*
  *  call-seq:
- *     ary.insert(index, obj...)  -> ary
+ *    array.insert(index, *objects) -> self
+ *
+ *  Inserts given +objects+ before or after the element at \Integer index +offset+;
+ *  returns +self+.
+ *
+ *  When +index+ is non-negative, inserts all given +objects+
+ *  before the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.insert(1, :bat, :bam) # => [:foo, :bat, :bam, "bar", 2]
  *
- *  Inserts the given values before the element with the given +index+.
+ *  Extends the array if +index+ is beyond the array (<tt>index >= self.size</tt>):
  *
- *  Negative indices count backwards from the end of the array, where +-1+ is
- *  the last element. If a negative index is used, the given values will be
- *  inserted after that element, so using an index of +-1+ will insert the
- *  values at the end of the array.
+ *    a = [:foo, 'bar', 2]
+ *    a.insert(5, :bat, :bam)
+ *    a # => [:foo, "bar", 2, nil, nil, :bat, :bam]
+ *
+ *  Does nothing if no objects given:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.insert(1)
+ *    a.insert(50)
+ *    a.insert(-50)
+ *    a # => [:foo, "bar", 2]
+ *
+ *  When +index+ is negative, inserts all given +objects+
+ *  _after_ the element at offset <tt>index+self.size</tt>:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.insert(-2, :bat, :bam)
+ *    a # => [:foo, "bar", :bat, :bam, 2]
  *
- *     a = %w{ a b c d }
- *     a.insert(2, 99)         #=> ["a", "b", 99, "c", "d"]
- *     a.insert(-2, 1, 2, 3)   #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
  */
 
 static VALUE
@@ -1771,15 +2659,20 @@ rb_ary_insert(int argc, VALUE *argv, VALUE ary)
 
     rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
     rb_ary_modify_check(ary);
-    if (argc == 1) return ary;
     pos = NUM2LONG(argv[0]);
+    if (argc == 1) return ary;
     if (pos == -1) {
-	pos = RARRAY_LEN(ary);
+        pos = RARRAY_LEN(ary);
     }
-    if (pos < 0) {
-	pos++;
+    else if (pos < 0) {
+        long minpos = -RARRAY_LEN(ary) - 1;
+        if (pos < minpos) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     pos, minpos);
+        }
+        pos++;
     }
-    rb_ary_splice(ary, pos, 0, rb_ary_new4(argc - 1, argv + 1));
+    rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
     return ary;
 }
 
@@ -1794,50 +2687,104 @@ ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
 
 /*
  *  call-seq:
- *     ary.each { |item| block }  -> ary
- *     ary.each                   -> Enumerator
+ *    array.each {|element| ... } -> self
+ *    array.each -> Enumerator
+ *
+ *  Iterates over array elements.
+ *
+ *  When a block given, passes each successive array element to the block;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each {|element|  puts "#{element.class} #{element}" }
+ *
+ *  Output:
+ *
+ *    Symbol foo
+ *    String bar
+ *    Integer 2
+ *
+ *  Allows the array to be modified during iteration:
  *
- *  Calls the given block once for each element in +self+, passing that element
- *  as a parameter.  Returns the array itself.
+ *    a = [:foo, 'bar', 2]
+ *    a.each {|element| puts element; a.clear if element.to_s.start_with?('b') }
  *
- *  If no block is given, an Enumerator is returned.
+ *  Output:
  *
- *     a = [ "a", "b", "c" ]
- *     a.each {|x| print x, " -- " }
+ *    foo
+ *    bar
  *
- *  produces:
+ *  When no block given, returns a new \Enumerator:
+ *    a = [:foo, 'bar', 2]
  *
- *     a -- b -- c --
+ *    e = a.each
+ *    e # => #<Enumerator: [:foo, "bar", 2]:each>
+ *    a1 = e.each {|element|  puts "#{element.class} #{element}" }
+ *
+ *  Output:
+ *
+ *    Symbol foo
+ *    String bar
+ *    Integer 2
+ *
+ *  Related: #each_index, #reverse_each.
  */
 
 VALUE
 rb_ary_each(VALUE ary)
 {
     long i;
-
+    ary_verify(ary);
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	rb_yield(RARRAY_AREF(ary, i));
+        rb_yield(RARRAY_AREF(ary, i));
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.each_index { |index| block }  -> ary
- *     ary.each_index                    -> Enumerator
+ *    array.each_index {|index| ... } -> self
+ *    array.each_index -> Enumerator
+ *
+ *  Iterates over array indexes.
+ *
+ *  When a block given, passes each successive array index to the block;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each_index {|index|  puts "#{index} #{a[index]}" }
  *
- *  Same as Array#each, but passes the +index+ of the element instead of the
- *  element itself.
+ *  Output:
  *
- *  An Enumerator is returned if no block is given.
+ *    0 foo
+ *    1 bar
+ *    2 2
  *
- *     a = [ "a", "b", "c" ]
- *     a.each_index {|x| print x, " -- " }
+ *  Allows the array to be modified during iteration:
  *
- *  produces:
+ *    a = [:foo, 'bar', 2]
+ *    a.each_index {|index| puts index; a.clear if index > 0 }
  *
- *     0 -- 1 -- 2 --
+ *  Output:
+ *
+ *    0
+ *    1
+ *
+ *  When no block given, returns a new \Enumerator:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    e = a.each_index
+ *    e # => #<Enumerator: [:foo, "bar", 2]:each_index>
+ *    a1 = e.each {|index|  puts "#{index} #{a[index]}"}
+ *
+ *  Output:
+ *
+ *    0 foo
+ *    1 bar
+ *    2 2
+ *
+ *  Related: #each, #reverse_each.
  */
 
 static VALUE
@@ -1847,24 +2794,54 @@ rb_ary_each_index(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	rb_yield(LONG2NUM(i));
+        rb_yield(LONG2NUM(i));
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.reverse_each { |item| block }  -> ary
- *     ary.reverse_each                   -> Enumerator
+ *    array.reverse_each {|element| ... } -> self
+ *    array.reverse_each -> Enumerator
+ *
+ *  Iterates backwards over array elements.
  *
- *  Same as Array#each, but traverses +self+ in reverse order.
+ *  When a block given, passes, in reverse order, each element to the block;
+ *  returns +self+:
  *
- *     a = [ "a", "b", "c" ]
- *     a.reverse_each {|x| print x, " " }
+ *    a = [:foo, 'bar', 2]
+ *    a.reverse_each {|element|  puts "#{element.class} #{element}" }
  *
- *  produces:
+ *  Output:
  *
- *     c b a
+ *    Integer 2
+ *    String bar
+ *    Symbol foo
+ *
+ *  Allows the array to be modified during iteration:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.reverse_each {|element| puts element; a.clear if element.to_s.start_with?('b') }
+ *
+ *  Output:
+ *
+ *    2
+ *    bar
+ *
+ *  When no block given, returns a new \Enumerator:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    e = a.reverse_each
+ *    e # => #<Enumerator: [:foo, "bar", 2]:reverse_each>
+ *    a1 = e.each {|element|  puts "#{element.class} #{element}" }
+ *
+ *  Output:
+ *
+ *    Integer 2
+ *    String bar
+ *    Symbol foo
+ *
+ *  Related: #each, #each_index.
  */
 
 static VALUE
@@ -1875,24 +2852,21 @@ rb_ary_reverse_each(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     len = RARRAY_LEN(ary);
     while (len--) {
-	long nlen;
-	rb_yield(RARRAY_AREF(ary, len));
-	nlen = RARRAY_LEN(ary);
-	if (nlen < len) {
-	    len = nlen;
-	}
+        long nlen;
+        rb_yield(RARRAY_AREF(ary, len));
+        nlen = RARRAY_LEN(ary);
+        if (nlen < len) {
+            len = nlen;
+        }
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.length -> int
- *
- *  Returns the number of elements in +self+. May be zero.
+ *    array.length -> an_integer
  *
- *     [ 1, 2, 3, 4, 5 ].length   #=> 5
- *     [].length                  #=> 0
+ *  Returns the count of elements in +self+.
  */
 
 static VALUE
@@ -1904,19 +2878,16 @@ rb_ary_length(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.empty?   -> true or false
+ *    array.empty?  -> true or false
  *
- *  Returns +true+ if +self+ contains no elements.
- *
- *     [].empty?   #=> true
+ *  Returns +true+ if the count of elements in +self+ is zero,
+ *  +false+ otherwise.
  */
 
 static VALUE
 rb_ary_empty_p(VALUE ary)
 {
-    if (RARRAY_LEN(ary) == 0)
-	return Qtrue;
-    return Qfalse;
+    return RBOOL(RARRAY_LEN(ary) == 0);
 }
 
 VALUE
@@ -1924,15 +2895,18 @@ rb_ary_dup(VALUE ary)
 {
     long len = RARRAY_LEN(ary);
     VALUE dup = rb_ary_new2(len);
-    ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
+    ary_memcpy(dup, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary));
     ARY_SET_LEN(dup, len);
+
+    ary_verify(ary);
+    ary_verify(dup);
     return dup;
 }
 
 VALUE
 rb_ary_resurrect(VALUE ary)
 {
-    return rb_ary_new4(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
+    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
 }
 
 extern VALUE rb_output_fs;
@@ -1949,15 +2923,15 @@ recursive_join(VALUE obj, VALUE argp, int recur)
     int *first = (int *)arg[3];
 
     if (recur) {
-	rb_raise(rb_eArgError, "recursive array join");
+        rb_raise(rb_eArgError, "recursive array join");
     }
     else {
-	ary_join_1(obj, ary, sep, 0, result, first);
+        ary_join_1(obj, ary, sep, 0, result, first);
     }
     return Qnil;
 }
 
-static void
+static long
 ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
 {
     long i;
@@ -1965,11 +2939,40 @@ ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
 
     if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
     for (i=0; i<max; i++) {
-	val = RARRAY_AREF(ary, i);
-	if (i > 0 && !NIL_P(sep))
-	    rb_str_buf_append(result, sep);
-	rb_str_buf_append(result, val);
-	if (OBJ_TAINTED(val)) OBJ_TAINT(result);
+        val = RARRAY_AREF(ary, i);
+        if (!RB_TYPE_P(val, T_STRING)) break;
+        if (i > 0 && !NIL_P(sep))
+            rb_str_buf_append(result, sep);
+        rb_str_buf_append(result, val);
+    }
+    return i;
+}
+
+static void
+ary_join_1_str(VALUE dst, VALUE src, int *first)
+{
+    rb_str_buf_append(dst, src);
+    if (*first) {
+        rb_enc_copy(dst, src);
+        *first = FALSE;
+    }
+}
+
+static void
+ary_join_1_ary(VALUE obj, VALUE ary, VALUE sep, VALUE result, VALUE val, int *first)
+{
+    if (val == ary) {
+        rb_raise(rb_eArgError, "recursive array join");
+    }
+    else {
+        VALUE args[4];
+
+        *first = FALSE;
+        args[0] = val;
+        args[1] = sep;
+        args[2] = result;
+        args[3] = (VALUE)first;
+        rb_exec_recursive(recursive_join, obj, (VALUE)args);
     }
 }
 
@@ -1979,50 +2982,25 @@ ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
     VALUE val, tmp;
 
     for (; i<RARRAY_LEN(ary); i++) {
-	if (i > 0 && !NIL_P(sep))
-	    rb_str_buf_append(result, sep);
-
-	val = RARRAY_AREF(ary, i);
-	if (RB_TYPE_P(val, T_STRING)) {
-	  str_join:
-	    rb_str_buf_append(result, val);
-	    *first = FALSE;
-	}
-	else if (RB_TYPE_P(val, T_ARRAY)) {
-	    obj = val;
-	  ary_join:
-	    if (val == ary) {
-		rb_raise(rb_eArgError, "recursive array join");
-	    }
-	    else {
-		VALUE args[4];
-
-		args[0] = val;
-		args[1] = sep;
-		args[2] = result;
-		args[3] = (VALUE)first;
-		rb_exec_recursive(recursive_join, obj, (VALUE)args);
-	    }
-	}
-	else {
-	    tmp = rb_check_string_type(val);
-	    if (!NIL_P(tmp)) {
-		val = tmp;
-		goto str_join;
-	    }
-	    tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
-	    if (!NIL_P(tmp)) {
-		obj = val;
-		val = tmp;
-		goto ary_join;
-	    }
-	    val = rb_obj_as_string(val);
-	    if (*first) {
-		rb_enc_copy(result, val);
-		*first = FALSE;
-	    }
-	    goto str_join;
-	}
+        if (i > 0 && !NIL_P(sep))
+            rb_str_buf_append(result, sep);
+
+        val = RARRAY_AREF(ary, i);
+        if (RB_TYPE_P(val, T_STRING)) {
+            ary_join_1_str(result, val, first);
+        }
+        else if (RB_TYPE_P(val, T_ARRAY)) {
+            ary_join_1_ary(val, ary, sep, result, val, first);
+        }
+        else if (!NIL_P(tmp = rb_check_string_type(val))) {
+            ary_join_1_str(result, tmp, first);
+        }
+        else if (!NIL_P(tmp = rb_check_array_type(val))) {
+            ary_join_1_ary(val, ary, sep, result, tmp, first);
+        }
+        else {
+            ary_join_1_str(result, rb_obj_as_string(val), first);
+        }
     }
 }
 
@@ -2030,36 +3008,36 @@ VALUE
 rb_ary_join(VALUE ary, VALUE sep)
 {
     long len = 1, i;
-    int taint = FALSE;
     VALUE val, tmp, result;
 
     if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
-    if (OBJ_TAINTED(ary)) taint = TRUE;
 
     if (!NIL_P(sep)) {
-	StringValue(sep);
-	len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+        StringValue(sep);
+        len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
     }
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	val = RARRAY_AREF(ary, i);
-	tmp = rb_check_string_type(val);
-
-	if (NIL_P(tmp) || tmp != val) {
-	    int first;
-	    result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
-	    rb_enc_associate(result, rb_usascii_encoding());
-	    if (taint) OBJ_TAINT(result);
-	    ary_join_0(ary, sep, i, result);
-	    first = i == 0;
-	    ary_join_1(ary, ary, sep, i, result, &first);
-	    return result;
-	}
+        val = RARRAY_AREF(ary, i);
+        tmp = rb_check_string_type(val);
+
+        if (NIL_P(tmp) || tmp != val) {
+            int first;
+            long n = RARRAY_LEN(ary);
+            if (i > n) i = n;
+            result = rb_str_buf_new(len + (n-i)*10);
+            rb_enc_associate(result, rb_usascii_encoding());
+            i = ary_join_0(ary, sep, i, result);
+            first = i == 0;
+            ary_join_1(ary, ary, sep, i, result, &first);
+            return result;
+        }
 
-	len += RSTRING_LEN(tmp);
+        len += RSTRING_LEN(tmp);
     }
 
-    result = rb_str_buf_new(len);
-    if (taint) OBJ_TAINT(result);
+    result = rb_str_new(0, len);
+    rb_str_set_len(result, 0);
+
     ary_join_0(ary, sep, RARRAY_LEN(ary), result);
 
     return result;
@@ -2067,24 +3045,43 @@ rb_ary_join(VALUE ary, VALUE sep)
 
 /*
  *  call-seq:
- *     ary.join(separator=$,)    -> str
+ *    array.join ->new_string
+ *    array.join(separator = $,) -> new_string
+ *
+ *  Returns the new \String formed by joining the array elements after conversion.
+ *  For each element +element+:
+ *
+ *  - Uses <tt>element.to_s</tt> if +element+ is not a <tt>kind_of?(Array)</tt>.
+ *  - Uses recursive <tt>element.join(separator)</tt> if +element+ is a <tt>kind_of?(Array)</tt>.
+ *
+ *  With no argument, joins using the output field separator, <tt>$,</tt>:
  *
- *  Returns a string created by converting each element of the array to
- *  a string, separated by the given +separator+.
- *  If the +separator+ is +nil+, it uses current $,.
- *  If both the +separator+ and $, are nil, it uses empty string.
+ *    a = [:foo, 'bar', 2]
+ *    $, # => nil
+ *    a.join # => "foobar2"
+ *
+ *  With \string argument +separator+, joins using that separator:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.join("\n") # => "foo\nbar\n2"
+ *
+ *  Joins recursively for nested Arrays:
+ *
+ *   a = [:foo, [:bar, [:baz, :bat]]]
+ *   a.join # => "foobarbazbat"
  *
- *     [ "a", "b", "c" ].join        #=> "abc"
- *     [ "a", "b", "c" ].join("-")   #=> "a-b-c"
  */
-
 static VALUE
 rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE sep;
 
-    rb_scan_args(argc, argv, "01", &sep);
-    if (NIL_P(sep)) sep = rb_output_fs;
+    if (rb_check_arity(argc, 0, 1) == 0 || NIL_P(sep = argv[0])) {
+        sep = rb_output_fs;
+        if (!NIL_P(sep)) {
+            rb_category_warn(RB_WARN_CATEGORY_DEPRECATED, "$, is set to non-nil value");
+        }
+    }
 
     return rb_ary_join(ary, sep);
 }
@@ -2092,32 +3089,32 @@ rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 static VALUE
 inspect_ary(VALUE ary, VALUE dummy, int recur)
 {
-    int tainted = OBJ_TAINTED(ary);
     long i;
     VALUE s, str;
 
     if (recur) return rb_usascii_str_new_cstr("[...]");
     str = rb_str_buf_new2("[");
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	s = rb_inspect(RARRAY_AREF(ary, i));
-	if (OBJ_TAINTED(s)) tainted = TRUE;
-	if (i > 0) rb_str_buf_cat2(str, ", ");
-	else rb_enc_copy(str, s);
-	rb_str_buf_append(str, s);
+        s = rb_inspect(RARRAY_AREF(ary, i));
+        if (i > 0) rb_str_buf_cat2(str, ", ");
+        else rb_enc_copy(str, s);
+        rb_str_buf_append(str, s);
     }
     rb_str_buf_cat2(str, "]");
-    if (tainted) OBJ_TAINT(str);
     return str;
 }
 
 /*
  *  call-seq:
- *     ary.inspect  -> string
- *     ary.to_s     -> string
+ *    array.inspect -> new_string
  *
- *  Creates a string representation of +self+.
+ *  Returns the new \String formed by calling method <tt>#inspect</tt>
+ *  on each array element:
  *
- *     [ "a", "b", "c" ].to_s     #=> "[\"a\", \"b\", \"c\"]"
+ *    a = [:foo, 'bar', 2]
+ *    a.inspect # => "[:foo, \"bar\", 2]"
+ *
+ *  Array#to_s is an alias for Array#inspect.
  */
 
 static VALUE
@@ -2135,58 +3132,88 @@ rb_ary_to_s(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.to_a     -> ary
+ *    to_a -> self or new_array
  *
- *  Returns +self+.
+ *  When +self+ is an instance of \Array, returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.to_a # => [:foo, "bar", 2]
+ *
+ *  Otherwise, returns a new \Array containing the elements of +self+:
+ *
+ *    class MyArray < Array; end
+ *    a = MyArray.new(['foo', 'bar', 'two'])
+ *    a.instance_of?(Array) # => false
+ *    a.kind_of?(Array) # => true
+ *    a1 = a.to_a
+ *    a1 # => ["foo", "bar", "two"]
+ *    a1.class # => Array # Not MyArray
  *
- *  If called on a subclass of Array, converts the receiver to an Array object.
  */
 
 static VALUE
 rb_ary_to_a(VALUE ary)
 {
     if (rb_obj_class(ary) != rb_cArray) {
-	VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
-	rb_ary_replace(dup, ary);
-	return dup;
+        VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+        rb_ary_replace(dup, ary);
+        return dup;
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.to_h     -> hash
+ *    array.to_h -> new_hash
+ *    array.to_h {|item| ... } -> new_hash
+ *
+ *  Returns a new \Hash formed from +self+.
+ *
+ *  When a block is given, calls the block with each array element;
+ *  the block must return a 2-element \Array whose two elements
+ *  form a key-value pair in the returned \Hash:
  *
- *  Returns the result of interpreting <i>ary</i> as an array of
- *  <tt>[key, value]</tt> pairs.
+ *    a = ['foo', :bar, 1, [2, 3], {baz: 4}]
+ *    h = a.to_h {|item| [item, item] }
+ *    h # => {"foo"=>"foo", :bar=>:bar, 1=>1, [2, 3]=>[2, 3], {:baz=>4}=>{:baz=>4}}
+ *
+ *  When no block is given, +self+ must be an \Array of 2-element sub-arrays,
+ *  each sub-array is formed into a key-value pair in the new \Hash:
+ *
+ *    [].to_h # => {}
+ *    a = [['foo', 'zero'], ['bar', 'one'], ['baz', 'two']]
+ *    h = a.to_h
+ *    h # => {"foo"=>"zero", "bar"=>"one", "baz"=>"two"}
  *
- *     [[:foo, :bar], [1, 2]].to_h
- *       # => {:foo => :bar, 1 => 2}
  */
 
 static VALUE
 rb_ary_to_h(VALUE ary)
 {
     long i;
-    VALUE hash = rb_hash_new();
+    VALUE hash = rb_hash_new_with_size(RARRAY_LEN(ary));
+    int block_given = rb_block_given_p();
+
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	VALUE key_value_pair = rb_check_array_type(rb_ary_elt(ary, i));
-	if (NIL_P(key_value_pair)) {
-	    rb_raise(rb_eTypeError, "wrong element type %s at %ld (expected array)",
-		rb_builtin_class_name(rb_ary_elt(ary, i)), i);
-	}
-	if (RARRAY_LEN(key_value_pair) != 2) {
-	    rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
-		i, RARRAY_LEN(key_value_pair));
-	}
-	rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
+        const VALUE e = rb_ary_elt(ary, i);
+        const VALUE elt = block_given ? rb_yield_force_blockarg(e) : e;
+        const VALUE key_value_pair = rb_check_array_type(elt);
+        if (NIL_P(key_value_pair)) {
+            rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
+                     rb_obj_class(elt), i);
+        }
+        if (RARRAY_LEN(key_value_pair) != 2) {
+            rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
+                i, RARRAY_LEN(key_value_pair));
+        }
+        rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
     }
     return hash;
 }
 
 /*
  *  call-seq:
- *     ary.to_ary -> ary
+ *    array.to_ary -> self
  *
  *  Returns +self+.
  */
@@ -2201,9 +3228,9 @@ static void
 ary_reverse(VALUE *p1, VALUE *p2)
 {
     while (p1 < p2) {
-	VALUE tmp = *p1;
-	*p1++ = *p2;
-	*p2-- = tmp;
+        VALUE tmp = *p1;
+        *p1++ = *p2;
+        *p2-- = tmp;
     }
 }
 
@@ -2215,23 +3242,23 @@ rb_ary_reverse(VALUE ary)
 
     rb_ary_modify(ary);
     if (len > 1) {
-	RARRAY_PTR_USE(ary, p1, {
-	    p2 = p1 + len - 1;	/* points last item */
-	    ary_reverse(p1, p2);
-	}); /* WB: no new reference */
+        RARRAY_PTR_USE_TRANSIENT(ary, p1, {
+            p2 = p1 + len - 1;	/* points last item */
+            ary_reverse(p1, p2);
+        }); /* WB: no new reference */
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.reverse!   -> ary
+ *    array.reverse! -> self
+ *
+ *  Reverses +self+ in place:
  *
- *  Reverses +self+ in place.
+ *    a = ['foo', 'bar', 'two']
+ *    a.reverse! # => ["two", "bar", "foo"]
  *
- *     a = [ "a", "b", "c" ]
- *     a.reverse!       #=> ["c", "b", "a"]
- *     a                #=> ["c", "b", "a"]
  */
 
 static VALUE
@@ -2242,12 +3269,14 @@ rb_ary_reverse_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.reverse    -> new_ary
+ *    array.reverse -> new_array
+ *
+ *  Returns a new \Array with the elements of +self+ in reverse order:
  *
- *  Returns a new array containing +self+'s elements in reverse order.
+ *    a = ['foo', 'bar', 'two']
+ *    a1 = a.reverse
+ *    a1 # => ["two", "bar", "foo"]
  *
- *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
- *     [ 1 ].reverse               #=> [1]
  */
 
 static VALUE
@@ -2257,9 +3286,9 @@ rb_ary_reverse_m(VALUE ary)
     VALUE dup = rb_ary_new2(len);
 
     if (len > 0) {
-	const VALUE *p1 = RARRAY_CONST_PTR(ary);
-	VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
-	do *p2-- = *p1++; while (--len > 0);
+        const VALUE *p1 = RARRAY_CONST_PTR_TRANSIENT(ary);
+        VALUE *p2 = (VALUE *)RARRAY_CONST_PTR_TRANSIENT(dup) + len - 1;
+        do *p2-- = *p1++; while (--len > 0);
     }
     ARY_SET_LEN(dup, RARRAY_LEN(ary));
     return dup;
@@ -2271,73 +3300,143 @@ rotate_count(long cnt, long len)
     return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
 }
 
+static void
+ary_rotate_ptr(VALUE *ptr, long len, long cnt)
+{
+    if (cnt == 1) {
+        VALUE tmp = *ptr;
+        memmove(ptr, ptr + 1, sizeof(VALUE)*(len - 1));
+        *(ptr + len - 1) = tmp;
+    }
+    else if (cnt == len - 1) {
+        VALUE tmp = *(ptr + len - 1);
+        memmove(ptr + 1, ptr, sizeof(VALUE)*(len - 1));
+        *ptr = tmp;
+    }
+    else {
+        --len;
+        if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+        if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+        if (len > 0) ary_reverse(ptr, ptr + len);
+    }
+}
+
 VALUE
 rb_ary_rotate(VALUE ary, long cnt)
 {
     rb_ary_modify(ary);
 
     if (cnt != 0) {
-	VALUE *ptr = RARRAY_PTR(ary);
-	long len = RARRAY_LEN(ary);
-
-	if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
-	    --len;
-	    if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
-	    if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
-	    if (len > 0) ary_reverse(ptr, ptr + len);
-	    return ary;
-	}
+        long len = RARRAY_LEN(ary);
+        if (len > 1 && (cnt = rotate_count(cnt, len)) > 0) {
+            RARRAY_PTR_USE_TRANSIENT(ary, ptr, ary_rotate_ptr(ptr, len, cnt));
+            return ary;
+        }
     }
-
     return Qnil;
 }
 
 /*
  *  call-seq:
- *     ary.rotate!(count=1)   -> ary
+ *    array.rotate! -> self
+ *    array.rotate!(count) -> self
  *
- *  Rotates +self+ in place so that the element at +count+ comes first, and
- *  returns +self+.
+ *  Rotates +self+ in place by moving elements from one end to the other; returns +self+.
+ *
+ *  When no argument given, rotates the first element to the last position:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.rotate! # => ["bar", 2, "bar", :foo]
+ *
+ *  When given a non-negative \Integer +count+,
+ *  rotates +count+ elements from the beginning to the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.rotate!(2)
+ *    a # => [2, :foo, "bar"]
+ *
+ *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.rotate!(20)
+ *    a # => [2, :foo, "bar"]
+ *
+ *  If +count+ is zero, returns +self+ unmodified:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.rotate!(0)
+ *    a # => [:foo, "bar", 2]
+ *
+ *  When given a negative Integer +count+, rotates in the opposite direction,
+ *  from end to beginning:
  *
- *  If +count+ is negative then it rotates in the opposite direction, starting
- *  from the end of the array where +-1+ is the last element.
+ *    a = [:foo, 'bar', 2]
+ *    a.rotate!(-2)
+ *    a # => ["bar", 2, :foo]
+ *
+ *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.rotate!(-5)
+ *    a # => ["bar", 2, :foo]
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.rotate!        #=> ["b", "c", "d", "a"]
- *     a                #=> ["b", "c", "d", "a"]
- *     a.rotate!(2)     #=> ["d", "a", "b", "c"]
- *     a.rotate!(-3)    #=> ["a", "b", "c", "d"]
  */
 
 static VALUE
 rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
 {
-    long n = 1;
-
-    switch (argc) {
-      case 1: n = NUM2LONG(argv[0]);
-      case 0: break;
-      default: rb_scan_args(argc, argv, "01", NULL);
-    }
+    long n = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
     rb_ary_rotate(ary, n);
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.rotate(count=1)    -> new_ary
+ *    array.rotate -> new_array
+ *    array.rotate(count) -> new_array
+ *
+ *  Returns a new \Array formed from +self+ with elements
+ *  rotated from one end to the other.
+ *
+ *  When no argument given, returns a new \Array that is like +self+,
+ *  except that the first element has been rotated to the last position:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a1 = a.rotate
+ *    a1 # => ["bar", 2, "bar", :foo]
+ *
+ *  When given a non-negative \Integer +count+,
+ *  returns a new \Array with +count+ elements rotated from the beginning to the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a.rotate(2)
+ *    a1 # => [2, :foo, "bar"]
+ *
+ *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a.rotate(20)
+ *    a1 # => [2, :foo, "bar"]
+ *
+ *  If +count+ is zero, returns a copy of +self+, unmodified:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a.rotate(0)
+ *    a1 # => [:foo, "bar", 2]
  *
- *  Returns a new array by rotating +self+ so that the element at +count+ is
- *  the first element of the new array.
+ *  When given a negative \Integer +count+, rotates in the opposite direction,
+ *  from end to beginning:
  *
- *  If +count+ is negative then it rotates in the opposite direction, starting
- *  from the end of +self+ where +-1+ is the last element.
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a.rotate(-2)
+ *    a1 # => ["bar", 2, :foo]
+ *
+ *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a.rotate(-5)
+ *    a1 # => ["bar", 2, :foo]
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.rotate         #=> ["b", "c", "d", "a"]
- *     a                #=> ["a", "b", "c", "d"]
- *     a.rotate(2)      #=> ["c", "d", "a", "b"]
- *     a.rotate(-3)     #=> ["b", "c", "d", "a"]
  */
 
 static VALUE
@@ -2345,22 +3444,17 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE rotated;
     const VALUE *ptr;
-    long len, cnt = 1;
-
-    switch (argc) {
-      case 1: cnt = NUM2LONG(argv[0]);
-      case 0: break;
-      default: rb_scan_args(argc, argv, "01", NULL);
-    }
+    long len;
+    long cnt = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
 
     len = RARRAY_LEN(ary);
     rotated = rb_ary_new2(len);
     if (len > 0) {
-	cnt = rotate_count(cnt, len);
-	ptr = RARRAY_CONST_PTR(ary);
-	len -= cnt;
-	ary_memcpy(rotated, 0, len, ptr + cnt);
-	ary_memcpy(rotated, len, cnt, ptr);
+        cnt = rotate_count(cnt, len);
+        ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
+        len -= cnt;
+        ary_memcpy(rotated, 0, len, ptr + cnt);
+        ary_memcpy(rotated, len, cnt, ptr);
     }
     ARY_SET_LEN(rotated, RARRAY_LEN(ary));
     return rotated;
@@ -2368,46 +3462,41 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
 
 struct ary_sort_data {
     VALUE ary;
-    int opt_methods;
-    int opt_inited;
-};
-
-enum {
-    sort_opt_Fixnum,
-    sort_opt_String,
-    sort_optimizable_count
+    VALUE receiver;
 };
 
-#define STRING_P(s) (RB_TYPE_P((s), T_STRING) && CLASS_OF(s) == rb_cString)
-
-#define SORT_OPTIMIZABLE_BIT(type) (1U << TOKEN_PASTE(sort_opt_,type))
-#define SORT_OPTIMIZABLE(data, type) \
-    (((data)->opt_inited & SORT_OPTIMIZABLE_BIT(type)) ? \
-     ((data)->opt_methods & SORT_OPTIMIZABLE_BIT(type)) : \
-     (((data)->opt_inited |= SORT_OPTIMIZABLE_BIT(type)), \
-      rb_method_basic_definition_p(TOKEN_PASTE(rb_c,type), id_cmp) && \
-      ((data)->opt_methods |= SORT_OPTIMIZABLE_BIT(type))))
-
 static VALUE
 sort_reentered(VALUE ary)
 {
     if (RBASIC(ary)->klass) {
-	rb_raise(rb_eRuntimeError, "sort reentered");
+        rb_raise(rb_eRuntimeError, "sort reentered");
     }
     return Qnil;
 }
 
+static void
+sort_returned(struct ary_sort_data *data)
+{
+    if (rb_obj_frozen_p(data->receiver)) {
+        rb_raise(rb_eFrozenError, "array frozen during sort");
+    }
+    sort_reentered(data->ary);
+}
+
 static int
 sort_1(const void *ap, const void *bp, void *dummy)
 {
     struct ary_sort_data *data = dummy;
     VALUE retval = sort_reentered(data->ary);
     VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+    VALUE args[2];
     int n;
 
-    retval = rb_yield_values(2, a, b);
+    args[0] = a;
+    args[1] = b;
+    retval = rb_yield_values2(2, args);
     n = rb_cmpint(retval, a, b);
-    sort_reentered(data->ary);
+    sort_returned(data);
     return n;
 }
 
@@ -2419,41 +3508,64 @@ sort_2(const void *ap, const void *bp, void *dummy)
     VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
     int n;
 
-    if (FIXNUM_P(a) && FIXNUM_P(b) && SORT_OPTIMIZABLE(data, Fixnum)) {
-	if ((long)a > (long)b) return 1;
-	if ((long)a < (long)b) return -1;
-	return 0;
+    if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(INTEGER)) {
+        if ((long)a > (long)b) return 1;
+        if ((long)a < (long)b) return -1;
+        return 0;
     }
-    if (STRING_P(a) && STRING_P(b) && SORT_OPTIMIZABLE(data, String)) {
-	return rb_str_cmp(a, b);
+    if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(STRING)) {
+        return rb_str_cmp(a, b);
+    }
+    if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(FLOAT)) {
+        return rb_float_cmp(a, b);
     }
 
     retval = rb_funcallv(a, id_cmp, 1, &b);
     n = rb_cmpint(retval, a, b);
-    sort_reentered(data->ary);
+    sort_returned(data);
 
     return n;
 }
 
 /*
  *  call-seq:
- *     ary.sort!                   -> ary
- *     ary.sort! { |a, b| block }  -> ary
+ *    array.sort! -> self
+ *    array.sort! {|a, b| ... } -> self
+ *
+ *  Returns +self+ with its elements sorted in place.
  *
- *  Sorts +self+ in place.
+ *  With no block, compares elements using operator <tt><=></tt>
+ *  (see Comparable):
  *
- *  Comparisons for the sort will be done using the <code><=></code> operator
- *  or using an optional code block.
+ *    a = 'abcde'.split('').shuffle
+ *    a # => ["e", "b", "d", "a", "c"]
+ *    a.sort!
+ *    a # => ["a", "b", "c", "d", "e"]
  *
- *  The block must implement a comparison between +a+ and +b+, and return
- *  +-1+, when +a+ follows +b+, +0+ when +a+ and +b+ are equivalent, or ++1+
- *  if +b+ follows +a+.
+ *  With a block, calls the block with each element pair;
+ *  for each element pair +a+ and +b+, the block should return an integer:
  *
- *  See also Enumerable#sort_by.
+ *  - Negative when +b+ is to follow +a+.
+ *  - Zero when +a+ and +b+ are equivalent.
+ *  - Positive when +a+ is to follow +b+.
+ *
+ *  Example:
+ *
+ *    a = 'abcde'.split('').shuffle
+ *    a # => ["e", "b", "d", "a", "c"]
+ *    a.sort! {|a, b| a <=> b }
+ *    a # => ["a", "b", "c", "d", "e"]
+ *    a.sort! {|a, b| b <=> a }
+ *    a # => ["e", "d", "c", "b", "a"]
+ *
+ *  When the block returns zero, the order for +a+ and +b+ is indeterminate,
+ *  and may be unstable:
+ *
+ *    a = 'abcde'.split('').shuffle
+ *    a # => ["e", "b", "d", "a", "c"]
+ *    a.sort! {|a, b| 0 }
+ *    a # => ["d", "e", "c", "a", "b"]
  *
- *     a = [ "d", "a", "e", "c", "b" ]
- *     a.sort!                    #=> ["a", "b", "c", "d", "e"]
- *     a.sort! { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
  */
 
 VALUE
@@ -2462,25 +3574,23 @@ rb_ary_sort_bang(VALUE ary)
     rb_ary_modify(ary);
     assert(!ARY_SHARED_P(ary));
     if (RARRAY_LEN(ary) > 1) {
-	VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
-	struct ary_sort_data data;
-	long len = RARRAY_LEN(ary);
-
-	RBASIC_CLEAR_CLASS(tmp);
-	data.ary = tmp;
-	data.opt_methods = 0;
-	data.opt_inited = 0;
-	RARRAY_PTR_USE(tmp, ptr, {
-	    ruby_qsort(ptr, len, sizeof(VALUE),
-		       rb_block_given_p()?sort_1:sort_2, &data);
-	}); /* WB: no new reference */
-	rb_ary_modify(ary);
+        VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+        struct ary_sort_data data;
+        long len = RARRAY_LEN(ary);
+        RBASIC_CLEAR_CLASS(tmp);
+        data.ary = tmp;
+        data.receiver = ary;
+        RARRAY_PTR_USE(tmp, ptr, {
+            ruby_qsort(ptr, len, sizeof(VALUE),
+                       rb_block_given_p()?sort_1:sort_2, &data);
+        }); /* WB: no new reference */
+        rb_ary_modify(ary);
         if (ARY_EMBED_P(tmp)) {
             if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
                 rb_ary_unshare(ary);
-		FL_SET_EMBED(ary);
+                FL_SET_EMBED(ary);
             }
-	    ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
+            ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
             ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
         }
         else {
@@ -2498,44 +3608,65 @@ rb_ary_sort_bang(VALUE ary)
                     rb_ary_unshare(ary);
                 }
                 else {
-		    ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+                    ary_heap_free(ary);
                 }
-                ARY_SET_PTR(ary, RARRAY_CONST_PTR(tmp));
+                ARY_SET_PTR(ary, ARY_HEAP_PTR(tmp));
                 ARY_SET_HEAP_LEN(ary, len);
-                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+                ARY_SET_CAPA(ary, ARY_HEAP_LEN(tmp));
             }
             /* tmp was lost ownership for the ptr */
             FL_UNSET(tmp, FL_FREEZE);
             FL_SET_EMBED(tmp);
             ARY_SET_EMBED_LEN(tmp, 0);
             FL_SET(tmp, FL_FREEZE);
-	}
+        }
         /* tmp will be GC'ed. */
         RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
     }
+    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.sort                   -> new_ary
- *     ary.sort { |a, b| block }  -> new_ary
+ *    array.sort -> new_array
+ *    array.sort {|a, b| ... } -> new_array
+ *
+ *  Returns a new \Array whose elements are those from +self+, sorted.
  *
- *  Returns a new array created by sorting +self+.
+ *  With no block, compares elements using operator <tt><=></tt>
+ *  (see Comparable):
  *
- *  Comparisons for the sort will be done using the <code><=></code> operator
- *  or using an optional code block.
+ *    a = 'abcde'.split('').shuffle
+ *    a # => ["e", "b", "d", "a", "c"]
+ *    a1 = a.sort
+ *    a1 # => ["a", "b", "c", "d", "e"]
  *
- *  The block must implement a comparison between +a+ and +b+, and return
- *  +-1+, when +a+ follows +b+, +0+ when +a+ and +b+ are equivalent, or ++1+
- *  if +b+ follows +a+.
+ *  With a block, calls the block with each element pair;
+ *  for each element pair +a+ and +b+, the block should return an integer:
  *
+ *  - Negative when +b+ is to follow +a+.
+ *  - Zero when +a+ and +b+ are equivalent.
+ *  - Positive when +a+ is to follow +b+.
  *
- *  See also Enumerable#sort_by.
+ *  Example:
  *
- *     a = [ "d", "a", "e", "c", "b" ]
- *     a.sort                    #=> ["a", "b", "c", "d", "e"]
- *     a.sort { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
+ *    a = 'abcde'.split('').shuffle
+ *    a # => ["e", "b", "d", "a", "c"]
+ *    a1 = a.sort {|a, b| a <=> b }
+ *    a1 # => ["a", "b", "c", "d", "e"]
+ *    a2 = a.sort {|a, b| b <=> a }
+ *    a2 # => ["e", "d", "c", "b", "a"]
+ *
+ *  When the block returns zero, the order for +a+ and +b+ is indeterminate,
+ *  and may be unstable:
+ *
+ *    a = 'abcde'.split('').shuffle
+ *    a # => ["e", "b", "d", "a", "c"]
+ *    a1 = a.sort {|a, b| 0 }
+ *    a1 # =>  ["c", "e", "b", "d", "a"]
+ *
+ *  Related: Enumerable#sort_by.
  */
 
 VALUE
@@ -2550,55 +3681,12 @@ static VALUE rb_ary_bsearch_index(VALUE ary);
 
 /*
  *  call-seq:
- *     ary.bsearch {|x| block }  -> elem
- *
- *  By using binary search, finds a value from this array which meets
- *  the given condition in O(log n) where n is the size of the array.
- *
- *  You can use this method in two use cases: a find-minimum mode and
- *  a find-any mode.  In either case, the elements of the array must be
- *  monotone (or sorted) with respect to the block.
- *
- *  In find-minimum mode (this is a good choice for typical use case),
- *  the block must return true or false, and there must be an index i
- *  (0 <= i <= ary.size) so that:
- *
- *  - the block returns false for any element whose index is less than
- *    i, and
- *  - the block returns true for any element whose index is greater
- *    than or equal to i.
- *
- *  This method returns the i-th element.  If i is equal to ary.size,
- *  it returns nil.
- *
- *     ary = [0, 4, 7, 10, 12]
- *     ary.bsearch {|x| x >=   4 } #=> 4
- *     ary.bsearch {|x| x >=   6 } #=> 7
- *     ary.bsearch {|x| x >=  -1 } #=> 0
- *     ary.bsearch {|x| x >= 100 } #=> nil
- *
- *  In find-any mode (this behaves like libc's bsearch(3)), the block
- *  must return a number, and there must be two indices i and j
- *  (0 <= i <= j <= ary.size) so that:
- *
- *  - the block returns a positive number for ary[k] if 0 <= k < i,
- *  - the block returns zero for ary[k] if i <= k < j, and
- *  - the block returns a negative number for ary[k] if
- *    j <= k < ary.size.
- *
- *  Under this condition, this method returns any element whose index
- *  is within i...j.  If i is equal to j (i.e., there is no element
- *  that satisfies the block), this method returns nil.
- *
- *     ary = [0, 4, 7, 10, 12]
- *     # try to find v such that 4 <= v < 8
- *     ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
- *     # try to find v such that 8 <= v < 10
- *     ary.bsearch {|x| 4 - x / 2 } #=> nil
- *
- *  You must not mix the two modes at a time; the block must always
- *  return either true/false, or always return a number.  It is
- *  undefined which value is actually picked up at each iteration.
+ *    array.bsearch {|element| ... } -> object
+ *    array.bsearch -> new_enumerator
+ *
+ *  Returns an element from +self+ selected by a binary search.
+ *
+ *  See {Binary Searching}[rdoc-ref:bsearch.rdoc].
  */
 
 static VALUE
@@ -2607,22 +3695,18 @@ rb_ary_bsearch(VALUE ary)
     VALUE index_result = rb_ary_bsearch_index(ary);
 
     if (FIXNUM_P(index_result)) {
-	return rb_ary_entry(ary, FIX2LONG(index_result));
+        return rb_ary_entry(ary, FIX2LONG(index_result));
     }
     return index_result;
 }
 
 /*
  *  call-seq:
- *     ary.bsearch_index {|x| block }  -> int or nil
- *
- *  By using binary search, finds an index of a value from this array which
- *  meets the given condition in O(log n) where n is the size of the array.
+ *    array.bsearch_index {|element| ... } -> integer or nil
+ *    array.bsearch_index -> new_enumerator
  *
- *  It supports two modes, depending on the nature of the block and they are
- *  exactly the same as in the case of #bsearch method with the only difference
- *  being that this method returns the index of the element instead of the
- *  element itself. For more details consult the documentation for #bsearch.
+ *  Searches +self+ as described at method #bsearch,
+ *  but returns the _index_ of the found element instead of the element itself.
  */
 
 static VALUE
@@ -2634,39 +3718,39 @@ rb_ary_bsearch_index(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     while (low < high) {
-	mid = low + ((high - low) / 2);
-	val = rb_ary_entry(ary, mid);
-	v = rb_yield(val);
-	if (FIXNUM_P(v)) {
-	    if (v == INT2FIX(0)) return INT2FIX(mid);
-	    smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
-	}
-	else if (v == Qtrue) {
-	    satisfied = 1;
-	    smaller = 1;
-	}
-	else if (v == Qfalse || v == Qnil) {
-	    smaller = 0;
-	}
-	else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
-	    const VALUE zero = INT2FIX(0);
-	    switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
-	      case 0: return INT2FIX(mid);
-	      case 1: smaller = 1; break;
-	      case -1: smaller = 0;
-	    }
-	}
-	else {
-	    rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
-		     " (must be numeric, true, false or nil)",
-		     rb_obj_class(v));
-	}
-	if (smaller) {
-	    high = mid;
-	}
-	else {
-	    low = mid + 1;
-	}
+        mid = low + ((high - low) / 2);
+        val = rb_ary_entry(ary, mid);
+        v = rb_yield(val);
+        if (FIXNUM_P(v)) {
+            if (v == INT2FIX(0)) return INT2FIX(mid);
+            smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
+        }
+        else if (v == Qtrue) {
+            satisfied = 1;
+            smaller = 1;
+        }
+        else if (!RTEST(v)) {
+            smaller = 0;
+        }
+        else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
+            const VALUE zero = INT2FIX(0);
+            switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
+              case 0: return INT2FIX(mid);
+              case 1: smaller = 0; break;
+              case -1: smaller = 1;
+            }
+        }
+        else {
+            rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
+                     " (must be numeric, true, false or nil)",
+                     rb_obj_class(v));
+        }
+        if (smaller) {
+            high = mid;
+        }
+        else {
+            low = mid + 1;
+        }
     }
     if (!satisfied) return Qnil;
     return INT2FIX(low);
@@ -2681,13 +3765,27 @@ sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
 
 /*
  *  call-seq:
- *     ary.sort_by! { |obj| block }    -> ary
- *     ary.sort_by!                    -> Enumerator
+ *    array.sort_by! {|element| ... } -> self
+ *    array.sort_by! -> new_enumerator
+ *
+ *  Sorts the elements of +self+ in place,
+ *  using an ordering determined by the block; returns self.
+ *
+ *  Calls the block with each successive element;
+ *  sorts elements based on the values returned from the block.
+ *
+ *  For duplicates returned by the block, the ordering is indeterminate, and may be unstable.
+ *
+ *  This example sorts strings based on their sizes:
+ *
+ *    a = ['aaaa', 'bbb', 'cc', 'd']
+ *    a.sort_by! {|element| element.size }
+ *    a # => ["d", "cc", "bbb", "aaaa"]
  *
- *  Sorts +self+ in place using a set of keys generated by mapping the
- *  values in +self+ through the given block.
+ *  Returns a new \Enumerator if no block given:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    a = ['aaaa', 'bbb', 'cc', 'd']
+ *    a.sort_by! # => #<Enumerator: ["aaaa", "bbb", "cc", "d"]:sort_by!>
  *
  */
 
@@ -2706,23 +3804,22 @@ rb_ary_sort_by_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.collect { |item| block }  -> new_ary
- *     ary.map     { |item| block }  -> new_ary
- *     ary.collect                   -> Enumerator
- *     ary.map                       -> Enumerator
+ *    array.map {|element| ... } -> new_array
+ *    array.map -> new_enumerator
  *
- *  Invokes the given block once for each element of +self+.
+ *  Calls the block, if given, with each element of +self+;
+ *  returns a new \Array whose elements are the return values from the block:
  *
- *  Creates a new array containing the values returned by the block.
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a.map {|element| element.class }
+ *    a1 # => [Symbol, String, Integer]
  *
- *  See also Enumerable#collect.
+ *  Returns a new \Enumerator if no block given:
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a.map
+ *    a1 # => #<Enumerator: [:foo, "bar", 2]:map>
  *
- *  If no block is given, an Enumerator is returned instead.
- *
- *     a = [ "a", "b", "c", "d" ]
- *     a.collect { |x| x + "!" }        #=> ["a!", "b!", "c!", "d!"]
- *     a.map.with_index{ |x, i| x * i } #=> ["", "b", "cc", "ddd"]
- *     a                                #=> ["a", "b", "c", "d"]
+ *  Array#collect is an alias for Array#map.
  */
 
 static VALUE
@@ -2734,7 +3831,7 @@ rb_ary_collect(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     collect = rb_ary_new2(RARRAY_LEN(ary));
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
+        rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
     }
     return collect;
 }
@@ -2742,23 +3839,22 @@ rb_ary_collect(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.collect! {|item| block }   -> ary
- *     ary.map!     {|item| block }   -> ary
- *     ary.collect!                   -> Enumerator
- *     ary.map!                       -> Enumerator
+ *    array.map! {|element| ... } -> self
+ *    array.map! -> new_enumerator
+ *
+ *  Calls the block, if given, with each element;
+ *  replaces the element with the block's return value:
  *
- *  Invokes the given block once for each element of +self+, replacing the
- *  element with the value returned by the block.
+ *    a = [:foo, 'bar', 2]
+ *    a.map! { |element| element.class } # => [Symbol, String, Integer]
  *
- *  See also Enumerable#collect.
+ *  Returns a new \Enumerator if no block given:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a.map!
+ *    a1 # => #<Enumerator: [:foo, "bar", 2]:map!>
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.map! {|x| x + "!" }
- *     a #=>  [ "a!", "b!", "c!", "d!" ]
- *     a.collect!.with_index {|x, i| x[0...i] }
- *     a #=>  ["", "b", "c!", "d!"]
+ *  Array#collect! is an alias for Array#map!.
  */
 
 static VALUE
@@ -2769,7 +3865,7 @@ rb_ary_collect_bang(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     rb_ary_modify(ary);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
+        rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
     }
     return ary;
 }
@@ -2781,66 +3877,128 @@ rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func
     long beg, len, i, j;
 
     for (i=0; i<argc; i++) {
-	if (FIXNUM_P(argv[i])) {
-	    rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
-	    continue;
-	}
-	/* check if idx is Range */
-	if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
-	    long end = olen < beg+len ? olen : beg+len;
-	    for (j = beg; j < end; j++) {
-		rb_ary_push(result, (*func)(obj, j));
-	    }
-	    if (beg + len > j)
-		rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
-	    continue;
-	}
-	rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
+        if (FIXNUM_P(argv[i])) {
+            rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
+            continue;
+        }
+        /* check if idx is Range */
+        if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
+            long end = olen < beg+len ? olen : beg+len;
+            for (j = beg; j < end; j++) {
+                rb_ary_push(result, (*func)(obj, j));
+            }
+            if (beg + len > j)
+                rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
+            continue;
+        }
+        rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
     }
     return result;
 }
 
+static VALUE
+append_values_at_single(VALUE result, VALUE ary, long olen, VALUE idx)
+{
+    long beg, len;
+    if (FIXNUM_P(idx)) {
+        beg = FIX2LONG(idx);
+    }
+    /* check if idx is Range */
+    else if (rb_range_beg_len(idx, &beg, &len, olen, 1)) {
+        if (len > 0) {
+            const VALUE *const src = RARRAY_CONST_PTR_TRANSIENT(ary);
+            const long end = beg + len;
+            const long prevlen = RARRAY_LEN(result);
+            if (beg < olen) {
+                rb_ary_cat(result, src + beg, end > olen ? olen-beg : len);
+            }
+            if (end > olen) {
+                rb_ary_store(result, prevlen + len - 1, Qnil);
+            }
+        }
+        return result;
+    }
+    else {
+        beg = NUM2LONG(idx);
+    }
+    return rb_ary_push(result, rb_ary_entry(ary, beg));
+}
+
 /*
  *  call-seq:
- *     ary.values_at(selector, ...)  -> new_ary
+ *    array.values_at(*indexes) -> new_array
+ *
+ *  Returns a new \Array whose elements are the elements
+ *  of +self+ at the given \Integer or \Range +indexes+.
+ *
+ *  For each positive +index+, returns the element at offset +index+:
  *
- *  Returns an array containing the elements in +self+ corresponding to the
- *  given +selector+(s).
+ *    a = [:foo, 'bar', 2]
+ *    a.values_at(0, 2) # => [:foo, 2]
+ *    a.values_at(0..1) # => [:foo, "bar"]
  *
- *  The selectors may be either integer indices or ranges.
+ *  The given +indexes+ may be in any order, and may repeat:
  *
- *  See also Array#select.
+ *    a = [:foo, 'bar', 2]
+ *    a.values_at(2, 0, 1, 0, 2) # => [2, :foo, "bar", :foo, 2]
+ *    a.values_at(1, 0..2) # => ["bar", :foo, "bar", 2]
+ *
+ *  Assigns +nil+ for an +index+ that is too large:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.values_at(0, 3, 1, 3) # => [:foo, nil, "bar", nil]
+ *
+ *  Returns a new empty \Array if no arguments given.
+ *
+ *  For each negative +index+, counts backward from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.values_at(-1, -3) # => [2, :foo]
+ *
+ *  Assigns +nil+ for an +index+ that is too small:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.values_at(0, -5, 1, -6, 2) # => [:foo, nil, "bar", nil, 2]
+ *
+ *  The given +indexes+ may have a mixture of signs:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.values_at(0, -2, 1, -1) # => [:foo, "bar", "bar", 2]
  *
- *     a = %w{ a b c d e f }
- *     a.values_at(1, 3, 5)          # => ["b", "d", "f"]
- *     a.values_at(1, 3, 5, 7)       # => ["b", "d", "f", nil]
- *     a.values_at(-1, -2, -2, -7)   # => ["f", "e", "e", nil]
- *     a.values_at(4..6, 3...6)      # => ["e", "f", nil, "d", "e", "f"]
  */
 
 static VALUE
 rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
 {
-    return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
+    long i, olen = RARRAY_LEN(ary);
+    VALUE result = rb_ary_new_capa(argc);
+    for (i = 0; i < argc; ++i) {
+        append_values_at_single(result, ary, olen, argv[i]);
+    }
+    RB_GC_GUARD(ary);
+    return result;
 }
 
 
 /*
  *  call-seq:
- *     ary.select { |item| block } -> new_ary
- *     ary.select                  -> Enumerator
+ *    array.select {|element| ... } -> new_array
+ *    array.select -> new_enumerator
  *
- *  Returns a new array containing all elements of +ary+
- *  for which the given +block+ returns a true value.
+ *  Calls the block, if given, with each element of +self+;
+ *  returns a new \Array containing those elements of +self+
+ *  for which the block returns a truthy value:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a1 = a.select {|element| element.to_s.start_with?('b') }
+ *    a1 # => ["bar", :bam]
  *
- *     [1,2,3,4,5].select { |num|  num.even?  }   #=> [2, 4]
+ *  Returns a new \Enumerator if no block given:
  *
- *     a = %w{ a b c d e f }
- *     a.select { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.select # => #<Enumerator: [:foo, "bar", 2, :bam]:select>
  *
- *  See also Enumerable#select.
+ *  Array#filter is an alias for Array#select.
  */
 
 static VALUE
@@ -2852,9 +4010,9 @@ rb_ary_select(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     result = rb_ary_new2(RARRAY_LEN(ary));
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-	    rb_ary_push(result, rb_ary_elt(ary, i));
-	}
+        if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+            rb_ary_push(result, rb_ary_elt(ary, i));
+        }
     }
     return result;
 }
@@ -2872,12 +4030,12 @@ select_bang_i(VALUE a)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-	VALUE v = RARRAY_AREF(ary, i1);
-	if (!RTEST(rb_yield(v))) continue;
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, v);
-	}
-	arg->len[1] = ++i2;
+        VALUE v = RARRAY_AREF(ary, i1);
+        if (!RTEST(rb_yield(v))) continue;
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, v);
+        }
+        arg->len[1] = ++i2;
     }
     return (i1 == i2) ? Qnil : ary;
 }
@@ -2890,33 +4048,41 @@ select_bang_ensure(VALUE a)
     long len = RARRAY_LEN(ary);
     long i1 = arg->len[0], i2 = arg->len[1];
 
-    if (i2 < i1) {
-	if (i1 < len) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		    MEMMOVE(ptr + i2, ptr + i1, VALUE, len - i1);
-		});
-	}
-	ARY_SET_LEN(ary, len - i1 + i2);
+    if (i2 < len && i2 < i1) {
+        long tail = 0;
+        rb_ary_modify(ary);
+        if (i1 < len) {
+            tail = len - i1;
+            RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+                    MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
+                });
+        }
+        ARY_SET_LEN(ary, i2 + tail);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.select!  {|item| block } -> ary or nil
- *     ary.select!                  -> Enumerator
+ *    array.select! {|element| ... } -> self or nil
+ *    array.select! -> new_enumerator
  *
- *  Invokes the given block passing in successive elements from +self+,
- *  deleting elements for which the block returns a +false+ value.
+ *  Calls the block, if given  with each element of +self+;
+ *  removes from +self+ those elements for which the block returns +false+ or +nil+.
  *
- *  The array may not be changed instantly every time the block is called.
+ *  Returns +self+ if any elements were removed:
  *
- *  If changes were made, it will return +self+, otherwise it returns +nil+.
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.select! {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
  *
- *  See also Array#keep_if
+ *  Returns +nil+ if no elements were removed.
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  Returns a new \Enumerator if no block given:
  *
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.select! # => #<Enumerator: [:foo, "bar", 2, :bam]:select!>
+ *
+ *  Array#filter! is an alias for Array#select!.
  */
 
 static VALUE
@@ -2934,18 +4100,20 @@ rb_ary_select_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.keep_if { |item| block } -> ary
- *     ary.keep_if                  -> Enumerator
+ *    array.keep_if {|element| ... } -> self
+ *    array.keep_if -> new_enumeration
+ *
+ *  Retains those elements for which the block returns a truthy value;
+ *  deletes all other elements; returns +self+:
  *
- *  Deletes every element of +self+ for which the given block evaluates to
- *  +false+.
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.keep_if {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
  *
- *  See also Array#select!
+ *  Returns a new \Enumerator if no block given:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.keep_if # => #<Enumerator: [:foo, "bar", 2, :bam]:keep_if>
  *
- *     a = %w{ a b c d e f }
- *     a.keep_if { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
  */
 
 static VALUE
@@ -2961,32 +4129,48 @@ ary_resize_smaller(VALUE ary, long len)
 {
     rb_ary_modify(ary);
     if (RARRAY_LEN(ary) > len) {
-	ARY_SET_LEN(ary, len);
-	if (len * 2 < ARY_CAPA(ary) &&
-	    ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
-	    ary_resize_capa(ary, len * 2);
-	}
+        ARY_SET_LEN(ary, len);
+        if (len * 2 < ARY_CAPA(ary) &&
+            ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+            ary_resize_capa(ary, len * 2);
+        }
     }
 }
 
 /*
  *  call-seq:
- *     ary.delete(obj)            -> item or nil
- *     ary.delete(obj) { block }  -> item or result of block
+ *    array.delete(obj) -> deleted_object
+ *    array.delete(obj) {|nosuch| ... } -> deleted_object or block_return
+ *
+ *  Removes zero or more elements from +self+.
+ *
+ *  When no block is given,
+ *  removes from +self+ each element +ele+ such that <tt>ele == obj</tt>;
+ *  returns the last deleted element:
+ *
+ *    s1 = 'bar'; s2 = 'bar'
+ *    a = [:foo, s1, 2, s2]
+ *    a.delete('bar') # => "bar"
+ *    a # => [:foo, 2]
+ *
+ *  Returns +nil+ if no elements removed.
  *
- *  Deletes all items from +self+ that are equal to +obj+.
+ *  When a block is given,
+ *  removes from +self+ each element +ele+ such that <tt>ele == obj</tt>.
  *
- *  Returns the last deleted item, or +nil+ if no matching item is found.
+ *  If any such elements are found, ignores the block
+ *  and returns the last deleted element:
  *
- *  If the optional code block is given, the result of the block is returned if
- *  the item is not found.  (To remove +nil+ elements and get an informative
- *  return value, use Array#compact!)
+ *    s1 = 'bar'; s2 = 'bar'
+ *    a = [:foo, s1, 2, s2]
+ *    deleted_obj = a.delete('bar') {|obj| fail 'Cannot happen' }
+ *    a # => [:foo, 2]
+ *
+ *  If no such elements are found, returns the block's return value:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.delete(:nosuch) {|obj| "#{obj} not found" } # => "nosuch not found"
  *
- *     a = [ "a", "b", "b", "b", "c" ]
- *     a.delete("b")                   #=> "b"
- *     a                               #=> ["a", "c"]
- *     a.delete("z")                   #=> nil
- *     a.delete("z") { "not found" }   #=> "not found"
  */
 
 VALUE
@@ -2996,26 +4180,27 @@ rb_ary_delete(VALUE ary, VALUE item)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-	VALUE e = RARRAY_AREF(ary, i1);
+        VALUE e = RARRAY_AREF(ary, i1);
 
-	if (rb_equal(e, item)) {
-	    v = e;
-	    continue;
-	}
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, e);
-	}
-	i2++;
+        if (rb_equal(e, item)) {
+            v = e;
+            continue;
+        }
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, e);
+        }
+        i2++;
     }
     if (RARRAY_LEN(ary) == i2) {
-	if (rb_block_given_p()) {
-	    return rb_yield(item);
-	}
-	return Qnil;
+        if (rb_block_given_p()) {
+            return rb_yield(item);
+        }
+        return Qnil;
     }
 
     ary_resize_smaller(ary, i2);
 
+    ary_verify(ary);
     return v;
 }
 
@@ -3025,18 +4210,18 @@ rb_ary_delete_same(VALUE ary, VALUE item)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-	VALUE e = RARRAY_AREF(ary, i1);
+        VALUE e = RARRAY_AREF(ary, i1);
 
-	if (e == item) {
-	    continue;
-	}
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, e);
-	}
-	i2++;
+        if (e == item) {
+            continue;
+        }
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, e);
+        }
+        i2++;
     }
     if (RARRAY_LEN(ary) == i2) {
-	return;
+        return;
     }
 
     ary_resize_smaller(ary, i2);
@@ -3050,33 +4235,41 @@ rb_ary_delete_at(VALUE ary, long pos)
 
     if (pos >= len) return Qnil;
     if (pos < 0) {
-	pos += len;
-	if (pos < 0) return Qnil;
+        pos += len;
+        if (pos < 0) return Qnil;
     }
 
     rb_ary_modify(ary);
     del = RARRAY_AREF(ary, pos);
-    RARRAY_PTR_USE(ary, ptr, {
-	MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+    RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+        MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
     });
     ARY_INCREASE_LEN(ary, -1);
-
+    ary_verify(ary);
     return del;
 }
 
 /*
  *  call-seq:
- *     ary.delete_at(index)  -> obj or nil
+ *    array.delete_at(index) -> deleted_object or nil
+ *
+ *  Deletes an element from +self+, per the given \Integer +index+.
+ *
+ *  When +index+ is non-negative, deletes the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(1) # => "bar"
+ *    a # => [:foo, 2]
+ *
+ *  If index is too large, returns +nil+.
  *
- *  Deletes the element at the specified +index+, returning that element, or
- *  +nil+ if the +index+ is out of range.
+ *  When +index+ is negative, counts backward from the end of the array:
  *
- *  See also Array#slice!
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(-2) # => "bar"
+ *    a # => [:foo, 2]
  *
- *     a = ["ant", "bat", "cat", "dog"]
- *     a.delete_at(2)    #=> "cat"
- *     a                 #=> ["ant", "bat", "dog"]
- *     a.delete_at(99)   #=> nil
+ *  If +index+ is too small (far from zero), returns nil.
  */
 
 static VALUE
@@ -3085,73 +4278,133 @@ rb_ary_delete_at_m(VALUE ary, VALUE pos)
     return rb_ary_delete_at(ary, NUM2LONG(pos));
 }
 
+static VALUE
+ary_slice_bang_by_rb_ary_splice(VALUE ary, long pos, long len)
+{
+    const long orig_len = RARRAY_LEN(ary);
+
+    if (len < 0) {
+        return Qnil;
+    }
+    else if (pos < -orig_len) {
+        return Qnil;
+    }
+    else if (pos < 0) {
+        pos += orig_len;
+    }
+    else if (orig_len < pos) {
+        return Qnil;
+    }
+    if (orig_len < pos + len) {
+        len = orig_len - pos;
+    }
+    if (len == 0) {
+        return rb_ary_new2(0);
+    }
+    else {
+        VALUE arg2 = rb_ary_new4(len, RARRAY_CONST_PTR_TRANSIENT(ary)+pos);
+        rb_ary_splice(ary, pos, len, 0, 0);
+        return arg2;
+    }
+}
+
 /*
  *  call-seq:
- *     ary.slice!(index)         -> obj or nil
- *     ary.slice!(start, length) -> new_ary or nil
- *     ary.slice!(range)         -> new_ary or nil
- *
- *  Deletes the element(s) given by an +index+ (optionally up to +length+
- *  elements) or by a +range+.
- *
- *  Returns the deleted object (or objects), or +nil+ if the +index+ is out of
- *  range.
- *
- *     a = [ "a", "b", "c" ]
- *     a.slice!(1)     #=> "b"
- *     a               #=> ["a", "c"]
- *     a.slice!(-1)    #=> "c"
- *     a               #=> ["a"]
- *     a.slice!(100)   #=> nil
- *     a               #=> ["a"]
+ *    array.slice!(n) -> object or nil
+ *    array.slice!(start, length) -> new_array or nil
+ *    array.slice!(range) -> new_array or nil
+ *
+ *  Removes and returns elements from +self+.
+ *
+ *  When the only argument is an \Integer +n+,
+ *  removes and returns the _nth_ element in +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.slice!(1) # => "bar"
+ *    a # => [:foo, 2]
+ *
+ *  If +n+ is negative, counts backwards from the end of +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.slice!(-1) # => 2
+ *    a # => [:foo, "bar"]
+ *
+ *  If +n+ is out of range, returns +nil+.
+ *
+ *  When the only arguments are Integers +start+ and +length+,
+ *  removes +length+ elements from +self+ beginning at offset  +start+;
+ *  returns the deleted objects in a new \Array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.slice!(0, 2) # => [:foo, "bar"]
+ *    a # => [2]
+ *
+ *  If <tt>start + length</tt> exceeds the array size,
+ *  removes and returns all elements from offset +start+ to the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.slice!(1, 50) # => ["bar", 2]
+ *    a # => [:foo]
+ *
+ *  If <tt>start == a.size</tt> and +length+ is non-negative,
+ *  returns a new empty \Array.
+ *
+ *  If +length+ is negative, returns +nil+.
+ *
+ *  When the only argument is a \Range object +range+,
+ *  treats <tt>range.min</tt> as +start+ above and <tt>range.size</tt> as +length+ above:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.slice!(1..2) # => ["bar", 2]
+ *    a # => [:foo]
+ *
+ *  If <tt>range.start == a.size</tt>, returns a new empty \Array.
+ *
+ *  If <tt>range.start</tt> is larger than the array size, returns +nil+.
+ *
+ *  If <tt>range.end</tt> is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.slice!(0..-2) # => [:foo, "bar"]
+ *    a # => [2]
+ *
+ *  If <tt>range.start</tt> is negative,
+ *  calculates the start index backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.slice!(-2..2) # => ["bar", 2]
+ *    a # => [:foo]
+ *
  */
 
 static VALUE
 rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE arg1, arg2;
-    long pos, len, orig_len;
+    VALUE arg1;
+    long pos, len;
 
     rb_ary_modify_check(ary);
+    rb_check_arity(argc, 1, 2);
+    arg1 = argv[0];
+
     if (argc == 2) {
-	pos = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
-      delete_pos_len:
-	if (len < 0) return Qnil;
-	orig_len = RARRAY_LEN(ary);
-	if (pos < 0) {
-	    pos += orig_len;
-	    if (pos < 0) return Qnil;
-	}
-	else if (orig_len < pos) return Qnil;
-	if (orig_len < pos + len) {
-	    len = orig_len - pos;
-	}
-	if (len == 0) return rb_ary_new2(0);
-	arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
-	RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
-	rb_ary_splice(ary, pos, len, Qundef);
-	return arg2;
-    }
-
-    if (argc != 1) {
-	/* error report */
-	rb_scan_args(argc, argv, "11", NULL, NULL);
+        pos = NUM2LONG(argv[0]);
+        len = NUM2LONG(argv[1]);
+        return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
     }
-    arg1 = argv[0];
 
     if (!FIXNUM_P(arg1)) {
-	switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
-	  case Qtrue:
-	    /* valid range */
-	    goto delete_pos_len;
-	  case Qnil:
-	    /* invalid range */
-	    return Qnil;
-	  default:
-	    /* not a range */
-	    break;
-	}
+        switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+          case Qtrue:
+            /* valid range */
+            return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
+          case Qnil:
+            /* invalid range */
+            return Qnil;
+          default:
+            /* not a range */
+            break;
+        }
     }
 
     return rb_ary_delete_at(ary, NUM2LONG(arg1));
@@ -3163,10 +4416,11 @@ ary_reject(VALUE orig, VALUE result)
     long i;
 
     for (i = 0; i < RARRAY_LEN(orig); i++) {
-	VALUE v = RARRAY_AREF(orig, i);
-	if (!RTEST(rb_yield(v))) {
-	    rb_ary_push(result, v);
-	}
+        VALUE v = RARRAY_AREF(orig, i);
+
+        if (!RTEST(rb_yield(v))) {
+            rb_ary_push(result, v);
+        }
     }
     return result;
 }
@@ -3179,12 +4433,12 @@ reject_bang_i(VALUE a)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-	VALUE v = RARRAY_AREF(ary, i1);
-	if (RTEST(rb_yield(v))) continue;
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, v);
-	}
-	arg->len[1] = ++i2;
+        VALUE v = RARRAY_AREF(ary, i1);
+        if (RTEST(rb_yield(v))) continue;
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, v);
+        }
+        arg->len[1] = ++i2;
     }
     return (i1 == i2) ? Qnil : ary;
 }
@@ -3193,7 +4447,6 @@ static VALUE
 ary_reject_bang(VALUE ary)
 {
     struct select_bang_arg args;
-
     rb_ary_modify_check(ary);
     args.ary = ary;
     args.len[0] = args.len[1] = 0;
@@ -3202,37 +4455,50 @@ ary_reject_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.reject! { |item| block }  -> ary or nil
- *     ary.reject!                   -> Enumerator
+ *    array.reject! {|element| ... } -> self or nil
+ *    array.reject! -> new_enumerator
+ *
+ *  Removes each element for which the block returns a truthy value.
+ *
+ *  Returns +self+ if any elements removed:
+ *
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a.reject! {|element| element.to_s.start_with?('b') } # => [:foo, 2]
  *
- *  Equivalent to Array#delete_if, deleting elements from +self+ for which the
- *  block evaluates to +true+, but returns +nil+ if no changes were made.
+ *  Returns +nil+ if no elements removed.
  *
- *  The array may not be changed instantly every time the block is called.
+ *  Returns a new \Enumerator if no block given:
  *
- *  See also Enumerable#reject and Array#delete_if.
+ *    a = [:foo, 'bar', 2]
+ *    a.reject! # => #<Enumerator: [:foo, "bar", 2]:reject!>
  *
- *  If no block is given, an Enumerator is returned instead.
  */
 
 static VALUE
 rb_ary_reject_bang(VALUE ary)
 {
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
     return ary_reject_bang(ary);
 }
 
 /*
  *  call-seq:
- *     ary.reject  {|item| block }  -> new_ary
- *     ary.reject                   -> Enumerator
+ *    array.reject {|element| ... } -> new_array
+ *    array.reject -> new_enumerator
+ *
+ *  Returns a new \Array whose elements are all those from +self+
+ *  for which the block returns +false+ or +nil+:
  *
- *  Returns a new array containing the items in +self+ for which the given
- *  block is not +true+. The ordering of non-rejected elements is maintained.
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a1 = a.reject {|element| element.to_s.start_with?('b') }
+ *    a1 # => [:foo, 2]
  *
- *  See also Array#delete_if
+ *  Returns a new \Enumerator if no block given:
+ *
+ *     a = [:foo, 'bar', 2]
+ *     a.reject # => #<Enumerator: [:foo, "bar", 2]:reject>
  *
- *  If no block is given, an Enumerator is returned instead.
  */
 
 static VALUE
@@ -3248,25 +4514,26 @@ rb_ary_reject(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.delete_if { |item| block }  -> ary
- *     ary.delete_if                   -> Enumerator
+ *    array.delete_if {|element| ... } -> self
+ *    array.delete_if -> Enumerator
  *
- *  Deletes every element of +self+ for which block evaluates to +true+.
+ *  Removes each element in +self+ for which the block returns a truthy value;
+ *  returns +self+:
  *
- *  The array is changed instantly every time the block is called, not after
- *  the iteration is over.
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a.delete_if {|element| element.to_s.start_with?('b') } # => [:foo, 2]
  *
- *  See also Array#reject!
+ *  Returns a new \Enumerator if no block given:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_if # => #<Enumerator: [:foo, "bar", 2]:delete_if>
  *
- *     scores = [ 97, 42, 75 ]
- *     scores.delete_if {|score| score < 80 }   #=> [97]
- */
+3 */
 
 static VALUE
 rb_ary_delete_if(VALUE ary)
 {
+    ary_verify(ary);
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     ary_reject_bang(ary);
     return ary;
@@ -3276,9 +4543,9 @@ static VALUE
 take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
 {
     VALUE *args = (VALUE *)cbarg;
-    if (args[1]-- == 0) rb_iter_break();
     if (argc > 1) val = rb_ary_new4(argc, argv);
     rb_ary_push(args[0], val);
+    if (--args[1] == 0) rb_iter_break();
     return Qnil;
 }
 
@@ -3288,38 +4555,71 @@ take_items(VALUE obj, long n)
     VALUE result = rb_check_array_type(obj);
     VALUE args[2];
 
+    if (n == 0) return result;
     if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
     result = rb_ary_new2(n);
     args[0] = result; args[1] = (VALUE)n;
-    if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
-	rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
-		 rb_obj_class(obj));
+    if (UNDEF_P(rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args)))
+        rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
+                 rb_obj_class(obj));
     return result;
 }
 
 
 /*
  *  call-seq:
- *     ary.zip(arg, ...)                  -> new_ary
- *     ary.zip(arg, ...) { |arr| block }  -> nil
+ *    array.zip(*other_arrays) -> new_array
+ *    array.zip(*other_arrays) {|other_array| ... } -> nil
+ *
+ *  When no block given, returns a new \Array +new_array+ of size <tt>self.size</tt>
+ *  whose elements are Arrays.
+ *
+ *  Each nested array <tt>new_array[n]</tt> is of size <tt>other_arrays.size+1</tt>,
+ *  and contains:
+ *
+ *  - The _nth_ element of +self+.
+ *  - The _nth_ element of each of the +other_arrays+.
  *
- *  Converts any arguments to arrays, then merges elements of +self+ with
- *  corresponding elements from each argument.
+ *  If all +other_arrays+ and +self+ are the same size:
  *
- *  This generates a sequence of <code>ary.size</code> _n_-element arrays,
- *  where _n_ is one more than the count of arguments.
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3]
+ *    c = [:c0, :c1, :c2, :c3]
+ *    d = a.zip(b, c)
+ *    d # => [[:a0, :b0, :c0], [:a1, :b1, :c1], [:a2, :b2, :c2], [:a3, :b3, :c3]]
  *
- *  If the size of any argument is less than the size of the initial array,
- *  +nil+ values are supplied.
+ *  If any array in +other_arrays+ is smaller than +self+,
+ *  fills to <tt>self.size</tt> with +nil+:
  *
- *  If a block is given, it is invoked for each output +array+, otherwise an
- *  array of arrays is returned.
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2]
+ *    c = [:c0, :c1]
+ *    d = a.zip(b, c)
+ *    d # => [[:a0, :b0, :c0], [:a1, :b1, :c1], [:a2, :b2, nil], [:a3, nil, nil]]
+ *
+ *  If any array in +other_arrays+ is larger than +self+,
+ *  its trailing elements are ignored:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3, :b4]
+ *    c = [:c0, :c1, :c2, :c3, :c4, :c5]
+ *    d = a.zip(b, c)
+ *    d # => [[:a0, :b0, :c0], [:a1, :b1, :c1], [:a2, :b2, :c2], [:a3, :b3, :c3]]
+ *
+ *  When a block is given, calls the block with each of the sub-arrays (formed as above); returns +nil+:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3]
+ *    c = [:c0, :c1, :c2, :c3]
+ *    a.zip(b, c) {|sub_array| p sub_array} # => nil
+ *
+ *  Output:
+ *
+ *    [:a0, :b0, :c0]
+ *    [:a1, :b1, :c1]
+ *    [:a2, :b2, :c2]
+ *    [:a3, :b3, :c3]
  *
- *     a = [ 4, 5, 6 ]
- *     b = [ 7, 8, 9 ]
- *     [1, 2, 3].zip(a, b)   #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
- *     [1, 2].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8]]
- *     a.zip([1, 2], [8])    #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
  */
 
 static VALUE
@@ -3330,51 +4630,51 @@ rb_ary_zip(int argc, VALUE *argv, VALUE ary)
     VALUE result = Qnil;
 
     for (i=0; i<argc; i++) {
-	argv[i] = take_items(argv[i], len);
+        argv[i] = take_items(argv[i], len);
     }
 
     if (rb_block_given_p()) {
-	int arity = rb_block_arity();
-
-	if (arity > 1) {
-	    VALUE work, *tmp;
-
-	    tmp = ALLOCV_N(VALUE, work, argc+1);
-
-	    for (i=0; i<RARRAY_LEN(ary); i++) {
-		tmp[0] = RARRAY_AREF(ary, i);
-		for (j=0; j<argc; j++) {
-		    tmp[j+1] = rb_ary_elt(argv[j], i);
-		}
-		rb_yield_values2(argc+1, tmp);
-	    }
-
-	    if (work) ALLOCV_END(work);
-	}
-	else {
-	    for (i=0; i<RARRAY_LEN(ary); i++) {
-		VALUE tmp = rb_ary_new2(argc+1);
-
-		rb_ary_push(tmp, RARRAY_AREF(ary, i));
-		for (j=0; j<argc; j++) {
-		    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-		}
-		rb_yield(tmp);
-	    }
-	}
+        int arity = rb_block_arity();
+
+        if (arity > 1) {
+            VALUE work, *tmp;
+
+            tmp = ALLOCV_N(VALUE, work, argc+1);
+
+            for (i=0; i<RARRAY_LEN(ary); i++) {
+                tmp[0] = RARRAY_AREF(ary, i);
+                for (j=0; j<argc; j++) {
+                    tmp[j+1] = rb_ary_elt(argv[j], i);
+                }
+                rb_yield_values2(argc+1, tmp);
+            }
+
+            if (work) ALLOCV_END(work);
+        }
+        else {
+            for (i=0; i<RARRAY_LEN(ary); i++) {
+                VALUE tmp = rb_ary_new2(argc+1);
+
+                rb_ary_push(tmp, RARRAY_AREF(ary, i));
+                for (j=0; j<argc; j++) {
+                    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+                }
+                rb_yield(tmp);
+            }
+        }
     }
     else {
-	result = rb_ary_new_capa(len);
+        result = rb_ary_new_capa(len);
 
-	for (i=0; i<len; i++) {
-	    VALUE tmp = rb_ary_new_capa(argc+1);
+        for (i=0; i<len; i++) {
+            VALUE tmp = rb_ary_new_capa(argc+1);
 
-	    rb_ary_push(tmp, RARRAY_AREF(ary, i));
-	    for (j=0; j<argc; j++) {
-		rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-	    }
-	    rb_ary_push(result, tmp);
-	}
+            rb_ary_push(tmp, RARRAY_AREF(ary, i));
+            for (j=0; j<argc; j++) {
+                rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+            }
+            rb_ary_push(result, tmp);
+        }
     }
 
     return result;
@@ -3382,15 +4682,14 @@ rb_ary_zip(int argc, VALUE *argv, VALUE ary)
 
 /*
  *  call-seq:
- *     ary.transpose -> new_ary
+ *    array.transpose -> new_array
  *
- *  Assumes that +self+ is an array of arrays and transposes the rows and
- *  columns.
+ *  Transposes the rows and columns in an \Array of Arrays;
+ *  the nested Arrays must all be the same size:
  *
- *     a = [[1,2], [3,4], [5,6]]
- *     a.transpose   #=> [[1, 3, 5], [2, 4, 6]]
+ *    a = [[:a0, :a1], [:b0, :b1], [:c0, :c1]]
+ *    a.transpose # => [[:a0, :b0, :c0], [:a1, :b1, :c1]]
  *
- *  If the length of the subarrays don't match, an IndexError is raised.
  */
 
 static VALUE
@@ -3402,36 +4701,34 @@ rb_ary_transpose(VALUE ary)
     alen = RARRAY_LEN(ary);
     if (alen == 0) return rb_ary_dup(ary);
     for (i=0; i<alen; i++) {
-	tmp = to_ary(rb_ary_elt(ary, i));
-	if (elen < 0) {		/* first element */
-	    elen = RARRAY_LEN(tmp);
-	    result = rb_ary_new2(elen);
-	    for (j=0; j<elen; j++) {
-		rb_ary_store(result, j, rb_ary_new2(alen));
-	    }
-	}
-	else if (elen != RARRAY_LEN(tmp)) {
-	    rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
-		     RARRAY_LEN(tmp), elen);
-	}
-	for (j=0; j<elen; j++) {
-	    rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
-	}
+        tmp = to_ary(rb_ary_elt(ary, i));
+        if (elen < 0) {		/* first element */
+            elen = RARRAY_LEN(tmp);
+            result = rb_ary_new2(elen);
+            for (j=0; j<elen; j++) {
+                rb_ary_store(result, j, rb_ary_new2(alen));
+            }
+        }
+        else if (elen != RARRAY_LEN(tmp)) {
+            rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+                     RARRAY_LEN(tmp), elen);
+        }
+        for (j=0; j<elen; j++) {
+            rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
+        }
     }
     return result;
 }
 
 /*
  *  call-seq:
- *     ary.replace(other_ary)  -> ary
- *     ary.initialize_copy(other_ary)	-> ary
+ *    array.replace(other_array) -> self
+ *
+ *  Replaces the content of +self+ with the content of +other_array+; returns +self+:
  *
- *  Replaces the contents of +self+ with the contents of +other_ary+,
- *  truncating or expanding if necessary.
+ *    a = [:foo, 'bar', 2]
+ *    a.replace(['foo', :bar, 3]) # => ["foo", :bar, 3]
  *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.replace([ "x", "y", "z" ])   #=> ["x", "y", "z"]
- *     a                              #=> ["x", "y", "z"]
  */
 
 VALUE
@@ -3441,183 +4738,347 @@ rb_ary_replace(VALUE copy, VALUE orig)
     orig = to_ary(orig);
     if (copy == orig) return copy;
 
-    if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
-        VALUE shared = 0;
+    rb_ary_reset(copy);
 
-        if (ARY_OWNS_HEAP_P(copy)) {
-	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
-	}
-        else if (ARY_SHARED_P(copy)) {
-            shared = ARY_SHARED(copy);
-            FL_UNSET_SHARED(copy);
-        }
-        FL_SET_EMBED(copy);
-	ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
-        if (shared) {
-            rb_ary_decrement_share(shared);
-        }
-        ARY_SET_LEN(copy, RARRAY_LEN(orig));
+    /* orig has enough space to embed the contents of orig. */
+    if (RARRAY_LEN(orig) <= ary_embed_capa(copy)) {
+        assert(ARY_EMBED_P(copy));
+        ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR_TRANSIENT(orig));
+        ARY_SET_EMBED_LEN(copy, RARRAY_LEN(orig));
+    }
+#if USE_RVARGC
+    /* orig is embedded but copy does not have enough space to embed the
+     * contents of orig. */
+    else if (ARY_EMBED_P(orig)) {
+        long len = ARY_EMBED_LEN(orig);
+        VALUE *ptr = ary_heap_alloc(copy, len);
+
+        FL_UNSET_EMBED(copy);
+        ARY_SET_PTR(copy, ptr);
+        ARY_SET_LEN(copy, len);
+        ARY_SET_CAPA(copy, len);
+
+        // No allocation and exception expected that could leave `copy` in a
+        // bad state from the edits above.
+        ary_memcpy(copy, 0, len, RARRAY_CONST_PTR_TRANSIENT(orig));
     }
+#endif
+    /* Otherwise, orig is on heap and copy does not have enough space to embed
+     * the contents of orig. */
     else {
-        VALUE shared = ary_make_shared(orig);
-        if (ARY_OWNS_HEAP_P(copy)) {
-	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
-        }
-        else {
-            rb_ary_unshare_safe(copy);
-        }
+        VALUE shared_root = ary_make_shared(orig);
         FL_UNSET_EMBED(copy);
-        ARY_SET_PTR(copy, RARRAY_CONST_PTR(orig));
-        ARY_SET_LEN(copy, RARRAY_LEN(orig));
-        rb_ary_set_shared(copy, shared);
+        ARY_SET_PTR(copy, ARY_HEAP_PTR(orig));
+        ARY_SET_LEN(copy, ARY_HEAP_LEN(orig));
+        rb_ary_set_shared(copy, shared_root);
     }
+    ary_verify(copy);
     return copy;
 }
 
 /*
  *  call-seq:
- *     ary.clear    -> ary
+ *     array.clear -> self
  *
- *  Removes all elements from +self+.
+ *  Removes all elements from +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.clear # => []
  *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.clear    #=> [ ]
  */
 
 VALUE
 rb_ary_clear(VALUE ary)
 {
     rb_ary_modify_check(ary);
-    ARY_SET_LEN(ary, 0);
     if (ARY_SHARED_P(ary)) {
-	if (!ARY_EMBED_P(ary)) {
-	    rb_ary_unshare(ary);
-	    FL_SET_EMBED(ary);
-	}
+        if (!ARY_EMBED_P(ary)) {
+            rb_ary_unshare(ary);
+            FL_SET_EMBED(ary);
+            ARY_SET_EMBED_LEN(ary, 0);
+        }
     }
-    else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
-	ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+    else {
+        ARY_SET_LEN(ary, 0);
+        if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+            ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+        }
     }
+    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.fill(obj)                                 -> ary
- *     ary.fill(obj, start [, length])               -> ary
- *     ary.fill(obj, range )                         -> ary
- *     ary.fill { |index| block }                    -> ary
- *     ary.fill(start [, length] ) { |index| block } -> ary
- *     ary.fill(range) { |index| block }             -> ary
+ *    array.fill(obj) -> self
+ *    array.fill(obj, start) -> self
+ *    array.fill(obj, start, length) -> self
+ *    array.fill(obj, range) -> self
+ *    array.fill {|index| ... } -> self
+ *    array.fill(start) {|index| ... } -> self
+ *    array.fill(start, length) {|index| ... } -> self
+ *    array.fill(range) {|index| ... } -> self
+ *
+ *  Replaces specified elements in +self+ with specified objects; returns +self+.
+ *
+ *  With argument +obj+ and no block given, replaces all elements with that one object:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a # => ["a", "b", "c", "d"]
+ *    a.fill(:X) # => [:X, :X, :X, :X]
+ *
+ *  With arguments +obj+ and \Integer +start+, and no block given,
+ *  replaces elements based on the given start.
+ *
+ *  If +start+ is in range (<tt>0 <= start < array.size</tt>),
+ *  replaces all elements from offset +start+ through the end:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, 2) # => ["a", "b", :X, :X]
+ *
+ *  If +start+ is too large (<tt>start >= array.size</tt>), does nothing:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, 4) # => ["a", "b", "c", "d"]
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, 5) # => ["a", "b", "c", "d"]
+ *
+ *  If +start+ is negative, counts from the end (starting index is <tt>start + array.size</tt>):
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, -2) # => ["a", "b", :X, :X]
+ *
+ *  If +start+ is too small (less than and far from zero), replaces all elements:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, -6) # => [:X, :X, :X, :X]
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, -50) # => [:X, :X, :X, :X]
+ *
+ *  With arguments +obj+, \Integer +start+, and \Integer +length+, and no block given,
+ *  replaces elements based on the given +start+ and +length+.
+ *
+ *  If +start+ is in range, replaces +length+ elements beginning at offset +start+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, 1, 1) # => ["a", :X, "c", "d"]
+ *
+ *  If +start+ is negative, counts from the end:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, -2, 1) # => ["a", "b", :X, "d"]
+ *
+ *  If +start+ is large (<tt>start >= array.size</tt>), extends +self+ with +nil+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, 5, 0) # => ["a", "b", "c", "d", nil]
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, 5, 2) # => ["a", "b", "c", "d", nil, :X, :X]
+ *
+ *  If +length+ is zero or negative, replaces no elements:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, 1, 0) # => ["a", "b", "c", "d"]
+ *    a.fill(:X, 1, -1) # => ["a", "b", "c", "d"]
+ *
+ *  With arguments +obj+ and \Range +range+, and no block given,
+ *  replaces elements based on the given range.
+ *
+ *  If the range is positive and ascending (<tt>0 < range.begin <= range.end</tt>),
+ *  replaces elements from <tt>range.begin</tt> to <tt>range.end</tt>:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, (1..1)) # => ["a", :X, "c", "d"]
+ *
+ *  If <tt>range.first</tt> is negative, replaces no elements:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, (-1..1)) # => ["a", "b", "c", "d"]
+ *
+ *  If <tt>range.last</tt> is negative, counts from the end:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, (0..-2)) # => [:X, :X, :X, "d"]
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, (1..-2)) # => ["a", :X, :X, "d"]
+ *
+ *  If <tt>range.last</tt> and <tt>range.last</tt> are both negative,
+ *  both count from the end of the array:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, (-1..-1)) # => ["a", "b", "c", :X]
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(:X, (-2..-2)) # => ["a", "b", :X, "d"]
+ *
+ *  With no arguments and a block given, calls the block with each index;
+ *  replaces the corresponding element with the block's return value:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "new_3"]
+ *
+ *  With argument +start+ and a block given, calls the block with each index
+ *  from offset +start+ to the end; replaces the corresponding element
+ *  with the block's return value.
+ *
+ *  If start is in range (<tt>0 <= start < array.size</tt>),
+ *  replaces from offset +start+ to the end:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(1) { |index| "new_#{index}" } # => ["a", "new_1", "new_2", "new_3"]
+ *
+ *  If +start+ is too large(<tt>start >= array.size</tt>), does nothing:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(4) { |index| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(4) { |index| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ *  If +start+ is negative, counts from the end:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(-2) { |index| "new_#{index}" } # => ["a", "b", "new_2", "new_3"]
+ *
+ *  If start is too small (<tt>start <= -array.size</tt>, replaces all elements:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(-6) { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "new_3"]
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(-50) { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "new_3"]
+ *
+ *  With arguments +start+ and +length+, and a block given,
+ *  calls the block for each index specified by start length;
+ *  replaces the corresponding element with the block's return value.
+ *
+ *  If +start+ is in range, replaces +length+ elements beginning at offset +start+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(1, 1) { |index| "new_#{index}" } # => ["a", "new_1", "c", "d"]
+ *
+ *  If start is negative, counts from the end:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(-2, 1) { |index| "new_#{index}" } # => ["a", "b", "new_2", "d"]
+ *
+ *  If +start+ is large (<tt>start >= array.size</tt>), extends +self+ with +nil+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(5, 0) { |index| "new_#{index}" } # => ["a", "b", "c", "d", nil]
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(5, 2) { |index| "new_#{index}" } # => ["a", "b", "c", "d", nil, "new_5", "new_6"]
  *
- *  The first three forms set the selected elements of +self+ (which
- *  may be the entire array) to +obj+.
+ *  If +length+ is zero or less, replaces no elements:
  *
- *  A +start+ of +nil+ is equivalent to zero.
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(1, 0) { |index| "new_#{index}" } # => ["a", "b", "c", "d"]
+ *    a.fill(1, -1) { |index| "new_#{index}" } # => ["a", "b", "c", "d"]
  *
- *  A +length+ of +nil+ is equivalent to the length of the array.
+ *  With arguments +obj+ and +range+, and a block given,
+ *  calls the block with each index in the given range;
+ *  replaces the corresponding element with the block's return value.
  *
- *  The last three forms fill the array with the value of the given block,
- *  which is passed the absolute index of each element to be filled.
+ *  If the range is positive and ascending (<tt>range 0 < range.begin <= range.end</tt>,
+ *  replaces elements from <tt>range.begin</tt> to <tt>range.end</tt>:
  *
- *  Negative values of +start+ count from the end of the array, where +-1+ is
- *  the last element.
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(1..1) { |index| "new_#{index}" } # => ["a", "new_1", "c", "d"]
+ *
+ *  If +range.first+ is negative, does nothing:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(-1..1) { |index| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ *  If <tt>range.last</tt> is negative, counts from the end:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(0..-2) { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "d"]
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(1..-2) { |index| "new_#{index}" } # => ["a", "new_1", "new_2", "d"]
+ *
+ *  If <tt>range.first</tt> and <tt>range.last</tt> are both negative,
+ *  both count from the end:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(-1..-1) { |index| "new_#{index}" } # => ["a", "b", "c", "new_3"]
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.fill(-2..-2) { |index| "new_#{index}" } # => ["a", "b", "new_2", "d"]
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.fill("x")              #=> ["x", "x", "x", "x"]
- *     a.fill("z", 2, 2)        #=> ["x", "x", "z", "z"]
- *     a.fill("y", 0..1)        #=> ["y", "y", "z", "z"]
- *     a.fill { |i| i*i }       #=> [0, 1, 4, 9]
- *     a.fill(-2) { |i| i*i*i } #=> [0, 1, 8, 27]
  */
 
 static VALUE
 rb_ary_fill(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE item, arg1, arg2;
+    VALUE item = Qundef, arg1, arg2;
     long beg = 0, end = 0, len = 0;
-    int block_p = FALSE;
 
     if (rb_block_given_p()) {
-	block_p = TRUE;
-	rb_scan_args(argc, argv, "02", &arg1, &arg2);
-	argc += 1;		/* hackish */
+        rb_scan_args(argc, argv, "02", &arg1, &arg2);
+        argc += 1;		/* hackish */
     }
     else {
-	rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+        rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
     }
     switch (argc) {
       case 1:
-	beg = 0;
-	len = RARRAY_LEN(ary);
-	break;
+        beg = 0;
+        len = RARRAY_LEN(ary);
+        break;
       case 2:
-	if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
-	    break;
-	}
-	/* fall through */
+        if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+            break;
+        }
+        /* fall through */
       case 3:
-	beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
-	if (beg < 0) {
-	    beg = RARRAY_LEN(ary) + beg;
-	    if (beg < 0) beg = 0;
-	}
-	len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
-	break;
+        beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
+        if (beg < 0) {
+            beg = RARRAY_LEN(ary) + beg;
+            if (beg < 0) beg = 0;
+        }
+        len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+        break;
     }
     rb_ary_modify(ary);
     if (len < 0) {
         return ary;
     }
     if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
-	rb_raise(rb_eArgError, "argument too big");
+        rb_raise(rb_eArgError, "argument too big");
     }
     end = beg + len;
     if (RARRAY_LEN(ary) < end) {
-	if (end >= ARY_CAPA(ary)) {
-	    ary_resize_capa(ary, end);
-	}
-	ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
-	ARY_SET_LEN(ary, end);
+        if (end >= ARY_CAPA(ary)) {
+            ary_resize_capa(ary, end);
+        }
+        ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+        ARY_SET_LEN(ary, end);
     }
 
-    if (block_p) {
-	VALUE v;
-	long i;
+    if (UNDEF_P(item)) {
+        VALUE v;
+        long i;
 
-	for (i=beg; i<end; i++) {
-	    v = rb_yield(LONG2NUM(i));
-	    if (i>=RARRAY_LEN(ary)) break;
-	    ARY_SET(ary, i, v);
-	}
+        for (i=beg; i<end; i++) {
+            v = rb_yield(LONG2NUM(i));
+            if (i>=RARRAY_LEN(ary)) break;
+            ARY_SET(ary, i, v);
+        }
     }
     else {
-	ary_memfill(ary, beg, len, item);
+        ary_memfill(ary, beg, len, item);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary + other_ary   -> new_ary
- *
- *  Concatenation --- Returns a new array built by concatenating the
- *  two arrays together to produce a third array.
+ *    array + other_array -> new_array
  *
- *     [ 1, 2, 3 ] + [ 4, 5 ]    #=> [ 1, 2, 3, 4, 5 ]
- *     a = [ "a", "b", "c" ]
- *     c = a + [ "d", "e", "f" ]
- *     c                         #=> [ "a", "b", "c", "d", "e", "f" ]
- *     a                         #=> [ "a", "b", "c" ]
+ *  Returns a new \Array containing all elements of +array+
+ *  followed by all elements of +other_array+:
  *
- *  Note that
- *     x += y
- *  is the same as
- *     x = x + y
- *  This means that it produces a new array. As a consequence,
- *  repeated use of <code>+=</code> on arrays can be quite inefficient.
+ *    a = [0, 1] + [2, 3]
+ *    a # => [0, 1, 2, 3]
  *
- *  See also Array#concat.
+ *  Related: #concat.
  */
 
 VALUE
@@ -3632,52 +5093,75 @@ rb_ary_plus(VALUE x, VALUE y)
     len = xlen + ylen;
     z = rb_ary_new2(len);
 
-    ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR(x));
-    ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR(y));
+    ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR_TRANSIENT(x));
+    ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR_TRANSIENT(y));
     ARY_SET_LEN(z, len);
     return z;
 }
 
+static VALUE
+ary_append(VALUE x, VALUE y)
+{
+    long n = RARRAY_LEN(y);
+    if (n > 0) {
+        rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR_TRANSIENT(y), n);
+    }
+    RB_GC_GUARD(y);
+    return x;
+}
+
 /*
  *  call-seq:
- *     ary.concat(other_ary)   -> ary
+ *    array.concat(*other_arrays) -> self
  *
- *  Appends the elements of +other_ary+ to +self+.
+ *  Adds to +array+ all elements from each \Array in +other_arrays+; returns +self+:
  *
- *     [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
- *     a = [ 1, 2, 3 ]
- *     a.concat( [ 4, 5 ] )
- *     a                                 #=> [ 1, 2, 3, 4, 5 ]
- *
- *  See also Array#+.
+ *    a = [0, 1]
+ *    a.concat([2, 3], [4, 5]) # => [0, 1, 2, 3, 4, 5]
  */
 
-VALUE
-rb_ary_concat(VALUE x, VALUE y)
+static VALUE
+rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
 {
-    rb_ary_modify_check(x);
-    y = to_ary(y);
-    if (RARRAY_LEN(y) > 0) {
-	rb_ary_splice(x, RARRAY_LEN(x), 0, y);
+    rb_ary_modify_check(ary);
+
+    if (argc == 1) {
+        rb_ary_concat(ary, argv[0]);
     }
-    return x;
+    else if (argc > 1) {
+        int i;
+        VALUE args = rb_ary_hidden_new(argc);
+        for (i = 0; i < argc; i++) {
+            rb_ary_concat(args, argv[i]);
+        }
+        ary_append(ary, args);
+    }
+
+    ary_verify(ary);
+    return ary;
 }
 
+VALUE
+rb_ary_concat(VALUE x, VALUE y)
+{
+    return ary_append(x, to_ary(y));
+}
 
 /*
  *  call-seq:
- *     ary * int     -> new_ary
- *     ary * str     -> new_string
+ *    array * n -> new_array
+ *    array * string_separator -> new_string
  *
- *  Repetition --- With a String argument, equivalent to
- *  <code>ary.join(str)</code>.
+ *  When non-negative argument \Integer +n+ is given,
+ *  returns a new \Array built by concatenating the +n+ copies of +self+:
  *
- *  Otherwise, returns a new array built by concatenating the +int+ copies of
- *  +self+.
+ *    a = ['x', 'y']
+ *    a * 3 # => ["x", "y", "x", "y", "x", "y"]
  *
+ *  When \String argument +string_separator+ is given,
+ *  equivalent to <tt>array.join(string_separator)</tt>:
  *
- *     [ 1, 2, 3 ] * 3    #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
- *     [ 1, 2, 3 ] * ","  #=> "1,2,3"
+ *    [0, [0, 1], {foo: 0}] * ', ' # => "0, 0, 1, {:foo=>0}"
  *
  */
 
@@ -3690,61 +5174,54 @@ rb_ary_times(VALUE ary, VALUE times)
 
     tmp = rb_check_string_type(times);
     if (!NIL_P(tmp)) {
-	return rb_ary_join(ary, tmp);
+        return rb_ary_join(ary, tmp);
     }
 
     len = NUM2LONG(times);
     if (len == 0) {
-	ary2 = ary_new(rb_obj_class(ary), 0);
-	goto out;
+        ary2 = ary_new(rb_cArray, 0);
+        goto out;
     }
     if (len < 0) {
-	rb_raise(rb_eArgError, "negative argument");
+        rb_raise(rb_eArgError, "negative argument");
     }
     if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
-	rb_raise(rb_eArgError, "argument too big");
+        rb_raise(rb_eArgError, "argument too big");
     }
     len *= RARRAY_LEN(ary);
 
-    ary2 = ary_new(rb_obj_class(ary), len);
+    ary2 = ary_new(rb_cArray, len);
     ARY_SET_LEN(ary2, len);
 
-    ptr = RARRAY_CONST_PTR(ary);
+    ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
     t = RARRAY_LEN(ary);
     if (0 < t) {
-	ary_memcpy(ary2, 0, t, ptr);
-	while (t <= len/2) {
-	    ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
+        ary_memcpy(ary2, 0, t, ptr);
+        while (t <= len/2) {
+            ary_memcpy(ary2, t, t, RARRAY_CONST_PTR_TRANSIENT(ary2));
             t *= 2;
         }
         if (t < len) {
-	    ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
+            ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR_TRANSIENT(ary2));
         }
     }
   out:
-    OBJ_INFECT(ary2, ary);
-
     return ary2;
 }
 
 /*
  *  call-seq:
- *     ary.assoc(obj)   -> element_ary  or  nil
+ *    array.assoc(obj) -> found_array or nil
  *
- *  Searches through an array whose elements are also arrays comparing +obj+
- *  with the first element of each contained array using <code>obj.==</code>.
+ *  Returns the first element in +self+ that is an \Array
+ *  whose first element <tt>==</tt> +obj+:
  *
- *  Returns the first contained array that matches (that is, the first
- *  associated array), or +nil+ if no match is found.
+ *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ *    a.assoc(4) # => [4, 5, 6]
  *
- *  See also Array#rassoc
+ *  Returns +nil+ if no such element is found.
  *
- *     s1 = [ "colors", "red", "blue", "green" ]
- *     s2 = [ "letters", "a", "b", "c" ]
- *     s3 = "foo"
- *     a  = [ s1, s2, s3 ]
- *     a.assoc("letters")  #=> [ "letters", "a", "b", "c" ]
- *     a.assoc("foo")      #=> nil
+ *  Related: #rassoc.
  */
 
 VALUE
@@ -3754,30 +5231,27 @@ rb_ary_assoc(VALUE ary, VALUE key)
     VALUE v;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	v = rb_check_array_type(RARRAY_AREF(ary, i));
-	if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
-	    rb_equal(RARRAY_AREF(v, 0), key))
-	    return v;
+        v = rb_check_array_type(RARRAY_AREF(ary, i));
+        if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+            rb_equal(RARRAY_AREF(v, 0), key))
+            return v;
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *     ary.rassoc(obj) -> element_ary or nil
+ *    array.rassoc(obj) -> found_array or nil
  *
- *  Searches through the array whose elements are also arrays.
+ *  Returns the first element in +self+ that is an \Array
+ *  whose second element <tt>==</tt> +obj+:
  *
- *  Compares +obj+ with the second element of each contained array using
- *  <code>obj.==</code>.
+ *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ *    a.rassoc(4) # => [2, 4]
  *
- *  Returns the first contained array that matches +obj+.
+ *  Returns +nil+ if no such element is found.
  *
- *  See also Array#assoc.
- *
- *     a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
- *     a.rassoc("two")    #=> [2, "two"]
- *     a.rassoc("four")   #=> nil
+ *  Related: #assoc.
  */
 
 VALUE
@@ -3787,11 +5261,11 @@ rb_ary_rassoc(VALUE ary, VALUE value)
     VALUE v;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	v = RARRAY_AREF(ary, i);
-	if (RB_TYPE_P(v, T_ARRAY) &&
-	    RARRAY_LEN(v) > 1 &&
-	    rb_equal(RARRAY_AREF(v, 1), value))
-	    return v;
+        v = RARRAY_AREF(ary, i);
+        if (RB_TYPE_P(v, T_ARRAY) &&
+            RARRAY_LEN(v) > 1 &&
+            rb_equal(RARRAY_AREF(v, 1), value))
+            return v;
     }
     return Qnil;
 }
@@ -3804,43 +5278,48 @@ recursive_equal(VALUE ary1, VALUE ary2, int recur)
 
     if (recur) return Qtrue; /* Subtle! */
 
+    /* rb_equal() can evacuate ptrs */
     p1 = RARRAY_CONST_PTR(ary1);
     p2 = RARRAY_CONST_PTR(ary2);
     len1 = RARRAY_LEN(ary1);
 
     for (i = 0; i < len1; i++) {
-	if (*p1 != *p2) {
-	    if (rb_equal(*p1, *p2)) {
-		len1 = RARRAY_LEN(ary1);
-		if (len1 != RARRAY_LEN(ary2))
-		    return Qfalse;
-		if (len1 < i)
-		    return Qtrue;
-		p1 = RARRAY_CONST_PTR(ary1) + i;
-		p2 = RARRAY_CONST_PTR(ary2) + i;
-	    }
-	    else {
-		return Qfalse;
-	    }
-	}
-	p1++;
-	p2++;
+        if (*p1 != *p2) {
+            if (rb_equal(*p1, *p2)) {
+                len1 = RARRAY_LEN(ary1);
+                if (len1 != RARRAY_LEN(ary2))
+                    return Qfalse;
+                if (len1 < i)
+                    return Qtrue;
+                p1 = RARRAY_CONST_PTR(ary1) + i;
+                p2 = RARRAY_CONST_PTR(ary2) + i;
+            }
+            else {
+                return Qfalse;
+            }
+        }
+        p1++;
+        p2++;
     }
     return Qtrue;
 }
 
 /*
  *  call-seq:
- *     ary == other_ary   ->   bool
+ *    array == other_array -> true or false
+ *
+ *  Returns +true+ if both <tt>array.size == other_array.size</tt>
+ *  and for each index +i+ in +array+, <tt>array[i] == other_array[i]</tt>:
  *
- *  Equality --- Two arrays are equal if they contain the same number of
- *  elements and if each element is equal to (according to Object#==) the
- *  corresponding element in +other_ary+.
+ *    a0 = [:foo, 'bar', 2]
+ *    a1 = [:foo, 'bar', 2.0]
+ *    a1 == a0 # => true
+ *    [] == [] # => true
  *
- *     [ "a", "c" ]    == [ "a", "c", 7 ]     #=> false
- *     [ "a", "c", 7 ] == [ "a", "c", 7 ]     #=> true
- *     [ "a", "c", 7 ] == [ "a", "d", "f" ]   #=> false
+ *  Otherwise, returns +false+.
  *
+ *  This method is different from method Array#eql?,
+ *  which compares elements using <tt>Object#eql?</tt>.
  */
 
 static VALUE
@@ -3848,13 +5327,13 @@ rb_ary_equal(VALUE ary1, VALUE ary2)
 {
     if (ary1 == ary2) return Qtrue;
     if (!RB_TYPE_P(ary2, T_ARRAY)) {
-	if (!rb_respond_to(ary2, idTo_ary)) {
-	    return Qfalse;
-	}
-	return rb_equal(ary2, ary1);
+        if (!rb_respond_to(ary2, idTo_ary)) {
+            return Qfalse;
+        }
+        return rb_equal(ary2, ary1);
     }
     if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
-    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+    if (RARRAY_CONST_PTR_TRANSIENT(ary1) == RARRAY_CONST_PTR_TRANSIENT(ary2)) return Qtrue;
     return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
 }
 
@@ -3865,18 +5344,27 @@ recursive_eql(VALUE ary1, VALUE ary2, int recur)
 
     if (recur) return Qtrue; /* Subtle! */
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
-	    return Qfalse;
+        if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+            return Qfalse;
     }
     return Qtrue;
 }
 
 /*
  *  call-seq:
- *     ary.eql?(other)  -> true or false
+ *    array.eql? other_array -> true or false
  *
- *  Returns +true+ if +self+ and +other+ are the same object,
- *  or are both arrays with the same content (according to Object#eql?).
+ *  Returns +true+ if +self+ and +other_array+ are the same size,
+ *  and if, for each index +i+ in +self+, <tt>self[i].eql? other_array[i]</tt>:
+ *
+ *    a0 = [:foo, 'bar', 2]
+ *    a1 = [:foo, 'bar', 2]
+ *    a1.eql?(a0) # => true
+ *
+ *  Otherwise, returns +false+.
+ *
+ *  This method is different from method Array#==,
+ *  which compares using method <tt>Object#==</tt>.
  */
 
 static VALUE
@@ -3885,20 +5373,21 @@ rb_ary_eql(VALUE ary1, VALUE ary2)
     if (ary1 == ary2) return Qtrue;
     if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
     if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
-    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+    if (RARRAY_CONST_PTR_TRANSIENT(ary1) == RARRAY_CONST_PTR_TRANSIENT(ary2)) return Qtrue;
     return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
 }
 
 /*
  *  call-seq:
- *     ary.hash   -> fixnum
+ *    array.hash -> integer
+ *
+ *  Returns the integer hash value for +self+.
  *
- *  Compute a hash-code for this array.
+ *  Two arrays with the same content will have the same hash code (and will compare using eql?):
  *
- *  Two arrays with the same content will have the same hash code (and will
- *  compare using #eql?).
+ *    [0, 1, 2].hash == [0, 1, 2].hash # => true
+ *    [0, 1, 2].hash == [0, 1, 3].hash # => false
  *
- *  See also Object#hash.
  */
 
 static VALUE
@@ -3911,23 +5400,22 @@ rb_ary_hash(VALUE ary)
     h = rb_hash_start(RARRAY_LEN(ary));
     h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	n = rb_hash(RARRAY_AREF(ary, i));
-	h = rb_hash_uint(h, NUM2LONG(n));
+        n = rb_hash(RARRAY_AREF(ary, i));
+        h = rb_hash_uint(h, NUM2LONG(n));
     }
     h = rb_hash_end(h);
-    return LONG2FIX(h);
+    return ST2FIX(h);
 }
 
 /*
  *  call-seq:
- *     ary.include?(object)   -> true or false
+ *    array.include?(obj) -> true or false
  *
- *  Returns +true+ if the given +object+ is present in +self+ (that is, if any
- *  element <code>==</code> +object+), otherwise returns +false+.
+ *  Returns +true+ if for some index +i+ in +self+, <tt>obj == self[i]</tt>;
+ *  otherwise +false+:
  *
- *     a = [ "a", "b", "c" ]
- *     a.include?("b")   #=> true
- *     a.include?("z")   #=> false
+ *    [0, 1, 2].include?(2) # => true
+ *    [0, 1, 2].include?(3) # => false
  */
 
 VALUE
@@ -3937,18 +5425,28 @@ rb_ary_includes(VALUE ary, VALUE item)
     VALUE e;
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	e = RARRAY_AREF(ary, i);
-	switch (rb_equal_opt(e, item)) {
-	  case Qundef:
-	    if (rb_equal(e, item)) return Qtrue;
-	    break;
-	  case Qtrue:
-	    return Qtrue;
-	}
+        e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, item)) {
+            return Qtrue;
+        }
     }
     return Qfalse;
 }
 
+static VALUE
+rb_ary_includes_by_eql(VALUE ary, VALUE item)
+{
+    long i;
+    VALUE e;
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (rb_eql(item, e)) {
+            return Qtrue;
+        }
+    }
+    return Qfalse;
+}
 
 static VALUE
 recursive_cmp(VALUE ary1, VALUE ary2, int recur)
@@ -3958,45 +5456,46 @@ recursive_cmp(VALUE ary1, VALUE ary2, int recur)
     if (recur) return Qundef;	/* Subtle! */
     len = RARRAY_LEN(ary1);
     if (len > RARRAY_LEN(ary2)) {
-	len = RARRAY_LEN(ary2);
+        len = RARRAY_LEN(ary2);
     }
     for (i=0; i<len; i++) {
-	VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
-	VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
-	if (v != INT2FIX(0)) {
-	    return v;
-	}
+        VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
+        VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
+        if (v != INT2FIX(0)) {
+            return v;
+        }
     }
     return Qundef;
 }
 
 /*
  *  call-seq:
- *     ary <=> other_ary   ->  -1, 0, +1 or nil
+ *    array <=> other_array -> -1, 0, or 1
+ *
+ *  Returns -1, 0, or 1 as +self+ is less than, equal to, or greater than +other_array+.
+ *  For each index +i+ in +self+, evaluates <tt>result = self[i] <=> other_array[i]</tt>.
+ *
+ *  Returns -1 if any result is -1:
+ *
+ *    [0, 1, 2] <=> [0, 1, 3] # => -1
+ *
+ *  Returns 1 if any result is 1:
+ *
+ *    [0, 1, 2] <=> [0, 1, 1] # => 1
  *
- *  Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
- *  array is less than, equal to, or greater than +other_ary+.
+ *  When all results are zero:
  *
- *  Each object in each array is compared (using the <=> operator).
+ *  - Returns -1 if +array+ is smaller than +other_array+:
  *
- *  Arrays are compared in an "element-wise" manner; the first element of +ary+
- *  is compared with the first one of +other_ary+ using the <=> operator, then
- *  each of the second elements, etc...
- *  As soon as the result of any such comparison is non zero (i.e. the two
- *  corresponding elements are not equal), that result is returned for the
- *  whole array comparison.
+ *      [0, 1, 2] <=> [0, 1, 2, 3] # => -1
  *
- *  If all the elements are equal, then the result is based on a comparison of
- *  the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
- *  and only if, they have the same length and the value of each element is
- *  equal to the value of the corresponding element in the other array.
+ *  - Returns 1 if +array+ is larger than +other_array+:
  *
- *  +nil+ is returned if the +other_ary+ is not an array or if the comparison
- *  of two elements returned +nil+.
+ *      [0, 1, 2] <=> [0, 1] # => 1
  *
- *     [ "a", "a", "c" ]    <=> [ "a", "b", "c" ]   #=> -1
- *     [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ]            #=> +1
- *     [ 1, 2 ]             <=> [ 1, :two ]         #=> nil
+ *  - Returns 0 if +array+ and +other_array+ are the same size:
+ *
+ *      [0, 1, 2] <=> [0, 1, 2] # => 0
  *
  */
 
@@ -4010,7 +5509,7 @@ rb_ary_cmp(VALUE ary1, VALUE ary2)
     if (NIL_P(ary2)) return Qnil;
     if (ary1 == ary2) return INT2FIX(0);
     v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
-    if (v != Qundef) return v;
+    if (!UNDEF_P(v)) return v;
     len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
     if (len == 0) return INT2FIX(0);
     if (len > 0) return INT2FIX(1);
@@ -4023,18 +5522,17 @@ ary_add_hash(VALUE hash, VALUE ary)
     long i;
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	VALUE elt = RARRAY_AREF(ary, i);
-	if (rb_hash_lookup2(hash, elt, Qundef) == Qundef) {
-	    rb_hash_aset(hash, elt, elt);
-	}
+        VALUE elt = RARRAY_AREF(ary, i);
+        rb_hash_add_new_element(hash, elt, elt);
     }
     return hash;
 }
 
 static inline VALUE
-ary_tmp_hash_new(void)
+ary_tmp_hash_new(VALUE ary)
 {
-    VALUE hash = rb_hash_new();
+    long size = RARRAY_LEN(ary);
+    VALUE hash = rb_hash_new_with_size(size);
 
     RBASIC_CLEAR_CLASS(hash);
     return hash;
@@ -4043,7 +5541,7 @@ ary_tmp_hash_new(void)
 static VALUE
 ary_make_hash(VALUE ary)
 {
-    VALUE hash = ary_tmp_hash_new();
+    VALUE hash = ary_tmp_hash_new(ary);
     return ary_add_hash(hash, ary);
 }
 
@@ -4053,10 +5551,8 @@ ary_add_hash_by(VALUE hash, VALUE ary)
     long i;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
-	if (rb_hash_lookup2(hash, k, Qundef) == Qundef) {
-	    rb_hash_aset(hash, k, v);
-	}
+        VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+        rb_hash_add_new_element(hash, k, v);
     }
     return hash;
 }
@@ -4064,51 +5560,61 @@ ary_add_hash_by(VALUE hash, VALUE ary)
 static VALUE
 ary_make_hash_by(VALUE ary)
 {
-    VALUE hash = ary_tmp_hash_new();
+    VALUE hash = ary_tmp_hash_new(ary);
     return ary_add_hash_by(hash, ary);
 }
 
 static inline void
 ary_recycle_hash(VALUE hash)
 {
-    if (RHASH(hash)->ntbl) {
-	st_table *tbl = RHASH(hash)->ntbl;
-	RHASH(hash)->ntbl = 0;
-	st_free_table(tbl);
+    assert(RBASIC_CLASS(hash) == 0);
+    if (RHASH_ST_TABLE_P(hash)) {
+        st_table *tbl = RHASH_ST_TABLE(hash);
+        st_free_table(tbl);
+        RHASH_ST_CLEAR(hash);
     }
-    RB_GC_GUARD(hash);
 }
 
 /*
  *  call-seq:
- *     ary - other_ary    -> new_ary
- *
- *  Array Difference
+ *    array - other_array -> new_array
  *
- *  Returns a new array that is a copy of the original array, removing any
- *  items that also appear in +other_ary+. The order is preserved from the
- *  original array.
+ *  Returns a new \Array containing only those elements from +array+
+ *  that are not found in \Array +other_array+;
+ *  items are compared using <tt>eql?</tt>;
+ *  the order from +array+ is preserved:
  *
- *  It compares elements using their #hash and #eql? methods for efficiency.
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1] - [1] # => [0, 2, 3]
+ *    [0, 1, 2, 3] - [3, 0] # => [1, 2]
+ *    [0, 1, 2] - [4] # => [0, 1, 2]
  *
- *     [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ]  #=>  [ 3, 3, 5 ]
- *
- *  If you need set-like behavior, see the library class Set.
+ *  Related: Array#difference.
  */
 
-static VALUE
+VALUE
 rb_ary_diff(VALUE ary1, VALUE ary2)
 {
     VALUE ary3;
     VALUE hash;
     long i;
 
-    hash = ary_make_hash(to_ary(ary2));
+    ary2 = to_ary(ary2);
+    if (RARRAY_LEN(ary2) == 0) { return ary_make_shared_copy(ary1); }
     ary3 = rb_ary_new();
 
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN || RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            VALUE elt = rb_ary_elt(ary1, i);
+            if (rb_ary_includes_by_eql(ary2, elt)) continue;
+            rb_ary_push(ary3, elt);
+        }
+        return ary3;
+    }
+
+    hash = ary_make_hash(ary2);
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-	if (st_lookup(rb_hash_tbl_raw(hash), RARRAY_AREF(ary1, i), 0)) continue;
-	rb_ary_push(ary3, rb_ary_elt(ary1, i));
+        if (rb_hash_stlike_lookup(hash, RARRAY_AREF(ary1, i), NULL)) continue;
+        rb_ary_push(ary3, rb_ary_elt(ary1, i));
     }
     ary_recycle_hash(hash);
     return ary3;
@@ -4116,18 +5622,73 @@ rb_ary_diff(VALUE ary1, VALUE ary2)
 
 /*
  *  call-seq:
- *     ary & other_ary      -> new_ary
+ *    array.difference(*other_arrays) -> new_array
+ *
+ *  Returns a new \Array containing only those elements from +self+
+ *  that are not found in any of the Arrays +other_arrays+;
+ *  items are compared using <tt>eql?</tt>;  order from +self+ is preserved:
+ *
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1].difference([1]) # => [0, 2, 3]
+ *    [0, 1, 2, 3].difference([3, 0], [1, 3]) # => [2]
+ *    [0, 1, 2].difference([4]) # => [0, 1, 2]
+ *
+ *  Returns a copy of +self+ if no arguments given.
+ *
+ *  Related: Array#-.
+ */
+
+static VALUE
+rb_ary_difference_multi(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE ary_diff;
+    long i, length;
+    volatile VALUE t0;
+    bool *is_hash = ALLOCV_N(bool, t0, argc);
+    ary_diff = rb_ary_new();
+    length = RARRAY_LEN(ary);
+
+    for (i = 0; i < argc; i++) {
+        argv[i] = to_ary(argv[i]);
+        is_hash[i] = (length > SMALL_ARRAY_LEN && RARRAY_LEN(argv[i]) > SMALL_ARRAY_LEN);
+        if (is_hash[i]) argv[i] = ary_make_hash(argv[i]);
+    }
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        int j;
+        VALUE elt = rb_ary_elt(ary, i);
+        for (j = 0; j < argc; j++) {
+            if (is_hash[j]) {
+                if (rb_hash_stlike_lookup(argv[j], RARRAY_AREF(ary, i), NULL))
+                    break;
+            }
+            else {
+                if (rb_ary_includes_by_eql(argv[j], elt)) break;
+            }
+        }
+        if (j == argc) rb_ary_push(ary_diff, elt);
+    }
+
+    ALLOCV_END(t0);
+
+    return ary_diff;
+}
+
+
+/*
+ *  call-seq:
+ *    array & other_array -> new_array
+ *
+ *  Returns a new \Array containing each element found in both +array+ and \Array +other_array+;
+ *  duplicates are omitted; items are compared using <tt>eql?</tt>:
  *
- *  Set Intersection --- Returns a new array containing elements common to the
- *  two arrays, excluding any duplicates. The order is preserved from the
- *  original array.
+ *    [0, 1, 2, 3] & [1, 2] # => [1, 2]
+ *    [0, 1, 0, 1] & [0, 1] # => [0, 1]
  *
- *  It compares elements using their #hash and #eql? methods for efficiency.
+ *  Preserves order from +array+:
  *
- *     [ 1, 1, 3, 5 ] & [ 1, 2, 3 ]                 #=> [ 1, 3 ]
- *     [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ]   #=> [ 'a', 'b' ]
+ *    [0, 1, 2] & [3, 2, 1, 0] # => [0, 1, 2]
  *
- *  See also Array#uniq.
+ *  Related: Array#intersection.
  */
 
