summaryrefslogtreecommitdiff
path: root/spec/ruby/core/encoding
diff options
context:
space:
mode:
Diffstat (limited to 'spec/ruby/core/encoding')
-rw-r--r--spec/ruby/core/encoding/_dump_spec.rb5
-rw-r--r--spec/ruby/core/encoding/_load_spec.rb5
-rw-r--r--spec/ruby/core/encoding/aliases_spec.rb43
-rw-r--r--spec/ruby/core/encoding/ascii_compatible_spec.rb22
-rw-r--r--spec/ruby/core/encoding/compatible_spec.rb772
-rw-r--r--spec/ruby/core/encoding/converter/asciicompat_encoding_spec.rb31
-rw-r--r--spec/ruby/core/encoding/converter/constants_spec.rb131
-rw-r--r--spec/ruby/core/encoding/converter/convert_spec.rb45
-rw-r--r--spec/ruby/core/encoding/converter/convpath_spec.rb24
-rw-r--r--spec/ruby/core/encoding/converter/destination_encoding_spec.rb11
-rw-r--r--spec/ruby/core/encoding/converter/finish_spec.rb36
-rw-r--r--spec/ruby/core/encoding/converter/insert_output_spec.rb5
-rw-r--r--spec/ruby/core/encoding/converter/inspect_spec.rb13
-rw-r--r--spec/ruby/core/encoding/converter/last_error_spec.rb91
-rw-r--r--spec/ruby/core/encoding/converter/new_spec.rb119
-rw-r--r--spec/ruby/core/encoding/converter/primitive_convert_spec.rb216
-rw-r--r--spec/ruby/core/encoding/converter/primitive_errinfo_spec.rb69
-rw-r--r--spec/ruby/core/encoding/converter/putback_spec.rb56
-rw-r--r--spec/ruby/core/encoding/converter/replacement_spec.rb70
-rw-r--r--spec/ruby/core/encoding/converter/search_convpath_spec.rb30
-rw-r--r--spec/ruby/core/encoding/converter/source_encoding_spec.rb11
-rw-r--r--spec/ruby/core/encoding/default_external_spec.rb69
-rw-r--r--spec/ruby/core/encoding/default_internal_spec.rb74
-rw-r--r--spec/ruby/core/encoding/dummy_spec.rb25
-rw-r--r--spec/ruby/core/encoding/find_spec.rb82
-rw-r--r--spec/ruby/core/encoding/fixtures/classes.rb49
-rw-r--r--spec/ruby/core/encoding/inspect_spec.rb33
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_name_spec.rb19
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_spec.rb19
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/error_bytes_spec.rb31
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/incomplete_input_spec.rb28
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/readagain_bytes_spec.rb31
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_name_spec.rb29
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_spec.rb34
-rw-r--r--spec/ruby/core/encoding/list_spec.rb49
-rw-r--r--spec/ruby/core/encoding/locale_charmap_spec.rb56
-rw-r--r--spec/ruby/core/encoding/name_list_spec.rb23
-rw-r--r--spec/ruby/core/encoding/name_spec.rb15
-rw-r--r--spec/ruby/core/encoding/names_spec.rb35
-rw-r--r--spec/ruby/core/encoding/replicate_spec.rb8
-rw-r--r--spec/ruby/core/encoding/to_s_spec.rb7
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_name_spec.rb16
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_spec.rb16
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/error_char_spec.rb28
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_name_spec.rb29
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_spec.rb30
46 files changed, 2640 insertions, 0 deletions
diff --git a/spec/ruby/core/encoding/_dump_spec.rb b/spec/ruby/core/encoding/_dump_spec.rb
new file mode 100644
index 0000000000..623fe88ec9
--- /dev/null
+++ b/spec/ruby/core/encoding/_dump_spec.rb
@@ -0,0 +1,5 @@
+require_relative '../../spec_helper'
+
+describe "Encoding#_dump" do
+ it "needs to be reviewed for spec completeness"
+end
diff --git a/spec/ruby/core/encoding/_load_spec.rb b/spec/ruby/core/encoding/_load_spec.rb
new file mode 100644
index 0000000000..608098d34b
--- /dev/null
+++ b/spec/ruby/core/encoding/_load_spec.rb
@@ -0,0 +1,5 @@
+require_relative '../../spec_helper'
+
+describe "Encoding._load" do
+ it "needs to be reviewed for spec completeness"
+end
diff --git a/spec/ruby/core/encoding/aliases_spec.rb b/spec/ruby/core/encoding/aliases_spec.rb
new file mode 100644
index 0000000000..12c6c6cf85
--- /dev/null
+++ b/spec/ruby/core/encoding/aliases_spec.rb
@@ -0,0 +1,43 @@
+require_relative '../../spec_helper'
+
+describe "Encoding.aliases" do
+ it "returns a Hash" do
+ Encoding.aliases.should.instance_of?(Hash)
+ end
+
+ it "has Strings as keys" do
+ Encoding.aliases.keys.each do |key|
+ key.should.instance_of?(String)
+ end
+ end
+
+ it "has Strings as values" do
+ Encoding.aliases.values.each do |value|
+ value.should.instance_of?(String)
+ end
+ end
+
+ it "has alias names as its keys" do
+ Encoding.aliases.key?('BINARY').should == true
+ Encoding.aliases.key?('ASCII').should == true
+ end
+
+ it "has the names of the aliased encoding as its values" do
+ Encoding.aliases['BINARY'].should == 'ASCII-8BIT'
+ Encoding.aliases['ASCII'].should == 'US-ASCII'
+ end
+
+ it "has an 'external' key with the external default encoding as its value" do
+ Encoding.aliases['external'].should == Encoding.default_external.name
+ end
+
+ it "has a 'locale' key and its value equals the name of the encoding found by the locale charmap" do
+ Encoding.aliases['locale'].should == Encoding.find(Encoding.locale_charmap).name
+ end
+
+ it "only contains valid aliased encodings" do
+ Encoding.aliases.each do |aliased, original|
+ Encoding.find(aliased).should == Encoding.find(original)
+ end
+ end
+end
diff --git a/spec/ruby/core/encoding/ascii_compatible_spec.rb b/spec/ruby/core/encoding/ascii_compatible_spec.rb
new file mode 100644
index 0000000000..04fc159bb8
--- /dev/null
+++ b/spec/ruby/core/encoding/ascii_compatible_spec.rb
@@ -0,0 +1,22 @@
+require_relative '../../spec_helper'
+
+describe "Encoding#ascii_compatible?" do
+ it "returns true if self represents an ASCII-compatible encoding" do
+ Encoding::UTF_8.ascii_compatible?.should == true
+ end
+
+ it "returns false if self does not represent an ASCII-compatible encoding" do
+ Encoding::UTF_16LE.ascii_compatible?.should == false
+ end
+
+ it "returns false for UTF_16 and UTF_32" do
+ Encoding::UTF_16.should_not.ascii_compatible?
+ Encoding::UTF_32.should_not.ascii_compatible?
+ end
+
+ it "is always false for dummy encodings" do
+ Encoding.list.select(&:dummy?).each do |encoding|
+ encoding.should_not.ascii_compatible?
+ end
+ end
+end
diff --git a/spec/ruby/core/encoding/compatible_spec.rb b/spec/ruby/core/encoding/compatible_spec.rb
new file mode 100644
index 0000000000..0d620e5bf3
--- /dev/null
+++ b/spec/ruby/core/encoding/compatible_spec.rb
@@ -0,0 +1,772 @@
+# encoding: binary
+
+require_relative '../../spec_helper'
+
+# TODO: add IO
+
+describe "Encoding.compatible? String, String" do
+ describe "when the first's Encoding is valid US-ASCII" do
+ before :each do
+ @str = "abc".dup.force_encoding Encoding::US_ASCII
+ end
+
+ it "returns US-ASCII when the second's is US-ASCII" do
+ Encoding.compatible?(@str, "def".encode("us-ascii")).should == Encoding::US_ASCII
+ end
+
+ it "returns US-ASCII if the second String is BINARY and ASCII only" do
+ Encoding.compatible?(@str, "\x7f").should == Encoding::US_ASCII
+ end
+
+ it "returns BINARY if the second String is BINARY but not ASCII only" do
+ Encoding.compatible?(@str, "\xff").should == Encoding::BINARY
+ end
+
+ it "returns US-ASCII if the second String is UTF-8 and ASCII only" do
+ Encoding.compatible?(@str, "\x7f".encode("utf-8")).should == Encoding::US_ASCII
+ end
+
+ it "returns UTF-8 if the second String is UTF-8 but not ASCII only" do
+ Encoding.compatible?(@str, "\u3042".encode("utf-8")).should == Encoding::UTF_8
+ end
+ end
+
+ describe "when the first's Encoding is ASCII compatible and ASCII only" do
+ it "returns the first's Encoding if the second is ASCII compatible and ASCII only" do
+ [ [Encoding, "abc".dup.force_encoding("UTF-8"), "123".dup.force_encoding("Shift_JIS"), Encoding::UTF_8],
+ [Encoding, "123".dup.force_encoding("Shift_JIS"), "abc".dup.force_encoding("UTF-8"), Encoding::Shift_JIS]
+ ].should be_computed_by(:compatible?)
+ end
+
+ it "returns the first's Encoding if the second is ASCII compatible and ASCII only" do
+ [ [Encoding, "abc".dup.force_encoding("BINARY"), "123".dup.force_encoding("US-ASCII"), Encoding::BINARY],
+ [Encoding, "123".dup.force_encoding("US-ASCII"), "abc".dup.force_encoding("BINARY"), Encoding::US_ASCII]
+ ].should be_computed_by(:compatible?)
+ end
+
+ it "returns the second's Encoding if the second is ASCII compatible but not ASCII only" do
+ [ [Encoding, "abc".dup.force_encoding("UTF-8"), "\xff".dup.force_encoding("Shift_JIS"), Encoding::Shift_JIS],
+ [Encoding, "123".dup.force_encoding("Shift_JIS"), "\xff".dup.force_encoding("UTF-8"), Encoding::UTF_8],
+ [Encoding, "abc".dup.force_encoding("BINARY"), "\xff".dup.force_encoding("US-ASCII"), Encoding::US_ASCII],
+ [Encoding, "123".dup.force_encoding("US-ASCII"), "\xff".dup.force_encoding("BINARY"), Encoding::BINARY],
+ ].should be_computed_by(:compatible?)
+ end
+
+ it "returns nil if the second's Encoding is not ASCII compatible" do
+ a = "abc".dup.force_encoding("UTF-8")
+ b = "1234".dup.force_encoding("UTF-16LE")
+ Encoding.compatible?(a, b).should == nil
+ end
+ end
+
+ describe "when the first's Encoding is ASCII compatible but not ASCII only" do
+ it "returns the first's Encoding if the second's is valid US-ASCII" do
+ Encoding.compatible?("\xff", "def".encode("us-ascii")).should == Encoding::BINARY
+ end
+
+ it "returns the first's Encoding if the second's is UTF-8 and ASCII only" do
+ Encoding.compatible?("\xff", "\u{7f}".encode("utf-8")).should == Encoding::BINARY
+ end
+
+ it "returns nil if the second encoding is ASCII compatible but neither String's encoding is ASCII only" do
+ Encoding.compatible?("\xff", "\u3042".encode("utf-8")).should == nil
+ end
+ end
+
+ describe "when the first's Encoding is not ASCII compatible" do
+ before :each do
+ @str = "abc".dup.force_encoding Encoding::UTF_7
+ end
+
+ it "returns nil when the second String is US-ASCII" do
+ Encoding.compatible?(@str, "def".encode("us-ascii")).should == nil
+ end
+
+ it "returns nil when the second String is BINARY and ASCII only" do
+ Encoding.compatible?(@str, "\x7f").should == nil
+ end
+
+ it "returns nil when the second String is BINARY but not ASCII only" do
+ Encoding.compatible?(@str, "\xff").should == nil
+ end
+
+ it "returns the Encoding when the second's Encoding is not ASCII compatible but the same as the first's Encoding" do
+ encoding = Encoding.compatible?(@str, "def".dup.force_encoding("utf-7"))
+ encoding.should == Encoding::UTF_7
+ end
+ end
+
+ describe "when the first's Encoding is invalid" do
+ before :each do
+ @str = "\xff".dup.force_encoding Encoding::UTF_8
+ end
+
+ it "returns the first's Encoding when the second's Encoding is US-ASCII" do
+ Encoding.compatible?(@str, "def".encode("us-ascii")).should == Encoding::UTF_8
+ end
+
+ it "returns the first's Encoding when the second String is ASCII only" do
+ Encoding.compatible?(@str, "\x7f").should == Encoding::UTF_8
+ end
+
+ it "returns nil when the second's Encoding is BINARY but not ASCII only" do
+ Encoding.compatible?(@str, "\xff").should == nil
+ end
+
+ it "returns nil when the second's Encoding is invalid and ASCII only" do
+ Encoding.compatible?(@str, "\x7f\x7f".dup.force_encoding("utf-16be")).should == nil
+ end
+
+ it "returns nil when the second's Encoding is invalid and not ASCII only" do
+ Encoding.compatible?(@str, "\xff\xff".dup.force_encoding("utf-16be")).should == nil
+ end
+
+ it "returns the Encoding when the second's Encoding is invalid but the same as the first" do
+ Encoding.compatible?(@str, @str).should == Encoding::UTF_8
+ end
+ end
+
+ describe "when the first String is empty and the second is not" do
+ describe "and the first's Encoding is ASCII compatible" do
+ before :each do
+ @str = "".dup.force_encoding("utf-8")
+ end
+
+ it "returns the first's encoding when the second String is ASCII only" do
+ Encoding.compatible?(@str, "def".encode("us-ascii")).should == Encoding::UTF_8
+ end
+
+ it "returns the second's encoding when the second String is not ASCII only" do
+ Encoding.compatible?(@str, "def".encode("utf-32le")).should == Encoding::UTF_32LE
+ end
+ end
+
+ describe "when the first's Encoding is not ASCII compatible" do
+ before :each do
+ @str = "".dup.force_encoding Encoding::UTF_7
+ end
+
+ it "returns the second string's encoding" do
+ Encoding.compatible?(@str, "def".encode("us-ascii")).should == Encoding::US_ASCII
+ end
+ end
+ end
+
+ describe "when the second String is empty" do
+ before :each do
+ @str = "abc".dup.force_encoding("utf-7")
+ end
+
+ it "returns the first Encoding" do
+ Encoding.compatible?(@str, "").should == Encoding::UTF_7
+ end
+ end
+
+ # Encoding negotiation depends on whether encodings are ASCII-compatible, empty
+ # and contain only ASCII characters (that take 7 bits). Check US-ASCII, UTF-8 and
+ # BINARY encodings (as most common) as well as an ASCII-compatible, a non-ASCII-compatible and a dummy
+ # encodings in all possible combinations.
+ describe "compatibility matrix" do
+
+# Use the following script to regenerate the matrix:
+#
+# ```
+# # encoding: binary
+#
+# ENCODINGS = [
+# "US-ASCII",
+# "UTF-8",
+# "ASCII-8BIT",
+# "ISO-8859-1", # ASCII-compatible
+# "UTF-16BE", # non-ASCII-compatible
+# "ISO-2022-JP" # dummy
+# ]
+#
+# TYPES = [:empty, :"7bits", :non7bits]
+#
+# VALUES = {
+# empty: "",
+# :"7bits" => "\x01\x01",
+# non7bits: "\x01\x81"
+# }
+#
+# ENCODINGS.product(TYPES, ENCODINGS, TYPES).each do |encoding1, type1, encoding2, type2|
+# value1 = VALUES[type1].dup.force_encoding(encoding1)
+# value2 = VALUES[type2].dup.force_encoding(encoding2)
+#
+# result_encoding = Encoding.compatible?(value1, value2)
+#
+# puts "[#{encoding1.inspect}, #{value1.inspect}, #{encoding2.inspect}, #{value2.inspect}, #{result_encoding&.name.inspect}],"
+# end
+# ```
+
+ matrix = [
+ ["US-ASCII", "", "US-ASCII", "", "US-ASCII"],
+ ["US-ASCII", "", "US-ASCII", "\x01\x01", "US-ASCII"],
+ ["US-ASCII", "", "US-ASCII", "\x01\x81", "US-ASCII"],
+ ["US-ASCII", "", "UTF-8", "", "US-ASCII"],
+ ["US-ASCII", "", "UTF-8", "\u0001\u0001", "US-ASCII"],
+ ["US-ASCII", "", "UTF-8", "\u0001\x81", "UTF-8"],
+ ["US-ASCII", "", "ASCII-8BIT", "", "US-ASCII"],
+ ["US-ASCII", "", "ASCII-8BIT", "\x01\x01", "US-ASCII"],
+ ["US-ASCII", "", "ASCII-8BIT", "\x01\x81", "ASCII-8BIT"],
+ ["US-ASCII", "", "ISO-8859-1", "", "US-ASCII"],
+ ["US-ASCII", "", "ISO-8859-1", "\x01\x01", "US-ASCII"],
+ ["US-ASCII", "", "ISO-8859-1", "\x01\x81", "ISO-8859-1"],
+ ["US-ASCII", "", "UTF-16BE", "", "US-ASCII"],
+ ["US-ASCII", "", "UTF-16BE", "\u0101", "UTF-16BE"],
+ ["US-ASCII", "", "UTF-16BE", "\u0181", "UTF-16BE"],
+ ["US-ASCII", "", "ISO-2022-JP", "", "US-ASCII"],
+ ["US-ASCII", "", "ISO-2022-JP", "\x01\x01", "ISO-2022-JP"],
+ ["US-ASCII", "", "ISO-2022-JP", "\x01\x81", "ISO-2022-JP"],
+ ["US-ASCII", "\x01\x01", "US-ASCII", "", "US-ASCII"],
+ ["US-ASCII", "\x01\x01", "US-ASCII", "\x01\x01", "US-ASCII"],
+ ["US-ASCII", "\x01\x01", "US-ASCII", "\x01\x81", "US-ASCII"],
+ ["US-ASCII", "\x01\x01", "UTF-8", "", "US-ASCII"],
+ ["US-ASCII", "\x01\x01", "UTF-8", "\u0001\u0001", "US-ASCII"],
+ ["US-ASCII", "\x01\x01", "UTF-8", "\u0001\x81", "UTF-8"],
+ ["US-ASCII", "\x01\x01", "ASCII-8BIT", "", "US-ASCII"],
+ ["US-ASCII", "\x01\x01", "ASCII-8BIT", "\x01\x01", "US-ASCII"],
+ ["US-ASCII", "\x01\x01", "ASCII-8BIT", "\x01\x81", "ASCII-8BIT"],
+ ["US-ASCII", "\x01\x01", "ISO-8859-1", "", "US-ASCII"],
+ ["US-ASCII", "\x01\x01", "ISO-8859-1", "\x01\x01", "US-ASCII"],
+ ["US-ASCII", "\x01\x01", "ISO-8859-1", "\x01\x81", "ISO-8859-1"],
+ ["US-ASCII", "\x01\x01", "UTF-16BE", "", "US-ASCII"],
+ ["US-ASCII", "\x01\x01", "UTF-16BE", "\u0101", nil],
+ ["US-ASCII", "\x01\x01", "UTF-16BE", "\u0181", nil],
+ ["US-ASCII", "\x01\x01", "ISO-2022-JP", "", "US-ASCII"],
+ ["US-ASCII", "\x01\x01", "ISO-2022-JP", "\x01\x01", nil],
+ ["US-ASCII", "\x01\x01", "ISO-2022-JP", "\x01\x81", nil],
+ ["US-ASCII", "\x01\x81", "US-ASCII", "", "US-ASCII"],
+ ["US-ASCII", "\x01\x81", "US-ASCII", "\x01\x01", "US-ASCII"],
+ ["US-ASCII", "\x01\x81", "US-ASCII", "\x01\x81", "US-ASCII"],
+ ["US-ASCII", "\x01\x81", "UTF-8", "", "US-ASCII"],
+ ["US-ASCII", "\x01\x81", "UTF-8", "\u0001\u0001", "US-ASCII"],
+ ["US-ASCII", "\x01\x81", "UTF-8", "\u0001\x81", nil],
+ ["US-ASCII", "\x01\x81", "ASCII-8BIT", "", "US-ASCII"],
+ ["US-ASCII", "\x01\x81", "ASCII-8BIT", "\x01\x01", "US-ASCII"],
+ ["US-ASCII", "\x01\x81", "ASCII-8BIT", "\x01\x81", nil],
+ ["US-ASCII", "\x01\x81", "ISO-8859-1", "", "US-ASCII"],
+ ["US-ASCII", "\x01\x81", "ISO-8859-1", "\x01\x01", "US-ASCII"],
+ ["US-ASCII", "\x01\x81", "ISO-8859-1", "\x01\x81", nil],
+ ["US-ASCII", "\x01\x81", "UTF-16BE", "", "US-ASCII"],
+ ["US-ASCII", "\x01\x81", "UTF-16BE", "\u0101", nil],
+ ["US-ASCII", "\x01\x81", "UTF-16BE", "\u0181", nil],
+ ["US-ASCII", "\x01\x81", "ISO-2022-JP", "", "US-ASCII"],
+ ["US-ASCII", "\x01\x81", "ISO-2022-JP", "\x01\x01", nil],
+ ["US-ASCII", "\x01\x81", "ISO-2022-JP", "\x01\x81", nil],
+ ["UTF-8", "", "US-ASCII", "", "UTF-8"],
+ ["UTF-8", "", "US-ASCII", "\x01\x01", "UTF-8"],
+ ["UTF-8", "", "US-ASCII", "\x01\x81", "US-ASCII"],
+ ["UTF-8", "", "UTF-8", "", "UTF-8"],
+ ["UTF-8", "", "UTF-8", "\u0001\u0001", "UTF-8"],
+ ["UTF-8", "", "UTF-8", "\u0001\x81", "UTF-8"],
+ ["UTF-8", "", "ASCII-8BIT", "", "UTF-8"],
+ ["UTF-8", "", "ASCII-8BIT", "\x01\x01", "UTF-8"],
+ ["UTF-8", "", "ASCII-8BIT", "\x01\x81", "ASCII-8BIT"],
+ ["UTF-8", "", "ISO-8859-1", "", "UTF-8"],
+ ["UTF-8", "", "ISO-8859-1", "\x01\x01", "UTF-8"],
+ ["UTF-8", "", "ISO-8859-1", "\x01\x81", "ISO-8859-1"],
+ ["UTF-8", "", "UTF-16BE", "", "UTF-8"],
+ ["UTF-8", "", "UTF-16BE", "\u0101", "UTF-16BE"],
+ ["UTF-8", "", "UTF-16BE", "\u0181", "UTF-16BE"],
+ ["UTF-8", "", "ISO-2022-JP", "", "UTF-8"],
+ ["UTF-8", "", "ISO-2022-JP", "\x01\x01", "ISO-2022-JP"],
+ ["UTF-8", "", "ISO-2022-JP", "\x01\x81", "ISO-2022-JP"],
+ ["UTF-8", "\u0001\u0001", "US-ASCII", "", "UTF-8"],
+ ["UTF-8", "\u0001\u0001", "US-ASCII", "\x01\x01", "UTF-8"],
+ ["UTF-8", "\u0001\u0001", "US-ASCII", "\x01\x81", "US-ASCII"],
+ ["UTF-8", "\u0001\u0001", "UTF-8", "", "UTF-8"],
+ ["UTF-8", "\u0001\u0001", "UTF-8", "\u0001\u0001", "UTF-8"],
+ ["UTF-8", "\u0001\u0001", "UTF-8", "\u0001\x81", "UTF-8"],
+ ["UTF-8", "\u0001\u0001", "ASCII-8BIT", "", "UTF-8"],
+ ["UTF-8", "\u0001\u0001", "ASCII-8BIT", "\x01\x01", "UTF-8"],
+ ["UTF-8", "\u0001\u0001", "ASCII-8BIT", "\x01\x81", "ASCII-8BIT"],
+ ["UTF-8", "\u0001\u0001", "ISO-8859-1", "", "UTF-8"],
+ ["UTF-8", "\u0001\u0001", "ISO-8859-1", "\x01\x01", "UTF-8"],
+ ["UTF-8", "\u0001\u0001", "ISO-8859-1", "\x01\x81", "ISO-8859-1"],
+ ["UTF-8", "\u0001\u0001", "UTF-16BE", "", "UTF-8"],
+ ["UTF-8", "\u0001\u0001", "UTF-16BE", "\u0101", nil],
+ ["UTF-8", "\u0001\u0001", "UTF-16BE", "\u0181", nil],
+ ["UTF-8", "\u0001\u0001", "ISO-2022-JP", "", "UTF-8"],
+ ["UTF-8", "\u0001\u0001", "ISO-2022-JP", "\x01\x01", nil],
+ ["UTF-8", "\u0001\u0001", "ISO-2022-JP", "\x01\x81", nil],
+ ["UTF-8", "\u0001\x81", "US-ASCII", "", "UTF-8"],
+ ["UTF-8", "\u0001\x81", "US-ASCII", "\x01\x01", "UTF-8"],
+ ["UTF-8", "\u0001\x81", "US-ASCII", "\x01\x81", nil],
+ ["UTF-8", "\u0001\x81", "UTF-8", "", "UTF-8"],
+ ["UTF-8", "\u0001\x81", "UTF-8", "\u0001\u0001", "UTF-8"],
+ ["UTF-8", "\u0001\x81", "UTF-8", "\u0001\x81", "UTF-8"],
+ ["UTF-8", "\u0001\x81", "ASCII-8BIT", "", "UTF-8"],
+ ["UTF-8", "\u0001\x81", "ASCII-8BIT", "\x01\x01", "UTF-8"],
+ ["UTF-8", "\u0001\x81", "ASCII-8BIT", "\x01\x81", nil],
+ ["UTF-8", "\u0001\x81", "ISO-8859-1", "", "UTF-8"],
+ ["UTF-8", "\u0001\x81", "ISO-8859-1", "\x01\x01", "UTF-8"],
+ ["UTF-8", "\u0001\x81", "ISO-8859-1", "\x01\x81", nil],
+ ["UTF-8", "\u0001\x81", "UTF-16BE", "", "UTF-8"],
+ ["UTF-8", "\u0001\x81", "UTF-16BE", "\u0101", nil],
+ ["UTF-8", "\u0001\x81", "UTF-16BE", "\u0181", nil],
+ ["UTF-8", "\u0001\x81", "ISO-2022-JP", "", "UTF-8"],
+ ["UTF-8", "\u0001\x81", "ISO-2022-JP", "\x01\x01", nil],
+ ["UTF-8", "\u0001\x81", "ISO-2022-JP", "\x01\x81", nil],
+ ["ASCII-8BIT", "", "US-ASCII", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "", "US-ASCII", "\x01\x01", "ASCII-8BIT"],
+ ["ASCII-8BIT", "", "US-ASCII", "\x01\x81", "US-ASCII"],
+ ["ASCII-8BIT", "", "UTF-8", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "", "UTF-8", "\u0001\u0001", "ASCII-8BIT"],
+ ["ASCII-8BIT", "", "UTF-8", "\u0001\x81", "UTF-8"],
+ ["ASCII-8BIT", "", "ASCII-8BIT", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "", "ASCII-8BIT", "\x01\x01", "ASCII-8BIT"],
+ ["ASCII-8BIT", "", "ASCII-8BIT", "\x01\x81", "ASCII-8BIT"],
+ ["ASCII-8BIT", "", "ISO-8859-1", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "", "ISO-8859-1", "\x01\x01", "ASCII-8BIT"],
+ ["ASCII-8BIT", "", "ISO-8859-1", "\x01\x81", "ISO-8859-1"],
+ ["ASCII-8BIT", "", "UTF-16BE", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "", "UTF-16BE", "\u0101", "UTF-16BE"],
+ ["ASCII-8BIT", "", "UTF-16BE", "\u0181", "UTF-16BE"],
+ ["ASCII-8BIT", "", "ISO-2022-JP", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "", "ISO-2022-JP", "\x01\x01", "ISO-2022-JP"],
+ ["ASCII-8BIT", "", "ISO-2022-JP", "\x01\x81", "ISO-2022-JP"],
+ ["ASCII-8BIT", "\x01\x01", "US-ASCII", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x01", "US-ASCII", "\x01\x01", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x01", "US-ASCII", "\x01\x81", "US-ASCII"],
+ ["ASCII-8BIT", "\x01\x01", "UTF-8", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x01", "UTF-8", "\u0001\u0001", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x01", "UTF-8", "\u0001\x81", "UTF-8"],
+ ["ASCII-8BIT", "\x01\x01", "ASCII-8BIT", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x01", "ASCII-8BIT", "\x01\x01", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x01", "ASCII-8BIT", "\x01\x81", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x01", "ISO-8859-1", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x01", "ISO-8859-1", "\x01\x01", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x01", "ISO-8859-1", "\x01\x81", "ISO-8859-1"],
+ ["ASCII-8BIT", "\x01\x01", "UTF-16BE", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x01", "UTF-16BE", "\u0101", nil],
+ ["ASCII-8BIT", "\x01\x01", "UTF-16BE", "\u0181", nil],
+ ["ASCII-8BIT", "\x01\x01", "ISO-2022-JP", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x01", "ISO-2022-JP", "\x01\x01", nil],
+ ["ASCII-8BIT", "\x01\x01", "ISO-2022-JP", "\x01\x81", nil],
+ ["ASCII-8BIT", "\x01\x81", "US-ASCII", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x81", "US-ASCII", "\x01\x01", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x81", "US-ASCII", "\x01\x81", nil],
+ ["ASCII-8BIT", "\x01\x81", "UTF-8", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x81", "UTF-8", "\u0001\u0001", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x81", "UTF-8", "\u0001\x81", nil],
+ ["ASCII-8BIT", "\x01\x81", "ASCII-8BIT", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x81", "ASCII-8BIT", "\x01\x01", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x81", "ASCII-8BIT", "\x01\x81", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x81", "ISO-8859-1", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x81", "ISO-8859-1", "\x01\x01", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x81", "ISO-8859-1", "\x01\x81", nil],
+ ["ASCII-8BIT", "\x01\x81", "UTF-16BE", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x81", "UTF-16BE", "\u0101", nil],
+ ["ASCII-8BIT", "\x01\x81", "UTF-16BE", "\u0181", nil],
+ ["ASCII-8BIT", "\x01\x81", "ISO-2022-JP", "", "ASCII-8BIT"],
+ ["ASCII-8BIT", "\x01\x81", "ISO-2022-JP", "\x01\x01", nil],
+ ["ASCII-8BIT", "\x01\x81", "ISO-2022-JP", "\x01\x81", nil],
+ ["ISO-8859-1", "", "US-ASCII", "", "ISO-8859-1"],
+ ["ISO-8859-1", "", "US-ASCII", "\x01\x01", "ISO-8859-1"],
+ ["ISO-8859-1", "", "US-ASCII", "\x01\x81", "US-ASCII"],
+ ["ISO-8859-1", "", "UTF-8", "", "ISO-8859-1"],
+ ["ISO-8859-1", "", "UTF-8", "\u0001\u0001", "ISO-8859-1"],
+ ["ISO-8859-1", "", "UTF-8", "\u0001\x81", "UTF-8"],
+ ["ISO-8859-1", "", "ASCII-8BIT", "", "ISO-8859-1"],
+ ["ISO-8859-1", "", "ASCII-8BIT", "\x01\x01", "ISO-8859-1"],
+ ["ISO-8859-1", "", "ASCII-8BIT", "\x01\x81", "ASCII-8BIT"],
+ ["ISO-8859-1", "", "ISO-8859-1", "", "ISO-8859-1"],
+ ["ISO-8859-1", "", "ISO-8859-1", "\x01\x01", "ISO-8859-1"],
+ ["ISO-8859-1", "", "ISO-8859-1", "\x01\x81", "ISO-8859-1"],
+ ["ISO-8859-1", "", "UTF-16BE", "", "ISO-8859-1"],
+ ["ISO-8859-1", "", "UTF-16BE", "\u0101", "UTF-16BE"],
+ ["ISO-8859-1", "", "UTF-16BE", "\u0181", "UTF-16BE"],
+ ["ISO-8859-1", "", "ISO-2022-JP", "", "ISO-8859-1"],
+ ["ISO-8859-1", "", "ISO-2022-JP", "\x01\x01", "ISO-2022-JP"],
+ ["ISO-8859-1", "", "ISO-2022-JP", "\x01\x81", "ISO-2022-JP"],
+ ["ISO-8859-1", "\x01\x01", "US-ASCII", "", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x01", "US-ASCII", "\x01\x01", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x01", "US-ASCII", "\x01\x81", "US-ASCII"],
+ ["ISO-8859-1", "\x01\x01", "UTF-8", "", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x01", "UTF-8", "\u0001\u0001", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x01", "UTF-8", "\u0001\x81", "UTF-8"],
+ ["ISO-8859-1", "\x01\x01", "ASCII-8BIT", "", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x01", "ASCII-8BIT", "\x01\x01", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x01", "ASCII-8BIT", "\x01\x81", "ASCII-8BIT"],
+ ["ISO-8859-1", "\x01\x01", "ISO-8859-1", "", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x01", "ISO-8859-1", "\x01\x01", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x01", "ISO-8859-1", "\x01\x81", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x01", "UTF-16BE", "", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x01", "UTF-16BE", "\u0101", nil],
+ ["ISO-8859-1", "\x01\x01", "UTF-16BE", "\u0181", nil],
+ ["ISO-8859-1", "\x01\x01", "ISO-2022-JP", "", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x01", "ISO-2022-JP", "\x01\x01", nil],
+ ["ISO-8859-1", "\x01\x01", "ISO-2022-JP", "\x01\x81", nil],
+ ["ISO-8859-1", "\x01\x81", "US-ASCII", "", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x81", "US-ASCII", "\x01\x01", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x81", "US-ASCII", "\x01\x81", nil],
+ ["ISO-8859-1", "\x01\x81", "UTF-8", "", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x81", "UTF-8", "\u0001\u0001", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x81", "UTF-8", "\u0001\x81", nil],
+ ["ISO-8859-1", "\x01\x81", "ASCII-8BIT", "", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x81", "ASCII-8BIT", "\x01\x01", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x81", "ASCII-8BIT", "\x01\x81", nil],
+ ["ISO-8859-1", "\x01\x81", "ISO-8859-1", "", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x81", "ISO-8859-1", "\x01\x01", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x81", "ISO-8859-1", "\x01\x81", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x81", "UTF-16BE", "", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x81", "UTF-16BE", "\u0101", nil],
+ ["ISO-8859-1", "\x01\x81", "UTF-16BE", "\u0181", nil],
+ ["ISO-8859-1", "\x01\x81", "ISO-2022-JP", "", "ISO-8859-1"],
+ ["ISO-8859-1", "\x01\x81", "ISO-2022-JP", "\x01\x01", nil],
+ ["ISO-8859-1", "\x01\x81", "ISO-2022-JP", "\x01\x81", nil],
+ ["UTF-16BE", "", "US-ASCII", "", "UTF-16BE"],
+ ["UTF-16BE", "", "US-ASCII", "\x01\x01", "US-ASCII"],
+ ["UTF-16BE", "", "US-ASCII", "\x01\x81", "US-ASCII"],
+ ["UTF-16BE", "", "UTF-8", "", "UTF-16BE"],
+ ["UTF-16BE", "", "UTF-8", "\u0001\u0001", "UTF-8"],
+ ["UTF-16BE", "", "UTF-8", "\u0001\x81", "UTF-8"],
+ ["UTF-16BE", "", "ASCII-8BIT", "", "UTF-16BE"],
+ ["UTF-16BE", "", "ASCII-8BIT", "\x01\x01", "ASCII-8BIT"],
+ ["UTF-16BE", "", "ASCII-8BIT", "\x01\x81", "ASCII-8BIT"],
+ ["UTF-16BE", "", "ISO-8859-1", "", "UTF-16BE"],
+ ["UTF-16BE", "", "ISO-8859-1", "\x01\x01", "ISO-8859-1"],
+ ["UTF-16BE", "", "ISO-8859-1", "\x01\x81", "ISO-8859-1"],
+ ["UTF-16BE", "", "UTF-16BE", "", "UTF-16BE"],
+ ["UTF-16BE", "", "UTF-16BE", "\u0101", "UTF-16BE"],
+ ["UTF-16BE", "", "UTF-16BE", "\u0181", "UTF-16BE"],
+ ["UTF-16BE", "", "ISO-2022-JP", "", "UTF-16BE"],
+ ["UTF-16BE", "", "ISO-2022-JP", "\x01\x01", "ISO-2022-JP"],
+ ["UTF-16BE", "", "ISO-2022-JP", "\x01\x81", "ISO-2022-JP"],
+ ["UTF-16BE", "\u0101", "US-ASCII", "", "UTF-16BE"],
+ ["UTF-16BE", "\u0101", "US-ASCII", "\x01\x01", nil],
+ ["UTF-16BE", "\u0101", "US-ASCII", "\x01\x81", nil],
+ ["UTF-16BE", "\u0101", "UTF-8", "", "UTF-16BE"],
+ ["UTF-16BE", "\u0101", "UTF-8", "\u0001\u0001", nil],
+ ["UTF-16BE", "\u0101", "UTF-8", "\u0001\x81", nil],
+ ["UTF-16BE", "\u0101", "ASCII-8BIT", "", "UTF-16BE"],
+ ["UTF-16BE", "\u0101", "ASCII-8BIT", "\x01\x01", nil],
+ ["UTF-16BE", "\u0101", "ASCII-8BIT", "\x01\x81", nil],
+ ["UTF-16BE", "\u0101", "ISO-8859-1", "", "UTF-16BE"],
+ ["UTF-16BE", "\u0101", "ISO-8859-1", "\x01\x01", nil],
+ ["UTF-16BE", "\u0101", "ISO-8859-1", "\x01\x81", nil],
+ ["UTF-16BE", "\u0101", "UTF-16BE", "", "UTF-16BE"],
+ ["UTF-16BE", "\u0101", "UTF-16BE", "\u0101", "UTF-16BE"],
+ ["UTF-16BE", "\u0101", "UTF-16BE", "\u0181", "UTF-16BE"],
+ ["UTF-16BE", "\u0101", "ISO-2022-JP", "", "UTF-16BE"],
+ ["UTF-16BE", "\u0101", "ISO-2022-JP", "\x01\x01", nil],
+ ["UTF-16BE", "\u0101", "ISO-2022-JP", "\x01\x81", nil],
+ ["UTF-16BE", "\u0181", "US-ASCII", "", "UTF-16BE"],
+ ["UTF-16BE", "\u0181", "US-ASCII", "\x01\x01", nil],
+ ["UTF-16BE", "\u0181", "US-ASCII", "\x01\x81", nil],
+ ["UTF-16BE", "\u0181", "UTF-8", "", "UTF-16BE"],
+ ["UTF-16BE", "\u0181", "UTF-8", "\u0001\u0001", nil],
+ ["UTF-16BE", "\u0181", "UTF-8", "\u0001\x81", nil],
+ ["UTF-16BE", "\u0181", "ASCII-8BIT", "", "UTF-16BE"],
+ ["UTF-16BE", "\u0181", "ASCII-8BIT", "\x01\x01", nil],
+ ["UTF-16BE", "\u0181", "ASCII-8BIT", "\x01\x81", nil],
+ ["UTF-16BE", "\u0181", "ISO-8859-1", "", "UTF-16BE"],
+ ["UTF-16BE", "\u0181", "ISO-8859-1", "\x01\x01", nil],
+ ["UTF-16BE", "\u0181", "ISO-8859-1", "\x01\x81", nil],
+ ["UTF-16BE", "\u0181", "UTF-16BE", "", "UTF-16BE"],
+ ["UTF-16BE", "\u0181", "UTF-16BE", "\u0101", "UTF-16BE"],
+ ["UTF-16BE", "\u0181", "UTF-16BE", "\u0181", "UTF-16BE"],
+ ["UTF-16BE", "\u0181", "ISO-2022-JP", "", "UTF-16BE"],
+ ["UTF-16BE", "\u0181", "ISO-2022-JP", "\x01\x01", nil],
+ ["UTF-16BE", "\u0181", "ISO-2022-JP", "\x01\x81", nil],
+ ["ISO-2022-JP", "", "US-ASCII", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "", "US-ASCII", "\x01\x01", "US-ASCII"],
+ ["ISO-2022-JP", "", "US-ASCII", "\x01\x81", "US-ASCII"],
+ ["ISO-2022-JP", "", "UTF-8", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "", "UTF-8", "\u0001\u0001", "UTF-8"],
+ ["ISO-2022-JP", "", "UTF-8", "\u0001\x81", "UTF-8"],
+ ["ISO-2022-JP", "", "ASCII-8BIT", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "", "ASCII-8BIT", "\x01\x01", "ASCII-8BIT"],
+ ["ISO-2022-JP", "", "ASCII-8BIT", "\x01\x81", "ASCII-8BIT"],
+ ["ISO-2022-JP", "", "ISO-8859-1", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "", "ISO-8859-1", "\x01\x01", "ISO-8859-1"],
+ ["ISO-2022-JP", "", "ISO-8859-1", "\x01\x81", "ISO-8859-1"],
+ ["ISO-2022-JP", "", "UTF-16BE", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "", "UTF-16BE", "\u0101", "UTF-16BE"],
+ ["ISO-2022-JP", "", "UTF-16BE", "\u0181", "UTF-16BE"],
+ ["ISO-2022-JP", "", "ISO-2022-JP", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "", "ISO-2022-JP", "\x01\x01", "ISO-2022-JP"],
+ ["ISO-2022-JP", "", "ISO-2022-JP", "\x01\x81", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x01", "US-ASCII", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x01", "US-ASCII", "\x01\x01", nil],
+ ["ISO-2022-JP", "\x01\x01", "US-ASCII", "\x01\x81", nil],
+ ["ISO-2022-JP", "\x01\x01", "UTF-8", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x01", "UTF-8", "\u0001\u0001", nil],
+ ["ISO-2022-JP", "\x01\x01", "UTF-8", "\u0001\x81", nil],
+ ["ISO-2022-JP", "\x01\x01", "ASCII-8BIT", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x01", "ASCII-8BIT", "\x01\x01", nil],
+ ["ISO-2022-JP", "\x01\x01", "ASCII-8BIT", "\x01\x81", nil],
+ ["ISO-2022-JP", "\x01\x01", "ISO-8859-1", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x01", "ISO-8859-1", "\x01\x01", nil],
+ ["ISO-2022-JP", "\x01\x01", "ISO-8859-1", "\x01\x81", nil],
+ ["ISO-2022-JP", "\x01\x01", "UTF-16BE", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x01", "UTF-16BE", "\u0101", nil],
+ ["ISO-2022-JP", "\x01\x01", "UTF-16BE", "\u0181", nil],
+ ["ISO-2022-JP", "\x01\x01", "ISO-2022-JP", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x01", "ISO-2022-JP", "\x01\x01", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x01", "ISO-2022-JP", "\x01\x81", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x81", "US-ASCII", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x81", "US-ASCII", "\x01\x01", nil],
+ ["ISO-2022-JP", "\x01\x81", "US-ASCII", "\x01\x81", nil],
+ ["ISO-2022-JP", "\x01\x81", "UTF-8", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x81", "UTF-8", "\u0001\u0001", nil],
+ ["ISO-2022-JP", "\x01\x81", "UTF-8", "\u0001\x81", nil],
+ ["ISO-2022-JP", "\x01\x81", "ASCII-8BIT", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x81", "ASCII-8BIT", "\x01\x01", nil],
+ ["ISO-2022-JP", "\x01\x81", "ASCII-8BIT", "\x01\x81", nil],
+ ["ISO-2022-JP", "\x01\x81", "ISO-8859-1", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x81", "ISO-8859-1", "\x01\x01", nil],
+ ["ISO-2022-JP", "\x01\x81", "ISO-8859-1", "\x01\x81", nil],
+ ["ISO-2022-JP", "\x01\x81", "UTF-16BE", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x81", "UTF-16BE", "\u0101", nil],
+ ["ISO-2022-JP", "\x01\x81", "UTF-16BE", "\u0181", nil],
+ ["ISO-2022-JP", "\x01\x81", "ISO-2022-JP", "", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x81", "ISO-2022-JP", "\x01\x01", "ISO-2022-JP"],
+ ["ISO-2022-JP", "\x01\x81", "ISO-2022-JP", "\x01\x81", "ISO-2022-JP"],
+ ]
+
+ matrix.each do |encoding1, value1, encoding2, value2, compatible_encoding|
+ it "returns #{compatible_encoding} for #{value1.inspect} in #{encoding1} and #{value2.inspect} in #{encoding2}" do
+ actual_encoding = Encoding.compatible?(value1.dup.force_encoding(encoding1), value2.dup.force_encoding(encoding2))
+ actual_encoding&.name.should == compatible_encoding
+ end
+ end
+ end
+end
+
+describe "Encoding.compatible? String, Regexp" do
+ it "returns US-ASCII if both are US-ASCII" do
+ str = "abc".dup.force_encoding("us-ascii")
+ Encoding.compatible?(str, /abc/).should == Encoding::US_ASCII
+ end
+
+ it "returns the String's Encoding if it is not US-ASCII but both are ASCII only" do
+ [ [Encoding, "abc", Encoding::BINARY],
+ [Encoding, "abc".encode("utf-8"), Encoding::UTF_8],
+ [Encoding, "abc".encode("euc-jp"), Encoding::EUC_JP],
+ [Encoding, "abc".encode("shift_jis"), Encoding::Shift_JIS],
+ ].should be_computed_by(:compatible?, /abc/)
+ end
+
+ it "returns the String's Encoding if the String is not ASCII only" do
+ [ [Encoding, "\xff", Encoding::BINARY],
+ [Encoding, "\u3042".encode("utf-8"), Encoding::UTF_8],
+ [Encoding, "\xa4\xa2".dup.force_encoding("euc-jp"), Encoding::EUC_JP],
+ [Encoding, "\x82\xa0".dup.force_encoding("shift_jis"), Encoding::Shift_JIS],
+ ].should be_computed_by(:compatible?, /abc/)
+ end
+
+ it "returns the Regexp's Encoding if the String is ASCII only and the Regexp is not" do
+ r = Regexp.new("\xa4\xa2".dup.force_encoding("euc-jp"))
+ Encoding.compatible?("hello".dup.force_encoding("utf-8"), r).should == Encoding::EUC_JP
+ end
+end
+
+describe "Encoding.compatible? String, Symbol" do
+ it "returns US-ASCII if both are ASCII only" do
+ str = "abc".dup.force_encoding("us-ascii")
+ Encoding.compatible?(str, :abc).should == Encoding::US_ASCII
+ end
+
+ it "returns the String's Encoding if it is not US-ASCII but both are ASCII only" do
+ [ [Encoding, "abc", Encoding::BINARY],
+ [Encoding, "abc".encode("utf-8"), Encoding::UTF_8],
+ [Encoding, "abc".encode("euc-jp"), Encoding::EUC_JP],
+ [Encoding, "abc".encode("shift_jis"), Encoding::Shift_JIS],
+ ].should be_computed_by(:compatible?, :abc)
+ end
+
+ it "returns the String's Encoding if the String is not ASCII only" do
+ [ [Encoding, "\xff", Encoding::BINARY],
+ [Encoding, "\u3042".encode("utf-8"), Encoding::UTF_8],
+ [Encoding, "\xa4\xa2".dup.force_encoding("euc-jp"), Encoding::EUC_JP],
+ [Encoding, "\x82\xa0".dup.force_encoding("shift_jis"), Encoding::Shift_JIS],
+ ].should be_computed_by(:compatible?, :abc)
+ end
+end
+
+describe "Encoding.compatible? String, Encoding" do
+ it "returns nil if the String's encoding is not ASCII compatible" do
+ Encoding.compatible?("abc".encode("utf-32le"), Encoding::US_ASCII).should == nil
+ end
+
+ it "returns nil if the Encoding is not ASCII compatible" do
+ Encoding.compatible?("abc".encode("us-ascii"), Encoding::UTF_32LE).should == nil
+ end
+
+ it "returns the String's encoding if the Encoding is US-ASCII" do
+ [ [Encoding, "\xff", Encoding::BINARY],
+ [Encoding, "\u3042".encode("utf-8"), Encoding::UTF_8],
+ [Encoding, "\xa4\xa2".dup.force_encoding("euc-jp"), Encoding::EUC_JP],
+ [Encoding, "\x82\xa0".dup.force_encoding("shift_jis"), Encoding::Shift_JIS],
+ ].should be_computed_by(:compatible?, Encoding::US_ASCII)
+ end
+
+ it "returns the Encoding if the String's encoding is ASCII compatible and the String is ASCII only" do
+ str = "abc".encode("utf-8")
+
+ Encoding.compatible?(str, Encoding::BINARY).should == Encoding::BINARY
+ Encoding.compatible?(str, Encoding::UTF_8).should == Encoding::UTF_8
+ Encoding.compatible?(str, Encoding::EUC_JP).should == Encoding::EUC_JP
+ Encoding.compatible?(str, Encoding::Shift_JIS).should == Encoding::Shift_JIS
+ end
+
+ it "returns nil if the String's encoding is ASCII compatible but the string is not ASCII only" do
+ Encoding.compatible?("\u3042".encode("utf-8"), Encoding::BINARY).should == nil
+ end
+end
+
+describe "Encoding.compatible? Regexp, String" do
+ it "returns US-ASCII if both are US-ASCII" do
+ str = "abc".dup.force_encoding("us-ascii")
+ Encoding.compatible?(/abc/, str).should == Encoding::US_ASCII
+ end
+
+ it "returns the String's Encoding when the String is ASCII only with a different encoding" do
+ r = Regexp.new("\xa4\xa2".dup.force_encoding("euc-jp"))
+ Encoding.compatible?(r, "hello".dup.force_encoding("utf-8")).should == Encoding::UTF_8
+ end
+
+ it "returns the Regexp's Encoding if the String has the same non-ASCII encoding" do
+ r = Regexp.new("\xa4\xa2".dup.force_encoding("euc-jp"))
+ Encoding.compatible?(r, "hello".dup.force_encoding("euc-jp")).should == Encoding::EUC_JP
+ end
+end
+
+describe "Encoding.compatible? Regexp, Regexp" do
+ it "returns US-ASCII if both are US-ASCII" do
+ Encoding.compatible?(/abc/, /def/).should == Encoding::US_ASCII
+ end
+
+ it "returns the first's Encoding if it is not US-ASCII and not ASCII only" do
+ [ [Encoding, Regexp.new("\xff"), Encoding::BINARY],
+ [Encoding, Regexp.new("\u3042".encode("utf-8")), Encoding::UTF_8],
+ [Encoding, Regexp.new("\xa4\xa2".dup.force_encoding("euc-jp")), Encoding::EUC_JP],
+ [Encoding, Regexp.new("\x82\xa0".dup.force_encoding("shift_jis")), Encoding::Shift_JIS],
+ ].should be_computed_by(:compatible?, /abc/)
+ end
+end
+
+describe "Encoding.compatible? Regexp, Symbol" do
+ it "returns US-ASCII if both are US-ASCII" do
+ Encoding.compatible?(/abc/, :def).should == Encoding::US_ASCII
+ end
+
+ it "returns the first's Encoding if it is not US-ASCII and not ASCII only" do
+ [ [Encoding, Regexp.new("\xff"), Encoding::BINARY],
+ [Encoding, Regexp.new("\u3042".encode("utf-8")), Encoding::UTF_8],
+ [Encoding, Regexp.new("\xa4\xa2".dup.force_encoding("euc-jp")), Encoding::EUC_JP],
+ [Encoding, Regexp.new("\x82\xa0".dup.force_encoding("shift_jis")), Encoding::Shift_JIS],
+ ].should be_computed_by(:compatible?, /abc/)
+ end
+end
+
+describe "Encoding.compatible? Symbol, String" do
+ it "returns US-ASCII if both are ASCII only" do
+ str = "abc".dup.force_encoding("us-ascii")
+ Encoding.compatible?(str, :abc).should == Encoding::US_ASCII
+ end
+end
+
+describe "Encoding.compatible? Symbol, Regexp" do
+ it "returns US-ASCII if both are US-ASCII" do
+ Encoding.compatible?(:abc, /def/).should == Encoding::US_ASCII
+ end
+
+ it "returns the Regexp's Encoding if it is not US-ASCII and not ASCII only" do
+ a = Regexp.new("\xff")
+ b = Regexp.new("\u3042".encode("utf-8"))
+ c = Regexp.new("\xa4\xa2".dup.force_encoding("euc-jp"))
+ d = Regexp.new("\x82\xa0".dup.force_encoding("shift_jis"))
+
+ [ [Encoding, :abc, a, Encoding::BINARY],
+ [Encoding, :abc, b, Encoding::UTF_8],
+ [Encoding, :abc, c, Encoding::EUC_JP],
+ [Encoding, :abc, d, Encoding::Shift_JIS],
+ ].should be_computed_by(:compatible?)
+ end
+end
+
+describe "Encoding.compatible? Symbol, Symbol" do
+ it "returns US-ASCII if both are US-ASCII" do
+ Encoding.compatible?(:abc, :def).should == Encoding::US_ASCII
+ end
+
+ it "returns the first's Encoding if it is not ASCII only" do
+ [ [Encoding, "\xff".to_sym, Encoding::BINARY],
+ [Encoding, "\u3042".encode("utf-8").to_sym, Encoding::UTF_8],
+ [Encoding, "\xa4\xa2".dup.force_encoding("euc-jp").to_sym, Encoding::EUC_JP],
+ [Encoding, "\x82\xa0".dup.force_encoding("shift_jis").to_sym, Encoding::Shift_JIS],
+ ].should be_computed_by(:compatible?, :abc)
+ end
+end
+
+describe "Encoding.compatible? Encoding, Encoding" do
+ it "returns nil if one of the encodings is a dummy encoding" do
+ [ [Encoding, Encoding::UTF_7, Encoding::US_ASCII, nil],
+ [Encoding, Encoding::US_ASCII, Encoding::UTF_7, nil],
+ [Encoding, Encoding::EUC_JP, Encoding::UTF_7, nil],
+ [Encoding, Encoding::UTF_7, Encoding::EUC_JP, nil],
+ [Encoding, Encoding::UTF_7, Encoding::BINARY, nil],
+ [Encoding, Encoding::BINARY, Encoding::UTF_7, nil],
+ ].should be_computed_by(:compatible?)
+ end
+
+ it "returns nil if one of the encodings is not US-ASCII" do
+ [ [Encoding, Encoding::UTF_8, Encoding::BINARY, nil],
+ [Encoding, Encoding::BINARY, Encoding::UTF_8, nil],
+ [Encoding, Encoding::BINARY, Encoding::EUC_JP, nil],
+ [Encoding, Encoding::Shift_JIS, Encoding::EUC_JP, nil],
+ ].should be_computed_by(:compatible?)
+ end
+
+ it "returns the first if the second is US-ASCII" do
+ [ [Encoding, Encoding::UTF_8, Encoding::US_ASCII, Encoding::UTF_8],
+ [Encoding, Encoding::EUC_JP, Encoding::US_ASCII, Encoding::EUC_JP],
+ [Encoding, Encoding::Shift_JIS, Encoding::US_ASCII, Encoding::Shift_JIS],
+ [Encoding, Encoding::BINARY, Encoding::US_ASCII, Encoding::BINARY],
+ ].should be_computed_by(:compatible?)
+ end
+
+ it "returns the Encoding if both are the same" do
+ [ [Encoding, Encoding::UTF_8, Encoding::UTF_8, Encoding::UTF_8],
+ [Encoding, Encoding::US_ASCII, Encoding::US_ASCII, Encoding::US_ASCII],
+ [Encoding, Encoding::BINARY, Encoding::BINARY, Encoding::BINARY],
+ [Encoding, Encoding::UTF_7, Encoding::UTF_7, Encoding::UTF_7],
+ ].should be_computed_by(:compatible?)
+ end
+end
+
+describe "Encoding.compatible? Object, Object" do
+ it "returns nil for Object, String" do
+ Encoding.compatible?(Object.new, "abc").should == nil
+ end
+
+ it "returns nil for Object, Regexp" do
+ Encoding.compatible?(Object.new, /./).should == nil
+ end
+
+ it "returns nil for Object, Symbol" do
+ Encoding.compatible?(Object.new, :sym).should == nil
+ end
+
+ it "returns nil for String, Object" do
+ Encoding.compatible?("abc", Object.new).should == nil
+ end
+
+ it "returns nil for Regexp, Object" do
+ Encoding.compatible?(/./, Object.new).should == nil
+ end
+
+ it "returns nil for Symbol, Object" do
+ Encoding.compatible?(:sym, Object.new).should == nil
+ end
+end
+
+describe "Encoding.compatible? nil, nil" do
+ it "returns nil" do
+ Encoding.compatible?(nil, nil).should == nil
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/asciicompat_encoding_spec.rb b/spec/ruby/core/encoding/converter/asciicompat_encoding_spec.rb
new file mode 100644
index 0000000000..7fa867a57e
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/asciicompat_encoding_spec.rb
@@ -0,0 +1,31 @@
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter.asciicompat_encoding" do
+ it "coerces non-String/Encoding objects with #to_str" do
+ str = mock('string')
+ str.should_receive(:to_str).at_least(1).times.and_return('string')
+ Encoding::Converter.asciicompat_encoding(str)
+ end
+
+ it "accepts an Encoding object as an argument" do
+ Encoding::Converter.asciicompat_encoding(Encoding.find("ISO-2022-JP")).should ==
+ Encoding::Converter.asciicompat_encoding("ISO-2022-JP")
+ end
+
+ it "returns a corresponding ASCII compatible encoding for ASCII-incompatible encodings" do
+ Encoding::Converter.asciicompat_encoding('UTF-16BE').should == Encoding::UTF_8
+ Encoding::Converter.asciicompat_encoding("ISO-2022-JP").should == Encoding.find("stateless-ISO-2022-JP")
+ end
+
+ it "returns nil when the given encoding is ASCII compatible" do
+ Encoding::Converter.asciicompat_encoding('ASCII').should == nil
+ Encoding::Converter.asciicompat_encoding('UTF-8').should == nil
+ end
+
+ it "handles encoding names who resolve to nil encodings" do
+ internal = Encoding.default_internal
+ Encoding.default_internal = nil
+ Encoding::Converter.asciicompat_encoding('internal').should == nil
+ Encoding.default_internal = internal
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/constants_spec.rb b/spec/ruby/core/encoding/converter/constants_spec.rb
new file mode 100644
index 0000000000..e2d21b5429
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/constants_spec.rb
@@ -0,0 +1,131 @@
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter::INVALID_MASK" do
+ it "exists" do
+ Encoding::Converter.should.const_defined?(:INVALID_MASK, false)
+ end
+
+ it "has an Integer value" do
+ Encoding::Converter::INVALID_MASK.should.instance_of?(Integer)
+ end
+end
+
+describe "Encoding::Converter::INVALID_REPLACE" do
+ it "exists" do
+ Encoding::Converter.should.const_defined?(:INVALID_REPLACE, false)
+ end
+
+ it "has an Integer value" do
+ Encoding::Converter::INVALID_REPLACE.should.instance_of?(Integer)
+ end
+end
+
+describe "Encoding::Converter::UNDEF_MASK" do
+ it "exists" do
+ Encoding::Converter.should.const_defined?(:UNDEF_MASK, false)
+ end
+
+ it "has an Integer value" do
+ Encoding::Converter::UNDEF_MASK.should.instance_of?(Integer)
+ end
+end
+
+describe "Encoding::Converter::UNDEF_REPLACE" do
+ it "exists" do
+ Encoding::Converter.should.const_defined?(:UNDEF_REPLACE, false)
+ end
+
+ it "has an Integer value" do
+ Encoding::Converter::UNDEF_REPLACE.should.instance_of?(Integer)
+ end
+end
+
+describe "Encoding::Converter::UNDEF_HEX_CHARREF" do
+ it "exists" do
+ Encoding::Converter.should.const_defined?(:UNDEF_HEX_CHARREF, false)
+ end
+
+ it "has an Integer value" do
+ Encoding::Converter::UNDEF_HEX_CHARREF.should.instance_of?(Integer)
+ end
+end
+
+describe "Encoding::Converter::PARTIAL_INPUT" do
+ it "exists" do
+ Encoding::Converter.should.const_defined?(:PARTIAL_INPUT, false)
+ end
+
+ it "has an Integer value" do
+ Encoding::Converter::PARTIAL_INPUT.should.instance_of?(Integer)
+ end
+end
+
+describe "Encoding::Converter::AFTER_OUTPUT" do
+ it "exists" do
+ Encoding::Converter.should.const_defined?(:AFTER_OUTPUT, false)
+ end
+
+ it "has an Integer value" do
+ Encoding::Converter::AFTER_OUTPUT.should.instance_of?(Integer)
+ end
+end
+
+describe "Encoding::Converter::UNIVERSAL_NEWLINE_DECORATOR" do
+ it "exists" do
+ Encoding::Converter.should.const_defined?(:UNIVERSAL_NEWLINE_DECORATOR, false)
+ end
+
+ it "has an Integer value" do
+ Encoding::Converter::UNIVERSAL_NEWLINE_DECORATOR.should.instance_of?(Integer)
+ end
+end
+
+describe "Encoding::Converter::CRLF_NEWLINE_DECORATOR" do
+ it "exists" do
+ Encoding::Converter.should.const_defined?(:CRLF_NEWLINE_DECORATOR, false)
+ end
+
+ it "has an Integer value" do
+ Encoding::Converter::CRLF_NEWLINE_DECORATOR.should.instance_of?(Integer)
+ end
+end
+
+describe "Encoding::Converter::CR_NEWLINE_DECORATOR" do
+ it "exists" do
+ Encoding::Converter.should.const_defined?(:CR_NEWLINE_DECORATOR, false)
+ end
+
+ it "has an Integer value" do
+ Encoding::Converter::CR_NEWLINE_DECORATOR.should.instance_of?(Integer)
+ end
+end
+
+describe "Encoding::Converter::XML_TEXT_DECORATOR" do
+ it "exists" do
+ Encoding::Converter.should.const_defined?(:XML_TEXT_DECORATOR, false)
+ end
+
+ it "has an Integer value" do
+ Encoding::Converter::XML_TEXT_DECORATOR.should.instance_of?(Integer)
+ end
+end
+
+describe "Encoding::Converter::XML_ATTR_CONTENT_DECORATOR" do
+ it "exists" do
+ Encoding::Converter.should.const_defined?(:XML_ATTR_CONTENT_DECORATOR, false)
+ end
+
+ it "has an Integer value" do
+ Encoding::Converter::XML_ATTR_CONTENT_DECORATOR.should.instance_of?(Integer)
+ end
+end
+
+describe "Encoding::Converter::XML_ATTR_QUOTE_DECORATOR" do
+ it "exists" do
+ Encoding::Converter.should.const_defined?(:XML_ATTR_QUOTE_DECORATOR, false)
+ end
+
+ it "has an Integer value" do
+ Encoding::Converter::XML_ATTR_QUOTE_DECORATOR.should.instance_of?(Integer)
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/convert_spec.rb b/spec/ruby/core/encoding/converter/convert_spec.rb
new file mode 100644
index 0000000000..c95e88a491
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/convert_spec.rb
@@ -0,0 +1,45 @@
+# encoding: binary
+# frozen_string_literal: true
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter#convert" do
+ it "returns a String" do
+ ec = Encoding::Converter.new('ascii', 'utf-8')
+ ec.convert('glark').should.instance_of?(String)
+ end
+
+ it "sets the encoding of the result to the target encoding" do
+ ec = Encoding::Converter.new('ascii', 'utf-8')
+ str = 'glark'.dup.force_encoding('ascii')
+ ec.convert(str).encoding.should == Encoding::UTF_8
+ end
+
+ it "transcodes the given String to the target encoding" do
+ ec = Encoding::Converter.new("utf-8", "euc-jp")
+ ec.convert("\u3042".dup.force_encoding('UTF-8')).should == \
+ "\xA4\xA2".dup.force_encoding('EUC-JP')
+ end
+
+ it "allows Strings of different encodings to the source encoding" do
+ ec = Encoding::Converter.new('ascii', 'utf-8')
+ str = 'glark'.dup.force_encoding('SJIS')
+ ec.convert(str).encoding.should == Encoding::UTF_8
+ end
+
+ it "reuses the given encoding pair if called multiple times" do
+ ec = Encoding::Converter.new('ascii', 'SJIS')
+ ec.convert('a'.dup.force_encoding('ASCII')).should == 'a'.dup.force_encoding('SJIS')
+ ec.convert('b'.dup.force_encoding('ASCII')).should == 'b'.dup.force_encoding('SJIS')
+ end
+
+ it "raises UndefinedConversionError if the String contains characters invalid for the target encoding" do
+ ec = Encoding::Converter.new('UTF-8', Encoding.find('macCyrillic'))
+ -> { ec.convert("\u{6543}".dup.force_encoding('UTF-8')) }.should.raise(Encoding::UndefinedConversionError)
+ end
+
+ it "raises an ArgumentError if called on a finished stream" do
+ ec = Encoding::Converter.new('UTF-8', Encoding.find('macCyrillic'))
+ ec.finish
+ -> { ec.convert("\u{65}") }.should.raise(ArgumentError)
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/convpath_spec.rb b/spec/ruby/core/encoding/converter/convpath_spec.rb
new file mode 100644
index 0000000000..23f1e5dc33
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/convpath_spec.rb
@@ -0,0 +1,24 @@
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter#convpath" do
+ it "returns an Array with a single element if there is a direct converter" do
+ cp = Encoding::Converter.new('ASCII', 'UTF-8').convpath
+ cp.should == [[Encoding::US_ASCII, Encoding::UTF_8]]
+ end
+
+ it "returns multiple encoding pairs when direct conversion is impossible" do
+ cp = Encoding::Converter.new('ascii','Big5').convpath
+ cp.should == [
+ [Encoding::US_ASCII, Encoding::UTF_8],
+ [Encoding::UTF_8, Encoding::Big5]
+ ]
+ end
+
+ it "indicates if crlf_newline conversion would occur" do
+ ec = Encoding::Converter.new("ISo-8859-1", "EUC-JP", crlf_newline: true)
+ ec.convpath.last.should == "crlf_newline"
+
+ ec = Encoding::Converter.new("ASCII", "UTF-8", crlf_newline: false)
+ ec.convpath.last.should_not == "crlf_newline"
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/destination_encoding_spec.rb b/spec/ruby/core/encoding/converter/destination_encoding_spec.rb
new file mode 100644
index 0000000000..481a857909
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/destination_encoding_spec.rb
@@ -0,0 +1,11 @@
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter#destination_encoding" do
+ it "returns the destination encoding as an Encoding object" do
+ ec = Encoding::Converter.new('ASCII','Big5')
+ ec.destination_encoding.should == Encoding::BIG5
+
+ ec = Encoding::Converter.new('SJIS','EUC-JP')
+ ec.destination_encoding.should == Encoding::EUC_JP
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/finish_spec.rb b/spec/ruby/core/encoding/converter/finish_spec.rb
new file mode 100644
index 0000000000..e13b7415f8
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/finish_spec.rb
@@ -0,0 +1,36 @@
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter#finish" do
+ before :each do
+ @ec = Encoding::Converter.new("utf-8", "iso-2022-jp")
+ end
+
+ it "returns a String" do
+ @ec.convert('foo')
+ @ec.finish.should.instance_of?(String)
+ end
+
+ it "returns an empty String if there is nothing more to convert" do
+ @ec.convert("glark")
+ @ec.finish.should == ""
+ end
+
+ it "returns the last part of the converted String if it hasn't already" do
+ @ec.convert("\u{9999}").should == "\e$B9a".dup.force_encoding('iso-2022-jp')
+ @ec.finish.should == "\e(B".dup.force_encoding('iso-2022-jp')
+ end
+
+ it "returns a String in the destination encoding" do
+ @ec.convert("glark")
+ @ec.finish.encoding.should == Encoding::ISO2022_JP
+ end
+
+ it "returns an empty String if self was not given anything to convert" do
+ @ec.finish.should == ""
+ end
+
+ it "returns an empty String on subsequent invocations" do
+ @ec.finish.should == ""
+ @ec.finish.should == ""
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/insert_output_spec.rb b/spec/ruby/core/encoding/converter/insert_output_spec.rb
new file mode 100644
index 0000000000..1346adde1e
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/insert_output_spec.rb
@@ -0,0 +1,5 @@
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter#insert_output" do
+ it "needs to be reviewed for spec completeness"
+end
diff --git a/spec/ruby/core/encoding/converter/inspect_spec.rb b/spec/ruby/core/encoding/converter/inspect_spec.rb
new file mode 100644
index 0000000000..3170ee451f
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/inspect_spec.rb
@@ -0,0 +1,13 @@
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter#inspect" do
+ it "includes the source and destination encodings in the return value" do
+ source = Encoding::UTF_8
+ destination = Encoding::UTF_16LE
+
+ output = "#<Encoding::Converter: #{source.name} to #{destination.name}>"
+
+ x = Encoding::Converter.new(source, destination)
+ x.inspect.should == output
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/last_error_spec.rb b/spec/ruby/core/encoding/converter/last_error_spec.rb
new file mode 100644
index 0000000000..3984a628f5
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/last_error_spec.rb
@@ -0,0 +1,91 @@
+# encoding: binary
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter#last_error" do
+ it "returns nil when the no conversion has been attempted" do
+ ec = Encoding::Converter.new('ascii','utf-8')
+ ec.last_error.should == nil
+ end
+
+ it "returns nil when the last conversion did not produce an error" do
+ ec = Encoding::Converter.new('ascii','utf-8')
+ ec.convert('a'.dup.force_encoding('ascii'))
+ ec.last_error.should == nil
+ end
+
+ it "returns nil when #primitive_convert last returned :destination_buffer_full" do
+ ec = Encoding::Converter.new("utf-8", "iso-2022-jp")
+ ec.primitive_convert(+"\u{9999}", +"", 0, 0, partial_input: false) \
+ .should == :destination_buffer_full
+ ec.last_error.should == nil
+ end
+
+ it "returns nil when #primitive_convert last returned :finished" do
+ ec = Encoding::Converter.new("utf-8", "iso-8859-1")
+ ec.primitive_convert("glark".dup.force_encoding('utf-8'), +"").should == :finished
+ ec.last_error.should == nil
+ end
+
+ it "returns nil if the last conversion succeeded but the penultimate failed" do
+ ec = Encoding::Converter.new("utf-8", "iso-8859-1")
+ ec.primitive_convert(+"\xf1abcd", +"").should == :invalid_byte_sequence
+ ec.primitive_convert("glark".dup.force_encoding('utf-8'), +"").should == :finished
+ ec.last_error.should == nil
+ end
+
+ it "returns an Encoding::InvalidByteSequenceError when #primitive_convert last returned :invalid_byte_sequence" do
+ ec = Encoding::Converter.new("utf-8", "iso-8859-1")
+ ec.primitive_convert(+"\xf1abcd", +"").should == :invalid_byte_sequence
+ ec.last_error.should.instance_of?(Encoding::InvalidByteSequenceError)
+ end
+
+ it "returns an Encoding::UndefinedConversionError when #primitive_convert last returned :undefined_conversion" do
+ ec = Encoding::Converter.new("utf-8", "iso-8859-1")
+ ec.primitive_convert(+"\u{9876}", +"").should == :undefined_conversion
+ ec.last_error.should.instance_of?(Encoding::UndefinedConversionError)
+ end
+
+ it "returns an Encoding::InvalidByteSequenceError when #primitive_convert last returned :incomplete_input" do
+ ec = Encoding::Converter.new("EUC-JP", "ISO-8859-1")
+ ec.primitive_convert(+"\xa4", +"", nil, 10).should == :incomplete_input
+ ec.last_error.should.instance_of?(Encoding::InvalidByteSequenceError)
+ end
+
+ it "returns an Encoding::InvalidByteSequenceError when the last call to #convert produced one" do
+ ec = Encoding::Converter.new("utf-8", "iso-8859-1")
+ exception = nil
+ -> {
+ ec.convert("\xf1abcd")
+ }.should.raise(Encoding::InvalidByteSequenceError) { |e|
+ exception = e
+ }
+ ec.last_error.should.instance_of?(Encoding::InvalidByteSequenceError)
+ ec.last_error.message.should == exception.message
+ end
+
+ it "returns an Encoding::UndefinedConversionError when the last call to #convert produced one" do
+ ec = Encoding::Converter.new("utf-8", "iso-8859-1")
+ exception = nil
+ -> {
+ ec.convert("\u{9899}")
+ }.should.raise(Encoding::UndefinedConversionError) { |e|
+ exception = e
+ }
+ ec.last_error.should.instance_of?(Encoding::UndefinedConversionError)
+ ec.last_error.message.should == exception.message
+ ec.last_error.message.should.include? "from UTF-8 to ISO-8859-1"
+ end
+
+ it "returns the last error of #convert with a message showing the transcoding path" do
+ ec = Encoding::Converter.new("iso-8859-1", "Big5")
+ exception = nil
+ -> {
+ ec.convert("\xE9") # é in ISO-8859-1
+ }.should.raise(Encoding::UndefinedConversionError) { |e|
+ exception = e
+ }
+ ec.last_error.should.instance_of?(Encoding::UndefinedConversionError)
+ ec.last_error.message.should == exception.message
+ ec.last_error.message.should.include? "from ISO-8859-1 to UTF-8 to Big5"
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/new_spec.rb b/spec/ruby/core/encoding/converter/new_spec.rb
new file mode 100644
index 0000000000..bbdfb48bce
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/new_spec.rb
@@ -0,0 +1,119 @@
+# encoding: binary
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter.new" do
+ it "accepts a String for the source encoding" do
+ conv = Encoding::Converter.new("us-ascii", "utf-8")
+ conv.source_encoding.should == Encoding::US_ASCII
+ end
+
+ it "accepts a String for the destination encoding" do
+ conv = Encoding::Converter.new("us-ascii", "utf-8")
+ conv.destination_encoding.should == Encoding::UTF_8
+ end
+
+ it "accepts an Encoding object for the source encoding" do
+ conv = Encoding::Converter.new(Encoding::US_ASCII, "utf-8")
+ conv.source_encoding.should == Encoding::US_ASCII
+ end
+
+ it "accepts an Encoding object for the destination encoding" do
+ conv = Encoding::Converter.new("us-ascii", Encoding::UTF_8)
+ conv.destination_encoding.should == Encoding::UTF_8
+ end
+
+ it "raises an Encoding::ConverterNotFoundError if both encodings are the same" do
+ -> do
+ Encoding::Converter.new "utf-8", "utf-8"
+ end.should.raise(Encoding::ConverterNotFoundError)
+ end
+
+ it "calls #to_str to convert the source encoding argument to an encoding name" do
+ enc = mock("us-ascii")
+ enc.should_receive(:to_str).and_return("us-ascii")
+ conv = Encoding::Converter.new(enc, "utf-8")
+ conv.source_encoding.should == Encoding::US_ASCII
+ end
+
+ it "calls #to_str to convert the destination encoding argument to an encoding name" do
+ enc = mock("utf-8")
+ enc.should_receive(:to_str).and_return("utf-8")
+ conv = Encoding::Converter.new("us-ascii", enc)
+ conv.destination_encoding.should == Encoding::UTF_8
+ end
+
+ it "sets replacement from the options Hash" do
+ conv = Encoding::Converter.new("us-ascii", "utf-8", replace: "fubar")
+ conv.replacement.should == "fubar"
+ end
+
+ it "calls #to_hash to convert the options argument to a Hash if not an Integer" do
+ opts = mock("encoding converter options")
+ opts.should_receive(:to_hash).and_return({ replace: "fubar" })
+ conv = Encoding::Converter.new("us-ascii", "utf-8", **opts)
+ conv.replacement.should == "fubar"
+ end
+
+ it "calls #to_str to convert the replacement object to a String" do
+ obj = mock("encoding converter replacement")
+ obj.should_receive(:to_str).and_return("fubar")
+ conv = Encoding::Converter.new("us-ascii", "utf-8", replace: obj)
+ conv.replacement.should == "fubar"
+ end
+
+ it "raises a TypeError if #to_str does not return a String" do
+ obj = mock("encoding converter replacement")
+ obj.should_receive(:to_str).and_return(1)
+
+ -> do
+ Encoding::Converter.new("us-ascii", "utf-8", replace: obj)
+ end.should.raise(TypeError)
+ end
+
+ it "raises a TypeError if passed true for the replacement object" do
+ -> do
+ Encoding::Converter.new("us-ascii", "utf-8", replace: true)
+ end.should.raise(TypeError)
+ end
+
+ it "raises a TypeError if passed false for the replacement object" do
+ -> do
+ Encoding::Converter.new("us-ascii", "utf-8", replace: false)
+ end.should.raise(TypeError)
+ end
+
+ it "raises a TypeError if passed an Integer for the replacement object" do
+ -> do
+ Encoding::Converter.new("us-ascii", "utf-8", replace: 1)
+ end.should.raise(TypeError)
+ end
+
+ it "accepts an empty String for the replacement object" do
+ conv = Encoding::Converter.new("us-ascii", "utf-8", replace: "")
+ conv.replacement.should == ""
+ end
+
+ describe "when passed nil for the replacement object" do
+ describe "when the destination encoding is not UTF-8" do
+ it "sets the replacement String to '?'" do
+ conv = Encoding::Converter.new("us-ascii", "binary", replace: nil)
+ conv.replacement.should == "?"
+ end
+
+ it "sets the replacement String encoding to US-ASCII" do
+ conv = Encoding::Converter.new("us-ascii", "binary", replace: nil)
+ conv.replacement.encoding.should == Encoding::US_ASCII
+ end
+
+ it "sets the replacement String to '\\uFFFD'" do
+ conv = Encoding::Converter.new("us-ascii", "utf-8", replace: nil)
+ conv.replacement.should == "\u{fffd}".dup.force_encoding("utf-8")
+ end
+
+ it "sets the replacement String encoding to UTF-8" do
+ conv = Encoding::Converter.new("us-ascii", "utf-8", replace: nil)
+ conv.replacement.encoding.should == Encoding::UTF_8
+ end
+ end
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/primitive_convert_spec.rb b/spec/ruby/core/encoding/converter/primitive_convert_spec.rb
new file mode 100644
index 0000000000..ab9ce6a992
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/primitive_convert_spec.rb
@@ -0,0 +1,216 @@
+# encoding: binary
+# frozen_string_literal: false
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter#primitive_convert" do
+ before :each do
+ @ec = Encoding::Converter.new("utf-8", "iso-8859-1")
+ end
+
+ it "accepts a nil source buffer" do
+ -> { @ec.primitive_convert(nil,"") }.should_not.raise
+ end
+
+ it "accepts a String as the source buffer" do
+ -> { @ec.primitive_convert("","") }.should_not.raise
+ end
+
+ it "raises FrozenError when the destination buffer is a frozen String" do
+ -> { @ec.primitive_convert("", "".freeze) }.should.raise(FrozenError)
+ end
+
+ it "accepts nil for the destination byte offset" do
+ -> { @ec.primitive_convert("","", nil) }.should_not.raise
+ end
+
+ it "accepts an integer for the destination byte offset" do
+ -> { @ec.primitive_convert("","a", 1) }.should_not.raise
+ end
+
+ it "calls #to_int to convert the destination byte offset" do
+ offset = mock("encoding primitive_convert destination byte offset")
+ offset.should_receive(:to_int).and_return(2)
+ @ec.primitive_convert("abc", result = " ", offset).should == :finished
+ result.should == " abc"
+ end
+
+ it "raises an ArgumentError if the destination byte offset is greater than the bytesize of the destination buffer" do
+ -> { @ec.primitive_convert("","am", 0) }.should_not.raise
+ -> { @ec.primitive_convert("","am", 1) }.should_not.raise
+ -> { @ec.primitive_convert("","am", 2) }.should_not.raise
+ -> { @ec.primitive_convert("","am", 3) }.should.raise(ArgumentError)
+ end
+
+ it "uses the destination byte offset to determine where to write the result in the destination buffer" do
+ dest = "aa"
+ @ec.primitive_convert("b",dest, nil, 0)
+ dest.should == "aa"
+
+ @ec.primitive_convert("b",dest, nil, 1)
+ dest.should == "aab"
+
+ @ec.primitive_convert("b",dest, nil, 2)
+ dest.should == "aabbb"
+ end
+
+ it "accepts nil for the destination bytesize" do
+ -> { @ec.primitive_convert("","", nil, nil) }.should_not.raise
+ end
+
+ it "accepts an integer for the destination bytesize" do
+ -> { @ec.primitive_convert("","", nil, 0) }.should_not.raise
+ end
+
+ it "allows a destination bytesize value greater than the bytesize of the source buffer" do
+ -> { @ec.primitive_convert("am","", nil, 3) }.should_not.raise
+ end
+
+ it "allows a destination bytesize value less than the bytesize of the source buffer" do
+ -> { @ec.primitive_convert("am","", nil, 1) }.should_not.raise
+ end
+
+ it "calls #to_int to convert the destination byte size" do
+ size = mock("encoding primitive_convert destination byte size")
+ size.should_receive(:to_int).and_return(2)
+ @ec.primitive_convert("abc", result = " ", 0, size).should == :destination_buffer_full
+ result.should == "ab"
+ end
+
+ it "uses destination bytesize as the maximum bytesize of the destination buffer" do
+ dest = ""
+ @ec.primitive_convert("glark", dest, nil, 1)
+ dest.bytesize.should == 1
+ end
+
+ it "allows a destination buffer of unlimited size if destination bytesize is nil" do
+ source = "glark".force_encoding('utf-8')
+ dest = ""
+ @ec.primitive_convert("glark", dest, nil, nil)
+ dest.bytesize.should == source.bytesize
+ end
+
+ it "accepts an options hash" do
+ @ec.primitive_convert("","",nil,nil, after_output: true).should == :finished
+ end
+
+ it "sets the destination buffer's encoding to the destination encoding if the conversion succeeded" do
+ dest = "".force_encoding('utf-8')
+ dest.encoding.should == Encoding::UTF_8
+ @ec.primitive_convert("\u{98}",dest).should == :finished
+ dest.encoding.should == Encoding::ISO_8859_1
+ end
+
+ it "sets the destination buffer's encoding to the destination encoding if the conversion failed" do
+ dest = "".force_encoding('utf-8')
+ dest.encoding.should == Encoding::UTF_8
+ @ec.primitive_convert("\u{9878}",dest).should == :undefined_conversion
+ dest.encoding.should == Encoding::ISO_8859_1
+ end
+
+ it "removes the undefined part from the source buffer when returning :undefined_conversion" do
+ dest = "".force_encoding('utf-8')
+ s = "\u{9878}abcd"
+ @ec.primitive_convert(s, dest).should == :undefined_conversion
+
+ s.should == "abcd"
+ end
+
+ it "returns :incomplete_input when source buffer ends unexpectedly and :partial_input isn't specified" do
+ ec = Encoding::Converter.new("EUC-JP", "ISO-8859-1")
+ ec.primitive_convert("\xa4", "", nil, nil, partial_input: false).should == :incomplete_input
+ end
+
+ it "clears the source buffer when returning :incomplete_input" do
+ ec = Encoding::Converter.new("EUC-JP", "ISO-8859-1")
+ s = "\xa4"
+ ec.primitive_convert(s, "").should == :incomplete_input
+
+ s.should == ""
+ end
+
+ it "returns :source_buffer_empty when source buffer ends unexpectedly and :partial_input is true" do
+ ec = Encoding::Converter.new("EUC-JP", "ISO-8859-1")
+ ec.primitive_convert("\xa4", "", nil, nil, partial_input: true).should == :source_buffer_empty
+ end
+
+ it "clears the source buffer when returning :source_buffer_empty" do
+ ec = Encoding::Converter.new("EUC-JP", "ISO-8859-1")
+ s = "\xa4"
+ ec.primitive_convert(s, "", nil, nil, partial_input: true).should == :source_buffer_empty
+
+ s.should == ""
+ end
+
+ it "returns :undefined_conversion when a character in the source buffer is not representable in the output encoding" do
+ @ec.primitive_convert("\u{9876}","").should == :undefined_conversion
+ end
+
+ it "returns :invalid_byte_sequence when an invalid byte sequence was found in the source buffer" do
+ @ec.primitive_convert("\xf1abcd","").should == :invalid_byte_sequence
+ end
+
+ it "removes consumed and erroneous bytes from the source buffer when returning :invalid_byte_sequence" do
+ ec = Encoding::Converter.new(Encoding::UTF_8, Encoding::UTF_8_MAC)
+ s = "\xC3\xA1\x80\x80\xC3\xA1".force_encoding("utf-8")
+ dest = "".force_encoding("utf-8")
+ ec.primitive_convert(s, dest)
+
+ s.should == "\x80\xC3\xA1".force_encoding("utf-8")
+ end
+
+ it "returns :finished when the conversion succeeded" do
+ @ec.primitive_convert("glark".force_encoding('utf-8'),"").should == :finished
+ end
+
+ it "clears the source buffer when returning :finished" do
+ s = "glark".force_encoding('utf-8')
+ @ec.primitive_convert(s, "").should == :finished
+
+ s.should == ""
+ end
+
+ it "returns :destination_buffer_full when the destination buffer is too small" do
+ ec = Encoding::Converter.new("utf-8", "iso-2022-jp")
+ source = "\u{9999}"
+ destination_bytesize = source.bytesize - 1
+ ec.primitive_convert(source, "", 0, destination_bytesize) \
+ .should == :destination_buffer_full
+ source.should == ""
+ end
+
+ it "clears the source buffer when returning :destination_buffer_full" do
+ ec = Encoding::Converter.new("utf-8", "iso-2022-jp")
+ s = "\u{9999}"
+ destination_bytesize = s.bytesize - 1
+ ec.primitive_convert(s, "", 0, destination_bytesize).should == :destination_buffer_full
+
+ s.should == ""
+ end
+
+ it "keeps removing invalid bytes from the source buffer" do
+ ec = Encoding::Converter.new(Encoding::UTF_8, Encoding::UTF_8_MAC)
+ s = "\x80\x80\x80"
+ dest = "".force_encoding(Encoding::UTF_8_MAC)
+
+ ec.primitive_convert(s, dest)
+ s.should == "\x80\x80"
+ ec.primitive_convert(s, dest)
+ s.should == "\x80"
+ ec.primitive_convert(s, dest)
+ s.should == ""
+ end
+
+ it "reuses read-again bytes after the first error" do
+ s = "\xf1abcd"
+ dest = ""
+
+ @ec.primitive_convert(s, dest).should == :invalid_byte_sequence
+ s.should == "bcd"
+ @ec.primitive_errinfo[4].should == "a"
+
+ @ec.primitive_convert(s, dest).should == :finished
+ s.should == ""
+
+ dest.should == "abcd"
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/primitive_errinfo_spec.rb b/spec/ruby/core/encoding/converter/primitive_errinfo_spec.rb
new file mode 100644
index 0000000000..580e2e37e1
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/primitive_errinfo_spec.rb
@@ -0,0 +1,69 @@
+# encoding: binary
+# frozen_string_literal: false
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter#primitive_errinfo" do
+ it "returns [:source_buffer_empty,nil,nil,nil,nil] when no conversion has been attempted" do
+ ec = Encoding::Converter.new('ascii','utf-8')
+ ec.primitive_errinfo.should == [:source_buffer_empty, nil, nil, nil, nil]
+ end
+
+ it "returns [:finished,nil,nil,nil,nil] when #primitive_convert last returned :finished" do
+ ec = Encoding::Converter.new('ascii','utf-8')
+ ec.primitive_convert("a","").should == :finished
+ ec.primitive_errinfo.should == [:finished, nil, nil, nil, nil]
+ end
+
+ it "returns [:source_buffer_empty,nil,nil,nil, nil] when #convert last succeeded" do
+ ec = Encoding::Converter.new('ascii','utf-8')
+ ec.convert("a".force_encoding('ascii')).should == "a".force_encoding('utf-8')
+ ec.primitive_errinfo.should == [:source_buffer_empty, nil, nil, nil, nil]
+ end
+
+ it "returns [:destination_buffer_full,nil,nil,nil,nil] when #primitive_convert last returned :destination_buffer_full" do
+ ec = Encoding::Converter.new("utf-8", "iso-2022-jp")
+ ec.primitive_convert("\u{9999}", "", 0, 0, partial_input: false).should == :destination_buffer_full
+ ec.primitive_errinfo.should == [:destination_buffer_full, nil, nil, nil, nil]
+ end
+
+ it "returns the status of the last primitive conversion, even if it was successful and the previous one wasn't" do
+ ec = Encoding::Converter.new("utf-8", "iso-8859-1")
+ ec.primitive_convert("\xf1abcd","").should == :invalid_byte_sequence
+ ec.primitive_convert("glark".force_encoding('utf-8'),"").should == :finished
+ ec.primitive_errinfo.should == [:finished, nil, nil, nil, nil]
+ end
+
+ it "returns the state, source encoding, target encoding, and the erroneous bytes when #primitive_convert last returned :undefined_conversion" do
+ ec = Encoding::Converter.new("utf-8", "iso-8859-1")
+ ec.primitive_convert("\u{9876}","").should == :undefined_conversion
+ ec.primitive_errinfo.should ==
+ [:undefined_conversion, "UTF-8", "ISO-8859-1", "\xE9\xA1\xB6", ""]
+ end
+
+ it "returns the state, source encoding, target encoding, and erroneous bytes when #primitive_convert last returned :incomplete_input" do
+ ec = Encoding::Converter.new("EUC-JP", "ISO-8859-1")
+ ec.primitive_convert("\xa4", "", nil, 10).should == :incomplete_input
+ ec.primitive_errinfo.should == [:incomplete_input, "EUC-JP", "UTF-8", "\xA4", ""]
+ end
+
+ it "returns the state, source encoding, target encoding, erroneous bytes, and the read-again bytes when #primitive_convert last returned :invalid_byte_sequence" do
+ ec = Encoding::Converter.new("utf-8", "iso-8859-1")
+ ec.primitive_convert("\xf1abcd","").should == :invalid_byte_sequence
+ ec.primitive_errinfo.should ==
+ [:invalid_byte_sequence, "UTF-8", "ISO-8859-1", "\xF1", "a"]
+ end
+
+ it "returns the state, source encoding, target encoding, erroneous bytes, and the read-again bytes when #convert last raised InvalidByteSequenceError" do
+ ec = Encoding::Converter.new("utf-8", "iso-8859-1")
+ -> { ec.convert("\xf1abcd") }.should.raise(Encoding::InvalidByteSequenceError)
+ ec.primitive_errinfo.should ==
+ [:invalid_byte_sequence, "UTF-8", "ISO-8859-1", "\xF1", "a"]
+ end
+
+ it "returns the state, source encoding, target encoding, erroneous bytes, and the read-again bytes when #finish last raised InvalidByteSequenceError" do
+ ec = Encoding::Converter.new("EUC-JP", "ISO-8859-1")
+ ec.convert("\xa4")
+ -> { ec.finish }.should.raise(Encoding::InvalidByteSequenceError)
+ ec.primitive_errinfo.should == [:incomplete_input, "EUC-JP", "UTF-8", "\xA4", ""]
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/putback_spec.rb b/spec/ruby/core/encoding/converter/putback_spec.rb
new file mode 100644
index 0000000000..a85cec5145
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/putback_spec.rb
@@ -0,0 +1,56 @@
+# encoding: binary
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter#putback" do
+ before :each do
+ @ec = Encoding::Converter.new("EUC-JP", "ISO-8859-1")
+ @ret = @ec.primitive_convert(@src=+"abc\xa1def", @dst=+"", nil, 10)
+ end
+
+ it "returns a String" do
+ @ec.putback.should.instance_of?(String)
+ end
+
+ it "returns a String in the source encoding" do
+ @ec.putback.encoding.should == Encoding::EUC_JP
+ end
+
+ it "returns the bytes buffered due to an :invalid_byte_sequence error" do
+ @ret.should == :invalid_byte_sequence
+ @ec.putback.should == 'd'
+ @ec.primitive_errinfo.last.should == 'd'
+ end
+
+ it "allows conversion to be resumed after an :invalid_byte_sequence" do
+ @src = @ec.putback + @src
+ @ret = @ec.primitive_convert(@src, @dst, nil, 10)
+ @ret.should == :finished
+ @dst.should == "abcdef"
+ @src.should == ""
+ end
+
+ it "returns an empty String when there are no more bytes to put back" do
+ @ec.putback
+ @ec.putback.should == ""
+ end
+
+ it "returns the problematic bytes for UTF-16LE" do
+ ec = Encoding::Converter.new("utf-16le", "iso-8859-1")
+ src = +"\x00\xd8\x61\x00"
+ dst = +""
+ ec.primitive_convert(src, dst).should == :invalid_byte_sequence
+ ec.primitive_errinfo.should == [:invalid_byte_sequence, "UTF-16LE", "UTF-8", "\x00\xD8", "a\x00"]
+ ec.putback.should == "a\x00".dup.force_encoding("utf-16le")
+ ec.putback.should == ""
+ end
+
+ it "accepts an integer argument corresponding to the number of bytes to be put back" do
+ ec = Encoding::Converter.new("utf-16le", "iso-8859-1")
+ src = +"\x00\xd8\x61\x00"
+ dst = +""
+ ec.primitive_convert(src, dst).should == :invalid_byte_sequence
+ ec.primitive_errinfo.should == [:invalid_byte_sequence, "UTF-16LE", "UTF-8", "\x00\xD8", "a\x00"]
+ ec.putback(2).should == "a\x00".dup.force_encoding("utf-16le")
+ ec.putback.should == ""
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/replacement_spec.rb b/spec/ruby/core/encoding/converter/replacement_spec.rb
new file mode 100644
index 0000000000..c25ec36517
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/replacement_spec.rb
@@ -0,0 +1,70 @@
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter#replacement" do
+ it "returns '?' in US-ASCII when the destination encoding is not UTF-8" do
+ ec = Encoding::Converter.new("utf-8", "us-ascii")
+ ec.replacement.should == "?"
+ ec.replacement.encoding.should == Encoding::US_ASCII
+
+ ec = Encoding::Converter.new("utf-8", "sjis")
+ ec.replacement.should == "?"
+ ec.replacement.encoding.should == Encoding::US_ASCII
+ end
+
+ it "returns \\uFFFD when the destination encoding is UTF-8" do
+ ec = Encoding::Converter.new("us-ascii", "utf-8")
+ ec.replacement.should == "\u{fffd}".dup.force_encoding('utf-8')
+ ec.replacement.encoding.should == Encoding::UTF_8
+ end
+end
+
+describe "Encoding::Converter#replacement=" do
+ it "accepts a String argument" do
+ ec = Encoding::Converter.new("utf-8", "us-ascii")
+ ec.replacement = "!"
+ ec.replacement.should == "!"
+ end
+
+ it "accepts a String argument of arbitrary length" do
+ ec = Encoding::Converter.new("utf-8", "us-ascii")
+ ec.replacement = "?!?" * 9999
+ ec.replacement.should == "?!?" * 9999
+ end
+
+ it "raises a TypeError if assigned a non-String argument" do
+ ec = Encoding::Converter.new("utf-8", "us-ascii")
+ -> { ec.replacement = nil }.should.raise(TypeError)
+ end
+
+ it "sets #replacement" do
+ ec = Encoding::Converter.new("us-ascii", "utf-8")
+ ec.replacement.should == "\u{fffd}".dup.force_encoding('utf-8')
+ ec.replacement = '?'.encode('utf-8')
+ ec.replacement.should == '?'.dup.force_encoding('utf-8')
+ end
+
+ it "raises an UndefinedConversionError is the argument cannot be converted into the destination encoding" do
+ ec = Encoding::Converter.new("sjis", "ascii")
+ utf8_q = "\u{986}".dup.force_encoding('utf-8')
+ ec.primitive_convert(utf8_q.dup, +"").should == :undefined_conversion
+ -> { ec.replacement = utf8_q }.should.raise(Encoding::UndefinedConversionError)
+ end
+
+ it "does not change the replacement character if the argument cannot be converted into the destination encoding" do
+ ec = Encoding::Converter.new("sjis", "ascii")
+ utf8_q = "\u{986}".dup.force_encoding('utf-8')
+ ec.primitive_convert(utf8_q.dup, +"").should == :undefined_conversion
+ -> { ec.replacement = utf8_q }.should.raise(Encoding::UndefinedConversionError)
+ ec.replacement.should == "?".dup.force_encoding('us-ascii')
+ end
+
+ it "uses the replacement character" do
+ ec = Encoding::Converter.new("utf-8", "us-ascii", :invalid => :replace, :undef => :replace)
+ ec.replacement = "!"
+ dest = +""
+ status = ec.primitive_convert(+"中文123", dest)
+
+ status.should == :finished
+ dest.should == "!!123"
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/search_convpath_spec.rb b/spec/ruby/core/encoding/converter/search_convpath_spec.rb
new file mode 100644
index 0000000000..cac44765f8
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/search_convpath_spec.rb
@@ -0,0 +1,30 @@
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter.search_convpath" do
+ it "returns an Array with a single element if there is a direct converter" do
+ cp = Encoding::Converter.search_convpath('ASCII', 'UTF-8')
+ cp.should == [[Encoding::US_ASCII, Encoding::UTF_8]]
+ end
+
+ it "returns multiple encoding pairs when direct conversion is impossible" do
+ cp = Encoding::Converter.search_convpath('ascii','Big5')
+ cp.should == [
+ [Encoding::US_ASCII, Encoding::UTF_8],
+ [Encoding::UTF_8, Encoding::Big5]
+ ]
+ end
+
+ it "indicates if crlf_newline conversion would occur" do
+ cp = Encoding::Converter.search_convpath("ISO-8859-1", "EUC-JP", crlf_newline: true)
+ cp.last.should == "crlf_newline"
+
+ cp = Encoding::Converter.search_convpath("ASCII", "UTF-8", crlf_newline: false)
+ cp.last.should_not == "crlf_newline"
+ end
+
+ it "raises an Encoding::ConverterNotFoundError if no conversion path exists" do
+ -> do
+ Encoding::Converter.search_convpath(Encoding::BINARY, Encoding::Emacs_Mule)
+ end.should.raise(Encoding::ConverterNotFoundError)
+ end
+end
diff --git a/spec/ruby/core/encoding/converter/source_encoding_spec.rb b/spec/ruby/core/encoding/converter/source_encoding_spec.rb
new file mode 100644
index 0000000000..6196f717bd
--- /dev/null
+++ b/spec/ruby/core/encoding/converter/source_encoding_spec.rb
@@ -0,0 +1,11 @@
+require_relative '../../../spec_helper'
+
+describe "Encoding::Converter#source_encoding" do
+ it "returns the source encoding as an Encoding object" do
+ ec = Encoding::Converter.new('ASCII','Big5')
+ ec.source_encoding.should == Encoding::US_ASCII
+
+ ec = Encoding::Converter.new('Shift_JIS','EUC-JP')
+ ec.source_encoding.should == Encoding::SHIFT_JIS
+ end
+end
diff --git a/spec/ruby/core/encoding/default_external_spec.rb b/spec/ruby/core/encoding/default_external_spec.rb
new file mode 100644
index 0000000000..2a2bd7f6ae
--- /dev/null
+++ b/spec/ruby/core/encoding/default_external_spec.rb
@@ -0,0 +1,69 @@
+require_relative '../../spec_helper'
+
+describe "Encoding.default_external" do
+ before :each do
+ @original_encoding = Encoding.default_external
+ end
+
+ after :each do
+ Encoding.default_external = @original_encoding
+ end
+
+ it "returns an Encoding object" do
+ Encoding.default_external.should.instance_of?(Encoding)
+ end
+
+ it "returns the default external encoding" do
+ Encoding.default_external = Encoding::SHIFT_JIS
+ Encoding.default_external.should == Encoding::SHIFT_JIS
+ end
+
+ platform_is :windows do
+ it 'is UTF-8 by default on Windows' do
+ Encoding.default_external.should == Encoding::UTF_8
+ end
+ end
+end
+
+describe "Encoding.default_external=" do
+ before :each do
+ @original_encoding = Encoding.default_external
+ end
+
+ after :each do
+ Encoding.default_external = @original_encoding
+ end
+
+ it "sets the default external encoding" do
+ Encoding.default_external = Encoding::SHIFT_JIS
+ Encoding.default_external.should == Encoding::SHIFT_JIS
+ Encoding.find('external').should == Encoding::SHIFT_JIS
+ end
+
+ platform_is_not :windows do
+ it "also sets the filesystem encoding" do
+ Encoding.default_external = Encoding::SHIFT_JIS
+ Encoding.find('filesystem').should == Encoding::SHIFT_JIS
+ end
+ end
+
+ it "can accept a name of an encoding as a String" do
+ Encoding.default_external = 'Shift_JIS'
+ Encoding.default_external.should == Encoding::SHIFT_JIS
+ end
+
+ it "calls #to_s on arguments that are neither Strings nor Encodings" do
+ string = mock('string')
+ string.should_receive(:to_str).at_least(1).and_return('US-ASCII')
+ Encoding.default_external = string
+ Encoding.default_external.should == Encoding::ASCII
+ end
+
+ it "raises a TypeError unless the argument is an Encoding or convertible to a String" do
+ -> { Encoding.default_external = [] }.should.raise(TypeError)
+ end
+
+ it "raises an ArgumentError if the argument is nil" do
+ -> { Encoding.default_external = nil }.should.raise(ArgumentError)
+ end
+end
diff --git a/spec/ruby/core/encoding/default_internal_spec.rb b/spec/ruby/core/encoding/default_internal_spec.rb
new file mode 100644
index 0000000000..38aef9dce9
--- /dev/null
+++ b/spec/ruby/core/encoding/default_internal_spec.rb
@@ -0,0 +1,74 @@
+require_relative '../../spec_helper'
+
+describe "Encoding.default_internal" do
+ before :each do
+ @original_encoding = Encoding.default_internal
+ end
+
+ after :each do
+ Encoding.default_internal = @original_encoding
+ end
+
+ it "is nil by default" do
+ Encoding.default_internal.should == nil
+ end
+
+ it "returns an Encoding object if a default internal encoding is set" do
+ Encoding.default_internal = Encoding::ASCII
+ Encoding.default_internal.should.instance_of?(Encoding)
+ end
+
+ it "returns nil if no default internal encoding is set" do
+ Encoding.default_internal = nil
+ Encoding.default_internal.should == nil
+ end
+
+ it "returns the default internal encoding" do
+ Encoding.default_internal = Encoding::BINARY
+ Encoding.default_internal.should == Encoding::BINARY
+ end
+end
+
+describe "Encoding.default_internal=" do
+ before :each do
+ @original_encoding = Encoding.default_internal
+ end
+
+ after :each do
+ Encoding.default_internal = @original_encoding
+ end
+
+ it "sets the default internal encoding" do
+ Encoding.default_internal = Encoding::SHIFT_JIS
+ Encoding.default_internal.should == Encoding::SHIFT_JIS
+ end
+
+ it "can accept a name of an encoding as a String" do
+ Encoding.default_internal = 'Shift_JIS'
+ Encoding.default_internal.should == Encoding::SHIFT_JIS
+ end
+
+ it "calls #to_str to convert an object to a String" do
+ obj = mock('string')
+ obj.should_receive(:to_str).at_least(1).times.and_return('ascii')
+
+ Encoding.default_internal = obj
+ Encoding.default_internal.should == Encoding::ASCII
+ end
+
+ it "raises a TypeError if #to_str does not return a String" do
+ obj = mock('string')
+ obj.should_receive(:to_str).at_least(1).times.and_return(1)
+
+ -> { Encoding.default_internal = obj }.should.raise(TypeError)
+ end
+
+ it "raises a TypeError when passed an object not providing #to_str" do
+ -> { Encoding.default_internal = mock("encoding") }.should.raise(TypeError)
+ end
+
+ it "accepts an argument of nil to unset the default internal encoding" do
+ Encoding.default_internal = nil
+ Encoding.default_internal.should == nil
+ end
+end
diff --git a/spec/ruby/core/encoding/dummy_spec.rb b/spec/ruby/core/encoding/dummy_spec.rb
new file mode 100644
index 0000000000..05530a8186
--- /dev/null
+++ b/spec/ruby/core/encoding/dummy_spec.rb
@@ -0,0 +1,25 @@
+require_relative '../../spec_helper'
+
+describe "Encoding#dummy?" do
+ it "returns false for proper encodings" do
+ Encoding::UTF_8.dummy?.should == false
+ Encoding::ASCII.dummy?.should == false
+ end
+
+ it "returns true for dummy encodings" do
+ Encoding::ISO_2022_JP.dummy?.should == true
+ Encoding::CP50221.dummy?.should == true
+ Encoding::UTF_7.dummy?.should == true
+ end
+
+ it "returns true for UTF_16 and UTF_32" do
+ Encoding::UTF_16.should.dummy?
+ Encoding::UTF_32.should.dummy?
+ end
+
+ it "implies not #ascii_compatible?" do
+ Encoding.list.select(&:dummy?).each do |encoding|
+ encoding.should_not.ascii_compatible?
+ end
+ end
+end
diff --git a/spec/ruby/core/encoding/find_spec.rb b/spec/ruby/core/encoding/find_spec.rb
new file mode 100644
index 0000000000..c5356560eb
--- /dev/null
+++ b/spec/ruby/core/encoding/find_spec.rb
@@ -0,0 +1,82 @@
+require_relative '../../spec_helper'
+
+describe "Encoding.find" do
+ before :all do
+ @encodings = Encoding.aliases.to_a.flatten.uniq
+ end
+
+ it "returns the corresponding Encoding object if given a valid encoding name" do
+ @encodings.each do |enc|
+ Encoding.find(enc).should.instance_of?(Encoding)
+ end
+ end
+
+ it "returns the corresponding Encoding object if given a valid alias name" do
+ Encoding.aliases.keys.each do |enc_alias|
+ Encoding.find(enc_alias).should.instance_of?(Encoding)
+ end
+ end
+
+ it "raises a TypeError if passed a Symbol" do
+ -> { Encoding.find(:"utf-8") }.should.raise(TypeError)
+ end
+
+ it "returns the passed Encoding object" do
+ Encoding.find(Encoding::UTF_8).should == Encoding::UTF_8
+ end
+
+ it "accepts encoding names as Strings" do
+ Encoding.list.each do |enc|
+ Encoding.find(enc.name).should == enc
+ end
+ end
+
+ it "accepts any object as encoding name, if it responds to #to_str" do
+ obj = Class.new do
+ attr_writer :encoding_name
+ def to_str; @encoding_name; end
+ end.new
+
+ Encoding.list.each do |enc|
+ obj.encoding_name = enc.name
+ Encoding.find(obj).should == enc
+ end
+ end
+
+ it "is case insensitive" do
+ @encodings.each do |enc|
+ Encoding.find(enc.upcase).should == Encoding.find(enc)
+ end
+ end
+
+ it "raises an ArgumentError if the given encoding does not exist" do
+ -> { Encoding.find('dh2dh278d') }.should.raise(ArgumentError, 'unknown encoding name - dh2dh278d')
+ end
+
+ # Not sure how to do a better test, since locale depends on weird platform-specific stuff
+ it "supports the 'locale' encoding alias" do
+ enc = Encoding.find('locale')
+ enc.should_not == nil
+ end
+
+ it "returns default external encoding for the 'external' encoding alias" do
+ enc = Encoding.find('external')
+ enc.should == Encoding.default_external
+ end
+
+ it "returns default internal encoding for the 'internal' encoding alias" do
+ enc = Encoding.find('internal')
+ enc.should == Encoding.default_internal
+ end
+
+ platform_is_not :windows do
+ it "uses default external encoding for the 'filesystem' encoding alias" do
+ enc = Encoding.find('filesystem')
+ enc.should == Encoding.default_external
+ end
+ end
+
+ platform_is :windows do
+ it "needs to be reviewed for spec completeness"
+ end
+end
diff --git a/spec/ruby/core/encoding/fixtures/classes.rb b/spec/ruby/core/encoding/fixtures/classes.rb
new file mode 100644
index 0000000000..943865e8d8
--- /dev/null
+++ b/spec/ruby/core/encoding/fixtures/classes.rb
@@ -0,0 +1,49 @@
+# encoding: binary
+module EncodingSpecs
+ class UndefinedConversionError
+ def self.exception
+ ec = Encoding::Converter.new('utf-8','ascii')
+ begin
+ ec.convert("\u{8765}")
+ rescue Encoding::UndefinedConversionError => e
+ e
+ end
+ end
+ end
+
+ class UndefinedConversionErrorIndirect
+ def self.exception
+ ec = Encoding::Converter.new("ISO-8859-1", "EUC-JP")
+ begin
+ ec.convert("\xA0")
+ rescue Encoding::UndefinedConversionError => e
+ e
+ end
+ end
+ end
+
+ class InvalidByteSequenceError
+ def self.exception
+ ec = Encoding::Converter.new("utf-8", "iso-8859-1")
+ begin
+ ec.convert("\xf1abcd")
+ rescue Encoding::InvalidByteSequenceError => e
+ # Return the exception object and the primitive_errinfo Array
+ [e, ec.primitive_errinfo]
+ end
+ end
+ end
+
+ class InvalidByteSequenceErrorIndirect
+ def self.exception
+ ec = Encoding::Converter.new("EUC-JP", "ISO-8859-1")
+ begin
+ ec.convert("abc\xA1\xFFdef")
+ rescue Encoding::InvalidByteSequenceError => e
+ # Return the exception object and the discarded bytes reported by
+ # #primitive_errinfo
+ [e, ec.primitive_errinfo]
+ end
+ end
+ end
+end
diff --git a/spec/ruby/core/encoding/inspect_spec.rb b/spec/ruby/core/encoding/inspect_spec.rb
new file mode 100644
index 0000000000..ab7f8cf9fc
--- /dev/null
+++ b/spec/ruby/core/encoding/inspect_spec.rb
@@ -0,0 +1,33 @@
+require_relative '../../spec_helper'
+
+describe "Encoding#inspect" do
+ it "returns a String" do
+ Encoding::UTF_8.inspect.should.instance_of?(String)
+ end
+
+ ruby_version_is ""..."3.4" do
+ it "returns #<Encoding:name> for a non-dummy encoding named 'name'" do
+ Encoding.list.to_a.reject {|e| e.dummy? }.each do |enc|
+ enc.inspect.should =~ /#<Encoding:#{enc.name}>/
+ end
+ end
+ end
+
+ ruby_version_is "3.4" do
+ it "returns #<Encoding:name> for a non-dummy encoding named 'name'" do
+ Encoding.list.to_a.reject {|e| e.dummy? }.each do |enc|
+ if enc.name == "ASCII-8BIT"
+ enc.inspect.should == "#<Encoding:BINARY (ASCII-8BIT)>"
+ else
+ enc.inspect.should =~ /#<Encoding:#{enc.name}>/
+ end
+ end
+ end
+ end
+
+ it "returns #<Encoding:name (dummy)> for a dummy encoding named 'name'" do
+ Encoding.list.to_a.select {|e| e.dummy? }.each do |enc|
+ enc.inspect.should =~ /#<Encoding:#{enc.name} \(dummy\)>/
+ end
+ end
+end
diff --git a/spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_name_spec.rb b/spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_name_spec.rb
new file mode 100644
index 0000000000..7d3cc77c0b
--- /dev/null
+++ b/spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_name_spec.rb
@@ -0,0 +1,19 @@
+require_relative "../../../spec_helper"
+require_relative '../fixtures/classes'
+
+describe "Encoding::InvalidByteSequenceError#destination_encoding_name" do
+ before :each do
+ @exception, = EncodingSpecs::InvalidByteSequenceError.exception
+ @exception2, = EncodingSpecs::InvalidByteSequenceErrorIndirect.exception
+ end
+
+ it "returns a String" do
+ @exception.destination_encoding_name.should.instance_of?(String)
+ @exception2.destination_encoding_name.should.instance_of?(String)
+ end
+
+ it "is equal to the destination encoding name of the object that raised it" do
+ @exception.destination_encoding_name.should == "ISO-8859-1"
+ @exception2.destination_encoding_name.should == "UTF-8"
+ end
+end
diff --git a/spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_spec.rb b/spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_spec.rb
new file mode 100644
index 0000000000..264c409b1c
--- /dev/null
+++ b/spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_spec.rb
@@ -0,0 +1,19 @@
+require_relative "../../../spec_helper"
+require_relative '../fixtures/classes'
+
+describe "Encoding::InvalidByteSequenceError#destination_encoding" do
+ before :each do
+ @exception, = EncodingSpecs::InvalidByteSequenceError.exception
+ @exception2, = EncodingSpecs::InvalidByteSequenceErrorIndirect.exception
+ end
+
+ it "returns an Encoding object" do
+ @exception.destination_encoding.should.instance_of?(Encoding)
+ @exception2.destination_encoding.should.instance_of?(Encoding)
+ end
+
+ it "is equal to the destination encoding of the object that raised it" do
+ @exception.destination_encoding.should == Encoding::ISO_8859_1
+ @exception2.destination_encoding.should == Encoding::UTF_8
+ end
+end
diff --git a/spec/ruby/core/encoding/invalid_byte_sequence_error/error_bytes_spec.rb b/spec/ruby/core/encoding/invalid_byte_sequence_error/error_bytes_spec.rb
new file mode 100644
index 0000000000..40a9a35caf
--- /dev/null
+++ b/spec/ruby/core/encoding/invalid_byte_sequence_error/error_bytes_spec.rb
@@ -0,0 +1,31 @@
+# encoding: binary
+require_relative "../../../spec_helper"
+require_relative '../fixtures/classes'
+
+describe "Encoding::InvalidByteSequenceError#error_bytes" do
+ before :each do
+ @exception, @errinfo = EncodingSpecs::InvalidByteSequenceError.exception
+ @exception2, @errinfo2 = EncodingSpecs::InvalidByteSequenceErrorIndirect.exception
+ end
+
+ it "returns a String" do
+ @exception.error_bytes.should.instance_of?(String)
+ @exception2.error_bytes.should.instance_of?(String)
+ end
+
+ it "returns the bytes that caused the exception" do
+ @exception.error_bytes.size.should == 1
+ @exception.error_bytes.should == "\xF1"
+ @exception.error_bytes.should == @errinfo[-2]
+
+ @exception2.error_bytes.size.should == 1
+ @exception2.error_bytes.should == "\xA1"
+ @exception2.error_bytes.should == @errinfo2[-2]
+ end
+
+ it "uses BINARY as the encoding" do
+ @exception.error_bytes.encoding.should == Encoding::BINARY
+
+ @exception2.error_bytes.encoding.should == Encoding::BINARY
+ end
+end
diff --git a/spec/ruby/core/encoding/invalid_byte_sequence_error/incomplete_input_spec.rb b/spec/ruby/core/encoding/invalid_byte_sequence_error/incomplete_input_spec.rb
new file mode 100644
index 0000000000..143db7b6da
--- /dev/null
+++ b/spec/ruby/core/encoding/invalid_byte_sequence_error/incomplete_input_spec.rb
@@ -0,0 +1,28 @@
+# encoding: binary
+require_relative '../../../spec_helper'
+
+describe "Encoding::InvalidByteSequenceError#incomplete_input?" do
+ it "returns nil by default" do
+ Encoding::InvalidByteSequenceError.new.incomplete_input?.should == nil
+ end
+
+ it "returns true if #primitive_convert returned :incomplete_input for the same data" do
+ ec = Encoding::Converter.new("EUC-JP", "ISO-8859-1")
+ ec.primitive_convert(+"\xA1", +'').should == :incomplete_input
+ begin
+ ec.convert("\xA1")
+ rescue Encoding::InvalidByteSequenceError => e
+ e.incomplete_input?.should == true
+ end
+ end
+
+ it "returns false if #primitive_convert returned :invalid_byte_sequence for the same data" do
+ ec = Encoding::Converter.new("ascii", "utf-8")
+ ec.primitive_convert(+"\xfffffffff", +'').should == :invalid_byte_sequence
+ begin
+ ec.convert("\xfffffffff")
+ rescue Encoding::InvalidByteSequenceError => e
+ e.incomplete_input?.should == false
+ end
+ end
+end
diff --git a/spec/ruby/core/encoding/invalid_byte_sequence_error/readagain_bytes_spec.rb b/spec/ruby/core/encoding/invalid_byte_sequence_error/readagain_bytes_spec.rb
new file mode 100644
index 0000000000..e4fc81aac6
--- /dev/null
+++ b/spec/ruby/core/encoding/invalid_byte_sequence_error/readagain_bytes_spec.rb
@@ -0,0 +1,31 @@
+# encoding: binary
+require_relative "../../../spec_helper"
+require_relative '../fixtures/classes'
+
+describe "Encoding::InvalidByteSequenceError#readagain_bytes" do
+ before :each do
+ @exception, @errinfo = EncodingSpecs::InvalidByteSequenceError.exception
+ @exception2, @errinfo2 = EncodingSpecs::InvalidByteSequenceErrorIndirect.exception
+ end
+
+ it "returns a String" do
+ @exception.readagain_bytes.should.instance_of?(String)
+ @exception2.readagain_bytes.should.instance_of?(String)
+ end
+
+ it "returns the bytes to be read again" do
+ @exception.readagain_bytes.size.should == 1
+ @exception.readagain_bytes.should == "a".dup.force_encoding('binary')
+ @exception.readagain_bytes.should == @errinfo[-1]
+
+ @exception2.readagain_bytes.size.should == 1
+ @exception2.readagain_bytes.should == "\xFF".dup.force_encoding('binary')
+ @exception2.readagain_bytes.should == @errinfo2[-1]
+ end
+
+ it "uses BINARY as the encoding" do
+ @exception.readagain_bytes.encoding.should == Encoding::BINARY
+
+ @exception2.readagain_bytes.encoding.should == Encoding::BINARY
+ end
+end
diff --git a/spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_name_spec.rb b/spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_name_spec.rb
new file mode 100644
index 0000000000..b00e1ad4e8
--- /dev/null
+++ b/spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_name_spec.rb
@@ -0,0 +1,29 @@
+require_relative "../../../spec_helper"
+require_relative '../fixtures/classes'
+
+describe "Encoding::UndefinedConversionError#source_encoding_name" do
+ before :each do
+ @exception, = EncodingSpecs::UndefinedConversionError.exception
+ @exception2, = EncodingSpecs::UndefinedConversionErrorIndirect.exception
+ end
+
+ it "returns a String" do
+ @exception.source_encoding_name.should.instance_of?(String)
+ end
+
+ it "is equal to the source encoding name of the object that raised it" do
+ @exception.source_encoding_name.should == "UTF-8"
+ end
+
+ # The source encoding specified in the Encoding::Converter constructor may
+ # differ from the source encoding returned here. What seems to happen is
+ # that when transcoding along a path with multiple pairs of encodings, the
+ # last one encountered when the error occurred is returned. So in this
+ # case, the conversion path is ISO-8859-1 -> UTF-8 -> EUC-JP. The
+ # conversion from ISO-8859-1 -> UTF-8 succeeded, but the conversion from
+ # UTF-8 to EUC-JP failed. IOW, it failed when the source encoding was
+ # UTF-8, so UTF-8 is regarded as the source encoding.
+ it "is equal to the source encoding at the stage of the conversion path where the error occurred" do
+ @exception2.source_encoding_name.should == 'UTF-8'
+ end
+end
diff --git a/spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_spec.rb b/spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_spec.rb
new file mode 100644
index 0000000000..32ad25dbb5
--- /dev/null
+++ b/spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_spec.rb
@@ -0,0 +1,34 @@
+require_relative "../../../spec_helper"
+require_relative '../fixtures/classes'
+
+describe "Encoding::InvalidByteSequenceError#source_encoding" do
+ before :each do
+ @exception, = EncodingSpecs::InvalidByteSequenceError.exception
+ @exception2, = EncodingSpecs::InvalidByteSequenceErrorIndirect.exception
+ end
+
+ it "returns an Encoding object" do
+ @exception.source_encoding.should.instance_of?(Encoding)
+ @exception2.source_encoding.should.instance_of?(Encoding)
+ end
+
+ it "is equal to the source encoding of the object that raised it" do
+ @exception.source_encoding.should == Encoding::UTF_8
+ end
+
+ # The source encoding specified in the Encoding::Converter constructor may
+ # differ from the source encoding returned here. What seems to happen is
+ # that when transcoding along a path with multiple pairs of encodings, the
+ # last one encountered when the error occurred is returned. So in this
+ # case, the conversion path is EUC-JP -> UTF-8 -> ISO-8859-1. The
+ # conversions failed with the first pair of encodings (i.e. transcoding
+ # from EUC-JP to UTF-8, so UTF-8 is regarded as the source encoding; if
+ # the error had occurred when converting from UTF-8 to ISO-8859-1, UTF-8
+ # would have been the source encoding.
+
+ # FIXME: Derive example where the failure occurs at the UTF-8 ->
+ # ISO-8859-1 case so as to better illustrate the issue
+ it "is equal to the source encoding at the stage of the conversion path where the error occurred" do
+ @exception2.source_encoding.should == Encoding::EUC_JP
+ end
+end
diff --git a/spec/ruby/core/encoding/list_spec.rb b/spec/ruby/core/encoding/list_spec.rb
new file mode 100644
index 0000000000..9fe336c608
--- /dev/null
+++ b/spec/ruby/core/encoding/list_spec.rb
@@ -0,0 +1,49 @@
+require_relative '../../spec_helper'
+
+describe "Encoding.list" do
+ it "returns an Array" do
+ Encoding.list.should.instance_of?(Array)
+ end
+
+ it "returns an Array of Encoding objects" do
+ Encoding.list.each do |enc|
+ enc.should.instance_of?(Encoding)
+ end
+ end
+
+ it "returns each encoding only once" do
+ orig = Encoding.list.map { |e| e.name }
+ orig.should == orig.uniq
+ end
+
+ it "includes the default external encoding" do
+ Encoding.list.include?(Encoding.default_external).should == true
+ end
+
+ it "does not include any alias names" do
+ Encoding.aliases.keys.each do |enc_alias|
+ Encoding.list.include?(enc_alias).should == false
+ end
+ end
+
+ it "includes all aliased encodings" do
+ Encoding.aliases.values.each do |enc_alias|
+ Encoding.list.include?(Encoding.find(enc_alias)).should == true
+ end
+ end
+
+ it "includes dummy encodings" do
+ Encoding.list.select { |e| e.dummy? }.should_not == []
+ end
+
+ it 'includes UTF-8 encoding' do
+ Encoding.list.should.include?(Encoding::UTF_8)
+ end
+
+ it 'includes CESU-8 encoding' do
+ Encoding.list.should.include?(Encoding::CESU_8)
+ end
+
+ # TODO: Find example that illustrates this
+ it "updates the list when #find is used to load a new encoding"
+end
diff --git a/spec/ruby/core/encoding/locale_charmap_spec.rb b/spec/ruby/core/encoding/locale_charmap_spec.rb
new file mode 100644
index 0000000000..0d77bf227b
--- /dev/null
+++ b/spec/ruby/core/encoding/locale_charmap_spec.rb
@@ -0,0 +1,56 @@
+require_relative '../../spec_helper'
+
+describe "Encoding.locale_charmap" do
+ it "returns a String" do
+ Encoding.locale_charmap.should.instance_of?(String)
+ end
+
+ describe "when setting LC_ALL=C" do
+ before :each do
+ @old_lc_all = ENV['LC_ALL']
+ end
+
+ after :each do
+ ENV['LC_ALL'] = @old_lc_all
+ end
+
+ # FIXME: Get this working on Windows
+ platform_is :linux do
+ platform_is_not :android do
+ it "returns a value based on the LC_ALL environment variable" do
+ ENV['LC_ALL'] = 'C'
+ ruby_exe("print Encoding.locale_charmap").should == 'ANSI_X3.4-1968'
+ end
+ end
+ end
+
+ platform_is :freebsd, :openbsd, :darwin do
+ it "returns a value based on the LC_ALL environment variable" do
+ ENV['LC_ALL'] = 'C'
+ ruby_exe("print Encoding.locale_charmap").should == 'US-ASCII'
+ end
+ end
+
+ platform_is :netbsd do
+ it "returns a value based on the LC_ALL environment variable" do
+ ENV['LC_ALL'] = 'C'
+ ruby_exe("print Encoding.locale_charmap").should == '646'
+ end
+ end
+
+ platform_is :android do
+ it "always returns UTF-8" do
+ ENV['LC_ALL'] = 'C'
+ ruby_exe("print Encoding.locale_charmap").should == 'UTF-8'
+ end
+ end
+
+ platform_is :bsd, :darwin, :linux do
+ it "is unaffected by assigning to ENV['LC_ALL'] in the same process" do
+ old_charmap = Encoding.locale_charmap
+ ENV['LC_ALL'] = 'C'
+ Encoding.locale_charmap.should == old_charmap
+ end
+ end
+ end
+end
diff --git a/spec/ruby/core/encoding/name_list_spec.rb b/spec/ruby/core/encoding/name_list_spec.rb
new file mode 100644
index 0000000000..1ba8d383bc
--- /dev/null
+++ b/spec/ruby/core/encoding/name_list_spec.rb
@@ -0,0 +1,23 @@
+require_relative '../../spec_helper'
+
+describe "Encoding.name_list" do
+ it "returns an Array" do
+ Encoding.name_list.should.instance_of?(Array)
+ end
+
+ it "returns encoding names as Strings" do
+ Encoding.name_list.each {|e| e.should.instance_of?(String) }
+ end
+
+ it "includes all aliases" do
+ Encoding.aliases.keys.each do |enc_alias|
+ Encoding.name_list.include?(enc_alias).should == true
+ end
+ end
+
+ it "includes all non-dummy encodings" do
+ Encoding.list.each do |enc|
+ Encoding.name_list.include?(enc.name).should == true
+ end
+ end
+end
diff --git a/spec/ruby/core/encoding/name_spec.rb b/spec/ruby/core/encoding/name_spec.rb
new file mode 100644
index 0000000000..1d625c9379
--- /dev/null
+++ b/spec/ruby/core/encoding/name_spec.rb
@@ -0,0 +1,15 @@
+require_relative "../../spec_helper"
+
+describe "Encoding#name" do
+ it "returns a String" do
+ Encoding.list.each do |e|
+ e.name.should.instance_of?(String)
+ end
+ end
+
+ it "uniquely identifies an encoding" do
+ Encoding.list.each do |e|
+ e.should == Encoding.find(e.name)
+ end
+ end
+end
diff --git a/spec/ruby/core/encoding/names_spec.rb b/spec/ruby/core/encoding/names_spec.rb
new file mode 100644
index 0000000000..e6bcbf474a
--- /dev/null
+++ b/spec/ruby/core/encoding/names_spec.rb
@@ -0,0 +1,35 @@
+require_relative '../../spec_helper'
+
+describe "Encoding#names" do
+ it "returns an Array" do
+ Encoding.name_list.each do |name|
+ e = Encoding.find(name) or next
+ e.names.should.instance_of?(Array)
+ end
+ end
+
+ it "returns names as Strings" do
+ Encoding.name_list.each do |name|
+ e = Encoding.find(name) or next
+ e.names.each do |this_name|
+ this_name.should.instance_of?(String)
+ end
+ end
+ end
+
+ it "returns #name as the first value" do
+ Encoding.name_list.each do |name|
+ e = Encoding.find(name) or next
+ e.names.first.should == e.name
+ end
+ end
+
+ it "includes any aliases the encoding has" do
+ Encoding.name_list.each do |name|
+ e = Encoding.find(name) or next
+ aliases = Encoding.aliases.select{|a,n| n == name}.keys
+ names = e.names
+ aliases.each {|a| names.include?(a).should == true}
+ end
+ end
+end
diff --git a/spec/ruby/core/encoding/replicate_spec.rb b/spec/ruby/core/encoding/replicate_spec.rb
new file mode 100644
index 0000000000..9fe0ba8747
--- /dev/null
+++ b/spec/ruby/core/encoding/replicate_spec.rb
@@ -0,0 +1,8 @@
+# encoding: binary
+require_relative '../../spec_helper'
+
+describe "Encoding#replicate" do
+ it "has been removed" do
+ Encoding::US_ASCII.should_not.respond_to?(:replicate, true)
+ end
+end
diff --git a/spec/ruby/core/encoding/to_s_spec.rb b/spec/ruby/core/encoding/to_s_spec.rb
new file mode 100644
index 0000000000..ee5e3b4abe
--- /dev/null
+++ b/spec/ruby/core/encoding/to_s_spec.rb
@@ -0,0 +1,7 @@
+require_relative "../../spec_helper"
+
+describe "Encoding#to_s" do
+ it "is an alias of Encoding#name" do
+ Encoding.instance_method(:to_s).should == Encoding.instance_method(:name)
+ end
+end
diff --git a/spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_name_spec.rb b/spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_name_spec.rb
new file mode 100644
index 0000000000..bc36695ca7
--- /dev/null
+++ b/spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_name_spec.rb
@@ -0,0 +1,16 @@
+require_relative "../../../spec_helper"
+require_relative '../fixtures/classes'
+
+describe "Encoding::UndefinedConversionError#destination_encoding_name" do
+ before :each do
+ @exception = EncodingSpecs::UndefinedConversionError.exception
+ end
+
+ it "returns a String" do
+ @exception.destination_encoding_name.should.instance_of?(String)
+ end
+
+ it "is equal to the destination encoding name of the object that raised it" do
+ @exception.destination_encoding_name.should == "US-ASCII"
+ end
+end
diff --git a/spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_spec.rb b/spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_spec.rb
new file mode 100644
index 0000000000..c0fcf8de58
--- /dev/null
+++ b/spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_spec.rb
@@ -0,0 +1,16 @@
+require_relative "../../../spec_helper"
+require_relative '../fixtures/classes'
+
+describe "Encoding::UndefinedConversionError#destination_encoding" do
+ before :each do
+ @exception = EncodingSpecs::UndefinedConversionError.exception
+ end
+
+ it "returns an Encoding object" do
+ @exception.destination_encoding.should.instance_of?(Encoding)
+ end
+
+ it "is equal to the destination encoding of the object that raised it" do
+ @exception.destination_encoding.should == Encoding::US_ASCII
+ end
+end
diff --git a/spec/ruby/core/encoding/undefined_conversion_error/error_char_spec.rb b/spec/ruby/core/encoding/undefined_conversion_error/error_char_spec.rb
new file mode 100644
index 0000000000..333acf5ee6
--- /dev/null
+++ b/spec/ruby/core/encoding/undefined_conversion_error/error_char_spec.rb
@@ -0,0 +1,28 @@
+require_relative "../../../spec_helper"
+require_relative '../fixtures/classes'
+
+describe "Encoding::UndefinedConversionError#error_char" do
+ before :each do
+ @exception = EncodingSpecs::UndefinedConversionError.exception
+ @exception2 = EncodingSpecs::UndefinedConversionErrorIndirect.exception
+ end
+
+ it "returns a String" do
+ @exception.error_char.should.instance_of?(String)
+ @exception2.error_char.should.instance_of?(String)
+ end
+
+ it "returns the one-character String that caused the exception" do
+ @exception.error_char.size.should == 1
+ @exception.error_char.should == "\u{8765}"
+
+ @exception2.error_char.size.should == 1
+ @exception2.error_char.should == "\u{A0}"
+ end
+
+ it "uses the source encoding" do
+ @exception.error_char.encoding.should == @exception.source_encoding
+
+ @exception2.error_char.encoding.should == @exception2.source_encoding
+ end
+end
diff --git a/spec/ruby/core/encoding/undefined_conversion_error/source_encoding_name_spec.rb b/spec/ruby/core/encoding/undefined_conversion_error/source_encoding_name_spec.rb
new file mode 100644
index 0000000000..4932a25ed7
--- /dev/null
+++ b/spec/ruby/core/encoding/undefined_conversion_error/source_encoding_name_spec.rb
@@ -0,0 +1,29 @@
+require_relative "../../../spec_helper"
+require_relative '../fixtures/classes'
+
+describe "Encoding::UndefinedConversionError#source_encoding_name" do
+ before :each do
+ @exception = EncodingSpecs::UndefinedConversionError.exception
+ @exception2 = EncodingSpecs::UndefinedConversionErrorIndirect.exception
+ end
+
+ it "returns a String" do
+ @exception.source_encoding_name.should.instance_of?(String)
+ end
+
+ it "is equal to the source encoding name of the object that raised it" do
+ @exception.source_encoding_name.should == "UTF-8"
+ end
+
+ # The source encoding specified in the Encoding::Converter constructor may
+ # differ from the source encoding returned here. What seems to happen is
+ # that when transcoding along a path with multiple pairs of encodings, the
+ # last one encountered when the error occurred is returned. So in this
+ # case, the conversion path is ISO-8859-1 -> UTF-8 -> EUC-JP. The
+ # conversion from ISO-8859-1 -> UTF-8 succeeded, but the conversion from
+ # UTF-8 to EUC-JP failed. IOW, it failed when the source encoding was
+ # UTF-8, so UTF-8 is regarded as the source encoding.
+ it "is equal to the source encoding at the stage of the conversion path where the error occurred" do
+ @exception2.source_encoding_name.should == 'UTF-8'
+ end
+end
diff --git a/spec/ruby/core/encoding/undefined_conversion_error/source_encoding_spec.rb b/spec/ruby/core/encoding/undefined_conversion_error/source_encoding_spec.rb
new file mode 100644
index 0000000000..cf12020ad2
--- /dev/null
+++ b/spec/ruby/core/encoding/undefined_conversion_error/source_encoding_spec.rb
@@ -0,0 +1,30 @@
+require_relative "../../../spec_helper"
+require_relative '../fixtures/classes'
+
+describe "Encoding::UndefinedConversionError#source_encoding" do
+ before :each do
+ @exception = EncodingSpecs::UndefinedConversionError.exception
+ @exception2 = EncodingSpecs::UndefinedConversionErrorIndirect.exception
+ end
+
+ it "returns an Encoding object" do
+ @exception.source_encoding.should.instance_of?(Encoding)
+ @exception2.source_encoding.should.instance_of?(Encoding)
+ end
+
+ it "is equal to the source encoding of the object that raised it" do
+ @exception.source_encoding.should == Encoding::UTF_8
+ end
+
+ # The source encoding specified in the Encoding::Converter constructor may
+ # differ from the source encoding returned here. What seems to happen is
+ # that when transcoding along a path with multiple pairs of encodings, the
+ # last one encountered when the error occurred is returned. So in this
+ # case, the conversion path is ISO-8859-1 -> UTF-8 -> EUC-JP. The
+ # conversion from ISO-8859-1 -> UTF-8 succeeded, but the conversion from
+ # UTF-8 to EUC-JP failed. IOW, it failed when the source encoding was
+ # UTF-8, so UTF-8 is regarded as the source encoding.
+ it "is equal to the source encoding at the stage of the conversion path where the error occurred" do
+ @exception2.source_encoding.should == Encoding::UTF_8
+ end
+end
> -rw-r--r--ext/bigdecimal/bigdecimal_en.html119
-rw-r--r--ext/bigdecimal/bigdecimal_ja.html19
-rw-r--r--ext/bigdecimal/extconf.rb4
-rw-r--r--ext/bigdecimal/lib/bigdecimal/jacobian.rb28
-rw-r--r--ext/bigdecimal/lib/bigdecimal/ludcmp.rb44
-rw-r--r--ext/bigdecimal/lib/bigdecimal/math.rb95
-rw-r--r--ext/bigdecimal/lib/bigdecimal/newton.rb11
-rw-r--r--ext/bigdecimal/lib/bigdecimal/util.rb130
-rw-r--r--ext/continuation/continuation.c8
-rw-r--r--ext/continuation/extconf.rb3
-rw-r--r--ext/coverage/coverage.c107
-rw-r--r--ext/coverage/extconf.rb3
-rw-r--r--ext/curses/.cvsignore3
-rw-r--r--ext/curses/curses.c2979
-rw-r--r--ext/curses/extconf.rb17
-rw-r--r--ext/curses/view.rb10
-rw-r--r--ext/curses/view2.rb228
-rw-r--r--ext/date/date_core.c9774
-rw-r--r--ext/date/date_parse.c2425
-rw-r--r--ext/date/date_strftime.c1155
-rw-r--r--ext/date/date_strptime.c698
-rw-r--r--ext/date/date_tmx.h56
-rw-r--r--ext/date/depend2
-rw-r--r--ext/date/extconf.rb2
-rw-r--r--ext/date/lib/date.rb61
-rw-r--r--ext/date/lib/date/format.rb1
-rw-r--r--ext/dbm/.cvsignore3
-rw-r--r--ext/dbm/dbm.c604
-rw-r--r--ext/dbm/extconf.rb297
-rw-r--r--ext/digest/.cvsignore3
-rw-r--r--ext/digest/bubblebabble/bubblebabble.c142
-rw-r--r--ext/digest/bubblebabble/depend3
-rw-r--r--ext/digest/bubblebabble/extconf.rb6
-rw-r--r--ext/digest/defs.h20
-rw-r--r--ext/digest/digest.c754
-rw-r--r--ext/digest/digest.h30
-rw-r--r--ext/digest/digest.txt113
-rw-r--r--ext/digest/digest.txt.ja111
-rw-r--r--ext/digest/extconf.rb6
-rw-r--r--ext/digest/lib/digest.rb88
-rw-r--r--ext/digest/lib/digest/hmac.rb302
-rw-r--r--ext/digest/lib/md5.rb14
-rw-r--r--ext/digest/lib/sha1.rb14
-rw-r--r--ext/digest/md5/.cvsignore3
-rw-r--r--ext/digest/md5/extconf.rb7
-rw-r--r--ext/digest/md5/md5.c30
-rw-r--r--ext/digest/md5/md5.h11
-rw-r--r--ext/digest/md5/md5init.c25
-rw-r--r--ext/digest/md5/md5ossl.c25
-rw-r--r--ext/digest/md5/md5ossl.h7
-rw-r--r--ext/digest/rmd160/.cvsignore3
-rw-r--r--ext/digest/rmd160/depend2
-rw-r--r--ext/digest/rmd160/extconf.rb9
-rw-r--r--ext/digest/rmd160/rmd160.c11
-rw-r--r--ext/digest/rmd160/rmd160.h20
-rw-r--r--ext/digest/rmd160/rmd160hl.c96
-rw-r--r--ext/digest/rmd160/rmd160init.c28
-rw-r--r--ext/digest/rmd160/rmd160ossl.c43
-rw-r--r--ext/digest/rmd160/rmd160ossl.h6
-rw-r--r--ext/digest/sha1/.cvsignore3
-rw-r--r--ext/digest/sha1/depend2
-rw-r--r--ext/digest/sha1/extconf.rb9
-rw-r--r--ext/digest/sha1/sha1.c24
-rw-r--r--ext/digest/sha1/sha1.h23
-rw-r--r--ext/digest/sha1/sha1hl.c102
-rw-r--r--ext/digest/sha1/sha1init.c28
-rw-r--r--ext/digest/sha1/sha1ossl.c43
-rw-r--r--ext/digest/sha1/sha1ossl.h9
-rw-r--r--ext/digest/sha2/.cvsignore3
-rw-r--r--ext/digest/sha2/depend3
-rw-r--r--ext/digest/sha2/extconf.rb26
-rw-r--r--ext/digest/sha2/lib/sha2.rb107
-rw-r--r--ext/digest/sha2/sha2.c283
-rw-r--r--ext/digest/sha2/sha2.h194
-rw-r--r--ext/digest/sha2/sha2hl.c252
-rw-r--r--ext/digest/sha2/sha2init.c29
-rw-r--r--ext/digest/sha2/sha2ossl.c11
-rw-r--r--ext/digest/sha2/sha2ossl.h17
-rw-r--r--ext/digest/test.sh7
-rw-r--r--ext/dl/.cvsignore8
-rw-r--r--ext/dl/callback/depend15
-rw-r--r--ext/dl/callback/extconf.rb14
-rw-r--r--ext/dl/callback/mkcallback.rb246
-rw-r--r--ext/dl/cfunc.c674
-rw-r--r--ext/dl/cptr.c682
-rw-r--r--ext/dl/depend47
-rw-r--r--ext/dl/dl.c1051
-rw-r--r--ext/dl/dl.def59
-rw-r--r--ext/dl/dl.h405
-rw-r--r--ext/dl/doc/dl.txt266
-rw-r--r--ext/dl/extconf.rb198
-rw-r--r--ext/dl/h2rb500
-rw-r--r--ext/dl/handle.c503
-rw-r--r--ext/dl/install.rb49
-rw-r--r--ext/dl/lib/dl.rb12
-rw-r--r--ext/dl/lib/dl/callback.rb112
-rw-r--r--ext/dl/lib/dl/cparser.rb109
-rw-r--r--ext/dl/lib/dl/func.rb187
-rw-r--r--ext/dl/lib/dl/import.rb445
-rw-r--r--ext/dl/lib/dl/pack.rb128
-rw-r--r--ext/dl/lib/dl/stack.rb116
-rw-r--r--ext/dl/lib/dl/struct.rb345
-rw-r--r--ext/dl/lib/dl/types.rb306
-rw-r--r--ext/dl/lib/dl/value.rb112
-rw-r--r--ext/dl/lib/dl/win32.rb25
-rw-r--r--ext/dl/mkcall.rb62
-rw-r--r--ext/dl/mkcallback.rb56
-rw-r--r--ext/dl/mkcbtable.rb18
-rw-r--r--ext/dl/ptr.c1067
-rw-r--r--ext/dl/sample/c++sample.C35
-rw-r--r--ext/dl/sample/c++sample.rb60
-rw-r--r--ext/dl/sample/drives.rb70
-rw-r--r--ext/dl/sample/getch.rb5
-rw-r--r--ext/dl/sample/libc.rb69
-rw-r--r--ext/dl/sample/msgbox.rb19
-rw-r--r--ext/dl/sample/msgbox2.rb18
-rw-r--r--ext/dl/sample/stream.rb87
-rw-r--r--ext/dl/sym.c992
-rw-r--r--ext/dl/test/libtest.def28
-rw-r--r--ext/dl/test/test.c247
-rw-r--r--ext/dl/test/test.rb306
-rw-r--r--ext/dl/type.rb115
-rw-r--r--ext/dl/win32/extconf.rb3
-rw-r--r--ext/dl/win32/lib/Win32API.rb30
-rw-r--r--ext/dl/win32/lib/win32/registry.rb845
-rw-r--r--ext/dl/win32/lib/win32/resolv.rb379
-rw-r--r--ext/dl/win32/lib/win32/sspi.rb330
-rw-r--r--ext/enumerator/.cvsignore2
-rw-r--r--ext/enumerator/enumerator.c298
-rw-r--r--ext/enumerator/enumerator.txt102
-rw-r--r--ext/enumerator/extconf.rb2
-rw-r--r--ext/etc/.cvsignore3
-rw-r--r--ext/etc/depend2
-rw-r--r--ext/etc/etc.c296
-rw-r--r--ext/etc/etc.txt72
-rw-r--r--ext/etc/etc.txt.ja72
-rw-r--r--ext/etc/extconf.rb19
-rwxr-xr-x[-rw-r--r--]ext/extmk.rb409
-rw-r--r--ext/fcntl/.cvsignore3
-rw-r--r--ext/fcntl/fcntl.c10
-rw-r--r--ext/fiber/extconf.rb3
-rw-r--r--ext/fiber/fiber.c8
-rw-r--r--ext/fiddle/closure.c307
-rw-r--r--ext/fiddle/closure.h8
-rw-r--r--ext/fiddle/conversions.c139
-rw-r--r--ext/fiddle/conversions.h44
-rw-r--r--ext/fiddle/extconf.rb24
-rw-r--r--ext/fiddle/fiddle.c87
-rw-r--r--ext/fiddle/fiddle.h103
-rw-r--r--ext/fiddle/function.c217
-rw-r--r--ext/fiddle/function.h8
-rw-r--r--ext/fiddle/lib/fiddle.rb34
-rw-r--r--ext/fiddle/lib/fiddle/closure.rb48
-rw-r--r--ext/fiddle/lib/fiddle/function.rb6
-rw-r--r--ext/gdbm/.cvsignore3
-rw-r--r--ext/gdbm/gdbm.c827
-rw-r--r--ext/iconv/.cvsignore5
-rw-r--r--ext/iconv/charset_alias.rb11
-rw-r--r--ext/iconv/depend2
-rw-r--r--ext/iconv/extconf.rb3
-rw-r--r--ext/iconv/iconv.c906
-rw-r--r--ext/iconv/mkwrapper.rb53
-rw-r--r--ext/io/console/console.c762
-rw-r--r--ext/io/console/extconf.rb20
-rw-r--r--ext/io/console/io-console.gemspec15
-rw-r--r--ext/io/console/lib/console/size.rb20
-rw-r--r--ext/io/nonblock/extconf.rb8
-rw-r--r--ext/io/nonblock/nonblock.c114
-rw-r--r--ext/io/wait/.cvsignore2
-rw-r--r--ext/io/wait/extconf.rb5
-rw-r--r--ext/io/wait/lib/nonblock.rb23
-rw-r--r--ext/io/wait/wait.c118
-rw-r--r--ext/json/extconf.rb3
-rw-r--r--ext/json/generator/depend1
-rw-r--r--ext/json/generator/extconf.rb10
-rw-r--r--ext/json/generator/generator.c1459
-rw-r--r--ext/json/generator/generator.h200
-rw-r--r--ext/json/lib/json.rb62
-rw-r--r--ext/json/lib/json/add/complex.rb22
-rw-r--r--ext/json/lib/json/add/core.rb243
-rw-r--r--ext/json/lib/json/add/rational.rb22
-rw-r--r--ext/json/lib/json/common.rb435
-rw-r--r--ext/json/lib/json/ext.rb15
-rw-r--r--ext/json/lib/json/version.rb8
-rw-r--r--ext/json/parser/depend1
-rw-r--r--ext/json/parser/extconf.rb10
-rw-r--r--ext/json/parser/parser.c2196
-rw-r--r--ext/json/parser/parser.h82
-rw-r--r--ext/json/parser/parser.rl916
-rw-r--r--ext/json/parser/prereq.mk9
-rw-r--r--ext/mathn/complex/complex.c7
-rw-r--r--ext/mathn/complex/extconf.rb3
-rw-r--r--ext/mathn/rational/extconf.rb3
-rw-r--r--ext/mathn/rational/rational.c7
-rw-r--r--ext/nkf/.cvsignore3
-rw-r--r--ext/nkf/lib/kconv.rb287
-rw-r--r--ext/nkf/nkf-utf8/config.h77
-rw-r--r--ext/nkf/nkf-utf8/nkf.c9260
-rw-r--r--ext/nkf/nkf-utf8/nkf.h192
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.c1474
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.h27
-rw-r--r--ext/nkf/nkf.c402
-rw-r--r--ext/objspace/depend3
-rw-r--r--ext/objspace/extconf.rb2
-rw-r--r--ext/objspace/objspace.c650
-rw-r--r--ext/openssl/.cvsignore5
-rw-r--r--ext/openssl/extconf.rb56
-rw-r--r--ext/openssl/lib/net/ftptls.rb43
-rw-r--r--ext/openssl/lib/net/telnets.rb248
-rw-r--r--ext/openssl/lib/openssl.rb9
-rw-r--r--ext/openssl/lib/openssl/bn.rb40
-rw-r--r--ext/openssl/lib/openssl/buffering.rb236
-rw-r--r--ext/openssl/lib/openssl/cipher.rb69
-rw-r--r--ext/openssl/lib/openssl/config.rb313
-rw-r--r--ext/openssl/lib/openssl/digest.rb65
-rw-r--r--ext/openssl/lib/openssl/ssl-internal.rb177
-rw-r--r--ext/openssl/lib/openssl/ssl.rb137
-rw-r--r--ext/openssl/lib/openssl/x509-internal.rb158
-rw-r--r--ext/openssl/lib/openssl/x509.rb156
-rw-r--r--ext/openssl/openssl_missing.c39
-rw-r--r--ext/openssl/openssl_missing.h110
-rw-r--r--ext/openssl/ossl.c569
-rw-r--r--ext/openssl/ossl.h80
-rw-r--r--ext/openssl/ossl_asn1.c1187
-rw-r--r--ext/openssl/ossl_asn1.h6
-rw-r--r--ext/openssl/ossl_bio.c28
-rw-r--r--ext/openssl/ossl_bio.h2
-rw-r--r--ext/openssl/ossl_bn.c273
-rw-r--r--ext/openssl/ossl_bn.h7
-rw-r--r--ext/openssl/ossl_cipher.c498
-rw-r--r--ext/openssl/ossl_cipher.h3
-rw-r--r--ext/openssl/ossl_config.c421
-rw-r--r--ext/openssl/ossl_config.h2
-rw-r--r--ext/openssl/ossl_digest.c406
-rw-r--r--ext/openssl/ossl_digest.h3
-rw-r--r--ext/openssl/ossl_engine.c68
-rw-r--r--ext/openssl/ossl_engine.h2
-rw-r--r--ext/openssl/ossl_hmac.c134
-rw-r--r--ext/openssl/ossl_hmac.h2
-rw-r--r--ext/openssl/ossl_ns_spki.c55
-rw-r--r--ext/openssl/ossl_ns_spki.h2
-rw-r--r--ext/openssl/ossl_ocsp.c123
-rw-r--r--ext/openssl/ossl_ocsp.h2
-rw-r--r--ext/openssl/ossl_pkcs12.c98
-rw-r--r--ext/openssl/ossl_pkcs12.h3
-rw-r--r--ext/openssl/ossl_pkcs5.c101
-rw-r--r--ext/openssl/ossl_pkcs5.h6
-rw-r--r--ext/openssl/ossl_pkcs7.c183
-rw-r--r--ext/openssl/ossl_pkcs7.h3
-rw-r--r--ext/openssl/ossl_pkey.c200
-rw-r--r--ext/openssl/ossl_pkey.h39
-rw-r--r--ext/openssl/ossl_pkey_dh.c232
-rw-r--r--ext/openssl/ossl_pkey_dsa.c223
-rw-r--r--ext/openssl/ossl_pkey_ec.c1594
-rw-r--r--ext/openssl/ossl_pkey_rsa.c251
-rw-r--r--ext/openssl/ossl_rand.c108
-rw-r--r--ext/openssl/ossl_rand.h2
-rw-r--r--ext/openssl/ossl_ssl.c1290
-rw-r--r--ext/openssl/ossl_ssl.h17
-rw-r--r--ext/openssl/ossl_ssl_session.c323
-rw-r--r--ext/openssl/ossl_version.h4
-rw-r--r--ext/openssl/ossl_x509.c2
-rw-r--r--ext/openssl/ossl_x509.h2
-rw-r--r--ext/openssl/ossl_x509attr.c72
-rw-r--r--ext/openssl/ossl_x509cert.c347
-rw-r--r--ext/openssl/ossl_x509crl.c100
-rw-r--r--ext/openssl/ossl_x509ext.c109
-rw-r--r--ext/openssl/ossl_x509name.c135
-rw-r--r--ext/openssl/ossl_x509req.c90
-rw-r--r--ext/openssl/ossl_x509revoked.c48
-rw-r--r--ext/openssl/ossl_x509store.c99
-rw-r--r--ext/openssl/ruby_missing.h31
-rw-r--r--ext/pathname/extconf.rb2
-rw-r--r--ext/pathname/lib/pathname.rb527
-rw-r--r--ext/pathname/pathname.c1241
-rw-r--r--ext/psych/emitter.c538
-rw-r--r--ext/psych/emitter.h8
-rw-r--r--ext/psych/extconf.rb16
-rw-r--r--ext/psych/lib/psych.rb331
-rw-r--r--ext/psych/lib/psych/coder.rb94
-rw-r--r--ext/psych/lib/psych/core_ext.rb42
-rw-r--r--ext/psych/lib/psych/deprecated.rb83
-rw-r--r--ext/psych/lib/psych/handler.rb236
-rw-r--r--ext/psych/lib/psych/handlers/document_stream.rb22
-rw-r--r--ext/psych/lib/psych/json/ruby_events.rb19
-rw-r--r--ext/psych/lib/psych/json/stream.rb15
-rw-r--r--ext/psych/lib/psych/json/tree_builder.rb12
-rw-r--r--ext/psych/lib/psych/json/yaml_events.rb29
-rw-r--r--ext/psych/lib/psych/nodes.rb77
-rw-r--r--ext/psych/lib/psych/nodes/alias.rb18
-rw-r--r--ext/psych/lib/psych/nodes/document.rb60
-rw-r--r--ext/psych/lib/psych/nodes/mapping.rb56
-rw-r--r--ext/psych/lib/psych/nodes/node.rb53
-rw-r--r--ext/psych/lib/psych/nodes/scalar.rb67
-rw-r--r--ext/psych/lib/psych/nodes/sequence.rb81
-rw-r--r--ext/psych/lib/psych/nodes/stream.rb37
-rw-r--r--ext/psych/lib/psych/omap.rb4
-rw-r--r--ext/psych/lib/psych/parser.rb51
-rw-r--r--ext/psych/lib/psych/scalar_scanner.rb128
-rw-r--r--ext/psych/lib/psych/set.rb4
-rw-r--r--ext/psych/lib/psych/stream.rb36
-rw-r--r--ext/psych/lib/psych/streaming.rb22
-rw-r--r--ext/psych/lib/psych/syntax_error.rb19
-rw-r--r--ext/psych/lib/psych/tree_builder.rb96
-rw-r--r--ext/psych/lib/psych/visitors.rb6
-rw-r--r--ext/psych/lib/psych/visitors/depth_first.rb26
-rw-r--r--ext/psych/lib/psych/visitors/emitter.rb51
-rw-r--r--ext/psych/lib/psych/visitors/json_tree.rb21
-rw-r--r--ext/psych/lib/psych/visitors/to_ruby.rb324
-rw-r--r--ext/psych/lib/psych/visitors/visitor.rb19
-rw-r--r--ext/psych/lib/psych/visitors/yaml_tree.rb454
-rw-r--r--ext/psych/parser.c579
-rw-r--r--ext/psych/parser.h6
-rw-r--r--ext/psych/psych.c34
-rw-r--r--ext/psych/psych.h20
-rw-r--r--ext/psych/to_ruby.c41
-rw-r--r--ext/psych/to_ruby.h8
-rw-r--r--ext/psych/yaml_tree.c24
-rw-r--r--ext/psych/yaml_tree.h8
-rw-r--r--ext/pty/.cvsignore3
-rw-r--r--ext/pty/README65
-rw-r--r--ext/pty/README.ja89
-rw-r--r--ext/pty/depend2
-rw-r--r--ext/pty/expect_sample.rb55
-rw-r--r--ext/pty/extconf.rb6
-rw-r--r--ext/pty/lib/expect.rb19
-rw-r--r--ext/pty/pty.c681
-rw-r--r--ext/pty/script.rb37
-rw-r--r--ext/racc/cparse/.cvsignore3
-rw-r--r--ext/racc/cparse/README10
-rw-r--r--ext/racc/cparse/cparse.c101
-rw-r--r--ext/racc/cparse/extconf.rb3
-rw-r--r--ext/readline/.cvsignore3
-rw-r--r--ext/readline/README68
-rw-r--r--ext/readline/README.ja444
-rw-r--r--ext/readline/extconf.rb61
-rw-r--r--ext/readline/readline.c1420
-rw-r--r--ext/ripper/README30
-rw-r--r--ext/ripper/depend47
-rw-r--r--ext/ripper/eventids2.c279
-rw-r--r--ext/ripper/extconf.rb22
-rw-r--r--ext/ripper/lib/ripper.rb4
-rw-r--r--ext/ripper/lib/ripper/core.rb70
-rw-r--r--ext/ripper/lib/ripper/filter.rb70
-rw-r--r--ext/ripper/lib/ripper/lexer.rb179
-rw-r--r--ext/ripper/lib/ripper/sexp.rb114
-rwxr-xr-xext/ripper/tools/generate-param-macros.rb14
-rwxr-xr-xext/ripper/tools/generate.rb152
-rwxr-xr-xext/ripper/tools/preproc.rb91
-rwxr-xr-xext/ripper/tools/strip.rb12
-rw-r--r--ext/sdbm/.cvsignore3
-rw-r--r--ext/sdbm/_sdbm.c178
-rw-r--r--ext/sdbm/depend4
-rw-r--r--ext/sdbm/extconf.rb1
-rw-r--r--ext/sdbm/init.c369
-rw-r--r--ext/sdbm/sdbm.h10
-rw-r--r--ext/socket/.cvsignore3
-rw-r--r--ext/socket/.document16
-rw-r--r--ext/socket/addrinfo.h49
-rw-r--r--ext/socket/ancdata.c1814
-rw-r--r--ext/socket/basicsocket.c773
-rw-r--r--ext/socket/constants.c145
-rw-r--r--ext/socket/depend28
-rw-r--r--ext/socket/extconf.rb283
-rw-r--r--ext/socket/getaddrinfo.c102
-rw-r--r--ext/socket/getnameinfo.c43
-rw-r--r--ext/socket/init.c552
-rw-r--r--ext/socket/ipsocket.c308
-rw-r--r--ext/socket/lib/socket.rb770
-rw-r--r--ext/socket/mkconstants.rb705
-rw-r--r--ext/socket/option.c923
-rw-r--r--ext/socket/raddrinfo.c2218
-rw-r--r--ext/socket/rubysocket.h308
-rw-r--r--ext/socket/socket.c4741
-rw-r--r--ext/socket/sockport.h20
-rw-r--r--ext/socket/sockssocket.c71
-rw-r--r--ext/socket/tcpserver.c171
-rw-r--r--ext/socket/tcpsocket.c82
-rw-r--r--ext/socket/udpsocket.c265
-rw-r--r--ext/socket/unixserver.c155
-rw-r--r--ext/socket/unixsocket.c515
-rw-r--r--ext/stringio/.cvsignore3
-rw-r--r--ext/stringio/README5
-rw-r--r--ext/stringio/depend5
-rw-r--r--ext/stringio/stringio.c880
-rw-r--r--ext/strscan/.cvsignore3
-rw-r--r--ext/strscan/depend3
-rw-r--r--ext/strscan/strscan.c203
-rw-r--r--ext/syck/.cvsignore3
-rw-r--r--ext/syck/bytecode.c33
-rw-r--r--ext/syck/emitter.c127
-rw-r--r--ext/syck/gram.c76
-rw-r--r--ext/syck/handler.c29
-rw-r--r--ext/syck/implicit.c34
-rw-r--r--ext/syck/lib/syck.rb447
-rw-r--r--ext/syck/lib/syck/baseemitter.rb242
-rw-r--r--ext/syck/lib/syck/basenode.rb222
-rw-r--r--ext/syck/lib/syck/constants.rb45
-rw-r--r--ext/syck/lib/syck/encoding.rb35
-rw-r--r--ext/syck/lib/syck/error.rb34
-rw-r--r--ext/syck/lib/syck/loader.rb14
-rw-r--r--ext/syck/lib/syck/rubytypes.rb467
-rw-r--r--ext/syck/lib/syck/stream.rb41
-rw-r--r--ext/syck/lib/syck/stringio.rb85
-rw-r--r--ext/syck/lib/syck/syck.rb16
-rw-r--r--ext/syck/lib/syck/tag.rb95
-rw-r--r--ext/syck/lib/syck/types.rb192
-rw-r--r--ext/syck/lib/syck/yamlnode.rb54
-rw-r--r--ext/syck/lib/syck/ypath.rb54
-rw-r--r--ext/syck/lib/yaml/syck.rb14
-rw-r--r--ext/syck/node.c33
-rw-r--r--ext/syck/rubyext.c475
-rw-r--r--ext/syck/syck.c58
-rw-r--r--ext/syck/syck.h87
-rw-r--r--ext/syck/token.c115
-rw-r--r--ext/syck/yaml2byte.c40
-rw-r--r--ext/syck/yamlbyte.h21
-rw-r--r--ext/syslog/.cvsignore3
-rw-r--r--ext/syslog/extconf.rb2
-rw-r--r--ext/syslog/syslog.c217
-rw-r--r--ext/syslog/syslog.txt11
-rw-r--r--ext/syslog/test.rb164
-rw-r--r--ext/tk/.cvsignore3
-rw-r--r--ext/tk/ChangeLog.tkextlib109
-rw-r--r--ext/tk/MANUAL_tcltklib.eng320
-rw-r--r--ext/tk/MANUAL_tcltklib.eucj55
-rw-r--r--ext/tk/README.1st21
-rw-r--r--ext/tk/README.ActiveTcl35
-rw-r--r--ext/tk/README.fork14
-rw-r--r--ext/tk/README.macosx-aqua20
-rw-r--r--ext/tk/README.tcltklib134
-rw-r--r--ext/tk/config_list.in41
-rw-r--r--ext/tk/depend4
-rw-r--r--ext/tk/extconf.rb2005
-rw-r--r--ext/tk/lib/README4
-rw-r--r--ext/tk/lib/multi-tk.rb969
-rw-r--r--ext/tk/lib/remote-tk.rb38
-rw-r--r--ext/tk/lib/tcltk.rb22
-rw-r--r--ext/tk/lib/tk.rb1882
-rw-r--r--ext/tk/lib/tk/after.rb2
-rw-r--r--ext/tk/lib/tk/autoload.rb704
-rw-r--r--ext/tk/lib/tk/bindtag.rb83
-rw-r--r--ext/tk/lib/tk/busy.rb118
-rw-r--r--ext/tk/lib/tk/button.rb8
-rw-r--r--ext/tk/lib/tk/canvas.rb170
-rw-r--r--ext/tk/lib/tk/canvastag.rb144
-rw-r--r--ext/tk/lib/tk/checkbutton.rb13
-rw-r--r--ext/tk/lib/tk/composite.rb118
-rw-r--r--ext/tk/lib/tk/console.rb6
-rw-r--r--ext/tk/lib/tk/dialog.rb30
-rw-r--r--ext/tk/lib/tk/encodedstr.rb90
-rw-r--r--ext/tk/lib/tk/entry.rb9
-rw-r--r--ext/tk/lib/tk/event.rb276
-rw-r--r--ext/tk/lib/tk/font.rb835
-rw-r--r--ext/tk/lib/tk/fontchooser.rb176
-rw-r--r--ext/tk/lib/tk/frame.rb8
-rw-r--r--ext/tk/lib/tk/grid.rb79
-rw-r--r--ext/tk/lib/tk/image.rb194
-rw-r--r--ext/tk/lib/tk/itemconfig.rb328
-rw-r--r--ext/tk/lib/tk/itemfont.rb69
-rw-r--r--ext/tk/lib/tk/kinput.rb6
-rw-r--r--ext/tk/lib/tk/label.rb8
-rw-r--r--ext/tk/lib/tk/labelframe.rb12
-rw-r--r--ext/tk/lib/tk/listbox.rb41
-rw-r--r--ext/tk/lib/tk/macpkg.rb11
-rw-r--r--ext/tk/lib/tk/menu.rb186
-rw-r--r--ext/tk/lib/tk/menubar.rb46
-rw-r--r--ext/tk/lib/tk/menuspec.rb259
-rw-r--r--ext/tk/lib/tk/message.rb9
-rw-r--r--ext/tk/lib/tk/mngfocus.rb4
-rw-r--r--ext/tk/lib/tk/msgcat.rb64
-rw-r--r--ext/tk/lib/tk/namespace.rb171
-rw-r--r--ext/tk/lib/tk/optiondb.rb62
-rw-r--r--ext/tk/lib/tk/optionobj.rb18
-rw-r--r--ext/tk/lib/tk/pack.rb17
-rw-r--r--ext/tk/lib/tk/package.rb4
-rw-r--r--ext/tk/lib/tk/palette.rb6
-rw-r--r--ext/tk/lib/tk/panedwindow.rb72
-rw-r--r--ext/tk/lib/tk/place.rb12
-rw-r--r--ext/tk/lib/tk/radiobutton.rb13
-rw-r--r--ext/tk/lib/tk/root.rb47
-rw-r--r--ext/tk/lib/tk/scale.rb38
-rw-r--r--ext/tk/lib/tk/scrollable.rb11
-rw-r--r--ext/tk/lib/tk/scrollbar.rb75
-rw-r--r--ext/tk/lib/tk/scrollbox.rb7
-rw-r--r--ext/tk/lib/tk/selection.rb6
-rw-r--r--ext/tk/lib/tk/spinbox.rb67
-rw-r--r--ext/tk/lib/tk/text.rb336
-rw-r--r--ext/tk/lib/tk/textimage.rb24
-rw-r--r--ext/tk/lib/tk/textmark.rb108
-rw-r--r--ext/tk/lib/tk/texttag.rb136
-rw-r--r--ext/tk/lib/tk/textwindow.rb33
-rw-r--r--ext/tk/lib/tk/timer.rb91
-rw-r--r--ext/tk/lib/tk/toplevel.rb33
-rw-r--r--ext/tk/lib/tk/ttk_selector.rb98
-rw-r--r--ext/tk/lib/tk/txtwin_abst.rb2
-rw-r--r--ext/tk/lib/tk/validation.rb53
-rw-r--r--ext/tk/lib/tk/variable.rb630
-rw-r--r--ext/tk/lib/tk/virtevent.rb85
-rw-r--r--ext/tk/lib/tk/winfo.rb10
-rw-r--r--ext/tk/lib/tk/winpkg.rb25
-rw-r--r--ext/tk/lib/tk/wm.rb476
-rw-r--r--ext/tk/lib/tk/xim.rb4
-rw-r--r--ext/tk/lib/tkclass.rb2
-rw-r--r--ext/tk/lib/tkextlib/ICONS/icons.rb8
-rw-r--r--ext/tk/lib/tkextlib/ICONS/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/SUPPORT_STATUS106
-rw-r--r--ext/tk/lib/tkextlib/blt.rb10
-rw-r--r--ext/tk/lib/tkextlib/blt/barchart.rb6
-rw-r--r--ext/tk/lib/tkextlib/blt/bitmap.rb21
-rw-r--r--ext/tk/lib/tkextlib/blt/busy.rb3
-rw-r--r--ext/tk/lib/tkextlib/blt/component.rb625
-rw-r--r--ext/tk/lib/tkextlib/blt/container.rb22
-rw-r--r--ext/tk/lib/tkextlib/blt/dragdrop.rb77
-rw-r--r--ext/tk/lib/tkextlib/blt/eps.rb2
-rw-r--r--ext/tk/lib/tkextlib/blt/graph.rb4
-rw-r--r--ext/tk/lib/tkextlib/blt/htext.rb4
-rw-r--r--ext/tk/lib/tkextlib/blt/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/blt/stripchart.rb6
-rw-r--r--ext/tk/lib/tkextlib/blt/table.rb132
-rw-r--r--ext/tk/lib/tkextlib/blt/tabnotebook.rb93
-rw-r--r--ext/tk/lib/tkextlib/blt/tabset.rb185
-rw-r--r--ext/tk/lib/tkextlib/blt/ted.rb12
-rw-r--r--ext/tk/lib/tkextlib/blt/tile.rb4
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/button.rb2
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/checkbutton.rb4
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/frame.rb2
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/label.rb2
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/radiobutton.rb4
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/scrollbar.rb2
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/toplevel.rb2
-rw-r--r--ext/tk/lib/tkextlib/blt/tree.rb385
-rw-r--r--ext/tk/lib/tkextlib/blt/treeview.rb283
-rw-r--r--ext/tk/lib/tkextlib/blt/unix_dnd.rb22
-rw-r--r--ext/tk/lib/tkextlib/blt/vector.rb49
-rw-r--r--ext/tk/lib/tkextlib/blt/watch.rb47
-rw-r--r--ext/tk/lib/tkextlib/blt/winop.rb12
-rw-r--r--ext/tk/lib/tkextlib/bwidget.rb2
-rw-r--r--ext/tk/lib/tkextlib/bwidget/arrowbutton.rb2
-rw-r--r--ext/tk/lib/tkextlib/bwidget/button.rb4
-rw-r--r--ext/tk/lib/tkextlib/bwidget/buttonbox.rb22
-rw-r--r--ext/tk/lib/tkextlib/bwidget/combobox.rb21
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dialog.rb51
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dynamichelp.rb7
-rw-r--r--ext/tk/lib/tkextlib/bwidget/entry.rb4
-rw-r--r--ext/tk/lib/tkextlib/bwidget/label.rb4
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelentry.rb4
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelframe.rb10
-rw-r--r--ext/tk/lib/tkextlib/bwidget/listbox.rb62
-rw-r--r--ext/tk/lib/tkextlib/bwidget/mainframe.rb54
-rw-r--r--ext/tk/lib/tkextlib/bwidget/messagedlg.rb18
-rw-r--r--ext/tk/lib/tkextlib/bwidget/notebook.rb32
-rw-r--r--ext/tk/lib/tkextlib/bwidget/pagesmanager.rb18
-rw-r--r--ext/tk/lib/tkextlib/bwidget/panedwindow.rb15
-rw-r--r--ext/tk/lib/tkextlib/bwidget/panelframe.rb22
-rw-r--r--ext/tk/lib/tkextlib/bwidget/passwddlg.rb8
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressbar.rb2
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressdlg.rb6
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollableframe.rb10
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrolledwindow.rb20
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollview.rb2
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectcolor.rb30
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectfont.rb14
-rw-r--r--ext/tk/lib/tkextlib/bwidget/separator.rb2
-rw-r--r--ext/tk/lib/tkextlib/bwidget/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/bwidget/spinbox.rb4
-rw-r--r--ext/tk/lib/tkextlib/bwidget/statusbar.rb26
-rw-r--r--ext/tk/lib/tkextlib/bwidget/titleframe.rb10
-rw-r--r--ext/tk/lib/tkextlib/bwidget/tree.rb116
-rw-r--r--ext/tk/lib/tkextlib/bwidget/widget.rb20
-rw-r--r--ext/tk/lib/tkextlib/itcl/incr_tcl.rb14
-rw-r--r--ext/tk/lib/tkextlib/itcl/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/itk/incr_tk.rb50
-rw-r--r--ext/tk/lib/tkextlib/itk/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/buttonbox.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/calendar.rb23
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintbox.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintdialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/checkbox.rb26
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/combobox.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dateentry.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/datefield.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialogshell.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/disjointlistbox.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/entryfield.rb37
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extbutton.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectionbox.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectiondialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/feedback.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectionbox.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectiondialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/finddialog.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hierarchy.rb80
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hyperhelp.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledframe.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledwidget.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/mainwindow.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/menubar.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagebox.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagedialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/notebook.rb19
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/optionmenu.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/panedwindow.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/promptdialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/pushbutton.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/radiobox.rb19
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scopedobject.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledcanvas.rb24
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledframe.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledhtml.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledlistbox.rb6
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledtext.rb94
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledwidget.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectionbox.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectiondialog.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/shell.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spindate.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinint.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinner.rb37
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spintime.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabnotebook.rb24
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabset.rb52
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timeentry.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timefield.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/toolbar.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/watch.rb4
-rwxr-xr-xext/tk/lib/tkextlib/pkg_checker.rb4
-rw-r--r--ext/tk/lib/tkextlib/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tcllib.rb29
-rw-r--r--ext/tk/lib/tkextlib/tcllib/README14
-rw-r--r--ext/tk/lib/tkextlib/tcllib/autoscroll.rb26
-rw-r--r--ext/tk/lib/tkextlib/tcllib/calendar.rb55
-rw-r--r--ext/tk/lib/tkextlib/tcllib/canvas_sqmap.rb36
-rw-r--r--ext/tk/lib/tkextlib/tcllib/canvas_zoom.rb21
-rw-r--r--ext/tk/lib/tkextlib/tcllib/chatwidget.rb151
-rw-r--r--ext/tk/lib/tkextlib/tcllib/crosshair.rb117
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ctext.rb14
-rw-r--r--ext/tk/lib/tkextlib/tcllib/cursor.rb14
-rw-r--r--ext/tk/lib/tkextlib/tcllib/dateentry.rb62
-rw-r--r--ext/tk/lib/tkextlib/tcllib/datefield.rb14
-rw-r--r--ext/tk/lib/tkextlib/tcllib/diagrams.rb224
-rw-r--r--ext/tk/lib/tkextlib/tcllib/dialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/tcllib/getstring.rb9
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ico.rb52
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ip_entry.rb17
-rw-r--r--ext/tk/lib/tkextlib/tcllib/khim.rb68
-rw-r--r--ext/tk/lib/tkextlib/tcllib/menuentry.rb47
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ntext.rb146
-rw-r--r--ext/tk/lib/tkextlib/tcllib/panelframe.rb10
-rw-r--r--ext/tk/lib/tkextlib/tcllib/plotchart.rb785
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ruler.rb2
-rw-r--r--ext/tk/lib/tkextlib/tcllib/screenruler.rb2
-rw-r--r--ext/tk/lib/tkextlib/tcllib/scrolledwindow.rb57
-rw-r--r--ext/tk/lib/tkextlib/tcllib/scrollwin.rb2
-rw-r--r--ext/tk/lib/tkextlib/tcllib/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tcllib/statusbar.rb79
-rw-r--r--ext/tk/lib/tkextlib/tcllib/superframe.rb2
-rw-r--r--ext/tk/lib/tkextlib/tcllib/swaplist.rb15
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist.rb9
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist_core.rb342
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist_tile.rb20
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tkpiechart.rb36
-rw-r--r--ext/tk/lib/tkextlib/tcllib/toolbar.rb175
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tooltip.rb13
-rw-r--r--ext/tk/lib/tkextlib/tcllib/widget.rb34
-rw-r--r--ext/tk/lib/tkextlib/tclx/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tile.rb288
-rw-r--r--ext/tk/lib/tkextlib/tile/dialog.rb22
-rw-r--r--ext/tk/lib/tkextlib/tile/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tile/sizegrip.rb32
-rw-r--r--ext/tk/lib/tkextlib/tile/style.rb261
-rw-r--r--ext/tk/lib/tkextlib/tile/tbutton.rb10
-rw-r--r--ext/tk/lib/tkextlib/tile/tcheckbutton.rb12
-rw-r--r--ext/tk/lib/tkextlib/tile/tcombobox.rb12
-rw-r--r--ext/tk/lib/tkextlib/tile/tentry.rb15
-rw-r--r--ext/tk/lib/tkextlib/tile/tframe.rb10
-rw-r--r--ext/tk/lib/tkextlib/tile/tlabel.rb10
-rw-r--r--ext/tk/lib/tkextlib/tile/tlabelframe.rb12
-rw-r--r--ext/tk/lib/tkextlib/tile/tmenubutton.rb16
-rw-r--r--ext/tk/lib/tkextlib/tile/tnotebook.rb55
-rw-r--r--ext/tk/lib/tkextlib/tile/tpaned.rb93
-rw-r--r--ext/tk/lib/tkextlib/tile/tprogressbar.rb6
-rw-r--r--ext/tk/lib/tkextlib/tile/tradiobutton.rb12
-rw-r--r--ext/tk/lib/tkextlib/tile/treeview.rb1284
-rw-r--r--ext/tk/lib/tkextlib/tile/tscale.rb14
-rw-r--r--ext/tk/lib/tkextlib/tile/tscrollbar.rb39
-rw-r--r--ext/tk/lib/tkextlib/tile/tseparator.rb6
-rw-r--r--ext/tk/lib/tkextlib/tile/tspinbox.rb107
-rw-r--r--ext/tk/lib/tkextlib/tile/tsquare.rb2
-rw-r--r--ext/tk/lib/tkextlib/tkDND/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tkDND/shape.rb32
-rw-r--r--ext/tk/lib/tkextlib/tkDND/tkdnd.rb70
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/htmlwidget.rb25
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tkimg/README2
-rw-r--r--ext/tk/lib/tkextlib/tkimg/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tktable/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tktable/tktable.rb305
-rw-r--r--ext/tk/lib/tkextlib/tktrans/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tktrans/tktrans.rb4
-rw-r--r--ext/tk/lib/tkextlib/treectrl/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/treectrl/tktreectrl.rb519
-rw-r--r--ext/tk/lib/tkextlib/trofs/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/version.rb6
-rw-r--r--ext/tk/lib/tkextlib/vu/bargraph.rb10
-rw-r--r--ext/tk/lib/tkextlib/vu/charts.rb2
-rw-r--r--ext/tk/lib/tkextlib/vu/dial.rb6
-rw-r--r--ext/tk/lib/tkextlib/vu/pie.rb83
-rw-r--r--ext/tk/lib/tkextlib/vu/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/vu/spinbox.rb4
-rw-r--r--ext/tk/lib/tkextlib/winico/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/winico/winico.rb89
-rw-r--r--ext/tk/old-README.tcltklib.eucj8
-rw-r--r--ext/tk/old-extconf.rb440
-rw-r--r--ext/tk/sample/24hr_clock.rb130
-rw-r--r--ext/tk/sample/binding_sample.rb8
-rw-r--r--ext/tk/sample/bindtag_sample.rb38
-rw-r--r--ext/tk/sample/binstr_usage.rb14
-rw-r--r--ext/tk/sample/cd_timer.rb16
-rw-r--r--ext/tk/sample/cmd_res_test.rb2
-rw-r--r--ext/tk/sample/demos-en/ChangeLog.prev2
-rw-r--r--ext/tk/sample/demos-en/README28
-rw-r--r--ext/tk/sample/demos-en/README.1st8
-rw-r--r--ext/tk/sample/demos-en/README.tkencoding4
-rw-r--r--ext/tk/sample/demos-en/anilabel.rb24
-rw-r--r--ext/tk/sample/demos-en/aniwave.rb19
-rw-r--r--ext/tk/sample/demos-en/arrow.rb80
-rw-r--r--ext/tk/sample/demos-en/bind.rb67
-rw-r--r--ext/tk/sample/demos-en/bitmap.rb16
-rw-r--r--ext/tk/sample/demos-en/browse122
-rw-r--r--ext/tk/sample/demos-en/browse222
-rw-r--r--ext/tk/sample/demos-en/button.rb12
-rw-r--r--ext/tk/sample/demos-en/check.rb22
-rw-r--r--ext/tk/sample/demos-en/check2.rb46
-rw-r--r--ext/tk/sample/demos-en/clrpick.rb30
-rw-r--r--ext/tk/sample/demos-en/colors.rb20
-rw-r--r--ext/tk/sample/demos-en/combo.rb96
-rw-r--r--ext/tk/sample/demos-en/cscroll.rb34
-rw-r--r--ext/tk/sample/demos-en/ctext.rb81
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms2
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms.tk802
-rw-r--r--ext/tk/sample/demos-en/entry1.rb18
-rw-r--r--ext/tk/sample/demos-en/entry2.rb12
-rw-r--r--ext/tk/sample/demos-en/entry3.rb70
-rw-r--r--ext/tk/sample/demos-en/filebox.rb47
-rw-r--r--ext/tk/sample/demos-en/floor.rb560
-rw-r--r--ext/tk/sample/demos-en/floor2.rb560
-rw-r--r--ext/tk/sample/demos-en/form.rb14
-rw-r--r--ext/tk/sample/demos-en/goldberg.rb419
-rw-r--r--ext/tk/sample/demos-en/hello6
-rw-r--r--ext/tk/sample/demos-en/hscale.rb29
-rw-r--r--ext/tk/sample/demos-en/icon.rb24
-rw-r--r--ext/tk/sample/demos-en/image1.rb15
-rw-r--r--ext/tk/sample/demos-en/image2.rb28
-rw-r--r--ext/tk/sample/demos-en/image3.rb43
-rw-r--r--ext/tk/sample/demos-en/items.rb103
-rw-r--r--ext/tk/sample/demos-en/ixset28
-rw-r--r--ext/tk/sample/demos-en/ixset254
-rw-r--r--ext/tk/sample/demos-en/knightstour.rb271
-rw-r--r--ext/tk/sample/demos-en/label.rb29
-rw-r--r--ext/tk/sample/demos-en/labelframe.rb18
-rw-r--r--ext/tk/sample/demos-en/mclist.rb117
-rw-r--r--ext/tk/sample/demos-en/menu.rb60
-rw-r--r--ext/tk/sample/demos-en/menu84.rb68
-rw-r--r--ext/tk/sample/demos-en/menubu.rb14
-rw-r--r--ext/tk/sample/demos-en/msgbox.rb34
-rw-r--r--ext/tk/sample/demos-en/msgbox2.rb91
-rw-r--r--ext/tk/sample/demos-en/paned1.rb18
-rw-r--r--ext/tk/sample/demos-en/paned2.rb52
-rw-r--r--ext/tk/sample/demos-en/patch_1.1c193
-rw-r--r--ext/tk/sample/demos-en/pendulum.rb75
-rw-r--r--ext/tk/sample/demos-en/plot.rb36
-rw-r--r--ext/tk/sample/demos-en/puzzle.rb38
-rw-r--r--ext/tk/sample/demos-en/radio.rb24
-rw-r--r--ext/tk/sample/demos-en/radio2.rb33
-rw-r--r--ext/tk/sample/demos-en/radio3.rb55
-rw-r--r--ext/tk/sample/demos-en/rmt68
-rw-r--r--ext/tk/sample/demos-en/rolodex6
-rw-r--r--ext/tk/sample/demos-en/rolodex-j323
-rw-r--r--ext/tk/sample/demos-en/ruler.rb42
-rw-r--r--ext/tk/sample/demos-en/sayings.rb16
-rw-r--r--ext/tk/sample/demos-en/search.rb51
-rw-r--r--ext/tk/sample/demos-en/spin.rb22
-rw-r--r--ext/tk/sample/demos-en/square12
-rw-r--r--ext/tk/sample/demos-en/states.rb30
-rw-r--r--ext/tk/sample/demos-en/style.rb80
-rw-r--r--ext/tk/sample/demos-en/tcolor18
-rw-r--r--ext/tk/sample/demos-en/text.rb14
-rw-r--r--ext/tk/sample/demos-en/textpeer.rb76
-rw-r--r--ext/tk/sample/demos-en/timer2
-rw-r--r--ext/tk/sample/demos-en/toolbar.rb130
-rw-r--r--ext/tk/sample/demos-en/tree.rb119
-rw-r--r--ext/tk/sample/demos-en/ttkbut.rb139
-rw-r--r--ext/tk/sample/demos-en/ttkmenu.rb85
-rw-r--r--ext/tk/sample/demos-en/ttknote.rb89
-rw-r--r--ext/tk/sample/demos-en/ttkpane.rb213
-rw-r--r--ext/tk/sample/demos-en/ttkprogress.rb66
-rw-r--r--ext/tk/sample/demos-en/twind.rb72
-rw-r--r--ext/tk/sample/demos-en/twind2.rb134
-rw-r--r--ext/tk/sample/demos-en/unicodeout.rb50
-rw-r--r--ext/tk/sample/demos-en/vscale.rb29
-rw-r--r--ext/tk/sample/demos-en/widget351
-rw-r--r--ext/tk/sample/demos-jp/README14
-rw-r--r--ext/tk/sample/demos-jp/anilabel.rb25
-rw-r--r--ext/tk/sample/demos-jp/aniwave.rb20
-rw-r--r--ext/tk/sample/demos-jp/arrow.rb77
-rw-r--r--ext/tk/sample/demos-jp/bind.rb60
-rw-r--r--ext/tk/sample/demos-jp/bitmap.rb15
-rw-r--r--ext/tk/sample/demos-jp/browse122
-rw-r--r--ext/tk/sample/demos-jp/browse222
-rw-r--r--ext/tk/sample/demos-jp/button.rb6
-rw-r--r--ext/tk/sample/demos-jp/check.rb17
-rw-r--r--ext/tk/sample/demos-jp/check2.rb47
-rw-r--r--ext/tk/sample/demos-jp/clrpick.rb27
-rw-r--r--ext/tk/sample/demos-jp/colors.rb21
-rw-r--r--ext/tk/sample/demos-jp/combo.rb98
-rw-r--r--ext/tk/sample/demos-jp/cscroll.rb33
-rw-r--r--ext/tk/sample/demos-jp/ctext.rb76
-rw-r--r--ext/tk/sample/demos-jp/dialog1.rb1
-rw-r--r--ext/tk/sample/demos-jp/dialog2.rb1
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms2
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms.tk802
-rw-r--r--ext/tk/sample/demos-jp/entry1.rb15
-rw-r--r--ext/tk/sample/demos-jp/entry2.rb11
-rw-r--r--ext/tk/sample/demos-jp/entry3.rb69
-rw-r--r--ext/tk/sample/demos-jp/filebox.rb48
-rw-r--r--ext/tk/sample/demos-jp/floor.rb557
-rw-r--r--ext/tk/sample/demos-jp/floor2.rb557
-rw-r--r--ext/tk/sample/demos-jp/form.rb11
-rw-r--r--ext/tk/sample/demos-jp/goldberg.rb426
-rw-r--r--ext/tk/sample/demos-jp/hello1
-rw-r--r--ext/tk/sample/demos-jp/hscale.rb29
-rw-r--r--ext/tk/sample/demos-jp/icon.rb23
-rw-r--r--ext/tk/sample/demos-jp/image1.rb16
-rw-r--r--ext/tk/sample/demos-jp/image2.rb26
-rw-r--r--ext/tk/sample/demos-jp/image3.rb32
-rw-r--r--ext/tk/sample/demos-jp/items.rb98
-rw-r--r--ext/tk/sample/demos-jp/ixset30
-rw-r--r--ext/tk/sample/demos-jp/ixset257
-rw-r--r--ext/tk/sample/demos-jp/knightstour.rb273
-rw-r--r--ext/tk/sample/demos-jp/label.rb20
-rw-r--r--ext/tk/sample/demos-jp/labelframe.rb28
-rw-r--r--ext/tk/sample/demos-jp/mclist.rb121
-rw-r--r--ext/tk/sample/demos-jp/menu.rb63
-rw-r--r--ext/tk/sample/demos-jp/menu84.rb67
-rw-r--r--ext/tk/sample/demos-jp/menu8x.rb69
-rw-r--r--ext/tk/sample/demos-jp/menubu.rb15
-rw-r--r--ext/tk/sample/demos-jp/msgbox.rb39
-rw-r--r--ext/tk/sample/demos-jp/msgbox2.rb90
-rw-r--r--ext/tk/sample/demos-jp/paned1.rb20
-rw-r--r--ext/tk/sample/demos-jp/paned2.rb56
-rw-r--r--ext/tk/sample/demos-jp/pendulum.rb76
-rw-r--r--ext/tk/sample/demos-jp/plot.rb37
-rw-r--r--ext/tk/sample/demos-jp/puzzle.rb41
-rw-r--r--ext/tk/sample/demos-jp/radio.rb15
-rw-r--r--ext/tk/sample/demos-jp/radio2.rb35
-rw-r--r--ext/tk/sample/demos-jp/radio3.rb57
-rw-r--r--ext/tk/sample/demos-jp/rmt68
-rw-r--r--ext/tk/sample/demos-jp/rolodex6
-rw-r--r--ext/tk/sample/demos-jp/rolodex-j5
-rw-r--r--ext/tk/sample/demos-jp/ruler.rb39
-rw-r--r--ext/tk/sample/demos-jp/sayings.rb17
-rw-r--r--ext/tk/sample/demos-jp/search.rb54
-rw-r--r--ext/tk/sample/demos-jp/spin.rb28
-rw-r--r--ext/tk/sample/demos-jp/square12
-rw-r--r--ext/tk/sample/demos-jp/states.rb11
-rw-r--r--ext/tk/sample/demos-jp/style.rb80
-rw-r--r--ext/tk/sample/demos-jp/tcolor19
-rw-r--r--ext/tk/sample/demos-jp/text.rb11
-rw-r--r--ext/tk/sample/demos-jp/textpeer.rb82
-rw-r--r--ext/tk/sample/demos-jp/timer2
-rw-r--r--ext/tk/sample/demos-jp/toolbar.rb136
-rw-r--r--ext/tk/sample/demos-jp/tree.rb120
-rw-r--r--ext/tk/sample/demos-jp/ttkbut.rb145
-rw-r--r--ext/tk/sample/demos-jp/ttkmenu.rb91
-rw-r--r--ext/tk/sample/demos-jp/ttknote.rb97
-rw-r--r--ext/tk/sample/demos-jp/ttkpane.rb216
-rw-r--r--ext/tk/sample/demos-jp/ttkprogress.rb71
-rw-r--r--ext/tk/sample/demos-jp/twind.rb69
-rw-r--r--ext/tk/sample/demos-jp/twind2.rb113
-rw-r--r--ext/tk/sample/demos-jp/unicodeout.rb50
-rw-r--r--ext/tk/sample/demos-jp/vscale.rb30
-rw-r--r--ext/tk/sample/demos-jp/widget461
-rw-r--r--ext/tk/sample/editable_listbox.rb148
-rw-r--r--ext/tk/sample/encstr_usage.rb9
-rw-r--r--ext/tk/sample/figmemo_sample.rb456
-rw-r--r--ext/tk/sample/images/teapot.ppm49
-rw-r--r--ext/tk/sample/irbtk.rb4
-rw-r--r--ext/tk/sample/irbtkw.rbw156
-rw-r--r--ext/tk/sample/menubar1.rb20
-rw-r--r--ext/tk/sample/menubar2.rb24
-rw-r--r--ext/tk/sample/menubar3.rb72
-rw-r--r--ext/tk/sample/msgs_rb/README4
-rw-r--r--ext/tk/sample/msgs_rb/es.msg2
-rw-r--r--ext/tk/sample/msgs_rb/ru.msg4
-rw-r--r--ext/tk/sample/msgs_rb2/README2
-rw-r--r--ext/tk/sample/msgs_tk/README2
-rw-r--r--ext/tk/sample/msgs_tk/el.msg2
-rw-r--r--ext/tk/sample/msgs_tk/es.msg2
-rw-r--r--ext/tk/sample/msgs_tk/license.terms2
-rw-r--r--ext/tk/sample/msgs_tk/ru.msg4
-rw-r--r--ext/tk/sample/multi-ip_sample.rb7
-rw-r--r--ext/tk/sample/multi-ip_sample2.rb2
-rw-r--r--ext/tk/sample/optobj_sample.rb30
-rw-r--r--ext/tk/sample/propagate.rb2
-rw-r--r--ext/tk/sample/remote-ip_sample.rb10
-rw-r--r--ext/tk/sample/remote-ip_sample2.rb20
-rw-r--r--ext/tk/sample/safe-tk.rb57
-rw-r--r--ext/tk/sample/scrollframe.rb28
-rw-r--r--ext/tk/sample/tcltklib/sample1.rb2
-rw-r--r--ext/tk/sample/tcltklib/sample2.rb106
-rw-r--r--ext/tk/sample/tkalignbox.rb102
-rw-r--r--ext/tk/sample/tkballoonhelp.rb118
-rw-r--r--ext/tk/sample/tkbiff.rb6
-rw-r--r--ext/tk/sample/tkbrowse.rb2
-rw-r--r--ext/tk/sample/tkcombobox.rb133
-rw-r--r--ext/tk/sample/tkdialog.rb2
-rw-r--r--ext/tk/sample/tkextlib/ICONS/viewIcons.rb38
-rw-r--r--ext/tk/sample/tkextlib/blt/barchart5.rb22
-rw-r--r--ext/tk/sample/tkextlib/blt/calendar.rb54
-rw-r--r--ext/tk/sample/tkextlib/blt/graph6.rb4056
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7.rb8
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7a.rb10
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7b.rb8
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7c.rb8
-rw-r--r--ext/tk/sample/tkextlib/blt/pareto.rb34
-rw-r--r--ext/tk/sample/tkextlib/blt/plot1b.rb2
-rw-r--r--ext/tk/sample/tkextlib/blt/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/blt/winop1.rb8
-rw-r--r--ext/tk/sample/tkextlib/blt/winop2.rb2
-rw-r--r--ext/tk/sample/tkextlib/bwidget/basic.rb96
-rw-r--r--ext/tk/sample/tkextlib/bwidget/demo.rb84
-rw-r--r--ext/tk/sample/tkextlib/bwidget/dnd.rb16
-rw-r--r--ext/tk/sample/tkextlib/bwidget/manager.rb28
-rw-r--r--ext/tk/sample/tkextlib/bwidget/select.rb56
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tmpldlg.rb162
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tree.rb96
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/calendar.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/combobox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dialogshell.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/disjointlistbox.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-1.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-2.rb16
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-3.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extbutton.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extfileselectionbox.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/fileselectionbox.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/hierarchy.rb16
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/labeledwidget.rb4
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/mainwindow.rb36
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar.rb66
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar2.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox1.rb6
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox2.rb6
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagedialog.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook2.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/optionmenu.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow2.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/promptdialog.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/pushbutton.rb4
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledframe.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledhtml.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledlistbox.rb6
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledtext.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectionbox.rb4
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectiondialog.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/shell.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinint.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinner.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook2.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/toolbar.rb32
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/watch.rb2
-rw-r--r--ext/tk/sample/tkextlib/tcllib/datefield.rb4
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos1.rb22
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos2.rb8
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos3.rb20
-rw-r--r--ext/tk/sample/tkextlib/tcllib/xyplot.rb2
-rw-r--r--ext/tk/sample/tkextlib/tile/demo.rb213
-rw-r--r--ext/tk/sample/tkextlib/tile/readme.txt4
-rw-r--r--ext/tk/sample/tkextlib/tile/repeater.tcl12
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue.tcl8
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/pkgIndex.tcl2
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik.tcl30
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/pkgIndex.tcl4
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc.rb122
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc.tcl38
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/pkgIndex.tcl4
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/pkgIndex.tcl4
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik.tcl2
-rw-r--r--ext/tk/sample/tkextlib/tile/toolbutton.tcl36
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/README6
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/hv.rb48
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/index.html48
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/index.html40
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/ss.rb82
-rw-r--r--ext/tk/sample/tkextlib/tkimg/demo.rb10
-rw-r--r--ext/tk/sample/tkextlib/tkimg/license_terms_of_Img_extension4
-rw-r--r--ext/tk/sample/tkextlib/tkimg/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/tktable/basic.rb14
-rw-r--r--ext/tk/sample/tkextlib/tktable/buttons.rb12
-rw-r--r--ext/tk/sample/tkextlib/tktable/command.rb22
-rw-r--r--ext/tk/sample/tkextlib/tktable/debug.rb16
-rw-r--r--ext/tk/sample/tkextlib/tktable/dynarows.rb14
-rw-r--r--ext/tk/sample/tkextlib/tktable/maxsize.rb14
-rw-r--r--ext/tk/sample/tkextlib/tktable/spreadsheet.rb16
-rw-r--r--[-rwxr-xr-x]ext/tk/sample/tkextlib/tktable/tcllogo.gifbin2341 -> 2341 bytes-rw-r--r--ext/tk/sample/tkextlib/tktable/valid.rb12
-rw-r--r--ext/tk/sample/tkextlib/treectrl/bitmaps.rb32
-rw-r--r--ext/tk/sample/tkextlib/treectrl/demo.rb349
-rw-r--r--ext/tk/sample/tkextlib/treectrl/explorer.rb126
-rw-r--r--ext/tk/sample/tkextlib/treectrl/help.rb106
-rw-r--r--ext/tk/sample/tkextlib/treectrl/imovie.rb30
-rw-r--r--ext/tk/sample/tkextlib/treectrl/layout.rb26
-rw-r--r--ext/tk/sample/tkextlib/treectrl/mailwasher.rb100
-rw-r--r--ext/tk/sample/tkextlib/treectrl/outlook-folders.rb52
-rw-r--r--ext/tk/sample/tkextlib/treectrl/outlook-newgroup.rb102
-rw-r--r--ext/tk/sample/tkextlib/treectrl/random.rb68
-rw-r--r--ext/tk/sample/tkextlib/treectrl/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/treectrl/www-options.rb72
-rw-r--r--ext/tk/sample/tkextlib/vu/canvItems.rb68
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker.rb4
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker2.rb16
-rw-r--r--ext/tk/sample/tkextlib/vu/dial_demo.rb62
-rw-r--r--ext/tk/sample/tkextlib/vu/oscilloscope.rb16
-rw-r--r--ext/tk/sample/tkextlib/vu/pie.rb10
-rw-r--r--ext/tk/sample/tkextlib/vu/vu_demo.rb14
-rw-r--r--ext/tk/sample/tkfrom.rb2
-rw-r--r--ext/tk/sample/tkhello.rb2
-rw-r--r--ext/tk/sample/tkmenubutton.rb56
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb.rb16
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb2.rb16
-rw-r--r--ext/tk/sample/tkmsgcat-load_tk.rb22
-rw-r--r--ext/tk/sample/tkmulticolumnlist.rb114
-rw-r--r--ext/tk/sample/tkmultilistbox.rb96
-rw-r--r--ext/tk/sample/tkmultilistframe.rb168
-rw-r--r--ext/tk/sample/tkoptdb-safeTk.rb28
-rw-r--r--ext/tk/sample/tkoptdb.rb32
-rw-r--r--ext/tk/sample/tkrttimer.rb17
-rw-r--r--ext/tk/sample/tksleep_sample.rb29
-rw-r--r--ext/tk/sample/tktextframe.rb267
-rw-r--r--ext/tk/sample/tktextio.rb579
-rw-r--r--ext/tk/sample/tktimer2.rb8
-rw-r--r--ext/tk/sample/tktimer3.rb8
-rw-r--r--ext/tk/sample/tktree.rb26
-rw-r--r--ext/tk/sample/ttk_wrapper.rb154
-rw-r--r--ext/tk/stubs.c134
-rw-r--r--ext/tk/tcltklib.c4511
-rw-r--r--ext/tk/tkutil/.cvsignore3
-rw-r--r--ext/tk/tkutil/extconf.rb16
-rw-r--r--ext/tk/tkutil/tkutil.c846
-rw-r--r--ext/win32ole/.cvsignore4
-rw-r--r--ext/win32ole/depend2
-rw-r--r--ext/win32ole/doc/win32ole.rd294
-rw-r--r--ext/win32ole/extconf.rb32
-rw-r--r--ext/win32ole/lib/win32ole.rb22
-rw-r--r--ext/win32ole/sample/excel1.rb15
-rw-r--r--ext/win32ole/sample/excel2.rb10
-rw-r--r--ext/win32ole/sample/ieconst.rb2
-rw-r--r--ext/win32ole/sample/ienavi.rb2
-rw-r--r--ext/win32ole/sample/ienavi2.rb40
-rw-r--r--ext/win32ole/sample/oledirs.rb2
-rw-r--r--ext/win32ole/sample/olegen.rb27
-rw-r--r--ext/win32ole/sample/xml.rb36
-rw-r--r--ext/win32ole/tests/oleserver.rb10
-rw-r--r--ext/win32ole/tests/testNIL2VTEMPTY.rb28
-rw-r--r--ext/win32ole/tests/testOLEEVENT.rb91
-rw-r--r--ext/win32ole/tests/testOLEMETHOD.rb92
-rw-r--r--ext/win32ole/tests/testOLEPARAM.rb65
-rw-r--r--ext/win32ole/tests/testOLETYPE.rb96
-rw-r--r--ext/win32ole/tests/testOLEVARIABLE.rb49
-rw-r--r--ext/win32ole/tests/testVARIANT.rb32
-rw-r--r--ext/win32ole/tests/testWIN32OLE.rb372
-rw-r--r--ext/win32ole/tests/test_ole_methods.rb36
-rw-r--r--ext/win32ole/tests/test_propertyputref.rb19
-rw-r--r--ext/win32ole/tests/test_word.rb37
-rw-r--r--ext/win32ole/tests/testall.rb15
-rw-r--r--ext/win32ole/win32ole.c6107
-rw-r--r--ext/zlib/.cvsignore3
-rw-r--r--ext/zlib/doc/zlib.rd911
-rw-r--r--ext/zlib/extconf.rb13
-rw-r--r--ext/zlib/zlib.c2272
-rw-r--r--file.c3969
-rw-r--r--gc.c3621
-rw-r--r--gc.h99
-rw-r--r--gem_prelude.rb1
-rw-r--r--golf_prelude.rb122
-rw-r--r--goruby.c24
-rw-r--r--hash.c2483
-rw-r--r--ia64.s42
-rw-r--r--id.c51
-rw-r--r--include/ruby.h34
-rw-r--r--include/ruby/backward/classext.h18
-rw-r--r--include/ruby/backward/rubyio.h6
-rw-r--r--include/ruby/backward/rubysig.h48
-rw-r--r--include/ruby/backward/st.h6
-rw-r--r--include/ruby/backward/util.h6
-rw-r--r--include/ruby/defines.h334
-rw-r--r--include/ruby/encoding.h350
-rw-r--r--include/ruby/intern.h906
-rw-r--r--include/ruby/io.h202
-rw-r--r--include/ruby/missing.h237
-rw-r--r--include/ruby/oniguruma.h807
-rw-r--r--include/ruby/re.h75
-rw-r--r--include/ruby/regex.h50
-rw-r--r--include/ruby/ruby.h1490
-rw-r--r--include/ruby/st.h146
-rw-r--r--include/ruby/subst.h20
-rw-r--r--include/ruby/util.h99
-rw-r--r--include/ruby/version.h78
-rw-r--r--include/ruby/vm.h68
-rw-r--r--include/ruby/win32.h773
-rw-r--r--inits.c120
-rw-r--r--insns.def2160
-rw-r--r--instruby.rb244
-rw-r--r--intern.h499
-rw-r--r--internal.h239
-rw-r--r--io.c11008
-rw-r--r--iseq.c1525
-rw-r--r--iseq.h125
-rw-r--r--keywords42
-rw-r--r--lex.c136
-rw-r--r--lex.c.blt219
-rw-r--r--lib/.document103
-rw-r--r--lib/English.rb10
-rw-r--r--lib/Env.rb18
-rw-r--r--lib/README45
-rw-r--r--lib/abbrev.rb29
-rw-r--r--lib/base64.rb142
-rw-r--r--lib/benchmark.rb342
-rw-r--r--lib/cgi-lib.rb272
-rw-r--r--lib/cgi.rb2154
-rw-r--r--lib/cgi/.document2
-rw-r--r--lib/cgi/cookie.rb164
-rw-r--r--lib/cgi/core.rb838
-rw-r--r--lib/cgi/html.rb1021
-rw-r--r--lib/cgi/session.rb289
-rw-r--r--lib/cgi/session/pstore.rb60
-rw-r--r--lib/cgi/util.rb194
-rw-r--r--lib/cmath.rb402
-rw-r--r--lib/complex.rb633
-rw-r--r--lib/csv.rb3054
-rw-r--r--lib/date.rb1328
-rw-r--r--lib/date/format.rb603
-rw-r--r--lib/date2.rb5
-rw-r--r--lib/debug.rb1520
-rw-r--r--lib/delegate.rb470
-rw-r--r--lib/drb/acl.rb154
-rw-r--r--lib/drb/drb.rb565
-rw-r--r--lib/drb/eq.rb2
-rw-r--r--lib/drb/extserv.rb21
-rw-r--r--lib/drb/extservm.rb71
-rw-r--r--lib/drb/invokemethod.rb12
-rw-r--r--lib/drb/observer.rb20
-rw-r--r--lib/drb/ssl.rb180
-rw-r--r--lib/drb/timeridconv.rb80
-rw-r--r--lib/drb/unix.rb52
-rw-r--r--lib/e2mmap.rb107
-rw-r--r--lib/erb.rb822
-rw-r--r--lib/eregex.rb37
-rw-r--r--lib/fileutils.rb566
-rw-r--r--lib/finalize.rb193
-rw-r--r--lib/find.rb46
-rw-r--r--lib/forwardable.rb205
-rw-r--r--lib/ftools.rb261
-rw-r--r--lib/generator.rb380
-rw-r--r--lib/getoptlong.rb295
-rw-r--r--lib/getopts.rb127
-rw-r--r--lib/gserver.rb94
-rw-r--r--lib/importenv.rb33
-rw-r--r--lib/ipaddr.rb461
-rw-r--r--lib/irb.rb314
-rw-r--r--lib/irb/cmd/chws.rb9
-rw-r--r--lib/irb/cmd/fork.rb15
-rw-r--r--lib/irb/cmd/help.rb25
-rw-r--r--lib/irb/cmd/load.rb13
-rw-r--r--lib/irb/cmd/nop.rb13
-rw-r--r--lib/irb/cmd/pushws.rb9
-rw-r--r--lib/irb/cmd/subirb.rb11
-rw-r--r--lib/irb/completion.rb140
-rw-r--r--lib/irb/context.rb70
-rw-r--r--lib/irb/ext/change-ws.rb17
-rw-r--r--lib/irb/ext/history.rb15
-rw-r--r--lib/irb/ext/loader.rb17
-rw-r--r--lib/irb/ext/math-mode.rb9
-rw-r--r--lib/irb/ext/multi-irb.rb47
-rw-r--r--lib/irb/ext/save-history.rb70
-rw-r--r--lib/irb/ext/tracer.rb13
-rw-r--r--lib/irb/ext/use-loader.rb11
-rw-r--r--lib/irb/ext/workspaces.rb9
-rw-r--r--lib/irb/extend-command.rb52
-rw-r--r--lib/irb/frame.rb7
-rw-r--r--lib/irb/help.rb36
-rw-r--r--lib/irb/init.rb92
-rw-r--r--lib/irb/input-method.rb50
-rw-r--r--lib/irb/inspector.rb109
-rw-r--r--lib/irb/lc/error.rb11
-rw-r--r--lib/irb/lc/help-message23
-rw-r--r--lib/irb/lc/ja/encoding_aliases.rb8
-rw-r--r--lib/irb/lc/ja/error.rb32
-rw-r--r--lib/irb/lc/ja/help-message61
-rw-r--r--lib/irb/locale.rb168
-rw-r--r--lib/irb/magic-file.rb36
-rw-r--r--lib/irb/notifier.rb27
-rw-r--r--lib/irb/output-method.rb36
-rw-r--r--lib/irb/ruby-lex.rb180
-rw-r--r--lib/irb/ruby-token.rb30
-rw-r--r--lib/irb/slex.rb49
-rw-r--r--lib/irb/src_encoding.rb4
-rw-r--r--lib/irb/version.rb11
-rw-r--r--lib/irb/workspace.rb23
-rw-r--r--lib/irb/ws-for-case-2.rb11
-rw-r--r--lib/irb/xmp.rb19
-rw-r--r--lib/jcode.rb220
-rw-r--r--lib/logger.rb270
-rw-r--r--lib/mailread.rb62
-rw-r--r--lib/mathn.rb432
-rw-r--r--lib/matrix.rb1606
-rw-r--r--lib/matrix/eigenvalue_decomposition.rb886
-rw-r--r--lib/matrix/lup_decomposition.rb218
-rw-r--r--lib/minitest/README.txt269
-rw-r--r--lib/minitest/autorun.rb18
-rw-r--r--lib/minitest/benchmark.rb372
-rw-r--r--lib/minitest/mock.rb106
-rw-r--r--lib/minitest/pride.rb99
-rw-r--r--lib/minitest/spec.rb519
-rw-r--r--lib/minitest/unit.rb1169
-rw-r--r--lib/mkmf.rb1545
-rw-r--r--lib/monitor.rb362
-rw-r--r--lib/mutex_m.rb121
-rw-r--r--lib/net/.document8
-rw-r--r--lib/net/ftp.rb754
-rw-r--r--lib/net/http.rb1710
-rw-r--r--lib/net/https.rb163
-rw-r--r--lib/net/imap.rb1083
-rw-r--r--lib/net/pop.rb354
-rw-r--r--lib/net/protocol.rb54
-rw-r--r--lib/net/smtp.rb794
-rw-r--r--lib/net/telnet.rb256
-rw-r--r--lib/observer.rb94
-rw-r--r--lib/open-uri.rb312
-rw-r--r--lib/open3.rb749
-rw-r--r--lib/optparse.rb492
-rw-r--r--lib/optparse/version.rb10
-rw-r--r--lib/ostruct.rb186
-rw-r--r--lib/parsearg.rb87
-rw-r--r--lib/parsedate.rb15
-rw-r--r--lib/pathname.rb1062
-rw-r--r--lib/ping.rb53
-rw-r--r--lib/pp.rb331
-rw-r--r--lib/prettyprint.rb553
-rw-r--r--lib/prime.rb509
-rw-r--r--lib/profile.rb4
-rw-r--r--lib/profiler.rb2
-rw-r--r--lib/pstore.rb390
-rw-r--r--lib/racc/parser.rb49
-rw-r--r--lib/rake.rb69
-rw-r--r--lib/rake/alt_system.rb109
-rw-r--r--lib/rake/application.rb595
-rw-r--r--lib/rake/classic_namespace.rb11
-rw-r--r--lib/rake/clean.rb32
-rw-r--r--lib/rake/cloneable.rb25
-rw-r--r--lib/rake/contrib/compositepublisher.rb21
-rw-r--r--lib/rake/contrib/ftptools.rb150
-rw-r--r--lib/rake/contrib/publisher.rb73
-rw-r--r--lib/rake/contrib/rubyforgepublisher.rb16
-rw-r--r--lib/rake/contrib/sshpublisher.rb50
-rw-r--r--lib/rake/contrib/sys.rb191
-rw-r--r--lib/rake/default_loader.rb10
-rw-r--r--lib/rake/dsl_definition.rb176
-rw-r--r--lib/rake/early_time.rb18
-rw-r--r--lib/rake/ext/core.rb27
-rw-r--r--lib/rake/ext/module.rb39
-rw-r--r--lib/rake/ext/string.rb167
-rw-r--r--lib/rake/ext/time.rb14
-rw-r--r--lib/rake/file_creation_task.rb24
-rw-r--r--lib/rake/file_list.rb403
-rw-r--r--lib/rake/file_task.rb47
-rw-r--r--lib/rake/file_utils.rb114
-rw-r--r--lib/rake/file_utils_ext.rb145
-rw-r--r--lib/rake/gempackagetask.rb15
-rw-r--r--lib/rake/invocation_chain.rb51
-rw-r--r--lib/rake/invocation_exception_mixin.rb16
-rw-r--r--lib/rake/lib/project.rake21
-rw-r--r--lib/rake/loaders/makefile.rb40
-rw-r--r--lib/rake/multi_task.rb16
-rw-r--r--lib/rake/name_space.rb25
-rw-r--r--lib/rake/packagetask.rb185
-rw-r--r--lib/rake/pathmap.rb1
-rw-r--r--lib/rake/pseudo_status.rb24
-rw-r--r--lib/rake/rake_module.rb29
-rw-r--r--lib/rake/rake_test_loader.rb22
-rw-r--r--lib/rake/rdoctask.rb234
-rwxr-xr-xlib/rake/ruby182_test_unit_fix.rb25
-rw-r--r--lib/rake/rule_recursion_overflow_error.rb20
-rw-r--r--lib/rake/runtest.rb21
-rw-r--r--lib/rake/task.rb327
-rw-r--r--lib/rake/task_argument_error.rb7
-rw-r--r--lib/rake/task_arguments.rb78
-rw-r--r--lib/rake/task_manager.rb307
-rw-r--r--lib/rake/tasklib.rb22
-rw-r--r--lib/rake/testtask.rb191
-rw-r--r--lib/rake/version.rb8
-rw-r--r--lib/rake/win32.rb55
-rw-r--r--lib/rational.rb525
-rw-r--r--lib/rbconfig/.document1
-rw-r--r--lib/rbconfig/datadir.rb13
-rw-r--r--lib/rbconfig/obsolete.rb5
-rw-r--r--lib/rdoc.rb147
-rw-r--r--lib/rdoc/README489
-rw-r--r--lib/rdoc/alias.rb113
-rw-r--r--lib/rdoc/anon_class.rb12
-rw-r--r--lib/rdoc/any_method.rb207
-rw-r--r--lib/rdoc/attr.rb136
-rw-r--r--lib/rdoc/class_module.rb582
-rw-r--r--lib/rdoc/code_object.rb307
-rw-r--r--lib/rdoc/code_objects.rb778
-rw-r--r--lib/rdoc/constant.rb86
-rw-r--r--lib/rdoc/context.rb1191
-rw-r--r--lib/rdoc/cross_reference.rb173
-rw-r--r--lib/rdoc/diagram.rb335
-rw-r--r--lib/rdoc/dot/dot.rb255
-rw-r--r--lib/rdoc/encoding.rb92
-rw-r--r--lib/rdoc/erbio.rb37
-rw-r--r--lib/rdoc/generator.rb40
-rw-r--r--lib/rdoc/generator/darkfish.rb390
-rw-r--r--lib/rdoc/generator/markup.rb208
-rw-r--r--lib/rdoc/generator/ri.rb86
-rw-r--r--lib/rdoc/generator/template/darkfish/.document (renamed from install-sh)0
-rw-r--r--lib/rdoc/generator/template/darkfish/classpage.rhtml321
-rw-r--r--lib/rdoc/generator/template/darkfish/filepage.rhtml124
-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick.pngbin0 -> 452 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick_link.pngbin0 -> 764 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bug.pngbin0 -> 774 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_black.pngbin0 -> 211 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_minus.pngbin0 -> 207 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_plus.pngbin0 -> 209 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/date.pngbin0 -> 626 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/find.pngbin0 -> 659 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/loadingAnimation.gifbin0 -> 5886 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/macFFBgHack.pngbin0 -> 207 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/package.pngbin0 -> 853 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_green.pngbin0 -> 621 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_text.pngbin0 -> 342 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_width.pngbin0 -> 309 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/plugin.pngbin0 -> 591 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/ruby.pngbin0 -> 592 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/tag_green.pngbin0 -> 613 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench.pngbin0 -> 610 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench_orange.pngbin0 -> 584 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/zoom.pngbin0 -> 692 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/index.rhtml64
-rw-r--r--lib/rdoc/generator/template/darkfish/js/darkfish.js116
-rw-r--r--lib/rdoc/generator/template/darkfish/js/jquery.js32
-rw-r--r--lib/rdoc/generator/template/darkfish/js/quicksearch.js114
-rw-r--r--lib/rdoc/generator/template/darkfish/js/thickbox-compressed.js10
-rw-r--r--lib/rdoc/generator/template/darkfish/rdoc.css763
-rw-r--r--lib/rdoc/generators/chm_generator.rb112
-rw-r--r--lib/rdoc/generators/html_generator.rb1509
-rw-r--r--lib/rdoc/generators/ri_generator.rb268
-rw-r--r--lib/rdoc/generators/template/chm/chm.rb87
-rw-r--r--lib/rdoc/generators/template/html/hefss.rb418
-rw-r--r--lib/rdoc/generators/template/html/html.rb711
-rw-r--r--lib/rdoc/generators/template/html/kilmer.rb435
-rw-r--r--lib/rdoc/generators/template/html/old_html.rb728
-rw-r--r--lib/rdoc/generators/template/html/one_page_html.rb122
-rw-r--r--lib/rdoc/generators/template/xml/rdf.rb112
-rw-r--r--lib/rdoc/generators/template/xml/xml.rb112
-rw-r--r--lib/rdoc/generators/xml_generator.rb130
-rw-r--r--lib/rdoc/ghost_method.rb8
-rw-r--r--lib/rdoc/include.rb100
-rw-r--r--lib/rdoc/known_classes.rb72
-rw-r--r--lib/rdoc/markup.rb652
-rw-r--r--lib/rdoc/markup/.document2
-rw-r--r--lib/rdoc/markup/attribute_manager.rb335
-rw-r--r--lib/rdoc/markup/blank_line.rb27
-rw-r--r--lib/rdoc/markup/document.rb127
-rw-r--r--lib/rdoc/markup/formatter.rb169
-rw-r--r--lib/rdoc/markup/formatter_test_case.rb699
-rw-r--r--lib/rdoc/markup/heading.rb20
-rw-r--r--lib/rdoc/markup/indented_paragraph.rb33
-rw-r--r--lib/rdoc/markup/inline.rb144
-rw-r--r--lib/rdoc/markup/list.rb81
-rw-r--r--lib/rdoc/markup/list_item.rb86
-rw-r--r--lib/rdoc/markup/paragraph.rb14
-rw-r--r--lib/rdoc/markup/parser.rb497
-rw-r--r--lib/rdoc/markup/pre_process.rb227
-rw-r--r--lib/rdoc/markup/raw.rb69
-rw-r--r--lib/rdoc/markup/rule.rb20
-rw-r--r--lib/rdoc/markup/sample/rdoc2latex.rb16
-rw-r--r--lib/rdoc/markup/sample/sample.rb42
-rw-r--r--lib/rdoc/markup/simple_markup.rb476
-rw-r--r--lib/rdoc/markup/simple_markup/fragments.rb328
-rw-r--r--lib/rdoc/markup/simple_markup/inline.rb340
-rw-r--r--lib/rdoc/markup/simple_markup/lines.rb151
-rw-r--r--lib/rdoc/markup/simple_markup/preprocess.rb73
-rw-r--r--lib/rdoc/markup/simple_markup/to_flow.rb188
-rw-r--r--lib/rdoc/markup/simple_markup/to_html.rb289
-rw-r--r--lib/rdoc/markup/simple_markup/to_latex.rb333
-rw-r--r--lib/rdoc/markup/test/AllTests.rb2
-rw-r--r--lib/rdoc/markup/test/TestInline.rb154
-rw-r--r--lib/rdoc/markup/test/TestParse.rb503
-rw-r--r--lib/rdoc/markup/text_formatter_test_case.rb116
-rw-r--r--lib/rdoc/markup/to_ansi.rb84
-rw-r--r--lib/rdoc/markup/to_bs.rb80
-rw-r--r--lib/rdoc/markup/to_html.rb324
-rw-r--r--lib/rdoc/markup/to_html_crossref.rb120
-rw-r--r--lib/rdoc/markup/to_rdoc.rb301
-rw-r--r--lib/rdoc/markup/to_test.rb72
-rw-r--r--lib/rdoc/markup/to_tt_only.rb114
-rw-r--r--lib/rdoc/markup/verbatim.rb45
-rw-r--r--lib/rdoc/meta_method.rb8
-rw-r--r--lib/rdoc/method_attr.rb355
-rw-r--r--lib/rdoc/normal_class.rb71
-rw-r--r--lib/rdoc/normal_module.rb66
-rw-r--r--lib/rdoc/options.rb1179
-rw-r--r--lib/rdoc/parser.rb208
-rw-r--r--lib/rdoc/parser/c.rb1047
-rw-r--r--lib/rdoc/parser/ruby.rb1782
-rw-r--r--lib/rdoc/parser/ruby_tools.rb162
-rw-r--r--lib/rdoc/parser/simple.rb49
-rw-r--r--lib/rdoc/parsers/parse_c.rb697
-rw-r--r--lib/rdoc/parsers/parse_f95.rb1841
-rw-r--r--lib/rdoc/parsers/parse_rb.rb2605
-rw-r--r--lib/rdoc/parsers/parse_simple.rb41
-rw-r--r--lib/rdoc/parsers/parserfactory.rb99
-rw-r--r--lib/rdoc/rdoc.rb670
-rw-r--r--lib/rdoc/require.rb53
-rw-r--r--lib/rdoc/ri.rb18
-rw-r--r--lib/rdoc/ri/driver.rb1178
-rw-r--r--lib/rdoc/ri/formatter.rb5
-rw-r--r--lib/rdoc/ri/paths.rb128
-rw-r--r--lib/rdoc/ri/ri_cache.rb187
-rw-r--r--lib/rdoc/ri/ri_descriptions.rb154
-rw-r--r--lib/rdoc/ri/ri_display.rb255
-rw-r--r--lib/rdoc/ri/ri_driver.rb143
-rw-r--r--lib/rdoc/ri/ri_formatter.rb674
-rw-r--r--lib/rdoc/ri/ri_options.rb313
-rw-r--r--lib/rdoc/ri/ri_paths.rb80
-rw-r--r--lib/rdoc/ri/ri_reader.rb100
-rw-r--r--lib/rdoc/ri/ri_util.rb75
-rw-r--r--lib/rdoc/ri/ri_writer.rb62
-rw-r--r--lib/rdoc/ri/store.rb358
-rw-r--r--lib/rdoc/ruby_lex.rb1297
-rw-r--r--lib/rdoc/ruby_token.rb416
-rw-r--r--lib/rdoc/rubygems_hook.rb220
-rw-r--r--lib/rdoc/single_class.rb23
-rw-r--r--lib/rdoc/stats.rb438
-rw-r--r--lib/rdoc/stats/normal.rb48
-rw-r--r--lib/rdoc/stats/quiet.rb59
-rw-r--r--lib/rdoc/stats/verbose.rb45
-rw-r--r--lib/rdoc/task.rb326
-rw-r--r--lib/rdoc/template.rb234
-rw-r--r--lib/rdoc/text.rb302
-rw-r--r--lib/rdoc/token_stream.rb50
-rw-r--r--lib/rdoc/tokenstream.rb25
-rw-r--r--lib/rdoc/top_level.rb474
-rw-r--r--lib/rdoc/usage.rb210
-rw-r--r--lib/readbytes.rb41
-rw-r--r--lib/resolv-replace.rb22
-rw-r--r--lib/resolv.rb1421
-rw-r--r--lib/rexml/attlistdecl.rb112
-rw-r--r--lib/rexml/attribute.rb307
-rw-r--r--lib/rexml/cdata.rb115
-rw-r--r--lib/rexml/child.rb164
-rw-r--r--lib/rexml/comment.rb134
-rw-r--r--lib/rexml/doctype.rb73
-rw-r--r--lib/rexml/document.rb333
-rw-r--r--lib/rexml/dtd/attlistdecl.rb14
-rw-r--r--lib/rexml/dtd/dtd.rb82
-rw-r--r--lib/rexml/dtd/elementdecl.rb26
-rw-r--r--lib/rexml/dtd/entitydecl.rb98
-rw-r--r--lib/rexml/dtd/notationdecl.rb64
-rw-r--r--lib/rexml/element.rb2290
-rw-r--r--lib/rexml/encoding.rb102
-rw-r--r--lib/rexml/encodings/CP-1252.rb98
-rw-r--r--lib/rexml/encodings/EUC-JP.rb35
-rw-r--r--lib/rexml/encodings/ICONV.rb22
-rw-r--r--lib/rexml/encodings/ISO-8859-1.rb7
-rw-r--r--lib/rexml/encodings/ISO-8859-15.rb69
-rw-r--r--lib/rexml/encodings/SHIFT-JIS.rb37
-rw-r--r--lib/rexml/encodings/SHIFT_JIS.rb1
-rw-r--r--lib/rexml/encodings/UNILE.rb34
-rw-r--r--lib/rexml/encodings/US-ASCII.rb30
-rw-r--r--lib/rexml/encodings/UTF-16.rb34
-rw-r--r--lib/rexml/encodings/UTF-8.rb18
-rw-r--r--lib/rexml/entity.rb293
-rw-r--r--lib/rexml/formatters/default.rb111
-rw-r--r--lib/rexml/formatters/pretty.rb141
-rw-r--r--lib/rexml/formatters/transitive.rb57
-rw-r--r--lib/rexml/functions.rb83
-rw-r--r--lib/rexml/instruction.rb102
-rw-r--r--lib/rexml/light/node.rb381
-rw-r--r--lib/rexml/namespace.rb78
-rw-r--r--lib/rexml/node.rb99
-rw-r--r--lib/rexml/output.rb24
-rw-r--r--lib/rexml/parent.rb51
-rw-r--r--lib/rexml/parseexception.rb8
-rw-r--r--lib/rexml/parsers/baseparser.rb172
-rw-r--r--lib/rexml/parsers/lightparser.rb84
-rw-r--r--lib/rexml/parsers/pullparser.rb2
-rw-r--r--lib/rexml/parsers/sax2parser.rb409
-rw-r--r--lib/rexml/parsers/streamparser.rb4
-rw-r--r--lib/rexml/parsers/treeparser.rb16
-rw-r--r--lib/rexml/parsers/ultralightparser.rb80
-rw-r--r--lib/rexml/parsers/xpathparser.rb109
-rw-r--r--lib/rexml/quickpath.rb495
-rw-r--r--lib/rexml/rexml.rb20
-rw-r--r--lib/rexml/sax2listener.rb184
-rw-r--r--lib/rexml/source.rb416
-rw-r--r--lib/rexml/streamlistener.rb180
-rw-r--r--lib/rexml/syncenumerator.rb7
-rw-r--r--lib/rexml/text.rb270
-rw-r--r--lib/rexml/undefinednamespaceexception.rb8
-rw-r--r--lib/rexml/validation/relaxng.rb36
-rw-r--r--lib/rexml/validation/validation.rb10
-rw-r--r--lib/rexml/xmldecl.rb127
-rw-r--r--lib/rexml/xmltokens.rb28
-rw-r--r--lib/rexml/xpath.rb130
-rw-r--r--lib/rexml/xpath_parser.rb186
-rw-r--r--lib/rinda/rinda.rb18
-rw-r--r--lib/rinda/ring.rb90
-rw-r--r--lib/rinda/tuplespace.rb123
-rw-r--r--lib/rss.rb85
-rw-r--r--lib/rss/0.9.rb63
-rw-r--r--lib/rss/1.0.rb61
-rw-r--r--lib/rss/2.0.rb8
-rw-r--r--lib/rss/atom.rb756
-rw-r--r--lib/rss/content.rb25
-rw-r--r--lib/rss/content/1.0.rb9
-rw-r--r--lib/rss/content/2.0.rb11
-rw-r--r--lib/rss/converter.rb44
-rw-r--r--lib/rss/dublincore.rb55
-rw-r--r--lib/rss/dublincore/1.0.rb12
-rw-r--r--lib/rss/dublincore/2.0.rb12
-rw-r--r--lib/rss/dublincore/atom.rb16
-rw-r--r--lib/rss/image.rb28
-rw-r--r--lib/rss/itunes.rb410
-rw-r--r--lib/rss/maker.rb39
-rw-r--r--lib/rss/maker/0.9.rb450
-rw-r--r--lib/rss/maker/1.0.rb343
-rw-r--r--lib/rss/maker/2.0.rb169
-rw-r--r--lib/rss/maker/atom.rb172
-rw-r--r--lib/rss/maker/base.rb966
-rw-r--r--lib/rss/maker/content.rb14
-rw-r--r--lib/rss/maker/dublincore.rb150
-rw-r--r--lib/rss/maker/entry.rb163
-rw-r--r--lib/rss/maker/feed.rb426
-rw-r--r--lib/rss/maker/image.rb118
-rw-r--r--lib/rss/maker/itunes.rb242
-rw-r--r--lib/rss/maker/slash.rb33
-rw-r--r--lib/rss/maker/syndication.rb13
-rw-r--r--lib/rss/maker/taxonomy.rb126
-rw-r--r--lib/rss/maker/trackback.rb117
-rw-r--r--lib/rss/parser.rb224
-rw-r--r--lib/rss/rexmlparser.rb10
-rw-r--r--lib/rss/rss.rb787
-rw-r--r--lib/rss/slash.rb49
-rw-r--r--lib/rss/syndication.rb15
-rw-r--r--lib/rss/taxonomy.rb20
-rw-r--r--lib/rss/trackback.rb36
-rw-r--r--lib/rss/utils.rb82
-rw-r--r--lib/rss/xml-stylesheet.rb8
-rw-r--r--lib/rss/xml.rb71
-rw-r--r--lib/rss/xmlparser.rb14
-rw-r--r--lib/rss/xmlscanner.rb10
-rw-r--r--lib/rubygems.rb1305
-rw-r--r--lib/rubygems/builder.rb99
-rw-r--r--lib/rubygems/command.rb536
-rw-r--r--lib/rubygems/command_manager.rb194
-rw-r--r--lib/rubygems/commands/build_command.rb59
-rw-r--r--lib/rubygems/commands/cert_command.rb86
-rw-r--r--lib/rubygems/commands/check_command.rb65
-rw-r--r--lib/rubygems/commands/cleanup_command.rb100
-rw-r--r--lib/rubygems/commands/contents_command.rb101
-rw-r--r--lib/rubygems/commands/dependency_command.rb160
-rw-r--r--lib/rubygems/commands/environment_command.rb130
-rw-r--r--lib/rubygems/commands/fetch_command.rb78
-rw-r--r--lib/rubygems/commands/generate_index_command.rb124
-rw-r--r--lib/rubygems/commands/help_command.rb167
-rw-r--r--lib/rubygems/commands/install_command.rb165
-rw-r--r--lib/rubygems/commands/list_command.rb35
-rw-r--r--lib/rubygems/commands/lock_command.rb110
-rw-r--r--lib/rubygems/commands/outdated_command.rb30
-rw-r--r--lib/rubygems/commands/owner_command.rb76
-rw-r--r--lib/rubygems/commands/pristine_command.rb110
-rw-r--r--lib/rubygems/commands/push_command.rb60
-rw-r--r--lib/rubygems/commands/query_command.rb263
-rw-r--r--lib/rubygems/commands/rdoc_command.rb91
-rw-r--r--lib/rubygems/commands/search_command.rb31
-rw-r--r--lib/rubygems/commands/server_command.rb86
-rw-r--r--lib/rubygems/commands/setup_command.rb358
-rw-r--r--lib/rubygems/commands/sources_command.rb136
-rw-r--r--lib/rubygems/commands/specification_command.rb131
-rw-r--r--lib/rubygems/commands/stale_command.rb28
-rw-r--r--lib/rubygems/commands/uninstall_command.rb94
-rw-r--r--lib/rubygems/commands/unpack_command.rb160
-rw-r--r--lib/rubygems/commands/update_command.rb232
-rw-r--r--lib/rubygems/commands/which_command.rb82
-rw-r--r--lib/rubygems/config_file.rb375
-rw-r--r--lib/rubygems/custom_require.rb69
-rw-r--r--lib/rubygems/defaults.rb124
-rw-r--r--lib/rubygems/dependency.rb260
-rw-r--r--lib/rubygems/dependency_installer.rb304
-rw-r--r--lib/rubygems/dependency_list.rb252
-rw-r--r--lib/rubygems/deprecate.rb70
-rw-r--r--lib/rubygems/doc_manager.rb243
-rw-r--r--lib/rubygems/errors.rb35
-rw-r--r--lib/rubygems/exceptions.rb91
-rw-r--r--lib/rubygems/ext.rb18
-rw-r--r--lib/rubygems/ext/builder.rb56
-rw-r--r--lib/rubygems/ext/configure_builder.rb25
-rw-r--r--lib/rubygems/ext/ext_conf_builder.rb24
-rw-r--r--lib/rubygems/ext/rake_builder.rb39
-rw-r--r--lib/rubygems/format.rb82
-rw-r--r--lib/rubygems/gem_openssl.rb90
-rw-r--r--lib/rubygems/gem_path_searcher.rb172
-rw-r--r--lib/rubygems/gem_runner.rb86
-rw-r--r--lib/rubygems/gemcutter_utilities.rb82
-rw-r--r--lib/rubygems/indexer.rb644
-rw-r--r--lib/rubygems/install_update_options.rb128
-rw-r--r--lib/rubygems/installer.rb626
-rw-r--r--lib/rubygems/installer_test_case.rb144
-rw-r--r--lib/rubygems/local_remote_options.rb148
-rw-r--r--lib/rubygems/mock_gem_ui.rb71
-rw-r--r--lib/rubygems/old_format.rb153
-rw-r--r--lib/rubygems/package.rb83
-rw-r--r--lib/rubygems/package/f_sync_dir.rb23
-rw-r--r--lib/rubygems/package/tar_header.rb266
-rw-r--r--lib/rubygems/package/tar_input.rb235
-rw-r--r--lib/rubygems/package/tar_output.rb146
-rw-r--r--lib/rubygems/package/tar_reader.rb106
-rw-r--r--lib/rubygems/package/tar_reader/entry.rb145
-rw-r--r--lib/rubygems/package/tar_test_case.rb137
-rw-r--r--lib/rubygems/package/tar_writer.rb241
-rw-r--r--lib/rubygems/package_task.rb126
-rw-r--r--lib/rubygems/path_support.rb70
-rw-r--r--lib/rubygems/platform.rb194
-rw-r--r--lib/rubygems/psych_additions.rb18
-rw-r--r--lib/rubygems/psych_tree.rb54
-rw-r--r--lib/rubygems/remote_fetcher.rb507
-rw-r--r--lib/rubygems/require_paths_builder.rb18
-rw-r--r--lib/rubygems/requirement.rb204
-rw-r--r--lib/rubygems/security.rb826
-rw-r--r--lib/rubygems/server.rb832
-rw-r--r--lib/rubygems/source_index.rb406
-rw-r--r--lib/rubygems/spec_fetcher.rb297
-rw-r--r--lib/rubygems/specification.rb2171
-rw-r--r--lib/rubygems/ssl_certs/ca-bundle.pem3366
-rw-r--r--lib/rubygems/syck_hack.rb145
-rw-r--r--lib/rubygems/test_case.rb870
-rw-r--r--lib/rubygems/test_utilities.rb160
-rw-r--r--lib/rubygems/text.rb65
-rw-r--r--lib/rubygems/uninstaller.rb271
-rw-r--r--lib/rubygems/user_interaction.rb562
-rw-r--r--lib/rubygems/validator.rb169
-rw-r--r--lib/rubygems/version.rb329
-rw-r--r--lib/rubygems/version_option.rb65
-rw-r--r--lib/rubyunit.rb6
-rw-r--r--lib/runit/assert.rb73
-rw-r--r--lib/runit/cui/testrunner.rb51
-rw-r--r--lib/runit/error.rb9
-rw-r--r--lib/runit/testcase.rb45
-rw-r--r--lib/runit/testresult.rb44
-rw-r--r--lib/runit/testsuite.rb26
-rw-r--r--lib/runit/topublic.rb8
-rw-r--r--lib/scanf.rb781
-rw-r--r--lib/securerandom.rb265
-rwxr-xr-x[-rw-r--r--]lib/set.rb556
-rw-r--r--lib/shell.rb153
-rw-r--r--lib/shell/builtin-command.rb68
-rw-r--r--lib/shell/command-processor.rb537
-rw-r--r--lib/shell/error.rb11
-rw-r--r--lib/shell/filter.rb55
-rw-r--r--lib/shell/process-controller.rb351
-rw-r--r--lib/shell/system-command.rb145
-rw-r--r--lib/shell/version.rb13
-rw-r--r--lib/shellwords.rb173
-rw-r--r--lib/singleton.rb420
-rw-r--r--lib/soap/attachment.rb107
-rw-r--r--lib/soap/baseData.rb942
-rw-r--r--lib/soap/element.rb258
-rw-r--r--lib/soap/encodingstyle/aspDotNetHandler.rb213
-rw-r--r--lib/soap/encodingstyle/handler.rb100
-rw-r--r--lib/soap/encodingstyle/literalHandler.rb226
-rw-r--r--lib/soap/encodingstyle/soapHandler.rb582
-rw-r--r--lib/soap/generator.rb268
-rw-r--r--lib/soap/header/handler.rb57
-rw-r--r--lib/soap/header/handlerset.rb70
-rw-r--r--lib/soap/header/simplehandler.rb44
-rw-r--r--lib/soap/httpconfigloader.rb119
-rw-r--r--lib/soap/mapping.rb10
-rw-r--r--lib/soap/mapping/factory.rb355
-rw-r--r--lib/soap/mapping/mapping.rb381
-rw-r--r--lib/soap/mapping/registry.rb541
-rw-r--r--lib/soap/mapping/rubytypeFactory.rb475
-rw-r--r--lib/soap/mapping/typeMap.rb50
-rw-r--r--lib/soap/mapping/wsdlencodedregistry.rb280
-rw-r--r--lib/soap/mapping/wsdlliteralregistry.rb418
-rw-r--r--lib/soap/marshal.rb59
-rw-r--r--lib/soap/mimemessage.rb240
-rw-r--r--lib/soap/netHttpClient.rb190
-rw-r--r--lib/soap/parser.rb251
-rw-r--r--lib/soap/processor.rb66
-rw-r--r--lib/soap/property.rb333
-rw-r--r--lib/soap/rpc/cgistub.rb206
-rw-r--r--lib/soap/rpc/driver.rb254
-rw-r--r--lib/soap/rpc/element.rb325
-rw-r--r--lib/soap/rpc/httpserver.rb129
-rw-r--r--lib/soap/rpc/proxy.rb497
-rw-r--r--lib/soap/rpc/router.rb594
-rw-r--r--lib/soap/rpc/rpc.rb25
-rw-r--r--lib/soap/rpc/soaplet.rb162
-rw-r--r--lib/soap/rpc/standaloneServer.rb43
-rw-r--r--lib/soap/soap.rb140
-rw-r--r--lib/soap/streamHandler.rb229
-rw-r--r--lib/soap/wsdlDriver.rb575
-rw-r--r--lib/sync.rb328
-rw-r--r--lib/tempfile.rb368
-rw-r--r--lib/test/unit.rb902
-rw-r--r--lib/test/unit/assertionfailederror.rb14
-rw-r--r--lib/test/unit/assertions.rb780
-rw-r--r--lib/test/unit/autorunner.rb204
-rw-r--r--lib/test/unit/collector.rb43
-rw-r--r--lib/test/unit/collector/dir.rb92
-rw-r--r--lib/test/unit/collector/objectspace.rb34
-rw-r--r--lib/test/unit/error.rb56
-rw-r--r--lib/test/unit/failure.rb51
-rw-r--r--lib/test/unit/parallel.rb161
-rw-r--r--lib/test/unit/testcase.rb147
-rw-r--r--lib/test/unit/testresult.rb80
-rw-r--r--lib/test/unit/testsuite.rb76
-rw-r--r--lib/test/unit/ui/console/testrunner.rb127
-rw-r--r--lib/test/unit/ui/fox/testrunner.rb268
-rw-r--r--lib/test/unit/ui/gtk/testrunner.rb416
-rw-r--r--lib/test/unit/ui/gtk2/testrunner.rb465
-rw-r--r--lib/test/unit/ui/testrunnermediator.rb68
-rw-r--r--lib/test/unit/ui/testrunnerutilities.rb46
-rw-r--r--lib/test/unit/ui/tk/testrunner.rb260
-rw-r--r--lib/test/unit/util/backtracefilter.rb40
-rw-r--r--lib/test/unit/util/observable.rb90
-rw-r--r--lib/test/unit/util/procwrapper.rb48
-rw-r--r--lib/thread.rb315
-rw-r--r--lib/thwait.rb95
-rw-r--r--lib/time.rb514
-rw-r--r--lib/timeout.rb151
-rw-r--r--lib/tmpdir.rb148
-rw-r--r--lib/tracer.rb247
-rw-r--r--lib/tsort.rb68
-rw-r--r--lib/ubygems.rb10
-rw-r--r--lib/un.rb203
-rw-r--r--lib/uri.rb95
-rw-r--r--lib/uri/common.rb858
-rw-r--r--lib/uri/ftp.rb170
-rw-r--r--lib/uri/generic.rb813
-rw-r--r--lib/uri/http.rb69
-rw-r--r--lib/uri/https.rb10
-rw-r--r--lib/uri/ldap.rb80
-rw-r--r--lib/uri/ldaps.rb20
-rw-r--r--lib/uri/mailto.rb89
-rw-r--r--lib/weakref.rb100
-rw-r--r--lib/webrick.rb202
-rw-r--r--lib/webrick/accesslog.rb94
-rw-r--r--lib/webrick/cgi.rb57
-rw-r--r--lib/webrick/compat.rb20
-rw-r--r--lib/webrick/config.rb32
-rw-r--r--lib/webrick/cookie.rb6
-rw-r--r--lib/webrick/htmlutils.rb5
-rw-r--r--lib/webrick/httpauth.rb56
-rw-r--r--lib/webrick/httpauth/authenticator.rb49
-rw-r--r--lib/webrick/httpauth/basicauth.rb45
-rw-r--r--lib/webrick/httpauth/digestauth.rb75
-rw-r--r--lib/webrick/httpauth/htdigest.rb39
-rw-r--r--lib/webrick/httpauth/htgroup.rb32
-rw-r--r--lib/webrick/httpauth/htpasswd.rb42
-rw-r--r--lib/webrick/httpauth/userdb.rb31
-rw-r--r--lib/webrick/httpproxy.rb269
-rw-r--r--lib/webrick/httprequest.rb178
-rw-r--r--lib/webrick/httpresponse.rb120
-rw-r--r--lib/webrick/https.rb5
-rw-r--r--lib/webrick/httpserver.rb66
-rw-r--r--lib/webrick/httpservlet/abstract.rb94
-rw-r--r--lib/webrick/httpservlet/cgi_runner.rb9
-rw-r--r--lib/webrick/httpservlet/cgihandler.rb40
-rw-r--r--lib/webrick/httpservlet/erbhandler.rb47
-rw-r--r--lib/webrick/httpservlet/filehandler.rb126
-rw-r--r--lib/webrick/httpservlet/prochandler.rb8
-rw-r--r--lib/webrick/httpstatus.rb172
-rw-r--r--lib/webrick/httputils.rb41
-rw-r--r--lib/webrick/httpversion.rb2
-rw-r--r--lib/webrick/log.rb56
-rw-r--r--lib/webrick/server.rb28
-rw-r--r--lib/webrick/ssl.rb13
-rw-r--r--lib/webrick/utils.rb151
-rw-r--r--lib/webrick/version.rb2
-rw-r--r--lib/wsdl/binding.rb65
-rw-r--r--lib/wsdl/data.rb64
-rw-r--r--lib/wsdl/definitions.rb250
-rw-r--r--lib/wsdl/documentation.rb32
-rw-r--r--lib/wsdl/import.rb80
-rw-r--r--lib/wsdl/importer.rb38
-rw-r--r--lib/wsdl/info.rb39
-rw-r--r--lib/wsdl/message.rb54
-rw-r--r--lib/wsdl/operation.rb130
-rw-r--r--lib/wsdl/operationBinding.rb108
-rw-r--r--lib/wsdl/param.rb85
-rw-r--r--lib/wsdl/parser.rb163
-rw-r--r--lib/wsdl/part.rb52
-rw-r--r--lib/wsdl/port.rb84
-rw-r--r--lib/wsdl/portType.rb73
-rw-r--r--lib/wsdl/service.rb61
-rw-r--r--lib/wsdl/soap/address.rb40
-rw-r--r--lib/wsdl/soap/binding.rb49
-rw-r--r--lib/wsdl/soap/body.rb56
-rw-r--r--lib/wsdl/soap/cgiStubCreator.rb76
-rw-r--r--lib/wsdl/soap/classDefCreator.rb314
-rw-r--r--lib/wsdl/soap/classDefCreatorSupport.rb126
-rw-r--r--lib/wsdl/soap/clientSkeltonCreator.rb78
-rw-r--r--lib/wsdl/soap/complexType.rb161
-rw-r--r--lib/wsdl/soap/data.rb42
-rw-r--r--lib/wsdl/soap/definitions.rb149
-rw-r--r--lib/wsdl/soap/driverCreator.rb95
-rw-r--r--lib/wsdl/soap/element.rb28
-rw-r--r--lib/wsdl/soap/fault.rb56
-rw-r--r--lib/wsdl/soap/header.rb86
-rw-r--r--lib/wsdl/soap/headerfault.rb56
-rw-r--r--lib/wsdl/soap/mappingRegistryCreator.rb92
-rw-r--r--lib/wsdl/soap/methodDefCreator.rb228
-rw-r--r--lib/wsdl/soap/operation.rb122
-rw-r--r--lib/wsdl/soap/servantSkeltonCreator.rb67
-rw-r--r--lib/wsdl/soap/standaloneServerStubCreator.rb85
-rw-r--r--lib/wsdl/soap/wsdl2ruby.rb176
-rw-r--r--lib/wsdl/types.rb43
-rw-r--r--lib/wsdl/wsdl.rb23
-rw-r--r--lib/wsdl/xmlSchema/all.rb69
-rw-r--r--lib/wsdl/xmlSchema/annotation.rb34
-rw-r--r--lib/wsdl/xmlSchema/any.rb56
-rw-r--r--lib/wsdl/xmlSchema/attribute.rb127
-rw-r--r--lib/wsdl/xmlSchema/choice.rb69
-rw-r--r--lib/wsdl/xmlSchema/complexContent.rb92
-rw-r--r--lib/wsdl/xmlSchema/complexType.rb139
-rw-r--r--lib/wsdl/xmlSchema/content.rb96
-rw-r--r--lib/wsdl/xmlSchema/data.rb80
-rw-r--r--lib/wsdl/xmlSchema/element.rb154
-rw-r--r--lib/wsdl/xmlSchema/enumeration.rb36
-rw-r--r--lib/wsdl/xmlSchema/import.rb65
-rw-r--r--lib/wsdl/xmlSchema/importer.rb87
-rw-r--r--lib/wsdl/xmlSchema/include.rb54
-rw-r--r--lib/wsdl/xmlSchema/length.rb35
-rw-r--r--lib/wsdl/xmlSchema/parser.rb166
-rw-r--r--lib/wsdl/xmlSchema/pattern.rb36
-rw-r--r--lib/wsdl/xmlSchema/schema.rb143
-rw-r--r--lib/wsdl/xmlSchema/sequence.rb69
-rw-r--r--lib/wsdl/xmlSchema/simpleContent.rb65
-rw-r--r--lib/wsdl/xmlSchema/simpleExtension.rb54
-rw-r--r--lib/wsdl/xmlSchema/simpleRestriction.rb73
-rw-r--r--lib/wsdl/xmlSchema/simpleType.rb73
-rw-r--r--lib/wsdl/xmlSchema/unique.rb34
-rw-r--r--lib/wsdl/xmlSchema/xsd2ruby.rb107
-rw-r--r--lib/xmlrpc/.document1
-rw-r--r--lib/xmlrpc/README.rdoc300
-rw-r--r--lib/xmlrpc/base64.rb24
-rw-r--r--lib/xmlrpc/client.rb177
-rw-r--r--lib/xmlrpc/config.rb10
-rw-r--r--lib/xmlrpc/create.rb203
-rw-r--r--lib/xmlrpc/datetime.rb22
-rw-r--r--lib/xmlrpc/httpserver.rb50
-rw-r--r--lib/xmlrpc/marshal.rb8
-rw-r--r--lib/xmlrpc/parser.rb435
-rw-r--r--lib/xmlrpc/server.rb212
-rw-r--r--lib/xmlrpc/utils.rb36
-rw-r--r--lib/xsd/charset.rb187
-rw-r--r--lib/xsd/codegen.rb12
-rw-r--r--lib/xsd/codegen/classdef.rb203
-rw-r--r--lib/xsd/codegen/commentdef.rb34
-rw-r--r--lib/xsd/codegen/gensupport.rb166
-rw-r--r--lib/xsd/codegen/methoddef.rb63
-rw-r--r--lib/xsd/codegen/moduledef.rb191
-rw-r--r--lib/xsd/datatypes.rb1269
-rw-r--r--lib/xsd/datatypes1999.rb20
-rw-r--r--lib/xsd/iconvcharset.rb33
-rw-r--r--lib/xsd/mapping.rb42
-rw-r--r--lib/xsd/namedelements.rb95
-rw-r--r--lib/xsd/ns.rb140
-rw-r--r--lib/xsd/qname.rb78
-rw-r--r--lib/xsd/xmlparser.rb61
-rw-r--r--lib/xsd/xmlparser/parser.rb96
-rw-r--r--lib/xsd/xmlparser/rexmlparser.rb54
-rw-r--r--lib/xsd/xmlparser/xmlparser.rb50
-rw-r--r--lib/xsd/xmlparser/xmlscanner.rb147
-rw-r--r--lib/yaml.rb466
-rw-r--r--lib/yaml/baseemitter.rb247
-rw-r--r--lib/yaml/basenode.rb216
-rw-r--r--lib/yaml/constants.rb45
-rw-r--r--lib/yaml/dbm.rb129
-rw-r--r--lib/yaml/encoding.rb33
-rw-r--r--lib/yaml/error.rb34
-rw-r--r--lib/yaml/loader.rb14
-rw-r--r--lib/yaml/rubytypes.rb408
-rw-r--r--lib/yaml/store.rb65
-rw-r--r--lib/yaml/stream.rb40
-rw-r--r--lib/yaml/stringio.rb83
-rw-r--r--lib/yaml/syck.rb19
-rw-r--r--lib/yaml/tag.rb91
-rw-r--r--lib/yaml/types.rb194
-rw-r--r--lib/yaml/yamlnode.rb54
-rw-r--r--lib/yaml/ypath.rb52
-rw-r--r--load.c792
-rw-r--r--main.c48
-rw-r--r--man/erb.1157
-rw-r--r--man/goruby.139
-rw-r--r--man/irb.1173
-rw-r--r--man/rake.1169
-rw-r--r--man/ri.1180
-rw-r--r--man/ruby.1511
-rw-r--r--marshal.c1316
-rw-r--r--math.c664
-rwxr-xr-xmdoc2man.rb465
-rw-r--r--method.h105
-rw-r--r--misc/README7
-rw-r--r--misc/inf-ruby.el247
-rw-r--r--misc/rb_optparse.bash20
-rwxr-xr-xmisc/rb_optparse.zsh38
-rw-r--r--misc/rdebug.el136
-rw-r--r--misc/rdoc-mode.el130
-rw-r--r--misc/ruby-electric.el95
-rw-r--r--misc/ruby-mode.el1807
-rw-r--r--misc/ruby-style.el78
-rw-r--r--misc/rubydb3x.el42
-rw-r--r--missing.h142
-rw-r--r--missing/acosh.c21
-rw-r--r--missing/alloca.c9
-rw-r--r--missing/cbrt.c11
-rw-r--r--missing/close.c72
-rw-r--r--missing/crypt.c123
-rw-r--r--missing/dup2.c5
-rw-r--r--missing/erf.c13
-rw-r--r--missing/ffs.c49
-rw-r--r--missing/finite.c5
-rw-r--r--missing/flock.c23
-rw-r--r--missing/hypot.c4
-rw-r--r--missing/isinf.c24
-rw-r--r--missing/isnan.c10
-rw-r--r--missing/langinfo.c148
-rw-r--r--missing/lgamma_r.c80
-rw-r--r--missing/memcmp.c10
-rw-r--r--missing/memmove.c18
-rw-r--r--missing/os2.c29
-rw-r--r--missing/setproctitle.c160
-rw-r--r--missing/signbit.c19
-rw-r--r--missing/strcasecmp.c16
-rw-r--r--missing/strchr.c22
-rw-r--r--missing/strerror.c5
-rw-r--r--missing/strftime.c907
-rw-r--r--missing/strlcat.c74
-rw-r--r--missing/strlcpy.c70
-rw-r--r--missing/strncasecmp.c21
-rw-r--r--missing/strstr.c15
-rw-r--r--missing/strtod.c271
-rw-r--r--missing/strtol.c10
-rw-r--r--missing/strtoul.c184
-rw-r--r--missing/tgamma.c92
-rw-r--r--missing/vsnprintf.c1135
-rw-r--r--missing/x68.c40
-rw-r--r--missing/x86_64-chkstk.s10
-rw-r--r--mkconfig.rb164
-rw-r--r--node.c921
-rw-r--r--node.h293
-rw-r--r--numeric.c2607
-rw-r--r--object.c2309
-rw-r--r--pack.c1900
-rw-r--r--parse.y8805
-rw-r--r--prec.c141
-rw-r--r--prelude.rb31
-rw-r--r--proc.c2251
-rw-r--r--process.c4518
-rw-r--r--random.c1331
-rw-r--r--range.c913
-rw-r--r--rational.c2409
-rw-r--r--re.c3542
-rw-r--r--re.h42
-rw-r--r--regcomp.c6321
-rw-r--r--regenc.c933
-rw-r--r--regenc.h219
-rw-r--r--regerror.c397
-rw-r--r--regex.c4648
-rw-r--r--regex.h221
-rw-r--r--regexec.c3826
-rw-r--r--regint.h850
-rw-r--r--regparse.c5686
-rw-r--r--regparse.h362
-rw-r--r--regsyntax.c315
-rw-r--r--ruby.1351
-rw-r--r--ruby.c1996
-rw-r--r--ruby.h734
-rw-r--r--rubyio.h88
-rw-r--r--rubysig.h105
-rw-r--r--rubytest.rb49
-rwxr-xr-xrunruby.rb59
-rw-r--r--safe.c135
-rw-r--r--sample/README13
-rw-r--r--sample/biorhythm.rb136
-rw-r--r--sample/cal.rb84
-rw-r--r--sample/cbreak.rb4
-rw-r--r--sample/coverage.rb62
-rw-r--r--sample/dbmtest.rb14
-rw-r--r--sample/drb/darray.rb2
-rw-r--r--sample/drb/darrayc.rb16
-rw-r--r--sample/drb/dbiff.rb4
-rw-r--r--sample/drb/dchatc.rb4
-rw-r--r--sample/drb/dchats.rb2
-rw-r--r--sample/drb/dhasen.rb4
-rw-r--r--sample/drb/dhasenc.rb3
-rw-r--r--sample/drb/dlogc.rb2
-rw-r--r--sample/drb/dlogd.rb2
-rw-r--r--sample/drb/dqin.rb2
-rw-r--r--sample/drb/dqout.rb2
-rw-r--r--sample/drb/dqueue.rb2
-rw-r--r--sample/drb/drbc.rb2
-rw-r--r--sample/drb/drbch.rb2
-rw-r--r--sample/drb/drbm.rb6
-rw-r--r--sample/drb/drbmc.rb2
-rw-r--r--sample/drb/drbs-acl.rb6
-rw-r--r--sample/drb/drbs.rb4
-rw-r--r--sample/drb/extserv_test.rb12
-rw-r--r--sample/drb/holderc.rb2
-rw-r--r--sample/drb/holders.rb6
-rw-r--r--sample/drb/http0.rb6
-rw-r--r--sample/drb/http0serv.rb12
-rw-r--r--sample/drb/name.rb16
-rw-r--r--sample/drb/namec.rb2
-rw-r--r--sample/drb/old_tuplespace.rb6
-rw-r--r--sample/drb/ring_echo.rb2
-rw-r--r--sample/drb/simpletuple.rb6
-rw-r--r--sample/drb/speedc.rb2
-rw-r--r--sample/drb/speeds.rb4
-rw-r--r--sample/dualstack-httpd.rb4
-rw-r--r--sample/eval.rb2
-rw-r--r--sample/exyacc.rb32
-rw-r--r--sample/from.rb161
-rw-r--r--sample/fullpath.rb2
-rw-r--r--sample/getopts.test36
-rw-r--r--sample/goodfriday.rb48
-rw-r--r--sample/list.rb1
-rw-r--r--sample/list2.rb2
-rw-r--r--sample/list3.rb2
-rw-r--r--sample/mine.rb1
-rw-r--r--sample/mkproto.rb6
-rw-r--r--sample/mrshtest.rb13
-rw-r--r--sample/occur.rb4
-rw-r--r--sample/occur2.rb11
-rw-r--r--sample/openssl/c_rehash.rb4
-rw-r--r--sample/openssl/cert_store_view.rb911
-rw-r--r--sample/openssl/certstore.rb2
-rw-r--r--sample/openssl/cipher.rb73
-rw-r--r--sample/openssl/echo_cli.rb21
-rw-r--r--sample/openssl/echo_svr.rb15
-rw-r--r--sample/openssl/gen_csr.rb13
-rw-r--r--sample/openssl/smime_read.rb10
-rw-r--r--sample/openssl/smime_write.rb12
-rw-r--r--sample/openssl/wget.rb17
-rwxr-xr-x[-rw-r--r--]sample/optparse/opttest.rb30
-rw-r--r--sample/philos.rb2
-rw-r--r--sample/pty/expect_sample.rb48
-rw-r--r--sample/pty/script.rb37
-rw-r--r--sample/pty/shl.rb (renamed from ext/pty/shl.rb)0
-rw-r--r--sample/rdoc/markup/rdoc2latex.rb15
-rw-r--r--sample/rdoc/markup/sample.rb40
-rw-r--r--sample/regx.rb23
-rw-r--r--sample/ripper/ruby2html.rb112
-rw-r--r--sample/ripper/strip-comment.rb19
-rwxr-xr-xsample/rss/blend.rb6
-rwxr-xr-xsample/rss/convert.rb2
-rwxr-xr-x[-rw-r--r--]sample/rss/list_description.rb17
-rwxr-xr-xsample/rss/re_read.rb14
-rwxr-xr-x[-rw-r--r--]sample/rss/rss_recent.rb24
-rw-r--r--sample/svr.rb4
-rw-r--r--sample/test.rb826
-rw-r--r--sample/time.rb16
-rw-r--r--sample/timeout.rb42
-rw-r--r--sample/trojan.rb2
-rw-r--r--sample/tsvr.rb2
-rw-r--r--sample/webrick/httpproxy.rb7
-rw-r--r--signal.c1021
-rw-r--r--siphash.c483
-rw-r--r--siphash.h48
-rw-r--r--sparc.c30
-rw-r--r--spec/README31
-rw-r--r--spec/default.mspec21
-rw-r--r--sprintf.c1048
-rw-r--r--st.c1196
-rw-r--r--st.h72
-rw-r--r--strftime.c1145
-rw-r--r--string.c7278
-rw-r--r--struct.c717
-rw-r--r--symbian/README.SYMBIAN93
-rw-r--r--symbian/configure.bat123
-rw-r--r--symbian/missing-aeabi.c18
-rw-r--r--symbian/missing-pips.c65
-rw-r--r--symbian/pre-build83
-rw-r--r--symbian/setup440
-rw-r--r--template/Doxyfile.tmpl267
-rw-r--r--template/encdb.h.tmpl83
-rwxr-xr-xtemplate/fake.rb.in47
-rw-r--r--template/id.h.tmpl141
-rw-r--r--template/insns.inc.tmpl20
-rw-r--r--template/insns_info.inc.tmpl83
-rw-r--r--template/known_errors.inc.tmpl14
-rw-r--r--template/minsns.inc.tmpl14
-rw-r--r--template/opt_sc.inc.tmpl32
-rw-r--r--template/optinsn.inc.tmpl30
-rw-r--r--template/optunifs.inc.tmpl35
-rw-r--r--template/ruby.pc.in44
-rw-r--r--template/transdb.h.tmpl59
-rw-r--r--template/vm.inc.tmpl29
-rw-r--r--template/vmtc.inc.tmpl18
-rw-r--r--template/yarvarch.en7
-rw-r--r--template/yarvarch.ja454
-rw-r--r--template/yasmdata.rb.tmpl20
-rw-r--r--test/-ext-/array/test_resize.rb29
-rw-r--r--test/-ext-/funcall/test_passing_block.rb22
-rw-r--r--test/-ext-/load/test_dot_dot.rb10
-rw-r--r--test/-ext-/old_thread_select/test_old_thread_select.rb99
-rw-r--r--test/-ext-/st/test_numhash.rb21
-rw-r--r--test/-ext-/string/test_cstr.rb17
-rw-r--r--test/-ext-/string/test_ellipsize.rb46
-rw-r--r--test/-ext-/string/test_enc_associate.rb12
-rw-r--r--test/-ext-/string/test_modify_expand.rb29
-rw-r--r--test/-ext-/string/test_set_len.rb25
-rw-r--r--test/-ext-/test_bug-3571.rb21
-rw-r--r--test/-ext-/test_bug-3662.rb10
-rw-r--r--test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb42
-rw-r--r--test/-ext-/win32/test_dln.rb13
-rw-r--r--test/-ext-/win32/test_fd_setsize.rb25
-rw-r--r--test/base64/test_base64.rb99
-rw-r--r--test/benchmark/test_benchmark.rb163
-rw-r--r--test/bigdecimal/test_bigdecimal.rb1310
-rw-r--r--test/bigdecimal/test_bigdecimal_util.rb43
-rw-r--r--test/bigdecimal/test_bigmath.rb63
-rw-r--r--test/bigdecimal/testbase.rb27
-rw-r--r--test/cgi/test_cgi_cookie.rb110
-rw-r--r--test/cgi/test_cgi_core.rb363
-rw-r--r--test/cgi/test_cgi_header.rb185
-rw-r--r--test/cgi/test_cgi_modruby.rb145
-rw-r--r--test/cgi/test_cgi_multipart.rb325
-rw-r--r--test/cgi/test_cgi_session.rb172
-rw-r--r--test/cgi/test_cgi_tag_helper.rb341
-rw-r--r--test/cgi/test_cgi_util.rb38
-rw-r--r--test/cgi/testdata/file1.html10
-rw-r--r--test/cgi/testdata/large.pngbin0 -> 156414 bytes-rw-r--r--test/cgi/testdata/small.pngbin0 -> 82 bytes-rw-r--r--test/coverage/test_coverage.rb64
-rw-r--r--test/csv/base.rb8
-rw-r--r--test/csv/line_endings.gzbin0 -> 59 bytes-rw-r--r--test/csv/test_csv.rb1753
-rwxr-xr-xtest/csv/test_csv_parsing.rb221
-rwxr-xr-xtest/csv/test_csv_writing.rb97
-rwxr-xr-xtest/csv/test_data_converters.rb263
-rwxr-xr-xtest/csv/test_encodings.rb339
-rwxr-xr-xtest/csv/test_features.rb274
-rwxr-xr-xtest/csv/test_headers.rb289
-rwxr-xr-xtest/csv/test_interface.rb337
-rwxr-xr-xtest/csv/test_row.rb313
-rwxr-xr-xtest/csv/test_serialization.rb158
-rwxr-xr-xtest/csv/test_table.rb420
-rw-r--r--test/csv/ts_all.rb21
-rw-r--r--test/date/test_date.rb144
-rw-r--r--test/date/test_date_arith.rb286
-rw-r--r--test/date/test_date_attr.rb112
-rw-r--r--test/date/test_date_base.rb442
-rw-r--r--test/date/test_date_compat.rb21
-rw-r--r--test/date/test_date_conv.rb137
-rw-r--r--test/date/test_date_marshal.rb29
-rw-r--r--test/date/test_date_new.rb271
-rw-r--r--test/date/test_date_parse.rb1097
-rw-r--r--test/date/test_date_strftime.rb401
-rw-r--r--test/date/test_date_strptime.rb486
-rw-r--r--test/date/test_switch_hitter.rb577
-rw-r--r--test/dbm/test_dbm.rb139
-rwxr-xr-x[-rw-r--r--]test/digest/test_digest.rb70
-rw-r--r--test/digest/test_digest_extend.rb157
-rw-r--r--test/digest/test_digest_hmac.rb2
-rw-r--r--test/dl/test_base.rb130
-rw-r--r--test/dl/test_callback.rb69
-rw-r--r--test/dl/test_cfunc.rb80
-rw-r--r--test/dl/test_cparser.rb13
-rw-r--r--test/dl/test_cptr.rb222
-rw-r--r--test/dl/test_dl2.rb155
-rw-r--r--test/dl/test_func.rb115
-rw-r--r--test/dl/test_handle.rb184
-rw-r--r--test/dl/test_import.rb164
-rw-r--r--test/dl/test_win32.rb54
-rw-r--r--test/drb/drbtest.rb94
-rw-r--r--test/drb/test_acl.rb2
-rw-r--r--test/drb/test_drb.rb59
-rw-r--r--test/drb/test_drbssl.rb8
-rw-r--r--test/drb/test_drbunix.rb8
-rw-r--r--test/drb/ut_eq.rb30
-rw-r--r--test/drb/ut_large.rb2
-rw-r--r--test/drb/ut_safe1.rb2
-rw-r--r--test/drb/ut_timerholder.rb2
-rw-r--r--test/erb/hello.erb4
-rw-r--r--test/erb/test_erb.rb430
-rw-r--r--test/erb/test_erb_m17n.rb123
-rw-r--r--test/etc/test_etc.rb110
-rw-r--r--test/fiddle/helper.rb111
-rw-r--r--test/fiddle/test_closure.rb84
-rw-r--r--test/fiddle/test_fiddle.rb32
-rw-r--r--test/fiddle/test_function.rb69
-rw-r--r--test/fileutils/clobber.rb91
-rw-r--r--test/fileutils/fileasserts.rb74
-rw-r--r--test/fileutils/test_dryrun.rb8
-rw-r--r--test/fileutils/test_fileutils.rb279
-rw-r--r--test/fileutils/test_nowrite.rb79
-rw-r--r--test/fileutils/test_verbose.rb2
-rw-r--r--test/gdbm/test_gdbm.rb168
-rw-r--r--test/iconv/test_basic.rb59
-rw-r--r--test/iconv/test_option.rb43
-rw-r--r--test/iconv/test_partial.rb41
-rw-r--r--test/iconv/utils.rb29
-rw-r--r--test/inlinetest.rb55
-rw-r--r--test/io/console/test_io_console.rb243
-rw-r--r--test/io/nonblock/test_flush.rb42
-rw-r--r--test/io/wait/test_io_wait.rb72
-rw-r--r--test/irb/test_completion.rb22
-rw-r--r--test/irb/test_option.rb12
-rw-r--r--test/json/fixtures/fail1.json1
-rw-r--r--test/json/fixtures/fail10.json1
-rw-r--r--test/json/fixtures/fail11.json1
-rw-r--r--test/json/fixtures/fail12.json1
-rw-r--r--test/json/fixtures/fail13.json1
-rw-r--r--test/json/fixtures/fail14.json1
-rw-r--r--test/json/fixtures/fail18.json1
-rw-r--r--test/json/fixtures/fail19.json1
-rw-r--r--test/json/fixtures/fail2.json1
-rw-r--r--test/json/fixtures/fail20.json1
-rw-r--r--test/json/fixtures/fail21.json1
-rw-r--r--test/json/fixtures/fail22.json1
-rw-r--r--test/json/fixtures/fail23.json1
-rw-r--r--test/json/fixtures/fail24.json1
-rw-r--r--test/json/fixtures/fail25.json1
-rw-r--r--test/json/fixtures/fail27.json2
-rw-r--r--test/json/fixtures/fail28.json2
-rw-r--r--test/json/fixtures/fail3.json1
-rw-r--r--test/json/fixtures/fail4.json1
-rw-r--r--test/json/fixtures/fail5.json1
-rw-r--r--test/json/fixtures/fail6.json1
-rw-r--r--test/json/fixtures/fail7.json1
-rw-r--r--test/json/fixtures/fail8.json1
-rw-r--r--test/json/fixtures/fail9.json1
-rw-r--r--test/json/fixtures/pass1.json56
-rw-r--r--test/json/fixtures/pass15.json1
-rw-r--r--test/json/fixtures/pass16.json1
-rw-r--r--test/json/fixtures/pass17.json1
-rw-r--r--test/json/fixtures/pass2.json1
-rw-r--r--test/json/fixtures/pass26.json1
-rw-r--r--test/json/fixtures/pass3.json6
-rw-r--r--test/json/setup_variant.rb11
-rwxr-xr-xtest/json/test_json.rb460
-rwxr-xr-xtest/json/test_json_addition.rb167
-rw-r--r--test/json/test_json_encoding.rb65
-rwxr-xr-xtest/json/test_json_fixtures.rb35
-rwxr-xr-xtest/json/test_json_generate.rb213
-rw-r--r--test/json/test_json_string_matching.rb40
-rwxr-xr-xtest/json/test_json_unicode.rb72
-rw-r--r--test/logger/test_logger.rb162
-rw-r--r--test/matrix/test_matrix.rb426
-rw-r--r--test/matrix/test_vector.rb134
-rw-r--r--test/minitest/test_minitest_benchmark.rb119
-rw-r--r--test/minitest/test_minitest_mock.rb154
-rw-r--r--test/minitest/test_minitest_spec.rb397
-rw-r--r--test/minitest/test_minitest_unit.rb1454
-rw-r--r--test/misc/test_ruby_mode.rb142
-rw-r--r--test/mkmf/base.rb129
-rw-r--r--test/mkmf/test_convertible.rb32
-rw-r--r--test/mkmf/test_find_executable.rb50
-rw-r--r--test/mkmf/test_flags.rb35
-rw-r--r--test/mkmf/test_signedness.rb27
-rw-r--r--test/mkmf/test_sizeof.rb45
-rw-r--r--test/monitor/test_monitor.rb31
-rw-r--r--test/net/http/test_buffered_io.rb17
-rw-r--r--test/net/http/test_http.rb555
-rw-r--r--test/net/http/test_httpheader.rb2
-rw-r--r--test/net/http/test_httpresponse.rb40
-rw-r--r--test/net/http/test_https.rb129
-rw-r--r--test/net/http/test_https_proxy.rb11
-rw-r--r--test/net/http/utils.rb112
-rw-r--r--test/net/imap/cacert.pem60
-rw-r--r--test/net/imap/server.crt61
-rw-r--r--test/net/imap/server.key15
-rw-r--r--test/net/imap/test_imap.rb505
-rw-r--r--test/net/imap/test_imap_response_parser.rb119
-rw-r--r--test/net/pop/test_pop.rb132
-rw-r--r--test/net/smtp/test_response.rb99
-rw-r--r--test/net/smtp/test_smtp.rb16
-rw-r--r--test/net/smtp/test_ssl_socket.rb91
-rw-r--r--test/nkf/test_kconv.rb104
-rw-r--r--test/nkf/test_nkf.rb6
-rw-r--r--test/objspace/test_objspace.rb55
-rw-r--r--test/open-uri/test_open-uri.rb730
-rw-r--r--test/open-uri/test_ssl.rb314
-rw-r--r--test/openssl/ssl_server.rb2
-rw-r--r--test/openssl/test_asn1.rb406
-rw-r--r--test/openssl/test_bn.rb23
-rw-r--r--test/openssl/test_buffering.rb88
-rw-r--r--test/openssl/test_cipher.rb22
-rw-r--r--test/openssl/test_config.rb288
-rw-r--r--test/openssl/test_digest.rb42
-rw-r--r--test/openssl/test_engine.rb15
-rw-r--r--test/openssl/test_hmac.rb28
-rw-r--r--test/openssl/test_ns_spki.rb11
-rw-r--r--test/openssl/test_ocsp.rb47
-rw-r--r--test/openssl/test_pair.rb124
-rw-r--r--test/openssl/test_pkcs12.rb209
-rw-r--r--test/openssl/test_pkcs7.rb38
-rw-r--r--test/openssl/test_pkey_dh.rb72
-rw-r--r--test/openssl/test_pkey_dsa.rb224
-rw-r--r--test/openssl/test_pkey_ec.rb182
-rw-r--r--test/openssl/test_pkey_rsa.rb207
-rw-r--r--test/openssl/test_ssl.rb389
-rw-r--r--test/openssl/test_ssl_session.rb327
-rw-r--r--test/openssl/test_x509cert.rb109
-rw-r--r--test/openssl/test_x509crl.rb29
-rw-r--r--test/openssl/test_x509ext.rb7
-rw-r--r--test/openssl/test_x509name.rb114
-rw-r--r--test/openssl/test_x509req.rb42
-rw-r--r--test/openssl/test_x509store.rb49
-rw-r--r--test/openssl/utils.rb188
-rw-r--r--test/optparse/test_bash_completion.rb42
-rw-r--r--test/optparse/test_getopts.rb34
-rw-r--r--test/optparse/test_noarg.rb14
-rw-r--r--test/optparse/test_optarg.rb4
-rw-r--r--test/optparse/test_optparse.rb19
-rw-r--r--test/optparse/test_placearg.rb13
-rw-r--r--test/optparse/test_reqarg.rb22
-rw-r--r--test/optparse/test_summary.rb38
-rw-r--r--test/optparse/test_zsh_completion.rb22
-rw-r--r--test/ostruct/test_ostruct.rb53
-rw-r--r--test/pathname/test_pathname.rb879
-rw-r--r--test/profile_test_all.rb52
-rw-r--r--test/psych/helper.rb63
-rw-r--r--test/psych/json/test_stream.rb109
-rw-r--r--test/psych/nodes/test_enumerable.rb43
-rw-r--r--test/psych/test_alias_and_anchor.rb96
-rw-r--r--test/psych/test_array.rb57
-rw-r--r--test/psych/test_boolean.rb36
-rw-r--r--test/psych/test_class.rb36
-rw-r--r--test/psych/test_coder.rb184
-rw-r--r--test/psych/test_date_time.rb17
-rw-r--r--test/psych/test_deprecated.rb210
-rw-r--r--test/psych/test_document.rb46
-rw-r--r--test/psych/test_emitter.rb94
-rw-r--r--test/psych/test_encoding.rb268
-rw-r--r--test/psych/test_engine_manager.rb57
-rw-r--r--test/psych/test_exception.rb130
-rw-r--r--test/psych/test_hash.rb44
-rw-r--r--test/psych/test_json_tree.rb65
-rw-r--r--test/psych/test_merge_keys.rb81
-rw-r--r--test/psych/test_nil.rb18
-rw-r--r--test/psych/test_null.rb19
-rw-r--r--test/psych/test_numeric.rb25
-rw-r--r--test/psych/test_object.rb44
-rw-r--r--test/psych/test_object_references.rb67
-rw-r--r--test/psych/test_omap.rb75
-rw-r--r--test/psych/test_parser.rb332
-rw-r--r--test/psych/test_psych.rb168
-rw-r--r--test/psych/test_scalar.rb11
-rw-r--r--test/psych/test_scalar_scanner.rb91
-rw-r--r--test/psych/test_serialize_subclasses.rb38
-rw-r--r--test/psych/test_set.rb49
-rw-r--r--test/psych/test_stream.rb93
-rw-r--r--test/psych/test_string.rb95
-rw-r--r--test/psych/test_struct.rb51
-rw-r--r--test/psych/test_symbol.rb17
-rw-r--r--test/psych/test_tainted.rb130
-rw-r--r--test/psych/test_to_yaml_properties.rb63
-rw-r--r--test/psych/test_tree_builder.rb79
-rw-r--r--test/psych/test_yaml.rb1269
-rw-r--r--test/psych/visitors/test_depth_first.rb49
-rw-r--r--test/psych/visitors/test_emitter.rb144
-rw-r--r--test/psych/visitors/test_to_ruby.rb325
-rw-r--r--test/psych/visitors/test_yaml_tree.rb155
-rw-r--r--test/rake/file_creation.rb34
-rw-r--r--test/rake/helper.rb492
-rw-r--r--test/rake/test_rake.rb40
-rw-r--r--test/rake/test_rake_application.rb489
-rw-r--r--test/rake/test_rake_application_options.rb335
-rw-r--r--test/rake/test_rake_clean.rb14
-rw-r--r--test/rake/test_rake_definitions.rb80
-rw-r--r--test/rake/test_rake_directory_task.rb46
-rw-r--r--test/rake/test_rake_dsl.rb77
-rw-r--r--test/rake/test_rake_early_time.rb31
-rw-r--r--test/rake/test_rake_extension.rb59
-rw-r--r--test/rake/test_rake_file_creation_task.rb56
-rw-r--r--test/rake/test_rake_file_list.rb628
-rw-r--r--test/rake/test_rake_file_list_path_map.rb8
-rw-r--r--test/rake/test_rake_file_task.rb102
-rw-r--r--test/rake/test_rake_file_utils.rb305
-rw-r--r--test/rake/test_rake_ftp_file.rb59
-rw-r--r--test/rake/test_rake_functional.rb450
-rw-r--r--test/rake/test_rake_invocation_chain.rb52
-rw-r--r--test/rake/test_rake_makefile_loader.rb44
-rw-r--r--test/rake/test_rake_multi_task.rb51
-rw-r--r--test/rake/test_rake_name_space.rb43
-rw-r--r--test/rake/test_rake_package_task.rb79
-rw-r--r--test/rake/test_rake_path_map.rb157
-rw-r--r--test/rake/test_rake_path_map_explode.rb34
-rw-r--r--test/rake/test_rake_path_map_partial.rb18
-rw-r--r--test/rake/test_rake_pseudo_status.rb21
-rw-r--r--test/rake/test_rake_rake_test_loader.rb21
-rw-r--r--test/rake/test_rake_rdoc_task.rb83
-rw-r--r--test/rake/test_rake_require.rb40
-rw-r--r--test/rake/test_rake_rules.rb327
-rw-r--r--test/rake/test_rake_task.rb267
-rw-r--r--test/rake/test_rake_task_argument_parsing.rb103
-rw-r--r--test/rake/test_rake_task_arguments.rb88
-rw-r--r--test/rake/test_rake_task_lib.rb9
-rw-r--r--test/rake/test_rake_task_manager.rb157
-rw-r--r--test/rake/test_rake_task_manager_argument_resolution.rb36
-rw-r--r--test/rake/test_rake_task_with_arguments.rb173
-rw-r--r--test/rake/test_rake_test_task.rb120
-rw-r--r--test/rake/test_rake_top_level_functions.rb111
-rw-r--r--test/rake/test_rake_win32.rb72
-rw-r--r--test/rake/test_sys.rb20
-rw-r--r--test/rdoc/README1
-rw-r--r--test/rdoc/binary.datbin0 -> 1024 bytes-rw-r--r--test/rdoc/hidden.zip.txt1
-rw-r--r--test/rdoc/test.ja.large.rdoc3
-rw-r--r--test/rdoc/test.ja.rdoc10
-rw-r--r--test/rdoc/test.ja.txt8
-rw-r--r--test/rdoc/test.txt1
-rw-r--r--test/rdoc/test_attribute_manager.rb120
-rw-r--r--test/rdoc/test_rdoc_alias.rb13
-rw-r--r--test/rdoc/test_rdoc_any_method.rb263
-rw-r--r--test/rdoc/test_rdoc_attr.rb123
-rw-r--r--test/rdoc/test_rdoc_class_module.rb718
-rw-r--r--test/rdoc/test_rdoc_code_object.rb290
-rw-r--r--test/rdoc/test_rdoc_constant.rb15
-rw-r--r--test/rdoc/test_rdoc_context.rb695
-rw-r--r--test/rdoc/test_rdoc_context_section.rb54
-rw-r--r--test/rdoc/test_rdoc_cross_reference.rb154
-rw-r--r--test/rdoc/test_rdoc_encoding.rb191
-rw-r--r--test/rdoc/test_rdoc_generator_darkfish.rb125
-rw-r--r--test/rdoc/test_rdoc_generator_ri.rb87
-rw-r--r--test/rdoc/test_rdoc_include.rb96
-rw-r--r--test/rdoc/test_rdoc_markup.rb91
-rw-r--r--test/rdoc/test_rdoc_markup_attribute_manager.rb240
-rw-r--r--test/rdoc/test_rdoc_markup_document.rb152
-rw-r--r--test/rdoc/test_rdoc_markup_formatter.rb57
-rw-r--r--test/rdoc/test_rdoc_markup_indented_paragraph.rb40
-rw-r--r--test/rdoc/test_rdoc_markup_paragraph.rb21
-rw-r--r--test/rdoc/test_rdoc_markup_parser.rb1486
-rw-r--r--test/rdoc/test_rdoc_markup_pre_process.rb410
-rw-r--r--test/rdoc/test_rdoc_markup_raw.rb27
-rw-r--r--test/rdoc/test_rdoc_markup_to_ansi.rb332
-rw-r--r--test/rdoc/test_rdoc_markup_to_bs.rb345
-rw-r--r--test/rdoc/test_rdoc_markup_to_html.rb355
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_crossref.rb110
-rw-r--r--test/rdoc/test_rdoc_markup_to_rdoc.rb341
-rw-r--r--test/rdoc/test_rdoc_markup_to_tt_only.rb229
-rw-r--r--test/rdoc/test_rdoc_method_attr.rb122
-rw-r--r--test/rdoc/test_rdoc_normal_class.rb23
-rw-r--r--test/rdoc/test_rdoc_normal_module.rb37
-rw-r--r--test/rdoc/test_rdoc_options.rb392
-rw-r--r--test/rdoc/test_rdoc_parser.rb83
-rw-r--r--test/rdoc/test_rdoc_parser_c.rb1436
-rw-r--r--test/rdoc/test_rdoc_parser_ruby.rb2477
-rw-r--r--test/rdoc/test_rdoc_parser_simple.rb99
-rw-r--r--test/rdoc/test_rdoc_rdoc.rb209
-rw-r--r--test/rdoc/test_rdoc_require.rb25
-rw-r--r--test/rdoc/test_rdoc_ri_driver.rb1061
-rw-r--r--test/rdoc/test_rdoc_ri_paths.rb43
-rw-r--r--test/rdoc/test_rdoc_ri_store.rb473
-rw-r--r--test/rdoc/test_rdoc_ruby_lex.rb23
-rw-r--r--test/rdoc/test_rdoc_rubygems_hook.rb201
-rw-r--r--test/rdoc/test_rdoc_single_class.rb12
-rw-r--r--test/rdoc/test_rdoc_stats.rb543
-rw-r--r--test/rdoc/test_rdoc_task.rb111
-rw-r--r--test/rdoc/test_rdoc_text.rb397
-rw-r--r--test/rdoc/test_rdoc_top_level.rb240
-rw-r--r--test/rdoc/xref_data.rb76
-rw-r--r--test/rdoc/xref_test_case.rb71
-rw-r--r--test/readline/test_readline.rb415
-rw-r--r--test/readline/test_readline_history.rb327
-rw-r--r--test/resolv/test_addr.rb16
-rw-r--r--test/resolv/test_dns.rb121
-rw-r--r--test/rexml/data/LostineRiver.kml.gzbin0 -> 50154 bytes-rw-r--r--test/rexml/data/ProductionSupport.xml29
-rw-r--r--test/rexml/data/axis.xml25
-rw-r--r--test/rexml/data/bad.xml5
-rw-r--r--test/rexml/data/basic.xml11
-rw-r--r--test/rexml/data/basicupdate.xml47
-rw-r--r--test/rexml/data/broken.rss20
-rw-r--r--test/rexml/data/contents.xml70
-rw-r--r--test/rexml/data/dash.xml12
-rw-r--r--test/rexml/data/defaultNamespace.xml6
-rw-r--r--test/rexml/data/doctype_test.xml34
-rw-r--r--test/rexml/data/documentation.xml542
-rw-r--r--test/rexml/data/euc.xml296
-rw-r--r--test/rexml/data/evaluate.xml28
-rw-r--r--test/rexml/data/fibo.xml29
-rw-r--r--test/rexml/data/foo.xml10
-rw-r--r--test/rexml/data/google.2.xml156
-rw-r--r--test/rexml/data/id.xml21
-rw-r--r--test/rexml/data/iso8859-1.xml4
-rw-r--r--test/rexml/data/jaxen24.xml2
-rw-r--r--test/rexml/data/jaxen3.xml15
-rw-r--r--test/rexml/data/lang.xml11
-rw-r--r--test/rexml/data/lang0.xml18
-rw-r--r--test/rexml/data/message.xml27
-rw-r--r--test/rexml/data/moreover.xml244
-rw-r--r--test/rexml/data/much_ado.xml6850
-rw-r--r--test/rexml/data/namespaces.xml18
-rw-r--r--test/rexml/data/nitf.xml67
-rw-r--r--test/rexml/data/numbers.xml18
-rw-r--r--test/rexml/data/ofbiz-issues-full-177.xml13971
-rw-r--r--test/rexml/data/pi.xml13
-rw-r--r--test/rexml/data/pi2.xml6
-rw-r--r--test/rexml/data/project.xml1
-rw-r--r--test/rexml/data/simple.xml2
-rw-r--r--test/rexml/data/stream_accents.xml4
-rw-r--r--test/rexml/data/t63-1.xmlbin0 -> 161690 bytes-rw-r--r--test/rexml/data/t63-2.svg2828
-rw-r--r--test/rexml/data/t75.xml31
-rw-r--r--test/rexml/data/test/tests.xml683
-rw-r--r--test/rexml/data/test/tests.xsl369
-rw-r--r--test/rexml/data/testNamespaces.xml22
-rw-r--r--test/rexml/data/testsrc.xml64
-rw-r--r--test/rexml/data/text.xml10
-rw-r--r--test/rexml/data/ticket_110_utf16.xmlbin0 -> 207464 bytes-rw-r--r--test/rexml/data/ticket_61.xml4
-rw-r--r--test/rexml/data/ticket_68.xml590
-rw-r--r--test/rexml/data/tutorial.xml678
-rw-r--r--test/rexml/data/underscore.xml6
-rw-r--r--test/rexml/data/web.xml42
-rw-r--r--test/rexml/data/web2.xml7
-rw-r--r--test/rexml/data/working.rss202
-rw-r--r--test/rexml/data/xmlfile-bug.xml15
-rw-r--r--test/rexml/data/xp.tst27
-rw-r--r--test/rexml/data/yahoo.xml80
-rw-r--r--test/rexml/listener.rb50
-rw-r--r--test/rexml/rexml_test_utils.rb5
-rw-r--r--test/rexml/test_attributes.rb198
-rw-r--r--test/rexml/test_attributes_mixin.rb32
-rw-r--r--test/rexml/test_changing_encoding.rb44
-rw-r--r--test/rexml/test_contrib.rb581
-rw-r--r--test/rexml/test_core.rb1462
-rw-r--r--test/rexml/test_doctype.rb107
-rw-r--r--test/rexml/test_document.rb109
-rw-r--r--test/rexml/test_elements.rb116
-rw-r--r--test/rexml/test_encoding.rb93
-rw-r--r--test/rexml/test_encoding_2.rb59
-rw-r--r--test/rexml/test_entity.rb149
-rw-r--r--test/rexml/test_functions.rb223
-rw-r--r--test/rexml/test_functions_number.rb32
-rw-r--r--test/rexml/test_jaxen.rb126
-rw-r--r--test/rexml/test_light.rb104
-rw-r--r--test/rexml/test_lightparser.rb12
-rw-r--r--test/rexml/test_listener.rb129
-rw-r--r--test/rexml/test_martin_fowler.rb37
-rw-r--r--test/rexml/test_namespace.rb38
-rw-r--r--test/rexml/test_notationdecl_mixin.rb58
-rw-r--r--test/rexml/test_notationdecl_parsetest.rb23
-rw-r--r--test/rexml/test_order.rb102
-rw-r--r--test/rexml/test_preceding_sibling.rb38
-rw-r--r--test/rexml/test_pullparser.rb100
-rw-r--r--test/rexml/test_rexml_issuezilla.rb14
-rw-r--r--test/rexml/test_sax.rb279
-rw-r--r--test/rexml/test_stream.rb104
-rw-r--r--test/rexml/test_ticket_80.rb56
-rw-r--r--test/rexml/test_validation_rng.rb790
-rw-r--r--test/rexml/test_xml_declaration_parent_child.rb33
-rw-r--r--test/rexml/test_xpath.rb1079
-rw-r--r--test/rexml/test_xpath_attribute_query.rb89
-rw-r--r--test/rexml/test_xpath_msw.rb38
-rw-r--r--test/rexml/test_xpath_pred.rb80
-rw-r--r--test/rexml/test_xpathtext.rb72
-rw-r--r--test/rinda/test_rinda.rb279
-rw-r--r--test/rinda/test_tuplebag.rb172
-rw-r--r--test/ripper/dummyparser.rb216
-rw-r--r--test/ripper/test_files.rb27
-rw-r--r--test/ripper/test_filter.rb83
-rw-r--r--test/ripper/test_parser_events.rb1142
-rw-r--r--test/ripper/test_ripper.rb49
-rw-r--r--test/ripper/test_scanner_events.rb837
-rw-r--r--test/rss/dot.pngbin0 -> 111 bytes-rw-r--r--test/rss/rss-assertions.rb1944
-rw-r--r--test/rss/rss-testcase.rb214
-rw-r--r--test/rss/test_1.0.rb156
-rw-r--r--test/rss/test_2.0.rb93
-rw-r--r--test/rss/test_accessor.rb32
-rw-r--r--test/rss/test_atom.rb681
-rw-r--r--test/rss/test_content.rb76
-rw-r--r--test/rss/test_dublincore.rb316
-rw-r--r--test/rss/test_image.rb49
-rw-r--r--test/rss/test_inherit.rb5
-rw-r--r--test/rss/test_itunes.rb347
-rw-r--r--test/rss/test_maker_0.9.rb215
-rw-r--r--test/rss/test_maker_1.0.rb281
-rw-r--r--test/rss/test_maker_2.0.rb194
-rw-r--r--test/rss/test_maker_atom_entry.rb393
-rw-r--r--test/rss/test_maker_atom_feed.rb454
-rw-r--r--test/rss/test_maker_content.rb15
-rw-r--r--test/rss/test_maker_dc.rb22
-rw-r--r--test/rss/test_maker_image.rb4
-rw-r--r--test/rss/test_maker_itunes.rb471
-rw-r--r--test/rss/test_maker_slash.rb37
-rw-r--r--test/rss/test_maker_sy.rb5
-rw-r--r--test/rss/test_maker_taxo.rb6
-rw-r--r--test/rss/test_maker_trackback.rb2
-rw-r--r--test/rss/test_maker_xml-stylesheet.rb14
-rw-r--r--test/rss/test_parser.rb26
-rw-r--r--test/rss/test_parser_1.0.rb27
-rw-r--r--test/rss/test_parser_atom_entry.rb163
-rw-r--r--test/rss/test_parser_atom_feed.rb276
-rw-r--r--test/rss/test_setup_maker_0.9.rb49
-rw-r--r--test/rss/test_setup_maker_1.0.rb110
-rw-r--r--test/rss/test_setup_maker_2.0.rb42
-rw-r--r--test/rss/test_setup_maker_atom_entry.rb409
-rw-r--r--test/rss/test_setup_maker_atom_feed.rb445
-rw-r--r--test/rss/test_setup_maker_itunes.rb144
-rw-r--r--test/rss/test_setup_maker_slash.rb38
-rw-r--r--test/rss/test_slash.rb64
-rw-r--r--test/rss/test_syndication.rb40
-rw-r--r--test/rss/test_taxonomy.rb30
-rw-r--r--test/rss/test_to_s.rb262
-rw-r--r--test/rss/test_trackback.rb28
-rw-r--r--test/rss/test_version.rb2
-rw-r--r--test/rss/test_xml-stylesheet.rb22
-rw-r--r--test/ruby/allpairs.rb103
-rw-r--r--test/ruby/beginmainend.rb2
-rw-r--r--test/ruby/enc/test_big5.rb28
-rw-r--r--test/ruby/enc/test_cp949.rb28
-rw-r--r--test/ruby/enc/test_emoji.rb442
-rw-r--r--test/ruby/enc/test_euc_jp.rb24
-rw-r--r--test/ruby/enc/test_euc_kr.rb28
-rw-r--r--test/ruby/enc/test_euc_tw.rb28
-rw-r--r--test/ruby/enc/test_gb18030.rb126
-rw-r--r--test/ruby/enc/test_gbk.rb28
-rw-r--r--test/ruby/enc/test_iso_8859.rb163
-rw-r--r--test/ruby/enc/test_koi8.rb22
-rw-r--r--test/ruby/enc/test_shift_jis.rb27
-rw-r--r--test/ruby/enc/test_utf16.rb384
-rw-r--r--test/ruby/enc/test_utf32.rb93
-rw-r--r--test/ruby/enc/test_windows_1251.rb16
-rw-r--r--test/ruby/endblockwarn_rb (renamed from test/ruby/endblockwarn.rb)0
-rw-r--r--test/ruby/envutil.rb200
-rw-r--r--test/ruby/lbtest.rb48
-rw-r--r--test/ruby/marshaltestlib.rb48
-rw-r--r--test/ruby/memory_status.rb96
-rw-r--r--test/ruby/sentence.rb668
-rw-r--r--test/ruby/test_alias.rb99
-rw-r--r--test/ruby/test_argf.rb759
-rw-r--r--test/ruby/test_array.rb2078
-rw-r--r--test/ruby/test_assignment.rb710
-rw-r--r--test/ruby/test_autoload.rb56
-rw-r--r--test/ruby/test_basicinstructions.rb685
-rw-r--r--test/ruby/test_beginendblock.rb113
-rw-r--r--test/ruby/test_bignum.rb460
-rw-r--r--test/ruby/test_call.rb4
-rw-r--r--test/ruby/test_case.rb57
-rw-r--r--test/ruby/test_class.rb261
-rw-r--r--test/ruby/test_clone.rb2
-rw-r--r--test/ruby/test_comparable.rb72
-rw-r--r--test/ruby/test_complex.rb1151
-rw-r--r--test/ruby/test_complex2.rb735
-rw-r--r--test/ruby/test_complexrational.rb407
-rw-r--r--test/ruby/test_const.rb27
-rw-r--r--test/ruby/test_continuation.rb124
-rw-r--r--test/ruby/test_defined.rb100
-rw-r--r--test/ruby/test_dir.rb194
-rw-r--r--test/ruby/test_dir_m17n.rb265
-rw-r--r--test/ruby/test_econv.rb931
-rw-r--r--test/ruby/test_encoding.rb116
-rw-r--r--test/ruby/test_enum.rb388
-rw-r--r--test/ruby/test_enumerator.rb377
-rw-r--r--test/ruby/test_env.rb360
-rw-r--r--test/ruby/test_eval.rb348
-rw-r--r--test/ruby/test_exception.rb212
-rw-r--r--test/ruby/test_fiber.rb240
-rw-r--r--test/ruby/test_file.rb269
-rw-r--r--test/ruby/test_file_exhaustive.rb1024
-rw-r--r--test/ruby/test_fixnum.rb232
-rw-r--r--test/ruby/test_float.rb413
-rw-r--r--test/ruby/test_fnmatch.rb106
-rw-r--r--test/ruby/test_gc.rb70
-rw-r--r--test/ruby/test_hash.rb853
-rw-r--r--test/ruby/test_integer.rb201
-rw-r--r--test/ruby/test_integer_comb.rb622
-rw-r--r--test/ruby/test_io.rb2121
-rw-r--r--test/ruby/test_io_m17n.rb2397
-rw-r--r--test/ruby/test_iterator.rb128
-rw-r--r--test/ruby/test_lambda.rb73
-rw-r--r--test/ruby/test_literal.rb293
-rw-r--r--test/ruby/test_m17n.rb1423
-rw-r--r--test/ruby/test_m17n_comb.rb1623
-rw-r--r--test/ruby/test_marshal.rb474
-rw-r--r--test/ruby/test_math.rb281
-rw-r--r--test/ruby/test_metaclass.rb167
-rw-r--r--test/ruby/test_method.rb426
-rw-r--r--test/ruby/test_mixed_unicode_escapes.rb25
-rw-r--r--test/ruby/test_module.rb1223
-rw-r--r--test/ruby/test_notimp.rb64
-rw-r--r--test/ruby/test_numeric.rb235
-rw-r--r--test/ruby/test_object.rb687
-rw-r--r--test/ruby/test_objectspace.rb34
-rw-r--r--test/ruby/test_optimization.rb163
-rw-r--r--test/ruby/test_pack.rb612
-rw-r--r--test/ruby/test_parse.rb828
-rw-r--r--test/ruby/test_path.rb57
-rw-r--r--test/ruby/test_pipe.rb4
-rw-r--r--test/ruby/test_primitive.rb423
-rw-r--r--test/ruby/test_proc.rb752
-rw-r--r--test/ruby/test_process.rb1314
-rw-r--r--test/ruby/test_rand.rb516
-rw-r--r--test/ruby/test_range.rb333
-rw-r--r--test/ruby/test_rational.rb1139
-rw-r--r--test/ruby/test_rational2.rb1386
-rw-r--r--test/ruby/test_readpartial.rb14
-rw-r--r--test/ruby/test_regexp.rb876
-rw-r--r--test/ruby/test_require.rb359
-rw-r--r--test/ruby/test_rubyoptions.rb566
-rw-r--r--test/ruby/test_settracefunc.rb507
-rw-r--r--test/ruby/test_signal.rb203
-rw-r--r--test/ruby/test_sleep.rb15
-rw-r--r--test/ruby/test_sprintf.rb334
-rw-r--r--test/ruby/test_sprintf_comb.rb553
-rw-r--r--test/ruby/test_string.rb1982
-rw-r--r--test/ruby/test_stringchar.rb29
-rw-r--r--test/ruby/test_struct.rb228
-rw-r--r--test/ruby/test_super.rb76
-rw-r--r--test/ruby/test_symbol.rb90
-rw-r--r--test/ruby/test_syntax.rb89
-rw-r--r--test/ruby/test_system.rb159
-rw-r--r--test/ruby/test_thread.rb713
-rw-r--r--test/ruby/test_time.rb688
-rw-r--r--test/ruby/test_time_tz.rb338
-rw-r--r--test/ruby/test_trace.rb46
-rw-r--r--test/ruby/test_transcode.rb1968
-rw-r--r--test/ruby/test_undef.rb37
-rw-r--r--test/ruby/test_unicode_escape.rb269
-rw-r--r--test/ruby/test_variable.rb52
-rw-r--r--test/ruby/test_whileuntil.rb111
-rw-r--r--test/ruby/test_yield.rb382
-rw-r--r--test/ruby/ut_eof.rb12
-rw-r--r--test/rubygems/bogussources.rb8
-rw-r--r--test/rubygems/ca_cert.pem45
-rw-r--r--test/rubygems/data/gem-private_key.pem27
-rw-r--r--test/rubygems/data/gem-public_cert.pem20
-rw-r--r--test/rubygems/data/null-type.gemspec.rzbin0 -> 553 bytes-rw-r--r--test/rubygems/fake_certlib/openssl.rb7
-rw-r--r--test/rubygems/fix_openssl_warnings.rb12
-rw-r--r--test/rubygems/foo/discover.rb (renamed from test/wsdl/datetime/datetime.rb)0
-rw-r--r--test/rubygems/insure_session.rb43
-rw-r--r--test/rubygems/plugin/exception/rubygems_plugin.rb2
-rw-r--r--test/rubygems/plugin/load/rubygems_plugin.rb3
-rw-r--r--test/rubygems/plugin/standarderror/rubygems_plugin.rb2
-rw-r--r--test/rubygems/private_key.pem27
-rw-r--r--test/rubygems/public_cert.pem20
-rw-r--r--test/rubygems/rubygems/commands/crash_command.rb5
-rw-r--r--test/rubygems/rubygems_plugin.rb21
-rw-r--r--test/rubygems/sff/discover.rb (renamed from test/wsdl/qualified/lp.rb)0
-rw-r--r--test/rubygems/simple_gem.rb66
-rw-r--r--test/rubygems/ssl_cert.pem (renamed from test/soap/ssl/server.cert)0
-rw-r--r--test/rubygems/ssl_key.pem (renamed from test/soap/ssl/server.key)0
-rw-r--r--test/rubygems/test_config.rb16
-rw-r--r--test/rubygems/test_gem.rb1281
-rw-r--r--test/rubygems/test_gem_builder.rb44
-rw-r--r--test/rubygems/test_gem_command.rb178
-rw-r--r--test/rubygems/test_gem_command_manager.rb215
-rw-r--r--test/rubygems/test_gem_commands_build_command.rb118
-rw-r--r--test/rubygems/test_gem_commands_cert_command.rb125
-rw-r--r--test/rubygems/test_gem_commands_check_command.rb18
-rw-r--r--test/rubygems/test_gem_commands_cleanup_command.rb89
-rw-r--r--test/rubygems/test_gem_commands_contents_command.rb145
-rw-r--r--test/rubygems/test_gem_commands_dependency_command.rb226
-rw-r--r--test/rubygems/test_gem_commands_environment_command.rb144
-rw-r--r--test/rubygems/test_gem_commands_fetch_command.rb102
-rw-r--r--test/rubygems/test_gem_commands_generate_index_command.rb131
-rw-r--r--test/rubygems/test_gem_commands_help_command.rb58
-rw-r--r--test/rubygems/test_gem_commands_install_command.rb354
-rw-r--r--test/rubygems/test_gem_commands_list_command.rb33
-rw-r--r--test/rubygems/test_gem_commands_lock_command.rb68
-rw-r--r--test/rubygems/test_gem_commands_outdated_command.rb38
-rw-r--r--test/rubygems/test_gem_commands_owner_command.rb147
-rw-r--r--test/rubygems/test_gem_commands_pristine_command.rb199
-rw-r--r--test/rubygems/test_gem_commands_push_command.rb107
-rw-r--r--test/rubygems/test_gem_commands_query_command.rb353
-rw-r--r--test/rubygems/test_gem_commands_server_command.rb59
-rw-r--r--test/rubygems/test_gem_commands_sources_command.rb210
-rw-r--r--test/rubygems/test_gem_commands_specification_command.rb241
-rw-r--r--test/rubygems/test_gem_commands_stale_command.rb40
-rw-r--r--test/rubygems/test_gem_commands_uninstall_command.rb137
-rw-r--r--test/rubygems/test_gem_commands_unpack_command.rb224
-rw-r--r--test/rubygems/test_gem_commands_update_command.rb372
-rw-r--r--test/rubygems/test_gem_commands_which_command.rb83
-rw-r--r--test/rubygems/test_gem_config_file.rb319
-rw-r--r--test/rubygems/test_gem_dependency.rb177
-rw-r--r--test/rubygems/test_gem_dependency_installer.rb853
-rw-r--r--test/rubygems/test_gem_dependency_list.rb268
-rw-r--r--test/rubygems/test_gem_doc_manager.rb32
-rw-r--r--test/rubygems/test_gem_ext_configure_builder.rb84
-rw-r--r--test/rubygems/test_gem_ext_ext_conf_builder.rb162
-rw-r--r--test/rubygems/test_gem_ext_rake_builder.rb66
-rw-r--r--test/rubygems/test_gem_format.rb88
-rw-r--r--test/rubygems/test_gem_gem_path_searcher.rb94
-rw-r--r--test/rubygems/test_gem_gem_runner.rb42
-rw-r--r--test/rubygems/test_gem_gemcutter_utilities.rb151
-rw-r--r--test/rubygems/test_gem_indexer.rb558
-rw-r--r--test/rubygems/test_gem_install_update_options.rb67
-rw-r--r--test/rubygems/test_gem_installer.rb1244
-rw-r--r--test/rubygems/test_gem_local_remote_options.rb114
-rw-r--r--test/rubygems/test_gem_package_tar_header.rb130
-rw-r--r--test/rubygems/test_gem_package_tar_input.rb129
-rw-r--r--test/rubygems/test_gem_package_tar_output.rb101
-rw-r--r--test/rubygems/test_gem_package_tar_reader.rb46
-rw-r--r--test/rubygems/test_gem_package_tar_reader_entry.rb119
-rw-r--r--test/rubygems/test_gem_package_tar_writer.rb144
-rw-r--r--test/rubygems/test_gem_package_task.rb59
-rw-r--r--test/rubygems/test_gem_path_support.rb93
-rw-r--r--test/rubygems/test_gem_platform.rb270
-rw-r--r--test/rubygems/test_gem_remote_fetcher.rb978
-rw-r--r--test/rubygems/test_gem_requirement.rb309
-rw-r--r--test/rubygems/test_gem_security.rb100
-rw-r--r--test/rubygems/test_gem_server.rb234
-rw-r--r--test/rubygems/test_gem_silent_ui.rb111
-rw-r--r--test/rubygems/test_gem_source_index.rb250
-rw-r--r--test/rubygems/test_gem_spec_fetcher.rb408
-rw-r--r--test/rubygems/test_gem_specification.rb1728
-rw-r--r--test/rubygems/test_gem_stream_ui.rb238
-rw-r--r--test/rubygems/test_gem_text.rb58
-rw-r--r--test/rubygems/test_gem_uninstaller.rb235
-rw-r--r--test/rubygems/test_gem_validator.rb63
-rw-r--r--test/rubygems/test_gem_version.rb181
-rw-r--r--test/rubygems/test_gem_version_option.rb89
-rw-r--r--test/rubygems/test_kernel.rb55
-rw-r--r--test/runner.rb16
-rw-r--r--test/scanf/data.txt6
-rw-r--r--test/scanf/test_scanf.rb325
-rw-r--r--test/scanf/test_scanfblocks.rb81
-rw-r--r--test/scanf/test_scanfio.rb20
-rw-r--r--test/sdbm/test_sdbm.rb93
-rw-r--r--test/soap/asp.net/hello.wsdl96
-rw-r--r--test/soap/asp.net/test_aspdotnet.rb111
-rw-r--r--test/soap/calc/calc.rb17
-rw-r--r--test/soap/calc/calc2.rb29
-rw-r--r--test/soap/calc/server.cgi13
-rw-r--r--test/soap/calc/server.rb17
-rw-r--r--test/soap/calc/server2.rb20
-rw-r--r--test/soap/calc/test_calc.rb49
-rw-r--r--test/soap/calc/test_calc2.rb53
-rw-r--r--test/soap/calc/test_calc_cgi.rb69
-rw-r--r--test/soap/fault/test_customfault.rb58
-rw-r--r--test/soap/header/server.cgi119
-rw-r--r--test/soap/header/test_authheader.rb240
-rw-r--r--test/soap/header/test_authheader_cgi.rb121
-rw-r--r--test/soap/header/test_simplehandler.rb116
-rw-r--r--test/soap/helloworld/hw_s.rb16
-rw-r--r--test/soap/helloworld/test_helloworld.rb40
-rw-r--r--test/soap/marshal/test_digraph.rb56
-rw-r--r--test/soap/marshal/test_marshal.rb26
-rw-r--r--test/soap/marshal/test_struct.rb47
-rw-r--r--test/soap/ssl/README1
-rw-r--r--test/soap/ssl/ca.cert23
-rw-r--r--test/soap/ssl/client.cert19
-rw-r--r--test/soap/ssl/client.key15
-rw-r--r--test/soap/ssl/sslsvr.rb57
-rw-r--r--test/soap/ssl/subca.cert21
-rw-r--r--test/soap/ssl/test_ssl.rb204
-rw-r--r--test/soap/struct/test_struct.rb77
-rw-r--r--test/soap/swa/test_file.rb73
-rw-r--r--test/soap/test_basetype.rb970
-rw-r--r--test/soap/test_envelopenamespace.rb92
-rw-r--r--test/soap/test_httpconfigloader.rb39
-rw-r--r--test/soap/test_mapping.rb59
-rw-r--r--test/soap/test_no_indent.rb86
-rw-r--r--test/soap/test_property.rb424
-rw-r--r--test/soap/test_soapelement.rb122
-rw-r--r--test/soap/test_streamhandler.rb209
-rw-r--r--test/soap/test_styleuse.rb333
-rw-r--r--test/soap/wsdlDriver/README.txt2
-rw-r--r--test/soap/wsdlDriver/calc.wsdl126
-rw-r--r--test/soap/wsdlDriver/document.wsdl54
-rw-r--r--test/soap/wsdlDriver/echo_version.rb20
-rw-r--r--test/soap/wsdlDriver/simpletype.wsdl63
-rw-r--r--test/soap/wsdlDriver/test_calc.rb100
-rw-r--r--test/soap/wsdlDriver/test_document.rb78
-rw-r--r--test/soap/wsdlDriver/test_simpletype.rb87
-rw-r--r--test/socket/test_addrinfo.rb619
-rw-r--r--test/socket/test_ancdata.rb66
-rw-r--r--test/socket/test_basicsocket.rb88
-rw-r--r--test/socket/test_nonblock.rb149
-rw-r--r--test/socket/test_socket.rb482
-rw-r--r--test/socket/test_sockopt.rb33
-rw-r--r--test/socket/test_tcp.rb42
-rw-r--r--test/socket/test_udp.rb39
-rw-r--r--test/socket/test_unix.rb373
-rw-r--r--test/stringio/test_stringio.rb479
-rw-r--r--test/strscan/test_stringscanner.rb201
-rw-r--r--test/syck/test_array.rb18
-rw-r--r--test/syck/test_boolean.rb37
-rw-r--r--test/syck/test_class.rb27
-rw-r--r--test/syck/test_engine_manager.rb3
-rw-r--r--test/syck/test_exception.rb46
-rw-r--r--test/syck/test_hash.rb29
-rw-r--r--test/syck/test_null.rb20
-rw-r--r--test/syck/test_omap.rb56
-rw-r--r--test/syck/test_set.rb31
-rw-r--r--test/syck/test_string.rb45
-rw-r--r--test/syck/test_struct.rb42
-rw-r--r--test/syck/test_symbol.rb22
-rw-r--r--test/syck/test_time.rb24
-rw-r--r--test/syck/test_yaml.rb1413
-rw-r--r--test/syck/test_yaml_properties.rb64
-rw-r--r--test/syck/test_yamlstore.rb79
-rw-r--r--test/test_cmath.rb16
-rw-r--r--test/test_delegate.rb129
-rw-r--r--test/test_find.rb226
-rw-r--r--test/test_ipaddr.rb3
-rw-r--r--test/test_mathn.rb10
-rw-r--r--test/test_mutex_m.rb26
-rw-r--r--test/test_open3.rb242
-rw-r--r--test/test_pp.rb192
-rw-r--r--test/test_prettyprint.rb519
-rw-r--r--test/test_prime.rb174
-rw-r--r--test/test_pstore.rb129
-rw-r--r--test/test_pty.rb200
-rw-r--r--test/test_securerandom.rb175
-rw-r--r--test/test_set.rb3
-rw-r--r--test/test_shellwords.rb56
-rw-r--r--test/test_singleton.rb103
-rw-r--r--test/test_syslog.rb185
-rw-r--r--test/test_tempfile.rb308
-rw-r--r--test/test_time.rb407
-rw-r--r--test/test_timeout.rb32
-rw-r--r--test/test_tracer.rb63
-rw-r--r--test/test_tsort.rb44
-rw-r--r--test/testunit/collector/test_dir.rb389
-rw-r--r--test/testunit/collector/test_objectspace.rb98
-rw-r--r--test/testunit/runit/test_assert.rb402
-rw-r--r--test/testunit/runit/test_testcase.rb91
-rw-r--r--test/testunit/runit/test_testresult.rb144
-rw-r--r--test/testunit/runit/test_testsuite.rb49
-rw-r--r--test/testunit/test4test_hideskip.rb7
-rw-r--r--test/testunit/test_assertion.rb8
-rw-r--r--test/testunit/test_assertions.rb528
-rw-r--r--test/testunit/test_error.rb26
-rw-r--r--test/testunit/test_failure.rb33
-rw-r--r--test/testunit/test_hideskip.rb20
-rw-r--r--test/testunit/test_parallel.rb181
-rw-r--r--test/testunit/test_rake_integration.rb35
-rw-r--r--test/testunit/test_testcase.rb275
-rw-r--r--test/testunit/test_testresult.rb104
-rw-r--r--test/testunit/test_testsuite.rb129
-rw-r--r--test/testunit/tests_for_parallel/ptest_first.rb7
-rw-r--r--test/testunit/tests_for_parallel/ptest_forth.rb16
-rw-r--r--test/testunit/tests_for_parallel/ptest_second.rb11
-rw-r--r--test/testunit/tests_for_parallel/ptest_third.rb10
-rw-r--r--test/testunit/tests_for_parallel/runner.rb10
-rw-r--r--test/testunit/util/test_backtracefilter.rb41
-rw-r--r--test/testunit/util/test_observable.rb102
-rw-r--r--test/testunit/util/test_procwrapper.rb36
-rw-r--r--test/thread/test_queue.rb38
-rw-r--r--test/uri/test_common.rb88
-rw-r--r--test/uri/test_ftp.rb30
-rw-r--r--test/uri/test_generic.rb158
-rw-r--r--test/uri/test_http.rb5
-rw-r--r--test/uri/test_ldap.rb32
-rw-r--r--test/uri/test_mailto.rb26
-rw-r--r--test/uri/test_parser.rb41
-rw-r--r--test/webrick/.htaccess1
-rw-r--r--test/webrick/test_cgi.rb110
-rw-r--r--test/webrick/test_cookie.rb58
-rw-r--r--test/webrick/test_filehandler.rb226
-rw-r--r--test/webrick/test_httpauth.rb111
-rw-r--r--test/webrick/test_httpproxy.rb282
-rw-r--r--test/webrick/test_httprequest.rb145
-rw-r--r--test/webrick/test_httpserver.rb73
-rw-r--r--test/webrick/test_httputils.rb36
-rw-r--r--test/webrick/test_server.rb31
-rw-r--r--test/webrick/test_utils.rb64
-rw-r--r--test/webrick/utils.rb30
-rw-r--r--test/webrick/webrick_long_filename.cgi36
-rw-r--r--test/win32ole/err_in_callback.rb9
-rw-r--r--test/win32ole/orig_data.csv5
-rw-r--r--test/win32ole/test_err_in_callback.rb52
-rw-r--r--test/win32ole/test_folderitem2_invokeverb.rb65
-rw-r--r--test/win32ole/test_nil2vtempty.rb36
-rw-r--r--test/win32ole/test_ole_methods.rb36
-rw-r--r--test/win32ole/test_propertyputref.rb30
-rw-r--r--test/win32ole/test_thread.rb20
-rw-r--r--test/win32ole/test_win32ole.rb517
-rw-r--r--test/win32ole/test_win32ole_event.rb334
-rw-r--r--test/win32ole/test_win32ole_method.rb146
-rw-r--r--test/win32ole/test_win32ole_param.rb106
-rw-r--r--test/win32ole/test_win32ole_type.rb249
-rw-r--r--test/win32ole/test_win32ole_typelib.rb116
-rw-r--r--test/win32ole/test_win32ole_variable.rb61
-rw-r--r--test/win32ole/test_win32ole_variant.rb665
-rw-r--r--test/win32ole/test_win32ole_variant_m.rb35
-rw-r--r--test/win32ole/test_win32ole_variant_outarg.rb69
-rw-r--r--test/win32ole/test_word.rb72
-rw-r--r--test/with_different_ofs.rb17
-rw-r--r--test/wsdl/any/any.wsdl50
-rw-r--r--test/wsdl/any/expectedDriver.rb54
-rw-r--r--test/wsdl/any/expectedEcho.rb14
-rw-r--r--test/wsdl/any/expectedService.rb52
-rw-r--r--test/wsdl/any/test_any.rb58
-rw-r--r--test/wsdl/axisArray/axisArray.wsdl60
-rw-r--r--test/wsdl/axisArray/itemList.rb27
-rw-r--r--test/wsdl/axisArray/test_axisarray.rb69
-rw-r--r--test/wsdl/datetime/DatetimeService.rb44
-rw-r--r--test/wsdl/datetime/datetime.wsdl45
-rw-r--r--test/wsdl/datetime/datetimeServant.rb21
-rw-r--r--test/wsdl/datetime/test_datetime.rb82
-rw-r--r--test/wsdl/document/document.wsdl74
-rw-r--r--test/wsdl/document/echo.rb92
-rw-r--r--test/wsdl/document/number.wsdl54
-rw-r--r--test/wsdl/document/ping_nosoapaction.wsdl66
-rw-r--r--test/wsdl/document/test_nosoapaction.rb109
-rw-r--r--test/wsdl/document/test_number.rb99
-rw-r--r--test/wsdl/document/test_rpc.rb177
-rw-r--r--test/wsdl/emptycomplextype.wsdl31
-rw-r--r--test/wsdl/map/map.wsdl92
-rw-r--r--test/wsdl/map/map.xml43
-rw-r--r--test/wsdl/map/test_map.rb99
-rw-r--r--test/wsdl/marshal/person.wsdl21
-rw-r--r--test/wsdl/marshal/person_org.rb22
-rw-r--r--test/wsdl/marshal/test_wsdlmarshal.rb80
-rw-r--r--test/wsdl/multiplefault.wsdl68
-rw-r--r--test/wsdl/qualified/lp.wsdl47
-rw-r--r--test/wsdl/qualified/lp.xsd26
-rw-r--r--test/wsdl/qualified/np.wsdl50
-rw-r--r--test/wsdl/qualified/test_qualified.rb154
-rw-r--r--test/wsdl/qualified/test_unqualified.rb143
-rw-r--r--test/wsdl/raa/RAA.rb243
-rw-r--r--test/wsdl/raa/RAAServant.rb99
-rw-r--r--test/wsdl/raa/RAAService.rb100
-rw-r--r--test/wsdl/raa/README.txt8
-rw-r--r--test/wsdl/raa/raa.wsdl264
-rw-r--r--test/wsdl/raa/server.rb103
-rw-r--r--test/wsdl/raa/test_raa.rb71
-rw-r--r--test/wsdl/ref/expectedProduct.rb90
-rw-r--r--test/wsdl/ref/product.wsdl86
-rw-r--r--test/wsdl/ref/test_ref.rb54
-rw-r--r--test/wsdl/rpc/echoDriver.rb55
-rw-r--r--test/wsdl/rpc/echo_serviceClient.rb23
-rw-r--r--test/wsdl/rpc/rpc.wsdl75
-rw-r--r--test/wsdl/rpc/test-rpc-lit.wsdl364
-rw-r--r--test/wsdl/rpc/test-rpc-lit12.wsdl455
-rw-r--r--test/wsdl/rpc/test_rpc.rb118
-rw-r--r--test/wsdl/rpc/test_rpc_lit.rb399
-rw-r--r--test/wsdl/simpletype/rpc/expectedClient.rb34
-rw-r--r--test/wsdl/simpletype/rpc/expectedDriver.rb62
-rw-r--r--test/wsdl/simpletype/rpc/expectedEchoVersion.rb23
-rw-r--r--test/wsdl/simpletype/rpc/expectedServant.rb32
-rw-r--r--test/wsdl/simpletype/rpc/expectedService.rb60
-rw-r--r--test/wsdl/simpletype/rpc/rpc.wsdl80
-rw-r--r--test/wsdl/simpletype/rpc/test_rpc.rb62
-rw-r--r--test/wsdl/simpletype/simpletype.wsdl95
-rw-r--r--test/wsdl/simpletype/test_simpletype.rb99
-rw-r--r--test/wsdl/soap/soapbodyparts.wsdl103
-rw-r--r--test/wsdl/soap/test_soapbodyparts.rb79
-rw-r--r--test/wsdl/test_emptycomplextype.rb21
-rw-r--r--test/wsdl/test_fault.rb51
-rw-r--r--test/wsdl/test_multiplefault.rb39
-rw-r--r--test/xmlrpc/htpasswd2
-rw-r--r--test/xmlrpc/test_cookie.rb96
-rw-r--r--test/xmlrpc/test_datetime.rb64
-rw-r--r--test/xmlrpc/test_features.rb6
-rw-r--r--test/xmlrpc/test_marshal.rb23
-rw-r--r--test/xmlrpc/test_parser.rb18
-rw-r--r--test/xmlrpc/test_webrick_server.rb57
-rw-r--r--test/xmlrpc/webrick_testing.rb24
-rw-r--r--test/xsd/codegen/test_classdef.rb214
-rw-r--r--test/xsd/noencoding.xml4
-rw-r--r--test/xsd/test_noencoding.rb32
-rw-r--r--test/xsd/test_xmlschemaparser.rb22
-rw-r--r--test/xsd/test_xsd.rb1511
-rw-r--r--test/xsd/xmlschema.xml12
-rw-r--r--test/yaml/test_yaml.rb1284
-rw-r--r--test/zlib/test_zlib.rb805
-rw-r--r--thread.c4849
-rw-r--r--thread_pthread.c1337
-rw-r--r--thread_pthread.h51
-rw-r--r--thread_win32.c787
-rw-r--r--thread_win32.h40
-rw-r--r--time.c5131
-rw-r--r--timev.h21
-rwxr-xr-xtool/asm_parse.rb51
-rwxr-xr-xtool/build-transcode16
-rwxr-xr-xtool/change_maker.rb30
-rwxr-xr-xtool/compile_prelude.rb198
-rwxr-xr-xtool/config.guess1501
-rwxr-xr-xtool/config.sub1705
-rw-r--r--tool/enc-emoji-citrus-gen.rb131
-rw-r--r--tool/enc-emoji4unicode.rb133
-rwxr-xr-xtool/enc-unicode.rb319
-rwxr-xr-xtool/eval.rb159
-rwxr-xr-xtool/file2lastrev.rb153
-rwxr-xr-xtool/generic_erb.rb34
-rwxr-xr-xtool/ifchange48
-rwxr-xr-xtool/insns2vm.rb15
-rw-r--r--tool/install-sh17
-rwxr-xr-xtool/instruction.rb1393
-rw-r--r--tool/jisx0208.rb84
-rwxr-xr-xtool/make-snapshot255
-rwxr-xr-xtool/mdoc2man.rb465
-rwxr-xr-xtool/merger.rb208
-rwxr-xr-xtool/mkconfig.rb272
-rwxr-xr-xtool/node_name.rb6
-rwxr-xr-xtool/parse.rb13
-rwxr-xr-xtool/rbinstall.rb604
-rwxr-xr-xtool/rmdirs11
-rwxr-xr-xtool/rubytest.rb28
-rwxr-xr-xtool/runruby.rb91
-rwxr-xr-xtool/strip-rdoc.rb22
-rw-r--r--tool/test/test_jisx0208.rb40
-rwxr-xr-xtool/transcode-tblgen.rb1064
-rwxr-xr-xtool/update-deps139
-rwxr-xr-xtool/vtlh.rb15
-rwxr-xr-xtool/ytab.sed37
-rw-r--r--transcode.c4471
-rw-r--r--transcode_data.h117
-rw-r--r--util.c4123
-rw-r--r--util.h67
-rw-r--r--variable.c1798
-rw-r--r--version.c138
-rw-r--r--version.h65
-rw-r--r--vm.c2278
-rw-r--r--vm_core.h756
-rw-r--r--vm_dump.c852
-rw-r--r--vm_eval.c1809
-rw-r--r--vm_exec.c156
-rw-r--r--vm_exec.h184
-rw-r--r--vm_insnhelper.c1749
-rw-r--r--vm_insnhelper.h220
-rw-r--r--vm_method.c1318
-rw-r--r--vm_opts.h51
-rw-r--r--vms/config.h102
-rw-r--r--vms/vms.h10
-rw-r--r--vms/vmsruby_private.c52
-rw-r--r--vms/vmsruby_private.h7
-rw-r--r--vsnprintf.c1287
-rw-r--r--win32/Makefile.sub814
-rw-r--r--win32/README.win3275
-rwxr-xr-xwin32/configure.bat164
-rw-r--r--win32/dir.h17
-rw-r--r--win32/enc-setup.mak10
-rw-r--r--win32/file.c661
-rwxr-xr-xwin32/ifchange.bat59
-rwxr-xr-xwin32/makedirs.bat3
-rwxr-xr-x[-rw-r--r--]win32/mkexports.rb182
-rwxr-xr-x[-rw-r--r--]win32/resource.rb44
-rwxr-xr-xwin32/rm.bat12
-rwxr-xr-xwin32/rmall.bat6
-rwxr-xr-xwin32/rmdirs.bat29
-rw-r--r--win32/setup.mak161
-rw-r--r--win32/stub.c42
-rw-r--r--win32/win32.c4597
-rw-r--r--win32/win32.h557
-rw-r--r--win32/winmain.c4
-rw-r--r--wince/Makefile.sub505
-rw-r--r--wince/README.wince121
-rw-r--r--wince/assert.c11
-rw-r--r--wince/assert.h6
-rwxr-xr-xwince/configure.bat102
-rw-r--r--wince/direct.c54
-rw-r--r--wince/direct.h22
-rw-r--r--wince/errno.c11
-rw-r--r--wince/errno.h55
-rw-r--r--wince/fcntl.h42
-rw-r--r--wince/io.h76
-rw-r--r--wince/io_wce.c230
-rw-r--r--wince/mkconfig_wce.rb7
-rw-r--r--wince/mkexports.rb35
-rw-r--r--wince/process.h46
-rw-r--r--wince/process_wce.c47
-rw-r--r--wince/resource.rb96
-rw-r--r--wince/setup.mak245
-rw-r--r--wince/signal.h71
-rw-r--r--wince/signal_wce.c26
-rw-r--r--wince/stddef.h5
-rw-r--r--wince/stdio.c36
-rw-r--r--wince/stdlib.c57
-rw-r--r--wince/string_wce.c89
-rw-r--r--wince/sys/stat.c102
-rw-r--r--wince/sys/stat.h68
-rw-r--r--wince/sys/timeb.c25
-rw-r--r--wince/sys/timeb.h26
-rw-r--r--wince/sys/types.h60
-rw-r--r--wince/sys/utime.c44
-rw-r--r--wince/sys/utime.h27
-rw-r--r--wince/time.h63
-rw-r--r--wince/time_wce.c301
-rw-r--r--wince/varargs.h34
-rw-r--r--wince/wince.c583
-rw-r--r--wince/wince.h191
-rw-r--r--wince/wincemain.c19
-rw-r--r--wince/wincon.h7
-rw-r--r--wince/winsock2.c338
-rw-r--r--x68/_dtos18.c250
-rw-r--r--x68/_round.c45
-rw-r--r--x68/fconvert.c81
-rw-r--r--x68/select.c167
3692 files changed, 1125520 insertions, 213850 deletions
diff --git a/.cvsignore b/.cvsignore
deleted file mode 100644
index 9fd96ca149..0000000000
--- a/.cvsignore
+++ /dev/null
@@ -1,58 +0,0 @@
-*.bak
-*.orig
-*.rej
-*.sav
-*~
-.ccmalloc
-.ppack
-.ext
-.git
-.svn
-.rbconfig.time
-COPYING.LIB
-ChangeLog.pre-alpha
-ChangeLog.pre1_1
-Makefile
-README.fat-patch
-README.v6
-README.atheos
-archive
-autom4te*.cache
-automake
-beos
-config.cache
-config.h
-config.h.in
-config.log
-config.status
-configure
-foo.rb
-libruby.so.*
-miniruby
-miniruby.elhash
-miniruby.elhash2
-miniruby.orig2
-miniruby.plhash
-miniruby.plhash2
-modex.rb
-newdate.rb
-newver.rb
-parse.c
-parse.y.try
-pitest.rb
-ppack
-preview
-rbconfig.rb
-rename2.h
-repack
-riscos
-rubicon
-ruby
-ruby-man.rd.gz
-rubyunit
-st.c.power
-this that
-tmp
-web
-y.output
-y.tab.c
diff --git a/.document b/.document
index 230c50e387..8a05d61beb 100644
--- a/.document
+++ b/.document
@@ -6,6 +6,9 @@
# Process all the C source files
*.c
+# prelude
+prelude.rb
+
# the lib/ directory (which has its own .document file)
lib
@@ -14,3 +17,6 @@ lib
# and some of the ext/ directory (which has its own .document file)
ext
+
+# rdoc files
+doc/*.rdoc
diff --git a/.gdbinit b/.gdbinit
new file mode 100644
index 0000000000..2a38da8892
--- /dev/null
+++ b/.gdbinit
@@ -0,0 +1,757 @@
+define rp
+ if ruby_dummy_gdb_enums.special_consts
+ end
+ if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
+ printf "FIXNUM: %ld\n", (long)($arg0) >> 1
+ else
+ if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
+ set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
+ if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
+ printf "SYMBOL(:%c)\n", $id
+ else
+ if $id == idDot2
+ echo SYMBOL(:..)\n
+ else
+ if $id == idDot3
+ echo SYMBOL(:...)\n
+ else
+ if $id == idUPlus
+ echo SYMBOL(:+@)\n
+ else
+ if $id == idUMinus
+ echo SYMBOL(:-@)\n
+ else
+ if $id == idPow
+ echo SYMBOL(:**)\n
+ else
+ if $id == idCmp
+ echo SYMBOL(:<=>)\n
+ else
+ if $id == idLTLT
+ echo SYMBOL(:<<)\n
+ else
+ if $id == idLE
+ echo SYMBOL(:<=)\n
+ else
+ if $id == idGE
+ echo SYMBOL(:>=)\n
+ else
+ if $id == idEq
+ echo SYMBOL(:==)\n
+ else
+ if $id == idEqq
+ echo SYMBOL(:===)\n
+ else
+ if $id == idNeq
+ echo SYMBOL(:!=)\n
+ else
+ if $id == idEqTilde
+ echo SYMBOL(:=~)\n
+ else
+ if $id == idNeqTilde
+ echo SYMBOL(:!~)\n
+ else
+ if $id == idAREF
+ echo SYMBOL(:[])\n
+ else
+ if $id == idASET
+ echo SYMBOL(:[]=)\n
+ else
+ printf "SYMBOL(%ld)\n", $id
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ else
+ if ($arg0) == RUBY_Qfalse
+ echo false\n
+ else
+ if ($arg0) == RUBY_Qtrue
+ echo true\n
+ else
+ if ($arg0) == RUBY_Qnil
+ echo nil\n
+ else
+ if ($arg0) == RUBY_Qundef
+ echo undef\n
+ else
+ if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
+ echo immediate\n
+ else
+ set $flags = ((struct RBasic*)($arg0))->flags
+ if ($flags & RUBY_T_MASK) == RUBY_T_NONE
+ printf "T_NONE: "
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_NIL
+ printf "T_NIL: "
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
+ printf "T_OBJECT: "
+ print (struct RObject *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
+ printf "T_CLASS%s: ", ($flags & RUBY_FL_SINGLETON) ? "*" : ""
+ print (struct RClass *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
+ printf "T_ICLASS: "
+ print (struct RClass *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
+ printf "T_MODULE: "
+ print (struct RClass *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
+ printf "T_FLOAT: %.16g ", (((struct RFloat*)($arg0))->float_value)
+ print (struct RFloat *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+ printf "T_STRING: "
+ set print address off
+ output (char *)(($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.ptr : \
+ ((struct RString*)($arg0))->as.ary)
+ set print address on
+ printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.len : \
+ (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ if !($flags & RUBY_FL_USER1)
+ printf "(embed) "
+ else
+ if ($flags & RUBY_FL_USER2)
+ printf "(shared) "
+ end
+ if ($flags & RUBY_FL_USER3)
+ printf "(assoc) "
+ end
+ end
+ printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+ if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
+ printf "coderange:unknown "
+ else
+ if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
+ printf "coderange:7bit "
+ else
+ if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
+ printf "coderange:valid "
+ else
+ printf "coderange:broken "
+ end
+ end
+ end
+ print (struct RString *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
+ set $regsrc = ((struct RRegexp*)($arg0))->src
+ set $rsflags = ((struct RBasic*)$regsrc)->flags
+ printf "T_REGEXP: "
+ set print address off
+ output (char *)(($rsflags & RUBY_FL_USER1) ? \
+ ((struct RString*)$regsrc)->as.heap.ptr : \
+ ((struct RString*)$regsrc)->as.ary)
+ set print address on
+ printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
+ ((struct RString*)$regsrc)->as.heap.len : \
+ (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ if $flags & RUBY_FL_USER6
+ printf "(none) "
+ end
+ if $flags & RUBY_FL_USER5
+ printf "(literal) "
+ end
+ if $flags & RUBY_FL_USER4
+ printf "(fixed) "
+ end
+ printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+ print (struct RRegexp *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+ if ($flags & RUBY_FL_USER1)
+ set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+ printf "T_ARRAY: len=%ld ", $len
+ printf "(embed) "
+ if ($len == 0)
+ printf "{(empty)} "
+ else
+ output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+ printf " "
+ end
+ else
+ set $len = ((struct RArray*)($arg0))->as.heap.len
+ printf "T_ARRAY: len=%ld ", $len
+ if ($flags & RUBY_FL_USER2)
+ printf "(shared) shared="
+ output/x ((struct RArray*)($arg0))->as.heap.aux.shared
+ printf " "
+ else
+ printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+ end
+ if ($len == 0)
+ printf "{(empty)} "
+ else
+ output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+ printf " "
+ end
+ end
+ print (struct RArray *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
+ printf "T_FIXNUM: "
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_HASH
+ printf "T_HASH: ",
+ if ((struct RHash *)($arg0))->ntbl
+ printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
+ end
+ print (struct RHash *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
+ printf "T_STRUCT: len=%ld ", \
+ (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+ ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
+ ((struct RStruct *)($arg0))->as.heap.len)
+ print (struct RStruct *)($arg0)
+ x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+ ((struct RStruct *)($arg0))->as.ary : \
+ ((struct RStruct *)($arg0))->as.heap.ptr)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
+ printf "T_BIGNUM: sign=%d len=%ld ", \
+ (($flags & RUBY_FL_USER1) != 0), \
+ (($flags & RUBY_FL_USER2) ? \
+ ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+ ((struct RBignum*)($arg0))->as.heap.len)
+ if $flags & RUBY_FL_USER2
+ printf "(embed) "
+ end
+ print (struct RBignum *)($arg0)
+ x/xw (($flags & RUBY_FL_USER2) ? \
+ ((struct RBignum*)($arg0))->as.ary : \
+ ((struct RBignum*)($arg0))->as.heap.digits)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
+ printf "T_RATIONAL: "
+ print (struct RRational *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
+ printf "T_COMPLEX: "
+ print (struct RComplex *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_FILE
+ printf "T_FILE: "
+ print (struct RFile *)($arg0)
+ output *((struct RFile *)($arg0))->fptr
+ printf "\n"
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
+ printf "T_TRUE: "
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
+ printf "T_FALSE: "
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_DATA
+ if ((struct RTypedData *)($arg0))->typed_flag == 1
+ printf "T_DATA(%s): ", ((struct RTypedData *)($arg0))->type->wrap_struct_name
+ print (struct RTypedData *)($arg0)
+ else
+ printf "T_DATA: "
+ print (struct RData *)($arg0)
+ end
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
+ printf "T_MATCH: "
+ print (struct RMatch *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
+ printf "T_SYMBOL: "
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
+ printf "T_UNDEF: "
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_NODE
+ printf "T_NODE("
+ output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+ printf "): "
+ print *(NODE *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
+ printf "T_ZOMBIE: "
+ print (struct RData *)($arg0)
+ else
+ printf "unknown: "
+ print (struct RBasic *)($arg0)
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+end
+document rp
+ Print a Ruby's VALUE.
+end
+
+define nd_type
+ print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+end
+document nd_type
+ Print a Ruby' node type.
+end
+
+define nd_file
+ print ((NODE*)($arg0))->nd_file
+end
+document nd_file
+ Print the source file name of a node.
+end
+
+define nd_line
+ print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
+end
+document nd_line
+ Print the source line number of a node.
+end
+
+# Print members of ruby node.
+
+define nd_head
+ printf "u1.node: "
+ rp ($arg0).u1.node
+end
+
+define nd_alen
+ printf "u2.argc: "
+ p ($arg0).u2.argc
+end
+
+define nd_next
+ printf "u3.node: "
+ rp ($arg0).u3.node
+end
+
+
+define nd_cond
+ printf "u1.node: "
+ rp ($arg0).u1.node
+end
+
+define nd_body
+ printf "u2.node: "
+ rp ($arg0).u2.node
+end
+
+define nd_else
+ printf "u3.node: "
+ rp ($arg0).u3.node
+end
+
+
+define nd_orig
+ printf "u3.value: "
+ rp ($arg0).u3.value
+end
+
+
+define nd_resq
+ printf "u2.node: "
+ rp ($arg0).u2.node
+end
+
+define nd_ensr
+ printf "u3.node: "
+ rp ($arg0).u3.node
+end
+
+
+define nd_1st
+ printf "u1.node: "
+ rp ($arg0).u1.node
+end
+
+define nd_2nd
+ printf "u2.node: "
+ rp ($arg0).u2.node
+end
+
+
+define nd_stts
+ printf "u1.node: "
+ rp ($arg0).u1.node
+end
+
+
+define nd_entry
+ printf "u3.entry: "
+ p ($arg0).u3.entry
+end
+
+define nd_vid
+ printf "u1.id: "
+ p ($arg0).u1.id
+end
+
+define nd_cflag
+ printf "u2.id: "
+ p ($arg0).u2.id
+end
+
+define nd_cval
+ printf "u3.value: "
+ rp ($arg0).u3.value
+end
+
+
+define nd_cnt
+ printf "u3.cnt: "
+ p ($arg0).u3.cnt
+end
+
+define nd_tbl
+ printf "u1.tbl: "
+ p ($arg0).u1.tbl
+end
+
+
+define nd_var
+ printf "u1.node: "
+ rp ($arg0).u1.node
+end
+
+define nd_ibdy
+ printf "u2.node: "
+ rp ($arg0).u2.node
+end
+
+define nd_iter
+ printf "u3.node: "
+ rp ($arg0).u3.node
+end
+
+
+define nd_value
+ printf "u2.node: "
+ rp ($arg0).u2.node
+end
+
+define nd_aid
+ printf "u3.id: "
+ p ($arg0).u3.id
+end
+
+
+define nd_lit
+ printf "u1.value: "
+ rp ($arg0).u1.value
+end
+
+
+define nd_frml
+ printf "u1.node: "
+ rp ($arg0).u1.node
+end
+
+define nd_rest
+ printf "u2.argc: "
+ p ($arg0).u2.argc
+end
+
+define nd_opt
+ printf "u1.node: "
+ rp ($arg0).u1.node
+end
+
+
+define nd_recv
+ printf "u1.node: "
+ rp ($arg0).u1.node
+end
+
+define nd_mid
+ printf "u2.id: "
+ p ($arg0).u2.id
+end
+
+define nd_args
+ printf "u3.node: "
+ rp ($arg0).u3.node
+end
+
+
+define nd_noex
+ printf "u1.id: "
+ p ($arg0).u1.id
+end
+
+define nd_defn
+ printf "u3.node: "
+ rp ($arg0).u3.node
+end
+
+
+define nd_old
+ printf "u1.id: "
+ p ($arg0).u1.id
+end
+
+define nd_new
+ printf "u2.id: "
+ p ($arg0).u2.id
+end
+
+
+define nd_cfnc
+ printf "u1.cfunc: "
+ p ($arg0).u1.cfunc
+end
+
+define nd_argc
+ printf "u2.argc: "
+ p ($arg0).u2.argc
+end
+
+
+define nd_cname
+ printf "u1.id: "
+ p ($arg0).u1.id
+end
+
+define nd_super
+ printf "u3.node: "
+ rp ($arg0).u3.node
+end
+
+
+define nd_modl
+ printf "u1.id: "
+ p ($arg0).u1.id
+end
+
+define nd_clss
+ printf "u1.value: "
+ rp ($arg0).u1.value
+end
+
+
+define nd_beg
+ printf "u1.node: "
+ rp ($arg0).u1.node
+end
+
+define nd_end
+ printf "u2.node: "
+ rp ($arg0).u2.node
+end
+
+define nd_state
+ printf "u3.state: "
+ p ($arg0).u3.state
+end
+
+define nd_rval
+ printf "u2.value: "
+ rp ($arg0).u2.value
+end
+
+
+define nd_nth
+ printf "u2.argc: "
+ p ($arg0).u2.argc
+end
+
+
+define nd_tag
+ printf "u1.id: "
+ p ($arg0).u1.id
+end
+
+define nd_tval
+ printf "u2.value: "
+ rp ($arg0).u2.value
+end
+
+define rb_p
+ call rb_p($arg0)
+end
+
+define rb_numtable_entry
+ set $rb_numtable_tbl = $arg0
+ set $rb_numtable_id = (st_data_t)$arg1
+ set $rb_numtable_key = 0
+ set $rb_numtable_rec = 0
+ if $rb_numtable_tbl->entries_packed
+ set $rb_numtable_p = $rb_numtable_tbl->bins
+ while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->bins+$rb_numtable_tbl->num_entries
+ if (st_data_t)$rb_numtable_p[0] == $rb_numtable_id
+ set $rb_numtable_key = (st_data_t)$rb_numtable_p[0]
+ set $rb_numtable_rec = (st_data_t)$rb_numtable_p[1]
+ set $rb_numtable_p = 0
+ else
+ set $rb_numtable_p = $rb_numtable_p + 2
+ end
+ end
+ else
+ set $rb_numtable_p = $rb_numtable_tbl->bins[$rb_numtable_id % $rb_numtable_tbl->num_bins]
+ while $rb_numtable_p
+ if $rb_numtable_p->key == $rb_numtable_id
+ set $rb_numtable_key = $rb_numtable_p->key
+ set $rb_numtable_rec = $rb_numtable_p->record
+ set $rb_numtable_p = 0
+ else
+ set $rb_numtable_p = $rb_numtable_p->next
+ end
+ end
+ end
+end
+
+define rb_id2name
+ rb_numtable_entry global_symbols.id_str (ID)$arg0
+ if $rb_numtable_rec
+ rp $rb_numtable_rec
+ else
+ echo undef\n
+ end
+end
+document rb_id2name
+ Print the name of id
+end
+
+define rb_method_entry
+ set $rb_method_entry_klass = (struct RClass *)$arg0
+ set $rb_method_entry_id = (ID)$arg1
+ set $rb_method_entry_me = (rb_method_entry_t *)0
+ while !$rb_method_entry_me && $rb_method_entry_klass
+ rb_numtable_entry $rb_method_entry_klass->m_tbl $rb_method_entry_id
+ set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
+ if !$rb_method_entry_me
+ set $rb_method_entry_klass = (struct RClass *)$rb_method_entry_klass->ptr->super
+ end
+ end
+ if $rb_method_entry_me
+ print *$rb_method_entry_klass
+ print *$rb_method_entry_me
+ else
+ echo method not found\n
+ end
+end
+document rb_method_entry
+ Search method entry by class and id
+end
+
+define rb_classname
+ call classname($arg0)
+ rb_p $
+ print *(struct RClass*)($arg0)
+end
+
+define rb_backtrace
+ call rb_backtrace()
+end
+
+define iseq
+ if dummy_gdb_enums.special_consts
+ end
+ if ($arg0)->type == ISEQ_ELEMENT_NONE
+ echo [none]\n
+ end
+ if ($arg0)->type == ISEQ_ELEMENT_LABEL
+ print *(LABEL*)($arg0)
+ end
+ if ($arg0)->type == ISEQ_ELEMENT_INSN
+ print *(INSN*)($arg0)
+ if ((INSN*)($arg0))->insn_id != YARVINSN_jump
+ set $i = 0
+ set $operand_size = ((INSN*)($arg0))->operand_size
+ set $operands = ((INSN*)($arg0))->operands
+ while $i < $operand_size
+ rp $operands[$i++]
+ end
+ end
+ end
+ if ($arg0)->type == ISEQ_ELEMENT_ADJUST
+ print *(ADJUST*)($arg0)
+ end
+end
+
+define rb_ps
+ rb_ps_vm ruby_current_vm
+end
+document rb_ps
+Dump all threads and their callstacks
+end
+
+define rb_ps_vm
+ print $ps_vm = (rb_vm_t*)$arg0
+ set $ps_threads = (st_table*)$ps_vm->living_threads
+ if $ps_threads->entries_packed
+ set $ps_threads_i = 0
+ while $ps_threads_i < $ps_threads->num_entries
+ set $ps_threads_key = (st_data_t)$ps_threads->bins[$ps_threads_i * 2]
+ set $ps_threads_val = (st_data_t)$ps_threads->bins[$ps_threads_i * 2 + 1]
+ rb_ps_thread $ps_threads_key $ps_threads_val
+ set $ps_threads_i = $ps_threads_i + 1
+ end
+ else
+ set $ps_threads_ptr = (st_table_entry*)$ps_threads->head
+ while $ps_threads_ptr
+ set $ps_threads_key = (st_data_t)$ps_threads_ptr->key
+ set $ps_threads_val = (st_data_t)$ps_threads_ptr->record
+ rb_ps_thread $ps_threads_key $ps_threads_val
+ set $ps_threads_ptr = (st_table_entry*)$ps_threads_ptr->fore
+ end
+ end
+end
+document rb_ps_vm
+Dump all threads in a (rb_vm_t*) and their callstacks
+end
+
+define rb_ps_thread
+ set $ps_thread = (struct RTypedData*)$arg0
+ set $ps_thread_id = $arg1
+ print $ps_thread_th = (rb_thread_t*)$ps_thread->data
+end
diff --git a/.gitignore b/.gitignore
new file mode 100644
index 0000000000..57557c9c2e
--- /dev/null
+++ b/.gitignore
@@ -0,0 +1,131 @@
+*-*-*.def
+*.a
+*.bak
+*.dSYM
+*.dylib
+*.inc
+*.log
+*.o
+*.orig
+*.rej
+*.sav
+*.swp
+*~
+.*-*
+.*.list
+.*.time
+.DS_Store
+.ccmalloc
+.ext
+.pc
+.ppack
+.svn
+Makefile
+extconf.h
+y.output
+y.tab.c
+
+# /
+/*.pc
+/*_prelude.c
+/COPYING.LIB
+/ChangeLog-1.8.0
+/ChangeLog.pre-alpha
+/ChangeLog.pre1_1
+/Doxyfile
+/GNUmakefile
+/README.atheos
+/README.fat-patch
+/README.v6
+/TAGS
+/archive
+/autom4te*.cache
+/automake
+/beos
+/breakpoints.gdb
+/config.cache
+/config.h
+/config.h.in
+/config.status
+/config.status.lineno
+/configure
+/doc/capi
+/enc.mk
+/enc/trans/*.c
+/encdb.h
+/exts.mk
+/goruby
+/id.h
+/largefile.h
+/lex.c
+/libruby*.*
+/miniprelude.c
+/miniruby
+/newdate.rb
+/newline.c
+/newver.rb
+/parse.c
+/parse.h
+/patches
+/patches-master
+/pitest.rb
+/ppack
+/prelude.c
+/preview
+/rbconfig.rb
+/rename2.h
+/repack
+/revision.h
+/riscos
+/rubicon
+/ruby
+/ruby-man.rd.gz
+/test.rb
+/tmp
+/transdb.h
+/uncommon.mk
+/web
+/yasmdata.rb
+
+# /benchmark/
+/benchmark/bmx_*.rb
+
+# /enc/trans/
+/enc/trans/*.c
+
+# /ext/
+/ext/extinit.c
+
+# /ext/dl/
+/ext/dl/*.func
+
+# /ext/dl/callback/
+/ext/dl/callback/*.func
+/ext/dl/callback/callback-*.c
+/ext/dl/callback/callback.c
+
+# /ext/iconv/
+/ext/iconv/config.charset
+/ext/iconv/iconv.rb
+
+# /ext/ripper/
+/ext/ripper/eventids1.c
+/ext/ripper/eventids2table.c
+/ext/ripper/ripper.*
+/ext/ripper/ids1
+/ext/ripper/ids2
+
+# /ext/socket/
+/ext/socket/constants.h
+/ext/socket/constdefs.h
+/ext/socket/constdefs.c
+
+# /ext/tk/
+/ext/tk/config_list
+
+# /spec/
+/spec/mspec
+/spec/rubyspec
+
+# /win32/
+/win32/*.ico
diff --git a/.indent.pro b/.indent.pro
new file mode 100644
index 0000000000..6a207a0554
--- /dev/null
+++ b/.indent.pro
@@ -0,0 +1,21 @@
+-bap
+-nbbb
+-nbc
+-br
+-nbs
+-ncdb
+-ce
+-cli0.5
+-ndj
+-ei
+-nfc1
+-i4
+-l120
+-lp
+-npcs
+-psl
+-sc
+-sob
+
+-TID
+-TVALUE
diff --git a/.travis.yml b/.travis.yml
new file mode 100644
index 0000000000..286342c1cc
--- /dev/null
+++ b/.travis.yml
@@ -0,0 +1,8 @@
+# no installation...
+before_script: autoconf
+script: "./configure && make all test"
+
+branches:
+ only:
+ - trunk
+ - ruby_1_9_3
diff --git a/BSDL b/BSDL
new file mode 100644
index 0000000000..82725534fa
--- /dev/null
+++ b/BSDL
@@ -0,0 +1,22 @@
+Copyright (C) 1993-2010 Yukihiro Matsumoto. All rights reserved.
+
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions
+are met:
+1. Redistributions of source code must retain the above copyright
+notice, this list of conditions and the following disclaimer.
+2. Redistributions in binary form must reproduce the above copyright
+notice, this list of conditions and the following disclaimer in the
+documentation and/or other materials provided with the distribution.
+
+THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGE.
diff --git a/COPYING b/COPYING
index 9043404a83..a1f19ff99d 100644
--- a/COPYING
+++ b/COPYING
@@ -1,6 +1,6 @@
Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
-You can redistribute it and/or modify it under either the terms of the GPL
-version 2 (see the file GPL), or the conditions below:
+You can redistribute it and/or modify it under either the terms of the
+2-clause BSDL (see the file BSDL), or the conditions below:
1. You may make and give away verbatim copies of the source form of the
software without restriction, provided that you duplicate all of the
diff --git a/COPYING.ja b/COPYING.ja
index 933cc7cb9a..5b5b91c149 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -1,6 +1,6 @@
-$BK\%W%m%0%i%`$O%U%j!<%=%U%H%&%'%"$G$9!%(BGPL(the GNU General
-Public License)$B$^$?$O0J2<$K<($9>r7o$GK\%W%m%0%i%`$r:FG[I[$G(B
-$B$-$^$9!%(BGPL$B$K$D$$$F$O(BGPL$B%U%!%$%k$r;2>H$7$F2<$5$$!%(B
+$BK\%W%m%0%i%`$O%U%j!<%=%U%H%&%'%"$G$9!%(B2-clause BSDL
+$B$^$?$O0J2<$K<($9>r7o$GK\%W%m%0%i%`$r:FG[I[$G$-$^$9(B
+2-clause BSDL$B$K$D$$$F$O(BBSDL$B%U%!%$%k$r;2>H$7$F2<$5$$!%(B
1. $BJ#@=$O@)8B$J$/<+M3$G$9!%(B
diff --git a/ChangeLog b/ChangeLog
index 8492394873..b34ed8cda1 100644
--- a/ChangeLog
+++ b/ChangeLog
@@ -1,17862 +1,16435 @@
-Thu Aug 16 04:34:56 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Nov 10 00:37:02 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * process.c (proc_exec_v, rb_proc_exec): preserve errno.
+ * siphash.h: check configure macros before include newer headers.
-Thu Aug 16 04:30:45 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Nov 10 00:37:02 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * variable.c (rb_path2class): get rid of dangling pointer caused by
- optimized out value.
+ * siphash.c (sip_init_state): use union to suppress warnings by gcc
+ 4.7.
-Thu Aug 16 04:24:28 2007 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Nov 10 00:37:02 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/dl/lib/dl/win32.rb: seems that dl doesn't accept void argument.
- fixed [ruby-bugs:PR#5489].
+ * random.c (rb_memhash): use siphash.
-Thu Aug 16 04:23:44 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Nov 9 16:17:09 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser): handle more
- extensions. [ruby-dev:30972]
+ * file.c (append_fspath): revert a part of r37562.
-Thu Aug 16 04:14:17 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * file.c (rb_file_expand_path_internal): ditto.
- * process.c (ruby_setreuid, ruby_setregid): rename to get rid of name
- clash.
-Thu Aug 16 04:11:17 2007 Ryan Davis <ryand@zenspider.com>
+ * file.c (rb_file_expand_path_internal): ignore the encoding of the
+ given path name and use filesystem encoding, except when the result
+ is 8bit range and the filesystem encoding is US-ASCII.
+ [ruby-dev:39393] [Bug #2154]
- * lib/rexml/dtd/dtd.rb: Fixed typo in code. Fixes bug #10420
+Fri Nov 9 16:15:50 2012 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-Thu Aug 16 04:08:20 2007 Shugo Maeda <shugo@ruby-lang.org>
+ * test/csv/test_features.rb: add require for Tempfile.
+ * test/csv/test_serialization.rb: ditto.
- * lib/net/imap.rb (ResponseParser#next_token): fixed
- error message. (backported from HEAD)
+Fri Nov 9 13:47:45 2012 Luis Lavena <luislavena@gmail.com>
- * lib/net/imap.rb (ResponseParser#parse_error): fixed
- the condition not to refer @token.symbol unexpectedly.
- Thanks, Dick Monahan. (backported from HEAD)
+ * test/win32ole/test_win32ole.rb (test_s_codepage_changed):
+ FileSystemObject only supports ANSI or UTF-16LE encoding.
+ Patch by bosko (Bosko Ivanisevic) [ruby-trunk - Bug #6650]
-Thu Aug 16 04:05:20 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Nov 9 13:16:16 2012 Kenta Murata <mrkn@mrkn.jp>
- * marshal.c (w_extended): erroneous check condition when dump
- method is defined. [ruby-core:10646]
+ * bignum.c (bigmul0): enable big_mul_toom3.
+ [ruby-core:48552] [Bug #7242]
-Sat Jun 9 10:40:00 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * bignum.c (bigmul1_toom3): fix incorrect calculation.
+ the patch is made by Heesob Park.
+ [ruby-core:48552] [Bug #7242]
- * stable version 1.8.5-p52 released.
+Fri Nov 9 13:16:16 2012 Kenta Murata <mrkn@mrkn.jp>
-Thu Jun 7 14:53:46 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * bignum.c (bigmul0): disable big_mul_toom3 temporalily.
+ [ruby-core:48552] [Bug #7242]
- * eval.c (method_inspect): show proper class name.
- [ruby-talk:248647], Thanks Calamitas.
+ * test/ruby/test_bignum.rb (test_mul_large_numbers):
+ add a test for bigmul1_toom3 suggested in [Bug #7242].
-Mon May 28 19:37:24 2007 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Nov 8 17:37:54 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/win32.c (move_to_next_entry): revert r12338. not necessary
- on ruby_1_8_5.
+ * file.c (append_fspath): filesystem encoding is prior to the encoding
+ of argument.
-Sun May 27 05:52:37 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * file.c (rb_file_expand_path_internal, EXPAND_PATH_BUFFER): ignore
+ the encoding of the given path name, use filesystem encoding always
+ instead. [ruby-dev:39393] [Bug #2154]
- * eval.c (mnew): call of super via a method object should work again.
- [ruby-talk:248647], Thanks Calamitas.
+ * test/ruby/test_file_exhaustive.rb: removed 2.0 spec tests.
- * test/ruby/test_method.rb (TestMethod::test_method_super): test for
- above fix.
+Thu Nov 8 17:33:53 2012 Luis Lavena <luislavena@gmail.com>
-Wed May 23 06:51:46 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * ext/zlib/extconf.rb: Recognize zlibwapi as linking library.
+ Patch by Daniel Berger.
- * lib/cgi.rb (CGI#[]): get rid of exceptions being raised.
- [ruby-dev:30740], Thanks Kentaro KAWAMOTO.
+ [ruby-core:44979] [Feature #6421]
-Wed May 23 06:14:15 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Nov 8 16:17:54 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * win32/win32.c (move_to_next_entry): loc also must move forward.
- [ruby-talk:251987]
+ * test/ruby/test_dir_m17n.rb: remove a garbage.
-Wed May 23 05:55:04 2007 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Nov 8 15:22:09 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * win32/win32.c (init_stdhandle): stderr should be without buffering,
- but mswin32 use buffering when stderr is not connected to tty.
+ * test/ruby/test_dir_m17n.rb: sorry, typo.
-Wed May 23 03:33:55 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Nov 8 14:50:02 2012 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * lib/monitor.rb (ConditionVariable#wait, mon_enter, mon_exit_for_cond):
- ensures Thread.critical to be false. [ruby-talk:248300]
+ * test/win32ole/test_win32ole_variant.rb: setting WIN32OLE.locale
+ to pass some assertion. Thanks to Hiroshi Shirosaki.
+ [ruby-core:46873][Bug #6814]
-Wed May 23 03:25:13 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Nov 8 14:46:17 2012 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * util.c (ruby_strtod): exponent is radix 10. [ruby-talk:248272]
+ * test/win32ole/test_win32ole.rb (test_s_codepage_changed):
+ FileSystemObject only supports ANSI or UTF-16LE encoding.
+ Patch by h.shirosaki (Hiroshi Shirosaki) [ruby-trunk - Bug #6650]
-Wed May 23 02:09:32 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
- * eval.c (rb_yield_0): should not clear state on TAG_NEXT when
- it's invoked from within lambda body. [ruby-talk:248136]
+Thu Nov 8 14:43:17 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * eval.c (proc_invoke): handle TAG_NEXT which would be caused by
- next in the lambda body as well.
+ * test/ruby/test_dir_m17n.rb: refactoring. RE should be in the left side
+ of the =~ operator, and compare the result with nil is meaningless.
-Wed May 23 01:55:49 2007 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Nov 8 14:43:17 2012 Luis Lavena <luislavena@gmail.com>
- * win32/win32.c (rb_w32_fclose, rb_w32_close): need to save errno
- before calling original fclose()/close().
+ * test/ruby/test_dir_m17n.rb (create_and_check_raw_file_name): add new
+ helper method to ease encoding testing. Patch by Oleg Sukhodolsky.
+ [ruby-core:46589][Bug #6765]
-Wed May 23 01:42:29 2007 Shugo Maeda <shugo@ruby-lang.org>
+ * test/ruby/test_dir_m17n.rb (test_filename_extutf8): use filesystem
+ encoding when reading entries and comparing.
- * lib/net/imap.rb (disconnect): call shutdown for
- SSLSocket. Thanks, Technorama Ltd.
+ * test/ruby/test_dir_m17n.rb (test_filename_utf8_raw_name): removed.
-Wed May 23 01:28:14 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_dir_m17n.rb (test_filename_utf8_raw_jp_name): split test.
- * error.c (rb_notimplement), io.c (pipe_open): removed definite
- articles and UNIX manual section from messages. [ruby-dev:30690]
+Thu Nov 8 14:16:53 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (pipe_open): raise NotImplementedError for command "-" on
- platforms where fork(2) is not available. [ruby-dev:30681]
+ * lib/mkmf.rb (MakeMakefile#timestamp_file): use .-. instead of !, a
+ special character of NMAKE and BSD make. [Bug #7265]
-Wed May 23 00:06:19 2007 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Nov 8 14:16:53 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/socket.c (s_recv, s_recvfrom): some systems (such as
- windows) doesn't set fromlen if the socket is connection-oriented.
- reported by Bram Whillock in [ruby-core:10512] [ruby-Bugs#9061]
+ * lib/mkmf.rb (MakeMakefile#timestamp_file): use ! instead of %, a GNU
+ make special character.
-Tue Mar 20 15:37:24 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
+Thu Nov 8 14:16:53 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * distruby.rb: Add zip generation.
+ * lib/mkmf.rb (create_makefile): use timestamp for destination
+ directories to make them before making or copying files there.
+ [ruby-dev:46067] [Bug #6904]
-Fri Mar 16 21:48:11 2007 Akinori MUSHA <knu@iDaemons.org>
+Thu Nov 8 14:13:53 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/dl/dl.c (rb_ary2cary): Fix a bug in type validation;
- submitted by sheepman <sheepman AT sheepman.sakura.ne.jp>
- in [ruby-dev:30554].
+ * configure.in (visibility_option): visibility attribute is not
+ available before GCC 4, so do not use -fvisibility option in that
+ case. [ruby-core:48147] [Bug #7205]
-Fri Mar 16 18:28:06 2007 Akinori MUSHA <knu@iDaemons.org>
+Thu Nov 8 14:11:49 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/etc/etc.c (etc_getgrgid): Fix a bug in Etc::getgrgid()
- always returning the (real) group entry of the running process;
- reported by: UEDA Hiroyuki <ueda AT netforest.ad.jp>
- in [ruby-dev:30586].
+ * vm.c (rb_vm_jump_tag_but_local_jump): pass through thrown objects.
+ [ruby-dev:46234] [Bug #7185]
-Wed Mar 14 12:30:00 2007 Shigeo Kobayashi <shigeo@tinyforest.jp>
+ * vm_eval.c (rb_eval_cmd): if state is non-zero, val should be nil and
+ rb_vm_jump_tag_but_local_jump() just jump tag.
- * ext/bigdecimal/bigdecimal.c: BigDecimal("-.31") is now
- treated as ("-0.31") not as ("0.31").
+Thu Nov 8 14:09:18 2012 Kenta Murata <mrkn@mrkn.jp>
-Fri Mar 16 18:05:40 2007 Akinori MUSHA <knu@iDaemons.org>
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_add),
+ test/bigdecimal/test_bigdecimal.rb:
+ need to specify precision for converting Rational and Float.
+ [ruby-core:48045] [Bug #7176]
- * lib/cgi.rb (CGI::header): IIS >= 5.0 does not need the nph
- assumption any more; submitted by MIYASAKA Masaru <alkaid AT
- coral.ocn.ne.jp> in [ruby-dev:30537].
+Thu Nov 8 14:05:31 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Mar 13 17:29:43 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * win32/win32.c (has_redirection): should use shell (cmd.exe) when
+ the commandline containts '&'.
+ reported by Roger Pack at [ruby-core:47912] [Bug #7143], and
+ patched by Heesob Park at [ruby-core:47931].
- * stable version 1.8.5-p35 released.
+Fri Oct 26 17:22:18 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Mar 13 14:42:10 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * file.c (append_fspath): need to set the encoding to result always.
- * test/fileutils/fileasserts.rb: Fix wrong error message.
+Fri Oct 26 11:03:46 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/fileutils.rb (FileUtils::mv): Type Error; should utilize
- Strings instead of Symbols here.
+ * file.c (rb_enc_path_next, rb_enc_path_skip_prefix)
+ (rb_enc_path_last_separator, rb_enc_path_end)
+ (ruby_enc_find_basename, ruby_enc_find_extname): encoding-aware
+ path handling functions.
-Mon Mar 12 17:22:44 2007 NAKAMURA Usaku <usa@ruby-lang.org>
+ * file.c (rb_home_dir, file_expand_path, rb_realpath_internal)
+ (rb_file_s_basename, rb_file_dirname, rb_file_s_extname)
+ (rb_file_join): should respect the encodings of arguments than
+ file system encoding. [ruby-dev:45145] [Bug #5919]
- * lib/fileutils.rb (FileUtils::mv): fix incomplete backport of
- FileUtils.mv changes at r11988
+ * dir.c (check_dirname, ruby_glob0): ditto.
-Mon Mar 12 16:09:28 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/pathname/pathname.c (path_sub_ext): ditto.
- * mkconfig.rb (patchlevel): read from version.h.
+Fri Oct 26 11:03:46 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Sun Mar 11 18:57:50 2007 Akinori MUSHA <knu@iDaemons.org>
+ * util.c, include/ruby/util.h (ruby_add_suffix): remove the function.
+ [Bug #5153] [ruby-core:38736]
- * misc/README: Add a note about ruby-electric.el.
+ * io.c (argf_next_argv): remove the call of above function.
- * misc/ruby-mode.el (ruby-non-block-do-re): Fix
- ruby-non-block-do-re. [ruby-core:03719]
+ * ext/-test-/add_suffix, test/-ext-/test_add_suffix.rb: remove the test
+ extension module because this is only for testsing ruby_add_suffix().
- * misc/inf-ruby.el: Synchronize the comment section with trunk.
+ * LEGAL: remove the mention about a part of util.c, because now we
+ removed the part.
- * misc/README, misc/rdebug.el: Add rdebug.el, Emacs ruby-debug
- interface based on rubydb3x.el; submitted by Martin Nordholts
- <enselic AT gmail.com> in [ruby-bugs:PR#9023].
+ * io.c (argf_next_argv): now the new filename is not guranteed to
+ use, so should check the return value of rename(2).
-Sun Mar 11 17:45:51 2007 Akinori MUSHA <knu@iDaemons.org>
+ * test/ruby/test_argf.rb (TestArgf#test_inplace_rename_impossible):
+ now we expect same result with other platforms on no_safe_rename
+ platforms (=Windows).
- * ext/dl/mkcallback.rb (mkfunc): Make sure that a callback
- function is found in the function table before trying to call
- it; submitted by sheepman <sheepman AT sheepman.sakura.ne.jp>
- in [ruby-dev:30524].
+Thu Oct 25 18:16:25 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Mar 6 18:58:37 2007 Keiju Ishitsuka <keiju@ruby-lang.org>
-
- * lib/shell/process-controller.rb: fix thread synchronization
- problem for [ruby-dev:30477].
-
-Sun Mar 4 23:53:27 2007 Minero Aoki <aamine@loveruby.net>
+ * lib/rubygems/installer.rb (check_that_user_bin_dir_is_in_path):
+ test_generate_bin_bindir_with_user_install_warning(TestGemInstaller)
+ fails on Windows with msys bash. It makes comparing paths
+ case-insensitive.
+ pick from upstream to fix a failure of test-all [ruby-core:47711]
+ https://github.com/rubygems/rubygems/commit/c474edb2f3704206f04da1c8c6cf9fb079d84abe
- * lib/fileutils.rb (mv): could not move a directory between
- different filesystems. [ruby-dev:30411]
+Thu Oct 25 17:55:01 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Mar 3 21:41:31 2007 Akinori MUSHA <knu@iDaemons.org>
+ * test/etc/test_etc.rb (TestEtc#test_getpwuid): `s' is never set to nil.
- * eval.c (stack_check): Unset inline to fix build with GCC 3.4.6;
- submitted by: NISHIMATSU Takeshi <t_nissie AT yahoo.co.jp> in
- [ruby-list:43218].
- cf. http://gcc.gnu.org/bugzilla/show_bug.cgi?id=24556
+Thu Oct 25 16:59:17 2012 Luis Lavena <luislavena@gmail.com>
-Sat Mar 3 16:30:39 2007 Akinori MUSHA <knu@iDaemons.org>
+ * test/ruby/test_file_exhaustive.rb: fix test introduced in r36811 for
+ posix environments where HOME is not defined. [ruby-core:47322]
- * env.h (SCOPE_CLONE): Introduce a new scope flag to prevent a
- local_tbl region from getting freed many times; submitted by
- Chikanaga Tomoyuki <chikanag AT nippon-control-system.co.jp> in
- [ruby-dev:30460].
+Thu Oct 25 16:59:17 2012 Luis Lavena <luislavena@gmail.com>
- * eval.c (proc_invoke): Ditto.
+ * configure.in (mingw): add shlwapi to the list of dependency
+ libs for Windows.
+ * win32/Makefile.sub (EXTSOLIBS): ditto.
- * gc.c (obj_free): Ditto.
+ * internal.h: declare internal functions rb_w32_init_file,
+ rb_file_expand_path_internal and rb_file_expand_path_fast.
- * parse.y (top_local_setup_gen): Ditto.
+ * file.c (Init_File): invoke Windows initialization rb_w32_init_file
-Sat Mar 3 15:41:33 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/file.c (rb_file_load_path_internal): new function.
+ Windows-specific implementation that replaces file_expand_path.
+ [Bug #6836][ruby-core:46996]
- * parse.y (stmt, arg): should not omit lhs of OP_ASGN1 even if
- empty. [ruby-dev:30452]
+ * win32/file.c (rb_w32_init_file): new function. Initialize codepage
+ cache for faster conversion encodings lookup.
-Wed Feb 28 20:51:32 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * file.c (file_expand_path): rename to rb_file_expand_path_internal.
+ Conditionally exclude from Windows.
- * pack.c (pack_unpack): properly ignore non-base64 octets such as
- UTF-8 encoded BOMs; submitted by SOUMA Yutaka <holon@radastery.jp>
- to fix [ruby-core:10437]
+ * file.c (rb_file_expand_path_fast): new function. delegates to
+ rb_file_expand_path_internal without performing a hit to the
+ filesystem.
-Wed Feb 28 00:08:11 2007 URABE Shyouhei <shyouhei@ice.uec.ac.jp>
+ * file.c (file_expand_path_1): use rb_file_expand_path_internal without
+ path expansion (used by require).
+ * file.c (rb_find_file_ext_safe): ditto.
+ * file.c (rb_find_file_safe): ditto.
- * mkconfig.rb (RbConfig): add CONFIG['PATCHLEVEL']
+ * load.c (rb_get_expanded_load_path): use rb_file_expand_path_fast.
+ * load.c (rb_feature_provided): ditto.
- * common.mk: new target dist
+ * file.c (rb_file_expand_path): use rb_file_expand_path_internal with
+ path expansion.
+ * file.c (rb_file_absolute_path): ditto.
- * distruby.rb: new file
+ * test/ruby/test_file_exhaustive.rb: new tests to exercise
+ rb_file_expand_path_internal implementation and compliance with
+ existing behaviors.
-Tue Feb 27 21:19:35 2007 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Oct 25 16:59:17 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * win32/win32.c (set_pioinfo_extra): new function for VC++8 SP1
- workaround. [ruby-core:10259]
+ * win32/file.c (INVALID_FILE_ATTRIBUTES): define for old SDK.
- * win32/win32.c (NtInitialize): call above function.
+Thu Oct 25 16:59:17 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Feb 26 09:57:58 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * win32/makedirs.bat: new command to make intermediate
+ directories, and not to report any errors if the directory
+ already exists.
- * signal.c (ruby_signal): don't set SA_RESTART. a backport from
- the HEAD. [ruby-talk:220937] [ruby-talk:147220]
+ * win32/Makefile.sub (MAKEDIRS): enable command extensions.
-Tue Feb 13 02:21:12 2007 Sam Roberts <sroberts@uniserve.com>
+Thu Oct 25 16:59:17 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * io.c (rb_f_syscall): Fix buffer overflow with syscall
- arguments. [ruby-bugs:PR#8541]
+ * win32/Makefile.sub (MAKEDIRS): use mkdir of cmd.exe instead of ruby.
+ [Bug #6103] [ruby-core:43012]
-Sat Feb 10 09:33:47 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * win32/README.win32: added a notice about command extension of cmd.exe.
- * ext/win32ole/win32ole.c (ole_variant2val): sorry, fix the enbug.
+Thu Oct 25 16:59:17 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
-Sat Feb 10 09:08:01 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * Makefile.in (PLATFORM_DIR): add a variable for `win32` directory.
+ * Makefile.in (clean-platform): add new target.
+ It cleans `win32` directory.
- * ext/win32ole/win32ole.c (ole_variant2val): fix compile error
- on VC++.
-
-Sat Feb 10 08:38:30 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_variant2val): fix the bug when
- SAFEARRAY pointer is NULL.
-
-Tue Feb 6 20:41:39 2007 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * string.c (rb_str_sub_bang): calling rb_str_modify() should be just
- before actually modifying the string.
- fixed: [ruby-dev:30211] (originally reported by zunda)
-
-Sat Jan 27 15:20:11 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (dyna_var_lookup): should not alter dvar->val not to
- destroy living value. [ruby-core:10076]
-
- * parse.y (dyna_init): ditto.
-
-Wed Jan 24 18:05:39 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): fix
- regexp font-lock bug. [ruby-talk:235758]
-
-Sun Jan 14 07:26:44 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_free, ole_type_free,
- olemethod_free, olevariable_free, oleparam_free,
- ole_event_free): fix memory leak. [ruby-core:09846]
-
-Tue Jan 9 12:29:20 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/etc/etc.c (etc_getpwuid, etc_getgrgid): fix to correctly
- convert uid/gid from VALUE.
-
- * ext/etc/etc.c (etc_getpwuid): ditto.
-
-Mon Dec 25 20:08:28 2006 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * ext/openssl/ossl.h: fixed compilation problem on gcc 3.2.
- [ruby-talk:214786]
-
-Mon Dec 25 10:40:40 2006 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * stable version 1.8.5-p12 released.
-
-Sat Dec 16 04:02:10 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tcltklib.c: shouldn't run the killed thread at callback.
- [ruby-talk: 227408]
-
-Fri Dec 15 17:21:14 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/rdoc/ri/ri_options.rb: prevent NameError. [ruby-dev:29597]
-
-Thu Dec 14 23:37:38 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (glob_helper): get rid of possible memory leak.
-
- * win32/win32.c (cmdglob, rb_w32_cmdvector, rb_w32_opendir,
- rb_w32_get_environ): not to use GC before initialization.
-
-Wed Dec 6 19:53:41 2006 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in (SITE_DIR): fixed to emtpy RUBY_SITE_LIB in config.h on
- NetBSD. fixed: [ruby-dev:29358]
-
-Mon Dec 4 10:43:46 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (dyna_init_gen): dvar initialization only if dvar is
- assigned inner block. [ruby-talk:227402]
-
-Mon Dec 4 10:22:26 2006 URABE Shyouhei <shyouhei@ice.uec.ac.jp>
-
- * stable version 1.8.5-p2 released.
-
-Sun Dec 3 17:11:12 2006 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/cgi.rb (CGI::QueryExtension::read_multipart): should quote
- boundary. JVN#84798830
-
-Sun Nov 26 16:36:46 2006 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * version.h: addition of RUBY_PATCHLEVEL.
- * version.c: ditto.
-
-Fri Nov 24 10:17:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * bignum.c (bignorm): avoid segmentation. a patch from Hiroyuki
- Ito <ZXB01226@nifty.com>. [ruby-list:43012]
-
-Thu Nov 2 15:43:39 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * parse.y (primary): should set NODE even when compstmt is NULL.
- merge from trunk. fixed: [ruby-dev:29732]
-
-Sat Sep 23 21:34:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi.rb (CGI::QueryExtension::read_multipart): CGI content
- may be empty. a patch from Jamis Buck <jamis at 37signals.com>.
-
-Mon Sep 4 21:43:57 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/dbm/extconf.rb: create makefile according to the result of check
- for dbm header. fixed: [ruby-dev:29445]
-
-Tue Aug 29 19:10:10 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (rb_hash_s_create): fixed memory leak, based on the patch
- by Kent Sibilev <ksruby at gmail.com>. fixed: [ruby-talk:211233]
-
-Fri Aug 25 17:15:17 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * stable version 1.8.5 released.
-
-Fri Aug 25 17:02:06 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (gc_sweep): typo fixed.
-
-Tue Aug 22 18:47:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_method):
- rdoc documents C module methods as instance methods. a patch in
- [ruby-core:08536].
-
-Sat Aug 19 14:15:02 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub (config.status): include winsock2.h instead of
- winsock.h when --with-winsock2 is specified.
- fixed: [ruby-dev:29296]
-
-Sat Aug 19 11:28:08 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_file_s_rename): use errno if set properly.
- fixed: [ruby-dev:29293]
-
-Sat Aug 19 11:09:23 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (then): remove semicolon warning. [ruby-dev:29299]
-
-Thu Aug 17 19:15:16 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_stat_[rRwWxX]): check for super user.
- fixed: [ruby-core:08616]
-
-Thu Aug 17 14:47:06 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb: added rdoc by Daniel Berger. [ruby-core:08177]
-
-Thu Aug 17 00:39:05 2006 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/ring.rb (do_reply): Fix for RingServer fails to find a
- TupleSpace when TupleSpace resides in the same ruby process with
- RingServer. a patch from Kent Sibilev. [ruby-core:08453]
-
-Wed Aug 16 11:45:36 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (proc_setuid, proc_setgid, proc_seteuid, proc_setegid):
- get rid of bogus implementations on Mac OS X.
-
-Tue Aug 15 19:10:18 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_class_comment): Fix
- broken class-level documentation.
-
-Wed Aug 16 11:09:26 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (set_arg0): fill argv other than the first with an empty
- string instead of NULL.
-
-Wed Aug 16 11:08:00 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.h: removed an excess macro. fixed: [ruby-dev:29258]
-
-Tue Aug 8 23:49:06 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/irb/extend-command.rb (IRB::ExtendCommandBundle): pacify
- RDoc. a patch from Eric Hodel <drbrain at segment7.net>.
- [ruby-core:08522]
-
-Tue Aug 8 11:32:54 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * Makefile.in, common.mk, configure.in: fix for platforms without
- rm. patches from Yutaka kanemoto <kinpoco at gmail.com>.
- [ruby-dev:29215]
-
-Mon Aug 7 17:56:59 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c, ext/digest/rmd160/rmd160ossl.c,
- ext/digest/sha1/sha1ossl.c, ext/readline/readline.c: move
- incluion of config.h to pacify AIX. a patch from Yutaka
- Kanemoto <kinpoco at gmail.com>. [ruby-dev:29197]
-
-Mon Aug 7 15:55:08 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/syck/syck.c (syck_move_tokens): should avoid negative
- memmove. [ruby-list:42625]
-
-Mon Aug 7 14:37:48 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * configure.in, common.mk: AIX link issue. a patch from Yutaka
- Kanemoto <kinpoco at gmail.com>. [ruby-dev:29190]
-
- * ext/socket/socket.c: AIX socket support. [ruby-dev:29190]
-
-Mon Aug 7 12:05:28 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * dln.c, eval.c, gc.c, regex.c, ruby.h: shut up AIX alloca
- warning. a patch from Yutaka Kanemoto <kinpoco at gmail.com>.
- [ruby-dev:29191]
-
-Sun Aug 6 20:40:41 2006 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date/format.rb (str[fp]time): %[EO]U didn't denote %U.
-
-Sat Aug 5 17:07:43 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (top_local_setup): local_vars[-1] should point
- ruby_scope itself to protect local_tbl from garbage collection.
- [ruby-dev:29049]
-
-Sat Aug 5 13:54:03 2006 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date/format.rb (str[fp]time): "%\n" means "\n".
-
-Fri Aug 4 15:21:00 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib: Merge RDoc and .document from HEAD.
- * lib/drb/ssl.rb: Close socket on SSLError [ruby-core:7197]
-
-Fri Aug 4 19:13:41 2006 Keiju Ishitsuka <keiju@ruby-lang.org>
-
- * lib/irb/{init.rb,ruby-lex.rb,slex.rb}: can't input '\c' for
- [ruby-core: 7122].
-
-Fri Aug 4 14:02:14 2006 James Edward Gray II <james@grayproductions.net>
-
- * lib/date/format.rb (__strptime, strftime): allow multi-line patterns
- in Date#strftime the same as Time#strftime accepts.
- fixed: [ruby-core:08466]
-
-Fri Aug 4 13:56:51 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * pack.c (pack_pack): check argument overrun for 'P'. based on a
- patch by rucila <rucila at yahoo.cojp>. fixed: [ruby-dev:29182]
-
-Tue Aug 1 17:44:03 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (init_stdhandle): assign standard file handles.
-
-Tue Aug 1 12:24:58 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (Init_Binding): fix old commit miss.
-
-Mon Jul 31 17:08:20 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (exit_handler): new function; release winsock and
- environment work area.
-
- * win32/win32.c (NTInitialize): setup exit_handler.
-
- * win32/win32.c (StartSockets): use exit_handler.
-
- * win32/win32.c (rb_w32_getenv): use GetEnvironmentStrings() instead
- of GetEnvironmentVariable(), because the latter cannot distinguish
- wheather a null environment variable exists or not.
- fixed: [ruby-talk:205123]
-
-Mon Jul 31 16:15:13 2006 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_process.rb (TestProcess#test_rlimit_nofile):
- setrlimit may fail with EINVAL.
- reported by MIYAMUKO Katsuyuki. [ruby-dev:29174]
-
-Mon Jul 31 13:38:22 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httprequest.rb (WEBrick::HTTPReuqest#parse_uri): improve
- for the value of IPv6 address in the Host: header field.
-
-Mon Jul 31 09:22:12 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ruby.h: use ifdef (or defined) for macro constants that may or
- may not be defined to shut up gcc's -Wundef warnings.
- [ruby-core:08447]
-
-Sun Jul 30 23:26:22 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_call0): trace call/return of method defined from block.
- fixed: [ruby-core:08329]
-
- * eval.c (rb_trap_eval): make the current thread runnable to deal with
- exceptions which occurred within the trap. fixed: [ruby-dev:27729]
-
- * lib/cgi/session.rb, lib/cgi/session/pstore.rb: suppress warnings.
- fixed: [ruby-talk:204896]
-
-Sat Jul 29 06:12:06 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: freeze ip_name for security reason.
-
-Sat Jul 29 01:23:52 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/logger.rb: improves the amount of documentation that Rdoc
- picks up when processing logger.rb by moving the require
- statement back before the comment block. a patch from Hugh
- Sasse <hgs at dmu.ac.uk>. [ruby-core:08422]
-
-Thu Jul 27 22:21:52 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * time.c (time_to_s): fixed format mismatch.
-
-Thu Jul 27 21:19:54 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * math.c (domain_check): a new function to check domain error
- explicitly for systems that return NaN like FreeBSD.
- [ruby-core:07019]
-
- * math.c (math_acos, math_asin, math_acosh, math_atanh, math_log,
- math_log10, math_sqrt): use domain_check().
-
- * math.c (math_sqrt): fix documentation flaw.
-
-Thu Jul 27 18:12:12 2006 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * time.c: need to declare time_utc_offset.
-
-Thu Jul 27 17:01:01 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (io_close): always calls "close" method of the receiver.
- [ruby-core:6911] [ruby-core:8112]
-
-Thu Jul 27 16:49:01 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * time.c (time_to_s): use +0900 style timezone string for local time.
- [ruby-dev:29143]
-
-Thu Jul 27 16:41:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/openssl/ossl.h: move <ruby.h> inclusion point to shut up
- Solaris compiler. [ruby-core:08114]
-
-Wed Jul 26 22:20:59 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * configure.in: add support for as and ASFLAGS. [ruby-dev:29138]
-
-Wed Jul 26 22:13:45 2006 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb: sync with HEAD (rev 1.132).
-
- * lib/net/http.rb (Net::HTTP#post, request_post, request): should
- set Content-Type: x-www-form-urlencoded by default.
-
- * lib/net/http.rb (Net::HTTPHeader#content_type): should return
- nil when there's no Content-Type.
-
- * lib/net/http.rb (Net::HTTPHeader#sub_type): should return nil
- when there's no sub Content-Type (e.g. "Content-Type: text").
-
- * lib/net/http.rb (Net::HTTPHeader#type_params): wrongly failed
- when there's no Content-Type.
-
-Wed Jul 26 18:35:38 2006 Minero Aoki <aamine@loveruby.net>
-
- * ext/strscan/strscan.c: sync with HEAD (rev 1.25).
-
- * ext/strscan/strscan.c (strscan_do_scan):
- StringScanner.new("").scan(//) should return "". [ruby-Bugs:4361]
-
-Wed Jul 26 18:14:19 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/pty/pty.c (getDevice): retry once after GC on failure.
- [ruby-core:08282]
-
-Wed Jul 26 17:28:16 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): prepend ".." to %u for negative bignum,
- but not "-". fixed: [ruby-core:08167]
-
-Wed Jul 26 16:39:07 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_scan): add string modification check.
- [ruby-core:7216]
-
-Wed Jul 26 16:06:03 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi.rb (CGI::QueryExtension::read_multipart): check
- multipart boundary end. a patch from Fujioka <fuj at rabbix.jp>
- [ruby-dev:28470]
-
-Wed Jul 26 01:02:59 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: suppress warnings by automake 1.8 or later.
-
-Tue Jul 25 00:30:06 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/prettyprint.rb: RD to RDoc conversion by Hugh Sasse.
-
-Tue Jul 25 14:49:51 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/mkmf.rb (configuration): typo.
-
-Tue Jul 25 13:14:32 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * process.c (rb_proc_times): rename hz to hertz to avoid name
- crash on AIX. [ruby-dev:29126]
-
-Mon Jul 24 22:03:40 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (backtrace): skip frames successive on node and method name.
-
-Mon Jul 24 17:55:55 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * process.c (rb_f_system): add security check. [ruby-talk:202947]
-
- * process.c (rb_f_system): move signal right before fork to avoid
- signal handler intervention.
-
-Mon Jul 24 15:51:52 2006 Tanaka Akira <akr@fsij.org>
-
- * ext/readline/readline.c (readline_readline): rl_deprep_term_function
- may be NULL with libedit. reported by Ryan Davis. [ruby-dev:29070]
-
-Mon Jul 24 15:19:55 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_call0): revert last change. [ruby-dev:29112]
- [ruby-core:08374]
-
-Sun Jul 23 22:59:49 2006 Tanaka Akira <akr@fsij.org>
-
- * test/socket/test_unix.rb: disabled on cygwin.
- reported by Kouhei Yanagita. [ruby-dev:29080]
-
-Fri Jul 21 21:21:08 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_call0): include funcalled methods in caller list.
- fixed: [ruby-core:08290]
-
-Fri Jul 21 12:11:00 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb, lib/mkmf.rb (with_destdir): remove drive letter before
- prepending destdir on DOSISH.
-
-Thu Jul 20 15:07:14 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ruby.h: export classes/modules to implement sandbox.
- [ruby-core:08283]
-
-Thu Jul 20 00:06:29 2006 Keiju Ishitsuka <keiju@ishitsuka.com>
-
- * lib/irb/completion.rb: support for completion of numeric
- number. [ruby-dev: 29038]
-
-Wed Jul 19 23:53:05 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/parser.rb, lib/rss/utils.rb: added documents.
-
-Tue Jul 18 22:10:13 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * process.c (rb_f_system): block SIGCHLD during the process
- execution, like glibc system(3) does. [ruby-talk:202361]
-
-Tue Jul 18 23:12:14 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (open_ifs_socket): should not use plain malloc.
-
- * win32/win32.c (rb_w32_opendir): should not use plain realloc.
-
-Tue Jul 18 18:05:49 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * test/ruby/test_float.rb (TestFloat::test_strtod): update test to
- conform strtod change.
-
-Tue Jul 18 15:49:42 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * pack.c (pack_unpack): propagate association array to copied
- string. [ruby-core:08223]
-
- * pack.c (pack_unpack): return referenced string itself if it has
- same length as specified. a patch from <nobu at ruby-lang.org>
- in [ruby-core:08225].
-
- * pack.c (pack_pack): taint 'p' packed strings.
-
-Tue Jul 18 14:03:02 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/webrick/httpserver.rb (WEBrick::HTTPServer::unmount): remove
- inpect argument from sprintf. [ruby-dev:29039]
-
-Tue Jul 18 10:53:37 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (rb_cstr_to_dbl): limit out-of-range message.
-
- * util.c (ruby_strtod): return end pointer even if ERANGE occurred.
- fixed: [ruby-dev:29041]
-
-Mon Jul 18 00:43:05 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * util.c (ruby_strtod): stop at dot not followed by digits.
- fixed: [ruby-dev:29035]
-
-Tue Jul 18 00:01:27 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: remove LIBRUBY_SO if static linked extensions exist.
-
-Mon Jul 17 23:30:46 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_msvcrt): defaulted to msvcrt. Workaround for a
- bug of cygwin 1.5.20.
-
-Mon Jul 17 13:43:05 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * pack.c (define_swapx): should not use plain malloc.
-
-Mon Jul 17 12:58:41 2006 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in: should use ac_cv_lib_dl_dlopen=no on MinGW.
-
-Sat Jul 15 23:50:12 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_require_safe): wait for another thread requiring the same
- feature. fixed: [ruby-core:08229]
-
-Sat Jul 15 01:27:13 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (has_magic): glob names contain alphabets to enable case fold
- search also for directories. fixed: [ruby-talk:201917]
-
-Sat Jul 15 01:09:22 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * st.c (malloc): use xmalloc/xcalloc instead of plain
- malloc/calloc, to detect memory allocation failure. see
- <http://www.nongnu.org/failmalloc/>.
-
- * gc.c (rb_memerror): should not raise empty nomem_error.
-
-Fri Jul 14 13:08:13 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: add methods for new features of latest Tcl/Tk8.5.
-
- * ext/tk/lib/tk/namespace.rb: ditto.
-
-Fri Jul 14 02:30:12 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/monitor.rb: document patch from Hugh Sasse <hgs at dmu.ac.uk>.
- [ruby-core:08205]
-
-Fri Jul 14 01:09:46 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (then): error in warning action.
-
-Fri Jul 14 00:10:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_pop): may cause realloc oscillation. a patch
- from MORITA Naoyuki <mlgetter at kidou.sakura.ne.jp>.
- [ruby-dev:29028]
-
-Thu Jul 13 22:23:56 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/composite.rb: improve handling of the classname on the
- option database for the widget class which includes TkComposite.
-
-Thu Jul 13 20:32:19 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/parser.rb: updated documents by a patch from
- Hugh Sasse <hgs at dmu.ac.uk>. [ruby-core:8194]
-
-Wed Jul 12 13:54:09 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (then): we'd like to reserve colon here for the future.
- warning added.
-
-Tue Jul 11 20:58:18 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ruby.h: export rb_cMethod. [ruby-talk:201259]
-
-Tue Jul 11 19:13:33 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: remove restriction on the class of
- pseudo-toplevel.
-
-Tue Jul 11 18:00:57 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: security fix.
-
-Tue Jul 11 17:33:39 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * string.c (rb_str_dump): need to extend len for \b.
-
-Mon Jul 10 22:00:00 2006 Shigeo Kobayashi <shigek@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c: Allows '_' to appear within
- digits. [ruby-dev:28872]
-
- * ext/bigdecimal/lib/bigdecimal/util.rb: Bug in to_r reported by
- [ruby-list:42533] fixed.
-
-Mon Jul 10 19:22:19 2006 Tanaka Akira <akr@fsij.org>
-
- * gc.c (gc_sweep): expand heap earlier.
- reported by MORITA Naoyuki. [ruby-dev:28960]
-
-Mon Jul 10 18:59:34 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/font.rb: sorry. mistaken to patch.
-
-Mon Jul 10 18:46:52 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tcltklib.c: make SEGV risk lower at exit.
-
- * ext/tk/lib/tk.rb: ditto.
-
- * ext/tk/lib/multi-tk.rb: fail to call function-style methods on slave
- interpreters. The strategy (MultiTkIp_PseudoToplevel_Evaluable) to
- fix the problem is a little tricky. You may have to take care of
- conflicting with it.
-
- * ext/tk/lib/tk.rb: a little change for the pseudo-toplevel strategy.
-
- * ext/tk/lib/tk/font.rb: ditto.
-
- * ext/tk/lib/tk/msgcat.rb: ditto.
-
- * ext/tk/lib/tkextlib/itk/incr_tk.rb: ditto.
-
- * ext/tk/sample/demos-en/widget: fail to call function-style methods
- on sample scripts. To fix it, a strategy which similar to the way
- on MultiTiIp is used. Please take care when re-write and re-run a
- demo script on the Widget-Demo code viewer.
-
- * ext/tk/sample/demos-jp/widget: ditto.
-
-Mon Jul 10 13:58:40 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * signal.c (ruby_nativethread_signal, posix_nativethread_signal,
- sigsend_to_ruby_thread, install_nativethread_sighandler):
- nativethread-support on signal handler. RE-backport from 1.9.
-
- * ruby.h (HAVE_NATIVETHREAD_KILL): ditto.
-
- * eval.c (ruby_native_thread_kill): ditto.
-
-Mon Jul 10 10:54:14 2006 Ryan Davis <ryand@zenspider.com>
-
- * lib/rdoc/parsers/parse_f95.rb: massive overhaul from Yasuhiro
- Morikawa including new file suffixes, function support, public
- variables and constants, derived-types, defined operators and
- assignments, namelists, and subroutine and function
- arguments. Truly massive.
-
- * lib/rdoc/diagram.rb: diagrams are now cached.
-
- * lib/irb/completion.rb: fixed a crasher when completing against
- an unnamed class/module.
-
- * lib/rdoc/parsers/parse_c.rb: private comment (--/++) support in
- C-file rdoc.
-
- * lib/debug.rb: minor clarification in help.
-
- * lib/pp.rb: minor clarification on exception.
-
-Mon Jul 10 09:29:12 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_clear_cache_for_undef): clear entries for included
- module. fixed: [ruby-core:08180]
-
-Mon Jul 10 01:48:38 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * st.h (st_data_t): use pointer sized integer for st_data_t.
- [ruby-dev:28988]
-
-Sun Jul 9 18:06:47 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (try_constant): fix for value 1 at cross compiling.
-
- * lib/mkmf.rb (create_makefile): prevent substitution of macro
- definition. fixed: http://www.yotabanana.com/lab/20060624.html#p02
-
-Sun Jul 9 00:54:34 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (next_jump): deal with destination of next.
- fixed: [ruby-core:08169]
-
-Fri Jul 7 00:38:49 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * hash.c (rb_hash_default): should not call default procedure if
- no key is given. [ruby-list:42541]
-
-Fri Jul 7 00:29:10 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * time.c (time_mload): a patch from Daniel Berger
- <Daniel.Berger at qwest.com>. [ruby-core:08128]
-
-Thu Jul 6 22:21:57 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (rb_proc_times): use sysconf(_SC_CLK_TCK) value prior to
- HZ and CLK_TCK. fixed: [ruby-talk:200293]
-
-Thu Jul 6 22:17:21 2006 Minero Aoki <aamine@loveruby.net>
-
- * ext/racc/cparse/cparse.c: sync with original code, rev 1.8.
-
- * ext/racc/cparse/cparse.c: should mark CparseParams objects.
-
- * lib/racc/parser.rb: sync with original code, rev 1.8.
-
- * lib/racc/parser.rb: update coding style.
-
-Mon Jul 3 19:04:38 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tcltklib.c (ip_make_menu_embeddable): help to make a menu
- widget embeddable (pack, grid, and so on) like as a general widget.
- However, an embeddable menu may require to be definied some event
- bindings for general use.
-
- * ext/tk/lib/tk/event.rb: [bug fix] Tk.callback_break and
- Tk.callback_continue don't work on MultiTkIp.
-
- * ext/tk/lib/multi-tk.rb: ditto.
-
- * ext/tk/lib/tk.rb: lack of Tk.callback_return.
-
- * ext/tk/lib/tk/menu.rb: improve creating clone menus.
-
-Mon Jul 3 14:42:06 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/etc/extconf.rb (PW_UID2VAL, PW_GID2VAL): defaulted to conversion
- from int, and sys/types.h needs to be included before grp.h.
- fixed: [ruby-dev:28938]
-
-Mon Jul 3 01:14:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_inspect): encode \b (\010) for escape.
- [ruby-dev:28927]
-
- * string.c (rb_str_dump): ditto.
-
-Sun Jul 2 19:17:56 2006 Minero Aoki <aamine@loveruby.net>
-
- * ext/racc/cparse/cparse.c: sync with original code (rev 1.7).
-
- * ext/racc/cparse/cparse.c: use rb_catch instead of rb_iterate.
- Giving a block to a Ruby-level method by rb_iterate is obsolete on
- Ruby 1.9. Note that current cparse.c still includes one
- rb_iterate call on Ruby 1.8, but it is not a problem (at least
- just now).
-
-Sat Jul 1 15:15:49 2006 Tanaka Akira <akr@m17n.org>
-
- * test/socket/test_nonblock.rb: add timeout to send/receive
- an empty UDP packet.
- [ruby-dev:28820]
-
-Fri Jun 30 23:46:23 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * configure.in: should test isinf for Solaris with GCC compiler.
- a patch from <ville.mattila at stonesoft.com>. [ruby-core:07791]
-
- * configure.in: -shared patch from Andrew Morrow
- <andrew.c.morrow at gmail.com>. [ruby-core:08100]
-
-Thu Jun 29 18:58:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_version): fix patch
- failure.
-
-Thu Jun 29 18:00:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c: add RDoc document. a patch from
- mathew <meta at pobox.com>. [ruby-core:07050]
-
-Wed Jun 28 15:47:14 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/optparse.rb: RDoc patch from Robin Stocker <robin@nibor.org>
- [ruby-core:08087]
-
-Wed Jun 28 19:04:34 2006 Tanaka Akira <akr@m17n.org>
-
- * test/socket/test_unix.rb: test_seqpacket_pair removed.
- [ruby-dev:28846]
-
-Tue Jun 27 23:03:49 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c: RDoc update for =~ method. a patch from Alex Young
- <alex at blackkettle.org>. [ruby-core:08068]
-
-Tue Jun 27 22:47:18 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tcltklib.c: forgot to update TCLTKLIB_RELEASE_DATE.
-
- * ext/tk/lib/tk.rb (tk_tcl2ruby): [bug fix] sometimes fail to convert
- a tcl string to a ruby object if the tcl string includes "\n".
-
-Tue Jun 27 16:04:05 2006 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * win32/win32.h: define isascii on MinGW for msvcrt compatibility.
-
- * configure.in: set ac_cv_header_sys_time_h=no on MinGW
- for msvcrt compatibility.
-
-Tue Jun 27 11:36:02 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/etc/etc.c (setup_passwd, setup_group): allow bignum uid, gid and
- so on. [ruby-talk:199102]
-
-Mon Jun 26 13:37:27 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/rdoc: Merge from HEAD.
- Add options to limit the ri search path.
-
-Tue Jun 27 00:54:08 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * util.c (powersOf10): constified.
-
-Mon Jun 26 18:37:44 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tcltklib.c (ip_delete): fix SEGV when a slave-ip is
- deleted on callback.
-
-Mon Jun 26 10:47:42 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (pipe_open): avoid closing uninitialized file descriptors.
- a patch from <tommy at tmtm.org> [ruby-dev:28600]
-
-Mon Jun 26 09:56:22 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.[ch] (rb_w32_send, rb_w32_sendto): constified.
-
-Sun Jun 25 23:02:12 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in, mkconfig.rb: catch-up for latest autoconf.
-
-Sat Jun 24 06:35:00 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * signal.c: revert last change.
-
- * ruby.h: ditto.
-
- * eval.c: ditto.
-
-Thu Jun 22 11:52:02 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/net/http.rb (Net::HTTPResponse): duplicated error 501;
- HTTPInternalServerError should be error 500. [ruby-core:08037]
-
-Thu Jun 22 05:15:58 2006 Tanaka Akira <akr@m17n.org>
-
- * ext/socket/socket.c (sock_s_socketpair): try GC only once.
- [ruby-dev:28778]
-
-Wed Jun 21 21:28:32 2006 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date.rb (jd_to_commercial): now works fine even if in
- mathn-ized context.
-
-Wed Jun 21 17:32:31 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * signal.c (ruby_nativethread_signal, posix_nativethread_signal,
- sigsend_to_ruby_thread, install_nativethread_sighandler):
- nativethread-support on signal handler (backport from 1.9).
-
- * ruby.h (HAVE_NATIVETHREAD_KILL): ditto.
-
- * eval.c (ruby_native_thread_kill): ditto.
-
-Wed Jun 21 08:39:54 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/xmlrpc/create.rb (XMLRPC::Create::conv2value): merge Date
- and Time processing. [ruby-core:08033]
-
-Wed Jun 21 01:40:25 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (yylex, reswords): modifier token is no longer returned in
- fname state. [ruby-dev:28775]
-
-Wed Jun 21 01:12:46 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: RSS::Element.def_corresponded_attr_writer
- supported date type.
-
-Tue Jun 20 22:08:36 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rss/test_parser.rb: split parser tests into ...
- * test/rss/test_parser_1.0.rb: ... RSS 1.0 parsing tests and ...
- * test/rss/test_parser_2.0.rb: ... RSS 2.0 parsing tests.
-
-Tue Jun 20 21:19:06 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: provided default RSS::Element#children.
-
- * lib/rss/0.9.rb: used default RSS::Element#children.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
-
-Tue Jun 20 21:04:33 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: provided default RSS::Element#_tags.
-
- * lib/rss/0.9.rb: used default RSS::Element#_tags.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
-
-Tue Jun 20 20:47:07 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: hide RSS::Element.install_model.
- (RSS::Element.install_have_child_element,
- RSS::Element.install_have_children_element,
- RSS::Element.install_text_element,
- RSS::Element.install_date_element): call
- RSS::Element.install_model internally.
-
- * lib/rss/0.9.rb: followed new API.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/content.rb: ditto.
- * lib/rss/dublincore.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/syndication.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
-Tue Jun 20 20:18:05 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/extconf.rb: add check for OBJ_NAME_do_all_sorted.
-
- * ext/openssl/ossl_cipher.c (ossl_s_ciphers): new method
- OpenSSL::Cipher.ciphers. it returns all the cipher names.
-
- * ext/openssl/lib/openssl/cipher.rb:
- - add constants AES128, AES192, AES256. [ruby-dev:28610]
- - reimplement without eval()
-
- * ext/openssl/lib/openssl/digest.rb: reimplement without eval().
-
- * test/openssl/test_cipher.rb, test_digest: fix about reimplemented
- features.
-
- * sample/openssl/cipher.rb: rewrite all.
-
-Sat Jun 19 11:21:46 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/test/unit/assertions.rb: Merge RDoc from HEAD.
-
-Tue Jun 20 01:06:57 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb:
- - cleanup validation mechanism. Now, #XXX_validation is
- needless.
- - changed internal variable name RSS::Element::MODEL to
- RSS::Element::MODELS.
- - RSS::Element.install_model requires uri.
-
- * lib/rss/0.9.rb: followed new validation API.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/content.rb: ditto.
- * lib/rss/dublincore.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/syndication.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
-Mon Jun 19 23:40:59 2006 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/lib/kconv.rb: remove default -m0 and fix document.
-
- * ext/nkf/nkf-8/{nkf.c, config.h, utf8tbl.c, utf8tbl.h}:
- imported nkf 2.0.7.
-
-Mon Jun 19 22:31:59 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb:
- - provided default #to_s as RSS::Element#to_s.
- - removed RSS::Element#other_element.
- - RSS::Element#tag requires attributes as Hash instead of Array.
-
- * lib/rss/0.9.rb: removed #to_s to use RSS::Element#to_s.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
- * lib/rss/2.0.rb: removed #other_element.
-
-Mon Jun 19 22:09:16 2006 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c(ole_invoke): support some kind of
- method of word. [ruby-Bugs#3237]
-
- * ext/win32ole/tests/test_word.rb: ditto.
-
- * ext/win32ole/tests/testall.rb: ditto.
-
-Mon Jun 19 00:02:17 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: automatically detected attributes.
-
- * lib/rss/0.9.rb: removed #_attrs.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
- * lib/rss/parser.rb: followed new internal API.
-
-Mon Jun 19 00:00:17 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: fix bug: initialize improper tables.
-
-Sun Jun 18 22:36:13 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: RSS::Element#initialize accepts initial
- attributes.
- * lib/rss/0.9.rb: ditto.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/dublincore.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
- * lib/rss/utils.rb: added Utils.element_initialize_arguments? to
- detect backward compatibility initial arguments.
-
- * lib/rss/parser.rb: user initial attributes to initialize
- RSS::Element.
-
-Sun Jun 18 18:24:42 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/converter.rb: use NKF for Uconv fallback.
-
-Sun Jun 18 18:22:04 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rss/test_image.rb: shared name space configuration.
-
-Sun Jun 18 18:13:25 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: improved ignore_unknown_element
- handling. RSS::NotExpectedTagError provides tag URI.
- * lib/rss/parser.rb: ditto.
- * lib/rss/0.9.rb: ditto.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/content.rb: ditto.
- * lib/rss/dublincore.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/syndication.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
- * test/rss/rss-assertions.rb: checked URI of not expected tag too.
- * test/rss/test_parser.rb: ditto.
-
-Sun Jun 18 18:08:36 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: changed empty namespace URI representation to ""
- from nil.
- * lib/rss/parser.rb: ditto.
- * lib/rss/0.9.rb: ditto.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
-
-Sun Jun 18 18:03:50 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/parser.rb: removed a guard for requiring open-uri.
-
-Sun Jun 18 18:01:26 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: fixed typo: except -> expect
- * lib/rss/parser.rb: ditto.
- * test/rss/rss-assertions.rb: ditto.
- * test/rss/test_parser.rb: ditto.
-
-Sun Jun 18 17:52:39 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: RSS::Element#calc_indent became to be deprecated.
- * lib/rss/0.9.rb: ditto.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
- * test/rss/test_1.0.rb: removed RSS::Element.indent_size tests.
- * test/rss/test_2.0.rb: ditto.
-
-Sun Jun 18 00:49:11 2006 Tanaka Akira <akr@m17n.org>
-
- * ext/socket/socket.c (bsock_recv_nonblock): new method
- BasicSocket#recv_nonblock.
- (udp_recvfrom_nonblock): renamed from ip_recvfrom_nonblock.
- IPSocket#recvfrom_nonblock is moved to UDPSocket#recvfrom_nonblock.
- (unix_recvfrom_nonblock): removed.
- UNIXSocket#recvfrom_nonblock is removed.
-
-Sat Jun 17 22:17:17 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/mathn.rb (Integer::prime_division): raise ZeroDivisionError
- on zeros. [ruby-dev:28739]
-
-Sat Jun 17 14:53:32 2006 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb: backport from 1.9.
- (Kernel#Pathname): new method.
-
-Sat Jun 17 10:30:41 2006 Kouhei Sutou <kou@cozmixng.org>
+ * common.mk (clean): add a dependency for `win32` directory.
+ * common.mk (distclean): ditto.
+ * common.mk (distclean-platform): add new target.
+ It cleans `win32` directory.
+ * common.mk ($(PLATFORM_D)): add new target to make `win32` directory.
+ * common.mk (win32/win32.$(OBJEXT)): move win32.o into `win32`
+ directory.
+ * common.mk (win32/file.$(OBJEXT)): add new target for win32/file.c.
- * lib/rss/rss.rb (Hash#merge, Enumerable#sort_by): removed.
+ * configure.in: move win32.o into `win32` directory and add
+ win32/file.o to MISSING.
- * lib/rss/rss.rb (RSS::RootElementMixin#to_xml): added.
- [ruby-talk:197284]
+ * file.c (file_load_ok, rb_file_load_ok): replace static
+ file_load_ok() with public rb_file_load_ok().
+ It's to link Windows implementation in win32/file.c.
+ * file.c (rb_find_file_ext_safe): ditto.
+ * file.c (rb_find_file_safe): ditto.
- We can convert RSS version easily like the following:
- rss10 = RSS::Parser.parse(File.read("1.0.rdf"))
- File.open("2.0.rss", "w") {|f| f.print(rss10.to_xml("2.0"))}
+ * win32/file.c (rb_file_load_ok): new file. Add Windows specific
+ optimized implementation of rb_file_load_ok(). We created a
+ separated file to avoid too many #ifdef macro which is unreadable.
- * test/rss/test_1.0.rb: added #to_xml test.
- * test/rss/test_2.0.rb: ditto.
+ * win32/Makefile.sub (PLATFORM_DIR): add a variable for `win32`
+ directory.
+ * win32/Makefile.sub (MISSING): move win32.obj into `win32`
+ directory and add win32/file.obj to MISSING.
+ * win32/Makefile.sub (MAKEDIRS): replace MINIRUBY with BASERUBY.
+ It's because miniruby doesn't exist when making `win32` directory.
+ * win32/Makefile.sub (clean-platform): add new target to clean `win32`
+ directory.
+ * win32/Makefile.sub ({$(srcdir)}.c{}.obj): make it not match
+ win32/file.c to build properly.
+ * win32/Makefile.sub (win32/win32.$(OBJEXT)): move win32.obj into
+ `win32` directory.
- * test/rss/rss-testcase.rb: added some helper methods that
- generates sample RSS 2.0.
+ Patch created with Luis Lavena.
+ [ruby-core:42480] [Feature #5999]
- * sample/rss/convert.rb: added a sample script to convert RSS format.
+Fri Oct 19 13:28:29 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Jun 17 10:23:22 2006 Kouhei Sutou <kou@cozmixng.org>
+ * configure.in (opt-dir): allow multiple directories separated by
+ $PATH_SEPARATOR as well as dir_config in mkmf.rb. [ruby-core:47868]
+ [Bug #7120]
- * lib/rss/rss.rb (Kernel#funcall): removed.
- * lib/rss/parser.rb (Kernel.URI): removed.
+Tue Oct 16 11:18:06 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rss/maker/: supported
- xxx.new_yyy do |yyy|
- yyy.zzz = zzz
- ...
- end
- style and this style became the style of the recommendation.
+ * lib/mkmf.rb (dir_config, init_mkmf): use configured libdir value as
+ default library path. [ruby-core:43726] [Bug #6207]
- Old style
- yyy = xxx.new_yyy
- yyy.zzz = zzz
- ...
- is supported too but this style isn't recommended.
- [ruby-talk:197284]
+Tue Oct 16 10:56:55 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/rss/test_*maker*.rb: used new recommended style.
+ * file.c (rb_find_file_ext_safe, rb_find_file_safe): default to
+ US-ASCII for encdb and transdb.
-Sat Jun 17 09:03:47 2006 Kouhei Sutou <kou@cozmixng.org>
+ * load.c (search_required): keep encoding of feature name. set
+ loading path to filesystem encoding. [Bug #6377][ruby-core:44750]
- * lib/rss, test/rss: backported from trunk. (2005-11-16 - now)
+ * ruby.c (add_modules, require_libraries): assume default external
+ encoding as well as ARGV.
- * lib/rss/rss.rb (RSS::VERSION): 0.1.5 -> 0.1.6.
- * test/rss/test_version.rb (RSS::TestVersion#test_version): ditto.
+Tue Oct 16 10:47:43 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rss/trackback.rb: added TrackBack prefix.
- * lib/rss/maker/trackback.rb: ditto.
+ * random.c (random_s_rand): ensure default PRNG is re-initialized
+ after fork. patched by Eric Wong. [ruby-core:41209][Bug #5661]
- * lib/rss/rss.rb : removed needless argument 'prefix'.
- * lib/rss/parser.rb: ditto.
+Tue Oct 16 10:21:23 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rss/1.0.rb: added rdf:Bag.
+ * ruby.c (rb_f_sub, rb_f_gsub): pass the given block.
+ [ruby-core:47967] [Bug #7157]
- * lib/rss/taxonomy.rb: implemented taxonomy module.
- * test/rss/test_taxonomy.rb: added tests for taxonomy support.
+Tue Oct 16 09:47:47 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/rss/1.0.rb: added convenience method 'resources'.
- * lib/rss/taxonomy.rb: ditto.
- * test/rss/rss-assertions.rb: added test for 'resources'.
- * test/rss/test_taxonomy.rb: ditto.
+ * test/ruby/test_regexp.rb
+ (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): use
+ Regexp.new instead of literal to ignore a parser warning.
- * lib/rss/rss.rb: fixed a indentation bug.
- * lib/rss/taxonomy.rb: fixed <taxo:topic> #to_s bug.
- * test/rss/test_taxonomy.rb: added a #to_s test.
+Tue Oct 16 09:47:47 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/rss/maker/taxonomy.rb: implemented taxonomy module for RSS
- Maker.
- * lib/rss/taxonomy.rb: supported RSS Maker.
- * lib/rss/maker.rb: added taxonomy module support.
+ * test/ruby/test_regexp.rb
+ (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): ignoring
+ warnings are already set in setup method.
- * lib/rss/rss.rb: adjusted to other element API.
- * lib/rss/1.0.rb: adjusted to other element API but backward
- compatibility is reserved.
- * lib/rss/0.9.rb: ditto.
+Sun Oct 14 01:21:42 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/rss/test_maker_taxo.rb: added test case for taxonomy module
- for RSS Maker.
- * test/rss/test_setup_maker_1.0.rb: added tests for taxo:topic.
+ * regparse.c (parse_char_class): should match with a hyphen after a
+ range in a character class.
- * test/rss/test_setup_maker_1.0.rb: added backward compatibility
+ * test/ruby/test_regexp.rb (TestRegexp#test_char_class): fixed wrong
test.
- * test/rss/test_setup_maker_0.9.rb: ditto.
- * test/rss/test_setup_maker_2.0.rb: ditto.
-
- * test/rss/rss-testcase.rb: added convenience method for setting
- up taxo:topic.
- * test/rss/rss-assertions.rb: added assertion for taxo:topic.
-
- * sample/rss/blend.rb: followed new API.
-
- * lib/rss/taxonomy.rb: changed class or module prefix to
- Taxonomy from Taxo.
- * lib/rss/maker/taxonomy.rb: ditto.
-
- * test/rss/test_taxonomy.rb: use #reject directory.
-
- * lib/rss/: use #__send__ instead of #send.
- * test/rss/: ditto.
-
- * lib/rss/parser.rb: added entity handling type predicate.
- * lib/rss/rexmlparser.rb: ditto.
- * lib/rss/xmlparser.rb: ditto.
- * lib/rss/xmlscanner.rb: ditto.
-
- * lib/rss/xmlscanner.rb: more robust entity handling.
-
- * test/rss/test_parser.rb: added an entity handling test.
-
- * test/rss/test_2.0.rb: added RSS 2.0 tests.
- * test/rss/rss-assertions.rb: extended XML stylesheet assertion.
- * lib/rss/0.9.rb: added initialize method.
- * test/rss/test_1.0.rb: cleanup.
-
- * lib/rss/image.rb: added Image prefix.
- * lib/rss/maker/image.rb: ditto.
-
- * lib/rss/rss.rb: improved type conversion.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/0.9.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/syndication.rb: ditto.
-
- * test/rss/test_2.0.rb: added type conversion tests.
- * test/rss/test_accessor.rb: ditto.
- * test/rss/test_to_s.rb: ditto.
- * test/rss/test_syndication.rb: ditto.
- * test/rss/test_setup_maker_2.0.rb: ditto.
- * test/rss/test_setup_maker_1.0.rb: ditto.
- * test/rss/test_setup_maker_0.9.rb: ditto.
- * test/rss/test_maker_sy.rb: ditto.
- * test/rss/test_maker_image.rb: ditto.
- * test/rss/test_maker_2.0.rb: ditto.
- * test/rss/test_maker_0.9.rb: ditto.
- * test/rss/test_image.rb: ditto.
-
- * test/rss/test_maker_1.0.rb: use assert instead of assert_equal.
-
- * test/rss/rss-assertions.rb: improved type conversion assertions.
-
- * lib/rss/rss.rb: added backward compatibility codes.
- * lib/rss/parser.rb: ditto.
- * test/rss/test_parser.rb: ditto.
- * test/rss/test_2.0.rb: ditto.
-
-Sat Jun 17 02:01:00 2006 Tanaka Akira <akr@m17n.org>
-
- * lib/pp.rb (Kernel#pretty_inspect): defined for pretty printed
- string.
-
-Sat Jun 17 00:23:58 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (reswords): kDO_BLOCK was missing. fixed: [ruby-core:7995]
-
-Sat Jun 17 00:02:15 2006 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_propertyput): support
- PROPERTYPUTREF. [ruby-talk:183042]
-
- * ext/win32ole/tests/test_propertyputref.rb: ditto.
-
-Thu Jun 15 23:02:47 2006 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (fole_methods): The return value
- of WIN32OLE#ole_methods should include PROPERTYPUTREF methods.
-
- * ext/win32ole/win32ole.c (fole_put_methods): The return value
- of WIN32OLE#ole_put_methods should include PROPERTYPUTREF methods.
-
- * ext/win32ole/tests/test_ole_methods.rb: ditto.
-
- * ext/win32ole/tests/testall.rb : ditto.
-
-Wed Jun 14 18:23:28 2006 Eric Hodel <drbrain@segment7.net>
-
- * enum.c (enum_any): Documentation typo.
-
-Wed Jun 14 15:01:09 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser#warn): Don't print
- warnings when -q is set.
-
-Wed Jun 14 23:03:53 2006 Tanaka Akira <akr@m17n.org>
-
- * configure.in: check sizeof(rlim_t).
- check setrlimit.
-
- * process.c (proc_getrlimit): new method Process.getrlimit.
- (proc_setrlimit): new method Process.setrlimit.
-
- * ruby.h (NUM2ULL): new macro.
-
-Mon Jun 12 22:25:09 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): adjust precision length to prevent
- splitting multi-byte characters. [ruby-list:42389]
-
-Sun Jun 11 23:20:07 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser::Arguable#getopts): pass self to the
- parser.
-
-Sun Jun 11 10:00:57 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.h (write): not need to define on bcc.
-
-Sun Jun 11 08:30:33 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser#getopts): new methods.
-
-Sat Jun 10 18:02:40 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/bigdecimal/lib/bigdecimal/newton.rb (Newton::nlsolve): typo
- fixed: raize -> raise. [ruby-talk:196608]
-
-Thu Jun 8 14:19:17 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.[ch] (rb_w32_read, rb_w32_write): new functions.
- use recv() and send() when fd is socket. fixed: [ruby-dev:28694]
-
-Wed Jun 7 16:22:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/tempfile.rb (Tempfile::make_tmpname): put dot between
- basename and pid. [ruby-talk:196272]
-
-Wed Jun 7 14:53:04 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (errmap): add some winsock errors.
-
-Wed Jun 7 11:34:38 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * configure.in: add new configure option `--with-winsock2' for mingw.
-
- * win32/Makefile.sub (config.h): define USE_WINSOCK2 in config.h
- instead of in CPPFLAGS.
-
- * ext/socket/extconf.rb: determine whether to use winsock2 or not
- by using with_config.
-
-Wed Jun 7 10:45:10 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/{configure.bat, setup.mak, Makefile.sub, win32.h}: add
- new configure option `--with-winsock2'.
-
- * win32/win32.c (StartSockets): ditto.
-
- * ext/socket/extconf.rb: ditto.
-
- * win32/win32.c (open_ifs_socket): new function.
-
- * win32/win32.c (StartSockets, rb_w32_socket): use open_ifs_socket()
- instead of socket().
- ifs socket support is backported from trunk.
-
-Wed Jun 7 09:14:44 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_call0): binding for the return event hook should have
- consistent scope. [ruby-core:07928]
-
- * eval.c (EXEC_EVENT_HOOK): trace_func may remove itself from
- event_hooks. no guarantee for arbitrary hook deletion.
- [ruby-dev:28632]
-
-Mon Jun 5 18:12:12 2006 Tanaka Akira <akr@m17n.org>
-
- * ext/socket/socket.c (sock_s_unpack_sockaddr_in): reject
- non-AF_INET/AF_INET6 sockaddr.
- (sock_s_unpack_sockaddr_un): reject non-AF_UNIX sockaddr.
- [ruby-dev:28691]
-
-Sun Jun 4 20:40:19 2006 Tanaka Akira <akr@m17n.org>
-
- * ext/socket/socket.c: fix sockaddr_un handling.
- [ruby-dev:28677]
-
-Fri Jun 2 22:08:17 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/forwardable.rb: RDoc typo fix from Jan Svitok
- <jan.svitok at gmail.com>. [ruby-core:07943]
-
-Fri Jun 2 19:02:09 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/extconf.rb: use create_header.
-
- * ext/openssl/ossl.h, ext/openssl/openssl_missing.h:
- include RUBY_EXTCONF_H.
-
-Fri Jun 2 17:16:52 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (CLEANINGS): remove extconf.h by distclean if created.
-
-Fri Jun 2 00:11:19 2006 Tanaka Akira <akr@m17n.org>
-
- * ext/socket/socket.c (s_recvfrom): alen may be zero with UNIXSocket
- too. (tested on NetBSD 3.0)
- (s_recvfrom_nonblock): extracted from sock_recvfrom_nonblock.
- (sock_recvfrom_nonblock): use s_recvfrom_nonblock.
- (ip_recvfrom_nonblock): new method: IPSocket#recvfrom_nonblock
- (unix_recvfrom_nonblock): new method: UNIXSocket#recvfrom_nonblock
- (s_accept_nonblock): extracted from sock_accept_nonblock.
- (sock_accept_nonblock): use s_accept_nonblock.
- (tcp_accept_nonblock): new method: TCPServer#accept_nonblock
- (unix_accept_nonblock): new method: UNIXServer#accept_nonblock
-
-Thu Jun 1 19:12:37 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (rb_w32_cmdvector): backslashes inside single-quotes
- no longer has special meanings. fixed: [ruby-list:42311]
-
-Thu Jun 1 16:14:41 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_getcwd): runtime's getcwd() will not success
- if the length of the cwd is longer than MAX_PATH.
- fixed [ruby-list:42335]
-
-Thu Jun 1 11:29:14 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_getcwd): set errno if not set.
- fixed [ruby-list:42346]
-
-Sat May 27 11:29:46 2006 nobuyoshi nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (extmake): remove extinit files if no statically linked
- extensions.
-
-Fri May 26 09:05:11 2006 nobuyoshi nakada <nobu@ruby-lang.org>
-
- * ruby.h, lib/mkmf.rb (create_header): clear command line options for
- macros moved to extconf.h.
-
- * ext/extmk.rb (extract_makefile, extmk): made RUBY_EXTCONF_H and
- EXTSTATIC permanent.
-
- * ext/{dbm,digest/*,socket,zlib}/extconf.rb: used $defs and $INCFLAGS.
-
- * {bcc32,win32,wince}/Makefile.sub (COMPILE_C, COMPILE_CXX): added
- $(INCFLAGS).
-
- * lib/mkmf.rb (configuration): add $defs unless extconf.h was created.
-
-Thu May 25 01:52:07 2006 nobuyoshi nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (pkg_config): particular config commands support.
-
- * ext/extmk.rb: deal with $static set in extconf.rb.
-
- * mkconfig.rb: merge multiple entries to an entry with multiple lines.
-
- * lib/mkmf.rb: allow a series of commands to link.
-
- * win32/Makefile.sub: embed manifests.
-
- * win32/setup.mak: suffix OS name by runtime version.
-
-Wed May 24 23:52:11 2006 nobuyoshi nakada <nobu@ruby-lang.org>
-
- * configure.in (ac_install_sh): ignore dummy install-sh.
- [ruby-talk:193876]
-
-Wed May 24 03:10:48 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/lib/openssl/ssl.rb
- (OpenSSL::SSL::SocketForwarder#setsockopt,getsockopt): typo fixed.
-Mon May 22 17:54:12 2006 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/ruby/test_regexp.rb (TestRegexp#check): now can accept the
+ error message.
- * ext/socket/socket.c (sock_recvfrom_nonblock): use rb_read_pending
- instead of rb_io_read_pending.
- [ruby-dev:28663]
+ * test/ruby/test_regexp.rb
+ (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): renamed
+ because the previous name was wrong.
-Mon May 22 17:30:04 2006 Tanaka Akira <akr@m17n.org>
+ * test/ruby/test_regexp.rb
+ (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): added
+ more test pattern.
- * rubyio.h (rb_io_set_nonblock): declared.
+Sat Oct 13 01:41:38 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * io.c (rb_io_set_nonblock): new function.
- (io_getpartial): nonblocking read support.
- (io_read_nonblock): new method: IO#read_nonblock.
- (io_write_nonblock): new method: IO#write_nonblock.
+ * regparse.c (parse_char_class): also need to check the type of token
+ after raw hyphen in regexp class, because the charcter code area
+ is union'ed with the property of TK_CHAR_TYPE.
+ reported by Bushi Zhang at [ruby-core:47115] [Backport #6853].
- * ext/socket/socket.c
- (sock_connect_nonblock): new method: Socket#connect_nonblock.
- (sock_accept_nonblock): new method: Socket#accept_nonblock.
- (sock_recvfrom_nonblock): new method: Socket#recvfrom_nonblock.
+Sat Oct 13 01:39:46 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- [ruby-core:7917]
+ * test/ruby/test_regexp.rb
+ (TestRegexp#test_raw_hyphen_and_type_char_after_range): added new
+ test. ref [ruby-core:47115] [Backport #6853]
-Mon May 22 15:57:39 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Oct 12 18:19:35 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (umethod_bind): should not update original class.
- [ruby-dev:28636]
+ * file.c (rb_get_path_check): path name must not contain NUL bytes.
-Mon May 22 13:38:57 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Oct 12 17:51:43 2012 Shugo Maeda <shugo@ruby-lang.org>
- * eval.c (ev_const_get): should support constant access from
- within instance_eval(). [ruby-dev:28327]
+ * error.c (exc_to_s, name_err_to_s, name_err_mesg_to_str): do not
+ taint messages.
-Thu May 18 17:51:32 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Oct 12 16:11:23 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * time.c (time_timeval): should round for usec floating
- number. [ruby-core:07896]
+ * configure.in (LIBDIR_BASENAME): use configured libdir value to fix
+ --enable-load-relative on systems where libdir is not default value,
+ overridden in config.site files. [ruby-core:47267] [Bug #6903]
- * time.c (time_add): ditto.
+ * ruby.c (ruby_init_loadpath_safe): ditto.
-Thu May 18 17:11:45 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Oct 12 13:56:01 2012 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
- * lib/cgi.rb (CGI::out): support utf-8. a patch from Fujioka
- <fuj at rabbix.jp>. [ruby-dev:28649]
+ * test/rexml/test_encoding.rb:
+ Add require 'require 'rexml/document'
-Thu May 18 00:42:12 2006 nobuyoshi nakada <nobu@ruby-lang.org>
+Fri Oct 12 13:36:32 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/extmk.rb, lib/mkmf.rb: use BUILD_FILE_SEPARATOR in Makefiles.
+ * numeric.c (flodivmod): must through the same pass if HAVE_FMOD or not.
+ this is a bugfix of r35013.
-Wed May 17 17:55:26 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Oct 12 13:28:37 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * dir.c (sys_warning): should not call a vararg function
- rb_sys_warning() indirectly. [ruby-core:07886]
+ * io.c (rb_cloexec_fcntl_dupfd): get rid of compile error on windows.
+ reported by Donovan Lampa at [ruby-core:43152] [Backport #6127],
+ based on a patch by Hiroshi Shirosaki at [ruby-core:47917].
-Wed May 17 08:17:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Oct 12 00:30:17 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * util.c (ruby_strtod): try to reduce errors using powersOf10
- table. [ruby-dev:28644]
+ * io.c (ioctl_narg_len, linux_iocparm_len): reinstantiate linux
+ specific narg length calculation.
+ * test/ruby/test_io.rb (test_ioctl_linux2): add new test for old and
+ unstructured ioctl.
-Tue May 16 15:34:18 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Oct 12 00:30:17 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * re.c (rb_reg_initialize): should not allow modifying literal
- regexps. frozen check moved from rb_reg_initialize_m as well.
+ * io.c (ioctl_narg_len): don't use _IOC_SIZE macro on Linux.
+ On Linux some constants for ioctl(2) doesn't include the size of
+ its return value and 16bit value; for example FIONREAD 0x541B.
+ Moreover the manual, ioctl_list(2), says "Note that the size
+ bits are very unreliable: in lots of cases they are wrong,
+ either because of buggy macros using sizeof(sizeof(struct)),
+ or because of legacy values."
+ So we shouldn't use it.
-Tue May 16 09:20:16 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Sep 25 09:30:36 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * re.c (rb_reg_initialize): should not modify untainted objects in
- safe levels higher than 3.
+ * win32/mkexports.rb: should not export DllMain().
+ reported by luis at [ruby-core:46743] [Bug #6790], solved by
+ Heesob Park, and confirmed by nobu.
- * re.c (rb_memcmp): type change from char* to const void*.
+Mon Sep 24 16:34:07 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
- * dir.c (dir_close): should not close untainted dir stream.
+ * include/ruby/win32.h (rb_w32_pow): add new function.
+ We use powl() instead of broken pow() for x64-mingw32. This workaround
+ fixes test failures related to floating point numeric.
+ [ruby-core:46686] [Bug #6784]
- * dir.c (GetDIR): add tainted/frozen check for each dir operation.
+Mon Sep 24 10:38:55 2012 Luis Lavena <luislavena@gmail.com>
-Mon May 15 17:42:39 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/win32ole/test_win32ole_method.rb (is_ruby64?): Correct platform
+ used to identify mingw-w64 (x64-mingw32). Patch by Hiroshi Shirosaki.
+ [ruby-core:46651][Bug #6782]
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_symbol_arg):
- typo fixed. a patch from Florian Gross <florg at florg.net>.
+Mon Sep 24 10:37:56 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Sat May 13 16:14:05 2006 Tanaka Akira <akr@m17n.org>
+ * lib/test/unit/parallel.rb: workaround fix for rubygems.
+ RubyGems can't find rake if the source directory is not equal to
+ the directory which is running the test. [Bug #6604]
- * lib/pp.rb (PP.mcall): new method.
- (Struct#pretty_print): call Kernel#class and Struct#members even if
- overridden.
- (Struct#pretty_print_cycle): ditto.
- [ruby-core:7865]
+Fri Sep 21 19:53:38 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu May 11 19:57:00 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/dl/cfunc.c (rb_dlcfunc_call): should convert a Bignum value to
+ unsigned long long on Win64.
+ [ruby-core:44636][Bug #6364] reported by raylinn@gmail.com (ray linn)
- * util.c (ruby_strtod): differ addition to minimize error.
- [ruby-dev:28619]
+Fri Sep 21 18:45:20 2012 Luis Lavena <luislavena@gmail.com>
-Fri Aug 11 15:39:25 2006 Eric Hodel <drbrain@segment7.net>
+ * include/ruby/win32.h: undef stat to silence mingw-w64 stat
+ redefinition warnings (GCC 4.6.3).
- * lib/yaml/tag.rb: Replace nodoc with stopdoc so Module methods get
- documented.
+Fri Sep 21 17:54:54 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu May 11 18:10:43 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * configure.in: add -Wall always.
- * util.c (ruby_strtod): should not raise ERANGE when the input
- string does not have any digits. [ruby-dev:28629]
+Thu Sep 20 10:23:37 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun May 7 03:09:51 2006 Stephan Maka <stephan@spaceboyz.net>
+ * thread_pthread.c (native_cond_initialize): destroy condattr
+ after using it. Patch by Stanislav Sedov. Thank you.
+ [Bug #7041] [ruby-core:47619]
- * lib/resolv.rb (Resolv::DNS::Requester::ConnectedUDP#initialize):
- Use AF_INET6 for nameservers containing colons.
+Sun Sep 9 23:01:43 2012 Tanaka Akira <akr@fsij.org>
-Sat May 6 00:38:42 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/zlib/extconf.rb: detect z_crc_t type which will be defined
+ since zlib-1.2.7.
- * signal.c (trap): sig should be less then NSIG. Coverity found
- this bug. a patch from Kevin Tew <tewk at tewk.com>.
- [ruby-core:07823]
+ * ext/zlib/zlib.c (rb_zlib_crc_table): use z_crc_t if available.
-Thu May 4 02:24:16 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sun Sep 9 02:44:21 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/syck/emitter.c (syck_scan_scalar): avoid accessing
- uninitialized array element. a patch from Pat Eyler
- <rubypate at gmail.com>. [ruby-core:07809]
+ * ext/zlib/extconf.rb: Use an exception instaed of bare puts.
- * array.c (rb_ary_fill): initialize local variables first. a
- patch from Pat Eyler <rubypate at gmail.com>. [ruby-core:07810]
+Sun Sep 9 02:44:21 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/syck/yaml2byte.c (syck_yaml2byte_handler): need to free
- type_tag. a patch from Pat Eyler <rubypate at gmail.com>.
- [ruby-core:07808]
+ * ext/psych/extconf.rb: Use an exception instaed of bare abort.
-Wed May 3 02:12:07 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sun Sep 9 02:44:21 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/socket/socket.c (make_hostent_internal): accept ai_family
- check from Sam Roberts <sroberts at uniserve.com>.
- [ruby-core:07691]
+ * ext/fiddle/extconf.rb: Use an exception instaed of bare abort.
-Mon May 1 12:23:19 2006 <sinara@blade.nagaokaut.ac.jp>
+Sun Sep 9 02:44:21 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * numeric.c (num_div): use floor rather than rb_Integer().
- [ruby-dev:28589]
+ * ext/readline/extconf.rb: Use an exception instead of bare exit.
- * numeric.c (flo_divmod): the first element of Float#divmod should
- be an integer. [ruby-dev:28589]
+Sun Sep 9 02:34:39 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * test/ruby/test_float.rb: add tests for divmod, div, modulo and remainder.
+ * ext/extmk.rb: Show a message when extconf.rb raised an exception.
+ * ext/openssl/extconf.rb: Use exception raising instead of message
+ and/or abort. We want to display error message to console _and_
+ logging into mkmf.log.
-Sat Apr 29 22:42:08 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sun Sep 9 02:30:20 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/openssl/ossl_asn1.c (ossl_asn1_decode0): should initialize
- flag. [ruby-core:07785]
+ * thread.c (rb_mutex_lock): stop multiple threads use
+ pthread_cond_timedwait() concurrently. [Bug #6278] [ruby-core:44275]
-Fri Apr 28 10:53:16 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Aug 30 09:24:43 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * util.c (ruby_strtod): should not cut off 18 digits for no
- reason. [ruby-core:07796]
+ * lib/uri/ftp.rb (URI::FTP#initialize): raise InvalidURIError if "//"
+ is not present [ruby-core:47344] [Bug #6945]
- * util.c (ruby_strtod): fixed wrong conversion.
+Tue Aug 28 00:40:14 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Apr 27 01:38:10 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/webrick/test_cgi.rb (TestWEBrickCGI#start_cgi_server): there are
+ no guarantee of existance of RbConfig::CONFIG['LIBPATHENV'].
+ it only exists in Unix-like environments.
- * array.c (rb_ary_fill): internalize local variable "beg" to
- pacify Coverity. [ruby-core:07770]
+ * test/webrick/test_filehandler.rb
+ (WEBrick::TestFileHandler#test_script_disclosure): ditto.
-Wed Apr 26 16:59:24 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Aug 23 12:08:25 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
- * pack.c (pack_unpack): now supports CRLF newlines. a patch from
- <tommy at tmtm.org>. [ruby-dev:28601]
+ * test/ruby/test_file_exhaustive.rb
+ (TestFileExhaustive#test_stat_special_file): add a test.
+ GetFileAttributesExW fails to get attributes of special files
+ such as pagefile.sys.
-Tue Apr 25 18:00:05 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * win32/win32.c (check_valid_dir): for performance, check the path
+ by FindFirstFileW only if the path contains "...".
- * ext/tk/tcltklib.c (delete_slaves): maybe increment the reference
- count of a NULL Tcl_Obj [ruby-core:07759].
+ * win32/win32.c (winnt_stat): use GetFileAttributesExW instead of
+ FindFirstFileW since GetFileAttributesExW is faster.
+ Based on the patch by Dusan D. Majkic.
+ [ruby-core:47083] [Feature #6845]
-Tue Apr 25 07:55:31 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Aug 23 11:19:51 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/jcode.rb (String::tr_s): should have translated non
- squeezing character sequence (i.e. a character) as well. thanks
- to Hiroshi Ichikawa <gimite at gimite.ddo.jp> [ruby-list:42090]
+ * thread_pthread.c (ruby_init_stack): STACK_GROW_DIR_DETECTION is
+ necessary on platforms with unknown stack direction. [Bug #6761]
-Tue Apr 25 00:08:24 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Aug 23 11:19:51 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * regex.c (re_compile_pattern): should check if c is not a
- multibyte character. a patch from KIMURA Koichi
- <kimura.koichi at canon.co.jp>. [ruby-dev:28598]
+ * thread_pthread.c (get_stack): Linux is the only OS which includes
+ the size of guard page into the stack size.
-Fri Apr 21 15:19:13 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu Aug 23 11:19:51 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/tcltklib.c (lib_eventloop_ensure): refer freed pointer
- [ruby-core:07744] and memory leak.
+ * gc.h (IS_STACK_DIR_UPPER): utility macro.
-Fri Apr 21 12:14:52 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * thread_pthread.c (get_stack): seems stack size does not include
+ guard size on Mac OS X.
- * ext/socket/socket.c: document update patch from Sam Roberts
- <sroberts at uniserve.com>. [ruby-core:07701]
+ * thread_pthread.c (ruby_init_stack): adjust stack size for offset of
+ addr from the bottom.
-Wed Apr 19 13:55:27 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Aug 23 11:19:51 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * parse.y (arg): too much NEW_LIST()
+ * thread_pthread.c (ruby_init_stack): use stack info if possible.
- * eval.c (SETUP_ARGS0): remove unnecessary access to nd_alen.
+Mon Aug 20 17:11:01 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Apr 19 11:57:04 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * file.c (file_path_convert): don't convert it when the path string is
+ ascii only. [ruby-core:41556] [Bug #5733]
+ tests are contributed by nobu.
- * eval.c (rb_eval): use ARGSCAT for NODE_OP_ASGN1.
- [ruby-dev:28585]
+Thu Aug 9 22:48:58 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * parse.y (list_concat): revert last change.
+ * pack.c (pack_unpack): when unpack('M') occurs an illegal byte
+ sequence, output the "=" character and the following character in
+ the decoded data without any transformation.
+ [ruby-dev:44875] [Bug #5635]
- * parse.y (arg): use NODE_ARGSCAT for placeholder.
+Tue Jul 31 10:36:12 2012 Aaron Patterson <aaron@tenderlovemaking.com>
-Wed Apr 19 11:13:17 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/psych/lib/psych.rb: updated to released version.
- * lib/getoptlong.rb (GetoptLong::get): RDoc update patch from
- mathew <meta at pobox.com>. [ruby-core:07738]
+ * ext/psych/psych.gemspec: ditto
-Wed Apr 19 10:13:27 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Jul 19 09:33:46 2012 Aaron Patterson <aaron@tenderlovemaking.com>
- * variable.c (rb_const_set): raise error when no target klass is
- supplied. [ruby-dev:28582]
+ * ext/psych/emitter.c (initialize): allow a configuration object to be
+ passed to the constructor so that mutation isn't required after
+ instantiation.
-Wed Apr 19 09:49:36 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/psych/lib/psych/handler.rb: add configuration object
- * parse.y (list_concat): should not modify nodes other than
- NODE_ARRAY. [ruby-dev:28583]
+ * ext/psych/lib/psych/visitors/emitter.rb: use configuration object if
+ extra configuration is present.
-Tue Apr 18 17:40:37 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Jul 17 03:56:34 2012 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/tk/lib/multi-tk.rb: add a binding to a container for a slave IP.
+ * ext/psych/lib/psych/visitors/to_ruby.rb: strings with YAML anchors
+ are properly referenced. Patched by Joe Rafaniello via Github:
+ https://github.com/tenderlove/psych/pull/69
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: ditto
+ * test/psych/test_alias_and_anchor.rb: test for change
- * ext/tk/lib/tk.rb: update RELEASE_DATE.
+Sat Jun 16 01:27:14 2012 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/tk/tcltklib.c: forget to reset a Tcl interpreter.
+ * ext/psych/lib/psych.rb: bumping psych to 1.3.3
+ * ext/psych/psych.gemspec: ditto
- * ext/tk/stubs.c: fix potential bugs about handling rb_argv0.
+Fri May 18 15:53:05 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Apr 18 00:11:21 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/psych/extconf.rb: Use an exception instaed of bare abort.
- * eval.c: block_unique should be 1, not frame_unique.
- [ruby-dev:28577]
+Fri May 18 01:28:21 2012 Aaron Patterson <aaron@tenderlovemaking.com>
-Fri Aug 11 15:39:25 2006 Eric Hodel <drbrain@segment7.net>
+ * ext/psych/parser.c (transcode_string): fix encoding index names.
+ Thanks markizko for reporting.
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_body): Make RDoc
- ignore C function prototypes. Patch by Tilman Sauerbeck
- <tilman at code-monkey.de>. [ruby-core:8574]
- * lib/yaml/tag.rb: Replace nodoc with stopdoc so Module methods get
- documented.
+Wed May 16 05:11:29 2012 Aaron Patterson <aaron@tenderlovemaking.com>
-Mon Apr 10 01:03:10 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/psych/lib/psych/visitors/to_ruby.rb: fix a bug with string
+ subclass dumping and loading.
- * prec.c (prec_prec_f): documentation patch from
- <gerardo.santana at gmail.com>. [ruby-core:07689]
+ * test/psych/test_array.rb: pertinent tests
-Sat Apr 8 02:34:34 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/psych/test_string.rb: ditto
- * bignum.c (rb_big_pow): second operand may be too big even if
- it's a Fixnum. [ruby-talk:187984]
+Wed May 16 01:31:21 2012 Aaron Patterson <aaron@tenderlovemaking.com>
-Sat Apr 8 02:12:38 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/psych/lib/psych/visitors/to_ruby.rb: convert omap tagged maps to
+ Psych::Omap objects rather than hashes. [Bug #6425]
- * README.EXT: update symbol description. [ruby-talk:188104]
+ * test/psych/test_omap.rb: pertinent test.
-Thu Apr 6 23:28:47 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed May 16 01:15:45 2012 Aaron Patterson <aaron@tenderlovemaking.com>
- * COPYING: explicitly note GPLv2. [ruby-talk:187922]
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: keep a reference to
+ custom coders so that GC does not impact dumped yaml reference ids.
-Thu Apr 6 11:18:37 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Mon Apr 30 04:43:53 2012 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/tk/lib/tk/panedwindow.rb: lack of arguments. [ruby-core:7681]
+ * ext/psych/lib/psych/json/yaml_events.rb: implicit styles should not
+ be changeable for JSON events.
-Thu Apr 6 01:04:47 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sun Jul 29 04:32:31 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/tcltklib.c: fix SEGV when embedding to an application.
- [ruby-core:7600]
+ * configure.in (ruby_pc): make configurable. [Bug #6051]
- * ext/tk/tcltklib.c: fix SEGV at exit. [ruby-talk:186489]
+Sun Jul 29 04:32:06 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/tkutil/tkutil.c: follow to changing specification of
- instance_eval on ruby-1.9.x.
+ * template/ruby.pc.in: added rubylibprefix, {rubylib,vendor,site}dir
+ and {ruby,vendor,site}archdir. [ruby-core:42766][Feature #6052]
- * ext/tk/lib/tk.rb: ditto.
+Sun Jul 29 04:31:01 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/tk/lib/multi-tk.rb: ditto.
+ * bignum.c: Added #include <strings.h> for ffs(). Patch by Perry
+ Smith. Thank you. [Bug #6748]
- * ext/tk/lib/tk.rb: remove warning about redefinition of methods.
+Sat Jul 28 04:04:01 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/tk/lib/tk/variable.rb: remove warning about unseting Tcl
- variables.
+ * include/ruby/intern.h (rb_num_zerodiv): Added NORETURN.
+ Patched by Xi Wang. [Bug #6736]
-Wed Mar 29 20:54:44 2006 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+Wed Jul 4 19:36:17 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/win32ole/win32ole.c (fole_getproperty): WIN32OLE#[] should accept
- multi arguments.
+ * ext/dl/cfunc.c (rb_dlcfunc_call): also needed the workaround for VC8
+ for x64. [ruby-dev:45875] [Bug #6676]
+ reported by aves_ramphastos (Seigo Ishigane)
- * ext/win32ole/tests/testWIN32OLE.rb (test_setproperty_bracket): ditto.
+Tue Jul 3 19:37:52 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Mar 29 10:07:44 2006 NAKAMURA Usaku <usa@ruby-lang.org>
+ * file.c (rmext): no extension to strip if empty string.
- * ext/nkf/nkf-utf8/nkf.c (nkf_each_char_to_hex, encode_fallback_subchar,
- e2w_conv): support C90 compiler.
+ * proc.c (rb_vm_rewrite_dfp_in_errinfo): Fix `unexpected return'
+ occurs when a proc is called in ensure. [Backport #6460]
-Wed Mar 29 06:48:40 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Jul 3 11:44:23 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (backtrace): reports aliased method names in a generated
- backtrace. a patch from "U.Nakamura" <usa at garbagecollect.jp>.
- [ruby-dev:28471]
+ * file.c (rb_enc_path_next, rb_enc_path_skip_prefix)
+ (rb_enc_path_last_separator, rb_enc_path_end)
+ (ruby_enc_find_basename, ruby_enc_find_extname): encoding-aware
+ path handling functions.
-Mon Mar 27 22:19:09 2006 NARUSE, Yui <naruse@ruby-lang.org>
+ * file.c (rb_home_dir, file_expand_path, rb_realpath_internal)
+ (rb_file_s_basename, rb_file_dirname, rb_file_s_extname)
+ (rb_file_join): should respect the encodings of arguments than
+ file system encoding. [ruby-dev:45145] [Bug #5919]
- * ext/nkf/nkf-utf8/{nkf.c, utf8tbl.c, config.h}: imported nkf 2.0.6.
- * Add --ic / --oc option and mapping tables.
- * Add fallback option.
- * Add --no-best-fit-chars option.
- * Fix some bugs.
+ * dir.c (check_dirname, ruby_glob0): ditto.
- * ext/nkf/nkf.c (nkf_split_options): added for parse option string.
+ * ext/pathname/pathname.c (path_sub_ext): ditto.
- * ext/nkf/lib/kconv.rb (Kconv.to*): add -m0.
- Note that Kconv.to* still imply -X.
+Tue Jul 3 11:43:46 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Mar 27 03:17:21 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * dir.c (dir_chdir, check_dirname): get rid of optimization-out.
- * eval.c (rb_call0): insecure calling should be checked for non
- NODE_SCOPE method invocations too.
+Thu Jun 28 17:57:49 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * eval.c (rb_alias): should preserve the current safe level as
- well as method definition.
+ * win32/win32.c (is_socket, is_console): add prototypes to fix compile
+ problem with gcc introduced at r32549.
-Fri Mar 24 23:14:30 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Jun 27 08:31:50 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (yield_under_i): pass self again for instance_eval().
- [ruby-dev:28466]
+ * insns.def (splatarray): make new array if flag is set.
-Fri Mar 24 17:20:03 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * compile.c (iseq_compile_each): make new array with
+ splat. [ruby-core:21901][Feature #1125]
- * process.c (rb_f_sleep): remove description about SIGALRM which
- is not valid on the current implementation. [ruby-dev:28464]
+Wed Jun 27 04:23:26 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Mar 23 10:47:03 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * win32/win32.c (rb_w32_sysinit): let the system not display the
+ critical-error-handler message box and the Windows Error Reporting
+ dialog. [ruby-core:45389] [Bug #6535]
- * eval.c (method_missing): should support argument splat in
- super. [ruby-talk:185438]
+Wed Jun 27 04:20:41 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Mar 20 12:05:18 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * bignum.c (rb_big_pow): estimate result bit size more precisely.
+ [ruby-core:30735][Feature #3429]
- * configure.in: Solaris SunPro compiler -rapth patch from
- <kuwa at labs.fujitsu.com>. [ruby-dev:28443]
+Tue Jun 26 20:36:53 2012 Tanaka Akira <akr@fsij.org>
-Mon Mar 20 09:40:23 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/drb/ssl.rb: generate 1024 bits RSA key instead of 512 bits.
+ OpenSSL 1.0.1 rejects 512 bits RSA key for TLS1.2 with SHA512.
+ http://rt.openssl.org/Ticket/Display.html?id=2769&user=guest&pass=guest
+ reported by Bohuslav Kabrda.
+ [ruby-core:43844] [ruby-trunk - Bug #6221]
- * configure.in: remove enable_rpath=no for Solaris.
- [ruby-dev:28440]
+Tue Jun 26 20:35:59 2012 Eric Hodel <drbrain@segment7.net>
-Fri Mar 17 19:08:49 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/zlib/zlib.c (do_inflate): Inflate more data if buffered data
+ exists. Allows Zlib::Inflate#set_dictionary to work.
+ [ruby-trunk - Bug #5929]
- * ext/openssl/ossl_ssl.c, ext/openssl/ossl_nsspki.c: fix typo.
- [ruby-core:07571]
+Thu Jun 21 13:42:57 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Mar 15 16:54:21 2006 NAKAMURA Usaku <usa@ruby-lang.org>
+ * thread.c (rb_threadptr_execute_interrupts_common):
+ test_signal_requiring of test/ruby/test_signal.rb fail if the sub
+ process is killed on waiting IO in lex_io_gets in rb_load_file in
+ rb_load_internal in require.
+ This is because
+ (1) the process receive the killing signal in
+ rb_thread_io_blocking_region in rb_read_internal in lex_io_gets.
+ (2) set th->errinfo as INT2FIX(TAG_FATAL) at
+ rb_threadptr_execute_interrupts_common.
+ (3) escape rb_load_file in rb_load_internal and jump to EXEC_TAG()
+ without set loaded as TRUE.
+ (4) call first rb_exc_raise(GET_THREAD()->errinfo); because loaded
+ is FALSE as above. this errinfo should be an exception object
+ but this is INT2FIX(TAG_FATAL).
+ Don't call first rb_exc_raise if GET_THREAD()->errinfo is Fixnum.
- * lib/mkmf.rb (create_makefile): support libraries without *.so.
+Mon Jun 11 19:56:22 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Mar 15 16:35:43 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * test/webrick/test_cgi.rb (class TestWEBrickCGI): respect
+ RbConfig::CONFIG["LIBPATHENV"]. [Bug #5135] [ruby-core:38653]
+ * test/webrick/test_filehandler.rb (class WEBrick): ditto.
- * ext/openssl/ossl_ssl.c, ext/openssl/ossl_nsspki.c: should use
- "rb_str_new(0, 0)" to make empty string.
+Tue Jun 5 14:03:53 2012 Akinori MUSHA <knu@iDaemons.org>
-Sat Mar 11 14:24:06 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/ipaddr.rb: Inhibit zero-filled octets in an IPv4 address in
+ all platforms. [ruby-dev:45671]
- * lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::wrap): removed
- space before argument parenthesis. [ruby-talk:183630]
+ * lib/ipaddr.rb: Allow the x:x:x:x:x:x:d.d.d.d form not limited to
+ IPv4 mapped/compatible addresses. This change also makes it
+ possible for the parser to understand IPv4 mapped and compatible
+ IPv6 addresses in non-compressed form.
- * ruby.1: a clarification patch from David Lutterkort
- <dlutter at redhat.com>. [ruby-core:7508]
+ * lib/ipaddr.rb: Stop exposing IPSocket.valid*? methods which were
+ only usable on non-IPv6-ready platforms.
-Sat Mar 4 15:26:40 2006 Tanaka Akira <akr@m17n.org>
+Sat Jun 2 18:49:39 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * gc.c (id2ref): fix symbol test.
+ * string.c (rb_enc_cr_str_buf_cat): don't reset coderange as unknown.
+ the condition 'ptr_a8 && str_cr != ENC_CODERANGE_7BIT' means not
+ unknown, str is also ASCII-8BIT because str_encindex == ptr_encindex,
+ and nont (str_cr == ENC_CODERANGE_UNKNOWN) and
+ str_cr != ENC_CODERANGE_7BIT means str_cr is valid because ASCII-8BIT
+ can't be broken. [ruby-dev:45688] [Bug #6509]
-Sat Mar 4 01:08:07 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed May 30 17:19:56 2012 Eric Hodel <drbrain@segment7.net>
- * lib/rdoc/ri/ri_paths.rb (RI::Paths): adding paths from rubygems
- directories. a patch from Eric Hodel <drbrain at segment7.net>.
- [ruby-core:07423]
+ * ext/zlib/zlib.c (do_inflate): Inflate more data if buffered data
+ exists. Allows Zlib::Inflate#set_dictionary to work.
+ [ruby-trunk - Bug #5929]
-Thu Mar 2 19:44:18 2006 Tanaka Akira <akr@m17n.org>
+Mon May 28 11:40:19 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * gc.c: align VALUE with sizeof(RVALUE) globally.
- (is_pointer_to_heap): check alignment out of loop.
- (id2ref): avoid collision between symbols and objects.
- (rb_obj_id): ditto. moved from object.c.
- [ruby-talk:178364] [ruby-core:7305]
+ * io.c (rb_io_extract_modeenc): fail only if conflicting
+ text/binary modes given explicitly. [ruby-dev:45268][Bug #6055]
-Thu Mar 2 18:58:18 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri May 25 17:18:06 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_thread_fd_writable): should not re-schedule output
- from KILLED thread (must be error printing).
+ * parse.y (f_arglist): should reset lexical states after empty
+ argument list with no parenthesis as well as parenthesized list,
+ so that reserved name method definition work. [ruby-dev:45626]
+ [Bug #6403]
-Thu Mar 2 17:57:49 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Fri May 25 10:40:31 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
- * gc.c: commited magic for reducing RVALUE size on windows. (24->20byte)
- [ruby-core:7474]
+ * include/ruby/win32.h (FD_SET): change function to macro.
+ To avoid buffer overflow when smaller FD_SETSISE is used in ext
+ libraries.
-Thu Mar 2 12:59:14 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * win32/win32.c (rb_w32_fdset): this function is not used anymore.
+ But we leave this for compatibility.
- * win32/win32.c (filetime_to_unixtime): should set tm_isdst to -1.
- stat() didn't treat daylight saving time property on WinNT.
- [ruby-talk:182100]
+ * win32/win32.c (rb_w32_select_with_thread): fix SEGV when smaller
+ FD_SETSISE is used in ext libraries. Dereference of fd_set pointer
+ causes SEGV.
-Thu Mar 2 08:02:42 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/-ext-/win32/test_fd_setsize.rb(TestFdSetSize): add tests for
+ above.
+ * ext/-test-/win32/fd_setsize/depend: ditto.
+ * ext/-test-/win32/fd_setsize/extconf.rb: ditto.
+ * ext/-test-/win32/fd_setsize/fd_setsize.c: ditto.
- * gc.c (add_heap): heap_slots may overflow. a patch from Stefan
- Weil <weil at mail.berlios.de>.
+ [ruby-core:44588] [Bug #6352]
-Wed Mar 1 00:24:31 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Fri May 25 10:38:06 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rdoc/parsers/parse_rb.rb (read_escape): could not handle /\^/.
- merged Mr. Ishizuka's lib/irb/ruby-lex.rb 's patch rev 1.29.
- [ruby-talk:181631] [ruby-dev:28404]
+ * io.c (io_strip_bom): check EOF. [Bug #6487][ruby-core:45203]
-Tue Feb 28 09:32:17 2006 NAKAMURA Usaku <usa@ruby-lang.org>
+Fri May 25 10:36:38 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/drb/extservm.rb (invoke_service_command): cannot invoke command
- if command name is quoted on mswin32. [ruby-dev:28400]
+ * parse.y (f_arglist): should reset lexical states after empty
+ argument list with no parenthesis as well as parenthesized list,
+ so that reserved name method definition work. [ruby-dev:45626]
+ [Bug #6403]
-Mon Feb 27 00:19:16 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon May 21 16:24:40 2012 Akinori MUSHA <knu@iDaemons.org>
- * ruby.h (SYM2ID): should not cast to signed long.
- [ruby-core:07414]
+ * ext/syslog/syslog.c (mSyslog_inspect): Use rb_sprintf().
-Fri Feb 24 20:07:23 2006 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * ext/syslog/syslog.c (mSyslog_inspect): Make sure self is a
+ module before calling rb_class2name().
- * test/drb/drbtest.rb (add_service_command): quote pathnames in the
- server's command line for space contained directory names.
- Thanks, arton. [ruby-dev:28386]
+Sat May 19 14:42:37 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Feb 24 12:11:08 2006 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/drb/drbtest.rb ({DRbCore,DRbAry}#teardown}: cannot pass SIGTERM
+ to another process on Windows, so use SIGINT instead.
- * instruby.rb: install *.exe.manifest and *.dll.manifest if exist.
- It's for VC++8.
+Sat May 19 14:42:20 2012 Tanaka Akira <akr@fsij.org>
-Fri Feb 24 11:33:52 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * lib/drb/ssl.rb: generate 1024 bits RSA key instead of 512 bits.
+ OpenSSL 1.0.1 rejects 512 bits RSA key for TLS1.2 with SHA512.
+ http://rt.openssl.org/Ticket/Display.html?id=2769&user=guest&pass=guest
+ reported by Bohuslav Kabrda.
+ [ruby-core:43844] [ruby-trunk - Bug #6221]
- * bcc32/Makefile.sub (HAVE_HYPOT): bcc32 has hypot().
+Sat May 19 14:41:45 2012 Tanaka Akira <akr@fsij.org>
-Fri Feb 24 11:19:58 2006 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/drb/drbtest.rb: rescue Errno::ESRCH for Process.kill.
+ reported by NARUSE, Yui. [ruby-dev:45551]
- * time.c (time_new_internal): add prototype to tell the compiler
- arugments types.
+Sat May 19 14:41:09 2012 Tanaka Akira <akr@fsij.org>
- * win32/win32.c (NtInitialize): need to set a handler for VC++8.
+ * lib/drb/extservm.rb (DRb::ExtServManager): don't use /bin/sh to
+ invoke service subprocess. mark detach threads for clean up.
-Fri Feb 24 08:19:16 2006 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/drb/drbtest.rb: clean up the service subprocess in teardown.
- * test.rb: Removed. Obsolete by test/nkf.
+ * test/drb/test_drb.rb: set @service_name for teardown.
- * ext/.document: enabled documents in nkf and kconv
-
- * ext/nkf/nkf.c ext/nkf/lib/kconv.rb: Add rdoc.
-
-Thu Feb 23 22:39:59 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bcc32/Makefile.sub: use borlndmm.dll if possible. bcc32's RTL internal
- memory manager cannot handle large memory block properly.
- ex: 10000.times { "" << "." * 529671; GC.start } # crash
- [ruby-dev:28230]
-
-Thu Feb 23 13:20:28 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * eval.c (SETUP_ARGS0): fixed memory corruption. [ruby-dev:28360]
-
-Tue Feb 21 02:18:46 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * configure.in (mingw): have link. [ruby-list:41838]
-
- * win32/Makefile.sub (config.h): ditto.
-
-Tue Feb 21 02:07:39 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (f_arglist): should set command_start = Qtrue for
- command body. [ruby-talk:180648]
-
-Mon Feb 20 17:37:26 2006 Tanaka Akira <akr@m17n.org>
-
- * mkconfig.rb: alias RbConfig for Config.
-
-Mon Feb 20 12:27:53 2006 Kent Sibilev <ksruby@gmail.com>
-
- * lib/rational.rb (Integer::gcd): small typo fix.
- [ruby-core:07395]
-
-Mon Feb 20 01:05:27 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/rational.rb (Integer::gcd): replaced by gcd4 in
- [ruby-core:07390]. [ruby-core:07377]
-
-Mon Feb 20 00:57:02 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl.h (OSSL_Debug): should not use __func__.
- [ruby-dev:28339]
-
-Sun Feb 19 04:46:29 2006 Guy Decoux <ts@moulon.inra.fr>
-
- * eval.c: initial value for block_unique must be 1.
- [ruby-talk:180420]
-
-Sat Feb 18 23:58:26 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/drb/test_drbunix.rb: ditto.
- * lib/tracer.rb (Tracer::Tracer.add_filter): turn on tracer mode
- only when caller() level size is one. [ruby-core:07389]
+ * test/drb/test_drbssl.rb: ditto.
- * lib/rdoc/parsers/parse_rb.rb: need not to require "tracer".
- [ruby-core:07389]
+Sat May 19 14:40:49 2012 Tanaka Akira <akr@fsij.org>
- * sample/rtags.rb: ditto.
+ * lib/drb/ssl.rb: close accepted TCP socket if SSL accept is failed.
+ [ruby-dev:45541]
-Sat Feb 18 12:18:26 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat May 19 14:39:50 2012 Tanaka Akira <akr@fsij.org>
- * lib/fileutils.rb (FileUtils::fu_world_writable): make it
- private. [ruby-core:07383]
+ * lib/webrick/utils.rb: fix fcntl call.
-Sat Feb 18 00:22:39 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/drb/unix.rb: ditto.
- * lib/tracer.rb: merged a minor clarification patch from Daniel
- Berger <Daniel.Berger at qwest.com>. [ruby-core:07376]
+Fri May 18 18:13:44 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Feb 17 11:18:42 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * lib/mkmf.rb (MakeMakefile#configuration): keep space at end of
+ OUTFLAG and COUTFLAG. [ruby-dev:45650]
- * util.c (ruby_strtod): Float("1e") should fail. [ruby-core:7330]
+Fri May 18 00:04:53 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * pack.c (EXTEND32): unpack("l") did not work where sizeof(long) != 4.
- [ruby-talk:180024]
+ * win32/win32.c (rb_w32_fstat, rb_w32_fstati64): convert FILETIME
+ to time_t directly, not to be affected by TZ unnecessarily.
- * pack.c (pack_unpack): fixed integer overflow on template "w".
- [ruby-talk:180126]
+ * win32/win32.c (unixtime_to_filetime): convert time_t to FILETIME
+ simply.
-Fri Feb 17 09:39:29 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed May 16 01:07:46 2012 Aaron Patterson <aaron@tenderlovemaking.com>
- * eval.c (rb_thread_wait_for): sleep should always sleep for
- specified amount of time. [ruby-talk:180067]
+ * ext/digest/md5/extconf.rb: use pkg_config for openssl so that
+ customized ssl paths are used for linking. Backports fixes for
+ [ruby-core:44755].
+ * ext/digest/rmd160/extconf.rb: ditto
+ * ext/digest/sha1/extconf.rb: ditto
+ * ext/digest/sha2/extconf.rb: ditto
-Thu Feb 16 01:10:48 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon May 14 17:14:10 2012 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
- * eval.c (backtrace): frame->orig_func may not be initialized.
- [ruby-core:07367]
+ * test/ruby/test_io.rb (test_flush_in_finalizer1): don't use IO.for_fd
+ to close IO objects. it create IO object with already closed fd, and
+ cause occasional Errno::EBADF in following tests. [ruby-core:45020]
+ [Bug #6228]
-Wed Feb 15 16:52:52 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon May 14 17:14:10 2012 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
- * eval.c (rb_eval): NODE_OP_ASGN1 should allow splat in its
- argument list. [ruby-core:07366]
+ * test/ruby/test_io.rb (TestIO): revert r35631. it broke the intent of
+ test_flush_in_finalizer1. [ruby-core:43951] [Bug ##6228]
- * parse.y (arg): avoid unnecessary extra argument.
- [ruby-core:07366]
+Mon May 14 13:18:56 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_eval): honor visibility on OP_ASGN1 and
- OP_ASGN2. [ruby-core:07366]
+ * parse.y (parser_tokadd_string): insert a backslash only if
+ quoted by single quotes. [ruby-dev:45281] [Bug #6069]
-Wed Feb 15 10:09:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon May 14 13:17:57 2012 Luis Lavena <luislavena@gmail.com>
- * eval.c (yield_under_i): should not pass self as an argument to
- the block for instance_eval. [ruby-core:07364]
+ * test/ruby/test_io.rb (class TestIO): Disable GC during IO tests to
+ avoid file descriptors being GC'ed. Suggestion by Tomoyuki Chikanaga
+ [ruby-core:43951][Bug #6228]
-Wed Feb 15 09:20:35 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri May 11 14:09:48 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_obj_instance_eval): should be no singleton classes for
- true, false, and nil. [ruby-dev:28186]
+ * ext/bigdecimal/bigdecimal.c (PUSH): to prevent VALUE from GC,
+ must not cast it to unsigned long, which may be shorter than
+ VALUE, and the result can be mere garbage.
-Tue Feb 14 18:48:33 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri May 11 01:04:54 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
- * eval.c (DMETHOD_P): accessing wrong frame. [ruby-dev:28181]
+ * io.c (io_unread): fix IO#pos with mode 'r' bug on Windows.
+ If the end of reading buffer is CR, io_unread() needs to unread one
+ more byte.
+ [ruby-core:44874] [Bug #6401]
- * eval.c (proc_invoke): preserve FRAME_DMETH flag.
+ * test/ruby/test_io_m17n.rb (TestIO_M17N#test_pos_with_buffer_end_cr):
+ add a test for above.
-Tue Feb 14 15:13:51 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Wed May 9 15:59:17 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/zlib/zlib.c: supress warning on test/zlib. [ruby-dev:28323]
+ * configure.in (RUBY_WERROR_FLAG): append all warning flags which
+ are enabled to compile, so that printf format modifiers properly
+ fail. [ruby-core:41351] [Bug #5679]
-Tue Feb 14 14:01:17 2006 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon May 7 20:23:29 2012 Tanaka Akira <akr@fsij.org>
- * time.c (search_time_t): support non 32bit time_t environments.
+ * lib/securerandom.rb (random_bytes): call to_int method for the
+ argument at first.
- * win32/Makefile.sub (config.h): VC++8 has ``long long'' type.
+Mon May 7 20:23:29 2012 Tanaka Akira <akr@fsij.org>
- * win32/Makefile.sub (config.h): VC++8's time_t is 64bit value.
+ * lib/securerandom.rb: show actual read length in an error message.
- * win32/win32.c (rb_w32_utime): drop read-only attribute before
- changing file time.
+Mon May 7 11:09:20 2012 NARUSE, Yui <naruse@ruby-lang.org>
- all changes are backported from CVS HEAD.
+ * ext/bigdecimal/bigdecimal.c (Init_bigdecimal): define IDs before
+ they are used. [ruby-core:44900] [Bug #6406]
-Tue Feb 14 11:21:38 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Apr 27 11:02:33 2012 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * io.c (argf_forward): should not use frame->argv.
- [ruby-core:07358]
+ * test/rinda/test_rinda.rb (test_core_03_notify): Fixed test failures
+ [ruby-dev:44430] [Ruby 1.9 - Bug #372]
-Mon Feb 13 18:08:12 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Apr 27 08:29:51 2012 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * eval.c (rb_call0): argument update propagation. [ruby-dev:28044]
+ * test/rinda/test_rinda.rb: fix sticks on some testsf problem
+ [Bug #6272]
- * env.h: remove argv member from struct FRAME.
+Wed Apr 25 05:56:56 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Feb 13 13:27:00 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/optparse.rb (OptionParser#to_a): split for each lines.
+ [ruby-dev:45568][Bug #6348]
- * eval.c (eval): should push class from binding if supplied.
- [ruby-core:07347]
+Tue Apr 24 21:20:39 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Feb 13 00:04:00 2006 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * lib/optparse.rb (OptionParser#to_a): should split by end-of-line,
+ and MUST TEST IT, MUST RUN THE TEST, MUST VERIFY BEFORE BACKPORT.
+ [ruby-dev:45568][Bug #6348]
- * lib/erb.rb (ERB::Compiler): add instance variable @insert_cmd to
- change <%='s behavior. (backported 1.15 - 1.16)
+Tue Apr 24 14:55:41 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Feb 11 02:04:11 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/optparse.rb (OptionParser#to_a): String#to_a is no longer
+ defined. [ruby-dev:45568][Bug #6348]
- * eval.c (eval): no need to push ruby_class. [ruby-dev:28176]
+Sat Apr 21 07:16:16 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Feb 11 01:57:44 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * strftime.c (rb_strftime_with_timespec): fix padding of time zone
+ offset. [ruby-dev:43287][Bug #4458]
- * eval.c (rb_f_autoload): check if ruby_cbase is nil (during
- instance_eval for objects cannot have singleton classes,
- e.g. fixnums and symbols). [ruby-dev:28178]
+ * strftime.c (rb_strftime_with_timespec): add an interim digit for
+ the timezone offset which is less than an hour.
-Tue Feb 7 23:03:24 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * strftime.c (rb_strftime_with_timespec): fix carry-up bug and
+ overwrite '+' with '-' if negative offset less than a hour.
+ [ruby-core:44447][Bug #6323]
- * ext/zlib/zlib.c: should not access ruby objects in finalizer.
- [ruby-dev:28286]
+Fri Apr 20 12:30:06 2012 Eric Hodel <drbrain@segment7.net>
-Mon Feb 6 16:02:51 2006 WATANABE Hirofumi <eban@ruby-lang.org>
+ * lib/rubygems/ssl_certs/AddTrustExternalCARoot.pem: Removed to avoid
+ conflict with ca-bundle.pem
+ * lib/rubygems/ssl_certs/VerisignClass3PublicPrimaryCertificationAuthority-G2.pem:
+ ditto.
+ * lib/rubygems/ssl_certs/Entrust_net-Secure-Server-Certification-Authority.pem:
+ ditto.
- * file.c (rb_thread_flock): ERROR_NOT_LOCKED is not an error on Cygwin.
- In such situation, flock() should return 0.
+Fri Apr 20 08:30:55 2012 Eric Hodel <drbrain@segment7.net>
-Mon Feb 6 00:41:08 2006 Tanaka Akira <akr@m17n.org>
+ * lib/rubygems: Update to RubyGems 1.8.23 which contains security
+ fixes:
- * ruby.h (RSTRUCT_LEN, RSTRUCT_PTR): defined for source level
- compatibility with ruby 1.9.
+ RubyGems now disallows redirection from HTTPS to HTTP.
-Sun Feb 5 21:05:34 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ RubyGems now verifies SSL connections.
- * numeric.c (fix_to_s): removed workaround for radix 2. Historically,
- rb_fix2str could only handle radix 8, 10, 16. (Rev1.37) But for now,
- it can handle radix 2..36. [ruby-Bugs#3438] [ruby-core:7300]
+ See https://github.com/rubygems/rubygems/blob/1.8/History.txt for
+ changes since 1.8.22.
+ * test/rubygems: ditto.
-Sun Feb 5 18:55:08 2006 Minero Aoki <aamine@loveruby.net>
+Fri Apr 20 07:39:50 2012 Eric Hodel <drbrain@segment7.net>
- * lib/net/http.rb: imported from trunk, rev 1.129
+ * lib/rubygems: Update to RubyGems 1.8.22 plus r33517 and r35337 which
+ were ported to the rubygems git repository.
- * lib/net/http.rb (add_field, get_fields): keep 1.8.2 backward
- compatibility.
+ See https://github.com/rubygems/rubygems/blob/1.8/History.txt for
+ changes since 1.8.11.
- * lib/net/https.rb: imported from trunk, rev 1.3.
+ * test/rubygems: ditto.
- * lib/net/https.rb: #use_ssl? definition moved from net/http.rb.
+ * lib/rubygems/version.rb: Fixed init_with warning by calling into
+ yaml_initialize (for syck) from psych's init_with
-Sun Feb 5 14:22:15 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Thu Apr 19 12:55:31 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/pstore.rb: should return default value if name is not found.
- [ruby-core:7304]
+ * ext/-test-/win32/dln/extconf.rb: need import library for ordinal
+ entry even on mingw. [ruby-core:44441][Bug #6320]
- * lib/pstore.rb: should raise PStore::Error if not in transaction.
+Wed Apr 18 23:08:58 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Feb 4 22:51:43 2006 Tanaka Akira <akr@m17n.org>
+ * configure.in (DOT, DOXYGEN): use AC_CHECK_PROGS instead of
+ AC_CHECK_PROG which needs the third argument. [ruby-core:44433]
+ [Bug #6316]
- * eval.c: apply the FreeBSD getcontext/setcontext workaround
- only before FreeBSD 7-CURRENT.
+ * configure.in (PKG_CONFIG): fix condition to skip older version
+ of pkg-config. continue in backticks does not affect outside.
-Sat Feb 4 21:19:23 2006 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Apr 17 21:35:47 2012 Kouhei Sutou <kou@cozmixng.org>
- * win32/win32.c (LK_ERR): ERROR_NOT_LOCKED is not an error.
- In such situation, flock() should return 0.
+ * lib/rexml/parsers/baseparser.rb, test/rexml/test_namespace.rb:
+ fix the default xml namespace URI validation.
+ [ruby-dev:45169] [Bug #5956]
+ Reported by Miho Hiramatsu. Thanks!!!
-Sat Feb 4 15:56:37 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Mon Apr 17 14:27:22 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * numeric.c (fix_to_s): (2**32).to_s(2) fails with exception where
- sizeof(int) == 4 < sizeof(long). [ruby-core:7300]
+ * dln.c (rb_w32_check_imported): skip ordinal entries. based on a
+ patch by phasis68 (Heesob Park) at [ruby-core:44381].
+ [ruby-core:44371][Bug #6303]
-Fri Feb 3 15:06:50 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Sun Apr 15 14:57:00 2012 Tanaka Akira <akr@fsij.org>
- * ext/syck/syck.c (syck_move_tokens): should reset p->cursor or etc
- even if skip == 0. This causes buffer overrun.
- (ex: YAML.load('--- "..' + '\x82\xA0' * 511 + '"'))
+ * test/test_pty.rb (test_pty_check_default): call PTY.check until
+ "cat" command is finished.
-Thu Feb 2 23:51:18 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Sun Apr 15 14:54:16 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/syck/emitter.c (syck_emitter_write): should not set '\0' on
- emitter's marker. if marker points to the end of buffer, this causes
- buffer overrun. (ex: YAML.dump("." * 12288))
+ * test/ruby/test_process.rb (TestProcess#windows?): new method.
-Thu Feb 2 16:01:24 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_process.rb (TestProcess#*): use above method.
- * eval.c (eval): need not to protect $SAFE value.
- [ruby-core:07177]
+ * test/ruby/test_process.rb (TestProcess#test_execopts_redirect):
+ windows doesn't support FD_CLOEXEC.
-Thu Feb 2 14:45:53 2006 Ville Mattila <ville.mattila@stonesoft.com>
+Sun Apr 15 06:40:28 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
- * configure.in: The isinf is not regognized by autoconf
- library guesser on solaris 10. [ruby-core:7138]
+ * include/ruby/win32.h (rb_w32_aspawn_flags): add the declaration of
+ new function.
-Wed Feb 1 22:01:47 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * process.c (enum): add EXEC_OPTION_PGROUP and move the position
+ above for the usage in proc_spawn_n().
- * configure.in, hash.c (ruby_setenv): use setenv(3) and unsetenv(3)
- where they are supported. modifing environ variable seems to
- segfault solaris 10. [ruby-core:7276] [ruby-dev:28270]
+ * process.c (proc_spawn_n): add an argument to pass new option
+ `new_pgroup`. The option specifies CREATE_NEW_PROCESS_GROUP flag to
+ CreateProcessW(). This flag is necessary for the usage of
+ Process.kill on the subprocess on Windows.
- * ruby.c (set_arg0): if use setenv(3), environ space cannot be used
- for altering argv[0].
+ * process.c (rb_exec_arg_addopt): ditto.
-Tue Jan 31 14:46:28 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * process.c (rb_spawn_process): ditto.
- * struct.c (rb_struct_select): update RDoc description.
- [ruby-core:7254]
+ * process.c (documentation for rb_f_spawn): add documentation for new
+ option `new_pgroup` of spawn.
-Tue Jan 31 11:58:51 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/ruby/test_process.rb (TestProcess#test_execopts_new_pgroup):
+ add tests for option `new_pgroup`.
- * ext/tk/lib/multi-tk.rb: add MultiTkIp#eval and bg_eval.
+ * test/ruby/test_thread.rb
+ (TestThreadGroup#test_thread_timer_and_interrupt):
+ add option `new_pgroup: true` to spawn on Windows. It's needed for
+ Process.kill on a subprocess.
- * ext/tk/lib/tk/namespace.rb: TkNamespace#eval was enbugged at the
- last commit. Now it will return a proper object.
+ * win32/win32.c (CreateChild): add an argument to pass
+ dwCreationFlags of CreateProcessW().
-Tue Jan 31 00:10:26 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * win32/win32.c (rb_w32_spawn): ditto.
- * ext/syck/rubyext.c (syck_resolver_transfer): workaround for SEGV.
- ex: ruby -ryaml -e 'YAML.load("!map:B {}")' [ruby-core:7217]
+ * win32/win32.c (rb_w32_aspawn_flags): add new function to pass
+ dwCreationFlags.
-Sat Jan 28 07:56:57 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * win32/win32.c (rb_w32_aspawn): refactor to move the content to
+ rb_w32_aspawn_flags().
+ [ruby-core:43245][Bug #6131]
- * lib/rdoc/usage.rb: support "a:0:33" style caller[-1]. In this case
- file name is "a:0". I don't know this really happens though...
- [ruby-Bugs:3344]
+Sun Apr 15 06:40:28 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
-Wed Jan 25 22:29:04 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_thread.rb
+ (TestThreadGroup#test_thread_timer_and_interrupt): skip on Windows.
+ Process.kill cannot kill a subprocess if CREATE_NEW_PROCESS_GROUP
+ flag is not specified in a call to CreateProcessW().
- * configure.in, dln.c, file.c, intern.h, missing.h (eaccess): use
- system routine if provided. fixed: [ruby-core:07195]
+ * win32/win32.c (CreateChild): revert the usage of
+ CREATE_NEW_PROCESS_GROUP flag for compatibility.
+ [ruby-core:43245][Bug #6131]
-Sun Jan 22 23:27:13 2006 Go Noguchi <gonoguti@yahoo.co.jp>
+Sun Apr 15 04:35:48 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
- * lib/test/unit/autorunner.rb (process_args): ignore arguments after
- '--' so that test scripts can handle them. fixed: [ruby-dev:28258]
+ * io.c (rb_io_eof): use eof() instead of io_fillbuf(). It's because
+ io_unread() doesn't work properly when reading CRLF with read(length)
+ and mode 'r'.
+ [ruby-core:44189][Bug #6271]
-Sun Jan 22 22:09:52 2006 Tanaka Akira <akr@m17n.org>
+ * test/ruby/test_io_m17n.rb (TestIO_M17N#test_read_crlf_and_eof):
+ test for above.
- * eval.c (POST_GETCONTEXT): define separately from PRE_GETCONTEXT on
- IA64 to avoid reusing variable address.
+Sun Apr 15 03:00:54 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Sun Jan 22 20:03:35 2006 Tanaka Akira <akr@m17n.org>
+ * io.c (io_unread): fixed memory leak. report by nagachika via IRC.
- * eval.c (ruby_setjmp): define PRE_GETCONTEXT and POST_GETCONTEXT
- instead of FUNCTION_CALL_MAY_RETURN_TWICE.
- define PRE_GETCONTEXT to clear carry flag for workaround of
- FreeBSD/i386 getcontext/setcontext bug.
- [ruby-dev:28263]
+Sun Apr 15 03:00:54 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
-Sat Jan 21 00:36:47 2006 Tanaka Akira <akr@m17n.org>
+ * io.c (static int io_fflush): add the definition.
+ Use it in set_binary_mode_with_seek_cur().
- * eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): use only on SPARC and IA64
- before gcc 4.0.3.
- [ruby-dev:28247]
+ * io.c (set_binary_mode_with_seek_cur): refactoring to split the
+ content into io_unread(). Fix the possibility of buffer overflow.
-Thu Jan 19 22:21:23 2006 Minero Aoki <aamine@loveruby.net>
+ * io.c (io_unread): add new implementation for Windows. Previous one
+ caused invalid cursor position using IO#pos with OS text mode. New
+ one fixes the bug.
- * lib/fileutils.rb (mv): should remove file after copying.
- [ruby-dev:28223]
+ * test/ruby/test_io_m17n.rb
+ (TestIO_M17N#test_pos_dont_move_cursor_position): add a test for
+ above bug.
+ [ruby-core:43497] [Bug #6179]
-Wed Jan 18 23:37:06 2006 Tanaka Akira <akr@m17n.org>
+Sun Apr 15 03:00:54 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): don't clobber %l7 of SPARC
- if enable-shared.
- (ruby_setjmp): call FUNCTION_CALL_MAY_RETURN_TWICE after getcontext
- too.
- reported by Pav Lucistnik and Marius Strobl.
- http://lists.freebsd.org/pipermail/freebsd-sparc64/2006-January/003739.html
+ * test/ruby/test_io.rb (TestIO#test_pos_with_getc): updated.
+ see [ruby-core:43550]
-Tue Jan 17 11:32:46 2006 NAKAMURA Usaku <usa@ruby-lang.org>
+Sun Apr 15 03:00:54 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * win32/setup.mak (MAKE): workaround for nmake 8.
+ * test/ruby/test_io.rb (TestIO#test_pos_with_getc): added.
+ see [Bug #6179][ruby-core:43518]
-Tue Jan 17 11:10:21 2006 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Apr 11 16:22:16 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/{Makefile.sub,setup.mak}: invoke .bat via shell. workaround
- for nmake 8.
+ * ext/-test-/add_suffix/bug.c (ruby_add_suffix): no static
+ declaration. [ruby-core:44277][Bug #6279]
-Mon Jan 16 10:26:23 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Sun Apr 8 06:53:55 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/syck/emitter.c (syck_emit_seq, syck_emit_map, syck_emit_item):
- should output complex key mark even if map's key is empty seq/map.
- [ruby-core:7129]
+ * io.c (io_unread): cast as long the value for extra_max.
+ [ruby-core:44137] [Bug #6257]
-Sat Jan 14 05:37:06 2006 Tanaka Akira <akr@m17n.org>
+Sat Apr 7 10:28:40 2012 Aaron Patterson <aaron@tenderlovemaking.com>
- * io.c (READ_DATA_PENDING, READ_DATA_PENDING_COUNT): defined
- for DragonFly BSD 1.4.0.
+ * ext/psych/lib/psych.rb: bumping up psych version to match release.
+ * ext/psych/psych.gemspec: ditto
-Sat Jan 14 03:43:24 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Sat Apr 7 02:07:00 2012 Aaron Patterson <aaron@tenderlovemaking.com>
- * file.c (rb_file_s_chmod): avoid warning where sizeof(int) !=
- sizeof(void*).
+ * ext/psych/parser.c: fall back to any encoding if the external
+ encoding is wrong. [ruby-core:44163]
+ * test/psych/test_encoding.rb: fix test
-Fri Jan 13 19:14:56 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Wed Apr 4 18:29:15 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/rdoc/diagram.rb:
- - properly quote bare element attributes
- - terminates dangling elements (e.g. <img>, <br>, <link>, etc)
- - converts "CVS" to the more HTML-friendly acronym element
- - adds missing type attributes to style elements
+ * test/ruby/test_sleep.rb (TestSleep#test_sleep_5sec): syntax error.
- based on Paul Duncan's patch <pabs@pablotron.org> [ruby-core:7028]
+ * test/ruby/test_sleep.rb (TestSleep#test_sleep_5sec): call uname
+ only on linux because it's a workaround for linux only.
- * lib/rdoc/generators/html_generator.rb: ditto.
- * lib/rdoc/generators/template/html/hefss.rb: ditto.
- * lib/rdoc/generators/template/html/html.rb: ditto.
- * lib/rdoc/generators/template/html/kilmer.rb: ditto.
+Wed Apr 4 11:32:09 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Jan 12 11:53:08 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/-test-/add_suffix/bug.c: make all functions in util.c static
+ to get rid of multiple definitions. reported at
+ https://trac.macports.org/ticket/33814
- * ext/tk/sample/tkballoonhelp.rb: [bug fix] couldn't add to a widget
- which is constructed with TkComposite module.
- [new feature] support 'command' option which is called just before
- popping up the balloon help.
+Tue Apr 3 18:34:33 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jan 11 15:00:00 2006 Ville Mattila <mulperi@iki.fi>
+ * process.c (setreuid, setregid): suppress warnings.
+ [ruby-core:43374][Bug #6169]
- * io.c (READ_PENDING*): Support solaris 64-bit environments.
- Solaris defines a opaque FILE struct when compiling 64 bit
- binaries. This means that we dont have access to _ptr etc.
- members anymore. The solution by Steven Lumos is to define
- FILE64 that has needed members available. I've modified
- the origanal patch a bit so that it compiles both with gcc
- and now free sun studio 11 compiler and both amd64 and sparc.
- NOTE! We have to 64 bit solaris FILE structure time to time
- otherwise we'll get breakage.
- [ruby-core:7106]
+Sat Mar 31 12:11:21 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Tue Jan 10 19:42:33 2006 Tanaka Akira <akr@m17n.org>
+ * ext/openssl/ossl_x509cert.c: Fix doc typo.
- * gc.c (garbage_collect): mark ruby_current_node.
- if an exception is raised in a finalizer called written in C by
- rb_gc_call_finalizer_at_exit, ruby_set_current_source may use
- collected ruby_current_node and mark_source_filename may corrupt
- memory.
+Fri Mar 30 14:17:17 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Tue Jan 10 13:30:34 2006 akira yamada <akira@ruby-lang.org>
+ * ext/openssl/ossl_pkcs7.c: fix crash when parsing garbage data.
+ * test/openssl/test_pkcs7.rb: assert correct behavior for it.
+ Thanks to Matt Venables for reporting the issue.
+ [ruby-core:43250][Bug #6134]
- * ext/syck/rubyext.c (syck_resolver_transfer): should be able to load
- !ruby/object:Bignum syntax 1.8.3 dumped. [ruby-core:6159]
+Fri Mar 30 14:17:17 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Tue Jan 10 12:47:41 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * test/openssl/test_x509cert.rb: exclude test that fails when issuing
+ a certificate with RSA signature and DSS1 digest for earlier
+ OpenSSL versions when used in conjunction with OpenSSL 1.0.1.
+ Thanks, Vit Ondruch, for reporting the issue.
+ [ruby-core:42949][Bug #6089]
- * lib/yaml/rubytypes.rb (Fixnum): Bignum could not be loaded in
- ruby 1.8.3/1.8.4. [ruby-core:6115]
+Fri Mar 30 14:15:40 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/yaml/rubytypes.rb (Numeric): Subclass of Numeric could not
- be dumped properly. [ruby-core:7047]
+ * string.c (str_new_empty): should copy also the encoding as an
+ empty substring. [ruby-dev:45441][Bug #6206]
-Tue Jan 10 12:00:48 2006 Aaron Schrab <aaron @nospam@ schrab.com>
+Fri Mar 30 14:14:36 2012 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/yaml/rubytypes.rb (Symbol#yaml_new): YAML loading of quoted
- Symbols broken. [ruby-Bugs:2535]
+ * ext/date/date_core.c (datetime_s_now): [ruby-core:43256].
-Mon Jan 9 19:54:35 2006 arton <artonx@yahoo.co.jp>
+Fri Mar 30 14:12:53 2012 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * ext/zlib/extconf.rb: zlib compiled DLL version 1.2.3 distributed by
- http://www.zlib.net/ has zdll.lib. [ruby-dev:28209]
+ * numeric.c: fix flodivmod for cornercases [Bug #6044]
+ add ruby_float_mod
-Mon Jan 9 14:17:12 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * insns.def (opt_mod): use ruby_float_mod
- * win32/Makefile.sub (OPTFLAGS): I have experienced trouble on y- flag,
- (VisualC++6) so use -O2b2xg- if $(MSC_VER) < 1400. [ruby-core:7040]
+ * internal.h: declare ruby_float_mod
-Mon Jan 9 14:17:12 2006 Kero van Gelder <rubyforge @nospam@ kero.tmfweb.nl>
+ * test/ruby/test_float.rb: tests for above
- * lib/webrick/httpservlet/filehandler.rb: fixed typo. [ruby-core:7075]
+ * test/ruby/envutil.rb: create helper assert_is_minus_zero
-Sat Jan 7 15:40:07 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Mar 28 08:44:24 2012 Aaron Patterson <aaron@tenderlovemaking.com>
- * parse.y (singleton): get rid of segfault on syntax error.
- fixed: [ruby-core:07070]
+ * ext/psych/lib/psych.rb: updating version to match gem
+ * ext/psych/psych.gemspec: ditto
+ * ext/psych/lib/psych/visitors/to_ruby.rb: fixing deprecation warning
-Fri Jan 6 10:16:20 2006 Steven Lumos <steven@lumos.us>
+Mon Jul 18 13:36:47 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * io.c (READ_DATA_PENDING): defined for 64bit Solaris on SPARC.
- [ruby-core:7057]
- (READ_DATA_PENDING_COUNT): ditto.
- (READ_DATA_PENDING_PTR): ditto.
+ * ext/psych/lib/psych.rb: define a new BadAlias error class.
-Sun Jan 1 17:07:59 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * ext/psych/lib/psych/visitors/to_ruby.rb: raise an exception when
+ deserializing an alias that does not exist.
- * win32/win32.c (rb_w32_seekdir): should not segfault even if passed
- the location which rb_w32_telldir didn't return. [ruby-core:7035]
- (I think HEAD implementation is better. but binary compatibility)
+ * test/psych/test_merge_keys.rb: corresponding test.
- * test/ruby/test_dir.rb: added.
+Fri Mar 9 06:29:22 2012 Aaron Patterson <aaron@tenderlovemaking.com>
-Sat Dec 31 22:57:00 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/psych/lib/psych.rb (load, parse): stop parsing or loading after
+ the first document has been parsed.
- * eval.c (rb_thread_save_context): should not recycle scope object used
- in a thread. fixed: [ruby-dev:28177]
+ * test/psych/test_stream.rb: pertinent tests.
-Fri Dec 30 18:22:42 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Mar 9 06:17:05 2012 Aaron Patterson <aaron@tenderlovemaking.com>
- * gc.c (garbage_collect): mark objects refered from aborting threads.
- [ruby-dev:28190]
+ * ext/psych/lib/psych.rb (parse_stream, load_stream): if a block is
+ given, documents will be yielded to the block as they are parsed.
+ [ruby-core:42404] [Bug #5978]
- * win32/Makefile.sub: VC++8 support.
+ * ext/psych/lib/psych/handlers/document_stream.rb: add a handler that
+ yields documents as they are parsed
-Fri Dec 30 14:24:53 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+ * test/psych/test_stream.rb: corresponding tests.
- * dir.c (glob_helper): do not use TRUE for djgpp.
+Tue Mar 6 02:31:20 2012 Aaron Patterson <aaron@tenderlovemaking.com>
-Fri Dec 30 04:54:40 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/psych/lib/psych/core_ext.rb: only extend Kernel if IRB is loaded
+ in order to stop method pollution.
- * file.c (eaccess): workaround for VC++8 runtime.
+Tue Feb 28 10:28:51 2012 Aaron Patterson <aaron@tenderlovemaking.com>
- * win32/win32.c (ioinfo): VC++8 support.
+ * ext/psych/lib/psych.rb: default open YAML files with utf8 external
+ encoding. [ruby-core:42967]
+ * test/psych/test_tainted.rb: ditto
-Thu Dec 29 23:59:37 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Feb 24 13:54:33 2012 Aaron Patterson <aaron@tenderlovemaking.com>
- * eval.c (rb_gc_mark_threads): leave unmarked threads which won't wake
- up alone, and mark threads in the loading table. [ruby-dev:28154]
+ * ext/psych/parser.c: prevent a memory leak by protecting calls to
+ handler callbacks.
+ * test/psych/test_parser.rb: test to demonstrate leak.
- * eval.c (rb_gc_abort_threads), gc.c (gc_sweep): kill unmarked
- threads. [ruby-dev:28172]
+Fri Feb 24 08:08:38 2012 Aaron Patterson <aaron@tenderlovemaking.com>
-Thu Dec 29 17:02:07 2005 Tanaka Akira <akr@m17n.org>
+ * ext/psych/parser.c: set parser encoding based on the YAML input
+ rather than user configuration.
+ * test/psych/test_encoding.rb: corresponding tests.
+ * test/psych/test_parser.rb: ditto
+ * test/psych/test_tainted.rb: ditto
- * test/ruby/envutil.rb (EnvUtil.rubybin): search "ruby" instead of
- "miniruby". [ruby-dev:28140]
+Fri Feb 10 03:41:31 2012 Aaron Patterson <aaron@tenderlovemaking.com>
-Tue Dec 27 16:59:52 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/psych/parser.c: removed external encoding setter, allow parser
+ to be reused.
+ * ext/psych/lib/psych/parser.rb: added external encoding setter.
+ * test/psych/test_parser.rb: test parser reuse
- * test/drb/drbtest.rb (DRbService::self.ext_service): increase
- timeout limit. a patch from Kazuhiro NISHIYAMA
- <zn at mbf.nifty.com>. [ruby-dev:28132]
+Wed Jan 18 12:49:15 2012 Aaron Patterson <aaron@tenderlovemaking.com>
-Tue Dec 27 08:29:18 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/psych/lib/psych/visitors/to_ruby.rb: Added support for loading
+ subclasses of String with ivars
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: Added support for dumping
+ subclasses of String with ivars
+ * test/psych/test_string.rb: corresponding tests
- * ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLSocket#post_connection_chech):
- treat wildcard character in commonName. [ruby-dev:28121]
+Wed Jan 18 10:39:47 2012 Aaron Patterson <aaron@tenderlovemaking.com>
-Mon Dec 26 22:32:47 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/psych/lib/psych/visitors/to_ruby.rb: Added ability to load array
+ subclasses with ivars.
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: Added ability to dump
+ array subclasses with ivars.
+ * test/psych/test_array.rb: corresponding tests
- * eval.c (rb_eval), gc.c (gc_mark_children), node.h (NEW_ALIAS,
- NEW_VALIAS), parse.y (fitem): allow dynamic symbols to
- NODE_UNDEF and NODE_ALIAS.
- backported from trunk. fixed: [ruby-dev:28105]
+Wed Dec 21 02:25:36 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Mon Dec 26 08:50:36 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/psych/emitter.c: fixing clang warnings. Thanks Joey!
- * eval.c (ev_const_get): fixed a bug in constant reference during
- instance_eval. [yarv-dev:707]
+Sun Dec 18 12:42:48 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * eval.c (ev_const_defined): ditto.
+ * ext/psych/lib/psych/visitors/to_ruby.rb: BigDecimals can be restored
+ from YAML.
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: BigDecimals can be dumped
+ to YAML.
+ * test/psych/test_numeric.rb: tests for BigDecimal serialization
- * lib/yaml.rb (YAML::add_domain_type): typo fixed. a patch from
- Joel VanderWerf <vjoel at path.berkeley.edu>.
- [ruby-talk:165285] [ruby-core:6995]
+Sun Dec 18 12:03:13 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Sat Dec 24 18:58:14 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/psych/lib/psych/scalar_scanner.rb: Strings that look like dates
+ should be treated as strings and not dates.
- * stable version 1.8.4 released.
+ * test/psych/test_scalar_scanner.rb: corresponding tests.
-Fri Dec 23 10:30:23 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Dec 7 08:04:31 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/digest/sha2/sha2.c (ULL): support AIX C. a patch from
- Kailden <kailden at gmail.com>. [ruby-core:06984]
+ * ext/psych/lib/psych.rb (module Psych): parse and load methods take
+ an optional file name that is used when raising Psych::SyntaxError
+ exceptions
+ * ext/psych/lib/psych/syntax_error.rb (module Psych): allow nil file
+ names and handle nil file names in the exception message
+ * test/psych/test_exception.rb (module Psych): Tests for changes.
-Wed Dec 21 16:53:06 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Wed Nov 30 09:09:37 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * file.c (w32_io_info): should return handle because FileIndex is
- valid only while file is open. [ruby-dev:28088]
+ * ext/psych/parser.c (parse): parse method can take an option file
+ name for use in exception messages.
+ * test/psych/test_parser.rb: corresponding tests.
-Wed Dec 21 14:53:26 2005 Tanaka Akira <akr@m17n.org>
+Tue Nov 22 04:46:22 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/pathname.rb (test_kernel_open): use File.identical?.
- [ruby-talk:171804]
+ * ext/psych/lib/psych.rb: remove autoload from psych
+ * ext/psych/lib/psych/json.rb: ditto
-Tue Dec 20 22:41:17 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Nov 9 04:52:16 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * eval.c (eval_under_i): evaluate source in caller's frame.
- [ruby-dev:28076]
+ * ext/psych/lib/psych/tree_builder.rb: dump complex numbers,
+ rationals, etc with reference ids.
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: ditto
+ * ext/psych/lib/psych/visitors/to_ruby.rb: loading complex numbers,
+ rationals, etc with reference ids.
+ * test/psych/test_object_references.rb: corresponding tests
- * eval.c (rb_call_super): use original method name on exception.
- [ruby-dev:28078]
+Mon Nov 7 20:31:52 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Tue Dec 20 13:11:59 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * ext/psych/lib/psych/scalar_scanner.rb: make sure strings that look
+ like base 60 numbers are serialized as quoted strings.
+ * test/psych/test_string.rb: test for change.
- * ext/syck/rubyext.c: fixed GC problem (backported HEAD 1.55 - 1.62)
- [ruby-dev:27839]
+Thu Oct 27 08:47:38 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/syck/syck.h (S_FREE): small hack. no need to check if pointer is
- NULL or not before S_FREE.
+ * ext/psych/parser.c: remove unused variable.
- * st.c: uses malloc instead of xmalloc to avoid GC. syck uses st_insert
- in gram.c to insert node from rb_syck_bad_anchor_handler into
- SyckParser's hash table. if GC occurs in st_insert, it's not under
- SyckParser's mark system yet. so RString can be released wrongly.
- [ruby-dev:28057]
+Wed Oct 5 02:50:27 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Tue Dec 20 12:53:23 2005 why the lucky stiff <why@ruby-lang.org>
+ * ext/psych/lib/psych/syntax_error.rb: Add file, line, offset, and
+ message attributes during parse failure.
+ * ext/psych/parser.c: Update parser to raise exception with correct
+ values.
+ * test/psych/test_exception.rb: corresponding tests.
- * ext/syck/rubyext.c (syck_emitter_reset): to ensure compatibility
- with previous Ruby versions, documents are no longer headless.
+Wed Oct 5 01:52:16 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Tue Dec 20 01:46:48 2005 Tanaka Akira <akr@m17n.org>
+ * ext/psych/parser.c (parse): Use context_mark for indicating error
+ line and column.
- * io.c (rb_f_backquote): fix a GC problem on
- IA64 with gcc 4.0.3 20051216 (prerelease) -O3.
+Wed Oct 5 01:22:08 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Mon Dec 19 23:32:39 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/psych/lib/psych/scalar_scanner.rb: use normal begin / rescue
+ since postfix rescue cannot receive the exception class. Thanks
+ nagachika!
- * parse.y (rb_symname_p): fixed wrong validation. [ruby-dev:28047]
+Tue Mar 27 22:22:50 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Dec 17 03:57:01 2005 Tanaka Akira <akr@m17n.org>
+ * configure.in (RUBY_STACK_GROW_DIRECTION): substitute CPU name as
+ shell variable name. based on the patch by The Written Word Inc. at
+ [ruby-core:40421]. [Bug #5488]
- * bignum.c (rb_big_rshift): fix a GC problem on
- IA64 with gcc 4.0.3 20051216 (prerelease).
+Mon Mar 26 09:57:12 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Sat Dec 17 03:30:23 2005 Tanaka Akira <akr@m17n.org>
+ * parse.y (parser_nextc): set encoding for the buffer of ripper.
- * eval.c (bmcall): fix a GC problem by tail call on
- IA64 with gcc 4.0.3 20051216 (prerelease).
+Sun Mar 18 13:23:28 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Dec 16 00:54:06 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * encoding.c (rb_enc_compatible): return ASCII-8BIT even if 2nd string
+ is ascii only string. [ruby-core:42354] [Bug #5968]
- * signal.c (Init_signal): revert C++ style comment.
- [ruby-dev:28041]
+Tue Mar 6 18:55:37 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Dec 15 12:35:14 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/test/unit/assertions.rb (assert_send, assert_not_send):
+ parenthesize non-empty arguments.
- * lib/tmpdir.rb: merged RDoc patch from Eric Hodel <drbrain at
- segment7.net>. [ruby-core:06894]
+Tue Mar 6 18:55:37 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Dec 15 01:33:31 2005 Tanaka Akira <akr@m17n.org>
+ * lib/test/unit/assertions.rb (assert_send): make arguments in
+ the default message clearer.
- * ext/zlib/zlib.c (zstream_run): fix a GC problem by tail call on
- x86_64 with gcc 4.0.3 20051111 (prerelease) (Debian 4.0.2-4)
+Tue Mar 6 12:48:08 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Dec 14 12:11:46 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+ * ext/io/console/console.c (set_rawmode): clear ECHOE and ECHOK
+ bits too.
- * test/gdbm/test_gdbm.rb: specify pid for the argument of
- Process.wait. workaround for Cygwin.
+ * ext/io/console/console.c (echo_p): ignore ECHOE and ECHOK bits.
+ [ruby-dev:45309] [Bug #6116]
-Wed Dec 14 12:01:26 2005 Tanaka Akira <akr@m17n.org>
+ * ext/io/console/console.c (console_raw): fix rdoc.
- * marshal.c (r_object0): fix a GC problem for reading a bignum on
- IA64 with gcc 3.3.5 (Debian 1:3.3.5-13).
+ * ext/io/console/console.c (console_set_echo): mentioned about
+ platform dependency.
-Tue Dec 13 12:23:47 2005 Tanaka Akira <akr@m17n.org>
+Tue Mar 6 12:40:08 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * re.c (rb_reg_regcomp): fix a GC problem on x86_64 with
- gcc 3.3.5 (Debian 1:3.3.5-13).
+ * ext/io/console/console.c (console_raw, console_set_raw)
+ (console_getch): optional parameters. [EXPERIMENTAL]
-Tue Dec 13 01:44:16 2005 Tanaka Akira <akr@m17n.org>
+Tue Mar 6 12:39:27 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * array.c (rb_ary_diff): fix a GC problem on IA64 with
- gcc 3.3.5 (Debian 1:3.3.5-13).
- When rb_ary_push is called, there was no register which contains
- `hash' but `&RHASH(hash)->tbl' instead.
+ * ext/io/console/console.c (console_cooked, console_set_cooked):
+ new methods to reset cooked mode. [EXPERIMENTAL]
-Tue Dec 13 00:08:09 2005 Tanaka Akira <akr@m17n.org>
+Tue Mar 6 12:31:47 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * sprintf.c (rb_str_format): fix a GC problem.
- [ruby-dev:28001]
+ * ext/io/console/console.c (io_getch): default delegating method
+ for StringIO. https://github.com/nobu/io-console/issues/4
-Mon Dec 12 15:54:56 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/stringio/stringio.c: moved some methods to hidden modules.
- * test/openssl/test_ssl.rb (test_parallel): call GC.start to close
- unused files. [ruby-dev:27981]
+Tue Mar 6 12:29:34 2012 Eric Hodel <drbrain@segment7.net>
-Mon Dec 12 00:33:56 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * io.c (Init_IO): Mention io/console methods. [Ruby 1.9 - Bug #5602]
+ * ext/io/console/console.c: Mention that io/console must be required
+ similar to lib/time.rb
- * ext/digest/digest.c (rb_digest_base_s_digest): add volatile to
- protect temporary context object. [ruby-dev:27979]
+Tue Mar 6 11:42:52 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/iconv/iconv.c (Init_iconv): rb_gc_register_address() should
- be called before actual variable initialization.
- [ruby-dev:27986]
+ * ext/syck/lib/syck/rubytypes.rb (Exception.yaml_new): fix bug
+ that causes YAML serialization problem for Exception.
+ Exception#initialize doesn't use visible instance variable for
+ the exception message, so call the method with the message.
+ patched by Jingwen Owen Ou <jingweno AT gmail.com>.
+ http://github.com/ruby/ruby/pull/41
-Fri Dec 9 23:31:02 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Mar 2 22:09:03 2012 Hiroshi Nakamura <nahi@ruby-lang.org>
- * lib/rexml/encoding.rb (encoding=): give priority to particular
- conversion to iconv. [ruby-core:06520]
+ * .travis.yml: Backport TravisCI configuration from trunk.