 
@@ -4135,28 +5696,70 @@ static VALUE
 rb_ary_and(VALUE ary1, VALUE ary2)
 {
     VALUE hash, ary3, v;
-    st_table *table;
     st_data_t vv;
     long i;
 
     ary2 = to_ary(ary2);
     ary3 = rb_ary_new();
-    if (RARRAY_LEN(ary2) == 0) return ary3;
+    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return ary3;
+
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            v = RARRAY_AREF(ary1, i);
+            if (!rb_ary_includes_by_eql(ary2, v)) continue;
+            if (rb_ary_includes_by_eql(ary3, v)) continue;
+            rb_ary_push(ary3, v);
+        }
+        return ary3;
+    }
+
     hash = ary_make_hash(ary2);
-    table = rb_hash_tbl_raw(hash);
 
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-	v = RARRAY_AREF(ary1, i);
-	vv = (st_data_t)v;
-	if (st_delete(table, &vv, 0)) {
-	    rb_ary_push(ary3, v);
-	}
+        v = RARRAY_AREF(ary1, i);
+        vv = (st_data_t)v;
+        if (rb_hash_stlike_delete(hash, &vv, 0)) {
+            rb_ary_push(ary3, v);
+        }
     }
     ary_recycle_hash(hash);
 
     return ary3;
 }
 
+/*
+ *  call-seq:
+ *    array.intersection(*other_arrays) -> new_array
+ *
+ *  Returns a new \Array containing each element found both in +self+
+ *  and in all of the given Arrays +other_arrays+;
+ *  duplicates are omitted; items are compared using <tt>eql?</tt>:
+ *
+ *    [0, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
+ *    [0, 0, 1, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
+ *
+ *  Preserves order from +self+:
+ *
+ *    [0, 1, 2].intersection([2, 1, 0]) # => [0, 1, 2]
+ *
+ *  Returns a copy of +self+ if no arguments given.
+ *
+ *  Related: Array#&.
+ */
+
+static VALUE
+rb_ary_intersection_multi(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result = rb_ary_dup(ary);
+    int i;
+
+    for (i = 0; i < argc; i++) {
+        result = rb_ary_and(result, argv[i]);
+    }
+
+    return result;
+}
+
 static int
 ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
 {
@@ -4165,40 +5768,535 @@ ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
     return ST_CONTINUE;
 }
 
+static void
+rb_ary_union(VALUE ary_union, VALUE ary)
+{
+    long i;
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        VALUE elt = rb_ary_elt(ary, i);
+        if (rb_ary_includes_by_eql(ary_union, elt)) continue;
+        rb_ary_push(ary_union, elt);
+    }
+}
+
+static void
+rb_ary_union_hash(VALUE hash, VALUE ary2)
+{
+    long i;
+    for (i = 0; i < RARRAY_LEN(ary2); i++) {
+        VALUE elt = RARRAY_AREF(ary2, i);
+        if (!rb_hash_stlike_update(hash, (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+            RB_OBJ_WRITTEN(hash, Qundef, elt);
+        }
+    }
+}
+
 /*
  *  call-seq:
- *     ary | other_ary     -> new_ary
- *
- *  Set Union --- Returns a new array by joining +ary+ with +other_ary+,
- *  excluding any duplicates and preserving the order from the original array.
+ *    array | other_array -> new_array
  *
- *  It compares elements using their #hash and #eql? methods for efficiency.
+ *  Returns the union of +array+ and \Array +other_array+;
+ *  duplicates are removed; order is preserved;
+ *  items are compared using <tt>eql?</tt>:
  *
- *     [ "a", "b", "c" ] | [ "c", "d", "a" ]    #=> [ "a", "b", "c", "d" ]
+ *    [0, 1] | [2, 3] # => [0, 1, 2, 3]
+ *    [0, 1, 1] | [2, 2, 3] # => [0, 1, 2, 3]
+ *    [0, 1, 2] | [3, 2, 1, 0] # => [0, 1, 2, 3]
  *
- *  See also Array#uniq.
+ *  Related: Array#union.
  */
 
 static VALUE
 rb_ary_or(VALUE ary1, VALUE ary2)
 {
     VALUE hash, ary3;
-    long i;
 
     ary2 = to_ary(ary2);
+    if (RARRAY_LEN(ary1) + RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        ary3 = rb_ary_new();
+        rb_ary_union(ary3, ary1);
+        rb_ary_union(ary3, ary2);
+        return ary3;
+    }
+
     hash = ary_make_hash(ary1);
+    rb_ary_union_hash(hash, ary2);
 
-    for (i=0; i<RARRAY_LEN(ary2); i++) {
-	VALUE elt = RARRAY_AREF(ary2, i);
-	if (!st_update(RHASH_TBL_RAW(hash), (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
-	    RB_OBJ_WRITTEN(hash, Qundef, elt);
-	}
-    }
     ary3 = rb_hash_values(hash);
     ary_recycle_hash(hash);
     return ary3;
 }
 
+/*
+ *  call-seq:
+ *    array.union(*other_arrays) -> new_array
+ *
+ *  Returns a new \Array that is the union of +self+ and all given Arrays +other_arrays+;
+ *  duplicates are removed;  order is preserved;  items are compared using <tt>eql?</tt>:
+ *
+ *    [0, 1, 2, 3].union([4, 5], [6, 7]) # => [0, 1, 2, 3, 4, 5, 6, 7]
+ *    [0, 1, 1].union([2, 1], [3, 1]) # => [0, 1, 2, 3]
+ *    [0, 1, 2, 3].union([3, 2], [1, 0]) # => [0, 1, 2, 3]
+ *
+ *  Returns a copy of +self+ if no arguments given.
+ *
+ *  Related: Array#|.
+ */
+
+static VALUE
+rb_ary_union_multi(int argc, VALUE *argv, VALUE ary)
+{
+    int i;
+    long sum;
+    VALUE hash, ary_union;
+
+    sum = RARRAY_LEN(ary);
+    for (i = 0; i < argc; i++) {
+        argv[i] = to_ary(argv[i]);
+        sum += RARRAY_LEN(argv[i]);
+    }
+
+    if (sum <= SMALL_ARRAY_LEN) {
+        ary_union = rb_ary_new();
+
+        rb_ary_union(ary_union, ary);
+        for (i = 0; i < argc; i++) rb_ary_union(ary_union, argv[i]);
+
+        return ary_union;
+    }
+
+    hash = ary_make_hash(ary);
+    for (i = 0; i < argc; i++) rb_ary_union_hash(hash, argv[i]);
+
+    ary_union = rb_hash_values(hash);
+    ary_recycle_hash(hash);
+    return ary_union;
+}
+
+/*
+ *  call-seq:
+ *     ary.intersect?(other_ary)   -> true or false
+ *
+ *  Returns +true+ if the array and +other_ary+ have at least one element in
+ *  common, otherwise returns +false+:
+ *
+ *     a = [ 1, 2, 3 ]
+ *     b = [ 3, 4, 5 ]
+ *     c = [ 5, 6, 7 ]
+ *     a.intersect?(b)   #=> true
+ *     a.intersect?(c)   #=> false
+ *
+ */
+
+static VALUE
+rb_ary_intersect_p(VALUE ary1, VALUE ary2)
+{
+    VALUE hash, v, result, shorter, longer;
+    st_data_t vv;
+    long i;
+
+    ary2 = to_ary(ary2);
+    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return Qfalse;
+
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            v = RARRAY_AREF(ary1, i);
+            if (rb_ary_includes_by_eql(ary2, v)) return Qtrue;
+        }
+        return Qfalse;
+    }
+
+    shorter = ary1;
+    longer = ary2;
+    if (RARRAY_LEN(ary1) > RARRAY_LEN(ary2)) {
+        longer = ary1;
+        shorter = ary2;
+    }
+
+    hash = ary_make_hash(shorter);
+    result = Qfalse;
+
+    for (i=0; i<RARRAY_LEN(longer); i++) {
+        v = RARRAY_AREF(longer, i);
+        vv = (st_data_t)v;
+        if (rb_hash_stlike_lookup(hash, vv, 0)) {
+            result = Qtrue;
+            break;
+        }
+    }
+    ary_recycle_hash(hash);
+
+    return result;
+}
+
+static VALUE
+ary_max_generic(VALUE ary, long i, VALUE vmax)
+{
+    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+    VALUE v;
+    for (; i < RARRAY_LEN(ary); ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (rb_cmpint(rb_funcallv(vmax, id_cmp, 1, &v), vmax, v) < 0) {
+            vmax = v;
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_fixnum(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(FIXNUM_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (FIXNUM_P(v)) {
+            if ((long)vmax < (long)v) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_float(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (RB_FLOAT_TYPE_P(v)) {
+            if (rb_float_cmp(vmax, v) < 0) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_string(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(STRING_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (STRING_P(v)) {
+            if (rb_str_cmp(vmax, v) < 0) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
+}
+
+/*
+ *  call-seq:
+ *    array.max -> element
+ *    array.max {|a, b| ... } -> element
+ *    array.max(n) -> new_array
+ *    array.max(n) {|a, b| ... } -> new_array
+ *
+ *  Returns one of the following:
+ *
+ *  - The maximum-valued element from +self+.
+ *  - A new \Array of maximum-valued elements selected from +self+.
+ *
+ *  When no block is given, each element in +self+ must respond to method <tt><=></tt>
+ *  with an \Integer.
+ *
+ *  With no argument and no block, returns the element in +self+
+ *  having the maximum value per method <tt><=></tt>:
+ *
+ *    [0, 1, 2].max # => 2
+ *
+ *  With an argument \Integer +n+ and no block, returns a new \Array with at most +n+ elements,
+ *  in descending order per method <tt><=></tt>:
+ *
+ *    [0, 1, 2, 3].max(3) # => [3, 2, 1]
+ *    [0, 1, 2, 3].max(6) # => [3, 2, 1, 0]
+ *
+ *  When a block is given, the block must return an \Integer.
+ *
+ *  With a block and no argument, calls the block <tt>self.size-1</tt> times to compare elements;
+ *  returns the element having the maximum value per the block:
+ *
+ *    ['0', '00', '000'].max {|a, b| a.size <=> b.size } # => "000"
+ *
+ *  With an argument +n+ and a block, returns a new \Array with at most +n+ elements,
+ *  in descending order per the block:
+ *
+ *    ['0', '00', '000'].max(2) {|a, b| a.size <=> b.size } # => ["000", "00"]
+ *
+ */
+static VALUE
+rb_ary_max(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result = Qundef, v;
+    VALUE num;
+    long i;
+
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+       return rb_nmin_run(ary, num, 0, 1, 1);
+
+    const long n = RARRAY_LEN(ary);
+    if (rb_block_given_p()) {
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+           v = RARRAY_AREF(ary, i);
+           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
+               result = v;
+           }
+        }
+    }
+    else if (n > 0) {
+        result = RARRAY_AREF(ary, 0);
+        if (n > 1) {
+            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+                return ary_max_opt_fixnum(ary, 1, result);
+            }
+            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+                return ary_max_opt_string(ary, 1, result);
+            }
+            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+                return ary_max_opt_float(ary, 1, result);
+            }
+            else {
+                return ary_max_generic(ary, 1, result);
+            }
+        }
+    }
+    if (UNDEF_P(result)) return Qnil;
+    return result;
+}
+
+static VALUE
+ary_min_generic(VALUE ary, long i, VALUE vmin)
+{
+    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+    VALUE v;
+    for (; i < RARRAY_LEN(ary); ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (rb_cmpint(rb_funcallv(vmin, id_cmp, 1, &v), vmin, v) > 0) {
+            vmin = v;
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_fixnum(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(FIXNUM_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (FIXNUM_P(a)) {
+            if ((long)vmin > (long)a) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_float(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (RB_FLOAT_TYPE_P(a)) {
+            if (rb_float_cmp(vmin, a) > 0) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_string(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(STRING_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (STRING_P(a)) {
+            if (rb_str_cmp(vmin, a) > 0) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
+/*
+ *  call-seq:
+ *    array.min -> element
+ *    array.min { |a, b| ... } -> element
+ *    array.min(n) -> new_array
+ *    array.min(n) { |a, b| ... } -> new_array
+ *
+ *  Returns one of the following:
+ *
+ *  - The minimum-valued element from +self+.
+ *  - A new \Array of minimum-valued elements selected from +self+.
+ *
+ *  When no block is given, each element in +self+ must respond to method <tt><=></tt>
+ *  with an \Integer.
+ *
+ *  With no argument and no block, returns the element in +self+
+ *  having the minimum value per method <tt><=></tt>:
+ *
+ *    [0, 1, 2].min # => 0
+ *
+ *  With \Integer argument +n+ and no block, returns a new \Array with at most +n+ elements,
+ *  in ascending order per method <tt><=></tt>:
+ *
+ *    [0, 1, 2, 3].min(3) # => [0, 1, 2]
+ *    [0, 1, 2, 3].min(6) # => [0, 1, 2, 3]
+ *
+ *  When a block is given, the block must return an Integer.
+ *
+ *  With a block and no argument, calls the block <tt>self.size-1</tt> times to compare elements;
+ *  returns the element having the minimum value per the block:
+ *
+ *    ['0', '00', '000'].min { |a, b| a.size <=> b.size } # => "0"
+ *
+ *  With an argument +n+ and a block, returns a new \Array with at most +n+ elements,
+ *  in ascending order per the block:
+ *
+ *    ['0', '00', '000'].min(2) {|a, b| a.size <=> b.size } # => ["0", "00"]
+ *
+ */
+static VALUE
+rb_ary_min(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result = Qundef, v;
+    VALUE num;
+    long i;
+
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+       return rb_nmin_run(ary, num, 0, 0, 1);
+
+    const long n = RARRAY_LEN(ary);
+    if (rb_block_given_p()) {
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+           v = RARRAY_AREF(ary, i);
+           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
+               result = v;
+           }
+        }
+    }
+    else if (n > 0) {
+        result = RARRAY_AREF(ary, 0);
+        if (n > 1) {
+            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+                return ary_min_opt_fixnum(ary, 1, result);
+            }
+            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+                return ary_min_opt_string(ary, 1, result);
+            }
+            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+                return ary_min_opt_float(ary, 1, result);
+            }
+            else {
+                return ary_min_generic(ary, 1, result);
+            }
+        }
+    }
+    if (UNDEF_P(result)) return Qnil;
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    array.minmax -> [min_val, max_val]
+ *    array.minmax {|a, b| ... } -> [min_val, max_val]
+ *
+ *  Returns a new 2-element \Array containing the minimum and maximum values
+ *  from +self+, either per method <tt><=></tt> or per a given block:.
+ *
+ *  When no block is given, each element in +self+ must respond to method <tt><=></tt>
+ *  with an \Integer;
+ *  returns a new 2-element \Array containing the minimum and maximum values
+ *  from +self+, per method <tt><=></tt>:
+ *
+ *    [0, 1, 2].minmax # => [0, 2]
+ *
+ *  When a block is given, the block must return an \Integer;
+ *  the block is called <tt>self.size-1</tt> times to compare elements;
+ *  returns a new 2-element \Array containing the minimum and maximum values
+ *  from +self+, per the block:
+ *
+ *    ['0', '00', '000'].minmax {|a, b| a.size <=> b.size } # => ["0", "000"]
+ *
+ */
+static VALUE
+rb_ary_minmax(VALUE ary)
+{
+    if (rb_block_given_p()) {
+        return rb_call_super(0, NULL);
+    }
+    return rb_assoc_new(rb_ary_min(0, 0, ary), rb_ary_max(0, 0, ary));
+}
+
 static int
 push_value(st_data_t key, st_data_t val, st_data_t ary)
 {
@@ -4208,31 +6306,33 @@ push_value(st_data_t key, st_data_t val, st_data_t ary)
 
 /*
  *  call-seq:
- *     ary.uniq!                -> ary or nil
- *     ary.uniq! { |item| ... } -> ary or nil
+ *    array.uniq! -> self or nil
+ *    array.uniq! {|element| ... } -> self or nil
  *
- *  Removes duplicate elements from +self+.
+ *  Removes duplicate elements from +self+, the first occurrence always being retained;
+ *  returns +self+ if any elements removed, +nil+ otherwise.
  *
- *  If a block is given, it will use the return value of the block for
- *  comparison.
+ *  With no block given, identifies and removes elements using method <tt>eql?</tt>
+ *  to compare.
  *
- *  It compares values using their #hash and #eql? methods for efficiency.
+ *  Returns +self+ if any elements removed:
  *
- *  +self+ is traversed in order, and the first occurrence is kept.
+ *    a = [0, 0, 1, 1, 2, 2]
+ *    a.uniq! # => [0, 1, 2]
  *
- *  Returns +nil+ if no changes are made (that is, no duplicates are found).
+ *  Returns +nil+ if no elements removed.
  *
- *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq!   # => ["a", "b", "c"]
+ *  With a block given, calls the block for each element;
+ *  identifies (using method <tt>eql?</tt>) and removes
+ *  elements for which the block returns duplicate values.
  *
- *     b = [ "a", "b", "c" ]
- *     b.uniq!   # => nil
+ *  Returns +self+ if any elements removed:
  *
- *     c = [["student","sam"], ["student","george"], ["teacher","matz"]]
- *     c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ *    a.uniq! {|element| element.size } # => ['a', 'aa', 'aaa']
  *
+ *  Returns +nil+ if no elements removed.
  */
-
 static VALUE
 rb_ary_uniq_bang(VALUE ary)
 {
@@ -4243,22 +6343,22 @@ rb_ary_uniq_bang(VALUE ary)
     if (RARRAY_LEN(ary) <= 1)
         return Qnil;
     if (rb_block_given_p())
-	hash = ary_make_hash_by(ary);
+        hash = ary_make_hash_by(ary);
     else
-	hash = ary_make_hash(ary);
+        hash = ary_make_hash(ary);
 
     hash_size = RHASH_SIZE(hash);
     if (RARRAY_LEN(ary) == hash_size) {
-	return Qnil;
+        return Qnil;
     }
     rb_ary_modify_check(ary);
     ARY_SET_LEN(ary, 0);
     if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
-	rb_ary_unshare(ary);
-	FL_SET_EMBED(ary);
+        rb_ary_unshare(ary);
+        FL_SET_EMBED(ary);
     }
     ary_resize_capa(ary, hash_size);
-    st_foreach(rb_hash_tbl_raw(hash), push_value, ary);
+    rb_hash_foreach(hash, push_value, ary);
     ary_recycle_hash(hash);
 
     return ary;
@@ -4266,22 +6366,24 @@ rb_ary_uniq_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.uniq                -> new_ary
- *     ary.uniq { |item| ... } -> new_ary
- *
- *  Returns a new array by removing duplicate values in +self+.
+ *    array.uniq -> new_array
+ *    array.uniq {|element| ... } -> new_array
  *
- *  If a block is given, it will use the return value of the block for comparison.
+ *  Returns a new \Array containing those elements from +self+ that are not duplicates,
+ *  the first occurrence always being retained.
  *
- *  It compares values using their #hash and #eql? methods for efficiency.
+ *  With no block given, identifies and omits duplicates using method <tt>eql?</tt>
+ *  to compare:
  *
- *  +self+ is traversed in order, and the first occurrence is kept.
+ *    a = [0, 0, 1, 1, 2, 2]
+ *    a.uniq # => [0, 1, 2]
  *
- *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq   # => ["a", "b", "c"]
+ *  With a block given, calls the block for each element;
+ *  identifies (using method <tt>eql?</tt>) and omits duplicate values,
+ *  that is, those elements for which the block returns the same value:
  *
- *     b = [["student","sam"], ["student","george"], ["teacher","matz"]]
- *     b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ *    a.uniq {|element| element.size } # => ["a", "aa", "aaa"]
  *
  */
 
@@ -4290,32 +6392,32 @@ rb_ary_uniq(VALUE ary)
 {
     VALUE hash, uniq;
 
-    if (RARRAY_LEN(ary) <= 1)
-        return rb_ary_dup(ary);
-    if (rb_block_given_p()) {
-	hash = ary_make_hash_by(ary);
-	uniq = rb_hash_values(hash);
+    if (RARRAY_LEN(ary) <= 1) {
+        hash = 0;
+        uniq = rb_ary_dup(ary);
+    }
+    else if (rb_block_given_p()) {
+        hash = ary_make_hash_by(ary);
+        uniq = rb_hash_values(hash);
     }
     else {
-	hash = ary_make_hash(ary);
-	uniq = rb_hash_values(hash);
+        hash = ary_make_hash(ary);
+        uniq = rb_hash_values(hash);
+    }
+    if (hash) {
+        ary_recycle_hash(hash);
     }
-    RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
-    ary_recycle_hash(hash);
 
     return uniq;
 }
 
 /*
  *  call-seq:
- *     ary.compact!    -> ary  or  nil
- *
- *  Removes +nil+ elements from the array.
+ *    array.compact! -> self or nil
  *
- *  Returns +nil+ if no changes were made, otherwise returns the array.
+ *  Removes all +nil+ elements from +self+.
  *
- *     [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
- *     [ "a", "b", "c" ].compact!           #=> nil
+ *  Returns +self+ if any elements removed, otherwise +nil+.
  */
 
 static VALUE
@@ -4325,16 +6427,16 @@ rb_ary_compact_bang(VALUE ary)
     long n;
 
     rb_ary_modify(ary);
-    p = t = (VALUE *)RARRAY_CONST_PTR(ary); /* WB: no new reference */
+    p = t = (VALUE *)RARRAY_CONST_PTR_TRANSIENT(ary); /* WB: no new reference */
     end = p + RARRAY_LEN(ary);
 
     while (t < end) {
-	if (NIL_P(*t)) t++;
-	else *p++ = *t++;
+        if (NIL_P(*t)) t++;
+        else *p++ = *t++;
     }
-    n = p - RARRAY_CONST_PTR(ary);
+    n = p - RARRAY_CONST_PTR_TRANSIENT(ary);
     if (RARRAY_LEN(ary) == n) {
-	return Qnil;
+        return Qnil;
     }
     ary_resize_smaller(ary, n);
 
@@ -4343,12 +6445,12 @@ rb_ary_compact_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.compact     -> new_ary
+ *    array.compact -> new_array
  *
- *  Returns a copy of +self+ with all +nil+ elements removed.
+ *  Returns a new \Array containing all non-+nil+ elements from +self+:
  *
- *     [ "a", nil, "b", nil, "c", nil ].compact
- *                       #=> [ "a", "b", "c" ]
+ *    a = [nil, 0, nil, 1, nil, 2, nil]
+ *    a.compact # => [0, 1, 2]
  */
 
 static VALUE
@@ -4361,23 +6463,29 @@ rb_ary_compact(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.count                   -> int
- *     ary.count(obj)              -> int
- *     ary.count { |item| block }  -> int
+ *    array.count -> an_integer
+ *    array.count(obj) -> an_integer
+ *    array.count {|element| ... } -> an_integer
  *
- *  Returns the number of elements.
+ *  Returns a count of specified elements.
  *
- *  If an argument is given, counts the number of elements which equal +obj+
- *  using <code>==</code>.
+ *  With no argument and no block, returns the count of all elements:
  *
- *  If a block is given, counts the number of elements for which the block
- *  returns a true value.
+ *    [0, 1, 2].count # => 3
+ *    [].count # => 0
  *
- *     ary = [1, 2, 4, 2]
- *     ary.count                  #=> 4
- *     ary.count(2)               #=> 2
- *     ary.count { |x| x%2 == 0 } #=> 3
+ *  With argument +obj+, returns the count of elements <tt>==</tt> to +obj+:
  *
+ *    [0, 1, 2, 0.0].count(0) # => 2
+ *    [0, 1, 2].count(3) # => 0
+ *
+ *  With no argument and a block given, calls the block with each element;
+ *  returns the count of elements for which the block returns a truthy value:
+ *
+ *    [0, 1, 2, 3].count {|element| element > 1} # => 2
+ *
+ *  With argument +obj+ and a block given, issues a warning, ignores the block,
+ *  and returns the count of elements <tt>==</tt> to +obj+.
  */
 
 static VALUE
@@ -4385,108 +6493,152 @@ rb_ary_count(int argc, VALUE *argv, VALUE ary)
 {
     long i, n = 0;
 
-    if (argc == 0) {
-	VALUE v;
+    if (rb_check_arity(argc, 0, 1) == 0) {
+        VALUE v;
 
-	if (!rb_block_given_p())
-	    return LONG2NUM(RARRAY_LEN(ary));
+        if (!rb_block_given_p())
+            return LONG2NUM(RARRAY_LEN(ary));
 
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    v = RARRAY_AREF(ary, i);
-	    if (RTEST(rb_yield(v))) n++;
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            v = RARRAY_AREF(ary, i);
+            if (RTEST(rb_yield(v))) n++;
+        }
     }
     else {
-	VALUE obj;
+        VALUE obj = argv[0];
 
-	rb_scan_args(argc, argv, "1", &obj);
-	if (rb_block_given_p()) {
-	    rb_warn("given block not used");
-	}
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
-	}
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
+        }
     }
 
     return LONG2NUM(n);
 }
 
 static VALUE
-flatten(VALUE ary, int level, int *modified)
+flatten(VALUE ary, int level)
 {
-    long i = 0;
-    VALUE stack, result, tmp, elt;
-    st_table *memo;
+    long i;
+    VALUE stack, result, tmp = 0, elt, vmemo;
+    st_table *memo = 0;
     st_data_t id;
 
-    stack = ary_new(0, ARY_DEFAULT_SIZE);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        elt = RARRAY_AREF(ary, i);
+        tmp = rb_check_array_type(elt);
+        if (!NIL_P(tmp)) {
+            break;
+        }
+    }
+    if (i == RARRAY_LEN(ary)) {
+        return ary;
+    }
+
     result = ary_new(0, RARRAY_LEN(ary));
-    memo = st_init_numtable();
-    st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
-    *modified = 0;
+    ary_memcpy(result, 0, i, RARRAY_CONST_PTR_TRANSIENT(ary));
+    ARY_SET_LEN(result, i);
+
+    stack = ary_new(0, ARY_DEFAULT_SIZE);
+    rb_ary_push(stack, ary);
+    rb_ary_push(stack, LONG2NUM(i + 1));
+
+    if (level < 0) {
+        vmemo = rb_hash_new();
+        RBASIC_CLEAR_CLASS(vmemo);
+        memo = st_init_numtable();
+        rb_hash_st_table_set(vmemo, memo);
+        st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
+        st_insert(memo, (st_data_t)tmp, (st_data_t)Qtrue);
+    }
+
+    ary = tmp;
+    i = 0;
 
     while (1) {
-	while (i < RARRAY_LEN(ary)) {
-	    elt = RARRAY_AREF(ary, i++);
-	    if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
-		rb_ary_push(result, elt);
-		continue;
-	    }
-	    tmp = rb_check_array_type(elt);
-	    if (RBASIC(result)->klass) {
-		rb_raise(rb_eRuntimeError, "flatten reentered");
-	    }
-	    if (NIL_P(tmp)) {
-		rb_ary_push(result, elt);
-	    }
-	    else {
-		*modified = 1;
-		id = (st_data_t)tmp;
-		if (st_lookup(memo, id, 0)) {
-		    st_free_table(memo);
-		    rb_raise(rb_eArgError, "tried to flatten recursive array");
-		}
-		st_insert(memo, id, (st_data_t)Qtrue);
-		rb_ary_push(stack, ary);
-		rb_ary_push(stack, LONG2NUM(i));
-		ary = tmp;
-		i = 0;
-	    }
-	}
-	if (RARRAY_LEN(stack) == 0) {
-	    break;
-	}
-	id = (st_data_t)ary;
-	st_delete(memo, &id, 0);
-	tmp = rb_ary_pop(stack);
-	i = NUM2LONG(tmp);
-	ary = rb_ary_pop(stack);
-    }
-
-    st_free_table(memo);
-
-    RBASIC_SET_CLASS(result, rb_class_of(ary));
+        while (i < RARRAY_LEN(ary)) {
+            elt = RARRAY_AREF(ary, i++);
+            if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
+                rb_ary_push(result, elt);
+                continue;
+            }
+            tmp = rb_check_array_type(elt);
+            if (RBASIC(result)->klass) {
+                if (memo) {
+                    RB_GC_GUARD(vmemo);
+                    st_clear(memo);
+                }
+                rb_raise(rb_eRuntimeError, "flatten reentered");
+            }
+            if (NIL_P(tmp)) {
+                rb_ary_push(result, elt);
+            }
+            else {
+                if (memo) {
+                    id = (st_data_t)tmp;
+                    if (st_is_member(memo, id)) {
+                        st_clear(memo);
+                        rb_raise(rb_eArgError, "tried to flatten recursive array");
+                    }
+                    st_insert(memo, id, (st_data_t)Qtrue);
+                }
+                rb_ary_push(stack, ary);
+                rb_ary_push(stack, LONG2NUM(i));
+                ary = tmp;
+                i = 0;
+            }
+        }
+        if (RARRAY_LEN(stack) == 0) {
+            break;
+        }
+        if (memo) {
+            id = (st_data_t)ary;
+            st_delete(memo, &id, 0);
+        }
+        tmp = rb_ary_pop(stack);
+        i = NUM2LONG(tmp);
+        ary = rb_ary_pop(stack);
+    }
+
+    if (memo) {
+        st_clear(memo);
+    }
+
+    RBASIC_SET_CLASS(result, rb_cArray);
     return result;
 }
 
 /*
  *  call-seq:
- *     ary.flatten!        -> ary or nil
- *     ary.flatten!(level) -> ary or nil
+ *    array.flatten! -> self or nil
+ *    array.flatten!(level) -> self or nil
+ *
+ *  Replaces each nested \Array in +self+ with the elements from that \Array;
+ *  returns +self+ if any changes, +nil+ otherwise.
  *
- *  Flattens +self+ in place.
+ *  With non-negative \Integer argument +level+, flattens recursively through +level+ levels:
  *
- *  Returns +nil+ if no modifications were made (i.e., the array contains no
- *  subarrays.)
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ *    a.flatten!(1) # => [0, 1, [2, 3], 4, 5]
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ *    a.flatten!(2) # => [0, 1, 2, 3, 4, 5]
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ *    a.flatten!(3) # => [0, 1, 2, 3, 4, 5]
+ *    [0, 1, 2].flatten!(1) # => nil
  *
- *  The optional +level+ argument determines the level of recursion to flatten.
+ *  With no argument, a +nil+ argument, or with negative argument +level+, flattens all levels:
+ *
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ *    a.flatten! # => [0, 1, 2, 3, 4, 5]
+ *    [0, 1, 2].flatten! # => nil
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ *    a.flatten!(-1) # => [0, 1, 2, 3, 4, 5]
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ *    a.flatten!(-2) # => [0, 1, 2, 3, 4, 5]
+ *    [0, 1, 2].flatten!(-1) # => nil
  *
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten!   #=> [1, 2, 3, 4, 5]
- *     a.flatten!   #=> nil
- *     a            #=> [1, 2, 3, 4, 5]
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten!(1) #=> [1, 2, 3, [4, 5]]
  */
 
 static VALUE
@@ -4495,15 +6647,14 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
     int mod = 0, level = -1;
     VALUE result, lv;
 
-    rb_scan_args(argc, argv, "01", &lv);
+    lv = (rb_check_arity(argc, 0, 1) ? argv[0] : Qnil);
     rb_ary_modify_check(ary);
     if (!NIL_P(lv)) level = NUM2INT(lv);
     if (level == 0) return Qnil;
 
-    result = flatten(ary, level, &mod);
-    if (mod == 0) {
-	ary_discard(result);
-	return Qnil;
+    result = flatten(ary, level);
+    if (result == ary) {
+        return Qnil;
     }
     if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
     rb_ary_replace(ary, result);
@@ -4514,246 +6665,212 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
 
 /*
  *  call-seq:
- *     ary.flatten -> new_ary
- *     ary.flatten(level) -> new_ary
- *
- *  Returns a new array that is a one-dimensional flattening of +self+
- *  (recursively).
- *
- *  That is, for every element that is an array, extract its elements into
- *  the new array.
+ *    array.flatten -> new_array
+ *    array.flatten(level) -> new_array
+ *
+ *  Returns a new \Array that is a recursive flattening of +self+:
+ *  - Each non-Array element is unchanged.
+ *  - Each \Array is replaced by its individual elements.
+ *
+ *  With non-negative \Integer argument +level+, flattens recursively through +level+ levels:
+ *
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ *    a.flatten(0) # => [0, [1, [2, 3], 4], 5]
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ *    a.flatten(1) # => [0, 1, [2, 3], 4, 5]
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ *    a.flatten(2) # => [0, 1, 2, 3, 4, 5]
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ *    a.flatten(3) # => [0, 1, 2, 3, 4, 5]
+ *
+ *  With no argument, a +nil+ argument, or with negative argument +level+, flattens all levels:
+ *
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ *    a.flatten # => [0, 1, 2, 3, 4, 5]
+ *    [0, 1, 2].flatten # => [0, 1, 2]
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ *    a.flatten(-1) # => [0, 1, 2, 3, 4, 5]
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ *    a.flatten(-2) # => [0, 1, 2, 3, 4, 5]
+ *    [0, 1, 2].flatten(-1) # => [0, 1, 2]
  *
- *  The optional +level+ argument determines the level of recursion to
- *  flatten.
- *
- *     s = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     t = [ 4, 5, 6, [7, 8] ]   #=> [4, 5, 6, [7, 8]]
- *     a = [ s, t, 9, 10 ]       #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten(1)              #=> [1, 2, 3, [4, 5]]
  */
 
 static VALUE
 rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
 {
-    int mod = 0, level = -1;
-    VALUE result, lv;
+    int level = -1;
+    VALUE result;
 
-    rb_scan_args(argc, argv, "01", &lv);
-    if (!NIL_P(lv)) level = NUM2INT(lv);
-    if (level == 0) return ary_make_shared_copy(ary);
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0])) {
+        level = NUM2INT(argv[0]);
+        if (level == 0) return ary_make_shared_copy(ary);
+    }
 
-    result = flatten(ary, level, &mod);
-    OBJ_INFECT(result, ary);
+    result = flatten(ary, level);
+    if (result == ary) {
+        result = ary_make_shared_copy(ary);
+    }
 
     return result;
 }
 
-#define OPTHASH_GIVEN_P(opts) \
-    (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
-static ID id_random;
-
 #define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
 
-/*
- *  call-seq:
- *     ary.shuffle!              -> ary
- *     ary.shuffle!(random: rng) -> ary
- *
- *  Shuffles elements in +self+ in place.
- *
- *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     a.shuffle!                #=> [2, 3, 1]
- *     a                         #=> [2, 3, 1]
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a.shuffle!(random: Random.new(1))  #=> [1, 3, 2]
- */
-
 static VALUE
-rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_shuffle_bang(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
 {
-    VALUE opts, randgen = rb_cRandom;
     long i, len;
 
-    if (OPTHASH_GIVEN_P(opts)) {
-	VALUE rnd;
-	ID keyword_ids[1];
-
-	keyword_ids[0] = id_random;
-	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
-	if (rnd != Qundef) {
-	    randgen = rnd;
-	}
-    }
-    rb_check_arity(argc, 0, 0);
     rb_ary_modify(ary);
     i = len = RARRAY_LEN(ary);
     RARRAY_PTR_USE(ary, ptr, {
-	while (i) {
-	    long j = RAND_UPTO(i);
-	    VALUE tmp;
-	    if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
-		rb_raise(rb_eRuntimeError, "modified during shuffle");
-	    }
-	    tmp = ptr[--i];
-	    ptr[i] = ptr[j];
-	    ptr[j] = tmp;
-	}
+        while (i) {
+            long j = RAND_UPTO(i);
+            VALUE tmp;
+            if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR_TRANSIENT(ary)) {
+                rb_raise(rb_eRuntimeError, "modified during shuffle");
+            }
+            tmp = ptr[--i];
+            ptr[i] = ptr[j];
+            ptr[j] = tmp;
+        }
     }); /* WB: no new reference */
     return ary;
 }
 
-
-/*
- *  call-seq:
- *     ary.shuffle              -> new_ary
- *     ary.shuffle(random: rng) -> new_ary
- *
- *  Returns a new array with elements of +self+ shuffled.
- *
- *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     a.shuffle                 #=> [2, 3, 1]
- *     a                         #=> [1, 2, 3]
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a.shuffle(random: Random.new(1))  #=> [1, 3, 2]
- */
-
 static VALUE
-rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
+rb_ary_shuffle(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
 {
     ary = rb_ary_dup(ary);
-    rb_ary_shuffle_bang(argc, argv, ary);
+    rb_ary_shuffle_bang(ec, ary, randgen);
     return ary;
 }
 
-
-/*
- *  call-seq:
- *     ary.sample                  -> obj
- *     ary.sample(random: rng)     -> obj
- *     ary.sample(n)               -> new_ary
- *     ary.sample(n, random: rng)  -> new_ary
- *
- *  Choose a random element or +n+ random elements from the array.
- *
- *  The elements are chosen by using random and unique indices into the array
- *  in order to ensure that an element doesn't repeat itself unless the array
- *  already contained duplicate elements.
- *
- *  If the array is empty the first form returns +nil+ and the second form
- *  returns an empty array.
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
- *     a.sample         #=> 7
- *     a.sample(4)      #=> [6, 4, 2, 5]
- */
-
-
 static VALUE
-rb_ary_sample(int argc, VALUE *argv, VALUE ary)
+ary_sample(rb_execution_context_t *ec, VALUE ary, VALUE randgen, VALUE nv, VALUE to_array)
 {
-    VALUE nv, result;
-    VALUE opts, randgen = rb_cRandom;
+    VALUE result;
     long n, len, i, j, k, idx[10];
     long rnds[numberof(idx)];
+    long memo_threshold;
 
-    if (OPTHASH_GIVEN_P(opts)) {
-	VALUE rnd;
-	ID keyword_ids[1];
-
-	keyword_ids[0] = id_random;
-	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
-	if (rnd != Qundef) {
-	    randgen = rnd;
-	}
-    }
     len = RARRAY_LEN(ary);
-    if (argc == 0) {
-	if (len < 2)
-	    i = 0;
-	else
-	    i = RAND_UPTO(len);
+    if (!to_array) {
+        if (len < 2)
+            i = 0;
+        else
+            i = RAND_UPTO(len);
 
-	return rb_ary_elt(ary, i);
+        return rb_ary_elt(ary, i);
     }
-    rb_scan_args(argc, argv, "1", &nv);
     n = NUM2LONG(nv);
     if (n < 0) rb_raise(rb_eArgError, "negative sample number");
     if (n > len) n = len;
     if (n <= numberof(idx)) {
-	for (i = 0; i < n; ++i) {
-	    rnds[i] = RAND_UPTO(len - i);
-	}
+        for (i = 0; i < n; ++i) {
+            rnds[i] = RAND_UPTO(len - i);
+        }
     }
     k = len;
     len = RARRAY_LEN(ary);
     if (len < k && n <= numberof(idx)) {
-	for (i = 0; i < n; ++i) {
-	    if (rnds[i] >= len) return rb_ary_new_capa(0);
-	}
+        for (i = 0; i < n; ++i) {
+            if (rnds[i] >= len) return rb_ary_new_capa(0);
+        }
     }
     if (n > len) n = len;
     switch (n) {
       case 0:
-	return rb_ary_new_capa(0);
+        return rb_ary_new_capa(0);
       case 1:
-	i = rnds[0];
-	return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
+        i = rnds[0];
+        return rb_ary_new_from_args(1, RARRAY_AREF(ary, i));
       case 2:
-	i = rnds[0];
-	j = rnds[1];
-	if (j >= i) j++;
-	return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
+        i = rnds[0];
+        j = rnds[1];
+        if (j >= i) j++;
+        return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
       case 3:
-	i = rnds[0];
-	j = rnds[1];
-	k = rnds[2];
-	{
-	    long l = j, g = i;
-	    if (j >= i) l = i, g = ++j;
-	    if (k >= l && (++k >= g)) ++k;
-	}
-	return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
+        i = rnds[0];
+        j = rnds[1];
+        k = rnds[2];
+        {
+            long l = j, g = i;
+            if (j >= i) l = i, g = ++j;
+            if (k >= l && (++k >= g)) ++k;
+        }
+        return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
     }
+    memo_threshold =
+        len < 2560 ? len / 128 :
+        len < 5120 ? len / 64 :
+        len < 10240 ? len / 32 :
+        len / 16;
     if (n <= numberof(idx)) {
-	long sorted[numberof(idx)];
-	sorted[0] = idx[0] = rnds[0];
-	for (i=1; i<n; i++) {
-	    k = rnds[i];
-	    for (j = 0; j < i; ++j) {
-		if (k < sorted[j]) break;
-		++k;
-	    }
-	    memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
-	    sorted[j] = idx[i] = k;
-	}
-	result = rb_ary_new_capa(n);
-	RARRAY_PTR_USE(result, ptr_result, {
-	    for (i=0; i<n; i++) {
-		ptr_result[i] = RARRAY_AREF(ary, idx[i]);
-	    }
-	});
+        long sorted[numberof(idx)];
+        sorted[0] = idx[0] = rnds[0];
+        for (i=1; i<n; i++) {
+            k = rnds[i];
+            for (j = 0; j < i; ++j) {
+                if (k < sorted[j]) break;
+                ++k;
+            }
+            memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+            sorted[j] = idx[i] = k;
+        }
+        result = rb_ary_new_capa(n);
+        RARRAY_PTR_USE_TRANSIENT(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                ptr_result[i] = RARRAY_AREF(ary, idx[i]);
+            }
+        });
+    }
+    else if (n <= memo_threshold / 2) {
+        long max_idx = 0;
+#undef RUBY_UNTYPED_DATA_WARNING
+#define RUBY_UNTYPED_DATA_WARNING 0
+        VALUE vmemo = Data_Wrap_Struct(0, 0, st_free_table, 0);
+        st_table *memo = st_init_numtable_with_size(n);
+        DATA_PTR(vmemo) = memo;
+        result = rb_ary_new_capa(n);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                long r = RAND_UPTO(len-i) + i;
+                ptr_result[i] = r;
+                if (r > max_idx) max_idx = r;
+            }
+            len = RARRAY_LEN(ary);
+            if (len <= max_idx) n = 0;
+            else if (n > len) n = len;
+            RARRAY_PTR_USE_TRANSIENT(ary, ptr_ary, {
+                for (i=0; i<n; i++) {
+                    long j2 = j = ptr_result[i];
+                    long i2 = i;
+                    st_data_t value;
+                    if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
+                    if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
+                    st_insert(memo, (st_data_t)j, (st_data_t)i2);
+                    ptr_result[i] = ptr_ary[j2];
+                }
+            });
+        });
+        DATA_PTR(vmemo) = 0;
+        st_free_table(memo);
     }
     else {
-	result = rb_ary_dup(ary);
-	RBASIC_CLEAR_CLASS(result);
-	RB_GC_GUARD(ary);
-	RARRAY_PTR_USE(result, ptr_result, {
-	    for (i=0; i<n; i++) {
-		j = RAND_UPTO(len-i) + i;
-		nv = ptr_result[j];
-		ptr_result[j] = ptr_result[i];
-		ptr_result[i] = nv;
-	    }
-	});
-	RBASIC_SET_CLASS_RAW(result, rb_cArray);
+        result = rb_ary_dup(ary);
+        RBASIC_CLEAR_CLASS(result);
+        RB_GC_GUARD(ary);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                j = RAND_UPTO(len-i) + i;
+                nv = ptr_result[j];
+                ptr_result[j] = ptr_result[i];
+                ptr_result[i] = nv;
+            }
+        });
+        RBASIC_SET_CLASS_RAW(result, rb_cArray);
     }
     ARY_SET_LEN(result, n);
 
@@ -4761,55 +6878,73 @@ rb_ary_sample(int argc, VALUE *argv, VALUE ary)
 }
 
 static VALUE
+ary_sample0(rb_execution_context_t *ec, VALUE ary)
+{
+    return ary_sample(ec, ary, rb_cRandom, Qfalse, Qfalse);
+}
+
+static VALUE
 rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
 {
     long mul;
     VALUE n = Qnil;
     if (args && (RARRAY_LEN(args) > 0)) {
-	n = RARRAY_AREF(args, 0);
+        n = RARRAY_AREF(args, 0);
     }
     if (RARRAY_LEN(self) == 0) return INT2FIX(0);
-    if (n == Qnil) return DBL2NUM(INFINITY);
+    if (NIL_P(n)) return DBL2NUM(HUGE_VAL);
     mul = NUM2LONG(n);
     if (mul <= 0) return INT2FIX(0);
     n = LONG2FIX(mul);
-    return rb_funcallv(rb_ary_length(self), '*', 1, &n);
+    return rb_fix_mul_fix(rb_ary_length(self), n);
 }
 
 /*
  *  call-seq:
- *     ary.cycle(n=nil) { |obj| block }  -> nil
- *     ary.cycle(n=nil)                  -> Enumerator
+ *    array.cycle {|element| ... } -> nil
+ *    array.cycle(count) {|element| ... } -> nil
+ *    array.cycle -> new_enumerator
+ *    array.cycle(count) -> new_enumerator
+ *
+ *  When called with positive \Integer argument +count+ and a block,
+ *  calls the block with each element, then does so again,
+ *  until it has done so +count+ times; returns +nil+:
+ *
+ *    output = []
+ *    [0, 1].cycle(2) {|element| output.push(element) } # => nil
+ *    output # => [0, 1, 0, 1]
  *
- *  Calls the given block for each element +n+ times or forever if +nil+ is
- *  given.
+ *  If +count+ is zero or negative, does not call the block:
  *
- *  Does nothing if a non-positive number is given or the array is empty.
+ *    [0, 1].cycle(0) {|element| fail 'Cannot happen' } # => nil
+ *    [0, 1].cycle(-1) {|element| fail 'Cannot happen' } # => nil
  *
- *  Returns +nil+ if the loop has finished without getting interrupted.
+ *  When a block is given, and argument is omitted or +nil+, cycles forever:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    # Prints 0 and 1 forever.
+ *    [0, 1].cycle {|element| puts element }
+ *    [0, 1].cycle(nil) {|element| puts element }
  *
- *     a = ["a", "b", "c"]
- *     a.cycle { |x| puts x }     # print, a, b, c, a, b, c,.. forever.
- *     a.cycle(2) { |x| puts x }  # print, a, b, c, a, b, c.
+ *  When no block is given, returns a new \Enumerator:
+ *
+ *    [0, 1].cycle(2) # => #<Enumerator: [0, 1]:cycle(2)>
+ *    [0, 1].cycle # => # => #<Enumerator: [0, 1]:cycle>
+ *    [0, 1].cycle.first(5) # => [0, 1, 0, 1, 0]
  *
  */
-
 static VALUE
 rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
 {
     long n, i;
-    VALUE nv = Qnil;
 
-    rb_scan_args(argc, argv, "01", &nv);
+    rb_check_arity(argc, 0, 1);
 
     RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
-    if (NIL_P(nv)) {
+    if (argc == 0 || NIL_P(argv[0])) {
         n = -1;
     }
     else {
-        n = NUM2LONG(nv);
+        n = NUM2LONG(argv[0]);
         if (n <= 0) return Qnil;
     }
 
@@ -4821,11 +6956,6 @@ rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
     return Qnil;
 }
 
-#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
-#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC_SET_CLASS_RAW(s, rb_cString))
-#define tmpary(n) rb_ary_tmp_new(n)
-#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
-
 /*
  * Build a ruby array of the corresponding values and yield it to the
  * associated block.
@@ -4835,11 +6965,9 @@ static int
 yield_indexed_values(const VALUE values, const long r, const long *const p)
 {
     const VALUE result = rb_ary_new2(r);
-    VALUE *const result_array = RARRAY_PTR(result);
-    const VALUE *const values_array = RARRAY_CONST_PTR(values);
     long i;
 
-    for (i = 0; i < r; i++) result_array[i] = values_array[p[i]];
+    for (i = 0; i < r; i++) ARY_SET(result, i, RARRAY_AREF(values, p[i]));
     ARY_SET_LEN(result, r);
     rb_yield(result);
     return !RBASIC(values)->klass;
@@ -4848,8 +6976,8 @@ yield_indexed_values(const VALUE values, const long r, const long *const p)
 /*
  * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
  *
- * When we have a complete permutation of array indexes, copy the values
- * at those indexes into a new array and yield that array.
+ * When we have a complete permutation of array indices, copy the values
+ * at those indices into a new array and yield that array.
  *
  * n: the size of the set
  * r: the number of elements in each permutation
@@ -4863,46 +6991,52 @@ permute0(const long n, const long r, long *const p, char *const used, const VALU
     long i = 0, index = 0;
 
     for (;;) {
-	const char *const unused = memchr(&used[i], 0, n-i);
-	if (!unused) {
-	    if (!index) break;
-	    i = p[--index];                /* pop index */
-	    used[i++] = 0;                 /* index unused */
-	}
-	else {
-	    i = unused - used;
-	    p[index] = i;
-	    used[i] = 1;                   /* mark index used */
-	    ++index;
-	    if (index < r-1) {             /* if not done yet */
-		p[index] = i = 0;
-		continue;
-	    }
-	    for (i = 0; i < n; ++i) {
-		if (used[i]) continue;
-		p[index] = i;
-		if (!yield_indexed_values(values, r, p)) {
-		    rb_raise(rb_eRuntimeError, "permute reentered");
-		}
-	    }
-	    i = p[--index];                /* pop index */
-	    used[i] = 0;                   /* index unused */
-	    p[index] = ++i;
-	}
+        const char *const unused = memchr(&used[i], 0, n-i);
+        if (!unused) {
+            if (!index) break;
+            i = p[--index];                /* pop index */
+            used[i++] = 0;                 /* index unused */
+        }
+        else {
+            i = unused - used;
+            p[index] = i;
+            used[i] = 1;                   /* mark index used */
+            ++index;
+            if (index < r-1) {             /* if not done yet */
+                p[index] = i = 0;
+                continue;
+            }
+            for (i = 0; i < n; ++i) {
+                if (used[i]) continue;
+                p[index] = i;
+                if (!yield_indexed_values(values, r, p)) {
+                    rb_raise(rb_eRuntimeError, "permute reentered");
+                }
+            }
+            i = p[--index];                /* pop index */
+            used[i] = 0;                   /* index unused */
+            p[index] = ++i;
+        }
     }
 }
 
 /*
  * Returns the product of from, from-1, ..., from - how_many + 1.
- * http://en.wikipedia.org/wiki/Pochhammer_symbol
+ * https://en.wikipedia.org/wiki/Pochhammer_symbol
  */
 static VALUE
 descending_factorial(long from, long how_many)
 {
-    VALUE cnt = LONG2FIX(how_many >= 0);
-    while (how_many-- > 0) {
-	VALUE v = LONG2FIX(from--);
-	cnt = rb_funcallv(cnt, '*', 1, &v);
+    VALUE cnt;
+    if (how_many > 0) {
+        cnt = LONG2FIX(from);
+        while (--how_many > 0) {
+            long v = --from;
+            cnt = rb_int_mul(cnt, LONG2FIX(v));
+        }
+    }
+    else {
+        cnt = LONG2FIX(how_many == 0);
     }
     return cnt;
 }
@@ -4910,16 +7044,23 @@ descending_factorial(long from, long how_many)
 static VALUE
 binomial_coefficient(long comb, long size)
 {
-    VALUE r, v;
+    VALUE r;
+    long i;
     if (comb > size-comb) {
-	comb = size-comb;
+        comb = size-comb;
     }
     if (comb < 0) {
-	return LONG2FIX(0);
+        return LONG2FIX(0);
     }
-    r = descending_factorial(size, comb);
-    v = descending_factorial(comb, comb);
-    return rb_funcallv(r, id_div, 1, &v);
+    else if (comb == 0) {
+        return LONG2FIX(1);
+    }
+    r = LONG2FIX(size);
+    for (i = 1; i < comb; ++i) {
+        r = rb_int_mul(r, LONG2FIX(size - i));
+        r = rb_int_idiv(r, LONG2FIX(i + 1));
+    }
+    return r;
 }
 
 static VALUE
@@ -4933,66 +7074,118 @@ rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
 
 /*
  *  call-seq:
- *     ary.permutation { |p| block }          -> ary
- *     ary.permutation                        -> Enumerator
- *     ary.permutation(n) { |p| block }       -> ary
- *     ary.permutation(n)                     -> Enumerator
+ *    array.permutation {|element| ... } -> self
+ *    array.permutation(n) {|element| ... } -> self
+ *    array.permutation -> new_enumerator
+ *    array.permutation(n) -> new_enumerator
+ *
+ *  When invoked with a block, yield all permutations of elements of +self+; returns +self+.
+ *  The order of permutations is indeterminate.
+ *
+ *  When a block and an in-range positive \Integer argument +n+ (<tt>0 < n <= self.size</tt>)
+ *  are given, calls the block with all +n+-tuple permutations of +self+.
+ *
+ *  Example:
+ *
+ *    a = [0, 1, 2]
+ *    a.permutation(2) {|permutation| p permutation }
+ *
+ *  Output:
+ *
+ *    [0, 1]
+ *    [0, 2]
+ *    [1, 0]
+ *    [1, 2]
+ *    [2, 0]
+ *    [2, 1]
+ *
+ *  Another example:
+ *
+ *    a = [0, 1, 2]
+ *    a.permutation(3) {|permutation| p permutation }
+ *
+ *  Output:
+ *
+ *    [0, 1, 2]
+ *    [0, 2, 1]
+ *    [1, 0, 2]
+ *    [1, 2, 0]
+ *    [2, 0, 1]
+ *    [2, 1, 0]
+ *
+ *  When +n+ is zero, calls the block once with a new empty \Array:
+ *
+ *    a = [0, 1, 2]
+ *    a.permutation(0) {|permutation| p permutation }
  *
- * When invoked with a block, yield all permutations of length +n+ of the
- * elements of the array, then return the array itself.
+ *  Output:
  *
- * If +n+ is not specified, yield all permutations of all elements.
+ *    []
  *
- * The implementation makes no guarantees about the order in which the
- * permutations are yielded.
+ *  When +n+ is out of range (negative or larger than <tt>self.size</tt>),
+ *  does not call the block:
  *
- * If no block is given, an Enumerator is returned instead.
+ *    a = [0, 1, 2]
+ *    a.permutation(-1) {|permutation| fail 'Cannot happen' }
+ *    a.permutation(4) {|permutation| fail 'Cannot happen' }
  *
- * Examples:
+ *  When a block given but no argument,
+ *  behaves the same as <tt>a.permutation(a.size)</tt>:
+ *
+ *    a = [0, 1, 2]
+ *    a.permutation {|permutation| p permutation }
+ *
+ *  Output:
+ *
+ *    [0, 1, 2]
+ *    [0, 2, 1]
+ *    [1, 0, 2]
+ *    [1, 2, 0]
+ *    [2, 0, 1]
+ *    [2, 1, 0]
+ *
+ *  Returns a new \Enumerator if no block given:
+ *
+ *    a = [0, 1, 2]
+ *    a.permutation # => #<Enumerator: [0, 1, 2]:permutation>
+ *    a.permutation(2) # => #<Enumerator: [0, 1, 2]:permutation(2)>
  *
- *   a = [1, 2, 3]
- *   a.permutation.to_a    #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- *   a.permutation(1).to_a #=> [[1],[2],[3]]
- *   a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
- *   a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- *   a.permutation(0).to_a #=> [[]] # one permutation of length 0
- *   a.permutation(4).to_a #=> []   # no permutations of length 4
  */
 
 static VALUE
 rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE num;
     long r, n, i;
 
     n = RARRAY_LEN(ary);                  /* Array length */
     RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size);   /* Return enumerator if no block */
-    rb_scan_args(argc, argv, "01", &num);
-    r = NIL_P(num) ? n : NUM2LONG(num);   /* Permutation size from argument */
+    r = n;
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0]))
+        r = NUM2LONG(argv[0]);            /* Permutation size from argument */
 
     if (r < 0 || n < r) {
-	/* no permutations: yield nothing */
+        /* no permutations: yield nothing */
     }
     else if (r == 0) { /* exactly one permutation: the zero-length array */
-	rb_yield(rb_ary_new2(0));
+        rb_yield(rb_ary_new2(0));
     }
     else if (r == 1) { /* this is a special, easy case */
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
     }
     else {             /* this is the general case */
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
-	char *used = (char*)(p + r);
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
+        char *used = (char*)(p + r);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
 
-	MEMZERO(used, char, n); /* initialize array */
+        MEMZERO(used, char, n); /* initialize array */
 
-	permute0(n, r, p, used, ary0); /* compute and yield permutations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+        permute0(n, r, p, used, ary0); /* compute and yield permutations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -5005,16 +7198,16 @@ combinate0(const long len, const long n, long *const stack, const VALUE values)
     MEMZERO(stack+1, long, n);
     stack[0] = -1;
     for (;;) {
-	for (lev++; lev < n; lev++) {
-	    stack[lev+1] = stack[lev]+1;
-	}
-	if (!yield_indexed_values(values, n, stack+1)) {
-	    rb_raise(rb_eRuntimeError, "combination reentered");
-	}
-	do {
-	    if (lev == 0) return;
-	    stack[lev--]++;
-	} while (stack[lev+1]+n == len+lev+1);
+        for (lev++; lev < n; lev++) {
+            stack[lev+1] = stack[lev]+1;
+        }
+        if (!yield_indexed_values(values, n, stack+1)) {
+            rb_raise(rb_eRuntimeError, "combination reentered");
+        }
+        do {
+            if (lev == 0) return;
+            stack[lev--]++;
+        } while (stack[lev+1]+n == len+lev+1);
     }
 }
 
@@ -5029,26 +7222,55 @@ rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
 
 /*
  *  call-seq:
- *     ary.combination(n) { |c| block }    -> ary
- *     ary.combination(n)                  -> Enumerator
+ *    array.combination(n) {|element| ... } -> self
+ *    array.combination(n) -> new_enumerator
+ *
+ *  Calls the block, if given, with combinations of elements of +self+;
+ *  returns +self+. The order of combinations is indeterminate.
+ *
+ *  When a block and an in-range positive \Integer argument +n+ (<tt>0 < n <= self.size</tt>)
+ *  are given, calls the block with all +n+-tuple combinations of +self+.
+ *
+ *  Example:
+ *
+ *    a = [0, 1, 2]
+ *    a.combination(2) {|combination| p combination }
+ *
+ *  Output:
  *
- * When invoked with a block, yields all combinations of length +n+ of elements
- * from the array and then returns the array itself.
+ *    [0, 1]
+ *    [0, 2]
+ *    [1, 2]
  *
- * The implementation makes no guarantees about the order in which the
- * combinations are yielded.
+ *  Another example:
  *
- * If no block is given, an Enumerator is returned instead.
+ *    a = [0, 1, 2]
+ *    a.combination(3) {|combination| p combination }
  *
- * Examples:
+ *  Output:
  *
- *     a = [1, 2, 3, 4]
- *     a.combination(1).to_a  #=> [[1],[2],[3],[4]]
- *     a.combination(2).to_a  #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
- *     a.combination(3).to_a  #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
- *     a.combination(4).to_a  #=> [[1,2,3,4]]
- *     a.combination(0).to_a  #=> [[]] # one combination of length 0
- *     a.combination(5).to_a  #=> []   # no combinations of length 5
+ *    [0, 1, 2]
+ *
+ *  When +n+ is zero, calls the block once with a new empty \Array:
+ *
+ *    a = [0, 1, 2]
+ *    a1 = a.combination(0) {|combination| p combination }
+ *
+ *  Output:
+ *
+ *    []
+ *
+ *  When +n+ is out of range (negative or larger than <tt>self.size</tt>),
+ *  does not call the block:
+ *
+ *    a = [0, 1, 2]
+ *    a.combination(-1) {|combination| fail 'Cannot happen' }
+ *    a.combination(4) {|combination| fail 'Cannot happen' }
+ *
+ *  Returns a new \Enumerator if no block given:
+ *
+ *    a = [0, 1, 2]
+ *    a.combination(2) # => #<Enumerator: [0, 1, 2]:combination(2)>
  *
  */
 
@@ -5061,25 +7283,25 @@ rb_ary_combination(VALUE ary, VALUE num)
     RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
     len = RARRAY_LEN(ary);
     if (n < 0 || len < n) {
-	/* yield nothing */
+        /* yield nothing */
     }
     else if (n == 0) {
-	rb_yield(rb_ary_new2(0));
+        rb_yield(rb_ary_new2(0));
     }
     else if (n == 1) {
-	for (i = 0; i < len; i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
     }
     else {
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	volatile VALUE t0;
-	long *stack = ALLOCV_N(long, t0, n+1);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        volatile VALUE t0;
+        long *stack = ALLOCV_N(long, t0, n+1);
 
-	RBASIC_CLEAR_CLASS(ary0);
-	combinate0(len, n, stack, ary0);
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+        RBASIC_CLEAR_CLASS(ary0);
+        combinate0(len, n, stack, ary0);
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -5088,8 +7310,8 @@ rb_ary_combination(VALUE ary, VALUE num)
  * Compute repeated permutations of +r+ elements of the set
  * <code>[0..n-1]</code>.
  *
- * When we have a complete repeated permutation of array indexes, copy the
- * values at those indexes into a new array and yield that array.
+ * When we have a complete repeated permutation of array indices, copy the
+ * values at those indices into a new array and yield that array.
  *
  * n: the size of the set
  * r: the number of elements in each permutation
@@ -5103,19 +7325,19 @@ rpermute0(const long n, const long r, long *const p, const VALUE values)
 
     p[index] = i;
     for (;;) {
-	if (++index < r-1) {
-	    p[index] = i = 0;
-	    continue;
-	}
-	for (i = 0; i < n; ++i) {
-	    p[index] = i;
-	    if (!yield_indexed_values(values, r, p)) {
-		rb_raise(rb_eRuntimeError, "repeated permute reentered");
-	    }
-	}
-	do {
-	    if (index <= 0) return;
-	} while ((i = ++p[--index]) >= n);
+        if (++index < r-1) {
+            p[index] = i = 0;
+            continue;
+        }
+        for (i = 0; i < n; ++i) {
+            p[index] = i;
+            if (!yield_indexed_values(values, r, p)) {
+                rb_raise(rb_eRuntimeError, "repeated permute reentered");
+            }
+        }
+        do {
+            if (index <= 0) return;
+        } while ((i = ++p[--index]) >= n);
     }
 }
 
@@ -5124,39 +7346,81 @@ rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
 {
     long n = RARRAY_LEN(ary);
     long k = NUM2LONG(RARRAY_AREF(args, 0));
-    VALUE v;
 
     if (k < 0) {
-	return LONG2FIX(0);
+        return LONG2FIX(0);
     }
-
-    v = LONG2NUM(k);
-    return rb_funcallv(LONG2NUM(n), id_power, 1, &v);
+    if (n <= 0) {
+        return LONG2FIX(!k);
+    }
+    return rb_int_positive_pow(n, (unsigned long)k);
 }
 
 /*
  *  call-seq:
- *     ary.repeated_permutation(n) { |p| block } -> ary
- *     ary.repeated_permutation(n)               -> Enumerator
+ *    array.repeated_permutation(n) {|permutation| ... } -> self
+ *    array.repeated_permutation(n) -> new_enumerator
+ *
+ *  Calls the block with each repeated permutation of length +n+ of the elements of +self+;
+ *  each permutation is an \Array;
+ *  returns +self+. The order of the permutations is indeterminate.
+ *
+ *  When a block and a positive \Integer argument +n+ are given, calls the block with each
+ *  +n+-tuple repeated permutation of the elements of +self+.
+ *  The number of permutations is <tt>self.size**n</tt>.
+ *
+ *  +n+ = 1:
+ *
+ *    a = [0, 1, 2]
+ *    a.repeated_permutation(1) {|permutation| p permutation }
+ *
+ *  Output:
+ *
+ *    [0]
+ *    [1]
+ *    [2]
+ *
+ *  +n+ = 2:
+ *
+ *    a.repeated_permutation(2) {|permutation| p permutation }
+ *
+ *  Output:
+ *
+ *    [0, 0]
+ *    [0, 1]
+ *    [0, 2]
+ *    [1, 0]
+ *    [1, 1]
+ *    [1, 2]
+ *    [2, 0]
+ *    [2, 1]
+ *    [2, 2]
+ *
+ *  If +n+ is zero, calls the block once with an empty \Array.
+ *
+ *  If +n+ is negative, does not call the block:
+ *
+ *    a.repeated_permutation(-1) {|permutation| fail 'Cannot happen' }
  *
- * When invoked with a block, yield all repeated permutations of length +n+ of
- * the elements of the array, then return the array itself.
+ *  Returns a new \Enumerator if no block given:
  *
- * The implementation makes no guarantees about the order in which the repeated
- * permutations are yielded.
+ *    a = [0, 1, 2]
+ *    a.repeated_permutation(2) # => #<Enumerator: [0, 1, 2]:permutation(2)>
  *
- * If no block is given, an Enumerator is returned instead.
+ *  Using Enumerators, it's convenient to show the permutations and counts
+ *  for some values of +n+:
  *
- * Examples:
+ *    e = a.repeated_permutation(0)
+ *    e.size # => 1
+ *    e.to_a # => [[]]
+ *    e = a.repeated_permutation(1)
+ *    e.size # => 3
+ *    e.to_a # => [[0], [1], [2]]
+ *    e = a.repeated_permutation(2)
+ *    e.size # => 9
+ *    e.to_a # => [[0, 0], [0, 1], [0, 2], [1, 0], [1, 1], [1, 2], [2, 0], [2, 1], [2, 2]]
  *
- *     a = [1, 2]
- *     a.repeated_permutation(1).to_a  #=> [[1], [2]]
- *     a.repeated_permutation(2).to_a  #=> [[1,1],[1,2],[2,1],[2,2]]
- *     a.repeated_permutation(3).to_a  #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
- *                                     #    [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
- *     a.repeated_permutation(0).to_a  #=> [[]] # one permutation of length 0
  */
-
 static VALUE
 rb_ary_repeated_permutation(VALUE ary, VALUE num)
 {
@@ -5167,25 +7431,25 @@ rb_ary_repeated_permutation(VALUE ary, VALUE num)
     r = NUM2LONG(num);                    /* Permutation size from argument */
 
     if (r < 0) {
-	/* no permutations: yield nothing */
+        /* no permutations: yield nothing */
     }
     else if (r == 0) { /* exactly one permutation: the zero-length array */
-	rb_yield(rb_ary_new2(0));
+        rb_yield(rb_ary_new2(0));
     }
     else if (r == 1) { /* this is a special, easy case */
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
     }
     else {             /* this is the general case */
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, r * sizeof(long));
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, r);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
 
-	rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+        rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -5197,19 +7461,19 @@ rcombinate0(const long n, const long r, long *const p, const long rest, const VA
 
     p[index] = i;
     for (;;) {
-	if (++index < r-1) {
-	    p[index] = i;
-	    continue;
-	}
-	for (; i < n; ++i) {
-	    p[index] = i;
-	    if (!yield_indexed_values(values, r, p)) {
-		rb_raise(rb_eRuntimeError, "repeated combination reentered");
-	    }
-	}
-	do {
-	    if (index <= 0) return;
-	} while ((i = ++p[--index]) >= n);
+        if (++index < r-1) {
+            p[index] = i;
+            continue;
+        }
+        for (; i < n; ++i) {
+            p[index] = i;
+            if (!yield_indexed_values(values, r, p)) {
+                rb_raise(rb_eRuntimeError, "repeated combination reentered");
+            }
+        }
+        do {
+            if (index <= 0) return;
+        } while ((i = ++p[--index]) >= n);
     }
 }
 
@@ -5219,35 +7483,71 @@ rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
     long n = RARRAY_LEN(ary);
     long k = NUM2LONG(RARRAY_AREF(args, 0));
     if (k == 0) {
-	return LONG2FIX(1);
+        return LONG2FIX(1);
     }
     return binomial_coefficient(k, n + k - 1);
 }
 
 /*
  *  call-seq:
- *     ary.repeated_combination(n) { |c| block } -> ary
- *     ary.repeated_combination(n)               -> Enumerator
+ *    array.repeated_combination(n) {|combination| ... } -> self
+ *    array.repeated_combination(n) -> new_enumerator
+ *
+ *  Calls the block with each repeated combination of length +n+ of the elements of +self+;
+ *  each combination is an \Array;
+ *  returns +self+. The order of the combinations is indeterminate.
+ *
+ *  When a block and a positive \Integer argument +n+ are given, calls the block with each
+ *  +n+-tuple repeated combination of the elements of +self+.
+ *  The number of combinations is <tt>(n+1)(n+2)/2</tt>.
+ *
+ *  +n+ = 1:
+ *
+ *    a = [0, 1, 2]
+ *    a.repeated_combination(1) {|combination| p combination }
+ *
+ *  Output:
+ *
+ *    [0]
+ *    [1]
+ *    [2]
+ *
+ *  +n+ = 2:
+ *
+ *    a.repeated_combination(2) {|combination| p combination }
+ *
+ *  Output:
  *
- * When invoked with a block, yields all repeated combinations of length +n+ of
- * elements from the array and then returns the array itself.
+ *    [0, 0]
+ *    [0, 1]
+ *    [0, 2]
+ *    [1, 1]
+ *    [1, 2]
+ *    [2, 2]
  *
- * The implementation makes no guarantees about the order in which the repeated
- * combinations are yielded.
+ *  If +n+ is zero, calls the block once with an empty \Array.
  *
- * If no block is given, an Enumerator is returned instead.
+ *  If +n+ is negative, does not call the block:
  *
- * Examples:
+ *    a.repeated_combination(-1) {|combination| fail 'Cannot happen' }
  *
- *   a = [1, 2, 3]
- *   a.repeated_combination(1).to_a  #=> [[1], [2], [3]]
- *   a.repeated_combination(2).to_a  #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
- *   a.repeated_combination(3).to_a  #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
- *                                   #    [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
- *   a.repeated_combination(4).to_a  #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
- *                                   #    [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
- *                                   #    [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
- *   a.repeated_combination(0).to_a  #=> [[]] # one combination of length 0
+ *  Returns a new \Enumerator if no block given:
+ *
+ *    a = [0, 1, 2]
+ *    a.repeated_combination(2) # => #<Enumerator: [0, 1, 2]:combination(2)>
+ *
+ *  Using Enumerators, it's convenient to show the combinations and counts
+ *  for some values of +n+:
+ *
+ *    e = a.repeated_combination(0)
+ *    e.size # => 1
+ *    e.to_a # => [[]]
+ *    e = a.repeated_combination(1)
+ *    e.size # => 3
+ *    e.to_a # => [[0], [1], [2]]
+ *    e = a.repeated_combination(2)
+ *    e.size # => 6
+ *    e.to_a # => [[0, 0], [0, 1], [0, 2], [1, 1], [1, 2], [2, 2]]
  *
  */
 
@@ -5260,67 +7560,105 @@ rb_ary_repeated_combination(VALUE ary, VALUE num)
     RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size);   /* Return enumerator if no block */
     len = RARRAY_LEN(ary);
     if (n < 0) {
-	/* yield nothing */
+        /* yield nothing */
     }
     else if (n == 0) {
-	rb_yield(rb_ary_new2(0));
+        rb_yield(rb_ary_new2(0));
     }
     else if (n == 1) {
-	for (i = 0; i < len; i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
     }
     else if (len == 0) {
-	/* yield nothing */
+        /* yield nothing */
     }
     else {
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, n);
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, n);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
 
-	rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+        rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.product(other_ary, ...)                -> new_ary
- *     ary.product(other_ary, ...) { |p| block }  -> ary
+ *    array.product(*other_arrays) -> new_array
+ *    array.product(*other_arrays) {|combination| ... } -> self
+ *
+ *  Computes and returns or yields all combinations of elements from all the Arrays,
+ *  including both +self+ and +other_arrays+:
+ *
+ *  - The number of combinations is the product of the sizes of all the arrays,
+ *    including both +self+ and +other_arrays+.
+ *  - The order of the returned combinations is indeterminate.
+ *
+ *  When no block is given, returns the combinations as an \Array of Arrays:
+ *
+ *    a = [0, 1, 2]
+ *    a1 = [3, 4]
+ *    a2 = [5, 6]
+ *    p = a.product(a1)
+ *    p.size # => 6 # a.size * a1.size
+ *    p # => [[0, 3], [0, 4], [1, 3], [1, 4], [2, 3], [2, 4]]
+ *    p = a.product(a1, a2)
+ *    p.size # => 12 # a.size * a1.size * a2.size
+ *    p # => [[0, 3, 5], [0, 3, 6], [0, 4, 5], [0, 4, 6], [1, 3, 5], [1, 3, 6], [1, 4, 5], [1, 4, 6], [2, 3, 5], [2, 3, 6], [2, 4, 5], [2, 4, 6]]
+ *
+ *  If any argument is an empty \Array, returns an empty \Array.
+ *
+ *  If no argument is given, returns an \Array of 1-element Arrays,
+ *  each containing an element of +self+:
+ *
+ *    a.product # => [[0], [1], [2]]
+ *
+ *  When a block is given, yields each combination as an \Array; returns +self+:
+ *
+ *    a.product(a1) {|combination| p combination }
+ *
+ *  Output:
  *
- *  Returns an array of all combinations of elements from all arrays.
+ *    [0, 3]
+ *    [0, 4]
+ *    [1, 3]
+ *    [1, 4]
+ *    [2, 3]
+ *    [2, 4]
  *
- *  The length of the returned array is the product of the length of +self+ and
- *  the argument arrays.
+ *  If any argument is an empty \Array, does not call the block:
  *
- *  If given a block, #product will yield all combinations and return +self+
- *  instead.
+ *    a.product(a1, a2, []) {|combination| fail 'Cannot happen' }
+ *
+ *  If no argument is given, yields each element of +self+ as a 1-element \Array:
+ *
+ *    a.product {|combination| p combination }
+ *
+ *  Output:
+ *
+ *    [0]
+ *    [1]
+ *    [2]
  *
- *     [1,2,3].product([4,5])     #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
- *     [1,2].product([1,2])       #=> [[1,1],[1,2],[2,1],[2,2]]
- *     [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
- *                                #     [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
- *     [1,2].product()            #=> [[1],[2]]
- *     [1,2].product([])          #=> []
  */
 
 static VALUE
 rb_ary_product(int argc, VALUE *argv, VALUE ary)
 {
     int n = argc+1;    /* How many arrays we're operating on */
-    volatile VALUE t0 = tmpary(n);
-    volatile VALUE t1 = tmpbuf(n, sizeof(int));
+    volatile VALUE t0 = rb_ary_hidden_new(n);
+    volatile VALUE t1 = Qundef;
     VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
-    int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
+    int *counters = ALLOCV_N(int, t1, n); /* The current position in each one */
     VALUE result = Qnil;      /* The array we'll be returning, when no block given */
     long i,j;
     long resultlen = 1;
 
     RBASIC_CLEAR_CLASS(t0);
-    RBASIC_CLEAR_CLASS(t1);
 
     /* initialize the arrays of arrays */
     ARY_SET_LEN(t0, n);
@@ -5333,81 +7671,84 @@ rb_ary_product(int argc, VALUE *argv, VALUE ary)
 
     /* Otherwise, allocate and fill in an array of results */
     if (rb_block_given_p()) {
-	/* Make defensive copies of arrays; exit if any is empty */
-	for (i = 0; i < n; i++) {
-	    if (RARRAY_LEN(arrays[i]) == 0) goto done;
-	    arrays[i] = ary_make_shared_copy(arrays[i]);
-	}
+        /* Make defensive copies of arrays; exit if any is empty */
+        for (i = 0; i < n; i++) {
+            if (RARRAY_LEN(arrays[i]) == 0) goto done;
+            arrays[i] = ary_make_shared_copy(arrays[i]);
+        }
     }
     else {
-	/* Compute the length of the result array; return [] if any is empty */
-	for (i = 0; i < n; i++) {
-	    long k = RARRAY_LEN(arrays[i]);
-	    if (k == 0) {
-		result = rb_ary_new2(0);
-		goto done;
-	    }
+        /* Compute the length of the result array; return [] if any is empty */
+        for (i = 0; i < n; i++) {
+            long k = RARRAY_LEN(arrays[i]);
+            if (k == 0) {
+                result = rb_ary_new2(0);
+                goto done;
+            }
             if (MUL_OVERFLOW_LONG_P(resultlen, k))
-		rb_raise(rb_eRangeError, "too big to product");
-	    resultlen *= k;
-	}
-	result = rb_ary_new2(resultlen);
+                rb_raise(rb_eRangeError, "too big to product");
+            resultlen *= k;
+        }
+        result = rb_ary_new2(resultlen);
     }
     for (;;) {
-	int m;
-	/* fill in one subarray */
-	VALUE subarray = rb_ary_new2(n);
-	for (j = 0; j < n; j++) {
-	    rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
-	}
-
-	/* put it on the result array */
-	if (NIL_P(result)) {
-	    FL_SET(t0, FL_USER5);
-	    rb_yield(subarray);
-	    if (! FL_TEST(t0, FL_USER5)) {
-		rb_raise(rb_eRuntimeError, "product reentered");
-	    }
-	    else {
-		FL_UNSET(t0, FL_USER5);
-	    }
-	}
-	else {
-	    rb_ary_push(result, subarray);
-	}
-
-	/*
-	 * Increment the last counter.  If it overflows, reset to 0
-	 * and increment the one before it.
-	 */
-	m = n-1;
-	counters[m]++;
-	while (counters[m] == RARRAY_LEN(arrays[m])) {
-	    counters[m] = 0;
-	    /* If the first counter overflows, we are done */
-	    if (--m < 0) goto done;
-	    counters[m]++;
-	}
+        int m;
+        /* fill in one subarray */
+        VALUE subarray = rb_ary_new2(n);
+        for (j = 0; j < n; j++) {
+            rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+        }
+
+        /* put it on the result array */
+        if (NIL_P(result)) {
+            FL_SET(t0, RARRAY_SHARED_ROOT_FLAG);
+            rb_yield(subarray);
+            if (!FL_TEST(t0, RARRAY_SHARED_ROOT_FLAG)) {
+                rb_raise(rb_eRuntimeError, "product reentered");
+            }
+            else {
+                FL_UNSET(t0, RARRAY_SHARED_ROOT_FLAG);
+            }
+        }
+        else {
+            rb_ary_push(result, subarray);
+        }
+
+        /*
+         * Increment the last counter.  If it overflows, reset to 0
+         * and increment the one before it.
+         */
+        m = n-1;
+        counters[m]++;
+        while (counters[m] == RARRAY_LEN(arrays[m])) {
+            counters[m] = 0;
+            /* If the first counter overflows, we are done */
+            if (--m < 0) goto done;
+            counters[m]++;
+        }
     }
+
 done:
-    tmpary_discard(t0);
-    tmpbuf_discard(t1);
+    ALLOCV_END(t1);
 
     return NIL_P(result) ? ary : result;
 }
 
 /*
  *  call-seq:
- *     ary.take(n)               -> new_ary
+ *    array.take(n) -> new_array
  *
- *  Returns first +n+ elements from the array.
+ *  Returns a new \Array containing the first +n+ element of +self+,
+ *  where +n+ is a non-negative \Integer;
+ *  does not modify +self+.
  *
- *  If a negative number is given, raises an ArgumentError.
+ *  Examples:
  *
- *  See also Array#drop
- *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.take(3)             #=> [1, 2, 3]
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.take(1) # => [0]
+ *    a.take(2) # => [0, 1]
+ *    a.take(50) # => [0, 1, 2, 3, 4, 5]
+ *    a # => [0, 1, 2, 3, 4, 5]
  *
  */
 
@@ -5416,25 +7757,31 @@ rb_ary_take(VALUE obj, VALUE n)
 {
     long len = NUM2LONG(n);
     if (len < 0) {
-	rb_raise(rb_eArgError, "attempt to take negative size");
+        rb_raise(rb_eArgError, "attempt to take negative size");
     }
     return rb_ary_subseq(obj, 0, len);
 }
 
 /*
  *  call-seq:
- *     ary.take_while { |arr| block }  -> new_ary
- *     ary.take_while                  -> Enumerator
+ *    array.take_while {|element| ... } -> new_array
+ *    array.take_while -> new_enumerator
+ *
+ *  Returns a new \Array containing zero or more leading elements of +self+;
+ *  does not modify +self+.
  *
- *  Passes elements to the block until the block returns +nil+ or +false+, then
- *  stops iterating and returns an array of all prior elements.
+ *  With a block given, calls the block with each successive element of +self+;
+ *  stops if the block returns +false+ or +nil+;
+ *  returns a new \Array containing those elements for which the block returned a truthy value:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.take_while {|element| element < 3 } # => [0, 1, 2]
+ *    a.take_while {|element| true } # => [0, 1, 2, 3, 4, 5]
+ *    a # => [0, 1, 2, 3, 4, 5]
  *
- *  See also Array#drop_while
+ *  With no block given, returns a new \Enumerator:
  *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.take_while { |i| i < 3 }  #=> [1, 2]
+ *    [0, 1].take_while # => #<Enumerator: [0, 1]:take_while>
  *
  */
 
@@ -5445,24 +7792,25 @@ rb_ary_take_while(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
     }
     return rb_ary_take(ary, LONG2FIX(i));
 }
 
 /*
  *  call-seq:
- *     ary.drop(n)               -> new_ary
- *
- *  Drops first +n+ elements from +ary+ and returns the rest of the elements in
- *  an array.
+ *    array.drop(n) -> new_array
  *
- *  If a negative number is given, raises an ArgumentError.
+ *  Returns a new \Array containing all but the first +n+ element of +self+,
+ *  where +n+ is a non-negative \Integer;
+ *  does not modify +self+.
  *
- *  See also Array#take
+ *  Examples:
  *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.drop(3)             #=> [4, 5, 0]
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.drop(0) # => [0, 1, 2, 3, 4, 5]
+ *    a.drop(1) # => [1, 2, 3, 4, 5]
+ *    a.drop(2) # => [2, 3, 4, 5]
  *
  */
 
@@ -5472,29 +7820,32 @@ rb_ary_drop(VALUE ary, VALUE n)
     VALUE result;
     long pos = NUM2LONG(n);
     if (pos < 0) {
-	rb_raise(rb_eArgError, "attempt to drop negative size");
+        rb_raise(rb_eArgError, "attempt to drop negative size");
     }
 
     result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
-    if (result == Qnil) result = rb_ary_new();
+    if (NIL_P(result)) result = rb_ary_new();
     return result;
 }
 
 /*
  *  call-seq:
- *     ary.drop_while { |arr| block }   -> new_ary
- *     ary.drop_while                  -> Enumerator
+ *    array.drop_while {|element| ... } -> new_array
+ *    array.drop_while -> new_enumerator
+
+ *  Returns a new \Array containing zero or more trailing elements of +self+;
+ *  does not modify +self+.
  *
- *  Drops elements up to, but not including, the first element for which the
- *  block returns +nil+ or +false+ and returns an array containing the
- *  remaining elements.
+ *  With a block given, calls the block with each successive element of +self+;
+ *  stops if the block returns +false+ or +nil+;
+ *  returns a new \Array _omitting_ those elements for which the block returned a truthy value:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.drop_while {|element| element < 3 } # => [3, 4, 5]
  *
- *  See also Array#take_while
+ *  With no block given, returns a new \Enumerator:
  *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.drop_while {|i| i < 3 }   #=> [3, 4, 5, 0]
+ *    [0, 1].drop_while # => # => #<Enumerator: [0, 1]:drop_while>
  *
  */
 
@@ -5505,85 +7856,588 @@ rb_ary_drop_while(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
     }
     return rb_ary_drop(ary, LONG2FIX(i));
 }
 
 /*
  *  call-seq:
- *     ary.any? [{ |obj| block }]   -> true or false
+ *    array.any? -> true or false
+ *    array.any? {|element| ... } -> true or false
+ *    array.any?(obj) -> true or false
+ *
+ *  Returns +true+ if any element of +self+ meets a given criterion.
+ *
+ *  With no block given and no argument, returns +true+ if +self+ has any truthy element,
+ *  +false+ otherwise:
+ *
+ *    [nil, 0, false].any? # => true
+ *    [nil, false].any? # => false
+ *    [].any? # => false
+ *
+ *  With a block given and no argument, calls the block with each element in +self+;
+ *  returns +true+ if the block returns any truthy value, +false+ otherwise:
+ *
+ *    [0, 1, 2].any? {|element| element > 1 } # => true
+ *    [0, 1, 2].any? {|element| element > 2 } # => false
+ *
+ *  If argument +obj+ is given, returns +true+ if +obj+.<tt>===</tt> any element,
+ *  +false+ otherwise:
  *
- *  See also Enumerable#any?
+ *    ['food', 'drink'].any?(/foo/) # => true
+ *    ['food', 'drink'].any?(/bar/) # => false
+ *    [].any?(/foo/) # => false
+ *    [0, 1, 2].any?(1) # => true
+ *    [0, 1, 2].any?(3) # => false
+ *
+ *  Related: Enumerable#any?
  */
 
 static VALUE
-rb_ary_any_p(VALUE ary)
+rb_ary_any_p(int argc, VALUE *argv, VALUE ary)
 {
     long i, len = RARRAY_LEN(ary);
-    const VALUE *ptr = RARRAY_CONST_PTR(ary);
 
+    rb_check_arity(argc, 0, 1);
     if (!len) return Qfalse;
-    if (!rb_block_given_p()) {
-	for (i = 0; i < len; ++i) if (RTEST(ptr[i])) return Qtrue;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qtrue;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) return Qtrue;
+        }
     }
     else {
-	for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
-	}
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
+        }
     }
     return Qfalse;
 }
 
 /*
- *  Arrays are ordered, integer-indexed collections of any object.
+ *  call-seq:
+ *    array.all? -> true or false
+ *    array.all? {|element| ... } -> true or false
+ *    array.all?(obj) -> true or false
+ *
+ *  Returns +true+ if all elements of +self+ meet a given criterion.
+ *
+ *  With no block given and no argument, returns +true+ if +self+ contains only truthy elements,
+ *  +false+ otherwise:
+ *
+ *    [0, 1, :foo].all? # => true
+ *    [0, nil, 2].all? # => false
+ *    [].all? # => true
+ *
+ *  With a block given and no argument, calls the block with each element in +self+;
+ *  returns +true+ if the block returns only truthy values, +false+ otherwise:
+ *
+ *    [0, 1, 2].all? { |element| element < 3 } # => true
+ *    [0, 1, 2].all? { |element| element < 2 } # => false
+ *
+ *  If argument +obj+ is given, returns +true+ if <tt>obj.===</tt> every element, +false+ otherwise:
+ *
+ *    ['food', 'fool', 'foot'].all?(/foo/) # => true
+ *    ['food', 'drink'].all?(/bar/) # => false
+ *    [].all?(/foo/) # => true
+ *    [0, 0, 0].all?(0) # => true
+ *    [0, 1, 2].all?(1) # => false
+ *
+ *  Related: Enumerable#all?
+ */
+
+static VALUE
+rb_ary_all_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qtrue;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (!RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (!RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    return Qtrue;
+}
+
+/*
+ *  call-seq:
+ *    array.none? -> true or false
+ *    array.none? {|element| ... } -> true or false
+ *    array.none?(obj) -> true or false
+ *
+ *  Returns +true+ if no element of +self+ meet a given criterion.
+ *
+ *  With no block given and no argument, returns +true+ if +self+ has no truthy elements,
+ *  +false+ otherwise:
+ *
+ *    [nil, false].none? # => true
+ *    [nil, 0, false].none? # => false
+ *    [].none? # => true
+ *
+ *  With a block given and no argument, calls the block with each element in +self+;
+ *  returns +true+ if the block returns no truthy value, +false+ otherwise:
+ *
+ *    [0, 1, 2].none? {|element| element > 3 } # => true
+ *    [0, 1, 2].none? {|element| element > 1 } # => false
+ *
+ *  If argument +obj+ is given, returns +true+ if <tt>obj.===</tt> no element, +false+ otherwise:
+ *
+ *    ['food', 'drink'].none?(/bar/) # => true
+ *    ['food', 'drink'].none?(/foo/) # => false
+ *    [].none?(/foo/) # => true
+ *    [0, 1, 2].none?(3) # => true
+ *    [0, 1, 2].none?(1) # => false
+ *
+ *  Related: Enumerable#none?
+ */
+
+static VALUE
+rb_ary_none_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qtrue;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    return Qtrue;
+}
+
+/*
+ *  call-seq:
+ *    array.one? -> true or false
+ *    array.one? {|element| ... } -> true or false
+ *    array.one?(obj) -> true or false
+ *
+ *  Returns +true+ if exactly one element of +self+ meets a given criterion.
+ *
+ *  With no block given and no argument, returns +true+ if +self+ has exactly one truthy element,
+ *  +false+ otherwise:
+ *
+ *    [nil, 0].one? # => true
+ *    [0, 0].one? # => false
+ *    [nil, nil].one? # => false
+ *    [].one? # => false
+ *
+ *  With a block given and no argument, calls the block with each element in +self+;
+ *  returns +true+ if the block a truthy value for exactly one element, +false+ otherwise:
+ *
+ *    [0, 1, 2].one? {|element| element > 0 } # => false
+ *    [0, 1, 2].one? {|element| element > 1 } # => true
+ *    [0, 1, 2].one? {|element| element > 2 } # => false
+ *
+ *  If argument +obj+ is given, returns +true+ if <tt>obj.===</tt> exactly one element,
+ *  +false+ otherwise:
+ *
+ *    [0, 1, 2].one?(0) # => true
+ *    [0, 0, 1].one?(0) # => false
+ *    [1, 1, 2].one?(0) # => false
+ *    ['food', 'drink'].one?(/bar/) # => false
+ *    ['food', 'drink'].one?(/foo/) # => true
+ *    [].one?(/foo/) # => false
+ *
+ *  Related: Enumerable#one?
+ */
+
+static VALUE
+rb_ary_one_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+    VALUE result = Qfalse;
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qfalse;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    array.dig(index, *identifiers) -> object
+ *
+ *  Finds and returns the object in nested objects
+ *  that is specified by +index+ and +identifiers+.
+ *  The nested objects may be instances of various classes.
+ *  See {Dig Methods}[rdoc-ref:dig_methods.rdoc].
+ *
+ *  Examples:
+ *
+ *    a = [:foo, [:bar, :baz, [:bat, :bam]]]
+ *    a.dig(1) # => [:bar, :baz, [:bat, :bam]]
+ *    a.dig(1, 2) # => [:bat, :bam]
+ *    a.dig(1, 2, 0) # => :bat
+ *    a.dig(1, 2, 3) # => nil
+ *
+ */
+
+static VALUE
+rb_ary_dig(int argc, VALUE *argv, VALUE self)
+{
+    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+    self = rb_ary_at(self, *argv);
+    if (!--argc) return self;
+    ++argv;
+    return rb_obj_dig(argc, argv, self, Qnil);
+}
+
+static inline VALUE
+finish_exact_sum(long n, VALUE r, VALUE v, int z)
+{
+    if (n != 0)
+        v = rb_fix_plus(LONG2FIX(n), v);
+    if (!UNDEF_P(r)) {
+        v = rb_rational_plus(r, v);
+    }
+    else if (!n && z) {
+        v = rb_fix_plus(LONG2FIX(0), v);
+    }
+    return v;
+}
+
+/*
+ * call-seq:
+ *   array.sum(init = 0) -> object
+ *   array.sum(init = 0) {|element| ... } -> object
+ *
+ *  When no block is given, returns the object equivalent to:
+ *
+ *    sum = init
+ *    array.each {|element| sum += element }
+ *    sum
+ *
+ *  For example, <tt>[e1, e2, e3].sum</tt> returns <tt>init + e1 + e2 + e3</tt>.
+ *
+ *  Examples:
+ *
+ *    a = [0, 1, 2, 3]
+ *    a.sum # => 6
+ *    a.sum(100) # => 106
+ *
+ *  The elements need not be numeric, but must be <tt>+</tt>-compatible
+ *  with each other and with +init+:
+ *
+ *    a = ['abc', 'def', 'ghi']
+ *    a.sum('jkl') # => "jklabcdefghi"
+ *
+ *  When a block is given, it is called with each element
+ *  and the block's return value (instead of the element itself) is used as the addend:
+ *
+ *    a = ['zero', 1, :two]
+ *    s = a.sum('Coerced and concatenated: ') {|element| element.to_s }
+ *    s # => "Coerced and concatenated: zero1two"
+ *
+ *  Notes:
+ *
+ *  - Array#join and Array#flatten may be faster than Array#sum
+ *    for an \Array of Strings or an \Array of Arrays.
+ *  - Array#sum method may not respect method redefinition of "+" methods such as Integer#+.
+ *
+ */
+
+static VALUE
+rb_ary_sum(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE e, v, r;
+    long i, n;
+    int block_given;
+
+    v = (rb_check_arity(argc, 0, 1) ? argv[0] : LONG2FIX(0));
+
+    block_given = rb_block_given_p();
+
+    if (RARRAY_LEN(ary) == 0)
+        return v;
+
+    n = 0;
+    r = Qundef;
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (block_given)
+            e = rb_yield(e);
+        if (FIXNUM_P(e)) {
+            n += FIX2LONG(e); /* should not overflow long type */
+            if (!FIXABLE(n)) {
+                v = rb_big_plus(LONG2NUM(n), v);
+                n = 0;
+            }
+        }
+        else if (RB_BIGNUM_TYPE_P(e))
+            v = rb_big_plus(e, v);
+        else if (RB_TYPE_P(e, T_RATIONAL)) {
+            if (UNDEF_P(r))
+                r = e;
+            else
+                r = rb_rational_plus(r, e);
+        }
+        else
+            goto not_exact;
+    }
+    v = finish_exact_sum(n, r, v, argc!=0);
+    return v;
+
+  not_exact:
+    v = finish_exact_sum(n, r, v, i!=0);
+
+    if (RB_FLOAT_TYPE_P(e)) {
+        /*
+         * Kahan-Babuska balancing compensated summation algorithm
+         * See https://link.springer.com/article/10.1007/s00607-005-0139-x
+         */
+        double f, c;
+        double x, t;
+
+        f = NUM2DBL(v);
+        c = 0.0;
+        goto has_float_value;
+        for (; i < RARRAY_LEN(ary); i++) {
+            e = RARRAY_AREF(ary, i);
+            if (block_given)
+                e = rb_yield(e);
+            if (RB_FLOAT_TYPE_P(e))
+              has_float_value:
+                x = RFLOAT_VALUE(e);
+            else if (FIXNUM_P(e))
+                x = FIX2LONG(e);
+            else if (RB_BIGNUM_TYPE_P(e))
+                x = rb_big2dbl(e);
+            else if (RB_TYPE_P(e, T_RATIONAL))
+                x = rb_num2dbl(e);
+            else
+                goto not_float;
+
+            if (isnan(f)) continue;
+            if (isnan(x)) {
+                f = x;
+                continue;
+            }
+            if (isinf(x)) {
+                if (isinf(f) && signbit(x) != signbit(f))
+                    f = NAN;
+                else
+                    f = x;
+                continue;
+            }
+            if (isinf(f)) continue;
+
+            t = f + x;
+            if (fabs(f) >= fabs(x))
+                c += ((f - t) + x);
+            else
+                c += ((x - t) + f);
+            f = t;
+        }
+        f += c;
+        return DBL2NUM(f);
+
+      not_float:
+        v = DBL2NUM(f);
+    }
+
+    goto has_some_value;
+    for (; i < RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (block_given)
+            e = rb_yield(e);
+      has_some_value:
+        v = rb_funcall(v, idPLUS, 1, e);
+    }
+    return v;
+}
+
+static VALUE
+rb_ary_deconstruct(VALUE ary)
+{
+    return ary;
+}
+
+/*
+ *  An \Array is an ordered, integer-indexed collection of objects, called _elements_.
+ *  Any object (even another array) may be an array element,
+ *  and an array can contain objects of different types.
+ *
+ *  == \Array Indexes
+ *
+ *  \Array indexing starts at 0, as in C or Java.
+ *
+ *  A positive index is an offset from the first element:
+ *
+ *  - Index 0 indicates the first element.
+ *  - Index 1 indicates the second element.
+ *  - ...
+ *
+ *  A negative index is an offset, backwards, from the end of the array:
+ *
+ *  - Index -1 indicates the last element.
+ *  - Index -2 indicates the next-to-last element.
+ *  - ...
+ *
+ *  A non-negative index is <i>in range</i> if and only if it is smaller than
+ *  the size of the array.  For a 3-element array:
+ *
+ *  - Indexes 0 through 2 are in range.
+ *  - Index 3 is out of range.
+ *
+ *  A negative index is <i>in range</i> if and only if its absolute value is
+ *  not larger than the size of the array.  For a 3-element array:
+ *
+ *  - Indexes -1 through -3 are in range.
+ *  - Index -4 is out of range.
+ *
+ *  Although the effective index into an array is always an integer,
+ *  some methods (both within and outside of class \Array)
+ *  accept one or more non-integer arguments that are
+ *  {integer-convertible objects}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
  *
- *  Array indexing starts at 0, as in C or Java.  A negative index is assumed
- *  to be relative to the end of the array---that is, an index of -1 indicates
- *  the last element of the array, -2 is the next to last element in the
- *  array, and so on.
  *
  *  == Creating Arrays
  *
- *  A new array can be created by using the literal constructor
- *  <code>[]</code>.  Arrays can contain different types of objects.  For
- *  example, the array below contains an Integer, a String and a Float:
+ *  You can create an \Array object explicitly with:
+ *
+ *  - An {array literal}[rdoc-ref:literals.rdoc@Array+Literals]:
+ *
+ *      [1, 'one', :one, [2, 'two', :two]]
+ *
+ *  - A {%w or %W: string-array Literal}[rdoc-ref:literals.rdoc@25w+and+-25W-3A+String-Array+Literals]:
+ *
+ *      %w[foo bar baz] # => ["foo", "bar", "baz"]
+ *      %w[1 % *]       # => ["1", "%", "*"]
  *
- *     ary = [1, "two", 3.0] #=> [1, "two", 3.0]
+ *  - A {%i pr %I: symbol-array Literal}[rdoc-ref:literals.rdoc@25i+and+-25I-3A+Symbol-Array+Literals]:
  *
- *  An array can also be created by explicitly calling Array.new with zero, one
- *  (the initial size of the Array) or two arguments (the initial size and a
- *  default object).
+ *      %i[foo bar baz] # => [:foo, :bar, :baz]
+ *      %i[1 % *]       # => [:"1", :%, :*]
  *
- *     ary = Array.new    #=> []
- *     Array.new(3)       #=> [nil, nil, nil]
- *     Array.new(3, true) #=> [true, true, true]
+ *  - \Method Kernel#Array:
  *
- *  Note that the second argument populates the array with references to the
- *  same object.  Therefore, it is only recommended in cases when you need to
- *  instantiate arrays with natively immutable objects such as Symbols,
- *  numbers, true or false.
+ *      Array(["a", "b"])             # => ["a", "b"]
+ *      Array(1..5)                   # => [1, 2, 3, 4, 5]
+ *      Array(key: :value)            # => [[:key, :value]]
+ *      Array(nil)                    # => []
+ *      Array(1)                      # => [1]
+ *      Array({:a => "a", :b => "b"}) # => [[:a, "a"], [:b, "b"]]
  *
- *  To create an array with separate objects a block can be passed instead.
- *  This method is safe to use with mutable objects such as hashes, strings or
- *  other arrays:
+ *  - \Method Array.new:
  *
- *     Array.new(4) { Hash.new } #=> [{}, {}, {}, {}]
+ *      Array.new               # => []
+ *      Array.new(3)            # => [nil, nil, nil]
+ *      Array.new(4) {Hash.new} # => [{}, {}, {}, {}]
+ *      Array.new(3, true)      # => [true, true, true]
  *
- *  This is also a quick way to build up multi-dimensional arrays:
+ *    Note that the last example above populates the array
+ *    with references to the same object.
+ *    This is recommended only in cases where that object is a natively immutable object
+ *    such as a symbol, a numeric, +nil+, +true+, or +false+.
  *
- *     empty_table = Array.new(3) { Array.new(3) }
- *     #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *    Another way to create an array with various objects, using a block;
+ *    this usage is safe for mutable objects such as hashes, strings or
+ *    other arrays:
  *
- *  An array can also be created by using the Array() method, provided by
- *  Kernel, which tries to call #to_ary, then #to_a on its argument.
+ *      Array.new(4) {|i| i.to_s } # => ["0", "1", "2", "3"]
  *
- *	Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
+ *    Here is a way to create a multi-dimensional array:
+ *
+ *      Array.new(3) {Array.new(3)}
+ *      # => [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *
+ *  A number of Ruby methods, both in the core and in the standard library,
+ *  provide instance method +to_a+, which converts an object to an array.
+ *
+ *  - ARGF#to_a
+ *  - Array#to_a
+ *  - Enumerable#to_a
+ *  - Hash#to_a
+ *  - MatchData#to_a
+ *  - NilClass#to_a
+ *  - OptionParser#to_a
+ *  - Range#to_a
+ *  - Set#to_a
+ *  - Struct#to_a
+ *  - Time#to_a
+ *  - Benchmark::Tms#to_a
+ *  - CSV::Table#to_a
+ *  - Enumerator::Lazy#to_a
+ *  - Gem::List#to_a
+ *  - Gem::NameTuple#to_a
+ *  - Gem::Platform#to_a
+ *  - Gem::RequestSet::Lockfile::Tokenizer#to_a
+ *  - Gem::SourceList#to_a
+ *  - OpenSSL::X509::Extension#to_a
+ *  - OpenSSL::X509::Name#to_a
+ *  - Racc::ISet#to_a
+ *  - Rinda::RingFinger#to_a
+ *  - Ripper::Lexer::Elem#to_a
+ *  - RubyVM::InstructionSequence#to_a
+ *  - YAML::DBM#to_a
  *
  *  == Example Usage
  *
  *  In addition to the methods it mixes in through the Enumerable module, the
- *  Array class has proprietary methods for accessing, searching and otherwise
+ *  \Array class has proprietary methods for accessing, searching and otherwise
  *  manipulating arrays.
  *
  *  Some of the more common ones are illustrated below.
@@ -5631,7 +8485,7 @@ rb_ary_any_p(VALUE ary)
  *
  *     arr.drop(3) #=> [4, 5, 6]
  *
- *  == Obtaining Information about an Array
+ *  == Obtaining Information about an \Array
  *
  *  Arrays keep track of their own length at all times.  To query an array
  *  about the number of elements it contains, use #length, #count or #size.
@@ -5669,7 +8523,7 @@ rb_ary_any_p(VALUE ary)
  *     arr.insert(3, 'orange', 'pear', 'grapefruit')
  *     #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
  *
- *  == Removing Items from an Array
+ *  == Removing Items from an \Array
  *
  *  The method #pop removes the last element in an array and returns it:
  *
@@ -5711,15 +8565,15 @@ rb_ary_any_p(VALUE ary)
  *
  *  == Iterating over Arrays
  *
- *  Like all classes that include the Enumerable module, Array has an each
+ *  Like all classes that include the Enumerable module, \Array has an each
  *  method, which defines what elements should be iterated over and how.  In
- *  case of Array's #each, all elements in the Array instance are yielded to
+ *  case of Array's #each, all elements in the \Array instance are yielded to
  *  the supplied block in sequence.
  *
  *  Note that this operation leaves the array unchanged.
  *
  *     arr = [1, 2, 3, 4, 5]
- *     arr.each { |a| print a -= 10, " " }
+ *     arr.each {|a| print a -= 10, " "}
  *     # prints: -9 -8 -7 -6 -5
  *     #=> [1, 2, 3, 4, 5]
  *
@@ -5728,18 +8582,19 @@ rb_ary_any_p(VALUE ary)
  *
  *     words = %w[first second third fourth fifth sixth]
  *     str = ""
- *     words.reverse_each { |word| str += "#{word} " }
+ *     words.reverse_each {|word| str += "#{word} "}
  *     p str #=> "sixth fifth fourth third second first "
  *
  *  The #map method can be used to create a new array based on the original
  *  array, but with the values modified by the supplied block:
  *
- *     arr.map { |a| 2*a }   #=> [2, 4, 6, 8, 10]
+ *     arr.map {|a| 2*a}     #=> [2, 4, 6, 8, 10]
  *     arr                   #=> [1, 2, 3, 4, 5]
- *     arr.map! { |a| a**2 } #=> [1, 4, 9, 16, 25]
+ *     arr.map! {|a| a**2}   #=> [1, 4, 9, 16, 25]
  *     arr                   #=> [1, 4, 9, 16, 25]
  *
- *  == Selecting Items from an Array
+ *
+ *  == Selecting Items from an \Array
  *
  *  Elements can be selected from an array according to criteria defined in a
  *  block.  The selection can happen in a destructive or a non-destructive
@@ -5750,9 +8605,9 @@ rb_ary_any_p(VALUE ary)
  *  === Non-destructive Selection
  *
  *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.select { |a| a > 3 }     #=> [4, 5, 6]
- *     arr.reject { |a| a < 3 }     #=> [3, 4, 5, 6]
- *     arr.drop_while { |a| a < 4 } #=> [4, 5, 6]
+ *     arr.select {|a| a > 3}       #=> [4, 5, 6]
+ *     arr.reject {|a| a < 3}       #=> [3, 4, 5, 6]
+ *     arr.drop_while {|a| a < 4}   #=> [4, 5, 6]
  *     arr                          #=> [1, 2, 3, 4, 5, 6]
  *
  *  === Destructive Selection
@@ -5763,25 +8618,205 @@ rb_ary_any_p(VALUE ary)
  *  Similar to #select vs. #reject, #delete_if and #keep_if have the exact
  *  opposite result when supplied with the same block:
  *
- *     arr.delete_if { |a| a < 4 } #=> [4, 5, 6]
+ *     arr.delete_if {|a| a < 4}   #=> [4, 5, 6]
  *     arr                         #=> [4, 5, 6]
  *
  *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.keep_if { |a| a < 4 } #=> [1, 2, 3]
+ *     arr.keep_if {|a| a < 4}   #=> [1, 2, 3]
  *     arr                       #=> [1, 2, 3]
  *
+ *  == What's Here
+ *
+ *  First, what's elsewhere. \Class \Array:
+ *
+ *  - Inherits from {class Object}[rdoc-ref:Object@What-27s+Here].
+ *  - Includes {module Enumerable}[rdoc-ref:Enumerable@What-27s+Here],
+ *    which provides dozens of additional methods.
+ *
+ *  Here, class \Array provides methods that are useful for:
+ *
+ *  - {Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array]
+ *  - {Querying}[rdoc-ref:Array@Methods+for+Querying]
+ *  - {Comparing}[rdoc-ref:Array@Methods+for+Comparing]
+ *  - {Fetching}[rdoc-ref:Array@Methods+for+Fetching]
+ *  - {Assigning}[rdoc-ref:Array@Methods+for+Assigning]
+ *  - {Deleting}[rdoc-ref:Array@Methods+for+Deleting]
+ *  - {Combining}[rdoc-ref:Array@Methods+for+Combining]
+ *  - {Iterating}[rdoc-ref:Array@Methods+for+Iterating]
+ *  - {Converting}[rdoc-ref:Array@Methods+for+Converting]
+ *  - {And more....}[rdoc-ref:Array@Other+Methods]
+ *
+ *  === Methods for Creating an \Array
+ *
+ *  - ::[]: Returns a new array populated with given objects.
+ *  - ::new: Returns a new array.
+ *  - ::try_convert: Returns a new array created from a given object.
+ *
+ *  === Methods for Querying
+ *
+ *  - #length, #size: Returns the count of elements.
+ *  - #include?: Returns whether any element <tt>==</tt> a given object.
+ *  - #empty?: Returns whether there are no elements.
+ *  - #all?: Returns whether all elements meet a given criterion.
+ *  - #any?: Returns whether any element meets a given criterion.
+ *  - #none?: Returns whether no element <tt>==</tt> a given object.
+ *  - #one?: Returns whether exactly one element <tt>==</tt> a given object.
+ *  - #count: Returns the count of elements that meet a given criterion.
+ *  - #find_index, #index: Returns the index of the first element that meets a given criterion.
+ *  - #rindex: Returns the index of the last element that meets a given criterion.
+ *  - #hash: Returns the integer hash code.
+ *
+ *  === Methods for Comparing
+ *
+ *  - #<=>: Returns -1, 0, or 1 * as +self+ is less than, equal to, or
+ *    greater than a given object.
+ *  - #==: Returns whether each element in +self+ is <tt>==</tt> to the corresponding element
+ *    in a given object.
+ *  - #eql?: Returns whether each element in +self+ is <tt>eql?</tt> to the corresponding
+ *    element in a given object.
+
+ *  === Methods for Fetching
+ *
+ *  These methods do not modify +self+.
+ *
+ *  - #[]: Returns one or more elements.
+ *  - #fetch: Returns the element at a given offset.
+ *  - #first: Returns one or more leading elements.
+ *  - #last: Returns one or more trailing elements.
+ *  - #max: Returns one or more maximum-valued elements,
+ *    as determined by <tt><=></tt> or a given block.
+ *  - #min: Returns one or more minimum-valued elements,
+ *    as determined by <tt><=></tt> or a given block.
+ *  - #minmax: Returns the minimum-valued and maximum-valued elements,
+ *    as determined by <tt><=></tt> or a given block.
+ *  - #assoc: Returns the first element that is an array
+ *    whose first element <tt>==</tt> a given object.
+ *  - #rassoc: Returns the first element that is an array
+ *    whose second element <tt>==</tt> a given object.
+ *  - #at: Returns the element at a given offset.
+ *  - #values_at: Returns the elements at given offsets.
+ *  - #dig: Returns the object in nested objects
+ *    that is specified by a given index and additional arguments.
+ *  - #drop: Returns trailing elements as determined by a given index.
+ *  - #take: Returns leading elements as determined by a given index.
+ *  - #drop_while: Returns trailing elements as determined by a given block.
+ *  - #take_while: Returns leading elements as determined by a given block.
+ *  - #slice: Returns consecutive elements as determined by a given argument.
+ *  - #sort: Returns all elements in an order determined by <tt><=></tt> or a given block.
+ *  - #reverse: Returns all elements in reverse order.
+ *  - #compact: Returns an array containing all non-+nil+ elements.
+ *  - #select, #filter: Returns an array containing elements selected by a given block.
+ *  - #uniq: Returns an array containing non-duplicate elements.
+ *  - #rotate: Returns all elements with some rotated from one end to the other.
+ *  - #bsearch: Returns an element selected via a binary search
+ *    as determined by a given block.
+ *  - #bsearch_index: Returns the index of an element selected via a binary search
+ *    as determined by a given block.
+ *  - #sample: Returns one or more random elements.
+ *  - #shuffle: Returns elements in a random order.
+ *
+ *  === Methods for Assigning
+ *
+ *  These methods add, replace, or reorder elements in +self+.
+ *
+ *  - #[]=: Assigns specified elements with a given object.
+ *  - #push, #append, #<<: Appends trailing elements.
+ *  - #unshift, #prepend: Prepends leading elements.
+ *  - #insert: Inserts given objects at a given offset; does not replace elements.
+ *  - #concat: Appends all elements from given arrays.
+ *  - #fill: Replaces specified elements with specified objects.
+ *  - #replace: Replaces the content of +self+ with the content of a given array.
+ *  - #reverse!: Replaces +self+ with its elements reversed.
+ *  - #rotate!: Replaces +self+ with its elements rotated.
+ *  - #shuffle!: Replaces +self+ with its elements in random order.
+ *  - #sort!: Replaces +self+ with its elements sorted,
+ *    as determined by <tt><=></tt> or a given block.
+ *  - #sort_by!: Replaces +self+ with its elements sorted, as determined by a given block.
+ *
+ *  === Methods for Deleting
+ *
+ *  Each of these methods removes elements from +self+:
+ *
+ *  - #pop: Removes and returns the last element.
+ *  - #shift:  Removes and returns the first element.
+ *  - #compact!: Removes all +nil+ elements.
+ *  - #delete: Removes elements equal to a given object.
+ *  - #delete_at: Removes the element at a given offset.
+ *  - #delete_if: Removes elements specified by a given block.
+ *  - #keep_if: Removes elements not specified by a given block.
+ *  - #reject!: Removes elements specified by a given block.
+ *  - #select!, #filter!: Removes elements not specified by a given block.
+ *  - #slice!: Removes and returns a sequence of elements.
+ *  - #uniq!: Removes duplicates.
+ *
+ *  === Methods for Combining
+ *
+ *  - #&: Returns an array containing elements found both in +self+ and a given array.
+ *  - #intersection: Returns an array containing elements found both in +self+
+ *    and in each given array.
+ *  - #+: Returns an array containing all elements of +self+ followed by all elements of a given array.
+ *  - #-: Returns an array containing all elements of +self+ that are not found in a given array.
+ *  - #|: Returns an array containing all elements of +self+ and all elements of a given array,
+ *    duplicates removed.
+ *  - #union: Returns an array containing all elements of +self+ and all elements of given arrays,
+ *    duplicates removed.
+ *  - #difference: Returns an array containing all elements of +self+ that are not found
+ *    in any of the given arrays..
+ *  - #product: Returns or yields all combinations of elements from +self+ and given arrays.
+ *
+ *  === Methods for Iterating
+ *
+ *  - #each: Passes each element to a given block.
+ *  - #reverse_each:  Passes each element, in reverse order, to a given block.
+ *  - #each_index: Passes each element index to a given block.
+ *  - #cycle: Calls a given block with each element, then does so again,
+ *    for a specified number of times, or forever.
+ *  - #combination: Calls a given block with combinations of elements of +self+;
+ *    a combination does not use the same element more than once.
+ *  - #permutation: Calls a given block with permutations of elements of +self+;
+ *    a permutation does not use the same element more than once.
+ *  - #repeated_combination: Calls a given block with combinations of elements of +self+;
+ *    a combination may use the same element more than once.
+ *  - #repeated_permutation: Calls a given block with permutations of elements of +self+;
+ *    a permutation may use the same element more than once.
+ *
+ *  === Methods for Converting
+ *
+ *  - #map, #collect: Returns an array containing the block return-value for each element.
+ *  - #map!, #collect!: Replaces each element with a block return-value.
+ *  - #flatten: Returns an array that is a recursive flattening of +self+.
+ *  - #flatten!: Replaces each nested array in +self+ with the elements from that array.
+ *  - #inspect, #to_s: Returns a new String containing the elements.
+ *  - #join: Returns a newsString containing the elements joined by the field separator.
+ *  - #to_a: Returns +self+ or a new array containing all elements.
+ *  - #to_ary: Returns +self+.
+ *  - #to_h: Returns a new hash formed from the elements.
+ *  - #transpose: Transposes +self+, which must be an array of arrays.
+ *  - #zip: Returns a new array of arrays containing +self+ and given arrays;
+ *    follow the link for details.
+ *
+ *  === Other Methods
+ *
+ *  - #*: Returns one of the following:
+ *
+ *    - With integer argument +n+, a new array that is the concatenation
+ *      of +n+ copies of +self+.
+ *    - With string argument +field_separator+, a new string that is equivalent to
+ *      <tt>join(field_separator)</tt>.
+ *
+ *  - #abbrev: Returns a hash of unambiguous abbreviations for elements.
+ *  - #pack: Packs the elements into a binary sequence.
+ *  - #sum: Returns a sum of elements according to either <tt>+</tt> or a given block.
  */
 
 void
 Init_Array(void)
 {
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
-
     rb_cArray  = rb_define_class("Array", rb_cObject);
     rb_include_module(rb_cArray, rb_mEnumerable);
 
     rb_define_alloc_func(rb_cArray, empty_ary_alloc);
+    rb_define_singleton_method(rb_cArray, "new", rb_ary_s_new, -1);
     rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
     rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
     rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
@@ -5792,7 +8827,6 @@ Init_Array(void)
     rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
     rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
     rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
-    rb_define_method(rb_cArray, "frozen?",  rb_ary_frozen_p, 0);
 
     rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
     rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
@@ -5804,18 +8838,24 @@ Init_Array(void)
     rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
     rb_define_method(rb_cArray, "first", rb_ary_first, -1);
     rb_define_method(rb_cArray, "last", rb_ary_last, -1);
-    rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
+    rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
+    rb_define_method(rb_cArray, "union", rb_ary_union_multi, -1);
+    rb_define_method(rb_cArray, "difference", rb_ary_difference_multi, -1);
+    rb_define_method(rb_cArray, "intersection", rb_ary_intersection_multi, -1);
+    rb_define_method(rb_cArray, "intersect?", rb_ary_intersect_p, 1);
     rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
     rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
+    rb_define_alias(rb_cArray,  "append", "push");
     rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
     rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
     rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
+    rb_define_alias(rb_cArray,  "prepend", "unshift");
     rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
     rb_define_method(rb_cArray, "each", rb_ary_each, 0);
     rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
     rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
     rb_define_method(rb_cArray, "length", rb_ary_length, 0);
-    rb_define_alias(rb_cArray,  "size", "length");
+    rb_define_method(rb_cArray, "size", rb_ary_length, 0);
     rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
     rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
     rb_define_method(rb_cArray, "index", rb_ary_index, -1);
@@ -5834,6 +8874,8 @@ Init_Array(void)
     rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
     rb_define_method(rb_cArray, "select", rb_ary_select, 0);
     rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+    rb_define_method(rb_cArray, "filter", rb_ary_select, 0);
+    rb_define_method(rb_cArray, "filter!", rb_ary_select_bang, 0);
     rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
     rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
     rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
@@ -5862,6 +8904,10 @@ Init_Array(void)
     rb_define_method(rb_cArray, "&", rb_ary_and, 1);
     rb_define_method(rb_cArray, "|", rb_ary_or, 1);
 
+    rb_define_method(rb_cArray, "max", rb_ary_max, -1);
+    rb_define_method(rb_cArray, "min", rb_ary_min, -1);
+    rb_define_method(rb_cArray, "minmax", rb_ary_minmax, 0);
+
     rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
     rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
     rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
@@ -5869,9 +8915,6 @@ Init_Array(void)
     rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
     rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
     rb_define_method(rb_cArray, "count", rb_ary_count, -1);
-    rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
-    rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
-    rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
     rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
     rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
     rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
@@ -5885,10 +8928,14 @@ Init_Array(void)
     rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
     rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
     rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
-    rb_define_method(rb_cArray, "any?", rb_ary_any_p, 0);
+    rb_define_method(rb_cArray, "any?", rb_ary_any_p, -1);
+    rb_define_method(rb_cArray, "all?", rb_ary_all_p, -1);
+    rb_define_method(rb_cArray, "none?", rb_ary_none_p, -1);
+    rb_define_method(rb_cArray, "one?", rb_ary_one_p, -1);
+    rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
+    rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
 