-Thu Dec 8 02:07:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Mar 1 18:39:44 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (umethod_bind): adjust invoking class for module method.
- [ruby-dev:27964]
+ * file.c (rb_file_join): honor input encodings than ASCII-8BIT.
+ [ruby-core:40338] [Bug #5483]
-Thu Dec 8 00:40:52 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Feb 28 11:56:52 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (call_trace_func): klass parameter should be a
- class/module that defines calling method. [ruby-talk:169307]
+ * configure.in (debugflags): check if -ggdb is accepted.
+ [ruby-core:42875][Bug #6080]
-Wed Dec 7 17:10:27 2005 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Mon Feb 27 17:25:40 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * sprintf.c (rb_f_sprintf): [ruby-dev:27967]
+ * ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): since methods
+ can be overridden, so should not make an assumption on the type
+ of results. [ruby-core:42969][Bug #6093]
-Wed Dec 7 15:31:35 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon Feb 27 02:28:17 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * sprintf.c (rb_str_format): integer overflow check added.
+ * regparse.c (add_code_range_to_buf0): wrong condition of duplicated
+ warnings.
- * sprintf.c (GETASTER): ditto.
+Sun Feb 26 12:26:26 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Dec 7 01:02:04 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * compile.c (iseq_compile_each): call on special object instead of
+ self. since stabby lambda is a syntax, so it should not be
+ affected by the context. [ruby-core:42349][Bug #5966]
- * ext/tk/README.macosx-aqua: [new document] tips to avoid the known
- bug on platform specific dialogs of Tcl/Tk Aqua on MacOS X.
+ * insns.def (send): no special deal for FCALL. self should be put
+ on TOS instead.
- * ext/tk/tcltklib.c: fix bug on switching threads and waiting on the
- deleted interpreter on vwait and tkwait command.
+Sat Feb 25 23:47:49 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/multi-tk.rb: kill the meaningless loop for the deleted Tk
- interpreter.
+ * file.c (utime_internal): fix a variable missed to replace.
+ [ruby-core:42864] [Bug #6077]
- * ext/tk/sample/demos-jp/image3.rb: [bug fix] wrong argument.
+Sat Feb 25 21:29:09 2012 URABE Shyouhei <shyouhei@ruby-lang.org>
- * ext/tk/sample/demos-en/image3.rb: ditto.
+ * test/ruby/test_literal.rb (TestRubyLiteral#test_special_const):
+ test for https://bugs.php.net/bug.php?id=61095
- * ext/tk/sample/demos-jp/menu.rb: fix message for MacOS X.
+Sat Feb 25 21:29:09 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/sample/demos-jp/menu8x.rb: ditto.
+ * dir.c, file.c, io.c (rb_sys_fail_path): use rb_sys_fail_str.
- * ext/tk/sample/demos-en/menu.rb: ditto.
+ * error.c: new functions to deal exceptions with string instances.
-Tue Dec 6 16:37:57 2005 Yuya Nishida <yuya@j96.org>
+ * dir.c, file.c, io.c: use rb_sys_fail_path.
- * eval.c (exec_under): avoid accessing ruby_frame->prev.
- [ruby-dev:27948]
+Sat Feb 25 21:18:12 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Dec 1 00:50:33 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * dir.c (dir_inspect), io.c (rb_io_inspect): keep encoding of path.
+ [Bug #6072]
- * eval.c (rb_funcall2): allow to call protected methods.
- fixed: [ruby-dev:27890]
+Sat Feb 25 21:18:12 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Nov 30 23:52:17 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * dir.c (dir_initialize): keep path in original encoding.
- * parse.y (NEWHEAP, ADD2HEAP): set count after pointer was set.
- fixed: [ruby-dev:27896]
+ * error.c (syserr_initialize): prefer the encoding of message over
+ locale. [ruby-dev:45279][Bug #6071]
-Wed Nov 30 13:43:07 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat Feb 25 17:10:51 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * misc/ruby-mode.el (ruby-expr-beg): support $! at the end of
- expression. [ruby-dev:27868]
+ * lib/fileutils.rb: use chomp(?/) instead of sub to optimize and avoid
+ to regexping invalid string.
-Mon Nov 28 18:55:43 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Feb 25 16:39:13 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/socket/socket.c (init_inetsock_internal): remove setting
- SO_REUSEADDR option on server socket on Cygwin.
- fixed: [ruby-core:6765] ([ ruby-Bugs-2872 ])
+ * complex.c (nucomp_marshal_load): raise error on invalid data.
+ reported by John Firebaugh [ruby-core:42860] [Bug #6076]
-Mon Nov 28 13:08:54 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Fri Feb 24 23:49:05 2012 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * win32/win32.c (rb_w32_strerror): remove all CR and LF. (avoid broken
- error message on bccwin32 + winsock)
+ * lib/ostruct.rb (delete_field): Bug fix so previous value is
+ returned. Patch by Nick Recobra [Bug #6063]
-Mon Nov 28 09:21:49 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Fri Feb 24 08:53:28 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/mkmf.rb (create_makefile): should not change sodir with
- dir.gsub!. (bccwin32 failed to install third party exntesions)
- [ruby-dev:27834]
+ * parse.y (parser_tokadd_string, parser_yylex): insert a backslash
+ if the next character is non-ascii. [ruby-dev:45278] [Bug #6069]
-Sun Nov 27 00:56:13 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Thu Feb 23 14:44:36 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/wsdl/xmlSchema/complexContent.rb: missing
- ComplexContent#elementformdefault method.
+ * lib/uri/common.rb (URI::Parser#initialize_regexp):
+ use \A \z instead of ^ $. [Bug #5843]
-Sat Nov 26 19:57:45 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+Thu Feb 23 08:08:23 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * dln.c (conv_to_posix_path): should initialize posix.
+ * win32/win32.c (rb_w32_uchmod): typo. [Bug#5671] [ruby-dev:44898]
-Thu Nov 24 21:05:58 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/ruby/test_file.rb (TestFile#test_chmod_m17n): test of above bug.
- * configure.in (AC_CHECK_FUNCS): need to check link().
- fixed: [ruby-dev:27814]
+Wed Feb 22 23:27:52 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Nov 24 01:22:25 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * test/iconv/test_option.rb: enabled. [ruby-core:42802][Bug #6061]
- * file.c (w32_io_info): CreateFile failed on Win9x if file was already
- opened. (FILE_SHARE_READ was needed, but actually I don't understand
- the flags of CreateFile well...)
+Wed Feb 22 22:04:15 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Nov 23 20:59:01 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * io.c (rb_io_s_foreach): argument check before making Enumerator.
+ [ruby-dev:31525]
- * ext/tk/lib/tk.rb: add Tk.pkgconfig_list and Tk.pkgconfig_get
- [Tk8.5 feature].
+Wed Feb 22 22:04:15 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/tk/text.rb: supports new indices modifires on a Text
- widget [Tk8.5 feature].
+ * io.c (rb_io_s_foreach): return enumerator including kerword
+ arguments. [ruby-dev:45267][Bug #6054]
- * ext/tk/lib/tk/virtevent.rb: add TkNamedVirtualEvent.
+Wed Feb 22 21:42:16 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/tk/autoload.rb: ditto.
+ * configure.in: remove workaround replacement from gcc to gcc-4.2.
+ [Backport #6043]
- * ext/tk/lib/tk/event.rb: add :data key for virtual events [Tk8.5
- feature].
+Wed Feb 22 08:11:06 2012 Narihiro Nakamura <authornari@gmail.com>
-Wed Nov 23 18:55:31 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * gc.c : remove gc_clear_mark_on_sweep_slots() and use
+ rest_sweep() instead of it, because some dead objects might be
+ marked in next the mark phase by false pointers.
+ [ruby-core:42672]
- * file.c (w32_io_info): should not call GetFileInformationByHandle
- for pipe.
+Sun Feb 19 12:27:24 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * file.c (w32_io_info): checks return value from rb_w32_get_osfhandle.
+ * configure.in: ignore all warnings from an arbitrary
+ header in /usr/local/include.
- * file.c (w32_io_info): now can identify directory on WinNT.
+Fri Feb 17 12:51:25 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Nov 23 03:40:49 2005 Guy Decoux <ts@moulon.inra.fr>
+ * lib/mkmf.rb (create_header): log the content of header.
- * re.c (KR_REHASH): should cast to unsigned for 64bit CPU.
- [ruby-core:06721]
+Fri Feb 17 12:26:15 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Wed Nov 23 11:01:33 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * test/readline/test_readline.rb (test_completion_proc_empty_result):
+ ensure clearance of Readline's line_buffer after the test.
- * intern.h, file.c: failed to compile on windows.
+Fri Feb 17 11:46:39 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Nov 23 07:26:44 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * test/readline/test_readline.rb (test_line_buffer__point): use
+ lambda not to exit entire method by "return". or "next" for
+ proc. [ruby-dev:45042] [Bug #5802]
- * ext/openssl/extconf.rb: check for X509V3_EXT_nconf_nid.
+Fri Feb 17 10:15:54 2012 Tanaka Akira <akr@fsij.org>
- * ext/openssl/ossl_x509ext.c (MakeX509ExtFactory): should use
- OPENSSL_malloc to allocate X509V3_CTX.
+ * ext/dbm/extconf.rb: check _DB_H_ macro unavailable except
+ Berkeley DB library.
- * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext): use
- X509V3_EXT_nconf_nid to avoid SEGV (and to build extensions which
- values are placed in separate section).
+Fri Feb 17 10:14:47 2012 Tanaka Akira <akr@fsij.org>
- * test/openssl/test_x509ext.rb: new file.
+ * test/dbm/test_dbm.rb: fix skip condition for libgdbm 1.8.0 or prior.
+ reported by Bohuslav Kabrda.
+ [ruby-core:42685] [ruby-trunk - Bug #6036]
-Wed Nov 23 01:22:57 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Feb 17 09:53:46 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * file.c (test_identical): test if two files are identical.
+ * tool/transcode-tblgen.rb (import_ucm): don't use \h because the
+ script should work with ruby 1.8.
- * file.c (rb_f_test): support DOSISH systems where st_ino is not
- reliable. fixed: [ruby-core:06672]
+ * tool/enc-unicode.rb: ditto.
- * win32.h, win32.c (rb_w32_osid): check the running platform.
+Thu Feb 16 17:54:14 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Nov 22 23:52:06 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/dbm/extconf.rb: merge trunk's ext/dbm/extconf.rb and
+ related functions of lib/mkmf.rb. [Backport #6021]
- * lib/optparse.rb: match incomplete (in current enconding) multibyte
- string. http://inamode6.tokuhirom.dnsalias.org/show/1551
+Thu Feb 16 09:25:52 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Nov 22 18:36:11 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * configure.in (enable_pthread): use -pthread on OpenBSD without
+ explicit option. patched by Jeremy Evans. [ruby-core:38572]
- * win32/win32.c (winnt_stat): set mapped errno instead of ENOENT.
+Thu Feb 16 07:34:34 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Tue Nov 22 14:46:57 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * cont.c (rb_fiber_reset_root_local_storage): add a new function to
+ restore rb_thread_t::local_storage.
- * file.c (rb_file_s_basename): skip slashes just after UNC top slashes.
+ * cont.c (rb_obj_is_fiber): add a new function to tell finalizer to
+ prevent fibers from destroy.
- * test/ruby/test_path.rb (test_dirname, test_basename): follow new
- spec. and add new tests.
+ * gc.c (rb_objspace_call_finalizer): don't sweep fibers at finalizing
+ objspace.
-Tue Nov 22 13:18:32 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * internal.h (rb_fiber_reset_root_local_storage, rb_obj_is_fiber):
+ add prototypes.
- * win32/win32.c (rb_w32_stat): Dir.chdir('//server/shared');
- p Dir.glob('*') should work on WinNT. (implemented our own
- stat(2) on WinNT) [ruby-list:41552] [ruby-dev:27711]
+ * vm.c (ruby_vm_destruct): reset main thread's local_storage before
+ free main thread. rb_thread_t::local_storage is replaced by fiber's
+ local storage when forked from fiber, and it should be already freed
+ when the fiber was destroyed. [ruby-core:41456] [Bug #5700]
-Tue Nov 22 02:31:53 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/ruby/test_fiber.rb (test_fork_from_fiber): add test for fork
+ from fiber.
- * ext/tk/lib/tkextlib/tile.rb: bug fix (Tk::Tile::USE_TTK_NAMESPACE
- is not defined).
+Thu Feb 16 06:30:37 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Nov 22 01:45:21 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/fiddle/closure.c (callback): deal with unsinged integers.
+ [ruby-core:42458][Bug #5991][Bug #6022]
- * file.c (rb_file_s_basename): DOSISH_UNC is defined on cygwin but
- DOSISH is not. fixed: [ruby-dev:27797]
+ * ext/fiddle/conversions.c (value_to_generic, generic_to_value):
+ ditto.
-Mon Nov 21 22:50:48 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/fiddle/closure.c (callback): same as r34506.
- * file.c (rb_path_skip_prefix, rb_file_s_basename): UNC without path
- should not be splitted. fixed: [ruby-dev:27776] [ruby-dev:27786]
+Wed Feb 15 10:35:43 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * parse.y (dsym): prohibit empty symbol literal by interpolation.
- fixed: [ruby-talk:166529]
+ * include/ruby/ruby.h (FIXNUM_P): simple flag should be int.
-Mon Nov 21 16:03:48 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Feb 15 10:33:41 2012 Eric Hodel <drbrain@segment7.net>
- * win32/setup.mk: findstr doesn't exist on win9x.
- fixed: [ruby-dev:27756]
+ * vm_eval.c (check_funcall): Call respond_to? with matching arity for
+ legacy single-argument implementations. [ruby-trunk - Bug #6000]
-Sun Nov 20 22:34:06 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Feb 15 10:25:22 2012 Naohisa Goto <ngotogenome@gmail.com>
- * parse.y (rb_symname_p): [ not followed by ] is not valid symbol.
- fixed: [ruby-talk:166520]
+ * vm_eval.c (check_funcall): set array elements one-by-one to fix
+ compile error with Fujitsu C Compiler 5.6 on Solaris 10 on Sparc.
-Sat Nov 19 19:57:54 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Feb 15 10:25:22 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/fileutils.rb (FileUtils::ln): ln documentation fix.
- [ruby-core:06661]
+ * test/ruby/test_object.rb: tests that respond_to? returns false.
-Sat Nov 19 07:34:32 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Wed Feb 15 10:25:22 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/tk/font.rb: remove dependency on Ruby's version (1.8
- or 1.9).
+ * vm_eval.c (check_funcall): try respond_to? first if redefined.
+ [Bug #5158]
- * ext/tk/lib/tkextlib/ICONS/icons.rb: ditto.
+Wed Feb 15 07:15:50 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/sample/tkextlib/treectrl/demo.rb: ditto.
+ * compile.c (defined_expr): guard the whole expression.
+ [ruby-dev:45021][Bug#5786]
-Fri Nov 18 17:57:08 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Feb 15 05:08:25 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * file.c (rb_file_s_dirname): should use skipprefix for UNC path.
- pointed out by nobu ([ruby-dev:27744]). fixed: [ruby-core:5076]
+ * ext/dl/cptr.c (rb_dlptr_s_to_ptr): use rb_check_funcall.
-Fri Nov 18 17:35:09 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/dl/cfunc.c (dlcfunc_mark), ext/dl/cptr.c (dlptr_mark):
+ workaround to mark wrapped object. this is not a true fix,
+ because [Bug #4929] is caused by the interface design of DL.
- * ext/tk/lib/multi-tk.rb: add restriction to access the entried
- command table and manipulate other IPs (for reason of security).
- Now, a IP object can be controlled by only its master IP or the
- default IP.
+Wed Feb 15 05:04:47 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/remote-tk.rb: add restriction to manipulate.
+ * ext/dl/cptr.c (rb_dlptr_aref, rb_dlptr_aset): check NULL pointer
+ dereference.
- * ext/tk/tcltklib.c (ip_is_slave_of_p): add TclTkIp#slave_of?(ip)
- to check manipulability.
+ * test/rinda/test_rinda.rb: decrease the code that depends on timing.
+ [Bug #372] [Bug #4160]
- * ext/tk/lib/tk.rb: bug fix on handling of Tcl's namespaces.
+Wed Feb 15 05:03:41 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * ext/tk/lib/tk/namespace.rb: ditto.
+ * test/rinda/test_rinda.rb (test_remote_array_and_hash):
+ add local variables to protect objects from GC. [ruby-dev:44253]
+ [Bug #5104]
-Fri Nov 18 17:26:06 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Feb 15 05:02:43 2012 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * file.c (rb_file_s_dirname): added checks for some patterns with drive
- letter. fixed: [ruby-dev:27738]
+ * test/win32ole/test_err_in_callback.rb (test_err_in_callback):
+ skip test if ADODB.connection is not available.
- * test/ruby/test_path.rb (test_dirname): added tests for above
- patterns.
+Wed Feb 15 04:49:23 2012 Yusuke Endoh <mame@tsg.ne.jp>
-Fri Nov 18 12:18:02 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * parse.y (debug_lines, coverage): set file path encoding for coverage
+ result. [ruby-dev:44950]
- * win32/win32.h (S_IFIFO): r,w = IO.pipe; r.stat.pipe? now
- returns true on VisualC++6.
+Tue Feb 14 16:57:11 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Nov 16 23:24:17 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rake/file_list.rb (Rake::FileList#egrep): there is no need to
+ open files in binary mode.
+ see more details in https://github.com/jimweirich/rake/issues/74
- * common.mk (static-ruby): overridable.
+Tue Feb 14 16:52:17 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/extmk.rb (parse_args): force to link extensions statically only
- if static is given for extstatic.
+ * lib/rdoc/encoding.rb (RDoc::Encoding.read_file): fixup newline chars
+ on Windows.
+ see https://github.com/rdoc/rdoc/issues/87
- * ext/extmk.rb (RUBY, RUBYW): overridable.
+ * test/rdoc/test_rdoc_markup_pre_process.rb
+ (TestRDocMarkupPreProcess#test_include_file,
+ TestRDocMarkupPreProcess#test_include_file_encoding_incompatible):
+ follow above change.
-Tue Nov 15 23:46:35 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Feb 14 16:34:11 2012 Shota Fukumori <sorah@tubusu.net>
- * lib/find.rb (Find::find): should not ignore symbolic links to
- non-existing files. [ruby-talk:165866]
+ * test/rubygems/test_gem_commands_help_command.rb: Add one
+ `require` because if run test-all with test/unit parallel
+ running, sometimes this test fails by some constants not found.
+ The error reason is some worker doesn't require the file needed by
+ this test. This issue is related to [ruby-core:36168].
-Tue Nov 15 16:23:26 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Tue Feb 14 15:58:31 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * array.c (rb_ary_fill): previous commit disabled this usage:
+ * gc.c (initial_params): pack in a struct.
- a = [0,1,2,3,4,5,6,7,8,9]
- a.fill {|i| a[i] * 10} #=> [nil, nil, ...., nil]
+ * gc.c (rb_gc_set_params): set parameters always.
+ [ruby-dev:44648] [Bug #5467]
- previous commit has the advantage of early garbage collection, but
- potensially this would break some script. so I reverted behavior.
+Tue Feb 14 15:44:42 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Nov 15 16:04:10 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * test/irb/test_completion.rb: skip if cannot load irb/completion
+ (maybe readline does not exist).
- * array.c (rb_ary_fill): tail elements were vanished when the middle
- part of array was filled. (ie: [0,1,2,3,4].fill(-1,2,1) => [0,1,-1])
+Tue Feb 14 15:07:23 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_array.rb (test_fill): added.
+ * lib/test/unit/assertions.rb (build_message): skip escaped
+ question marks.
-Tue Nov 15 14:39:16 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon Feb 13 12:06:29 2012 Loren Segal <lsegal@soen.ca>
- * array.c (rb_ary_fill): should adjust array length correctly when
- an array is expanded in the fill process. [ruby-core:06625]
+ * io.c (Init_IO): use directive hack to make ARGF documentable
+ in other tools. [ruby-core:42515][Bug #6007]
-Mon Nov 14 23:49:57 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Feb 12 16:57:56 2012 Akinori MUSHA <knu@iDaemons.org>
- * file.c (rb_file_s_readlink): ERANGE will occur only on GPFS.
- [ruby-dev:27699]
+ * misc/rdoc-mode.el (rdoc-imenu-create-index): Add imenu support
+ to rdoc-mode.
-Mon Nov 14 17:36:22 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * misc/rdoc-mode.el (rdoc-mode): Fix regexp patterns containing
+ "\s " where CR/LF is not supposed to match.
- * array.c (rb_ary_first): RDoc update from Daniel Berger
- <djberg96@yahoo.com>. [ruby-core:06577].
+Sun Feb 12 16:56:23 2012 Akinori MUSHA <knu@iDaemons.org>
-Fri Nov 11 10:31:44 2005 Zach Dennis <zdennis@mktec.com>
+ * misc/rdoc-mode.el (rdoc-mode): Add provide so that requiring
+ this library succeeds.
- * ext/socket/socket.c: Socket Documentation. [ruby-core:6552]
+Sun Feb 12 16:53:18 2012 Akinori MUSHA <knu@iDaemons.org>
-Fri Nov 11 08:20:56 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/tempfile.rb (Tempfile#unlink, Tempfile::Remover#call): Just
+ call File.unlink and ignore ENOENT because existence check
+ before unlinking does not help in terms of race condition.
- * Makefile.in (OUTFLAG): keep trailing spaces. [ruby-dev:27666]
+ * lib/tempfile.rb (Tempfile#unlink, Tempfile::Remover#call): My
+ comment about thread safeness is obsolete.
- * mkconfig.rb: substitution refereces added.
+Sun Feb 12 16:50:28 2012 Akinori MUSHA <knu@iDaemons.org>
-Fri Nov 11 07:44:18 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * lib/shellwords.rb: Fix rdoc markups.
- * configure.in: undef HAVE_LINK on BeOS. (link(2) always returns
- EINVAL, and this causes error in test/fileutils.)
+Sun Feb 12 16:50:28 2012 Akinori MUSHA <knu@iDaemons.org>
- * file.c: overwride chown(2) and fchown(2) on BeOS. (these functions
- should not change user/group id if -1 is passed as corresponding
- argument, and this causes error in test/fileutils too)
- [ruby-dev:27672]
+ * lib/shellwords.rb (Shellwords#shellsplit): Fix a bug where
+ consecutive backslashes in double quotes are all removed except
+ the one at the tail.
- * file.c (rb_file_s_link): checks HAVE_LINK.
+Sun Feb 12 16:38:13 2012 Akinori MUSHA <knu@iDaemons.org>
-Tue Nov 8 15:32:27 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * lib/shellwords.rb (Shellwords#shellescape): Drop the //n flag
+ that only causes warnings with no real effect. [Bug #5637]
- * lib/drb/ssl.rb (DRb::SSLConfig#accept): fixed typo.
- [ruby-dev:27560] [ruby-core:4627]
+Sun Feb 12 16:34:55 2012 Akinori MUSHA <knu@iDaemons.org>
-Mon Nov 7 13:43:51 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * tool/merger.rb (#default_merge_branch): Add support for
+ Subversion 1.7 which adopted a whole new working directory
+ structure.
- * ext/tk/stubs.c (_nativethread_consistency_check): use simpler
- (low cost) way to check whether the Tcl interpreter was compiled
- with threads enabled of not.
+Sun Feb 12 09:38:46 2012 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/tk/tcltklib.c: reduce warnings.
+ * vm_method.c (rb_add_method): should not call method_added hook
+ for undef operation. [Bug #5015]
- * ext/tk/tkutil/tkutil.c: ditto.
+Sun Feb 12 09:29:28 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Nov 7 00:06:58 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * regint.h (PLATFORM_UNALIGNED_WORD_ACCESS): Power PC does not
+ allow unaligned word access.
- * lib/yaml.rb: removed :nodoc: to generate Kernel doc. [ruby-core:6324]
+ * st.c (UNALIGNED_WORD_ACCESS): x86_64 allows unaligned word
+ access as well as i386.
-Sun Nov 6 23:39:13 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Feb 11 08:06:12 2012 Tanaka Akira <akr@fsij.org>
- * ext/iconv/iconv.c (Iconv::BrokenLibrary): exception when detected a
- bug of underlying library.
+ * test/openssl/test_ssl.rb (test_multibyte_read_write): start server
+ for each length to avoid race condition.
-Sun Nov 6 21:46:59 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Sat Feb 11 06:13:07 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/stubs.c (ruby_tcl_create_ip_and_stubs_init): should touch
- interpreter after initialization is done. [ruby-dev:27638]
+ * dir.c (fnmatch): The * needs to be escaped to avoid formatting in
+ fnmatch comment.
+ patched by @dalton. https://github.com/ruby/ruby/pull/91
-Sun Nov 6 20:13:27 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Feb 11 03:38:48 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
- * file.c (rb_file_s_readlink): readlink(2) on AIX fails with ERANGE if
- buffer size is less than required. fixed: [ruby-dev:27634]
+ * io.c (rb_sys_fail_path): move the definition.
+ Move above for using it in set_binary_mode_with_seek_cur().
-Wed Nov 2 20:25:28 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * io.c (set_binary_mode_with_seek_cur): fix improper seek cursor.
+ Seeking file cursor with setting binary mode has possibility to
+ cause infinite loop. Fixed the bug and refined error handling.
+ Introduced at r34043.
- * ext/tk/extconf.rb: ext/tk/extconf.rb: change the check parameter
- for Win32.
+ And cleanups as below.
+ Remove unnecessary parentheses of `fptr`.
+ Use return value of setmode().
-Wed Nov 2 20:14:53 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/ruby/test_io_m17n.rb
+ (TestIO_M17N#test_seek_with_setting_binmode): add a test for abobe.
+ [ruby-core:41671] [Bug #5714]
- * ext/tcltklib: merge into ext/tk and remove.
+Sat Feb 11 03:38:48 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Nov 2 19:03:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/ruby/test_io_m17n.rb
+ (TestIO_M17N#test_{read_with_binmode_and_get[cs]}): only for Windows.
- * ext/tcltklib/tcltklib.c (ip_rbUpdateObjCmd,
- ip_rb_threadUpdateObjCmd): passed improper flags to DoOneEvent().
+Sat Feb 11 03:38:48 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tk/tkutil.c: use rb_obj_respond_to() instead of rb_respond_to().
+ * win32/win32.c, include/ruby/win32.h (rb_w32_fd_is_text): new function.
-Tue Nov 1 14:20:11 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * win32/win32.c (init_stdhandle): set default mode of stdin as binmode.
- * eval.c (rb_call_super): should call method_missing if super is
- called from Kernel method.
+ * io.c (set_binary_mode_with_seek_cur): new function to replace
+ SET_BINARY_MODE_WITH_SEEK_CUR macro. now returns previous mode of the
+ fd and take care of LF in rbuf.
- * eval.c (exec_under): frame during eval should preserve external
- information.
+ * io.c (do_writeconv): set text mode when needed.
-Tue Nov 1 10:50:17 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * io.c (io_read): need to change the mode of the IO to binmode
+ temporally when the length for IO#read, because IO#read with length
+ must behave so.
- * ext/openssl/extconf.rb: should check ERR_peek_last_error().
- [ruby-dev:27597]
+ * test/ruby/test_io_m17n.rb (TestIO_M17N#test_{read_with_length,
+ read_with_length_binmode,get[cs]_and_read_with_binmode,
+ read_with_binmode_and_get[cs],read_write_with_binmode}): tests for
+ above changes.
- * ext/openssl/ossl.c (ossl_raise): ditto.
+ all patches are written by Hiroshi Shirosaki. [ruby-core:41496]
+ [Feature #5714]
-Mon Oct 31 17:34:46 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat Feb 11 03:37:56 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * configure.in: use proper option for Sun linker. A patch from
- Shinya Kuwamura <kuwa at labs.fujitsu.com>. [ruby-dev:27603]
+ * test/rexml/test_order.rb (OrderTester#test_more_ordering): use
+ GZip::GzReader.open instead of GZip::GzReader.new with File.new.
+ fixed a test error on Windows introduced at r33946.
-Mon Oct 31 11:27:22 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Feb 11 03:37:34 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/gdbm/test_gdbm.rb, test/sdbm/test_sdbm.rb (test_s_open_error):
- skip on Win32/DOS platforms.
+ * ext/zlib/zlib.c (rb_gzreader_initialize): revert a part of r33937.
+ 1st, to change the mode of an IO is very sensitive problem, so
+ fixed test errors on Windows introduced at r33953.
+ the maintainer of this library should judge it.
+ 2nd, usually Zlib::GzReader.new is not called directly. #initialize
+ is called via .open, and in the method the I/O is opened in binary
+ mode, so there is no problem without changing the mode in #initialize.
-Mon Oct 31 05:49:23 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ fixed test errors on Windows introduced at r33947.
+Sat Feb 11 03:23:58 2012 Luis Lavena <luislavena@gmail.com>
- * ext/openssl/ossl_cipher.c (ossl_cipher_update): input data must
- not be empty. [ruby-talk:161220]
+ * ext/zlib/zlib.c (rb_gzreader_initialize): use binary mode by default
+ under Windows. Patch by Hiroshi Shirosaki. [ruby-core:40706]
+ [Feature #5562]
- * test/openssl/test_cipher.rb: add test for Cipher#update("").
+ * include/ruby/encoding.h (void rb_econv_binmode): define NEWLINE
+ decorator.
-Mon Oct 31 05:37:20 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * io.c (rb_cloexec_fcntl_dupfd): Introduce NEED_READCONV and
+ NEED_WRITECONV to replace universal newline decorator by CRLF only
+ when required to improve file reading and writing under Windows.
+ Patch by Hiroshi Shirosaki. [ruby-core:40706] [Feature #5562]
+ * io.c (do_writeconv): adjust binary mode if required.
+ * io.c (read_all, appendline, swallow, rb_io_getline_1): ditto.
+ * io.c (io_getc, rb_io_each_codepoint, rb_io_ungetc): ditto.
+ * io.c (rb_io_binmode, rb_io_ascii8bit_binmode): ditto.
+ * io.c (rb_io_extract_modeenc, rb_sysopen): ditto.
+ * io.c (pipe_open, prep_stdio, io_encoding_set): ditto.
+ * io.c (rb_io_s_pipe, copy_stream_body): ditto.
- * lib/webrick/httpservlet/cgihandler.rb
- (WEBrick::HTTPServlet::CGIHandler#do_GET): the value of Set-Cookie:
- header field should be splited into each cookie. [ruby-Bugs:2199]
+ * test/ruby/test_io_m17n.rb (EOT): add test for pipe and stdin in
+ binary mode.
- * lib/webrick/cookie.rb (WEBrick::Cookie.parse_set_cookie): new method
- to parse the value of Set-Cookie: header field.
+ * win32/win32.c (init_stdhandle): remove O_BINARY from stdhandle
+ initialization.
+ * win32/win32.c (rb_w32_write): use FTEXT mode accordingly.
- * test/webrick/test_cookie.rb, test/webrick/test_cgi.rb,
- test/webrick/webrick.cgi: add some test for cookie.
+Sat Feb 11 03:20:22 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Oct 31 03:19:36 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * io.c (argf_next_argv): wrong timing of setting ecflags.
+ fixed the failure of TestArgf#test_textmode introduced at r33662.
- * ext/readline/readline.c (readline_readline): type check.
- [ruby-core:6089]
+Sat Feb 11 03:19:45 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * numeric.c (fix_rshift): RDoc fix. [ruby-core:6351]
+ * test/ruby/test_io_m17n.rb
+ (TestIO_M17N#test_default_stdout_stderr_mode): new test for
+ r33627-33629. see [backport #5565]
+Sat Feb 11 03:20:22 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * util.h (strtod): add #undef for platforms defines strtod()
- macro. [ruby-dev:27563]
+ * include/ruby/encoding.h (ECONV_NEWLINE_DECORATOR_READ_MASK,
+ ECONV_NEWLINE_DECORATOR_WRITE_MASK): new macro.
-Mon Oct 31 02:35:59 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * io.c (rb_io_extract_modeenc, pipe_open, prep_stdio, argf_next_argv):
+ set TEXTMODE_NEWLINE_DECORATOR_ON_WRITE for textmode on creating IO
+ if the flag is available.
- * test/ruby/test_float.rb (test_precision): test by assert_in_delta.
- [ruby-dev:27575]
+ * io.c (make_writeconv): drop decorators for reading.
-Sat Oct 29 01:58:25 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * io.c (make_readconv): drop decorators for writing.
- * ext/etc/etc.c: document update from mathew <meta@pobox.com>.
- [ruby-core:06473]
+ * io.c (do_writeconv): existing writeconv is not the condition to raise
+ ArgumentError. should check textmode or not.
- * ext/fcntl/fcntl.c: ditto.
+ * test/ruby/test_io_m17n.rb
+ (TestIO_M17N#test_{cr,lf,crlf}_decorator_on_stdout): test above
+ changes.
-Thu Oct 27 16:45:31 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * string.c (scan_once): wrong condition to use mbclen2().
- [ruby-dev:27535]
+Sat Feb 11 03:19:45 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Oct 26 09:27:27 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * test/ruby/test_io_m17n.rb (TestIO_M17N#test_{default_mode_on_dosish,
+ default_mode_on_unix,text_mode,binary_mode}): sorry for wrong test
+ committed in r33144. I'd misunderstood the spec of ruby's universal
+ newline.
- * ext/syck/implicit.c (syck_type_id_to_uri): should return
- newly allocated memory. otherwise, type_id will be freed
- twice. [ruby-dev:27384] [ruby-core:6385]
+Sat Feb 11 03:17:41 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Oct 26 09:04:51 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * test/ruby/test_io_m17n.rb (TestIO_M17N#test_{default_mode_on_dosish,
+ default_mode_on_unix,text_mode,binary_mode}): tests for [Bug #5164].
- * ruby.h (Qfalse, Qtrue, Qnil, Qundef): make sure these immediate
- values have VALUE type. there is an environment where sizeof(VALUE)
- != sizeof(int) like IA64. if 32bit integer (Qtrue) is passed to ANYARGS
- and received by 64bit integer (VALUE), upper bits may have garbage value.
- [ruby-dev:27513]
+Sat Feb 11 03:13:27 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 26 01:58:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * transcode.c: enabled econv newline option.
- * configure.in (RUBY_EXTERN): macro to export symbols in shared
- library. [ruby-core:05528]
+Sat Feb 11 02:39:09 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * defines.h, {bcc32,win32,wince}/Makefile.sub (RUBY_EXTERN): moved to
- configuration pass.
+ * variable.c (set_const_visibility): clear inine-cache when constant's
+ visibility is modified. [ruby-dev:44929]
- * ext/extmk.rb (extmake): RUBY_EXTERN for static linked extensions.
+ * test/ruby/test_module.rb (test_private_constants_clear_inlinecache):
+ add test for it.
-Tue Oct 25 15:32:00 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat Feb 11 02:39:09 2012 Yusuke Endoh <mame@tsg.ne.jp>
- * lib/rational.rb: applied documentation patch from Gavin Sinclair
- <gsinclair@gmail.com>. [ruby-core:06364]
+ * variable.c (set_const_visibility): print a warning when no argument
+ is passwd to Module#private_constant. [ruby-list:48558]
- * lib/irb.rb (IRB::Irb::eval_input): handle prompts with newlines
- in irb auto-indentation mode. [ruby-core:06358]
+ * vm_method.c (set_method_visibility): ditto for
+ Module#private_class_method.
-Tue Oct 25 02:12:08 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Feb 11 02:39:09 2012 Yusuke Endoh <mame@tsg.ne.jp>
- * lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::LABEL_LIST_RE):
- reduce redundant backtrack. [ruby-talk:161771]
+ * variable.c (set_const_visibility): Module#private_constant has
+ changed the visibility of only the first argument. Now it changes
+ all of them. [ruby-list:48558]
-Tue Oct 25 00:27:35 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * test/ruby/test_module.rb: add a test for above.
- * lib/rinda/*: RDoc documentation from Eric Hodel
- <drbrain@segment7.net> added.
+Sat Feb 11 02:39:09 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Mon Oct 24 21:14:29 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * variable.c (set_const_visibility): clear inine-cache when constant's
+ visibility is modified. [ruby-dev:44929]
- * configure.in, io.c: use sys/syscall.h if syscall.h is not available.
- [ruby-core:06247]
+ * test/ruby/test_module.rb (test_private_constants_clear_inlinecache):
+ add test for it.
-Mon Oct 24 20:49:45 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Feb 11 02:39:09 2012 Yusuke Endoh <mame@tsg.ne.jp>
- * ext/Win32API/lib/win32/resolv.rb (get_info): support multiple DNS.
- fixed: [ruby-list:40058], [ruby-dev:27479]
+ * variable.c (set_const_visibility): print a warning when no argument
+ is passwd to Module#private_constant. [ruby-list:48558]
-Mon Oct 24 07:57:56 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * vm_method.c (set_method_visibility): ditto for
+ Module#private_class_method.
- * ext/tk/lib/tk/canvas.rb (TkCanvasItemConfig::__item_val2ruby_optkeys):
- typo fixed. [ruby-talk:162187]
+Sat Feb 11 02:39:09 2012 Yusuke Endoh <mame@tsg.ne.jp>
- * ext/tk/lib/tk/menu.rb (TkMenuEntryConfig::__item_val2ruby_optkeys):
- ditto. [ruby-core:06359]
+ * variable.c (set_const_visibility): Module#private_constant has
+ changed the visibility of only the first argument. Now it changes
+ all of them. [ruby-list:48558]
-Sun Oct 23 21:50:15 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_module.rb: add a test for above.
- * ext/enumerator/enumerator.c: applied documentation patch from
- James Edward Gray II <james@grayproductions.net>.
- [ruby-core:06348]
+Sat Feb 11 02:26:51 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Sun Oct 23 07:11:11 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/openssl/buffering.rb: Force multi-byte strings to be treated as
+ binary data.
+ * test/openssl/test_ssl.rb: Add test for it.
- * ext/tcltklib/extconf.rb: improve messages [ruby-core:06325].
+ Thanks to Niklas Baumstark for reporting the issue!
- * ext/tk/lib/tk.rb, ext/tk/lib/tk/canvas.rb, ext/tk/lib/tk/entry.rb,
- ext/tk/lib/tk/frame.rb, ext/tk/lib/tk/image.rb,
- ext/tk/lib/tk/itemconfig.rb, ext/tk/lib/tk/labelframe.rb,
- ext/tk/lib/tk/listbox.rb, ext/tk/lib/tk/menu.rb,
- ext/tk/lib/tk/radiobutton.rb, ext/tk/lib/tk/scale.rb,
- ext/tk/lib/tk/spinbox.rb, ext/tk/lib/tk/text.rb,
- ext/tk/lib/tk/toplevel.rb: improve conversion of option values.
+ [Ruby 1.9 - Bug #5233] [ruby-core:39120]
- * ext/tk/lib/tkextlib/*: ditto.
+Fri Feb 10 17:25:28 2012 Tanaka Akira <akr@fsij.org>
- * ext/tk/lib/tkextlib/*: update to support ActiveTcl8.4.11.2.
+ * lib/set.rb (SortedSet.setup): remove old_init after initialize
+ method is redefined. The remove before redefinition makes the
+ warning prevention fragile. [ruby-dev:44892]
- * ext/tk/lib/tkextlib/trofs/*: support Trofs 0.4.3.
+Fri Feb 10 17:02:12 2012 okkez <okkez000@gmail.com>
- * ext/tk/lib/tkextlib/tile/*: support Tile 0.7.2.
+ * thread_pthread.c (rb_thread_create_timer_thread): fix memory
+ leak. [ruby-dev:44904] [Bug #5688]
- * ext/tk/lib/tkextlib/vu/*: support vu 2.3.0.
+Fri Feb 10 05:22:32 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/tkextlib/tcllib/*: support Tcllib 1.8 (Tklib 0.3).
+ * cont.c (fiber_setcontext): Use longjmp() instead of swapcontext() on
+ FreeBSD 9. [ruby-dev:41316] [Bug #3295] [Bug #5526]
-Sat Oct 22 23:54:07 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Feb 10 05:13:12 2012 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
- * ext/extmk.rb, lib/mkmf.rb (with_config): support --with-extension
- options. [ruby-dev:27449]
+ * object.c: Added examples for Object#is_a? and
+ Object#instance_of? patcheed from Manoj Kumar.
+ [Bug #5880] [ruby-core:42057]
-Sat Oct 22 13:26:57 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Feb 10 05:11:43 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * object.c (sym_inspect), parse.y (parser_yylex, rb_symname_p): check
- if valid as a symbol name more strictly. [ruby-dev:27478]
+ * io.c (argf_next_argv): reset ARGF.next_p on ARGV.replace.
+ r34409 breaks replacing ARGV.
+ [ruby-dev:45160] [Bug #5952]
- * test/ruby/test_symbol.rb: tests for [ruby-core:03573].
+Fri Feb 10 05:11:43 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * time.c (rb_strftime): removed meaningless volatile modifiers, and
- concatenate successive nul characters at once. [ruby-dev:27472]
+ * io.c (argf_close): skip stdin, which should be readable again.
+ [ruby-dev:45160] [Bug #5952]
-Fri Oct 21 19:21:56 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * io.c (argf_readlines): reinitialize after all read to be
+ readable again.
- * rubysig.h (CHECK_INTS): fixed typo. (I believe bit-or is improper)
+Fri Feb 9 01:36:19 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Fri Oct 21 17:49:32 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * backport r34482 from trunk
- * bin/erb (ERB::Main::run): typo fixed. [ruby-core:06337]
+ * ext/openssl/ossl_ssl.c: Add SSL constants and allow to unset SSL
+ option to prevent BEAST attack. See [Bug #5353].
-Fri Oct 21 15:27:17 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ In OpenSSL, OP_DONT_INSERT_EMPTY_FRAGMENTS is used to prevent
+ TLS-CBC-IV vulunerability described at
+ http://www.openssl.org/~bodo/tls-cbc.txt
+ It's known issue of TLSv1/SSLv3 but it attracts lots of attention
+ these days as BEAST attack. (CVE-2011-3389)
- * bignum.c (bignew_1): convertion from `int' to `char' discards
- upper bits, (ie. (char)0xff00 -> 0) so it's better to test if
- nonzero and set 0 or 1 instead of simply casting ... as a flag usage.
- (but I believe this won't cause actual bug in current implementation)
- [ruby-dev:27055]
+ Until now ossl sets OP_ALL at SSLContext allocation and call
+ SSL_CTX_set_options at connection. SSL_CTX_set_options updates the
+ value by using |= so bits set by OP_ALL cannot be unset afterwards.
+ This commit changes to call SSL_CTX_set_options only 1 time for each
+ SSLContext. It sets the specified value if SSLContext#options= are
+ called and sets OP_ALL if not.
- * time.c: should use LONG_LONG instead of `long long'.
+ To help users to unset bits in OP_ALL, this commit also adds several
+ constant to SSL such as
+ OpenSSL::SSL::OP_DONT_INSERT_EMPTY_FRAGMENTS. These constants were
+ not exposed in Ruby because there's no way to unset bits in OP_ALL
+ before.
-Thu Oct 20 09:37:15 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ Following is an example to enable 0/n split for BEAST prevention.
- * lib/mkmf.rb (create_makefile): Borland make seems not to allow
- empty dependency list. If this change is not good, please correct
- it.
+ ctx.options = OP_ALL & ~OP_DONT_INSERT_EMPTY_FRAGMENTS
-Thu Oct 20 07:55:09 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/openssl/test_ssl.rb: Test above option exists.
- * lib/mkmf.rb (create_makefile): get rid of a restriction
- of Borland make. fixed: [ruby-dev:27460]
+Thu Feb 9 17:08:20 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Thu Oct 20 00:13:18 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * cont.c (cont_mark): mark original Thread object from saved_thread.
+ [ruby-dev:44567] [Bug #5386]
- * rubysig.h (CHECK_INTS): fix typo.
+Thu Feb 9 17:05:07 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Oct 19 23:58:03 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * cont.c (HAVE_GETCONTEXT): see getcontext(3) because DragonFly BSD
+ x64 port doesn't have it.
- * lib/mkmf.rb (create_makefile): do not create unnecessary empty
- directories. fixed: [ruby-dev:27451]
+Thu Feb 9 16:19:04 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Oct 19 19:26:15 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/memory_status.rb (Memory::Win32): 64bit support.
- * parse.y (rb_gc_mark_parser): get rid of segfault with old yacc.
- fixed: [ruby-dev:27439]
+Thu Feb 9 16:19:04 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Oct 19 08:28:32 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/dl/lib/value.rb (DL::ValueUtil.{unsigned_value,signed_value}):
+ currenly pack/unpack does not accept "q!" and "Q!".
- * file.c (rb_file_join): elements may contain null pointer strings.
- report and fixed by Lloyd Zusman (hippoman): [ruby-core:06326]
+Thu Feb 9 16:19:04 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Oct 19 02:34:33 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/fiddle/conversions.c (value_to_generic): src is not guranteed as
+ a Bignum if the type is LONG_LONG. it may be a Fixnum if the value
+ is small.
- * eval.c, gc.c, time.c: made internal symbols static. [ruby-dev:27435]
+Thu Feb 9 16:19:04 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Oct 19 01:27:07 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/dl/lib/types.rb: Win64 support.
- * regex.c (re_compile_pattern): numeric literal inside character class
- disabled succeeding backtrack. fixed: [ruby-list:41328]
+Thu Feb 9 11:11:15 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
-Mon Oct 17 21:18:50 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/dbm/dbm.c (Init_dbm): fix a build error on mswin32.
+ use `extern __declspec(dllimport)` for dll link with VC.
+ [ruby-core:41996] [Bug #5869]
- * parse.y (parser_heap): byacc never free parser stack.
- fixed: [ruby-dev:27428]
+Thu Feb 9 11:11:15 2012 Tanaka Akira <akr@fsij.org>
-Mon Oct 17 16:04:47 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/dbm/dbm.c: use db_version() instead of DB_VERSION_STRING to
+ detect runtime Berkeley DB version.
+ use dpversion instead of _QDBM_VERSION to detect runtime QDBM
+ version.
+ [ruby-dev:44948]
- * file.c (chmod_internal, lchmod_internal): fixed type of 2nd argument.
+Thu Feb 9 11:11:15 2012 Tanaka Akira <akr@fsij.org>
-Sun Oct 16 22:16:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/dbm/extconf.rb: detect gdbm_version in libgdbm.
- * ext/extmk.rb: omit non-existing directories.
+ * ext/dbm/dbm.c: make DBM::VERSION more informative for gdbm, qdbm and
+ Berkeley DB 1.x. [ruby-dev:44944]
-Sun Oct 16 14:30:05 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Thu Feb 9 07:32:40 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/rinda/rinda.rb (Rinda::Tuple#initialize): check remote hash
- tuple. fixed: [ruby-list:41227]
+ * numeric.c (rb_enc_uint_char): raise RangeError when added codepoint
+ is invalid. [Feature #5855] [Bug #5863] [Bug #5864]
- * test/rinda/test_rinda.rb: test it.
+ * string.c (rb_str_concat): ditto.
-Sun Oct 16 03:38:07 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * string.c (rb_str_concat): set encoding as ASCII-8BIT when the string
+ is US-ASCII and the argument is an integer greater than 127.
- * rubysig.h (CHECK_INTS): prevent signal handler to run during
- critical section. [ruby-core:04039]
+ * regenc.c (onigenc_mb2_code_to_mbclen): rearrange error code.
- * eval.c (load_wait): need not to call rb_thread_schedule()
- explicitly. [ruby-core:04039]
+ * enc/euc_jp.c (code_to_mbclen): ditto.
- * eval.c (rb_thread_schedule): clear rb_thread_critical.
- [ruby-core:04039]
+ * enc/shift_jis.c (code_to_mbclen): ditto.
-Sat Oct 15 19:56:38 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Thu Feb 9 07:28:43 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * bin/erb: typo fixed, again. thanks, Doug Kearns.
+ * test/pathname/test_pathname.rb: not read but binread.
+ patched by Benoit Daloze, [ruby-core:42440] [Bug #5984]
-Fri Oct 14 22:08:26 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Feb 8 22:29:59 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/win32.c (ioctl): should set errno.
+ * string.c (rb_str_modify_expand): fix memory leak.
-Fri Oct 14 16:57:32 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Wed Feb 8 10:58:45 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/webrick/config.rb (Config::FileHandler): :UserDir should be nil.
- It is harmful to permit the access to ~/public_html by default.
- suggested by Hiroyuki Iwatsuki.
+ * ext/readline/readline.c (readline_attempted_completion_function):
+ respect encodings. [Bug #5941]
-Thu Oct 13 23:29:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Feb 8 10:56:00 2012 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * parse.y (HEAPCNT): bison allocates indivisible size.
- fixed: [ruby-core:06261]
+ * ext/readline/readline.c (readline_attempted_completion_function):
+ fix compile error.
- * io.c, pack.c, ext/syck/rubyext.c, ext/syck/syck.h, missing/isinf.c:
- get rid of warnings. fixed: [ruby-core:06247]
+Wed Feb 8 10:56:00 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 12 12:52:57 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/readline/readline.c (readline_attempted_completion_function):
+ empty completion result does not mean memory error.
- * ext/openssl/ossl.c (Init_openssl): should call
- OpenSSL_add_ssl_algorithms().
+Wed Feb 8 10:54:49 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 12 11:08:54 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+ * ext/readline/readline.c (readline_readline): check if outstream
+ is closed to get rid of a bug of readline 6. [ruby-dev:45043]
+ [Bug #5803]
- * file.c (rb_f_test): typo in RDoc comments.
+Wed Feb 8 10:52:51 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Oct 11 21:41:58 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/readline/readline.c (Init_readline): like r18313, libedit's
+ replace_history_entry may use offset instead of which.
+ so introduce history_replace_offset_func and initialize it.
- * eval.c (rb_obj_respond_to): check if obj responds to the given
- method with the given visibility. [ruby-dev:27408]
+ * ext/readline/readline.c (hist_set): use history_replace_offset_func.
- * eval.c (rb_respond_to): conform to Object#respond_to?. [ruby-dev:27411]
+Wed Feb 8 10:52:36 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Oct 11 00:01:21 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/readline/readline.c (Init_readline): fix wrong condition.
- * st.c (st_free_table): do not call free() but xfree().
- [ruby-core:06205]
+Wed Feb 8 10:50:11 2012 Naohisa Goto <ngotogenome@gmail.com>
-Sat Oct 8 20:04:40 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_rubyoptions.rb (test_script_from_stdin): slave pty
+ should be manipulated because master pty may not be a tty on some
+ environment (e.g. Solaris). [Bug:#5222] [ruby-dev:44420]
- * eval.c (Init_Binding): add Binding#dup method. [yarv-dev:666]
+Wed Feb 8 10:38:36 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * parse.y (rb_parser_malloc, rb_parser_free): manage parser stack on
- heap. [ruby-list:41199]
+ * Makefile.in (CFLAGS): append ARCH_FLAG.
- * ext/iconv/charset_alias.rb: parse config.charset_alias file directly.
+ * configure.in (ARCH_FLAG): exclude from CFLAGS.
-Fri Oct 7 09:54:00 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Feb 08 09:19:00 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * lib/cgi.rb (CGI::Cookie::parse): Cookies from Nokia devices may
- not be parsed correctly. A patch from August Z. Flatby
- (augustzf) in [ruby-Patches-2595]. [ruby-core:06183]
+ * ext/openssl/ossl_cipher.c: Add warning about key as IV.
-Thu Oct 6 20:12:16 2005 Minero Aoki <aamine@loveruby.net>
+Wed Feb 8 10:37:31 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/strscan/strscan.c (strscan_free): remove useless code.
- [ruby-dev:26368] [ruby-dev:27389]
- (backported from trunk, rev 1.22)
+ * ext/openssl/ossl_cipher.c: Update and complete documentation.
-Wed Oct 5 04:42:38 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Wed Feb 08 09:57:33 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * lib/xmlrpc/server.rb (XMLRPC::Server#initialize): should mount the
- servlet on "/".
+ * ext/openssl/ossl_asn1.c: Call INT2NUM only once for GeneralString.
+ Thanks to Mantas Mikulenas for noticing and providing a patch!
+ [ruby-core:42358] [Bug #5972]
-Wed Oct 5 03:59:09 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Wed Feb 8 10:34:59 2012 TAKAO Kouji <kouji@takao7.net>
- * lib/xmlrpc/server.rb (XMLRPC::Server#serve): delete wrong call
- of "join".
+ * ext/readline/readline.c (readline_attempted_completion_function):
+ in Readline module with GNU Readline 6 case, Readline module
+ resets completion_append_character to " ", after it executes
+ completion. So, Readline module stores
+ completion_append_character, and Readline module always sets it
+ after Readline module executes completion. [ruby-dev:43456]
+ [Feature #4635]
-Mon Oct 3 00:04:00 2005 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Wed Feb 8 09:47:52 2012 Tanaka Akira <akr@fsij.org>
- * pack.c (EXTEND16): [ruby-dev:27383]
+ * test/ruby/test_sleep.rb (test_sleep_5sec): 0.1sec tolerance is too
+ small for busy environment.
-Thu Sep 29 10:26:18 2005 Tanaka Akira <akr@m17n.org>
+Wed Feb 8 09:45:23 2012 Tanaka Akira <akr@fsij.org>
- * ext/dl/dl.c (rb_io_to_ptr): abolish sizeof(FILE).
- [ruby-dev:27317]
+ * test/dbm/test_dbm.rb: split tests for read only database.
-Thu Sep 29 07:22:05 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/gdbm/test_gdbm.rb: ditto.
- * evalc. (rb_f_send): underscores need to be escaped.
- fixed by Doug Kearns. [ruby-core:06053]
+Wed Feb 8 09:43:48 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Thu Sep 29 00:57:35 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * error.c (name_err_mesg_to_str): clear rb_thread_t::errinfo when
+ ignore exception under rb_protect(). [ruby-core:41612] [Bug #5755]
- * eval.c (ev_const_get), variable.c (rb_const_get_0): retry only when
- autoload succeeded.
+ * test/ruby/test_exception.rb (test_exception_in_name_error_to_str):
+ add a corresponding test.
- * variable.c (rb_autoload_load): now return true if autoload
- succeeded. fixed: [ruby-dev:27331]
+Wed Feb 8 09:36:42 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Sep 28 23:42:15 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * encoding.c (require_enc): reject only loading from untrusted
+ load paths. [ruby-dev:44541] [Bug #5279]
- * file.c (apply2files): add prototype.
+ * transcode.c (load_transcoder_entry): ditto.
- * file.c (rb_stat_inspect): constified.
+Wed Feb 8 09:36:42 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * class.c (rb_mod_init_copy, rb_class_init_copy), file.c (rb_stat_init_copy),
- numeric.c (num_init_copy), object.c (rb_obj_init_copy, Init_Object),
- re.c (match_init_copy, rb_reg_init_copy), time.c (time_init_copy):
- undocumented.
+ * encoding.c (load_encoding): predefined encoding names are safe.
+ [ruby-dev:44469] [Bug #5279]
-Wed Sep 28 23:09:23 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * transcode.c (load_transcoder_entry): ditto.
- * lib/delegate.rb: document update from James Edward Gray II
- <james@grayproductions.net>. [ruby-core:06027]
+Tue Feb 7 14:29:16 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Sep 28 15:14:19 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * st.c (st_foreach): should not yield same pair when checking
+ after unpacking.
- * lib/webrick/cgi.rb (WEBrick::CGI#start): req.query_string should
- refer the value of QUERY_STRING. [ruby-list:41186]
+Tue Feb 7 14:03:45 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#query_string=):
- add new method.
+ * lib/tempfile.rb (Tempfile#_close): clear @tempfile and @data[1] even
+ when exception is raised at @tempfile.close. [ruby-dev:45113]
-Wed Sep 28 10:45:44 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/tempfile.rb (Tempfile#unlink): fix a typo.
- * ext/tcltklib/tcltklib.c: cannot compile with Tcl/Tk8.0.x
- [ruby-dev:27335].
+Tue Feb 7 14:02:32 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Wed Sep 28 08:12:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_io.rb (test_autoclose_true_closed_by_finalizer,
+ test_autoclose_true_closed_by_finalizer): skip if IO objects are
+ not recycled yet. [ruby-dev:45098] [Bug #5850]
- * io.c (read_buffered_data): check if reached EOF. fixed: [ruby-dev:27334]
+Tue Feb 7 13:59:26 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Wed Sep 28 07:56:52 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * gc.c (run_finalizer): clear rb_thread_t::errinfo when ignore
+ an exception under rb_protect(). [ruby-dev:45113]
- * lib/yaml/basenode.rb (YAML::BaseNode::match_segment): fix typo.
- [ruby-dev:27237], [ruby-core:05854]
+Mon Feb 6 15:34:47 2012 Tanaka Akira <akr@fsij.org>
- * lib/yaml/tag.rb (Module#yaml_as): suppress warnings.
+ * ruby.c (fill_standard_fds): use fstat() instead of fcntl(F_GETFD)
+ for MinGW. reported by Luis Lavena. [ruby-core:40526] [Bug #5516]
- * lib/yaml/types.rb (YAML::PrivateType, YAML::DomainType): ditto.
+Mon Feb 6 15:34:47 2012 Tanaka Akira <akr@fsij.org>
-Wed Sep 28 03:23:35 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ruby.c (fill_standard_fds): new function to open closed standard
+ file descriptors.
+ (ruby_sysinit): call fill_standard_fds.
- * rubysig.h: fixed build problem with --enable-pthread on platforms
- which don't have setitimer().
+Mon Feb 6 15:19:17 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Sep 26 22:32:13 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * io.c (rb_io_fsync,rb_io_fdatasync): release GVL during fsync().
+ fsync() and fdatasync() may take a long time on slow disks and/or
+ if there is much dirty data.
+ Patch by Eric Wong. [Feature #5665] [ruby-core:41247]
- * eval.c (set_trace_func): add rb_secure(4) to prevent adding
- tracing function.
+Mon Feb 6 15:01:55 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Sep 25 12:05:10 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * vm_eval.c (vm_call0): should pass block to enumerators. patched
+ by Kazuki Tsujimoto. [ruby-dev:44961][Bug #5731]
- * bin/erb: typo fixed.
+ * vm_eval.c (method_missing), vm_insnhelper.c (vm_call_method):
+ ditto. patched by satoshi shiba.
-Sun Sep 25 01:46:43 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Feb 6 21:52:20 2012 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * misc/ruby-mode.el (ruby-calculate-indent): arrange deep-indent
- closing parenthesis at same column as the opening.
+ * common.mk (INSTRUBY_ARGS): added --mantype to apply mdoc2man.rb
+ to man pages. Fixes #5598.
+ (do-install-nodoc, do-install-local, do-install-man,
+ dont-install-nodoc, dont-install-local, dont-install-man):
+ No longer needs --mantype.
-Sun Sep 25 00:42:11 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ Reported by Rainer Orth <ro AT cebitec.uni-bielefeld.de>,
+ patch by George Koehler <xkernigh AT netscape.net>.
- * misc/ruby-mode.el (ruby-expr-beg): deal with heredoc separately.
- fixed: [ruby-list:41168]
+Mon Feb 6 21:21:46 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * misc/ruby-mode.el (ruby-calculate-indent): not to deepen indent
- level for continuous line inside parentheses.
- http://nabeken.tdiary.net/20050915.html#p02
+ * test/unit/assertions.rb (MINI_DIR): quick dirty hack to get rid of
+ warnings when using assert/assert_respond_to.
-Sun Sep 25 00:18:11 2005 Tanaka Akira <akr@m17n.org>
+Mon Feb 6 20:38:19 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * eval.c (unknown_node): show more information. [ruby-dev:26196]
+ * file.c (file_expand_path): reset coderange after expanding path.
-Sat Sep 24 08:56:01 2005 Minero Aoki <aamine@loveruby.net>
+Mon Feb 6 20:32:17 2012 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/fileutils.rb (cd): no longer accept :noop option, related
- code is useless (backported from trunk, rev 1.67).
- [ruby-core:05858] [ruby-Bugs:2494]
+ * ext/date/date_strptime.c: moved detector of leftover.
-Sat Sep 24 08:38:07 2005 Minero Aoki <aamine@loveruby.net>
+Mon Feb 6 20:32:17 2012 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/fileutils.rb: fix visibility of FileUtils::NoWrite, Verbose,
- DryRun (backported from trunk, rev 1.66). [ruby-core:05954]
+ * ext/date/date_parse.c: [ruby-core:42173].
- * test/fileutils/test_nowrite.rb: test it.
+Mon Feb 6 20:31:35 2012 Tadayoshi Funaba <tadf@dotrb.org>
- * test/fileutils/test_dryrun.rb: new file.
+ * ext/date/date_core.c: uses to_integer instead.
+ * test/date/test_switch_hitter.rb: added a test.
- * test/fileutils/test_verbose.rb: new file.
+Mon Feb 6 20:31:35 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Sat Sep 24 02:40:20 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/date/date_core.c (wholenum): fix the type of the return value.
- * lib/delegate.rb: document update from James Edward Gray II
- <james@grayproductions.net>. [ruby-core:05942]
+Mon Feb 6 20:31:35 2012 Tadayoshi Funaba <tadf@dotrb.org>
-Thu Sep 22 23:36:24 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/date/date_core.c: [ruby-dev:45008].
- * lib/mkmf.rb (find_executable0): default path if environment is not
- set. [ruby-dev:27281]
+Mon Feb 6 16:38:56 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Sep 22 16:33:12 2005 Shugo Maeda <shugo@ruby-lang.org>
+ * win32/win32.c (unixtime_to_filetime): should check the return value
+ of localtime(). reported by snowjail at gmail.com.
+ [ruby-dev:44838] [Bug #5596]
- * test/readline/test_readline.rb (TestReadline::replace_stdio):
- merged the patch of [ruby-dev:25232] instead of [ruby-dev:25223].
+Mon Feb 6 16:36:25 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Sep 21 23:30:44 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (rb_update_max_fd): fstat(2) can fail with other than
+ EBADF. [ruby-dev:44837] [Bug #5593]. Cf.
+ http://pubs.opengroup.org/onlinepubs/9699919799/functions/fstat.html
- * lib/mkmf.rb (configuration): generalized nmake dependent code.
+Mon Feb 6 16:31:16 2012 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Sep 21 09:07:55 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * io.c (io_fwrite): call rb_w32_write_console() only if FMODE_TTY is
+ set. this is the one of the reason of IO writing slowness of Windows
+ in 1.9.3 or later.
- * stable version 1.8.3 released.
+Mon Feb 6 16:21:57 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Sep 21 08:52:25 2005 why the lucky stiff <why@ruby-lang.org>
+ * file.c (file_expand_path): reset coderange after expanding path.
- * ext/syck/token.c: correctly compute identation of a block
- scalar's parent node. [ruby-talk:150620]
+Mon Feb 6 00:06:39 2012 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Sep 21 08:20:24 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/json/parser/parser.rl (json_string_unescape): workaround fix
+ for over optimization of GCC 4.7. [ruby-core:42085] [Bug #5888]
+ http://gcc.gnu.org/bugzilla/show_bug.cgi?id=51862
- * README.EXT, README.EXT.ja: add new features.
+Fri Feb 3 16:16:10 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Sep 21 07:43:58 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/envutil.rb (EnvUtil.invoke_ruby): yield also child pid
+ in block form.
- * lib/optparse.rb (default_argv, Arguable#options): defaults strings
- to be parsed to Arguable instance.
+Fri Feb 3 16:16:10 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
-Wed Sep 21 02:44:09 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_thread.rb
+ (TestThreadGroup#test_thread_timer_and_interrupt): skip exit status
+ assertion because we cannot get signal status on Windows.
- * file.c (path_check_0): disallow sticky world writable directory
- in PATH (and $LOAD_PATH). [ruby-dev:27226]
+ * win32/win32.c (CreateChild): create process group to receive the
+ signal by GenerateConsoleCtrlEvent().
- * file.c (fpath_check): typo fixed.
+ * win32/win32.c (kill): use CTRL_BREAK_EVENT instead of CTRL_C_EVENT
+ if a process group is specified. CTRL_C_EVENT signal cannot be
+ generated for process groups for the specification.
+ [ruby-dev:45149] [Bug #5812]
-Tue Sep 20 22:29:49 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Fri Feb 3 16:16:10 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * test/wsdl/simpletype/rpc/test_rpc.rb, test/wsdl/ref/test_ref.rb,
- test/wsdl/any/test_any.rb test/soap/wsdlDriver/test_calc.rb:
- suppress deliberate warnings with $VERBOSE = nil.
+ * test/ruby/envutil.rb (invoke_ruby): remove :timeout option before
+ pass it to Kernel#spawn.
-Tue Sep 20 21:26:23 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Feb 3 10:10:02 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * ext/io/wait/lib/nonblock.rb: disable on platforms non-blocking flag
- is not available. fixed: [ruby-dev:27187]
+ * thread_pthread.c (ping_signal_thread_list): remove return value.
+ * thread_pthread.c (check_signal_thread_list): add a new function to
+ check if signal thread list is empty.
+ * thread_pthread.c (thread_timer): check signal thread list after
+ timer_thread_function(). main thread might be added into signal thread
+ list during timer_thread_function().
-Tue Sep 20 18:23:04 2005 Tanaka Akira <akr@m17n.org>
+Fri Feb 3 10:10:02 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * eval.c (thread_mark): mark th->last_status. [ruby-dev:27179]
+ * thread_pthread.c (ubf_select): call rb_thread_wakeup_timer_thread()
+ only when it is not timer_thread. [Bug #5757] [ruby-dev:44985]
+ patched by Tomoyuki Chikanaga.
-Tue Sep 20 18:20:33 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Feb 1 09:50:10 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/yaml.rb: require 'yaml/constants'. [ruby-core:5776]
+ * doc/re.rdoc (Repetition): fix typo. reported by Ori Avtalion
+ and patched by Zachary Scott. [Bug #5947]
-Tue Sep 20 17:48:34 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Jan 24 11:38:05 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/xmlrpc/client.rb (XMLRPC::Client::do_rpc): add charset
- information to content-type header.[ruby-core:5127]
+ * lib/uri/common.rb (URI.encode_www_form_component): initialize on
+ requiring to support JRuby, which runs parallel multithreads.
+ [ruby-core:42222] [Bug #5925]
- * lib/xmlrpc/server.rb (CGIServer::serve): ditto.
+ * lib/uri/common.rb (URI.decode_www_form_component): initialize on
- * lib/xmlrpc/server.rb (ModRubyServer::serve): ditto.
+Sat Jan 28 05:53:34 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/xmlrpc/server.rb (WEBrickServlet::service): ditto.
+ * lib/irb/completion.rb (IRB::InputCompletor::CompletionProc):
+ ignore non-string name modules. [ruby-core:42244][Bug #5938]
-Tue Sep 20 17:34:46 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Mon Jan 23 18:18:58 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * test/webrick/test_cgi.rb: set ENV["PATH"] to CGIEnvPath on
- windows. bcc32's runtime is not installed into system directory,
- so it cannot be found without this setting. [ruby-dev:27166]
+ * encoding.c (rb_enc_compatible): fix segv on symbols.
+ [ruby-core:42204] [Bug #5921]
-Tue Sep 20 17:10:38 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Jan 17 17:18:41 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/dbm/test_dbm.rb (TestDBM::test_s_open_error): remove
- test_s_open_error test to detect duplicate open.
- [ruby-dev:27202]
+ * configure.in (SPT_TYPE): enable as SPT_REUSEARGV on Darwin.
-Tue Sep 20 17:08:31 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * missing/setproctitle.c (ruby_init_setproctitle): changed prefix.
- * io.c: PIPE_BUF is not defined on BeOS. use _POSIX_PIPE_BUF instead.
- [ruby-dev:27185]
+Mon Jan 16 16:41:53 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Sep 20 16:53:53 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/optparse.rb (Regexp): fix incorrect options when casting to
+ a Regexp, and suppress encoding option warnings.
+ https://github.com/ruby/ruby/pull/82
- * test/readline/test_readline.rb (TestReadline::replace_stdio):
- BSD seek support from [ruby-dev:25223]. fixed: [ruby-dev:27150]
+Fri Jan 13 15:22:43 2012 Tanaka Akira <akr@fsij.org>
-Tue Sep 20 15:39:40 2005 why the lucky stiff <why@ruby-lang.org>
+ * time.c (TIME_COPY_GMT): copy vtm.utc_offset and vtm.zone too.
+ patch by Tomoyuki Chikanaga.
+ [ruby-dev:44827] [Bug #5586]
- * ext/syck/emitter.c (syck_scan_scalar): prevent indicators from
- appearing alone or at the end of plain scalars. [ruby-core:5826]
+Thu Jan 12 13:52:13 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/syck/emitter.c (syck_emit_scalar): treat typed scalar nodes
- as complex keys.
+ * cont.c (cont_restore_0): prevent optimizing out `sp'. sp is used for
+ reserving a memory space with ALLOCA_N for restoring machine stack
+ stored in cont->machine_stack, but clang optimized out it (and
+ maybe #5851 is also caused by this).
+ This affected TestContinuation#test_check_localvars.
- * lib/syck.h: version 0.60.
+ * cont.c (cont_restore_1): revert workaround introduced in r32201.
- * lib/yaml/basenode.rb (YAML::BaseNode#at): transform keys during
- key searches.
+Thu Jan 12 01:40:33 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/syck/rubyext.c: loading of binary-typed nodes. prevent
- emission of plain strings that look like symbols, but which aren't.
+ * test/ruby/test_io.rb (TestIO#test_autoclose): Tempfile.new doesn't
+ accept the block argument.
-Tue Sep 20 05:50:22 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Sat Jan 7 22:46:36 2012 Kouhei Sutou <kou@cozmixng.org>
- * test/xmlrpc/test_webrick_server.rb (setup_http_server):
- should not include 'webrick/https' unless 'use_ssl' because
- it fails where openssl is not installed.
+ * lib/rexml/parsers/baseparser.rb: use private instead of _xxx
+ method name. This is Ruby code not Python code.
+ refs #5696
-Tue Sep 20 00:34:07 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Jan 03 23:57:37 2012 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
- * io.c (io_close): call rb_io_close() directly if io is a T_FILE
- object. [ruby-dev:27156]
+ * lib/rexml/parsers/baseparser.rb: rexml BaseParser uses
+ instance_eval unnecessarily on listener add.
+ patch from Charles Nutter. [Bug #5696] [ruby-core:41437]
-Mon Sep 19 19:09:08 2005 Minero Aoki <aamine@loveruby.net>
+Tue Jan 03 19:13:05 2012 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
- * file.c (rb_file_chown): should accept nil. [ruby-dev:27171]
- (backport from trunk, rev 1.208)
+ * test/rexml/test_sax.rb: add require 'rexml/document'.
+ [Backport #5834] [ruby-dev:45079]
-Mon Sep 19 18:35:13 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Jan 3 19:05:42 2012 Naohisa Goto <ngotogenome@gmail.com>
- * ext/dl/dl.c (rb_io_to_ptr): fix DragonFlyBSD support.
- [ruby-dev:27151]
+ * include/ruby/defines.h (FLUSH_REGISTER_WINDOWS): move sparc asm code
+ to a separete file sparc.c for preventing inlining optimization.
+ Patched by Jurij Smakov. [Bug #5244] [ruby-core:40685]
+ * sparc.c (rb_sparc_flush_register_windows): ditto.
+ * configure.in: ditto.
-Mon Sep 19 14:17:04 2005 Minero Aoki <aamine@loveruby.net>
+Mon Jan 2 23:52:20 2012 TAKAO Kouji <kouji@takao7.net>
- * ext/syck/emitter.c (syck_emit): passing an int* value to the
- long* parameter causes unaligned access on LP64 systems.
- [ruby-dev:27161]
+ * ext/readline/readline.c (Init_readline): libedit check
+ rl_getc_function only when rl_initialize() is called, and
+ using_history() call rl_initialize(). This assignment should be
+ placed before using_history(). [ruby-core:40641] [Bug #5539]
-Mon Sep 19 13:44:03 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+Mon Jan 2 23:47:58 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/win32ole/win32ole.c: avoid core dump with WIN32OLE_EVENT.
- [ruby-dev:27133]
+ * tool/rbinstall.rb (install_recursive, bin-comm): split mere
+ string not path name. [ruby-core:40462] [Bug #5492]
-Mon Sep 19 10:36:06 2005 Minero Aoki <aamine@loveruby.net>
+Mon Jan 2 23:41:57 2012 Tajima Akil <artonx@yahoo.co.jp>
- * lib/fileutils.rb (cp_r): default is :dereference_root=>true for
- backward compatibility. [ruby-dev:27145]
+ * win32/Makefile.sub (CONFIG_H): have stdint.h if VC2010.
+ [Bug #5243]
- * test/fileutils/test_fileutils.rb (test_cp_r): test it.
+Mon Jan 2 21:40:45 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Sep 19 09:57:39 2005 Minero Aoki <aamine@loveruby.net>
+ * tool/merger.rb (#version_up): version.h date should be Japanese
+ locale date.
- * test/fileutils/test_fileutils.rb: backported from trunk (1.36).
- (again) [ruby-dev:27145]
+Mon Jan 2 21:36:56 2012 Luis Lavena <luislavena@gmail.com>
-Mon Sep 19 07:45:37 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * configure.in: check -fno-omit-frame-pointer acceptance and usage
+ under MinGW. [ruby-core:39957] [Bug #5407]
- * ext/openssl/ossl_pkey.h, ossl_pkey_rsa.c, ossl_pkey_dsa.c:
- an instance variable "private" is added to OpenSSL::PKey class.
- this ivar is a flag that shows whether there is a private key
- in the instance.
+Mon Jan 2 20:05:10 2012 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/openssl/ossl_engine.c: (ossl_engine_load_privkey): set private
- key flag.
+ * include/ruby/ruby.h (SIZE_MAX): define SIZE_MAX if not defined.
+ patched by The Written Word Inc. [ruby-core:40422] [Bug #5489]
-Mon Sep 19 06:41:32 2005 Minero Aoki <aamine@loveruby.net>
+Mon Jan 2 20:00:01 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/fileutils.rb: backported from trunk (rev 1.65):
+ * ext/pty/pty.c (pty_check): should return nil until the child
+ terminates or stops. [ruby-dev:44600] [Bug #2642]
- * lib/fileutils.rb (rm_r): new option :secure.
+Mon Jan 2 19:27:18 2012 Yusuke Endoh <mame@tsg.ne.jp>
- * lib/fileutils.rb (rm_rf): new option :secure.
+ * thread.c (update_coverage): skip coverage count up if the current
+ line is out of the way. rb_sourceline() is unreliable when source
+ code is big. [ruby-dev:44413]
- * lib/fileutils.rb: new method #remove_entry_secure.
+ * test/coverage/test_coverage.rb: add a test for above.
- * lib/fileutils.rb (cd): remove option :noop.
+Mon Jan 2 19:08:54 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/fileutils.rb (cp_r): new option :dereference_root.
+ * thread_pthread.c (gvl_yield): don't prevent concurrent sched_yield().
+ [Bug #5130] [ruby-core:38647]
- * lib/fileutils.rb (cp_r): new option :dereference_root.
+Mon Jan 2 18:54:52 2012 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/fileutils.rb: new method #remove_entry.
+ * win32/configure.bat: disable delayed expansion of enironment variable.
+ [Bug #5517] [ruby-core:40531]
- * lib/fileutils.rb: new method #chmod_R.
+Wed Dec 28 11:22:45 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/fileutils.rb: new method #chown.
+ * lib/fileutils.rb (FileUtils::Entry_#entries): use utility method
+ instead of typoed regexp. [ruby-core:41829] [Bug #5817]
- * lib/fileutils.rb: new method #chown_R.
+Thu Dec 15 10:44:54 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/fileutils.rb: new method .commands.
+ * array.c (rb_ary_reject_bang, rb_ary_delete_if): update rdoc.
+ documentation from Thomas Leitner <t_leitner AT gmx.at> in
+ [ruby-core:41616]. [Bug #5752]
- * lib/fileutils.rb: new method .options.
+Wed Dec 14 15:28:31 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/fileutils.rb: new method .have_option?.
+ * transcode.c (str_encode): about the extension of :fallback
+ option since 1.9.3.
- * lib/fileutils.rb: new method .options_of.
+Tue Oct 4 06:43:47 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/fileutils.rb: new method .collect_method.
+ * ext/psych/lib/psych.rb: update psych version.
+ * ext/psych/psych.gemspec: generate new gemspec for new version.
- * lib/fileutils.rb: use module_function instead of single extend.
+Tue Oct 4 06:29:55 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * test/fileutils/test_fileutils.rb: backported from trunk (1.36).
+ * ext/psych/lib/psych.rb: calling `yaml` rather than `to_yaml`.
+ * ext/psych/lib/psych/nodes/node.rb: Rename `to_yaml` to just `yaml`
+ in order to avoid YAML::ENGINE switching from replacing this method.
+ * test/psych/helper.rb: fix tests for method name change.
+ * test/psych/test_document.rb: ditto
+ * test/psych/visitors/test_emitter.rb: ditto
-Mon Sep 19 03:17:48 2005 Tanaka Akira <akr@m17n.org>
+Tue Oct 4 06:20:19 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * file.c (rb_thread_flock): wrap the flock system call by
- TRAP_BEG/TRAP_END to enable signals. [ruby-dev:27122]
+ * ext/psych/lib/psych/scalar_scanner.rb: Match values against the
+ floating point spec defined in YAML to avoid erronious parses.
+ * test/psych/test_numeric.rb: corresponding test.
- * ext/socket/socket.c (bsock_send): wrap the sendto and send system
- call by TRAP_BEG/TRAP_END to enable signals when writing to a socket
- which is full. [ruby-dev:27132]
+Tue Oct 4 05:59:24 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * io.c (rb_io_syswrite): wrap the write system call by
- TRAP_BEG/TRAP_END to enable signals when writing to a pipe which is
- full. [ruby-dev:27134]
+ * ext/psych/lib/psych/visitors/to_ruby.rb: ToRuby visitor can be
+ constructed with a ScalarScanner.
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: ScalarScanner can be
+ passed to the YAMLTree visitor.
-Mon Sep 19 03:02:08 2005 Tanaka Akira <akr@m17n.org>
+Tue Oct 4 05:47:23 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * io.c (io_fwrite): wrap the write system call by TRAP_BEG/TRAP_END to
- enable signals when writing to a pipe which is full.
+ * ext/psych/lib/psych/visitors/to_ruby.rb: Define Regexp::NOENCODING
+ for 1.9.2 backwards compatibility.
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: Fix Date string
+ generation for 1.9.2 backwards compatibility.
-Sun Sep 18 02:10:47 2005 why the lucky stiff <why@ruby-lang.org>
+Fri Sep 2 04:05:25 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/yaml/rubytypes.rb: remove comments that are bungling up
- the rdoc and ri output. output symbols as plain scalars.
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: emit strings tagged as
+ ascii-8bit as binary in YAML.
+ * test/psych/test_string.rb: corresponding test.
- * ext/syck/rubyext.c (syck_emitter_reset): emit headless
- documents always.
+Wed Dec 7 19:04:22 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/syck/emitter.c (syck_scan_scalar): quote scalars with any
- kind of surrounding line space, tabs or spaces alike.
+ * configure.in (rpath): fix typo in the help string. a patch from
+ Yuji Yamano <yyamano AT kt.rim.or.jp> in [ruby-list:48568].
- * ext/syck/token.c: accept tabs as whitespace, not for indentation,
- but strip from plain scalars.
+Wed Nov 30 18:22:10 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/yaml/test_yaml.rb: remove outdated tests.
+ * complex.c (nucomp_rationalize): fix function. [ruby-core:40667]
+ [Bug #5546]
-Sat Sep 17 23:25:04 2005 sheepman <sheepman@sheepman.sakura.ne.jp>
+Thu Nov 17 10:36:46 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/mathn.rb (Rational::inspect): should preserve original
- operand. [ruby-core:05806]
+ * ext/psych/lib/psych.rb (load_file): make sure opened yaml files are
+ also closed. [ruby-core:41088]
-Sat Sep 17 23:20:27 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Nov 30 02:58:46 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * lib/cgi.rb (CGI::Cookie): should handle multiple values for a
- cookie name. [ruby-talk:156140]
+ * numeric.c (dbl2ival): Fix Float#divmod and #round for 32 bit
+ platform. part 1 of [bug #5276]
-Sat Sep 17 10:42:13 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Wed Nov 30 02:58:46 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string and bg_eval_string
- should call Kernel.eval on caller's safe-level instead of slave's
- safe-level (Of course, the given script should be evaluated on
- slave's safe-level).
+ * numeric.c (flo_round): Fix criteria for 32 bits platform
+ part 2 of [bug #5276]
-Sat Sep 17 09:45:26 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Nov 30 02:37:32 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * string.c (rb_str_substr): should propagate taintness even for
- empty strings. [ruby-dev:27121]
+ * numeric.c (flo_round): Make Float#round round big values [bug
+ #5272]
- * string.c (rb_str_aref): should infect result if range argument
- is tainted. [ruby-dev:27121]
+Wed Nov 30 02:37:32 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Sep 17 08:35:39 2005 Kouhei Sutou <kou@cozmixng.org>
+ * numeric.c (flo_round): substitute machine dependent magic number.
- * lib/rss/maker/base.rb (RSS::Maker::ItemsBase#normalize): fixed
- strange RSS::Maker::Item#max_size behavior.
- Thanks to Kazuhiko <kazuhiko@fdiary.net>.
+Wed Nov 30 02:28:22 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * test/rss/test_maker_1.0.rb (RSS::TestMaker10#test_items): ditto.
+ * numeric.c (int_round): Integer#round always returns an Integer [Bug
+ #5271]
-Fri Sep 16 23:09:20 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+Fri Nov 4 01:56:30 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/win32ole/win32ole.c (ole_search_event_at): bug fix
- in ext/win32ole/sample/ienavi.rb.
+ * io.c (make_writeconv): unversal_newline converter is for reading.
+ so, if the io is text mode and has ECONV_UNIVERSAL_NEWLINE_DECORATOR
+ flag, use crlf_newline converter for writing.
+ this change fixes the problem about the luck of CR up Kernel.p and
+ Kernel.puts to stdout/stderr on Windows.
- * ext/win32ole/win32ole/tests/testOLEEVENT.rb: ditto.
+Mon Nov 7 23:39:23 2011 Tajima Akio <artonx@yahoo.co.jp>
-Fri Sep 16 22:41:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (io_fflush): remove fsync().
+ * io.c (rb_io_flush, rb_io_rewind): fsync() here.
+ These pathces are backports of trunk r33651 for [Bug #5585]
- * file.c (rb_file_s_extname): empty string for path name ending with a
- period. fixed: [ruby-core:05651]
+Mon Oct 10 22:33:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * file.c (rb_file_join): smarter behavior at edge cases.
- fixed: [ruby-core:05706]
+ * test/-ext-/old_thread_select/test_old_thread_select.rb:
+ select() with timeout may return early in old Linux kernels
+ with 250 Hz tickrate and no dynticks, so skip everything older
+ than 2.6.32 (which has long term support).
+ And, Make the timing assertions consistently use assert_operator with
+ timing difference in error message
+ Patch by Eric Wong. [Bug #5335] [ruby-core:39618]
-Fri Sep 16 18:34:01 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Oct 4 16:17:50 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/syck/node.c (syck_replace_str): was using return from the
- void function. a patch from MIYAMUKO Katsuyuki
- <miyamuko at mtb.biglobe.ne.jp>. [ruby-dev:27111]
+ * lib/time.rb (Time.strptime): use Time.at if d[:seconds] is set.
+ Reported by Christopher Eberz. [ruby-core:39903] Bug #5399
-Fri Sep 16 14:48:48 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Oct 4 11:44:10 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/multi-tk.rb: fix typo on MultiTkIp#bg_eval_string
+ * gc.c (rb_gc_set_params): ruby_verbose can be Qnil, so use RTEST.
-Fri Sep 16 12:02:12 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon Oct 3 23:56:39 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * ext/syck/rubyext.c (syck_resolver_transfer): remove C++ style
- comment (//). [ruby-core:05793]
+ * gc.c (rb_gc_set_params): output GC parameter change messages only
+ if -w/-v options are specified. these messages are output to stderr,
+ not to stdout. [ruby-core:39795] [Bug #5380]
-Fri Sep 16 00:14:14 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * test/ruby/test_gc.rb (test_gc_parameter): add test for it.
- * test/logger/test_logger.rb: unintentionally overwritten changes by
- Usa. reverted.
+Wed Sep 28 09:14:16 2011 Nobuyoshi Nakada <>
-Fri Sep 16 00:06:18 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * configure.in (pthread_np.h): needs pthread.h to be included
+ previously on OpenBSD. a patch by George Koehler <xkernigh AT
+ netscape.net> at [ruby-core:39752]. [Bug #5376]
- * lib/webrick/cgi.rb (WEBrick::CGI::Socket#initialize): should set
- $stdout.binmode.
+Tue Sep 13 15:02:48 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Sep 15 23:25:21 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * lib/pstore.rb (PStore): always open in binary mode even if
+ default encodings are set. [Bug #5311] [ruby-core:39503]
- * lib/{soap,wsdl,xsd}, test/{soap,wsdl,xsd}: imported soap4r/1.5.5.
+Sat Oct 8 07:31:42 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- #nnn is a ticket number at http://dev.ctor.org/soap4r
+ * array.c (ary_join_1): should not copy the encoding of non-string
+ element after string element. [ruby-core:39776] [Bug #5379]
- * SOAP
+Sat Oct 8 06:51:46 2011 Eric Hodel <drbrain@segment7.net>
- * allow to configure an envelope namespace of SOAP request. (#124)
- TemporaryNamespace = 'http://www.w3.org/2003/05/soap-envelope'
- @client.options["soap.envelope.requestnamespace"] =
- TemporaryNamespace
- @client.options["soap.envelope.responsenamespace"] =
- TemporaryNamespace
- @client.do_proc(...)
+ * lib/rubygems: Update to RubyGems 1.8.11. Move Deprecate into the
+ Gem namespace.
- * let SOAP request XML indent space configuable. see
- "soap.envelope.no_indent" option. (#130)
+Sat Oct 8 06:37:08 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * let external CES configuable.
- ex. client["soap.mapping.external_ces"] = 'SJIS'. $KCODE is used
- by default. (#133)
- external CES ::= CES used in Ruby object of client and server
- internal CES ::= CES used in SOAP/OM
+ * gc.c (rb_gc_set_params): output GC parameter change messages only
+ if -w/-v options are specified. these messages are output to stderr,
+ not to stdout. [ruby-core:39795] [Bug #5380]
- * add iso-8859-1 external CES support. (#106)
+ * test/ruby/test_gc.rb (test_gc_parameter): add test for it.
- * fixed illegal 'qualified' handling of elements. it caused
- ASP.NET inteoperability problem. (#144)
+Sat Oct 8 06:26:24 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * added 'soap.envelope.use_numeric_character_reference' (boolean)
- option to let query XML use numeric character reference in XML,
- not plain UTF-8 character. !GoogleSearch server seems to not
- allow plain UTF-8 character since 2005-08-15 update. (#147)
+ * gc.c (add_heap_slots, init_heap): reset heaps_inc zero when
+ heap slots are expanded by environment variable RUBY_HEAP_MIN_SLOTS.
+ [ruby-core:39777] [Bug #5380]
- * SOAP::Header::SimpleHeader (de)serialization throws an exception
- on !SimpleHeader.on_(in|out)bound when header is a String. so we
- could not use a simple single element headerItem. fixed. thanks
- to emil. (#129)
+ * test/ruby/test_gc.rb (test_gc_parameter): add test for it.
- * out parameter of rpc operation did not work. (#132)
+ * test/ruby/envutil.rb (assert_normal_exit): add :child_env option to
+ enable pass environemnt variables to child process.
- * follow HTTP redirect only if using http-access2. (#125) (#145)
+Sat Oct 8 05:45:28 2011 Eric Hodel <drbrain@segment7.net>
- * add a workaround for importing an WSDL whose path begins with
- drive letter. (#115)
+ * proc.c (proc_call): Update documentation to match argument handling
+ of proc/Proc.new/lambda/->()
- * WSDL
+Sat Oct 8 05:38:29 2011 Eric Hodel <drbrain@segment7.net>
- * SOAP Data which is defined as a simpletype was not mapped
- correctly to Ruby obj when using wsdl2ruby.rb generated classdef
- file. (#123)
+ * proc.c (proc_call): Fix documentation of Proc#call vs Proc#===.
+ [Ruby 1.9 - Bug #5349]
- * rpc/literal support. (#118)
+Tue Sep 27 13:05:39 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * re-implemented local element qualify/unqualify control. handles
- elementFormDefault and form in WSDL. (#119)
+ * ext/openssl/ossl_asn1.c: fix int_ossl_asn1_decode0_cons when being
+ fed arbitrary string values.
+ Clearly distinguish between the cases "universal, infinite and
+ not a SEQUENCE or SET" and "universal SEQUENCE or SET, possibly
+ infinite". Raise error for universal tags that are not infinite.
+ * test/openssl/test_asn1.rb: add a test for this.
- * Array of an element which has simpleType causes a crash. (#128)
+ Thanks to Hiroshi Yoshida for reporting this bug.
+ [Bug #5363] [ruby-dev:44542]
- * prarmeterOrder may not contain return part so it can be shorter
- than parts size. Thanks to Hugh. (#139)
+Sat Sep 17 23:34:10 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * Samples
+ * parse.y (parser_data_type): inherit the core type in ripper so
+ that checks in core would work. [ruby-core:39591] [Bug #5331]
- * added !BasicAuth client sample. (#117)
+Fri Sep 23 14:15:01 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * added Base64 client/server sample.
+ * ext/openssl/ossl_asn1.c
+ ext/openssl/ossl_pkey.c: Remove unused variables.
- * added Flickr SOAP interface client sample. (#122)
+Fri Sep 23 06:54:44 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * added !SalesForce client sample. (#135)
+ * backport r33315 from trunk.
- * updated Thawte CA certificate for !GoogleAdWords sample.
+ * test/openssl/test_ssl_session.rb: execute test_session_exts_read
+ only for OpenSSL versions >= 0.9.8k. Thanks, Eric Wong, for
+ reporting this.
+ [Bug #4961] [ruby-core:37726]
- * updated a client script with the newer version made by Johan.
- thanks!
+Fri Sep 23 12:18:52 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * shortened long file names. (#120)
+ * backport r33311 from trunk.
- * fixed typo in authheader sample. (#129)
+ * test/openssl/test_ssl_session.rb: ensure server calls callbacks in
+ test_ctx_server_session_cb. Thanks to Eric Wong for the patch.
+ [Bug #5336] [ruby-core:39619]
- * updated deprecated method usage. (#138)
+Thu Sep 22 19:45:22 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Thu Sep 15 23:02:57 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * thread_pthread.c (ubf_select): activate timer thread when interrupt
+ blocking thread.
+ A patch created by Koichi Sasada. [ruby-core:39634] [Bug #5343]
+ to cover race condition, timer thread periodically send SIGVTARLM to
+ threads in signal thread list. so you should activate timer thread
+ when interrupt a thread.
- * win32/win32.h (rb_w32_stat): added prototype.
+Wed Sep 21 16:57:03 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Sep 15 22:35:55 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/io/wait/test_io_wait.rb (TestIOWait#setup): of course, the
+ behavior of mingw is just same with mswin.
- * test/ruby/test_signal.rb (test_exit_action): skip the test using
- fork on fork-less platforms.
+Sat Sep 17 22:21:26 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Sep 15 11:39:18 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * vm.c (rb_vm_make_env_object, rb_vm_get_sourceline): export as a
+ workaround for ruby-debug19 for the time being.
+ [ruby-core:38972] [Bug #5193]
- * ext/tk/lib/tk/dialog.rb: If a dialog does not show up yet,
- TkDialogObj#name raises an exception. [ruby-talk:156109]
+Fri Sep 16 01:08:19 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Sep 15 01:39:19 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * NEWS: cosmetic changes.
- * lib/rinda/tuplespace.rb (Rinda::TemplateEntry::initialize): pull
- up method. Tabs converted to spaces.
+Wed Sep 14 12:39:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Thu Sep 15 00:18:24 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * configure.in: do not use gcc-4.2 as the default compiler.
- * lib/net/telnet.rb (Net::Telnet::waitfor): replace sysread with
- readpartial. [ruby-talk:127641]
+ * NEWS: describe the issue about Xcode.
-Wed Sep 14 22:40:26 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Sep 14 11:46:30 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * dir.c (ruby_glob): glob function not using ruby exception system.
+ * thread.c (rb_fd_rcopy): added an argument guard.
+ Patch by NAKAMURA Usaku. [Bug #5306] [ruby-core:39435]
-Wed Sep 14 01:26:03 2005 Minero Aoki <aamine@loveruby.net>
+Tue Sep 13 09:28:58 2011 Koichi Sasada <ko1@atdot.net>
- * lib/net/https.rb: backported from trunk, rev 1.3.
- [ruby-dev:25673] (again), [ruby-dev:26617] (again),
- [ruby-dev:27062]
+ * NEWS: wrote about rb_reserved_fd_p() and objspace.
- * ext/openssl/lib/net/https.rb: removed.
+Mon Sep 12 20:47:52 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/lib/net/protocols.rb: removed.
+ * thread.c (rb_thread_select): fix a typo to initialize efds
+ properly. [Bug #5299] [ruby-core:39380]
- * lib/net/http.rb: #use_ssl?, #use_ssl are moved from net/https.
+Mon Sep 12 20:41:20 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Sep 13 22:09:40 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * thread.c (rb_thread_select): fix to ignore an argument
+ modification of rb_thread_fd_select().
+ based on a patch by Eric Wong. [Bug #5306] [ruby-core:39435]
+ * thread.c (rb_fd_rcopy): New. for reverse fd copy.
- * lib/logger.rb (Logger): added formatter accessor to logger for
- dictating the way in which the logger should format the messages it
- displays. Thanks to Nicholas Seckar (cf. [ruby-talk:153391]) and
- Daniel Berger.
+ * test/-ext-/old_thread_select/test_old_thread_select.rb
+ (test_old_select_false_positive): test for bug5306.
- * lib/logger.rb (Logger): added VERSION constant.
+ * ext/-test-/old_thread_select/old_thread_select.c (fdset2array):
+ New. convert fdsets to array.
+ * ext/-test-/old_thread_select/old_thread_select.c (old_thread_select):
+ return 'read', 'write', 'except' argument of rb_thread_select()
+ to ruby script.
- * lib/logger.rb: removed document for LogDevice. It is an
- implementation detail and is not a public interface.
+Tue Sep 6 13:15:44 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/logger/test_logger.rb: added tests.
+ * encoding.c (load_encoding): predefined encoding names are safe.
+ [ruby-dev:44469] [Bug #5279]
-Tue Sep 13 21:47:17 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * transcode.c (load_transcoder_entry): ditto.
- * eval.c (BEGIN_CALLARGS): pop halfly pushed status.
- fixed: [ruby-dev:26881]
+Fri Sep 9 16:02:04 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Sep 13 16:26:45 2005 Minero Aoki <aamine@loveruby.net>
+ * insns.def (concatstrings): don't use initial ASCII-8BIT string.
+ [ruby-core:38635] [Bug #5126]
- * lib/net/http.rb: backported from trunk, rev 1.128.
- [ruby-dev:25673] [ruby-dev:26617]
+Thu Sep 8 21:17:36 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/net/protocol.rb: backported from trunk, rev 1.78.
+ * ext/nkf/nkf-utf8/nkf.c: import nkf 2.1.2 (be9c280)
+ Bump version number/release date only.
- * lib/net/protocol.rb: new method #old_open to support net/smtp
- and net/pop.
+Wed Sep 7 23:42:45 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/smtp.rb: use #old_open.
+ * io.c (argf_next_argv): open in default text mode.
+ [ruby-core:39234] [Bug #5268]
- * lib/net/pop.rb: ditto.
+Mon Sep 5 15:06:55 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Sep 13 12:33:05 2005 why the lucky stiff <why@ruby-lang.org>
+ * test/rubygems/test_gem_security.rb
+ (test_class_build_self_signed_cert): reset opt[:trust_dir] to apply
+ temporary Gem.user_home.
- * lib/yaml.rb: reworking YAML::Stream to use the new
- emitter.
+Sun Sep 4 00:56:58 2011 Kazuki Tsujimoto <kazuki@callcc.net>
- * lib/yaml/stream.rb: ditto.
+ * backport r33177 from trunk.
- * lib/yaml/rubytypes.rb: added Object#yaml_new.
+ * test/ruby/test_fiber.rb (TestFiber#test_no_valid_cfp):
+ add a test. Unlike TestThread#test_no_valid_cfp,
+ this test succeeds even if win32ole is required (see r33153).
- * lib/yaml/tag.rb: the tag_subclasses? method now
- shows up in the class. allow taguri to be set using an accessor.
- continue support of Object#to_yaml_type.
+Fri Sep 2 21:11:16 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/syck/rubyext.c: new emitter code. yaml_new and yaml_initialize
- get called, should they be present. consolidated all the diaspora of internal
- node types into the family below YAML::Syck::Node -- Map,
- Seq, Scalar -- all of whom are SyckNode structs pointing to
- Ruby data. moved Object#yaml_new into the node_import and made it the
- default behavior. the target_class is always called wih yaml_new, prepended
- a parameter, which is the klass. loaded nodes through GenericResolver show their style.
- new Resolver#tagurize converts type ids to taguris.
+ * io.c (validate_enc_binmode, prep_stdio): default to text mode on
+ dosish platforms. [ruby-core:38822] [Bug #5164]
- * ext/syck/implicit.re: were 'y' and 'n' seriously omitted??
+ * transcode.c (rb_econv_prepare_options): keep default ecflags
+ unchanged if no options.
- * ext/syck/emitter.c: renovated emitter, walks the tree in advance.
- consolidated redundant block_styles struct into
- the scalar_style struct. (this means loaded nodes can now
- be sent back to emitter and preserve at least its very basic
- formatting.)
+Fri Sep 2 14:36:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/syck/gram.c: headless documents of any kind allowed.
+ * vm_insnhelper.c (vm_search_const_defined_class): search
+ ancestors only when global scope. [ruby-core:39227] [Bug #5264]
- * ext/syck/node.c: new syck_replace_str methods and syck_empty_*
- methods for rewriting node contents, while keeping the ID
- and other setup info. added syck_seq_assign.
+Fri Sep 2 09:58:08 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/syck/syck.h: reflect block_styles and new node functions.
+ * parse.y (parser_tokadd_string, parser_yylex): ignore a backslash
+ which prefixes an non-ascii character, which has no escape
+ syntax. [ruby-core:39222] [Ruby 1.9 - Bug #5262]
-Mon Sep 12 20:53:06 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Thu Sep 1 17:31:22 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/openssl/test_pkcs7.rb (test_enveloped): skip this test
- to avoid a bug of PKCS7_enctypt() (only if ext/openssl is
- compiled with OpenSSL-0.9.7d or earlier versions).
- http://www.mail-archive.com/openssl-dev@openssl.org/msg17376.html
+ * insns.def (defineclass), vm_insnhelper.c (vm_get_cvar_base): see
+ also inherited constants for classes without superclass and
+ modules. [ruby-core:37698] [Bug #3423]
-Mon Sep 12 14:03:33 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Sep 1 14:11:16 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/dbm/test_dbm.rb: remove locking test, which may not be
- supported on some platforms. [ruby-dev:27030]
+ * test/ruby/test_thread.rb (TestThread#test_no_valid_cfp): skip when
+ win32ole is required. in such case, win32ole redefines
+ Thread#initialize, and the block argument becomes to be not the top
+ of the thread, then this testcase always fails.
-Mon Sep 12 10:45:58 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Aug 31 16:02:45 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/dl/dl.c (rb_io_to_ptr): merged a patch for DragonFly BSD
- from Takahiro Kambe <taca at back-street.net>. [ruby-dev:27023]
+ * ext/json: Merge json gem v1.5.4 (3dab4c5a6a97fac03dac).
-Sun Sep 11 22:05:51 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Wed Aug 31 13:19:31 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * bin/erb (ERB::Main#run): set ERB#filename so that it is used
- when reporting syntax/runtime errors. Tabs converted to spaces.
+ * numeric.c (flo_round): Avoid overflow by optimizing for trivial
+ cases
+ [Bug #5227]
-Sat Sep 10 10:17:03 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Wed Aug 31 06:45:32 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/openssl/ossl_engine.c (ossl_engine_s_by_id):
- OpenSSL::Engine.by_id calls given block before calling
- ENGINE_init (block parameter is the return value of this method
- itself). this functionality is useful to load dynamic shared
- engines. the following code is a sample of loading a key using
- OpenSC PKCS #11 module.
+ * configure.in: fix r32835. $withval can't be used outer AC_ARG_WITH().
- require "openssl"
- pkcs11 = OpenSSL::Engine.by_id("dynamic"){|e|
- e.ctrl_cmd("SO_PATH", "/usr/lib/opensc/engine_pkcs11.so")
- e.ctrl_cmd("LIST_ADD", "1")
- e.ctrl_cmd("LOAD")
- }
- pkcs11.ctrl_cmd("PIN", "secret")
- key = pkcs11.load_private_key
+Wed Aug 31 05:29:03 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/openssl/ossl_engine.c (ossl_engine_ctrl_cmd): new method
- OpenSSL::Engine#ctrl_cmd. it wraps ENGINE_ctrl_cmd_string.
+ * win32/win32.c (rb_w32_select_with_thread): and my typo. we all must
+ be more careful.
- * ext/openssl/ossl_engine.c (ossl_engine_get_cmds): new method
- OpenSSL::Engine#cmds. it returms engine command definitions.
+Wed Aug 31 05:28:45 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Sep 10 10:09:47 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * thread.c (rb_thread_select): critical typo in r33117.
- * ext/openssl/ossl_asn1.c (asn1str_to_str): new function.
+Wed Aug 31 05:28:26 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/openssl/ossl_pkcs7.c: new class OpenSSL::PKCS7::RecipientInfo.
- this class wraps PKCS7_RECIP_INFO struct.
+ * test/-ext-/old_thread_select/test_old_thread_select.rb
+ (TestOldThreadSelect#test_old_select_read_timeout): if the machine
+ is fast enough, the time used by code around IO.select may be smaller
+ than Time implement threshold.
- * ext/openssl/ossl_pkcs7.c: OpenSSL::PKCS7::Signer is renamed to
- OpenSSL::PKCS7::SignerInfo. ("Signer" remains as an alias of
- SignerInfo.)
+Wed Aug 31 05:27:59 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/openssl/test_pkcs7.rb: new file.
+ * ext/-test-/old_thread_select/old_thread_select.c (old_thread_select):
+ typo.
-Sat Sep 10 10:05:51 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * test/-ext-/old_thread_select/test_old_thread_select.rb
+ (TestOldThreadSelect#test_old_select_signal_safe): use SIGINT instead
+ of SIGUSR1 because the former is general and the latter is platform
+ dependent.
- * ext/openssl/ossl_ns_spki.c (ossl_spki_initialize): assume that
- the argument is a DER string if Base64 decoding failed.
+Wed Aug 31 05:26:30 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/openssl/ossl_ns_pki.c (ossl_spki_to_der): new method.
+ * win32/win32.c, include/ruby/intern.h (rb_w32_fd_copy): implement
+ for rb_thread_select() in thread.c. the use of rb_fd_copy() is
+ introduced in r33117.
+ [Bug #5229] [ruby-core:39102]
- * test/openssl/test_ns_spki.rb: add new file.
+ * thread.c (rb_thread_select): must call rb_fd_init() before using
+ rb_fdset_t. see the implementations of rb_fd_init()s if you want to
+ know the reason.
-Sat Sep 10 09:56:24 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Tue Aug 30 11:25:21 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/openssl/lib/digest.rb: added SHA224, SHA256, SHA384 and SHA512.
- these features are enabled if this library is compiled with
- OpenSSL 0.9.8 or later.
+ * ext/json: Merge json gem 1.5.4+ (2149f4185c598fb97db1).
+ [Bug #5173] [ruby-core:38866]
- * test/openssl/test_digest.rb: add test for new digests.
+Tue Aug 30 09:53:59 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sat Sep 10 09:51:30 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * cont.c (fiber_entry): fix stack allocation failure on Debian
+ GNU/kFreeBSD.
+ Patch by Lucas Nussbaum <lucas at lucas-nussbaum dot net>.
+ [Bug #5241] [ruby-core:39147]
- * ext/openssl/ossl.c (ossl_raise): should use ERR_peek_last_error
- to get last error on the current thread. And should report
- errors on the stack while OpenSSL.debug is true.
+Tue Aug 30 09:52:29 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/openssl/ossl.c (ossl_get_errors): new method for debugging
- this library.
+ * backport r33117 from trunk.
- * ext/openssl/ossl_ssl.c (ossl_sslctx_set_ciphers): fix error message.
+ * thread.c (rb_thread_select): rewrite by using
+ rb_thread_fd_select(). old one is EINTR unsafe.
+ Patch by Eric Wong. [Bug #5229] [ruby-core:39102]
- * ext/openssl/ossl_x509req.c (ossl_x509req_set_attributes): get rid
- of unused variable.
+ * test/-ext-/old_thread_select/test_old_thread_select.rb:
+ a testcase for rb_thread_select().
+ * ext/-test-/old_thread_select/old_thread_select.c: ditto.
+ * ext/-test-/old_thread_select/depend: ditto.
+ * ext/-test-/old_thread_select/extconf.rb: ditto.
- * ext/openssl/ossl_x509store.c (ossl_x509store_initialize): should
- set @time to avoid warning.
+Tue Aug 30 09:16:17 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/openssl/ossl_x509store.c (ossl_x509store_set_default_paths,
- X509_STORE_add_cert, X509_STORE_add_crl): should raise error if
- wrapped functions failed.
+ * configure.in: fix a build failure on GNU Hurd.
+ Patch by Samuel Thibault <sthibault at debian dot org>. Thank you!
+ [Bug #5250] [ruby-core:39185]
- * test/openssl/test_x509store.rb: add test for errors.
+Sun Aug 28 15:38:17 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Fri Sep 9 22:13:19 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * backport r33106 from trunk.
- * eval.c (rb_call0): prohibit calling tainted method (>2) when
- $SAFE == 0.
+ * ext/date/date_parse.c (date_zone_to_diff): keep a temporary string
+ stored in variable while the contents buffer is beeing used.
-Fri Sep 9 16:45:25 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/date/date_parse.c (date_zone_to_diff): get rid of out of bounds
+ memory read. [ruby-dev:44409] [Bug #5213]
- * string.c (rb_str_times): make empty strings to keep taintness,
- and a little improvement. [ruby-dev:26900]
+Sun Aug 28 05:29:50 2011 Ryan Davis <ryand-ruby@zenspider.com>
- * ext/iconv/iconv.c (iconv_try), ext/iconv/extconf.rb: get rid of meta
- characters in command line option. fixed: [ruby-talk:155369]
+ * backport r33102 from trunk.
-Thu Sep 8 14:58:11 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/minitest/*: Imported minitest 2.5.1 (r6596)
+ * test/minitest/*: ditto
- * merged a patch from Takahiro Kambe <taca at back-street.net> to
- support DragonFly BSD. [ruby-dev:26984]
+Sat Aug 27 20:54:54 2011 Kazuki Tsujimoto <kazuki@callcc.net>
-Wed Sep 7 12:55:08 2005 Tanaka Akira <akr@m17n.org>
+ * backport r33099 from trunk.
- * lib/open-uri.rb: abolish mod === tempfile to avoid a problem
- [ruby-dev:26967].
+ * vm.c (rb_vm_rewrite_dfp_in_errinfo): change return type
+ to suppress a warning.
-Wed Sep 7 10:45:15 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vm_core.h: ditto.
- * eval.c (rb_thread_switch): convert all exceptions to
- SystemExit. fixed: [ruby-core:05724]
+Sat Aug 27 19:03:44 2011 Kazuki Tsujimoto <kazuki@callcc.net>
- * eval.c (rb_thread_terminated): show backtrace before propagate
- exceptions to main thread.
+ * backport r33096 from trunk.
-Wed Sep 7 08:35:04 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * proc.c (proc_new): force to rewrite errinfo when calling Proc.new in ensure.
+ [Bug #5234] [ruby-core:39125]
- * Makefile.in, configure.in (MINIOBJS): miniruby on HP-UX can not load
- extension libraries.
+ * vm.c (rb_vm_rewrite_dfp_in_errinfo): new function.
- * bignum.c (bignew_1, bigadd): K&R style argument actually can't be
- defined as char.
+ * vm.c (vm_make_env_each): changed accordingly.
- * missing/vsnprintf.c: ANSI compiler supports const keyword.
+ * vm_core.h: ditto.
- * ext/digest/sha2/extconf.rb: reject platforms which has inttypes.h
- but no 64bit integer.
+ * bootstraptest/test_flow.rb: add tests for above.
- * lib/mkmf.rb (what_type?): guesstimate type.
+Sat Aug 27 08:59:12 2011 Eric Hodel <drbrain@segment7.net>
- * ext/etc/etc.c (setup_passwd), ext/etc/extconf.rb: pw_age might be
- char*. fixed: [ruby-core:05470]
+ * NEWS: Update version of rake to 0.9.2.2.
-Wed Sep 7 08:32:47 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat Aug 27 08:44:58 2011 Eric Hodel <drbrain@segment7.net>
- * object.c (rb_mod_cvar_get, rb_mod_cvar_set): document fix from
- sheepman <sheepman@sheepman.sakura.ne.jp>; a bug in visibility
- description. [ruby-dev:26965]
+ * backport r33087 from trunk
- * sprintf.c (rb_f_sprintf): warn "too many argument" on verbose
- mode (-v/-w); backported from 1.9. [ruby-dev:26963]
+ * lib/rdoc: Import RDoc 3.9.4. Typo and grammar fixes by Luke Gruber.
+ [Ruby 1.9 - Bug #5203]
-Mon Sep 5 17:03:07 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat Aug 27 07:53:34 2011 Eric Hodel <drbrain@segment7.net>
- * lib/ostruct.rb: a patch from Florian Gross <florgro at gmail.com>
- merged to allow recursive inspect (and to_s) for OpenStruct.
- [ruby-core:05532]
+ * backport r33087 from trunk.
-Mon Sep 5 07:01:12 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * lib/open-uri.rb: Fix indentation of OpenURI::OpenRead#open. Use ++
+ instead of `' for method arguments in open-uri.rb
- * ext/openssl/openssl/lib/openssl/buffering.rb (Buffering#do_write):
- should clear data from the buffer which already been output.
+Sat Aug 27 07:22:07 2011 Eric Hodel <drbrain@segment7.net>
-Fri Sep 2 23:51:54 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * backport r33086 from trunk.
- * lib: do not use __send__ to access private methods. [ruby-dev:26935]
+ * ext/pathname/lib/pathname.rb: Fix typos and grammar mistakes. Patch
+ by Luke Gruber. [#5203]
+ * ext/pty/lib/expect.rb: ditto
+ * lib/mathn.rb: ditto
+ * lib/net/http.rb: ditto
+ * lib/open-uri.rb: ditto
+ * lib/ostruct.rb: ditto
+ * lib/tempfile.rb: ditto
+ * lib/thread.rb: ditto
+ * lib/weakref.rb: ditto
+ * sample/webrick/httpproxy.rb: ditto
-Fri Sep 2 03:29:00 2005 Keiju Ishitsuka <keiju@ruby-lang.org>
+Fri Aug 26 10:10:37 2011 Eric Hodel <drbrain@segment7.net>
- * lib/irb/init.rb: make IRB -I option that is same befavior for ruby.
- [ruby-dev:26872], [ruby-dev: 26920]
+ * backport r33074 from trunk.
- * lib/irb/locale.rb: support to print help message when OS locale is
- ja_JP.utf-8. [ruby-dev:26872]
+ * lib/rubygems: Update to RubyGems 1.8.10. Fixes security issue in
+ creating ruby-format gemspecs. Fixes Gem.dir not being at the front
+ of Gem.path to fix uninstall and cleanup commands. Fixes gem
+ uninstall stopping on the first missing gem.
-Thu Sep 1 17:11:25 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Aug 24 09:49:10 2011 Koichi Sasada <ko1@atdot.net>
- * eval.c (rb_call0): wrong condition for $SAFE restoration.
+ * backport r33045 from trunk.
-Thu Sep 1 14:12:45 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * insns.def (defined): fix to checking class variable.
+ A patch by Magnus Holm <judofyr@gmail.com>. Thanks!
- * ext/tk/lib/multi-tk.rb: On Tcl8.5, MultiTkIp#invoke_hidden doesn't
- work (gives wrong order of arguments).
+Fri Aug 26 08:21:10 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/tk/lib/multi-tk.rb: add MultiTkIp#invoke_hidden_on_namespace
- to support '-namespace' option of 'interp invokehidden' command
- on Tcl8.5.
+ * test/ruby/test_variable.rb: add a test for above.
-Wed Aug 31 14:43:15 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Aug 25 09:43:16 2011 Eric Hodel <drbrain@segment7.net>
- * win32/Makefile.sub (OPTFLAGS): default global optimization to
- disabled for all VC++ versions. fixed: [ruby-dev:26897]
+ * backport r33066 from trunk.
-Wed Aug 31 11:35:43 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/openssl/lib/openssl/bn.rb: Hide copyright info from RDoc.
+ * ext/openssl/lib/openssl/digest.rb: ditto
+ * ext/openssl/lib/openssl/cipher.rb: ditto
- * test/gdbm/test_gdbm.rb (teardown): should remove GDBM temporary
- file.
+Thu Aug 25 09:25:48 2011 Eric Hodel <drbrain@segment7.net>
-Wed Aug 31 10:30:56 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * backport r33065 from trunk.
- * process.c (proc_detach, proc_setmaxgroups): missing argument type
- declaration. (I recommend ANSI-style function)
+ * ext/openssl/ossl_digest.c: Document OpenSSL::Digest::digest and add
+ an example to OpenSSL::Digest. Patch by Sylvain Daubert.
+ [Ruby 1.9 - Bug #5166]
+ * ext/openssl/lib/openssl/digest.rb (module OpenSSL): ditto
-Tue Aug 30 23:20:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Aug 25 08:19:43 2011 Koichi Sasada <ko1@atdot.net>
- * eval.c (rb_rescue2): initialization miss. fixed: [ruby-dev:26917]
+ * vm.c (vm_make_env_each): work around to solve Bug #2729.
+ fixes: Bug #2729
+ a patch from Kazuki Tsujimoto <kazuki@callcc.net>
+ This problem is caused by changing dfp (dynamic env pointer)
+ from saved dfp. Saved dfp is pointed env in VM stack. However,
+ the dfp can be moved because VM copies env from VM stack to
+ the heap. At this copying, dfp was also changed. To solve this
+ problem, I'll try to change throw mechanism (not save target dfp,
+ but save target cfp).
- * lib/mkmf.rb (xsystem, xpopen): no longer expand by Config.
+ * bootstraptest/test_flow.rb: add a test for above.
- * lib/mkmf.rb (link_command, cc_command, cpp_command): expand
- variables at once, and quote hdrdir. fixed: [ruby-core:05680]
+Thu Aug 25 08:04:08 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * lib/mkmf.rb (libpathflag): quote paths.
+ * numeric.c (int_round): Fix Integer#round [ruby-core:39096]
-Tue Aug 30 19:34:27 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Thu Aug 25 06:51:08 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/digest/md5/md5ossl.h, ext/digest/rmd160/rmd160ossl.h,
- ext/digest/sha1/sha1ossl.h: include <stddef.h> to avoid
- error in compilation with OpenSSL-0.9.8. [ruby-list:41068]
+ * ext/psych/lib/psych.rb: Fixing psych version number.
-Mon Aug 29 19:54:21 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Thu Aug 25 06:11:35 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/rdoc/usage.rb: improper exceptions. [ruby-dev:26870]
+ * ext/psych/lib/psych/nodes/node.rb: default `to_yaml` encoding to be
+ UTF-8.
+ * test/psych/test_encoding.rb: test yaml dump encoding.
- * lib/rdoc/usage.rb: support the case when non-ruby code exists before
- shebang. (this is needed when ri.bat is executed on windows)
+Wed Aug 24 08:53:06 2011 Eric Hodel <drbrain@segment7.net>
-Mon Aug 29 17:48:17 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * backport r33043 from trunk.
- * eval.c (method_arity): should return proper arity value.
- [ruby-dev:26390]
+ * lib/rdoc: Update to RDoc 3.9.3. Fixes RDoc with `ruby -Ku`. Allows
+ HTTPS image paths to be turned into <img> tags. Prevents special
+ markup inside <tt> from being processed.
-Mon Aug 29 01:19:57 2005 Tanaka Akira <akr@m17n.org>
+Wed Aug 24 07:57:43 2011 Eric Hodel <drbrain@segment7.net>
- * lib/time.rb (Time.parse): extract fractional seconds using
- Date._parse. [ruby-talk:153859]
+ * backport r33040 from trunk.
-Sat Aug 27 20:20:01 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * lib/rubygems: Update to RubyGems 1.8.9. Fixes uninstalling multiple
+ gems and gem cleanup.
- * ext/curses/curses.c ({curses,window}_clrtoeol): added. suggested
- by Reyn Vlietstra.
+Wed Aug 24 06:45:20 2011 Ryan Davis <ryand-ruby@zenspider.com>
- * ext/curses/curses.c: chtype in curses is not `char', rahter `long'.
- [ruby-Bugs:2298]
+ * backport r33036 from trunk.
- * ext/curses/view.rb: String =~ String is deprecated.
+ * lib/minitest/*: Imported minitest 2.5.0 (r6557)
+ * test/minitest/*: ditto
-Wed Aug 24 10:53:28 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Aug 23 15:23:56 2011 Eric Hodel <drbrain@segment7.net>
- * test/logger/test_logger.rb (test_shifting_size): should close log
- device before unlink, since some platform cannot unlink opened
- file.
+ * backport r33027 from trunk.
-Sun Aug 21 00:13:27 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * load.c (rb_f_require): Improve documentation of Kernel#require.
+ [Ruby 1.9 - Bug #5210]
- * lib/wsdl/xmlSchema/importer.rb (WSDL::XMLSchema::Importer#fetch): add
- a workaround for importing an WSDL whose path begins with drive
- letter. [ruby-dev:26242]
+Tue Aug 23 15:11:48 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Sat Aug 20 22:37:13 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * backport r33023 from trunk.
- * lib/logger.rb (write, shift_log?, shift_log): file shifting race
- condition bug fixed. [ruby-dev:26764]
+ * ext/zlib/zlib.c (gzfile_read_header): Ensure that each section of
+ gzip header is readable to avoid SEGV.
- * test/logger/test_logger.rb: tests.
+ * test/zlib/test_zlib.rb (test_corrupted_header): Test it.
-Fri Aug 19 18:13:39 2005 Tanaka Akira <akr@m17n.org>
+Mon Aug 22 23:43:33 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * lib/time.rb (Time.apply_offset): fix a problem with last day of
- month. reported by Lucas Nussbaum. [ruby-talk:152866]
+ * backport r33021 from trunk.
-Thu Aug 18 12:46:28 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * sprintf.c (rb_str_format): add RB_GC_GUARD to prevent temporary
+ strings from GC.
- * bcc32/Makefile.sub (COMMON_HEADERS): reverted 1.42.2.24.
- I misunderstood, bccwin32 on ruby_1_8 uses winsock2 originally.
- [ruby-dev:26806]
+Sun Aug 21 17:58:38 2011 Kazuki Tsujimoto <kazuki@callcc.net>
- * win32/win32.h: include winsock2.h instead of winsock.h. (bcc32)
+ * backport r33019 from trunk.
-Wed Aug 17 23:58:05 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * iseq.c (iseq_s_disasm): remove variable which is no longer used
+ since r33013.
- * object.c (rb_to_integer): argument constified.
+Sun Aug 21 14:20:58 2011 Naohisa Goto <ngotogenome@gmail.com>
- * eval.c (terminate_process): take String message.
+ * configure.in: use LD_LIBRARY_PATH_64 on 64-bit Solaris.
- * eval.c (rb_thread_switch): propagate the exception caused thread
- termination directly. fixed: [ruby-core:05552]
+Sun Aug 21 11:13:54 2011 Naohisa Goto <ngotogenome@gmail.com>
-Wed Aug 17 00:05:46 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * backport r32895 from trunk.
- * eval.c (rb_add_method): preserve safe level in the environment
- where a method is defined .
+ * ext/fiddle/conversions.c (generic_to_value): ffi_arg and ffi_sarg
+ should be used to handle shorter return value. fix [Bug #3861]
+ [ruby-core:32504]
- * eval.c (rb_call0): restore preserved safe level in the method
- execution.
+ * ext/fiddle/closure.c (callback): ditto
-Mon Aug 15 00:38:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/fiddle/conversions.h (fiddle_generic): ditto
- * eval.c (rb_rescue2): reduce PUSH_TAG() as well as NODE_RESCUE.
- [ruby-dev:26800]
+ * ext/fiddle/conversions.c (value_to_generic): char, short and int
+ are strictly distinguished on big-endian CPU, e.g. sparc64.
- * range.c (range_check, range_init): reduce useless exceptions.
+Sat Aug 20 13:28:32 2011 Kazuki Tsujimoto <kazuki@callcc.net>
-Sat Aug 13 18:51:26 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * backport r33013 from trunk.
- * eval.c (rb_block_pass): distinguish current block from others.
- fixed: [ruby-dev:26274]
+ * iseq.c (iseq_s_disasm): fix a bug that may cause SEGV.
- * ext/stringio/stringio.c (strio_set_string): disallow nil.
- http://www.rubyist.net/~nobu/t/20050811.html#c05
+ * test/ruby/test_method.rb (test_body): add a test for the above change.
-Thu Aug 11 23:29:03 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Aug 20 10:43:24 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/stringio/stringio.c: keep holding string after closed.
+ * ext/stringio/stringio.c (strio_read): return new string if nil
+ is explicitly given as a buffer ([Bug #5207]), otherwise set the
+ encoding. also removed dead code.
-Thu Aug 11 13:01:48 2005 Kouhei Sutou <kou@cozmixng.org>
+Fri Aug 19 14:25:51 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rss: fixed sort bug. [ruby-list:41018]
+ * process.c (proc_spawn_v, proc_spawn): should not wait the
+ spawned process.
- * lib/rss/1.0.rb (RSS::RDF::Channel#setup_maker_attributes):
- removed self.
+ * process.c (proc_spawn_v): fix missing argument, and try with
+ /bin/sh only if failed with ENOEXEC.
- * lib/rss/maker/base.rb (RSS::Maker::ItemsBase#<=>): use #date
- instead of @date.
- (RSS::Maker::Base::self.def_array_element): added #size.
+Fri Aug 19 14:12:57 2011 Shugo Maeda <shugo@ruby-lang.org>
- * lib/rss/maker/1.0.rb
- (RSS::Maker::RSS10::Channel#to_rss,
- RSS::Maker::RSS10::Items::Item#to_rss): cleared dc_dates set
- upped by using #date.
+ * backport r33007 from trunk.
- * lib/rss/maker/dublincore.rb
- (RSS::Maker::ChannelBase, RSS::Maker::ItemsBase::ItemBase):
- fixed opposite alias.
+ * lib/net/imap.rb (idle): raises a Net::IMAP::Error when the
+ connection is closed. based on the patch by Hugo Barauna.
+ [Bug #5190] [ruby-core:38930]
- * test/rss/test_setup_maker_1.0.rb
- (RSS::TestSetupMaker10::test_setup_maker_items_sort): added some
- tests for RSS::Maker::ItemsBase#do_sort.
+Fri Aug 19 11:28:58 2011 Shugo Maeda <shugo@ruby-lang.org>
-Wed Aug 10 10:29:40 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * backport r33001 from trunk.
- * ext/tk/lib/tk.rb: fix bug on handling __ruby2val_optkeys().
+ * lib/net/imap.rb (msg_att): accepts extra space before ')'.
+ based on the patch by art lussos. [Bug #5163] [ruby-core:38820]
- * ext/tk/lib/tk/itemconfig.rb: fix bug on handling
- __item_ruby2val_optkeys().
+Wed Aug 17 15:27:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * ext/tk/lib/tk/canvas.rb: didn't check __item_ruby2val_optkeys().
+ * backport r32996 from trunk.
- * ext/tk/lib/tkextlib/blt/component.rb: ditto.
+ * ext/bigdecimal/bigdecimal.c (cannot_be_coerced_into_BigDecimal):
+ add a new function for raising error when an object cannot coerce
+ into BigDecimal. [Bug #5172]
-Tue Aug 9 15:12:04 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/bigdecimal/bigdecimal.c (BigDecimalValueWithPrec): use
+ cannot_be_coerced_into_BigDecimal function.
- * ext/tcltklib/tcltklib.c: remove dangerous 'rb_jump_tag's.
+ * ext/bigdecimal/bigdecimal.c (BigMath_s_exp): ditto.
- * ext/tk/lib/tk.rb: add __val2ruby_optkeys and __ruby2val_optkeys to
- help to convert option values between ruby and tcl.
+ * ext/bigdecimal/bigdecimal.c (BigMath_s_log): ditto.
- * ext/tk/lib/tk/itemconfig.rb: add __item_val2ruby_optkeys and
- __item_ruby2val_optkeys to help to convert option values between
- ruby and tcl.
+ * test/bigdecimal/test_bigdecimal.rb: test for the avobe changes.
- * ext/tk/lib/tk/radiobutton.rb: use __ruby2val_optkeys for 'variable'
- option (for the reason of backward compatibility).
+ * test/bigdecimal/testbase.rb (under_gc_stress): add a new utility
+ method to run tests under the condition of GC.stress = true.
- * ext/tk/lib/tk/composite.rb: clarify the arguments of super().
+Wed Aug 17 10:16:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * ext/tk/lib/tk/spinbox.rb: ditto.
+ * backport r32994 from trunk.
- * ext/tk/lib/tk/text.rb: ditto.
+ * rational.c (nurat_coerce): Rational#coerce should converts itself
+ into Complex if the argument is a Complex with non-zero imaginary
+ part. [Bug #5020] [ruby-dev:44088]
- * ext/tk/lib/tk/validation.rb: ditto.
+ * test/ruby/test_rational.rb (test_coerce): test for the above change.
- * ext/tk/lib/tkextlib/*: support to treat tkvariable-type
- configure options.
+Wed Aug 17 06:33:19 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Tue Aug 9 20:30:19 2005 Tadashi Saito <shiba@mail2.accsnet.ne.jp>
+ * backport r32992 from trunk.
- * bignum.c (rb_big_coerce): allow bignum x bignum coercing.
- [ruby-dev:26778]
+ * ext/openssl/ossl_x509cert.c: Add class documentation for
+ OpenSSL::X509::Certificate.
-Mon Aug 8 20:43:02 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Wed Aug 17 05:02:25 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * test/ruby/test_method.rb: added. [ruby-dev:26761]
+ * backport r32987 from trunk.
-Sun Aug 7 23:50:14 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/openssl/ossl_pkey.c: corrected docs, OpenSSL::PKey::DH does
+ *not* support #sign/verify.
- * test/ruby/test_super.rb: added from HEAD. [ruby-dev:26743]
+Tue Aug 16 18:56:54 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Aug 7 01:31:15 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * vm.c (ruby_threadptr_data_type): rename to hide.
+ [ruby-core:38972]
- * ext/win32ole/win32ole.c (WIN32OLE_EVENT#on_event): should set
- only one event handler.
+Tue Aug 16 18:52:08 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/win32ole/tests/testOLEEVENT.rb: ditto.
+ * win32/mkexports.rb (Exports::Mswin#each_export): exclude Init_
+ and _threadptr_ functions, as well as mingw.
- * ext/win32ole/tests/testOLEPARAM.rb: remove re-defined
- test_ole_type_detail method.
+Tue Aug 16 09:38:37 2011 Eric Hodel <drbrain@segment7.net>
-Sat Aug 6 12:35:24 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * backport r32981 and r32982 from trunk.
- * ext/tk/lib/{tk.rb,tk/itemconfig.rb}: configure creates
- TkVariable if key name is 'variable' or 'textvariable'
- by default. [ruby-dev:26749]
+ * ext/dl: Add documentation. Patch by Vincent Batts.
+ [Ruby 1.9 - Bug #5192]
- * ext/tk/lib/tk/{label,radiobutton}.rb: removed its own
- {variable,textvariable} function.
+ * ext/.document (fiddle): Remove duplicate entry
- * ext/tk/lib/tk/variable.rb: retains backward conpatibility.
+ * ext/fiddle: Complete documentation of Fiddle. Patch by Vincent
+ Batts. [#5192]
-Fri Aug 5 12:50:32 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Tue Aug 16 08:00:15 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tcltklib/tcltklib.c: fixed memory leak when tk_funcall raised
- exception. (copies argv into heap in tk_funcall instead of
- caller)
+ * backport r32977 from trunk
-Fri Aug 5 12:42:57 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/socket: Make Socket documentation appear. Add documentation for
+ Socket, TCPServer, SOCKSSocket. Patch by Sylvain Daubert.
+ [Ruby 1.9 - Feature #5182]
- * lib/mkmf.rb (create_makefile): need to convert path separetor
- before invoking install command.
+Mon Aug 15 10:16:55 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * backport r32973 from trunk.
-Fri Aug 5 00:27:04 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * ext/openssl/ossl_ssl.c: Support disabling OpenSSL compression.
- * ext/tcltklib/tcltklib.c: refactoring - extract ruby string <->
- tcl object conversion as get_str_from_obj and get_obj_from_str.
+ * test/openssl/test_ssl.rb: Add a test for it.
+ Thanks to Eric Wong for the patch.
+ [Ruby 1.9 - Feature #5183] [ruby-core:38911]
-Fri Aug 5 00:19:33 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Aug 13 22:17:27 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * extmk.rb (extmake): needs to be wrapped in an Array.
+ * tool/mkconfig.rb: do not make the entries related to sitedir and
+ verdordir if disabled by --without options. [ruby-core:38922]
+ [Bug #5187]
-Thu Aug 4 18:38:36 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sat Aug 13 17:06:57 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tcltklib/tcltklib.c: cannot compile for Tcl7.6/Tk4.2.
+ * ext/date/date_core.c: [ruby-core:38861]
- * ext/tcltklib/tcltklib.c: add nativethread consistency check.
+Sat Aug 13 16:59:51 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tcltklib/stubs.c: ditto.
+ * test/date/test_*.rb: added tests.
- * ext/tk/lib/tk.rb: forgot to define TclTkIp.encoding and encoding=
- when Tcl is 7.6 or 8.0.
+Sat Aug 13 09:36:19 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * ext/tk/lib/tk/wm.rb: support to make some methods as options of
- root or toplevel widget. [ruby-talk:150336]
+ * ext/date/date_parse.c (parse_ddd_cb): fix r32896. RB_GC_GUARD
+ insertion position was mistaken. [ruby-dev:44337] [Bug #5152]
- * ext/tk/lib/tk/root.rb: ditto.
+Sat Aug 13 09:26:24 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/tk/lib/tk/toplevel.rb: ditto.
+ * ext/psych/lib/psych/core_ext.rb: Make Kernel#y private.
+ [ruby-core:38913]
- * ext/tk/lib/tkextlib/SUPPRT_STATUS: update RELEASE_DATE
+ * test/psych/test_yaml.rb: corresponding test.
-Thu Aug 4 08:03:39 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Aug 13 09:15:16 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/extmk.rb (extmake): should not modify $mflags for each
- extentions.
+ * ext/date/date_core.c (date_strftime_alloc): followed the change
+ of r32885.
-Thu Aug 4 00:25:48 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * NEWS: followed the above change.
- * common.mk, Makefile.in, {bcc32,win32,wince}/Makefile.sub: integrated
- macro definitions.
+Sat Aug 13 08:49:05 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * bcc32/Makefile.sub: LIBRUBY_SO should use DLDOBJS, not EXTOBJS.
+ * ext/date/date_core.c: [ruby-core:38855].
- * {win32,wince}/Makefile.sub: separate config.h for compiler versions.
+Sat Aug 13 03:41:37 2011 Eric Hodel <drbrain@segment7.net>
-Wed Aug 3 21:59:16 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * backport r32953 from trunk.
- * ext/tk/lib/tk/variable.rb: TkVariable#trace didn't work on
- TkVariable retrived from TkVariable.new_hash.ref. [ruby-dev:26721]
+ * lib/uri/common.rb: Fix documentation of URI::Parser.new. Patch by
+ Steve Klabnik. [Ruby 1.9 - Bug #5177]
-Wed Aug 3 08:22:13 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat Aug 13 02:19:57 2011 Eric Hodel <drbrain@segment7.net>
- * ext/socket/socket.c (ruby_connect): revert [ruby-talk:111654]
- changes at 2004-09-07. [ruby-dev:26656]
+ * backport r32950 from trunk.
-Tue Aug 2 10:20:54 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * ext/digest/digest.c: Add documentation for the Digest module. Patch
+ by Sylvain Daubert. [Ruby 1.9 - Bug #5167]
- * ext/tcltklib/tcltklib.c: use Tcl_[GS]etVar2Ex instead of
- Tcl_Obj[GS]etVar2. (avoid Tcl_NewStringObj on supported platforms)
+Fri Aug 5 13:32:43 2011 Shugo Maeda <shugo@ruby-lang.org>
- * ext/tcltklib/tcltklib.c: use ip_{get,set,unset}_variable2_core from
- ip_{get,set,unset}_variable.
+ * backport r32856 from trunk.
- * ext/tcltklib/tcltklib.c: replaced Tcl_Panic with rb_bug.
+ * lib/xmlrpc/client.rb, lib/xmlrpc/server.rb: should use
+ String#bytesize instead of String#size.
-Tue Aug 2 01:41:28 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Fri Aug 12 13:53:03 2011 Narihiro Nakamura <narihiro@netlab.jp>
- * lib/ping.rb (Ping.pingecho): should rescue StandardError.
- [ruby-dev:26677]
+ * backport r32894 from trunk.
-Mon Aug 1 19:09:41 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * gc.c (gc_lazy_sweep): if sweep target slots are not found, we
+ try heap_increment() because it might be able to expand the
+ heap. [Bug #5127] [ruby-dev:44285]
- * ext/tcltklib/tcltklib.c: refactoring - replaced rb_ivar_defined &
- rb_ivar_get with single rb_attr_get call.
+ * gc.c (gc_clear_mark_on_sweep_slots): if a sweeping was
+ interrupted, we expand the heap if at all possible.
-Mon Aug 1 18:45:07 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Fri Aug 12 12:28:17 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tcltklib/tcltklib.c (Tcl_GetStringResult): refactoring - define
- alternative macro on Tcl7.x or earlier.
+ * lib/rake: Update to Rake 0.9.2.2. Prevent pollution of toplevel
+ namespace by Commands. Remove unused variable and debugging
+ statement in tests.
-Mon Aug 1 13:57:35 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Fri Aug 12 09:00:24 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tcltklib/tcltklib.c (deleted_ip): refactoring - interpreter
- deletion check. [ruby-dev:26664]
+ * backport r32941 from trunk
-Mon Aug 1 01:17:40 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * lib/rubygems: Import RubyGems 1.8.8. Fixes encoding of YAML gemspec
+ from gems. Github Issue #149
- * lib/drb/drb.rb (check_insecure_method): use private_methods and
- protected_methods instead of respond_to? to check method visibility.
- [ruby-dev:26616]
+Fri Aug 12 03:24:35 2011 Eric Hodel <drbrain@segment7.net>
- * test/drb/drbtest.rb: ditto.
+ * backport r32935 from trunk
- * test/drb/ut_drb.rb: ditto.
+ * lib/rdoc: Import RDoc 3.9.2. Fixes TIDYLINK for HTML output.
-Mon Aug 1 00:07:32 2005 Keiju Ishitsuka <keiju@ruby-lang.org>
- * lib/irb/context.rb: fix `irb --readline` option. [ruby-list:40955]
+Tue Aug 2 22:04:46 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Jul 29 09:59:38 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * backport r32815 from trunk.
- * eval.c (rb_yield_0): push yielded node instead of yielding.
- fixed: [yarv-dev:549]
+ * gc.c (init_heap): allocate sigaltstack after heaps are allocated.
+ [ruby-dev:44315] [Bug #5139]
-Thu Jul 28 18:09:55 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * vm.c (thread_free): use free because objspace is not ready.
- * ext/tcltklib/stubs.c: When --enable-tcltk-stubs, the initialize
- routine creates a Tcl/Tk interpreter and deletes it. However,
- init cost of Tk's MainWindow is not so small. And that makes it
- impossible to use libraries written with Tcl functions only on
- an environment without a graphical display. This changes support
- delaying initalization of Tk_Stubs until the script needs Tk.
+ * vm.c (th_init): use malloc because objspace is not ready.
- * ext/tcltklib/stubs.h: New file. Define prototypes and return
- codes of functions on stubs.c.
+Thu Aug 11 19:04:38 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * ext/tcltklib/tcltklib.c: Support delaying initalization of
- Tk_Stubs until the script needs Tk.
+ * backport r32931 from trunk.
- * ext/tcltklib/tcltklib.c: Show friendly error messages for errors
- on initialization.
+ * variable.c (autoload_delete): An autoload entry is still in a
+ RCLASS_IV_TBL, not in a RCLASS_CONST_TBL, so take back the table
+ changed in r29600. And an autoload entry keeps not a
+ rb_const_entry_t but a NODE so remove rb_const_entry_t thing added
+ in r29602.
- * ext/tcltklib/tcltklib.c: Avoid SEGV on ip_finalize() when ruby is
- exiting and $DEBUG is true. (Not fix. If you know the reason of
- why, please fix it.)
+Thu Aug 11 15:07:36 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/tkutil.c (ary2list, ary2list2): bug fix on handling of
- encoding.
+ * lib/mkmf.rb (link_command): use LIBRUBYARG in rbconfig for
+ unbundled extensions. [ruby-core:38802] [Bug #5147]
- * ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string and bg_eval_string
- don't work propery.
+ * lib/mkmf.rb (init_mkmf): revert r32902. [ruby-core:38903]
- * ext/tk/lib/tk.rb: Forget extending Tk::Encoding module to Tk.
- * ext/tk/lib/tk/variable.rb: TkVarAccess fails to initialize the
- object for an element of a Tcl's array variable.
+Wed Aug 10 19:30:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Wed Jul 27 23:23:54 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * backport r32903 from trunk.
- * gc.c (obj_free): make message format consistent with one from
- gc_mark(). [ruby-talk:149668]
+ * complex.c (nucomp_rationalize): calls rationalize of real part if
+ imaginary part is exactly zero. The patch is made by Marc-Andre
+ Lafortune. fixes [Bug #5178] [ruby-core:38885]
-Wed Jul 27 22:11:37 2005 Kouhei Sutou <kou@cozmixng.org>
+ * test/ruby/test_complex.rb (test_rationalize): add a test for the
+ above change.
- * sample/rss/tdiary_plugin: removed. because the plugin
- is imported in the tDiary plugin packages.
+ * complex.c (nucomp_to_r): fix RDoc comment. The patch is made by
+ Marc-Andre Lafortune.
-Wed Jul 27 10:59:02 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Aug 10 14:11:07 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * dir.c (dir_each): rewinddir(3) before iteration.
- [ruby-talk:149628]
+ * lib/mkmf.rb (init_mkmf): set $LIBRUBYARG regardless of shared
+ option. [ruby-core:38802] [Bug #5147]
-Tue Jul 26 12:57:49 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Wed Aug 10 02:57:01 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/openssl/openssl_missin.c: include <openssl/engine.h> before
- <openssl/x509_vfy.h> to avoid compilation error of mswin32.
- suggested by NAKAMURA Usaku.
+ * lib/net/http.rb: come back autoload. OpenSSL constant is used
+ some places, so it leads mistakes like HTTP.start.
-Mon Jul 25 21:30:46 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Aug 9 22:57:45 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * {bcc32,win32,wince}/Makefile.sub: moved CPPFLAGS only for ruby
- source to XCFLAGS.
+ * ext/date/date_parse.c (date_zone_to_diff): add RB_GC_GUARD.
+ [ruby-dev:44337] [Bug #5152]
-Mon Jul 25 13:45:18 2005 NAJIMA Hiroki <najima@mickey.ai.kyutech.ac.jp>
+ * ext/date/data_parse.c (parse_ddd_cb): ditto.
- * io.c: check HAVE_SYS_IOCTL_H before including the header.
- [ruby-dev:26610]
+Tue Aug 9 12:20:33 2011 Naohisa Goto <ngotogenome@gmail.com>
-Mon Jul 25 14:10:02 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/fiddle/helper.rb (libc_so, libm_so): Solaris support added.
+ [ruby-core:38853] [Bug #5168]
- * ext/tk/lib/multi-tk.rb: fix en-bugged part in the last commit.
+ * test/dl/test_base.rb (libc_so, libm_so): on Solaris, remove libc
+ and libm version numbers for detecting default libc and libm.
-Sat Jul 23 16:49:04 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Tue Aug 9 10:49:52 2011 Igor Zubkov <igor.zubkov@gmail.com>
- * ext/openssl/ossl_engine.c (ossl_engine_s_load): should check
- OPENSSL_NO_STATIC_ENGINE.
+ * array.c: Fix typo. https://github.com/ruby/ruby/pull/36
-Fri Jul 22 21:06:08 2005 Tadashi Saito <shiba@mail2.accsnet.ne.jp>
+Mon Aug 8 00:10:45 2011 Akinori MUSHA <knu@iDaemons.org>
- * bignum.c (rb_big_eq): reduce isnan(). [ruby-dev:26600]
+ * test/test_syslog.rb (TestSyslog#test_log): Do not be too
+ specific about the log line format. Fixes #5081.
- * numeric.c (flo_eq, flo_gt, flo_ge, flo_lt, flo_le): ditto.
+Sun Aug 7 23:39:44 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Fri Jul 22 15:02:39 2005 Kouhei Sutou <kou@cozmixng.org>
+ * time.c (rb_strftime_alloc): raise ERANGE if width is too large.
+ Patch by Nobuyoshi Nakada. [Bug #4457] [ruby-dev:43285]
- * lib/rss/rss.rb: moved copyright description to lib/rss.rb.
+ * test/ruby/test_time.rb (class TestTime): add a test for the
+ above change.
- * lib/rss.rb: added for convenience.
+Sun Aug 7 14:15:10 2011 Kazuki Tsujimoto <kazuki@callcc.net>
- * sample/rss/re_read.rb: added #to_s sample.
+ * backport r32876 from trunk.
- * sample/rss/blend.rb: use 'require "rss"' instead of
- 'require "rss/*"'.
- * sample/rss/list_description.rb: ditto.
- * sample/rss/rss_recent.rb: ditto.
- * sample/rss/tdiary-plugin/rss-recent.rb: ditto.
+ * ext/objspace/objspace.c: fix typos in a document.
- * sample/rss/tdiary-plugin/rss-recent.rb: 0.0.6 -> 0.0.7.
+Sun Aug 7 04:42:36 2011 Eric Hodel <drbrain@segment7.net>
-Fri Jul 22 14:37:43 2005 Kouhei Sutou <kou@cozmixng.org>
+ * marshal.c (w_object): Fix exception message when _dump_data
+ is not defined on a T_DATA object.
- * lib/rss/parser.rb (RSS::Parser#initialize): accept HTTP/FTP
- URI and local file path too.
+Sat Aug 6 06:14:20 2011 Eric Hodel <drbrain@segment7.net>
- * test/rss/test_parser.rb (RSS::TestParser#test_parse): test
- for the above.
+ * lib/rdoc: Update to 3.9.1. Fixes === lines in verbatim sections.
+ Fixes :nodoc: on class aliases. Fixes :stopdoc: creating references
+ to Object. Fixes spacing when class comments are merged in ri.
+ Fixes `ri []` crash. Fixes bug report URL when rdoc crashes. Adds
+ :doc: and :nodoc: to allow hiding of implementation details in ruby.
+ Makes `rdoc` and `ri` gem-aware.
-Fri Jul 22 07:01:42 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sat Aug 6 03:19:45 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tk/tkutil.c (tk_conv_args): forget to revert thread_critical
- and gc_disable when raise ArgumentError.
+ * lib/rubygems: Import RubyGems 1.8.7:
+ Added missing require for `gem uninstall --format-executable`.
- * ext/tk/lib/remote-tk.rb: RemoteTkIp doesn't need to include TkUtil.
+ The correct name of the executable being uninstalled is now displayed
+ with --format-executable.
- * ext/tcltklib/tcltklib.c: add TclTkIp#has_mainwindow? method.
+ Fixed `gem unpack uninstalled_gem` default version picker.
- * ext/tk/lib/tk.rb: add Tk.has_mainwindow? method.
+ RubyGems no longer claims a nonexistent gem can be uninstalled.
- * ext/tk/lib/multi-tk.rb: add MultiTkIp#has_mainwindow? method.
+ `gem which` no longer claims directories are requirable files.
- * ext/tk/lib/remote-tk.rb: add RemoteTkIp#has_mainwindow? method.
+ `gem cleanup` continues cleaning up gems if one can't be uninstalled
+ due to permissions. Issue #82.
- * ext/tk/lib/multi-tk.rb: slave IP fail to exit itself when $SAFE==4.
+ Gem repository directories are no longer created world-writable.
+ Patch by Sakuro OZAWA. [Ruby 1.9 - Bug #4930]
- * ext/tk/lib/multi-tk.rb: remove constants from MultiTkIp module to
- avoid access from external.
+Fri Aug 5 23:08:39 2011 Naohisa Goto <ngotogenome@gmail.com>
- * ext/tk/lib/multi-tk.rb: check_root flag is ignored on slave IPs'
- mainloop.
+ * backport r32845 from trunk.
- * ext/tk/lib/multi-tk.rb: hang-up Tk.mainloop called on a slave IP
- with $SAFE==4.
+ * configure.in: when Solaris cc, use $(CC) to link shared libs.
- * ext/tk/lib/multi-tk.rb: MultiTkIp#bg_eval_proc doesn't work
- properly.
+Fri Aug 5 22:16:20 2011 Naohisa Goto <ngotogenome@gmail.com>
- * ext/tk/lib/multi-tk.rb: add MultiTkIp#set_cb_error(proc) and
- cb_error(exc) to log errors at callbacks on safe slave IPs.
+ * numeric.c (rb_infinity, rb_nan): use WORDS_BIGENDIAN to get endian.
+ fix [Bug #5160] [ruby-dev:44356]
- * ext/tk/lib/multi-tk.rb: fail to get an available slave IP object
- when call Tk.mainloop in the block which is given to new_* method,
- because cannot finish initialize while the root widget is alive.
+Fri Aug 5 15:57:10 2011 Naohisa Goto <ngotogenome@gmail.com>
- * ext/tk/lib/multi-tk.rb: fail to control a slave IP when Tk.mainloop
- runs on the IP.
+ * complex.c (f_signbit): fix compile error in gcc4 on Solaris with
+ CFLAGS="-std=gnu99". [ruby-dev:44355] fix [Bug #5159]
-Wed Jul 20 19:20:37 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * math.c: ditto.
- * io.c (S_ISREG): need to define S_ISREG before it is used first.
+Thu Aug 5 10:09:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Wed Jul 20 18:40:50 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * backport r32846 from trunk.
- * io.c (wsplit_p): patch for the environment where
- fcntl(F_GETFL, O_NONBLOCK) is not supported. in that case,
- set FMODE_WSPLIT without fcntl check. [ruby-dev:26566]
+ * thread_pthread.c (native_cond_signal): retry to call pthread_cond_signal
+ and pthread_cond_broadcast if they return EAGAIN in
+ native_cond_signal and native_cond_broadcast, respectively.
+ It is for the pthread implementation of Mac OS X 10.7 (Lion).
+ fixes #5155. [ruby-dev:44342].
-Wed Jul 20 18:07:11 2005 Tanaka Akira <akr@m17n.org>
+ * thread_pthread.c (native_cond_broadcast): ditto.
- * io.c (rb_io_ctl): update FMODE_WSPLIT_INITIALIZED and FMODE_WSPLIT
- by F_SETFL.
+ * thread_pthread.c (struct cached_thread_entry): stop using
+ pthread_cond_t and its functions directly.
-Wed Jul 20 10:04:51 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * thread_pthread.c (register_cached_thread_and_wait): ditto.
- * variable.c (rb_class_path): need to adjust snprintf() len for
- teminating NUL. [ruby-dev:26581]
+ * thread_pthread.c (use_cached_thread): ditto.
-Wed Jul 20 04:01:55 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Fri Aug 5 07:35:00 2011 Luis Lavena <luislavena@gmail.com>
- * ext/socket/socket.c: sorry, BeOS also uses HAVE_CLOSESOCKET,
- so reverted.
+ * lib/rubygems/installer.rb (class Gem): Correct path check on Windows
+ Possible fix for [Ruby 1.9 - Bug #5111]
- * ext/socket/extconf.rb: should not define HAVE_CLOSESOCKET
- on windows.
+ * test/rubygems/test_gem_installer.rb (load Gem): ditto
+ Backported from trunk r32804
-Wed Jul 20 03:16:43 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Fri Aug 5 07:00:31 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/socket.c: should not undef close() on win32.
- it's defined to rb_w32_close(), otherwise handle leaks.
- [ruby-Bugs-2131]
+ * test/io/console/test_io_console.rb (test_noctty): daemon() on
+ Fedora Rawhide seems not to detach the controlling terminal,
+ when the argument noclose is non-zero. ref: [Bug #5135]
-Wed Jul 20 00:48:16 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Aug 4 02:35:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * error.c (syserr_initialize): don't use str before StringValue()
- check. [ruby-dev:26579]
+ * configure.in: use build_os variable for checking C and C++ compilers
+ matching.
-Tue Jul 19 22:47:29 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * configure.in: use clang++ if clang is used.
- * error.c (syserr_initialize): add 1 byte for snprintf() size for
- NUL at the end. [ruby-dev:26574]
+Thu Aug 4 02:21:10 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Jul 19 16:39:46 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/mkmf.rb (link_command): use static library only for bundled
+ extensions. [Bug #5147]
- * io.c (rb_io_inspect): replace sprintf() with "%s" format all
- over the place by snprintf() to avoid integer overflow.
+Wed Aug 3 00:11:08 2011 Tanaka Akira <akr@fsij.org>
-Tue Jul 19 14:08:22 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * lib/prettyprint.rb: update document. [ruby-core:36776]
- * ext/tcltklib/tcltklib.c: rbtk_eventloop_depth is used as int.
- * ext/tcltklib/tcltklib.c: rbtk_pending_exception is tested with
- NIL_P, so should assign Qnil instead of 0 (Qfalse).
+Tue Aug 2 20:10:16 2011 Shota Fukumori <sorah@tubusu.net>
- * ext/tcltklib/tcltklib.c (ip_invoke_real): fixed memory leak when
- ip is deleted.
+ * test/testunit/test_parallel.rb: pass "--ruby" option to
+ test/testunit/tests_for_parallel/runner.rb. [Bug #5132] [ruby-dev:44303]
+ Backported from trunk r32812.
-Tue Jul 19 13:19:46 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Aug 2 12:03:16 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/tk/variable.rb: For symmetry, add TkVariable#string. It
- returns a string even if the default value type of the TkVariable
- object is not "string".
+ * hash.c (recursive_hash): hash value of emptied hash should be
+ equal to an empty hash. [ruby-core:38650]
-Mon Jul 18 21:40:20 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Tue Aug 2 11:42:15 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_call0): make the pointer to NODE volatile
- instead of NODE itself.
+ * parse.y (rb_enc_symname2_p): :! is valid symbol. [Bug #5136]
-Mon Jul 18 14:32:21 2005 Tanaka Akira <akr@m17n.org>
+Tue Aug 2 03:26:02 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * eval.c (rb_call0): make body volatile to avoid optimization problem.
- [ruby-dev:26195]
+ * test/rake/test_rake_directory_task.rb (TestRakeDirectoryTask#
+ test_directory_win32): fixed wrong test.
+ backported r32670 from trunk.
-Mon Jul 18 12:23:27 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Mon Aug 1 15:45:23 2011 Eric Hodel <drbrain@segment7.net>
- * ext/io/wait/wait.c: wrong backport from trunk. fixed: [ruby-dev:26562]
+ * test/rake/test_rake_functional.rb: Don't assume the binary name of
+ ruby is "ruby". [Ruby 1.9 - Bug #5114]
+ * test/rake/helper.rb: ditto
-Mon Jul 18 09:36:25 2005 Tanaka Akira <akr@m17n.org>
+Mon Aug 1 05:21:42 2011 TAKANO Mitsuhiro (takano32) <tak@no32.tk>
- * rubyio.h (FMODE_WSPLIT, FMODE_WSPLIT_INITIALIZED): new constant.
+ * cont.c (cont_save_thread): fix missing semicolon.
- * io.c (wsplit_p): new function.
- (io_fwrite): split writing data by PIPE_BUF if wsplit_p is true in
- multi-threaded mode.
- [ruby-dev:26540]
+Sun Jul 31 22:57:16 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-Sun Jul 17 13:46:54 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * enc/Makefile.in (ECHO1): Same as the recent fix in common.mk.
+ ":" in a make variable replacement cause a syntax error with
+ /usr/ccs/bin/make on Solaris. Uses $(NULLCMD) instead.
- * ext/io/wait/extconf.rb, ext/io/wait/wait.c: Win32 platforms support.
+Sun Jul 31 22:44:08 2011 Kazuki Tsujimoto <kazuki@callcc.net>
-Fri Jul 15 23:59:03 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in: fix typos.
- * lib/rdoc/parsers/parse_c.rb (handle_class_module): handle a
- module enclosed in a built-in module. fixed: [ruby-talk:148239]
+Sun Jul 31 21:19:51 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * lib/rdoc/parsers/parse_c.rb (find_body): allow macros as methods.
+ * lib/mkmf.rb (configuration:ECHO1): Same as the recent fix in
+ common.mk.
+ ":" in a make variable replacement cause a syntax error with
+ /usr/ccs/bin/make on Solaris. Uses $(NULLCMD) instead.
- * lib/rdoc/parsers/parse_c.rb (find_call_seq): allow :nodoc: modifier
- in C. [ruby-core:04572]
+Sun Jul 31 21:16:02 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-Fri Jul 15 18:00:01 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * complex.c (f_signbit): gcc4 on Solaris DOES have signbit but does
+ not have it on header.
- * bcc32/Makefile.sub (COMMON_HEADERS): ruby_1_8 is using winsock.h.
- failed to compile ext/socket on bcc5.6.4. [ruby-dev:26193]
+ * math.c: ditto.
-Fri Jul 15 07:58:56 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sun Jul 31 21:09:04 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * lib/webrick/server.rb (WEBrick::GenericServer#accept_client):
- sockets should be non-blocking mode. [ruby-dev:26405]
+ * common.mk (node_name.inc): Use $(Q) for consistency.
- * lib/webrick/utils.rb (WEBrick::Utils.set_non_blocking): new method.
+ * Makefile.in (INSNS): ditto.
- * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#read_chunked):
- should call sock.read repeatedly until the preferred size data
- is obtained.
+Sun Jul 31 20:39:12 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-Thu Jul 14 18:27:16 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * common.mk (ECHO1): nmake does not allow parenthesis in make variable
+ replacement.
- * win32/win32.c (rb_w32_strerror): should return correct message
- for ENAMETOOLONG and ENOTEMPTY. (bcc32) [ruby-dev:26533]
+Sun Jul 31 20:21:36 2011 "Yuki Sonoda (Yugui)" <yugui@yugui.jp>
- * win32/win32.c (rb_w32_strerror): stripped CR LF on the tail.
- (bcc32) [ruby-dev:26533]
+ * common.mk (ECHO1): ":" in a make variable replacement cause a syntax
+ error with /usr/ccs/bin/make on Solaris. Uses $(NULLCMD) instead.
-Thu Jul 14 00:45:42 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in (NULLCMD): new check.
- * LEGAL (ext/nkf/nkf-utf8): updated from nkf1.7 to nkf-utf8.
+ * Makefile.in (NULLCMD): Reflects checking in configure.
-Wed Jul 13 19:37:47 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * win32/Makefile.sub (NULLCMD): new assignment.
- * win32/win32.c (rb_w32_mkdir): should set EEXIST (not EACCES)
- if file or directory already exists. (bcc32) [ruby-dev:26508]
+Sun Jul 31 11:31:07 2011 Kazuki Tsujimoto <kazuki@callcc.net>
- * win32/win32.c (rb_w32_rmdir): should set ENOTDIR (not EINVAL)
- if it is not directory. (bcc32, win32)
+ * backport r32768 from trunk.
- * win32/win32.c (rb_w32_rmdir, rb_w32_unlink): restore
- FILE_ATTRIBUTE_READONLY flag on function failure.
+ * vm.c: check if cfp is valid. [Bug #5083] [ruby-dev:44208]
-Wed Jul 13 12:40:00 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sat Jul 31 01:23:45 2011 Kenta Murata <mrkn@mrkn.jp>
- * ext/tcltklib/tcltklib.c: TclTkLib.do_one_event doesn't work.
+ * backport r32762 from trunk.
- * ext/tk/lib/tk.rb: Tk.thread_update is available.
+ * test/bigdecimal/test_bigdecimal.rb (test_version): removed.
-Tue Jul 12 23:32:11 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jul 30 23:51:44 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/mkmf.rb: keep curdir unexpanded.
+ * lib/cmath.rb (cbrt): should return a real number if possible.
-Mon Jul 11 08:31:29 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jul 30 23:48:04 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * regex.c (read_special): fix parsing backslashes following \c in
- regexp. fixed: [ruby-dev:26500]
+ * ext/date/date_core.c: an issue that is same as [ruby-dev:44071].
-Mon Jul 11 02:53:00 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/date/date_strftime.c: identical to [ruby-dev:44112].
- * lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line):
- mistook in merging the patch of [ruby-dev:26235] at
- revision 1.4.2.6.
+Sat Jul 30 23:19:09 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Jul 10 23:58:04 2005 Tanaka Akira <akr@m17n.org>
+ * defs/default_gems: separate from tool/rbinstall.rb.
- * lib/pathname.rb (Pathname#unlink): try Dir.unlink first to
- avoid unlink a directory by root.
- cf. [ruby-dev:26237]
+Sat Jul 30 23:14:44 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Jul 11 05:18:17 2005 Michael Neumann <mneumann@ruby-lang.org>
+ * io.c (rb_io_each_byte): rbuf can be refreshed during yield.
+ [Bug #5119]
- * lib/xmlrpc/server.rb (XMLRPC::Server): Switch from GServer over to
- WEBrick. This makes file lib/xmlrpc/httpserver.rb obsolete (at least it is
- no further used by the XML-RPC library).
+Sat Jul 30 22:35:50 2011 Naohisa Goto <ngotogenome@gmail.com>
-Sun Jul 10 12:47:01 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * strftime.c (NEEDS): avoid SEGV due to integer overflow in
+ sparc-solaris2.10 and i686-linux. fix [Bug #4456] [ruby-dev:43284]
- * lib/debug.rb (debug_command): added a deficient format specifier.
- fixed: [ruby-core:05419]
+Sat Jul 30 14:27:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Sat Jul 9 21:28:46 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * backport r32754 from trunk.
- * ext/win32ole/win32ole.c (ole_method_dispid): convert dispid
- in Ruby and C by INT2NUM and NUM2INT.
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_version): version 1.1.0.
- * ext/win32ole/win32ole.c (ole_invoke2): ditto.
+ * ext/bigdecimal/bigdecimal.gemspec: turn into a default gem.
- * ext/win32ole/test/testWIN32OLE.rb: ditto.
+ * tool/rbinstall.rb: ditto.
- * ext/win32ole/test/testOLEMETHOD.rb: ditto.
+Sat Jul 30 13:52:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Fri Jul 8 15:45:04 2005 Kouhei Sutou <kou@cozmixng.org>
+ * ext/bigdecimal/lib/bigdecimal/util.rb (Rational#to_d):
+ revive zero and implicit precision support as a deprecated feature.
- * lib/rss/rss.rb (RSS::VERSION): 0.1.4 -> 0.1.5.
-
- * test/rss/test_version.rb (RSS::TestVersion#test_version):
- ditto.
+ * test/bigdecimal/test_bigdecimal_util.rb: modify a test for the above
+ change.
- * lib/rss/0.9.rb (RSS::Rss::Channel::Item::Category):
- domain attribute of <category> is optional. Thanks to
- Chris Lee <clee@kde.org>.
+ * NEWS: describes the above change.
- * test/rss/test_parser.rb (RSS::TestParser#test_category20):
- adjusted test case.
+Sat Jul 30 10:58:10 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Jul 5 23:44:06 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vm.c (th_init): preallocate alternative stack.
+ NoMemoryError is better than rb_bug, of course.
+ Patch by Eric Wong. [ruby-core:38572][ruby-core:38594].
- * instruby.rb: expand source library path.
+ * signal.c (rb_register_sigaltstack): ditto.
-Tue Jul 5 23:27:14 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vm_core.h: moved ALT_STACK_SIZE definition from signal.c.
- * array.c (sort_2): get rid of yet another bcc's bug.
- fixed: [ruby-core:05152]
+ * vm.c (thread_free): use xfree() instead of free().
- * eval.c (rb_thread_save_context): must not switch contexts during
- re-allocating stack. fixed: [ruby-core:05219]
+Sat Jul 30 07:20:49 2011 Tanaka Akira <akr@fsij.org>
-Tue Jul 5 15:15:10 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/socket/lib/socket.rb (udp_server_sockets): unused variable
+ removed.
+ patch by Jeremy Evans. [ruby-core:38600]
- * ext/tk/tkutil.c: fix typo.
+Fri Jul 29 23:56:32 2011 Tanaka Akira <akr@fsij.org>
-Tue Jul 5 14:51:35 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/securerandom.rb: call OpenSSL::Random.seed at the
+ SecureRandom.random_bytes call.
+ based on the patch by Masahiro Tomita. [ruby-dev:44270]
- * ext/tcltklib/tcltklib.c: bug fix on treating Unicode strings.
+Fri Jul 29 20:48:39 2011 Tanaka Akira <akr@fsij.org>
- * ext/tcltklib/tcltklib.c: add methods to treat encoding mode.
+ * ext/socket/mkconstants.rb: fix typos.
- * ext/tcltklib/MANUAL.eng: add description of TclTkLib#encoding,
- encoding_system, and so on.
+Fri Jul 29 20:28:56 2011 Tanaka Akira <akr@fsij.org>
- * ext/tcltklib/MANUAL.euc: ditto.
+ * ext/socket/mkconstants.rb: use whitespaces as a separator.
- * ext/tk/tkutil.c: fail to create a Tcl's list string from an
- array including multiple kind of encoded strings.
+Fri Jul 29 18:59:07 2011 Tanaka Akira <akr@fsij.org>
- * ext/tk/lib/tk.rb: ditto.
+ * ext/socket/mkconstants.rb: add documents for constants.
+ patch by Eric Hodel. [ruby-core:37853] [Bug #4989]
- * ext/tk/lib/multi-tk.rb: 2nd arg of _{to|from}UTF8 is omissible.
+Mon Jul 25 23:51:01 2011 Yusuke Endoh <mame@tsg.ne.jp>
- * ext/tk/lib/remote-tk.rb: ditto.
+ * backport r32671 from trunk.
- * ext/tk/lib/tk.rb: override TclTkLib#encoding and encoding= to
- use TkCore::INTERP.encoding and encoding=.
+ * proc.c: pre-allocate the unlinked_method_entry_list_entry struct to
+ avoid memory allocation during GC. based on a patch from Eric Wong.
+ [ruby-core:38498]
- * ext/tk/lib/tk.rb: when "require 'tk'" and $KCODE=='NONE', check
- DEFAULT_TK_ENCODING to decide Ruby/Tk's system encoding mode.
+Mon Jul 25 22:36:11 2011 Yusuke Endoh <mame@tsg.ne.jp>
- * ext/tk/lib/tk/encodedstr.rb: check both of Tk.encoding and
- Tk.encoding_system. Tk.encoding has higher priority.
+ * backport r32669 from trunk.
- * ext/tk/lib/tk/optiondb.rb: ditto.
+ * proc.c (struct METHOD), gc.c (gc_marks), vm_method.c
+ (rb_gc_mark_unlinked_live_method_entries): fix SEGV bug.
+ rb_method_entry_t was free'd even when the method is still on the
+ stack if it is BMETHOD (i.e., Method#call). This is because
+ rb_method_entry_t is embedded in struct METHOD. This commit
+ separates them and marks the live method entries.
+ See [ruby-core:38449] in detail. fix [Bug #5047] [ruby-core:38171]
- * ext/tk/lib/tk/spinbox.rb: ditto.
+Thu Jul 28 23:36:28 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * ext/tk/lib/tk/validation.rb: ditto.
+ * ext/fiddle/closure.c (callback): use rb_ary_tmp_new() instead of
+ xmalloc() to allocate an array for arguments of callback procedure,
+ to prevent arguments from being swept by GC. [ruby-core:38546]
+ [Bug #4929]
- * ext/tk/lib/tk/namespace.rb: arguemnts for TclTkIp#_merge_tklist
- should be UTF-8 strings.
+Thu Jul 28 22:51:27 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Mon Jul 4 14:35:52 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * backport r32723 from trunk.
- * sample/svr.rb: service can be stopped by ill-behaved client; use
- tsvr.rb instead.
+ * ext/openssl/ossl_cipher.c (ossl_cipher_initialize): Avoid possible
+ SEGV from AES encryption/decryption. Processing data by
+ Cipher#update without initializing key (meaningless usage of Cipher
+ object since we don't offer a way to export a key) could cause SEGV.
-Mon Jul 4 13:25:21 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ In OpenSSL, the EVP which has EVP_CIPH_RAND_KEY flag (such as DES3)
+ allows uninitialized key, but other EVPs (such as AES) does not
+ allow it. Calling EVP_CipherUpdate() without initializing key causes
+ SEGV so we set the data filled with "\0" as the key by default. See
+ #2768.
- * missing/erf.c: original erf.c by prof. Okumura is confirmed to
- be public domain. reverted BSD implementation.
+ * test/openssl/test_cipher.rb: test it.
-Mon Jul 4 11:15:37 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Jul 28 04:53:31 2011 Eric Hodel <drbrain@segment7.net>
- * test/{dbm,gdbm,sdbm}/test_{dbm,gdbm,sdbm}.rb: skip some tests
- which using fork on fork-less platforms.
+ * lib/delegate.rb: Move file-level documentation to the appropriate
+ classes.
-Sun Jul 3 23:26:30 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Thu Jul 28 00:33:47 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * test/wsdl/document/test_rpc.rb: compare formatted time string of
- Time objects instead of comparing Time objects itself to avoid
- unintended conflict of usec part. [ruby-dev:26220]
+ * test/fileutils/test_fileutils.rb: add OpenBSD case.
+ patched by Jeremy Evans [ruby-core:38530] see #5097
-Sat Jul 2 22:41:04 2005 Tanaka Akira <akr@m17n.org>
+ * test/ruby/test_process.rb: ditto.
- * ext/socket/socket.c (unix_send_io, unix_recv_io): support x86-64 and
- IA64.
+Wed Jul 27 17:59:46 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Sat Jul 2 17:06:23 2005 Tanaka Akira <akr@m17n.org>
+ * include/ruby/missing.h: define __syscall if the platform has
+ __syscall in the library but doesn't define it in headers
+ for example Mac OS X.
- * defines.h (FLUSH_REGISTER_WINDOWS): defined for IA64.
- (flush_register_windows): declare flush_register_windows.
+Wed Jul 27 15:39:14 2011 Eric Hodel <drbrain@segment7.net>
- * eval.c (flush_register_windows): new function.
+ * object.c: Add usage documentation for BasicObject. Based on patch
+ by Thomas Sawyer. [Ruby 1.9 - Bug #5067]
-Fri Jul 1 17:48:52 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Jul 27 12:24:17 2011 Eric Hodel <drbrain@segment7.net>
- * bignum.c (get2comp): revert all prior changes, and calculate
- proper 2's complement for negative numbers. backported from
- HEAD.
+ * lib/rubygems/uninstaller.rb: Add missing require and update
+ messaging to avoid confusion with uninstall --format-executable.
+ [Ruby 1.9 - Bug #4062]
-Fri Jul 1 15:50:12 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Jul 27 10:47:57 2011 Eric Hodel <drbrain@segment7.net>
- * missing/erf.c: need to include some headers for some platforms.
+ * lib/rubygems: Update to RubyGems 1.8.6.1.
- * win32/win32.h (copysign, scalb): define for compatibility with
- other platforms. [ruby-dev:26430]
+Wed Jul 27 10:04:06 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Fri Jul 1 15:37:42 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * backport r32690 from trunk.
- * missing/crypt.c: modified to make it compilable on platforms
- other than BSD. [ruby-dev:26430]
+ * test/openssl/test_pkcs12.rb: Add test and intermediate certificates.
+ [ Ruby 1.9 - Feature #3793 ] [ruby-core:32088]
- * missing/erf.c: ditto. code from <exp.c> merged.
+Sat Jul 27 01:26:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Fri Jul 1 12:44:56 2005 Tanaka Akira <akr@m17n.org>
+ * NEWS: add changes of bigdecimal and bigdecimal/util.
- * lib/open-uri.rb (OpenURI.open_http): refine post_connection_check
- call.
+Wed Jul 27 01:13:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Fri Jul 1 11:34:08 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/bigdecimal/lib/bigdecimal/util.rb (Rational#to_d):
+ zero or negative precision is error. fixes #5098.
+ [ruby-dev:44210]
- * missing/crypt.c: replaced with 4.4BSD version.
+ * ext/bigdecimal/lib/bigdecimal/util.rb (Float#to_d): modified for
+ specifying precision. fixes #5098. [ruby-dev:44210]
- * missing/erf.c: ditto.
+ * ext/bigdecimal/lib/bigdecimal/util.rb (Integer#to_d): added
+ for symmetry to BigDecimal() function with an Integer.
+ fixes #5098. [ruby-dev:44210]
- * missing/vsnprintf.c: removed the third provision from the old
- BSD license. [ruby-core:05177]
+ * ext/bigdecimal/lib/bigdecimal/util.rb (BigDecimal#to_d): added
+ for adapting other Numeric subclasses. [ruby-dev:44245]
-Fri Jul 1 01:45:21 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/bigdecimal/test_bigdecimal_util.rb: add tests for the above
+ changes.
- * enum.c (enum_min, enum_max): must not return Qundef.
- fixed: [ruby-core:05299]
+Wed Jul 27 00:54:38 2011 Kenta Murata <mrkn@mrkn.jp>
-Fri Jul 1 00:18:40 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * bigdecimal/bigdecimal.c (VpDup) a new function for duplicating
+ a BigDecimal.
- * lib/delegate.rb (Delegator::respond_to): respond_to? must check
- destination object. [ruby-talk:146894]
+ * bigdecimal/bigdecimal.c (BigDecimal_new): support generating a new
+ BigDecimal from another BigDecimal using BigDecimal global function
+ or constructor. [ruby-dev:44245]
-Thu Jun 30 19:00:21 2005 Keiju Ishitsuka <keiju@ruby-lang.org>
- * lib/irb/ruby-lex.rb (RubyLex::identify_number): alternative implements
- for [ruby-dev:26410]. And support a numeric form of 0d99999.
+Mon Jul 25 22:24:09 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Thu Jun 30 17:28:10 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * backport r32666 from trunk.
- * lib/irb/ruby-lex.rb (RubyLex::identify_number): should not treat
- plain zero as an octal number. [ruby-dev:26410]
+ * lib/xmlrpc/client.rb: Fix possible HTTP header formatting failure by
+ 'Basic' header. Long username caused the base64 String truncation in
+ HTTP header which is not allowed. See #5046.
-Thu Jun 30 15:13:16 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/xmlrpc/test_webrick_server.rb: test it.
- * eval.c (rb_eval): pre-evaluate argument for unambiguous
- evaluation order. [ruby-dev:26383]
+Mon Jul 25 15:36:07 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Thu Jun 30 09:53:56 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/openssl/lib/openssl/{x509.rb,ssl.rb}: Add deprecation warning
+ for openssl/{x509,ssl} usage. Users should require "openssl" instead
+ of "openssl/ssl" and "openssl/x509". Start of transition period
+ introduced by [ruby-dev:38018].
- * lib/delegate.rb (Delegator::method_missing): forward unknown
- method to the destination. suggested by
- <christophe.poucet@gmail.com>. [ruby-talk:146776]
+Mon Jul 25 13:50:33 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Tue Jun 28 21:59:29 2005 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * backport r32662 from trunk.
- * dir.c, eval.c, hash.c, process.c, ruby.c: avoid warning "unused
- variable" [ruby-dev:26387]
+ * ext/openssl/lib/openssl/x509.rb: Cosmetic change: move definition
+ introduced in r30152 to x509-internal.rb.
-Sat Jun 25 17:15:23 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Mon Jul 25 13:35:20 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_query): should
- discard if key=val pair is empty. patch from Gary Wright.
+ * backport r32658 from trunk.
-Sat Jun 25 23:30:51 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/openssl/ossl_ssl.c (ossl_ssl_shutdown): Avoid randomly generated
+ SSLError from SSLSocket just after invoking SSLSocket#close.
+ OpenSSL's SSL_shutdown could try to send alert packet and it might
+ set SSLerr(global error stack) as the result. It causes the next
+ SSL read/write operation to fail by unrelated reason.
- * process.c (detach_process_watcher): terminate process watcher
- thread right after rb_waitpid() succeed. [ruby-talk:146430]
+ By design, we're ignoring any error at SSL_shutdown() so we clear
+ global error stack after SSL_shutdown is called. See #5039.
-Sat Jun 25 15:49:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jul 24 20:29:53 2011 Tanaka Akira <akr@fsij.org>
- * enum.c (enum_min, enum_max): do not ignore nil as the first element.
+ * ext/socket/extconf.rb: refine the recvmsg test.
-Sat Jun 25 14:40:17 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Sun Jul 24 20:02:31 2011 Tanaka Akira <akr@fsij.org>
- * ext/sdbm/init.c (fsdbm_select): SDBM#select had returned the array
- which contained each elements twice. [ruby-dev:26358]
+ * ext/socket/extconf.rb: fix the recvmsg test.
-Fri Jun 25 05:06:47 2005 Michael Neumann <mneumann@ruby-lang.org>
+Sun Jul 24 08:42:51 2011 Tanaka Akira <akr@fsij.org>
- * lib/xmlrpc/*, test/xmlrpc/*: backported changes from HEAD into 1.8
+ * ext/socket/extconf.rb: test recvmsg allocates file descriptors for
+ fd passing even with MSG_PEEK.
-Fri Jun 24 17:00:00 2005 Shigeo Kobayashi <shigeo@tinyforest.jp>
+ * ext/socket/ancdata.c: use the above test result.
- * ext/bigdecimal/bigdecimal.c: patch from "NATORI Shin"
- (u-tokyo.ac.jp) applied to fix rounding bug.
+Sun Jul 24 01:24:31 2011 Eric Hodel <drbrain@segment7.net>
-Fri Jun 24 13:06:45 2005 akira yamada <akira@ruby-lang.org>
+ * lib/rubygems/specification.rb: Restore behavior of
+ Gem::Specification#loaded. [Ruby 1.9 - Bug #5032]
- * lib/uri/common.rb, lib/uri/generic.rb: fixed typo in documents and
- replaced some existent domain name with "example.com".
+Sun Jul 24 01:14:49 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Jun 24 12:23:19 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/rake/test_rake_functional.rb (setup): Use __FILE__ for the base
+ directory. Current directory is not the top source directory when
+ the building process runs on other than there.
- * ext/tk/lib/tk.rb: fix typo on Tk.grid_propagate.
+ * test/rake/test_rake_rake_test_loader.rb: ditto.
- * ext/tk/lib/tk.rb: Tk.event_generate and TkWindow#event_generate
- accept TkEvent::Event object as context argument.
+ * test/rake/test_rake_task_argument_parsing.rb
+ (test_terminal_width_using_hardcoded_80): hardcoded 80 is used
+ when app.unix? is false.
- * ext/tk/lib/tk/event.rb: add TkEvent::Event#valid_fields and
- valid_for_generate to get field parameters of event_generate.
+Sun Jul 24 00:42:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Thu Jun 23 23:55:59 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in: change the default compiler to gcc-4.2 if target os
+ is OS X 10.7 (Lion).
- * runruby.rb: should load built rbconfig.rb.
+Sat Jul 23 17:06:25 2011 Tanaka Akira <akr@fsij.org>
-Thu Jun 23 16:53:15 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * io.c (rb_update_max_fd): validate fd.
- * ext/tk/lib/tk/canvastag.rb: TkcGroup.new cannot include given items.
- TkcGroup#exclude calls wrong method.
- Add alias TkcGroup#add [ruby-talk:146049].
+ * ext/socket/rubysocket.h (rsock_discard_cmsg_resource): add
+ msg_peek_p argument for the declaration.
- * ext/tk/lib/tk/canvas.rb: TkCanvas#dtag and some subcommands of
- TkCanvas#addtag fail to treat a TkcTag argument.
+ * ext/socket/ancdata.c (discard_cmsg): add msg_peek_p argument.
+ assume FreeBSD, NetBSD and MacOS X doesn't generate passed fd
+ when MSG_PEEK.
+ (rsock_discard_cmsg_resource): add msg_peek_p argument.
+ (bsock_recvmsg_internal): call rsock_discard_cmsg_resource with
+ msg_peek_p argument.
- * ext/tk/lib/tk/event.rb: add TkEvent::Event#generate to help to send
- current event to other widgets.
+ * ext/socket/unixsocket.c (unix_recv_io): call
+ rsock_discard_cmsg_resource with msg_peek_p argument.
-Mon Jun 20 18:44:04 2005 Tanaka Akira <akr@m17n.org>
+Sat Jul 23 14:38:28 2011 Eric Hodel <drbrain@segment7.net>
- * eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): DUMMY_SETJMP is replaced
- because setjmp is not enough to fix getcontext and SPARC register
- window problem.
+ * test/rake*: Remove dependencies on flexmock and session gems.
+ [Ruby 1.9 - Bug #4987]
-Mon Jun 20 16:48:36 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Fri Jul 22 21:46:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/dbm/dbm.c (fdbm_closed): new method DBM#closed?
+ * vm_insnhelper.c (vm_call_cfunc): added volatile for a workaround
+ of cfp consistency error problem on OS X 10.7 (Lion). It's
+ suspected llvm optimization bug.
+ [Bug #5076] [ruby-dev:44185]
- * ext/gdbm/gdbm.c (fgdbm_closed): new method GDBM#closed?
+Fri Jul 22 21:50:16 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/sdbm/init.c (fsdbm_closed): new method SDBM#closed?
+ * lib/uri/generic.rb (WFKV_): unroll the loop of regexp.
- * test/dbm/test_dbm.rb, test/gdbm/test_gdbm.rb, test/sdbm/test_sdbm.rb
- (teardown): close all db objects before deleting data files.
+ * lib/uri/generic.rb (URI.decode_www_form_component): ditto.
- * win32/win32.{ch} (unlink): hook runtime function to change
- file attribute before unlinking.
- fixed: [ruby-dev:26360]
+Fri Jul 22 21:49:48 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Jun 20 02:15:35 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * enum.c (enum_inject): remove empty line to notify rdoc
+ Enumerable#reduce is alias. patched by milki@github.
+ https://github.com/ruby/ruby/pull/26
- * gc.c (define_final): document fix: finalizers never get called
- before target object is destroyed.
+Fri Jul 22 21:49:28 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Jun 20 01:26:49 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#each):
+ Allow HTTP/0.9 request which doesn't has any header or body.
+ patched by Felix Jodoin. [ruby-core:38040] [Bug #5022]
- * ext/openssl/openssl_missing.c, ext/openssl/ossl.h,
- ext/openssl/ossl_asn1.c, ext/openssl/ossl_bio.c,
- ext/openssl/ossl_pkcs12.h, ext/openssl/ossl_x509req.c: avoid
- compiler warnings. suggested by Michal Rokos.
+Fri Jul 22 21:45:21 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Sun Jun 19 14:09:07 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/dl/handle.c (dlhandle_sym): clear previous error with dlerror()
+ before calling dlsym(). [ruby-dev:44091] [Bug #5021]
- * gc.c (run_final): reduce unnecessary object allocation during
- finalization.
+Fri Jul 22 19:05:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * gc.c (rb_gc_call_finalizer_at_exit): deferred finalizers list should
- be cleared before calling them. fixed: [ruby-talk:145790]
+ * parse.y (rb_enc_symname2_p): get rid of potential out-of-bound
+ access.
-Fri Jun 17 13:01:40 2005 Tanaka Akira <akr@m17n.org>
+Fri Jul 22 13:55:59 2011 Eric Hodel <drbrain@segment7.net>
- * lib/time.rb (Time.parse): fix previous leap seconds support.
- (Time.rfc2822): ditto.
- (Time.xmlschema): ditto.
+ * lib/net/http.rb: Net::HTTP#finish is used to manually close
+ connections. [Ruby 1.9 - Bug #5045]
-Thu Jun 16 15:06:55 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Fri Jul 22 13:51:29 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tcltklib/tcltklib.c (ip_rb_threadVwaitCommand): Tcl_Release
- was missing.
+ * ext/readline/readline.c: Add examples for Readline.completion_proc=.
+ [Ruby 1.9 - Bug #5057]
-Thu Jun 16 13:34:48 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Fri Jul 22 13:20:33 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tk/lib/tk.rb: add Tk.getMultiple{Open|Save}File() which return
- an Array of selected files.
+ * tool/rbinstall.rb (default gems): Install executables into the fake
+ gem dir for Gem.bin_path. [Ruby 1.9 - Bug #4485]
-Thu Jun 16 12:53:24 2005 Tanaka Akira <akr@m17n.org>
+Fri Jul 22 13:03:12 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * lib/time.rb (Time.parse): "Fri Jan 1 08:59:60 +0900 1999" was
- parsed as "Fri Jan 01 09:00:00 JST 1999" even on an environment
- which supports leap seconds.
- (Time.rfc2822): ditto.
- (Time.xmlschema): ditto.
+ * backport r32609 from trunk.
-Thu Jun 16 08:29:22 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * ext/openssl/ossl_hmac.c: Revert checking return type of
+ HMAC_Init_ex as it is not compatible with OpenSSL < 1.0.0.
- * ext/dl/sym.c (rb_dlsym_call): needs FREE_ARGS before return.
- fixed memory leak. [ruby-Bugs-2034]
+Fri Jul 22 11:22:20 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Wed Jun 15 18:26:39 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * backport r32606 from trunk.
- * ext/tk/lib/tk.rb: support "tk inactive" sub-command [for Tcl/Tk8.5a3]
+ * ext/openssl/ossl_digest.c: Check return value of EVP_DigestInit_ex.
+ * ext/openssl/ossl_hmac.c: Check return value of HMAC_Init_ex.
+ Thanks, Jared Jennings, for the patch.
+ [ Ruby 1.9 - Bug #4944 ] [ruby-core:37670]
- * ext/tk/lib/tk/namespace.rb: support "namespace path" sub-command and
- 'namespace ensemble' sub-command [for Tcl/Tk8.5a3]
+Fri Jul 22 09:17:43 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Tue Jun 14 02:02:43 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * backport r32604 from trunk.
- * ext/tk/tkutil.c: add TkUtil::CallbackSubst.subst_arg(m, ...) &
- _define_attribute_aliases(hash) to get substitution-argument from
- attributes (e.g. subst_arg(:x,:y,:num,:button) --> "%x %y %b %b ").
+ * ext/openssl/ossl_engine.c: Avoid double free of ENGINE reference.
+ * test/openssl/test_engine.rb: Add a test for it.
+ Thanks to Ippei Obayashi for providing the patch.
+ [ Ruby 1.9 - Bug #5062 ] [ruby-dev:44173]
- * ext/tk/lib/tk/event.rb: use _define_attribute_aliases().
+Fri Jul 22 06:39:34 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-Mon Jun 13 13:01:05 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * lib/csv.rb: Do not modify CSV.generate's argument [ruby-core:38356]
- * hash.c (ruby_setenv): fixed SEGV. [ruby-dev:26186]
+Thu Jul 21 20:02:11 2011 Yusuke Endoh <mame@tsg.ne.jp>
-Mon Jun 13 01:54:20 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * thread.c (set_trace_func, thread_set_trace_func_m): reset tracing
+ state when set_trace_func hook is removed. This is workaround patch
+ to force to reset tracing state that is broken by continuation call.
+ a patch from James M. Lawrence. [Feature #4347] [ruby-core:34998]
- * signal.c (sigexit): call rb_thread_signal_exit() instead of
- rb_exit(). [ruby-dev:26347]
+ * test/ruby/test_continuation.rb (class TestContinuation): add a test
+ for above. a patch from James M. Lawrence.
- * eval.c (rb_thread_signal_exit): a new function to exit on main
- thread.
+Thu Jul 21 20:59:59 2011 Tanaka Akira <akr@fsij.org>
- * eval.c (rb_thread_switch): exit status should be retrieved from
- ruby_errinfo.
+ * ext/socket/ancdata.c (discard_cmsg): workaround for MacOS X Lion.
- * eval.c (rb_f_exit): ensure exit(0) should call
- exit(EXIT_SUCCESS).
-Mon Jun 13 01:20:02 2005 Tanaka Akira <akr@m17n.org>
+Thu Jul 21 07:07:57 2011 Tanaka Akira <akr@fsij.org>
- * eval.c (rb_gc_mark_threads): curr_thread may not be part of the
- thread list. [ruby-dev:26312]
+ * backport r32579, r32581, r32587 by akr and r32588 by kazu.
-Fri Jun 10 23:35:34 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ r32579:
- * missing/mkdir.c: remove. [ruby-core:05177]
+ * io.c (rb_update_max_fd): new function.
-Fri Jun 10 22:54:26 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * internal.h (rb_update_max_fd): declare rb_update_max_fd.
- * missing.h: fd_set stuffs need sys/types.h. fixed: [ruby-core:05179]
+ * thread_pthread.c (rb_thread_create_timer_thread): update max fd when
+ timer thread pipe is created.
-Thu Jun 9 23:58:12 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ r32581:
- * ext/Win32API/Win32API.c (Win32API_Call): disable global
- optimization. fixed: [ruby-core:05143]
+ * io.c (UPDATE_MAXFD): removed.
-Thu Jun 9 23:35:22 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ r32587:
- * enum.c (enum_inject): default the result value to Qundef to use
- first element as initial value if not given.
+ * include/ruby/intern.h (rb_update_max_fd): declaration moved from
+ internal.h.
-Thu Jun 9 19:55:41 2005 Tanaka Akira <akr@m17n.org>
+ * file.c: ditto.
- * eval.c (ruby_longjmp): new macro to call longjmp, setcontext, etc.
- (ruby_setjmp): new macro to call setjmp, getcontext, etc.
- (ruby_setjmp): call setjmp before getcontext to avoid IA64 register
- stack problem.
- [ruby-talk:144939]
+ * io.c: call rb_update_max_fd for each new fds.
- * gc.c (Init_stack): remove IA64_MAGIC_STACK_LIMIT.
+ * process.c: ditto.
-Thu Jun 9 11:55:34 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * random.c: ditto.
- * lib/delegate.rb (SimpleDelegator::__setobj__): need check for
- recursive delegation. [ruby-core:04940]
+ * ruby.c: ditto.
-Wed Jun 8 18:47:10 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/io/console/console.c: ditto.
- * misc/ruby-mode.el (ruby-expr-beg): fix looking point drift.
+ * ext/openssl/ossl_bio.c: ditto.
-Wed Jun 8 11:11:34 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/pty/pty.c: ditto.
- * bignum.c (get2comp): calculate proper 2's complement for
- negative numbers. a bug in normalizing negative numbers
- reported from Honda Hiroki <hhonda@ipflex.com>.
+ * ext/socket/init.c: ditto.
-Wed Jun 8 08:33:10 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/socket/socket.c: ditto.
- * enum.c (enum_min_by, enum_max_by): return nil if no iteration.
- fixed: [ruby-dev:26245]
+ * ext/socket/ancdata.c: ditto.
- * eval.c (rb_need_block): ensure a block is given.
+ * ext/socket/unixsocket.c: ditto.
- * eval.c (backtrace): skip successive frames sharing same node.
+ r32588:
-Wed Jun 8 00:15:08 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * io.c (rb_update_max_fd): remove parentheses. they are not in
+ macro.
- * ext/socket/socket.c (ruby_getaddrinfo__aix): merged a patch from
- KUBO Takehiro <kubo at jiubao.org> to support AIX. [ruby-list:40832]
+Sun Jul 17 08:07:31 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Wed Jun 8 00:09:01 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * backport r32563 from trunk
- * lib/yaml/rubytypes.rb (Array::to_yaml): merged a patch from
- Tilman Sauerbeck <tilman at code-monkey.de>. [ruby-core:05055]
+ * test/openssl/test_ssl_session.rb: add PEM SSL session without TLS
+ extensions. Use this as the default for the tests to ensure
+ compatibility with OpenSSL 0.9.7.
+ [ Ruby 1.9 - Bug #4961 ] [ruby-core:37726]
- * lib/yaml/rubytypes.rb (Hash::to_yaml): ditto.
+Sat Jul 16 17:29:20 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jun 8 00:00:01 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * configure.in (RUBY_UNIVERSAL_ARCH): restore arch flag.
+ Bug #4977
- * ext/curses/curses.c (curses_insertln): merged a patch from
- TAKAHASHI Tamotsu <ttakah at lapis.plala.or.jp>. [ruby-ext:02305]
+Sat Jul 16 11:18:26 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Jun 7 19:34:15 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * win32/setup.mak: support to build x64-mswin64 on Windows7 (and Vista,
+ perhaps).
+ backported r32521 from trunk
- * lib/irb/init.rb (IRB::IRB.rc_file_generators): more flexible
- IRB.rc_file_generators. [ruby-core:05163]
+Sat Jul 16 06:31:23 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-Tue Jun 7 18:39:31 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/uri/common.rb (module): Remove optional parser argument to
+ Kernel#URI
+ [ruby-core:38061]
- * lib/thread.rb: RDoc documentation from Eric Hodel
- <drbrain at segment7.net> added. [ruby-core:05148]
+ * lib/uri/generic.rb (module): ditto
-Tue Jun 7 18:30:04 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jul 16 01:15:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/mkmf.rb (create_makefile): add .SUFFIXES from depend file.
- fixed: [ruby-dev:26294]
+ * time.c (time_dup): used rb_obj_class() instead of CLASS_OF().
+ The patch is made by Kazuki Tsujimoto. [Bug #5012] [ruby-dev:44071]
-Tue Jun 7 17:39:54 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_time.rb (TestTime#test_getlocal_dont_share_eigenclass):
+ added a new test for eigenclass of time object.
- * object.c (rb_mod_cvar_get): Module#class_variable_get(): back
- ported from CVS HEAD. [ruby-talk:144741]
+Fri Jul 15 19:11:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * object.c (rb_mod_cvar_set): Module#class_variable_set().
- [ruby-talk:144741]
+ * bignum.c (bigsub_int): add RB_GC_GUARD. This patch is made by
+ Makoto Kishimoto. fixes #4223 [ruby-dev:42907]
-Tue Jun 7 16:32:53 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * bignum.c (bigadd_int): ditto.
- * sprintf.c (rb_f_sprintf): raise exception on debug mode (-d),
- not verbose mode (-v/-w). [ruby-core:05123]
+Fri Jul 15 09:59:12 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Tue Jun 7 10:30:49 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * backport r32546 from trunk.
- * ext/tk/lib/multi-tk.rb: slave-ip fails to call procedures
- delegated by master-ip.
+ * ext/digest/sha2/sha2.c (SHA256_Update, SHA512_Update): avoid Bus
+ Error caused by unalignment access on Sparc-Solaris (and possibly on
+ other similar environment.) This patch just do memcpy always instead
+ of checking architecture. I see no perf drop on my 64bit env. For
+ more details, see #4320.
-Sun Jun 5 23:00:35 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/digest/test_digest.rb: add test for unalignment access.
- * ext/tk/lib/tk/console.rb: create console when required
- * ext/tk/sample/tkextlib/tile/demo.rb: fix TypeError & create Console
+Thu Jul 14 12:40:07 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Sat Jun 4 14:55:18 2005 Tanaka Akira <akr@m17n.org>
+ * backport r32537 from trunk.
- * test/dbm/test_dbm.rb: merged from ext/dbm/testdbm.rb.
+ * ext/openssl/ossl.c (ossl_verify_cb): trap the exception from
+ verify callback of SSLContext and X509Store and make the
+ verification fail normally. Raising exception directly from callback
+ causes orphan resources in OpenSSL stack. Patched by Ippei Obayashi.
+ See #4445.
- * test/gdbm/test_gdbm.rb: merged from ext/gdbm/testgdbm.rb.
+ * test/openssl/test_ssl.rb
+ (test_exception_in_verify_callback_is_ignored): test it.
- * test/sdbm/test_sdbm.rb: renamed from ext/sdbm/testsdbm.rb with
- modification to use test/unit.
+Wed Jul 13 08:20:08 2011 Shota Fukumori <sorah@tubusu.net>
-Fri Jun 3 14:06:12 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/test/unit.rb(Test::Unit::Options#process_args): Fix bug.
+ Fix process_args didn't return `@option` after r30939. Backported
+ r32526 from trunk.
- * ext/tk/lib/multi-tk.rb: fix typo.
+Mon Jul 11 23:50:39 2011 Yutaka Kanemoto <kanemoto@ruby-lang.org>
-Wed Jun 1 11:32:42 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * time.c: can't compile time.c on AIX due to missing declaration for
+ ffs(). It is declared in strings.h on AIX. backported r32518 from
+ trunk.
- * bcc32/Makefile.sub: can use single quote character in DESTDIR.
- [ruby-dev:26205]
+Mon Jul 11 23:47:00 2011 Yutaka Kanemoto <kanemoto@ruby-lang.org>
-Mon May 30 23:48:29 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * thread_pthread.c (get_stack): need to adjust stack addr for
+ [Bug #1813] on AIX. backported r32511 from trunk.
- * ext/tk/lib/tk/macpkg.rb: add PACKAGE_NAME information of Tcl/Tk
- Extension.
+Mon Jul 11 15:17:03 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tk/lib/tk/msgcat.rb: ditto.
+ * numeric.c (rb_num2ull): use FIX2LONG instead of FIX2ULONG. see
+ rb_num2ulong(). fixed the problem of ObjectSpace._id2ref of IL32LLP64
+ platforms, introduced at r32433.
+ backported r32512 from trunk.
- * ext/tk/lib/tk/winpkg.rb: ditto.
+Sun Jul 10 23:58:55 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * ext/tk/lib/tkextlib/*: ditto.
+ * version.h: 1.9.3 is no longer trunk.
-Sat May 28 16:40:15 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sun Jul 10 23:24:29 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * test/openssl/test_x509store.rb: add test for expired CRL
- and refine some assertions.
+ * class.c (rb_mix_module): reverted r31873.
+ (check_mix_method_i, do_mix_method_i) reverted r31917.
-Sat May 28 05:15:51 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * test/ruby/test_module.rb (TestModule#test_mix_const): reverted
+ r31918.
- * ext/openssl/ossl_x509store.c (ossl_x509stctx_set_time): should
- not set internal flag directry.
+Sun Jul 10 22:50:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Sat May 28 02:00:11 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/bigdecimal/bigdecimal.c (rmpd_power_by_big_decimal): fix
+ precision treatment errors.
- * lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line):
- ENV["REQUEST_URI"] is better to get correct Request-URI
- than ENV["SCRIPT_NAME"] + ENV["PATH_INFO"]. [ruby-dev:26235]
+ * test/bigdecimal/test_bigdecimal.rb: add tests for the above change.
+ fix precision treatment errors.
-Fri May 27 16:32:04 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_power): precision argument
+ should be optional for its compatibility.
- * lib/mkmf.rb: use the semicolon as the path separator
- in the environment of MSYS. fixed: [ruby-dev:26232]
+Sun Jul 10 22:38:09 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu May 26 06:08:11 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * parse.y (var_ref): distinguish vcall from local variable
+ references. based on a patch by Michael Edgar michael.j.edgar
+ AT dartmouth.edu. Bug #5002
- * ext/tk/lib/tk.rb: add shortcut-methods of tk_call + tk_split_list
+Sun Jul 10 21:51:29 2011 Koichi Sasada <ko1@atdot.net>
-Wed May 25 22:52:42 2005 Shugo Maeda <shugo@ruby-lang.org>
+ * internal.h: add comments (cautions).
- * lib/irb/input-method.rb: do not use Readline::HISTORY.pop.
- (backported from HEAD)
+Sun Jul 10 20:59:38 2011 Shota Fukumori <sorah@tubusu.net>
-Wed May 25 21:55:40 2005 Shugo Maeda <shugo@ruby-lang.org>
+ * lib/test/unit.rb: Add new class variable `@@testfile_prefix`.
+ This is for changing test name prefix. (For testing)
- * ext/readline/readline.c: supported libedit. (backported from HEAD)
+ * test/testunit/tests_for_parallel/ptest_first.rb: Renamed from
+ test_first.rb
- * ext/readline/extconf.rb: ditto.
+ * test/testunit/tests_for_parallel/ptest_second.rb: Renamed from
+ test_second.rb
- * test/readline/test_readline.rb: ditto.
+ * test/testunit/tests_for_parallel/ptest_third.rb: Renamed from
+ test_third.rb
-Wed May 25 20:06:27 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/testunit/tests_for_parallel/ptest_forth.rb: Renamed from
+ test_forth.rb
- * ext/tk/lib/tk.rb: TkComm#tk_split_*list fail to split a kind of SJIS
- strings. To avoid the trouble, add arguments to control converting
- encoding, and do split on a UTF8 string.
+ * test/testunit/tests_for_parallel/runner.rb: Remove misc.rb
- * ext/tk/lib/multi-tk.rb: modify to attend encoding.
+ * test/testunit/tests_for_parallel/ptest_first.rb: ditto.
- * ext/tk/lib/remote-tk.rb: ditto.
+ * test/testunit/tests_for_parallel/ptest_second.rb: ditto.
- * ext/tk/lib/tk/itemconfig.rb: ditto.
+ * test/testunit/tests_for_parallel/ptest_third.rb: ditto.
- * ext/tk/lib/tk/listbox.rb: ditto.
+ * test/testunit/tests_for_parallel/ptest_forth.rb: ditto.
- * ext/tk/lib/tk/namespace.rb: ditto.
+ * test/testunit/tests_for_parallel/misc.rb: Removed because no longer
+ needed.
- * ext/tk/lib/tk/panedwindow.rb: ditto.
+ * test/testunit/test_parallel.rb: Fix assertions for above.
- * ext/tk/lib/tk/text.rb: ditto.
+Sun Jul 10 16:57:08 2011 Koichi Sasada <ko1@atdot.net>
- * ext/tk/lib/tk/textmark.rb: ditto.
+ * vm_insnhelper.c (vm_throw): check a class frame.
+ Fixes Bug #4648.
+ The patch is contributed by Kazuki Tsujimoto.
- * ext/tk/lib/tk/texttag.rb: ditto.
+ * bootstraptest/test_proc.rb: add tests for above.
- * ext/tk/lib/tk/variable.rb: ditto.
+Sun Jul 10 17:28:01 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/tk/lib/tk/winfo.rb: ditto.
+ * thread_pthread.c (mutex_debug): use exit(EXIT_FAILURE) instad of
+ exit(1).
+ * thread_pthread.c (add_signal_thread_list): ditto.
+ * thread.c (rb_thread_call_with_gvl): ditto.
+ * util.c (Bug): ditto.
- * ext/tk/lib/tkextlib/iwidgets/scrolledlistbox.rb: ditto.
+Sun Jul 10 15:58:12 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/tkextlib/iwidgets/scrolledtext.rb: ditto.
+ * ext/json: Merge json gem 1.5.4+ (f7f78896607b6f6226cd).
+ [Bug #4700]
- * ext/tk/lib/tk.rb: add TkWindow#lower_window/raise_window and
- Tk#lower_window/raise_window by reason of method-name conflict
+Sun Jul 10 16:41:32 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/tk/lib/tk/canvas.rb: bug fix on TkCanvas#delete when given
- non-TkcItem arguments.
+ * vm_core.h (typedef struct rb_vm_struct): create a new
+ 'inhibit_thread_creation' field.
+ * thread.c (rb_thread_terminate_all): set inhibit_thread_creation.
+ * thread.c (thread_s_new): don't permit to create new thread
+ if the VM is under destruction. Otherwise evil finalizer code
+ can make SEGV. [Bug #4992][ruby-core:37858]
- * ext/tk/lib/tkextlib/iwidgets/scrolledcanvas.rb: ditto.
+ * bootstraptest/test_objectspace.rb: new test for this fix.
-Wed May 25 12:59:48 2005 Tanaka Akira <akr@m17n.org>
+Sun Jul 10 16:06:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/open-uri.rb (OpenURI::Meta::RE_QUOTED_STRING): a content of
- quoted-string should be zero or more characters.
+ * signal.c (sigsegv): use abort() instead of exit() when nested
+ SEGV was happen. Because unnested SEGV use abort().
+ [Bug #5013][ruby-dev:44078]
-Tue May 24 23:42:16 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sun Jul 10 15:30:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * numeric.c (fix_pow): support Fixnum ** Float case directly
- without coercing. [ruby-talk:142697] [ruby-talk:143054]
+ * load.c (rb_f_autoload): prevent to autoload for singleton
+ classes. fixes [Bug #4886] [ruby-dev:43816]
-Tue May 24 16:57:24 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * bootstraptest/test_autoload.rb: add tests for the above change.
- * ruby.c (require_libraries): caused SEGV when continuation jumped
- in to the required library code.
+Sun Jul 10 15:09:17 2011 Shota Fukumori <sorah@tubusu.net>
-Tue May 24 11:56:25 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+ * lib/test/unit/assertions.rb: Import documentation patch by Justin
+ Collins. [ruby-core:37225] [Feature #4903]
- * lib/getopts.rb: should warn only if verbose mode.
- fixed: [ruby-dev:26201]
+Sun Jul 10 14:57:36 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Tue May 24 06:45:31 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/date/date_core.c: canonicalizes nth and sf.
- * misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): string
- literals to be matched non-greedy.
+Sun Jul 10 14:13:50 2011 Koichi Sasada <ko1@atdot.net>
-Tue May 24 00:34:32 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * internal.h (rb_thread_call_with_gvl, rb_thread_call_without_gvl):
+ make them visible as experimental C APIs. fixes Feature #4328.
- * test/soap/calc: method name 'set' was able to crash with a class Set.
- [ruby-dev:26210]
+Sun Jul 10 12:18:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * test/wsdl/document/test_rpc.rb: dateTime comparison failed under
- TZ=right/Asia/Tokyo (with leap second.) [ruby-dev:26208]
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_power): support non-integral
+ exponent. fixes [Bug #3271]
-Mon May 23 16:24:05 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/bigdecimal/bigdecimal.c (rmpd_power_by_big_decimal): ditto.
- * ext/tcltklib/extconf.rb: Framework support on MacOS X Tiger.
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_power_op): add a function to
+ only use for "**" operator.
- * ext/tcltklib/README.1st: add description of Framework support options.
+ * test/bigdecimal/test_bigdecimal.rb: add a bunch of tests for the
+ above changes.
-Mon May 23 12:21:37 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/bigdecimal/bigdecimal.c (is_integer): add an utility function.
- * re.c (make_regexp): should not return junk address during
- compile time. [ruby-dev:26206]
+ * ext/bigdecimal/bigdecimal.c (is_negative): ditto.
-Sun May 22 21:54:06 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/bigdecimal/bigdecimal.c (is_positive): ditto.
- * lib/{soap,wsdl,xsd}, test/{soap,wsdl,xsd}: imported soap4r/1.5.4.
+ * ext/bigdecimal/bigdecimal.c (is_zero): ditto.
- == SOAP client and server ==
+ * ext/bigdecimal/bigdecimal.c (is_one): ditto.
- === for both client side and server side ===
+ * ext/bigdecimal/bigdecimal.c (is_even): ditto.
- * improved document/literal service support.
- style(rpc,document)/use(encoding, literal) combination are all
- supported. for the detail about combination, see
- test/soap/test_style.rb.
+Sun Jul 10 12:08:39 2011 Yusuke Endoh <mame@tsg.ne.jp>
- * let WSDLEncodedRegistry#soap2obj map SOAP/OM to Ruby according to
- WSDL as well as obj2soap. closes #70.
+ * compile.c (when_vals): when a string literal is written on when
+ clause, skip string creation to make it faster. [ruby-dev:44068]
+ [Feature #5000]
- * let SOAP::Mapping::Object handle XML attribute for doc/lit service.
- you can set/get XML attribute via accessor methods which as a name
- 'xmlattr_' prefixed (<foo name="bar"/> -> Foo#xmlattr_name).
+Sun Jul 10 11:35:29 2011 Yusuke Endoh <mame@tsg.ne.jp>
- === client side ===
+ * parse.y (reduce_nodes_gen): NODE_RETURN in rescue body must not be
+ reduced when there is an else clause. This caused bizarre behavior
+ in [Bug #4473] [ruby-core:35629] [ruby-core:37884].
- * WSDLDriver capitalized name operation bug fixed. from
- 1.5.3-ruby1.8.2, operation which has capitalized name (such as
- KeywordSearchRequest in AWS) is defined as a method having
- uncapitalized name. (converted with GenSupport.safemethodname
- to handle operation name 'foo-bar'). it introduced serious
- incompatibility; in the past, it was defined as a capitalized.
- define capitalized method as well under that circumstance.
+Sun Jul 10 09:46:14 2011 Masaya Tarui <tarui@ruby-lnag.org>
- * added new factory interface 'WSDLDriverFactory#create_rpc_driver'
- to create RPC::Driver, not WSDLDriver (RPC::Driver and WSDLDriver
- are merged). 'WSDLDriverFactory#create_driver' still creates
- WSDLDriver for compatibility but it warns that the method is
- deprecated. please use create_rpc_driver instead of create_driver.
+ * range.c (range_max): fix behavior with excluded end value.
+ [Bug #4591]
- * allow to use an URI object as an endpoint_url even with net/http,
- not http-access2.
+Sun Jul 10 09:13:18 2011 Eric Hodel <drbrain@segment7.net>
- === server side ===
+ * NEWS: Fix RubyGems version. [Ruby 1.9 - Bug #5004]
- * added mod_ruby support to SOAP::CGIStub. rename a CGI script
- server.cgi to server.rb and let mod_ruby's RubyHandler handles the
- script. CGIStub detects if it's running under mod_ruby environment
- or not.
+Sat Jul 9 20:01:59 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * added fcgi support to SOAP::CGIStub. see the sample at
- sample/soap/calc/server.fcgi. (almost same as server.cgi but has
- fcgi handler at the bottom.)
+ * internal.h: rb_rational_reciprocal is defined in rational.c.
- * allow to return a SOAPFault object to respond customized SOAP fault.
+Sat Jul 9 19:48:31 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * added the interface 'generate_explicit_type' for server side
- (CGIStub, HTTPServer). call 'self.generate_explicit_type = true'
- if you want to return simplified XML even if it's rpc/encoded
- service.
+ * internal.h: added declarations.
+ * complex.c: followed the above change.
- == WSDL ==
+Sat Jul 9 17:24:41 2011 Tadayoshi Funaba <tadf@dotrb.org>
- === WSDL definition ===
+ * NEWS: bigdecimal is not a builtin.
- * improved XML Schema support such as extension, restriction,
- simpleType, complexType + simpleContent, ref, length, import,
- include.
+Sat Jul 9 17:17:53 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * reduced "unknown element/attribute" warnings (warn only 1 time for
- each QName).
+ * ext/date/date_core.c: some improvements for performance.
- * importing XSD file at schemaLocation with xsd:import.
+Sat Jul 9 16:56:01 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- === code generation from WSDL ===
+ * atomic.h (ATOMIC_OR): _InterlockedOr is unavailable in VC6.
- * generator crashed when there's '-' in defined element/attribute
- name.
+ * numeric.c (ULLONG_MAX): fallback definition.
- * added ApacheMap WSDL definition.
+Sat Jul 9 15:59:19 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * sample/{soap,wsdl}: removed.
+ * win32/win32.c (rb_w32_{read,write}): should be signed.
+ Bug #5001
-Sun May 22 19:11:35 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sat Jul 9 14:02:20 2011 Takeyuki FUJIOKA <xibbar@ruby-lang.org>
- * ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLServer#intialize):
- should initialize session id context. [ruby-core:4663]
+ * lib/cgi/core.rb: fix multipart form parsing bug. [Bug #3866]
- * ext/openssl/ossl_ssl.c (ossl_sslctx_setup): add session id support.
+Sat Jul 9 11:41:03 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-Sat May 21 10:24:21 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * lib/matrix.rb: Add Vector#normalize [ruby-dev:43829]
- * bcc32/Makefile.sub: tds files were not deleted when DESTDIR
- included '\' path delimiter. [ruby-dev:26193]
+Sat Jul 9 09:25:06 2011 Eric Hodel <drbrain@segment7.net>
-Thu May 19 19:04:29 2005 speakillof <speakillof@yahoo.co.jp>
+ * enumerator.c: Remove "enumeration sequenced by".
+ [Ruby 1.9 - Bug #4757]
- * lib/rexml/encodings/SHIFT-JIS.rb: encoding and decoding were
- swapped. [ruby-core:4772]
+Sat Jul 9 09:14:56 2011 Eric Hodel <drbrain@segment7.net>
-Wed May 18 23:42:25 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c: Note that methods other than IO#gets may increase IO#lineno.
+ [Ruby 1.9 - Bug #4902]
- * error.c (exc_exception): reverted to call Exception#initialize
- directly. fixed: [ruby-dev:26177]
+Sat Jul 9 08:39:39 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed May 18 23:39:09 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * common.mk (RUN_OPT): disable gems.
- * dir.c (glob_helper): get rid of using String. [ruby-dev:26180]
+Sat Jul 9 08:37:05 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * dir.c (push_braces): should skip balanced braces.
+ * io.c (rb_io_close): close(2) on a fd which is being read by
+ another thread causes deadlock on Mac OS X 10.5
- * eval.c (ruby_options), win32/win32.c (NtInitialize): move argument
- intialization back. [ruby-dev:26180]
+Fri Jul 8 21:20:39 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Tue May 17 15:31:31 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * addr2line.c: use USE_ELF instead of __ELF__ because Solaris
+ doesn't define it. USE_ELF is already provided by configure.
+ patched by Naohisa Goto. [ruby-dev:44066] [Bug #4998]
- * lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should
- break the loop if the socket reached to EOF. [ruby-talk:142285]
+ * addr2line.h: ditto.
-Tue May 17 11:52:18 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * vm_dump.c: ditto.
- * win32/win32.c (unixtime_to_filetime): use localtime() instead of
- gmtime() when using FileLocalTimeToFileTime().
+Fri Jul 8 16:40:38 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon May 16 22:28:43 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/json/parser/parser.rl (convert_encoding): should not modify
+ the argument.
- * win32/win32.h, {bcc32,win32,wince}/Makefile.sub: moved rb_[ugp]id_t
- to get rid of redefinition warnings on mingw.
+ * ext/json/parser/parser.rl (convert_encoding): no needs to use
+ force_encoding.
- * class.c (rb_class_init_copy): singleton class is disallowed to copy,
- from its definition. fixed: [ruby-talk:142749]
+Fri Jul 8 15:53:31 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon May 16 08:52:29 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * error.c (rb_bug): get rid of segfault after all threads
+ disposed.
- * win32/win32.{h,c}: define rb_[pgu]id_t.
+Fri Jul 8 15:01:06 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon May 16 00:21:02 2005 Tanaka Akira <akr@m17n.org>
+ * ext/openssl/ossl.h: include openssl/e_os2.h before checking the
+ definition of OPENSSL_SYS_WIN32.
- * lib/pathname.rb (Pathname#unlink): use SystemCallError instead of
- Errno::EISDIR because EISDIR is not portable.
- [ruby-core:5001]
+Fri Jul 8 14:40:39 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Sun May 15 22:11:33 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * win32/win32.c (wunlink): reverted a part of r32426. it was mistakenly
+ mixed.
- * lib/drb/drb.rb (DRbObject#method_missing): use raise(exception).
- [ruby-dev:26164]
+Fri Jul 8 14:29:47 2011 Narihiro Nakamura <authornari@gmail.com>
-Sun May 15 18:56:35 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in: can't subtract void *.
- * configure.in, ruby.h: define rb_[pgu]id_t macros instead of typedefs
- to get rid of types which might not be defined yet. [ruby-dev:26165]
+Fri Jul 8 14:33:26 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Sun May 15 14:35:46 2005 Tanaka Akira <akr@m17n.org>
+ * win32/Makefile.sub (config.h): define GC_MARK_STACKFRAME_WORD.
+ fixed build problem of r32438. the value (30) is temporary value.
+ maybe it's enough by 20~24 according to my observation.
- * lib/pathname.rb (Pathname#unlink): unlink a symlink to a directory
- was failed. [ruby-core:4992]
+Fri Jul 8 13:47:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun May 15 09:57:30 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread.c (rb_mutex_unlock_all): folded into
+ rb_threadptr_unlock_all_locking_mutexes.
+ * thread.c (rb_threadptr_unlock_all_locking_mutexes) ditto.
- * win32/win32.c (unixtime_to_filetime): deal with DST.
- [ruby-talk:141817]
+Fri Jul 8 13:36:02 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sat May 14 23:59:11 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread.c (thread_unlock_all_locking_mutexes): rename to
+ rb_threadptr_unlock_all_locking_mutexes and remove static.
+ * vm_core.h: add rb_threadptr_unlock_all_locking_mutexes declaration.
+ * thread.c (thread_start_func_2): adjust the above rename.
- * error.c (exc_exception, {exit,name_err,syserr}_initialize): call
- Execption#initialize. fixed: [ruby-talk:142593]
+ * eval.c (ruby_cleanup): call rb_threadptr_unlock_all_locking_mutexes
+ again after finalizer. [Bug #4988] [ruby-dev:44049]
-Sat May 14 23:57:26 2005 Erik Huelsmann <ehuels@gmail.com>
+Fri Jul 8 13:06:09 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * configure.in: Check for the availability of pid_t, gid_t and uid_t and
- remove AC_TYPE_UID_T. fixed: [ruby-core:04745]
+ * cont.c (FIBER_MACHINE_STACK_ALLOCATION_SIZE): Fiber stack size
+ don't need to keep multiple number of sizeof(VALUE).
- * defines.h: Remove pid_t typedef.
+Fri Jul 8 11:39:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ruby.h: Define rb_pid_t, rb_gid_t and rb_uid_t in accordance with
- the available system types.
+ * common.mk (sudo-precheck): true command is not standard on
+ Windows.
- * process.c: Change instances of pid_t and gid_t to their rb_*
- counterparts.
+Fri Jul 8 10:39:52 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/pty/pty.c: Change pid_t to rb_pid_t.
+ * thread_pthread.c (gvl_destroy): fix cond_t leak.
- * vms/config.h: Define HAVE_{P,G,U}ID_T to 1.
+Fri Jul 8 09:17:59 2011 Eric Hodel <drbrain@segment7.net>
- * win32/Makefile.sub: Remove #define for {g,u}id_t.
+ * gc.c: Improve documentation
- * win32/win32.c: Change pid_t to rb_pid_t.
+Thu Jul 7 23:35:31 2011 Narihiro Nakamura <authornari@gmail.com>
- * wince/Makefile.sub: Remove #define for {g,u}id_t.
+ * gc.c: change water_mark value that may call
+ gc_mark(lev <= GC_LEVEL_MAX) in gc_mark().
+ In ruby_stack_check(), water_mark is a value that may call some
+ C function. Fixes Bug #3781
- * wince/sys/types.h: Remove definitions of {p,g,u}id_t.
+ * configure.in: define GC_MARK_STACKFRAME_WORD that approximate
+ size of gc_mark() and gc_mark_children() stackframes.
-Fri May 13 23:44:22 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Jul 7 17:55:05 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/extmk.rb: keep srcdir unexpanded.
+ * test/testunit/test_parallel.rb (TestParallelWorker#teardown): wait
+ the child process even if the communication pipe is broken.
- * lib/mkmf.rb (create_makefile): quote topdir and hdrdir if necessary.
- fixed: [ruby-core:04932]
+Thu Jul 7 15:44:42 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/mkmf.rb (configuration), {bcc32,win32,wince}/Makefile.sub: make
- also INSTALL_PROG and INSTALL_DATA system dependent.
- fixed: [ruby-core:04931]
+ * encoding.c (rb_enc_set_index, rb_enc_associate_index): should
+ check if frozen.
-Fri May 13 17:54:39 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * parse.y (rb_intern3), ruby.c (process_options, ruby_script):
+ defer freezing after associating encodings.
- * variable.c (generic_ivar_get): rb_attr_get should not warn.
- [ruby-dev:26010]
+Thu Jul 7 15:16:51 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Fri May 13 12:28:43 2005 Daniel Berger <djberge@qwest.com>
+ * numeric.c (rb_num2ull): use own switch sentence.
+ Current implementation can't convert 18446744073709551615.
- * array.c (rb_ary_select): can remove argc check. [ruby-core:4911]
+Thu Jul 7 06:56:15 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * test/ruby/test_array.rb: add test for find_all.
+ * cont.c (FIBER_STACK_FLAGS): workaround fix for r32420 on FreeBSD.
-Fri May 13 11:29:00 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Jul 7 06:46:12 2011 Eric Hodel <drbrain@segment7.net>
- * eval.c (unknown_node): add volatile directive to prototype.
+ * benchmark/driver.rb: Add difference column to report that averages
+ across all runs of a benchmark. [Ruby 1.9 - Feature #4982]
-Thu May 12 17:08:48 2005 Tanaka Akira <akr@m17n.org>
+Thu Jul 7 06:19:38 2011 Eric Hodel <drbrain@segment7.net>
- * io.c (rb_io_eof, remain_size, read_all, io_read, appendline)
- (swallow, rb_io_each_byte, rb_io_getc): revert previous change.
+ * lib/rubygems.rb: Reduce requires to improve `make benchmark`.
+ [#4962]
+ * lib/rubygems/specification.rb: Delay initialization of rubygems
+ until require is called.
- * io.c (rb_io_eof, io_fread, appendline, swallow, rb_io_each_byte)
- (rb_io_getc, rb_getc): call clearerr before getc to avoid
- stdio incompatibility.
+Thu Jul 7 04:31:26 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu May 12 16:52:20 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * parse.y (arg): rescue_mod is in inverse order from other
+ modifiers. patched by michael.j.edgar AT dartmouth.edu at
+ [ruby-core:36248]. fixed #4716.
- * lib/rdoc/parsers/parse_c.rb: more readability for mixing
- progress "c..." and warning message.
+Thu Jul 7 00:40:16 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu May 12 16:31:00 2005 NARUSE, Yui <naruse@ruby-lang.org>
+ * win32/win32.c (kill): check that the process exited or not before
+ terminating it. [Bug #4943]
- * ext/nkf/nkf-utf8/nkf.c: follow nkf 2.0.5
+Wed Jul 6 23:13:19 2011 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu May 12 16:15:01 2005 Tanaka Akira <akr@m17n.org>
+ * parse.y (opt_call_args): allow trailing comma after assoc
+ argument e.g. 'foo(bar:1,)'. fixed #3456
- * io.c (rb_io_eof, remain_size, read_all, io_read, appendline)
- (swallow, rb_io_each_byte, rb_io_getc): don't rely EOF flag.
- [ruby-talk:141527]
+Wed Jul 6 22:11:12 2011 Shota Fukumori <sorah@tubusu.net>
-Thu May 12 15:56:20 2005 Tilman Sauerbeck <tilman@code-monkey.de>
+ * test/cgi/test_cgi_header.rb(test_cgi_header_nph): Validate date in
+ "Date:" header
- * lib/rdoc/parsers/parse_c.rb: show parsing progress for C files.
- [ruby-core:4341]
+Wed Jul 6 21:29:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu May 12 13:47:56 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * cont.c (fiber_machine_stack_alloc): cleanup pointer arithmetic.
+ "size/sizeof(VALUE)" is ugly and easy confusing.
+ * cont.c (fiber_initialize_machine_stack_context): ditto.
- * test/drb/test_drb{ssl,unix}.rb: can test drb
- before install. (backported from HEAD) [ruby-dev:26146]
+Wed Jul 6 21:24:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu May 12 09:53:57 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * cont.c (fiber_machine_stack_alloc): fix mprotect misuse. A stack
+ guard page should have PROT_NONE.
+ * cont.c (fiber_initialize_machine_stack_context):
+ th->machine_stack_maxsize shouldn't be included guard pages size.
+ [Bug #4983][ruby-dev:44043]
- * version.c (ruby_show_version): flush for non-tty stdout.
+Wed Jul 6 21:23:38 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu May 12 09:07:07 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * cont.c (fiber_machine_stack_alloc): use MAP_STACK if it's provided.
- * test/ruby/envutil.rb, test/drb/drbtest.rb: can test drb
- before install. (backported from HEAD) [ruby-Bugs-1672]
+Wed Jul 6 21:22:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu May 12 01:23:55 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * cont.c (fiber_machine_stack_alloc): use MAP_FAILED instead of -1.
- * eval.c (rb_eval), parse.y (arg): reduce fixnum range literal at
- parser. fixed: [ruby-dev:26113]
+Wed Jul 6 21:21:05 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * eval.c (unknown_node): ignore broken NODE to get rid of accessing
- possibly inaccessible address. fixed: [ruby-dev:26122]
- should emit more useful information like [ruby-dev:26126], though.
+ * cont.c (fiber_machine_stack_alloc): remove unnecessary cast.
-Wed May 11 16:20:01 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Wed Jul 6 18:10:13 2011 Shota Fukumori <sorah@tubusu.net>
- * lib/webrick/cgi.rb: new methods WEBrick::CGI#[], WEBrick::CGI#logger
- and WEBrick::CGI#config. (backported from HEAD)
+ * test/cgi/test_cgi_header.rb(test_cgi_header_nph): Adding space after
+ comma.
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils.escape_path): should
- not use String#split("/"). (backported from HEAD)
+ * test/cgi/test_cgi_header.rb(test_cgi_header_nph): Remove variable
+ `now`. Suppress warning.
-Wed May 11 15:58:39 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Jul 6 12:18:09 2011 Shota Fukumori <sorah@tubusu.net>
- * eval.c (break_jump): break should not cross functions.
- [ruby-list:40818]
+ * test/cgi/test_cgi_header.rb(test_cgi_header_nph): Fix bug depends to
+ time. The test fails if time past 1 second in line 136-145
-Wed May 11 10:39:37 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Tue Jul 5 15:28:04 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/tempfile.rb (Tempfile#unlink): fixed typo.
+ * parse.y (parser_here_document): should dispatch heredoc_end
+ scanner event on an empty here document. fixed Bug#4543.
-Wed May 11 01:03:36 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 5 13:49:26 2011 Yusuke Endoh <mame@tsg.ne.jp>
- * eval.c (TMP_ALLOC): use macro NEW_NODE() to get rid of warnings on
- platforms which have no alloca(). fixed: [ruby-talk:141301]
+ * addr2line.c: fix r32407 to check HAVE_ALLOCA_H.
-Sun May 8 23:17:47 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Jul 5 14:05:43 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/tk/timer.rb: fix typo.
+ * lib/webrick/httpauth/digestauth.rb (_authenticate):
+ Literal texts in HTTP ABNF is case-insensitive (RFC2616 2.1),
+ and a sample implementation in RFC2617 also ignores the case
+ of algorithms. So now this ignores those cases.
+ [ruby-dev:43965] [Feature #4936]
-Sun May 8 16:52:56 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * lib/webrick/httpauth/digestauth.rb (initialize):
+ Because of above, opera_hack is useless and removed.
- * lib/profiler.rb: fixed "undefined method `[]' for nil:NilClass"
- [ruby-core:4775] [ruby-talk:140401] [ruby-dev:26118]
+Tue Jul 5 01:30:01 2011 Yusuke Endoh <mame@tsg.ne.jp>
-Sat May 7 22:58:00 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread_pthread.c (native_sleep): cut the waiting time up to
+ 100,000,000 because Solaris cond_timedwait() return EINVAL if an
+ argument is greater than current_time + 100,000,000. This is
+ considered as a kind of spurious wakeup. The caller to native_sleep
+ should care about spurious wakeup.
- * lib/mkmf.rb (have_var): no libs argument is given.
+Tue Jul 5 01:24:26 2011 Yusuke Endoh <mame@tsg.ne.jp>
-Sun May 1 09:58:11 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * cont.c: disable FIBER_USE_NATIVE on Solaris because resuming any
+ Fiber caused SEGV. I haven't follow up the issue deeply, but it
+ works when disabling the feature.
- * ruby.c (process_sflag): replace '-' in variable names with '_'.
- [ruby-dev:26107]
+Tue Jul 5 01:22:46 2011 Yusuke Endoh <mame@tsg.ne.jp>
- * ruby.c (set_arg0): use also environment variable space for setting
- $0. [ruby-core:04774]
+ * addr2line.c: include <alloca.h> to fix a build issue on Solaris.
-Wed Apr 27 23:42:22 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 5 00:49:05 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * win32/Makefile.sub (OPTFLAGS): default global optimization to
- disabled only for VC++6.
+ * ext/coverage/coverage.c: resurrect r32071 + add GC guard for
+ rb_coverages. [ruby-core:37352] [Bug #4927]
+ [ruby-core:36539] [Feature #4796]
-Tue Apr 26 22:58:00 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/coverage/test_coverage.rb resurrect r32071.
- * ext/tcltklib/tcltklib.c (ip_invoke_core): call Tcl's "::unknown"
- command when can't get information of target command.
+Mon Jul 4 22:24:46 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Apr 25 01:18:43 2005 Tanaka Akira <akr@m17n.org>
+ * thread_pthread.c (get_stack): For NetBSD/FreeBSD, use
+ pthread_attr_getstack() if possible. and, remove an assumption
+ of stack growing direction.
- * regex.c: declare rb_warn to have variadic argument. [ruby-core:4751]
+Mon Jul 4 20:42:31 2011 Yusuke Endoh <mame@tsg.ne.jp>
-Sat Apr 23 19:45:59 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * ext/coverage/coverage.c: revert r32071. The commit caused SEGV on
+ some minor nonfree OS. I have no means of debugging the bug. My
+ personal opinion is that such OS should be unsupported unless there
+ is an active maintainer. [ruby-core:37352]
- * ext/tcltklib/tcltklib.c (ip_RubyExitCommand): exit with status code
- via TclTkIp#_eval didn't work. [ruby-talk:139390]
+ * test/coverage/test_coverage.rb: ditto.
-Fri Apr 22 16:41:50 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Mon Jul 4 07:14:12 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tcltklib/tcltklib.c (ip_set_exc_message): fixed memory leak.
+ * thread_pthread.c (get_stack): the return address of get_stack
+ must be the highest address of the current thread's stack.
- * ext/tcltklib/tcltklib.c: eTkCallbackReturn was not initialized.
+Mon Jul 4 06:37:22 2011 Koichi Sasada <ko1@atdot.net>
-Thu Apr 21 00:07:50 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * include/ruby/intern.h, thread_pthread.c (rb_reserved_fd_p,
+ RB_RESERVED_FD_P): added. This C API is to limit to access
+ fds which are used by RubyVM internal. In this version of
+ CRuby, return 1 if fd is communication pipe.
+ If your application needs to close all file descriptors to
+ present resource leak, skip internal fds using this C API.
+ We also define a macro RB_RESERVED_FD_P(fd). So you can write
+ #ifndef RB_RESERVED_FD_P
+ #define RB_RESERVED_FD_P(fd) 0
+ #endif
+ for Ruby 1.9.2 or previous version to write compatible extensions.
+ See [ruby-core:37727]
- * lib/mkmf.rb (create_makefile): support platforms have file separator
- other than /.
+ * thread_win32.c (rb_reserved_fd_p): added (return 0 for any fds).
- * {bcc32,win32,wince}/Makefile.sub (BUILD_FILE_SEPARATOR): separator
- of building platform.
+ * io.c (rb_io_initialize): raise ArgumentError if given fd is reserved by Ruby.
- * {bcc32,win32,wince}/Makefile.sub (CP, INSTALL): use COPY command.
+Sun Jul 3 23:43:56 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-Wed Apr 20 23:22:39 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/extmk.rb (extmake): suppresses outputs from extconf.rb.
+ (extmake) warns a failure in extconf.rb.
- * Makefile.in, common.mk: miniruby depens on MINIOBJS.
+Sun Jul 3 13:44:51 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * dmydln.c (dln_load): dummy function to raise LoadError.
+ * array.c (ary_reject_bang): should not remove elements which are
+ not yielded. [Bug #2545]
- * cygwin/GNUmakefile.in, {bcc32,win32,wince}/Makefile.sub: miniruby
- can't load extensions on Windows.
+Sun Jul 3 06:10:26 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Apr 20 23:01:35 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread_pthread.c (get_stack): pthread_attr_getstack() doesn't
+ return stack start address, but stack base address. Thus,
+ we need to add stack size for getting stack start address.
+ And, we don't have to decrease guard size twice.
+ * thread_pthread.c (thread_start_func_1): don't use inaccurate
+ stack start guess if native_thread_init_stack() can be used.
+ [Bug #1813] [ruby-core:24540]
- * win32/ifchange.bat: delete testing files.
+Sun Jul 3 04:50:08 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Apr 20 07:27:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread_pthread.c (get_stack): add to a care of guard page on Mac
+ OS X. [Bug #1813] [ruby-core:24540]
+ * signal.c (ruby_signal): SIGBUS use alternative stack too.
+ * signal.c (sigbus): On Mac, thread stack overflow makes SIGBUS
+ instead of SIGSEGV. thus, added stackoverflow check.
+ * signal.c (default_handler): get rid of compilation warning.
+ * signal.c (Init_signal): ditto.
- * {bcc32,win32,wince}/configure.bat, {bcc32,win32,wince}/setup.mak:
- add extout option.
+Sat Jul 02 08:59:20 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * bcc32/setup.mak: make configuration variables overridable.
+ * test/openssl/test_ocsp.rb
+ * test/openssl/test_x509_cert.rb: Perform SHA-256 tests only if
+ supported by the available OpenSSL version. Versions < 0.9.8 don't
+ support it. [ruby-core:37724]
-Wed Apr 20 04:15:27 2005 Keiju Ishitsuka <keiju@ruby-lang.org>
+Sat Jul 2 07:17:45 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/irb.rb lib/irb/* doc/irb: IRB 0.9.5
+ * array.c (rb_ary_reject_bang, rb_ary_delete_if): rejected
+ elements should be removed. fixed [Bug #2545]
-Tue Apr 19 23:37:09 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+Sat Jul 2 01:57:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * lib/ftools.rb (File.safe_unlink): do not modify a symlinked file.
+ * NEWS: remove a description of Kernel#respond_to? because it has
+ been reverted at revision 28564.
-Tue Apr 19 00:06:20 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jul 2 00:58:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * ext/extmk.rb: expand path for ext/**/extconf.rb.
+ * NEWS: describe a change of multiplication of Bignum.
-Mon Apr 18 11:25:14 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Fri Jul 1 18:52:31 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/zlib/zlib.c (zstream_run): fixed SEGV. [ruby-core:4712]
+ * benchmark/bm_app_erb.rb: increase loop count. too short
+ measurement time makes less accuracy.
+ * benchmark/bm_app_factorial.rb: ditto.
+ * benchmark/bm_app_mandelbrot.rb: ditto.
+ * benchmark/bm_app_strconcat.rb: ditto.
-Sun Apr 17 23:57:49 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * benchmark/bm_io_file_create.rb: ditto.
+ * benchmark/bm_io_file_read.rb: ditto.
+ * benchmark/bm_io_file_write.rb: ditto.
- * ext/extmk.rb (extmake, parse_args): do not expand destdir.
+ * benchmark/bm_so_concatenate.rb: ditto.
+ * benchmark/bm_so_lists.rb: ditto.
+ * benchmark/bm_so_matrix.rb: ditto.
+ * benchmark/bm_so_random.rb: ditto.
+ * benchmark/bm_so_sieve.rb: ditto.
- * ext/extmk.rb (relative_from): treat mere drive letter as an absolute
- path.
+ * benchmark/bm_vm_thread_mutex1.rb: ditto.
+ * benchmark/bm_vm_thread_mutex2.rb: ditto.
+ * benchmark/bm_vm_thread_mutex3.rb: ditto.
-Sat Apr 16 17:01:16 2005 Kouhei Sutou <kou@cozmixng.org>
+ * benchmark/bm_vm1_block.rb: cleanup.
+ * benchmark/bm_vm1_const.rb: cleanup.
+ * benchmark/bm_vm1_ensure.rb: cleanup.
+ * benchmark/bm_vm1_ivar.rb: cleanup.
+ * benchmark/bm_vm1_length.rb: cleanup.
+ * benchmark/bm_vm1_neq.rb: cleanup.
+ * benchmark/bm_vm1_not.rb: cleanup.
+ * benchmark/bm_vm1_rescue.rb: cleanup.
+ * benchmark/bm_vm1_simplereturn.rb: cleanup.
+ * benchmark/bm_vm1_swap.rb: cleanup.
- * sample/rss/tdiary_plugin/rss-recent.rb (rss_recent_cache_rss):
- use the first date information of items as site date information
- if channel doesn't have date information.
+ * benchmark/bm_vm2_array.rb: cleanup.
+ * benchmark/bm_vm2_case.rb: cleanup.
+ * benchmark/bm_vm2_defined_method.rb: cleanup.
+ * benchmark/bm_vm2_eval.rb: cleanup.
+ * benchmark/bm_vm2_method.rb: cleanup.
+ * benchmark/bm_vm2_mutex.rb: cleanup.
+ * benchmark/bm_vm2_poly_method.rb: cleanup.
+ * benchmark/bm_vm2_poly_method_ov.rb: cleanup.
+ * benchmark/bm_vm2_proc.rb: cleanup.
+ * benchmark/bm_vm2_regexp.rb: cleanup.
+ * benchmark/bm_vm2_send.rb: cleanup.
+ * benchmark/bm_vm2_super.rb: cleanup.
+ * benchmark/bm_vm2_unif1.rb: cleanup.
+ * benchmark/bm_vm2_zsuper.rb: cleanup.
-Sat Apr 16 15:27:03 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * benchmark/bm_vm_thread_alive_check1.rb: cleanup.
- * configure.in (RUBY_PROG_INSTALL): not add -p option to INSTALL.
- files need timestamps to be kept are only ar-archive on a few
- platforms, and be installed by instruby.rb but not INSTALL.
- fixed: [ruby-core:04721]
+Fri Jul 1 15:23:00 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * mkconfig.rb: purge autoconf value variables.
+ * lib/matrix: Add LUP decomposition
-Sat Apr 16 10:36:01 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Fri Jul 1 15:21:14 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * bcc32/Makefile.sub: quick hack... prepend DESTDIR.
- still have restriction on DESTDIR ("", "/", "e:")
+ * lib/matrix.rb: Allow non integer exponents for Matrix#**
-Sat Apr 16 03:59:42 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Fri Jul 1 15:13:25 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * ext/openssl/extconf.rb: check for OPENSSL_cleanse.
+ * lib/matrix: Add Eigenvalue Decomposition
- * ext/openssl/openssl_missing.h: ditto.
+Fri Jul 1 15:10:22 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-Thu Apr 14 19:18:30 2005 Minero Aoki <aamine@loveruby.net>
+ * lib/matrix: Add Matrix#round
- * lib/fileutils.rb (remove_file): ignore exceptions caused by
- chmod.
+Fri Jul 1 11:41:12 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/fileutils.rb (remove_dir): try to get rights to rmdir.
- [ruby-Bugs:1502] (2 items backportted from HEAD, rev 1.53-54)
+ * string.c (tr_trans): free heap ptr when the str is not embedded.
+ patched by Eric Wong. [Bug #4956] [ruby-core:37708]
-Thu Apr 14 16:57:40 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jul 1 11:07:43 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * bcc32/Makefile.sub: failed to remove debug information files.
- fixed: [ruby-dev:26034]
+ * thread.c (do_select): fix memory leak.
+ Patch by Eric Wong. Thank you! [Bug #4953] [ruby-core:37702]
-Wed Apr 13 23:40:21 2005 Kouhei Sutou <kou@cozmixng.org>
+Fri Jul 1 08:21:28 2011 Koichi Sasada <ko1@atdot.net>
- * lib/rss/rss.rb (RSS::VERSION): 0.1.3 -> 0.1.4.
+ * vm_insnhelper.c (vm_getivar): check vm state version
+ to invalidate inline cache (ivar index).
+ fixes Bug #4926.
- * lib/rss/rss.rb (RSS::Element#converter): fixed converter
- transmission bug.
+ * vm_insnhelper.c (vm_setivar): ditto.
-Wed Apr 13 21:20:35 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+Fri Jul 1 08:03:15 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in (mingw32): extract msvcr*.dll from objdump result.
+ * error.c, thread_pthread.c (WRITE_CONST): suppress warnings
+ `ignoring return value'.
-Wed Apr 13 20:24:30 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jul 1 06:41:36 2011 Koichi Sasada <ko1@atdot.net>
- * configure.in (mingw32): use actual runtime DLL name as ruby DLL
- name and default load path.
+ * thread.c (rb_threadptr_check_signal): only wake up main thread.
- * win32/Makefile.sub, win32/setup.mak: ditto.
+ * thread.c (rb_threadptr_execute_interrupts_common): check signal
+ delivery if it is main thread.
+ fixes [ruby-dev:44005] [Ruby 1.9 - Bug #4950]
-Tue Apr 12 15:33:09 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * bootstraptest/test_fork.rb: add a test for above.
- * ext/tcltklib/tcltklib.c (ip_finalize): better modification than the
- previous commit [ruby-dev:26029].
+ * signal.c (rb_get_next_signal): skip if signal_buff is empty.
+ (check signal_buff.size first)
-Tue Apr 12 12:38:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * vm_core.h: remove unused variable rb_thread_t::exec_signal.
- * ext/tcltklib/tcltklib.c (ip_finalize): fix SEGV when Tcl_GlobalEval()
- modifies the argument string to eval.
+ * thread.c (rb_thread_check_trap_pending): check
+ rb_signal_buff_size() because rb_thread_t::exec_signal
+ is no longer available.
-Tue Apr 12 02:21:55 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Fri Jul 1 03:28:25 2011 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/tcltklib/tcltklib.c (ip_finalize): add existence check of
- Tcl commands before calling Tcl_GlobalEval().
+ * class.c (Init_class_hierarchy): should name BasicObject
+ explicitly.
-Mon Apr 11 23:47:21 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * variable.c (rb_const_defined_0): should not check for
+ superclasses as const_get.
- * lib/drb/drb.rb: [druby-ja:123] fix: When reference of my object is
- loaded, the object is tainted.
+Fri Jul 1 03:24:03 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * test/drb/test_drb.rb: ditto.
+ * ext/date/date_core.c: mathn is still alive (should die soon).
-Mon Apr 11 22:18:23 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+Thu Jun 30 23:50:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * dir.c, file.c (lstat): avoid warnings for mingw.
+ * misc/ruby-mode.el (ruby-indent-beg-re): Fix broken regular
+ expression. Fixes #4546
-Mon Apr 11 20:11:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu Jun 30 23:43:30 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/tcltklib/tcltklib.c (ip_finalize): adhoc patch to avoid SEGV
- when exit on Tcl/Tk8.3.x.
+ * ext/openssl/ossl.c/.h: Added ossl_x509_name_sk2ary.
+ * ext/openssl/ossl.c: Replaced ossl_x509_ary2k by generic macro to
+ simplify future conversions.
+ * ext/openssl/ossl_ssl.c: Implement SSLSocket#client_ca.
+ * test/openssl/test_ssl.rb: Add test for SSLSocket#client_ca.
+ Thanks to Ippei Obayashi for providing the patch!
+ [ Ruby 1.9 - Feature #4481 ] [ruby-core:35461]
-Mon Apr 11 15:26:25 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Jun 30 22:38:58 2011 Koichi Sasada <ko1@atdot.net>
- * lib/mkmf.rb (configuration): shouldn't output hdrdir twice.
+ * benchmark/bm_vm2_defined_method.rb: added to measure performance of
+ bmethod (method defined by define_method()).
-Mon Apr 11 12:09:05 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Thu Jun 30 22:17:04 2011 Koichi Sasada <ko1@atdot.net>
- * {bcc32,win32,wince}/Makefile.sub: ri data was not installed
- into correct path. [ruby-dev:26011]
+ * vm_insnhelper.c (vm_call_bmethod): fix to hook call/return event
+ for methods defined by define_method(). fixes Bug #4613.
- * bcc32/Makefile.sub: defaulted install-nodoc. [ruby-dev:26011]
+ * thread.c (call_trace_proc): Fix to skip if class is not given (0).
+ Note that ID and Class object are passed for call/return event
+ if the called method was defined by define_method().
+ If you are author of tracer/profiler/debugger, this may be an
+ important change. You should check passed class as zero or
+ non-zero instead of checking the event type.
-Sun Apr 10 10:12:42 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * test/ruby/test_settracefunc.rb: add a test for above.
- * ext/win32ole/win32ole.c(ole_invoke): retry after converting Qnil
- to VT_EMPTY.
+Thu Jun 30 21:18:35 2011 Yutaka Kanemoto <kanemoto@ruby-lang.org>
- * ext/win32ole/win32ole/tests/testWIN32OLE.rb: correct error
- message string "Unknown" => "unknown".
+ * configure.in: Add warnflags for XL/C on AIX during configure
+ to avoid [Bug #3971]. See [ruby-core:32859]
-Sat Apr 9 18:20:31 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu Jun 30 21:16:04 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/lib/tk/image.rb: support to create TkImage object without
- creating a new image object on Tk.
+ * ext/date/date_core.c (m_ajd): refers a constant.
- * ext/tk/lib/tk/menu.rb: use TkCommandNames on create_self()
+Thu Jun 30 20:54:25 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/tk/root.rb: TkRoot.to_eval() returns '.'.
+ * ext/io/console/io-console.gemspec: spin-off gem for 1.9.2.
- * ext/tk/lib/tk/text.rb: add methods to create a TkText::IndexString
- from (x, y) coords.
+Thu Jun 30 20:36:23 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/lib/tkextlib/tile/: add demo and update support status.
+ * ext/date/date_core.c: trivial changes.
-Sat Apr 9 14:42:29 2005 Kouhei Sutou <kou@cozmixng.org>
+Thu Jun 30 20:12:36 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * sample/rss/tdiary_plugin/rss-recent.rb: supported configuration
- via Web browser.
+ * test/ruby/test_module.rb: tests for [Bug #3422] and [Bug #3423].
-Sat Apr 9 11:59:57 2005 Kouhei Sutou <kou@cozmixng.org>
+Thu Jun 30 20:03:39 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/rss: backoported from HEAD.
+ * ext/date/date_core.c: modified doc.
- * lib/rss: refactored.
- - gave a name to 'x'.
- - undef_method -> remove_method for avoiding a warning in ruby 1.6.
+Thu Jun 30 19:09:19 2011 Koichi Sasada <ko1@atdot.net>
+ * thread_pthread.c (thread_timer): ignore unknown errno.
+ (we observed that select(2) was canceled by errno=514 on
+ boron == Linux/Xen environment)
- * lib/rss/parser.rb: @@setter -> @@setters.
+Thu Jun 30 17:33:25 2011 Koichi Sasada <ko1@atdot.net>
- * lib/rss/parser.rb
- (RSS::BaseListener.register_uri)
- (RSS::BaseListener.uri_registered?)
- (RSS::BaseListener.install_get_text_element):
- swapped the first argument and the second argument.
+ * ext/objspace/objspace.c (ObjectSpace.count_tdata_objects):
+ Fix rdoc. Fixes Bug #3892.
- * lib/rss/taxonomy.rb: swapped the first argument and the second
- argument for RSS::BaseListener.install_get_text_element.
- * lib/rss/image.rb: ditto.
- * lib/rss/syndication.rb: ditto.
- * lib/rss/dublincore.rb: ditto.
- * lib/rss/parser.rb: ditto.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/0.9.rb: ditto.
- * lib/rss/content.rb: ditto.
+ * ext/objspace/objspace.c (ObjectSpace.count_tdata_objects):
+ Change key type if the klass of a object is zero (internal object).
+ Read rdoc for details.
- * lib/rss/parser.rb
- (RSS::BaseListener.install_setter)
- (RSS::BaseListener.register_uri): changed fallback way.
+ * internal.h: export rb_objspace_data_type_name().
- * lib/rss/parser.rb: added class name registry for complex model
- elements. (ex. have childlen elements, have some attributes and
- a child element and so on.)
+Thu Jun 30 17:25:08 2011 Koichi Sasada <ko1@atdot.net>
+ * thread_pthread.c (ping_signal_thread_list, thread_timer):
+ fix to keep polling state if there are any ping-tasks.
- * lib/rss/dublincore.rb: supported multiple Dublin Core items.
- * lib/rss/maker/dublincore.rb: ditto.
+Thu Jun 30 12:25:34 2011 Koichi Sasada <ko1@atdot.net>
- * lib/rss/maker/image.rb: supproted new Dublin Core API.
+ * thread_pthread.c (rb_thread_create_timer_thread): allocate
+ machine stack for the timer thread at least 12KB. FreeBSD 8.2
+ AMD64 causes machine stack overflow (SIGSEGV) only with
+ PTHREAD_STACK_MIN (maybe defined as 2KB).
+Thu Jun 30 09:36:37 2011 Eric Hodel <drbrain@segment7.net>
- * lib/rss/maker/base.rb: added default current_element implementation.
+ * lib/weakref.rb: Attach documentation to WeakRef and add missing
+ documentation
+Thu Jun 30 09:30:14 2011 Eric Hodel <drbrain@segment7.net>
- * lib/rss/trackback.rb (RSS::TrackBackUtils.new_with_value_if_need):
- moved to RSS::Utils.
+ * lib/yaml.rb: Document toplevel YAML and YAML::ENGINE to describe
+ Psych vs Syck engines.
- * lib/rss/utils.rb (RSS::Utils.new_with_value_if_need):
- moved from RSS::TrackBackUtils.
+Thu Jun 30 09:21:52 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/cmath.rb: Hide handle_no_method_error from RDoc.
+ * error.c: Document or hide undocumented error classes.
- * lib/rss/maker/image.rb: fixed invalid argument of
- add_need_initialize_variable bug.
- * lib/rss/maker/trackback.rb: ditto.
+Thu Jun 30 07:49:04 2011 Eric Hodel <drbrain@segment7.net>
+ * hash.c: Document ENV
- * lib/rss/rss.rb (Hash#merge): added for ruby 1.6.
+Thu Jun 30 06:37:43 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rss/rss.rb (RSS::BaseModel.date_writer): changed to accept nil
- for date value.
+ * ruby.c (ruby_init_loadpath_safe): ensure RUBYLIB_PREFIX stored
+ before RUBYLIB, even if MANGLED_PATH is enabled. fixed #1679.
+ MANGLED_PATH is disabled by the default and will be removed
+ completely in the future.
+Thu Jun 30 06:32:21 2011 Eric Hodel <drbrain@segment7.net>
- * test/test_dublincore.rb: added tests for plural accessor and
- multiple Dublin Core items.
+ * lib/drb/drb.rb: Hide deprecated toplevel DRb constants.
- * test/test_setup_maker_1.0.rb: fixed swapped actual and expected
- values.
+Thu Jun 30 06:17:02 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * test/rss/rss-assertions.rb (assert_multiple_dublin_core): added
- an assertion for testing multiple Dublin Core items.
+ * lib/cmath.rb (CMath.log): second argument: b can be nil.
- * test/rss/test_maker_dc.rb (test_rss10_multiple): added a test
- for making multiple Dublin Core items.
+Thu Jun 30 06:23:28 2011 Eric Hodel <drbrain@segment7.net>
- * test/rss/test_maker_dc.rb (test_date): added a test for #date=
- and #dc_date=.
+ * thread.c (ruby_thread_s_pass): Fix typo.
+Thu Jun 30 06:16:53 2011 Eric Hodel <drbrain@segment7.net>
- * sample/rss/tdiary_plugin/rss-recent.rb:
- new option: @options['rss-recent.use-image-link']:
- use image as link instread of text if available.
+ * lib/rdoc: Update to RDoc 3.8 which contains fixes for documentation
+ in trunk.
- * sample/rss/tdiary_plugin/rss-recent.rb (RSS_RECENT_VERSION):
- 0.0.5 -> 0.0.6.
+Thu Jun 30 02:53:26 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Fri Apr 8 20:17:48 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread.c (rb_threadptr_execute_interrupts_common): remove
+ meaningless native_thread_yield(). It never close a race.
- * ext/extmk.rb (extmake): hdrdir needs to be defined also in
- Config::CONFIG.
+Thu Jun 30 02:41:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/mkmf.rb (configuration, create_makefile): get rid of recursive
- macro reference.
+ * thread.c (rb_thread_schedule_limits): minor optimization.
+ eliminate machine context saving when running time is enough small.
-Fri Apr 8 18:26:56 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Thu Jun 30 02:28:11 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/openssl/ossl_ssl.c: add callbacks to OpenSSL::SSL::SSLContexts.
- - SSLContext#client_cert_cb=(aProc). it is called when a client
- certificate is requested by a server and no certificate was not
- set for the SSLContext. it must return an Array which includes
- OpenSSL::X509::Certificate and OpenSSL::PKey::RSA/DSA objects.
- - SSLContext#tmp_dh_callback=(aProc). it is called in key
- exchange with DH algorithm. it must return an OpenSSL::PKey::DH
- object.
+ * thread.c (rb_thread_schedule_rec): move interrupt_flag check to
+ rb_thread_schedule().
+ And also rename to rb_thread_schedule_limits() and remove
+ sched_depth argument. It's no longer called recursive.
+ * thread.c (rb_thread_schedule): add to check interrupt_flag as
+ above explained.