-    id_cmp = rb_intern("<=>");
-    id_random = rb_intern("random");
-    id_div = rb_intern("div");
-    id_power = rb_intern("**");
+    rb_define_method(rb_cArray, "deconstruct", rb_ary_deconstruct, 0);
 }
+
+#include "array.rbinc"
diff --git a/array.rb b/array.rb
new file mode 100644
index 0000000000..b9fa9844e6
--- /dev/null
+++ b/array.rb
@@ -0,0 +1,69 @@
+class Array
+  # call-seq:
+  #    array.shuffle!(random: Random) -> array
+  #
+  # Shuffles the elements of +self+ in place.
+  #    a = [1, 2, 3] #=> [1, 2, 3]
+  #    a.shuffle!    #=> [2, 3, 1]
+  #    a             #=> [2, 3, 1]
+  #
+  # The optional +random+ argument will be used as the random number generator:
+  #    a.shuffle!(random: Random.new(1))  #=> [1, 3, 2]
+  def shuffle!(random: Random)
+    Primitive.rb_ary_shuffle_bang(random)
+  end
+
+  # call-seq:
+  #    array.shuffle(random: Random) -> new_ary
+  #
+  # Returns a new array with elements of +self+ shuffled.
+  #    a = [1, 2, 3] #=> [1, 2, 3]
+  #    a.shuffle     #=> [2, 3, 1]
+  #    a             #=> [1, 2, 3]
+  #
+  # The optional +random+ argument will be used as the random number generator:
+  #    a.shuffle(random: Random.new(1))  #=> [1, 3, 2]
+  def shuffle(random: Random)
+    Primitive.rb_ary_shuffle(random)
+  end
+
+  # call-seq:
+  #    array.sample(random: Random) -> object
+  #    array.sample(n, random: Random) -> new_ary
+  #
+  # Returns random elements from +self+.
+  #
+  # When no arguments are given, returns a random element from +self+:
+  #    a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+  #    a.sample # => 3
+  #    a.sample # => 8
+  # If +self+ is empty, returns +nil+.
+  #
+  # When argument +n+ is given, returns a new \Array containing +n+ random
+  # elements from +self+:
+  #    a.sample(3) # => [8, 9, 2]
+  #    a.sample(6) # => [9, 6, 10, 3, 1, 4]
+  # Returns no more than <tt>a.size</tt> elements
+  # (because no new duplicates are introduced):
+  #    a.sample(a.size * 2) # => [6, 4, 1, 8, 5, 9, 10, 2, 3, 7]
+  # But +self+ may contain duplicates:
+  #    a = [1, 1, 1, 2, 2, 3]
+  #    a.sample(a.size * 2) # => [1, 1, 3, 2, 1, 2]
+  # The argument +n+ must be a non-negative numeric value.
+  # The order of the result array is unrelated to the order of +self+.
+  # Returns a new empty \Array if +self+ is empty.
+  #
+  # The optional +random+ argument will be used as the random number generator:
+  #    a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+  #    a.sample(random: Random.new(1))     #=> 6
+  #    a.sample(4, random: Random.new(1))  #=> [6, 10, 9, 2]
+  def sample(n = (ary = false), random: Random)
+    if Primitive.mandatory_only?
+      # Primitive.cexpr! %{ rb_ary_sample(self, rb_cRandom, Qfalse, Qfalse) }
+      Primitive.ary_sample0
+    else
+      # Primitive.cexpr! %{ rb_ary_sample(self, random, n, ary) }
+      Primitive.ary_sample(random, n, ary)
+    end
+  end
+end
diff --git a/ast.c b/ast.c
new file mode 100644
index 0000000000..adb7287ed3
--- /dev/null
+++ b/ast.c
@@ -0,0 +1,773 @@
+/* indent-tabs-mode: nil */
+#include "internal.h"
+#include "internal/parse.h"
+#include "internal/symbol.h"
+#include "internal/warnings.h"
+#include "iseq.h"
+#include "node.h"
+#include "ruby.h"
+#include "ruby/encoding.h"
+#include "ruby/util.h"
+#include "vm_core.h"
+
+#include "builtin.h"
+
+static VALUE rb_mAST;
+static VALUE rb_cNode;
+
+struct ASTNodeData {
+    rb_ast_t *ast;
+    const NODE *node;
+};
+
+static void
+node_gc_mark(void *ptr)
+{
+    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+    rb_gc_mark((VALUE)data->ast);
+}
+
+static size_t
+node_memsize(const void *ptr)
+{
+    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+    return rb_ast_memsize(data->ast);
+}
+
+static const rb_data_type_t rb_node_type = {
+    "AST/node",
+    {node_gc_mark, RUBY_TYPED_DEFAULT_FREE, node_memsize,},
+    0, 0,
+    RUBY_TYPED_FREE_IMMEDIATELY,
+};
+
+static VALUE rb_ast_node_alloc(VALUE klass);
+
+static void
+setup_node(VALUE obj, rb_ast_t *ast, const NODE *node)
+{
+    struct ASTNodeData *data;
+
+    TypedData_Get_Struct(obj, struct ASTNodeData, &rb_node_type, data);
+    data->ast = ast;
+    data->node = node;
+}
+
+static VALUE
+ast_new_internal(rb_ast_t *ast, const NODE *node)
+{
+    VALUE obj;
+
+    obj = rb_ast_node_alloc(rb_cNode);
+    setup_node(obj, ast, node);
+
+    return obj;
+}
+
+static VALUE rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+static VALUE rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+
+static VALUE
+ast_parse_new(void)
+{
+    return rb_parser_set_context(rb_parser_new(), NULL, 0);
+}
+
+static VALUE
+ast_parse_done(rb_ast_t *ast)
+{
+    if (!ast->body.root) {
+        rb_ast_dispose(ast);
+        rb_exc_raise(GET_EC()->errinfo);
+    }
+
+    return ast_new_internal(ast, (NODE *)ast->body.root);
+}
+
+static VALUE
+ast_s_parse(rb_execution_context_t *ec, VALUE module, VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    return rb_ast_parse_str(str, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    rb_ast_t *ast = 0;
+
+    StringValue(str);
+    VALUE vparser = ast_parse_new();
+    if (RTEST(keep_script_lines)) rb_parser_keep_script_lines(vparser);
+    if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
+    if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
+    ast = rb_parser_compile_string_path(vparser, Qnil, str, 1);
+    return ast_parse_done(ast);
+}
+
+static VALUE
+ast_s_parse_file(rb_execution_context_t *ec, VALUE module, VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    return rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE f;
+    rb_ast_t *ast = 0;
+    rb_encoding *enc = rb_utf8_encoding();
+
+    FilePathValue(path);
+    f = rb_file_open_str(path, "r");
+    rb_funcall(f, rb_intern("set_encoding"), 2, rb_enc_from_encoding(enc), rb_str_new_cstr("-"));
+    VALUE vparser = ast_parse_new();
+    if (RTEST(keep_script_lines)) rb_parser_keep_script_lines(vparser);
+    if (RTEST(error_tolerant))  rb_parser_error_tolerant(vparser);
+    if (RTEST(keep_tokens))  rb_parser_keep_tokens(vparser);
+    ast = rb_parser_compile_file_path(vparser, Qnil, f, 1);
+    rb_io_close(f);
+    return ast_parse_done(ast);
+}
+
+static VALUE
+lex_array(VALUE array, int index)
+{
+    VALUE str = rb_ary_entry(array, index);
+    if (!NIL_P(str)) {
+        StringValue(str);
+        if (!rb_enc_asciicompat(rb_enc_get(str))) {
+            rb_raise(rb_eArgError, "invalid source encoding");
+        }
+    }
+    return str;
+}
+
+static VALUE
+rb_ast_parse_array(VALUE array, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    rb_ast_t *ast = 0;
+
+    array = rb_check_array_type(array);
+    VALUE vparser = ast_parse_new();
+    if (RTEST(keep_script_lines)) rb_parser_keep_script_lines(vparser);
+    if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
+    if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
+    ast = rb_parser_compile_generic(vparser, lex_array, Qnil, array, 1);
+    return ast_parse_done(ast);
+}
+
+static VALUE node_children(rb_ast_t*, const NODE*);
+
+static VALUE
+node_find(VALUE self, const int node_id)
+{
+    VALUE ary;
+    long i;
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    if (nd_node_id(data->node) == node_id) return self;
+
+    ary = node_children(data->ast, data->node);
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        VALUE child = RARRAY_AREF(ary, i);
+
+        if (CLASS_OF(child) == rb_cNode) {
+            VALUE result = node_find(child, node_id);
+            if (RTEST(result)) return result;
+        }
+    }
+
+    return Qnil;
+}
+
+extern VALUE rb_e_script;
+
+static VALUE
+script_lines(VALUE path)
+{
+    VALUE hash, lines;
+    ID script_lines;
+    CONST_ID(script_lines, "SCRIPT_LINES__");
+    if (!rb_const_defined_at(rb_cObject, script_lines)) return Qnil;
+    hash = rb_const_get_at(rb_cObject, script_lines);
+    if (!RB_TYPE_P(hash, T_HASH)) return Qnil;
+    lines = rb_hash_lookup(hash, path);
+    if (!RB_TYPE_P(lines, T_ARRAY)) return Qnil;
+    return lines;
+}
+
+static VALUE
+node_id_for_backtrace_location(rb_execution_context_t *ec, VALUE module, VALUE location)
+{
+    int node_id;
+
+    if (!rb_frame_info_p(location)) {
+        rb_raise(rb_eTypeError, "Thread::Backtrace::Location object expected");
+    }
+
+    node_id = rb_get_node_id_from_frame_info(location);
+    if (node_id == -1) {
+        return Qnil;
+    }
+
+    return INT2NUM(node_id);
+}
+
+static VALUE
+ast_s_of(rb_execution_context_t *ec, VALUE module, VALUE body, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE node, lines = Qnil;
+    const rb_iseq_t *iseq;
+    int node_id;
+
+    if (rb_frame_info_p(body)) {
+        iseq = rb_get_iseq_from_frame_info(body);
+        node_id = rb_get_node_id_from_frame_info(body);
+    }
+    else {
+        iseq = NULL;
+
+        if (rb_obj_is_proc(body)) {
+            iseq = vm_proc_iseq(body);
+
+            if (!rb_obj_is_iseq((VALUE)iseq)) return Qnil;
+        }
+        else {
+            iseq = rb_method_iseq(body);
+        }
+        if (iseq) {
+            node_id = ISEQ_BODY(iseq)->location.node_id;
+        }
+    }
+
+    if (!iseq) {
+        return Qnil;
+    }
+    lines = ISEQ_BODY(iseq)->variable.script_lines;
+
+    VALUE path = rb_iseq_path(iseq);
+    int e_option = RSTRING_LEN(path) == 2 && memcmp(RSTRING_PTR(path), "-e", 2) == 0;
+
+    if (NIL_P(lines) && rb_iseq_from_eval_p(iseq) && !e_option) {
+        rb_raise(rb_eArgError, "cannot get AST for method defined in eval");
+    }
+
+    if (!NIL_P(lines) || !NIL_P(lines = script_lines(path))) {
+        node = rb_ast_parse_array(lines, keep_script_lines, error_tolerant, keep_tokens);
+    }
+    else if (e_option) {
+        node = rb_ast_parse_str(rb_e_script, keep_script_lines, error_tolerant, keep_tokens);
+    }
+    else {
+        node = rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+    }
+
+    return node_find(node, node_id);
+}
+
+static VALUE
+rb_ast_node_alloc(VALUE klass)
+{
+    struct ASTNodeData *data;
+    VALUE obj = TypedData_Make_Struct(klass, struct ASTNodeData, &rb_node_type, data);
+
+    return obj;
+}
+
+static const char*
+node_type_to_str(const NODE *node)
+{
+    return (ruby_node_name(nd_type(node)) + rb_strlen_lit("NODE_"));
+}
+
+static VALUE
+ast_node_type(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return rb_sym_intern_ascii_cstr(node_type_to_str(data->node));
+}
+
+static VALUE
+ast_node_node_id(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2FIX(nd_node_id(data->node));
+}
+
+#define NEW_CHILD(ast, node) node ? ast_new_internal(ast, node) : Qnil
+
+static VALUE
+rb_ary_new_from_node_args(rb_ast_t *ast, long n, ...)
+{
+    va_list ar;
+    VALUE ary;
+    long i;
+
+    ary = rb_ary_new2(n);
+
+    va_start(ar, n);
+    for (i=0; i<n; i++) {
+        NODE *node;
+        node = va_arg(ar, NODE *);
+        rb_ary_push(ary, NEW_CHILD(ast, node));
+    }
+    va_end(ar);
+    return ary;
+}
+
+static VALUE
+dump_block(rb_ast_t *ast, const NODE *node)
+{
+    VALUE ary = rb_ary_new();
+    do {
+        rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+    } while (node->nd_next &&
+        nd_type_p(node->nd_next, NODE_BLOCK) &&
+        (node = node->nd_next, 1));
+    if (node->nd_next) {
+        rb_ary_push(ary, NEW_CHILD(ast, node->nd_next));
+    }
+
+    return ary;
+}
+
+static VALUE
+dump_array(rb_ast_t *ast, const NODE *node)
+{
+    VALUE ary = rb_ary_new();
+    rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+
+    while (node->nd_next && nd_type_p(node->nd_next, NODE_LIST)) {
+        node = node->nd_next;
+        rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+    }
+    rb_ary_push(ary, NEW_CHILD(ast, node->nd_next));
+
+    return ary;
+}
+
+static VALUE
+var_name(ID id)
+{
+    if (!id) return Qnil;
+    if (!rb_id2str(id)) return Qnil;
+    return ID2SYM(id);
+}
+
+static VALUE
+no_name_rest(void)
+{
+    ID rest;
+    CONST_ID(rest, "NODE_SPECIAL_NO_NAME_REST");
+    return ID2SYM(rest);
+}
+
+static VALUE
+rest_arg(rb_ast_t *ast, const NODE *rest_arg)
+{
+    return NODE_NAMED_REST_P(rest_arg) ? NEW_CHILD(ast, rest_arg) : no_name_rest();
+}
+
+static VALUE
+node_children(rb_ast_t *ast, const NODE *node)
+{
+    char name[DECIMAL_SIZE_OF_BITS(sizeof(long) * CHAR_BIT) + 2]; /* including '$' */
+
+    enum node_type type = nd_type(node);
+    switch (type) {
+      case NODE_BLOCK:
+        return dump_block(ast, node);
+      case NODE_IF:
+        return rb_ary_new_from_node_args(ast, 3, node->nd_cond, node->nd_body, node->nd_else);
+      case NODE_UNLESS:
+        return rb_ary_new_from_node_args(ast, 3, node->nd_cond, node->nd_body, node->nd_else);
+      case NODE_CASE:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+      case NODE_CASE2:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+      case NODE_CASE3:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+      case NODE_WHEN:
+        return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_body, node->nd_next);
+      case NODE_IN:
+        return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_body, node->nd_next);
+      case NODE_WHILE:
+      case NODE_UNTIL:
+        return rb_ary_push(rb_ary_new_from_node_args(ast, 2, node->nd_cond, node->nd_body),
+                           RBOOL(node->nd_state));
+      case NODE_ITER:
+      case NODE_FOR:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_iter, node->nd_body);
+      case NODE_FOR_MASGN:
+        return rb_ary_new_from_node_args(ast, 1, node->nd_var);
+      case NODE_BREAK:
+      case NODE_NEXT:
+      case NODE_RETURN:
+        return rb_ary_new_from_node_args(ast, 1, node->nd_stts);
+      case NODE_REDO:
+        return rb_ary_new_from_node_args(ast, 0);
+      case NODE_RETRY:
+        return rb_ary_new_from_node_args(ast, 0);
+      case NODE_BEGIN:
+        return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+      case NODE_RESCUE:
+        return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_resq, node->nd_else);
+      case NODE_RESBODY:
+        return rb_ary_new_from_node_args(ast, 3, node->nd_args, node->nd_body, node->nd_head);
+      case NODE_ENSURE:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_ensr);
+      case NODE_AND:
+      case NODE_OR:
+        {
+            VALUE ary = rb_ary_new();
+
+            while (1) {
+                rb_ary_push(ary, NEW_CHILD(ast, node->nd_1st));
+                if (!node->nd_2nd || !nd_type_p(node->nd_2nd, type))
+                    break;
+                node = node->nd_2nd;
+            }
+            rb_ary_push(ary, NEW_CHILD(ast, node->nd_2nd));
+            return ary;
+        }
+      case NODE_MASGN:
+        if (NODE_NAMED_REST_P(node->nd_args)) {
+            return rb_ary_new_from_node_args(ast, 3, node->nd_value, node->nd_head, node->nd_args);
+        }
+        else {
+            return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_value),
+                                        NEW_CHILD(ast, node->nd_head),
+                                        no_name_rest());
+        }
+      case NODE_LASGN:
+      case NODE_DASGN:
+      case NODE_IASGN:
+      case NODE_CVASGN:
+      case NODE_GASGN:
+        if (NODE_REQUIRED_KEYWORD_P(node)) {
+            return rb_ary_new_from_args(2, var_name(node->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
+        }
+        return rb_ary_new_from_args(2, var_name(node->nd_vid), NEW_CHILD(ast, node->nd_value));
+      case NODE_CDECL:
+        if (node->nd_vid) {
+            return rb_ary_new_from_args(2, ID2SYM(node->nd_vid), NEW_CHILD(ast, node->nd_value));
+        }
+        return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_else), ID2SYM(node->nd_else->nd_mid), NEW_CHILD(ast, node->nd_value));
+      case NODE_OP_ASGN1:
+        return rb_ary_new_from_args(4, NEW_CHILD(ast, node->nd_recv),
+                                    ID2SYM(node->nd_mid),
+                                    NEW_CHILD(ast, node->nd_args->nd_head),
+                                    NEW_CHILD(ast, node->nd_args->nd_body));
+      case NODE_OP_ASGN2:
+        return rb_ary_new_from_args(5, NEW_CHILD(ast, node->nd_recv),
+                                    RBOOL(node->nd_next->nd_aid),
+                                    ID2SYM(node->nd_next->nd_vid),
+                                    ID2SYM(node->nd_next->nd_mid),
+                                    NEW_CHILD(ast, node->nd_value));
+      case NODE_OP_ASGN_AND:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head), ID2SYM(idANDOP),
+                                    NEW_CHILD(ast, node->nd_value));
+      case NODE_OP_ASGN_OR:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head), ID2SYM(idOROP),
+                                    NEW_CHILD(ast, node->nd_value));
+      case NODE_OP_CDECL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head),
+                                    ID2SYM(node->nd_aid),
+                                    NEW_CHILD(ast, node->nd_value));
+      case NODE_CALL:
+      case NODE_OPCALL:
+      case NODE_QCALL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv),
+                                    ID2SYM(node->nd_mid),
+                                    NEW_CHILD(ast, node->nd_args));
+      case NODE_FCALL:
+        return rb_ary_new_from_args(2, ID2SYM(node->nd_mid),
+                                    NEW_CHILD(ast, node->nd_args));
+      case NODE_VCALL:
+        return rb_ary_new_from_args(1, ID2SYM(node->nd_mid));
+      case NODE_SUPER:
+        return rb_ary_new_from_node_args(ast, 1, node->nd_args);
+      case NODE_ZSUPER:
+        return rb_ary_new_from_node_args(ast, 0);
+      case NODE_LIST:
+      case NODE_VALUES:
+        return dump_array(ast, node);
+      case NODE_ZLIST:
+        return rb_ary_new_from_node_args(ast, 0);
+      case NODE_HASH:
+        return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+      case NODE_YIELD:
+        return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+      case NODE_LVAR:
+      case NODE_DVAR:
+        return rb_ary_new_from_args(1, var_name(node->nd_vid));
+      case NODE_IVAR:
+      case NODE_CONST:
+      case NODE_CVAR:
+      case NODE_GVAR:
+        return rb_ary_new_from_args(1, ID2SYM(node->nd_vid));
+      case NODE_NTH_REF:
+        snprintf(name, sizeof(name), "$%ld", node->nd_nth);
+        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+      case NODE_BACK_REF:
+        name[0] = '$';
+        name[1] = (char)node->nd_nth;
+        name[2] = '\0';
+        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+      case NODE_MATCH2:
+        if (node->nd_args) {
+            return rb_ary_new_from_node_args(ast, 3, node->nd_recv, node->nd_value, node->nd_args);
+        }
+        return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_value);
+      case NODE_MATCH3:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_value);
+      case NODE_MATCH:
+      case NODE_LIT:
+      case NODE_STR:
+      case NODE_XSTR:
+        return rb_ary_new_from_args(1, node->nd_lit);
+      case NODE_ONCE:
+        return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+      case NODE_DSTR:
+      case NODE_DXSTR:
+      case NODE_DREGX:
+      case NODE_DSYM:
+        {
+            NODE *n = node->nd_next;
+            VALUE head = Qnil, next = Qnil;
+            if (n) {
+                head = NEW_CHILD(ast, n->nd_head);
+                next = NEW_CHILD(ast, n->nd_next);
+            }
+            return rb_ary_new_from_args(3, node->nd_lit, head, next);
+        }
+      case NODE_EVSTR:
+        return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+      case NODE_ARGSCAT:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+      case NODE_ARGSPUSH:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+      case NODE_SPLAT:
+        return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+      case NODE_BLOCK_PASS:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+      case NODE_DEFN:
+        return rb_ary_new_from_args(2, ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_defn));
+      case NODE_DEFS:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv), ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_defn));
+      case NODE_ALIAS:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_1st, node->nd_2nd);
+      case NODE_VALIAS:
+        return rb_ary_new_from_args(2, ID2SYM(node->nd_alias), ID2SYM(node->nd_orig));
+      case NODE_UNDEF:
+        return rb_ary_new_from_node_args(ast, 1, node->nd_undef);
+      case NODE_CLASS:
+        return rb_ary_new_from_node_args(ast, 3, node->nd_cpath, node->nd_super, node->nd_body);
+      case NODE_MODULE:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_cpath, node->nd_body);
+      case NODE_SCLASS:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_body);
+      case NODE_COLON2:
+        return rb_ary_new_from_args(2, NEW_CHILD(ast, node->nd_head), ID2SYM(node->nd_mid));
+      case NODE_COLON3:
+        return rb_ary_new_from_args(1, ID2SYM(node->nd_mid));
+      case NODE_DOT2:
+      case NODE_DOT3:
+      case NODE_FLIP2:
+      case NODE_FLIP3:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_beg, node->nd_end);
+      case NODE_SELF:
+        return rb_ary_new_from_node_args(ast, 0);
+      case NODE_NIL:
+        return rb_ary_new_from_node_args(ast, 0);
+      case NODE_TRUE:
+        return rb_ary_new_from_node_args(ast, 0);
+      case NODE_FALSE:
+        return rb_ary_new_from_node_args(ast, 0);
+      case NODE_ERRINFO:
+        return rb_ary_new_from_node_args(ast, 0);
+      case NODE_DEFINED:
+        return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+      case NODE_POSTEXE:
+        return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+      case NODE_ATTRASGN:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv), ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_args));
+      case NODE_LAMBDA:
+        return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+      case NODE_OPT_ARG:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_body, node->nd_next);
+      case NODE_KW_ARG:
+        return rb_ary_new_from_node_args(ast, 2, node->nd_body, node->nd_next);
+      case NODE_POSTARG:
+        if (NODE_NAMED_REST_P(node->nd_1st)) {
+            return rb_ary_new_from_node_args(ast, 2, node->nd_1st, node->nd_2nd);
+        }
+        return rb_ary_new_from_args(2, no_name_rest(),
+                                    NEW_CHILD(ast, node->nd_2nd));
+      case NODE_ARGS:
+        {
+            struct rb_args_info *ainfo = node->nd_ainfo;
+            return rb_ary_new_from_args(10,
+                                        INT2NUM(ainfo->pre_args_num),
+                                        NEW_CHILD(ast, ainfo->pre_init),
+                                        NEW_CHILD(ast, ainfo->opt_args),
+                                        var_name(ainfo->first_post_arg),
+                                        INT2NUM(ainfo->post_args_num),
+                                        NEW_CHILD(ast, ainfo->post_init),
+                                        (ainfo->rest_arg == NODE_SPECIAL_EXCESSIVE_COMMA
+                                            ? ID2SYM(rb_intern("NODE_SPECIAL_EXCESSIVE_COMMA"))
+                                            : var_name(ainfo->rest_arg)),
+                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast, ainfo->kw_args)),
+                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast, ainfo->kw_rest_arg)),
+                                        var_name(ainfo->block_arg));
+        }
+      case NODE_SCOPE:
+        {
+            rb_ast_id_table_t *tbl = node->nd_tbl;
+            int i, size = tbl ? tbl->size : 0;
+            VALUE locals = rb_ary_new_capa(size);
+            for (i = 0; i < size; i++) {
+                rb_ary_push(locals, var_name(tbl->ids[i]));
+            }
+            return rb_ary_new_from_args(3, locals, NEW_CHILD(ast, node->nd_args), NEW_CHILD(ast, node->nd_body));
+        }
+      case NODE_ARYPTN:
+        {
+            struct rb_ary_pattern_info *apinfo = node->nd_apinfo;
+            VALUE rest = rest_arg(ast, apinfo->rest_arg);
+            return rb_ary_new_from_args(4,
+                                        NEW_CHILD(ast, node->nd_pconst),
+                                        NEW_CHILD(ast, apinfo->pre_args),
+                                        rest,
+                                        NEW_CHILD(ast, apinfo->post_args));
+        }
+      case NODE_FNDPTN:
+        {
+            struct rb_fnd_pattern_info *fpinfo = node->nd_fpinfo;
+            VALUE pre_rest = rest_arg(ast, fpinfo->pre_rest_arg);
+            VALUE post_rest = rest_arg(ast, fpinfo->post_rest_arg);
+            return rb_ary_new_from_args(4,
+                                        NEW_CHILD(ast, node->nd_pconst),
+                                        pre_rest,
+                                        NEW_CHILD(ast, fpinfo->args),
+                                        post_rest);
+        }
+      case NODE_HSHPTN:
+        {
+            VALUE kwrest = node->nd_pkwrestarg == NODE_SPECIAL_NO_REST_KEYWORD ? ID2SYM(rb_intern("NODE_SPECIAL_NO_REST_KEYWORD")) :
+                                                                                 NEW_CHILD(ast, node->nd_pkwrestarg);
+
+            return rb_ary_new_from_args(3,
+                                        NEW_CHILD(ast, node->nd_pconst),
+                                        NEW_CHILD(ast, node->nd_pkwargs),
+                                        kwrest);
+        }
+      case NODE_ERROR:
+        return rb_ary_new_from_node_args(ast, 0);
+      case NODE_ARGS_AUX:
+      case NODE_LAST:
+        break;
+    }
+
+    rb_bug("node_children: unknown node: %s", ruby_node_name(type));
+}
+
+static VALUE
+ast_node_children(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return node_children(data->ast, data->node);
+}
+
+static VALUE
+ast_node_first_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_first_lineno(data->node));
+}
+
+static VALUE
+ast_node_first_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_first_column(data->node));
+}
+
+static VALUE
+ast_node_last_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_last_lineno(data->node));
+}
+
+static VALUE
+ast_node_last_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_last_column(data->node));
+}
+
+static VALUE
+ast_node_all_tokens(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return rb_ast_tokens(data->ast);
+}
+
+static VALUE
+ast_node_inspect(rb_execution_context_t *ec, VALUE self)
+{
+    VALUE str;
+    VALUE cname;
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    cname = rb_class_path(rb_obj_class(self));
+    str = rb_str_new2("#<");
+
+    rb_str_append(str, cname);
+    rb_str_catf(str, ":%s@%d:%d-%d:%d>",
+                node_type_to_str(data->node),
+                nd_first_lineno(data->node), nd_first_column(data->node),
+                nd_last_lineno(data->node), nd_last_column(data->node));
+
+    return str;
+}
+
+static VALUE
+ast_node_script_lines(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+    VALUE ret = data->ast->body.script_lines;
+    if (!RB_TYPE_P(ret, T_ARRAY)) return Qnil;
+    return ret;
+}
+
+#include "ast.rbinc"
+
+void
+Init_ast(void)
+{
+    rb_mAST = rb_define_module_under(rb_cRubyVM, "AbstractSyntaxTree");
+    rb_cNode = rb_define_class_under(rb_mAST, "Node", rb_cObject);
+    rb_undef_alloc_func(rb_cNode);
+}
diff --git a/ast.rb b/ast.rb
new file mode 100644
index 0000000000..f3f72c747f
--- /dev/null
+++ b/ast.rb
@@ -0,0 +1,276 @@
+# for ast.c
+
+# AbstractSyntaxTree provides methods to parse Ruby code into
+# abstract syntax trees. The nodes in the tree
+# are instances of RubyVM::AbstractSyntaxTree::Node.
+#
+# This module is MRI specific as it exposes implementation details
+# of the MRI abstract syntax tree.
+#
+# This module is experimental and its API is not stable, therefore it might
+# change without notice. As examples, the order of children nodes is not
+# guaranteed, the number of children nodes might change, there is no way to
+# access children nodes by name, etc.
+#
+# If you are looking for a stable API or an API working under multiple Ruby
+# implementations, consider using the _parser_ gem or Ripper. If you would
+# like to make RubyVM::AbstractSyntaxTree stable, please join the discussion
+# at https://bugs.ruby-lang.org/issues/14844.
+#
+module RubyVM::AbstractSyntaxTree
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.parse(string, keep_script_lines: false, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #  Parses the given _string_ into an abstract syntax tree,
+  #  returning the root node of that tree.
+  #
+  #    RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+  #    # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-1:9>
+  #
+  #  If <tt>keep_script_lines: true</tt> option is provided, the text of the parsed
+  #  source is associated with nodes and is available via Node#script_lines.
+  #
+  #  If <tt>keep_tokens: true</tt> option is provided, Node#tokens are populated.
+  #
+  #  SyntaxError is raised if the given _string_ is invalid syntax. To overwrite this
+  #  behavior, <tt>error_tolerant: true</tt> can be provided. In this case, the parser
+  #  will produce a tree where expressions with syntax errors would be represented by
+  #  Node with <tt>type=:ERROR</tt>.
+  #
+  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2")
+  #     # <internal:ast>:33:in `parse': syntax error, unexpected ';', expecting ')' (SyntaxError)
+  #     # x = 1; p(x; y=2
+  #     #           ^
+  #
+  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2", error_tolerant: true)
+  #     # (SCOPE@1:0-1:15
+  #     #  tbl: [:x, :y]
+  #     #  args: nil
+  #     #  body: (BLOCK@1:0-1:15 (LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)) (ERROR@1:7-1:11) (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))))
+  #     root.children.last.children
+  #     # [(LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)),
+  #     #  (ERROR@1:7-1:11),
+  #     #  (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))]
+  #
+  #  Note that parsing continues even after the errored expresion.
+  #
+  def self.parse string, keep_script_lines: false, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_parse string, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.parse_file(pathname, keep_script_lines: false, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #   Reads the file from _pathname_, then parses it like ::parse,
+  #   returning the root node of the abstract syntax tree.
+  #
+  #   SyntaxError is raised if _pathname_'s contents are not
+  #   valid Ruby syntax.
+  #
+  #     RubyVM::AbstractSyntaxTree.parse_file("my-app/app.rb")
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-31:3>
+  #
+  #   See ::parse for explanation of keyword argument meaning and usage.
+  def self.parse_file pathname, keep_script_lines: false, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_parse_file pathname, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.of(proc, keep_script_lines: false, error_tolerant: false, keep_tokens: false)   -> RubyVM::AbstractSyntaxTree::Node
+  #     RubyVM::AbstractSyntaxTree.of(method, keep_script_lines: false, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #   Returns AST nodes of the given _proc_ or _method_.
+  #
+  #     RubyVM::AbstractSyntaxTree.of(proc {1 + 2})
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:35-1:42>
+  #
+  #     def hello
+  #       puts "hello, world"
+  #     end
+  #
+  #     RubyVM::AbstractSyntaxTree.of(method(:hello))
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-3:3>
+  #
+  #   See ::parse for explanation of keyword argument meaning and usage.
+  def self.of body, keep_script_lines: false, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_of body, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(backtrace_location)   -> integer
+  #
+  #   Returns the node id for the given backtrace location.
+  #
+  #     begin
+  #       raise
+  #     rescue =>  e
+  #       loc = e.backtrace_locations.first
+  #       RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(loc)
+  #     end # => 0
+  def self.node_id_for_backtrace_location backtrace_location
+    Primitive.node_id_for_backtrace_location backtrace_location
+  end
+
+  # RubyVM::AbstractSyntaxTree::Node instances are created by parse methods in
+  # RubyVM::AbstractSyntaxTree.
+  #
+  # This class is MRI specific.
+  #
+  class Node
+
+    #  call-seq:
+    #     node.type -> symbol
+    #
+    #  Returns the type of this node as a symbol.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+    #    root.type # => :SCOPE
+    #    lasgn = root.children[2]
+    #    lasgn.type # => :LASGN
+    #    call = lasgn.children[1]
+    #    call.type # => :OPCALL
+    def type
+      Primitive.ast_node_type
+    end
+
+    #  call-seq:
+    #     node.first_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text began.
+    def first_lineno
+      Primitive.ast_node_first_lineno
+    end
+
+    #  call-seq:
+    #     node.first_column -> integer
+    #
+    #  The column number in the source code where this AST's text began.
+    def first_column
+      Primitive.ast_node_first_column
+    end
+
+    #  call-seq:
+    #     node.last_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text ended.
+    def last_lineno
+      Primitive.ast_node_last_lineno
+    end
+
+    #  call-seq:
+    #     node.last_column -> integer
+    #
+    #  The column number in the source code where this AST's text ended.
+    def last_column
+      Primitive.ast_node_last_column
+    end
+
+    #  call-seq:
+    #     node.tokens -> array
+    #
+    #  Returns tokens corresponding to the location of the node.
+    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+    #    root.tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    #    root.tokens.map{_1[2]}.join # => "x = 1 + 2"
+    #
+    #  Token is an array of:
+    #
+    #  - id
+    #  - token type
+    #  - source code text
+    #  - location [ first_lineno, first_column, last_lineno, last_column ]
+    def tokens
+      return nil unless all_tokens
+
+      all_tokens.each_with_object([]) do |token, a|
+        loc = token.last
+        if ([first_lineno, first_column] <=> [loc[0], loc[1]]) <= 0 &&
+           ([last_lineno, last_column]   <=> [loc[2], loc[3]]) >= 0
+           a << token
+        end
+      end
+    end
+
+    #  call-seq:
+    #     node.all_tokens -> array
+    #
+    #  Returns all tokens for the input script regardless the receiver node.
+    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+    #    root.all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    #    root.children[-1].all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    def all_tokens
+      Primitive.ast_node_all_tokens
+    end
+
+    #  call-seq:
+    #     node.children -> array
+    #
+    #  Returns AST nodes under this one.  Each kind of node
+    #  has different children, depending on what kind of node it is.
+    #
+    #  The returned array may contain other nodes or <code>nil</code>.
+    def children
+      Primitive.ast_node_children
+    end
+
+    #  call-seq:
+    #     node.inspect -> string
+    #
+    #  Returns debugging information about this node as a string.
+    def inspect
+      Primitive.ast_node_inspect
+    end
+
+    #  call-seq:
+    #     node.node_id -> integer
+    #
+    #  Returns an internal node_id number.
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    def node_id
+      Primitive.ast_node_node_id
+    end
+
+    #  call-seq:
+    #     node.script_lines -> array
+    #
+    #  Returns the original source code as an array of lines.
+    #
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    def script_lines
+      Primitive.ast_node_script_lines
+    end
+
+    #  call-seq:
+    #     node.source -> string
+    #
+    #  Returns the code fragment that corresponds to this AST.
+    #
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    #
+    #  Also note that this API may return an incomplete code fragment
+    #  that does not parse; for example, a here document following
+    #  an expression may be dropped.
+    def source
+      lines = script_lines
+      if lines
+        lines = lines[first_lineno - 1 .. last_lineno - 1]
+        lines[-1] = lines[-1][0...last_column]
+        lines[0] = lines[0][first_column..-1]
+        lines.join
+      else
+        nil
+      end
+    end
+  end
+end
diff --git a/autogen.sh b/autogen.sh
new file mode 100755
index 0000000000..f8cdf3c0c1
--- /dev/null
+++ b/autogen.sh
@@ -0,0 +1,17 @@
+#!/bin/sh
+
+PWD=
+case "$0" in
+*/*) srcdir=`dirname $0`;;
+*) srcdir="";;
+esac
+
+symlink='--install --symlink'
+case " $* " in
+    *" -i "*|*" --install "*)
+        # reset to copy missing standard auxiliary files, instead of symlinks
+        symlink=
+        ;;
+esac
+
+exec ${AUTORECONF:-autoreconf} ${symlink} "$@" ${srcdir:+"$srcdir"}
diff --git a/basictest/runner.rb b/basictest/runner.rb
new file mode 100755
index 0000000000..0f398e7acc
--- /dev/null
+++ b/basictest/runner.rb
@@ -0,0 +1,33 @@
+#! ./miniruby
+
+exit if defined?(CROSS_COMPILING) and CROSS_COMPILING
+ruby = ENV["RUBY"]
+unless ruby
+  load './rbconfig.rb'
+  ruby = "./#{RbConfig::CONFIG['ruby_install_name']}#{RbConfig::CONFIG['EXEEXT']}"
+end
+unless File.exist? ruby
+  print "#{ruby} is not found.\n"
+  print "Try `make' first, then `make test', please.\n"
+  exit false
+end
+ARGV[0] and opt = ARGV[0][/\A--run-opt=(.*)/, 1] and ARGV.shift
+
+$stderr.reopen($stdout)
+error = ''
+
+srcdir = File.expand_path('..', File.dirname(__FILE__))
+if env = ENV["RUBYOPT"]
+  ENV["RUBYOPT"] = env + " -W1"
+end
+`#{ruby} #{opt} -W1 #{srcdir}/basictest/test.rb #{ARGV.join(' ')}`.each_line do |line|
+  if line =~ /^end of test/
+    print "\ntest succeeded\n"
+    exit true
+  end
+  error << line if %r:^(basictest/test.rb|not): =~ line
+end
+puts
+print error
+print "test failed\n"
+exit false
diff --git a/basictest/test.rb b/basictest/test.rb
new file mode 100755
index 0000000000..95875b52a6
--- /dev/null
+++ b/basictest/test.rb
@@ -0,0 +1,2367 @@
+#! /usr/bin/env ruby
+# -*- coding: us-ascii -*-
+
+$testnum=0
+$ntest=0
+$failed = 0
+class Progress
+  def initialize
+    @color = nil
+    @tty = nil
+    @quiet = nil
+    @verbose = nil
+    ARGV.each do |arg|
+      case arg
+      when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
+        warn "unknown --color argument: #$3" if $3
+        @color = $1 ? nil : !$2
+      when /\A--tty(=(?:yes|(no)|(.*)))?\z/
+        warn "unknown --tty argument: #$3" if $3
+        @tty = !$1 || !$2
+        true
+      when /\A-(q|-quiet)\z/
+        @quiet = true
+      when /\A-(v|-verbose)\z/
+        @verbose = true
+      end
+    end
+    @tty = STDERR.tty? && !STDOUT.tty? && /dumb/ !~ ENV["TERM"] if @tty.nil?
+    @eol = @tty && !@verbose ? "\r\e[K\r" : "\n"
+    case @color
+    when nil
+      @color = @tty
+    end
+    if @color
+      # dircolors-like style
+      colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
+      begin
+        File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
+          colors[n] ||= c
+        end
+      rescue
+      end
+      @passed = "\e[;#{colors["pass"] || "32"}m"
+      @failed = "\e[;#{colors["fail"] || "31"}m"
+      @reset = "\e[m"
+    else
+      @passed = @failed = @reset = ""
+    end
+    extend(Rotator) if @tty
+  end
+
+  def passed_string
+    "."
+  end
+  def failed_string
+    "#{@failed}F#{@reset}"
+  end
+  def init_string
+  end
+  def finish_string
+    if @quiet
+      @eol
+    else
+      "#{@passed}#{@ok ? 'OK' : ''} #{$testnum}#{@reset}#{@eol}"
+    end
+  end
+  def pass
+    STDERR.print passed_string
+  end
+  def fail
+    @ok = false
+    STDERR.print failed_string
+  end
+  def init
+    @ok = true
+    STDERR.print init_string
+  end
+  def finish
+    STDERR.print finish_string
+  end
+
+  module Rotator
+    ROTATOR = %w[- \\ | /]
+    BS = "\b" * ROTATOR[0].size
+    def passed_string
+      "#{BS}#{ROTATOR[(@count += 1) % ROTATOR.size]}"
+    end
+    def failed_string
+      "#{BS}#{super}#{ROTATOR[@count % ROTATOR.size]}"
+    end
+    def init_string
+      @count = 0
+      " "
+    end
+    def finish_string
+      s = "#{BS}#{' ' * BS.size}#{BS}#{super}"
+      s.gsub!(/\n/, "\r\e[2K\r") if @quiet
+      s
+    end
+  end
+end
+PROGRESS = Progress.new
+
+def test_check(what)
+  unless $ntest.zero?
+    PROGRESS.finish
+  end
+  STDERR.print "#{$0}:#{what} "
+  PROGRESS.init
+  $what = what
+  $testnum = 0
+end
+
+def test_ok(cond,n=1)
+  $testnum+=1
+  $ntest+=1
+  where = (st = caller(n)) ? st[0] : "caller error! (n=#{n}, trace=#{caller(0).join(', ')}"
+  if cond
+    PROGRESS.pass
+    printf "ok %d (%s)\n", $testnum, where
+  else
+    PROGRESS.fail
+    printf "not ok %s %d -- %s\n", $what, $testnum, where
+    $failed+=1
+  end
+  STDOUT.flush
+  STDERR.flush
+end
+
+# make sure conditional operators work
+
+test_check "assignment"
+
+a=[]; a[0] ||= "bar";
+test_ok(a[0] == "bar")
+h={}; h["foo"] ||= "bar";
+test_ok(h["foo"] == "bar")
+
+aa = 5
+aa ||= 25
+test_ok(aa == 5)
+bb ||= 25
+test_ok(bb == 25)
+cc &&=33
+test_ok(cc == nil)
+cc = 5
+cc &&=44
+test_ok(cc == 44)
+
+a = nil; test_ok(a == nil)
+a = 1; test_ok(a == 1)
+a = []; test_ok(a == [])
+a = [1]; test_ok(a == [1])
+a = [nil]; test_ok(a == [nil])
+a = [[]]; test_ok(a == [[]])
+a = [1,2]; test_ok(a == [1,2])
+a = [*[]]; test_ok(a == [])
+a = [*[1]]; test_ok(a == [1])
+a = [*[1,2]]; test_ok(a == [1,2])
+
+a = *[]; test_ok(a == [])
+a = *[1]; test_ok(a == [1])
+a = *[nil]; test_ok(a == [nil])
+a = *[[]]; test_ok(a == [[]])
+a = *[1,2]; test_ok(a == [1,2])
+a = *[*[]]; test_ok(a == [])
+a = *[*[1]]; test_ok(a == [1])
+a = *[*[1,2]]; test_ok(a == [1,2])
+
+a, = nil; test_ok(a == nil)
+a, = 1; test_ok(a == 1)
+a, = []; test_ok(a == nil)
+a, = [1]; test_ok(a == 1)
+a, = [nil]; test_ok(a == nil)
+a, = [[]]; test_ok(a == [])
+a, = 1,2; test_ok(a == 1)
+a, = [1,2]; test_ok(a == 1)
+a, = [*[]]; test_ok(a == nil)
+a, = [*[1]]; test_ok(a == 1)
+a, = *[1,2]; test_ok(a == 1)
+a, = [*[1,2]]; test_ok(a == 1)
+
+a, = *[]; test_ok(a == nil)
+a, = *[1]; test_ok(a == 1)
+a, = *[nil]; test_ok(a == nil)
+a, = *[[]]; test_ok(a == [])
+a, = *[1,2]; test_ok(a == 1)
+a, = *[*[]]; test_ok(a == nil)
+a, = *[*[1]]; test_ok(a == 1)
+a, = *[*[1,2]]; test_ok(a == 1)
+
+*a = nil; test_ok(a == [nil])
+*a = 1; test_ok(a == [1])
+*a = []; test_ok(a == [])
+*a = [1]; test_ok(a == [1])
+*a = [nil]; test_ok(a == [nil])
+*a = [[]]; test_ok(a == [[]])
+*a = [1,2]; test_ok(a == [1,2])
+*a = [*[]]; test_ok(a == [])
+*a = [*[1]]; test_ok(a == [1])
+*a = [*[1,2]]; test_ok(a == [1,2])
+
+*a = *[]; test_ok(a == [])
+*a = *[1]; test_ok(a == [1])
+*a = *[nil]; test_ok(a == [nil])
+*a = *[[]]; test_ok(a == [[]])
+*a = *[1,2]; test_ok(a == [1,2])
+*a = *[*[]]; test_ok(a == [])
+*a = *[*[1]]; test_ok(a == [1])
+*a = *[*[1,2]]; test_ok(a == [1,2])
+
+a,b,*c = nil; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = 1; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = []; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = [1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = [*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = *[]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = *[1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = *[*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+def f; yield nil; end; f {|a| test_ok(a == nil)}
+def f; yield 1; end; f {|a| test_ok(a == 1)}
+def f; yield []; end; f {|a| test_ok(a == [])}
+def f; yield [1]; end; f {|a| test_ok(a == [1])}
+def f; yield [nil]; end; f {|a| test_ok(a == [nil])}
+def f; yield [[]]; end; f {|a| test_ok(a == [[]])}
+def f; yield [*[]]; end; f {|a| test_ok(a == [])}
+def f; yield [*[1]]; end; f {|a| test_ok(a == [1])}
+def f; yield [*[1,2]]; end; f {|a| test_ok(a == [1,2])}
+def f; yield *[]; end; f {|a| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a| test_ok(a == [])}
+def f; yield *[*[]]; end; f {|a| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a| test_ok(a == 1)}
+
+def f; yield; end; f {|a,| test_ok(a == nil)}
+def f; yield nil; end; f {|a,| test_ok(a == nil)}
+def f; yield 1; end; f {|a,| test_ok(a == 1)}
+def f; yield []; end; f {|a,| test_ok(a == nil)}
+def f; yield [1]; end; f {|a,| test_ok(a == 1)}
+def f; yield [nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield [[]]; end; f {|a,| test_ok(a == [])}
+def f; yield [*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield [*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield [*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield *[]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield; end; f {|*a| test_ok(a == [])}
+def f; yield nil; end; f {|*a| test_ok(a == [nil])}
+def f; yield 1; end; f {|*a| test_ok(a == [1])}
+def f; yield []; end; f {|*a| test_ok(a == [[]])}
+def f; yield [1]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [nil]; end; f {|*a| test_ok(a == [[nil]])}
+def f; yield [[]]; end; f {|*a| test_ok(a == [[[]]])}
+def f; yield [1,2]; end; f {|*a| test_ok(a == [[1,2]])}
+def f; yield [*[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield [*[1]]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [*[1,2]]; end; f {|*a| test_ok(a == [[1,2]])}
+
+def f; yield *[]; end; f {|*a| test_ok(a == [])}
+def f; yield *[1]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[nil]; end; f {|*a| test_ok(a == [nil])}
+def f; yield *[[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield *[*[]]; end; f {|*a| test_ok(a == [])}
+def f; yield *[*[1]]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[*[1,2]]; end; f {|*a| test_ok(a == [1,2])}
+
+def f; yield; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield nil; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield 1; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield []; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [[]]; end; f {|a,b,*c| test_ok([a,b,c] == [[],nil,[]])}
+def f; yield [*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def f; yield *[]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def r; return; end; a = r(); test_ok(a == nil)
+def r; return nil; end; a = r(); test_ok(a == nil)
+def r; return 1; end; a = r(); test_ok(a == 1)
+def r; return []; end; a = r(); test_ok(a == [])
+def r; return [1]; end; a = r(); test_ok(a == [1])
+def r; return [nil]; end; a = r(); test_ok(a == [nil])
+def r; return [[]]; end; a = r(); test_ok(a == [[]])
+def r; return [*[]]; end; a = r(); test_ok(a == [])
+def r; return [*[1]]; end; a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; a = r(); test_ok(a == [])
+def r; return *[1]; end; a = r(); test_ok(a == [1])
+def r; return *[nil]; end; a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; a = r(); test_ok(a == [[]])
+def r; return *[*[]]; end; a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; a = *r(); test_ok(a == [[]])
+def r; return *[*[1,2]]; end; a = *r(); test_ok(a == [1,2])
+
+def r; return; end; *a = r(); test_ok(a == [nil])
+def r; return nil; end; *a = r(); test_ok(a == [nil])
+def r; return 1; end; *a = r(); test_ok(a == [1])
+def r; return []; end; *a = r(); test_ok(a == [])
+def r; return [1]; end; *a = r(); test_ok(a == [1])
+def r; return [nil]; end; *a = r(); test_ok(a == [nil])
+def r; return [[]]; end; *a = r(); test_ok(a == [[]])
+def r; return [1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return [*[]]; end; *a = r(); test_ok(a == [])
+def r; return [*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; *a = r(); test_ok(a == [])
+def r; return *[1]; end; *a = r(); test_ok(a == [1])
+def r; return *[nil]; end; *a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; *a = r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return *[*[]]; end; *a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; *a = *r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = *r(); test_ok(a == [1,2])
+def r; return *[*[1,2]]; end; *a = *r(); test_ok(a == [1,2])
+
+def r; return; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return nil; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return 1; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return []; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return [1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return [*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+def r; return *[]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return *[1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return *[*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+f = lambda {|r,| test_ok([] == r)}
+f.call([], *[])
+
+f = lambda {|r,*l| test_ok([] == r); test_ok([1] == l)}
+f.call([], *[1])
+
+f = lambda{|x| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|x,| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|*x| x}
+test_ok(f.call(42) == [42])
+test_ok(f.call([42]) == [[42]])
+test_ok(f.call([[42]]) == [[[42]]])
+test_ok(f.call([42,55]) == [[42,55]])
+test_ok(f.call(42,55) == [42,55])
+
+f = lambda { |a, b=42, *c| [a,b,c] }
+test_ok(f.call(1      ) == [1,42,[  ]] )
+test_ok(f.call(1,43   ) == [1,43,[  ]] )
+test_ok(f.call(1,43,44) == [1,43,[44]] )
+
+f = lambda { |a, b=(a|16), *c, &block| [a,b,c,block&&block[]] }
+test_ok(f.call(8      )     == [8,24,[  ],nil] )
+test_ok(f.call(8,43   )     == [8,43,[  ],nil] )
+test_ok(f.call(8,43,44)     == [8,43,[44],nil] )
+test_ok(f.call(8      ){45} == [8,24,[  ],45 ] )
+test_ok(f.call(8,43   ){45} == [8,43,[  ],45 ] )
+test_ok(f.call(8,43,44){45} == [8,43,[44],45 ] )
+
+f = lambda { |a, b=42, *c, d| [a,b,c,d] }
+test_ok(f.call(1      ,99) == [1,42,[  ],99] )
+test_ok(f.call(1,43   ,99) == [1,43,[  ],99] )
+test_ok(f.call(1,43,44,99) == [1,43,[44],99] )
+
+f = lambda { |a, b=(a|16), &block| [a,b,block&&block[]] }
+test_ok(f.call(8   )     == [8,24,nil] )
+test_ok(f.call(8,43)     == [8,43,nil] )
+test_ok(f.call(8,43)     == [8,43,nil] )
+test_ok(f.call(8   ){45} == [8,24,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+
+f = lambda { |a, b=42, d| [a,b,d] }
+test_ok(f.call(1   ,99) == [1,42,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+
+f = lambda { |b=42, *c, &block| [b,c,block&&block[]] }
+test_ok(f.call(     )     == [42,[  ],nil] )
+test_ok(f.call(43   )     == [43,[  ],nil] )
+test_ok(f.call(43,44)     == [43,[44],nil] )
+test_ok(f.call(     ){45} == [42,[  ],45 ] )
+test_ok(f.call(43   ){45} == [43,[  ],45 ] )
+test_ok(f.call(43,44){45} == [43,[44],45 ] )
+
+f = lambda { |b=42, *c, d| [b,c,d] }
+test_ok(f.call(      99) == [42,[  ],99] )
+test_ok(f.call(43   ,99) == [43,[  ],99] )
+test_ok(f.call(43,44,99) == [43,[44],99] )
+
+f = lambda { |b=42, &block| [b,block&&block[]] }
+test_ok(f.call(  )     == [42,nil] )
+test_ok(f.call(43)     == [43,nil] )
+test_ok(f.call(43)     == [43,nil] )
+test_ok(f.call(  ){45} == [42,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+
+f = lambda { |b=42, d| [b,d] }
+test_ok(f.call(   99) == [42,99] )
+test_ok(f.call(43,99) == [43,99] )
+test_ok(f.call(43,99) == [43,99] )
+
+
+a,=*[1]
+test_ok(a == 1)
+a,=*[[1]]
+test_ok(a == [1])
+a,=*[[[1]]]
+test_ok(a == [[1]])
+
+x, (y, z) = 1, 2, 3
+test_ok([1,2,nil] == [x,y,z])
+x, (y, z) = 1, [2,3]
+test_ok([1,2,3] == [x,y,z])
+x, (y, z) = 1, [2]
+test_ok([1,2,nil] == [x,y,z])
+
+a = loop do break; end; test_ok(a == nil)
+a = loop do break nil; end; test_ok(a == nil)
+a = loop do break 1; end; test_ok(a == 1)
+a = loop do break []; end; test_ok(a == [])
+a = loop do break [1]; end; test_ok(a == [1])
+a = loop do break [nil]; end; test_ok(a == [nil])
+a = loop do break [[]]; end; test_ok(a == [[]])
+a = loop do break [*[]]; end; test_ok(a == [])
+a = loop do break [*[1]]; end; test_ok(a == [1])
+a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+a = loop do break *[]; end; test_ok(a == [])
+a = loop do break *[1]; end; test_ok(a == [1])
+a = loop do break *[nil]; end; test_ok(a == [nil])
+a = loop do break *[[]]; end; test_ok(a == [[]])
+a = loop do break *[*[]]; end; test_ok(a == [])
+a = loop do break *[*[1]]; end; test_ok(a == [1])
+a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break; end; test_ok(a == [nil])
+*a = loop do break nil; end; test_ok(a == [nil])
+*a = loop do break 1; end; test_ok(a == [1])
+*a = loop do break []; end; test_ok(a == [])
+*a = loop do break [1]; end; test_ok(a == [1])
+*a = loop do break [nil]; end; test_ok(a == [nil])
+*a = loop do break [[]]; end; test_ok(a == [[]])
+*a = loop do break [1,2]; end; test_ok(a == [1,2])
+*a = loop do break [*[]]; end; test_ok(a == [])
+*a = loop do break [*[1]]; end; test_ok(a == [1])
+*a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break *[]; end; test_ok(a == [])
+*a = loop do break *[1]; end; test_ok(a == [1])
+*a = loop do break *[nil]; end; test_ok(a == [nil])
+*a = loop do break *[[]]; end; test_ok(a == [[]])
+*a = loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = loop do break *[*[]]; end; test_ok(a == [])
+*a = loop do break *[*[1]]; end; test_ok(a == [1])
+*a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = *loop do break *[[]]; end; test_ok(a == [[]])
+*a = *loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = *loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+a,b,*c = loop do break; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break nil; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break 1; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break []; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break [1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break [*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = loop do break *[]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break *[1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break *[*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+def r(val); a = yield(); test_ok(a == val, 2); end
+r(nil){next}
+r(nil){next nil}
+r(1){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+r([]){next *[]}
+r([1]){next *[1]}
+r([nil]){next *[nil]}
+r([[]]){next *[[]]}
+r([]){next *[*[]]}
+r([1]){next *[*[1]]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); *a = yield(); test_ok(a == val, 2); end
+r([nil]){next}
+r([nil]){next nil}
+r([1]){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([1,2]){next [1,2]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+def r(val); *a = *yield(); test_ok(a == val, 2); end
+r([[]]){next *[[]]}
+r([1,2]){next *[1,2]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); a,b,*c = yield(); test_ok([a,b,c] == val, 2); end
+r([nil,nil,[]]){next}
+r([nil,nil,[]]){next nil}
+r([1,nil,[]]){next 1}
+r([nil,nil,[]]){next []}
+r([1,nil,[]]){next [1]}
+r([nil,nil,[]]){next [nil]}
+r([[],nil,[]]){next [[]]}
+r([1,2,[]]){next [1,2]}
+r([nil,nil,[]]){next [*[]]}
+r([1,nil,[]]){next [*[1]]}
+r([1,2,[]]){next [*[1,2]]}
+
+def r(val); a,b,*c = *yield(); test_ok([a,b,c] == val, 2); end
+r([[],nil,[]]){next *[[]]}
+r([1,2,[]]){next *[1,2]}
+r([1,2,[]]){next *[*[1,2]]}
+
+test_check "condition"
+
+$x = '0';
+
+$x == $x && test_ok(true)
+$x != $x && test_ok(false)
+$x == $x || test_ok(false)
+$x != $x || test_ok(true)
+
+# first test to see if we can run the tests.
+
+test_check "if/unless";
+
+$x = 'test';
+test_ok(if $x == $x then true else false end)
+$bad = false
+unless $x == $x
+  $bad = true
+end
+test_ok(!$bad)
+test_ok(unless $x != $x then true else false end)
+
+test_check "case"
+
+case 5
+when 1, 2, 3, 4, 6, 7, 8
+  test_ok(false)
+when 5
+  test_ok(true)
+end
+
+case 5
+when 5
+  test_ok(true)
+when 1..10
+  test_ok(false)
+end
+
+case 5
+when 1..10
+  test_ok(true)
+else
+  test_ok(false)
+end
+
+case 5
+when 5
+  test_ok(true)
+else
+  test_ok(false)
+end
+
+case "foobar"
+when /^f.*r$/
+  test_ok(true)
+else
+  test_ok(false)
+end
+
+test_check "while/until";
+
+while_tmp = "while_tmp.#{$$}"
+tmp = open(while_tmp, "w")
+tmp.print "tvi925\n";
+tmp.print "tvi920\n";
+tmp.print "vt100\n";
+tmp.print "Amiga\n";
+tmp.print "paper\n";
+tmp.close
+
+# test break
+
+tmp = open(while_tmp, "r")
+test_ok(tmp.kind_of?(File))
+
+while line = tmp.gets()
+  break if /vt100/ =~ line
+end
+
+test_ok(!tmp.eof? && /vt100/ =~ line)
+tmp.close
+
+# test next
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+  next if /vt100/ =~ line
+  $bad = 1 if /vt100/ =~ line
+end
+test_ok(!(!tmp.eof? || /vt100/ =~ line || $bad))
+tmp.close
+
+# test redo
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+  lastline = line
+  line = line.gsub(/vt100/, 'VT100')
+  if lastline != line
+    line.gsub!('VT100', 'Vt100')
+    redo
+  end
+  $bad = 1 if /vt100/ =~ line
+  $bad = 1 if /VT100/ =~ line
+end
+test_ok(tmp.eof? && !$bad)
+tmp.close
+
+sum=0
+for i in 1..10
+  sum += i
+  i -= 1
+  if i > 0
+    redo
+  end
+end
+test_ok(sum == 220)
+
+# test interval
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+  break if 3
+  case line
+  when /vt100/, /Amiga/, /paper/
+    $bad = true
+  end
+end
+test_ok(!$bad)
+tmp.close
+
+File.unlink while_tmp or `/bin/rm -f "#{while_tmp}"`
+test_ok(!File.exist?(while_tmp))
+
+i = 0
+until i>4
+  i+=1
+end
+test_ok(i>4)
+
+
+# exception handling
+test_check "exception";
+
+begin
+  raise "this must be handled"
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+$bad = true
+begin
+  raise "this must be handled no.2"
+rescue
+  if $bad
+    $bad = false
+    retry
+    test_ok(false)
+  end
+end
+test_ok(true)
+
+# exception in rescue clause
+$string = "this must be handled no.3"
+begin
+  begin
+    raise "exception in rescue clause"
+  rescue
+    raise $string
+  end
+  test_ok(false)
+rescue => e
+  test_ok($! == e)
+  test_ok(e.message == $string)
+  test_ok(e != $string)
+end
+
+# exception in ensure clause
+begin
+  begin
+    raise "this must be handled no.4"
+  ensure
+    raise "exception in ensure clause"
+  end
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+$bad = true
+begin
+  begin
+    raise "this must be handled no.5"
+  ensure
+    $bad = false
+  end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+begin
+  begin
+    raise "this must be handled no.6"
+  ensure
+    $bad = false
+  end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+while true
+  begin
+    break
+  ensure
+    $bad = false
+  end
+end
+test_ok(!$bad)
+
+test_ok(catch(:foo) {
+     loop do
+       loop do
+	 throw :foo, true
+	 break
+       end
+       break
+       test_ok(false)			# should not reach here
+     end
+     false
+   })
+
+test_check "array"
+test_ok([1, 2] + [3, 4] == [1, 2, 3, 4])
+test_ok([1, 2] * 2 == [1, 2, 1, 2])
+test_ok([1, 2] * ":" == "1:2")
+
+test_ok([1, 2].hash == [1, 2].hash)
+
+test_ok([1,2,3] & [2,3,4] == [2,3])
+test_ok([1,2,3] | [2,3,4] == [1,2,3,4])
+test_ok([1,2,3] - [2,3] == [1])
+
+$x = [0, 1, 2, 3, 4, 5]
+test_ok($x[2] == 2)
+test_ok($x[1..3] == [1, 2, 3])
+test_ok($x[1,3] == [1, 2, 3])
+
+$x[0, 2] = 10
+test_ok($x[0] == 10 && $x[1] == 2)
+
+$x[0, 0] = -1
+test_ok($x[0] == -1 && $x[1] == 10)
+
+$x[-1, 1] = 20
+test_ok($x[-1] == 20 && $x.pop == 20)
+
+# array and/or
+test_ok(([1,2,3]&[2,4,6]) == [2])
+test_ok(([1,2,3]|[2,4,6]) == [1,2,3,4,6])
+
+# compact
+$x = [nil, 1, nil, nil, 5, nil, nil]
+$x.compact!
+test_ok($x == [1, 5])
+
+# uniq
+$x = [1, 1, 4, 2, 5, 4, 5, 1, 2]
+$x.uniq!
+test_ok($x == [1, 4, 2, 5])
+
+# empty?
+test_ok(!$x.empty?)
+$x = []
+test_ok($x.empty?)
+
+# sort
+$x = ["it", "came", "to", "pass", "that", "..."]
+$x = $x.sort.join(" ")
+test_ok($x == "... came it pass that to")
+$x = [2,5,3,1,7]
+$x.sort!{|a,b| a<=>b}		# sort with condition
+test_ok($x == [1,2,3,5,7])
+$x.sort!{|a,b| b-a}		# reverse sort
+test_ok($x == [7,5,3,2,1])
+
+# split test
+$x = "The Book of Mormon"
+test_ok($x.split(//).reverse!.join == $x.reverse)
+test_ok($x.reverse == $x.reverse!)
+test_ok("1 byte string".split(//).reverse.join(":") == "g:n:i:r:t:s: :e:t:y:b: :1")
+$x = "a b c  d"
+test_ok($x.split == ['a', 'b', 'c', 'd'])
+test_ok($x.split(' ') == ['a', 'b', 'c', 'd'])
+test_ok(defined? "a".chomp)
+test_ok("abc".scan(/./) == ["a", "b", "c"])
+test_ok("1a2b3c".scan(/(\d.)/) == [["1a"], ["2b"], ["3c"]])
+# non-greedy match
+test_ok("a=12;b=22".scan(/(.*?)=(\d*);?/) == [["a", "12"], ["b", "22"]])
+
+$x = [1]
+test_ok(($x * 5).join(":") == '1:1:1:1:1')
+test_ok(($x * 1).join(":") == '1')
+test_ok(($x * 0).join(":") == '')
+
+*$x = *(1..7).to_a
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+$x = [1,2,3]
+$x[1,0] = $x
+test_ok($x == [1,1,2,3,2,3])
+
+$x = [1,2,3]
+$x[-1,0] = $x
+test_ok($x == [1,2,1,2,3,3])
+
+$x = [1,2,3]
+$x.concat($x)
+test_ok($x == [1,2,3,1,2,3])
+
+test_check "hash"
+$x = {1=>2, 2=>4, 3=>6}
+
+test_ok($x[1] == 2)
+
+test_ok(begin
+     for k,v in $x
+       raise if k*2 != v
+     end
+     true
+   rescue
+     false
+   end)
+
+test_ok($x.length == 3)
+test_ok($x.has_key?(1))
+test_ok($x.has_value?(4))
+test_ok($x.values_at(2,3) == [4,6])
+test_ok($x == {1=>2, 2=>4, 3=>6})
+
+$z = $x.keys.sort.join(":")
+test_ok($z == "1:2:3")
+
+$z = $x.values.sort.join(":")
+test_ok($z == "2:4:6")
+test_ok($x == $x)
+
+$x.shift
+test_ok($x.length == 2)
+
+$z = [1,2]
+$x[$z] = 256
+test_ok($x[$z] == 256)
+
+$x = Hash.new(0)
+$x[1] = 1
+test_ok($x[1] == 1)
+test_ok($x[2] == 0)
+
+$x = Hash.new([])
+test_ok($x[22] == [])
+test_ok($x[22].equal?($x[22]))
+
+$x = Hash.new{[]}
+test_ok($x[22] == [])
+test_ok(!$x[22].equal?($x[22]))
+
+$x = Hash.new{|h,k| $z = k; h[k] = k*2}
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+$x.default = 5
+test_ok($x[23] == 5)
+
+$x = Hash.new
+def $x.default(k)
+  $z = k
+  self[k] = k*2
+end
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+
+test_check "iterator"
+
+# yield at top level
+test_ok(!defined?(yield))
+
+$x = [1, 2, 3, 4]
+$y = []
+
+# iterator over array
+for i in $x
+  $y.push i
+end
+test_ok($x == $y)
+
+# nested iterator
+def tt
+  1.upto(10) {|i|
+    yield i
+  }
+end
+
+i=0
+tt{|i| break if i == 5}
+test_ok(i == 0)
+
+def tt2(dummy)
+  yield 1
+end
+
+def tt3(&block)
+  tt2(raise(ArgumentError,""),&block)
+end
+
+$x = false
+begin
+  tt3{}
+rescue ArgumentError
+  $x = true
+rescue Exception
+end
+test_ok($x)
+
+def tt4 &block
+  tt2(raise(ArgumentError,""),&block)
+end
+$x = false
+begin
+  tt4{}
+rescue ArgumentError
+  $x = true
+rescue Exception
+end
+test_ok($x)
+
+# iterator break/redo/next/retry
+done = true
+loop{
+  break
+  done = false			# should not reach here
+}
+test_ok(done)
+
+done = false
+$bad = false
+loop {
+  break if done
+  done = true
+  next
+  $bad = true			# should not reach here
+}
+test_ok(!$bad)
+
+done = false
+$bad = false
+loop {
+  break if done
+  done = true
+  redo
+  $bad = true			# should not reach here
+}
+test_ok(!$bad)
+
+$x = []
+for i in 1 .. 7
+  $x.push i
+end
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+# append method to built-in class
+class Array
+  def iter_test1
+    collect{|e| [e, yield(e)]}.sort{|a,b|a[1]<=>b[1]}
+  end
+  def iter_test2
+    a = collect{|e| [e, yield(e)]}
+    a.sort{|a,b|a[1]<=>b[1]}
+  end
+end
+$x = [[1,2],[3,4],[5,6]]
+test_ok($x.iter_test1{|x|x} == $x.iter_test2{|x|x})
+
+class IterTest
+  def initialize(e); @body = e; end
+
+  def each0(&block); @body.each(&block); end
+  def each1(&block); @body.each {|*x| block.call(*x) } end
+  def each2(&block); @body.each {|*x| block.call(x) } end
+  def each3(&block); @body.each {|x| block.call(*x) } end
+  def each4(&block); @body.each {|x| block.call(x) } end
+  def each5; @body.each {|*x| yield(*x) } end
+  def each6; @body.each {|*x| yield(x) } end
+  def each7; @body.each {|x| yield(*x) } end
+  def each8; @body.each {|x| yield(x) } end
+
+  def f(a)
+    a
+  end
+end
+test_ok(IterTest.new(nil).method(:f).to_proc.call([1]) == [1])
+m = /\w+/.match("abc")
+test_ok(IterTest.new(nil).method(:f).to_proc.call([m]) == [m])
+
+IterTest.new([0]).each0 {|x| test_ok(x == 0)}
+IterTest.new([1]).each1 {|x| test_ok(x == 1)}
+IterTest.new([2]).each2 {|x| test_ok(x == [2])}
+#IterTest.new([3]).each3 {|x| test_ok(x == 3)}
+IterTest.new([4]).each4 {|x| test_ok(x == 4)}
+IterTest.new([5]).each5 {|x| test_ok(x == 5)}
+IterTest.new([6]).each6 {|x| test_ok(x == [6])}
+#IterTest.new([7]).each7 {|x| test_ok(x == 7)}
+IterTest.new([8]).each8 {|x| test_ok(x == 8)}
+
+IterTest.new([[0]]).each0 {|x| test_ok(x == [0])}
+IterTest.new([[1]]).each1 {|x| test_ok(x == [1])}
+IterTest.new([[2]]).each2 {|x| test_ok(x == [[2]])}
+IterTest.new([[3]]).each3 {|x| test_ok(x == 3)}
+IterTest.new([[4]]).each4 {|x| test_ok(x == [4])}
+IterTest.new([[5]]).each5 {|x| test_ok(x == [5])}
+IterTest.new([[6]]).each6 {|x| test_ok(x == [[6]])}
+IterTest.new([[7]]).each7 {|x| test_ok(x == 7)}
+IterTest.new([[8]]).each8 {|x| test_ok(x == [8])}
+
+IterTest.new([[0,0]]).each0 {|*x| test_ok(x == [[0,0]])}
+IterTest.new([[8,8]]).each8 {|*x| test_ok(x == [[8,8]])}
+
+def m0(v)
+  v
+end
+
+def m1
+  m0(block_given?)
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+def m
+  m0(block_given?,&Proc.new{})
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+class C
+  include Enumerable
+  def initialize
+    @a = [1,2,3]
+  end
+  def each(&block)
+    @a.each(&block)
+  end
+end
+
+test_ok(C.new.collect{|n| n} == [1,2,3])
+
+test_ok(Proc == lambda{}.class)
+test_ok(Proc == Proc.new{}.class)
+lambda{|a|test_ok(a==1)}.call(1)
+def block_test(klass, &block)
+  test_ok(klass === block)
+end
+
+block_test(NilClass)
+block_test(Proc){}
+
+def call_argument_test(state, proc, *args)
+  x = state
+  begin
+    proc.call(*args)
+  rescue ArgumentError
+    x = !x
+  end
+  test_ok(x,2)
+end
+
+call_argument_test(true, lambda{||})
+call_argument_test(false, lambda{||}, 1)
+call_argument_test(true, lambda{|a,|}, 1)
+call_argument_test(false, lambda{|a,|})
+call_argument_test(false, lambda{|a,|}, 1,2)
+
+call_argument_test(true, Proc.new{||})
+call_argument_test(true, Proc.new{||}, 1)
+call_argument_test(true, Proc.new{|a,|}, 1)
+call_argument_test(true, Proc.new{|a,|})
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+def block_get(&block)
+  block
+end
+
+test_ok(Proc == block_get{}.class)
+call_argument_test(true, block_get{||})
+call_argument_test(true, block_get{||}, 1)
+call_argument_test(true, block_get{|a,|}, 1)
+call_argument_test(true, block_get{|a,|})
+call_argument_test(true, block_get{|a,|}, 1,2)
+
+call_argument_test(true, block_get(&lambda{||}))
+call_argument_test(false, block_get(&lambda{||}),1)
+call_argument_test(true, block_get(&lambda{|a,|}),1)
+call_argument_test(false, block_get(&lambda{|a,|}),1,2)
+
+blk = block_get{11}
+test_ok(blk.class == Proc)
+test_ok(blk.to_proc.class == Proc)
+test_ok(blk.clone.call == 11)
+test_ok(block_get(&blk).class == Proc)
+
+lmd = lambda{44}
+test_ok(lmd.class == Proc)
+test_ok(lmd.to_proc.class == Proc)
+test_ok(lmd.clone.call == 44)
+test_ok(block_get(&lmd).class == Proc)
+
+test_ok(Proc.new{|a,| a}.yield(1,2,3) == 1)
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+test_ok(Proc.new{|&b| b.call(10)}.call {|x| x} == 10)
+test_ok(Proc.new{|a,&b| b.call(a)}.call(12) {|x| x} == 12)
+
+def test_return1
+  Proc.new {
+    return 55
+  }.yield + 5
+end
+test_ok(test_return1() == 55)
+def test_return2
+  lambda {
+    return 55
+  }.call + 5
+end
+test_ok(test_return2() == 60)
+
+def proc_call(&b)
+  b.call
+end
+def proc_yield()
+  yield
+end
+def proc_return1
+  lambda{return 42}.call+1
+end
+test_ok(proc_return1() == 43)
+def proc_return2
+  ->{return 42}.call+1
+end
+test_ok(proc_return2() == 43)
+def proc_return3
+  proc_call{return 42}+1
+end
+test_ok(proc_return3() == 42)
+def proc_return4
+  proc_yield{return 42}+1
+end
+test_ok(proc_return4() == 42)
+
+def ljump_test(state, proc, *args)
+  x = state
+  begin
+    proc.call(*args)
+  rescue LocalJumpError
+    x = !x
+  end
+  test_ok(x,2)
+end
+
+ljump_test(false, block_get{break})
+ljump_test(true, lambda{break})
+
+def exit_value_test(&block)
+  block.call
+rescue LocalJumpError
+  $!.exit_value
+end
+
+test_ok(45 == exit_value_test{break 45})
+
+test_ok(55 == begin
+              block_get{break 55}.call
+            rescue LocalJumpError
+              $!.exit_value
+            end)
+
+def block_call(&block)
+  block.call
+end
+
+def test_b1
+  block_call{break 11}
+end
+test_ok(test_b1() == 11)
+
+def ljump_rescue(r)
+  begin
+    yield
+  rescue LocalJumpError => e
+    r if /from proc-closure/ =~ e.message
+  end
+end
+
+def test_b2
+  ljump_rescue(22) do
+    block_get{break 21}.call
+  end
+end
+test_ok(test_b2() == 22)
+
+def test_b3
+  ljump_rescue(33) do
+    Proc.new{break 31}.yield
+  end
+end
+test_ok(test_b3() == 33)
+
+def test_b4
+  lambda{break 44}.call
+end
+test_ok(test_b4() == 44)
+
+def test_b5
+  ljump_rescue(55) do
+    b = block_get{break 54}
+    block_call(&b)
+  end
+end
+test_ok(test_b5() == 55)
+
+def test_b6
+  b = lambda{break 67}
+  block_call(&b)
+  66
+end
+test_ok(test_b6() == 66)
+
+def util_r7
+  block_get{break 78}
+end
+
+def test_b7
+  b = util_r7()
+  ljump_rescue(77) do
+    block_call(&b)
+  end
+end
+test_ok(test_b7() == 77)
+
+def util_b8(&block)
+  block_call(&block)
+end
+
+def test_b8
+  util_b8{break 88}
+end
+test_ok(test_b8() == 88)
+
+def util_b9(&block)
+  lambda{block.call; 98}.call
+end
+
+def test_b9
+  util_b9{break 99}
+end
+test_ok(test_b9() == 99)
+
+def util_b10
+  util_b9{break 100}
+end
+
+def test_b10
+  util_b10()
+end
+test_ok(test_b10() == 100)
+
+def test_b11
+  ljump_rescue(111) do
+    loop do
+      Proc.new{break 110}.yield
+      break 112
+    end
+  end
+end
+test_ok(test_b11() == 111)
+
+def test_b12
+  loop do
+    break lambda{break 122}.call
+    break 121
+  end
+end
+test_ok(test_b12() == 122)
+
+def test_b13
+  ljump_rescue(133) do
+    while true
+      Proc.new{break 130}.yield
+      break 131
+    end
+  end
+end
+test_ok(test_b13() == 133)
+
+def test_b14
+  while true
+    break lambda{break 144}.call
+    break 143
+  end
+end
+test_ok(test_b14() == 144)
+
+def test_b15
+  [0].each {|c| yield 1 }
+  156
+end
+test_ok(test_b15{|e| break 155 } == 155)
+
+def marity_test(m)
+  method = method(m)
+  test_ok(method.arity == method.to_proc.arity, 2)
+end
+marity_test(:test_ok)
+marity_test(:marity_test)
+marity_test(:p)
+
+class ITER_TEST1
+   def a
+     block_given?
+   end
+end
+
+class ITER_TEST2 < ITER_TEST1
+   def a
+     test_ok(super)
+     super
+   end
+end
+test_ok(ITER_TEST2.new.a {})
+
+class ITER_TEST3
+  def foo x
+    return yield if block_given?
+    x
+  end
+end
+
+class ITER_TEST4 < ITER_TEST3
+  def foo x
+    test_ok(super == yield)
+    test_ok(super(x, &nil) == x)
+  end
+end
+
+ITER_TEST4.new.foo(44){55}
+
+class ITER_TEST5
+   def tt(aa)
+     aa
+   end
+
+   def uu(a)
+      class << self
+         define_method(:tt) do |sym|
+            super(sym)
+         end
+      end
+   end
+
+   def xx(*x)
+     x.size
+   end
+end
+
+a = ITER_TEST5.new
+a.uu(12)
+test_ok(a.tt(1) == 1)
+
+class ITER_TEST6 < ITER_TEST5
+   def xx(*a)
+      a << 12
+      super
+   end
+end
+
+test_ok(ITER_TEST6.new.xx([24]) == 2)
+
+test_check "float"
+test_ok(2.6.floor == 2)
+test_ok((-2.6).floor == -3)
+test_ok(2.6.ceil == 3)
+test_ok((-2.6).ceil == -2)
+test_ok(2.6.truncate == 2)
+test_ok((-2.6).truncate == -2)
+test_ok(2.6.round == 3)
+test_ok((-2.4).truncate == -2)
+test_ok((13.4 % 1 - 0.4).abs < 0.0001)
+nan = 0.0/0
+def nan_test(x,y)
+  test_ok(x != y)
+  test_ok((x < y) == false)
+  test_ok((x > y) == false)
+  test_ok((x <= y) == false)
+  test_ok((x >= y) == false)
+end
+nan_test(nan, nan)
+nan_test(nan, 0)
+nan_test(nan, 1)
+nan_test(nan, -1)
+nan_test(nan, 1000)
+nan_test(nan, -1000)
+nan_test(nan, 1_000_000_000_000)
+nan_test(nan, -1_000_000_000_000)
+nan_test(nan, 100.0);
+nan_test(nan, -100.0);
+nan_test(nan, 0.001);
+nan_test(nan, -0.001);
+nan_test(nan, 1.0/0);
+nan_test(nan, -1.0/0);
+
+#s = "3.7517675036461267e+17"
+#test_ok(s == sprintf("%.16e", s.to_f))
+f = 3.7517675036461267e+17
+test_ok(f == sprintf("%.16e", f).to_f)
+
+
+test_check "bignum"
+def fact(n)
+  return 1 if n == 0
+  f = 1
+  while n>0
+    f *= n
+    n -= 1
+  end
+  return f
+end
+$x = fact(40)
+test_ok($x == $x)
+test_ok($x == fact(40))
+test_ok($x < $x+2)
+test_ok($x > $x-2)
+test_ok($x == 815915283247897734345611269596115894272000000000)
+test_ok($x != 815915283247897734345611269596115894272000000001)
+test_ok($x+1 == 815915283247897734345611269596115894272000000001)
+test_ok($x/fact(20) == 335367096786357081410764800000)
+$x = -$x
+test_ok($x == -815915283247897734345611269596115894272000000000)
+test_ok(2-(2**32) == -(2**32-2))
+test_ok(2**32 - 5 == (2**32-3)-2)
+
+$good = true;
+for i in 1000..1014
+  $good = false if ((1 << i) != (2**i))
+end
+test_ok($good)
+
+$good = true;
+n1= 1 << 1000
+for i in 1000..1014
+  $good = false if ((1 << i) != n1)
+  n1 *= 2
+end
+test_ok($good)
+
+$good = true;
+n2=n1
+for i in 1..10
+  n1 = n1 / 2
+  n2 = n2 >> 1
+  $good = false if (n1 != n2)
+end
+test_ok($good)
+
+$good = true;
+for i in 4000..4096
+  n1 = 1 << i;
+  if (n1**2-1) / (n1+1) != (n1-1)
+    $good = false
+  end
+end
+test_ok($good)
+
+b = 10**80
+a = b * 9 + 7
+test_ok(7 == a.modulo(b))
+test_ok(-b + 7 == a.modulo(-b))
+test_ok(b + -7 == (-a).modulo(b))
+test_ok(-7 == (-a).modulo(-b))
+test_ok(7 == a.remainder(b))
+test_ok(7 == a.remainder(-b))
+test_ok(-7 == (-a).remainder(b))
+test_ok(-7 == (-a).remainder(-b))
+
+test_ok(10**40+10**20 == 10000000000000000000100000000000000000000)
+test_ok(10**40/10**20 == 100000000000000000000)
+
+a = 677330545177305025495135714080
+b = 14269972710765292560
+test_ok(a % b == 0)
+test_ok(-a % b == 0)
+
+def shift_test(a)
+  b = a / (2 ** 32)
+  c = a >> 32
+  test_ok(b == c)
+
+  b = a * (2 ** 32)
+  c = a << 32
+  test_ok(b == c)
+end
+
+shift_test(-4518325415524767873)
+shift_test(-0xfffffffffffffffff)
+
+test_check "string & char"
+
+test_ok("abcd" == "abcd")
+test_ok("abcd" =~ /abcd/)
+test_ok("abcd" === "abcd")
+# compile time string concatenation
+test_ok("ab" "cd" == "abcd")
+test_ok("#{22}aa" "cd#{44}" == "22aacd44")
+test_ok("#{22}aa" "cd#{44}" "55" "#{66}" == "22aacd445566")
+test_ok("abc" !~ /^$/)
+test_ok("abc\n" !~ /^$/)
+test_ok("abc" !~ /^d*$/)
+test_ok(("abc" =~ /d*$/) == 3)
+test_ok("" =~ /^$/)
+test_ok("\n" =~ /^$/)
+test_ok("a\n\n" =~ /^$/)
+test_ok("abcabc" =~ /.*a/ && $& == "abca")
+test_ok("abcabc" =~ /.*c/ && $& == "abcabc")
+test_ok("abcabc" =~ /.*?a/ && $& == "a")
+test_ok("abcabc" =~ /.*?c/ && $& == "abc")
+test_ok(/(.|\n)*?\n(b|\n)/ =~ "a\nb\n\n" && $& == "a\nb")
+
+test_ok(/^(ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(ab+)+/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+/ =~ "ababb" && $& == "ababb")
+
+test_ok(/(\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+test_ok(/(?:\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+
+$x = <<END;
+ABCD
+ABCD
+END
+$x.gsub!(/((.|\n)*?)B((.|\n)*?)D/, '\1\3')
+test_ok($x == "AC\nAC\n")
+
+test_ok("foobar" =~ /foo(?=(bar)|(baz))/)
+test_ok("foobaz" =~ /foo(?=(bar)|(baz))/)
+
+$foo = "abc"
+test_ok("#$foo = abc" == "abc = abc")
+test_ok("#{$foo} = abc" == "abc = abc")
+
+foo = "abc"
+test_ok("#{foo} = abc" == "abc = abc")
+
+test_ok('-' * 5 == '-----')
+test_ok('-' * 1 == '-')
+test_ok('-' * 0 == '')
+
+foo = '-'
+test_ok(foo * 5 == '-----')
+test_ok(foo * 1 == '-')
+test_ok(foo * 0 == '')
+
+$x = "a.gif"
+test_ok($x.sub(/.*\.([^\.]+)$/, '\1') == "gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'b.\1') == "b.gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, '\2') == "")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'a\2b') == "ab")
+test_ok($x.sub(/.*\.([^\.]+)$/, '<\&>') == "<a.gif>")
+
+# character constants(assumes ASCII)
+test_ok("a"[0] == ?a)
+test_ok(?a == ?a)
+test_ok(?\C-a == "\1")
+test_ok(?\M-a == "\341")
+test_ok(?\M-\C-a == "\201")
+test_ok("a".upcase![0] == ?A)
+test_ok("A".downcase![0] == ?a)
+test_ok("abc".tr!("a-z", "A-Z") == "ABC")
+test_ok("aabbcccc".tr_s!("a-z", "A-Z") == "ABC")
+test_ok("abcc".squeeze!("a-z") == "abc")
+test_ok("abcd".delete!("bc") == "ad")
+
+$x = "abcdef"
+$y = [ ?a, ?b, ?c, ?d, ?e, ?f ]
+$bad = false
+$x.each_byte {|i|
+  if i.chr != $y.shift
+    $bad = true
+    break
+  end
+}
+test_ok(!$bad)
+
+s = "a string"
+s[0..s.size]="another string"
+test_ok(s == "another string")
+
+s = <<EOS
+#{
+[1,2,3].join(",")
+}
+EOS
+test_ok(s == "1,2,3\n")
+test_ok("Just".to_i(36) == 926381)
+test_ok("-another".to_i(36) == -23200231779)
+test_ok(1299022.to_s(36) == "ruby")
+test_ok(-1045307475.to_s(36) == "-hacker")
+test_ok("Just_another_Ruby_hacker".to_i(36) == 265419172580680477752431643787347)
+test_ok(-265419172580680477752431643787347.to_s(36) == "-justanotherrubyhacker")
+
+a = []
+(0..255).each {|n|
+  ch = [n].pack("C")
+  a.push ch if /a#{Regexp.quote ch}b/x =~ "ab"
+}
+test_ok(a.size == 0)
+
+test_check "assignment"
+a = nil
+test_ok(defined?(a))
+test_ok(a == nil)
+
+# multiple assignment
+a, b = 1, 2
+test_ok(a == 1 && b == 2)
+
+a, b = b, a
+test_ok(a == 2 && b == 1)
+
+a, = 1,2
+test_ok(a == 1)
+
+a, *b = 1, 2, 3
+test_ok(a == 1 && b == [2, 3])
+
+a, (b, c), d = 1, [2, 3], 4
+test_ok(a == 1 && b == 2 && c == 3 && d == 4)
+
+*a = 1, 2, 3
+test_ok(a == [1, 2, 3])
+
+*a = 4
+test_ok(a == [4])
+
+*a = nil
+test_ok(a == [nil])
+
+test_check "call"
+def aaa(a, b=100, *rest)
+  res = [a, b]
+  res += rest if rest
+  return res
+end
+
+# not enough argument
+begin
+  aaa()				# need at least 1 arg
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+begin
+  aaa				# no arg given (exception raised)
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+test_ok(aaa(1) == [1, 100])
+test_ok(aaa(1, 2) == [1, 2])
+test_ok(aaa(1, 2, 3, 4) == [1, 2, 3, 4])
+test_ok(aaa(1, *[2, 3, 4]) == [1, 2, 3, 4])
+
+test_check "proc"
+$proc = Proc.new{|i| i}
+test_ok($proc.call(2) == 2)
+test_ok($proc.call(3) == 3)
+
+$proc = Proc.new{|i| i*2}
+test_ok($proc.call(2) == 4)
+test_ok($proc.call(3) == 6)
+
+Proc.new{
+  iii=5				# nested local variable
+  $proc = Proc.new{|i|
+    iii = i
+  }
+  $proc2 = Proc.new {
+    $x = iii			# nested variables shared by procs
+  }
+  # scope of nested variables
+  test_ok(defined?(iii))
+}.call
+test_ok(!defined?(iii))		# out of scope
+
+loop{iii=5; test_ok(eval("defined? iii")); break}
+loop {
+  iii = 10
+  def dyna_var_check
+    loop {
+      test_ok(!defined?(iii))
+      break
+    }
+  end
+  dyna_var_check
+  break
+}
+$x=0
+$proc.call(5)
+$proc2.call
+test_ok($x == 5)
+
+if defined? Process.kill
+  test_check "signal"
+
+  $x = 0
+  trap "SIGINT", Proc.new{|sig| $x = 2}
+  Process.kill "SIGINT", $$
+  100.times {
+    sleep 0.1
+    break if $x != 0
+  }
+  test_ok($x == 2)
+
+  trap "SIGINT", Proc.new{raise "Interrupt"}
+
+  x = false
+  begin
+    Process.kill "SIGINT", $$
+    sleep 0.1
+  rescue
+    x = $!
+  end
+  test_ok(x && /Interrupt/ =~ x.message)
+end
+
+test_check "eval"
+test_ok(eval("") == nil)
+$bad=false
+eval 'while false; $bad = true; print "foo\n" end'
+test_ok(!$bad)
+
+test_ok(eval('Object'))
+test_ok(eval('true'))
+test_ok(!eval('nil'))
+test_ok(!eval('false'))
+
+$foo = 'test_ok(true)'
+begin
+  eval $foo
+rescue
+  test_ok(false)
+end
+
+test_ok(eval("$foo") == 'test_ok(true)')
+test_ok(eval("true") == true)
+i = 5
+test_ok(eval("i == 5"))
+test_ok(eval("i") == 5)
+test_ok(eval("defined? i"))
+
+# eval with binding
+def test_ev
+  local1 = "local1"
+  lambda {
+    local2 = "local2"
+    return binding
+  }.call
+end
+
+$x = test_ev
+test_ok(eval("local1", $x) == "local1") # normal local var
+test_ok(eval("local2", $x) == "local2") # nested local var
+$bad = true
+begin
+  p eval("local1")
+rescue NameError		# must raise error
+  $bad = false
+end
+test_ok(!$bad)
+
+module EvTest
+  EVTEST1 = 25
+  evtest2 = 125
+  $x = binding
+end
+test_ok(eval("EVTEST1", $x) == 25)	# constant in module
+test_ok(eval("evtest2", $x) == 125)	# local var in module
+$bad = true
+begin
+  eval("EVTEST1")
+rescue NameError		# must raise error
+  $bad = false
+end
+test_ok(!$bad)
+
+x = binding #! YARV Limitation: Proc.new{}
+eval "i4 = 1", x
+test_ok(eval("i4", x) == 1)
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "i4 = 22", x
+test_ok(eval("i4", x) == 22)
+$x = []
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+
+x = binding
+eval "i = 1", x
+test_ok(eval("i", x) == 1)
+x = Proc.new{binding}.call
+eval "i = 22", x
+test_ok(eval("i", x) == 22)
+$x = []
+x = Proc.new{binding}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+x = Proc.new{binding}.call
+eval "for i6 in 1..1; j6=i6; end", x
+test_ok(eval("defined? i6", x))
+test_ok(eval("defined? j6", x))
+
+Proc.new {
+  p = binding
+  eval "foo11 = 1", p
+  foo22 = 5
+  Proc.new{foo11=22}.call
+  Proc.new{foo22=55}.call
+  test_ok(eval("foo11", p) == eval("foo11"))
+  test_ok(eval("foo11") == 1)
+  test_ok(eval("foo22", p) == eval("foo22"))
+  test_ok(eval("foo22") == 55)
+}.call if false #! YARV Limitation
+
+#! YARV Limitation: p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+p1 = Proc.new{i7 = 0; binding}.call
+#! YARV Limitation: test_ok(p1.call == 0)
+eval "i7=5", p1
+#! YARV Limitation: test_ok(p1.call == 5)
+test_ok(!defined?(i7))
+
+if false #! YARV Limitation
+p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+i7 = nil
+test_ok(p1.call == 0)
+eval "i7=1", p1
+test_ok(p1.call == 1)
+eval "i7=5", p1
+test_ok(p1.call == 5)
+test_ok(i7 == nil)
+end
+
+# WASI doesn't support spawning a new process for now.
+unless /wasi/ =~ RUBY_PLATFORM
+test_check "system"
+test_ok(`echo foobar` == "foobar\n")
+test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
+
+script_tmp = "script_tmp.#{$$}"
+tmp = open(script_tmp, "w")
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby -s #{script_tmp} -zzz` == 'true')
+test_ok(`./miniruby -s #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby #{script_tmp} -zzz=678` == '678')
+
+tmp = open(script_tmp, "w")
+tmp.print "this is a leading junk\n";
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.print "__END__\n";
+tmp.print "this is a trailing junk\n";
+tmp.close
+
+test_ok(`./miniruby -x #{script_tmp}` == '')
+test_ok(`./miniruby -x #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+for i in 1..5
+  tmp.print i, "\n"
+end
+tmp.close
+
+`./miniruby -i.bak -pe '$_.sub!(/^[0-9]+$/){$&.to_i * 5}' #{script_tmp}`
+done = true
+tmp = open(script_tmp, "r")
+while tmp.gets
+  if $_.to_i % 5 != 0
+    done = false
+    break
+  end
+end
+tmp.close
+test_ok(done)
+
+File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
+File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
+end # not /wasi/ =~ RUBY_PLATFORM
+
+test_check "const"
+TEST1 = 1
+TEST2 = 2
+
+module Const
+  TEST3 = 3
+  TEST4 = 4
+end
+
+module Const2
+  TEST3 = 6
+  TEST4 = 8
+end
+
+include Const
+
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,3,4])
+
+include Const2
+STDERR.print "intentionally redefines TEST3, TEST4\n" if $VERBOSE
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,6,8])
+
+
+test_ok((String <=> Object) == -1)
+test_ok((Object <=> String) == 1)
+test_ok((Array <=> String) == nil)
+
+test_check "clone"
+foo = Object.new
+def foo.test
+  "test"
+end
+bar = foo.clone
+def bar.test2
+  "test2"
+end
+
+test_ok(bar.test2 == "test2")
+test_ok(bar.test == "test")
+test_ok(foo.test == "test")
+
+begin
+  foo.test2
+  test_ok false
+rescue NoMethodError
+  test_ok true
+end
+
+module M001; end
+module M002; end
+module M003; include M002; end
+module M002; include M001; end
+module M003; include M002; end
+
+test_ok(M003.ancestors == [M003, M002, M001])
+
+test_check "marshal"
+$x = [1,2,3,[4,5,"foo"],{1=>"bar"},2.5,fact(30)]
+$y = Marshal.dump($x)
+test_ok($x == Marshal.load($y))
+
+StrClone=String.clone;
+test_ok(Marshal.load(Marshal.dump(StrClone.new("abc"))).class == StrClone)
+
+[[1,2,3,4], [81, 2, 118, 3146]].each { |w,x,y,z|
+  a = (x.to_f + y.to_f / z.to_f) * Math.exp(w.to_f / (x.to_f + y.to_f / z.to_f))
+  ma = Marshal.dump(a)
+  b = Marshal.load(ma)
+  test_ok(a == b)
+}
+
+test_check "pack"
+
+$format = "c2x5CCxsdils_l_a6";
+# Need the expression in here to force ary[5] to be numeric.  This avoids
+# test2 failing because ary2 goes str->numeric->str and ary does not.
+ary = [1,-100,127,128,32767,987.654321098 / 100.0,12345,123456,-32767,-123456,"abcdef"]
+$x = ary.pack($format)
+ary2 = $x.unpack($format)
+
+test_ok(ary.length == ary2.length)
+test_ok(ary.join(':') == ary2.join(':'))
+test_ok($x =~ /def/)
+
+$x = [-1073741825]
+test_ok($x.pack("q").unpack("q") == $x)
+
+test_check "math"
+test_ok(Math.sqrt(4) == 2)
+
+include Math
+test_ok(sqrt(4) == 2)
+
+test_check "struct"
+struct_test = Struct.new("Test", :foo, :bar)
+test_ok(struct_test == Struct::Test)
+
+test = struct_test.new(1, 2)
+test_ok(test.foo == 1 && test.bar == 2)
+test_ok(test[0] == 1 && test[1] == 2)
+
+a, b = test.to_a
+test_ok(a == 1 && b == 2)
+
+test[0] = 22
+test_ok(test.foo == 22)
+
+test.bar = 47
+test_ok(test.bar == 47)
+
+test_check "variable"
+test_ok($$.instance_of?(Integer))
+
+# read-only variable
+begin
+  $$ = 5
+  test_ok false
+rescue NameError
+  test_ok true
+end
+
+foobar = "foobar"
+$_ = foobar
+test_ok($_ == foobar)
+
+class Gods
+  @@rule = "Uranus"
+  def ruler0
+    @@rule
+  end
+
+  def self.ruler1		# <= per method definition style
+    @@rule
+  end
+  class << self			# <= multiple method definition style
+    def ruler2
+      @@rule
+    end
+  end
+end
+
+module Olympians
+  @@rule ="Zeus"
+  def ruler3
+    @@rule
+  end
+end
+
+class Titans < Gods
+  @@rule = "Cronus"		# modifies @@rule in Gods
+  include Olympians
+  def ruler4
+    @@rule
+  end
+end
+
+test_ok(Gods.new.ruler0 == "Cronus")
+test_ok(Gods.ruler1 == "Cronus")
+test_ok(Gods.ruler2 == "Cronus")
+test_ok(Titans.ruler1 == "Cronus")
+test_ok(Titans.ruler2 == "Cronus")
+atlas = Titans.new
+test_ok(atlas.ruler0 == "Cronus")
+test_ok(atlas.ruler3 == "Zeus")
+begin
+  atlas.ruler4
+rescue RuntimeError => e
+  test_ok(e.message.include?("class variable @@rule of Olympians is overtaken by Gods"))
+else
+  test_ok(false)
+end
+test_ok(atlas.ruler3 == "Zeus")
+
+test_check "trace"
+$x = 1234
+$y = 0
+trace_var :$x, Proc.new{$y = $x}
+$x = 40414
+test_ok($y == $x)
+
+untrace_var :$x
+$x = 19660208
+test_ok($y != $x)
+
+trace_var :$x, Proc.new{$x *= 2}
+$x = 5
+test_ok($x == 10)
+
+untrace_var :$x
+
+test_check "defined?"
+
+test_ok(defined?($x))		# global variable
+test_ok(defined?($x) == 'global-variable')# returns description
+
+foo=5
+test_ok(defined?(foo))		# local variable
+
+test_ok(defined?(Array))	# constant
+test_ok(defined?(Object.new))	# method
+test_ok(!defined?(Object.print))# private method
+test_ok(defined?(1 == 2))	# operator expression
+
+class Foo
+  def foo
+    p :foo
+  end
+  protected :foo
+  def bar(f)
+    test_ok(defined?(self.foo))
+    test_ok(defined?(f.foo))
+  end
+end
+f = Foo.new
+test_ok(defined?(f.foo) == nil)
+f.bar(f)
+
+def defined_test
+  return !defined?(yield)
+end
+
+test_ok(defined_test)		# not iterator
+test_ok(!defined_test{})	# called as iterator
+
+test_check "alias"
+class Alias0
+  def foo; "foo" end
+end
+class Alias1 < Alias0
+  alias bar foo
+  def foo; "foo+" + super end
+end
+class Alias2 < Alias1
+  alias baz foo
+  undef foo
+end
+
+x = Alias2.new
+test_ok(x.bar == "foo")
+test_ok(x.baz == "foo+foo")
+
+# test_check for cache
+test_ok(x.baz == "foo+foo")
+
+class Alias3 < Alias2
+  def foo
+    defined? super
+  end
+  def bar
+    defined? super
+  end
+  def quux
+    defined? super
+  end
+end
+x = Alias3.new
+test_ok(!x.foo)
+test_ok(x.bar)
+test_ok(!x.quux)
+
+test_check "path"
+test_ok(File.basename("a") == "a")
+test_ok(File.basename("a/b") == "b")
+test_ok(File.basename("a/b/") == "b")
+test_ok(File.basename("/") == "/")
+test_ok(File.basename("//") == "/")
+test_ok(File.basename("///") == "/")
+test_ok(File.basename("a/b////") == "b")
+test_ok(File.basename("a.rb", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".*") == "a")
+test_ok(File.basename("a.rb///", ".c") == "a.rb")
+test_ok(File.dirname("a") == ".")
+test_ok(File.dirname("/") == "/")
+test_ok(File.dirname("/a") == "/")
+test_ok(File.dirname("a/b") == "a")
+test_ok(File.dirname("a/b/c") == "a/b")
+test_ok(File.dirname("/a/b/c") == "/a/b")
+test_ok(File.dirname("/a/b/") == "/a")
+test_ok(File.dirname("/a/b///") == "/a")
+case Dir.pwd
+when %r'\A\w:'
+  test_ok(/\A\w:\/\z/ =~ File.expand_path(".", "/"))
+  test_ok(/\A\w:\/a\z/ =~ File.expand_path("a", "/"))
+  dosish = true
+when %r'\A//'
+  test_ok(%r'\A//[^/]+/[^/]+\z' =~ File.expand_path(".", "/"))
+  test_ok(%r'\A//[^/]+/[^/]+/a\z' =~ File.expand_path(".", "/"))
+  dosish = true
+else
+  test_ok(File.expand_path(".", "/") == "/")
+  test_ok(File.expand_path("sub", "/") == "/sub")
+end
+if dosish
+  test_ok(File.expand_path("/", "//machine/share/sub") == "//machine/share")
+  test_ok(File.expand_path("/dir", "//machine/share/sub") == "//machine/share/dir")
+  test_ok(File.expand_path("/", "z:/sub") == "z:/")
+  test_ok(File.expand_path("/dir", "z:/sub") == "z:/dir")
+end
+test_ok(File.expand_path(".", "//") == "//")
+test_ok(File.expand_path("sub", "//") == "//sub")
+
+# test_check "Proc#binding"
+ObjectSpace.each_object(Proc){|o|
+  begin
+    b = o.binding
+    eval 'self', b
+  rescue ArgumentError
+  end
+}
+
+test_check "gc"
+begin
+  1.upto(10000) {
+    tmp = [0,1,2,3,4,5,6,7,8,9]
+  }
+  tmp = nil
+  test_ok true
+rescue
+  test_ok false
+end
+class S
+  def initialize(a)
+    @a = a
+  end
+end
+l=nil
+100000.times {
+  l = S.new(l)
+}
+GC.start
+test_ok true   # reach here or dumps core
+l = []
+100000.times {
+  l.push([l])
+}
+GC.start
+test_ok true   # reach here or dumps core
+
+ObjectSpace.each_object{|o|
+  o.class.name
+}
+
+test_ok true   # reach here or dumps core
+
+PROGRESS.finish
+if $failed > 0
+  printf "not ok/test: %d failed %d\n", $ntest, $failed
+else
+  printf "end of test(test: %d)\n", $ntest
+end
diff --git a/benchmark/README.md b/benchmark/README.md
new file mode 100644
index 0000000000..e11381cad9
--- /dev/null
+++ b/benchmark/README.md
@@ -0,0 +1,74 @@
+# ruby/benchmark
+
+This directory has benchmark definitions to be run with
+[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
+
+## Normal usage
+
+Execute `gem install benchmark_driver` and run a command like:
+
+```bash
+# Run a benchmark script with the ruby in the $PATH
+benchmark-driver benchmark/app_fib.rb
+
+# Run benchmark scripts with multiple Ruby executables or options
+benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
+
+# Or compare Ruby versions managed by rbenv
+benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
+
+# You can collect many metrics in many ways
+benchmark-driver benchmark/*.rb --runner memory --output markdown
+
+# Some are defined with YAML for complex setup or accurate measurement
+benchmark-driver benchmark/*.yml
+```
+
+See also:
+
+```console
+Usage: benchmark-driver [options] RUBY|YAML...
+    -r, --runner TYPE                Specify runner type: ips, time, memory, once, block (default: ips)
+    -o, --output TYPE                Specify output type: compare, simple, markdown, record, all (default: compare)
+    -e, --executables EXECS          Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
+        --rbenv VERSIONS             Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
+        --repeat-count NUM           Try benchmark NUM times and use the fastest result or the worst memory usage
+        --repeat-result TYPE         Yield "best", "average" or "worst" result with --repeat-count (default: best)
+        --alternate                  Alternate executables instead of running the same executable in a row with --repeat-count
+        --bundler                    Install and use gems specified in Gemfile
+        --filter REGEXP              Filter out benchmarks with given regexp
+        --run-duration SECONDS       Warmup estimates loop_count to run for this duration (default: 3)
+        --timeout SECONDS            Timeout ruby command execution with timeout(1)
+    -v, --verbose                    Verbose mode. Multiple -v options increase visilibity (max: 2)
+```
+
+## make benchmark
+
+Using `make benchmark`, `make update-benchmark-driver` automatically downloads
+the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
+benchmark\_driver.
+
+```bash
+# Run all benchmarks with the ruby in the $PATH and the built ruby
+make benchmark
+
+# Or compare with specific ruby binary
+make benchmark COMPARE_RUBY="/path/to/ruby --jit"
+
+# Run vm benchmarks
+make benchmark ITEM=vm
+
+# Run some limited benchmarks in ITEM-matched files
+make benchmark ITEM=vm OPTS=--filter=block
+
+# You can specify the benchmark by an exact filename instead of using the default argument:
+# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
+make benchmark ARGS=benchmark/erb_render.yml
+
+# You can specify any option via $OPTS
+make benchmark OPTS="--help"
+
+# With `make benchmark`, some special runner plugins are available:
+#   -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
+make benchmark ITEM=vm_bigarray OPTS="-r peak"
+```
diff --git a/benchmark/bm_app_answer.rb b/benchmark/app_answer.rb
index 3cd8a8fd37..3cd8a8fd37 100644
--- a/benchmark/bm_app_answer.rb
+++ b/benchmark/app_answer.rb
diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb
new file mode 100644
index 0000000000..16296af12b
--- /dev/null
+++ b/benchmark/app_aobench.rb
@@ -0,0 +1,297 @@
+# coding: US-ASCII
+
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+#      https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+srand(0)
+
+class Vec
+  def initialize(x, y, z)
+    @x = x
+    @y = y
+    @z = z
+  end
+
+  attr_accessor :x, :y, :z
+
+  def vadd(b)
+    Vec.new(@x + b.x, @y + b.y, @z + b.z)
+  end
+
+  def vsub(b)
+    Vec.new(@x - b.x, @y - b.y, @z - b.z)
+  end
+
+  def vcross(b)
+    Vec.new(@y * b.z - @z * b.y,
+            @z * b.x - @x * b.z,
+            @x * b.y - @y * b.x)
+  end
+
+  def vdot(b)
+    @x * b.x + @y * b.y + @z * b.z
+  end
+
+  def vlength
+    Math.sqrt(@x * @x + @y * @y + @z * @z)
+  end
+
+  def vnormalize
+    len = vlength
+    v = Vec.new(@x, @y, @z)
+    if len > 1.0e-17 then
+      v.x = v.x / len
+      v.y = v.y / len
+      v.z = v.z / len
+    end
+    v
+  end
+end
+
+
+class Sphere
+  def initialize(center, radius)
+    @center = center
+    @radius = radius
+  end
+
+  attr_reader :center, :radius
+
+  def intersect(ray, isect)
+    rs = ray.org.vsub(@center)
+    b = rs.vdot(ray.dir)
+    c = rs.vdot(rs) - (@radius * @radius)
+    d = b * b - c
+    if d > 0.0 then
+      t = - b - Math.sqrt(d)
+
+      if t > 0.0 and t < isect.t then
+        isect.t = t
+        isect.hit = true
+        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+                          ray.org.y + ray.dir.y * t,
+                          ray.org.z + ray.dir.z * t)
+        n = isect.pl.vsub(@center)
+        isect.n = n.vnormalize
+      else
+        0.0
+      end
+    end
+    nil
+  end
+end
+
+class Plane
+  def initialize(p, n)
+    @p = p
+    @n = n
+  end
+
+  def intersect(ray, isect)
+    d = -@p.vdot(@n)
+    v = ray.dir.vdot(@n)
+    v0 = v
+    if v < 0.0 then
+      v0 = -v
+    end
+    if v0 < 1.0e-17 then
+      return
+    end
+
+    t = -(ray.org.vdot(@n) + d) / v
+
+    if t > 0.0 and t < isect.t then
+      isect.hit = true
+      isect.t = t
+      isect.n = @n
+      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+                        ray.org.y + t * ray.dir.y,
+                        ray.org.z + t * ray.dir.z)
+    end
+    nil
+  end
+end
+
+class Ray
+  def initialize(org, dir)
+    @org = org
+    @dir = dir
+  end
+
+  attr_accessor :org, :dir
+end
+
+class Isect
+  def initialize
+    @t = 10000000.0
+    @hit = false
+    @pl = Vec.new(0.0, 0.0, 0.0)
+    @n = Vec.new(0.0, 0.0, 0.0)
+  end
+
+  attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+  i = f * 255.5
+  if i > 255.0 then
+    i = 255.0
+  end
+  if i < 0.0 then
+    i = 0.0
+  end
+  i.to_i
+end
+
+def otherBasis(basis, n)
+  basis[2] = Vec.new(n.x, n.y, n.z)
+  basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+  if n.x < 0.6 and n.x > -0.6 then
+    basis[1].x = 1.0
+  elsif n.y < 0.6 and n.y > -0.6 then
+    basis[1].y = 1.0
+  elsif n.z < 0.6 and n.z > -0.6 then
+    basis[1].z = 1.0
+  else
+    basis[1].x = 1.0
+  end
+
+  basis[0] = basis[1].vcross(basis[2])
+  basis[0] = basis[0].vnormalize
+
+  basis[1] = basis[2].vcross(basis[0])
+  basis[1] = basis[1].vnormalize
+end
+
+class Scene
+  def initialize
+    @spheres = Array.new
+    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+  end
+
+  def ambient_occlusion(isect)
+    basis = Array.new
+    otherBasis(basis, isect.n)
+
+    ntheta    = NAO_SAMPLES
+    nphi      = NAO_SAMPLES
+    eps       = 0.0001
+    occlusion = 0.0
+
+    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+                isect.pl.y + eps * isect.n.y,
+                isect.pl.z + eps * isect.n.z)
+    nphi.times do |j|
+      ntheta.times do |i|
+        r = rand
+        phi = 2.0 * 3.14159265 * rand
+        x = Math.cos(phi) * Math.sqrt(1.0 - r)
+        y = Math.sin(phi) * Math.sqrt(1.0 - r)
+        z = Math.sqrt(r)
+
+        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+        raydir = Vec.new(rx, ry, rz)
+        ray = Ray.new(p0, raydir)
+
+        occisect = Isect.new
+        @spheres[0].intersect(ray, occisect)
+        @spheres[1].intersect(ray, occisect)
+        @spheres[2].intersect(ray, occisect)
+        @plane.intersect(ray, occisect)
+        if occisect.hit then
+          occlusion = occlusion + 1.0
+        else
+          0.0
+        end
+      end
+    end
+
+    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+    Vec.new(occlusion, occlusion, occlusion)
+  end
+
+  def render(w, h, nsubsamples)
+    cnt = 0
+    nsf = nsubsamples.to_f
+    h.times do |y|
+      w.times do |x|
+        rad = Vec.new(0.0, 0.0, 0.0)
+
+        # Subsampling
+        nsubsamples.times do |v|
+          nsubsamples.times do |u|
+
+            cnt = cnt + 1
+            wf = w.to_f
+            hf = h.to_f
+            xf = x.to_f
+            yf = y.to_f
+            uf = u.to_f
+            vf = v.to_f
+
+            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+            eye = Vec.new(px, py, -1.0).vnormalize
+
+            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+            isect = Isect.new
+            @spheres[0].intersect(ray, isect)
+            @spheres[1].intersect(ray, isect)
+            @spheres[2].intersect(ray, isect)
+            @plane.intersect(ray, isect)
+            if isect.hit then
+              col = ambient_occlusion(isect)
+              rad.x = rad.x + col.x
+              rad.y = rad.y + col.y
+              rad.z = rad.z + col.z
+            end
+          end
+        end
+
+        r = rad.x / (nsf * nsf)
+        g = rad.y / (nsf * nsf)
+        b = rad.z / (nsf * nsf)
+        printf("%c", clamp(r))
+        printf("%c", clamp(g))
+        printf("%c", clamp(b))
+      end
+      nil
+    end
+
+    nil
+  end
+end
+
+alias printf_orig printf
+def printf *args
+  # $fp.printf(*args)
+end
+
+# File.open("ao.ppm", "w") do |fp|
+  # $fp = fp
+  printf("P6\n")
+  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  printf("255\n")
+  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
new file mode 100644
index 0000000000..31e29b7644
--- /dev/null
+++ b/benchmark/app_erb.yml
@@ -0,0 +1,23 @@
+#
+# Create many HTML strings with ERB.
+#
+prelude: |
+  require 'erb'
+
+  data = <<erb
+  <html>
+    <head> <%= title %> </head>
+    <body>
+      <h1> <%= title %> </h1>
+      <p>
+        <%= content %>
+      </p>
+    </body>
+  </html>
+  erb
+
+  title = "hello world!"
+  content = "hello world!\n" * 10
+benchmark:
+  app_erb: ERB.new(data).result(binding)
+loop_count: 15000
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/app_factorial.rb
index 45f471dfdb..45f471dfdb 100644
--- a/benchmark/bm_app_factorial.rb
+++ b/benchmark/app_factorial.rb
diff --git a/benchmark/bm_app_fib.rb b/benchmark/app_fib.rb
index 34a7b2e725..34a7b2e725 100644
--- a/benchmark/bm_app_fib.rb
+++ b/benchmark/app_fib.rb
diff --git a/benchmark/bm_app_lc_fizzbuzz.rb b/benchmark/app_lc_fizzbuzz.rb
index f09574bbeb..f09574bbeb 100644
--- a/benchmark/bm_app_lc_fizzbuzz.rb
+++ b/benchmark/app_lc_fizzbuzz.rb
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/app_mandelbrot.rb
index 801b75e8e2..801b75e8e2 100644
--- a/benchmark/bm_app_mandelbrot.rb
+++ b/benchmark/app_mandelbrot.rb
diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb
new file mode 100644
index 0000000000..47be7b203f
--- /dev/null
+++ b/benchmark/app_pentomino.rb
@@ -0,0 +1,130 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+  nb.each{|x|
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      [-ROW, -1, 1, ROW].each{|d|
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      }
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  }
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  (0...ROW*COL).each{|i|
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  }
+end
+
+def pboard
+  return # skip print
+  print "No. #$no\n"
+  (0...COL).each{|i|
+    print "|"
+    (0...ROW-NP).each{|j|
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    }
+    print "\n"
+  }
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      x.each{|s|
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      }
+      if f == 0 then
+        x.each{|s|
+          $b[pos+s] = i
+        }
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        x.each{|s|
+          $b[pos+s] = -1
+        }
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/app_raise.rb
index 5db8f95d50..5db8f95d50 100644
--- a/benchmark/bm_app_raise.rb
+++ b/benchmark/app_raise.rb
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/app_strconcat.rb
index 7eed7c1aed..7eed7c1aed 100644
--- a/benchmark/bm_app_strconcat.rb
+++ b/benchmark/app_strconcat.rb
diff --git a/benchmark/bm_app_tak.rb b/benchmark/app_tak.rb
index efe5380f4e..efe5380f4e 100644
--- a/benchmark/bm_app_tak.rb
+++ b/benchmark/app_tak.rb
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/app_tarai.rb
index 4c146f5ccf..4c146f5ccf 100644
--- a/benchmark/bm_app_tarai.rb
+++ b/benchmark/app_tarai.rb
diff --git a/benchmark/bm_app_uri.rb b/benchmark/app_uri.rb
index 586edfd5dc..586edfd5dc 100644
--- a/benchmark/bm_app_uri.rb
+++ b/benchmark/app_uri.rb
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
new file mode 100644
index 0000000000..88ef544ba0
--- /dev/null
+++ b/benchmark/array_flatten.yml
@@ -0,0 +1,19 @@
+prelude: |
+  small_flat_ary = 5.times.to_a
+  large_flat_ary = 100.times.to_a
+  small_pairs_ary = [[1, 2]] * 5
+  large_pairs_ary = [[1, 2]] * 100
+  mostly_flat_ary = 100.times.to_a.push([101, 102])
+
+benchmark:
+  small_flat_ary.flatten: small_flat_ary.flatten
+  small_flat_ary.flatten!: small_flat_ary.flatten!
+  large_flat_ary.flatten: large_flat_ary.flatten
+  large_flat_ary.flatten!: large_flat_ary.flatten!
+  small_pairs_ary.flatten: small_pairs_ary.flatten
+  small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
+  large_pairs_ary.flatten: large_pairs_ary.flatten
+  large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
+  mostly_flat_ary.flatten: mostly_flat_ary.flatten
+  mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
+loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
new file mode 100644
index 0000000000..26705323fd
--- /dev/null
+++ b/benchmark/array_intersection.yml
@@ -0,0 +1,14 @@
+prelude: |
+  small1 = [1, 2, 3]
+  small2 = [1, 2, 3, 4, 5]
+  small3 = [2, 3, 4, 5]
+  small4 = [2]
+  big1 = [1, 2, 3, 4] * 64
+  big2 = [1, 2, 3] * 64
+  big3 = [1, 2] * 64
+
+benchmark:
+  small-&: small1 & small2 & small3 & small4
+  small-intersection: small1.intersection(small2, small3, small4)
+  big-&: big1 & big2 & big3
+  big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_max_float.yml b/benchmark/array_max_float.yml
new file mode 100644
index 0000000000..ace1ae2e14
--- /dev/null
+++ b/benchmark/array_max_float.yml
@@ -0,0 +1,30 @@
+prelude: |
+  ary2 = 2.times.map(&:to_f).shuffle
+  ary10 = 10.times.map(&:to_f).shuffle
+  ary100 = 100.times.map(&:to_f).shuffle
+  ary500 = 500.times.map(&:to_f).shuffle
+  ary1000 = 1000.times.map(&:to_f).shuffle
+  ary2000 = 2500.times.map(&:to_f).shuffle
+  ary3000 = 2500.times.map(&:to_f).shuffle
+  ary5000 = 5000.times.map(&:to_f).shuffle
+  ary10000 = 10000.times.map(&:to_f).shuffle
+  ary20000 = 20000.times.map(&:to_f).shuffle
+  ary50000 = 50000.times.map(&:to_f).shuffle
+  ary100000 = 100000.times.map(&:to_f).shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_max_int.yml b/benchmark/array_max_int.yml
new file mode 100644
index 0000000000..acd83684d0
--- /dev/null
+++ b/benchmark/array_max_int.yml
@@ -0,0 +1,31 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary500 = 500.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary2000 = 2500.times.to_a.shuffle
+  ary3000 = 2500.times.to_a.shuffle
+  ary5000 = 5000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+  ary20000 = 20000.times.to_a.shuffle
+  ary50000 = 50000.times.to_a.shuffle
+  ary100000 = 100000.times.to_a.shuffle
+  ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+  ary1000000.max: ary1000000.max
+
+loop_count: 10000
diff --git a/benchmark/array_max_str.yml b/benchmark/array_max_str.yml
new file mode 100644
index 0000000000..2aeed010f2
--- /dev/null
+++ b/benchmark/array_max_str.yml
@@ -0,0 +1,30 @@
+prelude: |
+  ary2 = 2.times.map(&:to_s).shuffle
+  ary10 = 10.times.map(&:to_s).shuffle
+  ary100 = 100.times.map(&:to_s).shuffle
+  ary500 = 500.times.map(&:to_s).shuffle
+  ary1000 = 1000.times.map(&:to_s).shuffle
+  ary2000 = 2500.times.map(&:to_s).shuffle
+  ary3000 = 2500.times.map(&:to_s).shuffle
+  ary5000 = 5000.times.map(&:to_s).shuffle
+  ary10000 = 10000.times.map(&:to_s).shuffle
+  ary20000 = 20000.times.map(&:to_s).shuffle
+  ary50000 = 50000.times.map(&:to_s).shuffle
+  ary100000 = 100000.times.map(&:to_s).shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_min.yml b/benchmark/array_min.yml
new file mode 100644
index 0000000000..53e5072b14
--- /dev/null
+++ b/benchmark/array_min.yml
@@ -0,0 +1,31 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary500 = 500.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary2000 = 2500.times.to_a.shuffle
+  ary3000 = 2500.times.to_a.shuffle
+  ary5000 = 5000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+  ary20000 = 20000.times.to_a.shuffle
+  ary50000 = 50000.times.to_a.shuffle
+  ary100000 = 100000.times.to_a.shuffle
+  ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+  ary2.min: ary2.min
+  ary10.min: ary10.min
+  ary100.min: ary100.min
+  ary500.min: ary500.min
+  ary1000.min: ary1000.min
+  ary2000.min: ary2000.min
+  ary3000.min: ary3000.min
+  ary5000.min: ary5000.min
+  ary10000.min: ary10000.min
+  ary20000.min: ary20000.min
+  ary50000.min: ary50000.min
+  ary100000.min: ary100000.min
+  ary1000000.min: ary1000000.min
+
+loop_count: 10000
diff --git a/benchmark/array_sample.yml b/benchmark/array_sample.yml
new file mode 100644
index 0000000000..1cd2b34794
--- /dev/null
+++ b/benchmark/array_sample.yml
@@ -0,0 +1,4 @@
+prelude: ary = (1..10_000).to_a
+benchmark:
+  - ary.sample
+  - ary.sample(2)
diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb
new file mode 100644
index 0000000000..5f41ecc32b
--- /dev/null
+++ b/benchmark/array_sample_100k_10.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10}
diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb
new file mode 100644
index 0000000000..18b1715319
--- /dev/null
+++ b/benchmark/array_sample_100k_11.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 11}
diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb
new file mode 100644
index 0000000000..22863afe89
--- /dev/null
+++ b/benchmark/array_sample_100k__100.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 100}
diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb
new file mode 100644
index 0000000000..4cd79e6c67
--- /dev/null
+++ b/benchmark/array_sample_100k__1k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 1000}
diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb
new file mode 100644
index 0000000000..b3d264249e
--- /dev/null
+++ b/benchmark/array_sample_100k__6k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 6000}
diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb
new file mode 100644
index 0000000000..5dd55ec058
--- /dev/null
+++ b/benchmark/array_sample_100k___10k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10_000}
diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb
new file mode 100644
index 0000000000..1506732c3c
--- /dev/null
+++ b/benchmark/array_sample_100k___50k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 50_000}
diff --git a/benchmark/bm_array_shift.rb b/benchmark/array_shift.rb
index 798bb9e3f4..798bb9e3f4 100644
--- a/benchmark/bm_array_shift.rb
+++ b/benchmark/array_shift.rb
diff --git a/benchmark/array_small_and.rb b/benchmark/array_small_and.rb
new file mode 100644
index 0000000000..e53a6edae6
--- /dev/null
+++ b/benchmark/array_small_and.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+  (MIN_SIZE..MAX_SIZE).map do |size2|
+    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+  end
+end
+
+ITERATIONS.times do
+  ARRAYS.each do |group|
+    group.each do |arr1, arr2|
+      arr1 & arr2
+    end
+  end
+end
diff --git a/benchmark/array_small_diff.rb b/benchmark/array_small_diff.rb
new file mode 100644
index 0000000000..9661ee48db
--- /dev/null
+++ b/benchmark/array_small_diff.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+  (MIN_SIZE..MAX_SIZE).map do |size2|
+    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+  end
+end
+
+ITERATIONS.times do
+  ARRAYS.each do |group|
+    group.each do |arr1, arr2|
+      arr1 - arr2
+    end
+  end
+end
diff --git a/benchmark/array_small_or.rb b/benchmark/array_small_or.rb
new file mode 100644
index 0000000000..c58b5fd1ff
--- /dev/null
+++ b/benchmark/array_small_or.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+  (MIN_SIZE..MAX_SIZE).map do |size2|
+    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+  end
+end
+
+ITERATIONS.times do
+  ARRAYS.each do |group|
+    group.each do |arr1, arr2|
+      arr1 | arr2
+    end
+  end
+end
diff --git a/benchmark/array_sort_block.rb b/benchmark/array_sort_block.rb
new file mode 100644
index 0000000000..3579786056
--- /dev/null
+++ b/benchmark/array_sort_block.rb
@@ -0,0 +1,2 @@
+ary = Array.new(1000) { rand(1000) }
+10000.times { ary.sort { |a, b| a <=> b } }
diff --git a/benchmark/array_sort_float.rb b/benchmark/array_sort_float.rb
new file mode 100644
index 0000000000..9a6e2f8bd2
--- /dev/null
+++ b/benchmark/array_sort_float.rb
@@ -0,0 +1,2 @@
+arr = Array.new(1000) { rand }
+10000.times { arr.sort }
diff --git a/benchmark/array_sort_int.yml b/benchmark/array_sort_int.yml
new file mode 100644
index 0000000000..7b9027ebf7
--- /dev/null
+++ b/benchmark/array_sort_int.yml
@@ -0,0 +1,15 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+
+benchmark:
+  ary2.sort: ary2.sort
+  ary10.sort: ary10.sort
+  ary100.sort: ary100.sort
+  ary1000.sort: ary1000.sort
+  ary10000.sort: ary10000.sort
+
+loop_count: 10000
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
new file mode 100644
index 0000000000..6cb394cb9f
--- /dev/null
+++ b/benchmark/array_values_at_int.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
new file mode 100644
index 0000000000..5b53806d1c
--- /dev/null
+++ b/benchmark/array_values_at_range.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/attr_accessor.yml b/benchmark/attr_accessor.yml
new file mode 100644
index 0000000000..82134cdf9b
--- /dev/null
+++ b/benchmark/attr_accessor.yml
@@ -0,0 +1,29 @@
+prelude: |
+  class C
+    attr_accessor :x
+    def initialize
+      @x = nil
+    end
+    class_eval <<-END
+      def ar
+        #{'x;'*256}
+      end
+      def aw
+        #{'self.x = nil;'*256}
+      end
+      def arm
+        m = method(:x)
+        #{'m.call;'*256}
+      end
+      def awm
+        m = method(:x=)
+        #{'m.call(nil);'*256}
+      end
+    END
+  end
+  obj = C.new
+benchmark:
+  attr_reader: "obj.ar"
+  attr_writer: "obj.aw"
+  attr_reader_method: "obj.arm"
+  attr_writer_method: "obj.awm"
diff --git a/benchmark/bighash.rb b/benchmark/bighash.rb
new file mode 100644
index 0000000000..e2ad5a5c94
--- /dev/null
+++ b/benchmark/bighash.rb
@@ -0,0 +1 @@
+h = {}; 5000000.times {|n| h[n] = n }
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
deleted file mode 100644
index ffab116fcd..0000000000
--- a/benchmark/bm_app_aobench.rb
+++ /dev/null
@@ -1,291 +0,0 @@
-# AO render benchmark
-# Original program (C) Syoyo Fujita in Javascript (and other languages)
-#      https://code.google.com/p/aobench/
-# Ruby(yarv2llvm) version by Hideki Miura
-#
-
-IMAGE_WIDTH = 256
-IMAGE_HEIGHT = 256
-NSUBSAMPLES = 2
-NAO_SAMPLES = 8
-
-class Vec
-  def initialize(x, y, z)
-    @x = x
-    @y = y
-    @z = z
-  end
-
-  attr_accessor :x, :y, :z
-
-  def vadd(b)
-    Vec.new(@x + b.x, @y + b.y, @z + b.z)
-  end
-
-  def vsub(b)
-    Vec.new(@x - b.x, @y - b.y, @z - b.z)
-  end
-
-  def vcross(b)
-    Vec.new(@y * b.z - @z * b.y,
-            @z * b.x - @x * b.z,
-            @x * b.y - @y * b.x)
-  end
-
-  def vdot(b)
-    @x * b.x + @y * b.y + @z * b.z
-  end
-
-  def vlength
-    Math.sqrt(@x * @x + @y * @y + @z * @z)
-  end
-
-  def vnormalize
-    len = vlength
-    v = Vec.new(@x, @y, @z)
-    if len > 1.0e-17 then
-      v.x = v.x / len
-      v.y = v.y / len
-      v.z = v.z / len
-    end
-    v
-  end
-end
-
-
-class Sphere
-  def initialize(center, radius)
-    @center = center
-    @radius = radius
-  end
-
-  attr_reader :center, :radius
-
-  def intersect(ray, isect)
-    rs = ray.org.vsub(@center)
-    b = rs.vdot(ray.dir)
-    c = rs.vdot(rs) - (@radius * @radius)
-    d = b * b - c
-    if d > 0.0 then
-      t = - b - Math.sqrt(d)
-
-      if t > 0.0 and t < isect.t then
-        isect.t = t
-        isect.hit = true
-        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
-                          ray.org.y + ray.dir.y * t,
-                          ray.org.z + ray.dir.z * t)
-        n = isect.pl.vsub(@center)
-        isect.n = n.vnormalize
-      else
-        0.0
-      end
-    end
-    nil
-  end
-end
-
-class Plane
-  def initialize(p, n)
-    @p = p
-    @n = n
-  end
-
-  def intersect(ray, isect)
-    d = -@p.vdot(@n)
-    v = ray.dir.vdot(@n)
-    v0 = v
-    if v < 0.0 then
-      v0 = -v
-    end
-    if v0 < 1.0e-17 then
-      return
-    end
-
-    t = -(ray.org.vdot(@n) + d) / v
-
-    if t > 0.0 and t < isect.t then
-      isect.hit = true
-      isect.t = t
-      isect.n = @n
-      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
-                        ray.org.y + t * ray.dir.y,
-                        ray.org.z + t * ray.dir.z)
-    end
-    nil
-  end
-end
-
-class Ray
-  def initialize(org, dir)
-    @org = org
-    @dir = dir
-  end
-
-  attr_accessor :org, :dir
-end
-
-class Isect
-  def initialize
-    @t = 10000000.0
-    @hit = false
-    @pl = Vec.new(0.0, 0.0, 0.0)
-    @n = Vec.new(0.0, 0.0, 0.0)
-  end
-
-  attr_accessor :t, :hit, :pl, :n
-end
-
-def clamp(f)
-  i = f * 255.5
-  if i > 255.0 then
-    i = 255.0
-  end
-  if i < 0.0 then
-    i = 0.0
-  end
-  i.to_i
-end
-
-def otherBasis(basis, n)
-  basis[2] = Vec.new(n.x, n.y, n.z)
-  basis[1] = Vec.new(0.0, 0.0, 0.0)
-
-  if n.x < 0.6 and n.x > -0.6 then
-    basis[1].x = 1.0
-  elsif n.y < 0.6 and n.y > -0.6 then
-    basis[1].y = 1.0
-  elsif n.z < 0.6 and n.z > -0.6 then
-    basis[1].z = 1.0
-  else
-    basis[1].x = 1.0
-  end
-
-  basis[0] = basis[1].vcross(basis[2])
-  basis[0] = basis[0].vnormalize
-
-  basis[1] = basis[2].vcross(basis[0])
-  basis[1] = basis[1].vnormalize
-end
-
-class Scene
-  def initialize
-    @spheres = Array.new
-    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
-    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
-    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
-    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
-  end
-
-  def ambient_occlusion(isect)
-    basis = Array.new
-    otherBasis(basis, isect.n)
-
-    ntheta    = NAO_SAMPLES
-    nphi      = NAO_SAMPLES
-    eps       = 0.0001
-    occlusion = 0.0
-
-    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
-                isect.pl.y + eps * isect.n.y,
-                isect.pl.z + eps * isect.n.z)
-    nphi.times do |j|
-      ntheta.times do |i|
-        r = rand
-        phi = 2.0 * 3.14159265 * rand
-        x = Math.cos(phi) * Math.sqrt(1.0 - r)
-        y = Math.sin(phi) * Math.sqrt(1.0 - r)
-        z = Math.sqrt(r)
-
-        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
-        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
-        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
-
-        raydir = Vec.new(rx, ry, rz)
-        ray = Ray.new(p0, raydir)
-
-        occisect = Isect.new
-        @spheres[0].intersect(ray, occisect)
-        @spheres[1].intersect(ray, occisect)
-        @spheres[2].intersect(ray, occisect)
-        @plane.intersect(ray, occisect)
-        if occisect.hit then
-          occlusion = occlusion + 1.0
-        else
-          0.0
-        end
-      end
-    end
-
-    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
-
-    Vec.new(occlusion, occlusion, occlusion)
-  end
-
-  def render(w, h, nsubsamples)
-    cnt = 0
-    nsf = nsubsamples.to_f
-    h.times do |y|
-      w.times do |x|
-        rad = Vec.new(0.0, 0.0, 0.0)
-
-        # Subsmpling
-        nsubsamples.times do |v|
-          nsubsamples.times do |u|
-
-            cnt = cnt + 1
-            wf = w.to_f
-            hf = h.to_f
-            xf = x.to_f
-            yf = y.to_f
-            uf = u.to_f
-            vf = v.to_f
-
-            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
-            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
-
-            eye = Vec.new(px, py, -1.0).vnormalize
-
-            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
-
-            isect = Isect.new
-            @spheres[0].intersect(ray, isect)
-            @spheres[1].intersect(ray, isect)
-            @spheres[2].intersect(ray, isect)
-            @plane.intersect(ray, isect)
-            if isect.hit then
-              col = ambient_occlusion(isect)
-              rad.x = rad.x + col.x
-              rad.y = rad.y + col.y
-              rad.z = rad.z + col.z
-            end
-          end
-        end
-
-        r = rad.x / (nsf * nsf)
-        g = rad.y / (nsf * nsf)
-        b = rad.z / (nsf * nsf)
-        printf("%c", clamp(r))
-        printf("%c", clamp(g))
-        printf("%c", clamp(b))
-      end
-      nil
-    end
-
-    nil
-  end
-end
-
-alias printf_orig printf
-def printf *args
-end
-
-# File.open("ao.ppm", "w") do |fp|
-  printf("P6\n")
-  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
-  printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
-  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
-# end
-
-undef printf
-alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
deleted file mode 100644
index 77c66a7949..0000000000
--- a/benchmark/bm_app_erb.rb
+++ /dev/null
@@ -1,26 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-
-require 'erb'
-
-data = DATA.read
-max = 15_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-max.times{
-  ERB.new(data).result(binding)
-}
-
-__END__
-
-<html>
-  <head> <%= title %> </head>
-  <body>
-    <h1> <%= title %> </h1>
-    <p>
-      <%= content %>
-    </p>
-  </body>
-</html>
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
deleted file mode 100644
index 59c63f358e..0000000000
--- a/benchmark/bm_app_pentomino.rb
+++ /dev/null
@@ -1,259 +0,0 @@
-#!/usr/local/bin/ruby
-# This program is contributed by Shin Nishiyama
-
-
-# modified by K.Sasada
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n, a, nb)
-  nb.each{|x|
-    a[n] = x
-    if n == NP-1
-      $p << [a.sort]
-    else
-      nbc=nb.dup
-      [-ROW, -1, 1, ROW].each{|d|
-        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
-          nbc << x+d
-        end
-      }
-      nbc.delete x
-      piece(n+1,a[0..n],nbc)
-    end
-  }
-end
-
-def kikaku(a)
-  a.collect {|x| x - a[0]}
-end
-def ud(a)
-  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
-  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
-  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
-  piece(0,[],[0])
-  $p.each do |a|
-    a0 = a[0]
-    a[1] = ud(a0)
-    a[2] = rl(a0)
-    a[3] = ud(rl(a0))
-    a[4] = xy(a0)
-    a[5] = ud(xy(a0))
-    a[6] = rl(xy(a0))
-    a[7] = ud(rl(xy(a0)))
-    a.sort!
-    a.uniq!
-  end
-  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
-  (0...ROW*COL).each{|i|
-    if i % ROW >= ROW-NP
-      $b[i] = -2
-    else
-      $b[i] = -1
-    end
-    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
-  }
-end
-
-def pboard
-  return # skip print
-  print "No. #$no\n"
-  (0...COL).each{|i|
-    print "|"
-    (0...ROW-NP).each{|j|
-      x = $b[i*ROW+j]
-      if x < 0
-        print "..|"
-      else
-        printf "%2d|",x+1
-      end
-    }
-    print "\n"
-  }
-  print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
-  if a.length == $p.length then
-    $no += 1
-    pboard
-    return
-  end
-  while $b[pos] != -1
-    pos += 1
-  end
-  ($pnum - a).each do |i|
-    $p[i].each do |x|
-      f = 0
-      x.each{|s|
-        if $b[pos+s] != -1
-          f=1
-          break
-        end
-      }
-      if f == 0 then
-        x.each{|s|
-          $b[pos+s] = i
-        }
-        a << i
-        setpiece(a.dup, pos)
-        a.pop
-        x.each{|s|
-          $b[pos+s] = -1
-        }
-      end
-    end
-  end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
-
-
-__END__
-
-# original
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n,a,nb)
-  for x in nb
-    a[n] = x
-    if n == NP-1
-      $p << [a.sort]
-    else
-      nbc=nb.dup
-      for d in [-ROW, -1, 1, ROW]
-        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
-          nbc << x+d
-        end
-      end
-      nbc.delete x
-      piece(n+1,a[0..n],nbc)
-    end
-  end
-end
-
-def kikaku(a)
-  a.collect {|x| x - a[0]}
-end
-def ud(a)
-  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
-  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
-  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
-  piece(0,[],[0])
-  $p.each do |a|
-    a0 = a[0]
-    a[1] = ud(a0)
-    a[2] = rl(a0)
-    a[3] = ud(rl(a0))
-    a[4] = xy(a0)
-    a[5] = ud(xy(a0))
-    a[6] = rl(xy(a0))
-    a[7] = ud(rl(xy(a0)))
-    a.sort!
-    a.uniq!
-  end
-  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
-  for i in 0...ROW*COL
-    if i % ROW >= ROW-NP
-      $b[i] = -2
-    else
-      $b[i] = -1
-    end
-    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
-  end
-end
-
-def pboard
-  print "No. #$no\n"
-  for i in 0...COL
-    print "|"
-    for j in 0...ROW-NP
-      x = $b[i*ROW+j]
-      if x < 0
-        print "..|"
-      else
-        printf "%2d|",x+1
-      end
-    end
-    print "\n"
-  end
-  print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
-  if a.length == $p.length then
-    $no += 1
-    pboard
-    return
-  end
-  while $b[pos] != -1
-    pos += 1
-  end
-  ($pnum - a).each do |i|
-    $p[i].each do |x|
-      f = 0
-      for s in x do
-        if $b[pos+s] != -1
-          f=1
-          break
-        end
-      end
-      if f == 0 then
-        for s in x do
-          $b[pos+s] = i
-        end
-        a << i
-        setpiece(a.dup, pos)
-        a.pop
-        for s in x do
-          $b[pos+s] = -1
-        end
-      end
-    end
-  end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
deleted file mode 100644
index 7db5be9050..0000000000
--- a/benchmark/bm_so_ackermann.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-def ack(m, n)
-    if m == 0 then
-        n + 1
-    elsif n == 0 then
-        ack(m - 1, 1)
-    else
-        ack(m - 1, ack(m, n - 1))
-    end
-end
-
-NUM = 9
-ack(3, NUM)
-
-
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
deleted file mode 100644
index 2b8fce8f99..0000000000
--- a/benchmark/bm_so_array.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan and Mark Hubbart
-
-n = 9000 # Integer(ARGV.shift || 1)
-
-x = Array.new(n)
-y = Array.new(n, 0)
-
-n.times{|bi|
-  x[bi] = bi + 1
-}
-
-(0 .. 999).each do |e|
-  (n-1).step(0,-1) do |bi|
-    y[bi] += x.at(bi)
-  end
-end
-# puts "#{y.first} #{y.last}"
-
-
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
deleted file mode 100644
index 873214de7c..0000000000
--- a/benchmark/bm_so_concatenate.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
-
-STUFF = "hello\n"
-i = 0
-while i<10
-  i += 1
-  hello = ''
-  4_000_000.times do |e|
-    hello << STUFF
-  end
-end
-# puts hello.length
-
-
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
deleted file mode 100644
index 65f6337a4a..0000000000
--- a/benchmark/bm_so_count_words.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan
-
-input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
-
-nl = nw = nc = 0
-while true
-  tmp = input.read(4096) or break
-  data = tmp << (input.gets || "")
-  nc += data.length
-  nl += data.count("\n")
-  ((data.strip! || data).tr!("\n", " ") || data).squeeze!
-  nw += data.count(" ") + 1
-end
-# STDERR.puts "#{nl} #{nw} #{nc}"
-
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
deleted file mode 100644
index deb003a594..0000000000
--- a/benchmark/bm_so_exception.rb
+++ /dev/null
@@ -1,61 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-$HI = 0
-$LO = 0
-NUM = 250000 # Integer(ARGV[0] || 1)
-
-
-class Lo_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-class Hi_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-def some_function(num)
-  begin
-    hi_function(num)
-  rescue
-    print "We shouldn't get here, exception is: #{$!.type}\n"
-  end
-end
-
-def hi_function(num)
-  begin
-    lo_function(num)
-  rescue Hi_Exception
-    $HI = $HI + 1
-  end
-end
-
-def lo_function(num)
-  begin
-    blowup(num)
-  rescue Lo_Exception
-    $LO = $LO + 1
-  end
-end
-
-def blowup(num)
-  if num % 2 == 0
-    raise Lo_Exception.new(num)
-  else
-    raise Hi_Exception.new(num)
-  end
-end
-
-
-i = 1
-max = NUM+1
-while i < max
-  i += 1
-  some_function(i+1)
-end
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
deleted file mode 100644
index 3f759ba7ae..0000000000
--- a/benchmark/bm_so_fasta.rb
+++ /dev/null
@@ -1,81 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-$last = 42.0
-def gen_random (max,im=139968,ia=3877,ic=29573)
-    (max * ($last = ($last * ia + ic) % im)) / im
-end
-
-alu =
-   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
-   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
-   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
-   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
-   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
-   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
-   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-iub = [
-    ["a", 0.27],
-    ["c", 0.12],
-    ["g", 0.12],
-    ["t", 0.27],
-
-    ["B", 0.02],
-    ["D", 0.02],
-    ["H", 0.02],
-    ["K", 0.02],
-    ["M", 0.02],
-    ["N", 0.02],
-    ["R", 0.02],
-    ["S", 0.02],
-    ["V", 0.02],
-    ["W", 0.02],
-    ["Y", 0.02],
-]
-homosapiens = [
-    ["a", 0.3029549426680],
-    ["c", 0.1979883004921],
-    ["g", 0.1975473066391],
-    ["t", 0.3015094502008],
-]
-
-def make_repeat_fasta(id, desc, src, n)
-    puts ">#{id} #{desc}"
-    v = nil
-    width = 60
-    l = src.length
-    s = src * ((n / l) + 1)
-    s.slice!(n, l)
-    puts(s.scan(/.{1,#{width}}/).join("\n"))
-end
-
-def make_random_fasta(id, desc, table, n)
-    puts ">#{id} #{desc}"
-    rand, v = nil,nil
-    width = 60
-    chunk = 1 * width
-    prob = 0.0
-    table.each{|v| v[1]= (prob += v[1])}
-    for i in 1..(n/width)
-        puts((1..width).collect{
-            rand = gen_random(1.0)
-            table.find{|v| v[1]>rand}[0]
-        }.join)
-    end
-    if n%width != 0
-        puts((1..(n%width)).collect{
-            rand = gen_random(1.0)
-            table.find{|v| v[1]>rand}[0]
-        }.join)
-    end
-end
-
-
-n = (ARGV[0] or 250_000).to_i
-
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
deleted file mode 100644
index dadab3e79c..0000000000
--- a/benchmark/bm_so_k_nucleotide.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
-    n, table = seq.length - length + 1, Hash.new(0)
-    f, i = nil, nil
-    (0 ... length).each do |f|
-        (f ... n).step(length) do |i|
-            table[seq[i,length]] += 1
-        end
-    end
-    [n,table]
-
-end
-
-def sort_by_freq( seq,length )
-    n,table = frecuency( seq,length )
-    a, b, v = nil, nil, nil
-    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
-        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
-    end
-    puts
-end
-
-def find_seq( seq,s )
-    n,table = frecuency( seq,s.length )
-    puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
-    seq << line.chomp
-    line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
deleted file mode 100644
index e2c5c8e559..0000000000
--- a/benchmark/bm_so_matrix.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-n = 60 #Integer(ARGV.shift || 1)
-
-size = 40
-
-def mkmatrix(rows, cols)
-    count = 1
-    mx = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            row[j] = count
-            count += 1
-        end
-        mx[bi] = row
-    end
-    mx
-end
-
-def mmult(rows, cols, m1, m2)
-    m3 = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            val = 0
-            (0 .. (cols - 1)).each do |k|
-                val += m1.at(bi).at(k) * m2.at(k).at(j)
-            end
-            row[j] = val
-        end
-        m3[bi] = row
-    end
-    m3
-end
-
-m1 = mkmatrix(size, size)
-m2 = mkmatrix(size, size)
-mm = Array.new
-n.times do
-    mm = mmult(size, size, m1, m2)
-end
-# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
-
-
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
deleted file mode 100644
index 17e9c046a8..0000000000
--- a/benchmark/bm_so_meteor_contest.rb
+++ /dev/null
@@ -1,564 +0,0 @@
-#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-#   http://shootout.alioth.debian.org
-#   contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM:  the main body is at the bottom.
-#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-#   2) see how I represent a board as a bitmask by reading the blank_board comments
-#   3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
-  # an array (by location) containing a bit mask for how the piece maps at the given location.
-  # if the rotation is invalid at that location the mask will contain false
-  attr_reader :start_masks
-
-  # maps a direction to a relative location.  these differ depending on whether it is an even or
-  # odd row being mapped from
-  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
-  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
-  def initialize( directions )
-    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
-    @even_mask = mask_for_offsets( @even_offsets)
-    @odd_mask = mask_for_offsets( @odd_offsets)
-
-    @start_masks = Array.new(60)
-
-    # create the rotational masks by placing the base mask at the location and seeing if
-    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
-    # is true the piece cannot be placed
-    0.upto(59) do | offset |
-      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
-      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
-        imask = compute_required( mask, offset)
-        @start_masks[offset] = [ mask, imask, imask | mask ]
-      else
-        @start_masks[offset] = false
-      end
-    end
-  end
-
-  def compute_required( mask, offset )
-    board = blank_board
-    0.upto(offset) { | i | board |= 1 << i }
-    board |= mask
-    return 0 if (!prunable(board | mask, offset))
-    board = flood_fill(board,58)
-    count = 0
-    imask = 0
-    0.upto(59) do | i |
-      if (board[i] == 0) then
-        imask |= (1 << i)
-        count += 1
-      end
-    end
-    (count > 0 && count < 5) ? imask : 0
-  end
-
-  def flood_fill( board, location)
-    return board if (board[location] == 1)
-    board |= 1 << location
-    row, col = location.divmod(6)
-    board = flood_fill( board, location - 1) if (col > 0)
-    board = flood_fill( board, location + 1) if (col < 4)
-    if (row % 2 == 0) then
-      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
-    else
-      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
-    end
-    board
-  end
-
-  # given a location, produces a list of relative locations covered by the piece at this rotation
-  def offsets( location)
-    if is_even( location) then
-      @even_offsets.collect { | value | value + location }
-    else
-      @odd_offsets.collect { | value | value + location }
-    end
-  end
-
-  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
-  # this is hard to explain. imagine we have this partial board:
-  #   0 0 0 0 0 x        [positions 0-5]
-  #    0 0 1 1 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 1 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # The top-left of the piece is at position 8, the
-  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
-  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
-  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
-  #   0 0 0 1 1 x        [positions 0-5]
-  #    0 0 1 0 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 0 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
-  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
-  # this function would return
-  def normalize_offsets( values)
-    min = values.min
-    even_min = is_even(min)
-    other_min = even_min ? min + 6 : min + 7
-    other_values = values.collect do | value |
-      if is_even(value) then
-        value + 6 - other_min
-      else
-        value + 7 - other_min
-      end
-    end
-    values.collect! { | value | value - min }
-
-    if even_min then
-      [values, other_values]
-    else
-      [other_values, values]
-    end
-  end
-
-  # produce a bitmask representation of an array of offset locations
-  def mask_for_offsets( offsets )
-    mask = 0
-    offsets.each { | value | mask = mask + ( 1 << value ) }
-    mask
-  end
-
-  # finds a "safe" position that a position as described by a list of directions can be placed
-  # without falling off any edge of the board.  the values returned a location to place the first piece
-  # at so it will fit after making the described moves
-  def start_adjust( directions )
-    south = east = 0;
-    directions.each do | direction |
-      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
-      south += 1 if ( direction == :nw || direction == :ne )
-    end
-    south * 6 + east
-  end
-
-  # given a set of directions places the piece (as defined by a set of directions) on the board at
-  # a location that will not take it off the edge
-  def get_values ( directions )
-    start = start_adjust(directions)
-    values = [ start ]
-    directions.each do | direction |
-      if (start % 12 >= 6) then
-        start += @@rotation_odd_adder[direction]
-      else
-        start += @@rotation_even_adder[direction]
-      end
-      values += [ start ]
-    end
-
-    # some moves take you back to an existing location, we'll strip duplicates
-    values.uniq
-  end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-#   rotations -- all the rotations of the piece
-#   type -- a numeic "name" of the piece
-#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
-#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
-  attr_reader :rotations, :type, :masks
-  attr_accessor :placed
-
-  # transform hashes that change one direction into another when you either flip or rotate a set of directions
-  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
-  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
-  def initialize( directions, type )
-    @type = type
-    @rotations = Array.new();
-    @map = {}
-
-    generate_rotations( directions )
-    directions.collect! { | value | @@flip_converter[value] }
-    generate_rotations( directions )
-
-    # creates the masks AND a map that returns [location, rotation] for any given mask
-    # this is used when a board is found and we want to draw it, otherwise the map is unused
-    @masks = Array.new();
-    0.upto(59) do | i |
-      even = true
-      @masks[i] = @rotations.collect do | rotation |
-        mask = rotation.start_masks[i]
-        @map[mask[0]] = [ i, rotation ] if (mask)
-        mask || nil
-      end
-      @masks[i].compact!
-    end
-  end
-
-  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
-  def generate_rotations( directions )
-    6.times do
-      rotations.push( Rotation.new(directions))
-      directions.collect! { | value | @@rotate_converter[value] }
-    end
-  end
-
-  # given a board string, adds this piece to the board at whatever location/rotation
-  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
-  def fill_string( board_string)
-    location, rotation = @map[@placed]
-    rotation.offsets(location).each do | offset |
-      row, col = offset.divmod(6)
-      board_string[ row*5 + col, 1 ] = @type.to_s
-    end
-  end
-end
-
-# a blank bit board having this form:
-#
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
-  0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
-  0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
-  (location % 12) < 6
-end
-
-# support function that create three utility maps:
-#  $converter -- for each row an array that maps a five bit row (via array mapping)
-#                to the a a five bit representation of the bits below it
-#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-#                   a region array has three values the first is a mask of bits in the region,
-#                   the second is the count of those bits and the third is identical to the first
-#                   examples:
-#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-#                           0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
-  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
-  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
-  all_odds = Array.new(0b100000)
-  all_evens = Array.new(0b100000)
-  bit_counts = Array.new(0b100000)
-  new_regions = Array.new(0b100000)
-  0.upto(0b11111) do | i |
-    bit_count = odd = even = 0
-    0.upto(4) do | bit |
-      if (i[bit] == 1) then
-        bit_count += 1
-        odd |= odd_map[bit]
-        even |= even_map[bit]
-      end
-    end
-    all_odds[i] = odd
-    all_evens[i] = even
-    bit_counts[i] = bit_count
-    new_regions[i] = create_regions( i)
-  end
-
-  $converter = []
-  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
-  $bit_counts = bit_counts
-  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five.  The following board is an example of a prunable board:
-#    0 0 1 0 0
-#     0 1 0 0 0
-#    1 1 0 0 0
-#     0 1 0 0 0
-#    0 0 0 0 0
-#       ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
-#   location -- starting location, everything above and to the left is already full
-#   slotting -- set to true only when testing initial pieces, when filling normally
-#               additional assumptions are possible
-#
-# Algorithm:
-#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
-#    maintainng counts of active open areas (kept in the collector array) each collector contains
-#    three values at the start of an iteration:
-#          0: mask of bits that would be adjacent to the collector in this row
-#          1: the number of bits collected so far
-#          2: a scratch space starting as zero, but used during the computation to represent
-#             the empty bits in the new row that are adjacent (position 0)
-#  The exact procedure is described in-code
-def prunable( board, location, slotting = false)
-  collectors = []
-  # loop across the rows
-  (location / 6).to_i.upto(9) do | row_on |
-    # obtain a set of regions representing the bits of the current row.
-    regions = $regions[(board >> (row_on * 6)) & 0b11111]
-    converter = $converter[row_on]
-
-    # track the number of collectors at the start of the cycle so that
-    # we don't compute against newly created collectors, only existing collectors
-    initial_collector_count = collectors.length
-
-    # loop against the regions.  For each region of the row
-    # we will see if it connects to one or more existing collectors.
-    # if it connects to 1 collector, the bits from the region are added to the
-    # bits of the collector and the mask is placed in collector[2]
-    # If the region overlaps more than one collector then all the collectors
-    # it overlaps with are merged into the first one (the others are set to nil in the array)
-    # if NO collectors are found then the region is copied as a new collector
-    regions.each do | region |
-      collector_found = nil
-      region_mask = region[2]
-      initial_collector_count.times do | collector_num |
-        collector = collectors[collector_num]
-        if (collector) then
-          collector_mask = collector[0]
-          if (collector_mask & region_mask != 0) then
-            if (collector_found) then
-              collector_found[0] |= collector_mask
-              collector_found[1] += collector[1]
-              collector_found[2] |= collector[2]
-              collectors[collector_num] = nil
-            else
-              collector_found = collector
-              collector[1] += region[1]
-              collector[2] |= region_mask
-            end
-          end
-        end
-      end
-      if (collector_found == nil) then
-        collectors.push(Array.new(region))
-      end
-    end
-
-    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
-    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
-    # the board is prunable.  if it is a multiple of five it is removed.
-    # Collector that are still active have a new adjacent value [0] set based n the matched bits
-    # and have [2] cleared out for the next cycle.
-    collectors.length.times do | collector_num |
-      collector = collectors[collector_num]
-      if (collector) then
-        if (collector[2] == 0) then
-          return true if (collector[1] % 5 != 0)
-          collectors[collector_num] = nil
-        else
-          # if a collector matches all bits in the row then we can return unprunable early for the
-          # following reasons:
-          #    1) there can be no more unavailable bits bince we fill from the top left downward
-          #    2) all previous regions have been closed or joined so only this region can fail
-          #    3) this region must be good since there can never be only 1 region that is nuot
-          #       a multiple of five
-          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
-          # in pieces to see what configurations work for them (the only other time this algorithm is used).
-          return false if (collector[2] == 0b11111 && !slotting)
-          collector[0] = converter[collector[2]]
-          collector[2] = 0
-        end
-      end
-    end
-
-    # get rid of all the empty converters for the next round
-    collectors.compact!
-  end
-  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
-  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask.  see prunable for what a "region" is
-def create_regions( value )
-  regions = []
-  cur_region = 0
-  5.times do | bit |
-    if (value[bit] == 0) then
-      cur_region |= 1 << bit
-    else
-      if (cur_region != 0 ) then
-        regions.push( cur_region)
-        cur_region = 0;
-      end
-    end
-  end
-  regions.push(cur_region) if (cur_region != 0)
-  regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
-  find_top( 1)
-  find_top( 0)
-  print_results
-end
-
-# show the board
-def print_results
-  print "#{@boards_found} solutions found\n\n"
-  print_full_board( @min_board)
-  print "\n"
-  print_full_board( @max_board)
-  print "\n"
-end
-
-# finds solutions.  This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece.  It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
-#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
-#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
-#   diminsh over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
-#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-#   maximum number
-def find_top( rotation_skip)
-  board = blank_board
-  (@pieces.length-1).times do
-    piece = @pieces.shift
-    piece.masks[0].each do | mask, imask, cmask |
-      if ((rotation_skip += 1) % 2 == 0) then
-        piece.placed = mask
-        find( 1, 1, board | mask)
-      end
-    end
-    @pieces.push(piece)
-  end
-  piece = @pieces.shift
-  @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-#  start_location -- where to start looking for place for the next piece at
-#  placed -- number of pieces placed
-#  board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
-  # find the next location to place a piece by looking for an empty bit
-  while board[start_location] == 1
-    start_location += 1
-  end
-
-  @pieces.length.times do
-    piece = @pieces.shift
-    piece.masks[start_location].each do | mask, imask, cmask |
-      if ( board & cmask == imask) then
-        piece.placed = mask
-        if (placed == 9) then
-          add_board
-        else
-          find( start_location + 1, placed + 1, board | mask)
-        end
-      end
-    end
-    @pieces.push(piece)
-  end
-end
-
-# print the board
-def print_full_board( board_string)
-  10.times do | row |
-    print " " if (row % 2 == 1)
-    5.times do | col |
-      print "#{board_string[row*5 + col,1]} "
-    end
-    print "\n"
-  end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
-  board_string = "99999999999999999999999999999999999999999999999999"
-  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
-  save( board_string)
-  save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
-  if (@all_boards[board_string] == nil) then
-    @min_board = board_string if (board_string < @min_board)
-    @max_board = board_string if (board_string > @max_board)
-    @all_boards.store(board_string,true)
-    @boards_found += 1
-
-    # the exit motif is a time saver.  Ideally the function should return, but those tests
-    # take noticeable time (performance).
-    if (@boards_found == @stop_count) then
-      print_results
-      exit(0)
-    end
-  end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
-  Piece.new( [ :nw, :ne, :east, :east ], 2),
-  Piece.new( [ :ne, :se, :east, :ne ], 7),
-  Piece.new( [ :ne, :east, :ne, :nw ], 1),
-  Piece.new( [ :east, :sw, :sw, :se ], 6),
-  Piece.new( [ :east, :ne, :se, :ne ], 5),
-  Piece.new( [ :east, :east, :east, :se ], 0),
-  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
-  Piece.new( [ :se, :se, :se, :west ], 9),
-  Piece.new( [ :se, :se, :east, :se ], 8),
-  Piece.new( [ :east, :east, :sw, :se ], 3)
-  ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
-
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
deleted file mode 100644
index d6c5bb9e61..0000000000
--- a/benchmark/bm_so_nbody.rb
+++ /dev/null
@@ -1,148 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
- attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
- def initialize(x, y, z, vx, vy, vz, mass)
-  @x, @y, @z = x, y, z
-  @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
-  @mass = mass * SOLAR_MASS
- end
-
- def move_from_i(bodies, nbodies, dt, i)
-  while i < nbodies
-   b2 = bodies[i]
-   dx = @x - b2.x
-   dy = @y - b2.y
-   dz = @z - b2.z
-
-   distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-   mag = dt / (distance * distance * distance)
-   b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
-   @vx -= dx * b2_mass_mag
-   @vy -= dy * b2_mass_mag
-   @vz -= dz * b2_mass_mag
-   b2.vx += dx * b_mass_mag
-   b2.vy += dy * b_mass_mag
-   b2.vz += dz * b_mass_mag
-   i += 1
-  end
-
-  @x += dt * @vx
-  @y += dt * @vy
-  @z += dt * @vz
- end
-end
-
-def energy(bodies)
-  e = 0.0
-  nbodies = bodies.size
-
-  for i in 0 ... nbodies
-    b = bodies[i]
-    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
-    for j in (i + 1) ... nbodies
-      b2 = bodies[j]
-      dx = b.x - b2.x
-      dy = b.y - b2.y
-      dz = b.z - b2.z
-      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-      e -= (b.mass * b2.mass) / distance
-    end
-  end
-  e
-end
-
-def offset_momentum(bodies)
-  px, py, pz = 0.0, 0.0, 0.0
-
-  for b in bodies
-    m = b.mass
-    px += b.vx * m
-    py += b.vy * m
-    pz += b.vz * m
-  end
-
-  b = bodies[0]
-  b.vx = - px / SOLAR_MASS
-  b.vy = - py / SOLAR_MASS
-  b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
-  # sun
-  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
-  # jupiter
-  Planet.new(
-    4.84143144246472090e+00,
-    -1.16032004402742839e+00,
-    -1.03622044471123109e-01,
-    1.66007664274403694e-03,
-    7.69901118419740425e-03,
-    -6.90460016972063023e-05,
-    9.54791938424326609e-04),
-
-  # saturn
-  Planet.new(
-    8.34336671824457987e+00,
-    4.12479856412430479e+00,
-    -4.03523417114321381e-01,
-    -2.76742510726862411e-03,
-    4.99852801234917238e-03,
-    2.30417297573763929e-05,
-    2.85885980666130812e-04),
-
-  # uranus
-  Planet.new(
-    1.28943695621391310e+01,
-    -1.51111514016986312e+01,
-    -2.23307578892655734e-01,
-    2.96460137564761618e-03,
-    2.37847173959480950e-03,
-    -2.96589568540237556e-05,
-    4.36624404335156298e-05),
-
-  # neptune
-  Planet.new(
-    1.53796971148509165e+01,
-    -2.59193146099879641e+01,
-    1.79258772950371181e-01,
-    2.68067772490389322e-03,
-    1.62824170038242295e-03,
-    -9.51592254519715870e-05,
-    5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
-  i = 0
-  while i < nbodies
-    b = BODIES[i]
-    b.move_from_i(BODIES, nbodies, dt, i + 1)
-    i += 1
-  end
-end
-
-puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
deleted file mode 100644
index a0513f8c47..0000000000
--- a/benchmark/bm_so_nested_loop.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# from Avi Bryant
-
-n = 16 # Integer(ARGV.shift || 1)
-x = 0
-n.times do
-    n.times do
-        n.times do
-            n.times do
-                n.times do
-                    n.times do
-                        x += 1
-                    end
-                end
-            end
-        end
-    end
-end
-# puts x
-
-
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
deleted file mode 100644
index e8607c7199..0000000000
--- a/benchmark/bm_so_object.rb
+++ /dev/null
@@ -1,56 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Aristarkh Zagorodnikov
-
-class Toggle
-    def initialize(start_state)
-        @bool = start_state
-    end
-
-    def value
-        @bool
-    end
-
-    def activate
-        @bool = !@bool
-        self
-    end
-end
-
-class NthToggle < Toggle
-    def initialize(start_state, max_counter)
-        super start_state
-        @count_max = max_counter
-        @counter = 0
-    end
-
-    def activate
-        @counter += 1
-        if @counter >= @count_max
-            @bool = !@bool
-            @counter = 0
-        end
-        self
-    end
-end
-
-n = 1500000 # (ARGV.shift || 1).to_i
-
-toggle = Toggle.new 1
-5.times do
-    toggle.activate.value ? 'true' : 'false'
-end
-n.times do
-    toggle = Toggle.new 1
-end
-
-ntoggle = NthToggle.new 1, 3
-8.times do
-    ntoggle.activate.value ? 'true' : 'false'
-end
-n.times do
-    ntoggle = NthToggle.new 1, 3
-end
-
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
deleted file mode 100644
index c7d6fbfb4d..0000000000
--- a/benchmark/bm_so_pidigits.rb
+++ /dev/null
@@ -1,92 +0,0 @@
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Gabriele Renzi
-
-class PiDigitSpigot
-
-    def initialize()
-        @z = Transformation.new 1,0,0,1
-        @x = Transformation.new 0,0,0,0
-        @inverse = Transformation.new 0,0,0,0
-    end
-
-    def next!
-        @y = @z.extract(3)
-        if safe? @y
-            @z = produce(@y)
-            @y
-        else
-            @z = consume @x.next!()
-            next!()
-        end
-    end
-
-    def safe?(digit)
-        digit == @z.extract(4)
-    end
-
-    def produce(i)
-        @inverse.qrst(10,-10*i,0,1).compose(@z)
-    end
-
-    def consume(a)
-        @z.compose(a)
-    end
-end
-
-
-class Transformation
-    attr_reader :q, :r, :s, :t
-    def initialize (q, r, s, t)
-        @q,@r,@s,@t,@k = q,r,s,t,0
-    end
-
-    def next!()
-        @q = @k = @k + 1
-        @r = 4 * @k + 2
-        @s = 0
-        @t = 2 * @k + 1
-        self
-    end
-
-    def extract(j)
-        (@q * j + @r) / (@s * j + @t)
-    end
-
-    def compose(a)
-        self.class.new( @q * a.q,
-                        @q * a.r + r * a.t,
-                        @s * a.q + t * a.s,
-                        @s * a.r + t * a.t
-                    )
-    end
-
-    def qrst *args
-        initialize *args
-        self
-    end
-
-
-end
-
-
-WIDTH = 10
-n = 2_500 # Integer(ARGV[0])
-j = 0
-
-digits = PiDigitSpigot.new
-
-while n > 0
-    if n >= WIDTH
-        WIDTH.times {print digits.next!}
-        j += WIDTH
-    else
-        n.times {print digits.next!}
-        (WIDTH-n).times {print " "}
-        j += n
-    end
-    puts "\t:"+j.to_s
-    n -= WIDTH
-end
-
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
deleted file mode 100644
index 82ea666994..0000000000
--- a/benchmark/bm_so_reverse_complement.rb
+++ /dev/null
@@ -1,30 +0,0 @@
-#!/usr/bin/ruby
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# Contributed by Peter Bjarke Olsen
-# Modified by Doug King
-
-seq=Array.new
-
-def revcomp(seq)
-  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
-  stringlen=seq.length
-  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-while input.gets
-  if $_ =~ />/
-    if seq.length != 0
-      revcomp(seq.join)
-      seq=Array.new
-    end
-    puts $_
-  else
-    $_.sub(/\n/,'')
-    seq.push $_
-  end
-end
-revcomp(seq.join)
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
deleted file mode 100644
index 16906f3605..0000000000
--- a/benchmark/bm_vm1_attr_ivar.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
-  attr_reader :a, :b
-  def initialize
-    @a = nil
-    @b = nil
-  end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = obj.a
-  k = obj.b
-end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
deleted file mode 100644
index 7e7a6b48c0..0000000000
--- a/benchmark/bm_vm1_attr_ivar_set.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
-  attr_accessor :a, :b
-  def initialize
-    @a = nil
-    @b = nil
-  end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  obj.a = 1
-  obj.b = 2
-end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
deleted file mode 100644
index a9f56b15ea..0000000000
--- a/benchmark/bm_vm1_block.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
-  yield
-end
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  m{
-  }
-end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
deleted file mode 100644
index ac59ebccf1..0000000000
--- a/benchmark/bm_vm1_const.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-Const = 1
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = Const
-  k = Const
-end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
deleted file mode 100644
index a1596145f2..0000000000
--- a/benchmark/bm_vm1_ensure.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-i = 0
-while i<30_000_000 # benchmark loop 1
-  i += 1
-  begin
-    begin
-    ensure
-    end
-  ensure
-  end
-end
-
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
deleted file mode 100644
index d4581439ff..0000000000
--- a/benchmark/bm_vm1_float_simple.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0.0; f = 0.0
-while i<30_000_000
-  i += 1
-  f += 0.1; f -= 0.1
-  f += 0.1; f -= 0.1
-  f += 0.1; f -= 0.1
-end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
deleted file mode 100644
index e78bca5668..0000000000
--- a/benchmark/bm_vm1_gc_short_lived.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
deleted file mode 100644
index b66052dee0..0000000000
--- a/benchmark/bm_vm1_gc_short_with_complex_long.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-def nested_hash h, n
-  if n == 0
-    ''
-  else
-    10.times{
-      h[Object.new] = nested_hash(h, n-1)
-    }
-  end
-end
-
-long_lived = Hash.new
-nested_hash long_lived, 6
-
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
-
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
deleted file mode 100644
index 298dbc845b..0000000000
--- a/benchmark/bm_vm1_gc_short_with_long.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-long_lived = Array.new(1_000_000){|i| "#{i}"}
-GC.start
-GC.start
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
deleted file mode 100644
index 6b15c1b7bf..0000000000
--- a/benchmark/bm_vm1_gc_short_with_symbol.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# make many symbols
-50_000.times{|i| sym = "sym#{i}".to_sym}
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
deleted file mode 100644
index 881528845b..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-short_lived_ary = []
-
-if RUBY_VERSION >= "2.2.0"
-  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  short_lived_ary[0] = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary_promoted.rb b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
deleted file mode 100644
index 3c8279c956..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary_promoted.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-long_lived = []
-
-if RUBY_VERSION > "2.2.0"
-  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
-  GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  long_lived[0] = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
deleted file mode 100644
index a4067af36b..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-class C
-  attr_accessor :foo
-end
-short_lived_obj = C.new
-
-if RUBY_VERSION >= "2.2.0"
-  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  short_lived_obj.foo = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj_promoted.rb b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
deleted file mode 100644
index eee07a0248..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj_promoted.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-class C
-  attr_accessor :foo
-end
-long_lived = C.new
-
-if RUBY_VERSION >= "2.2.0"
-  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
-  GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  long_lived.foo = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
deleted file mode 100644
index 68a73cf92f..0000000000
--- a/benchmark/bm_vm1_ivar.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-@a = 1
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = @a
-  k = @a
-end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
deleted file mode 100644
index bd81b06c34..0000000000
--- a/benchmark/bm_vm1_ivar_set.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  @a = 1
-  @b = 2
-end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
deleted file mode 100644
index 353de3ab0e..0000000000
--- a/benchmark/bm_vm1_length.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-a = 'abc'
-b = [1, 2, 3]
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a.length
-  b.length
-end
-
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
deleted file mode 100644
index 36f2068811..0000000000
--- a/benchmark/bm_vm1_lvar_init.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def m v
-  unless v
-    # unreachable code
-    v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
-    v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
-    v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
-    v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
-    v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
-  end
-end
-
-i = 0
-
-while i<30_000_000 # while loop 1
-  i += 1
-  m i
-end
-
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
deleted file mode 100644
index 222e864134..0000000000
--- a/benchmark/bm_vm1_lvar_set.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
-end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
deleted file mode 100644
index bbb4ae07a4..0000000000
--- a/benchmark/bm_vm1_neq.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-obj1 = Object.new
-obj2 = Object.new
-
-while i<30_000_000 # while loop 1
-  i += 1
-  obj1 != obj2
-end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
deleted file mode 100644
index b09ecdcc21..0000000000
--- a/benchmark/bm_vm1_not.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-obj = Object.new
-
-while i<30_000_000 # while loop 1
-  i += 1
-  !obj
-end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
deleted file mode 100644
index b0d3e2bdfa..0000000000
--- a/benchmark/bm_vm1_rescue.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  begin
-  rescue
-  end
-end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
deleted file mode 100644
index 63f9f21675..0000000000
--- a/benchmark/bm_vm1_simplereturn.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  return 1
-end
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  m
-end
-
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
deleted file mode 100644
index 918f8b2112..0000000000
--- a/benchmark/bm_vm1_swap.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-a = 1
-b = 2
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a, b = b, a
-end
-
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
deleted file mode 100644
index 775597cea6..0000000000
--- a/benchmark/bm_vm1_yield.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
-  i = 0
-  while i<30_000_000 # while loop 1
-    i += 1
-    yield
-  end
-end
-
-m{}
-
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
deleted file mode 100644
index df9037c83c..0000000000
--- a/benchmark/bm_vm2_array.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  a = [1,2,3,4,5,6,7,8,9,10]
-end
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
deleted file mode 100644
index b02509d6a2..0000000000
--- a/benchmark/bm_vm2_bigarray.rb
+++ /dev/null
@@ -1,106 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  a = [
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-  ]
-end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
deleted file mode 100644
index 5e3f437bb8..0000000000
--- a/benchmark/bm_vm2_bighash.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<60_000 # benchmark loop 2
-  i += 1
-  a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
-end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
deleted file mode 100644
index adc6e4df0a..0000000000
--- a/benchmark/bm_vm2_case.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-i = 0
-while i<6_000_000 # while loop 2
-  case :foo
-  when :bar
-    raise
-  when :baz
-    raise
-  when :boo
-    raise
-  when :foo
-    i += 1
-  end
-end
-
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
deleted file mode 100644
index 053ed6c912..0000000000
--- a/benchmark/bm_vm2_defined_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-class Object
-  define_method(:m){}
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/bm_vm2_dstr.rb
deleted file mode 100644
index 58c0f7bbc3..0000000000
--- a/benchmark/bm_vm2_dstr.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-x = y = 'z'
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  str = "foo#{x}bar#{y}baz"
-end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
deleted file mode 100644
index 307cfc28ef..0000000000
--- a/benchmark/bm_vm2_eval.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  eval("1")
-end
-
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
deleted file mode 100644
index a8ccff7138..0000000000
--- a/benchmark/bm_vm2_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb
deleted file mode 100644
index 2badc73101..0000000000
--- a/benchmark/bm_vm2_method_missing.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
-  def method_missing mid
-  end
-end
-
-obj = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
-end
diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb
deleted file mode 100644
index b4efb4f520..0000000000
--- a/benchmark/bm_vm2_method_with_block.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
-end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
deleted file mode 100644
index 7362f738c5..0000000000
--- a/benchmark/bm_vm2_mutex.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-require 'thread'
-
-m = Mutex.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m.synchronize{}
-end
diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/bm_vm2_newlambda.rb
deleted file mode 100644
index 6422c9b0d0..0000000000
--- a/benchmark/bm_vm2_newlambda.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  lambda {}
-end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
deleted file mode 100644
index c82c0e4bce..0000000000
--- a/benchmark/bm_vm2_poly_method.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
-  def m
-    1
-  end
-end
-class C2
-  def m
-    2
-  end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  o = (i % 2 == 0) ? o1 : o2
-  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
deleted file mode 100644
index aa5fd1dd38..0000000000
--- a/benchmark/bm_vm2_poly_method_ov.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
-  def m
-    1
-  end
-end
-class C2
-  def m
-    2
-  end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  o = (i % 2 == 0) ? o1 : o2
-#  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
deleted file mode 100644
index 65e5217371..0000000000
--- a/benchmark/bm_vm2_proc.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-def m &b
-  b
-end
-
-pr = m{
-  a = 1
-}
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  pr.call
-end
-
diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb
deleted file mode 100644
index aa5387987f..0000000000
--- a/benchmark/bm_vm2_raise1.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
-  if n > 0
-    rec n-1
-  else
-    raise
-  end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-
-  begin
-    rec 1
-  rescue
-    # ignore
-  end
-end
diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb
deleted file mode 100644
index 1f61c63157..0000000000
--- a/benchmark/bm_vm2_raise2.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
-  if n > 0
-    rec n-1
-  else
-    raise
-  end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-
-  begin
-    rec 10
-  rescue
-    # ignore
-  end
-end
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
deleted file mode 100644
index 55f9e957a3..0000000000
--- a/benchmark/bm_vm2_regexp.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-str = 'xxxhogexxx'
-while i<6_000_000 # benchmark loop 2
-  /hoge/ =~ str
-  i += 1
-end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
deleted file mode 100644
index 6a3ab6fdab..0000000000
--- a/benchmark/bm_vm2_send.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
-  def m
-  end
-end
-
-o = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  o.__send__ :m
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_hi.rb b/benchmark/bm_vm2_struct_big_aref_hi.rb
deleted file mode 100644
index 22cb26b0a5..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.z # x[25]
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_lo.rb b/benchmark/bm_vm2_struct_big_aref_lo.rb
deleted file mode 100644
index 5e61a7087e..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.k # x[10]
-end
diff --git a/benchmark/bm_vm2_struct_big_aset.rb b/benchmark/bm_vm2_struct_big_aset.rb
deleted file mode 100644
index 5a1c3d16f3..0000000000
--- a/benchmark/bm_vm2_struct_big_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.k = i # x[10] = i
-end
diff --git a/benchmark/bm_vm2_struct_big_href_hi.rb b/benchmark/bm_vm2_struct_big_href_hi.rb
deleted file mode 100644
index fff940a80a..0000000000
--- a/benchmark/bm_vm2_struct_big_href_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:z]
-end
diff --git a/benchmark/bm_vm2_struct_big_href_lo.rb b/benchmark/bm_vm2_struct_big_href_lo.rb
deleted file mode 100644
index 5e4085d59d..0000000000
--- a/benchmark/bm_vm2_struct_big_href_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:k]
-end
diff --git a/benchmark/bm_vm2_struct_big_hset.rb b/benchmark/bm_vm2_struct_big_hset.rb
deleted file mode 100644
index 9c0cee4141..0000000000
--- a/benchmark/bm_vm2_struct_big_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:k] = i
-end
diff --git a/benchmark/bm_vm2_struct_small_aref.rb b/benchmark/bm_vm2_struct_small_aref.rb
deleted file mode 100644
index 8eaa555b41..0000000000
--- a/benchmark/bm_vm2_struct_small_aref.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.a
-end
diff --git a/benchmark/bm_vm2_struct_small_aset.rb b/benchmark/bm_vm2_struct_small_aset.rb
deleted file mode 100644
index ecd0f95669..0000000000
--- a/benchmark/bm_vm2_struct_small_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.a = i
-end
diff --git a/benchmark/bm_vm2_struct_small_href.rb b/benchmark/bm_vm2_struct_small_href.rb
deleted file mode 100644
index 2c88fee6bf..0000000000
--- a/benchmark/bm_vm2_struct_small_href.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:a]
-end
diff --git a/benchmark/bm_vm2_struct_small_hset.rb b/benchmark/bm_vm2_struct_small_hset.rb
deleted file mode 100644
index 33c36d20f1..0000000000
--- a/benchmark/bm_vm2_struct_small_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:a] = 1
-end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
deleted file mode 100644
index afd8579e7b..0000000000
--- a/benchmark/bm_vm2_super.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-
-class C
-  def m
-    1
-  end
-end
-
-class CC < C
-  def m
-    super()
-  end
-end
-
-obj = CC.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  obj.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
deleted file mode 100644
index 1774625942..0000000000
--- a/benchmark/bm_vm2_unif1.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-def m a, b
-end
-
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m 100, 200
-end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
deleted file mode 100644
index 2a43e62217..0000000000
--- a/benchmark/bm_vm2_zsuper.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-i = 0
-
-class C
-  def m a
-    1
-  end
-end
-
-class CC < C
-  def m a
-    super
-  end
-end
-
-obj = CC.new
-
-while i<6_000_000 # benchmark loop 2
-  obj.m 10
-  i += 1
-end
diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/bm_vm3_gc.rb
deleted file mode 100755
index 7db9829d44..0000000000
--- a/benchmark/bm_vm3_gc.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-#! /usr/bin/ruby
-5000.times do
-  100.times do
-    {"xxxx"=>"yyyy"}
-  end
-  GC.start
-end
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
deleted file mode 100644
index c993accdda..0000000000
--- a/benchmark/bm_vm_thread_alive_check1.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-5_000.times{
-  t = Thread.new{}
-  while t.alive?
-    Thread.pass
-  end
-}
diff --git a/benchmark/bm_vm_thread_mutex1.rb b/benchmark/bm_vm_thread_mutex1.rb
deleted file mode 100644
index 5c9f85dfb7..0000000000
--- a/benchmark/bm_vm_thread_mutex1.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# one thread, one mutex (no contention)
-
-require 'thread'
-m = Mutex.new
-r = 0
-max = 2000
-lmax = max * max
-(1..1).map{
-  Thread.new{
-    i = 0
-    while i<lmax
-      i += 1
-      m.synchronize{
-        r += 1
-      }
-    end
-  }
-}.each{|e|
-  e.join
-}
-raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex2.rb b/benchmark/bm_vm_thread_mutex2.rb
deleted file mode 100644
index 10de59054f..0000000000
--- a/benchmark/bm_vm_thread_mutex2.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# two threads, one mutex
-
-require 'thread'
-m = Mutex.new
-r = 0
-max = 2000
-lmax = (max * max)/2
-(1..2).map{
-  Thread.new{
-    i = 0
-    while i<lmax
-      i += 1
-      m.synchronize{
-        r += 1
-      }
-    end
-  }
-}.each{|e|
-  e.join
-}
-raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex3.rb b/benchmark/bm_vm_thread_mutex3.rb
deleted file mode 100644
index 7f9a44b39d..0000000000
--- a/benchmark/bm_vm_thread_mutex3.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-# 1000 threads, one mutex
-
-require 'thread'
-m = Mutex.new
-r = 0
-max = 2000
-(1..max).map{
-  Thread.new{
-    i = 0
-    while i<max
-      i += 1
-      m.synchronize{
-        r += 1
-      }
-    end
-  }
-}.each{|e|
-  e.join
-}
-raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/bm_vm_thread_pass.rb
deleted file mode 100644
index b5b3c0bc85..0000000000
--- a/benchmark/bm_vm_thread_pass.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# Plenty Thtread.pass
-# A performance may depend on GVL implementation.
-
-tmax = (ARGV.shift || 2).to_i
-lmax = 200_000 / tmax
-
-(1..tmax).map{
-  Thread.new{
-    lmax.times{
-      Thread.pass
-    }
-  }
-}.each{|t| t.join}
-
-
diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb
deleted file mode 100644
index 27157d1a6f..0000000000
--- a/benchmark/bm_vm_thread_pass_flood.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-1000.times{
-  Thread.new{loop{Thread.pass}}
-}
-
-i = 0
-while i<10000
-  i += 1
-end
diff --git a/benchmark/bm_vm_thread_pipe.rb b/benchmark/bm_vm_thread_pipe.rb
deleted file mode 100644
index 272d231eba..0000000000
--- a/benchmark/bm_vm_thread_pipe.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-# Mesure small and plenty pipe read/write.
-# A performance may depend on GVL implementation.
-
-lmax = 100_000
-r, w = IO.pipe
-[Thread.new{
-  lmax.times{
-    w.write('a')
-  }
-  p "w:exit"
-}, Thread.new{
-  lmax.times{
-    r.read(1)
-  }
-  p "r:exit"
-}].each{|t| t.join}
-
diff --git a/benchmark/bm_vm_thread_queue.rb b/benchmark/bm_vm_thread_queue.rb
deleted file mode 100644
index 37381ae62b..0000000000
--- a/benchmark/bm_vm_thread_queue.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-require 'thread'
-
-n = 1_000_000
-q = Queue.new
-consumer = Thread.new{
-  while q.pop
-    # consuming
-  end
-}
-
-producer = Thread.new{
-  n.times{
-    q.push true
-  }
-  q.push nil
-}
-
-consumer.join
diff --git a/benchmark/buffer_each.yml b/benchmark/buffer_each.yml
new file mode 100644
index 0000000000..417941104e
--- /dev/null
+++ b/benchmark/buffer_each.yml
@@ -0,0 +1,27 @@
+prelude: |
+  # frozen_string_literal: true
+  Warning[:experimental] = false
+  string = "The quick brown fox jumped over the lazy dog."
+  array = string.bytes
+  buffer = IO::Buffer.for(string)
+benchmark:
+  string.each_byte: |
+    upcased = String.new
+    string.each_byte do |byte|
+      upcased << (byte ^ 32)
+    end
+  array.each: |
+    upcased = String.new
+    array.each do |byte|
+      upcased << (byte ^ 32)
+    end
+  buffer.each: |
+    upcased = String.new
+    buffer.each(:U8) do |offset, byte|
+      upcased << (byte ^ 32)
+    end
+  buffer.each_byte: |
+    upcased = String.new
+    buffer.each_byte do |byte|
+      upcased << (byte ^ 32)
+    end
diff --git a/benchmark/buffer_get.yml b/benchmark/buffer_get.yml
new file mode 100644
index 0000000000..9e1f99d64e
--- /dev/null
+++ b/benchmark/buffer_get.yml
@@ -0,0 +1,25 @@
+prelude: |
+  # frozen_string_literal: true
+  Warning[:experimental] = false
+  string = "The quick brown fox jumped over the lazy dog."
+  buffer = IO::Buffer.for(string)
+  format = [:U32, :U32, :U32, :U32]
+benchmark:
+  string.unpack1: |
+    [
+      string.unpack1("N"),
+      string.unpack1("N", offset: 4),
+      string.unpack1("N", offset: 8),
+      string.unpack1("N", offset: 12),
+    ]
+  buffer.get_value: |
+    [
+      buffer.get_value(:U32, 0),
+      buffer.get_value(:U32, 4),
+      buffer.get_value(:U32, 8),
+      buffer.get_value(:U32, 12),
+    ]
+  buffer.get_values: |
+    buffer.get_values(format, 0)
+  string.unpack: |
+    string.unpack("NNNN")
diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml
new file mode 100644
index 0000000000..655be9d7d8
--- /dev/null
+++ b/benchmark/cgi_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'cgi/escape'
+benchmark:
+  - script: CGI.escapeHTML("")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("abcde")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("abcd<")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("'&\"<>")
+    loop_count: 5000000
+  - prelude: long_no_escape = "abcde" * 300
+    script: CGI.escapeHTML(long_no_escape)
+    loop_count: 1000000
+  - prelude: long_all_escape = "'&\"<>" * 10
+    script: CGI.escapeHTML(long_all_escape)
+    loop_count: 1000000
+  - prelude: | # http://example.com/
+      example_html = <<~HTML
+        <body>
+        <div>
+            <h1>Example Domain</h1>
+            <p>This domain is established to be used for illustrative examples in documents. You may use this
+            domain in examples without prior coordination or asking for permission.</p>
+            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+        </div>
+        </body>
+      HTML
+    script: CGI.escapeHTML(example_html)
+    loop_count: 1000000
diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml
new file mode 100644
index 0000000000..d0150c5e5b
--- /dev/null
+++ b/benchmark/complex_float_add.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_add: c = a + b
+loop_count: 1000000
diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml
new file mode 100644
index 0000000000..b9f5e1d51c
--- /dev/null
+++ b/benchmark/complex_float_div.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_div: c = a / b
+loop_count: 1000000
diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml
new file mode 100644
index 0000000000..59b096a6dc
--- /dev/null
+++ b/benchmark/complex_float_mul.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_mul: c = a * b
+loop_count: 1000000
diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml
new file mode 100644
index 0000000000..6fcde3125b
--- /dev/null
+++ b/benchmark/complex_float_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_new: c = Complex(a, b)
+loop_count: 1000000
diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml
new file mode 100644
index 0000000000..c40a31ab55
--- /dev/null
+++ b/benchmark/complex_float_power.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_power: c = a ** b
+loop_count: 1000000
diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml
new file mode 100644
index 0000000000..3fafe7cdbe
--- /dev/null
+++ b/benchmark/complex_float_sub.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_sub: c = a - b
+loop_count: 1000000
diff --git a/benchmark/constant_invalidation.rb b/benchmark/constant_invalidation.rb
new file mode 100644
index 0000000000..a95ec6f37e
--- /dev/null
+++ b/benchmark/constant_invalidation.rb
@@ -0,0 +1,22 @@
+$VERBOSE = nil
+
+CONSTANT1 = 1
+CONSTANT2 = 1
+CONSTANT3 = 1
+CONSTANT4 = 1
+CONSTANT5 = 1
+
+def constants
+  [CONSTANT1, CONSTANT2, CONSTANT3, CONSTANT4, CONSTANT5]
+end
+
+500_000.times do
+  constants
+
+  # With previous behavior, this would cause all of the constant caches
+  # associated with the constant lookups listed above to invalidate, meaning
+  # they would all have to be fetched again. With current behavior, it only
+  # invalidates when a name matches, so the following constant set shouldn't
+  # impact the constant lookups listed above.
+  INVALIDATE = true
+end
diff --git a/benchmark/dir_empty_p.rb b/benchmark/dir_empty_p.rb
new file mode 100644
index 0000000000..8329c757cf
--- /dev/null
+++ b/benchmark/dir_empty_p.rb
@@ -0,0 +1,5 @@
+require 'tmpdir'
+max = 100_000
+Dir.mktmpdir('bm_dir_empty_p') do |dir|
+  max.times { Dir.empty?(dir) }
+end
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
deleted file mode 100644
index defe3c30be..0000000000
--- a/benchmark/driver.rb
+++ /dev/null
@@ -1,400 +0,0 @@
-#
-# Ruby Benchmark driver
-#
-
-first = true
-
-begin
-  require 'optparse'
-rescue LoadError
-  if first
-    first = false
-    $:.unshift File.join(File.dirname(__FILE__), '../lib')
-    retry
-  else
-    raise
-  end
-end
-
-require 'benchmark'
-require 'pp'
-
-class BenchmarkDriver
-  def self.benchmark(opt)
-    driver = self.new(opt[:execs], opt[:dir], opt)
-    begin
-      driver.run
-    ensure
-      driver.show_results
-    end
-  end
-
-  def self.load(input, type, opt)
-    attrs = [:executables, :results]
-    case type
-    when 'yaml'
-      require 'yaml'
-      h = YAML.load(input)
-    when 'json'
-      require 'json'
-      h = JSON.load(input)
-    else
-      h = eval(input.read)
-    end
-    obj = allocate
-    obj.instance_variable_set("@execs", h[:executables] || h["executables"])
-    obj.instance_variable_set("@results", h[:results] || h["results"])
-    obj.instance_variable_set("@opt", opt)
-    obj
-  end
-
-  def output *args
-    puts(*args)
-    @output and @output.puts(*args)
-  end
-
-  def message *args
-    output(*args) if @verbose
-  end
-
-  def message_print *args
-    if @verbose
-      print(*args)
-      STDOUT.flush
-      @output and @output.print(*args)
-    end
-  end
-
-  def progress_message *args
-    unless STDOUT.tty?
-      STDERR.print(*args)
-      STDERR.flush
-    end
-  end
-
-  def initialize execs, dir, opt = {}
-    @execs = execs.map{|e|
-      e.strip!
-      next if e.empty?
-
-      if /(.+)::(.+)/ =~ e
-        # ex) ruby-a::/path/to/ruby-a
-        label = $1.strip
-        path = $2
-        version = `#{path} -v`.chomp
-      else
-        path = e
-        version = label = `#{path} -v`.chomp
-      end
-      [path, label, version]
-    }.compact
-
-    @dir = dir
-    @repeat = opt[:repeat] || 1
-    @repeat = 1 if @repeat < 1
-    @pattern = opt[:pattern] || nil
-    @exclude = opt[:exclude] || nil
-    @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
-    @output = opt[:output] ? open(opt[:output], 'w') : nil
-    @loop_wl1 = @loop_wl2 = nil
-    @ruby_arg = opt[:ruby_arg] || nil
-    @opt = opt
-
-    # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
-    @results = []
-
-    if @verbose
-      @start_time = Time.now
-      message @start_time
-      @execs.each_with_index{|(path, label, version), i|
-        message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\""
-      }
-    end
-  end
-
-  def adjusted_results name, results
-    s = nil
-    results.each_with_index{|e, i|
-      r = e.min
-      case name
-      when /^vm1_/
-        if @loop_wl1
-          r -= @loop_wl1[i]
-          r = 0 if r < 0
-          s = '*'
-        end
-      when /^vm2_/
-        if @loop_wl2
-          r -= @loop_wl2[i]
-          r = 0 if r < 0
-          s = '*'
-        end
-      end
-      yield r
-    }
-    s
-  end
-
-  def show_results
-    case @opt[:format]
-    when :tsv
-      strformat = "\t%1$s"
-      numformat = "\t%1$*2$.3f"
-      minwidth = 0
-      name_width = 0
-    when :markdown
-      markdown = true
-      strformat = "|%1$-*2$s"
-      numformat = "|%1$*2$.3f"
-    when :plain
-      strformat = " %1$-*2$s"
-      numformat = " %1$*2$.3f"
-    end
-
-    name_width ||= @results.map {|v,*| v.size}.max
-    minwidth ||= 7
-    width = @execs.map{|(_, v)| [v.size, minwidth].max}
-
-    output
-
-    if @verbose
-      message '-----------------------------------------------------------'
-      message 'raw data:'
-      message
-      message PP.pp(@results, "", 79)
-      message
-      message "Elapsed time: #{Time.now - @start_time} (sec)"
-    end
-
-    if rawdata_output = @opt[:rawdata_output]
-      h = {}
-      h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo')
-      h[:executables] = @execs
-      h[:results] = @results
-      if (type = File.extname(rawdata_output)).empty?
-        type = rawdata_output
-        rawdata_output = @output.path.sub(/\.[^.\/]+\z/, '') << '.' << rawdata_output
-      end
-      case type
-      when 'yaml'
-        require 'yaml'
-        h = YAML.dump(h)
-      when 'json'
-        require 'json'
-        h = JSON.pretty_generate(h)
-      else
-        require 'pp'
-        h = h.pretty_inspect
-      end
-      open(rawdata_output, 'w') {|f| f.puts h}
-    end
-
-    output '-----------------------------------------------------------'
-    output 'benchmark results:'
-
-    if @verbose and @repeat > 1
-      output "minimum results in each #{@repeat} measurements."
-    end
-
-    output "Execution time (sec)"
-    output if markdown
-    output ["name".ljust(name_width), @execs.map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
-    output ["-"*name_width, width.map{|n|":".rjust(n, "-")}].join("|") if markdown
-    @results.each{|v, result|
-      rets = []
-      s = adjusted_results(v, result){|r|
-        rets << sprintf(numformat, r, width[rets.size])
-      }
-      v += s if s
-      output [v.ljust(name_width), rets].join("")
-    }
-
-    if @execs.size > 1
-      output
-      output "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)"
-      output if markdown
-      output ["name".ljust(name_width), @execs[1..-1].map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
-      output ["-"*name_width, width[1..-1].map{|n|":".rjust(n, "-")}].join("|") if markdown
-      @results.each{|v, result|
-        rets = []
-        first_value = nil
-        s = adjusted_results(v, result){|r|
-          if first_value
-            if r == 0
-              rets << "Error"
-            else
-              rets << sprintf(numformat, first_value/r, width[rets.size+1])
-            end
-          else
-            first_value = r
-          end
-        }
-        v += s if s
-        output [v.ljust(name_width), rets].join("")
-      }
-    end
-
-    if @opt[:output]
-      output
-      output "Log file: #{@opt[:output]}"
-    end
-  end
-
-  def files
-    flag = {}
-    @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
-      next if @pattern && /#{@pattern}/ !~ File.basename(file)
-      next if @exclude && /#{@exclude}/ =~ File.basename(file)
-      case file
-      when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
-        flag[$1] = true
-      end
-      file
-    }.compact
-
-    if flag['vm1'] && !flag['whileloop']
-      @files << File.join(@dir, 'bm_loop_whileloop.rb')
-    elsif flag['vm2'] && !flag['whileloop2']
-      @files << File.join(@dir, 'bm_loop_whileloop2.rb')
-    end
-
-    @files.sort!
-    progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
-    @files
-  end
-
-  def run
-    files.each_with_index{|file, i|
-      @i = i
-      r = measure_file(file)
-
-      if /bm_loop_whileloop.rb/ =~ file
-        @loop_wl1 = r[1].map{|e| e.min}
-      elsif /bm_loop_whileloop2.rb/ =~ file
-        @loop_wl2 = r[1].map{|e| e.min}
-      end
-    }
-  end
-
-  def measure_file file
-    name = File.basename(file, '.rb').sub(/^bm_/, '')
-    prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
-    load prepare_file if FileTest.exist?(prepare_file)
-
-    if @verbose
-      output
-      output '-----------------------------------------------------------'
-      output name
-      output
-      output File.read(file)
-      output
-    end
-
-    result = [name]
-    result << @execs.map{|(e, v)|
-      (0...@repeat).map{
-        message_print "#{v}\t"
-        progress_message '.'
-
-        m = measure(e, file)
-        message "#{m}"
-        m
-      }
-    }
-    @results << result
-    result
-  end
-
-  unless defined?(File::NULL)
-    if File.exist?('/dev/null')
-      File::NULL = '/dev/null'
-    end
-  end
-
-  def measure executable, file
-    cmd = "#{executable} #{@ruby_arg} #{file}"
-
-    m = Benchmark.measure{
-      system(cmd, out: File::NULL)
-    }
-
-    if $? != 0
-      output "\`#{cmd}\' exited with abnormal status (#{$?})"
-      0
-    else
-      m.real
-    end
-  end
-end
-
-if __FILE__ == $0
-  opt = {
-    :execs => [],
-    :dir => File.dirname(__FILE__),
-    :repeat => 1,
-    :output => nil,
-    :raw_output => nil,
-    :format => :tsv,
-  }
-  formats = {
-    :tsv => ".tsv",
-    :markdown => ".md",
-    :plain => ".txt",
-  }
-
-  parser = OptionParser.new{|o|
-    o.on('-e', '--executables [EXECS]',
-      "Specify benchmark one or more targets (e1::path1; e2::path2; e3::path3;...)"){|e|
-       e.split(/;/).each{|path|
-         opt[:execs] << path
-       }
-    }
-    o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
-      opt[:dir] = d
-    }
-    o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
-      opt[:pattern] = p
-    }
-    o.on('-x', '--exclude [PATTERN]', "Benchmark exclude pattern"){|e|
-      opt[:exclude] = e
-    }
-    o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
-      opt[:repeat] = n.to_i
-    }
-    o.on('-o', '--output-file [FILE]', "Output file"){|f|
-      opt[:output] = f
-    }
-    o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a|
-      opt[:ruby_arg] = a
-    }
-    o.on('--rawdata-output [FILE]', 'output rawdata'){|r|
-      opt[:rawdata_output] = r
-    }
-    o.on('--load-rawdata=FILE', 'input rawdata'){|r|
-      opt[:rawdata_input] = r
-    }
-    o.on('-f', "--format=FORMAT", "output format (#{formats.keys.join(",")})", formats.keys){|r|
-      opt[:format] = r
-    }
-    o.on('-v', '--verbose'){|v|
-      opt[:verbose] = v
-    }
-    o.on('-q', '--quiet', "Run without notify information except result table."){|q|
-      opt[:quiet] = q
-      opt[:verbose] = false
-    }
-  }
-
-  parser.parse!(ARGV)
-  opt[:output] ||= "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}#{formats[opt[:format]]}"
-
-  if input = opt[:rawdata_input]
-    b = open(input) {|f|
-      BenchmarkDriver.load(f, File.extname(input)[1..-1], opt)
-    }
-    b.show_results
-  else
-    BenchmarkDriver.benchmark(opt)
-  end
-end
-
diff --git a/benchmark/enum_lazy_flat_map.yml b/benchmark/enum_lazy_flat_map.yml
new file mode 100644
index 0000000000..0ee390a441
--- /dev/null
+++ b/benchmark/enum_lazy_flat_map.yml
@@ -0,0 +1,16 @@
+prelude: |
+  num = (1..).lazy.take(100)
+  ary2 = [[1,2]].cycle.lazy.take(10)
+  ary10 = [[*1..10]].cycle.lazy.take(10)
+  ary20 = [[*1..20]].cycle.lazy.take(10)
+  ary50 = [[*1..50]].cycle.lazy.take(10)
+  ary100 = [[*1..100]].cycle.lazy.take(10)
+
+benchmark:
+  num3: num.flat_map {|x| x}.take(3).to_a
+  num10: num.flat_map {|x| x}.take(3).to_a
+  ary2:  ary2.flat_map {|x| x}.take(3).to_a
+  ary10: ary10.flat_map {|x| x}.take(3).to_a
+  ary20: ary20.flat_map {|x| x}.take(3).to_a
+  ary50: ary50.flat_map {|x| x}.take(3).to_a
+  ary100: ary100.flat_map {|x| x}.take(3).to_a
diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb
new file mode 100644
index 0000000000..8832392e65
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_100.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb
new file mode 100644
index 0000000000..329509fa8f
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_20.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb
new file mode 100644
index 0000000000..02ea4d4e71
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_50.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb
new file mode 100644
index 0000000000..2e6434d9c4
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_100.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb
new file mode 100644
index 0000000000..75e6398fee
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_20.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb
new file mode 100644
index 0000000000..59a39b78ff
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_50.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_zip.yml b/benchmark/enum_lazy_zip.yml
new file mode 100644
index 0000000000..4566ff0261
--- /dev/null
+++ b/benchmark/enum_lazy_zip.yml
@@ -0,0 +1,22 @@
+prelude: |
+  a = (1..3).lazy
+  b = a.map {|x| x}
+
+benchmark:
+  first_ary: a.zip(["a", "b", "c"]).first
+  first_nonary: a.zip("a".."c").first
+  first_noarg: a.zip.first
+
+  take3_ary: a.zip(["a", "b", "c"]).take(3).force
+  take3_nonary: a.zip("a".."c").take(3).force
+  take3_noarg: a.zip.take(3).force
+
+  chain-first_ary: b.zip(["a", "b", "c"]).first
+  chain-first_nonary: b.zip("a".."c").first
+  chain-first_noarg: b.zip.first
+
+  chain-take3_ary: b.zip(["a", "b", "c"]).take(3).force
+  chain-take3_nonary: b.zip("a".."c").take(3).force
+  chain-take3_noarg: b.zip.take(3).force
+
+  block: a.zip("a".."c") {|x, y| [x, y]}
diff --git a/benchmark/enum_minmax.yml b/benchmark/enum_minmax.yml
new file mode 100644
index 0000000000..9d01731abb
--- /dev/null
+++ b/benchmark/enum_minmax.yml
@@ -0,0 +1,25 @@
+prelude: |
+  set2 = 2.times.to_a.shuffle.to_set
+  set10 = 10.times.to_a.shuffle.to_set
+  set100 = 100.times.to_a.shuffle.to_set
+  set1000 = 1000.times.to_a.shuffle.to_set
+  set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+  set2.min: set2.min
+  set10.min: set10.min
+  set100.min: set100.min
+  set1000.min: set1000.min
+  set10000.min: set10000.min
+  set2.max: set2.max
+  set10.max: set10.max
+  set100.max: set100.max
+  set1000.max: set1000.max
+  set10000.max: set10000.max
+  set2.minmax: set2.minmax
+  set10.minmax: set10.minmax
+  set100.minmax: set100.minmax
+  set1000.minmax: set1000.minmax
+  set10000.minmax: set10000.minmax
+
+loop_count: 10000
diff --git a/benchmark/enum_sort.yml b/benchmark/enum_sort.yml
new file mode 100644
index 0000000000..6f26e748c6
--- /dev/null
+++ b/benchmark/enum_sort.yml
@@ -0,0 +1,15 @@
+prelude: |
+  set2 = 2.times.to_a.shuffle.to_set
+  set10 = 10.times.to_a.shuffle.to_set
+  set100 = 100.times.to_a.shuffle.to_set
+  set1000 = 1000.times.to_a.shuffle.to_set
+  set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+  set2.sort_by: set2.sort_by { 0 }
+  set10.sort_by: set10.sort_by { 0 }
+  set100.sort_by: set100.sort_by { 0 }
+  set1000.sort_by: set1000.sort_by { 0 }
+  set10000.sort_by: set10000.sort_by { 0 }
+
+loop_count: 10000
diff --git a/benchmark/enum_tally.yml b/benchmark/enum_tally.yml
new file mode 100644
index 0000000000..edd2e040a0
--- /dev/null
+++ b/benchmark/enum_tally.yml
@@ -0,0 +1,4 @@
+prelude: |
+  list = ("aaa".."zzz").to_a*10
+benchmark:
+  tally: list.tally
diff --git a/benchmark/erb_escape_html.yml b/benchmark/erb_escape_html.yml
new file mode 100644
index 0000000000..ca28d756e7
--- /dev/null
+++ b/benchmark/erb_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'erb'
+benchmark:
+  - script: ERB::Util.html_escape("")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("abcde")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("abcd<")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("'&\"<>")
+    loop_count: 5000000
+  - prelude: long_no_escape = "abcde" * 300
+    script: ERB::Util.html_escape(long_no_escape)
+    loop_count: 1000000
+  - prelude: long_all_escape = "'&\"<>" * 10
+    script: ERB::Util.html_escape(long_all_escape)
+    loop_count: 1000000
+  - prelude: | # http://example.com/
+      example_html = <<~HTML
+        <body>
+        <div>
+            <h1>Example Domain</h1>
+            <p>This domain is established to be used for illustrative examples in documents. You may use this
+            domain in examples without prior coordination or asking for permission.</p>
+            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+        </div>
+        </body>
+      HTML
+    script: ERB::Util.html_escape(example_html)
+    loop_count: 1000000
diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml
new file mode 100644
index 0000000000..15f6c3880b
--- /dev/null
+++ b/benchmark/erb_render.yml
@@ -0,0 +1,24 @@
+prelude: |
+  require 'erb'
+
+  data = <<erb
+  <html>
+    <head> <%= title %> </head>
+    <body>
+      <h1> <%= title %> </h1>
+      <p>
+        <%= content %>
+      </p>
+    </body>
+  </html>
+  erb
+
+  title = "hello world!"
+  content = "hello world!\n" * 10
+
+  src = "def self.render(title, content); #{ERB.new(data).src}; end"
+  mod = Module.new
+  mod.instance_eval(src, "(ERB)")
+benchmark:
+  erb_render: mod.render(title, content)
+loop_count: 1500000
diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml
new file mode 100644
index 0000000000..a36c759f8e
--- /dev/null
+++ b/benchmark/fiber_chain.yml
@@ -0,0 +1,36 @@
+prelude: |
+  def make_link(previous)
+    Fiber.new do
+      while message = previous.resume
+        Fiber.yield(message)
+      end
+    end
+  end
+
+  def make_chain(length = 1000, &block)
+    chain = Fiber.new(&block)
+
+    (length - 1).times do
+      chain = make_link(chain)
+    end
+
+    return chain
+  end
+
+  message = "Hello World!"
+
+  chain = make_chain do
+    while true
+      Fiber.yield(message)
+    end
+  end
+benchmark:
+  make_chain: |
+    make_chain(100) do
+      while true
+        Fiber.yield(message)
+      end
+    end
+  resume_chain: |
+    chain.resume
+loop_count: 5000
diff --git a/benchmark/fiber_locals.yml b/benchmark/fiber_locals.yml
new file mode 100644
index 0000000000..8588686477
--- /dev/null
+++ b/benchmark/fiber_locals.yml
@@ -0,0 +1,8 @@
+prelude: |
+  th = Thread.current
+  th[:key] = :val
+benchmark:
+  key?: th.key?(:key)
+  []: th[:key]
+  keys: th.keys
+loop_count: 1_000_000
diff --git a/benchmark/file_chmod.rb b/benchmark/file_chmod.rb
new file mode 100644
index 0000000000..1cd4760c9d
--- /dev/null
+++ b/benchmark/file_chmod.rb
@@ -0,0 +1,9 @@
+# chmod file
+require 'tempfile'
+max = 200_000
+tmp = Tempfile.new('chmod')
+path = tmp.path
+max.times do
+  File.chmod(0777, path)
+end
+tmp.close!
diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb
new file mode 100644
index 0000000000..bbb44aebac
--- /dev/null
+++ b/benchmark/file_rename.rb
@@ -0,0 +1,11 @@
+# rename file
+require 'tempfile'
+
+max = 100_000
+tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
+a, b = tmp.map { |x| x.path }
+tmp.each { |t| t.close } # Windows can't rename files without closing them
+max.times do
+  File.rename(a, b)
+  File.rename(b, a)
+end
diff --git a/benchmark/float_methods.yml b/benchmark/float_methods.yml
new file mode 100644
index 0000000000..56ea41effc
--- /dev/null
+++ b/benchmark/float_methods.yml
@@ -0,0 +1,14 @@
+prelude: |
+  flo = 4.2
+benchmark:
+  to_f: |
+    flo.to_f
+  abs: |
+    flo.abs
+  magnitude: |
+    flo.magnitude
+  -@: |
+    -flo
+  zero?: |
+    flo.zero?
+loop_count: 20000000
diff --git a/benchmark/float_neg_posi.yml b/benchmark/float_neg_posi.yml
new file mode 100644
index 0000000000..172db1bf6d
--- /dev/null
+++ b/benchmark/float_neg_posi.yml
@@ -0,0 +1,8 @@
+prelude: |
+  flo = 4.2
+benchmark:
+  negative?: |
+    flo.negative?
+  positive?: |
+    flo.positive?
+loop_count: 20000000
diff --git a/benchmark/float_to_s.yml b/benchmark/float_to_s.yml
new file mode 100644
index 0000000000..0abae5cdb8
--- /dev/null
+++ b/benchmark/float_to_s.yml
@@ -0,0 +1,7 @@
+prelude: |
+  floats = [*0.0.step(1.0, 0.0001)]
+
+benchmark:
+  to_s: floats.each {|f| f.to_s}
+
+loop_count: 1000
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
index 2eed7abc83..275f58b924 100644
--- a/benchmark/gc/aobench.rb
+++ b/benchmark/gc/aobench.rb
@@ -1 +1 @@
-require_relative '../bm_app_aobench.rb'
+require_relative '../app_aobench'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
index af8ea722aa..83347cdd20 100644
--- a/benchmark/gc/binary_trees.rb
+++ b/benchmark/gc/binary_trees.rb
@@ -1 +1 @@
-require_relative '../bm_so_binary_trees.rb'
+require_relative '../so_binary_trees'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
index 09a404466a..23d0b91c6c 100644
--- a/benchmark/gc/gcbench.rb
+++ b/benchmark/gc/gcbench.rb
@@ -3,11 +3,12 @@ require 'pp'
 require 'optparse'
 