- * ext/openssl/ossl_ssl.c (ossl_sslctx_set_ciphers): ignore the
- argument if it's nil.
+ * thread.c (rb_threadptr_execute_interrupts_rec): rename to
+ rb_threadptr_execute_interrupts_common() and remove sched_depth
+ argument. It's no longer called recursive.
- * ext/openssl/ossl_pkey.c
- (GetPrivPKeyPtr, ossl_pkey_sign): should call rb_funcall first.
- (DupPrivPKeyPtr): new function.
+ * thread.c (rb_thread_sleep): adapt the renaming.
+ * thread.c (rb_threadptr_execute_interrupts): ditto.
+ * thread.c (rb_thread_execute_interrupts): ditto.
- * ext/openssl/ossl_pkey_dh.c: add default DH parameters.
+Thu Jun 30 01:31:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/openssl/ossl_pkey.h: ditto.
+ * thread.c (thread_s_pass): change RDoc description and remove
+ a sample code. The actual implementation never behave as explained by
+ an example. It's a documentation bug.
-Fri Apr 8 01:55:20 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu Jun 30 00:54:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/tk/sample/demos-{en,jp}/goldberg.rb: reduced window size.
- [ruby-dev:25992]
+ * thread.c (rb_thread_stop): change RDoc sample code. The old
+ example is buggy and may cause deadlock. The patch is
+ suggested by Heesob Park <phasis@gmail.com>. Thank you!
+ [Bug #3606][ruby-core:31454]
-Thu Apr 7 23:58:40 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Jun 30 00:49:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/extmk.rb (extmake): keep directory names in Makefile as macros.
+ * thread.c (rb_thread_wakeup): change RDoc sample code. The old
+ example is buggy and may not display anything by a race.
+ The patch is suggested by Heesob Park <phasis@gmail.com>.
+ Thank you! [Bug #3606][ruby-core:31454]
- * lib/mkmf.rb (configuration, create_makefile): ditto.
+Thu Jun 30 00:43:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/mkmf.rb (CXX_EXT): separate C++ extensions.
+ * thread.c (rb_thread_run): change RDoc. The old example is buggy
+ and may cause deadlock. The patch is suggested by Heesob Park
+ <phasis@gmail.com>. Thank you! [Bug #3606][ruby-core:31454]
-Thu Apr 7 17:43:25 2005 Shugo Maeda <shugo@ruby-lang.org>
+Thu Jun 30 00:30:15 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
- * eval.c (rb_call0): "return" event hook should be always executed
- if event_hooks is set. fixed: [ruby-core:04662]
- (backported from HEAD)
+ * lib/cmath.rb: make same exception for Math. fix [Bug #3137].
-Mon Apr 4 23:17:52 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu Jun 30 00:03:20 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
- * ext/tk/lib/tk.rb (TkComm#array2tk_list): accept enc-mode argument to
- decide whether convert encoding of each element or not.
+ * lib/irb/completion.rb: complement correctly string literal. fix
+ [Bug #1145].
- * ext/tk/lib/tk/variable.rb (TkVariable#value=): fail to convert the
- encoding of array elements when assign an array to an TkVariable
- object.
+Wed Jun 29 23:42:51 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Mon Apr 4 10:26:48 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * ext/date/date_core.c: avoided using timev.
+ * ext/date/date_strftime.c: ditto.
+ * ext/date/date_tmx.h: ditto.
- * ext/tk/lib/tk/dialog.rb: fixed typo.
+Wed Jun 29 23:17:57 2011 WATANABE Hirofumi <eban@ruby-lang.org>
-Sun Apr 3 17:16:33 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * ext/openssl/ossl.h (OPENSSL_SYS_WIN32): support for mingw(msys).
- * win32/win32.{h,c} (rb_w32_fdopen): avoid warning on bcc32.
- (backported from HEAD)
+Wed Jun 29 23:09:14 2011 WATANABE Hirofumi <eban@ruby-lang.org>
-Sat Apr 2 23:38:54 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/extconf.rb (intptr_t, uintptr_t): support for the latest ActiveTcl with mingw.
- * configure.in (CP, INSTALL): get rid of less portable options.
+Wed Jun 29 22:49:10 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
- * lib/mkmf.rb (configuration, create_makefile): correct configuration
- variable.
+ * lib/irb/cmd/help.rb: support RDoc 3.7. fix [Bug #3760].
- * {bcc32,win32,wince}/{Makefile.sub,setup.mak}: leave prefix empty in
- config.status for backward compatibility. fixed: [ruby-core:04649]
+Wed Jun 29 22:04:14 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * lib/mkmf.rb (create_makefile): ensure library directories get made
- before copying libraries there.
+ * lib/tracer.rb: Tracer.on only if required by -r command-line option.
+ and consider --disable-gems option.
+ * test/test_tracer.rb: add tests for it.
-Sat Apr 2 16:59:46 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Wed Jun 29 13:55:36 2011 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/tk/lib/tk.rb: forgot to update RELEASE_DATE
+ * variable.c (rb_const_get_0): should not look for superclasses if
+ the second optional argument is given for #const_get().
+ fix [Bug #3422] [Bug #3423]
- * ext/tk/lib/tk/variable.rb: fix namespace trouble when autoloading
+Wed Jun 29 12:07:27 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tk/lib/tk/palette.rb: define Tcl variable 'tkPalette' as global
+ * math.c: Attach documentation for Math.
+ * object.c: Document NIL, TRUE, FALSE.
+ * io.c: Improve grammar in ARGF comment. Document STDIN/OUT/ERR.
+ Document ARGF global constant.
+ * lib/rake: Hide deprecated toplevel constants from RDoc (import from
+ rake trunk).
+ * lib/thwait.rb: Document ThWait.
+ * lib/mathn.rb: Hide Math redefinition from RDoc
+ * lib/sync.rb: Add a basic comment for Sync_m, Synchronizer_m, Sync,
+ Synchronizer.
+ * parse.y: Document SCRIPT_LINES__.
+ * hash.c: Document ENV class and global constant.
+ * vm.c: Document TOPLEVEL_BINDING.
+ * version.c: Document RUBY_* constants.
+ * ruby.c: Document DATA and ARGV.
- * ext/tk/lib/tk/dialog.rb: use array2tk_list method when calling
- Tk.ip_eval.
+Wed Jun 29 10:13:12 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * ext/tk/lib/tk/autoload.rb: add autoload entry 'TkDialogObj' and
- 'TkWarningObj'
+ * lib/matrix.rb: Matrix.zero can build rectangular matrices.
+ Vector#r should be called #magnitude
-Sat Apr 2 02:19:11 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Wed Jun 29 10:11:08 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * ext/tk/lib/tk.rb (TkWindow.initialize): accept 'without_creating'
- option without 'widgetname' option to allow creating a widget object
- which is used as an argument of Tcl/Tk's widget allocation commands.
+ * lib/matrix.rb: Add Matrix#diagonal?, hermitian?, normal?,
+ orthogonal?
+ permutation?, symmetric?, {lower|upper}triangular?, unitary?, zero?
- * ext/tk/lib/tk/image.rb (TkImage.initialize): accept 'imagename'
- option to create a image object by the given name.
+Wed Jun 29 10:09:35 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-Thu Mar 31 22:23:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/matrix.rb: Specialize Matrix#find_index to return [row, col]
+ and accept the same optional argument as #each
- * lib/mkmf.rb (SRC_EXT): exclude just case different suffixes on case
- insensitive file system platforms.
+Wed Jun 29 10:07:32 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * README.EXT, README.EXT.ja (Appendix C): utility functions.
+ * lib/matrix.rb: Matrix#each{_with_index} can iterate over a subset
+ of the Matrix
-Thu Mar 31 14:15:44 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Wed Jun 29 06:21:02 2011 Koichi Sasada <ko1@atdot.net>
- * ext/openssl/ossl_engine.c (ossl_engine_s_load): should return
- value. [ruby-dev:25971]
+ * thread_pthread.c (native_stop_timer_thread): skip to close
+ communication pipe to avoid timing bug (process termination timing).
+ The communication pipe will closed by OS.
-Thu Mar 31 08:25:50 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jun 29 06:09:54 2011 Koichi Sasada <ko1@atdot.net>
- * common.mk (RUBYOPT): clear for the environment RubyGems installed.
+ * error.c (rb_async_bug_errno): async-safe bug report function.
+ In timer thread, signal handler should use it.
+ The patch is contributed by Eric Wong <normalperson@yhbt.net>.
+ Refs: [ruby-core:37644] and [ruby-core:37647]
- * common.mk (clean-local): keep $(PREP) files till distclean.
+ * thread_pthread.c: use rb_async_bug_errno().
+ And replace all fprintf() to write().
- * common.mk (check): do all tests.
+ * internal.h (rb_async_bug_errno): add decl. of above func.
-Thu Mar 31 06:00:20 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Tue Jun 28 23:46:08 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
- * ext/openssl/ossl_engine.c (ossl_engine_s_load): should not raise
- error even if the specified engine could not be loaded. (Dynamic
- engines don't have fixed name to load.)
+ * lib/tracer.rb: count only non-internal libraries in stack trace,
+ ignoring custom_require.
-Thu Mar 31 00:18:27 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Tue Jun 28 21:44:58 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
- * win32/ifchange.bat, win32/rm.bat: backported from HEAD.
+ * lib/irb/ruby-lex.rb: recognize '\char' in ruby statement.
-Wed Mar 30 23:44:50 2005 Nobuyoshi Nakada <nobu.nokada@softhome.net>
+Tue Jun 28 20:39:29 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * Makefile.in, */Makefile.sub, */configure.bat,
- cygwin/GNUmakefile.in, common.mk, configure.in, ext/extmk.rb,
- lib/mkmf.rb, instruby.rb, runruby.rb: backport extout.
- [ruby-dev:25963]
+ * lib/debug.rb (var_list): Command 'var *' did not work on 1.9(!).
+ global_variables, local_variables, and instance_variables returns
+ Symbols from 1.9 and need to stringify before evaling it.
+ See #4931.
-Wed Mar 30 17:41:48 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Jun 28 19:23:01 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/tcltklib/tcltklib.c: add TclTkIp#_create_console() method to
- create a Tcl/Tk's console window.
+ * signal.c: Now, USE_TRAP_SIGMASK depend on HAVE_PTHREAD_SIGMASK.
+ The code have already depended on pthread_sigmask since r27464.
- * ext/tk/lib/multi-tk.rb: support TclTkIp#_create_console() method.
+Tue Jun 28 15:09:21 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/remote-tk.rb: ditto.
+ * lib/benchmark.rb: merge eregon/benchmark.
+ https://github.com/eregon/ruby/tree/benchmark
+ patched by Benoit Daloze. [ruby-core:37593] [Bug #4940]
- * ext/tk/lib/tk/console.rb: ditto.
+ * lib/benchmark (Benchmark#bmbm): bmbm should be consistent with bm
+ for the return value.
- * ext/tk/lib/tk.rb: update RELEASE_DATE
+ * test/benchmark: remove preemptive test instead of skipping
+ I removed the preemptive test I wrote for Feature #4197.
+ I'll add it back when the implementation will be able to satisfy it.
- * ext/tk/sample/demo-*/check2.rb: use 'return' in the Proc object.
+ * lib/benchmark (Benchmark#bmbm): remove useless explicit call,
+ #format is an alias of #to_s test/benchmark: add a test for
+ format of long time.
- * ext/tk/sample/tkextlib/**: ditto.
+ * lib/benchmark: fix label width: always add 1 to ensure there is a
+ space delimiter even with times over 100s
+ When I asked for Feature #4197, I wanted to make delimiting spaces
+ consistent for #bm and #bmbm.
+ But with times over 100s, the output contains no space between the
+ label and the first time (user).
+ Now both ensure there is always a space, even if that means 3 spaces
+ with times under 10s (because it is formatted as %10.6f)
-Tue Mar 29 22:11:56 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * test/benchmark: let labels be a constant
+ lib/benchmark (Benchmark#realtime): avoid creating an unused Proc
+ lib/benchmark (Benchmark#benchmark): use ensure clause to restore
+ STDOUT.sync, as in #bmbm
- * test/rinda/test_rinda.rb: use DRbObject.new_with instead of reinit.
- [ruby-dev:25961]
+Tue Jun 28 13:41:51 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Mar 28 23:40:40 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * thread_win32.c (native_stop_timer_thread): fixed commit miss of
+ r32244. grep sources before changing the signature of a function.
- * lib/drb/drb.rb: move method DRbObject#reinit to DRbObject.new_with.
- extract method DRbObject.prepare_backtrace. add DRb.regist_server,
- remove_server, fetch_server. change server in thread variable if
- in-proc server. [druby-ja:113]
+Tue Jun 28 11:49:14 2011 Koichi Sasada <ko1@atdot.net>
- * lib/drb/gw.rb: ditto.
+ * thread_pthread.c (consume_communication_pipe):
+ Make "buff" as static. (Maybe) "buff" can be shared between
+ any caller (any threads) because no one use the read values.
+ "buff" (1024 byte) on stack may cause stack overflow on
+ several environment (we found a crash on FreeBSD).
+ And remove const value "buff_size", and define CCP_READ_BUFF_SIZE
+ macro.
-Mon Mar 28 20:43:34 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jun 28 11:45:30 2011 Eric Hodel <drbrain@segment7.net>
- * ext/syck/rubyext.c: get rid of warnings caused by a bug of VC.
+ * lib/rake: Update rake to fix some bugs and hide deprecated features
+ from RDoc.
+ * lib/rake/version.rb: Bump version to 0.9.2.1 to distinguish it from
+ the released version.
+ * NEWS: ditto
-Mon Mar 28 08:39:49 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jun 28 11:17:28 2011 Eric Hodel <drbrain@segment7.net>
- * ext/iconv/iconv.c (iconv_create): Iconv::Failure requires 3
- arguments. (pointed out by NaHi)
+ * lib/rdoc: Update to RDoc 3.7 (final)
+ * NEWS: ditto
-Sat Mar 26 22:51:33 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Jun 28 10:18:42 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/tk.rb (_callback_entry_class?): add for checking whether
- a class is available for a callback entry.
+ * process.c (rb_daemon): fix wrong #endif position.
- * ext/tk/lib/tk.rb (after_cancel): add Tk.after_cancel(afterID) method.
+Tue Jun 28 07:50:32 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tk/lib/tk.rb (array2tk_list): change from private module method
- of TkComm to public module method.
+ * object.c (Init_Object): Teach RDoc what Init_class_hierarchy does to
+ hook up ri for BasicObject, Object, Module and Class.
- * ext/tk/lib/tk.rb (cget): add check that slot argument is not
- empty string.
+Tue Jun 28 05:03:32 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * ext/tk/lib/tk.rb (configinfo): ditto.
+ * thread.c (rb_thread_local_aref): RDoc fix. Thread#[] example
+ had a race. See #4480.
- * ext/tk/lib/tk/itemconfig.rb (itemcget): add check that slot argument
- is not empty string.
+Tue Jun 28 01:22:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * ext/tk/lib/tk/itemconfig.rb (itemconfiginfo): ditto.
+ * ext/bigdecimal/bigdecimal.c (BigMath_s_log): move BigMath.log from
+ bigdecimal/math.rb.
- * ext/tk/lib/tk/entry.rb: add TkEntry#icursor and icursor= (alias of
- cursor and cursor= method).
+ * ext/bigdecimal/lib/bigdecimal/math.rb: ditto.
- * ext/tk/lib/tk/font.rb: improve font treatment when the font name is
- empty string.
+ * test/bigdecimal/test_bigdecimal.rb: move test for BigMath.log from
+ test/bigdecimal/test_bigmath.rb.
- * ext/tk/lib/tk/variable.rb: add :variable, :window and :procedure
- type.
+ * test/bigdecimal/test_bigmath.rb: ditto.
- * ext/tk/lib/tk/variable.rb: improve treatment of array-type
- tkvariable.
+Tue Jun 28 01:19:52 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
- * ext/tk/lib/tkextlib/blt.rb: add commands for zooming.
+ * lib/irb/ruby-lex.rb: fix [Bug #4232].
- * ext/tk/lib/tkextlib/blt/*: bug fix.
+Tue Jun 28 00:14:13 2011 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: bug fix and add methods
- to call TreeCtrl commands for bindings.
+ * lib/drb/drb.rb: fix [Bug #4409]. add DRbServer#here?.
- * ext/tk/sample/tkextlib/blt/*: new sample scripts.
+ * test/drb/test_drb.rb: ditto.
- * ext/tk/sample/tkextlib/treectrl/*: ditto.
+ * test/drb/drbtest.rb: ditto.
-Fri Mar 25 10:53:16 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+ * test/drb/ut_eq.rb: ditto.
- * configure.in (WIN32_LEAN_AND_MEAN): removed because a lot of
- troubles. [ruby-list:40721]
+Tue Jun 28 00:08:43 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
-Thu Mar 24 23:10:44 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/irb/workspace.rb: fix BUG#4793.
- * lib/mkmf.rb (macro_defined?): try to compile for an old compiler
- which doesn't bail out at #error directive. [ruby-dev:25818]
+Mon Jun 27 22:06:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/mkmf.rb (check_sizeof): refine logging messages.
+ * thread_pthread.c (consume_communication_pipe): don't use C99
+ style variable length array.
-Thu Mar 24 03:57:48 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Mon Jun 27 22:04:27 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/webrick/utils.rb (WEBrick::Utils.create_listeners):
- - should raise ArgumentError if no port is specified.
- - even if the specified port is 0, all TCPServers should be
- initialized with the port given to the first one.
+ * thread_pthread.c (consume_communication_pipe): change return
+ type to void. caller doesn't use it.
- * lib/webrick/server.rb (WEBrick::GenericServer#initialize): if :Port
- parameter is 0, it should be updated with the port number which
- actually listened.
+Mon Jun 27 21:29:50 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Mar 23 00:35:10 2005 Shugo Maeda <shugo@ruby-lang.org>
+ * thread_pthread.h (rb_global_vm_lock_struct): add volatile to
+ gvl->waiting. now thread_timer() access it w/o lock.
- * test/ruby/test_settracefunc.rb (test_event): added tests for
- "class" and "end" and "raise".
+Mon Jun 27 21:16:11 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Mar 22 22:40:18 2005 Shugo Maeda <shugo@ruby-lang.org>
+ * thread_pthread.c: s/__gvl_acquire/gvl_acquire_common/ and
+ s/__gvl_release/gvl_release_common/.
- * eval.c (rb_call0): check event_hooks instead of trace_func.
+Mon Jun 27 11:41:47 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Mar 22 17:30:44 2005 Shugo Maeda <shugo@ruby-lang.org>
+ * thread_pthread.c (rb_thread_create_timer_thread):
+ the type of return value of write(2) is ssize_t.
- * eval.c (rb_add_event_hook): new function to add a hook function for
- interpreter events. (backported form HEAD)
+Mon Jun 27 09:57:02 2011 Koichi Sasada <ko1@atdot.net>
-Sun Mar 20 22:51:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread_pthread.c (rb_thread_create_timer_thread):
+ Fixes missing initialization of oflags.
- * lib/mkmf.rb (mkmf_failed): check if Makefile is created without
- create_makefile.
+Mon Jun 27 09:07:42 2011 Koichi Sasada <ko1@atdot.net>
-Sat Mar 19 23:48:10 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread_pthread.c: Stop polling in the timer thread when there are
+ no waiting thread. If there are 2 or more runnable threads,
+ the timer thread does polling. Avoid polling makes power save
+ for several computers (0.2W per a Ruby process, when I measured).
+ If outside-event such as signal or Thread#kill was occurred
+ when the timer thread does not do polling, then wake-up
+ the timer thread using communication-pipe (the timer thread
+ waits this communication-pipe with select(2)).
+ The discussion about this modification can be found from the post
+ [ruby-core:33456] and other related posts.
+ Note that Eric Wong and KOSAKI Motohiro give us the huge
+ contributions for this modification. Thanks.
- * misc/ruby-mode.el (ruby-expr-beg): returned true always.
- fixed: [ruby-list:40683]
+ * thread_pthread.c (rb_thread_wakeup_timer_thread): add a function.
+ This function wakes up the timer thread using communication-pipe.
-Sat Mar 19 00:41:02 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * thread.c (rb_thread_stop_timer_thread): add a parameter which
+ specify closing communication-pipe or not.
- * ext/tk/lib/tk/font.rb: add some TkFont class methods to get font
- information without creating a TkFont object.
+ * thread.c (rb_thread_terminate_all): do not stop timer thread here
+ (ruby_cleanup() terminate timer thread).
- * ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: bug fix and define some
- classes for components of Tk::TreeCtrl
+ * signal.c: wake up timer thread using
+ rb_thread_wakeup_timer_thread() from signal handler.
-Thu Mar 17 17:42:13 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * eval.c (ruby_cleanup): use rb_thread_stop_timer_thread(1).
- * struct.c (make_struct): allow non local-id field
- names. [ruby-core:04575]
+ * process.c: use rb_thread_stop_timer_thread(0)
+ (reuse communication-pipe).
- * struct.c (inspect_struct): ditto.
+ * thread_win32.c (rb_thread_wakeup_timer_thread): add a dummy
+ function.
-Wed Mar 16 23:36:02 2005 Shugo Maeda <shugo@ruby-lang.org>
+ * vm_core.h: add and fix decl. of functions.
- * eval.c (rb_call0): call_cfunc() should be protected.
+Mon Jun 27 08:01:19 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * test/ruby/test_settracefunc.rb: added test for c-return.
+ * ext/date/date_parse.c: should use ALLOCA_N.
-Wed Mar 16 22:20:25 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Mon Jun 27 01:34:18 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * object.c (str_to_id): fixed typo.
+ * test/etc/test_etc.rb (TestEtc#test_get{pw,gr}nam): skip entries
+ start with + sign, which means NIS. these are returned in the
+ case that passwd and group entries in /etc/nsswitch.conf are set
+ to use "nis" explicitly on Debian. fixed #3683
-Wed Mar 16 18:08:32 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon Jun 27 00:44:53 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * eval.c (rb_call0): reorganize "return" event post.
+ * parse.y (rb_parser_end_seen_p): fix documentation about return
+ value. patched by Sho Hashimoto. [Bug #4511]
-Tue Mar 15 23:49:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jun 27 00:40:47 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/iconv/iconv.c (Init_iconv): InvalidEncoding also should include
- Iconv::Failure.
+ * hash.c (rb_hash_reject): add documentation that Hash#reject
+ without block returns enumerator.
+ patched by Michael Edgar [Bug #4847] [ruby-core:36800]
-Tue Mar 15 16:38:11 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sun Jun 26 23:49:21 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/tkutil.c (ary2list): give wrong arguments to hash2kv()
+ * test/date/test_switch_hitter.rb: added a test.
-Mon Mar 14 19:39:33 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ Sun Jun 26 22:21:23 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/lib/tk/timer.rb (TkTimer): forgot to clear @return_value
- when restarting
+ * ext/date/date_core.c: refactoring.
- * ext/tk/lib/tk/sample/cd_timer.rb: new sample of TkRTTimer
+Sun Jun 26 18:03:30 2011 URABE Shyouhei <shyouhei@ruby-lang.org>
-Mon Mar 14 12:21:03 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * parse.y: comma at the end of line is no longer allowed.
+ A patch from Yukihiro Matsumoto <matz AT ruby-lang.org>.
+ (fixed #3456).
- * ext/tk/lib/tk/timer.rb (TkRTTimer): forgot to reset the callback
- time. So, 'continue' do all callbacks between 'stop' and 'continue'.
+Sun Jun 26 13:35:35 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Mar 14 08:14:56 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * vm_dump.c (rb_vm_bugreport): change CrashReporter suggestion messages
+ on Mac. It should be placed after "-- C level backtrace" line.
+ Suggested by Endoh-san.
- * object.c (str_to_id): warn for NUL containing strings.
+ <before>
+ -- See Crash Report log file under ~/Library/Logs/CrashReporter or ---------
+ -- /Library/Logs/CrashReporter, for the more detail of ---------------------
+ -- C level backtrace information -------------------------------------------
-Mon Mar 14 00:13:49 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ <after>
+ -- C level backtrace information -------------------------------------------
- * ext/tk/lib/tk/timer.rb (TkRTTimer): correct calculation of offset
- value. get a little better accuracy.
+ See Crash Report log file under ~/Library/Logs/CrashReporter or
+ /Library/Logs/CrashReporter, for the more detail of.
- * ext/tk/sample/demos-en/widget: use a binding with no local variables
- when eval a sample script.
+Sun Jun 26 10:08:28 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/tk/sample/demos-en/bind.rb: ditto.
+ * ext/openssl/extconf.rb
+ * ext/openssl/ossl_missing.h/.c: add ASN1_put_eoc if missing.
- * ext/tk/sample/demos-en/tcolor: ditto.
+ * ext/openssl/ossl_asn1.c: introduce ossl_asn1_object_size and
+ ossl_asn1_put_object to wrap functionality depending on OpenSSL
+ version in use.
+ Fixes [ Ruby 1.9 - Bug #4916 ] reported by Hiroshi Nakamura.
+ [ruby-core:37286]
- * ext/tk/sample/demos-jp/widget: ditto.
+Sun Jun 26 01:00:15 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/sample/demos-jp/bind.rb: ditto.
+ * ext/date/date_core.c (date_strftime_internal): removed meaningless braces.
+ * ext/date/date_core.c (gengo): the value should be int.
- * ext/tk/sample/demos-jp/tcolor: ditto.
+Sat Jun 25 23:45:30 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Sun Mar 13 10:04:17 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * vm_insnhelper.c (vm_search_superclass): avoid control frame
+ stack overrun. currently super() in Proc created in a method
+ defined by Module#define_method raise NoMethodError. [Bug #4881]
+ * test/ruby/test_method.rb t_super_in_proc_from_define_method):
+ add test for it.
- * test/rinda/test_rinda.rb: remove test_gc. [ruby-dev:25871]
+Sat Jun 25 23:23:14 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Thu Mar 10 19:12:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * thread.c (sleep_forever): now Kernel#sleep don't wakeup by
+ signal handler execution. [Bug #4072]
- * ext/tcltklib/tcltklib.c (lib_eventloop_ensure): mis-delete a timer
- handler when exit from a recursive called eventloop
+Sat Jun 25 23:14:47 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * ext/tk/lib/tk/timer.rb: new TkRTTimer class, which can works for a
- realtime operation
+ * thread.c (rb_threadptr_check_signal): remove unnecessary th->status
+ backup. fix race condition which may results unexpected main thread's
+ status transition. see #4072
- * ext/tk/sample/tkrttimer.rb: sample of TkRTTimer class
+Fri Jun 24 19:57:30 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * ext/tk/lib/tk/textmark.rb: move TkTextMark#+ and TkTextMark#- to
- TkText::IndexModMethods
+ * lib/webrick/httprequest.rb (setup_forwarded_info): Parsing request
+ header failed when the request is from 2 or more Apache reverse
+ proxies. It's said that all X-Forwarded-* headers will contain more
+ than one (comma-separated) value if the original request already
+ contained one of these headers. Since we could use these values as
+ Host header, we choose the initial(first) value. See #4922.
- * ext/tk/lib/tk/text.rb: improve TkTextMark#+ and TkTextMark#-, and
- add them to TkText::IndexModMethods module
+ * test/webrick/test_httprequest.rb (test_forwarded): Test it.
- * ext/tk/sample/tktextio.rb: add test part of "seek by text index
- modifiers"
+Fri Jun 24 17:06:33 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Mar 10 08:10:11 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * process.c (proc_daemon): should not start timer thread
+ twice. fixed Bug#4920.
- * re.c (make_regexp): need to free internal regexp structure when
- compilation fails. [ruby-talk:133228]
+Fri Jun 24 15:54:14 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Wed Mar 9 20:25:58 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/openssl/ossl_ssl.c (ossl_ssl_shutdown): Try to shutdown SSL
+ connection more gracefully. Call SSL_shutdown() max 4 times until it
+ returns 1 (success). Bi-directional SSL close has several states but
+ SSL_shutdown() kicks only 1 transition per call. Max 4 is from
+ mod_ssl.c of Apache httpd that says 'max 2x pending + 2x data = 4'.
+ See #4237.
- * ext/openssl/ossl_ssl.c (ossl_start_ssl, ossl_ssl_write): call
- rb_sys_fail if errno isn't 0. [ruby-dev:25831]
+Fri Jun 24 07:24:37 2011 Eric Hodel <drbrain@segment7.net>
- * ext/openssl/lib/openssl/cipher.rb: fix typo. [ruby-dev:24285]
+ * lib/rake/version.rb: Fixed VERSION to work with tool/rbinstall.rb
+ * bin/rake: Import bin/rake from 0.9.2
+ * tool/rbinstall.rb (install): Rake::VERSION is now in
+ lib/rake/version.rb. Fixes `make install`
-Wed Mar 9 15:46:35 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Fri Jun 24 07:11:37 2011 Eric Hodel <drbrain@segment7.net>
- * lib/webrick/server.rb (WEBrick::GenericServer#start): should
- restore @token if accept failure. suggested by Dominique Brezinski.
- [ruby-core:04518]
+ * lib/rake: Import Rake 0.9.2
-Wed Mar 9 13:37:57 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Fri Jun 24 00:44:15 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/sample/tktextio.rb: fix bug of handling 'end' position.
- support initial text, overwrite setting and pos_gravity control.
+ * ext/date/date_core.c (c_valid_{julian,gregorian}_p): fixed the range of month.
-Tue Mar 8 18:16:55 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Fri Jun 24 00:14:23 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/sample/tktextio.rb: New sample script. TkTextIO class in this
- sample supports to use a text widget as if it is a I/O stream (such
- like as StringIO class).
+ * ext/date/date_core.c: trivial changes on text.
-Tue Mar 8 13:54:40 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Jun 23 22:46:57 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * ext/socket/socket.c: workaround for some of 4.4BSD-Lite derived OSs.
+ * ext/openssl/ossl_x509name.c: Add X509::Name#hash_old as a wrapper
+ for X509_NAME_hash_old in OpenSSL 1.0.0. See #4805
-Tue Mar 8 12:36:17 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/openssl/test_x509name.rb (test_hash): Make test pass with
+ OpenSSL 1.0.0.
- * ext/socket/socket.c: document from Sam Roberts
- <sroberts@uniserve.com> for getsockopt and setsockopt is merged.
- [ruby-doc:824]
+ * NEWS: Add it.
-Tue Mar 8 01:27:00 2005 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Jun 23 19:30:53 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * ext/nkf/nkf-utf8/nkf.c: follow nkf 1.66
- fixed: [ruby-dev:25828]
+ * ext/openssl/ossl_ssl_session.c (ossl_ssl_session_set_time): Check
+ argument type with NUM2LONG if the arg is not a Time object.
+ See #4919.
-Mon Mar 7 21:35:02 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/openssl/ossl_ssl_session.c (ossl_ssl_session_set_timeout): Check
+ type with NUM2LONG. Time as an arg is not allowed. See #4919.
- * sample/webrick/httpsd.rb: fix typo in comment. suggested by
- Kazuhiko Shiozaki.
+ * test/openssl/test_ssl_session.rb (test_session_time,
+ test_session_timeout): Test it.
-Mon Mar 7 14:55:43 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Jun 23 13:30:30 2011 Shota Fukumori <sorah@tubusu.net>
- * eval.c (block_pass): should not push unique number if a block is
- not an orphan. [ruby-dev:25808]
+ * signal.c(ruby_atomic_exchange): Fix definition style.
-Wed Feb 16 02:55:21 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Wed Jun 22 22:34:05 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * ext/openssl/ossl_ssl.c (ossl_start_ssl, ossl_ssl_read,
- ossl_ssl_write):
- - need to set errno on Win32 platform.
- - should call rb_sys_fail instead of rasing SSLError if
- SSL_ERROR_SYSCALL occured.
- - should wait for that the underlying IO become readable or
- writable if the error was SSL_ERROR_WANT_READ or
- SSL_ERROR_WANT_WRITE. [ruby-dev:25795]
+ * ext/openssl/ossl_ssl.c (ossl_sslctx_session_new_cb): Return 0 to
+ OpenSSL from the callback for SSL_CTX_sess_set_get_cb().
+ Returning 0 means to OpenSSL that the session is still valid
+ (since we created Ruby Session object) and was not freed by us with
+ SSL_SESSION_free(). Call SSLContext#remove_session(sess) in
+ session_get_cb block if you don't want OpenSSL to cache the session
+ internally.
+ This potential issue was pointed by Ippei Obayashi. See #4416.
- * ext/openssl/lib/openssl/buffering.rb
- (Buffering#initialize): should set @eof and @rbuffer.
- (Buffering#fill_rbuff): should rescue Errno::EAGAIN.
- (Buffering#consume_rbuf): pointless eof flag resetting is deleted.
- (Buffering#read): should return an empty string if the specified
- size is zero.
- (Buffering#readpartial): new method.
- (Buffering#readline): fix typo.
- (Buffering#getc): return the first character of string correctly.
- (Buffering#each): fix typo. suggested by Brian Ollenberger.
- (Buffering#readchar): fix typo.
- (Buffering#eof?): should read again it the input buffer is empty.
- (Buffering#do_write): should rescue Errno::EAGAIN.
- (Buffering#puts): use "\n" as the output field separator.
+ * test/openssl/test_ssl_session.rb (test_ctx_server_session_cb): Test
+ it.
- * ext/openssl/lib/openssl/ssl.rb: set non-blocking flag to the
- underlying IO.
+Wed Jun 22 22:21:17 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/openssl/extconf.rb: get rid of GNUmakefile generation.
+ * ext/openssl/ossl_ssl_session.c: Respect T_BIGNUM time values. Patch by
+ Tomoyuki Chikanaga.
+ [ Ruby 1.9 - Bug #4919 ] [ruby-dev:43869]
- * text/openssl/test_pair.rb: test for IO like methods.
+Wed Jun 22 21:29:25 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * test/ruby/ut_eof.rb: test about empty file.
+ * ext/socket/depend (SOCK_HEADERS): use $(top_srcdir) instead of
+ $(topdir). sorry!
-Mon Mar 7 10:22:06 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+Wed Jun 22 19:47:03 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/un.rb: should use OptionParser. (backported form HEAD)
+ * cont.c (cont_capture): add volatile.
+ On clang -O, it is needed to avoid the optimization.
+ With this and llvm/clang's recent fix, clang 3.0 can
+ build ruby-trunk with -O option.
-Mon Mar 7 09:18:42 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * cont.c (cont_capture): use for-loop.
- * string.c (rb_str_cmp_m): should not return false but nil.
- fixed: [ruby-dev:25811]
+ * array.c (rb_ary_each): add volatile and use it.
-Mon Mar 7 01:22:14 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * vm_insnhelper.c (vm_call_cfunc): ditto.
- * ext/tk/tkutil.c: remove the some codes which depend on the
- difference between Ruby1.8 and 1.9, because st.c on Ruby1.9
- was changed.
+Wed Jun 22 18:20:46 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Mon Mar 7 00:01:04 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/openssl/ossl_ssl.c (ossl_sslctx_session_remove_cb):
+ OpenSSL::SSL::SSLContext#session_remove_cb was broken. It wrongly
+ tried to call the session_*new*_cb callback.
- * ext/tcltklib/tcltklib.c: fail to call TclTkLib.mainloop when $SAFE==4
+ * test/openssl/test_ssl_session.rb (class OpenSSL): Test it.
-Sun Mar 6 16:41:33 2005 Minero Aoki <aamine@loveruby.net>
+Wed Jun 22 17:37:49 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * lib/net/http.rb: HTTPHeader holds its header fields as an array
- (backport from CVS HEAD rev 1.112-1.123). [ruby-list:40629]
+ * ext/openssl/ossl.h: Introduced OSSL_BIO_reset macro for PEM/DER
+ fallback scenarios.
- * test/net/http/test_httpheader.rb: new file.
+ * ext/openssl/ossl_pkey_dsa.c
+ * ext/openssl/ossl_x509req.c
+ * ext/openssl/ossl_pkey_rsa.c
+ * ext/openssl/ossl_pkey_ec.c
+ * ext/openssl/ossl_ssl_session.c
+ * ext/openssl/ossl_x509crl.c
+ * ext/openssl/ossl_pkey.c
+ * ext/openssl/ossl_pkey_dh.c
+ * ext/openssl/ossl_x509cert.c
+ * ext/openssl/ossl_pkcs7.c: Use OSSL_BIO_reset.
-Sun Mar 6 11:47:10 2005 Sam Roberts <sroberts@uniserve.com>
+ * ext/openssl/ossl_ssl.c
+ * ext/openssl/ossl_cipher.c
+ * ext/openssl/ossl_pkey_ec.c
+ * ext/openssl/ossl_pkcs12.c
+ * ext/openssl/ossl_ssl_session.c: Replace rb_raise occurrences by
+ ossl_raise. This automatically flushes OpenSSL's error queue.
- * lib/pp.rb: rdoced. [ruby-core:4490]
+ * ext/openssl/ossl_pkcs7.c: Raise error if DER fallback for parsing
+ fails.
-Sun Mar 6 11:36:37 2005 Tanaka Akira <akr@m17n.org>
+ * test/openssl/test_pkey_ec.rb
+ * test/openssl/test_pkey_dsa.rb
+ * test/openssl/test_pkey_rsa.rb: Add assertions that OpenSSL.errors is
+ empty.
- * lib/pp.rb (File::Stat#pretty_print): Etc.getpwuid and Etc.getgrgid
- may return nil. [ruby-talk:129826]
- reported by Daniel Berger.
+ * test/openssl/test_pkey_rsa.rb: Remove initial OpenSSL.errors call in
+ test_new.
+ [ Ruby 1.9 - Bug #4885 ] [ruby-core:37134]
-Sat Mar 5 18:06:21 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Wed Jun 22 15:01:24 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * dir.c (fnmatch): removed unnecessary code. (ruby_1_8 didn't have
- String#clear, so [ruby-dev:24749] didn't affect it)
+ * ext/openssl/ossl_ssl.c: Use SSL_MODE_RELEASE_BUFFERS if available.
+ Thanks, Eric Wong, for providing the patch.
+ [ Ruby 1.9 - Feature #4672 ] [ruby-core:36127]
- * win32/win32.c (NtInitialize): ditto. (by numeric.c 1.101.2.14)
+Wed Jun 22 14:47:53 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Sat Mar 5 16:29:26 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/openssl/test_buffering.rb
+ * test/openssl/test_pkcs12.rb: Inherit from Test::Unit::TestCase
+ instead of MiniTest::Unit::TestCase. [ruby-core:37275]
- * ext/tk/lib/multi-tk.rb: freeze callback-entry objects
+Wed Jun 22 12:41:03 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * ext/tk/lib/tkextlib/tile.rb: support tile-0.6
+ * ext/openssl/ossl_ssl_session.c (ossl_ssl_session_to_der):
+ OpenSSL::SSL::Session#to_der was broken. Fix buffer handling.
-Fri Mar 4 19:39:28 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/openssl/test_ssl_session.rb (test_session): Test it.
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#do_includes): replace
- also locally defined modules.
+Wed Jun 22 12:38:52 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * ext/iconv/iconv.c: backport Iconv::InvalidEncoding from CVS HEAD.
+ * test/openssl/test_ssl_session.rb: Split out SSL::Session related
+ tests from test_ssl.rb
- * ext/strscan/strscan.c: moved misplaced rdoc.
+Wed Jun 22 03:20:52 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Fri Mar 4 15:58:12 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/psych/lib/psych/visitors/to_ruby.rb: Fix cyclic references of
+ objects. Thanks to CvX for reporting the bug and a test case.
+ * test/psych/test_object.rb: test for cyclic object references.
- * lib/cgi-lib.rb: add deprecation warning. [ruby-dev:25499]
- getopts.rb, parsearg.rb, importenv.rb as well.
+Wed Jun 22 02:39:54 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Fri Mar 4 11:17:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/net/http.rb (Net::HTTP.post_form): Do not ignore query part of
+ the given URI to post. See #655.
- * ext/tcltklib/tcltklib.c (ip_rbUpdateCommand): get rid of
- warnings with Tcl/Tk 8.3 or former (backport from CVS_HEAD).
+ * test/net/http/test_http.rb, test/net/http/utils.rb: Test it.
- * ext/tcltklib/tcltklib.c (ip_rb_threadUpdateCommand): ditto.
+Wed Jun 22 01:28:13 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Fri Mar 4 10:15:30 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/openssl/test_x509store.rb (test_set_errors): Redhat is
+ distributing a patched version of OpenSSL that allows multiple CRL
+ for a key (multi-crl.patch.) Make test pass on such env. See #4122,
+ #4554.
- * lib/set.rb (SortedSet::setup): a hack to shut up warning.
- [ruby-talk:132866]
+Tue Jun 21 21:50:37 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Fri Mar 4 07:07:00 2005 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/webrick/httpresponse.rb (HTTPResponse#setup_header): Close
+ HTTP/1.1 connection when returning an IO object as response body
+ without setting HTTPResponse#chunked to true. See #855 no.1.
- * ext/nkf/nkf-utf8/nkf.c: follow nkf 1.63
+ * test/webrick/test_httpserver.rb: Test it.
-Thu Mar 3 23:49:00 2005 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Jun 21 21:27:34 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/nkf/nkf-utf8/nkf.c: follow nkf 1.62
+ * internal.h: move rb_thread_io_blocking_region() declaration
+ from intern.h to internal.h. It's still experimental API and
+ need more discussion. [ruby-dev:43698]
+ * include/ruby/intern.h: ditto.
-Thu Mar 3 11:49:51 2005 Kouhei Sutou <kou@cozmixng.org>
+ * ext/socket/rubysocket.h: include internal.h.
+ * ext/socket/depend: add internal.h dependency.
+ * ext/socket/extconf.rb: add $INCFLAGS to topdir.
- * sample/rss/tdiary_plugin/rss-recent.rb: added site information.
+Tue Jun 21 20:38:47 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Wed Mar 2 19:53:07 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/date/date_core.c (datetime_s_*): canonicalize 24 o'clock.
- * ext/extmk.rb (parse_args): add DESTDIR only when not directed
- already. fixed: [ruby-dev:25781]
+Tue Jun 21 19:46:23 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Mar 2 17:14:18 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/ruby/test_thread.rb (TestThread#test_priority): enable
+ this test again. Current GVL respect thread priority rather
+ than past.
- * ext/tcltklib/tcltklib.c (lib_eventloop_core): fix typo
+Tue Jun 21 13:25:35 2011 TAKAO Kouji <kouji@takao7.net>
-Wed Mar 2 16:00:02 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/readline/readline.c (readline_getc): applied a patch in
+ #3827 by by Akio Tajima <artonx AT yahoo.co.jp>. (see #3827)
- * ext/tcltklib/tcltklib.c: enforce thread-check and exception-handling
- to avoid SEGV trouble.
- [KNOWN BUG] When supports pthread and running multiple Tk
- interpreters, an interrupt signal causes SEGV frequently. That
- may be a trouble of Ruby's signal handler.
+Tue Jun 21 13:16:31 2011 TAKAO Kouji <kouji@takao7.net>
- * ext/tk/tkutil/tkutil.c; fix a bug on converting a SJIS string array
- to a Tcl's list string.
+ * ext/readline/extconf.rb: fixed bug, specify --disable-libedit
+ then disable libedit, does not specify then check readline and
+ libedit if failed checking readline. (fixes #3375)
- * ext/tk/tcltklib.c: wrap Tcl's original "namespace" command to
- protect from namespace crash.
+Mon Jun 20 22:52:07 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/tk/lib/multi-tk.rb: enforce exception-handling.
+ * process.c (before_exec): use sig_do_nothing instead of SIG_DFL
+ for avoiding a race.
+ * process.c (sig_do_nothing): new function.
- * ext/tk/lib/multi-tk.rb: catch IRB_EXIT to work on irb.
+Mon Jun 20 21:31:03 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/tk/lib/tk.rb: ditto.
+ * thread_pthread.c (thread_timer): rename timeout_10ms to
+ time_quantum. it's no longer 10ms.
- * ext/tk/tcltklib.c: add TclTkLib.mainloop_thread?
+Mon Jun 20 18:46:02 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * ext/tk/lib/multi-tk.rb: (bug fix) callback returns a value.
+ * ext/openssl/ossl_cipher.c, ext/openssl/lib/openssl/cipher.rb:
+ Documentation fix by Ippei Obayashi. See #4419.
- * ext/tk/lib/tk/canvas.rb (delete): bug fix when multiple arguments.
+Mon Jun 20 15:41:33 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * ext/tk/lib/clock.rb: fix 'no method error'.
+ * lib/webrick/cookie.rb (WEBrick::Cookie.parse): Revert r31228.
+ r31228 was for allowing the 'Cookie:' header which did not have no
+ SP after ';' for separating cookie-pairs but RFC6265 requires single
+ SP after ';' there. We allow multiple SPs here for compatibility
+ with older WEBrick version.
- * ext/tk/lib/clock.rb (self.clicks): accept a Symbol argument.
+ * test/webrick/test_cookie.rb: Test it.
- * ext/tk/lib/variable.rb: be able to set default_value_type; :numeric,
- :bool, :string, :symbol, :list, :numlist or nil (default; same to
- :string). If set a type, TkVariable#value returns a value of the
- type.
+Sun Jun 19 13:31:26 2011 Shota Fukumori <sorah@tubusu.net>
- * ext/tk/lib/tkextlib/tclx/tclx.rb: add Tk::TclX.signal to warn the
- risk of using TclX extension's 'signal' command.
+ * NEWS: Introduce --hide-skip on test/unit.
- * ext/tk/sample/irbtk.rb: irb with Ruby/Tk.
+Sun Jun 19 10:05:16 2011 Shota Fukumori <sorah@tubusu.net>
- * ext/tk/sample/demos-*/anilabel.rb: bug fix on 'show code'
+ * lib/test/unit/parallel.rb: Override Test::Unit::TestCase#on_parallel_worker?
+ only when $0 == __FILE__.
- * ext/tk/sample/demos-*/aniwave.rb: new Ruby/Tk animation demo.
+ * lib/test/unit/parallel.rb: Run Test::Unit::Worker.run only when
+ $0 == __FILE__.
- * ext/tk/sample/demos-*/pendulum.rb: ditto.
+Sat Jun 18 23:59:24 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/sample/demos-*/goldberg.rb: ditto.
+ * io.c (fill_cbuf): finish reading at EOF, and the readconv has
+ been cleared by another thread while io_fillbuf() is waiting at
+ select(). a patch in [ruby-core:37197] by Hiroshi Shirosaki
+ <h.shirosaki AT gmail.com>. fixed #3840
- * ext/tk/sample/demos-*/widget: add entries of animation demos.
+Sat Jun 18 21:36:29 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Mar 1 00:47:43 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * thread_pthread.c: remove GVL_DEBUG
- * test/rinda/test_rinda.rb: backport from CVS_HEAD. use
- MockClock.sleep instead of Kernel.sleep [ruby-dev:25387]
+Sat Jun 18 21:32:02 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Mar 1 00:34:24 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * vm.c, vm_core.h (rb_vm_stack_to_heap): remove const.
+ It makes compilations warnings.
- * lib/rinda/tuplespace.rb (Rinda::TupleSpace): improved keeper thread.
+Sat Jun 18 18:54:15 2011 Koichi Sasada <ko1@atdot.net>
- * test/rinda/test_rinda.rb: ditto.
+ * vm.c, vm_core.h (rb_vm_stack_to_heap): fix "const" place.
-Mon Feb 28 11:42:23 2005 Ian Macdonald <ian@caliban.org>
+Sat Jun 18 17:23:38 2011 Tanaka Akira <akr@fsij.org>
- * exception error messages updated. [ruby-core:04497]
+ * eval.c, hash.c, load.c, proc.c, range.c, thread.c, time.c: don't
+ declare internal functions.
-Mon Feb 28 09:03:09 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * internal.h, vm_core.h: declare internal functions.
- * ext/socket/socket.c (Init_socket): add bunch of Socket
- constants. Patch from Sam Roberts <sroberts@uniserve.com>.
- [ruby-core:04409]
+ * array.c: include internal.h.
-Wed Feb 23 15:04:32 2005 akira yamada <akira@ruby-lang.org>
+ * common.mk: update dependency for array.o.
- * lib/uri/generic.rb (split_userinfo): should split ":pass" into ""
- and "pass". [ruby-dev:25667]
+Sat Jun 18 13:39:33 2011 Tanaka Akira <akr@fsij.org>
-Wed Feb 23 08:00:18 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * internal.h: declarations declared in include/ruby/*.h removed.
- * array.c (rb_ary_s_create): no need for negative argc check.
- [ruby-core:04463]
+Sat Jun 18 12:42:17 2011 Tanaka Akira <akr@fsij.org>
- * array.c (rb_ary_unshift_m): ditto.
+ * method.h, internal.h iseq.h: declare internal functions.
-Wed Feb 23 01:57:46 2005 Shugo Maeda <shugo@ruby-lang.org>
+ * compile.c, eval.c, iseq.c, object.c, parse.y, proc.c, process.c,
+ thread.c, vm.c, vm_eval.c, vm_insnhelper.c, vm_method.c: don't
+ declare internal functions.
- * lib/net/imap.rb (initialize): handle certs correctly. Thanks,
- NABEYA Kenichi. (backported from CVS HEAD)
+ Note that rb_method_entry_eq() is defined in vm_method.c but
+ there was a declaration in proc.c with different const-ness.
+ Now it is declared in method.h with same const-ness to the
+ definition.
-Tue Feb 22 07:25:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * object.c (rb_mod_module_exec): don't declare functions declared in
+ include/ruby/intern.h.
- * parse.y (parser_yylex): identfier after dot must not be a variable.
+Sat Jun 18 12:05:08 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Feb 21 10:04:49 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * include/ruby/backward/classext.h: for evil gems. fixed #4803
- * {bcc32,win32,wince}/Makefile.sub (config.h): add fcntl.
+Sat Jun 18 11:12:13 2011 Tanaka Akira <akr@fsij.org>
- * win32/win32.[ch] (fcntl): ditto.
+ * common.mk: update dependencies.
- * win32/win32.c (rb_w32_connect): support nonblocking mode.
+Sat Jun 18 11:09:03 2011 Tanaka Akira <akr@fsij.org>
- * ext/socket/socket.c (wait_connectable, ruby_connect): support
- nonblocking connect on various platforms.
- all changes are backported from CVS HEAD. [ruby-core:3154],
- [ruby-core:4364].
+ * io.c: suppress warnings.
-Sun Feb 20 00:48:48 2005 Tanaka Akira <akr@m17n.org>
+Sat Jun 18 10:22:39 2011 Tanaka Akira <akr@fsij.org>
- * lib/open-uri.rb (URI::FTP#buffer_open): access mechanism
- re-implemented according to RFC 1738.
- reported by Guillaume Marcais. [ruby-talk:131650]
+ * internal.h: declare more internal functions.
-Sat Feb 19 18:11:47 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * iseq.h (rb_method_get_iseq): declared.
- * lib/drb/drb.rb (DRbObject#respond_to?): take two arguments.
- [ruby-dev:25722]
+ * compile.c, eval.c, eval_error.c, iseq.c, parse.y, proc.c, range.c,
+ ruby.c, time.c, util.c, vm.c: don't declare internal functions.
- * test/drb/drbtest.rb: ditto.
+ * eval.c, parse.y, thread_pthread.c: non-existing function declarations
+ removed.
-Sat Feb 19 13:52:02 2005 Tanaka Akira <akr@m17n.org>
+Sat Jun 18 08:12:54 2011 Tanaka Akira <akr@fsij.org>
- * lib/open-uri.rb: call OpenSSL::SSL::SSLSocket#post_connection_check
- after connection is made.
+ * common.mk: dependencies updated.
-Sat Feb 19 01:32:03 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * tool/update-deps: new file to assist update dependencies in
+ common.mk.
- * ext/bigdecimal/lib/bigdecimal/newton.rb: resolved LoadError.
- [ruby-dev:25685]
+Sat Jun 18 07:27:27 2011 Tanaka Akira <akr@fsij.org>
- * ext/bigdecimal/sample/linear.rb: ditto.
+ * internal.h: declare internal functions here.
- * ext/bigdecimal/sample/nlsolve.rb: ditto.
+ * node.h: declare NODE dependent internal functions here.
- * ext/bigdecimal/lib/bigdecimal/nlsolve.rb: removed because this file
- is sample script and same file exists in ext/bigdecimal/sample.
+ * iseq.h: declare rb_iseq_t dependent internal functions here.
-Fri Feb 18 17:14:00 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * vm_core.h: declare rb_thread_t dependent internal functions here.
- * lib/xmlrpc/parser.rb (XMLRPC::FaultException): make it subclass
- of StandardError class, not Exception class. [ruby-core:04429]
+ * bignum.c, class.c, compile.c, complex.c, cont.c, dir.c, encoding.c,
+ enumerator.c, error.c, eval.c, file.c, gc.c, hash.c, inits.c, io.c,
+ iseq.c, load.c, marshal.c, math.c, numeric.c, object.c, parse.y,
+ proc.c, process.c, range.c, rational.c, re.c, ruby.c, string.c,
+ thread.c, time.c, transcode.c, variable.c, vm.c,
+ tool/compile_prelude.rb: don't declare internal functions declared
+ in above headers. include above headers if required.
-Thu Feb 17 20:11:18 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ Note that rb_thread_mark() was declared as
+ void rb_thread_mark(rb_thread_t *th) in cont.c but defined as
+ void rb_thread_mark(void *ptr) in vm.c. Now it is declared as
+ the later in internal.h.
- * lib/drb/drb.rb (DRbServer.default_safe_level): fix typo.
+Sat Jun 18 02:36:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Thu Feb 17 20:11:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/bigdecimal/bigdecimal.c (VpNewRbClass): fix type of the 2nd
+ argument.
- * test/digest/test_digest.rb: separate test case for each algorithms.
- [ruby-dev:25412]
+ * ext/bigdecimal/bigdecimal.h: ditto.
-Thu Feb 17 11:54:00 2005 Nathaniel Talbott <ntalbott@ruby-lang.org>
+Sat Jun 18 02:30:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * lib/test/unit/collector.rb (collect_file): now deletes paths added
- to $LOAD_PATH instead of restoring it verbatim.
+ * ext/bigdecimal/bigdecimal.c (BigMath_s_exp): move BigMath.exp from
+ bigdecimal/math.rb.
- * lib/test/unit/autorunner.rb (AutoRunner.run): fixed so that
- 'ruby -rtest/unit -rtest1 -rtest2 -e0' will use the objectspace
- collector again. Also tried to simplify the calling convention.
+ * ext/bigdecimal/lib/bigdecimal/math.rb: ditto.
- * test/runner.rb: adjusted for new AutoRunner semantics.
+ * test/bigdecimal/test_bigdecimal.rb: move test for BigMath.exp from
+ test/bigdecimal/test_bigmath.rb.
- * lib/test/unit.rb: ditto.
+ * test/bigdecimal/test_bigmath.rb: ditto.
-Thu Feb 17 04:21:47 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat Jun 18 00:20:54 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/open3.rb (Open3::popen3): $? should not be EXIT_FAILURE.
- fixed: [ruby-core:04444]
+ * ext/date/date_core.c: do not define wnum[01].
-Thu Feb 17 00:09:45 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Fri Jun 17 18:57:36 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * test/drb/ignore_test_drb.rb: move TestDRbReusePort to new file
- [ruby-dev:25238]
+ * compile.c (iseq_compile_each): fix return value of obj[a,*b]=c.
- * test/drb/test_drb.rb: add method DRbService.ext_service, move
- TestDRbReusePort to new file [ruby-dev:25238]
+Fri Jun 17 13:09:45 2011 Eric Hodel <drbrain@segment7.net>
- * test/drb/test_drb.rb: ditto.
+ * ext/curses/curses.c: Clean up documentation.
- * test/drb/test_drbssl.rb: ditto.
+Fri Jun 17 09:25:14 2011 Eric Hodel <drbrain@segment7.net>
- * test/drb/test_drbunix.rb: ditto.
+ * ext/curses/curses.c: Document curses constants. Patch by Vincent
+ Batts. [Ruby 1.9 - Bug #4880]
- * test/drb/ut_drb.rb: reduce sleep.
+Fri Jun 17 09:11:05 2011 Eric Hodel <drbrain@segment7.net>
-Thu Feb 17 00:02:27 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * object.c: Document Module#method_added and #method_removed.
+ Patch by Bryce Kerley. [Ruby 1.9 - Feature #4867]
- * eval.c (is_defined): NODE_IASGN is an assignment.
+Fri Jun 17 08:50:16 2011 Eric Hodel <drbrain@segment7.net>
-Wed Feb 16 23:34:30 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * io.c: Improve documentation of IO and File open and new.
+ Patch by Roger Pack. [Ruby 1.9 - Bug #4790]
- * lib/drb/drb.rb: add lazy stop_service. ([druby-ja:109])
+Fri Jun 17 07:53:50 2011 Eric Hodel <drbrain@segment7.net>
- * lib/drb/extserv.rb: ditto.
+ * lib/csv.rb: Document #raw_encoding. Patch by David Czarnecki.
+ [Ruby 1.9 - Bug #4874]
-Wed Feb 16 17:07:57 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Fri Jun 17 07:46:50 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tk/tkutil.c: Follow the change of st.c (st_foreach)
- [ruby-list:40623].
- Sometimes mis-convert from a Ruby's Array of SJIS Strings, which
- includes some kind of SJIS characters, to a Tcl's UTF8 list string.
+ * lib/benchmark.rb: Document Benchmark::Tms#memberwise. Patch by
+ David Czarnecki. [Ruby 1.9 - Bug #4873]
-Mon Feb 14 23:58:17 2005 Kouhei Sutou <kou@cozmixng.org>
+Fri Jun 17 07:38:31 2011 Eric Hodel <drbrain@segment7.net>
- * lib/rss/parser.rb (RSS::ListenerMixin::tag_end):
- fixed invalid namespace handling bug.
+ * lib/prettyprint.rb: Improve documentation. Patch by Ysiad
+ Ferreiras. [#4834]
-Mon Feb 14 13:12:38 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Fri Jun 17 07:23:03 2011 Eric Hodel <drbrain@segment7.net>
- * ext/openssl/lib/openssl/ssl.rb
- (OpenSSL::SSL::SSLSocket#post_connection_check): new method.
+ * array.c (rb_ary_drop): Improve documentation. Patch by Caley Woods.
+ [Ruby 1.9 - Bug #4858]
-Mon Feb 14 00:40:49 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Fri Jun 17 06:11:31 2011 Eric Hodel <drbrain@segment7.net>
- * lib/drb/drb.rb (InvokeMethod.perform): pass DRb info to sub thread.
+ * lib/webrick/log.rb: Improve documentation of BasicLog and Log.
+ Patch by Olivier Brisse. [Ruby 1.9 - Bug #4833]
+ * lib/webrick/httpstatus.rb: Improve documentation of
+ WEBrick::HTTPStatus. Patch by Olivier Brisse.
+ [Ruby 1.9 - Bug #4833]
- * test/drb/test_drb.rb (test_01_safe1_safe4_eval): fix test case.
+Fri Jun 17 04:48:22 2011 Koichi Sasada <ko1@atdot.net>
-Sun Feb 13 23:13:46 2005 Kouhei Sutou <kou@cozmixng.org>
+ * thread_pthread.c, thread_pthread.h: remove unused variables.
+ (native_thread_data_t::gvl_cond, native_thread_data_t::gvl_next)
- * lib/rss/dublincore.rb (RSS::DublicCoreModel#date{,=}): added
- convenient methods.
+Thu Jun 16 14:32:31 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/rss/0.9.rb (RSS::Rss::Channel#date{,=}): ditto.
+ * time.c (rb_time_new): prevent overflow by "* 1000".
- * lib/rss/2.0.rb (RSS::Rss::Channel::Item#date{,=}): ditto.
+Fri Jun 17 03:07:36 2011 Koichi Sasada <ko1@atdot.net>
- * test/rss/: added tests for the convenient methods.
+ * benchmark/bm_vm4_thread_create_join.rb,
+ benchmark/bm_vm4_thread_mutex[1-3].rb: renamed to
+ bm_thread_* (fix last rename).
-Sun Feb 13 22:43:03 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Fri Jun 17 02:26:47 2011 Koichi Sasada <ko1@atdot.net>
- * lib/drb/drb.rb (DRbServer): add default_safe_level, safe_level,
- config[:safe_level] ([druby-ja:120])
+ * thread_pthread.c (native_thread_create): fix debug message.
+ (add last newline)
- * test/drb/test_drb.rb, ut_eval.rb, ut_safe1.rb: ditto.
+Thu Jun 16 23:40:49 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun Feb 13 16:56:52 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * thread.c (rb_thread_schedule_rec): fix {UN,}LIKELY macro misuse.
+ * gc.c (rb_newobj): ditto.
+ * vm_insnhelper.c (vm_method_search): ditto.
- * lib/webrick/cgi.rb (WEBrick::CGI.start): should set reason-phrase
- to the value of status header field. ([ruby-dev:40617])
+Thu Jun 16 20:06:15 2011 Shota Fukumori <sorah@tubusu.net>
-Sun Feb 13 00:52:33 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * test/testunit/test_parallel.rb: Fix Regexp for test.
- * lib/erb.rb (ERB::Util.h, u): make it module_function.
+ * test/testunit/tests_for_parallel/test_third.rb: Use
+ Test::Unit::TestCase#on_parallel_worker? for detecting worker.
-Sat Feb 12 17:29:19 2005 Tanaka Akira <akr@m17n.org>
+ * lib/test/unit/testcase.rb(Test::Unit::TestCase#on_parallel_worker?):
+ New Method Test::Unit::TestCase#on_parallel_worker? returns true
+ when a testcase is running on parallel worker.
+ * lib/test/unit/parallel.rb(Test::Unit::TestCase#on_parallel_worker?):
+ ditto.
- * lib/open-uri.rb (OpenURI.open_loop): send authentication only for
- the URI directly specified.
+Thu Jun 16 19:27:12 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Sat Feb 12 15:07:23 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/test_securerandom.rb: Add testcase. This testcase does NOT aim
+ to test cryptographically strongness and randomness. It includes
+ the test for PID recycle issue of OpenSSL described in #4579 but
+ it's disabled by default.
- * random.c (rand_init): suppress warning.
+Thu Jun 16 17:55:07 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sat Feb 12 13:54:03 2005 Tanaka Akira <akr@m17n.org>
+ * test/ruby/test_io.rb (TestIO#test_copy_stream_socket): fix
+ test hanging up issue. Patch by CHIKANAGA Tomoyuki.
- * lib/open-uri.rb: support https if the platform provides CA
- certificates.
+Thu Jun 16 15:17:39 2011 Eric Hodel <drbrain@segment7.net>
-Sat Feb 12 06:18:28 2005 URABE Shyouhei <shyouhei@ice.uec.ac.jp>
+ * variable.c (const_missing): Add simple example of const_missing.
+ Patch by Anuj Dutta. [Ruby 1.9 - Bug #4794]
- * ext/etc/etc.c (Init_etc): sGroup needs HAVE_ST_GR_PASSWD check.
- [ruby-dev:25675]
+Thu Jun 16 15:09:29 2011 Eric Hodel <drbrain@segment7.net>
-Fri Feb 11 17:40:42 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * lib/monitor.rb: Improve documentation. Patch by Sandor Szucs.
+ [Ruby 1.9 - Bug #4823]
- * ext/openssl/ossl_x509store.c (ossl_x509store_set_default_paths):
- new method OpenSSL::X509::Store#set_default_paths.
+Thu Jun 16 14:54:09 2011 Eric Hodel <drbrain@segment7.net>
-Fri Feb 11 11:33:53 2005 Tanaka Akira <akr@m17n.org>
+ * lib/webrick/utils.rb: Document WEBrick::Utils. Patch by Olivier
+ Brisse. [Ruby 1.9 - Bug #4819]
- * lib/open-uri.rb (URI::HTTP#proxy_open): new option supported:
- :http_basic_authentication.
- suggested by Kent Sibilev. [ruby-core:4392]
+Thu Jun 16 14:26:46 2011 Eric Hodel <drbrain@segment7.net>
-Fri Feb 11 06:30:07 2005 George Ogata <g_ogata@optushome.com.au>
+ * lib/webrick/httpservlet/erbhandler.rb: Allow the ERB document to
+ alter the content-type of the response. [Ruby 1.9 - Bug #4685]
- * misc/ruby-mode.el: ignore parenthesis inside heredoc.
- [ruby-core:04415]
+Thu Jun 16 14:15:47 2011 Eric Hodel <drbrain@segment7.net>
-Fri Feb 11 04:54:13 2005 Tilman Sauerbeck <tilman@code-monkey.de>
+ * lib/timeout.rb: Clarify timeout duration types. Patch by Alf Mikula.
+ [Ruby 1.9 - Bug #4791]
+ * lib/net/http.rb: ditto
- * lib/rdoc/generators/html_generator.rb: [ruby-core:04412]
+Thu Jun 16 13:25:25 2011 Eric Hodel <drbrain@segment7.net>
- * lib/rdoc/generators/ri_generator.rb: ditto.
+ * lib/rdoc*: Import RDoc 3.7 release candidate
-Thu Feb 10 11:14:17 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Jun 16 11:35:09 2011 Shugo Maeda <shugo@ruby-lang.org>
- * win32/Makefile.sub (COMMON_HEADERS): shouldn't include winsock2.h.
+ * lib/net/imap.rb (search_response): parses SEARCH responses from
+ the Yahoo IMAP server correctly. patched by Mark Nadig. [Bug #4509]
- * ext/socket/extconf.rb (sockaddr_storage): remove workaround for
- mswin32.
+Thu Jun 16 09:12:38 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Feb 10 10:29:16 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * fix for build on solaris 10.
- * ext/curses/curses.c: don't need to check HAVE_WCOLOR_SET excluding
- window_color_set().
+Thu Jun 16 09:08:39 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Feb 10 00:47:25 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/io/console/test_io_console.rb (TestIO_Console#test_sync):
+ fix for daemon process.
- * struct.c (make_struct): fixed: [ruby-core:04402]
+Thu Jun 16 07:58:01 2011 Shota Fukumori <sorah@tubusu.net>
-Wed Feb 9 08:07:08 2005 Paul Duncan <pabs@pablotron.org>
+ * test/testunit/test_parallel.rb(test_ignore_tzero): Test for r32109.
- * ext/curses/curses.c (window_color_set): [ruby-core:04393]
+ * test/testunit/tests_for_parallel/test_third.rb: Use another way to
+ detect that test is running on worker. This fixes sometimes
+ TestParallel failing.
-Tue Feb 8 23:51:47 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Thu Jun 16 07:20:06 2011 Shota Fukumori <sorah@tubusu.net>
- * lib/drb/drb.rb: reject :instance_eval, :class_eval, :module_eval
- [druby-ja:117]
+ * lib/test/unit.rb(Test::Unit::Runner#_run_parallel): Ignore -j0
+ because it makes blocking forever by IO.select.
-Tue Feb 8 13:06:12 2005 Sam Roberts <sroberts@uniserve.com>
+Thu Jun 16 03:08:11 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/socket/socket.c (Init_socket): SO_REUSEPORT added.
- [ruby-talk:130092]
+ * test/testunit/test_parallel.rb (TestParallel::TestParallelWorker#
+ setup): now can run on Windows, probably.
-Tue Feb 8 09:30:01 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/testunit/test_parallel.rb (TestParallel::TestParallel#setup):
+ ditto.
- * lib/cgi.rb (CGI::Cookie): [ruby-talk:130040]
+Thu Jun 16 03:00:26 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Feb 8 00:19:02 2005 Tanaka Akira <akr@m17n.org>
+ * thread.c (do_select): Windows: no need to poll if select(2) is
+ cancelable.
- * lib/resolv.rb (Resolv::DNS::Name#subdomain_of?): new method.
- (Resolv::DNS::Name#inspect): ditto.
- Suggested by Sam Roberts. [ruby-talk:129086]
+ * thread_win32.c (native_fd_select): new function to make select(2)
+ cancelable.
-Mon Feb 7 10:06:30 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * thread_win32.c (rb_w32_check_interrupt): new function for checking
+ interrupt.
- * object.c: [ruby-doc:818]
+ * win32/win32.c (rb_w32_select_with_thread): new function. cancelable
+ select(2).
-Mon Feb 7 01:56:20 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * win32/win32.c (rb_w32_select): use above function internally.
- * instruby.rb, rubytest.rb (srcdir): no longer embed srcdir into
- rbconfig.rb. (backported from CVS HEAD)
+Wed Jun 15 23:30:45 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/socket/extconf.rb (sockaddr_storage): winsock2.h have the
- definition of struct sockaddr_storage, but socket.c doesn't
- include it because this version of ruby still has binary level
- compatibility with winsock1.
+ * gc.c: fix a regression by r31690 on AIX because AIX malloc
+ return NULL if it's passed 0. But some caller don't expect it.
+ patch by Yutaka Kanemoto. [ruby-dev:43779]
+ (vm_malloc_prepare): return calculated size.
+ (vm_xmalloc): use above result.
+ (vm_xcalloc): ditto.
- * lib/mkmf.rb (create_makefile): should support header files in
- depend file.
+Wed Jun 15 23:11:35 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Feb 7 01:21:50 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread.c: remove BLOCKING_REGION_CORE() macro. It's no longer used
+ since r32022.
- * ext/socket/extconf.rb: check if getaddrinfo() works fine only when
- wide-getaddrinfo option is not given. fixed: [ruby-dev:25422]
+Wed Jun 15 21:00:47 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * lib/mkmf.rb ($extmk): check if under ext directory.
+ * test/openssl/test_config.rb: execute based on the existence of the
+ OpenSSL module.
- * lib/mkmf.rb (Logging.postpone): allow recursive operation.
+Wed Jun 15 12:35:11 2011 Tanaka Akira <akr@fsij.org>
- * lib/mkmf.rb (try_constant): make sure if really a constant, reduce
- the number of times of compile.
+ * test/ruby/test_io.rb (test_copy_stream_socket): wait a child process
+ before SIGUSR1 handler is removed.
- * lib/mkmf.rb (have_macro, have_var, byte_order): new functions.
+ * test/pathname/test_pathname.rb (define_assertion): use line number
+ for test method names.
- * lib/mkmf.rb (find_library): allow directory list with separators.
+Wed Jun 15 10:37:43 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/mkmf.rb (arg_config): manage provided configuration options.
+ * file.c (rb_stat_rdev): use DEVT2NUM.
- * lib/mkmf.rb (dir_config): accept arrays of directory names as
- default values.
+ * file.c (rb_stat_rdev_major): ditto.
- * mkconfig.rb: no longer embed srcdir and compile_dir into
- rbconfig.rb.
+ * file.c (rb_stat_rdev_minor): ditto.
- * lib/mkmf.rb (create_makefile): fix unbalanced parens.
+Wed Jun 15 05:12:59 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sun Feb 6 19:23:01 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/tcltklib.c (lib_eventloop_core): revert the last change (it's
+ the part for ruby_1_8), and use rb_thread_check_ints() when RUBY_VM
+ is defined.
- * eval.c (stack_extend): add prototype because VC++8 doesn't
- accept __declspec(noinline) with K&R style function definitions.
- (backported from CVS HEAD)
+Wed Jun 15 04:42:47 2011 Koichi Sasada <ko1@atdot.net>
-Sun Feb 6 14:14:26 2005 Tadayoshi Funaba <tadf@dotrb.org>
+ * benchmark/bm_vm3_thread_*.rb: renamed bm_vm3_thread_*.rb to
+ benchmark/bm_vm_thread_*.rb.
- * lib/date.rb (new_with_hash): changed messages of exception.
+Wed Jun 15 04:28:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/date/format.rb (str[fp]time): undocumented conversion
- specifications %[1-3] are now deprecated.
+ * benchmark/bm_vm4_thread_pass.rb: rename bm_vm4* to
+ bm_vm_thread_*. suggested by ko1.
+ * benchmark/bm_vm4_pipe.rb: ditto.
+ * benchmark/bm_vm4_alive_check1.rb: ditto.
+ * benchmark/bm_vm4_pass_flood.rb: ditto.
-Sun Feb 6 12:20:11 2005 Akinori MUSHA <knu@iDaemons.org>
+Wed Jun 15 03:52:50 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * bignum.c (rb_big2ulong_pack): One too many arguments are passed
- to big2ulong().
+ * benchmark/bm_vm4_pass_flood.rb: new benchmark for GVL fairness.
+ * benchmark/bm_vm4_alive_check1.rb: ditto.
- * re.c (rb_reg_init_copy, rb_reg_initialize_m): One too many
- arguments are passed to rb_reg_initialize().
+Wed Jun 15 01:27:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun Feb 6 03:24:20 2005 Tanaka Akira <akr@m17n.org>
+ * thread_pthread.c (gvl_yield): fix live lock issue on 1-2 cpus
+ system. It's additional fix for r32021.
+ * thread_pthread.c (gvl_init): add switch_wait_cond.
+ * thread_pthread.h (typedef struct rb_global_vm_lock_struct): ditto.
- * lib/resolv.rb (Resolv::DNS::Resource::TXT): multiple strings was not
- handled.
- (Resolv::DNS::Resource::TXT#strings): new method to return all
- strings.
- (Resolv::DNS::Message::MessageEncoder#put_string_list): new method.
- (Resolv::DNS::Message::MessageDecoder#get_string_list): ditto.
- based on [ruby-talk:129732] by Sam Roberts.
+Tue Jun 14 23:16:22 2011 Tanaka Akira <akr@fsij.org>
-Fri Feb 4 00:30:45 2005 Kouhei Sutou <kou@cozmixng.org>
+ * bootstraptest/runner.rb (show_progress): refine verbose mode.
+ (exec_test): ditto.
- * lib/rss: supported Image module.
- http://web.resource.org/rss/1.0/modules/image/
+Tue Jun 14 23:02:36 2011 Tanaka Akira <akr@fsij.org>
-Thu Feb 3 23:42:36 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * bootstraptest/runner.rb (show_progress): extracted from assert_check.
+ (assert_check): use show_progress.
+ (assert_normal_exit): ditto.
+ (assert_finish): ditto.
+ (flunk): ditto.
- * ext/stringio/stringio.c (strio_close, strio_close_read, strio_close_write):
- should return nil instead of self as well as IO. [ruby-dev:25623]
+Tue Jun 14 22:51:42 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/stringio/stringio.c (strio_extend, strio_putc): fill with zero
- extended portion. [ruby-dev:25626]
+ * test/date/test_*.rb: added tests.
-Wed Feb 2 23:52:53 2005 sheepman <sheepman@tcn.zaq.ne.jp>
+Tue Jun 14 22:09:58 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/stringio/stringio.c (strio_truncate): should MEMZERO an extended
- part. [ruby-dev:25618]
+ * ext/date/date_core.c: renamed some functions.
+ * ext/date/date_core.c: modified doc.
-Wed Feb 2 21:56:01 2005 Kouhei Sutou <kou@cozmixng.org>
+Tue Jun 14 21:26:01 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * lib/rss/rss.rb (RSS::Element#convert): added.
+ * cont.c (cont_save_thread): add new utility function.
+ rb_context_t::saved_thread.machine_stack_start and
+ machine_stack_end should be cleared immediately after a snapshot of
+ current thread is stored to saved_thread. [ruby-dev:43680] [Bug #4855]
+ this change aims to get rid of unnecessary GC mark at machine stack.
- * lib/rss/rss.rb: convert -> need_convert.
+Tue Jun 14 19:50:49 2011 Tanaka Akira <akr@fsij.org>
- * lib/rss/1.0.rb: ditto.
+ * test/ruby/test_autoload.rb: remove temporary directory.
- * lib/rss/0.9.rb: ditto.
+Tue Jun 14 11:05:03 2011 Narihiro Nakamura <narihiro@netlab.jp>
- * lib/rss/2.0.rb: ditto.
+ * gc.c (rb_gc_set_params): call initial_expand_heap if
+ initial_heap_min_slots is set.
- * lib/rss/trackback.rb: ditto.
+Tue Jun 14 11:02:08 2011 Narihiro Nakamura <narihiro@netlab.jp>
-Tue Feb 1 22:48:48 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * gc.c: use size_t.
- * lib/drb/drb.rb (DRb::DRbObject#respond_to?): check marshal_dump and
- _dump.
+Tue Jun 14 01:10:38 2011 Yusuke Endoh <mame@tsg.ne.jp>
-Tue Feb 1 00:20:23 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/coverage/test_coverage.rb: add a test for restart. a patch
+ from Xavier Shay. [ruby-core:36745]
- * configure.in (aix): fix linker flags on AIX. [ruby-talk:125460]
+Tue Jun 14 01:05:10 2011 Yusuke Endoh <mame@tsg.ne.jp>
-Mon Jan 31 13:33:21 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/coverage/coverage.c: make it restartable. [ruby-core:36539]
- * ext/tcltklib/tcltklib.c: add invalid namespace check
+Mon Jun 13 23:55:40 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/tk/lib/multi-tk.rb: add invalid_namespace? method
+ * thread.c (rb_thread_schedule_rec): call gvl_yield() unconditionally.
+ * thread_pthread.c: remove HAVE_GVL_YIELD macro.
+ * thread_win32.c (gvl_yield): new. this fallback logic was moved from
+ rb_thread_schedule_rec().
- * ext/tk/lib/remote-tk.rb: ditto
+Mon Jun 13 23:50:25 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Jan 31 10:29:18 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/io/console/console.c (console_dev): typo.
- * lib/irb/context.rb (IRB::Context::initialize): [ruby-core:04330]
+Mon Jun 13 23:38:23 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Jan 29 09:42:12 2005 Sam Roberts <sroberts@uniserve.com>
+ * parse.y (parser_parse_string): flush delayed token. based on a
+ patch by Masaya Tarui in [ruby-dev:43762]. Bug #4544
- * lib/resolv.rb (Resolv::DNS::Resource::IN::SRV): Added RFC2782 SRV
- resource record for specifying location of services.
+ * parse.y (yylex): revert r24557. delayed token at the end of
+ string should be flushed already by the above change.
-Fri Jan 28 17:16:55 2005 Tanaka Akira <akr@m17n.org>
+Mon Jun 13 23:33:31 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/resolv.rb (Resolv::DNS::Config.parse_resolv_conf):
- parse options line for ndots option.
- (Resolv::Hosts#lazy_initialize): return self.
- (Resolv::DNS#lazy_initialize): ditto.
- (Resolv::DNS::Config#lazy_initialize): ditto.
- Suggested by Sam Roberts.
+ * ext/io/console/console.c (console_dev): console should be
+ unbuffered.
-Thu Jan 27 13:18:03 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/io/console/console.c (console_dev): take care of no-ctty
+ case.
- * st.c (st_foreach): report success/failure by return value.
- [ruby-Bugs-1396]
+Mon Jun 13 23:06:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu Jan 27 00:15:29 2005 Minero Aoki <aamine@loveruby.net>
+ * thread_pthread.c: rewrite GVL completely. This fix improve some
+ benchmark dramatically (e.g. vm3_thread_mutex result changed
+ form 120.601sec to 3.426sec).
+ * thread_win32.c: ditto.
+ * thread_pthread.h: ditto.
+ * vm_core.h: ditto.
+ * thread.c: ditto.
- * test/fileutils/test_fileutils.rb (setup): support BSD-style
- directory group inheritance. (backport from HEAD, rev 1.32)
+Mon Jun 13 23:11:52 2011 Tanaka Akira <akr@fsij.org>
- * test/fileutils/fileasserts.rb (assert_same_entry): show entry
- difference. (backport from HEAD, rev 1.4)
+ * test/socket/test_unix.rb: don't use Thread.abort_on_exception.
-Wed Jan 26 23:09:11 2005 Minero Aoki <aamine@loveruby.net>
+Mon Jun 13 23:05:01 2011 Tanaka Akira <akr@fsij.org>
- * lib/net/protocol.rb (WriteAdapter#puts): should append \n, not
- prepend. [ruby-talk:128302] (backport from HEAD, rev 1.75)
+ * ext/socket/unixsocket.c (unix_send_io): race condition fixed.
+ (unix_recv_io): ditto.
+ fixed by Eric Wong. [ruby-core:35574]
-Wed Jan 26 10:51:50 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/socket/test_unix.rb: test added for above problem.
- * win32/win32.c (flock_winnt, flock_win95): unlock file even if
- LOCK_NB is specified. (backported from CVS HEAD)
+Mon Jun 13 21:41:05 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Jan 25 17:11:51 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * thread_win32.c (native_cond_signal): remove unnecessary rb_bug().
+ It's additional fix for r32021. [Bug #4696]
- * ruby.c (proc_options): correct -T option in RUBYOPT. (backported
- from CVS HEAD)
+Mon Jun 13 20:50:49 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Tue Jan 25 14:05:52 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/openssl/test_ec.rb
+ test/openssl/test_pkey_ec.rb: merge both files into test_pkey_ec.rb.
+ Removed redundant group instantiation from PKey tests.
+ * test/openssl/utils.rb: only create TEST_PKEY_EC_P256V1 if EC is
+ defined.
- * ext/tcltklib/tcltklib.c: fix SEGV bug; trouble on canceling remained
- after scripts [ruby-dev:25479]: NULL current namespace when deleting
- Tk interpreter [ruby-talk:126225]
+Mon Jun 13 20:28:24 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/tcltklib/extconf.rb: bug fix; TCL_ENABLE_THREAD flag is inverted
- [ruby-talk:126360]
+ * test/openssl/digest.rb: remove MDC2 from test, it is not available
+ by default in an OpenSSL installation.
- * ext/tcltklib/extconf.rb: add yet another native-thread check
+Mon Jun 13 20:18:55 2011 Koichi Sasada <ko1@atdot.net>
- * ext/tk/tkutil.c: fix SEGV bug; NULL string pointer when finalize
- Ruby interpreter
+ * vm_core.h, vm_insnhelper.h: move decl. of
+ ruby_vm_global_state_version and related macros
+ from vm_core.h to vm_insnhelper.h.
- * ext/tk/lib/multi-tk.rb: avoid warning for deleted safeTk ip frame
+ * vm.c (vm_clear_all_cache): added. This function is called
+ when ruby_vm_global_state_version overflows.
+ TODO: vm_clear_all_inline_method_cache() is only place holder.
+ We need to implement it ASAP.
- * ext/tk/lib/tk/bindtag.rb: bug fix; new method of named bindtag
- doesn't return the created object [ruby-dev:25479]
+ * vm_method.c (vm_clear_global_method_cache): added.
- * ext/tk/lib/tk/menu.rb: bug on treating arguments [ruby-dev:25479]
+Mon Jun 13 19:46:21 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
- * ext/tk/lib/tk.rb: bug fix; cannot accept a callback ID string for
- a command argument [ruby-dev:25479]
+ * lib/cmath.rb: add new method Object#real?. fix #3137
- * ext/tk/lib/multi-tk.rb: ditto
+Mon Jun 13 18:52:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * ext/tk/lib/tk/*.rb: ditto
+ * ext/bigdecimal/bigdecimal.c (is_kind_of_BigDecimal): new function to
+ examine the whether the object is kind of BigDecimal.
- * ext/tk/lib/tkextlib/*.rb: ditto
+Mon Jun 13 18:49:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * ext/tk/sample/demos-jp/anilabel.rb: new demo script
+ * ext/bigdecimal/bigdecimal.c (BigDecimalCmp): use GetVpValueWithPrec
+ for Float and Rational arguments.
- * ext/tk/sample/demos-en/anilabel.rb: ditto
+ * test/bigdecimal/test_bigdecimal.rb (test_new, test_cmp, test_power):
+ add and modify tests for the above change.
- * ext/tk/sample/tkHTML/ss.rb: local variable scope bug fix
- [ruby-dev:25479]
+ * ext/bigdecimal/bigdecimal.c (BigDecimalCmp): modify coding style to
+ match ruby's standard.
-Mon Jan 24 15:44:25 2005 Tilman Sauerbeck <tilman@code-monkey.de>
+Mon Jun 13 18:33:04 2011 Tanaka Akira <akr@fsij.org>
- * lib/rdoc/parsers/parse_c.rb: allow whitespace after function names.
- [ruby-core:4296]
+ * lib/securerandom.rb (SecureRandom.random_bytes): modify PRNG state
+ to prevent random number sequence repetition at forked child
+ process which has same pid.
+ reported by Eric Wong. [ruby-core:35765]
- * lib/rdoc/parsers/parse_simple.rb: adds support for private comments
- in the "simple" parser. [ruby-core:4301]
+Mon Jun 13 17:02:34 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Jan 24 15:44:25 2005 Charles Mills <cmills@freeshell.org>
+ * lib/net/http.rb (Net::HTTP#use_ssl?): require 'openssl' only when
+ https is needed. fixes r31933.
- * lib/rdoc/parsers/parse_c.rb: adds support for constants
- (rb_define_const), accessors (rb_define_attr), and makes a
- couple fixes. [ruby-core:4307]
+Mon Jun 13 14:35:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Mon Jan 24 15:44:25 2005 Florian Gro <florgro@gmail.com>
+ * lib/cmath.rb (CMath.cbrt): returns the principal value of the cube
+ root of the argument. fix #3676
- * lib/rdoc/parsers/parse_rb.rb: Logic for def Builtin.method() end
- [ruby-core:4302]
+ * test/test_cmath.rb (test_cbrt_returns_principal_value_of_cube_root):
+ test for the above change.
-Mon Jan 24 15:44:25 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon Jun 13 14:17:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * document updates - [ruby-core:04296], [ruby-core:04301],
- [ruby-core:04302], [ruby-core:04307]
+ * lib/test/unit.rb (Test::Unit::GlobOption#non_options): fix typo.
-Sun Jan 23 12:41:16 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Mon Jun 13 13:04:20 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * lib/soap/wsdlDriver.rb: from 1.5.3-ruby1.8.2, operation which has
- capitalized name (such as KeywordSearchRequest in AWS) is defined as
- a method having uncapitalized name. (converted with
- GenSupport.safemethodname to handle operation name 'foo-bar'). it
- introduced serious incompatibility; in the past, it was defined as a
- capitalized.
+ * ext/openssl/ossl_digest.c: fix error for digests that have no oid
+ (e.g. DSS1).
+ * test/openssl/test_digest.c: add tests for this.
- define capitalized method as well under that circumstance.
+Mon Jun 13 12:51:51 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Sun Jan 23 05:24:42 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * lib/yaml.rb: load psych only when syck is not loaded.
- * ext/openssl/ossl_ocsp.c (ossl_ocspreq_to_der): should call
- GetOCSPReq at first.
+Mon Jun 13 12:23:39 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Sat Jan 22 23:09:47 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Mon Jun 13 12:23:39 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/drb/ssl.rb (accept): rescue SSLError. [druby-ja:110]
+ * ext/psych/lib/psych/deprecated.rb (Object#to_yaml_properties):
+ undef to_yaml_properties before redefine it.
-Sat Jan 22 22:35:03 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * ext/syck/lib/syck/rubytypes.rb: ditto.
- * lib/drb/unix.rb: fail if UNIXFileOwner is set. [druby-ja:111]
+Mon Jun 13 11:30:10 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Fri Jan 21 23:58:42 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/openssl/ossl_digest.c: allow Digests to be created by sn, ln or
+ oid.
+ * test/openssl/test_digest.rb: add tests for this.
+ [Ruby 1.9 - Feature #4412] [ruby-core:35319]
- * ext/stringio/stringio.c (strio_set_pos): clear EOF flag.
- [ruby-talk:127511]
+Mon Jun 13 10:54:03 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Fri Jan 21 20:07:02 2005 Tanaka Akira <akr@m17n.org>
+ * ext/openssl/pkey_dh.c: corrected documentation.
+ * test/openssl/utils.rb: add test key for DH.
+ * test/openssl/test_pkey_dh.rb: add tests.
- * lib/resolv.rb (Resolv::DNS::Config.resolv): don't raise ResolvError.
- reported by Sam Roberts. [ruby-talk:127133]
+Mon Jun 13 10:13:08 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Fri Jan 21 16:58:10 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/openssl/pkey_dh.c: clarify difference between DH#public_key and
+ DH#pub_key in documentation.
- * dir.c (rb_push_glob): should work for NUL delimited patterns.
+Mon Jun 13 05:50:43 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Fri Jan 21 13:58:37 2005 Shugo Maeda <shugo@ruby-lang.org>
+ * NEWS: introduce PKey.read.
- * lib/net/imap.rb (u8tou16): fixed typo. fixed: [ruby-list:40546]
- (backported from CVS HEAD)
+Mon Jun 13 05:17:29 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Fri Jan 21 09:30:16 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/openssl/ossl_pkey.c: added PKey.read module function that allows
+ reading arbitrary public/private keys from DER-/PEM-encoded File or
+ string instances.
+ * ext/openssl/ossl_pkey_dh.c: improved documentation.
+ * test/openssl/utils.rb: added EC test key.
+ * test/openssl/test_pkey_rsa.rb
+ test/openssl/test_pkey_dsa.rb: Test PKey.read. Reuse keys from
+ OpenSSL::TestUtils.
+ * test/openssl/test_pkey_ec.rb: Created test file for EC tests.
+ Test PKey.read.
+ [Ruby 1.9 - Feature #4424] [ruby-core:35330]
- * rubyio.h (rb_eof_error): should mark as NORETURN. (backported
- from CVS HEAD)
+Mon Jun 13 04:42:24 2011 Koichi Sasada <ko1@atdot.net>
-Fri Jan 21 00:31:36 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * ext/objspace/objspace.c (total_i): fix to skip no ruby objects.
- * ext/syck/rubyext.c (syck_parser_bufsize_set): avoid VC++ warning
- "local variable 'size' used without having been initialized".
+Mon Jun 13 03:07:38 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Jan 20 19:03:24 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/benchmark/test_benchmark.rb (capture_output):
+ replace '-' as space. On NetBSD, subtract between two Process.times
+ after and before the short process may return negative value like:
+ t0=Process.times; yield; t1=Process.times; p t1.utime-t0.utime
- * ext/extmk.rb (extmake): shouldn't set $extflags on mswin32.
+Mon Jun 13 02:40:23 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * win32/Makefile.sub (LIBRUBY_SO): should use $DLDOBJS instead of
- $EXTOBJS.
- fixed: [ruby-core:04290] (backported from CVS HEAD)
+ * test/openssl/test_pkey_dsa.rb: Test for DSA#syssign/sysverify.
-Thu Jan 20 11:42:02 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon Jun 13 01:59:19 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * string.c (rb_str_new4): should propagate taintedness.
+ * ext/openssl/ossl_pkey_dh.c: completed documentation.
+ * ext/openssl/ossl_pkey_dsa.c: corrected examples. Improved parameter
+ sections.
- * struct.c (rb_struct_set): use original method name, not callee
- name, to retrieve member slot. [ruby-core:04268]
+Mon Jun 13 00:25:10 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * time.c (time_strftime): protect from format modification from GC
- finalizers.
+ * ext/openssl/ossl_pkey_dsa.c: completed documentation.
-Wed Jan 19 18:06:40 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+Sun Jun 12 23:36:46 2011 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * lib/ipaddr.rb (to_s, test_to_s): too many colons with some cases.
- (backported from CVS HEAD)
+ * lib/drb/drb.rb (kill_sub_thread): remove the method. [ruby-core:34185]
-Wed Jan 19 01:16:30 2005 Tanaka Akira <akr@m17n.org>
+Sun Jun 12 21:01:56 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/resolv.rb (Resolv::DNS::Config.parse_resolv_conf): ignore
- domain and search directive without an argument.
- reported by Sam Roberts. [ruby-talk:126781]
+ * ext/date/date_core.c (d_lite_marshal_load): should give converted value.
-Tue Jan 18 15:03:05 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sun Jun 12 20:36:30 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/webrick/ssl.rb (WEBrick::Config::SSL): the default value
- of :SSLEnable is false.
+ * ext/date/date_core.c: edited doc.
- * lib/webrick/server.rb (WEBrick::Daemon.start): prepared stdio
- don't allow changing its mode.
+Sun Jun 12 18:12:07 2011 Koichi Sasada <ko1@atdot.net>
- * lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_service):
- should delete trailing LF from the result of pack("m*").
+ * benchmark/bm_vm3_clearmethodcache.rb: added.
- * lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_connect):
- - should delete trailing LF from the result of pack("m*").
- - clear Request-Line not to send the response by HTTPServer#run.
+Sun Jun 12 17:40:29 2011 Koichi Sasada <ko1@atdot.net>
- * lib/webrick/httputils (WEBrick::HTTPUtils.parse_qvalues):
- refine regexp (and change the name of a local variable).
+ * vm_method.c (rb_clear_cache*): update only vm state version.
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils#escape_path): add
- new method to escape URI path component.
+ * vm_method.c (rb_method_entry_get_without_cache, rb_method_entry):
+ Fill method cache entry with vm state version, and
+ check current vm state version for method (cache) look up.
+ This modification speed-up invalidating of global method cache table.
+ [Ruby 1.9 - Feature #3905] [ruby-core:36908]
- * lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line): should
- escape SCRIPT_NAME and PATH_INFO before being parsed as a URI.
+Sun Jun 12 16:19:48 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/webrick/*, sample/webrick/httpproxy.rb: add new file.
+ * ext/tk/extconf.rb: fail on Mac OS X. [Bug #4853][ruby-dev:43655]
-Mon Jan 17 23:33:46 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jun 12 15:56:08 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * configure.in (aix): fix typo. [ruby-talk:126401]
+ * thread.c: remove th->transition_for_lock. It's thread unsafe.
+ [Bug #4723][ruby-dev:43563]
-Mon Jan 17 07:08:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jun 12 15:47:35 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/readline/readline.c: suppress warnings.
+ * thread.c: introduce spurious wakeup safe deadlock check.
+ [Bug #4696][ruby-dev:43554]
- * lib/irb/extend-command.rb (IRB::ContextExtender.def_extend_command):
- ditto.
+Sun Jun 12 13:33:52 2011 Koichi Sasada <ko1@atdot.net>
- * lib/irb/ext/history.rb (IRB::Context::set_last_value): ditto.
+ * benchmark/bm_vm3_thread_mutex.rb: remove it.
- * lib/irb/ext/history.rb (IRB::Context::eval_history): ditto.
+ * benchmark/bm_vm3_thread_mutex[1-3].rb: added 3 benchmarks.
+ 1: one thread with one mutex (no contention).
+ 2: two threads with one mutex (contention).
+ 3: 1000 threads with one mutex (huge number of contention)
+ Above removed benchmark was type 3.
+ Therefore, this commit adds type 1 and 2 benchmark.
- * lib/irb/locale.rb (IRB::Locale::real_load): ditto.
+Sun Jun 12 11:16:59 2011 Tanaka Akira <akr@fsij.org>
- * lib/irb/slex.rb (SLex::Node::create_subnode): remove garbage.
+ * io.c: use select() appropriately for sendfile().
+ Fixed by Eric Wong. [ruby-core:36150]
+ (maygvl_copy_stream_wait_readwrite): removed.
+ (nogvl_copy_stream_sendfile): use nogvl_copy_stream_wait_write and
+ maygvl_copy_stream_wait_read instead of
+ maygvl_copy_stream_wait_readwrite.
-Mon Jan 17 00:09:42 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+Sun Jun 12 09:32:13 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/uri/common.rb (PORT): typo fix. fixed: [ruby-core:04256]
+ * atomic.h (ATOMIC_OR): _InterlockedOr is not available on mingw.h
+ * gc.c (rb_gc_set_params): VM_OBJSPACE is disabled on mingw.
-Sat Jan 15 14:57:22 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jun 12 01:07:09 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ruby.c (proc_options): ignore trailing CRs at the end of short
- options as well as long options. fixed: [ruby-core:04232]
+ * ext/date/date_core.c: edited doc.
-Sat Jan 15 13:35:16 2005 Kouhei Sutou <kou@cozmixng.org>
+Sat Jun 11 23:18:00 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/rss/rss.rb (RSS::VERSION): 0.1.2 -> 0.1.3.
+ * vm_core.h (RUBY_VM_SET_TIMER_INTERRUPT, RUBY_VM_SET_INTERRUPT,
+ RUBY_VM_SET_FINALIZER_INTERRUPT): use atomic ops for preventing
+ interrupt_flag bit lost. [Bug #4770][ruby-dev:43467]
+ * thread.c (rb_threadptr_execute_interrupts_rec): ditto.
+ * vm_core.h (typedef struct rb_thread_struct): change type of
+ interrupt_flag to rb_atomic_t.
+ * atomic.h: move atomic ops definition from signal.c.
+ * signal.c: remove atomic ops definition.
+ * common.mk (gc, signal, thread, cont): add to dependency to atomic.h.
- * lib/rss/rss.rb: accept inheritance. [ruby-talk:126104]
+Sat Jun 11 23:23:52 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Thu Jan 13 04:48:53 2005 Tanaka Akira <akr@m17n.org>
+ * ext/date/date_core.c: edited doc.
- * io.c (io_fread): don't warn nonblocking behavior by default.
+Sat Jun 11 23:02:36 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Wed Jan 12 00:36:29 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/lib/openssl/buffering.rb (module OpenSSL):
+ Buffering#each_byte should return String in accordance with IO in
+ 1.9.
- * object.c (rb_class_superclass): superclass of singleton class also
- should be a singleton class. fixed: [ruby-list:40519]
+ * test/openssl/test_buffering.rb (class OpenSSL): add tests for getc
+ and each_byte.
-Tue Jan 11 09:44:40 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Sat Jun 11 22:41:37 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * numeric.c (Init_Numeric): turn off floating point exceptions
- on bcc32. "1e300".to_f had crashed by overflow.
+ * time.c: a correction of doc for strftime (%v).
-Tue Jan 11 03:10:10 2005 Minero Aoki <aamine@loveruby.net>
+Sat Jun 11 22:30:53 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/fileutils.rb (copy_entry): could not copy symbolic link.
- [ruby-talk:125733]
+ * ext/date/date_core.c: replaced doc for strftime based on Time's one.
- * lib/fileutils.rb (copy_stream): use read/write instead of
- sysread/syswrite.
+Sat Jun 11 22:07:56 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Mon Jan 10 23:08:15 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/date/date_core.c (datetime_s_{iso8601,rfc3339,xmlschema,rfc2822,httpdate}):
+ do not take argument comp.
- * variable.c (rb_autoload): hide internal data from ruby level.
- fixed: [ruby-dev:25435], [ruby-list:40498]
+Sat Jun 11 21:58:31 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Mon Jan 10 01:22:55 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/date/date_core.c: added examples.
- * gc.c (rb_data_object_alloc): klass may be NULL.
- [ruby-list:40498]
+Sat Jun 11 19:40:45 2011 Narihiro Nakamura <authornari@gmail.com>
-Sun Jan 9 03:12:58 2005 Tanaka Akira <akr@m17n.org>
+ * gc.c: expand heap if initial_heap_min_slots is bigger than
+ HEAP_MIN_SLOTS.
- * io.c (io_fread): warn nonblocking behavior.
- (io_readpartial): new method IO#readpartial.
+Sat Jun 11 19:42:50 2011 WATANABE Hirofumi <eban@ruby-lang.org>
-Sat Jan 8 04:38:47 2005 why the lucky stiff <why@ruby-lang.org>
+ * ChangeLog (vim): set shiftwidth to 2.
- * lib/yaml.rb: Kernel#y requires an argument.
+Sat Jun 11 19:27:06 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Fri Jan 7 21:12:29 2005 TAMURA Takashi <sheepman@tcn.zaq.ne.jp>
+ * ext/openssl/ossl_x509req.c: raise RequestError instead of
+ CertificateError when Request#to_der gets an error from OpenSSL.
+ Patch from Ippei Obayashi, see #4420. I cannot write a test for
+ this... Request does not allow to create broken bytes...
- * random.c (rand_init): use ALLOC_N instead of ALLOCA_N
- [ruby-dev:25426]
+Sat Jun 11 19:34:51 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Fri Jan 7 18:03:35 2005 Tanaka Akira <akr@m17n.org>
+ * ext/date/date_core.c (Date::(ABBR_)?(MONTH|DAY)NAMES): should be usascii.
- * gc.c (mark_locations_array): avoid core dump with -O3.
- [ruby-dev:25424]
+Sat Jun 11 19:24:33 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Thu Jan 6 20:31:07 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/date/date_core.c: rewrote doc.
- * ext/zlib/zlib.c (zstream_end): should return value. (backported
- from CVS HEAD)
+Sat Jun 11 19:04:15 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Jan 6 19:55:13 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * lib/test/unit.rb (Test::Unit::GlobOption#non_options): should run
+ with 1.8.
- * win32/win32.c (rb_w32_close): didn't close socket handle.
- [ruby-dev:25414]
+Sat Jun 11 18:05:57 2011 WATANABE Hirofumi <eban@ruby-lang.org>
- * win32/win32.c (rb_w32_open_osfhandle): bcc32's _open_osfhandle
- never set EMFILE.
+ * bootstraptest/runner.rb: should initialize $stress to avoid warnings.
-Thu Jan 6 17:14:31 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Sat Jun 11 18:02:09 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * random.c (random_seed): O_NONBLOCK isn't defined on some
- platforms. [ruby-dev:25417]
+ * io.c (io_getc): should be 7bit if ascii. fixes #4557
-Thu Jan 6 13:45:35 2005 Tanaka Akira <akr@m17n.org>
+Sat Jun 11 16:52:16 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/time.rb: recognize +00:00 and GMT as a localtime.
+ * numeric.c (rb_enc_uint_chr): fix message format. Bug#4869
-Thu Jan 6 07:58:28 2005 Dave Thomas <dave@pragprog.com>
+Sat Jun 11 16:28:25 2011 Kouhei Sutou <kou@cozmixng.org>
- * lib/rdoc/usage.rb (RDoc::RDoc.usage_no_exit): Allow for colons
- in path names on DOS machines. (thanks to Johan Nilsson)
+ * lib/rexml/formatters/pretty.rb
+ (REXML::Formatters::Pretty#write_text),
+ test/rexml/test_core.rb
+ (Tester#test_pretty_format_long_text_finite): don't ignore
+ 'width' parameter in pretty formatter. fixes #4498
+ Reported by Michael Frasca. Thanks!!!
-Wed Jan 5 20:16:32 2005 Tanaka Akira <akr@m17n.org>
+Sat Jun 11 16:11:36 2011 Kouhei Sutou <kou@cozmixng.org>
- * random.c (limited_big_rand): didn't work if SIZEOF_BDIGITS == 2.
- [ruby-dev:25408]
+ * test/rexml/test_core.rb
+ (Tester#test_pretty_format_long_text_finite): remove needless
+ assert_nothing_raised.
- * random.c (random_seed): refined.
+Sat Jun 11 16:04:03 2011 Kouhei Sutou <kou@cozmixng.org>
-Wed Jan 5 12:49:39 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rexml/parsers/xpathparser.rb
+ (REXML::Parsers::XPathParser#parse),
+ test/rexml/test_elements.rb
+ (ElementsTester#test_each_with_frozen_condition):
+ don't modify original XPath. fixes #4161
+ Reported by Pavel Shved. Thanks!!!
- * eval.c (rb_thread_initialize): Thread objects cannot be initialized
- again. fixed: [ruby-core:04067]
+Sat Jun 11 15:53:27 2011 Kouhei Sutou <kou@cozmixng.org>
-Wed Jan 5 10:48:16 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/rexml/test_elements.rb (ElementsTester): remove needless
+ prefix from test name.
- * dir.c (dir_s_mkdir): win32 special processing doesn't need any
- longer. (backported from CVS HEAD)
+Sat Jun 11 15:36:36 2011 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * common.mk: fixed a grammatical error
- * win32/win32.[ch] (rb_w32_mkdir): new function. POSIX.1 compatible
- interface. (backported from CVS HEAD)
+Sat Jun 11 14:20:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * win32/win32.[ch] (rb_w32_rmdir): new function. (backported from CVS
- HEAD)
+ * vm.c (thread_memsize): don't ignore size of th->local_storage.
-Wed Jan 5 02:30:11 2005 Tanaka Akira <akr@m17n.org>
+Sat Jun 11 10:32:46 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * random.c (init_by_array): imported from mt19937ar-cok.tgz.
- (genrand_int32): ditto.
- (genrand_real): replaced with genrand_res53 in mt19937ar-cok.
- (rand_init): support bignum for longer seed.
- (random_seed): generate longer seed.
- (make_mask): new function.
- (limited_rand): ditto.
- (limited_big_rand): ditto.
- (rb_f_rand): call limited_rand and limited_big_rand.
- [ruby-dev:25403]
+ * lib/mkmf.rb: should quote arch_hdrdir and libpath for the case
+ installed prefix contains spaces.
-Tue Jan 4 23:25:29 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat Jun 11 10:20:52 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * bignum.c (rb_big_rand): should return positive random number.
- [ruby-dev:25401]
+ * thread_pthread.c (native_cond_timeout): wrap conditionally used
+ label.
-Tue Jan 4 11:15:29 2005 TAMURA Takashi <sheepman@tcn.zaq.ne.jp>
+ * thread_pthread.c (native_sleep): remove unused variable.
- * bignum.c (rb_big_rand): do not use rb_big_modulo to generate
- random bignums. [ruby-dev:25396]
+Sat Jun 11 10:15:50 2011 Tanaka Akira <akr@fsij.org>
-Mon Jan 3 14:01:54 2005 Tanaka Akira <akr@m17n.org>
+ * thread.c (rb_thread_execute_interrupts): use GetThreadPtr to extract
+ rb_thread_t from VALUE.
+ reported by Motohiro KOSAKI. [ruby-dev:43700]
- * random.c (random_seed): don't use /dev/urandom if it is not
- character device.
+Sat Jun 11 10:00:49 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Jan 3 11:37:42 2005 Tanaka Akira <akr@m17n.org>
+ * ruby.c (ruby_process_options): add missing return type.
- * random.c (random_seed): use /dev/urandom if available.
- [ruby-dev:25392]
+Fri Jun 10 23:18:09 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Jan 3 07:46:42 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/tk/tcltklib.c (lib_eventloop_core): replace CHECK_INTS with
+ rb_thread_check_ints(). Because current code can't be compiled.
- * lib/webrick/httpauth/htpasswd.rb (WEBrick::Htpasswd#reload):
- raise NotImplementedError if password is encrypted by digest
- algorithms. This patch is contributed by sheepman. [ruby-list:40467]
+Fri Jun 10 16:38:13 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/webrick/httpauth/digestauth.rb
- (WEBrick::HTTPAuth::DigestAuth#_authenticate): fix digest calculation.
- This patch is contributed by sheepman. [ruby-list:40482]
+ * encoding.c (rb_locale_charmap): When ruby process is run as Windows
+ Service the console codepage is not set, GetConsoleCP returns 0.
+ So on such environment, use GetACP().
+ http://blogs.msdn.com/b/michkap/archive/2005/02/08/369197.aspx
+ patched by Rafal Bigaj [ruby-core:36832] [Bug #4854]
- * lib/webrick/{httpauth.rb,httpauth/basicauth.rb,httpproxy.rb}: use
- pack/unpack-template char "m" instead of lib/base64.rb to do base64
- encoding/decoding. fixed: [ruby-dev:25336]
+Fri Jun 10 14:34:24 2011 Koichi Sasada <ko1@atdot.net>
- * test/webrick/test_httpauth.rb: new file.
+ * common.mk: restore TESTRUN_SCRIPT to "$(srcdir)/test.rb".
+ TESTRUN_SCRIPT is used by "make run", "make gdb" and so on.
-Sat Jan 1 04:20:23 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Fri Jun 10 13:01:24 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_ns_spki.c (ossl_spki_set_challenge): should call
- StringValue before GetSPKI. fixed: [ruby-dev:25359].
+ * test/ruby/test_module.rb (TestModule#remove_rake_mixins): remove all
+ module related to Rake.
-Sat Jan 1 01:13:28 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Jun 10 09:52:38 2011 Eric Hodel <drbrain@segment7.net>
- * variable.c (rb_autoload): [ruby-dev:25373]
+ * encoding.c: Mention that Encoding.compatible? can work with more
+ than just Strings.
-Fri Dec 31 14:10:43 2004 Dave Thomas <dave@pragprog.com>
+Fri Jun 10 02:25:53 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item): Fix problem
- if heading contains formatting.
+ * ext/psych/lib/psych.rb: updating version to match released gem.
-Thu Dec 30 00:41:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Jun 10 01:06:29 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * eval.c (svalue_to_avalue): [ruby-dev:25366]
+ * ext/bigdecimal (BigDecimal_to_i): Integer#** may return flonum.
- * string.c (rb_str_justify): [ruby-dev:25367]
+Fri Jun 10 00:35:12 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Wed Dec 29 11:07:07 2004 Dave Thomas <dave@pragprog.com>
+ * complex.c (string_to_c_internal): uses rb_reg_nth_match;
+ * rational.c (string_to_r_internal): ditto.
- * lib/rdoc/generators/template/html/kilmer.rb: Update to use new
- sections.
+Fri Jun 10 00:25:03 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Tue Dec 28 22:31:46 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * gc.c: remove an unused declaration.
- * string.c (rb_str_justify): create buffer string after argument type
- conversion. fixed: [ruby-dev:25341]
+Fri Jun 10 00:24:04 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Tue Dec 28 15:41:48 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * rational.c (string_to_r): Rational#** may return flonum.
- * ext/nkf/nkf-utf8/nkf.c (reinit): should initialize all static
- variables. fixed: [ruby-list:40445]
+Thu Jun 9 23:57:53 2011 Tanaka Akira <akr@fsij.org>
-Tue Dec 28 15:25:20 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c: fix IO.copy_stream interrupt handling.
+ based on the patch by Eric Wong. [ruby-core:36156]
- * ext/nkf/lib/kconv.rb (Kconv::RegexpEucjp): second byte is up to
- 0xfe.
+ * vm_core.h (rb_thread_call_with_gvl): don't declare here.
- * ext/nkf/lib/kconv.rb (Kconv#kconv): should handle UTF8 and UTF16
- properly.
+ * thread.c: include internal.h.
+ (rb_thread_execute_interrupts): new function.
-Tue Dec 28 13:35:20 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * internal.h (rb_thread_execute_interrupts): declared.
+ (rb_thread_call_with_gvl): declared.
- * ext/zlib/zlib.c (rb_deflate_s_deflate, rb_inflate_s_inflate): ensure
- freeing internal zstreams. fixed: [ruby-dev:25309]
+Thu Jun 9 23:34:01 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * ext/zlib/zlib.c (rb_deflate_init_copy): replace rb_deflate_clone.
+ * gc.c (rb_objspace_call_finalizer): use rb_typeddata_is_kind_of() for
+ type check to get rid of a double free when main Thread has singleton
+ class. [ruby-core:36741] [Bug #4828]
+ * thread.c (rb_obj_is_mutex): add a new utility function.
+ * vm.c (rb_obj_is_thread): ditto.
-Tue Dec 28 12:26:45 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Jun 9 22:53:49 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * win32/Makefile.sub, win32/setup.mak (RDOCTARGET, install,
- install-nodoc, install-doc): rdoc support for mswin32.
+ * test/ruby/test_thread.rb (TestThread#test_kill_thread_subclass):
+ add test for Thread.kill with Thread subclass instance.
- * win32/configure.bat (--enable-install-doc, --disable-install-doc):
- ditto.
+Thu Jun 9 22:31:47 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Mon Dec 27 20:02:14 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/ruby/test_thread.rb (TestThread#test_kill_wrong_argument):
+ test for [ruby-core:35086].
+ partially forward porting r31402 from ruby_1_9_2 branch.
- * ext/tcltklib/tcltklib.c: fix SEGV bug when deleting Tk interp
+Thu Jun 9 18:36:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * ext/tk/lib/multi-tk.rb: ditto
+ * string.c: Fix the ambiguous description of the behavior of
+ rb_str_aref_m with a range. It returns nil when the beginning of
+ the range is greater than the end of the string rather than the range.
-Mon Dec 27 16:55:17 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Thu Jun 9 10:57:03 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/openssl/ossl_x509name.c (Init_ossl_x509name): should use
- rb_hash_new to get exactly a Hash. fix [ruby-dev:25325].
+ * ext/psych/lib/psych/visitors/to_ruby.rb: Hash subclasses can be read
+ from YAML files.
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: Hash subclasses can be
+ dumped to YAML files.
+ * test/psych/test_hash.rb: corresponding test.
-Mon Dec 27 16:29:56 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Jun 9 09:18:51 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * string.c (rb_str_justify): [ruby-dev:25341]
+ * ext/psych/lib/psych/visitors/to_ruby.rb: Ruby modules can be loaded
+ from YAML files.
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: Ruby modules can be
+ dumped to YAML files.
+ * test/psych/test_class.rb: corresponding test.
-Mon Dec 27 15:47:48 2004 Minero Aoki <aamine@loveruby.net>
+Thu Jun 9 09:05:04 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * test/fileutils/fileasserts.rb: sync with HEAD.
+ * ext/psych/lib/psych/visitors/to_ruby.rb: Ruby classes can be loaded
+ from YAML files.
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: Ruby classes can be
+ dumped to YAML files.
+ * test/psych/test_class.rb: corresponding test.
- * test/fileutils/test_fileutils.rb: ditto.
+Wed Jun 8 21:38:57 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * test/fileutils/test_nowrite.rb: ditto.
+ * cont.c (root_fiber_alloc): set root fiber's status RUNNING.
+ in cont_mark() only RUNNING fiber's machine stack is marked.
+ root fiber's status should be RUNNING at the beginning regardless of
+ FIBER_USE_NATIVE. [ruby-core:36735] fixes #4827
-Mon Dec 27 15:21:07 2004 Minero Aoki <aamine@loveruby.net>
+Tue Jun 7 20:50:11 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/fileutils.rb (mv): should raise error when moving a
- directory to the (empty) directory. [ruby-talk:124368]
- (backport from HEAD 1.48)
+ * doc/irb/irb.rd: fix typo. patch by Nobuhiro IMAI.
+ [Bug #4843] [ruby-dev:43639]
+ * doc/irb/irb.rd.ja: ditto.
+ * doc/ChangeLog-YARV: ditto.
- * lib/fileutils.rb (mv): wrongly did not overwrite file on Win32
- platforms. (backport from HEAD 1.48)
+Tue Jun 7 18:52:55 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Dec 25 11:11:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/rubygems/user_interaction.rb (Gem::StreamUI#tty?): IO#tty? of
+ Windows has been fixed at r29969.
- * stable version 1.8.2 released.
+ * test/rubygems/test_gem_stream_ui.rb: now can run tests.
-Sat Dec 25 04:23:49 2004 Minero Aoki <aamine@loveruby.net>
+Tue Jun 7 18:36:41 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/fileutils.rb (mkdir, mkdir_p): should ensure directory
- permission. (backportted from HEAD, 1.47)
+ * test/rubygems/test_gem.rb (TestGem#{test_self_user_home_userprofile,
+ test_self_user_home_user_drive_and_path}): should simply ignore
+ meaningless tests instead of skipping them.
- * lib/fileutils.rb (traverse, remove_dir): untaint trasted
- objects. (backportted from HEAD, 1.46)
+Tue Jun 7 18:15:00 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Dec 25 01:28:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
+ should show some messages when skipping tests.
- * io.c: cancel io_reopen() change on Dec. 24th.
+Tue Jun 7 13:59:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * dln.c: use <dlfcn.h> for NetBSD. [ruby-dev:25313]
+ * ext/date/date_core.c (date_s_today, datetime_s_now): check the
+ result of localtime_r().
- * io.c (rb_f_select): IO list could be altered. [ruby-dev:25312]
+Tue Jun 7 13:36:51 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Dec 24 23:51:48 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * ext/tk/extconf.rb: use $defs not $CPPFLAGS to get rid of
+ command line escape issues on Windows. fixed #4835.
- * bcc32/Makefile.sub: bcc32 should use RTL dll (backport from HEAD)
- [ruby-dev:25306]
+Tue Jun 7 03:18:45 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * win32/win32.[ch]: ditto.
+ * test/ruby/test_io.rb (TestIO#test_s_{,bin}write): do not create a
+ file under /tmp. [Bug #4846]
-Fri Dec 24 23:27:18 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Mon Jun 6 22:51:43 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * ext/tk/lib/tk/image.rb: TkPhotoImage#cget bug fix
+ * cont.c: use #if FIBER_USE_NATIVE instead of #ifdef.
+ you can suppress use of setcontext for Fiber with compile option
+ -DFIBER_USE_NATIVE=0
-Fri Dec 24 18:39:25 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Mon Jun 6 21:59:23 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * win32/win32.[ch]: failed to compile on bcc32 (and probably wince)
- [ruby-dev:25306]
+ * test/date/test_switch_hitter.rb: added a test.
-Fri Dec 24 02:52:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jun 6 21:37:45 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * io.c (io_reopen, rb_io_reopen): prohibit to change access mode for
- special IO ports. [ruby-dev:25225]
+ * ext/date/date_core.c: added notes.
-Fri Dec 24 02:22:53 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jun 6 21:02:12 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/syck/rubyext.c (rb_syck_io_str_read): [ruby-core:03973]
+ * ext/date/date_core.c: flattened format to strftimev.
+ * ext/date/date_core.c (date_strftime_internal): taints run.
- * ext/syck/rubyext.c (syck_loader_transfer): check type conversion.
+Mon Jun 6 15:10:17 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/syck/rubyext.c (syck_parser_assign_io, rb_new_syck_node): duck
- typing.
+ * include/ruby/{defines,missing}.h (rb_infinity, rb_nan): move from
+ defines.h to missing.h. (couldn't use RUBY_EXTERN there.)
- * ext/syck/rubyext.c (syck_parser_s_alloc, syck_parser_initialize):
- allocation framework.
+Mon Jun 6 14:35:48 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/syck/rubyext.c (syck_emitter_s_alloc, syck_emitter_initialize):
- ditto.
+ * test/rdoc/test_rdoc_markup_pre_process.rb (TestRDocMarkupPreProcess#
+ {test_include_file,test_include_file_encoding_incompatible}): no
+ need to write such workaround. don't hide the bug of ruby. (and the
+ bug is already fixed.)
-Fri Dec 24 01:21:00 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Mon Jun 6 14:11:11 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tk/lib/tkextlib/blt.rb: add BLT extension support
+ * ext/date/date_core.c (valid_jd_sub): need to convert from VALUE to
+ double.
- * ext/tk/lib/tkextlib/blt/*.rb: ditto
+ * ext/date/date_core.c (offset_to_sec): get rid of a compiler warning.
- * ext/tk/lib/tkextlib/blt/tile/*.rb: ditto
+Mon Jun 6 14:09:08 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Dec 23 23:36:28 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * include/ruby/defines.h (rb_infinity, rb_nan): export for Windows.
- * process.c (proc_setgroups): check if the argument lenght is
- modified. fixed: [ruby-dev:25285]
+Mon Jun 6 10:54:45 2011 Shota Fukumori <sorah@tubusu.net>
-Thu Dec 23 13:13:33 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/test/unit.rb(Test::Unit::Runner#puke):
+ Add overriding from MiniTest::Unit#puke. This reverts minitest's fix
+ that skip messages are hidden when not verbose mode (-v option).
+ To hide skip messages, use --hide-skip option instead.
- * ext/tcltklib/tcltklib.c: define TclTkLib::COMPILE_INFO and
- RELEASE_DATE
+Mon Jun 6 10:52:13 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tcltklib/extconf.rb: ditto
+ * lib/net/http.rb: don't use autoload.
- * ext/tk/tkutil.c: define TkUtil::RELEASE_DATE
+Mon Jun 6 09:39:43 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/tk/lib/tk.rb: define Tk::RELEASE_DATE
+ * ext/psych/parser.c (parse): release event objects to plug memory
+ leak. Thanks Mark J. Titorenko!
-Thu Dec 23 09:38:31 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jun 5 23:26:15 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * io.c (io_reopen): restore exact mode. fixed: [ruby-core:04003]
+ * eval.c: remove rb_thread_stop_timer_thread function declaration.
+ Instead, include vm_core.h.
+ * process.c: ditto.
-Thu Dec 23 00:16:32 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jun 5 21:38:51 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * configure.in (bsdi): use $(CC) for LDSHARED. fixed [ruby-dev:25270]
+ * thread_pthread.c (thread_timer): add to care a spurious wakeup.
+ When native_cond_timedwait() return 0 by spurious wakeup, we
+ don't have to neither 1) call timer_thread_function and 2)
+ exit the timer thread.
-Wed Dec 22 11:14:55 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jun 5 17:50:01 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * io.c (rb_io_mode_modenum): replace O_ACCMODE with O_RDWR.
- fixed: [ruby-dev:25273]
+ * ext/date/date_core.c (m_real_cwyear): new. derived from m_cwyear.
+ * ext/date/date_strftime.c: trivial changes.
-Wed Dec 22 08:34:32 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jun 5 17:22:01 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/dl/sym.c (rb_dlsym_initialize): extract internal pointers after
- all argument conversion. fixed: [ruby-dev:25271]
+ * ext/tk/config_list.in: add new options for tcltklib.
-Wed Dec 22 00:08:01 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Sun Jun 5 10:06:50 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/soap/*, test/soap/*, sample/soap/authheader/*: eval cleanup.
+ * ext/date/date_tmx.h: now does not place decoded data. allows to
+ access indirectly via functions on demand.
+ * ext/date/date_strftime.c: ditto.
+ * ext/date/date_core.c: ditto.
+ * ext/date/date_core.c ({d|dt}_lite_to_s): use strftime.
-Tue Dec 21 22:07:33 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sun Jun 5 06:22:02 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
- ossl_asn1_decode_all): temporary value should be marked volatile.
+ * NEWS: wrote about changes of date.
-Tue Dec 21 14:40:02 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sat Jun 4 16:59:26 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
- ossl_asn1_decode_all): use rb_str_new4 to avoid SEGV.
- fix [ruby-dev:25261]
+ * ext/date/date_core.c (d_lite_inspect): changed the format.
+ * ext/date/date_core.c: refactoring and fixing some bugs.
- * test/openssl/test_asn1.rb: add tests for OpenSSL::ASN1.
+Sat Jun 4 04:04:41 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Dec 21 12:22:40 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/rubygems/test_gem_commands_which_command.rb:
+ "missing" exists on ruby's top source directory. [Bug #4815]
- * io.c (io_reopen): keep duplex pipe in correct mode for exception
- safeness. fixed: [ruby-dev:25152]
+Fri Jun 3 21:48:12 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Dec 21 12:10:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/rubygems/test_case.rb: Refix for test-all in separate directory.
+ r31147 + r31151.
- * ext/tk/lib/tk/grid.rb: rescue bug of 'grid configure' on Tcl/Tk8.3-
+Fri Jun 3 20:58:47 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Dec 21 00:53:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/date/date_core.c (d_lite_plus): get rid of compiler warnings.
- * ext/openssl/ossl_asn1.c (ossl_asn1_traverse): [ruby-dev:25261]
+Fri Jun 3 20:56:40 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/openssl/ossl_asn1.c (ossl_asn1_decode): ditto.
+ * include/ruby/missing.h, numeric.c (round): moved prototype of round()
+ from numeric.c to missing.h. (note: round() is C99 feature, so ruby
+ provides it if not exist in C runtime.)
- * ext/openssl/ossl_asn1.c (ossl_asn1_decode_all): ditto.
+Fri Jun 3 20:42:04 2011 Shota Fukumori <sorah@tubusu.net>
-Mon Dec 20 23:22:26 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * lib/test/unit/parallel.rb: Keep $stdin, $stdout before run testcase
+ and restore after run. Because some test break $stdin, $stdout.
+ Fixes [Bug #4433] [ruby-core:35353]
- * added files:
- * lib/soap/mapping/wsdl*.rb
- * lib/wsdl/soap/element.rb
- * lib/wsdl/xmlSchema/simpleContent.rb
+Fri Jun 3 19:58:14 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * modified files:
- * lib/soap/*
- * lib/wsdl/*
- * lib/xsd/*
- * test/soap/*
- * test/wsdl/*
- * test/xsd/*
- * sample/soap/*
- * sample/sdl/*
+ * io.c (io_fflush): windows -- call fsync() only when the FD is tied to
+ file, because if the FD is pipe, it blocks.
- * summary
- * imported from the soap4r repository. Version: 1.5.3-ruby1.8.2
+Fri Jun 3 09:27:31 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * added several XSD basetype support: nonPositiveInteger,
- negativeInteger, nonNegativeInteger, unsignedLong, unsignedInt,
- unsignedShort, unsignedByte, positiveInteger
+ * lib/net/http.rb (URI::HTTP#request_uri): return nil when the uri
+ is path-rootless form. Bug #4759
- * HTTP client connection/send/receive timeout support.
+Thu Jun 2 23:51:03 2011 James Edward Gray II <jeg2@ruby-lang.org>
- * HTTP client/server gzipped content encoding support.
+ * lib/csv.rb: Improve the line ending detection algorithm
+ patch by Alexey).
- * improved WSDL schema definition support; still is far from
- complete, but is making step by step improovement.
+Thu Jun 2 20:05:57 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Dec 20 22:56:39 2004 Tanaka Akira <akr@m17n.org>
+ * io.c (rb_io_s_write, rb_io_s_binwrite): return!!!
- * gc.c (stack_end_address): gcc noinline attribute is available since
- gcc-3.1.
+Thu Jun 2 16:29:34 2011 Shota Fukumori <sorah@tubusu.net>
-Mon Dec 20 14:07:02 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * io.c: Add File.write, File.binwrite. [Feature #1081] [ruby-core:21701]
- * ext/tk/lib/multi-tk.rb: supports new features of Tcl/Tk8.5a2
+ * test/ruby/test_io.rb: Test for File.write, File.binwrite.
- * ext/tk/lib/tk/clock.rb: ditto
+ * NEWS: News for above.
- * ext/tk/lib/tk/text.rb: ditto
+Thu Jun 2 12:33:09 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tk/lib/tk/panedwindow.rb: ditto
+ * io.c (io_fflush, rb_io_flush): need to fsync() when ruby calls
+ internal flush. [ruby-core:36670] [Bug #4813]
-Mon Dec 20 12:47:13 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Thu Jun 2 07:56:24 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/openssl/lib/net/https.rb,protocols.rb,telnets.rb: delete
- doc and code about SSLContext#{key_file,cert_file}.
- fixed: [ruby-dev:25243]
+ * ext/tk/tcltklib.c: reduce CPU power required by an eventloop.
-Mon Dec 20 12:42:17 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue May 31 21:28:33 2011 Tanaka Akira <akr@fsij.org>
- * io.c (io_fwrite): workaround for MSVCRT's bug.
- fixed: [ruby-core:03982]
+ * test/ruby/test_signal.rb (TestSignal#test_signal_requiring):
+ redirect stderr to null device.
-Mon Dec 20 11:21:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Jun 2 00:45:26 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * io.c (rb_io_eof): check if closed before clearerr().
- fixed: [ruby-dev:25251]
+ * ext/tk/extconf.rb: fix for uninitialized global variables.
+ [Ruby 1.9 - Bug #4811]
-Mon Dec 20 03:30:40 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jun 1 21:57:08 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/cgi/session.rb (CGI::Session#initialize): empty session id was
- used if request had no session key. fixed: [ruby-core:03981]
+ * thread_pthread.c (native_sleep): fix 1000times calculation error.
+ this is a regression since r31457. [Bug #4808] [ruby-dev:43606]
-Mon Dec 20 01:51:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Jun 1 17:19:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * struct.c (make_struct): [ruby-dev:25249]
+ * thread_pthread.c: remove unused macro.
-Mon Dec 20 00:28:20 2004 Kouhei Sutou <kou@cozmixng.org>
+Wed Jun 1 15:42:18 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rexml/encodings/SHIFT-JIS.rb: backported from CVS HEAD.
+ * parse.y (peek_n): new macro to see next nth char.
- * lib/rexml/encodings/SHIFT_JIS.rb: ditto.
+Wed Jun 1 15:40:46 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Dec 19 17:19:48 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * tool/rbinstall.rb (gem): fix for rubygems change.
- * ext/openssl/ossl_x509store.c
- (ossl_x509store_set_time): add OpenSSL::X509::Store#time=.
- (ossl_x509stctx_set_time): add OpenSSL::X509::StoreContext#time=.
+Wed Jun 1 14:07:57 2011 Ryan Davis <ryand-ruby@zenspider.com>
- * test/openssl/ossl_x509store.rb: test certificate validity times.
+ * lib/minitest/*: Imported minitest 2.2.2 (r6281)
+ * test/minitest/*: ditto
- * ext/openssl/ossl_x509name.c (ossl_x509name_to_s): add optional
- second argument to specify the output format (see also
- X509_NAME_print_ex).
+Wed Jun 1 12:35:50 2011 Ryan Davis <ryand-ruby@zenspider.com>
- * ext/openssl/ossl_x509name.c (ossl_x509name_init): new constants:
- OpenSSL::X509::Name::COMPAT, OpenSSL::X509::Name::RFC2253,
- OpenSSL::X509::ONELINE, OpenSSL::X509::MULTILINE.
+ * lib/rubygems*: Import rubygems 1.8.5 (released @ 137c80f)
+ * test/rubygems: Ditto
- * ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name::RFC2253DN):
- new module to provide the parse for RFC2253 DN format.
+Wed Jun 1 12:34:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name.parse_rfc2253):
- new method to parse RFC2253 DN format.
+ * NEWS: add new features of bigdecimal.
- * test/openssl/ossl_x509name.rb: add tests about RFC2253 DN.
+Wed Jun 1 09:41:14 2011 Eric Hodel <drbrain@segment7.net>
- * text/openssl/ssl_server.rb: try to listen ports from 20443 to 20542
- while EADDRINUSE is raised.
+ * lib/cgi/util.rb: Improve documentation. Patch by Kuba Fietkiewicz.
+ [Ruby 1.9 - Bug #4775]
+ * lib/cgi/core.rb: ditto
- * all changes in this entry are backport from 1.9.
+Wed Jun 1 09:26:05 2011 Eric Hodel <drbrain@segment7.net>
-Sun Dec 19 17:24:59 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mathn.rb: Improve documentation and attach it to Numeric.
+ Modified from patch by Anil V. [Ruby 1.9 - Bug #4762]
- * configure.in (enable_rpath): use rpath flag to embed the library
- path into extensions on ELF environment. [ruby-dev:25035]
+Wed Jun 1 09:21:30 2011 Eric Hodel <drbrain@segment7.net>
-Sun Dec 19 11:01:25 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/prime.rb: Indent examples enough to appear as code sections.
+ Note that Prime is Enumerable. [#4762]
- * lib/test/unit.rb: use standalone runner for -e.
+Wed Jun 1 07:34:57 2011 Eric Hodel <drbrain@segment7.net>
- * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner#options): accept
- multiple -p and -x options.
+ * hash.c (key_i): Change rdoc from "the first occurrence" to "an
+ occurrence" since first occurrence is not a specification of
+ Hash#key. [Ruby 1.9 - Bug #4760]
- * lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#recursive_collect):
- ditto.
+Wed Jun 1 07:26:19 2011 Eric Hodel <drbrain@segment7.net>
-Sat Dec 18 16:36:23 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/pty/pty.c (pty_check): Restore "not reached" comment.
+ [Ruby 1.9 - Bug #4756]
- * ext/zlib/zlib.c (rb_deflate_s_deflate, rb_inflate_s_inflate):
- disallow interrupt by type conversion. fixed: [ruby-dev:25226]
+Wed Jun 1 07:21:40 2011 Eric Hodel <drbrain@segment7.net>
-Sat Dec 18 15:16:41 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/zlib/zlib.c: Fix document-method declarations for set_sync and
+ set_comment. [Ruby 1.9 - Bug #4695]
- * lib/webrick/httpauth.rb,
- lib/webrick/httpauth/{basicauth.rb,digestauth.rb}: use
- pack/unpack-template char "m" instead of lib/base64.rb to do base64
- encoding/decoding.
+Wed Jun 1 06:43:13 2011 Masaya Tarui <tarui@ruby-lang.org>
-Sat Dec 18 10:51:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * load.c (loaded_feature_path): cut nonsense loop execution to fix
+ performance bug.
- * dir.c (dir_open_dir): new function. [ruby-dev:25242]
+Wed Jun 1 01:16:02 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Dec 17 18:07:01 2004 Shugo Maeda <shugo@ruby-lang.org>
+ * class.c (rb_mix_module): implement Module#mix.
- * test/readline/test_readline.rb: fix for BSD. Thanks, GOTOU Yuuzou.
- fixed: [ruby-dev:25218]
+Wed Jun 1 01:15:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Dec 17 16:28:12 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * io.c (io_encoding_set): should honor already set ecflags since it
+ might be set by mode option. fixed #4804
- * ext/tk/lib/tk.rb: fix bug on setting up system encoding
+Wed Jun 1 00:34:04 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * ext/tk/lib/tk/event.rb: fix error on require process
+ * ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): remove unused
+ variable.
- * ext/tk/lib/tk/font.rb: fix abnormal termination error on Windows
+Wed Jun 1 00:32:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * ext/tk/lib/tk/virtevent.rb: TkVirtualEvent::PreDefVirtEvent.new()
- accepts event-sequence arguments
+ * ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): support instantiation from
+ a Float through Rational.
- * ext/tk/lib/tk/text.rb: fail to dump embedded images
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_new): ditto.
- * ext/tk/lib/tk/text.rb: tag_nextrange and tag_prevrange returns wrong
- types of values
+ * test/bigdecimal/test_bigdecimal.rb (test_global_new_float): add a test for
+ the above changes.
- * ext/tk/lib/tk/texttag.rb: nextrange and prevrange returns wrong
- types of values
+ * test/bigdecimal/test_bigdecimal.rb (test_new_with_float): ditto.
- * ext/tk/lib/tk/text.rb: add TkText::IndexModMethods module and
- TkText::IndexString class to treat text index modifiers
+Wed Jun 1 00:07:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * ext/tk/lib/tk/texttag.rb: use TkText::IndexModMethods module
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_coerce): support coerce with a
+ Rational. The precision used for instantiate a BigDecimal from the
+ given Rational is obtained from the receiver BigDecimal.
- * ext/tk/lib/tk/textmark.rb: ditto
+ * test/bigdecimal/test_bigdecimal.rb (test_coerce): add a test for the
+ above change.
- * ext/tk/lib/tk/textimage.rb: ditto
+Tue May 31 23:49:08 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/lib/tk/textwindow.rb: ditto
+ * ext/date/date_core.c (offset_to_sec): fixed invalid validation.
- * ext/tk/lib/tk/textimage.rb: wrong gravity of text mark for embedded
- image
+Tue May 31 23:43:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * ext/tk/lib/tk/textwindow.rb: wrong gravity of text mark for
- embedded window
+ * ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): replace the algorithm for
+ coercing from a Rational to stop requiring "bigdecimal/util.rb".
+ [ruby-core:34318]
-Fri Dec 17 13:50:00 2004 Akiyoshi, Masamichi <akiyoshi@hp.com>
+ * ext/bigdecimal/bigdecimal.c (GetVpValue): refactoring.
- * vms/vmsruby_private.c, vms/vmsruby_private.h: private routines
- for VMS port are added.
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_new): support instantiation from a
+ Rational.
- * eval.c (ruby_init): change to call VMS private intialization routine.
+ * test/bigdecimal/test_bigdecimal.rb (test_global_new_with_rational): add a
+ test for the above change.
-Fri Dec 17 13:33:58 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/bigdecimal/test_bigdecimal.rb (test_new_with_rational): ditto.
- * lib/cgi/session.rb (CGI::Session#initialize): control adding
- session_id hidden fields. fixed: [ruby-talk:123850]
+Tue May 31 22:44:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Thu Dec 16 23:25:25 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_new): support instantiation a
+ BigDecimal object from an Integer.
- * lib/drb/drb.rb, lib/drb/ssl.rb: backported from CVS HEAD.
- [druby-ja:101]
+ * test/bigdecimal/test_bigdecimal.rb (test_new_with_integer):
+ add for testing the above change.
- * test/drb/test_drb.rb: adjust and reduce sleep (backported from
- CVS HEAD.)
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_global_new): replace its body
+ with a BigDecimal_new call.
-Thu Dec 16 18:44:58 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * test/bigdecimal/test_bigdecimal.rb (test_global_new_with_integer):
+ add for testing the above change.
- * lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should wait
- for reading request till data arrive. [ruby-talk:121068]
+Tue May 31 22:24:39 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/webrick/server.rb (WEBrick::GenericServer#start_thread):
- should log about all accepted socket. [ruby-core:03962]
+ * ext/date/date_core.c: use simple/complex mode instead of light/right mode.
+ * test/date/*.rb: followed the above changes.
- * lib/webrick/accesslog.rb (WEBrick::AccessLog#setup_params):
- "%%" and "%u" are supported. [webricken:135]
+Tue May 31 21:28:33 2011 Tanaka Akira <akr@fsij.org>
- * lib/webrick/httpservlet/filehandler.rb
- (WEBrick::HTTPServlet::FileHandler#check_filename):
- :NondisclosureName is acceptable if it is Enumerable.
+ * test/ruby/test_signal.rb (TestSignal#test_signal_requiring):
+ initialize SIGINT handler.
- * lib/webrick/config.rb (WEBrick::Config::FileHandler):
- default value of :NondisclosureName is [".ht*", "*~"].
+Tue May 31 17:03:24 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Thu Dec 16 18:36:52 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * lib/net/http.rb, lib/net/protocol.rb: Allow to configure to wait
+ server returning '100 continue' response before sending HTTP request
+ body. See NEWS for more detail. See #3622.
+ Original patch is made by Eric Hodel <drbrain@segment7.net>.
- * ext/openssl/ossl.c (ossl_raise): refine message format.
+ * test/net/http/test_http.rb: test it.
-Thu Dec 16 16:29:44 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * NEWS: Add new feature.
- * ext/tk/sample/demos-en/widget: modify version check for
- supporting features
+Tue May 31 14:17:49 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Dec 16 16:03:50 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * io.c (rb_io_s_pipe): potential bug. the mode of read IO is set as
+ DEFAULT_TEXTMODE in call of io_set_encoding(), and of write IO is
+ also set as it in call of io_new_instance() via rb_protect().
+ so, if DEFAULT_TEXTMODE is not 0, we should check the result of
+ extract_binmode() and avoid crush of default IO mode and the result.
- * ext/tk/lib/tk/bindtag.rb: bug fix [ruby-talk: 123667]
+Tue May 31 13:00:17 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * ext/tk/lib/tk/timer.rb: accept :idle for the interval argument
+ * strftime.c (rb_strftime_with_timespec): improved style consistency.
+ constified some variables.
- * ext/tk/lib/tk.rb: add TkComm._callback_entry?()
+ * test/test_time.rb (TestTime#test_huge_precision): test for #4456.
- * ext/tk/lib/multi-tk.rb: add MultiTkIp.cb_entry_class
+Tue May 31 12:53:10 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tk/lib/tk/canvas.rb: use TkComm._callback_entry?()
+ * test/io/wait/test_io_wait.rb (TestIOWait#{test_nread,test_ready?,
+ test_wait}: give system some time to process the written data.
- * ext/tk/lib/tk/canvastag.rb: ditto
+Tue May 31 12:40:49 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tk/lib/tk/dialog.rb: ditto
+ * test/ruby/test_io.rb (TestIO#test_open_mode): MUST release resources
+ explicitly. fix problem of r31671
- * ext/tk/lib/tk/optiondb.rb: ditto
+Tue May 31 10:49:55 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/tk/text.rb: ditto
+ * vm_exec.c: remove conditions for clang
+ because clang version 3.0 (trunk 132165) doesn't need them.
- * ext/tk/lib/tk/texttag.rb: ditto
+Mon May 30 22:19:33 2011 Tanaka Akira <akr@fsij.org>
- * ext/tk/lib/tk/textwindow.rb: ditto
+ * test/ruby/test_signal.rb (TestSignal#test_signal_requiring): don't
+ close stderr.
- * ext/tk/lib/tk/timer.rb: ditto
+Mon May 30 20:22:00 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tk/lib/tk/validation.rb: ditto
+ * test/ruby/test_signal.rb (TestSignal#test_signal_requiring): small
+ but critical typo of r31642. sorry...
+ [Bug #4798] [ruby-core:36550]
- * ext/tk/lib/tkextlib/*: ditto
+Mon May 30 15:44:16 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Dec 16 03:14:28 2004 Minero Aoki <aamine@loveruby.net>
+ * insns.def (opt_mult): as r31805, volatile it.
+ Without this, clang -O fails calculation.
- * lib/net/http.rb (basic_encode): return value of pack('m') may
- include multiple CR/LFs. Backported from main trunk (rev 1.112).
- [ruby-dev:25212]
+ * numeric.c (fix_mul): ditto.
-Thu Dec 16 00:33:37 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * rational.c (f_imul): ditto.
- * hash.c (Init_Hash): remove custom "hash" and "eql?".
+Mon May 30 10:26:51 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Dec 15 18:57:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * numeric.c (int_pow): make sure to assign the result of x * z.
+ If xz is optimized out, the value won't overflow.
- * lib/set.rb (Set::eql): wrong definition. [ruby-dev:25207]
+Sun May 29 23:17:29 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Dec 15 18:48:42 2004 Shugo Maeda <shugo@ruby-lang.org>
+ * re.c (rb_reg_match): fix rdoc of Regexp#=~.
+ patched by Tsuyoshi Sawada. [Bug #4781]
- * ext/curses/curses.c (window_subwin): call NUM2INT() before
- GetWINDOW(). (backported from CVS HEAD)
+Sun May 29 23:10:42 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Dec 15 17:03:50 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/webrick/https.rb (WEBrick::HTTPRequest#parse_uri):
+ keep parse_uri as private. patched by okkez. [Bug #4773]
- * win32/win32.[ch] (rb_w32_isatty): new function to replace MSVCRT's
- isatty because it never sets errno. (backported from CVS HEAD)
+Sun May 29 17:53:03 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Wed Dec 15 15:39:32 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * numeric.c: add #include "internal.h" for rb_big_uminus() prototype.
- * ext/openssl/ossl_x509name.c (ossl_x509name_to_a): avoid SEGV
- (rollback the previous commit).
+Sun May 29 15:09:05 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Dec 15 16:10:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * numeric.c (flo_round): fix for negative value.
- * object.c (rb_obj_id_obsolete): warn always.
+Sun May 29 02:16:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * eval.c (rb_enable_super): ditto.
+ * test/net/http/utils.rb (TestNetHTTPUtils#teardown): add nil check.
-Wed Dec 15 15:31:02 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sun May 29 00:22:40 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/set.rb (Set#==): [ruby-dev:25206]
+ * process.c (before_exec, after_exec): change from macro to function.
-Wed Dec 15 14:22:10 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat May 28 19:30:17 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * win32/win32.c (rb_w32_fdisset): check whether the handle is valid.
- fixed: [ruby-core:03959]
+ * process.c (before_exec, after_exec): change SIGPIPE handler to SIG_DFL
+ before calling execve(). Because r31760 reintroduced an issue that
+ system() may hang up (i.e. [ruby-dev:12261]).
+ * process.c (save_sigpipe, restore_sigpipe): new.
-Wed Dec 15 10:30:37 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat May 28 16:08:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/openssl/ossl_digest.c (ossl_digest_initialize): [ruby-dev:25198]
+ * signal.c (Init_signal, default_handler): change default SIGPIPE handler
+ from empty function to SIG_IGN. [ruby-dev:43215]
+ * signal.c (sigpipe): removed.
-Tue Dec 14 17:10:09 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat May 28 03:04:27 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * win32/win32.c (rb_w32_close): need to reset osfhnd().
+ * io.c (fill_cbuf): return MORE_CHAR_SUSPENDED when cbuf is not empty.
-Tue Dec 14 14:03:57 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sat May 28 02:22:48 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/openssl/ossl.c (ossl_raise): avoid buffer overrun.
- [ruby-dev:25187]
+ * string.c (rb_str_bytesize): rb_str_bytesize() should use LONG2NUM().
+ Patch by Nikolai Weibull. [Bug #4789] [ruby-core:36511]
-Tue Dec 14 12:36:04 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat May 28 02:06:26 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/cgi/session.rb (CGI::Session::initialize): generate new
- session if given session_id does not exist. [ruby-list:40368]
+ * io.c (fill_cbuf): Fix test-all crash.
-Mon Dec 13 18:13:52 2004 Tanaka Akira <akr@m17n.org>
+Sat May 28 00:58:40 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * gc.c (stack_end_address): new function to obtain stack end address.
- stack_end_address calls __builtin_frame_address(0) to obtain the
- frame pointer of a stack frame of stack_end_address. The address
- is the stack pointer of the caller's stack frame.
- (SET_STACK_END): use stack_end_address.
- This makes the conservative garbage collector to scan a stack frame
- of the garbage_collect function itself. This is required because
- callee-save registers may be stored in the frame.
- [ruby-dev:25158]
+ * lib/ostruct.rb (method_missing): Handle [] and []= correctly.
+ Based on a patch by Caius Durling, bug #4179 [ruby-core:33792]
-Mon Dec 13 00:58:02 2004 Tanaka Akira <akr@m17n.org>
+Fri May 27 23:56:54 2011 Kouhei Sutou <kou@cozmixng.org>
- * lib/pathname.rb (cleanpath_aggressive): make it private.
- (cleanpath_conservative): ditto.
- Suggested by Daniel Berger. [ruby-core:3914]
+ * test/rexml/test_core.rb (Tester::test_text_frozen): split frozen
+ string test. refs #4783
-Sun Dec 12 20:06:38 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Fri May 27 22:46:23 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/drb/drb.rb: backported from CVS HEAD.
+ * tool/rbinstall.rb (gem): install gemspec of json. fixed #4784
-Sun Dec 12 10:35:10 2004 Dave Thomas <dave@pragprog.com>
+Fri May 27 22:45:10 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rdoc/generators/template/html/html.rb (RDoc::Page): Don't
- show an accessor's r/w flag if none was specified
+ * io.c (validate_enc_binmode): do not clear textmode flag if
+ default. fixed #4732
-Sun Dec 12 10:14:03 2004 Dave Thomas <dave@pragprog.com>
+ * io.c (fill_cbuf): finish reading at EOF.
- * lib/rdoc/rdoc.rb (RDoc::RDoc::parse_files): Never exclude files
- explicitly given on the command line.
+Fri May 27 11:31:51 2011 misfo <tedwardo2@gmail.com>
-Sun Dec 11 23:54:07 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/rexml/text.rb (REXML::Text#initialize): prevent an error
+ when passing a frozen string to REXML::Text.new
- * ext/tk/*: update to support libraries in ActiveTcl8.4.12.0
- (see ext/tk/ChangeLog.tkextlib).
+ dup the string passed in instead of cloning so that it's frozen
+ state is ignored
- * ext/tk/sample/scrollframe.rb: add a new sample.
+Fri May 27 08:47:26 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sat Dec 11 20:12:21 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * thread.c (ppoll): typo bug fix.
- * lib/drb/drb.rb: add DRbRemoteError. [ruby-list:40348],
- [ruby-list:40390]
+Fri May 27 08:35:04 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/drb/drbtest.rb: ditto.
+ * ext/tk/lib/tk.rb: hang-up at exit before calling Tk.mainloop.
- * test/drb/ut_drb.rb: ditto.
+ * ext/tk/lib/tk/extconf.rb: cannot make on MinGW [Ruby 1.9 - Bug #4141].
-Sat Dec 11 15:38:14 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu May 27 00:34:07 2011 James Edward Gray II <jeg2@ruby-lang.org>
- * lib/jcode.rb (String::succ): [ruby-dev:25156]
+ * lib/csv.rb: Enhance each() to support Enumerator.
-Sat Dec 11 12:41:55 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu May 26 10:32:11 2011 James Edward Gray II <jeg2@ruby-lang.org>
- * eval.c (run_trap_eval): prototype; avoid VC++ warnings.
+ * lib/csv.rb: Documentation improvements from Ysiad Ferreiras.
+ [Ruby 1.9 - Bug #4785]
- * ext/socket/getaddrinfo.c: fix typo. fixed: [ruby-core:03947]
+Thu May 26 15:42:02 2011 Cezary Baginski <cezary.baginski@gmail.com>
- * win32/win32.c: need to include dln.h.
+ * lib/xmlrpc/parser.rb (FaultException): fix to_s and inspect
-Sat Dec 11 00:10:18 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/xmlrpc/parser.rb: test for the above
- * io.c (io_reopen): [ruby-dev:25150]
+Wed May 25 11:54:31 2011 Eric Hodel <drbrain@segment7.net>
-Fri Dec 10 08:39:27 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/curses/curses.c: Remove color constants block.
+ [Ruby 1.9 - Bug #4748]
- * ext/socket/socket.c (sock_listen): get OpenFile just before calling
- listen(2). fixed: [ruby-dev:25149]
+Wed May 25 09:56:45 2011 Eric Hodel <drbrain@segment7.net>
-Thu Dec 9 17:00:00 2004 Akiyoshi, Masamichi <akiyoshi@hp.com>
+ * ext/curses/curses.c: Add missing documentation for button state, MIN
+ and MAX comments. Add Curses. to TABSIZE= and ESCDELAY= methods.
+ [Ruby 1.9 - Bug #4747]
- * ext/socket/socket.c, ext/socket/getaddrinfo.c: port to VMS
+Wed May 25 09:35:31 2011 Eric Hodel <drbrain@segment7.net>
-Thu Dec 9 16:31:02 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/benchmark.rb: Restore nodoc for Benchmark::Job and
+ Benchmark::Report. [Ruby 1.9 - Bug #4726]
- * ext/sdbm/init.c (GetDBM): typo.
+Wed May 25 09:29:38 2011 Eric Hodel <drbrain@segment7.net>
-Thu Dec 9 16:05:00 2004 Akiyoshi, Masamichi <akiyoshi@hp.com>
+ * lib/net/pop.rb: Hide implementation details from RDoc.
+ [Ruby 1.9 - Bug #4711]
- * defines.h: change path of vms.h
- * vms/vms.h: delete reference for snprintf()
- * vms/config.h: new file
- * vms/config.h_in: deleted
+Wed May 25 09:26:29 2011 Eric Hodel <drbrain@segment7.net>
-Thu Dec 9 14:38:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/ftp.rb: Add :nodoc: for private methods.
+ [Ruby 1.9 - Bug #4710]
- * string.c (rb_str_inspect): escape # which starts an expression
- substitution. fixed: [ruby-core:03922]
+Wed May 25 09:19:17 2011 Eric Hodel <drbrain@segment7.net>
- * string.c (rb_str_dump): not escape # which isn't a substitution.
+ * ext/zlib/zlib.c: Fix Document-method declarations. Improve
+ Zlib::GzipFile's method catalog. [Ruby 1.9 - Bug #4695]
-Thu Dec 9 10:54:36 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed May 25 08:22:12 2011 Eric Hodel <drbrain@segment7.net>
- * ext/dbm/dbm.c (fdbm_select): [ruby-dev:25132]
+ * lib/erb.rb: Hide documentation for implementation details of ERB.
+ [Ruby 1.9 - Bug #4694]
- * ext/sdbm/init.c: ditto.
+Wed May 25 07:58:14 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/gdbm/gdbm.c: ditto.
+ * lib/tempfile.rb (Tempfile.{mkdir,rmdir}): revert for backward
+ compatibility.
-Thu Dec 9 03:08:36 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Wed May 25 07:13:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tcltklib/tcltklib.c (ip_init): set root-win title to "ruby" when
- the running script is '-e one-liner' or '-' (stdin).
+ * spec/README: update the description.
- * ext/tcltklib/extconf.rb: add find_library("#{lib}#{ver}",..) for
- stub libs
+Wed May 25 07:12:16 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/tk/textmark.rb: TkTextMarkCurrent and TkTextMarkAnchor
- have a wrong parent class.
+ * lib/tempfile.rb (Tempfile.{lock,unlock}_tempfile): refactor.
- * ext/tk/lib/tk/dialog.rb: rename TkDialog2 --> TkDialogObj and
- TkWarning2 --> TkWarningObj (old names are changed to alias names)
+Tue May 24 17:30:36 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/tk/dialog.rb: bug fix of treatment of 'prev_command'
- option and hashes for configuration
+ * spec/README: fix typo.
+ patched by bowsersenior. https://github.com/ruby/ruby/pull/24
- * ext/tk/lib/tk/dialog.rb: add TkDialogObj#name to return the
- button name
+Tue May 24 07:06:34 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/tk/lib/tk/radiobutton.rb: rename enbugged method value() ==>
- get_value() and value=(val) ==> set_value(val).
+ * ext/tk/lib/tk.rb: fail to start Tk.mainloop (exit immediately) on
+ some environment (reported on [ruby-talk:381444]).
- * ext/tk/lib/tk/menu.rb: add TkMenu.new_menuspec
+ * ext/tk/lib/tk/canvas.rb: support creating a canvas item object from
+ an item ID number.
- * ext/tk/lib/tk/menu.rb: add alias (TkMenuButton = TkMenubutton,
- TkOptionMenuButton = TkOptionMenubutton)
+ * ext/tk/lib/tk/image.rb: import documents which are pull-requested.
+ [Ruby 1.9 - Feature #4595]
- * ext/tk/lib/tk/event.rb: new method aliases (same as option keys of
- event_generate) for Event object
+ * ext/tk/lib/tk/extconf.rb: search directories for 64bit library (e.g.
+ /usr/lib64), add some new configure options (see README.tcltklib),
+ and bug fix.
- * ext/tk/lib/tk/font.rb: configinfo returns proper types of values
+ * ext/tk/lib/tk/README.tcltklib: modify docs for some new configure
+ options.
- * ext/tk/lib/tk.rb: bind methods accept subst_args + block
+Tue May 24 04:01:46 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/tk/lib/tk/canvas.rb: ditto
+ * lib/yaml.rb: switch default YAML engine to Psych, old syck engine
+ may be enabled via YAML::ENGINE.yamler = "syck". [ruby-core:36374]
- * ext/tk/lib/tk/canvastag.rb: ditto
+Mon May 23 09:45:26 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * ext/tk/lib/tk/frame.rb: ditto
+ * include/ruby/defines.h (CASEFOLD_FILESYSTEM): Revert r30508. Forgot to
+ include this file in the commit r31692. __APPLE__ is not
+ CASEFOLD_FILESYSTEM again, from this time.
- * ext/tk/lib/tk/text.rb: ditto
+Mon May 23 10:01:02 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/tk/lib/tk/texttag.rb: ditto
+ * ext/openssl/ossl_asn1.c: Do not parse zero-tagged values as EOC. Do
+ not let current length become negative for infinite length constructed
+ values. Support constructed values of length zero. Added tests.
- * ext/tk/lib/tk/toplevel.rb: ditto
+Mon May 23 09:19:53 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tk/lib/tkextlib/*: ditto and bug fix
+ * lib/net/smtp.rb: Document Net::SMTP::Response. Patch by J.R. Garcia.
+ [Ruby 1.9 - Bug #4768]
-Wed Dec 8 23:54:29 2004 Dave Thomas <dave@pragprog.com>
+Mon May 23 09:03:52 2011 Shota Fukumori <sorah@tubusu.net>
- * lib/rdoc/generators/template/html/html.rb (RDoc::Page): Typo
- meant that h2 tag was invisible.
+ * lib/test/unit/parallel.rb: Never Ignore SIGINT. When received
+ Interrupt, immediately puts result and exit. [ruby-dev:43571]
-Wed Dec 8 21:56:31 2004 Kouhei Sutou <kou@cozmixng.org>
+ * lib/test/unit.rb: When received Interrupt, wait results from workers
+ and collect them. [ruby-dev:43571]
- * lib/rss, test/rss, sample/rss: backported from CVS HEAD.
+Mon May 23 09:08:07 2011 Eric Hodel <drbrain@segment7.net>
-Wed Dec 8 14:31:36 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/mathn.rb: Improve documentation. Patch by Sandor Szucs.
+ [Ruby 1.9 - Bug #4767]
- * io.c (io_fwrite): change dereference for cosmetic reason.
+Mon May 23 08:45:55 2011 Eric Hodel <drbrain@segment7.net>
- * sprintf.c (rb_f_sprintf): [ruby-dev:25104]
+ * lib/ostruct.rb: Improve documentation. Patch by Franklin Webber.
+ [Ruby 1.9 - Bug #4761]
-Tue Dec 7 19:08:00 2004 Akiyoshi, Masamichi <akiyoshi@hp.com>
+Mon May 23 08:35:24 2011 Eric Hodel <drbrain@segment7.net>
- * io.c (io_fwrite): fix offset incrementation (for VMS and Human68k)
+ * hash.c: Improve documentation of Hash#key. Patch by Utkarsh
+ Kukreti. [Ruby 1.9 - Bug #4760]
-Tue Dec 7 00:27:37 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon May 23 08:32:59 2011 Eric Hodel <drbrain@segment7.net>
- * process.c (proc_setgroups): [ruby-dev:25081]
+ * enumerator.c: Improve documentation. Patch by Dave Copeland.
+ [Ruby 1.9 - Bug #4757]
-Mon Dec 6 18:08:10 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon May 23 07:19:45 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * re.c (rb_reg_eqq): document fix. [ruby-talk:122541]
+ * NEWS (openssl): Infinite length support. Different behavior of
+ Constructive and Primitive constructors.
-Mon Dec 6 17:19:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon May 23 06:58:33 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * rubysig.h (TRAP_BEG, TRAP_END): safe errno around CHECK_INTS.
- (backported from CVS HEAD) [ruby-dev:24993]
+ * ext/openssl/ossl_asn1.c: Forbid Constructives whose value is not an
+ Array to prevent segfault. Added test.
-Mon Dec 6 10:18:17 2004 Dave Thomas <dave@pragprog.com>
+Mon May 23 06:33:17 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::look_for_directives_in):
- Oops - 1.8 doesn't have String#clear
+ * ext/openssl/ossl_asn1.c: Forbid Constructive without infinite
+ length. This also prevents a segfault. Added test and improved
+ documentation.
-Mon Dec 6 09:59:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon May 23 05:58:14 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/socket/socket.c (sock_connect): use rb_str_new4().
- [ruby-dev:25052]
+ * ext/openssl/ossl_asn1.c: Fix decoding of infinite length values.
+ Simplified ossl_asn1_decode0 by splitting it into three separate
+ functions. Add tests.
+ [Ruby 1.9 - Bug #4374][ruby-core:35123]
-Mon Dec 6 01:42:08 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Mon May 23 04:03:46 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_public_encrypt,
- ossl_rsa_public_decrypt, ossl_rsa_private_encrypt,
- ossl_rsa_private_decrypt): should take an optional argument
- to specify padding mode. [ruby-talk:122539]
+ * ext/openssl/ossl_asn1.c (ossl_asn1_initialize): Allow creation of
+ Constructives with an explicit tag_class parameter without
+ automatically setting tagging to :EXPLICIT. Fixes a bug when encoding
+ infinite length primitive values.
- * ext/openssl/ossl_pkey_rsa.c (Init_ossl_rsa): add new constants
- PKCS1_PADDING, SSLV23_PADDING, NO_PADDING and PKCS1_OAEP_PADDING
- under OpenSSL::PKey::RSA.
+Mon May 23 04:03:46 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * test/openssl/test_pkey_rsa.rb: new file.
+ * ext/openssl/ossl_asn1.c (ossl_asn1_cons_to_der): Add an additional
+ EOC for infinite length Constructives that are supposed to be encoded
+ with explicit tagging. Also tabify method correctly.
-Sun Dec 5 19:39:17 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon May 23 03:44:39 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * lib/optparse.rb (OptionParser::Completion#complete): new parameter
- to direct case insensitiveness.
+ * ext/openssl/ossl_asn1.c (ossl_asn1data_to_der): Remove redundant
+ flag tmp_cons.
- * lib/optparse.rb (OptionParser#order!): ignore case only for long
- option. [ruby-dev:25048]
+Mon May 23 00:35:00 2001 Kenta Murata <mrkn@mrkn.jp>
-Sat Dec 4 22:54:15 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * bignum.c (dump_bignum, bigmul1_balance, big_split, biglsh_bang),
+ (bigrsh_bang, big_split3, bigmul1_toom3, bigmul0): implement Toom3 (Toom-Cook)
+ multiplication.
- * io.c (io_write): remove rb_str_locktmp(). [ruby-dev:25050]
+ * include/ruby/defines.h: add format prefixes for BDIGIT and BDIGIT_DBL.
- * io.c (io_fwrite): takes VALUE string as an argument.
- [ruby-dev:25050]
+Sun May 22 23:24:02 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/socket/socket.c (sock_connect): remove rb_str_locktmp().
- [ruby-dev:25050]
+ * ext/openssl/ossl_asn1.c: Instead of rb_intern use static symbols to
+ improve performance.
- * ext/socket/socket.c (udp_connect): [ruby-dev:25045]
+Sun May 22 21:56:51 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/socket/socket.c (udp_bind): ditto.
+ * ext/openssl/ossl_asn1.c: Use OpenSSL constants V_ASN1_xxx instead of
+ hardcoded numbers for initializing class_tag_map.
- * ext/socket/socket.c (udp_send): ditto.
+Sun May 22 21:29:29 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
- * ext/socket/socket.c (bsock_send): ditto.
+ * include/ruby/defines.h (CASEFOLD_FILESYSTEM): Revert r30508. See #4255.
+ Now __APPLE__ is not CASEFOLD_FILESYSTEM again.
- * ext/socket/socket.c (s_recvfrom): ditto.
+ * load.c (loaded_feature_path, rb_feature_p, load_lock): Revert r30508.
+ See #4255. Make $LOADED_FEATURES scanning case-sensitive again.
- * hash.c (rb_hash_hash): should provide "hash" method where "eql?"
- is redefined. [ruby-talk:122482]
+Sun May 22 18:59:27 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
-Sat Dec 4 14:54:52 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+ * ext/openssl/ossl_asn1.c(ossl_asn1_default_tag): avoid using RCLASS_SUPER
+ to make it compilable. Plus, tabify and change variable definition style.
- * eval.c (proc_invoke): use volatile `tmp' rather than `args'.
- [ruby-core:03882]
+Sun May 22 18:26:43 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Dec 4 14:28:56 2004 Dave Thomas <dave@pragprog.com>
+ * gc.c (vm_xcalloc): use calloc provided by platforms.
+ fixes #4754
- * lib/rdoc/code_objects.rb (RDoc::Context::Section::set_comment):
- Section comments may now be bracketed by lines which are
- ignored. You can now write
- # -----------
- # :section: Dave's Section
- # comment material
- # -----------
- The lines before :section: are removed, and identical lines at the end are
- also removed if present.
+Sun May 22 11:44:53 2011 Eric Hodel <drbrain@segment7.net>
-Sat Dec 4 03:33:45 2004 Shugo Maeda <shugo@ruby-lang.org>
+ * ext/pty/pty.c: Improve documentation. Patch by David Copeland.
+ [Ruby 1.9 - Bug #4756]
- * ext/readline/readline.c: check $SAFE. (backported from CVS HEAD)
+Sun May 22 11:26:39 2011 Eric Hodel <drbrain@segment7.net>
- * test/readline/test_readline.rb: added tests for readline.
- (backported from CVS HEAD)
+ * lib/timeout.rb: Improve documentation. Patch by David Copeland.
+ [Ruby 1.9 - Bug #4755]
-Sat Dec 4 02:24:00 2004 NARUSE, Yui <naruse@ruby-lang.org>
+Sun May 22 11:21:41 2011 Eric Hodel <drbrain@segment7.net>
- * ext/nkf/nkf.c: add constant NKF::VERSION
+ * lib/ipaddr.rb: Improve documentation. Patch by Sandor Szucs.
+ [Ruby 1.9 - Bug #4753]
- * ext/nkf/nkf.c(guess): this becomes an alias of guess2
+Sun May 22 11:14:40 2011 Eric Hodel <drbrain@segment7.net>
- * ext/nkf/test.rb(mime_out2): add --no-cp932
+ * lib/forwardable.rb: Document def_delegator. Patch by Sandor Szucs.
+ [Ruby 1.9 - Bug #4752]
- * ext/nkf/nkf-utf8/nkf.c: original nkf2 revision 1.47
+Sun May 22 11:11:41 2011 Eric Hodel <drbrain@segment7.net>
-Sat Dec 4 00:35:08 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/fileutils.rb: Document block behavior of FileUtils.cd. Patch by
+ Bil Kleb. [Ruby 1.9 - Bug #4751]
- * ext/socket/socket.c (bsock_setsockopt): [ruby-dev:25039]
+Sun May 22 11:07:47 2011 Eric Hodel <drbrain@segment7.net>
-Fri Dec 3 18:57:03 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/curses/curses.c: Complete documentation. Patch by Vincent
+ Batts. [Ruby 1.9 - Bug #4748]
- * lib/ostruct.rb: 1.9 marshaling support back-ported.
- [ruby-core:03871]
+Sun May 22 09:29:43 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Fri Dec 3 13:45:20 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
+ use spawn. it prevent that other tests inherit renamed $0.
- * eval.c (proc_invoke): copy arguments to frame.argv.
- [ruby-core:03861]
+Sun May 22 08:57:13 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Fri Dec 3 12:25:41 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_asn1.c: Default tag lookup in constant time via hash
+ instead of previous linear algorithm.
+ [Ruby 1.9 - Feature #4309][ruby-core:34813]
- * st.h: fix prototypes.
+Sun May 22 07:54:16 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Fri Dec 3 00:21:05 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/openssl/ossl_digest.c: Explain DSS and DSS1 in documentation.
- * object.c (convert_type): use rb_respond_to() again.
- [ruby-dev:25021]
+Sun May 22 07:10:25 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * eval.c (rb_respond_to): funcall respond_to? if it's redefined.
- [ruby-dev:25021]
+ * test/openssl/test_pkey_dsa.rb: Add tests for sign/verify.
-Fri Dec 3 01:55:24 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sun May 22 06:07:17 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/tk/lib/tk.rb: widget configuration by TkWindow#method_missing
- returns proper object. "widget.option = val" returns val, and
- "widget.option(val)" returns self.
+ * test/openssl/test_x509cert.rb: Merge DSA-related tests from ruby_1_8
+ branch.
- * ext/tk/lib/tk/font.rb: TkFont#replace accepts only one font argument.
+Sun May 22 04:11:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/tk/lib/tk/radiobutton.rb: add TkRadiobutton#value and
- TkRadiobutton#value=(val).
+ * thread.c (Init_Thread): add a code comment why the meaningless
+ line is necessary.
- * ext/tk/lib/tk/spinbox.rb: callback substitution support on
- command option.
+Sun May 22 01:35:12 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/sample/demos-en/widget: bug fix (wrong image height)
+ * ext/date/date_core.c: modified documentation.
- * ext/tk/sample/demos-jp/widget: ditto.
+Sat May 21 22:46:26 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Fri Dec 3 00:11:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/date/date_strftime(date_strftime_with_tmx): "%v" means "%e-%b-%Y".
- * io.c (rb_file_initialize): [ruby-dev:25032]
+Sat May 21 22:14:35 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu Dec 2 16:41:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (rb_io_extract_modeenc): accept combination hash and
+ File::Constants. (eg. File.open('yo', :mode => File::WRONLY))
+ [Feature #4742][ruby-core:36338]
+ * test/ruby/test_io.rb (TestIO#test_open_mode): new test.
- * eval.c (rb_protect): prevent continuations created inside from being
- called from the outside. [ruby-dev:25003]
+Sat May 21 21:44:14 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * eval.c (rb_callcc, rb_cont_call): prohibit calling from different
- signal contexts. [ruby-dev:25022]
+ * test/date/test_switch_hitter.rb: new.
-Thu Dec 2 09:57:24 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat May 21 21:18:29 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/ostruct.rb (OpenStruct::Marshaler): OpenStruct can be
- marshaled again. [ruby-core:03862]
+ * ext/date/date_{core,parse}.c: moved nearly all core code from ext/date/lib.
+ * ext/date/lib/{date,date/format}.rb: removed nearly all code.
-Thu Dec 2 09:30:06 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat May 21 02:58:46 2011 Eric Hodel <drbrain@segment7.net>
- * eval.c (thread_mark): mark thread group. [ruby-dev:25020]
+ * ext/.document: Add curses to documented extensions.
+ * ext/curses/curses.c: Improve documentation. Patch by Vincent Batts.
+ [Ruby 1.9 - Bug #4747]
- * eval.c (thgroup_add): check whether the argument is really a Thread.
+Sat May 21 02:51:01 2011 Eric Hodel <drbrain@segment7.net>
-Thu Dec 2 07:57:16 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/bigdecimal/lib/bigdecimal/util.rb: Improve documentation. Patch
+ by Pete Higgins. [Ruby 1.9 - Bug #4746]
- * io.c (rb_io_ctl): [ruby-dev:25019]
+Sat May 21 02:44:10 2011 Eric Hodel <drbrain@segment7.net>
-Wed Dec 1 02:21:02 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/bigdecimal/lib/bigdecimal/jacobian.rb: Document isEqual. Patch
+ by Kuba Fietkiewicz. [Ruby 1.9 - Bug #4744]
- * signal.c (sighandler): call handler immediately only for default
- handlers. [ruby-dev:25003]
+Sat May 21 02:22:34 2011 Eric Hodel <drbrain@segment7.net>
-Tue Nov 30 23:38:18 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/date/lib/date/format.rb: Document date formats. Patch by
+ Clinton Nixon. [Ruby 1.9 - Bug #4743]
- * io.c (io_fread): need not to null terminate. [ruby-dev:24998]
+Fri May 20 05:15:19 2011 Nobuhiro Iwamatsu <iwamatsu@nigauri.org>
- * io.c (read_all): remove unnecessary rb_str_resize().
- [ruby-dev:24996] (backported from CVS HEAD)
+ * gc.c: Fix build on m68k by 'error: too few arguments to
+ function 'mark_locations_array''.
- * io.c (io_readpartial): ditto.
+Fri May 20 04:23:42 2011 Eric Hodel <drbrain@segment7.net>
- * io.c (io_read): ditto.
+ * lib/scanf.rb: Improve documentation. Patch by Gabe McArthur.
+ [Ruby 1.9 - Bug #4735]
-Tue Nov 30 16:18:50 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri May 20 00:58:01 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (io_fread): need not to null terminate. [ruby-dev:24998]
+ * enc/trans/ibm737-tbl.rb: greek code page. fixes #4738
- * io.c (read_all): remove unnecessary rb_str_resize().
- [ruby-dev:24996]
+Thu May 19 14:44:05 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * io.c (io_read): ditto.
+ * test/ruby/test_signal.rb (test_signal_requiring): skip on Windows.
+ we can send SIGINT only to pid 0 and the process itself.
-Tue Nov 30 00:49:08 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu May 19 09:07:08 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (rb_io_sysread): use temporary lock. [ruby-dev:24992]
+ * lib: revert r31635-r31638 and untabify with expand(1).
-Mon Nov 29 16:06:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu May 19 07:47:26 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/stringio/stringio.c (strio_write): insufficiently filled string
- being extended when overwriting. [ruby-core:03836]
+ * test/openssl/test_pkey_rsa.rb: Add tests for sign/verify.
-Mon Nov 29 15:59:05 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu May 19 07:19:16 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * lib/ostruct.rb (OpenStruct::method_missing): check method
- duplication for -d.
+ * ext/openssl/ossl_pkey.c: Add documentation.
- * lib/ostruct.rb (OpenStruct::initialize): ditto.
+Thu May 19 07:06:56 2011 Eric Hodel <drbrain@segment7.net>
-Mon Nov 29 15:22:28 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/benchmark.rb: Fix indentation.
+ * lib/net/imap.rb: Fix indentation of regular expressions.
- * test/io/nonblock/test_flush.rb: abandon tests when io/nonblock is
- not supported.
+Thu May 19 06:36:11 2011 Eric Hodel <drbrain@segment7.net>
-Mon Nov 29 03:08:30 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/net/imap.rb: Fix indentation of EOF for heredoc.
+ * lib/debug.rb (Commands): Fix indentation of EOHELP for heredoc.
- * object.c (convert_type): direct call conversion methods for the
- performance. [ruby-core:03845]
+Thu May 19 06:30:38 2011 Eric Hodel <drbrain@segment7.net>
- * eval.c (rb_funcall_rescue): new function.
+ * lib/mkmf.rb: Fix indentation of EOM for heredoc.
- * object.c (rb_Array): avoid using rb_respond_to().
+Thu May 19 06:16:41 2011 Eric Hodel <drbrain@segment7.net>
- * object.c (rb_Integer): ditto.
+ * lib: Convert tabs to spaces for ruby files per
+ http://redmine.ruby-lang.org/projects/ruby/wiki/DeveloperHowto#coding-style
+ Patch by Steve Klabnik [Ruby 1.9 - Bug #4730]
+ Patch by Jason Dew [Ruby 1.9 - Feature #4718]
- * parse.y (reduce_nodes): empty body should return nil.
+Thu May 19 06:06:07 2011 Eric Hodel <drbrain@segment7.net>
- * string.c (rb_str_aset): the original string should not be
- affected by modifying duplicated string. [ruby-dev:24981]
+ * lib/cgi/util.rb: Improve documentation. Patch by Clinton Nixon.
+ [Ruby 1.9 - Bug #4733]
+ * lib/cgi/core.rb: ditto
+ * lib/cgi/cookie.rb: ditto
-Mon Nov 29 13:57:38 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu May 19 06:02:21 2011 Eric Hodel <drbrain@segment7.net>
- * win32/win32.c (CreateChild): search executable file if no program
- name given. (backported from CVS HEAD)
+ * lib/tempfile.rb: Document Dir.mkdir and Dir.rmdir. Patch by Clinton
+ Nixon. [Ruby 1.9 - Bug #4728]
-Mon Nov 29 13:37:54 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu May 19 05:57:52 2011 Eric Hodel <drbrain@segment7.net>
- * io.c (fptr_finalize): must not use FILE after fclose().
- [ruby-dev:24985]
+ * encoding.c: Improve documentation for Encoding#default_external and
+ Encoding#default_internal.
-Mon Nov 29 13:16:31 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed May 18 22:45:26 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/win32.c (CreateChild): push back the last space before next
- loop because CharNext() eats it.
+ * ext/io/console/lib/console/size.rb (IO#console_size): new
+ method. (EXPERIMENTAL)
-Mon Nov 29 01:18:18 2004 Tanaka Akira <akr@m17n.org>
+Wed May 18 22:41:51 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (rb_io_check_writable): call io_seek regardless of
- NEED_IO_SEEK_BETWEEN_RW. [ruby-dev:24986]
+ * internal.h: add for internal use only.
-Sat Nov 27 21:43:39 2004 Tanaka Akira <akr@m17n.org>
+Wed May 18 22:36:43 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c: avoid data lost with nonblocking fd and
- stdio buffering in sync mode. [ruby-dev:24966]
- based on matz's patch [ruby-dev:24967]
- (io_fwrite): new primitive writing function which writes
- directly if sync mode.
- (rb_io_fwrite): wrapper for io_fwrite now.
- (io_write): call io_fwrite instead of rb_io_fwrite.
+ * eval.c (setup_exception): internal exception should be hidden
-Sat Nov 27 14:44:15 2004 Kent Sibilev <ksibilev@bellsouth.net>
+Wed May 18 20:25:04 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/cgi/session.rb (CGI::Session::initialize): create_new_id is
- now a instance method. [ruby-core:03832]
+ * lib/timeout.rb (Timeout#timeout): don't leak "execution expired"
+ exception. [Bug #4283] [ruby-core:34534].
-Sat Nov 27 09:41:21 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed May 18 06:09:24 2011 Eric Hodel <drbrain@segment7.net>
- * io.c (io_fread): old rb_io_fread with file closing checking.
- (rb_io_fread): wrapper for io_fread now.
- [ruby-dev:24964]
+ * lib/cmath.rb: Add some examples and improve documentation. Patch by
+ Sandor Szucs. [Ruby 1.9 - Bug #4727]
-Fri Nov 26 18:02:44 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Wed May 18 05:40:31 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tk/lib/tk.rb: Tk.destroy uses TkWindow#epath
+ * lib/benchmark.rb: Remove nodoc from Benchmark::Job and
+ Benchmark::Report. Patch by Sandor Szucs. [Ruby 1.9 - Bug #4726]
- * ext/tk/lib/tk/image.rb: bug fix
+Wed May 18 05:29:26 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tk/lib/tk/wm.rb: add 'iconphoto' method(Windows only)
+ * lib/webrick/compat.rb: Improve documentation. Patch by Sandor
+ Szucs. [Ruby 1.9 - Bug #4725]
- * ext/tk/lib/tkextlib/*: some methods uses TkWindow#epath
+Wed May 18 05:10:35 2011 Eric Hodel <drbrain@segment7.net>
-Fri Nov 26 13:49:06 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/tracer.rb: Improve documentation. Patch by Richard Ramsden.
+ [Ruby 1.9 - Feature #4720]
- * eval.c (method_missing): raise TypeError for classes do not
- have allocators. [ruby-core:03752]
+Wed May 18 04:53:41 2011 Eric Hodel <drbrain@segment7.net>
- * lib/erb.rb: add RDoc by James Edward Gray II. [ruby-core:03786]
+ * lib/cmath.rb: Improve documentation. Patch by Jason Dew.
+ [Ruby 1.9 - Feature #4717]
-Fri Nov 26 13:29:02 2004 Dave Thomas <dave@pragprog.com>
+Wed May 18 04:50:24 2011 Eric Hodel <drbrain@segment7.net>
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::look_for_directives_in): Break
- out of preprocessing when we find a :section: directive (previously cleared out the
- comment, but this apparently now generates an error in gsub!)
+ * lib/net/ftp.rb: Improve documentation. Patch by Vincent Batts.
+ [Ruby 1.9 - Bug #4710]
-Fri Nov 26 00:17:40 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed May 18 03:14:49 2011 Eric Hodel <drbrain@segment7.net>
- * io.c (io_read): move StringValue() check before GetOpenFile().
- [ruby-dev:24959]
+ * test/test_singleton.rb: Add tests from lib/singleton.rb. Patch by
+ Pete Higgins. [Ruby 1.9 - Bug #4715]
-Thu Nov 25 20:14:57 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed May 18 03:03:07 2011 Eric Hodel <drbrain@segment7.net>
- * lib/thwait.rb (ThreadsWait#join_nowait): abnormally terminated
- threads should be also processed. [ruby-talk:121320]
+ * lib/singleton.rb: Improve documentation. Patch by Pete Higgins.
+ [Ruby 1.9 - Bug #4709]
-Thu Nov 25 10:14:26 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue May 17 21:24:04 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * dir.c (push_braces): do not reuse buffer strings. [ruby-core:03806]
+ * thread.c (rb_mutex_lock): remove remove_signal_thread_list() call.
+ It's meaningless because lock_interrupt doesn't call
+ add_signal_thread_list().
-Thu Nov 25 07:59:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue May 17 20:20:49 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * io.c (read_all): stringify non-nil buffer argument, and always
- taint the result. [ruby-dev:24955]
+ * vm_core.h (rb_thread_struct): add volatile to
+ transition_for_lock because it is not protected by lock.
-Wed Nov 24 01:01:31 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue May 17 20:08:53 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * io.c (io_read): integer conversion should be prior to
- GetOpenFile(). [ruby-dev:24952]
+ * LEGAL (missing/{elf,tgamma,lgamma_r}.c): they've been replaced by
+ public domain implementations.
- * configure.in, io.c: cancel [ ruby-Patches-1074 ].
+ * LEGAL (vsnprintf.c): it has moved to srcdir from missing/.
-Tue Nov 23 08:09:50 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * LEGAL (missing/crypt.c): list its original license.
- * ext/tk/lib/tk/menu.rb: improve usability of TkOptionMenubutton
+Tue May 17 19:54:26 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Nov 23 02:00:21 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * LEGAL (configure): add missing/setproctitle.c
- * file.c (rb_file_chown): integer conversion should be prior to
- GetOpenFile(). [ruby-dev:24949]
+Tue May 17 19:35:01 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ Fix FreeBSD test failure.
-Tue Nov 23 00:10:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
+ use ps -o command instead of ps -o cmd. FreeBSD doesn't support
+ -o cmd option.
- * file.c (rb_file_chown): integer conversion should be prior to
- GetOpenFile(). [ruby-dev:24947]
+Tue May 17 08:04:26 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * file.c (rb_file_truncate): ditto.
+ * ext/openssl/ossl_digest.c: Add documentation.
- * file.c (rb_file_s_truncate): ditto.
+Tue May 17 07:14:58 2011 Eric Hodel <drbrain@segment7.net>
- * dir.c (dir_seek): use NUM2OFFT().
+ * lib/net/http.rb: Improve documentation of proxy configuration
+ methods. Patch by Alf Mikula. [Ruby 1.9 - Bug #4714]
- * misc/ruby-mode.el (ruby-non-block-do-re): should not match words
- start with block keyword and underscore. [ruby-core:03719]
+Tue May 17 07:09:01 2011 Eric Hodel <drbrain@segment7.net>
-Mon Nov 22 22:33:02 2004 Dave Thomas <dave@pragprog.com>
+ * lib/net/pop.rb: Improve documentation. Patch by Vincent Batts.
+ [Ruby 1.9 - Bug #4711]
+ * lib/net/telnet.rb: ditto
- * lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Don't use names
- of variables or constants when oarsing 'require'
+Tue May 17 07:00:41 2011 Eric Hodel <drbrain@segment7.net>
-Mon Nov 22 00:13:35 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/net/http.rb: Fix nodoc for Net::HTTP::version_1_1?. Patch by
+ Alf Mikula. [Ruby 1.9 - Bug #4713]
- * dir.c (dir_seek): should retrieve dir_data after NUM2INT().
- [ruby-dev:24941]
+Tue May 17 06:56:26 2011 Eric Hodel <drbrain@segment7.net>
-Sat Nov 20 23:57:33 2004 Dave Thomas <dave@pragprog.com>
+ * lib/optparse.rb: Add link to make_switch to improve documentation.
+ Patch by David Copeland. [Ruby 1.9 - Bug #4708]
- * lib/rdoc/README (et al): Add a new directive, :section:, and
- change the output format to accomodate. :section: allows to to
- group together methods, attributes, constants, etc under
- headings in the output. If used, a table of contents is
- generated.
+Tue May 17 06:50:40 2011 Eric Hodel <drbrain@segment7.net>
-Sat Nov 20 23:56:54 2004 Dave Thomas <dave@pragprog.com>
+ * lib/observer.rb: Improve documentation. Patch by David Copeland.
+ [Ruby 1.9 - Bug #4707]
- * lib/rdoc/options.rb (Options::parse): Force --inline-source if
- --one-file option given
+Tue May 17 06:42:53 2011 Eric Hodel <drbrain@segment7.net>
-Sat Nov 20 23:55:19 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/logger.rb: Improve documentation. Patch by David Copeland.
+ [Ruby 1.9 - Bug #4706]
- * string.c (rb_str_splice): should place index wrapping after
- possible modification. [ruby-dev:24940]
+Tue May 17 06:28:14 2011 Eric Hodel <drbrain@segment7.net>
-Sat Nov 20 13:26:03 2004 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/gserver.rb: Improve documentation. Patch by David Copeland.
+ [Ruby 1.9 - Bug #4705]
- * ext/nkf/nkf-utf8/utf8tbl.c: original revision 1.7
+Tue May 17 06:21:15 2011 Eric Hodel <drbrain@segment7.net>
-Sat Nov 20 05:34:24 2004 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/cgi.rb: Add toplevel documentation to class CGI
+ * lib/cgi/session.rb: Add overview documentation to CGI::Cookie
+ * lib/cgi/html.rb: Don't add CGI::TagMaker documentation to CGI.
+ Patch by David Copeland. [Ruby 1.9 - Bug #4704]
+ * lib/cgi/core.rb: Clean up CGI documentation. Patch by David
+ Copeland. [Ruby 1.9 - Bug #4704]
+ * lib/cgi/cookie.rb: Clean up CGI::Cookie documentation. Patch by
+ David Copeland. [Ruby 1.9 - Bug #4704]
- * ext/nkf/nkf-utf8/nkf.c: original nkf.c rev:1.40
+Tue May 17 05:52:30 2011 Eric Hodel <drbrain@segment7.net>
- * ext/nkf/test.rb: add test for mime encode/decode
+ * ext/digest: Improve documentation of Digest, Digest::HMAC and
+ Digest::SHA2. Patch by Pete Higgins. [Ruby 1.9 - Bug #4702]
-Sat Nov 20 01:37:34 2004 Johan Holmberg <holmberg@iar.se>
+Tue May 17 03:51:42 2011 Eric Hodel <drbrain@segment7.net>
- * eval.c (error_print): nicer traceback at interrupt.
- [ruby-core:03774]
+ * lib/abbrev.rb: Hide copyright and revision information from RDoc.
+ Inspired by patch from David Copeland, bug #4703.
-Sat Nov 20 00:07:16 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue May 17 03:33:21 2011 Eric Hodel <drbrain@segment7.net>
- * string.c (str_gsub): internal buffer should not be listed by
- ObjectSpace.each_object() by String#gsub. [ruby-dev:24931]
+ * lib/timeout.rb (module Timeout): Hide internal constants. Patch by
+ Pete Higgins. [Ruby 1.9 - Bug #4701]
-Fri Nov 19 01:20:22 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon May 16 11:21:09 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/cgi/session.rb (CGI::Session::FileStore::initialize): raise
- exception if data corresponding to session specified from the
- client does not exist.
+ * configure.in, win32/Makefile.sub (RUBY_SO_NAME): add CPU as prefix
+ of RUBY_SO_NAME on x64/ia64 mswin/mingw.
+ [Feature #4602]
-Fri Nov 19 00:59:31 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon May 16 08:00:05 2011 Eric Hodel <drbrain@segment7.net>
- * string.c (str_gsub): internal buffer should not be listed by
- ObjectSpace.each_object(). [ruby-dev:24919]
+ * lib/rdoc.rb: Update to RDoc 3.6.1, allows OpenSSL::Digest to be
+ found.
-Thu Nov 18 18:41:08 2004 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Mon May 16 05:49:54 2011 Eric Hodel <drbrain@segment7.net>
- * test/ruby/test_stringchar.rb (test_bang): added.
+ * lib/drb/acl.rb: Add documentation.
- * string.c (rb_str_upcase_bang, rb_str_capitalize_bang)
- (rb_str_swapcase_bang): missing rb_str_modify(). [ruby-dev:24915]
+Mon May 16 05:13:20 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Thu Nov 18 00:21:15 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/openssl/ossl_asn1.c: Add documentation.
- * process.c (proc_getpgrp): prohibit for $SAFE=2.
- [ruby-dev:24899]
+Mon May 16 00:32:05 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * process.c (get_pid): ditto. [ruby-dev:24904]
+ * test/ruby/test_signal.rb (TestSignal#test_signal_process_group):
+ skip if the platform doesn't have :pgroup capability. (i.e. skip
+ if mswin32)
- * process.c (get_ppid): ditto.
+Sun May 15 23:53:31 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * array.c (rb_ary_delete): defer rb_ary_modify() until actual
- modification. [ruby-dev:24901]
+ * include/ruby/intern.h: resurrect old rb_fd_copy().
+ * thread.c (rb_fd_copy): ditto.
-Thu Nov 18 10:10:14 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun May 15 23:45:11 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * io.c, rubyio.h (rb_io_modenum_flags): exported.
+ * include/ruby/intern.h: remove rb_fd_copy() to rb_fd_dup() and
+ rb_w32_fdcopy() to rb_w32_fd_dup().
+ * win32/win32.c: ditto.
+ * thread.c: ditto.
- * ext/stringio/stringio.c (strio_initialize): allow Fixnum as mode as
- well as IO.new does. [ruby-dev:24896]
+Sun May 15 22:26:39 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Wed Nov 17 23:42:40 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * signal.c (rb_f_kill): accept '-SIGXXX' style signal with Symbol or
+ implicit convertion with #to_str. [ruby-dev:43169] fixes #4362
+ * test/ruby/test_signal.rb (test_signal_process_group): add a test
+ for send signal to process group.
- * test/ruby/test_settracefunc.rb: added. [ruby-dev:24884]
+Sun May 15 21:22:35 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Wed Nov 17 13:56:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * cont.c (cont_init): clear macihne_stack_start/end of saved thread to
+ prevent mark machine stack of GC'ed Thread. root Fiber is not
+ initialized by fiber_init().
+ based on a patch by Serge Balyuk [ruby-core:35891] fixes #4612
+ * test/ruby/test_fiber.rb (test_gc_root_fiber): add test for it.
- * parse.y (newline_node): should not use FL_SET. [ruby-dev:24874]
+Sun May 15 21:04:29 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * parse.y (string_content): should not use FL_UNSET.
+ * transcode.c (econv_init): revert r31353. [ruby-dev:43512]
- * node.h (NODE_NEWLINE): remove unused bit to utilize flag field
- in nodes.
+Sun May 15 03:39:35 2011 Eric Hodel <drbrain@segment7.net>
-Wed Nov 17 13:09:40 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/zlib/zlib.c: Improve documentation. Patch by Vincent Batts.
+ [Ruby 1.9 - Bug #4695]
- * {bcc32,win32,wince}/Makefile.sub (test): should build ruby.exe
- before running test. [ruby-core:03756]
+Sun May 15 03:23:46 2011 Eric Hodel <drbrain@segment7.net>
-Wed Nov 17 04:33:01 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * lib/erb.rb: Document ERB::Compiler. Patch by Simon Chiang.
+ [Ruby 1.9 - Bug #4694]
- * pack.c: all features are backport from 1.9. [ruby-dev:24826]
+Sun May 15 00:58:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ fix mswin32 build error.
- * bignum.c (rb_big2ulong_pack): new function to pack Bignums.
+ * missing/setproctitle.c: add #ifdef HAVE_UNISTD_H.
+ * win32/Makefile.sub (MISSING): add setproctitle.obj
-Wed Nov 17 03:42:45 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat May 14 22:45:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * string.c (rb_str_splice): move rb_str_modify() after
- StringValue(), which may alter the receiver. [ruby-dev:24878]
+ * missing/setproctitle.c: add to include "ruby/util.h".
-Tue Nov 16 23:45:07 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat May 14 19:52:22 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * numeric.c (flo_divmod): protect float values from GC by
- assignment to local variables. [ruby-dev:24873]
+ * test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
+ add for $0 test.
-Tue Nov 16 16:30:21 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat May 14 19:50:46 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * {bcc32,win32,wince}/setup.mak (-epilogue-): remove config.h and
- config.status to force updating them.
+ * missing/setproctitle.c (compat_init_setproctitle): use
+ ruby_strdup() instead of strdup().
-Tue Nov 16 16:20:45 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat May 14 19:37:31 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/stringio/stringio.c (strio_read): position was ignored when a
- buffer was passed. http://www.yo.rim.or.jp/~nov/d/?date=20041116#p03
+ * include/ruby/missing.h: add setproctitle() declaration.
+ * missing/setproctitle.c: added.
+ * configure.in: add check for missing/setproctitle.c.
-Tue Nov 16 11:19:07 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c (ruby_process_options): add to call compat_init_setproctitle().
+ * ruby.c (set_arg0): remove all platform specific code. it's
+ moved to missing/setproctitle.c.
+ * ruby.c (origarg): remove len field. It's no longer used.
+ * ruby.c (get_arglen): removed.
- * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::options): use
- Regexp conversion.
+ This patch makes a lot of cleanup set_arg0 related code and fixes
+ [Feature #4689].
-Tue Nov 16 01:41:31 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat May 14 17:42:21 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * string.c (str_mod_check): frozen check should be separated.
- [ruby-core:3742]
+ * process.c (rb_proc_times): improve documentation.
+ [ruby-core:35785] fixes #4581, reported by Andrew Grimm.
- * array.c (rb_ary_update): pedantic check to detect
- rb_ary_to_ary() to modify the receiver. [ruby-dev:24861]
+Sat May 14 12:12:54 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Mon Nov 15 13:50:52 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/openssl/test_pkey_dsa.rb: Add basic tests and tests that
+ ensure new public key PEM encoding behavior and ensure backward
+ compatibility.
+ [Ruby 1.9 - Bug #4422] [ruby-core:35328]
+ * test/openssl/test_pkey_rsa.rb: Remove line with 'puts'.
- * string.c (rb_str_justify): typo fixed. [ruby-dev:24851]
+Sat May 14 12:06:49 2011 Eric Hodel <drbrain@segment7.net>
-Mon Nov 15 11:50:32 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rdoc/context.rb (class RDoc): Fix infinite loop caused by
+ re-encountering BasicObject.
- * misc/ruby-mode.el (ruby-special-char-p, ruby-parse-partial): handle
- operator symbols. [ruby-talk:120177]
+Sat May 14 10:32:36 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Sun Nov 14 13:27:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/openssl/test_pkey_rsa.rb: Add tests that ensure new public key
+ encoding behavior and also ensure backward compatibility.
+ [Ruby 1.9 - Bug #4421] [ruby-core:35327]
- * lib/pp.rb (PP#object_address_group): remove odd number of 'f'
- prefixed to negative address.
+Sat May 14 09:50:10 2011 Eric Hodel <drbrain@segment7.net>
-Sun Nov 14 08:51:04 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * lib/yaml/dbm.rb: Add documentation. Patch by Justin Collins.
+ [Ruby 1.9 - Bug #4693]
+ * lib/yaml/store.rb: ditto
- * test/logger/test_logger.rb: Logger just expects
- Logger#datetime_format to be used for Time#strftime independently of
- locale. [ruby-dev:24828]
+Sat May 14 09:31:43 2011 Eric Hodel <drbrain@segment7.net>
-Fri Nov 12 15:03:26 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/rdoc.rb: Updated to RDoc 3.6
- * eval.c (ruby_options): now we cannot call rb_glob() before
- ruby_init(), so call rb_w32_cmdvector() at ruby_options().
+Sat May 14 07:30:29 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * win32.{c,h} (rb_w32_cmdvector): rename make_cmdvector() and
- export it.
+ * ext/psych/lib/psych.rb: released a new gem, so increasing version.
-Fri Nov 12 14:08:01 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sat May 14 05:08:32 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/tk/lib/tk/event.rb: remove $LOADED_FEATURES trick
+ * ext/openssl/ossl_digest.c
+ * ext/openssl/ossl_pkey.c
+ * ext/openssl/ossl_pkey.h
+ * test/openssl/pkey/test_pkey_rsa.rb
+ Reverted premature commit. Sorry for the noise!
- * ext/tk/lib/tk.rb: ditto
+Sat May 14 05:02:58 2011 Eric Hodel <drbrain@segment7.net>
-Fri Nov 12 00:31:05 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/uri.rb: Add toplevel documentation. Patch by Vincent Batts.
+ [Ruby 1.9 - Bug #4690]
- * ext/gdbm/gdbm.c (fgdbm_store): StringValue() may alter string
- pointer. [ruby-dev:24783]
+Sat May 14 04:19:06 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
-Thu Nov 11 17:36:12 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * NEWS: Describe altered behaviour for RSA and DSA public key
+ encoding. [Ruby 1.9 - Bug #4421, Bug #4422]
+ [ruby-core:35327,35328]
- * dir.c (rb_globi): also should call back via rb_glob_caller().
- [ruby-dev:24775]
+Sat May 14 02:57:52 2011 Eric Hodel <drbrain@segment7.net>
-Thu Nov 11 16:47:21 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/ipaddr.rb (unless Socket): Document valid*? methods. Patch by
+ Sebastian Martinez. [Ruby 1.9 - Feature #4687]
- * test/ruby/test_file.rb (test_truncate_wbuf): we want to test
- only File#truncate, not behaviour of seek(2).
+Sat May 14 02:54:04 2011 Eric Hodel <drbrain@segment7.net>
-Thu Nov 11 09:41:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/rexml/functions.rb: Add some documentation for REXML::Functions.
+ Patch by Sebastian Martinez. [Ruby 1.9 - Feature #4688]
- * dir.c (push_braces): was confusing VALUE and char*.
+Sat May 14 02:51:42 2011 Eric Hodel <drbrain@segment7.net>
- * dir.c (rb_push_glob): Dir.glob should have called its block.
+ * lib/resolv.rb: Hide private method and state-tracking constants from
+ RDoc. Patch by Mark Turner. [Ruby 1.9 - Feature #4691]
-Thu Nov 11 01:52:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri May 13 19:23:21 2011 URABE Shyouhei <shyouhei@ruby-lang.org>
- * error.c (syserr_initialize): use stringified object.
- [ruby-dev:24768]
+ * numeric.c (flo_coerce): Add #flo_coerce documentation.
+ Patch by Sebastian Martinez.
+ https://github.com/ruby/ruby/pull/21
-Wed Nov 10 22:49:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri May 13 18:42:22 2011 URABE Shyouhei <shyouhei@ruby-lang.org>
- * lib/delegate.rb (SimpleDelegator::dup): wrong number of
- arguments.
+ * README.EXT: fix typo. Patch by William Blackerby.
+ https://github.com/ruby/ruby/pull/19
- * lib/delegate.rb (DelegateClass::dup): ditto.
+ * README.EXT.ja: ditto.
-Wed Nov 10 12:31:21 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri May 13 15:22:34 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * README.EXT (Example): extconf.rb is indispensable now.
+ * win32/win32.c (rb_w32_select): check invalid handle before doing
+ select operations. see [ruby-dev:43513], [ruby-dev:43535]
-Wed Nov 10 03:33:36 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Fri May 13 08:34:00 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tcltklib/tcltklib.c: fix SEGV when compiled with Tcl/Tk8.3.x
- or older
+ * lib/rdoc/rdoc.rb: Output summary after documentation report.
+ * lib/rdoc/stats/normal.rb: Don't output information for users when
+ we're not on a TTY
- * ext/tk/lib/tkextlib/tile/style.rb: bug fix
+Fri May 13 07:49:02 2011 Eric Hodel <drbrain@segment7.net>
-Tue Nov 9 14:27:18 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/fileutils.rb: Hide internal methods from RDoc. Patch by Darragh
+ Curran. [Ruby 1.9 - Bug #4684]
- * lib/optparse.rb (OptionParser::Officious): moved from DefaultList.
+Fri May 13 07:36:23 2011 Eric Hodel <drbrain@segment7.net>
-Tue Nov 9 01:05:04 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/webrick/httpservlet/erbhandler.rb: Add documentation.
- * dir.c (rb_glob2): do not allocate buffer from heap to avoid
- memory leaks. use string object for buffering instead.
- [ruby-dev:24738]
+Fri May 13 07:04:33 2011 Eric Hodel <drbrain@segment7.net>
- * dir.c (join_path): ditto.
+ * lib/mathn.rb: Fix indentation. Patch by Jason Dew.
+ [Ruby 1.9 - Feature #4682]
- * io.c (io_read): external input buffer may be modified even after
- rb_str_locktmp(). [ruby-dev:24735]
+Fri May 13 06:50:43 2011 Eric Hodel <drbrain@segment7.net>
- * dir.c (fnmatch): p or s may be NULL. [ruby-dev:24749]
+ * lib/mathn.rb: Add documentation. Patch by Jason Dew. [Ruby 1.9 -
+ Feature #4667]
-Tue Nov 9 00:53:53 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Fri May 13 05:44:19 2011 Eric Hodel <drbrain@segment7.net>
- * regex.c (slow_match): avoid GCC 3.4.x warnings.
+ * lib/logger.rb (class Logger): Document Logger#datetime_format.
+ Patch by Sergio Gil Perez de la Manga. [Ruby 1.9 - Bug #4678]
-Tue Nov 9 00:50:06 2004 Dave Thomas <dave@pragprog.com>
+Fri May 13 05:39:11 2011 Eric Hodel <drbrain@segment7.net>
- * lib/rdoc/rdoc.rb: Change version numbering of RDoc and ri
+ * re.c (Init_Regexp): Document option constants. Patch by Vincent
+ Batts. [Ruby 1.9 - Bug #4677]
+ * lib/uri/common.rb (module URI): Documentation for URI. Patch by
+ Vincent Batts. [Ruby 1.9- Bug #4677]
+ * lib/uri/ftp.rb (module URI): ditto
+ * lib/uri/generic.rb (module URI): ditto
+ * lib/uri/http.rb (module URI): ditto
+ * lib/uri/https.rb (module URI): ditto
+ * lib/uri/ldap.rb (module URI): ditto
+ * lib/uri/ldaps.rb (module URI): ditto
+ * lib/uri/mailto.rb (module URI): ditto
+ * process.c (Init_process): Document Process constants. Patch by
+ Vincent Batts. [Ruby 1.9- Bug #4677]
-Mon Nov 8 23:38:35 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Fri May 13 05:16:38 2011 Eric Hodel <drbrain@segment7.net>
- * lib/drb/extservm.rb: add DRb::ExtServManager#uri=.
- [ruby-dev:24743]
+ * lib/rss/atom.rb (module RSS): Document URIs. Patch by Mark Turner.
+ [Ruby 1.9 - #4671]
+ * lib/rss/rss.rb (module RSS): Document exception classes. Patch by
+ Mark Turner. [Ruby 1.9 - #4671]
-Mon Nov 8 22:20:19 2004 Dave Thomas <dave@pragprog.com>
+Fri May 13 02:15:18 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
- Fix bug where parent class wasn't being detected if the
- child class was defined using the A::B notation.
+ * io.c (select_internal): remove unused variable (interrupt_flag).
-Mon Nov 8 00:14:13 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Thu May 12 18:24:34 2011 Kouhei Sutou <kou@clear-code.com>
- * configure.in: add setup for mignw32 cross compiling.
- [ruby-talk:119413]
+ * configure.in: limit to "T" type for prefix of external symbols
+ because x86_64-w64-mingw32-gcc on Debian GNU/Linux generates the
+ following symbol:
+ 0000000068483390 D _GLOBAL__F__conftest_external
-Sun Nov 7 23:49:26 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ Approved by nobu.
- * ext/tk/lib/tk.rb: bind-event methods accept multi substitution
- arguments.
+Thu May 12 14:50:52 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tk/lib/tk/canvas.rb: ditto.
+ * test/dl/test_base.rb (Fiddle::LIBC_SO): its always msvc*.dll on
+ mswin/mingw.
- * ext/tk/lib/tk/canvastag.rb: ditto.
+Thu May 12 14:47:53 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tk/lib/tk/text.rb: ditto.
+ * lib/mkmf.rb (Logging.postpone): copy only when temporary logfile
+ exists.
- * ext/tk/lib/tk/texttag.rb: ditto.
+Thu May 12 12:24:22 2011 Nobuhiro Iwamatsu <iwamatsu@nigauri.org>
- * ext/tk/lib/tkextlib: ditto.
+ * ext/openssl/ossl_ssl.c: By trunk@31346, function check of SSLv2 is
+ executed.
+ However, the problem is not revised in this.
+ This adds the control of using function of SSLv2 in made macro by
+ function check.
-Sat Nov 6 14:58:44 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Thu May 12 08:10:46 2011 Eric Hodel <drbrain@segment7.net>
- * lib/webrick/server.rb (WEBrick::HTTPServer#start): remove
- :DoNotReverseLookup option. (Socket#do_not_reverse_lookup is a
- ruby 1.9 feature)
+ * lib/set.rb (class Set): Add nodoc to internal-use methods. Patch
+ by Pete Higgins. [Ruby 1.9 - Bug #4665]
-Sat Nov 6 11:31:04 2004 Tadayoshi Funaba <tadf@dotrb.org>
+Thu May 12 08:01:14 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * lib/date.rb (_parse): checks whether zone was given.
+ * ext/openssl/ossl_pkey_ec.c: Allow encryption when PEM-encoding
+ Elliptic Curve private keys.
+ [ruby-core:35329] [Bug #4423]
-Sat Nov 6 00:46:27 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu May 12 07:54:59 2011 Eric Hodel <drbrain@segment7.net>
- * string.c (rb_str_locktmp): check STR_TMPLOCK flag before
- locking. [ruby-dev:24727]
+ * object.c (rb_obj_equal): Add documentation. Patch by Vincent Batts.
+ [Ruby 1.9 - Bug #4664]
+ * lib/rexml: ditto
+ * lib/mkmf.rb: ditto
+ * ext/socket/lib/socket.rb: ditto
-Fri Nov 5 18:12:42 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu May 12 07:30:08 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tk/lib/tk/scrollable.rb: divide Scrollable module into
- X_Scrollable and Y_Scrollable
+ * Various .document files: Update .document files to match files which
+ have documentation.
- * ext/tk/lib/tk/entry.rb: include X_Scrollable instead of Scrollable
+Thu May 12 07:18:45 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/tk/lib/tk/autoload.rb: define autoload for X_Scrollable and
- Y_Scrollable
+ * ext/openssl/ossl_pkey_dsa.c: Use generic X.509 SubjectPublicKeyInfo
+ format for PEM-encoding DSA public keys.
+ [ruby-core:35328] [Bug #4422]
-Fri Nov 5 16:05:32 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu May 12 06:27:31 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * ext/tk/lib/tk.rb: TkComm._at() supprts both of "@x,y" and "@x"
+ * ext/openssl/ossl_pkey_rsa.c: Use generic X.509 SubjectPublicKeyInfo
+ format for encoding RSA public keys.
+ [ruby-core:35327] [Bug #4421]
-Fri Nov 5 13:22:58 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Wed May 11 19:45:27 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
- * ext/tk/lib/tk/text.rb: sorry. bug fix again.
+ * lib/forwardable.rb: support 'delegate :foo => :bar' for to meet
+ by specification of RDOC.
-Fri Nov 5 13:17:54 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Wed May 11 08:36:38 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tk/lib/tk/text.rb: bug fix
+ * lib/webrick: Add documentation for WEBrick::HTTPAuth
-Fri Nov 5 08:52:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed May 11 03:06:35 2011 Eric Hodel <drbrain@segment7.net>
- * gc.c (gc_mark): stricter GC stack check.
+ * lib/rss.rb: Add documentation for RSS. Patch by Steve Klabnik.
+ [Ruby 1.9 - Bug #4663]
-Fri Nov 5 08:52:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue May 10 14:50:32 2011 Shota Fukumori <sorah@tubusu.net>
- * gc.c (gc_mark): stricter GC stack check.
+ * lib/test/unit.rb: Add option for hiding skip messages when test
+ ends. #4657
-Fri Nov 5 08:34:43 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/testunit/test_hideskip.rb, test/testunit/test4test_hideskip.rb:
+ test for above.
- * string.c (str_gsub): should have removed rb_str_unlocktmp(str).
- [ruby-dev:24708]
+Tue May 10 10:53:04 2011 Eric Hodel <drbrain@segment7.net>
-Thu Nov 4 21:25:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * common.mk (rdoc): Add rdoc-coverage rule
- * string.c (str_gsub): string modify check no longer based on
- tmplock. [ruby-dev:24706]
+Tue May 10 09:13:21 2011 Eric Hodel <drbrain@segment7.net>
-Thu Nov 4 19:27:46 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/webrick: Add Documentation
- * io.c (rb_f_open): fix typo.
+Tue May 10 04:22:09 Eric Hodel <drbrain@segment7.net>
-Thu Nov 4 15:02:14 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/webrick/log.rb: Hide copyright info from ri
+ * lib/webrick/httpstatus.rb: ditto
+ * lib/webrick/htmlutils.rb: ditto
+ * lib/webrick/httpversion.rb: ditto
+ * lib/webrick/version.rb: ditto
+ * lib/webrick/httpauth/userdb.rb: ditto
+ * lib/webrick/httpauth/authenticator.rb: ditto
+ * lib/webrick/accesslog.rb: ditto
- * ext/tk/lib/tk/variable.rb: forget to initialize instance_variables
- of TkVarAccess objects
+Mon May 9 20:57:13 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Thu Nov 4 09:11:35 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_{complex,rational}.rb: added tests.
- * gc.c (gc_mark): enable GC stack checking.
+Mon May 9 20:29:44 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Thu Nov 4 03:11:33 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * complex.c (string_to_c_internal): a refactoring.
- * string.c (str_gsub): lock strings temporarily. [ruby-dev:24687]
+Mon May 9 18:33:05 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/socket/socket.c (s_recvfrom): tmplock input buffer.
- [ruby-dev:24705]
+ * string.c: Improve documentation for String#start_with? and
+ String#end_with?. fixes #4652
+ patched by Andrew Grimm <andrew.j.grimm at gmail.com>
-Wed Nov 3 22:32:12 2004 NARUSE, Yui <naruse@ruby-lang.org>
+Mon May 9 13:49:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * process.c: On NetBSD don't use setruid() and setrgid().
+ * complex.c (string_to_c_internal): support scientific notation.
+ patched by Tinco Andringa. https://github.com/ruby/ruby/pull/16
+ [ruby-core:36046][Bug #4655]
-Wed Nov 3 22:24:17 2004 Daigo Moriwaki <techml@sgtpepper.net>
+Mon May 9 11:52:48 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/webrick/httpauth/digestauth.rb: use Base64.encode64 to
- avoid warnings.
+ * numeric.c (int_ord): remove K&R style.
+ patched by Daehyub Kim. https://github.com/ruby/ruby/pull/17
-Wed Nov 3 17:19:59 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sun May 8 22:17:24 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * array.c (rb_ary_uniq_bang): do not push frozen string from hash
- table. [ruby-dev:24695]
+ * test/ruby/test_{complex2,complexrational}.rb: use skip.
+ * test/date/*.rb: ditto.
- * array.c (rb_ary_and): ditto.
+Sun May 8 21:02:31 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * array.c (rb_ary_or): ditto.
+ * test/ruby/test_{complex2,complexrational}.rb: NEVER SKIP.
-Wed Nov 3 17:13:02 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sun May 8 21:01:21 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * io.c (pipe_open): fix compile error
+ * test/date/test_date_base.rb: fixed.
-Wed Nov 3 16:58:07 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sun May 8 20:54:11 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/lib/tk.rb: support to use different Tcl commands between
- configure and configinfo
+ * test/date/*.rb: NEVER SKIP.
- * ext/tk/lib/font.rb: ditto.
+Sun May 8 20:37:33 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/lib/itemconfig.rb: support to use different Tcl commands
- between item_configure and item_configinfo
+ * test/date/*.rb: reverted 31432.
- * ext/tk/lib/itemfont.rb: ditto.
+Sun May 8 20:32:43 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/extconf.rb: install SUPPORT_STATUS
+ * test/date/*.rb: reverted 31483.
- * ext/tk/lib/tkextlib: some bug fixes (see ext/tk/ChangeLog.tkextlib)
+Sun May 8 19:39:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Nov 3 16:30:41 2004 NARUSE, Yui <naruse@ruby-lang.org>
+ * thread_pthread.c (native_cond_timedwait): add to care EINTR.
+ * thread_pthread.c (thread_timer): remove EINTR check.
- * ext/nkf: follow nkf 2.0.4
+Sun May 8 19:04:15 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Wed Nov 3 15:53:34 2004 Kouhei Sutou <kou@cozmixng.org>
+ * lib/time.rb (xmlschema): avoid passing any negative numbers.
- * test/rss/test_maker_*.rb: added tests for RSS Maker.
+Sun May 8 18:40:03 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/rss/maker.rb: added RSS Maker.
+ * ext/date/date_{parse,strptime}.c: introduced some macros.
- * lib/rss/maker/*.rb: ditto.
+Sun May 8 17:17:13 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Tue Nov 2 16:35:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/date/*.rb: use skip /w messages.
- * ext/enumerator/enumerator.c (each_cons_i): pass copy of an
- internal consequent array. [ruby-talk:118691]
+Sun May 8 17:04:55 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Tue Nov 2 16:05:21 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/date/lib/date/format.rb (_httpdate): omitted to call zone_to_diff.
- * process.c (rb_f_fork): need to flush stdout and stderr before
- fork(2). [ruby-talk:117715]
+Sun May 8 16:56:19 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Tue Nov 2 01:20:09 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/date/date_core.c (date_s_test_*): use macros.
- * eval.c (proc_invoke): nail down dyna_var node when Proc object
- or continuation is created. [ruby-dev:24671]
+Sun May 8 10:24:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Nov 1 13:59:28 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+ * thread_pthread.c: cleanup signal_thread_list related ifdef.
+ 1) we don't have to use #ifdef FOO-PLATFORM directly 2) About
+ half #ifdef didn't care symbian properly.
- * ext/extmk.rb (MANIFEST): do not use anymore, use extconf.rb instead.
+Sun May 8 05:19:37 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/enumerator/extconf.rb, ext/fcntl/extconf.rb,
- ext/stringio/extconf.rb: added.
+ * test/io/wait/test_io_wait.rb: Linux socketpair(2) only support
+ AF_UNIX, but windows socketpair doesn't support it. we can't
+ avoid platform check. sigh!
- * MANIFEST, ext/**/MANIFEST: removed.
+Sun May 8 00:13:05 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * README.EXT, README.EXT.ja: remove MANIFEST stuff.
+ * test/io/wait/test_io_wait.rb: use Socket.pair instead of pipe.
+ Windows can only treat a socket.
-Mon Nov 1 01:14:52 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat May 7 22:43:48 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * io.c (rb_f_open): create copy of popen specifier. [ruby-dev:24656]
+ * thread.c (rb_fd_zero): remove redundant zero fill.
-Mon Nov 1 00:36:48 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Sat May 7 22:38:04 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * main.c (_stklen): move to gc.c.
+ * thread.c (rb_fd_init): remove volatile qualifier.
-Sun Oct 31 00:22:28 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat May 7 22:34:29 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * string.c (rb_str_locktmp): lock string temporarily.
+ * thread.c (rb_fd_init_copy): new internal api. It provide efficient
+ copy constructor semantics.
+ * thread.c (do_select): use rb_fd_init_copy().
- * string.c (str_independent): add tmplock check.
+Sat May 7 15:18:06 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ fix incorrect native_cond_signal call when deadlock was detected.
- * io.c (io_write): lock output string temporarily.
- [ruby-dev:24649]
+ * thread.c (lock_func): decrement cond_waiting if timeout was happen.
- * io.c (io_write): use rb_str_locktmp().
+Sat May 7 18:28:37 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (read_all): ditto.
+ * thread_pthread.c (USE_MONOTONIC_COND): check the availability
+ more strictly.
-Sat Oct 30 06:53:24 2004 Peter Vanbroekhoven <peter.vanbroekhoven@cs.kuleuven.ac.be>
+ * thread_pthread.h (rb_thread_cond_t): ditto.
- * eval.c (rb_eval): NODE_XSTR should pass copy of literal string.
+Sat May 7 15:15:10 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sat Oct 30 00:19:40 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ fix win32 native_cond_timedwait() makes SIGSEGV.
- * enum.c (enum_sort_by): protect continuation jump in.
- [ruby-dev:24642]
+ * thread_win32.h (rb_thread_cond_struct): add prev field instead of
+ last. (ie cond_event_entry is now using double linked list instead of
+ single)
+ * thread_win32.c (cond_event_entry): add prev field.
-Fri Oct 29 21:27:51 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread_win32.c (__cond_timedwait): remove entry properly if timeout
+ was happen.
- * io.c (rb_io_check_initialized): new function to check uninitialized
- object. [ruby-talk:118234]
+ * thread_win32.c (native_cond_signal): change for double linked list.
+ * thread_win32.c (native_cond_broadcast): ditto.
+ * thread_win32.c (native_cond_initialize): ditto.
- * file.c (rb_file_path), io.c (rb_io_closed): check if initialized.
+Sat May 7 12:41:04 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ fix mutex deadlock test hang-up.
-Fri Oct 29 10:00:30 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * thread_win32.c (abs_timespec_to_timeout_ms): fix 1000x calculation
+ mistake. (ie fix hang-up native_cond_timedwait())
- * eval.c (rb_thread_start_0): forget to free some memory chunks.
- [ruby-core:03611]
+Sat May 7 03:14:13 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * eval.c (ruby_cleanup): ruby_finalize_1 may cause exception,
- should be wrapped by PUSH_TAG/POP_TAG(). [ruby-dev:24627]
+ sleep_cond use monotonic time if possible.
-Thu Oct 28 08:42:02 2004 Tanaka Akira <akr@m17n.org>
+ * thread_pthread.c (native_thread_init): change sleep_cond
+ attribute to monotonic.
+ * thread_pthread.c (native_sleep): use native_cond_timeout().
- * io.c (argf_forward): use ANSI style.
- (argf_read): call argf_forward with argv argument.
- [ruby-dev:24624]
+ * thread_pthread.c (native_cond_timeout): add overflow care.
+ * thread_win32.c (native_cond_timeout): ditto.
-Thu Oct 28 23:32:54 2004 akira yamada <akira@ruby-lang.org>
+Sat May 7 02:49:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ fix win32 compile error.
- * ext/zlib/zlib.c (zstream_detach_input): resets klass of z->input if
- z->input isn't nil.
+ * thread_win32.c (RB_CONDATTR_CLOCK_MONOTONIC): define
+ RB_CONDATTR_CLOCK_MONOTONIC always.
+ * thread_pthread.c (RB_CONDATTR_CLOCK_MONOTONIC): ditto.
-Thu Oct 28 23:19:31 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat May 7 02:29:41 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/extmk.rb: prefer relative path. [ruby-talk:93037]
+ mutex: deadlock check timeout use monotonic time.
-Wed Oct 27 18:49:11 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * thread_pthread.c (native_cond_timeout): new internal api.
+ it calculate a proper time for argument of native_cond_timedwait().
+ * thread_win32.c (native_cond_timeout): ditto.
- * gc.c: prototype; rb_io_fptr_finalize() doesn't return any value
- at this version.
+ * thread_pthread.c (thread_timer): use native_cond_timeout()
+ instead of get_ts.
+ * thread.c (lock_func): ditto.
-Wed Oct 27 17:27:45 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * thread_pthread.c (get_ts): removed. use native_cond_timeout().
+ * thread.c (init_lock_timeout): ditto.
- * gc.c (gc_sweep): recover ruby_in_compile variable.
+Sat May 7 01:54:21 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Oct 27 09:17:30 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread_pthread.c (get_ts): add monotonic clock capability.
+ * thread_pthread.c (rb_thread_create_timer_thread): use monotonic
+ clock if possible.
- * string.c (str_gsub): use a string object for exception safeness.
- [ruby-dev:24601]
+Sat May 7 01:43:37 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Oct 26 23:52:32 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread_pthread.h (rb_thread_cond_t): add clockid field. it's
+ no longer an alias of pthread_cond_t.
+ * thread_pthread.c: adapt new rb_thread_cond_t type.
+ * thread.c (mutex_alloc): ditto.
+ * thread_win32.c (native_cond_initialize): ditto.
+ * configure.in: add check for pthread_cond_attr_setclock() and
+ clockid_t type.
- * io.c (rb_io_getline): rs modification check should not interfere in the loop.
+Fri May 6 23:29:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Oct 26 23:30:39 2004 Dave Thomas <dave@pragprog.com>
+ * thread.c (rb_wait_for_single_fd): use ppoll() instead of poll()
+ if possible. based on a patch from Eric Wong. [ruby-core:36003].
- * lib/rdoc/code_objects.rb (RDoc::Context::add_class_or_module):
- Restore correct :nopdoc: behavior with nested classes and modules.
+Fri May 6 23:13:43 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Oct 26 18:21:29 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * configure.in: remove nanosleep check. we no longer use it.
+ r20124 removed last usage.
- * string.c (RESIZE_CAPA): check string attribute before modifying
- capacity member of string structure. [ruby-dev:24594]
+Fri May 6 22:35:56 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Oct 26 11:33:26 2004 David G. Andersen <dga@lcs.mit.edu>
+ * ext/syck/rubyext.c (mktime_do): extra digits are not used.
- * ext/zlib/zlib.c (gzreader_gets): use memchr() to to gain
- performance. [ruby-talk:117701]
+Fri May 6 17:43:07 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Oct 26 10:56:55 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/syck/rubyext.c (mktime_do): remove unused variable offset.
- * sprintf.c (rb_f_sprintf): raise ArgumentError for extra
- arguments, unless (digit)$ style used.
+ * ext/syck/syck.h: use #ifdef instead of #if DEBUG.
-Tue Oct 26 11:33:26 2004 David G. Andersen <dga@lcs.mit.edu>
+Fri May 6 16:27:33 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/zlib/zlib.c (gzreader_gets): use memchr() to to gain
- performance. [ruby-talk:117701]
+ * ext/date/date_core.c (DAY_IN_NANOSECONDS): refix: 31438.
+ check with LONG_MAX and cast as long; without this the calculation
+ will be done as int and overflow.
-Tue Oct 26 10:56:55 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri May 6 15:01:11 2011 URABE Shyouhei <shyouhei@ruby-lang.org>
- * sprintf.c (rb_f_sprintf): raise ArgumentError for extra
- arguments, unless (digit)$ style used.
+ * ext/syck/rubyext.c (mktime_do): avoid buffer overrun, by
+ silently ignoring lesser significant digits. Required buffer
+ length can be computable so you might at first think of
+ allocating enough memory space on the fly using alloca(). That
+ is a wrong idea because when using alloca there is always risk
+ of integer overflow. A function that accepts outer-process
+ resources like this should not blindly trust its inputs. In
+ this particular case we just want to generate milliseconds
+ resolution by strtod() so the string in question needs no more
+ length than what we originally have. Ignoring lesser
+ significant digits should suffice I believe.
-Mon Oct 25 18:35:39 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Fri May 6 14:25:53 2011 Tinco Andringa <mail@tinco.nl>
- * win32/win32.c (isUNCRoot): should check NUL after '.'.
- [ruby-dev:24590]
+ * ext/syck/rubyext.c (mktime_do): YAML.load time correctly parse
+ usecs smaller than 1 fixes #4571
- * win32/win32.c (isUNCRoot): fixed buffer overrun.
+Thu May 5 22:23:34 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Oct 25 08:03:26 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread_pthread.c (native_mutex_reinitialize_atfork): removed
+ unused macro.
+ * thread_win32.c (native_mutex_reinitialize_atfork): ditto.
- * eval.c (get_backtrace): ignore illegal backtrace. [ruby-dev:24587]
+Thu May 5 22:09:39 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Oct 24 00:41:09 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/date/date_core.c (DAY_IN_NANOSECONDS): long long int is not
+ available on all platforms.
- * eval.c (rb_load, search_required, rb_require_safe, rb_require): use
- frozen shared string to avoid outside modification. [ruby-dev:24580]
+Thu May 5 17:36:31 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Sat Oct 23 22:18:32 2004 Guy Decoux <ts@moulon.inra.fr>
+ * eval.c (frame_func_id): store result of method_entry_of_iseq() to
+ cfp->me because method_entry_of_iseq() might become expensive.
- * eval.c (frame_free): Guy Decoux solved the leak problem.
- Thanks. [ruby-core:03549]
+Thu May 5 15:03:51 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Sat Oct 23 00:20:55 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * eval.c (frame_func_id): __method__ return different name from
+ methods defined by Module#define_method with a same block.
+ [ruby-core:35386] fixes #4606
+ * eval.c (method_entry_of_iseq): new helper function. search control
+ frame stack for a method entry which has given iseq.
+ * test/ruby/test_method.rb: add tests for #4606
- * ext/zlib/zlib.c (zstream_append_input): clear klass for z->input
- to avoid potential vulnerability.
+Wed May 4 22:13:09 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/zlib/zlib.c (zstream_run): always use zstream_append_input()
- to avoid SEGV. [ruby-dev:24568]
+ * benchmark/bm_vm4_pipe.rb: Reduced iterations. Too slow benchmark
+ is bad.
+ * benchmark/bm_vm4_thread_pass.rb: ditto.
-Fri Oct 22 12:02:28 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed May 4 22:08:22 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * eval.c (rb_alias): was warning for wrong condition.
- [ruby-dev:24565]
+ * test/date/test_date_base.rb: don't use no message skip().
-Fri Oct 22 10:36:37 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Wed May 4 21:11:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#meta_vars):
- should check if path_info is not nil.
+ * benchmark/bm_io_select2.rb: reduce number of using file
+ descriptors. because gdb need some fds.
-Fri Oct 22 00:22:31 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed May 4 19:00:59 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/zlib/zlib.c (zstream_shift_buffer): should restore class
- field of a buffer. [ruby-dev:24562]
+ * thread.c (rb_wait_for_single_fd): Fix wrong return value.
+ * test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb
+ (TestWaitForSingleFD#test_wait_for_closed_pipe): test for it.
-Fri Oct 22 00:20:33 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed May 4 18:46:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * string.c (rb_str_include): should not treat char as negative value.
- [ruby-dev:24558]
+ * ext/-test-/wait_for_single_fd: New. for testing
+ rb_wait_for_single_fd() internal function.
+ The patch was written by Eric Wong. [ruby-core:35991]
-Thu Oct 21 21:32:30 2004 IWATSUKI Hiroyuki <don@na.rim.or.jp>
+ * test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb: ditto.
- * lib/pstore.rb (PStore#transaction): Use the empty content when a
- file is not found. [ruby-dev:24561]
+Wed May 4 12:46:25 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu Oct 21 19:06:15 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * thread.c (rb_wait_for_single_fd): Added POLLNVAL check.
+ based on a patch from Eric Wong at [ruby-core:35991].
- * lib/webrick/httpresponse.rb (WEBrick::HTTPResponse#send_body_io):
- ensure to close @body. (http://bugs.debian.org/277520)
+Wed May 4 11:51:01 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu Oct 21 00:36:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * io.c (rb_f_select): remove useless ifdef.
- * eval.c (rb_alias): should warn on method discarding.
- [ruby-dev:24546]
+Wed May 4 11:42:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/zlib/zlib.c (zstream_expand_buffer_into): hide internal
- string buffer by clearing klass. [ruby-dev:24548]
+ * ext/socket/init.c (wait_connectable): fix error handling code.
+ RB_WAITFD_OUT is turned on even though an error occur.
-Wed Oct 20 19:45:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed May 4 10:12:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * string.c (str_gsub): reentrant check. [ruby-dev:24432]
+ * ext/readline/readline.c (readline_event): use rb_wait_for_single_fd().
+ The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
- * backport all SEGV bug fixes from CVS HEAD. [ruby-dev:24536]
+Wed May 4 10:10:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Oct 20 04:17:55 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/socket/init.c (wait_connectable): use rb_wait_for_single_fd().
+ The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
- * ext/dbm/dbm.c (fdbm_delete_if): should check if deleting element
- is a string. [ruby-dev:24490]
+ * ext/socket/init.c (try_wait_connectable, wait_connectable_ensure):
+ removed.
- * ext/sdbm/init.c (fsdbm_delete_if): ditto.
+Wed May 4 10:07:48 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Oct 20 01:37:18 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/io/wait/wait.c (io_wait): use rb_wait_for_single_fd().
+ The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
- * array.c (rb_ary_times): Array#* should return an instance of
- the class of right operand. [ruby-dev:24526]
+Wed May 4 10:01:27 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/zlib/zlib.c (zstream_detach_buffer): should not expose
- class-less object to Ruby world. [ruby-dev:24530]
+ * thread.c (rb_wait_for_single_fd): new. poll(2) based backend for
+ rb_wait_for_single_fd().
+ Now only Linux uses it.
- * eval.c (proc_dup): provide Proc#dup as well. [ruby-talk:116915]
+ The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
- * eval.c (ruby_exec): stack marking position may be higher than
- expected. thanks to Guy Decoux. [ruby-core:03527]
+Wed May 4 09:56:57 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Oct 19 22:43:12 2004 Dave Thomas <dave@pragprog.com>
+ * thread.c (rb_wait_for_single_fd): new.
+ * thread.c (select_single): select(2) based backend for
+ rb_wait_for_single_fd().
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_attr): If
- we come across 'attr' in a context where it isn't
- followed by a symbol, just issue a warning.
+ * io.c (make_writeconv): use rb_wait_for_single_fd() instead of
+ rb_thread_fd_select().
+ * io.c (rb_io_wait_readable): ditto.
+ * thread.c (rb_thread_wait_fd_rw): ditto.
-Tue Oct 19 20:41:37 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * io.c (wait_readable): removed.
+ * thread.c (init_set_fd): new helper function.
+ * include/ruby/io.h (RB_WAITFD_IN, RB_WAITFD_PRI, RB_WAITFD_OUT):
+ new constant for rb_single_wait_fd().
- * ext/win32ole.c(ole_invoke): retrieve the result value when
- retrying the IDispatch::invoke.
+ The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
-Tue Oct 19 17:24:11 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed May 4 08:04:59 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * io.c (read_all): block string buffer modification during
- rb_io_fread() by freezing it temporarily. [ruby-dev:24479]
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: fix time dumping so that
+ Syck can load UTC times that Psych dumps.
- * dir.c (rb_push_glob): block call at once the end of method.
- [ruby-dev:24487]
+Wed May 4 07:33:00 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/enumerator/enumerator.c (enum_each_slice): remove
- rb_gc_force_recycle() to prevent potential SEGV.
- [ruby-dev:24499]
+ * thread.c (rb_fd_copy): fix wrong argument.This issue was pointed
+ out by Eric Wong. [ruby-core:35982]
- * ext/zlib/zlib.c (zstream_expand_buffer): hide internal string
- buffer by clearing klass. [ruby-dev:24510]
+Tue May 3 20:29:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Oct 19 16:12:18 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/fileutils/test_fileutils.rb (TestFileUtils#test_chmod_symbol_mode):
+ Skip sticky bit test if the platform is FreeBSD. It doesn't allow to
+ change sticky bit if a target is regular file.
- * ext/tk/tkutil.c: backport from CVS HEAD
+Tue May 3 18:23:57 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-Tue Oct 19 08:54:26 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/date/test_date.rb (TestDate#test_coerce):
+ test for [ruby-core:35127].
- * intern.h, object.c (rb_class_inherited_p): export.
+Tue May 3 04:27:53 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Oct 19 08:46:57 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread.c (rb_thread_select): preserve errno if no error
+ occurred.
- * string.c (rb_str_upto): method result must be checked. [ruby-dev:24504]
+Tue May 3 03:57:04 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (error_print): ditto. [ruby-dev:24519]
+ * include/ruby/intern.h (rb_w32_fdcopy): add prototype. fixes
+ #4640
-Mon Oct 18 23:37:05 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon May 2 01:02:04 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * marshal.c (r_object0): check inheritance by the internal function.
- [ruby-dev:24515]
+ * lib/fileutils.rb (FileUtils#chmod): accept symbolic mode argument.
+ The patch was written by takkanm. [ruby-core:26029][Feature #2190]
-Mon Oct 18 15:58:01 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/fileutils.rb (FileUtils#fu_mode): new helper function.
+ * lib/fileutils.rb (FileUtils#symbolic_modes_to_i): ditto.
+ * lib/fileutils.rb (FileUtils#mode_mask): ditto.
+ * lib/fileutils.rb (FileUtils#user_mask): ditto.
- * range.c (range_step, range_each): need cast.
+ * test/fileutils/test_fileutils.rb (TestFileUtils#test_chmod_symbol_mode):
+ new test for the above symbolic mode.
+ * test/fileutils/test_fileutils.rb (TestFileUtils#test_chmod_R): ditto.
-Fri Oct 29 16:34:19 2004 Daiki Ueno <ueno@unixuser.org>
+Mon May 2 00:36:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * misc/ruby-mode.el (ruby-parse-partial): Parse the rest of the
- line after opening heredoc identifier. [ruby-dev:24635]
+ * ext/socket/init.c (rsock_connect): add to care EINTR. based
+ on a patch from Eric Wong at [ruby-core:35621][Bug #4555]
-Mon Oct 18 07:26:21 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun May 1 01:06:24 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * file.c (rb_file_truncate): discard read buffer before truncation.
- [ruby-dev:24197]
+ * thread.c (rb_thread_select): release GVL while waiting select().
-Mon Oct 18 02:11:21 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sat Apr 30 23:10:15 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/webrick/config.rb (WEBrick::Config::General): add default values:
- - WEBrick::Config[:DoNotReverseLookup]
- - WEBrick::Config[:RequestCallback] (it used as an alias of
- :RequestHandler in WEBrick::HTTPServer#run)
- - WEBrick::Config::FileHandler[:AcceptableLanguages]
+ * win32/win32.c (rb_w32_fdcopy): New. This can copy even though
+ fdset size exceed FD_SETSIZE.
+ * include/ruby/intern.h (rb_fd_copy): use rb_w32_fdcopy()
- * lib/webrick/httpservlet/filehandler.rb
- (WEBrick::HTTPServlet::FileHandler#set_filename): search files
- having suffix of language-name which Accept-Language header field
- includes if :AcceptableLanguages options is present.
+Sat Apr 30 20:18:43 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/webrick/httpservlet/filehandler.rb
- (WEBrick::HTTPServlet::FileHandler#get_servlet): new method to
- search servlet correspond to the suffix of filename.
+ * thread.c (do_select): Change argument type to rb_fdset_t.
+ Now do_select() is free from unexpected hangup if
+ HAVE_RB_FD_INIT=1 [Bug #4636]
- * lib/webrick/httprequest.rb: add attributes access methods: accept,
- accept_charset, accept_encoding, accept_language, content_length
- and content_type.
+ * thread.c (rb_thread_fd_select, rb_thread_wait_fd_rw):
+ adapt new argument type.
- * lib/webrick/httpresponse.rb: add attribute access methods:
- content_length, content_length=, content_type and content_type=.
+ * thread.c (rb_thread_select): make dummy implementation.
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils.mime_types):
- use the second suffix to detect media type. (the first suffix
- may be a language name.)
+Sat Apr 30 20:16:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_qvalues):
- add method to parse Accept header field. it returns an Array of
- values sorted by the qvalues.
+ * thread.c (rb_fd_copy): Change function argument. Now
+ rb_fd_copy() has fully copy semantics.
+ * include/ruby/intern.h: ditto.
-Mon Oct 18 02:04:11 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sat Apr 30 20:11:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/webrick/httpserver.rb (WEBrick::HTTPServer#virtual_host): new
- method to register virtual hosting servers.
+ * include/ruby/intern.h (rb_thread_select): mark as deprecated.
- * lib/webrick/server.rb (WEBrick::GenericServer#accept): call
- do_not_reverse_lookup for each socket if :DoNotReverseLookup
- is set. [ruby-core:02357]
+ * ext/io/wait/wait.c (wait_readable): use rb_thread_fd_select
+ instead of rb_thread_select.
+ * ext/socket/init.c (wait_connectable0): ditto.
+ * ext/readline/readline.c (readline_event): ditto.
+ * io.c (rb_io_wait_readable, wait_readable, rb_io_wait_writable,
+ wait_writable): ditto.
-Mon Oct 18 00:42:45 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat Apr 30 20:06:36 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/socket/socket.c (sock_s_getservbyaname): protocol string
- might be altered. [ruby-dev:24503]
+ * thread.c (do_select): remove useless ifdef. time calculation
+ is not heavy weight.
- * string.c (rb_str_upto): check if return value from succ is a
- string. [ruby-dev:24504]
+Sat Apr 30 16:48:36 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun Oct 17 23:03:48 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * benchmark/bm_io_select3.rb: New.
- * ext/tk/lib/tk/timer.rb: TkTimer#start and restart accept a block
+Sat Apr 30 16:27:09 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun Oct 17 13:05:04 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * io.c (copy_stream_body, rb_io_s_copy_stream): move rb_fd_init()
+ from copy_stream_body to rb_io_s_copy_stream. fds of passing
+ rb_fd_term() have to be guaranteed initialized.
- * ext/win32ole/win32ole.c (fole_func_methods): correct argument mismatch.
- * ext/win32ole/win32ole.c (fole_get_methods): ditto.
- * ext/win32ole/win32ole.c (fole_put_methods): ditto.
- * ext/win32ole/tests/testWIN32OLE.rb: add test for WIN32OLE#ole_func_methods
- WIN32OLE#ole_get_methods, WIN32OLE#ole_put_methods
+Sat Apr 30 16:13:17 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sat Oct 16 14:45:28 2004 Kouhei Sutou <kou@cozmixng.org>
+ * benchmark/bm_io_select.rb, benchmark/bm_io_select2.rb: New.
+ based on a patch from Eric Wong at [Feature #4531]
- * lib/rss/0.9.rb (RSS::Rss#to_s): removed garbage.
+Sat Apr 30 03:25:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sat Oct 16 13:42:49 2004 Kouhei Sutou <kou@cozmixng.org>
+ * test/io/wait/test_io_wait.rb: New. for testing ext/io/wait.
+ the patch was written by Eric Wong. [Feature #4531]
- * lib/rss/: untabified.
- * test/rss/: untabified.
- * lib/rss/0.9.rb (RSS::Rss#to_s): inent -> indent.
+Sat Apr 30 00:34:56 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sat Oct 16 13:34:56 2004 Kouhei Sutou <kou@cozmixng.org>
+ * include/ruby/win32.h: remove redundant declaration of
+ rb_w32_time_subtract().
- * lib/rss: supported prety print.
- * test/rss/test_1.0.rb: added test for calculating default indent size.
+Sat Apr 30 00:16:40 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Fri Oct 15 18:04:35 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * thread_pthread.c (gvl_init): fix hangup if GVL_SIMPLE_LOCK=1.
+ We don't have to call mutex_unlock() before initialize it!
- * ext/tk/lib/tk/timer.rb: TkTimer.new(interval, loop){ ... } is
- acceptable. Add TkTimer.start ( == new + start ).
+Fri Apr 29 13:15:15 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Fri Oct 15 12:43:09 2004 Tanaka Akira <akr@m17n.org>
+ * thread_win32.c (native_cond_timedwait): New. r31373 caused
+ win32 build failure.
- * eval.c (Init_stack): make prototype declaration consistent with
- the definition in gc.c.
+ * thread_win32.c (__cond_timedwait, abs_timespec_to_timeout_ms):
+ New helper functions.
-Thu Oct 14 14:34:01 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+ * win32/win32.c (rb_w32_time_subtract): rename from subtract and
+ remove static.
- * io.c (MODE_BINMODE, MODE_BINARY): fixed reversed condition.
+Fri Apr 29 10:43:09 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu Oct 14 13:33:59 2004 Kouhei Sutou <kou@cozmixng.org>
+ * benchmark/bm_vm4_pipe.rb: Add two new benchmark for GVL
+ performance. They was written by Koichi Sasada.
+ * benchmark/bm_vm4_thread_pass.rb: ditto.
- * lib/rss/rss.rb: added link to Tutorial.
+Fri Apr 29 10:25:31 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Oct 11 13:48:20 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * vm_method.c (rb_clear_cache_by_class): Revert r29673. It made
+ a segmentation fault regression. [Bug #4289][ruby-core:34554].
- * ext/tk/lib/tk/*: untabify
+Fri Apr 29 10:24:51 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Oct 10 12:32:08 2004 Dave Thomas <dave@pragprog.com>
+ * io.c (make_writeconv): do not add textmode newline decorator if any
+ newline decorator is set already. fixes #4618, fixes #4619
- * lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Allow 'require'
- to be used as a variable name
+Fri Apr 29 10:17:42 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sat Oct 9 21:23:37 2004 Kouhei Sutou <kou@cozmixng.org>
+ * thread.c (lock_func): small cleanup.
- * lib/rss/converter.rb: changed to try to use Iconv for default
- conversion.
+Fri Apr 29 10:07:13 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/rss/rss.rb: 0.0.9 -> 0.1.0.
+ * thread.c (rb_mutex_lock, lock_func): Avoid busy loop and
+ performance regression. bm_vm3_thread_mutex.rb performance
+ change from 109.064sec to 16.331sec. [Feature #4607]
-Sat Oct 9 19:50:36 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread.c (init_lock_timeout): New helper function.
- * io.c (rb_io_getline): should not treat char as negative value.
- [ruby-dev:24460]
+Thu Apr 28 16:15:49 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Oct 8 09:49:32 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * win32/{win32.c,dir.h} (rb_w32_uopendir): new API to pass UTF-8 path.
- * pack.c (pack_pack): pointer modification check before each
- iteration. [ruby-dev:24445]
+ * win32/win32.c (opendir_internal, rb_w32_opendir): extract and merge
+ common part of rb_w32_opendir() and rb_w32_uopendir().
-Fri Oct 8 01:13:05 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * dir.c (do_opendir, glob_helper): encoding.
- * ext/tk/lib/tk/optiondb.rb: make it more secure
+ * dir.c (dir_initialize, do_opendir): convert path to UTF-8 and call
+ rb_w32_uopendir() instead of rb_w32_opendir() on Windows.
+ fixes #4491, reported by Joey Zhou.
-Thu Oct 7 23:47:57 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu Apr 28 15:32:53 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tk/lib/tk/scrollbar.rb: When 'set' operation, a scrollbar
- cannot propagate view port information from the source widget
- (that calls 'set') to other assigned widgets.
+ * test/dl/test_base.rb (DL::LIBC_SO): its always msvc*.dll on
+ mswin/mingw.
-Thu Oct 7 17:36:25 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu Apr 28 06:07:06 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/tk.rb: When CHILDKILLED and so on, Tk.errorCode returns
- a Fixnum for 2nd element (it's pid) of the return value.
+ * lib/csv.rb (CSV::open): suppress universal newline decorator.
+ fixes #4603
-Thu Oct 7 12:55:04 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/csv.rb (CSV.read): no mode is needed.
- * io.c (io_read): should freeze buffer before thread context
- switch. [ruby-dev:24442]
+Thu Apr 28 06:06:56 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * pack.c (pack_unpack): string conversion should at the top of the
- method. [ruby-dev:24439]
+ * io.c (rb_io_extract_modeenc, rb_f_backquote): set default text
+ mode. fixes #4619
- * io.c (io_read): buffer should be frozen only after the length
- check. [ruby-dev:24440]
+ * io.c (pipe_open): set universal newline decorator if needed.
-Thu Oct 7 02:56:43 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Apr 27 11:33:08 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/stringio/stringio.c: use FMODE_APPEND.
+ * enc/trans/emoji_iso2022_kddi.trans: ISO-2022-JP-KDDI doesn't have
+ CP932 UDA. Another reason is emacs-mule: the implementation of
+ stateless-iso-2022-jp doesn't support beyond 94x94 (0x7fxx);
+ but CP932 UDA is in 7Fxx-92xx.
-Thu Oct 7 01:05:33 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Wed Apr 27 07:42:44 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/tk.rb: add Tk.errorInfo and Tk.errorCode
+ * configure.in (STRIP): use proper toolchain. based on a patch
+ from Jon Forums at [ruby-core:35909]. fixes #4617
-Thu Oct 7 00:08:37 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Apr 27 01:20:59 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * io.c (rb_io_s_sysopen): preserve path in the buffer allocated by
- ALLOCA_N() to prevent modification. [ruby-dev:24438]
+ * ext/date/date_core.c (date_zone_to_diff): renamed.
+ * ext/date/date_parse.c: ditto.
+ * ext/date/date_strptime.c: ditto.
-Wed Oct 6 09:21:00 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Apr 27 01:16:59 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (rb_io_mode_flags): preserve append mode flag.
- [ruby-dev:24436]
+ * encoding.c (enc_find): accept Encoding objects.
- * io.c (rb_io_modenum_mode): do not use external output buffer.
+Wed Apr 27 00:55:56 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (rb_str_justify): differ pointer retrieval to prevent
- padding string modification. [ruby-dev:24434]
+ * transcode.c (econv_opts): add newline option.
- * range.c (range_each_func): allow func to terminate loop by
- returning RANGE_EACH_BREAK.
+ * io.c (validate_enc_binmode, rb_io_extract_modeenc): set newline
+ decorator according to open mode.
- * range.c (member_i): use RANGE_EACH_BREAK. [ruby-talk:114959]
+ * transcode.c (rb_econv_prepare_options): new function, to prepare
+ econv options with newline flags.
-Mon Oct 4 14:04:14 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * include/ruby/encoding.h (ECONV_NEWLINE_DECORATOR_MASK): add.
- * io.c (rb_file_open_internal, rb_io_reopen): fname might be altered
- while GC. [ruby-dev:24408]
+Wed Apr 27 00:51:01 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Oct 4 12:53:45 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * file.c (rb_file_truncate): fix function.
- * ext/tk/lib/tk/optiondb.rb: support definition of command
- resources on widgets
+ * include/ruby/win32.h (ftruncate, truncate, ftello, fseeko): non-64
+ versions on mingw are useless because they use int32_t. fixes #4564
- * ext/tk/lib/tk/image.rb: bug fix
+Wed Apr 27 00:50:33 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Sun Oct 3 21:20:03 2004 Shugo Maeda <shugo@ruby-lang.org>
+ * ext/date/date_core.c: modified validation methods.
+ * ext/date/lib/date.rb: ditto.
- * lib/net/imap.rb (TEXT_REGEXP): allow 8-bit characters for the german
- version of Microsoft Exchange Server. (backported from HEAD)
+Wed Apr 27 00:00:37 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/net/imap.rb (RTEXT_REGEXP): ditto.
+ * ext/date/date_core.c (dt_lite_set_tmx): should get df value.
- * lib/net/imap.rb (CTEXT_REGEXP): ditto.
+Tue Apr 26 22:34:04 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Sat Oct 2 20:34:22 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/date/lib/date/format.rb (_iso8601): allowed day only civil
+ date. disallowed separatorless day only ordinal date.
- * node.h (NEW_DVAR): extra semicolon.
+Mon Apr 25 21:31:36 2011 Nobuhiro Iwamatsu <iwamatsu@nigauri.org>
-Sat Oct 2 00:42:20 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/openssl/extconf.rb: Should check SSLv2_*method.
+ openssl compiled with "no-ssl2" the extconf don't fail
+ when running `make' having this compilation errors.
+ Patched by Laurent Arnoud. fixes #4562, #4556
- * marshal.c (r_byte): retrieve pointer from string value for each
- time. [ruby-dev:24404]
+Mon Apr 25 20:53:32 2011 Tajima, Akio <artonx@yahoo.co.jp>
- * marshal.c (r_bytes0): ditto.
+ * win32/win32.c (kill): accept 0 only sig is SIGINT #4596
- * enum.c (sort_by_i): re-entrance check added. [ruby-dev:24399]
+Mon Apr 25 19:59:47 2011 Tajima, Akio <artonx@yahoo.co.jp>
- * io.c (io_read): should freeze all reading buffer.
- [ruby-dev:24400]
+ * win32/win32.c (kill): accept 0 as pid, fixes #4596
- * string.c (rb_str_sum): should use bignums when bits is greater
- than or equals to sizeof(long)*CHAR_BITS. [ruby-dev:24395]
+Mon Apr 25 16:43:45 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * eval.c (specific_eval): defer pointer retrieval to prevent
- unsafe sourcefile string modification. [ruby-dev:24382]
+ * random.c (random_rand): remove unused variables.
- * eval.c (specific_eval): defer pointer retrieval to prevent
- unsafe sourcefile string modification. [ruby-dev:24382]
+ * struct.c (rb_struct_define_without_accessor): ditto.
- * string.c (rb_str_sum): wrong cast caused wrong result.
- [ruby-dev:24385]
+ * strftime.c (rb_strftime_with_timespec): ditto.
- * enum.c (enum_sort_by): hide temporary array from
- ObjectSpace.each_object. [ruby-dev:24386]
+ * sprintf.c: ditto.
- * string.c (rb_str_sum): check was done with false pointer.
- [ruby-dev:24383]
+ * time.c (time_asctime): remove useless GetTimeval().
- * string.c (rb_str_sum): string may be altered. [ruby-dev:24381]
+ * thread_pthread.c: cast to (void *) for %p.
-Mon Oct 11 17:51:34 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon Apr 25 11:02:11 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * io.c (rb_io_popen): get mode string via rb_io_flags_mode() to
- avoid mode string modification. [ruby-dev:24454]
+ * ext/ripper/lib/ripper/sexp.rb: fix rdoc around sexp.
+ patched by Sho Hashimoto. fixes #4599
- * io.c (rb_io_getline_fast): should take delim as unsigned char to
- distinguish EOF and '\377'. [ruby-dev:24460]
+Mon Apr 25 08:24:04 2011 Shota Fukumori <sorah@tubusu.net>
- * io.c (rb_io_getline): add check for RS modification.
- [ruby-dev:24461]
+ * random.c (rb_f_rand, random_s_rand): RDocs for them.
- * enum.c (enum_sort_by): use qsort() directly instead using
- rb_iterate(). [ruby-dev:24462]
+Mon Apr 25 07:18:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * enum.c (enum_each_with_index): remove rb_gc_force_recycle() to
- prevent access to recycled object (via continuation for
- example). [ruby-dev:24463]
+ * random.c (random_s_rand, Init_Random): Random.rand should behave as
+ Random::DEFAULT.rand rather than Kernel#rand.
-Fri Oct 1 11:40:14 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * random.c (rand_range, random_rand): rand_range function extracted
+ from random_rand function.
- * eval.c (rb_f_eval): defer pointer retrieval to prevent unsafe
- sourcefile string modification. [ruby-dev:24373]
+ * random.c (rb_f_rand): accept a Range argument as Random#rand
+ [ruby-dev:43427] #4605
- * io.c (io_read): block string buffer modification during
- rb_io_fread() by freezing it temporarily. [ruby-dev:24366]
+Mon Apr 25 03:31:06 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * io.c (rb_io_s_popen): mode argument may be altered.
- [ruby-dev:24375]
+ * lib/time.rb: require 'date'.
+ * ext/date/lib/date/format.rb: removed require line.
- * file.c (rb_file_s_basename): ext argument may be altered.
- [ruby-dev:24377]
+Mon Apr 25 03:08:39 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * enum.c (enum_sort_by): use NODE instead of 2 element arrays.
- [ruby-dev:24378]
+ * ext/date/lib/date/format.rb: require 'date'.
- * string.c (rb_str_chomp_bang): StringValue() may change the
- receiver. [ruby-dev:24371]
+Mon Apr 25 03:04:16 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Fri Oct 1 11:25:20 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/date/lib/date/format.rb (_iso8601): added a pattern.
- * ext/tk/lib/tk/grid.rb: revive TkGrid.grid
+Mon Apr 25 02:51:22 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/tk/pack.rb: revive TkPack.pack
+ * ext/date/lib/date/format.rb: require 'date_core.so'.
+ date/format needs methods which are now in date_core.so.
+ This breaks make rdoc which uses Date._parse from time.rb.
- * ext/tk/lib/tk/place.rb: revive TkPlace.place
+Mon Apr 25 02:47:46 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Thu Sep 30 00:50:44 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/date/lib/date/format.rb (_iso8601): fixed a bug of regex.
- * ext/tcltklib/tcltklib.c (ip_init): bug fix
+Mon Apr 25 02:12:26 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/tkutil.c (get_eval_string_core): accept a Regexp object
+ * ext/date/lib/date/format.rb: an adjustment of regex.