 $list = true
-$gcprof = true
+$gcprof = false
 
 opt = OptionParser.new
 opt.on('-q'){$list = false}
 opt.on('-d'){$gcprof = false}
+opt.on('-p'){$gcprof = true}
 opt.parse!(ARGV)
 
 script = File.join(File.dirname(__FILE__), ARGV.shift)
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
index 94ba74be89..8ebdff7d1d 100644
--- a/benchmark/gc/pentomino.rb
+++ b/benchmark/gc/pentomino.rb
@@ -1 +1 @@
-require_relative '../bm_app_pentomino.rb'
+require_relative '../app_pentomino'
diff --git a/benchmark/hash_aref_array.rb b/benchmark/hash_aref_array.rb
new file mode 100644
index 0000000000..ac7a683d95
--- /dev/null
+++ b/benchmark/hash_aref_array.rb
@@ -0,0 +1,5 @@
+h = {}
+arrays = (0..99).each_slice(10).to_a
+#STDERR.puts arrays.inspect
+arrays.each { |s| h[s] = s }
+200_000.times { arrays.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym.rb b/benchmark/hash_aref_dsym.rb
new file mode 100644
index 0000000000..af4f8c36d4
--- /dev/null
+++ b/benchmark/hash_aref_dsym.rb
@@ -0,0 +1,4 @@
+h = {}
+syms = ('a'..'z').map { |s| s.to_sym }
+syms.each { |s| h[s] = 1 }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym_long.rb b/benchmark/hash_aref_dsym_long.rb
new file mode 100644
index 0000000000..9d7759379e
--- /dev/null
+++ b/benchmark/hash_aref_dsym_long.rb
@@ -0,0 +1,21 @@
+# [ruby-core:70129] [Bug #11396]
+collection_size = 200000
+sample_size = 10000
+
+values = (1..collection_size).to_a.map do |x|
+  "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
+end
+
+symbol_hash = {}
+
+values.each do |x|
+  symbol_hash[x.to_sym] = 1
+end
+
+# use the same samples each time to minimize deviations
+rng = Random.new(0)
+symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
+
+3000.times do
+  symbol_sample_array.each { |x| symbol_hash[x] }
+end
diff --git a/benchmark/hash_aref_fix.rb b/benchmark/hash_aref_fix.rb
new file mode 100644
index 0000000000..1346890582
--- /dev/null
+++ b/benchmark/hash_aref_fix.rb
@@ -0,0 +1,4 @@
+h = {}
+nums = (1..26).to_a
+nums.each { |i| h[i] = i }
+200_000.times { nums.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_flo.rb b/benchmark/hash_aref_flo.rb
index 2217274c82..2217274c82 100644
--- a/benchmark/bm_hash_aref_flo.rb
+++ b/benchmark/hash_aref_flo.rb
diff --git a/benchmark/bm_hash_aref_miss.rb b/benchmark/hash_aref_miss.rb
index b0913dd4bb..b0913dd4bb 100644
--- a/benchmark/bm_hash_aref_miss.rb
+++ b/benchmark/hash_aref_miss.rb
diff --git a/benchmark/bm_hash_aref_str.rb b/benchmark/hash_aref_str.rb
index 19439b061b..19439b061b 100644
--- a/benchmark/bm_hash_aref_str.rb
+++ b/benchmark/hash_aref_str.rb
diff --git a/benchmark/bm_hash_aref_sym.rb b/benchmark/hash_aref_sym.rb
index f75d163fe6..f75d163fe6 100644
--- a/benchmark/bm_hash_aref_sym.rb
+++ b/benchmark/hash_aref_sym.rb
diff --git a/benchmark/bm_hash_aref_sym_long.rb b/benchmark/hash_aref_sym_long.rb
index 9dab8df7be..9dab8df7be 100644
--- a/benchmark/bm_hash_aref_sym_long.rb
+++ b/benchmark/hash_aref_sym_long.rb
diff --git a/benchmark/hash_defaults.yml b/benchmark/hash_defaults.yml
new file mode 100644
index 0000000000..833f10e1c7
--- /dev/null
+++ b/benchmark/hash_defaults.yml
@@ -0,0 +1,6 @@
+prelude: |
+  h = Hash.new { :foo }
+benchmark:
+  default_aref: h[1]
+  default_method: h.default(1)
+loop_count: 1000000
diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml
new file mode 100644
index 0000000000..65f521ec94
--- /dev/null
+++ b/benchmark/hash_dup.yml
@@ -0,0 +1,8 @@
+prelude: |
+  small_hash = { a: 1 }
+  larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h
+
+benchmark:
+  dup_small: small_hash.dup
+  dup_larger: larger_hash.dup
+loop_count: 10000
diff --git a/benchmark/hash_first.yml b/benchmark/hash_first.yml
new file mode 100644
index 0000000000..c26df1a7ed
--- /dev/null
+++ b/benchmark/hash_first.yml
@@ -0,0 +1,11 @@
+prelude: |
+  hash1 = 1_000_000.times.to_h { [rand, true]}
+  hash2 = hash1.dup
+  hash2.keys[1..100_000].each { hash2.delete _1 }
+  hash2.delete hash2.first[0]
+
+benchmark:
+  hash1: hash1.first
+  hash2: hash2.first
+
+loop_count: 100_000
diff --git a/benchmark/bm_hash_flatten.rb b/benchmark/hash_flatten.rb
index e944aae9f2..e944aae9f2 100644
--- a/benchmark/bm_hash_flatten.rb
+++ b/benchmark/hash_flatten.rb
diff --git a/benchmark/bm_hash_ident_flo.rb b/benchmark/hash_ident_flo.rb
index 0c7edfed3e..0c7edfed3e 100644
--- a/benchmark/bm_hash_ident_flo.rb
+++ b/benchmark/hash_ident_flo.rb
diff --git a/benchmark/bm_hash_ident_num.rb b/benchmark/hash_ident_num.rb
index b226736c6f..b226736c6f 100644
--- a/benchmark/bm_hash_ident_num.rb
+++ b/benchmark/hash_ident_num.rb
diff --git a/benchmark/bm_hash_ident_obj.rb b/benchmark/hash_ident_obj.rb
index 4b3b58edec..4b3b58edec 100644
--- a/benchmark/bm_hash_ident_obj.rb
+++ b/benchmark/hash_ident_obj.rb
diff --git a/benchmark/bm_hash_ident_str.rb b/benchmark/hash_ident_str.rb
index 8582b38e31..8582b38e31 100644
--- a/benchmark/bm_hash_ident_str.rb
+++ b/benchmark/hash_ident_str.rb
diff --git a/benchmark/bm_hash_ident_sym.rb b/benchmark/hash_ident_sym.rb
index 4c81e3d28e..4c81e3d28e 100644
--- a/benchmark/bm_hash_ident_sym.rb
+++ b/benchmark/hash_ident_sym.rb
diff --git a/benchmark/bm_hash_keys.rb b/benchmark/hash_keys.rb
index 6863cd01f9..6863cd01f9 100644
--- a/benchmark/bm_hash_keys.rb
+++ b/benchmark/hash_keys.rb
diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb
new file mode 100644
index 0000000000..c188529260
--- /dev/null
+++ b/benchmark/hash_literal_small2.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz" }  }
diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb
new file mode 100644
index 0000000000..739f71b5b0
--- /dev/null
+++ b/benchmark/hash_literal_small4.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } }
diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb
new file mode 100644
index 0000000000..53d80af535
--- /dev/null
+++ b/benchmark/hash_literal_small8.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } }
diff --git a/benchmark/hash_long.rb b/benchmark/hash_long.rb
new file mode 100644
index 0000000000..03d9109602
--- /dev/null
+++ b/benchmark/hash_long.rb
@@ -0,0 +1,4 @@
+k1 = "Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong";
+k2 = "Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping";
+h = {k1 => 0, k2 => 0};
+3000000.times{|i| k = i % 2 ? k2 : k1; h [k] = h[k] + 1}
diff --git a/benchmark/bm_hash_shift.rb b/benchmark/hash_shift.rb
index a645671a5b..a645671a5b 100644
--- a/benchmark/bm_hash_shift.rb
+++ b/benchmark/hash_shift.rb
diff --git a/benchmark/hash_shift_u16.rb b/benchmark/hash_shift_u16.rb
new file mode 100644
index 0000000000..ec800d0342
--- /dev/null
+++ b/benchmark/hash_shift_u16.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(16384..65536).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_shift_u24.rb b/benchmark/hash_shift_u24.rb
new file mode 100644
index 0000000000..de4e0fa696
--- /dev/null
+++ b/benchmark/hash_shift_u24.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xff4000..0xffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_shift_u32.rb b/benchmark/hash_shift_u32.rb
new file mode 100644
index 0000000000..656aa55583
--- /dev/null
+++ b/benchmark/hash_shift_u32.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xffff4000..0xffffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_small2.rb b/benchmark/hash_small2.rb
new file mode 100644
index 0000000000..45485d9c71
--- /dev/null
+++ b/benchmark/hash_small2.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 2.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small4.rb b/benchmark/hash_small4.rb
new file mode 100644
index 0000000000..acd4084334
--- /dev/null
+++ b/benchmark/hash_small4.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 4.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small8.rb b/benchmark/hash_small8.rb
new file mode 100644
index 0000000000..9cffcc91b6
--- /dev/null
+++ b/benchmark/hash_small8.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 8.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_to_proc.rb b/benchmark/hash_to_proc.rb
new file mode 100644
index 0000000000..2b675bf509
--- /dev/null
+++ b/benchmark/hash_to_proc.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do |i|
+  [i].map(&h)
+end
diff --git a/benchmark/bm_hash_values.rb b/benchmark/hash_values.rb
index 069441302f..069441302f 100644
--- a/benchmark/bm_hash_values.rb
+++ b/benchmark/hash_values.rb
diff --git a/benchmark/int_quo.rb b/benchmark/int_quo.rb
new file mode 100644
index 0000000000..e22a3f8c30
--- /dev/null
+++ b/benchmark/int_quo.rb
@@ -0,0 +1 @@
+5000000.times { 42.quo(3) }
diff --git a/benchmark/io_copy_stream_write.rb b/benchmark/io_copy_stream_write.rb
new file mode 100644
index 0000000000..3fd87250a4
--- /dev/null
+++ b/benchmark/io_copy_stream_write.rb
@@ -0,0 +1,24 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+
+class Zero
+  def initialize
+    @n = 100000
+    @in = File.open('/dev/zero', 'rb')
+  end
+
+  def read(len, buf)
+    return if (@n -= 1) == 0
+    @in.read(len, buf)
+  end
+end
+
+begin
+  src = Zero.new
+  dst = File.open(IO::NULL, 'wb')
+  n = IO.copy_stream(src, dst)
+rescue Errno::ENOENT
+  # not *nix
+end if IO.respond_to?(:copy_stream) && IO.const_defined?(:NULL)
diff --git a/benchmark/io_copy_stream_write_socket.rb b/benchmark/io_copy_stream_write_socket.rb
new file mode 100644
index 0000000000..11f369bd0d
--- /dev/null
+++ b/benchmark/io_copy_stream_write_socket.rb
@@ -0,0 +1,35 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+class Zero
+  def initialize
+    @n = 100000
+    @in = File.open('/dev/zero', 'rb')
+  end
+
+  def read(len, buf)
+    return if (@n -= 1) == 0
+    @in.read(len, buf)
+  end
+end
+
+begin
+  require 'socket'
+  src = Zero.new
+  rd, wr = UNIXSocket.pair
+  pid = fork do
+    wr.close
+    buf = String.new
+    while rd.read(16384, buf)
+    end
+  end
+  rd.close
+  IO.copy_stream(src, wr)
+rescue Errno::ENOENT, NotImplementedError, NameError
+  # not *nix: missing /dev/zero, fork, or UNIXSocket
+rescue LoadError # no socket?
+ensure
+  wr.close if wr
+  Process.waitpid(pid) if pid
+end if IO.respond_to?(:copy_stream)
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/io_file_create.rb
index 2f205c1333..2f205c1333 100644
--- a/benchmark/bm_io_file_create.rb
+++ b/benchmark/io_file_create.rb
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/io_file_read.rb
index b9e796ed30..b9e796ed30 100644
--- a/benchmark/bm_io_file_read.rb
+++ b/benchmark/io_file_read.rb
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/io_file_write.rb
index aa1be0e5fe..aa1be0e5fe 100644
--- a/benchmark/bm_io_file_write.rb
+++ b/benchmark/io_file_write.rb
diff --git a/benchmark/bm_io_nonblock_noex.rb b/benchmark/io_nonblock_noex.rb
index da9357fdc6..da9357fdc6 100644
--- a/benchmark/bm_io_nonblock_noex.rb
+++ b/benchmark/io_nonblock_noex.rb
diff --git a/benchmark/io_nonblock_noex2.rb b/benchmark/io_nonblock_noex2.rb
new file mode 100644
index 0000000000..56819d049b
--- /dev/null
+++ b/benchmark/io_nonblock_noex2.rb
@@ -0,0 +1,21 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+begin
+  r, w = IO.pipe
+  while i < nr
+    i += 1
+    w.write_nonblock(msg, exception: false)
+    r.read_nonblock(1, buf, exception: false)
+  end
+rescue ArgumentError # old Rubies
+  while i < nr
+    i += 1
+    w.write_nonblock(msg)
+    r.read_nonblock(1, buf)
+  end
+ensure
+  r.close
+  w.close
+end
diff --git a/benchmark/io_pipe_rw.rb b/benchmark/io_pipe_rw.rb
new file mode 100644
index 0000000000..6862a8ae61
--- /dev/null
+++ b/benchmark/io_pipe_rw.rb
@@ -0,0 +1,13 @@
+# Measure uncontended GVL performance via read/write with 1:1 threading
+# If we switch to M:N threading, this will benchmark something else...
+r, w = IO.pipe
+src = '0'.freeze
+dst = String.new
+i = 0
+while i < 1_000_000
+  i += 1
+  w.write(src)
+  r.read(1, dst)
+end
+w.close
+r.close
diff --git a/benchmark/bm_io_select.rb b/benchmark/io_select.rb
index 19248daeb1..19248daeb1 100644
--- a/benchmark/bm_io_select.rb
+++ b/benchmark/io_select.rb
diff --git a/benchmark/bm_io_select2.rb b/benchmark/io_select2.rb
index 10e37d71b2..10e37d71b2 100644
--- a/benchmark/bm_io_select2.rb
+++ b/benchmark/io_select2.rb
diff --git a/benchmark/bm_io_select3.rb b/benchmark/io_select3.rb
index 7d0ba1f092..7d0ba1f092 100644
--- a/benchmark/bm_io_select3.rb
+++ b/benchmark/io_select3.rb
diff --git a/benchmark/io_write.rb b/benchmark/io_write.rb
new file mode 100644
index 0000000000..cdb409948b
--- /dev/null
+++ b/benchmark/io_write.rb
@@ -0,0 +1,22 @@
+#!/usr/bin/env ruby
+
+require 'benchmark'
+
+i, o = IO.pipe
+o.sync = true
+
+DOT = ".".freeze
+
+chunks = 100_000.times.collect{DOT}
+
+thread = Thread.new do
+  while i.read(1024)
+  end
+end
+
+100.times do
+  o.write(*chunks)
+end
+
+o.close
+thread.join
diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml
new file mode 100644
index 0000000000..ebdc8d7e8b
--- /dev/null
+++ b/benchmark/irb_color.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'irb/color'
+  code = <<~'CODE'
+    def self.foo # bar
+      :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}"
+    end
+  CODE
+benchmark:
+  irb_color_complete: |
+    IRB::Color.colorize_code(code, complete: true)
+  irb_color_incomplete: |
+    IRB::Color.colorize_code(code, complete: false)
+loop_count: 2000000
diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml
new file mode 100644
index 0000000000..28933f8b38
--- /dev/null
+++ b/benchmark/irb_exec.yml
@@ -0,0 +1,10 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'rbconfig'
+  irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f']
+benchmark:
+  irb_exec: |
+    IO.popen(irb_f, 'w') do |io|
+      io.write('exit')
+    end
+loop_count: 30
diff --git a/benchmark/iseq_load_from_binary.yml b/benchmark/iseq_load_from_binary.yml
new file mode 100644
index 0000000000..7e9d73bdd4
--- /dev/null
+++ b/benchmark/iseq_load_from_binary.yml
@@ -0,0 +1,25 @@
+prelude: |
+  symbol = RubyVM::InstructionSequence.compile(":foo; :bar; :baz; :egg; :spam").to_binary
+
+  define_method = RubyVM::InstructionSequence.compile(%{
+    def foo; end
+    def bar; end
+    def baz; end
+    def egg; end
+    def spam; end
+  }).to_binary
+
+  all = RubyVM::InstructionSequence.compile(%{
+    module Foo; def foo; :foo; end; end
+    module Bar; def bar; :bar; end; end
+    module Baz; def baz; :baz; end; end
+    class Egg; def egg; :egg; end; end
+    class Spaml; def spam; :spam; end; end
+  }).to_binary
+
+benchmark:
+  symbol: RubyVM::InstructionSequence.load_from_binary(symbol)
+  define_method: RubyVM::InstructionSequence.load_from_binary(define_method)
+  all: RubyVM::InstructionSequence.load_from_binary(all)
+
+loop_count: 100_000
diff --git a/benchmark/ivar_extend.yml b/benchmark/ivar_extend.yml
new file mode 100644
index 0000000000..eb9ee923f5
--- /dev/null
+++ b/benchmark/ivar_extend.yml
@@ -0,0 +1,23 @@
+prelude: |
+  class Embedded
+    def initialize
+      @a = 1
+      @b = 1
+      @c = 1
+    end
+  end
+
+  class Extended
+    def initialize
+      @a = 1
+      @b = 1
+      @c = 1
+      @d = 1
+      @e = 1
+      @f = 1
+    end
+  end
+benchmark:
+  embedded: Embedded.new
+  extended: Extended.new
+loop_count: 20_000_000
diff --git a/benchmark/kernel_clone.yml b/benchmark/kernel_clone.yml
new file mode 100644
index 0000000000..069b23abcd
--- /dev/null
+++ b/benchmark/kernel_clone.yml
@@ -0,0 +1,6 @@
+prelude: "object = Object.new"
+benchmark:
+  clone: "object.clone"
+  clone_true: "object.clone(freeze: true)"
+  clone_false: "object.clone(freeze: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_float.yml b/benchmark/kernel_float.yml
new file mode 100644
index 0000000000..215f6750fc
--- /dev/null
+++ b/benchmark/kernel_float.yml
@@ -0,0 +1,5 @@
+benchmark:
+  float: "Float(42)"
+  float_true: "Float(42, exception: true)"
+  float_false: "Float(42, exception: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_tap.yml b/benchmark/kernel_tap.yml
new file mode 100644
index 0000000000..4dcbb31b4d
--- /dev/null
+++ b/benchmark/kernel_tap.yml
@@ -0,0 +1,6 @@
+prelude: |
+  obj = Object.new
+  x = nil
+benchmark:
+  kernel_tap: obj.tap { |o| x = o }
+loop_count: 20000000
diff --git a/benchmark/kernel_then.yml b/benchmark/kernel_then.yml
new file mode 100644
index 0000000000..85f7341e33
--- /dev/null
+++ b/benchmark/kernel_then.yml
@@ -0,0 +1,6 @@
+benchmark:
+  kernel_then: 1.then { |i| i + 1 }
+  kernel_then_enum: 1.then
+  kernel_yield_self: 1.yield_self { |i| i + 1 }
+  kernel_yield_self_enum: 1.yield_self
+loop_count: 20000000
diff --git a/benchmark/keyword_arguments.yml b/benchmark/keyword_arguments.yml
new file mode 100644
index 0000000000..fce6bce0b8
--- /dev/null
+++ b/benchmark/keyword_arguments.yml
@@ -0,0 +1,13 @@
+prelude: |
+  h = {a: 1}
+  def kw(a: 1) a end
+  def kws(**kw) kw end
+benchmark:
+  kw_to_kw: "kw(a: 1)"
+  kw_splat_to_kw: "kw(**h)"
+  kw_to_kw_splat: "kws(a: 1)"
+  kw_splat_to_kw_splat: "kws(**h)"
+  kw_and_splat_to_kw: "kw(a: 1, **h)"
+  kw_splats_to_kw: "kw(**h, **h)"
+  kw_and_splat_to_kw_splat: "kws(a: 1, **h)"
+  kw_splats_to_kw_splat: "kws(**h, **h)"
diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb
new file mode 100644
index 0000000000..d22236e9fb
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/output/driver.rb
@@ -0,0 +1,36 @@
+require 'benchmark_driver/output/simple'
+
+# This replicates the legacy benchmark/driver.rb behavior.
+class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple
+  def initialize(*)
+    super
+    @stdout = $stdout
+    @strio  = StringIO.new
+    $stdout = IOMultiplexer.new(@stdout, @strio)
+  end
+
+  def with_benchmark(*)
+    super
+  ensure
+    logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log"
+    puts "\nLog file: #{logfile}"
+
+    $stdout = @stdout
+    File.write(logfile, @strio.tap(&:rewind).read)
+  end
+
+  class IOMultiplexer
+    def initialize(io1, io2)
+      @io1 = io1
+      @io2 = io2
+    end
+
+    [:write, :sync, :sync=, :puts, :print, :flush].each do |method|
+      define_method(method) do |*args|
+        @io1.send(method, *args)
+        @io2.send(method, *args)
+      end
+    end
+  end
+  private_constant :IOMultiplexer
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb
new file mode 100644
index 0000000000..3c3453e527
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cstime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :cstime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb
new file mode 100644
index 0000000000..e139962ef2
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cutime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :cutime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/mjit.rb b/benchmark/lib/benchmark_driver/runner/mjit.rb
new file mode 100644
index 0000000000..3a58a620de
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/mjit.rb
@@ -0,0 +1,34 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'erb'
+
+# A runner to measure after-JIT performance easily
+class BenchmarkDriver::Runner::Mjit < BenchmarkDriver::Runner::Ips
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
+    def parse(**)
+      jobs = super
+      jobs.map do |job|
+        job = job.dup
+        job.prelude = "#{job.prelude}\n#{<<~EOS}"
+          if defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled?
+            __bmdv_ruby_i = 0
+            while __bmdv_ruby_i < 10000 # MJIT call threshold
+              #{job.script}
+              __bmdv_ruby_i += 1
+            end
+            RubyVM::MJIT.pause # compile
+            #{job.script}
+            RubyVM::MJIT.resume; RubyVM::MJIT.pause # recompile
+            #{job.script}
+            RubyVM::MJIT.resume; RubyVM::MJIT.pause # recompile 2
+          end
+        EOS
+        job
+      end
+    end
+  })
+end
diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb
new file mode 100644
index 0000000000..d04f2e51ff
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/peak.rb
@@ -0,0 +1,151 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Peak
+  METRIC = BenchmarkDriver::Metric.new(
+    name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger',
+  )
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  # @param [BenchmarkDriver::Config::RunnerConfig] config
+  # @param [BenchmarkDriver::Output] output
+  # @param [BenchmarkDriver::Context] contexts
+  def initialize(config:, output:, contexts:)
+    @config = config
+    @output = output
+    @contexts = contexts
+  end
+
+  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+  # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
+  def run(jobs)
+    if jobs.any? { |job| job.loop_count.nil? }
+      jobs = jobs.map do |job|
+        job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1))
+      end
+    end
+
+    @output.with_benchmark do
+      jobs.each do |job|
+        @output.with_job(name: job.name) do
+          job.runnable_contexts(@contexts).each do |context|
+            value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+              run_benchmark(job, context: context)
+            end
+            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+              @output.report(values: { metric => value }, loop_count: job.loop_count)
+            end
+          end
+        end
+      end
+    end
+  end
+
+  private
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__)
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      with_script(benchmark.render) do |path|
+        output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read)
+        if $?.success?
+          Integer(f.read)
+        else
+          $stdout.print(output)
+          BenchmarkDriver::Result::ERROR
+        end
+      end
+    end
+  end
+
+  # Overridden by BenchmarkDriver::Runner::Size
+  def target
+    'peak'
+  end
+
+  # Overridden by BenchmarkDriver::Runner::Size
+  def metric
+    METRIC
+  end
+
+  def with_script(script)
+    if @config.verbose >= 2
+      sep = '-' * 30
+      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+    end
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      f.puts script
+      f.close
+      return yield(f.path)
+    end
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    def render
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      <<-RUBY
+#{prelude}
+#{while_loop(script, loop_count)}
+#{teardown}
+
+result_file, target, memory_status = ARGV
+require_relative memory_status
+
+ms = Memory::Status.new
+case target.to_sym
+when :peak
+  key = ms.respond_to?(:hwm) ? :hwm : :peak
+when :size
+  key = ms.respond_to?(:rss) ? :rss : :size
+else
+  raise('unexpected target: ' + target)
+end
+
+File.write(result_file, ms[key])
+      RUBY
+    end
+
+    private
+
+    def while_loop(content, times)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      end
+
+      if times > 1
+        <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+  #{content}
+  __bmdv_i += 1
+end
+        RUBY
+      else
+        content
+      end
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/ractor.rb b/benchmark/lib/benchmark_driver/runner/ractor.rb
new file mode 100644
index 0000000000..c730b8e4a5
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/ractor.rb
@@ -0,0 +1,122 @@
+require 'erb'
+
+# A runner to measure performance *inside* Ractor
+class BenchmarkDriver::Runner::Ractor < BenchmarkDriver::Runner::Ips
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob) do
+    attr_accessor :ractor
+  end
+
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
+    def parse(ractor: 1, **kwargs)
+      super(**kwargs).each do |job|
+        job.ractor = ractor
+      end
+    end
+  })
+
+  private
+
+  unless private_instance_methods.include?(:run_benchmark)
+    raise "#run_benchmark is no longer defined in BenchmarkDriver::Runner::Ips"
+  end
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    results = job.ractor.times.map do
+      Tempfile.open('benchmark_driver_result')
+    end
+    duration = with_script(benchmark.render(results: results.map(&:path))) do |path|
+      success = execute(*context.executable.command, path, exception: false)
+      if success && ((value = results.map { |f| Float(f.read) }.max) > 0)
+        value
+      else
+        BenchmarkDriver::Result::ERROR
+      end
+    end
+    results.each(&:close)
+
+    value_duration(
+      loop_count: job.loop_count,
+      duration: duration,
+    )
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    # @param [String] result - A file to write result
+    def render(results:)
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      ERB.new(<<-RUBY).result_with_hash(results: results)
+Warning[:experimental] = false
+# shareable-constant-value: experimental_everything
+#{prelude}
+
+if #{loop_count} == 1
+  __bmdv_loop_before = 0
+  __bmdv_loop_after = 0
+else
+  __bmdv_loop_before = Time.new
+  #{while_loop('', loop_count, id: 0)}
+  __bmdv_loop_after = Time.new
+end
+
+__bmdv_ractors = []
+<% results.size.times do %>
+__bmdv_ractors << Ractor.new(__bmdv_loop_after - __bmdv_loop_before) { |__bmdv_loop_time|
+  __bmdv_time = Time
+  __bmdv_script_before = __bmdv_time.new
+  #{while_loop(script, loop_count, id: 1)}
+  __bmdv_script_after = __bmdv_time.new
+
+  (__bmdv_script_after - __bmdv_script_before) - __bmdv_loop_time
+}
+<% end %>
+
+# Wait for all Ractors before executing code to write results
+__bmdv_ractors.map!(&:take)
+
+<% results.each do |result| %>
+File.write(<%= result.dump %>, __bmdv_ractors.shift)
+<% end %>
+
+#{teardown}
+      RUBY
+    end
+
+    private
+
+    # id is to prevent:
+    # can not isolate a Proc because it accesses outer variables (__bmdv_i)
+    def while_loop(content, times, id:)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      elsif times == 1
+        return content
+      end
+
+      # TODO: execute in batch
+      <<-RUBY
+__bmdv_i#{id} = 0
+while __bmdv_i#{id} < #{times}
+  #{content}
+  __bmdv_i#{id} += 1
+end
+      RUBY
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb
new file mode 100644
index 0000000000..1b31f901c7
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/size.rb
@@ -0,0 +1,25 @@
+require 'benchmark_driver/runner/peak'
+
+# Actually the same as BenchmarkDriver::Runner::Memory
+class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak
+  METRIC = BenchmarkDriver::Metric.new(
+    name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger',
+  )
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Peak#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Peak#target
+  def target
+    'size'
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb
new file mode 100644
index 0000000000..4577fb0bf8
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/stime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :stime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb
new file mode 100644
index 0000000000..64dc14f84e
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/total.rb
@@ -0,0 +1,137 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  # @param [BenchmarkDriver::Config::RunnerConfig] config
+  # @param [BenchmarkDriver::Output] output
+  # @param [BenchmarkDriver::Context] contexts
+  def initialize(config:, output:, contexts:)
+    @config = config
+    @output = output
+    @contexts = contexts
+  end
+
+  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+  # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs
+  def run(jobs)
+    if jobs.any? { |job| job.loop_count.nil? }
+      raise 'missing loop_count is not supported in Ruby repository'
+    end
+
+    @output.with_benchmark do
+      jobs.each do |job|
+        @output.with_job(name: job.name) do
+          job.runnable_contexts(@contexts).each do |context|
+            duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+              run_benchmark(job, context: context)
+            end
+            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+              @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count)
+            end
+          end
+        end
+      end
+    end
+  end
+
+  private
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      with_script(benchmark.render(result: f.path, target: target)) do |path|
+        IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2
+        if $?.success?
+          Float(f.read)
+        else
+          BenchmarkDriver::Result::ERROR
+        end
+      end
+    end
+  end
+
+  # This method is overridden by some subclasses
+  def metric
+    METRIC
+  end
+
+  # This method is overridden by some subclasses
+  def target
+    :total
+  end
+
+  def with_script(script)
+    if @config.verbose >= 2
+      sep = '-' * 30
+      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+    end
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      f.puts script
+      f.close
+      return yield(f.path)
+    end
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    # @param [String] result - A file to write result
+    def render(result:, target:)
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      <<-RUBY
+#{prelude}
+
+require 'benchmark'
+__bmdv_result = Benchmark.measure {
+  #{while_loop(script, loop_count)}
+}
+
+#{teardown}
+
+File.write(#{result.dump}, __bmdv_result.#{target})
+      RUBY
+    end
+
+    private
+
+    def while_loop(content, times)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      elsif times == 1
+        return content
+      end
+
+      # TODO: execute in batch
+      <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+  #{content}
+  __bmdv_i += 1
+end
+      RUBY
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb
new file mode 100644
index 0000000000..b61d83a188
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/utime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :utime
+  end
+end
diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb
new file mode 100644
index 0000000000..31b770c484
--- /dev/null
+++ b/benchmark/lib/load.rb
@@ -0,0 +1,18 @@
+# How to use this file:
+#   1. write a `$(srcdir)/test.rb` like:
+=begin
+require_relative 'benchmark/lib/load'
+
+Benchmark.driver(repeat_count: 5){|x|
+  x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby'
+  x.executable name: 'modif-miniruby', command: %w'./miniruby'
+
+  x.report %q{
+    h = {a: 1, b: 2, c: 3, d: 4}
+  }
+}
+=end
+#
+#  2. `make run`
+$:.unshift(File.join(__dir__, '../benchmark-driver/lib'))
+require 'benchmark_driver'
diff --git a/benchmark/bm_loop_for.rb b/benchmark/loop_for.rb
index 0fc4cc1511..0fc4cc1511 100644
--- a/benchmark/bm_loop_for.rb
+++ b/benchmark/loop_for.rb
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/loop_generator.rb
index d3375c744c..d3375c744c 100644
--- a/benchmark/bm_loop_generator.rb
+++ b/benchmark/loop_generator.rb
diff --git a/benchmark/bm_loop_times.rb b/benchmark/loop_times.rb
index 521f72ad1a..521f72ad1a 100644
--- a/benchmark/bm_loop_times.rb
+++ b/benchmark/loop_times.rb
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/loop_whileloop.rb
index 0072822c06..0072822c06 100644
--- a/benchmark/bm_loop_whileloop.rb
+++ b/benchmark/loop_whileloop.rb
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/loop_whileloop2.rb
index 47d02dffc4..47d02dffc4 100644
--- a/benchmark/bm_loop_whileloop2.rb
+++ b/benchmark/loop_whileloop2.rb
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
deleted file mode 100644
index b6d787ae27..0000000000
--- a/benchmark/make_fasta_output.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-# prepare 'fasta.output'
-
-def prepare_fasta_output n
-  filebase = File.join(File.dirname($0), 'fasta.output')
-  script = File.join(File.dirname($0), 'bm_so_fasta.rb')
-  file = "#{filebase}.#{n}"
-
-  unless FileTest.exist?(file)
-    STDERR.puts "preparing #{file}"
-
-    open(file, 'w'){|f|
-      ARGV[0] = n
-      $stdout = f
-      load script
-      $stdout = STDOUT
-    }
-  end
-end
-
diff --git a/benchmark/bm_marshal_dump_flo.rb b/benchmark/marshal_dump_flo.rb
index 9b8d0c6afb..9b8d0c6afb 100644
--- a/benchmark/bm_marshal_dump_flo.rb
+++ b/benchmark/marshal_dump_flo.rb
diff --git a/benchmark/bm_marshal_dump_load_geniv.rb b/benchmark/marshal_dump_load_geniv.rb
index 8252ad90fa..8252ad90fa 100644
--- a/benchmark/bm_marshal_dump_load_geniv.rb
+++ b/benchmark/marshal_dump_load_geniv.rb
diff --git a/benchmark/marshal_dump_load_integer.yml b/benchmark/marshal_dump_load_integer.yml
new file mode 100644
index 0000000000..78ebf823d2
--- /dev/null
+++ b/benchmark/marshal_dump_load_integer.yml
@@ -0,0 +1,22 @@
+prelude: |
+  smallint_array = 1000.times.map { |x| x }
+  bigint32_array = 1000.times.map { |x| x + 2**32 }
+  bigint64_array = 1000.times.map { |x| x + 2**64 }
+
+  smallint_dump = Marshal.dump(smallint_array)
+  bigint32_dump = Marshal.dump(bigint32_array)
+  bigint64_dump = Marshal.dump(bigint64_array)
+benchmark:
+  marshal_dump_integer_small: |
+    Marshal.dump(smallint_array)
+  marshal_dump_integer_over_32_bit: |
+    Marshal.dump(bigint32_array)
+  marshal_dump_integer_over_64_bit: |
+    Marshal.dump(bigint64_array)
+  marshal_load_integer_small: |
+    Marshal.load(smallint_dump)
+  marshal_load_integer_over_32_bit: |
+    Marshal.load(bigint32_dump)
+  marshal_load_integer_over_64_bit: |
+    Marshal.load(bigint64_dump)
+loop_count: 4000
diff --git a/benchmark/bm_marshal_dump_load_time.rb b/benchmark/marshal_dump_load_time.rb
index e29743b791..e29743b791 100644
--- a/benchmark/bm_marshal_dump_load_time.rb
+++ b/benchmark/marshal_dump_load_time.rb
diff --git a/benchmark/masgn.yml b/benchmark/masgn.yml
new file mode 100644
index 0000000000..31cb8ee4a3
--- /dev/null
+++ b/benchmark/masgn.yml
@@ -0,0 +1,53 @@
+prelude: |
+  a = [nil] * 3
+  b = Class.new{attr_writer :a, :b, :c}.new
+  c = d = e = f = g = h = i = nil
+benchmark:
+  array2_2: "c = (a[0], a[1] = 1, 2)"
+  array2_3: "c = (a[0], a[1] = 1, 2, 3)"
+  array3_2: "c = (a[0], a[1], a[2] = 1, 2)"
+  array3_3: "c = (a[0], a[1], a[2] = 1, 2, 3)"
+  attr2_2: "c = (b.a, b.b = 1, 2)"
+  attr2_3: "c = (b.a, b.b = 1, 2, 3)"
+  attr3_2: "c = (b.a, b.b, b.c = 1, 2)"
+  attr3_3: "c = (b.a, b.b, b.c = 1, 2, 3)"
+  lvar2_2: "c = (d, e = 1, 2)"
+  lvar2_3: "c = (d, e = 1, 2, 3)"
+  lvar3_2: "c = (d, e, f = 1, 2)"
+  lvar3_3: "c = (d, e, f = 1, 2, 3)"
+  array2_2p: "(a[0], a[1] = 1, 2; nil)"
+  array2_3p: "(a[0], a[1] = 1, 2, 3; nil)"
+  array3_2p: "(a[0], a[1], a[2] = 1, 2; nil)"
+  array3_3p: "(a[0], a[1], a[2] = 1, 2, 3; nil)"
+  attr2_2p: "(b.a, b.b = 1, 2; nil)"
+  attr2_3p: "(b.a, b.b = 1, 2, 3; nil)"
+  attr3_2p: "(b.a, b.b, b.c = 1, 2; nil)"
+  attr3_3p: "(b.a, b.b, b.c = 1, 2, 3; nil)"
+  lvar2_2p: "(d, e = 1, 2; nil)"
+  lvar2_3p: "(d, e = 1, 2, 3; nil)"
+  lvar3_2p: "(d, e, f = 1, 2; nil)"
+  lvar3_3p: "(d, e, f = 1, 2, 3; nil)"
+  array2_2lv: "c = (a[0], a[1] = g, h)"
+  array2_ilv: "c = (a[0], a[1] = g, h, i)"
+  arrayi_2lv: "c = (a[0], a[1], a[2] = g, h)"
+  arrayi_ilv: "c = (a[0], a[1], a[2] = g, h, i)"
+  attr2_2lv: "c = (b.a, b.b = g, h)"
+  attr2_ilv: "c = (b.a, b.b = g, h, i)"
+  attri_2lv: "c = (b.a, b.b, b.c = g, h)"
+  attri_ilv: "c = (b.a, b.b, b.c = g, h, i)"
+  lvar2_2lv: "c = (d, e = g, h)"
+  lvar2_ilv: "c = (d, e = g, h, i)"
+  lvari_2lv: "c = (d, e, f = g, h)"
+  lvari_ilv: "c = (d, e, f = g, h, i)"
+  array2_2plv: "(a[0], a[1] = g, h; nil)"
+  array2_iplv: "(a[0], a[1] = g, h, i; nil)"
+  arrayi_2plv: "(a[0], a[1], a[2] = g, h; nil)"
+  arrayi_iplv: "(a[0], a[1], a[2] = g, h, i; nil)"
+  attr2_2plv: "(b.a, b.b = g, h; nil)"
+  attr2_iplv: "(b.a, b.b = g, h, i; nil)"
+  attri_2plv: "(b.a, b.b, b.c = g, h; nil)"
+  attri_iplv: "(b.a, b.b, b.c = g, h, i; nil)"
+  lvar2_2plv: "(d, e = g, h; nil)"
+  lvar2_iplv: "(d, e = g, h, i; nil)"
+  lvari_2plv: "(d, e, f = g, h; nil)"
+  lvari_iplv: "(d, e, f = g, h, i; nil)"
diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb
new file mode 100644
index 0000000000..ffda109912
--- /dev/null
+++ b/benchmark/match_gt4.rb
@@ -0,0 +1 @@
+1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") }
diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb
new file mode 100644
index 0000000000..3b743d484a
--- /dev/null
+++ b/benchmark/match_small.rb
@@ -0,0 +1 @@
+1000000.times { 'haystack'.match(/hay/) }
diff --git a/benchmark/method_bind_call.yml b/benchmark/method_bind_call.yml
new file mode 100644
index 0000000000..9e0e046ed4
--- /dev/null
+++ b/benchmark/method_bind_call.yml
@@ -0,0 +1,16 @@
+prelude: |
+  named_module = Kernel
+
+  module FakeName
+    def self.name
+      "NotMyame".freeze
+    end
+  end
+
+  MOD_NAME = Module.instance_method(:name)
+
+benchmark:
+  fastpath: MOD_NAME.bind_call(Kernel)
+  slowpath: MOD_NAME.bind_call(FakeName)
+
+loop_count: 100_000
diff --git a/benchmark/mjit_exivar.yml b/benchmark/mjit_exivar.yml
new file mode 100644
index 0000000000..2584fa6410
--- /dev/null
+++ b/benchmark/mjit_exivar.yml
@@ -0,0 +1,18 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+  class Bench < Hash
+    def initialize
+      @exivar = nil
+    end
+
+    def exivar
+      @exivar
+    end
+  end
+
+  bench = Bench.new
+
+benchmark:
+  mjit_exivar: bench.exivar
+
+loop_count: 200000000
diff --git a/benchmark/mjit_integer.yml b/benchmark/mjit_integer.yml
new file mode 100644
index 0000000000..a6b5c9ee16
--- /dev/null
+++ b/benchmark/mjit_integer.yml
@@ -0,0 +1,32 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+  def mjit_abs(int)        int.abs        end
+  def mjit_bit_length(int) int.bit_length end
+  def mjit_comp(int)       ~int           end
+  def mjit_even?(int)      int.even?      end
+  def mjit_integer?(int)   int.integer?   end
+  def mjit_magnitude(int)  int.magnitude  end
+  def mjit_odd?(int)       int.odd?       end
+  def mjit_ord(int)        int.ord        end
+  def mjit_size(int)       int.size       end
+  def mjit_to_i(int)       int.to_i       end
+  def mjit_to_int(int)     int.to_int     end
+  def mjit_uminus(int)     -int           end
+  def mjit_zero?(int)      int.zero?      end
+
+benchmark:
+  - mjit_abs(-1)
+  - mjit_bit_length(100)
+  - mjit_comp(1)
+  - mjit_even?(2)
+  - mjit_integer?(0)
+  - mjit_magnitude(-1)
+  - mjit_odd?(1)
+  - mjit_ord(1)
+  - mjit_size(1)
+  - mjit_to_i(1)
+  - mjit_to_int(1)
+  - mjit_uminus(1)
+  - mjit_zero?(0)
+
+loop_count: 40000000
diff --git a/benchmark/mjit_kernel.yml b/benchmark/mjit_kernel.yml
new file mode 100644
index 0000000000..7720e65c2c
--- /dev/null
+++ b/benchmark/mjit_kernel.yml
@@ -0,0 +1,20 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+  def mjit_class(obj)
+    obj.class
+  end
+
+  def mjit_frozen?(obj)
+    obj.frozen?
+  end
+
+  str = ""
+  fstr = "".freeze
+
+benchmark:
+  - mjit_class(self)
+  - mjit_class(1)
+  - mjit_frozen?(str)
+  - mjit_frozen?(fstr)
+
+loop_count: 40000000
diff --git a/benchmark/mjit_leave.yml b/benchmark/mjit_leave.yml
new file mode 100644
index 0000000000..9ac68b164b
--- /dev/null
+++ b/benchmark/mjit_leave.yml
@@ -0,0 +1,8 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+  def leave
+    nil
+  end
+benchmark:
+  mjit_leave: leave
+loop_count: 200000000
diff --git a/benchmark/mjit_opt_cc_insns.yml b/benchmark/mjit_opt_cc_insns.yml
new file mode 100644
index 0000000000..fed6d34bd5
--- /dev/null
+++ b/benchmark/mjit_opt_cc_insns.yml
@@ -0,0 +1,27 @@
+# opt_* insns using vm_method_cfunc_is with send-compatible operands:
+#   * opt_nil_p
+#   * opt_not
+#   * opt_eq
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+  def mjit_nil?(obj)
+    obj.nil?
+  end
+
+  def mjit_not(obj)
+    !obj
+  end
+
+  def mjit_eq(a, b)
+    a == b
+  end
+
+benchmark:
+  - script: mjit_nil?(1)
+    loop_count: 40000000
+  - script: mjit_not(1)
+    loop_count: 40000000
+  - script: mjit_eq(1, nil)
+    loop_count: 8000000
+  - script: mjit_eq(nil, 1)
+    loop_count: 8000000
diff --git a/benchmark/mjit_struct_aref.yml b/benchmark/mjit_struct_aref.yml
new file mode 100644
index 0000000000..bfba1323f2
--- /dev/null
+++ b/benchmark/mjit_struct_aref.yml
@@ -0,0 +1,10 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+  def mjit_struct_aref(struct)
+    struct.aa
+  end
+  struct = Struct.new(:a0, :a1, :a2, :a3, :a4, :a5, :a6, :a7, :a8, :a9, :aa).new
+
+benchmark: mjit_struct_aref(struct)
+
+loop_count: 40000000
diff --git a/benchmark/module_eqq.yml b/benchmark/module_eqq.yml
new file mode 100644
index 0000000000..a561fb86dc
--- /dev/null
+++ b/benchmark/module_eqq.yml
@@ -0,0 +1,27 @@
+prelude: |
+  class SimpleClass; end
+  class MediumClass
+    10.times { include Module.new }
+  end
+  class LargeClass
+    100.times { include Module.new }
+  end
+  class HugeClass
+    300.times { include Module.new }
+  end
+  SimpleObj = SimpleClass.new
+  MediumObj = MediumClass.new
+  LargeObj = LargeClass.new
+  HugeObj = HugeClass.new
+benchmark:
+  simple_class_eqq_simple_obj: |
+    SimpleClass === SimpleObj
+  medium_class_eqq_simple_obj: |
+    MediumClass === SimpleObj
+  simple_class_eqq_medium_obj: |
+    SimpleClass === MediumObj
+  simple_class_eqq_large_obj: |
+    SimpleClass === LargeObj
+  simple_class_eqq_huge_obj: |
+    SimpleClass === HugeObj
+loop_count: 20000000
diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml
new file mode 100644
index 0000000000..79ba4f2177
--- /dev/null
+++ b/benchmark/nil_p.yml
@@ -0,0 +1,9 @@
+prelude: |
+  class Niller; def nil?; true; end; end
+  xnil, notnil = nil, Object.new
+  niller = Niller.new
+benchmark:
+  - xnil.nil?
+  - notnil.nil?
+  - niller.nil?
+loop_count: 10000000
diff --git a/benchmark/nilclass.yml b/benchmark/nilclass.yml
new file mode 100644
index 0000000000..fba67a5f6a
--- /dev/null
+++ b/benchmark/nilclass.yml
@@ -0,0 +1,6 @@
+benchmark:
+  to_i: |
+    nil.to_i
+  to_f: |
+    nil.to_f
+loop_count: 100000
diff --git a/benchmark/num_zero_p.yml b/benchmark/num_zero_p.yml
new file mode 100644
index 0000000000..2195963433
--- /dev/null
+++ b/benchmark/num_zero_p.yml
@@ -0,0 +1,8 @@
+benchmark:
+  - 0.zero?
+  - 1.zero?
+  - 0r.zero?
+  - 1r.zero?
+  - 0i.zero?
+  - 1i.zero?
+loop_count: 50000000
diff --git a/benchmark/numeric_methods.yml b/benchmark/numeric_methods.yml
new file mode 100644
index 0000000000..1384902935
--- /dev/null
+++ b/benchmark/numeric_methods.yml
@@ -0,0 +1,29 @@
+prelude: |
+  int = 42
+  flo = 4.2
+benchmark:
+  real?: |
+    int.real?
+  integer?: |
+    flo.integer?
+  finite?: |
+    int.finite?
+  infinite?: |
+    int.infinite?
+  integer_real: |
+    int.real
+  float_real: |
+    flo.real
+  integr_imag: |
+    int.imag
+  float_imag: |
+    flo.imag
+  integer_conj: |
+    int.conj
+  float_conj: |
+    flo.conj
+  integer_numerator: |
+    int.numerator
+  integer_denominator: |
+    int.denominator
+loop_count: 20000000
diff --git a/benchmark/object_allocate.yml b/benchmark/object_allocate.yml
new file mode 100644
index 0000000000..93ff463e41
--- /dev/null
+++ b/benchmark/object_allocate.yml
@@ -0,0 +1,21 @@
+prelude: |
+  class Eight
+    8.times { include(Module.new) }
+  end
+  class ThirtyTwo
+    32.times { include(Module.new) }
+  end
+  class SixtyFour
+    64.times { include(Module.new) }
+  end
+  class OneTwentyEight
+    128.times { include(Module.new) }
+  end
+  # Disable GC to see raw throughput:
+  GC.disable
+benchmark:
+  allocate_8_deep: Eight.new
+  allocate_32_deep: ThirtyTwo.new
+  allocate_64_deep: SixtyFour.new
+  allocate_128_deep: OneTwentyEight.new
+loop_count: 100000
diff --git a/benchmark/objspace_dump_all.yml b/benchmark/objspace_dump_all.yml
new file mode 100644
index 0000000000..ebab562d2e
--- /dev/null
+++ b/benchmark/objspace_dump_all.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'objspace'
+  require 'tempfile'
+  $objs = 1_000.times.map { Object.new }
+  $strings = 1_000.times.map { |i| "string #{i}" }
+  $file = Tempfile.new('heap')
+  $dev_null = File.open(File::NULL, 'w+')
+
+benchmark:
+  dump_all_string: "ObjectSpace.dump_all(output: :string)"
+  dump_all_file: "ObjectSpace.dump_all(output: $file)"
+  dump_all_dev_null: "ObjectSpace.dump_all(output: $dev_null)"
+loop_count: 1
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
index 01593965d9..1ce9f76275 100644
--- a/benchmark/other-lang/fact.py
+++ b/benchmark/other-lang/fact.py
@@ -3,7 +3,7 @@
 
 def factL(n):
 	r = 1
-	for x in range(2, n):
+	for x in range(2, n+1):
 		r *= x
 	return r
 
diff --git a/benchmark/pm_array.yml b/benchmark/pm_array.yml
new file mode 100644
index 0000000000..babb65a289
--- /dev/null
+++ b/benchmark/pm_array.yml
@@ -0,0 +1,19 @@
+prelude: |
+  def call(*val)
+    case val
+      in [String => body]
+        [200, {}, [body]]
+      in [Integer => status]
+        [status, {}, [""]]
+      in [Integer, String] => response
+        [response[0], {}, [response[1]]]
+      in [Integer, Hash, String] => response
+        [response[0], response[1], [response[2]]]
+    end
+  end
+
+benchmark:
+  first_match: call("ok")
+  second_match: call(401)
+  third_match: call(200, "ok")
+  fourth_match: call(201, {}, "created")
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
deleted file mode 100644
index ee2138cdb2..0000000000
--- a/benchmark/prepare_so_count_words.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# prepare 'wc.input'
-
-def prepare_wc_input
-  wcinput = File.join(File.dirname($0), 'wc.input')
-  wcbase  = File.join(File.dirname($0), 'wc.input.base')
-  unless FileTest.exist?(wcinput)
-    data = File.read(wcbase)
-    13.times{
-      data << data
-    }
-    open(wcinput, 'w'){|f| f.write data}
-  end
-end
-
-prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
deleted file mode 100644
index d83aeb7a7e..0000000000
--- a/benchmark/prepare_so_k_nucleotide.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
deleted file mode 100644
index da3ec2df14..0000000000
--- a/benchmark/prepare_so_reverse_complement.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(2_500_000)
diff --git a/benchmark/ractor_const.yml b/benchmark/ractor_const.yml
new file mode 100644
index 0000000000..d7ab74bdca
--- /dev/null
+++ b/benchmark/ractor_const.yml
@@ -0,0 +1,4 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+  ractor_const: Object
+ractor: 1
diff --git a/benchmark/ractor_float_to_s.yml b/benchmark/ractor_float_to_s.yml
new file mode 100644
index 0000000000..8f492be668
--- /dev/null
+++ b/benchmark/ractor_float_to_s.yml
@@ -0,0 +1,8 @@
+type: lib/benchmark_driver/runner/ractor
+prelude: |
+  FLOATS = [*0.0.step(1.0, 0.001)]
+benchmark:
+  ractor_float_to_s: |
+    FLOATS.each {|f| f.to_s}
+loop_count: 100
+ractor: 2
diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml
new file mode 100644
index 0000000000..a6674f82ee
--- /dev/null
+++ b/benchmark/range_last.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - (1..1_000_000).last(100)
+  - (1..1_000_000).last(1000)
+  - (1..1_000_000).last(10000)
diff --git a/benchmark/range_min.yml b/benchmark/range_min.yml
new file mode 100644
index 0000000000..9e60dd7308
--- /dev/null
+++ b/benchmark/range_min.yml
@@ -0,0 +1,2 @@
+benchmark:
+  - (1..10).min
diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml
new file mode 100644
index 0000000000..90a029d5b9
--- /dev/null
+++ b/benchmark/realpath.yml
@@ -0,0 +1,30 @@
+prelude: |
+  f = File
+  pwd = Dir.pwd
+  Dir.mkdir('b') unless f.directory?('b')
+  f.write('b/a', '') unless f.file?('b/a')
+
+  relative = 'b/a'
+  absolute = File.join(pwd, relative)
+  dir = 'b'
+  file = 'a'
+
+  relative_dir = 'b/c'
+  absolute_dir = File.join(pwd, relative_dir)
+  file_dir = 'c'
+benchmark:
+  relative_nil: "f.realpath(relative, nil)"
+  absolute_nil: "f.realpath(absolute, nil)"
+  relative_relative: "f.realpath(file, dir)"
+  absolute_relative: "f.realpath(absolute, dir)"
+  relative_absolute: "f.realpath(relative, pwd)"
+  relative_nil_dir: "f.realdirpath(relative_dir, nil)"
+  absolute_nil_dir: "f.realdirpath(absolute_dir, nil)"
+  relative_relative_dir: "f.realdirpath(file_dir, dir)"
+  absolute_relative_dir: "f.realdirpath(absolute_dir, dir)"
+  relative_absolute_dir: "f.realdirpath(relative_dir, pwd)"
+  relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil"
+  absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil"
+  relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil"
+  absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil"
+  relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil"
diff --git a/benchmark/report.rb b/benchmark/report.rb
deleted file mode 100644
index d2dc56b1e1..0000000000
--- a/benchmark/report.rb
+++ /dev/null
@@ -1,79 +0,0 @@
-#
-# YARV benchmark driver
-#
-
-require 'yarvutil'
-require 'benchmark'
-require 'rbconfig'
-
-def exec_command type, file, w
-  <<-EOP
-  $DRIVER_PATH = '#{File.dirname($0)}'
-  $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
-  require 'benchmark'
-  require 'yarvutil'
-#  print '#{type}'
-  begin
-    puts Benchmark.measure{
-      #{w}('#{file}')
-    }.utime
-  rescue Exception => exec_command_error_variable
-    puts "\t" + exec_command_error_variable.message
-  end
-  EOP
-end
-
-def benchmark cmd
-  rubybin = ENV['RUBY'] || RbConfig.ruby
-
-  IO.popen(rubybin, 'r+'){|io|
-    io.write cmd
-    io.close_write
-    return io.gets
-  }
-end
-
-def ruby_exec file
-  prog = exec_command 'ruby', file, 'load'
-  benchmark prog
-end
-
-def yarv_exec file
-  prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
-  benchmark prog
-end
-
-$wr = $wy = nil
-
-def measure bench
-  file = File.dirname($0) + "/bm_#{bench}.rb"
-  r = ruby_exec(file).to_f
-  y = yarv_exec(file).to_f
-  puts "#{bench}\t#{r}\t#{y}"
-end
-
-def measure2
-  r = ruby_exec.to_f
-  y = yarv_exec.to_f
-  puts r/y
-end
-
-if $0 == __FILE__
-  %w{
-    whileloop
-    whileloop2
-    times
-    const
-    method
-    poly_method
-    block
-    rescue
-    rescue2
-  }.each{|bench|
-    measure bench
-  }
-end
-
-
-
-
diff --git a/benchmark/require.yml b/benchmark/require.yml
new file mode 100644
index 0000000000..09f218cf08
--- /dev/null
+++ b/benchmark/require.yml
@@ -0,0 +1,32 @@
+prelude: |
+  require "fileutils"
+
+  def prepare
+    num_files = 10000
+
+    basename = File.dirname($0)
+    data_dir = File.join(basename, "bm_require.data")
+
+    # skip if all of files exists
+    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+      return
+    end
+
+    FileUtils.mkdir_p(data_dir)
+
+    1.upto(num_files) do |i|
+      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+    end
+  end
+
+  prepare
+benchmark:
+  require: |
+    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+    1.upto(10000) do |i|
+      require "c#{i}"
+    end
+
+    $:.pop
+loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
new file mode 100644
index 0000000000..0c63257106
--- /dev/null
+++ b/benchmark/require_thread.yml
@@ -0,0 +1,40 @@
+prelude: |
+  require "fileutils"
+
+  def prepare
+    num_files = 10000
+
+    basename = File.dirname($0)
+    data_dir = File.join(basename, "bm_require.data")
+
+    # skip if all of files exists
+    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+      return
+    end
+
+    FileUtils.mkdir_p(data_dir)
+
+    1.upto(num_files) do |i|
+      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+    end
+  end
+
+  prepare
+benchmark:
+  require_thread: |
+    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+    i=0
+    t = Thread.new do
+      while true
+        i = i+1 # dummy loop
+      end
+    end
+
+    1.upto(100) do |i|
+      require "c#{i}"
+    end
+
+    $:.pop
+    t.kill
+loop_count: 1
diff --git a/benchmark/run.rb b/benchmark/run.rb
deleted file mode 100644
index 0cd2363849..0000000000
--- a/benchmark/run.rb
+++ /dev/null
@@ -1,127 +0,0 @@
-#
-# Ruby benchmark driver
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$matzrubyonly = false
-$rubyonly = false
-
-$results  = []
-
-# prepare 'wc.input'
-def prepare_wc_input
-  wcinput = File.join(File.dirname($0), 'wc.input')
-  wcbase  = File.join(File.dirname($0), 'wc.input.base')
-  unless FileTest.exist?(wcinput)
-    data = File.read(wcbase)
-    13.times{
-      data << data
-    }
-    open(wcinput, 'w'){|f| f.write data}
-  end
-end
-
-prepare_wc_input
-
-def bm file
-  prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
-  return if prog.empty?
-
-  /[a-z]+_(.+)\.rb/ =~ file
-  bm_name = $1
-  puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
-  puts "#{bm_name}: "
-
-
-puts <<EOS unless $matzrubyonly || $rubyonly
-#{prog}
---
-EOS
-  begin
-    result = [bm_name]
-    result << matzruby_exec(file) unless $rubyonly
-    result << ruby_exec(file) unless $matzrubyonly
-    $results << result
-
-  rescue Exception => e
-    puts
-    puts "** benchmark failure: #{e}"
-    puts e.backtrace
-  end
-end
-
-def benchmark file, bin
-  m = Benchmark.measure{
-    `#{bin} #{$opts} #{file}`
-  }
-  sec = '%.3f' % m.real
-  puts " #{sec}"
-  sec
-end
-
-def ruby_exec file
-  print 'ruby'
-  benchmark file, $ruby_program
-end
-
-def matzruby_exec file
-  print 'matz'
-  rubylib = ENV['RUBYLIB']
-  ENV['RUBYLIB'] = ''
-  r = benchmark file, $matzruby_program
-  ENV['RUBYLIB'] = rubylib
-  r
-end
-
-if $0 == __FILE__
-  ARGV.each{|arg|
-    case arg
-    when /\A--ruby=(.+)/
-      $ruby_program = $1
-    when /\A--matzruby=(.+)/
-      $matzruby_program = $1
-    when /\A--opts=(.+)/
-      $opts = $1
-    when /\A(-r|--only-ruby)\z/
-      $rubyonly = true
-    when /\A(-m|--only-matzruby)\z/
-      $matzrubyonly = true
-    end
-  }
-  ARGV.delete_if{|arg|
-    /\A-/ =~ arg
-  }
-
-  puts "MatzRuby:"
-  system("#{$matzruby_program} -v")
-  puts "Ruby:"
-  system("#{$ruby_program} -v")
-  puts
-
-  if ARGV.empty?
-    Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
-      bm file
-    }
-  else
-    ARGV.each{|file|
-      Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
-        # file = "#{File.dirname(__FILE__)}/#{file}.rb"
-        bm ef
-      }
-    }
-  end
-
-  puts
-  puts "-- benchmark summary ---------------------------"
-  $results.each{|res|
-    print res.shift, "\t"
-    (res||[]).each{|result|
-      /([\d\.]+)/ =~ result
-      print $1 + "\t" if $1
-    }
-    puts
-  }
-end
-
diff --git a/benchmark/runc.rb b/benchmark/runc.rb
deleted file mode 100644
index 97c5cef045..0000000000
--- a/benchmark/runc.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-#
-#
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$rubybin = ENV['RUBY'] || RbConfig.ruby
-
-def runfile file
-  puts file
-  file = File.join(File.dirname($0), 'contrib', file)
-  Benchmark.bm{|x|
-    x.report('ruby'){
-      system("#{$rubybin} #{file}")
-    }
-    x.report('yarv'){
-      system("#{$rubybin} -rite -I.. #{file}")
-    }
-  }
-end
-
-ARGV.each{|file|
-  runfile file
-}
-
-
diff --git a/benchmark/bm_securerandom.rb b/benchmark/securerandom.rb
index a082ea6d5b..a082ea6d5b 100644
--- a/benchmark/bm_securerandom.rb
+++ b/benchmark/securerandom.rb
diff --git a/benchmark/so_ackermann.rb b/benchmark/so_ackermann.rb
new file mode 100644
index 0000000000..4effa1ecaf
--- /dev/null
+++ b/benchmark/so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/so_array.rb b/benchmark/so_array.rb
new file mode 100644
index 0000000000..767e03db5f
--- /dev/null
+++ b/benchmark/so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+  x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+  (n-1).step(0,-1) do |bi|
+    y[bi] += x.at(bi)
+  end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/so_binary_trees.rb
index b1693e4109..b1693e4109 100644
--- a/benchmark/bm_so_binary_trees.rb
+++ b/benchmark/so_binary_trees.rb
diff --git a/benchmark/so_concatenate.rb b/benchmark/so_concatenate.rb
new file mode 100644
index 0000000000..4468e20ac8
--- /dev/null
+++ b/benchmark/so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+  i += 1
+  hello = ''
+  4_000_000.times do |e|
+    hello << STUFF
+  end
+end
+# puts hello.length
+
+
diff --git a/benchmark/so_count_words.yml b/benchmark/so_count_words.yml
new file mode 100644
index 0000000000..99683505f9
--- /dev/null
+++ b/benchmark/so_count_words.yml
@@ -0,0 +1,65 @@
+prelude: |
+  #!/usr/bin/ruby
+
+  wc_input_base = <<EOS
+  Subject:      Re: Who was Izchak Miller?
+  From:         "Jane D. Anonymous" <nobody@yale.edu>
+  Date:         1996/04/28
+  Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
+  References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+  To:           75176.2330@compuserve.com
+  Content-Type: text/plain; charset=us-ascii
+  Organization: Yale University
+  X-Url:        news:4lk6vl$gde@ns.oar.net
+  Mime-Version: 1.0
+  Newsgroups:   rec.games.roguelike.nethack
+  X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
+
+  Hello there, Izchak Miller was my father.  When I was younger I spent 
+  many a night, hunched over the keyboard with a cup of tea, playing 
+  nethack with him and my brother.  my dad was a philosopher with a strong 
+  weakness for fantasy/sci fi.  I remember when he started to get involved 
+  with the Nethack team- my brother's Dungeons and Dragons monster book 
+  found a regular place beside my dad's desk. it's nice to see him living 
+  on in the game he loved so much :-).  
+                                                                    Tamar Miller
+
+  The following is a really long word of 5000 characters:
+
+  wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
+  EOS
+
+  # prepare 'wc.input'
+
+  def prepare_wc_input(wcbase)
+    wcinput = File.join(File.dirname($0), 'wc.input')
+    unless FileTest.exist?(wcinput)
+      data = wcbase.dup
+      13.times{
+        data << data
+      }
+      open(wcinput, 'w'){|f| f.write data}
+    end
+  end
+
+  prepare_wc_input(wc_input_base)
+
+benchmark:
+  so_count_words: |
+    # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+    # http://www.bagley.org/~doug/shootout/
+    # with help from Paul Brannan
+    input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+    nl = nw = nc = 0
+    while true
+      tmp = input.read(4096) or break
+      data = tmp << (input.gets || "")
+      nc += data.length
+      nl += data.count("\n")
+      ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+      nw += data.count(" ") + 1
+    end
+    # STDERR.puts "#{nl} #{nw} #{nc}"
+
+loop_count: 1
diff --git a/benchmark/so_exception.rb b/benchmark/so_exception.rb
new file mode 100644
index 0000000000..eb205b4df1
--- /dev/null
+++ b/benchmark/so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+class Hi_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+def some_function(num)
+  begin
+    hi_function(num)
+  rescue
+    print "We shouldn't get here, exception is: #{$!.type}\n"
+  end
+end
+
+def hi_function(num)
+  begin
+    lo_function(num)
+  rescue Hi_Exception
+    $HI = $HI + 1
+  end
+end
+
+def lo_function(num)
+  begin
+    blowup(num)
+  rescue Lo_Exception
+    $LO = $LO + 1
+  end
+end
+
+def blowup(num)
+  if num % 2 == 0
+    raise Lo_Exception.new(num)
+  else
+    raise Hi_Exception.new(num)
+  end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+  i += 1
+  some_function(i+1)
+end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/so_fannkuch.rb
index bac5ecd44c..bac5ecd44c 100644
--- a/benchmark/bm_so_fannkuch.rb
+++ b/benchmark/so_fannkuch.rb
diff --git a/benchmark/so_fasta.rb b/benchmark/so_fasta.rb
new file mode 100644
index 0000000000..dcc6b39507
--- /dev/null
+++ b/benchmark/so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random(max, im=139968, ia=3877, ic=29573)
+    (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+    ["a", 0.27],
+    ["c", 0.12],
+    ["g", 0.12],
+    ["t", 0.27],
+
+    ["B", 0.02],
+    ["D", 0.02],
+    ["H", 0.02],
+    ["K", 0.02],
+    ["M", 0.02],
+    ["N", 0.02],
+    ["R", 0.02],
+    ["S", 0.02],
+    ["V", 0.02],
+    ["W", 0.02],
+    ["Y", 0.02],
+]
+homosapiens = [
+    ["a", 0.3029549426680],
+    ["c", 0.1979883004921],
+    ["g", 0.1975473066391],
+    ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+    puts ">#{id} #{desc}"
+    v = nil
+    width = 60
+    l = src.length
+    s = src * ((n / l) + 1)
+    s.slice!(n, l)
+    puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+    puts ">#{id} #{desc}"
+    rand, v = nil,nil
+    width = 60
+    chunk = 1 * width
+    prob = 0.0
+    table.each{|v| v[1]= (prob += v[1])}
+    for i in 1..(n/width)
+        puts((1..width).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+    if n%width != 0
+        puts((1..(n%width)).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
new file mode 100644
index 0000000000..d7df086c39
--- /dev/null
+++ b/benchmark/so_k_nucleotide.yml
@@ -0,0 +1,155 @@
+prelude: |
+  bm_so_fasta = <<'EOS'
+  # The Computer Language Shootout
+  # http://shootout.alioth.debian.org/
+  # Contributed by Sokolov Yura
+
+  $last = 42.0
+  def gen_random(max, im=139968, ia=3877, ic=29573)
+      (max * ($last = ($last * ia + ic) % im)) / im
+  end
+
+  alu =
+     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+  iub = [
+      ["a", 0.27],
+      ["c", 0.12],
+      ["g", 0.12],
+      ["t", 0.27],
+
+      ["B", 0.02],
+      ["D", 0.02],
+      ["H", 0.02],
+      ["K", 0.02],
+      ["M", 0.02],
+      ["N", 0.02],
+      ["R", 0.02],
+      ["S", 0.02],
+      ["V", 0.02],
+      ["W", 0.02],
+      ["Y", 0.02],
+  ]
+  homosapiens = [
+      ["a", 0.3029549426680],
+      ["c", 0.1979883004921],
+      ["g", 0.1975473066391],
+      ["t", 0.3015094502008],
+  ]
+
+  def make_repeat_fasta(id, desc, src, n)
+      puts ">#{id} #{desc}"
+      v = nil
+      width = 60
+      l = src.length
+      s = src * ((n / l) + 1)
+      s.slice!(n, l)
+      puts(s.scan(/.{1,#{width}}/).join("\n"))
+  end
+
+  def make_random_fasta(id, desc, table, n)
+      puts ">#{id} #{desc}"
+      rand, v = nil,nil
+      width = 60
+      chunk = 1 * width
+      prob = 0.0
+      table.each{|v| v[1]= (prob += v[1])}
+      for i in 1..(n/width)
+          puts((1..width).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+      if n%width != 0
+          puts((1..(n%width)).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+  end
+
+
+  n = (ARGV[0] or 250_000).to_i
+
+  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+  EOS
+benchmark:
+  - name: so_k_nucleotide
+    prelude: |
+      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+      File.write(script, bm_so_fasta)
+
+      def prepare_fasta_output n
+        filebase = File.join(File.dirname($0), 'fasta.output')
+        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+        file = "#{filebase}.#{n}"
+
+        unless FileTest.exist?(file)
+          STDERR.puts "preparing #{file}"
+
+          open(file, 'w'){|f|
+            ARGV[0] = n
+            $stdout = f
+            load script
+            $stdout = STDOUT
+          }
+        end
+      end
+      prepare_fasta_output(100_000)
+    script: |
+      # The Computer Language Shootout
+      # http://shootout.alioth.debian.org
+      #
+      # contributed by jose fco. gonzalez
+      # modified by Sokolov Yura
+
+      seq = String.new
+
+      def frecuency( seq,length )
+          n, table = seq.length - length + 1, Hash.new(0)
+          f, i = nil, nil
+          (0 ... length).each do |f|
+              (f ... n).step(length) do |i|
+                  table[seq[i,length]] += 1
+              end
+          end
+          [n,table]
+
+      end
+
+      def sort_by_freq( seq,length )
+          n,table = frecuency( seq,length )
+          a, b, v = nil, nil, nil
+          table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+              puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+          end
+          puts
+      end
+
+      def find_seq( seq,s )
+          n,table = frecuency( seq,s.length )
+          puts "#{table[s].to_s}\t#{s.upcase}"
+      end
+
+      input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+      line = input.gets while line !~ /^>THREE/
+      line = input.gets
+
+      while (line !~ /^>/) & line do
+          seq << line.chomp
+          line = input.gets
+      end
+
+      [1,2].each {|i| sort_by_freq( seq,i ) }
+
+      %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+    loop_count: 1
diff --git a/benchmark/bm_so_lists.rb b/benchmark/so_lists.rb
index e8f4a2a5f7..e8f4a2a5f7 100644
--- a/benchmark/bm_so_lists.rb
+++ b/benchmark/so_lists.rb
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/so_mandelbrot.rb
index 76331c64b8..76331c64b8 100644
--- a/benchmark/bm_so_mandelbrot.rb
+++ b/benchmark/so_mandelbrot.rb
diff --git a/benchmark/so_matrix.rb b/benchmark/so_matrix.rb
new file mode 100644
index 0000000000..2d1e72bda9
--- /dev/null
+++ b/benchmark/so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+    count = 1
+    mx = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            row[j] = count
+            count += 1
+        end
+        mx[bi] = row
+    end
+    mx
+end
+
+def mmult(rows, cols, m1, m2)
+    m3 = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            val = 0
+            (0 .. (cols - 1)).each do |k|
+                val += m1.at(bi).at(k) * m2.at(k).at(j)
+            end
+            row[j] = val
+        end
+        m3[bi] = row
+    end
+    m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+    mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/so_meteor_contest.rb b/benchmark/so_meteor_contest.rb
new file mode 100644
index 0000000000..8c136baa6c
--- /dev/null
+++ b/benchmark/so_meteor_contest.rb
@@ -0,0 +1,563 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+#   http://shootout.alioth.debian.org
+#   contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM:  the main body is at the bottom.
+#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+#   2) see how I represent a board as a bitmask by reading the blank_board comments
+#   3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+  # an array (by location) containing a bit mask for how the piece maps at the given location.
+  # if the rotation is invalid at that location the mask will contain false
+  attr_reader :start_masks
+
+  # maps a direction to a relative location.  these differ depending on whether it is an even or
+  # odd row being mapped from
+  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+  def initialize( directions )
+    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+    @even_mask = mask_for_offsets( @even_offsets)
+    @odd_mask = mask_for_offsets( @odd_offsets)
+
+    @start_masks = Array.new(60)
+
+    # create the rotational masks by placing the base mask at the location and seeing if
+    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
+    # is true the piece cannot be placed
+    0.upto(59) do | offset |
+      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+        imask = compute_required( mask, offset)
+        @start_masks[offset] = [ mask, imask, imask | mask ]
+      else
+        @start_masks[offset] = false
+      end
+    end
+  end
+
+  def compute_required( mask, offset )
+    board = blank_board
+    0.upto(offset) { | i | board |= 1 << i }
+    board |= mask
+    return 0 if (!prunable(board | mask, offset))
+    board = flood_fill(board,58)
+    count = 0
+    imask = 0
+    0.upto(59) do | i |
+      if (board[i] == 0) then
+        imask |= (1 << i)
+        count += 1
+      end
+    end
+    (count > 0 && count < 5) ? imask : 0
+  end
+
+  def flood_fill( board, location)
+    return board if (board[location] == 1)
+    board |= 1 << location
+    row, col = location.divmod(6)
+    board = flood_fill( board, location - 1) if (col > 0)
+    board = flood_fill( board, location + 1) if (col < 4)
+    if (row % 2 == 0) then
+      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+    else
+      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+    end
+    board
+  end
+
+  # given a location, produces a list of relative locations covered by the piece at this rotation
+  def offsets( location)
+    if is_even( location) then
+      @even_offsets.collect { | value | value + location }
+    else
+      @odd_offsets.collect { | value | value + location }
+    end
+  end
+
+  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+  # this is hard to explain. imagine we have this partial board:
+  #   0 0 0 0 0 x        [positions 0-5]
+  #    0 0 1 1 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 1 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # The top-left of the piece is at position 8, the
+  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
+  #   0 0 0 1 1 x        [positions 0-5]
+  #    0 0 1 0 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 0 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+  # this function would return
+  def normalize_offsets( values)
+    min = values.min
+    even_min = is_even(min)
+    other_min = even_min ? min + 6 : min + 7
+    other_values = values.collect do | value |
+      if is_even(value) then
+        value + 6 - other_min
+      else
+        value + 7 - other_min
+      end
+    end
+    values.collect! { | value | value - min }
+
+    if even_min then
+      [values, other_values]
+    else
+      [other_values, values]
+    end
+  end
+
+  # produce a bitmask representation of an array of offset locations
+  def mask_for_offsets( offsets )
+    mask = 0
+    offsets.each { | value | mask = mask + ( 1 << value ) }
+    mask
+  end
+
+  # finds a "safe" position that a position as described by a list of directions can be placed
+  # without falling off any edge of the board.  the values returned a location to place the first piece
+  # at so it will fit after making the described moves
+  def start_adjust( directions )
+    south = east = 0;
+    directions.each do | direction |
+      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+      south += 1 if ( direction == :nw || direction == :ne )
+    end
+    south * 6 + east
+  end
+
+  # given a set of directions places the piece (as defined by a set of directions) on the board at
+  # a location that will not take it off the edge
+  def get_values( directions )
+    start = start_adjust(directions)
+    values = [ start ]
+    directions.each do | direction |
+      if (start % 12 >= 6) then
+        start += @@rotation_odd_adder[direction]
+      else
+        start += @@rotation_even_adder[direction]
+      end
+      values += [ start ]
+    end
+
+    # some moves take you back to an existing location, we'll strip duplicates
+    values.uniq
+  end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+#   rotations -- all the rotations of the piece
+#   type -- a numeic "name" of the piece
+#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
+#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+  attr_reader :rotations, :type, :masks
+  attr_accessor :placed
+
+  # transform hashes that change one direction into another when you either flip or rotate a set of directions
+  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+  def initialize( directions, type )
+    @type = type
+    @rotations = Array.new();
+    @map = {}
+
+    generate_rotations( directions )
+    directions.collect! { | value | @@flip_converter[value] }
+    generate_rotations( directions )
+
+    # creates the masks AND a map that returns [location, rotation] for any given mask
+    # this is used when a board is found and we want to draw it, otherwise the map is unused
+    @masks = Array.new();
+    0.upto(59) do | i |
+      even = true
+      @masks[i] = @rotations.collect do | rotation |
+        mask = rotation.start_masks[i]
+        @map[mask[0]] = [ i, rotation ] if (mask)
+        mask || nil
+      end
+      @masks[i].compact!
+    end
+  end
+
+  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+  def generate_rotations( directions )
+    6.times do
+      rotations.push( Rotation.new(directions))
+      directions.collect! { | value | @@rotate_converter[value] }
+    end
+  end
+
+  # given a board string, adds this piece to the board at whatever location/rotation
+  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+  def fill_string( board_string)
+    location, rotation = @map[@placed]
+    rotation.offsets(location).each do | offset |
+      row, col = offset.divmod(6)
+      board_string[ row*5 + col, 1 ] = @type.to_s
+    end
+  end
+end
+
+# a blank bit board having this form:
+#
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+  0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+  0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+  (location % 12) < 6
+end
+
+# support function that create three utility maps:
+#  $converter -- for each row an array that maps a five bit row (via array mapping)
+#                to the a five bit representation of the bits below it
+#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+#                   a region array has three values the first is a mask of bits in the region,
+#                   the second is the count of those bits and the third is identical to the first
+#                   examples:
+#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+#                           0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+  all_odds = Array.new(0b100000)
+  all_evens = Array.new(0b100000)
+  bit_counts = Array.new(0b100000)
+  new_regions = Array.new(0b100000)
+  0.upto(0b11111) do | i |
+    bit_count = odd = even = 0
+    0.upto(4) do | bit |
+      if (i[bit] == 1) then
+        bit_count += 1
+        odd |= odd_map[bit]
+        even |= even_map[bit]
+      end
+    end
+    all_odds[i] = odd
+    all_evens[i] = even
+    bit_counts[i] = bit_count
+    new_regions[i] = create_regions( i)
+  end
+
+  $converter = []
+  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+  $bit_counts = bit_counts
+  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five.  The following board is an example of a prunable board:
+#    0 0 1 0 0
+#     0 1 0 0 0
+#    1 1 0 0 0
+#     0 1 0 0 0
+#    0 0 0 0 0
+#       ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
+#   location -- starting location, everything above and to the left is already full
+#   slotting -- set to true only when testing initial pieces, when filling normally
+#               additional assumptions are possible
+#
+# Algorithm:
+#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
+#    maintainng counts of active open areas (kept in the collector array) each collector contains
+#    three values at the start of an iteration:
+#          0: mask of bits that would be adjacent to the collector in this row
+#          1: the number of bits collected so far
+#          2: a scratch space starting as zero, but used during the computation to represent
+#             the empty bits in the new row that are adjacent (position 0)
+#  The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+  collectors = []
+  # loop across the rows
+  (location / 6).to_i.upto(9) do | row_on |
+    # obtain a set of regions representing the bits of the current row.
+    regions = $regions[(board >> (row_on * 6)) & 0b11111]
+    converter = $converter[row_on]
+
+    # track the number of collectors at the start of the cycle so that
+    # we don't compute against newly created collectors, only existing collectors
+    initial_collector_count = collectors.length
+
+    # loop against the regions.  For each region of the row
+    # we will see if it connects to one or more existing collectors.
+    # if it connects to 1 collector, the bits from the region are added to the
+    # bits of the collector and the mask is placed in collector[2]
+    # If the region overlaps more than one collector then all the collectors
+    # it overlaps with are merged into the first one (the others are set to nil in the array)
+    # if NO collectors are found then the region is copied as a new collector
+    regions.each do | region |
+      collector_found = nil
+      region_mask = region[2]
+      initial_collector_count.times do | collector_num |
+        collector = collectors[collector_num]
+        if (collector) then
+          collector_mask = collector[0]
+          if (collector_mask & region_mask != 0) then
+            if (collector_found) then
+              collector_found[0] |= collector_mask
+              collector_found[1] += collector[1]
+              collector_found[2] |= collector[2]
+              collectors[collector_num] = nil
+            else
+              collector_found = collector
+              collector[1] += region[1]
+              collector[2] |= region_mask
+            end
+          end
+        end
+      end
+      if (collector_found == nil) then
+        collectors.push(Array.new(region))
+      end
+    end
+
+    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
+    # the board is prunable.  if it is a multiple of five it is removed.
+    # Collector that are still active have a new adjacent value [0] set based n the matched bits
+    # and have [2] cleared out for the next cycle.
+    collectors.length.times do | collector_num |
+      collector = collectors[collector_num]
+      if (collector) then
+        if (collector[2] == 0) then
+          return true if (collector[1] % 5 != 0)
+          collectors[collector_num] = nil
+        else
+          # if a collector matches all bits in the row then we can return unprunable early for the
+          # following reasons:
+          #    1) there can be no more unavailable bits bince we fill from the top left downward
+          #    2) all previous regions have been closed or joined so only this region can fail
+          #    3) this region must be good since there can never be only 1 region that is nuot
+          #       a multiple of five
+          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+          # in pieces to see what configurations work for them (the only other time this algorithm is used).
+          return false if (collector[2] == 0b11111 && !slotting)
+          collector[0] = converter[collector[2]]
+          collector[2] = 0
+        end
+      end
+    end
+
+    # get rid of all the empty converters for the next round
+    collectors.compact!
+  end
+  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask.  see prunable for what a "region" is
+def create_regions( value )
+  regions = []
+  cur_region = 0
+  5.times do | bit |
+    if (value[bit] == 0) then
+      cur_region |= 1 << bit
+    else
+      if (cur_region != 0 ) then
+        regions.push( cur_region)
+        cur_region = 0;
+      end
+    end
+  end
+  regions.push(cur_region) if (cur_region != 0)
+  regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+  find_top( 1)
+  find_top( 0)
+  print_results
+end
+
+# show the board
+def print_results
+  print "#{@boards_found} solutions found\n\n"
+  print_full_board( @min_board)
+  print "\n"
+  print_full_board( @max_board)
+  print "\n"
+end
+
+# finds solutions.  This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece.  It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
+#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
+#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
+#   diminsh over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
+#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+#   maximum number
+def find_top( rotation_skip)
+  board = blank_board
+  (@pieces.length-1).times do
+    piece = @pieces.shift
+    piece.masks[0].each do | mask, imask, cmask |
+      if ((rotation_skip += 1) % 2 == 0) then
+        piece.placed = mask
+        find( 1, 1, board | mask)
+      end
+    end
+    @pieces.push(piece)
+  end
+  piece = @pieces.shift
+  @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+#  start_location -- where to start looking for place for the next piece at
+#  placed -- number of pieces placed
+#  board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+  # find the next location to place a piece by looking for an empty bit
+  while board[start_location] == 1
+    start_location += 1
+  end
+
+  @pieces.length.times do
+    piece = @pieces.shift
+    piece.masks[start_location].each do | mask, imask, cmask |
+      if ( board & cmask == imask) then
+        piece.placed = mask
+        if (placed == 9) then
+          add_board
+        else
+          find( start_location + 1, placed + 1, board | mask)
+        end
+      end
+    end
+    @pieces.push(piece)
+  end
+end
+
+# print the board
+def print_full_board( board_string)
+  10.times do | row |
+    print " " if (row % 2 == 1)
+    5.times do | col |
+      print "#{board_string[row*5 + col,1]} "
+    end
+    print "\n"
+  end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+  board_string = "99999999999999999999999999999999999999999999999999"
+  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
+  save( board_string)
+  save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+  if (@all_boards[board_string] == nil) then
+    @min_board = board_string if (board_string < @min_board)
+    @max_board = board_string if (board_string > @max_board)
+    @all_boards.store(board_string,true)
+    @boards_found += 1
+
+    # the exit motif is a time saver.  Ideally the function should return, but those tests
+    # take noticeable time (performance).
+    if (@boards_found == @stop_count) then
+      print_results
+      exit(0)
+    end
+  end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+  Piece.new( [ :nw, :ne, :east, :east ], 2),
+  Piece.new( [ :ne, :se, :east, :ne ], 7),
+  Piece.new( [ :ne, :east, :ne, :nw ], 1),
+  Piece.new( [ :east, :sw, :sw, :se ], 6),
+  Piece.new( [ :east, :ne, :se, :ne ], 5),
+  Piece.new( [ :east, :east, :east, :se ], 0),
+  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+  Piece.new( [ :se, :se, :se, :west ], 9),
+  Piece.new( [ :se, :se, :east, :se ], 8),
+  Piece.new( [ :east, :east, :sw, :se ], 3)
+  ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
diff --git a/benchmark/so_nbody.rb b/benchmark/so_nbody.rb
new file mode 100644
index 0000000000..9884fc4edc
--- /dev/null
+++ b/benchmark/so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+  attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+  def initialize(x, y, z, vx, vy, vz, mass)
+    @x, @y, @z = x, y, z
+    @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+    @mass = mass * SOLAR_MASS
+  end
+
+  def move_from_i(bodies, nbodies, dt, i)
+    while i < nbodies
+      b2 = bodies[i]
+      dx = @x - b2.x
+      dy = @y - b2.y
+      dz = @z - b2.z
+
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      mag = dt / (distance * distance * distance)
+      b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+      @vx -= dx * b2_mass_mag
+      @vy -= dy * b2_mass_mag
+      @vz -= dz * b2_mass_mag
+      b2.vx += dx * b_mass_mag
+      b2.vy += dy * b_mass_mag
+      b2.vz += dz * b_mass_mag
+      i += 1
+    end
+
+    @x += dt * @vx
+    @y += dt * @vy
+    @z += dt * @vz
+  end
+end
+
+def energy(bodies)
+  e = 0.0
+  nbodies = bodies.size
+
+  for i in 0 ... nbodies
+    b = bodies[i]
+    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+    for j in (i + 1) ... nbodies
+      b2 = bodies[j]
+      dx = b.x - b2.x
+      dy = b.y - b2.y
+      dz = b.z - b2.z
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      e -= (b.mass * b2.mass) / distance
+    end
+  end
+  e
+end
+
+def offset_momentum(bodies)
+  px, py, pz = 0.0, 0.0, 0.0
+
+  for b in bodies
+    m = b.mass
+    px += b.vx * m
+    py += b.vy * m
+    pz += b.vz * m
+  end
+
+  b = bodies[0]
+  b.vx = - px / SOLAR_MASS
+  b.vy = - py / SOLAR_MASS
+  b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+  # sun
+  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+  # jupiter
+  Planet.new(
+    4.84143144246472090e+00,
+    -1.16032004402742839e+00,
+    -1.03622044471123109e-01,
+    1.66007664274403694e-03,
+    7.69901118419740425e-03,
+    -6.90460016972063023e-05,
+    9.54791938424326609e-04),
+
+  # saturn
+  Planet.new(
+    8.34336671824457987e+00,
+    4.12479856412430479e+00,
+    -4.03523417114321381e-01,
+    -2.76742510726862411e-03,
+    4.99852801234917238e-03,
+    2.30417297573763929e-05,
+    2.85885980666130812e-04),
+
+  # uranus
+  Planet.new(
+    1.28943695621391310e+01,
+    -1.51111514016986312e+01,
+    -2.23307578892655734e-01,
+    2.96460137564761618e-03,
+    2.37847173959480950e-03,
+    -2.96589568540237556e-05,
+    4.36624404335156298e-05),
+
+  # neptune
+  Planet.new(
+    1.53796971148509165e+01,
+    -2.59193146099879641e+01,
+    1.79258772950371181e-01,
+    2.68067772490389322e-03,
+    1.62824170038242295e-03,
+    -9.51592254519715870e-05,
+    5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+  i = 0
+  while i < nbodies
+    b = BODIES[i]
+    b.move_from_i(BODIES, nbodies, dt, i + 1)
+    i += 1
+  end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/so_nested_loop.rb b/benchmark/so_nested_loop.rb
new file mode 100644
index 0000000000..766fcf7b84
--- /dev/null
+++ b/benchmark/so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+    n.times do
+        n.times do
+            n.times do
+                n.times do
+                    n.times do
+                        x += 1
+                    end
+                end
+            end
+        end
+    end
+end
+# puts x
+
+
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/so_nsieve.rb
index a65cc78233..a65cc78233 100644
--- a/benchmark/bm_so_nsieve.rb
+++ b/benchmark/so_nsieve.rb
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/so_nsieve_bits.rb
index 6f958ee44e..6f958ee44e 100644
--- a/benchmark/bm_so_nsieve_bits.rb
+++ b/benchmark/so_nsieve_bits.rb
diff --git a/benchmark/so_object.rb b/benchmark/so_object.rb
new file mode 100644
index 0000000000..131f44624c
--- /dev/null
+++ b/benchmark/so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+    def initialize(start_state)
+        @bool = start_state
+    end
+
+    def value
+        @bool
+    end
+
+    def activate
+        @bool = !@bool
+        self
+    end
+end
+
+class NthToggle < Toggle
+    def initialize(start_state, max_counter)
+        super start_state
+        @count_max = max_counter
+        @counter = 0
+    end
+
+    def activate
+        @counter += 1
+        if @counter >= @count_max
+            @bool = !@bool
+            @counter = 0
+        end
+        self
+    end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+    toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+    ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/so_partial_sums.rb
index 630b45cb8d..630b45cb8d 100644
--- a/benchmark/bm_so_partial_sums.rb
+++ b/benchmark/so_partial_sums.rb
diff --git a/benchmark/so_pidigits.rb b/benchmark/so_pidigits.rb
new file mode 100644
index 0000000000..9a537b2d1c
--- /dev/null
+++ b/benchmark/so_pidigits.rb
@@ -0,0 +1,92 @@
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+    def initialize()
+        @z = Transformation.new 1,0,0,1
+        @x = Transformation.new 0,0,0,0
+        @inverse = Transformation.new 0,0,0,0
+    end
+
+    def next!
+        @y = @z.extract(3)
+        if safe? @y
+            @z = produce(@y)
+            @y
+        else
+            @z = consume @x.next!()
+            next!()
+        end
+    end
+
+    def safe?(digit)
+        digit == @z.extract(4)
+    end
+
+    def produce(i)
+        @inverse.qrst(10,-10*i,0,1).compose(@z)
+    end
+
+    def consume(a)
+        @z.compose(a)
+    end
+end
+
+
+class Transformation
+    attr_reader :q, :r, :s, :t
+    def initialize(q, r, s, t)
+        @q,@r,@s,@t,@k = q,r,s,t,0
+    end
+
+    def next!()
+        @q = @k = @k + 1
+        @r = 4 * @k + 2
+        @s = 0
+        @t = 2 * @k + 1
+        self
+    end
+
+    def extract(j)
+        (@q * j + @r) / (@s * j + @t)
+    end
+
+    def compose(a)
+        self.class.new( @q * a.q,
+                        @q * a.r + r * a.t,
+                        @s * a.q + t * a.s,
+                        @s * a.r + t * a.t
+                    )
+    end
+
+    def qrst *args
+        initialize *args
+        self
+    end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+    if n >= WIDTH
+        WIDTH.times {print digits.next!}
+        j += WIDTH
+    else
+        n.times {print digits.next!}
+        (WIDTH-n).times {print " "}
+        j += n
+    end
+    puts "\t:"+j.to_s
+    n -= WIDTH
+end
+
diff --git a/benchmark/bm_so_random.rb b/benchmark/so_random.rb
index a66b9e8e63..a66b9e8e63 100644
--- a/benchmark/bm_so_random.rb
+++ b/benchmark/so_random.rb
diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml
new file mode 100644
index 0000000000..de05eedfc4
--- /dev/null
+++ b/benchmark/so_reverse_complement.yml
@@ -0,0 +1,137 @@
+prelude: |
+  bm_so_fasta = <<'EOS'
+  # The Computer Language Shootout
+  # http://shootout.alioth.debian.org/
+  # Contributed by Sokolov Yura
+
+  $last = 42.0
+  def gen_random(max, im=139968, ia=3877, ic=29573)
+      (max * ($last = ($last * ia + ic) % im)) / im
+  end
+
+  alu =
+     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+  iub = [
+      ["a", 0.27],
+      ["c", 0.12],
+      ["g", 0.12],
+      ["t", 0.27],
+
+      ["B", 0.02],
+      ["D", 0.02],
+      ["H", 0.02],
+      ["K", 0.02],
+      ["M", 0.02],
+      ["N", 0.02],
+      ["R", 0.02],
+      ["S", 0.02],
+      ["V", 0.02],
+      ["W", 0.02],
+      ["Y", 0.02],
+  ]
+  homosapiens = [
+      ["a", 0.3029549426680],
+      ["c", 0.1979883004921],
+      ["g", 0.1975473066391],
+      ["t", 0.3015094502008],
+  ]
+
+  def make_repeat_fasta(id, desc, src, n)
+      puts ">#{id} #{desc}"
+      v = nil
+      width = 60
+      l = src.length
+      s = src * ((n / l) + 1)
+      s.slice!(n, l)
+      puts(s.scan(/.{1,#{width}}/).join("\n"))
+  end
+
+  def make_random_fasta(id, desc, table, n)
+      puts ">#{id} #{desc}"
+      rand, v = nil,nil
+      width = 60
+      chunk = 1 * width
+      prob = 0.0
+      table.each{|v| v[1]= (prob += v[1])}
+      for i in 1..(n/width)
+          puts((1..width).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+      if n%width != 0
+          puts((1..(n%width)).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+  end
+
+
+  n = (ARGV[0] or 250_000).to_i
+
+  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+  EOS
+benchmark:
+  - name: so_reverse_complement
+    prelude: |
+      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+      File.write(script, bm_so_fasta)
+
+      def prepare_fasta_output n
+        filebase = File.join(File.dirname($0), 'fasta.output')
+        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+        file = "#{filebase}.#{n}"
+
+        unless FileTest.exist?(file)
+          STDERR.puts "preparing #{file}"
+
+          open(file, 'w'){|f|
+            ARGV[0] = n
+            $stdout = f
+            load script
+            $stdout = STDOUT
+          }
+        end
+      end
+      prepare_fasta_output(2_500_000)
+    script: |
+      # The Great Computer Language Shootout
+      # http://shootout.alioth.debian.org/
+      #
+      # Contributed by Peter Bjarke Olsen
+      # Modified by Doug King
+
+      seq=Array.new
+
+      def revcomp(seq)
+        seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+        stringlen=seq.length
+        0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+      end
+
+      input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+      while input.gets
+        if $_ =~ />/
+          if seq.length != 0
+            revcomp(seq.join)
+            seq=Array.new
+          end
+          puts $_
+        else
+          $_.sub(/\n/,'')
+          seq.push $_
+        end
+      end
+      revcomp(seq.join)
+    loop_count: 1
diff --git a/benchmark/bm_so_sieve.rb b/benchmark/so_sieve.rb
index 43dc302648..43dc302648 100644
--- a/benchmark/bm_so_sieve.rb
+++ b/benchmark/so_sieve.rb
diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/so_spectralnorm.rb
index 6b97206689..6b97206689 100644
--- a/benchmark/bm_so_spectralnorm.rb
+++ b/benchmark/so_spectralnorm.rb
diff --git a/benchmark/string_capitalize.yml b/benchmark/string_capitalize.yml
new file mode 100644
index 0000000000..7d23fd3d35
--- /dev/null
+++ b/benchmark/string_capitalize.yml
@@ -0,0 +1,10 @@
+prelude: |
+  str1 = [*"a".."m",*"N".."Z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+benchmark:
+  capitalize-1: str1.capitalize
+  capitalize-10: str10.capitalize
+  capitalize-100: str100.capitalize
+  capitalize-1000: str1000.capitalize
diff --git a/benchmark/string_casecmp.yml b/benchmark/string_casecmp.yml
new file mode 100644
index 0000000000..2354040a04
--- /dev/null
+++ b/benchmark/string_casecmp.yml
@@ -0,0 +1,26 @@
+prelude: |
+  lstr1 = [*"a".."z",*"0".."9"].join("")
+  lstr10 = lstr1 * 10
+  lstr100 = lstr10 * 10
+  lstr1000 = lstr100 * 10
+  lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  lnonascii10 = lnonascii1 * 10
+  lnonascii100 = lnonascii10 * 10
+  lnonascii1000 = lnonascii100 * 10
+  ustr1 = [*"A".."Z",*"0".."9"].join("")
+  ustr10 = ustr1 * 10
+  ustr100 = ustr10 * 10
+  ustr1000 = ustr100 * 10
+  unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  unonascii10 = unonascii1 * 10
+  unonascii100 = unonascii10 * 10
+  unonascii1000 = unonascii100 * 10
+benchmark:
+  casecmp-1: lstr1.casecmp(ustr1)
+  casecmp-10: lstr10.casecmp(ustr10)
+  casecmp-100: lstr100.casecmp(ustr100)
+  casecmp-1000: lstr1000.casecmp(ustr1000)
+  casecmp-nonascii1: lnonascii1.casecmp(unonascii1)
+  casecmp-nonascii10: lnonascii10.casecmp(unonascii10)
+  casecmp-nonascii100: lnonascii100.casecmp(unonascii100)
+  casecmp-nonascii1000: lnonascii1000.casecmp(unonascii1000)
diff --git a/benchmark/string_casecmp_p.yml b/benchmark/string_casecmp_p.yml
new file mode 100644
index 0000000000..a790ce7d55
--- /dev/null
+++ b/benchmark/string_casecmp_p.yml
@@ -0,0 +1,26 @@
+prelude: |
+  lstr1 = [*"a".."z",*"0".."9"].join("")
+  lstr10 = lstr1 * 10
+  lstr100 = lstr10 * 10
+  lstr1000 = lstr100 * 10
+  lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  lnonascii10 = lnonascii1 * 10
+  lnonascii100 = lnonascii10 * 10
+  lnonascii1000 = lnonascii100 * 10
+  ustr1 = [*"A".."Z",*"0".."9"].join("")
+  ustr10 = ustr1 * 10
+  ustr100 = ustr10 * 10
+  ustr1000 = ustr100 * 10
+  unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  unonascii10 = unonascii1 * 10
+  unonascii100 = unonascii10 * 10
+  unonascii1000 = unonascii100 * 10
+benchmark:
+  casecmp_p-1: lstr1.casecmp?(ustr1)
+  casecmp_p-10: lstr10.casecmp?(ustr10)
+  casecmp_p-100: lstr100.casecmp?(ustr100)
+  casecmp_p-1000: lstr1000.casecmp?(ustr1000)
+  casecmp_p-nonascii1: lnonascii1.casecmp?(unonascii1)
+  casecmp_p-nonascii10: lnonascii10.casecmp?(unonascii10)
+  casecmp_p-nonascii100: lnonascii100.casecmp?(unonascii100)
+  casecmp_p-nonascii1000: lnonascii1000.casecmp?(unonascii1000)
diff --git a/benchmark/string_concat.yml b/benchmark/string_concat.yml
new file mode 100644
index 0000000000..e65c00cca9
--- /dev/null
+++ b/benchmark/string_concat.yml
@@ -0,0 +1,45 @@
+prelude: |
+  CHUNK = "a" * 64
+  UCHUNK = "é" * 32
+  GC.disable # GC causes a lot of variance
+benchmark:
+  binary_concat_7bit: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::BINARY)
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+  utf8_concat_7bit: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+  utf8_concat_UTF8: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+  interpolation: |
+    buffer = "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}"
diff --git a/benchmark/string_downcase.yml b/benchmark/string_downcase.yml
new file mode 100644
index 0000000000..1fea6afbec
--- /dev/null
+++ b/benchmark/string_downcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"A".."Z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  downcase-1: str1.upcase
+  downcase-10: str10.upcase
+  downcase-100: str100.upcase
+  downcase-1000: str1000.upcase
+  downcase-nonascii1: nonascii1.downcase
+  downcase-nonascii10: nonascii10.downcase
+  downcase-nonascii100: nonascii100.downcase
+  downcase-nonascii1000: nonascii1000.downcase
diff --git a/benchmark/string_index.rb b/benchmark/string_index.rb
new file mode 100644
index 0000000000..7783111082
--- /dev/null
+++ b/benchmark/string_index.rb
@@ -0,0 +1,3 @@
+str1 = "あ" * 1024 + "い" # not single byte optimizable
+str2 = "い"
+100_000.times { str1.index(str2) }
diff --git a/benchmark/string_scan_re.rb b/benchmark/string_scan_re.rb
new file mode 100644
index 0000000000..b0d60201a9
--- /dev/null
+++ b/benchmark/string_scan_re.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan(/abc/) }
diff --git a/benchmark/string_scan_str.rb b/benchmark/string_scan_str.rb
new file mode 100644
index 0000000000..42440bd948
--- /dev/null
+++ b/benchmark/string_scan_str.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan('abc') }
diff --git a/benchmark/string_slice.yml b/benchmark/string_slice.yml
new file mode 100644
index 0000000000..fc2393c5d1
--- /dev/null
+++ b/benchmark/string_slice.yml
@@ -0,0 +1,11 @@
+prelude: |
+  long_string = "x"*1000+"-hår"
+benchmark:
+  regexp-short: |
+    "x-hår".slice!(/-(.)(.)(.)/, 3)
+  regexp-long: |
+    long_string.dup.slice!(/-(.)(.)(.)/, 3)
+  string-short: |
+    "x-hår".slice!("r")
+  string-long: |
+    long_string.dup.slice!("r")
diff --git a/benchmark/string_split.yml b/benchmark/string_split.yml
new file mode 100644
index 0000000000..cc2c7d7855
--- /dev/null
+++ b/benchmark/string_split.yml
@@ -0,0 +1,22 @@
+prelude: |
+  str1 = [*0..5].join(" ") + " "
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+benchmark:
+  to_chars-1: str1.split('')
+  to_chars-10: str10.split('')
+  to_chars-100: str100.split('')
+  to_chars-1000: str1000.split('')
+  to_words-1: str1.split(' ')
+  to_words-10: str10.split(' ')
+  to_words-100: str100.split(' ')
+  to_words-1000: str1000.split(' ')
+  re_chars-1: str1.split(//)
+  re_chars-10: str10.split(//)
+  re_chars-100: str100.split(//)
+  re_chars-1000: str1000.split(//)
+  re_space-1: str1.split(/ /)
+  re_space-10: str10.split(/ /)
+  re_space-100: str100.split(/ /)
+  re_space-1000: str1000.split(/ /)
diff --git a/benchmark/string_swapcase.yml b/benchmark/string_swapcase.yml
new file mode 100644
index 0000000000..eeb5928907
--- /dev/null
+++ b/benchmark/string_swapcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"A".."M",*"n".."z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{c0}".."\u{cf}",*"\u{f0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  swapcase-1: str1.swapcase
+  swapcase-10: str10.swapcase
+  swapcase-100: str100.swapcase
+  swapcase-1000: str1000.swapcase
+  swapcase-nonascii1: nonascii1.swapcase
+  swapcase-nonascii10: nonascii10.swapcase
+  swapcase-nonascii100: nonascii100.swapcase
+  swapcase-nonascii1000: nonascii1000.swapcase
diff --git a/benchmark/string_upcase.yml b/benchmark/string_upcase.yml
new file mode 100644
index 0000000000..dab84bbde2
--- /dev/null
+++ b/benchmark/string_upcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"a".."z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  upcase-1: str1.upcase
+  upcase-10: str10.upcase
+  upcase-100: str100.upcase
+  upcase-1000: str1000.upcase
+  upcase-nonascii1: nonascii1.upcase
+  upcase-nonascii10: nonascii10.upcase
+  upcase-nonascii100: nonascii100.upcase
+  upcase-nonascii1000: nonascii1000.upcase
diff --git a/benchmark/time_at.yml b/benchmark/time_at.yml
new file mode 100644
index 0000000000..3247efbe77
--- /dev/null
+++ b/benchmark/time_at.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  - 'Time.at(0)'
+  - 'Time.at(0, 500)'
+  - 'Time.at(0, in: "+09:00")'
+  - 'Time.at(0, 500, in: "+09:00")'
diff --git a/benchmark/time_new.yml b/benchmark/time_new.yml
new file mode 100644
index 0000000000..5947dd3a41
--- /dev/null
+++ b/benchmark/time_new.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - 'Time.new(2021)'
+  - 'Time.new(2021, 8, 22)'
+  - 'Time.new(2021, 8, 22, in: "+09:00")'
diff --git a/benchmark/time_now.yml b/benchmark/time_now.yml
new file mode 100644
index 0000000000..f6d6a31489
--- /dev/null
+++ b/benchmark/time_now.yml
@@ -0,0 +1,3 @@
+benchmark:
+  - 'Time.now'
+  - 'Time.now(in: "+09:00")'
diff --git a/benchmark/time_parse.yml b/benchmark/time_parse.yml
new file mode 100644
index 0000000000..6060b58bc6
--- /dev/null
+++ b/benchmark/time_parse.yml
@@ -0,0 +1,10 @@
+prelude: |
+  require 'time'
+  inspect = "2021-08-23 09:57:02 +0900"
+  iso8601 = "2021-08-23T09:57:02+09:00"
+benchmark:
+  - Time.iso8601(iso8601)
+  - Time.parse(iso8601)
+  - Time.parse(inspect)
+  - Time.new(iso8601) rescue Time.iso8601(iso8601)
+  - Time.new(inspect) rescue Time.parse(inspect)
diff --git a/benchmark/time_strptime.yml b/benchmark/time_strptime.yml
new file mode 100644
index 0000000000..8d89ebb7a7
--- /dev/null
+++ b/benchmark/time_strptime.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'time'
+benchmark:
+  - Time.strptime("28/Aug/2005:06:54:20 +0000", "%d/%b/%Y:%T %z")
+  - Time.strptime("1", "%s")
+  - Time.strptime("0 +0100", "%s %z")
+  - Time.strptime("0 UTC", "%s %z")
+  - Time.strptime("1.5", "%s.%N")
+  - Time.strptime("1.000000000001", "%s.%N")
+  - Time.strptime("20010203 -0200", "%Y%m%d %z")
+  - Time.strptime("20010203 UTC", "%Y%m%d %z")
+  - Time.strptime("2018-365", "%Y-%j")
+  - Time.strptime("2018-091", "%Y-%j")
diff --git a/benchmark/time_subsec.rb b/benchmark/time_subsec.rb
new file mode 100644
index 0000000000..505021c701
--- /dev/null
+++ b/benchmark/time_subsec.rb
@@ -0,0 +1,2 @@
+t = Time.now
+4000000.times { t.subsec }
diff --git a/benchmark/vm_array.yml b/benchmark/vm_array.yml
new file mode 100644
index 0000000000..2a177237ef
--- /dev/null
+++ b/benchmark/vm_array.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_array: |
+    a = [1,2,3,4,5,6,7,8,9,10]
+loop_count: 6000000
diff --git a/benchmark/vm_attr_ivar.yml b/benchmark/vm_attr_ivar.yml
new file mode 100644
index 0000000000..75b803478e
--- /dev/null
+++ b/benchmark/vm_attr_ivar.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    attr_reader :a, :b
+    def initialize
+      @a = nil
+      @b = nil
+    end
+  end
+  obj = C.new
+benchmark:
+  vm_attr_ivar: |
+    j = obj.a
+    k = obj.b
+loop_count: 30000000
diff --git a/benchmark/vm_attr_ivar_set.yml b/benchmark/vm_attr_ivar_set.yml
new file mode 100644
index 0000000000..a0d379b18a
--- /dev/null
+++ b/benchmark/vm_attr_ivar_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    attr_accessor :a, :b
+    def initialize
+      @a = nil
+      @b = nil
+    end
+  end
+  obj = C.new
+benchmark:
+  vm_attr_ivar_set: |
+    obj.a = 1
+    obj.b = 2
+loop_count: 30000000
diff --git a/benchmark/bm_vm3_backtrace.rb b/benchmark/vm_backtrace.rb
index 0fbf73e1ca..0fbf73e1ca 100644
--- a/benchmark/bm_vm3_backtrace.rb
+++ b/benchmark/vm_backtrace.rb
diff --git a/benchmark/vm_bigarray.yml b/benchmark/vm_bigarray.yml
new file mode 100644
index 0000000000..8b2d3f3443
--- /dev/null
+++ b/benchmark/vm_bigarray.yml
@@ -0,0 +1,105 @@
+benchmark:
+  vm_bigarray: |
+    a = [
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+    ]
+loop_count: 6000000
diff --git a/benchmark/vm_bighash.yml b/benchmark/vm_bighash.yml
new file mode 100644
index 0000000000..4dacfde793
--- /dev/null
+++ b/benchmark/vm_bighash.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_bighash: |
+    a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+loop_count: 60000
diff --git a/benchmark/vm_block.yml b/benchmark/vm_block.yml
new file mode 100644
index 0000000000..68b3e40bf5
--- /dev/null
+++ b/benchmark/vm_block.yml
@@ -0,0 +1,9 @@
+prelude: |
+  def m
+    yield
+  end
+benchmark:
+  vm_block: |
+    m{
+    }
+loop_count: 30000000
diff --git a/benchmark/vm_block_handler.yml b/benchmark/vm_block_handler.yml
new file mode 100644
index 0000000000..461d7953ad
--- /dev/null
+++ b/benchmark/vm_block_handler.yml
@@ -0,0 +1,27 @@
+# :FIXME: is there a way to benchmark block_handler_type_ifunc?
+
+prelude: |
+  p = proc{_1}
+  o = Object.new
+  def o.each
+    i = 0
+    while i < 3_000_000 do
+      yield i
+      i += 1
+    end
+  end
+
+benchmark:
+  - name: block_handler_type_iseq
+    script: |
+      o.each{_1}
+
+  - name: block_handler_type_symbol
+    script: |
+      o.each(&:itself)
+
+  - name: block_handler_type_proc
+    script: |
+      o.each(&p)
+
+loop_count: 1
diff --git a/benchmark/vm_blockparam.yml b/benchmark/vm_blockparam.yml
new file mode 100644
index 0000000000..5e5a0170a2
--- /dev/null
+++ b/benchmark/vm_blockparam.yml
@@ -0,0 +1,7 @@
+prelude: |
+  def m &b
+  end
+benchmark:
+  vm_blockparam: |
+    m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_call.yml b/benchmark/vm_blockparam_call.yml
new file mode 100644
index 0000000000..a7d8d366ea
--- /dev/null
+++ b/benchmark/vm_blockparam_call.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def m &b
+    b.call
+  end
+benchmark:
+  vm_blockparam_call: |
+    m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_pass.yml b/benchmark/vm_blockparam_pass.yml
new file mode 100644
index 0000000000..841f5e7a63
--- /dev/null
+++ b/benchmark/vm_blockparam_pass.yml
@@ -0,0 +1,12 @@
+prelude: |
+  def bp_yield
+    yield
+  end
+
+  def bp_pass &b
+    bp_yield &b
+  end
+benchmark:
+  vm_blockparam_pass: |
+    bp_pass{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_yield.yml b/benchmark/vm_blockparam_yield.yml
new file mode 100644
index 0000000000..8ea9b46ed2
--- /dev/null
+++ b/benchmark/vm_blockparam_yield.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def bp_yield &b
+    yield
+  end
+benchmark:
+  vm_blockparam_yield: |
+    bp_yield{}
+loop_count: 30000000
diff --git a/benchmark/vm_case.yml b/benchmark/vm_case.yml
new file mode 100644
index 0000000000..b26a491a15
--- /dev/null
+++ b/benchmark/vm_case.yml
@@ -0,0 +1,13 @@
+benchmark:
+  vm_case: |
+    case :foo
+    when :bar
+      raise
+    when :baz
+      raise
+    when :boo
+      raise
+    when :foo
+      # noop
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_case_classes.yml b/benchmark/vm_case_classes.yml
new file mode 100644
index 0000000000..cacc4f0464
--- /dev/null
+++ b/benchmark/vm_case_classes.yml
@@ -0,0 +1,9 @@
+benchmark:
+  vm_case_classes: |
+    case :foo
+    when Hash
+      raise
+    when Array
+      raise
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_case_lit.yml b/benchmark/vm_case_lit.yml
new file mode 100644
index 0000000000..9f91801544
--- /dev/null
+++ b/benchmark/vm_case_lit.yml
@@ -0,0 +1,23 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_case_lit: |
+    i = 0
+    @ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
+    def foo(i)
+      @ret[i % @ret.size]
+    end
+
+    while i<6_000_000
+      case foo(i)
+      when "foo" then :foo
+      when true then true
+      when false then false
+      when :sym then :sym
+      when 6 then :fix
+      when nil then nil
+      when 0.1 then :float
+      when 0xffffffffffffffff then :big
+      end
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/bm_vm3_clearmethodcache.rb b/benchmark/vm_clearmethodcache.rb
index 9661323cd2..9661323cd2 100644
--- a/benchmark/bm_vm3_clearmethodcache.rb
+++ b/benchmark/vm_clearmethodcache.rb
diff --git a/benchmark/vm_const.yml b/benchmark/vm_const.yml
new file mode 100644
index 0000000000..8939ca0cd3
--- /dev/null
+++ b/benchmark/vm_const.yml
@@ -0,0 +1,13 @@
+prelude: |
+  Const = 1
+  A = B = C = D = E = F = G = H = I = J = K = L = M = N = O = P = Q = R = S = T = U = V = W = X = Y = Z = 1
+  def foo
+    A; B; C; D; E; F; G; H; I; J; K; L; M; N; O; P; Q; R; S; T; U; V; W; X; Y; Z
+  end
+benchmark:
+  vm_const: |
+    j = Const
+    k = Const
+  vm_const_many: |
+    foo
+loop_count: 30000000
diff --git a/benchmark/vm_cvar.yml b/benchmark/vm_cvar.yml
new file mode 100644
index 0000000000..1d0e161829
--- /dev/null
+++ b/benchmark/vm_cvar.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class A
+    @@foo = 1
+
+    def self.foo
+      @@foo
+    end
+
+    ("A".."Z").each do |module_name|
+      eval <<-EOM
+        module #{module_name}
+        end
+
+        include #{module_name}
+      EOM
+    end
+  end
+benchmark:
+  vm_cvar: A.foo
+loop_count: 600000
diff --git a/benchmark/vm_defined_method.yml b/benchmark/vm_defined_method.yml
new file mode 100644
index 0000000000..347e0cfd33
--- /dev/null
+++ b/benchmark/vm_defined_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+  class Object
+    define_method(:m){}
+  end
+benchmark:
+  vm_defined_method: |
+    m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_dstr.yml b/benchmark/vm_dstr.yml
new file mode 100644
index 0000000000..30c7a3193c
--- /dev/null
+++ b/benchmark/vm_dstr.yml
@@ -0,0 +1,6 @@
+prelude: |
+  x = y = 'z'
+benchmark:
+  vm_dstr: |
+    str = "foo#{x}bar#{y}baz"
+loop_count: 6000000
diff --git a/benchmark/vm_dstr_ary.rb b/benchmark/vm_dstr_ary.rb
new file mode 100644
index 0000000000..1d3aa3b97b
--- /dev/null
+++ b/benchmark/vm_dstr_ary.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = []
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_bool.rb b/benchmark/vm_dstr_bool.rb
new file mode 100644
index 0000000000..631ca54755
--- /dev/null
+++ b/benchmark/vm_dstr_bool.rb
@@ -0,0 +1,7 @@
+i = 0
+x = true
+y = false
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_class_module.rb b/benchmark/vm_dstr_class_module.rb
new file mode 100644
index 0000000000..becf0861c7
--- /dev/null
+++ b/benchmark/vm_dstr_class_module.rb
@@ -0,0 +1,10 @@
+i = 0
+class A; end unless defined?(A)
+module B; end unless defined?(B)
+x = A
+y = B
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
+
diff --git a/benchmark/vm_dstr_digit.rb b/benchmark/vm_dstr_digit.rb
new file mode 100644
index 0000000000..caaa395192
--- /dev/null
+++ b/benchmark/vm_dstr_digit.rb
@@ -0,0 +1,7 @@
+i = 0
+x = 0
+y = 9
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_int.rb b/benchmark/vm_dstr_int.rb
new file mode 100644
index 0000000000..ed380d7595
--- /dev/null
+++ b/benchmark/vm_dstr_int.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{i}bar#{i}baz"
+end
diff --git a/benchmark/vm_dstr_nil.rb b/benchmark/vm_dstr_nil.rb
new file mode 100644
index 0000000000..ec4f5d6c67
--- /dev/null
+++ b/benchmark/vm_dstr_nil.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = nil
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj.rb b/benchmark/vm_dstr_obj.rb
new file mode 100644
index 0000000000..fb78637ead
--- /dev/null
+++ b/benchmark/vm_dstr_obj.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = Object.new
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj_def.rb b/benchmark/vm_dstr_obj_def.rb
new file mode 100644
index 0000000000..99ff7b98fb
--- /dev/null
+++ b/benchmark/vm_dstr_obj_def.rb
@@ -0,0 +1,8 @@
+i = 0
+o = Object.new
+def o.to_s; -""; end
+x = y = o
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_str.rb b/benchmark/vm_dstr_str.rb
new file mode 100644
index 0000000000..45fc107892
--- /dev/null
+++ b/benchmark/vm_dstr_str.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = ""
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_sym.rb b/benchmark/vm_dstr_sym.rb
new file mode 100644
index 0000000000..484b8f8150
--- /dev/null
+++ b/benchmark/vm_dstr_sym.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = :z
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_ensure.yml b/benchmark/vm_ensure.yml
new file mode 100644
index 0000000000..4ea62f30de
--- /dev/null
+++ b/benchmark/vm_ensure.yml
@@ -0,0 +1,14 @@
+# Not utilizing loop_count since using it for this is too unstable for now
+benchmark:
+  vm_ensure: |
+    i = 0
+    while i<30_000_000
+      i += 1
+      begin
+        begin
+        ensure
+        end
+      ensure
+      end
+    end
+loop_count: 1
diff --git a/benchmark/vm_eval.yml b/benchmark/vm_eval.yml
new file mode 100644
index 0000000000..7ba1a8d1de
--- /dev/null
+++ b/benchmark/vm_eval.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_eval: |
+    eval("1")
+loop_count: 6000000
diff --git a/benchmark/vm_fiber_allocate.yml b/benchmark/vm_fiber_allocate.yml
new file mode 100644
index 0000000000..b5a54e1ddf
--- /dev/null
+++ b/benchmark/vm_fiber_allocate.yml
@@ -0,0 +1,8 @@
+prelude: |
+  # Disable GC to see raw throughput:
+  GC.disable
+benchmark:
+  vm_fiber_allocate: |
+    fiber = Fiber.new{Fiber.yield}
+    fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_count.yml b/benchmark/vm_fiber_count.yml
new file mode 100644
index 0000000000..b83d3152d4
--- /dev/null
+++ b/benchmark/vm_fiber_count.yml
@@ -0,0 +1,10 @@
+# On Linux, you will need to increase the maximum number of memory maps:
+# sudo sysctl -w vm.max_map_count=200000
+prelude: |
+  fibers = []
+benchmark:
+  vm_fiber_count: |
+    fiber = Fiber.new{Fiber.yield}
+    fibers << fiber
+    fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_reuse.yml b/benchmark/vm_fiber_reuse.yml
new file mode 100644
index 0000000000..4ca41085b1
--- /dev/null
+++ b/benchmark/vm_fiber_reuse.yml
@@ -0,0 +1,14 @@
+prelude: |
+  GC.disable
+  fibers = []
+benchmark:
+  vm_fiber_reuse: |
+    1024.times do
+      fiber = Fiber.new{Fiber.yield}
+      fibers << fiber
+      fiber.resume
+    end
+
+    fibers.clear
+    GC.start
+loop_count: 200
diff --git a/benchmark/vm_fiber_reuse_gc.yml b/benchmark/vm_fiber_reuse_gc.yml
new file mode 100644
index 0000000000..892622f121
--- /dev/null
+++ b/benchmark/vm_fiber_reuse_gc.yml
@@ -0,0 +1,12 @@
+# https://bugs.ruby-lang.org/issues/16009
+prelude: |
+  fibers = []
+benchmark:
+  vm_fiber_reuse_gc: |
+    2000.times do
+      fiber = Fiber.new{Fiber.yield}
+      fibers << fiber
+      fiber.resume
+    end
+    fibers.clear
+loop_count: 100
diff --git a/benchmark/vm_fiber_switch.yml b/benchmark/vm_fiber_switch.yml
new file mode 100644
index 0000000000..3de36b66eb
--- /dev/null
+++ b/benchmark/vm_fiber_switch.yml
@@ -0,0 +1,9 @@
+prelude: |
+  # based on benchmark for [ruby-core:65518] [Feature #10341] by Knut Franke
+  fib = Fiber.new do
+    loop { Fiber.yield }
+  end
+benchmark:
+  vm_fiber_switch: |
+    fib.resume
+loop_count: 20000000
diff --git a/benchmark/vm_float_simple.yml b/benchmark/vm_float_simple.yml
new file mode 100644
index 0000000000..92f5fd52ab
--- /dev/null
+++ b/benchmark/vm_float_simple.yml
@@ -0,0 +1,8 @@
+prelude: |
+  f = 0.0
+benchmark:
+  vm_float_simple: |
+    f += 0.1; f -= 0.1
+    f += 0.1; f -= 0.1
+    f += 0.1; f -= 0.1
+loop_count: 30000000
diff --git a/benchmark/vm_freezeobj.yml b/benchmark/vm_freezeobj.yml
new file mode 100644
index 0000000000..69a795a354
--- /dev/null
+++ b/benchmark/vm_freezeobj.yml
@@ -0,0 +1,6 @@
+prelude: |
+ objs = 100000.times.map { Object.new }
+benchmark:
+  vm_freeze_obj: |
+    objs.map(&:freeze)
+loop_count: 600
diff --git a/benchmark/vm_freezestring.yml b/benchmark/vm_freezestring.yml
new file mode 100644
index 0000000000..facc9aa043
--- /dev/null
+++ b/benchmark/vm_freezestring.yml
@@ -0,0 +1,10 @@
+prelude: |
+  class String
+    def freeze
+      -self
+    end
+  end
+benchmark:
+  vm_freezestring: |
+    "tXnL1BP5T1WPXMjuFNLQtallEtRcay1t2lHtJSrlVsDgvunlbtfpr/DGdH0NGYE9".freeze
+loop_count: 6000000
diff --git a/benchmark/vm_gc.rb b/benchmark/vm_gc.rb
new file mode 100644
index 0000000000..e668026915
--- /dev/null
+++ b/benchmark/vm_gc.rb
@@ -0,0 +1,6 @@
+5000.times do
+  100.times do
+    {"xxxx"=>"yyyy"}
+  end
+  GC.start
+end
diff --git a/benchmark/vm_gc_old_full.rb b/benchmark/vm_gc_old_full.rb
new file mode 100644
index 0000000000..cfdfc8c5a5
--- /dev/null
+++ b/benchmark/vm_gc_old_full.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+100.times do
+  GC.start
+end
diff --git a/benchmark/vm_gc_old_immediate.rb b/benchmark/vm_gc_old_immediate.rb
new file mode 100644
index 0000000000..ad22feb655
--- /dev/null
+++ b/benchmark/vm_gc_old_immediate.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+30_000.times do
+  GC.start(full_mark: false, immediate_sweep: true)
+end
diff --git a/benchmark/vm_gc_old_lazy.rb b/benchmark/vm_gc_old_lazy.rb
new file mode 100644
index 0000000000..b74d44baf1
--- /dev/null
+++ b/benchmark/vm_gc_old_lazy.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+30_000.times do
+  GC.start(full_mark: false, immediate_sweep: false)
+end
diff --git a/benchmark/vm_gc_short_lived.yml b/benchmark/vm_gc_short_lived.yml
new file mode 100644
index 0000000000..29c803fee3
--- /dev/null
+++ b/benchmark/vm_gc_short_lived.yml
@@ -0,0 +1,9 @@
+benchmark:
+  vm_gc_short_lived: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_complex_long.yml b/benchmark/vm_gc_short_with_complex_long.yml
new file mode 100644
index 0000000000..4b6c3ed7b9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_complex_long.yml
@@ -0,0 +1,25 @@
+prelude: |
+  def nested_hash h, n
+    if n == 0
+      ''
+    else
+      10.times{
+        h[Object.new] = nested_hash(h, n-1)
+      }
+    end
+  end
+
+  long_lived = Hash.new
+  nested_hash long_lived, 6
+
+  GC.start
+  GC.start
+benchmark:
+  vm_gc_short_with_complex_long: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_long.yml b/benchmark/vm_gc_short_with_long.yml
new file mode 100644
index 0000000000..03ba0f95a9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_long.yml
@@ -0,0 +1,13 @@
+prelude: |
+  long_lived = Array.new(1_000_000){|i| "#{i}"}
+  GC.start
+  GC.start
+benchmark:
+  vm_gc_short_with_long: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_symbol.yml b/benchmark/vm_gc_short_with_symbol.yml
new file mode 100644
index 0000000000..129b8bf4ed
--- /dev/null
+++ b/benchmark/vm_gc_short_with_symbol.yml
@@ -0,0 +1,13 @@
+prelude: |
+  50_000.times{|i| sym = "sym#{i}".to_sym}
+  GC.start
+  GC.start
+benchmark:
+  vm_gc_short_with_symbol: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary.yml b/benchmark/vm_gc_wb_ary.yml
new file mode 100644
index 0000000000..e3293e72d0
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary.yml
@@ -0,0 +1,12 @@
+prelude: |
+  short_lived_ary = []
+
+  if RUBY_VERSION >= "2.2.0"
+    GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+  end
+
+  short_lived = ''
+benchmark:
+  vm_gc_wb_ary: |
+    short_lived_ary[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary_promoted.yml b/benchmark/vm_gc_wb_ary_promoted.yml
new file mode 100644
index 0000000000..003995945b
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary_promoted.yml
@@ -0,0 +1,15 @@
+prelude: |
+  long_lived = []
+
+  if RUBY_VERSION > "2.2.0"
+    3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+  elsif
+    GC.start
+  end
+
+  short_lived = ''
+
+benchmark:
+  vm_gc_wb_ary_promoted: |
+    long_lived[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj.yml b/benchmark/vm_gc_wb_obj.yml
new file mode 100644
index 0000000000..a2a2ce2d18
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj.yml
@@ -0,0 +1,15 @@
+prelude: |
+  class C
+    attr_accessor :foo
+  end
+  short_lived_obj = C.new
+
+  if RUBY_VERSION >= "2.2.0"
+    GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+  end
+
+  short_lived = ''
+benchmark:
+  vm_gc_wb_obj: |
+    short_lived_obj.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj_promoted.yml b/benchmark/vm_gc_wb_obj_promoted.yml
new file mode 100644
index 0000000000..00a454ba72
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj_promoted.yml
@@ -0,0 +1,17 @@
+prelude: |
+  class C
+    attr_accessor :foo
+  end
+  long_lived = C.new
+
+  if RUBY_VERSION >= "2.2.0"
+    3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+  elsif
+    GC.start
+  end
+
+  short_lived = ''
+benchmark:
+  vm_gc_wb_obj_promoted: |
+    long_lived.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_iclass_super.yml b/benchmark/vm_iclass_super.yml
new file mode 100644
index 0000000000..21bb7db247
--- /dev/null
+++ b/benchmark/vm_iclass_super.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class C
+    def m
+      1
+    end
+
+    ("A".."M").each do |module_name|
+      eval <<-EOM
+          module #{module_name}
+            def m; super; end
+          end
+          prepend #{module_name}
+      EOM
+    end
+  end
+
+  obj = C.new
+benchmark:
+  vm_iclass_super: obj.m
+loop_count: 6000000
diff --git a/benchmark/vm_ivar.yml b/benchmark/vm_ivar.yml
new file mode 100644
index 0000000000..119531d5ef
--- /dev/null
+++ b/benchmark/vm_ivar.yml
@@ -0,0 +1,6 @@
+prelude: "@a = 1\n"
+benchmark:
+  vm_ivar: |
+    j = @a
+    k = @a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_embedded_obj_init.yml b/benchmark/vm_ivar_embedded_obj_init.yml
new file mode 100644
index 0000000000..74fe20a630
--- /dev/null
+++ b/benchmark/vm_ivar_embedded_obj_init.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_embedded_obj_init: |
+    c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_extended_obj_init.yml b/benchmark/vm_ivar_extended_obj_init.yml
new file mode 100644
index 0000000000..f054bab282
--- /dev/null
+++ b/benchmark/vm_ivar_extended_obj_init.yml
@@ -0,0 +1,16 @@
+prelude: |
+  class C
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+      @d = nil
+      @e = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_extended_obj_init: |
+    c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_generic_get.yml b/benchmark/vm_ivar_generic_get.yml
new file mode 100644
index 0000000000..dae2d37671
--- /dev/null
+++ b/benchmark/vm_ivar_generic_get.yml
@@ -0,0 +1,17 @@
+prelude: |
+  class C < Array
+    attr_reader :a, :b, :c
+    def initialize
+      @a = nil
+      @b = nil
+      @c = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_generic_get: |
+    c.a
+    c.b
+    c.c
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_generic_set.yml b/benchmark/vm_ivar_generic_set.yml
new file mode 100644
index 0000000000..102a6577fb
--- /dev/null
+++ b/benchmark/vm_ivar_generic_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C < Array
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_generic_set: |
+    c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_get.yml b/benchmark/vm_ivar_get.yml
new file mode 100644
index 0000000000..9174af6965
--- /dev/null
+++ b/benchmark/vm_ivar_get.yml
@@ -0,0 +1,37 @@
+prelude: |
+  class Example
+    def initialize
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+      @levar = 1
+    end
+
+    def get_value_loop
+      sum = 0
+
+      i = 0
+      while i < 1000000
+        # 10 times to de-emphasize loop overhead
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        i += 1
+      end
+
+      return sum
+    end
+  end
+
+  obj = Example.new
+benchmark:
+  vm_ivar_get: |
+    obj.get_value_loop
+loop_count: 100
diff --git a/benchmark/vm_ivar_get_unintialized.yml b/benchmark/vm_ivar_get_unintialized.yml
new file mode 100644
index 0000000000..a1ccfb06ce
--- /dev/null
+++ b/benchmark/vm_ivar_get_unintialized.yml
@@ -0,0 +1,12 @@
+prelude: |
+  class Example
+    def read
+      @uninitialized
+    end
+  end
+
+  obj = Example.new
+benchmark:
+  vm_ivar_get_uninitialized: |
+    obj.read
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_lazy_set.yml b/benchmark/vm_ivar_lazy_set.yml
new file mode 100644
index 0000000000..7372ffcfbc
--- /dev/null
+++ b/benchmark/vm_ivar_lazy_set.yml
@@ -0,0 +1,12 @@
+prelude: |
+  class Example
+    def lazy_set
+      @uninitialized ||= 123
+    end
+  end
+
+  objs = 10000000.times.map { Example.new }
+benchmark:
+  vm_ivar_lazy_set: |
+    objs.each(&:lazy_set)
+loop_count: 1
diff --git a/benchmark/vm_ivar_of_class.yml b/benchmark/vm_ivar_of_class.yml
new file mode 100644
index 0000000000..172e28b2fd
--- /dev/null
+++ b/benchmark/vm_ivar_of_class.yml
@@ -0,0 +1,12 @@
+prelude: |
+  class C
+    @a = 1
+    def self.a
+      _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+      _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+    end
+  end
+benchmark:
+  vm_ivar_of_class: |
+    a = C.a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_of_class_set.yml b/benchmark/vm_ivar_of_class_set.yml
new file mode 100644
index 0000000000..2ea5199423
--- /dev/null
+++ b/benchmark/vm_ivar_of_class_set.yml
@@ -0,0 +1,11 @@
+prelude: |
+  class C
+    @a = 1
+    def self.a o
+      @a = o; @a = o; @a = o; @a = o; @a = o; @a = o;
+    end
+  end
+benchmark:
+  vm_ivar_of_class_set: |
+    a = C.a(nil)
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set.yml b/benchmark/vm_ivar_set.yml
new file mode 100644
index 0000000000..8bbb60043b
--- /dev/null
+++ b/benchmark/vm_ivar_set.yml
@@ -0,0 +1,5 @@
+benchmark:
+  vm_ivar_set: |
+    @a = 1
+    @b = 2
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set_on_instance.yml b/benchmark/vm_ivar_set_on_instance.yml
new file mode 100644
index 0000000000..91857b7742
--- /dev/null
+++ b/benchmark/vm_ivar_set_on_instance.yml
@@ -0,0 +1,35 @@
+prelude: |
+  class TheClass
+    def initialize
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+      @levar = 1
+    end
+
+    def set_value_loop
+      # 1M
+      i = 0
+      while i < 1000000
+        # 10 times to de-emphasize loop overhead
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        i += 1
+      end
+    end
+  end
+
+  obj = TheClass.new
+
+benchmark:
+  vm_ivar_set_on_instance: |
+    obj.set_value_loop
+loop_count: 100
diff --git a/benchmark/vm_ivar_set_subclass.yml b/benchmark/vm_ivar_set_subclass.yml
new file mode 100644
index 0000000000..bc8bf5bf6b
--- /dev/null
+++ b/benchmark/vm_ivar_set_subclass.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class A
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+      @d = nil
+      @e = nil
+    end
+  end
+  class B < A; end
+  class C < A; end
+
+  b = B.new
+  c = C.new
+benchmark:
+  vm_ivar_init_subclass: |
+    b.set_ivars
+    c.set_ivars
+loop_count: 3000000
diff --git a/benchmark/vm_length.yml b/benchmark/vm_length.yml
new file mode 100644
index 0000000000..5fd94e7d86
--- /dev/null
+++ b/benchmark/vm_length.yml
@@ -0,0 +1,8 @@
+prelude: |
+  a = 'abc'
+  b = [1, 2, 3]
+benchmark:
+  vm_length: |
+    a.length
+    b.length
+loop_count: 30000000
diff --git a/benchmark/vm_lvar_cond_set.yml b/benchmark/vm_lvar_cond_set.yml
new file mode 100644
index 0000000000..1845f9d12e
--- /dev/null
+++ b/benchmark/vm_lvar_cond_set.yml
@@ -0,0 +1,8 @@
+benchmark:
+  vm_lvar_cond_set: |
+    a ||= 1
+    b ||= 1
+    c ||= 1
+    d ||= 1
+    nil
+loop_count: 30000000
diff --git a/benchmark/vm_lvar_init.yml b/benchmark/vm_lvar_init.yml
new file mode 100644
index 0000000000..70a9b1c0ca
--- /dev/null
+++ b/benchmark/vm_lvar_init.yml
@@ -0,0 +1,21 @@
+# while loop cost is not removed because `i` is used in the script
+benchmark:
+  vm_lvar_init: |
+    def m v
+      unless v
+        # unreachable code
+        v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
+        v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
+        v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
+        v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
+        v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
+      end
+    end
+
+    i = 0
+
+    while i<30_000_000
+      i += 1
+      m i
+    end
+loop_count: 1
diff --git a/benchmark/vm_lvar_set.yml b/benchmark/vm_lvar_set.yml
new file mode 100644
index 0000000000..f29f763d81
--- /dev/null
+++ b/benchmark/vm_lvar_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_lvar_set: |
+    a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
+loop_count: 30000000
diff --git a/benchmark/vm_method.yml b/benchmark/vm_method.yml
new file mode 100644
index 0000000000..d45e4ec572
--- /dev/null
+++ b/benchmark/vm_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def m
+    nil
+  end
+benchmark:
+  vm_method: |
+    m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_missing.yml b/benchmark/vm_method_missing.yml
new file mode 100644
index 0000000000..3da456c0bb
--- /dev/null
+++ b/benchmark/vm_method_missing.yml
@@ -0,0 +1,11 @@
+prelude: |
+  class C
+    def method_missing mid
+    end
+  end
+
+  obj = C.new
+benchmark:
+  vm_method_missing: |
+    obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_with_block.yml b/benchmark/vm_method_with_block.yml
new file mode 100644
index 0000000000..281a481394
--- /dev/null
+++ b/benchmark/vm_method_with_block.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def m
+    nil
+  end
+benchmark:
+  vm_method_with_block: |
+    m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
+loop_count: 6000000
diff --git a/benchmark/vm_module_ann_const_set.yml b/benchmark/vm_module_ann_const_set.yml
new file mode 100644
index 0000000000..243229ba4a
--- /dev/null
+++ b/benchmark/vm_module_ann_const_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_module_ann_const_set: |
+    Module.new.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_module_const_set.yml b/benchmark/vm_module_const_set.yml
new file mode 100644
index 0000000000..e5a24181a9
--- /dev/null
+++ b/benchmark/vm_module_const_set.yml
@@ -0,0 +1,8 @@
+prelude: |
+  module M
+  end
+  $VERBOSE = nil
+benchmark:
+  vm_module_const_set: |
+    M.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_mutex.yml b/benchmark/vm_mutex.yml
new file mode 100644
index 0000000000..abcf1e28ce
--- /dev/null
+++ b/benchmark/vm_mutex.yml
@@ -0,0 +1,8 @@
+prelude: |
+  require 'thread'
+
+  m = Thread::Mutex.new
+benchmark:
+  vm_mutex: |
+    m.synchronize{}
+loop_count: 6000000
diff --git a/benchmark/vm_neq.yml b/benchmark/vm_neq.yml
new file mode 100644
index 0000000000..fb04d15ae8
--- /dev/null
+++ b/benchmark/vm_neq.yml
@@ -0,0 +1,7 @@
+prelude: |
+  obj1 = Object.new
+  obj2 = Object.new
+benchmark:
+  vm_neq: |
+    obj1 != obj2
+loop_count: 30000000
diff --git a/benchmark/vm_newlambda.yml b/benchmark/vm_newlambda.yml
new file mode 100644
index 0000000000..0b9787d91a
--- /dev/null
+++ b/benchmark/vm_newlambda.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_newlambda: |
+    lambda {}
+loop_count: 6000000
diff --git a/benchmark/vm_not.yml b/benchmark/vm_not.yml
new file mode 100644
index 0000000000..c68dde3c50
--- /dev/null
+++ b/benchmark/vm_not.yml
@@ -0,0 +1,6 @@
+prelude: |
+  obj = Object.new
+benchmark:
+  vm_not: |
+    !obj
+loop_count: 30000000
diff --git a/benchmark/vm_poly_method.yml b/benchmark/vm_poly_method.yml
new file mode 100644
index 0000000000..dd2f4e71de
--- /dev/null
+++ b/benchmark/vm_poly_method.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_poly_method: |
+    class C1
+      def m
+        1
+      end
+    end
+    class C2
+      def m
+        2
+      end
+    end
+
+    o1 = C1.new
+    o2 = C2.new
+
+    i = 0
+    while i<6_000_000
+      o = (i % 2 == 0) ? o1 : o2
+      o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/vm_poly_method_ov.yml b/benchmark/vm_poly_method_ov.yml
new file mode 100644
index 0000000000..bca1b62729
--- /dev/null
+++ b/benchmark/vm_poly_method_ov.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_poly_method_ov: |
+    class C1
+      def m
+        1
+      end
+    end
+    class C2
+      def m
+        2
+      end
+    end
+
+    o1 = C1.new
+    o2 = C2.new
+
+    i = 0
+    while i<6_000_000
+      o = (i % 2 == 0) ? o1 : o2
+    #  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/vm_poly_same_method.yml b/benchmark/vm_poly_same_method.yml
new file mode 100644
index 0000000000..6c5404ac84
--- /dev/null
+++ b/benchmark/vm_poly_same_method.yml
@@ -0,0 +1,25 @@
+prelude: |
+  module AR; end
+  class AR::Base
+    def create_or_update
+      nil
+    end
+    def save
+      create_or_update
+    end
+  end
+  class Foo < AR::Base; end
+  class Bar < AR::Base; end
+  o1 = Foo.new
+  o2 = Bar.new
+benchmark:
+  vm_poly_same_method: |
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+loop_count: 6000000
diff --git a/benchmark/vm_poly_singleton.yml b/benchmark/vm_poly_singleton.yml
new file mode 100644
index 0000000000..c7923160fb
--- /dev/null
+++ b/benchmark/vm_poly_singleton.yml
@@ -0,0 +1,18 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_poly_singleton: |
+    class C1
+      def m; 1; end
+    end
+
+    o1 = C1.new
+    o2 = C1.new
+    o2.singleton_class
+
+    i = 0
+    while i<6_000_000 # benchmark loop 2
+      o = (i % 2 == 0) ? o1 : o2
+      o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/vm_proc.yml b/benchmark/vm_proc.yml
new file mode 100644
index 0000000000..2f8de6c272
--- /dev/null
+++ b/benchmark/vm_proc.yml
@@ -0,0 +1,12 @@
+prelude: |
+  def m &b
+    b
+  end
+
+  pr = m{
+    a = 1
+  }
+benchmark:
+  vm_proc: |
+    pr.call
+loop_count: 6000000
diff --git a/benchmark/vm_raise1.yml b/benchmark/vm_raise1.yml
new file mode 100644
index 0000000000..247d9f70ee
--- /dev/null
+++ b/benchmark/vm_raise1.yml
@@ -0,0 +1,16 @@
+prelude: |
+  def rec n
+    if n > 0
+      rec n-1
+    else
+      raise
+    end
+  end
+benchmark:
+  vm_raise1: |
+    begin
+      rec 1
+    rescue
+      # ignore
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_raise2.yml b/benchmark/vm_raise2.yml
new file mode 100644
index 0000000000..f0fa047b3c
--- /dev/null
+++ b/benchmark/vm_raise2.yml
@@ -0,0 +1,16 @@
+prelude: |
+  def rec n
+    if n > 0
+      rec n-1
+    else
+      raise
+    end
+  end
+benchmark:
+  vm_raise2: |
+    begin
+      rec 10
+    rescue
+      # ignore
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_regexp.yml b/benchmark/vm_regexp.yml
new file mode 100644
index 0000000000..2aa3d94dbd
--- /dev/null
+++ b/benchmark/vm_regexp.yml
@@ -0,0 +1,8 @@
+prelude: |
+  str = 'xxxhogexxx'
+benchmark:
+  vm_regexp: |
+    /hoge/ =~ str
+  vm_regexp_invert: |
+    str =~ /hoge/
+loop_count: 6000000
diff --git a/benchmark/vm_rescue.yml b/benchmark/vm_rescue.yml
new file mode 100644
index 0000000000..b4a0af521f
--- /dev/null
+++ b/benchmark/vm_rescue.yml
@@ -0,0 +1,6 @@
+benchmark:
+  vm_rescue: |
+    begin
+    rescue
+    end
+loop_count: 30000000
diff --git a/benchmark/vm_send.yml b/benchmark/vm_send.yml
new file mode 100644
index 0000000000..f31bc7ac89
--- /dev/null
+++ b/benchmark/vm_send.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    def m
+    end
+  end
+
+  o = C.new
+  m = :m
+benchmark:
+  vm_send: |
+    o.__send__ :m
+  vm_send_var: |
+    o.__send__ m
+loop_count: 6000000
diff --git a/benchmark/vm_send_cfunc.yml b/benchmark/vm_send_cfunc.yml
new file mode 100644
index 0000000000..b114ac317d
--- /dev/null
+++ b/benchmark/vm_send_cfunc.yml
@@ -0,0 +1,3 @@
+benchmark:
+  vm_send_cfunc: self.class
+loop_count: 100000000
diff --git a/benchmark/vm_simplereturn.yml b/benchmark/vm_simplereturn.yml
new file mode 100644
index 0000000000..c9829cff0b
--- /dev/null
+++ b/benchmark/vm_simplereturn.yml
@@ -0,0 +1,7 @@
+prelude: |
+  def m
+    return 1
+  end
+benchmark:
+  vm_simplereturn: m
+loop_count: 30000000
diff --git a/benchmark/vm_string_literal.yml b/benchmark/vm_string_literal.yml
new file mode 100644
index 0000000000..64439c7980
--- /dev/null
+++ b/benchmark/vm_string_literal.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_string_literal: |
+    x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aref_hi.yml b/benchmark/vm_struct_big_aref_hi.yml
new file mode 100644
index 0000000000..4cf78970cb
--- /dev/null
+++ b/benchmark/vm_struct_big_aref_hi.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_aref_hi: |
+    x.z # x[25]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aref_lo.yml b/benchmark/vm_struct_big_aref_lo.yml
new file mode 100644
index 0000000000..c91af27fa5
--- /dev/null
+++ b/benchmark/vm_struct_big_aref_lo.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_aref_lo: |
+    x.k # x[10]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aset.yml b/benchmark/vm_struct_big_aset.yml
new file mode 100644
index 0000000000..69550d14ea
--- /dev/null
+++ b/benchmark/vm_struct_big_aset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_struct_big_aset: |
+    s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+    x = s.new
+    i = 0
+    while i<6_000_000
+      i += 1
+      x.k = i # x[10] = i
+    end
+loop_count: 1
diff --git a/benchmark/vm_struct_big_href_hi.yml b/benchmark/vm_struct_big_href_hi.yml
new file mode 100644
index 0000000000..09b764dd13
--- /dev/null
+++ b/benchmark/vm_struct_big_href_hi.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_href_hi: |
+    x[:z]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_href_lo.yml b/benchmark/vm_struct_big_href_lo.yml
new file mode 100644
index 0000000000..d2f00b220f
--- /dev/null
+++ b/benchmark/vm_struct_big_href_lo.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_href_lo: |
+    x[:k]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_hset.yml b/benchmark/vm_struct_big_hset.yml
new file mode 100644
index 0000000000..fc45cbee9c
--- /dev/null
+++ b/benchmark/vm_struct_big_hset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_struct_big_hset: |
+    s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+    x = s.new
+    i = 0
+    while i<6_000_000
+      i += 1
+      x[:k] = i
+    end
+loop_count: 1
diff --git a/benchmark/vm_struct_small_aref.yml b/benchmark/vm_struct_small_aref.yml
new file mode 100644
index 0000000000..5a83251d1e
--- /dev/null
+++ b/benchmark/vm_struct_small_aref.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(:a, :b, :c)
+  x = s.new
+benchmark:
+  vm_struct_small_aref: |
+    x.a
+loop_count: 6000000
diff --git a/benchmark/vm_struct_small_aset.yml b/benchmark/vm_struct_small_aset.yml
new file mode 100644
index 0000000000..74f435f126
--- /dev/null
+++ b/benchmark/vm_struct_small_aset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_struct_small_aset: |
+    s = Struct.new(:a, :b, :c)
+    x = s.new
+    i = 0
+    while i<6_000_000
+      i += 1
+      x.a = i
+    end
+loop_count: 1
diff --git a/benchmark/vm_struct_small_href.yml b/benchmark/vm_struct_small_href.yml
new file mode 100644
index 0000000000..6b7d7f39e7
--- /dev/null
+++ b/benchmark/vm_struct_small_href.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(:a, :b, :c)
+  x = s.new
+benchmark:
+  vm_struct_small_href: |
+    x[:a]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_small_hset.yml b/benchmark/vm_struct_small_hset.yml
new file mode 100644
index 0000000000..5d43b150de
--- /dev/null
+++ b/benchmark/vm_struct_small_hset.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(:a, :b, :c)
+  x = s.new
+benchmark:
+  vm_struct_small_hset: |
+    x[:a] = 1
+loop_count: 6000000
diff --git a/benchmark/vm_super.yml b/benchmark/vm_super.yml
new file mode 100644
index 0000000000..0d1e965c6e
--- /dev/null
+++ b/benchmark/vm_super.yml
@@ -0,0 +1,17 @@
+prelude: |
+  class C
+    def m
+      1
+    end
+  end
+
+  class CC < C
+    def m
+      super()
+    end
+  end
+
+  obj = CC.new
+benchmark:
+  vm_super: obj.m
+loop_count: 6000000
diff --git a/benchmark/vm_swap.yml b/benchmark/vm_swap.yml
new file mode 100644
index 0000000000..e824a65e0a
--- /dev/null
+++ b/benchmark/vm_swap.yml
@@ -0,0 +1,7 @@
+prelude: |
+  a = 1
+  b = 2
+benchmark:
+  vm_swap: |
+    a, b = b, a
+loop_count: 30000000
diff --git a/benchmark/vm_symbol_block_pass.rb b/benchmark/vm_symbol_block_pass.rb
new file mode 100644
index 0000000000..1d433353e1
--- /dev/null
+++ b/benchmark/vm_symbol_block_pass.rb
@@ -0,0 +1,13 @@
+class C
+  1000.times {|i|
+    eval("def i#{i};end")
+  }
+end
+
+c = C.new
+m = C.instance_methods(false)
+5_000.times do
+  m.each do |n|
+    c.tap(&n)
+  end
+end
diff --git a/benchmark/vm_thread_alive_check.yml b/benchmark/vm_thread_alive_check.yml
new file mode 100644
index 0000000000..d21737d3e8
--- /dev/null
+++ b/benchmark/vm_thread_alive_check.yml
@@ -0,0 +1,8 @@
+benchmark:
+  vm_thread_alive_check: |
+    t = Thread.new{}
+    while t.alive?
+      Thread.pass
+    end
+loop_count: 50_000
+
diff --git a/benchmark/bm_vm_thread_close.rb b/benchmark/vm_thread_close.rb
index 3e9a265ce8..3e9a265ce8 100644
--- a/benchmark/bm_vm_thread_close.rb
+++ b/benchmark/vm_thread_close.rb
diff --git a/benchmark/vm_thread_condvar1.rb b/benchmark/vm_thread_condvar1.rb
new file mode 100644
index 0000000000..feed27c3ad
--- /dev/null
+++ b/benchmark/vm_thread_condvar1.rb
@@ -0,0 +1,28 @@
+# two threads, two mutex, two condvar ping-pong
+require 'thread'
+m1 = Thread::Mutex.new
+m2 = Thread::Mutex.new
+cv1 = Thread::ConditionVariable.new
+cv2 = Thread::ConditionVariable.new
+max = 100000
+i = 0
+wait = nil
+m2.synchronize do
+  wait = Thread.new do
+    m1.synchronize do
+      m2.synchronize { cv2.signal }
+      while (i += 1) < max
+        cv1.wait(m1)
+        cv2.signal
+      end
+    end
+  end
+  cv2.wait(m2)
+end
+m1.synchronize do
+  while i < max
+    cv1.signal
+    cv2.wait(m1)
+  end
+end
+wait.join
diff --git a/benchmark/vm_thread_condvar2.rb b/benchmark/vm_thread_condvar2.rb
new file mode 100644
index 0000000000..6590c4134b
--- /dev/null
+++ b/benchmark/vm_thread_condvar2.rb
@@ -0,0 +1,35 @@
+# many threads, one mutex, many condvars
+require 'thread'
+m = Thread::Mutex.new
+cv1 = Thread::ConditionVariable.new
+cv2 = Thread::ConditionVariable.new
+max = 1000
+n = 100
+waiting = 0
+scvs = []
+waiters = n.times.map do |i|
+  start_cv = Thread::ConditionVariable.new
+  scvs << start_cv
+  start_mtx = Thread::Mutex.new
+  start_mtx.synchronize do
+    th = Thread.new(start_mtx, start_cv) do |sm, scv|
+      m.synchronize do
+        sm.synchronize { scv.signal }
+        max.times do
+          cv2.signal if (waiting += 1) == n
+          cv1.wait(m)
+        end
+      end
+    end
+    start_cv.wait(start_mtx)
+    th
+  end
+end
+m.synchronize do
+  max.times do
+    cv2.wait(m) until waiting == n
+    waiting = 0
+    cv1.broadcast
+  end
+end
+waiters.each(&:join)
diff --git a/benchmark/bm_vm_thread_create_join.rb b/benchmark/vm_thread_create_join.rb
index 393cd45df9..393cd45df9 100644
--- a/benchmark/bm_vm_thread_create_join.rb
+++ b/benchmark/vm_thread_create_join.rb
diff --git a/benchmark/vm_thread_mutex1.rb b/benchmark/vm_thread_mutex1.rb
new file mode 100644
index 0000000000..66e42c85e1
--- /dev/null
+++ b/benchmark/vm_thread_mutex1.rb
@@ -0,0 +1,21 @@
+# one thread, one mutex (no contention)
+
+require 'thread'
+m = Thread::Mutex.new
+r = 0
+max = 2000
+lmax = max * max
+(1..1).map{
+  Thread.new{
+    i = 0
+    while i<lmax
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/vm_thread_mutex2.rb b/benchmark/vm_thread_mutex2.rb
new file mode 100644
index 0000000000..6e6c804c31
--- /dev/null
+++ b/benchmark/vm_thread_mutex2.rb
@@ -0,0 +1,21 @@
+# two threads, one mutex
+
+require 'thread'
+m = Thread::Mutex.new
+r = 0
+max = 2000
+lmax = (max * max)/2
+(1..2).map{
+  Thread.new{
+    i = 0
+    while i<lmax
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/vm_thread_mutex3.rb b/benchmark/vm_thread_mutex3.rb
new file mode 100644
index 0000000000..c750dc542a
--- /dev/null
+++ b/benchmark/vm_thread_mutex3.rb
@@ -0,0 +1,20 @@
+# 1000 threads, one mutex
+
+require 'thread'
+m = Thread::Mutex.new
+r = 0
+max = 2000
+(1..max).map{
+  Thread.new{
+    i = 0
+    while i<max
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/vm_thread_pass.rb b/benchmark/vm_thread_pass.rb
new file mode 100644
index 0000000000..438bd08d45
--- /dev/null
+++ b/benchmark/vm_thread_pass.rb
@@ -0,0 +1,15 @@
+# Plenty Thread.pass
+# A performance may depend on GVL implementation.
+
+tmax = (ARGV.shift || 8).to_i
+lmax = 400_000 / tmax
+
+(1..tmax).map{
+  Thread.new{
+    lmax.times{
+      Thread.pass
+    }
+  }
+}.each{|t| t.join}
+
+
diff --git a/benchmark/vm_thread_pass_flood.rb b/benchmark/vm_thread_pass_flood.rb
new file mode 100644
index 0000000000..65df8e6154
--- /dev/null
+++ b/benchmark/vm_thread_pass_flood.rb
@@ -0,0 +1,10 @@
+# n.b. this is a good test for GVL when pinned to a single CPU
+
+5_000.times{
+  Thread.new{loop{Thread.pass}}
+}
+
+i = 0
+while i<10_000
+  i += 1
+end
diff --git a/benchmark/vm_thread_pipe.rb b/benchmark/vm_thread_pipe.rb
new file mode 100644
index 0000000000..112a621905
--- /dev/null
+++ b/benchmark/vm_thread_pipe.rb
@@ -0,0 +1,17 @@
+# Measure small and plenty pipe read/write.
+# A performance may depend on GVL implementation.
+
+lmax = 100_000
+r, w = IO.pipe
+[Thread.new{
+  lmax.times{
+    w.write('a')
+  }
+  p "w:exit"
+}, Thread.new{
+  lmax.times{
+    r.read(1)
+  }
+  p "r:exit"
+}].each{|t| t.join}
+
diff --git a/benchmark/vm_thread_queue.rb b/benchmark/vm_thread_queue.rb
new file mode 100644
index 0000000000..1dd3696a3c
--- /dev/null
+++ b/benchmark/vm_thread_queue.rb
@@ -0,0 +1,18 @@
+require 'thread'
+
+n = 10_000_000
+q = Thread::Queue.new
+consumer = Thread.new{
+  while q.pop
+    # consuming
+  end
+}
+
+producer = Thread.new{
+  n.times{
+    q.push true
+  }
+  q.push nil
+}
+
+consumer.join
diff --git a/benchmark/vm_thread_sized_queue.rb b/benchmark/vm_thread_sized_queue.rb
new file mode 100644
index 0000000000..7b9af5482b
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue.rb
@@ -0,0 +1,20 @@
+require 'thread'
+# on producer, one consumer
+
+n = 1_000_000
+q = Thread::SizedQueue.new(100)
+consumer = Thread.new{
+  while q.pop
+    # consuming
+  end
+}
+
+producer = Thread.new{
+  while n > 0
+    q.push true
+    n -= 1
+  end
+  q.push nil
+}
+
+consumer.join
diff --git a/benchmark/vm_thread_sized_queue2.rb b/benchmark/vm_thread_sized_queue2.rb
new file mode 100644
index 0000000000..de9f55e978
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue2.rb
@@ -0,0 +1,23 @@
+require 'thread'
+# one producer, many consumers
+n = 1_000_000
+m = 10
+q = Thread::SizedQueue.new(100)
+consumers = m.times.map do
+  Thread.new do
+    while q.pop
+      # consuming
+    end
+  end
+end
+
+producer = Thread.new do
+  while n > 0
+    q.push true
+    n -= 1
+  end
+  m.times { q.push nil }
+end
+
+producer.join
+consumers.each(&:join)
diff --git a/benchmark/vm_thread_sized_queue3.rb b/benchmark/vm_thread_sized_queue3.rb
new file mode 100644
index 0000000000..ce5f1796d8
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue3.rb
@@ -0,0 +1,22 @@
+require 'thread'
+# many producers, one consumer
+n = 1_000_000
+m = 10
+q = Thread::SizedQueue.new(100)
+consumer = Thread.new do
+  while q.pop
+    # consuming
+  end
+end
+
+producers = m.times.map do
+  Thread.new do
+    while n > 0
+      q.push true
+      n -= 1
+    end
+  end
+end
+producers.each(&:join)
+q.push nil
+consumer.join
diff --git a/benchmark/vm_thread_sized_queue4.rb b/benchmark/vm_thread_sized_queue4.rb
new file mode 100644
index 0000000000..a9b7d80ec0
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue4.rb
@@ -0,0 +1,26 @@
+require 'thread'
+# many producers, many consumers
+nr = 1_000_000
+n = 10
+m = 10
+q = Thread::SizedQueue.new(100)
+consumers = n.times.map do
+  Thread.new do
+    while q.pop
+      # consuming
+    end
+  end
+end
+
+producers = m.times.map do
+  Thread.new do
+    while nr > 0
+      q.push true
+      nr -= 1
+    end
+  end
+end
+
+producers.each(&:join)
+n.times { q.push nil }
+consumers.each(&:join)
diff --git a/benchmark/vm_thread_sleep.yml b/benchmark/vm_thread_sleep.yml
new file mode 100644
index 0000000000..96901d8466
--- /dev/null
+++ b/benchmark/vm_thread_sleep.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_thread_sleep: |
+    Thread.new { sleep }
+loop_count: 10_000
diff --git a/benchmark/vm_unif1.yml b/benchmark/vm_unif1.yml
new file mode 100644
index 0000000000..04187bb0e2
--- /dev/null
+++ b/benchmark/vm_unif1.yml
@@ -0,0 +1,7 @@
+prelude: |
+  def m a, b
+  end
+benchmark:
+  vm_unif1: |
+    m 100, 200
+loop_count: 6000000
diff --git a/benchmark/vm_yield.yml b/benchmark/vm_yield.yml
new file mode 100644
index 0000000000..230be3d84f
--- /dev/null
+++ b/benchmark/vm_yield.yml
@@ -0,0 +1,13 @@
+# while loop cost is not removed due to benchmark_driver.gem's limitation
+benchmark:
+  vm_yield: |
+    def m
+      i = 0
+      while i<30_000_000
+        i += 1
+        yield
+      end
+    end
+
+    m{}
+loop_count: 1
diff --git a/benchmark/vm_zsuper.yml b/benchmark/vm_zsuper.yml
new file mode 100644
index 0000000000..bfb5837578
--- /dev/null
+++ b/benchmark/vm_zsuper.yml
@@ -0,0 +1,18 @@
+prelude: |
+  class C
+    def m a
+      1
+    end
+  end
+
+  class CC < C
+    def m a
+      super
+    end
+  end
+
+  obj = CC.new
+benchmark:
+  vm_zsuper: |
+    obj.m 10
+loop_count: 6000000
diff --git a/benchmark/wc.input.base b/benchmark/wc.input.base
deleted file mode 100644
index 41143fbac0..0000000000
--- a/benchmark/wc.input.base
+++ /dev/null
@@ -1,25 +0,0 @@
-Subject:      Re: Who was Izchak Miller?
-From:         "Jane D. Anonymous" <nobody@yale.edu>
-Date:         1996/04/28
-Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
-References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
-To:           75176.2330@compuserve.com
-Content-Type: text/plain; charset=us-ascii
-Organization: Yale University
-X-Url:        news:4lk6vl$gde@ns.oar.net
-Mime-Version: 1.0
-Newsgroups:   rec.games.roguelike.nethack
-X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
-
-Hello there, Izchak Miller was my father.  When I was younger I spent 
-many a night, hunched over the keyboard with a cup of tea, playing 
-nethack with him and my brother.  my dad was a philosopher with a strong 
-weakness for fantasy/sci fi.  I remember when he started to get involved 
-with the Nethack team- my brother's Dungeons and Dragons monster book 
-found a regular place beside my dad's desk. it's nice to see him living 
-on in the game he loved so much :-).  
-                                                                  Tamar Miller
-
-The following is a really long word of 5000 characters:
-
-wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
diff --git a/bignum.c b/bignum.c
index a6d68d875b..cb2c3b6f07 100644
--- a/bignum.c
+++ b/bignum.c
@@ -9,29 +9,45 @@
 