- * ext/tk/lib/multi-tk.rb: fix bug on 'exit' operation
+Mon Apr 25 01:58:50 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tk/lib/tk/text.rb: 'tksearch' accepts a Regexp object as a
- matting pattern argument
+ * ext/date/lib/date/format.rb: omitted to call _parse.
-Wed Sep 29 10:58:07 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Apr 25 01:03:03 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * enum.c (sort_by_i): internally used object must not be changed
- outside. [ruby-dev:24368]
+ * string.c (rb_to_id): remove unused variable.
-Mon Sep 27 13:46:45 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Apr 24 22:19:05 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * intern.h, struct.c (rb_struct_s_members, rb_struct_members): public
- accessors. [ruby-dev:24342]
+ * complex.c, rational.c: omitted some method calls.
- * marshal.c (w_object, r_object0): use accessors.
+Sun Apr 24 02:57:27 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Mon Sep 27 09:14:03 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/date/date_parse.c (n2i): takes long.
- * ext/socket/socket.c (s_accept): don't retry for EWOULDBLOCK.
- [ruby-talk:113807]
+Sun Apr 24 02:51:06 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Fri Sep 24 16:09:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/date/date_parse.c: reverted.
- * eval.c (proc_invoke): propagate DVAR_DONT_RECYCLE on termination
- to avoid double call to rb_gc_force_recycle(). [ruby-dev:24311]
+Sun Apr 24 02:25:23 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Sep 24 08:29:45 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * include/ruby/intern.h: pcc can't use __builtin_constant_p.
- * array.c (rb_ary_subseq): original object might be modified after
- sharing data creation. [ruby-dev:24327]
+ * vm_exec.c: change condition.
- * array.c (rb_ary_replace): ditto.
+Sun Apr 24 01:58:01 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * array.c (ary_make_shared): freeze shared array. [ruby-dev:24325]
+ * ext/date/date_core.c (leap_p): suppress warning: parentheses.
- * struct.c (struct_members): always check struct size and size of
- members list in the class. [ruby-dev:24320]
+ * ext/date/date_core.c (date_s__parse_internal): remove unused
+ variable "str".
-Thu Sep 23 09:29:14 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/date/date_parse.c (parse_ddd_cb): use RSTRING_LENINT.
- * string.c (rb_str_sub_bang): check if string is not modified
- during iteration. [ruby-dev:24315]
+ * ext/date/date_strftime.c (date_strftime_with_tmx): remove unused
+ variable.
- * hash.c (rb_hash_rehash): replace st_foreach() by its deep
- checking counterpart. [ruby-dev:24310]
+Sun Apr 24 00:34:23 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Wed Sep 22 13:38:12 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/date/date_parse.c: removed some unused macros. use strchr()
+ instead of index().
- * hash.c (rb_hash_rehash): add iteration check. [ruby-dev:24301]
+Sat Apr 23 21:29:42 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * st.c (st_foreach): add deep check.
+ * ext/date/date_core.c: replacement of implementation of
+ _parse. [experimental]
+ * ext/date/date_parse.c: new.
+ * ext/date/lib/date/format.rb: removed ruby version of _parse.
-Wed Sep 22 13:06:14 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Fri Apr 22 12:04:15 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * win32/win32.c (rb_w32_call_handler): workaround for Ctrl-C.
- merge from HEAD.
+ * array.c (rb_ary_sort_bang): fix rdoc.
+ patched by burningTyger. https://github.com/ruby/ruby/pull/11
-Wed Sep 22 00:11:12 2004 Dave Thomas <dave@pragprog.com>
+Fri Apr 22 11:49:49 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * process.c: Add documentation for fork()
+ * lib/xmlrpc/create.rb (XMLRPC::Create#conv2value):
+ XML-RPC's int is 32bit int, and Fixnum also may be beyond 32bit.
-Wed Sep 22 09:04:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/xmlrpc/create.rb (XMLRPC::Create#conv2value):
+ XML-RPC doesn't allow Infinity and NaN.
+ http://www.xmlrpc.com/spec
- * array.c (rb_ary_collect_bang): element size might change during
- comparison. [ruby-dev:24300]
+Fri Apr 22 04:16:14 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * array.c (rb_ary_reject_bang): ditto. [ruby-dev:24300]
+ * ext/psych/parser.c (parse): strings from psych have proper taint
+ markings.
- * array.c (rb_ary_eql): ditto. [ruby-dev:24300]
+ * test/psych/test_tainted.rb: test for string taint
-Tue Sep 21 18:29:49 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Apr 21 01:30:02 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * array.c (rb_ary_equal): merge miss.
+ * random.c (rb_f_srand): fix rdoc: srand(0)'s 0 is a seed.
+ [ruby-core:35833] fixes #4590
- * array.c (rb_ary_uniq_bang): element size might change during
- comparison. [ruby-dev:24298]
+Thu Apr 21 01:01:28 2011 Masaya Tarui <tarui@ruby-lang.org>
-Mon Sep 20 00:24:19 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * win32/win32.c (CreateChild): maximum length of lpCommandLine is
+ 32,768 characters, including the Unicode terminating null character.
- * enum.c (enum_sort_by): do not use qsort directly. use
- rb_ary_sort_bang() instead. [ruby-dev:24291]
+Wed Apr 20 21:32:11 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * enum.c (enum_sort_by): pedantic type check added.
- [ruby-dev:24291]
+ * ext/date/date_strptime.c (date__strptime_internal): do not
+ overwrite local variables.
- * hash.c (rb_hash_foreach_iter): check iter_lev after each
- iteration. [ruby-dev:24289]
+Wed Apr 20 14:41:28 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * array.c (rb_ary_and): element size might change during
- comparison. [ruby-dev:24290]
+ * string.c (rb_str_each_line): check string's length when compare
+ separator and string. [ruby-core:35815] fixes #4586
- * array.c (rb_ary_or): ditto. [ruby-dev:24292]
+Wed Apr 20 00:02:13 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * array.c (rb_ary_equal): wrong fix. [ruby-dev:24286]
+ * misc/ruby-mode.el (ruby-parse-partial): use position of open paren.
-Sat Sep 18 15:02:22 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Apr 19 01:00:21 2011 Tajima Akio <artonx@yahoo.co.jp>
- * array.c (rb_ary_equal): element size might change during
- comparison. [ruby-dev:24254]
+ * test/ruby/test_io.rb (TestIO#test_cross_thread_close_fd):
+ skip cross thread pipe close if windows
- * array.c (rb_ary_diff): ditto. [ruby-dev:24274]
+Mon Apr 18 12:15:46 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * array.c (rb_ary_select): ditto. [ruby-dev:24278]
+ * test/ruby/test_range.rb (TestRange#test_step_ruby_core_35753):
+ avoid float error. [ruby-core:35804]
- * array.c (rb_ary_delete): ditto. [ruby-dev:24283]
+Sun Apr 17 00:20:14 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * array.c (rb_ary_rindex): ditto. [ruby-dev:24275]
+ * ext/date/date_{core,strftime}.c: use struct tmx instead of vtm.
+ * ext/date/date_tmx.h: new.
- * array.c (rb_ary_initialize): element size might change during
- initializing block. [ruby-dev:24284]
+Sat Apr 16 22:23:52 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Sat Sep 18 14:10:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/date/date_strftime.c (date_strftime_wo_timespec): changed
+ the way of validation of locale modifiers.
- * dir.c (dir_s_chdir): avoid memory leak and unnecessary chdir to
- the original directory when exception has caused in changing
- direcotry or within block. thanks to Johan Holmberg
- <holmberg@iar.se> [ruby-core:03446]
+Sat Apr 16 21:55:12 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Fri Sep 17 20:20:27 2004 Minero Aoki <aamine@loveruby.net>
+ * ext/date/date_core.c: replacement of implementation of
+ _strptime. [experimental]
+ * ext/date/date_strptime.c: new.
+ * ext/date/lib/date/format.rb: removed ruby version of _strptime.
- * lib/fileutils.rb (mkdir_p): backport from CVS HEAD 1.45. [ruby-core:03420]
+Sat Apr 16 10:18:30 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Fri Sep 17 17:11:08 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * vm.c (Init_VM): suppress warning: "OPT_BASIC_OPERATIONS" is not
+ defined.
- * array.c (rb_ary_delete): element comparison might change array
- size. [ruby-dev:24273]
+Fri Apr 15 23:41:18 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * file.c (rb_file_truncate): clear stdio buffer before truncating
- the file. [ruby-dev:24191]
+ * ruby.c (proc_options): suppress warning:
+ "ALLOW_DEFAULT_SOURCE_ENCODING" is not defined.
- * ext/digest/digest.c: use rb_obj_class() instead of CLASS_OF
- which might return singleton class. [ruby-dev:24202]
+Fri Apr 15 15:10:29 2011 Akinori MUSHA <knu@iDaemons.org>
-Fri Sep 17 16:07:09 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/uri/generic.rb (#route_from_path): Fix a bug where
+ URI('http://h/b/').route_to('http://h/b') wrongly returned './'
+ (should be '../b'). [Bug #4476]
- * ext/tk/lib/multi-tk.rb: improve exit operation
+Fri Apr 15 14:58:06 2011 Akinori MUSHA <knu@iDaemons.org>
-Fri Sep 17 15:01:57 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/fileutils.rb (FileUtils#touch): Fix corrupted output when
+ mtime is specified in addition to nocreate (and verbose).
+ ref [ruby-dev:43401]
- * ext/tcltklib/tcltklib.c: fix SEGV when (thread_)vwait or
- (thread_)tkwait
+Thu Apr 14 23:43:43 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tk/lib/tk.rb: add alias wait_window to wait_destroy
+ * numeric.c (ruby_float_step): wrong loop condition.
+ fixes [ruby-core:35753], reported by Joey Zhou.
- * ext/tk/lib/multi-tk.rb: support calling 'mainloop' on slave
- interpreters (however, the 'real' eventloop must be run on the
- Default Master IP)
+ * test/ruby/test_range.rb (TestRange#test_step_ruby_core_35753):
+ test above change.
- * ext/tk/lib/remote-tk.rb: follow the changes of ext/tk/lib/multi-tk.rb
+Thu Apr 14 22:48:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/sample/remote-ip_sample2.rb: ditto
+ * lib/test/unit.rb (Test::Unit::Options#setup_options): set possible
+ values for completion. no conversion is needed.
- * ext/tk/sample/tkoptdb-safeTk.rb: ditto
+ * lib/test/unit.rb (Test::Unit::Runner::Worker#initialize): use
+ positional arguments instead of keyword arguments.
-Thu Sep 16 18:12:32 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * lib/test/unit.rb (Test::Unit::Runner#jobs_status): io/console may
+ not be available. use 80 as the last resort if IO#winsize and
+ COLUMNS are unavailable.
- * lib/webrick/cgi.rb (WEBrick::CGI#start): should set REMOTE_USER
- to request.user attribute.
+ * lib/test/unit.rb (Test::Unit::Runner::Worker#died): rename using a
+ verb.
- * lib/webrick/httpservlet/filehandler.rb
- (WEBrick::HTTPServlet::FileHandler#initialize): should expand
- the pathname of document root directory.
+ * lib/test/unit.rb (Test::Unit::Runner#_run_parallel): check if worker
+ is signaled and use its exit status.
-Thu Sep 16 15:49:28 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/test/unit.rb (Test::Unit::Runner::Worker#dead): no longer @in
+ and @out are separated.
- * string.c (rb_str_intern): protect string argument from GC.
- [ruby-core:03411]
+Thu Apr 14 21:23:29 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Sep 15 20:22:23 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * variable.c (rb_autoload_p): search superclasses as same as actual
+ loading. fixes [ruby-core:35679]
- * ext/tk/sample/tkoptdb-safeTk.rb: fix a bug depend on the changes
- of MultiTkIp
+Thu Apr 14 21:21:06 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Sep 14 23:54:11 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * include/ruby/win32.h (frexp, modf): wrongly declared as pure in
+ mingw math.h.
- * ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string was en-bugged by
- the previous changes.
+ * include/ruby/win32.h (ftruncate, truncate): mingw64 misses
+ prototypes.
-Tue Sep 14 23:45:44 2004 Dave Thomas <dave@pragprog.com>
+ * win32/win32.c (rb_w32_read): suppress warning.
- * lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::TextFormatter.for):
- Add Eric Hodel's simpleformatter.
+Thu Apr 14 19:55:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Sep 14 16:59:37 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/fileutils.rb (FileUtils#touch): fix corrupted output when
+ FileUtils.touch(:nocreate => true, :verbose => true) case.
+ The patch was written by Hiroyuki Iwatsuki. [ruby-dev:43401]
- * ext/tcltklib/tcltklib.c: fix SEGV
+Thu Apr 14 16:01:45 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * ext/tk/lib/multi-tk.rb: improve safe-level handling of argument proc
+ * io.c (rb_f_syscall): suppress warning: "HAVE___SYSCALL" is not
+ defined.
- * ext/tk/sample/multi-ip_sample.rb: rename of old 'safe-tk.rb'
+Thu Apr 14 00:41:09 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * ext/tk/sample/safe-tk.rb: new sample script
+ * thread.c (thread_fd_close_i): IOError exception should be assigned
+ to rb_thread_t::thrown_errinfo.
-Tue Sep 14 00:15:15 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Wed Apr 13 20:12:26 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * ext/zlib/zlib.c: backported from HEAD.
+ * io.c (rb_io_fdatasync): remove unused variable.
-Mon Sep 13 19:16:33 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Tue Apr 12 20:54:12 2011 Tanaka Akira <akr@fsij.org>
- * eval.c (blk_copy_prev): need frame_dup(). [ruby-dev:24103]
+ * include/ruby/st.h: parenthesize macro arguments.
-Mon Sep 13 16:23:27 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Apr 12 19:19:50 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/multi-tk.rb: MultiTkIp.new_master and new_slave accept
- safe-level value argument
+ * lib/uri/common.rb: avoid race condition. fixes #4572
-Mon Sep 13 10:20:45 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Apr 12 18:07:13 2011 TAKAO Kouji <kouji@takao7.net>
- * object.c (nil_inspect): fix typo.
+ * ext/readline/extconf.rb: --disable-libedit to disable
+ libedit. fixes #4550
-Mon Sep 13 01:03:02 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Apr 12 10:37:39 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tcltklib/tcltklib.c: improve control of preserv/release tcltkip
+ * include/ruby/win32.h: VC doesn't have ftruncate() and others, but
+ ruby needs HAVE_ macros to use our emulation functions.
+ (fix the problem of 31262)
- * ext/tcltklib/tcltklib.c: store original 'exit' command
+Tue Apr 12 01:33:00 2011 Luis Lavena <luislavena@gmail.com>
- * ext/tk/tkutil.c: fix(?) SEGV
+ * configure.in: properly evaluate existence of truncate, ftruncate
+ and ftello for MinGW. [ruby-core:35678]
+ * win32/win32.c: rename truncate, ftruncate and ftello to avoid
+ redefinitions.
+ * win32/win32.h: ditto.
-Sun Sep 12 23:46:23 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Mon Apr 11 21:51:52 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * util.c (ruby_strdup): remove unnecessary code. (xmalloc never
- returns NULL.)
+ * io.c: revert r31230. Because it made a regression.
+ [ruby-core:35631]
- * util.c (ruby_getcwd): fix memory leak on failure.
+Mon Apr 11 21:49:18 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun Sep 12 02:41:58 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/ruby/test_io.rb: Added TestIO#test_cross_thread_close_stdio
+ and TestIO#test_cross_thread_close_fd.
+ The patch was written by Eric Wong. [ruby-core:35669]
- * ext/tcltklib/tcltklib.c: add TclTkIp#allow_ruby_exit? and
- allow_ruby_exit=
+Mon Apr 11 21:15:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * file.c (rb_group_member): kill 256K of stack usage.
+ the patch was written by Eric Wong. [ruby-core:35699]
- * ext/tk/lib/multi-tk.rb: ditto.
+Mon Apr 11 07:24:13 2011 Eric Hodel <drbrain@segment7.net>
- * ext/tk/lib/remote-tk.rb: ditto.
+ * ext/openssl/ossl.c: Fix typo, document version constants.
- * ext/tcltklib/MANUAL.euc: ditto.
+Sun Apr 10 22:23:45 2011 Tanaka Akira <akr@fsij.org>
- * ext/tcltklib/MANUAL.eng: ditto.
+ * include/ruby/ruby.h: parenthesize macro arguments.
- * ext/tcltklib/tcltklib.c: fix some reasons of SEGV
+Sat Apr 9 23:31:47 2011 Shota Fukumori <sorah@tubusu.net>
- * ext/tk/tkutil.c: ditto.
+ * ext/stringio/stringio.c (strio_each, strio_readlines):
+ Use `NUM2LONG` instead of `FIX2INT`. Fixes [ruby-dev:43395].
- * ext/tk/lib/multi-tk.rb: ditto.
+Sat Apr 9 23:22:27 2011 Shota Fukumori <sorah@tubusu.net>
- * ext/tk/lib/tk/timer.rb: ditto.
+ * ext/stringio/stringio.c (strio_each):
+ Fix exception message and don't raise immediately if block is not
+ given.
+ Fixes [ruby-dev:43394].
-Sat Sep 11 16:09:46 2004 Dave Thomas <dave@pragprog.com>
+ * test/stringio/test_stringio.rb (test_each_line_limit_0):
+ Fix test for above.
- * lib/rdoc/parsers/parse_rb.rb: Fix up cross-file class merging.
+Sat Apr 9 21:54:15 2011 Shota Fukumori <sorah@tubusu.net>
-Fri Sep 10 20:20:53 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * ext/stringio/stringio.c (strio_each, strio_readlines):
+ limit must not be zero. Fixes [ruby-dev:43392].
- * ext/tcltklib/tcltklib.c (lib_merge_tklist): fix suspicious
- pointer conversion.
+ * test/stringio/test_stringio.rb: Add tests for above.
-Fri Sep 10 02:43:54 2004 Dave Thomas <dave@pragprog.com>
+Sat Apr 9 18:01:36 2011 Tanaka Akira <akr@fsij.org>
- * lib/rdoc/generators/template/kilmer.rb: James Buck's
- patch for call-seq.
+ * include/ruby/util.h: parenthesize macro arguments.
-Thu Sep 9 13:58:56 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Fri Apr 8 16:01:56 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tcltklib/tcltklib.c (ip_init): change flag value for setting
- 'argv' and 'argv0' variable
+ * ext/stringio/stringio.c (strio_getline): check whether str is
+ a string when str and lim are given.
+ https://twitter.com/watson1978/status/56225052152168449
- * ext/tk/lib/remote-tk.rb: follow changes of multi-tk.rb
+Thu Apr 7 20:03:52 2011 Tanaka Akira <akr@fsij.org>
-Thu Sep 9 11:46:18 2004 Dave Thomas <dave@pragprog.com>
+ * include/ruby/io.h: parenthesize macro arguments.
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_classes): Allow
- spaces aroun parameter to define_method_under (James Buck)
+Wed Apr 6 21:08:31 2011 Tanaka Akira <akr@fsij.org>
-Wed Sep 8 18:44:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * include/ruby/intern.h: parenthesize macro arguments.
- * ext/stringio/stringio.c (strio_write): zero fill a gap if exsts.
- [ruby-dev:24190]
+Wed Apr 6 15:12:40 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Sep 8 15:19:49 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/openssl/ossl_pkey_dh.c (ossl_dh_initialize):
+ pop pushed error after each try of reading. fixes #4550
- * ext/tcltklib/tcltklib.c (ip_init): cannot create a IP at level 4
+ * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
- * ext/tk/lib/multi-tk.rb: improve 'exit' operation, security check,
- and error treatment
+ * ext/openssl/ossl_pkey_ec.c (ossl_ec_initialize): ditto.
- * ext/tk/lib/multi-tk.rb: allow a trusted slave IP to create slave IPs
+Wed Apr 6 11:36:44 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/tk/listbox.rb: add TkListbox#value, value=, clear, and
- erase
+ * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize):
+ pop pushed error after each try of reading. fixes #4550
- * ext/tk/lib/tk/text.rb: add TkText#clear and erase
+Tue Apr 5 20:33:43 2011 Tanaka Akira <akr@fsij.org>
-Tue Sep 7 15:17:49 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * include/ruby/encoding.h: parenthesize macro arguments.
- * ext/socket/socket.c (ruby_connect): break immediately if a
- socket is non-blocking. [ruby-talk:111654]
+Mon Apr 4 22:02:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Sep 6 11:08:50 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * ext/io/nonblock/nonblock.c (io_nonblock_set): Avoid F_SETFL if
+ we're not changing the O_NONBLOCK bit. F_SETFL is an expensive
+ operation since it needs to affect all processes with the same
+ file object.
+ The patch is written by Eric Wong. [ruby-core:35556]
- * ext/tk/lib/tk/menu.rb(TkOptionMenubutton#insert): call correct method
+Mon Apr 4 21:41:26 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Sep 6 11:00:47 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * io.c (rb_io_syswrite): While local FS writes are usually
+ buffered, the buffers can be full or the file opened with
+ O_SYNC. IO#syswrite can also be used on blocking IOs
+ (pipe/socket) just like IO#write.
+ The patch is written by Eric Wong. [ruby-core:35554]
- * dir.c (dir_s_chdir): the patch to shut up false warning when
- exception occurred within a block. a patch was given from Johan
- Holmberg <holmberg at iar.se>. [ruby-core:03292]
+Mon Apr 4 11:50:40 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Sep 6 07:51:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/test_tempfile.rb: simply ignore platform dependent testcases
+ instead of skipping.
- * eval.c (cvar_cbase): singletons should refer outer cvar scope.
- [ruby-dev:24223]
+Sun Apr 3 22:52:22 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * eval.c (rb_load): should preserve previous ruby_wrapper value.
- [ruby-dev:24226]
+ * ext/syslog/syslog.c: improve rdoc.
+ a patch by Jonas Pfenniger. [ruby-core:35592] fixes #4545
-Sat Sep 4 01:14:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sun Apr 3 22:10:09 2011 Tanaka Akira <akr@fsij.org>
- * eval.c (cvar_cbase): class variables cause SEGV in
- instance_eval() for fixnums and symbols. [ruby-dev:24213]
+ * ext/zlib/zlib.c: parenthesize macro arguments.
-Fri Sep 3 17:47:58 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sun Apr 3 21:33:58 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * struct.c (make_struct): remove redefining constant when
- conflict. [ruby-dev:24210]
+ * configure.in: disable fdatasync again on Mac OS X.
+ [ruby-core:35493][Bug #4500]
-Fri Sep 3 11:31:44 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sun Apr 3 21:16:20 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/tk/lib/tk.rb: Tk.after makes TkCore::INTERP.tk_cmd_tbl grow
- [ruby-dev:24207]
+ * io.c (io_reopen): IO#close releases GVL if possible.
+ close() may block for certain file types (NFS, SO_LINGER
+ sockets, inotify), so let other threads run. The patch was
+ created by Eric Wong [ruby-core:35555][Bug #4527]
-Fri Sep 3 02:12:48 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * io.c (fptr_finalize): ditto.
- * ext/tcltklib/tcltklib.c: fix typo [ruby-talk:111266]
+ * io.c (maygvl_fclose): new.
+ * io.c (nogvl_fclose): ditto.
+ * io.c (maygvl_close): ditto.
+ * io.c (nogvl_close): ditto.
- * ext/tk/lib/tk/text.rb: fix typo
+Fri Apr 1 22:25:50 2011 Tanaka Akira <akr@fsij.org>
- * ext/tk/lib/multi-tk.rb: improve safe-level treatment on slave IPs
+ * ext/syslog/syslog.c: parenthesize macro arguments.
-Fri Sep 3 01:54:20 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Apr 1 18:53:06 2011 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/extmk.rb: already built-in libraries satisfy dependencies.
- [ruby-dev:24028]
+ * lib/webrick/cookie.rb (WEBrick::Cookie.parse): 'white space is
+ permitted between tokens' according to RFC2965. Though 'Netscape
+ spec' does not define the syntax clearly, make it tolerant as a
+ server. As a real-world example, rest-client gem sends
+ 'Cookie: foo=1;bar=2'
-Thu Sep 2 11:36:20 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+ * test/webrick/test_cookie.rb (test_parse_non_whitespace): test it.
- * eval.c (rb_obj_instance_eval): backported from HEAD.
+Fri Apr 1 13:19:20 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Sep 1 21:18:25 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * vm_core.h (RUBY_VM_CHECK_INTS_TH): merge a patch by ko1
+ in [ruby-dev:43373].
- * ext/tk/lib/tk/spinbox.rb: fix typo
+Thu Mar 31 23:15:46 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Aug 31 18:24:04 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * misc/ruby-mode.el (ruby-brace-to-do-end, ruby-do-end-to-brace):
+ adjust space between block beginning and block arguments
- * ext/tk/tkutil.c (cbsubst_init): fix memory leak
+Thu Mar 31 20:42:05 2011 Tanaka Akira <akr@fsij.org>
- * ext/tk/tkutil.c (cbsubst_get_all_subst_keys): fix SEGV
+ * ext/strscan/strscan.c: parenthesize macro arguments.
-Tue Aug 31 16:04:22 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu Mar 31 18:06:12 2011 Shugo Maeda <shugo@ruby-lang.org>
- * ext/tcltklib/tcltklib.c (ip_delete): when a tcltkip is deleted,
- destroy its root widget
+ * vm_insnhelper.c (vm_get_ev_const): should ignore crefs with
+ the NODE_FL_CREF_PUSHED_BY_EVAL flag.
-Tue Aug 31 12:30:36 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu Mar 31 16:49:56 2011 Shugo Maeda <shugo@ruby-lang.org>
- * ext/tcltklib/tcltklib.c (del_root): fix SEGV
+ * vm_insnhelper.c (vm_get_ev_const): search root cref properly.
+ [ruby-dev:43365]
-Mon Aug 30 23:11:06 2004 Dave Thomas <dave@pragprog.com>
+Thu Mar 31 14:50:25 2011 Shugo Maeda <shugo@ruby-lang.org>
- * lib/rdoc/ri/ri_driver.rb (and others): ri now merges documentation
- if it finds the same class in multiple places.
+ * eval.c (rb_mod_s_constants): should ignore crefs with
+ the NODE_FL_CREF_PUSHED_BY_EVAL flag.
-Mon Aug 30 22:40:30 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Wed Mar 30 22:55:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/multi-tk.rb: 'restart' method accepts arguments
+ * misc/ruby-mode.el (ruby-toggle-block): toggle do/end and {}.
-Mon Aug 30 21:50:14 2004 Dave Thomas <dave@pragprog.com>
+ * misc/ruby-mode.el (ruby-move-to-block): move to opening of
+ block.
- * object.c: Add RDoc for Module.included.
+Wed Mar 30 14:35:15 2011 Shugo Maeda <shugo@ruby-lang.org>
-Mon Aug 30 15:10:46 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+ * vm_insnhelper.h (COPY_CREF): should copy
+ the NODE_FL_CREF_PUSHED_BY_EVAL flag to hide constants from
+ methods defined by class_eval. [ruby-dev:43365]
- * configure.in (GNU/k*BSD): fixed FTBFS on GNU/k*BSD. [ruby-dev:24051]
+Wed Mar 30 00:24:53 2011 Tanaka Akira <akr@fsij.org>
-Mon Aug 30 11:29:35 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/stringio/stringio.c: parenthesize macro arguments.
- * win32/win32.c (CreateChild): strip trailing spaces. [ruby-dev:24143]
- merge from HEAD.
+Tue Mar 29 21:51:31 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Sun Aug 29 14:08:56 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * object.c (rb_String): Kernel#String should call to_str before to_s.
- * ext/tcltklib/tcltklib.c: compile error on bcc32 [ruby-dev:24081]
+Tue Mar 29 10:28:08 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string does not work
+ * test/webrick/test_filehandler.rb
+ (WEBrick::TestFileHandler#test_short_filename): the cgi doesn't exist
+ on current directory.
-Sat Aug 28 23:04:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Mar 29 05:19:57 2011 Tanaka Akira <akr@fsij.org>
- * bignum.c (rb_big_and): protect parameters from GC.
- [ruby-talk:110664]
+ * ext/socket/raddrinfo.c: parenthesize macro arguments.
-Thu Aug 26 04:38:29 2004 Dave Thomas <dave@pragprog.com>
+Tue Mar 29 00:03:51 2011 Tajima Akio <artonx@yahoo.co.jp>
- * eval.c (return_jump): Minor typo in error message. Now reads
- "return can't jump across threads".
+ * test/webrick/test_filehandler.rb (test_short_filename):
+ read real short filename by cmd because smb mounted files
+ have different naming convention.
-Tue Aug 24 17:30:00 2004 Shugo Maeda <shugo@ruby-lang.org>
+Mon Mar 28 11:38:08 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/cgi/session.rb (CGI::Session::FileStore#initialize): do not
- use a session id as a filename. (backported from HEAD)
+ * ext/date/date_core.c (date_s_today): use int for year.
- * lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): ditto.
+ * ext/date/date_core.c (datetime_s_now): ditto.
- * lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): use
- Dir::tmpdir. (backported from HEAD)
+Mon Mar 28 11:07:41 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Aug 24 14:40:16 2004 Shugo Maeda <shugo@ruby-lang.org>
+ * ext/extmk.rb: set MFLAGS from MAKEFLAGS when using nmake.
- * lib/cgi/session.rb (CGI::Session::FileStore#initialize): untaint
- session id after check. (backported from HEAD)
+Mon Mar 28 11:07:00 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Aug 24 09:09:01 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * common.mk (love): all you need is love.
- * ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): d2i
- functions may replace the pointer indicated by the first argument.
+Sun Mar 27 23:16:31 2011 Tanaka Akira <akr@fsij.org>
- * ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
+ * ext/socket/ipsocket.c: parenthesize macro arguments.
- * ext/openssl/ossl_x509name.c (ossl_x509name_initialize): ditto.
+Sun Mar 27 16:55:34 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Aug 23 14:04:51 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * misc/ruby-mode.el (ruby-mode-map): remove unnecessary
+ binding. fixes
+ http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=468952
- * ext/openssl/ossl_ssl.c (ossl_ssl_read):
- - should return an empty string if specified length to read is 0.
- - should check for pending data and wait for fd before reading.
- - call underlying IO's sysread if SSL session is not started.
- [ruby-dev:24072], [ruby-dev:24075]
+ * misc/ruby-mode.el: suppress warnings at byte compile. fixes
+ http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=502926
- * ext/openssl/ossl_ssl.c (ossl_ssl_write):
- - call underlying IO's syswrite if SSL session is not started.
+Sun Mar 27 11:18:35 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/openssl/ossl_ssl.c (ossl_ssl_pending): new method
- OpenSSL::SSL#pending.
+ * ext/date/date_core.c: removed unused variables.
- * ext/openssl/lib/openssl/buffering.rb: should not use select.
+Sat Mar 26 15:16:09 2011 Tanaka Akira <akr@fsij.org>
-Mon Aug 23 12:40:56 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/socket/getaddrinfo.c: parenthesize macro arguments.
- * lib/resolv.rb (Config.default_config_hash): when multiple domains
- are set, Win32::Resolv.get_resolv_info returns Array.
+Sat Mar 26 05:27:34 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Sun Aug 22 01:15:31 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/date/lib/date/format.rb (DateTime#strftime): removed because
+ date_core defines it.
- * lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_connect):
- should call :ProxyContentHandler before finishing CONNECT.
+Fri Mar 25 21:59:45 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Sat Aug 21 06:41:16 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/date/date_core.c: should not force cast with macros.
- * ext/tcltklib/extconf.rb (find_tcl, find_tk): find stub library.
+Fri Mar 25 21:56:10 2011 Tanaka Akira <akr@fsij.org>
- * lib/mkmf.rb (arg_config, with_config): deal with '-' and '_'
- uniformly. [ruby-dev:24118]
+ * ext/sdbm/init.c: parenthesize macro arguments.
-Thu Aug 19 16:29:45 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Fri Mar 25 19:39:40 2011 Ben Walton <bwalton@artsci.utoronto.ca>
- * ext/tk/lib/tk.rb: Fail to treat a hash value of 'font' option.
+ * test/test_syslog.rb:
+ Skip syslog tests that rely on LOG_PERROR unless it's defined
- * ext/tk/lib/tk.rb: bindinfo cannot return '%' substiturion infomation.
+ Instead of checking looking at the platform to determine if the tests
+ relying on LOG_PERROR should be run, look for the definition of the
+ constant as this will be robust against all platforms as long as the
+ underlying syslog.c code sets it up correctly.
- * ext/tk/lib/menu.rb: typo bug.
+ This specifically addresses failures on Solaris 9.
-Thu Aug 19 15:15:24 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ Use LOG_PID instead of LOG_PERROR in Syslog.open test
- * dir.c (free_dir): fix memory leak. reported by yamamoto
- madoka.
+ LOG_PERROR isn't a POSIX option for syslog, so it fails on platforms
+ that don't define it. Solaris 9 and 10 are examples of this.
-Thu Aug 19 11:00:00 2004 Akiyoshi, Masamichi <masamichi.akiyoshi@hp.com>
+ Use LOG_PID instead.
- * dln.c (dln_load): Modify to call lib$find_image_symbol for VMS.
- * io.c (rb_io_fwrite): Use fputc() for VMS non-stream file.
+Fri Mar 25 15:42:17 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Aug 19 06:07:45 2004 why the lucky stiff <why@ruby-lang.org>
+ * ext/sdbm/_sdbm.c (sdbm_open): use size_t.
- * ext/syck/token.c: re2c no longer compiled with bit vectors. caused
- problems for non-ascii characters. [ruby-core:03280]
- * ext/syck/implicit.c: ditto.
* ext/syck/bytecode.c: ditto.
- * lib/yaml/baseemitter.rb: folding now handles double-quoted strings,
- fixed problem with extra line feeds at end of folding, whitespace
- opening scalar blocks.
-
- * lib/yaml/rubytypes.rb: subtelties in handling strings with
- non-printable characters and odd whitespace patterns.
-
-Wed Aug 18 23:41:33 2004 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/protocol.rb (rbuf_fill): OpenSSL::SSL::SSLSocket has its own
- buffer, select(2) might not work. [ruby-dev:24072]
-
-Wed Aug 18 17:10:12 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/tcltklib/stubs.c (ruby_tcltk_stubs): need to call
- Tcl_FindExecutable() for Tcl/Tk 8.4.
-
-Wed Aug 18 12:52:55 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_obj_instance_eval): evaluates under special singleton
- classes as for special constants.
-
-Tue Aug 17 17:20:59 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_io_reopen): should clear allocated OpenFile. pointed
- out by Guy Decoux. [ruby-core:03288]
-
-Tue Aug 17 01:36:32 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/usage.rb: Remove extra indent. Tidy 'ri' option
- parsing so RDoc::usage plays better with OptionParser.
-
-Sat Aug 14 13:09:10 2004 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb: backport from CVS HEAD (rev1.44).
-
- * lib/fileutils.rb: cp_r should copy symlink itself, except cp_r
- root.
-
- * lib/fileutils.rb: new option mv :force.
-
- * lib/fileutils.rb: new module FileUtils::DryRun.
-
-Sat Aug 14 02:48:16 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/usage.rb: Added. Allows command line programs
- to report usage using their initial RDoc comment.
-
-Fri Aug 13 13:23:17 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_range_header):
- fix regex for range-spec.
-
- * lib/webrick/httpservlet/filehandler.rb
- (WEBrick::HTTPServlet::DefaultFileHandler#make_partial_content):
- multipart/byteranges response was broken.
-
- * lib/webrick/httpservlet/erbhandler.rb
- (WEBrick::HTTPServlet::ERBHandler#do_GET): should select media type
- by suffix of script filename.
-
- * lib/xmlrpc/server.rb: refine example code.
-
-Wed Aug 11 17:17:50 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in (RPATHFLAG): stop setting RPATHFLAG on Interix.
-
-Sun Aug 8 00:43:31 2004 why the lucky stiff <why@ruby-lang.org>
-
- * lib/implicit.c: added sexagecimal float#base60.
-
- * ext/syck/rubyext.c (yaml_org_handler): ditto.
-
- * lib/token.c: indentation absolutely ignored when processing flow
- collections. plain scalars are trimmed if indentation follows in
- an ambiguous flow collection.
-
-Sat Aug 7 00:50:01 2004 Tanaka Akira <akr@m17n.org>
-
- * ext/zlib/zlib.c: Zlib::GzipReader#read(0) returns "" instead of nil.
-
-Tue Aug 3 13:49:20 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/namespace.rb: bug fix
-
- * ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: add Tk::TreeCtrl.loupe
+ * ext/sdbm/_sdbm.c (delpair): use ptrdiff_t.
-Mon Aug 2 18:04:21 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/sdbm/init.c: use RSTRING_LENINT.
- * ext/tk/lib/tk/msgcat.rb (set_translation): bug fix (fail to set
- trans_str to the same as src_str when trans_str is not given.)
+ * ext/dl/handle.c: suppress warning: shorten-64-to-32.
-Mon Aug 2 11:53:06 2004 Dave Thomas <dave@pragprog.com>
+ * ext/strscan/strscan.c: ditto.
- * lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): Fix infinite recursion
- looking up some top level symbols (batsman)
+ * ext/syck/emitter.c: ditto.
-Mon Aug 2 11:48:29 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Allow '.'s in
- variable names to support SWIG generated files (Hans Fugal)
-
-Sat Jul 31 17:40:16 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-expr-beg, ruby-parse-partial,
- ruby-calculate-indent, ruby-move-to-block, ruby-forward-sexp,
- ruby-backward-sexp): keywords must match word-wise.
-
-Sat Jul 31 05:47:37 2004 why the lucky stiff <why@ruby-lang.org>
-
- * lib/yaml.rb (YAML::load_file, YAML::parse_file): added.
-
- * lib/yaml/rubytypes.rb: exceptions were using an older
- YAML.object_maker. [ruby-core:03080]
-
- * ext/syck/token.c (sycklex_yaml_utf8): using newline_len to
- handline CR-LFs. "\000" was showing up on folded blocks which
- stopped at EOF.
-
- * ext/syck/token.c: re2c compiled with bit vectors now.
* ext/syck/implicit.c: ditto.
- * ext/syck/bytecode.c: ditto.
-
-Fri Jul 30 16:10:54 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (lib_fromUTF8_core): raise ArgumentError when
- the unknown encoding name is given.
-
- * ext/tcltklib/tcltklib.c (lib_toUTF8_core): ditto.
-
- * ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertfrom): bug fix.
-
- * ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertto): ditto.
-
-Wed Jul 28 18:59:17 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi.rb (CGI::initialize): remove at_exit code for CGI_PARAMS
- and CGI_COOKIES. they will no longer be used.
-
-Wed Jul 28 01:04:44 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (run_final): wrong order of data. [ruby-dev:23984]
-
-Tue Jul 27 07:05:04 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_eval): copy on write for argument local variable
- assignment.
-
- * eval.c (assign): ditto.
-
- * eval.c (rb_call0): update ruby_frame->argv with the default
- value used for the optional arguments.
-
- * object.c (Init_Object): "===" calls rb_obj_equal() directly.
- [ruby-list:39937]
-
-Mon Jul 26 11:22:55 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils.escape): should
- escape space.
-
-Sun Jul 25 11:05:21 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.{h,c} (rb_w32_{f,fd,fs}open): workaround for bcc32's
- {f,fd,fs}open bug. set errno EMFILE and EBADF. [ruby-dev:23963]
-
-Sat Jul 24 13:32:47 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * range.c (rb_range_beg_len): returns Qnil only when "beg" points
- outside of a range. No boundary check for "end".
-
-Fri Jul 23 16:40:25 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (define_final): should not disclose NODE* to Ruby world.
- [ruby-dev:23957]
-
-Fri Jul 23 09:03:16 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (disconnected?): new method. (backported from HEAD)
-
-Thu Jul 22 16:41:54 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi/session.rb (CGI::Session::FileStore#update): sets the
- permission of the session data file to 0600.
-
- * lib/cgi/session/pstore.rb (CGI::Session::Pstore#initialize):
- ditto.
-
-Thu Jul 22 00:02:21 2004 Masahiro Kitajima <katonbo@katontech.com>
-
- * process.c (rb_f_system): not need to call last_status_set() any
- longer on _WIN32.
-
-Tue Jul 20 09:15:17 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * test/fileutils/test_fileutils.rb: File.link raises EINVAL on BeOS.
-
-Mon Jul 19 01:15:07 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpservlet/cgihandler.rb
- (WEBrick::HTTPServlet::CGIhandler#do_GET): set SystemRoot environment
- variable to CGI process on Windows native platforms. [ruby-dev:23936]
-
- * lib/webrick/httpservlet/cgihandler.rb
- (WEBrick::HTTPServlet::CGIhandler#do_GET): use $?.exitstatus and
- refine log message.
-
-Sun Jul 18 16:14:29 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/msgcat.rb (TkMsgCatalog.callback): bug fix
- ( wrong number of argument )
-
-Sun Jul 18 08:13:58 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): remove extra sign digit.
-
-Sun Jul 18 03:21:42 2004 Akinori MUSHA <knu@iDaemons.org>
-
- * dir.c (range): use NULL instead of 0.
-
- * dir.c (range): get rid of a gcc 3.4 warning.
-
-Sun Jul 18 03:12:11 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (receive_responses): return if a LOGOUT response
- received. (backported from HEAD)
- * lib/net/imap.rb (send_string_data): wait command continuation
- requests before sending octet data of literals. (backported from HEAD)
-
-Sat Jul 17 23:54:59 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/variable.rb: TkVariable#ref returns a TkVariable object
-
-Sat Jul 17 22:04:44 2004 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/ldap.rb: method hierarchical? should be in URI::LDAP.
-
-Sat Jul 17 18:29:07 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (stmt): not to show same error messages twice.
-
-Sat Jul 17 13:13:32 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/irb/ruby-lex.rb (RubyLex::identify_string): %s string do not
- process expression interpolation. [ruby-talk:106691]
-
-Sat Jul 17 05:26:27 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/diagram.rb: Incorporate Micheal Neuman's
- client-side imagemao patch
-
-Sat Jul 17 01:57:03 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (THREAD_ALLOC): th->thread should be initialized to NULL.
- [ruby-talk:106657] The solution was found by Guy Decoux.
-
-Fri Jul 16 22:30:28 2004 Michael Neumann <mneumann@ntecs.de>
-
- * file.c (rb_stat_dev_major): new methods File::Stat#dev_major and
- #dev_minor. [ruby-core:03195]
-
-Fri Jul 16 15:23:53 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (return_jump, break_jump): raise unexpceted local jump
- exception directly. [ruby-dev:23740]
-
- * lib/base64.rb (Deprecated): super in bound method calls original
- name method in stable version. [ruby-dev:23916]
-
-Fri Jul 16 11:31:49 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/test/unit/ui/{fox,gtk,gtk2}/testrunner.rb: remove
- garbage (patch from akira yamada) [ruby-dev:23911]
-
-Fri Jul 16 11:20:00 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): fix output of NaN, Inf and -Inf with
- "%f" or etc on MSVCRT platforms. (backported from HEAD)
-
-Fri Jul 16 11:17:38 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (exit_initialize): use EXIT_SUCCESS instead of 0.
- [ruby-dev:23913]
-
- * error.c (exit_success_p): new method SystemExit#success?.
- [ruby-dev:23912]
-
- * error.c (syserr_initialize): initialization for subclasses.
- [ruby-dev:23912]
-
-Thu Jul 15 23:53:38 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser#warn, OptionParser#abort): Exception
- no longer has to_str method.
-
-Thu Jul 15 22:59:48 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * ext/readline/extconf.rb: added dir_config for curses, ncurses,
- termcap. (backported from HEAD)
-
-Thu Jul 15 20:29:15 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * class.c, error.c, eval.c, intern.h, object.c, variable.c:
- do not set path if it is a singleton class. [ruby-dev:22588]
- (backport from 1.9)
-
-Thu Jul 15 10:15:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/, ext/tcltklib/: bug fix
-
- * ext/tk/lib/tk.rb: better operation for SIGINT when processing
- callbacks.
- * ext/tk/lib/tk/msgcat.rb: ditto.
- * ext/tk/lib/tk/variable.rb: ditto.
- * ext/tk/lib/tk/timer.rb: ditto.
-
- * ext/tk/lib/tk/validation.rb: add Tk::ValidateConfigure.__def_validcmd
- to define validatecommand methods easier
-
- * ext/tk/lib/tk.rb (_genobj_for_tkwidget): support autoload Tk ext
- classes
-
- * ext/tk/lib/tk/canvas.rb and so on: remove the parent widget type
- check for items (e.g. canvas items; depends on the class) to
- avoid some troubles on Tk extension widget class definition.
-
- * ext/tk/lib/tkextlib/: add Iwidget and TkTable extension support
-
- * ext/tk/sample/tkextlib/: add samples of Iwidget and TkTable
-
-
-Wed Jul 14 18:08:37 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_asn1.c (ossl_asn1cons_to_der): fix type of
- argument. [ruby-dev:23891]
-
- * test/openssl/test_x509store.rb: prune tests for CRL checking
- unless X509::V_FLAG_CRL_CHECK is defined.
-
-Wed Jul 14 12:29:07 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * util.c (ruby_strtod): should not convert string in the form of
- "-I.FE-X" which both "I" and "F" are ommitted. [ruby-dev:23883]
-
- * test/ruby/test_float.rb (test_strtod): add test for bug fix.
-
-Wed Jul 14 00:31:15 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * array.c: rdoc patch. merged patch from Johan Holmberg
- <holmberg@iar.se> [ruby-core:3170]
-
-Tue Jul 13 19:39:12 2004 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic#merge_path):
- "URI('http://www.example.com/foo/..') + './'" should return
- "URI('http://www.example.com/')". [ruby-list:39838]
- "URI('http://www.example.com/') + './foo/bar/..'" should return
- "URI('http://www.example.com/foo/')". [ruby-list:39844]
-
- * test/uri/test_generic.rb (TestGeneric#test_merge): added tests.
-
-Tue Jul 13 15:51:45 2004 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/mkmf.rb (init_mkmf): Do not add $(libdir) to $LIBPATH in
- extmk mode.
- * lib/mkmf.rb (dir_config): Prepend a new library path instead of
- appending so it is tried first.
-
-Tue Jul 13 00:50:48 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb: Support call-seq: for Ruby files.
-
-Mon Jul 12 21:20:36 2004 Dave Thomas <dave@pragprog.com>
-
- * html_generator.rb: Support hyperlinks of the form {any text}[xxx]
- as well as stuff[xxx]
-
-Sat Jul 10 09:30:24 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/soap/marshal/test_struct.rb: use qualified build-tin class name
- (::Struct) to avoid name crash.
-
-Sat Jul 10 04:21:56 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: better operation for SIGINT when processing
- callbacks.
- * ext/tk/lib/tk/msgcat.rb: ditto.
- * ext/tk/lib/tk/variable.rb: ditto.
- * ext/tk/lib/tk/timer.rb: ditto.
-
- * ext/tk/lib/tk/validation.rb (__def_validcmd): add a module
- function of Tk::ValidateConfigure to define validatecommand
- methods easier
-
-Fri Jul 9 22:36:36 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * array.c, enum.c, pack.c: rdoc patch from Johan Holmberg
- <holmberg@iar.se> [ruby-core:3132] [ruby-core:3136]
-
- * numeric.c: rdoc patch.
-
-Fri Jul 9 19:26:39 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (URI::HTTPS#proxy_open): raise ArgumentError to
- notice https is not supported.
-
-Fri Jul 9 14:28:54 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_thread_raise): accept third argument as well as
- Kernel#raise, and evaluate the arguments to create an exception in
- the caller's context. [ruby-talk:105507]
-
-Fri Jul 9 01:47:08 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib : bug fix
- * ext/tk/lib/tkextlib/itcl : add [incr Tcl] support
- * ext/tk/lib/tkextlib/itk : add [incr Tk] support
- * ext/tk/lib/tkextlib/iwidgets : midway point of [incr Widgets] support
- * ext/tk/sample/tkextlib/iwidgets : very simple examples of
- [incr Widgets]
-
-Thu Jul 8 22:52:19 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/{rss,parser,0.9,1.0,2.0}.rb: supported RSS 0.9x/2.0
- validation and validation which disregard order of elements.
- * test/rss/test_parser.rb: added tests for RSS 0.9x/2.0
- validation.
- * test/rss/{test_trackback,rss-testcase}.rb: fixed no good method
- name.
-
-Thu Jul 8 00:05:23 2004 akira yamada <akira@ruby-lang.org>
-
- * lib/tempfile.rb (Tempfile::initialize): got out code of
- generating tmpname. [ruby-dev:23832][ruby-dev:23837]
-
-Wed Jul 7 15:53:14 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * string.c (rb_str_match): raise TypeError when both arguments are
- strings. [ruby-dev:22869] (backported from HEAD)
-
- * string.c (rb_str_match2): removed.
-
- * Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
- wince/Makefile.sub (string.c): now not depend on version.h.
-
-Wed Jul 7 00:48:34 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/tk/lib/tkextlib/tktrans.rb,
- ext/tk/lib/tkextlib/treectrl.rb: fix syntax errors.
-
-Tue Jul 6 18:38:45 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib : improve framework of developping Tcl/Tk extension
- wrappers
-
-Mon Jul 5 23:56:42 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/{trackback,syndication,dublincore,content}.rb: worked
- with ruby 1.6 again.
-
- * test/rss/rss-assertions.rb: ditto.
-
-Mon Jul 5 22:54:39 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/uri/common.rb (Kernel#URI): new global method for parsing URIs.
-
-Mon Jul 5 09:02:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_thread_yield, rb_f_catch): 4th argument to rb_yield_0()
- is a set of bit flags. [ruby-dev:23859]
-
-Mon Jul 5 01:27:32 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/drb/drb.rb(DRbConn self.open): If socket pool is full, close
- the socket whose last-access-time is oldest. (and add new one)
- [ruby-dev:23860]
-
-Sun Jul 4 12:24:50 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: added copyright header.
-
-Sun Jul 4 00:24:40 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * added files
- * lib/soap/attachment.rb
- * lib/soap/header
- * lib/soap/mimemessage.rb
- * lib/soap/rpc/httpserver.rb
- * lib/wsdl/soap/cgiStubCreator.rb
- * lib/wsdl/soap/classDefCreator.rb
- * lib/wsdl/soap/classDefCreatorSupport.rb
- * lib/wsdl/soap/clientSkeltonCreator.rb
- * lib/wsdl/soap/driverCreator.rb
- * lib/wsdl/soap/mappingRegistryCreator.rb
- * lib/wsdl/soap/methodDefCreator.rb
- * lib/wsdl/soap/servantSkeltonCreator.rb
- * lib/wsdl/soap/standaloneServerStubCreator.rb
- * lib/wsdl/xmlSchema/enumeration.rb
- * lib/wsdl/xmlSchema/simpleRestriction.rb
- * lib/wsdl/xmlSchema/simpleType.rb
- * lib/xsd/codegen
- * lib/xsd/codegen.rb
- * sample/soap/authheader
- * sample/soap/raa2.4
- * sample/soap/ssl
- * sample/soap/swa
- * sample/soap/whois.rb
- * sample/soap/calc/samplehttpd.conf
- * sample/soap/exchange/samplehttpd.conf
- * sample/soap/sampleStruct/samplehttpd.conf
- * sample/wsdl/raa2.4
- * sample/wsdl/googleSearch/samplehttpd.conf
- * test/openssl/_test_ssl.rb
- * test/soap/header
- * test/soap/ssl
- * test/soap/struct
- * test/soap/swa
- * test/soap/wsdlDriver
- * test/wsdl/multiplefault.wsdl
- * test/wsdl/simpletype
- * test/wsdl/test_multiplefault.rb
-
- * modified files
- * lib/soap/baseData.rb
- * lib/soap/element.rb
- * lib/soap/generator.rb
- * lib/soap/marshal.rb
- * lib/soap/netHttpClient.rb
- * lib/soap/parser.rb
- * lib/soap/processor.rb
- * lib/soap/property.rb
- * lib/soap/soap.rb
- * lib/soap/streamHandler.rb
- * lib/soap/wsdlDriver.rb
- * lib/soap/encodingstyle/handler.rb
- * lib/soap/encodingstyle/literalHandler.rb
- * lib/soap/encodingstyle/soapHandler.rb
- * lib/soap/mapping/factory.rb
- * lib/soap/mapping/mapping.rb
- * lib/soap/mapping/registry.rb
- * lib/soap/mapping/rubytypeFactory.rb
- * lib/soap/mapping/wsdlRegistry.rb
- * lib/soap/rpc/cgistub.rb
- * lib/soap/rpc/driver.rb
- * lib/soap/rpc/element.rb
- * lib/soap/rpc/proxy.rb
- * lib/soap/rpc/router.rb
- * lib/soap/rpc/soaplet.rb
- * lib/soap/rpc/standaloneServer.rb
- * lib/wsdl/data.rb
- * lib/wsdl/definitions.rb
- * lib/wsdl/operation.rb
- * lib/wsdl/parser.rb
- * lib/wsdl/soap/definitions.rb
- * lib/wsdl/xmlSchema/complexContent.rb
- * lib/wsdl/xmlSchema/complexType.rb
- * lib/wsdl/xmlSchema/data.rb
- * lib/wsdl/xmlSchema/parser.rb
- * lib/wsdl/xmlSchema/schema.rb
- * lib/xsd/datatypes.rb
- * lib/xsd/qname.rb
- * sample/soap/calc/httpd.rb
- * sample/soap/exchange/httpd.rb
- * sample/soap/sampleStruct/httpd.rb
- * sample/soap/sampleStruct/server.rb
- * sample/wsdl/amazon/AmazonSearch.rb
- * sample/wsdl/amazon/AmazonSearchDriver.rb
- * sample/wsdl/googleSearch/httpd.rb
- * test/soap/test_basetype.rb
- * test/soap/test_property.rb
- * test/soap/test_streamhandler.rb
- * test/soap/calc/test_calc.rb
- * test/soap/calc/test_calc2.rb
- * test/soap/calc/test_calc_cgi.rb
- * test/soap/helloworld/test_helloworld.rb
- * test/wsdl/test_emptycomplextype.rb
- * test/wsdl/axisArray/test_axisarray.rb
- * test/wsdl/datetime/test_datetime.rb
- * test/wsdl/raa/test_raa.rb
- * test/xsd/test_xmlschemaparser.rb
- * test/xsd/test_xsd.rb
-
- * summary
- * add SOAP Header mustUnderstand support.
-
- * add HTTP client SSL configuration and Cookies support (works
- completely with http-access2).
-
- * add header handler for handling sending/receiving SOAP Header.
-
- * map Ruby's anonymous Struct to common SOAP Struct in SOAP Object
- Model. it caused error.
-
- * add WSDL simpleType support to restrict lexical value space.
-
- * add SOAP with Attachment support.
-
-Sat Jul 3 17:19:44 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/tk/lib/tkextlib/tkDND.rb: fix syntax error.
-
-Thu Jul 1 23:15:29 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/pstore.rb (transaction): safer backup scheme. [ruby-list:39102]
-
- * lib/pstore.rb (commit_new): use FileUtils.copy_stream for Cygwin.
- [ruby-dev:23157]
-
- * lib/pstore.rb (transaction): allow overriding dump and load.
- [ruby-dev:23567]
-
- * lib/pstore.rb (PStore#transaction): get rid of opening in write mode
- when read only transaction. [ruby-dev:23842]
-
- * lib/yaml/store.rb: follow lib/pstore.rb's change.
-
-Thu Jul 1 18:36:08 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tcltklib : bug fix
-
- * ext/tk/lib/tk : bug fix and add Tcl/Tk extension support libraries
-
-Thu Jul 1 11:59:45 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/extconf.rb: check for EVP_CIPHER_CTX_copy, ENGINE_add,
- EVP_CIPHER_CTX_set_padding, EVP_CipherFinal_ex, EVP_CipherInit_ex,
- EVP_DigestFinal_ex and EVP_DigestInit_ex.
-
- * ext/openssl/openssl_missing.c (EVP_CIPHER_CTX_copy): new function.
-
- * ext/openssl/openssl_missing.h (EVP_DigestInit_ex, EVP_DigestFinal_ex,
- EVP_CipherInit_ex, EVP_CipherFinal_ex, HMAC_Init_ex): new macro for
- OpenSSL 0.9.6.
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_encrypt, ossl_cipher_decrypt):
- re-implemnt (the arguments for this method is ).
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_pkcs5_keyivgen): new method
- OpenSSL::Cipher::Cipher#pkcs5_keyivgen. it calls EVP_BytesToKey().
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_alloc, ossl_cipher_initialize,
- ossl_cipher_copy, ossl_cipher_reset ossl_cipher_final,
- ossl_cipher_set_key, ossl_cipher_set_iv): replace all EVP_CipherInit
- and EVP_CipherFinal into EVP_CipherInit_ex and EVP_CipherFinal_ex.
- and EVP_CIPHER_CTX_init should only be called once.
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_set_key_length): new method
- OpenSSL::Cipher::Cipher#key_len=.
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_init_deprecated): new
- finction; print warning for Cipher#<<.
-
- * ext/openssl/ossl_digest.c: replace all EVP_DigestInit and
- EVP_DigestFinal into EVP_DigestInit_ex and EVP_DigestFinal_ex.
- and EVP_MD_CTX_init should only be called once.
-
- * ext/openssl/ossl_digest.c (digest_final): should call
- EVP_MD_CTX_cleanup to avoid memory leak.
-
- * ext/openssl/ossl_hmac.c (ossl_hmac_initialize): repalce HMAC_init
- into HMAC_init_ex. and HMAC_CTX_init is moved to ossl_hmac_alloc.
-
- * ext/openssl/ossl_hmac.c (hmac_final): should call
- HMAC_CTX_cleanup to avoid memory leak.
-
- * test/openssl/test_cipher.rb, test/openssl/test_digest.rb,
- test/openssl/test_hmac.rb: new file.
-
-Thu Jul 1 04:08:30 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_asn1.c (ossl_i2d_ASN1_TYPE, ossl_ASN1_TYPE_free):
- workaround for the versions earlier than OpenSSL-0.9.7.
-
-Thu Jul 1 03:33:55 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_pkey_dh.c (ossl_dh_initialize): should create
- empty pkey object if no argument is passed. [ruby-talk:103328]
-
- * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
-
- * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize): ditto.
-
- * ext/openssl/ossl_pkey_dh.c: add new methods: OpenSSL::PKey::DH#p,
- OpenSSL::PKey::DH#p=, OpenSSL::PKey::DH#g, OpenSSL::PKey::DH#g=,
- OpenSSL::PKey::DH#pub_key, OpenSSL::PKey::DH#pub_key=,
- OpenSSL::PKey::DH#priv_key and OpenSSL::PKey::DH#priv_key=.
-
- * ext/openssl/ossl_pkey_dsa.c: add new methods: OpenSSL::PKey::DSA#p,
- OpenSSL::PKey::DSA#p=, OpenSSL::PKey::DSA#q, OpenSSL::PKey::DSA#q=,
- OpenSSL::PKey::DSA#g, OpenSSL::PKey::DSA#g=,
- OpenSSL::PKey::DSA#pub_key, OpenSSL::PKey::DSA#pub_key=,
- OpenSSL::PKey::DSA#priv_key and OpenSSL::PKey::DSA#priv_key=.
-
-Thu Jul 1 03:16:09 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_read): take optional second argument
- to specify a string to be written.
-
- * ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#read):
- take optional second argument to specify a string to be written.
-
- * ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#gets):
- refine regexp for end-of-line.
+ * ext/syck/syck.c: ditto.
- * ext/opnessl/lib/openssl/ssl.rb
- (OpenSSL::SSL::SocketForwarder#listen): fix typo.
+ * ext/syck/token.c: ditto.
-Wed Jun 30 11:38:51 2004 Mikael Brockman <phubuh@phubuh.org>
+Fri Mar 25 12:14:58 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * parse.y (primary): should not be NULL. [ruby-core:03098]
+ * ext/nkf/nkf-utf8/nkf.c: import nkf 7f18e30.
-Wed Jun 30 02:53:24 2004 why the lucky stiff <why@ruby-lang.org>
+Fri Mar 25 11:49:29 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/syck/rubyext.c (syck_emitter_new): set buffer after
- Data_Wrap_Struct to avoid possible GC. [ruby-talk:104835]
+ * test/ruby/test_process.rb (TestProcess#test_no_curdir): skip silently
+ on Windows, because this tests a platform specific feature and it'll
+ never be supported on ruby on Windows.
-Tue Jun 29 10:31:19 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_dir_m17n.rb
+ (TestDir_M17N#test_filename_extutf8_invalid,
+ TestDir_M17N#test_filename_as_bytes_extutf8): ditto.
- * eval.c (rb_eval_cmd, rb_thread_trap_eval): restore safe level.
+ * test/open-uri/test_open-uri.rb
+ (TestOpenURI#test_find_proxy_case_sensitive_env): ditto.
- * gc.c (define_final, run_final): preserve and restore safe level for
- finalizers. [ruby-core:03058]
+ * test/dl/test_handle.rb (DL::TestHandle#test_NEXT,
+ DL::TestHandle#test_DEFAULT): ditto.
- * signal.c (signal_exec, rb_trap_exit, trap): preserve and restore
- safe level for signal handlers. [ruby-dev:23829]
+Thu Mar 24 23:06:29 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Jun 28 14:57:56 2004 Jeff Mitchell <quixoticsycophant@yahoo.com>
+ * vm_insnhelper.c (vm_get_ev_const): should not autoload in
+ defined? mode.
- * configure.in, lib/mkmf.rb (LIBPATHFLAG): use double quotes due to
- DOSISH compilers. [ruby-core:03107]
+ * variable.c (rb_const_defined_0): fix autoloading base.
+ [ruby-core:35509]
-Mon Jun 28 00:30:19 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Thu Mar 24 22:48:43 2011 Tanaka Akira <akr@fsij.org>
- * sample/drb/*.rb: using 'DRb.thread.join' instead of 'gets'
+ * ext/sdbm/_sdbm.c: parenthesize macro arguments.
-Sun Jun 27 22:39:51 2004 Kouhei Sutou <kou@cozmixng.org>
+Thu Mar 24 14:45:57 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * sample/rss/tdiary_plugin/rss-recent.rb: supported Hiki.
+ * ext/openssl/ossl.c: suppress warning: shorten-64-to-32.
-Sun Jun 27 12:19:46 2004 Kouhei Sutou <kou@cozmixng.org>
+ * ext/openssl/ossl.h: ditto.
- * {lib,sample,test}/rss: added RSS Parser. [ruby-dev:23780]
+ * ext/openssl/ossl_asn1.c: ditto.
-Sat Jun 26 11:07:30 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_bio.c: ditto.
- * configure.in (aix): -b must come at the start of the command line,
- and -e must not appear while testing libraries. [ruby-talk:104501]
+ * ext/openssl/ossl_bn.c: ditto.
- * lib/mkmf.rb (dir_config): quote directory names if necessary.
- [ruby-talk:104505]
+ * ext/openssl/ossl_cipher.c: ditto.
-Fri Jun 25 15:33:19 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_hmac.c: ditto.
- * ext/iconv/extconf.rb: check stricter. [ruby-talk:104501]
+ * ext/openssl/ossl_ns_spki.c: ditto.
- * ext/iconv/extconf.rb: include iconv.h for libiconv. [ruby-dev:22715]
+ * ext/openssl/ossl_ocsp.c: ditto.
-Fri Jun 25 08:31:29 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/openssl/ossl_pkcs5.c: ditto.
- * eval.c (rb_thread_atfork): remove "fork terminates thread"
- warning. [ruby-dev:23768]
+ * ext/openssl/ossl_pkey.c: ditto.
- * object.c (rb_obj_clone): backport FL_FINALIZE patch from 1.9.
- [ruby-core:02786][ruby-core:03067]
+ * ext/openssl/ossl_pkey_dh.c: ditto.
- * ext/socket/socket.c (sock_sockaddr): Socket#gethostbyname()
- should give us packed address, not struct sockaddr.
- [ruby-core:03053]
+ * ext/openssl/ossl_pkey_dsa.c: ditto.
-Fri Jun 25 02:04:23 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/openssl/ossl_pkey_ec.c: ditto.
- * {bcc32,win32,wince}/setup.mak: remove RUBY_EXTERN lines when
- including version.h. [ruby-talk:104456] (backported from HEAD)
+ * ext/openssl/ossl_pkey_rsa.c: ditto.
-Thu Jun 24 14:23:29 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_rand.c: ditto.
- * io.c (rb_io_fread): return already read data when system call is
- interrupted. [ruby-talk:97206]
+ * ext/openssl/ossl_ssl.c: ditto.
-Thu Jun 24 01:32:43 2004 Shugo Maeda <shugo@ruby-lang.org>
+ * ext/openssl/ossl_x509ext.c: ditto.
- * version.h: added declarations of ruby_version,
- ruby_release_date, ruby_platform.
- (backported from HEAD)
+ * ext/openssl/ossl_x509name.c: ditto.
-Wed Jun 23 22:23:37 2004 Dave Thomas <dave@pragprog.com>
+Thu Mar 24 11:48:19 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/socket/socket.c (sock_s_gethostbyaddr): Work around problem
- with OS X not returning 'from' parameter to recvfrom for
- connection-oriented sockets.
+ * ext/openssl/ossl_rand.c (ossl_rand_egd_bytes): use NUM2INT because
+ the result is used with functions whose argument is int.
-Wed Jun 23 01:45:27 2004 Dave Thomas <dave@pragprog.com>
+ * ext/openssl/ossl_ssl.c (ossl_sslctx_setup): ditto.
- * lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_quotation):
- Fix problem with the 'r' being dropped from %r{xxx}
+ * ext/openssl/ossl_x509store.c (ossl_x509store_set_purpose): ditto.
-Wed Jun 23 00:20:20 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * ext/openssl/ossl_x509store.c (ossl_x509store_set_trust): ditto.
- * ext/win32ole/win32ole.c (ole_hresult2msg): remove trailing
- CRs and LFs. (doesn't depend on CR+LF) [ruby-dev:23749]
+ * ext/openssl/ossl_x509store.c (ossl_x509stctx_set_purpose): ditto.
-Wed Jun 23 00:00:25 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_x509store.c (ossl_x509stctx_set_trust): ditto.
- * io.c (rb_io_initialize): should check fcntl result. [ruby-dev:23742]
+Thu Mar 24 11:36:55 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Jun 22 21:11:36 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * ext/openssl/ossl_x509name.c: id_aref's type is ID.
- * ext/win32ole/win32ole.c (OLE_FREE): should not call CoFreeUnuse-
- dLibraries().
+Thu Mar 24 10:04:35 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/win32ole/win32ole.c (ole_event_free): ditto.
+ * ext/io/console/console.c (console_set_winsize):
+ suppress warning: shorten-64-to-32.
- * ext/win32ole/win32ole.c (ole_hresult2msg): truncate error message
- before CR.
+Thu Mar 24 09:56:19 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Jun 22 16:47:42 2004 Shugo Maeda <shugo@ruby-lang.org>
+ * ext/openssl/ossl_ocsp.c (ossl_ocspreq_verify): flags is VALUE,
+ so it should use NUM2INT.
- * lib/net/ftp.rb (MDTM_REGEXP): fix for demon's ftp server.
- Thanks, Rutger Nijlunsing.
+ * ext/openssl/ossl_ocsp.c (ossl_ocspbres_verify): ditto.
-Mon Jun 21 10:19:23 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Mar 23 21:09:29 2011 Tanaka Akira <akr@fsij.org>
- * win32/win32.c (rb_w32_opendir): use FindFirstFile()/FindNextFile()/
- FindClose() instead of _findfirst()/_findnext()/_findclose().
- merge from HEAD.
+ * ext/readline/readline.c: parenthesize macro arguments.
-Sat Jun 19 13:24:15 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Mar 23 08:07:33 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (method_call): allow changing $SAFE. [ruby-dev:23713]
+ * numeric.c (flo_round): fix inaccurate results.
-Fri Jun 18 23:12:22 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Mar 23 00:12:16 2011 Tajima Akio <artonx@yahoo.co.jp>
- * eval.c (proc_save_safe_level, rb_set_safe_level, safe_setter): limit
- safe level.
+ * win32/win32.c: wait process real termination after reading
+ exit code. fixes #4518
-Wed Jun 16 23:05:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Mar 22 21:20:10 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * object.c (rb_mod_freeze): prepare string representation before
- freezing. [ruby-talk:103646]
+ * lib/rubygems/test_case.rb: save current dir to @current_dir
+ before Dir.chdir.
-Wed Jun 16 16:04:40 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Mar 22 20:10:04 2011 Tanaka Akira <akr@fsij.org>
- * object.c (rb_mod_le): singleton class inherits Class rather than its
- object's class. [ruby-dev:23690]
+ * ext/psych/parser.c: parenthesize macro arguments.
-Wed Jun 16 16:01:17 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Mar 22 20:10:01 2011 Tanaka Akira <akr@fsij.org>
- * gc.c (stack_grow_direction): memoize the direction.
+ * ext/openssl/ruby_missing.h: parenthesize macro arguments.
- * gc.c (Init_stack): should always move to end of VALUE.
+Tue Mar 22 13:33:22 2011 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Tue Jun 15 12:10:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/openssl/lib/openssl/buffering.rb: removed circular require of
+ openssl.rb.
- * ext/tk/lib/tk.rb: bug fix (TkWindow#grab)
+ * ext/openssl/lib/openssl/*: removed following comment for transition
+ measures of avoiding circular require. No one claimed about this as
+ far as I know.
+ ##
+ # Should we care what if somebody require this file directly?
+ # require "openssl"
-Mon Jun 14 18:23:27 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Mar 22 10:57:36 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/remote-tk.rb: bug fix
+ * test/runner.rb: set Gem::TestCase's @@project_dir.
-Sun Jun 13 00:23:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/rubygems/test_case.rb: set Gem::TestCase's @@project_dir only
+ when it is not defined.
- * ext/tcltklib/extconf.rb: [EXPERIMENTAL] MacOS X (darwin) support
+Tue Mar 22 09:38:19 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tcltklib/tcltklib.c: fix thread trouble on callback proc, and
- eliminate warning about instance variable access
+ * numeric.c (flo_round): use pow instead of while-loop. fixes #4510
+ patched by Alex Young [ruby-core:35526]
- * ext/tk/lib/tk/menubar.rb: improve supported menu_spec
+Tue Mar 22 06:47:46 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/tk/menuspec.rb: [add] menu_spec support library
+ * ext/date/date_strftime.c (date_strftime_wo_timespec):
+ suppress warning: shorten-64-to-32.
- * ext/tk/lib/tk/root.rb: add menu_spec support
+Tue Mar 22 06:42:42 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/tk/text.rb: bug fix
+ * ext/date/date_core.c: suppress warning: shorten-64-to-32.
- * ext/tk/lib/tk/toplevel.rb: add menu_spec support
+Tue Mar 22 06:41:37 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/sample/menubar?.rb: [add] sample of menu_spec usage
+ * lib/test/unit/parallel.rb: remove unused variable.
-Sat Jun 12 11:15:53 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Tue Mar 22 06:19:42 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * configure.in (target_os): strip -gnu suffix on Linux.
+ * enc/utf_16le.c: suppress warning: shorten-64-to-32.
-Fri Jun 11 17:08:21 2004 Akinori MUSHA <knu@iDaemons.org>
+ * ext/dbm/dbm.c: ditto.
- * config.guess: Restore a wrongly removed hyphen.
+ * ext/gdbm/gdbm.c: ditto.
-Fri Jun 11 14:30:08 2004 Akinori MUSHA <knu@iDaemons.org>
+ * parse.y (Init_ripper): suppress warning: unused value.
- * config.guess: Attempt to avoid system name change on
- Darwin platforms also.
+Mon Mar 21 11:21:32 2011 Shota Fukumori <sorah@tubusu.net>
-Fri Jun 11 14:22:45 2004 Akinori MUSHA <knu@iDaemons.org>
+ * lib/test/unit.rb: Refactoring. Unified if and elsif.
- * config.guess, config.sub: Attempt to avoid system name change on
- Linux platforms. We have been using "linux" instead of
- "linux-gnu" on this branch.
+Sun Mar 20 23:09:34 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Thu Jun 10 19:19:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/date/date_strftime.c: checks duplicated modifiers.
- * ext/sdbm/init.c (fsdbm_store): sdbm should use StringValue().
- [ruby-talk:103062]
+Sun Mar 20 22:32:30 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Wed Jun 9 18:04:14 2004 akira yamada <akira@ruby-lang.org>
+ * ext/date/date_strftime.c: removed unused code and arguments.
- * lib/uri/generic.rb (URI::Generic::merge,
- URI::Generic::route_from): accepts non-hierarchical URI.
- [ruby-dev:23631]
+Sun Mar 20 21:34:49 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * test/uri/test_generic.rb (TestGeneric::test_route,
- TestGeneric::test_merge): added tests for above changes.
+ * ext/date/date_core.c: replacement of implementation of
+ strftime. It has some limitations that is same as Time's
+ one. [experimental]
+ * ext/date/date_strftime.c: new.
+ * ext/date/lib/date/format.rb: removed ruby version of strftime.
-Wed Jun 9 17:39:37 2004 Akinori MUSHA <knu@iDaemons.org>
+Sun Mar 20 12:43:12 2011 Tanaka Akira <akr@fsij.org>
- * config.guess, config.sub: Update to a more recent version as of
- 2004-01-20.
+ * ext/openssl/ossl_x509store.c: parenthesize macro arguments.
- * configure.in: Add support for DragonFly BSD.
+Sun Mar 20 01:39:48 2011 Tajima Akio <artonx@yahoo.co.jp>
-Wed Jun 2 20:16:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * hash.c (ruby_setenv): check env process block size with OS ver.
+ * win32/win32.c: export rb_w32_osver for above patch.
+ * include/ruby/win32.h: declare rb_w32_osver for Win32 Libs.
- * string.c (str_new4): should share shared instance if it already
- exists. [ruby-dev:23665]
+Sat Mar 19 18:35:05 2011 Tajima Akio <artonx@yahoo.co.jp>
-Wed Jun 2 12:41:53 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * hash.c (ruby_setenv): calculate total env block size for win32.
+ * test/ruby/test_env.rb: add test for above patch.
- * io.c (rb_io_gets_m): set lastline ($_) even when read line is
- nil. [ruby-dev:23663]
+Sat Mar 19 17:14:46 2011 Tajima Akio <artonx@yahoo.co.jp>
-Fri May 28 11:20:31 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * hash.c (ruby_setenv): checking with max process environment
+ block size for Win32. 32767 for 2000/XP, 2003. if failed to
+ read the block, then checking with 5120 for earlier Windows.
- * eval.c (rb_eval): bad influence on frame node.
+Sat Mar 19 12:30:25 2011 Tanaka Akira <akr@fsij.org>
- * eval.c (eval): reverted wrongly removed condition. [ruby-dev:23638]
+ * ext/openssl/ossl_x509revoked.c: parenthesize macro arguments.
-Thu May 27 23:15:18 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Fri Mar 18 20:44:36 2011 Tanaka Akira <akr@fsij.org>
- * lib/logger.rb: leading 0 padding of timestamp usec part.
+ * ext/openssl/ossl_x509req.c: parenthesize macro arguments.
- * lib/csv.rb (CSV.parse): [CAUTION] behavior changed. in the past,
- CSV.parse accepts a filename to be read-opened (it was just a
- shortcut of CSV.open(filename, 'r')). now CSV.parse accepts a
- string or a stream to be parsed e.g.
- CSV.parse("1,2\n3,r") #=> [['1', '2'], ['3', '4']]
+Fri Mar 18 08:48:06 2011 Oleg Shaldybin <oleg.shaldybin@gmail.com>
- * lib/csv.rb: CSV::Row and CSV::Cell are deprecated. these classes
- are removed in the future. in the new csv.rb, row is represented
- as just an Array. since CSV::Row was a subclass of Array, it won't
- hurt almost all programs except one which depended CSV::Row#match.
- and a cell is represented as just a String or nil(NULL). this
- change will cause widespread destruction.
+ * lib/fileutils.rb (FileUtils::Entry_#copy_file): updated FileUtils.cp
+ to still copy file permissions when :preserve is false (as cp does
+ this even when -p isn't set).
- CSV.open("foo.csv", "r") do |row|
- row.each do |cell|
- if cell.is_null # using Cell#is_null
- p "(NULL)"
- else
- p cell.data # using Cell#data
- end
- end
- end
+Fri Mar 18 00:59:38 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- must be just;
+ * ext/win32ole/extconf.rb (create_docfile): removed. should not
+ modify source directory unnecessarily, platform dependent
+ documentation should be dealt with by rdoc. [ruby-core:35495]
- CSV.open("foo.csv", "r") do |row|
- row.each do |cell|
- if cell.nil?
- p "(NULL)"
- else
- p cell
- end
- end
- end
+Fri Mar 18 00:54:20 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/csv.rb: [CAUTION] record separator(CR, LF, CR+LF) behavior
- change. CSV.open, CSV.parse, and CSV,generate now do not force
- opened file binmode. formerly it set binmode explicitly.
+ * include/ruby/ruby.h (rb_funcall_passing_block): add prototype.
+ a patch by James M. Lawrence at [ruby-core:35501]
- with CSV.open, binmode of opened file depends the given mode
- parameter "r", "w", "rb", and "wb". CSV.parse and CSV.generate open
- file with "r" and "w".
+Wed Mar 17 06:23:31 2011 Tanaka Akira <akr@fsij.org>
- setting mode properly is user's responsibility now.
+ * ext/openssl/ossl_x509name.c: parenthesize macro arguments.
- * lib/csv.rb: accepts String as a fs (field separator/column separator)
- and rs (record separator/row separator)
+Wed Mar 16 20:36:56 2011 Tanaka Akira <akr@fsij.org>
- * lib/csv.rb (CSV.read, CSV.readlines): added. works as IO.read and
- IO.readlines in CSV format.
+ * ext/socket/ipsocket.c (init_inetsock_internal): raise an error on
+ listen(2) failure.
+ reported by Xavier Shay. [ruby-core:35505]
- * lib/csv.rb: added CSV.foreach(path, rs = nil, &block). CSV.foreach
- now does not handle "| cmd" as a path different from IO.foreach.
- needed?
+Wed Mar 16 15:06:21 2011 Eric Hodel <drbrain@segment7.net>
- * test/csv/test_csv.rb: updated.
+ * ext/openssl/lib/openssl/buffering.rb (module OpenSSL): #flush should
+ not change sync mode on exception.
+ * test/openssl/test_buffering.rb: added
- * test/ruby/test_float.rb: added test_strtod to test Float("0").
+Wed Mar 16 13:45:28 2011 Eric Hodel <drbrain@segment7.net>
-Thu May 27 21:37:50 2004 Tanaka Akira <akr@m17n.org>
+ * ext/openssl/lib/openssl/buffering.rb: de-nest Buffering module
- * lib/pathname.rb (Pathname#initialize): refine pathname initialization
- by pathname.
+ * ext/openssl/lib/openssl/buffering.rb: add RDoc
-Thu May 27 20:22:05 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Wed Mar 16 08:40:39 2011 Tanaka Akira <akr@fsij.org>
- * io.c (rb_io_fwrite): check all case errno != 0 [ruby-dev:23648]
+ * ext/openssl/ossl_x509ext.c: parenthesize macro arguments.
-Thu May 27 14:53:13 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Tue Mar 15 18:34:27 2011 Tanaka Akira <akr@fsij.org>
- * io.c (rb_io_fwrite): workaround for bcc32's fwrite bug.
- add errno checking. [ruby-dev:23627]
+ * ext/openssl/ossl_x509crl.c: parenthesize macro arguments.
-Wed May 26 14:19:42 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Mar 15 09:49:03 2011 Shota Fukumori <sorah@tubusu.net>
- * eval.c (rb_eval, eval): make line number consistent on eval with
- Proc. [ruby-talk:101253]
+ * test/misc/test_ruby_mode.rb (test_singleton_class): Skip for Pending.
-Wed May 26 13:59:17 2004 Dave Thomas <dave@pragprog.com>
+Mon Mar 14 21:20:44 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::skip_for_variable): Allow for
- 'do' after for statement
+ * test/ruby/test_require.rb (test_require_too_long_filename):
+ increase path length, because MAXPATHLEN is defined as 4096 on linux.
-Wed May 26 13:56:03 2004 Dave Thomas <dave@pragprog.com>
+ * test/ruby/test_require.rb (test_require_path_home_1): ditto.
- * lib/rdoc/generators/html_generator.rb (Generators::MarkUp::style_url): Fix
- relative path to code CSS file
+ * test/ruby/test_require.rb (test_require_path_home_2): ditto.
-Wed May 26 13:14:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Mar 14 19:54:37 2011 Tanaka Akira <akr@fsij.org>
- * io.c (rb_io_init_copy): copy also positions. [ruby-talk:100910]
+ * ext/openssl/ossl_x509cert.c: parenthesize macro arguments.
-Wed May 26 00:00:00 2004 why the lucky stiff <why@ruby-lang.org>
+Sun Mar 13 18:11:28 2011 Tanaka Akira <akr@fsij.org>
- * ext/syck/syck.c (syck_new_parser): clear parser on init.
- thanks, ts. [ruby-core:02931]
+ * ext/openssl/ossl_x509attr.c: parenthesize macro arguments.
- * ext/syck/token.c (sycklex_yaml_utf8): buffer underflow.
- thanks, ts. [ruby-core:02929]
+Sun Mar 13 16:07:58 2011 Shota Fukumori <sorah@tubusu.net>
- * lib/yaml/baseemitter.rb (indent_text): simpler flow block code.
+ * lib/pstore.rb: Fix don't raise "nested transaction" when thread_safe
+ is true. Patch by Masaki Matsushita (Glass_saga). [ruby-dev:43337]
- * lib/yaml.rb: added rdoc to beginning of lib.
+ * test/test_pstore.rb: Test for above.
+ Patch by Masaki Matsushita (Glass_saga) [ruby-dev:43337]
-Mon May 24 10:46:26 2004 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Sat Mar 12 04:12:41 2011 Tanaka Akira <akr@fsij.org>
- * lib/rdoc/generators/template/html/html.rb: SYSTEM identifiers
- must be absolute URIs
+ * ext/openssl/ossl_ssl_session.c: parenthesize macro arguments.
-Sat May 22 12:00:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Mar 12 02:27:07 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * MANIFEST: add new encodings in rexml.
+ * ext/date/date_core.c ({d,dt}_lite_marshal_load): checks the given
+ argument.
- * ext/tk/MANIFEST: add recent files.
+Sat Mar 12 01:26:24 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Sat May 22 05:37:11 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/date/date_core.c: changed some directives.
- * ext/tk/lib/remote-tk.rb: (NEW library) controll Tk interpreters
- on the other processes by Tcl/Tk's 'send' command
+Sat Mar 12 01:16:02 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Fri May 21 09:22:05 2004 Dave Thomas <dave@pragprog.com>
+ * ext/date/date_core.c, ext/date/lib/*: moved rdoc descriptions.
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_parameters):
- Add ()'s around parameters that don't have them
+Sat Mar 12 00:06:24 2011 Tadayoshi Funaba <tadf@dotrb.org>
-Thu May 20 17:02:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/date/lib: moved from lib.
- * lib/mkmf.rb (check_sizeof): define result size. [ruby-core:02911]
+Fri Mar 11 23:32:38 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * lib/mkmf.rb (create_header): macro name should not include equal
- sign.
+ * lib/date/delta*: removed undocumented delta.
-Thu May 20 15:59:50 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Fri Mar 11 18:42:43 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/socket.c: fix SEGV. [ruby-dev:23550]
+ * lib/mkmf.rb (find_executable0): should exclude directories.
-Thu May 20 14:35:52 2004 Tanaka Akira <akr@m17n.org>
+Fri Mar 11 01:40:35 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/socket/socket.c: check SCM_RIGHTS macro addition to
- the msg_control field to test existence of file descriptor passing
- by msg_control.
+ * process.c (proc_getmaxgroups, proc_setmaxgroups): Process#maxgroups
+ and Process#maxgroups= now raise NotImplementedError if the
+ platform don't support supplementary groups concept.
-Thu May 20 12:38:06 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Mar 11 01:25:03 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * numeric.c (flo_eq): always check if operands are NaN.
- [ruby-list:39685]
+ * process.c (get_sc_ngroups_max): return -1 if platform don't
+ support NGROUPS_MAX.
-Thu May 20 12:34:39 2004 Dave Thomas <dave@pragprog.com>
+Thu Mar 10 22:28:15 2011 Tanaka Akira <akr@fsij.org>
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_visibility):
- At Ryan Davis' suggestion, honor visibility modifers if guarded by a
- statement modifier
+ * ext/openssl/ossl_ssl.h: parenthesize macro arguments.
-Thu May 20 12:22:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Mar 10 21:59:37 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/mkmf.rb (have_type): do not check pointer to incomplete type,
- which always get compiled. [ruby-list:39683]
+ * parse.y (parser_encode_length): add exception as UTF8-MAC for
+ magic comment's emacs newline specifier
+ patched by James M. Lawrence [ruby-core:35476] fixes #4489
-Wed May 19 11:09:00 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu Mar 10 16:00:22 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/tk.rb: change permition of TkObject#tk_send from
- private to public
+ * parse.y (parser_encode_length): fix typo: the length of
+ "-dos" and "-mac" is not 5 but 4.
+ patched by James M. Lawrence [ruby-core:35476] fixes #4489
-Tue May 18 14:00:46 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Mar 10 10:52:01 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * node.h (NEW_DSTR): adjust list length.
+ * test/ruby/test_require.rb: setting too long string to ENV causes
+ Errno::EINVAL on Windows. long path name errors may causes over
+ about 1024 bytes, then limit it about 4000 bytes.
- * parse.y (literal_concat): ditto.
+Thu Mar 10 10:09:35 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Mon May 17 16:14:25 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * lib/test/unit.rb (Test::Unit::Runner::Worker#read): fix for the case
+ when IO#read or IO#gets returns nil.
- * numeric.c (flo_to_s): it's preferable that "p 0.0" outputs "0.0"
- instead of "0.0e+00". [ruby-dev:23480]
+Thu Mar 10 07:12:03 2011 Ryan Davis <ryand-ruby@zenspider.com>
- * numeric.c (flo_to_s): it's preferable that "p 0.00000000000000000001"
- outputs "1.0e-20" instead of "9.999999999999999e-21". (the precision
- is considered, but there is assumption DBL_DIG == 15 in current
- implementation)
+ * lib/rubygems*: Import rubygems 1.6.2 (release candidate @ 2026fbb5)
+ * test/rubygems: Ditto
+ * test/runner.rb: Added test to load path to fix test requires.
-Mon May 17 10:13:33 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Mar 10 03:00:43 2011 Tanaka Akira <akr@fsij.org>
- * ext/socket/socket.c (setup_domain_and_type): honor duck typing.
- [ruby-dev:23522]
+ * ext/openssl/ossl_ssl.c: parenthesize macro arguments.
- * ext/socket/socket.c (sock_s_getnameinfo): ditto.
+Wed Mar 9 23:51:26 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Mon May 17 01:15:23 2004 why the lucky stiff <why@ruby-lang.org>
+ * test/ruby/test_io_m17n.rb (test_io_new_enc): "sjis" is now an alias
+ of Windows-31J.
- * lib/yaml.rb: removed fallback to pure Ruby parser.
+Wed Mar 9 23:06:13 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/yaml/baseemitter.rb (indent_text): was forcing a mod value
- of zero at times, which kept some blocks from getting indentation.
+ * misc/ruby-mode.el (ruby-parse-partial): fix indent after aref.
- * lib/yaml/baseemitter.rb (node_text): rewriting folded scalars.
+Wed Mar 9 12:50:24 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/syck/syck.h: reports style of scalars now, be they plain, block
- single-, or double-quoted.
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: Rescue exceptions when
+ people implement the method method. Thanks Lin Jen-Shin.
+ [ruby-core:35255]
- * ext/syck/syck.c: ditto.
+ * test/psych/visitors/test_yaml_tree.rb: test for implementation of
+ method method.
- * ext/syck/gram.c: ditto.
+Wed Mar 9 11:53:31 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/syck/node.c: ditto.
+ * enc/shift_jis.c: Change SJIS as an alias of Windows-31J.
+ [ruby-dev:43027] fixes #4280
- * ext/syck/token.c: ditto.
+ * enc/shift_jis.c: Add PCK as an alias of Windows-31J.
- * ext/syck/rubyext.c (yaml_org_handler): symbols loaded only
- if scalar style is plain.
+Wed Mar 9 00:45:29 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/syck/rubyext.c (yaml_org_handler): some empty strings were
- loaded as symbols.
+ * ext/extmk.rb: nmake substitutes all occurrences in macro.
- * test/yaml/test_yaml.rb (test_perl_regexp): updated test to
- match new regexp serialization.
+ * ext/extmk.rb: workaround for nmake.
-Mon May 17 00:03:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+Tue Mar 8 23:49:45 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/drb/drb.rb: Cosmetic documentation changes.
+ * process.c (proc_setgroups): cleanup.
-Sun May 16 22:36:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+Tue Mar 8 23:40:30 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit.rb: Removed :nodoc: directive (it prevented effective
- RDoc operation), and added file-level comment.
+ * test/misc/test_ruby_mode.rb: test for ruby-mode.el.
-Sun May 16 20:55:49 2004 Tanaka Akira <akr@m17n.org>
+Tue Mar 8 23:27:38 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/dbm/dbm.c (fdbm_initialize): accept optional 3rd argument to
- specify an open flag.
- (Init_dbm): define open flags: DBM::READER, DBM::WRITER, DBM::WRCREAT
- and DBM::NEWDB.
+ * process.c (get_sc_ngroups_max): try to use NGROUPS_MAX at first if
+ _SC_NGROUP_MAX is not defined.
-Sun May 16 13:10:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+Tue Mar 8 23:10:16 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit/**/*.rb: Removed :nodoc: directives (many were
- generating warnings, many were on private methods).
+ * misc/ruby-mode.el (ruby-parse-partial): fix for array in block.
-Sat May 15 01:41:34 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Mar 8 21:44:49 2011 Tanaka Akira <akr@fsij.org>
- * eval.c (eval): forgot to restore $SAFE value before evaluating
- compiled node. [ruby-core:02872]
+ * ext/openssl/ossl_rand.c: parenthesize macro arguments.
-Sat May 15 01:33:12 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Mar 8 16:45:31 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * range.c (range_each_func): terminates loop if generating value
- is same to @end. [ruby-talk:100269]
+ * hash.c (ruby_setenv): MSDN says that Windows XP or earlier limits
+ the total size of environment block to 5,120 chars. and on such
+ OS, putenv() causes SEGV. So, ruby should limit the size of an
+ environment variable to 5,120 bytes for workaround.
-Fri May 14 22:08:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Mar 8 15:57:20 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * string.c (rb_str_new4): should not reuse frozen shared string if
- the original is not an instance of String. [ruby-talk:100193]
+ * test/rubygems/test_gem_spec_fetcher.rb
+ (TestGemSpecFetcher#test_cache_dir_escapes_windows_paths): cache_dir
+ may have driveletter and `:' for base of cache_dir itself, so need
+ to skip it for checking.
-Fri May 14 18:39:25 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Mar 8 12:30:06 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/tk/canvas.rb: improve coords support for canvas items.
- Now, supports all of the followings.
- TkcLine.new(c, 0, 0, 100, 100, :fill=>'red')
- TkcLine.new(c, [0, 0, 100, 100], :fill=>'red')
- TkcLine.new(c, [0, 0], [100, 100], :fill=>'red')
- TkcLine.new(c, [[0, 0], [100, 100]], :fill=>'red')
- TkcLine.new(c, :coords=>[0, 0, 100, 100], :fill=>'red')
- TkcLine.new(c, :coords=>[[0, 0], [100, 100]], :fill=>'red')
+ * misc/ruby-mode.el (ruby-deep-indent-paren-p, ruby-calculate-indent):
+ do not apply deep-indent inside parens at the beginning of
+ expressions.
-Fri May 14 12:11:43 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Tue Mar 8 09:32:48 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * util.c (ruby_strtod): strtod("0", &end); => end should point '\0'.
- [ruby-dev:23498]
+ * common.mk (configure-ext, build-ext), ext/extmk.rb (extmake):
+ support parallel-make under ext.
-Thu May 13 15:47:30 2004 akira yamada <akira@ruby-lang.org>
+Tue Mar 8 09:25:23 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/telnet.rb (Net::Telnet::login): "options" can specify
- regexps for login prompt and/or password prompt.
+ * process.c (proc_setgroups): use getgrnam() if getgrnam_r() is
+ not available.
-Thu May 13 14:23:45 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+ * process.c: RARRAY_LEN() returns long int.
- * hash.c (delete_if_i): use st_delete_safe() (via
- rb_hash_delete()) instead of returning ST_DELETE.
- backport from HEAD. [ruby-dev:23487]
+Tue Mar 8 09:07:03 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu May 13 13:01:30 2004 akira yamada <akira@ruby-lang.org>
+ * configure.in (RUBY_REPLACE_TYPE): enclose in quotes for multiple
+ type names.
- * lib/uri/mailto.rb (URI::MailTo::to_s): should include fragment.
+Tue Mar 8 01:43:11 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Thu May 13 11:04:08 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * process.c (get_sc_ngroups_max): define to wrap sysconf(3).
+ this also supports Windows which doesn't have sysconf(3).
- * pack.c (pack_pack): always add with null for 'Z'.
+ * process.c (maxgroups): use get_sc_ngroups_max.
- * pack.c (pack_unpack): terminated by null for 'Z'. [ruby-talk:98281]
+ * process.c (proc_setmaxgroups): ditto.
-Wed May 12 19:59:43 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Mar 8 01:16:49 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/mkmf.rb (have_type, check_sizeof): replace unusable characters.
- [ruby-talk:99788]
+ * gc.c (rb_objspace): an initializer must be a constant.
-Wed May 12 17:41:42 2004 Tanaka Akira <akr@m17n.org>
+Tue Mar 8 01:11:44 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/resolv.rb (Resolv::DNS::Config): make it configurable without
- external file such as /etc/resolv.conf.
+ * process.c (maxgroups): cast because sysconf(3)'s return value is long.
-Wed May 12 14:37:27 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * process.c (proc_setmaxgroups): ditto.
- * ext/openssl/ossl_x509name.c: attribute value of DC (short name of
- domainComponent) should be IA5String.
+ * process.c (proc_setgroups): cast because RARRAY_LEN() is long.
-Wed May 12 13:20:19 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Mar 8 00:02:47 2011 Tanaka Akira <akr@fsij.org>
- * ext/tk/lib/tk/composite.rb: improve configure methods (based on
- the proposal of [ruby-talk:99671]).
+ * ext/openssl/ossl_pkey_rsa.c: parenthesize macro arguments.
-Wed May 12 11:51:08 2004 Dave Thomas <dave@pragprog.com>
+Mon Mar 7 22:59:39 2011 Shota Fukumori <sorah@tubusu.net>
- * class.c (rb_obj_singleton_methods): fix rdoc
+ * lib/pstore.rb: Delete variable @transaction and fix #4474. Patch by
+ Masaki Matsushita (Glass_saga).
-Mon May 10 21:44:42 2004 Dave Thomas <dave@pragprog.com>
+ * test/test_pstore.rb(test_thread_safe): Add test for #4474.
- * lib/rdoc/generators/html_generator.rb: Change scheme for
- looking up symbols in HTML generator.
+Mon Mar 7 21:31:38 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon May 10 16:45:21 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * process.c (proc_setgroups): replace getgrnam() with getgrnam_r()
+ because getgrnam() isn't thread safe.
- * eval.c (eval): warning during eval should not cause deadlock.
- [ruby-talk:98651]
+Mon Mar 7 20:49:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * eval.c (rb_eval): raise TypeError exception for superclass
- mismatch. [ruby-list:39567]
+ * process.c (proc_getmaxgroups, proc_setmaxgroups): reflect
+ platform maxgroups limitation by default instead hardcoded 65536.
-Mon May 10 12:11:37 2004 Dave Thomas <dave@pragprog.com>
+Mon Mar 7 17:13:00 2011 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/rdoc/generators/html_generator.rb: Hack to search parents
- for unqualified constant names.
+ * gc.c (rb_gc_set_params): allow GC parameter configuration by
+ environment variables. based on a patch from funny-falcon at
+ https://gist.github.com/856296, but honors safe level.
-Mon May 10 12:11:37 2004 Dave Thomas <dave@pragprog.com>
+Mon Mar 7 09:05:18 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rdoc/generators/html_generator.rb: Hack to search parents
- for unqualified constant names.
+ * process.c: NUM2RLIM is defined but no getrlimit and setrlimit on
+ mingw.
-Sun May 9 22:37:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+Mon Mar 7 08:38:14 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/ftp.rb: improved documentation
- * lib/net/imap.rb: ditto
- * lib/net/pop.rb: ditto
- * lib/net/smtp.rb: ditto
- * lib/net/telnet.rb: ditto
+ * ext/date/date_core.c (DateTimeData): should not use bare 'long long'
+ and 'long double', which are not defined by C89.
-Fri May 7 21:50:21 2004 Dave Thomas <dave@pragprog.com>
+ * ext/date/date_core.c (dt_lite_plus): get rid of overflow at casting
+ down double to integer.
- * lib/rdoc/parsers/parse_rb.rb (RDoc::parse_include): Allow
- multiple arguments to 'include'
+Mon Mar 7 00:21:11 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Fri May 7 21:31:56 2004 Minero Aoki <aamine@loveruby.net>
+ * process.c (proc_getgroups): get rid of maxgroups dependency.
+ ngroups can be calculated dynamically.
- * lib/fileutils.rb (fu_list): Array() breaks pathes including "\n".
- [ruby-core:02843]
+Sun Mar 6 23:45:40 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Fri May 7 11:25:53 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * configure.in: rlim_t use standard RUBY_REPLACE_TYPE mechanism.
- * util.c (ruby_strtod): "0.0000000000000000001" should be converted
- to 1.0e-19 instead of 0.0. (leading zeros aren't significant digits)
- [ruby-talk:99318] [ruby-dev:23465]
+Sun Mar 6 23:26:07 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Fri May 7 10:00:05 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * process.c (proc_setmaxgroups): added negative value check.
+ This was suggested by Daniel Berger. Thanks Daniel!
+ [ruby-core:35426][Bug#4467]
- * ext/tk/tkutil.c (get_eval_string_core): bug fix. [ruby-dev:23466]
+Sun Mar 6 23:18:23 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu May 6 22:13:17 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * process.c (maxgroups, proc_setmaxgroups): increase max groups
+ limitation up to 65536.
- * ext/socket/socket.c (ippaddr): use NUMERICHOST if can not resolve
- hostname.
+Sun Mar 6 22:20:59 2011 Tanaka Akira <akr@fsij.org>
-Thu May 6 14:22:29 2004 why the lucky stiff <why@ruby-lang.org>
+ * ext/openssl/ossl_pkey_ec.c: parenthesize macro arguments.
- * lib/yaml/rubytypes.rb (to_yaml): added instance variable handling
- for Ranges, Strings, Structs, Regexps.
+Sun Mar 6 21:49:04 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/yaml/rubytypes.rb (to_yaml_fold): new method for setting a
- String's flow style.
+ * sample/list.rb (MyElem#initialize): initialize @head
+ explicitly. Otherwise -W2 option makes following warning.
+ "warning: instance variable @head not initialized".
+ This issue was founded by Andrew Grimm. Thanks Andrew!
+ [ruby-core:35435][Bug#4471]
- * lib/yaml.rb (YAML::object_maker): now uses Object.allocate.
+Sun Mar 6 05:21:41 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/syck/gram.c: fixed transfer methods on structs, broke it
- last commit.
+ * class.c: fix camelCase to snake_case in documentation code examples.
+ patched by Andrew Grimm. fixes Bug #4469
-Thu May 6 11:40:28 2004 Shugo Maeda <shugo@ruby-lang.org>
+ * marshal.c: ditto.
- * lib/net/imap.rb (string): accept NIL.
+ * proc.c: ditto.
- * lib/net/imap.rb (body_type_basic): allow body-fields omissions.
+ * sample/biorhythm.rb: ditto.
-Thu May 6 01:59:04 2004 Dave Thomas <dave@pragprog.com>
+ * vm_eval.c: ditto.
- * lib/rdoc/generators/html_generator.rb (Generators::HtmlMethod::params):
- Don't include the &block parameter if we have explicit
- yield parameters.
+ * vm_method.c: ditto.
-Wed May 5 03:40:29 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * lib/rinda/ring.rb: use recv instead of recvfrom.
+Sun Mar 6 03:22:27 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue May 4 23:52:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+ * io.c (io_cntl): use rb_thread_io_blocking_region() instead
+ rb_thread_blocking_region().
- * lib/gserver.rb: documented
+Sat Mar 5 22:54:36 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
-Tue May 4 23:46:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+ * include/ruby/intern.h: fix a typo of prototype declaration.
+ rb_mutex_try_lock -> rb_mutex_trylock [ruby-dev:43213]
- * lib/xmlrpc/README.txt: introduced for documentation purposes
+Sat Mar 5 19:44:03 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon May 3 09:47:24 2004 Dave Thomas <dave@pragprog.com>
+ * test/ruby/test_io.rb (TestIO#test_fcntl_lock): small clean up.
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
- Fix parsing bug if yield called within 1 line block
+Sat Mar 5 01:33:46 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun May 2 01:04:38 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * io.c (io_cntl, nogvl_io_cntl): IO.fcntl() and IO.ioctl()
+ release GVL during calling kernel interface.
+ Suggested by Eric Wong. [ruby-core:35417][Bug #4463]
- * ext/tcltklib, ext/tk: renewal Ruby/Tk
+ * test/ruby/test_io.rb (TestIO#test_fcntl_lock): add new test for
+ IO.fcntl().
-Fri Apr 30 20:08:41 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Fri Mar 4 23:09:12 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * time.c (SIZEOF_TIME_T): support SIZEOF_TIME_T == SIZEOF_INT.
+ * test/testunit/test_parallel.rb
+ (test_should_run_all_without_any_leaks): consider that the order of
+ testcase could change. [ruby-dev:43300] [Bug #4466]
-Tue Apr 27 13:12:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Mar 4 22:01:14 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * eval.c (rb_eval): too many line trace call. (ruby-bugs PR#1320)
+ * io.c (io_cntl): change 'cmd' type to int. ioctl and fcntl need to
+ be passed int.
+ * io.c (rb_io_ctl): ditto.
-Tue Apr 27 08:41:28 2004 why the lucky stiff <why@ruby-lang.org>
+Fri Mar 4 21:10:40 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/yaml/rubytypes.rb: passing Range tests.
+ * configure.in: save warnflags. the patch is created by Eric Wong.
+ [Bug #4465]
- * ext/syck/syck.h: version 0.44.
+Wed Mar 2 21:15:00 2011 Tanaka Akira <akr@fsij.org>
- * ext/syck/gram.c: transfers no longer open an indentation.
- fixed transfers which precede blocks.
+ * ext/openssl/ossl_pkey_dsa.c: parenthesize macro arguments.
- * ext/syck/token.c: ditto.
+Thu Mar 3 22:10:26 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/syck/syck.c: fixed segfault if an anchor has been released already.
+ * process.c (check_exec_redirect_fd, check_exec_redirect): raise
+ ArgumentError if fd >= 3 on Windows because the feature is not
+ supported.
- * ext/syck/node.c (syck_free_members): organized order of free'd nodes.
-
- * ext/syck/rubyext.c (syck_emitter_write_m): test for proper string with
- StringValue.
+ * test/ruby/test_process.rb (test_execopts_redirect): remove meaningless
+ argument.
-Mon Apr 26 23:56:54 2004 Daniel Kelley <news-1082945587@dkelley.gmp.san-jose.ca.us>
+Thu Mar 3 21:21:42 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * README.EXT, README.EXT.ja: fixed wrong function signature.
- [ruby-talk:98349]
+ * test/ruby/test_process.rb (test_execopts_redirect): redirecting fd
+ >= 3 is not supported on Windows, so should not specify such options
+ when calling spawn or others.
-Mon Apr 26 21:40:09 2004 Dave Thomas <dave@pragprog.com>
+Thu Mar 3 18:59:04 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/rdoc/code_objects.rb (RDoc::Context::add_alias): Only alias
- to instance methods.
+ * string.c (rb_str_slice_bang): raise error when the string is frozen.
-Sat Apr 24 10:38:31 2004 Dave Thomas <dave@pragprog.com>
+Thu Mar 3 14:25:19 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::group_lines):
- Fix bug where consecutive headings are merged.
+ * strftime.c (STRFTIME): return 0 and ERANGE when precision is too
+ large. [ruby-dev:43284] fixes #4456
-Fri Apr 23 23:26:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Mar 3 00:46:51 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/mkmf.rb: $hdrdir should not contain macros for backward
- compatibility. [bruby-dev:28]
+ * addr2line.c (uleb128): cast the value to unsigned long.
- * version.c (ruby_show_copyright): obtain copyright year from
- RUBY_RELEASE_YEAR.
+ * addr2line.c (fill_lines): print error when lseek fails.
- * win32/resource.rb: ditto.
+Thu Mar 3 00:36:29 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * win32/resource.rb: default rubyw icon to ruby.ico, and let DLL also
- include them.
+ * lib/rexml/encoding.rb (REXML::Encoding#encoding=): store @encoding
+ a String which means the name of the encoding.
+ this partially revert r29646.
- * win32/resource.rb: include winver.h for older WindowsCE.
+ * lib/rexml/document.rb: follow above.
-Fri Apr 23 16:38:46 2004 Tanaka Akira <akr@m17n.org>
+ * lib/rexml/output.rb: ditto.
- * lib/pathname.rb: sync taint/freeze flag between
- a pathname object and its internal string object.
+ * lib/rexml/parsers/baseparser.rb: ditto.
-Fri Apr 23 14:52:08 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rexml/source.rb: ditto.
- * parse.y (stmt, arg, aref_args): should not make sole splat into
- array, in aref_args other than aref with op_asgn.
+ * lib/rexml/xmldecl.rb: ditto.
-Fri Apr 23 14:14:38 2004 Tanaka Akira <akr@m17n.org>
+Wed Mar 2 23:19:56 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/resolv.rb: don't use Regexp#source to embed regexps.
- [ruby-dev:23432]
+ * string.c (str_byte_substr): return nil for negative length.
-Thu Apr 22 04:15:36 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Mar 2 21:15:00 2011 Tanaka Akira <akr@fsij.org>
- * parse.y (aref_args): should pass expanded list. [ruby-core:02793]
+ * ext/openssl/ossl_pkey_dh.c: parenthesize macro arguments.
-Thu Apr 22 01:12:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Mar 2 14:24:04 2011 Shota Fukumori <sorah@tubusu.net>
- * numeric.c (flo_to_s): tweak output string based to preserve
- decimal point and to remove trailing zeros. [ruby-talk:97891]
+ * lib/test/unit/parallel.rb: Fix name from `inclement_io` to
+ `increment_io`.
- * string.c (rb_str_index_m): use unsigned comparison for T_FIXNUM
- search. [ruby-talk:97342]
+Wed Mar 2 14:06:01 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Apr 21 22:57:27 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * string.c (rb_str_slice_bang): move treatments which is only needed
+ when the result is not nil.
- * lib/rinda/rinda.rb, test/rinda/test_rinda.rb: check Hash tuple size.
+Wed Mar 2 14:02:29 2011 Shota Fukumori <sorah@tubusu.net>
-Wed Apr 21 20:05:00 2004 Tanaka Akira <akr@m17n.org>
+ * test/testunit/test_parallel.rb(TestParallel#spawn_runner):
+ Fix outputing empty line in running test.
- * lib/open-uri.rb (URI::HTTP#proxy_open): set Host: field explicitly.
- [ruby-list:39542]
+ * test/testunit/tests_for_parallel/test_third.rb: Remove `sleep`
-Mon Apr 19 18:11:15 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Mar 1 22:29:10 2011 Tanaka Akira <akr@fsij.org>
- * hash.c (rb_hash_equal): returns true if two hashes have same set
- of key-value set. [ruby-talk:97559]
+ * ext/openssl/ossl_pkey.h: parenthesize macro arguments.
- * hash.c (rb_hash_eql): returns true if two hashes are equal and
- have same default values.
+Tue Mar 1 22:02:35 2011 Shota Fukumori <sorah@tubusu.net>
-Mon Apr 19 08:19:58 2004 Doug Kearns <djkea2@mugca.its.monash.edu.au>
+ * lib/test/unit/parallel.rb: Fix number.
- * dln.c, io.c, lib/benchmark.rb, lib/cgi.rb, lib/csv.rb, lib/date.rb,
- lib/ftools.rb, lib/getoptlong.rb, lib/logger.rb, lib/matrix.rb,
- lib/monitor.rb, lib/set.rb, lib/thwait.rb, lib/timeout.rb,
- lib/yaml.rb, lib/drb/drb.rb, lib/irb/workspace.rb, lib/net/ftp.rb,
- lib/net/http.rb, lib/net/imap.rb, lib/net/telnet.rb,
- lib/racc/parser.rb, lib/rinda/rinda.rb, lib/rinda/tuplespace.rb,
- lib/shell/command-processor.rb, lib/soap/rpc/soaplet.rb,
- lib/test/unit/testcase.rb, lib/test/unit/testsuite.rb: typo fix.
+Tue Mar 1 21:48:22 2011 Shota Fukumori <sorah@tubusu.net>
-Mon Apr 19 08:14:18 2004 Dave Thomas <dave@pragprog.com>
+ * lib/test/unit/parallel.rb: For Windows.
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Allow for
- #ifdef HAVE_PROTOTYPES
+ * test/testunit/test_parallel.rb(TestParallelWorker#test_quit_in_test):
+ Fix for above specification change.
+ * test/testunit/test_parallel.rb(TestParallel#spawn_runner):
+ Fix outputing empty line in running test.
-Fri Apr 16 22:33:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+Tue Mar 1 20:51:57 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/iconv/iconv.c: nearly finished RDoc comments.
+ * test/ruby/test_system.rb (TestSystem#test_system_at):
+ remove tests for [bug#4396]. because we decided to reject this
+ ticket.
-Fri Apr 16 17:04:07 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Mar 1 19:46:19 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * string.c (rb_str_equal): always returns true or false, never
- returns nil. [ruby-dev:23404]
+ * test/date/{test_date.rb,test_date_attr.rb}: [ruby-dev:43280]
-Fri Apr 16 08:27:02 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Mar 1 18:40:38 2011 Ryan Davis <ryan@YPCMC09457>
- * ext/extmk.rb: skip linking when libraries to be preloaded not
- compiled. [ruby-list:39561]
+ * lib/rubygems*: Import rubygems 1.6.0 (released version @ 58d8a0b9)
+ * test/rubygems: Ditto
-Thu Apr 15 23:21:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Mar 1 16:22:22 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * process.c (pst_success_p): new method Process::Status#success?.
- [ruby-dev:23385]
+ * win32/win32.c: revert r30987 because it causes some failures in
+ test-all, especially webrick.
-Thu Apr 15 17:12:13 2004 Tanaka Akira <akr@m17n.org>
+Tue Mar 1 15:59:53 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/gdbm/gdbm.c (Init_gdbm): define GDBM::READER, GDBM::WRITER,
- GDBM::WRCREAT and GDBM::NEWDB.
- (fgdbm_initialize): use specified read/write flag.
+ * string.c (rb_str_byteslice): the resulted encoding should keep
+ original encoding. this also fixes the encoding when the result
+ shares internal string. [ruby-core:35376]
-Wed Apr 14 11:29:56 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Tue Mar 1 13:25:00 2011 Kenta Murata <mrkn@mrkn.jp>
- * numeric.c (flo_eq): workaround for bcc32's bug.
- (ruby-bugs-ja:PR#594)
+ * ext/bigdecimal/bigdecimal.c (VpMemAlloc): CVE-2011-0188.
+ Fixes a bug reported by Drew Yao <ayao at apple.com>
-Wed Apr 14 13:06:35 2004 Doug Kearns <djkea2@mugca.its.monash.edu.au>
+Tue Mar 1 10:34:39 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * array.c, enum.c, eval.c, file.c, io.c, numeric.c, object.c, prec.c,
- process.c, re.c, string.c: typos in RDoc comments. [ruby-core:02783]
+ * string.c (rb_str_byteslice): Add String#byteslice. [ruby-core:35376]
-Wed Apr 14 11:06:38 2004 Dave Thomas <dave@pragprog.com>
+Tue Mar 1 00:12:49 2011 Tajima Akio <artonx@yahoo.co.jp>
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::scan): Changed
- behavior of :enddoc: -- it now unconditionally terminates
- processing of the current file.
+ * include/ruby/win32.h: define WIN32 if neither _WIN64 nor WIN32
+ defined. it forces to use push/pop for pack(4) pragma.
-Wed Apr 14 11:03:22 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Mon Feb 28 23:52:13 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * defines.h: include <net/socket.h> to get fd_set definition in BeOS.
+ * test/testunit/test_rake_integration.rb (test_with_rake_runner):
+ use assert_in_out_err for suppress messages.
-Tue Apr 13 23:06:30 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Mon Feb 28 22:48:56 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/rinda/rinda.rb: change pattern matching.
- a === b -> a == b || a === b. [druby-ja:98]
+ * win32/win32.c (rb_w32_spawn): use shell if a commandline contain
+ double-quote character.
+ * win32/win32.c (is_internal_cmd): similar, use shell if a commandline
+ contain caret character.
- * test/rinda/test_rinda.rb: ditto.
+ * test/ruby/test_system.rb (TestSystem#test_system_at): fix
+ wrong test case. if system() invoke a command by using shell,
+ system() never return nil. Also, "" quotation must not appear
+ twice in a command line.
-Tue Apr 13 19:54:29 2004 Minero Aoki <aamine@loveruby.net>
+Mon Feb 28 17:36:57 2011 Tanaka Akira <akr@fsij.org>
- * lib/net/http.rb: should not overwrite HTTP request header.
- [ruby-list:39543]
+ * ext/openssl/ossl_pkcs7.c: parenthesize macro arguments.
-Tue Apr 13 01:30:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+Mon Feb 28 16:48:42 2011 Tanaka Akira <akr@fsij.org>
- * ext/iconv/iconv.c: RDoc documentation (from RD; nearly finished).
- * ext/iconv/charset_alias.rb: Prevent from RDoc'ing.
+ * ext/openssl/ossl_pkcs12.c: parenthesize macro arguments.
-Mon Apr 12 19:11:29 2004 Eric Hodel <drbrain@segment7.net>
+Mon Feb 28 16:28:15 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * gc.c (rb_gc_copy_finalizer): typo. [ruby-core:02774]
+ * string.c (tr_trans): when the hash for multibyte repl is empty,
+ tr is inverse mode, and a character doesn't much the table, the
+ character should be replaced by last replacement. Bug #4449
-Mon Apr 12 18:52:32 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Mon Feb 28 16:38:56 2011 Tanaka Akira <akr@fsij.org>
- * ext/openssl/ossl_x509name.c (ossl_x509name_init_i): should return
- a value.
+ * ext/openssl/ossl_ocsp.c: parenthesize macro arguments.
-Mon Apr 12 10:43:47 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Mon Feb 28 13:02:15 2011 Danial Pearce <github@tigris.id.au>
- * dir.c (rb_glob2, rb_glob, rb_globi, push_globs, push_braces,
- rb_push_glob): fix memory leak. (leaked when block was interrupted)
+ * lib/tempfile.rb: Fix example file paths in docs for tempfile.
+ https://github.com/ruby/ruby/pull/5
-Mon Apr 12 10:27:37 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Mon Feb 28 12:56:18 2011 URABE Shyouhei <shyouhei@ruby-lang.org>
- * bcc32/Makefile.sub: backport SIZEOF_TIME_T definition from 1.9.
+ * ext/openssl/ossl_cipher.c (ossl_cipher_init): typo fix.
+ https://github.com/ruby/ruby/pull/8
- * win32/Makefile.sub: ditto.
+Mon Feb 28 12:28:13 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * wince/Makefile.sub: ditto.
+ * ext/date/date_core.c (datetime_s_now): localtime() and localtime_r()
+ required time_t pointer as 1st parameter, and tv_sec member of struct
+ timeval is long.
-Sun Apr 11 19:12:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Feb 28 11:57:40 2011 Shota Fukumori <sorah@tubusu.net>
- * ruby.c (require_libraries): restore source file/line after
- statically linked extensions initialized. [ruby-dev:23357]
+ * test/testunit/test_parallel.rb: Temporally disable test on Windows.
-Sun Apr 11 10:47:04 2004 Dave Thomas <dave@pragprog.com>
+Mon Feb 28 07:28:35 2011 Shota Fukumori <sorah@tubusu.net>
- * lib/rdoc/code_objects.rb (RDoc::TopLevel::add_class_or_module): Toplevel
- classes and modules are a special case too... (handle extending existing
- classes with or without :enddoc:)
+ * lib/test/unit.rb(Test::Unit::Runner#after_worker_quit):
+ method name more be natural English.
-Sat Apr 10 23:51:13 2004 Dave Thomas <dave@pragprog.com>
+ * lib/test/unit.rb(Test::Unit::Runner::Worker.launch):
+ IO.sync doesn't need. Should use "b" for mode.
- * lib/rdoc/code_objects.rb (RDoc::Context::add_to): Implementation of :enddoc:
- made one too many assumptions...
+Sun Feb 27 21:59:37 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sat Apr 10 00:00:19 2004 Dave Thomas <dave@pragprog.com>
+ * test/ruby/test_system.rb (TestSystem#test_system_redirect_win):
+ add test for system().
- * lib/rdoc/markup/simple_markup/inline.rb: Fix problem
- with \_cat_<b>dog</b>
+Sun Feb 27 18:00:09 2011 Shota Fukumori <sorah@tubusu.net>
-Wed Apr 7 00:19:50 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * lib/test/unit.rb: Refactoring; Worker never use Hash for internal
+ storage.
- * lib/rinda/rinda.rb: fix hash tuple bug.
+ * lib/test/unit.rb: Never use Kernel#spawn. Use IO.popen instead.
- * lib/rinda/tuplespace.rb: ditto.
+Sun Feb 27 13:16:48 2011 Tanaka Akira <akr@fsij.org>
- * test/rinda/test_rinda.rb
+ * ext/openssl/ossl_ns_spki.c: parenthesize macro arguments.
-Tue Apr 6 18:24:18 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat Feb 26 17:07:53 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * io.c (rb_io_reopen): should use rb_io_check_io().
+ * lib/date.rb: [Feature #4257]
-Tue Apr 6 16:46:09 2004 Tanaka Akira <akr@m17n.org>
+ * ext/date/extconf.rb: new
- * configure.in: check the size of time_t.
+ * ext/date/date_core.c: new
- * time.c (time_add): new function.
- (time_plus): use time_add.
- (time_minus): use time_add.
+Sat Feb 26 16:10:23 2011 Shota Fukumori <sorah@tubusu.net>
-Tue Apr 6 13:21:30 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/test/unit.rb: --jobs-status won't puts over 2 lines.
- * ext/socket/socket.c (make_hostent): must return value.
+ * test/testunit/test_parallel.rb: Fix test for above.
-Tue Apr 6 00:05:30 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * lib/test/*: refactoring.
- * lib/rinda/rinda.rb: add require 'drb/drb'
+Sat Feb 26 07:10:05 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Mon Apr 5 08:18:23 2004 Dave Thomas <dave@pragprog.com>
+ * ext/psych/lib/psych/scalar_scanner.rb: fix parsing timezone's whose
+ whose format is (+/-)hhmm. Thanks Goncalo Silva!
- * lib/rdoc/rdoc.rb: Remove leading ./ from file names so that cross
- references work properly.
+ * test/psych/test_scalar_scanner.rb: test for bug.
-Sun Apr 4 20:33:42 2004 Minero Aoki <aamine@loveruby.net>
+Thu Feb 24 23:02:55 2011 Tanaka Akira <akr@fsij.org>
- * eval.c (Init_load): make $LOADED_FEATURES built-in.
- [ruby-dev:23299]
+ * ext/openssl/ossl_hmac.c: parenthesize macro arguments.
- * ruby.c (ruby_prog_init): make $PROGRAM_NAME built-in.
+Thu Feb 24 22:53:10 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/English.rb: remove $LOADED_FEATURES and $PROGRAM_NAME.
+ * common.mk (love): for the birthday.
-Sun Apr 4 14:01:20 2004 Dave Thomas <dave@pragprog.com>
+Thu Feb 24 22:51:54 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rdoc/options.rb (Options::parse): Allow multiple -x options to RDoc.
- Fix bug where files weren't being excluded properly
+ * vm.c (ruby_vm_destruct): run vm exit hooks after all objects are
+ destructed.
-Sat Apr 3 17:11:05 2004 why the lucky stiff <why@ruby-lang.org>
+Thu Feb 24 14:40:33 2011 Shota Fukumori <sorah@tubusu.net>
- * ext/syck/syck.h: version 0.43.
+ * ChangeLog (vim): Modeline for vim
- * ext/syck/lib/gram.c: allow root-level inline collections.
- [ruby-talk:94922]
+Thu Feb 24 13:39:25 2011 Shota Fukumori <sorah@tubusu.net>
- * lib/yaml/rubytypes.rb (Symbol#to_yaml): emit symbols as implicits.
- [ruby-talk:94930]
+ * common.mk: Use $RUNRUBY for worker process.
- * ext/syck/bytecode.c: turn off default implicit typing.
+ * lib/test/unit.rb: Fix bug.
- * ext/syck/implicit.c: detect base60 integers.
+ * lib/test/unit.rb: @options[:ruby](@opts[:ruby]) is now Array.
- * ext/syck/rubyext.c: handle base60, as well as hex and octal
- with commas. implicit typing of ruby symbols.
+ * test/testunit/parallel.rb: Fix for above.
-Fri Apr 2 17:27:17 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Feb 24 10:05:55 2011 Shota Fukumori <sorah@tubusu.net>
- * eval.c (top_include): include in the wrapped load is done for
- the wrapper, not for a singleton class for wrapped main.
- [ruby-dev:23305]
+ * test/testunit/tests_for_parallel/misc.rb: Fix bug in r30947.
-Fri Apr 2 15:13:44 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/test/unit.rb, lib/test/unit/assertions.rb: For this test.
- * bignum.c (rb_big_eq): use temporary double variable to save the
- result (internal float register may be bigger than 64 bits, for
- example, 80 bits on x86). [ruby-dev:23311]
+Wed Feb 23 23:07:38 2011 Shota Fukumori <sorah@tubusu.net>
-Fri Apr 2 14:35:26 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/testunit/test_parallel.rb, test/testunit/parallel/*:
+ Test for r30939.
- * eval.c (block_pass): should generate unique identifier of the
- pushing block. [ruby-talk:96363]
+ * lib/test/unit.rb: For test.
-Fri Apr 2 07:31:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/test/parallel.rb: For test.
- * ext/socket/socket.c (make_hostent): fix memory leak, based on
- the patch from HORIKAWA Hisashi <vzw00011@nifty.ne.jp>.
+ * lib/test/unit/testcase.rb: For test.
-Thu Apr 1 22:55:33 2004 Dave Thomas <dave@pragprog.com>
+Wed Feb 23 22:05:13 2011 Tanaka Akira <akr@fsij.org>
- * lib/rdoc/parsers/parse_rb.rb: Allow rdoc comments in
- =begin rdoc/=end
+ * ext/openssl/ossl_engine.c: parenthesize macro arguments.
- * lib/rdoc/parsers/parse_rb.rb: Fix problem with comment in
- top-level method being taken as file comment.
+Tue Feb 22 23:15:17 2011 Shota Fukumori <sorah@tubusu.net>
-Thu Apr 1 22:55:04 2004 Dave Thomas <dave@pragprog.com>
+ * lib/test/unit.rb: Fix --ruby option doesn't effect.
- * lib/rdoc/ri/ri_options.rb: Fix undefined variable warning.
+ * lib/test/unit.rb: Fix typo.
-Thu Apr 1 19:58:37 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Tue Feb 22 21:39:28 2011 Tanaka Akira <akr@fsij.org>
- * lib/soap/mapping/{factory.rb,registry.rb}: fixed illegal mapped URI
- object with soap/marshal.
- added URIFactory class for URI mapping. BasetypeFactory checks
- instance_variables when original mapping is not allowed (ivar must
- be empty). Instance of URI have instance_variables but it must be
- llowed whenever original mapping is allowed or not.
+ * ext/openssl/ossl_digest.c: parenthesize macro arguments.
- * lib/xsd/datatypes.rb: check the smallest positive non-zero
- single-precision float exactly instead of packing with "f".
- [ruby-talk:88822]
+Tue Feb 22 14:34:26 2011 Shota Fukumori <sorah@tubusu.net>
- * lib/soap/mapping/rubytypeFactory.rb: should not dump singleton class.
- [ruby-dev:22588]
- c = class << Object.new; class C; self; end; end; SOAPMarshal.dump(c)
+ * lib/test/unit.rb: Fix merging miss.
-Wed Mar 31 19:06:23 2004 Tanaka Akira <akr@m17n.org>
+Tue Feb 22 12:27:26 2011 Shota Fukumori <sorah@tubusu.net>
- * time.c (year_leap_p): new function.
- (timegm_noleapsecond): ditto.
- (search_time_t): use timegm_noleapsecond instead of
- mktime for first guess.
+ * lib/test/unit.rb: Add new options; --jobs,-j,--ruby,--jobs-status,
+ --no-retry.
+ [Feature #4415] [ruby-dev:43226],[ruby-dev:43222],[ruby-core:35294]
-Wed Mar 31 12:04:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/test/unit/parallel.rb: Used at test/unit --jobs(-j) option.
- * lib/delegate.rb (DelegateClass): define internal methods of the
- result class, but not metaclass of the caller. [ruby-talk:96156]
+ * test/csv/test_serialization.rb: test/unit parallel running ready.
- * intern.h: provide proper prototypes. [ruby-core:02724]
+ * test/rake/test_file_task.rb: test/unit parallel running ready.
- * ruby.h: missing.h is now prerequisite to intern.h.
+Tue Feb 22 06:09:10 2011 Eric Hodel <drbrain@segment7.net>
-Tue Mar 30 20:25:34 2004 Tanaka Akira <akr@m17n.org>
+ * ext/syslog/syslog.c: Apply documentation patch from mathew murphy.
+ [Bug #4149]
- * time.c (search_time_t): limit guess range by mktime if it is
- available. [ruby-dev:23274]
+Tue Feb 22 03:09:10 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Sun Mar 28 14:16:59 2004 Minero Aoki <aamine@loveruby.net>
+ * ext/psych/lib/psych.rb: increase Psych to 1.1.0 for help with
+ debugging.
- * lib/net/pop.rb (auth): failed when account/password include "%".
- [ruby-talk:95933]
+Tue Feb 22 03:04:46 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Sat Mar 27 21:40:41 2004 Tanaka Akira <akr@m17n.org>
+ * ext/psych/lib/psych/streaming.rb: refactor streaming methods to a
+ module.
+ * ext/psych/lib/psych/stream.rb: extracted streaming specific methods
+ to a module.
+ * ext/psych/lib/psych/json/stream.rb: JSON stream inherits from
+ JSONTree and includes streaming methods.
+ * ext/psych/lib/psych/visitors/json_tree.rb: JSON does not support
+ object references, so remove object reference testing when building
+ JSON trees.
- * lib/open-uri.rb: permit extra semicolon in content-type field.
+Tue Feb 22 02:41:51 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Sat Mar 27 10:40:48 2004 Tanaka Akira <akr@m17n.org>
+ * ext/psych/lib/psych/visitors/yaml_tree.rb (accept): use Hash#key?
+ when looking up object references to err on the side of cache
+ misses.
- * (lib/pp.rb, lib/prettyprint.rb): define seplist in PP::PPMethods
- instead of PrettyPrint.
+Mon Feb 21 10:58:39 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Thu Mar 25 23:28:52 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/psych/lib/psych/json/yaml_events.rb: refactoring JSON event
+ handling methods to a module for reuse.
+ * ext/psych/lib/psych/json/tree_builder.rb: AST builder uses JSON
+ event methods.
+ * ext/psych/lib/psych/json/stream.rb: stream emitter uses JSON event
+ methods.
- * time.c (time_overflow_p): backport 1.9 usec overflow function.
- (ruby-bugs PR#1307)
+Mon Feb 21 10:54:29 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Thu Mar 25 23:15:24 2004 Dave Thomas <dave@pragprog.com>
+ * ext/psych/lib/psych/json/stream.rb: do not emit custom tags in maps
+ or sequences when emitting JSON.
+ * ext/psych/lib/psych/json/tree_builder.rb: do not emit custom tags in
+ sequences when emitting JSON.
+ * test/psych/json/test_stream.rb: tests for custom stream emits.
+ * test/psych/test_json_tree.rb: tests for JSON emits.
- * lib/rdoc/ri/ri_options.rb (RI::Options::show_version):
- Add --version option
+Mon Feb 21 10:05:10 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Thu Mar 25 04:16:18 2004 Dave Thomas <dave@pragprog.com>
+ * ext/psych/lib/psych/json/ruby_events.rb: DRY up ruby event handling
+ for JSON.
+ * ext/psych/lib/psych/visitors/json_tree.rb: use ruby events module
+ * ext/psych/lib/psych/json/stream.rb: ditto
- * lib/rdoc/ri/ri_options.rb (RI::Options): Add the --list-names option,
- which dumps our all known names
+Mon Feb 21 10:01:01 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Thu Mar 25 03:57:47 2004 Dave Thomas <dave@pragprog.com>
+ * ext/psych/lib/psych/json/stream.rb: fix JSON stream emits to use
+ double quotes during stream.
+ * test/psych/json/test_stream.rb: tests to reflect changes.
- * lib/rdoc/ri/ri_util.rb (NameDescriptor::initialize): No longer
- allow nested classes to be designated using "."--you must
- now use "::"
+Mon Feb 21 00:38:56 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu Mar 25 02:00:18 2004 Dave Thomas <dave@pragprog.com>
+ * test/ruby/test_system.rb (TestSystem#test_system_at):
+ add testcase for bug4396.
- * lib/rdoc/generators/template/html/one_page_html.rb (Page):
- Fix to work with C modules.
+Sun Feb 20 19:59:32 2011 Tanaka Akira <akr@fsij.org>
-Wed Mar 24 21:17:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+ * ext/openssl/ossl_cipher.c: parenthesize macro arguments.
- * lib/uri.rb: Documented (thanks Dmitry V. Sabanin).
- * lib/uri/common.rb: Ditto.
- * lib/uri/ftp.rb: Ditto.
- * lib/uri/generic.rb: Ditto.
- * lib/uri/http.rb: Ditto.
- * lib/uri/https.rb: Ditto.
- * lib/uri/ldap.rb: Ditto.
- * lib/uri/mailto.rb: Ditto.
- (All backported from 1.9)
+Sun Feb 20 16:26:45 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Mar 24 18:48:26 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread.c (exec_recursive): prevent temporary objects from GC.
- * lib/mkmf.rb ($ruby, $topdir, $hdrdir): should not be affected by
- DESTDIR after installed.
+ * prevent temporary objects from GC, and should not use
+ RSTRING_PTR() for function calls since it evaluates the argument
+ a couple of times.
- * lib/mkmf.rb (RUBY): / is not recognized as path separator on
- nmake/bmake. [ruby-list:39388]
+Sun Feb 20 16:22:53 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/mkmf.rb (init_mkmf): $INCFLAGS also should be lazy-evaluated.
+ * file.c (rb_file_flock): use rb_thread_io_blocking_region for the
+ time being.
-Wed Mar 24 12:32:56 2004 Dave Thomas <dave@pragprog.com>
+Sun Feb 20 05:33:17 2011 Ryan Davis <ryand-ruby@zenspider.com>
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_class_module):
- Don't document methods if we don't know for sure the
- class or module.
+ * lib/minitest/*.rb: Imported minitest 2.0.2 r6207.
+ * test/minitest/*: ditto
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
- Don't store documentation for singleton classes if we
- don't know the real class.
+Sun Feb 20 02:14:09 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Mar 24 11:11:26 2004 Dave Thomas <dave@pragprog.com>
+ * signal.c (sig_trap): avoid pthread_sigmask(xx, &mask, &mask) usage
+ because FreeBSD don't permit it. If it's used, it behave as
+ pthread_sigmask(xx, NULL, &mask).
- * lib/rdoc/generators/html_generator.rb (Generators::HTMLGenerator::load_html_template):
- Allow non-RDoc templates by putting a slash in the template name
+ * signal.c (init_sigchld): ditto.
-Mon Mar 22 16:19:57 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Sun Feb 20 00:46:51 2011 Tanaka Akira <akr@fsij.org>
- * ruby.1: add -width option to .Bl for old groff.
+ * ext/openssl/ossl_bn.c: parenthesize macro arguments.
-Sun Mar 21 21:11:16 2004 Keiju Ishitsuka <keiju@ishitsuka.com>
+Sat Feb 19 22:37:42 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * lib/shell/*: bug fix for Shell#system(command_line_string).
+ * vm_insnhelper.c (vm_check_if_namespace): guard temporary object
+ from GC.
-Sat Mar 20 20:57:10 2004 David Black <dblack@wobblini.net>
+Sat Feb 19 06:36:27 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/scanf.rb: Backported 1.9 branch
- modifications/corrections to 1.8 branch
+ * lib/test/unit.rb: partial revert of r30849. [ruby-core:32864]
-Sat Mar 20 23:51:03 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+ * test/testunit/test_rake_integration.rb: adding an integration test
+ with the rake loader to prevent regressions.
- * eval.c (rb_require_safe): preserve old ruby_errinfo.
- [ruby-talk:95409]
+Fri Feb 18 19:31:31 2011 Shugo Maeda <shugo@ruby-lang.org>
- * eval.c (rb_f_raise): should not clear backtrace information if
- exception object already have one.
+ * lib/fileutils.rb (FileUtils::remove_entry_secure): there is a
+ race condition in the case where the given path is a directory,
+ and some other user can move that directory, and create a
+ symlink while this method is executing.
+ Reported by: Nicholas Jefferson <nicholas at pythonic.com.au>
-Sat Mar 20 15:25:36 2004 Dave Thomas <dave@pragprog.com>
+Fri Feb 18 00:28:39 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * lib/rdoc/generators/template/html/html.rb (RDoc::Page): Force
- page background to white.
+ * compile.c (get_exception_sym2type): guard temporary object from GC.
-Sat Mar 20 09:52:33 2004 Tadayoshi Funaba <tadf@dotrb.org>
+Thu Feb 17 23:54:29 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * lib/date.rb, lib/date/format.rb: _parse() now accepts fractional
- part of second minute that follows a comma or a full stop.
+ * iseq.c (prepare_iseq_build): initialize iseq_compile_data::err_info
+ with nil. this fix exception in rb_iseq_load().
-Fri Mar 19 01:55:57 2004 Mauricio Fernandez <batsman.geo@yahoo.com>
+Thu Feb 17 22:32:35 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * io.c (rb_io_sync): need not to check writable. [ruby-core:02674]
+ * test/ruby/test_marshal.rb (test_marshal_dump_extra_iv):
+ fix a typo of local variable. [Bug #3720] [ruby-dev:42083]
-Thu Mar 18 21:44:38 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Thu Feb 17 21:32:53 2011 Tanaka Akira <akr@fsij.org>
- * lib/drb/drb.rb: backport drb.rb 1.16.
+ * ext/openssl/ossl.h: parenthesize macro arguments.
-Fri Mar 18 17:49:51 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Feb 16 20:37:48 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * struct.c (make_struct): allow const_id for accessor names.
- [ruby-core:04585]
+ * eval_jump.c (rb_exec_end_proc): changed at_exit and END proc
+ evaluation order. [Bug #4400] [ruby-core:35237]
+ * eval_jump.c (rb_mark_end_proc): ditto.
- * eval.c (rb_attr): check if attribute name is local_id or
- const_id.
+ * test/ruby/test_beginendblock.rb (TestBeginEndBlock#test_nested_at_exit):
+ added a test for nested at_exit.
+ * test/ruby/test_beginendblock.rb (TestBeginEndBlock#test_beginendblock):
+ changed the test to adopt new spec.
-Thu Mar 18 16:22:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Feb 16 20:17:06 2011 Tanaka Akira <akr@fsij.org>
- * eval.c (proc_eq): avoid false positive by using scope and
- dyna_vars. no longer use frame.uniq.
+ * ext/openssl/openssl_missing.h: parenthesize macro arguments.
-Wed Mar 17 14:44:43 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Tue Feb 15 21:37:45 2011 Tanaka Akira <akr@fsij.org>
- * dir.c (range): fix possible "\0" overrun. (in case of "\0-")
+ * ext/gdbm/gdbm.c: parenthesize macro arguments.
-Mon Mar 15 07:39:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Feb 15 20:34:53 2011 Tanaka Akira <akr@fsij.org>
- * eval.c (rb_yield_0): should not re-submit TAG_BREAK if this
- yield is not break destination. [ruby-dev:23197]
+ * array.c (ary_join_1): fix array size.
-Sat Mar 13 14:28:16 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Tue Feb 15 19:43:23 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * test/drb/test_drbssl.rb: rescue LoadError. (Barkport from main
- trunk)
+ * configure.in: fix and resubmit r30621. [ruby-dev:43203]
- * test/drb/test_drbunix.rb: ditto.
+Tue Feb 15 15:41:30 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Mar 10 22:28:09 2004 Minero Aoki <aamine@loveruby.net>
+ * array.c (array_join): copy the encoding of the first element as
+ an initial encoding.
- * lib/fileutils.rb (remove_dir): should handle symlink correctly.
- This patch is contributed by Christian Loew. [ruby-talk:94635]
- (Backport from main trunk)
+ * array.c (array_join_0): ditto.
-Wed Mar 10 16:28:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * array.c (array_join_1): ditto.
- * eval.c (return_jump): set return value to the return
- destination. separated from localjump_destination().
+ * array.c (inspect_ary): ditto.
- * eval.c (break_jump): break innermost loop (or thread or proc).
+ * array.c (array_join_1): add an argument to check the appending is
+ first one or not.
- * eval.c (rb_yield_0): set exit_value for block break.
+Tue Feb 15 15:40:53 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Mar 10 15:58:43 2004 Ryan Davis <ryand@zenspider.com>
+ * hash.c (inspect_i): copy the encoding of the first key as
+ an initial encoding.
- * eval.c (eval): Only print backtrace if generating the backtrace
- doesn't generate an exception. [ruby-core:02621]
+Mon Feb 14 15:00:16 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Mar 9 13:04:26 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * array.c (inspect_ary): don't taint the inspected result of a
+ recursive array.
- * io.c (rb_io_ungetc): raise IOError instead of calling
- rb_sys_fail(). [ruby-talk:23181]
+Tue Feb 15 15:43:29 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Mar 8 19:32:28 2004 akira yamada <akira@ruby-lang.org>
+ * encoding.c (rb_enc_compatible): change the rule for empty strings:
+ remove the special treatment of the US-ASCII encoded empty string.
+ Now Encoding.compatible? usually respect the encoding of the
+ receiver.
- * lib/uri/common.rb (URI::REGEXP::PATTERN::HOSTPORT): (?:#{PORT})
- -> (?::#{PORT}). [ruby-dev:23170]
+Tue Feb 15 15:39:37 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Mar 8 15:31:41 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * string.c (rb_enc_cr_str_buf_cat): remove special treatment of
+ ASCII-8BIT receivers.
- * dir.c (range): treat incomplete '[' as ordinary character (like
- has_magic does).
+ * string.c (str_gsub): set initial encoding of the buffer as the
+ same of the receiver. [ruby-core:35141]
- * dir.c (range): Cancel above change. More discussion is needed.
+Tue Feb 15 09:49:33 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Sun Mar 7 22:37:46 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * test/ruby/test_system.rb (TestSystem#test_system_at): use findstr
+ command instead of find command, because the latter is confusing
+ another famous Unix command.
- * test/drb/ut_drb.rb: use 'druby://localhost:0'. [ruby-dev:23078]
+Mon Feb 14 23:01:19 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * test/drb/ut_eval.rb: ditto.
+ * thread.c (rb_thread_io_blocking_region): reset th->waiting_fd
+ after blocking region, because remaining waiting_fd might
+ cause unnecessary IOError.
- * test/drb/ut_large.rb: ditto.
+Mon Feb 14 21:06:50 2011 URABE Shyouhei <shyouhei@ruby-lang.org>
- * test/drb/ut_safe1.rb: ditto.
+ * configure.in: revert r30621. That revision introduced mkmf test
+ failures and it turned out to be OK to revert. [ruby-dev:43203]
- * test/drb/ut_drb_drbssl.rb: use 'drbssl://localhost:0'.
+Mon Feb 14 21:04:01 2011 Tanaka Akira <akr@fsij.org>
-Sun Mar 7 16:22:26 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+ * ext/fiddle/conversions.h: parenthesize macro arguments.
- * Makefile.in (lex.c): use $? instead of $<.
+Mon Feb 14 18:41:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Fri Mar 5 00:54:14 2004 Dave Thomas <dave@pragprog.com>
+ * win32/setup.mak (USE_RUBYGEMS): fixed r30835. It didn't work on
+ mswin32 port. If you changed win32/configure.bat, you should change
+ setup.mak too.
- * lib/test/unit.rb: MOve RDoc documentation so that you can
- now say 'ri Test::Unit'
+Mon Feb 14 17:28:34 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Mar 2 12:32:59 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/ruby/test_system.rb (TestSystem#test_system_at):
+ added test. [ruby-core:35218] (#4393)
- * win32/Makefile.sub, wince/Makefile.sub (config.h): shouldn't check
- defined? NORETURN. [ruby-dev:23100]
+Mon Feb 14 13:15:35 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Mar 1 12:24:10 2004 Dave Thomas <dave@pragprog.com>
+ * win32/win32.c (is_internal_cmd): if the first char of prog is '@',
+ execute it via shell. [ruby-core:35218] (#4393)
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_alias):
- Allow aliases to have parentheses
+Mon Feb 14 10:33:45 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Sun Feb 29 23:14:53 2004 Dave Thomas <dave@pragprog.com>
+ * lib/test/unit.rb: revert r30863, because it causes too many noise.
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
- Handle :nodoc: on singleton classes.
+Mon Feb 14 07:34:55 2011 Tanaka Akira <akr@fsij.org>
-Sat Feb 28 10:58:49 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * ext/curses/curses.c: parenthesize macro arguments.
- * MANIFEST: add test_erb.rb
+Sun Feb 13 19:41:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/erb.rb, test/erb/test_erb.rb: don't forget filename,
- if both filename and safe_level given. [ruby-dev:23050]
+ * lib/test/unit.rb (Test::Unit::RequireFiles#non_options): skip
+ test suites failed to load instead of mere messages.
-Fri Feb 27 01:00:09 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Sun Feb 13 09:56:44 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/drb/drb.rb, test/drb/drbtest.rb: require drb/eq.rb by default
+ * test/openssl/test_config.rb (OpenSSL#test_freeze): fix error
+ message assertion.
-Wed Feb 25 21:16:25 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/io/nonblock/test_flush.rb (TestIONonblock#flush_test):
+ return true to finish the test.
- * instruby.rb (with_destdir): should return the given argument if no
- DESTDIR is given.
+ * test/syck/test_string.rb (Syck::TestString#test_non_binary_string):
+ use assert_not instead of refute, unless required minitest
+ explicitly.
- * instruby.rb: use path name expansion of cmd.exe.
+ * test/test_prime.rb (TestPrime::sieve.Integer): ditto.
-Wed Feb 25 09:35:22 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/xmlrpc/webrick_testing.rb (WEBrick_Testing#start_server):
+ catch IOError when server socket was closed.
- * error.c (NameError::Message): new class for lazy evaluation of
- message to ensure replaced before marshalling. merge from HEAD.
- (ruby-bugs-ja:PR#588)
+Sun Feb 13 07:39:51 2011 Yukihiro Matsumoto <matz@ruby-lang.org>
- * eval.c (rb_method_missing): use NameError::Message. merge from
- HEAD. (ruby-bugs-ja:PR#588)
+ * enum.c (enum_inject): typo fixed. a patch from Gaku Ueda in
+ [ruby-core:35216].
-Tue Feb 24 18:59:37 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Sun Feb 13 00:48:47 2011 Tadayoshi Funaba <tadf@dotrb.org>
- * dir.c (glob_helper): '**/' should not match leading period
- unless File::FNM_DOTMATCH is set. (like '*/') [ruby-dev:23014]
+ * lib/date.rb (Date#===): [ruby-core:35127]
-Tue Feb 24 13:22:21 2004 Dave Thomas <dave@pragprog.com>
+Sun Feb 13 00:29:18 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rdoc/rdoc.rb (RDoc::RDoc::normalized_file_list): Attempt to get better
- heuristics on which files to include and exclude. Now only include
- non-standard files if they are explicitly named in ARGV.
+ * lib/test/unit.rb (Test::Unit::Options#process_args): always
+ return options.
-Tue Feb 24 07:23:30 2004 Dave Thomas <dave@pragprog.com>
+ * lib/test/unit.rb (Test::Unit::RequireFiles#non_options): return
+ if any test case get loaded.
- * lib/rdoc/generators/html_generator.rb: Deal with :stopdoc: when
- choosing a default main page to display (ie. don't select a page
- if we don't have documentation for it).
+ * lib/test/unit.rb (Test::Unit::AutoRunner#initialize): do not add
+ default directory if it is nil.
-Tue Feb 24 06:40:14 2004 Dave Thomas <dave@pragprog.com>
+ * lib/test/unit.rb (Test::Unit::AutoRunner#process_args): return
+ true if any test cases to run.
- * lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
- class variables in code listings
+Sat Feb 12 23:17:43 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Feb 24 06:40:14 2004 Dave Thomas <dave@pragprog.com>
+ * lib/test/unit.rb (assert_include): add alias.
- * lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
- class variables in code listings
+Sat Feb 12 14:44:20 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Feb 24 06:32:27 2004 Dave Thomas <dave@pragprog.com>
+ * thread.c (rb_thread_io_blocking_region): new function to run
+ blocking region with GIL released, for fd.
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_aliases): Handle
- aliases in C files.
+ * thread.c (rb_thread_fd_close): implement. [ruby-core:35203]
-Tue Feb 24 06:16:22 2004 Dave Thomas <dave@pragprog.com>
+ * vm.c (th_init): rename from th_init2.
- * lib/rdoc/rdoc.rb (RDoc::RDoc::document): Now create op dir _before_
- parsing files.
+Sat Feb 12 14:41:36 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Feb 24 06:08:47 2004 Dave Thomas <dave@pragprog.com>
+ * lib/test/unit.rb (Test::Unit::AutoRunner#initialize): use
+ default_dir if no test case given.
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_constant):
- Start collecting text of constant values earlier: was missing
- values in output if there was no space after '='
+ * lib/test/unit.rb (Test::Unit::Runner): rename from Test::Unit::Mini.
-Tue Feb 24 06:08:25 2004 Dave Thomas <dave@pragprog.com>
+ * lib/test/unit.rb (Test::Unit::GlobOption#non_options): run tests
+ under base directory if no argument given.
- * lib/rdoc/generators/html_generator.rb: Escape contant values.
+Sat Feb 12 08:03:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Feb 24 03:45:06 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * test/ruby/test_settracefunc.rb (TestSetTraceFunc): ensure to use
+ method_added hook defined in Module.
- * ext/openssl/ossl_config.c (ossl_config_each): add new method
- OpenSSL::Config#each. it iterates with section name, field name
- and value.
+Sat Feb 12 01:04:02 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_config.c (Init_ossl_config): include Enumerable.
+ * ruby.c (proc_options): enable rubygems if --gem option is given.
-Mon Feb 23 09:16:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c (process_options): load rubygems if it is disabled but
+ --gem option is given.
- * instruby.rb (DOSISH): embedded path in batch files should not be
- prefixed by DESTDIR. [ruby-core:02186]
+Fri Feb 11 23:27:50 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-Sun Feb 22 09:54:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+ * ruby.c (proc_options): add --gem=enabled as an alias of
+ --enable=gems and --gem=disabled as an alias of --disable=gems.
+ Gem named "enabled" or "disabled" has already been reserved
+ legitimately for this purpose.
- * re.c: corrected documentation format (again)
+Fri Feb 11 23:17:04 2011 Tanaka Akira <akr@fsij.org>
-Sun Feb 22 09:43:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+ * ext/dl/cfunc.c: parenthesize macro arguments.
- * re.c: corrected documentation format (rb_reg_initialize_m)
+Fri Feb 11 21:41:53 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Feb 21 22:36:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * ext/zlib/zlib.c: documented, but needs more effort.
-
-Sat Feb 21 11:12:15 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * bin/testrb, test/runner.rb, lib/test/unit.rb: improve backward
+ compatibility.
- * missing/os2.c, missing/x68.c: typo fix. pointed out by greentea.
+Fri Feb 11 19:45:26 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Feb 20 18:59:47 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * eval.c (ruby_cleanup): use rb_ary_free to free internal object.
- * lib/irb/init.rb (IRB::IRB.parse_opts): add -I option to
- irb. [ruby-dev:39243]
+ * gc.h (RUBY_FREE_UNLESS_NULL): get rid of double free.
+ [ruby-core:35192]
-Thu Feb 19 23:24:16 2004 Dave Thomas <dave@pragprog.com>
+Fri Feb 11 16:57:03 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
- Support visibility modifiers for attributes
+ * test/ruby/test_transcode.rb (test_from_cp50221): fix wrong
+ assertion and move back.
-Thu Feb 19 23:24:16 2004 Dave Thomas <dave@pragprog.com>
+Fri Feb 11 14:33:18 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
- Support visibility modifiers for attributes
+ * lib/test/unit/assertions.rb (assert_no_match): alias for
+ backward compatibility.
-Thu Feb 19 22:39:04 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Fri Feb 11 12:06:48 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/rinda/test_rinda.rb: DRb.start_service only once in testsuites.
- DRb.start_service could handle this.
+ * ruby.c (add_gems, require_libraries, proc_options): add
+ --require and --gem options.
-Thu Feb 19 22:19:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+Fri Feb 11 12:03:24 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/ostruct.rb: documented
+ * configure.in (rubygems): add --disable-rubygems option.
-Thu Feb 19 21:28:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+Fri Feb 11 11:39:03 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/strscan/strscan.c: improved documentation
+ * template/fake.rb.in (CROSS_COMPILING): get rid of NameError.
-Thu Feb 19 03:10:52 2004 Minero Aoki <aamine@loveruby.net>
+Thu Feb 10 23:12:34 2011 Tanaka Akira <akr@fsij.org>
- * ext/strscan/strscan.c: synchronized with main trunk (rev 1.11).
+ * ext/dl/dl.h: parenthesize macro arguments.
-Thu Feb 19 02:30:34 2004 Minero Aoki <aamine@loveruby.net>
+Wed Feb 9 23:11:27 2011 Tanaka Akira <akr@fsij.org>
- * ext/strscan/strscan.c: documentation checked.
+ * ext/pty/pty.c: parenthesize macro arguments.
-Thu Feb 19 00:11:05 2004 Dave Thomas <dave@pragprog.com>
+Tue Feb 8 11:47:11 2011 Loren Sands-Ramshaw <lorensr@gmail.com>
- * lib/rdoc/markup/simple_markup/preprocess.rb (SM::PreProcess::handle):
- Strip extraneous space from filenames in :include:
+ * array.c: documentation clarification in rotate, rotate!,
+ index, and rindex. [ruby-core:35144]
-Wed Feb 18 22:52:00 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Wed Feb 9 09:45:43 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/drb/unix.rb: remove O_NONBLOCK, thanks \ay
+ * test/rdoc/test_rdoc_encoding.rb: remove unnecessary (and wrong)
+ platform-dependent hacks.
-Wed Feb 18 22:47:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+Wed Feb 9 00:47:18 2011 Tanaka Akira <akr@fsij.org>
- * ext/strscan/strscan.c: documented
+ * ext/etc/etc.c: parenthesize macro arguments.
-Wed Feb 18 22:03:11 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Tue Feb 8 19:38:00 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/*: should not depend on $KCODE.
+ * misc/ruby-mode.el (ruby-expr-beg): fix for invalid nest errors.
-Wed Feb 18 17:18:01 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Tue Feb 8 19:22:59 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/win32ole/win32ole.c: need to include <olectl.h> on Cygwin.
+ * configure.in (AC_MSG_CHECKING): fixed typo. the patch is
+ created by Benoit Daloze. Thanks a lot. [Bug #4384][ruby-core:35148]
-Wed Feb 18 10:40:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Feb 8 16:04:03 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * sprintf.c (rb_f_sprintf): do not prepend dots for negative
- numbers if FZERO is specified. [ruby-dev:39218]
+ * io.c (rb_io_s_sysopen): use NUM2MODET() instead NUM2UINT().
-Tue Feb 17 23:40:34 2004 Guy Decoux <ts@moulon.inra.fr>
+Tue Feb 8 15:59:23 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * sprintf.c (rb_f_sprintf): preserve original val for
- format_integer. [ruby-talk:92975]
+ * process.c (rb_run_exec_options_err): use MODET2NUM() instead
+ LONG2NUM().
-Tue Feb 17 23:28:45 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Tue Feb 8 13:59:56 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * test/ruby/marshaltestlib.rb: common marshal testcase added.
+ * configure.in: revert r30725. Now we have proper runtime fallback.
+ Therefore, no need compile time disabling. (see r30762).
- * test/ruby/test_marshal.rb: use above testsuite.
+Tue Feb 8 01:00:21 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * test/soap/marshal/test_marshal.rb: ditto.
+ * process.c (proc_setgroups): add GC guard to prevent intermediate
+ variable from GC.
- * test/soap/marshal/cmarshal.rb: removed (not used).
+Tue Feb 8 00:56:33 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Feb 17 10:51:23 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * misc/ruby-mode.el (ruby-expr-beg, ruby-in-here-doc-p): tell
+ singleton class definitions from here documents.
- * ext/syck/rubyext.c (syck_emitter_end_object): takes only one arg.
+ * misc/ruby-mode.el (ruby-expr-beg, ruby-parse-partial): keyword
+ followed by colon is label.
-Tue Feb 17 01:35:28 2004 Tanaka Akira <akr@m17n.org>
+Mon Feb 7 22:56:16 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * eval.c (rb_eval): care that another thread replace NODE_DREGX_ONCE
- to NODE_LIT. [ruby-dev:22920]
+ * lib/benchmark.rb (Benchmark#bmbm): use ensure clause instead of
+ Object#tap to restore STDOUT.sync.
-Tue Feb 17 01:24:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Feb 7 22:34:20 2011 Tanaka Akira <akr@fsij.org>
- * bcc32/Makefile.sub, win32/Makefile.sub (config.h): define
- STACK_GROW_DIRECTION. [ruby-dev:22910]
+ * lib/net/http.rb (Net::HTTP#connect): support SNI (Server Name
+ Indication) for HTTPS. [ruby-dev:43164]
+ http://stackoverflow.com/questions/4685736/openssl-server-name-indication-support-in-ruby
- * bcc32/Makefile.sub (config.h): add newer checks.
+Mon Feb 7 16:05:32 2011 Eric Hodel <drbrain@segment7.net>
- * wince/Makefile.sub (config.h): define NEED_IO_SEEK_BETWEEN_RW.
+ * lib/rdoc: Upgrade to RDoc 3.5.3 Fixes [Bug #4376]
-Tue Feb 17 00:38:10 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Mon Feb 7 11:46:59 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/rinda/tuplespace.rb: TupleSpace#initialize, stop doubling timeout
+ * common.mk (rdoc): add --encoding=UTF-8; ruby's rdoc must be UTF-8.
-Tue Feb 17 00:18:03 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Mon Feb 7 10:21:50 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/rinda/test_rinda.rb: import test_rinda.rb
+ * test/rdoc/test_rdoc_options.rb (TestRDocOptions#test_check_files):
+ there is no easy way to create owner unreadable file on Windows.
+ So, skip the test.
-Tue Feb 17 00:14:30 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Sun Feb 6 13:48:29 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * bcc32/Makefile.sub: avoid warning "Redefinition of macro
- 'HAVE_GETLOGIN'".
+ * ext/json/lib/json/common.rb (JSON::MissingUnicodeSupport.iconv):
+ should not drop rest of the result. use Iconv.conv instead.
- * vms/config.h_in: ditto.
+Sun Feb 6 12:46:02 2011 Eric Hodel <drbrain@segment7.net>
-Mon Feb 16 23:28:14 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * string.c (gsub): Ensure result encoding is the same as input
+ encoding. [Bug #4340].
- * lib/csv.rb: document reduction. [ruby-core:02429]
+Sun Feb 6 12:18:25 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Feb 16 22:08:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+ * parse.y (words, qwords): dispatch array events. based on a
+ patch from Michael Edgar. [Bug #4365].
- * lib/generator.rb: corrected doc format
- * lib/rinda/rinda.rb: added documentation (from Hugh Sasse)
- * lib/rinda/tuplespace.rb: ditto
+Sun Feb 6 12:12:59 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Feb 16 20:41:32 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * test/fileutils/fileasserts.rb (FileAssertions): separate module.
- * bcc32/Makefile.sub: show more warnings. (refering to mingw)
+Sun Feb 6 11:29:23 2011 Tanaka Akira <akr@fsij.org>
- * bcc32/setup.mak: ditto.
+ * ext/dbm/dbm.c: parenthesize macro arguments.
-Mon Feb 16 13:39:44 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Sat Feb 5 22:01:59 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * dir.c (rb_glob, rb_globi): add const.
+ * lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
+ revert r30796. r30797 and r30798 are an alternative fix.
+ [ruby-dev:43174]
- * ruby.h: ditto.
+Sat Feb 5 21:47:09 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Feb 16 02:16:33 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+ * parse.y (mlhs_basic): include mlhs_post for ripper. a patch
+ from Michael Edgar at [ruby-core:35078].
- * bcc32/Makefile.sub: should warn suspicious pointer conversion.
+Sat Feb 5 21:22:21 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * bcc32/setup.mak: ditto.
+ * lib/test/unit/assertions.rb (assert_block): move from
+ test/fileutils/fileasserts.rb.
-Sun Feb 15 19:06:42 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * test/fileutils/fileasserts.rb (assert_block): pass arguments
+ as-is. [ruby-dev:43174]
- * lib/rinda/tuplespace.rb: TupleSpace#read(tpl, 0), raise
- RequestExpiredError if not found.
+Sat Feb 5 16:47:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun Feb 15 15:56:46 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
+ msg can be passed nil. [Bug #4371] [ruby-dev:43174]
- * ext/win32ole/win32ole.c: add IDispatch wrapper in val2variant.
- Thanks, arton.
+Sat Feb 5 15:18:25 2011 Eric Hodel <drbrain@segment7.net>
-Sun Feb 15 01:46:05 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * lib/rdoc: Upgrade to RDoc 3.5.2
- * lib/mkmf.rb: absolute path of ruby is assigned to $(RUBY).
- [ruby-dev:22870]
+Sat Feb 5 12:05:27 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Feb 14 11:29:41 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * ext/syck/rubyext.c (syck_node_init_copy): SyckNode is not
+ copiable. [ruby-core:35094]
- * sample/drb/*: import lib/drb/sample
+Sat Feb 5 11:48:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Feb 14 11:08:23 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * ext/openssl/ossl_cipher.c (ossl_cipher_alloc): leave data ptr
+ NULL.
- * lib/drb/drb.rb: add pretty_print, thanks gotoken.
+ * ext/openssl/ossl_cipher.c (ossl_cipher_new, ossl_cipher_initialize):
+ allocate internal structure. [ruby-core:35094]
-Fri Feb 13 12:35:08 2004 Minero Aoki <aamine@loveruby.net>
+ * ext/openssl/ossl_cipher.c (ossl_cipher_copy): ditto.
- * test/fileutils/test_fileutils.rb: File.link may raise EINVAL and
- EACCES on Windows.
+Sat Feb 5 11:29:10 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Feb 12 21:45:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+ * ext/json/parser/parser.h (GET_PARSER): raise TypeError.
- * lib/ftools.rb: documented
+ * ext/json/parser/parser.rl (cParser_initialize): ditto.
-Thu Feb 12 21:25:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+ * ext/json/parser/parser.h (GET_PARSER): check if initialized.
+ [ruby-core:35079]
- * lib/base64.rb: backported from HEAD (modularised and documented)
+ * ext/json/parser/parser.rl (cParser_initialize): ditto.
-Thu Feb 12 20:31:48 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Feb 5 10:09:31 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/mkmf.rb (create_tmpsrc): cpp32 of Borland C++ ignores #error
- directives in DOS line-ending files at all.
+ * load.c (rb_get_expanded_load_path): always expand load paths.
-Thu Feb 12 02:23:56 2004 Tanaka Akira <akr@m17n.org>
+Sat Feb 5 09:38:08 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/pathname.rb: use assert_raise instead of assert_raises.
+ * transcode.c (encoded_dup): extract.
- * lib/pp.rb: ditto.
+Sat Feb 5 03:37:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/time.rb: ditto.
+ * lib/fileutils.rb (FileUtils::LowMethods): make low level methods
+ in NoWrite and DryRun to do nothing. [ruby-dev:43129]
- * lib/tsort.rb: ditto.
- use TSortHash and TSortArray instead of Hash and Array in test.
+ * test/fileutils/fileasserts.rb: add message arguments.
-Wed Feb 11 20:01:12 2004 akira yamada <akira@ruby-lang.org>
+ * test/fileutils/fileasserts.rb (Test::Unit::Assertions#assert_block):
+ show the given message.
- * test/ruby/test_file.rb (TestFile::test_fnmatch): added tests for
- File.fnmatch. [ruby-dev:22815][ruby-dev:22819]
+Sat Feb 5 02:09:39 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_proc.rb (TestProc::test_eq): added a
- test. [ruby-dev:22599]
+ * parse.y (lex_getline, parser_set_encode): set encoding of lines
+ in SCRIPT_LINES__ as source encoding. [ruby-dev:43168]
- * test/ruby/test_proc.rb (TestProc::test_eq): added tests for
- Proc#==. [ruby-dev:22592], [ruby-dev:22601]
+Sat Feb 5 02:08:37 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Feb 10 16:43:56 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vm.c (ruby_thread_data_type): add prefix.
- * eval.c (umethod_bind): purge unused check. [ruby-dev:22850]
+Sat Feb 5 00:59:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Feb 9 17:16:00 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+ * vm_core.h (GetThreadPtr): use TypedData_Get_Struct() instead
+ CoreDataFromValue() because we need type check. Otherwise,
+ type mismatch can cause segmentation fault crash.
+ [ruby-core:35086] [Ruby 1.9-Bug#4367]
- * lib/rdoc/parsers/parse_c.rb: escape '{' and '}' to avoid warnings.
+ * vm.c (thread_data_type): remove static.
-Mon Feb 9 13:00:55 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+Fri Feb 4 19:14:27 2011 Tanaka Akira <akr@fsij.org>
- * dir.c (fnmatch): File.fnmatch('*?', 'a') should return true.
- [ruby-dev:22815]
+ * enc/trans/utf8_mac.trans: parenthesize macro arguments.
- * dir.c (fnmatch): File.fnmatch('\[1\]' , '[1]') should return true.
- [ruby-dev:22819]
+Fri Feb 4 12:11:51 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun Feb 8 16:46:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (str_utf8_nth): fixed a condition of optimized lead
+ byte counting. [Bug #4366][ruby-dev:43170]
- * lib/pp.rb (PP::PPMethods::object_address_group): suppress negative
- sign for higher heap areas.
+Fri Feb 4 01:50:13 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Fri Feb 6 22:48:16 2004 Dave Thomas <dave@pragprog.com>
+ * string.c (count_utf8_lead_bytes_with_word): wrote function
+ comments.
- * lib/rdoc/generators/html_generator.rb (gen_url): Support
- https in RDoc hyperlinks
+Fri Feb 4 00:14:55 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Feb 6 22:41:22 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/zlib/zlib.c (gzfile_reader_get_unused): no need to dup
+ before rb_str_resurrect.
- * lib/pp.rb (PPInspectTest#test_to_s_with_iv): rollback the previous
- commit. [ruby-dev:22813]
+Thu Feb 3 20:04:44 2011 Tanaka Akira <akr@fsij.org>
-Fri Feb 6 22:22:50 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/curses/curses.c (CHECK): unused macro removed.
- * lib/pp.rb (PPInspectTest#test_to_s_with_iv): remove instance
- variable which is defined in the test.
+Thu Feb 3 18:33:26 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Feb 6 00:48:37 2004 Tanaka Akira <akr@m17n.org>
+ * ext/zlib/zlib.c (gzfile_reader_get_unused): use rb_str_resurrect
+ because gz->z.input is hidden string. [ruby-core:35057]
- * lib/prettyprint.rb (PrettyPrint#first?): obsoleted.
+Thu Feb 3 16:34:10 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Feb 5 23:56:55 2004 Tanaka Akira <akr@m17n.org>
+ * enc/shift_jis.c (code_to_mbc): cast as int from the subtraction of
+ pointers.
- * lib/prettyprint.rb (PrettyPrint#seplist): added.
+ * enc/utf_16le.c (utf16le_mbc_enc_len): use ptrdiff_t.
- * lib/pp.rb (PPMethods#pp_object): use seplist.
- (PPMethods#pp_hash): ditto.
- (Array#pretty_print): ditto.
- (Struct#pretty_print): ditto.
- (MatchData#pretty_print): ditto.
+ * enc/utf_32be.c (utf32be_left_adjust_char_head): ditto.
- * lib/set.rb (Set#pretty_print): use seplist.
+ * enc/utf_32le.c (utf32le_left_adjust_char_head): ditto.
-Wed Feb 4 02:12:06 2004 Tanaka Akira <akr@m17n.org>
+Thu Feb 3 16:31:43 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * file.c (test_l): fix wrong method name in document.
- (test_S): ditto.
- (test_b): ditto.
- (test_c): ditto.
- (test_suid): ditto.
- (test_sgid): ditto.
- (test_sticky): ditto.
+ * include/ruby/missing.h: don't use HAVE_STDDEF_H because it never
+ defined by configure though configure.bat defines it.
-Tue Feb 3 08:04:57 2004 Tanaka Akira <akr@m17n.org>
+ * include/ruby/ruby.h: move include stddef.h to defines.h
- * lib/pp.rb (Struct#pretty_print_cycle): follow 1.8 style.
+ * include/ruby/defines.h: ditto.
-Mon Feb 2 19:33:49 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Wed Feb 2 20:25:04 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * configure.in: backport from 1.9 for Interix.
+ * include/ruby/encoding.h (rb_enc_step_back): cast 4th argument 'n'
+ as int because Ruby usually treats length value as long but
+ onigenc_step_back's 4th argument is int.
- * dln.c (dln_load): ditto.
+Thu Feb 3 07:20:46 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Mon Feb 2 13:31:51 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/psych/lib/psych/visitors/to_ruby.rb: use Regexp::NOENCODING
+ rather than magic number.
- * lib/net/http.rb (canonical_each): fix merge miss.
+ * ext/syck/lib/syck/rubytypes.rb: ditto
-Mon Feb 2 01:54:00 2004 Tanaka Akira <akr@m17n.org>
+Thu Feb 3 07:16:11 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/pp.rb (Struct#pretty_print): make it 1.8 style.
- (Numeric#pretty_print, FalseClass#pretty_print)
- (TrueClass#pretty_print, Module#pretty_print): fix pp for objects
- with instance variables. [ruby-talk:91157]
+ * re.c (Init_Regexp): added a constant for ARG_ENCODING_NONE
+ [ruby-core:35054]
- * lib/open-uri.rb (URI::Generic#find_proxy): return nil on loopback
- address.
+ * test/ruby/test_regexp.rb: corresponding test.
- * lib/resolv-replace.rb (BasicSocket#send): don't replace because
- it has no hostname argument.
- (IPSocket.getaddress): raise SocketError instead of
- Resolv::ResolvError for errors.
- (TCPSocket#initialize, UDPSocket#bind, UDPSocket#connect)
- (SOCKSSocket#initialize): use IPSocket.getaddress instead of
- Resolv.getaddress.
- (UDPSocket#send): recognize 3 arguments form. try all addresses on
- 4 arguments form.
+Thu Feb 3 07:02:16 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Sun Feb 1 18:17:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+ * ext/psych/lib/psych/visitors/to_ruby.rb: ARG_ENCODING_NONE regular
+ expressions can round trip. [ruby-core:34969]
- * lib/net/http.rb: merged coding style changes from HEAD.
+ * test/psych/test_yaml.rb: test for ARG_ENCODING_NONE regex
-Sun Feb 1 16:15:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+ * ext/sych/lib/syck/rubytypes.rb: ARG_ENCODING_NONE regular
+ expressions can round trip.
- * lib/test/unit.rb: rearranged documentation for RDoc's sake.
- * lib/matrix.rb: improved documentation.
- * lib/net/http.rb: slight documentation formatting improvement.
+ * test/syck/test_yaml.rb: test for ARG_ENCODING_NONE regex
-Sun Feb 1 05:30:06 2004 Tanaka Akira <akr@m17n.org>
+Wed Feb 2 17:09:22 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/open-uri.rb (URI::Generic#find_proxy): warn HTTP_PROXY.
- raise an errror on non-http proxy URI.
- (OpenURI::Buffer#<<): make a tempfile binmode. [ruby-talk:90793]
+ * io.c (rb_io_fdatasync): Use fsync(2) if the underlying
+ operating system does not support fdatasync(2).
-Sat Jan 31 09:20:32 2004 NAKAMURA, Hiroshi <nakahiro@sairon.co.jp>
+Wed Feb 2 14:51:08 2011 Eric Hodel <drbrain@segment7.net>
- * sample/openssl/gen_csr.rb: wrong usage string.
+ * lib/rdoc/markup/to_tt_only.rb: commit miss
+ * test/rdoc/test_rdoc_markup_to_tt_only.rb: ditto
+ * test/rdoc/test_rdoc_single_class.rb: ditto
-Sat Jan 31 01:00:32 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Wed Feb 2 09:27:53 2011 Eric Hodel <drbrain@segment7.net>
- * lib/soap/wsdlDriver.rb, lib/wsdl/soap/operation.rb: add support of
- "parts" attribute of soap:body element in WSDL.
+ * lib/rdoc: Upgrade to RDoc 3.5.1
- * lib/wsdl/xmlSchema/schema.rb: friendly warning message for
- simpleType element which is not supported for now.
+Wed Feb 2 00:30:43 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/soap/mapping/factory.rb: deleted unused methods.
+ * include/ruby/st.h (st_table): Added comment why we need __extension__.
- * lib/soap/mapping/rubytypeFactory.rb: do no ignore case while xsi:type
- string <-> Ruby class name matching.
+Tue Feb 1 20:45:44 2011 Tanaka Akira <akr@fsij.org>
- * test/wsdl/soap/{soapbodyparts.wsdl,test_soapbodyparts.wsdl}: new
- files.
+ * enc/encdb.c: parenthesize macro arguments.
-Thu Jan 29 23:56:00 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Tue Feb 1 15:12:26 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * util.c (mblen): fix overrun. [ruby-dev:22672]
+ * test/ruby/test_require.rb (TestRequire#test_require_with_unc):
+ use ``127.0.0.1'' instead of ``localhost'' as host name, because
+ XP or earlier cannot resolv it as NBT hostname.
-Thu Jan 29 22:41:53 2004 Dave Thomas <dave@pragprog.com>
+Tue Feb 1 13:20:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/rdoc/generators/html_generator.rb: Allow 'link:' in Tidylinks.
- THis means you can write "see f1[link:files/f1_rb.html]".
+ * test/benchmark/test_benchmark.rb (#capture_bench_output):
+ Added explicit sleep. Windows have imprecise time support.
+ Thus Tms.new.Add!{} may be or may be not equal 0. The
+ test failure started since r30747.
-Thu Jan 29 15:33:23 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Tue Feb 1 11:03:47 2011 Ryan Davis <ryan@lust.local>
- * ext/openssl/ossl_x509hame.c (ossl_x509name_initialize): change
- second argument. it expected to be a Hash not an Integer.
+ * lib/rubygems*: Import rubygems 1.5.0 (released version @ 1fb59d0)
+ * test/rubygems: Ditto
- * ext/openssl/ossl_x509name.c (ossl_x509name_add_entry): add new
- function for OpenSSL::X509::Name#add_entry.
+Tue Feb 1 08:01:39 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_x509name.c (ossl_x509name_to_a): append ASN.1
- tag number to each element of return value.
+ * ext/io/console/console.c (console_set_winsize): new method to set
+ console size. [EXPERIMENTAL]
- * ext/openssl/ossl_x509name.c (Init_ossl_x509name): add constants
- OpenSSL::X509::Name::DEFAULT_OBJECT_TYPE and OBJECT_TYPE_TEMPLATE.
+ * ext/io/console/console.c (console_winsize): use GetWriteFD.
- * ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name#initialize):
- second argument takes OBJECT_TYPE_TEMPLATE by default.
+Tue Feb 1 02:28:14 2011 Masaya Tarui <tarui@ruby-lnag.org>
- * sample/openssl/gen_csr.rb: use OpenSSL::X509::Name.parse.
+ * include/ruby/win32.h, win32/win32.c: add rb_w32_inet_ntop.
+ inet_ntop's minimum supported client is Vista.
-Wed Jan 28 04:29:41 2004 Eric Schwartz <emschwar@fc.hp.com>
+Tue Feb 1 00:10:30 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/cgi/session.rb: use LOCK_SH to read, and a few other
- improvements. [ruby-core:02328]
+ * lib/benchmark.rb: fix benchmark to work with current ruby.
+ patched by Benoit Daloze [ruby-core:33846] [ruby-dev:43143]
+ merged from https://github.com/eregon/ruby/commits/benchmark
-Tue Jan 27 11:09:29 2004 FUKUMOTO Atsushi <fukumoto@nospam.imasy.or.jp>
+ * lib/benchmark (Report#width): update documentation
+ * lib/benchmark: document the return value of #benchmark and the
+ :list attribute in Report
+ * lib/benchmark (Tms#format): rename variables, use String#%
+ instead of Kernel.format
+ * lib/benchmark: remove undocumented Benchmark::times (an alias
+ of Process::times used twice)
+ * lib/benchmark (#benchmark): use label_width for the caption
+ * lib/benchmark (Tms#initialize): rename variables
+ * lib/benchmark: allow title to not be a String and call #to_s
+ * lib/benchmark (Benchmark#bm): return an Array of the times with
+ the labels
+ * lib/benchmark: correct output for Benchmark#bmbm
+ (remove the extra space)
+ * lib/benchmark: add a few tests for Benchmark::Tms output
+ * lib/benchmark: improve style (enumerators, ljust, unused vars)
+ * lib/benchmark: add spec about output and return value
+ * lib/benchmark: improve basic style and consistency
+ no parenthesis for print and use interpolation instead of printf
+ * lib/benchmark: remove unnecessary conversions and variables
+ * lib/benchmark: correct indentation
+ * lib/benchmark: rename the FMTSTR constant and variable to FORMAT
+ * lib/benchmark: remove useless exception
- * ext/socket/socket.c (s_recvfrom): sending length should be an
- invariant while retrying on EAGAIN. [ruby-talk:89962]
+ * test/benchmark: remove unused variable warnings
-Tue Jan 27 10:35:18 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Jan 31 23:27:23 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * ext/win32ole/win32ole.c (set_argv): fix condition.
+ * node.c (add_id): remove duplicated rb_id2str() call.
-Tue Jan 27 02:26:31 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sun Jan 30 17:19:46 2011 Tanaka Akira <akr@fsij.org>
- * lib/webrick/httputils.rb (WEBrick:HTTPUtils::parse_header):
- refine regex for header-name.
+ * missing/langinfo.c: parenthesize macro arguments.
-Tue Jan 27 00:30:11 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Jan 31 21:57:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * win32/Makefile.sub: rollback.
+ * configure.in: revert r30698.
-Mon Jan 26 22:53:04 2004 Dave Thomas <dave@pragprog.com>
+Mon Jan 31 21:32:44 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * io.c: Remove documentation references to $defout.
+ * thread.c (thread_start_func_2): check deadlock condition before
+ release thread stack. fix memory violation when deadlock detected.
+ reported by Max Aller. [Bug #4009] [ruby-core:32982]
-Mon Jan 26 15:11:47 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Jan 31 14:45:47 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * sample/exyacc.rb: escape '}' to avoid warning.
+ * lib/irb/locale.rb (IRB::Locale::#search_file):
+ Gem might be undefined if --disable-gems. [ruby-core:34990]
-Mon Jan 26 14:41:46 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon Jan 31 12:26:14 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/delegate.rb (Delegator::initialize): preserve
- singleton_method_added method [ruby-dev:22685]
+ * addr2line.c: suppressed shorten-64-to-32 warnings.
+ * regcomp.c: ditto.
+ * regexec.c: ditto.
+ * regint.h: ditto.
+ * regparse.c: ditto.
+ * regparse.h: ditto.
+ * time.c: ditto.
+ * variable.c: ditto.
- * lib/delegate.rb (Delegator::initialize): use Kernel::raise
- instead of mere raise. [ruby-dev:22681]
+Mon Jan 31 04:45:12 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Jan 26 12:47:17 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * array.c (rb_ary_uniq_bang): call ARY_SET_LEN(ary, 0) before
+ ary_resize_capa because ary_resize_capa expects resized length is
+ smaller than current array length. call rb_ary_unshare before
+ ary_resize_capa because ary_resize_capa lost the reference to
+ original shared array. [ruby-core:34997]
- * ext/tcltklib/tcltklib.c: define CONST84 when TCL_MAJOR_VERSION == 7
+Sun Jan 30 17:19:46 2011 Tanaka Akira <akr@fsij.org>
-Mon Jan 26 11:35:23 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * missing/crypt.c: parenthesize macro arguments.
- * ext/extmk.rb: Makefiles should depend on also rbconfig.rb.
- (ruby-bugs:PR#1256)
+Sun Jan 30 16:40:27 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/win32ole/win32ole.c (set_argv): set real arguments to
- WIN32OLE::ARGV. [ruby-list:39073]
+ * test/rubygems/test_gem_security.rb (TestGemSecurity): valid only
+ if OpenSSL is available.
-Thu Jan 22 22:54:53 2004 Shugo Maeda <shugo@ruby-lang.org>
+ * test/dl/test_dl2.rb (TestDL#test_sin): math functions do not
+ work on x86_64 due to the design of DL2.
- * lib/net/imap.rb (BEG_REGEXP): allow 8-bit characters in quoted
- strings for Novell GroupWise Internet Agent.
- * lib/net/imap.rb (DATA_REGEXP): ditto.
+ * test/dl/test_func.rb (DL::TestFunc#test_{sinf,sin): ditto.
-Thu Jan 22 16:21:33 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jan 30 16:09:22 2011 Tanaka Akira <akr@fsij.org>
- * parse.y (string_content): reset lexical states at the beginning of
- string contents. [ruby-list:39061]
+ * strftime.c (rb_strftime_with_timespec): %G produces 4 digits.
-Wed Jan 21 21:55:51 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Sun Jan 30 15:13:19 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/drb/drb.rb: remove O_NONBLOCK, thanks \ay
- * lib/drb/extserv.rb: typo
+ * enc/emacs_mule.c (emacsmule_islead): 7bit range is also leading
+ byte.
-Wed Jan 21 17:57:56 2004 Shugo Maeda <shugo@ruby-lang.org>
+Sun Jan 30 13:03:16 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/imap.rb (envelope): allow NIL.
- * lib/net/imap.rb (body): ditto.
- * lib/net/imap.rb (number): ditto.
- * lib/net/imap.rb (ensure_nz_number): show a detailed error
- message.
+ * hash.c (rb_hash_fetch_m): use useful message for longer key, not a
+ nonsense id value.
-Wed Jan 21 16:44:20 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (rb_str_ellipsize): new function to ellipsize a string.
- * lib/mkmf.rb (merge_libs): squeeze successive same libraries.
- [ruby-dev:22652]
+ * include/ruby/encoding.h (rb_enc_step_back): new function to step
+ back n characters.
-Wed Jan 21 16:01:37 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jan 30 12:53:38 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/digest/rmd160/extconf.rb: have_library appends found library.
+ * enc/emacs_mule.c (emacsmule_islead): fix inverse condition.
-Wed Jan 21 11:36:00 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sun Jan 30 09:37:25 2011 Yutaka Kanemoto <kanemoto@ruby-lang.org>
- * parse.y (block_append): update nd_end for "real" head node.
- [ruby-list:39058]
+ * io.c (struct argf): char behaves like an unsigned char
+ by default on AIX.
-Tue Jan 20 14:48:13 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sun Jan 30 08:02:55 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/openssl/extconf.rb: should check <openssl/conf_api.h> instead
- of OPENSSL_VERSION_NUMBER. [ruby-list:39056]
+ * configure.in: Mac OS X wrongly reports it has fdatasync(3).
-Tue Jan 20 14:43:17 2004 Dave Thomas <dave@pragprog.com>
+Sun Jan 30 03:29:47 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/base64.rb: Add RDoc
+ * ext/openssl/ossl_bn.c (GetBNPtr): add missing nil case.
+ patched by Martin Bosslet. [ruby-core:34987]
-Tue Jan 20 14:25:51 2004 Dave Thomas <dave@pragprog.com>
+Sun Jan 30 01:02:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/abbrev.rb: Add RDoc
+ * include/ruby/ruby.h: Added NUM2MODET() and MODET2NUM() default
+ definition.
+ Because r30686 introduced win32 build failure.
-Tue Jan 20 13:22:39 2004 Dave Thomas <dave@pragprog.com>
+Sat Jan 29 22:16:26 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/rdoc/generators/html_generator.rb: Document aliases at
- top-most level.
+ * array.c (rb_ary_join): [].join.encoding must be US-ASCII.
+ [ruby-list:47790]
- * lib/English.rb: Document English.rb.
+Sat Jan 29 20:22:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Jan 20 02:49:22 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * benchmark/driver.rb (BenchmarkDriver#measure): Show command line
+ when abnormal exiting occur.
- * ext/openssl/extconf.rb: add check for OpenSSL version.
- [ruby-list:39054]
+Sat Jan 29 10:53:16 2011 Yusuke Endoh <mame@tsg.ne.jp>
-Tue Jan 20 02:38:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * vm_insnhelper.c (vm_get_ev_const): no-scope reference to toplevel
+ private constant has been prohibited incorrectly.
- * marshal.c (w_class): should not dump singleton class.
- [ruby-dev:22631]
+ * test/ruby/test_module.rb (test_toplevel_private_constant): add a
+ test for above.
-Tue Jan 20 01:31:36 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Sat Jan 29 08:43:23 2011 Ryan Davis <ryand-ruby@zenspider.com>
- * io.c (lineno): typo fix(FIX2INT -> INT2FIX).
+ * lib/rubygems*: Import rubygems 1.5.0 (release candidate @ 09893d9)
+ * test/rubygems: Ditto
-Mon Jan 19 21:53:38 2004 akira yamada <akira@ruby-lang.org>
+Sat Jan 29 02:02:37 2011 Yusuke Endoh <mame@tsg.ne.jp>
- * io.c, re.c, string.c, time.c: fixed up positions of RDocs.
+ * variable.c (rb_mod_const_of, sv_i): Module#constant should exclude
+ private constants. see [ruby-core:32912].
-Mon Jan 19 07:09:20 2004 Tadayoshi Funaba <tadf@dotrb.org>
+ * test/ruby/test_module.rb (test_constants_with_private_constant): add
+ a test for above.
- * lib/date.rb: zone was wrong when it was behind UTC.
- Thanks Mark J. Reed.
+Sat Jan 29 01:36:41 2011 Yusuke Endoh <mame@tsg.ne.jp>
- * lib/date/format.rb: %z is now always replaced by four digits
- with a leading plus or minus sign.
+ * variable.c (rb_const_set): const_set should preserve constant
+ visibility. see [ruby-core:32912].
- * sample/cal.rb: added a class, anyway.
+ * test/ruby/test_module.rb: add a test for above.
-Sun Jan 18 20:47:35 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Sat Jan 29 01:24:57 2011 Yusuke Endoh <mame@tsg.ne.jp>
- * ruby.c: use translate_char() on Cygwin.
+ * compile.c (NODE_CLASS, NODE_MODULE), insns.def (defineclass): raise
+ an exception when "class Foo::Bar" is evaluated and Foo::Bar is
+ private. To implement this, define_type of "defineclass" is added
+ so that the instruction can distinguish whether the class definition
+ is scoped (class Foo::Bar) or not (class Bar).
-Sun Jan 18 02:33:26 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+ * test/ruby/test_class.rb (test_redefine_private_class),
+ test/ruby/test_module.rb
+ (test_define_module_under_private_constant): add tests for above.
- * defines.h (_WIN32): undef _WIN32 on Cygwin before defining DOSISH.
+Sat Jan 29 01:19:17 2011 Yusuke Endoh <mame@tsg.ne.jp>
-Sun Jan 18 00:23:55 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * constant.h, variable.c: to ensure compatibility, rb_const_get_* must
+ not raise an exception even when the constant is private. Instead,
+ rb_public_const_get_* and rb_public_const_defined_* are introduced,
+ which raise an exception when the referring constant is private.
+ see [ruby-core:32912].
- * marshal.c (class2path): check anonymous class/module before
- checking referable, and allow singleton classes.
+ * vm_insnhelper.c (vm_get_ev_const): use rb_public_const_get_* instead
+ of rb_const_get_* to follow the constant visibility when user code
+ refers a constant.
-Fri Jan 16 14:33:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_marshal.rb (test_marshal_private_class): add a test.
+ This test had failed because of incompatibility of rb_const_get.
- * marshal.c (class2path): get class path and check referable.
- [ruby-dev:22588]
+Sat Jan 29 00:30:44 2011 Yusuke Endoh <mame@tsg.ne.jp>
-Fri Jan 16 09:52:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * variable.c (set_const_visibility): fix typo. a patch from Tomoyuki
+ Chikanaga in [ruby-core:32919].
- * eval.c (proc_eq): Proc with empty body may not be equal.
- [ruby-dev:22590]
+Fri Jan 28 23:20:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu Jan 15 13:03:10 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/gdbm/test_gdbm.rb (TestGDBM#test_s_open_no_create,
+ TestGDBM2#test_writer_open_notexist): We only need to skip libgdbm
+ 1.8.0, not all 1.8.x. 1.8.1 or later don't have GDBM_WRITER sickness.
- * io.c (argf_read): do not append EOF. (ruby-bugs-ja:PR#585)
+Fri Jan 28 21:56:57 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * io.c (rb_io_fwrite): ad-hockery hack to get rid of HP-UX stdio
- weird behavior. [ruby-dev:22424]
+ * ext/dbm/extconf.rb: Added new header places for Fedora13.
-Wed Jan 14 13:31:06 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jan 28 21:49:30 2011 Tanaka Akira <akr@fsij.org>
- * ext/iconv/extconf.rb: wrapper iconv.rb is dependent on platform.
+ * ext/zlib/zlib.c: parenthesize macro arguments.
-Tue Jan 13 18:54:28 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Fri Jan 28 17:47:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/logger.rb(Logger#msg2str): no special treatment for the object
- which responds to :to_str. commited at 2004-01-11T21:46:27 by
- gsinclair.
+ * test/gdbm/test_gdbm.rb (TestGDBM2#test_writer_open_notexist):
+ gdbm 1.8.x changed GDBM::WRITER behavior. Thus our testcase need
+ to be changed too.
- * lib/logger.rb(LogDevice#initialize): remove type checking if the
- given object is a String. Kernel.open handles it correctly.
- commited at 2004-01-11T21:46:27 by gsinclair.
+Fri Jan 28 17:33:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * test/logger/test_logger.rb: follow above change (ArgumentError ->
- TypeError.) follow above commit.
+ * test/gdbm/test_gdbm.rb (TestGDBM#test_s_open_no_create): skip
+ the test if gdbm version is 1.8.x.
-Tue Jan 13 14:27:13 2004 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Fri Jan 28 16:30:51 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/test/unit/ui/testrunnerutilities.rb (TestRunnerUtilities):
- moved run method which allows output level. [ruby-dev:22554]
+ * test/ruby/test_require.rb (TestRequire#test_require_too_long_filename):
+ Added -w option because too long path error don't output a message
+ by default since r30660. [Bug #4336] [ruby-dev:43134]
-Tue Jan 13 04:29:52 2004 Dave Thomas <dave@pragprog.com>
+Fri Jan 28 16:19:38 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/rdoc/ri/ri_driver.rb (RiDriver::report_method_stuff):
- Show fully-qualified class names in class list.
+ * test/ruby/test_require.rb (TestRequire#test_require_path_home_{1,2}):
+ Added -w option because too long path error don't output a message
+ by default since r30660. [Bug #4336] [ruby-dev:43134]
-Tue Jan 13 01:04:37 2004 Dave Thomas <dave@pragprog.com>
+Fri Jan 28 16:04:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/rdoc/ri/ri_paths.rb (RI::Paths): First attempt at
- incorporating DESTDIR in the rdoc installation.
+ * test/ruby/test_require.rb (TestRequire#test_require_path_home_{1,2,3}):
+ split from test_require_path_home.
-Mon Jan 12 23:27:19 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jan 28 13:04:38 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * parse.y (primary): fix position after FCALL. [ruby-dev:22574]
+ * configure.in (--with-valgrind): Fixed r29683. Now this option
+ is really default on.
-Mon Jan 12 12:07:22 2004 Dave Thomas <dave@pragprog.com>
+Fri Jan 28 12:05:48 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods):
- Someone changed the "// in eval.c" comments to "/*...*/" style,
- so the parsing of the source file name broke.
+ * configure.in: Add #include<sys/stat.h> when struct stat is
+ tested. Otherwise, incomplete type dereference error will occur.
- * object.c: Remove spurious space in TrueClass documentation.
+Fri Jan 28 11:53:19 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Fix
- bad regexp: if the code before a documented method contained
- a comment that wasn't terminated by whitespace, that comment
- and all intervening code was included in the following
- method's documentation.
+ * configure.in: redundant variable names made strange conftest
+ error. Fixed it.
- * lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter::break_to_newline):
- HTML formats need explicit line breaks.
+Fri Jan 28 11:47:00 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Jan 12 11:46:30 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_process.rb (TestProcess#test_too_long_path{,2}):
+ should handle Errno::E2BIG, because this test checks crash of ruby,
+ not the error type system.
- * configure.in (LIBPATHFLAG, RPATHFLAG): enclose paths with single
- quotes. [ruby-dev:22564]
+Fri Jan 28 11:23:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/mkmf.rb (libpathflag): do not enclose with quotes always.
+ * io.c (rb_io_open): Use NUM2MODET() instead NUM2UINT().
+ * io.c (rb_scan_open_args): ditto.
- * {bcc32,win32,wince}/Makefile.sub (LIBPATHFLAG): quoted.
+Fri Jan 28 10:58:20 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Jan 12 02:24:07 2004 Dave Thomas <dave@pragprog.com>
+ * configure.in: Added mode_t type checking.
+ * process.c (rb_exec_arg_addopt): Use NUM2MODET() instead
+ NUM2LONG because clang makes compile error by this narrowing
+ conversion.
+ * process.c (rb_run_exec_options_err): ditto.
- * lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
- generation support to ri (Elliot Hughes)
+Fri Jan 28 02:37:18 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Jan 12 02:24:07 2004 Dave Thomas <dave@pragprog.com>
+ * re.c (rb_reg_raise): add GC guard to prevent intermediate
+ variable from GC.
- * lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
- generation support to ri (Elliot Hughes)
+Fri Jan 28 02:35:41 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun Jan 11 02:07:47 2004 Dave Thomas <dave@pragprog.com>
+ * hash.c (rb_hash_fetch_m): add GC guard to prevent intermediate
+ variable from GC.
- * lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
- Also accept command line options via the 'RI' environment variable.
+Fri Jan 28 01:33:51 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun Jan 11 02:07:47 2004 Dave Thomas <dave@pragprog.com>
+ * test/ruby/test_process.rb (TestProcess#test_too_long_path)
+ TestProcess#test_too_long_path): Reduced string size from 100MB
+ to 10MB. 100MB may cause no memory error. It isn't intended.
- * lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
- Also accept command line options via the 'RI' environment variable.
+Fri Jan 28 01:27:42 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sat Jan 10 21:27:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_process.rb (TestProcess#test_too_long_path2):
+ Factored out from test_too_long_path. A test should only do
+ one test.
- * eval.c (eval): need to add message delimiter. [ruby-dev:22561]
+Thu Jan 27 23:29:36 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Jan 10 01:54:50 2004 Eric Sunshine <sunshine@sunshineco.com>
+ * st.c (st_foreach): check if unpacked.
- * defines.h (__NeXT__): Ensure that all standard S_IRUSR, S_IWGRP,
- S_IRWXO, etc. macros are defined since future code might require
- them (even though present code only requires a subset).
+Thu Jan 27 23:14:19 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * defines.h (__NeXT__): Bug fix: WORDS_BIGENDIAN was not being set
- correctly on Rhapsody when -arch compiler flag was used (via
- configure's --enable-fat-binary option).
+ * misc/ruby-mode.el (ruby-mode-map): remove deprecated binding.
+ use M-; instead.
-Fri Jan 9 10:05:14 2004 Siena. <siena@faculty.chiba-u.jp>
+Thu Jan 27 21:58:32 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/mkmf.rb (libpathflag): use single quotes. [ruby-dev:22440]
+ * bignum.c (rb_str_to_inum): get rid of too huge alloca().
-Thu Jan 8 23:49:21 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+Thu Jan 27 21:43:29 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * configure.in (RDOCTARGET): new macro. if you want to install
- rdoc documentation, you need to run configure with
- --enable-install-doc.
+ * object.c (rb_str_to_dbl): rewrite again. use ALLOCV instead
+ rb_str_tmp_new().
-Thu Jan 8 21:29:43 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Thu Jan 27 21:41:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/openssl/ossl_pkey.c (ossl_pkey_to_der): removed; it returns
- public key only.
+ * win32/win32.c: get rid of STRNDUPA(). It's dangerous API.
- * ext/openssl/ossl_pkey_dh.c (ossl_dh_to_der): new function for
- OpenSSL::PKey::DH#to_der.
+Thu Jan 27 21:31:57 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_to_der): new function for
- OpenSSL::PKey::DSA#to_der.
+ * win32/win32.c (rb_w32_aspawn): get rid of too huge alloca().
+ [Bug #4330] [ruby-core:34898]
- * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_to_der): new function for
- OpenSSL::PKey::RSA#to_der.
+Thu Jan 27 20:30:18 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu Jan 8 16:51:04 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * win32/win32.c (rb_w32_spawn): get rid of too huge alloca().
- * test/wsdl/datetime/test_datetime.rb: fixed a stupid testcase which
- dumps "E" at month-end.
+Thu Jan 27 18:49:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu Jan 8 11:20:01 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+ * win32/win32.c (open_dir_handle): get rid of too huge alloca().
- * eval.c, object.c, process.c, re.c: don't use C++ style comments.
+Thu Jan 27 18:34:58 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu Jan 8 04:36:21 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * file.c (w32_io_info): get rid of too huge alloca().
+ [Bug #4313] [ruby-core:34830]
- * lib/webrick/cgi.rb (WEBrick::CGI#initialize): should create
- @config[:Logger] if it was not given.
+Thu Jan 27 18:19:51 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * sample/webrick/*: new files.
+ * win32/win32.c (wstati64): get rid of too huge alloca().
+ [Bug #4316] [ruby-core:34834]
- * MANIFEST: add sample/webrick/*
+Thu Jan 27 15:11:52 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Jan 7 13:00:18 2004 Dave Thomas <dave@pragprog.com>
+ * win32/win32.c (rb_w32_spawn, rb_w32_aspawn): get rid of too huge
+ alloca(). this is the real fix of [ruby-core:34833].
- * lib/rdoc/ri/ri_driver.rb: Fix problem where ri was
- being too eager to find matches of ambiguous method
- names (such as "ri Thread.join" would return both
- Thread.join and ThreadsWait.join)
+Thu Jan 27 12:46:25 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jan 7 12:35:41 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * process.c (ALLOC_ARGV_WITH_STR): fix void pointer arithmetic.
- * lib/debug.rb: revert command parse regexps. [ruby-list:39014] by
- Shirai,Kaoru.
+Thu Jan 27 08:41:40 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jan 7 08:21:04 2004 Dave Thomas <dave@pragprog.com>
+ * process.c (proc_exec_v, rb_proc_exec_n, rb_proc_exec)
+ (proc_spawn_n, proc_spawn): get rid of too huge alloca().
+ [ruby-core:34827], [ruby-core:34833]
- * lib/rdoc/parsers/parserfactory.rb: Check for shebang
- line in files that would otherwise be treated as
- plain text.
+Thu Jan 27 08:32:17 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Jan 6 22:13:34 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * include/ruby/ruby.h (ALLOCV): new API for exception-safe
+ temporary buffer. [ruby-core:34844]
- * eval.c (rb_mod_modfunc): should break if m has no super class.
- [ruby-dev:22498]
+ * string.c (rb_alloc_tmp_buffer, rb_free_tmp_buffer):
+ implementation of the API.
-Tue Jan 6 21:55:02 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Jan 27 08:22:49 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (fptr_finalize): should save errno just after failure.
- [ruby-dev:22492]
+ * dln_find.c (dln_find_1): use rb_warning and return immediately
+ if fname is longer than buffer.
-Tue Jan 6 14:53:14 2004 Dave Thomas <dave@pragprog.com>
+Wed Jan 26 22:57:30 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * bin/ri: split out the display side, making it pluggable. Added
- new ri_driver and ri_display files in lib/rdoc/ri.
+ * class.c (clone_method): add GC guard to prevent intermediate
+ variable from GC. [Bug #4321] [ruby-dev:43107]
-Tue Jan 6 06:37:53 2004 Dave Thomas <dave@pragprog.com>
+Wed Jan 26 22:45:16 2011 Tanaka Akira <akr@fsij.org>
- * bin/rdoc: Add --ri-system switch
+ * template/id.h.tmpl: parenthesize macro arguments.
- * lib/.document: Update with list of files that seem to have
- documentation
+Wed Jan 26 22:28:49 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
- * lib/test/unit.rb: Reorder comment to make it RDoc friendly.
+ * vm_eval.c (rb_throw_obj): add GC guard to prevent intermediate
+ variable from GC. [Bug #4322] [ruby-dev:43108]
- * Makefile.in: add install-nodoc target, and make it
- generate RDoc on default install.
+Wed Jan 26 17:08:59 2011 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * lib/rdoc/ri/ri_options.rb (RI::Options::parse): Add
- --doc-dir option to ri.
+ * ext/openssl/ossl_asn1.c (ossl_asn1_decode0): OpenSSL::ASN1.decode
+ should reject indefinite length primitive encodings as that is
+ illegal. Patch by Martin Bosslet. See #4324.
-Tue Jan 6 00:04:40 2004 Dave Thomas <dave@pragprog.com>
+Wed Jan 26 10:36:28 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
- fix parsing if there are braces in a method parameter list
+ * string.c (=~): documentation fix; the return value is nil when
+ it doesn't match. patched by Andrei Kulakov [ruby-core:34562]
-Fri Jan 2 14:54:11 2004 Dave Thomas <dave@pragprog.com>
+Tue Jan 25 08:41:58 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * bin/ri: Add new --classes option, and arrange for
- help messages to be paged too.
+ * dln_find.c (dln_find_1): omit too long pathnames.
- * bin/rdoc: Add statistics.
+Tue Jan 25 08:28:19 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * process.c: (MG) Added Process documentation
+ * string.c (rb_str_resize): get rid of out-of-bound access.
- * lib/rdoc/ri/ri_formatter.rb (RI::AttributeFormatter::wrap):
- Fix problem with labels not displaying in RI labeled
- lists using BS and ANSI modes.
+Tue Jan 25 07:48:22 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Fri Jan 2 01:50:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_thread.rb: remove unused variables.
- * io.c (argf_eof): ARGF.eof? should not have any side effect.
- [ruby-dev:22469]
+Tue Jan 25 07:45:44 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Wed Dec 31 17:25:17 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_thread.rb (TestThread#test_condvar_nolock_2): get
+ rid of method redefined.
- * io.c (argf_each_byte): should return self. [ruby-dev:22465]
+Tue Jan 25 07:00:52 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Dec 31 11:20:34 2003 Dave Thomas <dave@pragprog.com>
+ * string.c (rb_string_value_cstr): rb_str_modify can change
+ RSTRING_PTR.
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Make
- file referenced in "// in sss.c" relative to current file.
+Tue Jan 25 03:24:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Dec 31 11:17:37 2003 Dave Thomas <dave@pragprog.com>
+ * test/ruby/test_thread.rb: Added various ConditionVariable tests.
- * lib/rdoc/generators/html_generator.rb: Fix problem when
- a public method was aliased, but the alias is then
- made private, and hence doesn't appear in RDoc output.
+Mon Jan 24 22:26:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Dec 31 01:33:05 2003 Dave Thomas <dave@pragprog.com>
+ * object.c (rb_str_to_dbl): Fix again. use rb_str_tmp_new()
+ instead ALLOC_N.
- * array.c, error.c, eval.c, io.c, prec.c, range.c, re.c,
- string.c, time.c: Add RDoc for Kernel functions, and tidy.
+Mon Jan 24 21:50:48 2011 Tanaka Akira <akr@fsij.org>
-Tue Dec 30 19:39:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * vm_insnhelper.h: parenthesize macro arguments.
- * io.c (rb_f_readline): should raise EOFError at the end of
- files. [ruby-dev:22458]
+Mon Jan 24 21:28:34 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * io.c (argf_read): should concatenate input files when length
- argument is nil. [ruby-dev:22450]
+ * object.c (rb_str_to_dbl): use ALLOC_N instead ALLOCA_N because
+ ALLOC_N may cause stack overflow.
- * io.c (argf_read): should update supplied string buffer (2nd
- argument) even when IO#read is called multiple times.
+Mon Jan 24 21:04:45 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c: should initialize lineno by zero. [ruby-dev:22460]
+ * error.c (rb_invalid_str): prevent intermediate variable from GC.
+ [ruby-core:34820]
-Tue Dec 30 12:30:30 2003 Dave Thomas <dave@pragprog.com>
+Sun Jan 23 23:01:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): If a
- class and a method have the same name, finding Xxx.abc was trying
- to find 'abc' in method 'Xxx', not class 'Xxx'.
+ * test/io/console/test_io_console.rb: Don't run test if the system
+ don't support io/console.
+Sun Jan 23 22:17:07 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Dec 30 08:32:32 2003 Dave Thomas <dave@pragprog.com>
+ * test/fiddle/test_fiddle.rb: Don't run test if the system don't support
+ fiddle.
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
- Handle undoing nesting of yield parameters correctly for:
+ * test/fiddle/test_function.rb: ditto.
+ * test/fiddle/test_closure.rb: ditto.
- def each_entry(&b) Dir.foreach(@path) {|f| yield P.new(f) } end
+Sun Jan 23 11:39:18 2011 Tanaka Akira <akr@fsij.org>
+ * vm_exec.h: parenthesize macro arguments.
-Tue Dec 30 08:32:32 2003 Dave Thomas <dave@pragprog.com>
+Sun Jan 23 10:33:02 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
- Handle undoing nesting of yield parameters correctly for:
+ * template/fake.rb.in (ruby): suppress warnings.
- def each_entry(&block) Dir.foreach(@path) {|f| yield Pathname.new(f) } end
+Sun Jan 23 08:00:09 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Dec 29 12:51:02 2003 Dave Thomas <dave@pragprog.com>
+ * string.c (str_nth_len, str_utf8_nth): return the rest length together.
- * eval.c: Add RDoc for Kernel global functions.
+ * string.c (rb_str_substr): get rid of measure the length always
+ to improve performance for huge string. [ruby-core:34648]
-Mon Dec 29 11:00:16 2003 Dave Thomas <dave@pragprog.com>
+Sun Jan 23 00:40:10 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * array.c: Tidy up RDoc loose ends.
+ * test/test_syslog.rb: Fix to make a lot of test failure if
+ the platform doesn't support syslog.
-Mon Dec 29 05:05:51 2003 Dave Thomas <dave@pragprog.com>
+Sat Jan 22 11:49:55 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * struct.c, random: Add RDoc comments
+ * ext/psych/lib/psych/visitors/to_ruby.rb: fixing merge key support
+ when multiple merge keys are specified.
-Mon Dec 29 02:20:54 2003 Dave Thomas <dave@pragprog.com>
+ * test/psych/test_merge_keys.rb: tests for multi-merge key support
- * eval.c: Add RDoc for class Proc, Method, UnboundMethod
+Sat Jan 22 11:33:04 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Mon Dec 29 00:41:44 2003 Dave Thomas <dave@pragprog.com>
+ * ext/psych/lib/psych/visitors/to_ruby.rb: merge keys are actually
+ part of YAML 1.1, so they should be supported. Remove warning and
+ merge keys to parent. [ruby-core:34679]
- * math.c: Add RDoc comments
+ * test/psych/test_merge_keys.rb: test for merge keys
-Sun Dec 28 20:19:11 2003 Tanaka Akira <akr@m17n.org>
+Sat Jan 22 10:25:19 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/stringio/stringio.c (strio_sysread): StringIO.new.sysread didn't
- raise EOFError.
+ * ext/psych/parser.c (parse): add the file name to the exception when
+ parse errors occur.
- * ext/zlib/zlib.c (gzreader_gets): don't increment lineno when
- gzfile_read_all returns "".
+ * test/psych/test_parser.rb: test for parse error file name
-Sun Dec 28 15:25:08 2003 Dave Thomas <dave@pragprog.com>
+Sat Jan 22 10:12:30 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * class.c,object.c,parse.y,sprintf.c,variable.c: Document classes
- Object, Module, etc...
+ * ext/psych/parser.c (parse): fix assertion error when reusing a
+ parser after an exception has been raised
-Sun Dec 28 11:55:29 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * test/psych/test_parser.rb: test for assertion error
- * test/csv/test_csv.rb: generate bom.csv and mac.csv files on the fly.
- [ruby-talk:88852]
+Sat Jan 22 04:09:22 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * test/csv/{bom.csv,mac.csv}: removed.
+ * ext/psych/lib/psych/nodes/node.rb: Make Psych::Nodes::Node
+ enumerable.
-Sun Dec 28 08:56:51 2003 Dave Thomas <dave@pragprog.com>
+ * ext/psych/lib/psych/visitors/depth_first.rb: Add a depth-first
+ visitor to enumerate over a YAML AST in a depth-first fashion
- * eval.c: Thead[Group] RDoc (thanks to MG)
+ * test/psych/nodes/test_enumerable.rb: test for enumerating nodes
-Sun Dec 28 03:50:05 2003 Dave Thomas <dave@pragprog.com>
+ * test/psych/visitors/test_depth_first.rb: test for depth-first
+ visitor
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_override_comment):
- Escape method names used in regexp
+Sat Jan 22 00:53:42 2011 Tanaka Akira <akr@fsij.org>
-Sun Dec 28 01:46:02 2003 Dave Thomas <dave@pragprog.com>
+ * vm_core.h: parenthesize macro arguments.
- * lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item):
- Add support for rules in 'ri' output.
+Fri Jan 21 18:15:09 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Dec 28 01:35:35 2003 Dave Thomas <dave@pragprog.com>
+ * configure.in: should not use -Werror=* flags while conftests.
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body):
- Sometimes the Ruby source aliases two otherwise
- unrelated methods (for example Kernel#object_id and
- Kernel#hash are both the same C function). Provide a
- facility to allow the methods to be documented
- separately.
+Fri Jan 21 09:17:00 2011 Luis Lavena <luislavena@gmail.com>
-Sun Dec 28 01:05:31 2003 Dave Thomas <dave@pragprog.com>
+ * configure.in: Fix incorrectly detected x86_64-w64-mingw32 due
+ canonalization of target_os. Bug #3889 [ruby-core:32634]
- * marshal.c, signal.c: RDoc collemts added by Elliott Hughes
+Thu Jan 20 23:44:00 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun Dec 28 00:48:47 2003 Dave Thomas <dave@pragprog.com>
+ * configure.in: Fix rb_cv_va_args_macro was broken. We are using
+ -Werror=implicit-function-declaration compile option. therefore
+ we need a function declaration explicitly.
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_class_comment):
- Some source files use lower case class or module names
- when naming the Init_XXX function in C.
+Thu Jan 20 23:58:02 2011 Tanaka Akira <akr@fsij.org>
-Sat Dec 27 23:41:46 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * node.h: parenthesize macro arguments.
- * configure.in: fix "test: too many arguments" error.
+Thu Jan 20 23:25:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sat Dec 27 15:32:19 2003 Dave Thomas <dave@wireless_3.local.thomases.com>
+ * configure.in: Add '#include <stdlib.h>' to
+ rb_cv_localtime_overflow test too. It's reported by Tomoyuki
+ Chikanaga. Thanks.
- * time.c: RDoc comments added
+Thu Jan 20 16:11:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Sat Dec 27 15:07:57 2003 Dave Thomas <dave@pragprog.com>
+ * README.EXT, README.EXT.ja: You shouldn't choose ``conftest.c'' as a
+ name of a source file.
- * object.c: Add RDoc comments for Symbol class.
+Thu Jan 20 12:15:44 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sat Dec 27 14:42:30 2003 Dave Thomas <dave@pragprog.com>
+ * configure.in: Add stdlib.h inclusion into rb_cv_negative_time_t
+ test because it's required for exit(3). The patch is
+ created by Tomoyuki Chikanaga. [Bug #4287] [ruby-dev:43060]
- * numeric.c: Add RDoc comments.
+Thu Jan 20 11:39:41 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Dec 27 00:44:00 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/webrick/utils.rb (TestWEBrick::RubyBin): test CGI does not need
+ to load rubygems. if it activated, ruby raises LoadError about
+ rbconfig.rb.
- * io.c (next_argv): warn always for stdin on inplace edit mode.
+Thu Jan 20 09:19:42 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * io.c (read_all): need to check string value.
+ * ext/psych/lib/psych/visitors/json_tree.rb: Fix JSON emit for
+ DateTime and Time classes.
- * io.c (argf_read): allow ARGF.read(nil). [ruby-dev:22433]
+ * test/psych/test_json_tree.rb: test for JSON emit
-Fri Dec 26 23:02:09 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Jan 20 08:02:46 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * io.c (rb_f_backquote): need not to check nil result.
- [ruby-core:02078]
+ * ext/psych/lib/psych/coder.rb (represent_object): arbitrary objects
+ may be passed to the Psych::Coder object.
- * io.c (rb_io_getline): should return nil when read_all gives
- empty string, even when nil rs is specified. [ruby-core:02077]
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: support for visiting
+ arbitrary objects set on the coder.
-Fri Dec 26 18:50:59 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/psych/test_coder.rb: supporting test case.
- * configure.in: check if getcontext and setcontext are available.
+Thu Jan 20 06:03:17 2011 Tanaka Akira <akr@fsij.org>
- * eval.c: use presence of getcontext/setcontext.
+ * method.h: parenthesize macro arguments.
-Fri Dec 26 16:40:53 2003 Tanaka Akira <akr@m17n.org>
+Wed Jan 19 13:16:05 2011 Eric Hodel <drbrain@segment7.net>
- * lib/pathname.rb (PathnameTest#test_plus): add 2 assertions.
+ * lib/rubygems/commands/sources_command.rb: Finish removing code,
+ (fixes sources command test).
-Fri Dec 26 09:26:58 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Jan 19 13:04:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * pack.c (pack_pack): add sign check for 'i', and 'l'.
- [ruby-dev:22427]
+ * proc.c (proc_call): Add gc guard to avoid segfault. The fix
+ is created by Tomoyuki Chikanaga. [Bug #4238][ruby-dev:42963]
- * bignum.c (rb_quad_pack): add range check for 'quad int'.
+Wed Jan 19 12:31:28 2011 Eric Hodel <drbrain@segment7.net>
-Thu Dec 25 22:39:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/rubygems.rb: Since gem_prelude requires rubygems, enable
+ custom_require always.
- * string.c (rb_str_update): don't return any value.
+Wed Jan 19 12:08:08 2011 Eric Hodel <drbrain@segment7.net>
-Thu Dec 25 15:30:17 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/rubygems/commands/dependency_command.rb: Remove require of
+ deleted file.
+ * lib/rubygems/commands/fetch_command.rb: ditto
+ * lib/rubygems/commands/setup_command.rb: ditto
+ * lib/rubygems/commands/sources_command.rb: ditto
+ * lib/rubygems/commands/specification_command.rb: ditto
- * string.c (rb_str_update): call rb_str_modify().
+Wed Jan 19 08:13:59 2011 Ryan Davis <ryand-ruby@zenspider.com>
-Thu Dec 25 05:08:09 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rubygems*: Import rubygems 1.5.0 (release candidate)
+ * test/rubygems: Ditto
- * eval.c (search_required): search actual file name once when no
- extension specified.
+Tue Jan 18 23:31:01 2011 Yusuke Endoh <mame@tsg.ne.jp>
-Thu Dec 25 04:00:44 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * parse.y: avoid NULL reference. [ruby-dev:43067]
- * stable version 1.8.1 released.
+Wed Jan 19 02:54:04 2011 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Dec 25 00:17:53 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * vsnprintf.c (cvt): set first byte of buf to NUL for the case when
+ no bytes are written to the buf. [ruby-dev:43062]
- * configure.in: check for nanosleep, -lrt if required.
- [ruby-core:02059]
+Tue Jan 18 23:04:51 2011 Tanaka Akira <akr@fsij.org>
- * eval.c (thread_timer): use select(2) if nanosleep(2) is not
- available.
+ * gc.h: parenthesize macro arguments.
- * eval.c: check __stub_getcontext for glibc on some platforms.
- [ruby-list:38984]
+Tue Jan 18 18:31:14 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
-Wed Dec 24 23:48:04 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * lib/irb/completion.rb: Irb tab completion support for XX::method
+ forms.
- * test/soap/test_basetype.rb, test/soap/marshal/test_marshal.rb
- test/xsd/test_xsd.rb: use "(-1.0 / (1.0 / 0.0))" instead of "-0.0"
- to express -0.0. [ruby-talk:88786]
+Tue Jan 18 15:05:55 2011 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Wed Dec 24 23:29:30 2003 Tanaka Akira <akr@m17n.org>
+ * lib/logger.rb: added RDoc document for logging message escape
+ by Hal Brodigan. See #3869
- * lib/tsort.rb (test_orphaned_break): removed.
+Tue Jan 18 07:53:52 2011 Tanaka Akira <akr@fsij.org>
-Wed Dec 24 20:53:06 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * eval_intern.h: parenthesize macro arguments.
- * ext/tk/sample/tkmulticolumnlist.rb: new sample
+Tue Jan 18 04:42:44 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/tk/sample/tkmultilistframe.rb: bug fix
+ * ext/psych/lib/psych/parser.rb (Mark): Adding a class to wrap
+ marker information
-Wed Dec 24 20:37:37 2003 Eric Sunshine <sunshine@sunshineco.com>
+ * ext/psych/parser.c (mark): Add a method to return the mark object
+ for the parser
- * configure.in (LDSHARED): Fixed typographical error in assignment of
- LDSHARED for Rhapsody which caused linking of extension modules to
- fail.
+ * test/psych/test_parser.rb: tests for the Mark class.
-Wed Dec 24 17:51:18 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Jan 18 02:46:55 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * file.c (rb_thread_flock): enable thread support again.
+ * ext/psych/lib/psych/visitors/json_tree.rb (visit_String): JSON
+ strings should be dumped with double quotes. [ruby-core:34186]
-Wed Dec 24 16:46:08 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/psych/test_json_tree.rb: test for double quotes
- * eval.c (catch_timer): do not call rb_thread_schedule() inside to
- avoid pthread_mutex_lock() deadlock. interrupts to system calls
- are detected by TRAP_END via EINTR error.
+Mon Jan 17 23:36:33 2011 Tanaka Akira <akr@fsij.org>
- * eval.c (thread_timer): do not post signal unless it is
- absolutely necessary.
+ * array.c (rb_ary_times): less MEMCPY calls.
- * rubysig.h (TRAP_END): add CHECK_INTS to switch thread.
+Mon Jan 17 22:54:33 2011 Tanaka Akira <akr@fsij.org>
- * regex.c (re_compile_pattern): check if nextp is smaller than
- pend. [ruby-dev:22372]
+ * debug.h: parenthesize macro arguments.
- * eval.c (umethod_bind): remove method overridden check.
- [ruby-dev:22366]
+Mon Jan 17 21:40:25 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Dec 24 16:13:05 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ruby.c (process_options): revert r30549.
- * ext/openssl/ossl_ssl.c (ossl_ssl_read): should check for error
- status by SSL_get_error().
+Sun Jan 16 20:55:45 2011 Tanaka Akira <akr@fsij.org>
- * ext/openssl/ossl_ssl.c (ossl_ssl_write): ditto.
+ * vsnprintf.c: parenthesize macro arguments.
-Wed Dec 24 14:23:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jan 15 11:57:30 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/stringio/stringio.c (strio_read): clear the buffer argument
- when returning nil. [ruby-dev:22363]
+ * configure.in (warnflags): add -Werror=implicit-function-declaration
+ if available.
- * test/ruby/ut_eof.rb (TestEOF::test_eof_0, TestEOF::test_eof_1):
- add buffer argument tests.
+ * lib/mkmf.rb (init_mkmf): ignore warnings in mkmf tests.
-Wed Dec 24 14:07:55 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/mkmf/base.rb (setup, teardown): restore config values.
- * lib/test/unit/assertions.rb: Modules are allowed to rescue.
+ * test/mkmf/test_flags.rb: split from test_find_executable.rb.
- * lib/test/unit/autorunner.rb: show output_level in order.
+Sat Jan 15 10:04:14 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit/collector/dir.rb: get rid of successive same
- directories in load path.
+ * ruby.c (process_options): autoload rubygems.
- * test/testunit/test_assertions.rb (test_assert_nothing_raised,
- test_assert_raise): test for modules.
+ * tool/compile_prelude.rb (Prelude#initialize): ignore empty
+ preludes.
-Wed Dec 24 13:43:34 2003 Shugo Maeda <shugo@ruby-lang.org>
+ * ruby.c (ruby_init_prelude): get rid of global namespace
+ pollution.
- * lib/net/imap.rb (authenticate): remove "\n" from base64 encoded
- strings.
+Sat Jan 15 09:42:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Dec 24 11:26:41 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * include/ruby/io.h: missing prototypes.
- * test/fileutils/test_fileutils.rb: should not create any
- files or directories in current directory. [ruby-talk:88724]
+Fri Jan 14 23:25:55 2011 Tanaka Akira <akr@fsij.org>
-Wed Dec 24 10:29:53 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vm_method.c: parenthesize macro arguments.
- * ext/stringio/stringio.c (strio_read): never return nil at
- unlimited read. [ruby-dev:22334]
+Fri Jan 14 15:32:29 2011 Shugo Maeda <shugo@ruby-lang.org>
- * ext/stringio/stringio.c (strio_read): support second
- argument. [ruby-dev:22350]
+ * test/net/imap/test_imap.rb: call neither logout nor disconnect
+ unless connected. patch by Kazuhiro NISHIYAMA. [ruby-dev:42860]
-Wed Dec 24 09:38:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jan 14 14:56:57 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * parse.y (arg): should return 0 after error. [ruby-dev:22360]
+ * lib/net/imap.rb: use bytesize for binary strings.
+ patched by Yoshimasa Niwa. [ruby-core:34222]
-Wed Dec 24 00:56:54 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Jan 14 14:01:12 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * io.c (read_all): do not return nil at the end of file.
- [ruby-dev:22334]
+ * pack.c (pack_unpack): the resulted string of unpack('M') must have
+ ASCII-8BIT encoding (and ENC_CODERANGE_VALID). [ruby-core:34482]
- * io.c (argf_read): do not depend on nil at eof behavior of
- IO#read().
+Fri Jan 14 13:38:58 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * eval.c (rb_thread_join): dup exception before re-raising it.
+ * ext/zlib/zlib.c (gzfile_check_footer): ISIZE (Input SIZE) in
+ gzip's header is the size of uncompressed input data modulo 2^32.
+ [ruby-core:34481] http://www.ietf.org/rfc/rfc1952.txt
- * io.c (rb_io_eof): call clearerr() to prevent side effect. this
- patch is supplied by Masahiro Sakai <sakai@tom.sfc.keio.ac.jp>.
- [ruby-dev:22234]
+Fri Jan 14 11:36:25 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * pack.c (OFF16): get offset for big endian machines.
+ * configure.in, win32/Makefile.sub (RUNRUBY): require path should
+ include "." because rbconfig.rb is there.
- * pack.c (pack_pack): use OFF16 instead of OFF16B.
- [ruby-dev:22344]
+Fri Jan 14 10:40:11 2011 Ryan Davis <ryan@lust.local>
- * pack.c (pack_unpack): ditto.
+ * gem_prelude.rb: Just require rubygems. Fixes rubygems 1.4.
+ * lib/rubygems.rb: removed all Gem::Quickloader code.
+ * ruby.c: renamed ruby_init_gems to ruby_init_prelude. Set
+ $disable_rubygems since there is no fine grained mechanism to
+ skip parts of the prelude. Open to suggestions on how to do this
+ better.
+ * test/*.rb: Load path isn't set up correctly, so add
+ --disable-gems as needed to failing tests that are explicitly
+ testing stderr w/ ==.
-Tue Dec 23 22:47:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Jan 14 07:30:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (rb_io_check_readable): set FMODE_RBUF always, even if
- NEED_IO_SEEK_BETWEEN_RW is not defined. [ruby-dev:22340]
+ * io.c (argf_next_argv): go advance when the next file cannot be
+ read. [ruby-core:34446]
- * io.c (rb_io_check_writable): clear FMODE_RBUF before writing
- something.
+Thu Jan 13 20:49:19 2011 Tanaka Akira <akr@fsij.org>
-Tue Dec 23 22:25:00 2003 Gavin Sinclair <gsinclair@soyabean.com.au>
+ * vm_insnhelper.c: parenthesize macro arguments.
- * lib/optparse.rb: incomplete RDoc documentation added in place of
- existing RD comments. Tabs converted to spaces.
+Thu Jan 13 13:21:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Tue Dec 23 19:44:47 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * vm_dump.c: delete dashes to make lines 80 chars, Patched by
+ Shota Fukumori (sora_h). [Bug #4275] [ruby-dev:43021]
- * test/soap/test_streamhandler.rb (test_basic_auth): removed.
- soap4r + basic_auth is not officially supported in ruby/1.8.1 even
- though soap4r + basic_auth + http-access2 should run fine.
+Thu Jan 13 13:21:00 2011 Kenta Murata <mrkn@mrkn.jp>
-Tue Dec 23 19:42:59 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vm_dump.c: fix misspelling of CrashReporter, Patched by Shota
+ Fukumori (sora_h). [Bug #4275] [ruby-dev:43021]
- * io.c (rb_io_ungetc): raise an exception at unread stream to
- avoid unspecified behavior. [ruby-dev:22330]
+Thu Jan 13 06:27:29 2011 Ryan Davis <ryand-ruby@zenspider.com>
- * test/ruby/test_system.rb (test_syntax): glob relatively from
- __FILE__.
+ * error.c: Exception#to_s should actually call to_s.
-Tue Dec 23 18:09:40 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Jan 13 00:32:54 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * pack.c (pack_pack): remove unnecessary negative value check.
- [ruby-dev:22329]
+ * addr2line.c (get_nth_dirname): decrement the directory index
+ because the index specifies the index of given included_directories
+ which is separated by NUL and its index is begun from 1.
+ Note that 0 specifies the current directory of the compilation.
+ see also http://www.dwarfstd.org/doc/dwarf-2.0.0.pdf
-Tue Dec 23 17:26:55 2003 KONISHI Hiromasa <konishih@fd6.so-net.ne.jp>
+Thu Jan 13 00:06:38 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * bcc32/Makefile.sub (config.h): bcc has finite(). [ruby-list:38940]
+ * io.c (rb_f_syscall): Add warning messages. [ruby-core:34062]
-Tue Dec 23 16:08:16 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Thu Jan 13 00:00:07 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/rexml/encodings/US-ASCII.rb: typo. [ruby-talk:88650]
+ * io.c (rb_f_syscall): Some syscall return unsigned or pointer value.
+ Therefore we should only check the result is -1 or not.
+ [ruby-core:34062]
- * test/ruby/test_system.rb: num of asserts depended on running dir.
+Wed Jan 12 23:55:48 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * test/xsd/test_noencoding.rb: rexml + without iconv/uconv cannot
- handle euc-jp. install iconv, uconv or xmlscan.
+ * io.c (rb_f_syscall): Add 64bit Linux support. Some syscall takes
+ long type arguments.
-Tue Dec 23 14:13:51 2003 akira yamada <akira@ruby-lang.org>
+Wed Jan 12 19:37:10 2011 Tanaka Akira <akr@fsij.org>
- * lib/uri/generic.rb (URI::Generic::check_userinfo,
- URI::Generic::check_user, URI::Generic::check_password): tests
- conflicts/depends with other components closely.
+ * vm_dump.c: parenthesize macro arguments.
- * test/uri/test_generic.rb (TestGeneric::test_set_component):
- added tets.
+Wed Jan 12 19:28:23 2011 Tanaka Akira <akr@fsij.org>
-Tue Dec 23 11:08:34 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * vm.c (thread_free): reset ruby_current_thread if it points the
+ thread to free.
+ * gc.c (slot_sweep): don't call RUBY_VM_SET_FINALIZER_INTERRUPT if
+ there is no current thread.
+ [ruby-dev:43000]
- * test/xsd/test_noencoding.rb: rescue Errno::EINVAL and do not test.
- "euc-jp" might not be in supported encoding name list.
- [ruby-talk:88650]
+Wed Jan 12 19:09:29 2011 Tanaka Akira <akr@fsij.org>
-Tue Dec 23 06:10:31 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * enum.c (sort_by_i): reenter check more strictly.
+ (sort_by_cmp): ditto.
+ [ruby-dev:43003] reported by Usaku NAKAMURA.
- * lib/webrick/cgi.rb (CGI): add support for mod_ruby.
+Wed Jan 12 16:25:12 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * lib/webrick/cgi.rb (CGI::Socket): add check for existence of
- OpenSSL module in all HTTPS related methods.
+ * lib/net/http.rb (Net::HTTP#connect): makes it timeout during
+ SSL handshake too. [ruby-core:34203]
+ Patch by Marc Slemko.
- * lib/webrick/cgi.rb (CGI::Socket#cipher): should create similar
- value to OpenSSL::SSLSocket#cipher.
+ * test/net/http/test_http.rb (TestNetHTTP_v1_2#test_timeout_during_HTTP_session):
+ test for [ruby-core:34203]
- * lib/webrick/httpresponse.rb (HTTPResponse#setup_header): should
- set "connection: close" if @keep_alive is false.
+ * test/net/http/test_https.rb (TestNetHTTPS#test_timeout_during_SSL_handshake):
+ ditto.
- * lib/webrick/https.rb (HTTPrequest#meta_vars): add supprt for
- SSL_PROTOCOL, SSL_CIPHER_USEKEYSIZE and SSL_CIPHER_ALGKEYSIZE.
+Wed Jan 12 16:24:53 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-Mon Dec 22 23:00:05 2003 akira yamada <akira@ruby-lang.org>
+ * ext/readline/extconf.rb: new checks for RL_PROMPT_START_IGNORE
+ and RL_PROMPT_END_IGNORE. [ruby-core:34331]
- * lib/uri/generic.rb (URI::Generic::check_opaque): fixed typo.
+ * ext/readline/readline.c: enables USE_INSERT_IGNORE_ESCAPE only if
+ RL_PROMPT_{START,END}_IGNORE are available to get rid of compilation
+ error with libedit.
-Mon Dec 22 21:59:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jan 12 15:53:49 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/iconv/iconv.c (map_charset): always ensure code is a String.
+ * README.EXT.ja (rb_ensure): typo.
-Mon Dec 22 21:15:29 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jan 12 11:33:46 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * class.c (rb_mod_init_copy): always copy singleton class.
- [ruby-dev:22325]
+ * addr2line.c: OpenBSD uses the elf_abi.h header file instead of the
+ elf.h header file. patched by Jeremy Evans [ruby-core:34384]
-Mon Dec 22 20:44:36 2003 akira yamada <akira@ruby-lang.org>
+Wed Jan 12 03:59:36 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/uri/generic.rb (URI::Generic#route_from): accepts urls which
- has no host-part.
+ * test/webrick/test_cgi.rb: Removes usage of deprecated
+ :RequestHandler option.
+ patched by Peter Weldon [ruby-core:34010]
- * test/uri/test_generic.rb (TestGeneric::test_route): added a test.
+ * test/webrick/test_httpproxy.rb: ditto.
-Mon Dec 22 20:38:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/webrick/test_httpserver.rb: Add a test of the deprecation
+ behaviour.
- * lib/cgi.rb: reduce eval.
+Wed Jan 12 08:37:07 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/cgi.rb (CGI::QueryExtension::read_multipart): alias path to
- local_path. [ruby-list:38883]
+ * hash.c (hash_i): return different values for inverse hash.
+ [ruby-core:34334]
-Mon Dec 22 20:09:31 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Tue Jan 11 20:32:59 2011 Tanaka Akira <akr@fsij.org>
- * test/soap/test_property.rb: remove duplicated test method.
+ * variable.c: parenthesize macro arguments.
-Mon Dec 22 18:22:04 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Jan 11 13:06:38 2011 NAKAMURA Usaku <usa@ruby-lang.org>
- * bcc32/Makefile.sub, win32/Makefile.sub (config.h): remove
- HAVE_ISINF definition to follow previous commits of missing.h
- and win32/win32.h.
+ * array.c (rb_ary_resize): should care of embeded array when extending
+ the array.
-Mon Dec 22 17:23:42 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (rb_ary_resize): need to set capa when changing the real
+ size of the array.
+ these are latent bugs.
- * configure.in (ac_cv_func_setitimer): moved from defines.h
+Mon Jan 10 22:46:43 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * defines.h, rubysig.h, signal.c: removed macro handling which
- should be done in configure.
+ * include/ruby/defines.h (CASEFOLD_FILESYSTEM): HFS+ is case
+ insensitive.
- * configure.in (intrinsics.h): check if present.
+ * load.c (loaded_feature_path, rb_feature_p, load_lock): on a
+ case-insensitive filesystem, loaded features search should
+ ignore case. [ruby-core:34297]
- * ruby.h: include intrinsics.h if available.
+Mon Jan 10 21:34:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * bignum.c, marshal.c: include ieeefp.h if available.
+ * common.mk (showflags): show LD commands.
- * missing.h (isinf): define as a macro if finite() and isnan()
- are available. [ruby-core:02032]
+Mon Jan 10 14:32:55 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Dec 22 17:07:31 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * test/ruby/test_method.rb (TestMethod#test_define_method): method
+ transplanting between class and module is impossible.
- * configure.in (mingw): set isnan, finite and isinf to yes.
+Mon Jan 10 13:51:17 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Dec 22 13:40:19 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * misc/rdoc-mode.el (rdoc-mode): show trailing whitespace.
- * lib/soap/property.rb: passing block by reference.
+Mon Jan 10 11:22:02 2011 Tanaka Akira <akr@fsij.org>
-Mon Dec 22 00:32:43 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * util.c: parenthesize macro arguments.
- * eval.c (rb_with_disable_interrupt): use ENABLE_INTS instead of
- ALLOW_INTS which may switch context. [ruby-dev:22319]
+Mon Jan 10 07:41:31 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * ext/syck/emitter.c (syck_emitter_write): str bigger than
- e->bufsize causes buffer overflow. [ruby-dev:22307]
+ * misc/README: mention rdoc-mode.el and ruby-style.el.
-Sun Dec 21 17:29:00 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jan 9 20:37:21 2011 Tanaka Akira <akr@fsij.org>
- * class.c (rb_check_inheritable): new function. [ruby-dev:22316]
+ * transcode.c: parenthesize macro arguments.
- * intern.h: add prototype.
+Sun Jan 9 16:31:53 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * eval.c (superclass): use rb_check_inheritable().
+ * io.c (Kernel.#syscall): implemented on LP64/LLP64 environments too.
+ also uses __syscall if available for *BSD on 64bit architecture.
+ [ruby-core:34062]
- * object.c (rb_class_initialize): check argument validity.
+Sun Jan 9 16:31:34 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-Sun Dec 21 16:25:10 2003 Tanaka Akira <akr@m17n.org>
+ * lib/irb/locale.rb (IRB::Locale::LOCALE_NAME_RE):
+ some platform has a locale without territory but with
+ encoding.
+ (#each_sub_locale): ditto.
- * lib/pathname.rb (Pathname#+): re-implemented to resolve ".." in
- beginning of the argument.
- (Pathname#join): concatenate from the last argument.
- (Pathname#parent): just use Pathname#+.
+Sun Jan 9 14:47:50 2011 TAKAO Kouji <kouji@takao7.net>
-Sun Dec 21 00:12:37 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/readline/readline.c: apply a patch from Nobuyoshi Nakada.
+ fixed #3616 [ruby-core:31484] IRB + readline incorrectly counts
+ non-printing characters in prompt
- * ext/tk/lib/tk.rb: add new methods (TkScrollbar#assign, assign_list)
+Sat Jan 8 21:47:26 2011 Tanaka Akira <akr@fsij.org>
- * ext/tk/sample/tkmultilistframe.rb: use TkScrollbar#assign method
+ * enum.c (enum_sort_by): use rb_ary_resize.
+ (ary_cutoff): removed.
-Sat Dec 20 21:59:03 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sat Jan 8 21:24:17 2011 Tanaka Akira <akr@fsij.org>
- * lib/webrick/httprequest.rb (HTTPRequest#meta_vars): refine regexp.
+ * pack.c (swapf): compilation condition simplified.
+ (swapd): ditto.
- * lib/webrick/cgi.rb (CGI#start): NPH scripts return status line
- instead of Status: header field.
+Sat Jan 8 20:51:25 2011 Tanaka Akira <akr@fsij.org>
- * lib/webrick/cgi.rb (CGI::Socket): refine some coditions.
+ * pack.c (swapd): remove duplicated code.
-Sat Dec 20 16:07:14 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jan 8 19:28:55 2011 Tanaka Akira <akr@fsij.org>
- * lib/optparse.rb (OptionParser::Completion::complete): wrong
- Regexp for word boundary. pointed out by Gavin Sinclair.
+ * thread.c: parenthesize macro arguments.
- * lib/optparse.rb (OptionParser::make_switch): [no-] prefix was
- missing.
+Fri Jan 7 23:07:40 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Dec 20 11:40:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb (configuration): backref needs to capture.
- * lib/yaml.rb (YAML::YAML): adjust Marshal version.
+Fri Jan 7 21:57:22 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Dec 20 03:56:02 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * misc/ruby-mode.el (ruby-mode-variables), misc/ruby-style.el:
+ show trailing whitespace.
- * eval.c (rb_with_disable_interrupt): prohibit thread context
- switch during proc execution. [ruby-dev:21899]
+ * misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): highlight
+ regexp after open bracket. [ruby-core:34183]
-Sat Dec 20 02:41:02 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Fri Jan 7 00:37:35 2011 Tanaka Akira <akr@fsij.org>
- * lib/webrick/cgi.rb: add file. (yet another CGI library)
+ * string.c: parenthesize macro arguments.
- * MANIFEST: add lib/webrick/cgi.rb.
+Thu Jan 6 22:42:02 2011 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Dec 20 02:18:31 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * bignum.c (bigmul1_karatsuba): avoid overflow that make assertion
+ fail in certain case. this patch is contributed from Ray Chason
+ <chasonr at gmail.com> in personal communication.
- * misc/ruby-mode.el (ruby-calculate-indent): proper indentation
- inside of parentheses. [ruby-dev:22308]
+Thu Jan 6 20:55:49 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Dec 19 21:24:22 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * lib/mkmf.rb (create_makefile): ignore rest from first dot from
+ TARGET to generate init function name.
+ this is followup of r30464.
- * lib/webrick/httprequest.rb (HTTPRequest#meta_vars): should not set
- HTTP_CONTENT_TYPE and HTTP_CONTENT_LENGTH.
+Thu Jan 6 11:27:01 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/webrick/https.rb (HTTPRequest#parse): should check presence
- of cert() method to detect SSLSocket.
+ * ext/psych/lib/psych/json/tree_builder.rb (start_mapping): tags
+ should not be included in JSON mapping
-Fri Dec 19 22:56:46 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Thu Jan 6 09:23:33 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/soap/property.rb (SOAP::Property#load): new method for loading
- property value into existing property tree.
+ * lib/net/protocol.rb (eof?): BufferedIO should proxy eof? to the
+ underlying IO object.
- * test/soap/test_property.rb: add test.
+Thu Jan 6 09:12:31 2011 Aaron Patterson <aaron@tenderlovemaking.com>
-Fri Dec 19 19:21:49 2003 akira yamada <akira@ruby-lang.org>
+ * lib/mkmf.rb (configuration): fixing gsub when multiple error flags
+ are passed to GCC.
- * lib/runit/cui/testrunner.rb (RUNIT::CUI::TestRunner::run):
- should use Test::Unit::UI::{PROGRESS_ONLY,VERBOSE}.
+Thu Jan 6 05:25:49 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Dec 19 17:36:49 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * array.c (rb_ary_modify): export.
- * ext/tk/sample/tkmultilistbox.rb: bug fix
+Thu Jan 6 05:14:41 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/sample/tkmultilistframe.rb: new sample script
+ * ext/stringio/stringio.c (get_strio, strio_set_string)
+ (strio_reopen): check if frozen. [ruby-core:33648]
-Fri Dec 19 03:44:27 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Thu Jan 6 05:10:58 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/webrick/httputils.rb (parse_form_data): should return an
- empty Hash if the body is empty.
+ * array.c (rb_ary_resize): new utility function. [ruby-dev:42912]
-Thu Dec 18 21:47:35 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Jan 6 05:03:26 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/mkmf.rb (create_makefile): should remove deffile if it's
- made by miniruby. based on nobu's patch.
+ * dln.c (init_funcname_len): ignore rest from first dot.
+ [ruby-dev:41774]
-Thu Dec 18 21:44:21 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Jan 6 02:55:48 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * eval.c (stack_extend): ignore inline optimization on VC7.
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: use YAML 1.0 output
+ format for serializing nil values. Thanks Eric Hodel!
- * win32/Makefile.sub (OS, RT): can override.
+ * test/psych/test_nil.rb: test for nil values
- * win32/Makefile.sub (LDFLAGS): ditto. shouldn't use pdb:none
- option. based on Tietew's patch [ruby-dev:22289]
+Wed Jan 5 14:21:34 2011 Mark Dodwell <hi@mkdynamic.co.uk>
-Thu Dec 18 16:38:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c: fix rdoc typo.
+ https://github.com/shyouhei/ruby/pull/3
- * dir.c (fnmatch): unlike find_dirsep(), rb_path_next() never
- return NULL.
+Wed Jan 5 14:06:01 2011 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Dec 18 15:27:59 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * test/rdoc/test_rdoc_options.rb (TestRDocOptions#test_check_files):
+ skip on Windows because chmod 0 doesn't mean unreadable by owner.
- * lib/ipaddr.rb (IPSocket::getaddress): merge usa's patch.
- [ruby-dev:21678]
+Wed Jan 5 13:56:54 2011 Akinori MUSHA <knu@iDaemons.org>
-Wed Dec 17 15:15:30 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/net/http.rb (Net::HTTP#get): A header hash given should not
+ be modified.
- * lib/cgi.rb (CGI::QueryExtension::Value::[]): should work like
- String#[] if more than one arguments are specified.
+Wed Jan 5 12:10:08 2011 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/delegate.rb: avoid using common instance name as "@obj".
+ * ext/dl/{cfunc.c,dl.h,handle.c}, ext/fiddle/fiddle.{h,c}: Use _WIN32
+ rather than checking for windows.h. Thanks Jon Forums!
+ [ruby-core:33977]
- * lib/cgi.rb (CGI::QueryExtension::Value): Value is no longer
- subclass of String, but DelegateClass(String).
+Sat Jan 1 17:02:50 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * ext/curses/extconf.rb: restore function check for init_color.
- [ruby-list:38905]
+ * lib/irb/locale.rb (IRB::Locale#search_file): make it possible
+ to load a localization from a gem.
+ (IRB::Locale#lc_path): obsoleted because of the change of #search_file
+ (IRB::Locale#each_localized_path): new private method, based on
+ lc_path
+ (IRB::Locale#find): follows the change of #search_file.
+ (IRB::Locale#load): removed duplicate with #find.
- * Makefile.in: need to specify $(MAINLIBS) for the miniruby
- generation rule.
+Sat Jan 1 11:44:42 2011 Tanaka Akira <akr@fsij.org>
- * configure.in: better FreeBSD -lc_r support.
+ * strftime.c: parenthesize macro arguments.
-Wed Dec 17 00:16:14 2003 Minero Aoki <aamine@loveruby.net>
+Sat Jan 1 11:10:29 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/strscan/strscan.c: new method
- StringScanner#beginning_of_line? (alias #bol?)
+ * ext/zlib/zlib.c: take care of platforms where long is bigger
+ than int.
- * ext/strscan/strscan.c: new method StringScanner#concat and #<<.
+Sat Jan 1 11:03:58 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/strscan/strscan.c: StringScanner#new(str) does not duplicate
- nor freeze STR (allow destructive modification).
+ * NEWS (optparse): shell completion support.
- * test/strscan/test_stringscanner.rb: test new methods above.
+ * misc/README (rb_optparse.{bash,zsh}): for shell completion.
- * test/strscan/test_stringscanner.rb: test destructive string
- modification.
+ * include/ruby/intern.h (VALUE rb_ary_print_on): I have never seen
+ this function anywhere.
-Tue Dec 16 21:20:47 2003 Tanaka Akira <akr@m17n.org>
+Sat Jan 1 04:20:11 2011 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/pp.rb: don't use local variable `pp'.
+ * win32/win32.c (rb_w32_write_console): don't raise exception when
+ the conversion is for writing to console.
+ Patched by Heesob Park [ruby-core:33999]
- * lib/prettyprint.rb: ditto.
+Fri Dec 31 12:02:06 2010 Tanaka Akira <akr@fsij.org>
-Tue Dec 16 13:20:43 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * enum.c (enum_sort_by): use less temporary objects.
- * ext/tk/lib/tk.rb: condition bug of if statement on
- {pack,grid}_propagate methods
+Fri Dec 31 11:46:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Dec 16 03:17:29 2003 why the lucky stiff <why@ruby-lang.org>
+ * configure.in (warnflags), lib/mkmf.rb (configuration): turn
+ warnings into errors only for bundled extensions.
+ [ruby-core:33815]
- * lib/yaml/rubytypes.rb: comments in strings. [ruby-talk:88012]
+Fri Dec 31 11:15:57 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/yaml/test_yaml.rb: add test.
+ * ext/zlib/zlib.c (sizeof): zlib.h mistakenly assumes the result
+ of sizeof to be int, not size_t.
-Tue Dec 16 01:14:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Dec 31 10:27:34 2010 Tanaka Akira <akr@fsij.org>
- * eval.c (catch_timer): check rb_thread_crtical in main native
- thread.
+ * st.c: parenthesize macro arguments.
- * eval.c (thread_timer): just sends signals periodically, to
- prevent main native thread from receiving them in critical
- section. [ruby-core:01959]
+Fri Dec 31 03:23:26 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Dec 15 13:32:22 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vsnprintf.c (BSD__uqtoa): Fix overflow when long != quad_t.
+ patched by Peter Weldon <peter.weldon AT null.net>
+ [ruby-core:33985]
- * dir.c (check_dirname): check string safety and remove extraneous
- trailing directory separators. [ruby-dev:22279]
+Fri Dec 31 03:00:34 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * file.c: renamed and externalized rb_path_next,
- rb_path_skip_prefix, rb_path_last_separator, rb_path_end.
+ * Makefile.in: remove unnecessary semicolons.
- * intern.h: prototypes for rb_path_next, rb_path_skip_prefix,
- rb_path_last_separator, rb_path_end.
+Thu Dec 30 23:09:47 2010 wanabe <s.wanabe@gmail.com>
-Mon Dec 15 09:27:46 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+ * vm.c (vm_define_method): guard iseq from GC while method definition.
+ [ruby-dev:42832]
- * ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): first argument
- of rb_protect should take an argument of VALUE.
+Thu Dec 30 20:18:32 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sun Dec 14 18:46:48 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * win32/Makefile.sub: ditto.
- * ext/socket/socket.c (Init_socket): IPv6 is not supported although
- AF_INET6 is defined on MinGW.
+Thu Dec 30 20:57:09 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/ipaddr.rb (AF_INET6): workaround in the environment which does
- not support IPv6.
+ * Makefile.in: Check V=1 argument if run "make clean" or similar.
-Sat Dec 13 18:55:16 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Dec 30 20:41:50 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/iconv/charset_alias.rb: preserve original order.
+ * Makefile.in: Kill ugly line continuation.
- * ext/iconv/extconf.rb: remove wrapper file at clean.
+Thu Dec 30 11:49:40 2010 Tanaka Akira <akr@fsij.org>
-Sat Dec 13 18:09:42 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * sprintf.c: parenthesize macro arguments.
- * eval.c (thread_timer): use timer by sub-thread and nanosleep.
- [ruby-talk:87519]
+Wed Dec 29 21:20:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * gc.c (Init_stack): no stack adjustment for THREAD_SAFE.
+ * io.c (maygvl_copy_stream_wait_readwrite): define if USE_SENDFILE
-Sat Dec 13 17:17:59 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Dec 29 20:37:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (proc_alloc): cache the created object at first time.
- [ruby-talk:61288], [ruby-dev:22240]
+ * ext/extmk.rb: strip current directory prefix.
-Sat Dec 13 09:01:23 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * enc/depend (clean): remove name2ctype.h when out-of-place build.
- * configure.in: check ucontext.h.
+ * win32/Makefile.sub (clean-enc): pass V to inferior make.
- * eval.c: use getcontext/setcontext() instead of setjmp/longjmp()
- on ia64 or with native thread enabled. [ruby-core:01932]
+Wed Dec 29 18:23:46 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Dec 13 03:09:14 2003 why the lucky stiff <why@ruby-lang.org>
+ * re.c (rb_reg_expr_str): need to escape if the coderange is invalid.
- * lib/yaml/rubytypes.rb: anonymous struct fix. [ruby-core:01946]
+Wed Dec 29 10:06:51 2010 Tanaka Akira <akr@fsij.org>
- * test/yaml/test_yaml.rb: add test.
+ * signal.c: parenthesize macro arguments.
-Fri Dec 12 22:36:44 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Wed Dec 29 07:22:15 2010 Eric Hodel <drbrain@segment7.net>
- * lib/csv.rb: add Cell#to_str and Cell#to_s for /.../ =~ aCell,
- "#{aCell}" and so on.
+ * lib/rake/rdoctask.rb: Deprecate in favor of rdoc/task.
- * test/csv/test_csv.rb: add tests.
+Wed Dec 29 07:07:06 2010 Eric Hodel <drbrain@segment7.net>
-Fri Dec 12 19:33:06 2003 Minero Aoki <aamine@loveruby.net>
+ * lib/rdoc: Import RDoc 3.1
- * lib/fileutils.rb (mkdir): remove trailing `/' from pathes.
+Tue Dec 28 18:36:38 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/fileutils.rb (rmdir): ditto. [ruby-dev:22238]
+ * error.c, include/ruby/intern.h (rb_compile_error_with_enc): new
+ function to raise syntax error, with source encoding'ed message.
- * lib/fileutils.rb (rmdir_r): ditto.
+ * parse.y (compile_error): use above function.
+ [ruby-core:33951] (#4217)
- * lib/fileutils.rb (fu_copy_dir): check if it is a directory after
- mkdir(2).
+Tue Dec 28 07:37:38 2010 Tanaka Akira <akr@fsij.org>
-Fri Dec 12 06:06:09 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c: parenthesize macro arguments.
- * eval.c (proc_invoke): fix class name in warning message for
- define_method. [ruby-dev:22235]
+Tue Dec 28 07:17:11 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Thu Dec 11 21:24:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * NEWS: add ARGF.write and so on.
- * ext/openssl/ossl_pkcs12.[ch]: new files. add OpenSSL::PKCS12.
+Tue Dec 28 07:12:38 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * ext/openssl/ossl.[ch]: ditto.
+ * NEWS: add new magic-comment. (warn-indent) [ruby-core:25442]
- * ext/openssl/MANIFEST: add ossl_pkcs12.[ch].
+Tue Dec 28 04:32:37 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-Thu Dec 11 20:54:28 2003 Minero Aoki <aamine@loveruby.net>
+ * ext/fiddle/extconf.rb: check for windows.h while building fiddle.
+ Thanks Jon Forums! [ruby-core:33923]
- * lib/fileutils.rb (mkdir_p): remove trailing `/' befere mkdir(2).
- mkdir("nonexistdir/") does not work on NetBSD/Alpha 1.6.1.
+Tue Dec 28 01:45:12 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * lib/fileutils.rb (fu_list): call to_str for all arguments.
+ * NEWS: Add Zlib.deflate and Zlib.inflate.
+ [ruby-dev:42833]
-Thu Dec 11 20:07:01 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+Mon Dec 27 21:22:33 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/ftools.rb (makedirs): sync with fileutils.
+ * win32/configure.bat: Remove obsoleted coding rule. Now, we
+ don't support to build on Windows 95/98 and Me.
-Thu Dec 11 19:53:03 2003 Minero Aoki <aamine@loveruby.net>
+Mon Dec 27 18:27:13 2010 Tanaka Akira <akr@fsij.org>
- * lib/fileutils.rb (mkdir_p): catch all SystemCallErrors.
- (mkdir("C:\") causes EACCESS on Windows 2000/NTFS)
+ * re.c: parenthesize macro arguments.
-Thu Dec 11 19:08:02 2003 Minero Aoki <aamine@loveruby.net>
+Mon Dec 27 15:22:23 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/fileutils.rb (mkdir_p): check if it is a directory after
- mkdir(2) instead of before mkdir(2), to avoid race condition.