 **********************************************************************/
 
-#include "internal.h"
-#include "ruby/thread.h"
-#include "ruby/util.h"
+#include "ruby/internal/config.h"
+
+#include <ctype.h>
+#include <float.h>
+#include <math.h>
 
 #ifdef HAVE_STRINGS_H
-#include <strings.h>
+# include <strings.h>
 #endif
-#include <math.h>
-#include <float.h>
-#include <ctype.h>
+
 #ifdef HAVE_IEEEFP_H
-#include <ieeefp.h>
+# include <ieeefp.h>
 #endif
-#include <assert.h>
 
+#if !defined(USE_GMP)
 #if defined(HAVE_LIBGMP) && defined(HAVE_GMP_H)
-#define USE_GMP
-#include <gmp.h>
+# define USE_GMP 1
+#else
+# define USE_GMP 0
+#endif
+#endif
+#if USE_GMP
+# include <gmp.h>
 #endif
 
-#define RB_BIGNUM_TYPE_P(x) RB_TYPE_P((x), T_BIGNUM)
+#include "id.h"
+#include "internal.h"
+#include "internal/bignum.h"
+#include "internal/complex.h"
+#include "internal/gc.h"
+#include "internal/numeric.h"
+#include "internal/object.h"
+#include "internal/sanitizers.h"
+#include "internal/variable.h"
+#include "internal/warnings.h"
+#include "ruby/thread.h"
+#include "ruby/util.h"
+#include "ruby_assert.h"
 
-VALUE rb_cBignum;
 const char ruby_digitmap[] = "0123456789abcdefghijklmnopqrstuvwxyz";
 
 #ifndef SIZEOF_BDIGIT_DBL
@@ -62,8 +78,7 @@ STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
 #else
 #   define HOST_BIGENDIAN_P 0
 #endif
-#define ALIGNOF(type) ((int)offsetof(struct { char f1; type f2; }, f2))
-/* (!LSHIFTABLE(d, n) ? 0 : (n)) is same as n but suppress a warning, C4293, by Visual Studio.  */
+/* (!LSHIFTABLE(d, n) ? 0 : (n)) is the same as n but suppress a warning, C4293, by Visual Studio.  */
 #define LSHIFTABLE(d, n) ((n) < sizeof(d) * CHAR_BIT)
 #define LSHIFTX(d, n) (!LSHIFTABLE(d, n) ? 0 : ((d) << (!LSHIFTABLE(d, n) ? 0 : (n))))
 #define CLEAR_LOWBITS(d, numbits) ((d) & LSHIFTX(~((d)*0), (numbits)))
@@ -90,8 +105,8 @@ STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
 #endif
 
 #define BIGZEROP(x) (BIGNUM_LEN(x) == 0 || \
-		     (BDIGITS(x)[0] == 0 && \
-		      (BIGNUM_LEN(x) == 1 || bigzero_p(x))))
+                     (BDIGITS(x)[0] == 0 && \
+                      (BIGNUM_LEN(x) == 1 || bigzero_p(x))))
 #define BIGSIZE(x) (BIGNUM_LEN(x) == 0 ? (size_t)0 : \
     BDIGITS(x)[BIGNUM_LEN(x)-1] ? \
         (size_t)(BIGNUM_LEN(x)*SIZEOF_BDIGIT - nlz(BDIGITS(x)[BIGNUM_LEN(x)-1])/CHAR_BIT) : \
@@ -110,7 +125,7 @@ STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
 #define BIGNUM_SET_NEGATIVE_SIGN(b) BIGNUM_SET_SIGN(b, 0)
 #define BIGNUM_SET_POSITIVE_SIGN(b) BIGNUM_SET_SIGN(b, 1)
 
-#define bignew(len,sign) bignew_1(rb_cBignum,(len),(sign))
+#define bignew(len,sign) bignew_1(rb_cInteger,(len),(sign))
 
 #define BDIGITS_ZERO(ptr, n) do { \
   BDIGIT *bdigitz_zero_ptr = (ptr); \
@@ -136,21 +151,22 @@ STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
 #define GMP_DIV_DIGITS 20
 #define GMP_BIG2STR_DIGITS 20
 #define GMP_STR2BIG_DIGITS 20
+#if USE_GMP
+# define NAIVE_MUL_DIGITS GMP_MUL_DIGITS
+#else
+# define NAIVE_MUL_DIGITS KARATSUBA_MUL_DIGITS
+#endif
 
 typedef void (mulfunc_t)(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn);
 
 static mulfunc_t bary_mul_toom3_start;
 static mulfunc_t bary_mul_karatsuba_start;
 static BDIGIT bigdivrem_single(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT y);
-static void bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn);
 
-static VALUE bigmul0(VALUE x, VALUE y);
-static void bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn);
 static VALUE bignew_1(VALUE klass, size_t len, int sign);
 static inline VALUE bigtrunc(VALUE x);
 
 static VALUE bigsq(VALUE x);
-static void bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp);
 static inline VALUE power_cache_get_power(int base, int power_level, size_t *numdigits_ret);
 
 #if SIZEOF_BDIGIT <= SIZEOF_INT
@@ -378,6 +394,7 @@ bdigitdbl2bary(BDIGIT *ds, size_t n, BDIGIT_DBL num)
 static int
 bary_cmp(const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
+    size_t i;
     BARY_TRUNC(xds, xn);
     BARY_TRUNC(yds, yn);
 
@@ -386,11 +403,12 @@ bary_cmp(const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
     if (xn > yn)
         return 1;
 
-    while (xn-- && xds[xn] == yds[xn])
-        ;
-    if (xn == (size_t)-1)
+    for (i = 0; i < xn; i++)
+        if (xds[xn - i - 1] != yds[yn - i - 1])
+            break;
+    if (i == xn)
         return 0;
-    return xds[xn] < yds[xn] ? -1 : 1;
+    return xds[xn - i - 1] < yds[yn - i - 1] ? -1 : 1;
 }
 
 static BDIGIT
@@ -401,9 +419,9 @@ bary_small_lshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift)
     assert(0 <= shift && shift < BITSPERDIG);
 
     for (i=0; i<n; i++) {
-	num = num | (BDIGIT_DBL)*xds++ << shift;
-	*zds++ = BIGLO(num);
-	num = BIGDN(num);
+        num = num | (BDIGIT_DBL)*xds++ << shift;
+        *zds++ = BIGLO(num);
+        num = BIGDN(num);
     }
     return BIGLO(num);
 }
@@ -411,27 +429,27 @@ bary_small_lshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift)
 static void
 bary_small_rshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift, BDIGIT higher_bdigit)
 {
+    size_t i;
     BDIGIT_DBL num = 0;
-    BDIGIT x;
 
     assert(0 <= shift && shift < BITSPERDIG);
 
     num = BIGUP(higher_bdigit);
-    while (n--) {
-	num = (num | xds[n]) >> shift;
-        x = xds[n];
-	zds[n] = BIGLO(num);
-	num = BIGUP(x);
+    for (i = 0; i < n; i++) {
+        BDIGIT x = xds[n - i - 1];
+        num = (num | x) >> shift;
+        zds[n - i - 1] = BIGLO(num);
+        num = BIGUP(x);
     }
 }
 
 static int
-bary_zero_p(BDIGIT *xds, size_t xn)
+bary_zero_p(const BDIGIT *xds, size_t xn)
 {
     if (xn == 0)
         return 1;
     do {
-	if (xds[--xn]) return 0;
+        if (xds[--xn]) return 0;
     } while (xn);
     return 1;
 }
@@ -439,15 +457,15 @@ bary_zero_p(BDIGIT *xds, size_t xn)
 static void
 bary_neg(BDIGIT *ds, size_t n)
 {
-    while (n--)
-        ds[n] = BIGLO(~ds[n]);
+    size_t i;
+    for (i = 0; i < n; i++)
+        ds[n - i - 1] = BIGLO(~ds[n - i - 1]);
 }
 
 static int
 bary_2comp(BDIGIT *ds, size_t n)
 {
     size_t i;
-    i = 0;
     for (i = 0; i < n; i++) {
         if (ds[i] != 0) {
             goto non_zero;
@@ -610,8 +628,12 @@ static int
 bytes_2comp(unsigned char *buf, size_t len)
 {
     size_t i;
-    for (i = 0; i < len; i++)
-        buf[i] = ~buf[i];
+    for (i = 0; i < len; i++) {
+        signed char c = buf[i];
+        signed int d = ~c;
+        unsigned int e = d & 0xFF;
+        buf[i] = e;
+    }
     for (i = 0; i < len; i++) {
         buf[i]++;
         if (buf[i] != 0)
@@ -661,7 +683,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                     return ((1 < de - dp || CLEAR_LOWBITS(d, 8) != 0) ? 2 : 1) * sign;
                 }
 #if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
-                if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
+                if (wordsize == 2 && (uintptr_t)words % RUBY_ALIGNOF(uint16_t) == 0) {
                     uint16_t u = (uint16_t)(d = dp[0]);
                     if (need_swap) u = swap16(u);
                     *((uint16_t *)words) = u;
@@ -669,7 +691,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                 }
 #endif
 #if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
-                if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
+                if (wordsize == 4 && (uintptr_t)words % RUBY_ALIGNOF(uint32_t) == 0) {
                     uint32_t u = (uint32_t)(d = dp[0]);
                     if (need_swap) u = swap32(u);
                     *((uint32_t *)words) = u;
@@ -677,7 +699,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                 }
 #endif
 #if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
-                if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
+                if (wordsize == 8 && (uintptr_t)words % RUBY_ALIGNOF(uint64_t) == 0) {
                     uint64_t u = (uint64_t)(d = dp[0]);
                     if (need_swap) u = swap64(u);
                     *((uint64_t *)words) = u;
@@ -692,7 +714,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                     return (1 < de - dp || FILL_LOWBITS(d, 8) != -1) ? -2 : -1;
                 }
 #if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
-                if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
+                if (wordsize == 2 && (uintptr_t)words % RUBY_ALIGNOF(uint16_t) == 0) {
                     uint16_t u = (uint16_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
                     if (need_swap) u = swap16(u);
                     *((uint16_t *)words) = u;
@@ -701,7 +723,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                 }
 #endif
 #if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
-                if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
+                if (wordsize == 4 && (uintptr_t)words % RUBY_ALIGNOF(uint32_t) == 0) {
                     uint32_t u = (uint32_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
                     if (need_swap) u = swap32(u);
                     *((uint32_t *)words) = u;
@@ -710,7 +732,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                 }
 #endif
 #if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
-                if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
+                if (wordsize == 8 && (uintptr_t)words % RUBY_ALIGNOF(uint64_t) == 0) {
                     uint64_t u = (uint64_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
                     if (need_swap) u = swap64(u);
                     *((uint64_t *)words) = u;
@@ -753,7 +775,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
         }
 #endif
         if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
-            wordsize % SIZEOF_BDIGIT == 0 && (uintptr_t)words % ALIGNOF(BDIGIT) == 0) {
+            wordsize % SIZEOF_BDIGIT == 0 && (uintptr_t)words % RUBY_ALIGNOF(BDIGIT) == 0) {
             size_t bdigits_per_word = wordsize / SIZEOF_BDIGIT;
             size_t src_num_bdigits = de - dp;
             size_t dst_num_bdigits = numwords * bdigits_per_word;
@@ -896,8 +918,6 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
     }
 
     if ((flags & INTEGER_PACK_2COMP) && (sign < 0 && numwords != 0)) {
-        unsigned char *buf;
-
         int word_num_partialbits;
         size_t word_num_fullbytes;
 
@@ -957,7 +977,7 @@ integer_unpack_num_bdigits_small(size_t numwords, size_t wordsize, size_t nails,
 {
     /* nlp_bits stands for number of leading padding bits */
     size_t num_bits = (wordsize * CHAR_BIT - nails) * numwords;
-    size_t num_bdigits = (num_bits + BITSPERDIG - 1) / BITSPERDIG;
+    size_t num_bdigits = roomof(num_bits, BITSPERDIG);
     *nlp_bits_ret = (int)(num_bdigits * BITSPERDIG - num_bits);
     return num_bdigits;
 }
@@ -967,7 +987,7 @@ integer_unpack_num_bdigits_generic(size_t numwords, size_t wordsize, size_t nail
 {
     /* BITSPERDIG = SIZEOF_BDIGIT * CHAR_BIT */
     /* num_bits = (wordsize * CHAR_BIT - nails) * numwords */
-    /* num_bdigits = (num_bits + BITSPERDIG - 1) / BITSPERDIG */
+    /* num_bdigits = roomof(num_bits, BITSPERDIG) */
 
     /* num_bits = CHAR_BIT * (wordsize * numwords) - nails * numwords = CHAR_BIT * num_bytes1 - nails * numwords */
     size_t num_bytes1 = wordsize * numwords;
@@ -1035,6 +1055,7 @@ integer_unpack_num_bdigits(size_t numwords, size_t wordsize, size_t nails, int *
             size_t num_bdigits1 = integer_unpack_num_bdigits_generic(numwords, wordsize, nails, &nlp_bits1);
             assert(num_bdigits == num_bdigits1);
             assert(*nlp_bits_ret == nlp_bits1);
+            (void)num_bdigits1;
         }
 #endif
     }
@@ -1075,6 +1096,13 @@ integer_unpack_single_bdigit(BDIGIT u, size_t size, int flags, BDIGIT *dp)
     return sign;
 }
 
+#ifdef HAVE_BUILTIN___BUILTIN_ASSUME_ALIGNED
+#define reinterpret_cast(type, value) (type) \
+    __builtin_assume_aligned((value), sizeof(*(type)NULL));
+#else
+#define reinterpret_cast(type, value) (type)value
+#endif
+
 static int
 bary_unpack_internal(BDIGIT *bdigits, size_t num_bdigits, const void *words, size_t numwords, size_t wordsize, size_t nails, int flags, int nlp_bits)
 {
@@ -1095,23 +1123,24 @@ bary_unpack_internal(BDIGIT *bdigits, size_t num_bdigits, const void *words, siz
                 return integer_unpack_single_bdigit(*(uint8_t *)buf, sizeof(uint8_t), flags, dp);
             }
 #if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
-            if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
-                uint16_t u = *(uint16_t *)buf;
+            if (wordsize == 2 && (uintptr_t)words % RUBY_ALIGNOF(uint16_t) == 0) {
+                uint16_t u = *reinterpret_cast(const uint16_t *, buf);
                 return integer_unpack_single_bdigit(need_swap ? swap16(u) : u, sizeof(uint16_t), flags, dp);
             }
 #endif
 #if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
-            if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
-                uint32_t u = *(uint32_t *)buf;
+            if (wordsize == 4 && (uintptr_t)words % RUBY_ALIGNOF(uint32_t) == 0) {
+                uint32_t u = *reinterpret_cast(const uint32_t *, buf);
                 return integer_unpack_single_bdigit(need_swap ? swap32(u) : u, sizeof(uint32_t), flags, dp);
             }
 #endif
 #if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
-            if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
-                uint64_t u = *(uint64_t *)buf;
+            if (wordsize == 8 && (uintptr_t)words % RUBY_ALIGNOF(uint64_t) == 0) {
+                uint64_t u = *reinterpret_cast(const uint64_t *, buf);
                 return integer_unpack_single_bdigit(need_swap ? swap64(u) : u, sizeof(uint64_t), flags, dp);
             }
 #endif
+#undef reinterpret_cast
         }
 #if !defined(WORDS_BIGENDIAN)
         if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
@@ -1321,9 +1350,9 @@ bary_subb(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
 
     num = borrow ? -1 : 0;
     for (i = 0; i < sn; i++) {
-	num += (BDIGIT_DBL_SIGNED)xds[i] - yds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        num += (BDIGIT_DBL_SIGNED)xds[i] - yds[i];
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     if (yn <= xn) {
         for (; i < xn; i++) {
@@ -1342,7 +1371,7 @@ bary_subb(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     }
     if (num == 0) goto num_is_zero;
     for (; i < zn; i++) {
-	zds[i] = BDIGMAX;
+        zds[i] = BDIGMAX;
     }
     return 1;
 
@@ -1350,10 +1379,10 @@ bary_subb(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     if (xds == zds && xn == zn)
         return 0;
     for (; i < xn; i++) {
-	zds[i] = xds[i];
+        zds[i] = xds[i];
     }
     for (; i < zn; i++) {
-	zds[i] = 0;
+        zds[i] = 0;
     }
     return 0;
 }
@@ -1380,27 +1409,27 @@ bary_addc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     assert(yn <= zn);
 
     if (xn > yn) {
-	const BDIGIT *tds;
-	tds = xds; xds = yds; yds = tds;
-	i = xn; xn = yn; yn = i;
+        const BDIGIT *tds;
+        tds = xds; xds = yds; yds = tds;
+        i = xn; xn = yn; yn = i;
     }
 
     num = carry ? 1 : 0;
     for (i = 0; i < xn; i++) {
-	num += (BDIGIT_DBL)xds[i] + yds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        num += (BDIGIT_DBL)xds[i] + yds[i];
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     for (; i < yn; i++) {
         if (num == 0) goto num_is_zero;
-	num += yds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        num += yds[i];
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     for (; i < zn; i++) {
         if (num == 0) goto num_is_zero;
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     return num != 0;
 
@@ -1408,10 +1437,10 @@ bary_addc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     if (yds == zds && yn == zn)
         return 0;
     for (; i < yn; i++) {
-	zds[i] = yds[i];
+        zds[i] = yds[i];
     }
     for (; i < zn; i++) {
-	zds[i] = 0;
+        zds[i] = 0;
     }
     return 0;
 }
@@ -1427,7 +1456,9 @@ bary_add_one(BDIGIT *ds, size_t n)
 {
     size_t i;
     for (i = 0; i < n; i++) {
-	ds[i] = BIGLO(ds[i]+1);
+        BDIGIT_DBL n = ds[i];
+        n += 1;
+        ds[i] = BIGLO(n);
         if (ds[i] != 0)
             return 0;
     }
@@ -1495,15 +1526,16 @@ bigdivrem_mulsub(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
     i = 0;
 
     do {
-        BDIGIT_DBL ee;
+        BDIGIT_DBL_SIGNED ee;
         t2 += (BDIGIT_DBL)yds[i] * x;
         ee = num - BIGLO(t2);
-        num = (BDIGIT_DBL)zds[i] + ee;
+        num = (BDIGIT_DBL_SIGNED)zds[i] + ee;
         if (ee) zds[i] = BIGLO(num);
         num = BIGDN(num);
         t2 = BIGDN(t2);
     } while (++i < yn);
-    num += zds[i] - t2; /* borrow from high digit; don't update */
+    num -= (BDIGIT_DBL_SIGNED)t2;
+    num += (BDIGIT_DBL_SIGNED)zds[yn]; /* borrow from high digit; don't update */
     return num;
 }
 
@@ -1547,7 +1579,7 @@ rb_big_mul_normal(VALUE x, VALUE y)
 
 /* efficient squaring (2 times faster than normal multiplication)
  * ref: Handbook of Applied Cryptography, Algorithm 14.16
- *      http://www.cacr.math.uwaterloo.ca/hac/about/chap14.pdf
+ *      https://www.cacr.math.uwaterloo.ca/hac/about/chap14.pdf
  */
 static void
 bary_sq_fast(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn)
@@ -1565,30 +1597,30 @@ bary_sq_fast(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn)
         return;
 
     for (i = 0; i < xn-1; i++) {
-	v = (BDIGIT_DBL)xds[i];
-	if (!v)
+        v = (BDIGIT_DBL)xds[i];
+        if (!v)
             continue;
-	c = (BDIGIT_DBL)zds[i + i] + v * v;
-	zds[i + i] = BIGLO(c);
-	c = BIGDN(c);
-	v *= 2;
+        c = (BDIGIT_DBL)zds[i + i] + v * v;
+        zds[i + i] = BIGLO(c);
+        c = BIGDN(c);
+        v *= 2;
         vl = BIGLO(v);
         vh = (int)BIGDN(v);
-	for (j = i + 1; j < xn; j++) {
-	    w = (BDIGIT_DBL)xds[j];
-	    c += (BDIGIT_DBL)zds[i + j] + vl * w;
-	    zds[i + j] = BIGLO(c);
-	    c = BIGDN(c);
-	    if (vh)
+        for (j = i + 1; j < xn; j++) {
+            w = (BDIGIT_DBL)xds[j];
+            c += (BDIGIT_DBL)zds[i + j] + vl * w;
+            zds[i + j] = BIGLO(c);
+            c = BIGDN(c);
+            if (vh)
                 c += w;
-	}
-	if (c) {
-	    c += (BDIGIT_DBL)zds[i + xn];
-	    zds[i + xn] = BIGLO(c);
-	    c = BIGDN(c);
+        }
+        if (c) {
+            c += (BDIGIT_DBL)zds[i + xn];
+            zds[i + xn] = BIGLO(c);
+            c = BIGDN(c);
             if (c)
                 zds[i + xn + 1] += (BDIGIT)c;
-	}
+        }
     }
 
     /* i == xn-1 */
@@ -1613,13 +1645,21 @@ rb_big_sq_fast(VALUE x)
     return z;
 }
 
+static inline size_t
+max_size(size_t a, size_t b)
+{
+    return (a > b ? a : b);
+}
+
 /* balancing multiplication by slicing larger argument */
 static void
-bary_mul_balance_with_mulfunc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn, mulfunc_t *mulfunc)
+bary_mul_balance_with_mulfunc(BDIGIT *const zds, const size_t zn,
+                              const BDIGIT *const xds, const size_t xn,
+                              const BDIGIT *const yds, const size_t yn,
+                              BDIGIT *wds, size_t wn, mulfunc_t *const mulfunc)
 {
     VALUE work = 0;
-    size_t yn0 = yn;
-    size_t r, n;
+    size_t n;
 
     assert(xn + yn <= zn);
     assert(xn <= yn);
@@ -1627,14 +1667,26 @@ bary_mul_balance_with_mulfunc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t
 
     BDIGITS_ZERO(zds, xn);
 
+    if (wn < xn) {
+        /* The condition when a new buffer is needed:
+         * 1. (2(xn+r) > zn-(yn-r)) => (2xn+r > zn-yn), at the last
+         *    iteration (or r == 0)
+         * 2. (2(xn+xn) > zn-(yn-r-xn)) => (3xn-r > zn-yn), at the
+         *    previous iteration.
+         */
+        const size_t r = yn % xn;
+        if (2*xn + yn + max_size(xn-r, r) > zn) {
+            wn = xn;
+            wds = ALLOCV_N(BDIGIT, work, wn);
+        }
+    }
+
     n = 0;
-    while (yn > 0) {
-        BDIGIT *tds;
-        size_t tn;
-	r = xn > yn ? yn : xn;
-        tn = xn + r;
+    while (yn > n) {
+        const size_t r = (xn > (yn - n) ? (yn - n) : xn);
+        const size_t tn = (xn + r);
         if (2 * (xn + r) <= zn - n) {
-            tds = zds + n + xn + r;
+            BDIGIT *const tds = zds + n + xn + r;
             mulfunc(tds, tn, xds, xn, yds + n, r, wds, wn);
             BDIGITS_ZERO(zds + n + xn, r);
             bary_add(zds + n, tn,
@@ -1642,21 +1694,25 @@ bary_mul_balance_with_mulfunc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t
                      tds, tn);
         }
         else {
+            BDIGIT *const tds = zds + n;
             if (wn < xn) {
+                /* xn is invariant, only once here */
+#if 0
                 wn = xn;
                 wds = ALLOCV_N(BDIGIT, work, wn);
+#else
+                rb_bug("wds is not enough: %" PRIdSIZE " for %" PRIdSIZE, wn, xn);
+#endif
             }
-            tds = zds + n;
             MEMCPY(wds, zds + n, BDIGIT, xn);
             mulfunc(tds, tn, xds, xn, yds + n, r, wds+xn, wn-xn);
             bary_add(zds + n, tn,
                      zds + n, tn,
                      wds, xn);
         }
-	yn -= r;
-	n += r;
+        n += r;
     }
-    BDIGITS_ZERO(zds+xn+yn0, zn - (xn+yn0));
+    BDIGITS_ZERO(zds+xn+yn, zn - (xn+yn));
 
     if (work)
         ALLOCV_END(work);
@@ -1973,7 +2029,7 @@ bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGI
     }
 
     /*
-     * ref. http://en.wikipedia.org/wiki/Toom%E2%80%93Cook_multiplication
+     * ref. https://en.wikipedia.org/wiki/Toom%E2%80%93Cook_multiplication
      *
      * x(b) = x0 * b^0 + x1 * b^1 + x2 * b^2
      * y(b) = y0 * b^0 + y1 * b^1 + y2 * b^2
@@ -2046,21 +2102,21 @@ bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGI
         v3n = u3n; v3ds = u3ds; v3p = u3p;
     }
     else {
-	/* v1 <- y0 + y2 */
+        /* v1 <- y0 + y2 */
         bary_add(v1ds, v1n, y0ds, y0n, y2ds, y2n);
         v1p = 1;
 
-	/* y(-1) : v2 <- v1 - y1 = y0 - y1 + y2 */
+        /* y(-1) : v2 <- v1 - y1 = y0 - y1 + y2 */
         v2p = 1;
         if (bary_sub(v2ds, v2n, v1ds, v1n, y1ds, y1n)) {
             bary_2comp(v2ds, v2n);
             v2p = 0;
         }
 
-	/* y(1) : v1 <- v1 + y1 = y0 + y1 + y2 */
+        /* y(1) : v1 <- v1 + y1 = y0 + y1 + y2 */
         bary_add(v1ds, v1n, v1ds, v1n, y1ds, y1n);
 
-	/* y(-2) : v3 <- 2 * (v2 + y2) - y0 = y0 - 2 * (y1 - 2 * y2) */
+        /* y(-2) : v3 <- 2 * (v2 + y2) - y0 = y0 - 2 * (y1 - 2 * y2) */
         v3p = 1;
         if (v2p) {
             bary_add(v3ds, v3n, v2ds, v2n, y2ds, y2n);
@@ -2253,11 +2309,24 @@ rb_big_mul_toom3(VALUE x, VALUE y)
     return z;
 }
 
-#ifdef USE_GMP
+#if USE_GMP
+static inline void
+bdigits_to_mpz(mpz_t mp, const BDIGIT *digits, size_t len)
+{
+    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+    mpz_import(mp, len, -1, sizeof(BDIGIT), 0, nails, digits);
+}
+
+static inline void
+bdigits_from_mpz(mpz_t mp, BDIGIT *digits, size_t *len)
+{
+    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+    mpz_export(digits, len, -1, sizeof(BDIGIT), 0, nails, mp);
+}
+
 static void
 bary_mul_gmp(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
     mpz_t x, y, z;
     size_t count;
 
@@ -2266,15 +2335,15 @@ bary_mul_gmp(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT
     mpz_init(x);
     mpz_init(y);
     mpz_init(z);
-    mpz_import(x, xn, -1, sizeof(BDIGIT), 0, nails, xds);
+    bdigits_to_mpz(x, xds, xn);
     if (xds == yds && xn == yn) {
         mpz_mul(z, x, x);
     }
     else {
-        mpz_import(y, yn, -1, sizeof(BDIGIT), 0, nails, yds);
+        bdigits_to_mpz(y, yds, yn);
         mpz_mul(z, x, y);
     }
-    mpz_export(zds, &count, -1, sizeof(BDIGIT), 0, nails, z);
+    bdigits_from_mpz(z, zds, &count);
     BDIGITS_ZERO(zds+count, zn-count);
     mpz_clear(x);
     mpz_clear(y);
@@ -2313,9 +2382,9 @@ bary_sparse_p(const BDIGIT *ds, size_t n)
 {
     long c = 0;
 
-    if (          ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
-    if (c <= 1 && ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
-    if (c <= 1 && ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
+    if (          ds[2 * n / 5]) c++;
+    if (c <= 1 && ds[    n / 2]) c++;
+    if (c <= 1 && ds[3 * n / 5]) c++;
 
     return (c <= 1) ? 1 : 0;
 }
@@ -2378,8 +2447,8 @@ bary_mul_precheck(BDIGIT **zdsp, size_t *znp, const BDIGIT **xdsp, size_t *xnp,
     if (xn > yn) {
         const BDIGIT *tds;
         size_t tn;
-	tds = xds; xds = yds; yds = tds;
-	tn = xn; xn = yn; yn = tn;
+        tds = xds; xds = yds; yds = tds;
+        tn = xn; xn = yn; yn = tn;
     }
     assert(xn <= yn);
 
@@ -2423,12 +2492,7 @@ bary_mul_karatsuba_branch(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn,
 {
     /* normal multiplication when x is small */
     if (xn < KARATSUBA_MUL_DIGITS) {
-      normal:
-        if (xds == yds && xn == yn)
-            bary_sq_fast(zds, zn, xds, xn);
-        else
-            bary_short_mul(zds, zn, xds, xn, yds, yn);
-        return;
+        goto normal;
     }
 
     /* normal multiplication when x or y is a sparse bignum */
@@ -2446,6 +2510,15 @@ bary_mul_karatsuba_branch(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn,
 
     /* multiplication by karatsuba method */
     bary_mul_karatsuba(zds, zn, xds, xn, yds, yn, wds, wn);
+    return;
+
+  normal:
+    if (xds == yds && xn == yn) {
+        bary_sq_fast(zds, zn, xds, xn);
+    }
+    else {
+        bary_short_mul(zds, zn, xds, xn, yds, yn);
+    }
 }
 
 static void
@@ -2485,13 +2558,8 @@ bary_mul_toom3_start(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const
 static void
 bary_mul(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-#ifdef USE_GMP
-    const size_t naive_threshold = GMP_MUL_DIGITS;
-#else
-    const size_t naive_threshold = KARATSUBA_MUL_DIGITS;
-#endif
     if (xn <= yn) {
-        if (xn < naive_threshold) {
+        if (xn < NAIVE_MUL_DIGITS) {
             if (xds == yds && xn == yn)
                 bary_sq_fast(zds, zn, xds, xn);
             else
@@ -2500,13 +2568,13 @@ bary_mul(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds
         }
     }
     else {
-        if (yn < naive_threshold) {
+        if (yn < NAIVE_MUL_DIGITS) {
             bary_short_mul(zds, zn, yds, yn, xds, xn);
             return;
         }
     }
 
-#ifdef USE_GMP
+#if USE_GMP
     bary_mul_gmp(zds, zn, xds, xn, yds, yn);
 #else
     bary_mul_toom3_start(zds, zn, xds, xn, yds, yn, NULL, 0);
@@ -2530,30 +2598,31 @@ bigdivrem1(void *ptr)
     BDIGIT q;
 
     do {
-	if (bds->stop) {
-	    bds->zn = zn;
-	    return 0;
+        if (bds->stop) {
+            bds->zn = zn;
+            return 0;
         }
-	if (zds[zn-1] == yds[yn-1]) q = BDIGMAX;
-	else q = (BDIGIT)((BIGUP(zds[zn-1]) + zds[zn-2])/yds[yn-1]);
-	if (q) {
+        if (zds[zn-1] == yds[yn-1]) q = BDIGMAX;
+        else q = (BDIGIT)((BIGUP(zds[zn-1]) + zds[zn-2])/yds[yn-1]);
+        if (q) {
             num = bigdivrem_mulsub(zds+zn-(yn+1), yn+1,
                                    q,
                                    yds, yn);
-	    while (num) { /* "add back" required */
-		q--;
+            while (num) { /* "add back" required */
+                q--;
                 num = bary_add(zds+zn-(yn+1), yn,
                                zds+zn-(yn+1), yn,
                                yds, yn);
                 num--;
-	    }
-	}
+            }
+        }
         zn--;
-	zds[zn] = q;
+        zds[zn] = q;
     } while (zn > yn);
     return 0;
 }
 
+/* async-signal-safe */
 static void
 rb_big_stop(void *ptr)
 {
@@ -2576,10 +2645,9 @@ bigdivrem_single1(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT x_higher_bdi
         size_t i;
         BDIGIT_DBL t2;
         t2 = x_higher_bdigit;
-        i = xn;
-        while (i--) {
-            t2 = BIGUP(t2) + xds[i];
-            qds[i] = (BDIGIT)(t2 / y);
+        for (i = 0; i < xn; i++) {
+            t2 = BIGUP(t2) + xds[xn - i - 1];
+            qds[xn - i - 1] = (BDIGIT)(t2 / y);
             t2 %= y;
         }
         return (BDIGIT)t2;
@@ -2618,16 +2686,16 @@ bigdivrem_restoring(BDIGIT *zds, size_t zn, BDIGIT *yds, size_t yn)
     bds.zn = zn - ynzero;
     if (bds.zn > 10000 || bds.yn > 10000) {
       retry:
-	bds.stop = Qfalse;
-	rb_thread_call_without_gvl(bigdivrem1, &bds, rb_big_stop, &bds);
+        bds.stop = Qfalse;
+        rb_nogvl(bigdivrem1, &bds, rb_big_stop, &bds, RB_NOGVL_UBF_ASYNC_SAFE);
 
-	if (bds.stop == Qtrue) {
-	    /* execute trap handler, but exception was not raised. */
-	    goto retry;
-	}
+        if (bds.stop == Qtrue) {
+            /* execute trap handler, but exception was not raised. */
+            goto retry;
+        }
     }
     else {
-	bigdivrem1(&bds);
+        bigdivrem1(&bds);
     }
 }
 
@@ -2726,11 +2794,10 @@ rb_big_divrem_normal(VALUE x, VALUE y)
     return rb_assoc_new(q, r);
 }
 
-#ifdef USE_GMP
+#if USE_GMP
 static void
 bary_divmod_gmp(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
     mpz_t x, y, q, r;
     size_t count;
 
@@ -2744,8 +2811,8 @@ bary_divmod_gmp(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xd
     if (qds) mpz_init(q);
     if (rds) mpz_init(r);
 
-    mpz_import(x, xn, -1, sizeof(BDIGIT), 0, nails, xds);
-    mpz_import(y, yn, -1, sizeof(BDIGIT), 0, nails, yds);
+    bdigits_to_mpz(x, xds, xn);
+    bdigits_to_mpz(y, yds, yn);
 
     if (!rds) {
         mpz_fdiv_q(q, x, y);
@@ -2761,13 +2828,13 @@ bary_divmod_gmp(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xd
     mpz_clear(y);
 
     if (qds) {
-        mpz_export(qds, &count, -1, sizeof(BDIGIT), 0, nails, q);
+        bdigits_from_mpz(q, qds, &count);
         BDIGITS_ZERO(qds+count, qn-count);
         mpz_clear(q);
     }
 
     if (rds) {
-        mpz_export(rds, &count, -1, sizeof(BDIGIT), 0, nails, r);
+        bdigits_from_mpz(r, rds, &count);
         BDIGITS_ZERO(rds+count, rn-count);
         mpz_clear(r);
     }
@@ -2811,7 +2878,7 @@ rb_big_divrem_gmp(VALUE x, VALUE y)
 static void
 bary_divmod_branch(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-#ifdef USE_GMP
+#if USE_GMP
     if (GMP_DIV_DIGITS < xn) {
         bary_divmod_gmp(qds, qn, rds, rn, xds, xn, yds, yn);
         return;
@@ -2866,29 +2933,8 @@ bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, s
 }
 
 
-#define BIGNUM_DEBUG 0
-#if BIGNUM_DEBUG
-#define ON_DEBUG(x) do { x; } while (0)
-static void
-dump_bignum(VALUE x)
-{
-    long i;
-    printf("%c0x0", BIGNUM_SIGN(x) ? '+' : '-');
-    for (i = BIGNUM_LEN(x); i--; ) {
-        printf("_%0*"PRIxBDIGIT, SIZEOF_BDIGIT*2, BDIGITS(x)[i]);
-    }
-    printf(", len=%"PRIuSIZE, BIGNUM_LEN(x));
-    puts("");
-}
-
-static VALUE
-rb_big_dump(VALUE x)
-{
-    dump_bignum(x);
-    return x;
-}
-#else
-#define ON_DEBUG(x)
+#ifndef BIGNUM_DEBUG
+# define BIGNUM_DEBUG (0+RUBY_DEBUG)
 #endif
 
 static int
@@ -2907,7 +2953,7 @@ int
 rb_cmpint(VALUE val, VALUE a, VALUE b)
 {
     if (NIL_P(val)) {
-	rb_cmperr(a, b);
+        rb_cmperr(a, b);
     }
     if (FIXNUM_P(val)) {
         long l = FIX2LONG(val);
@@ -2916,9 +2962,9 @@ rb_cmpint(VALUE val, VALUE a, VALUE b)
         return 0;
     }
     if (RB_BIGNUM_TYPE_P(val)) {
-	if (BIGZEROP(val)) return 0;
-	if (BIGNUM_SIGN(val)) return 1;
-	return -1;
+        if (BIGZEROP(val)) return 0;
+        if (BIGNUM_SIGN(val)) return 1;
+        return -1;
     }
     if (RTEST(rb_funcall(val, '>', 1, INT2FIX(0)))) return 1;
     if (RTEST(rb_funcall(val, '<', 1, INT2FIX(0)))) return -1;
@@ -2926,44 +2972,44 @@ rb_cmpint(VALUE val, VALUE a, VALUE b)
 }
 
 #define BIGNUM_SET_LEN(b,l) \
-    ((RBASIC(b)->flags & BIGNUM_EMBED_FLAG) ? \
+    (BIGNUM_EMBED_P(b) ? \
      (void)(RBASIC(b)->flags = \
-	    (RBASIC(b)->flags & ~BIGNUM_EMBED_LEN_MASK) | \
-	    ((l) << BIGNUM_EMBED_LEN_SHIFT)) : \
+            (RBASIC(b)->flags & ~BIGNUM_EMBED_LEN_MASK) | \
+            ((l) << BIGNUM_EMBED_LEN_SHIFT)) : \
      (void)(RBIGNUM(b)->as.heap.len = (l)))
 
 static void
 rb_big_realloc(VALUE big, size_t len)
 {
     BDIGIT *ds;
-    if (RBASIC(big)->flags & BIGNUM_EMBED_FLAG) {
-	if (BIGNUM_EMBED_LEN_MAX < len) {
-	    ds = ALLOC_N(BDIGIT, len);
-	    MEMCPY(ds, RBIGNUM(big)->as.ary, BDIGIT, BIGNUM_EMBED_LEN_MAX);
-	    RBIGNUM(big)->as.heap.len = BIGNUM_LEN(big);
-	    RBIGNUM(big)->as.heap.digits = ds;
-	    RBASIC(big)->flags &= ~BIGNUM_EMBED_FLAG;
-	}
+    if (BIGNUM_EMBED_P(big)) {
+        if (BIGNUM_EMBED_LEN_MAX < len) {
+            ds = ALLOC_N(BDIGIT, len);
+            MEMCPY(ds, RBIGNUM(big)->as.ary, BDIGIT, BIGNUM_EMBED_LEN_MAX);
+            RBIGNUM(big)->as.heap.len = BIGNUM_LEN(big);
+            RBIGNUM(big)->as.heap.digits = ds;
+            FL_UNSET_RAW(big, BIGNUM_EMBED_FLAG);
+        }
     }
     else {
-	if (len <= BIGNUM_EMBED_LEN_MAX) {
-	    ds = RBIGNUM(big)->as.heap.digits;
-	    RBASIC(big)->flags |= BIGNUM_EMBED_FLAG;
-	    BIGNUM_SET_LEN(big, len);
+        if (len <= BIGNUM_EMBED_LEN_MAX) {
+            ds = RBIGNUM(big)->as.heap.digits;
+            FL_SET_RAW(big, BIGNUM_EMBED_FLAG);
+            BIGNUM_SET_LEN(big, len);
             (void)VALGRIND_MAKE_MEM_UNDEFINED((void*)RBIGNUM(big)->as.ary, sizeof(RBIGNUM(big)->as.ary));
-	    if (ds) {
-		MEMCPY(RBIGNUM(big)->as.ary, ds, BDIGIT, len);
-		xfree(ds);
-	    }
-	}
-	else {
-	    if (BIGNUM_LEN(big) == 0) {
-		RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
-	    }
-	    else {
-		REALLOC_N(RBIGNUM(big)->as.heap.digits, BDIGIT, len);
-	    }
-	}
+            if (ds) {
+                MEMCPY(RBIGNUM(big)->as.ary, ds, BDIGIT, len);
+                xfree(ds);
+            }
+        }
+        else {
+            if (BIGNUM_LEN(big) == 0) {
+                RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
+            }
+            else {
+                REALLOC_N(RBIGNUM(big)->as.heap.digits, BDIGIT, len);
+            }
+        }
     }
 }
 
@@ -2978,18 +3024,19 @@ static VALUE
 bignew_1(VALUE klass, size_t len, int sign)
 {
     NEWOBJ_OF(big, struct RBignum, klass, T_BIGNUM | (RGENGC_WB_PROTECTED_BIGNUM ? FL_WB_PROTECTED : 0));
-    BIGNUM_SET_SIGN(big, sign?1:0);
+    VALUE bigv = (VALUE)big;
+    BIGNUM_SET_SIGN(bigv, sign);
     if (len <= BIGNUM_EMBED_LEN_MAX) {
-	RBASIC(big)->flags |= BIGNUM_EMBED_FLAG;
-	BIGNUM_SET_LEN(big, len);
-        (void)VALGRIND_MAKE_MEM_UNDEFINED((void*)RBIGNUM(big)->as.ary, sizeof(RBIGNUM(big)->as.ary));
+        FL_SET_RAW(bigv, BIGNUM_EMBED_FLAG);
+        BIGNUM_SET_LEN(bigv, len);
+        (void)VALGRIND_MAKE_MEM_UNDEFINED((void*)big->as.ary, sizeof(big->as.ary));
     }
     else {
-	RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
-	RBIGNUM(big)->as.heap.len = len;
+        big->as.heap.digits = ALLOC_N(BDIGIT, len);
+        big->as.heap.len = len;
     }
-    OBJ_FREEZE(big);
-    return (VALUE)big;
+    OBJ_FREEZE(bigv);
+    return bigv;
 }
 
 VALUE
@@ -3048,7 +3095,7 @@ abs2twocomp(VALUE *xp, long *n_ret)
         MEMCPY(BDIGITS(z), ds, BDIGIT, n);
         bary_2comp(BDIGITS(z), n);
         hibits = BDIGMAX;
-	*xp = z;
+        *xp = z;
     }
     *n_ret = n;
     return hibits;
@@ -3072,7 +3119,7 @@ bigtrunc(VALUE x)
     if (len == 0) return x;
     while (--len && !ds[len]);
     if (BIGNUM_LEN(x) > len+1) {
-	rb_big_resize(x, len+1);
+        rb_big_resize(x, len+1);
     }
     return x;
 }
@@ -3125,7 +3172,7 @@ static VALUE
 bignorm(VALUE x)
 {
     if (RB_BIGNUM_TYPE_P(x)) {
-	x = bigfixize(x);
+        x = bigfixize(x);
     }
     return x;
 }
@@ -3137,7 +3184,7 @@ rb_big_norm(VALUE x)
 }
 
 VALUE
-rb_uint2big(VALUE n)
+rb_uint2big(uintptr_t n)
 {
     long i;
     VALUE big = bignew(bdigit_roomof(SIZEOF_VALUE), 1);
@@ -3147,8 +3194,8 @@ rb_uint2big(VALUE n)
     digits[0] = n;
 #else
     for (i = 0; i < bdigit_roomof(SIZEOF_VALUE); i++) {
-	digits[i] = BIGLO(n);
-	n = BIGDN(n);
+        digits[i] = BIGLO(n);
+        n = BIGDN(n);
     }
 #endif
 
@@ -3159,7 +3206,7 @@ rb_uint2big(VALUE n)
 }
 
 VALUE
-rb_int2big(SIGNED_VALUE n)
+rb_int2big(intptr_t n)
 {
     long neg = 0;
     VALUE u;
@@ -3167,27 +3214,27 @@ rb_int2big(SIGNED_VALUE n)
 
     if (n < 0) {
         u = 1 + (VALUE)(-(n + 1)); /* u = -n avoiding overflow */
-	neg = 1;
+        neg = 1;
     }
     else {
         u = n;
     }
     big = rb_uint2big(u);
     if (neg) {
-	BIGNUM_SET_SIGN(big, 0);
+        BIGNUM_SET_NEGATIVE_SIGN(big);
     }
     return big;
 }
 
 VALUE
-rb_uint2inum(VALUE n)
+rb_uint2inum(uintptr_t n)
 {
     if (POSFIXABLE(n)) return LONG2FIX(n);
     return rb_uint2big(n);
 }
 
 VALUE
-rb_int2inum(SIGNED_VALUE n)
+rb_int2inum(intptr_t n)
 {
     if (FIXABLE(n)) return LONG2FIX(n);
     return rb_int2big(n);
@@ -3333,7 +3380,7 @@ absint_numwords_generic(size_t numbytes, int nlz_bits_in_msbyte, size_t word_num
 
     if (sign == 2) {
 #if defined __GNUC__ && (__GNUC__ == 4 && __GNUC_MINOR__ == 4)
-	*nlz_bits_ret = 0;
+        *nlz_bits_ret = 0;
 #endif
         return (size_t)-1;
     }
@@ -3366,7 +3413,7 @@ rb_absint_numwords(VALUE val, size_t word_numbits, size_t *nlz_bits_ret)
     size_t numbytes;
     int nlz_bits_in_msbyte;
     size_t numwords;
-    size_t nlz_bits;
+    size_t nlz_bits = 0;
 
     if (word_numbits == 0)
         return (size_t)-1;
@@ -3381,6 +3428,7 @@ rb_absint_numwords(VALUE val, size_t word_numbits, size_t *nlz_bits_ret)
             numwords0 = absint_numwords_generic(numbytes, nlz_bits_in_msbyte, word_numbits, &nlz_bits0);
             assert(numwords0 == numwords);
             assert(nlz_bits0 == nlz_bits);
+            (void)numwords0;
         }
 #endif
     }
@@ -3568,7 +3616,7 @@ rb_integer_pack(VALUE val, void *words, size_t numwords, size_t wordsize, size_t
 }
 
 /*
- * Import an integer into a buffer.
+ * Import an integer from a buffer.
  *
  * [words] buffer to import.
  * [numwords] the size of given buffer as number of words.
@@ -3652,7 +3700,7 @@ rb_integer_unpack(const void *words, size_t numwords, size_t wordsize, size_t na
         }
         else if (num_bdigits == numberof(fixbuf)) {
             val = bignew((long)num_bdigits+1, 0);
-	    MEMCPY(BDIGITS(val), fixbuf, BDIGIT, num_bdigits);
+            MEMCPY(BDIGITS(val), fixbuf, BDIGIT, num_bdigits);
             BDIGITS(val)[num_bdigits++] = 1;
         }
         else {
@@ -3664,11 +3712,11 @@ rb_integer_unpack(const void *words, size_t numwords, size_t wordsize, size_t na
         BDIGIT_DBL u = fixbuf[0] + BIGUP(fixbuf[1]);
         if (u == 0)
             return LONG2FIX(0);
-	if (0 < sign && POSFIXABLE(u))
-            return LONG2FIX(u);
-	if (sign < 0 && BDIGIT_MSB(fixbuf[1]) == 0 &&
+        if (0 < sign && POSFIXABLE(u))
+            return LONG2FIX((long)u);
+        if (sign < 0 && BDIGIT_MSB(fixbuf[1]) == 0 &&
                 NEGFIXABLE(-(BDIGIT_DBL_SIGNED)u))
-            return LONG2FIX(-(BDIGIT_DBL_SIGNED)u);
+            return LONG2FIX((long)-(BDIGIT_DBL_SIGNED)u);
         val = bignew((long)num_bdigits, 0 <= sign);
         MEMCPY(BDIGITS(val), fixbuf, BDIGIT, num_bdigits);
     }
@@ -3685,46 +3733,78 @@ rb_integer_unpack(const void *words, size_t numwords, size_t wordsize, size_t na
 
 #define conv_digit(c) (ruby_digit36_to_number_table[(unsigned char)(c)])
 
-static void
-str2big_scan_digits(const char *s, const char *str, int base, int badcheck, size_t *num_digits_p, size_t *len_p)
+NORETURN(static inline void invalid_radix(int base));
+NORETURN(static inline void invalid_integer(VALUE s));
+
+static inline int
+valid_radix_p(int base)
+{
+    return (1 < base && base <= 36);
+}
+
+static inline void
+invalid_radix(int base)
+{
+    rb_raise(rb_eArgError, "invalid radix %d", base);
+}
+
+static inline void
+invalid_integer(VALUE s)
+{
+    rb_raise(rb_eArgError, "invalid value for Integer(): %+"PRIsVALUE, s);
+}
+
+static int
+str2big_scan_digits(const char *s, const char *str, int base, int badcheck, size_t *num_digits_p, ssize_t *len_p)
 {
     char nondigit = 0;
     size_t num_digits = 0;
     const char *digits_start = str;
     const char *digits_end = str;
+    ssize_t len = *len_p;
 
     int c;
 
-    if (badcheck && *str == '_') goto bad;
+    if (!len) {
+        *num_digits_p = 0;
+        *len_p = 0;
+        return TRUE;
+    }
+
+    if (badcheck && *str == '_') return FALSE;
 
     while ((c = *str++) != 0) {
-	if (c == '_') {
-	    if (nondigit) {
-		if (badcheck) goto bad;
-		break;
-	    }
-	    nondigit = (char) c;
-	    continue;
-	}
-	else if ((c = conv_digit(c)) < 0) {
-	    break;
-	}
-	if (c >= base) break;
-	nondigit = 0;
-        num_digits++;
-        digits_end = str;
-    }
-    if (badcheck) {
-	str--;
-	if (s+1 < str && str[-1] == '_') goto bad;
-	while (*str && ISSPACE(*str)) str++;
-	if (*str) {
-	  bad:
-	    rb_invalid_str(s, "Integer()");
-	}
+        if (c == '_') {
+            if (nondigit) {
+                if (badcheck) return FALSE;
+                break;
+            }
+            nondigit = (char) c;
+        }
+        else if ((c = conv_digit(c)) < 0 || c >= base) {
+            break;
+        }
+        else {
+            nondigit = 0;
+            num_digits++;
+            digits_end = str;
+        }
+        if (len > 0 && !--len) break;
+    }
+    if (badcheck && nondigit) return FALSE;
+    if (badcheck && len) {
+        str--;
+        while (*str && ISSPACE(*str)) {
+            str++;
+            if (len > 0 && !--len) break;
+        }
+        if (len && *str) {
+            return FALSE;
+        }
     }
     *num_digits_p = num_digits;
     *len_p = digits_end - digits_start;
+    return TRUE;
 }
 
 static VALUE
@@ -3895,7 +3975,7 @@ str2big_karatsuba(
     return z;
 }
 
-#ifdef USE_GMP
+#if USE_GMP
 static VALUE
 str2big_gmp(
     int sign,
@@ -3905,7 +3985,6 @@ str2big_gmp(
     size_t num_bdigits,
     int base)
 {
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
     char *buf, *p;
     const char *q;
     VALUE tmps;
@@ -3928,7 +4007,7 @@ str2big_gmp(
     zn = num_bdigits;
     z = bignew(zn, sign);
     zds = BDIGITS(z);
-    mpz_export(BDIGITS(z), &count, -1, sizeof(BDIGIT), 0, nails, mz);
+    bdigits_from_mpz(mz, BDIGITS(z), &count);
     BDIGITS_ZERO(zds+count, zn-count);
     mpz_clear(mz);
 
@@ -3939,6 +4018,8 @@ str2big_gmp(
 }
 #endif
 
+static VALUE rb_cstr_parse_inum(const char *str, ssize_t len, char **endp, int base);
+
 /*
  * Parse +str+ as Ruby Integer, i.e., underscores, 0d and 0b prefixes.
  *
@@ -3958,152 +4039,207 @@ str2big_gmp(
 VALUE
 rb_cstr_to_inum(const char *str, int base, int badcheck)
 {
-    const char *s = str;
+    char *end;
+    VALUE ret = rb_cstr_parse_inum(str, -1, (badcheck ? NULL : &end), base);
+    if (NIL_P(ret)) {
+        if (badcheck) rb_invalid_str(str, "Integer()");
+        ret = INT2FIX(0);
+    }
+    return ret;
+}
+
+/*
+ * Parse +str+ as Ruby Integer, i.e., underscores, 0d and 0b prefixes.
+ *
+ * str:  pointer to the string to be parsed.
+ *       should be NUL-terminated if +len+ is negative.
+ * len:  length of +str+ if >= 0.  if +len+ is negative, +str+ should
+ *       be NUL-terminated.
+ * endp: if non-NULL, the address after parsed part is stored.  if
+ *       NULL, Qnil is returned when +str+ is not valid as an Integer.
+ * ndigits: if non-NULL, the number of parsed digits is stored.
+ * base: see +rb_cstr_to_inum+
+ * flags: bitwise OR of below flags:
+ *       RB_INT_PARSE_SIGN: allow preceding spaces and +/- sign
+ *       RB_INT_PARSE_UNDERSCORE: allow an underscore between digits
+ *       RB_INT_PARSE_PREFIX: allow preceding prefix
+ */
+
+VALUE
+rb_int_parse_cstr(const char *str, ssize_t len, char **endp, size_t *ndigits,
+                  int base, int flags)
+{
+    const char *const s = str;
     char sign = 1;
     int c;
-    VALUE z;
+    VALUE z = Qnil;
 
-    int bits_per_digit;
+    unsigned long val;
+    int ov;
 
     const char *digits_start, *digits_end;
-    size_t num_digits;
+    size_t num_digits = 0;
     size_t num_bdigits;
-    size_t len;
+    const ssize_t len0 = len;
+    const int badcheck = !endp;
+
+#define ADV(n) do {\
+        if (len > 0 && len <= (n)) goto bad; \
+        str += (n); \
+        len -= (n); \
+    } while (0)
+#define ASSERT_LEN() do {\
+        assert(len != 0); \
+        if (len0 >= 0) assert(s + len0 == str + len); \
+    } while (0)
 
     if (!str) {
-	if (badcheck) {
-          bad:
-            rb_invalid_str(s, "Integer()");
-        }
-	return INT2FIX(0);
+        goto bad;
     }
-    while (ISSPACE(*str)) str++;
+    if (len && (flags & RB_INT_PARSE_SIGN)) {
+        while (ISSPACE(*str)) ADV(1);
 
-    if (str[0] == '+') {
-	str++;
-    }
-    else if (str[0] == '-') {
-	str++;
-	sign = 0;
-    }
-    if (str[0] == '+' || str[0] == '-') {
-	if (badcheck) goto bad;
-	return INT2FIX(0);
+        if (str[0] == '+') {
+            ADV(1);
+        }
+        else if (str[0] == '-') {
+            ADV(1);
+            sign = 0;
+        }
+        ASSERT_LEN();
     }
     if (base <= 0) {
-	if (str[0] == '0') {
-	    switch (str[1]) {
-	      case 'x': case 'X':
-		base = 16;
-                str += 2;
-		break;
-	      case 'b': case 'B':
-		base = 2;
-                str += 2;
-		break;
-	      case 'o': case 'O':
-		base = 8;
-                str += 2;
-		break;
-	      case 'd': case 'D':
-		base = 10;
-                str += 2;
-		break;
-	      default:
-		base = 8;
-	    }
-	}
-	else if (base < -1) {
-	    base = -base;
-	}
-	else {
-	    base = 10;
-	}
+        if (str[0] == '0' && len > 1) {
+            switch (str[1]) {
+              case 'x': case 'X':
+                base = 16;
+                ADV(2);
+                break;
+              case 'b': case 'B':
+                base = 2;
+                ADV(2);
+                break;
+              case 'o': case 'O':
+                base = 8;
+                ADV(2);
+                break;
+              case 'd': case 'D':
+                base = 10;
+                ADV(2);
+                break;
+              default:
+                base = 8;
+            }
+        }
+        else if (base < -1) {
+            base = -base;
+        }
+        else {
+            base = 10;
+        }
+    }
+    else if (len == 1 || !(flags & RB_INT_PARSE_PREFIX)) {
+        /* no prefix */
     }
     else if (base == 2) {
-	if (str[0] == '0' && (str[1] == 'b'||str[1] == 'B')) {
-	    str += 2;
-	}
+        if (str[0] == '0' && (str[1] == 'b'||str[1] == 'B')) {
+            ADV(2);
+        }
     }
     else if (base == 8) {
-	if (str[0] == '0' && (str[1] == 'o'||str[1] == 'O')) {
-	    str += 2;
-	}
+        if (str[0] == '0' && (str[1] == 'o'||str[1] == 'O')) {
+            ADV(2);
+        }
     }
     else if (base == 10) {
-	if (str[0] == '0' && (str[1] == 'd'||str[1] == 'D')) {
-	    str += 2;
-	}
+        if (str[0] == '0' && (str[1] == 'd'||str[1] == 'D')) {
+            ADV(2);
+        }
     }
     else if (base == 16) {
-	if (str[0] == '0' && (str[1] == 'x'||str[1] == 'X')) {
-	    str += 2;
-	}
-    }
-    if (base < 2 || 36 < base) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
-    }
-    if (*str == '0') {		/* squeeze preceding 0s */
-	int us = 0;
-	while ((c = *++str) == '0' || c == '_') {
-	    if (c == '_') {
-		if (++us >= 2)
-		    break;
-	    }
-	    else {
-		us = 0;
-	    }
-	}
-	if (!(c = *str) || ISSPACE(c)) --str;
+        if (str[0] == '0' && (str[1] == 'x'||str[1] == 'X')) {
+            ADV(2);
+        }
+    }
+    if (!valid_radix_p(base)) {
+        invalid_radix(base);
+    }
+    if (!len) goto bad;
+    num_digits = str - s;
+    if (*str == '0' && len != 1) { /* squeeze preceding 0s */
+        int us = 0;
+        const char *end = len < 0 ? NULL : str + len;
+        ++num_digits;
+        while ((c = *++str) == '0' ||
+               ((flags & RB_INT_PARSE_UNDERSCORE) && c == '_')) {
+            if (c == '_') {
+                if (++us >= 2)
+                    break;
+            }
+            else {
+                ++num_digits;
+                us = 0;
+            }
+            if (str == end) break;
+        }
+        if (!c || ISSPACE(c)) --str;
+        if (end) len = end - str;
     }
     c = *str;
     c = conv_digit(c);
     if (c < 0 || c >= base) {
-	if (badcheck) goto bad;
-	return INT2FIX(0);
-    }
-
-    bits_per_digit = bit_length(base-1);
-    if (bits_per_digit * strlen(str) <= sizeof(long) * CHAR_BIT) {
-        char *end;
-	unsigned long val = STRTOUL(str, &end, base);
-
-	if (str < end && *end == '_') goto bigparse;
-	if (badcheck) {
-	    if (end == str) goto bad; /* no number */
-	    while (*end && ISSPACE(*end)) end++;
-	    if (*end) goto bad;	      /* trailing garbage */
-	}
-
-	if (POSFIXABLE(val)) {
-	    if (sign) return LONG2FIX(val);
-	    else {
-		long result = -(long)val;
-		return LONG2FIX(result);
-	    }
-	}
-	else {
-	    VALUE big = rb_uint2big(val);
-	    BIGNUM_SET_SIGN(big, sign);
-	    return bignorm(big);
-	}
+        if (!badcheck && num_digits) z = INT2FIX(0);
+        goto bad;
+    }
+
+    if (ndigits) *ndigits = num_digits;
+    val = ruby_scan_digits(str, len, base, &num_digits, &ov);
+    if (!ov) {
+        const char *end = &str[num_digits];
+        if (num_digits > 0 && *end == '_' && (flags & RB_INT_PARSE_UNDERSCORE))
+            goto bigparse;
+        if (endp) *endp = (char *)end;
+        if (ndigits) *ndigits += num_digits;
+        if (badcheck) {
+            if (num_digits == 0) return Qnil; /* no number */
+            while (len < 0 ? *end : end < str + len) {
+                if (!ISSPACE(*end)) return Qnil; /* trailing garbage */
+                end++;
+            }
+        }
+
+        if (POSFIXABLE(val)) {
+            if (sign) return LONG2FIX(val);
+            else {
+                long result = -(long)val;
+                return LONG2FIX(result);
+            }
+        }
+        else {
+            VALUE big = rb_uint2big(val);
+            BIGNUM_SET_SIGN(big, sign);
+            return bignorm(big);
+        }
     }
 
   bigparse:
     digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    if (!str2big_scan_digits(s, str, base, badcheck, &num_digits, &len))
+        goto bad;
+    if (endp) *endp = (char *)(str + len);
+    if (ndigits) *ndigits += num_digits;
     digits_end = digits_start + len;
 
     if (POW2_P(base)) {
         z = str2big_poweroftwo(sign, digits_start, digits_end, num_digits,
-                bits_per_digit);
+                               bit_length(base-1));
     }
     else {
         int digits_per_bdigits_dbl;
         maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
         num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
 
-#ifdef USE_GMP
+#if USE_GMP
         if (GMP_STR2BIG_DIGITS < num_bdigits) {
             z = str2big_gmp(sign, digits_start, digits_end, num_digits,
                     num_bdigits, base);
@@ -4121,63 +4257,74 @@ rb_cstr_to_inum(const char *str, int base, int badcheck)
     }
 
     return bignorm(z);
+
+  bad:
+    if (endp) *endp = (char *)str;
+    if (ndigits) *ndigits = num_digits;
+    return z;
+}
+
+static VALUE
+rb_cstr_parse_inum(const char *str, ssize_t len, char **endp, int base)
+{
+    return rb_int_parse_cstr(str, len, endp, NULL, base,
+                             RB_INT_PARSE_DEFAULT);
 }
 
 VALUE
-rb_str_to_inum(VALUE str, int base, int badcheck)
+rb_str_convert_to_inum(VALUE str, int base, int badcheck, int raise_exception)
 {
-    char *s;
-    long len;
-    VALUE v = 0;
     VALUE ret;
+    const char *s;
+    long len;
+    char *end;
 
     StringValue(str);
     rb_must_asciicompat(str);
-    if (badcheck) {
-	s = StringValueCStr(str);
-    }
-    else {
-	s = RSTRING_PTR(str);
-    }
-    if (s) {
-	len = RSTRING_LEN(str);
-	if (s[len]) {		/* no sentinel somehow */
-	    char *p = ALLOCV(v, len+1);
-
-	    MEMCPY(p, s, char, len);
-	    p[len] = '\0';
-	    s = p;
-	}
+    RSTRING_GETMEM(str, s, len);
+    ret = rb_cstr_parse_inum(s, len, (badcheck ? NULL : &end), base);
+    if (NIL_P(ret)) {
+        if (badcheck) {
+            if (!raise_exception) return Qnil;
+            invalid_integer(str);
+        }
+        ret = INT2FIX(0);
     }
-    ret = rb_cstr_to_inum(s, base, badcheck);
-    if (v)
-	ALLOCV_END(v);
     return ret;
 }
 
 VALUE
+rb_str_to_inum(VALUE str, int base, int badcheck)
+{
+    return rb_str_convert_to_inum(str, base, badcheck, TRUE);
+}
+
+VALUE
 rb_str2big_poweroftwo(VALUE arg, int base, int badcheck)
 {
     int positive_p = 1;
     const char *s, *str;
     const char *digits_start, *digits_end;
     size_t num_digits;
-    size_t len;
+    ssize_t len;
     VALUE z;
 
-    if (base < 2 || 36 < base || !POW2_P(base)) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
+    if (!valid_radix_p(base) || !POW2_P(base)) {
+        invalid_radix(base);
     }
 
     rb_must_asciicompat(arg);
     s = str = StringValueCStr(arg);
+    len = RSTRING_LEN(arg);
     if (*str == '-') {
+        len--;
         str++;
         positive_p = 0;
     }
 
     digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    if (!str2big_scan_digits(s, str, base, badcheck, &num_digits, &len))
+        invalid_integer(arg);
     digits_end = digits_start + len;
 
     z = str2big_poweroftwo(positive_p, digits_start, digits_end, num_digits,
@@ -4195,25 +4342,28 @@ rb_str2big_normal(VALUE arg, int base, int badcheck)
     const char *s, *str;
     const char *digits_start, *digits_end;
     size_t num_digits;
-    size_t len;
+    ssize_t len;
     VALUE z;
 
     int digits_per_bdigits_dbl;
     size_t num_bdigits;
 
-    if (base < 2 || 36 < base) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
+    if (!valid_radix_p(base)) {
+        invalid_radix(base);
     }
 
     rb_must_asciicompat(arg);
-    s = str = StringValueCStr(arg);
-    if (*str == '-') {
+    s = str = StringValuePtr(arg);
+    len = RSTRING_LEN(arg);
+    if (len > 0 && *str == '-') {
+        len--;
         str++;
         positive_p = 0;
     }
 
     digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    if (!str2big_scan_digits(s, str, base, badcheck, &num_digits, &len))
+        invalid_integer(arg);
     digits_end = digits_start + len;
 
     maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
@@ -4234,25 +4384,28 @@ rb_str2big_karatsuba(VALUE arg, int base, int badcheck)
     const char *s, *str;
     const char *digits_start, *digits_end;
     size_t num_digits;
-    size_t len;
+    ssize_t len;
     VALUE z;
 
     int digits_per_bdigits_dbl;
     size_t num_bdigits;
 
-    if (base < 2 || 36 < base) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
+    if (!valid_radix_p(base)) {
+        invalid_radix(base);
     }
 
     rb_must_asciicompat(arg);
-    s = str = StringValueCStr(arg);
-    if (*str == '-') {
+    s = str = StringValuePtr(arg);
+    len = RSTRING_LEN(arg);
+    if (len > 0 && *str == '-') {
+        len--;
         str++;
         positive_p = 0;
     }
 
     digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    if (!str2big_scan_digits(s, str, base, badcheck, &num_digits, &len))
+        invalid_integer(arg);
     digits_end = digits_start + len;
 
     maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
@@ -4266,7 +4419,7 @@ rb_str2big_karatsuba(VALUE arg, int base, int badcheck)
     return bignorm(z);
 }
 
-#ifdef USE_GMP
+#if USE_GMP
 VALUE
 rb_str2big_gmp(VALUE arg, int base, int badcheck)
 {
@@ -4274,25 +4427,28 @@ rb_str2big_gmp(VALUE arg, int base, int badcheck)
     const char *s, *str;
     const char *digits_start, *digits_end;
     size_t num_digits;
-    size_t len;
+    ssize_t len;
     VALUE z;
 
     int digits_per_bdigits_dbl;
     size_t num_bdigits;
 
-    if (base < 2 || 36 < base) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
+    if (!valid_radix_p(base)) {
+        invalid_radix(base);
     }
 
     rb_must_asciicompat(arg);
-    s = str = StringValueCStr(arg);
-    if (*str == '-') {
+    s = str = StringValuePtr(arg);
+    len = RSTRING_LEN(arg);
+    if (len > 0 && *str == '-') {
+        len--;
         str++;
         positive_p = 0;
     }
 
     digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    if (!str2big_scan_digits(s, str, base, badcheck, &num_digits, &len))
+        invalid_integer(arg);
     digits_end = digits_start + len;
 
     maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
@@ -4319,8 +4475,8 @@ rb_ull2big(unsigned LONG_LONG n)
     digits[0] = n;
 #else
     for (i = 0; i < bdigit_roomof(SIZEOF_LONG_LONG); i++) {
-	digits[i] = BIGLO(n);
-	n = BIGDN(n);
+        digits[i] = BIGLO(n);
+        n = BIGDN(n);
     }
 #endif
 
@@ -4339,14 +4495,14 @@ rb_ll2big(LONG_LONG n)
 
     if (n < 0) {
         u = 1 + (unsigned LONG_LONG)(-(n + 1)); /* u = -n avoiding overflow */
-	neg = 1;
+        neg = 1;
     }
     else {
         u = n;
     }
     big = rb_ull2big(u);
     if (neg) {
-	BIGNUM_SET_SIGN(big, 0);
+        BIGNUM_SET_NEGATIVE_SIGN(big);
     }
     return big;
 }
@@ -4354,19 +4510,59 @@ rb_ll2big(LONG_LONG n)
 VALUE
 rb_ull2inum(unsigned LONG_LONG n)
 {
-    if (POSFIXABLE(n)) return LONG2FIX(n);
+    if (POSFIXABLE(n)) return LONG2FIX((long)n);
     return rb_ull2big(n);
 }
 
 VALUE
 rb_ll2inum(LONG_LONG n)
 {
-    if (FIXABLE(n)) return LONG2FIX(n);
+    if (FIXABLE(n)) return LONG2FIX((long)n);
     return rb_ll2big(n);
 }
 
 #endif  /* HAVE_LONG_LONG */
 
+#ifdef HAVE_INT128_T
+static VALUE
+rb_uint128t2big(uint128_t n)
+{
+    long i;
+    VALUE big = bignew(bdigit_roomof(SIZEOF_INT128_T), 1);
+    BDIGIT *digits = BDIGITS(big);
+
+    for (i = 0; i < bdigit_roomof(SIZEOF_INT128_T); i++) {
+        digits[i] = BIGLO(RSHIFT(n ,BITSPERDIG*i));
+    }
+
+    i = bdigit_roomof(SIZEOF_INT128_T);
+    while (i-- && !digits[i]) ;
+    BIGNUM_SET_LEN(big, i+1);
+    return big;
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_int128t2big(int128_t n)
+{
+    int neg = 0;
+    uint128_t u;
+    VALUE big;
+
+    if (n < 0) {
+        u = 1 + (uint128_t)(-(n + 1)); /* u = -n avoiding overflow */
+        neg = 1;
+    }
+    else {
+        u = n;
+    }
+    big = rb_uint128t2big(u);
+    if (neg) {
+        BIGNUM_SET_NEGATIVE_SIGN(big);
+    }
+    return big;
+}
+#endif
+
 VALUE
 rb_cstr2inum(const char *str, int base)
 {
@@ -4390,11 +4586,14 @@ big_shift3(VALUE x, int lshift_p, size_t shift_numdigits, int shift_numbits)
 
     if (lshift_p) {
         if (LONG_MAX < shift_numdigits) {
-            rb_raise(rb_eArgError, "too big number");
+          too_big:
+            rb_raise(rb_eRangeError, "shift width too big");
         }
         s1 = shift_numdigits;
         s2 = shift_numbits;
+        if ((size_t)s1 != shift_numdigits) goto too_big;
         xn = BIGNUM_LEN(x);
+        if (LONG_MAX/SIZEOF_BDIGIT <= xn+s1) goto too_big;
         z = bignew(xn+s1+1, BIGNUM_SIGN(x));
         zds = BDIGITS(z);
         BDIGITS_ZERO(zds, s1);
@@ -4485,12 +4684,6 @@ static size_t base36_numdigits_cache[35][MAX_BASE36_POWER_TABLE_ENTRIES];
 static void
 power_cache_init(void)
 {
-    int i, j;
-    for (i = 0; i < 35; ++i) {
-	for (j = 0; j < MAX_BASE36_POWER_TABLE_ENTRIES; ++j) {
-	    base36_power_cache[i][j] = Qnil;
-	}
-    }
 }
 
 static inline VALUE
@@ -4513,8 +4706,8 @@ power_cache_get_power(int base, int power_level, size_t *numdigits_ret)
     if (MAX_BASE36_POWER_TABLE_ENTRIES <= power_level)
         rb_bug("too big power number requested: maxpow_in_bdigit_dbl(%d)**(2**%d)", base, power_level);
 
-    if (NIL_P(base36_power_cache[base - 2][power_level])) {
-        VALUE power;
+    VALUE power = base36_power_cache[base - 2][power_level];
+    if (!power) {
         size_t numdigits;
         if (power_level == 0) {
             int numdigits0;
@@ -4530,11 +4723,11 @@ power_cache_get_power(int base, int power_level, size_t *numdigits_ret)
         rb_obj_hide(power);
         base36_power_cache[base - 2][power_level] = power;
         base36_numdigits_cache[base - 2][power_level] = numdigits;
-	rb_gc_register_mark_object(power);
+        rb_gc_register_mark_object(power);
     }
     if (numdigits_ret)
         *numdigits_ret = base36_numdigits_cache[base - 2][power_level];
-    return base36_power_cache[base - 2][power_level];
+    return power;
 }
 
 struct big2str_struct {
@@ -4575,19 +4768,21 @@ big2str_2bdigits(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t tail
         p = buf;
         j = sizeof(buf);
         do {
-            p[--j] = ruby_digitmap[num % b2s->base];
+            BDIGIT_DBL idx = num % b2s->base;
             num /= b2s->base;
+            p[--j] = ruby_digitmap[idx];
         } while (num);
         len = sizeof(buf) - j;
         big2str_alloc(b2s, len + taillen);
-	MEMCPY(b2s->ptr, buf + j, char, len);
+        MEMCPY(b2s->ptr, buf + j, char, len);
     }
     else {
         p = b2s->ptr;
         j = b2s->hbase2_numdigits;
         do {
-            p[--j] = ruby_digitmap[num % b2s->base];
+            BDIGIT_DBL idx = num % b2s->base;
             num /= b2s->base;
+            p[--j] = ruby_digitmap[idx];
         } while (j);
         len = b2s->hbase2_numdigits;
     }
@@ -4596,7 +4791,7 @@ big2str_2bdigits(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t tail
 
 static void
 big2str_karatsuba(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t wn,
-		  int power_level, size_t taillen)
+                  int power_level, size_t taillen)
 {
     VALUE b;
     size_t half_numdigits, lower_numdigits;
@@ -4626,17 +4821,17 @@ big2str_karatsuba(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t wn,
      */
 
     if (xn == 0 || bary_zero_p(xds, xn)) {
-	if (b2s->ptr) {
+        if (b2s->ptr) {
             /* When x is zero, power_cache_get_power(base, power_level) should be cached already. */
             power_cache_get_power(b2s->base, power_level, &len);
-	    memset(b2s->ptr, '0', len);
+            memset(b2s->ptr, '0', len);
             b2s->ptr += len;
-	}
+        }
         return;
     }
 
     if (power_level == 0) {
-	big2str_2bdigits(b2s, xds, xn, taillen);
+        big2str_2bdigits(b2s, xds, xn, taillen);
         return;
     }
 
@@ -4664,7 +4859,7 @@ big2str_karatsuba(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t wn,
             memset(b2s->ptr, '0', len);
             b2s->ptr += len;
         }
-	big2str_2bdigits(b2s, xds, xn, taillen);
+        big2str_2bdigits(b2s, xds, xn, taillen);
     }
     else {
         BDIGIT *qds, *rds;
@@ -4768,11 +4963,11 @@ big2str_generic(VALUE x, int base)
     BARY_TRUNC(xds, xn);
 
     if (xn == 0) {
-	return rb_usascii_str_new2("0");
+        return rb_usascii_str_new2("0");
     }
 
-    if (base < 2 || 36 < base)
-	rb_raise(rb_eArgError, "invalid radix %d", base);
+    if (!valid_radix_p(base))
+        invalid_radix(base);
 
     if (xn >= LONG_MAX/BITSPERDIG) {
         rb_raise(rb_eRangeError, "bignum too big to convert into `string'");
@@ -4809,7 +5004,7 @@ big2str_generic(VALUE x, int base)
     b2s_data.ptr = NULL;
 
     if (power_level == 0) {
-	big2str_2bdigits(&b2s_data, xds, xn, 0);
+        big2str_2bdigits(&b2s_data, xds, xn, 0);
     }
     else {
         VALUE tmpw = 0;
@@ -4818,7 +5013,7 @@ big2str_generic(VALUE x, int base)
         wn = power_level * BIGDIVREM_EXTRA_WORDS + BIGNUM_LEN(power);
         wds = ALLOCV_N(BDIGIT, tmpw, xn + wn);
         MEMCPY(wds, xds, BDIGIT, xn);
-	big2str_karatsuba(&b2s_data, wds, xn, wn, power_level, 0);
+        big2str_karatsuba(&b2s_data, wds, xn, wn, power_level, 0);
         if (tmpw)
             ALLOCV_END(tmpw);
     }
@@ -4837,11 +5032,10 @@ rb_big2str_generic(VALUE x, int base)
     return big2str_generic(x, base);
 }
 
-#ifdef USE_GMP
-VALUE
+#if USE_GMP
+static VALUE
 big2str_gmp(VALUE x, int base)
 {
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
     mpz_t mx;
     size_t size;
     VALUE str;
@@ -4849,7 +5043,7 @@ big2str_gmp(VALUE x, int base)
     size_t xn = BIGNUM_LEN(x);
 
     mpz_init(mx);
-    mpz_import(mx, xn, -1, sizeof(BDIGIT), 0, nails, xds);
+    bdigits_to_mpz(mx, xds, xn);
 
     size = mpz_sizeinbase(mx, base);
 
@@ -4885,7 +5079,7 @@ rb_big2str1(VALUE x, int base)
     size_t xn;
 
     if (FIXNUM_P(x)) {
-	return rb_fix2str(x, base);
+        return rb_fix2str(x, base);
     }
 
     bigtrunc(x);
@@ -4894,11 +5088,11 @@ rb_big2str1(VALUE x, int base)
     BARY_TRUNC(xds, xn);
 
     if (xn == 0) {
-	return rb_usascii_str_new2("0");
+        return rb_usascii_str_new2("0");
     }
 
-    if (base < 2 || 36 < base)
-	rb_raise(rb_eArgError, "invalid radix %d", base);
+    if (!valid_radix_p(base))
+        invalid_radix(base);
 
     if (xn >= LONG_MAX/BITSPERDIG) {
         rb_raise(rb_eRangeError, "bignum too big to convert into `string'");
@@ -4909,7 +5103,7 @@ rb_big2str1(VALUE x, int base)
         return big2str_base_poweroftwo(x, base);
     }
 
-#ifdef USE_GMP
+#if USE_GMP
     if (GMP_BIG2STR_DIGITS < xn) {
         return big2str_gmp(x, base);
     }
@@ -4924,38 +5118,12 @@ rb_big2str(VALUE x, int base)
     return rb_big2str1(x, base);
 }
 
-/*
- *  call-seq:
- *     big.to_s(base=10)   ->  string
- *
- *  Returns a string containing the representation of <i>big</i> radix
- *  <i>base</i> (2 through 36).
- *
- *     12345654321.to_s         #=> "12345654321"
- *     12345654321.to_s(2)      #=> "1011011111110110111011110000110001"
- *     12345654321.to_s(8)      #=> "133766736061"
- *     12345654321.to_s(16)     #=> "2dfdbbc31"
- *     78546939656932.to_s(36)  #=> "rubyrules"
- */
-
-static VALUE
-rb_big_to_s(int argc, VALUE *argv, VALUE x)
-{
-    int base;
-
-    if (argc == 0) base = 10;
-    else {
-	VALUE b;
-
-	rb_scan_args(argc, argv, "01", &b);
-	base = NUM2INT(b);
-    }
-    return rb_big2str(x, base);
-}
-
 static unsigned long
 big2ulong(VALUE x, const char *type)
 {
+#if SIZEOF_LONG > SIZEOF_BDIGIT
+    size_t i;
+#endif
     size_t len = BIGNUM_LEN(x);
     unsigned long num;
     BDIGIT *ds;
@@ -4970,9 +5138,9 @@ big2ulong(VALUE x, const char *type)
     num = (unsigned long)ds[0];
 #else
     num = 0;
-    while (len--) {
-	num <<= BITSPERDIG;
-	num += (unsigned long)ds[len]; /* overflow is already checked */
+    for (i = 0; i < len; i++) {
+        num <<= BITSPERDIG;
+        num += (unsigned long)ds[len - i - 1]; /* overflow is already checked */
     }
 #endif
     return num;
@@ -4987,10 +5155,8 @@ rb_big2ulong(VALUE x)
         return num;
     }
     else {
-        if (num <= LONG_MAX)
-            return -(long)num;
-        if (num == 1+(unsigned long)(-(LONG_MIN+1)))
-            return LONG_MIN;
+        if (num <= 1+(unsigned long)(-(LONG_MIN+1)))
+            return -(long)(num-1)-1;
     }
     rb_raise(rb_eRangeError, "bignum out of range of unsigned long");
 }
@@ -5005,10 +5171,8 @@ rb_big2long(VALUE x)
             return num;
     }
     else {
-        if (num <= LONG_MAX)
-            return -(long)num;
-        if (num == 1+(unsigned long)(-(LONG_MIN+1)))
-            return LONG_MIN;
+        if (num <= 1+(unsigned long)(-(LONG_MIN+1)))
+            return -(long)(num-1)-1;
     }
     rb_raise(rb_eRangeError, "bignum too big to convert into `long'");
 }
@@ -5018,6 +5182,9 @@ rb_big2long(VALUE x)
 static unsigned LONG_LONG
 big2ull(VALUE x, const char *type)
 {
+#if SIZEOF_LONG_LONG > SIZEOF_BDIGIT
+    size_t i;
+#endif
     size_t len = BIGNUM_LEN(x);
     unsigned LONG_LONG num;
     BDIGIT *ds = BDIGITS(x);
@@ -5025,14 +5192,14 @@ big2ull(VALUE x, const char *type)
     if (len == 0)
         return 0;
     if (BIGSIZE(x) > SIZEOF_LONG_LONG)
-	rb_raise(rb_eRangeError, "bignum too big to convert into `%s'", type);
+        rb_raise(rb_eRangeError, "bignum too big to convert into `%s'", type);
 #if SIZEOF_LONG_LONG <= SIZEOF_BDIGIT
     num = (unsigned LONG_LONG)ds[0];
 #else
     num = 0;
-    while (len--) {
-	num = BIGUP(num);
-	num += ds[len];
+    for (i = 0; i < len; i++) {
+        num = BIGUP(num);
+        num += ds[len - i - 1];
     }
 #endif
     return num;
@@ -5047,10 +5214,8 @@ rb_big2ull(VALUE x)
         return num;
     }
     else {
-        if (num <= LLONG_MAX)
-            return -(LONG_LONG)num;
-        if (num == 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
-            return LLONG_MIN;
+        if (num <= 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
+            return -(LONG_LONG)(num-1)-1;
     }
     rb_raise(rb_eRangeError, "bignum out of range of unsigned long long");
 }
@@ -5065,10 +5230,8 @@ rb_big2ll(VALUE x)
             return num;
     }
     else {
-        if (num <= LLONG_MAX)
-            return -(LONG_LONG)num;
-        if (num == 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
-            return LLONG_MIN;
+        if (num <= 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
+            return -(LONG_LONG)(num-1)-1;
     }
     rb_raise(rb_eRangeError, "bignum too big to convert into `long long'");
 }
@@ -5085,23 +5248,23 @@ dbl2big(double d)
     double u = (d < 0)?-d:d;
 
     if (isinf(d)) {
-	rb_raise(rb_eFloatDomainError, d < 0 ? "-Infinity" : "Infinity");
+        rb_raise(rb_eFloatDomainError, d < 0 ? "-Infinity" : "Infinity");
     }
     if (isnan(d)) {
-	rb_raise(rb_eFloatDomainError, "NaN");
+        rb_raise(rb_eFloatDomainError, "NaN");
     }
 
     while (1.0 <= u) {
-	u /= (double)(BIGRAD);
-	i++;
+        u /= (double)(BIGRAD);
+        i++;
     }
     z = bignew(i, d>=0);
     digits = BDIGITS(z);
     while (i--) {
-	u *= BIGRAD;
-	c = (BDIGIT)u;
-	u -= c;
-	digits[i] = c;
+        u *= BIGRAD;
+        c = (BDIGIT)u;
+        u -= c;
+        digits[i] = c;
     }
 
     return z;
@@ -5121,45 +5284,50 @@ big2dbl(VALUE x)
     BDIGIT *ds = BDIGITS(x), dl;
 
     if (i) {
-	bits = i * BITSPERDIG - nlz(ds[i-1]);
-	if (bits > DBL_MANT_DIG+DBL_MAX_EXP) {
-	    d = HUGE_VAL;
-	}
-	else {
-	    if (bits > DBL_MANT_DIG+1)
-		lo = (bits -= DBL_MANT_DIG+1) / BITSPERDIG;
-	    else
-		bits = 0;
-	    while (--i > lo) {
-		d = ds[i] + BIGRAD*d;
-	    }
-	    dl = ds[i];
-	    if (bits && (dl & ((BDIGIT)1 << (bits %= BITSPERDIG)))) {
-		int carry = (dl & ~(BDIGMAX << bits)) != 0;
-		if (!carry) {
-		    while (i-- > 0) {
-			carry = ds[i] != 0;
-			if (carry) break;
-		    }
-		}
-		if (carry) {
-		    dl &= BDIGMAX << bits;
-		    dl = BIGLO(dl + ((BDIGIT)1 << bits));
-		    if (!dl) d += 1;
-		}
-	    }
-	    d = dl + BIGRAD*d;
-	    if (lo) {
-		if (lo > INT_MAX / BITSPERDIG)
-		    d = HUGE_VAL;
-		else if (lo < INT_MIN / BITSPERDIG)
-		    d = 0.0;
-		else
-		    d = ldexp(d, (int)(lo * BITSPERDIG));
-	    }
-	}
-    }
-    if (!BIGNUM_SIGN(x)) d = -d;
+        bits = i * BITSPERDIG - nlz(ds[i-1]);
+        if (bits > DBL_MANT_DIG+DBL_MAX_EXP) {
+            d = HUGE_VAL;
+        }
+        else {
+            if (bits > DBL_MANT_DIG+1)
+                lo = (bits -= DBL_MANT_DIG+1) / BITSPERDIG;
+            else
+                bits = 0;
+            while (--i > lo) {
+                d = ds[i] + BIGRAD*d;
+            }
+            dl = ds[i];
+            if (bits && (dl & ((BDIGIT)1 << (bits %= BITSPERDIG)))) {
+                int carry = (dl & ~(BDIGMAX << bits)) != 0;
+                if (!carry) {
+                    while (i-- > 0) {
+                        carry = ds[i] != 0;
+                        if (carry) break;
+                    }
+                }
+                if (carry) {
+                    BDIGIT mask = BDIGMAX;
+                    BDIGIT bit = 1;
+                    mask <<= bits;
+                    bit <<= bits;
+                    dl &= mask;
+                    dl += bit;
+                    dl = BIGLO(dl);
+                    if (!dl) d += 1;
+                }
+            }
+            d = dl + BIGRAD*d;
+            if (lo) {
+                if (lo > INT_MAX / BITSPERDIG)
+                    d = HUGE_VAL;
+                else if (lo < INT_MIN / BITSPERDIG)
+                    d = 0.0;
+                else
+                    d = ldexp(d, (int)(lo * BITSPERDIG));
+            }
+        }
+    }
+    if (BIGNUM_NEGATIVE_P(x)) d = -d;
     return d;
 }
 
@@ -5169,30 +5337,15 @@ rb_big2dbl(VALUE x)
     double d = big2dbl(x);
 
     if (isinf(d)) {
-	rb_warning("Bignum out of Float range");
-	if (d < 0.0)
-	    d = -HUGE_VAL;
-	else
-	    d = HUGE_VAL;
+        rb_warning("Integer out of Float range");
+        if (d < 0.0)
+            d = -HUGE_VAL;
+        else
+            d = HUGE_VAL;
     }
     return d;
 }
 
-/*
- *  call-seq:
- *     big.to_f -> float
- *
- *  Converts <i>big</i> to a <code>Float</code>. If <i>big</i> doesn't
- *  fit in a <code>Float</code>, the result is infinity.
- *
- */
-
-static VALUE
-rb_big_to_f(VALUE x)
-{
-    return DBL2NUM(rb_big2dbl(x));
-}
-
 VALUE
 rb_integer_float_cmp(VALUE x, VALUE y)
 {
@@ -5243,13 +5396,22 @@ rb_integer_float_cmp(VALUE x, VALUE y)
     return INT2FIX(-1);
 }
 
+#if SIZEOF_LONG * CHAR_BIT >= DBL_MANT_DIG /* assume FLT_RADIX == 2 */
+COMPILER_WARNING_PUSH
+#if __has_warning("-Wimplicit-int-float-conversion")
+COMPILER_WARNING_IGNORED(-Wimplicit-int-float-conversion)
+#endif
+static const double LONG_MAX_as_double = LONG_MAX;
+COMPILER_WARNING_POP
+#endif
+
 VALUE
 rb_integer_float_eq(VALUE x, VALUE y)
 {
     double yd = RFLOAT_VALUE(y);
     double yi, yf;
 
-    if (isnan(yd) || isinf(yd))
+    if (!isfinite(yd))
         return Qfalse;
     yf = modf(yd, &yi);
     if (yf != 0)
@@ -5257,70 +5419,47 @@ rb_integer_float_eq(VALUE x, VALUE y)
     if (FIXNUM_P(x)) {
 #if SIZEOF_LONG * CHAR_BIT < DBL_MANT_DIG /* assume FLT_RADIX == 2 */
         double xd = (double)FIX2LONG(x);
-        if (xd != yd)
-            return Qfalse;
-        return Qtrue;
+        return RBOOL(xd == yd);
 #else
         long xn, yn;
-        if (yi < LONG_MIN || LONG_MAX < yi)
+        if (yi < LONG_MIN || LONG_MAX_as_double <= yi)
             return Qfalse;
         xn = FIX2LONG(x);
         yn = (long)yi;
-        if (xn != yn)
-            return Qfalse;
-        return Qtrue;
+        return RBOOL(xn == yn);
 #endif
     }
     y = rb_dbl2big(yi);
     return rb_big_eq(x, y);
 }
 
-/*
- *  call-seq:
- *     big <=> numeric   -> -1, 0, +1 or nil
- *
- *  Comparison---Returns -1, 0, or +1 depending on whether +big+ is
- *  less than, equal to, or greater than +numeric+. This is the
- *  basis for the tests in Comparable.
- *
- *  +nil+ is returned if the two values are incomparable.
- *
- */
 
 VALUE
 rb_big_cmp(VALUE x, VALUE y)
 {
-    int cmp;
-
     if (FIXNUM_P(y)) {
-        x = bignorm(x);
+        x = bigfixize(x);
         if (FIXNUM_P(x)) {
-            if (FIX2LONG(x) > FIX2LONG(y)) return INT2FIX(1);
-            if (FIX2LONG(x) < FIX2LONG(y)) return INT2FIX(-1);
-            return INT2FIX(0);
-        }
-        else {
-            if (BIGNUM_NEGATIVE_P(x)) return INT2FIX(-1);
-            return INT2FIX(1);
+            /* SIGNED_VALUE and Fixnum have same sign-bits, same
+             * order */
+            SIGNED_VALUE sx = (SIGNED_VALUE)x, sy = (SIGNED_VALUE)y;
+            if (sx < sy) return INT2FIX(-1);
+            return INT2FIX(sx > sy);
         }
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
+        if (BIGNUM_SIGN(x) == BIGNUM_SIGN(y)) {
+            int cmp = bary_cmp(BDIGITS(x), BIGNUM_LEN(x), BDIGITS(y), BIGNUM_LEN(y));
+            return INT2FIX(BIGNUM_SIGN(x) ? cmp : -cmp);
+        }
     }
     else if (RB_FLOAT_TYPE_P(y)) {
         return rb_integer_float_cmp(x, y);
     }
     else {
-	return rb_num_coerce_cmp(x, y, rb_intern("<=>"));
+        return rb_num_coerce_cmp(x, y, idCmp);
     }
-
-    if (BIGNUM_SIGN(x) > BIGNUM_SIGN(y)) return INT2FIX(1);
-    if (BIGNUM_SIGN(x) < BIGNUM_SIGN(y)) return INT2FIX(-1);
-
-    cmp = bary_cmp(BDIGITS(x), BIGNUM_LEN(x), BDIGITS(y), BIGNUM_LEN(y));
-    if (BIGNUM_SIGN(x))
-        return INT2FIX(cmp);
-    else
-        return INT2FIX(-cmp);
+    return INT2FIX(BIGNUM_SIGN(x) ? 1 : -1);
 }
 
 enum big_op_t {
@@ -5336,87 +5475,55 @@ big_op(VALUE x, VALUE y, enum big_op_t op)
     VALUE rel;
     int n;
 
-    if (FIXNUM_P(y) || RB_BIGNUM_TYPE_P(y)) {
-	rel = rb_big_cmp(x, y);
+    if (RB_INTEGER_TYPE_P(y)) {
+        rel = rb_big_cmp(x, y);
     }
     else if (RB_FLOAT_TYPE_P(y)) {
         rel = rb_integer_float_cmp(x, y);
     }
     else {
-	ID id = 0;
-	switch (op) {
-	  case big_op_gt: id = '>'; break;
-	  case big_op_ge: id = rb_intern(">="); break;
-	  case big_op_lt: id = '<'; break;
-	  case big_op_le: id = rb_intern("<="); break;
-	}
-	return rb_num_coerce_relop(x, y, id);
+        ID id = 0;
+        switch (op) {
+          case big_op_gt: id = '>'; break;
+          case big_op_ge: id = idGE; break;
+          case big_op_lt: id = '<'; break;
+          case big_op_le: id = idLE; break;
+        }
+        return rb_num_coerce_relop(x, y, id);
     }
 
     if (NIL_P(rel)) return Qfalse;
     n = FIX2INT(rel);
 
     switch (op) {
-	case big_op_gt: return n >  0 ? Qtrue : Qfalse;
-	case big_op_ge: return n >= 0 ? Qtrue : Qfalse;
-	case big_op_lt: return n <  0 ? Qtrue : Qfalse;
-	case big_op_le: return n <= 0 ? Qtrue : Qfalse;
+        case big_op_gt: return RBOOL(n >  0);
+        case big_op_ge: return RBOOL(n >= 0);
+        case big_op_lt: return RBOOL(n <  0);
+        case big_op_le: return RBOOL(n <= 0);
     }
     return Qundef;
 }
 
-/*
- * call-seq:
- *   big > real  ->  true or false
- *
- * Returns <code>true</code> if the value of <code>big</code> is
- * greater than that of <code>real</code>.
- */
-
-static VALUE
-big_gt(VALUE x, VALUE y)
+VALUE
+rb_big_gt(VALUE x, VALUE y)
 {
     return big_op(x, y, big_op_gt);
 }
 
-/*
- * call-seq:
- *   big >= real  ->  true or false
- *
- * Returns <code>true</code> if the value of <code>big</code> is
- * greater than or equal to that of <code>real</code>.
- */
-
-static VALUE
-big_ge(VALUE x, VALUE y)
+VALUE
+rb_big_ge(VALUE x, VALUE y)
 {
     return big_op(x, y, big_op_ge);
 }
 
-/*
- * call-seq:
- *   big < real  ->  true or false
- *
- * Returns <code>true</code> if the value of <code>big</code> is
- * less than that of <code>real</code>.
- */
-
-static VALUE
-big_lt(VALUE x, VALUE y)
+VALUE
+rb_big_lt(VALUE x, VALUE y)
 {
     return big_op(x, y, big_op_lt);
 }
 
-/*
- * call-seq:
- *   big <= real  ->  true or false
- *
- * Returns <code>true</code> if the value of <code>big</code> is
- * less than or equal to that of <code>real</code>.
- */
-
-static VALUE
-big_le(VALUE x, VALUE y)
+VALUE
+rb_big_le(VALUE x, VALUE y)
 {
     return big_op(x, y, big_op_le);
 }
@@ -5426,8 +5533,8 @@ big_le(VALUE x, VALUE y)
  *     big == obj  -> true or false
  *
  *  Returns <code>true</code> only if <i>obj</i> has the same value
- *  as <i>big</i>. Contrast this with <code>Bignum#eql?</code>, which
- *  requires <i>obj</i> to be a <code>Bignum</code>.
+ *  as <i>big</i>. Contrast this with Integer#eql?, which requires
+ *  <i>obj</i> to be an Integer.
  *
  *     68719476736 == 68719476736.0   #=> true
  */
@@ -5436,8 +5543,7 @@ VALUE
 rb_big_eq(VALUE x, VALUE y)
 {
     if (FIXNUM_P(y)) {
-	if (bignorm(x) == y) return Qtrue;
-	y = rb_int2big(FIX2LONG(y));
+        return RBOOL(bignorm(x) == y);
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
     }
@@ -5445,66 +5551,34 @@ rb_big_eq(VALUE x, VALUE y)
         return rb_integer_float_eq(x, y);
     }
     else {
-	return rb_equal(y, x);
+        return rb_equal(y, x);
     }
     if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y)) return Qfalse;
     if (BIGNUM_LEN(x) != BIGNUM_LEN(y)) return Qfalse;
-    if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) != 0) return Qfalse;
-    return Qtrue;
+    return RBOOL(MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) == 0);
 }
 
-/*
- *  call-seq:
- *     big.eql?(obj)   -> true or false
- *
- *  Returns <code>true</code> only if <i>obj</i> is a
- *  <code>Bignum</code> with the same value as <i>big</i>. Contrast this
- *  with <code>Bignum#==</code>, which performs type conversions.
- *
- *     68719476736.eql?(68719476736.0)   #=> false
- */
-
 VALUE
 rb_big_eql(VALUE x, VALUE y)
 {
     if (!RB_BIGNUM_TYPE_P(y)) return Qfalse;
     if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y)) return Qfalse;
     if (BIGNUM_LEN(x) != BIGNUM_LEN(y)) return Qfalse;
-    if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) != 0) return Qfalse;
-    return Qtrue;
+    return RBOOL(MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) == 0);
 }
 
-/*
- * call-seq:
- *    -big   ->  integer
- *
- * Unary minus (returns an integer whose value is 0-big)
- */
-
 VALUE
 rb_big_uminus(VALUE x)
 {
     VALUE z = rb_big_clone(x);
 
-    BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
+    BIGNUM_NEGATE(z);
 
     return bignorm(z);
 }
 
-/*
- * call-seq:
- *     ~big  ->  integer
- *
- * Inverts the bits in big. As Bignums are conceptually infinite
- * length, the result acts as if it had an infinite number of one
- * bits to the left. In hex representations, this is displayed
- * as two periods to the left of the digits.
- *
- *   sprintf("%X", ~0x1122334455)    #=> "..FEEDDCCBBAA"
- */
-
-static VALUE
-rb_big_neg(VALUE x)
+VALUE
+rb_big_comp(VALUE x)
 {
     VALUE z = rb_big_clone(x);
     BDIGIT *ds = BDIGITS(z);
@@ -5584,10 +5658,10 @@ bigsub_int(VALUE x, long y0)
     assert(xn == zn);
     num = (BDIGIT_DBL_SIGNED)xds[0] - y;
     if (xn == 1 && num < 0) {
-	BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
-	zds[0] = (BDIGIT)-num;
-	RB_GC_GUARD(x);
-	return bignorm(z);
+        BIGNUM_NEGATE(z);
+        zds[0] = (BDIGIT)-num;
+        RB_GC_GUARD(x);
+        return bignorm(z);
     }
     zds[0] = BIGLO(num);
     num = BIGDN(num);
@@ -5599,10 +5673,10 @@ bigsub_int(VALUE x, long y0)
     num = 0;
     for (i=0; i < xn; i++) {
         if (y == 0) goto y_is_zero_x;
-	num += (BDIGIT_DBL_SIGNED)xds[i] - BIGLO(y);
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
-	y = BIGDN(y);
+        num += (BDIGIT_DBL_SIGNED)xds[i] - BIGLO(y);
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
+        y = BIGDN(y);
     }
     for (; i < zn; i++) {
         if (y == 0) goto y_is_zero_z;
@@ -5617,9 +5691,9 @@ bigsub_int(VALUE x, long y0)
     for (; i < xn; i++) {
       y_is_zero_x:
         if (num == 0) goto num_is_zero_x;
-	num += xds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        num += xds[i];
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
 #if SIZEOF_BDIGIT < SIZEOF_LONG
     for (; i < zn; i++) {
@@ -5633,7 +5707,7 @@ bigsub_int(VALUE x, long y0)
 
     for (; i < xn; i++) {
       num_is_zero_x:
-	zds[i] = xds[i];
+        zds[i] = xds[i];
     }
 #if SIZEOF_BDIGIT < SIZEOF_LONG
     for (; i < zn; i++) {
@@ -5647,7 +5721,7 @@ bigsub_int(VALUE x, long y0)
     assert(num == 0 || num == -1);
     if (num < 0) {
         get2comp(z);
-	BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
+        BIGNUM_NEGATE(z);
     }
     RB_GC_GUARD(x);
     return bignorm(z);
@@ -5690,17 +5764,17 @@ bigadd_int(VALUE x, long y)
     num = 0;
     for (i=0; i < xn; i++) {
         if (y == 0) goto y_is_zero_x;
-	num += (BDIGIT_DBL)xds[i] + BIGLO(y);
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
-	y = BIGDN(y);
+        num += (BDIGIT_DBL)xds[i] + BIGLO(y);
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
+        y = BIGDN(y);
     }
     for (; i < zn; i++) {
         if (y == 0) goto y_is_zero_z;
-	num += BIGLO(y);
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
-	y = BIGDN(y);
+        num += BIGLO(y);
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
+        y = BIGDN(y);
     }
     goto finish;
 
@@ -5709,25 +5783,25 @@ bigadd_int(VALUE x, long y)
     for (;i < xn; i++) {
       y_is_zero_x:
         if (num == 0) goto num_is_zero_x;
-	num += (BDIGIT_DBL)xds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        num += (BDIGIT_DBL)xds[i];
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     for (; i < zn; i++) {
       y_is_zero_z:
         if (num == 0) goto num_is_zero_z;
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     goto finish;
 
     for (;i < xn; i++) {
       num_is_zero_x:
-	zds[i] = xds[i];
+        zds[i] = xds[i];
     }
     for (; i < zn; i++) {
       num_is_zero_z:
-	zds[i] = 0;
+        zds[i] = 0;
     }
     goto finish;
 
@@ -5744,15 +5818,15 @@ bigadd(VALUE x, VALUE y, int sign)
 
     sign = (sign == BIGNUM_SIGN(y));
     if (BIGNUM_SIGN(x) != sign) {
-	if (sign) return bigsub(y, x);
-	return bigsub(x, y);
+        if (sign) return bigsub(y, x);
+        return bigsub(x, y);
     }
 
     if (BIGNUM_LEN(x) > BIGNUM_LEN(y)) {
-	len = BIGNUM_LEN(x) + 1;
+        len = BIGNUM_LEN(x) + 1;
     }
     else {
-	len = BIGNUM_LEN(y) + 1;
+        len = BIGNUM_LEN(y) + 1;
     }
     z = bignew(len, sign);
 
@@ -5763,75 +5837,61 @@ bigadd(VALUE x, VALUE y, int sign)
     return z;
 }
 
-/*
- *  call-seq:
- *     big + other  -> Numeric
- *
- *  Adds big and other, returning the result.
- */
-
 VALUE
 rb_big_plus(VALUE x, VALUE y)
 {
     long n;
 
     if (FIXNUM_P(y)) {
-	n = FIX2LONG(y);
-	if ((n > 0) != BIGNUM_SIGN(x)) {
-	    if (n < 0) {
-		n = -n;
-	    }
-	    return bigsub_int(x, n);
-	}
-	if (n < 0) {
-	    n = -n;
-	}
-	return bigadd_int(x, n);
+        n = FIX2LONG(y);
+        if ((n > 0) != BIGNUM_SIGN(x)) {
+            if (n < 0) {
+                n = -n;
+            }
+            return bigsub_int(x, n);
+        }
+        if (n < 0) {
+            n = -n;
+        }
+        return bigadd_int(x, n);
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
-	return bignorm(bigadd(x, y, 1));
+        return bignorm(bigadd(x, y, 1));
     }
     else if (RB_FLOAT_TYPE_P(y)) {
-	return DBL2NUM(rb_big2dbl(x) + RFLOAT_VALUE(y));
+        return DBL2NUM(rb_big2dbl(x) + RFLOAT_VALUE(y));
     }
     else {
-	return rb_num_coerce_bin(x, y, '+');
+        return rb_num_coerce_bin(x, y, '+');
     }
 }
 
-/*
- *  call-seq:
- *     big - other  -> Numeric
- *
- *  Subtracts other from big, returning the result.
- */
-
 VALUE
 rb_big_minus(VALUE x, VALUE y)
 {
     long n;
 
     if (FIXNUM_P(y)) {
-	n = FIX2LONG(y);
-	if ((n > 0) != BIGNUM_SIGN(x)) {
-	    if (n < 0) {
-		n = -n;
-	    }
-	    return bigadd_int(x, n);
-	}
-	if (n < 0) {
-	    n = -n;
-	}
-	return bigsub_int(x, n);
+        n = FIX2LONG(y);
+        if ((n > 0) != BIGNUM_SIGN(x)) {
+            if (n < 0) {
+                n = -n;
+            }
+            return bigadd_int(x, n);
+        }
+        if (n < 0) {
+            n = -n;
+        }
+        return bigsub_int(x, n);
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
-	return bignorm(bigadd(x, y, 0));
+        return bignorm(bigadd(x, y, 0));
     }
     else if (RB_FLOAT_TYPE_P(y)) {
-	return DBL2NUM(rb_big2dbl(x) - RFLOAT_VALUE(y));
+        return DBL2NUM(rb_big2dbl(x) - RFLOAT_VALUE(y));
     }
     else {
-	return rb_num_coerce_bin(x, y, '-');
+        return rb_num_coerce_bin(x, y, '-');
     }
 }
 
@@ -5850,17 +5910,10 @@ bigsq(VALUE x)
     xds = BDIGITS(x);
     zds = BDIGITS(z);
 
-#ifdef USE_GMP
-    if (xn < GMP_MUL_DIGITS)
-        bary_sq_fast(zds, zn, xds, xn);
-    else
-        bary_mul(zds, zn, xds, xn, xds, xn);
-#else
-    if (xn < KARATSUBA_MUL_DIGITS)
+    if (xn < NAIVE_MUL_DIGITS)
         bary_sq_fast(zds, zn, xds, xn);
     else
         bary_mul(zds, zn, xds, xn, xds, xn);
-#endif
 
     RB_GC_GUARD(x);
     return z;
@@ -5893,26 +5946,19 @@ bigmul0(VALUE x, VALUE y)
     return z;
 }
 
-/*
- *  call-seq:
- *     big * other  -> Numeric
- *
- *  Multiplies big and other, returning the result.
- */
-
 VALUE
 rb_big_mul(VALUE x, VALUE y)
 {
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+        y = rb_int2big(FIX2LONG(y));
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
     }
     else if (RB_FLOAT_TYPE_P(y)) {
-	return DBL2NUM(rb_big2dbl(x) * RFLOAT_VALUE(y));
+        return DBL2NUM(rb_big2dbl(x) * RFLOAT_VALUE(y));
     }
     else {
-	return rb_num_coerce_bin(x, y, '*');
+        return rb_num_coerce_bin(x, y, '*');
     }
 
     return bignorm(bigmul0(x, y));
@@ -5939,21 +5985,21 @@ bigdivrem(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp)
     BARY_TRUNC(xds, xn);
 
     if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1])) {
-	if (divp) *divp = rb_int2big(0);
-	if (modp) *modp = x;
-	return Qnil;
+        if (divp) *divp = rb_int2big(0);
+        if (modp) *modp = x;
+        return Qnil;
     }
     if (yn == 1) {
-	dd = yds[0];
-	z = bignew(xn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
-	zds = BDIGITS(z);
+        dd = yds[0];
+        z = bignew(xn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+        zds = BDIGITS(z);
         dd = bigdivrem_single(zds, xds, xn, dd);
-	if (modp) {
-	    *modp = rb_uint2big((VALUE)dd);
-	    BIGNUM_SET_SIGN(*modp, BIGNUM_SIGN(x));
-	}
-	if (divp) *divp = z;
-	return Qnil;
+        if (modp) {
+            *modp = rb_uint2big((uintptr_t)dd);
+            BIGNUM_SET_SIGN(*modp, BIGNUM_SIGN(x));
+        }
+        if (divp) *divp = z;
+        return Qnil;
     }
     if (xn == 2 && yn == 2) {
         BDIGIT_DBL x0 = bary2bdigitdbl(xds, 2);
@@ -6018,11 +6064,11 @@ bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp)
 
     bigdivrem(x, y, divp, &mod);
     if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y) && !BIGZEROP(mod)) {
-	if (divp) *divp = bigadd(*divp, rb_int2big(1), 0);
-	if (modp) *modp = bigadd(mod, y, 1);
+        if (divp) *divp = bigadd(*divp, rb_int2big(1), 0);
+        if (modp) *modp = bigadd(mod, y, 1);
     }
     else if (modp) {
-	*modp = mod;
+        *modp = mod;
     }
 }
 
@@ -6033,123 +6079,85 @@ rb_big_divide(VALUE x, VALUE y, ID op)
     VALUE z;
 
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+        y = rb_int2big(FIX2LONG(y));
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
     }
     else if (RB_FLOAT_TYPE_P(y)) {
-	if (op == '/') {
-	    return DBL2NUM(rb_big2dbl(x) / RFLOAT_VALUE(y));
-	}
-	else {
-	    double dy = RFLOAT_VALUE(y);
-	    if (dy == 0.0) rb_num_zerodiv();
-	    return rb_dbl2big(rb_big2dbl(x) / dy);
-	}
+        if (op == '/') {
+            double dx = rb_big2dbl(x);
+            return rb_flo_div_flo(DBL2NUM(dx), y);
+        }
+        else {
+            VALUE v;
+            double dy = RFLOAT_VALUE(y);
+            if (dy == 0.0) rb_num_zerodiv();
+            v = rb_big_divide(x, y, '/');
+            return rb_dbl2big(RFLOAT_VALUE(v));
+        }
     }
     else {
-	return rb_num_coerce_bin(x, y, op);
+        return rb_num_coerce_bin(x, y, op);
     }
     bigdivmod(x, y, &z, 0);
 
     return bignorm(z);
 }
 
-/*
- *  call-seq:
- *     big / other     -> Numeric
- *
- * Performs division: the class of the resulting object depends on
- * the class of <code>numeric</code> and on the magnitude of the
- * result.
- */
-
 VALUE
 rb_big_div(VALUE x, VALUE y)
 {
     return rb_big_divide(x, y, '/');
 }
 
-/*
- *  call-seq:
- *     big.div(other)  -> integer
- *
- * Performs integer division: returns integer value.
- */
-
 VALUE
 rb_big_idiv(VALUE x, VALUE y)
 {
-    return rb_big_divide(x, y, rb_intern("div"));
+    return rb_big_divide(x, y, idDiv);
 }
 
-/*
- *  call-seq:
- *     big % other         -> Numeric
- *     big.modulo(other)   -> Numeric
- *
- *  Returns big modulo other. See Numeric.divmod for more
- *  information.
- */
-
 VALUE
 rb_big_modulo(VALUE x, VALUE y)
 {
     VALUE z;
 
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+        y = rb_int2big(FIX2LONG(y));
     }
     else if (!RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bin(x, y, '%');
+        return rb_num_coerce_bin(x, y, '%');
     }
     bigdivmod(x, y, 0, &z);
 
     return bignorm(z);
 }
 
-/*
- *  call-seq:
- *     big.remainder(numeric)    -> number
- *
- *  Returns the remainder after dividing <i>big</i> by <i>numeric</i>.
- *
- *     -1234567890987654321.remainder(13731)      #=> -6966
- *     -1234567890987654321.remainder(13731.24)   #=> -9906.22531493148
- */
-static VALUE
+VALUE
 rb_big_remainder(VALUE x, VALUE y)
 {
     VALUE z;
 
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+        y = rb_int2big(FIX2LONG(y));
     }
     else if (!RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bin(x, y, rb_intern("remainder"));
+        return rb_num_coerce_bin(x, y, rb_intern("remainder"));
     }
     bigdivrem(x, y, 0, &z);
 
     return bignorm(z);
 }
 
-/*
- *  call-seq:
- *     big.divmod(numeric)   -> array
- *
- *  See <code>Numeric#divmod</code>.
- *
- */
 VALUE
 rb_big_divmod(VALUE x, VALUE y)
 {
     VALUE div, mod;
 
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+        y = rb_int2big(FIX2LONG(y));
     }
     else if (!RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bin(x, y, rb_intern("divmod"));
+        return rb_num_coerce_bin(x, y, idDivmod);
     }
     bigdivmod(x, y, &div, &mod);
 
@@ -6160,16 +6168,17 @@ static VALUE
 big_shift(VALUE x, long n)
 {
     if (n < 0)
-	return big_lshift(x, 1+(unsigned long)(-(n+1)));
+        return big_lshift(x, 1+(unsigned long)(-(n+1)));
     else if (n > 0)
-	return big_rshift(x, (unsigned long)n);
+        return big_rshift(x, (unsigned long)n);
     return x;
 }
 
-static VALUE
+enum {DBL_BIGDIG = ((DBL_MANT_DIG + BITSPERDIG) / BITSPERDIG)};
+
+static double
 big_fdiv(VALUE x, VALUE y, long ey)
 {
-#define DBL_BIGDIG ((DBL_MANT_DIG + BITSPERDIG) / BITSPERDIG)
     VALUE z;
     long l, ex;
 
@@ -6177,21 +6186,23 @@ big_fdiv(VALUE x, VALUE y, long ey)
     l = BIGNUM_LEN(x);
     ex = l * BITSPERDIG - nlz(BDIGITS(x)[l-1]);
     ex -= 2 * DBL_BIGDIG * BITSPERDIG;
+    if (ex > BITSPERDIG) ex -= BITSPERDIG;
+    else if (ex > 0) ex = 0;
     if (ex) x = big_shift(x, ex);
 
     bigdivrem(x, y, &z, 0);
     l = ex - ey;
 #if SIZEOF_LONG > SIZEOF_INT
     {
-	/* Visual C++ can't be here */
-	if (l > INT_MAX) return DBL2NUM(INFINITY);
-	if (l < INT_MIN) return DBL2NUM(0.0);
+        /* Visual C++ can't be here */
+        if (l > INT_MAX) return HUGE_VAL;
+        if (l < INT_MIN) return 0.0;
     }
 #endif
-    return DBL2NUM(ldexp(big2dbl(z), (int)l));
+    return ldexp(big2dbl(z), (int)l);
 }
 
-static VALUE
+static double
 big_fdiv_int(VALUE x, VALUE y)
 {
     long l, ey;
@@ -6203,7 +6214,7 @@ big_fdiv_int(VALUE x, VALUE y)
     return big_fdiv(x, y, ey);
 }
 
-static VALUE
+static double
 big_fdiv_float(VALUE x, VALUE y)
 {
     int i;
@@ -6211,60 +6222,40 @@ big_fdiv_float(VALUE x, VALUE y)
     return big_fdiv(x, y, i - DBL_MANT_DIG);
 }
 
-/*
- *  call-seq:
-  *     big.fdiv(numeric) -> float
- *
- *  Returns the floating point result of dividing <i>big</i> by
- *  <i>numeric</i>.
- *
- *     -1234567890987654321.fdiv(13731)      #=> -89910996357705.5
- *     -1234567890987654321.fdiv(13731.24)   #=> -89909424858035.7
- *
- */
-
-
-VALUE
-rb_big_fdiv(VALUE x, VALUE y)
+double
+rb_big_fdiv_double(VALUE x, VALUE y)
 {
     double dx, dy;
+    VALUE v;
 
     dx = big2dbl(x);
     if (FIXNUM_P(y)) {
-	dy = (double)FIX2LONG(y);
-	if (isinf(dx))
-	    return big_fdiv_int(x, rb_int2big(FIX2LONG(y)));
+        dy = (double)FIX2LONG(y);
+        if (isinf(dx))
+            return big_fdiv_int(x, rb_int2big(FIX2LONG(y)));
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
-	dy = rb_big2dbl(y);
-	if (isinf(dx) || isinf(dy))
-	    return big_fdiv_int(x, y);
+        return big_fdiv_int(x, y);
     }
     else if (RB_FLOAT_TYPE_P(y)) {
-	dy = RFLOAT_VALUE(y);
-	if (isnan(dy))
-	    return y;
-	if (isinf(dx))
-	    return big_fdiv_float(x, y);
+        dy = RFLOAT_VALUE(y);
+        if (isnan(dy))
+            return dy;
+        if (isinf(dx))
+            return big_fdiv_float(x, y);
     }
     else {
-	return rb_num_coerce_bin(x, y, rb_intern("fdiv"));
+        return NUM2DBL(rb_num_coerce_bin(x, y, idFdiv));
     }
-    return DBL2NUM(dx / dy);
+    v = rb_flo_div_flo(DBL2NUM(dx), DBL2NUM(dy));
+    return NUM2DBL(v);
 }
 
-/*
- *  call-seq:
- *     big ** exponent   -> numeric
- *
- *  Raises _big_ to the _exponent_ power (which may be an integer, float,
- *  or anything that will coerce to a number). The result may be
- *  a Fixnum, Bignum, or Float
- *
- *    123456789 ** 2      #=> 15241578750190521
- *    123456789 ** 1.2    #=> 5126464716.09932
- *    123456789 ** -2     #=> 6.5610001194102e-17
- */
+VALUE
+rb_big_fdiv(VALUE x, VALUE y)
+{
+    return DBL2NUM(rb_big_fdiv_double(x, y));
+}
 
 VALUE
 rb_big_pow(VALUE x, VALUE y)
@@ -6274,48 +6265,55 @@ rb_big_pow(VALUE x, VALUE y)
 
   again:
     if (y == INT2FIX(0)) return INT2FIX(1);
+    if (y == INT2FIX(1)) return x;
     if (RB_FLOAT_TYPE_P(y)) {
-	d = RFLOAT_VALUE(y);
-	if ((!BIGNUM_SIGN(x) && !BIGZEROP(x)) && d != round(d))
-	    return rb_funcall(rb_complex_raw1(x), rb_intern("**"), 1, y);
+        d = RFLOAT_VALUE(y);
+        if ((BIGNUM_NEGATIVE_P(x) && !BIGZEROP(x))) {
+            return rb_dbl_complex_new_polar_pi(pow(-rb_big2dbl(x), d), d);
+        }
     }
     else if (RB_BIGNUM_TYPE_P(y)) {
-	y = bignorm(y);
-	if (FIXNUM_P(y))
-	    goto again;
-	rb_warn("in a**b, b may be too big");
-	d = rb_big2dbl(y);
+        y = bignorm(y);
+        if (FIXNUM_P(y))
+            goto again;
+        rb_warn("in a**b, b may be too big");
+        d = rb_big2dbl(y);
     }
     else if (FIXNUM_P(y)) {
-	yy = FIX2LONG(y);
+        yy = FIX2LONG(y);
 
-	if (yy < 0)
-	    return rb_funcall(rb_rational_raw1(x), rb_intern("**"), 1, y);
-	else {
-	    VALUE z = 0;
-	    SIGNED_VALUE mask;
+        if (yy < 0) {
+            x = rb_big_pow(x, LONG2NUM(-yy));
+            if (RB_INTEGER_TYPE_P(x))
+                return rb_rational_raw(INT2FIX(1), x);
+            else
+                return DBL2NUM(1.0 / NUM2DBL(x));
+        }
+        else {
+            VALUE z = 0;
+            SIGNED_VALUE mask;
             const size_t xbits = rb_absint_numwords(x, 1, NULL);
-	    const size_t BIGLEN_LIMIT = 32*1024*1024;
+            const size_t BIGLEN_LIMIT = 32*1024*1024;
 
-	    if (xbits == (size_t)-1 ||
+            if (xbits == (size_t)-1 ||
                 (xbits > BIGLEN_LIMIT) ||
                 (xbits * yy > BIGLEN_LIMIT)) {
-		rb_warn("in a**b, b may be too big");
-		d = (double)yy;
-	    }
-	    else {
-		for (mask = FIXNUM_MAX + 1; mask; mask >>= 1) {
-		    if (z) z = bigsq(z);
-		    if (yy & mask) {
-			z = z ? bigtrunc(bigmul0(z, x)) : x;
-		    }
-		}
-		return bignorm(z);
-	    }
-	}
+                rb_warn("in a**b, b may be too big");
+                d = (double)yy;
+            }
+            else {
+                for (mask = FIXNUM_MAX + 1; mask; mask >>= 1) {
+                    if (z) z = bigsq(z);
+                    if (yy & mask) {
+                        z = z ? bigtrunc(bigmul0(z, x)) : x;
+                    }
+                }
+                return bignorm(z);
+            }
+        }
     }
     else {
-	return rb_num_coerce_bin(x, y, rb_intern("**"));
+        return rb_num_coerce_bin(x, y, idPow);
     }
     return DBL2NUM(pow(rb_big2dbl(x), d));
 }
@@ -6335,8 +6333,8 @@ bigand_int(VALUE x, long xn, BDIGIT hibitsx, long y)
     xds = BDIGITS(x);
 #if SIZEOF_BDIGIT >= SIZEOF_LONG
     if (!hibitsy) {
-	y &= xds[0];
-	return LONG2NUM(y);
+        y &= xds[0];
+        return LONG2NUM(y);
     }
 #endif
 
@@ -6365,23 +6363,16 @@ bigand_int(VALUE x, long xn, BDIGIT hibitsx, long y)
     }
 #endif
     for (;i < xn; i++) {
-	zds[i] = xds[i] & hibitsy;
+        zds[i] = xds[i] & hibitsy;
     }
     for (;i < zn; i++) {
-	zds[i] = hibitsx & hibitsy;
+        zds[i] = hibitsx & hibitsy;
     }
     twocomp2abs_bang(z, hibitsx && hibitsy);
     RB_GC_GUARD(x);
     return bignorm(z);
 }
 
-/*
- * call-seq:
- *     big & numeric   ->  integer
- *
- * Performs bitwise +and+ between _big_ and _numeric_.
- */
-
 VALUE
 rb_big_and(VALUE x, VALUE y)
 {
@@ -6394,13 +6385,13 @@ rb_big_and(VALUE x, VALUE y)
     BDIGIT tmph;
     long tmpn;
 
-    if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bit(x, y, '&');
+    if (!RB_INTEGER_TYPE_P(y)) {
+        return rb_num_coerce_bit(x, y, '&');
     }
 
     hibitsx = abs2twocomp(&x, &xn);
     if (FIXNUM_P(y)) {
-	return bigand_int(x, xn, hibitsx, FIX2LONG(y));
+        return bigand_int(x, xn, hibitsx, FIX2LONG(y));
     }
     hibitsy = abs2twocomp(&y, &yn);
     if (xn > yn) {
@@ -6422,10 +6413,10 @@ rb_big_and(VALUE x, VALUE y)
     zds = BDIGITS(z);
 
     for (i=0; i<n1; i++) {
-	zds[i] = ds1[i] & ds2[i];
+        zds[i] = ds1[i] & ds2[i];
     }
     for (; i<n2; i++) {
-	zds[i] = hibits1 & ds2[i];
+        zds[i] = hibits1 & ds2[i];
     }
     twocomp2abs_bang(z, hibits1 && hibits2);
     RB_GC_GUARD(x);
@@ -6501,13 +6492,6 @@ bigor_int(VALUE x, long xn, BDIGIT hibitsx, long y)
     return bignorm(z);
 }
 
-/*
- * call-seq:
- *     big | numeric   ->  integer
- *
- * Performs bitwise +or+ between _big_ and _numeric_.
- */
-
 VALUE
 rb_big_or(VALUE x, VALUE y)
 {
@@ -6520,13 +6504,13 @@ rb_big_or(VALUE x, VALUE y)
     BDIGIT tmph;
     long tmpn;
 
-    if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bit(x, y, '|');
+    if (!RB_INTEGER_TYPE_P(y)) {
+        return rb_num_coerce_bit(x, y, '|');
     }
 
     hibitsx = abs2twocomp(&x, &xn);
     if (FIXNUM_P(y)) {
-	return bigor_int(x, xn, hibitsx, FIX2LONG(y));
+        return bigor_int(x, xn, hibitsx, FIX2LONG(y));
     }
     hibitsy = abs2twocomp(&y, &yn);
     if (xn > yn) {
@@ -6548,10 +6532,10 @@ rb_big_or(VALUE x, VALUE y)
     zds = BDIGITS(z);
 
     for (i=0; i<n1; i++) {
-	zds[i] = ds1[i] | ds2[i];
+        zds[i] = ds1[i] | ds2[i];
     }
     for (; i<n2; i++) {
-	zds[i] = hibits1 | ds2[i];
+        zds[i] = hibits1 | ds2[i];
     }
     twocomp2abs_bang(z, hibits1 || hibits2);
     RB_GC_GUARD(x);
@@ -6601,12 +6585,6 @@ bigxor_int(VALUE x, long xn, BDIGIT hibitsx, long y)
     RB_GC_GUARD(x);
     return bignorm(z);
 }
-/*
- * call-seq:
- *     big ^ numeric   ->  integer
- *
- * Performs bitwise +exclusive or+ between _big_ and _numeric_.
- */
 
 VALUE
 rb_big_xor(VALUE x, VALUE y)
@@ -6620,13 +6598,13 @@ rb_big_xor(VALUE x, VALUE y)
     BDIGIT tmph;
     long tmpn;
 
-    if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bit(x, y, '^');
+    if (!RB_INTEGER_TYPE_P(y)) {
+        return rb_num_coerce_bit(x, y, '^');
     }
 
     hibitsx = abs2twocomp(&x, &xn);
     if (FIXNUM_P(y)) {
-	return bigxor_int(x, xn, hibitsx, FIX2LONG(y));
+        return bigxor_int(x, xn, hibitsx, FIX2LONG(y));
     }
     hibitsy = abs2twocomp(&y, &yn);
     if (xn > yn) {
@@ -6645,10 +6623,10 @@ rb_big_xor(VALUE x, VALUE y)
     zds = BDIGITS(z);
 
     for (i=0; i<n1; i++) {
-	zds[i] = ds1[i] ^ ds2[i];
+        zds[i] = ds1[i] ^ ds2[i];
     }
     for (; i<n2; i++) {
-	zds[i] = hibitsx ^ ds2[i];
+        zds[i] = hibitsx ^ ds2[i];
     }
     twocomp2abs_bang(z, (hibits1 ^ hibits2) != 0);
     RB_GC_GUARD(x);
@@ -6656,13 +6634,6 @@ rb_big_xor(VALUE x, VALUE y)
     return bignorm(z);
 }
 
-/*
- * call-seq:
- *     big << numeric   ->  integer
- *
- * Shifts big left _numeric_ positions (right if _numeric_ is negative).
- */
-
 VALUE
 rb_big_lshift(VALUE x, VALUE y)
 {
@@ -6671,36 +6642,28 @@ rb_big_lshift(VALUE x, VALUE y)
     int shift_numbits;
 
     for (;;) {
-	if (FIXNUM_P(y)) {
-	    long l = FIX2LONG(y);
+        if (FIXNUM_P(y)) {
+            long l = FIX2LONG(y);
             unsigned long shift;
-	    if (0 <= l) {
-		lshift_p = 1;
+            if (0 <= l) {
+                lshift_p = 1;
                 shift = l;
             }
             else {
-		lshift_p = 0;
-		shift = 1+(unsigned long)(-(l+1));
-	    }
+                lshift_p = 0;
+                shift = 1+(unsigned long)(-(l+1));
+            }
             shift_numbits = (int)(shift & (BITSPERDIG-1));
             shift_numdigits = shift >> bit_length(BITSPERDIG-1);
             return bignorm(big_shift3(x, lshift_p, shift_numdigits, shift_numbits));
-	}
-	else if (RB_BIGNUM_TYPE_P(y)) {
+        }
+        else if (RB_BIGNUM_TYPE_P(y)) {
             return bignorm(big_shift2(x, 1, y));
-	}
-	y = rb_to_int(y);
+        }
+        y = rb_to_int(y);
     }
 }
 
-
-/*
- * call-seq:
- *     big >> numeric   ->  integer
- *
- * Shifts big right _numeric_ positions (left if _numeric_ is negative).
- */
-
 VALUE
 rb_big_rshift(VALUE x, VALUE y)
 {
@@ -6709,8 +6672,8 @@ rb_big_rshift(VALUE x, VALUE y)
     int shift_numbits;
 
     for (;;) {
-	if (FIXNUM_P(y)) {
-	    long l = FIX2LONG(y);
+        if (FIXNUM_P(y)) {
+            long l = FIX2LONG(y);
             unsigned long shift;
             if (0 <= l) {
                 lshift_p = 0;
@@ -6718,39 +6681,20 @@ rb_big_rshift(VALUE x, VALUE y)
             }
             else {
                 lshift_p = 1;
-		shift = 1+(unsigned long)(-(l+1));
-	    }
+                shift = 1+(unsigned long)(-(l+1));
+            }
             shift_numbits = (int)(shift & (BITSPERDIG-1));
             shift_numdigits = shift >> bit_length(BITSPERDIG-1);
             return bignorm(big_shift3(x, lshift_p, shift_numdigits, shift_numbits));
-	}
-	else if (RB_BIGNUM_TYPE_P(y)) {
+        }
+        else if (RB_BIGNUM_TYPE_P(y)) {
             return bignorm(big_shift2(x, 0, y));
-	}
-	y = rb_to_int(y);
+        }
+        y = rb_to_int(y);
     }
 }
 
-/*
- *  call-seq:
- *     big[n] -> 0, 1
- *
- *  Bit Reference---Returns the <em>n</em>th bit in the (assumed) binary
- *  representation of <i>big</i>, where <i>big</i>[0] is the least
- *  significant bit.
- *
- *     a = 9**15
- *     50.downto(0) do |n|
- *       print a[n]
- *     end
- *
- *  <em>produces:</em>
- *
- *     000101110110100000111000011110010100111100010111001
- *
- */
-
-static VALUE
+VALUE
 rb_big_aref(VALUE x, VALUE y)
 {
     BDIGIT *xds;
@@ -6760,29 +6704,29 @@ rb_big_aref(VALUE x, VALUE y)
     BDIGIT bit;
 
     if (RB_BIGNUM_TYPE_P(y)) {
-	if (!BIGNUM_SIGN(y))
-	    return INT2FIX(0);
-	bigtrunc(y);
-	if (BIGSIZE(y) > sizeof(size_t)) {
-	  out_of_range:
-	    return BIGNUM_SIGN(x) ? INT2FIX(0) : INT2FIX(1);
-	}
+        if (BIGNUM_NEGATIVE_P(y))
+            return INT2FIX(0);
+        bigtrunc(y);
+        if (BIGSIZE(y) > sizeof(size_t)) {
+            return BIGNUM_SIGN(x) ? INT2FIX(0) : INT2FIX(1);
+        }
 #if SIZEOF_SIZE_T <= SIZEOF_LONG
-	shift = big2ulong(y, "long");
+        shift = big2ulong(y, "long");
 #else
-	shift = big2ull(y, "long long");
+        shift = big2ull(y, "long long");
 #endif
     }
     else {
-	l = NUM2LONG(y);
-	if (l < 0) return INT2FIX(0);
-	shift = (size_t)l;
+        l = NUM2LONG(y);
+        if (l < 0) return INT2FIX(0);
+        shift = (size_t)l;
     }
     s1 = shift/BITSPERDIG;
     s2 = shift%BITSPERDIG;
     bit = (BDIGIT)1 << s2;
 
-    if (s1 >= BIGNUM_LEN(x)) goto out_of_range;
+    if (s1 >= BIGNUM_LEN(x))
+        return BIGNUM_SIGN(x) ? INT2FIX(0) : INT2FIX(1);
 
     xds = BDIGITS(x);
     if (BIGNUM_POSITIVE_P(x))
@@ -6795,128 +6739,72 @@ rb_big_aref(VALUE x, VALUE y)
     return (xds[s1] & bit) ? INT2FIX(1) : INT2FIX(0);
 }
 
-/*
- * call-seq:
- *   big.hash   -> fixnum
- *
- * Compute a hash based on the value of _big_.
- *
- * See also Object#hash.
- */
-
-static VALUE
+VALUE
 rb_big_hash(VALUE x)
 {
     st_index_t hash;
 
     hash = rb_memhash(BDIGITS(x), sizeof(BDIGIT)*BIGNUM_LEN(x)) ^ BIGNUM_SIGN(x);
-    return INT2FIX(hash);
+    return ST2FIX(hash);
 }
 
 /*
  * call-seq:
- *   big.coerce(numeric)  ->  array
+ *   int.coerce(numeric)  ->  array
  *
- * Returns an array with both a +numeric+ and a +big+ represented as Bignum
- * objects.
+ * Returns an array with both a +numeric+ and a +int+ represented as
+ * Integer objects or Float objects.
  *
- * This is achieved by converting +numeric+ to a Bignum.
+ * This is achieved by converting +numeric+ to an Integer or a Float.
  *
- * A TypeError is raised if the +numeric+ is not a Fixnum or Bignum type.
+ * A TypeError is raised if the +numeric+ is not an Integer or a Float
+ * type.
  *
  *     (0x3FFFFFFFFFFFFFFF+1).coerce(42)   #=> [42, 4611686018427387904]
  */
 
 static VALUE
-rb_big_coerce(VALUE x, VALUE y)
+rb_int_coerce(VALUE x, VALUE y)
 {
-    if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+    if (RB_INTEGER_TYPE_P(y)) {
+        return rb_assoc_new(y, x);
     }
-    else if (!RB_BIGNUM_TYPE_P(y)) {
-	rb_raise(rb_eTypeError, "can't coerce %s to Bignum",
-		 rb_obj_classname(y));
+    else {
+        x = rb_Float(x);
+        y = rb_Float(y);
+        return rb_assoc_new(y, x);
     }
-    return rb_assoc_new(y, x);
 }
 
-/*
- *  call-seq:
- *     big.abs -> aBignum
- *     big.magnitude -> aBignum
- *
- *  Returns the absolute value of <i>big</i>.
- *
- *     -1234567890987654321.abs   #=> 1234567890987654321
- */
-
-static VALUE
+VALUE
 rb_big_abs(VALUE x)
 {
-    if (!BIGNUM_SIGN(x)) {
-	x = rb_big_clone(x);
-	BIGNUM_SET_SIGN(x, 1);
+    if (BIGNUM_NEGATIVE_P(x)) {
+        x = rb_big_clone(x);
+        BIGNUM_SET_POSITIVE_SIGN(x);
     }
     return x;
 }
 
-/*
- *  call-seq:
- *     big.size -> integer
- *
- *  Returns the number of bytes in the machine representation of
- *  <i>big</i>.
- *
- *     (256**10 - 1).size   #=> 12
- *     (256**20 - 1).size   #=> 20
- *     (256**40 - 1).size   #=> 40
- */
+int
+rb_big_sign(VALUE x)
+{
+    return BIGNUM_SIGN(x);
+}
 
-static VALUE
+size_t
 rb_big_size(VALUE big)
 {
-    return SIZET2NUM(BIGSIZE(big));
+    return BIGSIZE(big);
 }
 
-/*
- *  call-seq:
- *     int.bit_length -> integer
- *
- *  Returns the number of bits of the value of <i>int</i>.
- *
- *  "the number of bits" means that
- *  the bit position of the highest bit which is different to the sign bit.
- *  (The bit position of the bit 2**n is n+1.)
- *  If there is no such bit (zero or minus one), zero is returned.
- *
- *  I.e. This method returns ceil(log2(int < 0 ? -int : int+1)).
- *
- *     (-2**10000-1).bit_length  #=> 10001
- *     (-2**10000).bit_length    #=> 10000
- *     (-2**10000+1).bit_length  #=> 10000
- *
- *     (-2**1000-1).bit_length   #=> 1001
- *     (-2**1000).bit_length     #=> 1000
- *     (-2**1000+1).bit_length   #=> 1000
- *
- *     (2**1000-1).bit_length    #=> 1000
- *     (2**1000).bit_length      #=> 1001
- *     (2**1000+1).bit_length    #=> 1001
- *
- *     (2**10000-1).bit_length   #=> 10000
- *     (2**10000).bit_length     #=> 10001
- *     (2**10000+1).bit_length   #=> 10001
- *
- *  This method can be used to detect overflow in Array#pack as follows.
- *
- *     if n.bit_length < 32
- *       [n].pack("l") # no overflow
- *     else
- *       raise "overflow"
- *     end
- */
+VALUE
+rb_big_size_m(VALUE big)
+{
+    return SIZET2NUM(rb_big_size(big));
+}
 
-static VALUE
+VALUE
 rb_big_bit_length(VALUE big)
 {
     int nlz_bits;
@@ -6957,36 +6845,328 @@ rb_big_bit_length(VALUE big)
             INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER);
 }
 
+VALUE
+rb_big_odd_p(VALUE num)
+{
+    return RBOOL(BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1);
+}
+
+VALUE
+rb_big_even_p(VALUE num)
+{
+    if (BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1) {
+        return Qfalse;
+    }
+    return Qtrue;
+}
+
+unsigned long rb_ulong_isqrt(unsigned long);
+#if SIZEOF_BDIGIT*2 > SIZEOF_LONG
+BDIGIT rb_bdigit_dbl_isqrt(BDIGIT_DBL);
+# ifdef ULL_TO_DOUBLE
+#   define BDIGIT_DBL_TO_DOUBLE(n) ULL_TO_DOUBLE(n)
+# endif
+#else
+# define rb_bdigit_dbl_isqrt(x) (BDIGIT)rb_ulong_isqrt(x)
+#endif
+#ifndef BDIGIT_DBL_TO_DOUBLE
+# define BDIGIT_DBL_TO_DOUBLE(n) (double)(n)
+#endif
+
+static BDIGIT *
+estimate_initial_sqrt(VALUE *xp, const size_t xn, const BDIGIT *nds, size_t len)
+{
+    enum {dbl_per_bdig = roomof(DBL_MANT_DIG,BITSPERDIG)};
+    const int zbits = nlz(nds[len-1]);
+    VALUE x = *xp = bignew_1(0, xn, 1); /* division may release the GVL */
+    BDIGIT *xds = BDIGITS(x);
+    BDIGIT_DBL d = bary2bdigitdbl(nds+len-dbl_per_bdig, dbl_per_bdig);
+    BDIGIT lowbits = 1;
+    int rshift = (int)((BITSPERDIG*2-zbits+(len&BITSPERDIG&1) - DBL_MANT_DIG + 1) & ~1);
+    double f;
+
+    if (rshift > 0) {
+        lowbits = (BDIGIT)d & ~(~(BDIGIT)1U << rshift);
+        d >>= rshift;
+    }
+    else if (rshift < 0) {
+        d <<= -rshift;
+        d |= nds[len-dbl_per_bdig-1] >> (BITSPERDIG+rshift);
+    }
+    f = sqrt(BDIGIT_DBL_TO_DOUBLE(d));
+    d = (BDIGIT_DBL)ceil(f);
+    if (BDIGIT_DBL_TO_DOUBLE(d) == f) {
+        if (lowbits || (lowbits = !bary_zero_p(nds, len-dbl_per_bdig)))
+            ++d;
+    }
+    else {
+        lowbits = 1;
+    }
+    rshift /= 2;
+    rshift += (2-(len&1))*BITSPERDIG/2;
+    if (rshift >= 0) {
+        if (nlz((BDIGIT)d) + rshift >= BITSPERDIG) {
+            /* (d << rshift) does cause overflow.
+             * example: Integer.sqrt(0xffff_ffff_ffff_ffff ** 2)
+             */
+            d = ~(BDIGIT_DBL)0;
+        }
+        else {
+            d <<= rshift;
+        }
+    }
+    BDIGITS_ZERO(xds, xn-2);
+    bdigitdbl2bary(&xds[xn-2], 2, d);
+
+    if (!lowbits) return NULL; /* special case, exact result */
+    return xds;
+}
+
+VALUE
+rb_big_isqrt(VALUE n)
+{
+    BDIGIT *nds = BDIGITS(n);
+    size_t len = BIGNUM_LEN(n);
+    size_t xn = (len+1) / 2;
+    VALUE x;
+    BDIGIT *xds;
+
+    if (len <= 2) {
+        BDIGIT sq = rb_bdigit_dbl_isqrt(bary2bdigitdbl(nds, len));
+#if SIZEOF_BDIGIT > SIZEOF_LONG
+        return ULL2NUM(sq);
+#else
+        return ULONG2NUM(sq);
+#endif
+    }
+    else if ((xds = estimate_initial_sqrt(&x, xn, nds, len)) != 0) {
+        size_t tn = xn + BIGDIVREM_EXTRA_WORDS;
+        VALUE t = bignew_1(0, tn, 1);
+        BDIGIT *tds = BDIGITS(t);
+        tn = BIGNUM_LEN(t);
+
+        /* t = n/x */
+        while (bary_divmod_branch(tds, tn, NULL, 0, nds, len, xds, xn),
+               bary_cmp(tds, tn, xds, xn) < 0) {
+            int carry;
+            BARY_TRUNC(tds, tn);
+            /* x = (x+t)/2 */
+            carry = bary_add(xds, xn, xds, xn, tds, tn);
+            bary_small_rshift(xds, xds, xn, 1, carry);
+            tn = BIGNUM_LEN(t);
+        }
+    }
+    RBASIC_SET_CLASS_RAW(x, rb_cInteger);
+    return x;
+}
+
+#if USE_GMP
+static void
+bary_powm_gmp(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, const BDIGIT *mds, size_t mn)
+{
+    mpz_t z, x, y, m;
+    size_t count;
+    mpz_init(x);
+    mpz_init(y);
+    mpz_init(m);
+    mpz_init(z);
+    bdigits_to_mpz(x, xds, xn);
+    bdigits_to_mpz(y, yds, yn);
+    bdigits_to_mpz(m, mds, mn);
+    mpz_powm(z, x, y, m);
+    bdigits_from_mpz(z, zds, &count);
+    BDIGITS_ZERO(zds+count, zn-count);
+    mpz_clear(x);
+    mpz_clear(y);
+    mpz_clear(m);
+    mpz_clear(z);
+}
+#endif
+
+static VALUE
+int_pow_tmp3(VALUE x, VALUE y, VALUE m, int nega_flg)
+{
+#if USE_GMP
+    VALUE z;
+    size_t xn, yn, mn, zn;
+
+    if (FIXNUM_P(x)) {
+       x = rb_int2big(FIX2LONG(x));
+    }
+    if (FIXNUM_P(y)) {
+       y = rb_int2big(FIX2LONG(y));
+    }
+    assert(RB_BIGNUM_TYPE_P(m));
+    xn = BIGNUM_LEN(x);
+    yn = BIGNUM_LEN(y);
+    mn = BIGNUM_LEN(m);
+    zn = mn;
+    z = bignew(zn, 1);
+    bary_powm_gmp(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn, BDIGITS(m), mn);
+    if (nega_flg & BIGNUM_POSITIVE_P(z)) {
+        z = rb_big_minus(z, m);
+    }
+    RB_GC_GUARD(x);
+    RB_GC_GUARD(y);
+    RB_GC_GUARD(m);
+    return rb_big_norm(z);
+#else
+    VALUE tmp = LONG2FIX(1L);
+    long yy;
+
+    for (/*NOP*/; ! FIXNUM_P(y); y = rb_big_rshift(y, LONG2FIX(1L))) {
+        if (RTEST(rb_int_odd_p(y))) {
+            tmp = rb_int_mul(tmp, x);
+            tmp = rb_int_modulo(tmp, m);
+        }
+        x = rb_int_mul(x, x);
+        x = rb_int_modulo(x, m);
+    }
+    for (yy = FIX2LONG(y); yy; yy >>= 1L) {
+        if (yy & 1L) {
+            tmp = rb_int_mul(tmp, x);
+            tmp = rb_int_modulo(tmp, m);
+        }
+        x = rb_int_mul(x, x);
+        x = rb_int_modulo(x, m);
+    }
+
+    if (nega_flg && rb_int_positive_p(tmp)) {
+        tmp = rb_int_minus(tmp, m);
+    }
+    return tmp;
+#endif
+}
+
 /*
- *  call-seq:
- *     big.odd? -> true or false
- *
- *  Returns <code>true</code> if <i>big</i> is an odd number.
+ * Integer#pow
  */
 
 static VALUE
-rb_big_odd_p(VALUE num)
+int_pow_tmp1(VALUE x, VALUE y, long mm, int nega_flg)
 {
-    if (BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1) {
-	return Qtrue;
+    long xx = FIX2LONG(x);
+    long tmp = 1L;
+    long yy;
+
+    for (/*NOP*/; ! FIXNUM_P(y); y = rb_big_rshift(y, LONG2FIX(1L))) {
+        if (RTEST(rb_int_odd_p(y))) {
+            tmp = (tmp * xx) % mm;
+        }
+        xx = (xx * xx) % mm;
+    }
+    for (yy = FIX2LONG(y); yy; yy >>= 1L) {
+        if (yy & 1L) {
+            tmp = (tmp * xx) % mm;
+        }
+        xx = (xx * xx) % mm;
+    }
+
+    if (nega_flg && tmp) {
+        tmp -= mm;
+    }
+    return LONG2FIX(tmp);
+}
+
+static VALUE
+int_pow_tmp2(VALUE x, VALUE y, long mm, int nega_flg)
+{
+    long tmp = 1L;
+    long yy;
+#ifdef DLONG
+    const DLONG m = mm;
+    long tmp2 = tmp;
+    long xx = FIX2LONG(x);
+# define MUL_MODULO(a, b, c) (long)(((DLONG)(a) * (DLONG)(b)) % (c))
+#else
+    const VALUE m = LONG2FIX(mm);
+    VALUE tmp2 = LONG2FIX(tmp);
+    VALUE xx = x;
+# define MUL_MODULO(a, b, c) rb_int_modulo(rb_fix_mul_fix((a), (b)), (c))
+#endif
+
+    for (/*NOP*/; ! FIXNUM_P(y); y = rb_big_rshift(y, LONG2FIX(1L))) {
+        if (RTEST(rb_int_odd_p(y))) {
+            tmp2 = MUL_MODULO(tmp2, xx, m);
+        }
+        xx = MUL_MODULO(xx, xx, m);
+    }
+    for (yy = FIX2LONG(y); yy; yy >>= 1L) {
+        if (yy & 1L) {
+            tmp2 = MUL_MODULO(tmp2, xx, m);
+        }
+        xx = MUL_MODULO(xx, xx, m);
     }
-    return Qfalse;
+
+#ifdef DLONG
+    tmp = tmp2;
+#else
+    tmp = FIX2LONG(tmp2);
+#endif
+    if (nega_flg && tmp) {
+        tmp -= mm;
+    }
+    return LONG2FIX(tmp);
 }
 
 /*
- *  call-seq:
- *     big.even? -> true or false
+ * Document-method: Integer#pow
+ * call-seq:
+ *    integer.pow(numeric)           ->  numeric
+ *    integer.pow(integer, integer)  ->  integer
+ *
+ * Returns (modular) exponentiation as:
  *
- *  Returns <code>true</code> if <i>big</i> is an even number.
+ *   a.pow(b)     #=> same as a**b
+ *   a.pow(b, m)  #=> same as (a**b) % m, but avoids huge temporary values
  */
-
-static VALUE
-rb_big_even_p(VALUE num)
+VALUE
+rb_int_powm(int const argc, VALUE * const argv, VALUE const num)
 {
-    if (BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1) {
-	return Qfalse;
+    rb_check_arity(argc, 1, 2);
+
+    if (argc == 1) {
+        return rb_int_pow(num, argv[0]);
     }
-    return Qtrue;
+    else {
+        VALUE const a = num;
+        VALUE const b = argv[0];
+        VALUE m = argv[1];
+        int nega_flg = 0;
+        if ( ! RB_INTEGER_TYPE_P(b)) {
+            rb_raise(rb_eTypeError, "Integer#pow() 2nd argument not allowed unless a 1st argument is integer");
+        }
+        if (rb_int_negative_p(b)) {
+            rb_raise(rb_eRangeError, "Integer#pow() 1st argument cannot be negative when 2nd argument specified");
+        }
+        if (!RB_INTEGER_TYPE_P(m)) {
+            rb_raise(rb_eTypeError, "Integer#pow() 2nd argument not allowed unless all arguments are integers");
+        }
+
+        if (rb_int_negative_p(m)) {
+            m = rb_int_uminus(m);
+            nega_flg = 1;
+        }
+
+        if (FIXNUM_P(m)) {
+            long const half_val = (long)HALF_LONG_MSB;
+            long const mm = FIX2LONG(m);
+            if (!mm) rb_num_zerodiv();
+            if (mm == 1) return INT2FIX(0);
+            if (mm <= half_val) {
+                return int_pow_tmp1(rb_int_modulo(a, m), b, mm, nega_flg);
+            }
+            else {
+                return int_pow_tmp2(rb_int_modulo(a, m), b, mm, nega_flg);
+            }
+        }
+        else {
+            if (rb_bigzero_p(m)) rb_num_zerodiv();
+            if (bignorm(m) == INT2FIX(1)) return INT2FIX(0);
+            return int_pow_tmp3(rb_int_modulo(a, m), b, m, nega_flg);
+        }
+    }
+    UNREACHABLE_RETURN(Qnil);
 }
 
 /*
@@ -7010,51 +7190,11 @@ rb_big_even_p(VALUE num)
 void
 Init_Bignum(void)
 {
-    rb_cBignum = rb_define_class("Bignum", rb_cInteger);
-
-    rb_define_method(rb_cBignum, "to_s", rb_big_to_s, -1);
-    rb_define_alias(rb_cBignum, "inspect", "to_s");
-    rb_define_method(rb_cBignum, "coerce", rb_big_coerce, 1);
-    rb_define_method(rb_cBignum, "-@", rb_big_uminus, 0);
-    rb_define_method(rb_cBignum, "+", rb_big_plus, 1);
-    rb_define_method(rb_cBignum, "-", rb_big_minus, 1);
-    rb_define_method(rb_cBignum, "*", rb_big_mul, 1);
-    rb_define_method(rb_cBignum, "/", rb_big_div, 1);
-    rb_define_method(rb_cBignum, "%", rb_big_modulo, 1);
-    rb_define_method(rb_cBignum, "div", rb_big_idiv, 1);
-    rb_define_method(rb_cBignum, "divmod", rb_big_divmod, 1);
-    rb_define_method(rb_cBignum, "modulo", rb_big_modulo, 1);
-    rb_define_method(rb_cBignum, "remainder", rb_big_remainder, 1);
-    rb_define_method(rb_cBignum, "fdiv", rb_big_fdiv, 1);
-    rb_define_method(rb_cBignum, "**", rb_big_pow, 1);
-    rb_define_method(rb_cBignum, "&", rb_big_and, 1);
-    rb_define_method(rb_cBignum, "|", rb_big_or, 1);
-    rb_define_method(rb_cBignum, "^", rb_big_xor, 1);
-    rb_define_method(rb_cBignum, "~", rb_big_neg, 0);
-    rb_define_method(rb_cBignum, "<<", rb_big_lshift, 1);
-    rb_define_method(rb_cBignum, ">>", rb_big_rshift, 1);
-    rb_define_method(rb_cBignum, "[]", rb_big_aref, 1);
-
-    rb_define_method(rb_cBignum, "<=>", rb_big_cmp, 1);
-    rb_define_method(rb_cBignum, "==", rb_big_eq, 1);
-    rb_define_method(rb_cBignum, ">", big_gt, 1);
-    rb_define_method(rb_cBignum, ">=", big_ge, 1);
-    rb_define_method(rb_cBignum, "<", big_lt, 1);
-    rb_define_method(rb_cBignum, "<=", big_le, 1);
-    rb_define_method(rb_cBignum, "===", rb_big_eq, 1);
-    rb_define_method(rb_cBignum, "eql?", rb_big_eql, 1);
-    rb_define_method(rb_cBignum, "hash", rb_big_hash, 0);
-    rb_define_method(rb_cBignum, "to_f", rb_big_to_f, 0);
-    rb_define_method(rb_cBignum, "abs", rb_big_abs, 0);
-    rb_define_method(rb_cBignum, "magnitude", rb_big_abs, 0);
-    rb_define_method(rb_cBignum, "size", rb_big_size, 0);
-    rb_define_method(rb_cBignum, "bit_length", rb_big_bit_length, 0);
-    rb_define_method(rb_cBignum, "odd?", rb_big_odd_p, 0);
-    rb_define_method(rb_cBignum, "even?", rb_big_even_p, 0);
-
-#ifdef USE_GMP
+    rb_define_method(rb_cInteger, "coerce", rb_int_coerce, 1);
+
+#if USE_GMP
     /* The version of loaded GMP. */
-    rb_define_const(rb_cBignum, "GMP_VERSION", rb_sprintf("GMP %s", gmp_version));
+    rb_define_const(rb_cInteger, "GMP_VERSION", rb_sprintf("GMP %s", gmp_version));
 #endif
 
     power_cache_init();
diff --git a/bin/erb b/bin/erb
deleted file mode 100755
index 6a88c3b26a..0000000000
--- a/bin/erb
+++ /dev/null
@@ -1,171 +0,0 @@
-#!/usr/bin/env ruby
-# Tiny eRuby --- ERB2
-# Copyright (c) 1999-2000,2002 Masatoshi SEKI
-# You can redistribute it and/or modify it under the same terms as Ruby.
-
-require 'erb'
-
-class ERB
-  module Main
-    def ARGV.switch
-      return nil if self.empty?
-      arg = self.shift
-      return nil if arg == '--'
-      case arg
-      when /\A-(.)(.*)/
-        if $1 == '-'
-          arg, @maybe_arg = arg.split(/=/, 2)
-          return arg
-        end
-        raise 'unknown switch "-"' if $2[0] == ?- and $1 != 'T'
-        if $2.size > 0
-          self.unshift "-#{$2}"
-          @maybe_arg = $2
-        else
-          @maybe_arg = nil
-        end
-        "-#{$1}"
-      when /\A(\w+)=/
-        arg
-      else
-        self.unshift arg
-        nil
-      end
-    end
-
-    def ARGV.req_arg
-      (@maybe_arg || self.shift || raise('missing argument')).tap {
-        @maybe_arg = nil
-      }
-    end
-
-    def trim_mode_opt(trim_mode, disable_percent)
-      return trim_mode if disable_percent
-      case trim_mode
-      when 0
-        return '%'
-      when 1
-        return '%>'
-      when 2
-        return '%<>'
-      when '-'
-        return '%-'
-      end
-    end
-    module_function :trim_mode_opt
-
-    def run(factory=ERB)
-      trim_mode = 0
-      disable_percent = false
-      variables = {}
-      begin
-        while switch = ARGV.switch
-          case switch
-          when '-x'                        # ruby source
-            output = true
-          when '-n'                        # line number
-            number = true
-          when '-v'                        # verbose
-            $VERBOSE = true
-          when '--version'                 # version
-            STDERR.puts factory.version
-            exit
-          when '-d', '--debug'             # debug
-            $DEBUG = true
-          when '-r'                        # require
-            require ARGV.req_arg
-          when '-S'                        # security level
-            arg = ARGV.req_arg
-            raise "invalid safe_level #{arg.dump}" unless arg =~ /\A[0-1]\z/
-            safe_level = arg.to_i
-          when '-T'                        # trim mode
-            arg = ARGV.req_arg
-            if arg == '-'
-              trim_mode = arg
-              next
-            end
-            raise "invalid trim mode #{arg.dump}" unless arg =~ /\A[0-2]\z/
-            trim_mode = arg.to_i
-          when '-E', '--encoding'
-            arg = ARGV.req_arg
-            set_encoding(*arg.split(/:/, 2))
-          when '-U'
-            set_encoding(Encoding::UTF_8, Encoding::UTF_8)
-          when '-P'
-            disable_percent = true
-          when '--help'
-            raise "print this help"
-          when /\A-/
-            raise "unknown switch #{switch.dump}"
-          else
-            var, val = *switch.split('=', 2)
-            (variables ||= {})[var] = val
-          end
-        end
-      rescue                               # usage
-        STDERR.puts $!.to_s
-        STDERR.puts File.basename($0) +
-          " [switches] [var=value...] [inputfile]"
-        STDERR.puts <<EOU
-  -x               print ruby script
-  -n               print ruby script with line number
-  -v               enable verbose mode
-  -d               set $DEBUG to true
-  -r library       load a library
-  -S safe_level    set $SAFE (0..1)
-  -E ex[:in]       set default external/internal encodings
-  -U               set default encoding to UTF-8.
-  -T trim_mode     specify trim_mode (0..2, -)
-  -P               ignore lines which start with "%"
-  var=value        set variable
-EOU
-        exit 1
-      end
-
-      $<.set_encoding(Encoding::ASCII_8BIT, nil)
-      src = $<.read
-      filename = $FILENAME
-      exit 2 unless src
-      trim = trim_mode_opt(trim_mode, disable_percent)
-      erb = factory.new(src.untaint, safe_level, trim)
-      erb.filename = filename
-      if output
-        if number
-          erb.src.each_line.with_index do |line, l|
-            puts "%3d %s"%[l+1, line]
-          end
-        else
-          puts erb.src
-        end
-      else
-        bind = TOPLEVEL_BINDING.taint
-        if variables
-          enc = erb.encoding
-          for var, val in variables do
-            val = val.encode(enc) if val
-            bind.local_variable_set(var, val)
-          end
-        end
-        erb.run(bind)
-      end
-    end
-    module_function :run
-
-    def set_encoding(extern, intern = nil)
-      verbose, $VERBOSE = $VERBOSE, nil
-      Encoding.default_external = extern unless extern.nil? || extern == ""
-      Encoding.default_internal = intern unless intern.nil? || intern == ""
-      [$stdin, $stdout, $stderr].each do |io|
-        io.set_encoding(extern, intern)
-      end
-    ensure
-      $VERBOSE = verbose
-    end
-    module_function :set_encoding
-    class << self; private :set_encoding; end
-  end
-end
-
-if __FILE__ == $0
-  ERB::Main.run
-end
diff --git a/bin/gem b/bin/gem
index a4ec754abb..1c16ea7ddd 100755
--- a/bin/gem
+++ b/bin/gem
@@ -5,21 +5,6 @@
 # See LICENSE.txt for permissions.
 #++
 
-require 'rubygems'
-require 'rubygems/gem_runner'
-require 'rubygems/exceptions'
-
-required_version = Gem::Requirement.new ">= 1.8.7"
-
-unless required_version.satisfied_by? Gem.ruby_version then
-  abort "Expected Ruby Version #{required_version}, is #{Gem.ruby_version}"
-end
-
-args = ARGV.clone
-
-begin
-  Gem::GemRunner.new.run args
-rescue Gem::SystemExitException => e
-  exit e.exit_code
-end
+require "rubygems/gem_runner"
 
+Gem::GemRunner.new.run ARGV.clone
diff --git a/bin/rdoc b/bin/rdoc
deleted file mode 100755
index aaa23292df..0000000000
--- a/bin/rdoc
+++ /dev/null
@@ -1,44 +0,0 @@
-#!/usr/bin/env ruby
-#
-#  RDoc: Documentation tool for source code
-#        (see lib/rdoc/rdoc.rb for more information)
-#
-#  Copyright (c) 2003 Dave Thomas
-#  Released under the same terms as Ruby
-
-begin
-  gem 'rdoc'
-rescue NameError => e # --disable-gems
-  raise unless e.name == :gem
-rescue Gem::LoadError
-end
-
-require 'rdoc/rdoc'
-
-begin
-  r = RDoc::RDoc.new
-  r.document ARGV
-rescue Errno::ENOSPC
-  $stderr.puts 'Ran out of space creating documentation'
-  $stderr.puts
-  $stderr.puts 'Please free up some space and try again'
-rescue SystemExit
-  raise
-rescue Exception => e
-  if $DEBUG_RDOC then
-    $stderr.puts e.message
-    $stderr.puts "#{e.backtrace.join "\n\t"}"
-    $stderr.puts
-  elsif Interrupt === e then
-    $stderr.puts
-    $stderr.puts 'Interrupted'
-  else
-    $stderr.puts "uh-oh! RDoc had a problem:"
-    $stderr.puts e.message
-    $stderr.puts
-    $stderr.puts "run with --debug for full backtrace"
-  end
-
-  exit 1
-end
-
diff --git a/bootstraptest/pending.rb b/bootstraptest/pending.rb
index 744c0adac1..2c4b85a419 100644
--- a/bootstraptest/pending.rb
+++ b/bootstraptest/pending.rb
@@ -1,19 +1,3 @@
-assert_equal 'A', %q{
-  class A
-    @@a = 'A'
-    def a=(x)
-      @@a = x
-    end
-    def a
-      @@a
-    end
-  end
-
-  B = A.dup
-  B.new.a = 'B'
-  A.new.a
-}, '[ruby-core:17019]'
-
 assert_equal 'ok', %q{
   def m
     lambda{
@@ -31,9 +15,7 @@ assert_equal 'ok', %q{
   end
 }
 
-assert_normal_exit %q{
-  r = Range.allocate
-  def r.<=>(o) true end
-  r.instance_eval { initialize r, r }
-  r.inspect
+# This randomly fails on mswin.
+assert_equal %q{[]}, %q{
+  Thread.new{sleep}.backtrace
 }
diff --git a/bootstraptest/runner.rb b/bootstraptest/runner.rb
index d9711fef38..f9b3e919b8 100755
--- a/bootstraptest/runner.rb
+++ b/bootstraptest/runner.rb
@@ -1,4 +1,4 @@
-"exec" "${RUBY-ruby}" "-x" "$0" "$@" || true # -*- mode: ruby; coding: utf-8 -*-
+"exec" "${RUBY-ruby}" "-x" "$0" "$@" || true # -*- Ruby -*-
 #!./ruby
 # $Id$
 
@@ -6,6 +6,9 @@
 # Never use optparse in this file.
 # Never use test/unit in this file.
 # Never use Ruby extensions in this file.
+# Maintain Ruby 1.8 compatibility for now
+
+$start_time = Time.now
 
 begin
   require 'fileutils'
@@ -57,23 +60,114 @@ if !Dir.respond_to?(:mktmpdir)
   end
 end
 
+# Configuration
+bt = Struct.new(:ruby,
+                :verbose,
+                :color,
+                :tty,
+                :quiet,
+                :wn,
+                :progress,
+                :progress_bs,
+                :passed,
+                :failed,
+                :reset,
+                :columns,
+                :window_width,
+                :width,
+                :indent,
+                :platform,
+                )
+BT = Class.new(bt) do
+  def indent=(n)
+    super
+    if (self.columns ||= 0) < n
+      $stderr.print(' ' * (n - self.columns))
+    end
+    self.columns = indent
+  end
+
+  def putc(c)
+    unless self.quiet
+      if self.window_width == nil
+        unless w = ENV["COLUMNS"] and (w = w.to_i) > 0
+          w = 80
+        end
+        w -= 1
+        self.window_width = w
+      end
+      if self.window_width and self.columns >= self.window_width
+        $stderr.print "\n", " " * (self.indent ||= 0)
+        self.columns = indent
+      end
+      $stderr.print c
+      $stderr.flush
+      self.columns += 1
+    end
+  end
+
+  def wn=(wn)
+    unless wn == 1
+      if /(?:\A|\s)--jobserver-(?:auth|fds)=(?:(\d+),(\d+)|fifo:((?:\\.|\S)+))/ =~ ENV.delete("MAKEFLAGS")
+        begin
+          if fifo = $3
+            fifo.gsub!(/\\(?=.)/, '')
+            r = File.open(fifo, IO::RDONLY|IO::NONBLOCK|IO::BINARY)
+            w = File.open(fifo, IO::WRONLY|IO::NONBLOCK|IO::BINARY)
+          else
+            r = IO.for_fd($1.to_i(10), "rb", autoclose: false)
+            w = IO.for_fd($2.to_i(10), "wb", autoclose: false)
+          end
+        rescue => e
+          r.close if r
+        else
+          r.close_on_exec = true
+          w.close_on_exec = true
+          tokens = r.read_nonblock(wn > 0 ? wn : 1024, exception: false)
+          r.close
+          if String === tokens
+            tokens.freeze
+            auth = w
+            w = nil
+            at_exit {auth << tokens; auth.close}
+            wn = tokens.size + 1
+          else
+            w.close
+            wn = 1
+          end
+        end
+      end
+      if wn <= 0
+        require 'etc'
+        wn = [Etc.nprocessors / 2, 1].max
+      end
+    end
+    super wn
+  end
+end.new
+
+BT_STATE = Struct.new(:count, :error).new
+
 def main
-  @ruby = File.expand_path('miniruby')
-  @verbose = false
+  BT.ruby = File.expand_path('miniruby')
+  BT.verbose = false
+  $VERBOSE = false
   $stress = false
-  @color = nil
-  @tty = nil
-  @quiet = false
+  BT.color = nil
+  BT.tty = nil
+  BT.quiet = false
+  # BT.wn = 1
   dir = nil
   quiet = false
   tests = nil
   ARGV.delete_if {|arg|
     case arg
     when /\A--ruby=(.*)/
-      @ruby = $1
-      @ruby.gsub!(/^([^ ]*)/){File.expand_path($1)}
-      @ruby.gsub!(/(\s+-I\s*)((?!(?:\.\/)*-(?:\s|\z))\S+)/){$1+File.expand_path($2)}
-      @ruby.gsub!(/(\s+-r\s*)(\.\.?\/\S+)/){$1+File.expand_path($2)}
+      ruby = $1
+      ruby.gsub!(/^([^ ]*)/){File.expand_path($1)}
+      ruby.gsub!(/(\s+-I\s*)((?!(?:\.\/)*-(?:\s|\z))\S+)/){$1+File.expand_path($2)}
+      ruby.gsub!(/(\s+-r\s*)(\.\.?\/\S+)/){$1+File.expand_path($2)}
+      BT.ruby = ruby
       true
     when /\A--sets=(.*)/
       tests = Dir.glob("#{File.dirname($0)}/test_{#{$1}}*.rb").sort
@@ -86,18 +180,23 @@ def main
       $stress = true
     when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
       warn "unknown --color argument: #$3" if $3
-      @color = $1 ? nil : !$2
+      BT.color = color = $1 ? nil : !$2
       true
     when /\A--tty(=(?:yes|(no)|(.*)))?\z/
       warn "unknown --tty argument: #$3" if $3
-      @tty = !$1 || !$2
+      BT.tty = !$1 || !$2
       true
     when /\A(-q|--q(uiet))\z/
       quiet = true
-      @quiet = true
+      BT.quiet = true
+      true
+    when /\A-j(\d+)?/
+      BT.wn = $1.to_i
       true
     when /\A(-v|--v(erbose))\z/
-      @verbose = true
+      BT.verbose = true
+      BT.quiet = false
+      true
     when /\A(-h|--h(elp)?)\z/
       puts(<<-End)
 Usage: #{File.basename($0, '.*')} --ruby=PATH [--sets=NAME,NAME,...]
@@ -119,38 +218,41 @@ End
     end
   }
   if tests and not ARGV.empty?
-    $stderr.puts "--tests and arguments are exclusive"
-    exit false
+    abort "--sets and arguments are exclusive"
   end
   tests ||= ARGV
   tests = Dir.glob("#{File.dirname($0)}/test_*.rb").sort if tests.empty?
   pathes = tests.map {|path| File.expand_path(path) }
 
-  @progress = %w[- \\ | /]
-  @progress_bs = "\b" * @progress[0].size
-  @tty = $stderr.tty? if @tty.nil?
-  case @color
+  BT.progress = %w[- \\ | /]
+  BT.progress_bs = "\b" * BT.progress[0].size
+  BT.tty = $stderr.tty? if BT.tty.nil?
+  BT.wn ||= /-j(\d+)?/ =~ (ENV["MAKEFLAGS"] || ENV["MFLAGS"]) ? $1.to_i : 1
+
+  case BT.color
   when nil
-    @color = @tty && /dumb/ !~ ENV["TERM"]
+    BT.color = BT.tty && /dumb/ !~ ENV["TERM"]
   end
-  @tty &&= !@verbose
-  if @color
+  BT.tty &&= !BT.verbose
+  if BT.color
     # dircolors-like style
     colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
     begin
-      File.read(File.join(__dir__, "../test/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
+      File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
         colors[n] ||= c
       end
     rescue
     end
-    @passed = "\e[;#{colors["pass"] || "32"}m"
-    @failed = "\e[;#{colors["fail"] || "31"}m"
-    @reset = "\e[m"
+    BT.passed = "\e[;#{colors["pass"] || "32"}m"
+    BT.failed = "\e[;#{colors["fail"] || "31"}m"
+    BT.reset = "\e[m"
   else
-    @passed = @failed = @reset = ""
+    BT.passed = BT.failed = BT.reset = ""
   end
+  target_version = `#{BT.ruby} -v`.chomp
+  BT.platform = target_version[/\[(.*)\]\z/, 1]
   unless quiet
-    puts Time.now
+    puts $start_time
     if defined?(RUBY_DESCRIPTION)
       puts "Driver is #{RUBY_DESCRIPTION}"
     elsif defined?(RUBY_PATCHLEVEL)
@@ -158,253 +260,473 @@ End
     else
       puts "Driver is ruby #{RUBY_VERSION} (#{RUBY_RELEASE_DATE}) [#{RUBY_PLATFORM}]"
     end
-    puts "Target is #{`#{@ruby} -v`.chomp}"
+    puts "Target is #{target_version}"
     puts
     $stdout.flush
   end
 
-  in_temporary_working_directory(dir) {
+  in_temporary_working_directory(dir) do
     exec_test pathes
-  }
+  end
 end
 
 def erase(e = true)
-  if e and @columns > 0 and !@verbose
-    "\r#{" "*@columns}\r"
+  if e and BT.columns > 0 and BT.tty and !BT.verbose
+    "\e[1K\r"
   else
     ""
   end
 end
 
-def exec_test(pathes)
-  @count = 0
-  @error = 0
-  @errbuf = []
-  @location = nil
-  @columns = 0
-  @width = pathes.map {|path| File.basename(path).size}.max + 2
+def load_test pathes
   pathes.each do |path|
-    @basename = File.basename(path)
-    $stderr.printf("%s%-*s ", erase(@quiet), @width, @basename)
-    $stderr.flush
-    @columns = @width + 1
-    $stderr.puts if @verbose
-    count = @count
-    error = @error
     load File.expand_path(path)
-    if @tty
-      if @error == error
-        msg = "PASS #{@count-count}"
-        @columns += msg.size - 1
-        $stderr.print "#{@progress_bs}#{@passed}#{msg}#{@reset}"
+  end
+end
+
+def concurrent_exec_test
+  aq = Queue.new
+  rq = Queue.new
+
+  ts = BT.wn.times.map do
+    Thread.new do
+      while as = aq.pop
+        as.call
+        rq << as
+      end
+    ensure
+      rq << nil
+    end
+  end
+
+  Assertion.all.to_a.shuffle.each do |path, assertions|
+    assertions.each do |as|
+      aq << as
+    end
+  end
+
+  BT.indent = 1
+  aq.close
+  i = 1
+  term_wn = 0
+  begin
+    while BT.wn != term_wn
+      if r = rq.pop
+        case
+        when BT.quiet
+        when BT.tty
+          $stderr.print "#{BT.progress_bs}#{BT.progress[(i+=1) % BT.progress.size]}"
+        else
+          BT.putc '.'
+        end
       else
-        msg = "FAIL #{@error-error}/#{@count-count}"
-        $stderr.print "#{@progress_bs}#{@failed}#{msg}#{@reset}"
-        @columns = 0
+        term_wn += 1
+      end
+    end
+  ensure
+    ts.each(&:kill)
+    ts.each(&:join)
+  end
+end
+
+def exec_test(pathes)
+  # setup
+  load_test pathes
+  BT_STATE.count = 0
+  BT_STATE.error = 0
+  BT.columns = 0
+  BT.width = pathes.map {|path| File.basename(path).size}.max + 2
+
+  # execute tests
+  if BT.wn > 1
+    concurrent_exec_test
+  else
+    prev_basename = nil
+    Assertion.all.each do |basename, assertions|
+      if !BT.quiet && basename != prev_basename
+        prev_basename = basename
+        $stderr.printf("%s%-*s ", erase(BT.quiet), BT.width, basename)
+        $stderr.flush
+      end
+      BT.columns = BT.width + 1
+      $stderr.puts if BT.verbose
+      count = BT_STATE.count
+      error = BT_STATE.error
+
+      assertions.each do |assertion|
+        BT_STATE.count += 1
+        assertion.call
+      end
+
+      if BT.tty
+        if BT_STATE.error == error
+          msg = "PASS #{BT_STATE.count-count}"
+          BT.columns += msg.size - 1
+          $stderr.print "#{BT.progress_bs}#{BT.passed}#{msg}#{BT.reset}" unless BT.quiet
+        else
+          msg = "FAIL #{BT_STATE.error-error}/#{BT_STATE.count-count}"
+          $stderr.print "#{BT.progress_bs}#{BT.failed}#{msg}#{BT.reset}"
+          BT.columns = 0
+        end
       end
+      $stderr.puts if !BT.quiet and (BT.tty or BT_STATE.error == error)
     end
-    $stderr.puts unless @quiet and @tty and @error == error
   end
-  $stderr.print(erase) if @quiet
-  if @error == 0
-    if @count == 0
-      $stderr.puts "No tests, no problem"
+
+  # show results
+  unless BT.quiet
+    $stderr.puts(erase)
+
+    sec = Time.now - $start_time
+    $stderr.puts "Finished in #{'%.2f' % sec} sec\n\n" if Assertion.count > 0
+  end
+
+  Assertion.errbuf.each do |msg|
+    $stderr.puts msg
+  end
+
+  out = BT.quiet ? $stdout : $stderr
+
+  if BT_STATE.error == 0
+    if Assertion.count == 0
+      out.puts "No tests, no problem" unless BT.quiet
     else
-      $stderr.puts "#{@passed}PASS#{@reset} all #{@count} tests"
+      out.puts "#{BT.passed}PASS#{BT.reset} all #{Assertion.count} tests"
     end
-    exit true
+    true
   else
-    @errbuf.each do |msg|
-      $stderr.puts msg
-    end
-    $stderr.puts "#{@failed}FAIL#{@reset} #{@error}/#{@count} tests failed"
-    exit false
+    $stderr.puts "#{BT.failed}FAIL#{BT.reset} #{BT_STATE.error}/#{BT_STATE.count} tests failed"
+    false
   end
 end
 
-def show_progress(message = '')
-  if @verbose
-    $stderr.print "\##{@count} #{@location} "
-  elsif @tty
-    $stderr.print "#{@progress_bs}#{@progress[@count % @progress.size]}"
-  end
-  t = Time.now if @verbose
-  faildesc, errout = with_stderr {yield}
-  t = Time.now - t if @verbose
-  if !faildesc
-    if @tty
-      $stderr.print "#{@progress_bs}#{@progress[@count % @progress.size]}"
-    elsif @verbose
-      $stderr.printf(". %.3f\n", t)
+def target_platform
+  BT.platform or RUBY_PLATFORM
+end
+
+class Assertion < Struct.new(:src, :path, :lineno, :proc)
+  @count = 0
+  @all = Hash.new{|h, k| h[k] = []}
+  @errbuf = []
+
+  class << self
+    attr_reader :count, :errbuf
+
+    def all
+      @all
+    end
+
+    def add as
+      @all[as.path] << as
+      as.id = (@count += 1)
+    end
+  end
+
+  attr_accessor :id
+  attr_reader :err, :category
+
+  def initialize(*args)
+    super
+    self.class.add self
+    @category = self.path.match(/test_(.+)\.rb/)[1]
+  end
+
+  def call
+    self.proc.call self
+  end
+
+  def assert_check(message = '', opt = '', **argh)
+    show_progress(message) {
+      result = get_result_string(opt, **argh)
+      yield(result)
+    }
+  end
+
+  def with_stderr
+    out = err = nil
+    r, w = IO.pipe
+    @err = w
+    err_reader = Thread.new{ r.read }
+
+    begin
+      out = yield
+    ensure
+      w.close
+      err = err_reader.value
+      r.close rescue nil
+    end
+
+    return out, err
+  end
+
+  def show_error(msg, additional_message)
+    msg = "#{BT.failed}\##{self.id} #{self.path}:#{self.lineno}#{BT.reset}: #{msg}  #{additional_message}"
+    if BT.tty
+      $stderr.puts "#{erase}#{msg}"
     else
-      $stderr.print '.'
+      Assertion.errbuf << msg
     end
-  else
-    $stderr.print "#{@failed}F"
-    $stderr.printf(" %.3f", t) if @verbose
-    $stderr.print "#{@reset}"
-    $stderr.puts if @verbose
-    error faildesc, message
-    unless errout.empty?
-      $stderr.print "#{@failed}stderr output is not empty#{@reset}\n", adjust_indent(errout)
+    BT_STATE.error += 1
+  end
+
+
+  def show_progress(message = '')
+    if BT.quiet || BT.wn > 1
+      # do nothing
+    elsif BT.verbose
+      $stderr.print "\##{@id} #{self.path}:#{self.lineno} "
+    elsif BT.tty
+      $stderr.print "#{BT.progress_bs}#{BT.progress[BT_STATE.count % BT.progress.size]}"
     end
-    if @tty and !@verbose
-      $stderr.printf("%-*s%s", @width, @basename, @progress[@count % @progress.size])
+
+    t = Time.now if BT.verbose
+    faildesc, errout = with_stderr {yield}
+    t = Time.now - t if BT.verbose
+
+    if !faildesc
+      # success
+      if BT.quiet || BT.wn > 1
+        # do nothing
+      elsif BT.tty
+        $stderr.print "#{BT.progress_bs}#{BT.progress[BT_STATE.count % BT.progress.size]}"
+      elsif BT.verbose
+        $stderr.printf(". %.3f\n", t)
+      else
+        BT.putc '.'
+      end
+    else
+      $stderr.print "#{BT.failed}F"
+      $stderr.printf(" %.3f", t) if BT.verbose
+      $stderr.print BT.reset
+      $stderr.puts if BT.verbose
+      show_error faildesc, message
+      unless errout.empty?
+        $stderr.print "#{BT.failed}stderr output is not empty#{BT.reset}\n", adjust_indent(errout)
+      end
+
+      if BT.tty and !BT.verbose and BT.wn == 1
+        $stderr.printf("%-*s%s", BT.width, path, BT.progress[BT_STATE.count % BT.progress.size])
+      end
+    end
+  rescue Interrupt
+    $stderr.puts "\##{@id} #{path}:#{lineno}"
+    raise
+  rescue Exception => err
+    $stderr.print 'E'
+    $stderr.puts if BT.verbose
+    show_error err.message, message
+  ensure
+    begin
+      check_coredump
+    rescue CoreDumpError => err
+      $stderr.print 'E'
+      $stderr.puts if BT.verbose
+      show_error err.message, message
+      cleanup_coredump
     end
   end
-rescue Interrupt
-  raise Interrupt
-rescue Exception => err
-  $stderr.print 'E'
-  $stderr.puts if @verbose
-  error err.message, message
-end
 
-# NativeClient is special.  The binary is cross-compiled.  But runs on the build environment.
-# So RUBY_PLATFORM in this process is not useful to detect it.
-def nacl?
-  @ruby and File.basename(@ruby.split(/\s/).first)['sel_ldr']
+  def get_result_string(opt = '', **argh)
+    if BT.ruby
+      filename = make_srcfile(**argh)
+      begin
+        kw = self.err ? {err: self.err} : {}
+        out = IO.popen("#{BT.ruby} -W0 #{opt} #{filename}", **kw)
+        pid = out.pid
+        out.read.tap{ Process.waitpid(pid); out.close }
+      ensure
+        raise Interrupt if $? and $?.signaled? && $?.termsig == Signal.list["INT"]
+
+        begin
+          Process.kill :KILL, pid
+        rescue Errno::ESRCH
+          # OK
+        end
+      end
+    else
+      eval(src).to_s
+    end
+  end
+
+  def make_srcfile(frozen_string_literal: nil)
+    filename = "bootstraptest.#{self.path}_#{self.lineno}_#{self.id}.rb"
+    File.open(filename, 'w') {|f|
+      f.puts "#frozen_string_literal:true" if frozen_string_literal
+      f.puts "GC.stress = true" if $stress
+      f.puts "print(begin; #{self.src}; end)"
+    }
+    filename
+  end
 end
 
-def assert_check(testsrc, message = '', opt = '')
-  show_progress(message) {
-    result = get_result_string(testsrc, opt)
-    check_coredump
-    yield(result)
-  }
+def add_assertion src, pr
+  loc = caller_locations(2, 1).first
+  lineno = loc.lineno
+  path = File.basename(loc.path)
+
+  Assertion.new(src, path, lineno, pr)
 end
 
-def assert_equal(expected, testsrc, message = '')
-  newtest
-  assert_check(testsrc, message) {|result|
-    if expected == result
-      nil
-    else
-      desc = "#{result.inspect} (expected #{expected.inspect})"
-      pretty(testsrc, desc, result)
-    end
-  }
+def assert_equal(expected, testsrc, message = '', opt = '', **argh)
+  add_assertion testsrc, -> as do
+    as.assert_check(message, opt, **argh) {|result|
+      if expected == result
+        nil
+      else
+        desc = "#{result.inspect} (expected #{expected.inspect})"
+        pretty(testsrc, desc, result)
+      end
+    }
+  end
 end
 
 def assert_match(expected_pattern, testsrc, message = '')
-  newtest
-  assert_check(testsrc, message) {|result|
-    if expected_pattern =~ result
-      nil
-    else
-      desc = "#{expected_pattern.inspect} expected to be =~\n#{result.inspect}"
-      pretty(testsrc, desc, result)
-    end
-  }
+  add_assertion testsrc, -> as do
+    as.assert_check(message) {|result|
+      if expected_pattern =~ result
+        nil
+      else
+        desc = "#{expected_pattern.inspect} expected to be =~\n#{result.inspect}"
+        pretty(testsrc, desc, result)
+      end
+    }
+  end
 end
 
 def assert_not_match(unexpected_pattern, testsrc, message = '')
-  newtest
-  assert_check(testsrc, message) {|result|
-    if unexpected_pattern !~ result
-      nil
-    else
-      desc = "#{unexpected_pattern.inspect} expected to be !~\n#{result.inspect}"
-      pretty(testsrc, desc, result)
-    end
-  }
+  add_assertion testsrc, -> as do
+    as.assert_check(message) {|result|
+      if unexpected_pattern !~ result
+        nil
+      else
+        desc = "#{unexpected_pattern.inspect} expected to be !~\n#{result.inspect}"
+        pretty(testsrc, desc, result)
+      end
+    }
+  end
 end
 
 def assert_valid_syntax(testsrc, message = '')
-  newtest
-  assert_check(testsrc, message, '-c') {|result|
-    result if /Syntax OK/ !~ result
-  }
+  add_assertion testsrc, -> as do
+    as.assert_check(message, '-c') {|result|
+      result if /Syntax OK/ !~ result
+    }
+  end
 end
 
-def assert_normal_exit(testsrc, *rest)
-  newtest
-  opt = {}
-  opt = rest.pop if Hash === rest.last
-  message, ignore_signals = rest
-  message ||= ''
-  timeout = opt[:timeout]
-  show_progress(message) {
-    faildesc = nil
-    filename = make_srcfile(testsrc)
-    old_stderr = $stderr.dup
-    timeout_signaled = false
-    begin
-      $stderr.reopen("assert_normal_exit.log", "w")
-      io = IO.popen("#{@ruby} -W0 #{filename}")
-      pid = io.pid
-      th = Thread.new {
-        io.read
-        io.close
-        $?
-      }
-      if !th.join(timeout)
-        Process.kill :KILL, pid
-        timeout_signaled = true
-      end
-      status = th.value
-    ensure
-      $stderr.reopen(old_stderr)
-      old_stderr.close
-    end
-    if status && status.signaled?
-      signo = status.termsig
-      signame = Signal.list.invert[signo]
-      unless ignore_signals and ignore_signals.include?(signame)
-        sigdesc = "signal #{signo}"
-        if signame
-          sigdesc = "SIG#{signame} (#{sigdesc})"
-        end
-        if timeout_signaled
-          sigdesc << " (timeout)"
+def assert_normal_exit(testsrc, *rest, timeout: nil, **opt)
+  add_assertion testsrc, -> as do
+    message, ignore_signals = rest
+    message ||= ''
+    as.show_progress(message) {
+      faildesc = nil
+      filename = as.make_srcfile
+      timeout_signaled = false
+      logfile = "assert_normal_exit.#{as.path}.#{as.lineno}.log"
+
+      begin
+        err = open(logfile, "w")
+        io = IO.popen("#{BT.ruby} -W0 #{filename}", err: err)
+        pid = io.pid
+        th = Thread.new {
+          io.read
+          io.close
+          $?
+        }
+        if !th.join(timeout)
+          Process.kill :KILL, pid
+          timeout_signaled = true
         end
-        faildesc = pretty(testsrc, "killed by #{sigdesc}", nil)
-        stderr_log = File.read("assert_normal_exit.log")
-        if !stderr_log.empty?
-          faildesc << "\n" if /\n\z/ !~ faildesc
-          stderr_log << "\n" if /\n\z/ !~ stderr_log
-          stderr_log.gsub!(/^.*\n/) { '| ' + $& }
-          faildesc << stderr_log
+        status = th.value
+      ensure
+        err.close
+      end
+      if status && status.signaled?
+        signo = status.termsig
+        signame = Signal.list.invert[signo]
+        unless ignore_signals and ignore_signals.include?(signame)
+          sigdesc = "signal #{signo}"
+          if signame
+            sigdesc = "SIG#{signame} (#{sigdesc})"
+          end
+          if timeout_signaled
+            sigdesc << " (timeout)"
+          end
+          faildesc = pretty(testsrc, "killed by #{sigdesc}", nil)
+          stderr_log = File.read(logfile)
+          if !stderr_log.empty?
+            faildesc << "\n" if /\n\z/ !~ faildesc
+            stderr_log << "\n" if /\n\z/ !~ stderr_log
+            stderr_log.gsub!(/^.*\n/) { '| ' + $& }
+            faildesc << stderr_log
+          end
         end
       end
-    end
-    faildesc
-  }
+      faildesc
+    }
+  end
 end
 
 def assert_finish(timeout_seconds, testsrc, message = '')
-  newtest
-  show_progress(message) {
-    faildesc = nil
-    filename = make_srcfile(testsrc)
-    io = IO.popen("#{@ruby} -W0 #{filename}")
-    pid = io.pid
-    waited = false
-    tlimit = Time.now + timeout_seconds
-    while Time.now < tlimit
-      if Process.waitpid pid, Process::WNOHANG
-        waited = true
-        break
-      end
-      sleep 0.1
-    end
-    if !waited
-      Process.kill(:KILL, pid)
-      Process.waitpid pid
-      faildesc = pretty(testsrc, "not finished in #{timeout_seconds} seconds", nil)
+  add_assertion testsrc, -> as do
+    if defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled? # for --jit-wait
+      timeout_seconds *= 3
     end
-    io.close
-    faildesc
-  }
+
+    as.show_progress(message) {
+      faildesc = nil
+      filename = as.make_srcfile
+      io = IO.popen("#{BT.ruby} -W0 #{filename}", err: as.err)
+      pid = io.pid
+      waited = false
+      tlimit = Time.now + timeout_seconds
+      diff = timeout_seconds
+      while diff > 0
+        if Process.waitpid pid, Process::WNOHANG
+          waited = true
+          break
+        end
+        if io.respond_to?(:read_nonblock)
+          if IO.select([io], nil, nil, diff)
+            begin
+              io.read_nonblock(1024)
+            rescue Errno::EAGAIN, IO::WaitReadable, EOFError
+              break
+            end while true
+          end
+        else
+          sleep 0.1
+        end
+        diff = tlimit - Time.now
+      end
+      if !waited
+        Process.kill(:KILL, pid)
+        Process.waitpid pid
+        faildesc = pretty(testsrc, "not finished in #{timeout_seconds} seconds", nil)
+      end
+      io.close
+      faildesc
+    }
+  end
 end
 
 def flunk(message = '')
-  newtest
-  show_progress('') { message }
+  add_assertion '', -> as do
+    as.show_progress('') { message }
+  end
+end
+
+def show_limit(testsrc, opt = '', **argh)
+  return if BT.quiet
+
+  add_assertion testsrc, -> as do
+    result = as.get_result_string(opt, **argh)
+    Assertion.errbuf << result
+  end
 end
 
 def pretty(src, desc, result)
-  src = src.sub(/\A.*\n/, '')
+  src = src.sub(/\A\s*\n/, '')
   (/\n/ =~ src ? "\n#{adjust_indent(src)}" : src) + "  #=> #{desc}"
 end
 
@@ -418,66 +740,6 @@ def untabify(str)
   str.gsub(/^\t+/) {' ' * (8 * $&.size) }
 end
 
-def make_srcfile(src)
-  filename = 'bootstraptest.tmp.rb'
-  File.open(filename, 'w') {|f|
-    f.puts "GC.stress = true" if $stress
-    f.puts "print(begin; #{src}; end)"
-  }
-  filename
-end
-
-def get_result_string(src, opt = '')
-  if @ruby
-    filename = make_srcfile(src)
-    begin
-      `#{@ruby} -W0 #{opt} #{filename}`
-    ensure
-      raise Interrupt if $? and $?.signaled? && $?.termsig == Signal.list["INT"]
-      raise CoreDumpError, "core dumped" if $? and $?.coredump?
-    end
-  else
-    eval(src).to_s
-  end
-end
-
-def with_stderr
-  out = err = nil
-  begin
-    r, w = IO.pipe
-    stderr = $stderr.dup
-    $stderr.reopen(w)
-    w.close
-    reader = Thread.start {r.read}
-    begin
-      out = yield
-    ensure
-      $stderr.reopen(stderr)
-      err = reader.value
-    end
-  ensure
-    w.close rescue nil
-    r.close rescue nil
-  end
-  return out, err
-end
-
-def newtest
-  @location = File.basename(caller(2).first)
-  @count += 1
-  cleanup_coredump
-end
-
-def error(msg, additional_message)
-  msg = "#{@failed}\##{@count} #{@location}#{@reset}: #{msg}  #{additional_message}"
-  if @tty
-    $stderr.puts "#{erase}#{msg}"
-  else
-    @errbuf.push msg
-  end
-  @error += 1
-end
-
 def in_temporary_working_directory(dir)
   if dir
     Dir.mkdir dir
@@ -494,18 +756,32 @@ def in_temporary_working_directory(dir)
 end
 
 def cleanup_coredump
-  FileUtils.rm_f 'core'
+  if File.file?('core')
+    require 'time'
+    Dir.glob('/tmp/bootstraptest-core.*').each do |f|
+      if Time.now - File.mtime(f) > 7 * 24 * 60 * 60 # 7 days
+        warn "Deleting an old core file: #{f}"
+        FileUtils.rm(f)
+      end
+    end
+    core_path = "/tmp/bootstraptest-core.#{Time.now.utc.iso8601}"
+    warn "A core file is found. Saving it at: #{core_path.dump}"
+    FileUtils.mv('core', core_path)
+    cmd = ['gdb', BT.ruby, '-c', core_path, '-ex', 'bt', '-batch']
+    p cmd # debugging why it's not working
+    system(*cmd)
+  end
   FileUtils.rm_f Dir.glob('core.*')
-  FileUtils.rm_f @ruby+'.stackdump' if @ruby
+  FileUtils.rm_f BT.ruby+'.stackdump' if BT.ruby
 end
 
 class CoreDumpError < StandardError; end
 
 def check_coredump
   if File.file?('core') or not Dir.glob('core.*').empty? or
-      (@ruby and File.exist?(@ruby+'.stackdump'))
+      (BT.ruby and File.exist?(BT.ruby+'.stackdump'))
     raise CoreDumpError, "core dumped"
   end
 end
 
-main
+exit main
diff --git a/bootstraptest/test_attr.rb b/bootstraptest/test_attr.rb
index 721a847145..3cb9d3eb39 100644
--- a/bootstraptest/test_attr.rb
+++ b/bootstraptest/test_attr.rb
@@ -34,3 +34,19 @@ assert_equal %{ok}, %{
     print "ok"
   end
 }, '[ruby-core:15120]'
+
+assert_equal %{ok}, %{
+  class Big
+    attr_reader :foo
+    def initialize
+      @foo = "ok"
+    end
+  end
+
+  obj = Big.new
+  100.times do |i|
+    obj.instance_variable_set(:"@ivar_\#{i}", i)
+  end
+
+  Big.new.foo
+}
diff --git a/bootstraptest/test_autoload.rb b/bootstraptest/test_autoload.rb
index a9f8e6dacd..9e0850bc52 100644
--- a/bootstraptest/test_autoload.rb
+++ b/bootstraptest/test_autoload.rb
@@ -1,7 +1,7 @@
 assert_equal 'ok', %q{
-  File.unlink('zzz.rb') if File.file?('zzz.rb')
+  File.unlink('zzz1.rb') if File.file?('zzz1.rb')
   instance_eval do
-    autoload :ZZZ, './zzz.rb'
+    autoload :ZZZ, './zzz1.rb'
     begin
       ZZZ
     rescue LoadError
@@ -11,9 +11,9 @@ assert_equal 'ok', %q{
 }, '[ruby-dev:43816]'
 
 assert_equal 'ok', %q{
-  open('zzz.rb', 'w') {|f| f.puts '' }
+  open('zzz2.rb', 'w') {|f| f.puts '' }
   instance_eval do
-    autoload :ZZZ, './zzz.rb'
+    autoload :ZZZ, './zzz2.rb'
     begin
       ZZZ
     rescue NameError
@@ -23,29 +23,29 @@ assert_equal 'ok', %q{
 }, '[ruby-dev:43816]'
 
 assert_equal 'ok', %q{
-  open('zzz.rb', 'w') {|f| f.puts 'class ZZZ; def self.ok;:ok;end;end'}
+  open('zzz3.rb', 'w') {|f| f.puts 'class ZZZ; def self.ok;:ok;end;end'}
   instance_eval do
-    autoload :ZZZ, './zzz.rb'
+    autoload :ZZZ, './zzz3.rb'
     ZZZ.ok
   end
 }, '[ruby-dev:43816]'
 
 assert_equal 'ok', %q{
-  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
-  autoload :ZZZ, "./zzz.rb"
+  open("zzz4.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
+  autoload :ZZZ, "./zzz4.rb"
   ZZZ.ok
 }
 
 assert_equal 'ok', %q{
-  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
-  autoload :ZZZ, "./zzz.rb"
-  require "./zzz.rb"
+  open("zzz5.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
+  autoload :ZZZ, "./zzz5.rb"
+  require "./zzz5.rb"
   ZZZ.ok
 }
 
 assert_equal 'okok', %q{
-  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
-  autoload :ZZZ, "./zzz.rb"
+  open("zzz6.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
+  autoload :ZZZ, "./zzz6.rb"
   t1 = Thread.new {ZZZ.ok}
   t2 = Thread.new {ZZZ.ok}
   [t1.value, t2.value].join
@@ -60,9 +60,9 @@ assert_finish 5, %q{
 }, '[ruby-core:21696]'
 
 assert_equal 'A::C', %q{
-  open("zzz.rb", "w") {}
+  open("zzz7.rb", "w") {}
   class A
-    autoload :C, "./zzz"
+    autoload :C, "./zzz7"
     class C
     end
     C
diff --git a/bootstraptest/test_constant_cache.rb b/bootstraptest/test_constant_cache.rb
new file mode 100644
index 0000000000..1fa83256ed
--- /dev/null
+++ b/bootstraptest/test_constant_cache.rb
@@ -0,0 +1,187 @@
+# Constant lookup is cached.
+assert_equal '1', %q{
+  CONST = 1
+
+  def const
+    CONST
+  end
+
+  const
+  const
+}
+
+# Invalidate when a constant is set.
+assert_equal '2', %q{
+  CONST = 1
+
+  def const
+    CONST
+  end
+
+  const
+
+  CONST = 2
+
+  const
+}
+
+# Invalidate when a constant of the same name is set.
+assert_equal '1', %q{
+  CONST = 1
+
+  def const
+    CONST
+  end
+
+  const
+
+  class Container
+    CONST = 2
+  end
+
+  const
+}
+
+# Invalidate when a constant is removed.
+assert_equal 'missing', %q{
+  class Container
+    CONST = 1
+
+    def const
+      CONST
+    end
+
+    def self.const_missing(name)
+      'missing'
+    end
+
+    new.const
+    remove_const :CONST
+  end
+
+  Container.new.const
+}
+
+# Invalidate when a constant's visibility changes.
+assert_equal 'missing', %q{
+  class Container
+    CONST = 1
+
+    def self.const_missing(name)
+      'missing'
+    end
+  end
+
+  def const
+    Container::CONST
+  end
+
+  const
+
+  Container.private_constant :CONST
+
+  const
+}
+
+# Invalidate when a constant's visibility changes even if the call to the
+# visibility change method fails.
+assert_equal 'missing', %q{
+  class Container
+    CONST1 = 1
+
+    def self.const_missing(name)
+      'missing'
+    end
+  end
+
+  def const1
+    Container::CONST1
+  end
+
+  const1
+
+  begin
+    Container.private_constant :CONST1, :CONST2
+  rescue NameError
+  end
+
+  const1
+}
+
+# Invalidate when a module is included.
+assert_equal 'INCLUDE', %q{
+  module Include
+    CONST = :INCLUDE
+  end
+
+  class Parent
+    CONST = :PARENT
+  end
+
+  class Child < Parent
+    def const
+      CONST
+    end
+
+    new.const
+
+    include Include
+  end
+
+  Child.new.const
+}
+
+# Invalidate when const_missing is hit.
+assert_equal '2', %q{
+  module Container
+    Foo = 1
+    Bar = 2
+
+    class << self
+      attr_accessor :count
+
+      def const_missing(name)
+        @count += 1
+        @count == 1 ? Foo : Bar
+      end
+    end
+
+    @count = 0
+  end
+
+  def const
+    Container::Baz
+  end
+
+  const
+  const
+}
+
+# Invalidate when the iseq gets cleaned up.
+assert_equal '2', %q{
+  CONSTANT = 1
+
+  iseq = RubyVM::InstructionSequence.compile(<<~RUBY)
+    CONSTANT
+  RUBY
+
+  iseq.eval
+  iseq = nil
+
+  GC.start
+  CONSTANT = 2
+}
+
+# Invalidate when the iseq gets cleaned up even if it was never in the cache.
+assert_equal '2', %q{
+  CONSTANT = 1
+
+  iseq = RubyVM::InstructionSequence.compile(<<~RUBY)
+    CONSTANT
+  RUBY
+
+  iseq = nil
+
+  GC.start
+  CONSTANT = 2
+}
diff --git a/bootstraptest/test_env.rb b/bootstraptest/test_env.rb
new file mode 100644
index 0000000000..7d1b45b75e
--- /dev/null
+++ b/bootstraptest/test_env.rb
@@ -0,0 +1,12 @@
+assert_equal "true", %q{
+  ENV["ENVTEST"] = "\u{e9 3042 d76c}"
+  env = ENV["ENVTEST"]
+  env.valid_encoding?
+}
+
+# different encoding is used for PATH
+assert_equal "true", %q{
+  ENV["PATH"] = "\u{e9 3042 d76c}"
+  env = ENV["PATH"]
+  env.valid_encoding?
+}
diff --git a/bootstraptest/test_eval.rb b/bootstraptest/test_eval.rb
index bf7478006d..a9f389c673 100644
--- a/bootstraptest/test_eval.rb
+++ b/bootstraptest/test_eval.rb
@@ -109,13 +109,40 @@ assert_equal %q{foo}, %q{
   }
 }
 assert_equal %q{1}, %q{
-  class Fixnum
+  class Integer
     Const = 1
   end
   1.instance_eval %{
     Const
   }
 }
+assert_equal %q{1}, %q{
+  class TrueClass
+    Const = 1
+  end
+  true.instance_eval %{
+    Const
+  }
+}
+assert_equal %q{[:Const]}, %q{
+  mod = Module.new
+  mod.instance_eval %{
+    Const = 1
+  }
+  raise if defined?(Module::Const)
+  mod.singleton_class.constants
+}
+assert_equal %q{can't define singleton}, %q{
+  begin
+    123.instance_eval %{
+      Const = 1
+    }
+    "bad"
+  rescue TypeError => e
+    raise "bad" if defined?(Integer::Const)
+    e.message
+  end
+}
 assert_equal %q{top}, %q{
   Const = :top
   class C
@@ -190,7 +217,8 @@ assert_equal %q{[10, main]}, %q{
 }
 
 %w[break next redo].each do |keyword|
-  assert_match %r"Can't escape from eval with #{keyword}\z", %{
+  assert_match %r"Can't escape from eval with #{keyword}\b", %{
+    $stderr = STDOUT
     begin
       eval "0 rescue #{keyword}"
     rescue SyntaxError => e
@@ -200,7 +228,7 @@ assert_equal %q{[10, main]}, %q{
 end
 
 assert_normal_exit %q{
-  STDERR.reopen(STDOUT)
+  $stderr = STDOUT
   class Foo
      def self.add_method
        class_eval("def some-bad-name; puts 'hello' unless @some_variable.some_function(''); end")
@@ -249,7 +277,9 @@ assert_equal 'ok', %q{
 
 assert_equal 'ok', %q{
   begin
-    12.instance_eval { @@a }
+    class A
+      12.instance_eval { @@a }
+    end
   rescue NameError
     :ok
   end
@@ -257,7 +287,9 @@ assert_equal 'ok', %q{
 
 assert_equal 'ok', %q{
   begin
-    12.instance_exec { @@a }
+    class A
+      12.instance_exec { @@a }
+    end
   rescue NameError
     :ok
   end
diff --git a/bootstraptest/test_exception.rb b/bootstraptest/test_exception.rb
index 35c8d25e37..0fb6f552b8 100644
--- a/bootstraptest/test_exception.rb
+++ b/bootstraptest/test_exception.rb
@@ -402,7 +402,7 @@ assert_equal 'nil', %q{
   exc.inspect
 }, '[ruby-dev:32608]'
 
-assert_equal 'exception class/object expected', %q{
+assert_equal 'divided by 0', %q{
   class ZeroDivisionError
     def self.new(message)
       42
diff --git a/bootstraptest/test_fiber.rb b/bootstraptest/test_fiber.rb
new file mode 100644
index 0000000000..2614dd13bf
--- /dev/null
+++ b/bootstraptest/test_fiber.rb
@@ -0,0 +1,39 @@
+show_limit %q{
+  fibers = []
+  begin
+    fiber = Fiber.new{Fiber.yield}
+    fiber.resume
+    fibers << fiber
+
+    raise Exception, "skipping" if fibers.count >= 10_000
+  rescue Exception => error
+    puts "Fiber count: #{fibers.count} (#{error})"
+    break
+  end while true
+}
+
+assert_equal %q{ok}, %q{
+  Fiber.new{
+  }.resume
+  :ok
+}
+
+assert_equal %q{ok}, %q{
+  100.times.collect{Fiber.new{}}
+  :ok
+}
+
+assert_equal %q{ok}, %q{
+  fibers = 1000.times.collect{Fiber.new{Fiber.yield}}
+  fibers.each(&:resume)
+  fibers.each(&:resume)
+  :ok
+}
+
+assert_normal_exit %q{
+  at_exit { Fiber.new{}.resume }
+}
+
+assert_normal_exit %q{
+  Fiber.new(&Object.method(:class_eval)).resume("foo")
+}, '[ruby-dev:34128]'
diff --git a/bootstraptest/test_flow.rb b/bootstraptest/test_flow.rb
index 0390062a24..35f19db588 100644
--- a/bootstraptest/test_flow.rb
+++ b/bootstraptest/test_flow.rb
@@ -534,11 +534,11 @@ assert_equal %Q{ENSURE\n}, %q{
  ['[ruby-core:39125]', %q{
   class Bug5234
     include Enumerable
-    def each
+    def each(&block)
       begin
         yield :foo
       ensure
-        proc
+        proc(&block)
       end
     end
   end
@@ -547,11 +547,11 @@ assert_equal %Q{ENSURE\n}, %q{
  ['[ruby-dev:45656]', %q{
   class Bug6460
     include Enumerable
-    def each
+    def each(&block)
       begin
         yield :foo
       ensure
-        1.times { Proc.new }
+        1.times { Proc.new(&block) }
       end
     end
   end
@@ -589,3 +589,13 @@ assert_equal "foo", %q{
   end
   Bug6460.new.m1
 }, '[ruby-dev:46372]'
+
+assert_equal "foo", %q{
+  obj = "foo"
+  if obj || any1
+    any2 = any2
+  else
+    raise obj.inspect
+  end
+  obj
+}, '[ruby-core:87830]'
diff --git a/bootstraptest/test_fork.rb b/bootstraptest/test_fork.rb
index 5de6ee1b12..83923dad97 100644
--- a/bootstraptest/test_fork.rb
+++ b/bootstraptest/test_fork.rb
@@ -21,10 +21,12 @@ assert_finish 10, %q{
   end
 }, '[ruby-core:22158]'
 
-assert_normal_exit(<<'End', '[ruby-dev:37934]')
+# temporarily stop this test to enable explicit failure when
+# timer thread couldn't be created (r61706 and r61717).
+assert_normal_exit(<<'End', '[ruby-dev:37934]') if false
   main = Thread.current
   Thread.new { sleep 0.01 until main.stop?; Thread.kill main }
-  Process.setrlimit(:NPROC, 1)
+  Process.setrlimit(:NPROC, 1) if defined?(Process::RLIMIT_NPROC)
   fork {}
 End
 
diff --git a/bootstraptest/test_insns.rb b/bootstraptest/test_insns.rb
new file mode 100644
index 0000000000..91fba9b011
--- /dev/null
+++ b/bootstraptest/test_insns.rb
@@ -0,0 +1,440 @@
+# C0 coverage of each instructions
+
+# :NOTE: This is for development purpose; never consider this file as
+# ISeq compilation specification.
+
+begin
+  # This library brings some additional coverage.
+  # Not mandatory.
+  require 'rbconfig/sizeof'
+rescue LoadError
+  # OK, just skip
+else
+  if defined? RbConfig::LIMITS
+    $FIXNUM_MAX = RbConfig::LIMITS["FIXNUM_MAX"]
+    $FIXNUM_MIN = RbConfig::LIMITS["FIXNUM_MIN"]
+  end
+end
+
+fsl   = { frozen_string_literal: true } # used later
+tests = [
+  # insn ,   expression to generate such insn
+  [ 'nop',   %q{ raise rescue true }, ],
+
+  [ 'setlocal *, 0', %q{ x = true }, ],
+  [ 'setlocal *, 1', %q{ x = nil; -> { x = true }.call }, ],
+  [ 'setlocal',      %q{ x = nil; -> { -> { x = true }.() }.() }, ],
+  [ 'getlocal *, 0', %q{ x = true; x }, ],
+  [ 'getlocal *, 1', %q{ x = true; -> { x }.call }, ],
+  [ 'getlocal',      %q{ x = true; -> { -> { x }.() }.() }, ],
+
+  [ 'setblockparam', <<-'},', ], # {
+    def m&b
+      b = # here
+        proc { true }
+    end
+    m { false }.call
+  },
+  [ 'getblockparam', <<-'},', ], # {
+    def m&b
+      b # here
+    end
+    m { true }.call
+  },
+  [ 'getblockparamproxy', <<-'},', ], # {
+    def m&b
+      b # here
+        .call
+    end
+    m { true }
+  },
+
+  [ 'setspecial', %q{ true if true..true }, ],
+  [ 'getspecial', %q{ $&.nil? }, ],
+  [ 'getspecial', %q{ $`.nil? }, ],
+  [ 'getspecial', %q{ $'.nil? }, ],
+  [ 'getspecial', %q{ $+.nil? }, ],
+  [ 'getspecial', %q{ $1.nil? }, ],
+  [ 'getspecial', %q{ $128.nil? }, ],
+
+  [ 'getglobal', %q{ String === $0 }, ],
+  [ 'getglobal', %q{ $_.nil? }, ],
+  [ 'setglobal', %q{ $0 = "true" }, ],
+
+  [ 'setinstancevariable', %q{ @x = true }, ],
+  [ 'getinstancevariable', %q{ @x = true; @x }, ],
+
+  [ 'setclassvariable', %q{ class A; @@x = true; end }, ],
+  [ 'getclassvariable', %q{ class A; @@x = true; @@x end }, ],
+
+  [ 'setconstant', %q{ X = true }, ],
+  [ 'setconstant', %q{ Object::X = true }, ],
+  [ 'getconstant', %q{ X = true; X }, ],
+  [ 'getconstant', %q{ X = true; Object::X }, ],
+
+  [ 'getinlinecache / setinlinecache', %q{ def x; X; end; X = true; x; x; x }, ],
+
+  [ 'putnil',               %q{ $~ == nil }, ],
+  [ 'putself',              %q{ $~ != self }, ],
+  [ 'putobject INT2FIX(0)', %q{ $~ != 0 }, ],
+  [ 'putobject INT2FIX(1)', %q{ $~ != 1 }, ],
+  [ 'putobject',            %q{ $~ != -1 }, ],
+  [ 'putobject',            %q{ $~ != /x/ }, ],
+  [ 'putobject',            %q{ $~ != :x }, ],
+  [ 'putobject',            %q{ $~ != (1..2) }, ],
+  [ 'putobject',            %q{ $~ != true }, ],
+  [ 'putobject',            %q{ /(?<x>x)/ =~ "x"; x == "x" }, ],
+
+  [ 'putspecialobject',         %q{ {//=>true}[//] }, ],
+  [ 'putstring',                %q{ "true" }, ],
+  [ 'tostring / concatstrings', %q{ "#{true}" }, ],
+  [ 'toregexp',                 %q{ /#{true}/ =~ "true" && $~ }, ],
+  [ 'intern',                   %q{ :"#{true}" }, ],
+
+  [ 'newarray',    %q{ ["true"][0] }, ],
+  [ 'newarraykwsplat', %q{ [**{x:'true'}][0][:x] }, ],
+  [ 'duparray',    %q{ [ true ][0] }, ],
+  [ 'expandarray', %q{ y = [ true, false, nil ]; x, = y; x }, ],
+  [ 'expandarray', %q{ y = [ true, false, nil ]; x, *z = y; x }, ],
+  [ 'expandarray', %q{ y = [ true, false, nil ]; x, *z, w = y; x }, ],
+  [ 'splatarray',  %q{ x, = *(y = true), false; x }, ],
+  [ 'concatarray', %q{ ["t", "r", *x = "u", "e"].join }, ],
+  [ 'concatarray', <<-'},', ],  # {
+    class X; def to_a; ['u']; end; end
+    ['t', 'r', *X.new, 'e'].join
+  },
+  [ 'concatarray', <<-'},', ],  # {
+    r = false
+    t = [true, nil]
+    q, w, e = r, *t             # here
+    w
+  },
+
+  [ 'newhash',  %q{ x = {}; x[x] = true }, ],
+  [ 'newhash',  %q{ x = true; { x => x }[x] }, ],
+  [ 'newhashfromarray', %q{ { a: true }[:a] }, ],
+  [ 'newrange', %q{ x = 1; [*(0..x)][0] == 0 }, ],
+  [ 'newrange', %q{ x = 1; [*(0...x)][0] == 0 }, ],
+
+  [ 'pop',     %q{ def x; true; end; x }, ],
+  [ 'dup',     %q{ x = y = true; x }, ],
+  [ 'dupn',    %q{ Object::X ||= true }, ],
+  [ 'reverse', %q{ q, (w, e), r = 1, [2, 3], 4; e == 3 }, ],
+  [ 'swap',    %q{ !!defined?([[]]) }, ],
+  [ 'swap',    <<-'},', ],      # {
+    x = [[false, true]]
+    for i, j in x               # here
+      ;
+    end
+    j
+  },
+
+  [ 'topn',        %q{ x, y = [], 0; x[*y], = [true, false]; x[0] }, ],
+  [ 'setn',        %q{ x, y = [], 0; x[*y]  =  true        ; x[0] }, ],
+  [ 'adjuststack', %q{ x = [true]; x[0] ||= nil; x[0] }, ],
+
+  [ 'defined',      %q{ !defined?(x) }, ],
+  [ 'checkkeyword', %q{ def x x:rand;x end; x x: true }, ],
+  [ 'checktype',    %q{ x = true; "#{x}" }, ],
+  [ 'checkmatch',   <<-'},', ], # {
+    x = y = true
+    case x
+    when false
+      y = false
+    when true                   # here
+      y = nil
+    end
+    y == nil
+  },
+  [ 'checkmatch',   <<-'},', ], # {
+    x, y = true, [false]
+    case x
+    when *y                     # here
+      z = false
+    else
+      z = true
+    end
+    z
+  },
+  [ 'checkmatch',   <<-'},', ], # {
+    x = false
+    begin
+      raise
+    rescue                      # here
+      x = true
+    end
+    x
+  },
+
+  [ 'defineclass', %q{                 module X;    true end }, ],
+  [ 'defineclass', %q{ X = Module.new; module X;    true end }, ],
+  [ 'defineclass', %q{                 class X;     true end }, ],
+  [ 'defineclass', %q{ X = Class.new;  class X;     true end }, ],
+  [ 'defineclass', %q{ X = Class.new;  class Y < X; true end }, ],
+  [ 'defineclass', %q{ X = Class.new;  class << X;  true end }, ],
+  [ 'defineclass', <<-'},', ], # {
+    X = Class.new
+    Y = Class.new(X)
+    class Y < X
+      true
+    end
+  },
+
+  [ 'opt_send_without_block', %q{ true.to_s }, ],
+  [ 'send',                   %q{ true.tap {|i| i.to_s } }, ],
+  [ 'leave',                  %q{ def x; true; end; x }, ],
+  [ 'invokesuper',            <<-'},', ], # {
+    class X < String
+      def empty?
+        super                   # here
+      end
+    end
+   X.new.empty?
+  },
+  [ 'invokeblock',            <<-'},', ], # {
+    def x
+      return yield self         # here
+    end
+    x do
+      true
+    end
+  },
+
+  [ 'opt_str_freeze', %q{ 'true'.freeze }, ],
+  [ 'opt_nil_p',      %q{ nil.nil? }, ],
+  [ 'opt_nil_p',      %q{ !Object.nil? }, ],
+  [ 'opt_nil_p',      %q{ Class.new{def nil?; true end}.new.nil? }, ],
+  [ 'opt_str_uminus', %q{ -'true' }, ],
+  [ 'opt_str_freeze', <<-'},', ], # {
+    class String
+      def freeze
+        true
+      end
+    end
+    'true'.freeze
+  },
+
+  [ 'opt_newarray_max', %q{ [ ].max.nil? }, ],
+  [ 'opt_newarray_max', %q{ [1, x = 2, 3].max == 3 }, ],
+  [ 'opt_newarray_max', <<-'},', ], # {
+    class Array
+      def max
+        true
+      end
+    end
+    [1, x = 2, 3].max
+  },
+  [ 'opt_newarray_min', %q{ [ ].min.nil? }, ],
+  [ 'opt_newarray_min', %q{ [3, x = 2, 1].min == 1 }, ],
+  [ 'opt_newarray_min', <<-'},', ], # {
+    class Array
+      def min
+        true
+      end
+    end
+    [3, x = 2, 1].min
+  },
+
+  [ 'throw',        %q{ false.tap { break true } }, ],
+  [ 'branchif',     %q{ x = nil;  x ||= true }, ],
+  [ 'branchif',     %q{ x = true; x ||= nil; x }, ],
+  [ 'branchunless', %q{ x = 1;    x &&= true }, ],
+  [ 'branchunless', %q{ x = nil;  x &&= true; x.nil? }, ],
+  [ 'branchnil',    %q{ x = true; x&.to_s }, ],
+  [ 'branchnil',    %q{ x = nil;  (x&.to_s).nil? }, ],
+  [ 'jump',         <<-'},', ], # {
+    y = 1
+    x = if y == 0 then nil elsif y == 1 then true else nil end
+    x
+  },
+  [ 'jump',         <<-'},', ], # {
+    # ultra complicated situation: this ||= assignment only generates
+    # 15 instructions, not including the class definition.
+    class X; attr_accessor :x; end
+    x = X.new
+    x&.x ||= true               # here
+  },
+
+  [ 'once', %q{ /#{true}/o =~ "true" && $~ }, ],
+  [ 'once', <<-'},', ],         # {
+    def once expr
+      return /#{expr}/o         # here
+    end
+    x = once(true); x = once(false); x = once(nil);
+    x =~ "true" && $~
+  },
+  [ 'once', <<-'},', ],         # {
+    # recursive once
+    def once n
+      return %r/#{
+        if n == 0
+          true
+        else
+          once(n-1)             # here
+        end
+      }/ox
+    end
+    x = once(128); x = once(7); x = once(16);
+    x =~ "true" && $~
+  },
+  [ 'once', <<-'},', ],         # {
+    # inter-thread lockup situation
+    def once n
+      return Thread.start n do |m|
+        Thread.pass
+        next %r/#{
+          sleep m               # here
+          true
+        }/ox
+      end
+    end
+    x = once(1); y = once(0.1); z = y.value
+    z =~ "true" && $~
+  },
+
+  [ 'opt_case_dispatch', %q{ case   0 when 1.1 then false else true end }, ],
+  [ 'opt_case_dispatch', %q{ case 1.0 when 1.1 then false else true end }, ],
+
+  [ 'opt_plus',    %q{ 1 + 1 == 2 }, ],
+  if defined? $FIXNUM_MAX then
+    [ 'opt_plus',  %Q{ #{ $FIXNUM_MAX } + 1 == #{ $FIXNUM_MAX + 1 } }, ]
+  end,
+  [ 'opt_plus',    %q{ 1.0 + 1.0 == 2.0 }, ],
+  [ 'opt_plus',    %q{ x = +0.0.next_float; x + x >= x }, ],
+  [ 'opt_plus',    %q{ 't' + 'rue' }, ],
+  [ 'opt_plus',    %q{ ( ['t'] + ['r', ['u', ['e'], ], ] ).join }, ],
+  [ 'opt_plus',    %q{ Time.at(1) + 1 == Time.at(2) }, ],
+  [ 'opt_minus',   %q{ 1 - 1 == 0 }, ],
+  if defined? $FIXNUM_MIN then
+    [ 'opt_minus', %Q{ #{ $FIXNUM_MIN } - 1 == #{ $FIXNUM_MIN - 1 } }, ]
+  end,
+  [ 'opt_minus',   %q{ 1.0 - 1.0 == 0.0 }, ],
+  [ 'opt_minus',   %q{ x = -0.0.prev_float; x - x == 0.0 }, ],
+  [ 'opt_minus',   %q{ ( [false, true] - [false] )[0] }, ],
+  [ 'opt_mult',    %q{ 1 * 1 == 1 }, ],
+  [ 'opt_mult',    %q{ 1.0 * 1.0 == 1.0 }, ],
+  [ 'opt_mult',    %q{ x = +0.0.next_float; x * x <= x }, ],
+  [ 'opt_mult',    %q{ ( "ruet" * 3 )[7,4] }, ],
+  [ 'opt_div',     %q{ 1 / 1 == 1 }, ],
+  [ 'opt_div',     %q{ 1.0 / 1.0 == 1.0 }, ],
+  [ 'opt_div',     %q{ x = +0.0.next_float; x / x >= x }, ],
+  [ 'opt_div',     %q{ x = 1/2r; x / x == 1 }, ],
+  [ 'opt_mod',     %q{ 1 % 1 == 0 }, ],
+  [ 'opt_mod',     %q{ 1.0 % 1.0 == 0.0 }, ],
+  [ 'opt_mod',     %q{ x = +0.0.next_float; x % x == 0.0 }, ],
+  [ 'opt_mod',     %q{ '%s' % [ true ] }, ],
+
+  [ 'opt_eq', %q{ 1 == 1 }, ],
+  [ 'opt_eq', <<-'},', ],       # {
+    class X; def == other; true; end; end
+    X.new == true
+  },
+  [ 'opt_neq', %q{ 1 != 0 }, ],
+  [ 'opt_neq', <<-'},', ],       # {
+    class X; def != other; true; end; end
+    X.new != true
+  },
+
+  [ 'opt_lt', %q{            -1   <  0 }, ],
+  [ 'opt_lt', %q{            -1.0 <  0.0 }, ],
+  [ 'opt_lt', %q{ -0.0.prev_float <  0.0 }, ],
+  [ 'opt_lt', %q{              ?a <  ?z }, ],
+  [ 'opt_le', %q{            -1   <= 0 }, ],
+  [ 'opt_le', %q{            -1.0 <= 0.0 }, ],
+  [ 'opt_le', %q{ -0.0.prev_float <= 0.0 }, ],
+  [ 'opt_le', %q{              ?a <= ?z }, ],
+  [ 'opt_gt', %q{             1   >  0 }, ],
+  [ 'opt_gt', %q{             1.0 >  0.0 }, ],
+  [ 'opt_gt', %q{ +0.0.next_float >  0.0 }, ],
+  [ 'opt_gt', %q{              ?z >  ?a }, ],
+  [ 'opt_ge', %q{             1   >= 0 }, ],
+  [ 'opt_ge', %q{             1.0 >= 0.0 }, ],
+  [ 'opt_ge', %q{ +0.0.next_float >= 0.0 }, ],
+  [ 'opt_ge', %q{              ?z >= ?a }, ],
+
+  [ 'opt_ltlt', %q{  '' << 'true' }, ],
+  [ 'opt_ltlt', %q{ ([] << 'true').join }, ],
+  [ 'opt_ltlt', %q{ (1 << 31) == 2147483648 }, ],
+
+  [ 'opt_aref', %q{ ['true'][0] }, ],
+  [ 'opt_aref', %q{ { 0 => 'true'}[0] }, ],
+  [ 'opt_aref', %q{ 'true'[0] == ?t }, ],
+  [ 'opt_aset', %q{ [][0] = true }, ],
+  [ 'opt_aset', %q{ {}[0] = true }, ],
+  [ 'opt_aset', %q{ x = 'frue'; x[0] = 't'; x }, ],
+  [ 'opt_aset', <<-'},', ], # {
+    # opt_aref / opt_aset mixup situation
+    class X; def x; {}; end; end
+    x = X.new
+    x&.x[true] ||= true         # here
+  },
+
+  [ 'opt_aref_with', %q{ { 'true' => true }['true'] }, ],
+  [ 'opt_aref_with', %q{ Struct.new(:nil).new['nil'].nil? }, ],
+  [ 'opt_aset_with', %q{ {}['true'] = true }, ],
+  [ 'opt_aset_with', %q{ Struct.new(:true).new['true'] = true }, ],
+
+  [ 'opt_length',  %q{   'true'       .length == 4 }, ],
+  [ 'opt_length',  %q{   :true        .length == 4 }, ],
+  [ 'opt_length',  %q{ [ 'true' ]     .length == 1 }, ],
+  [ 'opt_length',  %q{ { 'true' => 1 }.length == 1 }, ],
+  [ 'opt_size',    %q{   'true'       .size   == 4 }, ],
+  [ 'opt_size',    %q{               1.size   >= 4 }, ],
+  [ 'opt_size',    %q{ [ 'true' ]     .size   == 1 }, ],
+  [ 'opt_size',    %q{ { 'true' => 1 }.size   == 1 }, ],
+  [ 'opt_empty_p', %q{ ''.empty? }, ],
+  [ 'opt_empty_p', %q{ [].empty? }, ],
+  [ 'opt_empty_p', %q{ {}.empty? }, ],
+  [ 'opt_empty_p', %q{ Thread::Queue.new.empty? }, ],
+
+  [ 'opt_succ',  %q{ 1.succ == 2 }, ],
+  if defined? $FIXNUM_MAX then
+    [ 'opt_succ',%Q{ #{ $FIXNUM_MAX }.succ == #{ $FIXNUM_MAX + 1 } }, ]
+  end,
+  [ 'opt_succ',  %q{ '1'.succ == '2' }, ],
+
+  [ 'opt_not',  %q{ ! false }, ],
+  [ 'opt_neq', <<-'},', ],       # {
+    class X; def !; true; end; end
+    ! X.new
+  },
+
+  [ 'opt_regexpmatch2',  %q{ /true/ =~ 'true' && $~ }, ],
+  [ 'opt_regexpmatch2', <<-'},', ],       # {
+    class Regexp; def =~ other; true; end; end
+    /true/ =~ 'true'
+  },
+  [ 'opt_regexpmatch2',  %q{ 'true' =~ /true/ && $~ }, ],
+  [ 'opt_regexpmatch2', <<-'},', ],       # {
+    class String; def =~ other; true; end; end
+    'true' =~ /true/
+  },
+]
+
+# normal path
+tests.compact.each do |(insn, expr, *a)|
+  if a.last.is_a?(Hash)
+    a = a.dup
+    kw = a.pop
+    assert_equal 'true', expr, insn, *a, **kw
+  else
+    assert_equal 'true', expr, insn, *a
+  end
+end
+
+# with trace
+tests.compact.each {|(insn, expr, *a)|
+  progn = "set_trace_func(proc{})\n" + expr
+  if a.last.is_a?(Hash)
+    a = a.dup
+    kw = a.pop
+    assert_equal 'true', progn, 'trace_' + insn, *a, **kw
+  else
+    assert_equal 'true', progn, 'trace_' + insn, *a
+  end
+}
+
+assert_normal_exit("#{<<-"begin;"}\n#{<<-'end;'}")
+begin;
+  RubyVM::InstructionSequence.compile("", debug_level: 5)
+end;
diff --git a/bootstraptest/test_io.rb b/bootstraptest/test_io.rb
index 1d2b19368a..666e5a011b 100644
--- a/bootstraptest/test_io.rb
+++ b/bootstraptest/test_io.rb
@@ -1,3 +1,4 @@
+/freebsd/ =~ RUBY_PLATFORM or
 assert_finish 5, %q{
   r, w = IO.pipe
   t1 = Thread.new { r.sysread(1) }
@@ -30,7 +31,8 @@ assert_finish 10, %q{
   end
 }, '[ruby-dev:32566]'
 
-assert_finish 1, %q{
+/freebsd/ =~ RUBY_PLATFORM or
+assert_finish 5, %q{
   r, w = IO.pipe
   Thread.new {
     w << "ab"
@@ -52,7 +54,7 @@ assert_equal 'ok', %q{
   STDIN.reopen(rw)
   STDIN.reopen(save)
   rw.close
-  File.unlink(tmpname) unless RUBY_PLATFORM['nacl']
+  File.unlink(tmpname)
   :ok
 }
 
@@ -69,7 +71,7 @@ assert_equal 'ok', %q{
   STDIN.print "a"
   STDIN.reopen(save)
   rw.close
-  File.unlink(tmpname) unless RUBY_PLATFORM['nacl']
+  File.unlink(tmpname)
   :ok
 }
 
@@ -83,6 +85,7 @@ assert_normal_exit %q{
   ARGF.set_encoding "foo"
 }
 
+/freebsd/ =~ RUBY_PLATFORM or
 10.times do
   assert_normal_exit %q{
     at_exit { p :foo }
diff --git a/bootstraptest/test_jump.rb b/bootstraptest/test_jump.rb
index 595aaa7c4b..d07c47a56d 100644
--- a/bootstraptest/test_jump.rb
+++ b/bootstraptest/test_jump.rb
@@ -146,15 +146,16 @@ assert_equal %q{131}, %q{
     end
   }
 }
-assert_equal %q{ok}, %q{
+assert_match %r{Invalid retry}, %q{
+$stderr = STDOUT
 begin
   eval %q{
     1.times{
       retry
     }
   }
-rescue SyntaxError
-  :ok
+rescue SyntaxError => e
+  e.message
 end
 }
 assert_equal %q{3}, %q{
@@ -295,14 +296,19 @@ assert_equal "true", %q{
   s.return_eigenclass == class << s; self; end
 }, '[ruby-core:21379]'
 
-assert_equal "true", %q{
-  class Object
-    def yield_eigenclass
-      class << self
-        yield self
+assert_match %r{Invalid yield}, %q{
+$stderr = STDOUT
+begin
+  eval %q{
+    class Object
+      def yield_eigenclass
+        class << self
+          yield self
+        end
       end
     end
-  end
-  s = "foo"
-  s.yield_eigenclass {|c| c == class << s; self; end }
-}, '[ruby-dev:40975]'
+  }
+rescue SyntaxError => e
+  e.message
+end
+}
diff --git a/bootstraptest/test_literal.rb b/bootstraptest/test_literal.rb
index aa65bddae1..a0d4ee08c6 100644
--- a/bootstraptest/test_literal.rb
+++ b/bootstraptest/test_literal.rb
@@ -15,17 +15,17 @@ assert_equal 'sym',             ':sym'
 assert_equal ':sym',            ':sym.inspect'
 assert_equal 'Symbol',          ':sym.class'
 assert_equal '1234',            '1234'
-assert_equal 'Fixnum',          '1234.class'
+assert_equal 'Integer',         '1234.class'
 assert_equal '1234',            '1_2_3_4'
-assert_equal 'Fixnum',          '1_2_3_4.class'
+assert_equal 'Integer',         '1_2_3_4.class'
 assert_equal '18',              '0x12'
-assert_equal 'Fixnum',          '0x12.class'
+assert_equal 'Integer',         '0x12.class'
 assert_equal '15',              '0o17'
-assert_equal 'Fixnum',          '0o17.class'
+assert_equal 'Integer',         '0o17.class'
 assert_equal '5',               '0b101'
-assert_equal 'Fixnum',          '0b101.class'
+assert_equal 'Integer',         '0b101.class'
 assert_equal '123456789012345678901234567890', '123456789012345678901234567890'
-assert_equal 'Bignum',          '123456789012345678901234567890.class'
+assert_equal 'Integer',         '123456789012345678901234567890.class'
 assert_equal '2.0',             '2.0'
 assert_equal 'Float',           '1.3.class'
 
@@ -65,7 +65,8 @@ assert_equal ':a3c',            ':"a#{1+2}c".inspect'
 assert_equal 'Symbol',          ':"a#{1+2}c".class'
 
 # xstring
-unless nacl?
+# WASI doesn't support spawning a new process for now.
+if /wasi/ !~ target_platform
   assert_equal "foo\n",           %q(`echo foo`)
   assert_equal "foo\n",           %q(s = "foo"; `echo #{s}`)
 end
@@ -99,7 +100,7 @@ assert_equal '[3]',             '[3].inspect'
 assert_equal '3',               'a = [3]; a[0]'
 assert_equal 'Array',           '[1,2].class'
 assert_equal '2',               '[1,2].size'
-assert_equal '[1, 2]',           '[1,2].inspect'
+assert_equal '[1, 2]',          '[1,2].inspect'
 assert_equal 'Array',           '[1,2,3,4,5].class'
 assert_equal '5',               '[1,2,3,4,5].size'
 assert_equal '[1, 2, 3, 4, 5]', '[1,2,3,4,5].inspect'
@@ -169,7 +170,7 @@ assert_equal 'a',               'r = ("a".."c"); r.begin'
 assert_equal 'c',               'r = ("a".."c"); r.end'
 
 assert_equal 'String',          '__FILE__.class'
-assert_equal 'Fixnum',          '__LINE__.class'
+assert_equal 'Integer',         '__LINE__.class'
 
 ###
 
@@ -225,6 +226,24 @@ assert_equal 'ok', %q{ #  long hash literal (optimized)
   :ok
 }
 
+assert_equal 'ok', %q{ #  Bug #15536
+  eval <<-END
+    {
+      **{
+        a0: nil, a1: nil, a2: nil, a3: nil, a4: nil, a5: nil, a6: nil, a7: nil, a8: nil,
+      },
+      a0: nil, a1: nil, a2: nil, a3: nil, a4: nil, a5: nil, a6: nil, a7: nil, a8: nil,
+      **{
+        c: nil
+      },
+      b0: nil, b1: nil, b2: nil, b3: nil, b4: nil, b5: nil, b6: nil, b7: nil, b8: nil,
+      b9: nil, b10: nil, b11: nil, b12: nil, b13: nil, b14: nil, b15: nil, b16: nil,
+      b17: nil, b18: nil, b19: nil, b20: nil, b21: nil,
+    }
+  END
+  :ok
+}
+
 assert_equal 'ok', %q{
   [print(:ok), exit] # void literal with side-effect
   :dummy
diff --git a/bootstraptest/test_literal_suffix.rb b/bootstraptest/test_literal_suffix.rb
index 4316c9e040..c36fa7078f 100644
--- a/bootstraptest/test_literal_suffix.rb
+++ b/bootstraptest/test_literal_suffix.rb
@@ -46,9 +46,9 @@ assert_equal '1',               '1rescue nil'
 assert_equal '10000000000000000001/10000000000000000000',
              '1.0000000000000000001r'
 
-assert_equal 'syntax error, unexpected tIDENTIFIER, expecting end-of-input',
+assert_equal 'syntax error, unexpected local variable or method, expecting end-of-input',
              %q{begin eval('1ir', nil, '', 0); rescue SyntaxError => e; e.message[/\A:(?:\d+:)? (.*)/, 1] end}
-assert_equal 'syntax error, unexpected tIDENTIFIER, expecting end-of-input',
+assert_equal 'syntax error, unexpected local variable or method, expecting end-of-input',
              %q{begin eval('1.2ir', nil, '', 0); rescue SyntaxError => e; e.message[/\A:(?:\d+:)? (.*)/, 1] end}
-assert_equal 'syntax error, unexpected tIDENTIFIER, expecting end-of-input',
+assert_equal 'syntax error, unexpected local variable or method, expecting end-of-input',
              %q{begin eval('1e1r', nil, '', 0); rescue SyntaxError => e; e.message[/\A:(?:\d+:)? (.*)/, 1] end}
diff --git a/bootstraptest/test_method.rb b/bootstraptest/test_method.rb
index 639fe73397..04c9eb2d11 100644
--- a/bootstraptest/test_method.rb
+++ b/bootstraptest/test_method.rb
@@ -3,7 +3,7 @@ assert_equal '1',       'def m() 1 end; m()'
 assert_equal '1',       'def m(a) a end; m(1)'
 assert_equal '[1, 2]',  'def m(a,b) [a, b] end; m(1,2)'
 assert_equal '[1, 2, 3]', 'def m(a,b,c) [a, b, c] end; m(1,2,3)'
-assert_equal 'wrong number of arguments (1 for 0)', %q{
+assert_match /\Awrong number of arguments \(.*\b1\b.* 0\)\z/, %q{
   def m; end
   begin
     m(1)
@@ -12,7 +12,7 @@ assert_equal 'wrong number of arguments (1 for 0)', %q{
   end
 }
 
-assert_equal 'wrong number of arguments (0 for 1)', %q{
+assert_match /\Awrong number of arguments \(.*\b0\b.* 1\)\z/, %q{
   def m a; end
   begin
     m
@@ -22,7 +22,7 @@ assert_equal 'wrong number of arguments (0 for 1)', %q{
 }
 
 # default argument
-assert_equal '1',       'def m(x=1) x end; m()'
+assert_equal '1',       'def m(x=1) x end; m();'
 assert_equal '1',       'def m(x=7) x end; m(1)'
 assert_equal '1',       'def m(a,x=1) x end; m(7)'
 assert_equal '1',       'def m(a,x=7) x end; m(7,1)'
diff --git a/bootstraptest/test_objectspace.rb b/bootstraptest/test_objectspace.rb
index 862a94e376..63a8d99322 100644
--- a/bootstraptest/test_objectspace.rb
+++ b/bootstraptest/test_objectspace.rb
@@ -35,7 +35,7 @@ assert_normal_exit %q{
 
 assert_normal_exit %q{
   ObjectSpace.define_finalizer("") do
-    Mutex.new.lock
+    Thread::Mutex.new.lock
   end
 }, '[ruby-dev:44049]'
 