- [ruby-talk:87730]
- Refer: mkinstalldirs sh script, GNU mkdir(1) (coreutils 5.0)
+ * win32/README.win32: note to need NT based OS to build ruby.
-Thu Dec 11 18:49:30 2003 Minero Aoki <aamine@loveruby.net>
+Mon Dec 27 12:14:46 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/fileutils.rb: def m( arg ) -> def m(arg).
+ * common.mk (EXTMK_ARGS): specify to pass macro V, because nmake
+ doesn't pass it via MAKEFLAGS.
-Thu Dec 11 11:39:43 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Dec 27 10:33:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * configure.in (ieeefp.h), numeric.c: needed for finite() on
- Solaris. [ruby-core:01921]
+ * ext/zlib/zlib.c (Init_zlib): Add Zlib.deflate and Zlib.inflate.
+ [ruby-dev:42833]
- * file.c (rb_stat_inspect): adjust format specifier.
+Mon Dec 27 07:38:07 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * parse.c (arg_prepend): nodetype() is for debug use.
+ * misc/rb_optparse.zsh: add compdef for generator.
- * ruby.h (ISASCII, etc): cast to int to get rid of warning.
+Mon Dec 27 07:32:07 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * ruby.h (alloca.h): include even in GCC. [ruby-core:01925]
+ * lib/optparse.rb (OptionParser#compsys): escape brackets too.
+ [ruby-dev:42754]
- * ext/bigdecimal/bigdecimal.c (GetVpValue): adjust format
- specifier.
+Mon Dec 27 01:30:08 2010 Tanaka Akira <akr@fsij.org>
- * ext/bigdecimal/bigdecimal.c (BigDecimal_prec, BigDecimal_coerce,
- BigDecimal_divmod): use rb_assoc_new() to suppress memory usage.
+ * ext/socket/mkconstants.rb: add IF_NAMESIZE.
+ add a default for INET6_ADDRSTRLEN.
- * ext/bigdecimal/bigdecimal.c (BigDecimal_split): ditto.
+Sun Dec 26 23:49:47 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/dl/sym.c (rb_dlsym_guardcall): guard itself should be
- volatile.
+ * win32/Makefile.sub: suppress a strange error message when RMALL
+ found no such file.
+ * win32/rmall.bat: new.
- * ext/iconv/iconv.c (iconv_convert): ensure actual parameter with
- format specifier.
+Sun Dec 26 21:23:23 2010 <kosaki.motohiro@gmail.com>
- * ext/pty/pty.c (MasterDevice, SlaveDevice, deviceNo): do not
- define unless used.
+ * win32/Makefile.sub: fix 'nmake clean-enc' breakage since r28322.
- * ext/pty/pty.c (getDevice): get rid of warning.
+Sun Dec 26 22:25:07 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/socket.c (port_str, sock_s_getaddrinfo,
- sock_s_getnameinfo): FIX2INT() now returns long.
+ * ext/ripper/depend (ripper.y): fix messages with nmake.
+ [ruby-dev:42896]
- * ext/socket/socket.c (init_inetsock_internal): uninitialized
- variable.
+Sun Dec 26 22:24:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/syck/rubyext.c (syck_parser_assign_io): add prototype.
+ * file.c (file_expand_path): get rid of warnings caused by
+ -Wdeclaration-after-statement on cygwin.
- * ext/syck/rubyext.c (rb_syck_mktime, yaml_org_handler): use
- ISDIGIT() instead of isdigit() to avoid warnings and for
- platforms which don't support non-ascii charater.
+Sun Dec 26 20:28:34 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Dec 10 19:28:56 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * process.c (before_exec): add small comment.
- * ext/stringio/stringio.c (strio_read): set EOF flag at short read.
- [ruby-dev:22223], [ruby-dev:22224]
+Sun Dec 26 20:52:21 2010 Tanaka Akira <akr@fsij.org>
-Wed Dec 10 18:07:25 2003 Minero Aoki <aamine@loveruby.net>
+ * ext/socket/mkconstants.rb: define INET_ADDRSTRLEN as 16 if not
+ available. fix compilation error on mswin32-60. reported by nobu.
- * lib/erb.rb: new method ERB#filename(=). [ruby-dev:22208]
+Sun Dec 26 19:37:37 2010 Tanaka Akira <akr@fsij.org>
-Wed Dec 10 17:54:51 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/socket/option.c: define IFNAMSIZ if not available.
+ fix compilation error on mingw32. reported by nobu.
- * ext/stringio/stringio.c (strio_read): do not set EOF flag when
- requested length is zero. [ruby-dev:22214]
+Sun Dec 26 12:16:29 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Dec 10 17:17:18 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/rdoc/ri/paths.rb (RDoc::RI::Paths::HOMEDIR): no exception if
+ HOME is not set. [ruby-core:33867]
- * io.c (read_all): should return given string even if data read is
- empty. [ruby-dev:22207]
+Sun Dec 26 11:39:11 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Dec 10 17:16:06 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (stmt): missing ripper rule. i.e., `a::B ||= c 1'.
+ http://twitter.com/#!/wannabe53/status/18797576396472321
+ http://twitter.com/#!/wannabe53/status/18798416150663168
- * ext/stringio/stringio.c (strio_read): adjust behavior at reading
- beyond EOF to IO. [ruby-dev:22205]
+Sun Dec 26 11:15:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/ut_eof.rb (TestEOF::Seek): test behaviors at reading
- beyond EOF.
+ * test/with_different_ofs.rb (DifferentOFS): should not affect
+ original classes.
- * test/ruby/test_file.rb, test/stringio/test_stringio.rb: include
- TestEOF::Seek test case.
+Sun Dec 26 09:35:07 2010 Tanaka Akira <akr@fsij.org>
-Wed Dec 10 15:01:19 2003 Shugo Maeda <shugo@ruby-lang.org>
+ * rational.c: parenthesize macro arguments.
- * test/monitor/test_monitor.rb (test_cond): use Queue#deq
- instead of sleep.
+Sun Dec 26 09:22:19 2010 Tanaka Akira <akr@fsij.org>
-Wed Dec 10 14:45:39 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * ext/socket/option.c (rb_if_indextoname): new function to abstract
+ environments without if_indextoname.
+ (inspect_ipv6_multicast_if): new function to inspect
+ IPV6_MULTICAST_IF.
+ Socket::Option.new(:INET6, :IPV6, :MULTICAST_IF,
+ [2].pack("I!")).inspect is
+ "#<Socket::Option: INET6 IPV6 MULTICAST_IF eth0>".
- * ext/pty/pty.c (HAVE_SYS_IOCTL_H): need to include <sys/ioctl.h>
- for TIOCSCTTY on *BSD. based on gotoyuzo's patch.
- (ruby-bugs:PR#1211)
+Sun Dec 26 04:31:15 2010 Luis Lavena <luislavena@gmail.com>
- * ext/pty/pty.c (establishShell): should close descriptors if fork
- failed.
+ * ext/dl/win32/registry.rb: Corrected RegCreateKeyExA signature.
+ Patch by Rafal Michalski [ruby-core:33874] [Ruby 1.9-Bug#4203]
-Wed Dec 10 12:53:05 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+Sun Dec 26 02:31:58 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * win32/win32.h: define execv() using do_aspawn().
+ * io.c (advice_arg_check): Change argument check.
+ Now, an unsupported advice makes NotImplementedError.
+ [ruby-dev:42887] [Ruby 1.9-Feature#4204]
- * process.c (proc_exec_v): remove #ifdef's which stopped needing.
+Sun Dec 26 03:00:53 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Tue Dec 9 23:32:23 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/socket/extconf.rb: Fix build error which was introduced r30372.
- * ext/tk/lib/tk.rb, ext/tk/lib/tkcanvas.rb, ext/tk/lib/tkdialog.rb,
- ext/tk/lib/tkentry.rb, ext/tk/lib/tkscrollbox.rb, ext/tk/lib/tktext.rb,
- ext/tk/sample/tkalignbox.rb, ext/tk/sample/tkcombobox.rb,
- ext/tk/sample/tkmultilistbox.rb, ext/tk/sample/tkoptdb.rb, ext/tk/sample/tktextframe.rb,
- ext/tk/sample/demos-en/dialog1.rb, ext/tk/sample/demos-en/dialog2.rb,
- ext/tk/sample/demos-jp/dialog1.rb, ext/tk/sample/demos-jp/dialog2.rb:
- overrided instance methods, which are private methods on the super
- class, are changed to 'private'
+Sun Dec 26 01:37:10 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Dec 9 19:53:02 2003 akira yamada <akira@ruby-lang.org>
+ * ext/socket/extconf.rb: check the existence of if_indextoname().
- * lib/uri/generic.rb (URI::Generic#route_from0): make case insensitive
- for host-part.
+ * ext/socket/option.c: yesterday's akr's commits destroyed the build of
+ some unrelated platforms (such as Windows).
- * test/uri/test_generic.rb (test_route): added tests for the above
- change.
+Sat Dec 25 23:29:11 2010 Tanaka Akira <akr@fsij.org>
-Tue Dec 9 14:10:48 2003 Tanaka Akira <akr@m17n.org>
+ * ext/socket/option.c (inspect_ipv4_add_drop_membership): new function
+ to inspect struct ip_mreq and struct ip_mreqn for
+ IP_ADD_MEMBERSHIP and IP_DROP_MEMBERSHIP.
+ Socket::Option.new(:INET, :IP, :ADD_MEMBERSHIP,
+ [239,255,99,81, 0,0,0,0].pack("CCCCCCCC")).inspect is now
+ "#<Socket::Option: INET IP ADD_MEMBERSHIP 239.255.99.81 0.0.0.0>".
+ (inspect_ipv4_multicast_if): new function to inspect struct in_addr
+ and struct ip_mreqn for IP_MULTICAST_IF.
+ Socket::Option.new(:INET, :IP, :MULTICAST_IF,
+ [192,168,0,7].pack("CCCC")).inspect is now
+ "#<Socket::Option: INET IP MULTICAST_IF 192.168.0.7>".
- * io.c (rb_io_check_readable): don't call io_seek if EOF flag is set,
- to avoid clearing EOF flag.
- (rb_io_check_writable): ditto.
+ * ext/socket/extconf.rb: check struct ip_mreq and struct ip_mreqn.
-Tue Dec 9 02:53:55 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sat Dec 25 22:49:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/sample/tkalignbox.rb: new sample script
+ * test/csv: DifferentOFS needs to be include in each classes.
-Tue Dec 9 00:45:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * test/digest/test_digest_extend.rb (TestDigestExtend#setup):
+ should not depend on the result of previous tests
- * lib/test/unit/assertions.rb: renamed #assert_raises to #assert_raise
- and made the former call the latter. [ruby-core:01890]
+ * test/with_different_ofs.rb (DifferentOFS::WithDifferentOFS): give
+ name.
- * test/testunit/test_assertions.rb: ditto.
+ * test/with_different_ofs.rb (DifferentOFS): test suite for test
+ suites affected by $,.
-Tue Dec 9 00:07:35 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * test/digest/test_digest_extend.rb (TestDigestExtend): should not
+ assume $, invariant.
- * lib/soap/rpc/standaloneServer.rb: add 'shutdown' and 'status'
- methods as delegates to WEBrick.
+ * test/csv/test_data_converters.rb, test/csv/test_table.rb: don't
+ call setup within tests.
- * test/soap/calc/{test_calc.rb,test_calc2.rb},
- test/soap/helloworld/test_helloworld.rb,
- test/wsdl/datetime/test_datetime.rb, test/wsdl/raa/test_raa.rb:
- follow the change.
+Sat Dec 25 20:01:40 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Mon Dec 8 22:48:03 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (pipe_open): Added rb_thread_atfork(). We must reinitialize
+ GVL at new process creation.
- * lib/test/unit/autorunner.rb: remove dependency to a particular
- runner. [ruby-core:01901], [ruby-list:38869]
+Sat Dec 25 18:26:55 2010 Tanaka Akira <akr@fsij.org>
- * lib/test/unit/ui/testrunnerutilities.rb: moved output level
- constants from Console.
+ * ext/socket/option.c (inspect_ipv6_mreq): new function to inspect
+ struct ipv6_mreq for IPV6_JOIN_GROUP and IPV6_LEAVE_GROUP.
+ Socket::Option.new(:INET6, :IPV6, :JOIN_GROUP,
+ [0xff12,0,0,0,0,0,0,1, 2].pack("nnnnnnnnI!")).inspect is now
+ "#<Socket::Option: INET6 IPV6 JOIN_GROUP ff12::1 eth0>".
- * lib/test/unit/ui/console/testrunner.rb: ditto.
+ * ext/socket/extconf.rb: check struct ipv6_mreq.
- * lib/test/unit/ui/{fox,gtk,gtk2,tk}/testrunner.rb (initialize):
- accept output_level.
+Sat Dec 25 18:04:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Dec 8 15:03:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/csv.rb (CSV.foreach): 'rb' mode is defaulted in open.
- * ext/syck/syck.c (syck_io_str_read): get rid of buffer overflow.
+ * lib/csv.rb (CSV#init_separators): cannonicalize encoding options
+ as Encoding objects.
-Mon Dec 8 13:02:11 2003 Minero Aoki <aamine@loveruby.net>
+Sat Dec 25 18:30:34 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/uri/common.rb: new method URI.regexp. [ruby-dev:22121]
+ * thread.c (rb_thread_atfork): Add small comment why we need
+ reset random seed.
- * test/uri/test_common.rb: add test for URI.regexp.
+Sat Dec 25 17:33:55 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Dec 8 12:44:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/csv/base.rb (TestCSV.with_different_ofs): give name to
+ anonymous classes.
- * pack.c: define swap16 and swap32 only if they are not
- defined. OpenBSD defines these macros. [ruby-dev:22181]
+ * lib/csv.rb (CSV#init_separators): use IO#gets with length
+ parameter to get rid of wrong convertion.
-Sun Dec 7 20:54:17 2003 Tanaka Akira <akr@m17n.org>
+ * lib/csv.rb (CSV::foreach, CSV#initialize): directly use encoding
- * ext/iconv/iconv.c (map_charset): make case sensitive.
- ext/iconv/charset_alias.rb (charset_alias): don't ignore
- config.charset's information. sort aliases.
+ * lib/csv.rb, test/csv: should not assume $, invariant.
-Sat Dec 6 22:58:03 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sat Dec 25 16:08:06 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/openssl/ossl_ssl.c (ossl_start_ssl): new function to wrap
- SSL_connect and SSL_accept; if SSL_connect (or SSL_accept) returned
- but not finished the handshake process, we should retry it.
+ * signal.c: change rb_atomic_t definition from uchar to uint.
- * ext/openssl/ossl_ssl.c (ossl_ssl_connect): call ossl_start_ssl.
+Sat Dec 25 15:04:05 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto.
+ * test/csv/test_encodings.rb (TestEncodings#setup): fix evil test
+ suite writing to the source directory.
- * ext/openssl/ossl_ssl.c (ossl_ssl_read): allow signal traps.
+Sat Dec 25 15:08:08 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Sat Dec 6 21:45:10 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * ext/pty/pty.c (chfunc): Added rb_thread_atfork_before_exec().
+ We must reinitialize GVL at new process creation. Otherwise
+ we may meet an insane deadlock. [Bug#4121][ruby-dev:42686]
- * io.c (flush_before_seek): flush before seek on any platform.
+Sat Dec 25 14:27:09 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in: ditto.
+ * io.c (rb_io_extract_encoding_option): accept Encoding object as
+ encoding: optional argument. [ruby-dev:42884]
-Sat Dec 6 17:23:00 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Sat Dec 25 13:37:55 2010 Ryan Davis <ryand-ruby@zenspider.com>
- * lib/soap/soap.rb(SOAP::Env.getenv): allow upcase environment variable
- as well as downcase one.
+ * lib/minitest/*.rb: Imported minitest 2.0.2 r6093.
- * lib/soap/netHttpClient.rb(SOAP::NetHttpClient#proxy=): check URI.
+Sat Dec 25 13:05:59 2010 Tanaka Akira <akr@fsij.org>
-Fri Dec 5 23:22:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * random.c: parenthesize macro arguments.
- * lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises,
- Test::Unit::Assertions::assert_nothing_raised): use the last
- argument as message unless class object.
+Sat Dec 25 12:48:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/testunit/test_assertions.rb (test_assert_raises): test for
- multiple exception list. [ruby-core:01891]
+ * load.c (rb_f_require_relative): don't omit return type.
- * test/testunit/test_assertions.rb (test_assert_nothing_raised): test
- for non-exception classes.
+Sat Dec 25 11:06:00 2010 Eric Hodel <drbrain@segment7.net>
-Fri Dec 5 22:23:04 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * load.c (rb_f_require_relative): Add documentation.
- * lib/soap/netHttpClient.rb: proxy support did not work. fixed.
+Sat Dec 25 11:02:52 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/soap/property.rb: add class methods for loading property from
- stream/file/propertyfile. propertyfile is a file which is located at
- somedir in $:.
+ * ext/zlib/zlib.c (gzreader_gets): support optional length
+ parameter.
- * lib/soap/soap.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb,
- lib/wsdl/importer.rb: load property from propertyfile 'soap/property'
- e.g. /usr/local/lib/ruby/site_ruby/1.8/soap/property.
+ * ext/zlib/zlib.c (gzfile_read, gzfile_readpartial): length should
+ be long.
- * test/soap/test_property.rb, test/soap/test_streamhandler.rb: new file.
+Sat Dec 25 10:51:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Dec 5 17:26:23 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/json/generator/generator.{c,h} (fbuffer_free_only_buffer):
+ unused.
- * eval.c (rb_exec_end_proc): maintain tmp_end_procs.
- [ruby-dev:22154]
+ * ext/openssl/ossl_pkcs5.c (ossl_pkcs5_pbkdf2_hmac): add casts.
-Fri Dec 5 13:36:59 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Dec 24 08:46:04 2010 Tanaka Akira <akr@fsij.org>
- * eval.c (rb_exec_end_proc): should not clear end_procs and
- ephemeral_end_procs before execution. [ruby-dev:22144]
+ * process.c: parenthesize macro arguments.
- * eval.c (rb_obj_extend): call Module#extended hook after
- extended_object. [ruby-list:38866]
+Thu Dec 23 19:17:14 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * object.c (Init_Object): Module#extended defined.
+ * test/net/imap/cacert.pem: updated because it has been expired.
-Fri Dec 5 13:17:30 2003 Tanaka Akira <akr@m17n.org>
+ * test/net/imap/server.crt: signed again because CA cert was expired.
- * test/ruby/test_pipe.rb: use IO.pipe instead of IO.popen.
+Thu Dec 23 11:16:52 2010 Tanaka Akira <akr@fsij.org>
-Fri Dec 5 11:54:45 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y: parenthesize macro arguments.
- * ext/stringio/stringio.c (strio_read): follow IO#read.
+Thu Dec 23 11:00:09 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/ut_eof.rb, test/ruby/test_file.rb, test/ruby/test_pipe.rb,
- test/stringio/test_stringio.rb: add EOF test.
+ * error.c (rb_check_type): check for type from extensions for ruby
+ 1.8. see [ruby-core:33797].
-Fri Dec 5 02:49:35 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Dec 23 08:12:59 2010 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises):
- allow multiple exception list. [ruby-core:01884]
+ * lib/net/smtp.rb: refactoring Net::SMTP#esmtp= to use an
+ attr_accessor
- * lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_nothing_raised):
- check whether arguments are subclass of Exception.
+Thu Dec 23 06:35:41 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-Thu Dec 4 23:54:00 2003 Rick Ohnemus <rick.ohnemus@systemware.com>
+ * lib/net/smtp.rb: Net::SMTP should close the SSL connection if the
+ connection verification fails.
- * dln.c (aix_loaderror): should not use member named 'errno' which
- might be a macro (e.g. on AIX).
+Thu Dec 23 01:47:58 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Thu Dec 4 23:32:26 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * NEWS: remove #object_id. [ruby-dev:42840]
- * io.c (read_all): do not depend on lseek position.
- [ruby-dev:22026]
+Wed Dec 22 08:56:39 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Thu Dec 4 22:37:26 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * NEWS: add Module#private_constant and Module#public_constant.
+ [ruby-dev:39685][ruby-core:32698]
- * eval.c (rb_eval): preserve $! value when retry happens in the
- rescue clause. [ruby-talk:86697]
+Wed Dec 22 07:59:23 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Thu Dec 4 21:50:07 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * NEWS: add IO#advise. [ruby-core:33110] [Ruby 1.9-Feature#4038]
- * lib/drb/drb.rb (DRb::DRbMessage::send_request, send_reply):
- should rescue errors and re-raise DRbConnError on write too.
- [ruby-dev:22132]
+Tue Dec 21 23:45:31 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Dec 4 16:41:17 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * gc.c (Init_GC): move back object_id to Kernel. [ruby-dev:42840]
- * parse.y (exc_list): allow expanding list. [ruby-dev:22134]
+Tue Dec 21 12:45:16 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Dec 4 14:09:24 2003 Minero Aoki <aamine@loveruby.net>
+ * configure.in (target_archs): remove temporary objects.
- * test/fileutils/test_fileutils.rb (test_cp): test if the error is
- kind of SystemCallError. It is needless details that which errno
- is set on each systems.
+ * enc/Makefile.in, enc/depend (clean): remove work directories.
-Thu Dec 4 13:24:13 2003 Shugo Maeda <shugo@ruby-lang.org>
+Tue Dec 21 07:39:12 2010 Tanaka Akira <akr@fsij.org>
- * lib/monitor.rb: use Object#__send__ instead of Object#send.
+ * pack.c: parenthesize macro arguments.
-Thu Dec 4 13:17:45 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Tue Dec 21 06:25:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/soap/streamHandler.rb: support latest released version of
- http-access2.
+ * test/rexml/test_contrib.rb (ContribTester#test_pos): should not
+ use fixed path name for tests. [ruby-dev:42827]
-Thu Dec 4 13:04:44 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * test/rexml/test_sax.rb (SAX2Tester#test_socket): should not use
+ fixed port for tests. [ruby-dev:42828]
- * lib/soap/soap.rb: add SOAP::Env module for environment repository
- such as HTTP_PROXY.
+Tue Dec 21 06:10:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/soap/property.rb: property implementation.
+ * compile.c (setup_args), vm.c (invoke_block_from_c),
+ vm_insnhelper.c (caller_setup_args): reverted r30241 and r30243
+ except for the test.
- * lib/soap/streamHandler.rb, lib/soap/wsdlDriver.rb,
- lib/soap/rpc/driver.rb: use soap/property.rb.
+Tue Dec 21 01:41:42 2010 Masaya Tarui <tarui@ruby-lnag.org>
- * lib/wsdl/importer.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb:
- use SOAP::Env.
+ * io.c : add an extra byte to buffer for the specification of read
+ in Windows. see [ruby-core:33460] and r29980. and, we have to
+ discuss how to do this one byte.
- * lib/soap/netHttpClient.rb: add basic_auth, ssl_config, and cookie
- management interface, but ignored for now.
+Tue Dec 21 01:18:06 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/xsd/charset.rb: add XSD::Charset.encoding= interface to set
- wiredump charset explicitly. it was fixed to 'utf-8' when iconv or
- uconv module was found.
+ * error.c: Fix build error for win32. This regression was
+ introduced by r30271.
-Thu Dec 4 10:43:58 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Dec 21 00:59:40 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/dl/sym.c (rb_dlsym_guardcall): __declspec(noinline) is VC7
- feature.
+ * thread.c (thread_cleanup_func): Moved interrupted_lock
+ destroying code from native_thread_destroy() to
+ thread_cleanup_func() because it's platform independent logic.
-Thu Dec 4 10:27:12 2003 Minero Aoki <aamine@loveruby.net>
+ * thread_win32.c (native_thread_destroy): ditto.
+ * thread_pthread.c (native_thread_destroy): ditto.
- * lib/net/http.rb: update hyperlink to the Japanese document.
+Tue Dec 21 00:46:20 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu Dec 4 09:12:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * thread.c (thread_cleanup_func): Don't touch native threading
+ resource at fork. Sadly this is purely bandaid. We need to
+ implement proper fix later. [Bug #4169] [ruby-core:33767]
- * ext/openssl/ossl_asn1.c (asn1time_to_time): should check that
- the underlying value of ASN1_TIME isn't NULL. [ruby-core:01881]
+Tue Dec 21 00:22:44 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu Dec 4 08:29:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * error.c (exit_success_p): Check status code more carefully.
+ status code may have garbage in upper bit.
- * lib/webrick/server.rb (GenericServer#start): should rescue
- Exception to avoid unexpected aborting. [ruby-core:01853]
+Mon Dec 20 23:12:37 2010 Tanaka Akira <akr@fsij.org>
- * lib/webrick/server.rb (GenericServer#start_thread): should check
- that peeraddr isn't nil before printing.
+ * node.c: parenthesize macro arguments.
- * lib/webrick/httpresponse.rb (HTTPResponse#start_thread): should
- rescue Exception to avoid unexpected aborting of thread.
+Mon Dec 20 20:04:41 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Thu Dec 4 03:48:59 2003 Tanaka Akira <akr@m17n.org>
+ * NEWS: add #__id__ and #object_id. [ruby-dev:42778]
- * lib/pathname.rb (Pathname#link, Pathname#symlink): obsoleted.
- (Pathname#make_link, Pathname#make_symlink): new method.
+Mon Dec 20 20:03:21 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Thu Dec 4 01:45:24 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * thread_pthread.c (native_thread_destroy): Fixed gvl_cond leak.
- * io.c (argf_read): should not terminate on empty string; wait
- until real EOF. [ruby-dev:21969]
+Mon Dec 20 13:49:05 2010 Eric Hodel <drbrain@segment7.net>
- * io.c (argf_read): should adjust length to read, when length is
- specified and read spans command line argument files.
+ * NEWS: Add item for RDoc 3.0.1
-Wed Dec 3 19:38:36 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * lib/rdoc: Import RDoc 3.0.1, remove require for perl parser.
- * lib/drb/drb.rb: correct fcntl parameter. [ruby-dev:22120]
+Mon Dec 20 12:15:32 2010 Eric Hodel <drbrain@segment7.net>
-Wed Dec 3 13:49:07 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/rdoc: Import RDoc 3.0.
- * ext/tk/lib/tk.rb: 'format'==>'Kernel.format' (avoid override trouble)
+Mon Dec 20 01:55:03 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * ext/tk/lib/tkafter.rb: ditto.
+ * io.c (Init_IO): Added O_DIRECT. This feature was proposed by
+ Run Paint Run Run.
+ [Feature #4015] [ruby-core:33018]
- * ext/tk/lib/tkcanvas.rb: ditto.
+Sun Dec 19 19:15:23 2010 Tanaka Akira <akr@fsij.org>
- * ext/tk/lib/tkdialog.rb: ditto.
+ * marshal.c: parenthesize macro arguments.
- * ext/tk/lib/tktext.rb: ditto.
+Sat Dec 18 21:52:37 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Wed Dec 3 13:28:13 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vsnprintf.c (BSD_vfprintf): suppress warning: "_WIN32" is not
+ defined.
- * Makefile.in (lex.c): try gperf first, and copy from the source
- directory if failed. [ruby-dev:22123]
+Sat Dec 18 16:02:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/extmk.rb (MTIMES): let makefiles depend to mkmf.rb.
+ * compile.c (setup_args), vm.c (invoke_block_from_c),
+ vm_insnhelper.c (caller_setup_args): fix of r30241. lambda block
+ should check argument number.
- * lib/mkmf.rb (configuration): DLDFLAGS was duplicated.
+Sat Dec 18 14:42:29 2010 Tanaka Akira <akr@fsij.org>
-Tue Dec 2 23:18:12 2003 Minero Aoki <aamine@loveruby.net>
+ * load.c: parenthesize macro arguments.
- * lib/net/http.rb: wrote the warning about HTTP_PROXY environment
- variable.
+Sat Dec 18 10:07:04 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Dec 2 21:31:42 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * compile.c (setup_args, iseq_compile_each): optimize AMPER LAMBDA
+ combination as block.
- * bin/testrb: new test runner. [ruby-core:01845]
+Fri Dec 17 22:07:16 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner.run,
- Test::Unit::AutoRunner#process_args): take test list to run and
- options.
+ * gc.c (Init_GC): move #__id__ and #object_id to BasicObject.
+ [ruby-dev:42778]
- * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::RUNNERS,
- Test::Unit::AutoRunner#run): should not exit inside a library,
- just return the result instead.
+Fri Dec 17 19:35:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit.rb: ditto.
+ * test/mkmf/base.rb (TestMkmf::FakeLog): capture output from mkmf.
- * test/runner.rb: exit with the test result.
+ * test/mkmf/test_find_executable.rb (test_find_executable):
+ suppress meaningless differences for chkbuild.
-Tue Dec 2 20:18:48 2003 Eric Sunshine <sunshine@sunshineco.com>
+Fri Dec 17 13:26:54 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * configure.in (AC_PROG_YACC): AC_DEFINE(OLD_YACC) if Yacc is found
- instead of Bison or byacc.
+ * win32/setup.mak (BASERUBY): quit with an error when BASERUBY was not
+ able to set, just like configure.in does. [ruby-dev:42782]
- * parse.y: If OLD_YACC is defined, ensure that YYMAXDEPTH is at least
- 10000 (Bison's default) since some old versions of Yacc define it as
- low as 150 by default, which is too low for Ruby to parse some files,
- such as date/format.rb. Among other issues, the parse problem causes
- "make test" to fail.
+Fri Dec 17 07:04:09 2010 Tanaka Akira <akr@fsij.org>
-Tue Dec 2 20:03:20 2003 Minero Aoki <aamine@loveruby.net>
+ * iseq.c: parenthesize macro arguments.
- * test/fileutils/test_fileutils.rb: check if Pathnames are usable
- for arguments.
+Fri Dec 17 04:18:37 2010 Eric Hodel <drbrain@segment7.net>
-Tue Dec 2 04:22:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * transcode.c (str_encode): Alter comment for better wording and ri
+ output.
- * lib/test/unit/assertions.rb: fixed #assert_no_match message.
+Fri Dec 17 00:05:40 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * test/testunit/test_assertions.rb: ditto.
+ * io.c (rb_io_advise): New API. IO#advise() allows to tell the
+ ruby runtime how it expects to use a file handle. This feature
+ can be improved a performance some situations.
+ Note: This feature is mainly developed by Run Paint Run Run.
+ Thank you! [ruby-core:33110] [Ruby 1.9-Feature#4038]
-Tue Dec 2 00:43:00 2003 why the lucky stiff <why@ruby-lang.org>
+ * io.c (do_io_advise): Helper function.
+ * io.c (io_advise_sym_to_const): ditto.
- * ext/syck/syck.c: string buffering bug. decrementing by full
- max_size now. [ruby-core:01834]
+Thu Dec 16 23:29:20 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Dec 1 21:33:08 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * tool/rbinstall.rb (bin-comm): use transformed name.
+ [ruby-dev:42777]
- * numeric.c (num_sadded): prohibit singleton method definition for
- Numerics. fill yet another gap between Fixnum and Bignum.
+Thu Dec 16 21:52:07 2010 Tanaka Akira <akr@fsij.org>
-Mon Dec 1 17:33:47 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * io.c: parenthesize macro arguments.
- * pack.c (htov16): converts endian using swap16. htov32(), hton16,
- hton32 as well. [ruby-talk:85377]
+Thu Dec 16 21:46:39 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * pack.c (swap16): swap 2 bytes no matter how big short is on the
- platform. swap32() is also prepared.
+ * tool/mkconfig.rb (RbConfig): honor ARCHFLAGS and RC_ARCHS to
+ override embedded ARCH_FLAG value on universal-darwin.
- * numeric.c (rb_num2int): returns long to preserve information.
- rb_fix2int(), rb_num2uint(), rb_fix2uint() as well.
- [ruby-talk:85377]
+Thu Dec 16 19:50:12 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * numeric.c (rb_num2uint): should not check for value range if the
- source value is negative.
+ * win32/{configure.bat,setup.mak,Makefile.sub} (PROGRAM_PREFIX,
+ PROGRAM_SUFFIX): unite the differences of the names of macros of
+ prefix and suffix.
+ reported by HANEDA Norikatsu. [ruby-dev:42775]
-Mon Dec 1 17:14:34 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Dec 16 08:04:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * sample/optparse/opttest.rb: added.
+ * node.h (RNode): match the type of flags to RBasic, and renamed
+ nd_file as nd_reserved.
-Mon Dec 1 16:10:52 2003 Dave Thomas <dave@pragprog.com>
+ * iseq.c (set_relation), vm_insnhelper.c (vm_cref_push): nd_file
+ is always zero-cleared.
- * lib/rdoc/rdoc.rb: (etc) initial merge into main tree.
+Thu Dec 16 07:22:30 2010 Ryan Davis <ryand-ruby@zenspider.com>
-Mon Dec 1 14:17:49 2003 Minero Aoki <aamine@loveruby.net>
+ * lib/minitest/unit.rb: Imported minitest 2.0.1 r6079.
- * lib/fileutils.rb (fu_each_src_dest0): call #to_str to allow
- Pathname for arguments. [ruby-core:01795]
+Wed Dec 15 20:45:02 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/fileutils/test_fileutils.rb: does much strict test on
- "same" files detecting.
+ * lib/test/unit.rb (process_args): need to setup @help to print options.
-Mon Dec 1 09:28:14 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Dec 15 11:19:33 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
- (XCFLAGS): re-export $(XCFLAGS).
+ * test/zlib/test_zlib.rb (test_to_io): forgotten to fix with r30201.
- * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
- (ARCH_FLAG): export $(ARCH_FLAG) (perhaps empty value).
+Wed Dec 15 11:07:34 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Dec 1 01:03:27 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * io.c (simple_sendfile): enable on Mac OS X.
- * lib/mkmf.rb (TRY_LINK, link_command): added support for DLDFLAGS
- and ARCH_FLAG. [ruby-dev:22085]
+ * io.c (nogvl_copy_stream_sendfile): moved precheck of copy length.
-Sun Nov 30 20:18:07 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * io.c (nogvl_copy_stream_sendfile): should wait for both of
+ read/write fds.
- * configure.in: keep ARCH_FLAG separate. export ARCH_FLAG.
- [ruby-core:01819]
+Wed Dec 15 07:11:55 2010 Tanaka Akira <akr@fsij.org>
- * Makefile.in: add ARCH_FLAG to CFLAGS.
+ * hash.c: parenthesize macro arguments.
- * Makefile.in: add @CPPFLAGS@ to CPPFLAGS.
+Wed Dec 15 04:02:00 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * lib/mkmf.rb (link_command, cc_command): use ARCH_FLAG.
+ * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_config):
+ fix compile error when !HAVE_X509V3_SET_NCONF. Thanks
+ Chikanaga-san. [ruby-dev:42761] [Ruby 1.9-Bug#4158]
- * lib/mkmf.rb (configuration): add ARCH_FLAG to DLDFLAGS.
+Wed Dec 15 03:41:31 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * Makefile.in: add ARCH_FLAG to DLDFLAGS.
+ * test/ripper/test_parser_events.rb (TestRipper#test_block_variables):
+ Limit address space 100MB instead 100KB. Quite frankly, This
+ margin is too narrow to contain ruby. [ruby-dev:42763] [Bug#4159]
- * configure.in: should put getcwd in AC_CHECK_FUNCS, not
- AC_REPLACE_FUNCS. [ruby-core:01826]
+Tue Dec 14 23:53:52 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Sun Nov 30 18:22:48 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * io.c (simple_sendfile): improve linux compatibility on FreeBSD,
+ and now it works. But without cpuset -l 0, it still gets stuck.
- * configure.in: do not override CCDLDFLAGS, LDFLAGS, XLDFLAGS,
- DLDFLAGS and LDSHARED.
+Tue Dec 14 20:31:33 2010 Tanaka Akira <akr@fsij.org>
- * configure.in: XCFLAGS for compiling ruby itself. ARCH_FLAG is
- reflected in CFLAGS.
+ * gc.c: parenthesize macro arguments.
- * lib/mkmf.rb: ditto. do not import XCFLAGS from config.status.
+Tue Dec 14 18:31:48 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Sun Nov 30 17:37:36 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/test/unit.rb: help messages.
- * ext/tk/lib/tk.rb: bug fix [ruby-talk:86746]
+Tue Dec 14 18:19:03 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Sun Nov 30 13:02:00 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * common.mk (help): there is no reason to use the abbreviation for here.
- * lib/soap/encodingstyle/soapHandler.rb: refactoring - Simplifying
- Conditional Expressions.
+Tue Dec 14 15:03:46 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/wsdl/soap/definitions.rb: refactoring - Move Method.
+ * test/ruby/test_io.rb (test_reopen, test_reinitialize): should close
+ the temporary files.
- * test/xsd/{test_noencoding.rb,noencoding.xml}: new files. test for
- encoding unspecified XML file parsing.
+Tue Dec 14 14:24:15 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/wsdl/{test_fault.rb,map,datetime}: new files. test of
- SOAPFault, dateTime and Apache's Map.
+ * test/ruby/test_io.rb (make_tempfile): change the prefix from 'foo'
+ to 'test_io' because the old one is meaningless and inconvenient.
-Sun Nov 30 09:35:14 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_io.rb (test_binmode_after_closed): the temporary file
+ maked by make_temfile is already closed.
- * string.c (rb_str_update): get rid of SEGV at just allocated String.
- [ruby-core:01812]
+Tue Dec 14 13:52:19 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Nov 28 23:19:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_io.rb (test_flush_in_finalizer[12]): should close
+ temporary file because it's only used for taking pathname and
+ unlinking the file after the end of the test (in GC phase).
- * gc.c (gc_mark): explicitly check mark recursion levels, instead
- of unreliable stack length.
+Tue Dec 14 13:34:33 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Nov 28 22:49:56 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * ext/zlib/zlib.c (gzfile_s_open): should close the IO if some error
+ occurs in initializing.
- * lib/rinda/rinda.rb: fix TupleSpaceProxy#read, read_all.
+Tue Dec 14 13:04:16 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Nov 28 21:44:40 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * lib/net/http.rb (Net::HTTPRequest#send_request_body_data):
+ set binmode to tempfile.
- * test/fileutils/test_fileutils.rb (test_ln_s): should be a file, not
- a directory for FreeBSD.
+Tue Dec 14 12:55:46 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Nov 28 19:37:56 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/zlib/test_zlib.rb (*): should close files associated with zlib.
- * hash.c (env_has_value, env_index): must match exactly.
+Tue Dec 14 11:30:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/ruby/test_env.rb (test_has_value, test_index): condition for
- aboves.
+ * test/ruby/test_argf.rb (test_inplace_rename_impossible): unlink
+ the renamed temporary file on no_safe_rename platforms.
-Fri Nov 28 17:59:20 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/ruby/test_argf.rb (test_readlines_limit_0,
+ test_each_line_limit_0): should close argf because the associated
+ Tempfile object cannot unlink the temporary file when it's gc'ed
+ on some platforms (Windows, etc.)
- * test/ruby/test_env.rb: add tests for ENV.
+Tue Dec 14 11:27:07 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Nov 28 17:47:46 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * lib/minitest/unit.rb (Minitest::Unit#_run_suite): split test
+ name and its time. Thiw allows to know test's name when you are
+ running tests and meet a test which spends long time at realtime.
- * lib/drb/drb.rb (DRbMessage#load): rescue Errno::* and raise
- DRbConnError.
+Tue Dec 14 11:25:20 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Nov 28 15:41:15 2003 Tanaka Akira <akr@m17n.org>
+ * configure.in: Add -Werror=declaration-after-statement to default
+ warning flag. If you are using GCC, this flag is useful to
+ prevent breaking VC build.
- * lib/pathname.rb (Pathname#realpath): obsolete the force_absolute
- argument.
+Tue Dec 14 10:25:57 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Nov 28 14:41:52 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/openssl/ossl_asn1.c (ossl_asn1_decode0): how many gcc-c99isms
+ must a man mend; before he can build with VC? r30178
- * lib/soap/streamHandler.rb: drop unused http parameters.
+Mon Dec 13 21:26:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/soap/encodingstyle/soapHandler.rb, lib/soap/mapping/factory.rb,
- lib/soap/mapping/mapping.rb, lib/soap/mapping/registry.rb,
- lib/wsdl/soap/complexType.rb: ApacheSOAP's map support was broken
- under WSDL dynanic client environment. fixed.
+ * io.c (simple_sendfile): disable the use of sendfile(2) on
+ FreeBSD. It blocks on TestIO#test_copy_stream_socket.
- * test/wsdl/raa/*: add tests.
+Mon Dec 13 18:35:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/xsd/datatypes.rb: dateTime precision bug fix (at least, I hope.)
- bug of soap4r. XSDDateTimeImple.to_time passed a Float to
- Time.local/Time.gm as an usec, and NUM2LONG(rb_num2long for Float)
- causes rounding error.
+ * io.c: define USE_SENDFILE on FreeBSD or DragonFly BSD.
+ Remove Mac OS X because its argument is different from them.
- * test/soap/test_basetype.rb, test/xsd/test_xsd.rb: add tests.
+Mon Dec 13 12:00:09 2010 Tanaka Akira <akr@fsij.org>
-Fri Nov 28 04:15:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * file.c: parenthesize macro arguments.
- * eval.c (method_arity): used wrong Proc object. [ruby-talk:86504]
+Mon Dec 13 11:21:14 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Nov 28 00:47:29 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (simple_sendfile): added for BSD version of sendfile(2).
- * eval.c (rb_f_exit), process.c (rb_f_exit_bang): treat true as
- success, false as failure. [ruby-dev:22067]
+Mon Dec 13 09:50:09 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * eval.c (rb_f_abort, rb_thread_switch), process.c (rb_f_system): use
- ANSI macro instead of hard coded value.
+ * lib/net/http.rb (Net::HTTPRequest#set_form): Added to support
+ both application/x-www-form-urlencoded and multipart/form-data.
+ There is a similar API, Net::HTTPRequest#set_form_data, but
+ to keep its compatibility this is newly added. [ruby-dev:42729]
- * eval.c (rb_f_exit), process.c (rb_f_exit_bang): use VALUEs not but
- TYPEs.
+Sun Dec 12 23:45:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Nov 27 22:05:48 2003 Akinori MUSHA <knu@iDaemons.org>
+ * compile.c (iseq_compile_each): fix for __goto__ and __label__
+ where were totally broken.
- * eval.c, gc.c: FreeBSD/ia64 currently does not have a way for a
- process to get the base address for the RSE backing store, so
- hardcode it for the moment.
- [submitted by: Marcel Moolenaar <marcel@FreeBSD.org>]
+Sun Dec 12 22:45:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Nov 27 17:36:42 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * common.mk (ID_H_INCLUDES): now id.h depends on vm_opts.h.
- * ext/tk/lib/tkafter.rb: bug fix on TkTimer#cancel_on_exception=(mode).
- TkTimer#wait recieves the exception of the callback.
- The exception is kept on @return_value.
+Sun Dec 12 20:42:47 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Thu Nov 27 16:58:48 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * template/id.h.tmpl: suppress all warning: "SUPPORT_JOKE" is not
+ defined. [ruby-dev:42730]
- * win32/win32.c (rb_w32_stat): remove _fullpath() for NUL: device.
+Sun Dec 12 20:35:07 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Wed Nov 26 15:38:47 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * misc/rb_optparse.zsh: update how to install.
- * test/fileutils/test_fileutils.rb (test_ln_s): should take the
- existing symbolic link for OpenBSD.
+ * misc/rb_optparse.zsh: avoid error when setopt noclobber.
-Wed Nov 26 04:48:42 2003 why the lucky stiff <why@ruby-lang.org>
+ * lib/optparse.rb: fix typo. pointed out at
+ <http://d.hatena.ne.jp/nagachika/20101207>.
- * ext/syck/token.c: removed YYTOKTMP references which
- were causing buffer overflows on large block scalars,
- comments, quoted scalars and plain scalars.
+Sun Dec 12 13:27:35 2010 Tanaka Akira <akr@fsij.org>
- * ext/syck/rubyext.c: dynamic changing of buffer size.
+ * eval_error.c: parenthesize macro arguments.
- * ext/syck/syck.h: default buffer size of 4k.
+Sun Dec 12 11:53:24 2010 Tanaka Akira <akr@fsij.org>
-Wed Nov 26 00:55:30 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * error.c: parenthesize macro arguments.
- * lib/webrick/httpresponse.rb: add HTTPResponse#keep_alive=.
+Sun Dec 12 04:01:58 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/webrick/httpserver.rb (HTTPServer#run): should pass the
- request's keep_alive flag to the response.
+ * string.c (rb_str_inspect): fix: extra back slash is added when
+ the string is dummy encoding and includes \x22 or \x5C.
-Tue Nov 25 21:41:35 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Sun Dec 12 02:42:24 2010 Aaron Patterson <aaron@tenderlovemaking.com>
- * defines.h (ENV_IGNORECASE): should define when DOSISH without
- human68k. [ruby-dev:22047]
+ * ext/openssl/ossl_asn1.c: indefinite length BER to DER encoding is
+ properly supported. Thanks Martin Bosslet! [ruby-core:33082]
- * hash.c (env_has_value, env_index): don't ignore case of value.
- [ruby-dev:22048]
+Sat Dec 11 17:43:34 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Tue Nov 25 21:39:37 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/bigdecimal/bigdecimal.h: suppress "warning: 'VPrint' declared
+ 'static' but never defined".
- * file.c (path_check_1): honor sticky bits always.
- [ruby-talk:86273]
+Sat Dec 11 09:24:57 2010 Tanaka Akira <akr@fsij.org>
-Tue Nov 25 20:02:14 2003 Minero Aoki <aamine@loveruby.net>
+ * encoding.c: parenthesize macro arguments.
- * test/fileutils/test_fileutils.rb: do test in more deep
- directory.
+Sat Dec 11 08:12:48 2010 Eric Hodel <drbrain@segment7.net>
- * test/fileutils/test_nowrite.rb: ditto.
+ * ext/openssl/ossl.c, ext/openssl/ossl_pkey_rsa.c: Document RSA, RSA
+ encryption/decryption and PKCS #5 encryption/decryption.
-Tue Nov 25 19:04:23 2003 Tanaka Akira <akr@m17n.org>
+Sat Dec 11 06:23:41 2010 Eric Hodel <drbrain@segment7.net>
- * lib/open-uri.rb (URI::Generic#find_proxy): ENV case sensitivity test
- refined.
+ * ext/openssl/ossl_x509name.c: include Comparable to provide #==.
+ Document OpenSSL::X509::Name#<=>. [Ruby 1.9-Feature#4116]
-Tue Nov 25 18:13:30 2003 Minero Aoki <aamine@loveruby.net>
+Sat Dec 11 05:48:28 2010 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/fileutils/test_fileutils.rb: chdir Dir.tmpdir before each
- test. [ruby-dev:22045]
+ * ext/tk/lib/multi-tk.rb: infinite loop on method_missing at loading.
+ [ruby-dev:42716] [Ruby 1.9-Bug#4129]
- * test/fileutils/test_nowrite.rb: ditto.
+ * ext/tk/lib/multi-tk.rb: when no eventloop is running, ruby freezes at
+ exit.
-Tue Nov 25 17:52:11 2003 Tanaka Akira <akr@m17n.org>
+Sat Dec 11 02:23:15 2010 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/open-uri.rb (URI::Generic#find_proxy): use http_proxy under CGI
- if the environment variable is case sensitive.
+ * ext/openssl/extconf.rb: try pkgconfig first, then fall back to
+ normal have_library, etc. Thanks Erik Hollensbe. [ruby-core:32406]
-Tue Nov 25 16:41:33 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Fri Dec 10 22:33:39 2010 Tanaka Akira <akr@fsij.org>
- * test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb:
- removed. this test requires extra libraries in soap4r/1.5.*.
+ * dln_find.c: parenthesize macro arguments.
-Tue Nov 25 16:24:42 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Fri Dec 10 20:05:42 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/soap/**/*.rb, lib/wsdl/**/*.rb, lib/xsd/**/*.rb: changed license;
- GPL2 -> Ruby's.
+ * template/id.h.tmpl (ruby_method_ids): suppress warnings.
+ [ruby-dev:42730]
- * lib/soap/rpc/driver.rb, lib/soap/wsdlDriver.rb,
- lib/soap/streamHandler.rb: add interface to streamhandler.
+Fri Dec 10 18:29:20 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/soap/marshal.rb: raise error if parse fails.
+ * ruby.c (ruby_init_loadpath_safe): relatively called non-shared
+ binary cannot be found in PATH, so use given pathname.
- * lib/soap/netHttpClient.rb: add https support. Patched by
- Oliver M. Bolzer.
+Fri Dec 10 18:28:40 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/soap/netHttpClient.rb: dump HTTP response message body by itself.
+ * cygwin/GNUmakefile.in (SCRIPTPROGRAMS): ignore backup files and etc.
- * lib/soap/rpc/driver.rb, lib/soap/rpc/proxy.rb,
- lib/soap/wsdlDriver.rb: add driver#mandatorycharset interface to foce
- using charset for parsing response from buggy server.
+ * cygwin/GNUmakefile.in (scriptbin): set executable bit.
- * lib/soap/encodingstyle/soapHandler.rb: support Apache Axis's half
- typed multi-ref array.
+ * tool/rbinstall.rb (install_recursive): always skip default ignored
+ files. if block is given, call it instead of calling install.
- * lib/soap/mapping/factory.rb, lib/soap/mapping/registry.rb: map
- SOAPStruct which has multi-accessors which name are the same, to an
- array.
+ * tool/rbinstall.rb (bin-comm): use install_recursive.
- * lib/soap/rpc/element.rb: fixed illegal parameter order.
+Fri Dec 10 18:12:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/soap/rpc/element.rb: element name of response message could have
- the name other than 'return'.
+ * test/mkmf/base.rb (TestMkmf#config_value): extract macro value from
+ config.h.
- * lib/wsdl/operation.rb, lib/wsdl/operationBinding.rb,
- lib/wsdl/soap/classDefCreator.rb, lib/wsdl/soap/methodDefCreator.rb,
- lib/wsdl/soap/methodDefCreatorSupport.rb: WSDL/1.1 allows plural
- fault definition in a operation. [ruby-talk:84948]
+ * test/mkmf/test_sizeof.rb (TestMkmf::TestSizeof#test_sizeof_builtin),
+ (TestMkmf::TestSizeof#test_sizeof_struct): more tests.
- * test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb: add
- test for above fix.
+ * lib/mkmf.rb (check_signedness): should use the prelude code.
+ [ruby-dev:42731]
- * lib/wsdl/soap/complexType.rb: support WSDL array definition with
- maxOccures="unbound".
+ * lib/mkmf.rb (Logging.log_close): separate from Logging.logfile.
- * lib/xsd/charset.rb: use cp932 under emx. Patched by
- Siena. / SHINAGAWA, Norihide in [ruby-dev:21972]
+ * test/mkmf/base.rb (TestMkmf::MKMFLOG): show mkmf.log at failures.
- * lib/xsd/xmlparser/parser.rb: set @charset nil by default. Nil means
- 'follow encoding declaration in XML'.
+ * test/mkmf/base.rb (TestMkmf#teardown): close log file for each tests.
- * sample/soap/digraph.rb, sample/wsdl/amazon/wsdlDriver.rb,
- sample/wsdl/googleSearch/sampleClient.rb,
- sample/wsdl/googleSearch/wsdlDriver.rb,
- test/wsdl/test_emptycomplextype.rb,
- test/wsdl/marshal/test_wsdlmarshal.rb,
- test/xsd/test_xmlschemaparser.rb: use File.open(...) { |f| f.read }
- instead of File.open(...).read. [ruby-dev:21964]
+Fri Dec 10 11:36:43 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * test/wsdl/emptycomplextype.wsdl, test/wsdl/test_emptycomplextype.rb:
- simplify the test case.
+ * compile.c (enum): remove a comma at end of enumerator list.
- * test/wsdl/axisArray/*: add tests for axis's array encoding.
+ * constant.h (rb_const_flag_t): ditto.
-Tue Nov 25 16:15:29 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * iseq.h (enum catch_type): ditto.
- * ruby.h: don't treat Cygwin as Windows.
+ * iseq.h (enum defined_type): ditto.
-Tue Nov 25 15:18:28 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * vm_core.h (enum iseq_type): ditto.
- * configure.in: change default value of --enable-pthread (default: no)
+ * vm_core.h (enum vm_special_object_type): ditto.
-Tue Nov 25 07:31:16 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Dec 10 10:47:53 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * parse.y (primary): allow newlines just before right argument
- parenthesis. (ruby-bugs:PR#1221)
+ * sprintf.c (_HAVE_SANE_QUAD_): Don't forget LP64, r30156.
-Mon Nov 24 23:32:06 2003 Tanaka Akira <akr@m17n.org>
+Fri Dec 10 10:37:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/open-uri.rb (OpenURI.open_loop, URI::HTTP#proxy_open): use
- catch/throw for redirection instead of exception.
- (OpenURI.open_loop, OpenURI.redirectable?): restrict redirection.
+ * sprintf.c (_HAVE_SANE_QUAD_): if a certain platform has LONG_LONG in
+ 8 byte, it might be sane quad. [ruby-core:33634]
-Mon Nov 24 19:59:48 2003 Tanaka Akira <akr@m17n.org>
+Fri Dec 10 10:07:59 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/open-uri.rb (URI::Generic#find_proxy): use CGI_HTTP_PROXY
- instead of HTTP_PROXY in the CGI environment.
+ * lib/net/http.rb: remove version 1.1 features.
-Mon Nov 24 19:32:55 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+Fri Dec 10 02:18:02 2010 Aaron Patterson <aaron@tenderlovemaking.com>
- * ext/etc/extconf.rb: check for pw_passwd in struct passwd and
- gr_passwd in struct group for DJGPP.
+ * ext/openssl/ossl_x509store.c (ossl_x509stctx_cleanup): removing C
+ implementation of `cleanup`.
- * ext/etc/etc.c: ditto.
+ * ext/openssl/lib/openssl/x509.rb: adding ruby implementation of
+ `cleanup`. OpenSSL::X509::StoreContext#cleanup is deprecated since
+ reusing the underlying struct doesn't make sense. [ruby-dev:42546]
- * ext/Setup.dj: support for curses, etc, zlib.
+Thu Dec 9 20:14:39 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Nov 24 17:00:00 2003 Tanaka Akira <akr@m17n.org>
+ * parse.y (lvar_defined_gen, shadowing_lvar_gen, dvar_defined): no
+ warnings for unused method and block arguments.
+ [ruby-dev:42718] [ruby-dev:42724]
- * lib/open-uri.rb: validate option names.
- :content_length_proc and :progress_proc option implemented.
+Thu Dec 9 19:25:49 2010 Tanaka Akira <akr@fsij.org>
-Mon Nov 24 14:53:10 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+ * dln.c: parenthesize macro arguments.
- * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
- (XCFLAGS): output empty value instead of `-DRUBY_EXPORT'.
+Thu Dec 9 18:51:06 2010 Tanaka Akira <akr@fsij.org>
-Sat Nov 22 23:09:45 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * lib/webrick/accesslog.rb (WEBrick::AccessLog#format): support
+ %{remote}p for logging remote (client) port number.
+ [ruby-dev:42670]
- * configure.in: set enable_pthread to no on MinGW.
+Thu Dec 9 11:00:30 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Nov 22 22:56:20 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * array.c (rb_ary_dup): should copy contents only. no instance
+ variable, no class would be copied. it would affect methods
+ #sort, #reject, #transpose, #uniq, #compact, and #shuffle.
+ [ruby-core:33640]
- * configure.in: add --enable-pthread option (default: yes)
+ * array.c (rb_ary_reverse_m): ditto.
-Sat Nov 22 22:48:46 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * array.c (rb_ary_rotate_m): ditto.
- * ext/tk/lib/tk.rb: add Tk.grab_release and fix bug of TkComposite
+Wed Dec 8 21:38:40 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tk/lib/tkafter.rb: bug fix of TkAfter#start
+ * ext/dl/lib/dl/struct.rb: clean a warning: assigned but unused
+ variable. patched by Kouhei Yanagita. [ruby-dev:42722]
- * ext/tk/sample/tkcombobox.rb: new sample script
+ * ext/dl/lib/dl/import.rb: ditto.
- * ext/tcltklib/tcltklib.c: add native thread check
+Wed Dec 8 21:36:16 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Nov 22 18:49:47 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+ * parse.y (shadowing_lvar_gen): fix line number. [ruby-dev:42718]
- * ext/curses/curses.c (window_nodelay): nodelay() of NetBSD's
- libcruses returns no value, just like keypad().
+Wed Dec 8 20:37:11 2010 Tanaka Akira <akr@fsij.org>
-Sat Nov 22 17:36:36 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+ * dir.c: parenthesize macro arguments.
- * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
- (HAVE_GETCWD): output to config.h.
+Tue Dec 7 22:37:15 2010 Masaya Tarui <tarui@ruby-lnag.org>
- * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
- (XCFLAGS): output to config.status.
+ * io.c (io_read): duplicate string if shared. [ruby-dev:42719]
-Sat Nov 22 13:10:10 2003 Minero Aoki <aamine@loveruby.net>
+Tue Dec 7 22:31:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/fileutils.rb (have_st_ino?): djgpp has valid st_ino.
+ * lib/optparse.rb (OptionParser::Officious): separate completion
+ options from --help. [ruby-dev:42690]
-Sat Nov 22 11:28:48 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/optparse.rb (OptionParser::Completion#candidate),
+ (OptionParser::Switch#compsys): remove unused variables.
- * gc.c (Init_stack): stack region is far smaller than usual if
- pthread is used.
+Tue Dec 7 22:05:25 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Nov 22 07:30:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * transcode.c (transcode_loop): call default handler of the given
+ hash, method, proc or [] method as fallback. [ruby-dev:42692]
- * lib/test/unit/util/backtracefilter.rb: fixed a bug that occurred
- when an exception had no backtrace.
+Tue Dec 7 21:59:37 2010 Kouhei Sutou <kou@cozmixng.org>
- * test/testunit/util/test_backtracefilter.rb: ditto.
+ * lib/rexml/light/node.rb: remove circular require.
-Fri Nov 21 16:44:18 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Dec 7 21:56:01 2010 Kouhei Sutou <kou@cozmixng.org>
- * ext/tk/lib/tkentry.rb: fix the encoding trouble of percent
- substitutions on validatecommand option of TkEntry widget
+ * test/rexml/test_light.rb: really suppress a warning.
- * ext/tk/lib/tk.rb: fix bug on {pack|grid}_propagate() method
+Tue Dec 7 21:51:57 2010 Kouhei Sutou <kou@cozmixng.org>
-Fri Nov 21 16:12:11 2003 Akinori MUSHA <knu@iDaemons.org>
+ * test/rexml/test_light.rb: suppress a warning.
- * ruby.1: Fix markups and grammar.
+Tue Dec 7 21:14:03 2010 Tanaka Akira <akr@fsij.org>
-Fri Nov 21 14:49:42 2003 Minero Aoki <aamine@loveruby.net>
+ * debug.c: parenthesize macro arguments.
- * ruby.1: wrote about ruby related environment variables.
+Tue Dec 7 21:06:38 2010 Kouhei Sutou <kou@cozmixng.org>
-Fri Nov 21 12:28:03 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/rexml/doctype.rb, test/rexml/test_doctype.rb: suppress warnings.
+ [ruby-core:33305]
+ Reported by Aaron Patterson. Thanks!!!
- * marshal.c (w_extended): singleton methods should not be checked
- when dumping via marshal_dump() or _dump(). [ruby-talk:85909]
+Tue Dec 7 18:56:52 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Nov 21 01:40:00 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/nkf/lib/kconv.rb (String#kconv): fix typo and update rdoc.
+ patched by Kouhei Yanagita [ruby-dev:42696]
- * configure.in: check <pthread.h>
+Tue Dec 7 20:32:11 2010 Kouhei Sutou <kou@cozmixng.org>
- * ruby.h: include pthread.h if existence.
- define is_ruby_native() macro when not HAVE_NATIVETHREAD
+ * test/rexml/test_doctype.rb: add Accessor to test case name.
- * eval.c: undef is_ruby_native() function when not HAVE_NATIVETHREAD
+Tue Dec 7 20:31:02 2010 Kouhei Sutou <kou@clear-code.com>
-Fri Nov 21 00:43:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * test/rexml/test_doctype.rb: Doctype -> DocType.
- * lib/test/unit/assertions.rb: use #__send__ instead of #send.
+Tue Dec 7 20:29:23 2010 Kouhei Sutou <kou@clear-code.com>
- * lib/test/unit/testcase.rb: ditto.
+ * test/rexml/test_doctype_mixin.rb: rename to ...
+ * test/rexml/test_doctype.rb: ... this to remove needless name.
-Thu Nov 20 19:19:22 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+Tue Dec 7 17:03:16 2010 Shugo Maeda <shugo@ruby-lang.org>
- * configure.in: don't find the Cygwin's pthread library on MinGW.
+ * lib/net/imap.rb (xlist): supported the XLIST command, which is an
+ extension by Apple and Google. patch by Geoff Youngs.
+ [ruby-core:33521]
-Thu Nov 20 19:15:50 2003 Minero Aoki <aamine@loveruby.net>
+Tue Dec 7 08:00:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/fileutils.rb (have_st_ino?): emx (OS/2 with EMX) does not
- have st_ino (always 0). [ruby-dev:21972]
+ * configure.in, win32/Makefile.sub (WERRORFLAG): flag to treat
+ warnings as errors.
- * lib/fileutils.rb (rename_cannot_overwrite_file?): emx does not
- allow overwriting files by rename(2).
+ * lib/mkmf.rb (Logging.postpone): yield log file object.
- * test/fileutils/test_fileutils.rb: windows? ->
- have_drive_letter?, have_file_perm?
+ * lib/mkmf.rb (xsystem): add options, :werror only right now.
-Thu Nov 20 17:50:58 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/mkmf.rb (with_werror): check as if warnings are errors.
- * ext/tk/sample/tkballoonhelp.rb: new sample script
+ * lib/mkmf.rb (convertible_int): make declaration conflict
+ warnings errors not to pass wrong type. [ruby-dev:42684]
- * ext/tk/sample/tkmultilistbox.rb: ditto
+ * lib/mkmf.rb (COMMON_MACROS): get rid of conflicts.
- * ext/tk/sample/tktextframe.rb: ditto
+ * win32/Makefile.sub (WARNFLAGS): make declaration conflict
+ warnings errors if possible.
-Thu Nov 20 13:37:34 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sun Dec 7 21:16:10 2010 Tanaka Akira <akr@fsij.org>
- * ruby.h: define is_ruby_native_thread() for no native thread
- environment
+ * cont.c: parenthesize macro arguments.
- * eval.c: ditto
+Tue Dec 7 00:27:14 2010 Masaya Tarui <tarui@ruby-lnag.org>
-Thu Nov 20 12:42:47 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * win32/win32.c (rb_w32_read): fixed more for readline,
+ and so on. [ruby-core:33511]
- * configure.in: always check existence of the pthread library
+Mon Dec 6 23:18:22 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ruby.h: define macros for ruby's native thread check
+ * test/mkmf/base.rb (TestMkmf#setup): run quietly.
- * eval.c: add ruby's native thread check
+ * test/mkmf/test_find_executable.rb (test_find_executable): use
+ configured results.
- * gc.c: ditto
+ * common.mk (test-build): test for build process.
-Wed Nov 19 14:45:18 2003 Minero Aoki <aamine@loveruby.net>
+Mon Dec 6 22:47:15 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/http.rb (to_ary): print more friendly warning message.
+ * lib/optparse.rb (OptionParser#candidate): skip separators.
-Wed Nov 19 14:32:08 2003 Minero Aoki <aamine@loveruby.net>
+ * sample/optparse/opttest.rb: should not override --help.
+ [ruby-dev:42690]
- * lib/fileutils.rb (fu_same?): add djgpp and wince.
+Mon Dec 6 19:00:48 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * lib/fileutils.rb (cannot_overwrite_file?): add wince.
+ * misc/rb_optparse.zsh: fix typos.
-Wed Nov 19 11:04:47 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Dec 6 18:59:04 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * lib/fileutils.rb (cannot_overwrite_file?, have_st_ino?): bccwin32
- is same as mswin32.
+ * NEWS: add new encodings.
-Wed Nov 19 07:54:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+Mon Dec 6 18:56:42 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * lib/test/unit.rb: do not run tests if $! is set.
+ * test/ruby/test_string.rb (TestString#test_scan): add a test for
+ [ruby-core:33338] #4087.
- * lib/test/unit/assertionfailederror.rb: extend StandardError instead
- Exception (irb catches the former but not the latter).
+Mon Dec 6 18:55:36 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Tue Nov 18 23:31:36 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * test/uri/test_common.rb (TestCommon#test_encode_www_form): add
+ tests for r30015.
- * missing/memmove.c (memmove): take void *, not char *.
+Mon Dec 6 10:39:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * missing.h (memmove): ditto.
+ * lib/uri/common.rb (URI::Parser#initialize_pattern):
+ refix for restrict the pattern.
- * missing.h (strchr, strrchr): return char *, not int.
+Mon Dec 6 09:45:11 2010 Eric Hodel <drbrain@segment7.net>
-Tue Nov 18 22:20:10 2003 Minero Aoki <aamine@loveruby.net>
+ * ext/openssl (OpenSSL): add toplevel documentation
+ * ext/openssl/ossl_ssl.c (SSLContext, SSLSocket: add additional
+ documentation
+ * ext/openssl: move "let rdoc know about mOSSL" comments so they don't
+ show up in output
- * lib/fileutils.rb (fu_same?): temporal fix for windows.
+Mon Dec 6 09:16:46 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Nov 18 19:05:04 2003 Minero Aoki <aamine@loveruby.net>
+ * lib/uri/common.rb (URI::Parser#initialize_pattern):
+ workaround fix pattern of hostname for RFC 3986. [ruby-dev:42672]
- * lib/fileutils.rb (fu_same?): check by inode instead of path
- name, to detect two hard links pointing to the same content.
+Mon Dec 6 09:14:38 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * test/fileutils.rb: did not create correctly looped symlinks.
+ * lib/mkmf.rb (check_signedness): rename unused variable prelude.
-Tue Nov 18 18:23:05 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Dec 5 17:56:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/stringio/stringio.c (strio_read): behave as IO at empty string.
- [ruby-dev:21939], [ruby-dev:21941]
+ * class.c (make_metaclass): fix probable typo. builtin type flag
+ cannot be used with FL_TEST.
- * ext/stringio/stringio.c (strio_getc, strio_getline): set EOF flag.
+Sun Dec 5 12:09:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/stringio/stringio.c (strio_rewind, strio_seek, strio_ungetc):
- clear EOF flag.
+ * lib/irb/init.rb (IRB.parse_opts): fix typo. [ruby-core:33574]
- * test/stringio/test_stringio.rb: imported from [ruby-dev:21941].
+Sun Dec 5 11:27:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Nov 18 14:06:35 2003 Minero Aoki <aamine@loveruby.net>
+ * ruby.c (load_file_internal): decrement for ungotten line.
+ [ruby-dev:42680]
- * lib/fileutils.rb (fu_each_src_dest): raise if src==dest.
- [ruby-talk:85344] [ruby-core:01699]
+Sun Dec 5 10:32:11 2010 Tanaka Akira <akr@fsij.org>
- * lib/fileutils.rb: use Object#is_a? instead of Class#=== to allow
- e.g. remote objects for receivers.
+ * complex.c: parenthesize macro arguments.
- * lib/fileutils.rb: FileTest -> File.
+Sat Dec 4 11:39:17 2010 Eric Hodel <drbrain@segment7.net>
- * lib/fileutils.rb: put parentheses for arguments of File.xxxx?
+ * ext/openssl/ossl_x509ext.c (initialize): add documentation.
- * test/fileutils/test_fileutils.rb (test_cp): test "cp a a".
+Sat Dec 4 11:21:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/fileutils/test_fileutils.rb (test_mv): test "mv a a".
+ * hash.c (rb_hash_update_by): new API for Hash#update.
- * test/fileutils/test_fileutils.rb (test_ln): test "ln a a".
+Sat Dec 4 11:18:10 2010 Tanaka Akira <akr@fsij.org>
- * test/fileutils/test_fileutils.rb (test_ln_s): test "ln_s a a".
+ * class.c: parenthesize macro arguments.
- * test/fileutils/test_fileutils.rb (test_install): test "install a a".
+Sat Dec 4 11:07:57 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/fileutils/fileasserts.rb: new method assert_symlink.
+ * vm_core.h (rb_vm_inc_const_missing_count): missing prototype.
- * test/fileutils/fileasserts.rb: assert_is_directory -> assert_directory.
+Sat Dec 4 08:50:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Nov 17 19:38:49 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/iconv/iconv.c (Init_iconv): no warnings if $VERBOSE is nil.
- * file.c (getcwdofdrv): avoid using getcwd() directly, use
- my_getcwd() instead.
+Sat Dec 4 08:25:15 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * merged NeXT, OpenStep, Rhapsody ports patch from Eric Sunshine
- <sunshine@sunshineco.com>. [ruby-core:01596]
+ * vm_insnhelper.c (vm_call_method): revert r30064 and r30071,
+ because of [ruby-core:26761]. Bug#4106 rejected.
-Mon Nov 17 10:50:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Dec 4 07:46:48 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/optparse.rb (OptionParser::Completion::complete): allow least
- common completion for three or more candidates.
+ * lib/mkmf.rb (String#tr_cpp): substitute * with P like as
+ autoconf.
-Mon Nov 17 09:41:38 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Dec 3 22:36:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit/ui/tk/testrunner.rb,
- lib/test/unit/ui/gtk/testrunner.rb:
- run GUI main loop in sub thread.
+ * vm_insnhelper.c (vm_call_method): protected methods should be
+ checked against the real class.
- * lib/test/unit/ui/gtk2/testrunner.rb: imported from rough.
+Fri Dec 3 20:23:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit/autorunner.rb (keyword_display): sort keywords.
+ * lib/mkmf.rb (convertible_int): define printf format prefix too.
-Sun Nov 16 18:10:57 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb (convertible_int): detect convertible integer type.
+ port RUBY_REPLACE_INT from configure.in.
- * eval.c (rb_eval): iterator should return value from next inside
- begin/rescue/end. (ruby-bugs:PR#1218)
+ * lib/mkmf.rb (check_sizeof): should return integer always.
-Sun Nov 16 13:26:07 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Dec 3 12:54:48 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * marshal.c (w_object): LINK check earlier than anything else,
- i.e. do not dump TYPE_IVAR for already dumped objects.
- (ruby-bugs:PR#1220)
+ * win32/Makefile.sub (RCFLAGS): VC10 and after only. fixed the problem
+ of r30015. [ruby-core:33530]
- * eval.c (rb_eval): call "inherited" only when a new class is
- generated; not on reopening.
+Fri Dec 3 12:41:52 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
- * eval.c (eval): prepend error position in evaluating string to
- "mesg" attribute string only when it's available and is a
- string.
+ * gc.c (rb_objspace_free): With our "lazy-sweep" GC engine, it is
+ possible for an object to survive until its surrounding object
+ space is about to be freed. Those objects, if any, remains
+ leaked for the rest of a process life. This is problematic
+ because for instance a T_DATA object may have its own destructor
+ to terminate something.
-Sun Nov 16 12:16:10 2003 Minero Aoki <aamine@loveruby.net>
+ * vm.c (ruby_vm_destruct): ruby_current_vm termination should be
+ somewhere after rb_objspace_free for above reason.
- * lib/net/protocol.rb: logging response body. [experimental]
- [ruby-list:38800]
+Fri Dec 3 12:17:19 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Nov 16 10:49:38 2003 Gavin Sinclair <gsinclair@soyabean.com.au>
+ * vm_insnhelper.c (vm_call_method): protected singleton methods should
+ be visible from same real class methods. [ruby-core:33506]
- * lib/thread.rb (Thread.exclusive): wrap method definition in
- class Thread to enable rdoc to process.
+Fri Dec 3 07:08:42 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Nov 16 09:45:23 2003 Minero Aoki <aamine@loveruby.net>
+ * ext/stringio/stringio.c (strio_getline): round upto next char
+ boundary. [ruby-dev:42674]
- * lib/net/http.rb (set_debug_output): warn if method is called
- after #start. [ruby-dev:38798]
+Fri Dec 3 06:52:46 2010 Tanaka Akira <akr@fsij.org>
-Sun Nov 16 04:41:33 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * compile.c: parenthesize macro arguments.
- * eval.c (eval): do not re-raise exception to avoid unnecessary
- exception copying, instead modify exception and internal
- information to adjust eval().
+Fri Dec 3 04:08:59 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * eval.c (backtrace): can return the current frame information
- only if lev < -1.
+ * encoding.c (enc_alias_internal): use st_insert2 and change return
+ value to int.
-Sat Nov 15 22:16:42 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * encoding.c (enc_alias): follow enc_alias_internal.
- * /ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext):
- refine error message.
+Fri Dec 3 01:52:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Sat Nov 15 10:05:40 2003 Tanaka Akira <akr@m17n.org>
+ * encoding.c (enc_alias_internal): use xfree instead of free.
- * lib/open-uri.rb (OpenURI.open_loop, OpenURI::HTTP#proxy_open):
- refactored to support options.
- (Buffer): maintain size by this class.
+Thu Dec 2 23:52:26 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-Sat Nov 15 07:40:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * NEWS: entry for ruby_vm_at_exit().
- * eval.c (rb_method_node): new API to retrieve method body.
+ * eval.c (ruby_cleanup): bug fix around at_exit (1) timing was
+ wrong. (2) execution order was opposite.
-Fri Nov 14 13:21:30 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu Dec 2 23:05:14 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tcltklib/tcltklib.c: fix (en-bugged at 2003/11/07)
+ * win32/Makefile.sub (RCFLAGS): -nologo switch is only available in
+ newer versions of rc.exe. fixed the problem of r30012.
- * ext/tk/lib/tkdialog.rb: TkDialog.new accepts a parent widget
- argument [ruby-talk:85066]
+Thu Dec 2 21:28:07 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Nov 13 20:53:35 2003 Tanaka Akira <akr@m17n.org>
+ * ext/json/lib/json/add/rails.rb: removed.
- * lib/open-uri.rb (Kernel[#.]open): hard coded URI schemes removed.
- [ruby-ext:02251]
+Thu Dec 2 21:22:05 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Nov 13 19:17:00 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * encoding.c (enc_alias_internal): free the copied key and
+ return NULL when given key is already registered.
- * lib/test/unit/ui/tk/testrunner.rb: use grid and panedwindow
- (if available)
+ * encoding.c (enc_alias): call set_encoding_const only when the
+ alias is not registered yet.
-Thu Nov 13 17:56:41 2003 Tanaka Akira <akr@m17n.org>
+Thu Dec 2 19:58:24 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
- * lib/open-uri.rb (OpenURI.open_uri): use File::RDONLY.
- reported by Take_tk <ggb03124@nifty.ne.jp>.
- [ruby-ext:02245]
+ * vm.c (ruby_vm_at_exit): new API. This enables extension libs to
+ hook a VM termination. Right now, because the VM we have is
+ process global, most extensions do not deallocate resources and
+ leave them to Operating System's reaping userland processes. But
+ in a future we plan to have multiple VMs to run simultaneously in
+ a single process (MVM project). At that stage we can no longer
+ rely on OSes and have to manage every resources to be reclaimed
+ properly. So it is. For a forward-compatibility reason this API
+ is introduced now, encouraging you to be as gentle as you can for
+ your resources; that is, tidy up your room.
-Thu Nov 13 16:45:53 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * include/ruby/vm.h: ditto.
- * ext/openssl/ossl_x509req.c (ossl_x509req_to_der): add function for
- X509::Request#to_der.
+ * vm_core.h (rb_vm_struct): new field.
-Thu Nov 13 11:31:14 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vm.c (vm_init2): initialize above new field.
- * lib/optparse.rb (OptionParser::Completion#complete): prior shorter
- name to containing longer name.
+ * eval.c (ruby_cleanup): trigger those hooks.
-Thu Nov 13 06:08:54 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu Dec 2 17:00:44 2010 Tanaka Akira <akr@fsij.org>
- * ext/tk/lib/tk.rb: stop freezing some classes
+ * bignum.c: parenthesize macro arguments.
- * ext/tk/lib/multi-tk.rb: ditto.
+Thu Dec 2 15:31:14 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Nov 12 17:32:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/win32.c (rb_w32_read): more fix. [ruby-core:33513]
- * lib/test/unit/assertions.rb (assert_throws, assert_nothing_thrown):
- uncaught throw in sub thread raises ThreadError.
+Thu Dec 2 13:41:43 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/test/unit/ui/tk/testrunner.rb (setup_ui): "expand" is not
- necessary.
+ * win32/win32.c (rb_w32_read): workaround for console reading troubles.
+ fixed [ruby-core:33511]
-Wed Nov 12 14:09:43 2003 Shugo Maeda <shugo@ruby-lang.org>
+Thu Dec 2 13:10:42 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * test/monitor/test_monitor.rb: fix the timing problem by Queue.
+ * lib/uri/common.rb (URI.encode_www_form):
+ split key-value when the value is Array like object.
-Wed Nov 12 12:59:44 2003 Shugo Maeda <shugo@ruby-lang.org>
+Thu Dec 2 10:39:39 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * test/monitor/test_monitor.rb: added.
+ * lib/net/http.rb (Net::HTTP#set_form_data):
+ use URI.encode_www_form for application/x-www-form-urlencoded.
-Wed Nov 12 10:14:28 2003 Shugo Maeda <shugo@ruby-lang.org>
+Thu Dec 2 10:38:40 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/monitor.rb: refactored. Thanks, Gennady Bystritsky.
+ * ext/extmk.rb: remove $makeflags.defined?, it should be $mflags.
-Wed Nov 12 06:11:39 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Thu Dec 2 10:19:47 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/openssl/ossl.c (ossl_x509_sk2ary, ossl_x509crl_sk2ary):
- add functions to convert STACK into Array.
+ * win32/Makefile.sub (rc): suppress meaningless message.
- * ext/openssl/ossl.h: add prototypes.
+Thu Dec 2 10:09:40 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/openssl/ossl_pkcs7.c (ossl_pkcs7_set_certificates,
- ossl_pkcs7_get_certificates, ossl_pkcs7_get_crls,
- ossl_pkcs7_set_crls): add functions for PKCS7#certificates=
- PKCS7#certificates, PKCS7#crls= and PKCS7#crls.
+ * ext/json/generator/extconf.rb: remove the lines which set -O3
+ when -O option is not set.
+ Note that -O3 doesn't always exist.
-Wed Nov 12 00:47:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * ext/json/parser/extconf.rb: ditto.
- * lib/test/unit/ui/testrunnermediator.rb: should require 'test/unit'.
+Thu Dec 2 10:01:59 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Nov 11 23:54:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * ext/extmk.rb: define $makeflags.defined? like $mflags.
- * lib/test/unit/ui/gtk/testrunner.rb: added a rescue clause to handle
- the case when the requested font is not available.
+Thu Dec 2 07:20:20 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Nov 11 22:44:08 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/test/unit.rb (Test::Unit::GCStressOption): --gc-stress
+ option.
- * io.c (appendline): file may not end with newline. a bug if
- READ_DATA_PENDING_PTR is defined. [ruby-talk:84925]
+ * lib/test/unit.rb (Test::Unit::Mini#_run_suites): show the result
+ even when interrupted on the way.
-Tue Nov 11 10:42:41 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Thu Dec 2 07:08:38 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/tk.rb: raise an exception when creating TkWindow
- object, because TkWindow class is an abstract class.
+ * ext/io/console/console.c (setattr): should retry on EINTR.
+ [ruby-dev:42666]
-Tue Nov 11 03:30:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Thu Dec 2 02:30:50 2010 Eric Hodel <drbrain@segment7.net>
- * lib/ext/openssl/ossl_conf.c (ossl_config_get_value): return nil
- if the specified value doesn't exist.
+ * lib/net/http.rb: fixed positional wording to match revised order.
- * lib/ext/openssl/ossl_conf.c (ossl_config_get_section): return
- a empty hash if the specified section doesn't exist.
+Thu Dec 2 01:24:39 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Nov 10 11:40:29 2003 Shugo Maeda <shugo@ruby-lang.org>
+ * ext/json/lib/json/common.rb: don't use iconv on 1.9.
+ patched by Shota Fukumori [ruby-core:33164]
- * lib/monitor.rb (wait): return true on signal/broadcastfalse and
- false on timeout. Thanks Gennady Bystritsky.
+Thu Dec 2 01:02:03 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Nov 10 00:07:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/json: Update github/flori/json from 1.4.2+ to
+ e22b2f2bdfe6a9b0. this fixes some bugs.
- * parse.y (primary): primary_value may be 0 when syntax error.
- [ruby-talk:84893]
+Thu Dec 2 00:05:44 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Sun Nov 9 02:05:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * lib/net/http.rb: improve rdoc.
+ This change the order of chapter because such overview should
+ begin with simple examples.
+ patched by Eric Hodel [ruby-core:33469]
- * lib/test/unit/assertions.rb: un-deprecated #assert_not_nil to
- maintain symmetry with #assert_nil. Also added better output for
- #assert_kind_of.
+Wed Dec 1 22:01:49 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/testunit/tc_assertions.rb: ditto.
+ * numeric.c (Init_Numeric): fixed a potential bug when using bccwin32
+ ruby with Microsoft's dll, though we already gave up of supporting
+ bccwin32. [ruby-core:33503]
-Sat Nov 8 18:50:20 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Wed Dec 1 21:43:21 2010 Tanaka Akira <akr@fsij.org>
- * test/wsdl/raa/*: add new testcase for WSDL loading, parsing and
- reading.
+ * array.c: parenthesize macro arguments.
- * test/soap/marshal/*: backport from soap4r/1.5.1. all differences are
- for ruby/1.6.
+Wed Dec 1 21:41:57 2010 Tanaka Akira <akr@fsij.org>
- * lib/soap/*: backport from soap4r/1.5.1. all differences are for
- ruby/1.6.
+ * test/socket/test_addrinfo.rb: extract Errno::EADDRINUSE as a method.
- * lib/wsdl/data.rb, lib/wsdl/xmlSchema/data.rb: move definition of
- ArrayTypeAttrName from ::WSDL::XMLSchema::* to ::WSDL::*.
- [ruby-talk:84813]
+ * test/socket/test_socket.rb: ditto.
- * lib/wsdl/soap/definitions.rb: element name typo in custom exception
- struct definition which is needed for wsdlDriver; camelCase ->
- underscore_name.
+Wed Dec 1 15:08:32 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Nov 8 13:49:50 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/openssl/test_ssl.rb (test_not_started_session): non socket
+ argument of SSLSocket.new is not supported on Windows.
- * configure.in: improvement of pthread check
+Wed Dec 1 14:36:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Nov 8 13:28:46 2003 Takaaki Tateishi <ttate@ttsky.net>
- * ext/dl/sym.c: Add DL.win32_last_error and DL.last_error.
- Thanks, Kaoru Shirai.
+ * string.c (rb_memhash): zero-filled strings should return
+ different values. [ruby-core:33500]
-Sat Nov 8 06:19:38 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Wed Dec 1 14:27:49 2010 Ryan Davis <ryand-ruby@zenspider.com>
- * ext/tcltklib/tcltklib.c: To fix 'pthread-enabled Tcl/Tk' problem,
- TclTkIp#_eval calls Tcl_Eval() on the mainloop thread only
- (queueing a handler to the EventQueue).
+ * lib/minitest/*.rb: Imported minitest 2.0.0 r5952.
+ * test/minitest/*.rb: ditto.
+ * lib/test/unit.rb: Compatibility fix for minitest changes.
- * ext/tcltklib/README.1st: edit the description of '--with-pthread-ext'
+Wed Dec 1 10:16:41 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Nov 7 23:23:04 2003 Tanaka Akira <akr@m17n.org>
+ * string.c (rb_str_inspect): fix typo (not 0xFD but 0xFE).
- * lib/pathname.rb (Pathname#+): if self or the argument is `.', return
- another.
- (Pathname#parent): if self is `.', return `..'.
- (Pathname#children): if self is `.', don't prepend self for a
- pathname in a result.
- (Pathname#join): re-implemented using Pathname#+.
- (Pathname#find): if self is `.', remove `./' prefix of yielding
- pathname.
+Wed Dec 1 09:28:27 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Nov 7 10:23:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * addr2line.c: Follow .gnu_debuglink section.
+ A user of distribution provided ruby will see line
+ info if s/he has a debug package for ruby.
+ patched by Shinichiro Hamaji [ruby-dev:42655]
- * ext/socket/socket.c (make_hostent): get rid of SEGV on aliases
- lookup failure. (ruby-bugs:PR#1215)
+Wed Dec 1 01:29:15 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Nov 7 04:08:05 2003 UENO Katsuhiro <katsu@blue.sky.or.jp>
+ * string.c (rb_str_inspect): inspect as a dummy encoding string
+ when a UTF-16/32 (not BE/LE) string does not have a BOM.
+ Unicode and some RFCs say that a string labeled as UTF-16/32
+ doesn't have a BOM, it should be considered big endian.
+ But many Windows programs generates little endian UTF-16
+ strings without a BOM. So String#inspect treats a string
+ labeled UTF-16/32 without a BOM as a dummy encoding string.
+ patched by Martin Duerst. [ruby-core:33461]
- * ext/zlib/zlib.c (Init_zlib): define Zlib::GzipReader#each_line as
- an alias of Zlib::GzipReader#each.
+Tue Nov 30 17:04:10 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Nov 7 01:03:16 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * addr2line.c (parse_debug_line_cu): ignore DW_LNE_set_discriminator.
+ To ignore, it needs to read a single unsigned LEB128 integer.
- * eval.c (rb_load): save and restore rb_prohibit_interrupt.
- [ruby-dev:21857]
+Tue Nov 30 16:29:19 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Nov 6 18:05:07 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vm_dump.c: undef HAVE_BACKTRACE when the OS is FreeBSD (in other
+ words backtrace() is libexecinfo) and it is optimized.
+ This temporary hack may be also applied to other libexecinfo
+ environments.
- * io.c (rb_io_inspect): show the path also at a closed file.
- [ruby-dev:21851]
+Tue Nov 30 16:23:23 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Nov 6 11:42:07 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/http.rb: improve rdoc.
+ patched by Eric Hodel ref #4100
- * ext/stringio/stringio.c (strio_set_string, strio_reopen): check
- tainted.
+Tue Nov 30 12:23:52 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/stringio/stringio.c (strio_copy, strio_ungetc, strio_write,
- strio_putc): add infection.
+ * win32/win32.c (rb_w32_read): read only 1 byte at once on console.
+ workaround of Windows bug. see [ruby-core:33460].
+ this is not the final solution.
- * ext/stringio/stringio.c (strio_path): just nil. [ruby-dev:21846]
+Tue Nov 30 11:39:13 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ruby.c (proc_options): reserve searched script path in the
- source file name table. [ruby-list:38765]
+ * lib/net/http.rb: improve rdoc.
+ patched by mathew murphy [ruby-core:33472] ref #4100
- * lib/optparse.rb (OptionParser::Completion#complete): default not to
- ignore case on completion. [ruby-talk:84726]
+Tue Nov 30 05:03:44 2010 Eric Hodel <drbrain@segment7.net>
- * win32/win32.c (make_cmdvector): process backslashes even if a quote
- is not enclosed.
+ * lib/uri/common.rb (encode_www_form, encode_www_form_component):
+ Improve English in documentation.
-Wed Nov 5 23:49:45 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/openssl/ossl_ssl.c (ssl_version=, ciphers=): Document
+ #ssl_version=, add documentation for #ciphers=.
- * sample/openssl/gen_csr.rb: there (at least) is a CA which does not
- accept DN in UTF8STRING format. it's a sample.
+Mon Nov 29 22:55:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Nov 5 22:55:16 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/uri/common.rb (URI::WFKV_): get rid of backtrack explosion
+ by nested repeat operators. [ruby-core:33464]
- * configure.in, eval.c, signal.c: : add '--with-pthread-ext'
- option to fix the pthread trouble on 'tcltklib'
+Mon Nov 29 22:53:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tcltklib/README.1st: add the description of '--with-pthread-ext'
+ * win32/Makefile.sub (scriptbin.mk): fix generated rules.
- * ext/tk/lib/tktext.rb : add TkText#text_copy, text_cut, text_paste
- to support Tcl/Tk8.4's tk_textCopy, tk_textCut, tk_textPaste
+ * win32/win32.c (rb_w32_write_console): fix argument type.
- * ext/tk/lib/tk.rb : add TkMenu#set_focus support Tcl/Tk's
- tk_menuSetFocus
+Mon Nov 29 21:12:51 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Nov 5 17:33:45 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * misc/ruby-mode.el (ruby-forward-sexp): stop after literal hash
+ key labels.
- * eval.c (rb_load): allow interrupt during loaded program
- evaluation. [ruby-dev:21834]
+ * misc/ruby-mode.el (ruby-font-lock-keywords): highlight literal
+ hash key labels as symbols.
- * hash.c (rb_hash_fetch): always warn if default argument and a
- block are supplied at the same time. [ruby-dev:21842]
+Mon Nov 29 18:31:31 2010 Martin Duerst <duerst@it.aoyama.ac.jp>
- * hash.c (env_fetch): ditto.
+ * test/ruby/test_transcode.rb (test_unicode_public_review_issue_121):
+ - Removed commented-out options that are no longer under discussion.
+ - Added two more tests for forthcomming clarifications.
- * array.c (rb_ary_fetch): ditto.
+Mon Nov 29 14:31:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Nov 5 19:08:47 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/win32.c (rb_w32_isatty): use GetConsoleMode() to determine the
+ fd is console or not, just like rb_w32_write_console(). [experimental]
- * lib/optparse.rb (OptionParser::Switch::PlacedArgument::parse):
- do not remove next argument if empty value is placed.
+Mon Nov 29 14:19:40 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/optparse: added.
+ * include/ruby/win32.h (rb_w32_write_console): wrong prototype.
-Wed Nov 5 17:05:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Nov 29 14:10:55 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/test/unit/ui/gtk/testrunner.rb: typo.
+ * win32/win32.c (rb_w32_write_console): fixed indentation.
-Wed Nov 5 11:13:32 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Sun Nov 28 22:13:39 2010 Koichi Sasada <ko1@atdot.net>
- * string.c: add #include "version.h". this file still depends on it.
+ * thread_pthread.c (NATIVE_MUTEX_LOCK_DEBUG): move and use it.
- * Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
- wince/Makefile.sub: add version.h dependency to string.c.
+ * ChangeLog: fix my timezone.
-Wed Nov 5 09:14:23 2003 Shugo Maeda <shugo@ruby-lang.org>
+Mon Nov 28 21:58:58 2010 Koichi Sasada <ko1@atdot.net>
- * lib/monitor.rb: revert to the previous revision.
+ * thread_pthread.c: remove pthread_atfork().
-Wed Nov 5 08:39:51 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Mon Nov 28 21:54:22 2010 Koichi Sasada <ko1@atdot.net>
- * lib/webrick/https.rb (HTTPRequest#parse): set @client_cert_chain.
+ * thread_pthread.c (native_cond_*): Check return code.
+ (Some OSes except Linux return error code).
- * lib/webrick/https.rb (HTTPRequest#meta_vars): create
- SSL_CLIENT_CERT_CHAIN_n from @client_cert_chain.
+Sun Nov 28 21:46:21 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_ssl.c (ossl_ssl_get_peer_cert_chain): return nil
- if no cert-chain was given.
+ * thread_pthread.c (thread_start_func_1): initialize native thread
+ data immediately before starting.
-Tue Nov 4 23:44:48 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Sun Nov 28 14:56:32 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub:
- remove needless version.h dependency.
+ * io.c (struct argf): make lineno long, and reorder members.
-Tue Nov 4 23:38:43 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+Sun Nov 28 14:55:42 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * class.c, hash.c, string.c: remove #include "version.h".
+ * thread_win32.c (gvl_release, gvl_init): suppress warnings.
- * Makefile.in: remove needless version.h dependency.
+Sun Nov 28 14:48:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Nov 4 06:54:52 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * thread_pthread.c (gvl_release, gvl_init): suppress warnings.
- * io.c (read_all): fptr->f may be NULL, if IO is closed in the
- signal handler.
+ * vm_core.h (rb_vm_gvl_destroy): add prototype.
- * io.c (io_read): ditto.
+Sun Nov 28 14:46:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (get_pat): remove 1.8.0 warning code.
+ * thread_pthread.c (gvl_reinit): register atfork handler only in
+ the parent process, to get rid of dead lock.
- * string.c (rb_str_match): extend warning until 1.8.2.
+Sun Nov 28 12:23:57 2010 Koichi Sasada <ko1@atdot.net>
- * string.c (rb_str_match2): ditto.
+ * thread.c, vm_core.h: make gvl_acquire/release/init/destruct
+ APIs to modularize GVL implementation.
- * class.c (class_instance_method_list): remove 1.8.0 warnings.
- method_list now recurs. [ruby-dev:21816]
+ * thread_pthread.c, thread_pthread.h: Two GVL implementations.
+ (1) Simple locking GVL which is same as existing GVL.
+ (2) Wake-up queued threads. The wake-up order is simple FIFO.
+ (We can make several queues to support exact priorities, however
+ this causes some issues such as priority inversion and so on.)
+ This impl. prevents spin-loop (*1) caused on SMP environments.
+ *1: Only one Ruby thread acquires GVL again and again.
+ Bug #2359 [ruby-core:26694]
- * class.c (rb_obj_singleton_methods): ditto.
+ * thread_win32.c, thread_win32.h: Using simple lock
+ not by CRITICAL_SECTION but by Mutex.
+ Bug #3890 [ruby-dev:42315]
- * array.c (rb_ary_select): remove select with block.
- [ruby-dev:21824]
+ * vm.c (ruby_vm_destruct): ditto.
- * hash.c (rb_hash_select): ditto.
+Sun Nov 28 04:40:00 2010 Luis Lavena <luislavena@gmail.com>
- * hash.c (env_select): ditto.
+ * io.c (io_fwrite): use rb_w32_write_console under Windows.
- * re.c (match_select): ditto.
+ * win32/win32.c (rb_w32_write_console): added to write to write
+ Unicode using WriteConsoleW for stdout/stderr. [ruby-core:33166]
- * struct.c (rb_struct_select): ditto.
+Sun Nov 28 03:58:47 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Nov 3 22:53:21 2003 Minero Aoki <aamine@loveruby.net>
+ * lib/net/http.rb: improve rdoc.
+ patched by Mike Perham [ruby-core:33433]
- * lib/racc/parser.rb: synchronize with Racc 1.4.4.
+Sat Nov 27 19:12:10 2010 Tanaka Akira <akr@fsij.org>
- * ext/racc/cparse/cparse.c: ditto.
+ * time.c: parenthesize macro arguments.
- * ext/racc/cparse/cparse.c (parse_main): should abort when
- the length of LR state stack <=1, not ==0.
+Sat Nov 27 18:08:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Nov 3 08:50:47 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * time.c (leap_year_v_p): fixed typo. [ruby-dev:42631]
- * process.c (check_uid_switch): remove duplicated error messages.
+Sat Nov 27 17:57:08 2010 Tanaka Akira <akr@fsij.org>
- * process.c (check_gid_switch): ditto.
+ * resolv.rb (Resolv::DNS): use the same DNS server when retry using
+ TCP. reported by Julian Mehnle. [ruby-core:32970]
-Sun Nov 2 02:28:33 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sat Nov 27 15:45:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/webrick/ssl.rb: new option :SSLExtraChainCert.
+ * vm_dump.c (rb_vm_bugreport): see CrashReport log on Mac OS X.
-Sun Nov 2 01:02:04 2003 Akinori MUSHA <knu@iDaemons.org>
+ * configure.in: link addr2line only for ELF.
- * string.c (rb_str_hash): Update the HASH_PERL alternative hash
- algorithm in sync with Perl 5.8.
+Sat Nov 27 13:58:55 2010 Shugo Maeda <shugo@ruby-lang.org>
- * st.c (strhash): Ditto.
+ * lib/optparse.rb (OptionParser#candidate): : was missing. Thanks,
+ Shota Fukumori. [ruby-dev:42634]
-Sat Nov 1 18:21:09 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Sat Nov 27 12:07:05 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/openssl/ossl_ssl.c (ossl_ssl_peer_cert_chain): add new method
- SSLSocket#peer_cert_chain.
+ * man/ruby.1: Ruby man page from Arthur Gunn in [ruby-core:33412]
- * ext/openssl/ossl_x509req.c (GetX509ReqPtr): new function
- which returns underlying X509_REQ.
+Sat Nov 27 11:29:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_issuer_cert,
- ossl_x509extfactory_set_subject_cert, ossl_x509extfactory_set_crl,
- ossl_x509extfactory_set_subject_req, ossl_x509extfactory_set_config):
- use underlying C struct without duplication not to leak momory.
+ * lib/optparse.rb (OptionParser#candidate): get rid of 1.9 syntax
+ so that BASERUBY can be 1.8.
-Sat Nov 1 01:49:03 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Sat Nov 27 08:16:21 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/soap/mapping/factory.rb: mark marshalled basetype objects when
- @allow_original_mapping is true. multi-referencing basetype node is
- prohibited in SOAP/1.1 encoding but soap4r's original ruby object
- mapping requires basetype to be marked to detect self referencing
- loop. e.g. o = 1; o.instance_eval { @iv = o } soap4r's original
- mapping is only used through soap/marshal API.
+ * addr2line.c (rb_dump_backtrace_with_lines): should close fd on
+ edge case.
- * test/soap/marshal/test_marshal.rb: add tests for self referencing
- immutable objects.
+Fri Nov 26 13:33:24 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * test/soap/calc/test_calc_cgi.rb: fix test name.
+ * addr2line.c: apply a patch from shinichiro.h.
-Fri Oct 31 22:26:29 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
+Fri Nov 26 12:21:20 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * wince/string_wce.c (strrchr): should decrement pointer.
+ * addr2line.c: added to show source filename and line number of
+ functions in backtrace. [ruby-dev:42625]
+ a patch from shinichiro.h <shinichiro.hamaji AT gmail.com>
- * wince/Makefile.sub: correct a range of isdigit().
+ * addr2line.h: ditto.
-Fri Oct 31 12:55:24 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * common.mk: add addr2line.$(OBJEXT).
- * configure.in, lib/mkmf.rb: add RPATHFLAG for NetBSD.
- [ruby-dev:21791]
+ * configure.in: check dl_iterate_phdr.
- * bcc32/Makefile.sub, win32/Makefile.sub, win32/Makefile.sub: ditto.
+ * vm_dump.c (rb_vm_bugreport): use rb_dump_backtrace_with_lines in
+ addr2line.c when the binary is ELF.
-Fri Oct 31 01:38:14 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Fri Nov 26 12:12:50 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * wince/Makefile.sub, win32/Makefile.sub (.y.c): allow white spaces
- at the beginning of line to remove by sed. (ruby-bugs-ja:PR#580)
+ * regcomp.c (setup_tree): restart setup_tree() for a node whose
+ AnchorNode's type is ANCHOR_PREC_BEHIND or ANCHOR_PREC_BEHIND_NOT
+ and divide_look_behind_alternatives() divided it to NT_ALT or
+ NT_LIST. [ruby-core:33370]
-Fri Oct 31 01:02:24 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Nov 26 11:40:11 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * compar.c (cmp_equal): protect exceptions from <=> comparison
- again. returns nil if any exception or error happened during
- comparison.
+ * vm_dump.c (dump_thread): get only required rights of the target
+ thread because THREAD_ALL_ACCESS causes an access error on XP.
+ reported by Masaya TARUI via IRC.
- * eval.c (search_required): should update *featurep when DLEXT2 is
- defined. (ruby-bugs-ja:PR#581)
+Fri Nov 26 11:09:07 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Oct 30 23:41:04 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * vm_dump.c (dump_thread): show the displacement from the beginning
+ of the symbol.
- * lib/drb/drb.rb: add DRbArray
+Fri Nov 26 10:48:23 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/drb/invokemethod.rb: fix Hash#each problem. [ruby-dev:21773]
+ * vm_dump.c (dump_thread): follow the output of glibc.
+ see [ruby-dev:42627]
- * lib/drb/unix.rb: add LoadError. [ruby-dev:21743]
+Fri Nov 26 09:48:45 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Oct 30 23:19:11 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * re.c (rb_reg_initialize_str): should succeed the taint status from
+ the origin. [ruby-core:33338]
- * lib/soap/generator.rb: better XML pretty printing.
+Fri Nov 26 09:32:37 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/soap/encodingstyle/soapHandler.rb: remove unnecessary namespace
- assignment in the element which has "encodingStyle" attribute, and
- add necessary namespace assignment for "arrayType" attribute.
+ * vm_dump.c (dump_thread): seems to be necessary the 3rd argument of
+ SymGetLineFromAddr64(), even though MSDN says it can be zero.
- * test/soap/calc/test_calc_cgi.rb: take over $DEBUG to ruby process
- through CGI.
+Fri Nov 26 09:03:38 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Oct 30 22:59:39 2003 why the lucky stiff <why@ruby-lang.org>
+ * regcomp.c (onig_is_prelude): added to check whether ruby is still
+ in prelude (or other boot processes) or not.
- * ext/syck/yaml2byte.c: HASH const too long. Thanks, matz.
+ * regcomp.c (optimize_node_left): use onig_is_prelude for printing.
-Thu Oct 30 19:13:53 2003 Akinori MUSHA <knu@iDaemons.org>
+ * regcomp.c (set_optimize_info_from_tree): ditto.
- * ext/syck/MANIFEST: Add yamlbyte.h.
+ * regcomp.c (onig_compile): ditto.
-Thu Oct 30 14:25:31 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * regcomp.c (print_compiled_byte_code_list): print its address.
- * io.c (READ_DATA_BUFFERED): new macro to detect whether stdio
- buffer filled.
+ * regcomp.c (print_indent_tree): print its contents tree of
+ ANCHOR_PREC_READ(_NOT) and ANCHOR_PREC_BEHIND(_NOT).
- * io.c (rb_io_fptr_cleanup): move path deallocation to
- rb_io_fptr_finalize (finalizer called by GC).
+Thu Nov 25 23:10:49 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Oct 30 13:23:39 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * regcomp.c (print_distance_range): use PRIuSIZE.
- * parse.y (logop): left may be NULL. [ruby-talk:84539]
+ * regcomp.c (print_optimize_info): use %ld because the type of
+ calculated value of integers is long.
- * eval.c (rb_eval): NODE_CASE nd_head may be NULL.
+ * regexec.c (onig_print_compiled_byte_code): add prototype.
-Thu Oct 30 10:14:51 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * regexec.c (match_at): add 2nd argument.
- * lib/test/unit/autorunner.rb: make fox runner work.
+Thu Nov 25 10:29:55 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Oct 30 09:32:26 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/dl/callback/mkcallback.rb (gencallback): shouldn't assume that
+ VALUE is the same size with long.
- * process.c (rb_f_system): fixed lack of security check before
- calling do_spawn() on win32. [ruby-talk:84555]
+Thu Nov 25 10:03:14 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Oct 30 02:46:35 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/win32ole/test_err_in_callback.rb (teardown): remove tmp file
+ only when it exists.
- * eval.c (proc_invoke): single array value to normal Proc#call
- (i.e. not via lambda call), should be treated just like yield.
- [ruby-dev:21726]
+Thu Nov 25 01:38:25 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Oct 30 02:25:48 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * enc/trans/big5-hkscs-tbl.rb: Update table as HKSCS-2008.
+ patched by oCameLo oTnTh [ruby-core:33256]
- * ext/openssl/lib/openssl/buffering.rb (Buffering#initialize):
- add new method to inherit @sync from @io.sync.
+ * enc/big5.c: add alias Big5-HKSCS:2008 to Big5-HKSCS.
- * ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): no need to
- set sync flag explicitly.
+Wed Nov 24 15:18:07 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/openssl/ossl_ssl.c (ossl_sslctx_initialize): call super.
+ * vsnprintf (BSD_vfprintf): use QUADINT macro only when _HAVE_SANE_QUAD_
+ macro is defined.
- * ext/openssl/ossl_ssl.c (ossl_sslctx_setup): set extra chain
- certificates in @extra_chain_cert.
+Wed Nov 24 12:47:16 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Oct 29 22:02:04 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * vsnprintf (BSD_vfprintf): added VC++ compatible size specifications
+ (I, I32, I64).
- * test/drb/drbtest.rb: use rbconfig.rb to make the path of ruby
- interpreter to exec, instead of test/ruby/envutil.rb,
+Wed Nov 24 11:19:13 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Oct 29 19:58:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+ * string.c (rb_str_inspect): treat UTF-16 and UTF-32 as BE or LE.
- * ext/tcltklib/tcltklib.c (CONST84): define CONST84 when it is not
- defined and TCL_MAJOR_VERSION >= 8.
+Wed Nov 24 06:35:32 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tcltklib/tcltklib.c (VwaitVarProc, WaitVariableProc,
- rb_threadVwaitProc): use CONST84 instead of CONST.
+ * enc/trans/utf_16_32.trans: add the UTF-32 converter.
- * ext/tcltklib/tcltklib.c (ip_rbTkWaitCommand,
- ip_rb_threadTkWaitCommand): use CONST84 always.
+Wed Nov 24 05:40:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Oct 29 17:27:05 2003 Tanaka Akira <akr@m17n.org>
+Wed Nov 24 06:13:32 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * re.c (rb_reg_s_union, Init_Regexp): new method `Regexp.union'.
+ * win32/win32.c (filecp, wstr_to_mbstr, mbstr_to_wstr):
+ refactored.
- * lib/pathname.rb (realpath): examine Dir.pwd because it may have
- symlinks.
+Wed Nov 24 05:40:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Oct 29 17:16:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * enc/trans/utf_16_32.trans: add a converter from UTF-8 to UTF-16.
- * eval.c (rb_longjmp): must not disturb original jump.
- [ruby-dev:21733]
+Wed Nov 24 03:21:35 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Oct 29 15:28:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * enc/trans/utf_16_32.trans: raise error on unpaired upper
+ surrogates.
- * eval.c (Init_Proc): taint preallocated exception object
- sysstack_error. [ruby-talk:84534]
+Wed Nov 24 01:40:23 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Oct 29 11:27:39 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * enc/utf_16_32.h: add UTF-16 and UTF-32 as a dummy encoding.
- * parse.y (ret_args): node may be NULL. [ruby-talk:84530]
+ * enc/trans/utf_16_32.trans: add a converter from UTF-16 to UTF-8.
-Tue Oct 28 15:20:12 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Nov 23 21:59:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tcltklib/tcltklib.c (VwaitVarProc, ip_rbVwaitObjCmd,
- WaitVariableProc, WaitVisibilityProc, WaitWindowProc,
- ip_rbTkWaitObjCmd, ip_rbTkWaitCommand, rb_threadVwaitProc,
- rb_threadWaitVisibilityProc, rb_threadWaitWindowProc,
- ip_rb_threadVwaitObjCmd, ip_rb_threadTkWaitObjCmd): prototype;
- avoid VC++ warnings.
+ * win32/win32.c (wlink, rb_w32_getppid): use typedef instead of
+ repeating complicated function prototypes.
-Mon Oct 27 19:19:55 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Nov 23 18:54:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_longjmp): ignore reentering error while warning.
- [ruby-dev:21730]
+ * vm.c (rb_thread_mark): should mark self in control
+ frames. [ruby-core:33289]
-Mon Oct 27 00:23:50 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Nov 23 07:57:31 2010 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/tcltklib/tcltklib.c (ip_ruby): bug fix on Win : hang-up when
- calling 'exit' in the Tk callback procedure. [ruby-list:38656]
+ * lib/date/delta/parser.{ry,rb}: fixed a bug of token scanner.
-Sat Oct 25 09:18:04 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Nov 23 07:29:24 2010 Tadayoshi Funaba <tadf@dotrb.org>
- * eval.c (rb_method_missing): protect exception from within
- "inspect". (ruby-bugs:PR#1204)
+ * complex.c, rational.c ({nucomp,nurat}_expt): added a check.
-Fri Oct 24 23:26:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Nov 23 07:27:27 2010 Tadayoshi Funaba <tadf@dotrb.org>
- * hash.c (rb_hash_each): Hash#each should yield single value.
- [ruby-talk:84420]
+ * lib/date.rb (daynum): should be private.
- * hash.c (env_each): ditto for ENV.each.
+Tue Nov 23 07:22:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 23 20:25:32 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ChangeLog (change-log-indent-text): hanging indent.
- * lib/webrick/server.rb (GenericServer#start): should rescue
- IOError from IO::accept. [ruby-dev:21692]
+Tue Nov 23 06:30:51 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 23 17:59:36 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in (SITE_DIR, VENDOR_DIR),
+ version.c (ruby_initial_load_paths): exclude directories that
+ are configured without them from $LOAD_PATH. [ruby-core:33267]
- * eval.c (ruby_cleanup): initialize stack bottom for embedding.
- [ruby-dev:21686]
+ * configure.in (rubylibprefix): No ruby, No libprefix.
- * ext/dl/extconf.rb: move list of files to clean from DEPEND file,
- to get rid of macro redefinitions.
+Tue Nov 23 01:05:27 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Oct 23 13:44:00 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vsnprintf.c (BSD_vfprintf): don't output floating point
+ when the precision is 0. [ruby-dev:42615]
- * parse.y: integrate operations for stack_type. [ruby-dev:21681]
+Mon Nov 22 21:30:57 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 23 00:41:45 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * string.c (rb_str_inspect): fix for ascii-compatible external
+ encoding and different encoding string. [ruby-core:33283]
- * test/soap/calc/*, test/soap/helloworld/*: set logging threshold
- to ERROR.
+Mon Nov 22 18:45:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 22 12:53:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb (create_makefile): should not duplicate rules.
+ bug fix of r29842.
- * lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
- ignore tests which raised LoadError.
+Mon Nov 22 18:04:40 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * test/drb/drbtest.rb, test/ruby/test_beginendblock.rb,
- test/ruby/test_system.rb: avoid requiring same file twice.
+ * enc/big5.c: split CP950 from Big5.
- * test/drb/test_drbssl.rb, test/drb/test_drbunix.rb: should not use
- ARGV unless invoked directly. do not create test cases unless
- required libraries are available.
+ * enc/big5.c: split CP951 from Big5-HKSCS.
-Wed Oct 22 02:31:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * enc/trans/big5.trans: import conversion table of Big5, Big5-HKSCS,
+ CP950, and CP951 from ICU. they need fallback conversions.
+ ref [ruby-core:33256]
+ http://source.icu-project.org/repos/icu/data/trunk/charset/data/ucm/
- * eval.c (ruby_cleanup): should not ignore exit_value in END
- execution. [ruby-dev:21670]
+ * tool/transcode-tblgen.rb (import_ucm): add to import ucm files.
-Tue Oct 21 23:16:26 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon Nov 22 18:33:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (ruby_cleanup): call finalizers and exit procs before
- terminating threads.
+ * string.c (rb_str_inspect): append for each chars instead of bulk
+ copy if encoding conversion is needed. [ruby-core:33283]
- * eval.c (ruby_cleanup): preserve ruby_errinfo before ruby_finalize_0().
+Mon Nov 22 14:22:45 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Oct 21 15:57:11 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * time.c (time_zone): use rb_locale_str_new_cstr to set encoding
+ as locale and convert its content to internal encoding.
+ [ruby-core:33278]
- * lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
- prepend the directory of target file to the load path.
+Mon Nov 22 11:58:11 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Oct 21 15:08:53 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+ * string.c (rb_str_concat): set ENC_CODERANGE_VALID when the
+ receiver is 7BIT and the argument is non ASCII.
- * win32/win32.c (do_spawn, do_aspawn): should wait child process even
- if callded with P_OVERLAY.
+Mon Nov 22 01:48:58 2010 Tadayoshi Funaba <tadf@dotrb.org>
- * win32/win32.c (do_spawn, do_aspawn): should return child's exit
- status to parent.
+ * lib/date.rb: some improvements for performance.
-Tue Oct 21 00:35:02 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Sat Nov 20 07:45:50 2010 Aaron Patterson <aaron@tenderlovemaking.com>
- * test/soap/calc/*, test/soap/helloworld/*: catch the exception from
- test server thread and recover.
+ * lib/mkmf.rb: adding compilation support for ObjC/ObjC++ extensions.
+ Thanks Scott Gonyea! [ruby-core:33260]
-Tue Oct 21 00:22:57 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Sat Nov 20 01:57:55 2010 Akio Tajima <artonx@yahoo.co.jp>
- * test/drb/*: import drb/runit.
+ * common.mk: add dependency(insns.inc) to compile.obj
-Mon Oct 20 23:55:47 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Nov 19 23:05:48 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_eval): set current node after arguments evaluation.
- [ruby-dev:21632]
+ * win32/Makefile.sub (insns_rules.mk): remove extra backslash.
- * eval.c (rb_yield_0): set current node and keep it at local jump.
+ * cygwin/GNUmakefile.in, win32/Makefile.sub (clean): rc files are
+ made at compile time, so should be removed by clean.
-Mon Oct 20 22:01:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Nov 19 22:09:46 2010 Kouhei Sutou <kou@cozmixng.org>
- * eval.c (rb_thread_cleanup): keep thread group for main thread.
- [ruby-dev:21644]
+ * test/rexml/test_core.rb
+ (Tester#test_pretty_format_long_text_finite): skip a test that
+ uses long string on small memory system. [ruby-dev:42599]
-Mon Oct 20 18:28:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Nov 19 21:07:06 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_catch): backout.
+ * lib/optparse.rb: shell completion support for zsh. based on
+ <http://d.hatena.ne.jp/rubikitch/20071002/zshcomplete>
-Mon Oct 20 17:31:46 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/optparse.rb: shell completion support for bash.
- * eval.c (PUSH_FRAME): generate unique number to be TAG_JUMP()
- destination.
+Fri Nov 19 00:00:00 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (localjump_destination): use unique number in ruby_frame
- for localjump destination.
+ * cygwin/GNUmakefile.in (SCRIPTPROGRAMS): no needs on cygwin.
-Mon Oct 20 11:31:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/Makefile.sub (scriptbin): create script binaries.
- * test/ruby/test_signal.rb (test_signal): restore old trap.
+Thu Nov 18 23:21:23 2010 Kouhei Sutou <kou@cozmixng.org>
-Mon Oct 20 11:00:46 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/rexml/formatters/pretty.rb (REXML::Formatters::Pretty#wrap):
+ REXML::Formatters::Pretty#wrap used a recursive method call to
+ format text. This switches it to use an iterative approach.
+ [ruby-core:33245]
+ Patch by Jeremy Evans. Thanks!!!
- * gc.c (gc_sweep): loosen page free condition to avoid add_heap()
- race condition. [ruby-dev:21633]
+ * test/rexml/test_core.rb: add a test for it.
- * gc.c (gc_sweep): do not update malloc_limit when malloc_increase
- is smaller than malloc_limit.
+Thu Nov 18 22:58:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Oct 20 09:45:12 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+ * include/ruby/io.h (rb_io_buffer_t): extract from rb_io_t.
- * lib/debug.rb (debug_command): remove debug print.
+Thu Nov 18 07:37:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 20 00:25:41 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * Makefile.in (reconfig): force reconfigure with previous options.
- * eval.c (search_required): required name must not be changed before
- loading. [ruby-dev:24492]
+ * common.mk (showconfig): show configure flags, like as
+ `config.status --config' generated by recent autoconf.
-Sun Oct 19 13:12:30 2003 Tanaka Akira <akr@m17n.org>
+Thu Nov 18 07:16:49 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/pathname.rb (foreachline, dir_foreach): add obsolete warning.
+ * missing/langinfo.c (strncasecmp): get rid of redefinition.
-Sun Oct 19 00:14:22 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Thu Nov 18 00:02:17 2010 James Edward Gray II <jeg2@ruby-lang.org>
- * test/soap/calc/*, test/soap/helloworkd/*: changed port# of test
- server. (17171)
+ * lib/csv.rb: Upgrading output encoding with ASCII content
+ as needed. [ruby-core:33229]
-Sat Oct 18 23:01:32 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+Wed Nov 17 23:19:21 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * missing/acosh.c (DBL_MANT_DIG): typo fix(ifdef -> ifndef).
+ * win32/configure.bat: remove quotes from arguments to be quoted.
-Sat Oct 18 05:48:59 2003 why the lucky stiff <why@ruby-lang.org>
+ * lib/mkmf.rb (create_makefile): use forward slashes in messages.
- * ext/syck/rubyext.c: YAML::Syck::compile method.
+ * lib/mkmf.rb (create_makefile): make extension libraries messages
+ brief.
- * ext/syck/syck.c: Buffer edge bug.
+ * win32/Makefile.sub (MAKEDIRS): should not include silent flag.
- * ext/syck/yaml2byte.c: YAML to bytecode converter.
+ * common.mk (ext/ripper/ripper.c, ext/json/parser/parser.c): pass
+ Q and ECHO. [ruby-core:33226]
- * ext/syck/yamlbyte.h: Ditto.
+Wed Nov 17 16:09:52 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * ext/syck/bytecode.c: Bytecode parser fixes to empty collections
- and empty strings.
+ * test/test_tracer.rb: new test case.
+ minimal regression test for r29280.
- * ext/syck/token.c: Ditto.
+Wed Nov 17 16:04:23 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-Fri Oct 17 23:07:38 2003 Akinori MUSHA <knu@iDaemons.org>
+ * test/ruby/envutil.rb (Test::Unit::Assersions#assert_warn):
+ new assertion to assert that a particular warning message is
+ displayed.
+ forward port from branches/ruby_1_9_2@29795.
- * ext/enumerator/enumerator.c, ext/enumerator/enumerator.txt:
- Provide Kernel#to_enum as an alias for Kernel#enum_for. Maybe
- this is a better name.
+Wed Nov 17 15:16:48 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Oct 17 23:00:30 2003 Akinori MUSHA <knu@iDaemons.org>
+ * regint.h (OnigOpInfoType): constify name.
- * lib/generator.rb: Add rdoc documentation.
+ * regcomp.c (op2name): constify return value.
-Fri Oct 17 22:16:42 2003 Akinori MUSHA <knu@iDaemons.org>
+ * regcomp.c (onig_print_compiled_byte_code): use PRIuPTR and
+ uintptr_t to clean warnings.
- * lib/set.rb: Reword and fix Overview.
+ * regcomp.c (print_indent_tree): use PRIxPTR and intptr_t.
- * lib/set.rb: It is not necessary to require
- 'test/unit/ui/console/testrunner'.
+ * regexec.c (match_at): use PRIdPTR and intptr_t.
-Fri Oct 17 11:15:22 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Nov 17 09:49:10 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * test/ruby/test_range.rb: added.
+ * enc/shift_jis.c (property_name_to_ctype): fix memory leak.
- * MANIFEST: add test/ruby/test_range.rb.
+ * enc/euc_jp.c (property_name_to_ctype): ditto.
-Fri Oct 17 03:21:23 2003 William Sobel <will.sobel@barra.com>
+Wed Nov 17 08:54:04 2010 James Edward Gray II <jeg2@ruby-lang.org>
- * ext/socket/socket.c (make_hostent): h_aliases may be NULL.
- (ruby-bugs:PR#1195)
+ * lib/csv.rb: Upgrading output encoding as needed. [ruby-core:33135]
- * ext/socket/socket.c (sock_s_gethostbyaddr): ditto.
+Tue Nov 16 22:30:39 2010 Yusuke Endoh <mame@tsg.ne.jp>
-Fri Oct 17 00:12:41 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * vm_insnhelper.c (vm_throw): remove fear of undefined behavior :-)
+ Coverity Scan found this bug.
- * ext/tk/lib/tk.rb: (bug fix) instance variable @frame was used
- without initializing on TkComposite module.
+Tue Nov 16 09:33:00 2010 Kenta Murata <mrkn@mrkn.jp>
-Thu Oct 16 23:51:04 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/bigdecimal/lib/bigdecimal/util.rb (to_digits): avoid unused
+ variables warning, reported by Aaron Patterson.
- * ext/tk/lib/tk.rb: If $DEBUG == true and some exception is caused
- in a callback operation, Ruby/Tk shows a (verbose) backtrace
- information on the callback process.
+Tue Nov 16 06:39:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 16 17:09:19 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * pack.c (PACK_ITEM_ADJUST): return nil not result array and yield
+ values if block is given. [ruby-core:33193]
- * lib/debug.rb (DEBUGGER__::Context::debug_command): do not call
- debug_silent_eval() when $1 is not set. (ruby-bugs:PR#1194)
+Tue Nov 16 00:21:20 2010 Yusuke Endoh <mame@tsg.ne.jp>
-Thu Oct 16 16:54:57 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * regparse.c (and_cclass, or_cclass): fix memory leak. Coverity Scan
+ found this bug. [ruby-dev:42579]
- * string.c (rb_str_upto): ("a"..."a").to_a should return [].
- [ruby-core:01634]
+Tue Nov 16 00:07:32 2010 Yusuke Endoh <mame@tsg.ne.jp>
-Thu Oct 16 16:40:51 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * gc.c (assign_heap_slot): fix fear of memory leak and memory
+ violation. Coverity Scan found this bug.
- * ext/tk/lib/tk.rb:
- Add Tk::EncodedString and Tk::UTF8_String class to support
- characters using the \uXXXX escape to the UNICODE string.
+Mon Nov 15 23:54:45 2010 Yusuke Endoh <mame@tsg.ne.jp>
- * ext/tk/sample/{demos-en,demos-jp}/unicodeout.rb
- new demo-scripts (samples of Tk::UTF8_String)
+ * eval_intern.h (CHECK_STACK_OVERFLOW): it was not intended to add
+ size_t to a pointer typed VALUE*. Coverity Scan found this defect.
- * ext/tk/sample/{demos-en,demos-jp}/widget
- add entries for 'unicodeout.rb'
+Mon Nov 15 23:41:21 2010 Yusuke Endoh <mame@tsg.ne.jp>
-Thu Oct 16 08:38:06 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * compile.c (iseq_set_exception_local_table, iseq_set_local_table,
+ rb_iseq_build_from_ary): fix type inconsistency (which is benign
+ because sizeof(ID) == sizeof(ID*), though). Coverity Scan found
+ these bugs.
- * test/digest/test_digest.rb (test_eq): show failed class.
+Mon Nov 15 22:47:27 2010 Yusuke Endoh <mame@tsg.ne.jp>
- * test/ruby/test_iterator.rb (test_break, test_return_trace_func):
- test localjump destination.
+ * vm_eval.c (rb_funcall): ensure va_end after va_init_list. Coverity
+ Scan found this bug.
-Wed Oct 15 20:22:31 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Mon Nov 15 08:36:12 2010 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/soap/netHttpClient.rb: use URI::HTTP#request_uri instead of
- instance_eval('path_query'). [ruby-list:38575]
+ * lib/racc/parser.rb (do_parse, yyparse): using class eval to define
+ method and avoid __send__.
-Wed Oct 15 17:24:45 2003 URABE Shyouhei <root@mput.dip.jp>
+Mon Nov 15 06:43:48 2010 Aaron Patterson <aaron@tenderlovemaking.com>
- * lib/cgi.rb (CGI::Cookie): tiny typo fix.
+ * etc/openssl/ossl_ssl.c (ossl_ssl_get_cert): raise exception if
+ pointer is invalid. Thanks Ippei Obayashi! [ruby-dev:42573]
-Wed Oct 15 15:00:54 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Nov 14 17:57:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (ruby_run): just return FAILURE instead of parse error
- count. [ruby-list:38569]
+ * enc/Makefile.in (distclean): should not remove sources which are
+ distributed in tarball.
-Wed Oct 15 13:17:02 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Sun Nov 14 16:48:56 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/digest/digest.c (rb_digest_base_alloc): need to initialize
- buffer. [ruby-dev:21622]
+ * parse.y (parser_set_token_info): turn on/off with directives.
+ [ruby-core:25442]
-Wed Oct 15 11:23:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sun Nov 14 12:05:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * marshal.c (w_object): dump extended modules as well.
+ * io.c (argf_readlines): forward to current_file for arguments
+ check. http://twitter.com/nagachika/status/3634254856589312
- * marshal.c (r_object0): TYPE_USRMARSHAL should restore extended
- modules before invoking marshal_load. these two fixes are done
- by Masatoshi Seki <m_seki@mva.biglobe.ne.jp>.
+Sun Nov 14 08:48:06 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 15 09:30:34 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+ * win32/setup.mak (-basic-vars-, -runtime-): suppress trailing
+ space and compiler command line.
- * ext/enumerator/enumerator.c (enumerator_each): avoid VC++ warning.
+Sun Nov 14 04:22:32 2010 Alexander Zavorine <alexandre.zavorine@nokia.com>
- * ext/syck/syck.h: include stdio.h for definition of FILE.
+ * symbian/setup (config.h): Added HAVE_LABS and HAVE_LLABS to config.h.
-Wed Oct 15 08:09:07 2003 why the lucky stiff <why@ruby-lang.org>
+ * symbian/configure.bat: Changed packaging version in line with API
+ style 3 versioning.
- * ext/syck/bytecode.c: Checkin of YAML bytecode support.
+Sat Nov 13 16:37:56 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/syck/gram.c: Ditto.
+ * common.mk (showflags, help): emit messages at once.
- * ext/syck/syck.c: Ditto.
+ * win32/Makefile.sub (MSG, EOM): remove surrounding quotes by %~I.
- * ext/syck/token.c: Ditto.
+Sat Nov 13 01:31:30 2010 Akio Tajima <artonx@yahoo.co.jp>
- * ext/syck/handler.c: Ditto.
+ * win32/Makefile.sub: reorder variable End Of Message (don't display it)
- * ext/syck/handler.c: Now using 'tag' rather than 'taguri' in type URIs.
+Fri Nov 12 20:52:34 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/syck/rubyext.c: Ditto (on both counts).
+ * common.mk (showflags, help): use caret to quote leading spaces on
+ Windows.
-Wed Oct 15 05:05:53 2003 Akinori MUSHA <knu@iDaemons.org>
+ * Makefile.in, common.mk, cygwin/GNUmakefile.in, enc/depend,
+ ext/ripper/depend, lib/mkmf.rb, win32/Makefile.sub: caddle up.
- * lib/generator.rb: A new library which converts an internal
- iterator to an external iterator.
+Fri Nov 12 16:35:31 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/abbrev.rb: A new library which creates an abbreviation table
- from a list.
+ * configure.in: support C level backtrace information on FreeBSD.
+ When devel/libexecinfo is installed on FreeBSD, now ruby
+ can show C level backtrace information.
+ http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/libexecinfo/
-Wed Oct 15 04:31:51 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Fri Nov 12 09:58:30 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/tk/sample/demos-en/entry3.rb, ext/tk/sample/demos-jp/entry3.rb :
- new demo-scripts
+ * win32/setup.mak: use findstr.exe instead of find.exe, because all
+ target build platforms should have findstr.exe, and, find.exe often
+ means another command such as cygwin's.
- * ext/tk/sample/demos-en/widget, ext/tk/sample/demos-jp/widget :
- add entries for 'entry3.rb'
+Fri Nov 12 00:30:19 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 15 04:31:47 2003 Akinori MUSHA <knu@iDaemons.org>
+ * win32/Makefile.sub (config.h): need PRI_LL_PREFIX.
- * test/digest/test_digest.rb: Moved from ext/digest/test.rb.
+Thu Nov 11 23:38:32 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 15 03:53:20 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * configure.in: ANSI C-conforming const and volatile are mandatory
- * ext/tk/lib/tk.rb: fixed trouble on auto-load Tcl commands (enbug
- on the last commit).
+ * configure.in (AC_C_CONST, AC_C_INLINE, AC_C_VOLATILE): check
+ before used in other checks.
-Wed Oct 15 00:25:00 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * configure.in (RUBY_CHECK_PRINTF_PREFIX): should not break from
+ RUBY_WERROR_FLAG, so that ac_c_werror_flag gets restored.
- * parse.y (yylex): argument parentheses preceded by spaces should
- be warned; not error. [ruby-talk:84103]
+Thu Nov 11 23:04:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 15 00:20:15 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/iconv/iconv.c (warn_deprecated): show caller position.
- * ext/tcltklib/tcltklib.c: replace Tcl/Tk's vwait and tkwait to
- switch on threads smoothly and avoid seg-fault.
+Thu Nov 11 23:03:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tcltklib/tcltklib.c: add TclTkIp._thread_vwait and
- _thread_tkwait for waiting on a thread. (Because Tcl/Tk's vwait
- and tkwait command wait on an eventloop.)
+ * io.c (argf_close): untie tied io before closing.
- * ext/tk/lib/multi-tk.rb: support TclTkIp._thread_vwait and
- _thread_tkwait.
+ * io.c (argf_write): add ARGF.write and so on.
- * ext/tk/lib/tk.rb: now, TkVariable#wait has 2 arguments.
- If 1st argument is true, waits on a thread. If false, waits on
- an eventloop. If 2nd argument is true, checks existence of
- rootwidgets. If false, doesn't. Default is wait(true, false).
+ * io.c (argf_read_nonblock): add ARGF.read_nonblock.
- * ext/tk/lib/tk.rb: add TkVariable#tkwait(arg) which is equal to
- TkVariable#wait(arg, true). wait_visibility and wait_destroy
- have an argument for waiting on a thread or an eventloop.
+Thu Nov 11 21:49:06 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/tk.rb: improve of accessing Tcl/Tk's special variables.
+ * lib/rdoc/stats.rb (RDoc#print): get rid of NaN.
- * ext/tk/lib/tkafter.rb: support 'wait on a thread' and 'wait on
- an eventloop'.
+Thu Nov 11 21:47:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 15 00:10:24 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * common.mk (SHOWFLAGS): show compile flags.
- * lib/soap/baseData.rb: Introduce SOAPType as the common ancestor of
- SOAPBasetype and SOAPCompoundtype.
+ * common.mk: hide long command lines by default. verbose-mode is
+ turned on by V=1 as before.
+ http://jarp.does.notwork.org/diary/200605b.html#200605121
- * lib/soap/generator.rb, lib/soap/element.rb, lib/soap/encodingstyle/*:
- Encoding methods signature change. Pass SOAPGenerator as a parameter.
+Thu Nov 11 21:32:09 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/soap/mapping/*, test/soap/marshal/test_marshal.rb: Refactoring
- for better marshalling/unmarshalling support. Now I think SOAP
- marshaller supports all kind of object graph which is supported by
- Ruby's original marshaller. Of course there could be bugs as always.
- Find it. :-)
+ * lib/mkmf.rb (try_func): accept variable address.
- * lib/soap/rpc/standaloneServer.rb: Set severity threshould to INFO.
- DEBUG is too noisy.
+ * ext/win32ole/extconf.rb: libuuid is needed on cygwin.
- * lib/xsd/datatypes.rb: DateTime#of is obsoleted. Use DateTime#offset.
+Thu Nov 11 21:24:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/wsdl/emptycomplextype.wsdl, test/xsd/xmlschema.xml: Avoid
- useless warning.
+ * file.c (file_expand_path): use cygwin_conv_path on cygwin 1.7 or
+ later.
-Tue Oct 14 19:09:35 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c (push_include_cygwin): ditto.
- * eval.c (ruby_finalize_0): return the given exit status unless
- SystemExit got raised.
+Thu Nov 11 20:49:48 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Oct 14 11:53:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * include/ruby/ruby.h (PRI_LL_PREFIX): format type specifier for
+ LONG_LONG may vary on platforms.
- * intern.h (ruby_stop): never return.
+Thu Nov 11 20:45:23 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ruby.h (ruby_run): ditto.
+ * configure.in (SYMBOL_PREFIX): separate from EXPORT_PREFIX.
-Tue Oct 14 04:43:55 2003 Tanaka Akira <akr@m17n.org>
+ * win32/mkexports.rb (Exports#each_export): use SYMBOL_PREFIX.
- * lib/pathname.rb (realpath): make ELOOP check bit more robust.
- (children): prepend self by default.
- (chroot): obsoleted.
+Wed Nov 10 07:20:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Oct 14 02:29:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * cygwin/GNUmakefile.in (scriptbin): make executable file from
+ scripts with stub.
- * eval.c (rb_require_safe): segfault after loading .so.
+ * ruby.c (load_file_internal): assume xflag for exe file as well
+ as no-shebang file.
-Tue Oct 14 02:05:23 2003 Akinori MUSHA <knu@iDaemons.org>
+ * tool/rbinstall.rb: install script programs.
- * ext/Setup*, ext/enumerator/*: Add ext/enumerator, a helper
- module for the Enumerable interface.
+ * win32/mkexports.rb (Exports#initialize): alias ruby_sysinit for
+ stub.
-Mon Oct 13 23:55:59 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * win32/stub.c: stub for scripts. [EXPERIMENTAL]
- * test/ruby/envutil.rb: use Config::CONFIG["ruby_install_name"],
- not "ruby".
+Tue Nov 9 21:57:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Oct 13 23:57:29 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * dln.c (init_funcname): allocate and build initialization
+ funciton name at once.
- * eval.c (rb_feature_p): match by classified suffix.
+Tue Nov 9 21:14:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_require_safe): require library in the specified safe
- level.
+ * configure.in (AC_FUNC_GETPGRP, AC_FUNC_SETPGRP): no need when
+ not used.
- * variable.c (rb_autoload, rb_autoload_load): restore safe level
- when autoload was called. [ruby-dev:21338]
+ * configure.in (EXPORT_PREFIX): check generic prefix.
- * intern.h: prototypes; rb_require_safe.
+Tue Nov 9 13:24:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * test/runner.rb: accept non-option arguments.
+ * regenc.c (onigenc_minimum_property_name_to_ctype):
+ \p{...} should be case insensitive. [ruby-core:33000]
-Mon Oct 13 20:49:51 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * regenc.c (onigenc_property_list_add_property):
+ ditto.
- * string.c (str_new4): should not preserve FL_TAINT status in the
- internal shared string. [ruby-dev:21601]
+ * enc/euc_jp.c (init_property_list, property_name_to_ctype):
+ to lowercase property names.
- * string.c (rb_str_new4): ditto.
+ * enc/shift_jis.c (init_property_list, property_name_to_ctype):
+ ditto.
- * eval.c: use EXIT_SUCCESS and EXIT_FAILURE for exit values.
+Tue Nov 9 13:29:36 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * process.c: ditto. [ruby-list:38521]
+ * win32/win32.c (overlapped_socket_io): get rid of a warning of 64bit
+ mingw.
-Mon Oct 13 19:51:02 2003 Koji Arai <jca02266@nifty.ne.jp>
+Tue Nov 9 10:44:19 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/debug.rb (debug_command): should enter emacs mode when
- assigned any value to the environment variable "EMACS".
- On Meadow, (getenv "EMACS") is "meadow".
+ * util.c (ruby_strtod): this code uses FPU's rounding system.
+ But x86's FPU calculates double precision floating-point
+ numbers in 80bit precision, so it fails to round the value.
+ So ensure the value is assigned a variable. [ruby-dev:42551]
+ see also [ruby-math:00802]
+ http://www.shudo.net/java-grandprix99/strictfp/
-Sun Oct 12 14:45:03 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+Tue Nov 9 07:30:15 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/win32ole/extconf.rb: check "windows.h", not "windows".
- [ruby-talk:84051]
+ * error.c (rb_syserr_new): new function to make SystemCallError
+ instance without errno. [EXPERIMENTAL]
-Sat Oct 11 20:41:03 2003 Corinna Vinschen <corinna@vinschen.de>
+ * error.c (rb_syserr_fail, rb_mod_syserr_fail): ditto.
- * file.c (eaccess): Use access(2) on Cygwin.
+Tue Nov 9 05:54:57 2010 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-Sat Oct 11 17:09:21 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * lib/*.rb: Remove unused variable warnings.
+ Patch by Run Paint [ruby-core:30991]
- * lib/rexml/quickpath.rb (REXML::QuickPath::match):
- escape '[' to avoid warning.
+ * lib/rubygems/*, lib/rdoc/*.rb, lib/rake/*.rb: ditto
-Sat Oct 11 16:08:41 2003 Tanaka Akira <akr@m17n.org>
+Mon Nov 8 18:26:03 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/pathname.rb (realpath): check existence of the file.
+ * util.c (ruby_hdtoa): fix type cast and bufsize.
- * lib/pathname.rb (realpath): re-implemented.
- (realpath_root?, realpath_rec): removed
+Mon Nov 8 15:40:56 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Sat Oct 11 10:19:39 2003 Shugo Maeda <shugo@ruby-lang.org>
+ * vsnprintf.c (BSD_vfprintf): fix precision specifier doesn't
+ work well on %f. [ruby-dev:42552]
- * lib/monitor.rb: handle exceptions correctly. Thanks, Gennady
- Bystritsky.
+Mon Nov 8 14:41:40 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Oct 10 07:50:54 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/win32.c (get_wsa_extension_function): typos.
- * eval.c (is_defined): inheritance line adjustment as like as
- rb_call_super().
+Mon Nov 8 13:41:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Oct 10 01:19:00 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * tool/enc-unicode.rb,
+ enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
+ enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
+ Add Age property to regexp. [ruby-core:33019]
+ patched by Ammar Ali, tested by Run Paint Run Run
- * ext/openssl/ossl_x509name.c (ossl_x509name_initialize): add
- optional argument to specify the DirectoryString type
- (ASN1::UTF8STRING by default). RFC3280 deprecates PrintableString
- for DirectoryString, and strongly requires to use UTF8String for
- all certificates issued after December, 31 2003.
+Mon Nov 8 12:16:39 2010 Ben Walton <bwalton@artsci.utoronto.ca>
- * ext/openssl/lib/openssl/x509.rb (X509::Name::parse): ditto.
+ * configure.in: support -h for solaris linker when gcc not used
-Thu Oct 9 23:50:21 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Nov 8 11:47:39 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * eval.c (rb_thread_start_0): prevent thread from GC.
- [ruby-dev:21572]
+ * win32/win32.c (finish_overlapped_socket): refactoring.
-Thu Oct 9 19:11:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Nov 8 11:02:21 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * eval.c (rb_thread_start_0): non-volatile should be restored from
- volatile.
+ * win32/win32.c (get_proc_address): refactoring.
-Thu Oct 9 17:43:36 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/win32.c (get_wsa_exetinsion_function): refactoring.
- * eval.c (proc_save_safe_level, proc_get_safe_level,
- proc_set_safe_level): save/restore safe level 1..4.
+Mon Nov 8 09:45:35 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Oct 9 16:33:23 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * enc/trans/gbk-tbl.rb: Add euro sign. [ruby-core:33094]
+ CP936, which is de facto definition of GBK, has it.
+ http://msdn.microsoft.com/en-us/goglobal/cc305153.aspx
- * marshal.c (r_object0): remove unnecessary iv restoration for
- USRMARSHAL. [ruby-dev:21582]
+Mon Nov 8 07:26:20 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * marshal.c (w_object): dump generic instance variables from
- a string from '_dump'.
+ * configure.in: check only the first symbol to get rid of
+ duplication. [ruby-core:33084] #4031
- * variable.c (rb_generic_ivar_table): return 0 if obj's FL_EXIVAR
- is not set.
+Sun Nov 7 10:13:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * time.c (time_dump): copy instance variables to dumped string, to
- be included in the marshaled data.
+ * configure.in (NM): check on all platforms. #4031
- * bignum.c (rb_big2ulong): add range check to ensure round trip.
+Sun Nov 7 06:16:33 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-Thu Oct 9 15:45:27 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/openssl/test_ocsp.rb: adding test for r29699. Thanks Elise
+ Huard! [ruby-core:32460]
- * pack.c (uv_to_utf8): change message to "out of range", since
- negative values are not "too big". [ruby-dev:21567]
+Sat Nov 6 07:33:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 9 14:05:38 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in (rb_cv_export_prefix): check for prefixed
+ underscore of exported symbols
- * eval.c (rb_set_end_proc, rb_exec_end_proc): restore safe level.
- [ruby-dev:21557]
+ * tool/rbinstall.rb (bin-comm): prepend prolog shell script if
+ necessary.
-Thu Oct 9 10:51:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in (LIBRUBY_RELATIVE): use rpath token expansion.
- * eval.c (rb_yield_0): no error if block is empty.
+Sat Nov 6 07:24:01 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 9 06:43:33 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * template/ruby.pc.in (arch, sitearch): reordered.
- * eval.c (localjump_error): id should be ID.
+ * configure.in: keep failed file.
- * eval.c (rb_eval): nd_rval is set in copy_node_scope().
+Sat Nov 6 07:03:49 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_yield_0): unused variable.
+ * process.c (rb_fork_err): save errinfo before fdopen.
- * eval.c (rb_yield_0): nothing to do for empty node.
+Sat Nov 6 00:43:58 2010 Aaron Patterson <aaron@tenderlovemaking.com>
- * eval.c (call_end_proc, proc_invoke): adjust backtrace in END.
- [ruby-dev:21551]
+ * ext/openssl/ossl_ocsp.c (ossl_ocspcid_initialize): an optional
+ parameter may be used to specify the OpenSSL::OCSP::CertificateId on
+ initialization. Thanks Elise Huard! [ruby-core:32460]
- * eval.c (rb_thread_start_0): set the value by break as the result.
- [ruby-dev:21552]
+Fri Nov 5 12:23:01 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_thread_start_0, rb_thread_raise, rb_callcc): save
- variables across THREAD_SAVE_CONTEXT.
+ * test/ruby/test_{process,system}.rb (test_fallback_to_sh):
+ meaningless and wrong tests where /bin/sh does not exist.
-Thu Oct 9 12:05:46 2003 Eric Sunshine <sunshine@sunshineco.com>
+ * process.c (proc_spawn_v): should spawn, not exec.
- * configure.in: revived NextStep, OpenStep, and Rhapsody ports which
- had become unbuildable; enhanced --enable-fat-binary option so that
- it accepts a list of desired architectures (rather than assuming a
- fixed list), or defaults to a platform-appropriate list if user does
- not provide an explicit list; made the default list of architectures
- for MAB (fat binary) more comprehensive; now uses -fno-common even
- when building the interpreter (in addition to using it for
- extensions), thus allowing the interpreter to be embedded into a
- plugin module of an external project (in addition to allowing
- embedding directly into an application); added checks for
- <netinet/in_systm.h> (needed by `socket' extension) and getcwd(); now
- ensures that -I/usr/local/include is employed when extensions'
- extconf.rb scripts invoke have_header() since extension checks on
- NextStep and OpenStep will fail without it if the desired resource
- resides in the /usr/local tree; fixed formatting of --help message.
+Fri Nov 5 01:21:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * Makefile.in: $(LIBRUBY_A) rule now deletes the archive before
- invoking $(AR) since `ar' on Apple/NeXT can not "update" MAB archives
- (see configure's --enable-fat-binary option); added rule for new
- missing/getcwd.c.
+ * process.c (proc_exec_v, proc_spawn_v): try to execute with sh if
+ no shebang. [ruby-core:32745] [EXPERIMENTAL]
- * defines.h: fixed endian handling during MAB build (see configure's
- --enable-fat-binary option) to ensure that all portions of the
- project see the correct WORDS_BIGENDIAN value (some extension modules
- were getting the wrong endian setting); added missing constants
- GETPGRP_VOID, WNOHANG, WUNTRACED, X_OK, and type pid_t for NextStep
- and OpenStep; removed unnecessary and problematic HAVE_SYS_WAIT_H
- define in NeXT section.
+Fri Nov 5 00:39:00 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * dir.c: do not allow NAMLEN() macro to trust dirent::d_namlen on
- NextStep since, on some installations, this value always resolves
- uselessly to zero.
+ * io.c (rb_io_readlines, rb_io_each_line): limit must not be zero.
+ a patch from Tomoyuki Chikanaga at [ruby-dev:42538]. #4024
- * dln.c: added error reporting to NextStep extension loader since the
- previous behavior of failing silently was not useful; now ensures
- that NSLINKMODULE_OPTION_BINDNOW compatibility constant is defined
- for OpenStep and Rhapsody; no longer includes <mach-o/dyld.h> twice
- on Rhapsody since this header lacks multiple-include protection,
- which resulted in "redefinition" compilation errors.
+Fri Nov 5 00:14:15 2010 Aaron Patterson <aaron@tenderlovemaking.com>
- * main.c: also create hard reference to objc_msgSend() on NeXT
- platforms (in addition to Apple platforms).
+ * ext/fiddle/extconf.rb: fixing ffi library location on windows.
+ Thanks Usa! [ruby-core:32930]
- * lib/mkmf.rb: now exports XCFLAGS from configure script to extension
- makefiles so that extensions can be built MAB (see configure's
- --enable-fat-binary option); also utilize XCFLAGS in cc_command()
- (but not cpp_command() because MAB flags are incompatible with
- direct invocation of `cpp').
+Thu Nov 4 20:04:44 2010 Koichi Sasada <ko1@atdot.net>
- * ext/curses/extconf.rb: now additionally checks for presence of these
- curses functions which are not present on NextStep or Openstep:
- bkgd(), bkgdset(), color(), curs(), getbkgd(), init(), scrl(), set(),
- setscrreg(), wattroff(), wattron(), wattrset(), wbkgd(), wbkgdset(),
- wscrl(), wsetscrreg()
+ * gc.c (rb_newobj): force garbage_collect() if GC.stress == true.
- * ext/curses/curses.c: added appropriate #ifdef's for additional set of
- curses functions now checked by extconf.rb; fixed curses_bkgd() and
- window_bkgd() to correctly return boolean result rather than numeric
- result; fixed window_getbkgd() to correctly signal an error by
- returning nil rather than -1.
+Thu Nov 4 19:48:22 2010 Koichi Sasada <ko1@atdot.net>
- * ext/etc/etc.c: setup_passwd() and setup_group() now check for null
- pointers before invoking rb_tainted_str_new2() upon fields extracted
- from `struct passwd' and `struct group' since null pointers in some
- fields are common on NextStep/OpenStep (especially so for the
- `pw_comment' field) and rb_tainted_str_new2() throws an exception
- when it receives a null pointer.
+ * ChangeLog: missed to write a last ChangeLog.
- * ext/pty/pty.c: include "util.h" for strdup()/ruby_strdup() for
- platforms such as NextStep and OpenStep which lack strdup().
+ * gc.c (gc_finalize_deferred): removed.
- * ext/socket/getaddrinfo.c: cast first argument of getservbyname(),
- gethostbyaddr(), and gethostbyname() from (const char*) to non-const
- (char*) for older platforms such as NextStep and OpenStep.
+ * gc.c (rb_gc_finalize_deferred): Do not invoke a free_unused_heaps().
- * ext/socket/socket.c: include "util.h" for strdup()/ruby_strdup() for
- platforms such as NextStep and OpenStep which lack strdup(); include
- <netinet/in_systm.h> if present for NextStep and OpenStep; cast first
- argument of gethostbyaddr() and getservbyname() from (const char*) to
- non-const (char*) for older platforms.
+Thu Nov 4 19:45:27 2010 Koichi Sasada <ko1@atdot.net>
- * ext/syslog/syslog.c: include "util.h" for strdup()/ruby_strdup() for
- platforms such as NextStep and OpenStep which lack strdup().
+ * gc.c (run_final): do not need argument obj.
-Wed Oct 8 22:19:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+Thu Nov 4 19:26:10 2010 Koichi Sasada <ko1@atdot.net>
- * lib/test/unit.rb: removed installation instructions.
+ * gc.c (before_gc_sweep): fix commit miss.
- * lib/test/unit/ui/testrunnermediator.rb: moved the run flag to a more
- central location.
+Thu Nov 4 19:20:46 2010 Koichi Sasada <ko1@atdot.net>
- * lib/test/unit.rb: ditto.
+ * gc.c (after_gc_sweep, before_gc_sweep):
+ invoke rb_sweep_method_entry() as soon as possible.
- * lib/test/unit.rb: extracted the running code in to AutoRunner.
+Thu Nov 4 19:13:58 2010 Koichi Sasada <ko1@atdot.net>
- * lib/test/unit/autorunner.rb: added.
+ * gc.c (after_gc_sweep, slot_sweep): finalizers should be invoked
+ as soon as possible.
- * lib/test/unit/collector/objectspace.rb: extracted common test
- collection functionality in to a module.
+Thu Nov 4 10:30:40 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
- * lib/test/unit/collector.rb: ditto; added.
+ * configure.in (--with-valgrind): Now this option is default on.
+ You can still explicitly disable this feature by specifying
+ --without-valgrind.
- * test/testunit/collector/test_objectspace.rb: ditto.
+Thu Nov 4 02:06:16 2010 Yusuke Endoh <mame@tsg.ne.jp>
- * lib/test/unit/collector/dir.rb: added. Supports collecting tests out
- of a directory structure.
+ * cont.c (fiber_t_alloc): raise an error when fiber is going to be
+ initialized twice. [ruby-dev:42524]
- * test/testunit/collector/test_dir.rb: added.
+Thu Nov 4 02:04:25 2010 Yusuke Endoh <mame@tsg.ne.jp>
- * test/runner.rb: simplified to use the new capabilities.
+ * cont.c (rb_fiber_resume): raise an "double resume" error when root
+ fiber is going to be resumed. [ruby-dev:42523]
-Tue Oct 7 15:23:09 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Wed Nov 3 14:17:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_beginendblock.rb: add tests for nested BEGIN/END.
+ * lib/ostruct.rb (OpenStruct#delete_field): also undefine
+ accessor methods. [ruby-core:33010]
- * test/ruby/beginmainend.rb: add tests for nested BEGIN/END.
+Wed Nov 3 14:13:46 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/endblockwarn.rb: new file added to test of END-in-method
- warning.
+ * string.c (rb_enc_cr_str_buf_cat): concatenation of valid
+ encoding string and invalid encoding string should result
+ invalid encoding. [ruby-core:33027]
-Tue Oct 7 12:23:47 2003 Tanaka Akira <akr@m17n.org>
+Wed Nov 3 08:58:59 2010 Koichi Sasada <ko1@atdot.net>
- * ext/fcntl/fcntl.c (Init_fcntl): define Fcntl::O_ACCMODE.
+ * gc.c, vm.c, vm_core.h: remove USE_VALUE_CACHE option.
- * ext/socket/extconf.rb: useless assignment removed.
+Wed Nov 3 07:47:25 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Oct 7 09:13:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/irb/ruby-lex.rb (RubyLex#identify_string): parse multiple
+ regex options. a patch from Heesob Park in [ruby-core:32988].
- * test/ruby/test_beginendblock.rb (test_endinmethod): END{} is now
- allowed in eval.
+Wed Nov 3 07:33:57 2010 Tanaka Akira <akr@fsij.org>
-Tue Oct 7 04:15:25 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vm_method.c (rb_clear_cache_by_class): just return if the class has
+ no method. reported by Eric Wong. [ruby-core:32689]
- * parse.y (stmt): should not expand mrhs if lhs is solely starred.
+Tue Nov 2 22:50:25 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-Tue Oct 7 02:57:53 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/psych/lib/psych/visitors/visitor.rb (initialize): push accessor
+ methods to subclass that actually uses them.
- * parse.y (stmt): rhs of multiple assignment should not be
- expanded using "to_a". [ruby-dev:21527]
+Tue Nov 2 22:47:08 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-Tue Oct 7 01:42:34 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/psych/lib/psych/visitors/visitor.rb (accept): switch to
+ a dispatch cache rather than case / when statement.
- * ext/openssl/ossl_asn1.c (ossl_asn1_get_asn1type): use appropriate
- free function for ASN1_OBJECT.
+Tue Nov 2 21:46:52 2010 Kouhei Sutou <kou@cozmixng.org>
- * ext/openssl/ossl_asn1.c (ossl_asn1obj_get_sn): add new function for
- ASN1::ObjectId#sn; it returns short name text representation of OID.
+ * NEWS: fix a typo.
- * ext/openssl/ossl_asn1.c (ossl_asn1obj_get_ln): add new function for
- ASN1::ObjectId#ln; it returns long name text representation of OID.
+Tue Nov 2 20:10:32 2010 Tajima Akio <artonx@yahoo.co.jp>
- * ext/openssl/ossl_asn1.c (ossl_asn1obj_get_oid): add new function for
- ASN1::ObjectId#oid; it returns numerical representation of OID.
+ * test/rake/test_tasks.rb: clear env var which is used by the test.
+ [ruby-dev:42508]
-Mon Oct 6 22:59:46 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Tue Nov 2 00:25:54 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/csv.rb (IOReader, BasicWriter): call binmode when a given IO
- respond_to?(:binmode). record separator was wrong when you gave
- text mode IO to Reader.parse and Writer.generate.
+ * ext/socket/extconf.rb: win64 is just same with win32 about socket.
+ notice: but wince is not same.
- * test/csv/test_csv.rb: add tests for above change.
+Mon Nov 1 21:25:57 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-Sun Oct 5 23:27:09 2003 Tanaka Akira <akr@m17n.org>
+ * main.c: <stdlib.h> is needed, to introduce the getenv(3)
+ prototype declaration. Without it a C compiler shall infer
+ the getenv type as "int getenv(...);", but this is totally
+ wrong, especially when your machine's sizeof(int) and
+ sizeof(char*) differs. On such environment a return value
+ of getenv(3), which is in fact a char*, might first casted
+ into a int (loses data here), and then casted back to char*
+ by automatic integral promotion to fit to the prototype of
+ ruby_set_debug_option().
- * ext/socket/extconf.rb: check recvmsg even if sendmsg is exists.
+Sun Oct 31 23:27:09 2010 Koichi Sasada <ko1@atdot.net>
- * ext/socket/socket.c (thread_read_select): restored.
+ * gc.c (finalizer_table, objspace->final.table):
+ Create finalizer_table at Init_heap().
+ Remove all null checks of finalizer_table.
-Mon Oct 6 16:23:38 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * gc.c (mark_tbl): skip if no table entries.
- * marshal.c (w_object): wrong method name in the message.
+ * gc.c (slot_swee): remove useless need_call_final check.
-Mon Oct 6 16:02:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sun Oct 31 22:32:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * parse.y (stmt): END in method should cause warning.
- [ruby-dev:21519]
+ * gc.c (rb_objspace_free): finalizers should be called separately
+ from freeing objspace. [ruby-dev:42479]
-Mon Oct 6 15:17:23 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Sun Oct 31 22:24:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_iterator.rb (test_block_argument_without_paren):
- added. (follows sample/test.rb)
+ * eval.c (ruby_cleanup): free current VM and its objspace even
+ when exiting by SystemExit.
-Mon Oct 6 11:57:06 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Sun Oct 31 22:10:56 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: added
- test for eval-ed BEGIN END order.
+ * compile.c (new_child_iseq): adjust argument types.
-Mon Oct 6 09:19:54 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * iseq.c (prepare_iseq_build, rb_iseq_new),
+ (rb_iseq_new_with_bopt_and_opt, rb_iseq_new_with_opt),
+ (rb_iseq_new_with_bopt): ditto.
- * marshal.c (w_object): should pass "weak" value to next level.
- [ruby-dev:21496]
+ * compile.c (iseq_set_exception_table): suppress warnings.
- * eval.c (proc_alloc): should not use cached object if klass is
- different. [ruby-talk:83685]
+ * insns.def (putspecialobject, defined): ditto.
-Sun Oct 5 23:27:09 2003 Tanaka Akira <akr@m17n.org>
+ * iseq.c (iseq_load): ditto.
- * lib/pathname.rb: version information is added in document.
+Sun Oct 31 09:30:51 2010 Koichi Sasada <ko1@atdot.net>
-Sun Oct 5 23:07:03 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vm_core.h: some refactoring.
+ - move decl. of rb_compile_option_struct to iseq.h.
+ - define enum iseq_type.
+ - define enum vm_special_object_type.
- * eval.c (rb_f_END): block should be given. [ruby-dev:21497]
+ * compile.c: some refactoring.
+ - apply above changes.
+ - (struct iseq_link_element): change value of type.
+ - remove unused decl.
+ - fix comment.
+ - rename iseq_build_body and iseq_build_exception to
+ iseq_build_from_ary_body and iseq_build_from_ary_exception.
-Sun Oct 5 22:51:23 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * iseq.h: define enum catch_type and enum defined_type.
- * lib/ext/openssl/extconf.rb: add check for some engine functions
- unavailable in OpenSSL-0.9.6.
+ * insns.def: apply above changes.
- * lib/ext/openssl/ossl_engine.c: ditto.
+ * iseq.c: define ISEQ_MAJOR_VERSION and ISEQ_MINOR_VERSION.
-Sun Oct 5 17:56:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Oct 30 23:38:59 2010 Kouhei Sutou <kou@cozmixng.org>
- * eval.c (rb_eval): fix evaluation order. [ruby-list:38431]
+ * lib/rexml/encoding.rb: untabify.
-Sun Oct 5 15:05:06 2003 akira yamada <akira@ruby-lang.org>
+Sat Oct 30 21:06:37 2010 Kouhei Sutou <kou@cozmixng.org>
- * test/uri/*: translated RUNIT to Test::Unit.
+ * lib/rexml/encoding.rb: use Ruby native encoding mechanism.
+ [ruby-dev:42464]
+ * lib/rexml/encodings/: remove.
-Sun Oct 5 14:37:39 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * lib/rexml/document.rb, lib/rexml/formatters/default.rb,
+ lib/rexml/output.rb, lib/rexml/parseexception.rb,
+ lib/rexml/parsers/baseparser.rb, lib/rexml/source.rb,
+ lib/rexml/xmldecl.rb: use Ruby's native Encoding object.
- * lib/xsd/datatypes.rb: Rational -> Decimal string bug fix.
+ * test/rexml/, test/rss/: follow the above encoding changes.
- * test/soap/marshal/test_marshal.rb: ditto.
+ * NEWS: add REXML's incompatible change about encoding.
- * test/soap/calc/test_calc_cgi.rb: add Config::CONFIG["EXEEXT"] to
- RUBYBIN.
+Sat Oct 30 17:23:19 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Oct 5 13:47:22 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * util.c (ruby_strtod): get rid of overflow/underflow as possible.
- * test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: add tests
- about scope, order and allowed syntax.
+Sat Oct 30 14:37:39 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Oct 5 11:54:29 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * configure.in (ruby_pc): erase runtime-defined variables and
+ check if generated pc file is valid.
- * test/ruby/envutil.rb: added. split "rubybin" from test_system.rb.
+ * template/ruby.pc.in (DEFFILE): need for mingw.
- * test/ruby/test_system.rb: use envutil.rb
+ * template/ruby.pc.in (LIBRUBY): fix the order.
- * test/ruby/test_beginendblock.rb: added.
+Sat Oct 30 11:33:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/beginmainend.rb: added. used in test_beginendblock.rb.
+ * win32/Makefile.sub (ruby_pc): ignore missing variables.
-Sun Oct 5 11:23:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * template/ruby.pc.in: add missing variables for mswin.
- * test/testunit/runit/test_testresult.rb: removed some unnecessary
- cruft.
+Sat Oct 30 10:24:35 2010 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-Sun Oct 5 11:14:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * object.c: Make BasicObject.new accept no parameter.
+ Revert of r26135 [ruby-core:27080], as per [ruby-core:32952].
- * lib/rubyunit.rb: aliasing TestCase into the top level is
- problematic.
+Sat Oct 30 09:40:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/runit/assert.rb: fixed a couple of bugs caused by recent
- refactoring in Test::Unit.
+ * enum.c: use constants in id.h.
- * test/testunit/runit/*: added.
+Sat Oct 30 09:08:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Oct 5 10:55:29 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/fiddle/closure.c (fiddle_closure): embed cif not reference
+ so that the content surely get initialized. [ruby-dev:42480]
- * lib/open-uri.rb (URI::Generic#find_proxy): no_proxy support did not
- work. [ruby-dev:21484]
+Sat Oct 30 07:01:53 2010 Tanaka Akira <akr@fsij.org>
-Sun Oct 5 09:52:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * lib/resolv-replace.rb: suppress warning.
- * lib/test/unit/assertions.rb: will use pp for output if available.
- Can be disabled by setting Assertions.use_pp = false.
+ * lib/open-uri.rb: ditto.
- * test/testunit/test_assertions.rb: made a small change to exception
- formatting.
+Sat Oct 30 06:32:52 2010 Tanaka Akira <akr@fsij.org>
-Sun Oct 5 07:42:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * test/pathname/test_pathname.rb (TestPathname#test_grpowned?): the
+ group of the created file is inherited from the parent
+ directory on BSDs and MacOS X. Linux also inherit the group if
+ the setgid bit of the directory is set. It causes the test fail.
+ fixed by Shota Fukumori. [ruby-dev:42458]
- * lib/test/unit/assertions.rb: made small improvements to assertion
- messages. Deprecated Assertions#assert_not_nil; use #assert instead.
+Sat Oct 30 05:58:54 2010 Tanaka Akira <akr@fsij.org>
- * test/testunit/test_assertions.rb: ditto.
+ * lib/resolv.rb: retry via TCP if UDP reply is truncated.
+ fixed by Julian Mehnle. [ruby-core:32407]
- * test/testunit/util/test_procwrapper.rb: use #assert instead of
- #assert_not_nil.
+Sat Oct 30 00:35:13 2010 Koichi Sasada <ko1@atdot.net>
-Sun Oct 5 04:10:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * iseq.c (iseq_s_compile): fix optional argument.
+ a patch from Yutaka HARA [ruby-core:32953] [Ruby 1.9-Bug#4001]
- * lib/test/unit/assertions.rb: refactored message building.
+Sat Oct 30 00:24:42 2010 Koichi Sasada <ko1@atdot.net>
-Sun Oct 5 03:40:22 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/objspace/objspace.c (memsize_of): take care of
+ T_CLASS/const_tbl.
+ a patch from nagachika <nagachika00@gmail.com> [ruby-dev:42490]
- * ext/openssl/ossl_asn1.h: global symbols should be declared
- as external.
+Fri Oct 29 23:32:36 2010 Koichi Sasada <ko1@atdot.net>
-Sun Oct 5 03:03:20 2003 akira yamada <akira@ruby-lang.org>
+ * test/profile_test_all.rb: added.
+ You can use test-all profiler with the following command:
+ RUBY_TEST_ALL_PROFILE=true make test-all
+ This command generates ./test_all_profile and you can analyze
+ which tests consume memories.
- * test/ruby/test_exception.rb (test_else): added.
+ * test/runner.rb: ditto.
-Sun Oct 5 02:12:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+Fri Oct 29 10:02:03 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/test/unit/assertions.rb: changed assertion messages to rely more
- heavily on #inspect. Added backtrace filtering for exceptions in
- assertion messages.
+ * tool/enc-unicode.rb,
+ enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
+ enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
+ Add 'Unknown' Script.
+ patched by Run Paint Run Run. [ruby-core:32937] #3998
- * test/testunit/test_assertions.rb: ditto.
+Fri Oct 29 05:13:34 2010 Koichi Sasada <ko1@atdot.net>
-Sun Oct 5 02:12:00 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * ext/objspace/objspace.c (ObjectSpace.memsize_of_all): rename
+ ObjectSpace.total_memsize_of_all_objects() to
+ ObjectSpace.memsize_of_all([klass]).
+ Accept Class object to filter the objects.
- * lib/drb/acl.rb, lib/drb/ssl.rb: added.
+ * test/objspace/test_objspace.rb: fix test for above change.
- * lib/drb/drb.rb: exit from a thread using 'break'.
+Fri Oct 29 03:04:16 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Oct 4 21:49:14 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * string.c (rb_str_dump): fix expected length. [ruby-core:32935]
- * gc.c (Init_stack): the type of space is changed to unsigned int
- from double. [ruby-dev:21483]
+Thu Oct 28 23:31:39 2010 Koichi Sasada <ko1@atdot.net>
-Sat Oct 4 17:52:59 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * gc.c (before_gc_sweep, run_final): fix decrement timing of final_num.
- * lib/soap/netHttpClient.rb: follow http-access2. hosts which matches
- ENV['no_proxy'] or ENV['NO_PROXY'] are not proxyed.
- - [,:] separated. ("ruby-lang.org:rubyist.net")
- - no regexp. (give "ruby-lang.org", not "*.ruby-lang.org")
- - if you want specify host by IP address, give full address.
- ("192.168.1.1, 192.168.1.2")
+Thu Oct 28 20:11:30 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/soap/rpc/cgistub.rb: return "Status: XXX MMM" line.
+ * tool/enc-unicode.rb,
+ enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
+ enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
+ Update Oniguruma for Unicode 6.
+ patched by Run Paint Run Run. [ruby-core:32923] #3989
- * test/runner.rb: give testsuite name.
+Thu Oct 28 20:06:25 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Sat Oct 4 15:16:02 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * include/ruby/oniguruma.h (ONIGENC_CTYPE_SPECIAL_MASK):
+ change mask from 128 to 256. [ruby-core:32931]
- * marshal.c (w_object): instance variable dump do not cause error
- for objects that cannot be dumped, if they traversed from
- marshal_dump. they are just ignored.
+Thu Oct 28 12:06:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * gc.c (Init_stack): cast "space" (doble value) into unsigned
- int. should run on PowerPC.
+ * lib/webrick/httprequest.rb (read_request_line): extend max
+ length to 2083. This is from Internet Explorer's max uri
+ length. http://support.microsoft.com/kb/208427 [ruby-core:32924]
- * eval.c (rb_eval): should not execute else part if any exception
- is caught. [ruby-dev:21482]
+Thu Oct 28 04:00:08 2010 Koichi Sasada <ko1@atdot.net>
- * parse.y (f_args): should allow unparenthesized block argument.
+ * gc.c (GC.stat): added. [ruby-dev:38607]
- * parse.y (f_rest_arg): should allow unparenthesized rest
- argument.
+ * test/ruby/test_gc.rb: add a test for above.
-Sat Oct 4 14:59:51 2003 Tanaka Akira <akr@m17n.org>
+Thu Oct 28 03:13:06 2010 Koichi Sasada <ko1@atdot.net>
- * lib/pathname.rb (initialize): raise ArgumentError if argument has
- '\0' character.
- (relative_path_from): new method.
- (each_entry): new method for replacement of dir_foreach.
- (foreach, foreachline, dir_foreach, chdir): obsoleted.
+ * ext/objspace/objspace.c (memsize_of): fix rdoc.
-Sat Oct 4 12:58:48 2003 akira yamada <akira@ruby-lang.org>
+ * ext/objspace/objspace.c (total_memsize_of_all_objects): added.
- * test/uri/* (6 files): added.
+ * test/objspace/test_objspace.rb:
+ - add a test for ObjectSpace.total_memsize_of_all_objects.
+ - add two tests for ObjectSpace.memsize_of (for nil and Fixnum).
-Sat Oct 4 12:44:45 2003 akira yamada <akira@ruby-lang.org>
+Wed Oct 27 23:55:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/uri/ftp.rb, lib/uri/mailto.rb: renamed to #to_s from #to_str.
+ * ext/iconv/iconv.c (Init_iconv): warn deprecated use.
-Sat Oct 4 07:33:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+Wed Oct 27 18:50:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/test/unit/testsuite.rb: changed #<< to return self, and added
- #delete.
+ * bignum.c (rb_big2long, rb_big2ulong): rb2ulong() returns VALUE, but
+ its real range is ulong. So, if the size of VALUE is bigger than
+ ulong, upper bits are always zero even if the actual value is
+ negative.
+ fixed #3490
- * test/testunit/test_testsuite.rb: ditto. Also slightly refactored
- #test_size.
+Wed Oct 27 18:27:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/test/unit/collector/objectspace.rb: collector now preserves the
- hierarchy of suites.
+ * test/ruby/test_io.rb (TestIO#pipe): should close write end of pipe
+ before closing read end, to get rid of timing problem.
- * test/testunit/collector/test_objectspace.rb: ditto.
+ * test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
-Sat Oct 4 04:48:49 2003 why the lucky stiff <why@ruby-lang.org>
+Wed Oct 27 18:14:27 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/syck/rubyext.c: default keys handled.
+ * win32/win32.c (rb_w32_getppid): support Win64.
- * ext/syck/syck.h: lowered default buffer size to 16k for increased
- performance.
+Wed Oct 27 15:07:19 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/yaml: checkin of basic unit tests.
+ * thread_win32.c (w32_error): should get error no only once, because
+ the result of the second getting will indicate the error of the
+ first FormatMessage() call.
-Sat Oct 4 04:24:19 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Wed Oct 27 13:51:25 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/openssl/extconf.rb: add check for X509V3_set_nconf.
+ * test/ruby/test_io.rb (TestIO#pipe): need to propagate exceptions
+ in read/write thread. fix r29541.
- * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_config):
- cannot implement if X509V3_set_nconf doesn't exist.
+ * test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
-Sat Oct 4 02:12:44 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Wed Oct 27 12:05:40 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/xsd/datatypes.rb: dump sign by itself. under the problematic
- platform, sprintf("%+.10g", -0.0) => +0. sigh.
+ * class.c (clone_const): need to return value. fix r29602.
- * sample/wsdl/amazon/*: update schema ver2 to ver3.
+Wed Oct 27 11:58:58 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Oct 4 01:33:46 2003 Tanaka Akira <akr@m17n.org>
+ * include/ruby/ruby.h (NUM2LONG_internal): add cast to get rid of a
+ non GCC compiler warning. this is intentional type conversion.
- * lib/pathname.rb (initialize): duplicate and freeze argument.
- (to_s): return duplicated string.
- (children): new method.
- (each_line): new alias to foreachline.
+Wed Oct 27 09:25:46 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Oct 3 16:13:19 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * cont.c: apply documentation patch by Run Paint Run Run.
+ [ruby-core:32915]
- * ext/openssl/ossl_asn1.c: add DER encoder and decoder.
+Wed Oct 27 02:12:10 2010 Yusuke Endoh <mame@tsg.ne.jp>
- * ext/openssl/ossl_asn1.h: add OpenSSL::ASN1 module.
+ * object.c (Init_Object), constant.h, variable.c
+ (rb_mod_private_constant, rb_mod_public_constant,
+ set_const_visibility, rb_const_get_0): add Module#public_constant
+ and private_constant. [ruby-dev:39685][ruby-core:32698]
- * ext/openssl/ossl.c (Init_openssl): call Init_ossl_asn1.
+ * test/ruby/test_module.rb: add tests for above.
- * ext/openssl/extconf.rb: check if X509_ATTRIBUTE has field "single".
+Wed Oct 27 02:02:54 2010 Yusuke Endoh <mame@tsg.ne.jp>
- * ext/openssl/ossl_x509attr.c (ossl_x509attr_set_value): accept
- DER encoded data argument.
+ * class.c, constant.h, gc.c, method.h, object.c, variable.c,
+ vm_insnhelper.c: use struct rb_constant_entry_t as entry of
+ RCLASS_CONST_TBL. RCLASS_CONST_TBL has contained VALUE of constant
+ directly. Now instead rb_const_entry_t is contained in
+ RCLASS_CONST_TBL, rb_const_entry_t is managed by malloc, and
+ have not only the value itself but also visibility flag.
+ This is another preparation for private constant (see
+ [ruby-dev:39685][ruby-core:32698]).
- * ext/openssl/ossl_x509attr.c (ossl_x509attr_get_value): return
- DER encoded data in OpenSSL::ASN1 types.
+Wed Oct 27 01:56:34 2010 Yusuke Endoh <mame@tsg.ne.jp>
-Fri Oct 3 13:02:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * class.c, gc.c, object.c, variable.c, vm_insnhelper.c,
+ include/ruby/ruby.h: separate RCLASS_CONST_TBL from RCLASS_IV_TBL.
+ RCLASS_IV_TBL has contained not only instance variable table but
+ also constant table. Now the two table are separated to
+ RCLASS_CONST_TBL and RCLASS_IV_TBL. This is a preparation for
+ private constant (see [ruby-dev:39685][ruby-core:32698]).
- * lib/test/unit.rb: refactored to use optparse.
+Tue Oct 26 18:51:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/test/unit.rb: added support for selecting the output
- level from the command-line.
+ * lib/scanf.rb (extract_float): allow 2.e+2 style.
+ [ruby-dev:42452] #3978
- * lib/test/unit.rb: added a command-line switch to stop processing
- the command-line, allowing arguments to be passed to tests.
+Tue Oct 26 18:09:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit.rb: changed the method for specifying a runner or a
- filter from the command-line.
+ * Makefile.in (ASFLAGS): needs INCFLAGS.
- * lib/test/unit/collector/objectspace.rb: fixed a bug causing all
- tests to be excluded when the filter was set to an empty array.
+ * configure.in (rb_cv_dynamic_alloca): check if extra source for
+ dynamic size alloca.
- * test/testunit/collector/test_objectspace.rb: ditto.
+ * missing/x86_64-chkstk.s (___chkstk): necessary for alloca of
+ amd64-mingw32msvc-gcc on Ubuntu.
-Fri Oct 3 08:14:32 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * thread_win32.c (ruby_alloca_chkstk): check stack overflow
- * lib/irb/ruby-lex.rb (RubyLex::identify_identifier): support
- 'class ::Foo' syntax. [ruby-talk:83514]
+Tue Oct 26 18:04:53 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Oct 3 08:01:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * template/ruby.pc.in (Libs): needs DLDFLAGS.
- * lib/test/unit/assertions.rb: added a default message for #assert,
- #assert_block, and #flunk.
+Tue Oct 26 12:47:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/testunit/test_assertions.rb: ditto.
+ * common.mk (pkgconfig-data): moved from Makefile.in.
- * lib/test/unit/failure.rb: failures now show a better trace of where
- they occurred.
+ * tool/rbinstall.rb: install pc file only if non-empty.
+ [ruby-core:32901] #3983
- * test/testunit/test_failure.rb: ditto (added).
+ * win32/Makefile.sub (ruby_pc): create pc file.
- * lib/test/unit/testcase.rb: ditto.
+Tue Oct 26 09:13:34 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/testunit/test_testcase.rb: ditto.
+ * configure.in (rb_cv_gcc_atomic_builtins): check for atomic
+ builtins, all are not available in Apple derivative gcc.
- * lib/test/unit/util/backtracefilter.rb: added.
+Tue Oct 26 00:29:26 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/testunit/util/test_backtracefilter.rb: added.
+ * Makefile.in (pkgconfig-data): create pkg-config metadata file.
- * lib/test/unit/error.rb: changed to use BacktraceFilter and improved
- output.
+ * tool/rbinstall.rb: install pkg-config metadata file.
- * test/testunit/test_error.rb: ditto.
+ * template/ruby.pc.in: template of pkg-config metadata file.
-Thu Oct 2 20:33:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Oct 25 16:38:07 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
- * ext/iconv/iconv.c (iconv_failure_initialize): conform with
- orthodox initialization method.
+ * signal.c (rb_atomic_t): GCC (of at least recent versions)
+ has ubiquitous support for atomic operations. On that
+ compiler a C program can issue a memory barrier using these
+ dedicated instructions. According to the GCC manual they
+ cargo culted this feature form the Itanium ABI so chances
+ are that other compilers could also support this feature.
+ But so far GCC is the only compiler that I know to have it.
+ Also note that this works on non-Itanium machines.
- * ext/iconv/iconv.c (iconv_fail): initialize exception instance
- from the class, and do not share instance variables with the
- others. [ruby-dev:21470]
+Mon Oct 25 06:21:35 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 2 18:20:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vsnprintf.c (BSD_vfprintf): prec digits fractal part should be
+ appended to 0 if prec is given. [ruby-dev:42453] #3979
- * time.c (Init_Time): define initialize. [ruby-dev:21469]
+Mon Oct 25 02:57:21 2010 Koichi Sasada <ko1@atdot.net>
-Thu Oct 2 17:39:38 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * common.mk (run.gdb): Quit gdb on 'make gdb' when
+ no signals are received.
- * ext/openssl/ossl_engine.c: add a new module OpenSSL::Engine.
- it supports OpenSSL hardware cryptographic engine interface.
+Mon Oct 25 00:25:23 2010 Tadayoshi Funaba <tadf@dotrb.org>
- * ext/openssl/ossl_engine.h: ditto.
+ * lib/date.rb: some corrections of documentation.
- * ext/openssl/MANIFEST: add ossl_engine.c and ossl_engine.h.
+Sun Oct 24 17:14:00 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/extconf.rb: add check for openssl/engine.h.
+ * array.c, gc.c, hash.c, object.c, string.c, struct.c,
+ transcode.c, variable.c, vm.c, vm_insnhelper.c, vm_method.c:
+ replace calls to rb_error_frozen() with rb_check_frozen(). a
+ patch from Run Paint Run Run at [ruby-core:32014]
- * ext/openssl/ossl.c: call Init_ossl_engine().
+ * include/ruby/intern.h (rb_check_frozen): optimize.
+ [ruby-core:32878]
- * ext/openssl/ossl.h: include openssl/engine.h.
+Sun Oct 24 15:16:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_pkey_{rsa,dsa,dh}.c: check if underlying
- EVP_PKEY referes engine.
+ * lib/test/unit.rb (Test::Unit::Mini#run): abort if interrupted.
-Thu Oct 2 17:22:37 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/test/unit.rb (Test::Unit::Mini#run_test_suites): show the
+ result even when interrupted on the way.
- * time.c (time_load): restore instance variables (if any) before
- loading from marshaled data.
+ * lib/test/unit.rb (Test::Unit::Mini#run_test_suites): ensure
+ output sync mode to be restored.
-Thu Oct 2 14:19:15 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Oct 24 14:11:16 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/iconv/iconv.c (iconv_fail): now yield erred substring, and
- set error object to $!.
+ * vm.c (vm_define_method): defined method is run with the default
+ public visibility regardless the visibility context of definition.
+ [ruby-core:30638]
- * ext/iconv/iconv.c (iconv_convert): error handler block should
- return appended part and the rest. if rest is nil, the
- conversion stops.
+Sun Oct 24 12:08:54 2010 Aaron Patterson <aaron@tenderlovemaking.com>
-Thu Oct 2 12:00:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/test/unit.rb: make test/unit play nicely with the rake test
+ loader. [ruby-core:32864]
- * variable.c (rb_const_defined_0): look up constants in Object as
- well. [ruby-dev:21458]
+Sun Oct 24 00:25:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_defined.rb (TestDefined::test_defined): test for
- constants.
+ * test/ruby/test_rubyoptions.rb (test_segv_test): follow up the
+ change at r29556.
-Thu Oct 2 11:17:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+Sat Oct 23 14:39:58 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit/assertions.rb: should not capture an
- AssertionFailedError unless explicitly requested.
+ * lib/mkmf.rb: $extmk should be true for test/runner.
- * test/testunit/test_assertions.rb: ditto.
+Sat Oct 23 10:55:37 2010 Koichi Sasada <ko1@atdot.net>
- * test/testunit/collector/test_objectspace.rb: fixed a test failure
- caused by methods being returned in different orders on different
- platforms by moving test sorting from TestSuite into the locations
- where suites are constructed. [ruby-talk:83156]
+ * vm_dump.c (rb_vm_bugreport): fix to add bug outputs.
+ - loaded script ($0)
+ - loaded features ($")
+ - process memory map on Linux (/proc/self/maps)
- * lib/test/unit/testcase.rb: ditto.
+ * vm_dump.c (rb_vmdebug_stack_dump_raw): fix header message.
- * lib/test/unit/testsuite.rb: ditto.
+Fri Oct 22 14:50:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit/collector/objectspace.rb: ditto.
+ * lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
+ assertion message must not be nil.
-Thu Oct 2 03:25:01 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Fri Oct 22 13:59:50 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * eval.c (rb_thread_raise): prototype; avoid VC++ warning.
+ * lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
+ treat nil case. Please run test-all before commit such change.
-Thu Oct 2 01:37:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Oct 21 23:58:14 2010 Koichi Sasada <ko1@atdot.net>
- * time.c (time_mdump): new marshal dumper. _dump is still
- available for compatibility.
+ * gc.c (gc_lazy_sweep): Variable declarations should be at
+ the head of block.
- * time.c (time_mload): new marshal loader.
+Thu Oct 21 23:56:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * marshal.c (w_object): preserve instance variables for objects
- with marshal_dump.
+ * gc.c (objspace_each_objects, rb_objspace_each_objects): use
+ struct.
- * marshal.c (r_object0): restore instance variables before calling
- marshal_load.
+ * gc.c (objspace_each_objects): fix return with no value.
- * error.c (rb_warn_m): always return nil.
+Thu Oct 21 23:47:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 2 01:32:46 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * dir.c (dir_initialize): remove useless intermediate variable.
- * eval.c (rb_f_block_given_p): real required condition is
- ruby_frame->prev->iter == ITER_CUR.
+Thu Oct 21 16:07:20 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * eval.c (rb_block_given_p): ditto.
+ * io.c (rb_f_select): change rdoc.
+ patched by Eito Katagiri [ruby-core:31805]
- * eval.c (block_pass): update ruby_frame->iter only when previous
- value is ITER_NOT.
+Thu Oct 21 15:55:21 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Oct 2 01:02:35 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/webrick/httpauth/digestauth.rb
+ (WEBrick::HTTPAuth::ProxyDigestAuth#check_uri): privated.
+ [ruby-dev:42344]
- * variable.c (rb_const_defined_at): should exclude constants from
- Object when TYPE(klass) == T_MODULE *and* exclude is on.
- [ruby-dev:21458]
+Thu Oct 21 15:50:25 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * variable.c (rb_const_get_0): do not lookup constants from Object
- when TYPE(klass) == T_MODULE *and* exclude is on.
+ * io.c (rb_f_select): add correct rdoc.
+ patched by Dave Thomas [ruby-core:32467]
-Thu Oct 2 00:21:11 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Thu Oct 21 15:42:01 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * test/logger/test_logger.rb: unlinking file before close causes
- problem under win32 box.
+ * lib/net/telnet.rb (Net::Telnet#close): added.
+ patched by Erik Hollensbe [ruby-dev:42260] #3830
- * lib/xsd/datatypes.rb(XSDFloat, XSDDouble): add +/- sign explicitly
- when stringified and embedded into XML instance. Ruby's sprintf may
- format -0.0 as "0.0" (no minus sign) depending on underlying C
- sprintf implementation.
+Thu Oct 21 13:08:00 2010 Narihiro Nakamura <authornari@gmail.com>
- * test/xsd/test_xsd.rb, test/soap/test_basetype.rb: follow above change.
+ * gc.c (rb_objspace_each_objects): don't lazy sweep in
+ rb_objspace_each_objects. [Bug #3940] [ruby-dev:42369]
- * test/soap/calc/*: give httpd config param "CGIInterpreter".
- "/usr/bin/env ruby" thing does not work under non-Unix boxes.
+Thu Oct 21 00:05:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Oct 2 00:42:20 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_io.rb (TestIO#pipe): get rid of deadlock on pipe.
+ a patch from Tomoyuki Chikanaga at [ruby-dev:42435]. #3970
- * marshal.c (r_byte): retrieve pointer from string value for each
- time. [ruby-dev:24404]
+ * test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
- * marshal.c (r_bytes0): ditto.
+Wed Oct 20 23:54:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * enum.c (sort_by_i): re-entrance check added. [ruby-dev:24399]
+ * ext/dbm/dbm.c: rdoc based on a patch by mathew meta AT
+ pobox.com, at [ruby-core:32853].
- * io.c (io_read): should freeze all reading buffer.
- [ruby-dev:24400]
+Wed Oct 20 10:47:21 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * string.c (rb_str_sum): should use bignums when bits is greater
- than or equals to sizeof(long)*CHAR_BITS. [ruby-dev:24395]
+ * util.c (ruby_strtod): reject 0x1.p+0. [ruby-dev:42432] #3966
- * eval.c (specific_eval): defer pointer retrieval to prevent
- unsafe sourcefile string modification. [ruby-dev:24382]
+Wed Oct 20 10:00:57 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * string.c (rb_str_sum): wrong cast caused wrong result.
- [ruby-dev:24385]
+ * vsnprintf.c (BSD_vfprintf): print floating point on "%#a".
+ [ruby-dev:42431] Bug#3965
- * enum.c (enum_sort_by): hide temporary array from
- ObjectSpace.each_object. [ruby-dev:24386]
+Tue Oct 19 19:30:11 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * string.c (rb_str_sum): check was done with false pointer.
- [ruby-dev:24383]
+ * vsnprintf.c (BSD_vfprintf): clear ALT flag for %a.
+ [ruby-core:32841] [ruby-core:32848]
- * string.c (rb_str_sum): string may be altered. [ruby-dev:24381]
+Tue Oct 19 12:19:25 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 2 00:25:21 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vsnprintf.c (BSD_vfprintf): fix over-count of field size.
- * signal.c (ruby_signal_name): adjust to the prototype.
+Tue Oct 19 03:08:52 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * process.c (pst_inspect): ditto.
+ * vsnprintf.c (BSD_vfprintf): use HEXPREFIX flag for prefix of %a.
+ [ruby-core:32841]
- * ext/etc/etc.c (etc_getgrent, Init_etc): typo.
+Mon Oct 18 13:18:01 2010 Akinori MUSHA <knu@iDaemons.org>
-Wed Oct 1 20:49:41 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/digest/digest.c (rb_digest_class_init): Define
+ Digest::Class.new(). [Feature #3954]
- * gc.c (heaps): manage slots and limits together. [ruby-dev:21453]
+Mon Oct 18 12:58:40 2010 Tanaka Akira <akr@fsij.org>
- * gc.c (add_heap): should not clear heaps slot even if realloc()
- failed.
+ * pack.c (pack_pack): refine the document. [ruby-dev:42397]
+ (pack_unpack): ditto.
-Wed Oct 1 20:36:49 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+Mon Oct 18 10:19:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * MANIFEST: add wince/mkconfig_wce.rb.
+ * lib/net/http.rb (transport_request): @socket may be nil.
+ patched by Egbert Eich [ruby-core:32829]
-Wed Oct 1 17:22:33 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon Oct 18 09:57:28 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/etc/etc.c: add new functions: setpwent, getpwent, endpwent,
- setgrent, getgrent, endgrent.
+ * sprintf.c (BSD_vfprintf): wrong padding around prefix and
+ floating point with %a. [ruby-dev:42403] Bug #3956
- * ext/socket/socket.c (sock_s_gethostbyname): do not reverse lookup.
+Sun Oct 17 22:36:33 2010 Tadayoshi Funaba <tadf@dotrb.org>
-Wed Oct 1 17:01:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/date/delta.rb: added an rdoc tag.
- * eval.c (rb_load): Object scope had priority over required file
- scope. [ruby-dev:21415]
+Sun Oct 17 10:47:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 1 14:09:53 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
+ * variable.c (rb_mod_remove_const): update rdoc.
+ [ruby-core:31957]
- * wince/mkconfig_wce.rb: sorry, forget to commit.
+Sun Oct 17 10:40:17 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 1 10:08:42 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
+ * class.c (rb_define_{class,module}_id_under): register to be
+ marked, which probably are defined and used internally.
- * wince/setup.mak: add sigmarionIII SDK support.
+Sat Oct 16 11:10:55 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * wince/Makefile.sub: ditto.
+ * ext/win32ole/win32ole.c (ole_encoding2cp): set codepage 20936
+ according to GB2312. [Bug #3937] [ruby-core:32758]
- * wince/mkexports.rb: fix linker error in SH4.
+Sat Oct 16 10:54:57 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * wince/mkconfig_wce.rb: camouflage RUBY_PLATFORM for compiling ext.
+ * Makefile.in (CPP): already used in .c.i rule.
-Wed Oct 1 08:02:52 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
+ * cygwin/GNUmakefile.in (DLLWRAP, WINDRES): add --driver-name and
+ --preprocessor options explicitly. [ruby-core:32776]
- * wince/time_wce.c (time): add zero check.
+Sat Oct 16 10:06:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Sep 30 16:11:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/sdbm/_sdbm.c (SEEDUPS, BADMESS): make settable using command
+ line options.
- * Makefile.in: copy lex.c from $(srcdir) if it's not the current
- directory. [ruby-dev:21437]
+ * ext/sdbm/_sdbm.c (makroom): suppress unused result warning.
-Tue Sep 30 11:29:23 2003 Tanaka Akira <akr@m17n.org>
+ * ext/sdbm/extconf.rb: disable BADMESS, a library should not emit
+ messages directly.
- * process.c (pst_inspect): describe stopped process "stopped".
+Sat Oct 16 08:39:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Sep 30 09:31:56 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * dln.c (dln_strerror): get English message first, instead of
+ system default. see [ruby-dev:42358].
- * test/runner.rb: glob for directories.
+Sat Oct 16 00:08:00 2010 Koichi Sasada <ko1@atdot.net>
-Tue Sep 30 09:11:43 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * hash.c (rb_hash_aref): skip calling "default" method
+ if it is not needed, for speed-up.
- * eval.c (rb_eval): while/until should not capture break unless
- they are destination of the break.
+Fri Oct 15 23:36:25 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Sep 30 03:12:02 2003 Minero Aoki <aamine@loveruby.net>
+ * file.c (NUM2DEVT, DEVT2NUM, PRI_DEVT_PREFIX): fallback to
+ unsigned int.
- * lib/net/http.rb (finish): revert to 1.93.
+Fri Oct 15 22:54:46 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * lib/net/pop.rb (finish): revert to 1.60.
+ * ext/win32ole/win32ole.c (ole_hresult2msg): get English message first,
+ instead of system default. [ruby-core:32765]
- * lib/net/smtp.rb (finish): revert to 1.67.
+Fri Oct 15 22:47:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/http.rb (do_start): ensure to close socket if failed to
- start session.
+ * include/ruby/ruby.h (VALUE): prefer long over uintptr_t,
+ FIX2LONG expects VALUE to be long at least.
- * lib/net/pop.rb (do_start): ditto.
+ * include/ruby/ruby.h (FIX2LONG): parenthesize the argument.
- * lib/net/smtp.rb (do_start): ditto.
+Fri Oct 15 20:30:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/smtp.rb: SMTP#started? wrongly returned false always.
+ * configure.in (dev_t): use RUBY_REPLACE_TYPE.
-Tue Sep 30 02:54:49 2003 Minero Aoki <aamine@loveruby.net>
+ * file.c (rb_stat_inspect): use PRI_DEVT_PREFIX.
- * test/ruby/test_iterator.rb: new test
- test_break__nested_loop[123].
+Fri Oct 15 17:26:57 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Sep 29 23:39:13 2003 Minero Aoki <aamine@loveruby.net>
+ * pack.c (pack_pack): simplify comparison of explicit_endian
+ as pointed by nobu.
- * lib/net/http.rb (finish): does not raise IOError even if
- !started?, to allow closing socket which was opened before
- session started.
+ * pack.c (pack_unpack): ditto.
- * lib/net/pop.rb (finish): ditto.
+Fri Oct 15 16:40:37 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/net/smtp.rb (finish): ditto.
+ * pack.c (pack_pack): fix more than one modifiers appear in the
+ format string. [ruby-core:32793]
-Mon Sep 29 19:06:51 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * pack.c (pack_unpack): ditto.
- * ext/win32ole/extconf.rb: add windows.h checking.
- (ruby-bugs:PR#1185)
+Thu Oct 14 23:20:42 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Mon Sep 29 16:18:30 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * test/win32ole/test_folderitem2_invokeverb.rb: refactoring.
- * lib/logger.rb: check if the given logdevice object respond_to :write
- and :close, not is_a? IO. duck duck.
+Thu Oct 14 22:18:29 2010 Koichi Sasada <ko1@atdot.net>
- * test/logger/test_logger.rb: self IO.pipe reading/writing may be
- locked by the flood. use tempfile.
+ * insns.def, iseq.c, vm_insnhelper.c: rename variable name
+ (ip -> iseq).
- * lib/wsdl/xmlSchema/data.rb: wrong constant reference.
+Thu Oct 14 20:41:27 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Sep 29 16:11:23 2003 Minero Aoki <aamine@loveruby.net>
+ * pack.c (pack_pack): support endian modifiers: < and >.
+ [ruby-dev:42376] Feature #3491
- * test/fileutils/test_fileutils.rb: clean up temporary symlink.
- Patched by NaHi. [ruby-dev:21420]
+ * pack.c (pack_unpack): ditto.
-Mon Sep 29 11:16:55 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Oct 14 20:50:51 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * eval.c (rb_thread_atfork): wrong format specifier.
- [ruby-dev:21428]
+ * ext/win32ole/win32ole.c (reg_get_val): expand environment in
+ the pathname. [Bug #3907]
- * process.c (pst_inspect): better description.
+Thu Oct 14 07:35:07 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Sep 29 02:31:44 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * file.c (DEVT2NUM): added. Size of dev_t is depend on the
+ environment even if POSIX defines dev_t as unsigned integer.
+ For example, OpenVMS, 64bit Solaris 9, and NetBSD 6 defines
+ dev_t as 64bit unsigned integer.
- * lib/webrick/utils.rb (Utils::su): use setgid and setuid to
- set real and effective IDs. and setup group access list by
- initgroups.
+ * file.c (rb_stat_dev): use DEVT2NUM.
-Sun Sep 28 11:14:19 2003 Koji Arai <jca02266@nifty.ne.jp>
+ * file.c (rb_stat_dev_major): dev_t is not long. major(3)'s return
+ value is int.
- * ext/digest/digest.c (Init_digest): `copy_object' was deprecated.
- `initialize_copy' should be defined.
+ * file.c (rb_stat_dev_minor): dev_t is not long. minor(3)'s return
+ value is int.
- * ext/stringio/stringio.c (Init_stringio): ditto.
+ * configure.in: check size of dev_t.
-Sat Sep 27 18:25:13 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Thu Oct 14 07:22:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/xsd/charset.rb: XSD::Charset.is_ces did return always true under
- $KCODE = "NONE" environment. check added.
+ * array.c (rb_ary_and, rb_ary_or), class.c (rb_mod_init_copy),
+ gc.c (undefine_final), time.c (time_mload): get rid of
+ type-punning casts.
- * test/xsd/test_xsd.rb: add tests for above fix.
+Thu Oct 14 04:16:41 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Sat Sep 27 15:58:50 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * numeric.c (ruby_float_step): fix Numeric#step with infinity unit
+ doesn't works well. [ruby-core:32779]
- * lib/soap/rpc/cgistub.rb: make logging severity threshold higher.
+Wed Oct 13 23:16:46 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/soap/rpc/standaloneServer.rb: defer WEBrick server start to give
- a chance to reset logging severity threshold.
+ * tool/enc-unicode.rb: get rid of lots of warnings.
- * test/soap/calc/test_*, test/soap/helloworld/test_helloworld.rb: run
- silent.
+ * iseq.c (insn_operand_intern, rb_iseq_disasm): fix format specifiers.
-Sat Sep 27 09:44:18 2003 Minero Aoki <aamine@loveruby.net>
+ * vm.c (thread_free): ditto.
- * test/fileutils/test_fileutils.rb: clear all errors on Windows.
- [ruby-dev:21417]
+ * numeric.c (check_uint): get rid of overflow on LLP64 platforms.
- * test/fileutils/test_nowrite.rb: ditto.
+ * insns.def (opt_case_dispatch): use st_data_t.
-Mon Sep 27 09:14:03 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Oct 13 22:32:34 2010 Takeyuki FUJIOKA <xibbar@ruby-lang.org>
- * array.c (rb_ary_delete): comparison may change the capacity.
- [ruby-dev:24348]
+ * lib/cgi/util.rb (CGI::unescape): bugfix to unescape the multibyte
+ string. Thanks nobu and tDiary dev members. [Bug #3909]
- * array.c (rb_ary_fill): fill should honor length argument.
- [ruby-dev:24346]
+Wed Oct 13 21:13:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * array.c (rb_ary_replace): should not use ptr from shared array.
- [ruby-dev:24345]
+ * numeric.c (int_chr): raise error when the value is negative.
- * ext/socket/socket.c (s_accept): don't retry for EWOULDBLOCK.
- [ruby-talk:113807]
+Wed Oct 13 19:24:08 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-Sat Sep 27 04:57:07 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * vm.c (ruby_vm_destruct): This function type was wrong; correct to the prototype.
- * test/ruby/test_file.rb: new file. only asserts unlink-before-close
- behaviour now.
+Wed Oct 13 14:58:09 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * test/soap/marshal/test_digraph.rb: should close before unlink.
- unlink-before-close pattern is not needed here.
+ * numeric.c (rb_num_to_uint): fix 32bit logic.
-Sat Sep 27 03:32:37 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Wed Oct 13 12:53:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * test/soap/*, test/wsdl/*, test/xsd/*: move TestCase classes into
- each module namespace. TestMarshal in
- test/soap/marshal/test_marshal.rb crashed with
- test/ruby/test_marshal.rb.
+ * numeric.c (rb_num_to_uint): added to check the range of arguments.
+ Mainly for negative value with NUM2UINT on 32bit environment.
-Sat Sep 27 01:30:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+ * string.c (rb_str_concat): use rb_num_to_uint.
- * ext/socket/socket.c (ruby_connect): on win32, type of the 4th
- argument of getsockopt is char *.
+Wed Oct 13 12:10:02 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Sep 26 18:35:40 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * thread_win32.c (w32_error): get English message first, instead
+ of system default. see [ruby-core:32765].
+ [experimental]
- * lib/resolv-replace.rb: 1.8 compliance. [ruby-talk:82946]
+Wed Oct 13 11:04:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Sep 26 17:39:27 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * debug.c (ruby_set_debug_option): define always for binary
+ compatibility with debug env enabled binary.
- * test/ruby/test_marshal.rb: add test for ruby's objects.
+ * signal.c (ruby_enable_coredump): ditto.
-Fri Sep 26 09:52:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Oct 13 10:52:51 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * defines.h (flush_register_windows): use volatile only for gcc on
- Solaris. [ruby-dev:21403]
+ * include/ruby/ruby.h (ruby_executable_node): missing prototype.
- * lib/mkmf.rb (xsystem): use system directly to honor shell meta
- charaters.
+Wed Oct 13 05:23:04 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Sep 26 00:10:13 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * missing/strchr.c: add strlen's prototype.
- * lib/README: updated.
+ * missing/strstr.c: ditto.
-Thu Sep 25 17:48:10 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Oct 13 00:21:17 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl.c (ossl_buf2str): fix type of 1st argument for
- rb_protect.
+ * ext/syck/rubyext.c (struct mktime_arg): constified.
- * ext/openssl/ossl_hmac.c (ossl_hmac_digest): should return meaningful
- value.
+ * ext/syck/rubyext.c (mktime_do, mktime_r, rb_syck_mktime): fix
+ function signatures.
-Thu Sep 25 09:00:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+Wed Oct 13 00:18:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/ostruct.rb: Added OpenStruct#==.
+ * st.c (MurmurMagic): get rid of literal overflow.
- * test/ostruct/test_ostruct.rb: Added.
+ * configure.in (RUBY_CHECK_PRINTF_PREFIX): check for printf format
+ specifier if possible.
-Thu Sep 25 07:55:26 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Oct 12 23:58:19 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/win32ole/win32ole.c, ext/openssl/ossl_pkey_dsa.c,
- ext/openssl/ossl_pkey_rsa.c, ext/bigdecimal/bigdecimal.h: must
- not use C++ or C99 style comment yet. (ruby-bugs:PR#1184)
+ * win32/win32.c (rb_w32_open_osfhandle, rb_w32_wopen, rb_w32_pipe):
+ use uintptr_t instead of long for win64.
-Thu Sep 25 00:23:22 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * win32/win32.c (socketpair_internal): suppress warnings.
- * MANIFEST: add SOAP4R.
+ * win32/win32.c (ftruncate): use HANDLE instead of long for win64.
-Thu Sep 25 00:13:15 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * vsnprintf.c (BSD_vfprintf): fix cast.
- * lib/soap/* (29 files): SOAP4R added.
+ * numeric.c (rb_num2fix): result of rb_num2long is SIGNED_VALUE.
- * lib/wsdl/* (42 files): WSDL4R added.
+ * compile.c (iseq_build_body), error.c (set_syserr, get_syserr),
+ (syserr_initialize), gc.c (define_final, rb_gc_copy_finalizer),
+ (run_final), hash.c (rb_hash_aref, rb_hash_lookup2),
+ (rb_hash_fetch_m, rb_hash_clear, rb_hash_aset, eql_i),
+ iseq.c (iseq_load, iseq_data_to_ary), marshal.c (r_symlink),
+ thread.c (rb_thread_local_aref),
+ variable.c (generic_ivar_remove, ivar_get, rb_const_get_0),
+ (rb_cvar_get), vm.c (rb_vm_check_redefinition_opt_method),
+ vm_insnhelper.c (vm_get_ev_const), vm_method.c (remove_method),
+ ext/iconv/iconv.c (map_charset): use st_data_t.
- * lib/xsd/* (12 files): XSD4R added.
+ * compile.c (iseq_build_body), insns.def (getglobal, setglobal),
+ iseq.c (iseq_load, iseq_data_to_ary), util.c (valid_filename):
+ use VALUE.
- * test/soap/* (16 files): added.
+ * gc.c (obj_free, rb_objspace_call_finalizer): fix truncating
+ cast.
- * test/wsdl/* (2 files): added.
+ * gc.c (mark_current_machine_context): suppress warnings.
- * test/xsd/* (3 files): added.
+ * compile.c (iseq_compile_each): fix truncating cast.
- * sample/soap/* (27 files): added.
+ * cont.c (fiber_setcontext): missing variable definition.
- * sample/wsdl/* (13 files): added.
+Tue Oct 12 19:25:13 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Sep 24 02:08:11 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * error.c (exc_to_s): use OBJ_INFECT.
- * lib/webrick/httpservlet/cgihandler.rb: conform to mswin32.
- [ruby-talk:82735], [ruby-talk:82748], [ruby-talk:82818]
+ * error.c (name_err_to_s): ditto.
-Tue Sep 23 23:10:16 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * error.c (name_err_mesg_to_str): ditto.
- * lib/logger.rb: add Logger#<<(msg) for writing msg without any
- formatting.
+ * error.c (syserr_initialize): ditto.
- * test/logger/test_logger.rb: ditto.
+Tue Oct 12 19:07:55 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Sep 23 20:47:51 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * error.c (syserr_initialize): taint message if mesg is given
+ and it is tainted.
- * error.c (rb_warn_m): should not warn if -W0 is specified.
- [ruby-talk:82675]
+Tue Oct 12 18:25:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Sep 22 21:28:57 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * io.c (rb_io_ungetc): always see Bignum. On 32bit valid value
+ may be a Bignum. On 64bit for errors. [ruby-dev:42366]
- * MANIFEST: updated.
+Tue Oct 12 18:25:04 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Sep 22 19:22:26 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * string.c (rb_str_concat): use unsigned int for GB18030.
- * configure.in (AC_CHECK_FUNCS): add setuid and setgid.
+Tue Oct 12 17:53:49 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Sep 22 12:34:55 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * numeric (check_uint): the mask must refer to VALUE.
- * util.c (ruby_strtod): skip preceding zeros before counting
- digits in the mantissa. (ruby-bugs:PR#1181)
+Tue Oct 12 17:47:10 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Sun Sep 21 04:12:36 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * numeric (check_uint): set MSB for negative value.
- * ext/openssl/ossl_ocsp.c (ossl_ocspreq_initialize): the argument
- should be a String.
+ * numeric (rb_num2uint): return value's type of rb_num2ulong
+ is VALUE.
- * ext/openssl/ossl_ocsp.c (ossl_ocspres_initialize): ditt.
+ * numeric (int_chr): variable i can't be negative.
- * ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): ditto.
+Tue Oct 12 16:04:37 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
+ * win32/win32.c (rb_w32_strerror): get English message first, instead
+ of system default. see [ruby-dev:42358].
+ [experimental]
- * ext/openssl/ossl_x509ext.c (ossl_x509ext_set_value): ditto.
+Tue Oct 12 15:52:35 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Sep 20 11:49:05 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * win32/win32.c (rb_w32_strerror): unmap some range of errno for
+ workaround of VC10's strerror() and sys_nerr problem.
+ based on a patch from Akio Tajima, [ruby-dev:42355].
- * lib/logger.rb: typo fixed.
+Tue Oct 12 15:36:09 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * test/logger/test_logger.rb: new file.
+ * io.c (rb_io_ungetc): use unsigned int for GB18030.
-Fri Sep 19 11:39:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+Tue Oct 12 15:14:21 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * test/testunit/*: Added.
+ * io.c (rb_io_putc): support multibyte characters.
+ [ruby-core:30697]
- * lib/test/unit.rb: Documentation update.
+Tue Oct 12 15:10:31 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/test/unit/ui/console/testrunner.rb (TestRunner#initialize):
- Ditto.
+ * numeric.c (rb_enc_uint_chr): split from int_chr.
- * lib/test/unit.rb: Factored out an ObjectSpace collector.
+ * numeric.c (int_chr): use rb_enc_uint_chr.
- * lib/test/unit/collector/objectspace.rb: Ditto.
+ * include/ruby/encoding.h (rb_enc_uint_chr): added.
- * sample/testunit/*: Added.
+Tue Oct 12 14:04:41 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Sep 19 01:00:48 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * numeric.c (int_chr): a codepoint of Ruby M17N must be 32bit
+ unsigned int; GB18030 uses MSB. Also note that OnigCodePoint
+ is defined as unsigned int.
- * lib/webrick/log.rb (BasicLog#log): get rid of as ineffectual
- condition.
+Tue Oct 12 12:20:54 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/webrick/log.rb (BasicLog#format): add "\n" to message.
+ * vm_dump.c (dump_thread): foolish mistake.
-Thu Sep 18 22:43:20 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Oct 12 10:39:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (proc_invoke): should push PROT_PCALL tag for orphans.
+ * configure.in (RUBY_MINGW32): canonicalize only on mingw.
- * eval.c (proc_invoke): should update "result" for orphans.
+Mon Oct 11 20:20:23 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Sep 18 20:33:03 2003 Tietew <tietew-ml-ruby-list@tietew.net>
+ * lib/net/http.rb (HTTP.get): specify ASCII-8BIT as the result
+ encoding of Zlib::GzipReader.
+ http://hibari.2ch.net/test/read.cgi/tech/1281473294/271
- * parse.y (str_xquote): do not prepend escapes in
- backqoute literals. [ruby-list:38409]
+Mon Oct 11 17:42:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Sep 18 20:30:17 2003 Tanaka Akira <akr@m17n.org>
+ * error.c (syserr_initialize): use mesg's encoding when locale
+ encoding is US-ASCII. If locale encoding is not US-ASCII,
+ assume err has non ASCII characters. [ruby-dev:42358]
- * lib/pathname.rb: update document.
+Mon Oct 11 14:03:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Sep 18 15:27:05 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * error.c (syserr_initialize): set the encoding of Errno::*#message
+ as locale. [ruby-dev:42358]
- * lib/logger.rb: new file. Logger, formerly called devel-logger or
- Devel::Logger.
+Mon Oct 11 06:38:27 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * sample/logger/*: new file. samples of logger.rb.
+ * ext/stringio/stringio.c (strio_set_encoding):
+ StringIO#set_encoding can get 2nd argument and optional hash
+ for API compatibility to IO. [ruby-dev:42356]
-Wed Sep 17 23:41:45 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon Oct 11 06:11:30 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * eval.c (localjump_destination): should not raise ThreadError
- exception for "break". [ruby-dev:21348]
+ * io.c (rb_io_set_encoding): use rb_funcall2 when the io is not
+ a T_FILE. [ruby-dev:42356]
- * eval.c (proc_invoke): use result instead of prot_tag->retval.
- retval is no longer propagated to the ancestors.
+Sun Oct 10 18:42:23 2010 Akinori MUSHA <knu@iDaemons.org>
-Wed Sep 17 20:34:00 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/set.rb (Set#replace): Apply a bit of optimization.
- * parse.y (tokadd_string, parse_string, yylex): escaped terminator
- is now interpreted as is. [ruby-talk:82206]
+Sun Oct 10 10:20:07 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Sep 17 18:52:36 2003 Minero Aoki <aamine@loveruby.net>
+ * configure.in (RUBY_MINGW32): canonicalize as like mswin version.
- * test/fileutils/fileassertions.rb: new file.
+Sun Oct 10 05:33:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/fileutils/test_fileutils.rb: new file.
+ * vm_core.h (rb_signal_buff_size, rb_signal_exec): moved
+ declarations from thread.c.
- * test/fileutils/test_nowrite.rb: new file.
+Sat Oct 9 16:54:28 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Sep 17 18:51:02 2003 Minero Aoki <aamine@loveruby.net>
+ * configure.in (RSHIFT): quote to get rid of argument expansion
+ for autoconf 2.68.
- * test/strscan/test_stringscanner.rb: require test/unit.
+Sat Oct 9 11:00:06 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Sep 17 18:35:34 2003 Minero Aoki <aamine@loveruby.net>
+ * thread.c (thread_reset_event_flags, exec_event_hooks): ignore
+ hooks marked as removed.
- * test/strscan/test_stringscanner.rb: new file.
+ * thread.c (thread_exec_event_hooks): remove hooks to be removed.
-Wed Sep 17 18:03:30 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * thread.c (rb_threadptr_remove_event_hook, rb_remove_event_hook):
+ defer removing hooks if running the hooks. [ruby-dev:42350]
- * ext/openssl: all files are reviewed to simplify and avoid memory leak.
+Sat Oct 9 10:51:00 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/extconf.rb: add check for assert.h.
+ * thread.c (rb_threadptr_exec_event_hooks): suppress each event
+ hooks separately.
- * ext/openssl/ossl.c (ossl_buf2str): new function to convert
- C buffer to String and free buffer.
+ * thread.c (thread_suppress_tracing): split from
+ ruby_suppress_tracing, accepting thread pointer and event mask.
- * ext/openssl/ossl.c (ossl_x509_ary2sk): new function to convert
- Array of OpenSSL::X509 to STACK_OF(X509) with exception safe.
+Sat Oct 9 08:16:01 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl.c (ossl_to_der, ossl_to_der_if_possible): new
- functions to convert object to DER string.
+ * thread.c (rb_threadptr_remove_event_hook): fix typo.
- * ext/openssl/ossl.h: ditto.
+Fri Oct 8 10:52:25 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_bio.c (ossl_membio2str): new function to convert
- BIO to String object and free BIO.
+ * common.mk (RBCONFIG): depends on version.h due to
+ RUBY_PATCHLEVEL. [ruby-core:32709]
- * ext/openssl/ossl_bio.h: ditto.
+Fri Oct 8 00:24:54 2010 James Edward Gray II <jeg2@ruby-lang.org>
- * ext/openssl/ossl_pkcs7.c (ossl_pkcs7_to_der): add for "to_der".
+ * lib/csv.rb: Fixing documentation typos. [ruby-core:32712]
- * ext/openssl/ossl_x509name.c (ossl_x509name_to_der): ditto.
+Thu Oct 7 09:14:28 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/openssl/ossl_x509ext.c (ossl_x509ext_to_der): ditto.
+ * vm_exec.c (vm_exec_core): Treat clang as non gcc on this
+ context: It has __asm__ but doesn't works well.
- * ext/openssl/ossl_x509ext.c (create_ext_from_array): removed
- and reimplement in openssl/x509.rb.
+Wed Oct 6 12:28:22 2010 Tanaka Akira <akr@fsij.org>
- * ext/openssl/ossl_x509attr.c: reimplemented and disable some
- method temporarily. this class doesn't work fine without ASN.1
- data support;-) I'll rewrite in near future.
+ * lib/uri/generic.rb (URI::Generic#hostname): new method.
+ (URI::Generic#hostname=): ditto.
- * ext/openssl/lib/openssl/x509.c (X509::Attribute): get rid off
- unused code.
+ * lib/open-uri.rb: use URI#hostname
- * ext/openssl/lib/openssl/x509.c (X509::ExtensionFactory): refine all.
+ * lib/net/http.rb: ditto.
-Tue Sep 16 22:25:06 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ reported by Adam Majer. [ruby-core:32056]
- * test/csv/test_csv.rb: add negative tests of row_sep.
+Wed Oct 6 11:52:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Sep 16 18:02:36 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * io.c (fptr_finalize): write_mutex might have been destroyed
+ already in finalization phase, as the order of finalizers is not
+ guaranteed. rb_mutex_t should be used in place of Mutex object
+ in the future.
- * regex.c (re_compile_pattern): should not translate character
- class range edge. [ruby-list:38393]
+Tue Oct 5 22:17:02 2010 wanabe <s.wanabe@gmail.com>
-Tue Sep 16 16:47:56 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * win32/mkexports.rb: revert r29320 and r29402.
- * MANIFEST: add test/csv/mac.csv.
+Mon Oct 4 12:43:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/Makefile.sub, bcc32/Makefile.sub (test): add phony NUL target.
+ * parse.y (regexp): dregexp has literal string only at the head
+ and successors are array. [ruby-core:32682]
-Mon Sep 15 19:02:52 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Mon Oct 4 10:22:21 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/csv.rb: add extra pamameter to specify row(record) separater
- character. To parse Mac's CR separated CSV, do like this.
- CSV.open("mac.csv", "r", ?,, ?\r) { |row| p row.to_a }
- The 3rd parameter in this example ?, is for column separater and the
- 4th ?\r is for row separater. Row separater is nil by default. Nil
- separater means "\r\n" or "\n".
+ * random.c (rand_init): This checks the value is in 32bit or not,
+ so use int32_t, not int.
- * test/csv/test_csv.rb: add tests for above feature.
+Mon Oct 4 09:47:39 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * test/csv/mac.csv: added. Sample CR separated CSV file.
+ * random.c (rand_init): remove useless assignment.
-Fri Sep 12 22:41:48 2003 Michal Rokos <m.rokos@sh.cvut.cz>
+ * re.c (update_char_offset): remove unused variable.
- * ext/openssl/ossl.c: move ASN.1 stuff to ossl_asn1.[ch]
+ * re.c (read_escaped_byte): ditto.
- * ext/openssl/ossl.c: move BIO stuff to ossl_bio.[ch]
+Mon Oct 4 09:30:42 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/openssl/ossl_asn1.[ch]: new files
+ * ext/openssl/lib/openssl/bn.rb (Integer#to_bn): OpenSSL::BN.new
+ accepts only Strings, so call Integer#to_s(16).
+ 16 is for an optimization. [ruby-dev:42336]
- * ext/openssl/ossl_bio.[ch]: new files
+Mon Oct 4 07:57:51 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Sep 12 12:30:41 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * cont.c (fiber_memsize): Return size.
+ Before this change, fiber_memsize always returns 0.
- * intern.h (rb_disable_super, rb_enable_super): replace with dummy
- expressions instead of prototypes. the functions remain yet for
- binary compatibility. [ruby-talk:81758]
+Mon Oct 4 07:16:55 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Sep 12 12:09:54 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * enc/unicode.c (onigenc_unicode_property_name_to_ctype):
+ remove useless assignment.
- * bignum.c (rb_big_and): convert argument using 'to_int'.
+ * vm.c (vm_make_proc_from_block): ditto.
- * bignum.c (rb_big_or): ditto.
+ * variable.c (rb_ivar_count): ditto.
- * bignum.c (rb_big_xor): ditto.
+Mon Oct 4 06:40:24 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Sep 12 07:06:14 2003 David Black <dblack@superlink.net>
+ * Makefile.in (clean-rdoc): Don't use \ in variable expansion.
+ BSD make treats it as an escape character.
- * lib/scanf.rb: Took out useless @matched_item variable; some small
- refactoring.
+Mon Oct 4 00:01:53 2010 wanabe <s.wanabe@gmail.com>
-Thu Sep 11 08:43:44 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * tool/config.sub: revert r29320, r29324, r29347, r29354, r29365
+ to automake-1.11.1. [ruby-core:32634]
- * eval.c (rb_f_require): allow "require" on $SAFE>0, if feature
- name is not tainted.
+ * win32/mkexports.rb: no longer use 'mingw64'. a patch from Luis Lavena
+ at [ruby-core:32678].
- * lib/rexml/parsers/baseparser.rb (REXML::Parsers::BaseParser::stream):
- Supports StringIO.
+Sun Oct 3 20:36:37 2010 Akio Tajima (arton) <artonx@yahoo.co.jp>
-Wed Sep 10 22:47:30 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * test/win32ole/test_folderitem2_invokeverb.rb: Change creating
+ shortcut verb to 'Link' [Bug #3339]
- * ext/openssl/ossl.h: add a workaround for win32 platform.
- libeay32.dll doesn't export functions defined in conf_api.h.
+Sun Oct 3 19:44:23 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_config.c (ossl_config_initialize): ditto.
+ * configure.in (Makefile): get rid of duplicated ruby target when
+ already there it was.
- * ext/openssl/ossl_config.c (ossl_config_add_value): ditto.
+Sat Oct 2 22:59:32 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * ext/openssl/ossl_config.c (set_conf_section_i): should check
- if the argument is Array.
+ * test/win32ole/test_thread.rb: add for win32ole with Thread.
-Wed Sep 10 22:41:54 2003 Tietew <tietew@tietew.net>
+Fri Oct 1 17:03:00 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
- * eval.c (win32_get_exception_list): avoid VC7 warning.
- [ruby-win32:577]
+ * test/webrick/test_httpproxy.rb (TestWEBrickHTTPProxy::test_upstream_proxy):
+ My machine fails this test at this line, saying 503 service unavailable.
-Tue Sep 9 10:39:51 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Sep 30 16:11:08 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * eval.c (struct tag): dst should be VALUE.
+ * win32/win32.c (rb_w32_getenv): should return NULL if specified name
+ is empty. a patch from Heesob Park at [ruby-core:32650]
-Tue Sep 9 10:39:51 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Sep 30 15:18:23 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
- * eval.c (localjump_destination): stop at the scope where the current
- block was created. [ruby-dev:21353]
+ * parse.y (command_asgn): allow command_call to be right hand side
+ expression of chained assignment. [ruby-dev:42313]
-Tue Sep 9 05:17:04 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Thu Sep 30 10:55:38 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/openssl/ossl_config.rb: avoid compile error in OpenSSL-0.9.6.
+ * hash.c (ruby_setenv): workaround for old Windows. a patch from
+ Heesob Park. [ruby-core:32353]
-Tue Sep 9 02:41:35 2003 Michal Rokos <m.rokos@sh.cvut.cz>
+Thu Sep 30 09:29:06 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/openssl/ossl_config.c: Refine compatibility.
+ * lib/uri/common.rb (URI.encode_www_form): change treatment of
+ undefined value in given array as latest internet draft for
+ application/www-form-urlencoded.
+ http://tools.ietf.org/html/draft-hoehrmann-urlencoded-01
-Tue Sep 9 01:50:45 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Thu Sep 30 09:34:03 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/webrick/httpserver.rb (HTTPServer#access_log): add "\n" to
- the message.
+ * vm_dump.c (dump_thread): fixed wrong type of return value of
+ SymGetModuleBase64(). [ruby-dev:42306]
- * lib/webrick/log.rb (BasicLog#log): add "\n" only if needed.
+Wed Sep 29 21:04:05 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-Mon Sep 8 22:15:33 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/ruby/test_rubyoptions.rb (TestRubyOptions::test_script_from_stdin):
+ As usual, PTY is not always available.
- * ext/tk/lib/multi-tk.rb: modify security check at creating
- a new interpreter
+Wed Sep 29 18:38:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Sep 8 20:00:12 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * tool/config.sub (x64): regularize only for pc vendor, and strip
+ useless 64 suffix.
- * lib/optparse.rb, lib/optparse/version.rb: search also all
- capital versions.
+Wed Sep 29 17:53:02 2010 Kenta Murata <mrkn@mrkn.jp>
-Mon Sep 8 19:26:33 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/bigdecimal/bigdecimal.c (BIGDECIMAL_ENABLE_VPRINT):
+ VPrint is usually disabled. It's only used in debugging.
- * ext/openssl/ossl.h: include openssl/conf.h and openssl/conf_api.h.
+Wed Sep 29 17:41:34 2010 Kenta Murata <mrkn@mrkn.jp>
- * ext/openssl/ossl_config.c: refine all with backward compatibility.
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_save_limit):
+ return the result of a block.
- * ext/openssl/ossl_config.h: export GetConfigPtr() and DupConfigPtr().
+ * test/bigdecimal/test_bigdecimal.rb (test_save_limit):
+ add a test for the above change.
- * ext/openssl/ossl_x509.c: added new constants under X509 module.
- DEFAULT_CERT_AREA, DEFAULT_CERT_DIR, DEFAULT_CERT_FILE,
- DEFAULT_CERT_DIR_ENV, DEFAULT_CERT_FILE_ENV and DEFAULT_PRIVATE_DIR.
+Wed Sep 29 16:18:03 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_free): don't free
- the members of the struct. it's left to GC.
+ * vm_dump.c (dump_thread): remove unused optional arguments.
- * ext/openssl/ossl_x509ext.c (ossl_x509_set_config): add for config=.
+Wed Sep 29 13:26:30 2010 Kenta Murata <mrkn@mrkn.jp>
- * ext/openssl/ossl_x509ext.c (Xossl_x509extfactory_initialize):
- add attr readers: issuer_certificate, subject_certificate,
- subject_request, crl and config.
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_save_rounding_mode):
+ return the result of a block.
-Mon Sep 8 18:26:41 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * test/bigdecimal/test_bigdecimal.rb (test_save_rounding_mode):
+ add a test for the above change.
- * lib/webrick/accesslog.rb (AccessLog::setup_params): use req.port
- instead of config[:Port] or req.request_uri.port.
+ * test/bigdecimal/test_bigdecimal.rb (test_save_exception_mode):
+ add a test for the return value of BigDecimal.save_exception_mode.
- * lib/webrick/httprequest.rb (HTTPRequest#meta_vars): ditto.
+Wed Sep 29 12:45:30 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/webrick/httpservlet/filehandler.rb (FileHandler#dir_list): ditto.
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_div2, BigDecimal_add2,
+ BigDecimal_sub2, BigDecimal_mult2, VpLimitRound): remove meaningless
+ casts to get rid of compiler warnings.
- * lib/webrick/config.rb: :Listen option never be used.
+Wed Sep 29 12:35:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/webrick/server.rb (GenericServer#initialize): don't use :Listen
- option and add warning message.
+ * ext/bigdecimal/bigdecimal.c (VPrint, VpToString): fix format.
- * lib/webrick/log.rb (BasicLog#<<): shortcut of log(INFO, ...).
+Wed Sep 29 12:31:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/webrick/httpserver.rb (HTTPServer#accesslog): use << for logging.
+ * lib/rdoc/known_classes.rb (RDoc::KNOWN_CLASSES): add Encoding.
-Sun Sep 7 16:08:28 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Tue Sep 28 20:50:23 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tcltklib/tcltklib.c (lib_mainloop_core): fixed signal-trap bug
+ * tool/config.sub (x64): regularize same as mswin.
- * ext/tk/lib/*.rb : Ruby/Tk works at $SAFE == 4
+Tue Sep 28 20:06:14 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Sep 6 02:26:34 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * vm_dump.c (rb_vm_bugreport): add windows support.
+ based on patches from Peter Weldon at [ruby-core:32551]
- * test/ruby/test_*.rb: assert_same, assert_match, and so on.
+Mon Sep 27 23:30:34 2010 Koichi Sasada <ko1@atdot.net>
-Sat Sep 6 18:45:46 2003 Mauricio Fernandez <batsman.geo@yahoo.com>
+ * insns.def (opt_case_dispatch), vm_insnhelper.c:
+ execute the procedures of "when" clauses by bytecode
+ instead of st_foreach() when the object does not hit
+ prepared hash. [ruby-dev:42304]
- * parse.y (assignable): call rb_compile_error(), not rb_bug().
- [ruby-core:01523]
+Mon Sep 27 15:54:03 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-Sat Sep 6 17:40:41 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * test/net/http/test_https.rb: As always, localhost is not
+ guaranteed to be resolved as 127.0.0.1. But a SSL
+ certificate needs a socket to listen on a specific address
+ where a CN resolves to. On situations where localhost is
+ not 127.0.0.1, these tests are not possible.
- * ext/openssl/ruby_missing.c: rid of unnecessary backward
- compatibility stuff. and remove DEFINE_ALLOC_WRAPPER from
- all sources.
+Mon Sep 27 15:25:05 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
- * ext/openssl/ossl_x509ext.c (X509::Extension.new): new method.
+ * test/net/imap/test_imap.rb: resurrection of r29259.
+ this change depends on minitest 1.7.1.
- * ext/openssl/ossl_x509ext.c (X509::Extension#oid=): new method.
+ * lib/test/unit/assertions.rb: ditto.
- * ext/openssl/ossl_x509ext.c (X509::Extension#value=): new method.
+Sun Sep 26 22:59:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_x509ext.c (X509::Extension#critical=): new method.
+ * tool/config.sub (x86_64-pc-mingw64): regularize.
-Sat Sep 6 01:23:22 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Sun Sep 26 22:21:07 2010 wanabe <s.wanabe@gmail.com>
- * win32/win32.c (CreateChild): need to quote cmd if RUBYSHELL is set.
+ * ext/openssl/ossl_hmac.c (ossl_hmac_hexdigest, ossl_hmac_s_hexdigest),
+ ext/openssl/ossl_pkey_ec.c (ossl_ec_group_set_seed),
+ ext/openssl/ossl_ssl_session.c (ossl_ssl_session_to_der),
+ ext/openssl/ossl_pkcs7.c (numberof): suppress warnings.
+ [ruby-core:31932]
- * win32/win32.c (CreateChild): fix condition about whether to call
- shell or not.
+Sun Sep 26 10:25:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Sep 6 00:36:20 2003 Nobuyoshi Nakada <nobu.nokada@softhome.net>
+ * tool/config.{guess,sub}: updated to automake-1.11.1.
- * Makefile.in (test): phony target.
+Sat Sep 25 22:48:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/mkmf.rb (have_library, find_library): configure by library
- name.
+ * configure.in (LIBRUBY_DLDFLAGS): fix quoting.
- * lib/optparse.rb (OptionParser#order, #permute, #parse): allow an
- array as argument.
+Sat Sep 25 10:30:37 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_*.rb: moved invariants to left side in
- assert_equal, and use assert_nil, assert_raises and so on.
+ * configure.in (LIBRUBY_DLDFLAGS): use -unexported_symbol only
+ when available. http://trac.macports.org/ticket/26341
- * win32/win32.c (isInternalCmd): distinguish command.com and
- cmd.exe.
+Sat Sep 25 10:05:49 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- * win32/win32.c (make_cmdvector): a character just after wildcard
- was ignored. [ruby-core:01518]
+ * configure.in: Always add -mieee for Renesas SH4.
+ Thanks, Nobuhiro Iwamatsu. [Feature #3874] [ruby-core:32548]
-Fri Sep 5 20:27:08 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Sat Sep 25 01:34:41 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_*.rb: replace 'assert(a == b)' with assert_equal(a, b)'
+ * Makefile.in (install-cross): target to install cross-compiling
+ stuff.
-Fri Sep 5 18:00:51 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Fri Sep 24 23:44:59 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/lib/openssl/x509.rb: new method X509::Name::parse.
+ * string.c (sym_call), vm.c (invoke_block_from_c),
+ vm_insnhelper.c (vm_yield_with_cfunc): pass given block.
+ [ruby-core:32075]
- * ext/openssl/ossl_digest.c: add ossl_digest_new().
+ * vm_eval.c (rb_funcall_passing_block): new function to call
+ method with passing given block.
- * ext/openssl/ossl_digest.h: ditto.
+Fri Sep 24 15:50:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/openssl/ossl_cipher.c: add ossl_cipher_new().
+ * string.c (rb_str_to_i): fix rdoc: String#to_i raises an
+ exception when base is invalid. [ruby-core:31685]
- * ext/openssl/ossl_cipher.h: ditto.
+Fri Sep 24 15:28:35 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Sep 5 15:32:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (rb_str_rindex): use rb_enc_prev_char instead of repeated
+ str_nth.
+ patched by Michael Selig [ruby-core:32498]
- * misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): should not
- search delimiter forward if found in backward.
+Fri Sep 24 14:19:12 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-Fri Sep 5 13:32:48 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/test_pty.rb: Same as 229281; existence of PTY class do not
+ guarantee a successful pty operation.
- * test/runner.rb: arguments should be keys.
+Fri Sep 24 06:25:55 2010 Ryan Davis <ryand-ruby@zenspider.com>
-Fri Sep 5 12:09:55 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * lib/minitest/*.rb: Imported minitest 1.7.2 r5879.
+ * test/minitest/*.rb: ditto.
- * test/ruby/test_system.rb (test_system): check existence of ruby
- interpreter.
+Thu Sep 23 23:09:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Sep 5 11:32:17 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * vm_insnhelper.c (vm_get_cref0): cref is stacked only in normal
+ iseqs, so check if it is the case first.
- * lib/optparse.rb (--version): fix assignment/reference order.
+Thu Sep 23 23:08:41 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/optparse.rb (OptionParser#help): new; OptionParser#to_s may
- be deprecated in future.
+ * tool/config.sub: mingw64 should use x86_64. [ruby-core:32514]
- * lib/optparse/version.rb (OptionParser#show_version): hide Object.
+Thu Sep 23 21:40:40 2010 wanabe <s.wanabe@gmail.com>
- * test/runner.rb: fix optparse usage.
+ * ext/socket/raddrinfo.c (init_addrinfo, inspect_sockaddr): suppress
+ warnings. see [ruby-core:31932].
- * test/runner.rb: glob all testsuits if no tests given.
+Thu Sep 23 19:27:57 2010 wanabe <s.wanabe@gmail.com>
-Fri Sep 5 10:42:58 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * thread_win32.c (w32_wait_events, w32_close_handle): suppress warnings.
+ see [ruby-core:31932].
- * test/runner.rb: added. gets testcases from command line and runs it.
+Thu Sep 23 18:54:39 2010 wanabe <s.wanabe@gmail.com>
- * test/ruby/test_gc.rb: remove useless part which was for dumping test
- result.
+ * tool/config.sub: add mingw64.
-Fri Sep 5 09:28:59 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * win32/mkexports.rb (Exports::Mingw64): added.
- * test/ruby/test_gc.rb: added. splitter.rb which I made to split
- sample/test.rb into test/ruby/test_* kindly removed GC test (the
- last section in the original test) to reduce things to be worried.
+ * win32/mkexports.rb (Exports::Mingw32): renamed from Exports::Mingw.
-Fri Sep 5 03:00:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Sep 23 09:01:28 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_iterator.rb (test_block_in_arg): add no block
- given tests.
+ * vm_insnhelper.c (vm_cref_push): no outer cref is needed for proc
+ from method. Bug #3786, Bug #3860, [ruby-core:32501]
- * test/ruby/test_iterator.rb (test_ljump): uncomment LocalJumpError
- test.
+Wed Sep 22 17:12:01 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Fri Sep 5 01:10:11 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * test/openssl/utils.rb (OpenSSL#silent): always restore $VERBOSE.
+ [ruby-dev:42285]
- * test/ruby: tests for ruby itself.
+Wed Sep 22 16:59:40 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * test/ruby/test_*.rb: split sample/test.rb into 28 test/unit testcases.
- some tests could not be translates... search '!!' mark to see it.
+ * test/test_prime.rb (TestPrime#test_new): the warning expected have
+ not been displayed when $VERBOSE == nil. Patch by Shota Fukumori
+ a.k.a. sora_h. [ruby-dev:42272]
+ Recovers $stderr even if StringIO.new fails. Reported by unak.
- * test/csv/test_csv.rb: should require 'csv', not '../lib/csv'. test
- runner should set load path correctly.
+Wed Sep 22 01:55:48 2010 Koichi Sasada <ko1@atdot.net>
-Fri Sep 5 01:03:59 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * bootstraptest/test_method.rb: fix last commit.
- * test/csv/test_csv.rb: close opened files for CSV::IOBuf explicitly.
- opened file cannot be removed under win32 box.
+Wed Sep 22 01:49:52 2010 Koichi Sasada <ko1@atdot.net>
-Thu Sep 4 23:59:40 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * bootstraptest/test_method.rb: add a test for [ruby-core:30534].
- * parse.y (tokadd_string): newlines have no special meanings in
- %w/%W, otherwise they are ignored only when interpolation is
- enabled. [ruby-dev:21325]
+Wed Sep 22 00:52:44 2010 WATANABE Hirofumi <eban@ruby-lang.org>
-Thu Sep 4 19:38:25 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * lib/rdoc/ri/store.rb (save_cache): remove duplicate entries.
- * ext/io/wait/.cvsignore: added.
+Wed Sep 22 00:00:05 2010 Tanaka Akira <akr@fsij.org>
- * ext/openssl/.cvsignore: added.
+ * ext/pathname/pathname.c (path_f_pathname): Pathname() translated
+ from pathname.rb.
-Thu Sep 4 19:28:24 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Tue Sep 21 22:18:30 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * sample/openssl: added. Sample of standard distribution library
- should be locate in sample/{module_name}/*.
+ * tool/mkconfig.rb: fixed build problem on mswin64 introduced in r29278.
- * ext/openssl/sample/*: removed. move to sample/openssl/*.
+Tue Sep 21 02:42:35 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Thu Sep 4 18:02:15 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * test/pathname/test_pathname.rb (TestPathname#test_mkdir): fix typo.
- * test/csv/test_csv.rb: use remove_const to reduce warnings. use
- Dir.tmpdir to locate working files.
+Mon Sep 20 23:23:05 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Sep 4 17:41:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * dir.c (bracket): get rid of scanning at the end of the pattern
+ string, not to raise an exception while globbing command line.
+ [ruby-core:32478]
- * misc/ruby-mode.el (ruby-here-doc-beg-re): underscore also is
- valid delimiter.
+Mon Sep 20 11:25:49 2010 Tanaka Akira <akr@fsij.org>
- * misc/ruby-mode.el (ruby-here-doc-end-match): must quote
- arbitrary string to use as regexp.
+ * ext/pathname/pathname.c (Init_pathname): Pathname#=~ undefinition
+ translated from pathname.rb.
- * misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): must not
- call `ruby-here-doc-end-match' unless `ruby-here-doc-beg-re'
- matched.
+Mon Sep 20 02:34:11 2010 Kenta Murata <mrkn@mrkn.jp>
-Thu Sep 4 15:40:07 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/bigdecimal/bigdecimal.c (check_rounding_mode, BigDecimal_mode):
+ raise ArgumentError instead of TypeError passing invalid modes.
- * test/csv/test_csv.rb: run on test/unit original layer.
+ * test/bigdecimal/test_bigdecimal.rb (test_mode, test_round):
+ change against the above modifications.
-Thu Sep 4 12:54:50 2003 why the lucky stiff <why@ruby-lang.org>
+Sun Sep 19 22:08:39 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * ext/syck/token.c: headerless documents with root-level spacing now
- honored.
+ * lib/mkmf.rb (try_link): rdoc
+ (try_compile): ditto
+ (try_cpp): ditto
+ (try_func): ditto
+ (try_var): ditto
+ (try_run): ditto
+ (egrep_cpp): ditto
-Thu Sep 4 00:06:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sun Sep 19 20:43:33 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * eval.c (mark_frame_adj): need to adjust argv pointer if using
- system's alloca. [ruby-core:01503]
+ * configure.in (--disable-install-doc): disables capi too, in addition
+ to rdoc.
+ (--disable-install-rdoc): a new option for disabling only rdoc.
+ (--disable-install-capi): a new option for disabling only capi.
-Wed Sep 3 21:33:20 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Sun Sep 19 20:37:45 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * test: add test directory. Test::Unit aware testcases and needed
- files should be located in this directory. dir/file name convention;
- test/{module_name}/test_{testcase_name}.rb
- test/{module_name}/{needed_files}
- someday, someone will write testrunner which searches test_*.rb and
- run testcases automatically.
+ * common.mk (clean): removes all documents on cleaning.o
+ (CAPIOUT): new variable.
+ (clean-capi, distclean-capi, realclean-capi): new targets
- * test/csv/*: add testcase for lib/csv.rb.
+ * Makefile.in (clean-capi, distclean-capi, realclean-capi): ditto.
-Wed Sep 3 01:37:09 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * win32/Makefile.sub (clean-capi, distclean-capi, realclean-capi):
+ ditto.
- * io.c (rb_f_gets): should call next_argv() before type check
- current_file. [ruby-list:38336]
+Sun Sep 19 13:44:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Sep 2 20:37:15 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * configure.in (LIBRUBY_SO): fix an oversight of replace
+ RUBY_INSTALL_NAME with RUBY_SO_NAME. a patch from Jeremy Evans
+ at [ruby-core:32474].
- * ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): warning
- for skipping server verification.
+Sun Sep 19 07:48:20 2010 Tanaka Akira <akr@fsij.org>
-Tue Sep 2 23:36:57 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/pathname/pathname.c (path_unlink): Pathname#unlink and
+ Pathname#delete translated from pathname.rb.
- * eval.c (proc_invoke): should retrieve retval when pcall is true.
+Sun Sep 19 06:06:07 2010 Kenta Murata <mrkn@mrkn.jp>
-Tue Sep 2 14:09:20 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/bigdecimal/bigdecimal.c (check_rounding_mode): added for
+ converting symbol to rounding mode number.
- * ext/socket/extconf.rb: check s6_addr8 in in6_addr (Tru64 UNIX).
- the patch is submitted by nmu <nmu@users.sourceforge.jp>.
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_mode, BigDecimal_round):
+ support to specify rounding mode by symbol.
- * ext/socket/getaddrinfo.c (getaddrinfo): should use in6_addr8 on
- some platforms.
+ * test/bigdecimal/test_bigdecimal.rb (test_mode, test_round):
+ add tests for above changes.
- * ext/socket/getnameinfo.c (getnameinfo): ditto.
+Sun Sep 19 05:14:35 2010 Kenta Murata <mrkn@mrkn.jp>
-Tue Sep 2 14:02:19 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/bigdecimal/bigdecimal.c: fix rounding algorithms for half-down
+ and half-even. This change is based on the patch created by Matthew
+ Willson, the reporter of this bug. [Bug #3803] [ruby-core:32136]
- * ext/tcltklib/tcltklib.c (ip_invoke): fixed bug on passing a exception
+ * test/bigdecimal/test_bigdecimal.rb: add tests for above changes.
- * ext/tk/lib/{tk.rb, tkcanvas.rb, tkfont.rb, tktext.rb} :
- bug fix and improvement of font control
+Sat Sep 18 20:09:51 2010 Tanaka Akira <akr@fsij.org>
-Tue Sep 2 09:51:36 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/pathname/pathname.c (path_each_entry): Pathname#each_entry
+ translated from pathname.rb.
- * eval.c (rb_eval): should not handle exceptions within rescue
- argument. [ruby-talk:80804]
+Fri Sep 17 23:44:07 2010 Kouhei Sutou <kou@cozmixng.org>
-Tue Sep 2 00:44:37 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rexml/xpath_parser.rb, test/rexml/test_xpath.rb:
+ add missing method availability check. [ruby-core:32447]
+ Reported by Wiebe Cazemier. Thanks!!!
- * re.c (rb_memsearch): fix overrun. [ruby-talk:80759]
+Fri Sep 17 23:23:26 2010 Kouhei Sutou <kou@cozmixng.org>
-Tue Sep 2 00:41:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/rexml/test_sax.rb: don't use thread and sleep to avoid slow test.
- * ext/iconv/iconv.c (map_charset): use lower case keys.
+Fri Sep 17 23:10:44 2010 Kouhei Sutou <kou@cozmixng.org>
- * ext/iconv/iconv.c (iconv_fail): just yield error and return the
- result if a block is given.
+ * test/rexml/test_core.rb: enable.
- * ext/iconv/iconv.c (iconv_convert): yield error and append the
- result if a block is given.
+Fri Sep 17 22:46:02 2010 Kouhei Sutou <kou@cozmixng.org>
- * ext/iconv/charset_alias.rb (charset_alias): optional third
- argument.
+ * test/rexml/: untabify.
- * ext/iconv/charset_alias.rb (charset_alias): use CP932 instead of
- SHIFT_JIS on cygwin.
+Fri Sep 17 22:29:56 2010 Kouhei Sutou <kou@cozmixng.org>
-Mon Sep 1 18:34:25 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/rexml/: fix fixture data path. All REXML tests are worked.
- * eval.c (rb_eval): make tail recursion in ELSE clause of
- RESCUE a jump.
+Fri Sep 17 22:15:15 2010 Kouhei Sutou <kou@cozmixng.org>
-Mon Sep 1 18:00:02 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/rexml/test_listener.rb: remove needless codes.
- * parse.y (aref_args): forgot to call NEW_SPLAT(). reported by
- Dave Butcher.
+Fri Sep 17 22:12:23 2010 Kouhei Sutou <kou@cozmixng.org>
- * eval.c (Init_Thread): protect thgroup_default. suggested by Guy
- Decoux in [ruby-talk:80623]
+ * test/rexml/: import REXML tests from
+ http://www.germane-software.com/repos/rexml/trunk/test/.
+ Many tests are failed temporary. I'll fix them quickly. Sorry.
-Mon Sep 1 16:59:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Sep 17 16:48:49 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
- * eval.c (rb_thread_switch): add RESTORE_EXIT; exit by another
- thread termination.
+ * test/io/console/test_io_console.rb (TestIO_Console::helper):
+ PTY.open is not guaranteed to work. On my machine opening a
+ pty is prohibited via process control group. On those cases
+ exceptions shall occur, and that doesn't mean our fault.
+ Skip those tests on such situations.
- * eval.c (rb_thread_start_0): should not error_print() within
- terminated thread, because $stderr used by it might be
- overriden now. [ruby-dev:21280]
+Fri Sep 17 08:30:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Aug 31 22:46:55 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * lib/tracer.rb: count only non-internal libraries in stack trace,
+ ignoring custom_require. [ruby-core:31858]
- * eval.c (TAG_DST()): take no argument.
+Fri Sep 17 02:18:41 2010 Akinori MUSHA <knu@iDaemons.org>
- * process.c (p_gid_sw_ensure): return VALUE.
+ * tool/mkconfig.rb: Fix build with m4 1.4.15 generating duplicate
+ lines in config.status. According to nobu, the mswin32 port may
+ depend on the piece of code in question, so the behavior is left
+ unchanged on mswin32.
-Sun Aug 31 22:27:10 2003 Hidetoshi NAGAI <nagai@dumbo.ai.kyutech.ac.jp>
+Thu Sep 16 23:47:59 2010 Tanaka Akira <akr@fsij.org>
- * process.c (p_gid_sw_ensure): lack of function type
+ * ext/pathname/pathname.c (path_opendir): Pathname#opendir translated
+ from pathname.rb.
-Sun Aug 31 12:25:06 2003 Nobuyoshi Nakada <nobu.nokada@softhome.net>
+Thu Sep 16 21:40:37 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/optparse.rb: --version takes an optional argument; "all" or
- a list of package names.
+ * lib/test/unit.rb (Test::Unit::GlobOption): merged RejectOption.
-Sun Aug 31 10:17:02 2003 Tadayoshi Funaba <tadf@dotrb.org>
+ * test/runner.rb: utilize GlobOption.
- * lib/date/format.rb: yyyy/mm is not an acceptable format.
+Thu Sep 16 21:31:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/time.rb: follow above.
+ * lib/rdoc/ri/driver.rb (RDoc::RI::Driver.setup_options)
+ (RDoc::RI::Driver.fixup_options): split from process_args.
+ libraries should not parse ARGV inside, since it's a task of
+ applications, not libraries.
-Sat Aug 30 14:25:43 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Sep 16 21:02:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_iter_break): should not call TAG_JUMP directly.
+ * lib/rdoc/ri/paths.rb (RDoc::RI::Paths.each): HOMEDIR can be nil
+ if $HOME is unset.
-Sat Aug 30 03:58:21 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Sep 16 14:50:42 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
- * eval.c (struct BLOCK): remove BLOCKTAG, use scope instead.
+ * test/ruby/test_file_exhaustive.rb (TestFileExhaustive::test_expand_path):
+ ENV["HOME"] might not be set. On those cases without it an
+ exception raises here, which effectively disables later
+ tests on this method.
- * eval.c (POP_TAG): no longer propagate retval. retval is now set
- directly by localjump_destination().
+Thu Sep 16 08:30:28 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (localjump_destination): new function to cast
- return/break local jump.
+ * sprintf.c (rb_f_sprintf): fix rdoc. pointed out by Tomoyuki
+ Chikanaga at [ruby-core:32395], and a patch from Daniel
+ Bovensiepen at [ruby-core:32403].
- * eval.c (rb_yield_0): stop TAG_RETURN/TAG_BREAK escaping.
+Thu Sep 16 08:27:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Aug 29 22:35:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+ * ext/etc/extconf.rb: use expanded sysconfdir with empty DESTDIR.
+ [ruby-core:32394]
- * bigdecimal.c *.html: The 2nd arg. for add,sub,mult, and div is 0,
- then result will be the same as +,-,*,/ respectively.
+Thu Sep 16 06:07:24 2010 Tanaka Akira <akr@fsij.org>
-Fri Aug 29 17:30:15 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/pathname/pathname.c (path_rmdir): Pathname#rmdir translated
+ from pathname.rb.
- * process.c: bug fix
+Thu Sep 16 00:36:25 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * process.c: add rb_secure(2) to methods of Process::{UID,GID,Sys}
+ * ext/readline/extconf.rb: Remove Readline 6 check because
+ Ruby's license is now GPLv3 compatible. [ruby-core:28736]
- * process.c: deny handling IDs during evaluating the block given to
- the Process::{UID,GID}.switch method
+Thu Sep 16 00:26:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/tcltklib/tcltklib.c : some methods have no effect if on slave-IP
+ * COPYING: change Ruby's License from a dual license with GPLv2
+ to a dual license with 2-clause BSDL.
+ [ruby-dev:42166] [ruby-core:31971]
+ [ruby-dev:39167] [ruby-core:25272]
- * ext/tcltklib/tcltklib.c : can create a interpreter without Tk
+ * COPYING.ja: ditto.
- * ext/tcltklib/tcltklib.c : bug fix on handling exceptions
+ * BSDL: added. this is from The FreeBSD License.
- * ext/tcltklib/MANUAL.euc : modify
+Wed Sep 15 21:07:06 2010 Tanaka Akira <akr@fsij.org>
- * ext/tk/lib/tk.rb : freeze some core modules
+ * ext/pathname/pathname.c (path_mkdir): Pathname#mkdir translated
+ from pathname.rb.
- * ext/tk/lib/multi-tk.rb : more secure
+Wed Sep 15 13:37:00 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
- * ext/tk/lib/tk.rb: TkVariable.new(array) --> treat the array as the
- Tk's list
+ * test/net/imap/test_imap.rb: "localhost" not guaranteed to
+ resolve to "127.0.0.1". On my machine it is "::1" instead.
+ The problem is, you have to connect to the imaps server via
+ the canonical name written in a server certificate, and that
+ of the server.cert is "localhost". So you have to listen to
+ the address of what "localhost" resolves to. I think this
+ situation cannot be resolved in a handy manner because the
+ test "test_imaps_post_connection_check" is actually
+ expecting to connect to a server via an address other than
+ the CN. On my machine several assertions won't pass because
+ the test cannot connect to the server.
- * ext/tk/lib/tk.rb: improve accessibility of TkVariable object
+Wed Sep 15 09:12:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/lib/tk.rb, ext/tk/lib/tkfont.rb, ext/tk/lib/tkcanvas.rb,
- ext/tk/lib/tktext.rb : fix bug of font handling
+ * io.c (rb_io_puts): fix for wide char encoding strings.
+ [ruby-dev:42212]
- * ext/tk/lib/tkfont.rb TkFont.new() accepts compound fonts
+Wed Sep 15 07:27:52 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Aug 28 22:07:12 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * string.c (rb_str_format_m): mentioned about Hash argument. a patch
+ from Daniel Bovensiepen at [ruby-core:32386].
- * variable.c (rb_autoload_load): call const_missing if autoloading
- constant is not defined to allow hook.
+ * sprintf.c (get_hash): ditto, and fix typo.
- * eval.c (rb_eval): use rb_const_get_from() instead of
- rb_const_get_at().
+Wed Sep 15 07:22:20 2010 Tanaka Akira <akr@fsij.org>
- * eval.c (is_defined): forgot to check NODE_COLON3.
+ * ext/pathname/pathname.c (path_entries): Pathname#entries translated
+ from pathname.rb.
-Thu Aug 28 17:30:24 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Wed Sep 15 02:13:44 2010 Aaron Patterson <aaron@tenderlovemaking.com>
- * variable.c (rb_const_get_0): should check constants defined in
- included modules, if klass is Object. [ruby-talk:79302]
+ * ext/fiddle/closure.c : Don't use FFI closure alloc on OpenBSD.
+ Thanks Jeremy Evans! [ruby-core:32384]
- * numeric.c (check_uint): check should be done using UINT_MAX, not
- INT_MAX. this fix is submitted by Lyle Johnson
- <lyle@knology.net> in [ruby-core:01486]
+Tue Sep 14 20:17:48 2010 Tanaka Akira <akr@fsij.org>
-Thu Aug 28 05:02:52 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/pathname/pathname.c (path_s_getwd): Pathname.getwd and
+ Pathname.pwd translated from pathname.rb.
- * parse.y (singleton): typo fixed (ruby-bugs-ja:PR#562)
+Tue Sep 14 05:13:04 2010 Tanaka Akira <akr@fsij.org>
-Thu Aug 28 02:37:45 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/pathname/pathname.c (path_s_glob): Pathname.glob translated
+ from pathname.rb.
- * eval.c (rb_eval): *a = [1,2] now assigns [[1,2]] to a.
- consistent with *a = [1], which set [[1]] to a.
+Tue Sep 14 01:24:51 2010 Yutaka Kanemoto <kanemoto@ruby-lang.org>
- * node.h: merge NODE_RESTARY to NODE_SPLAT.
+ * ext/socket/raddrinfo.c (ruby_getaddrinfo__aix): suppress a
+ warning.
- * parse.y: rules simplified a bit by removing NODE_RESTARY.
+Mon Sep 13 20:48:30 2010 Tanaka Akira <akr@fsij.org>
- * sample/test.rb: updated for new assignment behavior.
+ * ext/pathname/pathname.c (path_zero_p): Pathname#zero? translated
+ from pathname.rb.