@@ -44,3 +44,12 @@ assert_normal_exit %q{
     Thread.new {}
   end
 }, '[ruby-core:37858]'
+
+assert_equal 'ok', %q{
+  objects_and_ids = 1000.times.map { o = Object.new; [o, o.object_id] }
+  objects_and_ids.each { |expected, id|
+    actual = ObjectSpace._id2ref(id)
+    raise "expected #{expected.inspect}, got #{actual.inspect}" unless actual.equal?(expected)
+  }
+  'ok'
+}
diff --git a/bootstraptest/test_proc.rb b/bootstraptest/test_proc.rb
index c23394e8d2..637603243d 100644
--- a/bootstraptest/test_proc.rb
+++ b/bootstraptest/test_proc.rb
@@ -224,19 +224,6 @@ assert_equal %q{[[nil, []], [1, []], [1, [2]], [1, [2, 3]]]}, %q{
   Proc.new{|a, *b| [a, b]}.call(1, 2, 3),
   ]
 }
-assert_equal %q{0}, %q{
-  pr = proc{
-    $SAFE
-  }
-  $SAFE = 1
-  pr.call
-}
-assert_equal %q{[1, 0]}, %q{
-  pr = proc{
-    $SAFE += 1
-  }
-  [pr.call, $SAFE]
-}
 assert_equal %q{1}, %q{
   def m(&b)
     b
@@ -380,8 +367,8 @@ assert_equal 'ok', %q{
 
 assert_equal 'ok', %q{
   class Foo
-    def call_it
-      p = Proc.new
+    def call_it(&block)
+      p = Proc.new(&block)
       p.call
     end
   end
diff --git a/bootstraptest/test_ractor.rb b/bootstraptest/test_ractor.rb
new file mode 100644
index 0000000000..67e66b03ee
--- /dev/null
+++ b/bootstraptest/test_ractor.rb
@@ -0,0 +1,1628 @@
+# Ractor.current returns a current ractor
+assert_equal 'Ractor', %q{
+  Ractor.current.class
+}
+
+# Ractor.new returns new Ractor
+assert_equal 'Ractor', %q{
+  Ractor.new{}.class
+}
+
+# Ractor.allocate is not supported
+assert_equal "[:ok, :ok]", %q{
+  rs = []
+  begin
+    Ractor.allocate
+  rescue => e
+    rs << :ok if e.message == 'allocator undefined for Ractor'
+  end
+
+  begin
+    Ractor.new{}.dup
+  rescue
+    rs << :ok if e.message == 'allocator undefined for Ractor'
+  end
+
+  rs
+}
+
+# A Ractor can have a name
+assert_equal 'test-name', %q{
+  r = Ractor.new name: 'test-name' do
+  end
+  r.name
+}
+
+# If Ractor doesn't have a name, Ractor#name returns nil.
+assert_equal 'nil', %q{
+  r = Ractor.new do
+  end
+  r.name.inspect
+}
+
+# Raises exceptions if initialize with an invalid name
+assert_equal 'ok', %q{
+  begin
+    r = Ractor.new(name: [{}]) {}
+  rescue TypeError => e
+    'ok'
+  end
+}
+
+# Ractor.new must call with a block
+assert_equal "must be called with a block", %q{
+  begin
+    Ractor.new
+  rescue ArgumentError => e
+    e.message
+  end
+}
+
+# Ractor#inspect
+# Return only id and status for main ractor
+assert_equal "#<Ractor:#1 running>", %q{
+  Ractor.current.inspect
+}
+
+# Return id, loc, and status for no-name ractor
+assert_match /^#<Ractor:#([^ ]*?) .+:[0-9]+ terminated>$/, %q{
+  r = Ractor.new { '' }
+  r.take
+  sleep 0.1 until r.inspect =~ /terminated/
+  r.inspect
+}
+
+# Return id, name, loc, and status for named ractor
+assert_match /^#<Ractor:#([^ ]*?) Test Ractor .+:[0-9]+ terminated>$/, %q{
+  r = Ractor.new(name: 'Test Ractor') { '' }
+  r.take
+  sleep 0.1 until r.inspect =~ /terminated/
+  r.inspect
+}
+
+# A return value of a Ractor block will be a message from the Ractor.
+assert_equal 'ok', %q{
+  # join
+  r = Ractor.new do
+    'ok'
+  end
+  r.take
+}
+
+# Passed arguments to Ractor.new will be a block parameter
+# The values are passed with Ractor-communication pass.
+assert_equal 'ok', %q{
+  # ping-pong with arg
+  r = Ractor.new 'ok' do |msg|
+    msg
+  end
+  r.take
+}
+
+# Pass multiple arguments to Ractor.new
+assert_equal 'ok', %q{
+  # ping-pong with two args
+  r =  Ractor.new 'ping', 'pong' do |msg, msg2|
+    [msg, msg2]
+  end
+  'ok' if r.take == ['ping', 'pong']
+}
+
+# Ractor#send passes an object with copy to a Ractor
+# and Ractor.receive in the Ractor block can receive the passed value.
+assert_equal 'ok', %q{
+  r = Ractor.new do
+    msg = Ractor.receive
+  end
+  r.send 'ok'
+  r.take
+}
+
+# Ractor#receive_if can filter the message
+assert_equal '[2, 3, 1]', %q{
+  r = Ractor.new Ractor.current do |main|
+    main << 1
+    main << 2
+    main << 3
+  end
+  a = []
+  a << Ractor.receive_if{|msg| msg == 2}
+  a << Ractor.receive_if{|msg| msg == 3}
+  a << Ractor.receive
+}
+
+# Ractor#receive_if with break
+assert_equal '[2, [1, :break], 3]', %q{
+  r = Ractor.new Ractor.current do |main|
+    main << 1
+    main << 2
+    main << 3
+  end
+
+  a = []
+  a << Ractor.receive_if{|msg| msg == 2}
+  a << Ractor.receive_if{|msg| break [msg, :break]}
+  a << Ractor.receive
+}
+
+# Ractor#receive_if can't be called recursively
+assert_equal '[[:e1, 1], [:e2, 2]]', %q{
+  r = Ractor.new Ractor.current do |main|
+    main << 1
+    main << 2
+    main << 3
+  end
+
+  a = []
+
+  Ractor.receive_if do |msg|
+    begin
+      Ractor.receive
+    rescue Ractor::Error
+      a << [:e1, msg]
+    end
+    true # delete 1 from queue
+  end
+
+  Ractor.receive_if do |msg|
+    begin
+      Ractor.receive_if{}
+    rescue Ractor::Error
+      a << [:e2, msg]
+    end
+    true # delete 2 from queue
+  end
+
+  a #
+}
+
+# dtoa race condition
+assert_equal '[:ok, :ok, :ok]', %q{
+  n = 3
+  n.times.map{
+    Ractor.new{
+      10_000.times{ rand.to_s }
+      :ok
+    }
+  }.map(&:take)
+}
+
+# Ractor.make_shareable issue for locals in proc [Bug #18023]
+assert_equal '[:a, :b, :c, :d, :e]', %q{
+  v1, v2, v3, v4, v5 = :a, :b, :c, :d, :e
+  closure = Ractor.current.instance_eval{ Proc.new { [v1, v2, v3, v4, v5] } }
+
+  Ractor.make_shareable(closure).call
+}
+
+# Ractor.make_shareable issue for locals in proc [Bug #18023]
+assert_equal '[:a, :b, :c, :d, :e, :f, :g]', %q{
+  a = :a
+  closure = Ractor.current.instance_eval do
+    -> {
+      b, c, d = :b, :c, :d
+      -> {
+        e, f, g = :e, :f, :g
+        -> { [a, b, c, d, e, f, g] }
+      }.call
+    }.call
+  end
+
+  Ractor.make_shareable(closure).call
+}
+
+# Now autoload in non-main Ractor is not supported
+assert_equal 'ok', %q{
+  autoload :Foo, 'foo.rb'
+  r = Ractor.new do
+    p Foo
+  rescue Ractor::UnsafeError
+    :ok
+  end
+  r.take
+}
+
+###
+###
+# Ractor still has several memory corruption so skip huge number of tests
+if ENV['GITHUB_WORKFLOW'] &&
+   ENV['GITHUB_WORKFLOW'] == 'Compilations'
+   # ignore the follow
+else
+
+# Ractor.select(*ractors) receives a values from a ractors.
+# It is similar to select(2) and Go's select syntax.
+# The return value is [ch, received_value]
+assert_equal 'ok', %q{
+  # select 1
+  r1 = Ractor.new{'r1'}
+  r, obj = Ractor.select(r1)
+  'ok' if r == r1 and obj == 'r1'
+}
+
+# Ractor.select from two ractors.
+assert_equal '["r1", "r2"]', %q{
+  # select 2
+  r1 = Ractor.new{'r1'}
+  r2 = Ractor.new{'r2'}
+  rs = [r1, r2]
+  as = []
+  r, obj = Ractor.select(*rs)
+  rs.delete(r)
+  as << obj
+  r, obj = Ractor.select(*rs)
+  as << obj
+  as.sort #=> ["r1", "r2"]
+}
+
+# Ractor.select from multiple ractors.
+assert_equal 30.times.map { 'ok' }.to_s, %q{
+  def test n
+    rs = (1..n).map do |i|
+      Ractor.new(i) do |i|
+        "r#{i}"
+      end
+    end
+    as = []
+    all_rs = rs.dup
+
+    n.times{
+      r, obj = Ractor.select(*rs)
+      as << [r, obj]
+      rs.delete(r)
+    }
+
+    if as.map{|r, o| r.object_id}.sort == all_rs.map{|r| r.object_id}.sort &&
+       as.map{|r, o| o}.sort == (1..n).map{|i| "r#{i}"}.sort
+      'ok'
+    else
+      'ng'
+    end
+  end
+
+  30.times.map{|i|
+    test i
+  }
+} unless ENV['RUN_OPTS'] =~ /--mjit-call-threshold=5/ || # This always fails with --mjit-wait --mjit-call-threshold=5
+  (ENV.key?('TRAVIS') && ENV['TRAVIS_CPU_ARCH'] == 'arm64') || # https://bugs.ruby-lang.org/issues/17878
+  true # too flaky everywhere http://ci.rvm.jp/results/trunk@ruby-sp1/4321096
+
+# Exception for empty select
+assert_match /specify at least one ractor/, %q{
+  begin
+    Ractor.select
+  rescue ArgumentError => e
+    e.message
+  end
+}
+
+# Outgoing port of a ractor will be closed when the Ractor is terminated.
+assert_equal 'ok', %q{
+  r = Ractor.new do
+    'finish'
+  end
+
+  r.take
+  sleep 0.1 until r.inspect =~ /terminated/
+
+  begin
+    o = r.take
+  rescue Ractor::ClosedError
+    'ok'
+  else
+    "ng: #{o}"
+  end
+}
+
+# Raise Ractor::ClosedError when try to send into a terminated ractor
+assert_equal 'ok', %q{
+  r = Ractor.new do
+  end
+
+  r.take # closed
+  sleep 0.1 until r.inspect =~ /terminated/
+
+  begin
+    r.send(1)
+  rescue Ractor::ClosedError
+    'ok'
+  else
+    'ng'
+  end
+}
+
+# Raise Ractor::ClosedError when try to send into a closed actor
+assert_equal 'ok', %q{
+  r = Ractor.new { Ractor.receive }
+  r.close_incoming
+
+  begin
+    r.send(1)
+  rescue Ractor::ClosedError
+    'ok'
+  else
+    'ng'
+  end
+}
+
+# Raise Ractor::ClosedError when try to take from closed actor
+assert_equal 'ok', %q{
+  r = Ractor.new do
+    Ractor.yield 1
+    Ractor.receive
+  end
+
+  r.close_outgoing
+  begin
+    r.take
+  rescue Ractor::ClosedError
+    'ok'
+  else
+    'ng'
+  end
+}
+
+# Can mix with Thread#interrupt and Ractor#take [Bug #17366]
+assert_equal 'err', %q{
+  Ractor.new{
+    t = Thread.current
+    begin
+      Thread.new{ t.raise "err" }.join
+    rescue => e
+      e.message
+    end
+  }.take
+}
+
+# Killed Ractor's thread yields nil
+assert_equal 'nil', %q{
+  Ractor.new{
+    t = Thread.current
+    Thread.new{ t.kill }.join
+  }.take.inspect #=> nil
+}
+
+# Ractor.yield raises Ractor::ClosedError when outgoing port is closed.
+assert_equal 'ok', %q{
+  r = Ractor.new Ractor.current do |main|
+    Ractor.receive
+    main << true
+    Ractor.yield 1
+  end
+
+  r.close_outgoing
+  r << true
+  Ractor.receive
+
+  begin
+    r.take
+  rescue Ractor::ClosedError
+    'ok'
+  else
+    'ng'
+  end
+}
+
+# Raise Ractor::ClosedError when try to send into a ractor with closed incoming port
+assert_equal 'ok', %q{
+  r = Ractor.new { Ractor.receive }
+  r.close_incoming
+
+  begin
+    r.send(1)
+  rescue Ractor::ClosedError
+    'ok'
+  else
+    'ng'
+  end
+}
+
+# A ractor with closed incoming port still can send messages out
+assert_equal '[1, 2]', %q{
+  r = Ractor.new do
+    Ractor.yield 1
+    2
+  end
+  r.close_incoming
+
+  [r.take, r.take]
+}
+
+# Raise Ractor::ClosedError when try to take from a ractor with closed outgoing port
+assert_equal 'ok', %q{
+  r = Ractor.new do
+    Ractor.yield 1
+    Ractor.receive
+  end
+
+  sleep 0.01 # wait for Ractor.yield in r
+  r.close_outgoing
+  begin
+    r.take
+  rescue Ractor::ClosedError
+    'ok'
+  else
+    'ng'
+  end
+}
+
+# A ractor with closed outgoing port still can receive messages from incoming port
+assert_equal 'ok', %q{
+  r = Ractor.new do
+    Ractor.receive
+  end
+
+  r.close_outgoing
+  begin
+    r.send(1)
+  rescue Ractor::ClosedError
+    'ng'
+  else
+    'ok'
+  end
+}
+
+# Ractor.main returns main ractor
+assert_equal 'true', %q{
+  Ractor.new{
+    Ractor.main
+  }.take == Ractor.current
+}
+
+# a ractor with closed outgoing port should terminate
+assert_equal 'ok', %q{
+  Ractor.new do
+    close_outgoing
+  end
+
+  true until Ractor.count == 1
+  :ok
+}
+
+# multiple Ractors can receive (wait) from one Ractor
+assert_equal '[0, 1, 2, 3, 4, 5, 6, 7, 8, 9]', %q{
+  pipe = Ractor.new do
+    loop do
+      Ractor.yield Ractor.receive
+    end
+  end
+
+  RN = 10
+  rs = RN.times.map{|i|
+    Ractor.new pipe, i do |pipe, i|
+      msg = pipe.take
+      msg # ping-pong
+    end
+  }
+  RN.times{|i|
+    pipe << i
+  }
+  RN.times.map{
+    r, n = Ractor.select(*rs)
+    rs.delete r
+    n
+  }.sort
+} unless /mswin/ =~ RUBY_PLATFORM # randomly hangs on mswin https://github.com/ruby/ruby/actions/runs/3753871445/jobs/6377551069#step:20:131
+
+# Ractor.select also support multiple take, receive and yield
+assert_equal '[true, true, true]', %q{
+  RN = 10
+  CR = Ractor.current
+
+  rs = (1..RN).map{
+    Ractor.new do
+      CR.send 'send' + CR.take #=> 'sendyield'
+      'take'
+    end
+  }
+  received = []
+  take = []
+  yielded = []
+  until rs.empty?
+    r, v = Ractor.select(CR, *rs, yield_value: 'yield')
+    case r
+    when :receive
+      received << v
+    when :yield
+      yielded << v
+    else
+      take << v
+      rs.delete r
+    end
+  end
+  [received.all?('sendyield'), yielded.all?(nil), take.all?('take')]
+}
+
+# multiple Ractors can send to one Ractor
+assert_equal '[0, 1, 2, 3, 4, 5, 6, 7, 8, 9]', %q{
+  pipe = Ractor.new do
+    loop do
+      Ractor.yield Ractor.receive
+    end
+  end
+
+  RN = 10
+  RN.times.map{|i|
+    Ractor.new pipe, i do |pipe, i|
+      pipe << i
+    end
+  }
+  RN.times.map{
+    pipe.take
+  }.sort
+}
+
+# an exception in a Ractor will be re-raised at Ractor#receive
+assert_equal '[RuntimeError, "ok", true]', %q{
+  r = Ractor.new do
+    raise 'ok' # exception will be transferred receiver
+  end
+  begin
+    r.take
+  rescue Ractor::RemoteError => e
+    [e.cause.class,   #=> RuntimeError
+     e.cause.message, #=> 'ok'
+     e.ractor == r]   #=> true
+  end
+}
+
+# threads in a ractor will killed
+assert_equal '{:ok=>3}', %q{
+  Ractor.new Ractor.current do |main|
+    q = Thread::Queue.new
+    Thread.new do
+      q << true
+      loop{}
+    ensure
+      main << :ok
+    end
+
+    Thread.new do
+      q << true
+      while true
+      end
+    ensure
+      main << :ok
+    end
+
+    Thread.new do
+      q << true
+      sleep 1
+    ensure
+      main << :ok
+    end
+
+    # wait for the start of all threads
+    3.times{q.pop}
+  end
+
+  3.times.map{Ractor.receive}.tally
+}
+
+# unshareable object are copied
+assert_equal 'false', %q{
+  obj = 'str'.dup
+  r = Ractor.new obj do |msg|
+    msg.object_id
+  end
+
+  obj.object_id == r.take
+}
+
+# To copy the object, now Marshal#dump is used
+assert_equal "allocator undefined for Thread", %q{
+  obj = Thread.new{}
+  begin
+    r = Ractor.new obj do |msg|
+      msg
+    end
+  rescue TypeError => e
+    e.message #=> no _dump_data is defined for class Thread
+  else
+    'ng'
+  end
+}
+
+# send shareable and unshareable objects
+assert_equal "ok", %q{
+  echo_ractor = Ractor.new do
+    loop do
+      v = Ractor.receive
+      Ractor.yield v
+    end
+  end
+
+  class C; end
+  module M; end
+  S = Struct.new(:a, :b, :c, :d)
+
+  shareable_objects = [
+    true,
+    false,
+    nil,
+    1,
+    1.1,    # Float
+    1+2r,   # Rational
+    3+4i,   # Complex
+    2**128, # Bignum
+    :sym,   # Symbol
+    'xyzzy'.to_sym, # dynamic symbol
+    'frozen'.freeze, # frozen String
+    /regexp/, # regexp literal
+    /reg{true}exp/.freeze, # frozen dregexp
+    [1, 2].freeze,   # frozen Array which only refers to shareable
+    {a: 1}.freeze,   # frozen Hash which only refers to shareable
+    [{a: 1}.freeze, 'str'.freeze].freeze, # nested frozen container
+    S.new(1, 2).freeze, # frozen Struct
+    S.new(1, 2, 3, 4).freeze, # frozen Struct
+    (1..2), # Range on Struct
+    (1..),  # Range on Struct
+    (..1),  # Range on Struct
+    C, # class
+    M, # module
+    Ractor.current, # Ractor
+  ]
+
+  unshareable_objects = [
+    'mutable str'.dup,
+    [:array],
+    {hash: true},
+    S.new(1, 2),
+    S.new(1, 2, 3, 4),
+    S.new("a", 2).freeze, # frozen, but refers to an unshareable object
+  ]
+
+  results = []
+
+  shareable_objects.map{|o|
+    echo_ractor << o
+    o2 = echo_ractor.take
+    results << "#{o} is copied" unless o.object_id == o2.object_id
+  }
+
+  unshareable_objects.map{|o|
+    echo_ractor << o
+    o2 = echo_ractor.take
+    results << "#{o.inspect} is not copied" if o.object_id == o2.object_id
+  }
+
+  if results.empty?
+    :ok
+  else
+    results.inspect
+  end
+}
+
+# frozen Objects are shareable
+assert_equal [false, true, false].inspect, %q{
+  class C
+    def initialize freeze
+      @a = 1
+      @b = :sym
+      @c = 'frozen_str'
+      @c.freeze if freeze
+      @d = true
+    end
+  end
+
+  def check obj1
+    obj2 = Ractor.new obj1 do |obj|
+      obj
+    end.take
+
+    obj1.object_id == obj2.object_id
+  end
+
+  results = []
+  results << check(C.new(true))         # false
+  results << check(C.new(true).freeze)  # true
+  results << check(C.new(false).freeze) # false
+}
+
+# move example2: String
+# touching moved object causes an error
+assert_equal 'hello world', %q{
+  # move
+  r = Ractor.new do
+    obj = Ractor.receive
+    obj << ' world'
+  end
+
+  str = 'hello'
+  r.send str, move: true
+  modified = r.take
+
+  begin
+    str << ' exception' # raise Ractor::MovedError
+  rescue Ractor::MovedError
+    modified #=> 'hello world'
+  else
+    raise 'unreachable'
+  end
+}
+
+# move example2: Array
+assert_equal '[0, 1]', %q{
+  r = Ractor.new do
+    ary = Ractor.receive
+    ary << 1
+  end
+
+  a1 = [0]
+  r.send a1, move: true
+  a2 = r.take
+  begin
+    a1 << 2 # raise Ractor::MovedError
+  rescue Ractor::MovedError
+    a2.inspect
+  end
+}
+
+# move with yield
+assert_equal 'hello', %q{
+  r = Ractor.new do
+    Thread.current.report_on_exception = false
+    obj = 'hello'
+    Ractor.yield obj, move: true
+    obj << 'world'
+  end
+
+  str = r.take
+  begin
+    r.take
+  rescue Ractor::RemoteError
+    str #=> "hello"
+  end
+}
+
+# yield/move should not make moved object when the yield is not succeeded
+assert_equal '"str"', %q{
+  R = Ractor.new{}
+  M = Ractor.current
+  r = Ractor.new do
+    s = 'str'
+    selected_r, v = Ractor.select R, yield_value: s, move: true
+    raise if selected_r != R # taken from R
+    M.send s.inspect # s should not be a moved object
+  end
+
+  Ractor.receive
+}
+
+# yield/move can fail
+assert_equal "allocator undefined for Thread", %q{
+  r = Ractor.new do
+    obj = Thread.new{}
+    Ractor.yield obj
+  rescue => e
+    e.message
+  end
+  r.take
+}
+
+# Access to global-variables are prohibited
+assert_equal 'can not access global variables $gv from non-main Ractors', %q{
+  $gv = 1
+  r = Ractor.new do
+    $gv
+  end
+
+  begin
+    r.take
+  rescue Ractor::RemoteError => e
+    e.cause.message
+  end
+}
+
+# Access to global-variables are prohibited
+assert_equal 'can not access global variables $gv from non-main Ractors', %q{
+  r = Ractor.new do
+    $gv = 1
+  end
+
+  begin
+    r.take
+  rescue Ractor::RemoteError => e
+    e.cause.message
+  end
+}
+
+# $stdin,out,err is Ractor local, but shared fds
+assert_equal 'ok', %q{
+  r = Ractor.new do
+    [$stdin, $stdout, $stderr].map{|io|
+      [io.object_id, io.fileno]
+    }
+  end
+
+  [$stdin, $stdout, $stderr].zip(r.take){|io, (oid, fno)|
+    raise "should not be different object" if io.object_id == oid
+    raise "fd should be same" unless io.fileno == fno
+  }
+  'ok'
+}
+
+# $stdin,out,err belong to Ractor
+assert_equal 'ok', %q{
+  r = Ractor.new do
+    $stdin.itself
+    $stdout.itself
+    $stderr.itself
+    'ok'
+  end
+
+  r.take
+}
+
+# $DEBUG, $VERBOSE are Ractor local
+assert_equal 'true', %q{
+  $DEBUG = true
+  $VERBOSE = true
+
+  def ractor_local_globals
+    /a(b)(c)d/ =~ 'abcd' # for $~
+    `echo foo` unless  /solaris/ =~ RUBY_PLATFORM
+
+    {
+     # ractor-local (derived from created ractor): debug
+     '$DEBUG' => $DEBUG,
+     '$-d' => $-d,
+
+     # ractor-local (derived from created ractor): verbose
+     '$VERBOSE' => $VERBOSE,
+     '$-w' => $-w,
+     '$-W' => $-W,
+     '$-v' => $-v,
+
+     # process-local (readonly): other commandline parameters
+     '$-p' => $-p,
+     '$-l' => $-l,
+     '$-a' => $-a,
+
+     # process-local (readonly): getpid
+     '$$'  => $$,
+
+     # thread local: process result
+     '$?'  => $?,
+
+     # scope local: match
+     '$~'  => $~.inspect,
+     '$&'  => $&,
+     '$`'  => $`,
+     '$\''  => $',
+     '$+'  => $+,
+     '$1'  => $1,
+
+     # scope local: last line
+     '$_' => $_,
+
+     # scope local: last backtrace
+     '$@' => $@,
+     '$!' => $!,
+
+     # ractor local: stdin, out, err
+     '$stdin'  => $stdin.inspect,
+     '$stdout' => $stdout.inspect,
+     '$stderr' => $stderr.inspect,
+    }
+  end
+
+  h = Ractor.new do
+    ractor_local_globals
+  end.take
+  ractor_local_globals == h #=> true
+}
+
+# selfs are different objects
+assert_equal 'false', %q{
+  r = Ractor.new do
+    self.object_id
+  end
+  r.take == self.object_id #=> false
+}
+
+# self is a Ractor instance
+assert_equal 'true', %q{
+  r = Ractor.new do
+    self.object_id
+  end
+  r.object_id == r.take #=> true
+}
+
+# given block Proc will be isolated, so can not access outer variables.
+assert_equal 'ArgumentError', %q{
+  begin
+    a = true
+    r = Ractor.new do
+      a
+    end
+  rescue => e
+    e.class
+  end
+}
+
+# ivar in shareable-objects are not allowed to access from non-main Ractor
+assert_equal "can not get unshareable values from instance variables of classes/modules from non-main Ractors", %q{
+  class C
+    @iv = 'str'
+  end
+
+  r = Ractor.new do
+    class C
+      p @iv
+    end
+  end
+
+
+  begin
+    r.take
+  rescue Ractor::RemoteError => e
+    e.cause.message
+  end
+}
+
+# ivar in shareable-objects are not allowed to access from non-main Ractor
+assert_equal 'can not access instance variables of shareable objects from non-main Ractors', %q{
+  shared = Ractor.new{}
+  shared.instance_variable_set(:@iv, 'str')
+
+  r = Ractor.new shared do |shared|
+    p shared.instance_variable_get(:@iv)
+  end
+
+  begin
+    r.take
+  rescue Ractor::RemoteError => e
+    e.cause.message
+  end
+}
+
+# ivar in shareable-objects are not allowed to access from non-main Ractor, by @iv (get)
+assert_equal 'can not access instance variables of shareable objects from non-main Ractors', %q{
+  class Ractor
+    def setup
+      @foo = ''
+    end
+
+    def foo
+      @foo
+    end
+  end
+
+  shared = Ractor.new{}
+  shared.setup
+
+  r = Ractor.new shared do |shared|
+    p shared.foo
+  end
+
+  begin
+    r.take
+  rescue Ractor::RemoteError => e
+    e.cause.message
+  end
+}
+
+# ivar in shareable-objects are not allowed to access from non-main Ractor, by @iv (set)
+assert_equal 'can not access instance variables of shareable objects from non-main Ractors', %q{
+  class Ractor
+    def setup
+      @foo = ''
+    end
+  end
+
+  shared = Ractor.new{}
+
+  r = Ractor.new shared do |shared|
+    p shared.setup
+  end
+
+  begin
+    r.take
+  rescue Ractor::RemoteError => e
+    e.cause.message
+  end
+}
+
+# But a shareable object is frozen, it is allowed to access ivars from non-main Ractor
+assert_equal '11', %q{
+  [Object.new, [], ].map{|obj|
+    obj.instance_variable_set('@a', 1)
+    Ractor.make_shareable obj = obj.freeze
+
+    Ractor.new obj do |obj|
+      obj.instance_variable_get('@a')
+    end.take.to_s
+  }.join
+}
+
+# and instance variables of classes/modules are accessible if they refer shareable objects
+assert_equal '333', %q{
+  class C
+    @int = 1
+    @str = '-1000'.dup
+    @fstr = '100'.freeze
+
+    def self.int = @int
+    def self.str = @str
+    def self.fstr = @fstr
+  end
+
+  module M
+    @int = 2
+    @str = '-2000'.dup
+    @fstr = '200'.freeze
+
+    def self.int = @int
+    def self.str = @str
+    def self.fstr = @fstr
+  end
+
+  a = Ractor.new{ C.int }.take
+  b = Ractor.new do
+    C.str.to_i
+  rescue Ractor::IsolationError
+    10
+  end.take
+  c = Ractor.new do
+    C.fstr.to_i
+  end.take
+
+  d = Ractor.new{ M.int }.take
+  e = Ractor.new do
+    M.str.to_i
+  rescue Ractor::IsolationError
+    20
+  end.take
+  f = Ractor.new do
+    M.fstr.to_i
+  end.take
+
+
+  # 1 + 10 + 100 + 2 + 20 + 200
+  a + b + c + d + e + f
+}
+
+# cvar in shareable-objects are not allowed to access from non-main Ractor
+assert_equal 'can not access class variables from non-main Ractors', %q{
+  class C
+    @@cv = 'str'
+  end
+
+  r = Ractor.new do
+    class C
+      p @@cv
+    end
+  end
+
+  begin
+    r.take
+  rescue Ractor::RemoteError => e
+    e.cause.message
+  end
+}
+
+# also cached cvar in shareable-objects are not allowed to access from non-main Ractor
+assert_equal 'can not access class variables from non-main Ractors', %q{
+  class C
+    @@cv = 'str'
+    def self.cv
+      @@cv
+    end
+  end
+
+  C.cv # cache
+
+  r = Ractor.new do
+    C.cv
+  end
+
+  begin
+    r.take
+  rescue Ractor::RemoteError => e
+    e.cause.message
+  end
+}
+
+# Getting non-shareable objects via constants by other Ractors is not allowed
+assert_equal 'can not access non-shareable objects in constant C::CONST by non-main Ractor.', %q{
+  class C
+    CONST = 'str'
+  end
+  r = Ractor.new do
+    C::CONST
+  end
+  begin
+    r.take
+  rescue Ractor::RemoteError => e
+    e.cause.message
+  end
+}
+
+# Constant cache should care about non-sharable constants
+assert_equal "can not access non-shareable objects in constant Object::STR by non-main Ractor.", %q{
+  STR = "hello"
+  def str; STR; end
+  s = str() # fill const cache
+  begin
+    Ractor.new{ str() }.take
+  rescue Ractor::RemoteError => e
+    e.cause.message
+  end
+}
+
+# Setting non-shareable objects into constants by other Ractors is not allowed
+assert_equal 'can not set constants with non-shareable objects by non-main Ractors', %q{
+  class C
+  end
+  r = Ractor.new do
+    C::CONST = 'str'
+  end
+  begin
+    r.take
+  rescue Ractor::RemoteError => e
+    e.cause.message
+  end
+}
+
+# define_method is not allowed
+assert_equal "defined with an un-shareable Proc in a different Ractor", %q{
+  str = "foo"
+  define_method(:buggy){|i| str << "#{i}"}
+  begin
+    Ractor.new{buggy(10)}.take
+  rescue => e
+    e.cause.message
+  end
+}
+
+# Immutable Array and Hash are shareable, so it can be shared with constants
+assert_equal '[1000, 3]', %q{
+  A = Array.new(1000).freeze # [nil, ...]
+  H = {a: 1, b: 2, c: 3}.freeze
+
+  Ractor.new{ [A.size, H.size] }.take
+}
+
+# Ractor.count
+assert_equal '[1, 4, 3, 2, 1]', %q{
+  counts = []
+  counts << Ractor.count
+  ractors = (1..3).map { Ractor.new { Ractor.receive } }
+  counts << Ractor.count
+
+  ractors[0].send('End 0').take
+  sleep 0.1 until ractors[0].inspect =~ /terminated/
+  counts << Ractor.count
+
+  ractors[1].send('End 1').take
+  sleep 0.1 until ractors[1].inspect =~ /terminated/
+  counts << Ractor.count
+
+  ractors[2].send('End 2').take
+  sleep 0.1 until ractors[2].inspect =~ /terminated/
+  counts << Ractor.count
+
+  counts.inspect
+}
+
+# ObjectSpace.each_object can not handle unshareable objects with Ractors
+assert_equal '0', %q{
+  Ractor.new{
+    n = 0
+    ObjectSpace.each_object{|o| n += 1 unless Ractor.shareable?(o)}
+    n
+  }.take
+}
+
+# ObjectSpace._id2ref can not handle unshareable objects with Ractors
+assert_equal 'ok', %q{
+  s = 'hello'
+
+  Ractor.new s.object_id do |id ;s|
+    begin
+      s = ObjectSpace._id2ref(id)
+    rescue => e
+      :ok
+    end
+  end.take
+}
+
+# Ractor.make_shareable(obj)
+assert_equal 'true', %q{
+  class C
+    def initialize
+      @a = 'foo'
+      @b = 'bar'
+    end
+
+    def freeze
+      @c = [:freeze_called]
+      super
+    end
+
+    attr_reader :a, :b, :c
+  end
+  S = Struct.new(:s1, :s2)
+  str = "hello"
+  str.instance_variable_set("@iv", "hello")
+  /a/ =~ 'a'
+  m = $~
+  class N < Numeric
+    def /(other)
+      1
+    end
+  end
+  ary = []; ary << ary
+
+  a = [[1, ['2', '3']],
+       {Object.new => "hello"},
+       C.new,
+       S.new("x", "y"),
+       ("a".."b"),
+       str,
+       ary,             # cycle
+       /regexp/,
+       /#{'r'.upcase}/,
+       m,
+       Complex(N.new,0),
+       Rational(N.new,0),
+       true,
+       false,
+       nil,
+       1, 1.2, 1+3r, 1+4i, # Numeric
+  ]
+  Ractor.make_shareable(a)
+
+  # check all frozen
+  a.each{|o|
+    raise o.inspect unless o.frozen?
+
+    case o
+    when C
+      raise o.a.inspect unless o.a.frozen?
+      raise o.b.inspect unless o.b.frozen?
+      raise o.c.inspect unless o.c.frozen? && o.c == [:freeze_called]
+    when Rational
+      raise o.numerator.inspect unless o.numerator.frozen?
+    when Complex
+      raise o.real.inspect unless o.real.frozen?
+    when Array
+      if o[0] == 1
+        raise o[1][1].inspect unless o[1][1].frozen?
+      end
+    when Hash
+      o.each{|k, v|
+        raise k.inspect unless k.frozen?
+        raise v.inspect unless v.frozen?
+      }
+    end
+  }
+
+  Ractor.shareable?(a)
+}
+
+# Ractor.make_shareable(obj) doesn't freeze shareable objects
+assert_equal 'true', %q{
+  r = Ractor.new{}
+  Ractor.make_shareable(a = [r])
+  [a.frozen?, a[0].frozen?] == [true, false]
+}
+
+# Ractor.make_shareable(a_proc) makes a proc shareable.
+assert_equal 'true', %q{
+  a = [1, [2, 3], {a: "4"}]
+
+  pr = Ractor.current.instance_eval do
+    Proc.new do
+      a
+    end
+  end
+
+  Ractor.make_shareable(a) # referred value should be shareable
+  Ractor.make_shareable(pr)
+  Ractor.shareable?(pr)
+}
+
+# Ractor.shareable?(recursive_objects)
+assert_equal '[false, false]', %q{
+  y = []
+  x = [y, {}].freeze
+  y << x
+  y.freeze
+  [Ractor.shareable?(x), Ractor.shareable?(y)]
+}
+
+# Ractor.make_shareable(recursive_objects)
+assert_equal '[:ok, false, false]', %q{
+  o = Object.new
+  def o.freeze; raise; end
+  y = []
+  x = [y, o].freeze
+  y << x
+  y.freeze
+  [(Ractor.make_shareable(x) rescue :ok), Ractor.shareable?(x), Ractor.shareable?(y)]
+}
+
+# Ractor.make_shareable with Class/Module
+assert_equal '[C, M]', %q{
+  class C; end
+  module M; end
+
+  Ractor.make_shareable(ary = [C, M])
+}
+
+# define_method() can invoke different Ractor's proc if the proc is shareable.
+assert_equal '1', %q{
+  class C
+    a = 1
+    define_method "foo", Ractor.make_shareable(Proc.new{ a })
+    a = 2
+  end
+
+  Ractor.new{ C.new.foo }.take
+}
+
+# Ractor.make_shareable(a_proc) makes a proc shareable.
+assert_equal 'can not make a Proc shareable because it accesses outer variables (a).', %q{
+  a = b = nil
+  pr = Ractor.current.instance_eval do
+    Proc.new do
+      c = b # assign to a is okay because c is block local variable
+      # reading b is okay
+      a = b # assign to a is not allowed #=> Ractor::Error
+    end
+  end
+
+  begin
+    Ractor.make_shareable(pr)
+  rescue => e
+    e.message
+  end
+}
+
+# Ractor.make_shareable(obj, copy: true) makes copied shareable object.
+assert_equal '[false, false, true, true]', %q{
+  r = []
+  o1 = [1, 2, ["3"]]
+
+  o2 = Ractor.make_shareable(o1, copy: true)
+  r << Ractor.shareable?(o1) # false
+  r << (o1.object_id == o2.object_id) # false
+
+  o3 = Ractor.make_shareable(o1)
+  r << Ractor.shareable?(o1) # true
+  r << (o1.object_id == o3.object_id) # false
+  r
+}
+
+# TracePoint with normal Proc should be Ractor local
+assert_equal '[4, 8]', %q{
+  rs = []
+  TracePoint.new(:line){|tp| rs << tp.lineno if tp.path == __FILE__}.enable do
+    Ractor.new{ # line 4
+      a = 1
+      b = 2
+    }.take
+    c = 3       # line 8
+  end
+  rs
+}
+
+# Ractor deep copies frozen objects (ary)
+assert_equal '[true, false]', %q{
+  Ractor.new([[]].freeze) { |ary|
+    [ary.frozen?, ary.first.frozen? ]
+  }.take
+}
+
+# Ractor deep copies frozen objects (str)
+assert_equal '[true, false]', %q{
+  s = String.new.instance_eval { @x = []; freeze}
+  Ractor.new(s) { |s|
+    [s.frozen?, s.instance_variable_get(:@x).frozen?]
+  }.take
+}
+
+# Can not trap with not isolated Proc on non-main ractor
+assert_equal '[:ok, :ok]', %q{
+  a = []
+  Ractor.new{
+    trap(:INT){p :ok}
+  }.take
+  a << :ok
+
+  begin
+    Ractor.new{
+      s = 'str'
+      trap(:INT){p s}
+    }.take
+  rescue => Ractor::RemoteError
+    a << :ok
+  end
+}
+
+# Ractor-local storage
+assert_equal '[nil, "b", "a"]', %q{
+  ans = []
+  Ractor.current[:key] = 'a'
+  r = Ractor.new{
+    Ractor.yield self[:key]
+    self[:key] = 'b'
+    self[:key]
+  }
+  ans << r.take
+  ans << r.take
+  ans << Ractor.current[:key]
+}
+
+###
+### Synchronization tests
+###
+
+N = 100_000
+
+# fstring pool
+assert_equal "#{N}#{N}", %Q{
+  N = #{N}
+  2.times.map{
+    Ractor.new{
+      N.times{|i| -(i.to_s)}
+    }
+  }.map{|r| r.take}.join
+}
+
+# enc_table
+assert_equal "100", %Q{
+  Ractor.new do
+    loop do
+      Encoding.find("test-enc-#{rand(5_000)}").inspect
+    rescue ArgumentError => e
+    end
+  end
+
+  src = Encoding.find("UTF-8")
+  100.times{|i|
+    src.replicate("test-enc-\#{i}")
+  }
+}
+
+# Generic ivtbl
+n = N/2
+assert_equal "#{n}#{n}", %Q{
+  2.times.map{
+    Ractor.new do
+      #{n}.times do
+        obj = ''
+        obj.instance_variable_set("@a", 1)
+        obj.instance_variable_set("@b", 1)
+        obj.instance_variable_set("@c", 1)
+        obj.instance_variable_defined?("@a")
+      end
+    end
+  }.map{|r| r.take}.join
+}
+
+# NameError
+assert_equal "ok", %q{
+  begin
+    bar
+  rescue => err
+  end
+  begin
+    Ractor.new{} << err
+  rescue TypeError
+    'ok'
+  end
+}
+
+assert_equal "ok", %q{
+  GC.disable
+  Ractor.new {}
+  raise "not ok" unless GC.disable
+
+  foo = []
+  10.times { foo << 1 }
+
+  GC.start
+
+  'ok'
+}
+
+# Can yield back values while GC is sweeping [Bug #18117]
+assert_equal "ok", %q{
+  workers = (0...8).map do
+    Ractor.new do
+      loop do
+        10_000.times.map { Object.new }
+        Ractor.yield Time.now
+      end
+    end
+  end
+
+  1_000.times { idle_worker, tmp_reporter = Ractor.select(*workers) }
+  "ok"
+}
+
+assert_equal "ok", %q{
+  def foo(*); ->{ super }; end
+  begin
+    Ractor.make_shareable(foo)
+  rescue Ractor::IsolationError
+    "ok"
+  end
+}
+
+assert_equal "ok", %q{
+  def foo(**); ->{ super }; end
+  begin
+    Ractor.make_shareable(foo)
+  rescue Ractor::IsolationError
+    "ok"
+  end
+}
+
+assert_equal "ok", %q{
+  def foo(...); ->{ super }; end
+  begin
+    Ractor.make_shareable(foo)
+  rescue Ractor::IsolationError
+    "ok"
+  end
+}
+
+assert_equal "ok", %q{
+  def foo((x), (y)); ->{ super }; end
+  begin
+    Ractor.make_shareable(foo([], []))
+  rescue Ractor::IsolationError
+    "ok"
+  end
+}
+
+assert_equal "ok", %q{
+  module M
+    def foo
+      @foo
+    end
+  end
+
+  class A
+    include M
+
+    def initialize
+      100.times { |i| instance_variable_set(:"@var_#{i}", "bad: #{i}") }
+      @foo = 2
+    end
+  end
+
+  class B
+    include M
+
+    def initialize
+      @foo = 1
+    end
+  end
+
+  Ractor.new do
+    b = B.new
+    100_000.times do
+      raise unless b.foo == 1
+    end
+  end
+
+  a = A.new
+  100_000.times do
+    raise unless a.foo == 2
+  end
+
+  "ok"
+}
+
+assert_match /\Atest_ractor\.rb:1:\s+warning:\s+Ractor is experimental/, %q{
+  Warning[:experimental] = $VERBOSE = true
+  STDERR.reopen(STDOUT)
+  eval("Ractor.new{}.take", nil, "test_ractor.rb", 1)
+}
+
+end # if !ENV['GITHUB_WORKFLOW']
diff --git a/bootstraptest/test_syntax.rb b/bootstraptest/test_syntax.rb
index a111990a1f..948e2d7809 100644
--- a/bootstraptest/test_syntax.rb
+++ b/bootstraptest/test_syntax.rb
@@ -268,8 +268,10 @@ assert_equal %q{}, %q{
   defined?(@@a)
 }
 assert_equal %q{class variable}, %q{
-  @@a = 1
-  defined?(@@a)
+  class A
+    @@a = 1
+    defined?(@@a)
+  end
 }
 assert_equal %q{}, %q{
   defined?($a)
@@ -626,7 +628,7 @@ assert_equal '2', %q{
 }
 
 assert_match /invalid multibyte char/, %q{
-  STDERR.reopen(STDOUT)
+  $stderr = STDOUT
   eval("\"\xf0".force_encoding("utf-8"))
 }, '[ruby-dev:32429]'
 
diff --git a/bootstraptest/test_thread.rb b/bootstraptest/test_thread.rb
index d64f44be49..5361828403 100644
--- a/bootstraptest/test_thread.rb
+++ b/bootstraptest/test_thread.rb
@@ -1,4 +1,14 @@
-# Thread and Fiber
+show_limit %q{
+  threads = []
+  begin
+    threads << Thread.new{sleep}
+
+    raise Exception, "skipping" if threads.count >= 10_000
+  rescue Exception => error
+    puts "Thread count: #{threads.count} (#{error})"
+    break
+  end while true
+} if false # disable to pass CI
 
 assert_equal %q{ok}, %q{
   Thread.new{
@@ -25,8 +35,9 @@ rescue ThreadError => e
   :ok if /can't create Thread/ =~ e.message
 end
 }
-assert_equal %q{5000}, %q{
-  5000.times{|e|
+assert_equal %q{ok}, %q{
+begin
+  :ok if 5000 == 5000.times{|e|
     (1..2).map{
       Thread.new{
       }
@@ -34,9 +45,13 @@ assert_equal %q{5000}, %q{
       e.join()
     }
   }
+rescue ThreadError => e
+  /can't create Thread/ =~ e.message ? :ok : e.message
+end
 }
-assert_equal %q{5000}, %q{
-  5000.times{|e|
+assert_equal %q{ok}, %q{
+begin
+  :ok if 5000 == 5000.times{|e|
     (1..2).map{
       Thread.new{
       }
@@ -44,6 +59,9 @@ assert_equal %q{5000}, %q{
       e.join(1000000000)
     }
   }
+rescue ThreadError => e
+  /can't create Thread/ =~ e.message ? :ok : e.message
+end
 }
 assert_equal %q{ok}, %q{
 begin
@@ -225,7 +243,7 @@ assert_equal 'true', %{
 }
 
 assert_equal 'ok', %{
-  open("zzz.rb", "w") do |f|
+  open("zzz_t1.rb", "w") do |f|
     f.puts <<-END
       begin
         Thread.new { fork { GC.start } }.join
@@ -236,7 +254,7 @@ assert_equal 'ok', %{
       end
     END
   end
-  require "./zzz.rb"
+  require "./zzz_t1.rb"
   $result
 }
 
@@ -291,10 +309,6 @@ assert_equal 'ok', %q{
 }, '[ruby-dev:34492]'
 
 assert_normal_exit %q{
-  at_exit { Fiber.new{}.resume }
-}
-
-assert_normal_exit %q{
   g = enum_for(:local_variables)
   loop { g.next }
 }, '[ruby-dev:34128]'
@@ -320,10 +334,6 @@ assert_normal_exit %q{
 }, '[ruby-dev:34128]'
 
 assert_normal_exit %q{
-  Fiber.new(&Object.method(:class_eval)).resume("foo")
-}, '[ruby-dev:34128]'
-
-assert_normal_exit %q{
   Thread.new("foo", &Object.method(:class_eval)).join
 }, '[ruby-dev:34128]'
 
@@ -339,7 +349,7 @@ assert_equal 'ok', %q{
 
 assert_equal 'ok', %q{
   begin
-    m1, m2 = Mutex.new, Mutex.new
+    m1, m2 = Thread::Mutex.new, Thread::Mutex.new
     f1 = f2 = false
     Thread.new { m1.lock; f2 = true; sleep 0.001 until f1; m2.lock }
     m2.lock; f1 = true; sleep 0.001 until f2; m1.lock
@@ -350,32 +360,32 @@ assert_equal 'ok', %q{
 }
 
 assert_equal 'ok', %q{
-  m = Mutex.new
+  m = Thread::Mutex.new
   Thread.new { m.lock }; sleep 0.1; m.lock
   :ok
 }
 
 assert_equal 'ok', %q{
-  m = Mutex.new
+  m = Thread::Mutex.new
   Thread.new { m.lock }; m.lock
   :ok
 }
 
 assert_equal 'ok', %q{
-  m = Mutex.new
+  m = Thread::Mutex.new
   Thread.new { m.lock }.join; m.lock
   :ok
 }
 
 assert_equal 'ok', %q{
-  m = Mutex.new
+  m = Thread::Mutex.new
   Thread.new { m.lock; sleep 0.2 }
   sleep 0.1; m.lock
   :ok
 }
 
 assert_equal 'ok', %q{
-  m = Mutex.new
+  m = Thread::Mutex.new
   Thread.new { m.lock; sleep 0.2; m.unlock }
   sleep 0.1; m.lock
   :ok
@@ -398,10 +408,10 @@ assert_equal 'ok', %q{
 }
 
 assert_equal 'ok', %{
-  open("zzz.rb", "w") do |f|
+  open("zzz_t2.rb", "w") do |f|
     f.puts <<-'end;' # do
       begin
-        m = Mutex.new
+        m = Thread::Mutex.new
         parent = Thread.current
         th1 = Thread.new { m.lock; sleep }
         sleep 0.01 until th1.stop?
@@ -422,15 +432,15 @@ assert_equal 'ok', %{
       end
     end;
   end
-  require "./zzz.rb"
+  require "./zzz_t2.rb"
   $result
 }
 
 assert_finish 3, %q{
   require 'thread'
 
-  lock = Mutex.new
-  cond = ConditionVariable.new
+  lock = Thread::Mutex.new
+  cond = Thread::ConditionVariable.new
   t = Thread.new do
     lock.synchronize do
       cond.wait(lock)
@@ -474,3 +484,17 @@ assert_equal 'foo', %q{
   GC.start
   f.call.source
 }
+assert_normal_exit %q{
+  class C
+    def inspect
+      sleep 0.5
+      'C!!'
+    end
+  end
+  Thread.new{
+    loop{
+      p C.new
+    }
+  }
+  sleep 0.1
+}, timeout: 5
diff --git a/bootstraptest/test_yjit.rb b/bootstraptest/test_yjit.rb
new file mode 100644
index 0000000000..5c655b8f25
--- /dev/null
+++ b/bootstraptest/test_yjit.rb
@@ -0,0 +1,3530 @@
+# Regression test for yielding with autosplat to block with
+# optional parameters. https://github.com/Shopify/yjit/issues/313
+assert_equal '[:a, :b, :a, :b]', %q{
+  def yielder(arg) = yield(arg) + yield(arg)
+
+  yielder([:a, :b]) do |c = :c, d = :d|
+    [c, d]
+  end
+}
+
+# Regression test for GC mishap while doing shape transition
+assert_equal '[:ok]', %q{
+  # [Bug #19601]
+  class RegressionTest
+    def initialize
+      @a = @b = @fourth_ivar_does_shape_transition = nil
+    end
+
+    def extender
+      @first_extended_ivar = [:ok]
+    end
+  end
+
+  GC.stress = true
+
+  # Used to crash due to GC run in rb_ensure_iv_list_size()
+  # not marking the newly allocated [:ok].
+  RegressionTest.new.extender.itself
+}
+
+assert_equal 'true', %q{
+  # regression test for tracking type of locals for too long
+  def local_setting_cmp(five)
+    victim = 5
+    five.define_singleton_method(:respond_to?) do |_, _|
+      victim = nil
+    end
+
+    # +1 makes YJIT track that victim is a number and
+    # defined? calls respond_to? from above indirectly
+    unless (victim + 1) && defined?(five.something)
+      # Would return wrong result if we still think `five` is a number
+      victim.nil?
+    end
+  end
+
+  local_setting_cmp(Object.new)
+  local_setting_cmp(Object.new)
+}
+
+assert_equal '18374962167983112447', %q{
+  # regression test for incorrectly discarding 32 bits of a pointer when it
+  # comes to default values.
+  def large_literal_default(n: 0xff00_fabcafe0_00ff)
+    n
+  end
+
+  def call_graph_root
+    large_literal_default
+  end
+
+  call_graph_root
+  call_graph_root
+}
+
+assert_normal_exit %q{
+  # regression test for a leak caught by an assert on --yjit-call-threshold=2
+  Foo = 1
+
+  eval("def foo = [#{(['Foo,']*256).join}]")
+
+  foo
+  foo
+
+  Object.send(:remove_const, :Foo)
+}
+
+assert_normal_exit %q{
+  # Test to ensure send on overriden c functions
+  # doesn't corrupt the stack
+  class Bar
+    def bar(x)
+      x
+    end
+  end
+
+  class Foo
+    def bar
+      Bar.new
+    end
+  end
+
+  foo = Foo.new
+  # before this change, this line would error
+  # because "s" would still be on the stack
+  # String.to_s is the overridden method here
+  p foo.bar.bar("s".__send__(:to_s))
+}
+
+
+assert_equal '[nil, nil, nil, nil, nil, nil]', %q{
+  [NilClass, TrueClass, FalseClass, Integer, Float, Symbol].each do |klass|
+    klass.class_eval("def foo = @foo")
+  end
+
+  [nil, true, false, 0xFABCAFE, 0.42, :cake].map do |instance|
+    instance.foo
+    instance.foo
+  end
+}
+
+assert_equal '0', %q{
+  # This is a regression test for incomplete invalidation from
+  # opt_setinlinecache. This test might be brittle, so
+  # feel free to remove it in the future if it's too annoying.
+  # This test assumes --yjit-call-threshold=2.
+  module M
+    Foo = 1
+    def foo
+      Foo
+    end
+
+    def pin_self_type_then_foo
+      _ = @foo
+      foo
+    end
+
+    def only_ints
+      1 + self
+      foo
+    end
+  end
+
+  class Integer
+    include M
+  end
+
+  class Sub
+    include M
+  end
+
+  foo_method = M.instance_method(:foo)
+
+  dbg = ->(message) do
+    return # comment this out to get printouts
+
+    $stderr.puts RubyVM::YJIT.disasm(foo_method)
+    $stderr.puts message
+  end
+
+  2.times { 42.only_ints }
+
+  dbg["There should be two versions of getinlineache"]
+
+  module M
+    remove_const(:Foo)
+  end
+
+  dbg["There should be no getinlinecaches"]
+
+  2.times do
+    42.only_ints
+  rescue NameError => err
+    _ = "caught name error #{err}"
+  end
+
+  dbg["There should be one version of getinlineache"]
+
+  2.times do
+    Sub.new.pin_self_type_then_foo
+  rescue NameError
+    _ = 'second specialization'
+  end
+
+  dbg["There should be two versions of getinlineache"]
+
+  module M
+    Foo = 1
+  end
+
+  dbg["There should still be two versions of getinlineache"]
+
+  42.only_ints
+
+  dbg["There should be no getinlinecaches"]
+
+  # Find name of the first VM instruction in M#foo.
+  insns = RubyVM::InstructionSequence.of(foo_method).to_a
+  if defined?(RubyVM::YJIT.blocks_for) && (insns.last.find { Array === _1 }&.first == :opt_getinlinecache)
+    RubyVM::YJIT.blocks_for(RubyVM::InstructionSequence.of(foo_method))
+      .filter { _1.iseq_start_index == 0 }.count
+  else
+    0 # skip the test
+  end
+}
+
+# Check that frozen objects are respected
+assert_equal 'great', %q{
+  class Foo
+    attr_accessor :bar
+    def initialize
+      @bar = 1
+      freeze
+    end
+  end
+
+  foo = Foo.new
+
+  5.times do
+    begin
+      foo.bar = 2
+    rescue FrozenError
+    end
+  end
+
+  foo.bar == 1 ? "great" : "NG"
+}
+
+# Check that global variable set works
+assert_equal 'string', %q{
+  def foo
+    $foo = "string"
+  end
+
+  foo
+}
+
+# Check that exceptions work when setting global variables
+assert_equal 'rescued', %q{
+  def set_var
+    $var = 100
+  rescue
+    :rescued
+  end
+
+  set_var
+  trace_var(:$var) { raise }
+  set_var
+}
+
+# Check that global variables work
+assert_equal 'string', %q{
+  $foo = "string"
+
+  def foo
+    $foo
+  end
+
+  foo
+}
+
+# Check that exceptions work when getting global variable
+assert_equal 'rescued', %q{
+  Warning[:deprecated] = true
+
+  module Warning
+    def warn(message)
+      raise
+    end
+  end
+
+  def get_var
+    $=
+  rescue
+    :rescued
+  end
+
+  $VERBOSE = true
+  get_var
+  get_var
+}
+
+# Check that global tracepoints work
+assert_equal 'true', %q{
+  def foo
+    1
+  end
+
+  foo
+  foo
+  foo
+
+  called = false
+
+  tp = TracePoint.new(:return) { |event|
+    if event.method_id == :foo
+      called = true
+    end
+  }
+  tp.enable
+  foo
+  tp.disable
+  called
+}
+
+# Check that local tracepoints work
+assert_equal 'true', %q{
+  def foo
+    1
+  end
+
+  foo
+  foo
+  foo
+
+  called = false
+
+  tp = TracePoint.new(:return) { |_| called = true }
+  tp.enable(target: method(:foo))
+  foo
+  tp.disable
+  called
+}
+
+# Make sure that optional param methods return the correct value
+assert_equal '1', %q{
+  def m(ary = [])
+    yield(ary)
+  end
+
+  # Warm the JIT with a 0 param call
+  2.times { m { } }
+  m(1) { |v| v }
+}
+
+# Test for topn
+assert_equal 'array', %q{
+  def threequals(a)
+    case a
+    when Array
+      "array"
+    when Hash
+      "hash"
+    else
+      "unknown"
+    end
+  end
+
+  threequals([])
+  threequals([])
+  threequals([])
+}
+
+# Test for opt_mod
+assert_equal '2', %q{
+  def mod(a, b)
+    a % b
+  end
+
+  mod(7, 5)
+  mod(7, 5)
+}
+
+# Test for opt_mult
+assert_equal '12', %q{
+  def mult(a, b)
+    a * b
+  end
+
+  mult(6, 2)
+  mult(6, 2)
+}
+
+# Test for opt_div
+assert_equal '3', %q{
+  def div(a, b)
+    a / b
+  end
+
+  div(6, 2)
+  div(6, 2)
+}
+
+# BOP redefined methods work when JIT compiled
+assert_equal 'false', %q{
+  def less_than x
+    x < 10
+  end
+
+  class Integer
+    def < x
+      false
+    end
+  end
+
+  less_than 2
+  less_than 2
+  less_than 2
+}
+
+# BOP redefinition works on Integer#<
+assert_equal 'false', %q{
+  def less_than x
+    x < 10
+  end
+
+  less_than 2
+  less_than 2
+
+  class Integer
+    def < x
+      false
+    end
+  end
+
+  less_than 2
+}
+
+# Putobject, less-than operator, fixnums
+assert_equal '2', %q{
+    def check_index(index)
+        if 0x40000000 < index
+            raise "wat? #{index}"
+        end
+        index
+    end
+    check_index 2
+    check_index 2
+}
+
+# foo leaves a temp on the stack before the call
+assert_equal '6', %q{
+    def bar
+        return 5
+    end
+
+    def foo
+        return 1 + bar
+    end
+
+    foo()
+    retval = foo()
+}
+
+# Method with one arguments
+# foo leaves a temp on the stack before the call
+assert_equal '7', %q{
+    def bar(a)
+        return a + 1
+    end
+
+    def foo
+        return 1 + bar(5)
+    end
+
+    foo()
+    retval = foo()
+}
+
+# Method with two arguments
+# foo leaves a temp on the stack before the call
+assert_equal '0', %q{
+    def bar(a, b)
+        return a - b
+    end
+
+    def foo
+        return 1 + bar(1, 2)
+    end
+
+    foo()
+    retval = foo()
+}
+
+# Passing argument types to callees
+assert_equal '8.5', %q{
+    def foo(x, y)
+        x + y
+    end
+
+    def bar
+        foo(7, 1.5)
+    end
+
+    bar
+    bar
+}
+
+# Recursive Ruby-to-Ruby calls
+assert_equal '21', %q{
+    def fib(n)
+        if n < 2
+            return n
+        end
+
+        return fib(n-1) + fib(n-2)
+    end
+
+    r = fib(8)
+}
+
+# Ruby-to-Ruby call and C call
+assert_normal_exit %q{
+  def bar
+    puts('hi!')
+  end
+
+  def foo
+    bar
+  end
+
+  foo()
+  foo()
+}
+
+# Method aliasing
+assert_equal '42', %q{
+  class Foo
+    def method_a
+      42
+    end
+
+    alias method_b method_a
+
+    def method_a
+        :somethingelse
+    end
+  end
+
+  @obj = Foo.new
+
+  def test
+    @obj.method_b
+  end
+
+  test
+  test
+}
+
+# Method aliasing with method from parent class
+assert_equal '777', %q{
+  class A
+    def method_a
+      777
+    end
+  end
+
+  class B < A
+    alias method_b method_a
+  end
+
+  @obj = B.new
+
+  def test
+    @obj.method_b
+  end
+
+  test
+  test
+}
+
+# The hash method is a C function and uses the self argument
+assert_equal 'true', %q{
+    def lehashself
+        hash
+    end
+
+    a = lehashself
+    b = lehashself
+    a == b
+}
+
+# Method redefinition (code invalidation) test
+assert_equal '1', %q{
+    def ret1
+        return 1
+    end
+
+    klass = Class.new do
+        def alias_then_hash(klass, method_to_redefine)
+            # Redefine the method to be ret1
+            klass.alias_method(method_to_redefine, :ret1)
+            hash
+        end
+    end
+
+    instance = klass.new
+
+    i = 0
+    while i < 12
+        if i < 11
+            # Redefine the bar method
+            instance.alias_then_hash(klass, :bar)
+        else
+            # Redefine the hash method to be ret1
+            retval = instance.alias_then_hash(klass, :hash)
+        end
+        i += 1
+    end
+
+    retval
+}
+
+# Code invalidation and opt_getinlinecache
+assert_normal_exit %q{
+  class Foo; end
+
+  # Uses the class constant Foo
+  def use_constant(arg)
+    [Foo.new, arg]
+  end
+
+  def propagate_type
+    i = Array.new
+    i.itself # make it remember that i is on-heap
+    use_constant(i)
+  end
+
+  propagate_type
+  propagate_type
+  use_constant(Foo.new)
+  class Jo; end # bump global constant state
+  use_constant(3)
+}
+
+# Method redefinition (code invalidation) and GC
+assert_equal '7', %q{
+    def bar()
+        return 5
+    end
+
+    def foo()
+        bar()
+    end
+
+    foo()
+    foo()
+
+    def bar()
+        return 7
+    end
+
+    4.times { GC.start }
+
+    foo()
+    foo()
+}
+
+# Method redefinition with two block versions
+assert_equal '7', %q{
+    def bar()
+        return 5
+    end
+
+    def foo(n)
+        return ((n < 5)? 5:false), bar()
+    end
+
+    foo(4)
+    foo(4)
+    foo(10)
+    foo(10)
+
+    def bar()
+        return 7
+    end
+
+    4.times { GC.start }
+
+    foo(4)
+    foo(4)[1]
+}
+
+# Method redefinition while the method is on the stack
+assert_equal '[777, 1]', %q{
+    def foo
+        redef()
+        777
+    end
+
+    def redef
+        # Redefine the global foo
+        eval("def foo; 1; end", TOPLEVEL_BINDING)
+
+        # Collect dead code
+        GC.stress = true
+        GC.start
+
+        # But we will return to the original foo,
+        # which remains alive because it's on the stack
+    end
+
+    # Must produce [777, 1]
+    [foo, foo]
+}
+
+# Test for GC safety. Don't invalidate dead iseqs.
+assert_normal_exit %q{
+  Class.new do
+    def foo
+      itself
+    end
+
+    new.foo
+    new.foo
+    new.foo
+    new.foo
+  end
+
+  4.times { GC.start }
+  def itself
+    self
+  end
+}
+
+# test setinstancevariable on extended objects
+assert_equal '1', %q{
+  class Extended
+    attr_reader :one
+
+    def write_many
+      @a = 1
+      @b = 2
+      @c = 3
+      @d = 4
+      @one = 1
+    end
+  end
+
+  foo = Extended.new
+  foo.write_many
+  foo.write_many
+  foo.write_many
+}
+
+# test setinstancevariable on embedded objects
+assert_equal '1', %q{
+  class Embedded
+    attr_reader :one
+
+    def write_one
+      @one = 1
+    end
+  end
+
+  foo = Embedded.new
+  foo.write_one
+  foo.write_one
+  foo.write_one
+}
+
+# test setinstancevariable after extension
+assert_equal '[10, 11, 12, 13, 1]', %q{
+  class WillExtend
+    attr_reader :one
+
+    def make_extended
+      @foo1 = 10
+      @foo2 = 11
+      @foo3 = 12
+      @foo4 = 13
+    end
+
+    def write_one
+      @one = 1
+    end
+
+    def read_all
+      [@foo1, @foo2, @foo3, @foo4, @one]
+    end
+  end
+
+  foo = WillExtend.new
+  foo.write_one
+  foo.write_one
+  foo.make_extended
+  foo.write_one
+  foo.read_all
+}
+
+# test setinstancevariable on frozen object
+assert_equal 'object was not modified', %q{
+  class WillFreeze
+    def write
+      @ivar = 1
+    end
+  end
+
+  wf = WillFreeze.new
+  wf.write
+  wf.write
+  wf.freeze
+
+  begin
+    wf.write
+  rescue FrozenError
+    "object was not modified"
+  end
+}
+
+# Test getinstancevariable and inline caches
+assert_equal '6', %q{
+  class Foo
+    def initialize
+      @x1 = 1
+      @x2 = 1
+      @x2 = 1
+      @x3 = 1
+      @x4 = 3
+    end
+
+    def bar
+      x = 1
+      @x4 + @x4
+    end
+  end
+
+  f = Foo.new
+  f.bar
+  f.bar
+}
+
+# Test that getinstancevariable codegen checks for extended table size
+assert_equal "nil\n", %q{
+  class A
+    def read
+      @ins1000
+    end
+  end
+
+  ins = A.new
+  other = A.new
+  10.times { other.instance_variable_set(:"@otr#{_1}", 'value') }
+  1001.times { ins.instance_variable_set(:"@ins#{_1}", 'value') }
+
+  ins.read
+  ins.read
+  ins.read
+
+  p other.read
+}
+
+# Test that opt_aref checks the class of the receiver
+assert_equal 'special', %q{
+  def foo(array)
+    array[30]
+  end
+
+  foo([])
+  foo([])
+
+  special = []
+  def special.[](idx)
+    'special'
+  end
+
+  foo(special)
+}
+
+# Test that object references in generated code get marked and moved
+assert_equal "good", %q{
+  def bar
+    "good"
+  end
+
+  def foo
+    bar
+  end
+
+  foo
+  foo
+
+  begin
+    GC.verify_compaction_references(expand_heap: true, toward: :empty)
+  rescue NotImplementedError
+    # in case compaction isn't supported
+  end
+
+  foo
+}
+
+# Test polymorphic getinstancevariable. T_OBJECT -> T_STRING
+assert_equal 'ok', %q{
+  @hello = @h1 = @h2 = @h3 = @h4 = 'ok'
+  str = ""
+  str.instance_variable_set(:@hello, 'ok')
+
+  public def get
+    @hello
+  end
+
+  get
+  get
+  str.get
+  str.get
+}
+
+# Test polymorphic getinstancevariable, two different classes
+assert_equal 'ok', %q{
+  class Embedded
+    def initialize
+      @ivar = 0
+    end
+
+    def get
+      @ivar
+    end
+  end
+
+  class Extended < Embedded
+    def initialize
+      @v1 = @v2 = @v3 = @v4 = @ivar = 'ok'
+    end
+  end
+
+  embed = Embedded.new
+  extend = Extended.new
+
+  embed.get
+  embed.get
+  extend.get
+  extend.get
+}
+
+# Test megamorphic getinstancevariable
+assert_equal 'ok', %q{
+  parent = Class.new do
+    def initialize
+      @hello = @h1 = @h2 = @h3 = @h4 = 'ok'
+    end
+
+    def get
+      @hello
+    end
+  end
+
+  subclasses = 300.times.map { Class.new(parent) }
+  subclasses.each { _1.new.get }
+  parent.new.get
+}
+
+# Test polymorphic opt_aref. array -> hash
+assert_equal '[42, :key]', %q{
+  def index(obj, idx)
+    obj[idx]
+  end
+
+  index([], 0) # get over compilation threshold
+
+  [
+    index([42], 0),
+    index({0=>:key}, 0),
+  ]
+}
+
+# Test polymorphic opt_aref. hash -> array -> custom class
+assert_equal '[nil, nil, :custom]', %q{
+  def index(obj, idx)
+    obj[idx]
+  end
+
+  custom = Object.new
+  def custom.[](_idx)
+    :custom
+  end
+
+  index({}, 0) # get over compilation threshold
+
+  [
+    index({}, 0),
+    index([], 0),
+    index(custom, 0)
+  ]
+}
+
+# Test polymorphic opt_aref. array -> custom class
+assert_equal '[42, :custom]', %q{
+  def index(obj, idx)
+    obj[idx]
+  end
+
+  custom = Object.new
+  def custom.[](_idx)
+    :custom
+  end
+
+  index([], 0) # get over compilation threshold
+
+  [
+    index([42], 0),
+    index(custom, 0)
+  ]
+}
+
+# Test custom hash method with opt_aref
+assert_equal '[nil, :ok]', %q{
+  def index(obj, idx)
+    obj[idx]
+  end
+
+  custom = Object.new
+  def custom.hash
+    42
+  end
+
+  h = {custom => :ok}
+
+  [
+    index(h, 0),
+    index(h, custom)
+  ]
+}
+
+# Test default value block for Hash with opt_aref
+assert_equal '[42, :default]', %q{
+  def index(obj, idx)
+    obj[idx]
+  end
+
+  h = Hash.new { :default }
+  h[0] = 42
+
+  [
+    index(h, 0),
+    index(h, 1)
+  ]
+}
+
+# A regression test for making sure cfp->sp is proper when
+# hitting stubs. See :stub-sp-flush:
+assert_equal 'ok', %q{
+  class D
+    def foo
+      Object.new
+    end
+  end
+
+  GC.stress = true
+  10.times do
+    D.new.foo
+    #    ^
+    #  This hits a stub with sp_offset > 0
+  end
+
+  :ok
+}
+
+# Test polymorphic callsite, cfunc -> iseq
+assert_equal '[Cfunc, Iseq]', %q{
+  public def call_itself
+    itself # the polymorphic callsite
+  end
+
+  class Cfunc; end
+
+  class Iseq
+    def itself
+      self
+    end
+  end
+
+  call_itself # cross threshold
+
+  [Cfunc.call_itself, Iseq.call_itself]
+}
+
+# Test polymorphic callsite, iseq -> cfunc
+assert_equal '[Iseq, Cfunc]', %q{
+  public def call_itself
+    itself # the polymorphic callsite
+  end
+
+  class Cfunc; end
+
+  class Iseq
+    def itself
+      self
+    end
+  end
+
+  call_itself # cross threshold
+
+  [Iseq.call_itself, Cfunc.call_itself]
+}
+
+# attr_reader method
+assert_equal '[100, 299]', %q{
+  class A
+    attr_reader :foo
+
+    def initialize
+      @foo = 100
+    end
+
+    # Make it extended
+    def fill!
+      @bar = @jojo = @as = @sdfsdf = @foo = 299
+    end
+  end
+
+  def bar(ins)
+    ins.foo
+  end
+
+  ins = A.new
+  oth = A.new
+  oth.fill!
+
+  bar(ins)
+  bar(oth)
+
+  [bar(ins), bar(oth)]
+}
+
+# get ivar on object, then on hash
+assert_equal '[42, 100]', %q{
+  class Hash
+    attr_accessor :foo
+  end
+
+  class A
+    attr_reader :foo
+
+    def initialize
+      @foo = 42
+    end
+  end
+
+  def use(val)
+    val.foo
+  end
+
+
+  h = {}
+  h.foo = 100
+  obj = A.new
+
+  use(obj)
+  [use(obj), use(h)]
+}
+
+# get ivar on String
+assert_equal '[nil, nil, 42, 42]', %q{
+  # @foo to exercise the getinstancevariable instruction
+  public def get_foo
+    @foo
+  end
+
+  get_foo
+  get_foo # compile it for the top level object
+
+  class String
+    attr_reader :foo
+  end
+
+  def run
+    str = String.new
+
+    getter = str.foo
+    insn = str.get_foo
+
+    str.instance_variable_set(:@foo, 42)
+
+    [getter, insn, str.foo, str.get_foo]
+  end
+
+  run
+  run
+}
+
+# splatting an empty array on a getter
+assert_equal '42', %q{
+  @foo = 42
+  module Kernel
+    attr_reader :foo
+  end
+
+  def run
+    foo(*[])
+  end
+
+  run
+  run
+}
+
+# splatting an empty array on a specialized method
+assert_equal 'ok', %q{
+  def run
+    "ok".to_s(*[])
+  end
+
+  run
+  run
+}
+
+# splatting an single element array on a specialized method
+assert_equal '[1]', %q{
+  def run
+    [].<<(*[1])
+  end
+
+  run
+  run
+}
+
+# specialized method with wrong args
+assert_equal 'ok', %q{
+  def run(x)
+    "bad".to_s(123) if x
+  rescue
+    :ok
+  end
+
+  run(false)
+  run(true)
+}
+
+# getinstancevariable on Symbol
+assert_equal '[nil, nil]', %q{
+  # @foo to exercise the getinstancevariable instruction
+  public def get_foo
+    @foo
+  end
+
+  dyn_sym = ("a" + "b").to_sym
+  sym = :static
+
+  # compile get_foo
+  dyn_sym.get_foo
+  dyn_sym.get_foo
+
+  [dyn_sym.get_foo, sym.get_foo]
+}
+
+# attr_reader on Symbol
+assert_equal '[nil, nil]', %q{
+  class Symbol
+    attr_reader :foo
+  end
+
+  public def get_foo
+    foo
+  end
+
+  dyn_sym = ("a" + "b").to_sym
+  sym = :static
+
+  # compile get_foo
+  dyn_sym.get_foo
+  dyn_sym.get_foo
+
+  [dyn_sym.get_foo, sym.get_foo]
+}
+
+# passing too few arguments to method with optional parameters
+assert_equal 'raised', %q{
+  def opt(a, b = 0)
+  end
+
+  def use
+    opt
+  end
+
+  use rescue nil
+  begin
+    use
+    :ng
+  rescue ArgumentError
+    :raised
+  end
+}
+
+# passing too many arguments to method with optional parameters
+assert_equal 'raised', %q{
+  def opt(a, b = 0)
+  end
+
+  def use
+    opt(1, 2, 3, 4)
+  end
+
+  use rescue nil
+  begin
+    use
+    :ng
+  rescue ArgumentError
+    :raised
+  end
+}
+
+# test calling Ruby method with a block
+assert_equal '[1, 2, 42]', %q{
+  def thing(a, b)
+    [a, b, yield]
+  end
+
+  def use
+    thing(1,2) { 42 }
+  end
+
+  use
+  use
+}
+
+# test calling C method with a block
+assert_equal '[42, 42]', %q{
+  def use(array, initial)
+    array.reduce(initial) { |a, b| a + b }
+  end
+
+  use([], 0)
+  [use([2, 2], 38), use([14, 14, 14], 0)]
+}
+
+# test calling block param
+assert_equal '[1, 2, 42]', %q{
+  def foo(&block)
+    block.call
+  end
+
+  [foo {1}, foo {2}, foo {42}]
+}
+
+# test calling without block param
+assert_equal '[1, false, 2, false]', %q{
+  def bar
+    block_given? && yield
+  end
+
+  def foo(&block)
+    bar(&block)
+  end
+
+  [foo { 1 }, foo, foo { 2 }, foo]
+}
+
+# test calling block param failing
+assert_equal '42', %q{
+  def foo(&block)
+    block.call
+  end
+
+  foo {} # warmup
+
+  begin
+    foo
+  rescue NoMethodError => e
+    42 if nil == e.receiver
+  end
+}
+
+# test calling method taking block param
+assert_equal '[Proc, 1, 2, 3, Proc]', %q{
+  def three(a, b, c, &block)
+    [a, b, c, block.class]
+  end
+
+  def zero(&block)
+    block.class
+  end
+
+  def use_three
+    three(1, 2, 3) {}
+  end
+
+  def use_zero
+    zero {}
+  end
+
+  use_three
+  use_zero
+
+  [use_zero] + use_three
+}
+
+# test building empty array
+assert_equal '[]', %q{
+  def build_arr
+    []
+  end
+
+  build_arr
+  build_arr
+}
+
+# test building array of one element
+assert_equal '[5]', %q{
+  def build_arr(val)
+    [val]
+  end
+
+  build_arr(5)
+  build_arr(5)
+}
+
+# test building array of several element
+assert_equal '[5, 5, 5, 5, 5]', %q{
+  def build_arr(val)
+    [val, val, val, val, val]
+  end
+
+  build_arr(5)
+  build_arr(5)
+}
+
+# test building empty hash
+assert_equal '{}', %q{
+  def build_hash
+    {}
+  end
+
+  build_hash
+  build_hash
+}
+
+# test building hash with values
+assert_equal '{:foo=>:bar}', %q{
+  def build_hash(val)
+    { foo: val }
+  end
+
+  build_hash(:bar)
+  build_hash(:bar)
+}
+
+# test string interpolation with known types
+assert_equal 'foobar', %q{
+  def make_str
+    foo = -"foo"
+    bar = -"bar"
+    "#{foo}#{bar}"
+  end
+
+  make_str
+  make_str
+}
+
+# test string interpolation with unknown types
+assert_equal 'foobar', %q{
+  def make_str(foo, bar)
+    "#{foo}#{bar}"
+  end
+
+  make_str("foo", "bar")
+  make_str("foo", "bar")
+}
+
+# test string interpolation with known non-strings
+assert_equal 'foo123', %q{
+  def make_str
+    foo = -"foo"
+    bar = 123
+    "#{foo}#{bar}"
+  end
+
+  make_str
+  make_str
+}
+
+# test string interpolation with unknown non-strings
+assert_equal 'foo123', %q{
+  def make_str(foo, bar)
+    "#{foo}#{bar}"
+  end
+
+  make_str("foo", 123)
+  make_str("foo", 123)
+}
+
+# test that invalidation of String#to_s doesn't crash
+assert_equal 'meh', %q{
+  def inval_method
+    "".to_s
+  end
+
+  inval_method
+
+  class String
+    def to_s
+      "meh"
+    end
+  end
+
+  inval_method
+}
+
+# test that overriding to_s on a String subclass works consistently
+assert_equal 'meh', %q{
+  class MyString < String
+    def to_s
+      "meh"
+    end
+  end
+
+  def test_to_s(obj)
+    obj.to_s
+  end
+
+  OBJ = MyString.new
+
+  # Should return '' both times
+  test_to_s("")
+  test_to_s("")
+
+  # Can return '' if YJIT optimises String#to_s too aggressively
+  test_to_s(OBJ)
+  test_to_s(OBJ)
+}
+
+# test string interpolation with overridden to_s
+assert_equal 'foo', %q{
+  class String
+    def to_s
+      "bad"
+    end
+  end
+
+  def make_str(foo)
+    "#{foo}"
+  end
+
+  make_str("foo")
+  make_str("foo")
+}
+
+# Test that String unary plus returns the same object ID for an unfrozen string.
+assert_equal 'true', %q{
+  def jittable_method
+    str = "bar"
+
+    old_obj_id = str.object_id
+    uplus_str = +str
+
+    uplus_str.object_id == old_obj_id
+  end
+  jittable_method
+}
+
+# Test that String unary plus returns a different unfrozen string when given a frozen string
+assert_equal 'false', %q{
+  # Logic needs to be inside an ISEQ, such as a method, for YJIT to compile it
+  def jittable_method
+    frozen_str = "foo".freeze
+
+    old_obj_id = frozen_str.object_id
+    uplus_str = +frozen_str
+
+    uplus_str.object_id == old_obj_id || uplus_str.frozen?
+  end
+
+  jittable_method
+}
+
+# String-subclass objects should behave as expected inside string-interpolation via concatstrings
+assert_equal 'monkeys / monkeys, yo!', %q{
+  class MyString < String
+    # This is a terrible idea in production code, but we'd like YJIT to match CRuby
+    def to_s
+      super + ", yo!"
+    end
+  end
+
+  def jittable_method
+    m = MyString.new('monkeys')
+    "#{m} / #{m.to_s}"
+  end
+
+  jittable_method
+}
+
+# String-subclass objects should behave as expected for string equality
+assert_equal 'false', %q{
+  class MyString < String
+    # This is a terrible idea in production code, but we'd like YJIT to match CRuby
+    def ==(b)
+      "#{self}_" == b
+    end
+  end
+
+  def jittable_method
+    ma = MyString.new("a")
+
+    # Check equality with string-subclass receiver
+    ma == "a" || ma != "a_" ||
+      # Check equality with string receiver
+      "a_" == ma || "a" != ma ||
+      # Check equality between string subclasses
+      ma != MyString.new("a_") ||
+      # Make sure "string always equals itself" check isn't used with overridden equality
+      ma == ma
+  end
+  jittable_method
+}
+
+# Test to_s duplicates a string subclass object but not a string
+assert_equal 'false', %q{
+  class MyString < String; end
+
+  def jittable_method
+    a = "a"
+    ma = MyString.new("a")
+
+    a.object_id != a.to_s.object_id ||
+      ma.object_id == ma.to_s.object_id
+  end
+  jittable_method
+}
+
+# Test freeze on string subclass
+assert_equal 'true', %q{
+  class MyString < String; end
+
+  def jittable_method
+    fma = MyString.new("a").freeze
+
+    # Freezing a string subclass should not duplicate it
+    fma.object_id == fma.freeze.object_id
+  end
+  jittable_method
+}
+
+# Test unary minus on string subclass
+assert_equal 'true', %q{
+  class MyString < String; end
+
+  def jittable_method
+    ma = MyString.new("a")
+    fma = MyString.new("a").freeze
+
+    # Unary minus on frozen string subclass should not duplicate it
+    fma.object_id == (-fma).object_id &&
+      # Unary minus on unfrozen string subclass should duplicate it
+      ma.object_id != (-ma).object_id
+  end
+  jittable_method
+}
+
+# Test unary plus on string subclass
+assert_equal 'true', %q{
+  class MyString < String; end
+
+  def jittable_method
+    fma = MyString.new("a").freeze
+
+    # Unary plus on frozen string subclass should not duplicate it
+    fma.object_id != (+fma).object_id
+  end
+  jittable_method
+}
+
+# Test << operator on string subclass
+assert_equal 'abab', %q{
+  class MyString < String; end
+
+  def jittable_method
+    a = -"a"
+    mb = MyString.new("b")
+
+    buf = String.new
+    mbuf = MyString.new
+
+    buf << a << mb
+    mbuf << a << mb
+
+    buf + mbuf
+  end
+  jittable_method
+}
+
+# test invokebuiltin as used in struct assignment
+assert_equal '123', %q{
+  def foo(obj)
+    obj.foo = 123
+  end
+
+  struct = Struct.new(:foo)
+  obj = struct.new
+  foo(obj)
+  foo(obj)
+}
+
+# test invokebuiltin_delegate as used inside Dir.open
+assert_equal '.', %q{
+  def foo(path)
+    Dir.open(path).path
+  end
+
+  foo(".")
+  foo(".")
+}
+
+# test invokebuiltin_delegate_leave in method called from jit
+assert_normal_exit %q{
+  def foo(obj)
+    obj.clone
+  end
+
+  foo(Object.new)
+  foo(Object.new)
+}
+
+# test invokebuiltin_delegate_leave in method called from cfunc
+assert_normal_exit %q{
+  def foo(obj)
+    [obj].map(&:clone)
+  end
+
+  foo(Object.new)
+  foo(Object.new)
+}
+
+# defining TrueClass#!
+assert_equal '[false, false, :ok]', %q{
+  def foo(obj)
+    !obj
+  end
+
+  x = foo(true)
+  y = foo(true)
+
+  class TrueClass
+    def !
+      :ok
+    end
+  end
+
+  z = foo(true)
+
+  [x, y, z]
+}
+
+# defining FalseClass#!
+assert_equal '[true, true, :ok]', %q{
+  def foo(obj)
+    !obj
+  end
+
+  x = foo(false)
+  y = foo(false)
+
+  class FalseClass
+    def !
+      :ok
+    end
+  end
+
+  z = foo(false)
+
+  [x, y, z]
+}
+
+# defining NilClass#!
+assert_equal '[true, true, :ok]', %q{
+  def foo(obj)
+    !obj
+  end
+
+  x = foo(nil)
+  y = foo(nil)
+
+  class NilClass
+    def !
+      :ok
+    end
+  end
+
+  z = foo(nil)
+
+  [x, y, z]
+}
+
+# polymorphic opt_not
+assert_equal '[true, true, false, false, false, false, false]', %q{
+  def foo(obj)
+    !obj
+  end
+
+  foo(0)
+  [foo(nil), foo(false), foo(true), foo([]), foo(0), foo(4.2), foo(:sym)]
+}
+
+# getlocal with 2 levels
+assert_equal '7', %q{
+  def foo(foo, bar)
+    while foo > 0
+      while bar > 0
+        return foo + bar
+      end
+    end
+  end
+
+  foo(5,2)
+  foo(5,2)
+}
+
+# test pattern matching
+assert_equal '[:ok, :ok]', %q{
+  class C
+    def destructure_keys
+      {}
+    end
+  end
+
+  pattern_match = ->(i) do
+    case i
+    in a: 0
+      :ng
+    else
+      :ok
+    end
+  end
+
+  [{}, C.new].map(&pattern_match)
+}
+
+# Call to object with singleton
+assert_equal '123', %q{
+  obj = Object.new
+  def obj.foo
+    123
+  end
+
+  def foo(obj)
+    obj.foo()
+  end
+
+  foo(obj)
+  foo(obj)
+}
+
+# Call method on an object that has a non-material
+# singleton class.
+# TODO: assert that it takes no side exits? This
+# test case revealed that we were taking exits unnecessarily.
+assert_normal_exit %q{
+  def foo(obj)
+    obj.itself
+  end
+
+  o = Object.new.singleton_class
+  foo(o)
+  foo(o)
+}
+
+# Call to singleton class
+assert_equal '123', %q{
+  class Foo
+    def self.foo
+      123
+    end
+  end
+
+  def foo(obj)
+    obj.foo()
+  end
+
+  foo(Foo)
+  foo(Foo)
+}
+
+# invokesuper edge case
+assert_equal '[:A, [:A, :B]]', %q{
+  class B
+    def foo = :B
+  end
+
+  class A < B
+    def foo = [:A, super()]
+  end
+
+  A.new.foo
+  A.new.foo # compile A#foo
+
+  class C < A
+    define_method(:bar, A.instance_method(:foo))
+  end
+
+  C.new.bar
+}
+
+# Same invokesuper bytecode, multiple destinations
+assert_equal '[:Forward, :SecondTerminus]', %q{
+  module Terminus
+    def foo = :Terminus
+  end
+
+  module SecondTerminus
+    def foo = :SecondTerminus
+  end
+
+
+  module Forward
+    def foo = [:Forward, super]
+  end
+
+  class B
+    include SecondTerminus
+  end
+
+  class A < B
+    include Terminus
+    include Forward
+  end
+
+  A.new.foo
+  A.new.foo # compile
+
+  class B
+    include Forward
+    alias bar foo
+  end
+
+  # A.ancestors.take(5) == [A, Forward, Terminus, B, Forward, SecondTerminus]
+
+  A.new.bar
+}
+
+# invokesuper calling into itself
+assert_equal '[:B, [:B, :m]]', %q{
+  module M
+    def foo = :m
+  end
+
+  class B
+    include M
+    def foo = [:B, super]
+  end
+
+  ins = B.new
+  ins.singleton_class # materialize the singleton class
+  ins.foo
+  ins.foo # compile
+
+  ins.singleton_class.define_method(:bar, B.instance_method(:foo))
+  ins.bar
+}
+
+# invokesuper changed ancestor
+assert_equal '[:A, [:M, :B]]', %q{
+  class B
+    def foo
+      :B
+    end
+  end
+
+  class A < B
+    def foo
+      [:A, super]
+    end
+  end
+
+  module M
+    def foo
+      [:M, super]
+    end
+  end
+
+  ins = A.new
+  ins.foo
+  ins.foo
+  A.include(M)
+  ins.foo
+}
+
+# invokesuper changed ancestor via prepend
+assert_equal '[:A, [:M, :B]]', %q{
+  class B
+    def foo
+      :B
+    end
+  end
+
+  class A < B
+    def foo
+      [:A, super]
+    end
+  end
+
+  module M
+    def foo
+      [:M, super]
+    end
+  end
+
+  ins = A.new
+  ins.foo
+  ins.foo
+  B.prepend(M)
+  ins.foo
+}
+
+# invokesuper replaced method
+assert_equal '[:A, :Btwo]', %q{
+  class B
+    def foo
+      :B
+    end
+  end
+
+  class A < B
+    def foo
+      [:A, super]
+    end
+  end
+
+  ins = A.new
+  ins.foo
+  ins.foo
+  class B
+    def foo
+      :Btwo
+    end
+  end
+  ins.foo
+}
+
+# Call to fixnum
+assert_equal '[true, false]', %q{
+  def is_odd(obj)
+    obj.odd?
+  end
+
+  is_odd(1)
+  is_odd(1)
+
+  [is_odd(123), is_odd(456)]
+}
+
+# Call to bignum
+assert_equal '[true, false]', %q{
+  def is_odd(obj)
+    obj.odd?
+  end
+
+  bignum = 99999999999999999999
+  is_odd(bignum)
+  is_odd(bignum)
+
+  [is_odd(bignum), is_odd(bignum+1)]
+}
+
+# Call to fixnum and bignum
+assert_equal '[true, false, true, false]', %q{
+  def is_odd(obj)
+    obj.odd?
+  end
+
+  bignum = 99999999999999999999
+  is_odd(bignum)
+  is_odd(bignum)
+  is_odd(123)
+  is_odd(123)
+
+  [is_odd(123), is_odd(456), is_odd(bignum), is_odd(bignum+1)]
+}
+
+# Call to static and dynamic symbol
+assert_equal 'bar', %q{
+  def to_string(obj)
+    obj.to_s
+  end
+
+  to_string(:foo)
+  to_string(:foo)
+  to_string((-"bar").to_sym)
+  to_string((-"bar").to_sym)
+}
+
+# Call to flonum and heap float
+assert_equal '[nil, nil, nil, 1]', %q{
+  def is_inf(obj)
+    obj.infinite?
+  end
+
+  is_inf(0.0)
+  is_inf(0.0)
+  is_inf(1e256)
+  is_inf(1e256)
+
+  [
+    is_inf(0.0),
+    is_inf(1.0),
+    is_inf(1e256),
+    is_inf(1.0/0.0)
+  ]
+}
+
+assert_equal '[1, 2, 3, 4, 5]', %q{
+  def splatarray
+    [*(1..5)]
+  end
+
+  splatarray
+  splatarray
+}
+
+assert_equal '[1, 1, 2, 1, 2, 3]', %q{
+  def expandarray
+    arr = [1, 2, 3]
+
+    a, = arr
+    b, c, = arr
+    d, e, f = arr
+
+    [a, b, c, d, e, f]
+  end
+
+  expandarray
+  expandarray
+}
+
+assert_equal '[1, 1]', %q{
+  def expandarray_useless_splat
+    arr = (1..10).to_a
+
+    a, * = arr
+    b, (*) = arr
+
+    [a, b]
+  end
+
+  expandarray_useless_splat
+  expandarray_useless_splat
+}
+
+assert_equal '[:not_heap, nil, nil]', %q{
+  def expandarray_not_heap
+    a, b, c = :not_heap
+    [a, b, c]
+  end
+
+  expandarray_not_heap
+  expandarray_not_heap
+}
+
+assert_equal '[:not_array, nil, nil]', %q{
+  def expandarray_not_array(obj)
+    a, b, c = obj
+    [a, b, c]
+  end
+
+  obj = Object.new
+  def obj.to_ary
+    [:not_array]
+  end
+
+  expandarray_not_array(obj)
+  expandarray_not_array(obj)
+}
+
+assert_equal '[1, 2, nil]', %q{
+  def expandarray_rhs_too_small
+    a, b, c = [1, 2]
+    [a, b, c]
+  end
+
+  expandarray_rhs_too_small
+  expandarray_rhs_too_small
+}
+
+assert_equal '[1, [2]]', %q{
+  def expandarray_splat
+    a, *b = [1, 2]
+    [a, b]
+  end
+
+  expandarray_splat
+  expandarray_splat
+}
+
+assert_equal '2', %q{
+  def expandarray_postarg
+    *, a = [1, 2]
+    a
+  end
+
+  expandarray_postarg
+  expandarray_postarg
+}
+
+assert_equal '10', %q{
+  obj = Object.new
+  val = nil
+  obj.define_singleton_method(:to_ary) { val = 10; [] }
+
+  def expandarray_always_call_to_ary(object)
+    * = object
+  end
+
+  expandarray_always_call_to_ary(obj)
+  expandarray_always_call_to_ary(obj)
+
+  val
+}
+
+# regression test of local type change
+assert_equal '1.1', %q{
+def bar(baz, quux)
+  if baz.integer?
+    baz, quux = quux, nil
+  end
+  baz.to_s
+end
+
+bar(123, 1.1)
+bar(123, 1.1)
+}
+
+# test enabling a line TracePoint in a C method call
+assert_equal '[[:line, true]]', %q{
+  events = []
+  events.instance_variable_set(
+    :@tp,
+    TracePoint.new(:line) { |tp| events << [tp.event, tp.lineno] if tp.path == __FILE__ }
+  )
+  def events.to_str
+    @tp.enable; ''
+  end
+
+  # Stay in generated code while enabling tracing
+  def events.compiled(obj)
+    String(obj)
+    @tp.disable; __LINE__
+  end
+
+  line = events.compiled(events)
+  events[0][-1] = (events[0][-1] == line)
+
+  events
+}
+
+# test enabling a c_return TracePoint in a C method call
+assert_equal '[[:c_return, :String, :string_alias, "events_to_str"]]', %q{
+  events = []
+  events.instance_variable_set(:@tp, TracePoint.new(:c_return) { |tp| events << [tp.event, tp.method_id, tp.callee_id, tp.return_value] })
+  def events.to_str
+    @tp.enable; 'events_to_str'
+  end
+
+  # Stay in generated code while enabling tracing
+  alias string_alias String
+  def events.compiled(obj)
+    string_alias(obj)
+    @tp.disable
+  end
+
+  events.compiled(events)
+
+  events
+} unless defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled? # MJIT calls extra Ruby methods
+
+# test enabling a TracePoint that targets a particular line in a C method call
+assert_equal '[true]', %q{
+  events = []
+  events.instance_variable_set(:@tp, TracePoint.new(:line) { |tp| events << tp.lineno })
+  def events.to_str
+    @tp.enable(target: method(:compiled))
+    ''
+  end
+
+  # Stay in generated code while enabling tracing
+  def events.compiled(obj)
+    String(obj)
+    __LINE__
+  end
+
+  line = events.compiled(events)
+  events[0] = (events[0] == line)
+
+  events
+}
+
+# test enabling tracing in the middle of splatarray
+assert_equal '[true]', %q{
+  events = []
+  obj = Object.new
+  obj.instance_variable_set(:@tp, TracePoint.new(:line) { |tp| events << tp.lineno })
+  def obj.to_a
+    @tp.enable(target: method(:compiled))
+    []
+  end
+
+  # Enable tracing in the middle of the splatarray instruction
+  def obj.compiled(obj)
+    * = *obj
+    __LINE__
+  end
+
+  obj.compiled([])
+  line = obj.compiled(obj)
+  events[0] = (events[0] == line)
+
+  events
+}
+
+# test enabling tracing in the middle of opt_aref. Different since the codegen
+# for it ends in a jump.
+assert_equal '[true]', %q{
+  def lookup(hash, tp)
+    hash[42]
+    tp.disable; __LINE__
+  end
+
+  lines = []
+  tp = TracePoint.new(:line) { lines << _1.lineno if _1.path == __FILE__ }
+
+  lookup(:foo, tp)
+  lookup({}, tp)
+
+  enable_tracing_on_missing = Hash.new { tp.enable }
+
+  expected_line = lookup(enable_tracing_on_missing, tp)
+
+  lines[0] = true if lines[0] == expected_line
+
+  lines
+}
+
+# test enabling c_call tracing before compiling
+assert_equal '[[:c_call, :itself]]', %q{
+  def shouldnt_compile
+    itself
+  end
+
+  events = []
+  tp = TracePoint.new(:c_call) { |tp| events << [tp.event, tp.method_id] }
+
+  # assume first call compiles
+  tp.enable { shouldnt_compile }
+
+  events
+} unless defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled? # MJIT calls extra Ruby methods
+
+# test enabling c_return tracing before compiling
+assert_equal '[[:c_return, :itself, main]]', %q{
+  def shouldnt_compile
+    itself
+  end
+
+  events = []
+  tp = TracePoint.new(:c_return) { |tp| events << [tp.event, tp.method_id, tp.return_value] }
+
+  # assume first call compiles
+  tp.enable { shouldnt_compile }
+
+  events
+} unless defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled? # MJIT calls extra Ruby methods
+
+# test c_call invalidation
+assert_equal '[[:c_call, :itself]]', %q{
+  # enable the event once to make sure invalidation
+  # happens the second time we enable it
+  TracePoint.new(:c_call) {}.enable{}
+
+  def compiled
+    itself
+  end
+
+  # assume first call compiles
+  compiled
+
+  events = []
+  tp = TracePoint.new(:c_call) { |tp| events << [tp.event, tp.method_id] }
+  tp.enable { compiled }
+
+  events
+}
+
+# test enabling tracing for a suspended fiber
+assert_equal '[[:return, 42]]', %q{
+  def traced_method
+    Fiber.yield
+    42
+  end
+
+  events = []
+  tp = TracePoint.new(:return) { events << [_1.event, _1.return_value] }
+  # assume first call compiles
+  fiber = Fiber.new { traced_method }
+  fiber.resume
+  tp.enable(target: method(:traced_method))
+  fiber.resume
+
+  events
+}
+
+# test compiling on non-tracing ractor then running on a tracing one
+assert_equal '[:itself]', %q{
+  def traced_method
+    itself
+  end
+
+  tracing_ractor = Ractor.new do
+    # 1: start tracing
+    events = []
+    tp = TracePoint.new(:c_call) { events << _1.method_id }
+    tp.enable
+    Ractor.yield(nil)
+
+    # 3: run compiled method on tracing ractor
+    Ractor.yield(nil)
+    traced_method
+
+    events
+  ensure
+    tp&.disable
+  end
+
+  tracing_ractor.take
+
+  # 2: compile on non tracing ractor
+  traced_method
+
+  tracing_ractor.take
+  tracing_ractor.take
+}
+
+# Try to hit a lazy branch stub while another ractor enables tracing
+assert_equal '42', %q{
+  def compiled(arg)
+    if arg
+      arg + 1
+    else
+      itself
+      itself
+    end
+  end
+
+  ractor = Ractor.new do
+    compiled(false)
+    Ractor.yield(nil)
+    compiled(41)
+  end
+
+  tp = TracePoint.new(:line) { itself }
+  ractor.take
+  tp.enable
+
+  ractor.take
+}
+
+# Test equality with changing types
+assert_equal '[true, false, false, false]', %q{
+  def eq(a, b)
+    a == b
+  end
+
+  [
+    eq("foo", "foo"),
+    eq("foo", "bar"),
+    eq(:foo, "bar"),
+    eq("foo", :bar)
+  ]
+}
+
+# Redefined String eq
+assert_equal 'true', %q{
+  class String
+    def ==(other)
+      true
+    end
+  end
+
+  def eq(a, b)
+    a == b
+  end
+
+  eq("foo", "bar")
+  eq("foo", "bar")
+}
+
+# Redefined Integer eq
+assert_equal 'true', %q{
+  class Integer
+    def ==(other)
+      true
+    end
+  end
+
+  def eq(a, b)
+    a == b
+  end
+
+  eq(1, 2)
+  eq(1, 2)
+}
+
+# aset on array with invalid key
+assert_normal_exit %q{
+  def foo(arr)
+    arr[:foo] = 123
+  end
+
+  foo([1]) rescue nil
+  foo([1]) rescue nil
+}
+
+# test ractor exception on when setting ivar
+assert_equal '42',  %q{
+  class A
+    def self.foo
+      _foo = 1
+      _bar = 2
+      begin
+        @bar = _foo + _bar
+      rescue Ractor::IsolationError
+        42
+      end
+    end
+  end
+
+  A.foo
+  A.foo
+
+  Ractor.new { A.foo }.take
+}
+
+assert_equal '["plain", "special", "sub", "plain"]', %q{
+  def foo(arg)
+    arg.to_s
+  end
+
+  class Sub < String
+  end
+
+  special = String.new("special")
+  special.singleton_class
+
+  [
+    foo("plain"),
+    foo(special),
+    foo(Sub.new("sub")),
+    foo("plain")
+  ]
+}
+
+assert_equal '["sub", "sub"]', %q{
+  def foo(arg)
+    arg.to_s
+  end
+
+  class Sub < String
+    def to_s
+      super
+    end
+  end
+
+  sub = Sub.new("sub")
+
+  [foo(sub), foo(sub)]
+}
+
+assert_equal '[1]', %q{
+  def kwargs(value:)
+    value
+  end
+
+  5.times.map { kwargs(value: 1) }.uniq
+}
+
+assert_equal '[:ok]', %q{
+  def kwargs(value:)
+    value
+  end
+
+  5.times.map { kwargs() rescue :ok }.uniq
+}
+
+assert_equal '[:ok]', %q{
+  def kwargs(a:, b: nil)
+    value
+  end
+
+  5.times.map { kwargs(b: 123) rescue :ok }.uniq
+}
+
+assert_equal '[[1, 2]]', %q{
+  def kwargs(left:, right:)
+    [left, right]
+  end
+
+  5.times.flat_map do
+    [
+      kwargs(left: 1, right: 2),
+      kwargs(right: 2, left: 1)
+    ]
+  end.uniq
+}
+
+assert_equal '[[1, 2]]', %q{
+  def kwargs(lead, kwarg:)
+    [lead, kwarg]
+  end
+
+  5.times.map { kwargs(1, kwarg: 2) }.uniq
+}
+
+# optional and keyword args
+assert_equal '[[1, 2, 3]]', %q{
+  def opt_and_kwargs(a, b=2, c: nil)
+    [a,b,c]
+  end
+
+  5.times.map { opt_and_kwargs(1, c: 3) }.uniq
+}
+
+assert_equal '[[1, 2, 3]]', %q{
+  def opt_and_kwargs(a, b=nil, c: nil)
+    [a,b,c]
+  end
+
+  5.times.map { opt_and_kwargs(1, 2, c: 3) }.uniq
+}
+
+# Bug #18453
+assert_equal '[[1, nil, 2]]', %q{
+  def opt_and_kwargs(a = {}, b: nil, c: nil)
+    [a, b, c]
+  end
+
+  5.times.map { opt_and_kwargs(1, c: 2) }.uniq
+}
+
+assert_equal '[[{}, nil, 1]]', %q{
+  def opt_and_kwargs(a = {}, b: nil, c: nil)
+    [a, b, c]
+  end
+
+  5.times.map { opt_and_kwargs(c: 1) }.uniq
+}
+
+# leading and keyword arguments are swapped into the right order
+assert_equal '[[1, 2, 3, 4, 5, 6]]', %q{
+  def kwargs(five, six, a:, b:, c:, d:)
+    [a, b, c, d, five, six]
+  end
+
+  5.times.flat_map do
+    [
+      kwargs(5, 6, a: 1, b: 2, c: 3, d: 4),
+      kwargs(5, 6, a: 1, b: 2, d: 4, c: 3),
+      kwargs(5, 6, a: 1, c: 3, b: 2, d: 4),
+      kwargs(5, 6, a: 1, c: 3, d: 4, b: 2),
+      kwargs(5, 6, a: 1, d: 4, b: 2, c: 3),
+      kwargs(5, 6, a: 1, d: 4, c: 3, b: 2),
+      kwargs(5, 6, b: 2, a: 1, c: 3, d: 4),
+      kwargs(5, 6, b: 2, a: 1, d: 4, c: 3),
+      kwargs(5, 6, b: 2, c: 3, a: 1, d: 4),
+      kwargs(5, 6, b: 2, c: 3, d: 4, a: 1),
+      kwargs(5, 6, b: 2, d: 4, a: 1, c: 3),
+      kwargs(5, 6, b: 2, d: 4, c: 3, a: 1),
+      kwargs(5, 6, c: 3, a: 1, b: 2, d: 4),
+      kwargs(5, 6, c: 3, a: 1, d: 4, b: 2),
+      kwargs(5, 6, c: 3, b: 2, a: 1, d: 4),
+      kwargs(5, 6, c: 3, b: 2, d: 4, a: 1),
+      kwargs(5, 6, c: 3, d: 4, a: 1, b: 2),
+      kwargs(5, 6, c: 3, d: 4, b: 2, a: 1),
+      kwargs(5, 6, d: 4, a: 1, b: 2, c: 3),
+      kwargs(5, 6, d: 4, a: 1, c: 3, b: 2),
+      kwargs(5, 6, d: 4, b: 2, a: 1, c: 3),
+      kwargs(5, 6, d: 4, b: 2, c: 3, a: 1),
+      kwargs(5, 6, d: 4, c: 3, a: 1, b: 2),
+      kwargs(5, 6, d: 4, c: 3, b: 2, a: 1)
+    ]
+  end.uniq
+}
+
+# implicit hashes get skipped and don't break compilation
+assert_equal '[[:key]]', %q{
+  def implicit(hash)
+    hash.keys
+  end
+
+  5.times.map { implicit(key: :value) }.uniq
+}
+
+# default values on keywords don't mess up argument order
+assert_equal '[2]', %q{
+  def default_value
+    1
+  end
+
+  def default_expression(value: default_value)
+    value
+  end
+
+  5.times.map { default_expression(value: 2) }.uniq
+}
+
+# constant default values on keywords
+assert_equal '[3]', %q{
+  def default_expression(value: 3)
+    value
+  end
+
+  5.times.map { default_expression }.uniq
+}
+
+# non-constant default values on keywords
+assert_equal '[3]', %q{
+  def default_value
+    3
+  end
+
+  def default_expression(value: default_value)
+    value
+  end
+
+  5.times.map { default_expression }.uniq
+}
+
+# reordered optional kwargs
+assert_equal '[[100, 1]]', %q{
+  def foo(capacity: 100, max: nil)
+    [capacity, max]
+  end
+
+  5.times.map { foo(max: 1) }.uniq
+}
+
+# invalid lead param
+assert_equal 'ok', %q{
+  def bar(baz: 2)
+    baz
+  end
+
+  def foo
+    bar(1, baz: 123)
+  end
+
+  begin
+    foo
+    foo
+  rescue ArgumentError => e
+    print "ok"
+  end
+}
+
+# reordered required kwargs
+assert_equal '[[1, 2, 3, 4]]', %q{
+  def foo(default1: 1, required1:, default2: 3, required2:)
+    [default1, required1, default2, required2]
+  end
+
+  5.times.map { foo(required1: 2, required2: 4) }.uniq
+}
+
+# reordered default expression kwargs
+assert_equal '[[:one, :two, 3]]', %q{
+  def foo(arg1: (1+0), arg2: (2+0), arg3: (3+0))
+    [arg1, arg2, arg3]
+  end
+
+  5.times.map { foo(arg2: :two, arg1: :one) }.uniq
+}
+
+# complex kwargs
+assert_equal '[[1, 2, 3, 4]]', %q{
+  def foo(required:, specified: 999, simple_default: 3, complex_default: "4".to_i)
+    [required, specified, simple_default, complex_default]
+  end
+
+  5.times.map { foo(specified: 2, required: 1) }.uniq
+}
+
+# cfunc kwargs
+assert_equal '{:foo=>123}', %q{
+  def foo(bar)
+    bar.store(:value, foo: 123)
+    bar[:value]
+  end
+
+  foo({})
+  foo({})
+}
+
+# cfunc kwargs
+assert_equal '{:foo=>123}', %q{
+  def foo(bar)
+    bar.replace(foo: 123)
+  end
+
+  foo({})
+  foo({})
+}
+
+# cfunc kwargs
+assert_equal '{:foo=>123, :bar=>456}', %q{
+  def foo(bar)
+    bar.replace(foo: 123, bar: 456)
+  end
+
+  foo({})
+  foo({})
+}
+
+# variadic cfunc kwargs
+assert_equal '{:foo=>123}', %q{
+  def foo(bar)
+    bar.merge(foo: 123)
+  end
+
+  foo({})
+  foo({})
+}
+
+# optimized cfunc kwargs
+assert_equal 'false', %q{
+  def foo
+    :foo.eql?(foo: :foo)
+  end
+
+  foo
+  foo
+}
+
+# attr_reader on frozen object
+assert_equal 'false', %q{
+  class Foo
+    attr_reader :exception
+
+    def failed?
+      !exception.nil?
+    end
+  end
+
+  foo = Foo.new.freeze
+  foo.failed?
+  foo.failed?
+}
+
+# regression test for doing kwarg shuffle before checking for interrupts
+assert_equal 'ok', %q{
+  def new_media_drop(attributes:, product_drop:, context:, sources:)
+    nil.nomethod rescue nil # force YJIT to bail to side exit
+
+    [attributes, product_drop, context, sources]
+  end
+
+  def load_medias(product_drop: nil, raw_medias:, context:)
+    raw_medias.map do |raw_media|
+      case new_media_drop(context: context, attributes: raw_media, product_drop: product_drop, sources: [])
+      in [Hash, ProductDrop, Context, Array]
+      else
+        raise "bad shuffle"
+      end
+    end
+  end
+
+  class Context; end
+
+  class ProductDrop
+    attr_reader :title
+    def initialize(title)
+      @title = title
+    end
+  end
+
+  # Make a thread so we have thread switching interrupts
+  th = Thread.new do
+    while true; end
+  end
+  1_000.times do |i|
+    load_medias(product_drop: ProductDrop.new("foo"), raw_medias: [{}, {}], context: Context.new)
+  end
+  th.kill.join
+
+  :ok
+}
+
+# regression test for tracing attr_accessor methods.
+assert_equal "true", %q{
+    c = Class.new do
+      attr_accessor :x
+      alias y x
+      alias y= x=
+    end
+    obj = c.new
+
+    ar_meth = obj.method(:x)
+    aw_meth = obj.method(:x=)
+    aar_meth = obj.method(:y)
+    aaw_meth = obj.method(:y=)
+    events = []
+    trace = TracePoint.new(:c_call, :c_return){|tp|
+      next if tp.path != __FILE__
+      next if tp.method_id == :call
+      case tp.event
+      when :c_call
+        events << [tp.event, tp.method_id, tp.callee_id]
+      when :c_return
+        events << [tp.event, tp.method_id, tp.callee_id, tp.return_value]
+      end
+    }
+    test_proc = proc do
+      obj.x = 1
+      obj.x
+      obj.y = 2
+      obj.y
+      aw_meth.call(1)
+      ar_meth.call
+      aaw_meth.call(2)
+      aar_meth.call
+    end
+    test_proc.call # populate call caches
+    trace.enable(&test_proc)
+    expected = [
+      [:c_call, :x=, :x=],
+      [:c_return, :x=, :x=, 1],
+      [:c_call, :x, :x],
+      [:c_return, :x, :x, 1],
+      [:c_call, :x=, :y=],
+      [:c_return, :x=, :y=, 2],
+      [:c_call, :x, :y],
+      [:c_return, :x, :y, 2],
+    ] * 2
+
+    expected == events
+}
+
+# duphash
+assert_equal '{:foo=>123}', %q{
+  def foo
+    {foo: 123}
+  end
+
+  foo
+  foo
+}
+
+# newhash
+assert_equal '{:foo=>2}', %q{
+  def foo
+    {foo: 1+1}
+  end
+
+  foo
+  foo
+}
+
+# block invalidation edge case
+assert_equal 'undef', %q{
+  class A
+    def foo(arg)
+      arg.times { A.remove_method(:bar) }
+      self
+    end
+
+    def bar
+      4
+    end
+
+    def use(arg)
+      # two consecutive sends. When bar is removed, the return address
+      # for calling it is already on foo's control frame
+      foo(arg).bar
+    rescue NoMethodError
+      :undef
+    end
+  end
+
+  A.new.use 0
+  A.new.use 0
+  A.new.use 1
+}
+
+# block invalidation edge case
+assert_equal 'ok', %q{
+  class A
+    Good = :ng
+    def foo(arg)
+      arg.times { A.const_set(:Good, :ok) }
+      self
+    end
+
+    def id(arg)
+      arg
+    end
+
+    def use(arg)
+      # send followed by an opt_getinlinecache.
+      # The return address remains on the control frame
+      # when opt_getinlinecache is invalidated.
+      foo(arg).id(Good)
+    end
+  end
+
+  A.new.use 0
+  A.new.use 0
+  A.new.use 1
+}
+
+assert_equal 'ok', %q{
+  # test hitting a branch stub when out of memory
+  def nimai(jita)
+    if jita
+      :ng
+    else
+      :ok
+    end
+  end
+
+  nimai(true)
+  nimai(true)
+
+  RubyVM::YJIT.simulate_oom! if defined?(RubyVM::YJIT)
+
+  nimai(false)
+}
+
+assert_equal 'new', %q{
+  # test block invalidation while out of memory
+  def foo
+    :old
+  end
+
+  def test
+    foo
+  end
+
+  def bar
+    :bar
+  end
+
+
+  test
+  test
+
+  RubyVM::YJIT.simulate_oom! if defined?(RubyVM::YJIT)
+
+  # Old simulat_omm! leaves one byte of space and this fills it up
+  bar
+  bar
+
+  def foo
+    :new
+  end
+
+  test
+}
+
+assert_equal 'ok', %q{
+  # Try to compile new method while OOM
+  def foo
+    :ok
+  end
+
+  RubyVM::YJIT.simulate_oom! if defined?(RubyVM::YJIT)
+
+  foo
+  foo
+}
+
+# struct aref embedded
+assert_equal '2', %q{
+  def foo(s)
+    s.foo
+  end
+
+  S = Struct.new(:foo)
+  foo(S.new(1))
+  foo(S.new(2))
+}
+
+# struct aref non-embedded
+assert_equal '4', %q{
+  def foo(s)
+    s.d
+  end
+
+  S = Struct.new(:a, :b, :c, :d, :e)
+  foo(S.new(1,2,3,4,5))
+  foo(S.new(1,2,3,4,5))
+}
+
+# struct aset embedded
+assert_equal '123', %q{
+  def foo(s)
+    s.foo = 123
+  end
+
+  s = Struct.new(:foo).new
+  foo(s)
+  s = Struct.new(:foo).new
+  foo(s)
+  s.foo
+}
+
+# struct aset non-embedded
+assert_equal '[1, 2, 3, 4, 5]', %q{
+  def foo(s)
+    s.a = 1
+    s.b = 2
+    s.c = 3
+    s.d = 4
+    s.e = 5
+  end
+
+  S = Struct.new(:a, :b, :c, :d, :e)
+  s = S.new
+  foo(s)
+  s = S.new
+  foo(s)
+  [s.a, s.b, s.c, s.d, s.e]
+}
+
+# struct aref too many args
+assert_equal 'ok', %q{
+  def foo(s)
+    s.foo(:bad)
+  end
+
+  s = Struct.new(:foo).new
+  foo(s) rescue :ok
+  foo(s) rescue :ok
+}
+
+# struct aset too many args
+assert_equal 'ok', %q{
+  def foo(s)
+    s.set_foo(123, :bad)
+  end
+
+  s = Struct.new(:foo) do
+    alias :set_foo :foo=
+  end
+  foo(s) rescue :ok
+  foo(s) rescue :ok
+}
+
+# File.join is a cfunc accepting variable arguments as a Ruby array (argc = -2)
+assert_equal 'foo/bar', %q{
+  def foo
+    File.join("foo", "bar")
+  end
+
+  foo
+  foo
+}
+
+# File.join is a cfunc accepting variable arguments as a Ruby array (argc = -2)
+assert_equal '', %q{
+  def foo
+    File.join()
+  end
+
+  foo
+  foo
+}
+
+# Make sure we're correctly reading RStruct's as.ary union for embedded RStructs
+assert_equal '3,12', %q{
+  pt_struct = Struct.new(:x, :y)
+  p = pt_struct.new(3, 12)
+  def pt_inspect(pt)
+    "#{pt.x},#{pt.y}"
+  end
+
+  # Make sure pt_inspect is JITted
+  10.times { pt_inspect(p) }
+
+  # Make sure it's returning '3,12' instead of e.g. '3,false'
+  pt_inspect(p)
+}
+
+# Regression test for deadlock between branch_stub_hit and ractor_receive_if
+assert_equal '10', %q{
+  r = Ractor.new Ractor.current do |main|
+    main << 1
+    main << 2
+    main << 3
+    main << 4
+    main << 5
+    main << 6
+    main << 7
+    main << 8
+    main << 9
+    main << 10
+  end
+
+  a = []
+  a << Ractor.receive_if{|msg| msg == 10}
+  a << Ractor.receive_if{|msg| msg == 9}
+  a << Ractor.receive_if{|msg| msg == 8}
+  a << Ractor.receive_if{|msg| msg == 7}
+  a << Ractor.receive_if{|msg| msg == 6}
+  a << Ractor.receive_if{|msg| msg == 5}
+  a << Ractor.receive_if{|msg| msg == 4}
+  a << Ractor.receive_if{|msg| msg == 3}
+  a << Ractor.receive_if{|msg| msg == 2}
+  a << Ractor.receive_if{|msg| msg == 1}
+
+  a.length
+}
+
+# checktype
+assert_equal 'false', %q{
+    def function()
+        [1, 2] in [Integer, String]
+    end
+    function()
+}
+
+# opt_send_without_block (VM_METHOD_TYPE_ATTRSET)
+assert_equal 'foo', %q{
+    class Foo
+      attr_writer :foo
+
+      def foo()
+        self.foo = "foo"
+      end
+    end
+    foo = Foo.new
+    foo.foo
+}
+
+# anytostring, intern
+assert_equal 'true', %q{
+    def foo()
+      :"#{true}"
+    end
+    foo()
+}
+
+# toregexp, objtostring
+assert_equal '/true/', %q{
+    def foo()
+      /#{true}/
+    end
+    foo().inspect
+}
+
+# concatstrings, objtostring
+assert_equal '9001', %q{
+    def foo()
+      "#{9001}"
+    end
+    foo()
+}
+
+# opt_send_without_block (VM_METHOD_TYPE_CFUNC)
+assert_equal 'nil', %q{
+    def foo
+      nil.inspect # argc: 0
+    end
+    foo
+}
+assert_equal '4', %q{
+    def foo
+      2.pow(2) # argc: 1
+    end
+    foo
+}
+assert_equal 'aba', %q{
+    def foo
+      "abc".tr("c", "a") # argc: 2
+    end
+    foo
+}
+assert_equal 'true', %q{
+    def foo
+      respond_to?(:inspect) # argc: -1
+    end
+    foo
+}
+assert_equal '["a", "b"]', %q{
+    def foo
+      "a\nb".lines(chomp: true) # kwargs
+    end
+    foo
+}
+
+# invokebuiltin
+assert_equal '123', %q{
+  def foo(obj)
+    obj.foo = 123
+  end
+
+  struct = Struct.new(:foo)
+  obj = struct.new
+  foo(obj)
+}
+
+# invokebuiltin_delegate
+assert_equal '.', %q{
+  def foo(path)
+    Dir.open(path).path
+  end
+  foo(".")
+}
+
+# opt_invokebuiltin_delegate_leave
+assert_equal '[0]', %q{"\x00".unpack("c")}
+
+# opt_send_without_block (VM_METHOD_TYPE_ISEQ)
+assert_equal '1', %q{
+  def foo = 1
+  def bar = foo
+  bar
+}
+assert_equal '[1, 2, 3]', %q{
+  def foo(a, b) = [1, a, b]
+  def bar = foo(2, 3)
+  bar
+}
+assert_equal '[1, 2, 3, 4, 5, 6]', %q{
+  def foo(a, b, c:, d:, e: 0, f: 6) = [a, b, c, d, e, f]
+  def bar = foo(1, 2, c: 3, d: 4, e: 5)
+  bar
+}
+assert_equal '[1, 2, 3, 4]', %q{
+  def foo(a, b = 2) = [a, b]
+  def bar = foo(1) + foo(3, 4)
+  bar
+}
+
+assert_equal '1', %q{
+  def foo(a) = a
+  def bar = foo(1) { 2 }
+  bar
+}
+assert_equal '[1, 2]', %q{
+  def foo(a, &block) = [a, block.call]
+  def bar = foo(1) { 2 }
+  bar
+}
+
+# opt_send_without_block (VM_METHOD_TYPE_IVAR)
+assert_equal 'foo', %q{
+  class Foo
+    attr_reader :foo
+
+    def initialize
+      @foo = "foo"
+    end
+  end
+  Foo.new.foo
+}
+
+# opt_send_without_block (VM_METHOD_TYPE_OPTIMIZED)
+assert_equal 'foo', %q{
+  Foo = Struct.new(:bar)
+  Foo.new("bar").bar = "foo"
+}
+assert_equal 'foo', %q{
+  Foo = Struct.new(:bar)
+  Foo.new("foo").bar
+}
+
+# getblockparamproxy
+assert_equal 'foo', %q{
+  def foo(&block)
+    block.call
+  end
+  foo { "foo" }
+}
+
+# getblockparam
+assert_equal 'foo', %q{
+  def foo(&block)
+    block
+  end
+  foo { "foo" }.call
+}
+
+assert_equal '[1, 2]', %q{
+  def foo
+    x = [2]
+    [1, *x]
+  end
+
+  foo
+  foo
+}
+
+# respond_to? with changing symbol
+assert_equal 'false', %q{
+  def foo(name)
+    :sym.respond_to?(name)
+  end
+  foo(:to_s)
+  foo(:to_s)
+  foo(:not_exist)
+}
+
+# respond_to? with method being defined
+assert_equal 'true', %q{
+  def foo
+    :sym.respond_to?(:not_yet_defined)
+  end
+  foo
+  foo
+  module Kernel
+    def not_yet_defined = true
+  end
+  foo
+}
+
+# respond_to? with undef method
+assert_equal 'false', %q{
+  module Kernel
+    def to_be_removed = true
+  end
+  def foo
+    :sym.respond_to?(:to_be_removed)
+  end
+  foo
+  foo
+  class Object
+    undef_method :to_be_removed
+  end
+  foo
+}
+
+# respond_to? with respond_to_missing?
+assert_equal 'true', %q{
+  class Foo
+  end
+  def foo(x)
+    x.respond_to?(:bar)
+  end
+  foo(Foo.new)
+  foo(Foo.new)
+  class Foo
+    def respond_to_missing?(*) = true
+  end
+  foo(Foo.new)
+}
+
+# bmethod
+assert_equal '[1, 2, 3]', %q{
+  one = 1
+  define_method(:foo) do
+    one
+  end
+
+  3.times.map { |i| foo + i }
+}
+
+# return inside bmethod
+assert_equal 'ok', %q{
+  define_method(:foo) do
+    1.tap { return :ok }
+  end
+
+  foo
+}
+
+# bmethod optional and keywords
+assert_equal '[[1, nil, 2]]', %q{
+  define_method(:opt_and_kwargs) do |a = {}, b: nil, c: nil|
+    [a, b, c]
+  end
+
+  5.times.map { opt_and_kwargs(1, c: 2) }.uniq
+}
+
+# bmethod with forwarded block
+assert_equal '2', %q{
+  define_method(:foo) do |&block|
+    block.call
+  end
+
+  def bar(&block)
+    foo(&block)
+  end
+
+  bar { 1 }
+  bar { 2 }
+}
+
+# bmethod with forwarded block and arguments
+assert_equal '5', %q{
+  define_method(:foo) do |n, &block|
+    n + block.call
+  end
+
+  def bar(n, &block)
+    foo(n, &block)
+  end
+
+  bar(0) { 1 }
+  bar(3) { 2 }
+}
+
+# bmethod with forwarded unwanted block
+assert_equal '1', %q{
+  one = 1
+  define_method(:foo) do
+    one
+  end
+
+  def bar(&block)
+    foo(&block)
+  end
+
+  bar { }
+  bar { }
+}
+
+# test for return stub lifetime issue
+assert_equal '1', %q{
+  def foo(n)
+    if n == 2
+      return 1.times { Object.define_method(:foo) {} }
+    end
+
+    foo(n + 1)
+  end
+
+  foo(1)
+}
+
+# case-when with redefined ===
+assert_equal 'ok', %q{
+  class Symbol
+    def ===(a)
+      true
+    end
+  end
+
+  def cw(arg)
+    case arg
+    when :b
+      :ok
+    when 4
+      :ng
+    end
+  end
+
+  cw(4)
+}
+
+assert_normal_exit %{
+  class Bug20997
+    def foo(&) = self.class.name(&)
+
+    new.foo
+  end
+}
diff --git a/bootstraptest/test_yjit_30k_ifelse.rb b/bootstraptest/test_yjit_30k_ifelse.rb
new file mode 100644
index 0000000000..c3afa95e4d
--- /dev/null
+++ b/bootstraptest/test_yjit_30k_ifelse.rb