-Wed Aug 27 22:33:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Sep 13 19:56:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * error.c (rb_bug): should not use other methods; this function is
- not for ordinary use. [ruby-dev:21259]
+ * ext/socket/rubysocket.h (__DARWIN_ALIGNBYTES): workaround of a
+ bug in system header of darwin 9. [ruby-core:32341]
-Wed Aug 27 15:07:57 2003 Minero Aoki <aamine@loveruby.net>
+Mon Sep 13 18:11:55 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/smtp.rb (check_response): AUTH CRAM-MD5 returns 334
- response. [ruby-list:38279]
+ * lib/mkmf.rb (try_do): fix typo. a patch from Peter Weldon
+ at [ruby-core:32327].
-Wed Aug 27 05:10:15 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Sep 13 10:12:09 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * win32/win32.c (map_errno): support winsock error.
+ * util.c (ruby_strtod): reject Float('0x0.').
+ [ruby-dev:42239] Bug #3820
- * win32/win32.c (pipe_exec, CreateChild, poll_child_status, waitpid,
- kill, link, rb_w32_rename, unixtime_to_filetime, rb_w32_utime):
- pass errno to map_errno().
+Mon Sep 13 09:23:58 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * win32/win32.c (rb_w32_select, rb_w32_accept, rb_w32_bind,
- rb_w32_connect, rb_w32_getpeername, rb_w32_getsockname,
- rb_w32_getsockopt, rb_w32_ioctlsocket, rb_w32_listen, rb_w32_recv,
- rb_w32_recvfrom, rb_w32_send, rb_w32_sendto, rb_w32_setsockopt,
- rb_w32_shutdown, rb_w32_socket, rb_w32_gethostbyaddr,
- rb_w32_gethostbyname, rb_w32_gethostname, rb_w32_getprotobyname,
- rb_w32_getprotobynumber, rb_w32_getservbyname, rb_w32_getservbyport,
- rb_w32_fclose, rb_w32_close): use map_errno().
+ * ext/openssl/ossl_bn.c (ossl_bn_is_prime): fix comparison
+ with rb_scan_args. Before this fix, OpenSSL::BN#prime?
+ is fully broken. [ruby-dev:42225]
- * win32/win32.h: add winsock errors.
+Mon Sep 13 06:45:24 2010 Tanaka Akira <akr@fsij.org>
-Tue Aug 26 23:53:23 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/pathname/pathname.c (path_writable_real_p):
+ Pathname#writable_real? translated from pathname.rb.
- * lib/ostruct.rb (OpenStruct::method_missing): prohibit modifying
- frozen OpenStruct. [ruby-talk:80214]
+Sun Sep 12 21:21:50 2010 Tadayoshi Funaba <tadf@dotrb.org>
-Tue Aug 26 20:03:50 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/date.rb: [ruby-core:32096] Thanks Colin Bartlett.
- * lib/mkmf.rb (create_tmpsrc): add the hook for source.
- [ruby-list:38122]
+Sun Sep 12 19:30:27 2010 Tanaka Akira <akr@fsij.org>
-Tue Aug 26 15:59:53 2003 why the lucky stiff <why@ruby-lang.org>
+ * ext/pathname/pathname.c (path_world_writable_p):
+ Pathname#world_writable? translated from pathname.rb.
- * implicit.c (syck_type_id_to_taguri): corrected detection of
- x-private types.
+Sun Sep 12 09:16:06 2010 Tanaka Akira <akr@fsij.org>
-Sun Aug 24 01:02:48 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/pathname/pathname.c (path_writable_p): Pathname#writable?
+ translated from pathname.rb.
- * file.c (file_expand_path): performance improvement.
- [ruby-talk:79748]
+Sun Sep 12 08:36:15 2010 Tanaka Akira <akr@fsij.org>
-Sat Aug 23 23:41:16 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * process.c (rlimit_resource_name2int): support more limits:
+ RLIMIT_MSGQUEUE, RLIMIT_NICE, RLIMIT_RTPRIO, RLIMIT_RTTIME and
+ RLIMIT_SIGPENDING.
+ (Init_process): ditto.
+ patch by Run Paint Run Run. [ruby-core:32262]
- * file.c (rb_file_s_expand_path): avoid calling rb_scan_args() for
- apparent cases. [ruby-talk:79748]
+Sun Sep 12 04:27:13 2010 Tanaka Akira <akr@fsij.org>
-Sat Aug 23 18:56:53 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * process.c (rlimit_resource_name2int): use STRCASECMP to avoid
+ ALLOCA_N.
- * ext/nkf/nkf.c (rb_nkf_putchar): should use rb_str_resize() to just
- resize a string, rb_str_cat() disallows NULL. [ruby-dev:21237]
+Sat Sep 11 16:47:41 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Aug 23 16:48:41 2003 Keiju Ishitsuka <keiju@ishitsuka.com>
+ * hash.c (ruby_setenv): raise if putenv and SetEnvironmentVariable
+ failed, because of the restriction of the size on Windows.
+ based on a patch from Peter Weldon at [ruby-core:32304]. fix:
+ Bug#3812, [ruby-core:32250]
- * lib/irb/ruby-lex.rb: bug fix for "foo" !~ /bar/. [ruby-talk:79942]
+Sat Sep 11 15:19:57 2010 Eric Hodel <drbrain@segment7.net>
-Sat Aug 23 15:59:58 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/webrick/httpauth/digestauth.rb (WEBrick::Config::DigestAuth):
+ Add documentation
- * eval.c (rb_eval, rb_iterate, block_pass): reduce PUSH/POP_TAG and
- EXEC_TAG() for retry. [ruby-dev:21216]
+ * lib/webrick/config.rb (WEBrick::Config::DigestAuth): Add
+ documentation
-Sat Aug 23 02:32:33 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat Sep 11 12:32:05 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_yield_splat): should check if "values" is array.
+ * include/ruby/intern.h (rb_set_kcode, rb_get_kcode): removed
+ zombie prototype declarations. a patch from Eric Hodel
+ at [ruby-core:32305].
- * enum.c (each_with_index_i): typo.
+Sat Sep 11 06:53:12 2010 Tanaka Akira <akr@fsij.org>
-Fri Aug 22 17:07:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/pathname/pathname.c (path_symlink_p): Pathname#symlink?
+ translated from pathname.rb.
- * enum.c (inject_i): use rb_yield_values.
+Fri Sep 10 23:03:43 2010 Tanaka Akira <akr@fsij.org>
- * enum.c (each_with_index_i): ditto.
+ * ext/pathname/pathname.c (path_sticky_p): Pathname#sticky? translated
+ from pathname.rb.
- * eval.c (rb_yield_splat): new function to call "yield *values".
+Fri Sep 10 19:11:13 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * string.c (rb_str_scan): use rb_yield_splat().
+ * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#continue): add
+ method for generating HTTP/1.1 100 continue response if the client
+ expects it, otherwise does nothing. Patch by Brian Candler.
+ ref #855.
-Fri Aug 22 06:13:22 2003 why the lucky stiff <why@ruby-lang.org>
+ * test/webrick/test_httprequest.rb: test added.
- * ext/syck/rubyext.c: refactoring of the transfer method
- dispatch. added yaml_org_handler for faster dispatch of
- transfers to base types.
+Fri Sep 10 17:49:34 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * lib/yaml/rubytypes.rb: removed handling of builtins from
- Ruby library.
+ * ext/openssl/lib/openssl/x509-internal.rb: removed unused local
+ variable.
- * ext/syck/token.c: quoted and block scalars are now implicit !str
+ * test/openssl/*: less warnings while test running with -w.
- * ext/syck/implicit.c: empty string detected as !null.
+Fri Sep 10 16:49:20 2010 Akinori MUSHA <knu@iDaemons.org>
-Fri Aug 22 01:00:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * class.c (rb_scan_args): Add support for optional keyword
+ argument hash. [ruby-dev:42221] [ruby-dev:38048]
- * eval.c (block_pass): improve passing current block.
+ * README.EXT, README.EXT.ja: Update documentation accordingly.
-Fri Aug 22 00:13:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+ * dir.c (dir_initialize): Make use of the new rb_scan_args()
+ feature.
- * ext/bigdecimal/bigdecimal.c: Int. overflow bug in multiplication
- fixed, and VpNmlz() speed up.
+ * io.c (rb_io_s_popen, rb_scan_open_args, rb_io_initialize)
+ (rb_io_s_pipe, open_key_args, io_s_foreach, io_s_readlines)
+ (rb_io_s_read, rb_io_set_encoding): Ditto.
-Wed Aug 20 16:44:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * transcode.c (str_transcode, econv_args)
+ (econv_primitive_convert): Ditto.
- * ext/socket/socket.c (ruby_connect): many systems seem to have
- a problem in select() after EINPROGRESS. [ruby-list:38080]
+ * ext/zlib/zlib.c (rb_gzreader_initialize): Ditto.
-Wed Aug 20 01:31:17 2003 why the lucky stiff <why@ruby-lang.org>
+Fri Sep 10 10:33:18 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/syck/syck.h: Parser definition problems on HP-UX.
- [ruby-talk:79389]
+ * random.c (rb_genrand_ulong_limited): renamed from
+ rb_rand_internal and now this is public API.
- * ext/syck/handler.c (syck_hdlr_get_anchor): Memory leak.
+ * include/ruby/ruby.h (rb_genrand_ulong_limited): added.
- * ext/syck/syck.s (syck_io_file_read): Bad arguments to fread.
+ * bignum.c (big_sparse_p): use rb_genrand_ulong_limited.
- * ext/syck/rubyext.c: Tainting issues.
+Fri Sep 10 13:07:22 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Tue Aug 19 23:20:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+ * ext/digest/lib/digest.rb: removed unused exception variable
+ assignment to avoid a warning.
- * ext/bigdecimal/bigdecimal.c .h .html: to_s("+") implemented.
+Fri Sep 10 07:29:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/bigdecimal/lib/bigdecimal/math.rb: E implemented.
+ * ext/etc/etc.c (etc_systmpdir): assume system default tmpdir
+ safe. [ruby-dev:42089]
-Tue Aug 19 07:47:09 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Fri Sep 10 07:03:23 2010 Tanaka Akira <akr@fsij.org>
- * lib/webrick/ssl.rb: new file; SSL/TLS enhancement for GenericServer.
+ * ext/pathname/pathname.c (path_size_p): Pathname#size? translated from
+ pathname.rb.
- * lib/webrick/https.rb: SSLSocket handling is moved to webrick/ssl.rb.
+Fri Sep 10 02:15:29 2010 Tanaka Akira <akr@fsij.org>
- * lib/webrick/compat.rb (File::fnmatch): remove old migration code.
+ * ext/socket/option.c (inspect_peercred): support OpenBSD-current.
+ patch by Jeremy Evans. [ruby-core:32240]
- * lib/webrick/httpserver.rb (HTTPServer#run): ditto.
+Thu Sep 9 23:25:53 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/webrick/server.rb (GenericServer#listen): the body of this
- method is pull out as Utils::create_lisnteners.
+ * vm.c (vm_backtrace_each): skip allocator frames which have no
+ name. [ruby-core:32231]
- * lib/webrick/utils.rb (Utils::create_lisnteners): new method.
+Thu Sep 9 22:39:08 2010 Tanaka Akira <akr@fsij.org>
- * lib/webrick/server.rb (GenericServer#start): should rescue
- unknown errors. and refine comments.
+ * ext/pathname/pathname.c (path_size): Pathname#size translated from
+ pathname.rb.
- * ext/openssl/lib/openssl/ssl.rb (SSLServer#accept): should close
- socket if SSLSocket raises error.
+Thu Sep 9 22:34:48 2010 wanabe <s.wanabe@gmail.com>
-Tue Aug 19 11:19:33 2003 Shugo Maeda <shugo@ruby-lang.org>
+ * compile.c (case_when_optimizable_literal): When float value can be
+ treated as integer, add to table hash of case that way.
+ based on a patch from Ikuo KOBORI. [ruby-dev:42038]
- * io.c (next_argv): should not call GetOpenFile() if rb_stdout is
- not a IO (T_FILE).
+ * insns.def (opt_case_dispatch): ditto.
-Tue Aug 19 07:47:09 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * test/ruby/test_case.rb: add tests.
- * ext/openssl/ossl_ssl.c: sync_close is moved to SSLSocket as
- a builtin.
+Thu Sep 9 17:15:15 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/openssl/lib/openssl/buffering.rb (Buffering#close): ditto.
+ * test/net/http/test_https.rb (test_identity_verify_failure): follows
+ the SSL hostname check error message of openssl.
- * ext/openssl/lib/openssl/buffering.rb (Buffering#puts): should
- add a return to the tails of each line.
+Thu Sep 9 10:44:46 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/openssl/lib/openssl/ssl.rb: new class OpenSSL::SSL::SSLServer.
+ * test/ruby/test_env.rb (test_aset): OpenBSD acts like NetBSD in
+ that it ignores characters after = in ENV.
+ patched by Jeremy Evans [ruby-core:32184]
- * ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): use sync_close.
+Thu Sep 9 09:02:01 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/openssl/sample/echo_svr.rb: use SSLServer.
+ * tool/rbinstall.rb (install?): gemspec filename should include
+ its version. patched by Luis Lavena [ruby-core:32165]
- * ext/openssl/sample/echo_cli.rb: add example of SSLSocket#sync_close.
+Wed Sep 8 22:46:31 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Tue Aug 19 01:24:34 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_ssl.c (ssl_get_error): Thread context switch was
+ blocked on Windows while blocking call for SSLSocket. Need to
+ convert errno for letting rb_io_wait_readable detect EWOULDBLOCK.
+ Patch by arton. ref #3794.
- * ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): Mac OS X standard
- headers are inconsistent at this macro. [ruby-core:01432]
+Wed Sep 8 20:56:57 2010 Tanaka Akira <akr@fsij.org>
- * ext/curses/extconf.rb: check if _XOPEN_SOURCE_EXTENDED breaks.
+ * ext/pathname/pathname.c (path_setgid_p): Pathname#setgid? translated
+ from pathname.rb.
- * ext/tcltklib/stubs.c: Status macro in X11/Xthreads.h bothers
- winspool.h
+Wed Sep 8 06:25:41 2010 Tanaka Akira <akr@fsij.org>
- * instruby.rb: make list at first instead of iterator.
- [ruby-talk:79347]
+ * ext/pathname/pathname.c (path_setuid_p): Pathname#setuid? translated
+ from pathname.rb.
-Mon Aug 18 11:23:11 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Sep 7 21:03:35 2010 Tanaka Akira <akr@fsij.org>
- * dir.c (glob_helper): preserve raw order for **.
+ * ext/pathname/pathname.c (path_readable_real_p):
+ Pathname#readable_real? translated from pathname.rb.
-Sun Aug 17 23:39:55 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Sep 6 23:07:25 2010 Tanaka Akira <akr@fsij.org>
- * ext/openssl/extconf.rb (HAVE_VA_ARGS_MACRO): need to compile.
+ * ext/pathname/pathname.c (path_world_readable_p):
+ Pathname#world_readable? translated from pathname.rb.
-Sun Aug 17 17:10:03 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+Mon Sep 6 11:03:13 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/openssl/lib/openssl/ssl.rb (SSLSocket#sync_close=): add a
- method to specify if the underlying IO will be closed in
- SSLSocket#close.
+ * Fixed wrong check of missing functions. Patch by Adrian Quark.
+ ref #3400
+ The patch contains following comment:
+ This patch should avoid unnecessary incompatibility with future
+ versions of Openssl. Changes suggested by bmaher_at_amazon.com.
- * ext/openssl/lib/openssl/buffering.rb: add forwarders to
- setsockopt, getsockopt and fcntl.
+Mon Sep 6 10:46:55 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/openssl/lib/net/protocols.rb: enable sync for SSLSocket.
+ * Fixed exception message for SSL post connection check failure. Patch
+ by Paul Betteridge. ref [Bug #3704]
-Sun Aug 17 11:32:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Sep 6 10:31:59 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/extmk.rb (extmake): should not force to remake Makefile when
- installation and so on.
+ * ext/readline/readline.c (readline_s_get_line_buffer):
+ Readline.line_buffer should return locale string.
+ [ruby-dev:42184] #3791
-Sat Aug 16 23:58:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Sep 6 09:47:24 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * marshal.c (w_symbol, w_object): get rid of warnings.
+ * util.c (ruby_strtod): check there is at least 1 digit after
+ "0x" before ".". [ruby-dev:42183] #3790
- * re.c (rb_memsearch): ditto.
+Mon Sep 6 09:44:50 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * time.c (time_dump): ditto.
+ * util.c (ruby_strtod): check integer overflow.
+ [ruby-dev:42180] #3789
- * ext/extmk.rb (extmake): not continue making when extconf.rb
- failed.
+Mon Sep 6 06:17:21 2010 Tanaka Akira <akr@fsij.org>
- * ext/openssl/extconf.rb: check __VA_ARGS__ macro more precisely.
+ * ext/pathname/pathname.c (path_readable_p): Pathname#readable?
+ translated from pathname.rb.
- * ext/openssl/ossl.h: remove version.h dependency.
+Sun Sep 5 23:02:34 2010 Tanaka Akira <akr@fsij.org>
- * ext/openssl/ruby_missing.h: ditto.
+ * ext/pathname/pathname.c (path_owned_p): Pathname#owned?
+ translated from pathname.rb.
- * lib/mkmf.rb (pkg_config): use --libs output except with
- only-L for other options. [ruby-list:38099]
+Sat Sep 4 23:48:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/mkmf.rb (create_makefile): separate rule for static
- library from shared object.
+ * file.c (rb_file_s_readlink): symlink target should be in
+ filesystem encoding.
- * win32/Makefile.sub, bcc32/Makefile.sub, wince/Makefile.sub:
- define exec_prefix and libdir.
+Sat Sep 4 10:40:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Aug 15 23:15:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+ * load.c (ruby_init_ext): export for golfers.
- * ext/bigdecimal/bigdecimal.c .h: Bug in combination of limit & div
- method fixed.
+ * vm_core.h (rb_iseq_eval, rb_iseq_compile_with_option): ditto.
- * ext/bigdecimal/lib/bigdecimal/math.rb: atan() & sqrt() added.
+Sun May 23 17:29:41 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
-Fri Aug 15 12:01:43 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * common.mk (capi): uses a timestamp file to get rid of
+ generating twice.
- * configure.in (HUGE_ST_INO): check whether struct stat.st_ino
- is larger than long. [ruby-dev:21194]
- http://www.geocities.co.jp/SiliconValley-PaloAlto/1409/ruby/beos.html
+Fri Jun 18 01:33:21 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * error.c (syserr_eqq): errno might exceed Fixnum limit.
+ * enc/Makefile.in (realclean): has been missing. necessary
+ for make realclean-enc.
- * error.c (Init_Exception): moved base initialization from
- init_syserr().
+Fri Sep 3 23:51:26 2010 Tanaka Akira <akr@fsij.org>
- * inits.c (rb_call_inits): postpone initializing errnos until
- Bignum is available.
+ * ext/pathname/pathname.c (path_socket_p): Pathname#socket?
+ translated from pathname.rb.
-Fri Aug 15 12:01:43 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Sep 3 06:40:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): needed to let
- keyname() and so on be declared.
+ * ext/pty/pty.c (chfunc): pass through exceptions.
- * ext/curses/curses.c (curses_resizeterm, window_resize):
- arguments conflicted with macros in term.h.
+ * io.c (rb_io_bufwrite, rb_io_bufread): added.
- * ext/curses/curses.c (Curses module methods): ensure
- initialized. [ruby-dev:21191]
+ * process.c (rb_fork_err): protect from exceptions.
-Fri Aug 15 02:08:53 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Sep 3 06:16:07 2010 Tanaka Akira <akr@fsij.org>
- * gc.c (id2ref): recycle check should be done by klass == 0.
- [ruby-core:01408]
+ * ext/pathname/pathname.c (path_pipe_p): Pathname#pipe?
+ translated from pathname.rb.
-Fri Aug 15 01:34:23 2003 Michal Rokos <m.rokos@sh.cvut.cz>
+Fri Sep 3 06:14:40 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_pkey.c: move generate_cb here
+ * ext/pty/pty.c (chfunc): restore errno from SystemCallError and
+ propagate proper exception to the parent. [ruby-dev:41965]
- * ext/openssl/ossl_pkey_{dh|dsa|rsa}.c: adapt to this cb
+Thu Sep 2 22:10:38 2010 Tanaka Akira <akr@fsij.org>
- * ext/openssl/openssl_missing.[ch]: add (0.9.6x, x<j) missing BN funcs
+ * ext/pathname/pathname.c (path_file_p): Pathname#file?
+ translated from pathname.rb.
- * ext/openssl/ossl_bn.c: use supplied funcs from openssl_missing.c
+Thu Sep 2 09:12:02 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Aug 15 00:38:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+ * win32/win32.c (rb_w32_spawn, rb_w32_aspawn): don't forget to free
+ memory.
- * ext/bigdecimal/bigdecimal.c: Bug in div method fixed.
+Thu Sep 2 09:01:13 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/bigdecimal/lib/bigdecimal/math.rb: Newly added.
+ * win32/win32.c (CreateChild): unicodize.
- * ext/bigdecimal/sample/pi.rb: Changed so as to use math.rb.
+ * win32/win32.c (rb_w32_spawn, rb_w32_aspawn): convert arguments of
+ CreateChild() from ACP to WideChar.
-Thu Aug 14 21:19:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Thu Sep 2 06:53:43 2010 Tanaka Akira <akr@fsij.org>
- * eval.c (Init_Thread): Continuation#[] added. [ruby-talk:79028]
+ * ext/pathname/pathname.c (path_directory_p): Pathname#directory?
+ translated from pathname.rb.
-Thu Aug 14 20:03:34 2003 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+Wed Sep 1 22:03:41 2010 Tanaka Akira <akr@fsij.org>
- * ext/win32ole/win32ole.c (OLE_FREE): should not call
- ole_message_loop.
+ * ext/pathname/pathname.c (path_grpowned_p): Pathname#grpowned?
+ translated from pathname.rb.
- * ext/win32ole/win32ole.c (ole_event_free): ditto.
+Wed Sep 1 17:39:02 2010 Ryan Davis <ryand-ruby@zenspider.com>
- * ext/win32ole/win32ole.c (ole_initialize): stop calling
- OleUninitialize at exit.
+ * lib/minitest/*.rb: Imported minitest 1.7.1 r5835.
+ * test/minitest/*.rb: ditto.
-Thu Aug 14 11:27:37 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Sep 1 16:50:42 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * gc.c (rb_data_object_alloc): check type of 1st argument.
- [ruby-dev:21192]
+ * string.c (tr_setup_table): optimized. don't create hash objects
+ when given pattern is ASCII only.
-Thu Aug 14 00:21:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * string.c (tr_find): ditto.
- * parse.y (mlhs_node): should allow "::Foo" (colon3) as lhs.
+Wed Sep 1 14:35:29 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * parse.y (lhs): ditto.
+ * array.c (rb_ary_rotate_m): fix typo of rdoc.
+ patched by Andrei Kulakov [ruby-core:31975]
- * parse.y (yylex): should return tCOLON3 right after kCLASS.
- [ruby-talk:78918]
+Wed Sep 1 14:33:36 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * error.c (exc_initialize): was converting argument to string too
- eagerly. Only check was needed. [ruby-talk:78958]
+ * enum.c (enum_zip): fix typo of rdoc.
+ patched by Andrei Kulakov [ruby-core:31974]
-Wed Aug 13 23:31:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+Wed Sep 1 12:56:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/bigdecimal/bigdecimal.c .h .html: Ambiguity of
- BigDecimal::limit removed.
+ * thread.c (ruby_suppress_tracing): restore the state and invoke
+ the func with normal state. a patch from Satoshi Shiba <shiba
+ AT rvm.jp> at [ruby-dev:42162]. [ruby-core:31783]
-Wed Aug 13 19:21:34 2003 Christian Neukirchen <chneukirchen@yahoo.de>
+Tue Aug 31 21:10:23 2010 Tanaka Akira <akr@fsij.org>
- * lib/webrick/https.rb (HTTPServer#run): should set syncing-mode
- to SSLSocket. [ruby-talk:78919]
+ * ext/pathname/pathname.c (path_exist_p): Pathname#exist? translated
+ from pathname.rb.
-Wed Aug 13 18:13:49 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Aug 31 17:32:34 2010 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * eval.c (POP_BLOCK): turn on BLOCK_LEFT flag when leaving block.
+ * ext/tk/stubs.c: fix [Bug #3771] "VC++ can't make ext/tk with enabling
+ stubs". Thanks, Akio Tajima [ruby-dev:42159].
- * eval.c (proc_invoke): unpack return/break destination when block
- is already left.
+Tue Aug 31 03:42:14 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Aug 13 15:58:31 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * string.c (tr_setup_table): fix bug in r29146.
+ Initialize table even if cflag is 0; tr_find see whether
+ del is empty or not.
- * object.c (rb_class_s_alloc): add function prototype to avoid VC++
- warning.
+ * string.c (tr_find): nodel can't be NULL; if NULL, it means
+ it is not specified.
-Wed Aug 13 13:50:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Aug 30 21:29:21 2010 Tanaka Akira <akr@fsij.org>
- * ext/Win32API/Win32API.c (Win32API_initialize): should pass some
- class to first argument of Data_Wrap_Struct(). (ruby-bugs:PR#1109)
+ * ext/pathname/pathname.c (path_executable_real_p):
+ Pathname#executable_real? translated from pathname.rb.
-Tue Aug 12 16:55:11 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Aug 30 15:00:13 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * Makefile.in: static link libraries to LIBRUBY_SO with static linked
- ext. [ruby-dev:21157]
+ * string.c (tr_setup_table): initialize negating table when
+ negating string is given. [ruby-core:31851]
- * ext/extmk.rb (extmake): sort extension library initialization order.
+ * string.c (tr_find): add a sentence for the time when
+ target characters include negating one.
- * ext/extmk.rb (extmake): compact $extlibs.
+ * string.c (rb_str_count): move definition.
-Tue Aug 12 02:48:56 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Mon Aug 30 07:32:41 2010 Tanaka Akira <akr@fsij.org>
- * eval.c (THREAD_SAVE_CONTEXT): should explicitly turn off the
- flag before calling getcontext(2).
+ * ext/pathname/pathname.c (path_executable_p): Pathname#executable?
+ translated from pathname.rb.
- * eval.c (struct thread): add member to save backing store on
- IA64. (ruby-bugs PR1086)
+Sun Aug 29 23:54:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (thread_mark): mark IA64 backing store region.
+ * lib/rdoc/parser/ruby.rb (RDoc#parse_call_parameters): don't
+ include assignment. [Bug #3759], [ruby-dev:42154]
- * eval.c (thread_free): free saved IA64 backing store.
+ * lib/rdoc/parser/ruby.rb (RDoc#parse_class): ignore non-constant
+ name singleton class. [Bug #3759], [ruby-dev:42154]
- * eval.c (rb_thread_save_context): save IA64 backing store as well.
+Sun Aug 29 23:25:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_thread_restore_context): restore IA64 backing store.
+ * file.c (rb_get_path_check): clarify error message for
+ ASCII-incompatible path name.
- * eval.c (THREAD_ALLOC): initialize IA64 members.
+Sun Aug 29 16:02:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Aug 11 22:31:50 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * lib/debug.rb(debug_command): inspection command should inspect
- resulting value even if it's nil. [ruby-dev:21180] by OMAE, jun
- <jun66j5@ybb.ne.jp>.
+ * common.mk (node_name.inc): remove command option -n and give
+ file as stdin, because IronRuby 1.1 still doesn't support it.
+ So now we can use ir.exe as BASERUBY.
- * lib/debug.rb(debug_command): incomplete regexp.
+ * tool/node_name.rb: read stdin with while gets.
-Mon Aug 11 17:33:07 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sun Aug 29 13:22:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_call_super): do not use rb_block_given_p() for
- check. [ruby-talk:78656]
+ * vm.c (rb_thread_method_id_and_class): curried proc has no
+ method. [ruby-core:31871]
- * eval.c (BEGIN_CALLARGS): push ITER_NOT only when ITER_PRE.
+Sun Aug 29 12:51:33 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Aug 10 10:43:05 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * load.c (rb_provide_feature): clarify error message for frozen
+ $LOADED_FEATURES. based on a patch from Run Paint Run Run at
+ [ruby-core:31913].
- * ext/openssl/lib/openssl/buffering.rb: increase BLOCK_SIZE
- from 1k to 16k bytes. [ruby-talk:78603]
+Sun Aug 29 12:19:58 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc): enable
- partial write to allow interruption in SSLSocket#write.
+ * load.c (load_failed): should honor encoding. [ruby-core:31915]
-Sun Aug 10 00:34:16 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+Sun Aug 29 09:35:10 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * cygwin/GNUmakefile: remove unnecessary '--drive-name=$(CC)'
- for ccache.
+ * common.mk (clean): exclude *.inc. [ruby-dev:41931]
-Sat Aug 9 10:36:21 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * common.mk (distclean): include *.inc.
- * marshal.c (w_object): do not dump generic instance variable when
- marshal_dump is defined.
+ * common.mk (help): change description about clean and distclean.
-Sat Aug 9 00:35:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+Sat Aug 29 06:34:52 2010 Tanaka Akira <akr@fsij.org>
- * ext/bigdecimal.c: F style output(like 1234.56789) implemented
- to to_s method.
- * ext/bigdecimal_??.html: F style output(like 1234.56789)
- implemented to to_s method.
+ * ext/pathname/pathname.c (path_chardev_p): Pathname#chardev?
+ translated from pathname.rb.
-Fri Aug 8 12:33:17 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+Sat Aug 28 17:39:33 2010 Kenta Murata <mrkn@mrkn.jp>
- * bcc32/Makefile.sub: rubyw.exe should be a Windows GUI program.
- add the -aa option to WLDFLAGS.
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_save_exception_mode,
+ BigDecimal_save_rounding_mode, BigDecimal_save_limit): added.
-Fri Aug 8 11:29:26 2003 Koji Arai <jca02266@nifty.ne.jp>
+ * test/bigdecimal/test_bigdecimal.rb: added tests for the above
+ features.
- * marshal.c (w_object): should set `c_arg' at first.
+Sat Aug 28 08:11:05 2010 Tanaka Akira <akr@fsij.org>
-Fri Aug 8 03:22:28 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+ * ext/pathname/pathname.c (path_blockdev_p): Pathname#blockdev?
+ translated from pathname.rb.
- * lib/webrick/httputils.rb (FormData#list): should not take
- a side effect for the receiver.
+Fri Aug 27 16:20:01 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
-Thu Aug 7 14:40:37 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * string.c (rb_str_prepend): new method by Shota Fukumori (sora_h)
+ [Feature #3765]
- * cygwin/GNUmakefile: better --disbale-shared option support.
+Fri Aug 27 15:24:20 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * cygwin/GNUmakefile: add forwarding DLL target for cygwin.
+ * math.c (math_atan2): you should know that M_PI is not the feature
+ of C90.
+ fixed build failure caused by r29115.
-Thu Aug 7 14:21:05 2003 Corinna Vinschen <vinschen@redhat.com>
+Fri Aug 27 15:26:33 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in: Fix Cygwin specific naming of libraries to
- be net distribution compliant. (ruby-bugs:PR#1077)
- cygwin-ruby18.dll -> cygruby18.dll
+ * file.c (null_device): move from io.c.
-Thu Aug 7 12:51:38 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Aug 27 12:47:44 2010 Kenta Murata <mrkn@mrkn.jp>
- * eval.c (rb_f_at_exit): should not be called without a block.
- block_given check added.
+ * math.c (math_atan2): change the behavior when x and y are zero.
+ [ruby-dev:42090] [Bug #3736] [ruby-dev:42116]
-Thu Aug 7 06:46:06 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * test/ruby/test_math.rb (test_atan2): add tests for the above
+ changes.
- * eval.c (rb_call0): forgot to pop ruby_class.
+Fri Aug 27 12:26:23 2010 NAKAMURA Usaku <usa@ruby-lang.org>
- * eval.c (rb_call0): update ruby_class as well as ruby_cref.
- (ruby-bugs-ja:PR#540)
+ * object.c (rb_obj_class): remove mention of obsolete method.
+ a patch from Run Paint Run Run at [ruby-core:31842].
-Thu Aug 7 04:52:50 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Aug 27 12:25:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_yield_0): remove ruby_frame->cbase and unify to
- ruby_cref. [ruby-talk:78141]
+ * io.c (null_device): the name of null device. [ruby-dev:41791]
-Thu Aug 7 04:19:15 2003 Akinori MUSHA <knu@iDaemons.org>
+Fri Aug 27 07:57:34 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * gc.c: FreeBSD/ia64's mcontext_t is a bit different from that of
- Linux/ia64. This makes gc.c compile but miniruby coredumps for
- the moment.
+ * array.c (rb_ary_shuffle_bang): bail out from modification during
+ shuffle.
-Thu Aug 7 00:15:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+ * array.c (rb_ary_sample): ditto.
- * ext/bigdecimal.c: Comparison results adjusted to Float's.
- * ext/bigdecimal.c: Use rb_num_coerce_????(x,y) instead of own.
+Fri Aug 27 05:11:51 2010 Tanaka Akira <akr@fsij.org>
-Wed Aug 6 22:58:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+ * ext/pathname/pathname.c (path_sysopen): Pathname#sysopen translated
+ from pathname.rb.
- * lib/test/unit/testcase.rb: Added equality checking.
- * lib/test/unit/testsuite.rb: Added equality checking.
- * lib/test/unit/assertions.rb: Fixed a warning.
+Thu Aug 26 22:53:56 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Aug 6 17:28:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (rb_ary_shuffle): rdoc fix. argument name was missing.
+ a patch from Run Paint Run Run at [ruby-core:31848].
- * ext/extmk.rb (extmake): pass LIBPATH to make ruby. [ruby-dev:21137]
+Thu Aug 26 21:49:46 2010 Tanaka Akira <akr@fsij.org>
- * ext/extmk.rb (extmake): set library name as source file name in
- Init_ext(). [ruby-dev:21137]
+ * ext/pathname/pathname.c (path_readlines): Pathname#readlines
+ translated from pathname.rb.
- * lib/mkmf.rb (Logging::postpone): postpone logging messages after
- heading message as the result of the block.
+Thu Aug 26 10:37:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
- * lib/mkmf.rb (macro_defined?): append newline to src unless ended
- with it.
+ * regint.h (OnigStackIndex): the type should be intptr_t.
+ Original Oniguruma assumes the size of long and that of void *
+ are equal, but it's not true on LLP64 platform: mswin64.
+ originally patched by shintaro kuwamoto [ruby-dev:42133]
- * lib/mkmf.rb (have_library): treat nil function name as "main".
- (ruby-bugs:PR#1083)
+Thu Aug 26 10:38:11 2010 Yutaka Kanemoto <kanemoto@ruby-lang.org>
- * lib/mkmf.rb (pkg_config): should append additional libraries to
- $libs but not $LIBS. [ruby-dev:21137]
+ * test/dl/test_base.rb: AIX does not have dynamically loadable lib[cm].
- * ext/io/wait/extconf.rb: check DOSISH macro instead of platform.
+ * test/fiddle/helper.rb: AIX does not have dynamically loadable lib[cm].
- * ext/digest/sha1/extconf.rb: have_library already appends library
- name.
+Thu Aug 26 09:49:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Aug 6 17:23:57 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * array.c (rb_ary_shuffle_bang): check number of argument.
- * eval.c: initialize /* OK */ variables by Qnil to stop warnings.
+Tue Aug 26 09:11:40 2010 Kenta Murata <mrkn@mrkn.jp>
-Wed Aug 6 04:58:32 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
+ rmpd_set_thread_local_exception_mode, VpGetException,
+ VpSetException): thread-local exception mode.
- * ext/Setup*: add io/wait and openssl.
+ * ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
+ rmpd_set_thread_local_precision_limit, VpGetPrecLimit,
+ VpSetPrecLimit): thread-local precision limit.
-Wed Aug 6 01:13:38 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
+ rmpd_set_thread_local_rounding_mode, VpGetRoundMode,
+ VpSetRoundMode, VpException, VpInternalRound):
+ thread-local rounding mode.
- * eval.c (rb_f_autoload): use ruby_cbase instead of ruby_class.
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_mode, BigDecimal_round,
+ VpIsRoundMode, VpGetRoundMode, VpSetRoundMode, VpActiveRound,
+ VpMidRound, VpLeftRound), ext/bigdecimal/bigdecimal.h:
+ use unsigned short for rounding mode.
- * eval.c (rb_f_autoload_p): ditto.
+ * test/bigdecimal/test_bigdecimal.rb (test_mode): add test for
+ setting rounding mode.
- * class.c (rb_mod_init_copy): no longer implements independent
- clone and dup methods. override "initialize_copy" instead.
- [ruby-core:01352]
+ * test/bigdecimal/test_bigdecimal.rb (test_thread_local_mode):
+ add test for setting mode thread-locally.
- * object.c (rb_class_s_alloc): define Class allocation function.
- this makes Classes to follow clone framework that uses
- initialize_copy.
+Thu Aug 26 07:29:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * object.c (rb_class_initialize): separate instantiation and
- initialization.
+ * array.c (rb_ary_{shuffle_bang,sample}): use Random class object.
- * object.c (rb_obj_alloc): prohibit instantiation from
- uninitialized class.
+ * random.c (try_get_rnd): use default_rand for Random as same as
+ singleton methods.
- * object.c (rb_class_superclass): check uninitialized class.
+ * random.c (rb_random_real): check the range of result.
- * array.c (rb_ary_fill): wrong index processing with block. this
- fix was done by Koji Arai <JCA02266@nifty.ne.jp> [ruby-list:38029]
+Wed Aug 25 22:11:11 2010 Tanaka Akira <akr@fsij.org>
- * marshal.c (w_object): should preserve generic ivar for nil,
- true, false, symbols, and fixnums.
+ * ext/pathname/pathname.c (path_binread): Pathname#binread translated
+ from pathname.rb.
- * marshal.c (w_uclass): base_klass check should be done after
- rb_class_real().
+Wed Aug 25 03:42:43 2010 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Aug 6 01:18:50 2003 Minero Aoki <aamine@loveruby.net>
+ * ext/dl/cfunc.c (rb_dlcfunc_call): workaround for VC9 for x64.
+ reported by kuwamoto shintaro in [ruby-dev:42125].
- * lib/net/http.rb: update document.
+Tue Aug 24 23:28:50 2010 Yusuke Endoh <mame@tsg.ne.jp>
- * lib/net/pop.rb: ditto.
+ * .gitignore: updated.
- * lib/net/protocol.rb: ditto.
+Tue Aug 24 22:07:28 2010 Tanaka Akira <akr@fsij.org>
-Wed Aug 6 00:48:37 2003 Koji Arai <jca02266@nifty.ne.jp>
+ * ext/pathname/pathname.c (path_read): Pathname#read translated from
+ pathname.rb.
- * marshal.c (w_object): should recommend marshal_dump rather than
- _dump_data.
+Tue Aug 24 10:11:04 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Aug 5 17:58:57 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+ * configure.in: read API version from include/ruby/version.h.
- * lib/fileutils.rb (install): should preserve timestamp only.
+ * {bcc,win}32/setup.mak (-version-): ditto.
-Tue Aug 5 17:31:59 2003 Ian Macdonald <ian@caliban.org>
+ * version.h (RUBY_LIB_VERSION): use API version numbers.
- * lib/shell/command-processor.rb (Shell::CommandProcessor::rmdir):
- simple typo.
+Tue Aug 24 07:07:28 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Aug 5 15:47:34 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (rb_ary_shuffle_bang, rb_ary_sample): add optional
+ argument random. [ruby-dev:41923] [EXPERIMENTAL]
- * eval.c (rb_load): should preserve current source file/line.
+ * random.c (rb_random_{int32,real,bytes}): fallback to normal
+ method invocation.
-Tue Aug 5 10:04:42 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Aug 24 06:08:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (str_new4): ptr may refer null_str.
+ * include/ruby/version.h (RUBY_API_VERSION_*): renamed and moved
+ from version.h. [ruby-dev:42103]
-Mon Aug 4 17:25:18 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Aug 24 05:58:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * stable version 1.8.0 released.
+ * ChangeLog: flushed. [ruby-dev:42050]
+For the changes before 1.9.3, see doc/ChangeLog-1.9.3
For the changes before 1.8.0, see doc/ChangeLog-1.8.0
Local variables:
+coding: us-ascii
add-log-time-format: (lambda ()
(let* ((time (current-time))
+ (system-time-locale "C")
(diff (+ (cadr time) 32400))
(lo (% diff 65536))
- (hi (+ (car time) (/ diff 65536))))
+ (hi (+ (car time) (/ diff 65536))))
(format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
indent-tabs-mode: t
tab-width: 8
+change-log-indent-text: 2
end:
+vim: tabstop=8 shiftwidth=2
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
new file mode 100644
index 0000000000..b97a08d928
--- /dev/null
+++ b/KNOWNBUGS.rb
@@ -0,0 +1,5 @@
+#
+# This test file concludes tests which point out known bugs.
+# So all tests will cause failure.
+#
+
diff --git a/LEGAL b/LEGAL
index 908eb270f5..65706459cd 100644
--- a/LEGAL
+++ b/LEGAL
@@ -5,34 +5,59 @@ All the files in this distribution are covered under either the Ruby's
license (see the file COPYING) or public-domain except some files
mentioned below.
-regex.[ch]:
-
- These files are under LGPL. Treat them as LGPL says. (See the file
- LGPL for details)
-
- Extended regular expression matching and search library.
- Copyright (C) 1993, 94, 95, 96, 97, 98 Free Software Foundation, Inc.
-
- The GNU C Library is free software; you can redistribute it and/or
- modify it under the terms of the GNU Library General Public License as
- published by the Free Software Foundation; either version 2 of the
- License, or (at your option) any later version.
-
- The GNU C Library is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
- Library General Public License for more details.
-
- You should have received a copy of the GNU Library General Public
- License along with the GNU C Library; see the file LGPL. If not,
- write to the Free Software Foundation, Inc., 59 Temple Place - Suite 330,
- Boston, MA 02111-1307, USA. */
-
- Multi-byte extension added May, 1993 by t^2 (Takahiro Tanimoto)
- Last change: May 21, 1993 by t^2
- removed gapped buffer support, multiple syntax support by matz <matz@nts.co.jp>
- Perl5 extension added by matz <matz@caelum.co.jp>
- UTF-8 extension added Jan 16 1999 by Yoshida Masato <yoshidam@tau.bekkoame.ne.jp>
+include/ruby/oniguruma.h:
+regcomp.c:
+regenc.[ch]:
+regerror.c:
+regexec.c:
+regint.h:
+regparse.[ch]:
+enc/ascii.c
+enc/big5.c
+enc/cp949.c
+enc/emacs_mule.c
+enc/encdb.c
+enc/euc_jp.c
+enc/euc_kr.c
+enc/euc_tw.c
+enc/gb18030.c
+enc/gb2312.c
+enc/gbk.c
+enc/iso_8859_1.c
+enc/iso_8859_10.c
+enc/iso_8859_11.c
+enc/iso_8859_13.c
+enc/iso_8859_14.c
+enc/iso_8859_15.c
+enc/iso_8859_16.c
+enc/iso_8859_2.c
+enc/iso_8859_3.c
+enc/iso_8859_4.c
+enc/iso_8859_5.c
+enc/iso_8859_6.c
+enc/iso_8859_7.c
+enc/iso_8859_8.c
+enc/iso_8859_9.c
+enc/koi8_r.c
+enc/koi8_u.c
+enc/shift_jis.c
+enc/unicode.c
+enc/us_ascii.c
+enc/utf_16be.c
+enc/utf_16le.c
+enc/utf_32be.c
+enc/utf_32le.c
+enc/utf_8.c
+enc/windows_1251.c
+
+Oniguruma ---- (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+
+http://www.geocities.jp/kosako3/oniguruma/
+http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
+http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
+
+ When this software is partly used or it is distributed with Ruby,
+ this of Ruby follows the license of Ruby.
configure:
@@ -43,9 +68,8 @@ configure:
This configure script is free software; the Free Software Foundation
gives unlimited permission to copy, distribute and modify it.
-config.guess:
-config.sub:
-parse.c:
+tool/config.guess:
+tool/config.sub:
As long as you distribute these files with the file configure, they
are covered under the Ruby's license.
@@ -72,7 +96,58 @@ parse.c:
configuration script generated by Autoconf, you may include it under
the same distribution terms that you use for the rest of that program.
+parse.c:
+
+ This file is licensed under the GPL, but is incorporated into Ruby and
+ redistributed under the terms of the Ruby license, as permitted by the
+ exception to the GPL below.
+
+ Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
+ Free Software Foundation, Inc.
+
+ This program is free software; you can redistribute it and/or modify
+ it under the terms of the GNU General Public License as published by
+ the Free Software Foundation; either version 2, or (at your option)
+ any later version.
+
+ This program is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ GNU General Public License for more details.
+
+ You should have received a copy of the GNU General Public License
+ along with this program; if not, write to the Free Software
+ Foundation, Inc., 51 Franklin Street, Fifth Floor,
+ Boston, MA 02110-1301, USA. */
+
+ /* As a special exception, you may create a larger work that contains
+ part or all of the Bison parser skeleton and distribute that work
+ under terms of your choice, so long as that work isn't itself a
+ parser generator using the skeleton or a modified version thereof
+ as a parser skeleton. Alternatively, if you modify or redistribute
+ the parser skeleton itself, you may (at your option) remove this
+ special exception, which will cause the skeleton and the resulting
+ Bison output files to be licensed under the GNU General Public
+ License without this special exception.
+
+ This special exception was added by the Free Software Foundation in
+ version 2.2 of Bison. */
+
util.c (partly):
+
+ Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
+
+ Permission to use, copy, modify, and distribute this software for any
+ purpose without fee is hereby granted, provided that this entire notice
+ is included in all copies of any software which is or includes a copy
+ or modification of this software and in all copies of the supporting
+ documentation for such software.
+
+ THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
+ WARRANTY. IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
+ REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
+ OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
+
win32/win32.[ch]:
You can apply the Artistic License to these files. (or GPL,
@@ -83,6 +158,32 @@ win32/win32.[ch]:
You may distribute under the terms of either the GNU General Public
License or the Artistic License, as specified in the perl README file.
+util.c (partly):
+
+ Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
random.c
This file is under the new-style BSD license.
@@ -130,72 +231,109 @@ random.c
http://www.math.keio.ac.jp/matumoto/emt.html
email: matumoto@math.keio.ac.jp
+vsnprintf.c:
+
+ This file is under the old-style BSD license. Note that the
+ paragraph 3 below is now null and void.
+
+ Copyright (c) 1990, 1993
+ The Regents of the University of California. All rights reserved.
+
+ This code is derived from software contributed to Berkeley by
+ Chris Torek.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. Neither the name of the University nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ IMPORTANT NOTE:
+ --------------
+ From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+ paragraph 3 above is now null and void.
+
st.[ch]:
-x68/*:
missing/alloca.c:
missing/dup2.c:
+missing/erf.c:
missing/finite.c:
missing/hypot.c:
missing/isinf.c:
missing/isnan.c:
+missing/lgamma_r.c:
missing/memcmp.c:
missing/memmove.c:
-missing/strcasecmp.c:
missing/strchr.c:
-missing/streror.c:
-missing/strftime.c:
-missing/strncasecmp.c:
missing/strstr.c:
missing/strtol.c:
+missing/tgamma.c:
ext/digest/sha1/sha1.[ch]:
These files are all under public domain.
-missing/strtod.c:
-
- This file will not be used on most platforms depending on how the
- configure script results. In any case you must not receive any fee
- with the file itself.
-
- Copyright (c) 1988-1993 The Regents of the University of California.
- Copyright (c) 1994 Sun Microsystems, Inc.
+missing/crypt.c:
- Permission to use, copy, modify, and distribute this
- software and its documentation for any purpose and without
- fee is hereby granted, provided that the above copyright
- notice appear in all copies. The University of California
- makes no representations about the suitability of this
- software for any purpose. It is provided "as is" without
- express or implied warranty.
+ This file is under the old-style BSD license. Note that the
+ paragraph 3 below is now null and void.
-missing/strtoul.c:
+ Copyright (c) 1989, 1993
+ The Regents of the University of California. All rights reserved.
- This file will not be used on most platforms depending on how the
- configure script results. In any case you must not receive any fee
- with the file itself.
+ This code is derived from software contributed to Berkeley by
+ Tom Truscott.
- Copyright 1988 Regents of the University of California
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. Neither the name of the University nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
- Permission to use, copy, modify, and distribute this
- software and its documentation for any purpose and without
- fee is hereby granted, provided that the above copyright
- notice appear in all copies. The University of California
- makes no representations about the suitability of this
- software for any purpose. It is provided "as is" without
- express or implied warranty.
+ THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
-missing/erf.c:
-missing/crypt.c:
-missing/vsnprintf.c:
+missing/setproctitle.c
This file is under the old-style BSD license. Note that the
paragraph 3 below is now null and void.
- Copyright (c) 1990, 1993
- The Regents of the University of California. All rights reserved.
-
- This code is derived from software contributed to Berkeley by
- Chris Torek.
+ Copyright 2003 Damien Miller
+ Copyright (c) 1983, 1995-1997 Eric P. Allman
+ Copyright (c) 1988, 1993
+ The Regents of the University of California. All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
@@ -221,10 +359,46 @@ missing/vsnprintf.c:
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
- IMPORTANT NOTE:
- --------------
- From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
- paragraph 3 above is now null and void.
+missing/strlcat.c
+missing/strlcpy.c
+
+ These files are under the new-style BSD license.
+
+ Copyright (c) 1998 Todd C. Miller <Todd.Miller@courtesan.com>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. The name of the author may not be used to endorse or promote products
+ derived from this software without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES,
+ INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY
+ AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL
+ THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+ EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+ PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
+ OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
+ WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
+ OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
+ ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
+
+missing/langinfo.c
+
+ This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
+ Ruby uses a modified version. The file contains the following
+ author/copyright notice:
+
+ Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
+ Permission to use, copy, modify, and distribute this software
+ for any purpose and without fee is hereby granted. The author
+ disclaims all warranties with regard to this software.
ext/digest/md5/md5.[ch]:
@@ -264,18 +438,7 @@ ext/digest/rmd160/rmd160.[ch]:
Copyright (c) Katholieke Universiteit Leuven
1996, All Rights Reserved
-ext/digest/rmd160/rmd160hl.c:
-ext/digest/sha1/sha1hl.c:
-
- These files are under the beer-ware license.
-
- "THE BEER-WARE LICENSE" (Revision 42):
- <phk@login.dkuug.dk> wrote this file. As long as you retain this notice you
- can do whatever you want with this stuff. If we meet some day, and you think
- this stuff is worth it, you can buy me a beer in return. Poul-Henning Kamp
-
ext/digest/sha2/sha2.[ch]:
-ext/digest/sha2/sha2hl.c:
These files are under the new-style BSD license.
diff --git a/LGPL b/LGPL
deleted file mode 100644
index b1e3f5a263..0000000000
--- a/LGPL
+++ /dev/null
@@ -1,504 +0,0 @@
- GNU LESSER GENERAL PUBLIC LICENSE
- Version 2.1, February 1999
-
- Copyright (C) 1991, 1999 Free Software Foundation, Inc.
- 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
-
-[This is the first released version of the Lesser GPL. It also counts
- as the successor of the GNU Library Public License, version 2, hence
- the version number 2.1.]
-
- Preamble
-
- The licenses for most software are designed to take away your
-freedom to share and change it. By contrast, the GNU General Public
-Licenses are intended to guarantee your freedom to share and change
-free software--to make sure the software is free for all its users.
-
- This license, the Lesser General Public License, applies to some
-specially designated software packages--typically libraries--of the
-Free Software Foundation and other authors who decide to use it. You
-can use it too, but we suggest you first think carefully about whether
-this license or the ordinary General Public License is the better
-strategy to use in any particular case, based on the explanations below.
-
- When we speak of free software, we are referring to freedom of use,
-not price. Our General Public Licenses are designed to make sure that
-you have the freedom to distribute copies of free software (and charge
-for this service if you wish); that you receive source code or can get
-it if you want it; that you can change the software and use pieces of
-it in new free programs; and that you are informed that you can do
-these things.
-
- To protect your rights, we need to make restrictions that forbid
-distributors to deny you these rights or to ask you to surrender these
-rights. These restrictions translate to certain responsibilities for
-you if you distribute copies of the library or if you modify it.
-
- For example, if you distribute copies of the library, whether gratis
-or for a fee, you must give the recipients all the rights that we gave
-you. You must make sure that they, too, receive or can get the source
-code. If you link other code with the library, you must provide
-complete object files to the recipients, so that they can relink them
-with the library after making changes to the library and recompiling
-it. And you must show them these terms so they know their rights.
-
- We protect your rights with a two-step method: (1) we copyright the
-library, and (2) we offer you this license, which gives you legal
-permission to copy, distribute and/or modify the library.
-
- To protect each distributor, we want to make it very clear that
-there is no warranty for the free library. Also, if the library is
-modified by someone else and passed on, the recipients should know
-that what they have is not the original version, so that the original
-author's reputation will not be affected by problems that might be
-introduced by others.
-
- Finally, software patents pose a constant threat to the existence of
-any free program. We wish to make sure that a company cannot
-effectively restrict the users of a free program by obtaining a
-restrictive license from a patent holder. Therefore, we insist that
-any patent license obtained for a version of the library must be
-consistent with the full freedom of use specified in this license.
-
- Most GNU software, including some libraries, is covered by the
-ordinary GNU General Public License. This license, the GNU Lesser
-General Public License, applies to certain designated libraries, and
-is quite different from the ordinary General Public License. We use
-this license for certain libraries in order to permit linking those
-libraries into non-free programs.
-
- When a program is linked with a library, whether statically or using
-a shared library, the combination of the two is legally speaking a
-combined work, a derivative of the original library. The ordinary
-General Public License therefore permits such linking only if the
-entire combination fits its criteria of freedom. The Lesser General
-Public License permits more lax criteria for linking other code with
-the library.
-
- We call this license the "Lesser" General Public License because it
-does Less to protect the user's freedom than the ordinary General
-Public License. It also provides other free software developers Less
-of an advantage over competing non-free programs. These disadvantages
-are the reason we use the ordinary General Public License for many
-libraries. However, the Lesser license provides advantages in certain
-special circumstances.
-
- For example, on rare occasions, there may be a special need to
-encourage the widest possible use of a certain library, so that it becomes
-a de-facto standard. To achieve this, non-free programs must be
-allowed to use the library. A more frequent case is that a free
-library does the same job as widely used non-free libraries. In this
-case, there is little to gain by limiting the free library to free
-software only, so we use the Lesser General Public License.
-
- In other cases, permission to use a particular library in non-free
-programs enables a greater number of people to use a large body of
-free software. For example, permission to use the GNU C Library in
-non-free programs enables many more people to use the whole GNU
-operating system, as well as its variant, the GNU/Linux operating
-system.
-
- Although the Lesser General Public License is Less protective of the
-users' freedom, it does ensure that the user of a program that is
-linked with the Library has the freedom and the wherewithal to run
-that program using a modified version of the Library.
-
- The precise terms and conditions for copying, distribution and
-modification follow. Pay close attention to the difference between a
-"work based on the library" and a "work that uses the library". The
-former contains code derived from the library, whereas the latter must
-be combined with the library in order to run.
-
- GNU LESSER GENERAL PUBLIC LICENSE
- TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
-
- 0. This License Agreement applies to any software library or other
-program which contains a notice placed by the copyright holder or
-other authorized party saying it may be distributed under the terms of
-this Lesser General Public License (also called "this License").
-Each licensee is addressed as "you".
-
- A "library" means a collection of software functions and/or data
-prepared so as to be conveniently linked with application programs
-(which use some of those functions and data) to form executables.
-
- The "Library", below, refers to any such software library or work
-which has been distributed under these terms. A "work based on the
-Library" means either the Library or any derivative work under
-copyright law: that is to say, a work containing the Library or a
-portion of it, either verbatim or with modifications and/or translated
-straightforwardly into another language. (Hereinafter, translation is
-included without limitation in the term "modification".)
-
- "Source code" for a work means the preferred form of the work for
-making modifications to it. For a library, complete source code means
-all the source code for all modules it contains, plus any associated
-interface definition files, plus the scripts used to control compilation
-and installation of the library.
-
- Activities other than copying, distribution and modification are not
-covered by this License; they are outside its scope. The act of
-running a program using the Library is not restricted, and output from
-such a program is covered only if its contents constitute a work based
-on the Library (independent of the use of the Library in a tool for
-writing it). Whether that is true depends on what the Library does
-and what the program that uses the Library does.
-
- 1. You may copy and distribute verbatim copies of the Library's
-complete source code as you receive it, in any medium, provided that
-you conspicuously and appropriately publish on each copy an
-appropriate copyright notice and disclaimer of warranty; keep intact
-all the notices that refer to this License and to the absence of any
-warranty; and distribute a copy of this License along with the
-Library.
-
- You may charge a fee for the physical act of transferring a copy,
-and you may at your option offer warranty protection in exchange for a
-fee.
-
- 2. You may modify your copy or copies of the Library or any portion
-of it, thus forming a work based on the Library, and copy and
-distribute such modifications or work under the terms of Section 1
-above, provided that you also meet all of these conditions:
-
- a) The modified work must itself be a software library.
-
- b) You must cause the files modified to carry prominent notices
- stating that you changed the files and the date of any change.
-
- c) You must cause the whole of the work to be licensed at no
- charge to all third parties under the terms of this License.
-
- d) If a facility in the modified Library refers to a function or a
- table of data to be supplied by an application program that uses
- the facility, other than as an argument passed when the facility
- is invoked, then you must make a good faith effort to ensure that,
- in the event an application does not supply such function or
- table, the facility still operates, and performs whatever part of
- its purpose remains meaningful.
-
- (For example, a function in a library to compute square roots has
- a purpose that is entirely well-defined independent of the
- application. Therefore, Subsection 2d requires that any
- application-supplied function or table used by this function must
- be optional: if the application does not supply it, the square
- root function must still compute square roots.)
-
-These requirements apply to the modified work as a whole. If
-identifiable sections of that work are not derived from the Library,
-and can be reasonably considered independent and separate works in
-themselves, then this License, and its terms, do not apply to those
-sections when you distribute them as separate works. But when you
-distribute the same sections as part of a whole which is a work based
-on the Library, the distribution of the whole must be on the terms of
-this License, whose permissions for other licensees extend to the
-entire whole, and thus to each and every part regardless of who wrote
-it.
-
-Thus, it is not the intent of this section to claim rights or contest
-your rights to work written entirely by you; rather, the intent is to
-exercise the right to control the distribution of derivative or
-collective works based on the Library.
-
-In addition, mere aggregation of another work not based on the Library
-with the Library (or with a work based on the Library) on a volume of
-a storage or distribution medium does not bring the other work under
-the scope of this License.
-
- 3. You may opt to apply the terms of the ordinary GNU General Public
-License instead of this License to a given copy of the Library. To do
-this, you must alter all the notices that refer to this License, so
-that they refer to the ordinary GNU General Public License, version 2,
-instead of to this License. (If a newer version than version 2 of the
-ordinary GNU General Public License has appeared, then you can specify
-that version instead if you wish.) Do not make any other change in
-these notices.
-
- Once this change is made in a given copy, it is irreversible for
-that copy, so the ordinary GNU General Public License applies to all
-subsequent copies and derivative works made from that copy.
-
- This option is useful when you wish to copy part of the code of
-the Library into a program that is not a library.
-
- 4. You may copy and distribute the Library (or a portion or
-derivative of it, under Section 2) in object code or executable form
-under the terms of Sections 1 and 2 above provided that you accompany
-it with the complete corresponding machine-readable source code, which
-must be distributed under the terms of Sections 1 and 2 above on a
-medium customarily used for software interchange.
-
- If distribution of object code is made by offering access to copy
-from a designated place, then offering equivalent access to copy the
-source code from the same place satisfies the requirement to
-distribute the source code, even though third parties are not
-compelled to copy the source along with the object code.
-
- 5. A program that contains no derivative of any portion of the
-Library, but is designed to work with the Library by being compiled or
-linked with it, is called a "work that uses the Library". Such a
-work, in isolation, is not a derivative work of the Library, and
-therefore falls outside the scope of this License.
-
- However, linking a "work that uses the Library" with the Library
-creates an executable that is a derivative of the Library (because it
-contains portions of the Library), rather than a "work that uses the
-library". The executable is therefore covered by this License.
-Section 6 states terms for distribution of such executables.
-
- When a "work that uses the Library" uses material from a header file
-that is part of the Library, the object code for the work may be a
-derivative work of the Library even though the source code is not.
-Whether this is true is especially significant if the work can be
-linked without the Library, or if the work is itself a library. The
-threshold for this to be true is not precisely defined by law.
-
- If such an object file uses only numerical parameters, data
-structure layouts and accessors, and small macros and small inline
-functions (ten lines or less in length), then the use of the object
-file is unrestricted, regardless of whether it is legally a derivative
-work. (Executables containing this object code plus portions of the
-Library will still fall under Section 6.)
-
- Otherwise, if the work is a derivative of the Library, you may
-distribute the object code for the work under the terms of Section 6.
-Any executables containing that work also fall under Section 6,
-whether or not they are linked directly with the Library itself.
-
- 6. As an exception to the Sections above, you may also combine or
-link a "work that uses the Library" with the Library to produce a
-work containing portions of the Library, and distribute that work
-under terms of your choice, provided that the terms permit
-modification of the work for the customer's own use and reverse
-engineering for debugging such modifications.
-
- You must give prominent notice with each copy of the work that the
-Library is used in it and that the Library and its use are covered by
-this License. You must supply a copy of this License. If the work
-during execution displays copyright notices, you must include the
-copyright notice for the Library among them, as well as a reference
-directing the user to the copy of this License. Also, you must do one
-of these things:
-
- a) Accompany the work with the complete corresponding
- machine-readable source code for the Library including whatever
- changes were used in the work (which must be distributed under
- Sections 1 and 2 above); and, if the work is an executable linked
- with the Library, with the complete machine-readable "work that
- uses the Library", as object code and/or source code, so that the
- user can modify the Library and then relink to produce a modified
- executable containing the modified Library. (It is understood
- that the user who changes the contents of definitions files in the
- Library will not necessarily be able to recompile the application
- to use the modified definitions.)
-
- b) Use a suitable shared library mechanism for linking with the
- Library. A suitable mechanism is one that (1) uses at run time a
- copy of the library already present on the user's computer system,
- rather than copying library functions into the executable, and (2)
- will operate properly with a modified version of the library, if
- the user installs one, as long as the modified version is
- interface-compatible with the version that the work was made with.
-
- c) Accompany the work with a written offer, valid for at
- least three years, to give the same user the materials
- specified in Subsection 6a, above, for a charge no more
- than the cost of performing this distribution.
-
- d) If distribution of the work is made by offering access to copy
- from a designated place, offer equivalent access to copy the above
- specified materials from the same place.
-
- e) Verify that the user has already received a copy of these
- materials or that you have already sent this user a copy.
-
- For an executable, the required form of the "work that uses the
-Library" must include any data and utility programs needed for
-reproducing the executable from it. However, as a special exception,
-the materials to be distributed need not include anything that is
-normally distributed (in either source or binary form) with the major
-components (compiler, kernel, and so on) of the operating system on
-which the executable runs, unless that component itself accompanies
-the executable.
-
- It may happen that this requirement contradicts the license
-restrictions of other proprietary libraries that do not normally
-accompany the operating system. Such a contradiction means you cannot
-use both them and the Library together in an executable that you
-distribute.
-
- 7. You may place library facilities that are a work based on the
-Library side-by-side in a single library together with other library
-facilities not covered by this License, and distribute such a combined
-library, provided that the separate distribution of the work based on
-the Library and of the other library facilities is otherwise
-permitted, and provided that you do these two things:
-
- a) Accompany the combined library with a copy of the same work
- based on the Library, uncombined with any other library
- facilities. This must be distributed under the terms of the
- Sections above.
-
- b) Give prominent notice with the combined library of the fact
- that part of it is a work based on the Library, and explaining
- where to find the accompanying uncombined form of the same work.
-
- 8. You may not copy, modify, sublicense, link with, or distribute
-the Library except as expressly provided under this License. Any
-attempt otherwise to copy, modify, sublicense, link with, or
-distribute the Library is void, and will automatically terminate your
-rights under this License. However, parties who have received copies,
-or rights, from you under this License will not have their licenses
-terminated so long as such parties remain in full compliance.
-
- 9. You are not required to accept this License, since you have not
-signed it. However, nothing else grants you permission to modify or
-distribute the Library or its derivative works. These actions are
-prohibited by law if you do not accept this License. Therefore, by
-modifying or distributing the Library (or any work based on the
-Library), you indicate your acceptance of this License to do so, and
-all its terms and conditions for copying, distributing or modifying
-the Library or works based on it.
-
- 10. Each time you redistribute the Library (or any work based on the
-Library), the recipient automatically receives a license from the
-original licensor to copy, distribute, link with or modify the Library
-subject to these terms and conditions. You may not impose any further
-restrictions on the recipients' exercise of the rights granted herein.
-You are not responsible for enforcing compliance by third parties with
-this License.
-
- 11. If, as a consequence of a court judgment or allegation of patent
-infringement or for any other reason (not limited to patent issues),
-conditions are imposed on you (whether by court order, agreement or
-otherwise) that contradict the conditions of this License, they do not
-excuse you from the conditions of this License. If you cannot
-distribute so as to satisfy simultaneously your obligations under this
-License and any other pertinent obligations, then as a consequence you
-may not distribute the Library at all. For example, if a patent
-license would not permit royalty-free redistribution of the Library by
-all those who receive copies directly or indirectly through you, then
-the only way you could satisfy both it and this License would be to
-refrain entirely from distribution of the Library.
-
-If any portion of this section is held invalid or unenforceable under any
-particular circumstance, the balance of the section is intended to apply,
-and the section as a whole is intended to apply in other circumstances.
-
-It is not the purpose of this section to induce you to infringe any
-patents or other property right claims or to contest validity of any
-such claims; this section has the sole purpose of protecting the
-integrity of the free software distribution system which is
-implemented by public license practices. Many people have made
-generous contributions to the wide range of software distributed
-through that system in reliance on consistent application of that
-system; it is up to the author/donor to decide if he or she is willing
-to distribute software through any other system and a licensee cannot
-impose that choice.
-
-This section is intended to make thoroughly clear what is believed to
-be a consequence of the rest of this License.
-
- 12. If the distribution and/or use of the Library is restricted in
-certain countries either by patents or by copyrighted interfaces, the
-original copyright holder who places the Library under this License may add
-an explicit geographical distribution limitation excluding those countries,
-so that distribution is permitted only in or among countries not thus
-excluded. In such case, this License incorporates the limitation as if
-written in the body of this License.
-
- 13. The Free Software Foundation may publish revised and/or new
-versions of the Lesser General Public License from time to time.
-Such new versions will be similar in spirit to the present version,
-but may differ in detail to address new problems or concerns.
-
-Each version is given a distinguishing version number. If the Library
-specifies a version number of this License which applies to it and
-"any later version", you have the option of following the terms and
-conditions either of that version or of any later version published by
-the Free Software Foundation. If the Library does not specify a
-license version number, you may choose any version ever published by
-the Free Software Foundation.
-
- 14. If you wish to incorporate parts of the Library into other free
-programs whose distribution conditions are incompatible with these,
-write to the author to ask for permission. For software which is
-copyrighted by the Free Software Foundation, write to the Free
-Software Foundation; we sometimes make exceptions for this. Our
-decision will be guided by the two goals of preserving the free status
-of all derivatives of our free software and of promoting the sharing
-and reuse of software generally.
-
- NO WARRANTY
-
- 15. BECAUSE THE LIBRARY IS LICENSED FREE OF CHARGE, THERE IS NO
-WARRANTY FOR THE LIBRARY, TO THE EXTENT PERMITTED BY APPLICABLE LAW.
-EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR
-OTHER PARTIES PROVIDE THE LIBRARY "AS IS" WITHOUT WARRANTY OF ANY
-KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE
-IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE
-LIBRARY IS WITH YOU. SHOULD THE LIBRARY PROVE DEFECTIVE, YOU ASSUME
-THE COST OF ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
-
- 16. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN
-WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY
-AND/OR REDISTRIBUTE THE LIBRARY AS PERMITTED ABOVE, BE LIABLE TO YOU
-FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR
-CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE
-LIBRARY (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING
-RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A
-FAILURE OF THE LIBRARY TO OPERATE WITH ANY OTHER SOFTWARE), EVEN IF
-SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH
-DAMAGES.
-
- END OF TERMS AND CONDITIONS
-
- How to Apply These Terms to Your New Libraries
-
- If you develop a new library, and you want it to be of the greatest
-possible use to the public, we recommend making it free software that
-everyone can redistribute and change. You can do so by permitting
-redistribution under these terms (or, alternatively, under the terms of the
-ordinary General Public License).
-
- To apply these terms, attach the following notices to the library. It is
-safest to attach them to the start of each source file to most effectively
-convey the exclusion of warranty; and each file should have at least the
-"copyright" line and a pointer to where the full notice is found.
-
- <one line to give the library's name and a brief idea of what it does.>
- Copyright (C) <year> <name of author>
-
- This library is free software; you can redistribute it and/or
- modify it under the terms of the GNU Lesser General Public
- License as published by the Free Software Foundation; either
- version 2.1 of the License, or (at your option) any later version.
-
- This library is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
- Lesser General Public License for more details.
-
- You should have received a copy of the GNU Lesser General Public
- License along with this library; if not, write to the Free Software
- Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
-
-Also add information on how to contact you by electronic and paper mail.
-
-You should also get your employer (if you work as a programmer) or your
-school, if any, to sign a "copyright disclaimer" for the library, if
-necessary. Here is a sample; alter the names:
-
- Yoyodyne, Inc., hereby disclaims all copyright interest in the
- library `Frob' (a library for tweaking knobs) written by James Random Hacker.
-
- <signature of Ty Coon>, 1 April 1990
- Ty Coon, President of Vice
-
-That's all there is to it!
-
-
diff --git a/Makefile.in b/Makefile.in
index 254f1656ee..df521cae94 100644
--- a/Makefile.in
+++ b/Makefile.in
@@ -1,16 +1,27 @@
SHELL = /bin/sh
+NULLCMD = @NULLCMD@
+RUNCMD = $(SHELL)
+CHDIR = @CHDIR@
+exec = exec
+NULL = /dev/null
#### Start of system configuration section. ####
srcdir = @srcdir@
-VPATH = $(srcdir):$(srcdir)/missing
+top_srcdir = $(srcdir)
+hdrdir = $(srcdir)/include
+PLATFORM_DIR = @PLATFORM_DIR@
CC = @CC@
-YACC = @YACC@
+CPP = @CPP@
+YACC = bison
PURIFY =
AUTOCONF = autoconf
@SET_MAKE@
MKFILES = @MAKEFILES@
+BASERUBY = @BASERUBY@
+TEST_RUNNABLE = @TEST_RUNNABLE@
+DOXYGEN = @DOXYGEN@
prefix = @prefix@
exec_prefix = @exec_prefix@
@@ -23,18 +34,29 @@ datadir = @datadir@
arch = @arch@
sitearch = @sitearch@
sitedir = @sitedir@
+ruby_version = @ruby_version@
TESTUI = console
TESTS =
-RDOCTARGET = @RDOCTARGET@
+INSTALLDOC = @INSTALLDOC@
+DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
EXTOUT = @EXTOUT@
-RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
+arch_hdrdir = $(EXTOUT)/include/$(arch)
+VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/enc:$(srcdir)/missing
empty =
OUTFLAG = @OUTFLAG@$(empty)
-CFLAGS = @CFLAGS@ @XCFLAGS@ @ARCH_FLAG@
-CPPFLAGS = -I. -I$(srcdir) @CPPFLAGS@
+COUTFLAG = @COUTFLAG@$(empty)
+ARCH_FLAG = @ARCH_FLAG@
+CFLAGS = @CFLAGS@ $(ARCH_FLAG)
+cflags = @cflags@
+optflags = @optflags@
+debugflags = @debugflags@
+warnflags = @warnflags@
+INCFLAGS = -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir)
+XCFLAGS = @XCFLAGS@
+CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
EXTLDFLAGS =
XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
@@ -42,18 +64,34 @@ EXTLIBS =
LIBS = @LIBS@ $(EXTLIBS)
MISSING = @LIBOBJS@ @ALLOCA@
LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(EXTLDFLAGS) @ARCH_FLAG@
+DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(EXTLDFLAGS) $(ARCH_FLAG)
SOLIBS = @SOLIBS@
MAINLIBS = @MAINLIBS@
-MINIOBJS = @MINIOBJS@
+ARCHMINIOBJS = @MINIOBJS@
+BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
+BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
+BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
+RUBY_BASE_NAME=@RUBY_BASE_NAME@
+RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
RUBY_SO_NAME=@RUBY_SO_NAME@
EXEEXT = @EXEEXT@
PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@
-RUNRUBY = @RUNRUBY@
+MINIRUBY = @MINIRUBY@\
+ $(MINIRUBYOPT)
+RUNRUBY = @RUNRUBY@ $(RUNRUBYOPT) -- $(RUN_OPTS)
+XRUBY = @XRUBY@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+XRUBY_LIBDIR = @XRUBY_LIBDIR@
+XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
+XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
+
+DEFAULT_PRELUDES = $(@USE_RUBYGEMS@_GEM_PRELUDE)
#### End of system configuration section. ####
@@ -69,23 +107,50 @@ LIBRUBYARG = @LIBRUBYARG@
LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
+THREAD_MODEL = @THREAD_MODEL@
+
PREP = @PREP@
ARCHFILE = @ARCHFILE@
SETUP =
EXTSTATIC = @EXTSTATIC@
+SET_LC_MESSAGES = env LC_MESSAGES=C
+MAKEDIRS = @MKDIR_P@
+CP = cp
+MV = mv
RM = rm -f
+RMDIR = @RMDIR@
+RMDIRS = @RMDIRS@
+RMALL = @RMALL@
NM = @NM@
AR = @AR@
ARFLAGS = rcu
RANLIB = @RANLIB@
AS = @AS@
-ASFLAGS = @ASFLAGS@
+ASFLAGS = @ASFLAGS@ $(INCFLAGS)
+IFCHANGE = $(srcdir)/tool/ifchange
+SET_LC_MESSAGES = env LC_MESSAGES=C
+OBJDUMP = @OBJDUMP@
+OBJCOPY = @OBJCOPY@
+VCS = @VCS@
+VCSUP = @VCSUP@
OBJEXT = @OBJEXT@
+ASMEXT = S
+DLEXT = @DLEXT@
MANTYPE = @MANTYPE@
+SYMBOL_PREFIX = @SYMBOL_PREFIX@
+
+INSTALLED_LIST= .installed.list
+
+MKMAIN_CMD = mkmain.sh
+
+SRC_FILE = $<
+
+MESSAGE_BEGIN = @for line in
+MESSAGE_END = ; do echo "$$line"; done
-PREINSTALL = @PREINSTALL@
+configure_args = @configure_args@
#### End of variables
all:
@@ -96,47 +161,62 @@ all:
.NOEXPORT:
miniruby$(EXEEXT):
- @$(RM) $@
- $(PURIFY) $(CC) $(MAINOBJ) $(MINIOBJS) $(LIBRUBY_A) $(LIBS) $(OUTFLAG)$@ $(LDFLAGS) $(MAINLIBS)
+ @-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
+ $(ECHO) linking $@
+ $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(DMYEXT) $(LIBS) $(OUTFLAG)$@
$(PROGRAM):
@$(RM) $@
- $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) $(OUTFLAG)$@
+ $(ECHO) linking $@
+ $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) $(OUTFLAG)$@
# We must `rm' the library each time this rule is invoked because "updating" a
# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
# supported.
$(LIBRUBY_A):
@$(RM) $@
- $(AR) $(ARFLAGS) $@ $(OBJS) $(DMYEXT)
+ $(ECHO) linking static-library $@
+ $(Q) $(AR) $(ARFLAGS) $@ $(OBJS) $(DMYEXT)
@-$(RANLIB) $@ 2> /dev/null || true
$(LIBRUBY_SO):
- $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(OUTFLAG)$@
+ @-$(PRE_LIBRUBY_UPDATE)
+ $(ECHO) linking shared-library $@
+ $(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(OUTFLAG)$@
+ -$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)*_threadptr_*' $@
@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link if File.exist? link; \
File.symlink "$(LIBRUBY_SO)", link}' \
$(LIBRUBY_ALIASES) || true
-fake.rb: Makefile
- @echo ' \
- class Object; \
- CROSS_COMPILING = RUBY_PLATFORM; \
- remove_const :RUBY_PLATFORM; \
- remove_const :RUBY_VERSION; \
- RUBY_PLATFORM = "@arch@"; \
- RUBY_VERSION = "@MAJOR@.@MINOR@.@TEENY@"; \
- end; \
- if RUBY_PLATFORM =~ /mswin|bccwin|mingw/; \
- class File; \
- remove_const :ALT_SEPARATOR; \
- ALT_SEPARATOR = "\\"; \
- end; \
- end; \
- ' > $@
-
-Makefile: $(srcdir)/Makefile.in
-
-$(MKFILES): config.status $(srcdir)/common.mk
+fake: $(arch)-fake.rb
+$(arch)-fake.rb: config.status $(srcdir)/template/fake.rb.in
+ @./config.status --file=$@:$(srcdir)/template/fake.rb.in
+ @chmod +x $@
+
+ruby_pc = @ruby_pc@
+$(ruby_pc):
+ @./config.status --file=$@:$(srcdir)/template/ruby.pc.in
+
+install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
+ $(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
+ $(ECHO) installing cross-compiling stuff
+ $(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+ $(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
+ $(Q) $(BASERUBY) -p \
+ -e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
+ -e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
+ rbconfig.rb > fake-rbconfig.rb
+ $(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
+ $(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
+ @$(RM) fake.rb fake-rbconfig.rb
+ $(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+ $(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
+ $(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
+ $(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
+
+Makefile: $(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
+
+$(MKFILES): config.status
MAKE=$(MAKE) $(SHELL) ./config.status
@{ \
echo "all:; -@rm -f conftest.mk"; \
@@ -146,33 +226,164 @@ $(MKFILES): config.status $(srcdir)/common.mk
$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
{ echo "Makefile updated, restart."; exit 1; }
-config.status: $(srcdir)/configure
- MINIRUBY="$(MINIRUBY)" $(SHELL) ./config.status --recheck
+uncommon.mk: $(srcdir)/common.mk
+ sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
-$(srcdir)/configure: $(srcdir)/configure.in
- cd $(srcdir) && $(AUTOCONF)
+.PHONY: reconfig
+reconfig-args = $(srcdir)/configure $(configure_args)
+config.status-args = ./config.status --recheck
+reconfig-exec-0 = exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3`
+reconfig-exec-1 = set -x; "$$@"
-lex.c: keywords
- @-$(RM) $@
- gperf -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@ || \
- cp "$(srcdir)/$@" .
+reconfig config.status: $(srcdir)/configure $(srcdir)/enc/Makefile.in
+ @PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
+ set $(SHELL) $($@-args); $(reconfig-exec-$(V))
-.y.c:
- $(YACC) $<
- sed '/^#/s|y\.tab\.c|$@|' y.tab.c > $@
- rm -f y.tab.c
+$(srcdir)/configure: $(srcdir)/configure.in
+ $(CHDIR) $(srcdir) && exec $(AUTOCONF)
+
+incs: id.h
+
+# Things which should be considered:
+# * with gperf v.s. without gperf
+# * committers may have various versions of gperf
+# * ./configure v.s. ../ruby/configure
+# * GNU make v.s. HP-UX make # HP-UX make invokes the action if lex.c and keywords has same mtime.
+# * svn checkout generate a file with mtime as current time
+# * ext4 and XFS has a mtime with fractional part
+lex.c: defs/keywords
+ @\
+ if cmp -s $(srcdir)/defs/lex.c.src $?; then \
+ [ $(Q) ] && echo copying $@ || set -x; \
+ $(CP) $(srcdir)/lex.c.blt $@; \
+ else \
+ [ $(Q) ] && echo generating $@ || set -x; \
+ gperf -C -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@.tmp && \
+ $(MV) $@.tmp $@ && \
+ $(CP) $? $(srcdir)/defs/lex.c.src && \
+ $(CP) $@ $(srcdir)/lex.c.blt; \
+ fi
+
+NAME2CTYPE_OPTIONS = -7 -c -j1 -i1 -t -C -P -T -H uniname2ctype_hash -Q uniname2ctype_pool -N uniname2ctype_p
+
+enc/unicode/name2ctype.h: enc/unicode/name2ctype.kwd
+ $(MAKEDIRS) $(@D)
+ @set +e; \
+ if cmp -s $(?:.kwd=.src) $?; then \
+ set -x; \
+ $(CP) $(?:.kwd=.h.blt) $@; \
+ else \
+ trap '$(RM) $@-1.h $@-2.h' 0 && \
+ set -x; \
+ sed '/^#ifdef USE_UNICODE_PROPERTIES/,/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-1.h && \
+ gperf $(NAME2CTYPE_OPTIONS) < $? > $@-2.h && \
+ diff -DUSE_UNICODE_PROPERTIES $@-1.h $@-2.h > $@.tmp || :; \
+ $(MV) $@.tmp $@ && \
+ $(CP) $? $(?:.kwd=.src) && \
+ $(CP) $@ $(?:.kwd=.h.blt); \
+ fi
.c.@OBJEXT@:
- $(CC) $(CFLAGS) $(CPPFLAGS) -c $<
+ @$(ECHO) compiling $<
+ $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
.s.@OBJEXT@:
- $(AS) $(ASFLAGS) -o $@ $<
+ @$(ECHO) assembling $<
+ $(Q) $(AS) $(ASFLAGS) -o $@ $<
+
+.c.S:
+ @$(ECHO) translating $<
+ $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
+
+.c.i:
+ @$(ECHO) preprocessing $<
+ $(Q) $(CPP) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
clean-local::
- @$(RM) ext/extinit.c ext/extinit.$(OBJEXT)
+ $(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output
+ -$(Q)$(RM) $(pkgconfig_DATA)
distclean-local::
- @$(RM) ext/config.cache $(RBCONFIG)
+ $(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
+ -$(Q)$(RM) run.gdb
+ -$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h
+ -$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
+
+clean-ext distclean-ext realclean-ext::
+ @cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
+ test "$$#" = 0 && set .; \
+ set dummy `\
+ find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$:~:' | sort | sed 's:~$$::'; \
+ `; shift; \
+ cd ..; \
+ for dir do \
+ echo $(@:-ext=)ing "$$dir"; \
+ (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
+ case "$@" in \
+ *distclean-ext*|*realclean-ext*) \
+ $(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
+ esac; \
+ done
+
+distclean-ext realclean-ext::
+ -$(Q)$(RMDIR) ext 2> /dev/null || true
+
+clean-extout:
+ -$(Q)$(RMDIRS) $(EXTOUT) 2> /dev/null || true
+
+clean-enc distclean-enc realclean-enc:
+ @test -f "$(ENC_MK)" || exit 0; \
+ echo $(@:-enc=ing) encodings; \
+ exec $(MAKE) -f $(ENC_MK) $(MFLAGS) $(@:-enc=)
+
+clean-rdoc distclean-rdoc realclean-rdoc:
+ @echo $(@:-rdoc=ing) rdoc
+ $(Q)$(RMALL) $(RDOCOUT)
+clean-capi distclean-capi realclean-capi:
+ @echo $(@:-capi=ing) capi
+ $(Q)$(RMALL) $(CAPIOUT)
+
+clean-platform:
+ @$(RM) $(PLATFORM_D)
+ -$(Q) $(RMDIR) $(PLATFORM_DIR) 2> /dev/null || true
ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
- $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) -o$@ -c ext/extinit.c
+ $(ECHO) compiling $@
+ $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
+
+up::
+ @$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
+
+update-mspec:
+ @$(CHDIR) $(srcdir); \
+ if [ -d spec/mspec ]; then \
+ cd spec/mspec; \
+ echo updating mspec ...; \
+ exec git pull; \
+ else \
+ echo retrieving mspec ...; \
+ exec git clone $(MSPEC_GIT_URL) spec/mspec; \
+ fi
+
+update-rubyspec: update-mspec
+ @$(CHDIR) $(srcdir); \
+ if [ -d spec/rubyspec ]; then \
+ cd spec/rubyspec; \
+ echo updating rubyspec ...; \
+ exec git pull; \
+ else \
+ echo retrieving rubyspec ...; \
+ exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
+ fi
+
+test-rubyspec-precheck:
+ @if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here. make update-rubyspec first.; exit 1; fi
+
+INSNS = opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
+ vmtc.inc vm.inc
+
+$(INSNS): $(srcdir)/insns.def vm_opts.h \
+ $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
+ $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
+ $(ECHO) generating $@
+ $(Q) $(BASERUBY) -Ks $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
diff --git a/NEWS b/NEWS
new file mode 100644
index 0000000000..30fec33fdd
--- /dev/null
+++ b/NEWS
@@ -0,0 +1,341 @@
+# -*- rd -*-
+= NEWS
+
+This document is a list of user visible feature changes made between
+releases except for bug fixes.
+
+Note that each entry is kept so brief that no reason behind or
+reference information is supplied with. For a full list of changes
+with all sufficient information, see the ChangeLog file.
+
+== Changes since the 1.9.2 release
+=== License
+
+* Ruby's License is changed from a dual license with GPLv2
+ to a dual license with 2-clause BSDL.
+
+=== Known platform dependent issues
+==== OS X Lion
+
+* You have to configure ruby with '--with-gcc=gcc-4.2' if you're using
+ Xcode 4.1, or, if you're using Xcode 4.2, you have to configure ruby
+ with '--with-gcc=clang'.
+
+=== C API updates
+
+* rb_scan_args() is enhanced with support for option hash argument
+ extraction.
+
+* ruby_vm_at_exit() added. This enables extension libs to hook a VM
+ termination.
+
+* rb_reserved_fd_p() added. If you want to close all file descriptors,
+ check using this API. [ruby-core:37759]
+
+=== Library updates (outstanding ones only)
+
+* builtin classes
+
+ * ARGF
+ * new methods:
+ * ARGF.print
+ * ARGF.printf
+ * ARGF.putc
+ * ARGF.puts
+ * ARGF.read_nonblock
+ * ARGF.to_write_io
+ * ARGF.write
+
+ * Array
+ * extended method:
+ * Array#pack supports endian modifiers
+
+ * Bignum
+ * Multiplication algorithm for Bignums with a large number of digits over
+ 150 BDIGITs is changed in order to reduce its calculation time.
+ Now such large Bignums are multiplied by using Toom-3 algorithm.
+
+ * Encoding
+ * new encodings:
+ * CP950
+ * CP951
+ * UTF-16
+ * UTF-32
+ * change alias:
+ * SJIS is Windows-31J
+
+ * File
+ * new constant:
+ * File::NULL
+ name of NULL device.
+ * File::DIRECT
+ name of O_DIRECT.
+
+ * IO
+ * extended method:
+ * IO#putc supports multibyte characters
+ * new methods:
+ * IO#advise
+ * IO.write(name, string, [offset] )
+ Write `string` to file `name`.
+ Opposite with File.read.
+ * IO.binwrite(name, string, [offset] )
+ binary version of IO.write.
+
+ * Kernel
+ * move #__id__ to BasicObject.
+ * extended method:
+ * Kernel#rand supports range argument
+
+ * Module
+ * new methods:
+ * Module#private_constant
+ * Module#public_constant
+
+ * Random
+ * extended method:
+ * Random.rand supports range argument
+
+ * String
+ * extended method:
+ * String#unpack supports endian modifiers
+ * new method:
+ * String#prepend
+ * String#byteslice
+
+ * Time
+ * extended method:
+ * Time#strftime supports %:z and %::z.
+
+ * Process
+ * Process#maxgroups and Process#maxgroups= now raise NotImplementedError if
+ the platform don't support supplementary groups concept.
+
+* bigdecimal
+
+ * BigDecimal#power and BigDecimal#** support non-integral exponent.
+
+ * Kernel.BigDecimal and BigDecimal.new now accept instances of Integer,
+ Rational, Float, and BigDecimal. If you pass a Rational or a Float to
+ them, you must specify the precision to produce the digits of a BigDecimal.
+
+ * The behavior of BigDecimal#coerce with a Rational is changed. It uses
+ the precision of the receiver BigDecimal to produce the digits of a
+ BigDecimal from the given Rational.
+
+* bigdecimal/util
+
+ * BigDecimal#to_d and Integer#to_d are added.
+
+ * Float#to_d accepts a precision.
+
+ * Rational#to_d raises ArgumentError when passing zero or negative
+ precision.
+
+ * Rational#to_d
+
+ * Zero and an implicit precision is deprecated.
+ This feature is removed at the next release of bigdecimal.
+
+ * A negative precision isn't supported.
+ Be careful it is an incompatible change.
+
+* date
+
+ * Accepts flonum explicitly with limitations.
+ * If the given offset is flonum, DateTime assumes its precision is
+ at most second.
+
+ DateTime.new(2001,2,3,0,0,0,3.0/24) ==
+ DateTime.new(2001,2,3,0,0,0,'+03:00')
+ #=> true
+
+ * If the given operand for -/+ is flonum, DateTime assumes its
+ precision is at most nanosecond.
+
+ DateTime.new(2001,2,3) + 0.5 == DateTime.new(2001,2,3,12)
+ #=> true
+
+ * Precision of offset is always at most second.
+
+ Rational('0.5') == Rational('0.500001') #=> false
+ DateTime.new(2001,2,3,0,0,0,Rational('0.5')) ==
+ DateTime.new(2001,2,3,0,0,0,Rational('0.500001'))
+ #=> true
+
+ * Ignores long offset and far reform day (with warning).
+
+ * Now accepts only:
+
+ -1<=offset<=1 (-24:00..+24:00)
+ 2298874<=start<=2426355 or -/+oo
+ (proleptic Gregorian/Julian mean -/+oo)
+
+ * A method strftime cannot produce huge output (same as Time's one).
+
+ * Even though Date/DateTime can handle far dates, the following causes
+ an exception.
+
+ DateTime.new(1<<10000).strftime('%Y') # Errno::ERANGE
+
+ * Changed the format of inspect.
+ * Changed the format of marshal (but, can load old dumps).
+
+* io/console
+ * new methods:
+ * IO#noecho {|io| }
+ * IO#echo=
+ * IO#echo?
+ * IO#raw {|io| }
+ * IO#raw!
+ * IO#getch
+ * IO#winsize
+ * IO.console
+
+* json
+ * updated to v1.5.4.
+
+* matrix
+ * new classes:
+ * Matrix::EigenvalueDecomposition
+ * Matrix::LUPDecomposition
+ * new methods:
+ * Matrix#diagonal?
+ * Matrix#eigen
+ * Matrix#eigensystem
+ * Matrix#hermitian?
+ * Matrix#lower_triangular?
+ * Matrix#lup
+ * Matrix#lup_decomposition
+ * Matrix#normal?
+ * Matrix#orthogonal?
+ * Matrix#permutation?
+ * Matrix#round
+ * Matrix#symmetric?
+ * Matrix#unitary?
+ * Matrix#upper_triangular?
+ * Matrix#zero?
+ * Vector#magnitude, #norm
+ * Vector#normalize
+ * extended methods:
+ * Matrix#each and #each_with_index can iterate on a subset of the elements
+ * Matrix#find_index returns [row, column] and can iterate on a subset
+ of the elements
+ * Matrix#** implements Numeric exponents (using the eigensystem)
+ * Matrix.zero can build rectangular matrices
+
+* minitest
+ * Minitest has been updated to version 2.2.2.
+ * For full details, see https://github.com/seattlerb/minitest/blob/master/History.txt
+
+* net/http
+ * SNI (Server Name Indication) supported for HTTPS.
+
+ * Allow to configure to wait server returning '100 continue' response
+ before sending HTTP request body. Set Net::HTTP#continue_timeout AND pass
+ 'expect' => '100-continue' to a extra HTTP header.
+
+ For example, the following code sends HTTP header and waits for getting
+ '100 continue' response before sending HTTP request body. When 0.5 [sec]
+ timeout occurs or the server send '100 continue', the client sends HTTP
+ request body.
+ http.continue_timeout = 0.5
+ http.request_post('/continue', 'body=BODY', 'expect' => '100-continue')
+
+ * new method:
+ * Net::HTTPRequest#set_form): Added to support
+ both application/x-www-form-urlencoded and multipart/form-data.
+
+* objspace
+ * new method:
+ * ObjectSpace::memsize_of_all
+
+* openssl
+ * PKey::RSA and PKey::DSA now use the generic X.509 encoding scheme
+ (e.g. used in a X.509 certificate's Subject Public Key Info) when
+ exporting public keys to DER or PEM. Backward compatibility is
+ ensured by (already existing) fallbacks during creation.
+ * OpenSSL::ASN1::Constructive#new and OpenSSL::ASN1::Primitive#new
+ (and the constructors of their sub-classes) will no longer force
+ tagging to be set to :EXPLICIT when tag and/or tag_class are passed
+ as parameters. tagging must be set explicitly.
+ * Support for infinite length encodings via infinite_length attribute.
+ * OpenSSL::PKey.read( file | string [, pwd] ) allows to read arbitrary
+ public/private keys in DER-/PEM-encoded form with an optional password
+ for encrypted PEM encodings.
+ * Add new method OpenSSL::X509::Name#hash_old as a wrapper of
+ X509_NAME_hash_old() defined from OpenSSL 1.0.0. It returns OpenSSL 0.9.8
+ compatible hash value.
+
+* optparse
+ * support for bash/zsh completion.
+
+* Rake
+ * Rake has been upgraded from 0.8.7 to 0.9.2.2. For full release notes see
+ https://github.com/jimweirich/rake/blob/master/CHANGES
+
+* RDoc
+ * RDoc has been upgraded to version 3.9.4. For full release notes see
+ http://docs.seattlerb.org/rdoc/History_txt.html
+
+* rexml
+ * Support Ruby native encoding mechanism and iconv dependency is dropped.
+
+* RubyGems
+ * RubyGems has been upgraded to version 1.8.10. For full release notes see
+ http://rubygems.rubyforge.org/rubygems-update/History_txt.html
+
+* stringio
+ * extended method:
+ * StringIO#set_encoding can get 2nd argument and optional hash.
+
+* test/unit
+ * New arguments:
+ * -j N, --jobs=N: Allow run N testcases at once.
+ * --jobs-status: Show status of jobs when parallel running.
+ * --no-retry: Don't retry testcases which failed when parallel running.
+ * --ruby=RUBY: path to ruby for job(worker) process. optional.
+ * --hide-skip: Hide skip messages. You'll see the number of skips at end of
+ test result.
+
+* uri
+ * new methods:
+ * URI::Generic#hostname
+ * URI::Generic#hostname=
+
+* webrick
+ * new method:
+ * WEBrick::HTTPRequest#continue for generating '100 continue' response.
+ * new logging directive:
+ * %{remote}p for remote (client) port number.
+
+* yaml
+ * The default YAML engine is now Psych. You may downgrade to syck by setting
+ YAML::ENGINE.yamler = 'syck'.
+
+* zlib
+ * new methods:
+ * Zlib.deflate
+ * Zlib.inflate
+
+* FileUtils
+ * extended method:
+ * FileUtils#chmod supports symbolic mode argument.
+
+=== Language changes
+
+* Regexps now support Unicode 6.0. (new characters and scripts)
+
+* [experimental] Regexps now support Age property.
+ Unlike Perl, current implementation takes interpretation of the
+ interpretation of UTS #18.
+ http://www.unicode.org/reports/tr18/
+
+* Turning on/off indentation warnings with directives.
+ ("# -*- warn-indent: true -*-" / "# -*- warn-indent: false -*-")
+
+=== Compatibility issues (excluding feature bug fixes)
+
+ * Rational#to_d
+
+ See above.
diff --git a/README b/README
index cf836415ad..3d2e636e4d 100644
--- a/README
+++ b/README
@@ -16,8 +16,9 @@ Perl). It is simple, straight-forward, and extensible.
+ Iterators and Closures
+ Garbage Collection
+ Dynamic Loading of Object files(on some architecture)
- + Highly Portable(works on many UNIX machines, and on DOS,
- Windows, Mac, BeOS etc.)
+ + Highly Portable (works on many Unix-like/POSIX compatible platforms
+ as well as Windows, Mac OS X, BeOS etc.)
+ cf. http://redmine.ruby-lang.org/wiki/ruby-19/SupportedPlatforms
* How to get Ruby
@@ -26,11 +27,6 @@ The Ruby distribution files can be found in the following FTP site:
ftp://ftp.ruby-lang.org/pub/ruby/
-The latest source code of this version series can be checked out
-through SVN with the following command:
-
- $ svn co http://svn.ruby-lang.org/repos/ruby/branches/ruby_1_8_6/
-
The trunk of the Ruby source tree can be checked out with the
following command:
@@ -70,6 +66,10 @@ This is what you need to do to compile and install Ruby:
2. Run ./configure, which will generate config.h and Makefile.
+ Some C compiler flags may be added by default depending on your
+ environment. Specify optflags=.. and warnflags=.. as necessary
+ to override them.
+
3. Edit defines.h if you need. Usually this step will not be needed.
4. Remove comment mark(#) before the module names from ext/Setup (or
@@ -89,6 +89,32 @@ This is what you need to do to compile and install Ruby:
7. Run 'make install'
+ This command will create following directories and install files
+ onto them.
+
+ * ${DESTDIR}${prefix}/bin
+ * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}
+ * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+ * ${DESTDIR}${prefix}/lib
+ * ${DESTDIR}${prefix}/lib/ruby
+ * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}
+ * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+ * ${DESTDIR}${prefix}/lib/ruby/site_ruby
+ * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}
+ * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+ * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby
+ * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}
+ * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+ * ${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}
+ * ${DESTDIR}${prefix}/share/man/man1
+ * ${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system
+
+ If Ruby's API version is `x.y.z', the ((|${MAJOR}|)) is `x', the
+ ((|${MINOR}|)) is `y', and the ((|${TEENY}|)) is `z'.
+
+ NOTE: teeny of the API version may be different from one of
+ Ruby's program version
+
You may have to be a super user to install ruby.
If you fail to compile ruby, please send the detailed error report with
diff --git a/README.EXT b/README.EXT
index e5d39911ca..de63f54699 100644
--- a/README.EXT
+++ b/README.EXT
@@ -8,8 +8,8 @@ In C, variables have types and data do not have types. In contrast,
Ruby variables do not have a static type, and data themselves have
types, so data will need to be converted between the languages.
-Data in Ruby are represented by C type `VALUE'. Each VALUE data has
-its data-type.
+Data in Ruby are represented by the C type `VALUE'. Each VALUE data
+has its data-type.
To retrieve C data from a VALUE, you need to:
@@ -31,10 +31,12 @@ The Ruby interpreter has the following data types:
T_STRING string
T_REGEXP regular expression
T_ARRAY array
- T_FIXNUM Fixnum(31bit integer)
T_HASH associative array
T_STRUCT (Ruby) structure
T_BIGNUM multi precision integer
+ T_FIXNUM Fixnum(31bit or 63bit integer)
+ T_COMPLEX complex number
+ T_RATIONAL rational number
T_FILE IO
T_TRUE true
T_FALSE false
@@ -46,9 +48,8 @@ In addition, there are several other types used internally:
T_ICLASS
T_MATCH
T_UNDEF
- T_VARMAP
- T_SCOPE
T_NODE
+ T_ZOMBIE
Most of the types are represented by C structures.
@@ -78,7 +79,8 @@ There is the data-type check function
void Check_Type(VALUE value, int type)
-which raises an exception if the VALUE does not have the type specified.
+which raises an exception if the VALUE does not have the type
+specified.
There are also faster check macros for fixnums and nil.
@@ -87,42 +89,53 @@ There are also faster check macros for fixnums and nil.
1.3 Convert VALUE into C data
-The data for type T_NIL, T_FALSE, T_TRUE are nil, true, false
+The data for type T_NIL, T_FALSE, T_TRUE are nil, false, true
respectively. They are singletons for the data type.
-
-The T_FIXNUM data is a 31bit length fixed integer (63bit length on
-some machines), which can be convert to a C integer by using the
-FIX2INT() macro. There is also NUM2INT() which converts any Ruby
-numbers into C integers. The NUM2INT() macro includes a type check, so
-an exception will be raised if the conversion failed. NUM2DBL() can
-be used to retrieve the double float value in same way.
-
-To get char* from a VALUE, version 1.7 recommend to use new macros
-StringValue() and StringValuePtr(). StringValue(var) replaces var's
-value to the result of "var.to_str()". StringValuePtr(var) does same
-replacement and returns char* representation of var. These macros
-will skip the replacement if var is a String. Notice that the macros
-requires to take only lvalue as their argument, to change the value
-of var in the replacement.
-
-In version 1.6 or earlier, STR2CSTR() was used to do same thing
-but now it is obsoleted in version 1.7 because of STR2CSTR() has
-a risk of dangling pointer problem in to_str() impliclit conversion.
+The equivalent C constants are: Qnil, Qfalse, Qtrue.
+Note that Qfalse is false in C also (i.e. 0), but not Qnil.
+
+The T_FIXNUM data is a 31bit or 63bit length fixed integer.
+This size is depend on the size of long: if long is 32bit then
+T_FIXNUM is 31bit, if long is 64bit then T_FIXNUM is 63bit.
+T_FIXNUM can be converted to a C integer by using the
+FIX2INT() macro or FIX2LONG(). Though you have to check that the
+data is really FIXNUM before using them, they are faster. FIX2LONG()
+never raises exceptions, but FIX2INT() raises RangeError if the
+result is bigger or smaller than the size of int.
+There are also NUM2INT() and NUM2LONG() which converts any Ruby
+numbers into C integers. These macros includes a type check,
+so an exception will be raised if the conversion failed. NUM2DBL()
+can be used to retrieve the double float value in the same way.
+
+You can use the macros
+StringValue() and StringValuePtr() to get a char* from a VALUE.
+StringValue(var) replaces var's value with the result of "var.to_str()".
+StringValuePtr(var) does same replacement and returns char*
+representation of var. These macros will skip the replacement if var
+is a String. Notice that the macros take only the lvalue as their
+argument, to change the value of var in place.
+
+You can also use the macro named StringValueCStr(). This is just
+like StringValuePtr(), but always add nul character at the end of
+the result. If the result contains nul character, this macro causes
+the ArgumentError exception.
+StringValuePtr() doesn't guarantee the existence of a nul at the end
+of the result, and the result may contain nul.
Other data types have corresponding C structures, e.g. struct RArray
-for T_ARRAY etc. The VALUE of the type which has corresponding structure
-can be cast to retrieve the pointer to the struct. The casting macro
-will be of the form RXXXX for each data type; for instance, RARRAY(obj).
-See "ruby.h".
+for T_ARRAY etc. The VALUE of the type which has the corresponding
+structure can be cast to retrieve the pointer to the struct. The
+casting macro will be of the form RXXXX for each data type; for
+instance, RARRAY(obj). See "ruby.h".
-For example, `RSTRING(str)->len' is the way to get the size of the
-Ruby String object. The allocated region can be accessed by
-`RSTRING(str)->ptr'. For arrays, use `RARRAY(ary)->len' and
-`RARRAY(ary)->ptr' respectively.
+There are some accessing macros for structure members, for example
+`RSTRING_LEN(str)' to get the size of the Ruby String object. The
+allocated region can be accessed by `RSTRING_PTR(str)'. For arrays,
+use `RARRAY_LEN(ary)' and `RARRAY_PTR(ary)' respectively.
Notice: Do not change the value of the structure directly, unless you
-are responsible for the result. This ends up being the cause of interesting
-bugs.
+are responsible for the result. This ends up being the cause of
+interesting bugs.
1.4 Convert C data into VALUE
@@ -152,9 +165,10 @@ range, but is a bit slower.
1.5 Manipulating Ruby data
-As I already mentioned, it is not recommended to modify an object's internal
-structure. To manipulate objects, use the functions supplied by the Ruby
-interpreter. Some (not all) of the useful functions are listed below:
+As I already mentioned, it is not recommended to modify an object's
+internal structure. To manipulate objects, use the functions supplied
+by the Ruby interpreter. Some (not all) of the useful functions are
+listed below:
String functions
@@ -163,6 +177,7 @@ interpreter. Some (not all) of the useful functions are listed below:
Creates a new Ruby string.
rb_str_new2(const char *ptr)
+ rb_str_new_cstr(const char *ptr)
Creates a new Ruby string from a C string. This is equivalent to
rb_str_new(ptr, strlen(ptr)).
@@ -173,13 +188,58 @@ interpreter. Some (not all) of the useful functions are listed below:
sources should be tainted.
rb_tainted_str_new2(const char *ptr)
+ rb_tainted_str_new_cstr(const char *ptr)
Creates a new tainted Ruby string from a C string.
+ rb_sprintf(const char *format, ...)
+ rb_vsprintf(const char *format, va_list ap)
+
+ Creates a new Ruby string with printf(3) format.
+
rb_str_cat(VALUE str, const char *ptr, long len)
Appends len bytes of data from ptr to the Ruby string.
+ rb_str_cat2(VALUE str, const char* ptr)
+
+ Appends C string ptr to Ruby string str. This function is
+ equivalent to rb_str_cat(str, ptr, strlen(ptr)).
+
+ rb_str_catf(VALUE str, const char* format, ...)
+ rb_str_vcatf(VALUE str, const char* format, va_list ap)
+
+ Appends C string format and successive arguments to Ruby string
+ str according to a printf-like format. These functions are
+ equivalent to rb_str_cat2(str, rb_sprintf(format, ...)) and
+ rb_str_cat2(str, rb_vsprintf(format, ap)), respectively.
+
+ rb_enc_str_new(const char *ptr, long len, rb_encoding *enc)
+
+ Creates a new Ruby string with the specified encoding.
+
+ rb_usascii_str_new(const char *ptr, long len)
+ rb_usascii_str_new_cstr(const char *ptr)
+
+ Creates a new Ruby string with encoding US-ASCII.
+
+ rb_str_resize(VALUE str, long len)
+
+ Resizes Ruby string to len bytes. If str is not modifiable, this
+ function raises an exception. The length of str must be set in
+ advance. If len is less than the old length the content beyond
+ len bytes is discarded, else if len is greater than the old length
+ the content beyond the old length bytes will not be preserved but
+ will be garbage. Note that RSTRING_PTR(str) may change by calling
+ this function.
+
+ rb_str_set_len(VALUE str, long len)
+
+ Sets the length of Ruby string. If str is not modifiable, this
+ function raises an exception. This function preserves the content
+ upto len bytes, regardless RSTRING_LEN(str). len must not exceed
+ the capacity of str.
+
Array functions
rb_ary_new()
@@ -199,17 +259,35 @@ interpreter. Some (not all) of the useful functions are listed below:
Creates an n-element array from a C array.
+ rb_ary_to_ary(VALUE obj)
+
+ Converts the object into an array.
+ Equivalent to Object#to_ary.
+
+ There are many functions to operate an array.
+ They may dump core if other types are given.
+
+ rb_ary_aref(argc, VALUE *argv, VALUE ary)
+
+ Equivaelent to Array#[].
+
+ rb_ary_entry(VALUE ary, long offset)
+
+ ary[offset]
+
+ rb_ary_subseq(VALUE ary, long beg, long len)
+
+ ary[beg, len]
+
rb_ary_push(VALUE ary, VALUE val)
rb_ary_pop(VALUE ary)
rb_ary_shift(VALUE ary)
rb_ary_unshift(VALUE ary, VALUE val)
- Array operations. The first argument to each functions must be an
- array. They may dump core if other types given.
2. Extending Ruby with C
-2.1 Addding new features to Ruby
+2.1 Adding new features to Ruby
You can add new features (classes, methods, etc.) to the Ruby
interpreter. Ruby provides APIs for defining the following things:
@@ -244,7 +322,7 @@ To define methods or singleton methods, use these functions:
VALUE (*func)(), int argc)
The `argc' represents the number of the arguments to the C function,
-which must be less than 17. But I believe you don't need that much. :-)
+which must be less than 17. But I doubt you'll need that many.
If `argc' is negative, it specifies the calling sequence, not number of
the arguments.
@@ -264,15 +342,23 @@ will be called like:
where obj is the receiver, and args is the Ruby array containing
actual arguments.
-There are two more functions to define methods. One is to define
-private methods:
+There are some more functions to define methods. One takes an ID
+as the name of method to be defined. See 2.2.2 for IDs.
+
+ void rb_define_method_id(VALUE klass, ID name,
+ VALUE (*func)(ANYARGS), int argc)
+
+There are two functions to define private/protected methods:
void rb_define_private_method(VALUE klass, const char *name,
VALUE (*func)(), int argc)
+ void rb_define_protected_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
-The other is to define module functions, which are private AND singleton
-methods of the module. For example, sqrt is the module function
-defined in Math module. It can be call in the form like:
+At last, rb_define_module_function defines a module functions,
+which are private AND singleton methods of the module.
+For example, sqrt is the module function defined in Math module.
+It can be called in the following way:
Math.sqrt(4)
@@ -286,22 +372,26 @@ To define module functions, use:
void rb_define_module_function(VALUE module, const char *name,
VALUE (*func)(), int argc)
-Oh, in addition, function-like methods, which are private methods defined
+In addition, function-like methods, which are private methods defined
in the Kernel module, can be defined using:
void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-To define alias to the method,
+To define an alias for the method,
void rb_define_alias(VALUE module, const char* new, const char* old);
+To define a reader/writer for an attribute,
+
+ void rb_define_attr(VALUE klass, const char *name, int read, int write)
+
To define and undefine the `allocate' class method,
void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
void rb_undef_alloc_func(VALUE klass);
-func have to take the klass as the argument and return a newly
-allocated instance. This instance should be empty as possible,
+func has to take the klass as the argument and return a newly
+allocated instance. This instance should be as empty as possible,
without any expensive (including external) resources.
2.1.3 Constant definition
@@ -321,21 +411,33 @@ There are several ways to invoke Ruby's features from C code.
2.2.1 Evaluate Ruby Programs in a String
The easiest way to use Ruby's functionality from a C program is to
-evaluate the string as Ruby program. This function will do the job.
+evaluate the string as Ruby program. This function will do the job:
VALUE rb_eval_string(const char *str)
Evaluation is done under the current context, thus current local variables
of the innermost method (which is defined by Ruby) can be accessed.
+Note that the evaluation can raise an exception. There is a safer
+function:
+
+ VALUE rb_eval_string_protect(const char *str, int *state)
+
+It returns nil when an error occur. Moreover, *state is zero if str was
+successfully evaluated, or nonzero otherwise.
+
+
2.2.2 ID or Symbol
-You can invoke methods directly, without parsing the string. First I need
-to explain about ID. ID is the integer number to represent Ruby's
-identifiers such as variable names. The Ruby data type corresponding to ID
-is Symbol. It can be accessed from Ruby in the form:
+You can invoke methods directly, without parsing the string. First I
+need to explain about ID. ID is the integer number to represent
+Ruby's identifiers such as variable names. The Ruby data type
+corresponding to ID is Symbol. It can be accessed from Ruby in the
+form:
:Identifier
+or
+ :"any kind of string"
You can get the ID value from a string within C code by using
@@ -366,8 +468,8 @@ specified by the symbol mid.
2.2.4 Accessing the variables and constants
You can access class variables and instance variables using access
-functions. Also, global variables can be shared between both environments.
-There's no way to access Ruby's local variables.
+functions. Also, global variables can be shared between both
+environments. There's no way to access Ruby's local variables.
The functions to access/modify instance variables are below:
@@ -386,7 +488,8 @@ See 2.1.3 for defining new constant.
3.1 Ruby constants that C can be accessed from C
-The following Ruby constants can be referred from C.
+As stated in section 1.3,
+the following Ruby constants can be referred from C.
Qtrue
Qfalse
@@ -416,25 +519,32 @@ function below.
You can defined hooked variables. The accessor functions (getter and
setter) are called on access to the hooked variables.
- void rb_define_hooked_variable(constchar *name, VALUE *var,
+ void rb_define_hooked_variable(const char *name, VALUE *var,
VALUE (*getter)(), void (*setter)())
If you need to supply either setter or getter, just supply 0 for the
hook you don't need. If both hooks are 0, rb_define_hooked_variable()
works just like rb_define_variable().
- void rb_define_virtual_variable(const char *name,
- VALUE (*getter)(), void (*setter)())
+The prototypes of the getter and setter functions are as follows:
-This function defines a Ruby global variable without a corresponding C
+ VALUE (*getter)(ID id, VALUE *var);
+ void (*setter)(VALUE val, ID id, VALUE *var);
+
+
+Also you can define a Ruby global variable without a corresponding C
variable. The value of the variable will be set/get only by hooks.
+ void rb_define_virtual_variable(const char *name,
+ VALUE (*getter)(), void (*setter)())
+
The prototypes of the getter and setter functions are as follows:
- (*getter)(ID id, void *data, struct global_entry* entry);
- (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+ VALUE (*getter)(ID id);
+ void (*setter)(VALUE val, ID id);
+
-3.3 Encapsulate C data into Ruby object
+3.3 Encapsulate C data into a Ruby object
To wrap and objectify a C pointer as a Ruby object (so called
DATA), use Data_Wrap_Struct().
@@ -448,6 +558,10 @@ function to free the pointer allocation. If this is -1, the pointer
will be just freed. The functions mark and free will be called from
garbage collector.
+These mark / free functions are invoked during GC execution. No
+object allocations are allowed during it, so do not allocate ruby
+objects inside them.
+
You can allocate and wrap the structure in one step.
Data_Make_Struct(klass, type, mark, free, sval)
@@ -493,6 +607,9 @@ has only one source file, choosing ``LIBRARY.c'' as a file name is
preferred. On the other hand, in case your library has multiple source
files, avoid choosing ``LIBRARY.c'' for a file name. It may conflict
with an intermediate file ``LIBRARY.o'' on some platforms.
+Note that some functions in mkmf library described below generate
+a file ``conftest.c'' for checking with compilation. You shouldn't
+choose ``conftest.c'' as a name of a source file.
Ruby will execute the initializing function named ``Init_LIBRARY'' in
the library. For example, ``Init_dbm()'' will be executed when loading
@@ -501,7 +618,8 @@ the library.
Here's the example of an initializing function.
--
-Init_dbm()
+void
+Init_dbm(void)
{
/* define DBM class */
cDBM = rb_define_class("DBM", rb_cObject);
@@ -535,8 +653,8 @@ struct dbmdata {
obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
--
-This code wraps the dbmdata structure into a Ruby object. We avoid wrapping
-DBM* directly, because we want to cache size information.
+This code wraps the dbmdata structure into a Ruby object. We avoid
+wrapping DBM* directly, because we want to cache size information.
To retrieve the dbmdata structure from a Ruby object, we define the
following macro:
@@ -556,8 +674,7 @@ methods with a fixed number of arguments receive arguments like this:
--
static VALUE
-fdbm_delete(obj, keystr)
- VALUE obj, keystr;
+fdbm_delete(VALUE obj, VALUE keystr)
{
:
}
@@ -571,10 +688,7 @@ arguments like this:
--
static VALUE
-fdbm_s_open(argc, argv, klass)
- int argc;
- VALUE *argv;
- VALUE klass;
+fdbm_s_open(int argc, VALUE *argv, VALUE klass)
{
:
if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
@@ -589,16 +703,17 @@ argument is the C array of the method arguments, and the third
argument is the receiver of the method.
You can use the function rb_scan_args() to check and retrieve the
-arguments. For example, "11" means that the method requires at least one
-argument, and at most receives two arguments.
+arguments. The third argument is a string that specifies how to
+capture method arguments and assign them to the following VALUE
+references.
+
-Methods with an arbitrary number of arguments can receive arguments
-by Ruby's array, like this:
+The following is an example of a method that takes arguments by Ruby's
+array:
--
static VALUE
-fdbm_indexes(obj, args)
- VALUE obj, args;
+thread_initialize(VALUE thread, VALUE args)
{
:
}
@@ -619,7 +734,7 @@ are not exported to the Ruby world. You need to protect them by
If the file named extconf.rb exists, it will be executed to generate
Makefile.
-extconf.rb is the file for check compilation conditions etc. You
+extconf.rb is the file for checking compilation conditions etc. You
need to put
require 'mkmf'
@@ -639,12 +754,12 @@ The value of the variables below will affect the Makefile.
$LDFLAGS: included in LDFLAGS make variable (such as -L)
$objs: list of object file names
-In normal, object files list is automatically generated by searching
-source files, but you need directs them explicitly if any sources will
+Normally, the object files list is automatically generated by searching
+source files, but you must define them explicitly if any sources will
be generated while building.
If a compilation condition is not fulfilled, you should not call
-``create_makefile''. The Makefile will not generated, compilation will
+``create_makefile''. The Makefile will not be generated, compilation will
not be done.
(5) prepare depend (optional)
@@ -654,7 +769,7 @@ check dependencies. You can make this file by invoking
% gcc -MM *.c > depend
-It's no harm. Prepare it.
+It's harmless. Prepare it.
(6) generate Makefile
@@ -662,6 +777,11 @@ Try generating the Makefile by:
ruby extconf.rb
+If the library should be installed under vendor_ruby directory
+instead of site_ruby directory, use --vendor option as follows.
+
+ ruby extconf.rb --vendor
+
You don't need this step if you put the extension library under the ext
directory of the ruby source tree. In that case, compilation of the
interpreter will do this step for you.
@@ -673,12 +793,12 @@ Type
make
to compile your extension. You don't need this step either if you have
-put extension library under the ext directory of the ruby source tree.
+put the extension library under the ext directory of the ruby source tree.
(8) debug
You may need to rb_debug the extension. Extensions can be linked
-statically by the adding directory name in the ext/Setup file so that
+statically by adding the directory name in the ext/Setup file so that
you can inspect the extension with the debugger.
(9) done, now you have the extension library
@@ -691,53 +811,120 @@ Appendix A. Ruby source files overview
ruby language core
- class.c
- error.c
- eval.c
- gc.c
- object.c
+ class.c : classes and modules
+ error.c : exception classes and exception mechanism
+ gc.c : memory management
+ load.c : library loading
+ object.c : objects
+ variable.c : variables and constants
+
+ruby syntax parser
parse.y
- variable.c
+ -> parse.c : automatically generated
+ keywords : reserved keywords
+ -> lex.c : automatically generated
+
+ruby evaluator (a.k.a. YARV)
+ compile.c
+ eval.c
+ eval_error.c
+ eval_jump.c
+ eval_safe.c
+ insns.def : definition of VM instructions
+ iseq.c : implementation of VM::ISeq
+ thread.c : thread management and context swiching
+ thread_win32.c : thread implementation
+ thread_pthread.c : ditto
+ vm.c
+ vm_dump.c
+ vm_eval.c
+ vm_exec.c
+ vm_insnhelper.c
+ vm_method.c
+
+ opt_insns_unif.def : instruction unification
+ opt_operand.def : definitions for optimization
+
+ -> insn*.inc : automatically generated
+ -> opt*.inc : automatically generated
+ -> vm.inc : automatically generated
+
+regular expression engine (oniguruma)
+ regex.c
+ regcomp.c
+ regenc.c
+ regerror.c
+ regexec.c
+ regparse.c
+ regsyntax.c
utility functions
- dln.c
- regex.c
- st.c
- util.c
+ debug.c : debug symbols for C debuggger
+ dln.c : dynamic loading
+ st.c : general purpose hash table
+ strftime.c : formatting times
+ util.c : misc utilities
ruby interpreter implementation
dmyext.c
+ dmydln.c
+ dmyencoding.c
+ id.c
inits.c
main.c
ruby.c
version.c
+ gem_prelude.rb
+ prelude.rb
+
+
class library
- array.c
- bignum.c
- compar.c
- dir.c
- enum.c
- file.c
- hash.c
- io.c
- marshal.c
- math.c
- numeric.c
- pack.c
- prec.c
- process.c
- random.c
- range.c
- re.c
- signal.c
- sprintf.c
- string.c
- struct.c
- time.c
+ array.c : Array
+ bignum.c : Bignum
+ compar.c : Comparable
+ complex.c : Complex
+ cont.c : Fiber, Continuation
+ dir.c : Dir
+ enum.c : Enumerable
+ enumerator.c : Enumerator
+ file.c : File
+ hash.c : Hash
+ io.c : IO
+ marshal.c : Marshal
+ math.c : Math
+ numeric.c : Numeric, Integer, Fixnum, Float
+ pack.c : Array#pack, String#unpack
+ proc.c : Binding, Proc
+ process.c : Process
+ random.c : random number
+ range.c : Range
+ rational.c : Rational
+ re.c : Regexp, MatchData
+ signal.c : Signal
+ sprintf.c :
+ string.c : String
+ struct.c : Struct
+ time.c : Time
+
+ defs/known_errors.def : Errno::* exception classes
+ -> known_errors.inc : automatically generated
+
+multilingualization
+ encoding.c : Encoding
+ transcode.c : Encoding::Converter
+ enc/*.c : encoding classes
+ enc/trans/* : codepoint mapping tables
+
+goruby interpreter implementation
+
+ goruby.c
+ golf_prelude.rb : goruby specific libraries.
+ -> golf_prelude.c : automatically generated
+
Appendix B. Ruby extension API reference
@@ -793,10 +980,17 @@ void Check_SafeStr(VALUE value)
** Data type conversion
-FIX2INT(value)
-INT2FIX(i)
-NUM2INT(value)
-INT2NUM(i)
+FIX2INT(value), INT2FIX(i)
+FIX2LONG(value), LONG2FIX(l)
+NUM2INT(value), INT2NUM(i)
+NUM2UINT(value), UINT2NUM(ui)
+NUM2LONG(value), LONG2NUM(l)
+NUM2ULONG(value), ULONG2NUM(ul)
+NUM2LL(value), LL2NUM(ll)
+NUM2ULL(value), ULL2NUM(ull)
+NUM2OFFT(value), OFFT2NUM(off)
+NUM2SIZET(value), SIZET2NUM(size)
+NUM2SSIZET(value), SSIZET2NUM(ssize)
NUM2DBL(value)
rb_float_new(f)
StringValue(value)
@@ -843,15 +1037,15 @@ it can't be seen from Ruby programs.
void rb_define_readonly_variable(const char *name, VALUE *var)
Defines a read-only global variable. Works just like
-rb_define_variable(), except defined variable is read-only.
+rb_define_variable(), except the defined variable is read-only.
void rb_define_virtual_variable(const char *name,
VALUE (*getter)(), VALUE (*setter)())
Defines a virtual variable, whose behavior is defined by a pair of C
functions. The getter function is called when the variable is
-referred. The setter function is called when the value is set to the
-variable. The prototype for getter/setter functions are:
+referenced. The setter function is called when the variable is set to a
+value. The prototype for getter/setter functions are:
VALUE getter(ID id)
void setter(VALUE val, ID id)
@@ -909,11 +1103,55 @@ Defines a singleton method. Arguments are same as rb_define_method().
rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
-Retrieve argument from argc, argv. The fmt is the format string for
-the arguments, such as "12" for 1 non-optional argument, 2 optional
-arguments. If `*' appears at the end of fmt, it means the rest of
-the arguments are assigned to the corresponding variable, packed in
-an array.
+Retrieve argument from argc and argv to given VALUE references
+according to the format string. The format can be described in ABNF
+as follows:
+
+--
+scan-arg-spec := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
+
+param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec / pre-opt-post-arg-spec
+pre-arg-spec := num-of-leading-mandatory-args [num-of-optional-args]
+post-arg-spec := sym-for-variable-length-args [num-of-trailing-mandatory-args]
+pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args num-of-trailing-mandatory-args
+option-hash-arg-spec := sym-for-option-hash-arg
+block-arg-spec := sym-for-block-arg
+
+num-of-leading-mandatory-args := DIGIT ; The number of leading
+ ; mandatory arguments
+num-of-optional-args := DIGIT ; The number of optional
+ ; arguments
+sym-for-variable-length-args := "*" ; Indicates that variable
+ ; length arguments are
+ ; captured as a ruby array
+num-of-trailing-mandatory-args := DIGIT ; The number of trailing
+ ; mandatory arguments
+sym-for-option-hash-arg := ":" ; Indicates that an option
+ ; hash is captured if the last
+ ; argument is a hash or can be
+ ; converted to a hash with
+ ; #to_hash. When the last
+ ; argument is nil, it is
+ ; captured if it is not
+ ; ambiguous to take it as
+ ; empty option hash; i.e. '*'
+ ; is not specified and
+ ; arguments are given more
+ ; than sufficient.
+sym-for-block-arg := "&" ; Indicates that an iterator
+ ; block should be captured if
+ ; given
+--
+
+For example, "12" means that the method requires at least one
+argument, and at most receives three (1+2) arguments. So, the format
+string must be followed by three variable references, which are to be
+assigned to captured arguments. For omitted arguments, variables are
+set to Qnil. NULL can be put in place of a variable reference, which
+means the corresponding captured argument(s) should be just dropped.
+
+The number of given arguments, excluding an option hash or iterator
+block, is returned.
** Invoking Ruby method
@@ -958,28 +1196,56 @@ Sets the value of the instance variable.
** Control Structure
- VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+ VALUE rb_block_call(VALUE recv, ID mid, int argc, VALUE * argv,
+ VALUE (*func) (ANYARGS), VALUE data2)
+
+Calls a method on the recv, with the method name specified by the
+symbol mid, with argc arguments in argv, supplying func as the
+block. When func is called as the block, it will receive the value
+from yield as the first argument, and data2 as the second argument.
+When yielded with multiple values (in C, rb_yield_values(),
+rb_yield_values2() and rb_yield_splat()), data2 is packed as an Array,
+whereas yielded values can be gotten via argc/argv of the third/fourth
+arguments.
+
+ [OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
Calls the function func1, supplying func2 as the block. func1 will be
called with the argument arg1. func2 receives the value from yield as
the first argument, arg2 as the second argument.
+When rb_iterate is used in 1.9, func1 has to call some Ruby-level method.
+This function is obsolete since 1.9; use rb_block_call instead.
+
VALUE rb_yield(VALUE val)
Evaluates the block with value val.
- VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+ VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
Calls the function func1, with arg1 as the argument. If an exception
occurs during func1, it calls func2 with arg2 as the argument. The
return value of rb_rescue() is the return value from func1 if no
exception occurs, from func2 otherwise.
- VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
+ VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
Calls the function func1 with arg1 as the argument, then calls func2
with arg2 if execution terminated. The return value from
-rb_ensure() is that of func1.
+rb_ensure() is that of func1 when no exception occured.
+
+ VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state)
+
+Calls the function func with arg as the argument. If no exception
+occured during func, it returns the result of func and *state is zero.
+Otherwise, it returns Qnil and sets *state to nonzero. If state is
+NULL, it is not set in both cases.
+
+ void rb_jump_tag(int state)
+
+Continues the exception caught by rb_protect() and rb_eval_string_protect().
+state must be the returned value from those functions. This function
+never return to the caller.
** Exceptions and Errors
@@ -1011,7 +1277,7 @@ Terminates the interpreter immediately. This function should be
called under the situation caused by the bug in the interpreter. No
exception handling nor ensure execution will be done.
-** Initialize and Starts the Interpreter
+** Initialize and Start the Interpreter
The embedding API functions are below (not needed for extension libraries):
@@ -1031,6 +1297,76 @@ Starts execution of the interpreter.
Specifies the name of the script ($0).
+** Hooks for the Interpreter Events
+
+ void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events, VALUE data)
+
+Adds a hook function for the specified interpreter events.
+events should be Or'ed value of:
+
+ RUBY_EVENT_LINE
+ RUBY_EVENT_CLASS
+ RUBY_EVENT_END
+ RUBY_EVENT_CALL
+ RUBY_EVENT_RETURN
+ RUBY_EVENT_C_CALL
+ RUBY_EVENT_C_RETURN
+ RUBY_EVENT_RAISE
+ RUBY_EVENT_ALL
+
+The definition of rb_event_hook_func_t is below:
+
+ typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
+ VALUE self, ID id, VALUE klass)
+
+The third argument `data' to rb_add_event_hook() is passed to the hook
+function as the second argument, which was the pointer to the current
+NODE in 1.8. See RB_EVENT_HOOKS_HAVE_CALLBACK_DATA below.
+
+ int rb_remove_event_hook(rb_event_hook_func_t func)
+
+Removes the specified hook function.
+
+** Macros for the Compatibilities
+
+Some macros to check API compatibilities are available by default.
+
+ NORETURN_STYLE_NEW
+
+Means that NORETURN macro is functional style instead of prefix.
+
+ HAVE_RB_DEFINE_ALLOC_FUNC
+
+Means that function rb_define_alloc_func() is provided, that means the
+allocation framework is used. This is same as the result of
+have_func("rb_define_alloc_func", "ruby.h").
+
+ HAVE_RB_REG_NEW_STR
+
+Means that function rb_reg_new_str() is provided, that creates Regexp
+object from String object. This is same as the result of
+have_func("rb_reg_new_str", "ruby.h").
+
+ HAVE_RB_IO_T
+
+Means that type rb_io_t is provided.
+
+ USE_SYMBOL_AS_METHOD_NAME
+
+Means that Symbols will be returned as method names, e.g.,
+Module#methods, #singleton_methods and so on.
+
+ HAVE_RUBY_*_H
+
+Defined in ruby.h and means correspoinding header is available. For
+instance, when HAVE_RUBY_ST_H is defined you should use ruby/st.h not
+mere st.h.
+
+ RB_EVENT_HOOKS_HAVE_CALLBACK_DATA
+
+Means that rb_add_event_hook() takes the third argument `data', to be
+passed to the given event hook function.
+
Appendix C. Functions Available in extconf.rb
These functions are available in extconf.rb:
@@ -1094,7 +1430,7 @@ this method, the compilation will not be done.
find_executable(bin, path)
Finds command in path, which is File::PATH_SEPARATOR-separated list of
-directories. If path is nil or omitted, environment varialbe PATH
+directories. If path is nil or omitted, environment variable PATH
will be used. Returns the path name of the command if it is found,
otherwise nil.
@@ -1122,8 +1458,8 @@ Returns an array of the added directories ([include_dir, lib_dir]).
pkg_config(pkg)
-Obtains the information of pkg by pkg-config command. The actual
-command name can be overriden by --with-pkg-config command line
+Obtains the information for pkg by pkg-config command. The actual
+command name can be overridden by --with-pkg-config command line
option.
/*
diff --git a/README.EXT.ja b/README.EXT.ja
index 30c4d520ba..f2d7609ff5 100644
--- a/README.EXT.ja
+++ b/README.EXT.ja
@@ -35,10 +35,12 @@ Ruby¤Ë¤Ï¥æ¡¼¥¶¤¬»È¤¦²ÄǽÀ­¤Î¤¢¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
T_STRING ʸ»úÎó
T_REGEXP Àµµ¬É½¸½
T_ARRAY ÇÛÎó
- T_FIXNUM Fixnum(31bitĹÀ°¿ô)
T_HASH Ï¢ÁÛÇÛÎó
T_STRUCT (Ruby¤Î)¹½Â¤ÂÎ
T_BIGNUM ¿ÇÜĹÀ°¿ô
+ T_FIXNUM Fixnum(31bit¤Þ¤¿¤Ï63bitĹÀ°¿ô)
+ T_COMPLEX Ê£ÁÇ¿ô
+ T_RATIONAL Í­Íý¿ô
T_FILE Æþ½ÐÎÏ
T_TRUE ¿¿
T_FALSE µ¶
@@ -50,9 +52,8 @@ Ruby¤Ë¤Ï¥æ¡¼¥¶¤¬»È¤¦²ÄǽÀ­¤Î¤¢¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
T_ICLASS
T_MATCH
T_UNDEF
- T_VARMAP
- T_SCOPE
T_NODE
+ T_ZOMBIE
¤Û¤È¤ó¤É¤Î¥¿¥¤¥×¤ÏC¤Î¹½Â¤ÂΤǼÂÁõ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
@@ -95,28 +96,40 @@ FIXNUM¤ÈNIL¤Ë´Ø¤·¤Æ¤Ï¤è¤ê¹â®¤ÊȽÊÌ¥Þ¥¯¥í¤¬ÍѰդµ¤ì¤Æ¤¤¤Þ¤¹¡¥
1.3 VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
-¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_NIL, T_FALSE, T_TRUE¤Ç¤¢¤ë»þ¡¤¥Ç¡¼¥¿¤Ï¤½¤ì¤¾
-¤ìnil, false, true¤Ç¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Ï¤Ò¤È
+¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_NIL¡¤T_FALSE¡¤T_TRUE¤Ç¤¢¤ë»þ¡¤¥Ç¡¼¥¿¤Ï¤½¤ì¤¾
+¤ìnil¡¤false¡¤true¤Ç¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Ï¤Ò¤È
¤Ä¤º¤Ä¤·¤«Â¸ºß¤·¤Þ¤»¤ó¡¥
-¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_FIXNUM¤Î»þ¡¤¤³¤ì¤Ï31bit¤Î¥µ¥¤¥º¤ò»ý¤ÄÀ°¿ô¤Ç
-¤¹¡¥FIXNUM¤òC¤ÎÀ°¿ô¤ËÊÑ´¹¤¹¤ë¤¿¤á¤Ë¤Ï¥Þ¥¯¥í¡ÖFIX2INT()¡×¤ò»È
-¤¤¤Þ¤¹¡¥¤½¤ì¤«¤é¡¤FIXNUM¤Ë¸Â¤é¤ºRuby¤Î¥Ç¡¼¥¿¤òÀ°¿ô¤ËÊÑ´¹¤¹¤ë
-¡ÖNUM2INT()¡×¤È¤¤¤¦¥Þ¥¯¥í¤¬¤¢¤ê¤Þ¤¹¡¥¤³¤Î¥Þ¥¯¥í¤Ï¥Ç¡¼¥¿¥¿¥¤
-¥×¤Î¥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤Þ¤¹(À°¿ô¤ËÊÑ´¹¤Ç¤­¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤¬
-ȯÀ¸¤¹¤ë)¡¥Æ±Íͤ˥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤ëÊÑ´¹¥Þ¥¯¥í¤Ïdouble¤ò
-¼è¤ê½Ð¤¹¡ÖNUM2DBL()¡×¤¬¤¢¤ê¤Þ¤¹¡£
-
-char* ¤ò¼è¤ê½Ð¤¹¾ì¹ç¡¢version 1.6 °ÊÁ°¤Ç¤Ï¡ÖSTR2CSTR()¡×¤È
-¤¤¤¦¥Þ¥¯¥í¤ò»È¤Ã¤Æ¤¤¤Þ¤·¤¿¤¬¡¢¤³¤ì¤Ï to_str() ¤Ë¤è¤ë°ÅÌÛ¤Î
-·¿ÊÑ´¹·ë²Ì¤¬ GC ¤µ¤ì¤ë²ÄǽÀ­¤¬¤¢¤ë¤¿¤á¡¢version 1.7 °Ê¹ß¤Ç¤Ï
-obsolete ¤È¤Ê¤ê¡¢Âå¤ï¤ê¤Ë StringValue() ¤È StringValuePtr()
-¤ò»È¤¦»ö¤ò¿ä¾©¤·¤Æ¤¤¤Þ¤¹¡£StringValue(var) ¤Ï var ¤¬ String
- ¤Ç¤¢¤ì¤Ð²¿¤â¤»¤º¡¢¤½¤¦¤Ç¤Ê¤±¤ì¤Ð var ¤ò var.to_str() ¤Î·ë²Ì¤Ë
-ÃÖ¤­´¹¤¨¤ë¥Þ¥¯¥í¡¢StringValuePtr(var) ¤ÏƱÍÍ¤Ë var ¤òÃÖ¤­´¹¤¨
-¤Æ¤«¤é var ¤Îʸ»úÎóɽ¸½¤ËÂФ¹¤ë char* ¤òÊÖ¤¹¥Þ¥¯¥í¤Ç¤¹¡£var ¤Î
-ÆâÍÆ¤òľÀÜÃÖ¤­´¹¤¨¤ë½èÍý¤¬Æþ¤ë¤Î¤Ç¡¢var ¤Ï lvalue ¤Ç¤¢¤ëɬÍפ¬
-¤¢¤ê¤Þ¤¹¡£
+¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_FIXNUM¤Î»þ¡¤¤³¤ì¤Ï31bit¤Þ¤¿¤Ï63bit¤Î¥µ¥¤¥º¤ò
+»ý¤ÄÀ°¿ô¤Ç¤¹¡¥long¤Î¥µ¥¤¥º¤¬32bit¤Î¥×¥é¥Ã¥È¥Õ¥©¡¼¥à¤Ç¤¢¤ì¤Ð
+31bit¤Ë¡¤long¤Î¥µ¥¤¥º¤¬64bit¤Î¥×¥é¥Ã¥È¥Õ¥©¡¼¥à¤Ç¤¢¤ì¤Ð63bit
+¤Ë¤Ê¤ê¤Þ¤¹. FIXNUM ¤ò C ¤ÎÀ°¿ô¤ËÊÑ´¹¤¹¤ë¤¿¤á¤Ë¤Ï¥Þ¥¯¥í
+¡ÖFIX2INT()¡×¤Þ¤¿¤Ï¡ÖFIX2LONG()¡×¤ò»È¤¤¤Þ¤¹¡¥¤³¤ì¤é¤Î¥Þ¥¯¥í
+¤ò»ÈÍѤ¹¤ëºÝ¤Ë¤Ï»öÁ°¤Ë¥Ç¡¼¥¿¥¿¥¤¥×¤¬FIXNUM¤Ç¤¢¤ë¤³¤È¤ò³Îǧ¤¹
+¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¤¬¡¤Èæ³ÓŪ¹â®¤ËÊÑ´¹¤ò¹Ô¤¦¤³¤È¤¬¤Ç¤­¤Þ¤¹¡¥¤Þ
+¤¿¡¤¡ÖFIX2LONG()¡×¤ÏÎã³°¤òȯÀ¸¤·¤Þ¤»¤ó¤¬¡¤¡ÖFIX2INT()¡×¤ÏÊÑ
+´¹·ë²Ì¤¬int¤Î¥µ¥¤¥º¤Ë¼ý¤Þ¤é¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤òȯÀ¸¤·¤Þ¤¹¡¥
+¤½¤ì¤«¤é¡¤FIXNUM¤Ë¸Â¤é¤ºRuby¤Î¥Ç¡¼¥¿¤òÀ°¿ô¤ËÊÑ´¹¤¹¤ë
+¡ÖNUM2INT()¡×¤ª¤è¤Ó¡ÖNUM2LONG()¡×¤È¤¤¤¦¥Þ¥¯¥í¤¬¤¢¤ê¤Þ¤¹¡¥¤³
+¤ì¤é¤Î¥Þ¥¯¥í¤Ï¥Þ¥¯¥í¤Ï¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤Þ¤¹
+(À°¿ô¤ËÊÑ´¹¤Ç¤­¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤¬È¯À¸¤¹¤ë)¡¥Æ±Íͤ˥Á¥§¥Ã¥¯Ìµ
+¤Ç»È¤¨¤ëÊÑ´¹¥Þ¥¯¥í¤Ïdouble¤ò¼è¤ê½Ð¤¹¡ÖNUM2DBL()¡×¤¬¤¢¤ê¤Þ¤¹¡¥
+
+char* ¤ò¼è¤ê½Ð¤¹¾ì¹ç¡¤ StringValue() ¤È StringValuePtr()
+¤ò»È¤¤¤Þ¤¹¡¥
+StringValue(var) ¤Ï var ¤¬ String
+¤Ç¤¢¤ì¤Ð²¿¤â¤»¤º¡¤¤½¤¦¤Ç¤Ê¤±¤ì¤Ð var ¤ò var.to_str() ¤Î·ë²Ì
+¤ËÃÖ¤­´¹¤¨¤ë¥Þ¥¯¥í¡¤StringValuePtr(var) ¤ÏƱÍÍ¤Ë var ¤ò
+String ¤ËÃÖ¤­´¹¤¨¤Æ¤«¤é var ¤Î¥Ð¥¤¥ÈÎóɽ¸½¤ËÂФ¹¤ë char* ¤ò
+ÊÖ¤¹¥Þ¥¯¥í¤Ç¤¹¡¥var ¤ÎÆâÍÆ¤òľÀÜÃÖ¤­´¹¤¨¤ë½èÍý¤¬Æþ¤ë¤Î¤Ç¡¤
+var ¤Ï lvalue ¤Ç¤¢¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
+¤Þ¤¿¡¤StringValuePtr() ¤ËÎà»÷¤·¤¿ StringValueCStr() ¤È¤¤¤¦¥Þ
+¥¯¥í¤â¤¢¤ê¤Þ¤¹¡¥StringValueCStr(var) ¤Ï var ¤ò String ¤ËÃÖ¤­
+´¹¤¨¤Æ¤«¤é var ¤Îʸ»úÎóɽ¸½¤ËÂФ¹¤ë char* ¤òÊÖ¤·¤Þ¤¹¡¥ÊÖ¤µ¤ì
+¤ëʸ»úÎó¤ÎËöÈø¤Ë¤Ï nul ʸ»ú¤¬Éղ䵤ì¤Þ¤¹¡¥¤Ê¤ª¡¤ÅÓÃæ¤Ë nul
+ʸ»ú¤¬´Þ¤Þ¤ì¤ë¾ì¹ç¤Ï ArgumentError ¤¬È¯À¸¤·¤Þ¤¹¡¥
+°ìÊý¡¤StringValuePtr() ¤Ç¤Ï¡¤ËöÈø¤Ë nul ʸ»ú¤¬¤¢¤ëÊݾڤϤʤ¯¡¤
+ÅÓÃæ¤Ë nul ʸ»ú¤¬´Þ¤Þ¤ì¤Æ¤¤¤ë²ÄǽÀ­¤â¤¢¤ê¤Þ¤¹¡¥
¤½¤ì°Ê³°¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ÏÂбþ¤¹¤ëC¤Î¹½Â¤ÂΤ¬¤¢¤ê¤Þ¤¹¡¥Âбþ¤¹
¤ë¹½Â¤ÂΤΤ¢¤ëVALUE¤Ï¤½¤Î¤Þ¤Þ¥­¥ã¥¹¥È(·¿ÊÑ´¹)¤¹¤ì¤Ð¹½Â¤ÂΤÎ
@@ -129,10 +142,11 @@ obsolete ¤È¤Ê¤ê¡¢Âå¤ï¤ê¤Ë StringValue() ¤È StringValuePtr()
ruby.h¤Ç¤Ï¹½Â¤ÂΤإ­¥ã¥¹¥È¤¹¤ë¥Þ¥¯¥í¤â¡ÖRXXXXX()¡×(Á´ÉôÂçʸ
»ú¤Ë¤·¤¿¤â¤Î)¤È¤¤¤¦Ì¾Á°¤ÇÄ󶡤µ¤ì¤Æ¤¤¤Þ¤¹(Îã: RSTRING())¡¥
-Î㤨¤Ð¡¤Ê¸»úÎóstr¤ÎŤµ¤òÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->len¡×¤È
-¤·¡¤Ê¸»úÎóstr¤òchar*¤È¤·¤ÆÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->ptr¡×
-¤È¤·¤Þ¤¹¡¥ÇÛÎó¤Î¾ì¹ç¤Ë¤Ï¡¤¤½¤ì¤¾¤ì¡ÖRARRAY(ary)->len¡×¡¤
-¡ÖRARRAY(ary)->ptr¡×¤È¤Ê¤ê¤Þ¤¹¡¥
+¹½Â¤ÂΤ«¤é¥Ç¡¼¥¿¤ò¼è¤ê½Ð¤¹¥Þ¥¯¥í¤¬Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥Ê¸»úÎó
+str¤ÎŤµ¤òÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING_LEN(str)¡×¤È¤·¡¤Ê¸»úÎóstr¤ò
+char*¤È¤·¤ÆÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING_PTR(str)¡×¤È¤·¤Þ¤¹¡¥ÇÛÎó¤Î
+¾ì¹ç¤Ë¤Ï¡¤¤½¤ì¤¾¤ì¡ÖRARRAY_LEN(ary)¡×¡¤¡ÖRARRAY_PTR(ary)¡×¤È
+¤Ê¤ê¤Þ¤¹¡¥
Ruby¤Î¹½Â¤ÂΤòľÀÜ¥¢¥¯¥»¥¹¤¹¤ë»þ¤Ëµ¤¤ò¤Ä¤±¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¤³
¤È¤Ï¡¤ÇÛÎó¤äʸ»úÎó¤Î¹½Â¤ÂΤÎÃæ¿È¤Ï»²¾È¤¹¤ë¤À¤±¤Ç¡¤Ä¾ÀÜÊѹ¹¤·
@@ -165,7 +179,8 @@ FIXNUM¤Ë´Ø¤·¤Æ¤ÏÊÑ´¹¥Þ¥¯¥í¤ò·Ðͳ¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥C¤ÎÀ°¿ô
¤«¤éVALUE¤ËÊÑ´¹¤¹¤ë¥Þ¥¯¥í¤Ï°Ê²¼¤Î¤â¤Î¤¬¤¢¤ê¤Þ¤¹¡¥É¬Íפ˱þ¤¸
¤Æ»È¤¤Ê¬¤±¤Æ¤¯¤À¤µ¤¤¡¥
- INT2FIX() ¤â¤È¤ÎÀ°¿ô¤¬31bit°ÊÆâ¤Ë¼ý¤Þ¤ë¼«¿®¤¬¤¢¤ë»þ
+ INT2FIX() ¤â¤È¤ÎÀ°¿ô¤¬31bit¤Þ¤¿¤Ï63bit°ÊÆâ¤Ë¼ý¤Þ¤ë¼«¿®
+ ¤¬¤¢¤ë»þ
INT2NUM() Ǥ°Õ¤ÎÀ°¿ô¤«¤éVALUE¤Ø
INT2NUM()¤ÏÀ°¿ô¤¬FIXNUM¤ÎÈϰϤ˼ý¤Þ¤é¤Ê¤¤¾ì¹ç¡¤Bignum¤ËÊÑ´¹
@@ -187,6 +202,7 @@ Ruby¤¬ÍѰդ·¤Æ¤¤¤ë´Ø¿ô¤òÍѤ¤¤Æ¤¯¤À¤µ¤¤¡¥
¿·¤·¤¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
rb_str_new2(const char *ptr)
+ rb_str_new_cstr(const char *ptr)
C¤Îʸ»úÎ󤫤éRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï
rb_str_new(ptr, strlen(ptr))¤ÈƱÅù¤Ç¤¢¤ë¡¥
@@ -198,13 +214,59 @@ Ruby¤¬ÍѰդ·¤Æ¤¤¤ë´Ø¿ô¤òÍѤ¤¤Æ¤¯¤À¤µ¤¤¡¥
¤Ç¤¢¤ë¡¥
rb_tainted_str_new2(const char *ptr)
+ rb_tainted_str_new_cstr(const char *ptr)
C¤Îʸ»úÎ󤫤鱸À÷¥Þ¡¼¥¯¤¬Éղ䵤줿Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
+ rb_sprintf(const char *format, ...)
+ rb_vsprintf(const char *format, va_list ap)
+
+ C¤Îʸ»úÎóformat¤È³¤¯°ú¿ô¤òprintf(3)¤Î¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë¤·¤¿¤¬¤Ã¤Æ
+ À°·Á¤·¡¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
+
rb_str_cat(VALUE str, const char *ptr, long len)
Ruby¤Îʸ»úÎóstr¤Ëlen¥Ð¥¤¥È¤Îʸ»úÎóptr¤òÄɲ乤롥
+ rb_str_cat2(VALUE str, const char* ptr)
+
+ Ruby¤Îʸ»úÎóstr¤ËC¤Îʸ»úÎóptr¤òÄɲ乤롥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï
+ rb_str_cat(str, ptr, strlen(ptr))¤ÈƱÅù¤Ç¤¢¤ë¡¥
+
+ rb_str_catf(VALUE str, const char* format, ...)
+ rb_str_vcatf(VALUE str, const char* format, va_list ap)
+
+ C¤Îʸ»úÎóformat¤È³¤¯°ú¿ô¤òprintf(3)¤Î¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë¤·¤¿¤¬¤Ã¤Æ
+ À°·Á¤·¡¤Ruby¤Îʸ»úÎóstr¤ËÄɲ乤롥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï¡¤¤½¤ì¤¾¤ì
+ rb_str_cat2(str, rb_sprintf(format, ...)) ¤ä
+ rb_str_cat2(str, rb_vsprintf(format, ap)) ¤ÈƱÅù¤Ç¤¢¤ë¡¥
+
+ rb_enc_str_new(const char *ptr, long len, rb_encoding *enc)
+
+ »ØÄꤵ¤ì¤¿¥¨¥ó¥³¡¼¥Ç¥£¥ó¥°¤ÇRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë.
+
+ rb_usascii_str_new(const char *ptr, long len)
+ rb_usascii_str_new_cstr(const char *ptr)
+
+ ¥¨¥ó¥³¡¼¥Ç¥£¥ó¥°¤¬US-ASCII¤ÎRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë.
+
+ rb_str_resize(VALUE str, long len)
+
+ Ruby¤Îʸ»úÎó¤Î¥µ¥¤¥º¤òlen¥Ð¥¤¥È¤ËÊѹ¹¤¹¤ë¡¥str¤ÎŤµ¤ÏÁ°
+ °Ê¤Æ¥»¥Ã¥È¤µ¤ì¤Æ¤¤¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¡¥len¤¬¸µ¤ÎŤµ¤è¤ê¤âû
+ ¤¤»þ¤Ï¡¤len¥Ð¥¤¥È¤ò±Û¤¨¤¿Éôʬ¤ÎÆâÍÆ¤Ï¼Î¤Æ¤é¤ì¤ë¡¥len¤¬¸µ
+ ¤ÎŤµ¤è¤ê¤âŤ¤»þ¤Ï¡¤¸µ¤ÎŤµ¤ò±Û¤¨¤¿Éôʬ¤ÎÆâÍÆ¤ÏÊݸ¤µ
+ ¤ì¤Ê¤¤¤Ç¥´¥ß¤Ë¤Ê¤ë¤À¤í¤¦¡¥¤³¤Î´Ø¿ô¤Î¸Æ¤Ó½Ð¤·¤Ë¤è¤Ã¤Æ
+ RSTRING_PTR(str)¤¬Êѹ¹¤µ¤ì¤ë¤«¤â¤·¤ì¤Ê¤¤¤³¤È¤ËÃí°Õ¡¥
+
+ rb_str_set_len(VALUE str, long len)
+
+ Ruby¤Îʸ»úÎó¤Î¥µ¥¤¥º¤òlen¥Ð¥¤¥È¤Ë¥»¥Ã¥È¤¹¤ë¡¥str¤¬Êѹ¹²Ä
+ ǽ¤Ç¤Ê¤±¤ì¤ÐÎã³°¤¬È¯À¸¤¹¤ë¡¥RSTRING_LEN(str)¤È¤Ï̵´Ø·¸¤Ë¡¤
+ len¥Ð¥¤¥È¤Þ¤Ç¤ÎÆâÍÆ¤ÏÊݸ¤µ¤ì¤ë¡¥len¤Ïstr¤ÎÍÆÎ̤ò±Û¤¨¤Æ¤¤
+ ¤Æ¤Ï¤Ê¤é¤Ê¤¤¡¥
+
+
ÇÛÎó¤ËÂФ¹¤ë´Ø¿ô
rb_ary_new()
@@ -224,14 +286,32 @@ Ruby¤¬ÍѰդ·¤Æ¤¤¤ë´Ø¿ô¤òÍѤ¤¤Æ¤¯¤À¤µ¤¤¡¥
ÇÛÎó¤ÇÍ¿¤¨¤¿nÍ×ÁǤÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
+ rb_ary_to_ary(VALUE obj)
+
+ ¥ª¥Ö¥¸¥§¥¯¥È¤òÇÛÎó¤ËÊÑ´¹¤¹¤ë.
+ Object#to_ary¤ÈƱÅù¤Ç¤¢¤ë.
+
+ ¾¤Ë¤âÇÛÎó¤òÁàºî¤¹¤ë´Ø¿ô¤¬Â¿¿ô¤¢¤ë. ¤³¤ì¤é¤Ï
+ °ú¿ôary¤ËÇÛÎó¤òÅϤµ¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤. ¤µ¤â¤Ê¤¤¤È
+ ¥³¥¢¤òÅǤ¯.
+
+ rb_ary_aref(argc, VALUE *argv, VALUE ary)
+
+ Array#[]¤ÈƱÅù.
+
+ rb_ary_entry(VALUE ary, long offset)
+
+ ary[offset]
+
+ rb_ary_subseq(VALUE ary, long beg, long len)
+
+ ary[beg, len]
+
rb_ary_push(VALUE ary, VALUE val)
rb_ary_pop(VALUE ary)
rb_ary_shift(VALUE ary)
rb_ary_unshift(VALUE ary, VALUE val)
- Array¤ÎƱ̾¤Î¥á¥½¥Ã¥É¤ÈƱ¤¸Æ¯¤­¤ò¤¹¤ë´Ø¿ô¡¥Âè1°ú¿ô¤Ïɬ¤º
- ÇÛÎó¤Ç¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¡¥
-
2¡¥Ruby¤Îµ¡Ç½¤ò»È¤¦
¸¶ÍýŪ¤ËRuby¤Ç½ñ¤±¤ë¤³¤È¤ÏC¤Ç¤â½ñ¤±¤Þ¤¹¡¥Ruby¤½¤Î¤â¤Î¤¬C¤Çµ­
@@ -294,19 +374,26 @@ argc¤¬Éé¤Î»þ¤Ï°ú¿ô¤Î¿ô¤Ç¤Ï¤Ê¤¯¡¤·Á¼°¤ò»ØÄꤷ¤¿¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
argc¤¬-1¤Î»þ¤Ï°ú¿ô¤òÇÛÎó¤ËÆþ¤ì¤ÆÅϤµ¤ì¤Þ¤¹¡¥argc¤¬-2¤Î»þ¤Ï°ú
¿ô¤ÏRuby¤ÎÇÛÎó¤È¤·¤ÆÅϤµ¤ì¤Þ¤¹¡¥
-¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï¤â¤¦Æó¤Ä¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ïprivate¥á
-¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ç¡¤°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¤Ç¤¹¡¥
+¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï¤Þ¤À¤¤¤¯¤Ä¤«¤¢¤ê¤Þ¤¹. ¤Ò¤È¤Ä¤Ï¥á¥½¥Ã¥É
+̾¤È¤·¤ÆID¤ò¼è¤ê¤Þ¤¹. ID¤Ë¤Ä¤¤¤Æ¤Ï2.2.2¤ò»²¾È.
+
+ void rb_define_method_id(VALUE klass, ID name,
+ VALUE (*func)(ANYARGS), int argc)
+
+private/protected¤Ê¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¤Õ¤¿¤Ä¤Î´Ø¿ô¤¬¤¢¤ê¤Þ¤¹.
void rb_define_private_method(VALUE klass, const char *name,
VALUE (*func)(), int argc)
+ void rb_define_protected_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
private¥á¥½¥Ã¥É¤È¤Ï´Ø¿ô·Á¼°¤Ç¤·¤«¸Æ¤Ó½Ð¤¹¤³¤È¤Î½ÐÍè¤Ê¤¤¥á¥½¥Ã
¥É¤Ç¤¹¡¥
-¤â¤¦¤Ò¤È¤Ä¤Ï¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô
-¤È¤Ï¥â¥¸¥å¡¼¥ë¤ÎÆÃ°Û¥á¥½¥Ã¥É¤Ç¤¢¤ê¡¤Æ±»þ¤Ëprivate¥á¥½¥Ã¥É¤Ç
-¤â¤¢¤ë¤â¤Î¤Ç¤¹¡¥Îã¤ò¤¢¤²¤ë¤ÈMath¥â¥¸¥å¡¼¥ë¤Îsqrt()¤Ê¤É¤¬¤¢¤²
-¤é¤ì¤Þ¤¹¡¥¤³¤Î¥á¥½¥Ã¥É¤Ï
+ºÇ¸å¤Ë¡¤ rb_define_module´Ø¿ô¤Ï¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤·¤Þ¤¹¡¥
+¥â¥¸¥å¡¼¥ë´Ø¿ô¤È¤Ï¥â¥¸¥å¡¼¥ë¤ÎÆÃ°Û¥á¥½¥Ã¥É¤Ç¤¢¤ê¡¤Æ±»þ¤Ë
+private¥á¥½¥Ã¥É¤Ç¤â¤¢¤ë¤â¤Î¤Ç¤¹¡¥Îã¤ò¤¢¤²¤ë¤ÈMath¥â¥¸¥å¡¼¥ë
+¤Îsqrt()¤Ê¤É¤¬¤¢¤²¤é¤ì¤Þ¤¹¡¥¤³¤Î¥á¥½¥Ã¥É¤Ï
Math.sqrt(4)
@@ -327,20 +414,24 @@ private¥á¥½¥Ã¥É¤È¤Ï´Ø¿ô·Á¼°¤Ç¤·¤«¸Æ¤Ó½Ð¤¹¤³¤È¤Î½ÐÍè¤Ê¤¤¥á¥½¥Ã
void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-¥á¥½¥Ã¥É¤ÎÊÌ̾¤òÄêµÁ¤¹¤ë¤¿¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡£
+¥á¥½¥Ã¥É¤ÎÊÌ̾¤òÄêµÁ¤¹¤ë¤¿¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
void rb_define_alias(VALUE module, const char* new, const char* old);
+°À­¤Î¼èÆÀ¡¦ÀßÄê¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¤Ë¤Ï
+
+ void rb_define_attr(VALUE klass, const char *name, int read, int write)
+
¥¯¥é¥¹¥á¥½¥Ã¥Éallocate¤òÄêµÁ¤·¤¿¤êºï½ü¤·¤¿¤ê¤¹¤ë¤¿¤á¤Î´Ø¿ô¤Ï
-°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡£
+°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
void rb_undef_alloc_func(VALUE klass);
-func¤Ï¥¯¥é¥¹¤ò°ú¿ô¤È¤·¤Æ¼õ¤±¼è¤Ã¤Æ¡¢¿·¤·¤¯³ä¤êÅö¤Æ¤é¤ì¤¿¥¤¥ó
-¥¹¥¿¥ó¥¹¤òÊÖ¤µ¤Ê¤¯¤Æ¤Ï¤Ê¤ê¤Þ¤»¤ó¡£¤³¤Î¥¤¥ó¥¹¥¿¥ó¥¹¤Ï¡¢³°Éô¥ê
-¥½¡¼¥¹¤Ê¤É¤ò´Þ¤Þ¤Ê¤¤¡¢¤Ç¤­¤ë¤À¤±¡Ö¶õ¡×¤Î¤Þ¤Þ¤Ë¤·¤Æ¤ª¤¤¤¿¤Û¤¦
-¤¬¤è¤¤¤Ç¤·¤ç¤¦¡£
+func¤Ï¥¯¥é¥¹¤ò°ú¿ô¤È¤·¤Æ¼õ¤±¼è¤Ã¤Æ¡¤¿·¤·¤¯³ä¤êÅö¤Æ¤é¤ì¤¿¥¤¥ó
+¥¹¥¿¥ó¥¹¤òÊÖ¤µ¤Ê¤¯¤Æ¤Ï¤Ê¤ê¤Þ¤»¤ó¡¥¤³¤Î¥¤¥ó¥¹¥¿¥ó¥¹¤Ï¡¤³°Éô¥ê
+¥½¡¼¥¹¤Ê¤É¤ò´Þ¤Þ¤Ê¤¤¡¤¤Ç¤­¤ë¤À¤±¡Ö¶õ¡×¤Î¤Þ¤Þ¤Ë¤·¤Æ¤ª¤¤¤¿¤Û¤¦
+¤¬¤è¤¤¤Ç¤·¤ç¤¦¡¥
2.1.3 Äê¿ôÄêµÁ
@@ -374,16 +465,26 @@ C¤«¤éRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹¤â¤Ã¤È¤â´Êñ¤ÊÊýË¡¤È¤·¤Æ¡¤Ê¸»úÎó¤Ç
¤³¤Îɾ²Á¤Ï¸½ºß¤Î´Ä¶­¤Ç¹Ô¤ï¤ì¤Þ¤¹¡¥¤Ä¤Þ¤ê¡¤¸½ºß¤Î¥í¡¼¥«¥ëÊÑ¿ô
¤Ê¤É¤ò¼õ¤±·Ñ¤®¤Þ¤¹¡¥
+ɾ²Á¤ÏÎã³°¤òȯÀ¸¤¹¤ë¤«¤â¤·¤ì¤Ê¤¤¤³¤È¤ËÃí°Õ¤·¤Þ¤·¤ç¤¦. ¤è¤ê°ÂÁ´
+¤Ê´Ø¿ô¤â¤¢¤ê¤Þ¤¹.
+
+ VALUE rb_eval_string_protect(const char *str, int *state)
+
+¤³¤Î´Ø¿ô¤Ï¥¨¥é¡¼¤¬È¯À¸¤¹¤ë¤Ènil¤òÊÖ¤·¤Þ¤¹¡¥¤½¤·¤Æ¡¤À®¸ù»þ¤Ë¤Ï
+*state¤Ï¥¼¥í¤Ë¡¤¤µ¤â¤Ê¤¯¤ÐÈó¥¼¥í¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+
2.2.2 ID¤Þ¤¿¤Ï¥·¥ó¥Ü¥ë
C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤³¤È¤â¤Ç¤­¤Þ
¤¹¡¥¤½¤ÎÁ°¤Ë¡¤Ruby¥¤¥ó¥¿¥×¥ê¥¿Æâ¤Ç¥á¥½¥Ã¥É¤äÊÑ¿ô̾¤ò»ØÄꤹ¤ë
»þ¤Ë»È¤ï¤ì¤Æ¤¤¤ëID¤Ë¤Ä¤¤¤ÆÀâÌÀ¤·¤Æ¤ª¤­¤Þ¤·¤ç¤¦¡¥
-ID¤È¤ÏÊÑ¿ô̾¡¤¥á¥½¥Ã¥É̾¤òɽ¤¹À°¿ô¤Ç¤¹¡¥Ruby¤Ç¤ÏID¤ËÂбþ¤¹¤ë
-¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ¥·¥ó¥Ü¥ë(Symbol)¤¬¤¢¤ê¡¤
+ID¤È¤ÏÊÑ¿ô̾¡¤¥á¥½¥Ã¥É̾¤òɽ¤¹À°¿ô¤Ç¤¹¡¥Ruby¤ÎÃæ¤Ç¤Ï
:¼±ÊÌ»Ò
+¤Þ¤¿¤Ï
+ :"Ǥ°Õ¤Îʸ»úÎó"
¤Ç¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤¹¡¥C¤«¤é¤³¤ÎÀ°¿ô¤òÆÀ¤ë¤¿¤á¤Ë¤Ï´Ø¿ô
@@ -394,14 +495,6 @@ ID¤È¤ÏÊÑ¿ô̾¡¤¥á¥½¥Ã¥É̾¤òɽ¤¹À°¿ô¤Ç¤¹¡¥Ruby¤Ç¤ÏID¤ËÂбþ¤¹¤ë
rb_to_id(VALUE symbol)
-ID¤«¤é¥·¥ó¥Ü¥ë¤òÆÀ¤ë¤¿¤á¤Ë¤Ï°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤¤¤Þ¤¹¡¥
-
- VALUE ID2SYM(ID id)
-
-¥·¥ó¥Ü¥ë¤«¤éID¤òÆÀ¤ë¤¿¤á¤Ë¤Ï°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤¤¤Þ¤¹¡¥
-
- ID SYM2ID(VALUE symbol)
-
2.2.3 C¤«¤éRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹
C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤¿¤á¤Ë¤Ï°Ê²¼
@@ -483,11 +576,17 @@ C¤ÈRuby¤ÇÂç°èÊÑ¿ô¤ò»È¤Ã¤Æ¾ðÊó¤ò¶¦Í­¤Ç¤­¤Þ¤¹¡¥¶¦Í­¤Ç¤­¤ëÂç°è
¤¹¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï´Ø¿ôgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì
¤¿»þ¤Ë¤Ï´Ø¿ôsetter¤¬¸Æ¤Ð¤ì¤ë¡¥hook¤ò»ØÄꤷ¤Ê¤¤¾ì¹ç¤Ïgetter¤ä
setter¤Ë0¤ò»ØÄꤷ¤Þ¤¹¡¥
-
# getter¤âsetter¤â0¤Ê¤é¤Ðrb_define_variable()¤ÈƱ¤¸¤Ë¤Ê¤ë¡¥
-¤½¤ì¤«¤é¡¤C¤Î´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRuby¤ÎÂç°èÊÑ¿ô¤òÄêµÁ¤¹¤ë
-´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
+getter¤Èsetter¤Î»ÅÍͤϼ¡¤ÎÄ̤ê¤Ç¤¹¡¥
+
+ VALUE (*getter)(ID id, VALUE *var);
+ void (*setter)(VALUE val, ID id, VALUE *var);
+
+
+¤½¤ì¤«¤é¡¤Âбþ¤¹¤ëC¤ÎÊÑ¿ô¤ò»ý¤¿¤Ê¤¤Ruby¤ÎÂç°èÊÑ¿ô¤òÄêµÁ¤¹¤ë
+¤³¤È¤â¤Ç¤­¤Þ¤¹. ¤½¤ÎÊÑ¿ô¤ÎÃͤϥե寴ؿô¤Î¤ß¤Ë¤è¤Ã¤Æ¼èÆÀ¡¦ÀßÄê
+¤µ¤ì¤Þ¤¹.
void rb_define_virtual_variable(const char *name,
VALUE (*getter)(), void (*setter)())
@@ -497,8 +596,8 @@ getter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì¤Þ¤¹¡¥
getter¤Èsetter¤Î»ÅÍͤϰʲ¼¤ÎÄ̤ê¤Ç¤¹¡¥
- (*getter)(ID id, void *data, struct global_entry* entry);
- (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+ (*getter)(ID id);
+ (*setter)(VALUE val, ID id);
3.3 C¤Î¥Ç¡¼¥¿¤òRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤¹¤ë
@@ -525,6 +624,11 @@ free¤Ï¤³¤Î¹½Â¤ÂΤ¬¤â¤¦ÉÔÍפˤʤä¿»þ¤Ë¸Æ¤Ð¤ì¤ë´Ø¿ô¤Ç¤¹¡¥¤³¤Î
´Ø¿ô¤¬¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿¤«¤é¸Æ¤Ð¤ì¤Þ¤¹¡¥¤³¤ì¤¬-1¤Î¾ì¹ç¤Ï¡¤Ã±
½ã¤Ë³«Êü¤µ¤ì¤Þ¤¹¡¥
+mark¤ª¤è¤Ófree´Ø¿ô¤ÏGC¼Â¹ÔÃæ¤Ë¸Æ¤Ó½Ð¤µ¤ì¤Þ¤¹.
+¤Ê¤ª, GC¼Â¹ÔÃæ¤ÏRuby¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¢¥í¥±¡¼¥·¥ç¥ó¤Ï¶Ø»ß¤µ¤ì¤Þ
+¤¹. ¤è¤Ã¤Æ, mark¤ª¤è¤Ófree´Ø¿ô¤ÇRuby¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¢¥í¥±¡¼¥·
+¥ç¥ó¤Ï¹Ô¤ï¤Ê¤¤¤Ç¤¯¤À¤µ¤¤.
+
C¤Î¹½Â¤ÂΤγäÅö¤ÈData¥ª¥Ö¥¸¥§¥¯¥È¤ÎÀ¸À®¤òƱ»þ¤Ë¹Ô¤¦¥Þ¥¯¥í¤È
¤·¤Æ°Ê²¼¤Î¤â¤Î¤¬Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
@@ -576,7 +680,10 @@ Ruby 1.1¤«¤é¤ÏǤ°Õ¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç¥À¥¤¥Ê¥ß¥Ã¥¯¥é¥¤¥Ö¥é¥ê¤òºî
¸À¸ì¤Î¥½¡¼¥¹¤¬Ê£¿ô¤Î¾ì¹ç¤Ë¤ÏµÕ¤Ë¡Ö¥é¥¤¥Ö¥é¥ê̾.c¡×¤È¤¤¤¦¥Õ¥¡
¥¤¥ë̾¤ÏÈò¤±¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤È¥â¥¸¥å¡¼
¥ëÀ¸À®»þ¤ËÃæ´ÖŪ¤ËÀ¸À®¤µ¤ì¤ë¡Ö¥é¥¤¥Ö¥é¥ê̾.o¡×¤È¤¤¤¦¥Õ¥¡¥¤¥ë
-¤È¤¬¾×ÆÍ¤¹¤ë¤«¤é¤Ç¤¹¡¥
+¤È¤¬¾×ÆÍ¤¹¤ë¤«¤é¤Ç¤¹¡¥¤Þ¤¿¡¤¸å½Ò¤¹¤ë mkmf ¥é¥¤¥Ö¥é¥ê¤Î¤¤¤¯¤Ä
+¤«¤Î´Ø¿ô¤¬¥³¥ó¥Ñ¥¤¥ë¤òÍפ¹¤ë¥Æ¥¹¥È¤Î¤¿¤á¤Ë¡Öconftest.c¡×¤È¤¤
+¤¦¥Õ¥¡¥¤¥ë̾¤ò»ÈÍѤ¹¤ë¤³¤È¤ËÃí°Õ¤·¤Æ¤¯¤À¤µ¤¤¡¥¥½¡¼¥¹¥Õ¥¡¥¤¥ë
+̾¤È¤·¤Æ¡Öconftest.c¡×¤ò»ÈÍѤ·¤Æ¤Ï¤Ê¤ê¤Þ¤»¤ó¡¥
Ruby¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ò¥í¡¼¥É¤¹¤ë»þ¤Ë¡ÖInit_¥é¥¤¥Ö¥é¥ê̾¡×¤È
¤¤¤¦´Ø¿ô¤ò¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Þ¤¹¡¥dbm¥é¥¤¥Ö¥é¥ê¤Î¾ì¹ç¡ÖInit_dbm¡×
@@ -584,7 +691,8 @@ Ruby¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ò¥í¡¼¥É¤¹¤ë»þ¤Ë¡ÖInit_¥é¥¤¥Ö¥é¥ê̾¡×¤È
ÄêµÁ¤ò¹Ô¤¤¤Þ¤¹¡¥dbm.c¤«¤é°ìÉô°úÍѤ·¤Þ¤¹¡¥
--
-Init_dbm()
+void
+Init_dbm(void)
{
/* DBM¥¯¥é¥¹¤òÄêµÁ¤¹¤ë */
cDBM = rb_define_class("DBM", rb_cObject);
@@ -646,8 +754,7 @@ fdbm_delete()¤Ï¤³¤Î¤è¤¦¤Ë¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
--
static VALUE
-fdbm_delete(obj, keystr)
- VALUE obj, keystr;
+fdbm_delete(VALUE obj, VALUE keystr)
{
:
}
@@ -663,10 +770,7 @@ fdbm_delete(obj, keystr)
--
static VALUE
-fdbm_s_open(argc, argv, klass)
- int argc;
- VALUE *argv;
- VALUE klass;
+fdbm_s_open(int argc, VALUE *argv, VALUE klass)
{
:
if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
@@ -681,22 +785,17 @@ fdbm_s_open(argc, argv, klass)
¤¨¤é¤ì¤Þ¤¹¡¥
¤³¤ÎÇÛÎó¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤ò²òÀϤ¹¤ë¤¿¤á¤Î´Ø¿ô¤¬open()¤Ç¤â»È¤ï
-¤ì¤Æ¤¤¤ërb_scan_args()¤Ç¤¹¡¥Âè3°ú¿ô¤Ë»ØÄꤷ¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë
-½¾¤¤¡¤Âè4ÊÑ¿ô°Ê¹ß¤Ë»ØÄꤷ¤¿ÊÑ¿ô¤ËÃͤòÂåÆþ¤·¤Æ¤¯¤ì¤Þ¤¹¡¥¤³¤Î
-¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï¡¤Âè1ʸ»úÌܤ¬¾Êά¤Ç¤­¤Ê¤¤°ú¿ô¤Î¿ô¡¤Âè2ʸ»úÌܤ¬
-¾Êά¤Ç¤­¤ë°ú¿ô¤Î¿ô¡¤Âè3ʸ»úÌܤ¬Âбþ¤¹¤ëÁê¼ê¤¬Ìµ¤¤¤¢¤Þ¤ê¤Î°ú
-¿ô¤¬¤¢¤ë¤«¤É¤¦¤«¤ò¼¨¤¹"*"¤Ç¤¹¡¥2ʸ»úÌܤÈ3ʸ»úÌܤϾÊά¤Ç¤­¤Þ
-¤¹¡¥dbm.c¤ÎÎã¤Ç¤Ï¡¤¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï"11"¤Ç¤¹¤«¤é¡¤°ú¿ô¤ÏºÇÄã1¤Ä
-¤Ç¡¤2¤Ä¤Þ¤Çµö¤µ¤ì¤ë¤È¤¤¤¦°ÕÌ£¤Ë¤Ê¤ê¤Þ¤¹¡¥¾Êά¤µ¤ì¤Æ¤¤¤ë»þ¤Î
-ÊÑ¿ô¤ÎÃͤÏnil(C¸À¸ì¤Î¥ì¥Ù¥ë¤Ç¤ÏQnil)¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-Ruby¤ÎÇÛÎó¤Ç°ú¿ô¤ò¼õ¤±¼è¤ë¤â¤Î¤Ïindexes¤¬¤¢¤ê¤Þ¤¹¡¥¼ÂÁõ¤Ï¤³
-¤¦¤Ç¤¹¡¥
+¤ì¤Æ¤¤¤ërb_scan_args()¤Ç¤¹¡¥Âè3°ú¿ô¤Ë»ØÄꤷ¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë½¾
+¤¤¡¤Âè4ÊÑ¿ô°Ê¹ß¤Ë»ØÄꤷ¤¿VALUE¤Ø¤Î»²¾È¤ËÃͤòÂåÆþ¤·¤Æ¤¯¤ì¤Þ
+¤¹¡¥
+
+
+°ú¿ô¤òRuby¤ÎÇÛÎó¤È¤·¤Æ¼õ¤±¼è¤ë¥á¥½¥Ã¥É¤ÎÎã¤Ë¤Ï
+Thread#initialize¤¬¤¢¤ê¤Þ¤¹¡¥¼ÂÁõ¤Ï¤³¤¦¤Ç¤¹¡¥
--
static VALUE
-fdbm_indexes(obj, args)
- VALUE obj, args;
+thread_initialize(VALUE thread, VALUE args)
{
:
}
@@ -735,9 +834,9 @@ Makefile¤òºî¤ë¾ì¹ç¤Î¿÷·¿¤Ë¤Ê¤ëextconf.rb¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤òºî¤ê
$LDFLAGS: ¥ê¥ó¥¯»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-L¤Ê¤É)
$objs: ¥ê¥ó¥¯¤µ¤ì¤ë¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë̾¤Î¥ê¥¹¥È
-¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤Î¥ê¥¹¥È¤Ï¡¢Ä̾ï¤Ï¥½¡¼¥¹¥Õ¥¡¥¤¥ë¤ò¸¡º÷¤·
-¤Æ¼«Æ°Åª¤ËÀ¸À®¤µ¤ì¤Þ¤¹¤¬¡¢make¤ÎÅÓÃæ¤Ç¥½¡¼¥¹¤òÀ¸À®¤¹¤ë¤è¤¦¤Ê
-¾ì¹ç¤ÏÌÀ¼¨Åª¤Ë»ØÄꤹ¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡£
+¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤Î¥ê¥¹¥È¤Ï¡¤Ä̾ï¤Ï¥½¡¼¥¹¥Õ¥¡¥¤¥ë¤ò¸¡º÷¤·
+¤Æ¼«Æ°Åª¤ËÀ¸À®¤µ¤ì¤Þ¤¹¤¬¡¤make¤ÎÅÓÃæ¤Ç¥½¡¼¥¹¤òÀ¸À®¤¹¤ë¤è¤¦¤Ê
+¾ì¹ç¤ÏÌÀ¼¨Åª¤Ë»ØÄꤹ¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
¥é¥¤¥Ö¥é¥ê¤ò¥³¥ó¥Ñ¥¤¥ë¤¹¤ë¾ò·ï¤¬Â·¤ï¤º¡¤¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥³¥ó
¥Ñ¥¤¥ë¤·¤Ê¤¤»þ¤Ë¤Ïcreate_makefile¤ò¸Æ¤Ð¤Ê¤±¤ì¤ÐMakefile¤ÏÀ¸
@@ -765,6 +864,12 @@ Makefile¤ò¼ÂºÝ¤ËÀ¸À®¤¹¤ë¤¿¤á¤Ë¤Ï
¤È¤·¤Æ¤¯¤À¤µ¤¤¡¥
+site_ruby ¥Ç¥£¥ì¥¯¥È¥ê¤Ç¤Ê¤¯¡¤
+vendor_ruby ¥Ç¥£¥ì¥¯¥È¥ê¤Ë¥¤¥ó¥¹¥È¡¼¥ë¤¹¤ë¾ì¹ç¤Ë¤Ï
+°Ê²¼¤Î¤è¤¦¤Ë --vendor ¥ª¥×¥·¥ç¥ó¤ò²Ã¤¨¤Æ¤¯¤À¤µ¤¤¡¥
+
+ ruby extconf.rb --vendor
+
¥Ç¥£¥ì¥¯¥È¥ê¤òext°Ê²¼¤ËÍѰդ·¤¿¾ì¹ç¤Ë¤ÏRubyÁ´ÂΤÎmake¤Î»þ¤Ë
¼«Æ°Åª¤ËMakefile¤¬À¸À®¤µ¤ì¤Þ¤¹¤Î¤Ç¡¤¤³¤Î¥¹¥Æ¥Ã¥×¤ÏÉÔÍפǤ¹¡¥
@@ -807,53 +912,119 @@ Ruby¤Î¥½¡¼¥¹¤Ï¤¤¤¯¤Ä¤«¤ËʬÎह¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤³¤Î¤¦¤Á¥¯¥é
Ruby¸À¸ì¤Î¥³¥¢
- class.c
- error.c
+ class.c : ¥¯¥é¥¹¤È¥â¥¸¥å¡¼¥ë
+ error.c : Îã³°¥¯¥é¥¹¤ÈÎã³°µ¡¹½
+ gc.c : µ­²±Îΰè´ÉÍý
+ load.c : ¥é¥¤¥Ö¥é¥ê¤Î¥í¡¼¥É
+ object.c : ¥ª¥Ö¥¸¥§¥¯¥È
+ variable.c : ÊÑ¿ô¤ÈÄê¿ô
+
+Ruby¤Î¹½Ê¸²òÀÏ´ï
+ parse.y : »ú¶ç²òÀÏ´ï¤È¹½Ê¸ÄêµÁ
+ -> parse.c : ¼«Æ°À¸À®
+ keywords : ͽÌó¸ì
+ -> lex.c : ¼«Æ°À¸À®
+
+Ruby¤Îɾ²Á´ï (Ä̾ÎYARV)
+ compile.c
eval.c
- gc.c
- object.c
- parse.y
- variable.c
+ eval_error.c
+ eval_jump.c
+ eval_safe.c
+ insns.def : ²¾ÁÛµ¡³£¸ì¤ÎÄêµÁ
+ iseq.c : VM::ISeq¤Î¼ÂÁõ
+ thread.c : ¥¹¥ì¥Ã¥É´ÉÍý¤È¥³¥ó¥Æ¥­¥¹¥ÈÀÚ¤êÂØ¤¨
+ thread_win32.c : ¥¹¥ì¥Ã¥É¼ÂÁõ
+ thread_pthread.c : Ʊ¾å
+ vm.c
+ vm_dump.c
+ vm_eval.c
+ vm_exec.c
+ vm_insnhelper.c
+ vm_method.c
+
+ opt_insns_unif.def : Ì¿ÎáÍ»¹ç
+ opt_operand.def : ºÇŬ²½¤Î¤¿¤á¤ÎÄêµÁ
+
+ -> insn*.inc : ¼«Æ°À¸À®
+ -> opt*.inc : ¼«Æ°À¸À®
+ -> vm.inc : ¼«Æ°À¸À®
+
+Àµµ¬É½¸½¥¨¥ó¥¸¥ó (µ´¼Ö)
+ regex.c
+ regcomp.c
+ regenc.c
+ regerror.c
+ regexec.c
+ regparse.c
+ regsyntax.c
¥æ¡¼¥Æ¥£¥ê¥Æ¥£´Ø¿ô
- dln.c
- regex.c
- st.c
- util.c
+ debug.c : C¥Ç¥Ð¥Ã¥¬ÍѤΥǥХå°¥·¥ó¥Ü¥ë
+ dln.c : ưŪ¥í¡¼¥Ç¥£¥ó¥°
+ st.c : ÈÆÍѥϥå·¥åɽ
+ strftime.c : »þ¹ïÀ°·Á
+ util.c : ¤½¤Î¾¤Î¥æ¡¼¥Æ¥£¥ê¥Æ¥£
Ruby¥³¥Þ¥ó¥É¤Î¼ÂÁõ
dmyext.c
+ dmydln.c
+ dmyencoding.c
+ id.c
inits.c
main.c
ruby.c
version.c
+ gem_prelude.rb
+ prelude.rb
+
¥¯¥é¥¹¥é¥¤¥Ö¥é¥ê
- array.c
- bignum.c
- compar.c
- dir.c
- enum.c
- file.c
- hash.c
- io.c
- marshal.c
- math.c
- numeric.c
- pack.c
- prec.c
- process.c
- random.c
- range.c
- re.c
- signal.c
- sprintf.c
- string.c
- struct.c
- time.c
+ array.c : Array
+ bignum.c : Bignum
+ compar.c : Comparable
+ complex.c : Complex
+ cont.c : Fiber, Continuation
+ dir.c : Dir
+ enum.c : Enumerable
+ enumerator.c : Enumerator
+ file.c : File
+ hash.c : Hash
+ io.c : IO
+ marshal.c : Marshal
+ math.c : Math
+ numeric.c : Numeric, Integer, Fixnum, Float
+ pack.c : Array#pack, String#unpack
+ proc.c : Binding, Proc
+ process.c : Process
+ random.c : Íð¿ô
+ range.c : Range
+ rational.c : Rational
+ re.c : Regexp, MatchData
+ signal.c : Signal
+ sprintf.c :
+ string.c : String
+ struct.c : Struct
+ time.c : Time
+
+ defs/known_errors.def : Îã³°¥¯¥é¥¹ Errno::*
+ -> known_errors.inc : ¼«Æ°À¸À®
+
+¿¸À¸ì²½
+ encoding.c : Encoding
+ transcode.c : Encoding::Converter
+ enc/*.c : ¥¨¥ó¥³¡¼¥Ç¥£¥ó¥°¥¯¥é¥¹·²
+ enc/trans/* : ¥³¡¼¥É¥Ý¥¤¥ó¥ÈÂбþɽ
+
+goruby¥³¥Þ¥ó¥É¤Î¼ÂÁõ
+
+ goruby.c
+ golf_prelude.rb : goruby¸ÇÍ­¤Î¥é¥¤¥Ö¥é¥ê
+ -> golf_prelude.c : ¼«Æ°À¸À®
+
Appendix B. ³ÈÄ¥ÍÑ´Ø¿ô¥ê¥Õ¥¡¥ì¥ó¥¹
@@ -911,10 +1082,17 @@ void Check_SafeStr(VALUE value)
** ·¿ÊÑ´¹
-FIX2INT(value)
-INT2FIX(i)
-NUM2INT(value)
-INT2NUM(i)
+FIX2INT(value), INT2FIX(i)
+FIX2LONG(value), LONG2FIX(l)
+NUM2INT(value), INT2NUM(i)
+NUM2UINT(value), UINT2NUM(ui)
+NUM2LONG(value), LONG2NUM(l)
+NUM2ULONG(value), ULONG2NUM(ul)
+NUM2LL(value), LL2NUM(ll)
+NUM2ULL(value), ULL2NUM(ull)
+NUM2OFFT(value), OFFT2NUM(off)
+NUM2SIZET(value), SIZET2NUM(size)
+NUM2SSIZET(value), SSIZET2NUM(ssize)
NUM2DBL(value)
rb_float_new(f)
StringValue(value)
@@ -1018,13 +1196,48 @@ rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int a
rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
- argc, argv·Á¼°¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤òʬ²ò¤¹¤ë¡¥fmt¤Ïɬ¿Ü°ú¿ô¤Î¿ô,
- Éղðú¿ô¤Î¿ô, »Ä¤ê¤Î°ú¿ô¤¬¤¢¤ë¤«¤ò»ØÄꤹ¤ëʸ»úÎó¤Ç, "¿ô»ú
- ¿ô»ú*"¤È¤¤¤¦·Á¼°¤Ç¤¢¤ë¡¥ 2 ÈÖÌܤοô»ú¤È"*"¤Ï¤½¤ì¤¾¤ì¾Êά²Ä
- ǽ¤Ç¤¢¤ë¡¥É¬¿Ü°ú¿ô¤¬°ì¤Ä¤â¤Ê¤¤¾ì¹ç¤Ï0¤ò»ØÄꤹ¤ë¡¥Âè3°ú¿ô°Ê
- ¹ß¤ÏÊÑ¿ô¤Ø¤Î¥Ý¥¤¥ó¥¿¤Ç, ³ºÅö¤¹¤ëÍ×ÁǤ¬¤½¤ÎÊÑ¿ô¤Ë³ÊǼ¤µ¤ì¤ë¡¥
- Éղðú¿ô¤ËÂбþ¤¹¤ë°ú¿ô¤¬Í¿¤¨¤é¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤ÏÊÑ¿ô¤ËQnil¤¬
- ÂåÆþ¤µ¤ì¤ë¡¥
+ argc, argv·Á¼°¤ÇÍ¿¤¨¤é¤ì¤¿»ØÄꤵ¤ì¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë½¾¤Ã¤Æ°ú
+ ¿ô¤òʬ²ò¤·¡¤Â³¤¯VALUE¤Ø¤Î»²¾È¤Ë¥»¥Ã¥È¤·¤Þ¤¹¡¥¤³¤Î¥Õ¥©¡¼¥Þ¥Ã
+ ¥È¤Ï¡¤ABNF¤Çµ­½Ò¤¹¤ë¤È°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
+
+--
+scan-arg-spec := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
+
+param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec / pre-opt-post-arg-spec
+pre-arg-spec := num-of-leading-mandatory-args [num-of-optional-args]
+post-arg-spec := sym-for-variable-length-args [num-of-trailing-mandatory-args]
+pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args num-of-trailing-mandatory-args
+option-hash-arg-spec := sym-for-option-hash-arg
+block-arg-spec := sym-for-block-arg
+
+num-of-leading-mandatory-args := DIGIT ; ÀèÆ¬¤ËÃÖ¤«¤ì¤ë¾ÊάÉÔǽ¤Ê°ú¿ô¤Î¿ô
+num-of-optional-args := DIGIT ; ³¤¤¤ÆÃÖ¤«¤ì¤ë¾Êά²Äǽ¤Ê°ú¿ô¤Î¿ô
+sym-for-variable-length-args := "*" ; ³¤¤¤ÆÃÖ¤«¤ì¤ë²ÄÊÑŰú¿ô¤ò
+ ; Ruby¤ÎÇÛÎó¤Ç¼èÆÀ¤¹¤ë¤¿¤á¤Î»ØÄê
+num-of-trailing-mandatory-args := DIGIT ; ½ªÃ¼¤ËÃÖ¤«¤ì¤ë¾ÊάÉÔǽ¤Ê°ú¿ô¤Î¿ô
+sym-for-option-hash-arg := ":" ; ¥ª¥×¥·¥ç¥ó¥Ï¥Ã¥·¥å¤ò¼èÆÀ¤¹¤ë
+ ; ¤¿¤á¤Î»ØÄê; ¾ÊάÉÔǽ¤Ê°ú¿ô¤Î
+ ; ¿ô¤è¤ê¤â¿¤¯¤Î°ú¿ô¤¬»ØÄꤵ¤ì¡¤
+ ; ºÇ¸å¤Î°ú¿ô¤¬¥Ï¥Ã¥·¥å¡Ê¤Þ¤¿¤Ï
+ ; #to_hash¤ÇÊÑ´¹²Äǽ¡Ë¤Î¾ì¹ç¤Ë
+ ; ¼èÆÀ¤µ¤ì¤ë¡¥ºÇ¸å¤Î°ú¿ô¤¬nil¤Î
+ ; ¾ì¹ç¡¤²ÄÊÑŰú¿ô»ØÄ꤬¤Ê¤¯¡¤
+ ; ¾ÊάÉÔǽ°ú¿ô¤Î¿ô¤è¤ê¤â¿¤¯¤Î
+ ; °ú¿ô¤¬»ØÄꤵ¤ì¤¿¾ì¹ç¤Ë¼èÆÀ¤µ¤ì¤ë
+sym-for-block-arg := "&" ; ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¼èÆÀ¤¹¤ë¤¿¤á¤Î
+ ; »ØÄê
+--
+
+ ¥Õ¥©¡¼¥Þ¥Ã¥È¤¬"12"¤Î¾ì¹ç¡¤°ú¿ô¤ÏºÇÄã1¤Ä¤Ç¡¤3¤Ä(1+2)¤Þ¤Çµö¤µ
+ ¤ì¤ë¤È¤¤¤¦°ÕÌ£¤Ë¤Ê¤ê¤Þ¤¹¡¥½¾¤Ã¤Æ¡¤¥Õ¥©¡¼¥Þ¥Ã¥Èʸ»úÎó¤Ë³¤¤
+ ¤Æ3¤Ä¤ÎVALUE¤Ø¤Î»²¾È¤òÃÖ¤¯É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥¤½¤ì¤é¤Ë¤Ï¼èÆÀ¤·¤¿
+ ÊÑ¿ô¤¬¥»¥Ã¥È¤µ¤ì¤Þ¤¹¡¥ÊÑ¿ô¤Ø¤Î»²¾È¤ÎÂå¤ï¤ê¤ËNULL¤ò»ØÄꤹ¤ë
+ ¤³¤È¤â¤Ç¤­¡¤¤½¤Î¾ì¹ç¤Ï¼èÆÀ¤·¤¿°ú¿ô¤ÎÃͤϼΤƤé¤ì¤Þ¤¹¡¥¤Ê¤ª¡¤
+ ¾Êά²Äǽ°ú¿ô¤¬¾Êά¤µ¤ì¤¿»þ¤ÎÊÑ¿ô¤ÎÃͤÏnil(C¸À¸ì¤Î¥ì¥Ù¥ë¤Ç¤Ï
+ Qnil)¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+ ÊÖ¤êÃͤÏÍ¿¤¨¤é¤ì¤¿°ú¿ô¤Î¿ô¤Ç¤¹¡¥¥ª¥×¥·¥ç¥ó¥Ï¥Ã¥·¥å¤ª¤è¤Ó¥¤
+ ¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤Ï¿ô¤¨¤Þ¤»¤ó¡¥
** Ruby¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·
@@ -1051,12 +1264,12 @@ char *rb_id2name(ID id)
char *rb_class2name(VALUE klass)
- ¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥¥¯¥é¥¹¤¬Ì¾Á°¤ò»ý¤¿¤Ê¤¤»þ¤Ë¤Ï,
- ÁÄÀè¤òÁ̤äÆÌ¾Á°¤ò»ý¤Ä¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹¡¥
+ ¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥¥¯¥é¥¹¤¬Ì¾Á°¤ò»ý¤¿¤Ê¤¤»þ¤Ë
+ ¤Ï, ÁÄÀè¤òÁ̤äÆÌ¾Á°¤ò»ý¤Ä¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹¡¥
int rb_respond_to(VALUE obj, ID id)
- obj¤¬id¤Ç¼¨¤µ¤ì¤ë¥á¥½¥Ã¥É¤ò»ý¤Ä¤«¤É¤¦¤«¤òÊÖ¤¹¡£
+ obj¤¬id¤Ç¼¨¤µ¤ì¤ë¥á¥½¥Ã¥É¤ò»ý¤Ä¤«¤É¤¦¤«¤òÊÖ¤¹¡¥
** ¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô
@@ -1073,12 +1286,26 @@ VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
** À©¸æ¹½Â¤
-VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+VALUE rb_block_call(VALUE obj, ID mid, int argc, VALUE * argv,
+ VALUE (*func) (ANYARGS), VALUE data2)
+
+ func¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ¡¤obj¤ò¥ì¥·¡¼¥Ð¡¤argc¤Èargv¤ò°ú¿ô
+ ¤È¤·¤Æmid¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¡¥func¤ÏÂè°ì°ú¿ô¤Ëyield¤µ¤ì¤¿ÃÍ¡¤
+ ÂèÆó°ú¿ô¤Ëdata2¤ò¼õ¤±¼è¤ë¡¥Ê£¿ô¤ÎÃͤ¬yield¤µ¤ì¤¿¾ì¹ç(C¤Ç¤Ï
+ rb_yield_values()¤Èrb_yield_values2(), rb_yield_splat())¡¤
+ data2¤ÏArray¤È¤·¤Æ¥Ñ¥Ã¥¯¤µ¤ì¤Æ¤¤¤ë¡¥Âè»°, Âè»Í°ú¿ô¤Îargc¤È
+ argv¤Ë¤è¤Ã¤Æyield¤µ¤ì¤¿Ãͤò¼è¤ê½Ð¤¹¤³¤È¤¬¤Ç¤­¤ë¡¥
+
+[OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
func2¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ, func1¤ò¥¤¥Æ¥ì¡¼¥¿¤È¤·¤Æ¸Æ¤Ö¡¥
func1¤Ë¤Ï arg1¤¬°ú¿ô¤È¤·¤ÆÅϤµ¤ì, func2¤Ë¤ÏÂè1°ú¿ô¤Ë¥¤¥Æ¥ì¡¼
¥¿¤«¤éÍ¿¤¨¤é¤ì¤¿ÃÍ, Âè2°ú¿ô¤Ëarg2¤¬ÅϤµ¤ì¤ë¡¥
+ 1.9¤Çrb_iterate¤ò»È¤¦¾ì¹ç¤Ï, func1¤ÎÃæ¤ÇRuby¥ì¥Ù¥ë¤Î¥á¥½¥Ã¥É
+ ¤ò¸Æ¤Ó½Ð¤µ¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤.
+ 1.9¤Çobsolete¤È¤Ê¤Ã¤¿. Âå¤ï¤ê¤Ërb_block_call¤¬ÍѰդµ¤ì¤¿.
+
VALUE rb_yield(VALUE val)
val¤òÃͤȤ·¤Æ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¸Æ¤Ó½Ð¤¹¡¥
@@ -1090,12 +1317,24 @@ VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
¤·¤Ê¤«¤Ã¤¿»þ¤Ïfunc1¤ÎÌá¤êÃÍ, Îã³°¤¬È¯À¸¤·¤¿»þ¤Ë¤Ïfunc2¤ÎÌá
¤êÃͤǤ¢¤ë¡¥
-VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, void (*func2)(), VALUE arg2)
+VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, ¼Â¹Ô½ªÎ»¸å(¤¿¤È¤¨Îã³°¤¬
ȯÀ¸¤·¤Æ¤â) func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤¹¤ë¡¥Ìá¤êÃͤÏfunc1
¤ÎÌá¤êÃͤǤ¢¤ë(Îã³°¤¬È¯À¸¤·¤¿»þ¤ÏÌá¤é¤Ê¤¤)¡¥
+VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state)
+
+ ´Ø¿ôfunc¤òarg¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, Îã³°¤¬È¯À¸¤·¤Ê¤±¤ì¤Ð¤½¤ÎÌá
+ ¤êÃͤòÊÖ¤¹¡¥Îã³°¤¬È¯À¸¤·¤¿¾ì¹ç¤Ï, *state¤ËÈó0¤ò¥»¥Ã¥È¤·¤Æ
+ Qnil¤òÊÖ¤¹¡¥
+
+void rb_jump_tag(int state)
+
+ rb_protect()¤ärb_eval_string_protect()¤ÇÊ᪤µ¤ì¤¿Îã³°¤òºÆ
+ Á÷¤¹¤ë¡¥state¤Ï¤½¤ì¤é¤Î´Ø¿ô¤«¤éÊÖ¤µ¤ì¤¿ÃͤǤʤ±¤ì¤Ð¤Ê¤é¤Ê¤¤¡¥
+ ¤³¤Î´Ø¿ô¤ÏľÀܤθƤӽФ·¸µ¤ËÌá¤é¤Ê¤¤¡¥
+
** Îã³°¡¦¥¨¥é¡¼
void rb_warning(const char *fmt, ...)
@@ -1145,6 +1384,77 @@ void ruby_script(char *name)
Ruby¤Î¥¹¥¯¥ê¥×¥È̾($0)¤òÀßÄꤹ¤ë¡¥
+** ¥¤¥ó¥¿¥×¥ê¥¿¤Î¥¤¥Ù¥ó¥È¤Î¥Õ¥Ã¥¯
+
+ void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events, VALUE data)
+
+»ØÄꤵ¤ì¤¿¥¤¥ó¥¿¥×¥ê¥¿¤Î¥¤¥Ù¥ó¥È¤ËÂФ¹¤ë¥Õ¥Ã¥¯´Ø¿ô¤òÄɲä·¤Þ¤¹¡¥
+events¤Ï°Ê²¼¤ÎÃͤÎor¤Ç¤Ê¤±¤ì¤Ð¤Ê¤ê¤Þ¤»¤ó:
+
+ RUBY_EVENT_LINE
+ RUBY_EVENT_CLASS
+ RUBY_EVENT_END
+ RUBY_EVENT_CALL
+ RUBY_EVENT_RETURN
+ RUBY_EVENT_C_CALL
+ RUBY_EVENT_C_RETURN
+ RUBY_EVENT_RAISE
+ RUBY_EVENT_ALL
+
+rb_event_hook_func_t¤ÎÄêµÁ¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹:
+
+ typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
+ VALUE self, ID id, VALUE klass)
+
+rb_add_event_hook() ¤ÎÂè3°ú¿ô data ¤Ï¡¤¥Õ¥Ã¥¯´Ø¿ô¤ÎÂè2°ú¿ô¤È
+¤·¤ÆÅϤµ¤ì¤Þ¤¹¡¥¤³¤ì¤Ï1.8¤Ç¤Ï¸½ºß¤ÎNODE¤Ø¤Î¥Ý¥¤¥ó¥¿¤Ç¤·¤¿¡¥°Ê
+²¼¤Î RB_EVENT_HOOKS_HAVE_CALLBACK_DATA ¤â»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡¥
+
+ int rb_remove_event_hook(rb_event_hook_func_t func)
+
+»ØÄꤵ¤ì¤¿¥Õ¥Ã¥¯´Ø¿ô¤òºï½ü¤·¤Þ¤¹¡¥
+
+** ¸ß´¹À­¤Î¤¿¤á¤Î¥Þ¥¯¥í
+
+API¤Î¸ß´¹À­¤ò¥Á¥§¥Ã¥¯¤¹¤ë¤¿¤á¤Ë°Ê²¼¤Î¥Þ¥¯¥í¤¬¥Ç¥Õ¥©¥ë¥È¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+NORETURN_STYLE_NEW
+
+ NORETURN ¥Þ¥¯¥í¤¬´Ø¿ô·¿¥Þ¥¯¥í¤È¤·¤ÆÄêµÁ¤µ¤ì¤Æ¤¤¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
+
+HAVE_RB_DEFINE_ALLOC_FUNC
+
+ rb_define_alloc_func() ´Ø¿ô¤¬Ä󶡤µ¤ì¤Æ¤¤¤ë¤³¤È¡¤¤Ä¤Þ¤ê
+ allocation framework ¤¬»È¤ï¤ì¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
+ have_func("rb_define_alloc_func", "ruby.h")
+ ¤Î·ë²Ì¤ÈƱ¤¸¡¥
+
+HAVE_RB_REG_NEW_STR
+
+ String¥ª¥Ö¥¸¥§¥¯¥È¤«¤éRegexp¥ª¥Ö¥¸¥§¥¯¥È¤òºî¤ë
+ rb_reg_new_str() ´Ø¿ô¤¬Ä󶡤µ¤ì¤Æ¤¤¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
+ have_func("rb_reg_new_str", "ruby.h").
+ ¤Î·ë²Ì¤ÈƱ¤¸¡¥
+
+HAVE_RB_IO_T
+
+ rb_io_t ·¿¤¬Ä󶡤µ¤ì¤Æ¤¤¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
+
+USE_SYMBOL_AS_METHOD_NAME
+
+ ¥á¥½¥Ã¥É̾¤òÊÖ¤¹¥á¥½¥Ã¥É¡¤Module#methods, #singleton_methods
+ ¤Ê¤É¤¬Symbol¤òÊÖ¤¹¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
+
+HAVE_RUBY_*_H
+
+ ruby.h ¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ë¡¥Âбþ¤¹¤ë¥Ø¥Ã¥À¤¬Ä󶡤µ¤ì¤Æ¤¤¤ë¤³¤È
+ ¤ò°ÕÌ£¤¹¤ë¡¥¤¿¤È¤¨¤Ð¡¤HAVE_RUBY_ST_H ¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤ë¾ì¹ç¤Ï
+ ñ¤Ê¤ë st.h ¤Ç¤Ï¤Ê¤¯ ruby/st.h ¤ò»ÈÍѤ¹¤ë¡¥
+
+RB_EVENT_HOOKS_HAVE_CALLBACK_DATA
+
+ rb_add_event_hook() ¤¬¥Õ¥Ã¥¯´Ø¿ô¤ËÅϤ¹ data ¤òÂè3°ú¿ô¤È¤·¤Æ
+ ¼õ¤±¼è¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
Appendix C. extconf.rb¤Ç»È¤¨¤ë´Ø¿ô¤¿¤Á
@@ -1169,10 +1479,10 @@ find_library(lib, func, path...)
have_func(func, header)
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ´Ø¿ôfunc¤Î¸ºß¤ò¥Á¥§¥Ã
- ¥¯¤¹¤ë¡¥func¤¬É¸½à¤Ç¤Ï¥ê¥ó¥¯¤µ¤ì¤Ê¤¤¥é¥¤¥Ö¥é¥êÆâ¤Î¤â¤Î¤Ç¤¢
- ¤ë»þ¤Ë¤ÏÀè¤Ëhave_library¤Ç¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤ª¤¯
- »ö¡¥´Ø¿ô¤¬Â¸ºß¤¹¤ë»þtrue¤òÊÖ¤¹¡¥
+ ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ´Ø¿ôfunc¤Î¸ºß¤ò¥Á¥§
+ ¥Ã¥¯¤¹¤ë¡¥func¤¬É¸½à¤Ç¤Ï¥ê¥ó¥¯¤µ¤ì¤Ê¤¤¥é¥¤¥Ö¥é¥êÆâ¤Î¤â¤Î¤Ç
+ ¤¢¤ë»þ¤Ë¤ÏÀè¤Ëhave_library¤Ç¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤ª
+ ¤¯»ö¡¥´Ø¿ô¤¬Â¸ºß¤¹¤ë»þtrue¤òÊÖ¤¹¡¥
have_var(var, header)
@@ -1223,7 +1533,8 @@ find_executable(command, path)
with_config(withval[, default=nil])
- ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--with-<withval>¤Ç»ØÄꤵ¤ì¤¿¥ª¥×¥·¥ç¥óÃͤòÆÀ¤ë¡¥
+ ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--with-<withval>¤Ç»ØÄꤵ¤ì¤¿¥ª¥×¥·¥ç¥óÃÍ
+ ¤òÆÀ¤ë¡¥
enable_config(config, *defaults)
disable_config(config, *defaults)
@@ -1232,8 +1543,9 @@ disable_config(config, *defaults)
--disable-<config>¤Ç»ØÄꤵ¤ì¤¿¿¿µ¶ÃͤòÆÀ¤ë¡¥
--enable-<config>¤¬»ØÄꤵ¤ì¤Æ¤¤¤¿¾ì¹ç¤Ïtrue¡¤
--disable-<config>¤¬»ØÄꤵ¤ì¤Æ¤¤¤¿¾ì¹ç¤Ïfalse¤òÊÖ¤¹¡¥
- ¤É¤Á¤é¤â»ØÄꤵ¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤Ï¡¤¥Ö¥í¥Ã¥¯¤Ä¤­¤Ç¸Æ¤Ó½Ð¤µ¤ì¤Æ¤¤¤ë¾ì¹ç¤Ï
- *defaults¤òyield¤·¤¿·ë²Ì¡¤¥Ö¥í¥Ã¥¯¤Ê¤·¤Ê¤é*defaults¤òÊÖ¤¹¡¥
+ ¤É¤Á¤é¤â»ØÄꤵ¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤Ï¡¤¥Ö¥í¥Ã¥¯¤Ä¤­¤Ç¸Æ¤Ó½Ð¤µ¤ì¤Æ
+ ¤¤¤ë¾ì¹ç¤Ï*defaults¤òyield¤·¤¿·ë²Ì¡¤¥Ö¥í¥Ã¥¯¤Ê¤·¤Ê¤é
+ *defaults¤òÊÖ¤¹¡¥
dir_config(target[, default_dir])
dir_config(target[, default_include, default_lib])
@@ -1242,8 +1554,8 @@ dir_config(target[, default_include, default_lib])
--with-<target>-lib¤Î¤¤¤º¤ì¤«¤Ç»ØÄꤵ¤ì¤ë¥Ç¥£¥ì¥¯¥È¥ê¤ò
$CFLAGS ¤ä $LDFLAGS ¤ËÄɲ乤롥--with-<target>-dir=/path¤Ï
--with-<target>-include=/path/include --with-<target>-lib=/path/lib
- ¤ÈÅù²Á¤Ç¤¢¤ë¡¥Äɲ䵤줿 include ¥Ç¥£¥ì¥¯¥È¥ê¤È lib ¥Ç¥£¥ì¥¯¥È¥ê¤Î
- ÇÛÎó¤òÊÖ¤¹¡¥ ([include_dir, lib_dir])
+ ¤ÈÅù²Á¤Ç¤¢¤ë¡¥Äɲ䵤줿 include ¥Ç¥£¥ì¥¯¥È¥ê¤È lib ¥Ç¥£¥ì
+ ¥¯¥È¥ê¤ÎÇÛÎó¤òÊÖ¤¹¡¥ ([include_dir, lib_dir])
pkg_config(pkg)
diff --git a/README.ja b/README.ja
index df8cfc03f4..dd7f67ca59 100644
--- a/README.ja
+++ b/README.ja
@@ -20,9 +20,9 @@ Ruby¤Ï¥Æ¥­¥¹¥È½èÍý´Ø·¸¤ÎǽÎϤʤɤËÍ¥¤ì¡¤Perl¤ÈƱ¤¸¤¯¤é¤¤¶¯ÎÏ
+ ¥¤¥Æ¥ì¡¼¥¿¤È¥¯¥í¡¼¥¸¥ã
+ ¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿
+ ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥° (¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤è¤ë)
- + °Ü¿¢À­¤¬¹â¤¤¡¥Â¿¤¯¤ÎUNIX¾å¤Çư¤¯¤À¤±¤Ç¤Ê¤¯¡¤DOS¤äWindows¡¤
- Mac¡¤BeOS¤Ê¤É¤Î¾å¤Ç¤âư¤¯
-
+ + °Ü¿¢À­¤¬¹â¤¤¡¥Â¿¤¯¤ÎUnix-like/POSIX¸ß´¹¥×¥é¥Ã¥È¥Õ¥©¡¼¥à¾å¤Ç
+ ư¤¯¤À¤±¤Ç¤Ê¤¯¡¤Windows¡¤ Mac OS X¡¤BeOS¤Ê¤É¤Î¾å¤Ç¤âư¤¯
+ cf. http://redmine.ruby-lang.org/wiki/ruby-19/SupportedPlatformsJa
* Æþ¼êË¡
@@ -34,10 +34,6 @@ Ruby¤Ï¥Æ¥­¥¹¥È½èÍý´Ø·¸¤ÎǽÎϤʤɤËÍ¥¤ì¡¤Perl¤ÈƱ¤¸¤¯¤é¤¤¶¯ÎÏ
** Subversion¤Ç
-ËÜ¥Ö¥é¥ó¥Á¤ÎRuby¤ÎºÇ¿·¤Î¥½¡¼¥¹¥³¡¼¥É¤Ï¼¡¤Î¥³¥Þ¥ó¥É¤Ç¼èÆÀ¤Ç¤­¤Þ¤¹¡¥
-
- $ svn co http://svn.ruby-lang.org/repos/ruby/branches/ruby_1_8_6/
-
³«È¯Àèü¤Î¥½¡¼¥¹¥³¡¼¥É¤Ï¼¡¤Î¥³¥Þ¥ó¥É¤Ç¼èÆÀ¤Ç¤­¤Þ¤¹¡¥
$ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
@@ -92,6 +88,10 @@ Ruby³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë¤Ä¤¤¤ÆÏ䷹礦ruby-ext¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤È
2. configure¤ò¼Â¹Ô¤·¤ÆMakefile¤Ê¤É¤òÀ¸À®¤¹¤ë
+ ´Ä¶­¤Ë¤è¤Ã¤Æ¤Ï¥Ç¥Õ¥©¥ë¥È¤ÎC¥³¥ó¥Ñ¥¤¥éÍÑ¥ª¥×¥·¥ç¥ó¤¬ÉÕ¤­
+ ¤Þ¤¹¡¥configure¥ª¥×¥·¥ç¥ó¤Ç optflags=.. warnflags=.. Åù
+ ¤Ç¾å½ñ¤­¤Ç¤­¤Þ¤¹¡¥
+
3. (ɬÍפʤé¤Ð)defines.h¤òÊÔ½¸¤¹¤ë
¿ʬ¡¤É¬Í×̵¤¤¤È»×¤¤¤Þ¤¹¡¥
@@ -116,6 +116,32 @@ Ruby³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë¤Ä¤¤¤ÆÏ䷹礦ruby-ext¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤È
7. make install
+ °Ê²¼¤Î¥Ç¥£¥ì¥¯¥È¥ê¤òºî¤Ã¤Æ¡¤¤½¤³¤Ë¥Õ¥¡¥¤¥ë¤ò¥¤¥ó¥¹¥È¡¼
+ ¥ë¤·¤Þ¤¹¡¥
+
+ * ${DESTDIR}${prefix}/bin
+ * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}
+ * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+ * ${DESTDIR}${prefix}/lib
+ * ${DESTDIR}${prefix}/lib/ruby
+ * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}
+ * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+ * ${DESTDIR}${prefix}/lib/ruby/site_ruby
+ * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}
+ * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+ * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby
+ * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}
+ * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+ * ${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}
+ * ${DESTDIR}${prefix}/share/man/man1
+ * ${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system
+
+ Ruby¤ÎAPI¥Ð¡¼¥¸¥ç¥ó¤¬`x.y.z'¤Ç¤¢¤ì¤Ð¡¤((|${MAJOR}|))¤Ï
+ `x'¤Ç¡¤((|${MINOR}|))¤Ï`y'¡¤((|${TEENY}|))¤Ï`z'¤Ç¤¹¡¥
+
+ Ãí°Õ: API¥Ð¡¼¥¸¥ç¥ó¤Îteeny¤Ï¡¤Ruby¥×¥í¥°¥é¥à¤Î¥Ð¡¼¥¸¥ç
+ ¥ó¤È¤Ï°Û¤Ê¤ë¤³¤È¤¬¤¢¤ê¤Þ¤¹¡¥
+
root¤Çºî¶È¤¹¤ëɬÍפ¬¤¢¤ë¤«¤â¤·¤ì¤Þ¤»¤ó¡¥
¤â¤·¡¤¥³¥ó¥Ñ¥¤¥ë»þ¤Ë¥¨¥é¡¼¤¬È¯À¸¤·¤¿¾ì¹ç¤Ë¤Ï¥¨¥é¡¼¤Î¥í¥°¤È¥Þ
@@ -130,15 +156,14 @@ UNIX¤Ç¤¢¤ì¤Ðconfigure¤¬¤Û¤È¤ó¤É¤Îº¹°Û¤òµÛ¼ý¤·¤Æ¤¯¤ì¤ë¤Ï¤º¤Ç
¤³¤È¤ò¥ì¥Ý¡¼¥È¤¹¤ì¤Ð¡¤²ò·è¤Ç¤­¤ë¤«¤âÃΤì¤Þ¤»¤ó¡¥
¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤â¤Ã¤È¤â°Í¸¤¹¤ë¤Î¤ÏGCÉô¤Ç¤¹¡¥Ruby¤ÎGC¤ÏÂоÝ
-¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤¬setjmp()¤Ë¤è¤Ã¤ÆÁ´¤Æ¤Î¥ì¥¸¥¹¥¿¤ò jmp_buf¤Ë
-³ÊǼ¤¹¤ë¤³¤È¤È¡¤jmp_buf¤È¥¹¥¿¥Ã¥¯¤¬32bit¥¢¥é¥¤¥ó¥á¥ó¥È¤µ¤ì¤Æ
-¤¤¤ë¤³¤È¤ò²¾Äꤷ¤Æ¤¤¤Þ¤¹¡¥ÆÃ¤ËÁ°¼Ô¤¬À®Î©¤·¤Ê¤¤¾ì¹ç¤ÎÂбþ¤ÏÈó
-¾ï¤Ëº¤Æñ¤Ç¤·¤ç¤¦¡¥¸å¼Ô¤Î²ò·è¤ÏÈæ³ÓŪ´Êñ¤Ç¡¤gc.c¤Ç¥¹¥¿¥Ã¥¯¤ò
-¥Þ¡¼¥¯¤·¤Æ¤¤¤ëÉôʬ¤Ë¥¢¥é¥¤¥ó¥á¥ó¥È¤Î¥Ð¥¤¥È¿ô¤À¤±¤º¤é¤·¤Æ¥Þ¡¼
-¥¯¤¹¤ë¥³¡¼¥É¤òÄɲ乤ë¤À¤±¤ÇºÑ¤ß¤Þ¤¹¡¥¡Ödefined(THINK_C)¡×¤Ç
-³ç¤é¤ì¤Æ¤¤¤ëÉôʬ¤ò»²¹Í¤Ë¤·¤Æ¤¯¤À¤µ¤¤
-
-# ¼ÂºÝ¤Ë¤ÏRuby¤ÏThink C¤Ç¤Ï¥³¥ó¥Ñ¥¤¥ë¤Ç¤­¤Þ¤»¤ó¡¥
+¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤¬setjmp()¤Þ¤¿¤Ïgetcontext()¤Ë¤è¤Ã¤ÆÁ´¤Æ¤Î¥ì
+¥¸¥¹¥¿¤òjmp_buf¤äucontext_t¤Ë³ÊǼ¤¹¤ë¤³¤È¤È¡¤jmp_buf¤ä
+ucontext_t¤È¥¹¥¿¥Ã¥¯¤¬32bit¥¢¥é¥¤¥ó¥á¥ó¥È¤µ¤ì¤Æ¤¤¤ë¤³¤È¤ò²¾Äê
+¤·¤Æ¤¤¤Þ¤¹¡¥ÆÃ¤ËÁ°¼Ô¤¬À®Î©¤·¤Ê¤¤¾ì¹ç¤ÎÂбþ¤ÏÈó¾ï¤Ëº¤Æñ¤Ç¤·¤ç
+¤¦¡¥¸å¼Ô¤Î²ò·è¤ÏÈæ³ÓŪ´Êñ¤Ç¡¤gc.c¤Ç¥¹¥¿¥Ã¥¯¤ò¥Þ¡¼¥¯¤·¤Æ¤¤¤ë
+Éôʬ¤Ë¥¢¥é¥¤¥ó¥á¥ó¥È¤Î¥Ð¥¤¥È¿ô¤À¤±¤º¤é¤·¤Æ¥Þ¡¼¥¯¤¹¤ë¥³¡¼¥É¤ò
+Äɲ乤ë¤À¤±¤ÇºÑ¤ß¤Þ¤¹¡¥¡Ödefined(__mc68000__)¡×¤Ç³ç¤é¤ì¤Æ¤¤
+¤ëÉôʬ¤ò»²¹Í¤Ë¤·¤Æ¤¯¤À¤µ¤¤¡¥
¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò»ý¤ÄCPU¤Ç¤Ï¡¤¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò¥¹¥¿¥Ã
¥¯¤Ë¥Õ¥é¥Ã¥·¥å¤¹¤ë¥¢¥»¥ó¥Ö¥é¥³¡¼¥É¤òÄɲ乤ëɬÍפ¬¤¢¤ë¤«¤âÃÎ
diff --git a/ToDo b/ToDo
index b55e399edf..7e5ef523a8 100644
--- a/ToDo
+++ b/ToDo
@@ -2,6 +2,10 @@ Language Spec.
- Class#allocate - basicNew
- class Foo::Bar<Baz .. end, module Boo::Bar .. end
+- raise exception by `` error
+- a +1 to be a+1, not a(+1).
+- clarify evaluation order of operator argument (=~, .., ...)
+- :symbol => value hash in the form of {symbol: value, ...} ??
* operator !! for rescue. ???
* objectify characters
* ../... outside condition invokes operator method too.
@@ -14,7 +18,6 @@ Language Spec.
* def Class#method .. end ??
* def Foo::Bar::baz() .. end ??
* I18N (or M17N) script/string/regexp
-* Fixnum 0 as false ????
* discourage use of symbol variables (e.g. $/, etc.) in manual
* discourage use of Perlish features by giving warnings.
* non confusing in-block local variable (is it possible?)
@@ -22,12 +25,9 @@ Language Spec.
+ variables appears within block may have independent values.
* Regexp: make /o thread safe.
* decide whether begin with rescue or ensure make do..while loop.
-* a +1 to be a+1, not a(+1).
* unify == and eql? again
* to_i returns nil if str contains no digit.
-* raise exception by `` error
* jar like combined library package. -> RubyGems?
-* resumable Exception via Exception#resume.
* method combination, e.g. before, after, around, etc.
* .. or something like defadvice in Emacs.
* property - for methods, or for objects in general.
@@ -35,8 +35,6 @@ Language Spec.
* selector namespace - something like generic-flet in CLOS, to help RubyBehavior
* private instance variable (as in Python?) @_foo in class Foo => @_Foo_foo
* warn/error "bare word" method, like "foo", you should type "foo()"
-* clarify evaluation order of operator argument (=~, .., ...)
-* :symbol => value hash in the form of {symbol: value, ...} ??
Hacking Interpreter
@@ -83,7 +81,7 @@ Standard Libraries
- use Mersenne Twister RNG for random.
- deprecate Array#indexes, and Array#indices.
- remove dependency on MAXPATHLEN.
-* String#scanf(?)
+- String#scanf(?)
* Object#fmt(?)
* Time::strptime
* Integer[num], Float[num]; Fixnum[num]?
@@ -117,7 +115,7 @@ Extension Libraries
Ruby Libraries
-* urllib.rb, nttplib.rb, etc.
+- urllib.rb, nttplib.rb, etc.
* format like perl's
Tools
diff --git a/addr2line.c b/addr2line.c
new file mode 100644
index 0000000000..219d1d4b47
--- /dev/null
+++ b/addr2line.c
@@ -0,0 +1,610 @@
+/**********************************************************************
+
+ addr2line.h -
+
+ $Author$
+
+ Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#include "ruby/config.h"
+#include "addr2line.h"
+
+#include <stdio.h>
+#include <errno.h>
+
+#ifdef USE_ELF
+
+#ifdef __OpenBSD__
+#include <elf_abi.h>
+#else
+#include <elf.h>
+#endif
+#include <fcntl.h>
+#include <limits.h>
+#include <stdio.h>
+#include <stdlib.h>
+#include <string.h>
+#include <sys/mman.h>
+#include <sys/types.h>
+#include <sys/stat.h>
+#include <unistd.h>
+
+#if defined(HAVE_ALLOCA_H)
+#include <alloca.h>
+#endif
+
+#ifdef HAVE_DL_ITERATE_PHDR
+# ifndef _GNU_SOURCE
+# define _GNU_SOURCE
+# endif
+# include <link.h>
+#endif
+
+#define DW_LNS_copy 0x01
+#define DW_LNS_advance_pc 0x02
+#define DW_LNS_advance_line 0x03
+#define DW_LNS_set_file 0x04
+#define DW_LNS_set_column 0x05
+#define DW_LNS_negate_stmt 0x06
+#define DW_LNS_set_basic_block 0x07
+#define DW_LNS_const_add_pc 0x08
+#define DW_LNS_fixed_advance_pc 0x09
+#define DW_LNS_set_prologue_end 0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin 0x0b /* DWARF3 */
+#define DW_LNS_set_isa 0x0c /* DWARF3 */
+
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence 0x01
+#define DW_LNE_set_address 0x02
+#define DW_LNE_define_file 0x03
+#define DW_LNE_set_discriminator 0x04 /* DWARF4 */
+
+#ifndef ElfW
+# if SIZEOF_VOIDP == 8
+# define ElfW(x) Elf64##_##x
+# else
+# define ElfW(x) Elf32##_##x
+# endif
+#endif
+
+typedef struct {
+ const char *dirname;
+ const char *filename;
+ int line;
+
+ int fd;
+ void *mapped;
+ size_t mapped_size;
+ unsigned long base_addr;
+} line_info_t;
+
+/* Avoid consuming stack as this module may be used from signal handler */
+static char binary_filename[PATH_MAX];
+
+static unsigned long
+uleb128(char **p) {
+ unsigned long r = 0;
+ int s = 0;
+ for (;;) {
+ unsigned char b = *(unsigned char *)(*p)++;
+ if (b < 0x80) {
+ r += (unsigned long)b << s;
+ break;
+ }
+ r += (b & 0x7f) << s;
+ s += 7;
+ }
+ return r;
+}
+
+static long
+sleb128(char **p) {
+ long r = 0;
+ int s = 0;
+ for (;;) {
+ unsigned char b = *(unsigned char *)(*p)++;
+ if (b < 0x80) {
+ if (b & 0x40) {
+ r -= (0x80 - b) << s;
+ }
+ else {
+ r += (b & 0x3f) << s;
+ }
+ break;
+ }
+ r += (b & 0x7f) << s;
+ s += 7;
+ }
+ return r;
+}
+
+static const char *
+get_nth_dirname(unsigned long dir, char *p)
+{
+ if (!dir--) {
+ return "";
+ }
+ while (dir--) {
+ while (*p) p++;
+ p++;
+ if (!*p) {
+ fprintf(stderr, "Unexpected directory number %lu in %s\n",
+ dir, binary_filename);
+ return "";
+ }
+ }
+ return p;
+}
+
+static void
+fill_filename(int file, char *include_directories, char *filenames,
+ line_info_t *line)
+{
+ int i;
+ char *p = filenames;
+ char *filename;
+ unsigned long dir;
+ for (i = 1; i <= file; i++) {
+ filename = p;
+ if (!*p) {
+ /* Need to output binary file name? */
+ fprintf(stderr, "Unexpected file number %d in %s\n",
+ file, binary_filename);
+ return;
+ }
+ while (*p) p++;
+ p++;
+ dir = uleb128(&p);
+ /* last modified. */
+ uleb128(&p);
+ /* size of the file. */
+ uleb128(&p);
+
+ if (i == file) {
+ line->filename = filename;
+ line->dirname = get_nth_dirname(dir, include_directories);
+ }
+ }
+}
+
+static int
+get_path_from_symbol(const char *symbol, const char **p, size_t *len)
+{
+ if (symbol[0] == '0') {
+ /* libexecinfo */
+ *p = strchr(symbol, '/');
+ if (*p == NULL) return 0;
+ *len = strlen(*p);
+ }
+ else {
+ /* glibc */
+ const char *q;
+ *p = symbol;
+ q = strchr(symbol, '(');
+ if (q == NULL) return 0;
+ *len = q - symbol;
+ }
+ return 1;
+}
+
+static void
+fill_line(int num_traces, void **traces,
+ unsigned long addr, int file, int line,
+ char *include_directories, char *filenames, line_info_t *lines)
+{
+ int i;
+ for (i = 0; i < num_traces; i++) {
+ unsigned long a = (unsigned long)traces[i] - lines[i].base_addr;
+ /* We assume one line code doesn't result >100 bytes of native code.
+ We may want more reliable way eventually... */
+ if (addr < a && a < addr + 100) {
+ fill_filename(file, include_directories, filenames, &lines[i]);
+ lines[i].line = line;
+ }
+ }
+}
+
+static void
+parse_debug_line_cu(int num_traces, void **traces,
+ char **debug_line, line_info_t *lines)
+{
+ char *p, *cu_end, *cu_start, *include_directories, *filenames;
+ unsigned long unit_length;
+ int default_is_stmt, line_base;
+ unsigned int header_length, minimum_instruction_length, line_range,
+ opcode_base;
+ unsigned char *standard_opcode_lengths;
+
+ /* The registers. */
+ unsigned long addr = 0;
+ unsigned int file = 1;
+ unsigned int line = 1;
+ unsigned int column = 0;
+ int is_stmt;
+ int basic_block = 0;
+ int end_sequence = 0;
+ int prologue_end = 0;
+ int epilogue_begin = 0;
+ unsigned int isa = 0;
+
+ p = *debug_line;
+
+ unit_length = *(unsigned int *)p;
+ p += sizeof(unsigned int);
+ if (unit_length == 0xffffffff) {
+ unit_length = *(unsigned long *)p;
+ p += sizeof(unsigned long);
+ }
+
+ cu_end = p + unit_length;
+
+ /*dwarf_version = *(unsigned short *)p;*/
+ p += 2;
+
+ header_length = *(unsigned int *)p;
+ p += sizeof(unsigned int);
+
+ cu_start = p + header_length;
+
+ minimum_instruction_length = *(unsigned char *)p;
+ p++;
+
+ is_stmt = default_is_stmt = *(unsigned char *)p;
+ p++;
+
+ line_base = *(char *)p;
+ p++;
+
+ line_range = *(unsigned char *)p;
+ p++;
+
+ opcode_base = *(unsigned char *)p;
+ p++;
+
+ standard_opcode_lengths = (unsigned char *)p - 1;
+ p += opcode_base - 1;
+
+ include_directories = p;
+
+ /* skip include directories */
+ while (*p) {
+ while (*p) p++;
+ p++;
+ }
+ p++;
+
+ filenames = p;
+
+ p = cu_start;
+
+#define FILL_LINE() \
+ do { \
+ fill_line(num_traces, traces, addr, file, line, \
+ include_directories, filenames, lines); \
+ basic_block = prologue_end = epilogue_begin = 0; \
+ } while (0)
+
+ while (p < cu_end) {
+ unsigned long a;
+ unsigned char op = *p++;
+ switch (op) {
+ case DW_LNS_copy:
+ FILL_LINE();
+ break;
+ case DW_LNS_advance_pc:
+ a = uleb128(&p);
+ addr += a;
+ break;
+ case DW_LNS_advance_line: {
+ long a = sleb128(&p);
+ line += a;
+ break;
+ }
+ case DW_LNS_set_file:
+ file = (unsigned int)uleb128(&p);
+ break;
+ case DW_LNS_set_column:
+ column = (unsigned int)uleb128(&p);
+ break;
+ case DW_LNS_negate_stmt:
+ is_stmt = !is_stmt;
+ break;
+ case DW_LNS_set_basic_block:
+ basic_block = 1;
+ break;
+ case DW_LNS_const_add_pc:
+ a = ((255 - opcode_base) / line_range) *
+ minimum_instruction_length;
+ addr += a;
+ break;
+ case DW_LNS_fixed_advance_pc:
+ a = *(unsigned char *)p++;
+ addr += a;
+ break;
+ case DW_LNS_set_prologue_end:
+ prologue_end = 1;
+ break;
+ case DW_LNS_set_epilogue_begin:
+ epilogue_begin = 1;
+ break;
+ case DW_LNS_set_isa:
+ isa = (unsigned int)uleb128(&p);
+ break;
+ case 0:
+ a = *(unsigned char *)p++;
+ op = *p++;
+ switch (op) {
+ case DW_LNE_end_sequence:
+ end_sequence = 1;
+ FILL_LINE();
+ addr = 0;
+ file = 1;
+ line = 1;
+ column = 0;
+ is_stmt = default_is_stmt;
+ end_sequence = 0;
+ isa = 0;
+ break;
+ case DW_LNE_set_address:
+ addr = *(unsigned long *)p;
+ p += sizeof(unsigned long);
+ break;
+ case DW_LNE_define_file:
+ fprintf(stderr, "Unsupported operation in %s\n",
+ binary_filename);
+ break;
+ case DW_LNE_set_discriminator:
+ /* TODO:currently ignore */
+ uleb128(&p);
+ break;
+ default:
+ fprintf(stderr, "Unknown extended opcode: %d in %s\n",
+ op, binary_filename);
+ }
+ break;
+ default: {
+ unsigned long addr_incr;
+ unsigned long line_incr;
+ a = op - opcode_base;
+ addr_incr = (a / line_range) * minimum_instruction_length;
+ line_incr = line_base + (a % line_range);
+ addr += (unsigned int)addr_incr;
+ line += (unsigned int)line_incr;
+ FILL_LINE();
+ }
+ }
+ }
+ *debug_line = p;
+}
+
+static void
+parse_debug_line(int num_traces, void **traces,
+ char *debug_line, unsigned long size, line_info_t *lines)
+{
+ char *debug_line_end = debug_line + size;
+ while (debug_line < debug_line_end) {
+ parse_debug_line_cu(num_traces, traces, &debug_line, lines);
+ }
+ if (debug_line != debug_line_end) {
+ fprintf(stderr, "Unexpected size of .debug_line in %s\n",
+ binary_filename);
+ }
+}
+
+/* read file and fill lines */
+static void
+fill_lines(int num_traces, void **traces, char **syms, int check_debuglink,
+ line_info_t *current_line, line_info_t *lines);
+
+static void
+follow_debuglink(char *debuglink, int num_traces, void **traces, char **syms,
+ line_info_t *current_line, line_info_t *lines)
+{
+ /* Ideally we should check 4 paths to follow gnu_debuglink,
+ but we handle only one case for now as this format is used
+ by some linux distributions. See GDB's info for detail. */
+ static const char global_debug_dir[] = "/usr/lib/debug";
+ char *p, *subdir;
+
+ p = strrchr(binary_filename, '/');
+ if (!p) {
+ return;
+ }
+ p[1] = '\0';
+
+ subdir = (char *)alloca(strlen(binary_filename) + 1);
+ strcpy(subdir, binary_filename);
+ strcpy(binary_filename, global_debug_dir);
+ strncat(binary_filename, subdir,
+ PATH_MAX - strlen(binary_filename) - 1);
+ strncat(binary_filename, debuglink,
+ PATH_MAX - strlen(binary_filename) - 1);
+
+ munmap(current_line->mapped, current_line->mapped_size);
+ close(current_line->fd);
+ fill_lines(num_traces, traces, syms, 0, current_line, lines);
+}
+
+/* read file and fill lines */
+static void
+fill_lines(int num_traces, void **traces, char **syms, int check_debuglink,
+ line_info_t *current_line, line_info_t *lines)
+{
+ int i;
+ char *shstr;
+ char *section_name;
+ ElfW(Ehdr) *ehdr;
+ ElfW(Shdr) *shdr, *shstr_shdr;
+ ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
+ int fd;
+ off_t filesize;
+ char *file;
+
+ fd = open(binary_filename, O_RDONLY);
+ if (fd < 0) {
+ return;
+ }
+ filesize = lseek(fd, 0, SEEK_END);
+ if (filesize < 0) {
+ int e = errno;
+ close(fd);
+ fprintf(stderr, "lseek: %s\n", strerror(e));
+ return;
+ }
+ lseek(fd, 0, SEEK_SET);
+ /* async-signal unsafe */
+ file = (char *)mmap(NULL, filesize, PROT_READ, MAP_SHARED, fd, 0);
+ if (file == MAP_FAILED) {
+ int e = errno;
+ close(fd);
+ fprintf(stderr, "mmap: %s\n", strerror(e));
+ return;
+ }
+
+ current_line->fd = fd;
+ current_line->mapped = file;
+ current_line->mapped_size = filesize;
+
+ for (i = 0; i < num_traces; i++) {
+ const char *path;
+ size_t len;
+ if (get_path_from_symbol(syms[i], &path, &len) &&
+ !strncmp(path, binary_filename, len)) {
+ lines[i].line = -1;
+ }
+ }
+
+ ehdr = (ElfW(Ehdr) *)file;
+ shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
+
+ shstr_shdr = shdr + ehdr->e_shstrndx;
+ shstr = file + shstr_shdr->sh_offset;
+
+ for (i = 0; i < ehdr->e_shnum; i++) {
+ section_name = shstr + shdr[i].sh_name;
+ if (!strcmp(section_name, ".debug_line")) {
+ debug_line_shdr = shdr + i;
+ break;
+ } else if (!strcmp(section_name, ".gnu_debuglink")) {
+ gnu_debuglink_shdr = shdr + i;
+ }
+ }
+
+ if (!debug_line_shdr) {
+ /* This file doesn't have .debug_line section,
+ let's check .gnu_debuglink section instead. */
+ if (gnu_debuglink_shdr && check_debuglink) {
+ follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
+ num_traces, traces, syms,
+ current_line, lines);
+ }
+ return;
+ }
+
+ parse_debug_line(num_traces, traces,
+ file + debug_line_shdr->sh_offset,
+ debug_line_shdr->sh_size,
+ lines);
+}
+
+#ifdef HAVE_DL_ITERATE_PHDR
+
+typedef struct {
+ int num_traces;
+ char **syms;
+ line_info_t *lines;
+} fill_base_addr_state_t;
+
+static int
+fill_base_addr(struct dl_phdr_info *info, size_t size, void *data)
+{
+ int i;
+ fill_base_addr_state_t *st = (fill_base_addr_state_t *)data;
+ for (i = 0; i < st->num_traces; i++) {
+ const char *path;
+ size_t len;
+ size_t name_len = strlen(info->dlpi_name);
+
+ if (get_path_from_symbol(st->syms[i], &path, &len) &&
+ (len == name_len || (len > name_len && path[len-name_len-1] == '/')) &&
+ !strncmp(path+len-name_len, info->dlpi_name, name_len)) {
+ st->lines[i].base_addr = info->dlpi_addr;
+ }
+ }
+ return 0;
+}
+
+#endif /* HAVE_DL_ITERATE_PHDR */
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **trace, char **syms)
+{
+ int i;
+ /* async-signal unsafe */
+ line_info_t *lines = (line_info_t *)calloc(num_traces,
+ sizeof(line_info_t));
+
+ /* Note that line info of shared objects might not be shown
+ if we don't have dl_iterate_phdr */
+#ifdef HAVE_DL_ITERATE_PHDR
+ fill_base_addr_state_t fill_base_addr_state;
+
+ fill_base_addr_state.num_traces = num_traces;
+ fill_base_addr_state.syms = syms;
+ fill_base_addr_state.lines = lines;
+ /* maybe async-signal unsafe */
+ dl_iterate_phdr(fill_base_addr, &fill_base_addr_state);
+#endif /* HAVE_DL_ITERATE_PHDR */
+
+ for (i = 0; i < num_traces; i++) {
+ const char *path;
+ size_t len;
+ if (lines[i].line) {
+ continue;
+ }
+
+ if (!get_path_from_symbol(syms[i], &path, &len)) {
+ continue;
+ }
+
+ strncpy(binary_filename, path, len);
+ binary_filename[len] = '\0';
+
+ fill_lines(num_traces, trace, syms, 1, &lines[i], lines);
+ }
+
+ /* fprintf may not be async-signal safe */
+ for (i = 0; i < num_traces; i++) {
+ line_info_t *line = &lines[i];
+
+ if (line->line > 0) {
+ fprintf(stderr, "%s ", syms[i]);
+ if (line->filename) {
+ if (line->dirname && line->dirname[0]) {
+ fprintf(stderr, "%s/", line->dirname);
+ }
+ fprintf(stderr, "%s", line->filename);
+ } else {
+ fprintf(stderr, "???");
+ }
+ fprintf(stderr, ":%d\n", line->line);
+ } else {
+ fprintf(stderr, "%s\n", syms[i]);
+ }
+ }
+
+ for (i = 0; i < num_traces; i++) {
+ line_info_t *line = &lines[i];
+ if (line->fd) {
+ munmap(line->mapped, line->mapped_size);
+ close(line->fd);
+ }
+ }
+ free(lines);
+}
+
+#else /* defined(USE_ELF) */
+#error not supported
+#endif
diff --git a/addr2line.h b/addr2line.h
new file mode 100644
index 0000000000..3782d89e07
--- /dev/null
+++ b/addr2line.h
@@ -0,0 +1,21 @@
+/**********************************************************************
+
+ addr2line.h -
+
+ $Author$
+
+ Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
+
+#ifdef USE_ELF
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces, char **syms);
+
+#endif /* USE_ELF */
+
+#endif /* RUBY_ADDR2LINE_H */
diff --git a/array.c b/array.c
index d456373fe4..e427cb3320 100644
--- a/array.c
+++ b/array.c
@@ -2,29 +2,37 @@
array.c -
- $Author: akr $
- $Date: 2006/06/24 14:53:36 $
+ $Author$
created at: Fri Aug 6 09:46:12 JST 1993
- Copyright (C) 1993-2003 Yukihiro Matsumoto
+ Copyright (C) 1993-2007 Yukihiro Matsumoto
Copyright (C) 2000 Network Applied Communication Laboratory, Inc.
Copyright (C) 2000 Information-technology Promotion Agency, Japan
**********************************************************************/
-#include "ruby.h"
-#include "util.h"
-#include "st.h"
+#include "ruby/ruby.h"
+#include "ruby/util.h"
+#include "ruby/st.h"
+#include "ruby/encoding.h"
+#include "internal.h"
+
+#ifndef ARRAY_DEBUG
+# define NDEBUG
+#endif
+#include <assert.h>
+
+#define numberof(array) (int)(sizeof(array) / sizeof((array)[0]))
VALUE rb_cArray;
+
static ID id_cmp;
#define ARY_DEFAULT_SIZE 16
+#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
void
-rb_mem_clear(mem, size)
- register VALUE *mem;
- register long size;
+rb_mem_clear(register VALUE *mem, register long size)
{
while (size--) {
*mem++ = Qnil;
@@ -32,134 +40,311 @@ rb_mem_clear(mem, size)
}
static inline void
-memfill(mem, size, val)
- register VALUE *mem;
- register long size;
- register VALUE val;
+memfill(register VALUE *mem, register long size, register VALUE val)
{
while (size--) {
*mem++ = val;
}
}
-#define ARY_TMPLOCK FL_USER1
+# define ARY_SHARED_P(ary) \
+ (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+ FL_TEST((ary),ELTS_SHARED)!=0)
+# define ARY_EMBED_P(ary) \
+ (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+ FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
+
+#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
+#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
+#define ARY_EMBED_LEN(a) \
+ (assert(ARY_EMBED_P(a)), \
+ (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
+ (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+
+#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
+#define FL_SET_EMBED(a) do { \
+ assert(!ARY_SHARED_P(a)); \
+ assert(!OBJ_FROZEN(a)); \
+ FL_SET((a), RARRAY_EMBED_FLAG); \
+} while (0)
+#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
+#define FL_SET_SHARED(ary) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ FL_SET((ary), ELTS_SHARED); \
+} while (0)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
+
+#define ARY_SET_PTR(ary, p) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ RARRAY(ary)->as.heap.ptr = (p); \
+} while (0)
+#define ARY_SET_EMBED_LEN(ary, n) do { \
+ long tmp_n = (n); \
+ assert(ARY_EMBED_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
+ RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
+} while (0)
+#define ARY_SET_HEAP_LEN(ary, n) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ RARRAY(ary)->as.heap.len = (n); \
+} while (0)
+#define ARY_SET_LEN(ary, n) do { \
+ if (ARY_EMBED_P(ary)) { \
+ ARY_SET_EMBED_LEN((ary), (n)); \
+ } \
+ else { \
+ ARY_SET_HEAP_LEN((ary), (n)); \
+ } \
+ assert(RARRAY_LEN(ary) == (n)); \
+} while (0)
+#define ARY_INCREASE_PTR(ary, n) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ RARRAY(ary)->as.heap.ptr += (n); \
+} while (0)
+#define ARY_INCREASE_LEN(ary, n) do { \
+ assert(!OBJ_FROZEN(ary)); \
+ if (ARY_EMBED_P(ary)) { \
+ ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
+ } \
+ else { \
+ RARRAY(ary)->as.heap.len += (n); \
+ } \
+} while (0)
+
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
+ ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SET_CAPA(ary, n) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ assert(!ARY_SHARED_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ RARRAY(ary)->as.heap.aux.capa = (n); \
+} while (0)
+
+#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
+#define ARY_SET_SHARED(ary, value) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ assert(ARY_SHARED_P(ary)); \
+ assert(ARY_SHARED_ROOT_P(value)); \
+ RARRAY(ary)->as.heap.aux.shared = (value); \
+} while (0)
+#define RARRAY_SHARED_ROOT_FLAG FL_USER5
+#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
+#define ARY_SHARED_NUM(ary) \
+ (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SET_SHARED_NUM(ary, value) do { \
+ assert(ARY_SHARED_ROOT_P(ary)); \
+ RARRAY(ary)->as.heap.aux.capa = (value); \
+} while (0)
+#define FL_SET_SHARED_ROOT(ary) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
+} while (0)
+
+static void
+ary_resize_capa(VALUE ary, long capacity)
+{
+ assert(RARRAY_LEN(ary) <= capacity);
+ assert(!OBJ_FROZEN(ary));
+ assert(!ARY_SHARED_P(ary));
+ if (capacity > RARRAY_EMBED_LEN_MAX) {
+ if (ARY_EMBED_P(ary)) {
+ long len = ARY_EMBED_LEN(ary);
+ VALUE *ptr = ALLOC_N(VALUE, (capacity));
+ MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
+ FL_UNSET_EMBED(ary);
+ ARY_SET_PTR(ary, ptr);
+ ARY_SET_HEAP_LEN(ary, len);
+ }
+ else {
+ REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, (capacity));
+ }
+ ARY_SET_CAPA(ary, (capacity));
+ }
+ else {
+ if (!ARY_EMBED_P(ary)) {
+ long len = RARRAY_LEN(ary);
+ VALUE *ptr = RARRAY_PTR(ary);
+ if (len > capacity) len = capacity;
+ MEMCPY(RARRAY(ary)->as.ary, ptr, VALUE, len);
+ FL_SET_EMBED(ary);
+ ARY_SET_LEN(ary, len);
+ xfree(ptr);
+ }
+ }
+}
+
+static void
+ary_double_capa(VALUE ary, long min)
+{
+ long new_capa = ARY_CAPA(ary) / 2;
+
+ if (new_capa < ARY_DEFAULT_SIZE) {
+ new_capa = ARY_DEFAULT_SIZE;
+ }
+ if (new_capa >= ARY_MAX_SIZE - min) {
+ new_capa = (ARY_MAX_SIZE - min) / 2;
+ }
+ new_capa += min;
+ ary_resize_capa(ary, new_capa);
+}
+
+static void
+rb_ary_decrement_share(VALUE shared)
+{
+ if (shared) {
+ long num = ARY_SHARED_NUM(shared) - 1;
+ if (num == 0) {
+ rb_ary_free(shared);
+ rb_gc_force_recycle(shared);
+ }
+ else if (num > 0) {
+ ARY_SET_SHARED_NUM(shared, num);
+ }
+ }
+}
+
+static void
+rb_ary_unshare(VALUE ary)
+{
+ VALUE shared = RARRAY(ary)->as.heap.aux.shared;
+ rb_ary_decrement_share(shared);
+ FL_UNSET_SHARED(ary);
+}
static inline void
-rb_ary_modify_check(ary)
- VALUE ary;
+rb_ary_unshare_safe(VALUE ary)
{
- if (OBJ_FROZEN(ary)) rb_error_frozen("array");
- if (FL_TEST(ary, ARY_TMPLOCK))
- rb_raise(rb_eRuntimeError, "can't modify array during iteration");
- if (!OBJ_TAINTED(ary) && rb_safe_level() >= 4)
- rb_raise(rb_eSecurityError, "Insecure: can't modify array");
+ if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+ rb_ary_unshare(ary);
+ }
+}
+
+static VALUE
+rb_ary_increment_share(VALUE shared)
+{
+ long num = ARY_SHARED_NUM(shared);
+ if (num >= 0) {
+ ARY_SET_SHARED_NUM(shared, num + 1);
+ }
+ return shared;
}
static void
-rb_ary_modify(ary)
- VALUE ary;
+rb_ary_set_shared(VALUE ary, VALUE shared)
+{
+ rb_ary_increment_share(shared);
+ FL_SET_SHARED(ary);
+ ARY_SET_SHARED(ary, shared);
+}
+
+static inline void
+rb_ary_modify_check(VALUE ary)
{
- VALUE *ptr;
+ rb_check_frozen(ary);
+ if (!OBJ_UNTRUSTED(ary) && rb_safe_level() >= 4)
+ rb_raise(rb_eSecurityError, "Insecure: can't modify array");
+}
+void
+rb_ary_modify(VALUE ary)
+{
rb_ary_modify_check(ary);
- if (FL_TEST(ary, ELTS_SHARED)) {
- ptr = ALLOC_N(VALUE, RARRAY(ary)->len);
- FL_UNSET(ary, ELTS_SHARED);
- RARRAY(ary)->aux.capa = RARRAY(ary)->len;
- MEMCPY(ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
- RARRAY(ary)->ptr = ptr;
+ if (ARY_SHARED_P(ary)) {
+ long len = RARRAY_LEN(ary);
+ if (len <= RARRAY_EMBED_LEN_MAX) {
+ VALUE *ptr = ARY_HEAP_PTR(ary);
+ VALUE shared = ARY_SHARED(ary);
+ FL_UNSET_SHARED(ary);
+ FL_SET_EMBED(ary);
+ MEMCPY(ARY_EMBED_PTR(ary), ptr, VALUE, len);
+ rb_ary_decrement_share(shared);
+ ARY_SET_EMBED_LEN(ary, len);
+ }
+ else {
+ VALUE *ptr = ALLOC_N(VALUE, len);
+ MEMCPY(ptr, RARRAY_PTR(ary), VALUE, len);
+ rb_ary_unshare(ary);
+ ARY_SET_CAPA(ary, len);
+ ARY_SET_PTR(ary, ptr);
+ }
}
}
VALUE
-rb_ary_freeze(ary)
- VALUE ary;
+rb_ary_freeze(VALUE ary)
{
return rb_obj_freeze(ary);
}
/*
* call-seq:
- * array.frozen? -> true or false
+ * ary.frozen? -> true or false
*
* Return <code>true</code> if this array is frozen (or temporarily frozen
* while being sorted).
*/
static VALUE
-rb_ary_frozen_p(ary)
- VALUE ary;
+rb_ary_frozen_p(VALUE ary)
{
if (OBJ_FROZEN(ary)) return Qtrue;
- if (FL_TEST(ary, ARY_TMPLOCK)) return Qtrue;
return Qfalse;
}
-static VALUE ary_alloc _((VALUE));
static VALUE
-ary_alloc(klass)
- VALUE klass;
+ary_alloc(VALUE klass)
{
NEWOBJ(ary, struct RArray);
OBJSETUP(ary, klass, T_ARRAY);
-
- ary->len = 0;
- ary->ptr = 0;
- ary->aux.capa = 0;
+ FL_SET_EMBED((VALUE)ary);
+ ARY_SET_EMBED_LEN((VALUE)ary, 0);
return (VALUE)ary;
}
static VALUE
-ary_new(klass, len)
- VALUE klass;
- long len;
+ary_new(VALUE klass, long capa)
{
- VALUE ary = ary_alloc(klass);
+ VALUE ary;
- if (len < 0) {
+ if (capa < 0) {
rb_raise(rb_eArgError, "negative array size (or size too big)");
}
- if (len > 0 && len * sizeof(VALUE) <= len) {
+ if (capa > ARY_MAX_SIZE) {
rb_raise(rb_eArgError, "array size too big");
}
- if (len == 0) len++;
- RARRAY(ary)->ptr = ALLOC_N(VALUE, len);
- RARRAY(ary)->aux.capa = len;
+ ary = ary_alloc(klass);
+ if (capa > RARRAY_EMBED_LEN_MAX) {
+ FL_UNSET_EMBED(ary);
+ ARY_SET_PTR(ary, ALLOC_N(VALUE, capa));
+ ARY_SET_CAPA(ary, capa);
+ ARY_SET_HEAP_LEN(ary, 0);
+ }
return ary;
}
VALUE
-rb_ary_new2(len)
- long len;
+rb_ary_new2(long capa)
{
- return ary_new(rb_cArray, len);
+ return ary_new(rb_cArray, capa);
}
VALUE
-rb_ary_new()
+rb_ary_new(void)
{
- return rb_ary_new2(ARY_DEFAULT_SIZE);
+ return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
}
-#ifdef HAVE_STDARG_PROTOTYPES
#include <stdarg.h>
-#define va_init_list(a,b) va_start(a,b)
-#else
-#include <varargs.h>
-#define va_init_list(a,b) va_start(a)
-#endif
VALUE
-#ifdef HAVE_STDARG_PROTOTYPES
rb_ary_new3(long n, ...)
-#else
-rb_ary_new3(n, va_alist)
- long n;
- va_dcl
-#endif
{
va_list ar;
VALUE ary;
@@ -167,63 +352,152 @@ rb_ary_new3(n, va_alist)
ary = rb_ary_new2(n);
- va_init_list(ar, n);
+ va_start(ar, n);
for (i=0; i<n; i++) {
- RARRAY(ary)->ptr[i] = va_arg(ar, VALUE);
+ RARRAY_PTR(ary)[i] = va_arg(ar, VALUE);
}
va_end(ar);
- RARRAY(ary)->len = n;
+ ARY_SET_LEN(ary, n);
return ary;
}
VALUE
-rb_ary_new4(n, elts)
- long n;
- const VALUE *elts;
+rb_ary_new4(long n, const VALUE *elts)
{
VALUE ary;
ary = rb_ary_new2(n);
if (n > 0 && elts) {
- MEMCPY(RARRAY(ary)->ptr, elts, VALUE, n);
+ MEMCPY(RARRAY_PTR(ary), elts, VALUE, n);
+ ARY_SET_LEN(ary, n);
}
- /* This assignment to len will be moved to the above "if" block in Ruby 1.9 */
- RARRAY(ary)->len = n;
-
return ary;
}
VALUE
-rb_assoc_new(car, cdr)
- VALUE car, cdr;
+rb_ary_tmp_new(long capa)
{
- VALUE ary;
+ return ary_new(0, capa);
+}
- ary = rb_ary_new2(2);
- RARRAY(ary)->ptr[0] = car;
- RARRAY(ary)->ptr[1] = cdr;
- RARRAY(ary)->len = 2;
+void
+rb_ary_free(VALUE ary)
+{
+ if (ARY_OWNS_HEAP_P(ary)) {
+ xfree(ARY_HEAP_PTR(ary));
+ }
+}
- return ary;
+RUBY_FUNC_EXPORTED size_t
+rb_ary_memsize(VALUE ary)
+{
+ if (ARY_OWNS_HEAP_P(ary)) {
+ return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
+ }
+ else {
+ return 0;
+ }
+}
+
+static inline void
+ary_discard(VALUE ary)
+{
+ rb_ary_free(ary);
+ RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
+ RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
}
static VALUE
-to_ary(ary)
- VALUE ary;
+ary_make_shared(VALUE ary)
+{
+ assert(!ARY_EMBED_P(ary));
+ if (ARY_SHARED_P(ary)) {
+ return ARY_SHARED(ary);
+ }
+ else if (ARY_SHARED_ROOT_P(ary)) {
+ return ary;
+ }
+ else if (OBJ_FROZEN(ary)) {
+ ary_resize_capa(ary, ARY_HEAP_LEN(ary));
+ FL_SET_SHARED_ROOT(ary);
+ ARY_SET_SHARED_NUM(ary, 1);
+ return ary;
+ }
+ else {
+ NEWOBJ(shared, struct RArray);
+ OBJSETUP(shared, 0, T_ARRAY);
+ FL_UNSET_EMBED(shared);
+
+ ARY_SET_LEN((VALUE)shared, RARRAY_LEN(ary));
+ ARY_SET_PTR((VALUE)shared, RARRAY_PTR(ary));
+ FL_SET_SHARED_ROOT(shared);
+ ARY_SET_SHARED_NUM((VALUE)shared, 1);
+ FL_SET_SHARED(ary);
+ ARY_SET_SHARED(ary, (VALUE)shared);
+ OBJ_FREEZE(shared);
+ return (VALUE)shared;
+ }
+}
+
+
+static VALUE
+ary_make_substitution(VALUE ary)
+{
+ if (RARRAY_LEN(ary) <= RARRAY_EMBED_LEN_MAX) {
+ VALUE subst = rb_ary_new2(RARRAY_LEN(ary));
+ MEMCPY(ARY_EMBED_PTR(subst), RARRAY_PTR(ary), VALUE, RARRAY_LEN(ary));
+ ARY_SET_EMBED_LEN(subst, RARRAY_LEN(ary));
+ return subst;
+ }
+ else {
+ return rb_ary_increment_share(ary_make_shared(ary));
+ }
+}
+
+VALUE
+rb_assoc_new(VALUE car, VALUE cdr)
+{
+ return rb_ary_new3(2, car, cdr);
+}
+
+static VALUE
+to_ary(VALUE ary)
{
return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
}
VALUE
-rb_check_array_type(ary)
- VALUE ary;
+rb_check_array_type(VALUE ary)
{
return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
}
-static VALUE rb_ary_replace _((VALUE, VALUE));
+/*
+ * call-seq:
+ * Array.try_convert(obj) -> array or nil
+ *
+ * Tries to convert +obj+ into an array, using +to_ary+ method. Returns the
+ * converted array or +nil+ if +obj+ cannot be converted for any reason.
+ * This method can be used to check if an argument is an array.
+ *
+ * Array.try_convert([1]) #=> [1]
+ * Array.try_convert("1") #=> nil
+ *
+ * if tmp = Array.try_convert(arg)
+ * # the argument is an array
+ * elsif tmp = String.try_convert(arg)
+ * # the argument is a string
+ * end
+ *
+ */
+
+static VALUE
+rb_ary_s_try_convert(VALUE dummy, VALUE ary)
+{
+ return rb_check_array_type(ary);
+}
/*
* call-seq:
@@ -231,55 +505,76 @@ static VALUE rb_ary_replace _((VALUE, VALUE));
* Array.new(array)
* Array.new(size) {|index| block }
*
- * Returns a new array. In the first form, the new array is
- * empty. In the second it is created with _size_ copies of _obj_
- * (that is, _size_ references to the same
- * _obj_). The third form creates a copy of the array
- * passed as a parameter (the array is generated by calling
- * to_ary on the parameter). In the last form, an array
- * of the given size is created. Each element in this array is
- * calculated by passing the element's index to the given block and
- * storing the return value.
- *
- * Array.new
- * Array.new(2)
- * Array.new(5, "A")
- *
- * # only one copy of the object is created
+ * Returns a new array.
+ *
+ * In the first form, if no arguments are sent, the new array will be empty.
+ * When a +size+ and an optional +obj+ are sent, an array is created with
+ * +size+ copies of +obj+. Take notice that all elements will reference the
+ * same object +obj+.
+ *
+ * The second form creates a copy of the array passed as a parameter (the
+ * array is generated by calling to_ary on the parameter).
+ *
+ * first_array = ["Matz", "Guido"]
+ *
+ * second_array = Array.new(first_array) #=> ["Matz", "Guido"]
+ *
+ * first_array.equal? second_array #=> false
+ *
+ * In the last form, an array of the given size is created. Each element in
+ * this array is created by passing the element's index to the given block
+ * and storing the return value.
+ *
+ * Array.new(3){ |index| index ** 2 }
+ * # => [0, 1, 4]
+ *
+ * == Common gotchas
+ *
+ * When sending the second parameter, the same object will be used as the
+ * value for all the array elements:
+ *
* a = Array.new(2, Hash.new)
+ * # => [{}, {}]
+ *
* a[0]['cat'] = 'feline'
- * a
+ * a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
+ *
* a[1]['cat'] = 'Felix'
- * a
- *
- * # here multiple copies are created
+ * a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
+ *
+ * Since all the Array elements store the same hash, changes to one of them
+ * will affect them all.
+ *
+ * If multiple copies are what you want, you should use the block
+ * version which uses the result of that block each time an element
+ * of the array needs to be initialized:
+ *
* a = Array.new(2) { Hash.new }
* a[0]['cat'] = 'feline'
- * a
- *
- * squares = Array.new(5) {|i| i*i}
- * squares
- *
- * copy = Array.new(squares)
+ * a # => [{"cat"=>"feline"}, {}]
+ *
*/
static VALUE
-rb_ary_initialize(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
{
long len;
VALUE size, val;
- if (rb_scan_args(argc, argv, "02", &size, &val) == 0) {
- RARRAY(ary)->len = 0;
+ rb_ary_modify(ary);
+ if (argc == 0) {
+ if (ARY_OWNS_HEAP_P(ary) && RARRAY_PTR(ary)) {
+ xfree(RARRAY_PTR(ary));
+ }
+ rb_ary_unshare_safe(ary);
+ FL_SET_EMBED(ary);
+ ARY_SET_EMBED_LEN(ary, 0);
if (rb_block_given_p()) {
rb_warning("given block not used");
}
return ary;
}
-
+ rb_scan_args(argc, argv, "02", &size, &val);
if (argc == 1 && !FIXNUM_P(size)) {
val = rb_check_array_type(size);
if (!NIL_P(val)) {
@@ -292,14 +587,11 @@ rb_ary_initialize(argc, argv, ary)
if (len < 0) {
rb_raise(rb_eArgError, "negative array size");
}
- if (len > 0 && len * (long)sizeof(VALUE) <= len) {
+ if (len > ARY_MAX_SIZE) {
rb_raise(rb_eArgError, "array size too big");
}
rb_ary_modify(ary);
- if (len > RARRAY(ary)->aux.capa) {
- REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
- RARRAY(ary)->aux.capa = len;
- }
+ ary_resize_capa(ary, len);
if (rb_block_given_p()) {
long i;
@@ -308,20 +600,19 @@ rb_ary_initialize(argc, argv, ary)
}
for (i=0; i<len; i++) {
rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
- RARRAY(ary)->len = i + 1;
+ ARY_SET_LEN(ary, i + 1);
}
}
else {
- memfill(RARRAY(ary)->ptr, len, val);
- RARRAY(ary)->len = len;
+ memfill(RARRAY_PTR(ary), len, val);
+ ARY_SET_LEN(ary, len);
}
-
return ary;
}
-/*
-* Returns a new array populated with the given objects.
+/*
+* Returns a new array populated with the given objects.
*
* Array.[]( 1, 'a', /^A/ )
* Array[ 1, 'a', /^A/ ]
@@ -329,65 +620,113 @@ rb_ary_initialize(argc, argv, ary)
*/
static VALUE
-rb_ary_s_create(argc, argv, klass)
- int argc;
- VALUE *argv;
- VALUE klass;
+rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
{
- VALUE ary = ary_alloc(klass);
-
- if (argc > 0) {
- RARRAY(ary)->ptr = ALLOC_N(VALUE, argc);
- MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
+ VALUE ary = ary_new(klass, argc);
+ if (argc > 0 && argv) {
+ MEMCPY(RARRAY_PTR(ary), argv, VALUE, argc);
+ ARY_SET_LEN(ary, argc);
}
- RARRAY(ary)->len = RARRAY(ary)->aux.capa = argc;
return ary;
}
void
-rb_ary_store(ary, idx, val)
- VALUE ary;
- long idx;
- VALUE val;
+rb_ary_store(VALUE ary, long idx, VALUE val)
{
if (idx < 0) {
- idx += RARRAY(ary)->len;
+ idx += RARRAY_LEN(ary);
if (idx < 0) {
- rb_raise(rb_eIndexError, "index %ld out of array",
- idx - RARRAY(ary)->len);
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ idx - RARRAY_LEN(ary), -RARRAY_LEN(ary));
}
}
+ else if (idx >= ARY_MAX_SIZE) {
+ rb_raise(rb_eIndexError, "index %ld too big", idx);
+ }
rb_ary_modify(ary);
- if (idx >= RARRAY(ary)->aux.capa) {
- long new_capa = RARRAY(ary)->aux.capa / 2;
+ if (idx >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, idx);
+ }
+ if (idx > RARRAY_LEN(ary)) {
+ rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary),
+ idx-RARRAY_LEN(ary) + 1);
+ }
- if (new_capa < ARY_DEFAULT_SIZE) {
- new_capa = ARY_DEFAULT_SIZE;
- }
- new_capa += idx;
- if (new_capa * (long)sizeof(VALUE) <= new_capa) {
- rb_raise(rb_eArgError, "index too big");
- }
- REALLOC_N(RARRAY(ary)->ptr, VALUE, new_capa);
- RARRAY(ary)->aux.capa = new_capa;
+ if (idx >= RARRAY_LEN(ary)) {
+ ARY_SET_LEN(ary, idx + 1);
+ }
+ RARRAY_PTR(ary)[idx] = val;
+}
+
+static VALUE
+ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
+{
+ assert(offset >= 0);
+ assert(len >= 0);
+ assert(offset+len <= RARRAY_LEN(ary));
+
+ if (len <= RARRAY_EMBED_LEN_MAX) {
+ VALUE result = ary_alloc(klass);
+ MEMCPY(ARY_EMBED_PTR(result), RARRAY_PTR(ary) + offset, VALUE, len);
+ ARY_SET_EMBED_LEN(result, len);
+ return result;
}
- if (idx > RARRAY(ary)->len) {
- rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len,
- idx-RARRAY(ary)->len + 1);
+ else {
+ VALUE shared, result = ary_alloc(klass);
+ FL_UNSET_EMBED(result);
+
+ shared = ary_make_shared(ary);
+ ARY_SET_PTR(result, RARRAY_PTR(ary));
+ ARY_SET_LEN(result, RARRAY_LEN(ary));
+ rb_ary_set_shared(result, shared);
+
+ ARY_INCREASE_PTR(result, offset);
+ ARY_SET_LEN(result, len);
+ return result;
}
+}
+
+static VALUE
+ary_make_shared_copy(VALUE ary)
+{
+ return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+}
+
+enum ary_take_pos_flags
+{
+ ARY_TAKE_FIRST = 0,
+ ARY_TAKE_LAST = 1
+};
- if (idx >= RARRAY(ary)->len) {
- RARRAY(ary)->len = idx + 1;
+static VALUE
+ary_take_first_or_last(int argc, VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+{
+ VALUE nv;
+ long n;
+ long offset = 0;
+
+ rb_scan_args(argc, argv, "1", &nv);
+ n = NUM2LONG(nv);
+ if (n > RARRAY_LEN(ary)) {
+ n = RARRAY_LEN(ary);
+ }
+ else if (n < 0) {
+ rb_raise(rb_eArgError, "negative array size");
+ }
+ if (last) {
+ offset = RARRAY_LEN(ary) - n;
}
- RARRAY(ary)->ptr[idx] = val;
+ return ary_make_partial(ary, rb_cArray, offset, n);
}
+static VALUE rb_ary_push_1(VALUE ary, VALUE item);
+
/*
* call-seq:
- * array << obj -> array
- *
+ * ary << obj -> ary
+ *
* Append---Pushes the given object on to the end of this array. This
* expression returns the array itself, so several appends
* may be chained together.
@@ -398,240 +737,262 @@ rb_ary_store(ary, idx, val)
*/
VALUE
-rb_ary_push(ary, item)
- VALUE ary;
- VALUE item;
+rb_ary_push(VALUE ary, VALUE item)
+{
+ rb_ary_modify(ary);
+ return rb_ary_push_1(ary, item);
+}
+
+static VALUE
+rb_ary_push_1(VALUE ary, VALUE item)
{
- rb_ary_store(ary, RARRAY(ary)->len, item);
+ long idx = RARRAY_LEN(ary);
+
+ if (idx >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, idx);
+ }
+ RARRAY_PTR(ary)[idx] = item;
+ ARY_SET_LEN(ary, idx + 1);
return ary;
}
-/*
+/*
* call-seq:
- * array.push(obj, ... ) -> array
- *
+ * ary.push(obj, ... ) -> ary
+ *
* Append---Pushes the given object(s) on to the end of this array. This
* expression returns the array itself, so several appends
* may be chained together.
*
* a = [ "a", "b", "c" ]
- * a.push("d", "e", "f")
+ * a.push("d", "e", "f")
* #=> ["a", "b", "c", "d", "e", "f"]
*/
static VALUE
-rb_ary_push_m(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
{
+ rb_ary_modify(ary);
while (argc--) {
- rb_ary_push(ary, *argv++);
+ rb_ary_push_1(ary, *argv++);
}
return ary;
}
+VALUE
+rb_ary_pop(VALUE ary)
+{
+ long n;
+ rb_ary_modify_check(ary);
+ if (RARRAY_LEN(ary) == 0) return Qnil;
+ if (ARY_OWNS_HEAP_P(ary) &&
+ RARRAY_LEN(ary) * 3 < ARY_CAPA(ary) &&
+ ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+ {
+ ary_resize_capa(ary, RARRAY_LEN(ary) * 2);
+ }
+ n = RARRAY_LEN(ary)-1;
+ ARY_SET_LEN(ary, n);
+ return RARRAY_PTR(ary)[n];
+}
+
/*
* call-seq:
- * array.pop -> obj or nil
- *
- * Removes the last element from <i>self</i> and returns it, or
+ * ary.pop -> obj or nil
+ * ary.pop(n) -> new_ary
+ *
+ * Removes the last element from +self+ and returns it, or
* <code>nil</code> if the array is empty.
- *
- * a = [ "a", "m", "z" ]
- * a.pop #=> "z"
- * a #=> ["a", "m"]
+ *
+ * If a number _n_ is given, returns an array of the last n elements
+ * (or less) just like <code>array.slice!(-n, n)</code> does.
+ *
+ * a = [ "a", "b", "c", "d" ]
+ * a.pop #=> "d"
+ * a.pop(2) #=> ["b", "c"]
+ * a #=> ["a"]
*/
-VALUE
-rb_ary_pop(ary)
- VALUE ary;
+static VALUE
+rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
{
- rb_ary_modify_check(ary);
- if (RARRAY(ary)->len == 0) return Qnil;
- if (!FL_TEST(ary, ELTS_SHARED) &&
- RARRAY(ary)->len * 2 < RARRAY(ary)->aux.capa &&
- RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
- RARRAY(ary)->aux.capa = RARRAY(ary)->len * 2;
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
+ VALUE result;
+
+ if (argc == 0) {
+ return rb_ary_pop(ary);
}
- return RARRAY(ary)->ptr[--RARRAY(ary)->len];
+
+ rb_ary_modify_check(ary);
+ result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+ ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+ return result;
}
-static VALUE
-ary_make_shared(ary)
- VALUE ary;
+VALUE
+rb_ary_shift(VALUE ary)
{
- if (!FL_TEST(ary, ELTS_SHARED)) {
- NEWOBJ(shared, struct RArray);
- OBJSETUP(shared, rb_cArray, T_ARRAY);
+ VALUE top;
- shared->len = RARRAY(ary)->len;
- shared->ptr = RARRAY(ary)->ptr;
- shared->aux.capa = RARRAY(ary)->aux.capa;
- RARRAY(ary)->aux.shared = (VALUE)shared;
- FL_SET(ary, ELTS_SHARED);
- OBJ_FREEZE(shared);
- return (VALUE)shared;
+ rb_ary_modify_check(ary);
+ if (RARRAY_LEN(ary) == 0) return Qnil;
+ top = RARRAY_PTR(ary)[0];
+ if (!ARY_SHARED_P(ary)) {
+ if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+ MEMMOVE(RARRAY_PTR(ary), RARRAY_PTR(ary)+1, VALUE, RARRAY_LEN(ary)-1);
+ ARY_INCREASE_LEN(ary, -1);
+ return top;
+ }
+ assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
+
+ RARRAY_PTR(ary)[0] = Qnil;
+ ary_make_shared(ary);
}
- else {
- return RARRAY(ary)->aux.shared;
+ else if (ARY_SHARED_NUM(ARY_SHARED(ary)) == 1) {
+ RARRAY_PTR(ary)[0] = Qnil;
}
+ ARY_INCREASE_PTR(ary, 1); /* shift ptr */
+ ARY_INCREASE_LEN(ary, -1);
+
+ return top;
}
/*
* call-seq:
- * array.shift -> obj or nil
- *
- * Returns the first element of <i>self</i> and removes it (shifting all
+ * ary.shift -> obj or nil
+ * ary.shift(n) -> new_ary
+ *
+ * Returns the first element of +self+ and removes it (shifting all
* other elements down by one). Returns <code>nil</code> if the array
* is empty.
- *
+ *
+ * If a number _n_ is given, returns an array of the first n elements
+ * (or less) just like <code>array.slice!(0, n)</code> does.
+ *
* args = [ "-m", "-q", "filename" ]
- * args.shift #=> "-m"
- * args #=> ["-q", "filename"]
+ * args.shift #=> "-m"
+ * args #=> ["-q", "filename"]
+ *
+ * args = [ "-m", "-q", "filename" ]
+ * args.shift(2) #=> ["-m", "-q"]
+ * args #=> ["filename"]
*/
-VALUE
-rb_ary_shift(ary)
- VALUE ary;
+static VALUE
+rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
{
- VALUE top;
-
- rb_ary_modify_check(ary);
- if (RARRAY(ary)->len == 0) return Qnil;
- top = RARRAY(ary)->ptr[0];
- ary_make_shared(ary);
- RARRAY(ary)->ptr++; /* shift ptr */
- RARRAY(ary)->len--;
+ VALUE result;
+ long n;
- return top;
-}
+ if (argc == 0) {
+ return rb_ary_shift(ary);
+ }
-VALUE
-rb_ary_unshift(ary, item)
- VALUE ary, item;
-{
- rb_ary_modify(ary);
- if (RARRAY(ary)->len == RARRAY(ary)->aux.capa) {
- long capa_inc = RARRAY(ary)->aux.capa / 2;
- if (capa_inc < ARY_DEFAULT_SIZE) {
- capa_inc = ARY_DEFAULT_SIZE;
+ rb_ary_modify_check(ary);
+ result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+ n = RARRAY_LEN(result);
+ if (ARY_SHARED_P(ary)) {
+ if (ARY_SHARED_NUM(ARY_SHARED(ary)) == 1) {
+ rb_mem_clear(RARRAY_PTR(ary), n);
}
- RARRAY(ary)->aux.capa += capa_inc;
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
+ ARY_INCREASE_PTR(ary, n);
}
+ else {
+ MEMMOVE(RARRAY_PTR(ary), RARRAY_PTR(ary)+n, VALUE, RARRAY_LEN(ary)-n);
+ }
+ ARY_INCREASE_LEN(ary, -n);
- /* sliding items */
- MEMMOVE(RARRAY(ary)->ptr + 1, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
-
- RARRAY(ary)->len++;
- RARRAY(ary)->ptr[0] = item;
-
- return ary;
+ return result;
}
/*
* call-seq:
- * array.unshift(obj, ...) -> array
- *
- * Prepends objects to the front of <i>array</i>.
- * other elements up one.
- *
+ * ary.unshift(obj, ...) -> ary
+ *
+ * Prepends objects to the front of +self+,
+ * moving other elements upwards.
+ *
* a = [ "b", "c", "d" ]
* a.unshift("a") #=> ["a", "b", "c", "d"]
* a.unshift(1, 2) #=> [ 1, 2, "a", "b", "c", "d"]
*/
static VALUE
-rb_ary_unshift_m(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
{
- long len = RARRAY(ary)->len;
+ long len;
+ rb_ary_modify(ary);
if (argc == 0) return ary;
-
- /* make rooms by setting the last item */
- rb_ary_store(ary, len + argc - 1, Qnil);
+ if (ARY_CAPA(ary) <= (len = RARRAY_LEN(ary)) + argc) {
+ ary_double_capa(ary, len + argc);
+ }
/* sliding items */
- MEMMOVE(RARRAY(ary)->ptr + argc, RARRAY(ary)->ptr, VALUE, len);
- MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
-
+ MEMMOVE(RARRAY_PTR(ary) + argc, RARRAY_PTR(ary), VALUE, len);
+ MEMCPY(RARRAY_PTR(ary), argv, VALUE, argc);
+ ARY_INCREASE_LEN(ary, argc);
+
return ary;
}
+VALUE
+rb_ary_unshift(VALUE ary, VALUE item)
+{
+ return rb_ary_unshift_m(1,&item,ary);
+}
+
/* faster version - use this if you don't need to treat negative offset */
static inline VALUE
-rb_ary_elt(ary, offset)
- VALUE ary;
- long offset;
+rb_ary_elt(VALUE ary, long offset)
{
- if (RARRAY(ary)->len == 0) return Qnil;
- if (offset < 0 || RARRAY(ary)->len <= offset) {
+ if (RARRAY_LEN(ary) == 0) return Qnil;
+ if (offset < 0 || RARRAY_LEN(ary) <= offset) {
return Qnil;
}
- return RARRAY(ary)->ptr[offset];
+ return RARRAY_PTR(ary)[offset];
}
VALUE
-rb_ary_entry(ary, offset)
- VALUE ary;
- long offset;
+rb_ary_entry(VALUE ary, long offset)
{
if (offset < 0) {
- offset += RARRAY(ary)->len;
+ offset += RARRAY_LEN(ary);
}
return rb_ary_elt(ary, offset);
}
-static VALUE
-rb_ary_subseq(ary, beg, len)
- VALUE ary;
- long beg, len;
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
{
- VALUE klass, ary2, shared;
- VALUE *ptr;
+ VALUE klass;
- if (beg > RARRAY(ary)->len) return Qnil;
+ if (beg > RARRAY_LEN(ary)) return Qnil;
if (beg < 0 || len < 0) return Qnil;
- if (beg + len > RARRAY(ary)->len) {
- len = RARRAY(ary)->len - beg;
- if (len < 0)
- len = 0;
+ if (RARRAY_LEN(ary) < len || RARRAY_LEN(ary) < beg + len) {
+ len = RARRAY_LEN(ary) - beg;
}
klass = rb_obj_class(ary);
if (len == 0) return ary_new(klass, 0);
- shared = ary_make_shared(ary);
- ptr = RARRAY(ary)->ptr;
- ary2 = ary_alloc(klass);
- RARRAY(ary2)->ptr = ptr + beg;
- RARRAY(ary2)->len = len;
- RARRAY(ary2)->aux.shared = shared;
- FL_SET(ary2, ELTS_SHARED);
-
- return ary2;
+ return ary_make_partial(ary, klass, beg, len);
}
-/*
+/*
* call-seq:
- * array[index] -> obj or nil
- * array[start, length] -> an_array or nil
- * array[range] -> an_array or nil
- * array.slice(index) -> obj or nil
- * array.slice(start, length) -> an_array or nil
- * array.slice(range) -> an_array or nil
+ * ary[index] -> obj or nil
+ * ary[start, length] -> new_ary or nil
+ * ary[range] -> new_ary or nil
+ * ary.slice(index) -> obj or nil
+ * ary.slice(start, length) -> new_ary or nil
+ * ary.slice(range) -> new_ary or nil
*
* Element Reference---Returns the element at _index_,
* or returns a subarray starting at _start_ and
* continuing for _length_ elements, or returns a subarray
* specified by _range_.
* Negative indices count backward from the end of the
- * array (-1 is the last element). Returns nil if the index
+ * array (-1 is the last element). Returns +nil+ if the index
* (or starting index) are out of range.
*
* a = [ "a", "b", "c", "d", "e" ]
@@ -650,22 +1011,16 @@ rb_ary_subseq(ary, beg, len)
*/
VALUE
-rb_ary_aref(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_aref(int argc, VALUE *argv, VALUE ary)
{
VALUE arg;
long beg, len;
if (argc == 2) {
- if (SYMBOL_P(argv[0])) {
- rb_raise(rb_eTypeError, "Symbol as array index");
- }
beg = NUM2LONG(argv[0]);
len = NUM2LONG(argv[1]);
if (beg < 0) {
- beg += RARRAY(ary)->len;
+ beg += RARRAY_LEN(ary);
}
return rb_ary_subseq(ary, beg, len);
}
@@ -677,11 +1032,8 @@ rb_ary_aref(argc, argv, ary)
if (FIXNUM_P(arg)) {
return rb_ary_entry(ary, FIX2LONG(arg));
}
- if (SYMBOL_P(arg)) {
- rb_raise(rb_eTypeError, "Symbol as array index");
- }
/* check if idx is Range */
- switch (rb_range_beg_len(arg, &beg, &len, RARRAY(ary)->len, 0)) {
+ switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
case Qfalse:
break;
case Qnil:
@@ -692,15 +1044,13 @@ rb_ary_aref(argc, argv, ary)
return rb_ary_entry(ary, NUM2LONG(arg));
}
-/*
+/*
* call-seq:
- * array.at(index) -> obj or nil
+ * ary.at(index) -> obj or nil
*
* Returns the element at _index_. A
- * negative index counts from the end of _self_. Returns +nil+
+ * negative index counts from the end of +self+. Returns +nil+
* if the index is out of range. See also <code>Array#[]</code>.
- * (<code>Array#at</code> is slightly faster than <code>Array#[]</code>,
- * as it does not accept ranges and so on.)
*
* a = [ "a", "b", "c", "d", "e" ]
* a.at(0) #=> "a"
@@ -708,101 +1058,75 @@ rb_ary_aref(argc, argv, ary)
*/
static VALUE
-rb_ary_at(ary, pos)
- VALUE ary, pos;
+rb_ary_at(VALUE ary, VALUE pos)
{
return rb_ary_entry(ary, NUM2LONG(pos));
}
/*
* call-seq:
- * array.first -> obj or nil
- * array.first(n) -> an_array
+ * ary.first -> obj or nil
+ * ary.first(n) -> new_ary
*
* Returns the first element, or the first +n+ elements, of the array.
* If the array is empty, the first form returns <code>nil</code>, and the
* second form returns an empty array.
*
* a = [ "q", "r", "s", "t" ]
- * a.first #=> "q"
- * a.first(1) #=> ["q"]
- * a.first(3) #=> ["q", "r", "s"]
+ * a.first #=> "q"
+ * a.first(2) #=> ["q", "r"]
*/
static VALUE
-rb_ary_first(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_first(int argc, VALUE *argv, VALUE ary)
{
if (argc == 0) {
- if (RARRAY(ary)->len == 0) return Qnil;
- return RARRAY(ary)->ptr[0];
+ if (RARRAY_LEN(ary) == 0) return Qnil;
+ return RARRAY_PTR(ary)[0];
}
else {
- VALUE nv, result;
- long n, i;
-
- rb_scan_args(argc, argv, "01", &nv);
- n = NUM2LONG(nv);
- if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
- result = rb_ary_new2(n);
- for (i=0; i<n; i++) {
- rb_ary_push(result, RARRAY(ary)->ptr[i]);
- }
- return result;
+ return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
}
}
/*
* call-seq:
- * array.last -> obj or nil
- * array.last(n) -> an_array
- *
- * Returns the last element(s) of <i>self</i>. If the array is empty,
+ * ary.last -> obj or nil
+ * ary.last(n) -> new_ary
+ *
+ * Returns the last element(s) of +self+. If the array is empty,
* the first form returns <code>nil</code>.
- *
- * [ "w", "x", "y", "z" ].last #=> "z"
+ *
+ * a = [ "w", "x", "y", "z" ]
+ * a.last #=> "z"
+ * a.last(2) #=> ["y", "z"]
*/
-static VALUE
-rb_ary_last(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+VALUE
+rb_ary_last(int argc, VALUE *argv, VALUE ary)
{
if (argc == 0) {
- if (RARRAY(ary)->len == 0) return Qnil;
- return RARRAY(ary)->ptr[RARRAY(ary)->len-1];
+ if (RARRAY_LEN(ary) == 0) return Qnil;
+ return RARRAY_PTR(ary)[RARRAY_LEN(ary)-1];
}
else {
- VALUE nv, result;
- long n, i;
-
- rb_scan_args(argc, argv, "01", &nv);
- n = NUM2LONG(nv);
- if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
- result = rb_ary_new2(n);
- for (i=RARRAY(ary)->len-n; n--; i++) {
- rb_ary_push(result, RARRAY(ary)->ptr[i]);
- }
- return result;
+ return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
}
}
/*
* call-seq:
- * array.fetch(index) -> obj
- * array.fetch(index, default ) -> obj
- * array.fetch(index) {|index| block } -> obj
- *
+ * ary.fetch(index) -> obj
+ * ary.fetch(index, default ) -> obj
+ * ary.fetch(index) {|index| block } -> obj
+ *
* Tries to return the element at position <i>index</i>. If the index
* lies outside the array, the first form throws an
* <code>IndexError</code> exception, the second form returns
* <i>default</i>, and the third form returns the value of invoking
* the block, passing in the index. Negative values of <i>index</i>
* count from the end of the array.
- *
+ *
* a = [ 11, 22, 33, 44 ]
* a.fetch(1) #=> 22
* a.fetch(-1) #=> 44
@@ -811,10 +1135,7 @@ rb_ary_last(argc, argv, ary)
*/
static VALUE
-rb_ary_fetch(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
{
VALUE pos, ifnone;
long block_given;
@@ -828,40 +1149,61 @@ rb_ary_fetch(argc, argv, ary)
idx = NUM2LONG(pos);
if (idx < 0) {
- idx += RARRAY(ary)->len;
+ idx += RARRAY_LEN(ary);
}
- if (idx < 0 || RARRAY(ary)->len <= idx) {
+ if (idx < 0 || RARRAY_LEN(ary) <= idx) {
if (block_given) return rb_yield(pos);
if (argc == 1) {
- rb_raise(rb_eIndexError, "index %ld out of array", idx);
+ rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+ idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
}
return ifnone;
}
- return RARRAY(ary)->ptr[idx];
+ return RARRAY_PTR(ary)[idx];
}
/*
* call-seq:
- * array.index(obj) -> int or nil
- *
- * Returns the index of the first object in <i>self</i> such that is
- * <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
- * no match is found.
- *
+ * ary.index(obj) -> int or nil
+ * ary.index {|item| block} -> int or nil
+ * ary.index -> an_enumerator
+ *
+ * Returns the index of the first object in +self+ such that the object is
+ * <code>==</code> to <i>obj</i>. If a block is given instead of an
+ * argument, returns index of first object for which <em>block</em> is true.
+ * Returns <code>nil</code> if no match is found.
+ * See also <code>Array#rindex</code>.
+ *
+ * If neither block nor argument is given, an enumerator is returned instead.
+ *
* a = [ "a", "b", "c" ]
- * a.index("b") #=> 1
- * a.index("z") #=> nil
+ * a.index("b") #=> 1
+ * a.index("z") #=> nil
+ * a.index{|x|x=="b"} #=> 1
+ *
+ * This is an alias of <code>#find_index</code>.
*/
static VALUE
-rb_ary_index(ary, val)
- VALUE ary;
- VALUE val;
+rb_ary_index(int argc, VALUE *argv, VALUE ary)
{
+ VALUE val;
long i;
- for (i=0; i<RARRAY(ary)->len; i++) {
- if (rb_equal(RARRAY(ary)->ptr[i], val))
+ if (argc == 0) {
+ RETURN_ENUMERATOR(ary, 0, 0);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ if (RTEST(rb_yield(RARRAY_PTR(ary)[i]))) {
+ return LONG2NUM(i);
+ }
+ }
+ return Qnil;
+ }
+ rb_scan_args(argc, argv, "1", &val);
+ if (rb_block_given_p())
+ rb_warn("given block not used");
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ if (rb_equal(RARRAY_PTR(ary)[i], val))
return LONG2NUM(i);
}
return Qnil;
@@ -869,144 +1211,173 @@ rb_ary_index(ary, val)
/*
* call-seq:
- * array.rindex(obj) -> int or nil
- *
- * Returns the index of the last object in <i>array</i>
- * <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
- * no match is found.
- *
+ * ary.rindex(obj) -> int or nil
+ * ary.rindex {|item| block} -> int or nil
+ * ary.rindex -> an_enumerator
+ *
+ * Returns the index of the last object in +self+
+ * <code>==</code> to <i>obj</i>. If a block is given instead of an
+ * argument, returns index of first object for which <em>block</em> is
+ * true, starting from the last object.
+ * Returns <code>nil</code> if no match is found.
+ * See also <code>Array#index</code>.
+ *
+ * If neither block nor argument is given, an enumerator is returned instead.
+ *
* a = [ "a", "b", "b", "b", "c" ]
- * a.rindex("b") #=> 3
- * a.rindex("z") #=> nil
+ * a.rindex("b") #=> 3
+ * a.rindex("z") #=> nil
+ * a.rindex { |x| x == "b" } #=> 3
*/
static VALUE
-rb_ary_rindex(ary, val)
- VALUE ary;
- VALUE val;
+rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
{
- long i = RARRAY(ary)->len;
+ VALUE val;
+ long i = RARRAY_LEN(ary);
- while (i--) {
- if (i > RARRAY(ary)->len) {
- i = RARRAY(ary)->len;
- continue;
+ if (argc == 0) {
+ RETURN_ENUMERATOR(ary, 0, 0);
+ while (i--) {
+ if (RTEST(rb_yield(RARRAY_PTR(ary)[i])))
+ return LONG2NUM(i);
+ if (i > RARRAY_LEN(ary)) {
+ i = RARRAY_LEN(ary);
+ }
}
- if (rb_equal(RARRAY(ary)->ptr[i], val))
+ return Qnil;
+ }
+ rb_scan_args(argc, argv, "1", &val);
+ if (rb_block_given_p())
+ rb_warn("given block not used");
+ while (i--) {
+ if (rb_equal(RARRAY_PTR(ary)[i], val))
return LONG2NUM(i);
+ if (i > RARRAY_LEN(ary)) {
+ i = RARRAY_LEN(ary);
+ }
}
return Qnil;
}
-/*
- * call-seq:
- * array.indexes( i1, i2, ... iN ) -> an_array
- * array.indices( i1, i2, ... iN ) -> an_array
- *
- * Deprecated; use <code>Array#values_at</code>.
- */
-
-static VALUE
-rb_ary_indexes(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
-{
- VALUE new_ary;
- long i;
-
- rb_warn("Array#%s is deprecated; use Array#values_at", rb_id2name(rb_frame_last_func()));
- new_ary = rb_ary_new2(argc);
- for (i=0; i<argc; i++) {
- rb_ary_push(new_ary, rb_ary_aref(1, argv+i, ary));
- }
-
- return new_ary;
-}
-
VALUE
-rb_ary_to_ary(obj)
- VALUE obj;
+rb_ary_to_ary(VALUE obj)
{
- if (TYPE(obj) == T_ARRAY) {
- return obj;
- }
- if (rb_respond_to(obj, rb_intern("to_ary"))) {
- return rb_convert_type(obj, T_ARRAY, "Array", "to_ary");
- }
+ VALUE tmp = rb_check_array_type(obj);
+
+ if (!NIL_P(tmp)) return tmp;
return rb_ary_new3(1, obj);
}
static void
-rb_ary_splice(ary, beg, len, rpl)
- VALUE ary;
- long beg, len;
- VALUE rpl;
+rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
{
long rlen;
if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
if (beg < 0) {
- beg += RARRAY(ary)->len;
+ beg += RARRAY_LEN(ary);
if (beg < 0) {
- beg -= RARRAY(ary)->len;
- rb_raise(rb_eIndexError, "index %ld out of array", beg);
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ beg - RARRAY_LEN(ary), -RARRAY_LEN(ary));
}
}
- if (beg + len > RARRAY(ary)->len) {
- len = RARRAY(ary)->len - beg;
+ if (RARRAY_LEN(ary) < len || RARRAY_LEN(ary) < beg + len) {
+ len = RARRAY_LEN(ary) - beg;
}
- if (NIL_P(rpl)) {
+ if (rpl == Qundef) {
rlen = 0;
}
else {
rpl = rb_ary_to_ary(rpl);
- rlen = RARRAY(rpl)->len;
+ rlen = RARRAY_LEN(rpl);
}
rb_ary_modify(ary);
-
- if (beg >= RARRAY(ary)->len) {
+ if (beg >= RARRAY_LEN(ary)) {
+ if (beg > ARY_MAX_SIZE - rlen) {
+ rb_raise(rb_eIndexError, "index %ld too big", beg);
+ }
len = beg + rlen;
- if (len >= RARRAY(ary)->aux.capa) {
- REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
- RARRAY(ary)->aux.capa = len;
+ if (len >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, len);
}
- rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, beg - RARRAY(ary)->len);
+ rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary), beg - RARRAY_LEN(ary));
if (rlen > 0) {
- MEMCPY(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
+ MEMCPY(RARRAY_PTR(ary) + beg, RARRAY_PTR(rpl), VALUE, rlen);
}
- RARRAY(ary)->len = len;
+ ARY_SET_LEN(ary, len);
}
else {
long alen;
- if (beg + len > RARRAY(ary)->len) {
- len = RARRAY(ary)->len - beg;
- }
-
- alen = RARRAY(ary)->len + rlen - len;
- if (alen >= RARRAY(ary)->aux.capa) {
- REALLOC_N(RARRAY(ary)->ptr, VALUE, alen);
- RARRAY(ary)->aux.capa = alen;
+ alen = RARRAY_LEN(ary) + rlen - len;
+ if (alen >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, alen);
}
if (len != rlen) {
- MEMMOVE(RARRAY(ary)->ptr + beg + rlen, RARRAY(ary)->ptr + beg + len,
- VALUE, RARRAY(ary)->len - (beg + len));
- RARRAY(ary)->len = alen;
+ MEMMOVE(RARRAY_PTR(ary) + beg + rlen, RARRAY_PTR(ary) + beg + len,
+ VALUE, RARRAY_LEN(ary) - (beg + len));
+ ARY_SET_LEN(ary, alen);
}
if (rlen > 0) {
- MEMMOVE(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
+ MEMMOVE(RARRAY_PTR(ary) + beg, RARRAY_PTR(rpl), VALUE, rlen);
}
}
}
-/*
+/*!
+ * expands or shrinks \a ary to \a len elements.
+ * expanded region will be filled with Qnil.
+ * \param ary an array
+ * \param len new size
+ * \return \a ary
+ * \post the size of \a ary is \a len.
+ */
+VALUE
+rb_ary_resize(VALUE ary, long len)
+{
+ long olen;
+
+ rb_ary_modify(ary);
+ olen = RARRAY_LEN(ary);
+ if (len == olen) return ary;
+ if (len > ARY_MAX_SIZE) {
+ rb_raise(rb_eIndexError, "index %ld too big", len);
+ }
+ if (len > olen) {
+ if (len >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, len);
+ }
+ rb_mem_clear(RARRAY_PTR(ary) + olen, len - olen);
+ ARY_SET_LEN(ary, len);
+ }
+ else if (ARY_EMBED_P(ary)) {
+ ARY_SET_EMBED_LEN(ary, len);
+ }
+ else if (len <= RARRAY_EMBED_LEN_MAX) {
+ VALUE tmp[RARRAY_EMBED_LEN_MAX];
+ MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
+ ary_discard(ary);
+ MEMCPY(ARY_EMBED_PTR(ary), tmp, VALUE, len);
+ ARY_SET_EMBED_LEN(ary, len);
+ }
+ else {
+ if (olen > len + ARY_DEFAULT_SIZE) {
+ REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len);
+ ARY_SET_CAPA(ary, len);
+ }
+ ARY_SET_HEAP_LEN(ary, len);
+ }
+ return ary;
+}
+
+/*
* call-seq:
- * array[index] = obj -> obj
- * array[start, length] = obj or an_array or nil -> obj or an_array or nil
- * array[range] = obj or an_array or nil -> obj or an_array or nil
+ * ary[index] = obj -> obj
+ * ary[start, length] = obj or other_ary or nil -> obj or other_ary or nil
+ * ary[range] = obj or other_ary or nil -> obj or other_ary or nil
*
* Element Assignment---Sets the element at _index_,
* or replaces a subarray starting at _start_ and
@@ -1015,11 +1386,10 @@ rb_ary_splice(ary, beg, len, rpl)
* the current capacity of the array, the array grows
* automatically. A negative indices will count backward
* from the end of the array. Inserts elements if _length_ is
- * zero. If +nil+ is used in the second and third form,
- * deletes elements from _self_. An +IndexError+ is raised if a
- * negative index points past the beginning of the array. See also
+ * zero. An +IndexError+ is raised if a negative index points
+ * past the beginning of the array. See also
* <code>Array#push</code>, and <code>Array#unshift</code>.
- *
+ *
* a = Array.new
* a[4] = "4"; #=> [nil, nil, nil, nil, "4"]
* a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
@@ -1027,38 +1397,31 @@ rb_ary_splice(ary, beg, len, rpl)
* a[0, 2] = "?" #=> ["?", 2, nil, "4"]
* a[0..2] = "A" #=> ["A", "4"]
* a[-1] = "Z" #=> ["A", "Z"]
- * a[1..-1] = nil #=> ["A"]
+ * a[1..-1] = nil #=> ["A", nil]
+ * a[1..-1] = [] #=> ["A"]
*/
static VALUE
-rb_ary_aset(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_aset(int argc, VALUE *argv, VALUE ary)
{
long offset, beg, len;
if (argc == 3) {
- if (SYMBOL_P(argv[0])) {
- rb_raise(rb_eTypeError, "Symbol as array index");
- }
- if (SYMBOL_P(argv[1])) {
- rb_raise(rb_eTypeError, "Symbol as subarray length");
- }
- rb_ary_splice(ary, NUM2LONG(argv[0]), NUM2LONG(argv[1]), argv[2]);
+ rb_ary_modify_check(ary);
+ beg = NUM2LONG(argv[0]);
+ len = NUM2LONG(argv[1]);
+ rb_ary_splice(ary, beg, len, argv[2]);
return argv[2];
}
if (argc != 2) {
rb_raise(rb_eArgError, "wrong number of arguments (%d for 2)", argc);
}
+ rb_ary_modify_check(ary);
if (FIXNUM_P(argv[0])) {
offset = FIX2LONG(argv[0]);
goto fixnum;
}
- if (SYMBOL_P(argv[0])) {
- rb_raise(rb_eTypeError, "Symbol as array index");
- }
- if (rb_range_beg_len(argv[0], &beg, &len, RARRAY(ary)->len, 1)) {
+ if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
/* check if idx is Range */
rb_ary_splice(ary, beg, len, argv[1]);
return argv[1];
@@ -1072,31 +1435,29 @@ fixnum:
/*
* call-seq:
- * array.insert(index, obj...) -> array
- *
+ * ary.insert(index, obj...) -> ary
+ *
* Inserts the given values before the element with the given index
* (which may be negative).
- *
+ *
* a = %w{ a b c d }
* a.insert(2, 99) #=> ["a", "b", 99, "c", "d"]
* a.insert(-2, 1, 2, 3) #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
*/
static VALUE
-rb_ary_insert(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_insert(int argc, VALUE *argv, VALUE ary)
{
long pos;
- if (argc == 1) return ary;
if (argc < 1) {
rb_raise(rb_eArgError, "wrong number of arguments (at least 1)");
}
+ rb_ary_modify_check(ary);
+ if (argc == 1) return ary;
pos = NUM2LONG(argv[0]);
if (pos == -1) {
- pos = RARRAY(ary)->len;
+ pos = RARRAY_LEN(ary);
}
if (pos < 0) {
pos++;
@@ -1107,53 +1468,61 @@ rb_ary_insert(argc, argv, ary)
/*
* call-seq:
- * array.each {|item| block } -> array
- *
- * Calls <i>block</i> once for each element in <i>self</i>, passing that
+ * ary.each {|item| block } -> ary
+ * ary.each -> an_enumerator
+ *
+ * Calls <i>block</i> once for each element in +self+, passing that
* element as a parameter.
- *
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
* a = [ "a", "b", "c" ]
* a.each {|x| print x, " -- " }
- *
+ *
* produces:
- *
+ *
* a -- b -- c --
*/
VALUE
-rb_ary_each(ary)
- VALUE ary;
+rb_ary_each(VALUE array)
{
long i;
+ volatile VALUE ary = array;
- for (i=0; i<RARRAY(ary)->len; i++) {
- rb_yield(RARRAY(ary)->ptr[i]);
+ RETURN_ENUMERATOR(ary, 0, 0);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ rb_yield(RARRAY_PTR(ary)[i]);
}
return ary;
}
/*
* call-seq:
- * array.each_index {|index| block } -> array
- *
+ * ary.each_index {|index| block } -> ary
+ * ary.each_index -> an_enumerator
+ *
* Same as <code>Array#each</code>, but passes the index of the element
* instead of the element itself.
- *
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ *
* a = [ "a", "b", "c" ]
* a.each_index {|x| print x, " -- " }
- *
+ *
* produces:
- *
+ *
* 0 -- 1 -- 2 --
*/
static VALUE
-rb_ary_each_index(ary)
- VALUE ary;
+rb_ary_each_index(VALUE ary)
{
long i;
+ RETURN_ENUMERATOR(ary, 0, 0);
- for (i=0; i<RARRAY(ary)->len; i++) {
+ for (i=0; i<RARRAY_LEN(ary); i++) {
rb_yield(LONG2NUM(i));
}
return ary;
@@ -1161,29 +1530,31 @@ rb_ary_each_index(ary)
/*
* call-seq:
- * array.reverse_each {|item| block }
- *
- * Same as <code>Array#each</code>, but traverses <i>self</i> in reverse
+ * ary.reverse_each {|item| block } -> ary
+ * ary.reverse_each -> an_enumerator
+ *
+ * Same as <code>Array#each</code>, but traverses +self+ in reverse
* order.
- *
+ *
* a = [ "a", "b", "c" ]
* a.reverse_each {|x| print x, " " }
- *
+ *
* produces:
- *
+ *
* c b a
*/
static VALUE
-rb_ary_reverse_each(ary)
- VALUE ary;
+rb_ary_reverse_each(VALUE ary)
{
- long len = RARRAY(ary)->len;
+ long len;
+ RETURN_ENUMERATOR(ary, 0, 0);
+ len = RARRAY_LEN(ary);
while (len--) {
- rb_yield(RARRAY(ary)->ptr[len]);
- if (RARRAY(ary)->len < len) {
- len = RARRAY(ary)->len;
+ rb_yield(RARRAY_PTR(ary)[len]);
+ if (RARRAY_LEN(ary) < len) {
+ len = RARRAY_LEN(ary);
}
}
return ary;
@@ -1191,286 +1562,268 @@ rb_ary_reverse_each(ary)
/*
* call-seq:
- * array.length -> int
- *
- * Returns the number of elements in <i>self</i>. May be zero.
- *
+ * ary.length -> int
+ *
+ * Returns the number of elements in +self+. May be zero.
+ *
* [ 1, 2, 3, 4, 5 ].length #=> 5
*/
static VALUE
-rb_ary_length(ary)
- VALUE ary;
+rb_ary_length(VALUE ary)
{
- return LONG2NUM(RARRAY(ary)->len);
+ long len = RARRAY_LEN(ary);
+ return LONG2NUM(len);
}
/*
* call-seq:
- * array.empty? -> true or false
- *
- * Returns <code>true</code> if <i>self</i> array contains no elements.
- *
+ * ary.empty? -> true or false
+ *
+ * Returns <code>true</code> if +self+ contains no elements.
+ *
* [].empty? #=> true
*/
static VALUE
-rb_ary_empty_p(ary)
- VALUE ary;
+rb_ary_empty_p(VALUE ary)
{
- if (RARRAY(ary)->len == 0)
+ if (RARRAY_LEN(ary) == 0)
return Qtrue;
return Qfalse;
}
VALUE
-rb_ary_dup(ary)
- VALUE ary;
+rb_ary_dup(VALUE ary)
{
- VALUE dup = rb_ary_new2(RARRAY(ary)->len);
-
- DUPSETUP(dup, ary);
- MEMCPY(RARRAY(dup)->ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
- RARRAY(dup)->len = RARRAY(ary)->len;
+ VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+ MEMCPY(RARRAY_PTR(dup), RARRAY_PTR(ary), VALUE, RARRAY_LEN(ary));
+ ARY_SET_LEN(dup, RARRAY_LEN(ary));
return dup;
}
+VALUE
+rb_ary_resurrect(VALUE ary)
+{
+ return rb_ary_new4(RARRAY_LEN(ary), RARRAY_PTR(ary));
+}
+
extern VALUE rb_output_fs;
+static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
+
static VALUE
-inspect_join(ary, arg)
- VALUE ary;
- VALUE *arg;
+recursive_join(VALUE obj, VALUE argp, int recur)
+{
+ VALUE *arg = (VALUE *)argp;
+ VALUE ary = arg[0];
+ VALUE sep = arg[1];
+ VALUE result = arg[2];
+ int *first = (int *)arg[3];
+
+ if (recur) {
+ rb_raise(rb_eArgError, "recursive array join");
+ }
+ else {
+ ary_join_1(obj, ary, sep, 0, result, first);
+ }
+ return Qnil;
+}
+
+static void
+ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
{
- return rb_ary_join(arg[0], arg[1]);
+ long i;
+ VALUE val;
+
+ if (max > 0) rb_enc_copy(result, RARRAY_PTR(ary)[0]);
+ for (i=0; i<max; i++) {
+ val = RARRAY_PTR(ary)[i];
+ if (i > 0 && !NIL_P(sep))
+ rb_str_buf_append(result, sep);
+ rb_str_buf_append(result, val);
+ if (OBJ_TAINTED(val)) OBJ_TAINT(result);
+ if (OBJ_UNTRUSTED(val)) OBJ_TAINT(result);
+ }
}
-VALUE
-rb_ary_join(ary, sep)
- VALUE ary, sep;
+static void
+ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
{
- long len = 1, i;
- int taint = Qfalse;
- VALUE result, tmp;
+ VALUE val, tmp;
- if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
- if (OBJ_TAINTED(ary) || OBJ_TAINTED(sep)) taint = Qtrue;
+ for (; i<RARRAY_LEN(ary); i++) {
+ if (i > 0 && !NIL_P(sep))
+ rb_str_buf_append(result, sep);
- for (i=0; i<RARRAY(ary)->len; i++) {
- tmp = rb_check_string_type(RARRAY(ary)->ptr[i]);
- len += NIL_P(tmp) ? 10 : RSTRING(tmp)->len;
- }
- if (!NIL_P(sep)) {
- StringValue(sep);
- len += RSTRING(sep)->len * (RARRAY(ary)->len - 1);
- }
- result = rb_str_buf_new(len);
- for (i=0; i<RARRAY(ary)->len; i++) {
- tmp = RARRAY(ary)->ptr[i];
- switch (TYPE(tmp)) {
+ val = RARRAY_PTR(ary)[i];
+ switch (TYPE(val)) {
case T_STRING:
+ str_join:
+ rb_str_buf_append(result, val);
+ *first = FALSE;
break;
case T_ARRAY:
- if (rb_inspecting_p(tmp)) {
- tmp = rb_str_new2("[...]");
+ obj = val;
+ ary_join:
+ if (val == ary) {
+ rb_raise(rb_eArgError, "recursive array join");
}
else {
- VALUE args[2];
+ VALUE args[4];
- args[0] = tmp;
+ args[0] = val;
args[1] = sep;
- tmp = rb_protect_inspect(inspect_join, ary, (VALUE)args);
+ args[2] = result;
+ args[3] = (VALUE)first;
+ rb_exec_recursive(recursive_join, obj, (VALUE)args);
}
break;
default:
- tmp = rb_obj_as_string(tmp);
+ tmp = rb_check_string_type(val);
+ if (!NIL_P(tmp)) {
+ val = tmp;
+ goto str_join;
+ }
+ tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
+ if (!NIL_P(tmp)) {
+ obj = val;
+ val = tmp;
+ goto ary_join;
+ }
+ val = rb_obj_as_string(val);
+ if (*first) {
+ rb_enc_copy(result, val);
+ *first = FALSE;
+ }
+ goto str_join;
}
- if (i > 0 && !NIL_P(sep))
- rb_str_buf_append(result, sep);
- rb_str_buf_append(result, tmp);
- if (OBJ_TAINTED(tmp)) taint = Qtrue;
+ }
+}
+
+VALUE
+rb_ary_join(VALUE ary, VALUE sep)
+{
+ long len = 1, i;
+ int taint = FALSE;
+ int untrust = FALSE;
+ VALUE val, tmp, result;
+
+ if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
+ if (OBJ_TAINTED(ary) || OBJ_TAINTED(sep)) taint = TRUE;
+ if (OBJ_UNTRUSTED(ary) || OBJ_UNTRUSTED(sep)) untrust = TRUE;
+
+ if (!NIL_P(sep)) {
+ StringValue(sep);
+ len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+ }
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ val = RARRAY_PTR(ary)[i];
+ tmp = rb_check_string_type(val);
+
+ if (NIL_P(tmp) || tmp != val) {
+ int first;
+ result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
+ rb_enc_associate(result, rb_usascii_encoding());
+ if (taint) OBJ_TAINT(result);
+ if (untrust) OBJ_UNTRUST(result);
+ ary_join_0(ary, sep, i, result);
+ first = i == 0;
+ ary_join_1(ary, ary, sep, i, result, &first);
+ return result;
+ }
+
+ len += RSTRING_LEN(tmp);
}
+ result = rb_str_buf_new(len);
if (taint) OBJ_TAINT(result);
+ if (untrust) OBJ_UNTRUST(result);
+ ary_join_0(ary, sep, RARRAY_LEN(ary), result);
+
return result;
}
/*
* call-seq:
- * array.join(sep=$,) -> str
- *
+ * ary.join(sep=$,) -> str
+ *
* Returns a string created by converting each element of the array to
* a string, separated by <i>sep</i>.
- *
+ *
* [ "a", "b", "c" ].join #=> "abc"
* [ "a", "b", "c" ].join("-") #=> "a-b-c"
*/
static VALUE
-rb_ary_join_m(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
{
VALUE sep;
rb_scan_args(argc, argv, "01", &sep);
if (NIL_P(sep)) sep = rb_output_fs;
-
- return rb_ary_join(ary, sep);
-}
-
-/*
- * call-seq:
- * array.to_s -> string
- *
- * Returns _self_<code>.join</code>.
- *
- * [ "a", "e", "i", "o" ].to_s #=> "aeio"
- *
- */
-
-VALUE
-rb_ary_to_s(ary)
- VALUE ary;
-{
- if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
-
- return rb_ary_join(ary, rb_output_fs);
-}
-
-static ID inspect_key;
-
-struct inspect_arg {
- VALUE (*func)();
- VALUE arg1, arg2;
-};
-
-static VALUE
-inspect_call(arg)
- struct inspect_arg *arg;
-{
- return (*arg->func)(arg->arg1, arg->arg2);
-}
-
-static VALUE
-get_inspect_tbl(create)
- int create;
-{
- VALUE inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
-
- if (NIL_P(inspect_tbl)) {
- if (create) {
- tbl_init:
- inspect_tbl = rb_ary_new();
- rb_thread_local_aset(rb_thread_current(), inspect_key, inspect_tbl);
- }
- }
- else if (TYPE(inspect_tbl) != T_ARRAY) {
- rb_warn("invalid inspect_tbl value");
- if (create) goto tbl_init;
- rb_thread_local_aset(rb_thread_current(), inspect_key, Qnil);
- return Qnil;
- }
- return inspect_tbl;
-}
-
-static VALUE
-inspect_ensure(obj)
- VALUE obj;
-{
- VALUE inspect_tbl;
-
- inspect_tbl = get_inspect_tbl(Qfalse);
- if (!NIL_P(inspect_tbl)) {
- rb_ary_pop(inspect_tbl);
- }
- return 0;
-}
-
-VALUE
-rb_protect_inspect(func, obj, arg)
- VALUE (*func)(ANYARGS);
- VALUE obj, arg;
-{
- struct inspect_arg iarg;
- VALUE inspect_tbl;
- VALUE id;
- inspect_tbl = get_inspect_tbl(Qtrue);
- id = rb_obj_id(obj);
- if (rb_ary_includes(inspect_tbl, id)) {
- return (*func)(obj, arg);
- }
- rb_ary_push(inspect_tbl, id);
- iarg.func = func;
- iarg.arg1 = obj;
- iarg.arg2 = arg;
-
- return rb_ensure(inspect_call, (VALUE)&iarg, inspect_ensure, obj);
-}
-
-VALUE
-rb_inspecting_p(obj)
- VALUE obj;
-{
- VALUE inspect_tbl;
-
- inspect_tbl = get_inspect_tbl(Qfalse);
- if (NIL_P(inspect_tbl)) return Qfalse;
- return rb_ary_includes(inspect_tbl, rb_obj_id(obj));
+ return rb_ary_join(ary, sep);
}
static VALUE
-inspect_ary(ary)
- VALUE ary;
+inspect_ary(VALUE ary, VALUE dummy, int recur)
{
int tainted = OBJ_TAINTED(ary);
+ int untrust = OBJ_UNTRUSTED(ary);
long i;
VALUE s, str;
+ if (recur) return rb_usascii_str_new_cstr("[...]");
str = rb_str_buf_new2("[");
- for (i=0; i<RARRAY(ary)->len; i++) {
- s = rb_inspect(RARRAY(ary)->ptr[i]);
- if (OBJ_TAINTED(s)) tainted = Qtrue;
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ s = rb_inspect(RARRAY_PTR(ary)[i]);
+ if (OBJ_TAINTED(s)) tainted = TRUE;
+ if (OBJ_UNTRUSTED(s)) untrust = TRUE;
if (i > 0) rb_str_buf_cat2(str, ", ");
+ else rb_enc_copy(str, s);
rb_str_buf_append(str, s);
}
rb_str_buf_cat2(str, "]");
if (tainted) OBJ_TAINT(str);
+ if (untrust) OBJ_UNTRUST(str);
return str;
}
/*
* call-seq:
- * array.inspect -> string
+ * ary.to_s -> string
+ * ary.inspect -> string
*
- * Create a printable version of <i>array</i>.
+ * Creates a string representation of +self+.
*/
static VALUE
-rb_ary_inspect(ary)
- VALUE ary;
+rb_ary_inspect(VALUE ary)
{
- if (RARRAY(ary)->len == 0) return rb_str_new2("[]");
- if (rb_inspecting_p(ary)) return rb_str_new2("[...]");
- return rb_protect_inspect(inspect_ary, ary, 0);
+ if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
+ return rb_exec_recursive(inspect_ary, ary, 0);
+}
+
+VALUE
+rb_ary_to_s(VALUE ary)
+{
+ return rb_ary_inspect(ary);
}
/*
* call-seq:
- * array.to_a -> array
- *
- * Returns _self_. If called on a subclass of Array, converts
+ * ary.to_a -> ary
+ *
+ * Returns +self+. If called on a subclass of Array, converts
* the receiver to an Array object.
*/
static VALUE
-rb_ary_to_a(ary)
- VALUE ary;
+rb_ary_to_a(VALUE ary)
{
if (rb_obj_class(ary) != rb_cArray) {
- VALUE dup = rb_ary_new2(RARRAY(ary)->len);
+ VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
rb_ary_replace(dup, ary);
return dup;
}
@@ -1479,267 +1832,448 @@ rb_ary_to_a(ary)
/*
* call-seq:
- * array.to_ary -> array
- *
- * Returns _self_.
+ * ary.to_ary -> ary
+ *
+ * Returns +self+.
*/
static VALUE
-rb_ary_to_ary_m(ary)
- VALUE ary;
+rb_ary_to_ary_m(VALUE ary)
{
return ary;
}
+static void
+ary_reverse(p1, p2)
+ VALUE *p1, *p2;
+{
+ while (p1 < p2) {
+ VALUE tmp = *p1;
+ *p1++ = *p2;
+ *p2-- = tmp;
+ }
+}
+
VALUE
-rb_ary_reverse(ary)
- VALUE ary;
+rb_ary_reverse(VALUE ary)
{
VALUE *p1, *p2;
- VALUE tmp;
rb_ary_modify(ary);
- if (RARRAY(ary)->len > 1) {
- p1 = RARRAY(ary)->ptr;
- p2 = p1 + RARRAY(ary)->len - 1; /* points last item */
-
- while (p1 < p2) {
- tmp = *p1;
- *p1++ = *p2;
- *p2-- = tmp;
- }
+ if (RARRAY_LEN(ary) > 1) {
+ p1 = RARRAY_PTR(ary);
+ p2 = p1 + RARRAY_LEN(ary) - 1; /* points last item */
+ ary_reverse(p1, p2);
}
return ary;
}
/*
* call-seq:
- * array.reverse! -> array
- *
- * Reverses _self_ in place.
- *
+ * ary.reverse! -> ary
+ *
+ * Reverses +self+ in place.
+ *
* a = [ "a", "b", "c" ]
* a.reverse! #=> ["c", "b", "a"]
* a #=> ["c", "b", "a"]
*/
static VALUE
-rb_ary_reverse_bang(ary)
- VALUE ary;
+rb_ary_reverse_bang(VALUE ary)
{
return rb_ary_reverse(ary);
}
/*
* call-seq:
- * array.reverse -> an_array
- *
- * Returns a new array containing <i>self</i>'s elements in reverse order.
- *
+ * ary.reverse -> new_ary
+ *
+ * Returns a new array containing +self+'s elements in reverse order.
+ *
* [ "a", "b", "c" ].reverse #=> ["c", "b", "a"]
* [ 1 ].reverse #=> [1]
*/
static VALUE
-rb_ary_reverse_m(ary)
- VALUE ary;
+rb_ary_reverse_m(VALUE ary)
+{
+ long len = RARRAY_LEN(ary);
+ VALUE dup = rb_ary_new2(len);
+
+ if (len > 0) {
+ VALUE *p1 = RARRAY_PTR(ary);
+ VALUE *p2 = RARRAY_PTR(dup) + len - 1;
+ do *p2-- = *p1++; while (--len > 0);
+ }
+ ARY_SET_LEN(dup, RARRAY_LEN(ary));
+ return dup;
+}
+
+static inline long
+rotate_count(long cnt, long len)
+{
+ return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
+}
+
+VALUE
+rb_ary_rotate(VALUE ary, long cnt)
+{
+ rb_ary_modify(ary);
+
+ if (cnt != 0) {
+ VALUE *ptr = RARRAY_PTR(ary);
+ long len = RARRAY_LEN(ary);
+
+ if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
+ --len;
+ if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+ if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+ if (len > 0) ary_reverse(ptr, ptr + len);
+ return ary;
+ }
+ }
+
+ return Qnil;
+}
+
+/*
+ * call-seq:
+ * ary.rotate!(cnt=1) -> ary
+ *
+ * Rotates +self+ in place so that the element at +cnt+ comes first,
+ * and returns +self+. If +cnt+ is negative then it rotates in
+ * the opposite direction.
+ *
+ * a = [ "a", "b", "c", "d" ]
+ * a.rotate! #=> ["b", "c", "d", "a"]
+ * a #=> ["b", "c", "d", "a"]
+ * a.rotate!(2) #=> ["d", "a", "b", "c"]
+ * a.rotate!(-3) #=> ["a", "b", "c", "d"]
+ */
+
+static VALUE
+rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
{
- return rb_ary_reverse(rb_ary_dup(ary));
+ long n = 1;
+
+ switch (argc) {
+ case 1: n = NUM2LONG(argv[0]);
+ case 0: break;
+ default: rb_scan_args(argc, argv, "01", NULL);
+ }
+ rb_ary_rotate(ary, n);
+ return ary;
+}
+
+/*
+ * call-seq:
+ * ary.rotate(cnt=1) -> new_ary
+ *
+ * Returns new array by rotating +self+ so that the element at
+ * +cnt+ in +self+ is the first element of the new array. If +cnt+
+ * is negative then it rotates in the opposite direction.
+ *
+ * a = [ "a", "b", "c", "d" ]
+ * a.rotate #=> ["b", "c", "d", "a"]
+ * a #=> ["a", "b", "c", "d"]
+ * a.rotate(2) #=> ["c", "d", "a", "b"]
+ * a.rotate(-3) #=> ["b", "c", "d", "a"]
+ */
+
+static VALUE
+rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE rotated, *ptr, *ptr2;
+ long len, cnt = 1;
+
+ switch (argc) {
+ case 1: cnt = NUM2LONG(argv[0]);
+ case 0: break;
+ default: rb_scan_args(argc, argv, "01", NULL);
+ }
+
+ len = RARRAY_LEN(ary);
+ rotated = rb_ary_new2(len);
+ if (len > 0) {
+ cnt = rotate_count(cnt, len);
+ ptr = RARRAY_PTR(ary);
+ ptr2 = RARRAY_PTR(rotated);
+ len -= cnt;
+ MEMCPY(ptr2, ptr + cnt, VALUE, len);
+ MEMCPY(ptr2 + len, ptr, VALUE, cnt);
+ }
+ ARY_SET_LEN(rotated, RARRAY_LEN(ary));
+ return rotated;
}
struct ary_sort_data {
VALUE ary;
- VALUE *ptr;
- long len;
+ int opt_methods;
+ int opt_inited;
};
-static void
-ary_sort_check(data)
- struct ary_sort_data *data;
+enum {
+ sort_opt_Fixnum,
+ sort_opt_String,
+ sort_optimizable_count
+};
+
+#define STRING_P(s) (TYPE(s) == T_STRING && CLASS_OF(s) == rb_cString)
+
+#define SORT_OPTIMIZABLE_BIT(type) (1U << TOKEN_PASTE(sort_opt_,type))
+#define SORT_OPTIMIZABLE(data, type) \
+ (((data)->opt_inited & SORT_OPTIMIZABLE_BIT(type)) ? \
+ ((data)->opt_methods & SORT_OPTIMIZABLE_BIT(type)) : \
+ (((data)->opt_inited |= SORT_OPTIMIZABLE_BIT(type)), \
+ rb_method_basic_definition_p(TOKEN_PASTE(rb_c,type), id_cmp) && \
+ ((data)->opt_methods |= SORT_OPTIMIZABLE_BIT(type))))
+
+static VALUE
+sort_reentered(VALUE ary)
{
- if (RARRAY(data->ary)->ptr != data->ptr || RARRAY(data->ary)->len != data->len) {
- rb_raise(rb_eArgError, "array modified during sort");
+ if (RBASIC(ary)->klass) {
+ rb_raise(rb_eRuntimeError, "sort reentered");
}
+ return Qnil;
}
static int
-sort_1(a, b, data)
- VALUE *a, *b;
- struct ary_sort_data *data;
+sort_1(const void *ap, const void *bp, void *dummy)
{
- VALUE retval = rb_yield_values(2, *a, *b);
+ struct ary_sort_data *data = dummy;
+ VALUE retval = sort_reentered(data->ary);
+ VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
int n;
- n = rb_cmpint(retval, *a, *b);
- ary_sort_check(data);
+ retval = rb_yield_values(2, a, b);
+ n = rb_cmpint(retval, a, b);
+ sort_reentered(data->ary);
return n;
}
static int
-sort_2(ap, bp, data)
- VALUE *ap, *bp;
- struct ary_sort_data *data;
+sort_2(const void *ap, const void *bp, void *dummy)
{
- VALUE retval;
- VALUE a = *ap, b = *bp;
+ struct ary_sort_data *data = dummy;
+ VALUE retval = sort_reentered(data->ary);
+ VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
int n;
- if (FIXNUM_P(a) && FIXNUM_P(b)) {
+ if (FIXNUM_P(a) && FIXNUM_P(b) && SORT_OPTIMIZABLE(data, Fixnum)) {
if ((long)a > (long)b) return 1;
if ((long)a < (long)b) return -1;
return 0;
}
- if (TYPE(a) == T_STRING) {
- if (TYPE(b) == T_STRING) return rb_str_cmp(a, b);
+ if (STRING_P(a) && STRING_P(b) && SORT_OPTIMIZABLE(data, String)) {
+ return rb_str_cmp(a, b);
}
retval = rb_funcall(a, id_cmp, 1, b);
n = rb_cmpint(retval, a, b);
- ary_sort_check(data);
+ sort_reentered(data->ary);
return n;
}
-static VALUE
-sort_internal(ary)
- VALUE ary;
-{
- struct ary_sort_data data;
-
- data.ary = ary;
- data.ptr = RARRAY(ary)->ptr; data.len = RARRAY(ary)->len;
- qsort(RARRAY(ary)->ptr, RARRAY(ary)->len, sizeof(VALUE),
- rb_block_given_p()?sort_1:sort_2, &data);
- return ary;
-}
-
-static VALUE
-sort_unlock(ary)
- VALUE ary;
-{
- FL_UNSET(ary, ARY_TMPLOCK);
- return ary;
-}
-
/*
* call-seq:
- * array.sort! -> array
- * array.sort! {| a,b | block } -> array
- *
- * Sorts _self_. Comparisons for
+ * ary.sort! -> ary
+ * ary.sort! {| a,b | block } -> ary
+ *
+ * Sorts +self+. Comparisons for
* the sort will be done using the <code><=></code> operator or using
* an optional code block. The block implements a comparison between
* <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
* <code>Enumerable#sort_by</code>.
- *
+ *
* a = [ "d", "a", "e", "c", "b" ]
- * a.sort #=> ["a", "b", "c", "d", "e"]
- * a.sort {|x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
+ * a.sort! #=> ["a", "b", "c", "d", "e"]
+ * a.sort! {|x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
*/
VALUE
-rb_ary_sort_bang(ary)
- VALUE ary;
+rb_ary_sort_bang(VALUE ary)
{
rb_ary_modify(ary);
- if (RARRAY(ary)->len > 1) {
- FL_SET(ary, ARY_TMPLOCK); /* prohibit modification during sort */
- rb_ensure(sort_internal, ary, sort_unlock, ary);
+ assert(!ARY_SHARED_P(ary));
+ if (RARRAY_LEN(ary) > 1) {
+ VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+ struct ary_sort_data data;
+
+ RBASIC(tmp)->klass = 0;
+ data.ary = tmp;
+ data.opt_methods = 0;
+ data.opt_inited = 0;
+ ruby_qsort(RARRAY_PTR(tmp), RARRAY_LEN(tmp), sizeof(VALUE),
+ rb_block_given_p()?sort_1:sort_2, &data);
+
+ if (ARY_EMBED_P(tmp)) {
+ assert(ARY_EMBED_P(tmp));
+ if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
+ rb_ary_unshare(ary);
+ }
+ FL_SET_EMBED(ary);
+ MEMCPY(RARRAY_PTR(ary), ARY_EMBED_PTR(tmp), VALUE, ARY_EMBED_LEN(tmp));
+ ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
+ }
+ else {
+ assert(!ARY_EMBED_P(tmp));
+ if (ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
+ assert(!ARY_EMBED_P(ary));
+ FL_UNSET_SHARED(ary);
+ ARY_SET_CAPA(ary, ARY_CAPA(tmp));
+ }
+ else {
+ assert(!ARY_SHARED_P(tmp));
+ if (ARY_EMBED_P(ary)) {
+ FL_UNSET_EMBED(ary);
+ }
+ else if (ARY_SHARED_P(ary)) {
+ /* ary might be destructively operated in the given block */
+ rb_ary_unshare(ary);
+ }
+ else {
+ xfree(ARY_HEAP_PTR(ary));
+ }
+ ARY_SET_PTR(ary, RARRAY_PTR(tmp));
+ ARY_SET_HEAP_LEN(ary, RARRAY_LEN(tmp));
+ ARY_SET_CAPA(ary, ARY_CAPA(tmp));
+ }
+ /* tmp was lost ownership for the ptr */
+ FL_UNSET(tmp, FL_FREEZE);
+ FL_SET_EMBED(tmp);
+ ARY_SET_EMBED_LEN(tmp, 0);
+ FL_SET(tmp, FL_FREEZE);
+ }
+ /* tmp will be GC'ed. */
+ RBASIC(tmp)->klass = rb_cArray;
}
return ary;
}
/*
* call-seq:
- * array.sort -> an_array
- * array.sort {| a,b | block } -> an_array
- *
- * Returns a new array created by sorting <i>self</i>. Comparisons for
+ * ary.sort -> new_ary
+ * ary.sort {| a,b | block } -> new_ary
+ *
+ * Returns a new array created by sorting +self+. Comparisons for
* the sort will be done using the <code><=></code> operator or using
* an optional code block. The block implements a comparison between
* <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
* <code>Enumerable#sort_by</code>.
- *
+ *
* a = [ "d", "a", "e", "c", "b" ]
* a.sort #=> ["a", "b", "c", "d", "e"]
* a.sort {|x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
*/
VALUE
-rb_ary_sort(ary)
- VALUE ary;
+rb_ary_sort(VALUE ary)
{
ary = rb_ary_dup(ary);
rb_ary_sort_bang(ary);
return ary;
}
+
+static VALUE
+sort_by_i(VALUE i)
+{
+ return rb_yield(i);
+}
+
+/*
+ * call-seq:
+ * ary.sort_by! {| obj | block } -> ary
+ * ary.sort_by! -> an_enumerator
+ *
+ * Sorts +self+ in place using a set of keys generated by mapping the
+ * values in +self+ through the given block.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_sort_by_bang(VALUE ary)
+{
+ VALUE sorted;
+
+ RETURN_ENUMERATOR(ary, 0, 0);
+ rb_ary_modify(ary);
+ sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
+ rb_ary_replace(ary, sorted);
+ return ary;
+}
+
+
/*
* call-seq:
- * array.collect {|item| block } -> an_array
- * array.map {|item| block } -> an_array
- *
- * Invokes <i>block</i> once for each element of <i>self</i>. Creates a
+ * ary.collect {|item| block } -> new_ary
+ * ary.map {|item| block } -> new_ary
+ * ary.collect -> an_enumerator
+ * ary.map -> an_enumerator
+ *
+ * Invokes <i>block</i> once for each element of +self+. Creates a
* new array containing the values returned by the block.
* See also <code>Enumerable#collect</code>.
- *
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
* a = [ "a", "b", "c", "d" ]
* a.collect {|x| x + "!" } #=> ["a!", "b!", "c!", "d!"]
* a #=> ["a", "b", "c", "d"]
*/
static VALUE
-rb_ary_collect(ary)
- VALUE ary;
+rb_ary_collect(VALUE ary)
{
long i;
VALUE collect;
- if (!rb_block_given_p()) {
- return rb_ary_new4(RARRAY(ary)->len, RARRAY(ary)->ptr);
- }
-
- collect = rb_ary_new2(RARRAY(ary)->len);
- for (i = 0; i < RARRAY(ary)->len; i++) {
- rb_ary_push(collect, rb_yield(RARRAY(ary)->ptr[i]));
+ RETURN_ENUMERATOR(ary, 0, 0);
+ collect = rb_ary_new2(RARRAY_LEN(ary));
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_ary_push(collect, rb_yield(RARRAY_PTR(ary)[i]));
}
return collect;
}
-/*
+
+/*
* call-seq:
- * array.collect! {|item| block } -> array
- * array.map! {|item| block } -> array
+ * ary.collect! {|item| block } -> ary
+ * ary.map! {|item| block } -> ary
+ * ary.collect -> an_enumerator
+ * ary.map -> an_enumerator
*
- * Invokes the block once for each element of _self_, replacing the
+ * Invokes the block once for each element of +self+, replacing the
* element with the value returned by _block_.
* See also <code>Enumerable#collect</code>.
- *
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
* a = [ "a", "b", "c", "d" ]
* a.collect! {|x| x + "!" }
* a #=> [ "a!", "b!", "c!", "d!" ]
*/
static VALUE
-rb_ary_collect_bang(ary)
- VALUE ary;
+rb_ary_collect_bang(VALUE ary)
{
long i;
+ RETURN_ENUMERATOR(ary, 0, 0);
rb_ary_modify(ary);
- for (i = 0; i < RARRAY(ary)->len; i++) {
- rb_ary_store(ary, i, rb_yield(RARRAY(ary)->ptr[i]));
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_ary_store(ary, i, rb_yield(RARRAY_PTR(ary)[i]));
}
return ary;
}
VALUE
-rb_values_at(obj, olen, argc, argv, func)
- VALUE obj;
- long olen;
- int argc;
- VALUE *argv;
- VALUE (*func) _((VALUE,long));
+rb_get_values_at(VALUE obj, long olen, int argc, VALUE *argv, VALUE (*func) (VALUE, long))
{
VALUE result = rb_ary_new2(argc);
long beg, len, i, j;
@@ -1766,15 +2300,15 @@ rb_values_at(obj, olen, argc, argv, func)
return result;
}
-/*
+/*
* call-seq:
- * array.values_at(selector,... ) -> an_array
+ * ary.values_at(selector,... ) -> new_ary
*
* Returns an array containing the elements in
- * _self_ corresponding to the given selector(s). The selectors
- * may be either integer indices or ranges.
+ * +self+ corresponding to the given selector(s). The selectors
+ * may be either integer indices or ranges.
* See also <code>Array#select</code>.
- *
+ *
* a = %w{ a b c d e f }
* a.values_at(1, 3, 5)
* a.values_at(1, 3, 5, 7)
@@ -1783,36 +2317,37 @@ rb_values_at(obj, olen, argc, argv, func)
*/
static VALUE
-rb_ary_values_at(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
{
- return rb_values_at(ary, RARRAY(ary)->len, argc, argv, rb_ary_entry);
+ return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
}
+
/*
* call-seq:
- * array.select {|item| block } -> an_array
- *
- * Invokes the block passing in successive elements from <i>array</i>,
+ * ary.select {|item| block } -> new_ary
+ * ary.select -> an_enumerator
+ *
+ * Invokes the block passing in successive elements from +self+,
* returning an array containing those elements for which the block
* returns a true value (equivalent to <code>Enumerable#select</code>).
- *
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
* a = %w{ a b c d e f }
* a.select {|v| v =~ /[aeiou]/} #=> ["a", "e"]
*/
static VALUE
-rb_ary_select(ary)
- VALUE ary;
+rb_ary_select(VALUE ary)
{
VALUE result;
long i;
- result = rb_ary_new2(RARRAY(ary)->len);
- for (i = 0; i < RARRAY(ary)->len; i++) {
- if (RTEST(rb_yield(RARRAY(ary)->ptr[i]))) {
+ RETURN_ENUMERATOR(ary, 0, 0);
+ result = rb_ary_new2(RARRAY_LEN(ary));
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ if (RTEST(rb_yield(RARRAY_PTR(ary)[i]))) {
rb_ary_push(result, rb_ary_elt(ary, i));
}
}
@@ -1821,14 +2356,76 @@ rb_ary_select(ary)
/*
* call-seq:
- * array.delete(obj) -> obj or nil
- * array.delete(obj) { block } -> obj or nil
- *
- * Deletes items from <i>self</i> that are equal to <i>obj</i>. If
+ * ary.select! {|item| block } -> ary or nil
+ * ary.select! -> an_enumerator
+ *
+ * Invokes the block passing in successive elements from
+ * +self+, deleting elements for which the block returns a
+ * false value. It returns +self+ if changes were made,
+ * otherwise it returns <code>nil</code>.
+ * See also <code>Array#keep_if</code>
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_select_bang(VALUE ary)
+{
+ long i1, i2;
+
+ RETURN_ENUMERATOR(ary, 0, 0);
+ rb_ary_modify(ary);
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+ VALUE v = RARRAY_PTR(ary)[i1];
+ if (!RTEST(rb_yield(v))) continue;
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, v);
+ }
+ i2++;
+ }
+
+ if (RARRAY_LEN(ary) == i2) return Qnil;
+ if (i2 < RARRAY_LEN(ary))
+ ARY_SET_LEN(ary, i2);
+ return ary;
+}
+
+/*
+ * call-seq:
+ * ary.keep_if {|item| block } -> ary
+ * ary.keep_if -> an_enumerator
+ *
+ * Deletes every element of +self+ for which <i>block</i> evaluates
+ * to false.
+ * See also <code>Array#select!</code>
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * a = %w{ a b c d e f }
+ * a.keep_if {|v| v =~ /[aeiou]/} #=> ["a", "e"]
+ */
+
+static VALUE
+rb_ary_keep_if(VALUE ary)
+{
+ RETURN_ENUMERATOR(ary, 0, 0);
+ rb_ary_select_bang(ary);
+ return ary;
+}
+
+/*
+ * call-seq:
+ * ary.delete(obj) -> obj or nil
+ * ary.delete(obj) { block } -> obj or nil
+ *
+ * Deletes items from +self+ that are equal to <i>obj</i>.
+ * If any items are found, returns <i>obj</i>. If
* the item is not found, returns <code>nil</code>. If the optional
* code block is given, returns the result of <i>block</i> if the item
- * is not found.
- *
+ * is not found. (To remove <code>nil</code> elements and
+ * get an informative return value, use #compact!)
+ *
* a = [ "a", "b", "b", "b", "c" ]
* a.delete("b") #=> "b"
* a #=> ["a", "c"]
@@ -1837,22 +2434,24 @@ rb_ary_select(ary)
*/
VALUE
-rb_ary_delete(ary, item)
- VALUE ary;
- VALUE item;
+rb_ary_delete(VALUE ary, VALUE item)
{
+ VALUE v = item;
long i1, i2;
- for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
- VALUE e = RARRAY(ary)->ptr[i1];
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+ VALUE e = RARRAY_PTR(ary)[i1];
- if (rb_equal(e, item)) continue;
+ if (rb_equal(e, item)) {
+ v = e;
+ continue;
+ }
if (i1 != i2) {
rb_ary_store(ary, i2, e);
}
i2++;
}
- if (RARRAY(ary)->len == i2) {
+ if (RARRAY_LEN(ary) == i2) {
if (rb_block_given_p()) {
return rb_yield(item);
}
@@ -1860,24 +2459,21 @@ rb_ary_delete(ary, item)
}
rb_ary_modify(ary);
- if (RARRAY(ary)->len > i2) {
- RARRAY(ary)->len = i2;
- if (i2 * 2 < RARRAY(ary)->aux.capa &&
- RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
- REALLOC_N(RARRAY(ary)->ptr, VALUE, i2 * 2);
- RARRAY(ary)->aux.capa = i2 * 2;
+ if (RARRAY_LEN(ary) > i2) {
+ ARY_SET_LEN(ary, i2);
+ if (i2 * 2 < ARY_CAPA(ary) &&
+ ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+ ary_resize_capa(ary, i2*2);
}
}
- return item;
+ return v;
}
VALUE
-rb_ary_delete_at(ary, pos)
- VALUE ary;
- long pos;
+rb_ary_delete_at(VALUE ary, long pos)
{
- long i, len = RARRAY(ary)->len;
+ long len = RARRAY_LEN(ary);
VALUE del;
if (pos >= len) return Qnil;
@@ -1887,23 +2483,22 @@ rb_ary_delete_at(ary, pos)
}
rb_ary_modify(ary);
- del = RARRAY(ary)->ptr[pos];
- for (i = pos + 1; i < len; i++, pos++) {
- RARRAY(ary)->ptr[pos] = RARRAY(ary)->ptr[i];
- }
- RARRAY(ary)->len = pos;
+ del = RARRAY_PTR(ary)[pos];
+ MEMMOVE(RARRAY_PTR(ary)+pos, RARRAY_PTR(ary)+pos+1, VALUE,
+ RARRAY_LEN(ary)-pos-1);
+ ARY_INCREASE_LEN(ary, -1);
return del;
}
/*
* call-seq:
- * array.delete_at(index) -> obj or nil
- *
+ * ary.delete_at(index) -> obj or nil
+ *
* Deletes the element at the specified index, returning that element,
* or <code>nil</code> if the index is out of range. See also
* <code>Array#slice!</code>.
- *
+ *
* a = %w( ant bat cat dog )
* a.delete_at(2) #=> "cat"
* a #=> ["ant", "bat", "dog"]
@@ -1911,28 +2506,21 @@ rb_ary_delete_at(ary, pos)
*/
static VALUE
-rb_ary_delete_at_m(ary, pos)
- VALUE ary, pos;
+rb_ary_delete_at_m(VALUE ary, VALUE pos)
{
return rb_ary_delete_at(ary, NUM2LONG(pos));
}
/*
* call-seq:
- * array.slice!(index) -> obj or nil
- * array.slice!(start, length) -> sub_array or nil
- * array.slice!(range) -> sub_array or nil
- *
+ * ary.slice!(index) -> obj or nil
+ * ary.slice!(start, length) -> new_ary or nil
+ * ary.slice!(range) -> new_ary or nil
+ *
* Deletes the element(s) given by an index (optionally with a length)
- * or by a range. Returns the deleted object, subarray, or
- * <code>nil</code> if the index is out of range. Equivalent to:
- *
- * def slice!(*args)
- * result = self[*args]
- * self[*args] = nil
- * result
- * end
- *
+ * or by a range. Returns the deleted object (or objects), or
+ * <code>nil</code> if the index is out of range.
+ *
* a = [ "a", "b", "c" ]
* a.slice!(1) #=> "b"
* a #=> ["a", "c"]
@@ -1943,194 +2531,269 @@ rb_ary_delete_at_m(ary, pos)
*/
static VALUE
-rb_ary_slice_bang(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
{
VALUE arg1, arg2;
- long pos, len;
+ long pos, len, orig_len;
- if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
- pos = NUM2LONG(arg1);
- len = NUM2LONG(arg2);
+ rb_ary_modify_check(ary);
+ if (argc == 2) {
+ pos = NUM2LONG(argv[0]);
+ len = NUM2LONG(argv[1]);
delete_pos_len:
+ if (len < 0) return Qnil;
+ orig_len = RARRAY_LEN(ary);
if (pos < 0) {
- pos = RARRAY(ary)->len + pos;
+ pos += orig_len;
+ if (pos < 0) return Qnil;
}
- arg2 = rb_ary_subseq(ary, pos, len);
- rb_ary_splice(ary, pos, len, Qnil); /* Qnil/rb_ary_new2(0) */
+ else if (orig_len < pos) return Qnil;
+ if (orig_len < pos + len) {
+ len = orig_len - pos;
+ }
+ if (len == 0) return rb_ary_new2(0);
+ arg2 = rb_ary_new4(len, RARRAY_PTR(ary)+pos);
+ RBASIC(arg2)->klass = rb_obj_class(ary);
+ rb_ary_splice(ary, pos, len, Qundef);
return arg2;
}
- if (!FIXNUM_P(arg1) && rb_range_beg_len(arg1, &pos, &len, RARRAY(ary)->len, 1)) {
- goto delete_pos_len;
+ if (argc != 1) {
+ /* error report */
+ rb_scan_args(argc, argv, "11", NULL, NULL);
+ }
+ arg1 = argv[0];
+
+ if (!FIXNUM_P(arg1)) {
+ switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+ case Qtrue:
+ /* valid range */
+ goto delete_pos_len;
+ case Qnil:
+ /* invalid range */
+ return Qnil;
+ default:
+ /* not a range */
+ break;
+ }
}
return rb_ary_delete_at(ary, NUM2LONG(arg1));
}
-/*
- * call-seq:
- * array.reject! {|item| block } -> array or nil
- *
- * Equivalent to <code>Array#delete_if</code>, deleting elements from
- * _self_ for which the block evaluates to true, but returns
- * <code>nil</code> if no changes were made. Also see
- * <code>Enumerable#reject</code>.
- */
+static VALUE
+ary_reject(VALUE orig, VALUE result)
+{
+ long i;
+
+ for (i = 0; i < RARRAY_LEN(orig); i++) {
+ VALUE v = RARRAY_PTR(orig)[i];
+ if (!RTEST(rb_yield(v))) {
+ rb_ary_push_1(result, v);
+ }
+ }
+ return result;
+}
static VALUE
-rb_ary_reject_bang(ary)
- VALUE ary;
+ary_reject_bang(VALUE ary)
{
- long i1, i2;
+ long i;
+ VALUE result = Qnil;
- rb_ary_modify(ary);
- for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
- VALUE v = RARRAY(ary)->ptr[i1];
- if (RTEST(rb_yield(v))) continue;
- if (i1 != i2) {
- rb_ary_store(ary, i2, v);
+ rb_ary_modify_check(ary);
+ for (i = 0; i < RARRAY_LEN(ary); ) {
+ VALUE v = RARRAY_PTR(ary)[i];
+ if (RTEST(rb_yield(v))) {
+ rb_ary_delete_at(ary, i);
+ result = ary;
+ }
+ else {
+ i++;
}
- i2++;
}
- if (RARRAY(ary)->len == i2) return Qnil;
- if (i2 < RARRAY(ary)->len)
- RARRAY(ary)->len = i2;
+ return result;
+}
- return ary;
+/*
+ * call-seq:
+ * ary.reject! {|item| block } -> ary or nil
+ * ary.reject! -> an_enumerator
+ *
+ * Equivalent to <code>Array#delete_if</code>, deleting elements from
+ * +self+ for which the block evaluates to true, but returns
+ * <code>nil</code> if no changes were made.
+ * The array is changed instantly every time the block is called and
+ * not after the iteration is over.
+ * See also <code>Enumerable#reject</code> and <code>Array#delete_if</code>.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_reject_bang(VALUE ary)
+{
+ RETURN_ENUMERATOR(ary, 0, 0);
+ return ary_reject_bang(ary);
}
/*
* call-seq:
- * array.reject {|item| block } -> an_array
- *
- * Returns a new array containing the items in _self_
+ * ary.reject {|item| block } -> new_ary
+ * ary.reject -> an_enumerator
+ *
+ * Returns a new array containing the items in +self+
* for which the block is not true.
+ * See also <code>Array#delete_if</code>
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
*/
static VALUE
-rb_ary_reject(ary)
- VALUE ary;
+rb_ary_reject(VALUE ary)
{
- ary = rb_ary_dup(ary);
- rb_ary_reject_bang(ary);
- return ary;
+ VALUE rejected_ary;
+
+ RETURN_ENUMERATOR(ary, 0, 0);
+ rejected_ary = rb_ary_new();
+ ary_reject(ary, rejected_ary);
+ return rejected_ary;
}
/*
* call-seq:
- * array.delete_if {|item| block } -> array
- *
- * Deletes every element of <i>self</i> for which <i>block</i> evaluates
- * to <code>true</code>.
- *
+ * ary.delete_if {|item| block } -> ary
+ * ary.delete_if -> an_enumerator
+ *
+ * Deletes every element of +self+ for which <i>block</i> evaluates
+ * to true.
+ * The array is changed instantly every time the block is called and
+ * not after the iteration is over.
+ * See also <code>Array#reject!</code>
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
* a = [ "a", "b", "c" ]
* a.delete_if {|x| x >= "b" } #=> ["a"]
*/
static VALUE
-rb_ary_delete_if(ary)
- VALUE ary;
+rb_ary_delete_if(VALUE ary)
{
- rb_ary_reject_bang(ary);
+ RETURN_ENUMERATOR(ary, 0, 0);
+ ary_reject_bang(ary);
return ary;
}
+static VALUE
+take_i(VALUE val, VALUE *args, int argc, VALUE *argv)
+{
+ if (args[1]-- == 0) rb_iter_break();
+ if (argc > 1) val = rb_ary_new4(argc, argv);
+ rb_ary_push(args[0], val);
+ return Qnil;
+}
+
+static VALUE
+take_items(VALUE obj, long n)
+{
+ VALUE result = rb_check_array_type(obj);
+ VALUE args[2];
+
+ if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
+ result = rb_ary_new2(n);
+ args[0] = result; args[1] = (VALUE)n;
+ rb_block_call(obj, rb_intern("each"), 0, 0, take_i, (VALUE)args);
+ return result;
+}
+
+
/*
* call-seq:
- * array.zip(arg, ...) -> an_array
- * array.zip(arg, ...) {| arr | block } -> nil
- *
+ * ary.zip(arg, ...) -> new_ary
+ * ary.zip(arg, ...) {| arr | block } -> nil
+ *
* Converts any arguments to arrays, then merges elements of
- * <i>self</i> with corresponding elements from each argument. This
+ * +self+ with corresponding elements from each argument. This
* generates a sequence of <code>self.size</code> <em>n</em>-element
* arrays, where <em>n</em> is one more that the count of arguments. If
* the size of any argument is less than <code>enumObj.size</code>,
- * <code>nil</code> values are supplied. If a block given, it is
+ * <code>nil</code> values are supplied. If a block is given, it is
* invoked for each output array, otherwise an array of arrays is
* returned.
- *
+ *
* a = [ 4, 5, 6 ]
* b = [ 7, 8, 9 ]
- *
* [1,2,3].zip(a, b) #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
* [1,2].zip(a,b) #=> [[1, 4, 7], [2, 5, 8]]
* a.zip([1,2],[8]) #=> [[4,1,8], [5,2,nil], [6,nil,nil]]
*/
static VALUE
-rb_ary_zip(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_zip(int argc, VALUE *argv, VALUE ary)
{
int i, j;
long len;
- VALUE result;
+ VALUE result = Qnil;
+ len = RARRAY_LEN(ary);
for (i=0; i<argc; i++) {
- argv[i] = to_ary(argv[i]);
+ argv[i] = take_items(argv[i], len);
}
- if (rb_block_given_p()) {
- for (i=0; i<RARRAY(ary)->len; i++) {
- VALUE tmp = rb_ary_new2(argc+1);
-
- rb_ary_push(tmp, rb_ary_elt(ary, i));
- for (j=0; j<argc; j++) {
- rb_ary_push(tmp, rb_ary_elt(argv[j], i));
- }
- rb_yield(tmp);
- }
- return Qnil;
+ if (!rb_block_given_p()) {
+ result = rb_ary_new2(len);
}
- len = RARRAY(ary)->len;
- result = rb_ary_new2(len);
- for (i=0; i<len; i++) {
+
+ for (i=0; i<RARRAY_LEN(ary); i++) {
VALUE tmp = rb_ary_new2(argc+1);
rb_ary_push(tmp, rb_ary_elt(ary, i));
for (j=0; j<argc; j++) {
rb_ary_push(tmp, rb_ary_elt(argv[j], i));
}
- rb_ary_push(result, tmp);
+ if (NIL_P(result)) {
+ rb_yield(tmp);
+ }
+ else {
+ rb_ary_push(result, tmp);
+ }
}
return result;
}
/*
* call-seq:
- * array.transpose -> an_array
- *
- * Assumes that <i>self</i> is an array of arrays and transposes the
+ * ary.transpose -> new_ary
+ *
+ * Assumes that +self+ is an array of arrays and transposes the
* rows and columns.
- *
+ *
* a = [[1,2], [3,4], [5,6]]
* a.transpose #=> [[1, 3, 5], [2, 4, 6]]
*/
static VALUE
-rb_ary_transpose(ary)
- VALUE ary;
+rb_ary_transpose(VALUE ary)
{
long elen = -1, alen, i, j;
VALUE tmp, result = 0;
- alen = RARRAY(ary)->len;
+ alen = RARRAY_LEN(ary);
if (alen == 0) return rb_ary_dup(ary);
for (i=0; i<alen; i++) {
tmp = to_ary(rb_ary_elt(ary, i));
if (elen < 0) { /* first element */
- elen = RARRAY(tmp)->len;
+ elen = RARRAY_LEN(tmp);
result = rb_ary_new2(elen);
for (j=0; j<elen; j++) {
rb_ary_store(result, j, rb_ary_new2(alen));
}
}
- else if (elen != RARRAY(tmp)->len) {
- rb_raise(rb_eIndexError, "element size differs (%d should be %d)",
- RARRAY(tmp)->len, elen);
+ else if (elen != RARRAY_LEN(tmp)) {
+ rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+ RARRAY_LEN(tmp), elen);
}
for (j=0; j<elen; j++) {
rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
@@ -2141,75 +2804,102 @@ rb_ary_transpose(ary)
/*
* call-seq:
- * array.replace(other_array) -> array
- *
- * Replaces the contents of <i>self</i> with the contents of
- * <i>other_array</i>, truncating or expanding if necessary.
- *
+ * ary.replace(other_ary) -> ary
+ *
+ * Replaces the contents of +self+ with the contents of
+ * <i>other_ary</i>, truncating or expanding if necessary.
+ *
* a = [ "a", "b", "c", "d", "e" ]
* a.replace([ "x", "y", "z" ]) #=> ["x", "y", "z"]
* a #=> ["x", "y", "z"]
*/
-static VALUE
-rb_ary_replace(copy, orig)
- VALUE copy, orig;
+VALUE
+rb_ary_replace(VALUE copy, VALUE orig)
{
- VALUE shared;
-
- rb_ary_modify(copy);
+ rb_ary_modify_check(copy);
orig = to_ary(orig);
if (copy == orig) return copy;
- shared = ary_make_shared(orig);
- if (RARRAY(copy)->ptr && !FL_TEST(copy, ELTS_SHARED))
- free(RARRAY(copy)->ptr);
- RARRAY(copy)->ptr = RARRAY(orig)->ptr;
- RARRAY(copy)->len = RARRAY(orig)->len;
- RARRAY(copy)->aux.shared = shared;
- FL_SET(copy, ELTS_SHARED);
+ if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
+ VALUE *ptr;
+ VALUE shared = 0;
+
+ if (ARY_OWNS_HEAP_P(copy)) {
+ xfree(RARRAY_PTR(copy));
+ }
+ else if (ARY_SHARED_P(copy)) {
+ shared = ARY_SHARED(copy);
+ FL_UNSET_SHARED(copy);
+ }
+ FL_SET_EMBED(copy);
+ ptr = RARRAY_PTR(orig);
+ MEMCPY(RARRAY_PTR(copy), ptr, VALUE, RARRAY_LEN(orig));
+ if (shared) {
+ rb_ary_decrement_share(shared);
+ }
+ ARY_SET_LEN(copy, RARRAY_LEN(orig));
+ }
+ else {
+ VALUE shared = ary_make_shared(orig);
+ if (ARY_OWNS_HEAP_P(copy)) {
+ xfree(RARRAY_PTR(copy));
+ }
+ else {
+ rb_ary_unshare_safe(copy);
+ }
+ FL_UNSET_EMBED(copy);
+ ARY_SET_PTR(copy, RARRAY_PTR(orig));
+ ARY_SET_LEN(copy, RARRAY_LEN(orig));
+ rb_ary_set_shared(copy, shared);
+ }
return copy;
}
-/*
+/*
* call-seq:
- * array.clear -> array
+ * ary.clear -> ary
*
- * Removes all elements from _self_.
+ * Removes all elements from +self+.
*
* a = [ "a", "b", "c", "d", "e" ]
* a.clear #=> [ ]
*/
VALUE
-rb_ary_clear(ary)
- VALUE ary;
+rb_ary_clear(VALUE ary)
{
- rb_ary_modify(ary);
- RARRAY(ary)->len = 0;
- if (ARY_DEFAULT_SIZE * 2 < RARRAY(ary)->aux.capa) {
- REALLOC_N(RARRAY(ary)->ptr, VALUE, ARY_DEFAULT_SIZE * 2);
- RARRAY(ary)->aux.capa = ARY_DEFAULT_SIZE * 2;
+ rb_ary_modify_check(ary);
+ ARY_SET_LEN(ary, 0);
+ if (ARY_SHARED_P(ary)) {
+ if (!ARY_EMBED_P(ary)) {
+ rb_ary_unshare(ary);
+ FL_SET_EMBED(ary);
+ }
+ }
+ else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+ ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
}
return ary;
}
/*
* call-seq:
- * array.fill(obj) -> array
- * array.fill(obj, start [, length]) -> array
- * array.fill(obj, range ) -> array
- * array.fill {|index| block } -> array
- * array.fill(start [, length] ) {|index| block } -> array
- * array.fill(range) {|index| block } -> array
- *
- * The first three forms set the selected elements of <i>self</i> (which
+ * ary.fill(obj) -> ary
+ * ary.fill(obj, start [, length]) -> ary
+ * ary.fill(obj, range ) -> ary
+ * ary.fill {|index| block } -> ary
+ * ary.fill(start [, length] ) {|index| block } -> ary
+ * ary.fill(range) {|index| block } -> ary
+ *
+ * The first three forms set the selected elements of +self+ (which
* may be the entire array) to <i>obj</i>. A <i>start</i> of
* <code>nil</code> is equivalent to zero. A <i>length</i> of
* <code>nil</code> is equivalent to <i>self.length</i>. The last three
* forms fill the array with the value of the block. The block is
* passed the absolute index of each element to be filled.
- *
+ * Negative values of <i>start</i> count from the end of the array.
+ *
* a = [ "a", "b", "c", "d" ]
* a.fill("x") #=> ["x", "x", "x", "x"]
* a.fill("z", 2, 2) #=> ["x", "x", "z", "z"]
@@ -2219,18 +2909,15 @@ rb_ary_clear(ary)
*/
static VALUE
-rb_ary_fill(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_fill(int argc, VALUE *argv, VALUE ary)
{
VALUE item, arg1, arg2;
long beg = 0, end = 0, len = 0;
VALUE *p, *pend;
- int block_p = Qfalse;
+ int block_p = FALSE;
if (rb_block_given_p()) {
- block_p = Qtrue;
+ block_p = TRUE;
rb_scan_args(argc, argv, "02", &arg1, &arg2);
argc += 1; /* hackish */
}
@@ -2240,31 +2927,36 @@ rb_ary_fill(argc, argv, ary)
switch (argc) {
case 1:
beg = 0;
- len = RARRAY(ary)->len;
+ len = RARRAY_LEN(ary);
break;
case 2:
- if (rb_range_beg_len(arg1, &beg, &len, RARRAY(ary)->len, 1)) {
+ if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
break;
}
/* fall through */
case 3:
beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
if (beg < 0) {
- beg = RARRAY(ary)->len + beg;
+ beg = RARRAY_LEN(ary) + beg;
if (beg < 0) beg = 0;
}
- len = NIL_P(arg2) ? RARRAY(ary)->len - beg : NUM2LONG(arg2);
+ len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
break;
}
rb_ary_modify(ary);
+ if (len < 0) {
+ return ary;
+ }
+ if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
+ rb_raise(rb_eArgError, "argument too big");
+ }
end = beg + len;
- if (end > RARRAY(ary)->len) {
- if (end >= RARRAY(ary)->aux.capa) {
- REALLOC_N(RARRAY(ary)->ptr, VALUE, end);
- RARRAY(ary)->aux.capa = end;
+ if (RARRAY_LEN(ary) < end) {
+ if (end >= ARY_CAPA(ary)) {
+ ary_resize_capa(ary, end);
}
- rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, end - RARRAY(ary)->len);
- RARRAY(ary)->len = end;
+ rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+ ARY_SET_LEN(ary, end);
}
if (block_p) {
@@ -2273,12 +2965,12 @@ rb_ary_fill(argc, argv, ary)
for (i=beg; i<end; i++) {
v = rb_yield(LONG2NUM(i));
- if (i>=RARRAY(ary)->len) break;
- RARRAY(ary)->ptr[i] = v;
+ if (i>=RARRAY_LEN(ary)) break;
+ RARRAY_PTR(ary)[i] = v;
}
}
else {
- p = RARRAY(ary)->ptr + beg;
+ p = RARRAY_PTR(ary) + beg;
pend = p + len;
while (p < pend) {
*p++ = item;
@@ -2287,62 +2979,61 @@ rb_ary_fill(argc, argv, ary)
return ary;
}
-/*
+/*
* call-seq:
- * array + other_array -> an_array
+ * ary + other_ary -> new_ary
*
* Concatenation---Returns a new array built by concatenating the
* two arrays together to produce a third array.
- *
+ *
* [ 1, 2, 3 ] + [ 4, 5 ] #=> [ 1, 2, 3, 4, 5 ]
*/
VALUE
-rb_ary_plus(x, y)
- VALUE x, y;
+rb_ary_plus(VALUE x, VALUE y)
{
VALUE z;
long len;
y = to_ary(y);
- len = RARRAY(x)->len + RARRAY(y)->len;
+ len = RARRAY_LEN(x) + RARRAY_LEN(y);
z = rb_ary_new2(len);
- MEMCPY(RARRAY(z)->ptr, RARRAY(x)->ptr, VALUE, RARRAY(x)->len);
- MEMCPY(RARRAY(z)->ptr + RARRAY(x)->len, RARRAY(y)->ptr, VALUE, RARRAY(y)->len);
- RARRAY(z)->len = len;
+ MEMCPY(RARRAY_PTR(z), RARRAY_PTR(x), VALUE, RARRAY_LEN(x));
+ MEMCPY(RARRAY_PTR(z) + RARRAY_LEN(x), RARRAY_PTR(y), VALUE, RARRAY_LEN(y));
+ ARY_SET_LEN(z, len);
return z;
}
-/*
+/*
* call-seq:
- * array.concat(other_array) -> array
+ * ary.concat(other_ary) -> ary
+ *
+ * Appends the elements of <i>other_ary</i> to +self+.
*
- * Appends the elements in other_array to _self_.
- *
* [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
*/
VALUE
-rb_ary_concat(x, y)
- VALUE x, y;
+rb_ary_concat(VALUE x, VALUE y)
{
+ rb_ary_modify_check(x);
y = to_ary(y);
- if (RARRAY(y)->len > 0) {
- rb_ary_splice(x, RARRAY(x)->len, 0, y);
+ if (RARRAY_LEN(y) > 0) {
+ rb_ary_splice(x, RARRAY_LEN(x), 0, y);
}
return x;
}
-/*
+/*
* call-seq:
- * array * int -> an_array
- * array * str -> a_string
+ * ary * int -> new_ary
+ * ary * str -> new_string
*
* Repetition---With a String argument, equivalent to
* self.join(str). Otherwise, returns a new array
- * built by concatenating the _int_ copies of _self_.
+ * built by concatenating the _int_ copies of +self+.
*
*
* [ 1, 2, 3 ] * 3 #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
@@ -2351,11 +3042,10 @@ rb_ary_concat(x, y)
*/
static VALUE
-rb_ary_times(ary, times)
- VALUE ary, times;
+rb_ary_times(VALUE ary, VALUE times)
{
- VALUE ary2, tmp;
- long i, len;
+ VALUE ary2, tmp, *ptr, *ptr2;
+ long t, len;
tmp = rb_check_string_type(times);
if (!NIL_P(tmp)) {
@@ -2363,29 +3053,43 @@ rb_ary_times(ary, times)
}
len = NUM2LONG(times);
- if (len == 0) return ary_new(rb_obj_class(ary), 0);
+ if (len == 0) {
+ ary2 = ary_new(rb_obj_class(ary), 0);
+ goto out;
+ }
if (len < 0) {
rb_raise(rb_eArgError, "negative argument");
}
- if (LONG_MAX/len < RARRAY(ary)->len) {
+ if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
rb_raise(rb_eArgError, "argument too big");
}
- len *= RARRAY(ary)->len;
+ len *= RARRAY_LEN(ary);
ary2 = ary_new(rb_obj_class(ary), len);
- RARRAY(ary2)->len = len;
-
- for (i=0; i<len; i+=RARRAY(ary)->len) {
- MEMCPY(RARRAY(ary2)->ptr+i, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+ ARY_SET_LEN(ary2, len);
+
+ ptr = RARRAY_PTR(ary);
+ ptr2 = RARRAY_PTR(ary2);
+ t = RARRAY_LEN(ary);
+ if (0 < t) {
+ MEMCPY(ptr2, ptr, VALUE, t);
+ while (t <= len/2) {
+ MEMCPY(ptr2+t, ptr2, VALUE, t);
+ t *= 2;
+ }
+ if (t < len) {
+ MEMCPY(ptr2+t, ptr2, VALUE, len-t);
+ }
}
+ out:
OBJ_INFECT(ary2, ary);
return ary2;
}
-/*
+/*
* call-seq:
- * array.assoc(obj) -> an_array or nil
+ * ary.assoc(obj) -> new_ary or nil
*
* Searches through an array whose elements are also arrays
* comparing _obj_ with the first element of each contained array
@@ -2404,17 +3108,15 @@ rb_ary_times(ary, times)
*/
VALUE
-rb_ary_assoc(ary, key)
- VALUE ary, key;
+rb_ary_assoc(VALUE ary, VALUE key)
{
long i;
VALUE v;
- for (i = 0; i < RARRAY(ary)->len; ++i) {
- v = RARRAY(ary)->ptr[i];
- if (TYPE(v) == T_ARRAY &&
- RARRAY(v)->len > 0 &&
- rb_equal(RARRAY(v)->ptr[0], key))
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ v = rb_check_array_type(RARRAY_PTR(ary)[i]);
+ if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+ rb_equal(RARRAY_PTR(v)[0], key))
return v;
}
return Qnil;
@@ -2422,38 +3124,50 @@ rb_ary_assoc(ary, key)
/*
* call-seq:
- * array.rassoc(key) -> an_array or nil
- *
+ * ary.rassoc(obj) -> new_ary or nil
+ *
* Searches through the array whose elements are also arrays. Compares
- * <em>key</em> with the second element of each contained array using
+ * _obj_ with the second element of each contained array using
* <code>==</code>. Returns the first contained array that matches. See
* also <code>Array#assoc</code>.
- *
+ *
* a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
* a.rassoc("two") #=> [2, "two"]
* a.rassoc("four") #=> nil
*/
VALUE
-rb_ary_rassoc(ary, value)
- VALUE ary, value;
+rb_ary_rassoc(VALUE ary, VALUE value)
{
long i;
VALUE v;
- for (i = 0; i < RARRAY(ary)->len; ++i) {
- v = RARRAY(ary)->ptr[i];
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ v = RARRAY_PTR(ary)[i];
if (TYPE(v) == T_ARRAY &&
- RARRAY(v)->len > 1 &&
- rb_equal(RARRAY(v)->ptr[1], value))
+ RARRAY_LEN(v) > 1 &&
+ rb_equal(RARRAY_PTR(v)[1], value))
return v;
}
return Qnil;
}
-/*
+static VALUE
+recursive_equal(VALUE ary1, VALUE ary2, int recur)
+{
+ long i;
+
+ if (recur) return Qtrue; /* Subtle! */
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ if (!rb_equal(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+ return Qfalse;
+ }
+ return Qtrue;
+}
+
+/*
* call-seq:
- * array == other_array -> bool
+ * ary == other_ary -> bool
*
* Equality---Two arrays are equal if they contain the same number
* of elements and if each element is equal to (according to
@@ -2466,11 +3180,8 @@ rb_ary_rassoc(ary, value)
*/
static VALUE
-rb_ary_equal(ary1, ary2)
- VALUE ary1, ary2;
+rb_ary_equal(VALUE ary1, VALUE ary2)
{
- long i;
-
if (ary1 == ary2) return Qtrue;
if (TYPE(ary2) != T_ARRAY) {
if (!rb_respond_to(ary2, rb_intern("to_ary"))) {
@@ -2478,9 +3189,18 @@ rb_ary_equal(ary1, ary2)
}
return rb_equal(ary2, ary1);
}
- if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
- for (i=0; i<RARRAY(ary1)->len; i++) {
- if (!rb_equal(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+ if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+ return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
+}
+
+static VALUE
+recursive_eql(VALUE ary1, VALUE ary2, int recur)
+{
+ long i;
+
+ if (recur) return Qtrue; /* Subtle! */
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
return Qfalse;
}
return Qtrue;
@@ -2488,74 +3208,76 @@ rb_ary_equal(ary1, ary2)
/*
* call-seq:
- * array.eql?(other) -> true or false
+ * ary.eql?(other) -> true or false
*
- * Returns <code>true</code> if _array_ and _other_ are the same object,
+ * Returns <code>true</code> if +self+ and _other_ are the same object,
* or are both arrays with the same content.
*/
static VALUE
-rb_ary_eql(ary1, ary2)
- VALUE ary1, ary2;
+rb_ary_eql(VALUE ary1, VALUE ary2)
{
- long i;
-
if (ary1 == ary2) return Qtrue;
if (TYPE(ary2) != T_ARRAY) return Qfalse;
- if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
- for (i=0; i<RARRAY(ary1)->len; i++) {
- if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
- return Qfalse;
+ if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+ return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
+}
+
+static VALUE
+recursive_hash(VALUE ary, VALUE dummy, int recur)
+{
+ long i;
+ st_index_t h;
+ VALUE n;
+
+ h = rb_hash_start(RARRAY_LEN(ary));
+ if (recur) {
+ h = rb_hash_uint(h, NUM2LONG(rb_hash(rb_cArray)));
}
- return Qtrue;
+ else {
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ n = rb_hash(RARRAY_PTR(ary)[i]);
+ h = rb_hash_uint(h, NUM2LONG(n));
+ }
+ }
+ h = rb_hash_end(h);
+ return LONG2FIX(h);
}
/*
* call-seq:
- * array.hash -> fixnum
+ * ary.hash -> fixnum
*
* Compute a hash-code for this array. Two arrays with the same content
* will have the same hash code (and will compare using <code>eql?</code>).
*/
static VALUE
-rb_ary_hash(ary)
- VALUE ary;
+rb_ary_hash(VALUE ary)
{
- long i, h;
- VALUE n;
-
- h = RARRAY(ary)->len;
- for (i=0; i<RARRAY(ary)->len; i++) {
- h = (h << 1) | (h<0 ? 1 : 0);
- n = rb_hash(RARRAY(ary)->ptr[i]);
- h ^= NUM2LONG(n);
- }
- return LONG2FIX(h);
+ return rb_exec_recursive_outer(recursive_hash, ary, 0);
}
/*
* call-seq:
- * array.include?(obj) -> true or false
- *
+ * ary.include?(obj) -> true or false
+ *
* Returns <code>true</code> if the given object is present in
- * <i>self</i> (that is, if any object <code>==</code> <i>anObject</i>),
+ * +self+ (that is, if any object <code>==</code> <i>anObject</i>),
* <code>false</code> otherwise.
- *
+ *
* a = [ "a", "b", "c" ]
* a.include?("b") #=> true
* a.include?("z") #=> false
*/
VALUE
-rb_ary_includes(ary, item)
- VALUE ary;
- VALUE item;
+rb_ary_includes(VALUE ary, VALUE item)
{
long i;
-
- for (i=0; i<RARRAY(ary)->len; i++) {
- if (rb_equal(RARRAY(ary)->ptr[i], item)) {
+
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ if (rb_equal(RARRAY_PTR(ary)[i], item)) {
return Qtrue;
}
}
@@ -2563,13 +3285,32 @@ rb_ary_includes(ary, item)
}
-/*
+static VALUE
+recursive_cmp(VALUE ary1, VALUE ary2, int recur)
+{
+ long i, len;
+
+ if (recur) return Qundef; /* Subtle! */
+ len = RARRAY_LEN(ary1);
+ if (len > RARRAY_LEN(ary2)) {
+ len = RARRAY_LEN(ary2);
+ }
+ for (i=0; i<len; i++) {
+ VALUE v = rb_funcall(rb_ary_elt(ary1, i), id_cmp, 1, rb_ary_elt(ary2, i));
+ if (v != INT2FIX(0)) {
+ return v;
+ }
+ }
+ return Qundef;
+}
+
+/*
* call-seq:
- * array <=> other_array -> -1, 0, +1
+ * ary <=> other_ary -> -1, 0, +1 or nil
*
* Comparison---Returns an integer (-1, 0,
* or +1) if this array is less than, equal to, or greater than
- * other_array. Each object in each array is compared
+ * <i>other_ary</i>. Each object in each array is compared
* (using <=>). If any value isn't
* equal, then that inequality is the return value. If all the
* values found are equal, then the return is based on a
@@ -2577,86 +3318,120 @@ rb_ary_includes(ary, item)
* ``equal'' according to <code>Array#<=></code> if and only if they have
* the same length and the value of each element is equal to the
* value of the corresponding element in the other array.
- *
+ *
* [ "a", "a", "c" ] <=> [ "a", "b", "c" ] #=> -1
* [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ] #=> +1
*
*/
VALUE
-rb_ary_cmp(ary1, ary2)
- VALUE ary1, ary2;
+rb_ary_cmp(VALUE ary1, VALUE ary2)
{
- long i, len;
+ long len;
+ VALUE v;
- ary2 = to_ary(ary2);
- len = RARRAY(ary1)->len;
- if (len > RARRAY(ary2)->len) {
- len = RARRAY(ary2)->len;
- }
- for (i=0; i<len; i++) {
- VALUE v = rb_funcall(rb_ary_elt(ary1, i), id_cmp, 1, rb_ary_elt(ary2, i));
- if (v != INT2FIX(0)) {
- return v;
- }
- }
- len = RARRAY(ary1)->len - RARRAY(ary2)->len;
+ ary2 = rb_check_array_type(ary2);
+ if (NIL_P(ary2)) return Qnil;
+ if (ary1 == ary2) return INT2FIX(0);
+ v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
+ if (v != Qundef) return v;
+ len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
if (len == 0) return INT2FIX(0);
if (len > 0) return INT2FIX(1);
return INT2FIX(-1);
}
static VALUE
-ary_make_hash(ary1, ary2)
- VALUE ary1, ary2;
+ary_add_hash(VALUE hash, VALUE ary)
{
- VALUE hash = rb_hash_new();
long i;
- for (i=0; i<RARRAY(ary1)->len; i++) {
- rb_hash_aset(hash, RARRAY(ary1)->ptr[i], Qtrue);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ rb_hash_aset(hash, RARRAY_PTR(ary)[i], Qtrue);
}
- if (ary2) {
- for (i=0; i<RARRAY(ary2)->len; i++) {
- rb_hash_aset(hash, RARRAY(ary2)->ptr[i], Qtrue);
+ return hash;
+}
+
+static inline VALUE
+ary_tmp_hash_new(void)
+{
+ VALUE hash = rb_hash_new();
+
+ RBASIC(hash)->klass = 0;
+ return hash;
+}
+
+static VALUE
+ary_make_hash(VALUE ary)
+{
+ VALUE hash = ary_tmp_hash_new();
+ return ary_add_hash(hash, ary);
+}
+
+static VALUE
+ary_add_hash_by(VALUE hash, VALUE ary)
+{
+ long i;
+
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+ if (rb_hash_lookup2(hash, k, Qundef) == Qundef) {
+ rb_hash_aset(hash, k, v);
}
}
return hash;
}
-/*
+static VALUE
+ary_make_hash_by(VALUE ary)
+{
+ VALUE hash = ary_tmp_hash_new();
+ return ary_add_hash_by(hash, ary);
+}
+
+static inline void
+ary_recycle_hash(VALUE hash)
+{
+ if (RHASH(hash)->ntbl) {
+ st_table *tbl = RHASH(hash)->ntbl;
+ RHASH(hash)->ntbl = 0;
+ st_free_table(tbl);
+ }
+}
+
+/*
* call-seq:
- * array - other_array -> an_array
+ * ary - other_ary -> new_ary
*
* Array Difference---Returns a new array that is a copy of
* the original array, removing any items that also appear in
- * other_array. (If you need set-like behavior, see the
+ * <i>other_ary</i>. (If you need set-like behavior, see the
* library class Set.)
*
* [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ] #=> [ 3, 3, 5 ]
*/
static VALUE
-rb_ary_diff(ary1, ary2)
- VALUE ary1, ary2;
+rb_ary_diff(VALUE ary1, VALUE ary2)
{
VALUE ary3;
volatile VALUE hash;
long i;
- hash = ary_make_hash(to_ary(ary2), 0);
+ hash = ary_make_hash(to_ary(ary2));
ary3 = rb_ary_new();
- for (i=0; i<RARRAY(ary1)->len; i++) {
- if (st_lookup(RHASH(hash)->tbl, RARRAY(ary1)->ptr[i], 0)) continue;
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ if (st_lookup(RHASH_TBL(hash), RARRAY_PTR(ary1)[i], 0)) continue;
rb_ary_push(ary3, rb_ary_elt(ary1, i));
}
+ ary_recycle_hash(hash);
return ary3;
}
-/*
+/*
* call-seq:
- * array & other_array
+ * ary & other_ary -> new_ary
*
* Set Intersection---Returns a new array
* containing elements common to the two arrays, with no duplicates.
@@ -2666,168 +3441,231 @@ rb_ary_diff(ary1, ary2)
static VALUE
-rb_ary_and(ary1, ary2)
- VALUE ary1, ary2;
+rb_ary_and(VALUE ary1, VALUE ary2)
{
- VALUE hash, ary3, v, vv;
+ VALUE hash, ary3, v;
+ st_data_t vv;
long i;
ary2 = to_ary(ary2);
- ary3 = rb_ary_new2(RARRAY(ary1)->len < RARRAY(ary2)->len ?
- RARRAY(ary1)->len : RARRAY(ary2)->len);
- hash = ary_make_hash(ary2, 0);
+ ary3 = rb_ary_new2(RARRAY_LEN(ary1) < RARRAY_LEN(ary2) ?
+ RARRAY_LEN(ary1) : RARRAY_LEN(ary2));
+ hash = ary_make_hash(ary2);
- for (i=0; i<RARRAY(ary1)->len; i++) {
- v = vv = rb_ary_elt(ary1, i);
- if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
+ if (RHASH_EMPTY_P(hash))
+ return ary3;
+
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ vv = (st_data_t)(v = rb_ary_elt(ary1, i));
+ if (st_delete(RHASH_TBL(hash), &vv, 0)) {
rb_ary_push(ary3, v);
}
}
+ ary_recycle_hash(hash);
return ary3;
}
-/*
+/*
* call-seq:
- * array | other_array -> an_array
+ * ary | other_ary -> new_ary
*
* Set Union---Returns a new array by joining this array with
- * other_array, removing duplicates.
+ * <i>other_ary</i>, removing duplicates.
*
* [ "a", "b", "c" ] | [ "c", "d", "a" ]
* #=> [ "a", "b", "c", "d" ]
*/
static VALUE
-rb_ary_or(ary1, ary2)
- VALUE ary1, ary2;
+rb_ary_or(VALUE ary1, VALUE ary2)
{
- VALUE hash, ary3;
- VALUE v, vv;
+ VALUE hash, ary3, v;
+ st_data_t vv;
long i;
ary2 = to_ary(ary2);
- ary3 = rb_ary_new2(RARRAY(ary1)->len+RARRAY(ary2)->len);
- hash = ary_make_hash(ary1, ary2);
+ ary3 = rb_ary_new2(RARRAY_LEN(ary1)+RARRAY_LEN(ary2));
+ hash = ary_add_hash(ary_make_hash(ary1), ary2);
- for (i=0; i<RARRAY(ary1)->len; i++) {
- v = vv = rb_ary_elt(ary1, i);
- if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ vv = (st_data_t)(v = rb_ary_elt(ary1, i));
+ if (st_delete(RHASH_TBL(hash), &vv, 0)) {
rb_ary_push(ary3, v);
}
}
- for (i=0; i<RARRAY(ary2)->len; i++) {
- v = vv = rb_ary_elt(ary2, i);
- if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
+ for (i=0; i<RARRAY_LEN(ary2); i++) {
+ vv = (st_data_t)(v = rb_ary_elt(ary2, i));
+ if (st_delete(RHASH_TBL(hash), &vv, 0)) {
rb_ary_push(ary3, v);
}
}
+ ary_recycle_hash(hash);
return ary3;
}
+static int
+push_value(st_data_t key, st_data_t val, st_data_t ary)
+{
+ rb_ary_push((VALUE)ary, (VALUE)val);
+ return ST_CONTINUE;
+}
+
/*
* call-seq:
- * array.uniq! -> array or nil
- *
- * Removes duplicate elements from _self_.
+ * ary.uniq! -> ary or nil
+ * ary.uniq! { |item| ... } -> ary or nil
+ *
+ * Removes duplicate elements from +self+. If a block is given,
+ * it will use the return value of the block for comparison.
* Returns <code>nil</code> if no changes are made (that is, no
* duplicates are found).
- *
+ *
* a = [ "a", "a", "b", "b", "c" ]
- * a.uniq! #=> ["a", "b", "c"]
+ * a.uniq! # => ["a", "b", "c"]
+ *
* b = [ "a", "b", "c" ]
- * b.uniq! #=> nil
+ * b.uniq! # => nil
+ *
+ * c = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ * c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *
*/
static VALUE
-rb_ary_uniq_bang(ary)
- VALUE ary;
+rb_ary_uniq_bang(VALUE ary)
{
- VALUE hash, v, vv;
+ VALUE hash, v;
long i, j;
- hash = ary_make_hash(ary, 0);
-
- if (RARRAY(ary)->len == RHASH(hash)->tbl->num_entries) {
- return Qnil;
+ rb_ary_modify_check(ary);
+ if (RARRAY_LEN(ary) <= 1)
+ return Qnil;
+ if (rb_block_given_p()) {
+ hash = ary_make_hash_by(ary);
+ if (RARRAY_LEN(ary) == (i = RHASH_SIZE(hash))) {
+ return Qnil;
+ }
+ ARY_SET_LEN(ary, 0);
+ if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+ rb_ary_unshare(ary);
+ FL_SET_EMBED(ary);
+ }
+ ary_resize_capa(ary, i);
+ st_foreach(RHASH_TBL(hash), push_value, ary);
}
- for (i=j=0; i<RARRAY(ary)->len; i++) {
- v = vv = rb_ary_elt(ary, i);
- if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
- rb_ary_store(ary, j++, v);
+ else {
+ hash = ary_make_hash(ary);
+ if (RARRAY_LEN(ary) == (long)RHASH_SIZE(hash)) {
+ return Qnil;
}
+ for (i=j=0; i<RARRAY_LEN(ary); i++) {
+ st_data_t vv = (st_data_t)(v = rb_ary_elt(ary, i));
+ if (st_delete(RHASH_TBL(hash), &vv, 0)) {
+ rb_ary_store(ary, j++, v);
+ }
+ }
+ ARY_SET_LEN(ary, j);
}
- RARRAY(ary)->len = j;
+ ary_recycle_hash(hash);
return ary;
}
/*
* call-seq:
- * array.uniq -> an_array
- *
- * Returns a new array by removing duplicate values in <i>self</i>.
- *
+ * ary.uniq -> new_ary
+ * ary.uniq { |item| ... } -> new_ary
+ *
+ * Returns a new array by removing duplicate values in +self+. If a block
+ * is given, it will use the return value of the block for comparison.
+ *
* a = [ "a", "a", "b", "b", "c" ]
- * a.uniq #=> ["a", "b", "c"]
+ * a.uniq # => ["a", "b", "c"]
+ *
+ * b = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ * b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *
*/
static VALUE
-rb_ary_uniq(ary)
- VALUE ary;
+rb_ary_uniq(VALUE ary)
{
- ary = rb_ary_dup(ary);
- rb_ary_uniq_bang(ary);
- return ary;
+ VALUE hash, uniq, v;
+ long i;
+
+ if (RARRAY_LEN(ary) <= 1)
+ return rb_ary_dup(ary);
+ if (rb_block_given_p()) {
+ hash = ary_make_hash_by(ary);
+ uniq = ary_new(rb_obj_class(ary), RHASH_SIZE(hash));
+ st_foreach(RHASH_TBL(hash), push_value, uniq);
+ }
+ else {
+ hash = ary_make_hash(ary);
+ uniq = ary_new(rb_obj_class(ary), RHASH_SIZE(hash));
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ st_data_t vv = (st_data_t)(v = rb_ary_elt(ary, i));
+ if (st_delete(RHASH_TBL(hash), &vv, 0)) {
+ rb_ary_push(uniq, v);
+ }
+ }
+ }
+ ary_recycle_hash(hash);
+
+ return uniq;
}
-/*
+/*
* call-seq:
- * array.compact! -> array or nil
+ * ary.compact! -> ary or nil
*
- * Removes +nil+ elements from array.
- * Returns +nil+ if no changes were made.
+ * Removes +nil+ elements from the array.
+ * Returns +nil+ if no changes were made, otherwise returns
+ * <i>ary</i>.
*
* [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
* [ "a", "b", "c" ].compact! #=> nil
*/
static VALUE
-rb_ary_compact_bang(ary)
- VALUE ary;
+rb_ary_compact_bang(VALUE ary)
{
VALUE *p, *t, *end;
+ long n;
rb_ary_modify(ary);
- p = t = RARRAY(ary)->ptr;
- end = p + RARRAY(ary)->len;
-
+ p = t = RARRAY_PTR(ary);
+ end = p + RARRAY_LEN(ary);
+
while (t < end) {
if (NIL_P(*t)) t++;
else *p++ = *t++;
}
- if (RARRAY(ary)->len == (p - RARRAY(ary)->ptr)) {
+ n = p - RARRAY_PTR(ary);
+ if (RARRAY_LEN(ary) == n) {
return Qnil;
}
- RARRAY(ary)->len = RARRAY(ary)->aux.capa = (p - RARRAY(ary)->ptr);
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+ ARY_SET_LEN(ary, n);
+ if (n * 2 < ARY_CAPA(ary) && ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+ ary_resize_capa(ary, n * 2);
+ }
return ary;
}
/*
* call-seq:
- * array.compact -> an_array
+ * ary.compact -> new_ary
*
- * Returns a copy of _self_ with all +nil+ elements removed.
+ * Returns a copy of +self+ with all +nil+ elements removed.
*
* [ "a", nil, "b", nil, "c", nil ].compact
* #=> [ "a", "b", "c" ]
*/
static VALUE
-rb_ary_compact(ary)
- VALUE ary;
+rb_ary_compact(VALUE ary)
{
ary = rb_ary_dup(ary);
rb_ary_compact_bang(ary);
@@ -2836,146 +3674,1015 @@ rb_ary_compact(ary)
/*
* call-seq:
- * array.nitems -> int
- *
- * Returns the number of non-<code>nil</code> elements in _self_.
- * May be zero.
- *
- * [ 1, nil, 3, nil, 5 ].nitems #=> 3
+ * ary.count -> int
+ * ary.count(obj) -> int
+ * ary.count { |item| block } -> int
+ *
+ * Returns the number of elements. If an argument is given, counts
+ * the number of elements which equals to <i>obj</i>. If a block is
+ * given, counts the number of elements yielding a true value.
+ *
+ * ary = [1, 2, 4, 2]
+ * ary.count #=> 4
+ * ary.count(2) #=> 2
+ * ary.count{|x|x%2==0} #=> 3
+ *
*/
static VALUE
-rb_ary_nitems(ary)
- VALUE ary;
+rb_ary_count(int argc, VALUE *argv, VALUE ary)
{
long n = 0;
- VALUE *p, *pend;
- p = RARRAY(ary)->ptr;
- pend = p + RARRAY(ary)->len;
+ if (argc == 0) {
+ VALUE *p, *pend;
+
+ if (!rb_block_given_p())
+ return LONG2NUM(RARRAY_LEN(ary));
+
+ for (p = RARRAY_PTR(ary), pend = p + RARRAY_LEN(ary); p < pend; p++) {
+ if (RTEST(rb_yield(*p))) n++;
+ }
+ }
+ else {
+ VALUE obj, *p, *pend;
- while (p < pend) {
- if (!NIL_P(*p)) n++;
- p++;
+ rb_scan_args(argc, argv, "1", &obj);
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (p = RARRAY_PTR(ary), pend = p + RARRAY_LEN(ary); p < pend; p++) {
+ if (rb_equal(*p, obj)) n++;
+ }
}
+
return LONG2NUM(n);
}
-static long
-flatten(ary, idx, ary2, memo)
- VALUE ary;
- long idx;
- VALUE ary2, memo;
+static VALUE
+flatten(VALUE ary, int level, int *modified)
{
- VALUE id;
- long i = idx;
- long n, lim = idx + RARRAY(ary2)->len;
-
- id = rb_obj_id(ary2);
- if (rb_ary_includes(memo, id)) {
- rb_raise(rb_eArgError, "tried to flatten recursive array");
- }
- rb_ary_push(memo, id);
- rb_ary_splice(ary, idx, 1, ary2);
- while (i < lim) {
- VALUE tmp;
-
- tmp = rb_check_array_type(rb_ary_elt(ary, i));
- if (!NIL_P(tmp)) {
- n = flatten(ary, i, tmp, memo);
- i += n; lim += n;
+ long i = 0;
+ VALUE stack, result, tmp, elt;
+ st_table *memo;
+ st_data_t id;
+
+ stack = ary_new(0, ARY_DEFAULT_SIZE);
+ result = ary_new(0, RARRAY_LEN(ary));
+ memo = st_init_numtable();
+ st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
+ *modified = 0;
+
+ while (1) {
+ while (i < RARRAY_LEN(ary)) {
+ elt = RARRAY_PTR(ary)[i++];
+ tmp = rb_check_array_type(elt);
+ if (RBASIC(result)->klass) {
+ rb_raise(rb_eRuntimeError, "flatten reentered");
+ }
+ if (NIL_P(tmp) || (level >= 0 && RARRAY_LEN(stack) / 2 >= level)) {
+ rb_ary_push(result, elt);
+ }
+ else {
+ *modified = 1;
+ id = (st_data_t)tmp;
+ if (st_lookup(memo, id, 0)) {
+ st_free_table(memo);
+ rb_raise(rb_eArgError, "tried to flatten recursive array");
+ }
+ st_insert(memo, id, (st_data_t)Qtrue);
+ rb_ary_push(stack, ary);
+ rb_ary_push(stack, LONG2NUM(i));
+ ary = tmp;
+ i = 0;
+ }
+ }
+ if (RARRAY_LEN(stack) == 0) {
+ break;
}
- i++;
+ id = (st_data_t)ary;
+ st_delete(memo, &id, 0);
+ tmp = rb_ary_pop(stack);
+ i = NUM2LONG(tmp);
+ ary = rb_ary_pop(stack);
}
- rb_ary_pop(memo);
- return lim - idx - 1; /* returns number of increased items */
+ st_free_table(memo);
+
+ RBASIC(result)->klass = rb_class_of(ary);
+ return result;
}
/*
* call-seq:
- * array.flatten! -> array or nil
- *
- * Flattens _self_ in place.
+ * ary.flatten! -> ary or nil
+ * ary.flatten!(level) -> array or nil
+ *
+ * Flattens +self+ in place.
* Returns <code>nil</code> if no modifications were made (i.e.,
- * <i>array</i> contains no subarrays.)
- *
+ * <i>ary</i> contains no subarrays.) If the optional <i>level</i>
+ * argument determines the level of recursion to flatten.
+ *
* a = [ 1, 2, [3, [4, 5] ] ]
* a.flatten! #=> [1, 2, 3, 4, 5]
* a.flatten! #=> nil
* a #=> [1, 2, 3, 4, 5]
+ * a = [ 1, 2, [3, [4, 5] ] ]
+ * a.flatten!(1) #=> [1, 2, 3, [4, 5]]
*/
static VALUE
-rb_ary_flatten_bang(ary)
- VALUE ary;
+rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
{
- long i = 0;
- int mod = 0;
- VALUE memo = Qnil;
+ int mod = 0, level = -1;
+ VALUE result, lv;
- while (i<RARRAY(ary)->len) {
- VALUE ary2 = RARRAY(ary)->ptr[i];
- VALUE tmp;
+ rb_scan_args(argc, argv, "01", &lv);
+ rb_ary_modify_check(ary);
+ if (!NIL_P(lv)) level = NUM2INT(lv);
+ if (level == 0) return Qnil;
- tmp = rb_check_array_type(ary2);
- if (!NIL_P(tmp)) {
- if (NIL_P(memo)) {
- memo = rb_ary_new();
- }
- i += flatten(ary, i, tmp, memo);
- mod = 1;
- }
- i++;
+ result = flatten(ary, level, &mod);
+ if (mod == 0) {
+ ary_discard(result);
+ return Qnil;
}
- if (mod == 0) return Qnil;
+ if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
+ rb_ary_replace(ary, result);
+ if (mod) ARY_SET_EMBED_LEN(result, 0);
+
return ary;
}
/*
* call-seq:
- * array.flatten -> an_array
- *
+ * ary.flatten -> new_ary
+ * ary.flatten(level) -> new_ary
+ *
* Returns a new array that is a one-dimensional flattening of this
* array (recursively). That is, for every element that is an array,
- * extract its elements into the new array.
- *
+ * extract its elements into the new array. If the optional
+ * <i>level</i> argument determines the level of recursion to flatten.
+ *
* s = [ 1, 2, 3 ] #=> [1, 2, 3]
* t = [ 4, 5, 6, [7, 8] ] #=> [4, 5, 6, [7, 8]]
* a = [ s, t, 9, 10 ] #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- * a.flatten #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10
+ * a.flatten #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ * a = [ 1, 2, [3, [4, 5] ] ]
+ * a.flatten(1) #=> [1, 2, 3, [4, 5]]
*/
static VALUE
-rb_ary_flatten(ary)
- VALUE ary;
+rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
+{
+ int mod = 0, level = -1;
+ VALUE result, lv;
+
+ rb_scan_args(argc, argv, "01", &lv);
+ if (!NIL_P(lv)) level = NUM2INT(lv);
+ if (level == 0) return ary_make_shared_copy(ary);
+
+ result = flatten(ary, level, &mod);
+ OBJ_INFECT(result, ary);
+
+ return result;
+}
+
+#define OPTHASH_GIVEN_P(opts) \
+ (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
+static VALUE sym_random;
+
+#define RAND_UPTO(max) (long)(rb_random_real(randgen)*(max))
+
+/*
+ * call-seq:
+ * ary.shuffle! -> ary
+ * ary.shuffle!(random: rng) -> ary
+ *
+ * Shuffles elements in +self+ in place.
+ * If +rng+ is given, it will be used as the random number generator.
+ */
+
+static VALUE
+rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE *ptr, opts, *snap_ptr, randgen = rb_cRandom;
+ long i, snap_len;
+
+ if (OPTHASH_GIVEN_P(opts)) {
+ randgen = rb_hash_lookup2(opts, sym_random, randgen);
+ }
+ if (argc > 0) {
+ rb_raise(rb_eArgError, "wrong number of arguments (%d for 0)", argc);
+ }
+ rb_ary_modify(ary);
+ i = RARRAY_LEN(ary);
+ ptr = RARRAY_PTR(ary);
+ snap_len = i;
+ snap_ptr = ptr;
+ while (i) {
+ long j = RAND_UPTO(i);
+ VALUE tmp;
+ if (snap_len != RARRAY_LEN(ary) || snap_ptr != RARRAY_PTR(ary)) {
+ rb_raise(rb_eRuntimeError, "modified during shuffle");
+ }
+ tmp = ptr[--i];
+ ptr[i] = ptr[j];
+ ptr[j] = tmp;
+ }
+ return ary;
+}
+
+
+/*
+ * call-seq:
+ * ary.shuffle -> new_ary
+ * ary.shuffle(random: rng) -> new_ary
+ *
+ * Returns a new array with elements of this array shuffled.
+ *
+ * a = [ 1, 2, 3 ] #=> [1, 2, 3]
+ * a.shuffle #=> [2, 3, 1]
+ *
+ * If +rng+ is given, it will be used as the random number generator.
+ *
+ * a.shuffle(random: Random.new(1)) #=> [1, 3, 2]
+ */
+
+static VALUE
+rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
{
ary = rb_ary_dup(ary);
- rb_ary_flatten_bang(ary);
+ rb_ary_shuffle_bang(argc, argv, ary);
+ return ary;
+}
+
+
+/*
+ * call-seq:
+ * ary.sample -> obj
+ * ary.sample(random: rng) -> obj
+ * ary.sample(n) -> new_ary
+ * ary.sample(n, random: rng) -> new_ary
+ *
+ * Choose a random element or +n+ random elements from the array. The elements
+ * are chosen by using random and unique indices into the array in order to
+ * ensure that an element doesn't repeat itself unless the array already
+ * contained duplicate elements. If the array is empty the first form returns
+ * <code>nil</code> and the second form returns an empty array.
+ *
+ * If +rng+ is given, it will be used as the random number generator.
+ */
+
+
+static VALUE
+rb_ary_sample(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE nv, result, *ptr;
+ VALUE opts, randgen = rb_cRandom;
+ long n, len, i, j, k, idx[10];
+ double rnds[numberof(idx)];
+
+ if (OPTHASH_GIVEN_P(opts)) {
+ randgen = rb_hash_lookup2(opts, sym_random, randgen);
+ }
+ ptr = RARRAY_PTR(ary);
+ len = RARRAY_LEN(ary);
+ if (argc == 0) {
+ if (len == 0) return Qnil;
+ if (len == 1) {
+ i = 0;
+ }
+ else {
+ double x = rb_random_real(randgen);
+ if ((len = RARRAY_LEN(ary)) == 0) return Qnil;
+ i = (long)(x * len);
+ }
+ return RARRAY_PTR(ary)[i];
+ }
+ rb_scan_args(argc, argv, "1", &nv);
+ n = NUM2LONG(nv);
+ if (n < 0) rb_raise(rb_eArgError, "negative sample number");
+ if (n > len) n = len;
+ if (n <= numberof(idx)) {
+ for (i = 0; i < n; ++i) {
+ rnds[i] = rb_random_real(randgen);
+ }
+ }
+ len = RARRAY_LEN(ary);
+ ptr = RARRAY_PTR(ary);
+ if (n > len) n = len;
+ switch (n) {
+ case 0:
+ return rb_ary_new2(0);
+ case 1:
+ i = (long)(rnds[0] * len);
+ return rb_ary_new4(1, &ptr[i]);
+ case 2:
+ i = (long)(rnds[0] * len);
+ j = (long)(rnds[1] * (len-1));
+ if (j >= i) j++;
+ return rb_ary_new3(2, ptr[i], ptr[j]);
+ case 3:
+ i = (long)(rnds[0] * len);
+ j = (long)(rnds[1] * (len-1));
+ k = (long)(rnds[2] * (len-2));
+ {
+ long l = j, g = i;
+ if (j >= i) l = i, g = ++j;
+ if (k >= l && (++k >= g)) ++k;
+ }
+ return rb_ary_new3(3, ptr[i], ptr[j], ptr[k]);
+ }
+ if (n <= numberof(idx)) {
+ VALUE *ptr_result;
+ long sorted[numberof(idx)];
+ sorted[0] = idx[0] = (long)(rnds[0] * len);
+ for (i=1; i<n; i++) {
+ k = (long)(rnds[i] * --len);
+ for (j = 0; j < i; ++j) {
+ if (k < sorted[j]) break;
+ ++k;
+ }
+ memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+ sorted[j] = idx[i] = k;
+ }
+ result = rb_ary_new2(n);
+ ptr_result = RARRAY_PTR(result);
+ for (i=0; i<n; i++) {
+ ptr_result[i] = ptr[idx[i]];
+ }
+ }
+ else {
+ VALUE *ptr_result;
+ result = rb_ary_new4(len, ptr);
+ RBASIC(result)->klass = 0;
+ ptr_result = RARRAY_PTR(result);
+ RB_GC_GUARD(ary);
+ for (i=0; i<n; i++) {
+ j = RAND_UPTO(len-i) + i;
+ nv = ptr_result[j];
+ ptr_result[j] = ptr_result[i];
+ ptr_result[i] = nv;
+ }
+ RBASIC(result)->klass = rb_cArray;
+ }
+ ARY_SET_LEN(result, n);
+
+ return result;
+}
+
+
+/*
+ * call-seq:
+ * ary.cycle(n=nil) {|obj| block } -> nil
+ * ary.cycle(n=nil) -> an_enumerator
+ *
+ * Calls <i>block</i> for each element repeatedly _n_ times or
+ * forever if none or +nil+ is given. If a non-positive number is
+ * given or the array is empty, does nothing. Returns +nil+ if the
+ * loop has finished without getting interrupted.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ *
+ * a = ["a", "b", "c"]
+ * a.cycle {|x| puts x } # print, a, b, c, a, b, c,.. forever.
+ * a.cycle(2) {|x| puts x } # print, a, b, c, a, b, c.
+ *
+ */
+
+static VALUE
+rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
+{
+ long n, i;
+ VALUE nv = Qnil;
+
+ rb_scan_args(argc, argv, "01", &nv);
+
+ RETURN_ENUMERATOR(ary, argc, argv);
+ if (NIL_P(nv)) {
+ n = -1;
+ }
+ else {
+ n = NUM2LONG(nv);
+ if (n <= 0) return Qnil;
+ }
+
+ while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ rb_yield(RARRAY_PTR(ary)[i]);
+ }
+ }
+ return Qnil;
+}
+
+#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
+#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC(s)->klass = rb_cString)
+#define tmpary(n) rb_ary_tmp_new(n)
+#define tmpary_discard(a) (ary_discard(a), RBASIC(a)->klass = rb_cArray)
+
+/*
+ * Recursively compute permutations of r elements of the set [0..n-1].
+ * When we have a complete permutation of array indexes, copy the values
+ * at those indexes into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * index: what index we're filling in now
+ * used: an array of booleans: whether a given index is already used
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+permute0(long n, long r, long *p, long index, char *used, VALUE values)
+{
+ long i,j;
+ for (i = 0; i < n; i++) {
+ if (used[i] == 0) {
+ p[index] = i;
+ if (index < r-1) { /* if not done yet */
+ used[i] = 1; /* mark index used */
+ permute0(n, r, p, index+1, /* recurse */
+ used, values);
+ used[i] = 0; /* index unused */
+ }
+ else {
+ /* We have a complete permutation of array indexes */
+ /* Build a ruby array of the corresponding values */
+ /* And yield it to the associated block */
+ VALUE result = rb_ary_new2(r);
+ VALUE *result_array = RARRAY_PTR(result);
+ const VALUE *values_array = RARRAY_PTR(values);
+
+ for (j = 0; j < r; j++) result_array[j] = values_array[p[j]];
+ ARY_SET_LEN(result, r);
+ rb_yield(result);
+ if (RBASIC(values)->klass) {
+ rb_raise(rb_eRuntimeError, "permute reentered");
+ }
+ }
+ }
+ }
+}
+
+/*
+ * call-seq:
+ * ary.permutation { |p| block } -> ary
+ * ary.permutation -> an_enumerator
+ * ary.permutation(n) { |p| block } -> ary
+ * ary.permutation(n) -> an_enumerator
+ *
+ * When invoked with a block, yield all permutations of length <i>n</i>
+ * of the elements of <i>ary</i>, then return the array itself.
+ * If <i>n</i> is not specified, yield all permutations of all elements.
+ * The implementation makes no guarantees about the order in which
+ * the permutations are yielded.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * Examples:
+ *
+ * a = [1, 2, 3]
+ * a.permutation.to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ * a.permutation(1).to_a #=> [[1],[2],[3]]
+ * a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
+ * a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ * a.permutation(0).to_a #=> [[]] # one permutation of length 0
+ * a.permutation(4).to_a #=> [] # no permutations of length 4
+ */
+
+static VALUE
+rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE num;
+ long r, n, i;
+
+ n = RARRAY_LEN(ary); /* Array length */
+ RETURN_ENUMERATOR(ary, argc, argv); /* Return enumerator if no block */
+ rb_scan_args(argc, argv, "01", &num);
+ r = NIL_P(num) ? n : NUM2LONG(num); /* Permutation size from argument */
+
+ if (r < 0 || n < r) {
+ /* no permutations: yield nothing */
+ }
+ else if (r == 0) { /* exactly one permutation: the zero-length array */
+ rb_yield(rb_ary_new2(0));
+ }
+ else if (r == 1) { /* this is a special, easy case */
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
+ }
+ }
+ else { /* this is the general case */
+ volatile VALUE t0 = tmpbuf(n,sizeof(long));
+ long *p = (long*)RSTRING_PTR(t0);
+ volatile VALUE t1 = tmpbuf(n,sizeof(char));
+ char *used = (char*)RSTRING_PTR(t1);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC(ary0)->klass = 0;
+
+ MEMZERO(used, char, n); /* initialize array */
+
+ permute0(n, r, p, 0, used, ary0); /* compute and yield permutations */
+ tmpbuf_discard(t0);
+ tmpbuf_discard(t1);
+ RBASIC(ary0)->klass = rb_cArray;
+ }
+ return ary;
+}
+
+/*
+ * call-seq:
+ * ary.combination(n) { |c| block } -> ary
+ * ary.combination(n) -> an_enumerator
+ *
+ * When invoked with a block, yields all combinations of length <i>n</i>
+ * of elements from <i>ary</i> and then returns <i>ary</i> itself.
+ * The implementation makes no guarantees about the order in which
+ * the combinations are yielded.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * Examples:
+ *
+ * a = [1, 2, 3, 4]
+ * a.combination(1).to_a #=> [[1],[2],[3],[4]]
+ * a.combination(2).to_a #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
+ * a.combination(3).to_a #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
+ * a.combination(4).to_a #=> [[1,2,3,4]]
+ * a.combination(0).to_a #=> [[]] # one combination of length 0
+ * a.combination(5).to_a #=> [] # no combinations of length 5
+ *
+ */
+
+static VALUE
+rb_ary_combination(VALUE ary, VALUE num)
+{
+ long n, i, len;
+
+ n = NUM2LONG(num);
+ RETURN_ENUMERATOR(ary, 1, &num);
+ len = RARRAY_LEN(ary);
+ if (n < 0 || len < n) {
+ /* yield nothing */
+ }
+ else if (n == 0) {
+ rb_yield(rb_ary_new2(0));
+ }
+ else if (n == 1) {
+ for (i = 0; i < len; i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
+ }
+ }
+ else {
+ volatile VALUE t0 = tmpbuf(n+1, sizeof(long));
+ long *stack = (long*)RSTRING_PTR(t0);
+ volatile VALUE cc = tmpary(n);
+ VALUE *chosen = RARRAY_PTR(cc);
+ long lev = 0;
+
+ MEMZERO(stack, long, n);
+ stack[0] = -1;
+ for (;;) {
+ chosen[lev] = RARRAY_PTR(ary)[stack[lev+1]];
+ for (lev++; lev < n; lev++) {
+ chosen[lev] = RARRAY_PTR(ary)[stack[lev+1] = stack[lev]+1];
+ }
+ rb_yield(rb_ary_new4(n, chosen));
+ if (RBASIC(t0)->klass) {
+ rb_raise(rb_eRuntimeError, "combination reentered");
+ }
+ do {
+ if (lev == 0) goto done;
+ stack[lev--]++;
+ } while (stack[lev+1]+n == len+lev+1);
+ }
+ done:
+ tmpbuf_discard(t0);
+ tmpary_discard(cc);
+ }
+ return ary;
+}
+
+/*
+ * Recursively compute repeated permutations of r elements of the set
+ * [0..n-1].
+ * When we have a complete repeated permutation of array indexes, copy the
+ * values at those indexes into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * index: what index we're filling in now
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+rpermute0(long n, long r, long *p, long index, VALUE values)
+{
+ long i, j;
+ for (i = 0; i < n; i++) {
+ p[index] = i;
+ if (index < r-1) { /* if not done yet */
+ rpermute0(n, r, p, index+1, values); /* recurse */
+ }
+ else {
+ /* We have a complete permutation of array indexes */
+ /* Build a ruby array of the corresponding values */
+ /* And yield it to the associated block */
+ VALUE result = rb_ary_new2(r);
+ VALUE *result_array = RARRAY_PTR(result);
+ const VALUE *values_array = RARRAY_PTR(values);
+
+ for (j = 0; j < r; j++) result_array[j] = values_array[p[j]];
+ ARY_SET_LEN(result, r);
+ rb_yield(result);
+ if (RBASIC(values)->klass) {
+ rb_raise(rb_eRuntimeError, "repeated permute reentered");
+ }
+ }
+ }
+}
+
+/*
+ * call-seq:
+ * ary.repeated_permutation(n) { |p| block } -> ary
+ * ary.repeated_permutation(n) -> an_enumerator
+ *
+ * When invoked with a block, yield all repeated permutations of length
+ * <i>n</i> of the elements of <i>ary</i>, then return the array itself.
+ * The implementation makes no guarantees about the order in which
+ * the repeated permutations are yielded.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * Examples:
+ *
+ * a = [1, 2]
+ * a.repeated_permutation(1).to_a #=> [[1], [2]]
+ * a.repeated_permutation(2).to_a #=> [[1,1],[1,2],[2,1],[2,2]]
+ * a.repeated_permutation(3).to_a #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
+ * # [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
+ * a.repeated_permutation(0).to_a #=> [[]] # one permutation of length 0
+ */
+
+static VALUE
+rb_ary_repeated_permutation(VALUE ary, VALUE num)
+{
+ long r, n, i;
+
+ n = RARRAY_LEN(ary); /* Array length */
+ RETURN_ENUMERATOR(ary, 1, &num); /* Return enumerator if no block */
+ r = NUM2LONG(num); /* Permutation size from argument */
+
+ if (r < 0) {
+ /* no permutations: yield nothing */
+ }
+ else if (r == 0) { /* exactly one permutation: the zero-length array */
+ rb_yield(rb_ary_new2(0));
+ }
+ else if (r == 1) { /* this is a special, easy case */
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
+ }
+ }
+ else { /* this is the general case */
+ volatile VALUE t0 = tmpbuf(r, sizeof(long));
+ long *p = (long*)RSTRING_PTR(t0);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC(ary0)->klass = 0;
+
+ rpermute0(n, r, p, 0, ary0); /* compute and yield repeated permutations */
+ tmpbuf_discard(t0);
+ RBASIC(ary0)->klass = rb_cArray;
+ }
return ary;
}
+static void
+rcombinate0(long n, long r, long *p, long index, long rest, VALUE values)
+{
+ long j;
+ if (rest > 0) {
+ for (; index < n; ++index) {
+ p[r-rest] = index;
+ rcombinate0(n, r, p, index, rest-1, values);
+ }
+ }
+ else {
+ VALUE result = rb_ary_new2(r);
+ VALUE *result_array = RARRAY_PTR(result);
+ const VALUE *values_array = RARRAY_PTR(values);
+
+ for (j = 0; j < r; ++j) result_array[j] = values_array[p[j]];
+ ARY_SET_LEN(result, r);
+ rb_yield(result);
+ if (RBASIC(values)->klass) {
+ rb_raise(rb_eRuntimeError, "repeated combination reentered");
+ }
+ }
+}
+
+/*
+ * call-seq:
+ * ary.repeated_combination(n) { |c| block } -> ary
+ * ary.repeated_combination(n) -> an_enumerator
+ *
+ * When invoked with a block, yields all repeated combinations of
+ * length <i>n</i> of elements from <i>ary</i> and then returns
+ * <i>ary</i> itself.
+ * The implementation makes no guarantees about the order in which
+ * the repeated combinations are yielded.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * Examples:
+ *
+ * a = [1, 2, 3]
+ * a.repeated_combination(1).to_a #=> [[1], [2], [3]]
+ * a.repeated_combination(2).to_a #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
+ * a.repeated_combination(3).to_a #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
+ * # [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
+ * a.repeated_combination(4).to_a #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
+ * # [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
+ * # [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
+ * a.repeated_combination(0).to_a #=> [[]] # one combination of length 0
+ *
+ */
+
+static VALUE
+rb_ary_repeated_combination(VALUE ary, VALUE num)
+{
+ long n, i, len;
+
+ n = NUM2LONG(num); /* Combination size from argument */
+ RETURN_ENUMERATOR(ary, 1, &num); /* Return enumerator if no block */
+ len = RARRAY_LEN(ary);
+ if (n < 0) {
+ /* yield nothing */
+ }
+ else if (n == 0) {
+ rb_yield(rb_ary_new2(0));
+ }
+ else if (n == 1) {
+ for (i = 0; i < len; i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
+ }
+ }
+ else if (len == 0) {
+ /* yield nothing */
+ }
+ else {
+ volatile VALUE t0 = tmpbuf(n, sizeof(long));
+ long *p = (long*)RSTRING_PTR(t0);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC(ary0)->klass = 0;
+
+ rcombinate0(len, n, p, 0, n, ary0); /* compute and yield repeated combinations */
+ tmpbuf_discard(t0);
+ RBASIC(ary0)->klass = rb_cArray;
+ }
+ return ary;
+}
+
+/*
+ * call-seq:
+ * ary.product(other_ary, ...) -> new_ary
+ * ary.product(other_ary, ...) { |p| block } -> ary
+ *
+ * Returns an array of all combinations of elements from all arrays.
+ * The length of the returned array is the product of the length
+ * of +self+ and the argument arrays.
+ * If given a block, <i>product</i> will yield all combinations
+ * and return +self+ instead.
+ *
+ *
+ * [1,2,3].product([4,5]) #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
+ * [1,2].product([1,2]) #=> [[1,1],[1,2],[2,1],[2,2]]
+ * [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
+ * # [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
+ * [1,2].product() #=> [[1],[2]]
+ * [1,2].product([]) #=> []
+ */
+
+static VALUE
+rb_ary_product(int argc, VALUE *argv, VALUE ary)
+{
+ int n = argc+1; /* How many arrays we're operating on */
+ volatile VALUE t0 = tmpary(n);
+ volatile VALUE t1 = tmpbuf(n, sizeof(int));
+ VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
+ int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
+ VALUE result = Qnil; /* The array we'll be returning, when no block given */
+ long i,j;
+ long resultlen = 1;
+
+ RBASIC(t0)->klass = 0;
+ RBASIC(t1)->klass = 0;
+
+ /* initialize the arrays of arrays */
+ ARY_SET_LEN(t0, n);
+ arrays[0] = ary;
+ for (i = 1; i < n; i++) arrays[i] = Qnil;
+ for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
+
+ /* initialize the counters for the arrays */
+ for (i = 0; i < n; i++) counters[i] = 0;
+
+ /* Otherwise, allocate and fill in an array of results */
+ if (rb_block_given_p()) {
+ /* Make defensive copies of arrays; exit if any is empty */
+ for (i = 0; i < n; i++) {
+ if (RARRAY_LEN(arrays[i]) == 0) goto done;
+ arrays[i] = ary_make_shared_copy(arrays[i]);
+ }
+ }
+ else {
+ /* Compute the length of the result array; return [] if any is empty */
+ for (i = 0; i < n; i++) {
+ long k = RARRAY_LEN(arrays[i]), l = resultlen;
+ if (k == 0) {
+ result = rb_ary_new2(0);
+ goto done;
+ }
+ resultlen *= k;
+ if (resultlen < k || resultlen < l || resultlen / k != l) {
+ rb_raise(rb_eRangeError, "too big to product");
+ }
+ }
+ result = rb_ary_new2(resultlen);
+ }
+ for (;;) {
+ int m;
+ /* fill in one subarray */
+ VALUE subarray = rb_ary_new2(n);
+ for (j = 0; j < n; j++) {
+ rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+ }
+
+ /* put it on the result array */
+ if(NIL_P(result)) {
+ FL_SET(t0, FL_USER5);
+ rb_yield(subarray);
+ if (! FL_TEST(t0, FL_USER5)) {
+ rb_raise(rb_eRuntimeError, "product reentered");
+ }
+ else {
+ FL_UNSET(t0, FL_USER5);
+ }
+ }
+ else {
+ rb_ary_push(result, subarray);
+ }
+
+ /*
+ * Increment the last counter. If it overflows, reset to 0
+ * and increment the one before it.
+ */
+ m = n-1;
+ counters[m]++;
+ while (counters[m] == RARRAY_LEN(arrays[m])) {
+ counters[m] = 0;
+ /* If the first counter overflows, we are done */
+ if (--m < 0) goto done;
+ counters[m]++;
+ }
+ }
+done:
+ tmpary_discard(t0);
+ tmpbuf_discard(t1);
+
+ return NIL_P(result) ? ary : result;
+}
+
+/*
+ * call-seq:
+ * ary.take(n) -> new_ary
+ *
+ * Returns first n elements from <i>ary</i>.
+ *
+ * a = [1, 2, 3, 4, 5, 0]
+ * a.take(3) #=> [1, 2, 3]
+ *
+ */
+
+static VALUE
+rb_ary_take(VALUE obj, VALUE n)
+{
+ long len = NUM2LONG(n);
+ if (len < 0) {
+ rb_raise(rb_eArgError, "attempt to take negative size");
+ }
+ return rb_ary_subseq(obj, 0, len);
+}
+
+/*
+ * call-seq:
+ * ary.take_while {|arr| block } -> new_ary
+ * ary.take_while -> an_enumerator
+ *
+ * Passes elements to the block until the block returns +nil+ or +false+,
+ * then stops iterating and returns an array of all prior elements.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * a = [1, 2, 3, 4, 5, 0]
+ * a.take_while {|i| i < 3 } #=> [1, 2]
+ *
+ */
+
+static VALUE
+rb_ary_take_while(VALUE ary)
+{
+ long i;
+
+ RETURN_ENUMERATOR(ary, 0, 0);
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ if (!RTEST(rb_yield(RARRAY_PTR(ary)[i]))) break;
+ }
+ return rb_ary_take(ary, LONG2FIX(i));
+}
+
+/*
+ * call-seq:
+ * ary.drop(n) -> new_ary
+ *
+ * Drops first n elements from +ary+ and returns the rest of
+ * the elements in an array.
+ *
+ * a = [1, 2, 3, 4, 5, 0]
+ * a.drop(3) #=> [4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop(VALUE ary, VALUE n)
+{
+ VALUE result;
+ long pos = NUM2LONG(n);
+ if (pos < 0) {
+ rb_raise(rb_eArgError, "attempt to drop negative size");
+ }
-/* Arrays are ordered, integer-indexed collections of any object.
- * Array indexing starts at 0, as in C or Java. A negative index is
- * assumed to be relative to the end of the array---that is, an index of -1
- * indicates the last element of the array, -2 is the next to last
- * element in the array, and so on.
+ result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
+ if (result == Qnil) result = rb_ary_new();
+ return result;
+}
+
+/*
+ * call-seq:
+ * ary.drop_while {|arr| block } -> new_ary
+ * ary.drop_while -> an_enumerator
+ *
+ * Drops elements up to, but not including, the first element for
+ * which the block returns +nil+ or +false+ and returns an array
+ * containing the remaining elements.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * a = [1, 2, 3, 4, 5, 0]
+ * a.drop_while {|i| i < 3 } #=> [3, 4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop_while(VALUE ary)
+{
+ long i;
+
+ RETURN_ENUMERATOR(ary, 0, 0);
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ if (!RTEST(rb_yield(RARRAY_PTR(ary)[i]))) break;
+ }
+ return rb_ary_drop(ary, LONG2FIX(i));
+}
+
+
+
+/* Arrays are ordered, integer-indexed collections of any object.
+ * Array indexing starts at 0, as in C or Java. A negative index is
+ * assumed to be relative to the end of the array---that is, an index of -1
+ * indicates the last element of the array, -2 is the next to last
+ * element in the array, and so on.
*/
void
-Init_Array()
+Init_Array(void)
{
+#undef rb_intern
+#define rb_intern(str) rb_intern_const(str)
+
rb_cArray = rb_define_class("Array", rb_cObject);
rb_include_module(rb_cArray, rb_mEnumerable);
rb_define_alloc_func(rb_cArray, ary_alloc);
rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
+ rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
- rb_define_method(rb_cArray, "to_s", rb_ary_to_s, 0);
rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
+ rb_define_alias(rb_cArray, "to_s", "inspect");
rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
rb_define_method(rb_cArray, "frozen?", rb_ary_frozen_p, 0);
@@ -2993,8 +4700,8 @@ Init_Array()
rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
- rb_define_method(rb_cArray, "pop", rb_ary_pop, 0);
- rb_define_method(rb_cArray, "shift", rb_ary_shift, 0);
+ rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
+ rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
rb_define_method(rb_cArray, "each", rb_ary_each, 0);
@@ -3003,20 +4710,24 @@ Init_Array()
rb_define_method(rb_cArray, "length", rb_ary_length, 0);
rb_define_alias(rb_cArray, "size", "length");
rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
- rb_define_method(rb_cArray, "index", rb_ary_index, 1);
- rb_define_method(rb_cArray, "rindex", rb_ary_rindex, 1);
- rb_define_method(rb_cArray, "indexes", rb_ary_indexes, -1);
- rb_define_method(rb_cArray, "indices", rb_ary_indexes, -1);
+ rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
+ rb_define_method(rb_cArray, "index", rb_ary_index, -1);
+ rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
+ rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
+ rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
+ rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
rb_define_method(rb_cArray, "select", rb_ary_select, 0);
+ rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+ rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
@@ -3048,10 +4759,24 @@ Init_Array()
rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
- rb_define_method(rb_cArray, "flatten", rb_ary_flatten, 0);
- rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, 0);
- rb_define_method(rb_cArray, "nitems", rb_ary_nitems, 0);
+ rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
+ rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
+ rb_define_method(rb_cArray, "count", rb_ary_count, -1);
+ rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
+ rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
+ rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
+ rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
+ rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
+ rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
+ rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
+ rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
+ rb_define_method(rb_cArray, "product", rb_ary_product, -1);
+
+ rb_define_method(rb_cArray, "take", rb_ary_take, 1);
+ rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
+ rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
+ rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
id_cmp = rb_intern("<=>");
- inspect_key = rb_intern("__inspect_key__");
+ sym_random = ID2SYM(rb_intern("random"));
}
diff --git a/atomic.h b/atomic.h
new file mode 100644
index 0000000000..5b3fb99024
--- /dev/null
+++ b/atomic.h
@@ -0,0 +1,56 @@
+#ifndef RUBY_ATOMIC_H
+#define RUBY_ATOMIC_H
+
+#ifdef _WIN32
+#if defined _MSC_VER && _MSC_VER > 1200
+#pragma intrinsic(_InterlockedOr)
+#endif
+typedef LONG rb_atomic_t;
+
+# define ATOMIC_SET(var, val) InterlockedExchange(&(var), (val))
+# define ATOMIC_INC(var) InterlockedIncrement(&(var))
+# define ATOMIC_DEC(var) InterlockedDecrement(&(var))
+#if defined __GNUC__
+# define ATOMIC_OR(var, val) __asm__("lock\n\t" "orl\t%1, %0" : "=m"(var) : "Ir"(val))
+#elif defined _MSC_VER && _MSC_VER <= 1200
+# define ATOMIC_OR(var, val) rb_w32_atomic_or(&(var), (val))
+static inline void
+rb_w32_atomic_or(volatile rb_atomic_t *var, rb_atomic_t val)
+{
+#ifdef _M_IX86
+ __asm mov eax, var;
+ __asm mov ecx, val;
+ __asm lock or [eax], ecx;
+#else
+#error unsupported architecture
+#endif
+}
+#else
+# define ATOMIC_OR(var, val) _InterlockedOr(&(var), (val))
+#endif
+# define ATOMIC_EXCHANGE(var, val) InterlockedExchange(&(var), (val))
+
+#elif defined HAVE_GCC_ATOMIC_BUILTINS
+/* @shyouhei hack to support atomic operations in case of gcc. Gcc
+ * has its own pseudo-insns to support them. See info, or
+ * http://gcc.gnu.org/onlinedocs/gcc/Atomic-Builtins.html */
+
+typedef unsigned int rb_atomic_t; /* Anything OK */
+# define ATOMIC_SET(var, val) __sync_lock_test_and_set(&(var), (val))
+# define ATOMIC_INC(var) __sync_fetch_and_add(&(var), 1)
+# define ATOMIC_DEC(var) __sync_fetch_and_sub(&(var), 1)
+# define ATOMIC_OR(var, val) __sync_or_and_fetch(&(var), (val))
+# define ATOMIC_EXCHANGE(var, val) __sync_lock_test_and_set(&(var), (val))
+
+#else
+typedef int rb_atomic_t;
+extern rb_atomic_t ruby_atomic_exchange(rb_atomic_t *ptr, rb_atomic_t val);
+
+# define ATOMIC_SET(var, val) ((var) = (val))
+# define ATOMIC_INC(var) (++(var))
+# define ATOMIC_DEC(var) (--(var))
+# define ATOMIC_OR(var, val) ((var) |= (val))
+# define ATOMIC_EXCHANGE(var, val) ruby_atomic_exchange(&(var), (val))
+#endif
+
+#endif /* RUBY_ATOMIC_H */
diff --git a/bcc32/Makefile.sub b/bcc32/Makefile.sub
index 030a799e99..1cd26a8643 100644
--- a/bcc32/Makefile.sub
+++ b/bcc32/Makefile.sub
@@ -3,9 +3,19 @@
SHELL = $(COMSPEC)
MKFILES = Makefile
+!ifndef MFLAGS
+MFLAGS=-
+!endif
+
#### Start of system configuration section. ####
+!ifndef OS
OS = bccwin32
-RT = $(OS)
+!endif
+!if !defined(RT)
+!error RT not defined. Retry from configure pass.
+!endif
+
+arch = $(ARCH)-$(OS)
## variables may be overridden by $(compile_dir)/Makefile
!ifndef srcdir
@@ -23,7 +33,7 @@ RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME)w
!endif
!ifndef RUBY_SO_NAME
-RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)
+RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)$(TEENY)
!endif
!ifndef icondirs
!ifdef ICONDIRS
@@ -36,7 +46,6 @@ iconinc=-I$(icondirs: = -I)
!endif
###############
-VPATH = $(srcdir):$(srcdir)/missing
.SUFFIXES: .y
!ifndef CC
@@ -49,15 +58,21 @@ CPP = cpp32
RC = brcc32
!endif
!ifndef YACC
-YACC = byacc
+YACC = bison
!endif
!ifndef AR
AR = tlib
!endif
+!ifndef BASERUBY
+BASERUBY = ruby
+!endif
PURIFY =
AUTOCONF = autoconf
+IFCHANGE = $(srcdir:/=\)\win32\ifchange.bat
RM = $(srcdir:/=\)\win32\rm.bat
+CP = copy > nul
+MV = move > nul
!if !defined(PROCESSOR_ARCHITECTURE)
PROCESSOR_ARCHITECTURE = x86
@@ -94,14 +109,11 @@ exec_prefix = $(prefix)
libdir = $(exec_prefix)/lib
!endif
!if !defined(datadir)
-datadir = /share
+datadir = $(prefix)/share
!endif
!ifndef EXTOUT
EXTOUT = .ext
!endif
-!ifndef RIDATADIR
-RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
-!endif
!ifndef TESTUI
TESTUI = console
!endif
@@ -109,13 +121,24 @@ TESTUI = console
TESTS =
!endif
!ifndef RDOCTARGET
-RDOCTARGET = install-nodoc
+RDOCTARGET = install-doc
!endif
OUTFLAG = -o
+COUTFLAG = -o
!ifndef CFLAGS
CFLAGS = -q -tWR -tWC $(DEBUGFLAGS) $(OPTFLAGS) $(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
!endif
+!ifndef DEFS
+DEFS =
+!endif
+!ifndef CPPFLAGS
+CPPFLAGS =
+!endif
+CPPFLAGS = $(DEFS) $(CPPFLAGS)
+!ifndef CXXFLAGS
+CXXFLAGS = $(CFLAGS)
+!endif
!ifndef LDFLAGS
LDFLAGS = -S:$(STACK)
!endif
@@ -129,15 +152,15 @@ EXTLIBS =
MEMLIB =
!endif
LIBS = $(MEMLIB) cw32i.lib import32.lib ws2_32.lib $(EXTLIBS)
-MISSING = acosh.obj crypt.obj erf.obj win32.obj
+MISSING = acosh.obj cbrt.obj crypt.obj erf.obj lgamma_r.obj strlcat.obj strlcpy.obj tgamma.obj win32.obj
!ifndef STACK
STACK = 0x2000000
!endif
-XCFLAGS = -DRUBY_EXPORT -I. -I$(srcdir) -I$(srcdir)missing
+XCFLAGS = -DRUBY_EXPORT -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir) -I$(srcdir)/missing
-ARFLAGS = /a
+ARFLAGS = /a /p32
LD = ilink32 -q -Gn
LDSHARED = $(LD)
XLDFLAGS = -Tpe c0x32.obj
@@ -153,8 +176,8 @@ EXEEXT = .exe
PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
WPROGRAM=$(RUBYW_INSTALL_NAME)$(EXEEXT)
RUBYDEF = $(RUBY_SO_NAME).def
-MINIRUBY = .\miniruby$(EXEEXT)
-RUNRUBY = .\ruby$(EXEEXT) "$(srcdir)runruby.rb" --extout="$(EXTOUT)" --
+MINIRUBY = .\miniruby$(EXEEXT) -I$(srcdir)/lib $(MINIRUBYOPT)
+RUNRUBY = .\$(PROGRAM) -i"$(EXTOUT)/$(arch)" "$(srcdir)/runruby.rb" --extout="$(EXTOUT)" --
ORGLIBPATH = $(LIB)
@@ -164,63 +187,96 @@ LIBRUBY_A = $(RUBY_SO_NAME)-static.lib
LIBRUBY_SO = $(RUBY_SO_NAME).dll
LIBRUBY = $(RUBY_SO_NAME).lib
LIBRUBYARG = $(LIBRUBY)
+THREAD_MODEL = win32
PREP = miniruby$(EXEEXT)
OBJEXT = obj
+ASMEXT = asm
+
+INSTALLED_LIST= .installed.list
+
+MKMAIN_CMD = mkmain.bat
+
+SRC_FILE = $(<:\=/)
WINMAINOBJ = winmain.$(OBJEXT)
-MINIOBJS = dmydln.$(OBJEXT)
+ARCHMINIOBJS = dmydln.$(OBJEXT)
+
+arch_hdrdir = $(EXTOUT)/include/$(arch)
+hdrdir = $(srcdir)/include
+VPATH = $(arch_hdrdir)/ruby;$(hdrdir)/ruby;$(srcdir);$(srcdir)/enc;$(srcdir)/missing;$(srcdir)/win32
-.path.c = .;$(srcdir);$(srcdir)win32;$(srcdir)missing
-.path.h = .;$(srcdir);$(srcdir)win32;$(srcdir)missing
+.path.c = .;$(srcdir);$(srcdir)/enc;$(srcdir)/win32;$(srcdir)/missing
+.path.ci = $(srcdir)
+.path.inc = .;$(srcdir)
+.path.def = .;$(srcdir)
+.path.h = .;$(arch_hdrdir)/ruby;$(hdrdir)/ruby;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
.path.y = $(srcdir)
.path. = $(srcdir)
.c.obj:
- $(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) -c $(<:/=\)
+ $(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) $(COUTFLAG)$@ -c $(<:/=\)
-.rc.res:
- $(RC) $(RFLAGS) -I. -I$(<D). $(iconinc) -I$(srcdir)win32 $(RFLAGS) -fo$@ $(<:/=\)
+.c.asm:
+ $(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) $(COUTFLAG)$@ -S $(<:\=/)
-.y.c:
- $(YACC) $(YFLAGS) $(<:\=/)
- sed -e "s!^ *extern char \*getenv();!/* & */!;s/^\(#.*\)y\.tab/\1parse/" y.tab.c > $(@F)
- @del y.tab.c
+.rc.res:
+ $(RC) $(RFLAGS) -I. -I$(<D). $(iconinc) -I$(srcdir)/win32 $(RFLAGS) -fo$@ $(<:/=\)
-all: $(srcdir)bcc32/Makefile.sub $(srcdir)common.mk
+all: $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
ruby: $(PROGRAM)
rubyw: $(WPROGRAM)
!include $(srcdir)/common.mk
-PHONY: Makefile
+$(MKFILES): $(srcdir)/bcc32/Makefile.sub $(srcdir)/bcc32/configure.bat $(srcdir)/bcc32/setup.mak
+ $(COMSPEC) /C $(srcdir:/=\)\bcc32\configure.bat $(configure_args)
+ @echo $(MKFILES) should be updated, re-run $(MAKE).
+ @$(MAKE) > nul -q -f &&|
+PHONY: nul
+ @exit
+|
+
+PHONY: nul
+RUBY_CONFIG_H = $(arch_hdrdir)/ruby/config.h
CONFIG_H = ./.config.h.time
config: config.status
config.status: $(CONFIG_H)
-$(CONFIG_H): $(MKFILES) $(srcdir)bcc32/Makefile.sub
- @$(srcdir:/=\)win32\ifchange.bat config.h &&|
+guard = INCLUDE_RUBY_CONFIG_H
+
+$(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
+ @if not exist $(arch_hdrdir:/=\) md $(arch_hdrdir:/=\)
+ @if not exist $(arch_hdrdir:/=\)\ruby md $(arch_hdrdir:/=\)\ruby
+ @$(IFCHANGE) $(RUBY_CONFIG_H:/=\) &&|
+\#ifndef $(guard)
+\#define $(guard) 1
+\#define NO_BIG_INLINE 1
\#define HAVE_SYS_TYPES_H 1
\#define HAVE_SYS_STAT_H 1
\#define HAVE_STDLIB_H 1
\#define HAVE_STRING_H 1
\#define HAVE_MEMORY_H 1
+\#define HAVE_LONG_LONG 1
\#define HAVE_OFF_T 1
\#define SIZEOF_INT 4
\#define SIZEOF_SHORT 2
\#define SIZEOF_LONG 4
\#define SIZEOF_LONG_LONG 0
\#define SIZEOF___INT64 8
-\#define SIZEOF_OFF_T 4
+\#define SIZEOF_OFF_T 8
\#define SIZEOF_VOIDP 4
\#define SIZEOF_FLOAT 4
\#define SIZEOF_DOUBLE 8
\#define SIZEOF_TIME_T 4
+\#define SIZEOF_RLIM_T 0
+\#define SIZEOF_SIZE_T 4
+\#define SIZEOF_PTRDIFF_T 4
\#define HAVE_PROTOTYPES 1
\#define TOKEN_PASTE(x,y) x\#\#y
\#define HAVE_STDARG_PROTOTYPES 1
@@ -236,6 +292,32 @@ $(CONFIG_H): $(MKFILES) $(srcdir)bcc32/Makefile.sub
\#define rb_pid_t int
\#define HAVE_STRUCT_STAT_ST_RDEV 1
\#define HAVE_ST_RDEV 1
+!if $(BORLANDC) < 0x0580
+\#define int8_t signed char
+\#define uint8_t unsigned char
+\#define int16_t short
+\#define uint16_t unsigned short
+\#define int32_t int
+\#define uint32_t unsigned int
+\#define int64_t __int64
+\#define uint64_t unsigned __int64
+\#define ssize_t int
+!endif
+\#define HAVE_INT8_T 1
+\#define HAVE_UINT8_T 1
+\#define SIZEOF_INT8_T 1
+\#define HAVE_INT16_T 1
+\#define HAVE_UINT16_T 1
+\#define SIZEOF_INT32_T 2
+\#define HAVE_INT32_T 1
+\#define HAVE_UINT32_T 1
+\#define SIZEOF_INT32_T 4
+\#define HAVE_INT64_T 1
+\#define HAVE_UINT64_T 1
+\#define SIZEOF_INT64_T 8
+\#define HAVE_INTPTR_T 1
+\#define HAVE_UINTPTR_T 1
+\#define HAVE_SSIZE_T 1
\#define GETGROUPS_T int
\#define RETSIGTYPE void
\#define HAVE_ALLOCA 1
@@ -251,6 +333,8 @@ $(CONFIG_H): $(MKFILES) $(srcdir)bcc32/Makefile.sub
\#define HAVE_STRTOD 1
\#define HAVE_STRTOL 1
\#define HAVE_STRTOUL 1
+\#define HAVE_SNPRINTF 1
+\#define HAVE_VSNPRINTF 1
\#define HAVE_ISNAN 1
\#define HAVE_FINITE 1
\#define HAVE_HYPOT 1
@@ -258,7 +342,10 @@ $(CONFIG_H): $(MKFILES) $(srcdir)bcc32/Makefile.sub
\#define HAVE_WAITPID 1
\#define HAVE_FSYNC 1
\#define HAVE_GETCWD 1
-\#define HAVE_CHSIZE 1
+\#define HAVE_TRUNCATE 1
+\#define HAVE_FTRUNCATE 1
+\#define HAVE_FSEEKO 1
+\#define HAVE_FTELLO 1
\#define HAVE_TIMES 1
\#define HAVE_FCNTL 1
\#define HAVE_LINK 1
@@ -270,21 +357,22 @@ $(CONFIG_H): $(MKFILES) $(srcdir)bcc32/Makefile.sub
\#define RSHIFT(x,y) ((x)>>(int)y)
\#define FILE_COUNT level
\#define FILE_READPTR curp
+\#define RUBY_SETJMP(env) setjmp(env)
+\#define RUBY_LONGJMP(env,val) longjmp(env,val)
+\#define RUBY_JMP_BUF jmp_buf
\#define inline __inline
\#define NEED_IO_SEEK_BETWEEN_RW 1
\#define STACK_GROW_DIRECTION -1
\#define DEFAULT_KCODE KCODE_NONE
+\#define LOAD_RELATIVE 1
\#define DLEXT ".so"
-\#define RUBY_LIB "/lib/ruby/$(MAJOR).$(MINOR)"
-\#define RUBY_SITE_LIB "/lib/ruby/site_ruby"
-\#define RUBY_SITE_LIB2 "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)"
+\#define RUBY_LIB_PREFIX "/lib/ruby"
\#define RUBY_PLATFORM "$(ARCH)-$(OS)"
-\#define RUBY_ARCHLIB "/lib/ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
-\#define RUBY_SITE_ARCHLIB "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
+\#endif /* $(guard) */
|
- @exit > $@
+ @exit > $(@:/=\)
-config.status: $(MKFILES) $(srcdir)bcc32/Makefile.sub $(srcdir)common.mk
+config.status: $(MKFILES) $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
@echo Creating $@
@type > $@ &&|
# Generated automatically by Makefile.sub.
@@ -292,13 +380,14 @@ s,@SHELL@,$$(COMSPEC),;t t
s,@BUILD_FILE_SEPARATOR@,\,;t t
s,@PATH_SEPARATOR@,;,;t t
s,@CFLAGS@,$(CFLAGS),;t t
+s,@DEFS@,$(DEFS),;t t
s,@CPPFLAGS@,$(CPPFLAGS),;t t
s,@CXXFLAGS@,$(CXXFLAGS),;t t
s,@FFLAGS@,$(FFLAGS),;t t
s,@LDFLAGS@,,;t t
s,@LIBS@,$(LIBS),;t t
s,@exec_prefix@,$${prefix},;t t
-s,@prefix@,,;t t
+s,@prefix@,$(prefix),;t t
s,@program_transform_name@,s,,,,;t t
s,@bindir@,$${exec_prefix}/bin,;t t
s,@sbindir@,$${exec_prefix}/sbin,;t t
@@ -312,6 +401,7 @@ s,@includedir@,$${prefix}/include,;t t
s,@oldincludedir@,/usr/include,;t t
s,@infodir@,$${prefix}/info,;t t
s,@mandir@,$${prefix}/man,;t t
+s,@ridir@,$${prefix}/share/ri,;t t
s,@build@,$(CPU)-pc-$(OS),;t t
s,@build_alias@,$(CPU)-$(OS),;t t
s,@build_cpu@,$(CPU),;t t
@@ -329,17 +419,17 @@ s,@target_vendor@,pc,;t t
s,@target_os@,$(OS),;t t
s,@CC@,$(CC),;t t
s,@CPP@,cpp32,;t t
+s,@CXX@,$$(CC),;t t
+s,@LD@,$(LD),;t t
s,@YACC@,$(YACC),;t t
s,@RANLIB@,,;t t
s,@AR@,$(AR),;t t
s,@ARFLAGS@,$(ARFLAGS) ,;t t
s,@LN_S@,$(LN_S),;t t
-s,@SET_MAKE@,$(SET_MAKE),;t t
+s,@SET_MAKE@,MFLAGS = -$$(MAKEFLAGS),;t t
+s,@RM@,$$(top_srcdir:/=\)\win32\rm.bat,;t t
s,@CP@,copy > nul,;t t
-s,@INSTALL@,copy > nul,;t t
-s,@INSTALL_PROG@,$$(INSTALL),;t t
-s,@INSTALL_DATA@,$$(INSTALL),;t t
-s,@LIBOBJS@, acosh.obj crypt.obj erf.obj win32.obj,;t t
+s,@LIBOBJS@, $(MISSING),;t t
s,@ALLOCA@,$(ALLOCA),;t t
s,@DEFAULT_KCODE@,$(DEFAULT_KCODE),;t t
s,@EXEEXT@,.exe,;t t
@@ -379,23 +469,30 @@ s,@SOLIBS@,$(SOLIBS),;t t
s,@DLDLIBS@,$(DLDLIBS),;t t
s,@ENABLE_SHARED@,yes,;t t
s,@OUTFLAG@,$(OUTFLAG),;t t
+s,@COUTFLAG@,$(COUTFLAG),;t t
s,@CPPOUTFILE@,,;t t
s,@LIBPATHFLAG@, -L"%s",;t t
s,@RPATHFLAG@,,;t t
s,@LIBARG@,%s.lib,;t t
-s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE), $$(RESFILE),;t t
-s,@COMPILE_C@,$$(CC) $$(INCFLAGS) $$(CFLAGS) $$(CPPFLAGS) -c $$(<:/=\),;t t
-s,@COMPILE_CXX@,$$(CXX) $$(INCFLAGS) $$(CXXFLAGS) $$(CPPFLAGS) -P -c $$(<:/=\),;t t
+s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS:/=\), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE:/=\), $$(RESFILE:/=\),;t t
+s,@COMPILE_C@,$$(CC) $$(INCFLAGS) $$(CFLAGS) $$(CPPFLAGS) $(COUTFLAG)$$(@) -c $$(<:/=\),;t t
+s,@COMPILE_CXX@,$$(CXX) $$(INCFLAGS) $$(CXXFLAGS) $$(CPPFLAGS) -P $(COUTFLAG)$$(@) -c $$(<:/=\),;t t
s,@COMPILE_RULES@,{$$(srcdir)}.%s{}.%s: {$$(topdir)}.%s{}.%s: {$$(hdrdir)}.%s{}.%s: .%s.%s:,;t t
s,@RULE_SUBST@,{.;$$(VPATH)}%s,;t t
s,@COMMON_LIBS@,m advapi32 avicap32 avifil32 cap comctl32 comdlg32 dlcapi gdi32 glu32 imagehlp imm32 inetmib1 kernel32 loadperf lsapi32 lz32 mapi32 mgmtapi mpr msacm32 msvfw32 nddeapi netapi32 ole32 oleaut32 oledlg olepro32 opengl32 pdh pkpd32 rasapi32 rasdlg rassapi rpcrt4 setupapi shell32 shfolder snmpapi sporder tapi32 url user32 vdmdbg version win32spl winmm wintrust wsock32,;t t
-s,@COMMON_MACROS@,WIN32_LEAN_AND_MEAN;t t
+s,@COMMON_MACROS@,WIN32_LEAN_AND_MEAN WIN32,;t t
s,@COMMON_HEADERS@,winsock2.h windows.h,;t t
+s,@cleanlibs@,$$*.tds,;t t
+s,@cleanobjs@,$$*-$$(arch).def $$*.il? $$*.lib,;t t
s,@TRY_LINK@,$$(CC) -oconftest $$(INCFLAGS) -I$$(hdrdir) $$(CPPFLAGS) $$(CFLAGS) $$(LIBPATH) $$(LDFLAGS) $$(src) $$(LOCAL_LIBS) $$(LIBS),;t t
s,@EXPORT_PREFIX@,_,;t t
s,@arch@,$(ARCH)-$(OS),;t t
s,@sitearch@,$(ARCH)-$(OS),;t t
s,@sitedir@,$${prefix}/lib/ruby/site_ruby,;t t
+s,@vendordir@,$${prefix}/lib/ruby/vendor_ruby,;t t
+s,@rubyhdrdir@,$$(includedir)/ruby-$$(MAJOR).$$(MINOR).$$(TEENY),;t t
+s,@sitehdrdir@,$$(rubyhdrdir)/site_ruby,;t t
+s,@vendorhdrdir@,$$(rubyhdrdir)/vendor_ruby,;t t
s,@configure_args@,--enable-shared $(configure_args),;t t
s,@configure_input@,$$configure_input,;t t
s,@srcdir@,$(srcdir),;t t
@@ -404,7 +501,7 @@ s,@top_srcdir@,$(srcdir),;t t
miniruby$(EXEEXT):
@echo $(LIBS)
- $(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(MINIOBJS),$@,nul,$(LIBRUBY_A) $(LIBS)
+ $(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(MINIOBJS) $(COMMONOBJS:/=\) $(DMYEXT),$@,nul,$(LIBS)
$(PROGRAM): $(MAINOBJ) $(LIBRUBY_SO) $(RUBY_INSTALL_NAME).res
$(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBY_INSTALL_NAME).res
@@ -421,37 +518,59 @@ $(LIBRUBY_A): $(OBJS) $(DMYEXT)
$(LIBRUBY_SO): $(LIBRUBY_A) $(DLDOBJS) $(RUBYDEF) $(RUBY_SO_NAME).res
@echo $(DLDOBJS)
+ @$(PRE_LIBRUBY_UPDATE)
$(LIBRUBY_LDSHARED) $(LIBRUBY_DLDFLAGS) $(DLDOBJS:/=\),$(LIBRUBY_SO),nul,$(LIBRUBY_A) $(LIBS),$(RUBYDEF),$(RUBY_SO_NAME).res
$(LIBRUBY): $(LIBRUBY_SO)
$(RUBYDEF): $(LIBRUBY_A) $(PREP)
- $(MINIRUBY) $(srcdir)bcc32/mkexports.rb -output=$@ -base=$(RUBY_SO_NAME) $(LIBRUBY_A)
+ $(MINIRUBY) $(srcdir)/bcc32/mkexports.rb -output=$@ -base=$(RUBY_SO_NAME) $(LIBRUBY_A)
-$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb
- @$(MINIRUBY) $(srcdir)win32/resource.rb \
+$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb $(srcdir)/revision.h $(srcdir)/win32/resource.rb
+ @$(MINIRUBY) $(srcdir)/win32/resource.rb \
-ruby_name=$(RUBY_INSTALL_NAME) \
-rubyw_name=$(RUBYW_INSTALL_NAME) \
-so_name=$(RUBY_SO_NAME) \
- . $(icondirs) $(srcdir)win32
-
-post-install-ext::
- $(MINIRUBY) -I$(srcdir)lib -rrbconfig -rfileutils \
- -e "FileUtils.rm_f(Dir[ARGV[0]+Config::CONFIG['archdir']+'/**/*.tds'])" "$(DESTDIR:\=/)"
+ . $(icondirs) $(srcdir)/win32
+
+lex.c: {$(srcdir)}lex.c.blt
+ copy "$(?:/=\)" $@
+
+post-install-bin::
+ @$(NULLCMD)
+post-install-lib::
+ @$(NULLCMD)
+post-install-ext-comm::
+ @$(NULLCMD)
+post-install-ext-arch::
+ @$(NULLCMD)
+post-install-man::
+ @$(NULLCMD)
+post-install-doc::
+ @$(NULLCMD)
clean-local::
- @$(RM) ext\extinit.c ext\extinit.$(OBJEXT) *.tds *.il? $(RUBY_SO_NAME).lib
+ @$(RM) $(WINMAINOBJ) ext\extinit.c ext\extinit.$(OBJEXT) *.tds *.il? $(RUBY_SO_NAME).lib
@$(RM) $(RUBY_INSTALL_NAME).res $(RUBYW_INSTALL_NAME).res $(RUBY_SO_NAME).res
+ @$(RM) *.map *.pdb *.ilk *.exp $(RUBYDEF) ext\ripper\y.output
distclean-local::
@$(RM) ext\config.cache $(RBCONFIG:/=\)
- @$(RM) *.map *.pdb *.ilk *.exp $(RUBYDEF)
@$(RM) $(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc
+clean-ext distclean-ext realclean-ext::
+ @for /R ext %I in (.) do @if exist %I\Makefile ( \
+ echo $(@:-ext=)ing %~nI & \
+ cd %I & \
+ $(MAKE) $(MFLAGS) $(@:-ext=) & \
+ cd %CD% \
+ )
+
ext/extinit.obj: ext/extinit.c $(SETUP)
- $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) -o$@ -c ext/extinit.c
+ $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
main.$(OBJEXT): win32.h
+ascii.$(OBJEXT): win32.h
array.$(OBJEXT): win32.h
bignum.$(OBJEXT): win32.h
class.$(OBJEXT): win32.h
@@ -460,6 +579,7 @@ dir.$(OBJEXT): dir.h win32.h
dln.$(OBJEXT): win32.h
enum.$(OBJEXT): win32.h
error.$(OBJEXT): win32.h
+euc_jp.$(OBJEXT): win32.h
eval.$(OBJEXT): win32.h
file.$(OBJEXT): win32.h
gc.$(OBJEXT): win32.h
@@ -477,14 +597,21 @@ prec.$(OBJEXT): win32.h
random.$(OBJEXT): win32.h
range.$(OBJEXT): win32.h
re.$(OBJEXT): win32.h
-regex.$(OBJEXT): win32.h
+regcomp.$(OBJEXT): win32.h
+regenc.$(OBJEXT): win32.h
+regerror.$(OBJEXT): win32.h
+regexec.$(OBJEXT): win32.h
+reggnu.$(OBJEXT): win32.h
+regparse.$(OBJEXT): win32.h
ruby.$(OBJEXT): win32.h
signal.$(OBJEXT): win32.h
+sjis.$(OBJEXT): win32.h
sprintf.$(OBJEXT): win32.h
st.$(OBJEXT): win32.h
string.$(OBJEXT): win32.h
struct.$(OBJEXT): win32.h
time.$(OBJEXT): win32.h
+utf_8.$(OBJEXT): win32.h
util.$(OBJEXT): win32.h
variable.$(OBJEXT): win32.h
version.$(OBJEXT): win32.h
diff --git a/bcc32/README.bcc32 b/bcc32/README.bcc32
index c27a1261f1..cd33eec0a1 100644
--- a/bcc32/README.bcc32
+++ b/bcc32/README.bcc32
@@ -16,7 +16,7 @@
* ilink32
(3) If you want to build from CVS source, following commands are required.
- * byacc ((<URL:http://gnuwin32.sourceforge.net/packages/byacc.htm>))
+ * bison ((<URL:http://gnuwin32.sourceforge.net/packages/bison.htm>))
* sed ((<URL:http://gnuwin32.sourceforge.net/packages/sed.htm>))
(4) We strongly recommend to build ruby on C++Builder, to link following files.
@@ -30,7 +30,13 @@
== How to compile and install
(1) Execute bcc32\configure.bat on your build directory.
- ex. c:\ruby-1.6.7>bcc32\configure.bat
+ ex. c:\src\ruby> bcc32\configure.bat
+ You can specify the target platform as an argument.
+ For example, run `((%configure i686-bccwin32%))'
+ You can also specify the install directory.
+ For example, run `((%configure --prefix=<install_directory>%))'
+ Default of the install directory is /usr .
+ The default ((|<PLATFORM>|)) is `(({i386-bccwin32}))'.
(2) Change ((|RUBY_INSTALL_NAME|)) and ((|RUBY_SO_NAME|)) in (({Makefile}))
if you want to change the name of the executable files.
@@ -41,20 +47,7 @@
(4) Run `((%make test%))'
-(5) Run `((%make DESTDIR=<install_directory> install%))'
-
- This command will create following directories and install files onto them.
- * <install_directory>\bin
- * <install_directory>\lib
- * <install_directory>\lib\ruby
- * <install_directory>\lib\ruby\<MAJOR>.<MINOR>
- * <install_directory>\lib\ruby\<MAJOR>.<MINOR>\<PLATFORM>
- * <install_directory>\lib\ruby\site_ruby
- * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>
- * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>\<PLATFORM>
- * <install_directory>\man\man1
- If Ruby's version is `x.y.z', the ((|<MAJOR>|)) is `x' and the ((|<MINOR>|)) is `y'.
- The ((|<PLATFORM>|)) is usually `(({i586-bccwin32}))'.
+(5) Run `((%make install%))'
(6) Requires dynamic RTL (cc3250.dll on C++Builder5) and borlndmm.dll (If built with
usebormm.lib) to use installed binary. These files are ordinary in bcc32's bin
@@ -90,10 +83,10 @@ in Japanese, but you can download at least.
C:
cd \ruby
- bcc32\configure
+ bcc32\configure --prefix=/usr/local
make
make test
- make DESTDIR=/usr/local install
+ make install
* Build on the relative directory from the ruby source directory and CPU type
i386.
@@ -108,10 +101,10 @@ in Japanese, but you can download at least.
cd \ruby
mkdir bccwin32
cd bccwin32
- ..\bcc32\configure target i386-bccwin32
+ ..\bcc32\configure --prefix=/usr/local
make
make test
- make DESTDIR=/usr/local install
+ make install
* Build on the different drive.
@@ -122,10 +115,10 @@ in Japanese, but you can download at least.
D:
cd D:\build\ruby
- C:\src\ruby\bcc32\configure
+ C:\src\ruby\bcc32\configure --prefix=C:/usr/local
make
make test
- make DESTDIR=C:/usr/local install
+ make install
== Bugs
diff --git a/bcc32/configure.bat b/bcc32/configure.bat
index 123a3f23c8..8cdfc64b03 100755
--- a/bcc32/configure.bat
+++ b/bcc32/configure.bat
@@ -6,70 +6,120 @@
echo> ~tmp~.mak ####
echo>> ~tmp~.mak conf = %0
echo>> ~tmp~.mak $(conf:\=/): nul
-echo>> ~tmp~.mak @del ~tmp~.mak
+echo>> ~tmp~.mak @del ~setup~.mak
echo>> ~tmp~.mak @-$(MAKE) -l$(MAKEFLAGS) -f $(@D)setup.mak \
+if exist pathlist.tmp del pathlist.tmp
+if exist confargs.mk del confargs.mk
:loop
if "%1" == "" goto :end
if "%1" == "--prefix" goto :prefix
+if "%1" == "prefix" goto :prefix
if "%1" == "--srcdir" goto :srcdir
if "%1" == "srcdir" goto :srcdir
if "%1" == "--target" goto :target
if "%1" == "target" goto :target
if "%1" == "--with-static-linked-ext" goto :extstatic
if "%1" == "--program-suffix" goto :suffix
-if "%1" == "--program-name" goto :progname
+if "%1" == "RUBY_SUFFIX" goto :suffix
+if "%1" == "--program-name" goto :installname
+if "%1" == "--install-name" goto :installname
+if "%1" == "RUBY_INSTALL_NAME" goto :installname
+if "%1" == "--so-name" goto :soname
+if "%1" == "RUBY_SO_NAME" goto :soname
if "%1" == "--enable-install-doc" goto :enable-rdoc
if "%1" == "--disable-install-doc" goto :disable-rdoc
if "%1" == "--extout" goto :extout
+if "%1" == "EXTOUT" goto :extout
+if "%1" == "--with-baseruby" goto :baseruby
+if "%1" == "BASERUBY" goto :baseruby
+if "%1" == "--path" goto :path
if "%1" == "-h" goto :help
if "%1" == "--help" goto :help
- echo>> ~tmp~.mak "%1" \
+ echo>>confargs.tmp %1 \
shift
goto :loop
:srcdir
- echo>> ~tmp~.mak -D"srcdir=%2" \
+ echo>> ~tmp~.mak -Dsrcdir=%2 \
+ echo>>confargs.tmp --srcdir=%2 \
shift
shift
goto :loop
:prefix
- echo>> ~tmp~.mak -D"prefix=%2" \
+ echo>> ~tmp~.mak -Dprefix=%2 \
+ echo>>confargs.tmp %1=%2 \
shift
shift
goto :loop
:suffix
- echo>> ~tmp~.mak -D"RUBY_SUFFIX=%2" \
+ echo>>confargs.mk !ifndef RUBY_SUFFIX
+ echo>>confargs.mk RUBY_SUFFIX = %2
+ echo>>confargs.mk !endif
+ echo>>confargs.tmp %1=%2 \
shift
shift
goto :loop
:installname
- echo>> ~tmp~.mak -D"RUBY_INSTALL_NAME=%2" \
+ echo>>confargs.mk !ifndef RUBY_INSTALL_NAME
+ echo>>confargs.mk RUBY_INSTALL_NAME = %2
+ echo>>confargs.mk !endif
+ echo>>confargs.tmp %1=%2 \
shift
shift
goto :loop
:soname
- echo>> ~tmp~.mak -D"RUBY_SO_NAME=%2" \
+ echo>>confargs.mk !ifndef RUBY_SO_NAME
+ echo>>confargs.mk RUBY_SO_NAME = %2
+ echo>>confargs.mk !endif
+ echo>>confargs.tmp %1=%2 \
shift
shift
goto :loop
:target
- echo>> ~tmp~.mak "%2" \
+ echo>> ~tmp~.mak %2 \
+ echo>>confargs.tmp --target=%2 \
shift
shift
goto :loop
:extstatic
- echo>> ~tmp~.mak -D"EXTSTATIC=static" \
+ echo>>confargs.mk !ifndef EXTSTATIC
+ echo>>confargs.mk EXTSTATIC = static
+ echo>>confargs.mk !endif
+ echo>>confargs.tmp %1 \
shift
goto :loop
:enable-rdoc
- echo>> ~tmp~.mak -D"RDOCTARGET=install-doc" \
+ echo>>confargs.mk !ifndef RDOCTARGET
+ echo>>confargs.mk RDOCTARGET = install-doc
+ echo>>confargs.mk !endif
+ echo>>confargs.tmp %1 \
shift
goto :loop
:disable-rdoc
- echo>> ~tmp~.mak -D"RDOCTARGET=install-nodoc" \
+ echo>>confargs.mk !ifndef RDOCTARGET
+ echo>>confargs.mk RDOCTARGET = install-nodoc
+ echo>>confargs.mk !endif
+ echo>>confargs.tmp %1 \
shift
goto :loop
:extout
- echo>> ~tmp~.mak "EXTOUT=%2" \
+ echo>>confargs.mk !ifndef EXTOUT
+ echo>>confargs.mk EXTOUT = %2
+ echo>>confargs.mk !endif
+ echo>>confargs.tmp %1=%2 \
+ shift
+ shift
+goto :loop
+:baseruby
+ echo>>confargs.mk !ifndef BASERUBY
+ echo>>confargs.mk BASERUBY = %2
+ echo>>confargs.mk !endif
+ echo>>confargs.tmp %1=%2 \
+ shift
+ shift
+goto :loop
+:path
+ echo>>pathlist.tmp %2;\
+ echo>>confargs.tmp %1=%2 \
shift
shift
goto :loop
@@ -82,11 +132,32 @@ goto :loop
echo System types:
echo --target=TARGET configure for TARGET [i386-bccwin32]
echo Optional Package:
+ echo --with-baseruby=RUBY use RUBY as baseruby [ruby]
echo --with-static-linked-ext link external modules statically
echo --enable-install-doc install rdoc indexes during install
+ del *.tmp
del ~tmp~.mak
goto :exit
:end
-echo>> ~tmp~.mak bcc32dir="$(@D)"
-make -s -f ~tmp~.mak
+echo>> ~tmp~.mak -Dbcc32dir=$(@D)
+if not exist confargs.tmp goto :noconfargs
+ echo>>confargs.mk configure_args = \
+ type>>confargs.mk confargs.tmp
+ echo.>>confargs.mk
+ echo>>confargs.mk ####
+:noconfargs
+if not exist pathlist.tmp goto :nopathlist
+ echo>>confargs.mk pathlist = \
+ type>>confargs.mk pathlist.tmp
+ echo.>>confargs.mk
+ echo>>confargs.mk ####
+ echo>>confargs.mk PATH = $(pathlist:;=/bin;)$(PATH)
+ echo>>confargs.mk INCLUDE = $(pathlist:;=/include;)
+ echo>>confargs.mk LIB = $(pathlist:;=/lib;)
+:nopathlist
+if exist confargs.mk copy confargs.mk ~setup~.mak > nul
+type>>~setup~.mak ~tmp~.mak
+del *.tmp > nul
+del ~tmp~.mak > nul
+make -s -f ~setup~.mak
:exit
diff --git a/bcc32/mkexports.rb b/bcc32/mkexports.rb
index e34b441e2f..888ab2e2a6 100644..100755
--- a/bcc32/mkexports.rb
+++ b/bcc32/mkexports.rb
@@ -1,25 +1,26 @@
#!./miniruby -s
-SYM = {}
-STDIN.reopen(open("nul"))
-ARGV.each do |obj|
- IO.foreach("|tdump -q -oiPUBDEF -oiPUBD32 #{obj.tr('/', '\\')}") do |l|
- next unless /(?:PUBDEF|PUBD32)/ =~ l
- SYM[$1] = true if /'(.*?)'/ =~ l
+$:.unshift(File.expand_path("../..", __FILE__))
+require 'win32/mkexports'
+
+class Exports::Bcc < Exports
+ def forwarding(internal, export)
+ internal[/\A_?/]+export
end
-end
-exports = []
-if $name
- exports << "Name " + $name
-elsif $library
- exports << "Library " + $library
-end
-exports << "Description " + $description.dump if $description
-exports << "EXPORTS" << SYM.keys.sort
+ def each_line(objs, &block)
+ objs.each do |obj|
+ opt = /\.(?:so|dll)\z/i =~ obj ? "-ee" : "-oiPUBDEF -oiPUBD32"
+ IO.foreach("|tdump -q #{opt} #{obj.tr('/', '\\')} < nul", &block)
+ end
+ end
-if $output
- open($output, 'w') {|f| f.puts exports.join("\n")}
-else
- puts exports.join("\n")
+ def each_export(objs)
+ objdump(objs) do |l|
+ next unless /(?:PUBDEF|PUBD32|EXPORT)/ =~ l
+ yield $1 if /'(.*?)'/ =~ l
+ end
+ yield "_strcasecmp", "_stricmp"
+ yield "_strncasecmp", "_strnicmp"
+ end
end
diff --git a/bcc32/setup.mak b/bcc32/setup.mak
index 1c922c208f..df2fd3c128 100644
--- a/bcc32/setup.mak
+++ b/bcc32/setup.mak
@@ -1,13 +1,13 @@
# -*- makefile -*-
!if "$(srcdir)" != ""
-bcc32dir = $(srcdir)bcc32/
+bcc32dir = $(srcdir)/bcc32
!elseif "$(bcc32dir)" == "bcc32/"
-srcdir = ./
+srcdir = .
!elseif "$(bcc32dir:/bcc32/=)/bcc32/" == "$(bcc32dir)"
-srcdir = $(bcc32dir:/bcc32/=/)
+srcdir = $(bcc32dir:/bcc32/=)
!else
-srcdir = $(bcc32dir)../
+srcdir = $(bcc32dir)/..
!endif
!ifndef prefix
prefix = /usr
@@ -15,7 +15,7 @@ prefix = /usr
OS = bccwin32
RT = $(OS)
BANG = !
-APPEND = echo>>$(MAKEFILE)
+APPEND = echo.>>$(MAKEFILE)
!ifdef MAKEFILE
MAKE = $(MAKE) -f $(MAKEFILE)
!else
@@ -30,7 +30,9 @@ i586-$(OS): -prologue- -i586- -epilogue-
i686-$(OS): -prologue- -i686- -epilogue-
alpha-$(OS): -prologue- -alpha- -epilogue-
--prologue-: nul
+-prologue-: -basic-vars- -version- -system-vars-
+
+-basic-vars-: nul
@echo Creating $(MAKEFILE)
@type > $(MAKEFILE) &&|
\#\#\# Makefile for ruby $(OS) \#\#\#
@@ -40,36 +42,79 @@ $(BANG)endif
$(BANG)ifndef prefix
prefix = $(prefix:\=/)
$(BANG)endif
-$(BANG)ifndef EXTSTATIC
-EXTSTATIC = $(EXTSTATIC)
-$(BANG)endif
-!if defined(RDOCTARGET)
-$(BANG)ifndef RDOCTARGET
-RDOCTARGET = $(RDOCTARGET)
-$(BANG)endif
+$(BANG)if !defined(BASERUBY)
+!if defined(BASERUBY)
+BASERUBY = $(BASERUBY)
+!endif
+|
+!if !defined(BASERUBY)
+ @for %I in (ruby.exe) do @echo BASERUBY = "%~$$PATH:I" >> $(MAKEFILE)
!endif
-!if defined(EXTOUT)
-$(BANG)ifndef EXTOUT
-EXTOUT = $(EXTOUT)
+ @type >> $(MAKEFILE) &&|
$(BANG)endif
+|
+!if exist(confargs.mk)
+ @type confargs.mk >> $(MAKEFILE)
+ @del confargs.mk
!endif
+
+-system-vars-: -runtime- -bormm-
+
+-bormm-: nul
+ @-ilink32 -q -Gn -x usebormm.lib > nul
+ @-if exist usebormm.tds $(APPEND) MEMLIB = usebormm.lib
+ @if exist usebormm.* del usebormm.*
+
+-osname-: nul
+ @echo OS = >>$(MAKEFILE)
+
+-runtime-: nul
+ type > conftest.c &&|
+\#include <stdio.h>
+int main(){printf("");return 0;}
|
- @type > usebormm.bat &&|
-@echo off
-ilink32 -Gn -x usebormm.lib > nul
-if exist usebormm.tds echo MEMLIB = usebormm.lib
+ bcc32 conftest.c cw32i.lib > nul
+ tdump conftest.exe < nul > conftest.i
+ grep "^Imports from CC" conftest.i > conftest.c
+ cpp32 -P- -DFile=\# -DImports=RTNAME -Dfrom== conftest.c > nul
+ $(MAKE) > nul -DBANG=$(BANG) -f &&|
+-runtime-: nul
+$(BANG)include conftest.i
+RT = $$(RTNAME:.DLL=)
+OS = $$(RT:CC32=)
+-runtime-:
+ del conftest.*
+$(BANG)if "$$(OS)" == "50"
+ echo OS = bccwin32 >> $(MAKEFILE)
+$(BANG)else
+ echo OS = bccwin32_$$(OS) >> $(MAKEFILE)
+$(BANG)endif
|
- @usebormm.bat >> $(MAKEFILE)
- @del usebormm.*
+ @echo RT = $$(OS) >> $(MAKEFILE)
- @cpp32 -I$(srcdir) -DRUBY_EXTERN="//" -P- -o$(MAKEFILE) > nul &&|
+-version-: nul
+ @cpp32 -I$(srcdir) -P- -o$(MAKEFILE) > nul &&|
+\#define RUBY_REVISION 0
\#include "version.h"
-MAJOR = RUBY_VERSION_MAJOR
-MINOR = RUBY_VERSION_MINOR
-TEENY = RUBY_VERSION_TEENY
+MAJOR = RUBY_API_VERSION_MAJOR
+MINOR = RUBY_API_VERSION_MINOR
+TEENY = RUBY_API_VERSION_TEENY
+
+BORLANDC = __BORLANDC__
|
- @type $(MAKEFILE).i >> $(MAKEFILE)
+ @$(MAKE) > nul -DBANG=$(BANG) -f &&,
+-version-: nul
+$(BANG)include $(MAKEFILE)
+$(BANG)include $(MAKEFILE).i
+-version-:
@del $(MAKEFILE).i
+ @type >> $(MAKEFILE) &&|
+MAJOR = $$(MAJOR)
+MINOR = $$(MINOR)
+TEENY = $$(TEENY)
+BORLANDC = $$(BORLANDC)
+|
+,
-generic-: nul
!if defined(PROCESSOR_ARCHITECTURE) || defined(PROCESSOR_LEVEL)
@@ -84,7 +129,6 @@ $(BANG)ifndef PROCESSOR_LEVEL
PROCESSOR_LEVEL = $(PROCESSOR_LEVEL)
$(BANG)endif
!endif
-
|
!endif
@@ -114,20 +158,22 @@ $(BANG)endif
@$(APPEND) PROCESSOR_LEVEL = 6
@$(APPEND) !endif
+-epilogue-: -encs-
+
+-encs-: nul
+ @$(MAKE) -f $(srcdir)/win32/enc-setup.mak srcdir="$(srcdir)" MAKEFILE=$(MAKEFILE)
+
-epilogue-: nul
@type >> $(MAKEFILE) &&|
-\# OS = $(OS)
-\# RT = $(RT)
\# RUBY_INSTALL_NAME = ruby
\# RUBY_SO_NAME = $$(RT)-$$(RUBY_INSTALL_NAME)$$(MAJOR)$$(MINOR)
\# CFLAGS = -q $$(DEBUGFLAGS) $$(OPTFLAGS) $$(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
-\# CPPFLAGS = -I. -I$$(srcdir) -I$$(srcdir)missing -DLIBRUBY_SO=\"$$(LIBRUBY_SO)\"
+\# CPPFLAGS = -I. -I$$(srcdir) -I$$(srcdir)/missing -DLIBRUBY_SO=\"$$(LIBRUBY_SO)\"
\# STACK = 0x2000000
\# LDFLAGS = -S:$$(STACK)
\# RFLAGS = $$(iconinc)
\# EXTLIBS = cw32.lib import32.lib user32.lib kernel32.lib
-$(BANG)include $$(srcdir)bcc32/Makefile.sub
+$(BANG)include $$(srcdir)/bcc32/Makefile.sub
|
- @$(srcdir:/=\)\win32\rm.bat config.h config.status
@echo type "`$(MAKE)'" to make ruby for $(OS).
diff --git a/benchmark/bm_app_answer.rb b/benchmark/bm_app_answer.rb
new file mode 100644
index 0000000000..3cd8a8fd37
--- /dev/null
+++ b/benchmark/bm_app_answer.rb
@@ -0,0 +1,15 @@
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+def the_answer_to_life_the_universe_and_everything
+ (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
+end
+
+answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
new file mode 100644
index 0000000000..77c66a7949
--- /dev/null
+++ b/benchmark/bm_app_erb.rb
@@ -0,0 +1,26 @@
+#
+# Create many HTML strings with ERB.
+#
+
+require 'erb'
+
+data = DATA.read
+max = 15_000
+title = "hello world!"
+content = "hello world!\n" * 10
+
+max.times{
+ ERB.new(data).result(binding)
+}
+
+__END__
+
+<html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+</html>
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/bm_app_factorial.rb
new file mode 100644
index 0000000000..45f471dfdb
--- /dev/null
+++ b/benchmark/bm_app_factorial.rb
@@ -0,0 +1,11 @@
+def fact(n)
+ if(n > 1)
+ n * fact(n-1)
+ else
+ 1
+ end
+end
+
+100.times {
+ fact(5000)
+}
diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb
new file mode 100644
index 0000000000..34a7b2e725
--- /dev/null
+++ b/benchmark/bm_app_fib.rb
@@ -0,0 +1,10 @@
+def fib n
+ if n < 3
+ 1
+ else
+ fib(n-1) + fib(n-2)
+ end
+end
+
+fib(34)
+
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
new file mode 100644
index 0000000000..89069db7ab
--- /dev/null
+++ b/benchmark/bm_app_mandelbrot.rb
@@ -0,0 +1,23 @@
+require 'complex'
+
+def mandelbrot? z
+ i = 0
+ while i<100
+ i+=1
+ z = z * z
+ return false if z.abs > 2
+ end
+ true
+end
+
+ary = []
+
+(0..1000).each{|dx|
+ (0..1000).each{|dy|
+ x = dx / 50.0
+ y = dy / 50.0
+ c = Complex(x, y)
+ ary << c if mandelbrot?(c)
+ }
+}
+
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
new file mode 100644
index 0000000000..59c63f358e
--- /dev/null
+++ b/benchmark/bm_app_pentomino.rb
@@ -0,0 +1,259 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+ nb.each{|x|
+ a[n] = x
+ if n == NP-1
+ $p << [a.sort]
+ else
+ nbc=nb.dup
+ [-ROW, -1, 1, ROW].each{|d|
+ if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+ nbc << x+d
+ end
+ }
+ nbc.delete x
+ piece(n+1,a[0..n],nbc)
+ end
+ }
+end
+
+def kikaku(a)
+ a.collect {|x| x - a[0]}
+end
+def ud(a)
+ kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+ kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+ kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+ piece(0,[],[0])
+ $p.each do |a|
+ a0 = a[0]
+ a[1] = ud(a0)
+ a[2] = rl(a0)
+ a[3] = ud(rl(a0))
+ a[4] = xy(a0)
+ a[5] = ud(xy(a0))
+ a[6] = rl(xy(a0))
+ a[7] = ud(rl(xy(a0)))
+ a.sort!
+ a.uniq!
+ end
+ $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+ (0...ROW*COL).each{|i|
+ if i % ROW >= ROW-NP
+ $b[i] = -2
+ else
+ $b[i] = -1
+ end
+ $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+ }
+end
+
+def pboard
+ return # skip print
+ print "No. #$no\n"
+ (0...COL).each{|i|
+ print "|"
+ (0...ROW-NP).each{|j|
+ x = $b[i*ROW+j]
+ if x < 0
+ print "..|"
+ else
+ printf "%2d|",x+1
+ end
+ }
+ print "\n"
+ }
+ print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+ if a.length == $p.length then
+ $no += 1
+ pboard
+ return
+ end
+ while $b[pos] != -1
+ pos += 1
+ end
+ ($pnum - a).each do |i|
+ $p[i].each do |x|
+ f = 0
+ x.each{|s|
+ if $b[pos+s] != -1
+ f=1
+ break
+ end
+ }
+ if f == 0 then
+ x.each{|s|
+ $b[pos+s] = i
+ }
+ a << i
+ setpiece(a.dup, pos)
+ a.pop
+ x.each{|s|
+ $b[pos+s] = -1
+ }
+ end
+ end
+ end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
+
+
+__END__
+
+# original
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n,a,nb)
+ for x in nb
+ a[n] = x
+ if n == NP-1
+ $p << [a.sort]
+ else
+ nbc=nb.dup
+ for d in [-ROW, -1, 1, ROW]
+ if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+ nbc << x+d
+ end
+ end
+ nbc.delete x
+ piece(n+1,a[0..n],nbc)
+ end
+ end
+end
+
+def kikaku(a)
+ a.collect {|x| x - a[0]}
+end
+def ud(a)
+ kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+ kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+ kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+ piece(0,[],[0])
+ $p.each do |a|
+ a0 = a[0]
+ a[1] = ud(a0)
+ a[2] = rl(a0)
+ a[3] = ud(rl(a0))
+ a[4] = xy(a0)
+ a[5] = ud(xy(a0))
+ a[6] = rl(xy(a0))
+ a[7] = ud(rl(xy(a0)))
+ a.sort!
+ a.uniq!
+ end
+ $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+ for i in 0...ROW*COL
+ if i % ROW >= ROW-NP
+ $b[i] = -2
+ else
+ $b[i] = -1
+ end
+ $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+ end
+end
+
+def pboard
+ print "No. #$no\n"
+ for i in 0...COL
+ print "|"
+ for j in 0...ROW-NP
+ x = $b[i*ROW+j]
+ if x < 0
+ print "..|"
+ else
+ printf "%2d|",x+1
+ end
+ end
+ print "\n"
+ end
+ print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+ if a.length == $p.length then
+ $no += 1
+ pboard
+ return
+ end
+ while $b[pos] != -1
+ pos += 1
+ end
+ ($pnum - a).each do |i|
+ $p[i].each do |x|
+ f = 0
+ for s in x do
+ if $b[pos+s] != -1
+ f=1
+ break
+ end
+ end
+ if f == 0 then
+ for s in x do
+ $b[pos+s] = i
+ end
+ a << i
+ setpiece(a.dup, pos)
+ a.pop
+ for s in x do
+ $b[pos+s] = -1
+ end
+ end
+ end
+ end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/bm_app_raise.rb
new file mode 100644
index 0000000000..01d2ae3219
--- /dev/null
+++ b/benchmark/bm_app_raise.rb
@@ -0,0 +1,8 @@
+i=0
+while i<300000
+ i+=1
+ begin
+ raise
+ rescue
+ end
+end
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/bm_app_strconcat.rb
new file mode 100644
index 0000000000..7b2f2da5a7
--- /dev/null
+++ b/benchmark/bm_app_strconcat.rb
@@ -0,0 +1,5 @@
+i=0
+while i<2_000_000
+ "#{1+1} #{1+1} #{1+1}"
+ i+=1
+end
diff --git a/benchmark/bm_app_tak.rb b/benchmark/bm_app_tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/bm_app_tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+ unless y < x
+ z
+ else
+ tak( tak(x-1, y, z),
+ tak(y-1, z, x),
+ tak(z-1, x, y))
+ end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/bm_app_tarai.rb
new file mode 100644
index 0000000000..4c146f5ccf
--- /dev/null
+++ b/benchmark/bm_app_tarai.rb
@@ -0,0 +1,10 @@
+def tarai( x, y, z )
+ if x <= y
+ then y
+ else tarai(tarai(x-1, y, z),
+ tarai(y-1, z, x),
+ tarai(z-1, x, y))
+ end
+end
+
+tarai(12, 6, 0)
diff --git a/benchmark/bm_app_uri.rb b/benchmark/bm_app_uri.rb
new file mode 100644
index 0000000000..586edfd5dc
--- /dev/null
+++ b/benchmark/bm_app_uri.rb
@@ -0,0 +1,8 @@
+require 'uri'
+
+100_000.times{
+ uri = URI.parse('http://www.ruby-lang.org')
+ uri.scheme
+ uri.host
+ uri.port
+}
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb
new file mode 100644
index 0000000000..2f205c1333
--- /dev/null
+++ b/benchmark/bm_io_file_create.rb
@@ -0,0 +1,13 @@
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+ f = open(file, 'w')
+ f.close#(true)
+}
+File.unlink(file)
+
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb
new file mode 100644
index 0000000000..b9e796ed30
--- /dev/null
+++ b/benchmark/bm_io_file_read.rb
@@ -0,0 +1,15 @@
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world! " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+ f.seek 0
+ f.read
+}
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb
new file mode 100644
index 0000000000..aa1be0e5fe
--- /dev/null
+++ b/benchmark/bm_io_file_write.rb
@@ -0,0 +1,14 @@
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world! " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+ f.seek 0
+ f.write str
+}
diff --git a/benchmark/bm_io_select.rb b/benchmark/bm_io_select.rb
new file mode 100644
index 0000000000..19248daeb1
--- /dev/null
+++ b/benchmark/bm_io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+ IO.select nil, w
+}
+
diff --git a/benchmark/bm_io_select2.rb b/benchmark/bm_io_select2.rb
new file mode 100644
index 0000000000..7b167af774
--- /dev/null
+++ b/benchmark/bm_io_select2.rb
@@ -0,0 +1,18 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+ ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+ IO.select nil, last
+end
+
diff --git a/benchmark/bm_io_select3.rb b/benchmark/bm_io_select3.rb
new file mode 100644
index 0000000000..fcdbb96e0e
--- /dev/null
+++ b/benchmark/bm_io_select3.rb
@@ -0,0 +1,17 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+ r, w = IO.pipe
+ r.close
+ ios.push w
+end
+
+nr.times do
+ IO.select nil, ios
+end
+
diff --git a/benchmark/bm_loop_for.rb b/benchmark/bm_loop_for.rb
new file mode 100644
index 0000000000..0fc4cc1511
--- /dev/null
+++ b/benchmark/bm_loop_for.rb
@@ -0,0 +1,3 @@
+for i in 1..30_000_000
+ #
+end
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
new file mode 100644
index 0000000000..d3375c744c
--- /dev/null
+++ b/benchmark/bm_loop_generator.rb
@@ -0,0 +1,14 @@
+max = 600000
+
+if defined? Fiber
+ gen = (1..max).each
+ loop do
+ gen.next
+ end
+else
+ require 'generator'
+ gen = Generator.new((0..max))
+ while gen.next?
+ gen.next
+ end
+end
diff --git a/benchmark/bm_loop_times.rb b/benchmark/bm_loop_times.rb
new file mode 100644
index 0000000000..521f72ad1a
--- /dev/null
+++ b/benchmark/bm_loop_times.rb
@@ -0,0 +1 @@
+30_000_000.times{|e|}
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
new file mode 100644
index 0000000000..43d35e1131
--- /dev/null
+++ b/benchmark/bm_loop_whileloop.rb
@@ -0,0 +1,4 @@
+i=0
+while i<30_000_000 # benchmark loop 1
+ i+=1
+end
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
new file mode 100644
index 0000000000..e514989661
--- /dev/null
+++ b/benchmark/bm_loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i=0
+while i< 6_000_000 # benchmark loop 2
+ i+=1
+end
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
new file mode 100644
index 0000000000..7db5be9050
--- /dev/null
+++ b/benchmark/bm_so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
new file mode 100644
index 0000000000..2b8fce8f99
--- /dev/null
+++ b/benchmark/bm_so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+ x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+ (n-1).step(0,-1) do |bi|
+ y[bi] += x.at(bi)
+ end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
new file mode 100644
index 0000000000..6a26465578
--- /dev/null
+++ b/benchmark/bm_so_binary_trees.rb
@@ -0,0 +1,57 @@
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+def STDOUT.write_ *args
+end
+
+def item_check(tree)
+ if tree[0] == nil
+ tree[1]
+ else
+ tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+ item_item = 2 * item
+ depth -= 1
+ [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+ [nil, item, nil]
+ end
+end
+
+max_depth = 12 # 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+ temp_tree = bottom_up_tree(i, depth)
+ check += item_check(temp_tree)
+
+ temp_tree = bottom_up_tree(-i, depth)
+ check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
new file mode 100644
index 0000000000..56b9410632
--- /dev/null
+++ b/benchmark/bm_so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i=0
+while i<10
+ i+=1
+ hello = ''
+ 4_000_000.times do |e|
+ hello << STUFF
+ end
+end
+# puts hello.length
+
+
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
new file mode 100644
index 0000000000..65f6337a4a
--- /dev/null
+++ b/benchmark/bm_so_count_words.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan
+
+input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+nl = nw = nc = 0
+while true
+ tmp = input.read(4096) or break
+ data = tmp << (input.gets || "")
+ nc += data.length
+ nl += data.count("\n")
+ ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+ nw += data.count(" ") + 1
+end
+# STDERR.puts "#{nl} #{nw} #{nc}"
+
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
new file mode 100644
index 0000000000..d8b461290c
--- /dev/null
+++ b/benchmark/bm_so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+class Hi_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+def some_function(num)
+ begin
+ hi_function(num)
+ rescue
+ print "We shouldn't get here, exception is: #{$!.type}\n"
+ end
+end
+
+def hi_function(num)
+ begin
+ lo_function(num)
+ rescue Hi_Exception
+ $HI = $HI + 1
+ end
+end
+
+def lo_function(num)
+ begin
+ blowup(num)
+ rescue Lo_Exception
+ $LO = $LO + 1
+ end
+end
+
+def blowup(num)
+ if num % 2 == 0
+ raise Lo_Exception.new(num)
+ else
+ raise Hi_Exception.new(num)
+ end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+ i+=1
+ some_function(i+1)
+end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
new file mode 100644
index 0000000000..bac5ecd44c
--- /dev/null
+++ b/benchmark/bm_so_fannkuch.rb
@@ -0,0 +1,45 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+ maxFlips, m, r, check = 0, n-1, n, 0
+ count = (1..n).to_a
+ perm = (1..n).to_a
+
+ while true
+ if check < 30
+ puts "#{perm}"
+ check += 1
+ end
+
+ while r != 1
+ count[r-1] = r
+ r -= 1
+ end
+
+ if perm[0] != 1 and perm[m] != n
+ perml = perm.clone #.dup
+ flips = 0
+ while (k = perml.first ) != 1
+ perml = perml.slice!(0, k).reverse + perml
+ flips += 1
+ end
+ maxFlips = flips if flips > maxFlips
+ end
+ while true
+ if r==n then return maxFlips end
+ perm.insert r,perm.shift
+ break if (count[r] -= 1) > 0
+ r += 1
+ end
+ end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
new file mode 100644
index 0000000000..3f759ba7ae
--- /dev/null
+++ b/benchmark/bm_so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random (max,im=139968,ia=3877,ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+]
+homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
new file mode 100644
index 0000000000..dadab3e79c
--- /dev/null
+++ b/benchmark/bm_so_k_nucleotide.rb
@@ -0,0 +1,48 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# contributed by jose fco. gonzalez
+# modified by Sokolov Yura
+
+seq = String.new
+
+def frecuency( seq,length )
+ n, table = seq.length - length + 1, Hash.new(0)
+ f, i = nil, nil
+ (0 ... length).each do |f|
+ (f ... n).step(length) do |i|
+ table[seq[i,length]] += 1
+ end
+ end
+ [n,table]
+
+end
+
+def sort_by_freq( seq,length )
+ n,table = frecuency( seq,length )
+ a, b, v = nil, nil, nil
+ table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+ puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+ end
+ puts
+end
+
+def find_seq( seq,s )
+ n,table = frecuency( seq,s.length )
+ puts "#{table[s].to_s}\t#{s.upcase}"
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+line = input.gets while line !~ /^>THREE/
+line = input.gets
+
+while (line !~ /^>/) & line do
+ seq << line.chomp
+ line = input.gets
+end
+
+[1,2].each {|i| sort_by_freq( seq,i ) }
+
+%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+
diff --git a/benchmark/bm_so_lists.rb b/benchmark/bm_so_lists.rb
new file mode 100644
index 0000000000..f8d26797aa
--- /dev/null
+++ b/benchmark/bm_so_lists.rb
@@ -0,0 +1,47 @@
+#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
+
+NUM = 300
+SIZE = 10000
+
+def test_lists()
+ # create a list of integers (Li1) from 1 to SIZE
+ li1 = (1..SIZE).to_a
+ # copy the list to li2 (not by individual items)
+ li2 = li1.dup
+ # remove each individual item from left side of li2 and
+ # append to right side of li3 (preserving order)
+ li3 = Array.new
+ while (not li2.empty?)
+ li3.push(li2.shift)
+ end
+ # li2 must now be empty
+ # remove each individual item from right side of li3 and
+ # append to right side of li2 (reversing list)
+ while (not li3.empty?)
+ li2.push(li3.pop)
+ end
+ # li3 must now be empty
+ # reverse li1 in place
+ li1.reverse!
+ # check that first item is now SIZE
+ if li1[0] != SIZE then
+ p "not SIZE"
+ 0
+ else
+ # compare li1 and li2 for equality
+ if li1 != li2 then
+ return(0)
+ else
+ # return the length of the list
+ li1.length
+ end
+ end
+end
+
+i = 0
+while i<NUM
+ i+=1
+ result = test_lists()
+end
+
+result
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb
new file mode 100644
index 0000000000..76331c64b8
--- /dev/null
+++ b/benchmark/bm_so_mandelbrot.rb
@@ -0,0 +1,57 @@
+# The Computer Language Benchmarks Game
+# http://shootout.alioth.debian.org/
+#
+# contributed by Karl von Laudermann
+# modified by Jeremy Echols
+
+size = 600 # ARGV[0].to_i
+
+puts "P4\n#{size} #{size}"
+
+ITER = 49 # Iterations - 1 for easy for..in looping
+LIMIT_SQUARED = 4.0 # Presquared limit
+
+byte_acc = 0
+bit_num = 0
+
+count_size = size - 1 # Precomputed size for easy for..in looping
+
+# For..in loops are faster than .upto, .downto, .times, etc.
+for y in 0..count_size
+ for x in 0..count_size
+ zr = 0.0
+ zi = 0.0
+ cr = (2.0*x/size)-1.5
+ ci = (2.0*y/size)-1.0
+ escape = false
+
+ # To make use of the for..in code, we use a dummy variable,
+ # like one would in C
+ for dummy in 0..ITER
+ tr = zr*zr - zi*zi + cr
+ ti = 2*zr*zi + ci
+ zr, zi = tr, ti
+
+ if (zr*zr+zi*zi) > LIMIT_SQUARED
+ escape = true
+ break
+ end
+ end
+
+ byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
+ bit_num += 1
+
+ # Code is very similar for these cases, but using separate blocks
+ # ensures we skip the shifting when it's unnecessary, which is most cases.
+ if (bit_num == 8)
+ print byte_acc.chr
+ byte_acc = 0
+ bit_num = 0
+ elsif (x == count_size)
+ byte_acc <<= (8 - bit_num)
+ print byte_acc.chr
+ byte_acc = 0
+ bit_num = 0
+ end
+ end
+end
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
new file mode 100644
index 0000000000..e2c5c8e559
--- /dev/null
+++ b/benchmark/bm_so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+ count = 1
+ mx = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ row[j] = count
+ count += 1
+ end
+ mx[bi] = row
+ end
+ mx
+end
+
+def mmult(rows, cols, m1, m2)
+ m3 = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ val = 0
+ (0 .. (cols - 1)).each do |k|
+ val += m1.at(bi).at(k) * m2.at(k).at(j)
+ end
+ row[j] = val
+ end
+ m3[bi] = row
+ end
+ m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+ mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
new file mode 100644
index 0000000000..99cf6a91cc
--- /dev/null
+++ b/benchmark/bm_so_meteor_contest.rb
@@ -0,0 +1,564 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+# contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM: the main body is at the bottom.
+# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# 2) see how I represent a board as a bitmask by reading the blank_board comments
+# 3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+ # an array (by location) containing a bit mask for how the piece maps at the given location.
+ # if the rotation is invalid at that location the mask will contain false
+ attr_reader :start_masks
+
+ # maps a direction to a relative location. these differ depending on whether it is an even or
+ # odd row being mapped from
+ @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+ @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+ def initialize( directions )
+ @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+ @even_mask = mask_for_offsets( @even_offsets)
+ @odd_mask = mask_for_offsets( @odd_offsets)
+
+ @start_masks = Array.new(60)
+
+ # create the rotational masks by placing the base mask at the location and seeing if
+ # 1) it overlaps the boundries and 2) it produces a prunable board. if either of these
+ # is true the piece cannot be placed
+ 0.upto(59) do | offset |
+ mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+ if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+ imask = compute_required( mask, offset)
+ @start_masks[offset] = [ mask, imask, imask | mask ]
+ else
+ @start_masks[offset] = false
+ end
+ end
+ end
+
+ def compute_required( mask, offset )
+ board = blank_board
+ 0.upto(offset) { | i | board |= 1 << i }
+ board |= mask
+ return 0 if (!prunable(board | mask, offset))
+ board = flood_fill(board,58)
+ count = 0
+ imask = 0
+ 0.upto(59) do | i |
+ if (board[i] == 0) then
+ imask |= (1 << i)
+ count += 1
+ end
+ end
+ (count > 0 && count < 5) ? imask : 0
+ end
+
+ def flood_fill( board, location)
+ return board if (board[location] == 1)
+ board |= 1 << location
+ row, col = location.divmod(6)
+ board = flood_fill( board, location - 1) if (col > 0)
+ board = flood_fill( board, location + 1) if (col < 4)
+ if (row % 2 == 0) then
+ board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+ else
+ board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+ end
+ board
+ end
+
+ # given a location, produces a list of relative locations covered by the piece at this rotation
+ def offsets( location)
+ if is_even( location) then
+ @even_offsets.collect { | value | value + location }
+ else
+ @odd_offsets.collect { | value | value + location }
+ end
+ end
+
+ # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+ # this is hard to explain. imagine we have this partial board:
+ # 0 0 0 0 0 x [positions 0-5]
+ # 0 0 1 1 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 1 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # The top-left of the piece is at position 8, the
+ # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+ # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+ # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
+ # 0 0 0 1 1 x [positions 0-5]
+ # 0 0 1 0 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 0 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+ # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+ # this function would return
+ def normalize_offsets( values)
+ min = values.min
+ even_min = is_even(min)
+ other_min = even_min ? min + 6 : min + 7
+ other_values = values.collect do | value |
+ if is_even(value) then
+ value + 6 - other_min
+ else
+ value + 7 - other_min
+ end
+ end
+ values.collect! { | value | value - min }
+
+ if even_min then
+ [values, other_values]
+ else
+ [other_values, values]
+ end
+ end
+
+ # produce a bitmask representation of an array of offset locations
+ def mask_for_offsets( offsets )
+ mask = 0
+ offsets.each { | value | mask = mask + ( 1 << value ) }
+ mask
+ end
+
+ # finds a "safe" position that a position as described by a list of directions can be placed
+ # without falling off any edge of the board. the values returned a location to place the first piece
+ # at so it will fit after making the described moves
+ def start_adjust( directions )
+ south = east = 0;
+ directions.each do | direction |
+ east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+ south += 1 if ( direction == :nw || direction == :ne )
+ end
+ south * 6 + east
+ end
+
+ # given a set of directions places the piece (as defined by a set of directions) on the board at
+ # a location that will not take it off the edge
+ def get_values ( directions )
+ start = start_adjust(directions)
+ values = [ start ]
+ directions.each do | direction |
+ if (start % 12 >= 6) then
+ start += @@rotation_odd_adder[direction]
+ else
+ start += @@rotation_even_adder[direction]
+ end
+ values += [ start ]
+ end
+
+ # some moves take you back to an existing location, we'll strip duplicates
+ values.uniq
+ end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+# rotations -- all the rotations of the piece
+# type -- a numeic "name" of the piece
+# masks -- an array by location of all legal rotational masks (a n inner array) for that location
+# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+ attr_reader :rotations, :type, :masks
+ attr_accessor :placed
+
+ # transform hashes that change one direction into another when you either flip or rotate a set of directions
+ @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+ @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+ def initialize( directions, type )
+ @type = type
+ @rotations = Array.new();
+ @map = {}
+
+ generate_rotations( directions )
+ directions.collect! { | value | @@flip_converter[value] }
+ generate_rotations( directions )
+
+ # creates the masks AND a map that returns [location, rotation] for any given mask
+ # this is used when a board is found and we want to draw it, otherwise the map is unused
+ @masks = Array.new();
+ 0.upto(59) do | i |
+ even = true
+ @masks[i] = @rotations.collect do | rotation |
+ mask = rotation.start_masks[i]
+ @map[mask[0]] = [ i, rotation ] if (mask)
+ mask || nil
+ end
+ @masks[i].compact!
+ end
+ end
+
+ # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+ def generate_rotations( directions )
+ 6.times do
+ rotations.push( Rotation.new(directions))
+ directions.collect! { | value | @@rotate_converter[value] }
+ end
+ end
+
+ # given a board string, adds this piece to the board at whatever location/rotation
+ # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+ def fill_string( board_string)
+ location, rotation = @map[@placed]
+ rotation.offsets(location).each do | offset |
+ row, col = offset.divmod(6)
+ board_string[ row*5 + col, 1 ] = @type.to_s
+ end
+ end
+end
+
+# a blank bit board having this form:
+#
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+ 0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+ 0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+ (location % 12) < 6
+end
+
+# support function that create three utility maps:
+# $converter -- for each row an array that maps a five bit row (via array mapping)
+# to the a a five bit representation of the bits below it
+# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+# a region array has three values the first is a mask of bits in the region,
+# the second is the count of those bits and the third is identical to the first
+# examples:
+# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+# 0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+ odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+ even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+ all_odds = Array.new(0b100000)
+ all_evens = Array.new(0b100000)
+ bit_counts = Array.new(0b100000)
+ new_regions = Array.new(0b100000)
+ 0.upto(0b11111) do | i |
+ bit_count = odd = even = 0
+ 0.upto(4) do | bit |
+ if (i[bit] == 1) then
+ bit_count += 1
+ odd |= odd_map[bit]
+ even |= even_map[bit]
+ end
+ end
+ all_odds[i] = odd
+ all_evens[i] = even
+ bit_counts[i] = bit_count
+ new_regions[i] = create_regions( i)
+ end
+
+ $converter = []
+ 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+ $bit_counts = bit_counts
+ $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five. The following board is an example of a prunable board:
+# 0 0 1 0 0
+# 0 1 0 0 0
+# 1 1 0 0 0
+# 0 1 0 0 0
+# 0 0 0 0 0
+# ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+# board -- an initial bit board (6 bit padded rows, see blank_board for format)
+# location -- starting location, everything above and to the left is already full
+# slotting -- set to true only when testing initial pieces, when filling normally
+# additional assumptions are possible
+#
+# Algorithm:
+# The algorithm starts at the top row (as determined by location) and iterates a row at a time
+# maintainng counts of active open areas (kept in the collector array) each collector contains
+# three values at the start of an iteration:
+# 0: mask of bits that would be adjacent to the collector in this row
+# 1: the number of bits collected so far
+# 2: a scratch space starting as zero, but used during the computation to represent
+# the empty bits in the new row that are adjacent (position 0)
+# The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+ collectors = []
+ # loop accross the rows
+ (location / 6).to_i.upto(9) do | row_on |
+ # obtain a set of regions representing the bits of the curent row.
+ regions = $regions[(board >> (row_on * 6)) & 0b11111]
+ converter = $converter[row_on]
+
+ # track the number of collectors at the start of the cycle so that
+ # we don't compute against newly created collectors, only existing collectors
+ initial_collector_count = collectors.length
+
+ # loop against the regions. For each region of the row
+ # we will see if it connects to one or more existing collectors.
+ # if it connects to 1 collector, the bits from the region are added to the
+ # bits of the collector and the mask is placed in collector[2]
+ # If the region overlaps more than one collector then all the collectors
+ # it overlaps with are merged into the first one (the others are set to nil in the array)
+ # if NO collectors are found then the region is copied as a new collector
+ regions.each do | region |
+ collector_found = nil
+ region_mask = region[2]
+ initial_collector_count.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ collector_mask = collector[0]
+ if (collector_mask & region_mask != 0) then
+ if (collector_found) then
+ collector_found[0] |= collector_mask
+ collector_found[1] += collector[1]
+ collector_found[2] |= collector[2]
+ collectors[collector_num] = nil
+ else
+ collector_found = collector
+ collector[1] += region[1]
+ collector[2] |= region_mask
+ end
+ end
+ end
+ end
+ if (collector_found == nil) then
+ collectors.push(Array.new(region))
+ end
+ end
+
+ # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+ # be zero. The size of any such reaason is tested if it is not a muliple of five true is returned since
+ # the board is prunable. if it is a multiple of five it is removed.
+ # Collector that are still active have a new adjacent value [0] set based n the matched bits
+ # and have [2] cleared out for the next cycle.
+ collectors.length.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ if (collector[2] == 0) then
+ return true if (collector[1] % 5 != 0)
+ collectors[collector_num] = nil
+ else
+ # if a collector matches all bits in the row then we can return unprunable early for the
+ # follwing reasons:
+ # 1) there can be no more unavailable bits bince we fill from the top left downward
+ # 2) all previous regions have been closed or joined so only this region can fail
+ # 3) this region must be good since there can never be only 1 region that is nuot
+ # a multiple of five
+ # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+ # in pieces to see what configurations work for them (the only other time this algorithm is used).
+ return false if (collector[2] == 0b11111 && !slotting)
+ collector[0] = converter[collector[2]]
+ collector[2] = 0
+ end
+ end
+ end
+
+ # get rid of all the empty converters for the next round
+ collectors.compact!
+ end
+ return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+ collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask. see prunable for what a "region" is
+def create_regions( value )
+ regions = []
+ cur_region = 0
+ 5.times do | bit |
+ if (value[bit] == 0) then
+ cur_region |= 1 << bit
+ else
+ if (cur_region != 0 ) then
+ regions.push( cur_region)
+ cur_region = 0;
+ end
+ end
+ end
+ regions.push(cur_region) if (cur_region != 0)
+ regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+ find_top( 1)
+ find_top( 0)
+ print_results
+end
+
+# show the board
+def print_results
+ print "#{@boards_found} solutions found\n\n"
+ print_full_board( @min_board)
+ print "\n"
+ print_full_board( @max_board)
+ print "\n"
+end
+
+# finds solutions. This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece. It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+# Since any found solution has an inverse we want to maximize finding solutions that are not already found
+# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
+# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
+# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
+# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+# maximum number
+def find_top( rotation_skip)
+ board = blank_board
+ (@pieces.length-1).times do
+ piece = @pieces.shift
+ piece.masks[0].each do | mask, imask, cmask |
+ if ((rotation_skip += 1) % 2 == 0) then
+ piece.placed = mask
+ find( 1, 1, board | mask)
+ end
+ end
+ @pieces.push(piece)
+ end
+ piece = @pieces.shift
+ @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found. depth is acheived via recursion. the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+# start_location -- where to start looking for place for the next piece at
+# placed -- number of pieces placed
+# board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+ # find the next location to place a piece by looking for an empty bit
+ while board[start_location] == 1
+ start_location += 1
+ end
+
+ @pieces.length.times do
+ piece = @pieces.shift
+ piece.masks[start_location].each do | mask, imask, cmask |
+ if ( board & cmask == imask) then
+ piece.placed = mask
+ if (placed == 9) then
+ add_board
+ else
+ find( start_location + 1, placed + 1, board | mask)
+ end
+ end
+ end
+ @pieces.push(piece)
+ end
+end
+
+# print the board
+def print_full_board( board_string)
+ 10.times do | row |
+ print " " if (row % 2 == 1)
+ 5.times do | col |
+ print "#{board_string[row*5 + col,1]} "
+ end
+ print "\n"
+ end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+ board_string = "99999999999999999999999999999999999999999999999999"
+ @all_pieces.each { | piece | piece.fill_string( board_string ) }
+ save( board_string)
+ save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+ if (@all_boards[board_string] == nil) then
+ @min_board = board_string if (board_string < @min_board)
+ @max_board = board_string if (board_string > @max_board)
+ @all_boards.store(board_string,true)
+ @boards_found += 1
+
+ # the exit motif is a time saver. Ideally the function should return, but those tests
+ # take noticable time (performance).
+ if (@boards_found == @stop_count) then
+ print_results
+ exit(0)
+ end
+ end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+ Piece.new( [ :nw, :ne, :east, :east ], 2),
+ Piece.new( [ :ne, :se, :east, :ne ], 7),
+ Piece.new( [ :ne, :east, :ne, :nw ], 1),
+ Piece.new( [ :east, :sw, :sw, :se ], 6),
+ Piece.new( [ :east, :ne, :se, :ne ], 5),
+ Piece.new( [ :east, :east, :east, :se ], 0),
+ Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+ Piece.new( [ :se, :se, :se, :west ], 9),
+ Piece.new( [ :se, :se, :east, :se ], 8),
+ Piece.new( [ :east, :east, :sw, :se ], 3)
+ ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
+
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
new file mode 100644
index 0000000000..d6c5bb9e61
--- /dev/null
+++ b/benchmark/bm_so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+ def initialize(x, y, z, vx, vy, vz, mass)
+ @x, @y, @z = x, y, z
+ @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+ @mass = mass * SOLAR_MASS
+ end
+
+ def move_from_i(bodies, nbodies, dt, i)
+ while i < nbodies
+ b2 = bodies[i]
+ dx = @x - b2.x
+ dy = @y - b2.y
+ dz = @z - b2.z
+
+ distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+ mag = dt / (distance * distance * distance)
+ b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+ @vx -= dx * b2_mass_mag
+ @vy -= dy * b2_mass_mag
+ @vz -= dz * b2_mass_mag
+ b2.vx += dx * b_mass_mag
+ b2.vy += dy * b_mass_mag
+ b2.vz += dz * b_mass_mag
+ i += 1
+ end
+
+ @x += dt * @vx
+ @y += dt * @vy
+ @z += dt * @vz
+ end
+end
+
+def energy(bodies)
+ e = 0.0
+ nbodies = bodies.size
+
+ for i in 0 ... nbodies
+ b = bodies[i]
+ e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+ for j in (i + 1) ... nbodies
+ b2 = bodies[j]
+ dx = b.x - b2.x
+ dy = b.y - b2.y
+ dz = b.z - b2.z
+ distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+ e -= (b.mass * b2.mass) / distance
+ end
+ end
+ e
+end
+
+def offset_momentum(bodies)
+ px, py, pz = 0.0, 0.0, 0.0
+
+ for b in bodies
+ m = b.mass
+ px += b.vx * m
+ py += b.vy * m
+ pz += b.vz * m
+ end
+
+ b = bodies[0]
+ b.vx = - px / SOLAR_MASS
+ b.vy = - py / SOLAR_MASS
+ b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+ # sun
+ Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+ # jupiter
+ Planet.new(
+ 4.84143144246472090e+00,
+ -1.16032004402742839e+00,
+ -1.03622044471123109e-01,
+ 1.66007664274403694e-03,
+ 7.69901118419740425e-03,
+ -6.90460016972063023e-05,
+ 9.54791938424326609e-04),
+
+ # saturn
+ Planet.new(
+ 8.34336671824457987e+00,
+ 4.12479856412430479e+00,
+ -4.03523417114321381e-01,
+ -2.76742510726862411e-03,
+ 4.99852801234917238e-03,
+ 2.30417297573763929e-05,
+ 2.85885980666130812e-04),
+
+ # uranus
+ Planet.new(
+ 1.28943695621391310e+01,
+ -1.51111514016986312e+01,
+ -2.23307578892655734e-01,
+ 2.96460137564761618e-03,
+ 2.37847173959480950e-03,
+ -2.96589568540237556e-05,
+ 4.36624404335156298e-05),
+
+ # neptune
+ Planet.new(
+ 1.53796971148509165e+01,
+ -2.59193146099879641e+01,
+ 1.79258772950371181e-01,
+ 2.68067772490389322e-03,
+ 1.62824170038242295e-03,
+ -9.51592254519715870e-05,
+ 5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+ i = 0
+ while i < nbodies
+ b = BODIES[i]
+ b.move_from_i(BODIES, nbodies, dt, i + 1)
+ i += 1
+ end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
new file mode 100644
index 0000000000..a0513f8c47
--- /dev/null
+++ b/benchmark/bm_so_nested_loop.rb